CA2195217A1 - Methods of identifying patients having an altered immune status - Google Patents

Abstract

Methods of identifying a patient having an altered immune status involve determining an immune status index for the patient and comparing it to the immune status index in healthy individuals. In general, an immune status index is the ratio of the amount of a protein that varies significantly in a patient with an altered immune status to the amount of another protein that is substantially invariant in both healthy and immune-altered individuals. Variable proteins can be TCR subunit proteins, T lymphocyte signal transduction pathway proteins, polynucleotide binding proteins or biological response modifiers (BRM). In addition, the ratio of a TH-1-type BRM to a TH-2-type BRM, the ratio of cytoplasmic to nuclear levels of polynucleotide binding proteins, the pattern of protein binding to an oligonucleotide probe that comprises the protein binding region of a gene for a BRM, or the pattern of distribution of T lymphocytes in a density gradient following density gradient centrifugation are also suitable as an immune status index. The methods are useful in identifying patients exhibiting immunosuppression, hyperimmunity and autoimmunity, as well as in assessing the immune status of a patient undergoing organ transplant.

Description

2 1 9 5 2 1 7 r~~

METHODS OF 1~L~L1~Y1~- PATIENTS
HAVING AN ALTERED IMM~NE STATUS
BAC~UUN~ OF T~E INV~L1~N
The present invention relates to methods of identifying a patient who has an altered immune status compared to a normal status. The methods involve det~rm;n;ng an immune status index for the patient and comparing the value of the index to the immune status index in healthy individuals. A significant variation between the patient~s immune status index and the immune status index for healthy individuals indicates that the patient~s immune status is altered. The present invention is used to identify patients with immunosuppression, hypersensitivity or autoimmunity as well as to monitor the immune response in general to facilitate medical t,~i t. The immune status index is used to stage or evaluate the progress of cancer therapy including chemotherapy, immunotherapy or surgery. The immune status index is used to evaluate a Fatient undergoing organ transplant and to evaluate the effect of ongoing therapy for autoimmune diseases or allergies.
The immune system is comprised of a complex array of precisely regulated cell types and the soluble molecules which these cells secrete. The im~une response in a healthy individual involves recognition of a pathogen, other foreign material, or tumor cell followed by the elimination of the pathogen or other foreign material from the organism. Broadly speaking, the immune response can be divided i~to two categories, the innate responses and the adoptive responses. As a result of interactions among the components of the immune system, however, most immune responses comprise a variety of innate and adoptive me~h~ni~c The innate responses are generally mediated by an important group of leukocytes known as phagocytic cells which include monocytes, macrophages and polymorphonuclear neutrophils. In general, these cell types act as a first line of defense against infection W096/03523 2 1 9 5 2 1 7 r ~ ~

because they utilize non-specific recognition systems to bind microorganisms, ;nt~rn~l;ze them and destroy them.
Central to the adoptive responses of the immune system are the lymphocytes. Bymphocytes specifically recognize individual pathogens whether they are inside host cells or outside cells in blood or in tissue fluids.
Bymphocytes are generally divided into two groups, T
lymphocytes (also called T cells) and 3 lymphocytes (also called 3 cells). The s cells release specific ~n~iho~;es that combat extracellular pathogens and their products by binding to specific target molecules. T cells, on the other hand, have a wider array of responsibilities.
Certain T cells interact with phagocytic cells to~help the phagocytes destroy pathogens they have taken up.
Other T cells recognize aberrant cells or ceIls infected by virus and destroy them. Still other T cells control B cell development and antibody production.
A ~f;n;~;ve T cell marker is the T cell antigen receptor designated TCR~ Among T cells in the blood, generally more than 95~ of them are classified as TCR-2 and the L. ; n~r are TCR-1. TCR-1 and TCR-2 are distinguished on the basis of Ti subunits. The Ti subunits of the TCR-2 are two disulfide-linked polypeptides known as ~ and ~. TCR-l is structurally similar to TCR-2, but the TCR-l Ti subunits are the ~ and ~ polypeptides. Both TCR-l and TCR-2 are associated with a complex of polypeptides which comprise the CD3 complex.
The TCR found on the surface of all T cells is composed of at least six di~fere~t subunits which can be divided into three distinct subgroups of proteins.
Rl ~nrnPr (1990) . The heterodimers ~ or ~ within the receptor complex are responsible for.:ligand binding.
Another subgroup of proteins which comprise the TCR are the CD3 chains which rnrr~p~rs at least four distinct, but closely related subunits. These subunits are ~
~ and ~. Koning (l990); Blumberg (l990).
Diversification of receptor types is the result of segregation o~ chains of the TCR complex into multiple W096/03523 2 1 9 5 2 1 7 1~11~ 1 ~ - 3 -subunits. Incompletely assembled complexes are degraded, resulting in the surface expression of only completely assembled receptors. Rl~nqnPr ~1989).
T cells that are TCR-2 are subdivided into a subset of cells which carry the CD4 marker and another which carries the CD8 marker. The CD4+ subset (TH) mainly induces immune responses while the CD8+ subset (Tc) is largely composed of cytotoxic/suppressor cells. The CD4+
subset is subdivided into those cells which positively influence the response of T cells and B cells. Another CD4+ subset of cells induces the suppressor/cytotoxic functions of CD8+ cells.
The CD4+ subset is further subdivided into TH-1 and TH-2 type cells. Tx-1 and TH-2 type cells are distinguished on the basis of the spectrum of l~ _hnkinPq they secrete. TH-1 cells have been found to secrete interleukin-2 ~IL-2) and IFN-~, while TH-2 cells have been found to secrete IL-4, IL-5, IL-6 and IL-10. TH-1 and TH-2 cell types are thought to be derived from a common precursor population termed a TH-0 cell. In contrast to the mutually exclusive cytokine production of all or most of TH-l and TH-2 cells, TH-0 cells produce all or most of these lymphnkinP~. Treatment of TH-0 cells with IL-12 results in the production of TH-l-type cells. IL-12 is produced by macrophages and 8 cells.
TH cells appear to control and modulate the development of immune responses. TH cells play a major role in determining which epitopes become targets of the immune response and selection of effector mp~h~n;~mq, The antigen-presenting cells (APCs) present processed antigen to TH cells which recn~ni 7P certain epitopes and thus select those which act as targets for the relevant effector functions. The TH cells then select and activate the appropriate effector cells including B cells that produce antibody and modulate the actions of other effector cells, Tc cells, natural killer (NR) cells, macrophages, granulocytes and antibody dependent cytotoxic (R) cells.

2 ~ ~52 ~ 7 w096l03523 ]~

The release of different cytokines by TH cells may play a role in selection of effector m~rhAn; ~m~ and cytotoxic cells. TH-1 cells secrete IL-2 and IFN-~ which tend to activate macrophages and cytotoxic cells. In contrast, TH-2 cells secrete IL-4, IL-5, IL-6 and IL-10 and tend to increase production of eosinophils and mast cells as well as enhance production o~ an~ibody including IgE and decrease the function of cytotoxic cells. Once established, the TH-1 or TH-2 patter~ is mAintAln~rl through production of a cytokine that inh;h;tc production oi the other subset. The IFN-~ produced by TH-1 cells inhibits production of TH-2 type cytokines such as IL-4, IL-10 . while the IL-10 produced by TH-2 inhibits pro~n~tinn of TH-1 type cytokines such as IL-2 and yIFN.
In addition to determining which epitopes are to be the targets of the immune system, the immune system must also select the a~L~iate effector m~rhAn;rmc for each infection Effector m~hnn; r~ which can be selected include 1) cytotoxic T cell, 2) antibody plus mast cells and eosinophils or 3) macrophage activation and delayed hypersensitivity. Activation of ina~ Liate effector r ~hAn; rmc can lead to enhanced susceptibility rather than protection.
The molecular mechanism by which T cell clones become restricted to express only certain lymrhnk;n~ genes has " ;n~ obscure, although it has been reported that cAMP, or a labile regulatory protein, can inhibit expression of IL-2 in T~-2 cells. Novak (1990), Munoz (1989~. ~uman B cell lines are capable of producing endogenous ~IFN and this gene expression correlates, at least in part, with the methylation status of a SnaB 1 restriction enzyme site (TACGTA) present between the CALaT and TATA box in the human ~IFN promoter.:Pang (1992). The SnaB 1 enzyme iR methylation rensitive as it does not cleave DNA if the C is methylated at the 5 position, but does cleave DNA if the C is not methylated.
Yang (1990). In a human s=cell l;nP thAt expresses ~IFN
spnntAn~nllRly, and in a murine T-cell line stably W096/03523 2 ~ 952 ~ 7 r~

trarsfected with the human ~IFN genomic DNA, this site was totally hypomethylated and completely cleaved by 5naB
1. Pang (1992).
Tc cells, also known as killer T cells, are effector cells which play an important role:in immune reactions against intracellular parasites and viruses by lysing infected target cells. Cytotoxic T cells have also been implicated in protecting the body from developing cancers through an immune surveillance ~~h~n; r~ . Under certain conditions, CD8+ T cells have also been shown to function as cells able to suppress the immunologic activity. This is mediated by the prr~ tirln of the raw factors produced by the T~-2 cells; i.e. IL4, IL10. T suppressor cells block thc induction and/or activity of T helper cells.
T cells do not-generally recognize free antigen, but recognize it on the surface of other cells. These other cells may be specialized antigen-presenting cells capable of stimulating T cell division or may be virally-infected cells within the body that become targets for cytotoxic T cells.
Tc/Ts cells usually recognize antigen in association with class I Major Histot-t ~t;hility Complex (MHC) products which are expressed on all nucleated cells.
Helper T cells, and most T cells which proliferate in response to an~igen in vitro, recognize antigen in association with class II MHC products. Class II
products are expressed mostly on antigen-presenting cells and on some lymphocytes.
In summary, the process of activation of the humoral (antibody and complement) or the cellular arm of the immune response and the regulation of such response appear to be controlled by the production of cytokines by T-cells and monocytes. Thus, it is likely that alterations in this regulation could result in the abnormal function of the immune response. This abnormal function could either be a decreased immune response resulting in immunosuppression, or alternatively in an abnormally increased response against one's own normal tissues in what is known as autoimmunity.
Determining the status of the immune response has mainly been.done by clinical means. An "opportunistic infection," that is, the presence of~an~infection by a microorganism that normally is not pathogenic, suggests an immunosuppressed state. ~lternatlvely, the presence of rheumatoid arthritis suggests an autoimmune process.
Once the clinical findings occur, specific laboratory tests can confirm these findings. These laboratory tests mainly confirm that an altered immune system exists, for example, the ~nt;nnrlear antibody test demonstrates the presence of al~to~nt1hodies in the serum of lupus patients, or the isolation of an ~ ILullistiC
microorganism confirms ~the presence of an - immunosuppressive process. However, there are no adequate tests to monitor the function of::the immune system. Present immune tests on immune function include:
(1) Cell number: White blood cell count, CD4~/CD8 ratio.
(2) Cell response: Proliferation index to tetanus toxoid (3) Antibody levels in serum.

(4) L~l h~k;n~ production: Tests absolute levels of 1~ ~ h~k; nPc in serum.
None of these tests take into account the fact that the immune response is a balance between TH-1 and TH-2 responses. Considering the complex number of different specialized cell types that comprise the immune system, as well as the subtle control networks that exist among these cell types, it is not surprising that even small perturbations in this system can lead to serious illness in the patient. Many diseases are characterized by the development o~:an impaired or altered immune response.
Progressive immunosuppression has been observed in patients with acquired immunodeficiency syndrome (AIDS), sepsis, leprosy, cyt~ g~l~virus in~ections, malaria, cancer and the like. The ~h~n1 F - q responsible for the W096/03523 2 1 9 5 2 1 7 r~~

down-regulation of the immune response, however, remain to be elnr;~i=t~.
Deficits in T cell function have been prorQs~d to play an important role in the immune impairment seen in cancer patients and tumor-bearing mice. Mizoguchi (1992) describe alterations in the signal transduction molecules in T cells from MCA-38 tumor-bearing mice that indicate these changes represent the molecular basis for functional impairments observed in splenic T cells isolated from these animals.
An ;mh~ nre in the immune system is evident in autoimmunity which is characterized by the production of autoantibodies and autoreactive T cells. The auto-immune disease may be organ-specific in the case of thyrotoxicosis or pernicious anaemia, or non-organ-specific in the case of scleroderma, systemic lupus erythematosus or rheumatoid arthritis. Other diseases which result from the establiql t of an autoimmune response include lupus and autn; ~ thyroiditis.
On the other hand, hypersensitivity occurs when an immune response occurs in an exaggerated or i~ u~Lu~Liate form causing tissue damage. Hypersensitivity reactions are no more than a beneficial immune response acting inappropriately, thereby leading to ;nfl i tion and tissue damage. Certain types of hypersensitivity reactions are antibody-m~ te~ while others are mediated primarily by T cells and macrophages.
In Type I hypersensitivity an IgE response is directed against innocuous envirnnm~n~i~l antigens such as pollen or animal dander. The acute inflammatory reaction with symptoms such as asthma or rhinitis is caused by the release of pharmacological mediators by IgE-sensitized mast cells Antibody-dependent cytotoxic hypersensitivity or Type II hypersensitivity occurs when antibody binds to either self antigen or foreign antigen on cells. Type III hypersensitivity occurs when immune complexes are formed in large quantities or cannot be cleared adequately by the reticulo-endothelial system.

