CA2082631A1 - Antisense inhibitors of the human immunodeficiency virus - Google Patents
Antisense inhibitors of the human immunodeficiency virusInfo
- Publication number
- CA2082631A1 CA2082631A1 CA002082631A CA2082631A CA2082631A1 CA 2082631 A1 CA2082631 A1 CA 2082631A1 CA 002082631 A CA002082631 A CA 002082631A CA 2082631 A CA2082631 A CA 2082631A CA 2082631 A1 CA2082631 A1 CA 2082631A1
- Authority
- CA
- Canada
- Prior art keywords
- oligonucleotide
- hiv
- analog
- tat
- subunits
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Abandoned
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1131—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against viruses
- C12N15/1132—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against viruses against retroviridae, e.g. HIV
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/31—Chemical structure of the backbone
- C12N2310/315—Phosphorothioates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2740/00—Reverse transcribing RNA viruses
- C12N2740/00011—Details
- C12N2740/10011—Retroviridae
- C12N2740/16011—Human Immunodeficiency Virus, HIV
- C12N2740/16311—Human Immunodeficiency Virus, HIV concerning HIV regulatory proteins
- C12N2740/16322—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
Abstract
Methods for modulating the expression of the HIV tat gene are disclosed comprising contacting tat RNA with oligonucleotide or oligonucleotide analog which can bind with at least a portion of the RNA. In accordance with the preferred embodiments, oligonucleotides or oligonucleotide analogs are designed to bind to portions of the tat RNA which are of significance to the expression of the gene coding for said RNA. In accordance with a preferred embodiment, methods of treatment of human immunodeficiency virus are disclosed.
Description
WO 91/1800~1 PCTlUS91/0273~i ANTI8E:N82 INIIIBITORS OF T}IE }IU~N IM~IIJNODEFIC~:ENCY VIRUS
FIELD OF T~IE INVENTION
This invention relates to the field of therapeutics, particularly the treatment of infections of the human immunodeficiency virus (HIV). It relates to thë design, synthesis and application of oligonucleotides and oligonucleotide analogs which inhibit the activity of the HIV
and other retroviruses.
B~CRGROUND OF T~E INVENTION
This invention relates to materials and methods for modulatinq the activity of HIV RNA. The invention generally relates to the field of "antisense" c:ompounds, compounds which are capable of specific hyhridization with a nucleotide sequence of an RNA. In accordance wi.th preferred embodiments, this invention is directed to methods for achieving therapeutic treatment of disease and regulating gene expression in experimental systems.
It is well known that most of the bodily states in mammals including infectious disease states, are effected by proteins. Such proteins, either acting directly or through their enzymatic functions, contribute in major proportion to ` many diseases in animals and man. Classical therapeutics has generally focused upon interactions with such proteins in efforts to moderate their disease causing or disease potentiating functions. Recently, however, attempts have been made to moderate the actual production of such proteins by interactions with molecules that direct their synthesis, intracellular RN.~. 3y interfering with the production of , .
`' W~1/18004 PCT~US91/0~73 2~ 82 63 ~ - 2 -proteins, it has been hoped to effect therapeutic results with maximum effect and minimal side effects. It is the general object of such therapeutic approaches to interfere with or otherwise modulate gene expression leading to undesired protein formation.
One method for inhibiting specific gene expression which has been adopted to some degree is the "antisense"
approach, where oligonucleotide analogs complimentary to a specific, target, messenger RNA, mRNA sequence are used. A
number of workers have reported such attempts. Pertinent reviews include C.A. Stein & J.S. Cohen, Cancer Research, vol.
48, pp. 2659-2668 (1988); J. Walder, Genes & Development, vol.
2, pp. 502-504 (1988); C.J.-Marcus-Sekura, Anal. Biochemistry, -vol. 172, 289-295 (1988); G. Zon, Journal of Protein Chemistry, vol. 6, pp-131-145 (1987); G. Zon, Pharmaceutical Research, vol. 5, pp. 539-549 (1988); A. R. Van der Krol, J.N.
Mol, & A.R. 5tuitje, Biorechniques, ~ol. 6, pp. 958-973 (1988) and D.S. Loose-Mitchell, TIPS, vol. 9, pp. 45-47 (1988). Each of the foregoing provide backgrc~und concernin~ general antisense theory and prior techniques.
Prior attempts to inhibit HIV by various antisense approaches have been,made by a number of researchers.
Zamecnic and coworkers have used phosphodiester oligonucleotides targeted to the reverse transcriptase primer site and to splice donor/acceptor si~es P.C. Zamecnik, J.
Goodchild, Y. Taguchi, P.S. Sarin, Proc. Natl . Acad. Sci .
USA 83, 4143 (1986). Goodchild and coworkers have made phosphodiester compounds targeted to the initiation sites for translation, the cap site, the polyadenylation signal, the 5' repeat region and a site between the g~g and ~1 genes.
J. Goodchild, S. Agrawal, M.P. Civeira, P.S. Sarin, D. Sun, .; P.C. Zamecnik, Proc. Natl . Acad. sci . u. s. A. 85, 5507 (1988). In the Goodchild study, the greatest activity was achieved by targeting the polyadenylation signal. Agrawal and coworkers have extended the studies of Goodchild by using chemically modified oligonucleotide analogs which were also targeted to the cap and splice donor/acceptor sites. S.
, .. :. : , . : .. , .. ~. , . ,.. ~ , - .
: .: : :., . : ., :,, WO91/18004 PCT/~'S~1/02734 _ 3 _ ~082631 Agarwal, J. Goodchild, M.P. Civeira, A.H. Thornton, P.S.
Sarin, P.C. Zamecnik, Proc. Nat'l. Acad. Sci. USA 85, iO79 (1988). A portion of one o~ these overlapped a portion of the HIV TAR region but was not found to have exemplary effect.
Neither was this oligonucleotide analog designed to interfere with the HIV TAR region. Agrawal and coworkers have used oligo-nucleotide analogs ~arge~ed to the splice donor/acceptor site inhibit HIV infection in early infected and chronically infected cells. S. Agrawal, T. Ikeuchi, D. Sun, P.S. Sarin, A. Konopka, J. Maizel, Proc. Natl. Acad. Sci. U. S. A. 86, 7790 t1989).
Sarin and coworkers have also used chemically modified oligonucleotide analogs targeted to the cap and~
splice donor/acceptor sites. P.S. Sarin, S. Agrawal, M.P.
Civeira, J. Goodchild, T. Ikeuchi, P.C. Zamecnik, Proc. Natl.
Acad. Sci. U. S. A. 85, 7448 (1988). Zia and coworkers have also used an oligonucleotide analog targeted to a splice acceptor site to inhibit HIV. ~.A. Zaia, J.J. Rossi, G.J.
Murakawa, P.A. Spallone, D.A. Stephens, B.E. Kaplan, J. Virol.
62, 3914 ~1988). Matsukura and coworkers have synthesized oligonucleotide analogs targeted to the initiation of translation of the ~y gene m~NA. M~ Matsukura, K. Shinozuka, G. Zon, et al, Proc. Natl. Acad. ';ci. USA 84, 7706 ~1987);
R.L. Letsinger, G.R. Zhang, D.K. Sun, T. Ikeuchi, P.S. Sarin, 25 Proc. Natl. Acad. sci. U. S. A. 86, 6553 (1989). Mori and coworXers have used a different oligonucleotide analog targeted to the same region as Matsukura. K. Mori, C.
Boiziau, C. Cazenave, et al, Nucleic Acids Res. 17, 8207 (1989). Shibahara and coworkers have used oligonucleotide analogs targeted to a splice acceptor site as well as the reverse transcriptase primer binding site. S. Shibahara, S.
Mukai, H. Morisawa, H. Nakashima, S. Kobayashi, N. Yamamoto, Nucl. Acids Res. 17, 239 (1989). Letsinger and coworkers have synthesized and tested a oligonucleotide analogs with conjugated cholesterol targeted to a splice site. K. Mori, C. Boiziau, C. Cazenave, et al, Nucieic Acids ~es. 17, 8207 (1989). Stevenson and Iversen have conjugated polylysine to ` : ' . ; , ` ' ':
~. . .
WO91/1~J004 PCTtUS~110~734 20~ 263 1 4 _ oligonucleotide analogs targeted to the splice donor and the 5'-end of the first exon of the tat gene. M. Stevenson, P.L.
Iversen, J. Gen. Virol. 70, 2673 (1989). Buck and coworkers have recently described the use of phosphate-methylat~d DNA
oligonucleotides targeted to HIV mRNA and DNA. H.M. Buck, L.H. Koole, M.H.P. van Gendersen, L. Smith, J.L.M.C. Green, S. Jurriaans and J. Goudsmit. Science 248, 208-212 tl990).
These prior attempts at targeting HIV have largely focused on the nature of the chemical modification used in the oligonucleotide analog. Although each of the above publications have reported some degree of success in inhibiting some function of the virus, a general therapeutic scheme to target HIV and other retroviruses-has not been found. Accordingly, there has been and continues to be a long-felt need for the design of oligonucleotides and oligonucleotide analogs which are capable of effective, therapeutic antisense use.
This long-felt need has not been satisfied by prior work in the field of antisense oligorlucleotide therapy for HIV
and other retroviruses and viruses. Others have failed to identify target sites in which anti1sense oligonucleotides or oligonucleotide analogs are ther~peutically ef~ective at reasonable rates of application.
OBJ~TS OF THE INV2NTION
It is a principal object of the invention to provide therapies for human diseases, particularly the human immunodeficiency virus and other human retroviruses.
It is a further object of the invention to provide molecules, especially oligonucleotides and oligonucleotide analogs which perturb the structure of mRNA.
Yet another object of this invention is to modulate gene expression in cells.
A further object is to interfere with the secondary structure of RNAs through interaction of those structures with oligonucleotides or oligonucleotide analogs.
These and other objects of this invention will "''. ' '' '~ ~, ' ~' ,, ', , ,, ,' , WO~l/t8004 PCT/~'S91/0~734 ~ 5 - ~08~63t become apparent from a review of the instant specifications.
B~RY OF T~IE INVEN'rION
Prior attempts at antisense targeting to HIV have been focused on inhibition of the synthesis of some particular viral protein thought to be essential to the success of the infection. In the present invention, the same goal (inhibition of viral gene expression) is achieved, but greater, therapeutically significant activity is obtained by targeting particular sites on the HIV or other retrovirus RNA.
In the present invention, target RNAs which have important biological function have been found to be the key target sites. It has been determined that targeting these RNA
regions is a key to effective antisense therapy with oligonucleotides and oligonucleotide analogs.
It has now been discovered that compounds which speci~ically hind the tat RNA structure and inter~ere with tat trans-activation have activity as therapeutic agents for HIV
inEection. It is intended that all strains o~ HIV fall within the spirit and scope of this invention. While different strains of HIV may have different tat RNA sequences, this invention can be practiced on alternative strains of ~IV by changing the sequence of the oligonucleotide or oligonucleotide analog to complement the structure of the alternative strain in accordance with the present teachings.
In accordance with the present invention, methods of modulating the expression of genes are provided. The targeted RNA, or cells containing it, is contacted with oligonucleotide or oligonucleotide analog which can bind with at least a portion of the RNA. The gene is generally one which is believed to give rise to a disease state in an organism and is typically a virus or, preferably, a retrovirus such as HIV, although other infectious organisms can be so attacked leading to therapeutic methods for treating diseased states by administering oligonucleotides or oligonucleotide analogs to animals suspected of having viral or retroviral infections.
.,.
:' w~ on4 PCT/US91/0~73 2 08 2 ~3 ~ - 6 -It has now been found that oligonucleotide or oligonucleotide analogs can be designed, especially for retroviruses such as HIV, which are effective in diminishing the infection. For HIV, a number of sequences have been found which are effective and persons of ordinary skill in the art will likely identify others. These sequences are the first, practically effective antisense sequences which have been shown to be effective in inhibiting the tat region of HIV and to lead to HIV therapeutics. Accordingly, this invention provides oligonucleotides and oligonucleotide analogs capable of binding with at least a portion of tat mRNA of HIV. Such oligonucleotides and analogs have been found corresponding to the nucleotide sequences G G C T C C A T T T C T T G` C-T-C T C ,-CCATTTCTTGCTCTCCTCTGT, GCTATGTCGACACCCAATTC, 15 CCGCCCCTCGCCTCTTGCCG, CGGGTCCCCTCGGGATTGGG, and CACCTTCTTCTTC'rATTCCT. It is preferred that theoligonucleotides and analogs have at least about 6 contiguous subunits of such sequences, with at least about lO being preferred and at least about 15 being still more preferred.
