CA2125145A1 - Process for immobilizing nucleic acid probes on polystyrene surfaces - Google Patents
Process for immobilizing nucleic acid probes on polystyrene surfacesInfo
- Publication number
- CA2125145A1 CA2125145A1 CA002125145A CA2125145A CA2125145A1 CA 2125145 A1 CA2125145 A1 CA 2125145A1 CA 002125145 A CA002125145 A CA 002125145A CA 2125145 A CA2125145 A CA 2125145A CA 2125145 A1 CA2125145 A1 CA 2125145A1
- Authority
- CA
- Canada
- Prior art keywords
- nucleic acid
- probe
- polymer
- assay
- oligonucleotide
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Abandoned
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6834—Enzymatic or biochemical coupling of nucleic acids to a solid phase
Abstract
Nucleic acid probes are immobilized on polystyrene surfaces such as the wells of microtiter plates for use in solution phase nucleic acid sandwich hybridization assays, particularly those using large branched DNA amplification multimers, by: (a) cleansing the surface by washing it sequentially with a strong acid, a strong base, and water; (b) passively adsorbing a polypeptide having primary amino groups onto the cleansed surface; and (c) covalently bonding the probe to the adsorbed polypeptide via a base-stable bifunctional crosslinking agent; and (d) subjecting the surface to conditions that simulate the hybridization conditions used in the assay.
Description
WO 93/13224 PCr/US92/1 134~
21251~
ACID PROBES ON POLYSTYRENE SURFACES
De~ion Technical Field This invention is in the field of nucleic acid hybridization assays. More specifically, it 10 relates to an improved method for imrnobilizing nucleic acid probes on polystyrenc surfaces for thc purposc of removing analyte nucleic acid from solution.
BackQround Art Commonly owned US 4,868,105 describes a solution phase nucleic acid sandwich hybrid-15 ization assay in which analyte nucleic acid is first hybridized in solution to a labeling probe setand to a capturing probe set in a first vessel. The probe-analyte complex is then transferre d to a sccond vessel tha~ contains a solid-phase-imrnobilized probe that is complementary to a segment of the capturing probes. The segments hybridize to the immobilized probe, thus remov-ing the complex from solution. Having the analyte in the form of an immobilized complex facil-2() itates subsequent scparation steps in the assay. Ultimately, single stranded segments of the label-ing probe set are hybridized to labeled probes, thus permittin~ the analyte-containinP complex to be detected via a signal generated directly or indirectly from the label.
Comrnonly owned European Patent Application (ÉP) 317077 discloses a variation in the assay described in US 4,868,105 in which the signal generated by the labeled probes is amplified.
~5 Thc amplification involves the use of nucleic acid multimers. These multimers are branched polynucleotides that are constructei to have a segment that hybridizes specifically to the analyte nucleic acid or to a nucleic acid (branched or linear) that is bound to the analyte and iterations of a second segment that hybridize specifically to the labeled probe. ~n the assay employing the multimer, the initial steps of hybridizing the analyte to label or amplifler probe sets and capturin~
30 probe sets in a first vessel and transferring the complex to another vessel containing immobilized nucleic acid that will hybridize tO a segment of the capturing probes are followed. The multimer is then hybridized to the irnmobiliæd complex and the labeled probes in turn hybridized to the WO 93/13224 PCr/US92/113~
2~2~
second se~ment iterations on the multimer. Since the multimers provide a large number of sites for label probe attachment, the signal is arnplified.
Commonly owned copending application US Serial No. 558,897, filed 27 July l990, (PCT
W092/02526) describes the preparation of large comb-type branched polynucleotide multimers 5 for use in the above-described solution phase assay. The combs provide greater signal enhancement in the assays than the smaller multimers.
As described in EP 317077, ~vo types of solution phase nucleic acid sandwich hybrid-ization assay formats are employed: a bead assay procedure, and a microtiter dish assay pro-cedure. In practice, the microtiter dish assay is preferred. The procedure for immobilizing the 10 capture probe in the wells of polystyrene microtiter dishes was as follows. Poly-(phenylalanyl-,, lysine) was passively adsorbed onto the surfaces of the wells of the dish. The oligonuc?eotideto be imrnobilized was synthesized by solid state procedures to have a 5' modified cytidi ne (the N4-(~aminocaproyl-2-aminoethyl derivative of cytidine). This oligonucleotide was activated by reacting the modified cytidine with the bifunctional crosslinking agent ethylene glycol bis-15 (succinimydyl succinate) and the activated oligonucleotide was added to the wells and incubated at room temperature. During the incubation, the other functional group of the crosslinking agent reacts with the primary ~mino groups of the adsorbed poly-(phenylalanyl-lysine) to thus imrnobil-ize the oligonucleotide. The wells were then washed with phosphate-buffered saline (PBS), coated with HM buffer (0.1% SDS, 4xSSC, 1 mg/mL sonicated salmon sperm DNA, 1 mg/mL
20 poly-A, l() m~,/mL bovine serum albumin), washed again with PBS, and stored for use. As indicated, the initial hybridization of the analyte to the capturing and amplifying probe sets was carried out in separate wells under basic conditions. Following the hybridization, the solution was neutralized and the neutralized solution transferred to the wells containing the isnmobilized probe. The initial hybridization could not be carried out in the wells containing the immobilized 25 capture probe because the irnmobilized complex was unstable under the hybridization conditions.
The present invention provides several advantages over the above~escribed prior pro-cedure. First, it pemlits the entire assay, including the initial hybridization, tO be carried out in one well. Second, it improves the reproducability of the assay. Finally, in its preferred embodi-ment employing large comb-type multirners, it provides reduced background signal.
;~
:`:
WO 93~13224 Pcr/Us92/l 1343 2 ~ 2 ~ 3 Disclosure of the Invention Onc aspect of the prescnt invention is a process for immobilizing a nucleic acid probe having a first functional group on a polystyrene surface for use in a solution phase nucleic acid sandwich hybridization assay comprising:
S (a) cleansing the polys~,rrene surface by washing it sequcntially with a strong acid.
a strong base and water;
(b) passively adsorbing a polymN having a second functional group(s) onto the poly-styrene surface; and (c) covalently bonding the nucleic acid probe to the adso~d polymer via a base-stablc linkagc.
.~ Another aspect of the invcntion is an article of manufacture for use in a solution phasc nuclcic acid sandwich hybridization assay comprisin~ a polystyrene surface having a polyrncr adsorbed thereon and a nucleic acid probe covalcntly bonded to the polymer via a base-stable linlcage.
Still anothcr æpect of the invention is an improvement in a solution phæe nucleic acid sandwich hybridization assay for detecting the prescnce of an analyte single-stranded nucleic acid in a sample wherein the assay comprises the steps of:
(a) contacting the sample under hybridizing conditions with a set of labeling probes each of which has a first segment that is complementary to the analyte and a second segment that is complementary to a se~ment of a DNA multimer and a set of capture probes each of which has a first segrnent that is complementary to the analyte and a second segment that is comple-mentary to an oligonucleotide immobilized on a polystyrene surface;
(b) contactin~ the product of step (a) under hybridizing conditions with said oligonuc-leotide immobilized on a polystyrene surfacc;
(c) contacting the product of step (b) under hybridization conditions with said multi-mer; and (d) contacting the product of step (c) under hybridization conditions with a labeled oligonucleotide that hybridizes to the multimer and tbc improvernent is the use in step (b) of an oligonucleotide that is immobilized to the polystyrene surface via an adsorbed polymer to which the oligonucleotide is covalently bound via a base-stable linkage.
21251~
ACID PROBES ON POLYSTYRENE SURFACES
De~ion Technical Field This invention is in the field of nucleic acid hybridization assays. More specifically, it 10 relates to an improved method for imrnobilizing nucleic acid probes on polystyrenc surfaces for thc purposc of removing analyte nucleic acid from solution.
BackQround Art Commonly owned US 4,868,105 describes a solution phase nucleic acid sandwich hybrid-15 ization assay in which analyte nucleic acid is first hybridized in solution to a labeling probe setand to a capturing probe set in a first vessel. The probe-analyte complex is then transferre d to a sccond vessel tha~ contains a solid-phase-imrnobilized probe that is complementary to a segment of the capturing probes. The segments hybridize to the immobilized probe, thus remov-ing the complex from solution. Having the analyte in the form of an immobilized complex facil-2() itates subsequent scparation steps in the assay. Ultimately, single stranded segments of the label-ing probe set are hybridized to labeled probes, thus permittin~ the analyte-containinP complex to be detected via a signal generated directly or indirectly from the label.
Comrnonly owned European Patent Application (ÉP) 317077 discloses a variation in the assay described in US 4,868,105 in which the signal generated by the labeled probes is amplified.
~5 Thc amplification involves the use of nucleic acid multimers. These multimers are branched polynucleotides that are constructei to have a segment that hybridizes specifically to the analyte nucleic acid or to a nucleic acid (branched or linear) that is bound to the analyte and iterations of a second segment that hybridize specifically to the labeled probe. ~n the assay employing the multimer, the initial steps of hybridizing the analyte to label or amplifler probe sets and capturin~
30 probe sets in a first vessel and transferring the complex to another vessel containing immobilized nucleic acid that will hybridize tO a segment of the capturing probes are followed. The multimer is then hybridized to the irnmobiliæd complex and the labeled probes in turn hybridized to the WO 93/13224 PCr/US92/113~
2~2~
second se~ment iterations on the multimer. Since the multimers provide a large number of sites for label probe attachment, the signal is arnplified.
Commonly owned copending application US Serial No. 558,897, filed 27 July l990, (PCT
W092/02526) describes the preparation of large comb-type branched polynucleotide multimers 5 for use in the above-described solution phase assay. The combs provide greater signal enhancement in the assays than the smaller multimers.
As described in EP 317077, ~vo types of solution phase nucleic acid sandwich hybrid-ization assay formats are employed: a bead assay procedure, and a microtiter dish assay pro-cedure. In practice, the microtiter dish assay is preferred. The procedure for immobilizing the 10 capture probe in the wells of polystyrene microtiter dishes was as follows. Poly-(phenylalanyl-,, lysine) was passively adsorbed onto the surfaces of the wells of the dish. The oligonuc?eotideto be imrnobilized was synthesized by solid state procedures to have a 5' modified cytidi ne (the N4-(~aminocaproyl-2-aminoethyl derivative of cytidine). This oligonucleotide was activated by reacting the modified cytidine with the bifunctional crosslinking agent ethylene glycol bis-15 (succinimydyl succinate) and the activated oligonucleotide was added to the wells and incubated at room temperature. During the incubation, the other functional group of the crosslinking agent reacts with the primary ~mino groups of the adsorbed poly-(phenylalanyl-lysine) to thus imrnobil-ize the oligonucleotide. The wells were then washed with phosphate-buffered saline (PBS), coated with HM buffer (0.1% SDS, 4xSSC, 1 mg/mL sonicated salmon sperm DNA, 1 mg/mL
20 poly-A, l() m~,/mL bovine serum albumin), washed again with PBS, and stored for use. As indicated, the initial hybridization of the analyte to the capturing and amplifying probe sets was carried out in separate wells under basic conditions. Following the hybridization, the solution was neutralized and the neutralized solution transferred to the wells containing the isnmobilized probe. The initial hybridization could not be carried out in the wells containing the immobilized 25 capture probe because the irnmobilized complex was unstable under the hybridization conditions.
The present invention provides several advantages over the above~escribed prior pro-cedure. First, it pemlits the entire assay, including the initial hybridization, tO be carried out in one well. Second, it improves the reproducability of the assay. Finally, in its preferred embodi-ment employing large comb-type multirners, it provides reduced background signal.
;~
:`:
WO 93~13224 Pcr/Us92/l 1343 2 ~ 2 ~ 3 Disclosure of the Invention Onc aspect of the prescnt invention is a process for immobilizing a nucleic acid probe having a first functional group on a polystyrene surface for use in a solution phase nucleic acid sandwich hybridization assay comprising:
S (a) cleansing the polys~,rrene surface by washing it sequcntially with a strong acid.
a strong base and water;
(b) passively adsorbing a polymN having a second functional group(s) onto the poly-styrene surface; and (c) covalently bonding the nucleic acid probe to the adso~d polymer via a base-stablc linkagc.
.~ Another aspect of the invcntion is an article of manufacture for use in a solution phasc nuclcic acid sandwich hybridization assay comprisin~ a polystyrene surface having a polyrncr adsorbed thereon and a nucleic acid probe covalcntly bonded to the polymer via a base-stable linlcage.
Still anothcr æpect of the invention is an improvement in a solution phæe nucleic acid sandwich hybridization assay for detecting the prescnce of an analyte single-stranded nucleic acid in a sample wherein the assay comprises the steps of:
(a) contacting the sample under hybridizing conditions with a set of labeling probes each of which has a first segment that is complementary to the analyte and a second segment that is complementary to a se~ment of a DNA multimer and a set of capture probes each of which has a first segrnent that is complementary to the analyte and a second segment that is comple-mentary to an oligonucleotide immobilized on a polystyrene surface;
(b) contactin~ the product of step (a) under hybridizing conditions with said oligonuc-leotide immobilized on a polystyrene surfacc;
(c) contacting the product of step (b) under hybridization conditions with said multi-mer; and (d) contacting the product of step (c) under hybridization conditions with a labeled oligonucleotide that hybridizes to the multimer and tbc improvernent is the use in step (b) of an oligonucleotide that is immobilized to the polystyrene surface via an adsorbed polymer to which the oligonucleotide is covalently bound via a base-stable linkage.
Wo 93/13224 - PCr/US92/1 1343 2~2~14S :~
Brief Description of the Drawin~s In the drawings:
Figure 1 is a graph of the results of the experiments described in Example 3.
Figures 2-3 are listings of sequences of segrnents of the probes described in Example 4.
Figure 4 is a graph of the results of the tests described in Example 4.
Modes for Carrvin~ out the lnvention Dcfinitions Thc term "base-stablc" as uscd to charactcrize thc covalcnt linkagcs that arc cmployed in ' this invcntion intcnds linkages Ihat undergo no substantial degradation (e.g., brcakage of covalent bonds due to hydrolysis) when contacted with I N NaOH at tcrnpe~atures in the range of 4 tO
70C or under conditions that are at least as stringent (e.g., sirnulate or arc more stringent) as those used in the hybridization of the probes to the anaiyte in thc solution-phase hyb~idization assay.
The terrn "bifunctional crosslinking agent" intcnds organic molecules that have two f,unc-tional ~roups, one of which is capablc of rcacting with a functional ~roup of thc polymer employed in the invention to forrn a covalent bond between the agent and the polyrner and the other of which is capable of reacting with a functional ~roup on the nucleic acld probe that is to bc inunobilized to form a second covalent bond between the agent and the probe. The result-ing ternary complex comprises the crosslinking agent bound covalently tO both the polymer and the probe via rcaction bctwecn the two functional groups of the agent and functional ~roups on the polymer and the probe. Preferably. the functional ~roups on the polymer and probe are pri-mary amino groups and the functional groups on the agent are selected from those that react with primary amino groups (e,g~. carboxyl, sulfonyl chlonde or aldehyde groups), "Solution phase nucleic acid hybridization assay" intends the assay techniques described and claimed in commonly owned U.S. Patent No. 4,868,105 and EP 317077.