21 9521 7 .
WO 96/03523 ~ r Type IV hypersensitivity is most seriously manifested when antigens are trapped in~a macrophage and cannot be cleared. T cells are then stimulated to elaborate 1~l h~k;nPP which mediate a range of infl: tory responses.
T cell recognition events apparently lead to signal transduction and appropriate biochemical signals that control cellular responses.: The ability of TCR to transduce signals to multiple biochemical cascades is a central event of immune cell activation. The details of this signal transduction pathway, however, are poorly understood. One or more tyrosine (Tyr) kinases likely have an essential role in T ~ell activation. Rl ~n~nP~
~1991). At least two signal transduction pathways are activated upon stimulation of TCR by an antigen or by monoclonal antibodies directe-d against either CD3 or the heterodimer.
Stimulation of TCR activates a tyrosine kinase.
Samelson (1986); Patel (1987); Hsi (1989).
Phosphorylation of severaL proteins with tyrosine residues is induced within seconds of TCR s~imnl~t;on.
June (1990). None of the TCR chains possesses intrinsic kinase activity. A member of the Src family of tyrosine kinases designated Fyn, however, coprecipitates with the CD3 complex. ~ ~lqon (1990). A T celL specific member of the Src family of tyrosine kinases, Lck, is tightly, but non-covalently, associated with the cytoplasmic domain of . either a CD4 -or CD8 molecule. The extracellular domains of CD4 and CD8 bind to MHC class II
and class I molecules, respectively. Upon binding of~TCR
to an antigen-MHC complex on a presenting cell, the TCR
is believed to be brought into close proximity with either a CD4 or CD8 mclecule that is capable of ;n~PpPn~Pntly binding to an appropriate MHC molecule.
TCR also activates a phosphatidylinositol-specific phospholipase C which leads to hydrolysis of phosphatidylinositol-4,5-bis-phosphate. Weiss (1984);
Imboden (1985). This leads to she liberation of two W096/03~23 2 1 952 ~ 7 ~ 4 ~ _ g second messengers: 1) inositol-1,4,5-tris-ph~sph~te which is responsible for transient Cal~ mobilization; and 2) diacylglycerol which is a potent activator of protein kinase. Berridge (1989).
Another set of proteins that is related to signal transduction is the NF-KB/rel transcription factors, also known as the Rel-related protein family. Members of the Rel-related protein family all have similar primary amino acid sequences and bind to an array of homologous 0 de~nn~l~otide sequences with varying affinities. The NF-KB transcription activator is a multiprotein complex.
The NF-KB transcription activator appears to be specialized in the organism to rapidly induce the synthesis of defense and sign~ll;ng proteins upon exposure of cells to a wide variety of agents including cytokines, double-stranded RNA, T cell mitogens, DNA
damaging agents, protein synthesis inhibitors, parasites, viruses and viral transactivators. A common ~n~;n~tor of the agents that activate NF-Ks is that they either signal or represent a threat to cells and the organisms.
NF-KB is particularly suited to rapidly activate gene expression because (1) it does not require new protein synthesis, (ii) a simple dissociation reaction triggers activation, (iii) NF-KB actively participates in cytoplasmic-nuclear sign~ll;ng and (iv) it is a potent transactivator.
NF-KB is involved in the in~ ihle expression of the T cell growth factor IL-2, as well as the in~n~;hle expression of a component of IL-2 high affinity receptor, suggesting that NF-KB is a growth regulator. There is indeed a good correlation between the proliferative state of T ceIls and the state of NF-KB activity.
Three protein subunits, I~B, p50 and p65 control the ~ biological functions of NF-Ks. Members of the I~B
protein family display multiple homologous amino acid stretches (ankyrin repeats) that spe~if;~lly interact with NF-KB/Rel proteins. I~s includes a 35-43 kDa subunit which inhibits the DNA-binding of NF-KB and W096/03523 2 1 9 52 1 7 ~"~

serves to retain NF-KB in an ;n~nc;hle form in the cytoplasm of unstimulated cells. ~pon st;~ tion of cells, I~s dissociatee from the inactive complex with p65 and p50. The released p50-p65 complex heteroaimer then migrates into the nucleus and trans-activates genes.
Constitutive expression of the IL-2 receptor ~ gene in hybrids between a T-cell and myeloma cell line depends solely on the presence of the hPt~rn~; . Only p65 appears to bind ItB. Within cells, I~B is released by modification of either ItB, p65 or both.
Rel proteins are capable of re~n~ri7;ng KB motifs.
The I~B-family and Rel-family therefore comprise related proteins which are known to be involved~ in cytoplasmic/nuclear signalling. Other information on the NF-KB transcription activator and its relatinn~h;p to the rel proteins may be found in Baeuerle (l991).
The present invention addresses limitations in the art for detecting and monitoring the immune status of a mammal às well as identifying appropriate treatment modalities The present invention provides improved methods for evaluating the status of a patient's immune system. More specifically, the present invention provides improved methods for identifying, monitoring and evaluating the degree of immunosuppression, hyperimmunity or autoimmunity in a patient.
A need exists for effective methods of measuri~g the progression of ; lnnsnppression so that attempts at . augmenting the immune sygtem in an immunosuppressed patient can be effectively timed. A need also exists for a method by which a patient's level of immunosuppression is estimated and used to ~r~nr~t~l y predict the l;kel;hnod of a patient~s response ~o therapy. A need exists for a method to determine how much to suppress the immune response of a patient with antn; lnity. The patient~s therapy can then be d~veloped in a systematic fashion. A method is needed by which a clinician can determine whether a patient~s ~ lymphocytes will be capable of activation and, thus, whether autologous W09C103523 2 1 952 1 7 ~ ' 4 adoptive immunotherapy will likely be efficacious. A
need also r~nt;nnP,q to exist for~a method of screening for immunosuppressive agents and agents that reverse or inhibit immunosuppression.
There is a need to detect tumors, in particular early in the development of a tumor, so that treatment effectiveness is ~nhAn~ Also, improved methods for staging oi;cancer would facilitate choice of the most appropriate treatment modalities. There is also a need to test the effectiveness of treatment modalities prior to clinical trials, and as adjuncts to clinical trials.
There is a need for methods for detecting and measuring the degree of hyp~rir-lnity or autoimmunity in the patient. In addition, improved methods for staging of the progression of hyperimmunity or autoimmunity would facilitate choice of the most appropriate treatment modalities as well as monitor the effectiveness of treatment modalities.
There is a need for methods of monitoring and evaluating the immune status of the patient receiving bone marrow or tissue transplants. Methods for monitoring and evaluating the immune status of the graft recipient, prior to the procedure, as well as after receipt of foreign tissue, are needed to effectively determine when immunosuppressive druys should be administered.
The present invention addresses limitations in the art for evaluating, monitoring and predicti~g the status of a patient~s immune system thereby providing a means to more effectively diagnose and treat patients with an altered immune status.
SUNMARY OF T~3 lNV~l~LlUN
The present invention relates to methods of identifying and monitoring a patient having an altered ~5 immune status. T~e methods involve determining an immune status index for the patient and comparing it to the immune status index in healthy (control) individuals. A
significant variation between the patient's immune status w096io3s23 J ~11~, C' index and the immune status index for healthy (control) individuals indicates that the patient's immune status is altered A "healthy patient~ is defined herein as one not known to have a disease or ~nn~;t jnn ~.qsociated with an altered immune state. The immune status index is used to identify patien~s with immunosuppression, hyperimmunity, or auto; ;ty. The immune status index is used to stage or evaluate the progress of cancer therapy including chemotherapy, immunotherapy or surgery.
The immune status index is used to evaluate a patient undergoing organ tr~n~pl~nt .
In general, an immune status index is the ratio of the amoun~ of a TCR subunit protein, a T lymphocyte signal transduction pathway protein, a polynucleotide binding protein, or a BRM that varies si~n;ficAntly in a patient with an altered immune status to the amount of another protein that is subsr~nt;~lly invariant in healthy and immune-altered individuals. Alternatively, the ratio of a T~-l-type sRM to a T~-2-type BRM, the ratio o~ cytopl~;c to nuclear ~levels of certain polynucleotide binding proteins, the pattern of protein binding to an oligonucleotide probe that comprises the protein binding region of a gene for a fiRM, methylation status of.nucleotides within the regulatory element of a BRM gene, and the pattern of distribution of T
lymphocytes in a density gradient _ following centri~ng~t;nn of a lymphocyte preparation, is the immune ~ status index. The methods are useful for identification of patients exhibiting i - u~ ssion, hyperimmunity and autoimmunity as well as assessing the immune status of a patients undergoing bone marrow, tissue, or organ transplants. The methods are useful for Identifying compounds capable of alter~ing the immune status of~the patient, that is identification of compounds~capable of ;n~nC;ng or reverging immunosuppression.
A distribution of each ratio in a sample of control patients and of patients known to have a condition predisposing to an altered immune state is developed.

W096/035Z3 2 1 ~52 1 7 ~ - 13 -..
Threshold values to separate a ~'normal" from an "altered"
immune state are determined depending on the sensitivity-specificity desired for a particular assay.
A fnn~ t~l concept of the present invention is that there is a balanced ratio of functions relating to the immune system ~;nt~;n~d in a normal individual, and that the ratio is altered in diseases or malfunctions of the immune system. For example, during tumor growth, a myriad of alterations may occur, ~r~n~;ng on the nature and extent of the tumor, and how long it has been in the host. The most i~formative way of understanding and staging the state of immune responsiveness and the effect of tumor progression on the immune response is evaluating the ratios of different markers, for example, TH-l ly~rhmkin~ /TH-2 lym?h~k;n~; tIL-2/IL-4; yIFN/IL-4; or IL-2/IL-10 and the like), CD3~ chain~CD3c chain, and/or cytoplasmic ~F-KB/nuclear NF-Ks. One ratio or a combination of ratios may be determined depending on which ratios are discr; m; n~ry of a particular disease or condition of interest.
In addition, the pattern of protein binding to an oligonucleotide probe that comprises the protein binding region of a biological response modifier (BRM) gene, such as the ~IFN gene, is suitable to distinguish a T~-l from a TH-2 immune response because the pattern of protein binding is different in the two cell types. Thus, these patterns of protein binding are a way of determining whether an individual~s response is in a TH-1 or a T~-2 mode.
Alternatively, the methylation status of nucleotides within the regulatory element of a BRM gene, such as the ~IFN, i8 suitable to distinguish a T~-l from a T~-2 immune response because the pattern of DNA methylation is different in the two cell types. Determination of the methylation status within the regulatory element of a BRM
gene allows one to assess whether an individual's immune response is in a T~-l or a TH-2 mode. In addition, the pattern of distribution of T lymphocytes in a density W096i03523 2 1 9 5 2 1 7 P~./~

gradient following centrifugation of peripheral blood cells can also be used as an immune status index.
As used herein, altered i une ~tatua refers to a deviation as defined by a threshold or the distribution of control values. Deviation may be caused by immunosuppression, autoimmunity or hyperimmunity or any other disease characterized by the malfunctioning of the immune system. An altered immune status is evaluated by determining an immune status index for the patient and comparing it to the immune status index in healthy individuals. A significant variation between the patient~s immune status index and the immune status index for healthy individuals indicates that the patient's immune status is altered. ~ = ~
1~ SubstAntinlly or si3n;fi~ntly altered refers to a value outside of the statistical limits of the control distribution.
~hn~r~lly high or low refers to a value of a ratio outside of the statistical limits of the control distribution. - =
As used herein, T lymphocytes or T cellB include all subsets of lymphocytes which carry the T cell antigen receptor. These subsets include, e.g., lymphocytes which are CD3+CD4+(~+); CD3+CD8+(~+); CD3+CD4CD8~ +); and CD3+CD56+.
As used herein, l~munotherapy includes adoptive i~munotherapy which includes c~llnlar adoptive immunotherapy which involves the administration of immunologically active ~(immunocompetent) cells to an individual for the purpose of providing a h~n~f i ~
immunological effect to the individual, such as reduction or control of cancerous or diseased tissue.
Immunotherapy also ;n~ = cytokine therapy, vaccines, infusion of nntiho~;es and chemo-immunotherapy.
3~ As used herein, immunotherapeutic activity or im~une response or i -logicnlly active or i - _etent includes anti-tumor activity, anti-infected cell W096/03s23 2 1 9 5 2 1 7 . ~ 5 activity, anti-disease agent activity and killer activity of white blood cells.
As used herein, the ~signal transduction pathway includes any protein, the expression of which is induced, linked or regulated by the binding of a ligand or an antibody to any T cell surface receptor. These proteins include, but are not limited to, Jun, Fos, Myc, GAP, Rafl, c-relr Plc~, Protein G, Inositol Phosphate, Protein Kinase C, Mapl-kinase, CD45 phosphatase and the Src family of kinases including Lck, Fyn, Yes and Lyn. The signal transduction proaeins also include D~A binding proteins, such as NF-~B, NFAT, etc.
Ag used herein, antibody includes~any protein or protein analogue which binds spen;f~c~lly to an appropriate e~itope of an antigen. Antibody includes any - protein or protein analogue which binds specifically to an d~L~Liate epitope of the T cell receptor that is 5t1mnl~tn~y Antibody also includes any protein or protein analogue which binds specifically to a TCR
subunit protein, protein in the T lymphocyte signal transduction pathway, polynucleotide binding protein or BRM. The term includes antibodies made by conv~nt;nn~l methods including polyclonals, I nn~nn~lq or fragments thereof, as well as genetically Qngineered or synthetic molecules, e.g.' single chain antibodies, that contain a binding region that is the functional e~uivalent of an antibody in its binding sp~n;f;nity~
A diag20stically ~i~n;f;c~nt portion of a protein binding region of a sRM gene is defined as a region sufficient ~o ~distinguish a condition to be detected, from a control value.
As used herein, hio]n~ir~l response modi_ier (BRM) includes those soluble proteins which mediate much of the intercellular signalling re~uired for an integrated response to a variety of external stimuli. A BRM
includes cytokines, which are potent mediators that interact with specific high affinity receptors on the cell surface. Cytokines have beQn shown to affect the W096/03523 2 I q 5 2l16 - r~~

