CA2226717A1 - Self-contained device integrating nucleic acid extraction, amplification and detection - Google Patents

Abstract

A self-contained device is described that integrates nucleic acid extraction, specific target amplification and detection into a single device. This integration permits rapid and accurate nucleic acid sequence detection. The invention may be used, for example, in the screening for nucleic acid sequences which may be indicative of genetic defects or contagious diseases, as well as for monitoring efficacy in the treatment of contagious diseases.

Description

03/13~97 09:31 F.4~ 303 810 1587 Julle L. Bernard Ihn~
PCTI~JS 9 6 l l l b 3 IPEA/U~ l~ MAR 1997 SELF-CONTAINED DEVICE INTEGRATIl~G ~LJCLEIC
ACll~ EX~RACTION, AMPL~FICATION AND DETECTTON

FIELD OF INVENTION
This invention relates to the general fields of molec~ r biology and S rnc~lic~l sc;ence, and specifir~lly to a method of extracting nucleic acid, amplifying specific target sequences, and ~etec~in~ amplified nucleic acid sequences in a self-cont~ined device. This application, thus, descri~es a self-c.-nt~ined device capable of rapid and ~rC~r~te detection oftarget nucleic acid sequences.

BACKGROUND ~D PR101~ ART
Ihe use of nucleic acid probe tests based on hybrirli7~tion in routine clinical lal~oLatol~ procedures is hindered by lack o~sensitivity. The ability to ampli~ nucleic acids from clinir~l samples has greatly advanced nucleic acid probe tPrhnology, providing the sensitivity l~rl~inf~ in earlier versions 1~ ofnon-isotopicassays. S~ ivi~raffordedbyol rlrot~ probetests lltili7in~ nucleic acid amplification no~ ree~iq that of any other mf~thorl.
Nucleic acid amplifir~ n procedure~s can detcct a single copy of a specific nucleic acid sequence. Routine detecti--n and id~ntification of specific gene sequences have ex~emely broad application in a number of set~ing~ and iIldustries l~e major ba~rier for ~e 1T~ncf~ of technology to routine field testing is the absence of an econ- mic~l and easy-to-use system or apparatus.
In order to cG~ cte in today's cost conscious env~o~ c ,l genetic based testin~ must provide for high throll~hrllt while inco~ur~til~g adequate 2~ controls and safe~uards to pf~,vt;lll false positivc results due to sample cross-cont~min~tion En ~

Current technology involves several steps, althoug_ recent developments are directed toward automa*ng systems for detec*on of the amplified target sequence. The first step, extrac*on of nllcleic acids, is accompliched in a variety of waysj for eY~mple, phenol extraction, S chaotropic reagent extraction, cl~o~ ographic pllrifir,~*on (Qiagen, WO
95/01359, pllrific~tion on silica membranes, speci_cally incorporated herein) and ultracentrifilgation (M~ni~*c et al. (1982) Molecular Cloning A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, speçific-~lly incorporated herein). Phenol is a well-est~bliched health h~7~rd and requires special h~n~ling for waste removal. The extraction method is also tedious and labor mle,lsi~e. Ultriqce~ ;r~g~*on often requires the use of expensive and h~7~rdous çhemic~lc as well as the use of sophisticated and costly eqllipm~nt The process often requires long run *Ines, some*mes involving one or more days of ce. .~ .; r~.g~tion The easiest and fastest method is sep~r~*on using chrom~togr~rhy pllrific~tinn The second step, the ~mplific~*on of the target nllcl~ic acid, employs a variety of enzymes known as polymerases and li~ces. Polymerase chain re~c*~ n (PCR) is the most commonly used ~mplific~*Qn t~çhnique. The gener~l principles and con~litionc for ~mplifir;~tion of m~cl~jc acids using PCR are quite well known in the art; the details of which are provided in numerous l~rt;lences inchl~ling United States Patent No. 4,683,195, United States Patent No. 4,683,202 and United States Patent No. 4,965,188, all to Mullis et al., all of which are specifically incorporated herein. Thus, the details of PCR technology are not included herein. Other approaches 2~ inclllrle ligase chain reaction, Q,B replicase, strand ~1icpl~ment assay, transcnptiQn me~ tçd iSQ ('R cvcling probe technolo_y and mlcleic acid sequence-based amplification (NASBA).
A current protein (1etection technology for ~ntigen-antibody assays involves the use of rnic c~y~licles. Furtherrnore, a variety of mi.;lop~Licle strategies for dip-stick detection ~ntigen-antibody assays are ~