A "modified nuclcotide" intends a nucleotide monomer that may be stably incorporated into a polynucleotide and which has an additional functional group that will react with a func-tional group of the crosslinking agent, wo 93/1322~ Pcr/us92/l 1343 2 ~
A "multimer" intends a branched polynucleo~de that is capable of hybridizing simultan^
eously directly or indircctly to analyte nucleic acid and to a multiplicity of labeled probes. The branching in the multimers is effected through covalent bonds and the multimers are composed of two types of oligonucleotide units that are capable of hybridizing, respectively, to analyte nuc-5 leic acid or nucleic acid hybridized to analyte nucleic acid and to a multiplicity of labeled probes.The composition and preparation of such multimers are desc~ibed in EP 317077 and W092/
02526~ the disclosures of which are incorporated herein by reference.
lmrnobilization of Probe on Polvst,rrene Surface While the following discussion is directed to immobiliztng probes on the surfaces of the weUs of conventional polystyrene microtiter plates, it will be appreciated that the invention meth-odology may be used to immobilize probes on other polystyrene surfaces employed in nucleic acid sandwich hybridizations. such as par~ticlcs (bcads). tubes. filters. columns. and thc likc.
The polystyrene surface is first cleansed by washing it successively ~,vith a strong acid~
15 a strong base~ and aqueous buffer. The acid will normally be a nuneral acid such as hydro-chloric, nitric~ or sulfuric acid at a concentration of 0.1 to 5 N. Hydrochloric acid (1 N) is pre-ferred. The surface ~ill normally be contacted with the acid for I to 60 min (preferably about 15-20 min) at temperatures in the range of 4 to 37C. The acid-treated wells are then washed with a neutral aqueous buffer such as phosphate-buffered saline. The strong base will nonnaUy 20 be an alkali metal hydroxide (e.g., NaOH, KOH) at a concentration of 0.1 to 5 N. Sodium hydroxide (1 N) is preferred. Contact time between the surface and the base will usually be 1 to 60 min, preferably about 15-20 min. The contact temperature will a~ain typically be 4 to 37C. Pollowing the base treatnnent, the surface is a8ain washed with neutral aqueous buffer.
The surface is coated with a polymer, preferably a polypeptide that has a multiplicity of 25 reacive primary anuno groups and which will passively adsorb onto polystyrene. The polypep-ide will typically have an average of about 10% to 100% primary amine containin~ amino acid residues per molecule. The polypeptide may be a naturally occurring protein or a synthetic poly-peptide. The synthetic polypeptide may be homopolymeric (composed of the same amino acid) or copolymeric (composed of two or more anuno acids). Other re~ctive functionalities, such as 30 sulfllydryl or carboxylates, on either natural or synthetic amino acids can be employed. Its mol-4 PCr~US92/1 1343 2 ~ 2 w ~
ecular weight is not critical and will normally be in the range of 5,000 tO 50,000 daltons.
Examples of polypeptides that may be used in this capacity are polylysine, poly(Phe-l,ys), poly(Ala-Glu), casein, and bovine serum albumin. Poly(Phe-Lys) (1:1 mol ratio of phe:lys) having a molecular weight in the range of 30,000 to 60,000 is preferred. The coating is carried out by contacting the clcanscd polystyrene with a ncutral (pH 6-8) aqueous buffcr solution of the polypcptidc. Thc conccntration of polypeptidc in the solution will n~rmally be 0.01 to 10 mg/ml, more usually 0.1 to 1.5 mg/mL. The solution may optionally contain salt up to about SM con-centration. Thc polypcptidc coating stcp will normally bc carricd out at 20C to 65C for 0.5 to 36 hr, prcferably at 25 to 35C for 15 to 20 hr. Following this treatmcnt. the surfacc is washed repeatcdly with a ncu~al aqucous buffer to rcmove any unadsorbed polypeptidc. Option-.~ally, it may bc subjcctcd to conditions (pH, ionic strength, detergent, proteinases2 that simulate or are more stringent than those used in the initial hybridization stcp of the assay to dislodge adsorbcd polypeptidc that would be susccptible to dislodgcment during thc initial hybridization.
The single-stranded oligonuclcotidc probe that is covalcntly bound to the adsorbed poly-peptide may be prcpared by the automated phosphoramidate method dcsc ibed by Warner et al., DNA (1984) 3.401, and purificd according to Sanchcz-Pcscador and Urdea, DNA (1984) 3:339.
They includc a 5'-modified nucleotidc or nonnucleotidc linker that includes a functional group that provides a reactive site by which to couple the oli~onucleotide to the crosslinking agcnt.
A preferred modified nuclcotide is the N4-(6-aminocaproyl-2-aminoethyl) derivative of 5-methyl-cytidinc, described in US 4,868,105. Other modified nucleotides are described in US 4,948,8~2.
The length and base composition of the oligonucleoide probe will depend upon the length and base composition of the nucleic acid sequence tO which it must hybridize. It will norrnally be 15 to 100 nucleotides in length, more usually 20 to 30 nucleotides in length. The 21 base oligo-nucleotide 5'-XCACCACTTTCTCCAAAGAAG3' (described jD EP 317077), and 5'-XCACrrC-ACI~TTCCAAGAG-3', where X represents the N4-(6-aminocaproyl-2-aminoethyl~ deriva-tive of cytidine, have been chosen as standard probe se~uences.
The oligonucleotide is coupled to the base-stable bifunctional crosslinking agent via reac-tion bet~veen the functional group of the 5'-modified nucleotide of the oligonucleotide and one of the functional groups of the crosslinking agent. To avoid COUP1iDg oligonucleotide to both functional groups of the crosslinking agent, the agent is used in large excess (e.g., 50- tO 100(~-:
Wo 93/13224 PCI /US92/1 1343 2~2., ~
fold cxcess). A variety of crosslinking agents may be used as l~ng as the functional criteria of base-stability and reactivity with the oligonucleotide and amino groups of the polypeptidc are met. Examples of suitable crosslinking agents may bc found in Piercc Chcmical Catalog. The conditions of thc coupling rcaction will vary with thc particular agcnt used. Thc prcsently prc-5 fcrred crosslinking agent is bis(sulfosuccinimidyl)suberate. Thc crosslinkin~ agcnt will normallybc dissolvcd in a polar solvcnt or aqueous buffcr, and thc solution addcd to a solution of th c oligonuclcotddc in an aqucous buffcr and the polar solvent. Thc coupling will normally bc carried out at ncutral (6-8) pH, and ternperatures in the rangc of 4C to 25C for about 10 min.
to 18 hr. The resulting oligonucleotidc-crosslinking agent conjugatc (sornctimes referrcd to 10 hcrcin as "acdvated oligonucleotide") may be purified from unreacted stardng materials and ,.~unwantcd reaction products using convcndonal chromatographic procedures.
Thc polypeptide-coated surfacc is then contactcd with a neutral aqueous buffercd solution of the puriffed activatcd oligonucleotide under conditions that p~it the remaining functional group of the crosslinking agent to react with an amino group of the adsorbcd polypeptidc. Typ-ically this coupling rcacdon is carried out using cxccss activated o}igonuclcodde (10- to 100-fold excess is prcferrcd) at 0C to 25C for 0.5 to 18 hr, prcfcrably at 2C to 8C for 8 to 18 hr.
Aftcr this rcaction is complctc. thc surfacc is washcd with an aqueous buffcr to rcmovc unrcacted activatcd oligonuclcotidc from thc surface. At this stagc in thc proccss, the surfacc is coated with adsorbcd polypcptide to which the nucleic acid probe has been covalently bound via thc cross-linking a&cnt. In the casc of standard microtitcr wclls, there will typically be 0~1 to 10 pmoles.
prcfcrably 0.4 to 0.7 pmoles, of immobilized nuclcic acid probe per wcll. At this point. one may optionally "ovcrcouplc" thc plate. by adding additional bifunctional crosslinker to thc surface to rcact with any rcactivc groups rcmaining on thc plate surface.
Whcn thc surface is to bc used in an amplified assay procedure, particularly an assay using thc large comb-typc multimers of W092/02526, it is prcfcrable to subjcct the surface to conditions that sirnulate the conditions (pH, ionic strength, tcmperature, detergcnt) that prevail during thc solution phase hybridization step of the assay. Such trcatrncnt tends to dislodge any polypcptide-oligonucleotide complex that might be dislodged during the solution phase hybridiza-tion. Accordingly, in such instances the surface will be contacted with a mild basic solution con-taining a low concentration of a detergent (e.g.~ 0.1 to 0.5 N NaOH contair~ing 0.01 to 2.0 wt~
WO 93/13224 PCr/US92/1 134~
2:~2~1'1 :3 sodium dodecyl sulfate (SDS)) at 25 to 85C for 10 tO 180 minutes.) After this final treatment~ -the surface is aspirated. The surface is then washed with aqueous buffer. It may be stored in a humidity-controlled environment at 0C to 10C pending use.
S Use of Coated PolystYrene Surfaee ln Solution Phase Hybridization Assasr The eoated polystyrene surfaee is used in solution phase sandwich hybridizations as fol-lows. In the instance where the coated surface is the inner surface of the well of a mierotiter plate, the analyte nucleie aeid is plaeed in the well with an excess of two single-stranded nueleic aeid probe sets: (1) a set of eapture probes, eaeh having a first binding sequence eomplementary to the analyte and a seeond binding scquenee that is complementary to nueleie aeid bound to the ~, well surfaee, and (2) a set of amplifier probes (branehed OI linear), eaeh having a filrst binding sequenee that is eapable of speeific binding to the analyte and a second binding sequence that is eapable of speeific binding to a segment of the multimer. By using an amplifier probe, the multimer may be designed to be a "universal" reagent and different mul~mers need not be made for eaeh analyte. The resulting produet is a tnree eomponent nueleic acid complex of the two probes hybridized to the analyte by their first binding sequenees. The second binding sequences of the probes rem~in as single-stranded segments as they are not complementary to the analyte.
This eomplex hybridizes to the immobilized probe on the well surfaee via the second bindin~
sequenee. The resulting produet eomprises the eomplex bound to the well surface via the duplex formed by the oligonueleotide bound to the well surface and the seeond binding sequenee of the eapture probe. Unbound mateAals are then removed from the surfaee such as by washing.
The amplifieation multimer is then added to the bound complex under hybridization con-ditions to permit the multimer to hybridize to the available seeond binding sequence of the ampli-fier probe of the eomplex. The resulting complex is then separated from any unbound multimer by washing. The labeled oli~onucleotide is then added under conditions which permit it to -.
hybridize to the complementary oligonucleotide units of the multimer. The resulting immobilized labeled nucleic acid complex is then washed to remove unbound labeled oligonucleotide, and read.
The analyte nucleic acids may be from a variety of sources, e.g.. biological fluids or 30 solids, food stuffs, environmental materials, etc., and may be prepared for the hybridization anal-'~
WO 93/13224 PCr/US92/1 1343 2~ 231~
ysis by a variety of means, e.g., proteinase KISDS, chaotropic salts, etc. Also, it may be ofadvantagc to decrease the avcrage size of the analyte nucleic acids by enzymatic, physical or chemical means, e.g., restriction enzymes, sonication, chemical degradation (e.g., metal ions), etc.
The fragmcnts may be as small as 0.1 Kb, usually being at least abou~ 0.5 Kb and may be I Kb 5 or higher. Thc analyte sequencc is provided in single-stranded forrn for analysis. Where the sequence is naturally present in single^stranded form, denaturation may not be requircd. How-ever, where the sequcnce is present in double-stranded form, the sequence will bc denatured.
Denaturation can bc carried out by various techniques, such as aL~cali, generaUy from about 0.05 to 0.2 M hydroxidc, formamide. salts, heat, or combinations thaeof.
The first binding sequcnccs of thc capturc probc and amplificr probc that arc complemcn-tary to thc analyte sequence will each be of at least 15 nuclcotides, usually at least 25 nuclco-tides, and not more than about S Kb, usually not more than about I Kb, prefcrably not morc than about 100 nuclcotides. They will typically bc approximatcly 30 nucleotides. Thcy will norrnally bc choscn to bind to different sequences of the analyte. The first binding sequcnces may be scl-ected based on a variety of considerations. Dcpcnding upon thc nature of the analyte, one may be intcrested in a consensus sequencc, a sequcncc associated with polymolphisms, a particular phcnotypc or gcnotypc, a particular strain, or thc like.
By appropriatc selection of thc first binding sequenccs of the amplificr and capture probcs they may be uscd to identify a spccific nucleic acid molecule that includes a particular gene or other scqucnce that is present as part of different nuclcic acid molecules. In ordcr to discriminate the nucleic acid molecule of interest from other molecules that also contain thc given sequence.
one of the probes is made complcmentary to thc given sequence while the other is madc comple-mcntary to another scquencc of the moleculc which othcr sequcnce is unique to that molccule (i.e., is not prcscnt in the other molecules that contain the given sequence).
The second binding sequences of the capture probe and amplifier probe are selected to be complementary, respectively. to the oligonucleotide branch to the polystyrene surface and to a segment of the multimer and so as to not be encountered by endogenous sequences in the sample/analyte. The second binding sequence may be contiguous tO thei first binding sequence or be spaced therefrom by an intermediate noncomplementary sequence. The probes may include Wo93/13224 - PCl/US92/tl34~
~1~J5~S
other noncomplementary sequences if desired. These noncomplementary sequences must not hinder the binding of the binding sequences or cause nonspecific binding to occur.
The capture probe and amplifier probe may be prepared by oligonucleotide synthesis pro-cedures or by cloning, preferably the former.
It will be appreciated that the binding sequences need not have perfect complementarity to provide homoduplexes. In many situations, heteroduplexes will suffice where fewer than about 10% of the bases are mismatches, ignoring loops of five or more nucleotides. Accordingly, as used herein the term "complementary" intends a de~ree of complernentarity suffieient to provide a stable duplex structure.
