CA2228635C - Mammalian apoptosis inhibitor protein gene family, primers, probes and detection methods - Google Patents

Mammalian apoptosis inhibitor protein gene family, primers, probes and detection methods Download PDF

Info

Publication number
CA2228635C
CA2228635C CA002228635A CA2228635A CA2228635C CA 2228635 C CA2228635 C CA 2228635C CA 002228635 A CA002228635 A CA 002228635A CA 2228635 A CA2228635 A CA 2228635A CA 2228635 C CA2228635 C CA 2228635C
Authority
CA
Canada
Prior art keywords
xaa1
iap
seq
cys
leu
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Fee Related
Application number
CA002228635A
Other languages
French (fr)
Other versions
CA2228635A1 (en
Inventor
Stephen Baird
Robert G. Korneluk
Peter Liston
Alexander E. Mackenzie
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Ottawa
Original Assignee
University of Ottawa
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from US08/511,485 external-priority patent/US5919912A/en
Application filed by University of Ottawa filed Critical University of Ottawa
Priority to CA002403947A priority Critical patent/CA2403947C/en
Publication of CA2228635A1 publication Critical patent/CA2228635A1/en
Application granted granted Critical
Publication of CA2228635C publication Critical patent/CA2228635C/en
Anticipated expiration legal-status Critical
Expired - Fee Related legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4747Apoptosis related proteins
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/16Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • A61P31/14Antivirals for RNA viruses
    • A61P31/18Antivirals for RNA viruses for HIV
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • A61P9/10Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/502Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing non-proliferative effects
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57407Specifically defined cancers
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57407Specifically defined cancers
    • G01N33/57419Specifically defined cancers of colon
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57407Specifically defined cancers
    • G01N33/57423Specifically defined cancers of lung
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57407Specifically defined cancers
    • G01N33/57426Specifically defined cancers leukemia
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57407Specifically defined cancers
    • G01N33/5743Specifically defined cancers of skin, e.g. melanoma
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6872Intracellular protein regulatory factors and their receptors, e.g. including ion channels
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00Genetically modified animals
    • A01K2217/05Animals comprising random inserted nucleic acids (transgenic)
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00Genetically modified animals
    • A01K2217/07Animals genetically altered by homologous recombination
    • A01K2217/075Animals genetically altered by homologous recombination inducing loss of function, i.e. knock out
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/118Prognosis of disease development
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/136Screening for pharmacological compounds
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/156Polymorphic or mutational markers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/158Expression markers
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2500/00Screening for compounds of potential therapeutic value
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2510/00Detection of programmed cell death, i.e. apoptosis

Abstract

Disclosed is substantially pure DNA encoding mammalian IAP polypeptides; substantially pure polypeptides; and methods of using such DNA to express th e IAP polypeptides in cells and animals to inhibit apoptosis. Also disclosed a re conserved regions characteristic of the IAP family and primers and probes fo r the identification and isolation of additional IAP genes. In addition, metho ds for treating diseases and disorders involving apoptosis are provided.</SDOAB >

Description

MAMMALIAN APOPTOSIS INHIBITOR PROTEIN GENE FAMILY, PRIMERS, PROBES AND DETECTION METHOD
ckcrroundc~f the s The invention relates to apoptosis.
There are two general ways by which cells die.
The most easily recognized way is by necrosis, which is usually caused by an injury that is severe enough to disrupt cellular homeostasis. Typically, the cell's ~o osmotic pressure is disturbed and, consequently, the cell swells and then ruptures. When the cellular contents are spilled into the surrounding tissue space, an inflammatory response often ensues.
The second general way by which cells die is ~s referred to as apoptosis, or programmed cell death.
Apoptosis often occurs so rapidly that it is difficult to detect. This may help to explain why the involvement of apoptosis in a wide spectrum of biological processes has only recently been recognized.
2o The apoptosis pathway has been highly conserved throughout evolution, and plays a critical role in embryonic development, viral pathogenesis, cancer, autoimmune disorders, and neurodegenerative disease. For example, inappropriate apoptosis may cause or contribute 2s to AIDS, Alzheimer's Disease, Parkinson's Disease, Amyotrophic Lateral Sclerosis (ALS), retinitis pigmentosa and other diseases of the retina, myelodysplastic syndrome (e. g. aplastic anemia), toxin-induced liver disease, including alcoholism, and ischemic injury so (e. g. myocardial infarction, stroke, and reperfusion injury). Conversely, the failure of an apoptotic response has been implicated in the development of cancer, particularly follicular lymphoma, p53-mediated carcinomas, and hormone-dependent tumors, in autoimmune ss disorders, such as lupus erythematosis and multiple sclerosis, and in viral infections, including those associated with herpes virus, poxvirus, and adenovirus.
In patients infected with HIV-1, mature CD4+
T lymphocytes respond to stimulation from mitogens or s super-antigens by undergoing apoptosis. However, the great majority of these cells are not infected with the virus. Thus, inappropriate antigen-induced apoptosis could be responsible for the destruction of this vital part of the immune system in the early stages of HIV
~o infection.
Baculoviruses encode proteins that are termed inhibitors of apoptosis proteins (IAPs) because they inhibit the apoptosis that would otherwise occur when insect cells are infected by the virus. These proteins ~s are thought to work in a manner that is independent of other viral proteins. The baculovirus IAP genes include sequences encoding a ring zinc finger-like motif (RZF), which is presumed to be directly involved in DNA binding, and two N-terminal domains that consist of a 70 amino zo acid repeat motif termed a BIR domain (Baculovirus IAP
Repeat).
summary of the Invention In general, the invention features a substantially pure DNA molecule, such as a genomic, cDNA, or synthetic zs DNA molecule, that encodes a mammalian IAP polypeptide.
This DNA may be incorporated into a vector, into a cell, which may be a mammalian, yeast, or bacterial cell, or into a transgenic animal or embryo thereof. In preferred embodiments, the DNA molecule is a murine gene (e.g., m-so xiap, m-hiap-l, or m-hiap-2) or a human gene (e. g., xiap, hiap-1, or hiap-2). In most preferred embodiments the IAP gene is a human IAP gene. In other various preferred embodiments, the cell is a transformed cell. In related aspects, the invention features a transgenic animal containing a transgene that encodes an IAP polypeptide that is expressed in or delivered to tissue normally susceptible to apoptosis, i.e., to a tissue that may be harmed by either the induction or repression of s apoptosis. In yet another aspect, the invention features DNA encoding fragments of IAP polypeptides including the BIR domains and the RZF domains provided herein.
In specific embodiments, the invention features DNA sequences substantially identical to the DNA
~o sequences shown in Figs. 1-6, or fragments thereof. In another aspect, the invention also features RNA which is encoded by the DNA described herein. Preferably, the RNA
is mRNA. In another embodiment the RNA is antisense RNA.
In another aspect, the invention features a ~s substantially pure polypeptide having a sequence substantially identical to one of the IAP amino acid sequences shown in Figures 1-6.
In a second aspect, the invention features a substantially pure DNA which includes a promoter capable zo of expressing the IAP gene in a cell susceptible to apoptosis. In preferred embodiments, the IAP gene is xiap, hiap-1, or hiap-2. Most preferably, the genes are human or mouse genes. The gene encoding hiap-2 may be the full-length gene, as shown in Fig. 3, or a truncated 2s variant, such as a variant having a deletion of the sequence boxed in Fig. 3.
In preferred embodiments, the promoter is the promoter native to an IAP gene. Additionally, transcriptional and translational regulatory regions are, so preferably, those native to an IAP gene. In another aspect, the invention provides transgenic cell lines and transgenic animals. The transgenic cells of the invention are preferably cells that are altered in their apoptotic response. In preferred embodiments, the 35 transgenic cell is a fibroblast, neuronal cell, a Y
lymphocyte cell, a glial cell, an embryonic stem cell, or an insect cell. Most preferably, the neuron is a motor neuron and the lymphocyte is a CD4+ T cell.
In another aspect, the invention features a method s of inhibiting apoptosis that involves producing a transgenic cell having a transgene encoding an IAP
polypeptide. The transgene is integrated into the genome of the cell in a way that allows for expression.
Furthermore, the level of expression in the cell is ~o sufficient to inhibit apoptosis.
In a related aspect, the invention features a transgenic animal, preferably a mammal, more preferably a rodent, and most preferably a mouse, having either increased copies of at least one IAP gene inserted into 15 the genome (mutant or wild-type), or a knockout of at least one IAP gene in the genome. The transgenic animals will express either an increased or a decreased amount of IAP polypeptide, depending on the construct used and the nature of the genomic alteration. For example, utilizing zo a nucleic acid molecule that encodes all or part of an IAP to engineer a knockout mutation in an IAP gene would generate an animal with decreased expression of either all or part of the corresponding IAP polypeptide. In contrast, inserting exogenous copies of all or part of an zs IAP gene into the genome, preferably under the control of active regulatory and promoter elements, would lead to increased expression or the corresponding IAP
polypeptide.
In another aspect, the invention features a method 30 of detecting an IAP gene in a cell by contacting the IAP
gene, or a portion thereof (which is greater than 9 nucleotides, and preferably greater than 18 nucleotides in length), with a preparation of genomic DNA from the cell. The IAP gene and the genomic DNA are brought into ss contact under conditions that allow for hybridization (and therefore, detection) of DNA sequences in the cell that are at least 50~ identical to the DNA encoding HIAP-1, HIAP-2, or XIAP polypeptides.
In another aspect, the invention features a method s of producing an IAP polypeptide. This method involves providing a cell with DNA encoding all or part of an IAP
polypeptide (which is positioned for expression in the cell), culturing the cell under conditions that allow for expression of the DNA, and isolating the IAP polypeptide.
~o In preferred embodiments, the IAP polypeptide is expressed by DNA that is under the control of a constitutive or inducible promotor. As described herein, the promotor may be a heterologous promotor.
In another aspect, the invention features ~s substantially pure mammalian IAP polypeptide.
Preferably, the polypeptide includes an amino acid sequence that is substantially identical to all, or to a fragment of, the amino acid sequence shown in any one of Figs. 1-4. Most preferably, the polypeptide is the XIAP, zo HIAP-1, HIAP-2, M-XIAP, M-HIAP-1, or M-HIAP-2 polypeptide. Fragments including one or more BIR domains (to the exclusion of the RZF), the RZF domain (to the exclusion of the BIR domains), and a RZF domain with at least one BIR domain, as provided herein, are also a part zs of the invention.
In another aspect, the invention features a recombinant mammalian polypeptide that is capable of modulating apoptosis. The polypeptide may include at least a ring zinc finger domain and a BIR domain as 3o defined herein. In preferred embodiments, the invention features (a) a substantially pure polypeptide, and (b) an oligonucleotide encoding the polypeptide. In instances were the polypeptide includes a ring zinc finger domain, the ring zinc finger domain will have a sequence as conforming to: Glu-Xaal-Xaal-Xaal- Xaal-Xaal-Xaal-Xaa2-Xaal-Xaal-Xaal-Cys-Lys-Xaa3-Cys-Met-Xaal-Xaal-Xaal-Xaal-Xaal-Xaa3-Xaal-Phe-Xaal-Pro-Cys-Gly-His-Xaal-Xaal-Xaal-Cys-Xaal-Xaal-Cys-Ala-Xaal-Xaal-Xaal-Xaal-Xaal-Cys-Pro-Xaal-Cys, where Xaal is any amino acid, Xaa2 is Glu or s Asp, Xaa3 is Val or Ile (SEQ ID NO:1); and where the polypeptide includes at least one BIR domain, the BIR
domain will have a sequence conforming to: Xaal-Xaal-Xaal-Arg-Leu-Xaal-Thr-Phe-Xaal-Xaal-Trp-Pro-Xaa2-Xaal-Xaal-Xaa2-Xaa2-Xaal-Xaal-Xaal-Xaal-Leu-Ala-Xaal-Ala-Gly-~o Phe-Tyr-Tyr-Xaal-Gly-Xaal-Xaal-Asp-Xaal-Val-Xaal-Cys-Phe-Xaal-Cys-Xaal-Xaal-Xaal-Xaal-Xaal-Xaal-Trp-Xaal-Xaal-Xaal-Asp-Xaal-Xaal-Xaal-Xaal-Xaal-His-Xaal-Xaal-Xaal-Xaal-Pro-Xaal-Cys-Xaal-Phe-Val, where Xaal may be any amino acid and Xaa2 may be any amino acid or may be absent (SEQ ID N0:2).
In various preferred embodiments the polypeptide has at least two or, more preferably at least three BIR
domains, the RZF domain has one of the IAP sequences shown in Fig. 6, and the BIR domains are comprised of BIR
zo domains shown in Fig. 5. In other preferred embodiments the BIR domains are at the amino terminal end of the protein relative to the RZF domain, which is at or near the carboxyl terminus of the polypeptide.
In another aspect, the invention features an IAP
zs gene isolated according to the method involving: (a) providing a sample of DNA; (b) providing a pair of oligonucleotides having sequence homology to a conserved region of an IAP disease-resistance gene; (c) combining the pair of oligonucleotides with the cell DNA sample 3o under conditions suitable for polymerase chain reaction-mediated DNA amplification; and (d) isolating the amplified IAP gene or fragment thereof.
In preferred embodiments, the amplification is carried out using a reverse-transcription polymerase s5 chain reaction, for example, the RACE method. In another aspect, the invention features an IAP gene isolated according to the method involving: (a) providing a preparation of DNA; (b) providing a detectably labelled DNA sequence having homology to a conserved region of an s IAP gene; (c) contacting the preparation of DNA with the detectably-labelled DNA sequence under hybridization conditions providing detection of genes having 50% or greater nucleotide sequence identity; and (d) identifying an IAP gene by its association with the detectable label.

~o In another aspect, the invention features an IAP

gene isolated according to the method involving: (a) providing a cell sample; (b) introducing by transformation into the cell sample a candidate IAP gene;

(c) expressing the candidate IAP gene within the cell ~s sample; and (d) determining whether the cell sample exhibits an altered apoptotic response, whereby a response identifies an IAP gene.

~~~~L --~s~~ ~ t~e- i~e~ i+ri~ ~e~~~~

method of identifying an IAP gene in a cell, involving:

zo (a) providing a preparation of cellular DNA (for example, from the human genome or a cDNA library (such as a cDNA

library isolated from a cell type which undergoes apoptosis); (b) providing a detectably-labelled DNA

sequence (for example, prepared by the methods of the zs invention) having homology to a conserved region of an IAP gene; (c) contacting the preparation of cellular DNA

with the detectably-labelled DNA sequence under hybridization conditions providing detection of genes having 50% nucleotide or greater sequence identity; and ao (d) identifying an IAP gene by its association with the detectable label.

In another aspect, the invention features a method of isolating an IAP gene from a recombinant library, involving: (a) providing a recombinant library;

ss (b) contacting the library with a detectably-labelled _g_ gene fragment produced according to the PCR method of the invention under hybridization conditions providing detection of genes having 50% or greater nucleotide sequence identity; and (c) isolating an IAP gene by its s association with the detectable label. In another aspect, the invention features a method of identifying an IAP gene involving: (a) providing a cell tissue sample;
(b) introducing by transformation into the cell sample a candidate IAP gene; (c) expressing the candidate IAP gene ~o within the cell sample; and (d) determining whether the cell sample exhibits inhibition of apoptosis, whereby a change in (i.e. modulation of) apoptosis identifies an IAP gene. Preferably, the cell sample is a cell type that may be assayed for apoptosis (e.g., T cells, B
~s cells, neuronal cells, baculovirus-infected insect cells, glial cells, embryonic stem cells, and fibroblasts). The candidate IAP gene is obtained, for example, from a cDNA
expression library, and the response assayed is the inhibition of apoptosis.
zo In another aspect, the invention features a method of inhibiting apoptosis in a mammal wherein the method includes: (a) providing DNA encoding at least one IAP polypeptide to a cell that is susceptible to apoptosis; wherein the DNA is integrated into the genome zs of the cell and is positioned for expression in the cell;
and the IAP gene is under the control of regulatory sequences suitable for controlled expression of the gene(s); wherein the IAP transgene is expressed at a level sufficient to inhibit apoptosis relative to a cell 30 lacking the IAP transgene. The DNA integrated into the genome may encode all or part of an IAP polypeptide. It may, for example, encode a ring zinc finger and one or more BIR domains. In contrast, it may encode either the ring zinc finger alone, or one or more BIR domains alone.
35 Skilled artisans will appreciate that IAP polypeptides may also be administered directly to inhibit undesirable apoptosis.
In a related aspect, the invention features a s method of inhibiting apoptosis by producing a cell that s has integrated, into its genome, a transgene that includes the IAP gene, or a fragment thereof. The IAP
gene may be placed under the control of a promoter providing constitutive expression of the IAP gene.
Alternatively, the IAP transgene may be placed under the ~o control of a promoter that allows expression of the gene to be regulated by environmental stimuli. For example, the IAP gene may be expressed using a tissue-specific or cell type-specific promoter, or by a promoter that is activated by the introduction of an external signal or ~s agent, such as a chemical signal or agent. In preferred embodiments the cell is a lymphocyte, a neuronal cell, a glial cell, or a fibroblast. In other embodiments, the cell in an HIV-infected human, or in a mammal suffering from a neurodegenerative disease, an ischemic injury, a zo toxin-induced liver disease, or a myelodysplastic syndrome.
In a related aspect, the invention provides a method of inhibiting apoptosis in a mammal by providing an apoptosis-inhibiting amount of IAP polypeptide. The 2s IAP polypeptide may be a full-length polypeptide, or it may be one of the fragments described herein.
In another aspect, the invention features a purified antibody that binds specifically to an IAP
family protein. Such an antibody may be used in any 3o standard immunodetection method for the identification of an IAP polypeptide. Preferably, the antibody binds specifically to XIAP, HIAP-1, or HIAP-2. In various embodiments, the antibody may react with other IAP
polypeptides or may be specific for one or a few IAP
35 polypeptides. The antibody may be a monoclonal or a 76962-52(S) polyclonal antibody. Preferably, the antibody reacts specifically with only one of the IAP polypeptides, for example, reacts with murine and human xiap, but. not with hiap-1 or hiap-2 from other mammalian species.
According to a further aspect of the present invention, there is pravided a substantially pure mammalian IAP polypeptide, or fragment thereof that specifically binds an antisera directed to an IAP.
The antibodies of the invention may be prepared by a variety of methods. ~"or example, the IAP polypeptide, or antigenic fragments thereof, can be administered to an animal in order to induce the production of polycl.onal antibodies. Alternatively, antibodies used as described herein may be monoclonal. antibodies, which are prepared using hybridoma technology (see, e.g., Kohler et al., Nature 256:495, 1975; Kohler et al., Eur. ~~. Immunol. 6:511, 1976;
Kohler et al., Eur. J. l:mmunol. 6:292, 1976; Hammerling et al., In Monoclonal Antibodies and T Cell Hybridomas, Elsevier, NY, 1981). The invention features antibodies that specifically bind human or murine IAP polypeptides, or fragments thereof. In particular the invention features "neutralizing" antibodies. By "neutralizing" antibodies is meant antibodies that interfere with any of the biological activities of IAP polypeptides, particularly the ability of IAPs to inhibit apoptosis. The neutralizing antibody may reduce the ability of IAP polypeptides to inhibit polypeptides by, preferably 50%, more preferably by 70%, and most preferably by 90% or more. Any standard assay of apoptosis, including those described herein, may be used to assess neutralizing antibodies.