It is preferred for some embodiments that the oligonucleotide or oligonucleotide analog substantia:Lly correspond to a given sequence. By this is meant that the c)ligonucleotide or analog have every subunit of the sequence or an effective substitute.
Thus, s~lbstitutions such as U for T and the like may be made in wild type oligonucleotides. Additionally, of course, other chemical modifications to form oligonucleotide analogs may be made without departing from the spirit of this invention.
The sequence portions may fall anywhere within the given sequences to likely have effect. Oligonucleotides and analogs, such as the preferred phosphorothioate analogs may be presented in a pharmaceutically acceptable carrier.
Methods of inhibiting gene expression, especially tat gene expression have also been discovered. Such inhibition may be employed for therapeutics, for diagnosis or for research. Thus, methods of treating an animal suspected of having a disease characterized by tat gene expression, especially AIDS, have been discovered comprising contacting .: . . ~ :
WO~I/lg~)n4 PCT/US91/02734 - 7 ~ `2~263~
the animal with oligonucleotides or oligonucleotide analogs in accordance with this invention.
It is preferred that the oligonucleotide or oligonucleotide analog be capable of binding with at least about six subunits of the RNA portion. It is more preferred that from eight to fifty units be capable of being bound, with from about 10 to about 20 subunits being even more preferred. I
In accordance with preferred embodiments, the oligonucleotide of oligonucleotide analog is capable of forming a duplex structure with the portion of RNA. While the mechanism of the interaction is not Xnown with certainty, it is possible that it may effect modulation of gene -- --- expression through a number of ways.
In accordance with preferred embodiments, the RNA
portion which is interfered with comprises at least a part of the tat mRNA of HIV. The oligonucleotides and oligonucleotide analogs in accordance with this invention ar~, themselves believed to be novel. Thus, ol~gonucleotides which are capable of interacting with po~tions of tat RNA are comprehended. Thus, animals suspected of having the disease are contacted with oligonucleotide or oligonucleotide analog which can bind with the tat ~NA. In particular, the present invention is believed to be effective in the treatment of HIV
infections in mammals, especially man.
2 5 B~IEF DESC}~IPTION OF T~ DRA~ING8 Figure 1 depicts a linear HIV-l tat mRNA sequence.
Figure 2 depicts the activity of a series of oligonucleotides and oligonucleotide analogs in accordance with this invention in a cell culture assay for TAR/tat transactivation.
, I)ETAILED DESCRIPTION OF PREFE~RED EMBODINl~:NTS
It has been discovered to be possible to regulate the activity of HIV tat RNA in cells by introducing oligonucleotides or oligonucleotide analogs which bind to the tat mRNA. The oligonucleotides or oligonucleotide analogs , .
WO~1/l80n4 PCT/US91/0273~
2~82631 interfere with the normal function of the mRNA and these methods can be used to treat diseases, particularly HIV.
In the context of this invention, the term oligonuc-leotide refers to a plurality of joined nucleotide units formed from naturally-occurring bases and cyclofuranosyl groups joined by native phosphodiester bonds. This term effectively refers to naturally-occurring species or synthetic species formed from naturally-occurring subunits.
"Oligonucleotide analog," as that term is used in connection with this invention, refers to moieties which function similarly to oligonucleotides but which have non naturally-occurring portions. Thus, oligonucleotide analogs may have -altered sugar moieties or inter-sugar linkages.
Exemplary among these are the phosphorothioate and othar sulfur containing species which are known for use in the art.
They may also comprise altered base units or other modifications consistent with the spirit of this invention.
In accordance with certain preferred embodiments, at least some of the phosphodiester bonds of the oligonucleotide have been substituted with a structure which ~unctions to enhance the ability of the compositions to penetrate into the region of cells where the RNA whose actlvity is to be modu~ated is located. It is preferred that such linkages be sulfur-containing. It is presently preferred that such substitutions comprise phosphorothioate bonds.
Others such as alkyl phosphothioat~ bonds, N-alkyl phosphoramidates,phosphorodithioates, alkylphosphonates,and short chain alkyl or cycloalkyl structures may also be useful.
In accordance with other preferred embodiments, the phosphodiester bonds are substituted with structures which are, at once, substantially non-ionic and non-chiral. Persons of ordinary skill in the art will be able to select other linkages for use in the practice of the invention.
It is generally preferred for use in some embodiments of this invention that the 2' position of the linking sugar moieties in at least some of the subunits of the oligonucleotides or oligonucleotide analogs be substituted.
~,. . - :
... . .. ..
:. . - . . ::. . :
- . : . .
:::: . . . . ...
... .. . .. .
WO 91/lX004 PCr/l,'S91/02734 Thus, 2' substituients such as OH, SH, F, OCH3, OCN, OC~CH3 where n is from 1 to about 20 and other substituients having similar properties may be useful in some embodiments.
Oligonucleotide analogs may also include species which include at least some modified base forms. Thus, purines and pyrimidines other than those normally found in nature may be so employed. Similarly, modifications on the cyclofuranose portions of the nucleotide subunits may also occur as long as the essential tenets of this invention are adhered to.
Such analogs are best described as being functionally interchangeable with natural oligonucleotides (or synthesized oligonucleotides along natural lines), but which have one or more differences from natural structure. All such analogs are comprehended by this invention so long as they function effectively to bind to selected portions of tat RNA.
Th~ oligonucleotides and oligonucleotide analogs in accordance with this invention pref~!rably comprise from about 3 to about 100 subunits. It is preferred that such oligonucleotides and analogs comprise at least about 6 subunits with from about 8 to abo~t 50 subunits being more pre~erred, and still more preferred to have from about 10 to about 20 subunits. As will be appreciated, a subunit is a base and sugar combination suitably bound to adjacent subunits through phosphodiester or other bonds.
The oligonucleotides and oligonucleotide analogs of this invention can be used in diagnostics, therapeutics and as research reagents and kits. For therapeutic use, the oligonucleotide or oligonucleotide analog is administered to an animal, especially a human, such as are suffering from a virus or retrovirus infection such as AIDS.
It is generally preferred to apply the therapeutic agents in accordance with this invention internally such as orally, intravenously or intramuscularly. Other forms of administration, such as transdermally, topically or intralesionally may also be useful. Inclusion in suppositories may also be useful. Use of the oligonucleotides .
, ' . i ' WO9~/18004 PCT/~91/0~73~
2082~3~ - lO-and oligonucleotide analogs of this invention in prophylaxis is also likely to be useful. Use of pharmacologically acceptable carriers is also preferred for some embodiments.
In accordance with the present invention, it will be understood that the term "to bind" as it refers to the interaction between an oligonucleotide or oligonucleotide analog and an RNA portion or subportion may have any of several, related meanings. Thus, the present invention comprehends binding of an oligonucleotide or analog with at least one portion of tat RNA. It will be understood that the oligonucleotide or analog will bind with at least one portion of the RNA portion in a Watson-Crick fashion so as to form, locally, a heteroduplex between the RNA portion and the oligonucleotide or analog. This heteroduplex formation is believed to result in alteration of the structure or function of the RNA portion. The exact mechanism and the result of this effect is not known with certainty, yet it is believed that the normal ~tructure or function of the RNA portion is gradually replaced by the binding of the oligonucleotide with one or more portions of the RNA. 'since the electronic and steric factors which attend the new h~eteroduplex are different from those of the natural-occurring RNA portion, the Qffectiveness and nature of the func:tion to generate protein from the RNA is interfered with. The resulting formation of defective or missing protein manifests itself overall as a modulation in the expression of the gene coding for the RNA.
In short, any interaction or binding of oligonucleotide or oligonucleotide analog with tat RNA is believed to have the potential for interference with RNA
function and, hence, for modulation the expression of the gene from which the RNA derives. Tat RNA targets have been found which exhibit overall diminution of activity of HIV when oligonucleotides or oligonucleotide analogs corresponding to portions of the target are administered to infected cells.
While a wide variety of oligonucleotides and oligonucl20tide analogs are believed to be useful in practice of the present invention, it has been found to be preferred .
.: :: ~ ~.. . :
'' ~ . ` `: '`:,.. ,`'` - ' WO~I/lXOO~ PCT/US91/0273~
2~631 to design such oligonucleotides and analogs so as to bind with at least about six subunits of a portion of RNA. In accordance with other preferred embodiments, oligonucleotides which combine with from about six to about 30 and even more preferably with about 10 to about 20 subunits are preferred.
As discussed above, it is presently believed that the tat RNA
of HIV comprises an excellent target for employment of the present invention. Accordingly, preparation of oligonucleotide or oligonucleotide analog for binding with one or more portions of the tat RNA region of HIV are preferred.
Therapeutics are particular objects of the present invention. Thus, presenting oligonucleotides and oligonucleotide analogs in accordance with the -present invention in pharmaceutically acceptable carriers may be highly useful. This is especially true for treatment of the disease AIDS.
Overall, it is preferred to administer to patients suspected of suffering from the foregoing disease`states with amounts of oligonucleotide or analog, in either native form or suspended in a carrier medium in amounts and upon treatment schedules which are effective to reduce the symptomology of that disease. It is within the scale of a person's skill in the art to determine optimum dosages and treatment schedules for such treatment regimens.
An elaborate set of conl:rol elements in the HIV
genome determine whether the virus replicates or remains dormant. Of the nine genes identified in the HIV genome, only three are from the core and envelope. W.A. Haseltine, F.
Wong-Staal, Scientific American October, 52 (1988). The other six ~enes are involved in regulation of the production of viral proteins. Regulatory genes work by encoding a protein that interacts with a responsive element somewhere else on the viral genome. The major regulatory gene responsible for initiating the burst of replication is the tat ttrans-activator) gene. Figure 1 is a sequence for the cDNA of the tat region in HIV. The product of the tat gene, tat protein, works by interaction with a short sequence element known as : .
W~91/18nO4 PCTlUS91/02734 2~ 6~1 - 12 -TAR (trans-acting responsive element). The TAR sequence is encoded in the viral long terminal repeats (LTR's), and therefore is included in the mRNA from every HIV gene.
Expression of the tat protein results in increased expression of other HIV genes up to 1,000 fold, including the tat gene itself. Because of this autoregulatory positive feedback, and the fact that the TAR sequence in included in the mRNA from every HIV transcript, a immense amount of viral gene expression is triggered when the tat gene is activated.
The interaction between the tat gene and the TAR element is therefore crucial to the life cycle of the HIV, and specific disruption of this interaction is likely to interrupt the propagation of the virus.
The mechanism of trans-activation of TAR-containing genes by the tat protein has recently been studied intensely.
Philip,A. Sharp, Robert,A. Marciniak, Cell 59, 229 ~1989).
Although much remains to be learned, two important points have become clear: that tat increases the expression of TAR-containing genes by increasing both the amount of viral mRNA
and the efficiency of its translation, and that TAR functions as an RNA structure, rather than a DNA structure.
The unusual conclusion that tat increases the transcription of TAR-contàining genes, but does so by interacting with the TAR element in RNA was derived from a num~er of observations. Philip,A. Sharp, Robert,A. MarciniaX, Cell 59, 229 (1989). In order to achieve trans-activation, the TAR element must be located immediately downstream from the site of initiation of transcription. Moreover, TAR is orientation dependent; if inserted in the inverse orientation, it fails to function.
Some of the strongest evidence that tat interacts with TAR as an RNA structure has come from mutagenesis experiments. Efforts to study the TAR element were stimulated by the observation that the tat protein from HIV-1 was capable of trans-activating vectors containing the TAR region of HIV-2, a different strain of virus, even though there is very little pri~ary sequence homology in the TAR region between the , WO~ OO~t PCT/~'S91/02734 - 13 - ; 2~26~ ~
two strains. S. Feng, E.C. Holland, Nature 334, 165 ~1988).
However, examination of the TAR seq~lence from HIV-l and HIV-2 with computer programs that predict RNA secondary revealed the potential of RNA stem-loop structures, with a single stem-loop in the TAR region of HIV-l and three stem-loop structures in HIV-2. Although the compositions and lengths of the stems were divergent, all four loops contained the pentanucleotide CUGGG as shown in Figures lA and lB. Mutagenesis experiments revealed that each of the nucleotides present in the loop are absolutely essential for trans-activation by tat, but that base substitutions in the stem were tolerated to some extent so long as the stem structure was maintained. S. Feng, E.C.
Holland, Nature 334, 165 (1988).