av~ ble for s~mrle, a ~iu~len~y m~rkPte~l at-home pregnancy test (United States Patent No. 5,141,850 to Cole et al., specifically incorporated herein).
Such tests use dyed particles that form a visible line following a specific ~ntigPn-antibody reaction. The instant invention is accompli~hed by hybri~1i7~tiQn of amplicons to ca~ e oligonucleotides bound to miclop~ul icles. That is, the invention disclosed herein detects nucleic acid ~mplicons.
The detection of amplified nucleic acid for clinic~l use relies largely on hy~ri~li7~tion of the amplified product and detection with a probe labeled with a variety of en_ymes and lllminP,scPnt re~gPnt~. United States Patent No. 5,374,524 to Miller, specifically incorporated herein, describes a mlcleic acid probe assay that combines mlçleic acid amplific~tion and solution hybricli7~tion using c~lul~ and reporter probes. These terhniques re~ ; mnlhple re~gPnt~ several washing steps, and speci~li7P-l eqllipm~nt for detec*on of the target mlcleic acid. Moreover, these te~hniques are labor intensive and require teçhnici~n~ with expertise in molec~ r biology.
The use of probes compri~e~l of oli~onllcleotide sequences bound to miclopal~icles is well known and illustrated in prior art. The mPçh~ni~m for chmsnt of oli~omlcleo*des to microp~Licles in hybritli7~*on assays and for the purifica*on of nucleic acids is also well known. European Patent No. 200133, specifically incorporated herein, ~lescrihes the ~tt~t~hment of oligonucleo*des to water-insoluble par~icles less than 50 micrometers in diameter used in hybridization assays for the capture of target nucleo*des.
United States Patent No. 5,387,512 to Wu, specifically incorporated herein, describes the use of oligonucleotide sequences covalently bound to mic~o~ icles as probes for capturing P~R a~plified nncleic acids. United States Patent No. 5,328,825 to Findlay, specifically incorporated herein, also describes an oligonucleotide linked by way of a protein or carbohydrate to a water-insoluble particle. The oligonucleo*de probe is covalently coupled to the miclop~Licle or other solid support. The sensi*ivity and CA 022267l7 l998-0l-l3 specificity of all of the above-reference ~alellls iS based on hybritli7~tion ofthe olig~ mlcleotide probe to the target nucleic acid.
The use of incorporated non-radioactive labels into the ~mrlific~tion reactions for the detection of nucleic acids is also well known in the art.
Nucleic acids modified with biotin (United States Patent No. 4,687,732 to Ward et al., European Patent No. 063879, both specifically incorporated herein), ~ oxin (EuropeanPatentNo. 173251, specificallyincorporated herein) and other haptens have also been used. For eY~mrle~ United States Patent No. 5,344,757 to Graf, specifically incorporated herein, uses a nncleic acid probe co~ at least one hapten as label for hybritli7~tion with a complement~ry target nllcleic acid bound to a solid membrane. The sensilivil~ and specificity of these assays is based on the incol~u~lion of a single label in the ~mrlific~tion re~c*~n which can be ~ietecte~ using an antibody specific to the label. The usual case involves an ~ntiho-ly conjugated to an enzyme. Furthermore, the a~ tion of substrate ~ener~t~s a colorim~tric or fluorescent change which can be detecte~l with an instrument.
Still, the above-described approaches are labor intensive with many steps and washes, require special and costly eqllirmPnt for the ~ieteC*~n of the target mlcleic acid; lequ.le trained staff, and take several hours to complete. Several patents have issued which deal with ~lltom~*on of the processes of amplifir~tion and subsequent ~ietection of the amplicon. These ~le;l~l~ use specialized eqllipment and are still based on the principle of hybri~ tion and immnnoassay technology. For example, European Patent No. 320308, specifically incorporated herein, describes a system detecting t~rget nucleic acids ~mplified by the ligase chain r!~c*on ~ntom~te~l approaches elimin~tt- the need for specially trained personnel, however, the cost of the eqnirment is very high and the possibility of c~ *on still exits since many s~mples will be processed by the same eq ~ipment To elimin~te the issue of col~ tit n, it is CA 022267l7 l998-0l-l3 necess~ry to integrate the three steps outlined above. The self-cont~ine~l device disclosed herein accompli~hçs this goal by integrating çxi~*ng nucleic acid extraction and isothe,rm~l amplification technologies with an innova*ve detec*ion strategy.
The invention described herein provides for the rapid and accurate detection of amplified nucleic acid sequences using a self-cont~ined device.
The possibility of co~ *Qn is elimin~te~l because of the ''Llllow away"
approach ~lesrrihed herein. Flimin~*on of cross co..~ l;on opens the door to mass screening incl~ ing ~lltom~*on The high sensi*ivity of the analysis allows for the early detection of ~ e~e and an oppolLu~iL~y for early tre~ttnçnt The present invention diagnoses the presence of infectious e~ce~ of genetic, b~r,teri~l or viral origin. Analysis by this inven*on can monitor the efficacy of tre~tme,nt, for e~r~mrleJ~ to ms)nitor HIV virus in the plasma of p~*ent~ undergoing therapy. Analysis, according to the inven*on disclosed herein, is easy, requiring little expertise in the art of molecular biology. The cost is ~i~ifis~nt1y less th~n other methods lellLl~y in use to detect amplified nucleic acids. The *me frame for detec*ng an amplified sequence is reduced dr~s*r~lly. There is no danger from potentially h~7~rdous chemic~k;. The analysis does not re.~ e special waste disposal procedures. The requirements of many washes in an immllnometric or hybri~li7~tion approach are eli...;..;.l~l The self-contained device does not require special eqllirme,nt, other than a st~n~l~rd~
constant temperature heat block. The low complexity of the device lends itself to "point of care" testing in clinics and physician's offices. The portability of the device provides for "on site" analysis to detect nucleic acidsequences in the areas of ~orensics, agriculture, enviro~nent and the food industry.
Nucleic acid probe tec_nology has developed rapidly in recent years as the scien*fic co.. l.l.ily has discovered *s value for detection of various diseases, org~ni~m~ or genetic abnorm~li*es ~mplific~tion techniques have provided the sensitivity to qualitatively ~lrl~ e the presence of even minute 4. .it..l ;l ;es of nucleic acid. The drawback to wide spread use of thistechnology is the possibility of cross co..l;~ tion of s~mples since the test is so sensitive. The cost of nucleic acid based testing is high as it requires highly skilled technicians and sophi~tic~te~1 eqllirment One method of eli...;.~ the possibility of carry over from one sample to another, is to use a completely enclosed disposable device.

SUMMARY OF INVENTION
This invention is based on a novel concept for a metho~l for detecting specific DNA or RNA seqll~nces The present invention is ~lçfined by a self-cont~in~-l device integrating mlt~leic acid extraction, ~mrlifiç~tion and ~etection metho~lologies The present invention is a self-co~t~in~d device that .l.Le~les nucleic acid extraction, specific target ~rnrlifiç~tion and .letecti~n into a single device, ~e~ iLLi,lg rapid and accurate nucleic acid seqll~nçe c~etection The present invention is applicable to all nllcleic acids and deliv~liv~;s thereof. The present invention is useful to identify specific nllcleic acid sequences corresponding to certain rli~e~ses or conrlitiQn~ as well as mo~ u~
efficacy in the tre~tment of cont~gious ~i~e~es, but is not int~n-le~l to be limite~1 to these uses.
In an embodiment of the invention, the self-c~nt~ine~l device compri~es a first hollow elong~te~l cylinder with a single closed end and a plllri~lity of chambers therein, a second hollow elong~te~ cylinder positioned conti~ously inside the first cylinder capable of relative rotation.
Sample is introduced into the second cvlinder for extraction. The extracted nllclçic acid is bound to a solid phase membrane or silica, and therefore not eluted from the solid phase by the ~ lition of wash buffer. Amplifir~tion and labeling takes place in the same cylinder. Finally, the labeled, s~mplified product is reacted with miclopalLicles conjugated with receptor WO 97/03348 PCItUS96/11633 specific li~n-ls for detection of the target sequence.
In another embo-liment of the invention, sample is extracted, ~mplified and detected in three separate and sequential chambers.
Other fealules and adv~nt~gçs of the present invention will become a~pa~ form the following detailed ~lesçrirtion, taken in conjunction with the acco~ ing figures, that illustrate by way of e~r~mrle, the principles of the instant invention.
The present invention relates generally to a self-cont~ined device integrating mlr.leic acid extraction, specific target ~mrlific~tion, and ~let~ction This invention relies on the pnncirles of chromatographic mlcleic acid extraction from the s~mrle, ~mrlific~tion of specific target mlcleic acid sequences resllltin~ in a dual labeled amplific~tion product, ligand-receptor bin~ling and miclop~icle technology for ~letection of ~mrlifiecl mlcleic acid. Furth~ormore, the instant invention may rely on mlt~,leic acid hybritli~tion The process according to the present invention is suitable for the *on of all mlcleic acid target sequences. The sensitivity and accuracy of this process are improved col.l~aled to the processes cullc~
used by those slcilled in the art. The invention offers the possibility of co.. l; .. i~tic)n free, rapid and reliable clelr .. ;"~tion of the presence of specific ~mrlified target mlcleic acids.

CA 022267l7 l998-0l-l3 BRIEF DESCRIPTION OF THE FIGURES
Figure 1 is a perspective view of a self-contained device integrating nucleic acid extraction, amplification and ~letection Figure 2 is a sc.l~em~tic of the plcrcllcd se~ling mech~ni~m, S illustrating each of the three device rotational positions: A) closed; B) open;
and C) elute.

Figure 3 is a cross-section view of the upper and lower bodies of the device, showing the hinged cover in the open posi*- n Figure 4 is a perspective view of the hinged cover and the reaction bead c~n~inecl within a re~ction bead chamber having an integral knife-edge.

Figure ~ is a cross-section view of the a~lu,c section of the second hollow elong~tç~l cylinder.

Figure 6 depicts the relative position of the absorbent pad and strip having miclu~hLicles and c~3lulc zones.

Figure 7 depicts a sequential perspective view illu~L~ g the operating sequence of the self-cont~ine~l device.

Figure 8 illustrates the re~çntc and their perspective interaction in the ~mplific~tion chamber of the device in an SDA strategy.

Figure 9 depicts re~,nts and their respective interactions in an ~ltern~te SDA strategy.

Figure 10 depicts the re~g~ntc and their respective interactions in a cycling probe assay Figure 11 illustrates the detection results of isoth~rm~l ~mrlific~tion and detection with bifunctionally labeled amplified target sequence using strand displacement assay.

