CA2171638C - The semaphorin gene family - Google Patents

Abstract

A novel class of proteins, semaphorins, nucleic acids encoding semaphorins, semaphorin peptides, and methods of using semaphorins and semaphorin-encoding nucleic acids are disclosed. Semaphorin peptides and receptor agonists and antagonists provide potent modulators of nerve cell growth and regeneration. The invention provides pharmaceutical compositions, methods for screening chemical libraries for regulators of cell growth/differentiation; semaphorin gene-derived nucleic acids for use in genetic mapping, as probes for related genes, and as diagnostic reagents for genetic neurological disease; specific cellular and animal systems for the development of neurological disease therapy.

Description

WO 95107706 PCTlIJS94110151 THE SEMAPHGRIN GENE FAMB,Y
The research carried out in the subject application was supported in part by grants from the National Institutes of Wealth. The government may have rights in any patent issuing on this application.
~)DUCTION
Technical Field The technical field of this invention concerns peptides, polypeptides, and polynucleotides involved in nerve cell growth.
Background The specificity of the wiring of the nervous system -- the complex pattern of specific synaptic connections -- begvls to unfold during development as the growing tips of neurons - the growth cones - traverse long distances to find their correct targets. Along their journey, they are confronted by and correctly navigate a series of choice points in a remarkably unerring way to ultimately contact and recognize their correct target.
The identification of growth core guidance cues is to a large extent, the holy grail of neurobiology. These are the compounds that tell neurons when to grow, where to grow, and when to stop growing. The medical applications of such compounds and their antagonists acre enormous and include modulating neuronal growth regenerative capacity, treating neurodegenerative disease, and mapping (e.g. diagnosing) genetic neurological defects.
Over decades of concentrated research, various hypotheses of chemo-attractants and repellent, labeled pathways, cell adhesion molecules, etc.
have been evoked to explain guidance. ~. Recently, several recent lines of experiments suggest repulsion may play an important role in neuron guidance and two apparently unrelated factors ("Neurite Growth Inhibitor" and "Collapsin") capable of inhibiting or collapsing growth cones have been reported.
S
Relevant Literature For a recent review of much of the literature in this field, see Goodman and Shatz (1993) Cell 72/Neuron 10, 77-98. A description of grasshopper fasciclin IV
(now called G-Semaphorin I) appears in Kolodkin et al. (1992) Neuron 9, 831-845.
Recent reports on Collapsin and Neurite Growth Inhibitor include Raper and Kapfhammer (1990) Neuron 4, 21-29, an abstract presented by Raper at the GIBCO-BRL Symposium on "Genes and Development/Function of Brain" on July 26, 1993 and Schwab and Caroni (1988) J Neurosci 8, 2381 and Schnell and Schwab (1990) Nature 343, 269, respectively.
SUMMARY OF THE INVENTION
A novel class of proteins, semaphorins, nucleic acids encoding semaphorins, and methods of using semaphorins and semaphorin-encoding nucleic acids are disclosed. Semaphorins include the first known family of human proteins which function as growth cone inhibitors and a family of proteins involved in viral, particularly pox viral, pathogenesis and oncogenesis. Families of semaphorin-specific receptors, including receptors found on nerve growth cones and immune cells are also disclosed.
The invention provides agents, including semaphorin peptides, which specifically bind semaphorin receptors and agents, including semaphorin receptor peptides, which specifically bind semaphorins. These agents provide potent modulators of nerve cell growth, immune responsiveness and viral pathogenesis and find use in the treatment and diagnosis of neurological disease and neuro-regeneration, immune modulation including hypersensitivity and graft-rejection, and diagnosis and treatment of viral and oncological infection/diseases.
Semaphorins, semaphorin receptors, semaphorin-encoding nucleic acids, and unique portions thereof also find use variously in screening chemical libraries for regulators of semaphorin or semaphorin receptor-mediated cell activity, in 2171638 _ genetic mapping, as probes for related genes, as diagnostic reagents for genetic neurological, immunological and oncological disease and in the production of specific cellular and animal systems for the development of neurological, immunological, oncological and viral disease therapy.
More specifically, then present invention provides an isolated semaphori,n polypeptide comprising the amino acid sequence of any one of SEQ ID NOS: 54, 56, 58, 60, 62 and 64, or a portion thereof, said portion sufficient to provide a semaphorin binding specificity ~~nd comprising a peptide sequence selected from the group consisting of SEQ ID NOS: 1-52 and 67-100, with the proviso that said polypeptide is other than a natural vaccinia o~_ variola major virus open reading frame translation product.
The present invention also provides an isolated semaphorin polypeptide comprising the amino acid sequence of any one of SEQ ID NOS: 54, 60, 62, or 64, or a portion thereof, said portion sufficieni~ to provide a semaphorin binding specificity and comprising a peptide sequence selected from the group consisting of SEQ ID NOS: 1-52 and 67-100, and with the proviso th<~t said peptide sequence is contained within none of SEQ ID NOS: 56, 58 and 66.
The present invention also provides a method of identifying an agent which specifically binds a semaphorin polypeptide, said method comprising the steps of:
contacting a panel of prospective agents with a polypeptide according to the invention disclosed herein;

21 7 163 g ..
measuring the binding of a plurality of said prospective agents to said polypeptide; and identifying from said plur<~lity an agent which specifically binds said polypepi~ide wherein said agent specifically binds a semaphorin polypeptide.
The present invention also provides a method of diagnosing a patient for a predisposition to neurological disease associated with a genetic locus, said method comprising the steps of:
isolating somatic cells from a patient;
isolating genomic DNA from said somatic cells;
contacting said genomic DNA with a probe comprising a DNA sequence encoding a polypepi~ide according to the invention disclosed herein under conditions wherein said probe hybridizes to homologous I~NA; and identifying a region of said genomic DNA which hybridizes with said probe wherein the presence, absence or sequence of said region correlates with a predisposition to a neurological disease.
The present invention also provides use of an isolated semaphorin polypeptide according to the invention disclosed herein for treating a patient with neurological injury or disease or a pathological viral infection, wherein said polypeptide modulates neural cell growth cone function or viral pathogen:icity in said patient.
The present invention also provides use of an isolated semaphorin polypeptide according to the invention - 3a -w 2171638 ..
disclosed herein, for modulating a cell function.
DESCRIPTION OF SPECIFIC EMBODIMENTS
The present invention discloses novel families of proteins important in nerve and immune cell function: the semaphorins and the semaphorin receptors. The invention provides agents, including semaphorin peptides, which specifically bind semaphorin receptors and agents, including semaphorin receptor peptides, which specifically bind semaphorins. These agents find a wide variety of clinical, therapeutic and research uses, esspecially agents which modulate nerve and/or immune cell function by specifically mimicking or interfering with sE~maphorin-receptor binding.
For example, selected semaphorin peptides shown to act as semaphorin receptor antagonists are effective by competitively inhibiting native semaphorin association with cellular receptors. Thus, depending on the targeted receptor, these agents can be used to block semaphorin mediated neural cell growth cone repulsion or contact inhibition. Such agents find broad clinical application where nerve cell growth is indicated, e.g. traumatic injury to nerve cells, neurodegenerative disease, etc. A wide variety of semaphorin- and semaphorin receptor-specific binding agents and methods for identifying, making and using the same are described below.
Binding agents of particular interest are semaphorin peptides which specifically bind and antagonize a semaphorin receptor and semaphorin receptor peptides which - 3b -g.

specifically bind a semaphorin and prevent binding to a native receptor. While exemplified primarily with semaphorin peptides, much of the following description applies analogously to semaphorin receptor peptides.
The semaphorin peptides of the invention comprise a unique portion of a semaphorin and have semaphorin binding specificity. A "unique portion" of a semaphorin has an amino acid sequence unique to that disclosed in that it is not found in any previously known p~_otein. Thus a unique portion has an amino acid sequence lengi~h at least long enough to define a novel peptide. Unique semaphorin portions are found to vary from about 5 to about 25 residues, WO 95107706 2 1 7 1 6 ~ g pCT~S94110151 ,.." preferably from 5 to 10 residues'in length, depending on the particular amino acid sequence. Unique semaphorin portions are readily identified by comparing the subject semaphorin portion sequences with known peptide/protein sequence data bases. Preferred unique portions derive from the semaphorin domains (which exclude the Ig-like, intracellular and trulsmembrane domains as well as the signal sequences) of the disclosed semaphorin sequences, especially regions that bind the semaphorin receptor, especially that of the human varieties. Preferred semaphorin receptor unique portions derive from tt»e semaphorin binding domains, especially regions with residues which contact the: semaphorin ligand, especially that of the human varieties. Particular preferred peptides are further described herein.
The subject peptides may be free or coupled to other atoms or molecules.
Frequently the peptides are present as a portion of a larger polypeptide comprising the subject peptide where the remainder of the polypeptide need not be semaphorin-or semaphorin receptor-derived. Alternatively, the subject peptide may be present as a portion of a "substantially full-length" semaphorin domain or semaphorin receptor sequence which comprises or Encodes at least about 200, preferably at least about 250, more preferably at least about 300 amino acids of a disclosed semaphorinJreceptor sequence. Thus tt~e invention also provides polypeptides comprising a sequence substantially similar to that of a substantially full-length semaphorin domain or a semaphorin receptor. "Substantially similar" sequences share at least about 40 % , more preferably at least about 60 % , and most preferably at least about 80 % sequence identity. Where the sequences diverge, the differences are generally point insertions/deletions or conservative substitutions, i.e. a cysteine/threonine or serine substiitution, an acidic/acidic or hydrophobic/hydrophobic amino acid substitution, etc.
The subject semaphorin peptides/polypeptides are "isolated", meaning unaccompanied by at least some of the material with which they are associated in their natural state. Generally, an isolated peptide/polypeptide constitutes at least about 1 % , preferably at least about 10 ro , and more preferably at least about 50 %
by weight of the total peptide/protein in a given sample. By pure peptide/polypeptide is intended at least ;about 90 % , preferably at least 95 % , and more preferably at least about 99 % by weight of total peptide/protein.
Included in the subject peptide/polypeptide weight are any atoms, molecules, groups, or WO 95!07706 21 7 16 3 8 ~_ PCTIUS94110151 polymers covalently coupled to the subyect s~emaphorin/receptor peptide/polypeptide, especially peptides., proteins; detectable labels, glycosylations, phosphorylations, etc.
The subject peptides/polypeptidEa may be isolated or purified in a variety of ways known to those skilled in the art depending on what other components are present in the sample and to what, if mything, the peptide/polypeptide is covalently linked. Purification methods include electrophoretic, molecular, immunological and chromatographic te~~hniques, especially affinity chromatography and RP-HPLC in the case peptides. For general guidance in suitable purification techniques, see Scopes, R., Protein Purification, Springer-Verlag, NY (1982).
The subject peptideslpolypeptides generally comprise naturally occurring amino acids but D-amino acids or amino acid mimetics coupled by peptide bonds or peptide bond mimetics may also be used. Amino acid mimetics are other than naturally occurring amino acids that conformationally mimic the amino acid for the purpose of the requisite semaphorin/rec;eptor binding specificity. Suitable mimetics are known to those of ordinary skill in the art and include (3-y-b amino and imino acids, cyclohexylalanine, adamantylacetic acid, etc., modifications of the amide nitrogen, the a-carbon, amide carbonyl!, backbone modifications, etc. See, generally, Morgan and Gainor (1989) Ann. Repts. Med. Chem 24, 243-252;
Spatola (1983) Chemistry and Biochemistry of Amino Acids, Peptides and Proteins, Vol VII (Weinstein) and Cho et. al (1993) Science 261, 1303-1305 for the synthesis and screening of oligocafbamates.
The subject semaphorin peptides/polypeptides have a "semaphorin binding specificity" meaning that the subject peptide/polypeptide retains a molecular conformation specific to one or more of the disclosed semaphorins and specifically recognizable by a semaphorin-specific receptor, antibody, etc. As such, a semaphorin binding specificity may be provided by a semaphorin-specific immunological epitope, lectin binding ;site, etc. , and preferably, a receptor binding site. Analogously, the semaphorin receptor peptides/polypeptides have a "semaphorin receptor binding specificity" meaning that these peptides/polypeptides retain a molecular conformation specifiic to one or more of the disclosed semaphorin receptors and specifically recognizable by a semaphorin, a receptor-specific antibody, etc.

wo 9s~o~~o6 21 7 16 3 8 pCT~s94110151 "Specific binding" is empirically determined by contacting, for example a semaphorin-derived peptide with a mixture of components and identifying those components that preferentially bind .the semaphorin. Specific binding is most conveniently shown by competition with labeled ligand using recombinant semaphorin peptide either in vitro or in cellular expression systems as disclosed herein. Generally, specific binding of the subject semaphorin has binding affinity of 10'~M, preferably l~gM, more preferably 10'1°M, under in vitro conditions as exemplified below.
The peptides/polypeptides may be modified or joined to other compounds using physical, chemical, and molecular techniques disclosed or cited herein or otherwise known to those skilled in the relevant art to affect their semaphorin binding specificity or other properties such as solubility, membrane transportability, stability, binding specificity and affinity, chemical reactivity, toxicity, bioavailability, localization, detectability, in vivo half life, etc. as assayed by methods disclosed herein or otherwise known to those of ordinary skill in the art. For example, point mutations are introduced by site directed mutagenesis of nucleotides in the DNA encoding the disclosed semaphorin polypeptides or in the course of in vitro peptide synthesis.
Other modifications to further modulate binding specificity/affinity include chemical/enzymatic intervention (e.g. fatty acid-acylation, proteolysis, glycosylation) and especially where the peptide/polypeptide is integrated into a larger polypeptide, selection of a particular expression host, etc. In particular, many of the disclosed semaphorin peptides contain serine and threonine residues which are phosphorylated or dephosphorylated. See e.g. methods disclosed in Roberts et al. (1991) Science 253, 1022-1026 and in Wegner et al. (1992) Science 256, 370-373. Amino and/or carboxyl termini may be functionalized e.g., for the . amino group, acylation or alkylation, and for the carboxyl group, esterification or amidification, or the like. Many of the disclosed semaphorin peptides/polypeptides also contain glycosylation sites and patterns which may disrupted or modified, e.g.
by enzymes like glycosidases or used to purify/identify the receptor, e.g.
with lectins. For instance, N or O-linked glycosylation sites of the disclosed semaphorin peptides may be deleted or substituted for by another basic amino acid such as Lys or His for N-linked glycosylation alterations, or deletions or polar . ..__..~_.~~... . . ..._~.__ _ _ ._. T

substitutions are introduced at Ser and Thr residues for modulating O-linked glycosylation. Glycosylation variants aJre also produced by selecting appropriate host cells, e.g. yeast, insect, or various mairunalian cells, or by in vitro methods such as neuraminidase digestion. Useful expression systems include COS-7, 293, BHK, CHO, TM4, CVl, VERO-76, HELA, MDCK, BRL 3A, W138, Hep G2, MMT 060562, TRI
cells, baculovirus systems, for examples. Other covalent modifications of the disclosed semaphorin peptides/polypeptides may be; introduced by reacting the targeted amino acid residues with an organic derivatizirhg (e.g. methyl-3-[(p-azido-phenyl)dithio]
propioimidate) or crosslinking agent (e.g. 1,1-bis(diazoacetyl)-2-phenylethane) capable of reacting with selected side chains or termini. For therapeutic and diagnostic localization, semaphorins and peptides thereof may be labeled directly (radioisotopes, fluorescers, etc.) or indirectly with an agent capable of providing a detectable signal, for example, a heart muscle kinase labeling :>ite.
The following are 14 classes of preferred semaphorin peptides where bracketed positions may be occupied by any one of the residues contained in the brackets and "Xaa"
signifies that the position may be occupied by any one of the 20 naturally encoded amino acids. These enumerated peptides maintan highly conserved structures which provide important semaphorin binding specificities;
(a) [AspGlu]Cys[GlnLysArgAlaAsn:~Asn[TyrPheVal]Ile (SEQ ID NO:1) Cys[GlnLysArgAlaAsn]Asn[Tyrl'heVal]Ile[ArgLysGlnThr] (SEQ ID N0:2) (b)CysGlyThr[AsnGly] [AlaSerAsn] [TyrPheHisGly] [LysArgHisAsnGln] (SEQ ID N0:3 ) CysGlyThr[AsnGly][AlaSerAsn]:xaaXaaPro (SEQ ID N0:4) CysGlyThr[AsnGly]XaaXaaXaaF'roXaa[CysAsp] (SEQ ID NO:S) CysGlyThrXaaXaaXaaXaaProXaa[CysAsp]XaaXaa[TyrIle] (SEQ ID N0:6) (c)[ArgIleGlnVa1][GlyAla][LeuValLys][C;ysSer]Pro[PheTyr][AspAsn] (SEQ ID N0:7) [CysSer]Pro[PheTyr][AspAsn]Pro.[AspGluArgLys][HisLeuAspJ (SEQ ID N0:8) GlyXaa[GlyAla]Xaa[CysSer]Pro'Cyr[AspAsn]Pro (SEQ ID N0:9) (d) Leu[PheTyr]Ser[GlyAla]Thr[Val.AsnAla]Ala (SEQ ID NO:10) Leu[PheTyr]SerXaaThrXaaAla[AspGlu][PheTyr] (SEQ ID NO:11) A

2171638 _ [PheTyr]Ser[GlyAla]Thr[ValAsnAla]Ala[AspGlu][PheTyr] (SEQ ID N0:12) (e) Leu[AsnAsp)[AlaLys]ProAsnPh.eVal (SEQ ID N0:13) PhePhePheArgGlu (SEQ ID N0:14) PhePhe[PheTyr]ArgGlu[ThrAsn] (SEQ ID NO:15) S PhePheArgGlu[ThrAsn]Ala (SE~Q ID N0:16) Phe[PheTyr]ArgGlu[ThrAsn]Ala (SEQ ID N0:17) TyrPhePhe[PheTyr]ArgGlu (SE(~ ID NO:18) [PheTyr]PhePhe[PheTyr]ArgGlu (SEQ ID N0:19) [PheTyr][PheTyr][PheTyr]ArgGlu[ThrAsn]Ala (SEQ ID N0:20) [IleVal][PheTyr]Phe[PheTyr][PheTyr]ArgGlu (SEQ ID N0:21) Asp[LysPheTyr]Val[PheTyr][PheTyrIleI:eu][PheTyrIleLeu][PheTyr] (SEQ ID N0:22) [ValIle] [PheTyr] [PheTyrIleLeu] [Phe7.'yrIleLeu]Phe[AxgThr]Xaa[ThrAsn](SEQID
N0:23) [ValIle] [PheTyr] [PheTyrIleLeu] [PheTyrIleLeu] [PheTyr] [ArgThr] [GluAspVa1]
[ThrAsn]
(SEQ ID N0:24) (g) Glu[PheTyr]IleAsn[CysSer]GlyI~ys (SEQ ID N0:25) [PheTyrJIleAsnCysGlyLys[AIaV'alIle] (SEQ ID N0:26) (h) Arg[ValIle][AlaGly][ArgGln][ValIle]CysLys (SEQ ID N0:27) Arg[ValIle]Xaa[ArgGln][ValIle]CysXaaXaaAsp (SEQ ID N0:28) GlyLys[ValAlaIle]XaaXaaXaaArg[ValAlaIle]XaaXaaXaaCysLys (SEQ ID N0:29) (i)[ArgLysAsn]Trp[ThrAlaSer][ThrAlaSo,r][PheTyrLeu]Leu[LysArg] (SEQ ID N0:30) [PheTyr]Leu[LysArg][AlaSer]ArgLeu[AsnIle]Cys (SEQ ID N0:31) [AsnIle]CysSer(IleVal][ProSer)Cily (SEQ ID N0:32) Trp[ThrAlaSer][ThrAlaSer][PheTyrLeu'~LeuLys[AlaSerValIleLeu]XaaLeu (SEQ ID
N0:33) Trp[ThrAlaSer][ThrAlaSer]XaaI,euLysXaaXaaLeuXaaCys (SEQ ID N0:34) TrpXaa[ThrSer]XaaLeuLysXaa~:aaLeuXaaCys (SEQ ID N0:35) (j) [PheTyr][PheTyr][AsnAsp]GluIleGlnSer (SEQ ff~ N0:36) [PheTyr]Pro[PheTyr][PheTyr][PlzeTyr][AsnAsp]Glu (SEQ ID N0:37) (k) GlySerAla[ValIleLeu]CysXaa[PheTyr] (SEQ ID N0:38) SerAla[ValIleLeu]CysXaa[PheT:yr]XaaMet (SEQ ID N0:39) 2171fi38 (1) AsnSer[AsnAla]TrpLeu[ProAla:~Val (SEQ ID N0:40) (m) [ValLeuIle]Pro[GluAspTyrSerP'he)ProArgProGly (SEQ ID N0:41) [ValLeuIle]ProXaaPro[ArgAla]ProGlyXaaCys (SEQ ID N0:42) Pro[GluAspTyrSerPhe]ProArgF'roGly[ThrGlnSer]Cys (SEQ ID N0:43) (n) AspPro[HisPheTyr]Cys[AlaGhr]Trp (SEQ ID N0:44) Pro[HisPheTyr]Cys[AlaGly]Trp.Asp (SEQ ID N0:45) AspProXaaCys[AlaGly]TrpAsp (SEQ ID N0:46) CysXaaXaaXaaXaaAspProXaaC'.ysXaaTrpAsp (SEQ ID N0:47) CysXaaXaaXaaAspProXaaCysX:aaTrpAsp (SEQ ID N0:48) CysXaaXaaAspProXaaCysXaaTrpAsp (SEQ ID N0:49) CysXaaXaaCysXaaXaaXaa.Xaa~~spXaa:XaaCysXaaTrpAsp (SEQ ID NO:50) CysXaaXaaCysXaaXaa.XaaAsp~:aaXaaCysXaaTrpAsp (SEQ ID NO:51 ) CysXaaXaaCysXaaXaaAspXaa.~:aaCysXaaTrpAsp (SEQ LD N0:52) The following peptides represent particularly preferred members of each class:
(a) AspCysGlnAsnTyrIle (SEQ ID 1'J0:67) (b) CysGlyThr[AsnGly)[AlaSer]Xaa,XaaPro (SEQ ID N0:68) (c) GlyXaa[SerCys)ProTyrAspPro (SEQ ID N0:69) (d) LeuTyrSerGlyThr[ValAsnAla]Ala (SEQ ID N0:70) (e) LeuAsnAlaProAsnPheVal (SEQ ID N0:71 ) (f) [PheTyr]PhePhe[PheTy)ArgGlu (SEQ ID N0:19) (g) Glu[PheTyr]IleAsn[CysSer]GlyL,ys (SEQ ID N0:25)\~, (h) Arg[ValIle]AlaArgValCysLys (SEQ ID N0:72) (i) Trp[ThrAla][ThrSer][PheTyr]LeuLys[AlaSer]ArgLeu (SEQ ID N0:,73) (j) ProPheTyrPhe[AsnAsp]GluIleGlnSer (SEQ ID N0:74) (k) GlySerAlaValCysXaa[PheTyr] (SEQ ID N0:75) (1) AsnSerAsnTrpLeu[ProAla]Val (SEQ ID N0:76) (m) Pro[GluAsp]ProArgProGly[ThrGlnSer]Cys (SEQ ID N0:77) (n) AspProTyrCys[AlaGlv]TrpAsp (SEQ ID N0:78) The following 14 classes are preferred peptides which exclude semaphorin peptides encoded in open reading frames of Variola major or Vaccinia viruses.
(a) [AspGlu]Cys[GlnLysArgAlaAsn]Asn[TyrPheVal]Ile (SEQ ID NO:OI) Cys[GlnLysArgAlaAsn]Asn[Tyr-PheVal]Ile[ArgLysGlnThr] (SEQ ID N0:02) (b) CysGlyThr[AsnGly][AlaSer][TyrPheHisGly][LysArgHisAsnGln] (SEQ ID
N0:79) CysGlyThr[AsnGly][AlaSerAsn][TyrPheHis][LysArgHisAsnGln] (SIrQ ID N0:80) CysGlyThr[AsnGly][AlaSer]XaaXaaPro (SEQ ID N0:81) (c)[ArgIleGlnVa1][GlyAla][LeuValLys][~CysSer]Pro[PheTyr][AspAsn] (SEQ ID
N0:07) [CysSer]Pro[PheTyr] [AspAsn]Pro[AspGluArgLys] [HisLeuAsp] (SEQIDN0:08) GlyXaa[GlyAla]Xaa[CysSer]ProTyr[AspAsn]Pro (SEQ ID N0:09) (d) Leu[PheTyr]Ser[GlyAla]Thr[Va:lAsnAla]Ala (SEQ ID NO:10) Leu[PheTyr]SerXaaThrXaaAla[~~spGlu][PheTyr] (SEQ ID NO:11) [PheTyr]Ser[GlyAla]Thr[ValAsnAla]Ala[AspGlu][PheTyr] (SEQ ID N0:12) (e) Leu[AsnAsp][AlaLys]ProAsnPheVal (SEQ ID N0:13) (fJ PhePhePheArgGlu (SEQ ID NO;14) PhePhe[PheTyr]ArgGlu(ThrAsn:] (SEQ ID N0:15) PhePheArgGlu[ThrAsn]Ala (SEI~ ID N0:16) Phe[PheTyr]ArgGlu[ThrAsn]Ala (SEQ ID N0:17) TyrPhePhe[PheTyr]ArgGlu (SE(~ ID N0:18) [PheTyr]PhePhe[PheTyr]ArgGlu. (SEQ ID N0:19) [PheTyr][PheTyT][PheTyr]ArgGlu[ThrAsn]Ala (SEQ ID N0:20) [IleVal][PheTyr]Phe[PheTyr][Ph.eTyr]ArgGlu (SEQ ID N0:21) Asp[LysPheTyr]Val[PheTyr][PheTyrLeu][PheTyrIleLeu][PheTyr] (SEQ ID N0:22) Asp[LysPheTyr]Val[PheTyr][PheTyrIle:Leu][PheTyrIle][PheTyr] (SEQ ID N0:82) [ValIle][PheTyr][PheTyrLeu][PheTyrIleLeu]Phe[ArgThr]Xaa[ThrAsn] (SEQ IDN0:83) [ValIle][PheTyr][PheTyrIleLeu][PheTyrIle]Phe[ArgThr]Xaa[ThrAsn] (SEQ ID N0:84) [ValIle][PheTyr][PheTyrIleLeu][PheTyrIleLeu]PheArgXaa(ThrAsn] (SEQ ID N0:85) [ValIle][PheTyr] [PheTyrLeu] [PheTyrIleLeu] [PheTyr][ArgThr][GluAspVal]
[ThrAsn]
(SEQ ID N0:86) (g) Glu[PheTyr]IleAsn[CysSer]GlyLys (SEQ ID N0:25) ,~-. , [PheTyr]IleAsnCysGlyLys[AlaValIle] (SEQ 117 N0:26) (h) Arg[ValIle)[AlaGly][ArgGln][V'alIle]CysLys (SEQ ID N0:27) Arg[ValIle]Xaa[ArgGln][ValIle:~CysXaaXaaAsp (SEQ ID N0:28) GlyLys[ValAlaIle]XaaXaaXaaArg(Vah~laIle]XaaXaaXaaCysLys (SEQ ID N0:29) (i) [ArgLysAsn]Trp[ThrAla][ThrAl~uSer)[PheTyrLeu]Leu[LysArg](SEQIDN0:87) [PheTyr]Leu[LysArg][AlaSer]ArgLeu[AsnIle]Cys (SEQ ID N0:31) [AsnIle]CysSer[IleVal][ProSer](sly (SEQ ID N0:32) Trp[ThrAla][ThrAlaSer] [PheTyrLeu]LeuLys[AlaSerValIleLeu]XaaLeu (SEQ ID N0:88) Trp [ThrAlaSer] (ThrAlaSer] [PheTyrLeu]:LeuLys [AlaSerIleLeu]XaaLeu (SEQ ID
N0:89) Trp[ThrAla][ThrAlaSer]XaaLeuLysXaaXaaLeuXaaCys (SEQ ID N0:90) (j) [PheTyr][PheTyr][AsnAsp]GluIl.eGlnSer (SEQ ID N0:36) [PheTyr]Pro[PheTyr][PheTyr][PheTyr][AsnAsp]Glu (SEQ ID N0:37) (k) GlySerAla[ValIleLeu]CysXaa[PlheTyr] (SEQ ID N0:38) SerAla[ValIle]CysXaa[PheTyr]XaaMet (SEQ ID N0:39) (1) AsnSer[AsnAla]TrpLeu[ProAla]Val (SEQ ID N0:40) (m) [ValLeuIle]Pro[GluAspTyrSerPhe]ProArgProGly (SEQ )D N0:41) [ValLeuIle]ProXaaProArgProGlyXaaCys (SEQ ID N0:91) Pro[GluAspTyrSerPhe]ProArgProGly[ThrGlnSer]Cys (SEQ ID N0:43) (n) AspPro[HisPheTyr]Cys[AlaGly]'Trp (SEQ ID N0:44) Pro[HisPheTyr]Cys[AlaGly]Trp~~sp (SEQ ID N0:45) AspProXaaCys[AlaGly]TrpAsp (SEQ 1D N0:46) CysXaaXaaXaaXaaAspProXaaCysXaaTrpAsp (SEQ ID N0:47) CysXaaXaaXaaAspProXaaCysXaaTrpAsp (SEQ ID N0:48) CysXaaXaaAspProXaaCysXaaT~pAsp (SEQ ID N0:49) CysXaaXaaCysXaaXaaXaaXaaA,spXaaXaaCysXaaTrpAsp (SEQ ID NO:50) CysXaaXaaCysXaaXaaXaaAspx:aaXaaCysXaaTrpAsp (SEQ ID NO:51) CysXaaXaaCysXaaXaaAspXaax:aaCysXaaTrpAsp (SEQ ID N0:52) The following 2 classes are preferred peptides which exclude semaphorin peptides encoded in open reading frames of Variola major or Vaccinia viruses Grasshopper Semaphorin I.