76962-52 (S) - 10a -In addition to intact monoclonal and polyclonal anti-IAP antibodies, the invention features various genetically engineered antibodies, humanized antibodies, and antibody fragments, including F(ab')2, Fab', Fab, Fv and sFv fragments. Antibodies can be humanized by methods known in the art, e.g., monoclona:l antibodies with a desired binding specificity can be commercially humanized (Scotgene, Scotland; Oxford Molecular, Palo _ 11 _ Alto, CA). Fully human antibodies, such as those expressed in transgenic animals, are also features of the invention (Green et al., Nature Genetics 7:13-21, 1994).

Ladner (U. S. Patent 4,946,778 and 4,704,692) s describes methods for preparing single polypeptide chain antibodies. Ward et al. (Nature 341:544-546, 1989) describe the preparation of heavy chain variable domains, which they term "single domain antibodies," which have high antigen-binding affinities. McCafferty et al.

~o (Nature 348:552-554, 1990) show that complete antibody V

domains can be displayed on the surface of fd bacteriophage, that the phage bind specifically to antigen, and that rare phage (one in a million) can be isolated after affinity chromatography. Boss et al.

~s (U.S. Patent 4,816,397) describe various methods for producing immunoglobulines, and immunologically functional fragments thereof, which include at least the variable domains of the heavy and light chain in a single host cell. Cabilly et al. (U. S. Patent 4,816,567) zo describe methods for preparing chimeric antibodies.

In another aspect, the invention features a method of identifying a compound that modulates apoptosis. The method includes providing a cell expressing an IAP polypeptide, contacting the cell with a zs candidate compound, and monitoring the expression of an IAP gene. An alteration in the level of expression of the IAP gene indicates the presence of a compound which modulates apoptosis. The compound may be an inhibitor or an enhancer of apoptosis. In various preferred 3o embodiments, the cell is a fibroblast, a neuronal cell, a glial cell, a lymphocyte (T cell or B cell), or an insect cell; the polypeptide expression being monitored is XIAP, HIAP-1, HIAP-2, M-XIAP, M-HIAP-1, or M-HIAP-2 (i.e., human or murine).

In a related aspect, the invention features methods of detecting compounds that modulate apoptosis using the interaction trap technology and IAP
polypeptides, or fragments thereof, as a component of the s bait. In preferred embodiments, the compound being tested as a modulator of apoptosis is also a polypeptide.
In another aspect, the invention features a method for diagnosing a cell proliferation disease, or an increased likelihood of such a disease, using an IAP
~o nucleic acid probe or antibody. Preferably, the disease is a cancer. Most preferably, the disease is selected from the group consisting of promyelocytic leukemia, a HeLa-type carcinoma, chronic myelogenous leukemia (preferably using xiap or hiap-2 related probes), ~s lymphoblastic leukemia (preferably using a xiap related probe), Burkitt's lymphoma (preferably using an hiap-1 related probe), colorectal adenocarcinoma, lung carcinoma, and melanoma (preferably using a xiap probe).
Preferably, a diagnosis is indicated by a 2-fold increase 2o in expression or activity, more preferably, at least a 10-fold increase a.n expression or activity.
Skilled artisans will recognize that a mammalian IAP, or a fragment thereof (as described herein), may serve as an active ingredient in a therapeutic zs composition. This composition, depending on the IAP or fragment included, may be used to modulate apoptosis and thereby treat any condition that is caused by a disturbance in apoptosis.
In addition, apoptosis may be induced in a cell 3o by administering to the cell a negative regulator of the IAP-dependent anti-apoptotic pathway. The negative regulator may be, but is not limited to, an IAP
polypeptide that includes a ring zinc finger, and an IAP
polypeptide that includes a ring zinc finger and lacks at 35 least one BIR domain. Alternatively, apoptosis may be induced in the cell by administering a gene encoding an IAP polypeptide, such as these two polypeptides. In yet another method, the negative regulator may be a purified antibody, or a fragment thereof, that binds specifically to an IAP polypeptide. For example, the antibody may bind to an approximately 26 kDa cleavage product of an IAP polypeptide that includes at least one BIR domain but lacks a ring zinc finger domain. The negative regulator may also be an IAP antisense mRNA molecule.
~o As summarized above, an IAP nucleic acid, or an IAP polypeptide may be used to modulate apoptosis.
Furthermore, an IAP nucleic acid, or an IAP polypeptide, may be used in the manufacture of a medicament for the modulation of apoptosis.
~s By "IAP gene" is meant a gene encoding a polypeptide having at least one BIR domain and a ring zinc finger domain which is capable of modulating (inhibiting or enhancing) apoptosis in a cell or tissue when provided by other intracellular or extracellular zo delivery methods. In preferred embodiments the IAP gene is a gene having about 50~ or greater nucleotide sequence identity to at least one of the IAP amino acid encoding sequences of Figs. 1-4 or portions thereof. Preferably, the region of sequence over which identity is measured is 2s a region encoding at least one BIR domain and a ring zinc finger domain. Mammalian IAP genes include nucleotide sequences isolated from any mammalian source.
Preferably, the mammal is a human.
The term "IAP gene" is meant to encompass any 3o member of the family of apoptosis inhibitory genes, which are characterized by their ability to modulate apoptosis.
An IAP gene may encode a polypeptide that has at least 20~, preferably at least 30~, and most preferably at least 50$ amino acid sequence identity with at least one 3s of the conserved regions of one of the IAP members described herein (i.e., either the BIR or ring zinc finger domains from the human or murine xiap, hiap-1 and hiap-2). Representative members of the IAP gene family include, without limitation, the human and murine xiap, s hiap-1, and hiap-2 genes.
By "IAP protein" or "IAP polypeptide" is meant a polypeptide, or fragment thereof, encoded by an IAP gene.
By "BIR domain" is meant a domain having the amino acid sequence of the consensus sequence: Xaal-Xaal-1o Xaal-Arg-Leu-Xaal-Thr-Phe-Xaal-Xaal-Trp-Pro-Xaa2-Xaal-Xaal-Xaa2-Xaa2-Xaal-Xaal-Xaal-Xaal-Leu-Ala-Xaal-Ala-Gly-Phe-Tyr-Tyr-Xaal-Gly-Xaal-Xaal-Asp-Xaal-Val-Xaal-Cys-Phe-Xaal-Cys-Xaal-Xaal- Xaal-Xaal-Xaal-Xaal-Trp-Xaal-Xaal-Xaal-Asp-Xaal-Xaal-Xaal- Xaal-Xaal-His-Xaal-Xaal-Xaal-15 Xaal-Pro-Xaal-Cys-Xaal-Phe-Val, wherein Xaal is any amino acid and Xaa2 is any amino acid or is absent (SEQ ID
N0:2). Preferably, the sequence is substantially identical to one of the BIR domain sequences provided for xiap, hiap-1, hiap-2 herein.
zo By "ring zinc finger" or "RZF" is meant a domain having the amino acid sequence of the consensus sequence:
Glu-Xaal-Xaal-Xaal-Xaal-Xaal-Xaal-Xaa2-Xaal-Xaal-Xaal-Cys- Lys-Xaa3-Cys-Met-Xaal-Xaal-Xaal-Xaal-Xaal-Xaa3-Xaal-Phe-Xaal-Pro-Cys-Gly-His-Xaal-Xaal-Xaal-Cys-Xaal-Xaal-z5 Cys-Ala- Xaal-Xaal-Xaal-Xaal-Xaal-Cys-Pro-Xaal-Cys, wherein Xaal is any amino acid, Xaa2 is Glu or Asp, and Xaa3 is Val or Ile (SEQ ID NO:1).
Preferably, the sequence is substantially identical to the RZF domains provided herein for the 3o human or murine xiap, hiap-1, or hiap-2.
By "modulating apoptosis" or "altering apoptosis" is meant increasing or decreasing the number of cells that would otherwise undergo apoptosis in a given cell population. Preferably, the cell population ss is selected from a group including T cells, neuronal cells, fibroblasts, or any other cell line known to undergo apoptosis in a laboratory setting (e.g., the baculovirus infected insect cells). It will be appreciated that the degree of modulation provided by an IAP or modulating compound in a given assay will vary, but that one skilled in the art can determine the statistically significant change in the level of apoptosis which identifies an IAP or a compound which modulates an IAP.
1o By "inhibiting apoptosis" is meant any decrease in the number of cells which undergo apoptosis relative to an untreated control. Preferably, the decrease is at least 25%, more preferably the decrease is 50%, and most preferably the decrease is at least one-fold.
By "polypeptide" is meant any chain of more than two amino acids, regardless of post-translational modification such as glycosylation or phosphorylation.
By "substantially identical" is meant a polypeptide or nucleic acid exhibiting at least 50%, 2o preferably 85%, more preferably 90%, and most preferably 95% homology to a reference amino acid or nucleic acid sequence. For polypeptides, the length of comparison sequences will generally be at least 16 amino acids, preferably at least 20 amino acids, more preferably at i5 least 25 amino acids, and most preferably 35 amino acids.
For nucleic acids, the length of comparison sequences will generally be at least 50 nucleotides, preferably at least 60 nucleotides, more preferably at least 75 nucleotides, and most preferably 110 nucleotides.
3o Sequence identity is typically measured using sequence analysis software with the default parameters specified therein (e. g., Sequence Analysis Software Package of the Genetics Computer Group, University of Wisconsin Biotechnology Center, 1710 University Avenue, 35 Madison, WI 53705). This software program matches similar sequences by assigning degrees of homology to various substitutions, deletions, and other modifications. Conservative substitutions typically include substitutions within the following groups:
s glycine, alanine, valine, isoleucine, leucine; aspartic _ acid, glutamic acid, asparagine, glutamine; serine, threonine; lysine, arginine; and phenylalanine, tyrosine.
By "substantially pure polypeptide" is meant a polypeptide that has been separated from the components ~o that naturally accompany it. Typically, the polypeptide is substantially pure when it is at least 60%, by weight, free from the proteins and naturally-occurring organic molecules with which it is naturally associated.
Preferably, the polypeptide is an IAP polypeptide that is ~s at least 75%, more preferably at least 90%, and most preferably at least 99%, by weight, pure. A
substantially pure IAP polypeptide may be obtained, for example, by extraction from a natural source (e.g. a fibroblast, neuronal cell, or lymphocyte) by expression 20 of a recombinant nucleic acid encoding an IAP
polypeptide, or by chemically synthesizing the protein.
Purity can be measured by any appropriate method, e.g., by column chromatography, polyacrylamide gel electrophoresis, or HPLC analysis.
2s A protein is substantially free of naturally associated components when it is separated from those contaminants which accompany it in its natural state.
Thus, a protein which is chemically synthesized or produced in acellular system different from the cell from so which it naturally originates will be substantially free from its naturally associated components. Accordingly, substantially pure polypeptides include those derived from eukaryotic organisms but synthesized in E. coli or other prokaryotes. By "substantially pure DNA°° is meant 3s DNA that is free of the genes which, in the naturally-_ 17 _ occurring genome of the organism from which the DNA of the invention is derived, flank the gene. The term therefore includes, for example, a recombinant DNA which is incorporated into a vector; into an autonomously s replicating plasmid or virus; or into the genomic DNA of a prokaryote or eukaryote; or which exists as a separate molecule (e. g., a cDNA or a genomic or cDNA fragment produced by PCR or restriction endonuclease digestion) independent of other sequences. It also includes a ~o recombinant DNA which is part of a hybrid gene encoding additional polypeptide sequence.
By '°transformed cell" is meant a cell into which (or into an ancestor of which) has been introduced, by means of recombinant DNA techniques, a DNA molecule encoding (as used herein) an IAP polypeptide.
By °'transgene" is meant any piece of DNA which is inserted by artifice into a cell, and becomes part of t::e--gensme-of--the--~rgan~sm-which~e~;elops--frsm-that cell.
Such a transgene may include a gene which is partly or zo entirely heterologous (i.e., foreign) to the transgenic organism, or may represent a gene homologous to an endogenous gene of the organism.
By "transgenic°° is meant any cell which includes a DNA sequence which is inserted by artifice into a cell zs and becomes part of the genome of the organism which develops from that cell. As used herein, the transgenic organisms are generally transgenic mammalian (e. g., rodents such as rats or mice) and the DNA (transgene) is inserted by artifice into the nuclear genome.
3o By "transformation" is meant any method for introducing foreign molecules into a cell. Lipofection, calcium phosphate precipitation, retroviral delivery, electroporation, and biolistic transformation are just a few of the teachings which may be used. For example, 35 biolistic transformation is a method for introducing _ 1s _ foreign molecules into a cell using velocity driven microprojectiles such as tungsten or gold particles.
Such velocity-driven methods originate from pressure bursts which include, but are not limited to, helium-s driven, air-driven, and gunpowder-driven techniques.
Biolistic transformation may be applied to the transformation or transfection of a wide variety of cell types and intact tissues including, without limitation, intracellular organelles (e.g., and mitochondria and ~o chloroplasts), bacteria, yeast, fungi, algae, animal tissue, and cultured cells.
By "positioned for expression°' is meant that the DNA molecule is positioned adjacent to a DNA sequence which directs transcription and translation of the is sequence (i.e., facilitates the production of, e.g., an IAP polypeptide, a recombinant protein or a RNA
molecule).
By "reporter gene" is meant a gene whose expression may be assayed; such genes include, without zo limitation, glucuronidase (GUS), luciferase, chloramphenicol transacetylase (CAT), and ~-galactosidase.
By "promoter'° is meant minimal sequence sufficient to direct transcription. Also included in the 2s invention are those promoter elements which are sufficient to render promoter-dependent gene expression controllable for cell type-specific, tissue-specific or inducible by external signals or agents; such elements may be located in the 5' or 3' regions of the native ao gene .
By "operably linked" is meant that a gene and one or more regulatory sequences are connected in such a way as to permit gene expression when the appropriate molecules (e.g., transcriptional activator proteins are 35 bound to the regulatory sequences).

By "conserved region" is meant any stretch of six or more contiguous amino acids exhibiting at least 30%, preferably 50%, and most preferably 70% amino acid sequence identity between two or more of the IAP family s members, (e. g., between human HIAP-1, HIAP-2, and XIAP).

Examples of preferred conserved regions are shown (as boxed or designated sequences) in Figures 5-7 and Tables 1 and 2, and include, without limitation, BIR domains and ring zinc finger domains.

~o By "detectably-labelled" is meant any means for marking and identifying the presence of a molecule, e.g., an oligonucleotide probe or primer, a gene or fragment thereof, or a cDNA molecule. Methods for detectably-labelling a molecule are well known in the art and ~s include, without limitation, radioactive labelling (e.
g., with an isotope such as 32P or 35S) and nonradioactive labelling (e. g., chemiluminescent labelling, e.g., f luor escein labelling By "antisense," as used herein in reference to Zo nucleic acids, is meant a nucleic acid sequence, regardless of length, that is complementary to the coding strand of a gene.

By "purified antibody" is meant antibody which is at least 60%, by weight, free from proteins and is naturallyoccurring organic molecules with which it is naturally associated. Preferably, the preparation is at least 75%, more preferably 90%, and most preferably at least 99%, by weight, antibody, e.g., an IAP specific antibody. A purified antibody may be obtained, for 3o example, by affinity chromatography using recombinantly-produced protein or conserved motif peptides and standard techniques.

By "specifically binds" is meant an antibody that recognizes and binds a protein but that does not ss substantially recognize and bind other molecules in a sample, e.g., a biological sample, that naturally includes protein.
Other features and advantages of the invention will be apparent from the following description of the s preferred embodiments thereof, and from the claims.
grief Description of the Drawincts Fig. 1 is the human xiap cDNA sequence (SEQ ID N0:3) and the XIAP polypeptide sequence (SEQ ID N0:4).
to Fig. 2 is the human hiap-1 cDNA sequence (SEQ ID N0:5) and the HIAP-1 polypeptide sequence (SEQ ID N0:6).
Fig. 3 is the human hiap-2 cDNA sequence (SEQ ID N0:7) and the HIAP-2 polypeptide sequence ~s (SEQ ID N0:8). The sequence absent in the hiap-2-D
variant is boxed.
Fig. 4 is the murine xiap cDNA sequence (SEQ ID N0:9) and encoded murine XIAP polypeptide sequence (SEQ ID NO:10).
zo Fig. 5 is the murine hiap-1 cDNA sequence (SEQ ID N0:39) and the encoded murine HIAP-1 polypeptide sequence (SEQ ID N0:40).
Fig. 6 is the murine hiap-2 cDNA sequence (SEQ ID N0:41) and the encoded murine HIAP-2 polypeptide z5 (SEQ ID N0:42).
Fig. 7 is a representation of the alignment of the BIR domains of IAP proteins (SEQ ID NOs 11 and 14-31) .
Fig. 8 is a representation of the alignment of 3o human IAP polypeptides with diap, cp-iap, and the IAP
consensus sequence (SEQ ID NOs:4, 6, 8, 10, 12, and 13).
Fig. 9 is a representation of the alignment of the ring zinc finger domains of IAP proteins (SEQ ID
NOs:32-38).

_ 2t _ Fig. 10 is a photograph of a Northern blot illustrating human hiap-1 and hiap-2 mRNA expression in human tissues.
Fig. 11 is a photograph of a Northern blot s illustrating human hiap-2 mRNA expression in human tissues.
Fig. 12 is a photograph of a Northern blot illustrating human xiap mRNA expression in human tissues.
Fig. 13A and 13B are photographs of agarose gels to illustrating apoptotic DNA ladders and RT-PCR products using hiap-1 and hiap-2 specific probes in HIV-infected T
cells.
Fig. 14A - 14D are graphs depicting suppression of apoptosis by XIAP, HIAP-1, HIAP-2, bcl-2, smn, and 6-t5 myc.
Fig. 15A - 15B are bar graphs depicting the percentage of viable CHO cells following transient transfection with the cDNA constructs shown and subsequent serum withdrawal.
2o Fig. 16A - 16B are bar graphs depicting the percentage of viable CHO cells following transient transfection with the cDNA constructs shown and subsequent exposure to menadione (Fig. 16A = 10 /sM
menadione; Fig. 16B = 20 u,M menadione).
zs Fig. 17 is a photograph of an agarose gel containing cDNA fragments that were amplified, with hiap-1-specific primers, from RNA obtained from Raji, Ramos, EB-3, and Jiyoye cells, and from normal placenta.
Fig. 18 is a photograph of a Western blot so containing protein extracted from Jurltat and astrocytoma cells stained with an anti-XIAP antibody. The position and size of a series of marker proteins is indicated.
Fig. 19 is a photograph of a Western blot containing protein extracted from Jurlcat cells following 35 treatment as described in Example XII. The blot was stained with a rabbit polyclonal anti-XIAP antibody.
Lane l, negative control; lane 2, anti-Fas antibody;
lane 3, anti-Fas antibody and cycloheximide; lane 4, TNF-t a; lane 5, TNF-a and cycloheximide.
s Fig. 20 is a photograph of a Western blot containing protein extracted from FieLa cells following exposure to anti-Fas antibodies. The blot was stained with a rabbit polyclonal anti-XIAP antibody. Lane 1, negative control; lane 2, cycloheximide; lane 3, anti-Fas ~o antibody; lane 4, anti-Fas antibody and cycloheximide;
lane 5, TNF-a; lane 6, TNF-a and cycloheximide.