The labeled oligonucleotide will include a sequence complementary to the repeated oligo-' nucleotide units of the multimer. The labeled oligonucleotide will include one or more molecules ("labels"), which directly or indirectly provide for a detectable signal. The labels may be bound to individual members of the complementary sequcncc or may be present as a terminal member or terminal tail having a plurality of labels. Various mcans for providing labcls bound to the sequence have been reported in the literature. See, for example, Leary et al., Proc Natl Acad Sci USA (1983) 80:4045: Renz and Kurz, Nuc Acids Res (1984) 12:3435; Richardson and Gumport, Nuc Acids Res (1983) 11:6167; Smith et al., Nuc Acids Res (1985) 13.2399; Meinkoth and Wahl~ Anal Biochem (1984) 138:267. The labels may be bound either covalently or non-covalently to the complementary sequence. Labels which may be employed include radio-nuclides~ fluorescers, chemiluminescers~ dyes, enzymes, enzyme substrates, enzyme cofactors.
enzyme inhibitors, enzyrne subunits. metal ions, and the like. Illustrative specific labels include fluorescein, rhodamine, Texas red, phycoerythrin, unibelliferone, Iuminol, NADPH, -B-~alacto-sidase, horseradish peroxidase, etc.
The ratio of capture probe and amplifier probe to anticipated moles of analyte will each be at least stoichiometric and preferably in excess. This ratio is preferably at least about 1.5:1.
and more preferably at least 2:1. It will norrnally be in the range of 2:1 to 10,000:1. Concentra-tions of each of the probes will generally range from about 10-1 to 10-6 M, with sample nucleic acid concentrations varying from 10-21 to 10 12 M. The hybridization steps of the assay will gen-erally take from about 10 minutes to 2 hours, frequently being completed in about I hour.
.10 -WO 93/13224 PCr/US92/1 1343 ~;S1~3 Hybridization can be carried out at a rnildly elevated temperature, generally in the range from about 20C to 80C, more usually from about 35C to 70C, particularly 65C.
The hybridization reactions are usuaUy done in an aqueous medium, particularly a buf-fcred aqueous medium, which may include various additives. Additives which may be cmployed include low concentrations of detergent (0.1 to 1%), salts, e.g., sodium citratc (0.017 to 0.17 M), , Ficoll, polyvinylpyrrolidine, carrier nucleic acids, caIIier proteins, etc. Nonaqueous solvents may bc addcd to the aqueous medium, such as dimcthylformamide, dimethylsulfoxide, alcohols, and fonnamide. Thcsc othcr solvents will bc prcscnt in amounts ranging from 2 to 50%.
Thc stringcncy of thc hybridization medium may be controlled by temperan~rc, salt con- ;`
ccntration, solvent systcm, and thc like. Thus~ dcpending upon the Icngth and nature of the .sequence of interest, the stringency will be varied.
Dcpending upon ~hc naturc of the label, various techniques can be employed for dctecting thc prcscncc of the label. For fluorescers, a largc number of different fluoromcte~s are available.
For chcmiluminescers, luminometers or films are available. With enzymes, a fluorescent. chemi-lumincscent, or colored product can be provided and determined fluorometrically, luminometric-ally, spectrophotometrically or visually. The various labels which have been employed In immunoassays and the techniques applicable to imrnunoassays can be employed with the subject assays.
The following examples further illustrate the invention. These examples are not intended to lim~t the invcntion in any manner.
Example 1 White Microlite I Rcmovawell strips (polystyrene microtiter plates, 96 wells/plate) were purchascd from Dynatech lnc.
~5 Pre-Wash Each well was filled with 200 ~L 6N HCI and incubated at room temperature for 15-20 min. The plates were then washed 4 times with IX PBS and the wells aspirated to remove liquid. The wells were then filled with 200 uL 6N NaOH and incubated at room temperature for WO 93tl3224 PCr/US92/1 1343 2~251~5 15-20 min. The plates were again washed 4 t~nes with l~C PBS and the wells aspirated to remove liquid.
Poly(Phe-LYs) Coadn~
S Poly(Phe-Lys) was purchased from Sigma Chemicals. lnc. This polypeptide has a 1:1 molar ratio of phe:lys and an average m.w. of 47,900 gll-Jmole. It has an avcrage length of 309 amino acids and contains 155 amines/mole~ 30 mL of a I mg/mL solution of the polypeptide was mixed with 2M NaCl/0.5 x PBS to a final conccntration of 0.1 mg/mL (pH 6.0). 100 pL
of this solution was added to cach wcll. Thc platc was wrapped in plastic to prcvent drying and incubated at 30C ovcrnight. The platc was then washed 4 timcs with IX PBS and thc wdls aspirated to remove liquid.
First StriP~in~ `
200 pL of 0.2 N NaOH containing 0.5 wt% SDS was added to the pol~pcptide-coated wclls. The plate was wrapped in plastic and incubatcd at 65C for I hr. The plate was then washed 4 times with lX PBS and the wells aspirated to remove liquid.
Oli~onucleotide Activadon 50 m~ aliquots of disuccinimidyl suberate (DSS) were each dissolved in 500 ,uL dimethyl-forrnamide (DMF).
26 OD,60 units of the above-described 21-rner oligonucleotide (designated XTl ) in IX
PBS was added to each aliquot of DSS-DMF. The n~ixture was vortexed and incubated at room ~emperature for 30 min. Two NAP25 columns ( 1, 50 ~uL aliquot per 26 OD260) were equilibrated with lX PBS, the DSS-DMF-oligonucleotide rnix was diluted with 2 mL lX PBS, and the diluted mix was loaded quickly onto the columns. The co!umns were allowed to drain and the eluent was discarded. Activated oligonucleotide was eluted from each column with 3.5 mL of IX PBS, collectin,~ the enti~e column into 100 mL lX PBS.
wo 93/1322~ Pcr/US92/l 134~
212~
Couplin~ of Activated Oli~onucleotide tO Polv(Phe-LYs)-Coated Plates 50 ,uL of the activated oligonucleotide-containing eluent was added to each well and the wells were incubated at room temperature for 120 min. The plate was then washed 4 times with ;
lX PBS and the wells aspirated to remove liquid.
S ' '.;''.
Final StriPPin~
200 yL of 0.2N NaOH containing 0.5 wt.% SDS was added to each well. The plate was wrapped in plastic and incubatcd at 65C for 60 min. Thc platc was then washcd 4 timcs with ;`
lX PBS and the wells aspirated to rernove liquid. The stripped plate was storcd with desiccant lû beads at 2-8C.
ExamPle 2 Pre-Wash Microlite I Removawell polystyrene rnicrotitcr plates werc prewashed as in Example 1, cxcept that 1 N HCI and I N NaOH were used.
PolvDePtide Coatin~
The wells were coated as in Example 1. The first stripping step was eliminated.
Oli~onucleotide Activation XTI oligonucleotide was activated as in Examplc l, except that: the molar ratio of DSS
to XTl was 400:1 instead of 1000:1; the buffer and pH used during activation was sodium phos-phate at pH 7.8; the buffer and pH used to quench activation was sodium phosphate at pH 6.5;
and the temperature and buffer used to purify the activated oligonuc!eotide was sodium phosphate 2S atpH 6.5. 4C.
CouplinP Activated Oli~onucleotide to Coated Wells Coupling was carried out as in Example 1, except that the buffer was sodium phosphate, pH 7.8 and the incubation was ovemight.
WO 93/13224 PCr/US92/t 1343 2 ~
Stri~in~
The wells were stripped with 0.2 N NaOH/0.5 wt.% SDS as in Exarnple 1.
`:
Example 3 The immobilization procedures of Examples 1 and 2 were repeated using varying amounts of activated oligonucleotides used in the coupling step. The amounts of oligonucleotide bound to the well surface was determined in each of these experiments. Fig. 1 is a graph showing the results of these cxpcriments. As indicatcd, the procedurc of Examplc 2 rcsults in about 10 timcs morc oligonucleotide bound to thc surface at a ~ivcn amount of activated oli~onucleotide added to the well.
~,:
Exam~le_4 This example illustrates the use of the inYention in an HCV RNA assay and relates the sensitivity of the assay to the amount of probe immobilized on the plate.
Svnthesis of Multimer Used in Assav A "15 x 3" amplified solution phase nucleic acid sandwich hybridization assay was employed in this exarnple. The "15 x 3" designation derives ~rom the fact that the forrnat cmploys a comb-type multirner havin~ a first segment that hybridizes to the amplifier probe and fifteen iterations of a second se~ment that hybridizes to three labeled oligonucleotide probes.
The 15 x 3 comb-type branched oligonuclcotide having tS branch sites and sidechain cxtensions having three labeled oligonucleotide binding sites was synthesized as follows.
All chemical syntheses of oligonucleotides were performed on an automatic l~ A synthe-sizer (Applied Biosystems, lnc., (ABI) model 380 B). Phosphoramidite chemistry of the beta cyanoethyl type was used including 5'-phosphorylation which employed PhostelTM reagent (ABN). Standard ABI protocols were used except as indicated. Where it is indicated that a mul-tiple of a cycle was used (e.g., 1.2 cycle), the multiple of the standard amount of amidite recom-mended by ABI was employed in the specified cycle. Appended hereto are the programs for carrying out cycles 1.2 and 6.4 as run on the Applied Biosystems Model 380 B DI~A Synthe- -30 sizer.
WO 93/13224 P~/U~S92/1 1343 2 ~
A comb body of the fol~owing structure was first prepared: :
3 T, 8( 1 )~ 5G I I I GTGG-s' (RGTCAGTp-5')~ 5 whcrcin X' is a branching monomer, and R is a periodatc cleavable linker.
The portion of the comb body through the 15 I'IX') repeats is first synthesized using , 33.8 mg aminopropyl-derivatized thymidinè con~olled pore glass (CPG) (2000 A, 7.4 15 micromoles thymidine per gram support) with a 1.2 cycle protocol. The branching site nucleotide was of the formula:
I l - N(CH2)6 OR2 H3C~N
o backbone--(~
backbone WO 93/13224 PCr/US92/1 1343 2 ~ 4 S
whcre R2 represents O :'' ~ ~' Il ,.
O
For synthesis of the comb body (not including sidechains), the concentration of be~a cyan-octhylphosphoramidite monomers was 0.1 M for A. C, G and T, 0.15 M for thc branching site -monoma E, and 0.2 M for PhostelTM reagent. Detritylation was done with 3~Yo trichloroacetic acid in methylene chloride using stepped flowthrough for the duration of the deprotection. At 15 the conclusion thc 5' DMT was replaced with an acetyl group.
Clcavable linkcr R and six base sidechain cxtensions of the formula 3'-RGTCAGTp were synthesized at each branching monomer site as follows. Thc base protccting group removal (R2 in the formula above) was performed manually while retaining the CPG support in the same col-umn used for synthesizing the comb body~ ln the case of R2 = levulinyl, a solution of 0.5 M
20 hydrazine hydrate in pyridine/~lacial acetic acid (1:1 v/v) was introducod and kept in contact with the CPG support for 90 min with renewal of the liquid every 15 min, followed by extensive washing with pyridinel~lacial aceic acid (1:1 v/v) and then by acetonitrile. After the deprotec-tion the cleavable linker R and six base sidechain extensions were added using a 6.4 cycle.
ln these syntheses the concentration of phosphoramudites was 0.1 M (except 0.2 M R and '~ PhostelTM reagent; R was 2-(4-(4-(2-Dimethoxyt~ityloxy)ethyl)-phenoxy ~3-di(benzoyloXy)-butaneoxy)phenyl)ethyl-2-cyanoethyl-N,N-diisopropylphosphorarrudite).
Detritylation is effected with a solution of 39c trichloroacetic acid in methylene chloride using continuous flowthrough, followed by a rinse solution of toluene/chloromethane (1:1 v/v).
Branched polynucleotide chains were removed from the solid supports automatically in the 380B
30 using the cycle "CE NH3." The ammonium hydroxide solution was collected in 4 mL screw-capped Wheaton vials and heated at S0C for 12 hr to remove all base-protecting ~roups. After cooling to room temperature the solvent was removed in a Speed-Vac evaporator and the residue .
WO 93/13224 PCl`/US92/1 134~.
2 ~
dissolved in 100 ~L water. 3' backbone extensions (segment A), sidechain ex~nsions and liga-tion template/linkers of the following st.~ctures were also made usin~ thc automatic synthesizer:
3' Backbone extension 3'-TCCGTATCCTGGGCACAGAGGTGCp-5' Sidechain extcnsion 3'-GATGCG(l-rCATGCTGTTGGTGTAG)3-5' Ligation tcmplatc for linking 3' baclcbone ,extension 3'-AAAAAAAAAAGCACCTp-5' Ligadon tem-plate for link-ing sidechain extcnsion 3'-CGCATCACTGAC-5' The crude comb body was purified by a standard polyacrylarrude gel (7% with 7 M urea and Ix TBE running buffer) method.
The 3' backbone extension and the sidechain extensions were ligated to the comb body as follows. The comb body (4 pmoleluL)~ 3' backbone extension (6.25 pmole/~L)~ sidechain extension (93.75 pmolel,uL), sidechain linkin~ template (93.75 pmole/~L), and backbone linkin~
template (5 pmole/yL) wac combincd in I mm ATP/ S mM DTT/ 50 rnM Tlis-HCI. pH 8.0/ 10 mM M~CI,/ 2 mM spennidine, with 0.5 units/pL T4 polynucleotide kinase. The mixture was incubated at 37C for 2 hr, then heated in a watcr bath to 95C, and then slowly cooled to below 35C over a 1 hr period. 2 rnM ATP, 10 mM DTT, l4% polyethylene glycol, and 0.21 units/~L
T4 ligase were added, and the rruxture incubated for 16-24 hr at 23C. The DNA was precipita-ted in NaCI/ethanol~ resuspended in water, and subjected to a second ligation as follows. The mixture was adjusted to I rnrn ATP, 5 rnm DTT, 14% polyethylene glycol, 50 rnM Tris-HCI, pH
7.S, 10 mM MgCI2, 2 mM spermidine, 0.5 units/~L T4 polynucleotide kinase, and 0.21 units/ uL
T4 ligase were added, and the mixture incubated at 23C for 16-24 hr. Ligation products were then purified by polyacrylamide gel electrophoresis.
wo 93/13224 PCr/US9Z/1 1343 .,.
2 ~ ~ ~ 1 1 v Label and Ca~turc Probes Used The amplifier (label) and capnlre probe HCV-specific segments used in this assay were as follows:
S Probcs complementary to nucleo~de sequcnces in the HCV El gene of Group I viral isolates (see ,~
Fi~ure 2A):
ComPlcment of ' Probc T~,rDC Probe Numbcr Nucleotide Numbcrs Lab~,l 27A 879-911 ~,,Labcl 28A 912-944 Capturc 29A 945-977 Label 30A 978-1010 Label 31A 1011^1043 Label 32A 1044-1076 Labcl 33A 1077-1109 Capture 34A 1110-11~2 Labcl 35A 1143-1175 Label 36A 1176-1208 Label 37A 1209-1241 ,.
Label 38A 1242-1274 , Capture 39A 1275-1307 Label 40A 1308-1340 Label 41A 1341^1373 Label 42A 1374-1406 Label 43A 1407-1439 Capnlre 44A 1440-1472 ;
Label 45A 1473-1505 ., .