(fj TyrPhePhe[PheTyr]ArgGlu (SEQ II) N0:18) Asp[LysTyr]Val[PheTyr][PheTy~rLeu][PheTyrIleLeu][PheTyr] (SEQ ID N0:92) Asp[LysTyr]Val[PheTyr][PheTyrIleLeu][PheTyrIle][PheTyr] (SEQ ID N0:93) [ValIleJTyr[PheTyrLeu][PheTyrIleLeu]:Phe[ArgThr]Xaa[ThrAsn] (SEQ ID N0:94) [ValIle]Tyr[PheTyrIleLeu][PheTyrIle]P:he[ArgThr]Xaa[ThrAsn] (SEQ ID N0:95) [ValIle]Tyr[PheTyrIleLeu][PheT:yrIleLeu]PheArgXaa[ThrAsn] (SEQ ID N0:96) Val[PheTyr] [PheTyrLeu] [PheTyz~IleLeu] [PheTyr] [ArgThr] [GluAspVa1][ThrAsn]
(SEQ ID N0:97) Val[PheTyr] [PheTyrIleLeuJ [Phe7.'yrIle] [PheTyr] [ArgThr) [GluAsp Val]
[ThrAsn]
(SEQ ID N0:98) V al [PheTyr] [PheTyrIleLeu] [PheTyrIleLeu] [PheTyr] Arg [GluAsp V al]
[ThrAsn]
(SEQ ID N0:99) (n) CysXaaXaaXaaAspProXaaCysXaa7.'rpAsp (SEQ ID N0:48) CysXaaXaaAspProXaaCysXaaTrpAsp (SEQ ID N0:49) CysXaaXaaCysXaaXaaXaaAsp~;aaXaaCysXaaTrpAsp (SEQ ID NO:S 1 ) CysXaaXaaCysXaaXaaAspXaa~:aaCysXaaTrpAsp (SEQ ID N0:52) The following S classes include peptides which encompass peptides encoded in open reading frames of Variola major or Vaccinia viruses. Accordingly, in the event that these viral peptides are not novel per se, the present invention discloses a hitherto unforseen and unforseeable utility for there peptides as immunosuppressants and targets of anti-viral therapy.
(b)CysGlyThr[AsnGly][AlaSerAsnJ[TyrPheHisGly][LysArgHisAsnGln] (SEQ ID
N0:03) CysGlyThr[AsnGly][AlaSerAsn]XaaXaaPro (SEQ ID N0:04) CysGlyThr[AsnGly]XaaXaaXaal?roXaa[CysAsp] (SEQ ID NO:OS) CysGlyThrXaaXaaXaaXaaProXua[CysAsp]XaaXaa[TyrIle] (SEQ ID N0:06) (fjAsp[LysPheTyr] Val[PheTyr] [PheTyrIleLeu] [PheTyrIleLeu] [PheTyr] (SEQ ID
N0:22) [ValIle][PheTyr][PheTyrIleLeu][PheTyrIleLeu]Phe[ArgThr]Xaa[ThrAsn] (SEQ ID
N0:23 ) Val [PheTyr] [PheTyrIleLeu] [PheTyrIlf;Leu] [PheTyr] [ArgThr] [GluAspVal]
[ThrAsn]
(SEQ ID NO:100) (i) [ArgLysAsn]Trp [ThrAlaSer] [ThrAla Ser] [PheTyrLeu]Leu[LysArg] (SEQ ID
N0:30) Trp[ThrAlaSer] [ThrAlaSerJ [PheTyrLeu]LeuLys[AlaSerValIleLeu]XaaLeu (SEQ
S ID N0:33) Trp[ThrAlaSer][ThrAlaSer]XaaLeuLysXaaXaaLeuXaaCys (SEQ ID N0:34) TrpXaa[ThrSer]XaaLeuLysXaa:XaaLeuXaaCys (SEQ ID N0:35) (k) SerAla[ValIleLeu]CysXaa[PheTyr]XaaMet (SEQ ID N0:39) (m) [ValLeuIle]ProXaaPro[ArgAla]ProGlyXaaCys (SEQ ID N0:42) The disclosed semaphorin sequence data are used to define a wide variety of other semaphorin- and semaphorin receptor-specific binding agents using immunologic, chromatographic or synthetic methods available to those skilled in the art.
Of particular significance are peptides comprising unique portions of semaphorin-specific receptors and polypeptides comprising a sequence substantially similar to that of a substantially full-length semaphor~in receptor. Using semaphorin peptides, these receptors are identified by a variety of techniques known to those skilled in the art where a ligand to the target receptor is known, including expression cloning as set out in the exemplification below. For other examples of receptor isolation with known ligand using expression cloning, see, Staunton et al (1989) Nature 339, 61; Davis et al (1991) Science 253, 59; Lin et al (1992) Cell 68, 775; Gearing et al (1989) EMBO 8, 3667;
Aruffo and Seed (1987) PNAS 84, 8573 and references therein. Generally, COS cells are transfected to express a cDNA library or PCR product and cells producing peptides/polypeptides which bind a semaphorin/receptor peptide/polypeptide are isolated. For neurosemaphorin receptors, fetal brain cDNA libraries are preferred; for immunosemaphorin receptors, libraries derived from activated lymphoid or myeloid cell lines or tissue derived from sites of inflammation or delayed-type hypersensitivity are preferred; and for semaphorin and semaphorin receptor variants used by tumor cells to evade immune surveillance or suppress an immune response (oncosema~phorins), libraries derived from cancerous tissue or tumor cell lines resistant to the host immune system are preferred.
Alternatively, PCR
primers based upon known semaphorin/rf:ceptor sequences such as those disclosed herein are used to amplify PCR product from such tissues/cells. Other 1:3 w - 2171fi38 ...., .. -..-, ~ _ ceceptor/ligand isolation methods using immobilized ligand or antibody are known to those skilled in the art.
Semaphorin receptor peptides 'with receptor binding specificity are identified by a variety of ways including having conserved consensus sequences with other semaphorin receptors, by crosslinldng to ligand or receptor-specific antibody, or preferably, by screening such peptide: for semaphorin binding or disruption of semaphorin-receptor binding. Methods for identifying semaphorin receptor peptides with the requisite binding activity are described herein or otherwise known to those skilled in the art. By analogous methods, semaphorin receptor peptides are used to define additional semapho,dn peptides with semaphorin binding specificity, particularly receptor specil;icity.
The various semaphorin and se;maphorin receptor peptides are used to define functional domains of semapho:rins, identify compounds that associate with semaphorins, design compounds capat~le of modulating semaphorin-mediated nerve and immune cell function, and define additional semaphorin and semaphorin receptor-specific binding agents. For example, semaphorin mutants, including deletion mutants are generated from the disclosed semaphorin sequences and used to identify regions important for specific protein-ligand or protein-protein interactions, for example, by assaying for the ability to mediate repulsion or preclude aggregation in cell-based assays as described herein. Further, x-ray crystallographic data of the disclosed protein are used to rationally design binding molecules of determined structure or c:omplementarity for modulating growth cone growth and guidance.
Additional semaphorin- and receptor-specific agents include specific antibodies that can be modified to a monovalent form, such as Fab, Fab', or Fv, spexifically binding oligopeptides or ol~igonucle~tides and most preferably, small molecular weight organic receptor antagonists. For example, the disclosed semaphorin and receptor peptides are used as immunogens to generate semaphorin-and receptor-specific polyclonal or monoclonal antibodies. See, Harlow and Lane (1988) Antibodies, A Laboratory Manual, Cold Spring Harbor Laboratory, for general methods. Anti-idiotypic antibody, especially internal imaging anti-ids are also prepared using the disclosures herein.

WO 95/07706 21 7 1 6 3 ~ PCT/US94/10151 In addition to semaphorin and semaphorin-receptor derived polypeptides and peptides, other prospective agents are screened from large libraries of synthetic or natural compounds. For exannple, numerous means are available for random and directed synthesis of saccharide, peptide, and nucleic acid based compounds.
Alternatively, libraries of natural compounds in the form of bacterial, fungal, plant and animal extracts are available or readily producible. Additionally, natural and synthetically produced libraries and compounds are readily modified through conventional chemical, physical, and biochemical means. See, e.g. Houghten et ail. and Lam et al (1991) Nature 354, 84 and 81, respectively and Bla~lce and Litzi-Davis (1992), Bioconjugate C:hem 3, 510.
Useful agents are identified with a range of assays employing a compound comprising the subject peptides or encoding nucleic acids. A wide variety of in vitro, cell-free binding assays" especially assays for specific binding to immobilized compounds comprising semaphorin or semaphorin receptor peptide find convenient use. While less preferred, cell-based assays may be used to determine specific effects of prospective agents on semaphorin-receptor binding may be assayed, see, e.g. Schnell and Schwab (1990) supra. Optionally, the intracellular C-terminal domain is substituted with a sequence encoding a oligopeptide or polypeptide domain that provides a detectable intracellular signal upon ligand binding different from the natural receptor. Useful intracellular domains include those of the human insulin receptor and the TCR, especially domains with ldnase activity and domains capable of triggering calcium influx which is conveniently detected by fluorimetry by preloading the host cells with Fura-2. More preferred assays involve simple cell-free in vitro binding of candidate agents to immobilized semaphorin or receptor peptides, or vice ver,~a. See, e.g. Fodor et al (1991) Science 251, 767 for light directed parallel synthesis method. Such assays are amenable to scale-up, high throughput usage suitablE: for volume drug screening.
Useful agents are typically those that bind to a semaphorin or disrupt the association of a semaphorin with its receptor. Preferred agents are semaphorin specific and do not cross react with other neural or lymphoid cell membrane proteins. Useful agents may be found within numerous chemical classes, though typically they are organic compounds; preferably small organic compounds.
Small organic compounds have a molecular weight of more than 150 yet less than about W ~ 95/07706 4,500, preferably less than about 1500, more preferably, less than about 500.
Exemplary classes include peptides, saccharides, steroids, heterocyclics, polycyclics, substituted aromatic compounds, and the like.
Selected agents may be modified to enhance efficacy, stability, pharmaceutical compatibility, and the like. Structural identification of an agent may be used to identify, generate, or screen additional agents. For example, where peptide agents are identified, they may be modified in a variety of ways as described above, e.g. to enhance their proteolytic stability. Other methods of stabilization may include encapsulation, for example, in liposomes, etc.
The subject binding .agents may be prepared in a variety of ways known to those skilled in the art. For. example, peptides under about 60 amino acids can be readily synthesized today using conventional commercially available automatic synthesizers. Alternatively, DNA sequences may be prepared encoding the desired peptide and inserted into an appropriate expression vector for expression in a prokaryotic or eukaryotic host. A wide variety of expression vectors are available today and may be used in conventional ways for transformation of a competent host for expression and isolation. If desired, the open reading frame encoding the desired peptide may be joined to a signal sequence for secretion, so as to permit isolation from the culture medium. Methods for preparing the desired sequence, inserting the sequence into an expression vector, transforming a competent host, and growing the host in culture for production of the product may be found in U.S.
Patent Nos. 4,710,473, 4,71.1,843 and 4,713,339.
For therapeutic uses, the compositions and agents disclosed herein may be administered by any convenient way. Small organics are preferably administered orally; large molecular weight (e.g. greater than 1 kD, usually greater than 3 kD, more usually greater than 10 kD) compositions and agents are preferably administered parenterally, conveniently in a pharmaceutically or physiologically acceptable carrier, e.g., phosphate buffered saline, saline, deionized water, or the like. Typically, the compositions are added to a retained physiological fluid such as blood or synovial fluid. :Eor CNS administration, a variety of techniques are available for promoting transfer of the therapeutic across the blood brain barrier including disruption by surgery or injection, drugs which transciently open adhesion contact between CNS vasculature endothelial cells, and compounds which fascilitate translocation through such cells.
As examples, many ofthe disclosed therapeutics are amenable to directly injected or infused, topical, intratracheal/nasal administration, e.g. through aerosol, intraocularly, or within/on implants e.g. fibers (e.g. collagen) osmotic pumps, grafts comprising appropriately transformed cells, etc. A particularly useful application involves coating, imbedding or derivatizing fibers, such as collagen fibers, protein polymers, etc. with therapuetic peptides. Other useful approaches are described in Otto et al.
(1989) J
Neuroscience Research 22, 83-91 and Otto and Unsicker ( 1990) J Neuroscience 10,1912-1921. Generally, the amount administered will be empirically determined, typically in the range of about 10 to 1000 ~g/kg of the recipient. For peptide agents, the concentration will generally be in the range of about 50 to 500 ~g/ml in the dose administered. Other additives may be included, such as stabilizers, bactericides, etc.
These additives will be present in conventional amounts.
The invention provides isolated nucleic acid sequences encoding the disclosed semaphorin and semaphorin receptor peptides and polypeptides, including sequences substantially identical to sequences encoding such polypeptides. An "isolated"
nucleic acid sequence is present as other than a naturally occurring chromosome or transcript in its natural state and typically is removed from at least some of the nucleotide sequences with which it is normally associated with on a natural chromosome. A
complementary sequence hybridizes to a unique portion of the disclosed semaphorin sequence under low stringency conditions, for example, at 50°C and SSC (0.9 M saline/0.09 M sodium citrate) and that remains bound when subject to washing at 55 °C with SSC. Regions of non-identity of complementary nucleic acids are preferably or in the case of homologous nucleic acids, a nucleotide change providing a redundant codon. A partially pure nucleotide sequence constitutes at least: about S%, preferably at least about 30%, and more preferably at least about 90% by weight of total nucleic acid present in a given fraction.
Unique portions of the disclosed nucleic acid sequence are of length sufficient to distinguish previously known nucleic acid sequences. Thus, a unique portion has a nucleotide sequence at least long enough to define a novel oligonucleotide. Preferred nucleic acid portions encode a unique semaphorin peptide.
The nucleic acids of the invention and portions thereof, other than those used as PCR
primers, are usually at least about 60 by and usually less than about 60 kb in length. PCR
primers are generally between about 15 amd 100 nucleotides in length.
S The invention also provides for the disclosed sequences modified by transitions, transversions, deletions, insertions, or other modifications such as alternative splicing and also provides for genomic semaphorin sequences, and gene flanking sequcnces, including regulatory sequences; included are DN.A and RNA sequences, sense and antisense.
Preferred DNA sequence portions include portions encoding the preferred amino acid sequence portions disclosed above. For antisense applications where the inhibition of semaphorin expression is indicated, especially useful oligonucleotides are between about 10 and 30 nucleotides in length and inch.~de sequences surrounding the disclosed ATG
start site, especially the oligonucleotides defined by the disclosed sequence beginning about 5 nucleotides before the start site and ending about 10 nucleotides after the 1 S disclosed start site. Other especially useful semaphorin mutants involve deletion or substitution modifications of the disclosed cytoplasmic C-termini of transmembrane semaphorins. Accordingly, semaphorin mutants with semaphorin binding affinities but with altered intracellular signal transduction capacities are produced.
For modified semaphorin-encoding sequences or related sequences encoding proteins with semaphorin-like functions,, there will generally be substantial sequence identity between at least a segment thereof and a segment encoding at least a portion of the disclosed semaphorin sequence, preferably at least about 60%, more preferably at least 80%, most preferably at least 90% identity. Homologous segments are particularly within semaphorin domain-encoding regions and regions encoding protein domains involved in protein-protein, particularly semaphorin-receptor interactions and differences within such segments are particularly conservative substitutions.
Typically, the invention's semaphorin peptide encoding polynucleotides are associated with heterologous sequences. Examples of such heterologous sequences include regulatory sequences such as promoters, enhancers, response elements, r WO 95107706 21 7 16 3 8 pCT/US94/10151 signal sequences, polyadenylation sequences, etc., introns, 5' and 3' noncoding regions, etc. Other useful heterologous sequences are known to those skilled in the art or otherwise disclosed references cited herein. According to a particular embodiment of the invention, portions of the semaphorin encoding sequence are spliced with hetemlogous sequences to ;produce soluble, secreted fusion proteins, using appropriate signal sequences and optionally, a fusion partner such as /3-Gal.
The disclosed sequences are alsa used to identify and isolate other natural semaphorins and analogs. In particular, the disclosed nucleic acid sequences are used as hybridization probes under low-stringency or PCR primers, e.g.
oligonucleotides encoding functional semaphorin domains are 3zP-labeled and used to screen 7~cDNA libraries at low stringency to identify similar cDNAs that encode proteins with related functional domains. Additionally, nucleic acids encoding at least a portion of the disclosed semapharin are used to characterize tissue specific expression of semaphorin as well as changes of expression over time, particularly during organismal development or cellular differentiation.
The semaphorin encoding nucleic acids can be subject to alternative purification, synthesis, modification, sequencing, expression, transfection, administration or other use by methods disclosed in standard manuals such as Molecular Cloning, A Laboratory Manual (2nd Ed., Sambrook, Fritsch and Maniatis, Cold Spring Harbor), Current Protocols in Molecular Biology (Eds.
Aufubel, Brent, Kingston, More, Feidman, Smith and Stuhl, Greene Publ. Assoc., Wiley-Interscience, NY, NY, 1992) or that are otherwise known in the art. For example, the nucleic acids can be modified to alter stability, solubility, binding affinity and specificity, etc. semaphorin-encoding sequences can be selectively methylated, etc. The nucleic acid sequences of the present invention may also be modified with a label capable of providing a detectable signal, either directly or indirectly. Exemplary labels include radioisotopes, fluorescers, biotinylation, etc.
Tfie invention also provides vectors comprising nucleic acids encoding semaphorin peptides, polypeptides or analogs. A large number of vectors, including plasmid and viral vectors, have been described for expression in a variety of eukaryotic and prokaryotic hosts. Advantageously, vectors may also include a promotor operably linked to the semaphorin-encoding portion. Vectors will often include one or more replication systems for cloning or expression, one or more 21 7 16 3 ~ PCT/US94110151 markers for selection in the host, e.g. antibiotic resistance. The inserted semaphorin coding sequences may be synthesized, isolated from natural sources, prepared as hybrids, etc. Suitable host cells may be transformed/transfected/infected by any suitable method including electroporation, CaClz mediated DNA uptake, viral infection, microinjection, microprojectile, or other methods.
Appropriate host cells include bacteria, arche,~acteria, fungi, especially yeast, and plant and animal cells, especially mammalian cells. Of particular interest are E. coli, B. subtilis, Saccharomyces cerevisiae, SF9 cells, C129 cells, 293 cells, Neurospora, and CHO, COS, HeLa cells, immortalized mammalian myeloid and lymphoid cell lines, and pluripotent cells, especially mammalian ES
cells and zygotes. Preferred replication systems include M13, ColEl, SV40, baculovirus, lambda, adenovirus, AAV, BPV, etc. A large number of transcription initiation and termination regulatory regions have been isolated and shown to be effective in the transcription and translation of heterologous proteins in the various hosts. Examples of these regions, methods of isolation, manner of manipulation, etc. are known in the art. Under appropriate expression conditions, host cells can be used as a source of recombinantly produced semaphorins or analogs.
For the production of stably transformed cells and transgenic animals, nucleic acids encoding the disclosed semaphorins may be integrated into a host genome by recombination events. For example, such a sequence can be r---~__ microinjected into a cell, and thereby effect homologous recombination at the site of an endogenous gene, an analog or pseudogene thereof, or a sequence with substantial identity to an semaphorin-encoding gene. Other recombination-based methods such as nonhomologous recombinations, deletion of endogenous gene by homologous recombination, especially in pluripotent cells, etc., provide additi~pnal applications. Preferred transgenics and stable transformants over-express the disclosed receptor gene and find use in drug development and as a disease model.
Alternatively, knock-out cells and animals find use in development and functional studies. Methods for making transgenic animals, usually rodents, from ES cells or zygotes are known to those skilled in the art.