Figure 12 shows the detection results of a lateral flow assay.

Figure 13 shows the detection results of an ~ltern~te lateral flow.

Figure 14 depicts a NASBA strategy.

Figure 15 shows the results of detection by amplifir~tion with a single labeled primer followed by hybri~i7~tion with a probe co~ a single label.

REFERENCE NUMERALS IN DRAWINGS
First hollow elon~;~t~l 24 Colored miclo~Licles cylinder Capture zone for target 2 Second hollow elongated sequence cylinder 26 Capture zone for control 3 ~inpetl cover sequence 6 Index pin 7 Index notch 9 Absorbent pad Strip 11 ~ç~ction bead 12 Reaction bead chamber 13 Aperture 14 Living hinge Sealing lip 16 Reservoir 17 Solid snrf~e 1 8 Knife-edge 19 Foil or foil/polymer membrane Detection chamber 21 Trans~ viewing window 22 Porous membrane 23 Silica slu~y DETAILED DESCRIPTION OF THE PREFFRRF.n EMBODIMENT
It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the invention as claimed.
The present invention provides a method of detecting an amplified target nllcleic acid sequence that is present in a sample. It is recogr~ized by those skilled in the art that assays for a broad range of target nucleic acid sequences present in a sample may be performç~l in accordance with the present invention. Samples may inchlcle biological s~mrles derived from agriculture sources, b~cteri~l and viral sources, and from human or other animal sources, as well as other samples such as waste or tlrinking water, agricultural products, processed foodstuff, air, etc. FY~mples incln~le blood, stool, 5~ ll11, mllclls, serum, unne, saliva, lea~ ~, a biopsy s~mrl~, an histological tissue sample, a tissue culture product~ an agricultural product, waste or ~1rinkin~ water, foodstuff, air, etc. The present invention is useful for the detection of nncleic acid sequences in~lic~tive of genetic defect~s or cont~gious tli~e-~ses The following ~lefinition~ will be helrfill in lm~ rst~n~linp~ the specification and claims. The ~l~finitions provided herein should be borne in rnind when these terms are used in the following e~mrles and throughout the instant applic~tion As used herein, the term ' kL~ge~ ~nucleic acid molecule refers to the nucleic acid molecule that is amplified by the presente~l methods. The ''ku~;t:l" molecule can be purified, partially purified, or present in an un~u~iCed state in the sample.
As used in this invention, the term "~mrlific~tion" refers to a "template-dependent process" that results in an increase in the concentration o~a nucleic acid sequence relative to its initial concentration. A "template-dependent proce~ss" is ~1efine~l as a process that involves the "template-dependent ext~n~ion" of a "primer" molecule. A "primer" molecule refers CA 022267l7 l998-0l-l3 to a sequence of mlcleic acid that is complement~ry to a porhon of the target or control sequence and may or may not be labeled with a hapten. A
"template dependent exfPncinn~ refers to nucleic acid synthesis of RNA or DNA wherein the sequence of the newly synthesi7ed strand of mll~.leic acid S is dictated by the rules of complement~ry base pa~ing of the target nllcleic acid and the primers.
The present invention relates to the extraction and amplific~*on of mlcleic acids in a chamber of a self-co--l; ;--efl device, followed by lletectinn in a another chamber~ and collection of waste in, yet, another chamber. The re~r,tinn ch~mbPrs are functinn~lly distinct, seqnPnh~l and comp~ct Said çh~mhers deliver precise volumes, dispense re~Pnte and collect waste. All of this occurs in a completely self-cont~in~-l device with eimpl~P fool proof directions for use as ~1es~ribed below.
As illu~ Led in Figure 1, an extrachon, ~mplific~*on and ~let~Pchinn device consists of a first hollow elon~tç~ cylinder 1 having one closed end and an intçgr~lly-molclecl cover 3 hinged to the opposing, open end and a second hollow elon~;~tç~1 cylinder 2 that is po~eitionP(l conti~lously inside the first cylinder 1 and capable of relahve rotation. The ~lcrellc;d embo~limPnt of the second cylinder 2 is a tapered cylinder tçrmin~ting with an aperture 13 having a se~ling lip 15. The first cylinder 1 fi~rther concictc of 2 chambers: a reservoir 16 and a ~letection çh~mhçr 20, said ~3etectinn chamber further cnneiehng of a pad 9 and a strip 10. The bULt~ of the device is composed of a m~tPri~l that does not facilitate binding of mlcleic acids and proteins. The ~rerell~d m~tPri~l is heat and cold recict~nt m~tPri~
which is light weight, rigid and sturdy. The plc;relled size is compact enough to fit into conventional size heat blocks, h~w~ve;r, the size may be scaled up or down, accordingly. The ~ler~lled embodiment inserts the device into a conct~nt temperature environment, such as a heat block, allowing the reactions to proceed at the ~ rclled con~litionc of constant temperature.
When sample is introduced into the device, mlcleic acid extraction and amplification takes place in the second cylinder 2, said first hollow elongated cylinder 2 CO,.~;1i,,;,,g the detection chamber 20 having a means for detection. The reservoir 16 collects the lysis buffer used in the extraction process and subsequent washes.
The second cylinder 2 rotates relative to the first cylinder 1 and locks into position A, position B or position C. At the tapered end of the secon~1 cylinder 2, an aperture 13 having a sealing lip 15 enables the second cylinder 2 to engage with either the ~letectiQn chamber 20 or reservoir 16.
The first cylinder 1 co..l;.;..~ two chambers, the reservoir 16 and the detection chamber 20. The hinged cover 3 has one in~exinp pin 6 used for locking the second cylinder 2 in positions A, B and C. The secon~l cylinder 2 is closed to the reservoir 16 in the A, or closed, position. In the B, or open, position, the secon-l cylinder 2 allows flow to the reservoir 16. In the C, or elute, pocition ~mrlified nucleic acid target and control are able to wick into the tletection chamber 20. The hinged cover 3 also cont~in~ a reaction bead 11 within a reaction bead chamber 12. This bead 11 contains the reaction enzymes and other re~g~nt~ required for the ~mrlific~tiQn step.
The second cylinder 2 contains three notches 7 for in(le~in~ with the in~l~.xing pin 6 and locking the relative rotation of cylinders 1 and 2.
In position A, the second cylinder 2 is sealed, allowing for the extraction step and the amplific~tiQn step to take place, In position B, the second cylinder 2 is such that the opening in the second cylinder 2 is not 2s sealed and is over the reservoir 16. In position C, the second cylinder 2 is rotated such that the second cylinder 2 is not sealed and the openlng is over an absorbent pad 9 located in the detection chamber 20. The absorbent pad 9 collects the ~mrlified product and wicks the product onto a strip 10 of nylon, nitrocellulose or other suitable m~t~.ri~l The strip lO contains colored micro~licles 24 and ca~lule zones for the target 25 and the control 26 sequences. The detection chamber 20 contains a Ll~s~c;.-l viewing window 21 for observing the results of the reaction.
Figure 2 illustrates the ~lcrel~cd embodiment of the sealing mech~ni~m of the device disclosed herein. In open position A, the second cylinder 2 is sealed by a sealing lip 15. The sealing lip 15 is composed of a flexible m~f~ri~l that can be compressed when in contact with a solid surface 17 at the top of the first cylinder 1. In close posit;c n B, rotation ofthe second cylinder 2 relative to the first cylinder 1 allow the contont~ of thesecond cylinder 2 to flow into the reservoir 16 through a porous membrane 22 in the bottom of the second cylinder 2. In this po~i~on, the se~lin~ lip 15 is e,~t~,n~le~l beyond the plane of compression and allows fluid to flow into the reservoir 16. The secc.n~l cylinder 2 can be rotated relative to the first cylinder 1 into elute position C. In this position, the sealing lip 15 is again ~ ,n-le~l beyond the plane of co~-ession over an opening cn.. l~ g an absorbent pad 9 and a strip 10 of m~,mhr~n.? use for the ~etechon step.
A cross-section of the upper 1 and lower 2 body of the device and the hinged cover 3 in the open position is illustrated in Figure 3. The index pin 6 is located on the hinged cover 3. Three index notches 7 are located on the second cylinder 2. The re~ction bead 11 contains lyophili7Pcl enzymes and re~nt~ for the ~mplific~tion re~ction The hinged cover 3 contains a knife-edge 18, which when sllfficienf pressure is applied punctures a foil membrane 19 releasing the reaction bead 11 into the second cylinder 2, as shown in Figure 4.
A cross-section of t,he bottom of the second cylinder 2 is illu~ Led in Figure 5. The sealing lip 15 contains a porous membrane 22~hat binds the extracted nucleic acids or a porous membrane 22 that holds a silica slu~y 23 in the second cylinder 2. A strip 10 co..~ g a region with immobilized colored microparticle 24 and two ca~ c: zones 25, 26 is depicted in Figure 6. The miclo~licles 24 are coated with a receptor that is specific to the target and the control sequence. Target sequence capture zone 25 contains receplo,~ specific for haptens on the target sequence and control sequence ca~ zone 26 contains receptors specific for haptens on the control sequence.
The following ex~mples serve to exrl~in and illustrate the present inven*ion. Said examples are not to be construed as limi*n~; of the inven*on in anyway. Various mo~lifiç~*c~nc are possible within the scope of the invention.