function of all cell types involved in an immune response and to be involved in lymphopoiesis and hematopoiesis.
They have been implica~ed in the pathophysiology of a large number of diceases. L~ ~hrk;n~c are preferred cytokines in the claimed invention.
As used herein, the NF-KB/Rel family of transcription factors is a multiprotein complex which activates gene transcription. Several proteins ;nr]n~;ng I~B, plO5 tprecursor of p50), p50 and p65 control the~biological functions of NF-KB. NF-KB i9 a member of the Rel-related protein family which all have similar primary amino acid sequences and bind to an array of homologous nllrleotide se~uences with varying affinities. Rel-related proteins can form a large number of di:stinct KB-binding dimeric complexes since most ~omo- and heterdimeric combinations are possible. The Rel protein family includes p50, p52, p65, v-Rel and c-Rel.
As used herein, polynucleotide binding protein is a protein or multiprotein complex that associates with DNA
and thereby regulates transcriptional activity of a gene either by activating or repressing pnoduction of mRNA.
As used herein, olig~nllrleotide probe is a segment of nucleotides that hybridizes under stringent conditions to a sequence of nucleotides. As used herein a protein binding region of a genc or regulatory element of a gene is that region of D~A which binds a protein or multiprotein complex and thereby regulates transcriptional activity of a gene either by activating or repressing production of mRNA.
Further ob]ects, features and advantages of the invention will become apparent form the detailed description of the invention which fc~lows.
DET~Trr-n DESCRIPTION
The process of alteration of the immune response in cancer involves changes in the structure of the TCR and alterations in the nuclear transcription factors such as NF-KB. All of these alterations support an interpretation that T helper cells in the presence of a 21 952l 7 WO96/03S23 I~11~J~ .. 1 ~ -- 17 -tumor are shifting from a TH-1 response which drives a cellular response, to a TH-2 response which drives a humoral response.
It is possible tha~ the immune response produced by the TH-0, TH-1 or TH-2 cells results in a diseased state that needs to be corrected. It is also possible, however, that the type of TH-0, TH-1 or TH-2 cells present in tumor bearing animals or cancer patients are not normal, especially given the major alterations seen in the TCR. Therefore these cells are designated herein as TH-2'.
Serum of mice with tumors exhibits increased levels of IL4 and IL10, as compared to a normal mouse, which indicates a TH-2 response. Moreover, a uni~ue pattern of protein binding to an oligonucleotide probe that comprises the protein binding region of a gene for BRM
occurs in TH-1 and TH-2 cloneg. For example, the binding pattern was determined using a 32 base pair probe from the promoter region of ~IFN. This pattern was tested in the ~ ghtPr T cells and the CD4+ helper cells from normal mice, mice bearing tumor for 18 days and long-term tumor bearing mice (MCA-38 colon cancer). The pattern that appeared in the normal state matched that of the TH-l clones. In contrast, the pattern of the tumor bearing mice, even though it did not match that of~TH-2 cells, was nonetheless completely different from that of the normal TH-l-type pattern TH-2 cells from tumor bearing mice (i.e. TH-2' cells) may be altered in more than one way.
The pattern of protein binding to DNA is useful to identify the shift from TH-1 to TH-2. Additionally, the concept of a TH-l ~ TH-2 shift opens up avenues to new therapeutic approaches which~could reverse the process back to a TH-1 response. Thus, the ability of in vitro or in vivo manipulation or drugs to induce cells from long-term tumor bearers to revert back to a TH-1 pattern is used as a screen to select potential therapeutic agents. Likewise, a therapy (chemotherapy, radiation, W096l03~23 2 l 9 5 2 ~ 7 ~.,. I

surgery, immunotherapy or even gene therapy) can be monitored to determine if it is effective by demonstrating the ability of the therapy to shift the protein binding pattern of D~A in T lymphocytes to a TH-1 or a TH-2 response depending on the needed therapeutic outcome. These changes could occur even before a reduction in tumor is apparent. This assay i8 BUitable to monitor the TH-1/TH-2 conversion, or to detect a TH-O
status in other diseases in which the immune response is important.
The process of 1088 of the cellular immune response with an increase in the antibody response in patients with advanced cancer was described in the 1960's. Based on current knowledge of immunology this alteration i9 ~pl~;n~ by a change from a pr~ ;n~n~e of a TH-1 response (IL-2 and ~IFN) to a TH-2 response (I~-4, IL-6, I~-lo~. In serum of tumor-bearing mice, there is an increase in the amount of IL-4 and IL-10 which is not detected in the serum of normal mice. Similarly, cultures of splenocytes from normal mice and mice bearing a tumor for short or long periods of time demonstrates that the first group produces mainly ID-2 and ~IFN ~TH-l). T cells from the tumor-bearing mice show a progressive loss of the ability to produce I~-2 and ~IFN
and instead produce I~-4. ~:
A likely explanation for these observations is:that a tumor produces a factor or a "signal" which induces major changes in the NF-Ks molecules. In the tumor-bearing mouse model, the cytoplasmic p50, p65 and rel remai~ normal. However, the same factor which should be found:in the nucleus is not seen and the p50 is replaced by a p~8 form. It is possible that the translocation of these proteins to the nucleus is somehow blocked or that they are cleaved by a nuclear protease. In humans the major .change is the loss of nuclear p65 and rel with decreased levels of nuclear p50. In general it is thought that the p65/p50 heterodimer is a stimulator of the production of I~-2, while the p50/p50 h~ ; r is a W096/03~23 21 9 ~21 7 r~ .' 4 ~ - 19 -suppressor. If the p65 is no~ present in the nucleus as a result of degradation, blockage of translocation or lack of an appropriate translocation signal, then p50/p50 dimers would be pre~erentially formed. This would therefore be suppressive of the I~-2 gene and would decrease the production of IL-2. If the IL-2 ~T~-1)- IL-4 (T~-2) production is normally balanced, the decrease in the production of IL-2 suggests that there is a relative increase of IL-4 activity, even though the absolute amount may not be altered, thus effectively driving the response into a T~-2 pattern.
One measure of the immune status index is the ratio of the amount of a TCR subunit protein or T lymphocyte signal transduction pathway protein that varies signiflcantly in a patient with an altered immune status, to the amount of another protein that is subst~nt;nlly invariant in healthy and immune-altered individuals. In U.S. patent application serial nos. 07/863,262, now Patent No 5,296,353, and 08/034,832, the ~nnt~nt~ Of said applications being incorporated herein by reference, it was disclosed that there is a marked ~ecrease in the therapeutic efficacy of adoptively transferred T
lymphocytes from murine hosts bearing MCA-38 tumor for >
30 days (late tumor-bearing mice or late TBM) as compared to normal mice and mice bearing tumor for ~ 21 days (early tumor-bearing mice or~:early T3M).
T lymphocytes from late TBM lose the ~xpression of the CD3~ and CD3y chains into the TCR. The CD3~ chain is in turn replaced in the TCR by the FCEY chain, a member of the ~ family of chains. These lymphocytes also exhibit a marked decrease in T lymphocyte signal transduction pathway proteins such as tyrosine kinases of the Src family, notably LcK and Fyn, as well as proteins PLCy and GAP. On the other hand, integration of CD3E
into the TCR is subst~nt;~lly unchanged Similar changes in the pattern of integration of proteins into the TCR
and expression of proteins in the signal transduction pathway have been observed ln human cancer patients.

W096/0~ ~1 9 5 Z I 7 r~

The immune status indexr therefore, is determined by immuno-precipitating the TCR complex from a known quantity of cells. The ratio of the amount of a TCR
subunit protein integrated into the TCR complex that varies significantly in a patient with an altered immune status. such as CD3~, CD3~ or Fc~, to the amount of another TCR protein that is subst~nti~11y invariant in healthy and immune-altered individuals, such as CD3~, or TCR~, constitutes an immune status index.
In another illustrative ~o~;- , an immune status index constitutes the ratio of the amount of a T
lymphocyte signal transduction pathway protein that varies significantly in a patient with an altered immune status, such as LcK, Fyn or PLC~, to the amount of another protein that is subst~nt;~lly invariant in healthy and immune-altered individuals, such as CD3~ or TCR~.
Another immune status index is the ratio of the amount of a BRM that varies significantly in a patient with an altered immune status to the amount of another protein that is subst~nt;~lly invariant in healthy and immune-altered individuals. This type of immune status index is, e.g., the ratio of the amount of a TH-l-type BRM to a TH-2-type BRM. For example, an immune status index is the ratio of TH-1 lymphokines/TH-2 lymn~nkin~s.
More specifically an immune status i~ndex is the ratio of IL-2~IL-4; ylFN/IL-4; or IL-2/IL-lO, and the like.
Another immune status index is the ratio of the amount of cytoplasmic to nuclear levels of certain NF-KB/rel proteins, or the~ratio of the amount of certain NF-KB/rel proteins that varies significantly in a patient with an altered immune status to the amount of another protein that is subst~nt;~11y invariant in healthy and immune-altered individuals. In U.S. patent~application serial no. 08/034,832, ~he contents of said application being incorporated herein by reference, it was disclosed that in some abnormal conditions, c-Rel, p65 and p50 are absent. In other conditions, only one or two are absent, W096/~3523 2 l q52 1 7 ~ - 21 -.
or the protein is absent from the nucleus but not the cytoplasm. In still other abnormal conditions, new forms of protein replace a form present in the normal state.
For example, in the presence of RENCA tumor and MCA-38 colon tumor in a mouse, the p50 protein, a cn~rnnt~ntof nuclei of a T lymphocyte preparation from a non-tumor bearing mammal, disappears, and is replaced by p48 and p46 (proteins with estimated molecular weights of 48 and 46 kD respectively as dett~rr;n~d by Western blots.) Some of the new protein forms appear to be related to the larger molecular weight form they replace by N-terminal truncation of the larger form. Analysis of the pattern of NF-KB/rel proteins in ~ nt patients revealed alterations from the non-cancerous state. c-Rel and p-65 were absent in nuclear preparations.
Thus, an immune status index is the ratio of the amount of cytoplasmic to nuclear levels of p65 and c-Rel.
For example, an ELISA method for the determination of the ratio of cytoplasmic to nuclear amounts of p65 and c-Rel comprises preparation of samples of tissue or fluid, such as blood, cnnt~;n;ng T lymphocytes. In the case of human T lymphocytes, the cells must be stimulated, such as by incubation for 1 or more hours with an anti- C3 antibody, in order to detect p65 translocation to the nucleus. The cells in the T lymphocyte preparation are subse~uently gently lysed so that nuclei remain intact. The intact nuclei are gently separated from the cytoplasmic components, e.g., by means of low speed centrifugation.
For example, the cell lysates t~nnt~;n;nt3 intact nuclei are placed in microtitre plate wells and the plates are centrifuged at low speed to sediment the intact nuclei, for example at 2,000 rpm for 5 min. The supernatant containing the cl _ ~ntq of the cytoplasm are removed and placed in separate well~. The nuclei are lysed and the amount of p65 and c-Rel in each of the nuclear and cytoplasmic fractions is ~uantified. The immune status index is the ratio of the amount of cytoplasmic to nuclear p65 and c-rel.