The compositions and methods disclosed herein may be used to effect gene therapy. See, e.g. Zhu et al. (1993) Science 261, 209-211; Gutierrez et al.
(1992) Lancet 339, 715-?21. For example, cells are transfected with semaphorin sequences operably linked to gene regulatory sequences capable of effecting altered semaphorin expression or regulation. To modulate semaphorin translation, cells may be transfected with complementary antisense polynucleotides. For gene therapy involving the transfusion of semaphorin transfected cells, administration will depend on a number of variables that are ascertained empirically. For example, the number of cells will vary depending on the stability of the transfused cells. Transfusion media is typically a buffered saline solution or other pharmacologically acceptable solution. Similarly the amount of other administered compositions, e.g. transfected nucleic acid, protein, etc., will depend on the manner of administration, purpose of the therapy, and the like.
The following examples are offered by way of illustration and not by way of limitation.
E~: MP
I. Isolation and characterization o~f Grasshonner Semaphorin I (SEO ID
NOs~57 and 58~ (nreviousl~referred to as Fasciclin IVl In order to identify cell surface molecules that function in selective fasciculation, a series of monoclonal antibody (MAb) screens was conducted.
The immunogen used for most of these screens was membranes from the longitudinal connectives (the collection of longitudinal axons) between adjacent segmental ganglia of the nervous system of the larval grasshopper. From these screens, MAb 3B11 and 8C6 were used to purify and characterize two surface glycoproteins, fasciclin I and fasciclin II, see, Bastiani et al., 1987; the genes encoding both were subsequently cloned, see, Snow et al. 1989, Zinn et al. 1988, and Harrelson and Goodman, 1988.
Another MAb isolated during these screens, MAb 6F8, was chosen for the present study because, just as with fasciclin I and fasciclin II, the antigen recognized by this MAb is expressed on a different but overlapping subset of axon pathways in the developing CNS. The 6F8 antigen appears to be localized on the outside of cell surfaces, as indicated by MAb binding when incubated both in live ~l'n ~"07706 2 ~ 7 16 3 8 PCT/L1S94110151 preparations, and in fixed preparations in which no detergents have been added.
Because the 6F8 antigen is a surface glycoprotein expressed on a subset of axon fascicles (see below), we call it fasciclin IV.
Fasciclin IV expression begins early in embryonic development before axonogenesis. At 29 % of development, expression is seen on the surface of the midline mesectodermal cells and around 5-7 neuroblasts and associated ectodermal cells per hemisegment. This expression is reminiscent of the mesectodermal and neuroblast-associated expression observed with both fasciclin I and fasciclin II;
however, in each case, the pattern resolves into a different subset of neuroblasts and associated ectodermal cells.
At 32% of development, shortly after the onset of axonogenesis in the CNS, fasciclin IV expression is seen on the surface of the axons and cell bodies of the three pairs of MP4, MPS, and MP6 midline progeny, the three U motoneurons, and on several unidentified neurons in close proximity to the U's. This is in contrast to fasciclin II, which at this stage is expressed on the MP1 and dMP2 neurons, and fasciclin I, which is expressed on the U neurons but not on any midline precursor progeny.
The expression of fasciclin IV on a subset of axon pathways is best observed around 40 % of development, after the establishment of the first longitudinal and commissural axon pathways . At this stage, the protein is expressed on two longitudinal axon fascicles, a subset of commissural axon fascicles, a tract extending anteriorly along the midline, and a subset of fascicles in the segmental nerve (SN) and intersegmental nerve (ISN) roots.
Specifically, fasciclin IV is expressed on the U fascicle, a longitudinal pathway (between adjacent segmental neuromeres) pioneered in part by the U
neurons, and on the A/P longitudinal fascicle (in part an extension of the U
fascicle within each segmental neuromere. In addition, fasciclin IV is also expressed on a second narrower, medial, and more ventral longitudinal pathway. The U axons turn and exit the CNS as they pioneer the ISN; the U's and many other axons within the ISN express fasciclin IV. The continuation of the U fascicle posterior to the ISN junction is also fasciclin IV-positive. The specificity of fasciclin IV for distinct subsets of longitudinal pathways can be seen by comparing fasciclin IV and . 2171638 _ fasciclin II expression in the same embryo; fasciclin IV is expressed on the U
and A/P
pathways whereas fasciclin II is expressed on the MP 1 pathway.
The axons in the median fiber tra:ct (MFT) also express fasciclin IV. The MFT
is pioneered by the three pairs of progeny of the midline precursofs MP4, MPS, and MP6.
The MFT actually contains three separate fascicles. The axons of the two MP4 progeny pioneer the dorsal MFT fascicle and thE.n bifurcate at the posterior end of the anterior commissure; whereas the axons of the two MP6 progeny pioneer the ventral MFT
fascicle and then bifurcate at the anterior end of the posterior commissure. Fasciclin IV is expressed on the cell bodies of the six MP4, MPS, and MP6 neurons, and on their growth cones and axons as they extend anteriorly in the MFT and bifurcate in one of the two commissures. However, this expression is regional in that once these axons bifurcate and begin to extend laterally across the longitudinal pathways and towards the peripheral nerve roots, their expression of fasciclin IV greatly decreases. Thus, fasciclin IV
is a label for tl~e axons in the MFT and their initial bi:furcations in both the anterior and posterior commissures. It appears to be expressed on other commissural fascicles as well.
However, the commissural expression ~of fasciclin IV is distinct from the transient expression of fasciclin II along the posterior edge of the posterior commissure, or the expression of fasciclin I on several different commissural axon fascicles in both the anterior and posterior commissure (Bastiani et al., 1987; Harrelson and Goodman, 1988).
Fasciclin IV is also expressed on a subset of motor axons exiting the CNS in the SN. The SN splits into two major branches, one anterior and the other posterior, as it exits the CNS. Two large bundles of motoneuron axons in the anterior branch express fasciclin IV at high levels; one narrow bundle of motoneuron axons in the posterior branch expresses the protein at much lower levels. Fasciclin IV is also expressed on many of the axons in the ISN.
The CNS and nerve root expression patterns of fasciclin IV, fasciclin I, and fasciclin II at around 40% of embryonic development indicate that although there is some overlap in their patterns (e.g., both fasciclin IV and fasciclin I label the U axons), these three surface glycoproteins label distinct subsets of axon pathways in the developing CNS.

~'n 95/07706 21 7 16 3 g PCT/US94/10151 _ _ . ~ .. _ _ F~cic~ ~ is ~p~ed on epithelial bands in the developing limb bud Fasciclin IV is expressed on tl»e developing limb bud epithelium in circumferential bands; at 34.5 % of development these bands can be localized with respect to constrictions in the epithelium that mark presumptive segment boundaries. In addition to a band just distal to the trochanter/coxa segment boundary, bands are also found in the tibia, femur, coxa, and later in development a fifth band is found in the tarsus. Fasciclin TV is also expressed in the nascent chordotonal organ in the dorsal aspect of the femur. The bands in the tibia, trochanter, and coxa completely encircle the limb. However, the femoral band is incomplete, containing a gap on the anterior epithelia of this segment.
The position of the Til axon pathway with respect to these bands of fasciclin IV-positive epithelia suggests a potential role for fasciclin IV in guiding the Til growth cones. First, the band of fasciclin IV expression in the trochanter, which is approximately three epithelial cell diameters in width when encountered by the Til growth cones, is the axial location where the growth cones reorient from proximal migration to circumferential branch extension. The Trl cell, which marks the location of the turn, lies within this band, usually over the central or the proximal cell tier. Secondly, although there is a more distal fasciclin IV
expressing band in the femur, where a change in Til growth is not observed, there exists a gap in this band such that fasciclin IV expressing cells are not traversed by the Til growth cones. The Til axons also may encounter a fasciclin IV
expressing region within the coxa, where interactions between the growth cones, the epithelial cells, and the Cx 1 guidepost cells have not yet been investigated.
In addition to its expression over the surface of bands of epithelial cells, fasciclin IV protein, as visualized with MAb 6F8, is also found on the basal surface of these cells in a punctate pattern. This punctate staining is not an artifact of the HRP immunocytochemistry since fluorescent visualization of MAb 6F8 is also punctate. The non-neuronal expression of fasciclin IV is not restricted to limb buds. Circumferential epithelial bands of fasciclin IV expression are also seen on subesophageal mandibular structures and. on the developing antennae.

WO 95107706 2 ~ 7 ~ 6 3 8 r- PCTIi1S94I10151 MAb directed against fasciclin IV can alter the formation of the Til axon pathway in the limb bud The expression of fasciclin IV on an epithelial band at a key choice point in the formation of the Til axon pathway led us to ask whether this protein is involved in growth cone guidance at this location. To answer this question, we cultured embryos, or epithelial fillets (e. g., O'Connor et al., 1990), during the S % of development necessary for norcnal pathway formation, either in the presence or absence of MAb 6F8 or 6F8 Fab fiagments. Under the culture conditions used for these experiments, defective Til pathways are observed in 14% of limbs (Chang et al., 1992); this defines the baseline of abnormalities observed using these conditions. For controls we used other MAbs and their Fab fragments that either bind to the surfaces of these neurons and epithelial cells (MAb 3B11 against the surface protein fasciclin I) or do not (MAb 4D9 against the nuclear protein engrailed; Patel et al., 1989). To assess the impact of MAb 6F8 on Til pathway formation, we compared the percentage of aberrant pathways observed following treatment with MAb 6F8 to that observed with MAbs 3B11 and 4D9. Our cultures began at 32% of development when the Til growth cones have not yet reached the epithelium just distal to the trochanter~'coxa boundary and therefore have not encountered epithelial cells expressing fasciclin lV. Following approximately hours in culture ( - 4 % of development), embryos were fixed and immunostained with antibodies to HItP in order to visualize the Til axons and other neurons in the limb bud. Criteria for scoring the Til pathway, and the definition of "aberrant", are described in detail in the Experimental Procedures.
Although MAb 6F8 does not arrest pathway formation, several types of distinctive, abnormal pathways are observed. These defects generally begin where growth cones first contact the fasciclin. IV expressing cells in the trochanter.
Normally, the Til neurons each have a single axon, and the axons of the two cells are fasciculated in that portion of the pathway within the trochanter.
Following treatment with MAb 6F8, multiple long axon branches are observed within, and proximal to, the trochanter. Two major classes of pathways are taken by these branches; in 36 % of aberrant limbs, multiple, long axon branches extend ventrally in the region distal to the Cxl cells which contains the band of fasciclin IV
expressing epithelial cells. In the ventral region of the trochanter, these branches 7706 2 ~ 7 ~ 6 3 v PCT/US94110151 often independently turn proximally to contact the Cxl cells, and thus complete the pathway in this region.
In the second major class of pathway defect, seen in 47% of aberrant limbs, axon branches leave the trochanter at abnormal, dorsal locations, and extend proximally across the trochanter/coxa boundary. These axons then veer ventrally, often contacting the Cxl neurons. The remaining 17% of defects include defasciculation distal to the trochanter, axon branches that fail to turn proximally in the ventral trochanter and continue into the posterior compartment of the limb, and axon branches which cross the trochanter/coxa boundary and continue to extend proximally without a ventral turn.
When cultured in the presence of MAb 6F8, 43 % of limbs exhibited malformed Til pathways (n = 381) as compared to 11 % with MAb 3B11 (n =
230) and 5 % with MAb 4D9 (n = 20). These percentages are pooled from treatments with MAbs concentrated from hybridoma supernatant, IgGs isolated from these supernatants, and Fab fragments isolated from these IgG
preparations (see Experimental Procedures). The frequency of malformed Til pathways and the types of defects observed showed no significant variation regardless of the method of antibody preparation or type of antibody used. Since Fabs show similar results as IgGs, the effects of MAb 6F8 are not due to cross linking by the bivalent IgG.
In summary, following treatment with MAb 6F8, the Til pathway typically exhibits abnormal morphology beginning just distal to the trochanter and at the site of fasciclin IV expression. The two most common types of Til pathway defects described above occur in 36% of experimental limbs (treated with MAb 6F8), but are seen in only 4% of control limbs (treated with MAbs 3 B11 and 4D9).
Fasciclin IV cDNAs encode a novel integral membrane protein Grasshopper fasciclin IV was purified by passing crude embryonic grasshopper lysates over a MAb 6F8 column. After affinity purification, the protein was eluted, precipitated, denatured, modified at cysteines, and digested with either trypsin or Lys-C. Individual peptides were resolved by reverse phase I3PLC and microsequenced using standard methods.
The amino acid sequences derived from these proteolytic fragments were used to generate oligonucleotide probes for PCR experiments, resulting in products WO 95/07706 2 ~ 7 ~ 6 3 8 PCT/US94110151 that were used to isolate cDNA clones from the Zinn embryonic grasshopper cDNA library (Snow et al., 1988). Sequence analysis of these cDNAs reveals a single open reading frame (ORF) encoding a protein with two potential hydrophobic stretches of amino acids: an amino-terminal signal sequence of 20 residues and (beginning at amino acid 627) a potential transmembrane domain of 25 amino acids. Thus, the deduced protein has an extracellular domain of 605 amino acids, a transmembrane domain, and a cytoplasmic domain of 78 amino acids. The calculated molecular mass of the mature fasciclin IV protein is 80 kd and is confirmed by Western blot analysis of the affinity purified and endogenous protein as described below. The extra.cellular domain of the protein includes cysteine residues that fall into three loose clusters but do not constitute a repeated domain and are not similar to other kr.~own motifs with cysteine repeats.
There are also six potential sites for N-linked glycosylation in the extracellular domain.
Treatment of affinity purified fasciclin IV with N-Glycanase demonstrates that fasciclin IV does indeed contain N-linked oligosaccharides. Fasciclin IV shows no sequence similarity when compared wiith other proteins in the PIR data base using BLASTP (Altschul et al., 1990), and is therefore a novel type I integral membrane protein.
A polyclonal antiserum directed against the cytoplasmic domain of the protein encoded by the fasciclin IV cDNA was used to stain grasshopper embryos at 40 % of development. The observed staining pattern was identical to that seen with MAb 6F8. On Western blots, this antiserum recognizes the protein we affinity purified using MAb 6F8 and tlhen subjected to microsequence analysis.
Additionally, the polyclonal serum recognizes a protein of similar molecular mass from grasshopper embryonic membranes. Taken together these data indicate that the sequence we have obtained is indeed fasciclin IV.
Four other cell surface proteins. that label subsets of axon pathways in the insect nervous system (fasciclin I, fasciclin II, fasciclin III, and neuroglian) are capable of mediating homophilic cell adhesion when transfected into S2 cells in vitro (Snow et al., 1989; Elldns et al., 1990b; Grenningloh et al., 1990). To ask whether fasciclin IV can function as a homophilic cell adhesion molecule, the fasciclin IV cDNA with the complete ~ORF was placed under the control of the inducible metallothionein promoter (Bunch et al., 1988), transfected into S2 cells, WO 9510770b 2 ~ 7 16 3 8 PCTIIJS94110151 end assayed for its ability to promote adhesion in normally non-adhesive S2 cells.
Following induction with copper, fasciclin IV was synthesized in these S2 cells as shown by Western blot analysis and cell surface staining of induced S2 cells with the polyclonal antiserum described above.
S We observed no evidence for aggregation upon induction of fasciclin IV
expression, thus suggesting that, in contrast to the other four proteins, fasciclin IV
does not function as a homophilic cell adhesion molecule. Alternatively, fasciclin IV-mediated aggregation might require some further posttranslational modification, or co-factor, not supplied by the S2 cells, but clearly this protein acts differently in the S2 cell assay than the other four axonal glycoproteins previously tested.
This is consistent with the pattern of fasciclin IV expression in the embryonic limb since only the epithelial cells and not the Til growth cones express fasciclin IV, and yet antibody blocking experiments indicate that fasciclin IV functions in the epithelial guidance of these growth cones. Such results suggest that fasciclin IV
functions in a heterophilic adhesion or signaling system.
Discussion Fasciclin IV is expressed on groups of axons that fasciculate in the CNS, suggesting that, much like other insect axonal glycoproteins, it functions as a homophilic cell adhesion molecule binding these axons together. Yet, in the limb bud, fasciclin IV is expressed on a band of epithelium but not on the growth cones that reorient along this band, suggesting a heterophilic function. That fasciclin IV
functions in a heterophilic rather than homophilic fashion is supported by the lack of homophilic adhesion in S2 cell aggregation assays. In contrast, fasciclin I, fasciclin II, fasciclin III, and neuroglian all can function as homophilic cell adhesion molecules (Snow et al., 1989; Elkins et al., 1990b; Grenningloh et al., 1990).
cDNA seque~lYCe analysis indicates that fasciclin IV is an integral membrane protein with a novel sequence not related to any protein in the present data base.
Thus, fasciclin IV represents a new type of protein that functions in the epithelial guidance of pioneer growth cones in the developing limb bud. Given its expression on a subset of axon pathways in the developing CNS, fasciclin IV
functions in the guidance of CNS growth cones a~ well.

_ ._.__.._~_._ _.. __. ....._..._~..._...._.T...__-.....__._...~__..._.........

WO 95/07706 21 7 1 fi 3 8 ' PCTIUS94110151 c The results from the MAb blocking experiments illuminate several issues in Til growth cone guidance and axon morphogenesis in the limb. First, the most striking change in growth cone behavior in the limb is the cessation of proximal growth and initiation of circumferential extension of processes upon encountering the lxochanter/coxa boundary region (Bentley and Caudy, 1983; Caudy and Bentley, 198'x. This could be because the band of epithelial cells within the trochanter promotes circumferential growth, or because the cells comprising the trochanter/coxa boundary and the region just proximal to it are non-permissive or aversive for growth cone migration, o~r both. The extension of many axon branches across the trochanter/coxa boundary following treatment with MAb 6F8 suggests that the lrochanterlcoxa boundary cells, which do not express fasciclin IV, are not aversive or non-permissive. 7.'hus the change in behavior at the boundary appears to be due to the ability of fasciclin IV expressing epithelial cells to promote circumferential extension of processes from the Til growth cones.
Secondly, treatment with MAb 6F8 results in frequent defasciculation of the axons of the two Til neurons, and also formation of abnormal multiple axon branches, within the trochanter over fasciclin IV-expressing epithelial cells.
Previous studies have shown that treatment with antibodies against ligands expressed on non-neural substrates (L~andmesser et al., 1988), or putative competitive inhibitors of substrate ligands (Wang and Denburg, 1992) can promote defasciculation and increased axonal branching. Our results suggest that Til axon:axon fasciculation and axon branching also are strongly influenced by interactions with substrate ligands, and that fasciclin IV appears to be a component of this interaction within the trochante:r.
Thirdly, despite the effects of :MAb 6F8 on axon branching, and on crossing the trochanter/coxa boundary, there remains a pronounced tendency for branches to grow ventrally both within the trochanter and within the distal region of the coxa. Consequently, all signals which can promote ventral migration of the growth cones have not been blocked by MAb 6F8 treatment. Antibody treatment may have a threshold effect in which ventral growth directing properties of fasciclin IV are more robust, and less incapacitated by treatment, than other features; alternatively, guidance information promoting ventral migration may be 2,~ 7 ~1_6 3 8 PCTIL1S94/1~151 independent of fasciclin IV. Time lapse video experiments to determine how the abnormal pathways we observe actually form can resolve these issues.
These results demonstrate that fasciclin IV functions as a guidance cue for the Til growth cones just distal to the trochanter/coxa boundary, is required for these growth cones to stop proximal growth and spread circumferentially, and that the function of fasciclin IV in Til pathway formation result from interactions between a receptor/ligand on the Til growth cones and fasciclin IV on the surface of the band of epithelial cells results in changes in growth cone morphology and subsequent reorientation. Fasciclin IV appears to elicit this change in growth cone morphology and orientation via regulation of adhesion, a signal transduction function, or a combination of the two.
Experimental Procedures Immunocytoc6emistry Grasshopper embryos were obtained from a colony maintained at the U.C.
Berkeley and staged by percentage of total embryonic development (Bentley et al. , 1979). Embryos were dissected in PBS, fixed for 40 min in PEM-FA [0.1 M
PIPES (pH6.95), 2.0 mM EGTA, 1.0 mM MgS04, 3.7% formaldehyde], washed for 1 hr with three changes in PBT (lx PBS, 0.5% Triton X-100, 0.2% BSA), blocked for 30 min in PBT with 5 % normal goat serum, and incubated overnight at 4°C in primary antibody. PBSap (lx PBS, 0.1% Saponin, 0.2% BSA) was used in place of PBT with MAb 8G7. Antibody dilutions were as follows: MAb 6F8 l:l, polyclonal antisera directed against a fasciclin IV bacterial fusion protein (~98-3) 1:400; MAb 8G7 1:4; MAb 8C6 1:1. The embryos were washed for one hour in PBT with three changes, blocked for 30 min, and incubated in secondary antibody for at least 2 hr at room temperature. The secondary antibodies were HRP-conjugated goat anti-mouse and anti-rat IgG (Jackson Immunoresearch Lab), and were diluted 1:300. ~ Embryos were washed in PBT for one hour with three changes and then reacted in 0.5 % diaminobenZidine (DAB) in PBT. The reaction was stopped with several washes in PBS and the embryos were cleared in a glycerol series (50 % , 70 % , 90 % ), mounted and viewed under Nomarski or bright field optics. For double-labelled preparations the first HRP reaction was done in PBT containing 0.06 % NiCl, followed by washing, blocking, and incubation ........ .... ......._...__._. ........__. .._...~.....__ _.........__ .....
......_.._...., ......_,.T..... .... _......

overnight in the second primary antibody. The second antibody was visualized with a DAB reaction as described above. Embryos cultured in the presence of monoclonal antibodies were fixed and incubated overnight in goat anti-HRP (Jackson Immunoresearch Labs) conjugated to RITC (Molecular Probes), washed for one hour in PBT with three changes, mounted in 90% glycerol, 2.5°,~o DABCO (Polysciences), and viewed under epifluorescence. S2 cells were stained with polyclonal sera #98-3 diluted 1:400 and processed as described previously (Snow et al., 1989).
Monoclonal Antibody Blocking Experiments In order to test for functional blocking, monoclonal antibody reagents were prepared as follows. Hybridoma supernatant was brought to 20% with HZO-saturated NH4S04, incubated in ice 1 hr, and spun at 15,000 g at 4°C for 20 min. The supernatant was brought to 56% with Hz0-saturated NH4S04, incubated overnight at 4°C, spun as above. The pellet was resuspended in PBS using approximately 1/40 volume of the original hybridoma supernatant (often remaining a slurry) andl dialyzed against lx PBS overnight at 4°C with two changes. This reagent is referred to as "concentrated hybridoma supernatant." Purified IgG was obtained by using Immunopure P:UusTM immobilized protein A IgG
purification kit (Pierce) to isolate IgG from the concentrated hybridoma supernatant. Fab fragments were obtained using the ImmunoPure~''~'' Fab preparation kit (Pierce) from the previously isolated IgGs. For blocking experiments each reagent was diluted into freshly made supplemented RPMI culture media (O'Connor et al., 1990) and dialyzed overnight at 4°C against 10 volumes of the same culture media. Dilutions were as follows: concentrated hybridoma supernatant 1:4; purified IgG 1 SOmg/ml; :Fab 75mg/ml.
Embryos for culture experiments were carefully staged to between 31 and 32% of development. As embryos in each clutch typically differ by less that 1% of embryonic development from each other, the growth cones of the Ti 1 neurons at the beginning of the culture period were located approximately in the mid-femur, well distal to the trochanter/coxa segment boundary. From each clutch at least two limbs were filleted and the Ti1 neurons labelled with the lipophillic dye Di I (Molecular Probes) as described (O'Connor et al., 1990) in order to confirm the precise location of the Til growth cones. Prior to culturing, embryos were sterilized and dissected (Chang et al.,1992). The entire amnion and dorsal membrane was removed from the embryo to insure access of the reagents during culturing. Embryos were randomly divided into groups and cultured in one of i:he blocking reagents described above. Cultures were incubated with occasional agitation at 30°C for 30 hrs. At the end of the culture period embryos were fixed and processed for analysis as described above in immunocytochemistry.
For each culture experiment, the scoring of the Ti 1 pathway in each limb was confirmed independently by a second observer. There was no statistically significant variation between the two observers. Limbs from MAb cultured embryos were compared to representative normal limbs from non-MAb cultured embryos and were scored as abnormal if any major deviation from the normal Til pathway was observed. The Til pathway was scored as abnormal for one or more of the following observed characteristics:
(1) defasciculation for a minimum distance of approximately 25 mm anywhere along the pathway, (2) multiple axon branches that extended ventrally within the trochanter, (3) presence of one or more axon branches that crossed the trochanter/coxa boundary dorsal to the Cxl cells, but then turned ventrally in the coxa and contacted the Cxl cells, (4) the presence of axon branches that crossed the trochanter/coxa segment boundary, did not turn ventrally, but continued proximally toward the CNS, and (5) failure of ventrally extended axons within the trochanter to contact and reorient proximally to the Cxl cells. For each MAb tested, the data are presented as a percentage of the abnormal Ti 1 pathways observed.
Protein Affinity Purification and Microsequencing Grasshopper fasciclin IV was purified by passing crude embryonic grasshopper lysate (Bastiani et al., 1987) over an Affi-cJel 1 STM column (Bio Rad) conjugated with the monoclonal antibody 6F8. Protein was eluted with 50 mM DEA (pH 11.5), 0.1%
Lauryldimethylamine oxide (Cal Bio C',hem), and 1mM EDTA. Protein was then precipitated, denatured, modified at cyste~ines, and digested with either trypsin or Lys-C
(Boehringer-Mannheim). Individual peptides were resolved by RP-HPLC and microsequenced (Applied Biosystems 47'71 Microsequencer) using standard chemistry.

