CA2189774A1 - Recombinant hk2 polypeptide - Google Patents

Abstract

An isolated. substantially homogenous hK2 polypeptide is provided as well as isolated nucleic acid molecules encoding hK2 polypeptide, including (a) a cDNA molecule comprising the nucleotide sequence of the coding region of human hK2 gene, (b) a DNA molecule capable of hybridizing under stringent conditions to a molecule of (a); and (c) a genetic variant of any of the DNA molecules of (a) and (b) which encodes of polypeptide processing an antigenic function of naturally occurring polypeptide.

Description

wo 9513~7~8 ` 2 1 8 9 7 7 4 ~ 57 RE(~O~IBINANT ED;~2 POLYP~IIDE
S RArkf~rol-n i of ~he Tnventir~n The glandular kallikreins are a subgroup of serine proteases which are rnvolved in the post-l, ,.. ,~1~. ;, ). IAI processing of specific polypeptide precursors to their biologically active forms. Ihe hurnan kallikrein gene family corlsists of three merr~ers: prostate-specific antigen, human glandular 10 kallikrein, and ~~ clldl kallikrein. SeeJ.A Clements, Fn~ir~cr Rev..
393 (1989) arld T.~ Chu et al. (U.S. Patent No. 4,446,122). A common . .,. lA~ c for these members of the tissue (glandular) kailikrein gene farnilies was recently adopted by T. Berg et al., in ~rrPnt Prr)~ on Kinin~
Rir~rhr~niclry ~n~i Mr~ler1l1Ar Riolr-~v of the KAilil~r~in-Kinin S~strrn Agents15 ~nri Artirln~ Vol 1" H. Fritz et al.., eds., Birkkauser Verlag, Basel (1992), and is defined in Table I, below.

The Human Tissue Kallikrein Gene Family (?g~oved g~r~ir.c r~ IA~;.", New Previous Desigrla- Desigr~a- New Protern 25 ~iQIl ~inns mRNA/rl )NA ~Zt~in DP~i~n~tir)n hKLK1 KLK1 ~HK1 and tissuekalli- hK1 hRKALL phKK25 krein ~renal/
cDNAs IJa.l. l~ali-vary) hKLK2 KLK2 prostate-specific hK2 hGK-1 glandular kzlli-hKK-3 krein hKLK3 PSA ~-iPSA-1 PSA (prostate- hK3 PA andPSA specific antigen) APS cDNAs WO 95~30758 ~ IS7

2~ 89774 Ihe DNA sequenoe homology between hKLK2 and hKLK3 (exon regions) is 80/4 whereas the homology between hKLK2 and hKLK1 is 65%. Ihe deduced amino acid sequence homology of bK2 to hKI is 57/0.
Amino acid se~uenoes deduced by L.J. Schedlich et al., ~, 6, 429 (1987) S and B.J. M~T;S, (~lin F~ Ph~rrn~ l Pbysi-ll lÇ, 345 (1989) indicate that hK2 r~ay be a trypsin-like serine protease, where~s hK3 (PSA) is a Ll~ vLIy,u~ilrlike serine protease. Therefore, if hK2 is indeed secretor~, it may have a different physiological function than hK3.
Ihe hKLK2 gene is located about 12 kbp duwl~L~ from the 10 hKLK3 gene in a head-to-tail fashion on Ll~,ulllu~u..æ 19. (P.H. Riegman et al., FFR~ LPt~ 247. 123, (1989)). Tbe sirnilarities of gene structure and deduced amino acid se~uenoes of these human kallikreins suggest that their evolution may involve the same anoestral gene. Most ill.Ll~Li--~, as reported by Morris, cited ~; P. ~ inf~ FER~ L,~ ?~6, 205 (1988);
15 and Young, 1~ y. 31, 1952 a992), both hK2 ar~d hK3 may be expressed only in tbe human prostate, while expression of hKI is lirnited tû
the pancreas, ~ 1--"~----1;1---1~-- gland, kidney, and other l~UII~IU~ , tissues.
Tremendous irlterest has been generated in hK3 (PSA) because of the important role it plays as a marker to detect and to monitor IJlu~ liU
20 of prostate carcinoma. Its usefulness as a marker is based on the elevated serum ~ ;.... of circulating hK3 proteins which are frequently associated with prostatic cancer. Ihe serum c~ "~ , ,,l ;.... of hK3 has been fourld to be ~lu~vlLiullal to the cancer mass in untreated patients, but is also,UlU~)Ul~iUII~I to the volume of I~y~ Dlic tissue in patients with benign 25 prostatic hyperplasia (BPH). The serum levels of hK3 become reduoed following prostate cancer therapy.
Despite the i"r." . "~ , . which can be ascertained about bK2 from the genomic DNA sequence, very little is known about the bK2 polypeptide itself. The reason for this is that the protein has not been purified 30 and .] ,..~ 1 Thus, a need exists for a method to obtain hK2 puly~Li(l~ and related pvly~ Jlid~ in sufficient c~antity and purity for L~ rl;~ 1 and for use as therapeutic/diagnostic agents or reagents.

Ll ~ t~ i : _ L .. ~ J :1~ r l V II.J _ ~Li.l t ~ ! . a I t i 2 ~ 8 9 7 74 Sl-mm~y nf th~ 7Ave:ntio~
The present invention Frovides an isolated, ' ~y h~
hK2 palypeptide. As used hcrein, iQ the torm "hK2 polypeptide'' includes pre-pro hK2, pro hK2 and malure hEC2 polypeptides. Prc-pro hK2 is secreted by the S ceL~ in viv~, arld is cleaved duriPg s~cretiorl to yie~d pro hK2, which is then en~YmaticaLTy c~eaved irl the ~ ~r-r~ r ~llv;~ l to yield "mature" hK2.
IvIost prefcrably, the hK2 polypeptidc is corltiguous in amino acid sequence with SEQ ID NO: 16, SEQ ID NO: 6, SEQ ID ~O:I9, or S~Q ID NO: lO.
The presetlt inYention also provides isolated nucleic acid 10 molecules encoding hT;~2 polypeptide, including (a) a cDNA molecule comprising the nucleotide sequence of the coding region of the hK2 gene, (b) a DNA molecule capa~le of hybridizing under stringent conditions t~o a nuclectide sequence ~ y to the nucleotide sequence of (a); and (c) a genetic variant of any of the DNA molecules of (a) and (b~ which enco~ies of 15 polypeptide processing an antigenic functiorl of natura~ly occurring bK2 polypeptide. Prefer3bly, the rlucleic acid comprises a discrete, isolated DNA orRNA molecule encoding the compLete hK2 polypeptide, ~,vhich can include the pre-pro, pro or mature forms. ~ost preferably, the nucleic acid is a DNA
sequence contiguous with SEQ ID NO: ~, 7, 20 or 9, e.g., see ~igs. 5, 6 or 7.
20 These D~A sequences can be produced using the PO~ . chain reaction (PCR~, and noveT l~ lrVl;~i~ primers empLoyed in the synthesis are also an embodiment of the inYention.
The nucleic acid sequence also can cornprise a promoter operably linl;ed to the nuc~cic acid sequence. Therefore, tne invention ~Iso comprises a 25 chimeric e~pressir~n vector comprising the above-described nucleic acid sequence, u~.aliu~ll~ linked to control sequences recognized by a host cell f ! .~ .i witn the vector, as well as s2id ~ ` 1. ' . " ;I host cell, and methods of its rr~FArAhnn and use to produc~ IC~.Ullli~lLlCII~ hK2. Thus, thc prcsent invcntion also pro~ides a method of using a nucleic acid molecule, such as a 30 cDN.A clone erlcoding hK2 pol~eptide, comprising expressing the nucleic æid molecule in a cuLrured host cell ~ r ~ f preferably stably l . ,. . - r ~ 1. with K~ (,IIL,X ~ "U ~ `f~ J~ r ~ `J I l ~i fl I .
2~ 89774 3a a c~Lim~rLc expr~ sslan Yector comprising said nucleic acid WO gS/30758 2 1 8 9 7 7 4 ~ r~ !C157 molecule operably linked to contrvl sequences recogn~zed by the host cell l l al ~r~ ll l l lrll with the vector; and recvvering the hK2 polypeptide from the transgenic host cell, i.e., from the culture medium. As used herein, the term "chimeric" means that the vector comprisQ DNA from at least two different 5 species, or comprises DNA from the same species, which is Iinked or associated in a manner which does not occur in the "native" form of said species.
More specifically, ~li and b~uluvll~ rnsect cells systems have been employed to produce hK2 polypeptides in two forms, i.e. pre-pro 10 hK2 (pphK2) and mature hK2 (rnhK2). Thus, the present invention provides the first example of the O~,I~JlQ~iUll of hK2 in ll~t~,lvlo~u~ systems.
Hov~ever, although pphK2 produced in ~.~li has proven to be an invaluable resource for generating antibodies to the dena~AAred form of the protein, it is desirable to both discern the steps involved in the biu~yll~l~is of hK2 and to 15 obtain antibodies specific for the fully processed and se~reted form of the prvtein. Therefore, ,,, ,,,,,~1;,.,, cell systems have been employed to produce hK2 polypeptides. Thus, the present invention also provides the first example of the expression of hK2 in " ,~ "" I~.I I A. I cells and r~ r~tir~n and ( IIA~ rl ~ of the secreted protein.
The high degree of arnino acid sequence homology of hK2 with hK3 indicates that measuring serum ~ ,. " ,~ of both proteins may be useful in the diagnosis and monitoring of prostate cancer. For example, the antibodies developed against hK3 now used in these assays could ~l~vl~ dlly also recognize hK2, because of mutual C~ a,ll;.l,,l;..l. in the antigenic 25 preparations used to develop the anti-hK3 antibodies or because of antibody cross-reactivity bet~veen these two proteins. This could account for the substantial percentage of false positive results which are observed in current hK3 assays. On the other hand, if circulating hK2 levels are also elevated above baseline levels in prostate cancer patients, detection of hK2 by hK2-30 specific antibodies could provide an alternative, ~'A ~l l ri. l l l ~ ll y assay forprostate cancer.

