CA2216990A1 - Human g-protein chemokine receptor hdgnr10 - Google Patents

Description

._ :

E~AN G-PRO~EI~ OE E~O~INE RE~ ~DG~R10 This invention relates to newly ideneified polynucleotides, polypeptides encoded by such polynu-leotides, the use of such polynucleotides and, polypeptides, as well as the production of such polynucleotides and polypeptides. More particularly, the polypeptide of the present invention is a human 7-tr~nF~mhrane receptor which has been putatively identified as a chemokine receptor, sometimes hereinafter referred to as "G-Protein Chemokine Receptor" or n~n~l O n . The invention also relates to inhihiting the action of such polypeptides.
It i8 well established that many medically significant biological processes are mediated by proteins participating in signal. transduction pathways that involve G-proteins and/or second messengers, e.g., cAM~ (Lefkowitz, Nature, 351:353-354 (1991)). Herein these proteins are referred to a~ proteins participating in pathways with G-proteins or PPG
proteins. Some examples of these ?roteins include the GPC
receptors, such as those for adrenergic agents and dopamine (Robilka, B.~., et al., PN~S, 84:46-50 (1987); ~obilka, B.~., et al., Science. 238:650-656 (1987); Bunzow, J.R., et al., Nature, 336:783-787 ~1~88)), G-proteins themsel~es, ef~ector proteins, e.g., phospholipase C, adenyl cyclase, and phosphodiesterase, ar.d actuator proteins, e.g., protein kinase A and protein kinase C (Simon, M.I., et al., Scienc~ 7 252:802-8 (lg91)).
~or example, in one form of signal transduction, the effect of hormone binding is activation of an enzyme, adenylate cyclase, inside the cell. EnzymP activation by hormones is dependent on the presence of the nucleotide GTP, and Grp al50 influences hormone hin~iing. A G-protein connects the hormone receptors to adenylate cyclase. G-protein was shown to exchange GTP for bound GDP when activated by hor~one receptors. The GTP-carrying form then binds to an activated adenylate cyclase. Hydrolysis of GTP
to GDP, catalyzed by the G-protein itself, returns the G-protein to its basal, inactive form. Thus, the G-protein serves a dual role, as an intermediate that relays the signal from receptor to effector, and as a clock that controls the duration of the signal.
The membrane protein gene superfamily of G-protein coupled receptors has been characterized as having seven putative tr~n~ ~ hLdne ~m-tnc. The ~m~ins are believed to represent tr~nslF h~dne a-helices connected by extracellular or cytoplasmic loops. G-protein coupled receptors include a wide range of biologically active receptors, such as hormone, viral, growth factor and neuroreceptors.
G-protein coupled receptors have been characterized as including these seven conserved hydrophobic stretches of about 20 .to 30 ~m~no acids, connecting at least eight divergent hydrophilic loops. The G-protein family of coupled receptors includes dop~mine receptors which bind to neuroleptic drugs used for treating psychotic and neurological disorders. Other examples of members of this family include calcitonin, adrenergic, endothelin, cAMP, adenosine, muscarinic, acetylcholine, serotonin, hist~m;ne, thrombin, kinin, follicle stimulating hormone, opsins, endothelial differentiation gene-l receptor and rhodopsins, odorant, cytomegalovirus receptors, etc.

, G-protein coupled receptors can be intraceilularly coupled by heterotrimeriC G-proteins to various intracellular enzymes, ion channels and transporters (see, Johnson~ et al., Endoc., Re~., 10:317-331 (1989)). Different G-protein ~-subunits preferentially 5timulate particular effectors to modulate various biological functions in a cell.
Phosphorylation of cytoplasmuc residues of G-protein coupled receptors have been identified as an important mechanism for the regulation of G-protein coupling of some G-protein coupled receptors. G-protein coupled receptors are found in numerous sites within a m~m~l ian host.
Chemokines, also referred to a~ intercrine cytokines, are a subfamily of structurally and functionally related cytokines. These molecules are 8-10 kd in size. In general, chemokines exhibit 20% to 75~ homology at the amino acid level and are characterized by four conserved cysteine residues that form two di6ulfide bonds. Based on the arrangement of the first two cysteine residues, chemokines have been cla~sified into two subfamilies, alpha and beta.
In the alpha subfamily, the first two cysteines are separated by one amino acid and hence are referred to as the "C-X-C"
subfamily. In the beta subfamily, the two cysteines are in a~ adjacent po~ition and are, therefore, referred to a~ the nc-~" subfamily. Thus far, at least nine different members of this family ha~e been identified in hlm~nc The intercrine cytokine6 Pyhihit a wide ~ariety of functionfi. A hallmark feature i8 their ability to elicit chemotactic migration of distinct cell types, including monocytes, neutrophils, T lymphocytes, basophils and fibroblasts. Many chemokines have proinflammatory activity and are invol~ed in multiple steps during an inflammatory reaction. These activities include stimulation of histamine relea~e, ly~osomal enzyme and leukotriene release, increased adherence o~ target immune cells to endothelial cell~, enhanced binding of complement proteins, induced expression of granulocyte adhesion molecules and complement receptors, and respiratory bur8t. In addition to their involvement in inflammation, certain chemokines have been shown to exhibit other activities. For example, macrophage inflammatory protein 1 (MIP-l) is able to suppress hematopoietic stem cell proliferation, platelet factor-4 (PF-4) is a potent inhibitor of endothelial cell growth, Interleukin-8 (IL-8) promotes proliferation of keratinocytes, and GR0 is an autocrine growth factor for m~lAnom~ cells.
In light of the diverse biological activities, it is not surprising that chemokines have been implicated in a number of physiological and disease conditions, including lymphocyte trafficking, wound~ healing, hematopoietic regulation and ;mmmological disorders such as allergy, asthma and arthritis.
In accordance with one aspect of the present invention, there are provided novel mature receptor polypeptides as well as biologically active and diagnostically or therapeutically useful fragments, analogs and derivatives thereof. The receptor polypeptides of the present invention are of human origin.
In accordance with another aspect of the present invention, there are provided isolated nucleic acid molecules encoding the receptor polypeptides of the present invention, including mRNAs, DNAs, cDNAs, genomic DNA as well as antisense- an~logs thereof and biologically active and diagnostically or therapeutically useful fragments thereaf.
In accordance with a further aspect of the present inve~tion, there are provided processes for producing such receptor polypeptides by recomhin~nt techniques comprising culturing recombinant prokaryotic and~or eukaryotic host cells, cont~ining nucleic acid sequences encoding the receptor polypeptides of the present i~vention, under conditions promoting expression of said polypeptides and subsequent recovery of said polypeptides.

. CA 02216990 1997-11-27 . , .

In accordance with yet a further aspect of the present invention, there are provided antibcdies against such receptor polypeptides.
In accordance with another aspect of the present invention there are provided methods of screening for compounds which bind to and activate or inhibit aceivation of the receptor polypeptides of the present invention.
In accor~nce with still another embodiment of the present invention there are provided processes of a~ministering compounds to a ho6t which ~ind to and activate the receptor polypeptide of the present invention which are useful in sti~ll~ting haematopoiesis, wound healing, coagulation, angiogenesis, to treat solid tumors, chronic infections, leukemia, T-cell mediated auto-immune diseases, parasitic infections, psoriasis, and to stimulate growth factor activity.
In accordance -with another aspect of the pre~ent invention there is provided a method of ~mi n; stering the receptor polypeptides of the present invention via gene thera~y to treat conditions related to underexpression of the polypeptides or underexpression of a ligand for the receptor polypeptide.
In accordance with still another ~mhg~i m~nt of the present in~ention there are provided processes of ~ministering compounds to a host which bind to and inhibit activation of the receptor polypeptide~ of the present invention which are useful in the prevention and/or treatment of aller~y, atherogenesis, ~n~phylaxis, malignancy, chronic and acute inflammation, histamine and IgB-mediated allergic reactions, prostagl~n~n-independent fever, ~one marrow failure, 8ilic08i5, sarcoidosis, rheumatoid arthritis, shock and hyper-eosinophilic syndrome.
In accordance with yet another aspect of_the present invention, there are provided nucleic acid probes comprising nucleic acid molecuIes of s~fficient length to specifically hybridize to the polynucleotide sequences of the present invention.
In accordance with still another aspect of the present invention, there are provided diagnostic assays for detecting diseases related to mutations in the nucleic acid sequences encoding such polypeptides and for detecting an altered level of the soluble form of the receptor polypeptides.
In accordance with yet a further aspect of the present invention, there are provided processes for utilizing such-receptor polypeptides, or polynucleotides encoding such polypeptides, for in-vitro purposes related to scientific research, synthesis of DNA and manufacture of DNA vectors.
These and other aspects of the present invention should be apparent to those skilled in the art from the teachings herein.
The following drawings are illustrative of embodiments of the invention and are not meant to limit the scope of the invention as encompassed by the claims.
Figure 1 shows the cDNA sequence and the corresponding deduced amino acid sequence of the G-protein coupled receptor of the present invention. The standard one-letter abbreviation for amino acids is used. Sequencing was performed using a 373 Automated DNA sequencer (Applied Biosystems, Inc.).
Figure 2 illustrates an amino acid alignment of the G-protein chemokine receptor of the present invention and the human MCP-1 receptor.
In accordance with an aspect of the present invention, there is provided an isolated nucleic acid (polynucleotide) which encodes for the mature polypeptide having the deduced amino acid sequence of Figure 1 (SEQ ID NO:2) or for the mature polypeptide encoded by the cDNA of the clone deposited as ATCC Deposit No. 97183 with the American Type Culture Collection, 12301 Parklawn Drive, Rockville, Maryland, 20852, United States of America, on June 1, 1995.
The polynucleotide of this invention was discovered in a cDNA library derived from human monocytes. It is . .