W0~6/03523 2 1 9 5 2 1 7 F~~

Alternatively, an immune~status index is the ratio of the amount of nuclear levels of p65 and c-Rel to the amount of another protein, e.g., nuclear MAP kinase that is subst~nti~lly invariant in healthy and immune-altered individuals. The amounts of~ nuclear p65 and~or c-Rel, and MAP kinase are determined following purification of intact nuclei, and the immune status index i9 expressed as the ratio of the amount ~f nuclear p65 and c-Rel to the amount of the substAnt;Ally invariant protein.
The amount of TCR subunit protein, T lymphocyte signal transduction pathway protein, NF-KB/rel protein, sRM, or polynucleotide binding protein can be determined by many different conv~ntjnnAl and well known assay methods. Samples of tissue or fluid such as blood are isolated from the patient and the amount of the selected protein is determined. These samples are taken from various tissues including tumor tissue, splenic or lymphatic tissue, peripheral blood cells, cerebrospinal fluid, pleural effusions and ascites.
A protein extract of the tissue or cell sample is analyzed directly to determine the amount of the protein.
Alternatively, T cells, T cell subsets, nuclear cell fractions or cytoplasmic cell fractions are purified before determining the amount of the selected protein.
T cells or T cell subsets are purified by any of a variety of conventional techniques such as rosetting followed by Ficoll~-Hypaque~ gradient centrifugation, indirect panning, antibody/complement-mediated cytotoxicity, ;~nnl gnetic purificatiPn, flow cytometry, and similar techni~ues. Additionally, the TCR
are immunoprecipitated using an antlbody such as anti-CD3~. The subunit proteins comprisi~g the TCR: are analyzed by Western blot by methods known to those of skill in the art.
The amount of a protein is determined~using well known techniques such as immunofluorescence, ELISA, western blot analysis, and similar techniques. An extract for analysis of protein by any of these ~well W096/03523 2 1 9 5 ~ 1 7 ~ 5:~ 1 ~ - 23 -known techniques i8 made by convrnt;nn~l methods from the tissue or fluid sample, or T cells or T cell subsets prepared from these samples. An antibody which Gpecifically detects the selected protein, and which is conjugated to a known label, is prepared by methods known to those of skill in the art.
A kit for determining the immune status of a patient ;nrl ll~P~ an antibody directed to a protein from a group ;nrln~;nrJ a TCR subunit, a signal transduction pathway protein, a BRM, a polynucleotide-binding protein and a NF-Ks/rel family protein. In separate rrnt~;nrrs, one or more ~nt;hc~;es are present, each directed to an individual protein of the present invention. The kit also includes means for detecting the formation of an lS antigen-antibody complex, from which the presence of a particular protein is inferred and quantitated. Immune status indices, as described above, are r~lC~ t~ based upon the amount of each protein detected.
T lnr~qsay-based diagnostic kits of the present invention are typically used in an ELISA format to detect the presence or quantity of proteins in a sample such as a lymphocyte preparation. ELISA re~ers to an enzyme-linked immunosorbent assay that typically employs an antibody or antigen bound to a solid phase and an enzyme-antigen or enzyme-antibody conjugate to detect and quantify the amount of antigen present in a sample. A
description of the E~ISA technique is found in Sites et al. (1982) and in U.S. Patent Nos. 3,654,090, 3,850,752 and 4,016,043, each of which are incorporated herein by reference. Suitable reagents in the kits in separate containers include:
1. a. a kit for cell separation including a column to eliminate B cells, granulocytes and monocytes;
b. a cell lysis kit c~nt~in;ng the lysate reagents;
c. E~ISA plate with ~nt;hr~;~q bound to it or individual vials of polyclonal anti-CD3 capture/murine ~ 1 n ~ n 1 7 ~ ~
W096/03~23 L 1 7 J~ l/ Ic~ . 4 monoclonal to CD3~, CD3~, Fc~ or CD3~ as a probe/~lk~l;n~ phosphatase-coupled goat anti-murine Ig.
2. a. a kit for cell separation ;n~ ;ng a column to eliminate B cells, granulocytes and monocytes;
b. a cell lysis ~kit containing the lysate reagents;
c. tran3fer of lysate to ELISA plate for separation of nuclear and cytoplasmic fractions by means of centrifugation;
d. ELISA plate with ~nt;ho~;es hound to it or individual vials of murine r nrl~n~l to p65 or c-Rel and a probe such as ~lk~l;n~ phosphatase-coupled goat anti-murine Ig, or any other equivalent pro~e well known to the skilled artisan.
Another type of immune status index can be obtained using the pattern of protein binding to an oligonucleotide probe that comprises the protein binding region of a BRM gene, such as the ~IFN gene. The pattern of protein binding to the oligonucleotide probe that comprises the protein binding region of a BRM gene i3 determined by methods well known to the skilled artisan, such as the electrophoretic mobility shift assay (EMSA).
Norihisa (1994). The oligonucleotide probe that comprises the protein binding region of a BRM gene can be a nucleotide :sequence that does not include a KB
sequence. An immune status index that is the pattern of protein binding to an oligonucleotide probe that comprises the protein binding regions of a BRM gene is suitable to distinguish a T~-1 from a T~-2 immune response, or to detect a T~-2' immune response, because the pattern of protein binding is different in these cell types. Thus, these patterns of protein binding are a way of determining whether an individual's response is~in a TH- 1, TH- 2 or T~-2' mode.
~n immune status index is the methylation status of nucleotides within the regulatory element of a BRM gene.
The methylation status of nhcleotides within the regulatory element of a BRM is determined by means of W096/03523 2 1 9 5 2 1 7 A ~ ~

methods well known to the skilled artisan. For example, a restriction enzyme is selected that is sensitive to the methylation status of the restriction enzyme's target sequence. D~p~n~;ng upon whether the target sequence methylated or not, a particular restriction enzyme may or may not cleave the target and product(s) are detected by means Of Southern blot analysis using a hybridization probe that comprises a nucleotide sequence that includes the targes sequence of the restriction enzyme. The methylation status of nucleosides within the regulatory element of~a ;3RM gene provides a way of ~t~rmin;nr whether an individual's response is in a TH-1 or a TH-2 mode.
More specifically, the methylation status of CpG
dinucleotide rnnt~;n~d within a TATA-proximal regulator element of the ~IFN promoter correlates with the transcription of the ~IFN gene. In murine TH-1 clones and two human CD4+ clones which produce ~IFN and IL-2, this site is either completely or partially 11YL- thylated In contrast, in murine TX-2 clones which produce IL-4 and IL-5, but do not produce ~IFN or IL-2, this site is greater than 98~ methylated. Treatment of murine TE-2 cell lines with 5-azacytidine, an agent that inhibits methylation of the DNA, converts these cells to ~IFN producers.~
A ,, rk~hl e and attractively simple type of immune status index can be derived from the pattern of distribution in a density gradient, of T lymphocytes obtained from a patient and subjected to density gradient centrifu~t;~n, compared to the pattern of distribution in a density gradient, of T lymphocytes obtained from a healthy individual and subjected to density gradient centrifugation~ The pattern of distribution, in a density gradient of T lymphocytes obtained from an individual with an altered immune status significantly differs from the pattern of distribution, in a density gradient, of T lymphocytes obtained from a healthy individual.

W096/03523 2 1 9 5 2 ~ 7 ~ c ~ 1 D~p~n~ing upon the nature of the altered immune status, the patient may have fewer, or alternatively, more T lymphocytes in one or more bands in the density gradient. The change in the pattern of distribution in the density gradient of T lymphocytes fr4m the patient, compared to the healthy cortrol, evidences a change in the size and physiology of the T lymphocytes and is diagnostic of a change in the patient's immune status.
The change in the pattern of distribution of T
lD lymphocytes in the density gradient is cor~lated with the type and severity of disease. The pattern of distribution of T lymphocytes in the density gradient also can be used to monitor recovery of the patient, i.e.
restoration of a normal immune status. The pattern of distribution of T lymphocytes in the density gradient can be used to identify compounds that alter the immune status of the individual, such as compound that induce or reverse immunosuppression.
Any material that is gentle to cells, that is, which does not disrupt the cells or significantly change membrane permeability, can be used to produce=the density gradient. For example, Percoll~ (polyvinylpyrollidone), Ficoll~ (sucrose polymer), HypaQuel (3,5-Bis-acetamido -2,4,6-tri-iodobenzoic acid, sodium), sucrose, dextrans or other sugar polymers, are d~U~U~ iate materials for production of the density gradient. The density gradient can be continuous or discontinuous. The range of densities in the gradient can be varied so long as the cells are separated in a diagnostically meanful manner.
Percoll~ density gradient centrifugation of human peripheral blood lymphocytes revealed that size correlated with density. Most of the T lymphocytes from healthy individuals were found in most dense Fraction 6 while a small proportion of the T lymphocytes were found in the less dense Fractior. 3. The cells in Fraction 6 are smaller than those in Fraction 3. Tn cancer patients, on the other hand, the majority of T
lymphocytes were fQund in the larger~and less dense W096/03~23 2 1 q 5 2 1 7 r~.,~
~ - 27 -Fraction 3. Accordingly, the cells may be separated on the basis of density or size, 8UC~ as by fluorescence activated cell sorting (FACS).
The immune status index can be expressed as a change in the pattern of distribution of T lymphocytes in the density gradient. Alternatively, the immune status index can be expressed ~uantitatively as the ratio of the number of cells, or amount of protein, in specific density gradient fractions, so long as the cells isolated lQ from patient and control are prepared by the same method and e~ual numbers of cells are applied to each gradient.
In addition, the immune status index can be expressed as the relative amounts of a TCR subunit protein, a T
lymphocyte signal transduction pathway protein, a polynucleotide binding protein, or a BRM in T lymphocytes from specific density gradient fractions. Alternatively, the immune status index is the ratio of a TH-1-type BRM
to a TH-2-type 3RM, the ratio of cytoplasmic to nuclear levels of certain polynucleotide binding proteins, the pattern of protein binding to an oligonucleotide probe that comprises the protein binding region of a gene for a BF~, and the methylation status of nucleotides within the regulatory element of a sRM gene in T lymphocytes from one or more density gradient fractions. A
significant varlation between the patient~s immune status index and the immune status index for healthy (control) individuals indicates that the patient~s immune status index is altered.
An illustrative kit containing the necessary ma~erials ~for rapid and reproducible separation of T
lymphocyte fractions by density gradient centrifugation under sterile conditions, and reagents for the determining the immune status of cells in the fractions is provide~. A kit for determining the immune status index of a patient typically would include centrifugation tubes and materials for preparation of the density gradient, such as sterile solutions of Percoll~, describe generically of various densities. The kit can c~ntain a W096l03523 2 ~ 9 5 2 ~ 7 r~.~

cell lysis kit rnnr~;ning cell lysis reagents.
Alternatively, the kit contains materials for cell separation such as a column to ~l;m;n~te B cells, granulocytes or monocytes. The kit can contain pipettes for removal of cell fractions following density gradient centrifugation. The kit may contain reagents for the stimulation of separated T cell fractions, such as the anti-CD3 antibody and cell culture medium.
The kit also can contain~reagents for determining the amount of one or more diagnostic proteins in a density gradient fraction. The kit can contain one or more EhISA
plates with antibodies bound to it, or individual vials ~nt~;n;ng antibodies to p65, c-Rel, p50, or~BRM such as IL-2, IL-4, e~c. The kit can contain a probe such as alkaline phosphatase-coupled goat anti-murine Ig, or any other probe well known to the skilled artisan.
In place of, or in addition to, reagents for determining the amount of one or more aiagnostic proteins in the density gradient fraction, the kit can contain reagents for determining the pattern of protein bi~ding to an oligonucleotide probe that comprises the protein binding region of a BRM gene or the methylation status of nucleotiaes within the regulatory element of a BRM gene.
These reagents include an oligonucleQtide probe for use in EMSA analysis of nuclear extracts prepared from the cell fraction. Alternatively, the reagents can include one or more restriction enzymes and a DNA hybridization probe for determining the methylation status of nucleotides within the regulatory element of a BRM gene.
The T lymphocyte preparation is obtained from any source of T lymphocytes such as spleen, peripheral blood, tumor, lymph nodes, thymus, etc. For example, peripheral blood lymphocytes are obtained by conv~nti~n~l methods and red blood cells are removed by lysis. Intact live cells are separated from cell debris and dead cells by means of centrifugation. The T celis are then subjected to density gradient centrifugation, for example density gradient centrifugation in Percoll~, Fiçoll~ or sucrose.

WO9C/03523 2 1 9 5 2 1 7 r~~
~ - 29 -The pattern of distribution of T cells obtained from the T cell preparation from healthy controls and patients suspected of having an altered immune status are compared following density gradient centrifugation.
An immune status index also can be expressed as a ratio, or other relati~n~;p, of any one of the immune status indices, as determined by any of the methods outlined above, to an immune status index, as determined by any of the other methods outlined above. An immune status index also can be a combination of said individual ratios.
A significant variation between a patient's immune status index, as determined by any of the methods outlined above, and the immune status index in healthy individuals determined by the same method, indicates that the patient~s immune status is altered. It is contemplated that an immune status index is used to detect and monitor immunosuppression, such as the i -_u~,ession commonly associated with cancer. An immune status index is used to determine the patient's therapeutic plan. For example, the physician determines an immune status index to evaluate the level of immunosuppression of the patient~s own T lymphocytes and to determine the li k~l i h~od of success that these cells can be stimulated for effective autologous adoptive immunotherapy. U.S. patent application serial no.
07/910,835, now patent no. 5,316,763, discloses methods of adoptive immunotherapy. ~ikewise, the immune status index can be used to aid the physician in ~ r~ining when to treat the immunosuppressed patient with immunostimulating drugs, antibacterial agents, and the like.
Diseases which result in progressive immunosuppression include cancer ~of =~many different tissues including leukemia, ~odgkin's disease, lung cancer, colon cancer, gliomas, renal cell carcinoma, and the like. Progressive immunosuppression is observed in a great variety of infections including those that are W096l03s23 21 95217 intracellular such as leprosy, tuberculogis, 1P;R1 ;~;
those that are extr~Pll~ r such as sepsis, kiseases of viral etiology such as those caused by XI~, cytomegalovirus, Epstein sarr, and the like; parasitic infections such as schistosomiasis, malaria, and the like.
If chemoth~rapy, radiotherapy, surgery, medication, immunotherapy or some other treatment modality, or combination of treatment m~~l ;t;es, is effective in eliminating the tumor, or other cause of immunosuppression, then the immune status index should return to normal. These i~ L~v~ ts are monitored by the methods of the present invention.
It is contemplated that the immune status index is suitable to detect and monitor ~-~to; ~ty. For example, the immune status index is suitable to dPtArm;n~
the patient~s therapeutic plan. Diseases which result in the establishment of autoimmune response include lupus, ~lltO; ~ thyroiditis, scleroderma, rheumatoid diseases such as rheumatoid arthritis, and the like.
It is contemplated ~hat the immune status index is suitable to detect and monitor hyperimmunity. For example, the immune status index is used to ~PtPrm;~P the patient~s therapeutic plan.
The following examples are set forth as representative of specific and preferred emoodiments of the present invention. These examples are not to be construed as limiting the scope of the invention in any manner. It should be understood that many variations and modifications can be made~while remaining within the spirit and scope of the inv~ention.
Example 1 ~nt~hodieg to the ~ Protein Polyclonal and monoclonal antibodies were made to two different Keyhole Limpet Hemocyanin (KL~)-conjugated peptides having amino acid sequences based on the sequence of the human ~ protein. The antibodies were 21 9~21 7 ~ - 31 -prepared by Multiple Peptide Systems, now Chiron Mimotopes Peptide Systems.
The amino acid se~uence of peptide 1 was RRRr~R~nGLyQGc-NH2 (SEQ ID NO:l). The Rn~;ho~;~c made to peptide 1 were designated:
Polyclonal: AB70-92A
Monoclonal: M~B3-92A
The amino ;acid se~uence of peptide 2 was DTYDALHMQTLAPRC-NE2 (SEQ ID NO:2). The Ant;ho~;es made to peptide 2 were designated:
Polyclonal: AB70-92B or Onco~l Monoclonal: MAB12-92 The polyclonal An~;ho~;es were prepared by means of the following protocol. 5 mg of purified peptide was coupled through the terminal cystein thiol to RLH with the heterobifunctional cross-linking agent MBS
(Maleimidobenzoyl-N-hydroxysuccinimide ester), in a ration of 1 part peptide to 1 part RLE (w/w). The host were New Zealand while rabbits 6-12 months in age. The peptide was suspended in PBS buffer (3.1 mg/ml), emulsified by mixing with an e~ual volume of Freund's Adjuvant and injected into ~five to six subcutaneous dorsal sites for a total volume of 0.6 ml (1.0 mg of conjugate, 0.50 mg peptide) per ;r~nn;7ation~
Animals were bled from the ear vein and the blood was then heated at 37~C for 1 hours, cilled at 0~C for 15 hours nd centrifuged. The serum was stored at -20~C.
The pre-immune bleed, first bleed, second bleed and third made were made on days 1, 46, 49 and 53, respectively.
In order' to ~control the effectiveness of the ; ;7~tion, the pre-immune serum and the first bleed were tested by ELISA with RL~ as coat. For all sera, the anti-peptide antibody titer was determined by means of ELISA with free peptide as coat (lOQ pmoles/well). Prior to use, the polyclonal antibodies were affinity purified on a column to which was attached the synthetic purified peptide using methods well known to the skilled artisan.