W0 95/30758 ' ' ~ 1 8 9 7 7 4 ~ 15t - -The7efore, 1lK2 polypeptide, as well as variants and subunits thereof, produced by the present met7,lod can be 7 sed to produce populations of ar7tibodies that, in tun, can be 7 sed as the basis for assays to detect and quantify hK2 polypeptide (or "protein") in samples de7ived from tissues such 5 as prostate carcirlom~s, cells such æ prostate cell Imes, or from fluids such as seminal fluid or blood. Thus. the preser7t invention a,so provides populations Of 1111~ 111 IAI or polyclona7, antibodies that specifica ly bind to hK2 polypeptide, while not significantly bi7lding to h7~3. The term "sigt ificantly"is defirled by reference to the ;u~ aLiv~ æsays discussed below. These 10 antibodies cal a so be used in affinity l.~ llllA~ / Al~lly~ to purify II IAI~ AI jAI ~
h7,'2 from natL7ral sources. The isolated, ~A 7hCtAn7iAlly llul~o~ ~7uY h7l~2 c~n also be employed as a component in diagnostic assays for "native" h7æ in samples derived from h7~ 7n tissues or ~ y~iolo~i~l fluids. For example, the Ir~ h7æ can be bound to a detectable label and employed in 15 ~u..~ .iLiv~ l lf~ for h7,.~2, as described in U.S. patent application Seria~ No. 08/096,946, filed July æ, 1993.
As used herein vv7th respect to the present ir7vention, the tern s "h7æ ~ol~ i~," "h7~2 protein," and "nK2" are considered to refer to identica7l h7Jman materials, u7aless other~-vise indicated.
R7 ir f D~7 7f)n of ti7f F~7 77~7 Figure I depicts a time cou7 ~e st7Jdy of Ir~ IAI 11 pph7l~2 in SJ'9 cells infected with Ir.~ l IAI 11 pphK2 virLs. At each of the time points cells were depleted of l... L71...1.1...f and cysteine for I hour in deficient media 25 and then ~lq,~ .". It- 1 with [35S]-methione ar7d [35S]-cysterne. ~rotein was f.7.Atf rrninf-f.7 by Bradford assay. A7iquots of protein (20 llg) were loaded onto a 12% Tris-Glycine SDS gel. A rl ,. ,~I,l " .. ;. . ,A~r, cassette was exposed overnight. The band of mterest is indicated with an arrow. w.t.: wild type.
FigLre 2 depicts the detection of lr~ J ", .1,;. IA~ Il rnhK2 in cell 30 Iysate f~ctions. SJ9 cel s were ir7fected either with lr~ A Il mh7æ, wild type or left 7~nit fected for 48 ho7_rs. Met7i ionine and cysteine pools were depleted for I hour in deficient media Cells were Ylq.l,l. ."~ llrl1 with [35S]-WO 95/3075~ S~I~ IS7 l., and [35S]-cysteine for 6 hours. Cells were separated into soluble and insoluble fractions using H20 and repeated ~ ... conditions.
Aliquots of protein (50 llg per lane) were loaded onto a 10% Tris-Glycine SDS gel and CI~;I1U~IIU1~AI. Tne gel was dried and exposed to x-ray film 5 for 2 days. The band of interest is indicated with an arrow.
Figure 3 depicts the expression of ~ pphK2 in E.
coli. E. coli strain BL21 (DE3) LysS barboring pBppHK2 was gro~vn in LB
media to O.D.600 0.2 and incubated without (lane 2, not-induced (N)) or with (lane 3, induced ~[)) 0.4 mM IPTG for 2 hrs. Cells were Iysed in sample 10 buffer and subjected to SDSIPAGE on a 4-20% gradient gel. Protein bands ~vere visualized by staining the gel with Coomassie blue.
Figure 4 depicts the amino æid sequences of mature hK2 (deduced from cDNA sequence, SEQ ID NO: 16) and hK3 (SEQ ID NO: 1).
Underlined sequences denote ~."~I,..",..~ .ls regiorls that can be used for 15 prepalation of antibodies specific to hK2.
Figure 5 depicts pphK2 cDNA containing a BamH1 site at the 5' end and a Pstl site at the 3' end (SEQ ID NO: 5) (coding strand is numbered) as well as the arnino acid sequence of pre-pro hK2 encoded thereby (SEQ ID NO: 6). The amino acid sequences of pro hK2 and mature 20 hK2 are also shown on the Figure.
Figure 6 depicts rnhK2 cDNA cor~aining an EcoR1 site at the 5' end and Pstl site at the 3' end (SEQ ID NO: 7), as well as the CUll~ amino acid sequence (SEQ ID NO: 8) which r,l ~ the amino acid sequence of r~lK2 poly~l,ii~.
Figure 7 depicts pro 1~2 DNA (SEQ ID NO: 9) (coding strand is numbered) and the amino acid sequence of pro hK2 (SEQ ID NO: 10).
Figure 8 depicts a gel confirming the expression of l~ . ., . ,1,;. ,~"
pphK2 in a ,.,~."",AI.,." cell line. AV12-pGThK2 (Lane 4-6) and AV12-pGT-d (Lane 3) clonal cell lines were grown in DlûF media About 300111 of 30 spent medium from the above clones were .~."~ i and subjected to SDS/PAOE along with See Blue MW marker (lane 1) arld pphK2 Iysate from E. coli cells (lane 2). The gel was blotted onto nitrocellulose paper and WO 95~30758 ~ 8 9 7 7 4 ~ 157 ,""""""l,l~ d usirlg a 1/1000 dilution of anti-pphK2 rabbit antiserum. H~P-goat arlti-rabbit was used as the secondary probe and the blot was developed by DAB plus H202. Lane 3 (AV12-pGT-d) is AV12 transfected with vector without insert.
S Figure 9 depicts the DEAE chrom~tl-gr7q hy of AV12 media.
The sample was applied rn a bicarbonte buffer, pH 8 and eluted with a salt gradient. The solid line is the A280 elution profile. The triangle line represents the E~ISA assay of individual sa-mples which had been dried onto microtiter plates and developed with rabbit aQti-hK2 antibody.
Figure 10 depicts the llrlLu~ ol,ic interaction profile of DEAE
fractions. The fractions were pooled, (`1)11( ' ~ Jl and applied to an HIC
column irl 1.2 M sodium sulfate, and eluted with a decre~sing salt gradient.
The solid line is A280 and the triangle line shows the ELISA assay profile of the fractions using rabbit anti-hK2 antibody.
Figure 11 depicts the Size E~clusion Cl,l.",. ~ y of HIC
purified prohK2, in particular, the A280 profile of 22 rnin peak eluted off HIC
column. The 19.4 min pealc appears l,..,...~ by SDS-PAGE. After this peak was Iyophilized, the N-terminal sequence and amino acid confirmed its identity as the pro form of hK2.
Figure 12 depicts the SDS/PAGE analysis of prohK2 and PSA.
g of purified phK2 or PSA was boiled in sarnple buffer containing (R) or not containing (N) 1% BME. Sarnples were subjected to SDS/PAGE on a 4-20% gel. The protein bands were visuali~ed by staining the gel with silver.
~t~ ~til~n of ~h~ Tnvention As used herein, the term "hK2 polypeptide" preferably the l~l ." ~l ", .," ,t pre-pro, pro and mature hK2 ~I.~ i~,. As proposed herein, a rnature hK2 pol~,Li~ having the amino acid sequence shown in Fig. 4 (SEQ ID NO: 16), as well æ "variant" pbl~Li.l~, which 3û sb~3re at least 90/O homology with SEQ II) NO: 16 in the regions which are ~lh~t~nti~lly h-m~ sn~ with hK3, i.e., which regions are not identified by bars as shown in Fig. 4. Such hK2 polypeptides a,so possess antigenic WO95/30758 21 ~977 4 P~ o~ls7 function in comrnon with the mature hK2 molecule of Fig. 4, in that said polypeptides are also definable by antibodies which bind specifically thereto, but ~vhich do not cross-react ~vith hK3 (or hKI). Preferably, said antibodies react with antigenic sites or epitopes that are also present on the mature hK2 5 molecule of Fig. 4. Antibodies useful to define common antigenic function are described in detail in Ser. No. 0~/096,946, i.e., polyclonal antisera prepared in vivo against hK2 subrnit 41-56.
"Isolated hK2 nucleic acid" is RNA or DNA containing g[eater than 15, preferably 20 or more, sequential nucleotide bases that encode a 10 biologically active hK2 polypeptide or a variant fragment thereof, that is ~ l " "~ "~ to the non-coding strand of the native hK2 polypeptide RNA
or DNA, or hybridizes to said RNA or DNA and remains stably bound under stringent conditions. Thus, the RNA or DNA is isolated in that it is free from at least one c~ " ,1 A ~111 IA~ , nucleic acid with which it is nor[nally associated in 15 the natural source and is preferably substantially free of any other I ~ l ll "~I ;,, RNA or DNA The phrase "free from at least one ~",~,.",."~ source nucleic acid with which it is normally associated" includes the case ~vhere the nucleic acid is lI,ulilU~lUWd into the source or natural cell but is in a different ~,Lulllu~ull dl location or is otherwise flanked by nucleic acid sequences not 20 norrn~lly found in the source cell. An example of isolated hK2 nucleic acid is RNA or DNA that encodes a biologically active hK2 ~Iy~ sharing at least 90% sequence identity with the hK3~ " ",~ l"~ regions of the hK2 peptide of Fig. 4, æ described above. The term "isolated, .j"l .~I 1,,l;..'!y 1~ " ~ rl 1~ " as used with respes~t to an hK2 ~ul~ Li~ is defined in terms 25 of the ,.. l,...~f)lf)~f ~ discussed herein below.
As used herein, the term "l'' . ., . ,1.;. .~ .l nucleic acid," i.e., "l~ . l. . ,l ,., .~ ,l DNA" refers to a rfucleic acid, i.e., to DNA that hæ been derived or isolated from any appropriate tissue source, that may be 1y chemically altered in vi~, an later introduced into target host 30 cells, such æ cells derived from animal, plant, insect, yeæt, fungal or bacterial sources. An example of l~ ". "1,...,.. ~l DNA "derived" from a source,would be a DNA sequence that is identified as a useful fragment encoding WO95/30758 ' 2 ~ & 9 7 7 4 P~ l/U.~ C.'C '157 hK2, or a fragment or variant thereof, and which is then chemically synthesized in essentially pure form. An example of such DNA "isolated"
from a source would be a useful DNA sequence that is excised or removed from said source by chemical means, e.g, by the use of restriction 5 ~"~1~",.~ 50 that it can be further IllAlllI~lllAIr.l, e.g, amplified, for use in the invention, by the ~ y of genetic ~"~ ;"~
Iherefore, "~ DNA" includes completely synthetic DNA sequences, semi-synthetic DNA sequences, semi-synthetic DNA
sequences, DNA sequences isolated from biological sources, and DNA
10 sequences derived from introduced RNA, æ well æ mr~tures thereof.
Generally, the ~ ,I IAI 11 DNA sequence i3 not originally resident in the genome of the host target cell which is the recipient of the DNA, or it is resident in the genome but is not expressed The 1~)"l1~ DNA sequence, used for IIAII~ IIIIA~;I~II
15 herein, may be circular or linear, double-stranded or single-stranded.
Generally, the DNA sequence is in the form of chimeric DNA, such æ
plæmid DNA, that can also contain coding regions flanked by control sequences which promote the expression of the Ir~ ,I DNA present in the resultant cell line. For example, the 1~ ,,, ,l ,;. ,~. ,l DNA rnay itself 20 comprise a promoter that is active in " ,~. "" ,,~l -, cells, or may utilize a promoter already present in the genome that is the I I ;111` ~ 1111 IA~ ;I II~ target.
Such promoters mclude the CMV promoter, æ well æ the SV 40 late promoter and retroviral LTRs ~ong terminal repeat elements). Aside from l~`~llllllllA.II DNA sequences that serve æ ~ iUII units for hK2 or 25 portions thereof, a portion of the l~ "" ~l .;. ,,.. ,l DNA may be ~ 1. Al 1 serving a regulatory or a structural function.
"Control sequences" is deflned to mean DNA sequences necessary for the expression of an operably linked coding sequence in a particular host organism. Ihe control sequences that are suitable for 30 ,UlUk~yU~i~ cells, for example, indude a promoter, and optionally an operatorsequence, and a ribosome binding site. Eukaryotic cells are known to utilize promoters, ~Iy~llylAlioll sigr~ls, and erlhancers.

WO9S130758 2 L8 9 7 7 4 ~ i7 "Operably linked" is defined to me n thdt the nucleic acids are plæed in a functional relationship with another nucleic æid sequence. For example, DNA for a ~)I~U~ ; or secretory leader is oper_bly linked to DNA for a polypeptide if it is e,~pressed as a preprotein that ~dlLi~;lJdLc~ in 5 the secretion of the polypeptide; a promoter or enh ncer is operably linked toa coding sequence if it affects the l, ~., l~. ., ,1 ll i. ", of the sequence; or a ribosome binding site is operably linked to a coding sequence if it is positioned so as to fæilitate translation. Generally, "operably linked" means that the DNA
sequences being linked are contiguous and, in the case of a secretory leader, 10 contiguous and in reading ph se. However, enhancers do not have to be ~f~nti2~ lc Linking is A~ by ligation at corlvenient restriction sites. If such sites do not exist, the synthetic ~ "".,. ~ ;llr adAptors or linkers are used in æcord with l:ul~ Liu~l prætioe.
Aside from IC~UII~il~lt DNA sequenoes that serve as 15 1~ I l1 d ;-~11 units for hK2 or portions thereof, a portion of the lc~ . " . ,l .,, IA. II
DNA may be l -- d 1~ 1 1 ;Ip~1 serving a regulatory or a stn~al fùnction.
Ihe l~f )IIIlI;IIA.11 DNA to be irltroduoed into the cells further will generally contain either a selectable marker gene or a reporter gene or both to fæilitate i.l, .lir~ ., and selection of ~ filllll. .l oells from the 20 population of oells sought to be II All~rl ll lll. .1 Alternatively, the selectAble m rker may be carried on a separate piece of DNA and used in a co-I I AI I~r( II I I IAI ;I II I prooedure. Both selectable m rkers and reporter genes may be flarlked with appro~riate regulatory sequenoes to enable expression in the host oells. Useful selectable markers are well known in the art and include, for 25 exarnple, antibiotic and herbicide-resistAnce genes, such as n5~. _~, 5!~, kaL
~, ~ and the like.
Reporter genes are used for identifying potentially l,,..,~r,",..f~1 oells and for evaluating the f~.", ~ IAI;tY of regulatory sequences. Reporter genes which encode for e sily assayable proteins are well known in the a~t.
30 In general, a reporter gene is a gene which is not present in or expressed bythe recipient organism or tissue and which encodes a protein whose expression is manifested by some easily detectable property, e.g., enzymatic ætivity.

~ wossl3/)7ss ~ ~ 8 9 7 74 P~ 157 Preferred genes include the Chl.",.",l,l,. .,;. ..1 acetyl transferase gene (cat) from Tn9 of E. coli. the beta-glucuronidase gene (gus) of the uidA locus of ~QIi, and the luciferase gene from frrefly Phf-tinll~ pyr~ Expression of the reporter gene is assayed at a suitable time after the DNA has been introduced 5 into the recipient cells.
Other elements functional in the host cells, such as introns, enhancers, ~ul~ lyldfivll se~uences and the like, may also be a pa~t of the ,.,."l,;.,A.,~ DNA Such elements may or rnay not he necessary for the function of the DNA, but may provide improved expression of the DNA by 10 affecting ll.."c. ;l~l;",-, stability of the mRNA, or the like. Such elements may be included in the DNA as desired to obtain the optimal IJ~ UIIllallU~ of the ,""~r"",;"~ DNA in the cell.
~ he general methods for Cul~L u~;Li..g 1~.ll~1.;ll,..ll DNA which can transform target cells are well known to those skilled in the art, and the 15 same C--lllln~ and methods of w ~LIu,Lu - may be utilized to produce the DNA useful herein. For exarnple, J. Sambrook et al., M~lr~ r ('If~nir~
A T ~hnr~tf)~ ~ml~l Cold Spring Harbor Laboratory Press (2d ed., 1989), provides suitable methods of ~
The ~ DNA can be readily introduced into the target 20 cells by ~ r l...., with an expression vector cornprising cDNA encoding hK2, for example, by the modified calcium phosphate ,ul~;~;~Liull procedure of C. Chen et al., Mnl CPII Ri~-l 1, 2745 (1987). Tr~n~ f~.tirln can also be . .I by lipofectin, using CUIlllll~ llly available kits, e.g., provided by BRL.
Suitable host cells for the expression of hK2 polypeptide are derived from n~llti~P~ r organisrns. Such host cells are capable of complex processing and glycosylation activities. In principle, any higher eukaryotic cell culture is workable, whether from vertebrate or illV~lt~l~ culture.
Examples of illv~.~Vl..lC cells include plant and insect cells. Numerous 30 baculoviral strains and variarlts and cu..~ r ~' ~ pennissive insect host cells frrvm hosts such as Spodopterafrugiperda (caterpillar), A.edes aegypti (mosquito), ~ edes albopictus (mosquito), Drosophila rrrelanogaster (iiuitfly), .