Further evidence for the TAR structure functioning as RNA was obtained from experiments in which the sequences flanking the stem-loop structure were altered creating competing secondary structures in the RNA that were more stable than the natural TAR stem-loop. B. Berkhout, Cell 59, 273 (1989). This was accomplished by introducing additional sequences into the TAR-containing RNA that were antisense to the 5 ' side of the stem-loop structure. Trans-activation of the modified TAR structure was lost, suggesting that the TAR
s~quences alone are not sufficient ~or trans-activation, but that these sequences must fold up in the proper secondary 25 structure to be active. It also suggests that antisense sequences to the TAR stem-loop are capable of disrupting the natural RNA structure.
Direct biochemical evidence for TAR stem-loop structure has also been obtained. The TAR RNA has been enzymatically synthesized in vitro and probed with enzymes selectively cleave single stranded regions of RNA, but not duplex structures. The results of the enzyme cleavage patterns were consis~ent with the computer predicted RNA secondary structure. B. Ber~hout, Cell 59, 273 (1989).
In summar~, there is strong and direct evidence from a number of studies that the HIV tat protein is responsible for triggering an enormous amount of viral gene expression, - ~ :; :' ~ ' . :
: :. , . , ,. :- :.
WO')I/I~ PCT/US9t/0~734 20 82 63 ~ - 14 -that this occurs by interactisn with the TAR sequence which is incorporated into every HIV mRNA transcript, that the HIV
TAR sequence functions as an RNA structure and that the correct TAR RNA structure is essential for tat transactivation.
T~R and tat function has been studied by removing the gen~s from the HIV genome and studying them in cell lines in isolation. Vectors have been constructed to study the interactions between the tat protein and TAR element. The tat gene is expressed under the SV40 promoter. The TAR region is expressed from a separate plasmid fused to an easily assayed reporter gene, the placental alkaline phosphatase gene tPAP). --P. Henthorn, P. Zervos, M. Raducha, H.-Harris, T.
Kadesch, Pro~. Natl. Acad. Sci. USA 85, 6342 (1988).
Enzymatic activity in cell culture models has been shown to be dependent upon both the presence of the essential elements of the TAR region and the presence of the tat protein. P.
Sharp, R. Marciniak, Cell 5'~, 229 (1989); S. Feng, E.C.
Holl~nd, Nature 334, 165 (1988); Michael,F. Laspia, Andrew,P.
Rice, Michael,B. Mathews, Cell 59, 283 (1989); J.A. Garcia, D. Harrich, E. Soultanakis, F. Wu, R. Mitsuyasu, R. a. Gaynor, E~BO J. 8, 76S (1989); and B. Berkhout, Cell 59, 273 (1989).
In essence, the vector system reconst:itutes the events of tat-mediated TAR transactivation in which occurs in HIV infected cells.
TAT/TAR trans activation can be conveniently assayed by placing the human placental alkaline phosphatase gene (PAP) under the regulatory control of the HIV-l LTR sequences, which contain enhancer, promoter, and tar elements. A plasmid containing the HIV-l LTR, pHIVCAT-0 (S. Feng, E.C. Holland, Nature 334, 165 (1988)), contains HIV U3 in its entirety and R up through position +78 (a HindIII site). Digestion of this plasmid with a combination of HindIII and AatII releases the CAT cassette along with the SV40 sequences responsible for the processing of the RNA. A second plasmid, pSV2Apap, contains the PAP cassette with eukaryotic processing signals, under the transcriptional control of an SV40 promoter. P. Henthorn, P
- " . : ~,,, ,,, . ~ . -~()'~lt1#nO~ PCT/~'S91/0'734 2~82~31 Zervos, M. Raducha, H. Harris, T. Kadesch, Proc. Natl. Acad.
Sci. USA 85, 6342 (1988). The PAP cassette and processing sequences were released from the plasmid by digestion with HindIII and AatII. A new plasmid, pHIVPAP, was created by ligating the HindIII/AatII fragment containing the HIV-l LTR
and vector sequences from pHIVCAT-0, to the HindIII/AatII PAP
cassette from pSV2Apap.
To test the activity of oligonucleotide analogs, pcDEBtat and pHIVPAP were co-transfected into HeLa cells by calcium/phosphate precipitation. The effects of the selected oligonucleotide analogs was determined as follows. HeLa cells were split 1:8 into 6-well dishes the day prior to the transfections. For each dish, lug of--pHIVPAP- and 12ug of pcDEBtat were precipitated in 500 ~l of HBs and 32 ~l of 2.5 M CaCl2. The CaP04 precipitate was divided evenly between the 6 wells. Oligonucleotides or oligonucleotide analogs were precepitated in the same manner and added to the cells at the concentrations indicated in the figures. The precipitate was allowed to sit on the cells for 20 minutes then complete media was added and the cells were incubated for an additional 4 hours. The cells were then shocked~with 10% glycerol in HBS.
After 48 hours, cells were harvested and p~otein and PAP assays performed as described by Henthorn et al. P.
Henthorn, P. Zervos, M. Raducha, H. Harris, T. Kadesch, Proc.
Natl. Acad. Sci. USA 85, 6342 (1988) with the following modifications. The cells were harvested in 0.5 ml of TBS, of which 0.1 mls were used for use in the protein assay. The remaining 0.4 mls of cell suspension was pelleted then resuspended in 50 ~l TBS. Endogenous phosphatases were inactivated by heatin~ the cells at 65C for 30 min. The heat stable human placental alkaline phosphatase activity was assayed by the addition of PNPP (0.5 ml, 5 mM PNPP) to the cell suspension, which was then incubated at 37C. Activity was determined at 30 minute intervals using 150 ~l aliquots of the reaction mixture and measuring absorbance at 405 nm with a Titertek Multiscan MCC\340 ELISA plate reader. The PAP activity was normalized to the total protein in each well : , 1 ~.
WO9l/l800~ P~T/US9t/0273 as determined by Bio-Rad protein assay, in which 1\5 of the harvested cells in TBS(0.1 ~1) were added to 30 ~1 of Bio-Rad Protein Reagent, then incubated for 10 minutes at room temperature, followed by measurement of absorbance at 595 nm using the Titertek plate reader.
Cells were treated with the following oligonucleotide analogs having phosphorothioate backbones:
# 5' 3' Control TGGCATCGAT GCTCA
The data are displayed graphically in Figure 2.
5ignificant diminution in PAP activity, which is a direct measure of gene expression from the ~IIV LTR, was exhibited by the phosphorothioate oligonucleotidle analogs bearing code numbers 461, 46~, 463, 464 and 465. Oligonucleo~ide 466 and the control oligonucleotide, which was not desinged to be complementary to the tat mRNA did not exhibit significant activities in this assay. The apparent increase in PAP
activity at the 1 uM dose for the control oligonucleotide and compound number 466 probably resulted from a carrier effect in Which the oligonucleotides facilitated uptake of the plasmids at the time of transfection. This effect may have been present in experiments with the active oligonucleotides, but was masked by the specific inhibitory activities of these compounds.
. , : ,~,
FIELD OF T~IE INVENTION
This invention relates to the field of therapeutics, particularly the treatment of infections of the human immunodeficiency virus (HIV). It relates to thë design, synthesis and application of oligonucleotides and oligonucleotide analogs which inhibit the activity of the HIV
and other retroviruses.
B~CRGROUND OF T~E INVENTION
This invention relates to materials and methods for modulatinq the activity of HIV RNA. The invention generally relates to the field of "antisense" c:ompounds, compounds which are capable of specific hyhridization with a nucleotide sequence of an RNA. In accordance wi.th preferred embodiments, this invention is directed to methods for achieving therapeutic treatment of disease and regulating gene expression in experimental systems.
It is well known that most of the bodily states in mammals including infectious disease states, are effected by proteins. Such proteins, either acting directly or through their enzymatic functions, contribute in major proportion to ` many diseases in animals and man. Classical therapeutics has generally focused upon interactions with such proteins in efforts to moderate their disease causing or disease potentiating functions. Recently, however, attempts have been made to moderate the actual production of such proteins by interactions with molecules that direct their synthesis, intracellular RN.~. 3y interfering with the production of , .
`' W~1/18004 PCT~US91/0~73 2~ 82 63 ~ - 2 -proteins, it has been hoped to effect therapeutic results with maximum effect and minimal side effects. It is the general object of such therapeutic approaches to interfere with or otherwise modulate gene expression leading to undesired protein formation.
One method for inhibiting specific gene expression which has been adopted to some degree is the "antisense"
approach, where oligonucleotide analogs complimentary to a specific, target, messenger RNA, mRNA sequence are used. A
number of workers have reported such attempts. Pertinent reviews include C.A. Stein & J.S. Cohen, Cancer Research, vol.
48, pp. 2659-2668 (1988); J. Walder, Genes & Development, vol.
2, pp. 502-504 (1988); C.J.-Marcus-Sekura, Anal. Biochemistry, -vol. 172, 289-295 (1988); G. Zon, Journal of Protein Chemistry, vol. 6, pp-131-145 (1987); G. Zon, Pharmaceutical Research, vol. 5, pp. 539-549 (1988); A. R. Van der Krol, J.N.
Mol, & A.R. 5tuitje, Biorechniques, ~ol. 6, pp. 958-973 (1988) and D.S. Loose-Mitchell, TIPS, vol. 9, pp. 45-47 (1988). Each of the foregoing provide backgrc~und concernin~ general antisense theory and prior techniques.
Prior attempts to inhibit HIV by various antisense approaches have been,made by a number of researchers.
Zamecnic and coworkers have used phosphodiester oligonucleotides targeted to the reverse transcriptase primer site and to splice donor/acceptor si~es P.C. Zamecnik, J.
Goodchild, Y. Taguchi, P.S. Sarin, Proc. Natl . Acad. Sci .
USA 83, 4143 (1986). Goodchild and coworkers have made phosphodiester compounds targeted to the initiation sites for translation, the cap site, the polyadenylation signal, the 5' repeat region and a site between the g~g and ~1 genes.
J. Goodchild, S. Agrawal, M.P. Civeira, P.S. Sarin, D. Sun, .; P.C. Zamecnik, Proc. Natl . Acad. sci . u. s. A. 85, 5507 (1988). In the Goodchild study, the greatest activity was achieved by targeting the polyadenylation signal. Agrawal and coworkers have extended the studies of Goodchild by using chemically modified oligonucleotide analogs which were also targeted to the cap and splice donor/acceptor sites. S.
, .. :. : , . : .. , .. ~. , . ,.. ~ , - .
: .: : :., . : ., :,, WO91/18004 PCT/~'S~1/02734 _ 3 _ ~082631 Agarwal, J. Goodchild, M.P. Civeira, A.H. Thornton, P.S.
Sarin, P.C. Zamecnik, Proc. Nat'l. Acad. Sci. USA 85, iO79 (1988). A portion of one o~ these overlapped a portion of the HIV TAR region but was not found to have exemplary effect.
Neither was this oligonucleotide analog designed to interfere with the HIV TAR region. Agrawal and coworkers have used oligo-nucleotide analogs ~arge~ed to the splice donor/acceptor site inhibit HIV infection in early infected and chronically infected cells. S. Agrawal, T. Ikeuchi, D. Sun, P.S. Sarin, A. Konopka, J. Maizel, Proc. Natl. Acad. Sci. U. S. A. 86, 7790 t1989).
Sarin and coworkers have also used chemically modified oligonucleotide analogs targeted to the cap and~
splice donor/acceptor sites. P.S. Sarin, S. Agrawal, M.P.
Civeira, J. Goodchild, T. Ikeuchi, P.C. Zamecnik, Proc. Natl.
Acad. Sci. U. S. A. 85, 7448 (1988). Zia and coworkers have also used an oligonucleotide analog targeted to a splice acceptor site to inhibit HIV. ~.A. Zaia, J.J. Rossi, G.J.
Murakawa, P.A. Spallone, D.A. Stephens, B.E. Kaplan, J. Virol.
62, 3914 ~1988). Matsukura and coworkers have synthesized oligonucleotide analogs targeted to the initiation of translation of the ~y gene m~NA. M~ Matsukura, K. Shinozuka, G. Zon, et al, Proc. Natl. Acad. ';ci. USA 84, 7706 ~1987);
R.L. Letsinger, G.R. Zhang, D.K. Sun, T. Ikeuchi, P.S. Sarin, 25 Proc. Natl. Acad. sci. U. S. A. 86, 6553 (1989). Mori and coworXers have used a different oligonucleotide analog targeted to the same region as Matsukura. K. Mori, C.