PCR Methods DNA complementary to poly(A)+ RNA from 45%-50% grasshopper embryos was prepared (Sambrook et al.,1989). PCR was performed using Perkin Elmer Taq polymerase (Saiki et al., 1988), and partially degenerate (based on grasshopper codon bias) oligonucleotides in both orientations corresponding to a portion of the protein sequence of several fasciclin IV peptides as determined by microsequencing. These oligonucleotides were designed so as not to include all of the peptide-derived DNA sequence, leaving a remaining 9-12 base pairs that could be used to confirm the correct identity of amplified products. All possible combinations of these sequences were tried. 40 cycles were performed, the parameters of each cyclE; as follows: 96° for one min; a sequentially decreasing annealing temperature (2°C/cycle, starting at 65°C
and ending at 55°C for remaining 35 cycles) for 1 min; and at 72"C for one min. Reaction products were cloned into the Sma site of M13 mpl0 and sequenced. Two products, 1074 by and 288 by in length, contained DNA 3' to the oligonucleotide sequences encoded the additional amino acid sequence of the fasciclin IV peptide :from which the oligonuceotides were derived.
cDNA Isolation and Sequence Analysis Both PCR products were used to screen 1 X 106 clones from a grasshopper embryonic cDNA library (Snow et al., 1988). 21 clones that hybridized to both fragments were recovered, and one 2600 by clone was sequenced using the dideoxy chain termination method (Sanger et al., 1977) and SequenaseTM (US Biochemical Corp.). Templates were made from M 13 mp 10 vectors containing inserts generated by sonication of plasmid clones.
One cDNA was completely sequenced on both strands using oligonucleotides and double strand sequencing of plasmid DNA (Sam~brook et al., 1989) to fill gaps. Two additional cDNAs were analyzed by double strand sequencing to obtain the 3' 402 by of the transcript.
All three cDNAs were used to construct a plasmid containing the entire transcript. The complete transcript sequence is 2860 by in length with 452 by of 5' and 217 by of 3' untranslated sequences containing stop codons in all reading frames.
The predicted protein sequence was analyzed using the FASTDB~ and BLASTPTM
programs (Intelligenetics). The fasciclin IV ORF unambiguously contains 10 of the 11 peptide sequences determined by microsequencing the fasciclin IV trypsin and Lys-C
peptides.
Generation of Polyclonal Antibodies From Bacterial Fusion Proteins Bacterial trpE fusion proteins were; constructed using pATH (Koerner et al., 1991) vectors, three restriction fragments encoding extracellular sequences, and one fragment (770 by HindIII/ Eco R1, which includes amino acids 476-730 ) encoding both extracellular and intracellular sequences (designated #98-3). Fusion proteins were isolated by making an extract of purified inclusion bodies (Spindler et al., 1984), and rats were immunized with ~70mg of protein emulsified in RIBITM adjuvant (Immunochem Research).
Rats were injected at two week intervals and serum was collected 7 days following each injection.
Sera were tested histologically on grasshopper embryos at 45% of development.
Construct #98-3 showed a strong response and exhibited a staining pattern identical to that of MAb 6F8. Two of the extracellular constructs responded weakly but also showed the fasciclin IV staining pattern. All pre-immune sera failed to stain grasshopper embryos.
S2 Cell Transfections, Aggregation Assays, and Western Analysis A restriction fragment containing t:he full length fasciclin IV cDNA was cloned into pRmHa-3 (Bunch et al, 1988) and co-transformed into Drosophila S2 cells (Schneider, 1972) with the plasmid pPC4 (Jokerst et a., 1989), which confers a-amanitin resistance.
S2 cells were transformed using the Lipofe;ctin Reagent and recommended protocol (BRL) with minor modifications. All other S2 cell manipulations are essentially as described (Snow et al.,1989), including adhesion assays. Fasciclin IV expression in transformed cell lines was induced for adhesion assays and histology by adding CuS04 to 0.7 mM
and incubating for at least 48 hrs. Northern analysis confirmed transcription of fasciclin IV and surface-associated staining of the S2 cells with polyclonal serum #98-3 strongly suggests fasciclin IV is being transported to the cell surface. Preparation of membranes s PCT/US94/10151 from S2 cells and from grasshopper embryos, PAGE, and Western blot were performed as previously described (Elkins et al., 1990b) except that signal was detected using the enhanced chemiluminescence immunodetection system kit (Amersham) . Amount of protein per lane in each sample loaded: fasciclin IV
protein, - 5 ng; S2 cell membranes, 40 mg; grasshopper membranes 80 mg.
Amounts of protein loaded were verified by Ponceau S staining of the blot prior to incubation with the antibody.
References cited in Example I
Altschul et al. (1990) J. Mol. Biol. 215:403-410; Bastiani et al. (1992) Dev.
Biol. , in press.; Bastiani et al. (1986) J. Neurosci. 6:3518-3531; Bastiani et al.
(1986) J.
Neurosci. 6:3542-3551; Bastiani et al. 1;1987) Cell 48:745-755; Bastiani et al.
(1984) J. Neurosci. 4:2311-2328; Bentley and Caudy (1983) Nature 304:62-65;
Bentley et al. (1979) J. Embryol. Exp. Morph. 54:47-74; Bentley and O'Connor (1992); Letourneau et al. (New York: lZaven Press, Ltd.), pp. 265-282; Bunch et al. (1988) Nucleic Acids Res. 16:1043-1061; Chang et al. (1992) Development 114:507-519; Caudy and Bentley (1987) Dev. Biol. 119:454-465; Chou and Fasman (1974) Biochemistry 13:222-245; Elkins et al. (1990a) Cell 60:565-575;
Elkins (1990b) J. Cell Biol. 110:1825-.1832; Goodman et al. (1981) J.
Neurosci.
1:94-102; Grenningloh et al. (1990) Symp. Quart. Biol. 55:327-340; Grenningloh et al. (1991) Cell b7:45-57; Harrelson and Goodman (1988) Science 242:700-708;
Jacobs and Goodman (1989) J. Neurosci. 7:2402-2411; Jay and Keshishian (1990) Nature 348:548-551; Jokerst et al. (1989) Mol. Gen. Genet. 215:266-275;
Koerner et al. (1991) Methods Enzymol. 194:477-490; Landmesser et al. (1988) Dev.
Biol.
130:645-670; Lefcort and Bentley (19E~7) Dev. Biol. 119:466-480; Lefcort and Bentley (1989) J. Cell. Biol. 108:1737-1749; O'Connor et al. (1990) J.
Neurosci.
10:3935-3946; Fatel et al. (1989) Cell 58:955-968; Patel et al. (1987) Cell 48:975-988; Raper et al. (1984) J. Neurosci. 4:2329-2345; Saiki et al. (1988) Science 239:487-494; Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual (Cold Spring Harbor, New York: Coki Spring Harbor Laboratory); Sanger et al.
(1977) Proc. Natl. Acad. Sci. USA 74:5463-5467; Schneider (1972) J. Embryol.
Exp. Morphol. 27:353-365; Snow et al. (1989) Cell 59:313-323; Snow et al.
(1988) Proc. Natl. Acad. Sci. USA 85:5291-5295; Spindler et al. (1984) J.
~rol.

wo 9sio~~o6 PCTIUS941101s1 2 ~' '~~ ~ rs 3' 8 49:132-141; Wang and Denburg (1992) Neuron. 8:701-714; Wang et al. (1992) J.
Cell Biol. 118:163-176; and Zinn et al. (1988) Cell 53:577-587.
Genbank Accession Number:
The accession number for the sequence reported in this paper is L00709.
II. Isolation and characterization of Tribolium (SEfZ ID NOs~ 63 and 641 and Drosophila ISEC,~ ID NOs~ 59 and 60LSemanhorin I. Drosophila Semaphorin II
(SEO ID NOs~61 and 62) Human Semanhorin III ISEQ ID NOs~ 53 and 54) and Vaccinia Virus Semaphorin IV (SEQ ID NOs~ 55 and 56) and Variola Ma~
lsmallpoxl Virus Semanhorin IV (SEO ID NOs~ 65 and 66~
We used our G-Semaphorin I cDNA in standard low stringency screening methods (of both cDNA and genomic libraries) in an attempt to isolate a potential Semaphorin I homologue from Drosophila. We were unsuccessful in these screens. Since the sequence was novel and shared no similarity to anything else in the data base, we then attempted to see if we could identify a Semaphorin I
homologue in other, more closely related insects. If possible, we would then compare these sequences to find the most conserved regions, and then to use probes (i.e., oligonucleotide primers for PCR) based on these conserved regions to find a Drosophila homologue.
In the process, we used the G-Semaphorin I cDNA in low stringency screens to clone Semaphorin I cDNAs from libraries made from locust Locusta migratoria embryonic RNA and from a cDNA embryonic library from the cricket Acheta domestica. We used PCR to clone genomic fragments from genomic DNA
in the beetle Tribolium, and from the moth Manduca. We then used the Tribolium genomic DNA fragment to isolate cDNA clones and ultimately sequenced the complete ORF for the Tribolium cDNA.
In the meantime, we used the partial Tribolium and Manduca sequences in combination with the complete grasshopper sequence to identify conserved regions that allowed us to design primers for PCR in an attempt to clone a Drosophila Semaphorin I homologue. Several pairs of primers generated several different bands, which were subcloned and sequenced and several of the bands gave partial WO 95/07706 2 ~ 7 16 3 8 - PCTIi1S94110151 sequences of the Drosophila Semaphcirin homologue. One of the bands gave a partial sequence of what was clearly a different, more divergent gene, which we call D-Semaphorin II.
Based on the sequence of PCR products, we knew we had identified two different Drosophila genes, one of which appeared to be the Semaphorin I
homologue, and the other a second related gene. The complete ORF sequence of the D-Semaphorin I homologue revealed an overall structure identical to G-Semaphorin I: a signal sequence, an ~extracellular domain of around 550 amino acids containing 16 cysteines, a transmembrane domain of 25 amino acids, and a cytoplasmic domain of 117 amino aciids. When we had finished the sequence for D-Semaphorin II, we were able to begin to run homology searches in the data base, which revealed some of its structural features further described herein.
The Semaphorin II sequence revealed a dufferent structure: a signal sequence of 16 amino acids, a - 525 amino acid dornain containing 16 cysteines, with a single immunoglobulin (Ig) domain of 66 amino acids, followed by a short unique region of 73 amino acids. There is no evidence for either a transmembrane domain or a potential phospholipid linkage in the C-terminus of this protein. Thus, it appears that the D-Semaphorin II protein is s~reted from the cells that produce it.
The grasshopper, Tribolium, and Drosophila Semaphorin I cDNA sequences, as well as the sequence of the D-Semaphorin II cDNA, are shown herein. In addition, we used this same technique to identify Semaphorin I genes in a moth, Manduca sexta, a locust, Locusts migratoria, and a cricket, Acheta domestics.
With this large family of insect Semaphorin genes, we identified a number of good stretches of the right amino acids (with the least degeneracy based on their codons) with strong homology for designing primers for PCR to look for human genes. We designed a set of oligonucleotide primers, and plated out several human cDNA libraries: a fetal brain library (Stratagene), and an adult hippocampus library. We ultimately obtained a human cDNA PCR bands of the right size that did not autoprime and thus were good candidates to be bonafide Semaphorin-like cDNAs from humans. These bands were purified, subcloned, and sequenced.
Whole-mount in situ hybridization experiments showed that D-Semaphorin I
and II are expressed by different subsets of neurons in the embryonic CNS. D-Semaphorin I is expressed by certain cells along the midline as well as by other neurons, whereas D-Semaphorin II is not expressed at the midline, but is expressed by a different subset of neurons. In addition.. D-Semaphorin II is expressed by a subset of muscles prior to and during the period of innervation by specific motoneuron.
On the polytene chromosomes, the D-Semaphorin I gene maps to (gene-band-chromosome) 22L and that of D-Semaphorin II to 53(J9-1028. We have identified loss of function mutations in the D-Semaphorin I gene andl a pair of P-element transposon insertions in the D-Semaphorin II gene which appear to camse severe phenotypes.
When we lined up the G-Semaphorin I, T-Semaphorin I, D-Semaphorin I, and D-Semaphorin II sequences and ran the sequences through a sequence data base in search of other sequences with significant similarity, we discovered a curious finding:
these Semaphorins share sequence similarity v~rith the A39R open reading frame (ORF) from Vaccinia virus and the A43R ORF from V~~riola Major (smallpox) virus and we discovered that the amino acids shared with the virus ORF were in the same regions where the insect proteins shared their greatest similarity. The viral OIL' began with a putative signal sequence, continued for several hundred amino acids with sequence similarity to the Semaphorin genes, and then ended without any membrane linkage signal (suggesting that the protein as made by the infected cell would likely be se~ret~,d).
We reasoned that the virus se~maphorins were appropriated host proteins advantageously exploited by the viruses, which would have host counterparts that most likely function in the immune system to inhibit or decrease an immune response, just as in the nervous system they appear to function by inhibiting growth cone extension.
Analogous to situations where viruses ane thought to encode a secreted form of a host cellular receptor, here the virus may cause the infected cell to make a lot of the secreted ligand to mimic an inhibitory signal and thus help decrease the immune response.
III. Isolation and characterization of Marine CNS Semaphorin III Receptor using Epitope Tagged Human Semaphorin III (hSIII) mRNA was isolated from marine fetal brain tissue and used to construct a cDNA
library in a mammalian expression vector, pCMX, essentially as in Davis et al.
(1991) Science 253, 59.

. 2171638 The transfection and screening procedure is modified from Lin et al (1992) Cell 68, 775. COS cells grown on glass slide flaskettes are transfected with pools of the eDNA
clones, allowed to bind radioiodinated hSIII truncated at the C-terminus end of the semaphorin domain. In parallel, similarly treated COS cells are allowed to bind unlabelled human semaphorin III truncated at the C-terminus end of the semaphorin domain and there joined to a 10-amino acid extension derived from the human c-myc proto-oncogene product. This modified hSIII allows the identification of hSIII receptors with the use of the tagged ligand as a bridge between the receptor and a murine monoclonal antibody which is specific for an epitope in the c-myc tag. Accordingly, after binding unlabelled hSIII the cells are exposed to the monoclonal wlhich may be labeled directly or subsequently decorated with a secondary anti-mouse labeled antibody for enhanced signal amplification.
Cells are then fixed and screened using dark-field microscopy essentially as in Lin et al. (supra). Positive clones are identified and sequence analysis of murine CNS
Semphorin III receptor cDNA clones by the dideoxy chain termination method is used to construct full-length receptor coding sequences.
IV. Protocol for Protein-Protc;in H-Sema III - H-Sema III Receptor Drug Screening Assay.
A. Reagents:
- Neutralite Avidin: 20 pg/ml in PBS.
- Blockin bg uffer: 5% BSA, 0.5% Tween 20 in PBS; 1 hr, RT.
- Assay Buffer: 100 mM KCI, 20 mM HF;PES pH 7.6, 0.25 mM EDTA, 1% glycerol, 0.5 NP-40, 50 mM BME, 1 mg/ml BSA, protease inhibitor cocktail.
33p H_Sema III lOx stock: 10'8 - 10-6 M "cold" truncated (Semaphorin domain) H-Sema III supplemented with 50,000-500,000 cprn of labeled and truncated H-Sema III
(Beckman counter). Store at 4 °C during screening.
- Protease inhibitor cocktail (100X): 1 mg Trypsin Inhibitor (BMB # 109894), 1 mg Aprotinin (BMB # 236624), 2.5 mg Ben:aamidine (Sigma # B-6506), 2.5 mg Leupeptin (BMB # 1017128), 1 mg APMSF (BMB ~'- 917575), and 0.2m M NaVo3 (Sigma # S-6508) in 10 ml of PBS.

- H-Sema III Receptor: 10-8 - 10-6 M of triotinylated H-Sema III biotinylated receptor in PBS.
B. Preparation of assay plates:
- Coat with 120 pl of stock N-Avidin per well at least 1 hr at 25C or overnight at 4 °C.
- Wash 2X with 200 pl PBS.
- Block with 150 ~l of blocking buffer.
- Wash 2X with 200 pl PBS.
C. Assay:
- Add 40 ~1 assay buffer/well.
- Add 10 ~1 candidate agent.
- Add 10 pl 33P-H-Sema III (5,000-50,000 cpm/0.1-10 pmoles/well =10-9- 10-' M
final concentration).
- Mix - Incubate 1 hr. at 25C.
- Add 40 pl H-Sema III receptor (0.1-10 pmoles/40 ul in assay buffer) - Incubate 1 hr at 25C.
- Stop the reaction by washing 4X: with 200 wl PBS.
- Add 150 ~1 scintillation cocktail.
- Count in Topcount.
D. Assay controls (located on each p:late):
a. Non-specific binding (no receptor added) b. Soluble (non-biotinylatf;d receptor) at 80% inhibition.
It is evident from the above result.. that one can use the methods and compositions disclosed herein for making and identifying diagnostic probes and therapeutic drugs. It will also be clear to one skilled in the art frorri a reading of this disclosure that advantage can be taken to effect alterations of semaphorin responsiveness in a host.
Although the foregoing invention has been described in some detail by way of WO 95/07706 21 7 16 3 8 pCT/US94/10151 illustration and example for purposes of clarity of understanding, it will be readily apparent to those of ordinary skill in the art in light of the teachings of this invention that certain changes and modifications may be made thereto without departing from the spirit or scope of 'the appended claims.

r s ~.., SEQUENCE LISTINGS
Sequences S3-68 show the nucleotide <~nd deduced amino-acid sequences of human semaphorin III, vaccinia virus semaphorin IV, grasshopper semaphorin I, Drosophila semaphorin I, Drosophila semaphorin II, Tribolium semaphorin I and variola major virus S semaphorin IV.
(1) GENERAL INFORMATION
SEQiJENCE LISTING
lO (i) APPLICANT: Goodman, Corey S.
Kolodkin, Alex L.
Matthes, David Bentley, David R.
0' Connor, Timothy (ii) TITLE OF INVENTION: The Semaphorin Gene Family (iii) NUMBER OF SEQUENCES: 100 2O (iv) CORRESPONDENCE ADDRESS:

(A) ADDRESSEE: SCIENCE & ~.'ECHNOLOGY LAW GROUP

(B) STREET: 268 Bush Street, Suite 3200 (C) CITY: San Francisco (D) STATE: CA

2S (E) COUNTRY: USA

(F) ZIP: 94104 (v) COMPUTER READABLE FORM:

(A) MEDIUM TYPE: Floppy <3isk 3O (B) COMPUTER: IBM PC (TM) compatible (C) OPERATING SYSTEM: PC--DOS (TM) / MS-DOS (TM) (D) SOFTWARE: PatentIn (TM) ~telease #1.0, Version #1.25 (vi) CURRENT APPLICATION DATA:

3S (A) APPLICATION NUMBER:

(B) FILING DATE: 13-SEP-7.994 (C) CLASSIFICATION:

(viii) ATTORNEY/AGENT INFORMATIOPd:

4O (A) NAME: Osman, Richard A.

(B) REGISTRATION NUMBER: 36,627 (C) REFERENCE/DOCKET NUME3ER: B94-002-PCT

(ix) TELECOMMUNICATION INFORMA7.'ION:

4S (A) TELEPHONE: (415)343-4341 (B) TELEFAX: (415) 343-4342 (C) TELEX:

(2) INFORMATION
FOR SEQ
ID N0:1:

SO (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 6 amino acida (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear SS (ii) MOLECULE TYPE: peptide (ix) FEATURE:

2'.171638 or N at residue #3; and Y,F or V at residue #5"
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:
Xaa Cys Xaa Asn Xaa Ile (2) INFORMATION FOR SEQ ID N0:2:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 6 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix) FEATURE: .
(A) NAME/KEY: Peptide (B) LOCATION: 1..6 (D) OTHER INFORMATION: /label= SEQ02 /note= "Xaa denotea Q,K,R,A or N at residue #2;
Y,F or V at residuE~ #4; and R,K,Q or T at residue #6"
(xi) SEQUENCE DESCRIPTION: SEQ :CD N0:2:
Cys Xaa Asn Xaa Ile Xaa (2) INFORMATION FOR SEQ ID N0:3:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 7 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix) FEATURE:
(A) NAME/KEY: Peptide (B) LOCATION: 1..7 (D) OTHER INFORMATION: /laibel= SEQ03 /note= "Xaa denotes N or G at residue #4; A,S or N
at residue #5; Y,F,H or G at residue #6; and K,R,H,N or Q at residue #7"
(xi) SEQUENCE DESCRIPTION: SEQ ::D N0:3:
Cys Gly Thr Xaa Xaa Xaa Xaa (2) INFORMATION FOR SEQ ID N0:4:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 8 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix) FEATURE:
(A) NAME/KEY: Peptide (B) LOCATION: 1..8 (D) OTHER INFORMATION: /label= SEQ04 /note= "Xaa denotes N or G at residue #4; and A,S
or N at residue #5"
(xi) SEQUENCE DESCRIPTION: SEQ _:D N0:4:
Cys Gly Thr Xaa Xaa Xaa Xaa Pro ~6 3 ~" 2171638 (2) INFORMATION FOR SEQ ID N0:5:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 10 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix) FEATURE:
(A) NAME/KEY: Peptide (B) LOCATION: 1..10 (D) OTHER INFORMATION: /label= SEQ05 /note= "Xaa denotes N or G at residue #4; and C or D at residue #10"
(xi) SEQUENCE DESCRIPTION: SEQ :CD N0:5:
Cys Gly Thr Xaa Xaa Xaa Xaa Pro Xaa Xaa (2) INFORMATION FOR SEQ ID N0:6:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 13 amino acid::
(B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix) FEATURE:
(A) NAME/KEY: Peptide (B) LOCATION: 1..13 (D) OTHER INFORMATION: /label= SEQ06 /note= "Xaa denotea~ C or D at residue #10; and Y
or I at residue #13"
(xi) SEQUENCE DESCRIPTION: SEQ I'D N0:6:
Cys Gly Thr Xaa Xaa Xaa Xaa Pro Xaa Xaa Xaa Xaa Xaa (2) INFORMATION FOR SEQ ID N0:7:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 7 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix) FEATURE:
(A) NAME/KEY: Peptide (B) LOCATION: 1..7 (D) OTHER INFORMATION: /label= SEQ07 /note= "Xaa denotes R,I,Q or V at residue #1; G or A at residue #2; L,V or K at residue #3; C or S at residue #4; F or Y at residue #6; and D or N at residue #7"
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:7:
Xaa Xaa Xaa Xaa Pro Xaa Xaa (2) INFORMATION FOR SEQ ID N0:8:

21 71638_ (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 7 amino acids.