.. .. . , . _ .

wo ss/307ss 2 18 9 7 7 4 r~l,.~ 157 and BOInE~JX mori have been identified. See, e.g., Luckow et al., l~io T~hnnlnPv, .~ 47 (1988); Miller et al., in GenPti~ F.~inP~ir~ J. K
Setlow et al., eds., Vol. 8 (Plenum Publishing, 1986), pp. 277-2.79; and Maeda et al., ~ ;592 (1985). A variety of viral strains for 1, Al 1~ r~ I i"" are 5 publicly available, e.g., the L-l variant of,47~togr~pha califomif~aNPV and the Bm-5 strain of Bom~x mori NPV, and such viruses may be used, preferably for 1, Al 1~ r~ 1 ;. ", of Spodopter~ frugipe~ cells.
RecoverS~ or isolation of a given fragment of DNA from a rectriction digest can empoly separation of the digest on polyaayla~nide or 10 agarvse gel by el~uu~ ul~; " illrl 1l i ri~ 111 of the fragment of interest by . 1 " "~ "" of its mobility versus that of marker DNA fragments of kno~n molecular weight, removal of the gel section corltaining the desired fragment, and separation of the gel frvm DNA. For example, see Lawn et al., ~l~i~
A~i-lc ~ff ~, 6103-6114 (1981), and Cioeddel et al., ~llrlPir A'`i~lc ~P.C ~, 15 4057 (1980).
"Southern analysis" or "Southern blottirlg" is a method by which the presence of DNA sequences in a restriction rl 1~ ~ digest of DNA or DNA-containing ~u~ll,uu~;Liull is confirrned by lly~l;di~dLiu~ to a known, labeled nl;g"""~ Ir~Jti~7r or DNA fragment. Southern analysis typically 20 involves el~L ul~l.u.c;i;c separation of DNA digests on agarose gels, AI jl 111 of the DNA after el_L u~,l-u etic separation, and transfer of the DNA to nitrocellulose, nylon, or anotler suitable mernbrane support for analysis with a lA-~ lf l, I,;u~u-~l~t~d, or enzyme-labeled prvbe as described in sections 9.37-9.52 of Sarnbrook et al., s~rL
"Northern analysis" or "Northern blotting" is a method used to identify RNA sequences that hybridize to a known probe such as an nli~",~ j(Ir~ DNA fragment, cDNA or fragment thereof, or RNA fragment.
The probe is labeled with a ,A.1;~ such as 32-P, by 7~iut;ll~k~iivll or with an enzyme. The RNA to be analyzed can be usually f I~LLvlullul~ti~lly 30 separated on an agarvse vr pOly~~ lu~ gel, transferred to nitrocellulose, nylon, or vther suitable membrane, and hybridized with the prvbe, using W0 95/30758 2 1 8 9 7 7 4 r~ 157 standard techniques well known in the art such as those described in se~tions 7.39-7.52 of Sambrook et al., suprfl "Polymerase chain reaction" or "PCR" refers to a procedure or technique in which amounts of a preselected piece of nucleic acid, RNA
5 and/or DNA, are arnplified æ described in U.S. Patent No. 4,683,195.
Generally,sequenoe;llr"".A~",fromtheendsoftheregionofinterestor beyond is employed to design f)li~ol ll l( If ~ 1f primers. These primers v/ill be identical or similar in sequence to opposite strands of the template to be amplified. PCR can be used to amplify specific RNA sequences, specific 10 DNA sequences from total genomic DNA, and cDNA transcribed from total cellular RNA, l~lcliu~-Ld~c or plasmid se~uences, and the like. See gerlerally Mullis et al., Cold SpnngH~orSymp. Qua~ ioL, 51, 263 (1987); Erlich, ed., PCR ~ecl~?olog)~, (Stockton Press, NY, 1989).
"Stringent conditions" are those that (I) employ low ionic strength and 'nigh tC~ ~UC for wa~ing, for example, 0.015 M NaCI/0.0015 M sodium citrate (SSC); 0.1% sodiurn lauryl sulfate (SDS) at 50C, or (2) employ during llylJIi~ dliull a denaturing agent such as ft)rm~niAf, for example, 50% (vol/vol) formamide with 0.1% bovine serum albuminlO.1%
Ficoll/0.1% polyvil.yl~yllulidull~/50 mM sodium phosphate buffer at pH 6.5 with 750 mM NaCI, 75 rnM sodium citrate at 42C. Another example is use of 50% ff)rm-AmiAf, 5 x SSC (0.75 M NaCI, 0.075 M sodium citrate), 50 mM
sodium phosphate (pH 6.8), 0.1% sodium ~1~ , 5 x Denhardt's solution, sonicated salmon sperm DNA (50 llg/ml), 0.1% SDS, and 10%
dextran sulfate at 42C, with washes at 42~C in 0.2 x SSC and 0.1% SDS.
When hK2 pbly~clJ~idc is expressed in a .~, ." ~1,;. ,~. ,~ cell othff than one of human origin, the hK2 polypeptide is completely free of proteins or ~Iy~Jq~id~ of hurnan origin. However, it is necessary to purify hE~2 poly~ Ldf from ~,."~1,;",..,1 cell proteins or poly~Aidc~ to obtain ~UIC~ diUl15 that are ~llhct~nti~lly 1~"",~ "~ as to hK2 polypeptide. For 30 example, the culture medium or Iysate can be cPntrlfi-~ to remove particulate cell de-hris. The membrane and soluble protein fractions are then separated. The hK2 ~,oly~ i~ ma~ then be purified from the soluble WO 95/30758 2 1 8 9 7 7 4 14 ' PCT/I~S95/06157 protein fraction arld, if necessary, from the membrane fraction of the culture Iysate. HK2 pul~ i~ can then be purified from ~ A.~ mll~ soluble proteins and polypeptides by r~A- IIIIIIA~;()II on IlllllI~ A~lllly or ion-exchAnge columns; ethanol ~,.~;~,;laliu.., reverse phase HPLC; ~ A/(I~AIIIIY on silica 5 or on a cation-exchange resin such as DEAE; .I....,..Al..r~ , SDS-PAGE;
Ammf-nil~m sulfate ~.~;~i~i~,.., gel filtration using, for exarnple, Sephadex G-75; or lig nd a~lnity chlnmAtl-~rhy.
Once isolated from the resulting transgenic host cells, derivatives and variants of the hK2 polypeptide can be readily prepared. For 10 example, amides of the hK2 polypeptides of the present invention may also be prepared by techniques well known in the art for converting a carboxylic acid group or precursor, to an amide. A preferred method for arnide formation at the C-terminal carboxyl group is to cleave the polypeptide from a solid support with an appropriate amine, or to cleave in the presence of an alcohol, 15 yiel&ng an ester, followed by aminolysis with the desired amine.
Salts of carboxyl groups of the hK2 pul~ id~ may be prepared in the usual manner by contacting the peptide with one or more equivalents of a desired base such as, for example, a metallic hydroxide base, e.g., so&um hydroxide; a metal carbonate or l.; - ~", ~ base such as, for 20 exarnple, so&um carbonate or so&um l.;- A ~ , or an arnine base such as, for example, L-ir~ ' , l,; .IIA~ A.II;II~ ~ and the like.
N-acyl derivatives of an amino group of the present polypeptides may be prepared by utilizing an N-acyl protected amino acid for the final r, ..,.Irl.~A1;. "" or by acylating a protected or u..~.ut~l~d peptide. ~
25 acyl derivatives may be prepared, for exarnple, by acylation of a free hydroxy peptide or peptide resin. Ether acylation may be carried out using standard acylatrng reagents such as acyl h~lides~ anhydrides, acyl imidazoles, and the like. Both N- ar~a ~acylation may be carried out together, if desired. In ad&tion, the internal hK2 amino acid sequence of Fig 4 can be modified by 30 ~"~ il"l."~ one or two ~u ~ ~iv~ amino acid ,"l,~l;l"l;.".~ for the positions specified, mcluding ~ which utilize the D rather than L form. ~he invention is also directed to variant or modified forms of the hK2 polypeptide wo 95/30758 2 1 8 ~ 7 7 4 P~ . 'C -15~
l~i of Fig. 4. One or more of tbe residues of this polypeptide can be altered, so long as antigenic function is retained. Corlservative arnino acid ~
are preferred--that is, for exaTnple, aspartic-glutamic as æidic amino æids;
Iy~ e/~ Lidine as basic amino æids; lcuci~ olcu~
S IllCLI !valillc as lly~Lu~llu~;c amino æids;
serine/~l~l~ldl~u-.ll~llc as 11.~ I~u~ amino æids.
Acid addition salts of the polypeptides may be prepared by contætirlg the polypeptide with one or more equivalents of tbe desired inorganic or organic æid, such as, for example, l~ydlul,lllulic æid. Esters of 10 carboxyl groups of the puly~ d~ may also be prepared by any of the usual methods known in the art.
Once isolated, hK2 pùly~lJlidc and its s~ lly active variants, derivatives and fragmerlts thereof can be used in assays for hK2 in samples derived from biological materials suspected of containing hK2 or 15 anti-hK2 antibodies, as disclosed in detail in Serial No. 08/096,946. For example, the hK2 polypeptide can be labelled with a detectable label, such as via one or more ;..1;~-1,,1,.11, .1 peptidyl rcsidues, and can be used to compete with ~"~ g, ~ hK2 for binding to anti-hK2 antibodies, i.e., as a "capture antigen" to bind to arlti-hK2 antibodies in a sample of a physiological fluid, 20 via various eull4~Li~ive i" " "~ ~ forrnat for hK2 which uses ;I l ll l l. lI ,, I ;, anti-hK2 antibodies is ca~ried out by:
(a) providing an arnount of anti-hK2 antibodies attæhed to a solid surface;
(b) mixing the sarnple of ~ y~iulogiedl fluid to be tested with a known amount of hK2 polypeptide which comprises a detectable label, to produce a mixed sample;
(c) contæting said antibodies on said solid surfæe with said mixed sample for a sufficient time to allow i. "" " " ,~ I reactions to occur between said antibodies and said hK2, and between said antibodies and said labelled polypeptide;
(d) separating the solid surfæe from the mixed sample;
,, _ _ . ... .. ..

woss/307s8 2 1 89774 ~ 57 (e) detecting or .lrl~"""""p the presence or atnount of labelled polypeptide either bound to the antibodies on the solid surface or rem~ining in the mixed sample; and (f) ~l~ rl 1 l l;l l l l l~ from the result in step (e) the presence or amount of said hK2 in said sample.
I~ another format which can detect en-lng~no -~ hK2 in a sample by a Wlll~.i~iV~ irlhibition ;IllllI~ Ay~ a known atnount of anti-bK2 antibody is added to a sample wntaining an urlknown amount of cl ~ rl 1~ hK2. ~he known amount is selected to be less than the amount 10 required to wmplex all of the hK2 suspected to be present, e.g., that would be present in a sample of the same amount of physiological fluid obt~ined from a patient known to be prostate cancer. NexL, a known atnount of the hK2 polypeptide of the invention or a subunit thereof, wmprising a detectable label is added. If C~ hK2 is present m the sample, fewer antibodies 15 will be available to bind the labelled hK2 poly~ide, and it will remaitl freein solution. If no c, ,. l. ,~"""~i hK2 is present, the added labelled ~Iy~li~14will wmplex with the added anti-hK2 anhbodies to form binary wmplexe Ne~, the binary antibody-antigen wmplexes ate ~Ic~;l, ' by arl anti-mammal IgG antibody (sheep, goat, mouse, etG). The amount of lddiu~Livi~y 20 or other label in the precipit~tte (a terrlaty wmplex) is inversely ~ iul~l to the amount of r:l ~.T. ,~,. .. Il -~ ~` hK2 that is present in the sample, e.g., a pellet containing reduced amounts of radiod~livi~y is in&cative of the presence of c"~ , "--ll~ hK2.
Alternatively to the cul..~IL.llal techniques for prepating 25 polyclonal antibodies or arltisera in labotatory and fatm animals, monoclonal antibo&es against hK2 polypeptide can be prepat~d using known hybridoma cell culture techniques. In general, this method involves prepated an antibody-producing fused cell line, e.g, of primaty spleen cells fused with a wrnpatible wntinuous lirle of myeloma cells, and growing the fused cells 30 either in mass culture or in an animal species from which the myeloma cell line used was derived or is ~mr~tihlc Such antibodies offer many advantages in .,~ ", .l"" i~. ,. . to those produced by inoculation of animals, as they WO95130758 ' 2 ~ 8 ~ 7 7 4 r~ c~c-ls7 are highly specific and sensitive and relatively "pure" ;" " ", l"n. l .~ ";. .lly.
T,l,ll,,l,,l,lr,~,i.,.lly active fragments of the present antibodies are also ~-vithin the scope of the present invention, e.g, the f(ab) fragment, as are partially humanized "~"~ ",il antibodies.
The invention will be further described by referenre to the following detailed exarnples.
~L
C;ons~uclion of hK2 e~plession v~
10 (A) ~'~nf~tinn of I~J~IIlJI~ )vilu~ nnt~inil~E~hK~ an-l mhK~
rn-li~ Sf~lf nnPc A cDNA (~UIVNII~Iy 820 bp long) encoding the entire prepro-hK2 (pphK2) (from nucleotide #40 to #858 relative to the start site of the pphK2 transcript), as sho~-vn in Fig 5, ~-vas sylitll~i~l from RNA of 15 human BPH tissue using reverse~ N)ly~ ~. chain reaction ~RT- ~
PCR) technology with a pair of hK2 specific nli~l " ,. ,. l~ ,l " l~ primers (5'ACGCGGATCCAGCATGTGCiGACCTG(;l l~ SEQ ID NO: 2 and 5'ACAGCTGCAGTlTACTAGAG&TAGGCiGTGGGAC 3' SEQ ID NO:3).
This cDNA wæ generated such that 5' and 3' ends (with respect to pphK20 sense sequenre) were bracketed with BamHI and Pst 1 sequenres ly. The cDNA wæ then purified by agarose gel CI~Llul)llU~ and digested with BamH1 and Pst I restriction enzymes. The restricted cDNA
wæ ligated vvith the Bam~TI-Pst I digested pVL1393 plæmid vector and l, ," ,~r( " " ,~ l into the }~QIi HBIOI strain. E. coli harboring pphK2 25 cDNA/pVL1393 plasmid vertor were selected and verified by restriction enzyme mapping and DNA sfyrlf nrin~ Plasrnid pphK2 cDNAlpVL1393 was mass-prvduced in ~,~QIi and purified by CsCI gradient ultra-., "l " r.,~, ;....
cDNA encoding the mature hK2 was ~ylllL~i~l using PCR
with the ilrulr.. ,1 i.. f I pphK2 cDNA as the template plus a pair of hK2 30 nli~l~.l l lF-I1ill-_ (5'ACGCGGATCCAGCATGTGGGACCTG~l l SEQ ID NO: 2 and 5'ACCGGAATTCATGATTGTG&GAGGCTG&GAGTGT3' SEQ ID NO: 4).