Fig. 21A - 21B are photographs of Western blots stained with rabbit polyclonal anti-XIAP antibody.
Protein was extracted from FIeLa cells (Fig. 21A) and ~s Jurlcat cells (Fig. 21B) immediately, 1, 2, 3, 5, 10, and 22 hours after exposure to anti-Fas antibody.
Fig. 22A and 22B are photographs of Western blots stained with an anti-CPP32 antibody (Fig. 22A) or a rabbit polyclonal anti-XIAP antibody (Fig. 22B). Protein zo was extracted from Jurl~at cells immediately, 3 hours, or 7 hours after exposure to an anti-Fas antibody. In addition to total protein, cytoplasmic and nuclear extracts are shown.
Fig. 23 is a photograph of a polyacrylamide gel z5 following electrophoresis of the products of an in v.~tro XIAP cleavage assay.
Detailed Descrit~tion IAP Genes and Polvt~entides A new class of mammalian proteins that modulate 3o apoptosis (IAPS) and the genes that encode these proteins have been discovered. The IAP proteins are characterized by the presence of a ring zinc finger domain (RZF; Fig.
9) and at least one BIR domain, as defined by the boxed consensus sequences shown in Figs. 7 and 8, and by the sequence domains listed in Tables 1 and 2. As examples of novel IAP genes and proteins, the cDNA sequences and amino acid sequences for human IAPs (HIAP-1, HIAP-2, and XIAP) and a new murine inhibitor of apoptosis, XIAP, are s provided. Additional members of the mammalian IAP family (including homologs from other species and mutant sequences) may be isolated using standard cloning techniques and the conserved amino acid sequences, primers, and probes provided herein and known in the art.
~o Furthermore, IAPs include those proteins lacking the ring zinc finger, as further described below.

NUCLEOTIDE POSITION OF CONSERVED DOMAINS*
BIR-1 BIR-2 BIR-3 Ring Zinc Finger h-siap 109 - 312 520 - 723 826 - 1023 1348 - 1485 15m-$iap 202 - 405 613 - 816 916 - 1113 1438 - 1575 h-hiap-1 273 - 476 693 - 893 951 - 1154 1824 - 1961 m-hiap-1 251 - 453 670 - 870 928 - 1131 1795 - 1932 h-hiap-2 373 - 576 787 - 987 1042 - 1245 1915 - 2052 m-hiap-2 215 - 418 608 - 808 863 - 1066 1763 - 1876 2o *Positions indicated correspond to those shown in Figs.
1-4.

AMINO ACID POSITION OF CONSERVED DOMAINS*
BIR-1 BIR-2 BIR-3 Ring Zinc Finger h-BAIP 26 - 93 163 - 230 265 - 330 439 - 484 m-ZIAP 26 - 93 163 - 230 264 - 329 438 - 483 h-HIAP1 29 - 96 169 - 235 255 - 322 546 - 591 m-HIAPl 29 - 96 169 - 235 255 - 322 544 - 589 h-HIAP2 46 - 113 184 - 250 269 - 336 560 - 605 m-HIAP2 25 - 92 156 - 222 241 - 308 541 - 578 *Positions indicated correspond to those shown in Figs.
~ 0 1-4 .
Recognition of the mammalian IAP family has provided an emergent pattern of protein structure.
Recognition of this pattern allows proteins having a known, homologous sequence but unknown function to be ~s classified as putative inhibitors of apoptosis. A
drosophila gene, now termed diap, was classified in this way (for sequence information see Genbank Accession Number M96581 and Fig. 6). The conservation of these proteins across species indicates that the apoptosis 2o signalling pathway has been conserved throughout evolution.
The IAP proteins may be used to inhibit the apoptosis that occurs as part of numerous disease processes or disorders. For example, IAP polypeptides or 2s nucleic acid encoding IAP polypeptides may be administered for the treatment or prevention of apoptosis that occurs as a part of AIDS, neurodegenerative diseases, ischemic injury, toxin-induced liver disease and myelodysplastic syndromes. Nucleic acid encoding the 3o IAP polypeptide may also be provided to inhibit apoptosis.

II. Clonincr of IAP Genes A. xiap The search for human genes involved in apoptosis resulted in the identification of an X-linked sequence s tag site (STS) in the GenBank database, which demonstrated strong homology with the conserved RZF

domain of CpIAP and OpIAP, the two baculovirus genes known to inhibit apoptosis (Clew et al., Mol. Cell Biol.

14:5212-5222, 1994; Birnbaum et al., J. Virol. 68:2521-8, ~0 1994). Screening a human fetal brain ZapII cDNA library (Stratagene, La Jolla, CA) with this STS resulted in the identification and cloning of xiap (for X-linked Inhibitor of Apoptosis Protein gene). The human gene has a 1.5 kb coding sequence that includes three BIR domains ~5 (Crook et al., J. Virol. 67:2168-74, 1993; Clem et al., Science 254:1388-90, 1991; Birnbaum et al., J. Virol., 68:2521-8, 1994) and a zinc finger. Northern blot analysis with xiap revealed message greater than 7 kb, which is expressed in various tissues, particularly liver 2o and kidney (Fig. 12). The large size of the transcript reflects large 5' and 3' untranslated regions.

D. Human hiap-1 and hiap-2 The hiap-1 and hiap-2 genes were cloned by screening a human liver library (Stratagene Inc., zs LaJolla, CA) with a probe including the entire xiap coding region at low stringency (the final wash was performed at 40C with 2X SSC, 10~ SDS; Figs. 2 and 3).

The hiap-1 and hiap-2 genes were also detected independently using a probe derived from an expressed so sequence tag (EST; GenBank Accession No. T96284), which includes a portion of a BIR domain. The EST sequence was originally isolated by the polymerase chain reaction; a cDNA library was used as a template and amplified with EST-specific primers. The DNA ampliderived probe was then used to screen the human liver cDNA library for full-length hiap coding sequences. A third DNA was subsequently detected that includes the hiap-2 sequence but that appears to lack one exon, presumably due to alternative mRNA splicing (see boxed region in Fig. 3).
s The expression of hiap-1 and hiap-2 in human tissues as assayed by Northern blot analysis is shown in Figures 8 and 9.
C. m-xiao Fourteen cDNA and two genomic clones were ~o identified by screening a mouse embryo ~.gtl1 cDNA library (Clontech, Palo Alto, CA) and a mouse FIX II genomic library with a xiap cDNA probe, respectively. A cDNA
contig spanning 8.0 kb was constructed using 12 overlapping mouse clones. Sequence analysis revealed a ~s coding sequence of approximately 1.5 kb. The mouse gene, m-xiap, encodes a polypeptide with striking homology to human XIAP.at and around the initiation methionine, the stop codon, the three BIR domains, and the RZF domain.
As with the human gene, the mouse homologue contains 20 large 5' and 3' UTRs, which could produce a transcript as large as 7-8 kb.
Analysis of the sequence and restriction map of m-xiap further delineate the structure and genomic organization of m-xiap. Southern blot analysis and zs inverse PCR techniques (Groden et al., Cell 66:589-600, 1991) can be employed to map exons and define exon-intron boundaries.
Antisera can be raised against a m-xiap fusion protein that was obtained from, for example, E. coli so using a bacterial expression system. The resulting antisera can be used along with Northern blot analysis to analyze the spatial and temporal expression of m-xiap in the mouse.

D. m-hiap-1 and m-hiap-2 The murine homologs of hiap-1 and hiap-2 were cloned and sequenced in the same general manner as m-xiap .y using the human hiap-1 and hiap-2 sequences as probes.

s Cloning of m-hiap-1 and m-hiap-2 further demonstrate that homologs from different species may be isolated using the techniques provided herein and those generally known to artisans skilled in molecular biology.

IIZ. Identification of Additional IAP Genes ~o Standard techniques, such as the polymerase chain reaction (PCR) and DNA hybridization, may be used to clone additional human IAP genes and their homologues in other species. Southern blots of human genomic DNA

hybridized at low stringency with probes specific for ~s xiap, hiap-1 and hiap-2 reveal bands that correspond to other known human IAP sequences as well as additional bands that do not correspond to known IAP sequences.

Thus, additional IAP sequences may be readily identified using low stringency hybridization. Examples of murine zo and human xiap, hiap-1, and hiap-2 specific primers, which may be used to clone additional genes by RT-PCR, are shown in Table 5.

IV. Characterization of IAP Activity s~~d Intracellular Localization Studies 2s The ability of putative IAPs to modulate apoptosis can be defined in in vitro systems in which alterations of apoptosis can be detected. Mammalian expression constructs carrying IAP cDNAs, which are either full-length or truncated, can be introduced into so cell lines such as CHO, NIH 3T3, HL60, Rat-l, or Jurkat cells. In addition, SF21 insect cells may be used, in which case the IAP gene is preferentially expressed using an insect heat shock promotor. Following transfection, - apoptosis can be induced by standard methods, which 3s include serum withdrawal, or application of - staurosporine, menadione (which induces apoptosis via _ Zg _ free radial formation), or anti-Fas antibodies. As a control, cells are cultured under the same conditions as those induced to undergo apoptosis, but either not transfected, or transfected with a vector that lacks an s IAP insert. The ability of each IAP construct to inhibit apoptosis upon expression can be quantified by calculating the survival index of the cells, i.e., the ratio of surviving transfected cells to surviving control cells. These experiments can confirm the presence of ~o apoptosis inhibiting activity and, as discussed below, can also be used to determine the functional regions) of an IAP. These assays may also be performed in combination with the application of additional compounds in order to identify compounds that modulate apoptosis ~s via IAP expression.
Cell Survival following Transfection with Full-lenctth IAP Constructs and Induction of Apoptosis Specific examples of the results obtained by zo performing various apoptosis suppression assays are shown in Figs. 14A to 14D. For example, CHO cell survival following transfection with one of six constructs and subsequent serum withdrawal is shown in Fig. 14A. The cells were transfected using Lipofectace'" with 2 ~g of zs one of the following recombinant plasmids: pCDNA36myc-xiap (xiap), pCDNA3-6myc-hiap-1 (hiap-1), pCDNA3-6myc-hiap-2 (hiap-2), pCDNA3-bcl-2 (bcl-2), pCDNA3-HA-smn (smn), and pCDNA3-6myc (6-myc). Oligonucleotide primers were synthesized to allow PCR amplification and cloning ~o of the xiap, hiap-1, and hiap-2 ORFs in pCDNA3 (Invitrogen). Each construct was modified to incorporate a synthetic myc tag encoding six repeats of the peptide sequence MEQKLISEEDL [(SEQ ID NO:-)J, thus allowing detection of myc-IAP fusion proteins via monoclonal anti-cs myc antiserum (Egan et al., Nature 363:45-51, 1993).
Triplicate samples of cell lines in 24-well dishes were washed 5 times with serum free media and maintained in serum free conditions during the course of the experiment. Cells that excluded trypan blue, and that were therefore viable, were counted with a hemocytometer s immediately, 24 hours, 48 hours, and 72 hours, after serum withdrawal. Survival was calculated as a percentage of the initial number of viable cells. In this experiment and those presented in Figs. 14B and 14D, the percentage of viable cells shown represents the ~o average of three separate experiments performed in triplicate, +/- average deviation.
The survival of CHO cells following transfection (with each one of the six constructs described above) and exposure to menadione is shown in Fig. 14B. The cells ~s were plated in 24-well dishes, allowed to grow overnight, and then exposed to 20 ~cM menadione for 1.5 hours (Sigma Chemical Co., St. Louis, MO). Triplicate samples were harvested at the time of exposure to menadione and 24 hours afterward, and survival was assessed by trypan blue zo exclusion.
The survival of Rat-1 cells following transfection (with each one of the six constructs described above) and exposure to staurosporine is shown in Fig. 14C. Rat-1 cells were transfected and then 2s selected in medium containing 800 ~u,g/ml 6418 for two weeks. The cell line was assessed for resistance to staurosporine-induced apoptosis (1 Er,M) for 5 hours.
Viable cells were counted 24 hours after exposure to staurosporine by trypan blue exclusion. The percentage 30 of viable cells shown represents the average of two experiments, ~ average deviation.
The Rat-1 cell line was also used to test the resistance of these cells to menadione (Fig. 14D) following transfection with each of the six constructs 3s described above. The cells were exposed to 10 ACM

menadione for 1.5 hours, and the number of viable cells was counted 18 hours later.
Comparison of Cell Survival ~'ollowinct Transfection with s Full-lenctth vs. Partial zAP Constructs In order to investigate the mechanism whereby _ human IAPs, including XIAP, HIAP-1, and HIAP-2, afford protection against cell death, expression vectors were constructed that contained either: (1) full-length IAP
~o cDNA (as described above), (2) a portion of an IAP gene that encodes the BIR domains, but not the RZF, or (3) a portion of an IAP gene that encodes the RZF, but not the BIR domains. Human and murine xiap or m-xiap cDNAs were tested by transient or stable expression in HeLa, Jurkat, ~s and CHO cell lines. Following transfection, apoptosis was induced by serum withdrawal, application of menadione, or application of an anti-Fas antibody. Cell death was then assessed, as described above, by trypan blue exclusion. As a control for transfection Zo efficiency, the cells were co-transfected with a ~B-gal expression construct. Typically, approximately 20~ of the cells were successfully transfected.
When CHO cells were transiently transfected, constructs containing full-length xiap or m-xiap cDNAs 2s conferred modest protection against cell death (Fig. 15A). In contrast, the survival of CHO cells transfected with constructs encoding only the BIR domains (i.e., lacking the RZF domain; see Fig. 15A) was markedly enhanced 72 hours after serum deprivation. Furthermore, 3o a large percentage of cells expressing the BIR domains were still viable after 96 hours, at which time no viable cells remained in the control, i.e. non-transfected, cell cultures (see "CHO" in Fig. 15A), and less than 5~ of the cells transfected with the vector only, i.e., lacking a _ 3s cDNA insert, remained viable (see "pcDNA3" in Fig. 15A).
Deletion of any of the BIR domains results in the complete loss of apoptotic suppression, which is reflected by a decrease in the percentage of surviving CHO cells to control levels within 72 hours of serum withdrawal (Fig. 15B; see "xiap~l" (which encodes amino acids 89-497 of XIAP (SEQ ID N0.:4)), "xiap~2" (which encodes amino acids 246-497 of XIAP (SEQ ID N0.:4)), and "xiap~3" (which encodes amino acids 342-497 of XIAP (SEQ
ID N0.:4)) at 72 hours).
Stable pools of transfected CHO cells, which 1o were maintained for several months under 6418 selection, were induced to undergo apoptosis by exposure to 10 ~cM
menadione for 2 hours. Among the CHO cells tested were those that were stably transfected with: (1) full-length m-xiap cDNA (miap), (2) full-length xiap cDNA (xiap), (3) 1s full-length bcl-2 cDNA (Bcl-2), (4) cDNA encoding the three BIR domains (but not the RZF) of m-xiap (BIR), and (5) cDNA encoding the RZF (but not BIR domains) of m-xiap (RZF). Cells that were non-transfected (CHO) or transfected with the vector only (pcDNA3), served as 2o controls for this experiment. Following exposure to 10 ~tM menadione, the transfected cells were washed with phosphate buffered saline (PBS) and cultured for an additional 24 hours in menadione-free medium. Cell death was assessed, as described above, by trypan blue zs exclusion. Less than 10% of the non-transfected or vector-only transfected cells remained viable at the end of the 24 hour survival period. Cells expressing the RZF
did not fare significantly better. However, expression of full-length m-xiap, xiap, or bcl-2, and expression of 3o the BIR domains, enhanced cell survival (Fig. 16A). When the concentration of menadione was increased from 10 ~M
to 20 Nr,M (with all other conditions of the experiment being the same as when 10 ~tM menadione was applied), the percentage of viable CHO cells that expressed the BIR
3s domain cDNA construct was higher than the percentage of viable cells that expressed either full-length m-xiap or bcl-2 (Fig. 16B) .
Analysis of the Subcellular Location c~f Expressed RZF and BIR Domains ' s The assays of cell death described above indicate that the RZF may act as a negative regulator of the anti-apoptotic function of IAPs. One way in which the RZF, and possibly other IAP domains, may exert their regulatory influence is by altering the expression of ~o genes, whose products function in the apoptotic pathway.
In order to determine whether the subcellular locations of expressed RZF and BIR domains are consistent with roles as nuclear regulatory factors, COS cells were transiently transfected with the following four ~s constructs, and the expressed polypeptide was localized by immunofluorescent microscopy: (1) pcDNA3-6myc-xiap, which encodes all 497 amino acids of SEQ ID N0:4, (2) pcDNA3-6myc-m-xiap, which encodes all 497 amino acids of mouse xiap (SEQ ID NO:10), (3) pcDNA3-6myc-mxiap-BIR, 2o which encodes amino acids 1 to 341 of m-xiap (SEQ ID _ NO:10), and (4) pcDNA3-6myc-mxiap-RZF, which encodes amino acids 342-497 of m-xiap (SEQ ID NO:10). The cells were grown on multi-well tissue culture slides for 12 hours, and then fixed and permeabilized with methanol.
2s The constructs used (here and in the cell death assays) were tagged with a human Myc epitope tag at the N-terminus. Therefore, a monoclonal anti-Myc antibody and a secondary goat anti-mouse antibody, which was conjugated to FITC, could be used to localize the 3o expressed products in transiently transfected COS cells.
Full-length XIAP and MIAP were located in the cytoplasm, with accentuated expression in the peri-nuclear zone.
The same pattern of localization was observed when the cells expressed a construct encoding the RZF domain (but -3s not the BIR domains). However, cells expressing the BIR
domains (without the RZF) exhibited, primarily, nuclear -staining. The protein expressed by the BIR domain construct appeared to be in various stages of transfer to the nucleus.

These observations are consistent with the fact s that, as described below, XIAP is cleaved within T cells that are treated with anti-Fas antibodies (which are potent inducers of apoptosis), and its N-terminal domain is translocated to the nucleus.

Examples of Additional A~optosis Assavs ~o Specific examples of apoptosis assays are also provided in the following references. Assays for apoptosis in lymphocytes are disclosed by: hi et al., "Induction of apoptosis in uninfected lymphocytes by HIV-1 Tat protein", Science 268:429-431, 1995; Gibellini et ~s al., 'Tat-expressing Jurkat cells show an increased resistance to different apoptotic stimuli, including acute human immunodeficiency virus-type 1 (HIV-1) infection", Br. J. Haematol. 89:24-33, 1995; Martin et al., "HIV-1 infection of human CD4+ T cells in vitro.

2o Differential induction of apoptosis in these cells." J.

Immunol. 152:330-42, 1994; Terai et al., "Apoptosis as a mechanism of cell death in cultured T lymphoblasts acutely infected with HIV-1", J. Clin Invest. 87:1710-5, 1991; Dhein et al., "Autocrine T-cell suicide mediated by z5 APO-1/(Fas/CD95)11, Nature 373:438-441, 1995; Katsikis et al., 'Fas antigen stimulation induces marked apoptosis of T lymphocytes in human immunodeficiency virus-infected individuals", J. Exp. Med. 1815:2029-2036, 1995;

Westendorp et al., Sensitization of T cells to CD95-3o mediated apoptosis by HIV-1 Tat and gp120", Nature 375:497, 1995; DeRossi et al., Virology 198:234-44, 1994.