FY~mple 1 Sample Flow Throll~h the Preferred Embodiment of a Self-Contained Device The ~c;r~ ed embodiment of the device ~1icclose~3 herein is rlefinetl by two hollow elon~tetl cylinders, a first cylinder having a closed end, as illustrated in Figure 1, for the extrac*ion, amplific~*on and ~letec*on of mlcleic acid seq~P-nçes. In the close posi*on A, sample is introduced into the second cylinder 2. The second cylinder 2 cont~inc dry lysing re~ent~
for extraction of nucleic acids. The sample provides the liquid that resuspends the lysing re~gentc After a brief inc ~b~*on period with the cover 3 closed, the second cylinder 2 is rotated into open position B. The extracted mlcleic acid remains in the upper chamber bound to the porous membrane 22 or the silica slurry 23, while the liquid flows into the reservoir 16. In this posi*on, several washes of buffer or water follow. Next, the second cylinder 2 is rotated into close position A such that the second cylinder 2 is sealed, water is added and the cover closed. When sl.fficient pressure is applied to the hinge-d cover 3, ~he ~e~sctiQn bead il is rele~ce~
from the reaction bead ch~mber 12 and added to the second cylinder 2 by breaking the foil membrane 19 with the knife-edge 18. The reaction bead 11 carries the enzymes necessary for amplifica*~on, which are resuspended CA 022267l7 l998-0l-l3 in the water and amplification takes place on the membrane 22 or silica slurry 23 c~ the extracted mlcleic acids. After an a~piop"ate incubation period, the second cylinder 2 is rotated relative to the first cylinder 1 into elute position C. The amplification re~ctiQn ~ Lul~ is able to enter the detection chamber 20 as it is absorbed onto the pad 9. When the pad 9 absorbs a sufficient amount of liquid, the reaction ~ ule is wicked up the strip 10. On the strip, the colored micl~licles 24 bind to haptens resnlting from the ~mrlification re~c~ion and travel to the c~lule zone on the membrane where they form a visible line of detec*on if the target sequence is present and for the control sequence. The line of detec*on is viewed from the transparent viewing window 21. See Figure 7.
The second cylinder 2 has a c~r~ity of 0.001 to 25 ml. Sample is whole blood, S~uL~ ., serurn, pl~m~ urine, fecal matter, a tissue, part of an organ or any other source that may cont~in the target mlcleic sequence.
~mple is from hnm~n~, plants or ~nim~l~ and may be ~nvirol.. ~nt~l in nature.
The method and ~lus disclosed herein provides for extremely rapid, econl mic~l nucleic acid detec*on Further, this self-cont~ine~l device ~i~nific~ntly reduces the risk of cross co~ tion in that neither amplific~tion re~g-ont~ nor amplicons are manipulated. The .. i.. ;.. ~l li*on~l instrllment~tion required, a st~n~l~rd heat block, and simrlicily of the protocol, enable the test to be performed easily, anywhere and with a ...;..;~I...l amount of technical experience.

Example 2 Microparticle Selection The ~lc;relled miclo~icles ntili7e~1 in this invention are composed of polymeric m~teri~l~ such as latex polyethylene, polypropylene, polymethylmethacrylate or polystyrene. However, a variety of other synthetic or natural materials may also be used in the ~ ~ion of the miclol)~icles, for example, ~ilic~tes7 par~m~gnetic particles and colloidal gold. The usual form of miclopa.Licles possesses 5nrf~çe sulfate charge groups that can be modified by the introduction of functional groups such as hydroxyl, carboxyl, amine and carboxylate groups. The functional groups are used to bind a wide variety of ligan~ls and receptors to the microp~licles. These groups are selected on the basis of their ability to facilitate binding with the selected member of the ligand-receptor pair, either by covalent binding or adsorption. The plcrcllcd method of ~tt~hment ofthe receptor to the miclop~licles is covalent binding.
The size of the miclo~Licles used in this invention is selected to optimi7e the binding and ~3etPc*on of the labeled amplicons. Microp~Licles are available in a size range of 0.01-10.0 ,~lm in tii~metpr. The ~lerel,cd tli~mPtçr for this embodiment of the invention is a range of 0.01-1.0 ~m, specifically not excln~lin~; the use of either larger or ~m~ller microp~ulicles as a~ liately rlel~ ",;,.ç-l The micro~Licles are activated with a snit~ble lcce~lor for binding to the target ligand. The ~l~,r~lcd miclu~ Licle in the present invention is composed of latex co..~;.;..;..P a colored dye.
In the present invention, miclo~ icle bound lec~lol~ are specific for discreet haptens located on the ends of amplified m~ ic acid seqllPnçes The receptors must be c~p~ble of binding to their specific binding partner (hapten) and, fur~er, çh~ngin~ the derivatized ha~lcl,s from the ~lcrcllcd biotin and digoxigenin neces~it~tes a change in the recep~ols. Conjllg~*on of the receptors to the micropaIticle is accomplished by covalent binding or, in a~ropliate cases, by adsorption of the receptor onto the surface of the microparticle. Techniques for the adsorption or covalent binding of receptors to microparticles are well know in the art and require no further explanation.
In order to prepare the anti-digoxig~onin coated miclop~hlicles, 0.25-1.0 mg/ml of anti--lip~ xi~enin Fab is inc~lbate~l with a susp~n~ion cc~ ;..;..g a final concentration of 1.0% miclop~licles/ml. The miclopa,licles and ~ o~i~;enin Fab are allowed to react for 15 minlltes prior to tre~tment with a~;liv~ g agent for covalent binding. The miclo~Licles are treated with EDAC (l-ethyl-3-(3-dimethylaminopropyl) carbotli~mide) at a final concentration of 0-2.5 mM. The Fab and mic,op~Licles are mixed and incubated ~t room temperature for one hour. Unbound Fab is removed by sllcce~eive washes and the coated rnicr~ icles are resuspended in storage buffer.
Lateral flow assays are performed on nylon or nitrocelllllose membranes spotted with c~u-c; zones of 1.0 ~ t;p~ridin at concentrations between 0.0 and 1.0 mg/rnl.