structurallv related to the G protein-coupled receptor family. It cont~inC an open reading frame encoding a protein of 3S2 amino acid residues. The protein exhibits the highest degree of homology to a human MCP-l receptor with 70.1 %
identity and 82.9 % simil~rity over a 347 amino acid stretch.
The polynucleotide of the present invention may be in the form of RNA or in the form of DNA, which DNA includes cDNA, genomic DNA, and synthetic DNA. The DNA may be double-stranded or single-stranded, and if single stranded may be the coding strand or non-coding ~anti-sense) strand. The coding sequence which encodes the mature polypeptide may be identical to the coding sequence shown in Figure 1 (SBQ ID
NO:l) or that of the deposited clone or may be a different coding sequence which coding sequence, as a result of the re~--n~ncy or degeneracy of the genetic code, encodes the-same mature polypeptide a~ the DNA of Pigure 1 (SBQ ID NO:l)~
or the deposited cDN~.
The polynucleotide which encodes for the mature polypeptide of ~igure 1 or for the mature polypeptide encoded by the deposited CDNA may include: only the coding sequence for the mature polypeptide; the coding sequence for the mature polypeptide and additional coding sequence such as a tr~n~emhrane (TM) or intra-cellular ~ in; the coding sequence for the mature polypeptide (and optionally additional coding sequence) and non-coding sequence, such as introns or non-coding sequence 5' and/or 3' of the coding sequence for the mature polypeptide.
Thus, the term "polynucleotide encoding a polypeptide n encomr~ses a polynucleotide which includes only coding sequence for the polypeptide a~ well as a polynucleotide which includes additional coding and/or non-coding sequence.
The present invention further relates to variants of the hereinabove described polynucleotides which encode for fragments, analogs and derivatives of the polypeptide having the deduced amino acid sequence of Pigure 1 or the polypeptide encoded by the cDNA of the deposited clone. Th variant of the polynucleotide may be a naturally occurring allelic variant of the polynucleotide or a non-naturally occurring variant of the polynucleotide.
Thus, the present invention includes polynucleotides encoding the same mature polypeptide as shown in Figure 1 (S~Q ID NO:2) or the same mature polypeptide encoded by the cDNA of the deposited clone as well as variants of such polynucleotides which Yariants encode for a fragment, derivative or analog of the polypeptide of Figure 1 (S~Q ID
NO:2) or the polypeptide encoded by the cDN~ of the deposited clone. Such nucleotide variants include deletion variants, substitution variants and addition or insertion variants.
As hereinabove indicated, the polynucleotide may have a coding sequence which is a naturally occurring allelic-variant of the codlng sequence shown in F~gure 1 (S~Q ID~
NO:l) or of the coding ~equence of the deposited clone. As known in the art, a~ allelic variant i9 an alternate form of a polynucleotide sequence which may have a substitution, deletion or addition of one or more nucleotides, which does not substantially alter the function of the encoded polypeptide.
The polynucleotides may also encode for a soluble form of the G-protein ~h~mokine receptor polypeptide which is the extracellular portion of the polypeptide which has been cleaved from the TM and intracellular ~ in of the full-length polypeptide of the present invention.
The polynucleotides of the present-invention may also have the co~tng sequence fused in frame to a mar~er sequence which allow~ for purification of the polypeptide of the present invention. The mar~er sequence may be a hexa-histidine tag supplied by a pQ~-9 vector to provide for purification of the mature polypeptide fused to the ~arker i~
the ca~e of a bacterial host, or, for example, the marker sequence may be a hemagglutinin (~A) tag when a m~mmAl ian -host, e.g. COS-7 cells, is used. The HA tag corresponds to an epitope derived from the influenza hemagglutinin protein (Wilson, I., et al., Cell, 37:76, ~1984)).
The term "gene" means the segment of DNA involved in producing a polypeptide chain; it includes regions preceding and following the coding region (leader and trailer) as well as intervening se~uences (introns) between individual coding segments (exons).
~ ragments of the full length gene of the present invention may be used as a hybridization probe for a cDNA
library to isolate the full length cDN~ and to isolate other cDNAs which have a high sequence similarity to the gene or similar biological activity. Probes of this type preferably have at least 30 bases and may contain, for example, 50 or more bases. The probe may also be used to identify a cDNA
clone corresponding to a full length transcript and a genomic, clone or clones that contain the complete gene including regulatory and promotor regions, exons, and introns. An example of a screen C~L ises isolating the coding region of the gene by using the known DNA sequence to synthesize an oligonucleotide probe. Labeled oligonucleotides having a sequence complementary to that of the gene of the present invention are used to screen a library of human cDN~, genomic DNA or mRNA to determine which members of the library the probe hybridizes to.
The . present invention further relates to polynucleotides which hybridize to the hereinabove-described sequences if there is at least 70%, preferably at least 90%, and ~ re preferably at least 95% identity between the sequences. The present invention particularly relates to polynucleotides which hybridize under stringent conditions to the hereinabove-described polynucleotides. As herein-used, the term ~stringent conditions~ means hybridization will occur only if there i5 at least 95% and preferably at least 97% identity between the se~uences. The polynucleotides which hybridize to the hereinabove described polynucléotid~ ;
in a preferred embodiment encode polypeptides which either retain substantially the same biological function or activity as the mature polypeptide encoded by the cDNAs of ~igure 1 (S~Q ID NO:1) or the deposited cDNA(s~.
Alternatively, the polynucleotide may have at least 20 bases, preferably 30 bases, and more preferably at least 50 bases which hybridize to a polynucleotide of the present invention and which has an identity thereto, as hereinabove described, and which may or may not retain activity. For example, such polynucleotides may be employed as probes for the polynucleotide of S~Q ID NO:1, for example, for recovery of the polynucleotide or as a diagnostic probe or as a PCR
primer.
Thus, the present invention is directed to polynucleotides having at least a 70% identity, preferably at least 90% and more preferably at least a 95% identity to a polynucleotide which encodes the polypeptide of SBQ ID NO:2 as well as fra~mo~ts thereof, which fragments have at least 30 bases and preferably at least 50 bases and to polypeptides encoded ~y such polynucleotides.
The deposit(s) referred to herein will be maintained under the terms of the Budapest Treaty on the International Recog~ition of the Deposit of Micro-organisms for purposes of Patent Procedure. These deposits are provided merely as convenience to those of skill in the art and are not an a*m;ssion that a deposit is re~uired under 35 U.S.C. ~112.
The sequence of the polynucleotides contained in the deposited materials, as well as the amino acid sequence of the polypeptides encoded thereby, are incorporated herein by reference and are controlling in the event of any conflict with any description of sequences herein. A license may be required to ma}ce, or sell the deposited materials, and no such license is hereby granted.

. .