WO 93/13224 . PCr/US92~1 134~
2 1 ~ 5 Probes complcmentary to nucleotide sequences in t~.e HCV El yene of Group II viral isolates (see Figure 2B~:
ComPlement of Probc TvDe Probe NumberNucleotide Numbers Label 27B 879-911 Label 28B 912-944 Capnlre 29B 945-977 Labcl 30B 978-1010 Label 31B 1011-1043 "Labcl 32B 10441076 Label 33B 1077-1109 Capture 34B 1110-1142 Label 35B 1143-1175 lS Label 36B 1176-1208 Label 37B 1209-1241 Label 38B 1242- 1274 Capture 39B 1275-1307 ~, Label 40B 1308- 1340 Label 41 B 1341 - 1373 Label 42B 1374-1406 Label 43B 1407-1439 Capture 44B 1440-1472 Label 45B 1473-1505 ~5 WO 93/13224 PCr/US92J1 1343 ~i ,.,;ll~
Probes complementary to nucleo~ide sequences in the C ~ene and the S'-un~anslated region (see Figure 3):
Probe TYDe Probe Number Capture HCY.33. 1 S Labcl HCV.33.2 La~l HCV.33.3 Label HCV.33.4 Capn¢c HCV.33.5 Labcl HCV.33.6 10 Label HCV.33.7 ~, La~l HCV.33.8 Capt~e HCV.33.9 La~l HCV.33.10 Labcl HCV.33.11 15 Labcl HCV.33.12 Capn~c HCV.33.13 Labcl HCV.33.14 La~l HCV.33.15 Label HCV.33.16A
20 Labcl HCV.33.16B
Capt~e HCV.33.17 Labcl HCV.33.18 Labcl HCV.33.19 Label HCV.33.20 25 Capt~e HCV.33.21 La~l HCV.33.22 Label HCV.33.23 Label HCV.33.24 Cap~e HCV.33.25 La~l HCV.33.26 wO 93/13221 PCr/US92/l 134~ ~
2 ~ 2 ~
ln the above sets, each capture probe contained, in addi~on to the sequences complementary to the HCV sequences, a downstream sequence complementary to XTI .
AssaY Format S Exlraction buffer of the following range was prepared.
Extraction Buller Ra:lDe - 100 mL
ReciPe for 100 mL:
5.3 mL 1 M Tris-HCl, pH 8 4.24 mL 0.25 M EDTA
.~ 13 mL 10% SDS
l60 ~L 10 mg/mL sssDNA
26.5 rnL 20~X SSC
7 mL Dcionized FomlarT~ide 93 mg Protcinasc K
The Tris, EDTA, SDS, sonicated salmon spcrm DNA and SSC were added to 25 mL de-ionized water and the volume was adjusted to 93 mL with deionized water. The solution was mixed ~ently and the pH was adjusted tô 7.S. The proteinase K was addcd to the solution and 20 mixed until dissolvcd. The solution was incubatcd at 37C in a watcr bath for 3 hr. The solution was cooled to room tempcrature and the formamide was added.
Hybridization buffcr of thc following recipe was made by mixing the contents with restin~
to form a solution.
- 2l -WO 93/13224 - Pcr/uS92/1 134~
2 ~
. :
Hvbrid~zation Buffer Recipe - lL
Rccipe for I Liter:
5 gr Blocking Reagent 10 mL 10% SDS
200 mL 20X SSC
Dl water to I li~er Twenty-five pL each of the capture and label probes were added to 3,000 pL of PK buffer (12 mg proteinase K dissolved in 6 mL of extraction buffer). Fifty pL of this mixnlre was added to the wells of a microtiter plate prepared as in Example 2, foUowcd by the addition of 50 ~L
.~ of the sarnple suspected of containing HCV nucleic acid. The plate is covered with Mylar and incubated at 65C for 16 hr. The plate was then cooled, the Mylar removed, the wells aspiratcd, washed with IX wash buffer (0.1% SDS/0.015 M NaCU0.0015 M sodium citrate) and a~spirated again.
A solution of the multimer (25 fmol/50 ,uL) in hybridization buffer was prepared and 50 ,uL was added to each well. l'he plate was covered with Mylar~ agitated for 30 seconds and incu~
bated at 55C for 30 minutes. The plate was then cooled, the Mylar removed, washed with IX
wash buffer, and aspirated.
The assay was carried out on sPecimens containing, respecively, HCV RNA at 5~ 50, and 500 tipomoles (tm, I tipomole - 602 molecules, or 10 2~ mole) using micro~iter plates prepared as in Example 2 with varying arnounts of immobilized (capture) DNA per well. Sensitivity was characterized as a delta value = (mean - 2 std dev) - (zero ~ 2 std dev). Figure 4 reports the results of these assays~` As indicated, optimum sensitivity for this assay occurs at 0.1 to 1.1 pmoles of immobilized DNA per well.
Example 5 Assays for HBV DNA were carried out using the format described ul Exalmple 4 above and rrucrotiter plates coated as in Exarnple 2 above but using various polypeptide coa~ings. ln these assays, poly(Phe-Lys), casein, Boehringer-Mannheim "blockin~ rea~ent" (#109617fi `
' wo 93/13224 Pcr/uss2/l 1343 2~2~
Boehringer-Mannheim Catalog). poly(Ala-Glu) and poly(Glu-Lys) coated plates exhibited similar perfomlance in the assay.
Exam~le 6 A modified procedure is as follows:
e-Wash White Microlite I Removawell strips (polystyrene microtiter plates, 96 wells/plate) were obtained from Dynatcch Inc. Each well was fillcd with 250 pL 1 N HCl and incubated at room temperaturc for 15-20 min. The plaus werc then fill~d wîth 250 pL 1 N NaOH and incubated st room temperaturc for 15-20 min. Thc platcs wcre then washed 3 times with I x PBS, and the ~,., weDs aspirated to remove liquid.
Polv(Phe-Lvs) Coatin~
Poly(Phe-Lys) (as described above) was mixcd with 2 M NaCI~ lX PBS to a final concen-tration of 0.1 mg/mL (pH 6.0), and 200 ,uL of the rcsulting solution added to each well. The plate was wrapped in plastic to prevent drying, and incubated overni~ht at 30C. The plate was then washed 3 times with IX PBS, and the wells aspirated to remove liquid. ;~
Oli~onucleotide Activation To 250 OD260 units of PSCP (5'-XCACl~CACl~TCmCCAAGAG-3'. where X is ~
(6-arninocaproyl-2-aminoethyl)-5-methylcytidine) in 50 mM sodium phosphate (pH 7.8) was added bis(sulfosuccinimidyl)suberate ("BS3", 180 mg). The n~ixture was vortexed and incubated at room temperature for 30 min. A gel filtradon column (Sephadex(~) G-25, Pharmacia) equil-ibrated with 10 mM sodium phosphate (pH 6.5) was used to purify the activated oli~onucleotide.
The acdvated oligonucleodde reacdon mixture was applied to the column and allowed to filter.
The eluate was collected and saved for use in the ncxt step. The concentration of the eluate was 2S adjusted to 3.7 x lo-2 OD26JmL usin~ 50 mM sodium phosphate (pH 7.8) for dilution.
Couplin~ of Activated Oli~onucleotide to Polv(Ph~-Lvs)-Coated Plates The activated oligonucleotide-containing eluent (l00 ~L) was added to eash well. and the wells incubated at 4C for 12-18 hours. The plate was then washed twice with IX PBS. and the wells aspirated to remove liquid.
Wo 93/13224 PCr/US92/1!343 2 1 ~ rj 1 ~ S ;r Final StriPPin~
NaOH (0.2 N, 250 ,uL) containing 0.1 wt% SDS was added to each well. The plate was wrapped in plastic and incubated at 65C for 60 rnin. The plate was then washed 3 times with lX PBS, and the wdls aspirated to remove liauid.
S Ovcrcou~lin~
Sodium phosphate (50 mM, 100 ,uL, pH 7.8) containing 0.4 mg/rnL BS3 was added tocach well and allowed to incubate with the plate for 12-18 hours. Thc plate was then washed twice with lX PBS and once with watcr. The completed plates were thcn stored in pouches at 4C.
Modifications of the abovc-described modes for carrying out the invcntion that are ., obvious to those of skill in biochen~istry, nucleic acid hybridiza~on assays, and related fields are intended to be within the scope of the following claims.
Brief Description of the Drawin~s In the drawings:
Figure 1 is a graph of the results of the experiments described in Example 3.
Figures 2-3 are listings of sequences of segrnents of the probes described in Example 4.
Figure 4 is a graph of the results of the tests described in Example 4.
Modes for Carrvin~ out the lnvention Dcfinitions Thc term "base-stablc" as uscd to charactcrize thc covalcnt linkagcs that arc cmployed in ' this invcntion intcnds linkages Ihat undergo no substantial degradation (e.g., brcakage of covalent bonds due to hydrolysis) when contacted with I N NaOH at tcrnpe~atures in the range of 4 tO
70C or under conditions that are at least as stringent (e.g., sirnulate or arc more stringent) as those used in the hybridization of the probes to the anaiyte in thc solution-phase hyb~idization assay.
The terrn "bifunctional crosslinking agent" intcnds organic molecules that have two f,unc-tional ~roups, one of which is capablc of rcacting with a functional ~roup of thc polymer employed in the invention to forrn a covalent bond between the agent and the polyrner and the other of which is capable of reacting with a functional ~roup on the nucleic acld probe that is to bc inunobilized to form a second covalent bond between the agent and the probe. The result-ing ternary complex comprises the crosslinking agent bound covalently tO both the polymer and the probe via rcaction bctwecn the two functional groups of the agent and functional ~roups on the polymer and the probe. Preferably. the functional ~roups on the polymer and probe are pri-mary amino groups and the functional groups on the agent are selected from those that react with primary amino groups (e,g~. carboxyl, sulfonyl chlonde or aldehyde groups), "Solution phase nucleic acid hybridization assay" intends the assay techniques described and claimed in commonly owned U.S. Patent No. 4,868,105 and EP 317077.
A "modified nuclcotide" intends a nucleotide monomer that may be stably incorporated into a polynucleotide and which has an additional functional group that will react with a func-tional group of the crosslinking agent, wo 93/1322~ Pcr/us92/l 1343 2 ~
A "multimer" intends a branched polynucleo~de that is capable of hybridizing simultan^
eously directly or indircctly to analyte nucleic acid and to a multiplicity of labeled probes. The branching in the multimers is effected through covalent bonds and the multimers are composed of two types of oligonucleotide units that are capable of hybridizing, respectively, to analyte nuc-5 leic acid or nucleic acid hybridized to analyte nucleic acid and to a multiplicity of labeled probes.The composition and preparation of such multimers are desc~ibed in EP 317077 and W092/
02526~ the disclosures of which are incorporated herein by reference.
lmrnobilization of Probe on Polvst,rrene Surface While the following discussion is directed to immobiliztng probes on the surfaces of the weUs of conventional polystyrene microtiter plates, it will be appreciated that the invention meth-odology may be used to immobilize probes on other polystyrene surfaces employed in nucleic acid sandwich hybridizations. such as par~ticlcs (bcads). tubes. filters. columns. and thc likc.
The polystyrene surface is first cleansed by washing it successively ~,vith a strong acid~
15 a strong base~ and aqueous buffer. The acid will normally be a nuneral acid such as hydro-chloric, nitric~ or sulfuric acid at a concentration of 0.1 to 5 N. Hydrochloric acid (1 N) is pre-ferred. The surface ~ill normally be contacted with the acid for I to 60 min (preferably about 15-20 min) at temperatures in the range of 4 to 37C. The acid-treated wells are then washed with a neutral aqueous buffer such as phosphate-buffered saline. The strong base will nonnaUy 20 be an alkali metal hydroxide (e.g., NaOH, KOH) at a concentration of 0.1 to 5 N. Sodium hydroxide (1 N) is preferred. Contact time between the surface and the base will usually be 1 to 60 min, preferably about 15-20 min. The contact temperature will a~ain typically be 4 to 37C. Pollowing the base treatnnent, the surface is a8ain washed with neutral aqueous buffer.
The surface is coated with a polymer, preferably a polypeptide that has a multiplicity of 25 reacive primary anuno groups and which will passively adsorb onto polystyrene. The polypep-ide will typically have an average of about 10% to 100% primary amine containin~ amino acid residues per molecule. The polypeptide may be a naturally occurring protein or a synthetic poly-peptide. The synthetic polypeptide may be homopolymeric (composed of the same amino acid) or copolymeric (composed of two or more anuno acids). Other re~ctive functionalities, such as 30 sulfllydryl or carboxylates, on either natural or synthetic amino acids can be employed. Its mol-4 PCr~US92/1 1343 2 ~ 2 w ~
ecular weight is not critical and will normally be in the range of 5,000 tO 50,000 daltons.
Examples of polypeptides that may be used in this capacity are polylysine, poly(Phe-l,ys), poly(Ala-Glu), casein, and bovine serum albumin. Poly(Phe-Lys) (1:1 mol ratio of phe:lys) having a molecular weight in the range of 30,000 to 60,000 is preferred. The coating is carried out by contacting the clcanscd polystyrene with a ncutral (pH 6-8) aqueous buffcr solution of the polypcptidc. Thc conccntration of polypeptidc in the solution will n~rmally be 0.01 to 10 mg/ml, more usually 0.1 to 1.5 mg/mL. The solution may optionally contain salt up to about SM con-centration. Thc polypcptidc coating stcp will normally bc carricd out at 20C to 65C for 0.5 to 36 hr, prcferably at 25 to 35C for 15 to 20 hr. Following this treatmcnt. the surfacc is washed repeatcdly with a ncu~al aqucous buffer to rcmove any unadsorbed polypeptidc. Option-.~ally, it may bc subjcctcd to conditions (pH, ionic strength, detergent, proteinases2 that simulate or are more stringent than those used in the initial hybridization stcp of the assay to dislodge adsorbcd polypeptidc that would be susccptible to dislodgcment during thc initial hybridization.
The single-stranded oligonuclcotidc probe that is covalcntly bound to the adsorbed poly-peptide may be prcpared by the automated phosphoramidate method dcsc ibed by Warner et al., DNA (1984) 3.401, and purificd according to Sanchcz-Pcscador and Urdea, DNA (1984) 3:339.
They includc a 5'-modified nucleotidc or nonnucleotidc linker that includes a functional group that provides a reactive site by which to couple the oli~onucleotide to the crosslinking agcnt.
A preferred modified nuclcotide is the N4-(6-aminocaproyl-2-aminoethyl) derivative of 5-methyl-cytidinc, described in US 4,868,105. Other modified nucleotides are described in US 4,948,8~2.