Assays for apoptosis in fibroblasts are disclosed by: Vossbeck et al., "Direct transforming activity of TGF-beta on rat fibroblasts", Int. J. Cancer 35 61:92-97, 1995; Goruppi et al., "Dissection of c-myc _ 34 _ domains involved in S phase induction of NIH3T3 fibroblasts", Oncogene 9:1537-44, 1994; Fernandez et al., "Differential sensitivity of normal and Ha-ras transformed C3H mouse embryo fibroblasts to tumor s necrosis factor: induction of bcl-2, c-myc, and manganese superoxide dismutase in resistant cells°', Oncogene 9:2009-17, 1994; Harrington et al., °°c-Myc-induced apoptosis in fibroblasts is inhibited by specific cytokines°', EMBO J., 13:3286-3295, 1994; Itoh et al., °°A
~o novel protein domain required for apoptosis. Mutational analysis of human Fas antigen", J. Biol. Chem.
268:10932-?, 1993.
Assays for apoptosis in neuronal cells are disclosed by: Melino et al., "Tissue transglutaminase is and apoptosis: sense and antisense transfection studies with human neuroblastoma cells°°, Mol. Cell Biol. 14:6584-6596, 1994; Rosenbaum et al., '°Evidence for hypoxia-induced, programmed cell death of cultured neurons'°, Ann.
Neurol. 36:864-870, 1994; Sato et al., °'Neuronal zo differentiation of PC12 cells as a result of prevention of cell death by bcl-2°', J. Neurobiol 25:1227-1234, 1994;
Ferrari et al., "N-acetylcysteine D- and L-stereoisomers prevents apoptotic death of neuronal cells°°, J. Neurosci.
1516:2857-2866, 1995; Talley et al., "Tumor necrosis 2s factor alpha-induced apoptosis in human neuronal cells:
protection by the antioxidant N-acetylcysteine and the genes bcl-2 and crma", Mol. Cell Biol. 1585:2359-2366, 1995; Talley et al., "Tumor Necrosis Factor Alpha-Induced Apoptosis in Human Neuronal Cells: Protection by the so Antioxidant NAcetylcysteine and the Genes bcl-2 and crma", Mol. Cell. Biol. 15:2359-2366, 1995; Walkinshaw et al., "Induction of apoptosis in catecholaminergic PC12 cells by L-DOPA. Implications for the treatment of Parkinson's disease.°', J. Clin. Invest. 95:2458-2464, 35 1995.

Assays for apoptosis in insect cells are disclosed by: Clem et al., "Prevention of apoptosis by a baculovirus gene during infection of insect cells", Science 254:1388-90, 1991; Crook et al., "An apoptosis-inhibiting baculovirus gene with a zinc finger-like motif", J. Virol. 67:2168-74, 1993; Rabizadeh et al., "Expression of the baculovirus p35 gene inhibits mammalian neural cell death", J. Neurochem. 61:2318-21, 1993; Birnbaum et al., "An apoptosis inhibiting gene from ~o a nuclear polyhedrosis virus encoding a polypeptide with Cys/His sequence motifs'°, J. Virol. 68:2521-8, 1994; Clem et al., "Control of programmed cell death by the baculovirus genes p35 and IAP", Mol. Cell. Biol. 14:5212-5222, 1994.
~s V. Construction of a Transqenic Animal Characterization of IAP genes provides information that is necessary for an IAP knockout animal model to be developed by homologous recombination.
Preferably, the model is a mammalian animal, most zo preferably a mouse. Similarily, an animal model of IAP
overproduction may be generated by integrating one or more IAP sequences into the genome, according to standard transgenic techniques.
A replacement-type targeting vector, which would 2s be used to create a knockout model, can be constructed using an isogenic genomic clone, for example, from a mouse strain such as 129/Sv (Stratagene Inc., LaJolla, CA). The targeting vector will be introduced into a suitably-derived line of embryonic stem (ES) cells by 3o electroporation to generate ES cell lines that carry a profoundly truncated form of an IAP. To generate chimeric founder mice, the targeted cell lines will be injected into a mouse blastula stage embryo.
Heterozygous offspring will be interbred to homozygosity.
35 Knockout mice would provide the means, in vivo, to screen for therapeutic compounds that modulate apoptosis via an IAP-dependent pathway.
VI. IAP Protein Expression IAP genes may be expressed in both prokaryotic s and eukaryotic cell types. If an IAP modulates apoptosis by exacerbating it, it may be desirable to express that protein under control of an inducible promotor.
In general, IAPs according to the invention may ~o be produced by transforming a suitable host cell with all or part of an IAP-encoding cDNA fragment that has been placed into a suitable expression vector.
Those skilled in the art of molecular biology will understand that a wide variety of expression systems 15 may be used to produce the recombinant protein. The precise host cell used is not critical to the invention.
The IAP protein may be produced in a prokaryotic host (e.g., E. coli) or in a eukaryotic host (e.g., S.
cerevisiae, insect cells such as Sf21 cells, or mammalian zo cells such as COS-1, NIH 3T3, or HeLa cells). These cells are publically available, for example, from the American Type Culture Collection, Rockville, MD; see also Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, New York, NY, 1994). The method of 2s transduction and the choice of expression vehicle will depend on the host system selected. Transformation and transfection methods are described, e.g., in Ausubel et al. (supra), and expression vehicles may be chosen from those provided, e.g. in Toning Vecto s~ A aboratory 3o Manual (P. H. Pouwels et al., 1985, Supp. 1987).
A preferred expression system is the baculovirus system using, for example, the vector pBacPAK9, which is available from Clontech (Palo Alto, CA). If desired, this system may be used in conjunction with other protein 3s expression techniques, for example, the myc tag approach described by Evan et al. (Mol. Cell Biol. 5:3610-3616, 1985).
Alternatively, an IAP may be produced by a J
stably-transfected mammalian cell line. A number of s vectors suitable for stable transfection of mammalian cells are available to the public, e.g., see Pouwels et al. (supra), as are methods for constructing such cell lines (see e.g., Ausubel et al. (supra). In one example, cDNA encoding an IAP is cloned into an expression vector ~o that includes the dihydrofolate reductase (DHFR) gene.
Integration of the plasmid and, therefore, integration of the IAP-encoding gene into the host cell chromosome is selected for by inclusion of 0.01-300 Er,M methotrexate in the cell culture medium (as described, Ausubel et al., ~s supra). This dominant selection can be accomplished in most cell types. Recombinant protein expression can be increased by DHFR-mediated amplification of the transfected gene.
Methods for selecting cell lines bearing gene Zo amplifications are described in Ausubel et al. (supra).
These methods generally involve extended culture in medium containing gradually increasing levels of methotrexate. The most commonly used DHFR-containing expression vectors are pCVSEII-DHFR and pAdD26SV(A) is (described in Ausubel et al., supra). The host cells described above or, preferably, a DHFR-deficient CHO cell line (e. g., CHO DHFR- cells, ATCC Accession No. CRL 9096) are among those most preferred for DHFR selection of a stably-transfected cell line or DHFR-mediated gene 3o amplification.
Once the recombinant protein is expressed, it is isolated by, for example, affinity chromatography. In one example, an anti-IAP antibody, which may be produced by the methods described herein, can be attached to a 35 column and used to isolate the IAP protein. Lysis and fractionation of IAP-harboring cells prior to affinity chromatography may be performed by standard methods (see e.g., Ausubel et al., supra). Once isolated, the F
recombinant protein can, if desired, be purified further s by e.g., by high performance liquid chromatography (HPLC;
e.g., see Fisher, Laboratory Technisues In Biochemistry And Molecular Biology, Work and Burdon, Eds., Elsevier, 1980).
Polypeptides of the invention, particularly ~o short IAP fragments, can also be produced by chemical synthesis (e. g., by the methods described in Solid Phase Peptide Synthesis, 2nd ed., 1984 The Pierce Chemical Co., Rocltford, IL). These general techniques of polypeptide expression and purification can also be used to produce ~s and isolate useful IAP fragments or analogs, asdescribed herein.
VII. Anti-IAP Antibodies In order to generate IAP-specific antibodies, an IAP coding sequence (i.e., amino acids 180-276) can be zo expressed as a C-terminal fusion with glutathione S-transferase (GST; Smith et al., Gene 67:31-40, 1988).
The fusion protein can be purified on glutathione-Sepharose beads, eluted with glutathione, and cleaved with thrombin (at the engineered cleavage site), and zs purified to the degree required to successfully immunize rabbits. Primary immunizations can be carried out with Freund's complete adjuvant and subsequent immunizations performed with Freund's incomplete adjuvant. Antibody titres are monitored by Western blot and 3o immunoprecipitation analyses using the thrombin-cleaved IAP fragment of the GST-IAP fusion protein. Immune sera are affinity purified using CNBr-Sepharose-coupled IAP
protein. Antiserum specificity is determined using a panel of unrelated GST proteins (including GSTp53, Rb, HPV-16 E6, and E6-AP) and GST-trypsin (which was generated by PCR using known sequences).
As an alternate or adjunct immunogen to GST
a fusion proteins, peptides corresponding to relatively s unique hydrophilic regions of IAP may be generated and coupled to keyhole limpet hemocyanin (KLH) through an introduced C-terminal lysine. Antiserum to each of these peptides is similarly affinity purified on peptides conjugated to BSA, and specificity is tested by ELISA and ~o Western blotting using peptide conjugates, and by Western blotting and immunoprecipitation using IAP expressed as a GST fusion protein.
Alternatively, monoclonal antibodies may be prepared using the IAP proteins described above and ~s standard hybridoma technology (see, e.g., Kohler et al., Nature 256:495, 1975; Kohler et al., Eur. J. Immunol.
6:511, 1976;
Kohler et al., Eur. J. Immunol. 6:292, 1976; Hammerling et al., In I~!Lonoclonal Antibodies and T Cell Hybridomas, 2o Elsevier, New York, NY, 1981; Ausubel et al., supra).
Once produced, monoclonal antibodies are also tested for specific IAP recognition by Western blot or immunoprecipitation analysis (by the methods described in Ausubel et al., supra).
2s Antibodies that specifically recognize IAPs or fragments of IAPs, such as those described herein containing one or more BIR domains (but not a ring zinc finger domain), or that contain a ring zinc finger domain (but not a BIR domain) are considered useful in the 3o invention. They may, for example, be used in an immunoassay to monitor IAP expression levels or to determine the subcellular location of an IAP or IAP
fragment produced by a mammal. Antibodies that inhibit the 26 lcDa IAP cleavage product described herein (which 3s contains at least one BIR domain) may be especially useful in inducing apoptosis in cells undergoing undesirable proliferation.
Preferably, antibodies of the invention are produced using IAP sequence that does not reside within s highly conserved regions, and that appears likely to be antigenic, as analyzed by criteria such as those provided by the Peptide structure program (Genetics Computer Group Sequence Analysis Package, Program Manual for the GCG
Package, Version 7, 1991) using the algorithm of Jameson ~o and Wolf (CABIOS 4:181, 1988). Specifically, these regions, which are found between BIR1 and BIR2 of all IAPs, are: from amino acid 99 to amino acid 170 of hiap-1, from amino acid 123 to amino acid 184 of hiap-2, and from amino acid 116 to amino acid 133 of either xiap or ~s m-xiap. These fragments can be generated by standard techniques, e.g. by the PCR, and cloned into the pGEX
expression vector (Ausubel et al., supra). Fusion proteins are expressed in E. coli and purified using a glutathione agarose affinity matrix as described in zo Ausubel et al. (supra). In order to minimize the potential for obtaining antisera that is non-specific, or exhibits low-affinity binding to IAP, two or three fusions are generated for each protein, and each fusion is injected into at least two rabbits. Antisera are zs raised by injections in series, preferably including at least three booster injections.
VIII. Identification of Molecules that Modal ate IAP Protein Ex~aression Isolation of IAP cDNAs also facilitates the ~o identification of molecules that increase or decrease IAP
expression. In one approach, candidate molecules are added, in varying concentration, to the culture medium of cells expressing IAP mRNA. IAP expression is then measured, for example, by Northern blot analysis (Ausubel -3s et al., supra) using an IAP cDNA, or cDNA fragment, as a hybridization probe (see also Table 5). The level of IAP -WO 97/06255 PCTlIB96/01022 expression in the presence of the candidate molecule is compared to the level of IAP expression in the absence of the candidate molecule, all other factors (e. g. cell type and culture conditions) being equal.
s The effect of candidate molecules on IAP-mediated apoptosis may, instead, be measured at the level of translation by using the general approach described above with standard protein detection techniques, such as Western blotting or immunoprecipitation with an IAP-1o specific antibody (for example, the IAP antibody described herein).
Compounds that modulate the level of IAP may be purified, or substantially purified, or may be one component of a mixture of compounds such as an extract or 1s supernatant obtained from cells (Ausubel et al., supra).
In an assay of a mixture of compounds, IAP expression is tested against progressively smaller subsets of the compound pool (e. g., produced by standard purification techniques such as HPLC or FPLC) until a single compound 20 or minimal number of effective compounds is demonstrated to modulate IAP expression.
Compounds may also be screened for their ability to modulate IAP apoptosis inhibiting activity. In this approach, the degree of apoptosis in the presence of a zs candidate compound is compared to the degree of apoptosis in its absence, under equivalent conditions. Again, the screen may begin with a pool of candidate compounds, from which one or more useful modulator compounds are isolated in a step-wise fashion. Apoptosis activity may be 3o measured by any standard assay, for example, those described herein.
Another method for detecting compounds that modulate the activity of IAPs is to screen for compounds that interact physically with a given IAP polypeptide.
35 These compounds may be detected by adapting interaction trap expression systems known in the art. These systems detect protein interactions using a transcriptional activation assay and are generally described by Gyuris et al. (Cell 75:791-803, 1993) and Field et al., Nature s 340:245-246, 1989), and are commercially available from y Clontech (Palo Alto, CA). In addition, PCT Publication WO 95/28497 describes an interaction trap assay in which proteins involved in apoptosis, by virtue of their interaction with Bcl-2, are detected. A similar method ~o may be used to identify proteins and other compounds that interact with IAPs.
Compounds or molecules that function as modulators of IAP-mediated cell death may include peptide and non-peptide molecules such as those present in cell extracts, mammalian serum, or growth medium in which mammalian cells have been cultured.
A molecule that promotes an increase in IAP
expression or IAP activity is considered particularly useful in the invention; such a molecule may be used, for zo example, as a therapeutic to increase cellular levels of IAP and thereby exploit the ability of IAP polypeptides to inhibit apoptosis.
A molecule that decreases IAP activity (e.g., by decreasing IAP gene expression or polypeptide activity) zs may be used to decrease cellular proliferation. This would be advantageous in the treatment of neoplasms (see Table 3, below), or other cell proliferative diseases.

NORTHERN BLOT IAP RNA LEVELS IN CANCER CELLS*
r siap hiapi hiap2 Promyelocytic Leukemia HL-60 + + +

Hela S-3 + + +

s Chronic Myelogenous Leukemia K-562 +++ + +++

Lymphoblastic Leukemia MOLT-4 +++ + +

Burkitt's Lymphoma Raji + +(x10) +

Colorectal Adenocarcinoma SW-480 +++ +++ +++

Lung Carcinoma A-549 + + +

~o Melanoma G-361 +++ + +

*Levels are indicated by a (+) and are the approximate increase in RNA levels relative to Northern blots of RNA
from non-cancerous control cell lines. A single plus indicates an estimated increase of at least 1-fold ~s Molecules that are found, by the methods described above, to effectively modulate IAP gene expression or polypeptide activity may be tested further in animal models. If they continue to function successfully in an in vivo setting, they may be used as 2o therapeutics to either inhibit or enhance apoptosis, as appropriate.
IX. IAP Theranv The level of IAP gene expression correlates with the level of apoptosis. Thus, IAP genes also find use in 2s anti-apoptosis gene therapy. In particular, a functional IAP gene may be used to sustain neuronal cells that undergo apoptosis in the course of a neurodegenerative disease, lymphocytes (i.e., T cells and B cells), or cells that have been injured by ischemia.
3o Retroviral vectors, adenoviral vectors, adeno-associated viral vectors, or other viral vectors with the appropriate tropism for cells likely to be involved in apoptosis (for example, epithelial cells) may be used as a gene transfer delivery system for a therapeutic IAP
gene construct. Numerous vectors useful for this purpose i are generally known (Miller, Human Gene Therapy 15-14, 1990; Friedman, Science 244:1275-1281, 1989; Eglitis and Anderson, BioTechniques 6:608-614, 1988; Tolstoshev and Anderson, current opinion in Biotechnology 1:55-61, 1990;
Sharp, The Lancet 337:1277-1278, 1991; Cornetta et al., Nucleic Acid Research and Molecular Biology 36:311-322, ~0 1987; Anderson, Science 226:401-409, 1984; Moen, Blood Cells 17:407-416, 1991; Miller et al., Biotechniques 7:980-990, 1989; Le Gal La Salle et al., Science 259:988-990, 1993; and Johnson, Chest 107:77S-83S, 1995).
Retroviral vectors are particularly well developed and ~s have been used in clinical settings (Rosenberg et al., N.
Engl. J. Med 323:370, 1990; Anderson et al., U.S. Patent No. 5,399,346). Non-viral approaches may also be employed for the introduction of therapeutic DNA into cells otherwise predicted to undergo apoptosis. For zo example, IAP may be introduced into a neuron or a T cell by lipofection (Felgner et al., Proc. Natl. Acad. Sci.
USA 84:7413, 1987; Ono et al., Neurosci. Lett. 117:259, 1990; Brigham et al., Am. J. Med. Sci. 298:278, 1989;
Staubinger et al., Meth. Enz. 101:512, 1983), zs asialorosonucoid-polylysine conjugation (Wu et al., J.
Biol. Chem. 263:14621, 1988; Wu et al., J. Biol. Chem.
264:16985, 1989); or, less preferably, microinjection under surgical conditions (Wolff et al., Science 247:1465, 1990).
so For any of the methods of application described above, the therapeutic IAP DNA construct is preferably applied to the site of the predicted apoptosis event (for example, by injection). However, it may also be applied to tissue in the vicinity of the predicted apoptosis event or to a blood vessel supplying the cells predicted to undergo apoptosis.
In the constructs described, IAP cDNA expression V
can be directed from any suitable promoter (e.g., the s human cytomegalovirus (CMV), simian virus 40 (SV40), or metallothionein promoters), and regulated by any appropriate mammalian regulatory element. For example, if desired, enhancers known to preferentially direct gene expression in neural cells, T cells, or B cells may be ~o used to direct IAP expression. The enhancers used could include, without limitation, those that are characterized as tissue- or cell-specific in their expression.
Alternatively, if an IAP genomic clone is used as a therapeutic construct (for example, following its ~s isolation by hybridization with the IAP cDNA described above), regulation may be mediated by the cognate regulatory sequences or, if desired, by regulatory sequences derived from a heterologous source, including any of the promoters or regulatory elements described zo above .
Less preferably, IAP gene therapy is accomplished by direct administration of the IAP mRNA or antisense IAP mRNA to a cell that is expected to undergo apoptosis. The mRNA may be produced and isolated by any zs standard technique, but is most readily produced by in vitro transcription using an IAP cDNA under the control of a high efficiency promoter (e. g., the T7 promoter).
Administration of IAP mRNA to malignant cells can be carried out by any of the methods for direct nucleic acid so administration described above.
Ideally, the production of IAP protein by any gene therapy approach will result in cellular levels of IAP that are at least equivalent to the normal, cellular level of IAP in an unaffected cell. Treatment by any IAP-mediated gene therapy approach may be combined with more traditional therapies.