The present invention further relates to a G-protein chemokine receptor polypeptide which has the deduced amino -acid sequence of Figure 1 (SgQ ID NO:2) or which has the amino acid sequence encoded by the deposited cDNA, as well as fragments, analogs and derivatives of such polypeptide.
The terms "fragment, n nderivative" and "analog" when referring to the polypeptide of ~igure 1 or that encoded by the deposited cDNA, means a polypeptide which either retains substantially the same biological function or activity as ~uch polypeptide, i.e. functions as a G-protein chemokine receptor, or retains the ability to bind the ligand or the receptor even though the polypeptide does not function as a G-protein chemokine receptor, for example, a soluble form of the receptor. An analog includes a yLuyLotein which can be activated by cleavage of the proprotein portion to produce an active mature polypeptide.
The polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide or a synthetic polypeptide, preferably a recombinant polypeptide.
The fragment, derivative or analog of the polypeptide of ~igure 1 (SBQ ID NO:2) or that encoded by the depo~ited cDN~ may be (i) one in which one or more of the amino acid residues are substituted with a conserved or non-conserved amino acid residue tpreferably a conserved amino acid residue) and such substituted amino acid residue may or may not be one encoded by the genetic code, or tii) one in which one or more of the amino acid residues includes a substituent group, or (iii) one in which the mature polypeptide is fused with another compound, such as a c~mpound to increase the half-life of the polypeptide (for example, polyethylene glycol), or (iY) one in which the additional amino acids are fused to the mature polypeptide for purification of the polypeptide or (v) one in which a fragment of the polypeptide is soluble, i.e. not membrane bound, yet still binds ligands to the membrane bound receptor. Such fragments, derivatives CA 02216990 1997-11-27 : -and a~alogs are deemed to be within the scope of thos skilled in the art from the teachings herein.
The polypeptides and polynucleotides of the present invention are preferably provided in an isolated form, and preferably are purified to homogeneity.
The polypeptides of the present invention include the polypeptide of S~Q ID NO:2 (in particular the mature polypeptide) as well as polypeptides which have at least 70%
similarity (preferably a 70~ identity~ to the polypeptide of S~Q ID NO:2 and more preferably a 90~ similarity (more preferably a 90~ identity) to the polypeptide of S~Q ID NO:2 and still more preferably a 95% si~il~rity (still more preferably a 90% identity) to the polypeptide of S~Q ID NO:2 and to portions of such polypeptide with such portion of the polypeptide generally cont~in~ng at least 30 amino acids and more pre~erably at least 5~ amino acids.
Afi known in the art n similarity" between two polypeptides is determined by c~mr~ring the amino acid sequence and conserved ~m; no acid substitutes thereto of the polypeptide to the sequence of a second polypeptide.
~ ragments or portions of the polypeptides of the present invention may be employed for producing the corresponding full-length polypeptide by peptide synthesis, therefore, the fragments may be employed as-intermediates for producins the full-length polypeptides. ~ragments or portions of the polynucleotides of the present invention may be used to synthesize full-length polynucleotides of the present invention.
The term "gene" means the segment of DNA involved in pro~l~cing a polypeptide chain; it includes regions preceding and following the coding region "leader and trailer" as well as in~ervening sequences ~introns) between individual coding segments (exons).
The term n isolated" means thae the material is removed ~rom its original environment (e.g., the natural environment -'2-if it is naturally occurring). ~or example, a naturally-occurring polynucleotide or polypeptide present in a living ~nim~l is not isolated, but the same polynucleotide or polypeptide, separated from some or all of the coexisting materials in the natural system, is isolated. Such polynucleotides could be part of a vector and/or such polynucleotides or polypeptides could be part of a composition, and still be isolated in that such vector or composition is not part of its natural en~ironment.
The polypeptides of the present invention include the polypeptide of S~Q ID N0:2 ~in particular the mature polypeptide) as well as polypeptides which have at least 70%
simllarity (preferably at least 70~ identity) to the polypeptide of SBQ ID N0:2 and more preferably at least 90%
similarity (more preferably at least 90% identity) to the polypeptide of SBQ ID N0:2 and still more preferably at least 95% similarity ~still mDre preferably at least 95% identity) to the polypeptide of SBQ ID N0:2 and also include portions of such polypeptides with such portion of the polypeptide generally cont~in;ng at least 30 amino acids and more preferably at least 50 amino acids.
As known in the art n similarity" between two polypeptides i6 detenmined by c~mr~ring the amino acid se~uence and its conserved amino acid substitutes of one polypeptide to the sequence of a second polypeptide.
Fragments or portions of the polypeptides of the present in~ention may be employed for producing the corresponding full-length polypeptide by peptide synthesis; therefore, the fragments may be employed as intermediates for producing the full-length polypeptides. ~ragments or portions of the polynucleotides of the present invention may be used to synthesize full-length polynucleotides of the present invention.
The preRent invention also relates to vectors which include polynucleotides of the present invention, host cells which are genetically engineered with vectors o~ t~ ;
invention and the production of polypeptldes of the invention by recom~inant techniques.
Host cells are genetically engineered (transduced or trans~ormed or transfected) with the vectors of this invention which may ~e, for example, a cloning vector or an expression vector. The vector may be, for example, in the form of a plasmid, a viral particle, a phage, etc. The engineered host cells can be cultured in conventional nutrient media modified as appropriate for activating promoters, selecting transformants or amplifying the genes of the present invention. The culture conditions, such as temperature, pH and the like, are those previously used with the host cell selected for expression, and will be apparent to the ordinarily skilled artisan.
The polynucleotides of the present invention may be employed for producing polypeptides by recombinant techniques. Thus, for example, the polynucleotide may be included in any one of a variety of exprescion vectors for expressing a polypeptide. Such vectors include chromosomal, nonchromosoma} and synthetic DNA sequences, e.g., derivatives of SV40; bacterial plasmids; phage DNA;
baculovirus; yea~t plasmids; vectors derived from combinations of plasmids and phage DNA, viral DNA such as vaccinia, adenovirus, fowl pox virus, and pseudorabies.
However, any other vector may be used as long as it is replicable and viable in the host.
The appropriate DNA sequence may be inserted into the vector by a variety of procedures. In general, the DNA
sequence is inserted into an appropriate restriction ~n~ontlclease site(~) by procedures known in the art. Such procedures and others are deemed to be within the scope of those skilled in the art.
The DNA se~uence in the expression vector is operatively linked to an appropriate expression control sequence~s) (promoter) to direct mRNA synthesis. As representative examples of such promoters, there may be mentioned: LTR or SV40 promoter, the E- coli. lac or trP, the phage lambda PL
promoter and other promoters ~nown to control expression of genes in prokaryotic or eukaryotic cells or their viruses.
The expression vector also contains a ribosome bindlng site for translation initiation and a transcription tenminator.
The vector may al50 include appropriate sequences for amplifying expression.
In additlon, the expression vectors preferably contain one or more selectable marker genes to provide a phenotypic trait for selection of transformed host cells such as dihydrofolate reductase or neomycin resistance for eukaryotic cell culture, or such as tetracycline or am~icillin resistance in B. coli.
The vector cont~ining the appropriate DN~ sequence as hereinabove described, as well as an appropriate promoter or control sequence, may be employed to transform an appropriate host to permit the host to express the protein.
As representative examples of appropriate hosts, there may be mentioned: bacterial cells, such as E. coli, StreDtOm~CeS, Salmonella tvphimurium; fungal cells, such as yeast; insect cells such as Droso~hila and SPodoptera Sf9;
~ni m~ 1 cells such as C~O, COS or Bowes melanoma; adenovirusi plant cells, etc. The selection of an appropriate host is deemed to.be within the scope of those skilled in the art from the teachings herein.
More particularly, the present invention also includes recomh;n~nt constructs comprising one or more of the sequences as broadly described a~ove. The constructs cv~.~rise a vector, such as a plasmid or viral vector, into which a se~uence of the invention has been inserted, in a forward or reverse orientation. In a preferred aspect of this em~odiment, the construct further comprises regulatory sequences, including, for example, a promoter, operably linked to the sequence. Large numbers of suitable vector and promoters are ~nown to those of skill in the art, and are commercially available. The following vectors are provided by way of example. Bacte~_al: pQE70, pQE60, pQE-9 (Qiagen), pbs, pD10, phagescript, psiX174, pbluescrlpt Sg, pbsks, pNH8A, pNH16a, pNH18A, pNH46A (Stratagene); ptrc99a, pKR223-3, pKK233-3, pDR540, pRIT5 (Pharmacia). 8ukaryotic: pWLN~O, pSV2CAT, pOG44, pXTl, pSG (Stratagene) pSV~3, pBPV, pMSG, pSVL (Pharmacia). However, any other plasm~id or vector may be used as long as they are replicable and viable in the host.
Promoter regions can be selected from any desired gene using CAT (chloramphenicol transferase) vectors or other vectors with selectable mar~ers. Two appropriate vectors are PgR232-8 and PCM7. Particular named bacterial promoters include lacI, lacZ, T3, T7, gpt, lambda PR~ PL and trp.
Bukaryotic promoters include CMV imme~iate early, HSV
thymidine kinase, early and late SV40, LTRs from retrovirus, and mouse metallothionein-I. Selection of the appropriate vector and promoter is well within the level of ordinary skill in the art.
In a further embodiment, the present invention relates to host cells cont~ining the above-described constructs. The host cell can be a higher eukaryotic cell, such as a m~mm~l ian cell, or a lower eukaryotic cell, such as a yeast cell, or the host cell can be a prokaryotic cell, such as a bacterial cell. Introduction of the construct into the host cell can be effected by calcium phosphate transfection, D~A~-Dextran mediated transfection, or electroporation. ~Da~is, L., Dl~ner, M., Battey, I., Basic Meehods in Molecular Biology, (1986)).
The constructs in host cells can be used in a conventional ~nner to produce the gene product encoded by the recombinant sequence. Alternatively, the polypeptides of the invention can be synthetically produced by conventiona peptide synthesizers.
Mature proteins can be expressed in m~mm~ lian cells, yeast, bacteria, or other cells under the control of appropriate promoters. Cell-~ree translation systems can also be emDloyed to produce such proteins using RNAs derived ~rom the DNA constructs of the present invention.
Appropriate cloning and expression vectors for use with prokaryotic and eukaryotic hosts are described by Sambrook, et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor, N.Y., (~989), the disclosure of which is hereby incorporated by reference.
- Transcription-of the DNA encoding the polypeptides of the present invention by higher eukaryotes is increased by inserting an ~nh~ncer sequence into the vector. Bnhancers are cis-acting elements of DN~, usually about from 10 to 300 bp that act on a promoter to increase its transcription.
Examples including the SV40 enhancer on the late side of the replication origin bp 100 to 270, a cytomegalovirus early promoter P~h~ncer, the polyoma enhancer on the late side of the replication origin, and adenovirus ~nh~ncers.
Generally, recombinant expression ~ectors will include origins o~ replication and selectable markers penmitting transformation of the host cell, e.g., the ampicillin resistance gene of E. coli and S. cerevisiae TRPl gene, and a promoter derived from a highly-expressed gene to direct transcription of a downstream structural sequence. Such promoters can be derived from operons encoding glycolytic enzymes such as 3-phosphoglycerate kinase (PGK), a-factor, acid pho6phatase, or heat shock proteins, among others. The heterologous structural sequence is assembled in appropriate phase with translation initiation and termination sequences, and preferably, a leader sequence capable o~ directing secretion of translated protein into the periplasmic space or extracellular medium. Optionally, the heterologous sequence can encode a fUsion protein including an N-terminal identification peptide imparting desired characteristics, e.g., stabilization or simplified purification of expressed recombinant product.
Useful expression vectors for hacterial use are constructed by inserting a structural DNA sequence encoding a desired protein together with suitable translation initiation and termination signals in operable readlng phase with a functional promoter. The vector will comprise one or more phenotypic selectable markers and an origin of replication to ensure maintenance of the vector and to, if desirable, provide amplification within the host. Suitable prokaryotic hosts for transformation include ~. coli, Bacillus subtilis, Salmonella tvphimurium and various species within the genera Psell~o~n~s, Streptomyces, and Staphylococcus, although others may also be employed as a matter of choice.
As a representative but nonlimiting example, useful expression vectors for bacterial use can comprise a selectable marker and bacterial origin of replication derived from c~mercially a~ailable plasmids c~mprising genetic elements of the well known cloning ~ector pBR322 (ATCC
37017). Such comm~rcial vectors include, for example, p~223-3 ~Pharmacia Fine Chemicals, Uppsala, Sweden) and GEMl (Promega ~iotec, Madison, WI, USA). These pBR322 "backbone"
sections are combined with an appropriate promoter and the structural sequence to be expressed.
Pollowing transformation of a suitable host strain and growth of the host strain to an appropriate cell density, the selected promoter is induced by appropriate means ~e.g., temperature shift or chemical induction) and cells are cultured for an additional period.
Cells are typically harvested by centrifugation, disrupted by physical or chemical means, and the resulting crude extract retained for further purification.

Microbial cells employed in ex~ression of proteInS can be disrupted by any convenient method, including freeze-thaw cycling, sonication, mechanical disruption, or use of cell lysing agents, such methods are well know to those skilled in the art.
Various mammalian cell culture systems can also be employed to express recombinant protein. Examples of m~mm~l ian expression systems include the COS-7 lines of monkey kidney fibroblasts, described by Gluzman, Cell, 23:175 ~1981), and other cell lines capable of expressing a compatible vector, for example, the C127, 3T3, C~0, HeLa and BHK cell lines. Mammalian expression vectors will comprise an origin of replication, a suitable promoter and enhancer, and also any necessary ri~osome binding sites, polyadenylation site, splice donor a~d acceptor sites, transcriptional termination sequences, and 5' flanking nontranscribed sequences. DNA sequences derived from the SV40 splice, and polyadenylation sltes may be used to provide the required nontranscribed genetic elements.
The G-protein chemokine receptor polypeptides can be recovered and purified from recombinant cell cultures by methods including ~mmonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hy~roxylapatite chromatography and lectin chromatography. Protein refolding steps can be used, as necessary, in completing configuration of the mature protein. Finally, high performance liquid chromatography (~PLC) can be employed for final purification steps.
The polypeptides of the present in~ention may be a naturally purified product, or a product of chemical synthetic procedures, or produced by recombinant techniques from a prokaryotic or eukaryotic host ~for example, by ~acterial, yeast, higher plant, insect and m~mm~lian cells in culture). Depending upon the host employed in a recombinar production procedure, the polypeptides of the present invention may be glycosylated or may be non-glycosylated Polypeptides of the in~ention may also include an initia methionine amino acid residue.
The polynucleotides and polypeptides of the present invention m2y be employed as research reagents and materials for discovery of treatments and diagnostics to human disease.
The G-protein chemokine receptors of the present invent.ion may be employed in a process for screening for compounds which activate (agonists) or inhibit activation (antagonists) of the receptor polypeptide of the present invention .
In general, such screening procedures involve providing appropriate cells which express the receptor polypeptide of the present invention on the surface thereof. Such cells include cells from m~mm~S, yeast, drosophila or ~. Coli. In particular, a polynuc}eotide encoding the receptor of the present invention is employed to transfect cells to thereby express the G-protein chemokine receptor. The expressed receptor is then contacted with a test compound to observe binding, stimulation or inhibition of a functional response.
One such screening procedure involves the use of melanophores which are transfected to express the G-protein chemokine receptor of the present invention. Such a screening technique is described in PCT WO 92/01810 published ~ebruary 6, 1992.
Thus, for example, such assay may be employed for screening for a com~ound which inhibits activation of the receptor polypeptide of the present invention by contacting the melanophore cells which encode the receptor with both the receptor ligand and a compound to be screened. ~hibition of the signal generated by the ligand indicates that a co~,~ound is a potential antagonist for the receptor, i.e., inhibits activation of the receptor.