The length and base composition of the oligonucleoide probe will depend upon the length and base composition of the nucleic acid sequence tO which it must hybridize. It will norrnally be 15 to 100 nucleotides in length, more usually 20 to 30 nucleotides in length. The 21 base oligo-nucleotide 5'-XCACCACTTTCTCCAAAGAAG3' (described jD EP 317077), and 5'-XCACrrC-ACI~TTCCAAGAG-3', where X represents the N4-(6-aminocaproyl-2-aminoethyl~ deriva-tive of cytidine, have been chosen as standard probe se~uences.
The oligonucleotide is coupled to the base-stable bifunctional crosslinking agent via reac-tion bet~veen the functional group of the 5'-modified nucleotide of the oligonucleotide and one of the functional groups of the crosslinking agent. To avoid COUP1iDg oligonucleotide to both functional groups of the crosslinking agent, the agent is used in large excess (e.g., 50- tO 100(~-:
Wo 93/13224 PCI /US92/1 1343 2~2., ~
fold cxcess). A variety of crosslinking agents may be used as l~ng as the functional criteria of base-stability and reactivity with the oligonucleotide and amino groups of the polypeptidc are met. Examples of suitable crosslinking agents may bc found in Piercc Chcmical Catalog. The conditions of thc coupling rcaction will vary with thc particular agcnt used. Thc prcsently prc-5 fcrred crosslinking agent is bis(sulfosuccinimidyl)suberate. Thc crosslinkin~ agcnt will normallybc dissolvcd in a polar solvcnt or aqueous buffcr, and thc solution addcd to a solution of th c oligonuclcotddc in an aqucous buffcr and the polar solvent. Thc coupling will normally bc carried out at ncutral (6-8) pH, and ternperatures in the rangc of 4C to 25C for about 10 min.
to 18 hr. The resulting oligonucleotidc-crosslinking agent conjugatc (sornctimes referrcd to 10 hcrcin as "acdvated oligonucleotide") may be purified from unreacted stardng materials and ,.~unwantcd reaction products using convcndonal chromatographic procedures.
Thc polypeptide-coated surfacc is then contactcd with a neutral aqueous buffercd solution of the puriffed activatcd oligonucleotide under conditions that p~it the remaining functional group of the crosslinking agent to react with an amino group of the adsorbcd polypeptidc. Typ-ically this coupling rcacdon is carried out using cxccss activated o}igonuclcodde (10- to 100-fold excess is prcferrcd) at 0C to 25C for 0.5 to 18 hr, prcfcrably at 2C to 8C for 8 to 18 hr.
Aftcr this rcaction is complctc. thc surfacc is washcd with an aqueous buffcr to rcmovc unrcacted activatcd oligonuclcotidc from thc surface. At this stagc in thc proccss, the surfacc is coated with adsorbcd polypcptide to which the nucleic acid probe has been covalently bound via thc cross-linking a&cnt. In the casc of standard microtitcr wclls, there will typically be 0~1 to 10 pmoles.
prcfcrably 0.4 to 0.7 pmoles, of immobilized nuclcic acid probe per wcll. At this point. one may optionally "ovcrcouplc" thc plate. by adding additional bifunctional crosslinker to thc surface to rcact with any rcactivc groups rcmaining on thc plate surface.
Whcn thc surface is to bc used in an amplified assay procedure, particularly an assay using thc large comb-typc multimers of W092/02526, it is prcfcrable to subjcct the surface to conditions that sirnulate the conditions (pH, ionic strength, tcmperature, detergcnt) that prevail during thc solution phase hybridization step of the assay. Such trcatrncnt tends to dislodge any polypcptide-oligonucleotide complex that might be dislodged during the solution phase hybridiza-tion. Accordingly, in such instances the surface will be contacted with a mild basic solution con-taining a low concentration of a detergent (e.g.~ 0.1 to 0.5 N NaOH contair~ing 0.01 to 2.0 wt~
WO 93/13224 PCr/US92/1 134~
2:~2~1'1 :3 sodium dodecyl sulfate (SDS)) at 25 to 85C for 10 tO 180 minutes.) After this final treatment~ -the surface is aspirated. The surface is then washed with aqueous buffer. It may be stored in a humidity-controlled environment at 0C to 10C pending use.
S Use of Coated PolystYrene Surfaee ln Solution Phase Hybridization Assasr The eoated polystyrene surfaee is used in solution phase sandwich hybridizations as fol-lows. In the instance where the coated surface is the inner surface of the well of a mierotiter plate, the analyte nucleie aeid is plaeed in the well with an excess of two single-stranded nueleic aeid probe sets: (1) a set of eapture probes, eaeh having a first binding sequence eomplementary to the analyte and a seeond binding scquenee that is complementary to nueleie aeid bound to the ~, well surfaee, and (2) a set of amplifier probes (branehed OI linear), eaeh having a filrst binding sequenee that is eapable of speeific binding to the analyte and a second binding sequence that is eapable of speeific binding to a segment of the multimer. By using an amplifier probe, the multimer may be designed to be a "universal" reagent and different mul~mers need not be made for eaeh analyte. The resulting produet is a tnree eomponent nueleic acid complex of the two probes hybridized to the analyte by their first binding sequenees. The second binding sequences of the probes rem~in as single-stranded segments as they are not complementary to the analyte.
This eomplex hybridizes to the immobilized probe on the well surfaee via the second bindin~
sequenee. The resulting produet eomprises the eomplex bound to the well surface via the duplex formed by the oligonueleotide bound to the well surface and the seeond binding sequenee of the eapture probe. Unbound mateAals are then removed from the surfaee such as by washing.
The amplifieation multimer is then added to the bound complex under hybridization con-ditions to permit the multimer to hybridize to the available seeond binding sequence of the ampli-fier probe of the eomplex. The resulting complex is then separated from any unbound multimer by washing. The labeled oli~onucleotide is then added under conditions which permit it to -.
hybridize to the complementary oligonucleotide units of the multimer. The resulting immobilized labeled nucleic acid complex is then washed to remove unbound labeled oligonucleotide, and read.
The analyte nucleic acids may be from a variety of sources, e.g.. biological fluids or 30 solids, food stuffs, environmental materials, etc., and may be prepared for the hybridization anal-'~
WO 93/13224 PCr/US92/1 1343 2~ 231~
ysis by a variety of means, e.g., proteinase KISDS, chaotropic salts, etc. Also, it may be ofadvantagc to decrease the avcrage size of the analyte nucleic acids by enzymatic, physical or chemical means, e.g., restriction enzymes, sonication, chemical degradation (e.g., metal ions), etc.
The fragmcnts may be as small as 0.1 Kb, usually being at least abou~ 0.5 Kb and may be I Kb 5 or higher. Thc analyte sequencc is provided in single-stranded forrn for analysis. Where the sequence is naturally present in single^stranded form, denaturation may not be requircd. How-ever, where the sequcnce is present in double-stranded form, the sequence will bc denatured.
Denaturation can bc carried out by various techniques, such as aL~cali, generaUy from about 0.05 to 0.2 M hydroxidc, formamide. salts, heat, or combinations thaeof.
The first binding sequcnccs of thc capturc probc and amplificr probc that arc complemcn-tary to thc analyte sequence will each be of at least 15 nuclcotides, usually at least 25 nuclco-tides, and not more than about S Kb, usually not more than about I Kb, prefcrably not morc than about 100 nuclcotides. They will typically bc approximatcly 30 nucleotides. Thcy will norrnally bc choscn to bind to different sequences of the analyte. The first binding sequcnces may be scl-ected based on a variety of considerations. Dcpcnding upon thc nature of the analyte, one may be intcrested in a consensus sequencc, a sequcncc associated with polymolphisms, a particular phcnotypc or gcnotypc, a particular strain, or thc like.
By appropriatc selection of thc first binding sequenccs of the amplificr and capture probcs they may be uscd to identify a spccific nucleic acid molecule that includes a particular gene or other scqucnce that is present as part of different nuclcic acid molecules. In ordcr to discriminate the nucleic acid molecule of interest from other molecules that also contain thc given sequence.
one of the probes is made complcmentary to thc given sequence while the other is madc comple-mcntary to another scquencc of the moleculc which othcr sequcnce is unique to that molccule (i.e., is not prcscnt in the other molecules that contain the given sequence).
The second binding sequences of the capture probe and amplifier probe are selected to be complementary, respectively. to the oligonucleotide branch to the polystyrene surface and to a segment of the multimer and so as to not be encountered by endogenous sequences in the sample/analyte. The second binding sequence may be contiguous tO thei first binding sequence or be spaced therefrom by an intermediate noncomplementary sequence. The probes may include Wo93/13224 - PCl/US92/tl34~
~1~J5~S
other noncomplementary sequences if desired. These noncomplementary sequences must not hinder the binding of the binding sequences or cause nonspecific binding to occur.
The capture probe and amplifier probe may be prepared by oligonucleotide synthesis pro-cedures or by cloning, preferably the former.
It will be appreciated that the binding sequences need not have perfect complementarity to provide homoduplexes. In many situations, heteroduplexes will suffice where fewer than about 10% of the bases are mismatches, ignoring loops of five or more nucleotides. Accordingly, as used herein the term "complementary" intends a de~ree of complernentarity suffieient to provide a stable duplex structure.
The labeled oligonucleotide will include a sequence complementary to the repeated oligo-' nucleotide units of the multimer. The labeled oligonucleotide will include one or more molecules ("labels"), which directly or indirectly provide for a detectable signal. The labels may be bound to individual members of the complementary sequcncc or may be present as a terminal member or terminal tail having a plurality of labels. Various mcans for providing labcls bound to the sequence have been reported in the literature. See, for example, Leary et al., Proc Natl Acad Sci USA (1983) 80:4045: Renz and Kurz, Nuc Acids Res (1984) 12:3435; Richardson and Gumport, Nuc Acids Res (1983) 11:6167; Smith et al., Nuc Acids Res (1985) 13.2399; Meinkoth and Wahl~ Anal Biochem (1984) 138:267. The labels may be bound either covalently or non-covalently to the complementary sequence. Labels which may be employed include radio-nuclides~ fluorescers, chemiluminescers~ dyes, enzymes, enzyme substrates, enzyme cofactors.
enzyme inhibitors, enzyrne subunits. metal ions, and the like. Illustrative specific labels include fluorescein, rhodamine, Texas red, phycoerythrin, unibelliferone, Iuminol, NADPH, -B-~alacto-sidase, horseradish peroxidase, etc.
The ratio of capture probe and amplifier probe to anticipated moles of analyte will each be at least stoichiometric and preferably in excess. This ratio is preferably at least about 1.5:1.
and more preferably at least 2:1. It will norrnally be in the range of 2:1 to 10,000:1. Concentra-tions of each of the probes will generally range from about 10-1 to 10-6 M, with sample nucleic acid concentrations varying from 10-21 to 10 12 M. The hybridization steps of the assay will gen-erally take from about 10 minutes to 2 hours, frequently being completed in about I hour.
.10 -WO 93/13224 PCr/US92/1 1343 ~;S1~3 Hybridization can be carried out at a rnildly elevated temperature, generally in the range from about 20C to 80C, more usually from about 35C to 70C, particularly 65C.
The hybridization reactions are usuaUy done in an aqueous medium, particularly a buf-fcred aqueous medium, which may include various additives. Additives which may be cmployed include low concentrations of detergent (0.1 to 1%), salts, e.g., sodium citratc (0.017 to 0.17 M), , Ficoll, polyvinylpyrrolidine, carrier nucleic acids, caIIier proteins, etc. Nonaqueous solvents may bc addcd to the aqueous medium, such as dimcthylformamide, dimethylsulfoxide, alcohols, and fonnamide. Thcsc othcr solvents will bc prcscnt in amounts ranging from 2 to 50%.
Thc stringcncy of thc hybridization medium may be controlled by temperan~rc, salt con- ;`
ccntration, solvent systcm, and thc like. Thus~ dcpending upon the Icngth and nature of the .sequence of interest, the stringency will be varied.
Dcpending upon ~hc naturc of the label, various techniques can be employed for dctecting thc prcscncc of the label. For fluorescers, a largc number of different fluoromcte~s are available.
For chcmiluminescers, luminometers or films are available. With enzymes, a fluorescent. chemi-lumincscent, or colored product can be provided and determined fluorometrically, luminometric-ally, spectrophotometrically or visually. The various labels which have been employed In immunoassays and the techniques applicable to imrnunoassays can be employed with the subject assays.
The following examples further illustrate the invention. These examples are not intended to lim~t the invcntion in any manner.
Example 1 White Microlite I Rcmovawell strips (polystyrene microtiter plates, 96 wells/plate) were purchascd from Dynatech lnc.
~5 Pre-Wash Each well was filled with 200 ~L 6N HCI and incubated at room temperature for 15-20 min. The plates were then washed 4 times with IX PBS and the wells aspirated to remove liquid. The wells were then filled with 200 uL 6N NaOH and incubated at room temperature for WO 93tl3224 PCr/US92/1 1343 2~251~5 15-20 min. The plates were again washed 4 t~nes with l~C PBS and the wells aspirated to remove liquid.
Poly(Phe-LYs) Coadn~
S Poly(Phe-Lys) was purchased from Sigma Chemicals. lnc. This polypeptide has a 1:1 molar ratio of phe:lys and an average m.w. of 47,900 gll-Jmole. It has an avcrage length of 309 amino acids and contains 155 amines/mole~ 30 mL of a I mg/mL solution of the polypeptide was mixed with 2M NaCl/0.5 x PBS to a final conccntration of 0.1 mg/mL (pH 6.0). 100 pL
of this solution was added to cach wcll. Thc platc was wrapped in plastic to prcvent drying and incubated at 30C ovcrnight. The platc was then washed 4 timcs with IX PBS and thc wdls aspirated to remove liquid.
First StriP~in~ `
200 pL of 0.2 N NaOH containing 0.5 wt% SDS was added to the pol~pcptide-coated wclls. The plate was wrapped in plastic and incubatcd at 65C for I hr. The plate was then washed 4 times with lX PBS and the wells aspirated to remove liquid.
Oli~onucleotide Activadon 50 m~ aliquots of disuccinimidyl suberate (DSS) were each dissolved in 500 ,uL dimethyl-forrnamide (DMF).
26 OD,60 units of the above-described 21-rner oligonucleotide (designated XTl ) in IX
PBS was added to each aliquot of DSS-DMF. The n~ixture was vortexed and incubated at room ~emperature for 30 min. Two NAP25 columns ( 1, 50 ~uL aliquot per 26 OD260) were equilibrated with lX PBS, the DSS-DMF-oligonucleotide rnix was diluted with 2 mL lX PBS, and the diluted mix was loaded quickly onto the columns. The co!umns were allowed to drain and the eluent was discarded. Activated oligonucleotide was eluted from each column with 3.5 mL of IX PBS, collectin,~ the enti~e column into 100 mL lX PBS.
wo 93/1322~ Pcr/US92/l 134~
212~
Couplin~ of Activated Oli~onucleotide tO Polv(Phe-LYs)-Coated Plates 50 ,uL of the activated oligonucleotide-containing eluent was added to each well and the wells were incubated at room temperature for 120 min. The plate was then washed 4 times with ;
lX PBS and the wells aspirated to remove liquid.