W096l03523 2 l 9 52 i 7 r8~

The monoclonal ~ntihn~iP~ were prepared by as described in ~.S. Patent. No. 5,246,831, which is incorporated herein by reference. The criteria used for selection of the anti-~ monoclonal antibodies were as follows. In the first fusion, all hybridomas that produce detectable antibody to the antigen are selected.
The peptides antigens were ~hsnrhP~ to microliter wells of ELISA plates for this testing purpose. All positive fusion cultures were ~r~n~d in voLume and re-tested in the same manner. Approximately 5 of the cultures having the highest OD values according to ELISA were then selected for subcloning to e~sure monoclonality.
Resulting subclones were then tested in the same manner as in the initial screen to detect all positive subclones.
Once again, positive subclones were ~YpAn~, re-tested and the culture having th~ h1gh~t OD values according to ELISA were selected. Fi~ally, the 5 PRr~n~ subcultures having the highest OD values were ~p~n~d for injection into~mice for ascites production.
Accordingly, it is well within the skill level o~ the artisan in this field, without undue experi- tAt;nn, to prepare other monoclonal ~nt1hn~;~5 having the same antigen binding characteristics as MAB3-92A and MAB12-92.
Exa~ple 2 ELISA Assay for CD3~ and ~ Proteins The CD3~ chain cnnt~;n~d in detergent lysates of peripheral blood cells (PBLs) or of human T cell lines was measured by a sandwich ELISA as~say. Detergent lysates of cells were prepared by resuspending the cells at a cnnc~ntration of lx106~10 ~1 of lysis buffer (50 mM
Hepes pH 7.4, 150 mM NaC1, 1 mM sodium orthovanadate, 1 mM EDTA, 10 ~g~ml leupeptin, lQ ~g/ml aprotinin) nnnt~;n;ng either 0.5~ triton X-100 (Sigma) or 1.0~
digitonin (Wako BioProducts). After incubating 30 min on ice, the suspensions were c~ntr;ruged at 14,000 rpm for 5 min (Eppendorf Microcentrifuge Model 5415C).

21 ~521 7 W096l035~

, .
The CD3E complex was first captured on 96-well-plates (Nunc MaxiSorp) coated with an affinity-purified rabbit polyclonal anti-CD3~ antibody (DAKO, catalogue # A452).
The antibody-bound complex was then detected using a murine mnnn~l nn~l anti-CD3 antibody recognizing a separate epitope (Coulter, OKT3). Binding of the murine antibody was detected using an ~lk~l in~ phosphatase-coupled goat anti-murine Ig reagent (Southern Biotech, catalogue # 1010-04) followed by addition of the ~lkAl;n~
phosphatase substrate, p-nitrophenyl phosphate (pNPP, Sigma, catalogue # 2765).
The 96-well plates were coated with primary antibody by in~nbating overnight at 4~C with 100 ~l/well of rabbit anti-CD3~ at 5 ~g/ml in phosphate buffered saline (PBS).
The antibody solution was removed by flicking the cnnt~nt~ of the plate and the plates were subse~uently incubated for 2 h at 4~C with 200 ~l/well of PBS
cnnt~;n;ng 2% w/v dry nonfat milk to block absorption sites. Blocking solution was removed and the plates were washed 2x with 150 ~l PBS/well.
Cell lysates were added to ~pLu~Lldte wells and incubated lh at 4OC. The plates were washed 5x with 150 ~l PBS, followed by addition of 100 ~l/well of secondary murine anti-CD3 reagent (5~g/ml in PBS containing 0.2~
milk). Following a 30 min incubation at 4~C, the plates were again washed 5x with 150 ~l PBS. 2\1k~1;nP
phosphatase-coupled goat anti-murine Ig reagent (100 ~l/well of a 1:500 dilution in PBS cnnt~;n;ng 0.2% milk) was added and the plates were incubated another 30 min at 4~C. 2\fter washing 5x, nNPP substrate (100 ~l of 1 mg/ml in 10% dieth~nnl~m;n~ 240 ~M MgCl2, pH 9.8) was added to each well. The plates were incubated at 37~C for 30 to 60 min.
Absorption readings were made at 405 nm on a Bio-Tek Model EL 312e microplate spectrophotometer. Background controls were included in which primary antibody, lysate or secondary antibody were replaced with PBS in the protocol. Detergent lysates of B cell lines negative for CD3e and ~ expression based on immunofluorescence were used as additional controls.
The ~ protein was measured using two different protocols. In Protocol 1, rabbit anti-CD3~ (DAKO #A452) was used on the plates to capture detergent-solubilized complexes c~nt~;nlng CD3e and ~ protein. The amount of antibody-bound ~ protein was then measured using a murine monoclonal anti-~ reagent (Coulter TCR-~, catalogue #
6604592) and alkaline phosphatase-coupled goat anti-murine Ig. : :
In Protocol 2, a murine monoclonal anti-~ antibody (Coulter CD3~) was used to capture detergent-solubilized ~ protein directly, followed by ~tecti~n of bound using a rabbit polyclonal anti-~ antibody and alkaline phosphatase-coupled goat anti-rabbit-polyclonal antibody (Southern Biotech, catalogue #4010-04). The rabbit polyclonal anti-~ antibody was Onco~1 coupled to carrier protein KI~. The assays were performed as in the CD3e assay above, using primary Ab at 5 ~g/ml to coat the plates and secondary antibody at 5 ~g/ml (Coulter TCR-~) or at a 1:300 dilution of crude sera.
Typical results using the CD3 ELISA assay and the two versions of the ~ ELISA assay are shown in Table 1. In all three assays, detergent lysates prepared from normal human peripheral blood T cells or T cell lines gave absorption values far above those obtained using lysates from ~-negative B cell lines or from controls in which the primary Ab was excluded The digitonin lysis buffer was clearly superior to triton X-100 for measurement of CD3-~ association using anti-CD3 as the capture reagent and anti-~ for detection (~ Protocol #1) while triton X-100 lysates appeared slightly superior for measuring ~ antigen using the combination of two anti-~ Abs for capture and detection (~ Protocol #2). Both digitonin and triton lysis buffers performed well in the CD3 a3say. A likely explanation for the differences between the two ~ assay protocols is that digitonin may preserve the noncovalent association W096/03523 _ 32 1 952 1 7 P~lll 9' 4 of ~ and CD3~ while triton X-lOQ may cause its dissociation. Another point to consider in using the two ~ assay protocols i8 that the anti-CD3~/anti-~ protocol focuses on the level of ~ chain associated with CD3 on the surface of CD3-posltive T cells while the anti-~/anti-~ protocol measures ~ content regardless of its association with CD3 or its location in T cells or other types of ~-positive cells (i.e., natural killer cells).
For the purposes of the immune status index it is necessary to measure the ~ actually incorporated into the CD3.
Also shown in Table 1 is the ratio of Ahsrrh~nre values in the ~ and CD3~ assays. 3ecause the proportion of CD3-positive T cells in peripheral blood and the amount of CD3~ per cell may vary, the ratio offers a convenient way to normalize ~ levels to CD3 content without requiring purification of~T cells from the samples.

Table 1 Capture EI ISA AsEIayEl of :!~eta and CD3 ZEiTA
Cell SamPle Ratio--CD3f t/CD3f Protocol IProtocol 2 Nornnal T cells Digitonin iysale 0 517 0 701 0 806 0 87 Triton Iysate0 022 1 280 1099 1 16 lurkat T coll line Triton IysateND--~ 0 849 1 310 0 64 B cell lines RL
Digitonin Iysate 0 001 0 030 0 000 Triton Iysate0 035 0 047 C 000 HT
Triton IysateND 0 014 0 000 No primary Ab Control Normal T cells Triton IysateND 0 027 0 001 Digitonin Iysate 0 012 ND 0 000 optic.l Density 4~5 Ratio of absorbance values wherein values used in determining the ratio of ~ to CD3~ were derived using Protocol #2 ND = not done ApplicatiQn of the CD3~ and ~ capture ELISA assays to mixed cell populations containlng ~significant proportions (10~) of polymorphonuclear cells (PMNs) requires special precautions due to the release of proteases from such cells during the detergent lysis step. In such instances, a modified lysis buffer is employed which contains additional protease inhibitors.
Examples of such inhibitors include soybean trypsin/chymotrypsin inhibitor (200 ~g/ml, Sigma), chymostatin 200 7 ~g/ml, Boehringer M=nnht~;m) and phenyl methyl sulphonyl fluoride (2mM). As shown in Table 2, in mixed cell populations c~n~=;n;ng a high proportion of:
PMNs (RC-PBL sample), these three protease inhibitors ~ - 37 -cause a dramatic increase in the amount of measurable chain, implying that ~ chain is particularly sensitive (relative to the CD3 chain) to proteolytic destruction.
Purification of T lymphocytes from the mixed cell~ population ~RC-T sample) has a comparable effect.
Table 2 Effect of Protease Inhibitors on the ~/CD3 ELISA Assay Sample Protease ~ PMNs ZetaCD3e Ratio Inhibitors Protocol 1~/CD3 RC-PBL - 55 0.050 0.342 0.15 + 55 0.229 0.354 0.65 RC-T - 7 0.346 0.455 0.76 + 7 0.610 0.504 1.21 O tical Density 405 nm.
*~ Ratio of absorbance values wherein ~ values used in det~rmin;ng the ratio of ~ to CD3~ were derived using Protocol #1 = = Example 3 Cell-Ba8ed T Q8ay of CD3e and ~ Proteins In this protocol CD3e and ~ proteins are measured with a 96 well microliter plate format employing intact fixed cells. Lymphocytes or other cells are fixed to the wells of the microliter plate using such reagents as paraformaldehyde, methanol, etc., followed by permA~hi1;7ation with detergents (digitonin or triton X100, etc.). Primary antibodies to CD3e, or other proteins of interest are added to the appropriate wells and their binding is detected using biotinylated secondary antibody reagents and avidin probes labeled with en2ymes (~lk~lin~ phosphatase, etc.), fluorescent molecules (europium, etc.), or radioisotopes (125, etc.).
In the cell-based ; lnn~say 50 ~l of T cells (5xlO~) were added to each well and the liquid was allowed to evapo-rate. The cells were fixed and permeabili2ed simultaneously with a cola~solution of 1 paraformaldehyde and 0.1~~ triton X100 in PsS for 3 W096l035~ ~1 ~ 5 2 1 7 P~~

minutes. The solution was removed by flicking the plate and blocking solution was added to the pla~e for 10 minutes. The blocking solution was removed by f 1; rk; n~
the plate and the primary antibodies (rabbit anti-CD3~
(DAKO) and affinity purified rabbit anti-~ (Onco~l) at 1:500 dilution were added to the appropriate wells and incubated at 4~C for 1 hr.
Unbound antibodies were removed by ~l~irkinr~ the plates and by washing the plate 3x with PBS using an automated microplate washer. A secondary antibody (biotinylated goat anti-rabbit IgG, 1:1000) was added to the wells and incubated for 30 min. at 4~C. The unbound secondary antibody was removed by washing the plate 3x with PBS using a microplate~washer. Streptavidin-EuCl (Wallac, #1244-360, 1:1000 dilution) was added to each well and incubated for 10 min. at 4~C. The unbound streptavidin-EuCl was removed by washing the plate 3x with PBS using a microplate washer. To increase fluorescence, 100 ~1 of enhance~solution (Wallac, #1244-105) was added to each well and incubated for 5 min. at room temperature. The iluorescence of::each well was read in a time resolved fluorimeter (Wallac, Model #1232).
Table 3 illustrates that the ratios of CD3~ to CD3~
(determined by cell-based ;~nno~Say using time resolved fluorimetry) of several ~ cell popula~ions were comparable to their ratios detected by the capture ELISA
assay (See Example 2).