Another therapeutic approach within the invention involves administration of recombinant IAP
s protein, either directly to the site of a predicted apoptosis event (for example, by injection) or systemically (for example, by any conventional recombinant protein administration technique). The dosage of IAP depends on a number of factors, including ~o the size and health of the individual patient, but, generally, between O.1 mg and 100 mg inclusive are administered per day to an adult in any pharmaceutically-acceptable formulation.
Administration of IAP Polvneptides IAP
~s genes. pr Modulators of IAP Svnthesis or Function An IAP protein, gene, or modulator may be administered within a pharmaceutically-acceptable diluent, carrier, or excipient, in unit dosage form.
Conventional pharmaceutical practice may be employed to zo provide suitable formulations or compositions to administer IAP to patients suffering from a disease that is caused by excessive apoptosis. Administration may begin before the patient is symptomatic. Any appropriate route of administration may be employed, for example, z5 administration may be parenteral, intravenous, intraarterial, subcutaneous, intramuscular, intracranial, intraorbital, ophthalmic, intraventricular, intracapsular, intraspinal, intracisternal, intraperitoneal, intranasal, aerosol, or oral so administration. Therapeutic formulations may be in the form of liquid solutions or suspensions; for oral administration, formulations may be in the form of tablets or capsules; and for intranasal formulations, in the form of powders, nasal drops, or aerosols. -a5 Methods well known in the art for making formulations are found, for example, in "Remington's Pharmaceutical Sciences." Formulations for parenteral administration may, for example, contain excipients, sterile water, or saline, polyalkylene glycols such as polyethylene glycol, oils of vegetable origin, or s hydrogenated napthalenes. Biocompatible, biodegradable lactide polymer, lactide/glycolide copolymer, or polyoxyethylene-polyoxypropylene copolymers may be used to control the release of the compounds. Other potentially useful parenteral delivery systems for IAP
~o modulatory compounds include ethylene-vinyl acetate copolymer particles, osmotic pumps, implantable infusion systems, and liposomes. Formulations for inhalation may contain excipients, for example, lactose, or may be aqueous solutions containing, for example, polyoxyethylene-9-lauryl ether, glycocholate and deoxycholate, or may be oily solutions for administration in the form of nasal drops, or as a gel.
If desired, treatment with an IAP protein, gene, or modulatory compound may be combined with more 2o traditional therapies for the disease such as surgery, steroid therapy, or chemotherapy for autoimmune disease;
antiviral therapy for AIDS; and tissue plasminogen activator (TPA) for ischemic injury.
Detection of Conditions Involving 2s Altered Apoptosis IAP polypeptides and nucleic acid sequences find diagnostic use in the detection or monitoring of conditions involving aberrant levels of apoptosis. For example, decrease expression of IAP may be correlated 3o with enhanced apoptosis in humans (see XII, below).
Accordingly, a decrease or increase in the level of IAP
production may provide an indication of a deleterious condition. Levels of IAP expression may be assayed by any standard technique. For example, IAP expression in a 3s biological sample (e.g., a biopsy) may be monitored by standard Northern blot analysis or may be aided by PCR

(see, e.g., Ausubel et al., supra; PCR Technology: _ 'prlr~~~ples and At~t~lications for DNA amplification, H.A.
Ehrlich, Ed. Stockton Press, NY; Yap et al. Nucl. Acids.
Res. 19:4294, 1991).
s Alternatively, a biological sample obtained from a patient may be analyzed for one or more mutations in the IAP sequences using a mismatch detection approach.
Generally, these techniques involve PCR amplification of nucleic acid from the patient sample, followed by ~o identification of the mutation (i.e., mismatch) by either altered hybridization, aberrant electrophoretic gel migration, binding or cleavage mediated by mismatch binding proteins, or direct nucleic acid sequencing. Any of these techniques may be used to facilitate mutant IAP
~s detection, and each is well known in the art; examples of particular techniques are described, without limitation, in Orita et al., Proc. Natl. Acad. Sci. USA 86:2766-2770, 1989; Sheffield et al., Proc. Natl. Acad. Sci. USA
86:232-236, 1989).
2o In yet another approach, immunoassays are used to detect or monitor IAP protein in a biological sample.
IAPspecific polyclonal or monoclonal antibodies (produced as described above) may be used in any standard immunoassay format (e.g., ELISA, Western blot, or RIA) to 2s measure IAP polypeptide levels. These levels would be compared to wild-type IAP levels, with a decrease in IAP
production indicating a condition involving increased apoptosis. Examples of immunoassays are described, e.g., in Ausubel et al., supra. Immunohistochemical techniques 3o may also be utilized for IAP detection. For example, a tissue sample may be obtained from a patient, sectioned, and stained for the presence of IAP using an anti-IAP
antibody and any standard detection system (e.g., one which includes a secondary antibody conjugated to 35 horseradish peroxidase). General guidance regarding such techniques can be found in, e.g., Bancroft and Stevens ~Theorv and Practice of Histolocrical Technictues, Churchill Livingstone, 1982) and Ausubel et al. (supra).
In one preferred example, a combined diagnostic s method may be employed that begins with an evaluation of IAP protein production (for example, by immunological techniques or the protein truncation test (Hogerrorst et al., Nature Genetics 10:208-212, 1995) and also includes a nucleic acid-based detection technique designed to ~o identify more subtle IAP mutations (for example, point mutations). As described above, a number of mismatch detection assays are available to those skilled in the art, and any preferred technique may be used. Mutations in IAP may be detected that either result in loss of IAP
expression or loss of IAP biological activity. In a variation of this combined diagnostic method, IAP
biological activity is measured as protease activity using any appropriate protease assay system (for example, those described above).
2o Mismatch detection assays also provide an opportunity to diagnose an IAP-mediated predisposition to diseases caused by inappropriate apoptosis. For example, a patient heterozygous for an IAP mutation may show no clinical symptoms and yet possess a higher than normal Zs probability of developing one or more types of neurodegenerative, myelodysplastic or ischemic diseases.
Given this diagnosis, a patient may take precautions to minimize their exposure to adverse environmental factors (for example, UV exposure or chemical mutagens) and to so carefully monitor their medical condition (for example, through frequent physical examinations). This type of IAP diagnostic approach may also be used to detect IAP
mutations in prenatal screens. The IAP diagnostic assays described above may be carried out using any biological as sample (for example, any biopsy sample or bodily fluid or tissue) in which IAP is normally expressed.
Identification of a mutant IAP gene may also be assayed using these sources for test samples.
Alternatively, a IAP mutation, particularly as part of a diagnosis for predisposition to IAP-associated degenerative disease, may be tested using a DNA sample from any cell, for example, by mismatch detection techniques. Preferably, the DNA sample is subjected to PCR amplification prior to analysis.
~o In order to demonstrate the utility of IAP gene sequences as diagnostics and prognostics for cancer, a Human Cancer Cell Line Multiple Tissue Northern Blot (Clontech, Palo Alto, CA; ,7757-1) was probed. This Northern blot contained approximately 2 ~.g of poly A+ RNA
~s per lane from eight different human cell lines: (1) promyelocytic leukemia HL-60, (2) HeLa cell S3, (3) chronic myelogenous leukemia K-562, (4) lymphoblastic leukemia MOLT-4, (5) Burkitt's lymphoma Raji, (6) colorectal adenocarcinoma SW480, (7) lung carcinoma A549, zo and (8) melanoma 6361. As a control, a Human Multiple Tissue Northern Blot (Clontech, Palo Alto, CA; x'7759-1) was probed. This Northern blot contained approximately 2 ~cg of poly A+ RNA from eight different human tissues:
(1) spleen, (2) thymus, (3) prostate, (4) testis, (5) zs ovary, (6) small intestine, (7) colon, and (8) peripheral blood leukocytes.
The Northern blots were hybridized sequentially with: (1) a 1.6 kb probe to the xiap coding region, (2) a 375 by hiap-2 specific probe corresponding to the so 3' untranslated region, (3) a 1.3 kb probe to the coding region of hiap-1, which cross-reacts with hiap-2, (4) a 1.0 kb probe derived from the coding region of bcl-2, and (5) a probe to ,B-actin, which was provided by the manufacturer. Hybridization was carried out at 50°C
as overnight, according to the manufacturer's suggestion.

.. The blot was washed twice with 2X SSC, 0.1~ SDS at room temperature for 15 minutes and then with 2X SSC, 0.1~ SDS
_ at 50°C.
All cancer lines tested showed increased IAP
s expression relative to samples from non-cancerous control tissues (Table 3). Expression of xiap was particularly high in HeLa (S-3), chronic myelogenous leukemia (K-562), colorectal adenocarcinoma (SW-480), and melanoma (G-361) lines. Expression of hiap-1 was extremely high in 1o Burkitt's lymphoma, and was also elevated in colorectal adenocarcinoma. Expression of hiap-2 was particularly high in chronic myelogenous leukemia (K-562) and colorectal adenocarcinoma (SW-480). Expression of Bcl-2 was upregulated only in HL-60 leukemia cells.
15 These observations suggest that upregulation of the anti-apoptotic IAP genes may be a widespread phenomenon, perhaps occurring much more frequently than upregulation of Bcl-2. Furthermore, upregulation may be necessary for the establishment or maintenance of the zo transformed state of cancerous cells.
In order to pursue the observation described above, i.e., that hiap-1 is overexpressed in the Raji Burkitt's lymphoma cell line, RT-PCR analysis was performed in multiple Burkitt's lymphoma cell lines.
zs Total RNA was extracted from cells of the Raji, Ramos, EB-3, and Jiyoye cell lines, and as a positive control, from normal placental tissue. The RNA was reverse transcribed, and amplified by PCR with the following set of oligonucleotide primers:
so 5'-AGTGCGGGTTTTTATTATGTG-3' (SEQ ID NO:-) and 5'-AGATGACCACAAGGAATAAACACTA-3' (BEQ ID NO:-), which selectively amplify a hiap-1 cDNA fragment. RT-PCR was conducted using a PerkinElmer 480 Thermocycler to carry out 35 cycles of the following program: 94°C for 1 35 minute, 50°C for 1.5 minutes, and 72°C for a minute. The PCR reaction product was electrophoresed on an agarose gel and stained with Ethidium bromide. Amplified cDNA
fragments of the appropriate size were clearly visible in all lanes containing Burkitt~s lymphoma samples, but s absent in the lanes containing the normal placental tissue sample, and absent in lanes containing negative control samples, where template DNA was omitted from the reaction (Fig. 17).
XII. Accumulation of a 26 kDa ~o cieavag~e Protein in Astrocytoma Cells $s Identification of a 26 kDa Cleavage Protein A total protein extract was prepared from Jurkat and astrocytoma cells by sonicating them (X3 for 15 seconds at 4°C) in 50 mM Tris-HCl (pH 8.0), 150 mM NaCl, 15 1 mM PMSF, 1 E.cg/ml aprotinin, and 5 mM benzamidine.
Following sonication, the samples were centrifuged (14,000 RPM in a microfuge) for five minutes. Twenty Ecg of protein was loaded per well on a 10~ SDS-polyacrylamide gel, electrophoresed, and electroblotted zo by standard methods to PVDF membranes. Western blot analysis, performed as described previously, revealed that the astrocytoma cell line (CCF-STTG1) abundantly expressed an anti-xiap reactive band of approximately 26 kDa, despite the lack of an apoptotic trigger event (Fig.
zs 18). In fact, this cell line has been previously characterized as being particularly resistant to standard apoptotic triggers.
A 26 kDa xiap-reactive band was also observed under the following experimental conditions. Jurkat so cells (a transformed human T cell line) were induced to undergo apoptosis by exposure to an anti-Fas antibody (1 ~Cg/ml). Identical cultures of Jurkat cells were exposed either to: (1) anti-Fas antibody and cycloheximide (20 /ig/ml), (2) tumor necrosis factor alpha (TNF-a, at 1,000 -ss U/ml), or (3) TNF-a and cycloheximide (20 fcg/ml). All cells were harvested 6 hours after treatment began. In -addition, as a negative control, anti-Fas antibody was added to an extract after the cells were harvested. The cells were harvested in SDS sample buffer, electrophoresed on a 12.5% SDS polyacrylamide gel, and s electroblotted onto PVDF membranes using standard methods. The membranes were immunostained with a rabbit polyclonal anti-XIAP antibody at 1:1000 for 1 hour at room temperature. Following four 15 minute washes, a goat anti-rabbit antibody conjugated to horse-radish ~o peroxidase was applied at room temperature for 1 hour.
Unbound secondary antibody was washed away, and chemiluminescent detection of XIAP protein was performed.
The Western blot revealed the presence of the full-length, 55 kDa XIAP protein, both in untreated and treated cells. In addition, a novel, approximately 26 kDa xiap-reactive band was also observed in apoptotic cell extracts, but not in the control, untreated cell extracts (Fig. 19).
Cleavage of XIAP occurs in a variety of cell zo types, including other cancer cell lines such as HeLa.
The expression of the 26 kDa XIAP cleavage product was demonstrated in HeLa cells as follows. HeLa cells were treated with either: (1) cyclohexamide (20 ~cg/ml), (2) anti-Fas antibody (1 ~cg/ml), (3) anti-Fas antibody 2s ( 1 Ecg/ml ) and cyclohexamide ( 2 0 ~.g/ml ) , ( 4 ) TNFa (1,000 U/ml), or (5) TNFa (1,000 U/ml) and cyclohexamide (20 ~Cg/ml). All cells were harvested 18 hours after treatment began. As above, anti-Fas antibody was added to an extract after the cells were harvested. HeLa cells 3o were harvested, and the Western blot was probed under the same conditions as used to visualize xiap-reactive bands from Jurkat cell samples. A 26 kDa XIAP band was again seen in the apoptotic cell preparations (Fig. 20).
Furthermore, the degree of XIAP cleavage correlated 35 positively with the extent of apoptosis. Treatment of - s4 -HeLa cells with cycloheximide or TNFa alone caused only minor apoptosis,.and little cleavage product was observed. If the cells were treated with the anti-Fas antibody, a greater amount of cleavage product was s apparent. These data indicate that XIAP is cleaved in more than one cell type and in response to more than one type of apoptotic trigger.
Time Course of Expression The time course over which the 26 kDa cleavage ~o product accumulates was examined by treating HeLa and Jurkat cells with anti-Fas antibody (1 ~.g/ml) and harvesting them either immediately, or 1, 2, 3, 5, 10, or 22 hours after treament. Protein extracts were prepared and Western blot analysis was performed as described ~s above. Both types of cells accumulated increasing quantities of the 26 kDa cleavage product over the time course examined (Figs. 21A and 21B).
Subcellular Localization of the 26 kDa XIAP Cleavage Product 2o In order to determine the subcellular location of the 26 kDa cleavage product, Jurkat cells were induced to undergo apoptosis by exposure to anti-Fas antibody (1 ug/ml) and were then harvested either immediately, 3 hours, or 7 hours later. Total protein extracts were zs prepared, as described above, from cells harvested at each time point. In order to prepare nuclear and cytoplasmic cell extracts, apoptotic Jurkat cells were washed with isotonic Tris buffered saline (pH 7.0) and lysed by freezing and thawing five times in cell 3o extraction buffer (50 mM PIPES, 50 mM KC1, 5 mM EGTA, 2 mM MgCl2, 1 mM DTT, and 20 ~r,M cytochalasin B). Nuclei were pelleted by centrifugation and resuspended in isotonic Tris (pH 7.0) and frozen at -80°C. The cytoplasmic fraction of the extract was processed further as by centrifugation at 60,000 RPM in a TA 100.3 rotor for 30 minutes. Supernatants were removed and frozen at - -76962-52(S) 80°C. Samples of both nuclear and cytoplasmic fractions were loaded on a 12.5% SDS-polyacrylamide gel, and electroblotted onto PVDF membranes. Western blot analysis was then performed using either an anti-CPP32 antibody (Transduction Laboratories Lexington, KY; Fig.
22A) or the rabbit anti-XIAP antibody described above (Fig. 22B).
The anti-CPP32 antibody, which recognizes the CPP32 protease (also known as YAI~~'.A or .Apopain) ~o partitioned almost exclusively in, the cytoplasmic fraction. The 55 kDa XIAP protain localized exclusively in the cytoplasm of apoptotic cells, in agreement with the studies presented above, where XIAP protein in normal, healthy COS cells was seen to localize, by ~s'~ immunofluoresence microscopy, to the cytoplasm. In contrast, the 26 kDa cleavage product localized exclusively to the nuclear fraction of apoptotic Jurkat cells. Taken together, these observations suggest that the anti-apoptotic component of XIAP could be the 26 kDa zo cleavage product, which exerts its influence within the nucleus.
_D. In vitro Cleavage of XIAP protein and Characterization of the Cleavage Produces For this series of experiments, XIAP protean was z5 labeled with 35S using the plasmid pcDNA3-6myc-XIAP, T7 RNA polymerase, and a coupled transcription/translation kit (Promega) according to the manufacturer's instructions. Radioactively labeled XIAP protein was separated from unincorporated methionine by column So chromatography using Sephadex G-50". In addition, extracts of apoptotic Jurkat cells were prepared following treatment with anti-Fa~~ antibody (1 ~cg/ml) for three hours. To prep*re the extracts, the cells were lysed in Triton X-lOC buffer (1% Triton X-100, 25 mM Tris 3s HC1) on ice for two hours and then microcentrifuged for 5 minutes. The soluble extract was retained (and was *Trade-mark 76962-52(S) labeled TX100). Cells were lysed in cell extraction buffer with freeze/thawing. The soluble cytoplasmic fraction was set aside (and labeled CEB). Nuclear pellets from the preparation of the CEB cytoplasmic s fraction were solubilized with Triton X-100 buffer, microcentrifuged, and the soluble fractions, which contains primarily nuclear DNA, was retained (and labeled CEB-TX100). Soluble cell extract was prepared by lysing cells with NP-40 buffer, followed by microcentrifugation ~o for 5 minutes (and was labeled NP-40). In vitro cleavage was performed by incubating 16 ~cl of each extract (CEB, TX-100, CEB-TX100, and NP-40) with 4 ~1 of in vitro translated XIAP protein at 37°C for 7 hours. Negative controls, containing only TX100 buffer or CEB buffer were i5 also included. The proteins were separated on a 10=~ SDS-polyacrylamide gel, which was dried and exposed to :~C-ray film overnight.
In vitro cleavage of XIAP was apparent in the CEB extract. The observed molecular weight of the zo cleavage product was approximately 36 kDa (Fig. 23). The kDa shift in the size of the cleavage product indicates that the observed product is derived from the amino-terminus of the recombinant protein, which contains six copies of the myc epitope (10 kDa). It thus appears z5 that the cleavage product possesses at least two of the BIR domains, and that it is localized to the nucleus.
XIII. Treatment of HIV Infected Individuals The expression of hiap-1 and hiap-2 is decreased significantly in HIV-infected human cells. Furthermore, so this decrease precedes apoptosis. Therefore, administration of HIAP-1, HIAP-2, genes encoding these proteins, or compounds that up:regulate these genes can be used to prevent T cell attrition in HIV-infected patients. The following assay may also be used to screen *Trade-mark for compounds that alter hiap-1 and hiap-2 expression, and which also prevent apoptosis.