W095130758 2 l ~7 74 r~ 57 As noted, the 3' end n~ ul~.lr was the same 3' end nli~ lP used for ~y~ c~i~lg the pphK2 cDN~ However, the 5' end nlignmlrlPoti~ip was different from the 5' nli~nmlrlP~tirlP used for the pphK2 cDNA, and therefore generates a cDNA coding for the ma~ure form of hK2 (rnhK2), as shown in 5 Fig 6. The rnhK2 cDNA was bracketed with EcoRI and Pstl sequences at the 5' and 3' ends rPspectively. The protein produced from the rnhK2 cDNA
will gain an exogenous methionine at its N-terminus. The rnhK2/pVL1393 vector was generated and purified as described for pphK21pVL1393 The DNA sequence analysis for pphK2 and n~K2 in pVL1393 showed that one 10 nucleotide (#805) has been altered (G to T) in a silent mutation.
pphK2/pVL1393 or rnhK21pVL1393 DNA (2 llg) were r~ ~r,l with a linealized R~rl-ln~l~l DNA (0.5 llg; Pharmingen, San Diego, CA) irlto S~9 insect cells according to Pl~llfil~ iul~ (S.
Gruenwold et al., b~UIUYillJ~i expression vector system: Pr~res and 15 Methods Manual, rl~llfill~ l, San Diego, CA (1993)). Four to six days after the 1, ,l,, r., ~ ;.)" S,!9 cell spent medium containing viral particles was harvested and used to irlfect fresh S,'9 oells to amplify viral titers. Total RNA was isolated for Northem blot analysis of authentic pphK2 or mhK2 transcript using hK2 cDNA as a probe. Further proof of pphK2 or rnhK2 transcript 20 expressed m 1~ ~ " "1,;- IAI 1~ virus infected S~9 oells was obtained by RT-PCR
and DNA ~APrlllPn~Ain~ Pure l~ b~UIUYillJ~ containing pphK2 or rnhK2 were obtained by secondary or tertiary plaque ~.-. ;IAII A'l;l~ll protocolaccording to i~ from E'l~lllill~cll (S. Gruemvold et al., cited above).
25 E~ ile 2.
Generafion of ~I~vo~c ~ ; vec~r A 0.8 kb fragment ICIJlC~,IILillg the entire preprobK2 (pphK2) coding sequenoe was generated by IJVIylllCld: c chain rerlction (PCR) using primers A (5'TATACATATGTGGGACCTG(~ l( l(,C3' SEQ ID NO.: I l) 30 and B (5'ATATGGATCCTCAGC~GGlTGGCTCiCGATGGT3' SEQ ID NO:
12) and plasmid pVL1393 containing pphK2 as the template. The pphK2 bacterial expression vector (pBPPHK2) was prepared by standard DNA

iCC~ ; : ' '13 ~ `J : ~ 'J ;~ .J ~J5~ JU ~ l tl.;: 11 1 ~i cloning technology, (Sambrook, cited above), ta subclone this 0.8 kb fragment into the Nde l/BamHI site of the plasrnid pPl~S579 (a gift from Dr. H. Hsiung, Eli Lilly Co, rne.) under the eontrol ~f T7 promoter. The DNA of the entire insert plus the cloning sites was sequeneed to confim~ that no clor,~ng artifacts 5 had oeeurred and to ensure that no anomalles In the sequenee had been generated by PCR. pBPPHK2 was ~" ~ into E. coli BL21 (DE3)Lys S (Novagen, Ine., Madiserl, Wl).
'-3.
10 G of ~ " P~Dression vector To express hK2 in mzrnm~ n cell lines, a O.g kb fra~nent I e~ ,.Lh.t~ the entire preprohk2 (pphK2) codin~ sequenee was generated by PCR using primers A(5'ATATGGATCCATATGTCAGCATGTGGGACCTG~Jl lt~ CA3') 15 (SEQ ID NO: 17) and Bt5'.4TATGGATCCTCAGGGGTT&GCTGCGATGGT3') (3EQ ID NO: 12) and plasmid pVL 1393 eontainirlg pphK2 as the template. The ~
expression vector (pGThK2) was prepa~ed using standard DNA elerling technology (Sambroolc, lg89), to clone tbis 0.~ kb fragment into tbe Bc l l site of 20 tbe plasmid pGT-d (a gift from Dr. Brian GrinnelL Eli Lilly, ïnc.) under control of the GBMT promoto~. The D~A of the entire insert plus the eloning sites v as sequenced and a singl~ base pair change at position 650 (T for C) was noted.
This change results in a~ t~mino acid s~lbstitl~tinn of valine fo} alanine at position 217 in hK2. AVl2-664 (ATCC CRL-gS95), a cell line derived from a 2~ adenovirus-induc~d tumors in Syrian hamster, was grown in Dulbecco's modif~ed Eagle's medium ~ l with 10% fetal ba~ine serum (DIOF) and transfected with plasmid pGThK2 using the calcium phosphate methad.
F.-- ' 4.
30 l ~ ~ - of, ~ - ' pph}U ~nd mhK2 A. hlrlllovin-q jn~t cellSy~nl WO 9S/30758 1 ~3 9 7 7 4 I~ .'C'157 S.t9 cells (7xlO6/plate) were seeded onto 100 mm Corning plates with 10% fetal calf serum - Graces medium at room t~ dLUI~ for I
hr. After attachrnent orl cult~re plates, cells were infected with wild type or Ir. ~ ", II ,;. ,A. ,I l,~uluvil u~ in serum free Excell-400 medium and incubated at 5 27C. Control cells were groun in the absence of virus. At designated times (24-96 hr) cells u~ere placed in fresh Sf9-llOO media deficient of either methionine or methionine and cysteirle for 45~0 min at 27C, then incubated uith Prornix (0.143 mCi/plate; a mrxture of [35S]-Il-~lLluulll~ and [35S]-cysteine; 1,000-1,400 Ci/mmol; Amersham) in serum free and 10 I"rlI.;.~";~ y~ deficient S~9IIOO mediurn (Biofluids) for 5-8 hr or 20 hr.
After the end of each incubation time, cells and spent media were separated by ~`rl 1l l; I-i l~f 11111 (1~000 rpm; Beckrnan J-6B; Beci~man, Fullerton, CA). Cells were washed and A~AfnfiI~I (13,000 rpm; Biofuge 13, Baxter) twice. ~he washe~i cells were Iysed by ~i~'ll~.. in a detergent buffer (10 rrlM Tris, pH
15 7.5; 130 rnM NaCI, 1% Triton X-100, 10 rnM NaF; 10 mM NaPi, lOrnM
Nappi, pH7.5) or H20 and c~nfrifil~i tû obtain cytosol and insoluble cellular fractions. Protein contents of the above sarrlples were deternlined by either the Bradford or Lowry method (BioRad, Inc., Melville, N.Y.). The above si~ent media, cystosol and insolubie celluiar fraction were frozen and stored 20 separately urltil used. A duplicate set of samples were prepared without 35S- labeling For SDS-poly~ gel ~l~llu~llul~ (PAGE) arlalysis of expression of hK2 protein in S,9 cells, samples were added to sarnple buffer (U.K l~elïunli, ~, ~, 680 (1970, heated at 95C for S minutes and 25 subjected to SDS-PAGE under reducing conditions.
Northem blot arfaiysis was routinely used to screen and isolate clonal Ir~ I b~4uiuvlluJ~ expressing pphK2 or rnhK2 rnRNA A
r. ~ of tne ~1l~ll~ g lanes in both AI ~ II Ih of the Northem blot and l~ of ethi&um bromide staining of RNA shows 30 that rrRNA for pphK2 or rlAhK2 was present in Ir~ ,I virus infected S~9 but not in wild type virus-infected cells. Moreover, each of the pphK2 or rnhK2 rnRNA positive lanes represents RNA isolated from S.~9 cells infected .. ... ..

woss/307~s 21 ~q774 P~llu~ 7 with ~ viruses denved from a single viral plaque. Thus, the results sugge3t that high frequency (100/0) of l~)III~ baculovirus containing either pphK2 or rnhK2 was obtained from the above c~l . AI ,~rrl l ;UII.
Fu.~ ..ul~, the sequences of pphK2 or mhK2 expressed in viral infected SJ9 5 cells were confirmed by a ~ I of RT-PCR, cloning and DNA
To determine whether the pphK2 protein is expressed in the insect cell S~, time course studies using 35S-labeling of de novo synthesis of protem ~vas performed and detected by SDS denaturing polya~,lyla,lliJ~ gel 10 ~ u~ ~is (PAGE). As seen inthe autoradiograph (Fig. 1), aunique protein (about 28 KDa) was found in pphK2-1~ -l1~il~l~ virus-infected S~9 cells at 35-74 hour post-infection. This band was missing in uninfected cells or oells infected with wild type virus. The vilal polyhedron protein (about 32 KDa) was found (Fig. 1) as expected in S~9 cells infected with wild type 15 virus, ~hereas it was not expressed by l~ ...,A,.I virus (Fig 1). The protein was detected in cytosol when subcellular fractions (cytosol vs.
insoluble fraction) was prepared by Iysing cells with H20 and freeze thaw, ~hereas this 28 KD protein was detected in insoluble fraction when prepared by a detergent buffer and fr~e thaw (data not shown).
The rnhK2 protein was also expressed m the insect cell S 9, 35S-labeling of de novo ~yll~l~;~l protein was performed. As seen in the ig. 2), a unique protein (about 28 KDa) was found in the insoluble fraction of rnhK2~ virus-infected ~9 cells at 48 hours post-infection. This band ~vas missing in uninfected cells or cells infected 25 with wild type virus. The viral polyhedron protein (about 32 KDa) was found in wild type virus-infected cells, whereas it was not expressed in cells infected with lrl~ l ll virus (Fig. 1). When the cytosol fraction was exan~ined, no 28 KDa band was observed.
30 B. E Coli sys~n Plasmid pBPPHK2 was "~ ,~r~,. " 1~ll into ~li BL21 (DE3) pLysS (Novagen, Inc., Madison, Wl). This strain contains a ,hlu -lu~ull~l woss/307ss 2 1 8~774 F~~ S~ 157 copy of T7 RNA ~oly~ .~G under the control of rnducible LacW5 promoter. Upon addition of IPTG (isopropyl-~D-ll.i~.~l l. I.)I.yl~lu~id~) thc expression of the T7 RNA polymerase is induced which in tu~n acti~ates the T7 promoter resulting in Ov~)ludu~iùll of the gene product under control of 5 this promoter. To detG~mine whether the product of the ppHK2 gene would be expressed from pBPPHK2, single colonies of BL21 E.~li l,,,. ~r(~l,"~
with pBPPHK2 were grown to O.D.600 = 0.2 in 10 rnl LB media plus ampicillin (lOOIlg/ml) and induced ~vith 0.4 mM IPTG (Sigrna, Inc.). Cells were harvested 2 hours after induction by ~ rl 1l l i r, 1~l ;. ", and Ir.~ )rl 1~ 1 in 10 1.5 ml SDS/PAGE sample buffer (U.K Laemmli, ~h~, 2~, 6801970) before SDS/PAGE analysis. The cell pellet from the IPTG-induced culture was lr~l'`l~ Illrli in 0.05M Tris, pH 8.0 (at 9mVgm cell pellet) and stirred at room ~ d~G (25C, r.t.) for 1 hour. Lysozyme (4 mg/ml) was added to this suspension (at 1 mUgm cell pellet) and the suspension was stirred at r.t.
15 for 30 min followed by incubation on ice for 30 rnin. The susperlsion was sonicated for 2 min at 150 watts and c~n1rifi~A at 3000xg to isolate the inclusion bodies. Inclusion bodies were Ir~ l in r~nning buffer (25 rnM Tris, 192 rnM glycrne, 0.1% SDS) and after .. .11"r,.~:;-.., both the pellet and the ~ were analyzed by SDSIPAOE.
About 90% of the pphK2 was found to be in the ~
fraction which rndicated that pphK2 is soluble in 0.1% SDS. To preparG
samples for amino acid sequenoe analysis, 20ul of inclusion body Iysate wæ
subjected to SDS/PAGE on a ~20% gradient gel (BI~RAD, Inc., Melville, N.Y.). The protein ~vas blotted from the gel onto 0.2,u PVD~ paper (BI~
25 RAD) and stained with Coomæsie blue. The protein band of interest wæ cut out from the blot and subjected to amino acid sequencing using a protein sequencer model 477A (Applied ~iosystern, Inc., Foster Cit~, CA).
The induced cells uv~ ullu~Gd large amounts of a polypeptide with apparent mole~ular mæs of about 28kd (Figure 3). D~;LulllG~- ;c 30 analysis indicated that this protein comprised ~I.,u~.~.ly 40% of total cellular protein. The size of this protein as determined by an SDS-PAGE gel wæ ~ - ,,l If to thal prGdicted from coding sequcnce for pphK2. To ~ woss/307ss 21 89774 r~ r-ls7 confirm that this protein is pphK2, the sequence of the frrst 10 amino acids (MWDLVLSTAL) (SEQ ID NO: 13) from the N-terminus was tlPtPrminPA
This sequence agrees perfectly with that deduced from the DNA sequence of pphK2 cDNA. As noted, it has different identity f~om the first 10 amino 5 acids of both pphKl (MWFLVLCLAL) (SEQ ID NO: 14) and pphK3 (MWVPVVFLTL) (SEQ ID NO: 15). It also shows that this protein is not modified or processed at the N-terminus either during or after expression in E.
coli. These results ~lr",l."~h..'~ that we were able to accurately express pphK2 in E. coli from pBPPHK2.
C hl~mm~ n Sy~tpm 1. Isol~ion aml r, ~ of probein Plasmid pGThK2 was l"l"~ri)ll"rA into hamster cell line AV12-664 (ATCC-CT~Ir9595). To determine whether the product of the ppT~K2 15 gene would be expressed from pGThK2, AV12-pGThK2 #2 was grown in DlOF + 200nM MTX At about 60% confluency the oells were washed with Tl;3nks balanced salt solution and lC~ "~lrll in serum-free T~H4 medium.
The spent medium was collected after 7 days (serum-free sperlt medium) and stored at -20C. Figure 8 depicts a SDS-PAGE confr~ming expression of 20 ~""l~ ,l pphK2 in a ",~."",,.l.,.., cell line. AV12-pGThK2 (Lane ~6) and AV12-pGT-d (Lane 3) clonal cell lines were grown in DlOF media. About 300111 of spent medium from the above clones were ~`11111, .a.,,1r,1 and subjected to SDSIPAGE along with See Blu~e MW marker (lane 1) and pphK2 Iysate from E. coli cells (lane 2). The gel was blotted onto nitrocellulose 25 paper and i~ l using a 1/1000 dilution of anti-pphK2 rabbit antiserunL HRP-goat anti-rabbit was used as the secondary probe and the blot was developed by DAB plus H202. T ane 3 (AV12-pGT-d) is AV12 transfected with vector without insert.
To purify the protein, the serum-free spent medium was 30 ~ rll from 5-10 fold by ~ ' ~It~ti~m with a 10 kDa molecular ~veight cutoff mernbrane then dialyzed overnight at 4C versus 50 mM sodium 1,;~,..1~.",.1~, pH 8. Samples were filtered with 0.2 ~ filters and then purnped W0 95/30758 ~ J,,,r:C t~?