W096103~23 2 1 q 5 2 1 7 ~ - 39 -Comparison of ~/CD3 6 Detection of Capture ELISA with Cell-Baaed Aasay T cell CD3~/CD3c Ratios Populations~
ELISA ASSAY OELL-BASED ASSAY
1 1.2 1.2 2 1.0 0.9 3 1.4 1.1 4 1.2 1.3 1.4 1.6 mean ~ SD 1.2 ~ 0.17 1.2 ~ 0.25 ' T cells were isol,ted from peripheral blood lymphocytes using R&D Systems' columns ~HTCC-1000).
Example 4 Conversion from TH1 to T~2 in Cancer The amount of T~1-type and T~2-type lymp~k;nPq present in serum of healthy, early TBM and later TBM was compared. Approximately 1 x 1o6 MCA-38 cells in 0.5 ml HBSS were in~ected snh~llt~n~ously in 6- to 3-week old C57BL/6 mice using a 30 gauge needle. Tumors grew progressively and mice were sacrificed at <14 or_~26 days of tumor growth. The serum was collected and the spleen lymphocytes stimulated. Thç amount of IL-Z, IFN~, IL-4 and IL10 present in the serum of healthy untreated controls and MCA-38-treated mice was determined by ELISA.
Tumor-bearing mice exhibit a progressive loss in the ability to produce IL-2 and ~IFN while at the same time producing increasingly more IL-4 and IL-10. There is an increase in the amount of IL-4 and IL-10 in ~he serum of MCA-38-treated mice that is not detectable in the normal healthy control mice. (Table 4). As the cancer develops in the MCA-38-treated mice there is a ahift in the immune sy6tem from a T~-1 status to a T~-2 seatu6.

W096/03~23 2 1 9~2 1 7 .~.,~

Table 4 Increase in IL-4 and IL-10 in Mlce with Tumors IL-4* IL-lQ**
Normal serum 25 0.44 Long-term tumors (32 days) 30 2.35 * picograms/ml ** units/ml Example 5 Pattern of Protein Binding to an Ol~gAn~leotlde Probe Comprising the DNA Binding Region of a BRM Gene 10An electrophoretic mobility shift assay (EMSA) was used to compare the pattern of DNA bindi~g found in nuclear extracts of Tx-1 (AE.7) and Tx-2 (DlO.G41) mouse clones to that found in the nuclear extracts of splenic CD4~ T cells of normal mice and MCA-38-bearing mice at 1511, 18 and 32 days after administration of MCA-38 cells to the animal. Nuclear ~extracts were prepared by pelleting cells at 1200 rpm~for 5 min, washed once with cold phosphate buffered saline, and resn~pPn~Pd in lysis buffer ~25 mM Hepes, pH 7.8, 50 mM RCl, 0.5~ NP40 (v/v), 0.1 mM dithiothreitol) cnnt~;n;ng 1 mM PMSF and 1 ~g/ml leupeptin and aprotinin A as protease inhibitors. ~ells were lysed by incubating on ice for 5 min.
Lysates were centrifuged at 2000 rpm for 5 min, supernatant was collected as cytoplasmic extract, and the pellet was washed once with lysis buffer without NP40.
The pellet was resuspended in elution buffer (25 mM
Hepes, pH 7.8t 500 mM KCl, 10~ glycerol (v\v), 0.1 mM
dithiothreitol) c~ ;n;ng 1 ~M PMSF, and 1 ~g/ml leupeptin and àprotlnin A. The resuspended pellet was gently mixed by using an end-to-end mixer for 20 min at 4~C. Supernatant was collected after centrifuging at 14000 rpm for 3D min, and was dialyzed for~2 h against dialysis buffer (25 mM~Hepes, pH 7.8, 50 mM KCl, 10~
glycerol, 0.1 mM DDT, and 1 mM PMSF). Aliquots were ~uickly frozen in dry ice/ethanol and storPd at -70~C.

.. . .. . . .. , . . . , . ... _ . _ _ _ _ _ _ _ _ _ W096/03523 4l2 1 9 ~2 1 7 r~

A "P-labeled olirjnnnrleotide corrprrnn~;nri to the sequence of the human ~IFN gene promoter region was used as a probe. The nucleotide sequence of the oligonucleotide=probe used was (SEQ ID NO:3) 5' ~AAACTTGTGAAAATACGTAATCCTCAGGAGA 3' The assay was done by pre-incubating nuclear extract (2 ~g protein) in reaction buffer (10 ~l total volume) rnnt~;n;ng 20 mM Tris (ph 7.5), 60 mM KCl, 4~ Ficol, 2 mM
EDTA, 0.5 mM DTT, 1 ~g poly dIdC and with or without unlabeled competitors for 10 min at room temperature.
The l~h~lled oligonucleotide probe was then added to the reaction mixture and incubation cnntinn~ for 20 min.
The complexes were separated on a 4~ polyacrylamide gel with 44.5 mM tris-borate (pH 8.3) and 1 mM EDTA buffer.
After electrophoresis, the gel was dried and exposed to autoradiography.
Nuclear extracts (2 ~g protein) ~rom TH-1 and TH-2 clones were used in the assay. The competitor (100-fold molar excess) consisted of unlabeled oligonucleotide.
Nuclear extracts (2 ~g protein) from splenic CD4+ T cells o~ normal mice and mice bearing MCA-38 for 18 and 32 days were assayed in the same manner as the TH-1 and TH-2 nuclear extracts. Competitors (100-fold molar excess) used were unlabeled specific :and non-specific nl; gnnllrl eotiaes.
In the DNA-binding assay using nuclear extracts from Tx-1 cells, two specific DNA-protein complexes were obtained (Bands 1 and 2). Bands 1 and 2 were drastically reduced in the nuclear extract of TH-2 cells. Moreover, a new DNA-protein complex was observed in the TH-2 nuclear extract which was absent in TH-1 (Band 3).
Nuclear extracts (2 ~g protein) from splenic CD4f T
cells of normal mice and mice bearing MCA-38 for 11, 18 and 32 days were assayed in the=same manner as the TH-1 and TH-2 nuclear extracts. Two DNA-protein complexes were observed in the nuclear extracts from normal control mice that correspond to bands 1 and 2 of TH-1 cells.
Bands 1 and 2 progressively decreased in day 11, 18 and W096/03523 2 1 9 5 2 1 7 rc~
- 42 ~

32 MCA-38 tumor-bearing mice. A third D~A-protein complex was observed in day 11 tumor-bearing mice that correRpnn~Pd to band 3 in the TH-2 cells. However, band 3 progressively decreased in day 18 and day -32 tumor-bearing mice. Therefore the:pattern of protein binding to an oligonucleotide probe ~ that comprises a diagnostically significant portion of the protein binding region of the yIFN gene in MCA-38 tumor-bearing mice is neither equivalent to the TH-1-tyoe pattern of protein binding observed in normal control mice nor e~uivalent to the TH-2-type pattern of ~H-2 cells and therefore is characterized as TH-2'.
Accordingly, the pattern of protein bi~ding to an oligonucleotide probe that comprises all or a diagnostically significant portion of the protein binding region of a gene for a BRM can be used to identify patients having an altered immune status.
Example 6 Methylation Statua of Nucleotidea Within Regulatory Element of BRM Gene The mouse TH-1 clone D1_1 and the mouse:TH-2 clone CDC25 were obtained from Dr. Abul Abbas (Harvard Medical School) and Dr. David Parker (Univ. of Massachusetts), and are specific for rabbit gamma globulin in the context of IAd. The derivation of the TH-2 cell line DlO.G41, obtained from the American Type Culture Collec~ion (Rockville, MD) has been described_ Kaye (1983). Clone A.E7, a murine TH-1 clone, was obtained from Dr. Ronald Schwartz, NIH, and is specific for pigeon cytochrome c, H-2~. Clone LV3M (TH-1) was obtained from Dr. Louis Rizzo, National Eye Institute, and is specific for KLH, H-2d. Clones B10 (TH-1); 2A11 (TH-2); and A109 1 ~TH-2) are specific for St~ph~n~rotoxin B (SEB), H-2b;
(SEB/KLH, H-2d; and SEB, ~-2d; respectively. All mouse T
ceIl clones were stimulated every 2 weeks and rested for 7-10 days after stimulation before use. :
Human CD4 clones AD-14 and AD-20 were isolatea by direct limiting dilution cloning of peripheral blood CD4 W096/03523 2195217 r "~

T cells from healthy adult donors. CD4 T cells were isolated from peripheral blood. Lewis (1988). The CD4 T cells were seeded at l or 5 cells per well into 96-well round bottom plates that contained 10 x 105 irradiated adult p~riph~ral blood nn~lrlear cells (3000 rad) in CT.4S medium ~Hu-Li (1989)), supplemented with 3.1 ~g/ml Con A (Pharmacia, Piscataway, NJ), 0.5 ng/ml PMA (Sigma, St. Louis, MO), purified human IL-2, 5 U/ml (Boehringer-~nnh~;m), and 5 ng/ml recombinant human IL-2, kindly provided by Dr. Ken Grabstein, (Immunex Corp). Overlying medium (0.1 ml) was replaced with an er~ual volume of fresh IL-2 (5 U/ml, Boehringer-Mannheim) cnnt~ln~ng medium every 3-5 days. Growth positive wells were scored macroscopically at 3 wk and ~ ndrd in 12-well tissue culture plates by stimulation with Con A, IL-2 and feeder cells every 2-3 wk.
For ~IFN production analysis, cells were cultured at 1 x 105/ml in RPMI medium supplemented with 2 mM ~-glutamine and 10~ FCS and stimulated with 25 ~l of Con A
(Pharmacia) for 24 h. Supernatants were collected and frozen at -80~C until assayed for cytokine content by ELISA. Thymocytes were isolated by Ficoll~ Hypariue centrifugation frcm infants undergoing cardiac surgery.
Bewis=(lg91).
DNA from murine cells was extracted using r~ ni~1nlum isothiocyanate. Pange (1992). DNA was extracted from human cells using proteinase K (200 ~g/ml) digestion followed by phenol-chloroform extraction. Murine genomic DNA (5 or 7.5 ~g) was digested with 50 units of BamH 1 and 25 units of SnaB 1, or 50 units of BamH 1 followed by isopropanol precipitation and overnight digestion with either Mspl or HpaII. Human genomic DNA (10 ~g) was digested with 5D units of PvuII and 25 units of SnaB 1 (all restriction enzymes from Boehringer Mannheim).
After digestion overnight at 37~C in Boehringer-Mannheim M buffer, the DNA was subjected to agarose gel electrophoresis, transferred to Magnagraph nylon membranes (MSI, Westboro, MA), W crosslinked and baked W096/03523 2 1 9 5 2 1 7 E~l/~

of 1 h at 80~C. Murine and human DNA blots were hybridized with Nylohybe hybridization buffer (Digene, Inc., Silver Spring, MD) according to the manufacturer~s instructions. For Southern blots of murine DNA, the probe consisted of the full length murine yIFN cDNA. For human DNA blots, the probe consisted of a HindIII~SauI
human yIFN genomic fragment ~hat includes the first exon segment. Gray (1982).
EMSA was performed under standard conditions.
Norihisa (1994). For ~ethylation studies, the3~P-labeled oligonucleotide was incubated with CpG methylase (New English Biolabs) as re ~ A by the manufacturer.
The murine T~-l clone A.E7 and T~-2 clone DlO.G41 were transfected by electroporation l]t;1;7;nr a BioRad electroporation aevice at 270 volts, 960 microfarads.
Forty mi~LuyLd~ of DNA was utilized with 20 x 106 cells.
After electroporation, cells were rested overnight, then stimulated 24 h with plate bound anti-CD3. CAT activity was measured by the liquid ~rln~;llAtion CAT assay after 48 h ~ederer (1994).
Cell culture supernatants were analyzed for mouse yIFN ut;l;7;nr a commercially available E~ISA (Endogen, Minneapolis, MN) by Clinical T ~nrloqy Services, PRI/DynCorp, NCI-FCRDG. For measurement of human yIFN by ELISA, plates were coated with 5 ~g/ml murine anti-human yIFN mAb 20B8 (provided~ by Genentech, South San Francisco, CA) in 0.05 carbonate buffer (pH9.6) for 12-24 h at 4~C and blockea with PBS with 0.5% BSA and 0.05~
Tween-20 (EIA buffer). Samples were applied to wells for 2 h at room temperature.= Plates= were seruentially incubated with rabbit anti-rhyIFN serum (1:10~000 in EIA
buffer) (Genentech, South San Francisco, GA~ for 1 h, horseradish peroxidase-conjugated goat anti-rabbit Ig (1:5000 in EIA buffer, TAGO, Burllngame, CA). Wells were developed~by addition of TMB substrate solution as directed by the manufacturer (Kirkegaard and Perry, Gaithersburg, MD), and after 30-60 min ~.D. 650 was determined using a plate reader. ~I~-l clones selectively W096/03523 2 19 52 17 r~

produced ~IFN and IL-2 while TH-2 clones 3electively produced IL-4 and IL-5.
Southern blot analysis of murine T helper clones revealed the following. A SnaB 1 site lies just proximal to the first exon of the ~IFN gene and if the DNA is cut by BamH 1 and SnaB 1, a 5 kb DNA fragment should be revealed by Southern blot analysis using the ~IFN cDNA as a hybridization probe. DNA from each of the TH-1 and TH-2 clones was cut with BamH 1 alone revealirg the expected 1010 kb ~IFN genomic DNA. Gray (1982) DNA was extracted from the TH-1 clones Dl.1 and A.E7 and was completely cut by SnaB 1. Only a single band is present because the probe used for the hybrizaiton was the murine ~IFN cDNA
that does not hybridize to the 5-prime flank. DNA was 15isolated from Tx-2 clones D10 and CDC25 and was not cut by SnaB 1, indicating that the enzyme site is methylated in the TH-2 clones. Restriction enzyme analysis of two additional ;n~or~n~Pntly isolated TH-1 clones ~B10 and LV3M) produce the same restriction pattern as TH-1 clones 20D1.1 and A.E7. Restriction enzyme analysis of two additional independently isolated TH-2 clones ~A109.1 and 2All) produced the exact same restriction enzyme pattern as TH-2 clones D10.g41 and CDC25. Accordingly, Southern blot analysis revealed a correlation between the 25hypomethylation of the SnaB 1 site and ~IFN expression.
In an effort to determine if other sites within the ~IFN genomic DNA were also hypomethylated in TH-1 cells, DNA from two TH-1 clones and two TH-2 clones were digested with BamH 1 and Mspl or Hpa II ~CCGG recognition 30site). These sites are not located in introns and 5~
HpaII sites are approximately 1200 bp and 2600 bp upstream of the transcription initiation site. The DNA
from the TH-1 clones D1_1 and AE7 was digested differently by Hpa II than the DNA from the TH-2 clones 35D10.G41 and CDG25. The band pattern indicates that sites far upstream of the promoter (most likely -2600) were hypomethylated in TH-2 cells but not in the TH-1 cells.
In addition, the 0.5 kb band present in HpaII digests of W096l03523 21 ~521 7 r~