Boiziau, C. Cazenave, et al, Nucleic Acids Res. 17, 8207 (1989). Shibahara and coworkers have used oligonucleotide analogs targeted to a splice acceptor site as well as the reverse transcriptase primer binding site. S. Shibahara, S.
Mukai, H. Morisawa, H. Nakashima, S. Kobayashi, N. Yamamoto, Nucl. Acids Res. 17, 239 (1989). Letsinger and coworkers have synthesized and tested a oligonucleotide analogs with conjugated cholesterol targeted to a splice site. K. Mori, C. Boiziau, C. Cazenave, et al, Nucieic Acids ~es. 17, 8207 (1989). Stevenson and Iversen have conjugated polylysine to ` : ' . ; , ` ' ':
~. . .
WO91/1~J004 PCTtUS~110~734 20~ 263 1 4 _ oligonucleotide analogs targeted to the splice donor and the 5'-end of the first exon of the tat gene. M. Stevenson, P.L.
Iversen, J. Gen. Virol. 70, 2673 (1989). Buck and coworkers have recently described the use of phosphate-methylat~d DNA
oligonucleotides targeted to HIV mRNA and DNA. H.M. Buck, L.H. Koole, M.H.P. van Gendersen, L. Smith, J.L.M.C. Green, S. Jurriaans and J. Goudsmit. Science 248, 208-212 tl990).
These prior attempts at targeting HIV have largely focused on the nature of the chemical modification used in the oligonucleotide analog. Although each of the above publications have reported some degree of success in inhibiting some function of the virus, a general therapeutic scheme to target HIV and other retroviruses-has not been found. Accordingly, there has been and continues to be a long-felt need for the design of oligonucleotides and oligonucleotide analogs which are capable of effective, therapeutic antisense use.
This long-felt need has not been satisfied by prior work in the field of antisense oligorlucleotide therapy for HIV
and other retroviruses and viruses. Others have failed to identify target sites in which anti1sense oligonucleotides or oligonucleotide analogs are ther~peutically ef~ective at reasonable rates of application.
OBJ~TS OF THE INV2NTION
It is a principal object of the invention to provide therapies for human diseases, particularly the human immunodeficiency virus and other human retroviruses.
It is a further object of the invention to provide molecules, especially oligonucleotides and oligonucleotide analogs which perturb the structure of mRNA.
Yet another object of this invention is to modulate gene expression in cells.
A further object is to interfere with the secondary structure of RNAs through interaction of those structures with oligonucleotides or oligonucleotide analogs.
These and other objects of this invention will "''. ' '' '~ ~, ' ~' ,, ', , ,, ,' , WO~l/t8004 PCT/~'S91/0~734 ~ 5 - ~08~63t become apparent from a review of the instant specifications.
B~RY OF T~IE INVEN'rION
Prior attempts at antisense targeting to HIV have been focused on inhibition of the synthesis of some particular viral protein thought to be essential to the success of the infection. In the present invention, the same goal (inhibition of viral gene expression) is achieved, but greater, therapeutically significant activity is obtained by targeting particular sites on the HIV or other retrovirus RNA.
In the present invention, target RNAs which have important biological function have been found to be the key target sites. It has been determined that targeting these RNA
regions is a key to effective antisense therapy with oligonucleotides and oligonucleotide analogs.
It has now been discovered that compounds which speci~ically hind the tat RNA structure and inter~ere with tat trans-activation have activity as therapeutic agents for HIV
inEection. It is intended that all strains o~ HIV fall within the spirit and scope of this invention. While different strains of HIV may have different tat RNA sequences, this invention can be practiced on alternative strains of ~IV by changing the sequence of the oligonucleotide or oligonucleotide analog to complement the structure of the alternative strain in accordance with the present teachings.
In accordance with the present invention, methods of modulating the expression of genes are provided. The targeted RNA, or cells containing it, is contacted with oligonucleotide or oligonucleotide analog which can bind with at least a portion of the RNA. The gene is generally one which is believed to give rise to a disease state in an organism and is typically a virus or, preferably, a retrovirus such as HIV, although other infectious organisms can be so attacked leading to therapeutic methods for treating diseased states by administering oligonucleotides or oligonucleotide analogs to animals suspected of having viral or retroviral infections.
.,.
:' w~ on4 PCT/US91/0~73 2 08 2 ~3 ~ - 6 -It has now been found that oligonucleotide or oligonucleotide analogs can be designed, especially for retroviruses such as HIV, which are effective in diminishing the infection. For HIV, a number of sequences have been found which are effective and persons of ordinary skill in the art will likely identify others. These sequences are the first, practically effective antisense sequences which have been shown to be effective in inhibiting the tat region of HIV and to lead to HIV therapeutics. Accordingly, this invention provides oligonucleotides and oligonucleotide analogs capable of binding with at least a portion of tat mRNA of HIV. Such oligonucleotides and analogs have been found corresponding to the nucleotide sequences G G C T C C A T T T C T T G` C-T-C T C ,-CCATTTCTTGCTCTCCTCTGT, GCTATGTCGACACCCAATTC, 15 CCGCCCCTCGCCTCTTGCCG, CGGGTCCCCTCGGGATTGGG, and CACCTTCTTCTTC'rATTCCT. It is preferred that theoligonucleotides and analogs have at least about 6 contiguous subunits of such sequences, with at least about lO being preferred and at least about 15 being still more preferred.
It is preferred for some embodiments that the oligonucleotide or oligonucleotide analog substantia:Lly correspond to a given sequence. By this is meant that the c)ligonucleotide or analog have every subunit of the sequence or an effective substitute.
Thus, s~lbstitutions such as U for T and the like may be made in wild type oligonucleotides. Additionally, of course, other chemical modifications to form oligonucleotide analogs may be made without departing from the spirit of this invention.
The sequence portions may fall anywhere within the given sequences to likely have effect. Oligonucleotides and analogs, such as the preferred phosphorothioate analogs may be presented in a pharmaceutically acceptable carrier.
Methods of inhibiting gene expression, especially tat gene expression have also been discovered. Such inhibition may be employed for therapeutics, for diagnosis or for research. Thus, methods of treating an animal suspected of having a disease characterized by tat gene expression, especially AIDS, have been discovered comprising contacting .: . . ~ :
WO~I/lg~)n4 PCT/US91/02734 - 7 ~ `2~263~
the animal with oligonucleotides or oligonucleotide analogs in accordance with this invention.
It is preferred that the oligonucleotide or oligonucleotide analog be capable of binding with at least about six subunits of the RNA portion. It is more preferred that from eight to fifty units be capable of being bound, with from about 10 to about 20 subunits being even more preferred. I
In accordance with preferred embodiments, the oligonucleotide of oligonucleotide analog is capable of forming a duplex structure with the portion of RNA. While the mechanism of the interaction is not Xnown with certainty, it is possible that it may effect modulation of gene -- --- expression through a number of ways.
In accordance with preferred embodiments, the RNA
portion which is interfered with comprises at least a part of the tat mRNA of HIV. The oligonucleotides and oligonucleotide analogs in accordance with this invention ar~, themselves believed to be novel. Thus, ol~gonucleotides which are capable of interacting with po~tions of tat RNA are comprehended. Thus, animals suspected of having the disease are contacted with oligonucleotide or oligonucleotide analog which can bind with the tat ~NA. In particular, the present invention is believed to be effective in the treatment of HIV
infections in mammals, especially man.
2 5 B~IEF DESC}~IPTION OF T~ DRA~ING8 Figure 1 depicts a linear HIV-l tat mRNA sequence.
Figure 2 depicts the activity of a series of oligonucleotides and oligonucleotide analogs in accordance with this invention in a cell culture assay for TAR/tat transactivation.
, I)ETAILED DESCRIPTION OF PREFE~RED EMBODINl~:NTS
It has been discovered to be possible to regulate the activity of HIV tat RNA in cells by introducing oligonucleotides or oligonucleotide analogs which bind to the tat mRNA. The oligonucleotides or oligonucleotide analogs , .
WO~1/l80n4 PCT/US91/0273~
2~82631 interfere with the normal function of the mRNA and these methods can be used to treat diseases, particularly HIV.
In the context of this invention, the term oligonuc-leotide refers to a plurality of joined nucleotide units formed from naturally-occurring bases and cyclofuranosyl groups joined by native phosphodiester bonds. This term effectively refers to naturally-occurring species or synthetic species formed from naturally-occurring subunits.
"Oligonucleotide analog," as that term is used in connection with this invention, refers to moieties which function similarly to oligonucleotides but which have non naturally-occurring portions. Thus, oligonucleotide analogs may have -altered sugar moieties or inter-sugar linkages.
Exemplary among these are the phosphorothioate and othar sulfur containing species which are known for use in the art.
They may also comprise altered base units or other modifications consistent with the spirit of this invention.
In accordance with certain preferred embodiments, at least some of the phosphodiester bonds of the oligonucleotide have been substituted with a structure which ~unctions to enhance the ability of the compositions to penetrate into the region of cells where the RNA whose actlvity is to be modu~ated is located. It is preferred that such linkages be sulfur-containing. It is presently preferred that such substitutions comprise phosphorothioate bonds.
Others such as alkyl phosphothioat~ bonds, N-alkyl phosphoramidates,phosphorodithioates, alkylphosphonates,and short chain alkyl or cycloalkyl structures may also be useful.
In accordance with other preferred embodiments, the phosphodiester bonds are substituted with structures which are, at once, substantially non-ionic and non-chiral. Persons of ordinary skill in the art will be able to select other linkages for use in the practice of the invention.
It is generally preferred for use in some embodiments of this invention that the 2' position of the linking sugar moieties in at least some of the subunits of the oligonucleotides or oligonucleotide analogs be substituted.
~,. . - :
... . .. ..
:. . - . . ::. . :
- . : . .
:::: . . . . ...
... .. . .. .
WO 91/lX004 PCr/l,'S91/02734 Thus, 2' substituients such as OH, SH, F, OCH3, OCN, OC~CH3 where n is from 1 to about 20 and other substituients having similar properties may be useful in some embodiments.
Oligonucleotide analogs may also include species which include at least some modified base forms. Thus, purines and pyrimidines other than those normally found in nature may be so employed. Similarly, modifications on the cyclofuranose portions of the nucleotide subunits may also occur as long as the essential tenets of this invention are adhered to.
Such analogs are best described as being functionally interchangeable with natural oligonucleotides (or synthesized oligonucleotides along natural lines), but which have one or more differences from natural structure. All such analogs are comprehended by this invention so long as they function effectively to bind to selected portions of tat RNA.
Th~ oligonucleotides and oligonucleotide analogs in accordance with this invention pref~!rably comprise from about 3 to about 100 subunits. It is preferred that such oligonucleotides and analogs comprise at least about 6 subunits with from about 8 to abo~t 50 subunits being more pre~erred, and still more preferred to have from about 10 to about 20 subunits. As will be appreciated, a subunit is a base and sugar combination suitably bound to adjacent subunits through phosphodiester or other bonds.
The oligonucleotides and oligonucleotide analogs of this invention can be used in diagnostics, therapeutics and as research reagents and kits. For therapeutic use, the oligonucleotide or oligonucleotide analog is administered to an animal, especially a human, such as are suffering from a virus or retrovirus infection such as AIDS.
It is generally preferred to apply the therapeutic agents in accordance with this invention internally such as orally, intravenously or intramuscularly. Other forms of administration, such as transdermally, topically or intralesionally may also be useful. Inclusion in suppositories may also be useful. Use of the oligonucleotides .
, ' . i ' WO9~/18004 PCT/~91/0~73~
2082~3~ - lO-and oligonucleotide analogs of this invention in prophylaxis is also likely to be useful. Use of pharmacologically acceptable carriers is also preferred for some embodiments.
In accordance with the present invention, it will be understood that the term "to bind" as it refers to the interaction between an oligonucleotide or oligonucleotide analog and an RNA portion or subportion may have any of several, related meanings. Thus, the present invention comprehends binding of an oligonucleotide or analog with at least one portion of tat RNA. It will be understood that the oligonucleotide or analog will bind with at least one portion of the RNA portion in a Watson-Crick fashion so as to form, locally, a heteroduplex between the RNA portion and the oligonucleotide or analog. This heteroduplex formation is believed to result in alteration of the structure or function of the RNA portion. The exact mechanism and the result of this effect is not known with certainty, yet it is believed that the normal ~tructure or function of the RNA portion is gradually replaced by the binding of the oligonucleotide with one or more portions of the RNA. 'since the electronic and steric factors which attend the new h~eteroduplex are different from those of the natural-occurring RNA portion, the Qffectiveness and nature of the func:tion to generate protein from the RNA is interfered with. The resulting formation of defective or missing protein manifests itself overall as a modulation in the expression of the gene coding for the RNA.