S ' '.;''.
Final StriPPin~
200 yL of 0.2N NaOH containing 0.5 wt.% SDS was added to each well. The plate was wrapped in plastic and incubatcd at 65C for 60 min. Thc platc was then washcd 4 timcs with ;`
lX PBS and the wells aspirated to rernove liquid. The stripped plate was storcd with desiccant lû beads at 2-8C.
ExamPle 2 Pre-Wash Microlite I Removawell polystyrene rnicrotitcr plates werc prewashed as in Example 1, cxcept that 1 N HCI and I N NaOH were used.
PolvDePtide Coatin~
The wells were coated as in Example 1. The first stripping step was eliminated.
Oli~onucleotide Activation XTI oligonucleotide was activated as in Examplc l, except that: the molar ratio of DSS
to XTl was 400:1 instead of 1000:1; the buffer and pH used during activation was sodium phos-phate at pH 7.8; the buffer and pH used to quench activation was sodium phosphate at pH 6.5;
and the temperature and buffer used to purify the activated oligonuc!eotide was sodium phosphate 2S atpH 6.5. 4C.
CouplinP Activated Oli~onucleotide to Coated Wells Coupling was carried out as in Example 1, except that the buffer was sodium phosphate, pH 7.8 and the incubation was ovemight.
WO 93/13224 PCr/US92/t 1343 2 ~
Stri~in~
The wells were stripped with 0.2 N NaOH/0.5 wt.% SDS as in Exarnple 1.
`:
Example 3 The immobilization procedures of Examples 1 and 2 were repeated using varying amounts of activated oligonucleotides used in the coupling step. The amounts of oligonucleotide bound to the well surface was determined in each of these experiments. Fig. 1 is a graph showing the results of these cxpcriments. As indicatcd, the procedurc of Examplc 2 rcsults in about 10 timcs morc oligonucleotide bound to thc surface at a ~ivcn amount of activated oli~onucleotide added to the well.
~,:
Exam~le_4 This example illustrates the use of the inYention in an HCV RNA assay and relates the sensitivity of the assay to the amount of probe immobilized on the plate.
Svnthesis of Multimer Used in Assav A "15 x 3" amplified solution phase nucleic acid sandwich hybridization assay was employed in this exarnple. The "15 x 3" designation derives ~rom the fact that the forrnat cmploys a comb-type multirner havin~ a first segment that hybridizes to the amplifier probe and fifteen iterations of a second se~ment that hybridizes to three labeled oligonucleotide probes.
The 15 x 3 comb-type branched oligonuclcotide having tS branch sites and sidechain cxtensions having three labeled oligonucleotide binding sites was synthesized as follows.
All chemical syntheses of oligonucleotides were performed on an automatic l~ A synthe-sizer (Applied Biosystems, lnc., (ABI) model 380 B). Phosphoramidite chemistry of the beta cyanoethyl type was used including 5'-phosphorylation which employed PhostelTM reagent (ABN). Standard ABI protocols were used except as indicated. Where it is indicated that a mul-tiple of a cycle was used (e.g., 1.2 cycle), the multiple of the standard amount of amidite recom-mended by ABI was employed in the specified cycle. Appended hereto are the programs for carrying out cycles 1.2 and 6.4 as run on the Applied Biosystems Model 380 B DI~A Synthe- -30 sizer.
WO 93/13224 P~/U~S92/1 1343 2 ~
A comb body of the fol~owing structure was first prepared: :
3 T, 8( 1 )~ 5G I I I GTGG-s' (RGTCAGTp-5')~ 5 whcrcin X' is a branching monomer, and R is a periodatc cleavable linker.
The portion of the comb body through the 15 I'IX') repeats is first synthesized using , 33.8 mg aminopropyl-derivatized thymidinè con~olled pore glass (CPG) (2000 A, 7.4 15 micromoles thymidine per gram support) with a 1.2 cycle protocol. The branching site nucleotide was of the formula:
I l - N(CH2)6 OR2 H3C~N
o backbone--(~
backbone WO 93/13224 PCr/US92/1 1343 2 ~ 4 S
whcre R2 represents O :'' ~ ~' Il ,.
O
For synthesis of the comb body (not including sidechains), the concentration of be~a cyan-octhylphosphoramidite monomers was 0.1 M for A. C, G and T, 0.15 M for thc branching site -monoma E, and 0.2 M for PhostelTM reagent. Detritylation was done with 3~Yo trichloroacetic acid in methylene chloride using stepped flowthrough for the duration of the deprotection. At 15 the conclusion thc 5' DMT was replaced with an acetyl group.
Clcavable linkcr R and six base sidechain cxtensions of the formula 3'-RGTCAGTp were synthesized at each branching monomer site as follows. Thc base protccting group removal (R2 in the formula above) was performed manually while retaining the CPG support in the same col-umn used for synthesizing the comb body~ ln the case of R2 = levulinyl, a solution of 0.5 M
20 hydrazine hydrate in pyridine/~lacial acetic acid (1:1 v/v) was introducod and kept in contact with the CPG support for 90 min with renewal of the liquid every 15 min, followed by extensive washing with pyridinel~lacial aceic acid (1:1 v/v) and then by acetonitrile. After the deprotec-tion the cleavable linker R and six base sidechain extensions were added using a 6.4 cycle.
ln these syntheses the concentration of phosphoramudites was 0.1 M (except 0.2 M R and '~ PhostelTM reagent; R was 2-(4-(4-(2-Dimethoxyt~ityloxy)ethyl)-phenoxy ~3-di(benzoyloXy)-butaneoxy)phenyl)ethyl-2-cyanoethyl-N,N-diisopropylphosphorarrudite).
Detritylation is effected with a solution of 39c trichloroacetic acid in methylene chloride using continuous flowthrough, followed by a rinse solution of toluene/chloromethane (1:1 v/v).
Branched polynucleotide chains were removed from the solid supports automatically in the 380B
30 using the cycle "CE NH3." The ammonium hydroxide solution was collected in 4 mL screw-capped Wheaton vials and heated at S0C for 12 hr to remove all base-protecting ~roups. After cooling to room temperature the solvent was removed in a Speed-Vac evaporator and the residue .
WO 93/13224 PCl`/US92/1 134~.
2 ~
dissolved in 100 ~L water. 3' backbone extensions (segment A), sidechain ex~nsions and liga-tion template/linkers of the following st.~ctures were also made usin~ thc automatic synthesizer:
3' Backbone extension 3'-TCCGTATCCTGGGCACAGAGGTGCp-5' Sidechain extcnsion 3'-GATGCG(l-rCATGCTGTTGGTGTAG)3-5' Ligation tcmplatc for linking 3' baclcbone ,extension 3'-AAAAAAAAAAGCACCTp-5' Ligadon tem-plate for link-ing sidechain extcnsion 3'-CGCATCACTGAC-5' The crude comb body was purified by a standard polyacrylarrude gel (7% with 7 M urea and Ix TBE running buffer) method.
The 3' backbone extension and the sidechain extensions were ligated to the comb body as follows. The comb body (4 pmoleluL)~ 3' backbone extension (6.25 pmole/~L)~ sidechain extension (93.75 pmolel,uL), sidechain linkin~ template (93.75 pmole/~L), and backbone linkin~
template (5 pmole/yL) wac combincd in I mm ATP/ S mM DTT/ 50 rnM Tlis-HCI. pH 8.0/ 10 mM M~CI,/ 2 mM spennidine, with 0.5 units/pL T4 polynucleotide kinase. The mixture was incubated at 37C for 2 hr, then heated in a watcr bath to 95C, and then slowly cooled to below 35C over a 1 hr period. 2 rnM ATP, 10 mM DTT, l4% polyethylene glycol, and 0.21 units/~L
T4 ligase were added, and the rruxture incubated for 16-24 hr at 23C. The DNA was precipita-ted in NaCI/ethanol~ resuspended in water, and subjected to a second ligation as follows. The mixture was adjusted to I rnrn ATP, 5 rnm DTT, 14% polyethylene glycol, 50 rnM Tris-HCI, pH
7.S, 10 mM MgCI2, 2 mM spermidine, 0.5 units/~L T4 polynucleotide kinase, and 0.21 units/ uL
T4 ligase were added, and the mixture incubated at 23C for 16-24 hr. Ligation products were then purified by polyacrylamide gel electrophoresis.
wo 93/13224 PCr/US9Z/1 1343 .,.
2 ~ ~ ~ 1 1 v Label and Ca~turc Probes Used The amplifier (label) and capnlre probe HCV-specific segments used in this assay were as follows:
S Probcs complementary to nucleo~de sequcnces in the HCV El gene of Group I viral isolates (see ,~
Fi~ure 2A):
ComPlcment of ' Probc T~,rDC Probe Numbcr Nucleotide Numbcrs Lab~,l 27A 879-911 ~,,Labcl 28A 912-944 Capturc 29A 945-977 Label 30A 978-1010 Label 31A 1011^1043 Label 32A 1044-1076 Labcl 33A 1077-1109 Capture 34A 1110-11~2 Labcl 35A 1143-1175 Label 36A 1176-1208 Label 37A 1209-1241 ,.
Label 38A 1242-1274 , Capture 39A 1275-1307 Label 40A 1308-1340 Label 41A 1341^1373 Label 42A 1374-1406 Label 43A 1407-1439 Capnlre 44A 1440-1472 ;
Label 45A 1473-1505 ., .
WO 93/13224 . PCr/US92~1 134~
2 1 ~ 5 Probes complcmentary to nucleotide sequences in t~.e HCV El yene of Group II viral isolates (see Figure 2B~:
ComPlement of Probc TvDe Probe NumberNucleotide Numbers Label 27B 879-911 Label 28B 912-944 Capnlre 29B 945-977 Labcl 30B 978-1010 Label 31B 1011-1043 "Labcl 32B 10441076 Label 33B 1077-1109 Capture 34B 1110-1142 Label 35B 1143-1175 lS Label 36B 1176-1208 Label 37B 1209-1241 Label 38B 1242- 1274 Capture 39B 1275-1307 ~, Label 40B 1308- 1340 Label 41 B 1341 - 1373 Label 42B 1374-1406 Label 43B 1407-1439 Capture 44B 1440-1472 Label 45B 1473-1505 ~5 WO 93/13224 PCr/US92J1 1343 ~i ,.,;ll~
Probes complementary to nucleo~ide sequences in the C ~ene and the S'-un~anslated region (see Figure 3):
Probe TYDe Probe Number Capture HCY.33. 1 S Labcl HCV.33.2 La~l HCV.33.3 Label HCV.33.4 Capn¢c HCV.33.5 Labcl HCV.33.6 10 Label HCV.33.7 ~, La~l HCV.33.8 Capt~e HCV.33.9 La~l HCV.33.10 Labcl HCV.33.11 15 Labcl HCV.33.12 Capn~c HCV.33.13 Labcl HCV.33.14 La~l HCV.33.15 Label HCV.33.16A
20 Labcl HCV.33.16B
Capt~e HCV.33.17 Labcl HCV.33.18 Labcl HCV.33.19 Label HCV.33.20 25 Capt~e HCV.33.21 La~l HCV.33.22 Label HCV.33.23 Label HCV.33.24 Cap~e HCV.33.25 La~l HCV.33.26 wO 93/13221 PCr/US92/l 134~ ~
2 ~ 2 ~
ln the above sets, each capture probe contained, in addi~on to the sequences complementary to the HCV sequences, a downstream sequence complementary to XTI .
AssaY Format S Exlraction buffer of the following range was prepared.
Extraction Buller Ra:lDe - 100 mL
ReciPe for 100 mL:
5.3 mL 1 M Tris-HCl, pH 8 4.24 mL 0.25 M EDTA
.~ 13 mL 10% SDS
l60 ~L 10 mg/mL sssDNA
26.5 rnL 20~X SSC
7 mL Dcionized FomlarT~ide 93 mg Protcinasc K
The Tris, EDTA, SDS, sonicated salmon spcrm DNA and SSC were added to 25 mL de-ionized water and the volume was adjusted to 93 mL with deionized water. The solution was mixed ~ently and the pH was adjusted tô 7.S. The proteinase K was addcd to the solution and 20 mixed until dissolvcd. The solution was incubatcd at 37C in a watcr bath for 3 hr. The solution was cooled to room tempcrature and the formamide was added.
Hybridization buffcr of thc following recipe was made by mixing the contents with restin~
to form a solution.
- 2l -WO 93/13224 - Pcr/uS92/1 134~
2 ~
. :
Hvbrid~zation Buffer Recipe - lL
Rccipe for I Liter:
5 gr Blocking Reagent 10 mL 10% SDS
200 mL 20X SSC
Dl water to I li~er Twenty-five pL each of the capture and label probes were added to 3,000 pL of PK buffer (12 mg proteinase K dissolved in 6 mL of extraction buffer). Fifty pL of this mixnlre was added to the wells of a microtiter plate prepared as in Example 2, foUowcd by the addition of 50 ~L
.~ of the sarnple suspected of containing HCV nucleic acid. The plate is covered with Mylar and incubated at 65C for 16 hr. The plate was then cooled, the Mylar removed, the wells aspiratcd, washed with IX wash buffer (0.1% SDS/0.015 M NaCU0.0015 M sodium citrate) and a~spirated again.
A solution of the multimer (25 fmol/50 ,uL) in hybridization buffer was prepared and 50 ,uL was added to each well. l'he plate was covered with Mylar~ agitated for 30 seconds and incu~
bated at 55C for 30 minutes. The plate was then cooled, the Mylar removed, washed with IX
wash buffer, and aspirated.
The assay was carried out on sPecimens containing, respecively, HCV RNA at 5~ 50, and 500 tipomoles (tm, I tipomole - 602 molecules, or 10 2~ mole) using micro~iter plates prepared as in Example 2 with varying arnounts of immobilized (capture) DNA per well. Sensitivity was characterized as a delta value = (mean - 2 std dev) - (zero ~ 2 std dev). Figure 4 reports the results of these assays~` As indicated, optimum sensitivity for this assay occurs at 0.1 to 1.1 pmoles of immobilized DNA per well.
Example 5 Assays for HBV DNA were carried out using the format described ul Exalmple 4 above and rrucrotiter plates coated as in Exarnple 2 above but using various polypeptide coa~ings. ln these assays, poly(Phe-Lys), casein, Boehringer-Mannheim "blockin~ rea~ent" (#109617fi `
' wo 93/13224 Pcr/uss2/l 1343 2~2~
Boehringer-Mannheim Catalog). poly(Ala-Glu) and poly(Glu-Lys) coated plates exhibited similar perfomlance in the assay.