Cultured mature lymphocyte CD-4+ T cell lines (H9, labelled "a"; CEM/CM-3, labelled "b"; 6T-CEM, s labelled "c"; and Jurkat, labelled "d" in Figs. 13A and 13B), were examined for signs of apoptosis (Fig. 13A) and hiap gene expression (Fig. 13B) after exposure to mitogens or HIV infection. Apoptosis was demonstrated by the appearance of DNA "laddering" upon gel ~o electrophoresis and gene expression was assessed by PCR.

The results obtained from normal (non-infected, non-mitogen stimulated) cells are shown in each lane labelled "1" in Figs. 13A and 13B. The results obtained 24 hours after PHA/PMA (phytohemagglutinin/phorbol ester) ~s stimulation are shown in each lane labelled "2". The results obtained 24 hours after HIV strain IIIB infection are shown in each lane labelled "3". The "M" refers to standard DNA markers (the 123 by ladder in Fig. 13B, and the lambda HindIII ladder in Fig. 13A (both from Gibco-zo BRL)). DNA ladders (Prigent et al., J. Immunol. Methods, 160:139-140, 1993), which indicate apoptosis, are evident when DNA from the samples described above are electrophoresed on an ethidium bromide-stained agarose gel (Fig. 13A). The sensitivity and degree of apoptosis zs of the four T cell lines tested varies following mitogen stimulation and HIV infection.

In order to examine hiap gene expression, total RNA was prepared from the cultured cells and reverse transcribed using oligo-dT priming. The RT cDNA products 3o were amplified by PCR using specific primers (as shown in Table 5) for the detection of hiap-2a, hiap-2b and hiap-1. The PCR was conducted using a PerkinElmer 480 thermocycler with 35 cycles of the following program:

94C for one minute, 55C for 2 minutes and 72C for 1.5 ss minutes. The RT-PCR reaction products were electrophoresed on a 1% agarose gel, which was stained with ethidium bromide. Absence of hiap-2 transcripts is noted in all four cell lines 24 hours after HIV _ infection. In three of four cell lines (all except H9), the hiap-1 gene is also dramatically down-regulated after HIV infection. PHA/PMA mitogen stimulation also appears to decrease hiap gene expression; particularly of hiap-2 and to a lesser extent, of hiap-1. The data from these experiments is summarized in Table 5. The expression of ~o ,8-actin was consistent in all cell lines tested, indicating that there is not a flaw in the RT-PCR assay that could account for the decrease in hiap gene expression.

~5 OLIGONUCLEOTIDE PRIMERS FOR THE SPECIFIC RT-PCR
AMPLIFICATION OF UNIQUE IAP GENES
IAP Gene Forward Prister Reverse Primor Sise of Product (nucleotide (nucleotide (bp) position*) position*) h-xiap p2415 (876-896) p2449 (1291-1311)435 s-xiap p2566 (458-478) p2490 (994-1013) 555 20 h-hia 1 2465 827-847 2464 1008-1038 211 st-hia 1 2687 747-767 2684 1177-1197 450 hiap2 p2595 (1562-1585) p2578 (2339-2363)801 618b m-hiap2 p2693 (1751-1772) p2734 (2078-2100)349 * Nucleotide position as determined from Figs. 1-4 for 25 each IAP gene a PCR product size of hiap2a PCR product size of hiap2b APOPTOSIS AND HIAP GENE EXPRESSION IN CULTURED T-CELLS
FOLLOWING MITOGEN STIMULATION OR HIV INFECTION
Cell Line Condition Apoptosis hiapi hiap2 s H9 not stimulated - +

PHA/PMA stimulated +++ +

HIV infected ++ + -CEM/CM-3 not stimulated - +

PHA/PMA stimulated + -HIV infected - -6T-CSM not stimulated - + +

PHA/PMA stimulated - -HIV infected + - -Jurkat not stimulated - + ++

PHA/PMA stimulated + + +

HIV infected - -X~V. Assic;nment of xiap, hiap-1, and hiap-2 to Chromosomes Xa25 and 11q22-23 by Fluorescence in situ Hybridization s Fluorescence in situ hybridization (FISH) was used to identify the chromosomal location of xiap, hiap-1 -and hiap-2. The probes used were cDNAs cloned in plasmid vectors: the 2.4 kb xiap clone included 1493 by of coding sequence, 34bp of 5' UTR (untranslated region) and ~0 913 by of 3'UTR; the hiap-1 cDNA was 3.1 kb long and included 1812 by coding and 1300 by of 3' UTR; and the hiap-2 clone consisted of 1856 by of coding and 1200 by of 5' UTR. A total of 1 ~g of probe DNA was labelled with biotin by nick translation (BRL). Chromosome ~5 spreads prepared from a normal peripheral blood culture were denatured for 2 minutes at 70°C in 50% formamide/2X
SSC and subsequently hybridized with the biotin labelled DNA probe for 18 hours at 37°C in a solution consisting of 2X SSC/70% formamide/10% dextran sulfate. After 2o hybridization, the spreads were washed in 2X SSC/50% formamide, followed by a wash in 2X SSC at 42°C. The biotin labelled DNA was detected by fluorescein isothiocyanate (FITC) conjugated avidin antibodies and anti-avidin antibodies (ONCOR detection 2s kit), according to the manufacturer's instructions.
Chromosomes were counterstained with propidium iodide and examined with a Olympus BX60 epifluorescence microscope.
For chromosome identification, the slides with recorded labelled metaphase spreads were destained, dehydrated, 3o dried, digested with trypsin for 30 seconds and stained with 4% Giemsa stain for 2 minutes. The chromosome spreads were relocated and the images were compared.
A total of I01 metaphase spreads were examined with the xiap probe, as described above. Symmetrical "
ss fluorescent signals on either one or both homologs of chromosome Xq25 were observed in 74% of the cells analyzed. Following staining with hiap-1 and hiap-2 probes, 56 cells were analyzed and doublet signals in the region 11q22-23 were observed in 83% of cells examined.
s The xiap gene was mapped to Xq25 while the hiap-1 and hiap-2 genes were mapped at the border of 11q22 and 11q23 bands.
These experiments confirmed the location of the xiap gene on chromosome Xq25. No highly consistent 1o chromosomal abnormalities involving band Xq25 have been reported so far in any malignancies. However, deletions within this region are associated with a number of immune system defects including X-linked lymphoproliferative disease (Wu et al., Genomics 17:163-170, 1993).
15 Cytogenetic abnormalities of band 11q23 have been identified in more than 50% of infant leukemias regardless of the phenotype (Martinez-Climet et al., Leukaemia 9:1299-1304, 1995). Rearrangements of the MLL
Gene (mixed lineage leukemia or myeloid lymphoid 20 leukemia; Ziemin Van der Poel et al., Proc. Natl. Acad.
Sci. USA 88:10735-10739, 1991) have been detected in 80%
of cases with 11q23 translocation, however patients whose rearrangements clearly involved regions other than the MLL gene were also reported (Kobayashi et al., Blood 2s 82:547-551, 1993). Thus, the IAP genes may follow the Bcl-2 paradigm, and would therefore play an important role in cancer transformation.
XV. Preventive Anti-Apontotic Theralw In a patient diagnosed to be heterozygous for an 3o IAP mutation or to be susceptible to IAP mutations (even if those mutations do not yet result in alteration or loss of IAP biological activity), or a patient diagnosed as HIV positive, any of the above therapies may be administered before the occurrence of the disease phenotype. For example, the therapies may be provided to a patient who is HIV positive but does not yet show a diminished T cell count or other overt signs of AIDS. In particular, compounds shown to increase IAP expression or s IAP biological activity may be administered by any standard dosage and route of administration (see above).
Alternatively, gene therapy using an IAP expression construct may be undertaken to reverse or prevent the cell defect prior to the development of the degenerative ~o disease.
The methods of the instant invention may be used to reduce or diagnose the disorders described herein in any mammal, for example, humans, domestic pets, or livestock. Where a non-human mammal is treated or is diagnosed, the IAP polypeptide, nucleic acid, or antibody employed is preferably specific for that species.
Other Embodiments In other embodiments, the invention includes any protein which is substantially identical to a mammalian 2o IAP polypeptides (Figs. 1-6; SEQ ID NOs:l-42); such homologs include other substantially pure naturally-occurring mammalian IAP proteins as well as allelic variants; natural mutants; induced mutants; DNA sequences which encode proteins and also hybridize to the IAP DNA
25 sequences of Figs. 1-6 (SEQ ID NOS:l-42) under high stringency conditions or, less preferably, under low stringency conditions (e. g., washing at 2X SSC at 400C
with a probe length of at least 40 nucleotides); and proteins specifically bound by antisera directed to a IAP
3o polypeptide. The term also includes chimeric polypeptides that include a IAP portion. r The invention further includes analogs of any naturally-occurring IAP polypeptide. Analogs can differ ' from the naturally-occurring IAP protein by amino acid _ E,3 _ f sequence differences, by post-translational modifications, or by both. Analogs of the invention will generally exhibit at least 85%, more preferably 90%, and most preferably 95% or even 99% identity with all or part s of a naturally occurring IAP amino acid sequence. The length of sequence comparison is at least 15 amino acid residues, preferably at least 25 amino acid residues, and more preferably more than 35 amino acid residues.

Modifications include in vivo and in vitro chemical to derivatization of polypeptides, e.g., acetylation, carboxylation, phosphorylation, or glycosylation; such modifications may occur during polypeptide synthesis or processing or following treatment with isolated modifying enzymes. Analogs can also differ from the naturally-~s occurring IAP polypeptide by alterations in primary sequence. These include genetic variants, both natural and induced (for example, resulting from random mpt_agP_n_P__ci-~ by 3rradi_ation o_r ex_nosure to ethanemethylsulfate or by site-specific mutagenesis as 2o described in Sambrook, Fritsch and Maniatis, Molecular Cloning: A Laboratory Manual (2d ed.), CSH Press, 1989, or Ausubel et al., supra). Also included are cyclized peptides, molecules, and analogs which contain residues other than L-amino acids, e.g., D-amino acids or non-zs naturally occurring or synthetic amino acids, e.g., B or y amino acids. In addition to full-length polypeptides, the invention also includes IAP polypeptide fragments.

As used herein, the term "fragment," means at least 20 contiguous amino acids, preferably at least 30 contiguous so amino acids, more preferably at least 50 contiguous amino acids, and most preferably at least 60 to 80 or more contiguous amino acids. Fragments of IAP polypeptides can be generated by methods known to those skilled in the art or may result from normal protein processing (e. g., 3s removal of amino acids from the nascent polypeptide that are not required for biological activity or removal of amino acids by alternative mRNA splicing or alternative protein processing events).
Preferable fragments or analogs according to the s invention are those which facilitate specific detection of a IAP nucleic acid or amino acid sequence in a sample to be diagnosed. Particularly useful IAP fragments for this purpose include, without limitation, the amino acid fragments shown in Table 2.
~o What is claimed is:

SEQUENCE LISTING
(1) GENERAL INFORMATION:
(i) APPLICANT: University of Ottawa Rorneluk, Robert G.
Mackenzie, Alexander E.
- Baird, Stephen Liston, Peter (ii) TITLE OF INVENTION: MAMMALIAN IAP GENE FAMILY, PRIMERS, PROBES, AND DETECTION METHODS
(iii) NUMBER OF SEQUENCES: 45 (iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: Fish & Richardson P.C.
(B) STREET: 225 Franklin Street (C) CITY: Boston (D) STATE: MA
(E) COUNTRY: USA
(F) ZIP: 02110-2804 (v) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Floppy disk (B) COMPUTER: IBM PC compatible (C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: PatentIn Release #1.0, Version #1.30 (vi) CURRENT APPLICATION DATA:
~A~ ~PLICATION--i~-UMBER:
(B) FILING DATE:
(C) CLASSIFICATION:
(vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER: PCT/IB96/----(B) FILING DATE: 05-AUG-1996 (C) CLASSIFICATION:
(vii) PRIORITY APPLICATION DATA:
(A) APPLICATION NUMBER: US 08/511,485 (B) FILING DATE: 04-AUG-1995 (C) CLASSIFICATION:
(vii) PRIORITY APPLICATION DATA:
(A) APPLICATION NUMBER: US 08/576,956 (B) FILING DATE: 22-DEC-1995 (C) CLASSIFICATION:
(viii) ATTORNEY/AGENT INFORMATION:
(A) NAME: Clark, Paul T.
(B) REGISTRATION NUMBER: 30,162 (C) REFERENCE/DOCFCET NUMBER: 07891/003W01 (ix) TELECOMMUNICATION INFORMATION:
(A) TELEPHONE: 617/542-5070 (B) TELEFAX: 617/542-8906 (C) TELEX: 200154 (2) INFORMATION FOR SEQ ID NO:1:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 46 amino acids (B) TYPEz amino acid (C) STRANDEDNESS: not relevant (D) TOPOLOGY: both (ii) MOLECULE TYPE: protein (ix) FEATURE: ' (D) OTHER INFORMATION: Xaa at positons 2, 3, 4, 5, 6, 7, 9, 10, 11, 17, 18, 19, 20, 21, 23, 25, 30, 31, 32, 34, 35, 38, 39, 40, 41, 42, and 45 may be any amino acid. Xaa at positon 8 is Glu or Asp. Xaa at positions 14 & 22 is Val or Ile.
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:
Glu Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Cys Lys Xaa Cys Met Xaa Xaa Xaa Xaa Xaa Xaa Xaa Phe Xaa Pro Cys Gly His Xaa Xaa Xaa Cys Xaa Xaa Cys Ala Xaa Xaa Xaa Xaa Xaa Cys Pro Xaa Cys (2) INFORMATION FOR SEQ ID N0:2:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 68 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: not relevant (D) TOPOLOGY: both (ii) MOLECULE TYPE: protein (ix) FEATURE:
(D) OTF~R INFORMATION: Xaa at positions 1, 2, 3, 6, 9, 10, 14, 15, 18, 19, 20, 21, 24, 30, 32, 33, 35, 37, 40, 42, 43, 44, 45, 46, 47, 49, 50, 51, 53, 54, 55, 56, 57, 59, 60, 61, 62, 64 and 66 may be any amino acid. Xaa at positions 13, 16 and 17 may be any amino acid or may be absent.
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:2:
Xaa Xaa Xaa Arg Leu Xaa Thr Phe Xaa Xaa Trp Pro Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Leu Ala Xaa Ala Gly Phe Tyr Tyr Xaa Gly Xaa Xaa Asp Xaa Val Xaa Cys Phe Xaa Cys Xaa Xaa Xaa Xaa Xaa Xaa Trp Xaa Xaa Xaa Asp Xaa Xaa Xaa Xaa Xaa His Xaa Xaa Xaa Xaa Pro Xaa Cys Xaa Phe Val (2) INFORMATION FOR SEQ ID N0:3:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 2540 base pairs (B) TYPE: nucleic acid _ (C) STRANDEDNESS: both (D) TOPOLOGY: both (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID N0:3:

.

.

_ ~,g _ ATCGTTTTTG

AAGTGTCCCA

AACTCTATAG

TGACTTTAAG

TAGCATTTGC TACCAAGTAG G~1AAAAAAAT GTGTTTTAGT TGGCAATATA1680 GTACATGGCA

TAGCTGTATT

AGCATCATAC

GTAAGTGAAT

TTCTGTATAT

GAAAAAGGAA

TGTTGTGTTT

ATATGTTTGT

GCCAACATGT

GGGACACTAT

GAGAGATTTG

GATTGGGGGA

TTTTGTTCTG

CATCAGTAAC

CACCCACCAC

(2) INFORMATION FOR SEQ ID N0:4:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 497 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: unknown (D) TOPOLOGY: both (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID N0:4:
Met Thr Phe Asn Ser Phe Glu Gly Ser Lys Thr Cys Val Pro Ala Asp Ile Asn Lys Glu Glu Glu Phe Val Glu Glu Phe Asn Arg Leu Lya Thr Phe Ala Asn Phe Pro Ser Gly Ser Pro Val Ser Ala Ser Thr Leu Ala Arg Ala Gly Phe Leu Tyr Thr Gly Glu Gly Asp Thr Val Arg Cys Phe Ser Cys His Ala Ala Val Asp Arg Trp Gln Tyr Gly Asp Ser Ala Val Gly Arg His Arg Lys Val Ser Pro Asn Cys Arg Phe Ile Asn Gly Phe " ~ Tyr Leu Glu Asn Ser Ala Thr Gln Ser Thr Asn Ser Gly Ile Gln Asn Gly Gln Tyr Lys Val Glu Asn Tyr Leu Gly Ser Arg Asp His Phe Ala Leu Asp Arg Pro Ser Glu Thr His Ala Asp Tyr Leu Leu Arg Thr Gly Gln Val Val Asp Ile Ser Asp Thr Ile Tyr Pro Arg Asn Pro Ala Met Tyr Cys Glu Glu Ala Arg Leu Lys Ser Phe Gln Asn Trp Pro Asp Tyr Ala His Leu Thr Pro Arg Glu Leu Ala Ser Ala Gly Leu Tyr Tyr Thr Gly Ile Gly Asp Gln Val Gln Cys Phe Cys Cys Gly Gly Lys Leu Lys Asn Trp Glu Pro Cys Asp Arg Ala Trp Ser Glu His Arg Arg His Phe Pro Asn Cys Phe Phe Val Leu Gly Arg Asn Leu Asn Ile Arg Ser Glu Ser Asp Ala Val Ser Ser Asp Arg Asn Phe Pro Asn Ser Thr Asn Leu Pro Arg Asn Pro Ser Met Ala Asp Tyr Glu Ala Arg Ile Phe Thr Phe Gly Thr Trp Ile Tyr Ser Val Asn Lys Glu Gln Leu Ala Arg Ala Gly Phe Tyr Ala Leu Gly Glu Gly Asp Lys Val Lys Cys Phe His Cys Gly Gly Gly Leu Thr Asp Trp Lys Pro Ser Glu Asp Pro Trp Glu Gln His Ala Lys Trp Tyr Pro Gly Cys Lys Tyr Leu Leu Glu Gln Lys Gly Gln Glu Tyr Ile Asn Asn Ile Hie Leu Thr His Ser Leu Glu Glu Cys Leu Val Arg Thr Thr Glu Lys Thr Pro Ser Leu Thr Arg Arg Ile Asp Asp Thr Ile Phe Gln Asn Pro Met Val Gln Glu Ala Ile Arg Met Gly Phe Ser Phe Lya Asp Ile Lys Lys Ilg Met Glu Glu Lys Ile Gln Ile Ser Gly Ser Aan Tyr Lya Ser Leu Glu Val Leu Val Ala Asp Leu Val Asn Ala Gln Lys Asp Ser Met Gln Asp Glu Ser Ser Gln Thr Ser Leu Gln . Lys Glu Ile Ser Thr Glu Glu Gln Leu Arg Arg Leu Gln Glu Glu Lys Leu Cys Lys Ile Cys Met Asp Arg Asn Ile Ala Ile Val Phe Val Pro Cys Gly His Leu Val Thr Cys Lys Gln Cys Ala Glu Ala Val Asp Lya Cys Pro Met Cys Tyr Thr Val Ile Thr Phe Lys Gln Lys Ile Phe Met ser (2) INFORMATION FOR SEQ ID N0:5:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 2676 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: both (D) TOPOLOGY: both (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID N0:5:

AATGCATAGA

ACTGATAAAA

TTCCCCATTC

AAAAGCGCCA

ACGTATTCCA

TTCTATTACA

AACTGGAAAA

TTCGTTCAGA

TCTTCAGTAA

CGTGGCTCTT

TCTGCCTTGA

ACTTTTCAGA

.