In short, any interaction or binding of oligonucleotide or oligonucleotide analog with tat RNA is believed to have the potential for interference with RNA
function and, hence, for modulation the expression of the gene from which the RNA derives. Tat RNA targets have been found which exhibit overall diminution of activity of HIV when oligonucleotides or oligonucleotide analogs corresponding to portions of the target are administered to infected cells.
While a wide variety of oligonucleotides and oligonucl20tide analogs are believed to be useful in practice of the present invention, it has been found to be preferred .
.: :: ~ ~.. . :
'' ~ . ` `: '`:,.. ,`'` - ' WO~I/lXOO~ PCT/US91/0273~
2~631 to design such oligonucleotides and analogs so as to bind with at least about six subunits of a portion of RNA. In accordance with other preferred embodiments, oligonucleotides which combine with from about six to about 30 and even more preferably with about 10 to about 20 subunits are preferred.
As discussed above, it is presently believed that the tat RNA
of HIV comprises an excellent target for employment of the present invention. Accordingly, preparation of oligonucleotide or oligonucleotide analog for binding with one or more portions of the tat RNA region of HIV are preferred.
Therapeutics are particular objects of the present invention. Thus, presenting oligonucleotides and oligonucleotide analogs in accordance with the -present invention in pharmaceutically acceptable carriers may be highly useful. This is especially true for treatment of the disease AIDS.
Overall, it is preferred to administer to patients suspected of suffering from the foregoing disease`states with amounts of oligonucleotide or analog, in either native form or suspended in a carrier medium in amounts and upon treatment schedules which are effective to reduce the symptomology of that disease. It is within the scale of a person's skill in the art to determine optimum dosages and treatment schedules for such treatment regimens.
An elaborate set of conl:rol elements in the HIV
genome determine whether the virus replicates or remains dormant. Of the nine genes identified in the HIV genome, only three are from the core and envelope. W.A. Haseltine, F.
Wong-Staal, Scientific American October, 52 (1988). The other six ~enes are involved in regulation of the production of viral proteins. Regulatory genes work by encoding a protein that interacts with a responsive element somewhere else on the viral genome. The major regulatory gene responsible for initiating the burst of replication is the tat ttrans-activator) gene. Figure 1 is a sequence for the cDNA of the tat region in HIV. The product of the tat gene, tat protein, works by interaction with a short sequence element known as : .
W~91/18nO4 PCTlUS91/02734 2~ 6~1 - 12 -TAR (trans-acting responsive element). The TAR sequence is encoded in the viral long terminal repeats (LTR's), and therefore is included in the mRNA from every HIV gene.
Expression of the tat protein results in increased expression of other HIV genes up to 1,000 fold, including the tat gene itself. Because of this autoregulatory positive feedback, and the fact that the TAR sequence in included in the mRNA from every HIV transcript, a immense amount of viral gene expression is triggered when the tat gene is activated.
The interaction between the tat gene and the TAR element is therefore crucial to the life cycle of the HIV, and specific disruption of this interaction is likely to interrupt the propagation of the virus.
The mechanism of trans-activation of TAR-containing genes by the tat protein has recently been studied intensely.
Philip,A. Sharp, Robert,A. Marciniak, Cell 59, 229 ~1989).
Although much remains to be learned, two important points have become clear: that tat increases the expression of TAR-containing genes by increasing both the amount of viral mRNA
and the efficiency of its translation, and that TAR functions as an RNA structure, rather than a DNA structure.
The unusual conclusion that tat increases the transcription of TAR-contàining genes, but does so by interacting with the TAR element in RNA was derived from a num~er of observations. Philip,A. Sharp, Robert,A. MarciniaX, Cell 59, 229 (1989). In order to achieve trans-activation, the TAR element must be located immediately downstream from the site of initiation of transcription. Moreover, TAR is orientation dependent; if inserted in the inverse orientation, it fails to function.
Some of the strongest evidence that tat interacts with TAR as an RNA structure has come from mutagenesis experiments. Efforts to study the TAR element were stimulated by the observation that the tat protein from HIV-1 was capable of trans-activating vectors containing the TAR region of HIV-2, a different strain of virus, even though there is very little pri~ary sequence homology in the TAR region between the , WO~ OO~t PCT/~'S91/02734 - 13 - ; 2~26~ ~
two strains. S. Feng, E.C. Holland, Nature 334, 165 ~1988).
However, examination of the TAR seq~lence from HIV-l and HIV-2 with computer programs that predict RNA secondary revealed the potential of RNA stem-loop structures, with a single stem-loop in the TAR region of HIV-l and three stem-loop structures in HIV-2. Although the compositions and lengths of the stems were divergent, all four loops contained the pentanucleotide CUGGG as shown in Figures lA and lB. Mutagenesis experiments revealed that each of the nucleotides present in the loop are absolutely essential for trans-activation by tat, but that base substitutions in the stem were tolerated to some extent so long as the stem structure was maintained. S. Feng, E.C.
Holland, Nature 334, 165 (1988).
Further evidence for the TAR structure functioning as RNA was obtained from experiments in which the sequences flanking the stem-loop structure were altered creating competing secondary structures in the RNA that were more stable than the natural TAR stem-loop. B. Berkhout, Cell 59, 273 (1989). This was accomplished by introducing additional sequences into the TAR-containing RNA that were antisense to the 5 ' side of the stem-loop structure. Trans-activation of the modified TAR structure was lost, suggesting that the TAR
s~quences alone are not sufficient ~or trans-activation, but that these sequences must fold up in the proper secondary 25 structure to be active. It also suggests that antisense sequences to the TAR stem-loop are capable of disrupting the natural RNA structure.
Direct biochemical evidence for TAR stem-loop structure has also been obtained. The TAR RNA has been enzymatically synthesized in vitro and probed with enzymes selectively cleave single stranded regions of RNA, but not duplex structures. The results of the enzyme cleavage patterns were consis~ent with the computer predicted RNA secondary structure. B. Ber~hout, Cell 59, 273 (1989).
In summar~, there is strong and direct evidence from a number of studies that the HIV tat protein is responsible for triggering an enormous amount of viral gene expression, - ~ :; :' ~ ' . :
: :. , . , ,. :- :.
WO')I/I~ PCT/US9t/0~734 20 82 63 ~ - 14 -that this occurs by interactisn with the TAR sequence which is incorporated into every HIV mRNA transcript, that the HIV
TAR sequence functions as an RNA structure and that the correct TAR RNA structure is essential for tat transactivation.
T~R and tat function has been studied by removing the gen~s from the HIV genome and studying them in cell lines in isolation. Vectors have been constructed to study the interactions between the tat protein and TAR element. The tat gene is expressed under the SV40 promoter. The TAR region is expressed from a separate plasmid fused to an easily assayed reporter gene, the placental alkaline phosphatase gene tPAP). --P. Henthorn, P. Zervos, M. Raducha, H.-Harris, T.
Kadesch, Pro~. Natl. Acad. Sci. USA 85, 6342 (1988).
Enzymatic activity in cell culture models has been shown to be dependent upon both the presence of the essential elements of the TAR region and the presence of the tat protein. P.
Sharp, R. Marciniak, Cell 5'~, 229 (1989); S. Feng, E.C.
Holl~nd, Nature 334, 165 (1988); Michael,F. Laspia, Andrew,P.
Rice, Michael,B. Mathews, Cell 59, 283 (1989); J.A. Garcia, D. Harrich, E. Soultanakis, F. Wu, R. Mitsuyasu, R. a. Gaynor, E~BO J. 8, 76S (1989); and B. Berkhout, Cell 59, 273 (1989).
In essence, the vector system reconst:itutes the events of tat-mediated TAR transactivation in which occurs in HIV infected cells.
TAT/TAR trans activation can be conveniently assayed by placing the human placental alkaline phosphatase gene (PAP) under the regulatory control of the HIV-l LTR sequences, which contain enhancer, promoter, and tar elements. A plasmid containing the HIV-l LTR, pHIVCAT-0 (S. Feng, E.C. Holland, Nature 334, 165 (1988)), contains HIV U3 in its entirety and R up through position +78 (a HindIII site). Digestion of this plasmid with a combination of HindIII and AatII releases the CAT cassette along with the SV40 sequences responsible for the processing of the RNA. A second plasmid, pSV2Apap, contains the PAP cassette with eukaryotic processing signals, under the transcriptional control of an SV40 promoter. P. Henthorn, P
- " . : ~,,, ,,, . ~ . -~()'~lt1#nO~ PCT/~'S91/0'734 2~82~31 Zervos, M. Raducha, H. Harris, T. Kadesch, Proc. Natl. Acad.
Sci. USA 85, 6342 (1988). The PAP cassette and processing sequences were released from the plasmid by digestion with HindIII and AatII. A new plasmid, pHIVPAP, was created by ligating the HindIII/AatII fragment containing the HIV-l LTR
and vector sequences from pHIVCAT-0, to the HindIII/AatII PAP
cassette from pSV2Apap.
To test the activity of oligonucleotide analogs, pcDEBtat and pHIVPAP were co-transfected into HeLa cells by calcium/phosphate precipitation. The effects of the selected oligonucleotide analogs was determined as follows. HeLa cells were split 1:8 into 6-well dishes the day prior to the transfections. For each dish, lug of--pHIVPAP- and 12ug of pcDEBtat were precipitated in 500 ~l of HBs and 32 ~l of 2.5 M CaCl2. The CaP04 precipitate was divided evenly between the 6 wells. Oligonucleotides or oligonucleotide analogs were precepitated in the same manner and added to the cells at the concentrations indicated in the figures. The precipitate was allowed to sit on the cells for 20 minutes then complete media was added and the cells were incubated for an additional 4 hours. The cells were then shocked~with 10% glycerol in HBS.
After 48 hours, cells were harvested and p~otein and PAP assays performed as described by Henthorn et al. P.
Henthorn, P. Zervos, M. Raducha, H. Harris, T. Kadesch, Proc.
Natl. Acad. Sci. USA 85, 6342 (1988) with the following modifications. The cells were harvested in 0.5 ml of TBS, of which 0.1 mls were used for use in the protein assay. The remaining 0.4 mls of cell suspension was pelleted then resuspended in 50 ~l TBS. Endogenous phosphatases were inactivated by heatin~ the cells at 65C for 30 min. The heat stable human placental alkaline phosphatase activity was assayed by the addition of PNPP (0.5 ml, 5 mM PNPP) to the cell suspension, which was then incubated at 37C. Activity was determined at 30 minute intervals using 150 ~l aliquots of the reaction mixture and measuring absorbance at 405 nm with a Titertek Multiscan MCC\340 ELISA plate reader. The PAP activity was normalized to the total protein in each well : , 1 ~.
WO9l/l800~ P~T/US9t/0273 as determined by Bio-Rad protein assay, in which 1\5 of the harvested cells in TBS(0.1 ~1) were added to 30 ~1 of Bio-Rad Protein Reagent, then incubated for 10 minutes at room temperature, followed by measurement of absorbance at 595 nm using the Titertek plate reader.
Cells were treated with the following oligonucleotide analogs having phosphorothioate backbones:
# 5' 3' Control TGGCATCGAT GCTCA
The data are displayed graphically in Figure 2.
5ignificant diminution in PAP activity, which is a direct measure of gene expression from the ~IIV LTR, was exhibited by the phosphorothioate oligonucleotidle analogs bearing code numbers 461, 46~, 463, 464 and 465. Oligonucleo~ide 466 and the control oligonucleotide, which was not desinged to be complementary to the tat mRNA did not exhibit significant activities in this assay. The apparent increase in PAP
activity at the 1 uM dose for the control oligonucleotide and compound number 466 probably resulted from a carrier effect in Which the oligonucleotides facilitated uptake of the plasmids at the time of transfection. This effect may have been present in experiments with the active oligonucleotides, but was masked by the specific inhibitory activities of these compounds.