The screen may be employed for determining a ccmpound which activates the receptor by contacting such cells with compounds to be screened and determining whether such compound generates a signal, i.e., activates the receptor.
Other screening technioues include the use of cells which express the G-protein chemokine receptor tfor e~ample, transfected CHO cells) in a system which measures extracellular pH changes caused by receptor activation, for example, as described in Science, volume 246, pages 181-296 ~October 1989). ~or example, compounds may be contacted with a cell which expresses the receptor polypeptide of the present invention and a second messenger response, e.g.
signal transduction or p~ changes, may be measured to determine whether the potential compound activates or inhibits the receptor.
Another such screening technique involves introducing, RNA encoding the G-protein chemokine receptor into Xenopus oocytes to transiently express the receptor. The receptor oocytes may then be contacted with the receptor ligand and a compound to be screened, followed by detection of inhibition or activation o~ a calcium signal in the case of screening for co~pounds which are thought to inh~bit activation of the receptor.
Another screening technique involves expressing the G-protein chemokine receptor in which the receptor is linked to a phospholipase C or D. As representative examples of such cells, there may be mentioned endothelial cells, smooth muscle cells, embryonic kidney cells, etc. The screening may be acc~.,~lished as hereinabove described by detecting activation of the receptor or inhibition of activation of the receptor from the phospholipase second signal.
Another method involves screening for cu-,-uounds which inhiblt activation of the receptor polypeptide of the present invention antagonists by determining inhibition Dinding of labeled ligand to cells which have the receptor on the surface thereof. Such a method involves transfecting ~
eukaryotic cell with DNA encoding the G-protein chemokine receptor such that the cell expresses the receptor on its surface and contacting the cell with a compound in the presence of a labeled form of a known ligand. The ligand can be labeled, e.g., by radioactivity. The amount of labeled ligand bound to the receptors is measured, e.g., by measuring radioactivity of the receptors. If the compound binds to the receptor as determined by a reduction of labeled ligand which binds to the receptors, the binding of labeled ligand to the-receptor is inhibited.
An antibody may antagonize a G-protein chemokine receptor of the present invention, or in some cases an oligopeptide, which bind to the G-protein chemokine receptor but does not elicit a second messenger response such that the activity of the G-protein chemokine receptors is prevented.
Antibodies include anti-idiotypic antibodies which recognize uni~ue determinants generally associated with the antigen-hin~;ng site of an antibody. Potential antagonist c~mp~unds also include proteins which are closely related to the ligand of the G-protein chemokine receptors, i.e. a fragment of the ligand, which have lost biological function and when binding to the G-protein chemokine receptor elicit no response.
An antisense construct prepared through the use of antisense technology, may be used to control gene expression through triple-helix formaeion or antisense DNA or RNA, both of which methods are based on bin~ing of a polynucleotide to DNA or RNA. Por example, the S' coding portion of the polynucleotide sequence, which encodes for the mature polypeptides of the present invention, is used to design an antisense RNA oligonucleotide of from about 10 to 40 base pairs in length. A DNA oligonucleotide is designed to be c~..~lementary to a region of the gene involved in transcription (triple helix -see Lee et al., Nucl. Acids Res., 6:3073 (1979); Cooney et al, Science, 241:456 (1988);

and Dervan et al., Science, 251: 1360 (1991)), thereby preventing transcrlption and the production of G-protein chemokine receptor. The antisense RNA oligonucleotide hybridizes to the mRNA i~ vivo and blocks translation of mRNA
molecules into G-protein coupled receptor (antisense - Okano, ~. Neurochem., 56:560 (1991); Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression, CRC Press, Boca Raton, FL (1988)). The oligonucleotides described above can also be delivered to cells such that the antisense RNA or DNA
may be expressed 1~ vivo to inhibit production of G-protein chemokine receptor.
A small molecule which binds to the G-protein chemokine receptor, making it inaccessible to ligands such that normal biological activity is prevented, for example small peptides or peptide-like molecules, may also be used to inhibit activation of the receptor polypeptide of the present invention.
A soluble form of the G-protein chemokine receptor, e.g.
a fragment of the receptors, may be used to inhibit activation of the receptor by binding to the ligand to a polypeptide of the present invention and preventing the ligand from interacting with ~embrane bound G-protein chemokine receptors.
The c~mpounds which bind to and activate the G-protein chemokine receptors of the present invention may be employed to stimul~te haematopoiesis, wound healing, coagulation, angiogenesis, to treat solid tumors, chronic infections, leukemia, T-cell mediated auto-immune diseases, parasitic infections, psoriasis, and to stimulate growth factor activity.
The cu--~ounds which bind to and inhibit the G-protein chemokine receptors of the present inventlon may be employed to treat allergy, atherogenesis, anaphylaxis, malignancy, chronic and acute inflammation, histamine and IgE-mediated allergic reactions, prostaglandin-independent fever, bone marrow failure, silicosis, sarcoidosis, rheumatoid arthrit~s shock and hyper-eosinophilic syndrome.
The com~ounds may be employed in combination with a suitable pharmaceutical carrier. Such compositions comprise a therapeutically effective amount of the compound and a pharmaceutically acceptable carrier or excipient. Such a carrier includes but is not limited to saline, buffered saline, dextrose, water, glycerol, ethanol, and combinations thereof. The formulation should suit the mode of ~mi ni stration.
The invention also provides a pharmaceutical pack or kit comprising one or more containers filled with one or more of the ingredients of the pharmaceutical compositions of the invention. Associated with such container(s) can be a notice in the form prescribed by a governmental agency regulating the manufacture, use or sale of pharm~aceuticals or biological products, which notice re~lects approval by the agency of manufacture, use or sale for human ~ministration. In addition, the c ~pounds of the present invention may be employed in conjunction with other therapeutic co..~ounds.
The pharmaceutical compositions may be administered in a convenient m~nner such as by the topical, intravenous, intraperitoneAl, intramuscular, subcutaseous, intranasal or intradermal ~applicable?) routes. The pharmaceutical compositions are ~ nistered in an amount which is effective for treating andtor prophylaxis of the specific indication.
In general, the pharmaceutical compositions will be A~mi ni gtered in an a~ unt of at least about 10 ~g/kg body weight and in most cases they will be ~mi ni stered in an a~ount not in excess of about 8 mg/~g bady weight per day.
In most cases, the dosage is from about 10 ~g/kg to about 1 mg/kg body weight daily, taking into account the routes of A ~ln;stration, syn~toms, etc. ~CON~K~ DOSAGi;:S1 The G-protein chemokine receptor polypeptides and antagonists or agonists which are polypeptides, may also be employed in accordance with the present invention by expression of such polypeptides in vivo, which is often referred to as "gene therapy.~
Thus, for example, cells from a patient may be engineered with a polynucleotide (DNA or RNA) encoding a polypeptide ex vivo, with the engineered cells then being provided to a patient to be treated with the polypeptide.
Such methods are well-known in the art. ~or example, cells may be engineered by procedures known in the art by use of a retroviral particle containing RNA encoding a polypeptide of the present invention.
Similarly, cells may be engineered in vivo for expression of a polypeptide i~ vivo by, for example, procedures known in the art. As known in the art, a producer cell for producing a retroviral par~icle containing RNA
encoding the polypeptide of the present invention may be ~*mj ni stered to a patient for engineering cells in vivo and expression of the polypeptide in vivo. These and other methods for A~mi ni stering a polypeptide of the present in~ention by such method should be apparent to those skilled in the art from the teachings of the present invention. Por example, the expression vehicle for engineering cells may be other than a retrovirus, for example, an adenovirus which may be used to engineer cells in vivo after combination with a suitable delivery vehicle Retr~viruses from which the retroviral plasmid vectors hereina~ove mentioned may be derived include, but are not limited to, Moloney Murine Leukemia Virus, spleen necrosis virus, retroviruses such as Rous Sarcoma Virus, Harvey Sarcoma Virus, avian leukosis virus, gibban ape leukemia virus, human i~m~nodeficiency virus, adenovirus, Myeloproliferati~e Sarcoma Virus, a~d m~mm~ry tumor virus.
In one embodiment, the retroviral plasmud vector is derived from Moloney Murine Leukemia Virus.