Exam~le 6 A modified procedure is as follows:
e-Wash White Microlite I Removawell strips (polystyrene microtiter plates, 96 wells/plate) were obtained from Dynatcch Inc. Each well was fillcd with 250 pL 1 N HCl and incubated at room temperaturc for 15-20 min. The plaus werc then fill~d wîth 250 pL 1 N NaOH and incubated st room temperaturc for 15-20 min. Thc platcs wcre then washed 3 times with I x PBS, and the ~,., weDs aspirated to remove liquid.
Polv(Phe-Lvs) Coatin~
Poly(Phe-Lys) (as described above) was mixcd with 2 M NaCI~ lX PBS to a final concen-tration of 0.1 mg/mL (pH 6.0), and 200 ,uL of the rcsulting solution added to each well. The plate was wrapped in plastic to prevent drying, and incubated overni~ht at 30C. The plate was then washed 3 times with IX PBS, and the wells aspirated to remove liquid. ;~
Oli~onucleotide Activation To 250 OD260 units of PSCP (5'-XCACl~CACl~TCmCCAAGAG-3'. where X is ~
(6-arninocaproyl-2-aminoethyl)-5-methylcytidine) in 50 mM sodium phosphate (pH 7.8) was added bis(sulfosuccinimidyl)suberate ("BS3", 180 mg). The n~ixture was vortexed and incubated at room temperature for 30 min. A gel filtradon column (Sephadex(~) G-25, Pharmacia) equil-ibrated with 10 mM sodium phosphate (pH 6.5) was used to purify the activated oli~onucleotide.
The acdvated oligonucleodde reacdon mixture was applied to the column and allowed to filter.
The eluate was collected and saved for use in the ncxt step. The concentration of the eluate was 2S adjusted to 3.7 x lo-2 OD26JmL usin~ 50 mM sodium phosphate (pH 7.8) for dilution.
Couplin~ of Activated Oli~onucleotide to Polv(Ph~-Lvs)-Coated Plates The activated oligonucleotide-containing eluent (l00 ~L) was added to eash well. and the wells incubated at 4C for 12-18 hours. The plate was then washed twice with IX PBS. and the wells aspirated to remove liquid.
Wo 93/13224 PCr/US92/1!343 2 1 ~ rj 1 ~ S ;r Final StriPPin~
NaOH (0.2 N, 250 ,uL) containing 0.1 wt% SDS was added to each well. The plate was wrapped in plastic and incubated at 65C for 60 rnin. The plate was then washed 3 times with lX PBS, and the wdls aspirated to remove liauid.
S Ovcrcou~lin~
Sodium phosphate (50 mM, 100 ,uL, pH 7.8) containing 0.4 mg/rnL BS3 was added tocach well and allowed to incubate with the plate for 12-18 hours. Thc plate was then washed twice with lX PBS and once with watcr. The completed plates were thcn stored in pouches at 4C.
Modifications of the abovc-described modes for carrying out the invcntion that are ., obvious to those of skill in biochen~istry, nucleic acid hybridiza~on assays, and related fields are intended to be within the scope of the following claims.
Claims (21)
1. A process for immobilizing a nucleic acid probe having a first functional group on a polystyrene surface for use in a solution phase nucleic acid sandwich hybridization assay com-prising the steps:
(a) cleansing the polystyrene surface by washing it sequentially with a strong acid, a strong base, and water;
(b) passively adsorbing a polymer having second functional groups onto the cleansed polystyrene surface; and (c) covalently bonding the nucleic acid probe to the adsorbed polymer via a base-stable linkage involving said first and second functional groups.
(a) cleansing the polystyrene surface by washing it sequentially with a strong acid, a strong base, and water;
(b) passively adsorbing a polymer having second functional groups onto the cleansed polystyrene surface; and (c) covalently bonding the nucleic acid probe to the adsorbed polymer via a base-stable linkage involving said first and second functional groups.
2. The process of claim 1 wherein said bonding is effected via a bifunctional crosslinking agent.
3. The process of claim 1 wherein the polymer is a polypeptide and the second functional groups arc primary amino groups.
4. The process of claim 1 including the step of (d) subjecting the polymer-nucleic acid probe-coated surface to conditions that at least as stringent as the conditions used in the solution phase sandwich hybridization assay.
5. The process of claim 2 wherein the polymer-nucleic acid probe-coated surface is contacted with a mild base solution containing a low concentration of detergent at 25 to 65°C
for 10 to 180 minutes.
for 10 to 180 minutes.
6. The process of claim 3 wherein the solution is 0.1 to 0.5 N NaOH containing 0.01 to 2 wt% sodium dodecyl sulfate.
7. The process of claim 1 wherein the strong acid is 1 to 10 N HCI and the strong base is 1 to 10 N alkali metal hydroxide.
8. The process of claim 2 wherein the nucleic acid probe is first covalently bound to the crosslinking agent via reaction between the first functional group on the probe and one of the functional groups of the agent to form an activated nucleic acid probe and the activated nucleic acid probe is then covalently bound to the adsorbed polymer via reaction between one of said second functional groups and the other functional group of the agent.
9. The process of claim 8 wherein the nucleic acid probe has a cytidine in which the N4-position is modified to provide said functional group on the probe.
10. The process of claim 2 wherein the polymer is poly(Phe-Lys), the crosslinking agent is disuccinimidyl suberate, and the nucleic acid probe is selected from the group consisting of 5'-XCACCACTTTCTCCAAAGAAG-3' and 5'-XCACTTCACTTTCTTTCCAAGAG-3', where X represents the N4-(6-aminocaproyl-2-aminoethyl) derivative of cytidine.
11. An article of manufacture for use in a solution phase nucleic acid sandwich hybridization assay comprising a polystyrene surface having a polymer adsorbed thereon and a nucleic acid probe covalently bonded to the polymer via a base-stable bifunctional crosslinking agent.
12. The article of manufacture of claim 11 wherein the article is a well of a microtiter plate.
13. The article of manufacture of claim 11 wherein the article is a bead.
14. The article of manufacture of claim 10 wherein there are about 0.1 to 10 pmoles of the probe on the surface.
15. The article of manufacture of claim 12 wherein there are about 0.4 to 0.7 pmoles of the probe in the well surface.
16. The article of manufacture of claim 9 wherein the polymer is poly(Phe-Lys), the crosslinking agent is disuccinimidyl suberate, and the nucleic acid probe is selected from the group consisting of 5'-XCACCACTTTCTCCAAAGAAG-3' and 5'-XCACTTCACTTTCTTTCC-AAGAG-3', where X represents the N4-(6-aminocaproyl-2-aminoethyl) derivative of cytidine.
17. In a solution phase nucleic acid sandwich hybridization assay for detecting the presence of an analyte single-stranded nucleic acid in a sample wherein the assay comprises the steps of:
(a) contacting the sample under hybridizing conditions with a set of labeling probes each of which has a first segment that is complementary to the analyte and a second segment that is complementary to a segment of a DNA multimer and a set of capture probes each of which has a first segment that is complementary to the analyte and a second segment that is complementary to an oligonucleotide immobilized on a polystyrene surface;
(b) contacting he product of step (a) under hybridizing conditions with said oligonucleotide immobilized on a polystyrene surface;
(c) contacting the product of step (b) under hybridization conditions with said multimer; and (d) contacting the product of step (c) under hybridization conditions with a labeled oligonucleotide that hybridizes to the multimer, the improvement wherein the oligonucleotide is immobilized to the polystyrene surface via a polymer adsorbed on the surface to which the oligonucleotide is covalently bound via a base-stable linkage.
(a) contacting the sample under hybridizing conditions with a set of labeling probes each of which has a first segment that is complementary to the analyte and a second segment that is complementary to a segment of a DNA multimer and a set of capture probes each of which has a first segment that is complementary to the analyte and a second segment that is complementary to an oligonucleotide immobilized on a polystyrene surface;
(b) contacting he product of step (a) under hybridizing conditions with said oligonucleotide immobilized on a polystyrene surface;
(c) contacting the product of step (b) under hybridization conditions with said multimer; and (d) contacting the product of step (c) under hybridization conditions with a labeled oligonucleotide that hybridizes to the multimer, the improvement wherein the oligonucleotide is immobilized to the polystyrene surface via a polymer adsorbed on the surface to which the oligonucleotide is covalently bound via a base-stable linkage.
18. The process of claim 17 wherein the bonding is effected via a bifunctional crosslinking agent.
19. The assay of claim 17 wherein the polystyrene surface is a well of a microtiter plate and steps (a) through (d) are carried out in said well.
20. The assay of claim 17 wherein the surface has been subjected to the hybridization conditions of step (a) after oligonucleotide has been immobilized therein and washed prior to carrying out step (a).
21. The assay of claim 18 wherein the polymer is poly(Phe-Lys), the crosslinking agent is disuccinimidyl suberate, and the nucleic acid probe is selected from the group consisting of 5'-XCACCACTTTCTCCAAAGAAG-3' and 5'-XCACTTCACTTTCTTTCCAAGAG-3', where X represents the N4-(6-aminocaproyl-2-aminoethyl) derivative of cytidine.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US07/813,338 US5747244A (en) | 1991-12-23 | 1991-12-23 | Nucleic acid probes immobilized on polystyrene surfaces |
| US07/813,338 | 1991-12-23 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CA2125145A1 true CA2125145A1 (en) | 1993-07-08 |
Family
ID=25212094
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CA002125145A Abandoned CA2125145A1 (en) | 1991-12-23 | 1992-12-22 | Process for immobilizing nucleic acid probes on polystyrene surfaces |
Country Status (8)
| Country | Link |
|---|---|
| US (2) | US5747244A (en) |
| EP (1) | EP0620864B1 (en) |
| JP (2) | JP3515781B2 (en) |
| AT (1) | ATE191237T1 (en) |
| AU (1) | AU3427693A (en) |
| CA (1) | CA2125145A1 (en) |
| DE (1) | DE69230864T2 (en) |
| WO (1) | WO1993013224A1 (en) |
Families Citing this family (85)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR100361933B1 (en) * | 1993-09-08 | 2003-02-14 | 라 졸라 파마슈티칼 컴파니 | Chemically defined nonpolymeric bonds form the platform molecule and its conjugate |
| US5538848A (en) * | 1994-11-16 | 1996-07-23 | Applied Biosystems Division, Perkin-Elmer Corp. | Method for detecting nucleic acid amplification using self-quenching fluorescence probe |
| US6821727B1 (en) | 1993-11-15 | 2004-11-23 | Applera Corporation | Hybridization assay using self-quenching fluorescence probe |
| US5853974A (en) | 1995-06-07 | 1998-12-29 | Chiron Corporation | Enhancement of alkaline phosphatase with SDS in chemiluminescent substrates |
| US7825237B2 (en) | 1996-05-03 | 2010-11-02 | Applied Biosystems, Llc | Oligonucleotides and analogs labeled with energy transfer dyes |
| US7388092B2 (en) | 1996-05-03 | 2008-06-17 | Applera Corporation | Oligonucleotides and analogs labeled with energy transfer dyes |
| US5945526A (en) | 1996-05-03 | 1999-08-31 | Perkin-Elmer Corporation | Energy transfer dyes with enhanced fluorescence |
| US5863727A (en) * | 1996-05-03 | 1999-01-26 | The Perkin-Elmer Corporation | Energy transfer dyes with enhanced fluorescence |
| US5800996A (en) * | 1996-05-03 | 1998-09-01 | The Perkin Elmer Corporation | Energy transfer dyes with enchanced fluorescence |
| US5837466A (en) * | 1996-12-16 | 1998-11-17 | Vysis, Inc. | Devices and methods for detecting nucleic acid analytes in samples |
| US5958696A (en) * | 1997-07-17 | 1999-09-28 | Boehringer Ingelheim Pharmaceuticals, Inc. | Quantitative solid phase helicase assay |
| AU748022B2 (en) * | 1997-12-12 | 2002-05-30 | Digene Corporation | Universal collection medium |
| JP2002504351A (en) * | 1998-02-19 | 2002-02-12 | エドボテック | Biomolecule staining product and method |
| US6458953B1 (en) * | 1998-12-09 | 2002-10-01 | La Jolla Pharmaceutical Company | Valency platform molecules comprising carbamate linkages |
| US6638714B1 (en) | 1999-02-03 | 2003-10-28 | Ortho-Clinical Diagnostics, Inc. | Oligonucleotide primers for efficient detection of hepatitis C virus (HCV) and methods of use thereof |
| US6623919B1 (en) | 1999-02-03 | 2003-09-23 | Ortho-Clinical Diagnostics, Inc | Oligonucleotide primers for efficient multiplex detection of hepatitis C virus (HCV) and human immunodeficiency virus (HIV) and methods of use thereof |
| CA2376057A1 (en) * | 1999-06-08 | 2000-12-14 | La Jolla Pharmaceutical Company | Valency platform molecules comprising aminooxy groups |
| AU7078200A (en) * | 1999-08-27 | 2001-03-26 | United States Of America, Represented By The Secretary, Department Of Health And Human Services, The | Polypeptides, comprising il-6 ligand-binding receptor domains and related nucleic acids, antibodies, compositions, and methods of use |
| US6358684B1 (en) | 1999-08-27 | 2002-03-19 | Pe Corporation | UV excitable fluorescent energy transfer dyes |
| US6218124B1 (en) | 1999-08-27 | 2001-04-17 | Pe Corporation | Method for detecting oligonucleotides using UV light source |
| US6503736B1 (en) * | 1999-11-12 | 2003-01-07 | BIOMéRIEUX, INC. | Antibodies to crosslinkers and methods for using the same |
| US7109024B2 (en) * | 1999-11-15 | 2006-09-19 | Dr. Chip Biotechnology Inc. | Biomolecule-bound substrates |
| US20040146918A1 (en) * | 2000-02-18 | 2004-07-29 | Weiner Michael L. | Hybrid nucleic acid assembly |
| WO2001072766A1 (en) * | 2000-03-29 | 2001-10-04 | Polyprobe, Inc. | Quality control reagents for nucleic acid microarrays |