. , : ,~,
Claims (27)
1. An oligonucleotide or oligonucleotide analog comprising at least 6 contiguous subunits corresponding to any of the nucleotide sequences:
2. The oligonucleotide or oligonucleotide analog of claim 1 comprising at least about 10 contiguous subunits.
3. The oligonucleotide or oligonucleotide analog of claim 1 comprising at least about 15 contiguous subunits.
4. The oligonucleotide or oligonucleotide analog of claim 1 substantially corresponding to one of said sequences.
5. The oligonucleotide or oligonucleotide analog of claim 1 in a pharmaceutically acceptable carrier.
6. An oligonucleotide or oligonucleotide analog capable of binding with at least a portion of tat mRNA of HIV.
7. The oligonucleotide or oligonucleotide analog of claim 6 comprising at least about 6 subunits.
8. The oligonucleotide or oligonucleotide analog of claim 6 comprising at least about 15 subunits.
9. The oligonucleotide or oligonucleotide analog of claim 6 comprising from about 8 to about 50 subunits.
10. The oligonucleotide or oligonucleotide analog of claim 6 comprising from about 10 to about 20 subunits.
11. The oligonucleotide or oligonucleotide analog of claim 6 capable of forming a heteroduplex with said portion.
12. A method for treating an animal suspected of having a disease characterized by expression of the HIV tat gene comprising contacting said animal with an oligonucleotide or oligonucleotide analog comprising at least 6 contiguous subunits corresponding to any of the nucleotide sequences:
13. The method of claim 12 wherein said oligonucleotide or oligonucleotide analog comprises at least about 10 contiguous subunits.
14. The method of claim 12 wherein said oligonucleotide or oligonucleotide analog comprises at least about 15 contiguous subunits.
15. The method of claim 12 wherein said oligonucleotide or oligonucleotide analog substantially corresponds to one of said sequences.
16. The method of claim 12 wherein said oligonucleotide or oligonucleotide analog is in a pharmaceutically acceptable carrier.
17. A method for treating an animal suspected of having a disease characterized by expression of the HIV tat gene comprising contacting said animal with an oligonucleotide or oligonucleotide analog capable of binding with at least a portion of tat mRNA of HIV.
18. The method of claim 17 wherein said oligonucleotide or oligonucleotide analog comprises at least about 6 subunits.
19. The method of claim 17 wherein said oligonucleotide or oligonucleotide analog comprises at least about 15 subunits.
20. The method of claim 17 wherein said oligonucleotide or oligonucleotide analog comprises from about 8 to about 50 subunits.
21. The method of claim 17 wherein said oligonucleotide or oligonucleotide analog comprises from about 10 to about 20 subunits.
22. The method of claim 17 wherein said oligonucleotide or oligonucleotide analog is capable of forming a heteroduplex with said portion.
23. The method of claim 17 wherein said oligonucleotide or oligonucleotide analog is in a pharmaceutically acceptable carrier.
24. A method for treating an animal suspected of having a HIV infection comprising contacting said animal with an oligonucleotide or oligonucleotide analog capable of binding with at least a portion of tat mRNA of HIV.
25. The method of claim 24 wherein said animal is human.
26. A method for modulating expression of the HIV
tat gene comprising contacting cells or an animal infected with HIV with an oligonucleotide or oligonucleotide analog comprising at least 6 contiguous subunits corresponding to any of the nucleotide sequences:
tat gene comprising contacting cells or an animal infected with HIV with an oligonucleotide or oligonucleotide analog comprising at least 6 contiguous subunits corresponding to any of the nucleotide sequences:
27. A method for modulating expression of the HIV
tat gene comprising contacting cells or an animal infected with HIV with an oligonucleotide or oligonucleotide analog capable of binding with at least a portion of tat mRNA of HIV.
tat gene comprising contacting cells or an animal infected with HIV with an oligonucleotide or oligonucleotide analog capable of binding with at least a portion of tat mRNA of HIV.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US521,907 | 1990-05-11 | ||
| US07/521,907 US5166195A (en) | 1990-05-11 | 1990-05-11 | Antisense inhibitors of the human immunodeficiency virus phosphorothioate oligonucleotides |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CA2082631A1 true CA2082631A1 (en) | 1991-11-12 |
Family
ID=24078638
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CA002082631A Abandoned CA2082631A1 (en) | 1990-05-11 | 1991-04-22 | Antisense inhibitors of the human immunodeficiency virus |
Country Status (13)
| Country | Link |
|---|---|
| US (2) | US5166195A (en) |
| EP (1) | EP0527916B1 (en) |
| JP (1) | JPH0832242B2 (en) |
| KR (1) | KR0149680B1 (en) |
| AT (1) | ATE181960T1 (en) |
| AU (1) | AU651593B2 (en) |
| BR (1) | BR9106440A (en) |
| CA (1) | CA2082631A1 (en) |
| DE (1) | DE69131422T2 (en) |
| FI (1) | FI925103A0 (en) |
| HU (1) | HUT62912A (en) |
| NO (1) | NO924258L (en) |
| WO (1) | WO1991018004A1 (en) |
Families Citing this family (155)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CA1223831A (en) | 1982-06-23 | 1987-07-07 | Dean Engelhardt | Modified nucleotides, methods of preparing and utilizing and compositions containing the same |
| US5856088A (en) * | 1989-07-11 | 1999-01-05 | Gen-Probe Incorporated | Detection of human immunodeficiency virus type 1 |
| US6589734B1 (en) | 1989-07-11 | 2003-07-08 | Gen-Probe Incorporated | Detection of HIV |
| US6339066B1 (en) | 1990-01-11 | 2002-01-15 | Isis Pharmaceuticals, Inc. | Antisense oligonucleotides which have phosphorothioate linkages of high chiral purity and which modulate βI, βII, γ, δ, Ε, ζ and η isoforms of human protein kinase C |
| US5620963A (en) * | 1991-10-15 | 1997-04-15 | Isis Pharmaceuticals, Inc. | Oligonucleotides for modulating protein kinase C having phosphorothioate linkages of high chiral purity |
| US20040142899A1 (en) * | 1990-01-11 | 2004-07-22 | Isis Pharmaceuticals, Inc. | Compositions and methods for enhanced biostability and altered biodistribution of oligonucleotides in mammals |
| US6753423B1 (en) | 1990-01-11 | 2004-06-22 | Isis Pharmaceuticals, Inc. | Compositions and methods for enhanced biostability and altered biodistribution of oligonucleotides in mammals |
| US5587361A (en) * | 1991-10-15 | 1996-12-24 | Isis Pharmaceuticals, Inc. | Oligonucleotides having phosphorothioate linkages of high chiral purity |
| US5959096A (en) * | 1992-03-16 | 1999-09-28 | Isis Pharmaceuticals, Inc. | Antisense oligonucleotides against human protein kinase C |
| US5635488A (en) * | 1991-10-15 | 1997-06-03 | Isis Pharmaceuticals, Inc. | Compounds having phosphorodithioate linkages of high chiral purity |
| US5248670A (en) * | 1990-02-26 | 1993-09-28 | Isis Pharmaceuticals, Inc. | Antisense oligonucleotides for inhibiting herpesviruses |
| US6034233A (en) * | 1990-05-04 | 2000-03-07 | Isis Pharmaceuticals Inc. | 2'-O-alkylated oligoribonucleotides and phosphorothioate analogs complementary to portions of the HIV genome |
| US5138045A (en) * | 1990-07-27 | 1992-08-11 | Isis Pharmaceuticals | Polyamine conjugated oligonucleotides |
| GB9016973D0 (en) * | 1990-08-02 | 1990-09-19 | Medical Res Council | Viral growth inhibition |
| WO1992003454A1 (en) * | 1990-08-14 | 1992-03-05 | Isis Pharmaceuticals, Inc. | Inhibition of influenza virus type a, ann arbor strain h2n2 by antisense oligonucleotides |
| US5786145A (en) * | 1990-09-20 | 1998-07-28 | Medical Research Council | Oligonucleotide competitors for binding of HIV RRE to REV protein and assays for screening inhibitors of this binding |
| GB9020541D0 (en) * | 1990-09-20 | 1990-10-31 | Medical Res Council | Viral growth inhibition |
| US7119184B2 (en) * | 1991-08-12 | 2006-10-10 | Isis Pharmaceuticals, Inc. | Oligonucleotides having A-DNA form and B-DNA form conformational geometry |
| US6369209B1 (en) | 1999-05-03 | 2002-04-09 | Isis Pharmaceuticals, Inc. | Oligonucleotides having A-DNA form and B-DNA form conformational geometry |
| US5654284A (en) * | 1991-10-15 | 1997-08-05 | Isis Pharmaceuticals, Inc. | Oligonucleotides for modulating RAF kinase having phosphorothioate linkages of high chiral purity |
| US5607923A (en) * | 1991-10-15 | 1997-03-04 | Isis Pharmaceuticals, Inc. | Oligonucleotides for modulating cytomegalovirus having phosphorothioate linkages of high chiral purity |
| US5576302A (en) * | 1991-10-15 | 1996-11-19 | Isis Pharmaceuticals, Inc. | Oligonucleotides for modulating hepatitis C virus having phosphorothioate linkages of high chiral purity |
| US5599797A (en) * | 1991-10-15 | 1997-02-04 | Isis Pharmaceuticals, Inc. | Oligonucleotides having phosphorothioate linkages of high chiral purity |
| US5661134A (en) * | 1991-10-15 | 1997-08-26 | Isis Pharmaceuticals, Inc. | Oligonucleotides for modulating Ha-ras or Ki-ras having phosphorothioate linkages of high chiral purity |
| US6335434B1 (en) | 1998-06-16 | 2002-01-01 | Isis Pharmaceuticals, Inc., | Nucleosidic and non-nucleosidic folate conjugates |
| US8153602B1 (en) | 1991-11-19 | 2012-04-10 | Isis Pharmaceuticals, Inc. | Composition and methods for the pulmonary delivery of nucleic acids |
| WO1993013114A1 (en) | 1991-12-24 | 1993-07-08 | Isis Pharmaceuticals, Inc. | COMPOSITIONS AND METHODS FOR MODULATING β-AMYLOID |
| US6117847A (en) * | 1992-03-16 | 2000-09-12 | Isis Pharmaceuticals, Inc. | Oligonucleotides for enhanced modulation of protein kinase C expression |
| US5916807A (en) * | 1992-03-16 | 1999-06-29 | Isis Pharmaceuticals, Inc. | Antisense oligonucleotides against human protein kinase C |
| US6537973B1 (en) | 1992-03-16 | 2003-03-25 | Isis Pharmaceuticals, Inc. | Oligonucleotide inhibition of protein kinase C |
| US5922686A (en) * | 1992-03-16 | 1999-07-13 | Isis Pharmaceuticals, Inc. | Oligonucleotide modulation of protein kinase C |
| US5681747A (en) * | 1992-03-16 | 1997-10-28 | Isis Pharmaceuticals, Inc. | Nucleic acid sequences encoding protein kinase C and antisense inhibition of expression thereof |
| US5885970A (en) * | 1992-03-16 | 1999-03-23 | Isis Pharmaceuticals, Inc. | Antisense oligonucleotides against human protein kinase C |
| US5882927A (en) * | 1992-03-16 | 1999-03-16 | Isis Pharmaceuticals, Inc. | Oligonucleotide inhibition of protein kinase C |
| US6153599A (en) * | 1992-03-16 | 2000-11-28 | Isis Pharmaceuticals, Inc. | Methoxyethoxy oligonucleotides for modulation of protein kinase C expression |