The vector includes one ~r more promoters. Suitab promoters which may be employed include, but are not limited to, the retroviral LTR; the SV40 promoter; and the human cytomegalovirus (CMV) promoter described in Miller, et al., Biotechniques, Vol. 7, No. 9, 980-990 (1989), or any other promoter (e.g., cellular promoters such as eukaryotic cellular promoters including, but not limited to, the histone, pol III, and ~-actin promoters). Other viral promoters which may be employed include, but are not limited to, adenovirus promoters, thymidine kinase (Tg) promoters, and B19 parvovlrus promoters. The selection of a suitable promoter will be apparent to those skilled in the art from the teachings contained herein.
The nucleic acid sequence encoding the polypeptide of the present invention is under the control of a suitable promoter. Suitable promot~-rs which may be employed include, but are not limited to, adenoviral promoters, such as the adeno~iral major late promoter; or hetorologous promoters, such as the cytomegalovirus (CM~) promoter; the respiratory syncytial virus (RSV) promoter; inducible promoters, such as the MMT promoter, the metallothionein promoter; heat shock promoters; the albumin promoter; the ApoAI promoter; human glo~in promoters; viral thymidine kinase promoters, such as the Herpes Simplex thymidine kinase promoter; reeroviral LTRs ~including the modified retroviral LTRs hereinabove described).; the ~-actin promoter; and human growth hormone promoters. The promoter also may be the native promoter which controls the genes encoding the polypeptides.
The retroviral plasmid vector is employed to transduce packaging cell lines to form producer cell lines. Bxamples of packaglng cells which may be transfected include, but are not limited to, the P~S01, PA317, ~-2, ~-AM, PA12, T19-14X, VT-lg-17-H2, ~CRB, ~CRIP, GP~E-86, GP~en~Aml2, and DAN cell lines as described in Miller, Human Gene TheraDy, Vol. 1, pgs. 5-14 (1990~, which is incorporated herein by reference in its entirety. The vector may transduce the packaging cells through any meanS known in the art. Such means include, but are not limited to, electroporation, the use of liposomes, and CaPOI precipitation. In one alternative, the retroviral plasmid vector may be encapsulated into. a liposome, or coupled to a lipid, and then administered to a host.
The producer cell line generates infectious retroviral vector particles which include the nucleic acid sequence(s) encoding the polypeptides. Such retroviral vector particles then may be employed, to transduce eukaryotic cells, either in vitro or i~ vivo. The transduced eukaryotic cells will express the nucleic acid sequence(s) encoding the polypeptide. Eukaryotic cells which may be transduced include, but are not limited to, embryonic stem cells, embryonic carcinoma cells, as well as hematopoietic stem cells, hepatocytes, fibroblasts, myoblasts, keratinocytes, endothelial cells, and bronchial epithelial cells.
The present invention also provides a method for determining whether a ligand not known to be capable of binding to a G-protein chemokine receptor can bind to such receptor which comprises contacting a m~mm~l ian cell which expresse6 a G-protein chemokine receptor with the lisand under conditions permitting binding of ligands tO the G-protein chemokine receptor, detecting the presence of a ligand which binds to the receptor and thereby determining whether the ligand binds to the G-protein chemokine receptor.
The syste~s hereinabove described for determining agonists and/or antagOnists may also-be employed for determining ligand~ which bind to the receptor.
This invention also provides a method of detecting expression of a G-protein chemokine receptor polypeptide of the present invention on the surface of a cell by detecting the nresence of mRNA coding for the receptor which comprises obt~ining total mRNA from the cell and contacting the m~N~ so obtained with a nucleic acid probe com~rising a nuclelc aci molecule of at least 10 nucleotides capable of specifically hybridizing with a sequence included within the sequence of a nucleic acid molecule encoding the receptor under hybridizing conditions, detecting the presence of mRNA
hybridized to the probe, and thereby detecting the expression of the receptor by the cell.
The present invention also provides a method for identifying receptors related to the receptor polypeptides of the present invention-. These related receptors may be identified by homology to a G-protien chemokine receptor polypeptide of the present invention, by low stringency cross hybridization, or by identifying receptors that interact with related natural or synthetic ligands and or elicit similar behaviors after genetic or pharmacological blockade of the chemokine receptor polypeptides of the present invention.
Fragments of the genes may be used as a hybridization probe for a cDNA library to isolate other genes which have a high sequence similarity to the genes of the present invention, or which have similar biological activity. Probes of this type are at least 20 bases, preferably at least 30 bases and most preferably at least 50 bases or more. The probe may also be used to identify a cDNA clone corresponding to a full length transcript and a geno~ic clone or clones that cont~i n the complete gene of the present invention including regulatory and promoter regions, exons and introns.
An example of a screen of this type co~prises isolating the coding region of the gene by using the known DNA sequence to synthesize an oligonucleotide probe. Labeled oligonucleotides having a sequence complementary to that of the genes of the present invention are used to screen a library of human cDNA, genomic DNA or mRNA to determine which members of the library the probe hybridizes to.
The present invention also contem~lztes the use of the genes of the present invention as a diagnostic, for example, some diseaseS result from inherited defective genes. -~hese genes can be detected by comDaring the sequences of the defective gene with that of a normal one. Subsequently, one can verify that a "mutant" gene is associated with abnormal receptor activity. In addition, one can insert mutant receptor genes into a suitable vector for expression in a functional assay system (e.g., colorimetric assay, expression on MacConkey plates, complementation experiments, in a receptor deficient strain of H~R293 cells) as yet another means to verify or identify mutations. Once "mutant" genes have been identified, one can then screen population for carriers of the "mutant n receptor gene.
Individuals carrying mutations in the gene of the present invention may be detected at the DNA level by a variety of techniques. Nucleic acids used for diagnosis may be obtained from a patient's cells, including but not limited to such as from blood, urine, saliva, tissue biopsy and autopsy material. The genomic DNA may bè used directly for detection or may be amplified enzymatically by using PCR
(Saiki, et al., Nature, 324:163-166 19~6) prior to analysis.
R~ or CDNA may also be used for the same purpose. As an example, PCR primers complimentary to the nucleic acid of the instant invention can be used to identify and analyze mutations in the gene of the present invention. For example, deletions and insertions can be detected by a change in size of the amplified product in comparison to the normal genotype. Point mutations can be identified by hybridizing amplified DNA to radio labeled RNA of the invention or alternatively, radio labeled antisense DNA sequences of the invention. Perfectly matched sequences can be distinguished from mismatched duplexes by RNase A digestion or by differences in melting temperatures. Such a diagnostic would be particularly useful for prenatal or even neonatal testing.
Sequence differences between the reference gene and Utantsn may be revealed by the direct DNA sequencing .

method. In addition, cloned DNA segments may be used aC-probes to detect specific DNA segments. The sensitivity of this method is greatly enhanced when combined with PCR. ~or example, a sequence primer is used with double stranded PCR
product or a single s.randed template molecule generated by a modified PCR. The sequence determination is per~ormed by conventional procedures with radio labeled nucleotide or k an automatic sequencing procedure with fluorescent-tags.
Genetic testing based on DNA sequence differences may be achieved by detection of alterations in the electrophoretic mobility of DNA fragments in gels with or without denaturing agents. Sequences changes at specific locations may also be revealed by nucleus protection assays, such RNase and S1 protection or the chemical cleavage method (e.g. Cotton, et al., PNA5. USA, 85:4397-4401 19~5).
In addition, some diseases are a result of, or are characterized by changes in gene expression which can be detected by changes in the m~N~. Alternatively, the genes of the present invention can be used as a reference to identify individuals expressing a decrease of funceions associated with receptors of this type.
The present invention also relates to a diagnostic assay for detecting altered levels of soluble forms of the G-proein chemokine receptor polypeptides of the present invention in various tissues. Assays used to detect levels of the soluble receptor ~olypeptides in a sample derived from a host are well known to those of skill in the art and include radioi ~ ~no~says, competitive-hin~ing assays, Western blot analysis and preferably as ELISA assay.
An ~LISA afisay initially comprises preparing an antibody specific to antigens of the G-protein chemokine receptor polypeptides, preferably a monoclonal antibody. In addition a reporter antibody is prepared against the monoclonal antibody. To the reporter an~ibody is attached a detectable reagent such as radioactivity, fluorescence or in this example a horseradish peroxidase enzyme. A sample is now removed from a host and incubated on a solid support, e.g. a polystyrene dish, that binds the proteins in the sample. Any free protein binding sites on the dish are then covered by incubating with a non-specific protein such as bovine serum albumin. Next, the monoclonal antibody is incubated in the dish during which time the monoclonal antibodies attach to any G-protein chemokine receptor proteins attached to the polystyrene dish. All unbound monoclonal antibody is washed ou~ with buffer. The reporter antibody linked to horseradish peroxidase is now placed in the dish resulting in binding of the reporter antibody to any monoclonal antibody bound to G-protein chemokine receptor proteins. Unattached reporter antibody is then washed out. Peroxidase substrates are then added to the dish and the amount of color developed in a given time period is a measurement of the amount of G-protein chemokine receptor proteins present in a gi~en volume of patient sample when comDared against a st~n~rd curve.
The sequences of the present invention are also valuable for chromosome identification. The se~uence is specifically targeted to and can hybridize with a particular location on an individual human chromosome. Moreo~er, there is a current need for identifying particular sites on the chromosome. Few chromosome marking reagents based on actual sequence data (repeat polymorphisms) are presently available for marking chromosomal location. The mapping of ~NAs to chromosomes according to the present invention is an important first step in correlating those sequences with genes associated with disease.
~ riefly, sequences can be mapped to chromosomes by preparing PCR primers ~preferably 15-25 bp) from the cDNA.
Computer analysis of the cDNA is used to rapidly select primers that do not span more than one exon in the genomic DNA! thus complicating the amplification process. These primers are then used for PCR screening of somatic cell hybrids containing individual human chromosomes. Only thoser'"
hybrids containing the human gene corresponding to the primer will yield an amplified fragment.
PCR mapping of somatic cell hybrids is a rapid procedure for assigning a partlcular DNA to a particular chromosome.
Using the present invention with the same oliyonucleotide primers, sublocalization can be achieved with panels of fragments from specific chromosomes or pools of large genomic clones in an analogous manner. Other ~apping strategies that -can similarly be used to map to its chromosome include in situ hybridization, prescreening with la~eled flow-sorted chromosomes and preselection by hybridization to construct chromosome specific-cDNA libraries.
Fluorescence ln situ hybridization (FISH) of a cDNA
clone to a metaphase chromosomal spread can be used to pro~ide a precise chromosomal location in one step. This technique can be used with cDNA as short as 50 or 60 bases.
For a review of this technique, see Verma et al., Human Chromosomes: a Manual of Basic Techniques, Pergamon Press, New York (1988).
Once a sequence has been mapped to a precise chromosomal location, the physical position of the sequence on the chromosome can be correlated with genetlc map data. Such data are found, for example, in V. McKusick, Mendelian Inheritance in Man tavailable on line through Johns Hopkins University Welch Medical ~ibrary). The relationship between genes and diseases that have been mapped to the same chromosomal region are then identified through linkage analysis (coinheritance of physically adjacent genes).
Next, it is necessary to determine the differences in the c~N~ or gen~mic se~uence between affected and unaf~ected individuals. If a mutation is observed in some or all of the affected individuals but not in any normal individuals, then the mutation is likely to be the causative agent o~ the disease.

With current resolution of physical mappin~ and genetic mapping techniques, a cDNA precisely localized to a chromosomal region associated with the disease could be one of between 50 and 500 potential causative cenes. (This assumes 1 megabase mapping resolution and one gene per.20 kb).
The polypeptides, their fragments or other derivatives, or analogs thereof, or cells expressing them can be used as an immunogen to produce antibodies thereto. These antibodies can be, for example, polyclonal or monoclonal antibodies.
The present invention also includes rhimPric, single chain, and hl~m~nized antibodies, as well as Fab fragments, or the product of an Fab expression library. Various procedures known in the art may be used for the production of such antibodies and fragments.
Antibodies generated against ehe polypeptides corresponding to a sequence of the present in~ention can be obtained by direct injection of the polypeptides into an ~nim~l or by ~mi ni sterinc the polvpeptides to an ~nim~l, preferably a nonh~lm~n. The anti~ody so obtained will then bind the polypeptides itself. In this manner, even a sequence encoding only a fragment of the polypeptides can be used to generate antibodies binding the whole native polypeptides. Such antibodies can then be used to isolate the polypeptide from tissue expressing that polypeptide.
For preparation of monoclonal antibodies, any technique which provides antibodies produced by continuous cell line cultures can be used. Examples include the hybridoma technique (Kohler and Milstein, 1975, Nature, 256:495-497), the trioma technique, the human B-cell hybridoma technique (~ozbor et al., 1983, Immunology Today 4:72), and the EBV-hybridoma technique to produce human monoclonal antibodies (Cole, et al., 1985, in Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96).