TH-1 but not T~-2 DNA indicates that at least 2 or 3 sites at the 3' end of the gene were hypomethylated in T~-1 but not T~-2 cells. The presence of a 2-3 kb band in the digestion could not be readily ~pl~;n~d, but may reflect the presence of an Msp/HpaII site in the third intron not predicted from the pllhl; R~ murine IFN-~genomic sequence or present in the genomic DNA clone.
Thus, hypomethylation of the entire ~INF genomic DNA does not occur in T~-1 cells and T~-1 and T~-2 cell lines exhibit specific methylation differences.
Southern blot analysis of human T lymphocyte clones was undertaken to determine if hypomethylation of the SnaB 1 site also correlated with ~IFN gene expression in two adult CD4+ human T-cell clones AD-14 and AD-20.
Total genomic DNA was isolated from the CD4+ clones and human thymocytes. The thymocyte DNA digested with either PvuII or PvuII and SnaB 1 produced a single band of 6.7 kb when probed with the HindIII/SauI human ~IFN genomic fragment that includes the first exon segment. Digestion of AD-14 DNA with PvuII and SnaB 1 produced a single band of 2_6~kb. Digestion of AD-20 D~ wlth PvuII and SnaB 1 followed by hybridization with the Hi~dII/Sau I fragment produced 2 bands measuring 2.6 and 6.7 kb. Accordingly, the CD4+ human T cell clones were cleaved by SnaB 1 and this is consistent with the ability of these cells to produce ~IFN mRNA. Protein analysis after 24 h stimulation with anti-CDl antibody resulted in 3890 pg/ml and 69 pg/ml of ~IFN from clones AD-14 and AD-20 but less than 20 pg/ml from whole thymocytes, demonstrating a rough correlation between levels of ~IFN produced and extent of SnaB 1 cleavage. ~ ~
Based on these results, it was next determined if specific DNA-protein complexes could be formed with an oligonucleotide ~nn~;n;ng this methylation site and if methylation in vi~ro might affect the ability of DNA
binding proteins to interact with this site in the ~IFN
promoter. The EMSA assays were performed using nuclear extracts from the murine T~-1 clone D1.1.

W096/03~23 21 9521 7 r~ . 4 ~ - 47 -A 3IP-labeled oligonucleotide corresponding to the sequence of the ~IFN gene promoter region was used as a probe. The nucleotide sequence of the oligonucleotide probe used was ~SEQ ID NO:3) 5~ AAAACTTGT~ .TAATCCTCAGGAGA 3' This is the -71 to -40 region of the human 1IEN promoter.
This region is identical to that of the mouse promoter ~-69 to -40) with one important difference. The mouse promoter cnnt~in~ an additional CpG dinucleotide at positions -48 and -47 while the human promoter c~ntA;n~
a TC at this location. Thus, by using the human promoter, the only CG ~;nnrleotide in the oligonucleotide is in the SnaB 1 site.
At least five specific complexes were observed with an oligomer c~nt~;n;ng the ~IEN SnaB 1 site in the D1.1 nuclear extracts. These complexes appeared to be specific as loss of binding was observed when cold o';rJ~nllrleotide was added ag the competitor, but not when an oligonucleotide r~n~;n;ng an Spl site was added as the competitor. Treatment of the cells with anti-CD3 bound to plates for 18 h did not result in any increase in the levels or numbers of complexes. In addition, mutation of the C to T results in decreased levels of three of the complexes indicating that the C plays a role in the formation of these complexes.
Bands 1-4 observed in the nuc~ear extracts of the D1.1 cells apparently correspond to bands 1-3 observed in the TH-1 ~AE.7) and TH-2 ~DlO.G41) mouse clones because bands 2 and 3 of the D1.1 cells appear to be a doublet of band 2 of the AE.7 and DlO.G41 cells. The difference in the protein binding pattern between TH-1 clones D1.1 and AE.7 may be the result of cell culturing.
In order to determine if methylation of the CpG
affected the protein complexes, the oligonucleotide was methylated ln vitro utilizing a commercially available CpG methylase. Specific binding in 3 of the 5 ~
was lost after methylation. However, not all complexes were lost indicating that this specific methylation did W09~03523 ~1 9 5 2 1 7 F~~ . 4 not totally block all protein interaction with the oligonucleotide. This inhibition was not the result of the methylase binding to the DNA as, in a mock reaction in which the S-adenosylmeth;~n;n~ was omitted, no loss of DNA-protein complex formation as observed.
As these results suggest that introduction of a non-methylated yIFN promoter into a TE-2 cell line might result in transcriptional activity, the full length ~IFN
promoter linked to the CAT ge~e was transiently transfected into the TH-1 clone A.B7 and the Tu-2 clone DlO.G41. Transfection into A.E7 resulted in CAT activity almost 3-fold higher than seen with the pCAT vector alone, and this activity was not increased by anti-CD3 treatment of the cells. This same plasmid was very weakly active and also not ; n~ur; hl e upon transfection into the TH-2 clone DlO.G41. As this DNA is unlikely to become methylated in a transient transfection assay, these results are consistent with the hypothesis that in addition to methylation differences, T~-2 cells may have quantitative and/or qualitative ~; ~f~r~n~ in specific DNA binding proteins as compared to T~-l cells and that additional proteins and regulatory regions may be required for in~n~;h1e ~IFN gene expression.
It was previously shown that treatment with 5-25 azacytidine of a murine T-cell line~and~Hut78 cells resulted in these cells reacquiring the~capacity to produce ~IFN. Farrar (1985). Hardy (1985). To determine if inhibition of DNA methylation in the TH-2 cells could result in an activation of ~IFN gene expression, two T~-2 clones were treated with anti-CD3 prior to, or after treatment with, 5-azacytidine and culture supernatants were analyzed for yIFN by E~ISA.
The 5-azacytidine treatment did result in anti-CD3 induced expressio~ of ~IFN by the clones after:48 h, consistent with the hypothesis that methylation of specific regions of the genomic D~A is involved in the control of ~IFN mRNA expression. The production of ~IFN
-~ W096/0~ 2 1 9 52 1 7 r~~

by one of the clones was comparable to that observed with TH-1 cells treated with anti-CD3.
Methylation of specific regions of the DNA is an important ~nh~n;Pm for the control of ~IFN gene expression in T lymphocytes. Indeed, if ~H-0 cells, which express ~IFN, are precursors of TH-1 and TH-2 cells, the data indicate that remethylation of the promoter of the ~IFN gene is triggered by an as yet unknown I ~hAn;s~ during the differentiation process towards a TH-2 phenotype. l'hese findings do not imply that methylation or the lack of methylation of DNA at the SnaB 1 site and/or other sites in the ~IFN gene is the only ~nhAn;r~ by which the potential for ~IFN expression in T cells iB controlled. There are multiple regions in the promoter and first intron of the yIFN gene that contribute to control of tissue-specific and activation-specific expression.
The failure to observe increased CAT activity in the TH-1 clone, A.F7, after anti-CD3 treatment suggests strongly that other regions, perhaps intronic, also are required for-fu11 promoter activity. Demethylation of specific regions of the gene may be a nrrr.qsAry event that permits accessibility of basal regulatory proteins, permitting ~nhAnrP~ gene expressior after addition DNA
binding proteins are induced by T-cell activation.
Additionally, demethylation may activate expression of transcription factors encoded outside of the ~IFN genetic locus required for maximal ~IFN gene expression. The observation that TH-2 cells rnntA;n h;rhrr levels of one of the protein complexes than observed in TH1 cells suggest that possibly additional or modified proteins, ;nnll1~;nr transcriptional repressors, may bind to specific ~ regions of the promoter and inhibit transcription.
Accordingly, a method of identifying patients having an altered immune status comprises determining, in a lymphocyte preparation from a patient being evaluated, the methylation status of nucleotides within the W096/03523 '~ 21 ~521 7 r~ 14 regulatory element of a BRM~gene; and determining, in a lymphocyte preparation from one or mo~e healthy individuals, the methylation status of nucleotides within said regulatory element of a BRM gene. The methylation status in the patient's lymphocyte preparation is compared to said methylation status in the healthy individual's lymphocyte preparation and a significant variation thereof is an indication of an altered immune status in said patient.
Ex~mple 7 Density Gradient Assay Xuman peripheral blood lymphocytes were obtained by methods well known in the art. The red blood cells in a sample of peripheral flood were lysed in SCR buffer and the cell debris removed by means of centrifugation.~l The " in;ng cells were placed over a disr~ntim~n~ Percoll~
gradient prepared in the following manner. Each fraction of the gradient is prepared in RPMI 1640 supplemented with 2~ Fetal Calf Serum, glutamine, penicillin, streptomycin and 5mM Hepes. The osmolarity of the medium is adjusted to 280 to 285 mOsm/kg H20. The osmolarity of the Percoll~ is adjusted to 285 mOsm/kg H20 with 10x ~n~ntrated ~ss. The gradient is prepared in Falcon 2095 15 ml conical test tubes as follows:
25 Medium (ul) Eraction Pe~colll (ul~_ Volume (ml~
3,550 1 2,450 2.5 3,440 2 2,660 2.5 3,250 3 2,750 2.5 3,100 4 2,900 1.5 2,950 5 3,050 1.5 2,800 6 3,200 1.5 2,000 7 4,000 1.5 The refractive Index at 25~C of fr~t;onq 1, 2, 3, 4, 5, 6, and 7 is 1.3432, 1.3436, 1.3440, 1.3443, 1.3446, 1.3450 and 1.3470, respectively.
50 X lo6 cells were carefully layered on top of the gradient to avoid mixing, and the tubes were centrifuged 09~03523 at 550 g for 30 min. at room temperature in a ~eckman T~-6 table centrifuge.
Following centrifugation, six discrete bands were observed. T lymphocytes from healthy individuals were pr~( ;n~ntly found i~ Fraceion 6 (F6), although a small number of T lymphocytes were found in Fraction 3 (F3).
Monocytes are prP~ in~tely found in Fraction 1 (Fl) and NX cells and LGLs are predominately found in Fraction 2 (F2).
The F6 cells were stimulated with anti-CD3 antibody for 1 h and the nuclear proteins in the stimulated cells were analyzed. The proteins p65 and c-Rel were detectable in the nucleus of stimulated F6 cells but not in unst;mnlst~d F6 cells. An increased amount of p50 protein was detectable in the nucleus of stimulated F6 cells compared to unstimulated F6 cells.