FY~mplL 3 Amplification The present invention employs a variety of di~.~nl enzymes to ~ccomrlich amplification of the target mlcleic acid sequence, for e~mrle~, polymerases and li~es Polymer~ees are ~lefined by their function of incorporating nucleoside triphosph~tei to extend a 3' hydroxyl ~....;....s of a "primer molecule." As used herein, a "primer" is an oli~onllcleotide, that when hybri~li7ed to a target nncleic acid molecule, possesses a 3' hy~o~yl If ~ ;..-.s that can be ç~tenderl by a polymerase and a hapten label at or near the 5' ~.. ;.. --~. For a general ~li' cn~sion concernin~ polymerases, see Watson, J.D. et al., (1987) Molecular Biology of the Gene, 4th Ed., W.A.
Benj~min, lnc., Menlo Park, CA. Examples of polymerases that can be used in accordance with the methods described herein incln(le, but are not limit~d to, E. coli DNA polymerase I, the large proteolytic fr~gTne.nt of E. coli polymerase I, cornmonly known as "Klenow" polym~rase, Taq-polymerase, T7 polymerase, T4 polymerase, T5 polymerase and reverse transcriptase.
The general principles and conditions for ~mplification of mlcleic acids using polymerase chain reaction, as discussed supra, are well known in ~e art.

-Example 4 Isothermal Amplification Approach to Detection with Labeled Amplified Tar~et Sequence U~in.~ NASBA
The ple~l,cd embodiment for amplification using this invention is an is'othenn~l reaction such as NASBA (United States Patent No. 5,130,238, S specifically incorporated herein) or strand ~ pl~r,ement assay (SDA)(WaLker et al. (1992) PNAS 89:392, specifically incorporated herein). The primary product of the NASBA reaction is single strand RNA.
The NASBA reaction ntili7es a primer co~ a T7 polymerase promoter. Following T7 tr~n~çrirtion, up to 100 copies of target RNA are produced. These copies are the same sequence as the ori in~l target RNA.
They serve as temrl~tes3 thus, star~ing the cycle again and reslllting in up to a billion fold ~mplific~tion of the original tçmrl~te.
In order to incorporate NASBA into the device disclosed herein, probes that allow the fo~ l;on of a bifimr,tion~lly ha~l~ ~i7e~ :~mrlification product have been dçcigne-l For NASBA there are two possible strategies:
1) design amplifir~tion primers that are hapl~ erl and 2) use two L~e..i~ed c~lule oligos which bind to the product RNA. See, for e~mple Figures 8 and 9. The model system chosen is to the HIV POL
gene.
In the instant NASBA ha~le~ l ;on strategy, the T7NASFAM
h~rt~ni~tion rrimer, co..l;1i..i..~ a T7 tr~n~rrirt~e promoter and an :3tt~r.~ 1 fluorescein, binds to the target RNA. A reverse tr~n~crirtase transcribes a DNA copy of the RNA, as illustrated in example B of Figure 14. The original RNA strand is digested by RNase H. A reverse h~l~ l ;on primer, P2NASBIO with attached biotin binds to the ~nti~nce DNA and is ex~en-led by the DNA polymerase activity of the reverse transcriptase. The hapteni7ed primers are as follows:

T7NASFAM (T7-PROMOTER PRIMER):
5'-FI.UORESCEIN

-AATTCTAATACGACTCACTATAGGGTGCTATGTCACTTCCCCTTGGTTCTCTSEQ ID NO:l P2NASBIO (REVERSE PRIMER):
5'BIOTIN-AGTGGGGGGACATCAAGCAûCC;A T GCAAA-3' SEQ ID NO:2 The resnltin~ double-stranded bi-hapt~ni7~tion DNA int~nediate is illustrated in example D of Figure 14. This cnmrle~ gives signal in lateral flow or slide ~ tit~n T7 RNA polymerase binds to the promoter region to m~nllf~ctllre many copies of a minus-sense RNA, as shown in example F of Figure 14. This RNA contributes to the ...~.... r~ctnre of the DNA intermerli~te by similar means. Two ca~L-LIe oligos, each having one hapten of either fluorescein or biotin, bind to the (-)sense RNAs giving bifunctional hapt~ni7~1 complexes. These comrle~es give signal in lateral flow or slide ~p;lntin~tion The h~~ 1 c~u,c oligos ~e~ign~l to bind to the minus-sense RNA product are:

5C(-)NASBA:
15 5'-FLUORESCEIN-TG~CCTG&TGCAATAGGCCC-3' SEQ ID NO:3 3C(-)NASBA:
5'-CCCATTCTGCAGCTTCCTCA-BIOTIN-3' SEQ ID NO:4 Fy~mple 5 Isothermal Amplification Approach to Detection with Bifunctionally Lal~eled Amplified Tar~et Sequence Usin~
Strand Displacement Assay The instant strand displacement assay (SDA) is an example of an isothenn~l ~mplifiç~tion that can be ~letecte~l by using miclop~Licles and bifunctionally labeled product. SDA technology is descIibed in United States Patent No. 5,455,166 to Becton Dickin~on and Col~ ly, specifiç~lly incorporated herein. SDA is isoth~ l amplific~*on based on the W097/03348 PCT~S96111633 ability of a restriction enzyme to nick the unmodified strand of a hemirhosphorothioate from of *s recogniti~ n site and the ability of DNA
polymerase to initiate replication at the nick and flispl~ce the dowllsl~e~
non-template strand. Primers co..l;l;..i..g recognition sites for the nickin~
S restriction enzyme bind to opposite strands of target DNA at positionsfl~nkin~ the sequence to be amplified. The target fr~ment is exponenti~lly amplified by coupling sense and ~ntis~nse reactions in which strands ~lisp1~ce~1 from the sense re~cti~ n serve as a target for the ~ntis~n~e re~ctinn and vice versa.
This set of experim~nts is con-l-lcte~l with composite extt~nsion primers that are labeled with biotin, fam or ~ oxig~nin Bumper primPrs are the same sequence as provided by Becton Dicl~inson and Co~
(Franlclin Lakes, New Jersey). The sequences of the target, ~e l~ cr primer and the composite e~t~nsion primer are as follows:

Bumper l~
B 1: 5'-CGATCGAGCAAGCCA SEQ ~ NO:5 B2: 5'-CGAGCCGCTCGCTGA SEQ ~ NO:6 Composite e~t~n~ion primPrS:
Sl: 5'-f~dig-ACCGCATCGAATGCATGTCTCGGGTAAGGCGTACTCGAC6EQ ~ NO:7 S2: 5'-bio~-CGATTCCGCTCCAGACTTCTCGGGTGTACTGAGATCCCCT SEQ ~ NO:8 Target sequence:
5'TGGACCCGCCAACAAGAAGGCGTACTCGACCTGAAAGACGTTATCCACCAT
ACGGATAGGGGATCTCAGTACACATCGATCCGGTTCAGCG SEQ ~ NO:9 The reaction is set up per the thermophilic Strand Displacement ~mplific~tion (tSDA) protocol developed by Becton Dickinson and Co.
The target or~nism is Mycobacterium tu~erculosis. For pilot studies, an artificial target temrl~te con~i~tinP; of the 9 lnt sequence of the M.
tuberculosis genome, defined by the Becton Dickinson outer (bumper) primers, is used. ~mplific~tion conditions used are identical to those used by Becton Dickinson for tSDA.
S Membrane used for this procedure is nitrocellulose, purchased from Millipore Corporation, Bedford, MA. A stripe of ~llc~ridin at a conce~ ion of 1 mg/ml is applied at a rate of 1 ~ll/cm via a linear reagent striper (IVEK Corporation, No. Sprin fiel~l VT) 1 cm from the bottom edge of the memhr~ne After applis~tiQn of the ~LIc;~.~idin, the membrane is allowed to dry and then blocked for non-specific bin~lin~ by 0.5% casein in 100 mM Tris, pH 7.4. The membranes are washed tw~ce with water (ddH2O) and allowed to dry. Next, 3 !11 of anti-S 1 (complem~nt~ry to S 1 without the biotin label) andlor S2 primer (complem~nt~ry to S2 without the dig or fam label) is spotted onto a second membrane. This m~mhr~ne is sandwiched onto the first memhr~ne in order to ca~ e free primers that co~e~e with the product for the mic~u~Licles or ~ idin c~lule zone. The miclo~alLicles are plcpaled as outlined supra in Fx~mple 2 with either anti-~ oxig~nin Fab or anti-fam monoclonal IgG. The miclo~Licles are diluted 1:2 with a 35% sucrose solution and 3 ~11 applied directly to the membrane and dried.
The re~c~tion product (10 ~11) is added to 45 ~11 SDA buffer, then applied (50 ~,11) to the previously striped membrane. Applic~tion of the sample requires the bifunctionally labeled product and the competing primers to pass through the anti-primer coated membrane and the dried microparticles. When the target is present, there is a visible line on the membrane. When the target is not present, ~ere is absense of a visible line.
The results of one such experiment are shown in Figure 11.

Example 6 Inhibition Assav: Loss of Visible Si.~l on Lateral Flow Membrane CA 022267l7 l998-0l-l3 Cycling probe tec_nology involves a mlcleic acid probe that incorporates DNA-RNA-DNA sequences ~lesipned to hybridize with the target sequences. See, for example, Figure 10. The probes are bifunctionally labeled with biotin and fam. If the probes hybridize with the target generating double stranded nucleic acid, RNase H in the reaction buffer cleaves the probes. This cleavage results in loss of signal when applied to a membrane co~ -g a ca~ e zone of ~Lle~ idin and anti-fam co~te~l, colored mi~;lop~icles. If the target is not present, there is a visible line on the membrane.
lo The specific probe and target employed in the instant example havebeen ~lesi~ned by ID Biomedical Corporation for use in ~letec*n~
Mycobacterium tuberculosis. The probe is a çhimeric construct co~ g both DNA and RNA sequences with labels on the 5' (fam) and the 3' (biotin) ends of the DNA portion of the probe. The bintlinP~ of the probe to a single strand of target generates double stranded mlcleic acid which is cleaved with RNase H, thus, elimin~ting the bifunction~ y of the probe. The sequence of the probe is ~les~ribed below:

FARK2S3B probe 20 5'- fam AAA GAT GT agag GGT ACA GA-3'biotin SEQ ID NO:10 (lower case indicates dw~l ib~ bases) The sequence of the target is described below:
ARK2-T synthetic target 5'- AAT CTG TAC CCT CTA CAT CTT TAA-3 ' SEQ ID NO: 11 2s The reaction is completed following the protocol provided by ID
Bi~ m~r1ical Corporation. Membrane used for this procedure is nitrocellulose, purchased from Millipore Corporation, Bedford, MA. A

CA 022267l7 l998-0l-l3 WO 97t03348 PCTtUS96/11633 stripe of ~ idin at a concentration of 1 mg/ml is applied at a rate of 1 I/cm via a linear reagent striper (IVEK (~orporation, No. Springfie~ VT) 1 cm from the bottom edge of the membrane. After applic~tion of the ~LIG~ ~d~n, the membrane is allowed to dry and then blocked for non-specific binding by 0.5% casein in 100 mM Tris, pH 7.4. The membranes are washed twice with water (ddH70) and allowed to dry. The miclopallicles used are ~ d as ouclined supra in Fx~mrle 2, repl~.ing anti-digoxigenin Fab with anti-fam monoclonal IgG.
The reaction product (10 ~11) is added to 5 ~11 of 0.1% anti-fam coated microp~licles (0.1%) and 35 ~11 of water, then applied (50 ~1) to the previously striped membrane. The binding of the probe to the target followed by cleavage of the probe by RNase H, results in loss of the bifimrtion~lity of dle probe. When the target is present, the absence of a visible line on the membrane exists. When the target is not present, the bifimction~lly labeled probe is able to bind the anti-fam coated micr~pa.Licles and the ~ ~vidin bound to the membrane, rçsnltinp in a visible line. The results of one such exrlonment are shown in Figure 12.
With amplifi~tion, certain specimen~ are inhibitory to the amplific~tion re~ction providing false-negative results. To avoid this problem, a positive control -- a control mlrleic acid wi~ primer recognition sequences attached to a totally irrelevant nnclçic acid sequence -- is incorporated. This positive control primer is a component of the mlrleic acid extraction re~entc in second cylinder of the device, thus, controlling for sample extraction and delivery as well as detecting ~mrlifis~tion failure.
The lJlertlled embodiment of the positive control is a l~mh~1~ DNA
sequence. The control nucleic acid is extr~cted ~nd ~m~lifie~l along with the target nucleic acid and is detected by a line of immobile anti-digoxi~çnin beads on the detection solid phase.
The target oligonucleotide primer and the control oligonucleotide primer used in this invention contain at least one hapten as label which does CA 022267l7 l998-0l-l3 not participate in the priming reaction. The hapten is bound to at least one position of the nucleic acid primer. For the deriv~ti7~ti-)n of nucleic acid primers, various methods can be employed. See, ~ni~ti~ supra The incorporation of the hapten can take place enzym~tic~lly~ chemically or photochemic~lly. The hapten can be derivatized directly to the 5' end of the primer or contain a bridge 1 to 30 atoms long. In the ylere:lled embo~im~nt the bridge is linear. However, in an ~ltern~te embo-1iment the bridge consists of a branched chain with a hapten molecule on at least one of the chain ends. By means of the presence of several hapten molecules on the ends of a branched chain, the detection sen~ilivil~ is increased. The ylc:relled haptens for the present invention are biotin and digoxig~nin however, other haptens having a receptor as specific binding agent available are suitable, for ex~mple, steroids, h~lo~ and 2,4 di~ uyhenyl.

Example 7 Detection of Bifunctionally Labeled Amplified Product Membrane used for this procedure is nitrocel1ll1Osç, purchased from Millipore Coryoration, Bedford, MA. A stripe of ~Llcy~vidin at a concentration of 1 mg/ml is applied at a rate of 1 ~lVcm via a linear reagent striper (IVEK Corporation, No. Sprin~fiel~l VT) 1 cm from the bottom edge of the membrane. After applic~tion of the ~Ll~yL~vidin, the membrane 2û is allowed to dry and then blocked for non-specific bin~linp~ by û.5% casein in 100 mM Tris, pH 7.4. The membranes are washed twice with water (ddH20) and allowed to dry.
The amplification product is added to the membranes with colored receptor coated beads at rlilll*onc of 0.001-1.0% microy~hlicles/ml. This mi~ule is allowed to wi~ p the m~mbrane. Positive reac~on~ result in a colored line where the capture material is applied. Amplific~tiQn reactions without the target sequence added to the reaction serve as negative controls.
The results of one of these exp~rim~nt~ are illustrated in Figure 13.
If the target and control mlclçic acid sequence are present, the CA 022267l7 l998-0l-l3 receptor bound miclop~hlicles interacts with h~pt~n(s) to c~Lule the zlmplified mlcleic acid. The result, a line of dyed particles visible on the membrane for the target and for the control nucleic acids. If the target is not present, the dyed particles are not c~~ d and are not visible. When the result of the analysis is negative, the control nucleic acid sequences must be visible inllica1in~ that the extraction and ~mplification were perforrned correctly.