(B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix) FEATURE:

(A) NAME/KEY: Peptide (B) LOCATION: 1..7 (D) OTHER INFORMATION: /Label=

/note= "Xaa denotes C or S at residue #1; F or Y

at residue #3; D or N at residue #4; D,E,R or K at residue #6;.and H,L or D at residue #7"

(xi) SEQUENCE DESCRIPTION: SEQ ID
NO: B:

Xaa Pro Xaa Xaa Pro Xaa Xaa (2) INFORMATION
FOR SEQ
ID N0:9:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 9 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix) FEATURE:

(A) NAME/KEY: Peptide (B) LOCATION: 1..9 (D) OTHER INFORMATION: /label=

/note= "Xaa denotes G or A at residue #3; C or S

at residue #5; and D or N at residue #8"

(xi) SEQUENCE DESCRIPTION: SEQ ID
N0:9:

Gly Xaa Xaa Xaa Xaa Pro Tyr Xaa Pro (2) INFORMATION
FOR SEQ
ID NO:10:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 7 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix) FEATURE:

(A) NAME/KEY: Peptide (B) LOCATION: 1..7 (D) OTHER INFORMATION: /label=

/note= "Xaa denotes F or Y at residue #2; G or A

at residue #4; and V,N or A at residue #6"

(xi) SEQUENCE DESCRIPTION: SEQ ID
NO:10:

Leu Xaa Ser Xaa Thr Xaa Ala (2) INFORMATION
FOR SEQ
ID NO:11:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 9 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix) FEATURE:

(A) NAME/KEY: Peptide (B) LOCATION: 1..9 (D) OTHER INFORMATION: /label=

/note= "Xaa denotes F or Y at residue #2; D
or E

at residue #8; and F or Y at residue #9"

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:11:

Leu Xaa Ser Xaa Thr Xaa Ala Xaa Xaa (2) INFORMATION
FOR SEQ
ID N0:12:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 8 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix) FEATURE:

(A) NAME/KEY: Peptide (B) LOCATION: 1..8 (D) OTHER INFORMATION: /label=

/note= "Xaa denote~a F or Y at residue #l; G
or A

at residue #3; V,N or A at residue #5; D or E at residue #7; and F or Y at residue #8"

(xi) SEQUENCE DESCRIPTION: SEQ :CD
N0:12:

Xaa Ser Xaa Thr Xaa Ala Xaa Xaa (2) INFORMATION
FOR SEQ
ID N0:13:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 7 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix) FEATURE:

(A) NAME/KEY: Peptide (B) LOCATION: 1..7 (D) OTHER INFORMATION: /label=

/note= "Xaa denote: N or D at residue #2; and A or K at residue #3"

(xi) SEQUENCE DESCRIPTION: SEQ 7.D
N0:13:

Leu Xaa Xaa Pro Asn Phe Val (2) INFORMATION
FOR SEQ
ID N0:14:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 5 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ I:D
N0:14:

Phe Phe Phe Arg Glu 9: 6 (2) INFORMATION FOR SEQ ID N0:15:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 6 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix) FEATURE:
(A) NAME/KEY: Peptide (B) LOCATION: 1..6 (D) OTHER INFORMATION: /label= SEQ15 /note= "Xaa denotes F or Y at residue #3; and T or N at residue #6"
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:15:
Phe Phe Xaa Arg Glu Xaa (2) INFORMATION FOR SEQ ID N0:16:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 6 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix) FEATURE:
(A) NAME/KEY: Peptide (B) LOCATION: 1..6 (D) OTHER INFORMATION: /label= SEQ16 /note= "Xaa denotes T or N at residue #5"
(xi) SEQUENCE DESCRIPTION: SEQ :ID N0:16:
Phe Phe Arg Glu Xaa Ala (2) INFORMATION FOR SEQ ID N0:17:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 6 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix) FEATURE:
(A) NAME/KEY: Peptide (B) LOCATION: 1..6 (D) OTHER INFORMATION: /label= SEQ17 /note= "Xaa denotes F or Y at residue #2; and T or N at residue #5"
(xi) SEQUENCE DESCRIPTION: SEQ ::D N0:17:
Phe Xaa Arg Glu Xaa Ala (2)-INFORMATION FOR SEQ ID N0:18:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 6 amino acids (B) TYPE: amino acid ~6 7 (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix) FEATURE:
(A) NAME/KEY: Peptide (B) LOCATION: 1..6 (D) OTHER INFORMATION: /label= SEQ18 /note= "Xaa denotes F or Y at residue #4"
(xi) SEQUENCE DESCRIPTION: SEQ :ID N0:18:
Tyr Phe Phe Xaa Arg Glu (2) INFORMATION FOR SEQ ID N0:19:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 6 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix) FEATURE:
(A) NAME/KEY: Peptide (B) LOCATION: 1..6 (D) OTHER INFORMATION: /label= SEQ19 /note= "Xaa denoteea F or Y at residue #1; and F or Y at residue #4"
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:19:
Xaa Phe Phe Xaa Arg Glu (2) INFORMATION FOR SEQ ID N0:20:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 7 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix) FEATURE:
(A) NAME/KEY: Peptide (B) LOCATION: 1..7 (D) OTHER INFORMATION: /label= SEQ20 /note= "Xaa denote: F or Y at residue #1; F or Y
at residue #2; F or Y at residue #3; and T or N at residue #6"
(xi) SEQUENCE DESCRIPTION: SEQ 1:D N0:20:
Xaa Xaa Xaa Arg Glu Xaa Ala (2) INFORMATION FOR SEQ ID N0:21:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 7 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix) FEATURE:
(A) NAME/KEY: Peptide 9: 8 (B) LOCATION: 1..7 (D) OTHER INFORMATION: /label= SEQ21 /note= "Xaa denotes I or V at residue #l; F or Y
at residue #2; F or Y at residue #4; and F or Y at residue #5"
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:21:
Xaa Xaa Phe Xaa Xaa Arg Glu (2) INFORMATION FOR SEQ ID N0:22:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 7 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix) FEATURE:
(A) NAME/KEY: Peptide (B) LOCATION: 1..7 (D) OTHER INFORMATION: /label= SEQ22 /note= "Xaa denote;a K,F or Y at residue #2; F or Y
at residue #4; F;Y,I or L at residue #5; F,Y,I or L at residue #6; amd F or Y at residue #7"
(xi) SEQUENCE DESCRIPTION: SEQ :CD N0:22:
Asp Xaa Val Xaa Xaa Xaa Xaa (2) INFORMATION FOR SEQ ID N0:23:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 8 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix) FEATURE:
(A) NAME/KEY: Peptide (B) LOCATION: 1..8 (D) OTHER INFORMATION: /label= SEQ23 /note= "Xaa denotes V or I at residue #l; F or Y
at residue #2; F,Y,I or L at residue #3; F,Y,I or L at residue #4; R or T at residue #6; and T or N
at residue #8"
(xi) SEQUENCE DESCRIPTION: SEQ 7:D N0:23:
Xaa Xaa Xaa Xaa Phe Xaa Xaa Xaa~

(2) INFORMATION FOR SEQ ID N0:24:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 8 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix) FEATURE:
(A) NAME/KEY: Peptide (B) LOCATION: 1..8 2171fi~8 (D) OTHER INFORMATION: /label= SEQ24 /note= "Xaa denotes V or I at residue #1; F or Y
at residue #2; F,Y,I or L at residue #3; F,Y,I or L at residue #4; F or Y at residue #5; R or T at residue #6; E,D or V at residue #7; and T or N at residue #e"
(xi) SEQUENCE DESCRIPTION: SEQ :CD N0:24:
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa (2) INFORMATION FOR SEQ ID N0:25:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 7 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix) FEATURE:
(A) NAME/KEY: Peptide (B) LOCATION: 1..7 (D) OTHER INFORMATION: /label= SEQ25 /note= "Xaa denote:. F or Y at residue #2; and C or S at residue #5"
(xi) SEQUENCE DESCRIPTION: SEQ 7:D N0:25:
Glu Xaa Ile Asn Xaa Gly Lys (2) INFORMATION FOR SEQ ID N0:26:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 7 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix) FEATURE:
(A) NAME/KEY: Peptide (B) LOCATION: 1..7 (D) OTHER INFORMATION: /la.bel= SEQ26 /note= "Xaa denotes F or Y at residue #1; and A,V
or I at residue #7"
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:26:
Xaa Ile Asn Cys Gly Lys Xaa (2) INFORMATION FOR SEQ ID N0:27:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 7 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix) FEATURE:
(A) NAME/KEY: Peptide (B) LOCATION: 1..7 (D) OTHER INFORMATION: /label= SEQ27 /note= "Xaa denotes V or I at residue #2; A or G

at residue #3; R or Q at residue #4; and V or I at residue #5"

(xi) SEQUENCE DESCRIPTION: SEQ ID N0:27:

Arg Xaa Xaa Xaa Xaa Cys Lys (2) INFO RMATION FOR SEQ ID N0:28:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 9 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix ) FEATURE:

(A) NAME/KEY: Peptide (B) LOCATION: 1..9 (D) OTHER INFORMATION: /label= SEQ28 /note= "Xaa denotes V or I at residue #2; R or Q

at residue #4; and V or I at residue #5"

(xi) SEQUENCE DESCRIPTION: SEQ ID N0:28:

Arg Xaa Xaa Xaa Xaa Cys Xaa Xa;s Asp (2) INFORMATION
FOR SEQ
ID N0:29:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 13 amino acid;a (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix) FEATURE:

(A) NAME/KEY: Peptide (B) LOCATION: 1..13 (D) OTHER INFORMATION: /label= SEQ29 /note= "Xaa denotes V,A or I at residue #3; and V,A or I at residue #8"

(xi) SEQUENCE DESCRIPTION: SEQ 7.D N0:29:

Gly Lys Xaa,Xaa Xaa Xaa Arg Xaa Xaa Xaa Xaa Cys Lys (2) INFORMATION
FOR SEQ
ID N0:30:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 7 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix) FEATURE:

(A) NAME/KEY: Peptide (B) LOCATION: 1..7 (D) OTHER INFORMATION: /label= SEQ30 /note= "Xaa denotes R,K or N at residue #1; T,A
or S at residue #3; T,A or S at residue #4; F,Y or L

at residue #5; and K or R at residue #7"

(xi) SEQUENCE DESCRIPTION: SEQ ID N0:30:

Xaa Trp Xaa Xaa Xaa Leu Xaa (2) INFORMATION FOR SEQ ID N0:31:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 8 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix) FEATURE:
(A) NAME/KEY: Peptide (B) LOCATION: 1..8 (D) OTHER INFORMATION: /label= SEQ31 /note= "Xaa denote:a F or Y at residue #1; K or R
at residue #3; A or S at residue #4; and N or I at residue #7"
(xi) SEQUENCE DESCRIPTION: SEQ :LD N0:31:
Xaa Leu Xaa Xaa Arg Leu Xaa Cys (2) INFORMATION FOR SEQ ID N0:32:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 6 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix) FEATURE:
(A) NAME/KEY: Peptide (B) LOCATION: 1..6 (D) OTHER INFORMATION: /label= SEQ32 /note= "Xaa denotef~ N or I at residue #1; I or V
at residue #4; and P or S at residue #5"
(xi) SEQUENCE DESCRIPTION: SEQ 7:D N0:32:
Xaa Cys Ser Xaa Xaa Gly (2) INFORMATION FOR SEQ ID N0:33:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 9 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix) FEATURE:
(A) NAME/KEY: Peptide (B) LOCATION: 1..9 (D) OTHER INFORMATION: /label= SEQ33 /note= "Xaa denotes. T,A or S at residue #2; T,A or S at residue #3; F,Y or L at residue #4; and A,S,V,I or L at residue #7"
(xi) SEQUENCE DESCRIPTION: SEQ I:D N0:33:
- Trp Xaa Xaa Xaa Leu Lys Xaa Xaa~ Leu (2) INFORMATION FOR SEQ ID N0:34:
°_.2 (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 11 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix) FEATURE:
(A) NAME/KEY: Peptide (B) LOCATION: 1..11 (D) OTHER INFORMATION: /label= SEQ34 /note= "Xaa denotes T,A or S at residue #2; and T,A or S at residue #3"
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:34:
Trp Xaa Xaa Xaa Leu Lys Xaa Xaa Leu Xaa Cys (2) INFORMATION FOR SEQ ID N0:35:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 11 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix) FEATURE:
(A) NAME/KEY: Peptide _ (B) LOCATION: 1..11 (D) OTHER INFORMATION: /label= SEQ35 /note= "Xaa denotes T or S at residue #3"
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:35:
Trp Xaa Xaa Xaa Leu Lys Xaa Xaa Leu Xaa Cys (2) INFORMATION FOR SEQ ID N0:36:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 7 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix) FEATURE:
(A) NAME/KEY: Peptide (B) LOCATION: 1..7 (D) OTHER INFORMATION: /label= SEQ36 /note= "Xaa denotes F or Y at residue #1; F or Y
at residue #2; and N or D at residue #3"
(xi) SEQUENCE DESCRIPTION: SEQ :ID N0:36:
Xaa Xaa Xaa Glu Ile Gln Ser (2) INFORMATION FOR SEQ ID N0:37:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 7 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide !5 3 (ix) FEATURE:
(A) NAME/KEY: Peptide (B) LOCATION: 1..7 (D) OTHER INFORMATION: /Label= SEQ37 /note= "Xaa denotes F or Y at residue #1; F or Y
at residue #3; F or Y at residue #4; F or Y at residue #5; and N or D at residue #6"
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:37:
Xaa Pro Xaa Xaa Xaa Xaa Glu (2) INFORMATION FOR SEQ ID N0:38:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 7 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix) FEATURE:
(A) NAME/KEY: Peptide (B) LOCATION: 1..7 (D) OTHER INFORMATION: /label= SEQ38 /note= "Xaa denotes V,I or L at residue #4; and F
or Y at residue #7"
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:38:
Gly Ser Ala Xaa Cys Xaa Xaa (2) INFORMATION FOR SEQ ID N0:39:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 8 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix) FEATURE:
(A) NAME/KEY: Peptide (B) LOCATION: 1..8 (D) OTHER INFORMATION: /l~~bel= SEQ39 /note= "Xaa denotes V,I or L at residue #3; and F
or Y at residue #6"
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:39:
Ser Ala Xaa Cys Xaa Xaa Xaa Met (2) INFORMATION FOR SEQ ID N0:40:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 7 amino acids (H) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix) FEATURE:
(A) NAME/KEY: Peptide (B) LOCATION: 1..7 (D) OTHER INFORMATION: /label= SEQ40 !i 4 /note= "Xaa denotes N or A at residue #3; and P or A at residue #6"
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:40:
Asn Ser Xaa Trp Leu Xaa Val (2) INFORMATION FOR SEQ ID N0:41:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 7 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix) FEATURE:
(A) NAME/KEY: Peptide (B) LOCATION: 1..7 (D) OTHER INFORMATION: /l~~bel= SEQ41 /note= "Xaa denotes V,L or I at residue #1; and E,D,Y,S or F at re;aidue #3"
(xi) SEQUENCE DESCRIPTION: SEQ :ID N0:41:
Xaa Pro Xaa Pro Arg Pro Gly (2) INFORMATION FOR SEQ ID N0:42:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 9 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix) FEATURE:
(A) NAME/KEY: Peptide (B) LOCATION: 1..9 (D) OTHER INFORMATION: /le~bel= SEQ42 /note= "Xaa denotes V,L or I at residue #1; and R
or A at residue #5"
(xi) SEQUENCE DESCRIPTION: SEQ ~D N0:42:
Xaa Pro Xaa Pro Xaa Pro Gly Xaa Cys (2) INFORMATION FOR SEQ ID N0:43:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 8 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix) FEATURE:
(A) NAME/KEY: Peptide (B) LOCATION: 1..8 (D) OTHER INFORMATION: /laibel= SEQ43 /note= "Xaa denotes. E,D,Y,S or F at residue #2;
and T,Q or S at re:;idue #7"
(xi) SEQUENCE DESCRIPTION: SEQ I:D N0:43:
Pro Xaa Pro Arg Pro Gly Xaa Cy~;

°_.5 (2) INFORMATION FOR SEQ ID N0:44:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 6 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix) FEATURE:
(A) NAME/KEY: Peptide (B) LOCATION: 1..6 (D) OTHER INFORMATION: /label= SEQ44 /note= "Xaa denotes H,F or Y at residue #3; and A
or G at res~.due #5"
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:44:
Asp Pro Xaa Cys Xaa Trp (2) INFORMATION FOR SEQ ID N0:45:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 6 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix) FEATURE:
(A) NAME/KEY: Peptide (B) LOCATION: 1..6 (D) OTHER INFORMATION: /label= SEQ45 /note= "Xaa denote:. H,F or Y at residue #2; and A
or G at residue #4'°
(xi) SEQUENCE DESCRIPTION: SEQ I:D N0:45:
Pro Xaa Cys Xaa Trp Asp (2) INFORMATION FOR SEQ ID N0:46:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 7 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix) FEATURE:
(A) NAME/KEY: Peptide (B) LOCATION: 1..7 (D) OTHER INFORMATION: /label= SEQ46 /note= "Xaa denotes A or G at residue #5"
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:46:
Asp Pro Xaa Cys Xaa Trp Asp (2) INFORMATION FOR SEQ ID N0:47:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 12 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID N0:47:
Cys Xaa Xaa Xaa Xaa Asp Pro Xaa Cys Xaa Trp Asp (2) INFORMATION FOR SEQ ID N0:48:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 11 amino acids (H) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear -(ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTIOAT: SEQ ID N0:48:
Cys Xaa Xaa Xaa Asp Pro Xaa Cys Xaa Trp Asp (2) INFORMATION FOR SEQ ID N0:49:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 10 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID N0:49:
Cys Xaa Xaa Asp Pro Xaa Cys Xa,a Trp Asp (2) INFORMATION FOR SEQ ID N0:50:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 15 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID N0:50:
Cys Xaa Xaa Cys Xaa Xaa Xaa Xa,a Asp Xaa Xaa Cys Xaa Trp Asp (2) INFORMATION FOR SEQ ID N0:51:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 14 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID N0:51:
Cys Xaa Xaa Cys Xaa Xaa Xaa As;p Xaa Xaa Cys Xaa Trp Asp (2) INFORMATION FOR SEQ ID N0:52:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 13 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID N0:52:
Cys Xaa Xaa Cys Xaa Xaa Asp Xaa Xaa Cys Xaa Trp Asp (2) INFORMATION FORSEQ ID N0:53:

(i ) SEQUENCE ISTICS:
CHARACTER

(A) 601basepai rs LENGTH:

(B) nucleic acid TYPE:

(C) double STRANDEDNESS:

(D) linear TOPOLOGY:

(ii ) MOLECULE cDNA
TYPE:

(ix ) FEATURE:

(A) CDS, NAME/KEY:

(B) 16..2331 LOCATION:

(xi ) SEQUENCE SEQ :LD :
DESCRIPTION: N0:53 GCAGC
ATG
GGC
TGG
TTA
AC'C
AGG
ATT
GTC
TGT
CTT
TTC
TGG

Met u l Gly Thr Cys Trp Arg Leu Le Ile Phe Va Trp 1 !i 1 0 CTT

Gly Val Leu ThrAla ArgAlaAsn TyrGlnAsn GlyLys AsnAsn Leu CTG

Val Pro Arg LysLeu SerTyrLys GluMetLeu GluSer AsnAsn Leu TTC

Val Ile Thr AsnGly LeuAlaAsn SerSerSer TyrHis ThrPhe Phe GAG

Leu Leu Asp GluArg SerArgLeu TyrValGly AlaLys AspHis Glu TTC

Ile Phe Ser AspLeu ValAsnIle LysAspPhe GlnLys IleVal Phe TCT

Trp Pro Val TyrThr ArgArgAsp GluCysLys TrpAla GlyLys Ser AAA

Asp Ile Leu GluCys AlaAsnPhe IleLysVal LeuLys AlaTyr Lys CAC

Asn Gln Thr LeuTyr AlaCysGly ThrGlyAla PheHis ProIle His ATT

Cys Thr Tyr GluIle GlyHisHis ProGluAsp AsnIle PheLys Ile TCA

Leu Glu Asn HisPhe GluAsnGly ArgGlyLys SerPro TyrAsp Ser CTG

Pro Lys Leu ThrAla SerLeuLeu IleAspGly GluLeu TyrSer Leu GCT

Gly- Thr Ala AspPhe MetGlyArg AspPheAla IlePhe ArgThr Ala CAC

Leu Gly His HisPro IleArgThr GluGlnHis AspSer ArgTrp His CTC AAT GATCCAAAG TTCATT AGTGCC'CACCTC ATCTCAGAG AGTGAC 723 Leu Asn AspProLys PheIle SerAla HisLeu IleSerGlu SerAsp Asn Pro GluAspAsp LysVal TyrPhe PhePhe ArgGluAsn AlaIle Asp Gly GluHisSer GlyLys AlaThr HisAla ArgIleGly GlnIle Cys Lys AsnAspPhe GlyGly HisArg SerLeu ValAsnLys TrpThr 270 275 . 280 Thr Phe LeuLysAla ArgLeu IleCys SerVal ProGlyPro AsnGly Ile Asp ThrHisPhe AspGlu LeuGln AspVal PheLeuMet AsnPhe Lys Asp ProLysAsn ProVal ValTyr GlyVal PheThrThr SerSer Asn Ile PheLysGly SerAla ValCys MetTyr SerMetSer AspVal Arg Arg ValPheLeu GlyPro TyrAla HisArg AspGlyPro AsnTyr Gln Trp ValProTyr GlnGly ArgVal ProTyr ProArgPro GlyThr Cys Pro SerLysThr PheGly GlyPhe AspSer ThrLysAsp LeuPro Asp Asp ValIleThr PheAla ArgSer HisPro AlaMetTyr AsnPro Val Phe ProMetAsn AsnArg ProIle ValIle LysThrAsp ValAsn Tyr Gln PheThrGln IleVal ValAsp ArgVal AspAlaGlu AspGly Gln Tyr AspValMet PheIle GlyThr AspVal GlyThrVal LeuLys Val Val SerIlePro LysGlu ThrTrp TyrAsp LeuGluGlu ValLeu Leu Glu GluMetThr ValPhe ArgGlu ProThr AlaIleSer AlaMet Glu Leu SerThrLys GlnGln GlnLeu TyrIle GlySerThr AlaGly !i 9 Val Ala Gln Leu Pro Leu His Arg Cys Asp Ile Tyr Gly Lys Ala Cys TAC

Ala GluCysCys LeuAla ArgAsp Pro Cys AlaTrp AspGly Ser Tyr AAG AGA

Ala CysSerArg TyrPhe ProThr Ala Arg ArgThr ArgArg Gln Lys CAC

Asp IleArgAsn GlyAsp ProLeu Thr Cys SerAsp LeuHis His His GAG

Asp AsnHisHis GlyHis SerPro Glu Arg IleIle TyrGly Val Glu AGT

Glu AsnSerSer ThrPhe LeuGlu Cys Pro LysSer GlnArg Ala Ser AAT

Leu ValTyrTrp GlnPhe GlnArg Arg Glu GluArg LysGlu Glu Asn ACA

Ile ArgValAsp AspHis IleIle Arg Asp GlnGly LeuLeu Leu Thr AAT

Arg SerLeuGln GlnLys AspSer Gly Tyr LeuCys HisAla Val Asn AAG

Glu HisGlyPhe IleGln ThrLeu Leu Val ThrLeu GluVal Ile Lys CAT

Asp ThrGluHis LeuGlu GluLeu Leu Lys AspAsp AspGly Asp His AGC

Gly SerLysThr LysGlu MetSer Asn Met ThrPro SerGln Lys Ser .ATC

Val TrpTyrArg AspPhe MetGln Leu Asn HisPro AsnLeu Asn Ile 'TGG

Thr MetAspGlu PheCys GluGln Val Lys ArgAsp ArgLys Gln 'Trp isGG

Arg ArgGlnArg ProGly HisThr Pro Asn SerAsn LysTrp Lys Gly ~9AC

His LeuGlnGlu AsnLys LysGly Arg Arg ArgThr HisGlu Phe ~~lsn GAG AGGGCACCC AGGAGT GTCTGAGCTGCi~T CTAGA 2358 TACCT AACCTCAAAC

Glu ArgAlaPro ArgSer Val AAGTAGAAAC TAGAC TGGAAAAi~CAAATG CAATATACAT

TTGCC AATAAC GAACTTTTTT

CATG GCATTA GGAT~ATTCAG CTGAGTTCCA CAATTATAA

TGTGGATGTT C
TACAATGGTG

ATTAAATCCA CTAATAGG CTT'.CTTTTTC CTAATACCAC

TGAGTAACTT CGGGTTAAAA
TC

GTAAGAGACA CTGAACCC T TGGAGCCA TTC~~TACAGG TCCCTATTTA

G CG AGGAACGGAA

(2) INFORMATION FORSEQ ID
N0:54:

(i) CHARACTERISTICS:
SEQUENCE

(A)LENGTH: 77 1 amino acids (B)TYPE:
amino acid (D)TOPOLOGY: linear (ii) TYPE:
MOLECULE protein (xi) DESCRIPTION: SEQ N0:54:
SEQUENCE ID