directly onto a TSK DEAE-5PW HPLC column (21 mm X 150 mm) at a flow rate of S rr~min. Buffer A contained 50 n~l sodium b;~l~lh.f~, pH 7.9 Buffer B contained 50 mM sodium IJ;I~ IIIAU- plus 0.5 M sodium chloride, pH 7.6. The elution profile shown in Figure 9 was developed with a gradient 5 from 0-50% Buffer B over 35 min; 50-100% B from 35-40 min and isocratic elution at 100% B for 5 min before re-~~ hrltion in Buffer A The flow rate was 5rntJmirl throughout.
DEAE fractions were assayed for the presence of hK2 by ELISA using rabbit anit-pphK2 as primary antibodies. The ELISA assayed 10 showed a peak of hK2 activity which eluted at ~,u~-~ly 0-2M NaCl (shown as the triangle line in Figure 9), which correlated well with the appearance of a 34 kDa band of protein seen by SDS-PAGE in the same fractions (da~a not shown).
Fractions with hK2 activity were pooled and /`l .". . . ,l, . . f. . I by 15 lll~ lAl;llll with 10 kDa ",. .lll.,..~,r~ to a~ lu~illL~ly 5-& mL where upon solid Ammfmillm sulfate was added to make a final ~.."~ A1;IIII of I M.
This sample wa5 then mjected onto a PolyLC. polypropyl ~ . lA, . .;il~ column, lOOOA pore size, 4.6 mm X 200 mm, to resolve protein by llyJIulJ~
interaction chr~mAh ~hy (H[C, see Figure 10). Buffer A was 20 mM Na 20 phosphate, 1.2 M Na sulfate pH 6.3 and Buffer B wa3 S0 rrlM Na phosphate, 5% 2-propanol, pH 7.4. The elution gradient was 0-20% B over 5 min; 20-55% B from 5-20 min, isocratic at 55% B from 20-23 min, 55-100% B from 23-Z5 min; isocratic at 100% B for 2 min before re-~rl;l;l.,d;.." Buffer A
The flow rate was 0.7 m-~imin~ Greater than 90% of the A280 was not 25 retained on H[C colurr~n. The main peak retained on E~C, which eluted at æ
min, also showed the highest peak of activity by ELISA assay (triangle line, Figure 10).
H[C fractions which tested positive for hK2 on ELISA were pooled, ultrafilter .""" ~111. t~ ,1 as above to a volurne less than I mL then 30 injected on a 10/30 Pharrnacia S12 size exclusion column f,l";l;l"alr~l in 100 mM Amm~lnillm ae. The flow rate was 0.7 ml/min. When the 22 min peak from HIC was resolved by size exclusion ~ a~ Al~l~y, typically ,~ WO95/30758 ' ' 2 ~ g9774 P ~ 157 about 80-90% of the protein A28o eluted at 19.4 min, a retention time consisterlt with a protein of ~ u~ll~ly 34 kDa (Figure 11). The only other protein peak on SEC, elutirlg at 16.7 rnin, Wll~)UII~I to an about 70KDa proteirl seen also in previous l" ~ 1 l steps.
S To e?~ine the efficiency of our ~", ;1;. A~ I scheme, 1.5 llg of purified phK2 was subjected to SDS/PAGE irl the presence or absence of ~
I (BME), and the gel was stained with silver. Results showed that the phK2 irl our sample was about 95% pure (Fig. 12). It also showed that pro-hK2 migrated at about 30 KD irl the absence of BME, and it 10 migrated at about 34 kDa in the presence of BME. This pattern is sirnilar to that observed for the PSA purified from seminal fluid (Fig. 12).
phK2 is recogrlized by rabbit anti-pphK2, rabbit anti-PSA and a murine mnn~l~ nAI antibody directed against a ~Iy~
covering amino acids 41-56 of hK2, when analyzed on WESTERN blots or 15 when dried down on microtiter plates. EIowever, phK2 was not detectable by these antibodies in sandwich assays. These results further ~ i' tnat the phK2 and PSA are ,~ ..,1~.",.A; ~ Iy different and the antibodies currently available to PSA or hK2 can not detect phK2 in its native form. Fu~iL~llll . c, phK2 was not detectable by the Tandem R or free-PSA assays (;lll..l..l.. l~-gj.
20 assays for detection of PSA in serum).
A sample of the hybridoma (~lA 523.5) secreting the murine IAI antibody has been deposited in the AmQican Type Culture Collection, Rockville, MD, and assigned ATCC E~11876.
2. Ar.,irlo Acid Analysis and Plotein S~, O of pl~
The peak collected off size exclusion ~LI~ Y (SEC) in ~ ""--,--;,-.-- acetate was Iyophilized to remo~e the buffQr thQn 1~ "l~1 in watQr. An aliquot (2.5~g)of this sample was loaded on a Porton mQ-nbrane (Beckman ill:~LlUlllQl~i) and subjected to automated N-te~ninal sequence 30 analysis on an Applied BiosystQAs model 477A protein sequencer which yielded the following sequence:

Ri.~. ~0~ )t; :'~U~ 'J~i . 'I :!';'J . :;L'~ J ~i:J ''.I'J~ J
~ 2l ~9774 Val-Pro-Leu-lle-Gln-Ser-Arg-[le-Yal-Gly-Gly-Trp-Glu- (SEQ ID NO: 18). A~
aliquot of the same sample in water was Also hydrolyzed in gaseous 6 N HCI
under vacuum for 20 h at l l 2 C then ~ l in O. lN HCI and analyzed on an Hewlett Packard Aminoquant amino acid analyzer utilizing pre-column 5 derivatization of amino acids with OPA for primary and FMOC far secondary amir~es.
No competing sequence was evide~t from the profile of amino acids released sequerltially by the Edrnan ~ procedure. By analogy t~
PSA this proteirl is pro hK2, sinc~ the knoun sequence of mature PSA has been 10 shown to begin with Ileu-Val-Gly-etc and pro PSA has been postulated to have an extra 7 arnino acias at the N-term~us. Atr~ino acid analysis of this proteirlyielded an amino acid .~ ,.. c~nsistent with the . ~ sequence of probK2. These results ~lPTnlm~tr~t~ that pphK2, having SEQ ID NO: 19, was accurately expressed in the,, -,.ll.,~li,., l cell line AV12-664 from pGThK2.
Fnr~ ~ 5.
P~ I ' of rmtib~dies to . ' ' ppbK2 A. F:. Coli SVSt~m To prepare pphK2 for rabbit ~ ... , the inclusiarl bodies 20 obtained from bacterial cultures of BL2 L ~pBpphK2) after IPTG induction as irL
Exa~ple 4B were ~ua~dcl in 100/~l SDS/PAGE sample buffer/ml bacterial culture and clc,,l.u~,l.u.~ l on preparative S~S/PAGE. The pphK2 band was cxcised and electraeluted fram the gd irlto tunning buffer (2'im~1 Tris, 192 mM
glycine, 0.1% SDS) and used as the i.~-..u.ug_... Two rabbits were each 25 imrmmi7Prl with 1~0~g of the illl~ llU~;..I in complete Freund's adjuvant andwere boosted twice in three week inkrvals with 1 00~g of the, .. . ~.. in incom~lete Frelmd's adjuvant and PBS, respectiYe~y. Rabbit rlnti-pph}C2 sera was obta~ned one week followin~ the second boosl. The presence of anti-pphK2 in the rabbit antiserum was shasbn by ELISA (data noe sho~vn). Once confirrned 30 by this method, the highest titer antiserurn was tcsted on Western blats using Iysates from IPTG induced or nûn-induced cultures of Bl.2 1 (pBpphK2~. ~t was L~ 'S3~ U~ )" . ~ ;3;31J :3~ u ~J'J ~:3U~J.~ 5: /_ ~) 26a evident t3'lat the antiserurn contained wo ss/307ss ~ 57 antibodier, highly specific for the pphK2 protein since a protein band at about 28kd Cu~ ulldlllg to pphK2 vas recogrli7ed only in the induced Iysate. The antiserurn also recogrl,~ed the purified pphK2 furtber showing the specificity of the antibodier, to pphK2. ~he above data ~Ir~ d~ that the antibodies 5 recogr~ize the prepro-fonn of hK2.
To delineate if the antiserurn recognizes the mature for~n of hK2 (mhK2), mhK2 was expressed in ~.~QIi as a glutathione S-transferase fusion protein (GST-rnhK2, 58kd), and the cell Iysate was i".",.,.~ rl1 using anit-pphK2 rabbit anti~,erum. It was evident that anti-ppbK2 antiserurn 10 recognized the GST-mkK2, .1~ d i~ ~ that antibodies were at least in part again~,t the rnat~re rc~,ion of pphK2. To c-xamine the pattern rccogrfized in seminal fluid by anti-pphK2 antibodics, seminal fluid was preparcd from poolcd semen as dcscribcd by Sl~n~lh~ and Blakc, J. Url~ln~y, 149, 1523 (1990), and immlm~lhl~A with anti-pphK2 rahbit antiserunL The antiserum 15 rccognized a _ajor band at about 34kd plus scvera~ rninor bands at lowcr MW. The pre-immune serurn did not recogrli7e any bands in any of the above ~AI,r. ;, . .. ,l~, showing that the antibodics were gcneratc-d by To detc-nnine whethcr thcre are any pphK2-spccific antibodies 20 in rabbit anit-pphK2 antiscnLm, the antibodies cross-reacting to PSA were absorbed ûut of the antiserurn by a PSA affinity resin. Spccifically, Iml of the sera wa3 diluted with ImL 100 mM HEPES, pH. 7.5 and incubatcd with native PSA-bound Affigel-10 for 3.5 hours at 4C. The mixture wa3 used poured into a colurnn, the flow-through was collc-cted and the colurnn was 25 washcd with 30 ml HEPES buffcr. Antibodies bound to the column (eluate) were eluted by acetic acid (IN, pH 4.0) and neulIalized to pH. 6.6 with N~OH. Native PSA was isolatcd from seminal fluid as describcd by Sensabaugh and Blake, cited above. ppPSA was purified frûm ~.5Qli 1~,.1 ,~r( ., .. 1 with pla~,mid pPHS579 (corltaining ppPSA under control of T7 30 promotcr) using a procedure analogous to pphK2 l"" ;~
The flow-through and the colunnn eluate wcre testcd for Abs I~U~,IllLUlg pphK2, ppPSA and native PSA (PSA isolatcd from seminal fluid) , WO9S/30758 21 89 7 74 r~ s7 using Western blot analysis. It was evident that antibodies in the untreated rabbit anti-pphK2 antiserum recogoized all three proteins indicating that pphK2, ppPSA and se-m~ fluid-PSA share some similar epitopes. However, while the column elu~te contained antibodies that recognized all three protein, 5 the flow-through contained antibodies that recogr~ized only pphK2. This indicates that anti-pphK2 antiserum contains pphK2-specific antibodies and these antibodies can be isolated by PSA affinity absorption. This system enabled us to generate anti-pphK2 antibodies uhich recognize both pphK2 and mhK2. rhus, utilr~ing immlmogeniA and pure l~ollLu~l~ hK2 proteirL
10 generate rabbit antiserlm was generated which corltains pphK2-specific antibodies, providing a valuable source for generating arld screening for hK2-specific " ,. " " ~ 1. " IAI antibodies.
~ hese examples describe the use of three heterologous expression systems (i.e. both uluLuyu~i-, and eukaryotic~ for the successful 15 expression of the hK2 I,ol~l ti~. Thus, the method of the invention enables production of large quantities of CllhctAntiAlly pure hK2 polypeptide. Ihe pulS~liJ~ can be used both to study its biological functions and to produce j""".~."~ t~. 1;.~" reagents such as labelled hK2 ~l~yti~l~, labelled fragments thereof and antibodies thereto. Ihe iull-llu.lule~ ~lb can provide a 20 method to purify native hK2 and to study the properties of the purified native hK2 polypeptide.
The pphK2 U.~ IUJIIU~II rn E. coli can be readily solubilized in 0.1% SDS, thus solubility is not a problern. This is in contrast to the expression of human salivary kallikrein protein, hK1, in E. coli, which was 25 found in insoluble inclusion bodies (J. Wang, et al ~inrhPm J., 21~, 63 (1991)). In contrast, the present invention yields almost pure protein uhich can be purr~led to hA,m~ ity by preparative SDS-PAGE. This purified ,~-" " "1,;, IA~ 11 pphK2 can be used for the generation of " ,- ."..,1. ., IAI and polyclonal antibodies.
As shoun above, RAr'll~ viral DNA can be used to generate a l'' . " "1 .i, IA. 11 baculovirus containing pphK2 or mhK2. Use of RA~ 1 viral DNA provides high selection of positive lr- .. "1 I; I ~

~ W095/30758 2 1 g~774 ~ s7 baculoviruses. Indeed, Northern blot analysis showed a high frequency of ." ,1.;. ,~ virus expressing pphK2 or rnhK2 mRNA. Moreover, SDS-PAGE
analysis showed that both pphK2 and rnhK2 l r~, ,,, ,1 ,l, ,,., ,1 viruses produced unique proteins with sizes similar to the calculated molecular weights for 5 pphK2 or rnhK2. Although the levels of the lrl ~" "I .~ hK2 expressed in insect system may not be as high as in E. coli, the hK2 protein produced in baculovirus-insect systetn may contain the secreted form which would be more like the natural form of the protein.
Plasmids pphK21pVL1393 in E. col. H13101 has been 10 deposited in the American Type Culture Collection, Rockville, MD, USA on May 2, 1994 under the provisions of the Budapest Treaty and have been assigned accession number ATCC 69614.
The invention has been described with reference to various specific and preferred ~mhtxlirr~ t~ and techniques. However, it should be 15 understood that many variations and " ,~ d ;. " l~ may be made while remaining within the spirit and scope of the invention.