| US5643780A (en) * | 1992-04-03 | 1997-07-01 | Isis Pharmaceuticals, Inc. | Compositions and methods for modulating RNA activity through modification of the 5' cap structure of RNA |
| AU4774593A (en) * | 1992-07-17 | 1994-02-14 | Aprogenex, Inc. | Multi reporter-labeled nucleic acid probes |
| AU4775193A (en) * | 1992-07-17 | 1994-02-14 | Aprogenex, Inc. | In situ detection of nucleic acids using 3sr amplification |
| US5521061A (en) * | 1992-07-17 | 1996-05-28 | Aprogenex, Inc. | Enhancement of probe signal in nucleic acid-mediated in-situ hybridization studies |
| US6391542B1 (en) | 1992-09-10 | 2002-05-21 | Isis Pharmaceuticals, Inc. | Compositions and methods for treatment of Hepatitis C virus-associated diseases |
| EP0662157B1 (en) * | 1992-09-10 | 2001-06-20 | Isis Pharmaceuticals, Inc. | Compositions and methods for treatment of hepatitis c virus-associated diseases |
| US20040049021A1 (en) * | 1992-09-10 | 2004-03-11 | Anderson Kevin P. | Compositions and mehtods for treatment of Hepatitis C virus-associated diseases |
| US6423489B1 (en) | 1992-09-10 | 2002-07-23 | Isis Pharmaceuticals, Inc. | Compositions and methods for treatment of Hepatitis C virus-associated diseases |
| US6174868B1 (en) | 1992-09-10 | 2001-01-16 | Isis Pharmaceuticals, Inc. | Compositions and methods for treatment of hepatitis C virus-associated diseases |
| US6995146B2 (en) | 1992-09-10 | 2006-02-07 | Isis Pharmaceuticals, Inc. | Compositions and methods for treatment of hepatitis C virus-associated diseases |
| US5523389A (en) * | 1992-09-29 | 1996-06-04 | Isis Pharmaceuticals, Inc. | Inhibitors of human immunodeficiency virus |
| US5985558A (en) | 1997-04-14 | 1999-11-16 | Isis Pharmaceuticals Inc. | Antisense oligonucleotide compositions and methods for the inibition of c-Jun and c-Fos |
| CA2110946A1 (en) * | 1992-12-09 | 1994-06-10 | Elazar Rabbani | Induction of immunocompatibility by nucleic acid |
| KR100325554B1 (en) | 1993-03-26 | 2002-11-02 | 젠-프로브 인코포레이티드 | Detection of Human Immunodeficiency Virus Type 1 |
| KR960703170A (en) * | 1993-06-23 | 1996-06-19 | 알버트 디. 프리센. | ANTISENSE OLIGONUCLEOTIDES AND THERAPEUTIC USE THEREOF IN HUMAN IMMUNODEFICIENCY VIRUS INFECTION |
| WO1995003407A2 (en) * | 1993-07-19 | 1995-02-02 | Gen-Probe Incorporated | Oligonucleotides with activity against human immunodeficiency virus |
| US5739309A (en) * | 1993-07-19 | 1998-04-14 | Gen-Probe Incorporated | Enhancement of oligonucleotide inhibition of protein production, cell proliferation and / or multiplication of infectious disease pathogens |
| EP0728139B1 (en) | 1993-09-03 | 2003-08-13 | Isis Pharmaceuticals, Inc. | Amine-derivatized nucleosides and oligonucleosides |
| US5807838A (en) * | 1994-09-23 | 1998-09-15 | Isis Pharmaceuticals, Inc. | Oligonucleotide modulation of multidrug resistance-associated protein |
| US5510239A (en) * | 1993-10-18 | 1996-04-23 | Isis Pharmaceuticals, Inc. | Oligonucleotide modulation of multidrug resistance-associated protein |
| US6399376B1 (en) | 1993-11-05 | 2002-06-04 | Isis Pharmaceuticals, Inc. | Modulation of vascular cell adhesive molecule expression through oligonucleotide interactions |
| US5814619A (en) * | 1994-04-08 | 1998-09-29 | Isis Pharmacuticals, Inc. | Oligonucleotide inhibition of P120 |
| US6090626A (en) * | 1994-05-31 | 2000-07-18 | Isis Pharmaceuticals Inc. | Antisense oligonucleotide modulation of raf gene expression |
| US6358932B1 (en) | 1994-05-31 | 2002-03-19 | Isis Pharmaceticals, Inc. | Antisense oligonucleotide inhibition of raf gene expression |
| US5656612A (en) * | 1994-05-31 | 1997-08-12 | Isis Pharmaceuticals, Inc. | Antisense oligonucleotide modulation of raf gene expression |
| US20030119769A1 (en) * | 1994-05-31 | 2003-06-26 | Monia Brett P | Antisense oligonucleotide modulation of raf gene expression |
| US5563255A (en) * | 1994-05-31 | 1996-10-08 | Isis Pharmaceuticals, Inc. | Antisense oligonucleotide modulation of raf gene expression |
| US20060142236A1 (en) * | 1994-05-31 | 2006-06-29 | Isis Pharmaceuticals, Inc. | Antisense oligonucleotide modulation of raf gene expression |
| US5744362A (en) * | 1994-05-31 | 1998-04-28 | Isis Pharmaceuticals, Inc. | Antisense oligonucleotide modulation of raf gene expression |
| KR100211178B1 (en) * | 1994-05-31 | 1999-07-15 | 파샬 비. 린네 | Antisense oligonucleotide modulation of raf gene expression |
| US6410518B1 (en) | 1994-05-31 | 2002-06-25 | Isis Pharmaceuticals, Inc. | Antisense oligonucleotide inhibition of raf gene expression |
| US6207646B1 (en) | 1994-07-15 | 2001-03-27 | University Of Iowa Research Foundation | Immunostimulatory nucleic acid molecules |
| US5733781A (en) * | 1994-07-19 | 1998-03-31 | Gen-Probe Incorporated | Oligonucleotides and methods for inhibiting propagation of human immunodeficiency virus |
| US6372427B1 (en) * | 1995-04-12 | 2002-04-16 | Hybridon, Inc. | Cooperative oligonucleotides |
| US20030099959A1 (en) * | 1995-04-12 | 2003-05-29 | Kandimalla Ekambar R. | Cooperative oligonucleotides |
| US5985662A (en) * | 1995-07-13 | 1999-11-16 | Isis Pharmaceuticals Inc. | Antisense inhibition of hepatitis B virus replication |
| US5856099A (en) * | 1996-05-21 | 1999-01-05 | Isis Pharmaceuticals, Inc. | Antisense compositions and methods for modulating type I interleukin-1 receptor expression |
| US6776986B1 (en) | 1996-06-06 | 2004-08-17 | Novartis Ag | Inhibition of HIV-1 replication by antisense RNA expression |
| US6111085A (en) * | 1996-09-13 | 2000-08-29 | Isis Pharmaceuticals, Inc. | Carbamate-derivatized nucleosides and oligonucleosides |
| US6001991A (en) * | 1996-10-04 | 1999-12-14 | Isis Pharmaceuticals Inc. | Antisense oligonucleotide modulation of MDR P-glycoprotein gene expression |
| US7235653B2 (en) * | 1996-12-31 | 2007-06-26 | Isis Pharmaceuticals, Inc. | Oligonucleotide compositions and methods for the modulation of the expression of B7 protein |
| US6077833A (en) * | 1996-12-31 | 2000-06-20 | Isis Pharmaceuticals, Inc. | Oligonucleotide compositions and methods for the modulation of the expression of B7 protein |
| US20040023917A1 (en) * | 1996-12-31 | 2004-02-05 | Bennett C. Frank | Oligonucleotide compositions and methods for the modulation of the expression of B7 protein |
| US6319906B1 (en) | 1996-12-31 | 2001-11-20 | Isis Pharmaceuticals | Oligonucleotide compositions and methods for the modulation of the expression of B7 protein |
| US6172209B1 (en) | 1997-02-14 | 2001-01-09 | Isis Pharmaceuticals Inc. | Aminooxy-modified oligonucleotides and methods for making same |
| US6127533A (en) * | 1997-02-14 | 2000-10-03 | Isis Pharmaceuticals, Inc. | 2'-O-aminooxy-modified oligonucleotides |
| US6576752B1 (en) | 1997-02-14 | 2003-06-10 | Isis Pharmaceuticals, Inc. | Aminooxy functionalized oligomers |
| US6265388B1 (en) | 1997-03-21 | 2001-07-24 | President And Fellows Of Harvard College | Antisense inhibition of angiogenin expression |
| EP1012331B1 (en) | 1997-07-01 | 2006-03-29 | Isis Pharmaceuticals, Inc. | Compositions and methods for the delivery of oligonucleotides via the alimentary canal |
| US5972639A (en) * | 1997-07-24 | 1999-10-26 | Irori | Fluorescence-based assays for measuring cell proliferation |
| US5877309A (en) | 1997-08-13 | 1999-03-02 | Isis Pharmaceuticals, Inc. | Antisense oligonucleotides against JNK |
| US6133246A (en) * | 1997-08-13 | 2000-10-17 | Isis Pharmaceuticals Inc. | Antisense oligonucleotide compositions and methods for the modulation of JNK proteins |
| US20070149472A1 (en) * | 1997-08-13 | 2007-06-28 | Mckay Robert | Antisense oligonucleotide compositions and methods for the modulation of jnk proteins |
| US6809193B2 (en) | 1997-08-13 | 2004-10-26 | Isis Pharmaceuticals, Inc. | Antisense oligonucleotide compositions and methods for the modulation of JNK proteins |
| DK1045918T3 (en) | 1998-01-12 | 2008-12-08 | Pedro Jose | G protein-related kinase mutants in essential hypertension |
| EP1080103A4 (en) * | 1998-05-21 | 2003-07-02 | Isis Pharmaceuticals Inc | Compositions and methods for non-parenteral delivery of oligonucleotides |
| AU753270B2 (en) * | 1998-05-21 | 2002-10-10 | Isis Pharmaceuticals, Inc. | Compositions and methods for topical delivery of oligonucleotides |
| DE69932717T2 (en) | 1998-05-22 | 2007-08-09 | Ottawa Health Research Institute, Ottawa | METHODS AND PRODUCTS FOR INDUCING MUCOSAL IMMUNITY |
| US6277967B1 (en) | 1998-07-14 | 2001-08-21 | Isis Pharmaceuticals, Inc. | Carbohydrate or 2′-modified oligonucleotides having alternating internucleoside linkages |
| US6867294B1 (en) | 1998-07-14 | 2005-03-15 | Isis Pharmaceuticals, Inc. | Gapped oligomers having site specific chiral phosphorothioate internucleoside linkages |
| US6242589B1 (en) | 1998-07-14 | 2001-06-05 | Isis Pharmaceuticals, Inc. | Phosphorothioate oligonucleotides having modified internucleoside linkages |
| US6077709A (en) | 1998-09-29 | 2000-06-20 | Isis Pharmaceuticals Inc. | Antisense modulation of Survivin expression |
| US6335194B1 (en) | 1998-09-29 | 2002-01-01 | Isis Pharmaceuticals, Inc. | Antisense modulation of survivin expression |
| CN1273478C (en) | 1999-02-12 | 2006-09-06 | 三共株式会社 | Novel nucleosides and oligonucleotide analogues |
| US6656730B1 (en) | 1999-06-15 | 2003-12-02 | Isis Pharmaceuticals, Inc. | Oligonucleotides conjugated to protein-binding drugs |
| JP4151751B2 (en) * | 1999-07-22 | 2008-09-17 | 第一三共株式会社 | New bicyclonucleoside analogues |
| US6147200A (en) * | 1999-08-19 | 2000-11-14 | Isis Pharmaceuticals, Inc. | 2'-O-acetamido modified monomers and oligomers |
| AU2001276691A1 (en) * | 2000-08-03 | 2002-02-18 | Matsushita Electric Industrial Co., Ltd. | Brushless motor and method of manufacturing the brushless motor |
| US20030096770A1 (en) * | 2001-07-11 | 2003-05-22 | Krotz Achim H. | Enhancement of the stability of oligonucleotides comprising phosphorothioate linkages by addition of water-soluble antioxidants |
| SI1446162T1 (en) | 2001-08-17 | 2009-04-30 | Coley Pharm Gmbh | Combination motif immune stimulatory oligonucleotides with improved activity |
| DK1470144T3 (en) | 2002-02-01 | 2009-04-06 | Univ Mcgill | Oligonucleotides comprising alternating segments and applications thereof |
| US20030191075A1 (en) * | 2002-02-22 | 2003-10-09 | Cook Phillip Dan | Method of using modified oligonucleotides for hepatic delivery |
| US7569553B2 (en) | 2002-07-03 | 2009-08-04 | Coley Pharmaceutical Group, Inc. | Nucleic acid compositions for stimulating immune responses |
| US7576066B2 (en) | 2002-07-03 | 2009-08-18 | Coley Pharmaceutical Group, Inc. | Nucleic acid compositions for stimulating immune responses |