Example 8 Detection by Amplification with a Sin~le Labeled Primer Followed by Hybridization with a Probe That Contains a Sin~le Label The target mlcleic acid sequence is amplified by PCR using 200-1000 mM primer concc~ lion, GeneAmp EZ rTth RNA PCR kit (Perkin Elmer Corp., ~l~m~d~ CA) and 106 copies/ml of the target HrV RNA
sequence. Forty PCR cycles, each cycle being 60~C for 15 ~ es, 95~C
for 15 seconds, and 55~C for 60 seconds, are run.
The sequences of the primers is as follows:

SK38 Dig Primer 5'-DIG ATA ATC CAC CTA TCC CAG TAG GAG AAA T-3 ' SEQ ID NO: 12 SK39 Primer 20 5'-TT TGG TCC TTG TCT TAT GTC CAG AAT GC-3 ' SEQ ID NO: 13 Specific PCR reachon conditions are described below:
Reagent Final conc.
SX EZ Buffer lx Mn(OAc)2 3 mM
rTth polymerase 5 U
dntp's 240 ~lM each WO 97/03348 PCTtUS96tll633 SK38 1 ~lM
SK39 1 ',IM
rTth DNA Polymerase from Perkin Elmer N808-0097 The SK38 Dig----SK39 amplicon (5 ~11) is incubated with 5 ~1 of 25 S ~lM (125 pmol) SK39 biotin at 95~C for 1 mimlte, and then 55~C for 1 minute. The amplicon bound to the anti-digoxigenin microparticles wicks through the membrane to the alle~L~ridin line and is c~lu~ed by the interaction of biotin and ~Llepl~idin. The result is a visible line of colored micro~u licles.
In the negative control, the procedure is performed as described above, but without the addition of the target sequence. Without the presence of the target sequence in the ~mplific~*on re~c*on, the bifunctionally labeled amplicon is not generated and the visible line of detectiQn is not present. The results of one such t~ .ent are shown in Figure 15.

FY7~mrle 9 Alternate Embodiment of a Self-Contained Device ~s~mrle is introduced into an extraction chamber for extraction of nucleic acid. This chamber incorporates a nncleic acid extraction/solid phase mlcleic acid binding protocol providing a rapid method of nllcleic acid purification. The p~e~,led extraction method makes use of chaotropic agents such as guanidine isothiocynate to disrupt the cell membranes and extract the nucleic acid. Proteins are degraded by protein~ces. The extracted nucleic acid binds to a solid phase membrane in the extraction charnber. The nucleic ~cid i~ eluted from the solid phase bv the addition of - 25 elution buffer. The design of a fitting between the solid phase membrane and a seal prevents waste from e.ntPrin~ the amplific~tion chamber.
After the sample is added to the extraction chamber, a supply assembly unit locks onto the top of a processor ~sPtnhly unit by cornecting a first and a second fitting. Following a 10-15 minute incubation allowing nucleic acid extraction, the first of four plungers is depressed. Air in a compartment forces the extraction l~ we past the solid phase membrane binding the nucleic acid. The filtrate is collected in a S waste chamber. Depression of the second plunger forces a wash buffer stored in a wash buffer compartment across the solid phase membrane and filtrate passes to the waste chamber. The seal located directly below the solid phase membrane is disposed at an angle to aid in efficiellt collection of the waste. Depressing the third plunger forces air stored in a co~ ~L.llent across the solid phase m~mhr~ne inellring that all of the wash buffer is removed. The processor ~cs~mhly unit twists, simlllt~neously breaking the seal and closing off a waste chamber conduit. Depressing the fourth pllm~er delivers an elution buffer stored in a co~ ent for elution of the mlt~leic acid from ~e solid phase and delivers a volume of ml~leic acid into an ~mplific~*on chamber.
In the ~ le embo~im~nt the ~mrlifi~*on chamber cr ~ the re~gent~ for ~mrlific~*on and hyhri~li7~*on In ~d~iition~ t~orn~*ve embo~liment~ re~qg~nt~ for ~mplification and hybritli7~*0n are in separate sh~mhers. This process is char~ct~ri7erl in that the sample is treated, after ex~action, with two distinct labeled oligonucleotides primers. The sequence of the first primer is complement~ry to a partial sequence of a strand of the target nucleic acid and is labeled with hapten, for sx~mple~
biotin. The sequence of the second primer is complem~nt~ry to a partial sequence of the control mlcleic acid and labeled with a second hapten, for example, ~ Qxi~enin Eitherprimermay contain apromoterregion.
Subjecting the ~ e to amplificatiorl preferal:~y iso,~h~ mrlific~*on, results in hapten labeled target and control nucleic acid. These labeled, ~mplified mlcleic acid sequences react with oligonucleotides conjugated to miclopa~licles of suitable color and diameter for ~letection The rnicroparticles are conjugated with an oligo specific for binding nucleic acid sequence on the target. The microparticles are conjugated with an oligo specific for binding nucleic acid on the control. The resnl*ng miclo~Licles, bound by hybritli7~*on to the amplicons, are ~letecte-l in the detection chamber.

FY~mple 10 Extraction of Nucleic Acids with Ouanidinium Thiocyanate onto Glass (Silica Dioxide) and Subsequent Amplification Without Elution from Silica Dioxide A column was constructed using Ansys 0.4 mm membrane as filter to contain the silica dioxide and a syringe al)pal~lus to pull buffer through the colllmn in a~plo~lllalcly 15 seconds. 50 ~11 serum, 2 ~11 SiO2 (0.5 mg/~
and 450 ~11 GuSCN lysis buffer are mixed by ~tllc~g and then incubated at room tempc.~Lule for 10 ...~ S The specific lysis buffer for the instant set of eXperimPnt~ cont~in~ 14.71 g GuSCN (4M final), 0.61 ml "Triton X-100", 5.5 ml 0.2M EDTA pH 8.0 and is q.s. to 31.11 ml with 0. lM Tris-HCl pH 6.4. The silica ~lio~ e is washed twice with 500 ~11 70% ETOH.
Next, the filter with SiO2 is removed from the column and the SiO2 washed off of the membrane using 20 ~11 water (ddH20). 5 ~11 silica dioxide slurry is added to a PCR reaction using st~n-l~rd protocol for HIV model system, as detailed supra in Fx~mrle 8.
The instant invention provides a rapid, simple and accurate metht)-l of ~letectinp; ~mplified target nucleic acid sequences with a self-c- nt~in~
device. Sensitivity and specificity of the assay are based on labeling of the target, by incorporating label or by subsequent hyhri~li7~tion of labeled probed, during the amplification process. The method does not require costly and sophisticated equipment or specially trained pers~nn~l nor does it pose any health hazard.
While the above ~les~rirtion contains many specificities these should not be construed as limit~tion~ on the scope of the invention, but rather an exemplification of the ~lcre~lt;d embodiment thereof. Many other v~ri~tionc are possible, such as amplif~ing several target s~mplec in the same re~c*on ~IUIe, llfili7in~ newly discovered polymerases and lig~cec, etc. Thus ~e scope of the invention should be (1~ ed by the appended clairns and their legal equivalents, rather than by the e~mI~le given.