IIL~ `'t~- tj-'J~ "~ ~,"", _ t.~U t~iJ _~J~ 'lt.~ . /l.l(i SU!35T}TCT~ SE~ 3NCE LISTING
~1) G8NE~L I~FOPMATI0N:
i~ APPLICANT: Mayc Fou~d~tior~ fcr ~edical ~d~ oti n and Resear~h ~ybritech Tn~
Ti~d 11, Donald ~.
Young, ChArle~ Y.F.
saedi, Moh~mmed S.
(ii~ TI~LE OF INVBNTrON~ nln~ ~g2 Polypeptidc (iiiJ NU~38R OP S~QCENCES: 20 ~iv) ~O~r.-i~u..Jr~ i ADDÆSS:
(A~ ADDR}55S~ri: S- - _ , Lundber~, ~oe~sner ~ }CIuth, P.A.
~B~ SI~EET: 3500 IDS Center (C~ CITY: M~nn~
(D~ STAT~: MN
(~) COUNTRY: ~F~
( F) ZIP: S ~i4 02 (v~ COMPUTER R3ADA3LE FORM:
(A~ MEDrUM mE Floppy disk (B~ COMP~TE~: IBM PC ihl (C~ OPERATING SYSTEM: PC-DOS~MS-DOS
(D~ SOFTWAR3: pntentIn ~elease #l.C, Version #1.2 (vi) CURÆNT APPLICATION DATA:
(A) A~PLICATION NCMSER-(s) FILING DA1~3:
~C) C~SSIFICATION:
(viii) ATTO~Y/AGI!NT l :r- ~ :
(A3 NAME: Woessrter, Warren D.
(~3) REGISTRATION NCMBER: 30,440 (C~ REFBRE~NCE/DOC~ET NCMi3~R: 150.148WOl (iX) TEL.liCu._ ~NT(~TION ll!lrUA~ LJOI:
(A) TELEPEWNE: 612-339-0331 (B) TiiLEFAX: 612-33g-3C61 o\ ` L:I'A ~11 L:.~CilL ~ I)t~ t~ 3~ :3~)ti l - + 3 i) 1~'3 ~3~ ;G: /~.3 l 218~774 (2) IN3SORMA~I~N 3,~'0R SEO ID NO:l:
~i) SEO~3ENCE ~33~ T~ ~ L~
~A~ LENaTEl "37 amino aclc3s (B) TYPE: amlno acid (C) 5~ inglA
(D) TOPOLO~iY: linei~r (il) MOLEC'J~E TYPE: pep~ide (xi) SEOU3NCE i~ t~lrllur3: SECi ID NO:l:
Ile Val Gly Gly Trp Glu Cy8 Glu Lyt ~lis Ser Gln Pro Trp Gln Val Leu Val A;a Ser Arg Gly Arg Ala Val Cys Gly Gly Val Leu Val 1~ 9 Pro Gln Trp Vi~l Leu 11~- Ala Ala His Cys Ile Arg Asn 3~ys ger Val Ile Leu Leu Gly ~rg j-ii3 Ser Leu Phe ~ii3 Pro Glu A3p rhr Gly Gln 50 , SS 6C
V~ Phe Gl:~ Val Ser Thr Ser Phe Pro 33ii~ Pro Le ~ ~yr Asp Met Ser Leu Leu Lys Asn Arg Phe Leu Arg j?ro Gly 3~133p Af3p Ser Ser liB Ai~p

3,eu ,~e~ LeU L~u Arg Leu Ser Glu Pro Alil Glu Leu Thr ~3p A' ~ Val 100 105 . 110 Ly3 Vi~l Met Asp Leu Pro Thr Gln Glu Pro Ala Leu Gly Thr Thr Cy , - T~ r Ala Ser Gly Trp Gly Ser Ile Glu Pro Glu Glu Phe Leu Thr 3'ro Lyii Ly6 Leu Gln Cys Val Gln Leu ,~i~ Val Ile Ser A~n Aep Val Cy8 145 l~iO lSS 16C
P.la Gln Val lia Pro Gln Ly~3 Val ~hr Lyi3 Phe Met Leu Cys Ala Gly Arg Trp Thr Gly Gly Lys Ser Thr Cy~ Ser Gly Asp 5-3r Gly G' y Pro 1~3C liiS 130 Leu Val Cys Aan Gly V~l Leu Gln Gly rle T31r Ser Trp Gly Ser Glu lg5 200 205 Pro Cyi5 Ala Le3u Pro Glu Arg i~ro Ser L~3u Tyr Thr Lys V3~1 Val 3~13 Tyr Arg Lys ~rp Ile Lyis Aup Thr ~le Val Ala Aan Pro .

2 ~ , - ~Trlir FOF, 5EQ ID ~O: 2:
(i1 SEOrJENCE (~ A~ 4LL:_ ~A) LBNGTX: 32 ~n~ P~ir~
(B) TYPE: ~rLUC1eiC ~Cid ~C) STT~ Ce ning1e ~D) TOPOLOGY: 1inear MOLECULE TYPE: CDNA
(Xi~ SEOt:ENCE DESCRIPTION: SEQ m NO:2:
Arr.rr~,rr AGCATGTGGG ACCTGGTTCT CT 32 (2~ 1.`.1'U.__..L:~N FOR SEO ID NO:3:
(i) SEOUZ~CE ~Fr~ , r i r~ L1L:~:
(A) LENGT};: 33 ~:a3e Pair~
~B~ TYPB: nUcleic ~Cid (C~ 9T1~r~ q5: ~ing1e (D~ TOPOLUGY: 11near (ii) MOLECr~TE TYP~: CDNPL
(X1) SBQUENOE DESC~LIP~ION: SEQ ID YO:3:
ArArr~!:rAr. TTTACTAGAG r~1Ar.;r~1~r~ GAC 33 (2) ~ FOR SEQ ID YO:4:
(I) SBCUENOE r~r`~ `;LLW:
(A) LBNGTY: ~g ba~e Pa1r6 (3) TYPE: nUC1eiC !LCid (C) ST~ ing1e (D) TOPOI.OGY: ~1ne~r (ii) MOLECrJLE IYPE: CDNA
(Xi) SZQUENCE DL;~Ca1r11~: SEQ ID NO:4:
ACCGGAPLT2'C ATGATTGTGG GAGGCTGr;3A G~GT 34 (Z) INFORMA'rION FOR SZQ ID NO:~3:
(i) SZQI~CZ r~A~A. I r ~ r~ I L~:
(A) LENGT~;: r~32 ba~e P~irn ~B) TYPE: nUC1eiC ncid ~C) ~A dC~ e ~5~ TOPOLOGY: 1in~r~r (ii) MOLEC~LE: TYPE: CDNA
(iX) ~EAT1~RE:
(A~ ~FEY: CDS
~3~ LOCAT~QN: 10..792 (xl) SEC~ CE l~v~ ur~: SEiC ID ~O:5:
GGArCCAGC ATG TGG GAC CT~ GTT CTC TCC ATC GCC rrG TCT aTG GaG 48 M~t TrrJ Aap Lcu Val ~eu Ser ILe Ala Leu Ser V~1 Gly ~GC ACT aGT GCC GTG CCC CTC ATC CAG TC~ CGG A~T GTa GGA GGC TGG 96 Cy~ Thr Gly Ala V~l Pro Lcu Ile Gln Ser Arg rle Val GLy Gly Trp lS 2U 25 GAa TGT aAG AAG CAT TCC CAA CCC TGG CAG GTG aCT GTG TAC AGT CAT 144 Glu Cy~ Glu Lys Hls Ser aln Pro T-p Gln Val ALa Val Tyr Ser ~tis 30 35 40 4;
aGA TGG GCA CAC TaT GaG GGT GTC CTG GTG CAC CCC C~G ~GG GTG CTC 192 aly Trp Alo. I{is Cy~ Gly Gly Val Leu Val El~ Pro Gln Trp Val Leu 5~ 55 60 ACA GCT GCC CAT TGC CTA AAG AAG APT AaC CAG GTC TCa CTG GGT CGG Z40 Th~ Ala Ala ~18 Cys Leu Lys Ly~ A in S~r Gln Val Trp Leu Gly Arg 65 70 7s CAC AAC CTG m aAG CCT GAA ~AC ACA GaC CAa A~iG GTC CCT GTC AGC Z88 Hilii A~n Leu Phe Glu Pro Glu Asp Thr Gly Gln Arg Val Pro Val Ser 80 85 9o CAC AGC TTC CCA CAC cca CTC 1`AC AAT ATG AGC C~T CTa AAG CAT C~A 336 Ser Phe Pro ~lis Pro Leu ~yr Alsn Met 3er Leu Leu Ly~ C.ln 95 100 lOS
AGC C~ AGA CCA GAT GAA GAC TCC AGC CAT GAC CTC ATG CTG CTC C5C 384 8er L~u i rg Pro Aap Glu Asp Ser Ser His A~p Leu Met Leu Leu Arg 110 115 lZ0 ~25 CTG TCA GAG CCT GCC AAG ATC ACA GAT ~iTT GTa Aaci GTC CTG aGC CTG 432 Leu Ser GLu Pro Ala Ly~ Ile Thr Asp Val Val Ly~ Val Leu Gly Leu CCC ACC CaG aAa CCA GCA CTG GGG ACC ACC TGC TAC GCC TCA GGC Taa 4 8 0 Pro Thr Gln Glu Pro A;a Leu Gly Thr Thr Cys Tyr Al~ Ser Gly Trp 1~5 lS0 155 GGC AGC ATC GAA CCA GAa GAG TTC TTa CGC CCC AGG AGT CTT CAG TGT 52 Gly Ser ~le Glu Pro Glu Glu Phe Leu Arg Pro ~rSr Ser Leu GLn CYB

Val Ser Leu ~ill Leu Leu 3~r Asn Asp Met Cy~ ALa Arg Ala Tyr Ser aAG AAG GTG ACA GAG TTC ATG TTG TGT GCT GaG CTC TGG ACA GGT GGT 624 Glu Lya Val T}~r Glu Phe Met L-u Cya A1~ ~iily Leu Trp ~hr Gly Gly 190 195 200 20s AAh GAC P.CT TGT GGG GGT C-AT TCT GGG GGT CCA CTT GTC TGT AAT GGT 672 LYB Asp Thr cy8 Gly Gly A9p Ser Gly Gly Pro l,eu Val Cy~ AE;~ Gly iC~ . ~ u!~ PA ~ C~ ()r3 : ~3 ~ 3t, : ~ t7 : ~ 3~t ~ + l ~ ~t~t ~';3U~t;l ~;o: tl:t~
2~ 89774 ~4 GTG CTT CAA GGT ATC ~CA TCA TGG GGC CCT GAG CCA TGT GCC CTC.i CCT 720 Val Leu G1:L Gly 3-1~ Thr Ser Trp Gly Pro alu Pro Cys Al~ J,eu Pro GAA AAG CCT GCT aTa TAC ACC AAG GTG GTG CAT TAC CGG AAG TGG ATC 768 Glu LyG Pro Ala V~1 Tyr ~hr LYG Val Val NiG Tyr Arg Ly~t Trp ~lc AAG GAC ACC ATC GCA GCC AAC CCC TGAt3TGCCCC l~Trrr~rrr CTACCTCT~ 821 Ly~t Aap Thr Ile Ala Ala At3n Pro rT~ ~ . nTe3r~t n 8 3 2 (2~ INFORMATION FOR SEQ ID NO:6:
( i ) S EQ~JENCE ~ ~t ~ L L:~:
(AJ hBNGTN: 261 ami~o acids (B~ TYPE: acino acid (D) TOPOLO,GY: linear OLEC~LE TYPE: ~ro'ceir.
(xi) SEQI~NCE Lt~ LUN: SEQ ID r~:6 Met Trp A~33p Leu Val Leu ser Ile Ala L~u S~r Val Gly Cy8 Thr Gly Ala Val Pro Leu Ile Gln Ser Arg Ile Va} Gly Gly Trp Glu Cys Glu Lya Nis Ser Gln Pro Trp Gln Val Ala Val Tyr Ser His Gly Trp Ala Nls Cy~ Gly Gly Val Leu Va~ Hio Pro Gln Trp Val I,eu Thr Ala A1A

Ni~t Cye Leu LYG Lye Asn Ser Gln Vdl Tr~t Leu G~y Arg His Atln ~u Phe Glu ~ro Glu A~p ~hr Gly G~n Arg Val Pro Vt~l S~r His Ser Phe Pro ~iG Pro Le ~ Tyr At3n Met Ser ~eu Leu Ly~ Hio Gln Ser Leu Arg 100 105 ~ 110 Pro ~itp Glu A133p Ser Ser ~ p Leu Met l~eu Leu Arg L~u Ser Glu Pro Ala Ly~ Ile Thr Aap Val VA1 Lylt Val Leu Gly Leu Pro Thr Gln 130 135 14~3 Glu Pro Ala Leu Gly Thr Thr Cye Tyr A}~ ger Gly Trp Gly Ser ~1~
145 150 lSS 160 Glu rro Glu Glu Phe Leu Arg Pro Arg Ser Leu Gln Cys Val Ser Leu 'S`~ A~ A~IIL\ ~ ù- O-Otj . "":U~ Jo~ ;.:I/ti~ u ~u '0~`~ ii.:9~i~

Hi6 Leu L~u Ser Asr. A~p Met Cy6 Ala Arg Ala Tyr Ser Glu Ly6 Val Thr Glu Phe Met Leu Cy~ A1!L Gly heu Tr,o Thr Gly Gly Ly~ A~p Thr l9S 200 Z05 Cyo Gly Gly A6p Ser Gly Gly Pro Leu Val Cys As~ Gly V~l Leu Gln Gly Ile T~Lr Ser Trp Gly Pro Glu Pro C~8 Ala Leu Pro Glu Lys Prc Ala Val Tyr Thr Lys Val Val Hi8 Tyr Arg Lya Trp ~le Ly6 Asp Thr Ile ~la Ala Asn Pro (2) INFOPMATION FOR SEO ID NO:7:
~i~ SEQm~NCE :~ LlW
~A) LFiNGTH: 760 ~a6e pairs ~9~ TY2Ei: nuclelc acid ~C) 5T~LNnrn~qC double TOPOLOGY~ e~-r ~ii) MOLECUL3 7.'YPE: cDNA
( ix) FEAT~E:
~A) NAMFi/KEY: C39 (~) liOCATION: 7..72C
~xi) 9l3~UFNCE LJ~S~L~LL~il: SEO ID NO:7:
GAATTC ATG ATT GTG GGA GGC TGG GAG TGT GAG AAG CAT TCC CAA C~C 4a Met ~lc Val Gly Gly Trp Glu Cy~ Glu Ly6 His Ser GLn Pro TGG C~G GTG GCT GTG SAC AGT CAT GGA TGG GCA CAC TGT ~iGG GGT GTC 96 ~ :
Trp Gln Val Ala Val Tyr Ser Hill Gly Trp Ala His Cy~ Gly Gly Val lS 20 25 30 CTG ~TG CAC CCC CAG SGG GTG CTC ACA GC~,GCC CAT TGC CTA AAG AAG 1~4 Leu V~L1 His Pro G'Ln Tr~ vi~l Leu T~Lr Ala Ala Hi6 Cys Leu Lys Lys Ai~T AGC CPG GTC TGG CTG GGT CGG CAC AAC CTG rTT GACL CCT GAA ~AC 192 A6r Ser Gln Val Trp Leu Gly Arg ~is Asn Lou Pb.~ Glu Pro Glu A~