| US7807803B2 (en) | 2002-07-03 | 2010-10-05 | Coley Pharmaceutical Group, Inc. | Nucleic acid compositions for stimulating immune responses |
| US7605138B2 (en) | 2002-07-03 | 2009-10-20 | Coley Pharmaceutical Group, Inc. | Nucleic acid compositions for stimulating immune responses |
| US20040053880A1 (en) | 2002-07-03 | 2004-03-18 | Coley Pharmaceutical Group, Inc. | Nucleic acid compositions for stimulating immune responses |
| MXPA05004588A (en) | 2002-10-29 | 2005-12-14 | Coley Pharmaceutical Group Ltd | Use of cpg oligonucleotides in the treatment of hepatitis c virus infection. |
| AU2003300919A1 (en) | 2002-12-11 | 2004-06-30 | Coley Pharmaceutical Gmbh | 5' cpg nucleic acids and methods of use |
| US8084432B2 (en) * | 2003-02-13 | 2011-12-27 | Isis Pharmaceuticals, Inc. | Compositions and methods for treatment of pouchitis |
| JP2004283024A (en) * | 2003-03-19 | 2004-10-14 | Junsei Chemical Co Ltd | New antisense oligonucleotide and anti-hiv agent |
| WO2004092407A1 (en) * | 2003-04-17 | 2004-10-28 | Genesis Group Inc. | Pygopus in diagnosis and treatment of cancer |
| AU2004238057B2 (en) * | 2003-05-16 | 2009-09-24 | Universite Laval | CNS chloride modulation and uses thereof |
| US7960355B2 (en) * | 2003-05-23 | 2011-06-14 | Isis Pharmaceuticals, Inc. | Compositions and methods for the modulation of the expression of B7 protein |
| US7897582B2 (en) * | 2003-05-23 | 2011-03-01 | Isis Pharmaceuticals, Inc. | Oligonucleotide compositions and methods for the modulation of the expression of B7 protein |
| CA2540949A1 (en) | 2003-10-30 | 2005-05-12 | Coley Pharmaceutical Gmbh | C-class oligonucleotide analogs with enhanced immunostimulatory potency |
| KR20130008653A (en) | 2003-12-03 | 2013-01-22 | 코다 테라퓨틱스 (엔지) 리미티드 | Antisense compounds targeted to connexins and methods of use thereof |
| US7718382B2 (en) * | 2004-05-14 | 2010-05-18 | Universite Laval | Method for identifying compounds for treatment of pain |
| JP2008509681A (en) * | 2004-06-09 | 2008-04-03 | マクギル・ユニバーシテイ | Polynucleotides encoding the acetylcholine-dependent chloride channel subunit of CENORHABDITISELEGANS |
| MY159370A (en) | 2004-10-20 | 2016-12-30 | Coley Pharm Group Inc | Semi-soft-class immunostimulatory oligonucleotides |
| WO2006134494A2 (en) | 2005-02-03 | 2006-12-21 | Coda Therapeutics Limited | Anti-connexin compounds and therapeutic uses thereof |
| US8101585B2 (en) * | 2006-08-04 | 2012-01-24 | Isis Pharmaceuticals, Inc. | Compositions and methods for the modulation of JNK proteins |
| AU2007283022B2 (en) | 2006-08-08 | 2011-07-28 | Rheinische Friedrich-Wilhelms-Universitat Bonn | Structure and use of 5' phosphate oligonucleotides |
| EP2091557A2 (en) * | 2006-11-15 | 2009-08-26 | Coda Therapeutics, INC. | Improved methods and compositions for wound healing |
| JP5431949B2 (en) | 2006-12-11 | 2014-03-05 | コーダ セラピューティクス， インコーポレイテッド | Anti-connexin polynucleotides as impaired wound healing compositions |
| CA2709153A1 (en) * | 2007-12-11 | 2009-06-18 | Coda Therapeutics, Inc. | Impaired wound healing compositions and treatments |
| JP2011506446A (en) | 2007-12-11 | 2011-03-03 | コーダ セラピューティクス， インコーポレイテッド | Injured wound healing composition and treatment |
| JP2011507862A (en) * | 2007-12-21 | 2011-03-10 | コーダ セラピューティクス， インコーポレイテッド | Use of anti-connexin 43 polynucleotides for the treatment of abnormal or excessive scarring |
| US20110144182A1 (en) * | 2007-12-21 | 2011-06-16 | David Lawrence Becker | Treatment of surgical adhesions |
| US8975237B2 (en) * | 2007-12-21 | 2015-03-10 | Coda Therapeutics, Inc. | Treatment of fibrotic conditions |
| US20110092449A1 (en) * | 2007-12-21 | 2011-04-21 | Bradford James Duft | Treatment of fibrotic conditions |
| US9035037B2 (en) * | 2007-12-21 | 2015-05-19 | Coda Therapeutics, Inc. | Medical devices |
| WO2009085269A2 (en) * | 2007-12-21 | 2009-07-09 | Coda Therapeutics, Inc. | Use of anti-connexin polynucleotides, peptides or antibodies for the treatment of orthopedic conditions |
| US20110038920A1 (en) * | 2008-01-07 | 2011-02-17 | Ryoichi Mori | Wound healing compositions and treatments |
| WO2009141146A1 (en) | 2008-05-21 | 2009-11-26 | Gunther Hartmann | 5' triphosphate oligonucleotide with blunt end and uses thereof |
| WO2009148613A1 (en) * | 2008-06-04 | 2009-12-10 | Coda Therapeutics, Inc. | Treatment of pain with gap junction modulation compounds |
| EP2432499A2 (en) | 2009-05-20 | 2012-03-28 | Schering Corporation | Modulation of pilr receptors to treat microbial infections |
| WO2011084357A1 (en) | 2009-12-17 | 2011-07-14 | Schering Corporation | Modulation of pilr to treat immune disorders |
| EP2508530A1 (en) | 2011-03-28 | 2012-10-10 | Rheinische Friedrich-Wilhelms-Universität Bonn | Purification of triphosphorylated oligonucleotides using capture tags |
| CN111172162A (en) | 2011-04-21 | 2020-05-19 | 葛兰素史克公司 | Modulation of Hepatitis B Virus (HBV) expression |
| JP2015513905A (en) | 2012-03-27 | 2015-05-18 | コーダ セラピューティクス， インコーポレイテッド | Compositions and treatments based on cadherin regulation |
| EP2712870A1 (en) | 2012-09-27 | 2014-04-02 | Rheinische Friedrich-Wilhelms-Universität Bonn | Novel RIG-I ligands and methods for producing them |
| US9156896B2 (en) | 2013-03-15 | 2015-10-13 | Coda Therapeutics, Inc. | Wound healing compositions and treatments |
| EP3868772A1 (en) | 2013-09-30 | 2021-08-25 | Geron Corporation | Phosphorodiamidate backbone linkage for oligonucleotides |
| CN114010788A (en) | 2014-08-22 | 2022-02-08 | 奥克兰联合服务有限公司 | Channel modulators |
| CN107207577B (en) | 2014-09-05 | 2021-11-09 | Rsem有限合伙公司 | Compositions and methods for treating and preventing inflammation |
| CN107636159B (en) | 2015-02-04 | 2022-06-14 | 百时美施贵宝公司 | Method for selecting therapeutic molecules |
| CA2975525A1 (en) | 2015-02-04 | 2016-08-11 | F. Hoffmann-La Roche Ag | Tau antisense oligomers and uses thereof |
| EP3615575A4 (en) | 2017-04-28 | 2021-01-13 | Auckland Uniservices Limited | Methods of treatment and novel constructs |
| WO2019093649A1 (en) | 2017-11-10 | 2019-05-16 | 주식회사 엘지화학 | Novel compound and organic light-emitting element using same |
Family Cites Families (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4959463A (en) * | 1985-10-15 | 1990-09-25 | Genentech, Inc. | Intermediates |
| US4806463A (en) * | 1986-05-23 | 1989-02-21 | Worcester Foundation For Experimental Biology | Inhibition of HTLV-III by exogenous oligonucleotides |
| EP0331939B1 (en) * | 1988-02-16 | 2001-11-14 | Greatbatch Gen-Aid, Ltd | Modified cells having resistance to retroviral infection |
| DE68925278T2 (en) * | 1988-02-26 | 1996-09-19 | Worcester Found Ex Biology | INHIBITION OF HTLV-III BY EXOGENE OLIGONUCLEOTIDES |
| DE3907562A1 (en) * | 1989-03-09 | 1990-09-13 | Bayer Ag | ANTISENSE OLIGONUCLEOTIDS FOR INHIBITING THE TRANSACTIVATOR TARGET SEQUENCE (TAR) AND THE SYNTHESIS OF THE TRANSACTIVATOR PROTEIN (TAT) FROM HIV-1 AND THE USE THEREOF |
| FR2648045B1 (en) * | 1989-06-13 | 1991-09-27 | Centre Nat Rech Scient | ALPHA ANOMERIC OLIGONUCLEOTIDE COMPOUNDS INHIBITING REPLICATION OF RETROVIRUSES |
-
1990
- 1990-05-11 US US07/521,907 patent/US5166195A/en not_active Expired - Lifetime
-
1991
- 1991-04-22 KR KR1019920702823A patent/KR0149680B1/en not_active IP Right Cessation
- 1991-04-22 BR BR919106440A patent/BR9106440A/en not_active Application Discontinuation
- 1991-04-22 HU HU923538A patent/HUT62912A/en unknown
- 1991-04-22 JP JP3509815A patent/JPH0832242B2/en not_active Expired - Lifetime
- 1991-04-22 WO PCT/US1991/002734 patent/WO1991018004A1/en active IP Right Grant
- 1991-04-22 CA CA002082631A patent/CA2082631A1/en not_active Abandoned
- 1991-04-22 DE DE69131422T patent/DE69131422T2/en not_active Expired - Fee Related
- 1991-04-22 AT AT91909892T patent/ATE181960T1/en not_active IP Right Cessation
- 1991-04-22 AU AU78826/91A patent/AU651593B2/en not_active Ceased
- 1991-04-22 EP EP91909892A patent/EP0527916B1/en not_active Expired - Lifetime
-
1992
- 1992-03-18 US US07/852,322 patent/US5591600A/en not_active Expired - Lifetime
- 1992-11-05 NO NO92924258A patent/NO924258L/en unknown
- 1992-11-10 FI FI925103A patent/FI925103A0/en not_active Application Discontinuation
Also Published As
| Publication number | Publication date |
|---|---|
| NO924258D0 (en) | 1992-11-05 |
| WO1991018004A1 (en) | 1991-11-28 |
| AU7882691A (en) | 1991-12-10 |
| KR0149680B1 (en) | 1998-08-17 |
| HUT62912A (en) | 1993-06-28 |
| EP0527916A4 (en) | 1994-04-06 |
| FI925103A (en) | 1992-11-10 |
| HU9203538D0 (en) | 1993-03-29 |
| NO924258L (en) | 1992-11-05 |
| JPH06500005A (en) | 1994-01-06 |
| AU651593B2 (en) | 1994-07-28 |
| DE69131422T2 (en) | 1999-10-28 |
| FI925103A0 (en) | 1992-11-10 |
| US5591600A (en) | 1997-01-07 |
| EP0527916A1 (en) | 1993-02-24 |
| DE69131422D1 (en) | 1999-08-12 |
| EP0527916B1 (en) | 1999-07-07 |
| BR9106440A (en) | 1993-05-18 |
| ATE181960T1 (en) | 1999-07-15 |
| JPH0832242B2 (en) | 1996-03-29 |
| US5166195A (en) | 1992-11-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP0527916B1 (en) | Antisense inhibitors of the human immunodeficiency virus | |
| US6034233A (en) | 2'-O-alkylated oligoribonucleotides and phosphorothioate analogs complementary to portions of the HIV genome | |
| US6107062A (en) | Antisense viruses and antisense-ribozyme viruses | |
| US6368863B1 (en) | Reagents and methods for modulating gene expression through RNA mimicry | |
| NZ257434A (en) | Anti-hiv oligonucleotides having a sequence complementary to at least nucleotides 324-348 of the gag region of hiv-1 and resistance to nuclease digestion and medicaments thereof | |
| JPH09501047A (en) | Antisense oligonucleotides and their use in human immunodeficiency virus infection | |
| AU654816B2 (en) | Modulation of gene expression through interference with RNA secondary structure | |
| US5874564A (en) | Reagents and methods for modulating gene expression through RNA mimicry | |
| Duan et al. | Intracellular inhibition of HIV-1 replication using a dual protein-and RNA-based strategy | |
| US5847096A (en) | DNA constructs encoding CD4 fusion proteins | |
| WO1993005147A1 (en) | Defective interfering hiv particles with chimeric cd4-env | |
| US5866698A (en) | Modulation of gene expression through interference with RNA secondary structure | |
| EP1180167B1 (en) | In vivo selection method for determining inhibitory rna molecules | |
| AU678980B2 (en) | Method of inhibiting viral replication | |
| US5863794A (en) | SV40 viral vectors for targeted integration into cells | |
| EP0707493A1 (en) | Inhibitors and target molecule co-localization | |
| JP2003534012A (en) | Antiviral antisense treatment |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| EEER | Examination request | ||
| FZDE | Discontinued |