Techni~ues described ~o- the production of single-chai;
antibodies (U.S. Patent 4,946,778) can be adapted to produce single chain antibodieS to immunogenic polypeptide products of this invention. Also, trans-~nic mice may be used to express hllm~nized antibodies ~o imml~nogenic polypeptide products of this invention.
The present invention will be further described with reference to the following examples; however, it is to be understood that the present invention is not limited to such examples. All parts or amounts, unless otherwise specified, are by weight.
In order to facilitate understanding of the following examples certain frequently occur_ing methods and/or terms will be described.
"Plasmids n are designated by a lower case p preceded and/or followed by capital letters and/or num~ers. The starting plasmids herein are either commercially available, publicly available on an unrestricted basis, or can be constructed from a~ailable plasmids in accord with published procedures. In addition, equivalent plasmids to those described are known in the art and will be apparent to the ordin~rily skilled artisan.
"Digestion" of DNA refers to catalytic cleavage of the DNA with a restriction enzyme that acts only at certain se~uences in the DNA. The various restriction enzymes used herein are commercially available and their reaction conditions, cofactors and other requirements were used as would be known to the ordinarily skilled artisan. ~or analytical purposes, typically 1 ~g of plasmid or DNA
fragment is used with about 2 units of enzyme in about 20 ~1 of buffer solution. ~or the Furpose of isolating DNA
fragments for plasmid construction, typically 5 to 50 ~g of DNA are digested with 20 to 250 unlts of enzyme in a larger volume. Appropriate buffers and substrate amounts for particular restriction enzymes are specified by the manufacturer. Incubation times of about 1 hour at 37~C are ordinarily used, but may vary in accordance with the supplier's instructions. After digestion the reaction is electrophoresed directly on a polyacrylamide gel to isolate-the desired fragment.
Size separation of the cleaved fragments is performed using 8 percent polyacrylamide gel described by Goeddel, D.
et al ., Nucleic Acids Res., 8:4057 (1980).
"Oligonucleotides" refers to either a single stranded polydeoxynucleotide or two complementary polydeoxynucleotide strands which may be chemically synthesized. Such synthetic oligonucleotides have no 5' phosphate and thus will not ligate to another oligonucleotide without adding a phosphate with an ATP in the presence of a kinase. A synthetic oligonucleotide will ligate to a fragment that has not been dephosphorylated.
"Ligation" refers to the process of forming phosphodiester bonds between two double stranded nucleic acid fragments (Maniatis, T., et al., Id., p. 146). Unless otherwise provided, ligation may be accomplished using known buf~ers and conditions with 10 units to T4 DNA ligase ("ligase~') per 0.5 ~g of approximately equimolar amounts of the DNA fragments to be ligated.
Unless otherwise stated, transformation was performed as described in the method of Graham, F. and Van der Eb, A., Virology, 52:456-457 (1973).
Example 1 Bacterial Expression and Purification of HDGNR10 The DNA sequence encoding for HDGNR10, ATCC No. 97183 is initially amplified using PCR oligonucleotide primers corresponding to the 5' and sequences of the processed HDGNR10 protein (minus the signal peptide sequence) and the vector sequences 3' to the HDGNR10 gene. Additional nucleotides corresponding to HDGNR10 were added to the 5' and 3' sequences respectively. The 5' oligonucleotide primer has the sequence S' CGGAATTCCTCCATGGATTATCAAGTGTCA 3' contains an ~coRI restriction enzyme site followed by 18 nucleotides O~
HDGNR10 coding sequence starting from the presumed terminal amino acid of the processed protein codon. The 3' sequence 5' CGGAAGCTTCGTCACAAGCCCACAGATAT 3' contains complementary sequences to a HindIII site and is followed by 18 nucleotides of EDGNR10 coding sequence. The restriction enzyme sites correspond to the restriction enzyme sites on the bacterial expression vector pQE-9 (Qiagen, Inc. ~259 Eton Avenue, Chat~worth, CA, 91311). pQ~-9 encodes antibiotic resistance (Amp'), a bacterial origin of replication ~ori), an IPTG-regulatable promoter operator (P/O), a ribosome binding site (RBS), a 6-His tag and restriction enzyme sites. pQE-9 was then digested with EcoRI and HindIII. The amplified sequences were ligated into pQE-9 and were inserted in frame with the sequence encodins for the histidine tag and the RBS. The ligation mixture was then used to transform E. coli strain M~5/rep 4 (Qiagen, Inc.) by the procedure described in Sambrook, J. et al., Molecular Cloning: A Laboratory Manual, Cold Spring Laboratory Press, (1989). M15/rep4 contains ~ultiple copies of the plasmid pR~P4, which expresses the lacI repressor and also confers kanamycin resistance (ganr).
Transformants are identified by their ability to grow on LB
plates and ampicillin/kanamycin resistant colonies were selected. Plasmid DNA was isolated and confirmed by restriction analysis. Clones containing the desired constructs were grown Gvernight (O/N) in liquid culture in LB
media supplemented with both Amp (100 ug/ml) and Kan (25 ug/ml). The O/N culture is used to inoculate a large culture at a ratio of 1:100 to 1:250. The cells were grown to an optical density 600 (O.D.~) of between 0.4 and 0.6. IPTG
(~Isopropyl-B-D-ehiogalacto pyranoside") was then added to a final concentration of 1 ~M. IPTG induces by inactivating the lacI repressor, clearing the 'JO leading ~o increased gene expression. Cells were grown an extra 3 tO 4 hours.

Cells were then harvested by centrifugation. The cell pellet was solubilized in the chaotropic agent 6 Molar Guanidine HCl. After clarification, solubilized HDGNR10 was purified from this solution by chromatography on a Nickel-Chelate column under conditions that allow for tight binding by proteins containing the 6-His tag. Hochuli, E. et al., J.
Chromatography 411:177-184 (1984). HDGNR10 was eluted from the column in 6 molar guanidine HCl pH 5.0 and for the purpose of renaturation adjusted to 3 molar guanidine HCl, lOOmM sodium phosphate, 10 mmolar glutathione (reduced) and 2 mmolar glutathione (oxidized). After incubation in this solution for 12 hours the protein was dialyzed to 10 mmolar sodium phosphate.

Example 2 Ex~ression of Recombinant HDGNR10 in COS cells The expression of plasmid, HDGNR10 HA is derived from a vector pcDNAI/Amp (Invitrogen) containing: 1) SV40 origin of replication, 2) ampicillin resistance gene, 3) E.coli replication origin, 4) CMV promoter followed by a polylinker region, a SV40 intron and polyadenylation site. A DNA
fragment encoding the entire HDGNR10 precursor and a HA tag fused in frame to its 3' end was cloned into the polylinker region of the vector, therefore, the recombinant protein expression is directed under the CMV promoter. The HA tag correspond to an epitope derived from the influenza hemagglutinin protein as previously described (I. Wilson, H.
Niman, R. Heighten, A Cherenson, M. Connolly, and R. Lerner, 1984, Cell 37, 767). The infusion of HA tag to the target protein allows easy detection of the recombinant protein with an antibody that recognizes the HA epitope.
The plasmid construction strategy is described as follows:
The DNA sequence encoding for HDGNR10, ATCC No. 97183, was constructed by PCR using two primers: the 5' primer 5' GTCC

AAGcITGccAccATGGATTATcAAGTGTc~ 3' and concains a HindIII Sitf'' followed by 18 nucleotides of HDGNR10 coding sequence starting from the initiation codon; the 3' sequence 5~
CTAGcTcGAGTcAAGcGTAGTcTGGGAcGTcGTATGG-~TAGcAcAAGcccAcAGATATTTc 3' contains complementary sequences to an XhoI site, translation StOp codon, HA tag and the last 18 n~lcleotides of the HDGNR10 coding sequence ~not including the StOp codon).
Therefore, the PCR product contains a HindIII site HDGNRlo coding sequence followed by HA tag fused in frame, a translation termination stop codon next to the H~ tag, and an XhoI site. The PCR amplified DNA fragment and the vector, pcDNAI~Amp, were digested with ~indITI and XhoI restriction enzyme and ligated. The ligation mixture was transformed into E. coli strain SURE (available from Stratagene Cloning Systems, 11099 North Torrey Pines Road, La Jolla, CA 92037) the transformed culture was plated on ampicillin media plates and resistant colonies were selected. Plasmid DNA was isolated from transformants and examined by restriction analysis for the presence of the correct fragment. For expression of the reco~hin~nt HDGNR10, COS cells were transfected with the expression vector by DEAE-DEXTRAN
method. ~J. Sambrook, E. Fritsch, T. Maniatis, Molecular Cloning: A Laboratory Manual, Cold Spring Laboratory Press, (1989)). The expression of the HDÇNR10 HA protein was detected by radiolabelling and im~noprecipitation method.
(E. Harlo~, D. Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, (1988)). Cells were labelled for 8 hours with 3~S-cysteine two days post transfection.
Culture media were then collected a~d cells were lysed with detergent (RIPA buffer (150 ~M NaCl, 1% NP-40, 0.1% SDS, 1%
NP-40, 0.5% DOC, 50mM Tris, pH 7.5). (Wilson, I. et al., Id.
37:767 (1984)). Both cell lysate and culture media were precipitated with a HA specific monoclonal antibody.
Proteins precipitated were analyzed on 15% SDS-PAGE gel~.