ACA GGC CAG AG~ GTC CCT GTC AGC CAC AGC TTC CCA CAC CCG CTC TAC 24 0 Thr Gly Gl~ Arg V1L1 Pro V~L1 Ser Hi6 S~r Pho Pro Hi6 Pro L-u Tyr ss 70 75 AAT ATa AGC CTT CTG AAG CAT CAA AGC CTT AGA CCA GAT GAA GAC TCC 288 LI~A ~ t;~ ti ~ u :~o~ t ~J ;~J ~ ,5 ~ ti .
2~ 89774 Asn Met Sor Leu Leu Ly3 Hi~ Gl~ Ser Leu Arg ~o Asp Glu Asp Ser AGC CAT GAC CTC ATG CTG CTC C~C CTG TCP. GAG CCT GCC A~G ATC ACA 336 9cr His A~p Leu Met Leu Leu Arg Leu Ser Glu Pro Ala Lys Ile T}lr gs lO0 lC5 L10 GAT GTT GTG AAG GTC CTG GGC CTG CCC ACC CAG GAG CCA GCA CTG GGa 384 Asp Val Yal Ly~ Val Leu Gly Leu Pro Thr Gln Glu Pr~ Ala Leu Gly ACC ACC TGC TAC GCC TCA GGC TCG GGC AGC ATC aA~ CCA GhG GAG TTC 432 Thr Thr CY8 Tyr al,- 9er Gly Trp aly Ser rle Glu Pro Glu Glu Ph~

TTG CGC CCC AGG AGT CTT CAG TGT GTa AaC CTC CAT CTC CTG TCC AAT 4~30 Leu Arg Pro Arg Ser Leu Glr. Cy5 Yal Ser Leu His L~u Leu Ser A6ir.
~ 45 150 155 GAC ATG TGT GCT AGA GCT TAC TCT GAG A~3 GTG ACA GAa TTC ATG TTG 528 Asp Met Cyc Ali~ Arg Al~ Tyr S61r Glu Lyc V~L Thr Glu Ph~ Met Leu TGT GCT GGG CTC TGG ACA GaT GGT A~A GAC ACT TGT GGG aGT GAT TCT 576 Cy~ ALa Gly Leu Trp Thr Gly Gly ryG Acp Thr Cys Gly Gly Asp 8er 175 1~30 185 190 GGa GGT CCA CTT GTC TGT AAT GGT GX CTT C~A GGT ATC ACA TCa TCG 6~4 Gly Gly Pro Leu Val Cy~ AG~ Gly V~1 Leu Glr. Gly Ile Thr Ser Trp 195 200 20s GGC CCT GAG CCA TaT GCC CTG CCT GAA AAG CCT GCT GTG TAC ACC AAG 672 Gly Pro Glu Pro CYG Ali~ Leu Pro Glu Lya Pro Al~ Vi~1 Tyr Thr Lys GTG GTG CAT TAC CaG A~G TGG ATC AAG GAC ACC ATC Gi-A acc AAC CCC 720 Vi~l Val Nis Tyr Arg Ly~ Trj Ile Lya Aap Thr I'~ AL~ Ala Al~n Pro '6t''D ~rGrr~r TGTCCCACCC CTA~CTCTAG T~ 76a (2~ I~FOPMATIC)N POK SEQ ID ~o ( i ~ SEQUE~C~
IA~ LrNGT~: 233 il~ino acid (S~ TYPFi: i~milLo i~cid (D) TQPOLOaY: li:lei r (ii~ MOLFiCULFi TYP3: p-otein (xi) SSQUF~C~ L~tiS~Klr~ M 8FiQ ID ~J0:8 Me~ rle Val Gly Gly Trp Glu Cyr Glu Ly3 Hi~ ser &ln Pro Trp Glr.

V~1 Al~ VaL Tyr So- NiL Gly Trp AL~ Ni~ Cy8 Gly Gly Viill Leu Va}
3a ~C~ E~ E:\CllE~ 3- ~3-'~ ' ;3;3c3 ;3(J~ +LU ~ ,3~3c3~
.
2 l 89774 ~7 Nis Pro Gln Trp Val Leu Thr Ala Al 3 Hi~ Cy~ Leu Lys Lys Asr.3 Ser Gln Va} Trp Leu Gly Arg Hi~ A6rL ~u Ehe Glu Pro Glu Aap T~Lr Gl Glrl Arg Val Pro Yal Se~ Ni6 Ser P~e Pro Hi~ Pro Leu Tyr Asr3 Met er Leu L¢u Lys His Gln Ser Leu Arg Pro 3~p Glu A5p Ser Ser El~

sp Leu Met Leu Leu 3~rg Leu Ser Glu Pro A1/L Lys Ile Thr A~3p Val Val Ly6 Val L~u Gly L-u Pro Thr GlrL Glu Pro Ala Leu Gly Thr mr Cys Tyr Ala Ser Gly Trp Gly Ser Ile Glu Pro Glu Glu Phe L~u Arg 130 135 14a Pro Arg Ser Leu G13 Cys V~L1 Ser Leu Hi3 Leu Leu Ser AsrL Asp Met YEI Ala 3~rg A1rL Tyr 9er Glu Ly~ V~l Thr alu Phe Met Leu Cy3 Ala ly I,eu Trp Thr Gly Gly Ly~ Asp Thr Cy i Gly Gly Arp 92r Gly Gly Pro Leu V;~l Cy~l A~n Gly Yal Leu Gln Gly rle Thr Ser Trp Gly Pro Glu Pro Cyl~ Ala Leu Pro Glu Lys Pro Al~ Val Tyr Thr Ly3 Val Val Hir3 Tyr Arg Ly~ TrQ Ile LY- Asp Thr Ile Ala Ala AL;rL Pro ( 2 ) IXFOP~IOX FOR SEQ ID NO: 9:
~i~ SEIQUEXCE ~o~ ~ rYr.:~L~L~:
(A) ~ENG$E~: 766 ba3e p~ir~
(3~ TYPE: nuclelc Lcld "
(C) ST~ Cc: dou3~1e (D~ TOPOL0~iY: li~ear MOLECULE TYPE: cD~A
( ix) FEATt~E:
(A) 3nL~ME/3 Ey CDs (3~ LOCATrON: 1..732 ~xi~ SEQUENCE L/~ rL`L61~: SE0 ID NO:9:

~C~ 56E'A ~1~ S:.~CS515~ ''U- t;-Oti: '' ':0~3 : ~il'' ;l~ssi .3~'til-- +I'J li'- `'.i!i')l lt,ii.~
.
. . 2 1 89774 aTG CCC CTC ATC CAG TCT CGO ATT GTG GGA GGC T~iG GAS TGT GAG AAG 4 8 Val Pro L~u Ile Glrs ser Arg Ile V~l Gly Gly Trp Glu Cy~ Glu Ly3 CAT TCC C~ CCC TGG CAG GTG GCT GTGS TAC AGT CAT GGA TGG GCA CAC 96 His 3er Gln Pro Trp Gln Val Al~ V~l Tyr Ser Hia Gly Trp AlS~ Hi6 TGT GGG OGT GTC CTG GTG CAC CCC CAG TGG STG CTC ACA GCT CCC CA~ 144 CYD Gly Gly Vs~l Leu Val H15s Pro Gln Trp Val Leu Thr Ala Ala His TGC CTA A~G AAG AAT AGC CAG GTC TGG CTG GGT COG CAC AAC CTG TTT 192 Cy~ L~u LYD L~,-3 Aan Scr Gln Val Trs~ ~eu Gly Arg ~L6 A6n Leu Phe 5a 55 60 G1SL Pro Glu Aap Thr Gly Gln Arg V~1 Pro Vs~l Ser His Ser Phe Pro CAC CCG CTC TAC AAT ATG AOC CTT CTG A~G CAT C~A A~iC ~TT AGA CCA 28a Hi3 Pro Leu Tyr A3rl Met ger Leu Leu Ly3 ~sl3 Gln Ser ..eu Arg P~o as 9C 95 GAT GA~ GAC TCC AGC 'C,AT GAC CTC ATG CTG CTC CGC C--G TCA CiAG CCT 33 6 AD~ Glu A3p Ser Ser His AErp Le.u Met Leu Leu Arg L~u Ser Glu Pro 100 10; ' 110 Ala Lya ~le Thr ADp Vss~l Va' Ly~s Val Leu Gly Leu Pr~ Thr Glr. Glu 115 ;20 125 Pro Ala Leu Gly Thr Thr Cys Tyr Ala S~r Gly Trp Gly Ser Ile Glu Pro Glu Glu Phe Leu Arg Pro Arg Ser l,eu Gl~ Cys Val Ser Lcu Hls 145 150 1~5 160 CTC CTG ~CC AAT GAC ~TG TGT G-T AGA GCT TAC TCT GAG A~S GTG ACA 528 I,eu Leu Ser A~n A3p Met ~ya Ala Arg Al~ Tyr S~r Glu Ly~ V~l Thr GAG TTC ATG TTG TGT GCT GGG CTC TSG ACA GGT GOT A~A GAC ACT TGT 576 Glu Phe Met Leu CyD Ala Gly ~u Trp Tkr,.Gly Gly Lya Asp Tkr Cya 1eo 185 190 GGG GGT G~ TCT GGG GGT CCA CTT GTC TGT AAT GGT GTG CTT C~A GGT 624 Gly Gly A~p Ser Gly Gly Pro l.eu VIL1 Cy~ A3n Gly Val l.eu Gln Gly ATC ACA TCA TGG GGC CCS GAG CCA TGS GCC CTG CCT GAA AA~ CCT GCT 67Z
Ile Thr S~r Trp Gly Pro Glu Pro Cy~ Ala ~eu Pro Glu Ly~ Pro Al:-GTO TAC ACC AAG GTG GTG CAT TAC CGG AAG TGG ASC A~G GAC ACC ATC 720Val Tyr Tkr Lys VIL1 V~l His Tyr hrg Lys Trp Ile Lys Asp Thr Ile _ _ _ _ _ _ _ _ ;C~ . ~o~ kf~A ~l L~O:~IL~ ooi : ~'fi- o;~ f: ~ rlU flJ 'iJ`lUl f~

GCA OEC AAC CCC ~r~f~r~fr:~r ~ T~'~'f~rr:' CTACCTClAG TA~A 766 Ala Alfff Af;n Pro (2) IRFO~fATIOhf FOR S~Q ID NO:lO:
~i) SEQL'ENCL r~ frcTIcs (A) LENGTH: 244 f~ no f;cld6 (~3) TYPE: anir~o acid (D) TOPOLOGY: lire~r (ii~ MO~-rCUL3 TYPE: prof eLn (xi) 53QU~3NC3 U~L~l~lOf!f: SEQ ID NO:lO:
Val Pro Leu Ile Glr. Ser Arg Ile Vf~l Gly Gly Trp Glu Cyfff Glu Lys His Ser Gln Pro Tr~ Glr~ Val Alfl V~l Tyr Ser HLg Gly Trp Ala His Cy6 Gly Gly V~l Leu Vf~l f~ifff Pro Gln Trp Vfff l Leu Thr ~lff~ Ala Hi6 35 40 .S
Cyf3 Leu Lys Lys Afff" Ser Gln Val Trp Leu Gly Arg Hi3 A~n Leu Phe ~o SS 60 Glu Pro Glu Afffp Thr Gly Gln Arg V 1 Pro Vfll 6er His Ser Phe Pro Hl~ Pro Leu Tyr Af~n Met s~r Leu Lcu Lys Hifff GLfl 90r Leu ~rg Pro ABP Glu A~p Ser Ser Hi6 AfSp Leu Met Leu Leu arc-f Leu Ser Glu Pro Ala Lys Ile Thr Af~p Vff~l Val Lys Val Leu Gly l.eu Pro ~ Gln Glu llS 120 125 Pro ~la Leu Gly ~hr Thr Cy~ Tyr ~lfl Ser Gly Trp Gly Ser Ile Glu 130 135 l~O
Pro Glu Glu Phe Leu Arg Pro Arg sQr Leu Glr, Cys Val Sor Leu Hls 145 lSO lSS 160 Leu Leu Ser Asr. A6p Mef Cy6 Ala Arq Ala Tyr Ser Glu Lys Val Thr Glu Phe ~et Leu Cy~f Ala Gly Leu Trp ~hr Gly Gly Lyo Aup Thr Cys lbO lBS 190 Gly Gly Asp Scr Gly Gly Pro Leu Yal Cyff Afffn Gly val Leu Gln Gly l9S 200 205 Ile ~r sf~r Trp Gly Pro Glu Pro Cy8 Alf~ Leu P o Glu Lylff Pro Ala KC~ L~A I~L:\C~lk\ ~)b ~ ti-L)t~ : til ~ U :~ U ';J:JU~41.~
~' 21 g9774 Val Tyr Thr LYc Val Val }}is TYr Arg hys Trp Ile hy~ ~ap Thr I12 Ala Ala AGrL Pro t2) INFORMATIOU FOR SBO rD NO:ll:
~i~ SEaV~CB r~rTl:~qT~cs:
(A1 LBNGT~: 2a base ~air8 a) TYPE: nucleic acid ~C) S~ : ~ingle tD) TOFOLOGY: li~ear ~ii) MOhECULE TYPE: ~DN~
~xi) S~a~lENCB Ll~LdL~r~ : SEa ID NO:ll:
T~T~r~T~To. TGOGACCT~3G TTCTCTCC 23 ~2) INFORMATION ~OR SEQ ID NO:12:
(i) SBQUENCE t~DDrT~T~TIC3:
~A) hB~3TE~: 31 ~a~e p,Dir~
~B) TYPB: nucleLc ~cid (C) ST-~ ~: single ~D) TOPOLOGY: li~ear ~ii) MOhECULE TYP8: cDNA
(xi) S~QUENCE J~ Rlrllur~: SEG ID NO:12:
ATATG~ATCC ~CAGG~iGTTG ~ . r 31 (2) IN~0.MA~ION FOR SEQ ID ~0:13:
~i) SEQUENCB r~DOD~
tA) L~NGT~ mi~c ~cicc o ) TYPE: ~ino ~cid ) qTr~ ~Np c.q ~ gle ~D) TO~O~OGY: li~e~r (i~l MOI,BCUBB IYPB: peptidc ~xi) SEQ~ENCE ~ rl~.ur~: ~3EQ ID NO:13:
Mot Trp A~p ~eu ~al ~eu ser Il- ~la Leu (2) Ir~r. _--rnN FOR S~Q ID NO:14:
(i) SEQUENOE t~ o~rT~orcTIcs ~C~. io~ L~ IE.~ v~ s~ +~J ~J ~sJs)~
21 ~774 (A) LEXGTH: 10 amino acid3 (B) TYPE:: an:lno ~cid (C~ S~P~m~ ~C~c 31nglc ~D) TOPOLOGY: linear ( i 1 ) MOL~3Ct t F TYPE: p~pti de (xi~ SFt~uEr~C~ Vhb~'rLUY: gEQ ID N~:14:
Met Trp Phe Leu V~l Leu Cy3 Leu Al~ Leu l tJ
(2) I~FORMATIO~ FO~ SEQ ID ~O:15:
(i) SEQt~CE f~:b~ rqTIcs:
(A) LEl-sGTH: 10 amis~.o ~cld3 (B) TYPFi: amino Jcid (C) S~ slt.~gle (D) TOPOLOGY: line~r (11) MOLECr3LE TYP~: peptide (x~) SEQUENCE DESCRIPTION: SEQ ID sgO:15:
Met Tr~ Val Prr Val ~ 1 P~e IAau Thr L~u (2~ I~gFORMArION FOR 5~2 ID NO:l~:
(i) SEQUENCE r~t~b~ I ib:
(A) LENG~E: Z37 cmino acld3, (B~ TYPb: aml~ cld ~C) S~n~n~Cs ~ingle (D~ TOPOLOGY: line~r (li~ MOLEsCt3LE TYPsi: pe~tide (xl) SEQr3ENCE'i 1~5b~1t"1UCI: SEQ ID NO:16:
Ile Val aly Gly Trp ~31u Cy3 Glu Ly!s N13 S~ Gl:~ Pro Tro Gln ~7al Ala Val Tyr Ser Hi~ Gly Trp Al~ Kis cy8 Gly Gly val Leu Val Hls Pro Gl~ Trp V~l Leu Thr Al~ Ala Ni3 Cy~ L~u Ly~i Lyii Asrl Ser G1::.
35 40 sS
Va,l Trp ~eu Gly ~rg Hi~ Leu Phe Glu Pro 51u Asp Thr Gly Glr.