Met GlyTrp LeuThrArg IleVal CysLeu PheTrpGly ValLeuLeu Thr AlaArg AlaAsnTyr GlnAsn GlyLys AsnAsnVal ProArgLeu Lys LeuSer TyrLysGlu MetLeu GluSer AsnAsnVal IleThrPhe 35 .40 45 Asn GlyLeu AlaAsnSer SerSer TyrHis ThrPheLeu LeuAspGlu Glu ArgSer ArgLeuTyr ValGly AlaLys AspHisIle PheSerPhe Asp LeuVal AsnIleLys AspPhe GlnLys IleValTrp ProValSer Tyr ThrArg ArgAspGlu CysLys TrpAla GlyLysAsp IleLeuLys Glu CysAla AsnPheIle LysVal LeuLys AlaTyrAsn GlnThrHis Leu TyrAla CysGlyThr GlyAla PheHis ProIleCys ThrTyrIle Glu IleGly HisHisPro GluAsp AsnIle PheLysLeu GluAsnSer His PheGlu AsnGlyArg GlyLys SerPro TyrAspPro LysLeuLeu Thr AlaSer LeuLeuIle AspGly GluLeu TyrSerGly ThrAlaAla Asp PheMet GlyArgAsp PheAla IlePhe ArgThrLeu GlyHisHis His ProIle ArgThrGlu GlnHis AspSer ArgTrpLeu AsnAspPro Lys PheIle SerAlaHis LeuIle SerGlu SerAspAsn ProGluAsp Asp LysVal TyrPhePhe PheArg GluAsn AlaIleAsp GlyGluHis Ser GlyLys AlaThrHis AlaArg IleGly GlnIleCys LysAsnAsp Phe GlyGly HisArgSer LeuVal AsnLys TrpThrThr PheLeuLys Ala ArgLeu IleCysSer ValPro GlyPro AsnGlyIle AspThrHis Phe AspGlu LeuGlnAsp ValPhe LeuMet AsnPheLys AspProLys Asn ProVal ValTyrGly ValPhe ThrThr SerSerAsn IlePheLys Gly SerAla ValCysMet TyrSer MetSer AspValArg ArgValPhe Leu GlyPro TyrAlaHis ArgAsp GlyPro AsnTyrGln TrpValPro Tyr GlnGly ArgValPro TyrPro ArgPro GlyThrCys ProSerLys Thr PheGly GlyPheAsp SerThr LysAsp LeuProAsp AspValIle ~51 385 ~ 390 395 400 Thr Phe Ala Arg Ser His Pro Ala Met Tyr Asn Pro Val Phe Pro Met Asn AsnArg ProIle ValIle LysThrAsp ValAsn TyrGln PheThr Gln IleVal ValAsp ArgVal AspAlaGlu AspGly GlnTyr AspVal Met PheIle GlyThr AspVal GlyThrVal LeuLys ValVal SerIle Pro LysGlu ThrTrp TyrAsp LeuGluGlu ValLeu LeuGlu GluMet Thr ValPhe ArgGlu ProThr AlaIleSer AlaMet GluLeu SerThr 485 . 490 495 Lys GlnGln GlnLeu TyrIle GlySerThr AlaGly ValAla GlnLeu Pro LeuHis ArgCys AspIle TyrGlyLys AlaCys AlaGlu CysCys Leu AlaArg AspPro TyrCys AlaTrpAsp GlySer AlaCys SerArg Tyr PhePro ThrAla LysArg ArgThrArg ArgGln AspIle ArgAsn Gly AspPro LeuThr HisCys SerAapLeu HisHis AspAsn HisHis Gly HisSer ProGlu GluArg IleIleTyr GlyVal GluAsn SerSer Thr PheLeu GluCys SerPro LysSerGln ArgAla LeuVal TyrTrp Gln PheGln ArgArg AsnGlu GluArgLys GluGlu IleArg ValAsp Asp HisIle IleArg ThrAsp GlnGlyLeu LeuLeu ArgSer LeuGln Gln LysAsp SerGly AsnTyr LeuCysHis AlaVal GluHis GlyPhe Ile GlnThr LeuLeu LysVal ThrLeuGlu ValIle AspThr GluHis Leu GluGlu LeuLeu HisLys AspAspAsp GlyAsp GlySer LysThr Lys GluMet SerAsn SerMet ThrProSer GlnLys ValTrp TyrArg Asp PheMet GlnLeu IleAsn HisProAsn LeuAsn ThrMet AspGlu Phe CysGlu GlnVal TrpLys ArgAspArg LysGln ArgArg GlnArg Pro GlyHis ThrPro GlyAsn SerAsnLys TrpLys HisLeu GlnGlu Asn LysLys GlyArg AsnArg ArgThrHis GluPhe GluArg AlaPro Arg SerVal (2) INFORMATION FOR SEQ ID N0:55:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1332 base pai~:s (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear ;:

2 171 fi3g (ii ) LECULE cDNA
MO TYPE:

(ix ) E:
FEATUR

( A) KEY:CDS
NAME/

( B) ION:7.. 1329 LOCAT

(xi ) QUENCE IPTION: SEQ ID :
SE DESCR N0:55 ATA

MetMet ValLeuLeu Ala ValTyr SerIleVal PheVal His Asp Val IleIle IleLysVal GlnArg TyrIle AsnAspIle LeuThr Leu Asp IlePhe TyrLeuPhe I,ysMet IlePro LeuLeuPhe IleLeu Phe Tyr PheAla AsnGlyIle GluTrp HisLys PheGluThr SerGlu Glu Ile IleSer ThrTyrLeu LeuAsp AspVal LeuTyrThr GlyVal Asn Gly AlaVal TyrThrPhe SerAsn AsnLys LeuAsnLys ThrGly Leu Thr AsnAsn AsnTyrIle ThrThr SerIle LysValGlu AspAla Asp Lys AspThr LeuValCys GlyThr AsnAsn GlyAsnPro LysCys Trp Lys IleAsp GlySerAsp AspPro LysHis ArgGlyArg GlyTyr Ala Pro TyrGln AsnSerLys ValThr IleIle SerHisAsn GlyCys Val Leu SerAsp IleAsnIle SerLys GluGly IleLysArg TrpArg Arg Phe AspGly ProCysGly TyrAsp LeuTyr ThrAlaAsp AsnVal Ile Pro LysAsp GlyLeuArg GlyAla PheVal AspLysAsp GlyThr Tyr Asp LysVal TyrIleLeu PheThr AspThr IleGlySer LysArg Ile Val LysIle ProTyrIle AlaGln MetCys LeuAsnAsp GluGly Gly Pro SerSer LeuSerSer HisArg TrpSer ThrPheLeu LysVal Glu Leu GluCys AspIleAsp GlyArg SerTyr ArgGlnIle IleHis E. 3 AAA
ACA

Ser ArgThr IleLysThr AspAsn AspThr IleLeuTyr ValPhe Phe Asp SerPro TyrSerLys SerAla LeuCys ThrTyrSer MetAsn Thr Ile LysGln SerPheSer ThrSer LysLeu GluGlyTyr ThrLys Gln Leu ProSer ProAlaSer GlyIle CysLeu ProAlaGly LysVal Val Pro HisThr ThrPheGlu ValIle GluLys TyrAsnVal LeuAsp Asp Ile IleLys ProLeuSer AsnGln ProIle PheGluGly ProSer Gly Val LysTrp PheAspIle LysGlu LysGlu AsnGluHis ArgGlu Tyr Arg IleTyr PheIleLys GluAsn SerIle TyrSerPhe AspThr Lys Ser LysGln ThrArgSer SerGln ValAsp AlaArgLeu PheSer Val Met ValThr SerLysPro LeuPhe IleAla AspIleGly IleGly Val Gly MetPro GlnMetLys LysIle LeuLys Met (2) INFORMATION FORSEQ ID N0:56:

(i)SEQUENCE CHARACTERISTICS:

(A) LENGTH: acids amino (B) TYPE:
amino acid (D) TOPOLOGY:
linear ( ii)MOLECULE. TYPE: protein (xi) SEQUENCE DESCRIPTION: ~i N0:56:
SE ID

Met Met ValLeu LeuHis Ala Val Ser Ile ValPhe ValAepVal Tyr Ile Ile IleLys ValGln Arg Tyr Asn Asp IleLeu ThrLeuAsp Ile Ile Phe TyrLeu PheLys Met Ile Leu Leu PheIle LeuPheTyr Pro Phe Ala AsnGly IleGlu Trp His Phe Glu ThrSer GluGluIle Lys 50 Ile Ser ThrTyr LeuLeu Asp Asp Leu Tyr ThrGly ValAsnGly Val 65 70 75 g0 Ala Val TyrThr PheSer Asn Asn Leu Asn LysThr GlyLeuThr Lys Asn Asn AsnTyr IleThr Thr Ser Lys Val GluAsp AlaAspLys Ile Asp Thr LeuVal CysGly Thr Asn Gly Asn ProLys CysTrpLys Asn ' 115 12 12 Ile AspGly Asp AspProLys HisArg GlyArgGly TyrAla Pro Ser Tyr GlnAsn Lys ValThrIle IleSer HisAsnGly CysVal Leu Ser Ser AspIle Ile SerLysGlu GlyIle LysArgTrp ArgArg Phe Asn Asp GlyPro Gly TyrAspLeu TyrThr AlaAspAsn ValIle Pro Cys Lys AspGly Arg GlyAlaPhe ValAsp LysAspGly ThrTyr Asp Leu Lys ValTyr Leu PheThrAsp ThrIle GlySerLys ArgIle Val Ile 210 215, 220 Lys IlePro Ile AlaGlnMet CysLeu AsnAspGlu GlyGly Pro Tyr Ser SerLeu Ser HisArgTrp SerThr PheLeuLys ValGlu Leu Ser Glu CysAsp Asp GlyArgSer TyrArg GlnIleIle HisSer Arg Ile Thr IleLys Asp AsnAspThr IleLeu TyrValPhe PheAsp Ser Thr Pro TyrSer Ser AlaLeuCys ThrTyr SerMetAsn ThrIle Lys Lys Gln SerPhe Thr SerLysLeu GluGly TyrThrLys GlnLeu Pro Ser Ser ProAla Gly IleCysLeu ProAla GlyLysVal ValPro His Ser Thr ThrPhe Val IleGluLys TyrAsn ValLeuAsp AspIle Ile Glu Lys ProLeu Asn GlnProIle PheGlu GlyProSer GlyVal Lys Ser Trp PheAsp Lys GluLysGlu AsnGlu HisArgGlu TyrArg Ile Ile Tyr PheIle Glu AsnSerIle TyrSer PheAspThr LysSer Lys Lys Gln ThrArg Ser GlnValAsp AlaArg LeuPheSer ValMet Val Ser Thr SerLys Leu PheIleAla AspIle GlyIleGly ValGly Met Pro Pro GlnMet Lys.IleLeuLys Met Lys (2) INFORMATION FOR SEQID
N0:57:

(i)SEQUENCE
CHARACTERISTICS:

(A) pairs LENGTH:

base (B) nucleic acid TYPE:

(C) double STRANDEDNESS:

(D) linear TOPOLOGY:

(ii)MOLECULE cDNA
TYPE:

(ix)FEATURE:

(A) CDS
NAME/KEY:

(B) 451..2640 LOCATION:

(xi)SEQUENCE
DESCRIPTION:
SEQ
7:D
N0:57:

ATTCCACCTC CCTCTCGCCA
CCGCTGACCG GGCGAAAACT

GAC:GATCTTT

ACGACGTGTC TTTTCATGTT
AACAACATTT CCGTGAAACC

TGC:TTCCGTG

GCTTCTCGCA TTACCACTCT TCCGTTTCCC AG7.'GTTTGTT TTCTCCGTTT CTTTCATCGT 180 fi 5 GGATGT'TTTG TTTTGGTGTA GCGAGTGACG AGCTTATGTC ATTAAACGTA CATCCAATCT 240 GTCGGTATAT TGGTGTGTGA TATTTTACTA TT'ATATATTT AGCCATCACT TGAAAGCCGT 300 GTGCCGCGGC
CGCACTGAAC
AT'G
CGG
GCG
GCG
CTG
GTG
GCC
GTC

Met Arg Ala Ala Leu Val Ala Val Ala Ala LeuLeu TrpValAla LeuHis AlaAla AlaTrpVal AsnAsp Val Ser ProLys MetTyrVal GlnPhe GlyGlu GluArgVal GlnArg 25 30 . 35 40 Phe Leu GlyAsn GluSerHis LysAsp HisPhe LysLeuLeu GluLys Asp His AsnSer LeuLeuVal GlyAla ArgAsn IleValTyr AsnIle Ser Leu ArgAsp LeuThrGlu PheThr GluGln ArgIleGlu TrpHis Ser Ser GlyAla HisArgGlu LeuCys TyrLeu LysGlyLys SerGlu Asp Asp CysGln AsnTyrIle ArgVal LeuAla LysIleAsp AspAsp Arg Val LeuIle CysGlyThr AsnAla TyrLys ProLeuCys ArgHis Tyr Ala LeuLys AspGlyAsp TyrVal ValGlu LysGluTyr GluGly Arg Gly LeuCys ProPheAsp ProAsp HisAsn SerThrAla IleT'yr Ser Glu GlyGln LeuTyrSer AlaThr ValAla AspPheSer GlyThr Asp Pro LeuIle TyrArgGly ProLeu ArgThr GluArgSer AspLeu Lys Gln LeuAsn AlaProAsn PheVal AsnThr MetGluTyr AsnAsp Phe Ile PhePhe PhePheArg GluThr AlaVal GluTyrIle AsnCys Gly Lys AlaIle TyrSerArg ValAla ArgVal CysLysHis AspLys Gly Gly ProHis GlnGlyGly AspArg TrpThr SerPheLeu LysSer A,rg LeuAsn CysSer ValProGly AspTyr ProPhe TyrPhe AsnGlu Ile GlnSer ThrSer AspIleIle GluGly AsnTyr GlyGly GlnVal Glu LysLeu IleTyr GlyValPhe ThrThr ProVal AsnSer IleGly Gly SerAla ValCys AlaPheSer MetLys SerIle LeuGlu SerPhe Asp GlyPro PheLys GluGlnGlu ThrMet AsnSer AsnTrp LeuAla Val ProSer LeuLys ValProGlu ProArg ProGly GlnCys ValAsn Asp SerArg ThrLeu ProAspVal SerVal AsnPhe ValLys SerHis Thr LeuMet AspGlu AlaValPro AlaPhe PheThr ArgPro IleLeu Ile ArgIle SerLeu GlnTyrArg PheThr LysIle AlaVal AspGln Gln ValArg ThrPro AspGlyLys AlaTyr AspVal LeuPhe IleGly Thr AspAsp GlyLys ValIleLys AlaLeu AsnSer AlaSer PheAsp Ser SerAsp ThrVal AspSerVal ValIle GluGlu LeuGln ValLeu Pro ProGly ValPro ValLysAsn LeuTyr ValVal ArgMet AspGly Asp AspSer LysLeu.ValValVal SerAsp AspGlu IleLeu AlaIle Lys LeuHis ArgCys GlySerAsp LysIle ThrAsn CysArg GluCys Val SerLeu GlnAsp ProTyrCys AlaTrp AspAsn ValGlu LeuLys Cys ThrAla ValGly SerProAsp TrpSer AlaGly LysArg ArgPhe Ile GlnAsn IleSer LeuGlyGlu HisLys AlaCys GlyGly ArgPro Gln ThrGlu IleVal AlaSerPro ValPro ThrGln ProThr ThrLys ~i 7 ATC
CAC

Ser SerGly AspPro ValHisSer Ile GlnAlaGlu PheGlu Pro His GTA

Glu IleAsp AsnGlu IleValIle Gly AspAspSer AsnVal Ile Val GCA

Pro AsnThr LeuAla GluIleAsn His GlySerLys LeuPro Ser Ala GCG

Ser GlnGlu LysLeu ProIleTyr Thr GluThrLeu ThrIle Ala Ala GTT

Ile ValThr SerCys LeuGlyAla Leu ValGlyPhe IleSer Gly Val GAG

Phe LeuPhe SerArg ArgCysArg Gly AspTyrThr AspMet Pro Glu AGG

Phe ProAsp GlnArg HisGlnLeu Asn LeuThrGlu AlaGly Leu Arg TGT

Asn AlaAsp SerPro TyrLeuPro Pro AlaAsnAsn LysAla Ala Cys AAG

Ile AsnLeu ValLeu AsnValPro Pro AsnAlaAsn GlyLys Asn Lys ATA

Ala AsnSer SerAla GluAsnLys Pro GlnLysVal LysLys Thr Ile CTTTGGTATC
TGTTT7.'GGTG
CAGACCCATG

Tyr Ile CTATTGAGAA CTTCTGTAAT
ATGTCCTCAA
GAF~P.GTTAAA

ACTTTCCATA CAGAAGAAGT
GTAATACAGA
ACAATGTGAA

CAAAAAAGTG
TATAGTGATC
TGTGATCAGT

(2) INFORMATION FOR SEQID
N0:58:

(i) CHARACTERISTICS:
SEQUENCE

(A)LENGTH: 730 amino acids (B)TYPE:
amino acid (D)TOPOLOGY:
linear (ii) TYPE:
MOLECULE protein (xi) DESCRIPTION: SEGi N0:58:
SEQUENCE ID

Met ArgAla AlaLeu ValAlaVal Ala LeuLeuTrp ValAla Leu Ala His AlaAla AlaTrp ValAsnAsp Val ProLysMet TyrVal Gln Ser Phe GlyGlu GluArg ValGlnArg Phe GlyAsnGlu SerHis Lys Leu Asp HisPhe LysLeu LeuGluLys Asp AsnSerLeu LeuVal Gly His Ala -ArgAsn IleVal TyrAsnIle Ser ArgAspLeu ThrGlu Phe Leu Thr GluGln ArgIle GluTrpHis Ser GlyAlaHis ArgGlu Leu Ser Cys Ty'r Leu Lys Gly Lys Ser Glu Asp Asp Cys Gln Asn Tyr Ile Arg Val LeuAla LysIle AspAspAsp ArgVal LeuIle CysGlyThr Asn Ala TyrLys ProLeu CysArgHis TyrAla LeuLys AspGlyAsp Tyr Val ValGlu LysGlu TyrGluGly ArgGly LeuCys ProPheAsp Pro Asp HisAsn SerThr AlaIleTyr SerGlu GlyGln LeuTyrSer Ala Thr ValAla AspPhe SerGlyThr AspPro LeuIle TyrArgGly Pro Leu ArgThr GluArg SerAspLeu LysGln LeuAsn AlaProAsn Phe Val AsnThr MetGlu TyrAsnAsp PheIle PhePhe PhePheArg Glu Thr AlaVal GluTyr IleAsnCys GlyLys AlaIle TyrSerArg Val Ala ArgVal CysLys HisAspLys GlyGly ProHis GlnGlyGly Asp Arg TrpThr SerPhe LeuLysSer ArgLeu AsnCys SerValPro Gly Asp TyrPro PheTyr PheAsnGlu IleGln SerThr SerAspIle Ile Glu GlyAsn TyrGly GlyGlnVal GluLys LeuIle TyrGlyVal Phe Thr ThrPro ValAsn SerIleGly GlySer AlaVal CysAlaPhe Ser Met LysSer IleLeu GluSerPhe AspGly ProPhe LysGluGln Glu Thr MetAsn SerAsn TrpLeuAla ValPro SerLeu LysValPro Glu Pro ArgPro GlyGln CysValAsn AspSer ArgThr LeuProAsp Val Ser ValAsn PheVal LysSerHis ThrLeu MetAsp GluAlaVal Pro Ala PhePhe ThrArg ProIleLeu IleArg IleSer LeuGlnTyr Arg Phe ThrLys IleAla ValAspGln GlnVal ArgThr ProAspGly Lys 405. 410 415 Ala TyrAsp ValLeu PheIleGly ThrAsp AspGly LysValIle Lys Ala LeuAsn SerAla SerPheAsp SerSer AspThr ValAspSer Val Val IleGlu GluLeu GlnValLeu ProPro GlyVal ProValLys Asn Leu TyrVal ValArg MetAspGly AspAsp SerLys LeuValVal Val Ser AspAsp GluIle LeuAlaIle LysLeu HisArg CysGlySer Asp Lys IleThr AsnCys ArgGluCys ValSer LeuGln AspProTyr Cys Ala- TrpAsp AsnVal GluLeuLys CysThr AlaVal GlySerPro Asp Trp SerAla GlyLys ArgArgPhe IleGln AsnIle SerLeuGly Glu ,~ , p a) His Ly's Ala Cys Gly Gly Arg Pro Gln Thr Glu Ile Val Ala Ser Pro Val Pro Thr Gln Pro Thr Thr Lys Ser Ser Gly Asp Pro Val His Ser Ile His GlnAla GluPhe GluProGlu~.IleAsp AsnGlu IleVal Ile Gly Val AspAsp SerAsn ValIlePro AsnThr LeuAla GluIle Asn His Ala GlySer LysLeu ProSerSer GlnGlu LysLeu ProIle Tyr Thr Ala GluThr LeuThr IleAlaIle ValThr SerCys LeuGly Ala Leu Val ValGly PheIle SerGlyPhe LeuPhe SerArg ArgCys Arg Gly Glu AspTyr ThrAsp MetProPhe ProAsp GlnArg HisGln Leu Asn Arg LeuThr GluAla GlyLeuAsn AlaAsp SerPro TyrLeu Pro Pro Cys AlaAsn AsnLys AlaAlaIle AsnLeu ValLeu AsnVal Pro Pro Lys AsnAla AsnGly LysAsnAla AsnSer SerAla GluAsn Lys Pro Ile GlnLys ValLys LysThrTyr Ile (2) INFORMATION ID N0:59:
FOR
SEQ

(i) SEQUENCE CHARACTER ISTICS:

(A) LENGTH: basepairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (ii)MOLECULE TYPE:cDNA

(ix)FEATURE:

(A) NAME/KEY: CDS

(B) LOCATION: 1..1953 (xi)SEQUENCE DESCRIPTION: ID
SEQ N0:59:

AAT

Glu Asp Asp Cys Gln TyrIle ArgIleMet ValVal ProSer Pro Asn TGT

Gly Arg Leu Phe Val GlyThr AsnSerPhe ArgPro MetCys Asn Cys GAC

Thr Tyr Ile Ile Ser SerAsn TyrThrLeu GluAla ThrLys Asn Asp CCC

Gly Gln Ala Val Cys TyrAsp ProArgHis AsnSer ThrSer Val Pro CTG

50 Leu Ala Asp Asn Glu TyrSer GlyThrVal AlaAsp PheSer Gly Leu TAC

Ser- Asp Pro Ile Ile ArgGlu ProLeuGln ThrGlu GlnTyr Asp Tyr GCA

Ser Leu Ser Leu Asn ProAsn PheValSer SerPhe ThrGln Gly Ala i 21 7 63 _ Asp PheVal TyrPhePhe PheArg GluThr AlaVal GluPheIle Asn Cys GlyLys AlaIleTyr SerArg ValAla ArgVal CysLysTrp Asp Lys GlyGly ProHisArg PheArg AsnArg TrpThr SerPheLeu Lys Ser ArgLeu AsnCysSer IlePro GlyAsp TyrPro PheTyrPhe Asn 165 , 170 175 Glu IleGln SerAlaSer AsnLeu ValGlu GlyGln TyrGlySer Met Ser SerLys LeuIleTyr GlyVal PheAsn ThrPro SerAsnSer Ile Pro GlySer AlaValCys AlaPhe AlaLeu GlnAsp IleAlaAsp Thr Phe GluGly GlnPheLys GluGln ThrGly IleAsn SerAsnTrp Leu Pro ValAsn AsnAlaLys ValPro AspPro ArgPro GlySerCys His Asn AspSer ArgAlaLeu ProAsp ProThr LeuAsn PheIleLys Thr His SerLeu MetAspGlu AsnVal ProAla PhePhe SerGlnPro Ile Leu ValArg ThrSerThr IleTyr ArgPhe ThrGln IleAlaVal Asp Ala GlnIle LysThrPro GlyGly LysThr TyrAsp ValIlePhe Val Gly ThrAsp HisGlyLys IleIle LysSer ValAsn AlaGluSer Ala Asp SerAla AspLysVal ThrSer ValVal IleGlu GluIleAsp Val Leu ThrLys SerGluPro IleArg AsnLeu GluIle ValArgThr Met Gln TyrAsp GlnProLys AspGly SerTyr AspAsp GlyLysLeu Ile Ile ValThr AspSerGln ValVal AlaIle GlnLeu HisArgCys His '.~ 1 Asn Asp LysIle ThrSerCys Ser GluCysValAla Leu GlnAspPro Tyr Cys AlaTrp AspLysIle Ala GlyLysCysArg Ser HisGlyAla Pro Arg TrpLeu GluGluAsn Tyr PheTyrGlnAsn Val AlaThrGly Gln His AlaAla CysProSer Gly LysIleAsnSer Lys AspAlaAsn Ala Gly GluGln LysGlyPhe A_rgAsnAspMetAsp Leu LeuAspSer Arg Arg GlnSer LysAspGln Glu IleIleAspAsn Ile AspLysAsn Phe Glu AspIle IleAsnAla Gln TyrThrValGlu Thr LeuValMet Ala Val LeuAla GlySerIle Phe SerLeuLeuVal Gly PhePheThr Gly Tyr PheCys GlyArgArg Cys HisLysAspGlu Asp AspAsnLeu Pro Tyr ProAsp ThrGluTyr Glu TyrPheGluGln Arg GlnAsnVal Asn Ser PhePro SerSerCys Arg IleGlnGlnGlu Pro LysLeuLeu Pro Gln ValGlu GluValThr Tyr AlaAspAlaVal Leu LeuProGln Pro Pro ProPro AsnLysMet His SerProLysAsn Thr LeuArgLys Pro Pro MetHis GlnMetHis Gln GlyProAsnSer Glu ThrLeuPhe Gln Phe HisVal ThrAlaThr Thr ProSerSerArg Ile ValValAla CAATTACAGG