CA 022267l7 l998-0l-l3 SEQUENCE LISTING
( 1 ) ~N~T INFORMATION:
(I) APPLICANT: John C. Gerdes Lynn D. Jankovsky Diane L. Kozwich (ii) TITLE OF lNv~N~l~lON: SELF-CONT~TN~n DEVICE
INTEGRATING NUCLEIC ACID
EXTRACTION, AMPLIFICATION
AND DETECTION
(iii)NUMBER OF SEQUENCES: 9 (iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: Julie L. Bernard, Attorney at Law (B) STREET: 9000 E. Inspiration Drive 15 (C) CITY: Parker (D) STATE: Colorado (E) COUN'1'KY: USA
(F) ZIP: 80134-8535 (v) COM~U'1'~K R~n~RT.~ FORM:
(A) MEDIUM TYPE: Diskette, 3.5 inch (B) COM~U~1~K: IBM PC Compatible (C) OPERATING ~Y~l~M: MS-DOS
(D) SOFTWARE: WordPer~ect 6.0 (vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER:
(B) FILING DATE: 12 July 1996 (C) CLASSIFICATION:
(vii)PRIOR APPLICATION DATA:
(A) APPLICATION NUMBER: 60/000885 (B) FILING DATE: 13 July 1995 (viii)ATTORNEY/AGENT INFORMATION:
(A) NAME: Julie L. Bernard (B) REGISTRATION NUMBER: 36,450 (C) REFERENCE/DOCRET NUMBER: IAD-1 35 (ix) TELECOMMUNICATION INFORMATION:
(A) TELEPHONE: 303 841 7472 (B) TELEFAX: 303 840 1567 W097/03~8 PCT~S96/11633 (2) INFORMATION FOR SEQ ID NO:l:
(I) SEQUENCE C~ARACTERISTICS:
(A) LENGTH: 52 bases (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ix) SEQUENCE DESCRIPTION: SEQ ID NO:l:
AATTCTAATA CGACTCACTA TAGGGTGCTA TGTCACTTCC

10 (2) INFORMATION FOR SEQ ID NO:2:
(I) SEQUENCE ~AR~CTERISTICS:
(A) LENGTH: 29 bases (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ix) SEQUENCE DESCRIPTION: SEQ ID NO:2:
AGTGGGGGGA CATCAAGCAG CCATGCAaA 29 (2) INFORMATION FOR SEQ ID NO:3:
(I) SEQUENCE ~ARACTERISTICS:
(A) LENGTH: 20 bases (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ix) SEQ~NC~ DESCRIPTION: SEQ ID NO:3:
TGGCCTGGTG ~A~ GCCC 20 (2) INFORMATION FOR SEQ ID NO:4:
(I) SEQUENCE ~ARA~TERISTICS:
(A) LENGTH: 20 bases (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: l; n~
(ix) SEQUENCE DESCRIPTION: SEQ ID NO:4:

(2) INFORMATION FOR SEQ ID NO:5:
(I) SEQUENCE ~AR~CTERISTICS:
(A) LENGTH: 15 bases (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ix) SEQUENCE DESCRIPTION: SEQ ID NO:5:

W097/03348 PCT~S96/11633 (2) INFORMATION FOR SEQ ID NO:6:
(I) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 15 bases (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY~ line~
(ix) SEQUENCE DESCRIPTION: SEQ ID NO:6:

(2) INFORMATION FOR SEQ ID NO:7:
(I) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 40 bases (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: l; n e~ r (ix) SEQUENCE DESCRIPTION: SEQ ID NO:7:

(2) INFORMATION FOR SEQ ID NO:8:
(I) SEQUENCE ~ARACTERISTICS:
(A) L~N~'1'~: 40 bases (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ix) SEQUENCE DESCRIPTION: SEQ ID NO:8:

25 (2) INFORMATION FOR SEQ ID NO:9:
tI) SEQu~N~ r~ARACTERISTICS:
(A) L~N~1~: 92 bases (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ix) SEQUENCE DESCRIPTION: SEQ ID NO:9:
TGGACCCGCC ~ArAAGAAGG CGTACTCGAC CTr-AAAr-ACG
TTATCr~Cr-A TACGGATAGG GGATCTCAGT A~A~ATCGAT

35 (2) INFORMATION FOR SEQ ID NO:10:
(I) SEQUENCE r~ARACTERISTICS:
(A) LENGTH: 20 bases (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ix) SEQUENCE DESCRIPTION: SEQ ID NO:10:
AAAGATGTag agGGTACAGA 20 CA 022267l7 Isss-ol-l3 W097/03348 PCT~S96/11633 (2) INFORMATION FOR SEQ ID NO:11:
(I) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 24 bases (B) TYPE: nucleic acid (C) STRANDEDNESS: single . (D) TOPOLOGY: linear (ix) SEQUENCE DESCRIPTION: SEQ ID NO:11:

(2) INFORMATION FOR SEQ ID NO:12:
(I) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 28 bases (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: l;ne~r 15 (i~) SEQUENCE DESCRIPTION: SEQ ID NO:12:
ATAATCCACC TATCCCAGTA G~ ~ 28 (2) INFORMATION FOR SEQ ID NO:13:
(I) SEQUENCE ~R~cTERIsTIcs:
(A) LENGTH: 28 bases (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: l;ne~r (ix) SEQu~ DESCRIPTION: SEQ ID NO:13:
TTTGGTCCTT ~l~C~ ATGTC CAGAATGC 28

Claims (10)

We claim:

1. A self-contained device for the extraction, amplification and detection ofnucleic acid sequences, which comprises:
a) a first hollow elongated cylinder having an open end and a closed end, said cylinder further having a plurality of chambers therein, each chamber having an upper proximate end and a lower distal end;
b) a second hollow elongated cylinder positioned contiguously inside said first cylinder and having an upper distal end and a lower proximate end with an aperture and sealing lip interposed and connecting via rotation said lower proximate end of the second cylinder to said upper proximate end of each chamber of said first cylinder, said second cylinder further having three indexing notches disposed equidistance from each other on the upper distal end of the cylinder; and c) a cover integrally hinged to the open end of the first cylinder, said cover having a reaction bead chamber integral with a knife-edge, said chamber hermetically sealed with a membrane and housing a reaction bead, said cover further having an indexing pin disposed diametrically to the hinge for indexing with said notches during rotation of said first cylinder in relation to said second cylinder.

2. The self-contained device as defined in claim 1, wherein said second hollow elongated cylinder further comprises an extraction and amplification means.

3. The self-contained device as defined in claim 2, wherein said extraction means includes dry lysing reagent for nucleic acid extraction.

4. The self-contained device as defined in claim 2, wherein said amplification means includes polymerases or ligases.

5. The self-contained device as defined in claim 1, wherein said first hollow elongated cylinder's plurality of chambers includes a reservoir chamber and a detection chamber.

6. The self-contained device as defined in claim 5, wherein said reservoir is defined by the continuous sides of said first hollow elongated cylinder, said detection chamber and a porous membrane, said membrane having pores of a size to enable fluid to pass through.

7 The self-contained device as defined in claim 5, wherein said detection chamber further comprises a detection means.

8. The self-contained device as defined in claim 1, wherein said detection means includes an absorbent pad and a strip having colored microparticles and capture zones.

9. The self-contained device as defined in claim 1, wherein the amplification target is any specific nucleic acid sequence.

10. The self-contained device as defined in claim 1, wherein said membrane is selected from the group consisting of foil and foil/polymer.