| US6951939B2 (en) * | 2000-06-08 | 2005-10-04 | La Jolla Pharmaceutical Company | Multivalent platform molecules comprising high molecular weight polyethylene oxide |
| US7601497B2 (en) | 2000-06-15 | 2009-10-13 | Qiagen Gaithersburg, Inc. | Detection of nucleic acids by target-specific hybrid capture method |
| US7439016B1 (en) | 2000-06-15 | 2008-10-21 | Digene Corporation | Detection of nucleic acids by type-specific hybrid capture method |
| US20030219816A1 (en) * | 2001-07-02 | 2003-11-27 | Keith Solomon | Composite microarray slides |
| WO2002002585A2 (en) * | 2000-07-05 | 2002-01-10 | Cuno, Inc. | Low fluorescence nylon/glass composites for microdiagnostics |
| US6890483B2 (en) * | 2000-07-05 | 2005-05-10 | Cuno Incorporated | Non-luminescent substrate |
| GB0016836D0 (en) | 2000-07-07 | 2000-08-30 | Lee Helen | Improved dipstick assays (1) |
| AU2001292922A1 (en) * | 2000-09-20 | 2002-04-29 | Datascope Investment Corp. | Nucleic acid detection |
| JP2002125688A (en) * | 2000-10-30 | 2002-05-08 | Tosoh Corp | Oligonucleotide for detecting hepatitis c virus in high sensitivity and method for detecting the same |
| US8964604B2 (en) * | 2000-12-26 | 2015-02-24 | Polycom, Inc. | Conference endpoint instructing conference bridge to dial phone number |
| US6927029B2 (en) | 2001-12-03 | 2005-08-09 | Agilent Technologies, Inc. | Surface with tethered polymeric species for binding biomolecules |
| US20040009506A1 (en) * | 2002-03-29 | 2004-01-15 | Genentech, Inc. | Methods and compositions for detection and quantitation of nucleic acid analytes |
| EP1387169B1 (en) * | 2002-08-02 | 2006-05-24 | Sony Deutschland GmbH | Method of attaching hydrophilic species to hydrophilic macromolecules and immobilizing the hydrophilic macromolecules on a hydrophobic surface |
| US20040058886A1 (en) * | 2002-08-08 | 2004-03-25 | Dharmacon, Inc. | Short interfering RNAs having a hairpin structure containing a non-nucleotide loop |
| US20040043478A1 (en) * | 2002-08-29 | 2004-03-04 | Li-Wei Hsu | Plastic slides for the fabrication of biochips |
| US7597936B2 (en) * | 2002-11-26 | 2009-10-06 | University Of Utah Research Foundation | Method of producing a pigmented composite microporous material |
| AU2003293015A1 (en) * | 2002-11-26 | 2004-06-18 | University Of Utah Research Foundation | Microporous materials, methods, and articles for localizing and quantifying analytes |
| US7833714B1 (en) | 2003-04-11 | 2010-11-16 | Affymetrix, Inc. | Combinatorial affinity selection |
| JP5173193B2 (en) * | 2003-11-14 | 2013-03-27 | スリーエム イノベイティブ プロパティズ カンパニー | N-sulfonylaminocarbonyl-containing compound |
| US7169933B2 (en) * | 2003-11-14 | 2007-01-30 | 3M Innovative Properties Company | N-sulfonylaminocarbonyl containing compounds |
| US7423155B2 (en) * | 2003-11-14 | 2008-09-09 | 3M Innovative Properties Company | N-sulfonyldicarboximide containing tethering compounds |
| US7943388B2 (en) * | 2003-11-14 | 2011-05-17 | 3M Innovative Properties Company | Acoustic sensors and methods |
| US7361767B2 (en) * | 2003-11-14 | 2008-04-22 | 3M Innovative Properties Company | N-sulfonyldicarboximide containing tethering compounds |
| US7482122B1 (en) * | 2004-10-19 | 2009-01-27 | Hai Xing Chen | Method of signal enhancement for measurement of nucleic acid sequences |
| US20060147940A1 (en) * | 2004-12-30 | 2006-07-06 | Affymetrix, Inc. | Combinatorial affinity selection |
| US8628918B2 (en) * | 2005-05-09 | 2014-01-14 | Affymetrix, Inc. | Multiplex capture of nucleic acids |
| US8632970B2 (en) | 2005-05-09 | 2014-01-21 | Affymetrix, Inc. | Multiplex capture of nucleic acids |
| ATE502120T1 (en) * | 2005-05-12 | 2011-04-15 | Affymetrix Inc | MULTIPLEX ASSAY FOR BRANCHED CHAIN DNA |
| ES2565670T3 (en) * | 2005-06-20 | 2016-04-06 | Advanced Cell Diagnostics, Inc. | Nucleic acid detection methods in individual cells and identification of rare cells in large populations of heterogeneous cells |
| US7544754B2 (en) | 2005-09-30 | 2009-06-09 | 3M Innovative Properties Company | Crosslinked polymers with amine binding groups |
| US7544756B2 (en) * | 2005-09-30 | 2009-06-09 | 3M Innovative Properties Company | Crosslinked polymers with amine binding groups |
| US7927798B2 (en) * | 2005-10-05 | 2011-04-19 | Panomics, Inc. | Detection of nucleic acids from whole blood |
| US8017360B2 (en) | 2005-11-10 | 2011-09-13 | Panomics, Inc. | Detection of nucleic acids through amplification of surrogate nucleic acids |
| JP2008043332A (en) | 2006-08-17 | 2008-02-28 | Panomics Inc | Quantitative determination of nucleic acid from tissue slide |
| US7492312B2 (en) * | 2006-11-14 | 2009-02-17 | Fam Adly T | Multiplicative mismatched filters for optimum range sidelobe suppression in barker code reception |
| US8080372B2 (en) * | 2007-04-11 | 2011-12-20 | Canon Kabushiki Kaisha | Method for detecting nucleic acid in sample, method for designing probes, system for designing probes therefor |
| EP3136103B1 (en) * | 2007-10-05 | 2018-08-29 | Affymetrix, Inc. | Highly multiplexed assays |
| US20090215050A1 (en) * | 2008-02-22 | 2009-08-27 | Robert Delmar Jenison | Systems and methods for point-of-care amplification and detection of polynucleotides |
| US20090298709A1 (en) * | 2008-05-28 | 2009-12-03 | Affymetrix, Inc. | Assays for determining telomere length and repeated sequence copy number |
| US8288520B2 (en) * | 2008-10-27 | 2012-10-16 | Qiagen Gaithersburg, Inc. | Fast results hybrid capture assay and system |
| EP2385979B1 (en) * | 2009-01-28 | 2017-08-16 | QIAGEN Gaithersburg, Inc. | Sequence-specific large volume sample preparation method and assay |
| US9797000B2 (en) | 2009-05-01 | 2017-10-24 | Qiagen Gaithersburg Inc. | Non-target amplification method for detection of RNA splice-forms in a sample |
| CA2773320C (en) | 2009-09-14 | 2018-02-20 | Qiagen Gaithersburg, Inc. | Compositions and methods for recovery of nucleic acids or proteins from tissue samples fixed in cytology media |
| WO2011038403A1 (en) | 2009-09-28 | 2011-03-31 | Yuling Luo | Methods of detecting nucleic acid sequences with high specificity |
| AU2011210748A1 (en) | 2010-01-29 | 2012-08-09 | Qiagen Gaithersburg, Inc. | Method of determining and confirming the presence of HPV in a sample |
| WO2011094514A1 (en) * | 2010-01-29 | 2011-08-04 | Qiagen Gaithersburg, Inc. | Methods and compositions for sequence-specific purification and multiplex analysis of nucleic acids |
| EP2572001A2 (en) | 2010-05-19 | 2013-03-27 | QIAGEN Gaithersburg, Inc. | Methods and compositions for sequence-specific purification and multiplex analysis of nucleic acids |
| ES2562821T3 (en) | 2010-10-21 | 2016-03-08 | Advanced Cell Diagnostics, Inc. | Ultrasensitive method for in situ detection of nucleic acids |
| US9885092B2 (en) | 2011-02-24 | 2018-02-06 | Qiagen Gaithersburg Inc. | Materials and methods for detection of HPV nucleic acids |
| AT512416B1 (en) | 2012-02-13 | 2013-10-15 | Greiner Bio One Gmbh | ARRANGEMENT AND METHOD FOR DETECTING MICROORGANISMS IN A CULTURAL VESSEL |
| US9783841B2 (en) | 2012-10-04 | 2017-10-10 | The Board Of Trustees Of The Leland Stanford Junior University | Detection of target nucleic acids in a cellular sample |
| US9273349B2 (en) | 2013-03-14 | 2016-03-01 | Affymetrix, Inc. | Detection of nucleic acids |
| JP6734011B2 (en) * | 2014-06-06 | 2020-08-05 | 古河電気工業株式会社 | Biomolecule detection test kit, biomolecule detection method using the same, biomolecule detection test piece and biomolecule detection labeling reagent used therein |
| CN104569383A (en) * | 2015-01-13 | 2015-04-29 | 科蒂亚(新乡)生物技术有限公司 | Method for coating polyethylene microwell plate with nucleic acid |
| EP3913068B1 (en) | 2015-10-12 | 2023-08-02 | Advanced Cell Diagnostics, Inc. | In situ detection of nucleotide variants in high noise samples, and compositions and methods related thereto |
| USD825184S1 (en) | 2017-02-22 | 2018-08-14 | Yeti Coolers, Llc | Bag |
| CA3054439A1 (en) | 2017-03-08 | 2018-09-13 | Yeti Coolers, Llc | Container with magnetic closure |
| US10954055B2 (en) | 2017-03-08 | 2021-03-23 | Yeti Coolers, Llc | Container with magnetic closure |
| US11076666B2 (en) | 2017-03-08 | 2021-08-03 | Yeti Coolers, Llc | Container with magnetic closure |
| USD909063S1 (en) | 2019-03-08 | 2021-02-02 | Yeti Coolers, Llc | Bag |
| WO2022076500A1 (en) | 2020-10-08 | 2022-04-14 | Ecolab Usa Inc. | System and technique for detecting cleaning chemical usage to control cleaning efficacy |
Family Cites Families (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP0134307B1 (en) * | 1983-07-29 | 1989-04-19 | Henning Berlin GmbH Chemie und Pharmawerk | Preactivated surfaces of synthetic materials for immobilizing organochemical and biological substances, process for preparing them and their use |
| US4748111A (en) * | 1984-03-12 | 1988-05-31 | Molecular Diagnostics, Inc. | Nucleic acid-protein conjugate used in immunoassay |
| US4657853A (en) * | 1984-09-14 | 1987-04-14 | E. I. Du Pont De Nemours And Company | Immunoassays utilizing covalent conjugates of polymerized enzyme and antibody |
| DE3524451A1 (en) * | 1985-07-09 | 1987-03-12 | Behringwerke Ag | Article for use in immunoassay coated with polymer |
| US4868105A (en) * | 1985-12-11 | 1989-09-19 | Chiron Corporation | Solution phase nucleic acid sandwich assay |
| US5124246A (en) * | 1987-10-15 | 1992-06-23 | Chiron Corporation | Nucleic acid multimers and amplified nucleic acid hybridization assays using same |
| CA1339351C (en) * | 1987-10-15 | 1997-08-26 | Michael S. Urdea | Nucleic acid multimers and amplified nucleic acid hybridization assays using same |
| CA2031659A1 (en) * | 1990-01-26 | 1991-07-27 | John B. Findlay | Water-insoluble reagent, nucleic acid probe, test kit and diagnostic and purification methods |
| EP0745689A3 (en) * | 1990-05-11 | 1996-12-11 | Microprobe Corporation | A dipstick for a nucleic acid hybridization assay |
-
1991
- 1991-12-23 US US07/813,338 patent/US5747244A/en not_active Expired - Lifetime
-
1992
- 1992-12-22 AT AT93902855T patent/ATE191237T1/en not_active IP Right Cessation
- 1992-12-22 EP EP93902855A patent/EP0620864B1/en not_active Expired - Lifetime
- 1992-12-22 DE DE69230864T patent/DE69230864T2/en not_active Expired - Lifetime
- 1992-12-22 WO PCT/US1992/011343 patent/WO1993013224A1/en active IP Right Grant
- 1992-12-22 AU AU34276/93A patent/AU3427693A/en not_active Abandoned
- 1992-12-22 CA CA002125145A patent/CA2125145A1/en not_active Abandoned
- 1992-12-22 JP JP51195693A patent/JP3515781B2/en not_active Expired - Fee Related
-
1995
- 1995-05-10 US US08/438,639 patent/US5712383A/en not_active Expired - Lifetime
-
2003
- 2003-05-28 JP JP2003151687A patent/JP2004004087A/en active Pending
Also Published As
| Publication number | Publication date |
|---|---|
| US5712383A (en) | 1998-01-27 |
| US5747244A (en) | 1998-05-05 |
| JP2004004087A (en) | 2004-01-08 |
| JPH07502656A (en) | 1995-03-23 |
| DE69230864T2 (en) | 2000-11-09 |
| WO1993013224A1 (en) | 1993-07-08 |
| AU3427693A (en) | 1993-07-28 |
| JP3515781B2 (en) | 2004-04-05 |
| EP0620864A1 (en) | 1994-10-26 |
| ATE191237T1 (en) | 2000-04-15 |
| DE69230864D1 (en) | 2000-05-04 |
| EP0620864B1 (en) | 2000-03-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CA2125145A1 (en) | Process for immobilizing nucleic acid probes on polystyrene surfaces | |
| AU634969B2 (en) | Method and reagents for detecting nucleic acid sequences | |
| JP2560003B2 (en) | Method for detecting target genetic material | |
| US4868105A (en) | Solution phase nucleic acid sandwich assay | |
| US5702891A (en) | HAV probes for use in solution phase sandwich hybridization and assays for detecting the presence of HAV | |
| JP4714320B2 (en) | Solid phase nucleic acid labeling by transamination | |
| US5849481A (en) | Nucleic acid hybridization assays employing large comb-type branched polynucleotides | |
| US6110676A (en) | Methods for suppressing the binding of detectable probes to non-target sequences in hybridization assays | |
| JP3907201B2 (en) | HIV probe for use in solution phase sandwich hybridization assays | |
| US5510084A (en) | Process for immobilizing a nucleic acid fragment by passive attachment to a solid substrate, the solid substrate thus obtained, and its use | |
| US5736316A (en) | HBV capture and amplifiers probes for use in solution phase sandwich hybridization assays | |
| RU2142467C1 (en) | Polynucleotides, method of preparing thereof, hybridization analysis of nucleic acid | |
| US20070196828A1 (en) | Process for detecting or quantifying more than one nucleic acid in library via terminal attachment of non-inherent universal detection targets to nucleic acid copies produced thereby | |
| JPS62190086A (en) | Molecule effective for detecting nucleic acid sequence | |
| US5702893A (en) | Hydrophobic nucleic acid probe | |
| US5618674A (en) | Chlamydiae probes for use in solution phase sandwich hybridization assays | |
| US6461871B1 (en) | Method for the preparation of a probe for nucleic acid hybridization | |
| JPH05501961A (en) | New pathogen detection method using DNA probes | |
| US6962778B1 (en) | Methods, kits and compositions for suppressing the binding of detectable probes to non-target sequences in hybridization assays | |
| JP3626782B2 (en) | Oligonucleotide and nucleic acid sequence analysis method | |
| US7285401B1 (en) | Method and reagents for detecting nucleic acid sequences | |
| EP0815259B1 (en) | Modulation of the binding properties of nucleic acid binding partners | |
| JPH0959294A (en) | Fluorescence-labeled oligonucleotide | |
| JPH10262675A (en) | Analysis of base sequence of oligonucleotide and nucleic acid |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| EEER | Examination request | ||
| FZDE | Discontinued |