Thr Thr SerGlu HisCysVal Pro ThrArg CGCGGCGATG GTC.'AAGAAGG TTTACCTTTG

GCTTTTCCAC AGACGGGAGT
CACCCGCAGC

GGGGCGGCTG ACC:CAAAATA TGGCTGTAAA

AAACCAGTCA CAACACAAAC
GGGACTAATT

ACACGTAACA AGACAGCCGC CCCGTCATGG

GAAGTCTTGG CATTGTAACT
TCGCGCAAGA

CAACACCGCT CAGCAGCAGT CGCAGCAGCC

CGAATAGCCC GCACTCCAGT
CCAGCAGCAG

TCGGGCTCCT AGC:AGCAGTC CGGCTCCGCC

CGCCCGTAAT CTCCAGCAGT
GTCCAACAGC

CCCAGTCCGC AGC:TACATCT ACCGTGATTG

AGGAGAGCCC ATTGATATGC
CAAGAACTGC

AACACCAAAT CACiTCCACGC ACGCCCAGCC

CGATGCCACT ACACTCACAC
CATCCAGGCC

CCGCACCCGC CCGACCACGC CCCCAGCACA

ACCCGCTTCC GCCACGCGCC
GCCACCCGGT

AGAAGTCCAA AAGTCCATGC CCGTGACACC

TGATCGGCAG AGTTCAACCG
GACATATGCC

'~ 2 CAATCGCCGC TGGCTGAGACGCCCTCCTATGl~.GCTCTACGAACGCCACTCGGATGCGGCC2570 ACCTTCCACT TTGGGGATGAGGACGATGACGA.TGATGATGAGCACGACCAGGAGGACACC2630 CCACCGCTGC CGCCGCCTCGTAGATTTCGCTT'TGGCAACAGGGAGCTGTTCAGCATGAGT2750 CGTGGCGCTG CGATATAGGAATAACCACTCCCCCTTCCCTTAAACTTAAAGTAGCiyATCG3230 GTATACACAA GCAAGCATAACATAACATACGT.ATATATGACTCTATATATACCAATAGAT3410 TTCATAGACG ATTCACATGGATCGGCTACGCT.AAATTAGAGCTGCAAAATGATATTGTTA3470 ATTACGATTA GAGAAAAAAAAAAAGGAATTCG.ATATCAAGCKTATCGATACCNTCGACCT3530 (2) INFORMATION FOR SEQID N0:60:

(i)SEQUENCE CHARACT ERISTICS :

(A) LENGTH : 0 .acids 65 amino (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE:
protein (xi) SEQUENCE DESCRIPTION : l2 N0:60:
SE ID

Glu AspAspCys Gln AsnTyrIle ArgIle MetValVal ProSer Pro Gly ArgLeuPhe Val CysGlyThr AsnSer PheArgPro MetCys Asn Thr TyrIleIle Ser AspSerAsn TyrThr LeuGluAla ThrLys Asn Gly GlnAlaVal Cys ProTyrAsp ProArg HisAsnSer ThrSer Val Leu AlaAspAsn Glu LeuTyrSer GlyThr ValAlaAsp PheSer Gly Ser AspProIle Ile TyrArgGlu ProLeu GlnThrGlu GlnTyr Asp Ser LeuSerLeu Asn AlaProAsn PheVal SerSerPhe ThrGln Gly Asp PheValTyr Phe PhePheArg GluThr AlaValGlu PheIle Asn Cys GlyLysAla Ile TyrSerArg ValAla ArgValCys LysTrp Asp Lys GlyGlyPro His ArgPheArg AsnArg TrpThrSer PheLeu Lys Ser ArgLeuAsn Cys SerIlePro GlyAsp TyrProPhe TyrPhe Asn Glu IleGlnSer Ala SerAsnLeu ValGlu GlyGlnTyr GlySer Met Ser SerLysLeu Ile TyrGlyVal PheAsn ThrProSer AsnSer Ile Pro GlySerAla Val CysAlaPhe AlaLeu GlnAspIle AlaAsp Thr Phe GluGlyGln Phe LysGluGln ThrGly IleAsnSer AsnTrp Leu Pro VaT Asn Asn Ala Lys Val Pro Asp Pro Arg Pro Gly Ser Cys His Asn Asp SerArg AlaLeu ProAspPro ThrLeu AsnPhe IleLysThr S His Ser LeuMet AspGlu AsnValPro AlaPhe PheSer GlnProIle Leu Val ArgThr SerThr IleTyrArg PheThr GlnIle AlaValAsp Ala Gln IleLys ThrPro GlyGlyLys ThrTyr AspVal IlePheVal Gly Thr AspHis GlyLys IleIleLys SerVal AsnAla GluSerAla Asp Ser AlaAsp LysVal ThrS,erVal ValIle GluGlu IleAspVal Leu Thr LysSer GluPro IleArgAsn LeuGlu IleVal ArgThrMet Gln Tyr AspGln ProLys AspGlySer TyrAsp AspGly LysLeuIle Ile Val ThrAsp SerGln ValValAla IleGln LeuHis ArgCysHis Asn Asp LysIle ThrSer CysSerGlu CysVal AlaLeu GlnAspPro Tyr Cys AlaTrp AspLys IleAlaGly LysCys ArgSer HisGlyAla Pro Arg TrpLeu GluGlu AsnTyrPhe TyrGln AsnVal AlaThrGly Gln His AlaAla CysPro SerGlyLys IleAsn SerLys AspAlaAsn Ala Gly GluGln LysGly PheArgAsn AspMet AspLeu LeuAspSer Arg Arg GlnSer LysAsp GlnGluIle IleAsp AsnIle AspLysAsn Phe Glu AspIle IleAsn AlaGlnTyr ThrVal GluThr LeuValMet Ala Val LeuAla GlySer IlePheSer LeuLeu ValGly PhePheThr Gly Tyr PheCys GlyArg ArgCysHis LysAsp GluAsp AspAsnLeu Pro Tyr ProAsp ThrGlu TyrGluTyr PheGlu GlnArg GlnAsnVal Asn Ser PhePro SerSer CysArgIle GlnGln GluPro LysLeuLeu Pro Gln ValGlu GluVal ThrTyrAla AspAla ValLeu LeuProGln Pro Pro ProPro AsnLys MetHisSer ProLys AsnThr LeuArgLys Pro Pro MetHis GlnMet HisGlnGly ProAsn SerGlu ThrLeuPhe Gln Phe HisVal ThrAla ThrThrPro SerSer ArgIle ValValAla Thr Thr SerGlu HisCys ValProThr Arg (2) INFORMATION FOR SEQ ID N0:61:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 2670 base pairs <.

( B) nucleic aci d TYPE:

( C) dou ble STRANDEDNESS:

(D) linear ' TOPOLOGY:

(ii)MO LECULE cDNA
TYPE:

(ix)FEATURE:

(A) CDS
NAME/KEY:

(B) 268..2439 LOCATION:

(xi)SE QUENCE SEQID
DESCRIPTION: N0:61:

GAAAATCGAA CWCCGAATTG C TTAGATAGTT GCAAGCCTAA

AATGAACWG AF,AACGCCAA

TGCATTTCAG AKATTTNMMC ACGAAAGTGA

GATGCGAAAC ACAGTGGTAA
AF,GTTCCGCC

AATGCCCAAG AATCTCGAGC AACAAGCAAC CGCCTCTCAC

GGAAACACCA
Ap,CACAAAAG

TCGCTCTTGC ACTTTAATCC T CATTCGCCCC CCGGTCGACC

AATTGAGGT GGTGGGGTCG

CCTCGCA CTT
ATG CTA
T' CAG
CTA
TCG
CCG
CTC

M et er S' Leu Leu Gln Leu Ser Pro Leu CTC GCACTCCTG CTA CTCCTCTGC AGT'AGT GTGAGC GAGACGGCT GCG 342 Leu AlaLeuLeu Leu LeuLeuCys SerSer ValSer GluThrAla Ala GAC TACGAGAAC ACC TGGAACTTC TAC'TAC GAGCGT CCCTGTTGC ACT 390 Asp TyrGluAsn Thr TrpAsnPhe TyrTyr GluArg ProCysCys Thr GGA AACGATCAG GGG AACAACAAT TAC'GGA AAACAC GGCGCAGAT CAT 438 Gly AsnAspGln Gly AsnAsnAsn TyrGly LysHis GlyAlaAsp His Val ArgGluPhe Asn CysGlyLys LeuTyr TyrArg ThrPheHis Met Asn GluAspArg Asp ThrLeuTyr ValGly AlaMet AspArgVal Phe CGT GTGAACCTG CAG AATATCTCC TCA.TCC AATTGT AATCGGGAT GCG 582 Arg ValAsnLeu Gln AsnIleSer SerSer AsnCys AsnArgAsp Ala Ile AsnLeuGlu Pro ThrArgAsp AspVal ValSer CysValSer Lys Gly LysSerGln Ile PheAspCys LysAsn HisVal ArgValIle Gln Ser MetAspGln Gly AspArgLeu TyrVal CysGly ThrAsnAla His Asn ProLysAsp Tyr ValIleT'yrAlaAsn LeuThr HisLeuPro Arg Ser GluTyrVal Ile GlyValGly LeuGly IleAla LysCysPro Tyr Asp ProLeuAsp Asn SerThrAla IleTyr ValGlu AsnGlyAsn Pro Gly GlyLeuPro Gly LeuTyrSer GlyThr AsnAla GluPheThr Lys Ala AspThrVal Ile PheArgThr AspLeu TyrAsn ThrSerAla Lys Arg Leu GluTyr LysPhe LysArg ThrLeuLys TyrAsp SerLys Trp GAC AAC
AAA TTT
GTC
GGC
TCC
TTT
GAT
ATT
GGG
GAG
TAC
GTG

Leu Asp LysPro AsnPhe ValGly SerPheAsp IleGly GluTyr Val Tyr Phe PhePhe ArgGlu ThrAla ValGluTyr IleAsn CysGly Lys Ala Val TyrSer ArgIle AlaArg ValCysLys LysAsp ValGly Gly Lys Asn LeuLeu AlaHis AsnTrp AlaThrTyr LeuLys AlaArg Leu Asn Cys SerIle SerGly GluPhe ProPheTyr PheAsn GluIle Gln Ser Val TyrGln LeuPro SerAsp LysSerArg PhePhe AlaThr Phe Thr Thr SerThr AsnGly LeuIle GlySerAla ValCys SerPhe His Ile Asn GluIle GlnAla AlaPhe AsnGlyLys PheLys GluGln Ser Ser Ser AsnSer AlaTrp LeuPro ValLeuAsn SerArg ValPro Glu Pro Arg ProGly ThrCys ValAsn AspThrSer AsnLeu ProAsp Thr Val Leu AsnPhe IleArg SerHis ProLeuMet AspLys AlaVal Asn His Glu HisAsn AsnPro ValTyr TyrLysArg AspLeu ValPhe Thr Lys Leu ValVal AspLys IleArg IleAspIle LeuAsn GlnGlu Tyr Ile Val TyrTyr ValGly ThrAsn LeuGlyArg IleTyr LysIle Val Gln Tyr TyrArg AsnGly GluSer LeuSerLys LeuLeu AspIle Phe Glu Val AlaPro AsnGlu AlaIle GlnValMet GluIle SerGln Thr Arg Lys SerLeu TyrIle GlyThr AspHisArg IleLys GlnIle Asp Leu Ala Met Cys Asn Arg Arg Tyr Asp Asn Cys Phe Arg Cys Val Arg Asp ProTyr CysGly TrpAsp LysGlu AlaAsn ThrCysArg ProTyr Glu LeuAsp LeuLeu GlnAsp ValAla AsnGlu ThrSerAsp IleCys Asp SerSer ValLeu LysLys LysIle ValVal ThrTyrGly GlnSer GTA CATCTG GGCTGT TTCGTC AAAATA CCCGAA GTGCTGAAG AAT~vAG 2070 Val HisLeu GlyCys PheVal I,ysIle ProGlu ValLeuLys AsnGlu Gln ValThr TrpTyr HisHis SerLys AspLys GlyArgTyr GluIle Arg TyrSer ProThr LysTyr IleGlu ThrThr GluArgGly LeuVal Val ValSer ValAsn GluAla AspGly GlyArg TyrAspCys HisLeu Gly GlySer LeuLeu CysSer TyrAsn IleThr ValAspAla HisArg Cys ThrPro ProAsn LysSer AsnAsp TyrGln LysIleTyr SerAsp Trp CysHis GluPhe GluLys TyrLys ThrAla MetLysSer TrpGlu Lys LysGln GlyGln CysSer ThrArg GlnAsn PheSerCys AsnGln AAGAGAGTAT

His ProAsn GluIle PheArg LysPro AsnVal ATGCCGTCAT GCGAAGAGGA
CGTCGTCCAA
TCi~ATTTTAG

GCGGAATAGA CATTATTATC
AAGCCCAGGA
CGi~GAAGAAC

TCATAGACAT CCTAAAGGAT
ACTTTCTTCA
GCi~ATGAACA

CCGAAGCATT
TACAATGCAT

(2) INFORMATION FOR SEQID :
N0:62 (i) CHARACTERISTICS:
SEQUENCE

(A)LENGTH: 724 amino acids (B)TYPE: acid amino (D)TOPOLOGY: inear l (ii) TYPE: otein MOLECULE pr (xi) DESCRIPTION: SE(z N0:62:
SEQUENCE ID

Met SerLeu LeuGln LeuSer ProLeu LeuAla LeuLeuLeu LeuLeu Cys -SerSer ValSer GluThr AlaAla AspTyr GluAsnThr TrpAsn Phe TyrTyr GluArg ProCys CysThr GlyAsn AspGlnGly AsnAsn '7 7 As'n Tyr~Gly Lys His Gly Ala Asp His Val Arg Glu Phe Asn Cys Gly Lys Leu TyrTyr ArgThrPhe HisMet AsnGlu AspArgAsp ThrLeu Tyr Val GlyAla MetAspArg ValPhe ArgVal AsnLeuGln AsnIle Ser Ser SerAsn CysAsnArg AspAla IleAsn LeuGluPro ThrArg Asp Asp ValVal SerCysVal SerLys GlyLys SerGlnIle PheAsp Cys Lys AsnHis ValArgVal IleGln SerMet AspGlnGly AspArg Leu Tyr ValCys GlyThrAsn AlaHis AsnPro LysAspTyr ValIle Tyr Ala AsnLeu ThrHisLeu ProArg SerGlu TyrValIle GlyVal Gly Leu GlyIle AlaLysCys ProTyr AspPro LeuAspAsn SerThr Ala Ile TyrVal GluAsnGly AsnPro GlyGly LeuProGly LeuTyr Ser Gly ThrAsn AlaGluPhe ThrLys AlaAsp ThrValIle PheArg Thr Asp LeuTyr AsnThrSer AlaLys ArgLeu GluTyrLys PheLys Arg Thr LeuLys TyrAspSer LysTrp LeuAsp LysProAsn PheVal Gly Ser PheAsp IleGlyGlu TyrVal TyrPhe PhePheArg GluThr Ala Val GluTyr IleAsnCys GlyLys AlaVal TyrSerArg IleAla Arg Val CysLys LysAapVal GlyGly LysAsn LeuLeuAla HisAsn Trp Ala ThrTyr LeuLysAla ArgLeu AsnCys SerIleSer GlyGlu Phe Pro PheTyr PheAsnGlu IleGln SerVal TyrGlnLeu ProSer Asp Lys SerArg PhePheAla ThrPhe ThrThr SerThrAsn GlyLeu Ile Gly SerAla ValCysSer PheHis IleAsn GluIleGln AlaAla Phe Asn GlyLys PheLysGlu GlnSer SerSer AsnSerAla TrpLeu Pro Val LeuAsn SerArgVal ProGlu ProArg ProGlyThr CysVal Asn Asp ThrSer AsnLeuPro AspThr ValLeu AsnPheIle ArgSer His Pro LeuMet AspLysAla ValAsn HisGlu HisAsnAsn ProVal Tyr Tyr LysArg AspLeuVal PheThr LysLeu ValValAsp LysIle Arg Ile AspIle LeuAsnGln GluTyr IleVal TyrTyrVal GlyThr Asn -LeuGlyArg IleTyrLys IleVal GlnTyr TyrArgAsn GlyGlu Ser Leu SerLys LeuLeuAsp IlePhe GluVal AlaProAsn GluAla Ilc Gln Val Met Glu Ile Ser Gln Thr Arg Lys Ser Leu Tyr Ile Gly Thr AspHis ArgIle LysGln IleAspLeu AlaMet CysAsn ArgArg Tyr AspAsn CysPhe ArgCys ValArgAsp ProTyr CysGly TrpAsp Lys GluAla AsnThr CysArg ProTyrGlu LeuAsp LeuLeu GlnAsp Val AlaAsn GluThr SerAsp IleCysAsp SerSer ValLeu LysLys Lys IleVal ValThr TyrGly GlnSerVal HisLeu GlyCys PheVal Lys IlePro GluVal LeuLys AsnGluGln ValThr TrpTyr HisHis Ser LysAsp LysGly ArgTyr GluIleArg TyrSer ProThr LysTyr Ile GluThr ThrGlu ArgGly LeuValVal ValSer ValAsn GluAla Asp GlyGly ArgTyr AspCys HisLeuGly GlySer LeuLeu CysSer Tyr AsnIle ThrVal AspAla HisArgCys ThrPro ProAsn LysSer 660 '665 670 Asn AspTyr GlnLys IleTyr SerAspTrp CysHis GluPhe GluLys Tyr LysThr AlaMet LysSer TrpGluLys LysGln GlyGln CysSer Thr ArgGln AsnPhe SerCys AsnGlnHis ProAsn GluIle PheArg Lys ProAsn Val (2) INFORMATION FOR SEQ ID N0:63:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 2504 base pai;rs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

(ix) FEATURE:

(A) NAME/KEY: CDS

(B) LOCATION: 355..2493 (xi) SEQUENCE DESCRIPTION: SEQ :CD N0:63:

GGCCGGTCGA CCACGAGCGA AGTTTAGTAT CAi~GTTGAGAGTTTGTTTGG AGCGTAGTTT60 GTGTTCTTGA AGATGCTTCC CTTGGTTTTC GGi~TAAGCTTTCCTGTGGAT TGTTGTGTTC180 TTGAAGATGC TTCCCTTGGT TTTCGGATAA GC'CTTCCAGCGTGGTTTCAG CCTCGGCTTG240 ACGCGTACAA TCGACAAAAT GTTTGGTTTC CAi4TTGATCTTGCAATGTAG CTAC 357 ATG

Met CTG CAT

Val Val Lys Ile Leu Val Trp Ser Ile Cys Ile Ala Leu Cys Leu His GCT~TGG ATG CCG GAT AGT TCT TCC AAA TTA AAC CAT TTT AAA 453 ATA TCA

Ala Trp Met Pro Asp Ser Ser Ser Lys Leu Asn His Phe Lys Ile Ser ACG TTT

Val 'GluSerLys SerPhe ThrGly AsnAlaThr PhePro AspHis Phe Ile Val LeuAsn GlnAsp GluThr SerIleLeu ValGly GlyArg Asn Arg Val TyrAsn LeuSer IlePhe AspLeuSer GluArg LysGly Gly Arg Ile AspTrp ProSer SerAsp AlaHisGly GlnLeu CysIle Leu Lys Gly LysThr AspAsp AspCys GlnAsnTyr IleArg IleLeu Tyr Ser Ser GluPro GlyLys LeuVal IleCysGly ThrAsn SerTyr Lys Pro Leu CysArg ThrTyr AlaPhe LysGluGly LysTyr LeuVal Glu Lys Glu ValGlu GlyIle GlyLeu CysProTyr AsnPro GluHis Asn Ser Thr SerVal SerTyr AsnGly GlnLeuPhe SerAla ThrVal Ala Asp Phe SerGly GlyAsp ProLeu IleTyrArg GluPro GlnArg Thr Glu Leu SerAsp LeuLys GlnLeu AsnAlaPro AsnPhe ValAsn Ser Val Ala TyrGly AspTyr IlePhe PhePheTyr ArgGlu ThrAla Val Glu Tyr MetAsn CysGly LysVal IleTyrSer ArgVal AlaArg Val Cys Lys AspAsp LysGly GlyPro HisGlnSer ArgAsp ArgTrp Thr Ser Phe LeuLys AlaArg LeuAsn CysSerIle ProGly GluTyr Pro Phe Tyr PheAsp GluIle GlnSer ThrSerAsp IleVal GluGly Arg Tyr Asn SerAsp AspSer LysLys IleIleTyr GlyIle LeuThr Thr Pro Val AsnAla IleGly GlySer AlaIleCys AlaTyr GlnMet Ala Asp Ile LeuArg ValPhe GluGly SerPheLys HisGln GluThr Ile BO

Asn Ser AsnTrp LeuPro ValPro GlnAsn LeuValPro GluPro Arg CCC GGG CAGTGC GTACGC GACAGC AGG~ATC CTGCCCGAC AAGAAC GTC 1461 Pro Gly GlnCys ValArg AspSer ArchIle LeuProAsp LysAsn Val Asn Phe IleLys ThrHis SerLeu Met.Glu AspValPro AlaLeu Phe GGA AAA CCAGTT CTGGTC CGAGTG AGT'CTG CAGTATCGG TTTACA GCC 1557 Gly Lys ProVal LeuVal ArgVal SerLeu GlnTyrArg PheThr Ala ATA ACA GTGGAT CCACAA GTGAAA ACp,ATC AATAATCAG TATCTC GAT 1605 Ile Thr ValAsp ProGln ValLys ThrIle AsnAsnGln TyrLeu Asp Val Leu TyrIle GlyThr AspAsp GlyLys ValLeuLys AlaVal Asn ATA CCA AAGCGA CACGCT AAAGCG TTG'~TTA TATCGAAAA TACCGT ACA 1701 Ile Pro LysArg HisAla LysAla Leu.Leu TyrArgLys TyrArg Thr TCC GTA CATCCG CACGGA GCTCCC GTP.AAA CAGCTGAAG ATCGCT CCC 1749 Ser Val HisPro HisGly AlaPro ValLys GlnLeuLys IleAla Pro GGT TAT GGCAAA GTTGTG GTGGTC GGG'~AAA GACGAAATC AGACTT GCT 1797 Gly Tyr GlyLys ValVal ValVal GlyLys AspGluIle ArgLeu Ala AAT CTC AACCAT TGTGCA AGCAAA ACG'CGG TGCAAGGAC TGTGTG GAA 1845 Asn Leu AsnHis CysAla SerLys ThrArg CysLysAsp CysVal Glu CTG CAA GACCCA CATTGC GCCTGG GAC'GCC AAACAAAAC CTGTGT GTC 1893 Leu Gln AspPro HisCys AlaTrp AspAla LysGlnAsn LeuCys Val AGC ATT GACACC GTCACT TCGTAT CGC'TTC CTGATCCAG GACGTA GTT 1941 Ser Ile AspThr ValThr SerTyr ArgPhe LeuIleGln AspVal Val Arg Gly AspAsp AsnLys CysTrp SerPro GlnThrAsp LysLys Thr GTG ATT AAGAAT AAG.CCC AGCGAG GTT'GAG AACGAGATT ACGAAC TCC 2037 Val Ile LysAsn LysPro SerGlu ValGlu AsnGluIle ThrAsn Ser ATT GAC GAAAAG GATCTC GATTCA AGC'GAT CCGCTCATC AAAACT GGT 2085 Ile Asp GluLys AspLeu AspSer SerAsp ProLeuIle LysThr Gly CTC GAT GACGAT TCCGAT TGTGAT CCA.GTC AGCGAGAAC AGCATA GGC 2133 Leu Asp AspAsp SerAsp CysAsp ProVal SerGluAsn SerIle Gly GGA TGC GCCGTC CGCCAG CAACTT GTT'ATA TACACAGCT GGGACT CTA 2181 Gly Cys AlaVal ArgGln GlnLeu ValIle TyrThrAla GlyThr Leu CAC ATT GTCGTG GTCGTC GTCAGC ATC'GTG GGTTTATTT TCTTGG CTT 2229 His Ile ValVal ValVal ValSer IleVal GlyLeuPhe SerTrp Leu TAT AGC GGGTTA TCTGTT TTCGCA AAA.TTT CACTCGGAT TCGCAA TAT 2277 Tyr Ser GlyLeu SerVal PheAla LysPhe HisSerAsp SerGln T'yr Pro Glu AlaPro PheIle GluGlnHis AsnHis LeuGlu ArgLeuSer Ala Asn GlnThr GlyTyr LeuThrPro ArgAla AsnLys AlaValAsn Leu Val ValLys ValSer SerSerThr ProArg ProLys LysAspAsn Leu Asp ValSer LysAsp LeuAsnIle AlaSer AspGly ThrLeuGln 690 695 , 700 705 AAA ATC AAGAAG ACTTAC ATTTAGTGCGi~CT 2504 TTTT

Lys Ile LysLys ThrTyr Ile (2) INFORMATION FORSEQ ID
N0:64:

(i)SEQUENCE CHARACTERISTICS:

(A) LENGTH: 712amino acids (B) TYPE:
amino acid (D) TOPOLOGY:
linear (ii) TYPE:
MOLECULE protein (xi) DESCRIPTION: SES2 N0:64:
SEQUENCE ID