In contrast, the T lymphocytes from human ~ n~
and renal cell carcinoma patients were pr~ 'n~ntly found in F3 following density gradient centrifugation in Percoll~ under the same conditions. The F6 T lymphocytes were stimulated with anti-CD3 for 1 h. The proteins p65 and c-Rel were not detectable in the nucleus of stimulated F6 cells from these patients. Likewise, there was no increase in the amount of p50 in the nucleus of 5tlmnl~t~ F6 cells from the patients.
Accordingly, an immune status index is the pattern of distribution of T lymphocytes in a density gradient.
More specifically, an immune status index is the ratio of T lymphocytes in F3 to F6, as measured by cell number or total protein. A change in the pattern of distribution of T lymphocytes in the density gradient, or in the F3/F6 ratio in the patient, compared to healthy controls, is diagnostic of a change in the immune status index of the patient.
3~ CITFD DO~u ~
The references listed below are incorporated herein by reference to the extent that they supplement, explain, W096/03523 2 1 q 5 2 1 7 P~~
- 52 - ~

provide a background for, or teach methodology, techni~ues, and/or compositions employed herein.
Baeuerle, P.A., Biophysica Acta 1072:63-80 (1991).
Berridge, C.B. et al., Nature 341:197 (1989).
Blumberg, R.S. et al., Proc. Natl~ Acad. Sci. USA
87:7220 (1990).
Coligan, J.E., Vol. I. Current Protocols in Immunology, Green ~nh1;ch;ng Associates and Wiley-Interscience, 2.4.1-2.I0.3 (1991).
Farrar et al., J. Immunol. 135: 1551 (1985).
Gray et al., Nature 298: 859 (1982).
Hardy et al., Proc. Natl. Acad. sci. USA 82: 8173 (1985).
Hsi, E.D. et al., ~. Biol. Chem. 264:10836 (1989).
Hm-Li et al., J. Immunol. 42:800 (1989).
Imboden, J.B. et al., J. Exp. Med. 161:446 (1985).
June, C.H et al., J. Immunol. 144:1591 (1990).
Kaye et al., J Exp. ~ed. 158:836 (1983).
Klausner, R.D., New Biol. 1:3 (1989).
Kl~nqn~r, R.D. et al., Annu. Rev Cell ~iol. 6:403 (1990).
Rl~ncnor, R.D. et al., Cell 64-875 (1991).
Koning, F. et al., Eur. J. Immunology 20:299 (1990).
Lederer et al., J. Immunol. 152: 77 (1994).
Lewis et al., Proc. Natl. Acad. Sci. USA 85:974 (1988).
Mizoguchi et al., Science 258:1795 (1992).
Munoz et al., Proc. Natl. Acad Sci. USA 86:9461 (1989).
Norihisa et al., J. Immunol. 152: 485 (1994).
Novak et al., Proc. Natl Acad. Sci. USA 87:9353 (1990). ~ :
Patel, M.D. et al , J. Biol. Chem. 262-5831 ~1987).
Pang et al. Blood 80:724 (1992).
Samelson, ~.E. et al., Cell 46:1083 (1986).
Samelson, L.E. et al., Proc. Natl. Acad. sci. USA
87:4358 (1990). ~ - ~

W096/0~
~ - 53 -Sites, D.P. et al., Ohapter 22 o~ Basic and Clinical Immunology 4th ed. Lange Medical Publications o~ Los Altos, rA1if~)rn;A (1982).
Weiss, A. et al., Proc. Natl. Acad. sci. USA 81:4169 (1984).
U.S. Patent No. 5,246,831 W 096l03523 2 1 9 5 2 1 7 . ~ v5 SEQ~EN OE ~ISTING

(1) GENERAL INFORMATION:
(i) APPLIÇANTS: UNITED STATES OF AMERICA, AS ~ J BY
T~E SECRETARY DEPARTMENT OF HEALTH AND HUMAN SERVICES
AND
ONCOTHERAPEUTICS, INÇ.
(ii) TITLE OF INVENTION: METHODS OF ~ Yl~ PATIENTS HAVING
ALTERED IMMUNE STATUS
(iii) NUMBER OF SEQUENCES: 3 (iv) C~ D~ ADDRESS:
A) ADDRESSEE: Foley & Lardner B) STREET: 3000 X Street, N.W., Suite 500 C) CITY: ~ashinyton, D.C.
E) COUNTRY: USA
,F) ZIP: 20007-5109 ~v) COM?UTER READABLE FORM:
A MEDIUM TYPE: Floppy disk Bl COMPUTER: IBM PC ~ -;hlP
C OPERATING SYSTEM: PC DOS/MS-DOS
D SOFTWARE: PatentIn ReleaDe #1.0, Version #1.25 (vi) CURRENT APPLICATION DATA:
(A) APPLIÇATION = ER:
(B) FILING DATE:
(C) CLASSIFICATION:
(viii) ATTOENEY/AGENT INFORMATION:
(A) NAME: SAXE, Bernhard D.
(B) REGISTRATION = ER: 28,665 (C) EEFEREN OE /DOCXET = ER: 40403/157/ONCO
~ix) TEL~._.J~l~ATION INFORMATION:
(A) TELEPHONE: (202)672-5300 (B) TELEFAX: (202)672-5399 ~C) TELEX: 904136 (2) INFORMATION FOR SEQ ID NO:l:
ii) SEQUENCE r~o~rT~o~cTIcs:
~A) LENGTH: 14 amino acidD
(B) TYPE: amiro acid (D) TOPOLOGY- linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:l:

Ars Arg Ary Gly DyD GIy His Asp Gly Deu Tyr Gln Gly ÇyD

W 096/03523 2 1 9 5 2 1 7~

(2) INFORMATION FOR SEQ ID NO:2:
(i) SEQUENCE rU~a~
(A) LENGTH: 15 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide A
(xi) SEQUENCE ~C~l~l~: SEQ ID NO:Z:
Asp Thr Tyr Asp Ala Leu His Met Gln Thr Leu Ala Pro Arg Cys (2) INFORMATION FOR SEQ ID NO:3:
(i) SEQUENCE ~u~R~rTRRTqTIcs:
~A~ LENGTH: 32 base pairs 3I TYPE: nucleic acid C STR~mRnNRC.q: ~ingle D TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:
AAAACTTGTG ~ T~rGT~ ATCCTCAGGA GA 32

Claims (27)

WE CLAIM:

1. A method of identifying patients having an altered immune status, said method comprising the steps of:
a. determining, in a lymphocyte preparation from a patient being evaluated, an immune status index for said patient that is the ratio of the amount of a TCR subunit protein whose integration in the TCR subunit is abnormally high or low in a patient having an altered immune status, to the amount of a TCR subunit protein whose integration in the TCR subunit is substantially unchanged in a patient having an altered immune status;
b. determining, in a lymphocyte preparation from one or more healthy individuals, an immune status index that is the ratio of the amount of said TCR subunit protein whose integration in the TCR subunit is abnormally high or low in a patient having an altered immune status, to the amount of said TCR subunit protein whose integration in the TCR subunit is substantially unchanged in a patient having an altered immune status; and c. comparing said patient's immune status index with said immune status index for healthy individuals, a significant variation thereof being an indication of an altered immune status in said patient.

2. The method of claim 1, wherein said TCR subunit protein whose integration in the TCR subunit is abnormally high or low in a patient having an altered immune status is CD3~ or Fc.epsilon..gamma..

3. The method of claim 1, wherein said TCR subunit protein whose integration in the TCR subunit is substantially unchanged in a patient having an altered immune status is CD3.epsilon. or TCR.alpha..beta..

4. A method of identifying patients having an altered immune status, said method comprising the steps of:
a. determining, in a lymphocyte preparation from a patient being evaluated, an immune status index for said patient that is the ratio of the amount of a T lymphocyte signal transduction pathway protein that is abnormally high or low in a patient having an altered immune status, to the amount of a protein that is substantially unchanged in a patient having an altered immune status;
b. determining, in a lymphocyte preparation from one or more healthy individuals, an immune status index that is the ratio of the amount of said T lymphocyte signal transduction pathway protein that is abnormally high or low in a patient having an altered immune status, to the amount of said protein that is substantially unchanged in a patient having an altered immune status; and c. comparing said patient's immune status index with said immune status index for healthy individuals, a significant variation thereof being an indication of an altered immune status in said patient.

5. The method of claim 4, wherein said T lymphocyte signal transduction pathway protein that is abnormally high or low in a patient having an altered immune status is Lck or PLC.gamma..

6. The method of claim 4, wherein said protein that is substantially unchanged in a patient having an altered immune status is a TCR subunit protein whose integration in the TCR subunit is substantially unchanged in a patient having an altered immune status.

7. The method of claim 6, wherein said TCR subunit protein whose integration in the TCR subunit is substantially unchanged in a patient having an altered immune status is CD3.epsilon. or TCR.alpha..beta..

8. A method of identifying patients having an altered immune status, said method comprising the steps of:
a. determining, in a lymphocyte preparation from a patient being evaluated, an immune status index for said patient that is the ratio of the amount of a biological response modifier (BRM) that is abnormally high or low in a patient having an altered immune status, to the amount of a protein that is substantially unchanged in a patient having an altered immune status;
b. determining, in a lymphocyte preparation from one or more healthy individuals, an immune status index that is the ratio of the amount of said BRM that is abnormally high or low in a patient having an altered immune status, to the amount of said protein that is substantially unchanged in a patient having an altered immune status; and c. comparing said patient's immune status index with said immune status index for healthy individuals, a significant variation thereof being an indication of an altered immune status in said patient.

9. The method of claim 8, wherein said BRM that is abnormally high or low in a patient having an altered immune status is selected from the group consisting of IL-2, .gamma.IFN, IL4, IL5, IL6, IL10 and IL12.

10. The method of claim 9, wherein said protein that is substantially unchanged in a patient having an altered immune status is a TCR subunit protein whose integration in the TCR subunit is substantially unchanged in a patient having an altered immune status.

11. The method of claim 10, wherein said TCR subunit protein whose integration in the TCR subunit is substantially unchanged in a patient having an altered immune status is CD3.epsilon. or TCR.alpha..beta..

12. A method of identifying patients having an altered immune status, said method comprising the steps of:
a. determining, in a lymphocyte preparation from a patient being evaluated, an immune status index for said patient that is the ratio of the amount of a TH1-type BRM to the amount of a TH2-type BRM;
b. determining, in a lymphocyte preparation from one or more healthy individuals, an immune status index that is the ratio of the amount of a TH1-type BRM to the amount of a TH2-type BRM; and c. comparing said patient's immune status index with said immune status index for healthy individuals, a significant variation thereof being an indication of an altered immune status in said patient.

13. The method of claim 12, wherein said TH1-type BRM is IL-2 or .gamma.IFN, and the TH2-type BRM is selected from the group consisting of IL4, IL5, IL-6 and IL10.

14. A method of identifying patients having an altered immune status, said method comprising the steps of:
a. determining, in a lymphocyte preparation from a patient being evaluated, an immune status index for said patient that is the ratio of the amount of a DNA binding protein that is abnormally high or low or in a patient having an altered immune status, to the amount of a protein that is substantially unchanged in a patient having an altered immune response;
b. determining, in a lymphocyte preparation from one or more healthy individuals, an immune status index that is the ratio of the amount of said DNA binding protein that is abnormally high or low in a patient having an altered immune status, to the amount of said protein that is substantially unchanged in a patient having an altered immune status; and c. comparing said patient's immune status index with said immune status index for healthy individuals, a significant variation thereof being an indication of an altered immune status in said patient.

15. The method of claim 14, wherein said amount of DNA binding protein that is abnormally high or low in a patient having an altered immune status is determined for the nuclear or the cytoplasmic fraction of the cells in said lymphocyte preparation.

16. The method of claim 14, wherein said DNA binding protein that is abnormally high or low in a patient having an altered immune status is a DNA-binding component of NF-KB or rel.

17. The method of claim 14, wherein said protein that is substantially unchanged in a patient having an altered immune status is a TCR subunit protein whose integration in the TCR subunit is substantially unchanged in a patient having an altered immune status.

18. The method of claim 17, wherein said TCR subunit protein whose integration in the TCR subunit is substantially unchanged in a patient having an altered immune status is CD3.epsilon. or TCR.alpha..beta..

19. A method of identifying patients having an altered immune status. said method comprising the steps of:
a. determining, in a lymphocyte preparation from a patient being evaluated, an immune status index for said patient that is the ratio of the amount of a DNA binding protein in the cytoplasm of cells in said lymphocyte preparation to the amount of said DNA
binding protein in the nucleus of cells in said lymphocyte preparation;
b. determining, in a lymphocyte preparation from one or more healthy individuals, an immune status index that is the ratio of the amount of said DNA binding protein in the cytoplasm of cells in said lymphocyte preparation to the amount of said DNA
binding protein in the nucleus of cells in said lymphocyte preparation;
and c. comparing said patient's immune status index with said immune status index for healthy individuals, a significant variation thereof being an indication of an altered immune status in said patient.

20. The method of claim 19, wherein said DNA binding protein is NF-KB or c-rel.

21. A method of identifying patients having an altered immune status, said method comprising the steps of:
a. determining, in a lymphocyte preparation from a patient being evaluated, the pattern of protein binding to an oligonucleotide probe that comprises all or a diagnostically significant portion of the protein binding region of a gene for a BRM;
b. determining, in a lymphocyte preparation from one or more healthy individuals, the pattern of protein binding to an oligonucleotide probe that comprises all or a diagnostically significant portion of the protein binding region of said gene for a BRM;
and c. comparing said pattern of protein binding to said oligonucleotide probe in the patient's lymphocyte preparation, to said pattern of protein binding to said oligonucleotide probe in the healthy individual's lymphocyte preparation, a significant variation thereof being an indication of an altered immune status in said patient.

22. The method of claim 21, wherein said BRM is selected from the group consisting of .gamma.IFN, IL-2, IL-4, IL-5, IL-6, IL10 and IL12.

23. The method of claim 21, wherein said lymphocyte preparation is prepared from fluid or tissue selected from the group consisting of spleen tissue, peripheral blood, tumor tissue, lymph node tissue, cerebrospinal fluid, pleural effusions and ascites.

24. The method of claim 22, wherein said oligonucleotide probe has the DNA sequence 5'AAAACTTGTGAAAATACGTAATCCTCAGGAGA 3'.

25. A method of identifying patients having an altered immune status, said method comprising the steps of:
a. determining, in a lymphocyte preparation from a patient being evaluated, the methylation status of nucleotides within the regulatory element of a BRM gene;
b. determining, in a lymphocyte preparation from one or more healthy individuals, the methylation status of nucleotides within said regulatory element of a BRM gene; and c. comparing said methylation status in the patient's lymphocyte preparation, to said methylation status in the healthy individual's lymphocyte preparation, a significant variation thereof being an indication of an altered immune status in said patient.

26. The method of claim 25, wherein said nucleotides within said regulatory element of a BRM gene are the CpG
dinucleotide contained within the TATA-proximal regulatory element of the human .gamma.IFN gene.

27. A method of identifying patients having an altered immune status, said method consisting essentially of:
a. determining, in a lymphocyte preparation from a patient being evaluated, the pattern of distribution of T lymphocytes in a density gradient following density gradient centrifugation;

b. determining, in a lymphocyte preparation from one or more healthy individuals, the pattern of distribution of T lymphocytes in a density gradient following density gradient centrifugation; and c. comparing said patient's pattern of T
lymphocyte distribution with said pattern of T lymphocyte distribution for healthy individuals, a significant variation thereof being an indication of an altered immune status in said patient.