Exam~le 3 Cloninq and eX~ression of HDGNR10 usin~ the baculovirus expression svstem The DNA sequence encoding the full length H3GNRlO
protein, ATCC ~ , was amplified using PCR
oligonucleotide primers corresponding to the 5' and 3' sequences of the gene:
The 5' primer has the sequence 5' CGGGATCCCTCCATG~ATTAT
CAAGTGTCA 3' and contains a BamHI restriction enzyme site followed by 4 nucleotides resembling an efficient signal for the initiation of translation in eukaryotic cells (J. Mol.
Biol. 1987, 196, 947-950, Kozak, M.), and just behind the first 18 nucleotides of the HDGNR10 gene (the initiation codon for translation is "ATGn).
The 3' primer has the sequence 5' CG&GATCCCGCT
CACAAGCCCACAGATAT 3' and contains the cleavage site for the restriction endonuclease BamHI and 18 nucleotides complementary to the 3' non-translated sequence of the HDGNR10 gene. The amplified sequences were isolated from a 1% agaro~e gel using a com~ercially available kit ( "Geneclean, n BIO 101 Inc., La Jolla, Ca.). The fragment was then digested with the endonuclease BamXI and purified as described above. This frasment is designated F2.
The vector pRG1 (modification of pVL541 vector, discussed below) is used for the expression of the HDGNR10 protein using the baculovir~s expression system (for review see: Summers, M.D. and Smith, G.E. 1987, A manual of methods ~or baculovirus vectors and insect cell culture procedures, Texas Agricultural ~xperimer~al Station Bulletin No. 1555).
This expression vector contains the strong polyhedrin promoter of the Autographa californica nuclear polyhedrosis virus (AcMNPV) followed by the recognition sites for the restriction endonuclease BamHI. The polyadenylation site of the simian virus (SV)40 is used for efficient polyadenylation. For an easy select on of recombinant _~9_ ~iruses the beta-galaC~OS1dase gene from E.coli ls ir.serte~
ln the same orlentatiOn as the polyhedrin promoter followed by the polyadenylation slgnal of the polyhedrin gene. The polyhedrin sequences are flan~ed at both sides by viral sequences for the cell-mediated homologous recombination of co-transfected wild-type viral DNA. Many other baculovirus vectors could be used ln place of pRG1 such as pAc373, pVL941 and pAcIM1 (Luckow, V.A. and Summers, M.D., Vlrology, 170:31-39)-The plasmid was digested with the restriction enzymeBam~I and then dephosphorylated using calf intestinal phosphatase by procedures known ln the art. The DNA was then isolated from a 1% agarose gel as described above. This vector DNA ls designated V2.
Fragment F2 and the dephosphorylated plasmid V2 were ligated with T4 DNA ligase. E.coli B101 cells were then transformed and bacteria identified that contained the plasmid (pBacHDGNR10) with the ~DGNR10 gene using the enzyme BamHI. The sequence of the cloned fragment was confirmed by DNA sequencing.
5 ~g of the plasmid pBacH~GN~10 were co-transfected with 1.0 ~g of a commercially available linearized baculo~irus ("BaculoGold~ baculovirus DNA", Pharmingen, San Diego, CA.) using the lipofection method (Felgner et al. Proc. Natl.
Acad. Sci. USA, 84:7413-7417 (1987)).
l~g of BaculoGold~ ~irus DNA and 5 ~g of the plasmid pR~C~ GNR10 were mixed in a sterile well of a microtiter plate cont~ining 50 ~l of serum free Grace~s medium (Life Technologies Inc., Gaithersbury, MD). Afterwards 10 ~1 Lipofectin plus 90 ~l Grace~s mediu~ were added, mixed and incubated for 15 minutes at room _emperature. Then the transfection mixture was added drop wise to the Sf9 insect cells (ATCC CRL 1711) seeded in a 35 mm tissue culture plate with 1 ml Grace~ medium without serum. The plate was rocked back and forth to mix the newly added solution. The plate was then incubated for 5 hours at 27~C. After 5 hours the transfection solution was removed from the plate and l ml of Grace's insect medium supplemented with 10~ fetal calf serum was added. The plate was put back into an incubator and cultivation continued at 27~C for four days.
After four days the supernatant ~as collected and a plaque assay performed similar as described by Summers and Smith (supra). As a modification an agarose gel with "Blue Gal" (Life Technologies Inc., Gaithersburg) was used which allows an easy isolation of blue stained plaques. (A
detailed description of a l'plaque assay" can also be found in the user~s guide for insect cell culture and baculovirology distributed by Life,Technologies Inc., Gaithersburg, page 9-10) .
Four days after the serial dilution, the viruses were added to the cells, blue stained plaques were picked with the tip of an Eppendorf pipette. The agar containing the recombinant viruses was then resuspended in an Eppendorf tube cont~ining 200 ~l of Grace's medium. The agar was removed by a brief centrifugation and the supernatant containing the recombinant baculoviruses was used to infect Sf9 cells seeded in 35 mm dishes. ~our days later the supernatants of these culture dishes were harvested and then stored at 4~C.
Sf9 cells were grown in Grace's medium supplemented with 10% heat-inactivated ~S. The cells were infected with the recombinant baculovirus V-HDGNR10 at a multiplicity of infection (MOI) of 2. Six hours later the medium was removed and replaced with S~900 II medium minus methionine and cysteine ~Life Technologies Inc., Gaithersburg). 4Z hours later 5 ~Ci of 35S-methionine and 5 ~Ci 35S cysteine (Amersham) were added. The cells were further incubated for 16 hours before they were harvested by centrifugacion and the labelled proteins visualized ~y SDS-PAGE and autoradiography.

Example 4 -~1 -Expression via Gene TheraPv Fibroblasts are obtained from a subject by skin biopsy.-The resulting tissue is placed in tissue-culture medium and separated into small pieces. Small chunks of the tissue are placed on a wet surface of a tissue culture flask, approximately ten pieces are placed in each flask. The flask is turned upside down, closed tight and left at room temperature over night. After 24 hours at room tem~erature, the flask is inverted and the chunks of tissue remain fixed to the bottom of the flask and fresh media (e.g., Ham's F12 media, with 10~ FBS, penicillin and streptomycin, is added.
This is then incubated at 37~C for approximately one week.
~t this time, fresh media is added and subsequently changed every several days. After an additional two weeks in culture, a monolayer of fibroblasts emerge. The monolayer is trypsinized and scaled into larger flasks.
pMV-7 (Kirschmeier, P.T. et a , DNA, 7:219-25 (1988) flanked by the long terminal repeats of the Moloney murine sarcoma virus, is digested with EcoRI and ~indIII and subsequently treated with calf intestinal phosphatase. The linear vector is fractionated on agarose gel a~d purified, using glass beads.
The cDNA encoding a polypeptide of the present invention is amplified using PCR primers which correspond to the 5' and 3~ end sequences respectively. The 5' primer ccntains an EcoRI site.and the 3' primer contalns a ~indIII site. Equal quantities of the Moloney murine sarcoma virus linear bac~bone and the EcoRI and ~indIII fragment are added together, in the presence of T4 DNA ligase. The resulting mixture is maintained under conditiors appropriate for ligation of the two fragments. The ligation mixture is used to transform bacteria ~3101, which are then plated onto agar-containing kanamycin for the purpose of confirming that the vector had the gene of interest properly inserted.

The amphotropic pA317 or GP+aml2 packaging cells are grown in tissue culture to confluent density in Dulbecco~s Modified Eagles Medium ~DMEM) with 10% calf serum tCS), penicillin and streptomycin. The MSV vector containing the gene is then added to the media and the packaging cells are transduced with the vector. The packaging cells now produce infectious viral particles containing the gene (the packaging cells are now referred to as producer cells).
Fresh media is added to the transduced producer cells, and subsequently, the media is harvested from a 10 cm plate of confluent producer cells. The spent media, containing the infectious viral particles, is filtered through a millipore filter to remove detached producer cells and this media is then used to infect fibroblas~ cells. Media is removed from a sub-confluent plate of fibroblasts and quickly replaced with the media from the producer cells. This media is removed and replaced with fresh media. lf the titer of virus is high, then virtually all fibroblasts will be infected and no selection is required. If the titer is very low, then it is necessary to use a retroviral vector that has a selectable marker, such as neo or his.
The engineered fibroblasts are then injec~ed into the host, either aIone or after having been grown to confluence on cytodex 3 microcarrier beads. The fibroblasts now produce the protein product.
Numerous modifications and variations of the present invention are possible in light of the above teachings and, therefore, within the scope of the appended claims, the invention may be prac~iced otherwise than as particularly described.