Arg lral ~ro V~l Ser ~lc ber ~h~ Pro J3~ Pro Leu Tyr Asn Met 8~r ~s 7tJ 7s atJ
Leu l.e~ Ly~ ~iti Glr. Ser Leu Arg Pro A~p Glu A~p Ser ser !3iH ~a~p as 90 gs ~~

~C~. ~0:\:5}'.~ .\CIIE~ ''S~ J~ ': 15: ijl ) :i;J'3 ~oi;~- +IU ~ 3'J'JI I.~i.i:,y.~ ~
. ~ 21t~9774 Leu Met Leu I.eu Arg Lou S~r Glu Pro ~1~ Lys ~le Thr A~!p ~1 Val 100 , lCS 110 Lye V~l Leu aly Leu Pro T~r G1D 51U Pro Ala. Leu Gly Thr mr CyY
llC 120 125 Tyr ~la Ser Gly Tro Gly S~r Ile Glu Pro Glu Glu Phe Leu Arg Pro Arg 8~r Leu Gl~ Cy~ V31 S~r Leu Hie Leu Lc~u 5er Acn A~
1~5 150 155 p t,~et Cys Ala Arg Ala Tyr S~r Qlu Ly~ Yal mr Glu Phe l~let Leu Cys Ala aly Leu Trp Thr Gly Gly Ly6 Agp Thr Cys Gly Gly A6p Ser Gl~r Gly Pro ~SO 185 190 Leu VaL CYG Asn Gly Val Leu G1D Gly rle Thr Ser T--p Gly Pro Glu 195 ~00 205 Pro Cys Ala Leu Pro Gl~ Ly~ Pro Al~ Yal Tyr Thr Lys V31 Val Elr ~yr Arg Lyo Trp Ile Ly~ Asp rhr Ile Ala A13 Asr. Pro ~2~ lN~ut~ ùN FO~ SEO ID ~0:17:
~i) 55Q~JCg ~7~ RT;~RTqTIcg:
~A) LEI~GT}I: ~.2 baae ~Lir~
~a) rYp- nucleLc ~cld ~C~ s~rs~ ~ : 6iDgle ~D) TOPQLOGY: liDear ~ii) MOLECOTE ~P'i:: cDNA
~xi) S~Q~CZ 055CIII~TION: SEQ ID ~0:1?:
aT~Tr,~ rr(~ T.. ~ ' ATaTGGG~CC l~Ll~-l~.L~ CA 42 t2) INFO.5M~TION FO~ SBQ ID NO :13:
ti, g~Q~BNCg r~ ~R5TCTICS:
(A) I,ENGTH: 13 ~miDo ccid~
~B~ TYP5: 3miDo ~cid ~C~ STli~ ~IRD ';q: ai:lgle ~D) TOPOLQGY: linear ~ii] MOL35C5,LB TYPE: p-ptide ~xi.) SBQ~NCB oc;.~lar~u~l: 5_Q I~ ~0:18:
V~ ro r,ou I1c Gln Bcr Arg rle v~ Ly Gly ~rp Glu .. . ..

S l~A ~L:~CIIL ~ s,~ ;I'ISJ ;l~ SJ ~SJ '':3515/ S ~ : G ~
2~ ~774 ~2) I~FOR~sATION FOR SELQ ~D ~0 19 i I S~QL~NCE CH~ rq~IC9 1 ~A) L~'SGTY: 261 amLno acids (B) TYP~: amlno acid ~D) TOPOLOG~: lirear (ii~ MOLBC~JLE TYPE: proteir.
txi~ 9}SQI}E~JCE u8~ el: 31~Q ID I~O:lg:
Me~ TrF l~sp Leu Val Leu Ser Ile Ala Leu Ser Val ~ Thr G
5 1 G y Cy Ly Ala Val Pro Lcu Ile Gln Ser Arg ~1~ Val Gly aly Trp ~lu Cy8 G}u Lya Hi3 Ser Gln Pro TrF Gl~ Val ALa Val Tyr 'ier ~}i3 Gly Trp Ala 35 40 J.5 Hi~ Cys Gly Gly Val Leu Val ~li3 Pro Gln Trp V~l Leu T~.r ALa ~La }~is Cy~ Leu Ly~ Lrss A~n Ser Gln V~l Trp Leu 51y Arg ~isi ~6n L~u Phe Glu Pro GLu Aap T~r G~y Glr. Arg V~l Prcl V31 Ser E~ls Srr Phe Pro ~i6 Pro Leu Tyr Psin Met Ser Lcu Leu Ly8 E~is~ Glr. Ser Leu Arg 100 105 . 110 Prc AGP Glu A3p Ser Ser His AsF ~eu ~!et Leu Leu Arg Leu Ser Glu 115 12G la5 .f Pro Al~ Lys Il~ Thr Asp Val V~l Lys V~l Leu Gly Leu Pro Thr Gln Glu Pr~ Ala Leu Gly Thr Th~ Cyss Tyr Ala Ser Gly Trp Gly S~r Ile Glu Pro Glu t:lu ~he Leu Arg Pro ~rg Ser Leu Gln Cy~ V~l Ser Leu ~isss Leu Leu 9er A~ Asp Met Cy8 Al~ Arg,P.l~ Tyr Ser Glu Lys Val lG leS 190 'rhr Glu Phc Met L~u CyD IU5 Gly Leu Trp T~r Gly Gly Ly~ Asp T~.r 195 aoo zOS
Cy~ Gly Gly Asp Ser Gly Gly Pro Leu V~l Cys P,sn Gly Val Leu Gln Gly Il~ Thr Ser T-p Gly Pro Glu Pro Cyc Ala Lcu Pro Glu Lys Pro 225 ~30 235 240 Val Val Tyr Thr Lys Vai V~' ~19 Tyr Arg LyG TrF Ile Lys A5p Thr _ _ ~C~ SI'A ~l~'E~'~C.7lE.\ ~1t'i : 'U- t , ~ . ti ~ ;i( )t .1-- + M3 ~ 3 F7s ~ ~ fi~: /7 7 ~

~l~ A1A Al~ Asn Pro 26~
~2) _NFOP3~,7ATION FO.~ SBQ ID 7.~7O:20:
(i.~ 8E~C5 r~R~t~T~rcTIC9:
~A) L3 .7GTk: B32 bae,e p~lr6 (B) TYP3: ruclcic ~cid (C) g~r7~r~7~77~77~qq: dc7uole (D) TOP0LCGY: linear (ii~ MOLiiCU'.7r TYPS: cDt.7A
c~ FEATBRE:
(A) NP~q5~XEY: C~S
(~3) L0CATIOY: 10.. 792 ~xi) 55Q77E.~tCE L~c;~ LU~: SEQ ID f:GO:20:
GGATCCAGC ATG TGG f~iAC CTG G~T CTC TCC ATC GCC TTG TCT GTG GGG 48 .~et Tr~7 A7p Leu Y~l Leu Ser rl~ Ala Leu Ser Val Gly TGC AC~ GGT GCC aTG CCC CTC ATC CAG rC- CGG ATT GTG GGA GGC TGG 96 Cy3 Thr Gly Al~ Val Pr~7 Leu Il~ Gln Ser Arg rle Val Gly aly Tr;7 ~S 20 25 G1~ TGT GAG A~G CAT TCC CA~ CCC TGG CAG GTG GCT GTG TAC AGT CAT 1~4 Glu t~y~7 Glu 7 ys ~ia Ser Gl7~ Pr~ Trp Gln V~ Ala vfil Tyr 8er .:i~
3t7 3s g~ 45 GGA TGG GCA C~C TGT GGG GGT GTC CTG GTG CAC CCC C~i TGG GTG CTC 192 Gly Tr~7 Ala ~.iti~ Cya qly Gly V~L1 Leu V~l 7iit~7 Pro Gln Trp V~l l,eu A~ GCT GCC CAT TGC CTA AAG A.7~G AAT AGC CAG GTC TGG CX GGT CGG 240 Thr Ala Ala Hl~ Cy~7 ..~u Ly6 . y3 A5n Ser Glr val Trp Leu Gly Arg 65 70 ~.7s CAC AAC CTG TTT C7AG CCT GAA GAC AQ GGC C~G AGG Gq'C CCS GTC AGC 288 Hi3 A~n Leu Phe Glu Prc Glu Asp 7.~r Gly Gln Arg V~l Prc7 Val 9er 80 8s go CAC AGC STC CC~ CAC CCG CTC SAC AAT ATG AGC CTT CTG A.7~G C~T C~A 336 ~i3 3er Ph~ Pro Nls Pro Leu Tyr Afin Met Ser _,eu L~u ~ya His Gln 9S l0C l05 AGC CTT AGA CCA GAS GAA GaC TCC AGC CAT GAC CsC ATG CTG CTC CGC 334 5er I,eu Arg Pro Aap Glu A3p 9er Ser Hi~ Asp e7 Met ,eu Leu Arg llû 115 120 125 CTG SCA GAG CCT GCC A~G ATC ACA GAS G~T GTG AAG GTC CTG GGC CTG ~32 Leu 8er Glu ~7~c7 Ala Ly~ Ile Thr A3p Val V~1 L.y8 V~l 7eu Gly l.eu 130 l~S 14 _ _ .. _ _ . _ ... . _ _

Claims (20)

WHAT IS CLAIMED IS:

1. Isolated, substantially homogeneous pre-pro hK2 polypeptide.

2. Isolated, substantially homogenous pro hK2 polypeptide.

3. Isolated, substantially homogenous mature hK2 polypeptide.

4. An antibody that is capable of specifically binding the hK2 polypeptide of claims 1, 2, 3 or 18 and which does not bind to hK3 .

5. The antibody of claim 4 which is a monoclonal antibody.

6. A hybridoma cell line producing the antibody of claim 5.

7. A chimeric expression vector comprising a nuclcic acid molecule encoding an hK2 polypeptide which is pre-pro hK2 polypeptide (SEQ ID
NO:6), pro hk2 polypeptide (SEQ ID NO:10), mature hK2 polypeptide (SEQ ID NO:16), a variant prepro, pro or mature hK2 polypeptide comprising SEQ ID NO:19, or a variant hK2 polypeptide having at least 90% homology with SEQ ID NO:16 in regions that are substantially homologous with hK3 polypeptide (SEQ ID NO:1). wherein the variant hK2 having at least 90% homology with SEQ ID NO:16 is not SEQ ID
NO:19, and wherein the nucleic acid molecule is operably linked to control sequences recognized by a host cell Transformed with the vector, so as to result in expression of said hK2 polypeptide.

8. The vector of claim 7 wherein the host cell is E.coli.

9. The vector of claim 7 wherein the host cell is a mammalian cell.

10. A host cell transformed with the vector of claim 7.

11 . The host cell of claim 10 which E.coli

12. The host cell of claim 10 which is mammalian.

13. A method of using a nucleic acid molecule encoding an hK2 polypeptide which is pre-pro hK2 polypeptide (SEQ ID NO:6),pro hK2 polypeptide (SEQ ID NO:10), mature hK2 polypeptide (SEQ ID NO:16),a variant prepro, pro or mature hK2 polypeptide comprising SEQ ID NO:19, or a variant hK2 polypeptide having at least 90% homology with SEQ ID
NO:16 in regions that are substantially homologous with hK3 polypeptide (SEQ ID NO:1), wherein the variant hK2 having at least 90% homology with SEQ ID NO:16 is not SEQ ID NO:l9, said method comprising expressing the nucleic acid molecule in a cultured host cell stably transformed with a chimeric vector comprising said nucleic acid molecule operably linked to control sequences recognized by the host cell transformed with the vector, and recovering the hK2 polypeptide from the host cell.

14. The method of claim 13 wherein the host cell is E.coli.

15. The method of claim 13 wherein the host cell is mammalian.

16. The method of claim 13 wherein the nucleic acid molecule is DNA.

17. The method of claim 13 wherein the hK2 polypeptide is recovered from the host cell culture medium.

18. An isolated, substantially homogenous preprohK2, prohK2 or hK2 polypeptide comprising SEQ ID NO:19.

19. An isolated nucleic acid molecule comprising SEQ ID NO:20.

20. A chimeric expression vector which comprises a nucleic acid molecule comprising SEQ ID NO:20 operably linked to control sequences recognized by a host cell transformed with the vector.