Met Val ValLys IleLeu ValTrpSer IleCys LeuIle AlaLeuCys His Ala TrpMet ProAsp SerSerSer LysLeu IleAsn HisPheLys Ser Val GluSer LysSer PheThrGly AsnAla ThrPhe ProAspHis Phe Ile ValLeu AsnGln AspGluThr SerIle LeuVal GlyGlyArg Asn Arg ValTyr AsnLeu SerIlePhe AspLeu SerGlu ArgLysGly Gly Arg IleAsp TrpPro SerSerAsp AlaHis GlyGln LeuCysIle Leu Lys GlyLys ThrAsp AspAspCys GlnAsn TyrIle ArgIleLeu Tyr Ser SerGlu ProGly LysLeuVal IleCys GlyThr AsnSerTyr Lys Pro LeuCys ArgThr TyrAlaPhe LysGlu GlyLys TyrLeuVal Glu Lys GluVal GluGly IleGlyLeu CysPro TyrAsn ProGluHis Asn Ser ThrSer ValSer TyrAsnGly GlnLeu PheSer AlaThrVal Ala Asp PheSer GlyGly AspProLeu IleTyr ArgGlu ProGlnArg Thr Glu LeuSer AspLeu LysGlnLeu AsnAla ProAsn PheValAsn Ser Val AlaTyr GlyAsp TyrIlePhe PhiPhe TyrArg GluThrAla Val Glu TyrMet AsnCys GlyLysVal IleTyr SerArg ValAlaArg Val Cys LysAsp AspLys GlyGlyPro HisGln SerArg AspArgTrp !3 2 .9 Thr Ser Phe Leu Lys Ala Arg Leu Asn Cys Ser Ile Pro Gly Glu Tyr Pro Phe TyrPhe AspGlu IleGln SerThrSer AspIle ValGlu Gly Arg Tyr AsnSer AspAsp SerLys LysIleIle TyrGly IleLeu Thr Thr Pro ValAsn AlaIle GlyGly SerAlaIle CysAla TyrGln Met Ala Asp IleLeu ArgVal PheGlu GlySerPhe LysHis GlnGlu Thr Ile Asn SerAsn TrpLeu ProVal ProGlnAsn LeuVal ProGlu Pro Arg Pro GlyGln CysVal ArgAsp SerArgIle LeuPro AspLys Asn Val Asn PheIle LysThr HisSer LeuMetGlu AspVal ProAla Leu Phe Gly LysPro ValLeu ValArg ValSerLeu GlnTyr ArgPhe Thr Ala Ile ThrVal AspPro GlnVal LysThrIle AsnAsn GlnTyr Leu Asp Val LeuTyr IleGly ThrAsp AspGlyLys ValLeu LysAla Val 420 '425 430 Asn Ile ProLys ArgHis AlaLys AlaLeuLeu TyrArg LysTyr Arg Thr Ser ValHis ProHis GlyAla ProValLys GlnLeu LysIle Ala Pro Gly TyrGly LysVal ValVal ValGlyLys AspGlu IleArg Leu Ala Asn LeuAsn HisCys AlaSer LysThrArg CysLys AspCys Val Glu Leu GlnAsp ProHis CysAla TrpAspAla LysGln AsnLeu Cys Val Ser IleAsp ThrVal ThrSer TyrArgPhe LeuIle GlnAsp Val Val Arg GlyAsp AspAsn LysCys TrpSerPro GlnThr AspLys Lys Thr Val IleLys AsnLys ProSer GluValGlu AsnGlu IleThr Asn Ser Ile AspGlu LysAsp LeuAsp SerSerAsp ProLeu IleLys Thr Gly Leu AspAsp AspSer AspCys AspProVal SerGlu AsnSer Ile Gly Gly CysAla ValArg GlnGln LeuValIle TyrThr AlaGly Thr Leu His IleVal ValVal ValVal SerIleVal GlyLeu PheSer Trp Leu Tyr SerGly LeuSer ValPhe AlaLysPhe HisSer AspSer Gln Tyr Pro GluAla ProPhe IleGlu GlnHisAsn HisLeu GluArg Leu Ser Ala AsnGln ThrGly TyrLeu ThrProArg AlaAsn LysAla Val Asn Leu ValVal LysVal SerSer SerThrPro ArgPro LysLys Asp Asn Leu AspVal SerLys AspLeu AsnIleAla SerAsp GlyThr Leu Glri Lys Ile Lys Lys Thr Tyr Ile (2) INFORMATION SEQ ID N0:65:
FOR

(i ) SEQUENCE
CHARACTERISTICS:

(A) LENGTH: 69 base 3 pains (B) TYPE: nuc leic acid (C) STRANDEDNESS:
double (D) TOPOLOGY: linear (ii) MOLECULE cDNA
TYPE:

(ix) FEATURE:

(A) NAME/KEY: CDS

(B) LOCATION: 1..3f9 (xi) SEQUENCE :
DESCRIPTION:
SEQ ID
N0:65 TAC AAC' Met IleTyr Leu Thr Ala Asp Val IleProLys AspGly Leu Tyr Asn.

GTC GGT' Gln GlyAla Phe Asp Lys Asp Thr TyrAspLys ValTyr Ile Val Gly ACT AAG

Leu PheThr Val Ile Gly Ser Arg IleValLys Ile'ProTyr Thr Lys TGC GAA

Ile AlaGln Met Leu Asn Asp Cys GlyProSer SerLeu Ser Cys Glu TCG AAA

Ser HisArg Trp Thr Leu Leu Val GluLeuGlu CysAsp Ile Ser Lys TAT AAT

Asp GlyArg Ser Ser Gln Ile His SerLysThr IleLys Gln T'yr Asn TAC TCT

Ile MetIle Arg Tyr Met Tyr Leu IleValLeu PheGln Val Tyr Ser CTA TAC

Arg IleMet Tyr Phe Tyr Glu His Leu Tyr (2) INFORMATION SEQ ID N0:66:
FOR

(i) CHARACTERISTICS:
SEQUENCE

(A) LENGTH: 122 amino ,kids (B) TYPE:
amino acid (D) TOPOLOGY:
linear (ii) TYPE:
MOLECULE protein (xi) DESCRIPTION: ID N0:66:
SEQUENCE SEQ

Met IleTyr Leu Thr Ala Asp Val IleProLys AspGly Leu Tyr Asn Gln GlyAla Phe Asp Lys Asp Thr TyrAspLys ValTyr Ile Val Gly Leu PheThr Val Ile G11 Ser Arg IleValLys IlePro Tyr Thr Lys Ile- AlaGln Met Leu Asn Asp Cys GlyProSer SerLeu Ser Cys Glu Ser HisArg Trp Thr Leu Leu Val GluLeuGlu CysAsp Ile Ser Lys .9 ,,._ Asp Gly Arg Ser Tyr Ser Gln Ile Asn. His Ser Lys Thr Ile Lys Gln Ile Met Ile Arg Tyr Tyr Met Tyr 5er Leu Ile Val Leu Phe Gln Val Arg Ile Met Tyr Leu Phe Tyr Glu Tyr His (2) INFORMATION FOR SEQ ID N0:67:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 6 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID N0:67:
Asp Cys Gln Asn Tyr Ile (2) INFORMATION FOR SEQ ID N0:68:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 8 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix) FEATURE:
(A) NAME/KEY: Peptide (B) LOCATION: 1..8 (D) OTHER INFORMATION: /label= SEQ68 /note= "Xaa denotes N or G at residue #4; and A or S
at residue #5"
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:68:
Cys Gly Thr Xaa Xaa Xaa Xaa Pro (2) INFORMATION FOR SEQ ID N0:69:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 7 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix) FEATURE:
(A) NAME/KEY: Peptide (B) LOCATION: 1..7 (D) OTHER INFORMATION: /label= SEQ69 /note= "Xaa denotes S or C at residue #3"
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:69:
Gly Xaa Xaa Pro Tyr Asp Pro (2) INFORMATION FOR SEQ ID N0:70:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 7 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix) FEATURE:
(A) NAME/KEY: Peptide (B) LOCATION: 1..7 (D) OTHER INFORMATION: /label= SEQ70 /note= '~Xaa denotes V, N or A"
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:70:
Leu Tyr Ser Gly Thr Xaa Ala (2) INFORMATION FOR SEQ ID N0:71:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 7 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID N0:71:
Leu Asn Ala Pro Asn Phe Val (2) INFORMATION FOR SEQ ID N0:72:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 7 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix) FEATURE:
(A) NAME/KEY: Peptide (B) LOCATION: 1..7 (D) OTHER INFORMATION: /label= SEQ72 /note= ~'Xaa denotes V or I"
(xi) SEQUENCE DESCRIPTION: SEQ :CD N0:72:
Arg Xaa Ala Arg Val Cys Lys (2) INFORMATION FOR SEQ ID N0:73:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 9 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix) FEATURE:
(A) NAME/KEY: Peptide (B) LOCATION: 1..9 (D) OTHER INFORMATION: /label= SEQ73 /note= "Xaa denotef~ T or A at residue #2; T or S
at residue #3; F or Y at residue #4; and A or S at residue #7"
(xi) SEQUENCE DESCRIPTION: SEQ 7:D N0:73:
Trp Xaa Xaa Xaa Leu Lys Xaa Arc_~ Leu (2) INFORMATION FOR SEQ ID N0:74:
f3 6 ,C<:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 9 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix) FEATURE:
(A) NAME/KEY: Peptide (B) LOCATION: 1..9 (D) OTHER INFORMATION: /label= SEQ74 /note= "Xaa denotes N or D"
(xi) SEQUENCE DESCRIPTION: SEQ I:D N0:74:
Pro Phe Tyr Phe Xaa Glu.Ile Gln Ser (2) INFORMATION FOR SEQ ID N0:75:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 7 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix) FEATURE:
(A) NAME/KEY: Peptide (B) LOCATION: 1..7 (D) OTHER INFORMATION: /label= SEQ75 /note= "Xaa denote~~ F or Y at residue #7"
(xi) SEQUENCE DESCRIPTION: SEQ I:D N0:75:
Gly Ser Ala Val Cys Xaa Xaa (2) INFORMATION FOR SEQ ID N0:76:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 7 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix) FEATURE:
(A) NAME/KEY: Peptide (B) LOCATION: 1..7 (D) OTHER INFORMATION: /label= SEQ76 /note= "Xaa denote~~ P or A at residue #6"
(xi) SEQUENCE DESCRIPTION: SEQ I:D N0:76:
Asn Ser Asn Trp Leu Xaa Val (2) INFORMATION FOR SEQ ID N0:77:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 8 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix) FEATURE:
(A) NAME/KEY: Peptide . 2171638 (B) LOCATION: 1..8 (D) OTHER INFORMATION: /label= SEQ77 /note= "Xaa denotes E or D at residue #2; T, Q or S
at residue #7"
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:77:
Pro Xaa Pro Arg Pro G1_~ Xaa Cys (2) INFORMATION FOR SEQ ID N0:78:
(i) SEQUENCE CHARACTERISTICS:
(A1 LENGTH: 7 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: pep~ide (ix) FEATURE:
(A) NAME/KEY: Pep~ide (B) LOCATION: 1..7 (D) OTHER INFORMATION: /label= SEQ78 /note= "Xaa denote;a A or G"
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:78:
Asp Pro Tyr Cys Xaa Trp Asp (2) INFORMATION FOR SEQ ID N0:79:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 7 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix) FEATURE:
(A) NAME/KEY: Pep~ide (B) LOCATION: 1..';
(D) OTHER INFORMATION: /label= SEQ79 /note= "Xaa denotes N or G at residue #4; A or S at residue #5; Y, F, H or G at residue #6; and K, R, H, N or Q at residue #7"
(xi) SEQUENCE DESCRIPTION: SEQ ::D N0:79:
Cys Gly Thr Xaa Xaa Xa~ Xaa (2) INFORMATION FOR SEQ ID .;0:80:
(i) SEQUENCE CHARACTER=STICS:
(A) LENGTH: 7 amir_o acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: pep~ide (ix) FEATURE:
(A) NAME/KEY: Pep~ide (B) LOCATION: 1..~
(D) OTHER INFORMA-ION: /label= SEQ80 /note= ~'Xaa denote:. N or G at residue #4; A, S or N
at residue #5; Y, ~ or H at residue #6; and K, R, H, N or Q at residue #-"

A

(xi) SEQUENCE DESCRIPTION: SEQ :ID N0:80:
Cys Gly Thr Xaa Xaa Xaa Xaa (2) INFORMATION FOR SEQ ID N0:81:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: B amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix) FEATURE:
(A) NAME/KEY: Peptide (B) LOCATION: 1..8 (D) OTHER INFORMATION: /label= SEQ81 /note= "Xaa denotes N or G at residue #4; and A or S
at residue #5"
(xi) SEQUENCE DESCRIPTION: SEQ :CD N0:81:
Cys Gly Thr Xaa Xaa Xaa Xaa Pro (2) INFORMATION FOR SEQ ID N0:82:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 7 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix) FEATURE:
(A) NAME/KEY: Peptide (B) LOCATION: 1..7 (D) OTHER INFORMATION: /label= SEQ82 /note= "Xaa denotes K, F or Y at residue #2; F or Y
at residue #4; F, Y, :C or L at residue #5; F, Y or I at residue #6; and F or Y at residue #7"
(xi) SEQUENCE DESCRIPTION: SEQ :CD N0:82:
Asp Xaa Val Xaa Xaa Xaa Xaa (2) INFORMATION FOR SEQ ID N0:83:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 8 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix) FEATURE:
(A) NAME/KEY: Peptide (B) LOCATION: 1..8 (D) OTHER INFORMATION: /label= SEQ83 /note= "Xaa denotes V or I at residue #~1; F or Y
at residue #2; F, Y or L at residue #3; F, Y, I or L at residue #4; R or T at residue #6; and T or N at residue #8"
(xi) SEQUENCE DESCRIPTION: SEQ .CD N0:83:
Xaa Xaa Xaa Xaa Phe Xaa Xaa Xaa s3 9 A

(2)'INFORMATION FOR SEQ ID N0:84:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: B amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix) FEATURE:
(A) NAME/KEY: Peptide (B) LOCATION: 1..8 (D) OTHER INFORMATION: /label= SEQ84 /note= "Xaa denotes V or I at residue #1; F or Y
at residue #2; F, Y, I or L at residue #3; F, Y or I at residue #4; R or T at residue #6; and T or N at residue #8"
(xi) SEQUENCE DESCRIPTION: SEQ :LD N0:84:
Xaa Xaa Xaa Xaa Phe Xaa Xaa Xaa (2) INFORMATION FOR SEQ ID N0:85:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 8 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix) FEATURE:
(A) NAME/KEY: Peptide (B) LOCATION: 1..8 (D) OTHER INFORMATION: /label= SEQ85 /note= "Xaa denotef3 V or I at residue #1; F or Y
at residue #2; F, Y, I on L at residue #3; F, Y, I or L at residue #4; and T or N at residue #8"
(xi) SEQUENCE DESCRIPTION: SEQ 7.D N0:85:
Xaa Xaa Xaa Xaa Phe Arg Xaa Xaa (2) INFORMATION FOR SEQ ID N0:86:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 8 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix) FEATURE:
(A) NAME/KEY: Peptide (B) LOCATION: 1..8 (D) OTHER INFORMATION: /label= SEQ86 /note= "Xaa denotes V or I at residue #1; F or Y
at residue #2; F, Y or L at residue #3; F, Y, I or L at residue #4; F or Y at ree>idue #5, R or T at residue #6, E, D or V at residue #7; and T or N at residue #8"
(xi) SEQUENCE DESCRIPTION: SEQ 7:D N0:86:
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa (2) INFORMATION FOR SEQ ID N0:87:
S~ 0 (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 7 amino acids (B) TYPE: amino acid (C) STR.ANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix) FEATURE:
(A) NAME/KEY: Peptide (B) LOCATION: 1..7 (D) OTHER INFORMATION: /label= SEQ87 /note= "Xaa denotes R, K or N at residue #1; T or A
at residue #3; T, A or S at residue #4; F, Y or L at residue #5;.and K or R at residue #7"
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:87:
Xaa Trp xaa Xaa Xaa Leu Xaa (2) INFORMATION FOR SEQ ID N0:88:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 9 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix) FEATURE:
(A) NAME/KEY: Peptide (B) LOCATION: 1..9 (D) OTHER INFORMATION: /label= SEQ88 /note= '~Xaa denotes T or A at residue #2; T, A or S
at residue #3; F, Y or L at residue #4; A, S, V, I or L at residue #7"
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:88:
Trp Xaa Xaa Xaa Leu Lys Xaa Xaa Leu (2) INFORMATION FOR SEQ ID N0:89:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 9 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix) FEATURE:
(A) NAME/KEY: Peptide (B) LOCATION: 1..9 (D) OTHER INFORMATION: /Label= SEQ89 /note= "Xaa denotes T, A or S at residue #2; T, A or S
at residue #3; F, Y or L at residue #4; A, S, I or L at residue #7"
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:89:
Trp Xaa Xaa Xaa Leu Lys Xaa Xa,a Leu (2) INFORMATION FOR SEQ ID N0:90:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 11 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix) FEATURE:
(A) NAME/KEY: Peptide (B) LOCATION: 1..11 (D) OTHER INFORMATION: /l~~bel= SEQ90 /note= "Xaa denotes T or A at residue #2; and T, A or S
at residue #3"
(xi) SEQUENCE DESCRIPTION: SEQ :LD N0:90:
Trp Xaa Xaa Xaa Leu Lys Xaa Xa<a Leu Xaa Cys 1 5 . 10 (2) INFORMATION FOR SEQ ID N0:91:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 9 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix) FEATURE:
(A) NAME/KEY: Peptide (B) LOCATION: 1..9 (D) OTHER INFORMATION: /label= SEQ91 /note= "Xaa denotes V, L or I at residue #1"
(xi) SEQUENCE DESCRIPTION: SEQ :CD N0:91:
Xaa Pro Xaa Pro Arg Pro Gly Xaa Cys (2) INFORMATION FOR SEQ ID N0:92:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 7 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix) FEATURE:
(A) NAME/KEY: Peptide (B) LOCATION: 1..7 (D) OTHER INFORMATION: /label= SEQ92 /note= "Xaa denote:c K or Y at residue #2; F or Y
at residue #4; F, Y ox' L at residue #5; F, Y, I or L at residue #6; and F or Y at residue #7"
(xi) SEQUENCE DESCRIPTION: SEQ 7:D N0:92:
Asp Xaa Val Xaa Xaa Xaa Xaa (2) INFORMATION FOR SEQ ID V0:93:
(i) SEQUENCE CHARACTERT_STICS:
(A) LENGTH: 7 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix) FEATURE:
S~ 2 (A) NAME/KEY: Peptide (B) LOCATION: 1..7 (D) OTHER INFORMATION: /label= SEQ93 /note= "Xaa denotes K or Y at residue #2; F or Y
at residue #4; F, Y, I or L at residue #5; F, Y or I at residue #6; and F ~ar Y at residue #7"
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:93:
Asp Xaa Val Xaa Xaa Xaa Xaa (2) INFORMATION FOR SEQ ID N0:94:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 8 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix) FEATURE:
(A) NAME/KEY: Peptide (B) LOCATION: 1..8 (D) OTHER INFORMATION: /label= SEQ94 /note= "Xaa denotes V or I at residue #1; F, Y or L
at residue #3; F, Y, I or L at residue #4; R or T at residue #6; and T or N at residue #8"
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:94:
Xaa Tyr Xaa Xaa Phe Xaa Xaa Xaa (2) INFORMATION FOR SEQ ID N0:95:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 8 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix) FEATURE:
(A) NAME/KEY: Peptide (B) LOCATION: 1..8 (D) OTHER INFORMATION: /label= SEQ95 /note= "Xaa denotes V or I at residue #1; F, Y, I or L
at residue #3; F, Y or I at residue #4; R or T at residue #6; and T or N at residue #8"
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:95:
Xaa Tyr Xaa Xaa Phe Xaa Xaa Xaa (2) INFORMATION FOR SEQ ID N0:96:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 8 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix) FEATURE:
(A) NAME/KEY: Peptide (B) LOCATION: 1..8 .217163 8 (D) OTHER INFORMATION: /label= SEQ96 /note= "Xaa denotes V or I at residue #1; F, Y, I or L
at residue #3; F, Y, I or L at residue #4; and T or N at residue #8"
(xi) SEQUENCE DESCRIPTION: SEQ 7:D N0:96:
Xaa Tyr Xaa Xaa Phe Arg Xaa Xaa (2) INFORMATION FOR SEQ ID N0:97:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 8 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix) FEATURE:
(A) NAME/KEY: Peptide (B) LOCATION: 1..8 (D) OTHER INFORMATION: /label= SEQ97 /note= "Xaa denotes F' or Y at residue #2; F, Y or L
at residue #3; F, Y, I or L at residue #4; F or Y at residue #5; R or T at residue #6; E, D, or V at residue #7; and T or N at residue #8"
(xi) SEQUENCE DESCRIPTION: SEQ 7:D N0:97:
Val Xaa Xaa Xaa Xaa Xaa Xaa Xaa (2) INFORMATION FOR SEQ ID N0:98:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 8 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix) FEATURE:
(A) NAME/KEY: Peptide (B) LOCATION: 1..8 (D) OTHER INFORMATION: /label= SEQ98 /note= "Xaa denotes F or Y at residue #2; F, Y, I or L
at residue #3; F, Y or I at residue #4; F or Y at residue #5; R or T at residue #6; E, D, or V at residue #7; and T or N at residue #8"
(xi) SEQUENCE DESCRIPTION: SEQ 7:D N0:98:
Val Xaa Xaa Xaa Xaa Xaa Xaa Xaa (2) INFORMATION FOR SEQ ID N0:99:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 8 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix) FEATURE:
(A) NAME/KEY: Peptide (B) LOCATION: 1..8 S~ 4 (D) OTHER INFORMATION: /l~~bel= SEQ99 /note= "Xaa denotes :F or Y at residue #2; F, Y, I or L
at residue #3; F, Y, I or L at residue #4; F or Y at residue #5; E, D, or V at residue= #~; and T or N at residue #8"
(xi) SEQUENCE DESCRIPTION: SEQ :ID N0:99:
Val Xaa Xaa Xaa Xaa Arg Xaa Xa~~

(2) INFORMATION FOR SEQ ID NO:100 (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 8 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: jingle (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix) FEATURE:
(A) NAME/KEY: Peptide (B) LOCATION: 1..8 (D) OTHER INFORMATION: /label= SEQ100 /note= "Xaa denotes 7.~' or Y at residue #2; F, Y, I or L
at residue #3; F, Y, :C or L at residue #4; F or Y at residue #5; R or T at residue. #6; E, D, or V at residue #7; and T or N at residue #8"
(xi) SEQUENCE DESCRIPTION: SEQ :CD NO:100 Val Xaa Xaa Xaa Xaa Xaa Xaa Xaa A

Claims (10)

WHAT IS CLAIMED IS:

1. An isolated semaphorin polypeptide comprising an amino acid sequence selected from the group consisting of SEQ ID NOS:54, 60, 62 and 64; or a portion thereof, said portion sufficient to provide a semaphorin binding specificity and comprising a peptide sequence selected from the group consisting of SEQ ID NOS:1-52 and 67-100, and with the proviso that said peptide sequence is contained within none of SEQ ID
NOS:56, 58 and 66.

2. An isolated semaphorin polypeptide according to claim 1, wherein said polypeptide comprises an amino acid sequence selected from the group consisting of SEQ ID
NOS:54, 60, 62 and 64.

3. An isolated antibody that specifically binds a semaphorin polypeptide portion according to claim 1.

4. An isolated nucleic acid comprising a nucleotide sequence encoding a polypeptide according to claim 1 or 2 wherein said sequence is joined to a nucleotide not naturally joined to said sequence.

5. A cell comprising a nucleic acid according to claim 4.

6. A process for the production of a recombinant semaphorin polypeptide comprising culturing the cell of claim 5 under conditions suitable for the expression of said polypeptide, and recovering said polypeptide.

7. A method of identifying an agent which specifically binds a semaphorin polypeptide, said method comprising the steps of:
contacting a panel of prospective agents with a polypeptide according to claim 1 or 2;

measuring the binding of a plurality of said prospective agents to said polypeptide;
and identifying from said plurality an agent which specifically binds said polypeptide, wherein said agent specifically binds a semaphorin polypeptide.

8. A method of diagnosing a patient for a predisposition to neurological disease associated with a genetic locus, said method comprising the steps of:
isolating somatic cells from a patient;
isolating genomic DNA from said somatic cells;
contacting said genomic DNA with a with a probe comprising a DNA sequence encoding a polypeptide according to claim 1 or 2 under conditions wherein said probe hybridizes to homologous DNA; and identifying a region of said genomic DNA which hybridizes with said probe, wherein the presence, absence or sequence of said region correlates with a predisposition to a neurological disease.

9. Use of an isolated semaphorin polypeptide according to claim 1 or 2 for treating a patient with neurological injury or disease or a pathological viral infection, wherein said polypeptide modulates neural cell growth cone function or viral pathogenicity in said patient.

10. Use of an isolated semaphorin polypeptide according to claim 1 or 2 for modulating a cell function by mimicking or interfering with a semaphorin-receptor binding of the cell.