.
SEQUENCE LISTING
t1) GENERAL INFORMATION:
(i) APPLICANT: Li, ET AL.
(ii) TITLE OF INVENTION: Human G-Protein Chemokine Receptor (iii) NI~E3ER OF SEQUENCES:
(iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: CARELLA, BYRNE, ~AIN, GIL-ILLAN, CECCHI, STEWART & OLSTEIN
(B) STREET: 6 BECRER FARM ROAD
(C) CITY: ROSELAND
(D) STATE: NEW JERSE'f (E) COUNTRY: USA
(F) ZIP: -07Go8 (v) COMPUTER READABLE r OR~i:
(A) MEDIUM TYPE: 3.5 INCX DIS~ETTE
(B) COMPUTER: IBM PS/2 (C) OPERATING SYSTE~I: MS-DOS
(D) SOFTWARE: h-ORD PE~FECT 5.1 (vi) CURRE~T APPLICATION DA-.A:
(A) APPLICATION NUMff3ER:
(B) FlLING DATE: concurrently (C) CLASSIFICATION:
(vii) ATTORNEY~AGBNT INFORMA.IO~-:
(A) N~ME: FERRARG, GR~GORY ~.
(B) REGISTRATION NUMBER: 36,134 (C) REF~RENOEJDûC~T ~-~3ER: 325800-(viii) TELECOMMUNICATION INFORMATION:
(A) TEL~PHONE: 201-994-1700 (a? TEL~FAX: 201- 394-1744 (2) INEORMATION FOR SEQ ID NO:1:
(i) SEQUENF~ CHAR~CTERISTI~S
(A) L~NGTH: 1414 ~A~E ?AIRS
(B) TYPE: NUCLEIC ACIE
(C) STRANDEDNESS: SINGLE
(~) TO~GLOGY: LINEA~
- (ii) MOLECULE TYPE: ~D~
(xi~ SEQUEN~ DESCRI~TION arQ D NO:l: -G~GAGATGG. GCT~C~TG~ A-TCCC_C~ AGAGCC~ GCTCTCCATC TAG-G~AC~G 60 , GGAAGC-LAGC AGCAAACCTT CCCTTCACLA ~GAAAC-.~A T G~T~GGCC C~AAAGAGAG 120 TTAATTCAAT GTAGACATCT ATGTAGGCAA TAAAAACC~ ATTGATGTAT AAAACAGTTT 180 GCATTCATGG AGGG~AACTA AATACA--C AGGACTTTAT ~AAAGATCAC TTTTTATTTA 240 Met Asp Tyr Gln Val Se- Ser Pro Ile Tvr Asp ATC AAT TAT TAT ACA TCG GAG CC~ T~C CCA AAA A.C AAT GTG AAG CAA 339 Ile Asn T~r Tyr Thr Ser Glu Pro Cys Pro Lys Ile Asn Val 'ys Gln ATC GCA GCC CGC CTC CTG CC~ CCG CTC TAC TCA CLG GTG -TC ATC TT- 387 Ile Ala Ala Arg Leu Leu Pro Pro Leu Tyr Se- Leu Val Phe Ile Phe Gly Phe Val Gly Asn Met Leu Val Ile Leu Ile Leu Iie Asn Cys Gln Arg Leu Glu Ser Met Thr Asp I;e T~fr Leu Leu Asn Leu Ala Ile Ser Asp Leu Phe Phe Leu Leu Th_ Vai Pro Phe T_p Ala His Tyr Ala Ala GCC CAG TG& GAC TTT GGA AAT ACA ATG TGT CAA CTC TTG ACA ~G~ CTC 579 Ala Gln Trp Asp Phe Gly Asn Thr Me~ Cys Leu Leu Thr Gly Leu Tyr Phe Ile Gly Phe Phe Ser Giy Ile Phe ~he Ile Ile Gln Leu Leu Thr Ile Asp Arg Tyr Leu Ala Ile Val H_s Ala Val Phe Ala Leu Lys Ala AGG ACG GTC ACC r~-l GGC GTG GTG ACA AGT GTG ATC ACT -GG GTG GTG 723 Arg Thr VaL Thr Phe Gly Vai Val Thr ~er Val Ile Thr Trp Val Val GCT GTG TTT GCG .CT CTC CCA GGA A.C ATC TTT ACC AGA TCT CAA AAA 771 Ala Val Phe Ala Ser Leu Pro Gly Ile Ile Phe Tnr A-g Ser Gln Lys GAA GGT ~-~u CAT TAC ACC TGC AGC TCT CAT r~ CCA TAC AG. CA5 TAT 819 Glu Gly Leu His Tyr Thr cys Ser Ser His Phe Pro I~r Ser Gln Tyr CAA TTC TGG AAG AAT TTC CAG ACA ..~ ~AG A-.A G C ATC ..G GGG CTG 867 Gln Phe Trp Lys Asn Phe Gln Thr Le~ Lys '_e Val i.e Leu Gly Leu GTC CTG CCG,CTG CTT GTC ATG G.C ~._ .GC ~~ TCG GGA ATC CTA AAA 915 Val Leu Pro Leu Leu Val Met Vai iie Cys Ty- Ser Giy Ile Leu Lys ACT CTG C T CGG .GT CGA AA- ~A~ AAC- AAG AC~ CAC AGG GC. GT~ AGG 563 Thr Leu Leu Arg Cys Arg Asn G;u Lys Lys Ars Hls Arg Ala Val Arg CTT ATC TTC ACC ATC ATG A-T G-T -.A ~TT C~C . C -GG GCT C_C TAC 1011 Leu Ile Phe Thr Ile Met I;e Val T~-r Phe Leu 2he .:~ Ala Pro Tyr AAC ATT GTC CTT CTC CTG AAC ACC _C GAG G~A T C ~~ GGC CTG AAT 1059 Asn Ile Val Leu Leu Leu Asn Tnr 2ne Gln G,u Pne Phe Gly Leu Asn AAT TGC AGT AGC TCT AAC AGG TTG G~C CAA G~- A-G CAG G-G ACA GAG 1107 Asn Cys Ser Ser Ser Asn A~s Leu AsF G;n Aia Mee G;n Val Thr Glu AC~ CTT GGG ATG ACG CAC TGC TGC A':'C AAC C;'C ATC ATC -.A'; GCC TTT 1155 Thr Leu Gly Me~ Thr H:is Cys Cys I:e Asn Pro Iie lle ~yr Ala Phe CA 022l6990 l997-ll-27 GTC GGG GAG AAG ..C AG~ AAC TAC CTC TTA GTC ~~~ TTC CAA AAG CAC . 1203,'~
Val Gly Glu Lys Phe Arg Asn Tyr Leu Leu Val Phe Phe Gln Lys His ATT GCC AAA CGC ~G TGC AA~ TGC TGT TCT ATT TTC CAG CAA GAG GCT 1251 Ile Ala Lys Arg Phe Cys Lys Cys Cys Se- Ile Phe G;n Gln Glu ~la CCC GAG CGA GCA AGC TCA GTT TAC ACC CGA TCC ACT GGG GAG CAG G~A 1299 Pro Glu Arg ~la Ser Ser Val Tyr Thr Arg Ser Thr Gly Glu Gln Glu ATA TCT GTG GGC TT~ TGACACGGAC TCAAGTGGGG TGGTGACCCA GLCAGAGTTG 1354 Ile Ser Val Gly Leu TGCACATGGC TTA~ Ll~A TACACAGCC~ GGGCTGG~GG TGGGGTGG~A G~ -l 1414 (2) INFORMATION FOR SEQ ID NO:2:
(i) SEQUENCE CHARACTERISTICS
~A) LENG'rH: AMINO ACIDS
(B) TYPE: AMINO ACID
~C) STRANDEDNESS:
- (D) TOPOLOGY: LINEAR
(ii) MOLECUL~ TYPE: E~OTEIN
(xi) SEQUENOE DESCRIPTION: SEQ ID NO:2:
Met Asp Tyr Gln Val Ser Ser Pro Ile Tyr Asp Ile Asn Tyr Tyr Thr Ser Glu Pro Cys Pro Lys Ile Asn Val Lys Gln Ile Ala Ala Arg Leu Leu Pro Pro Leu Tyr Ser Leu Val Phe Ile Phe Gly Phe ~ Val Gly Asn Met Leu Val Ile Leu Ile Leu Ile Asn Cys Gln Arg Leu Glu Ser Met Thr Asp Ile 'ryr Leu Leu Asn Leu Ala Ile Ser Asp Leu Phe Phe Leu Leu Thr ~~al Pro Phe Trp Ala ~is Tyr Ala Ala Ala Gln Trp Asp Pne Gly Asn Thr Met Cys Leu Leu Thr Gly 95. 100 105 Leu Tyr Phe Ile Gly Pne Phe Ser Gly Ile Phe Phe Ile Ile Gln Leu Leu Thr Ile Asp Arg 'yr Leu Ala Ile Val His Ala Val Phe Ala Leu Lys Ala Arg T~r Val Th- Phe Gly Val Val Thr Ser Val 140 14, 150 Ile Thr Trp Val Val Ala Val Phe ~la Ser Le~ Pro Gly Ile Ile Phe Thr Arg Ser Gln ~ya Glu ~ly Leu His Tyr Thr cys Ser Ser His Phe Pro Tyr Ser Gln Tyr Gln Phe Tr~ Lys ~sn Phe Gln Thr 185 l9C 195 Leu Lys ,le Val Ile LeL Gly ..2U Va~ Le-._ Pro Leu Leli Val Met -4~-.
val Ile Cys Tyr Ser Gly Ile Leu Lys Thr Leu Leu Arg Cys Arg ~sn Glu Lys Lys Arg His Arg Ala Val Arg Leu Ile Phe Thr Ile 230 235 : 240 ~et Ile Val Tyr Phe Leu Phe Trp Ala Pro Tyr Asn Ile Val Leu ~eu Leu Asn Thr Phe Gln Glu Phe Phe Gly Leu Asn Asn Cys Ser ~er Ser Asn Arg Leu Asp Gln Ala Met Gln Val Thr Glu Thr Leu ~ly Met Thr His Cys Cys Ile Asn Prv Ile Ile Tyr Ala Phe Val ~ly Glu Lys Phe Arg Asn Tyr Leu Leu Val Phe Phe Gln Lys ~is ~le Ala Lys Arg Pne Cys ..ys Cys Cys Ser Ile Phe Gln Gln Glu 32G 3~5 330 ~la Pro Glu Arg Ala Ser Ser Jal Tyr rhr Arg Ser Thr Gly Glu ~ln Glu Ile Ser Val Gl-y Leu

Claims (20)

1. An isolated polynucleotide comprising a member selected from the group consisting of:
(a) a polynucleotide encoding the polypeptide as set forth in SEQ ID NO:2;
(b) a polynucleotide encoding a mature polypeptide encoded by the DNA contained in ATCC Deposit No. 97183;
(c) a polynucleotide capable of hybridizing to and which is at least 70% identical to the polynucleotide of (a) or (b); and (d) a polynucleotide fragment of the polynucleotide of (a), (b) or (c).

2. The polynucleotide of claim 1 wherein the polynucleotide is DNA.

3. A vector containing the DNA of Claim 2.

4. A host cell transformed or transfected with the vector of Claim 3.

5. A process for producing a polypeptide comprising:
expressing from the host cell of Claim 4 the polypeptide encoded by said DNA.

6. A process for producing cells capable of expressing a polypeptide comprising transforming or transfecting the cells with the vector of Claim 3.

7. A receptor polypeptide comprising a member selected from the group consisting of:
(i) a polypeptide having the deduced amino acid sequence of SEQ ID NO:2 and fragments, analogs and derivatives thereof; and (ii) a polypeptide encoded by the cDNA of ATCC
Deposit No. 97183 and fragments, analogs and derivatives of said polypeptide.

8. The polypeptide of Claim 7 wherein the polypeptide has the deduced amino acid sequence of SEQ ID
NO:2.

9. An antibody against the polypeptide of claim 7 selected from the group consisting of an antibody which agonizes the activity of the polypeptide and an antibody which antagonizes the activity of the polypeptide.

10. A compound which activates the polypeptide of claim 7.

11. A compound which inhibits activation of the polypeptide of claim 7.

12. A method for the treatment of a patient having need to activate a G-protein chemokine receptor comprising:
administering to the patient a therapeutically effective amount of the compound of claim 10.
.

13. A method for the treatment of a patient having need to inhibit a G-protein chemokine receptor comprising:
administering to the patient a therapeutically effective amount of the compound of claim 11.

14. The method of claim 12 wherein said compound is a polypeptide and a therapeutically effective amount of the compound is administered by providing to the patient DNA
encoding said agonist and expressing said agonist in vivo.

.

15. The method of claim 13 wherein said compound is polypeptide and a therapeutically effective amount of the compound is administered by providing to the patient DNA
encoding said antagonist and expressing said antagonist in vivo .

16. A method for identifying compounds which bind to and activate the receptor polypeptide of claim 7 comprising:
contacting a cell expressing on the surface thereof the receptor polypeptide, said receptor being associated with a second component capable of providing a detectable signal in response to the binding of a compound to said receptor polypeptide, with a compound under conditions sufficient to permit binding of the compound to the receptor polypeptide; and identifying if the compound is an effective agonist by detecting the signal produced by said second component.

17. A method for identifying compounds which bind to and inhibit activation the polypeptide of claim 7 comprising:
contacting a cell expressing on the surface thereof the receptor polypeptide, said receptor being associated with a second component capable of providing a detectable signal in response to the binding of a compound to said receptor polypeptide, with a compound to be screened under conditions to permit binding to the receptor polypeptide; and determining whether the compound inhibits activation of the polypeptide by detecting the absence of a signal generated from the interaction of the ligand with the polypeptide.

18. A process for diagnosing a disease or a susceptibility to a disease related to an under-expression of the polypeptide of claim 7 comprising:
determining a mutation in the nucleic acid sequence encoding said polypeptide.

19. The polypeptide of Claim 7 wherein the polypeptide is a soluble fragment of the polypeptide and is capable of binding a ligand for the receptor.

20. A diagnostic process comprising:
analyzing for the presence of the polypeptide of claim 19 in a sample derived from a host.