' AGAGAATTAC TTGAGCCCAG GAGTTTGAATCCATCCTGGGCAGCATACTGAGACCCTGCC2460 _ n _ (2) INFORMATION FOR SEQ ID N0:6:
(i) SEQUENCE CHARACTERISTICS: -(A) LENGTH: 604 amino acids (B) TYPES amino acid (C) STRANDEDNESS: not relevant (D) TOPOLOGY: both ' (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID N0:6:
Met Asn Ile Val Glu Asn Ser Ile Phe Leu Ser Asn Leu Met Lys Ser Ala Asn Thr Phe Glu Leu Lys Tyr Asp Leu Ser Cys Glu Leu Tyr Arg Met Ser Thr Tyr Ser Thr Phe Pro Ala Gly Val Pro Val Ser Glu Arg Ser Leu Ala Arg Ala Gly Phe Tyr Tyr Thr Gly Val Asn Asp Lys Val Lys Cys Phe Cys Cys Gly Leu Met Leu Asp Asn Trp Lys Arg Gly Asp Ser Pro Thr Glu Lys His Lys Lys Leu Tyr Pro Ser Cys Arg Phe Val Gln Ser Leu Asn Ser Val Asn Asn Leu Glu Ala Thr Ser Gln Pro Thr Phe Pro Ser Ser Val Thr His Ser Thr His Ser Leu Leu Pro Gly Thr Glu Asn Ser Gly Tyr Phe Arg Gly Ser Tyr Ser Asn Ser Pro Ser Asn Pro Val Asn Ser Arg Ala Asn Gln Glu Phe Ser Ala Leu Met Arg Ser Ser Tyr Pro Cys Pro Met Asn Asn Glu Asn Ala Arg Leu Leu Thr Phe Gln Thr Trp Pro Leu Thr Phe Leu Ser Pro Thr Asp Leu Ala Arg Ala Gly Phe Tyr Tyr Ile Gly Pro Gly Asp Arg Val Ala Cys Phe Ala Cys Gly Gly Lys Leu Ser Asn Trp Glu Pro Lys Asp Asn Ala Met Ser Glu His Lgu Arg His Phe Pro Lys Cys Pro Phe Ile Glu Asn Gln Leu Gln Asp Thr Ser Arg Tyr Thr Val Ser Asn Leu Ser Met Gln Thr His Ala Ala Arg Phe Lys Thr Phe Phe Asn Trp Pro Ser Ser Val Leu Val Asn Pro Glu Gln Leu Ala Ser Ala Gly Phe Tyr Tyr Val Gly Asn Ser Asp Asp Val Lys Cys Phe Cys Cys Asp Gly Gly Leu Arg Cys Trp Glu Ser Gly Asp Asp Pro Trp Val Gln His Ala Lys Trp Phe Pro Arg Cys Glu Tyr Leu Ile Arg Ile Lys Gly Gln Glu Phe Ile Arg Gln Val Gln Ala Ser Tyr Pro His Leu Leu Glu Gln Leu Leu Ser Thr Ser Asp Ser Pro Gly Asp Glu Asn Ala Glu Ser Ser Ile Ile His Leu Glu Pro Gly Glu Asp His Ser Glu Asp Ala Ile Met Met Asn Thr Pro Val Ile Asn Ala Ala Val Glu Met Gly Phe Ser Arg Ser Leu Val Lys Gln Thr Val Gln Arg Lys Ile Leu Ala Thr Gly Glu Asn Tyr Arg Leu Val Asn Asp Leu Val Leu Asp Leu Leu Aen Ala Glu Asp Glu Ile Arg Glu Glu Glu Arg Glu Arg Ala Thr Glu Glu Lys Glu Ser Asn Asp Leu Leu Leu Ile Arg Lys Asn Arg Met Ala Leu Phe Gln His Leu Thr Cys Val Ile Pro Ile Leu Asp Ser Leu Leu Thr Ala Gly Ile Ile Asn Glu Gln Glu His Asp Val Ile Lys Gln Lys Thr Gln Thr Ser Leu Gln Ala Arg Glu Leu Ile Asp Thr Ile Leu Val Lys Gly Asn Ile Ala Ala Thr Val Phe Arg Asn Ser Leu Gln Glu Ala Glu Ala Val Leu Tyr Glu His Leu Phe Val Gln Gln Asp Ile Lys Tyr Ile Pro Thr Glu Asp Val Ser Asp Leu Pro Val Glu Glu Gln Leu Arg Arg Leu Pro Glu Glu Arg Thr Cys Lys Val Cys Met Asp Lys Glu Val Ser Ile Val Phe Ile Pro Cys Gly His Leu Val Val Cys Lys Asp Cys Ala Pro Ser Leu Arg Lys Cys Pro Ile Cys Arg 580 585 590 ' Ser Thr Ile Lys Gly Thr Val Arg Thr Phe Leu Ser (2) INFORMATION FOR SEQ ID N0:7:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 2580 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: both (D) TOPOLOGY: both (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID N0:7:

GCTGTTGTCA

TATTTACAAG GGAAGATTTA TGTTTGGTGA ACTATATTAGTATGTATGTGTACCTAAGGG2340, (2) INFORMATION FOR SEQ ID N0:8:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 618 amino acids (8) TYPE: amino acid (C) STRANDEDNESS: not relevant (D) TOPOLOGY: both (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRZPTION: SEQ ID N0:8:
Y
Met His Lys Thr Ala Ser Gln Arg Leu Phe Pro Gly Pro Ssr Tyr Gln Aen Ilg Lys Ser Ile Met Glu Asp Ser Thr Ile Leu Ser Asp Trp Thr Asn Ser Asn Lys Gln Lys Met Lys Tyr Asp Phe Ser Cys Glu Leu Tyr Arg Met Ser Thr Tyr Ser Thr Phe Pro Ala Gly Val Pro Val Ser Glu Arg Ser Leu Ala Arg Ala Gly Phe Tyr Tyr Thr Gly Val Asn Asp Lys 65 70 75 8p Val Lys Cys Phe Cys Cys Gly Leu Met Leu Asp Asn Trp Lys Leu Gly Asp Ser Pro Ile Gln Lys His Lys Gln Leu Tyr Pro Ser Cys Ser Phe Ile Gln Asn Leu Val Ser Ala Ser Leu Gly Ser Thr Ser Lys Asn Thr Ser Pro Met Arg Asn Ser Phe Ala His Ser Leu Ser Pro Thr Leu Glu His Ser Ser Leu Phe Ser Gly Ser Tyr Ser Ser Leu Pro Pro Asn Pro Leu Asn Ser Arg Ala Val Glu Asp Ile Ser Ser Ser Arg Thr Asn Pro Tyr Ser Tyr Ala Met Ser Thr Glu Glu Ala Arg Phe Leu Thr Tyr His Met Trp Pro Leu Thr Phe Leu Ser Pro Ser Glu Leu Ala Arg Ala Gly Phe Tyr Tyr Ile Gly Pro Gly Asp Arg Val Ala Cys Phe Ala Cys Gly Gly Lys Leu Ser Asn Trp Glu Pro Lys Asp Asp Ala Met Ser Glu His Arg Arg His Phe Pro Asn Cys Pro Phe Leu Glu Asn Ser Leu Glu Thr Leu Arg Phe Ser Ile Ser Asn Leu Ser Met Gln Thr His Ala Ala Arg Met Arg Thr Phe Met Tyr Trp Pro Ser Ser Val Pro Val Gln Pro Glu Gln Leu Ala Ser Ala Gly Phe Tyr Tyr Val Gly Arg Asn Asp Asp Val Lys Cys Phe Gly Cys Asp Gly Gly Leu Arg Cys Trp Glu Ser Gly Asp Asp Pro Trp Val Glu His Ala Lys Trp Phe Pro Arg Cys Glu Phe Leu Ile Arg Met Lys Gly Gln Glu Phe Val Asp Glu Ile Gln Gly Arg Tyr Pro His Leu Leu Glu Gln Leu Leu Ser Thr Ser Asp Thr Thr Gly Glu ' 355 360 365 Glu Asn Ala Asp Pro Pro Ile Ile His Phe Gly Pro Gly Glu Ser Ser Ser Glu Asp Ala Val Met Met Asn Thr Pro Val Val Lys Ser Ala Leu Glu Met Gly Phe Asn Arg Asp Leu Val Lys Gln Thr Val Leu Ser Lys Ile Leu Thr Thr Gly Glu Asn Tyr Lys Thr Val Asn Asp Ile Val Ser Ala Leu Leu Asn Ala Glu Asp Glu Lys Arg Glu Glu Glu Lys Glu Lys Gln Ala Glu Glu Met Ala Ser Asp Asp Leu Ser Leu Ile Arg Lys Asn Arg Met Ala Leu Phe Gln Gln Leu Thr Cys Val Leu Pro Ile Leu Asp Asn Leu Leu Lys Ala Asn Val Ile Asn Lys Gln Glu His Asp Ile Ile Lye Gln Lys Thr Gln Ile Pro Leu Gln Ala Arg Glu Leu Ile Asp Thr Ile Trp Val Lys Gly Asn Ala Ala Ala Asn Ile Phe Lys Asn Cys Leu Lys Glu Ile Asp Ser Thr Leu Tyr Lys Asn Leu Phe Val Asp Lys Asn Met Lys Tyr Ile Pro Thr Glu Asp Val Ser Gly Leu Ser Leu Glu Glu Gln Leu Arg Arg Leu Gln Glu Glu Arg Thr Cys Lys Val Cys Met Asp Lys Glu Val Ser Val Val Phe Ile Pro Cys Gly His Leu Val Val Cys Gln Glu Cys Ala Pro Ser Leu Arg Lys Cys Pro Ile Cys Arg Gly Ile 595 , 600 605 Ile Lys Gly Thr Val Arg Thr Phe Leu Ser (2) INFORMATION FOR SEQ ID N0:9:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 2100 base pairs (B) TYPE: nucleic acid ' (C) STRANDEDNESS: both (D) TOPOLOGY: both ' (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE
DESCRIPTION:
SEQ ID
N0:9:

AACAAGGAGCAGCTTGCAAG AGCTGGATTTTATGCTTTAGGTGAAGGCGATAAAGTGAAG 1020 .

TCCGGGAGCAGCTATCTATC ACTTGAGGTCCTGATTGCAGATCTTGTGAGTGCTCAGAAA 1380.

a _ 79 _ (2),INFORMATION FOR SEQ ID NO:10:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 496 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: not relevant (D) TOPOLOGY: both (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:10:
Met Thr Phe Asn Ser Phe Glu Gly Thr Arg Thr Phe Val Leu Ala Asp Thr Asn Lys Asp Glu Glu Phe Val Glu Glu Phe Asn Arg Leu Lys Thr Phe Ala Asn Phe Pro Ser Ser Ser Pro Val Ser Ala Ser Thr Leu Ala Arg Ala Gly Phe Leu Tyr Thr Gly Glu Gly Asp Thr Val Gln Cys Phe Ser Cys His Ala Ala Ile Asp Arg Trp Gln Tyr Gly Asp Ser Ala Val Gly Arg His Arg Arg Ile Ser Pro Asn Cys Arg Phe Ile Asn Gly Phe Tyr Phe Glu Asn Gly Ala Ala Gln Ser Thr Asn Pro Gly Ile Gln Asn Gly Gln Tyr Lys Ser Glu Asn Cys Val Gly Asn Arg Asn Pro Phe Ala Pro Asp Arg Pro Pro Glu Thr His Ala Asp Tyr Leu Leu Arg Thr Gly Gln Val Val Asp Ile Ser Asp Thr Ile Tyr Pro Arg Asn Pro Ala Met x _ gp _ Cys Ser Glu Glu Ala Arg Leu Lys Ser Phe Gln Asn Trp Pro Asp Tyr 165 170 175 "
Ala His Leu Thr Pro Arg Glu Leu Ala Ser Ala Gly Leu Tyr Tyr Thr Gly Ala Asp Asp Gln Val Gln Cys Phe Cys Cys Gly Gly Lye Leu Lys Asn Trp Glu Pro Cys Asp Arg Ala Trp Ser Glu His Arg Arg His Phe Pro Asn Cye Phe Phe Val Leu Gly Arg Asn Val Asn Val Arg Ser Glu Ser Gly Val Ser Ser Asp Arg Asn Phe Pro Asn Ser Thr Asn Ser Pro Arg Asn Pro Ala Met Ala Glu Tyr Glu Ala Arg Ile Val Thr Phe Gly Thr Trp Ile Tyr Ser Val Asn Lys Glu Gln Leu Ala Arg Ala Gly Phe Tyr Ala Leu Gly Glu Gly Asp Lys Val Lys Cys Phe His Cys Gly Gly Gly Leu Thr Asp Trp Lys Pro Ser Glu Asp Pro Trp Asp Gln His Ala Lys Cys Tyr Pro Gly Cys Lys Tyr Leu Leu Asp Glu Lys Gly Gln Glu Tyr Ile Asn Asn Ile His Leu Thr His Pro Leu Glu Glu Ser Leu Gly Arg Thr Ala Glu Lys Thr Pro Pro Leu Thr Lys Lys Ile Asp Asp Thr Ile Phe Gln Asn Pro Met Val Gln Glu Ala Ile Arg Met Gly Phe Ser Phe Lys Asp Leu Lys Lys Thr Met Glu Glu Lys Ile Gln Thr Ser Gly Ser Ser Tyr Leu Ssr Leu Glu Val Leu Ile Ala Asp Leu Val Ser Ala Gln Lys Asp Asn Thr Glu Asp Glu Ser Ser Gln Thr Ser Leu Gln Lys Asp Ile Ser Thr Glu Glu Gln Leu Arg Arg Leu Gln Glu Glu Lys Leu Ser Lys Ile Cys Met Asp Arg Asn Ile Ala Ile Val Phe Phe Pro Cys Gly His Leu Ala Thr Cys Lys Gln Cys Ala Glu Ala Val Asp Lys Cys Pro Met Cys Tyr Thr Val Ile Thr Phe Asn Gln Lya Its Phe Met Ser _ 81 _ (2) INFORMATION FOR SEQ ID NO:11:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 67 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: not relevant (D) TOPOLOGY: both (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:11:
Lys Ala Ala Arg Leu Gly Thr Tyr Thr Asn Trp Pro Val Gln Phe Leu Glu Pro Ser Arg Met Ala Ala Ser Gly Phe Tyr Tyr Leu Gly Arg Gly Aep Glu Val Arg Cys Ala Phe Cys Lys Val Glu Ile Thr Asn Trp Val Arg Gly Asp Asp Pro Glu Thr Asp His Lys Arg Trp Ala Pro Gln Cys Pro Phe Val (2) INFORMATION FOR SEQ ID N0:12:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 275 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: not relevant (D) TOPOLOGY: both (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID N0:12:
Met Ser Asp Leu Arg Leu Glu Glu Val Arg Leu Asn Thr Phe Glu Lys Trp Pro Val Ser Phe Leu Ser Pro Glu Thr Met Ala Lys Asn Gly Phe Tyr Tyr Leu Gly Arg Ser Asp Glu Val Arg Cys Ala Phe Cya Lys Val Glu Ile Met Arg Trp Lys Glu Gly Glu Asp Pro Ala Ala Asp His Lys Lys Trp Ala Pro Gln Cys Pro Phe Val Lys Gly Ile Asp Val Cys Gly Ser Ile Val Thr Thr Asn Asn Ile Gln Asn Thr Thr Thr His Asp Thr _ 8z _ Ile Ile Gly Pro Ala His Pro Lys Tyr Ala His Glu Ala Ala Arg Val Lys Ser Phe His Asn Trp Pro Arg Cys Met Lys Gln Arg Pro Glu Gln Met Ala Asp Ala Gly Phe Phe Tyr Thr Gly Tyr Gly Asp Asn Thr Lys ' Cys Phe Tyr Cys Asp Gly Gly Leu Lys Asp Trp Glu Pro Glu Asp Val Pro Trp Glu Gln His Val Arg Trp Phe Asp Arg Cys Ala Tyr Val Gln Leu Val Lys Gly Arg Asp Tyr Val Gln Lys Val Ile Thr Glu Ala Cys Val Leu Pro Gly Glu Asn Thr Thr Val Ser Thr Ala Ala Pro Val Ser Glu Pro Ile Pro Glu Thr Lys Ile Glu Lys Glu Pro Gln Val Glu Asp Ser Lys Leu Cys Lys Ile Cys Tyr Val Glu Glu Cys Ile Val Cys Phe Val Pro Cys Gly His Val Val Ala Cys Ala Lys Cys Ala Leu Ser Val Asp Lys Cys Pro Met Cys Arg Lys Ile Val Thr Ser Val Leu Lys Val Tyr Phe Ser (2) INFORMATION FOR SEQ ID N0:13:
(i) SEQUENGE CHARACTERISTICS:
(A) LENGTH: 498 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: not relevant (D) TOPOLOGY: both (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID N0:13:
Met Thr Glu Leu Gly Met Glu Leu Glu Ser Val Arg Leu Ala Thr Phe Gly Glu Trp Pro Leu Asn Ala Pro Val Ser Ala Glu Asp Leu Val Ala Asn Gly Phe Phe Ala Thr Gly Lys Trp Leu Glu Ala Glu Cys His Phe Cys His Val Arg Ile Asp Arg Trp Glu Tyr Gly Asp Gln Val Ala Glu d Arg His Arg Arg Ser Ser Pro Ile Cys Ser Met Val Leu Ala Pro Asn His Cys Gly Asn Val Pro Arg Ser Gln Glu Ser Asp Asn Glu Gly Asn ' Ser Val Val Asp Ser Pro Glu Ser Cys Ser Cys Pro Asp Leu Leu Leu Glu Ala Asn Arg Leu Val Thr Phe Lys Asp Trp Pro Asn Pro Asn Ile Thr Pro Gln Ala Leu Ala Lys Ala Gly Phe Tyr Tyr Leu Asn Arg Leu Asp His Val Lys Cys Val Trp Cys Asn Gly Val Ile Ala Lys Trp Glu Lys Asn Asp Asn Ala Phe Glu Glu His Lys Arg Phe Phe Pro Gln Cys Pro Arg Val Gln Met Gly Pro Leu Ile Glu Phe Ala Thr Gly Lys Asn Leu Asp Glu Leu Gly Ile Gln Pro Thr Thr Leu Pro Leu Arg Pro Lys Tyr Ala Cys Val Asp Ala Arg Leu Arg Thr Phe Thr Asp Trp Pro Ile Ser Asn Ile Gln Pro Ala Ser Ala Leu Ala Gln Ala Gly Leu Tyr Tyr Gln Lys Ile Gly Asp Gln Val Arg Cys Phe His Cys Asn Ile Gly Leu Arg Ser Trp Gln Lys Glu Asp Glu Pro Trp Phe Glu His Ala Lys Trp Ser Pro Lys Cys Gln Phe Val Leu Leu Ala Lys Gly Pro Ala Tyr Val Ser Glu Val Leu Ala Thr Thr Ala Ala Asn Ala Ser Ser Gln Pro Ala Thr Ala Pro Ala Pro Thr Leu Gln Ala Asp Val Leu Met Asp Glu Ala Pro Ala Lys Glu Ala Leu Thr Leu Gly Ile Asp Gly Gly Val Val Arg Asn Ala Ile Gln Arg Lys Leu Leu Ser Ser Gly Cys Ala Phe Ser Thr Leu Asp Glu Leu Leu His Asp Ile Phe Asp Asp Ala Gly Ala Gly Ala Ala Leu Glu Val Arg Glu Pro Pro Glu Pro Ser Ala Pro Phe Ile Glu Pro Cys Gln Ala Thr Thr Ser Lys Ala Ala Ser Val Pro Ile Pro Val WO 97/06255 PCT/aB96/01022 g4 _ Ala Asp Ser Ile Pro Ala Lys Pro Gln Ala Ala Glu Ala Val Ser Asn Ile Ser Lys Ile Thr Asp Glu Ile Gln Lys Met Ser Val Ser Thr Pro Asn Gly Asn Leu Ser Leu Glu Glu Glu Asn Arg Gln Leu Lys Asp Ala Arg Leu Cys Lys Val Cys Leu Asp Glu Glu Val Gly Val Val Phe Leu ' Pro Cys Gly His Leu Ala Thr Cys Asn Gln Cys Ala Pro Ser Val Ala Asn Cys Pro Met Cys Arg Ala Asp Ile Lys Gly Phe Val Arg Thr Phe Leu Ser (2) INFORMATION FOR SEQ ID N0:14:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 67 amino acids (B) TYPEz amino acid (C) STRANDEDNESS: not relevant (D) TOPOLOGY: both (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID N0:14:
Glu Glu Val Arg Leu Asn Thr Phe Glu Lys Trp Pro Val Ser Phe Leu Ser Pro Glu Thr Met Ala Lys Asn Gly Phe Tyr Tyr Leu Gly Arg Ser Asp Glu Val Arg Cys Ala Phe Cys Lys Val Glu Ile Met Arg Trp Lys Glu Gly Glu Asp Pro Ala Ala Asp His Lys Lys Trp Ala Pro Gln Cys Pro Phe Val (2) INFORMATION FOR SEQ ID N0:15:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 67 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: not relevant (D) TOPOLOGY: both (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID
N0:15:

Glu Ala Asn Arg Leu Val Thr Phe Trp Pro Asn Asn Lys Asp Pro Ile ' Thr Pro Gln Ala Leu Ala Lys Ala Tyr Tyr Leu Arg Gly Phe Asn Leu Asp His Val Lya Cys Val Trp Cys Val Ile Ala Trp Asn Gly Lys Glu Lys Asn Asp Asn Ala Phe Glu Glu Arg Phe Phe Gln His Lys Pro Cys Pro Arg Val (2) INFORMATION
FOR SEQ ID N0:16:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 68 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: not relevant (D) TOPOLOGY: both (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID
N0:16:

Glu Phe Asn Arg Leu Lys Thr Phe Phe Pro Ser Ser Ala Asn Ser Pro Val Ser Ala Ser Thr Leu Ala Arg Phe Leu Tyr Gly Ala Gly Thr Glu Gly Asp Thr Val Gln Cys Phe Ser Ala Ala Ile Arg Cys His Asp Trp Gln Tyr Gly Asp Ser Ala Val Gly Arg Arg Ile Pro Arg His Ser Asn Cys Arg Phe Ile (2) INFORMATION
FOR SEQ ID N0:17:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 68 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: not relevant (D) TOPOLOGY: both (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID N0:17:

_ 86 _ Glu Phe Aen Arg Leu Lys Thr Phe Ala Asn Phe Pro Ser Gly Ser Pro Val Ser Ala Ser Thr Leu Ala Arg Ala Gly Phe Leu Tyr Thr Gly Glu Gly Asp Thr Val Arg Cys Phe Ser Cys His Ala Ala Val Asp Arg Trp Gln Tyr Gly Asp Ser Ala Val Gly Arg His Arg Lys Val Ser Pro Asn Cys Arg Phe Ile (2) INFORMATION FOR SEQ ID N0:18:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 68 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: not relevant (D) TOPOLOGY: both (ii) MOLECULE TYPE: protein (xi)SEQUENCE DESCRIPTION:
SEQ ID N0:18:

GluLeu Tyr Arg Ser Thr Tyr Ser Pro AlaGly Val Met Thr Phe Pro ValSer Glu Arg Leu Ala Arg Ala Tyr TyrThr Gly Ser Gly Phe Val AsnAsp Lys Val Cys Phe Cys Cys Met LeuAsp Asn Lys Gly Leu Trp LysArg Gly Asp Pro Thr Glu Lys Lys LeuTyr Pro Ser His Lys Ser CysArg Phe Val (2) INFORMATION FOR SEQ ID N0:19:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 68 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: not relevant (D) TOPOLOGY: both (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID N0:19:
v Glu Leu Tyr Arg Met Ser Thr Tyr Ser Thr Phe Pro Ala Gly Val Pro Val Ser Glu Arg Ser Leu Ala Arg Ala Gly Phe Tyr Tyr Thr Gly Val Asn Asp Lys Val Lys Cys Phe Cys Cys Gly Leu Met Leu Asp Asn Trp H
' Lys Leu Gly Asp Ser Pro Ile Gln Lys His Lys Gln Leu Tyr Pro Ser ' Cys Ser Phe Ile (2) INFORMATION FOR SEQ ID N0:20:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 68 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: not relevant (D) TOPOLOGY: both (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID N0:20:
Glu Glu Ala Arg Leu Lys Ser Phe Gln Asn Trp Pro Asp Tyr Ala His Leu Thr Pro Arg Glu Leu Ala Ser Ala Gly Leu Tyr Tyr Thr Gly Ala Asp Asp Gln Val Gln Cys Phe Cys Cys Gly Gly Lys Leu Lys Asn Trp Glu Pro Cys Asp Arg Ala Trp Ser Glu His Arg Arg His Phe Pro Asn Cys Phe Phe Val (2) INFORMATION FOR SEQ ID N0:21:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 68 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: not relevant (D) TOPOLOGY: both (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID N0:21:
Glu Glu Ala Rrg Leu Lys Ser Phe Gln Asn Trp Pro Asp Tyr Ala His Y
Leu Thr Pro Arg Glu Leu Ala Ser Ala Gly Leu Tyr Tyr Thr Gly Ile Gly Asp Gln Val Gln Cys Phe Cys Cys Gly Gly Lys Leu Lys Asn Trp Glu Pro Cys Asp Arg Ala Trp Ser Glu His Arg Arg His Phe Pro Asn Cys Phe Phe Val ' (2),INFORMATION FOR SEQ ID N0:22: ' (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 67 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: not relevant (D) TOPOLOGY: both (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID N0:22:
Glu Asn Ala Arg Leu Leu Thr Phe Gln Thr Trp Pro Leu Thr Phe Leu Ser Pro Thr Asp Leu Ala Arg Ala Gly Phe Tyr Tyr Ile Gly Pro Gly Asp Arg Val Ala Cys Phe Ala Cys Gly Gly Lys Leu Ser Asn Trp Glu Pro Lys Asp Asn Ala Met Ser Glu His Leu Arg His Phe Pro Lys Cys Pro Phe Ile (2) INFORMATION FOR SEQ ID N0:23:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 67 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: not relevant (D) TOPOLOGY: both (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID N0:23:
Glu Glu Ala Arg Phe Leu Thr Tyr His Met Trp Pro Leu Thr Phe Leu Ser Pro Ser Glu Leu Ala Arg Ala Gly Phe Tyr Tyr Ile Gly Pro Gly _v Asp Arg Val Ala Cye Phe Ala Cys Gly Gly Lys Leu Ser Asn Trp Glu Pro Lys Asp Asp Ala Met Ser Glu His Arg Arg His Phe Pro Asn Cys Pro Phe Leu (2) INFORMATION FOR SEQ ID N0:24:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTHS 66 amino acids (B) TYPE: amino acid (C) STRANDEDNESSs not relevant (D) TOPOLOGY: both (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID N0:24:
Tyr Glu Ala Arg Ile Val Thr Phe Gly Thr Trp Ile Tyr Ser Val Asn Lys Glu Gln Leu Ala Arg Ala Gly Phe Tyr Ala Leu Gly Glu Gly Asp Lys Val Lys Cys Phe His Cys Gly Gly Gly Leu Thr Asp Trp Lys Pro Ser Glu Asp Pro Trp Asp Gln His Ala Lys Cys Tyr Pro Gly Cys Lys Tyr Leu (2) INFORMATION FOR SEQ ID N0:25:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 66 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: not relevant (D) TOPOLOGY: both (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID N0:25:
Tyr Glu Ala Arg Ile Phe Thr Phe Gly Thr Trp Ile Tyr Ser Val Asn Lys Glu Gln Leu Ala Arg Ala Gly Phe Tyr Ala Leu Gly Glu Gly Asp Lys Val Lys Cys Phe Hie Cys Gly Gly Gly Leu Thr Asp Trp Lys Pro Y
Ser Glu Asp Pro Trp Glu Gln His Ala Lys Trp Tyr Pro Gly Cys Lys Tyr Leu (2) INP"ORMATION P'OR SEQ ID N0:26:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 68 amino acids ' (Bj TYPE: amino acid (C) STRANDEDNESS: not relevant _ (D) TOPOLOGY: both (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID N0:26:
His Ala Ala Arg Phe Lys Thr Phe Phe Asn Trp Pro Ser Ser Val Leu Val Asn Pro Glu Gln Leu Ala Ser Ala Gly Phe Tyr Tyr Val Gly Asn Ser Asp Asp Val Lys Cys Phe Cys Cys Asp Gly Gly Leu Arg Cys Trp Glu Ser Gly Asp Asp Pro Trp Val Gln His Ala Lys Trp Phe Pro Arg Cys Glu Tyr Leu (2j INFORMATION FOR SEQ ID N0:27:
(ij SEQUENCE CHARACTERISTICS:
(Aj LENGTH: 68 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: not relevant (D) TOPOLOGY: both (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID N0:27:
His Ala Ala Arg Met Arg Thr Phe Met Tyr Trp Pro Ser Ser Val Pro Val Gln Pro Glu Gln Leu Ala Ser Ala Gly Phe Tyr Tyr Val Gly Arg Asn Asp Asp Val Lys Cys Phe Gly Cys Asp Gly Gly Leu Arg Cys Trp Glu Ser Gly Asp Asp Pro Trp Val Glu His Ala Lys Trp Phe Pro Arg r Cys Glu Phe Leu (2) INFORMATION FOR SEQ ID N0:28:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 68 amino acids (B) TYPES amino acid (C) STRANDEDNESS: not relevant (D) TOPOLOGY: both (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID N0:28:
Glu Ala Ala Arg Leu Arg Thr Phe Ala Glu Trp Pro Arg Gly Leu Lys Gln Arg Pro Glu Glu Leu Ala Glu Ala Gly Phe Phe Tyr Thr Gly Gln Gly Asp Lys Thr Arg Cys Phe Cys Cys Asp Gly Gly Leu Lys Asp Trp Glu Pro Asp Asp Ala Pro Trp Gln Gln His Ala Arg Trp Tyr Asp Arg Cys Glu Tyr Val (2) INFORMATION FOR SEQ ID N0:29:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 68 amino acids (8) TYPE: amino acid (C) STRANDEDNESS: not relevant (D) TOPOLOGY: both (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID N0:29:
Glu Ala Ala Arg Val Lys Ser Phe His Asn Trp Pro Arg Cys Met Lys Gln Arg Pro Glu Gln Met Ala Asp Ala Gly Phe Phe Tyr Thr Gly Tyr Gly Asp Asn Thr Lys Cys Phe Tyr Cys Asp Gly Gly Leu Lys Asp Trp Glu Pro Glu Asp Val Pro Trp Glu Gln His Val Arg Trp Phe Asp Arg Cys Ala Tyr Val (2) INFORMATION FOR SEQ ID N0:30:
t (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 68 amino acids (B) TYPE: amino acid -(C) STRANDEDNESS: not relevant (D) TOPOLOGY: both (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID N0:30s Val Asp Ala Arg Leu Arg Thr Phe Thr Asp Trp Pro Ile Ser Asn Ile Gln Pro Ala Ser Ala Leu Ala Gln Ala Gly Leu Tyr Tyr Gln Lys Ile Gly Asp Gln Val Arg Cys Phe His Cys Asn Ile Gly Leu Arg Ser Trp Gln Lys Glu Asp Glu Pro Trp Phe Glu His Ala Lys Trp Ser Pro Lys Cys Gln Phe Val (2) INFORMATION FOR SEQ ID N0:31:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 66 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: not relevant (D) TOPOLOGY: both (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID N0:31:
Glu Ser Val Arg Leu Ala Thr Phe Gly Glu Trp Pro Leu Asn Ala Pro Val Ser Ala Glu Asp Leu Val Ala Asn Gly Phe Phe Gly Thr Trp Met Glu Ala Glu Cys Asp Phe Cys His Val Arg Ile Asp Arg Trp Glu Tyr Gly Asp Leu Val Ala Glu Arg His Arg Arg Ser Ser Pro Ile Cye Ser Met Val (2) INFORMATION FOR SEQ ID N0:32:
(i) SEQUENCE CHARACTERISTICS: =
(A) LENGTH: 46 amino acids (B) TYPES amino acid (C) STRANDEDNESS: not relevant (D) TOPOLOGY: both (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID N0:32:
Glu Gln Leu Arg Arg Leu Gln Glu Glu Arg Thr Cys Lys Val Cys Met Asp Lys Glu Val Ser Val Val Phe Ile Pro Cys Gly His Leu Val Val Cys Gln Glu Cys Ala Pro Ser Leu Arg Lys Cys Pro Ile Cys (2) INFORMATION FOR SEQ ID N0:33:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 46 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: not relevant (D) TOPOLOGY: both (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID N0:33:
Glu Gln Leu Arg Arg Leu Pro Glu Glu Arg Thr Cys Lys Val Cys Met Asp Lye Glu Val Ser Ile Val Phe Ile Pro Cys Gly His Leu Val Val Cys Lys Asp Cys Ala Pro Ser Leu Arg Lys Cys Pro Ile Cys (2) INFORMATION FOR SEQ ID N0:34:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 46 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: not relevant (D) TOPOLOGY: both (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID N0:34:
Glu Gln Leu Arg Arg Leu Gln Glu Glu Lys Leu Ser Lys Ile Cys Met a Asp Arg Asn Ile Ala Ile Val Phe Phe Pro Cys Gly His Leu Ala Thr 2p 25 30 Cys Lys Gln Cys Ala Glu Ala Val Asp Lys Cys Pro Met Cys (2) INFORMATION FOR SEQ ID N0:35:
(i) SEQUENCE CHARACTERISTICS: -(A) LENGTH: 46 amino acids "
(B) TYPE: amino acid (C) STRANDEDNESS: not relevant (D) TOPOLOGY: both ' i t t v vr~r s.~rTr t. r~rac.. ....,.a..:
~11~ C~VJ.I~InVLJ'r iirfal ~ILVW Cil1 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:35:
Glu Gln Leu Arg Arg Leu Gln Glu Glu Lys Leu Cys Lys Ile Cys Met Asp Arg Asn Ile Ala Ile Val Phe Val Pro Cys Gly His Leu Val Thr Cys Lys Gln Cys Ala Glu Ala Val Asp Lys Cys Pro Met Cys (2) INFORMATION FOR SEQ ID N0:36:
(f) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 46 amino acids (B) TYPE: amino acid (C) STRAP1DEDNESS: not relevant (D) TOPOLOGY: both (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ZD N0:36:
Glu Glu Asn Arg Gln Leu Lys Asp Ala Arg Leu Cys Lys Val Cys Leu Asp Glu Glu Val Gly Val Val Phe Leu Pro Cys Gly His Leu Ala Thr Cys Asn Gln Cys Ala Pro Ser Val Ala Asn Cys Pro Met Cys (2) INFORMATION FOR SEQ ID N0:37:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 46 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: not relevant (D) TOPOLOGY: both (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID N0:37:
Glu Lys Glu Pro Gln Val Glu Asp Ser Lys Leu Cys Lys Ile Cys Tyr Val Glu Glu Cys Ile Val Cys Phe Val Pro Cys Gly His Val Val Ala Cys Ala Lys Cys Ala Leu Ser Val Asp Lys Cys Pro Met Cys (2) INFORMATION FOR SEQ ID N0:38:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 46 amino acids (B) TYPES amino acid (C) STRANDEDNESS: not relevant (D) TOPOLOGY: both (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID N0:38:
Ala Val Glu Ala Glu Val Ala Asp Asp Arg Leu Cys Lys Ile Cys Leu Gly Ala Glu Lys Thr Val Cys Phe Val Pro Cys Gly His Val Val Ala Cys Gly Lys Cys Ala Ala Gly Val Thr Thr Cys Pro Val Cys (2) INFORMATION FOR SEQ ID N0:39:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 2474 base pairs (8) TYP$s nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID N0:39:

CAACAGTCTG

TTTGAGCTTT

CTCAGACCCT

CCACTTTGCA

TTTTCTGTCA

AGTGGCCTGC

GTCAGAGCAC

TTCGAGATAC

CTCTAACTGG

TTATACAGGA

GGAATCTGGA

GCTCAGAATC

TGAGCAGCTA

GCATTTTGGC

AGCAGCCTTG

CCTGGCCACT

AGAAGACGAG

ATGAGAGAGG AGCAGATGGA GCAGGCGGCC GAGGAGGAGG AGTCAGATGA 1500 , TCTAGCACTA

AATGCTGTAT

ACAGAAACCA

CACTGCAGCA

TATATTTGTG

GGAAGAACAG

TTGCGGCCCC TCCCGGAGGA CAGAATGTGT AAAGTGTGTA TGGACCGAGA 1860 .
GGTATCCATC

TCTGAGGAAG

CTGAACAAGA

CCAGTTCCAT

ATATAAACAT

GAAAAACTTT TGTCTGAAGT CAAGAATGAA TGAATTACTT ATATAATAAT 2160 "
TTTAATTGGT

CATATTTACA

GAGAGGGTTT

CAACGGGCAG

(2) INFORMATION FOR SEQ ID N0:40:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTHS 602 amino acids (8) TYPES amino acid (C) STRAP1DEDNESS: not relevant (D) TOPOLOGY: linear (ii) MOLECULE TYPES protein (xi) SEQUENCE DESCRIPTION: SEQ ID N0:40:
Met Asn Met Val Gln Aap Ser Ala Phe Leu Ala Lys Leu Met Lys Ser Ala Asp Thr Phe Glu Leu Lys Tyr Asp Phe Ser Cys Glu Leu Tyr Arg Leu Ser Thr Tyr Ser Ala Phe Pro Arg Gly Val Pro Val Ser Glu Arg Ser Leu Ala Arg Ala Gly Phe Tyr Tyr Thr Gly Ala Asn Asp Lys Val Lys Cys Phe Cys Cys Gly Leu Met Leu Asp Asn Trp Lys Gln Gly Asp Ser Pro Met Glu Lys His Arg Lys Leu Tyr Pro Ser Cys Asn Phe Val Gln Thr Leu Asn Pro Ala Asn Ser Leu Glu Ala Ser Pro Arg Pro Ser Leu Pro Ser Thr Ala Met Ser Thr Met Pro Leu Ser Phe Ala Ser Ser Glu Asn Thr Gly Tyr Phe Ser Gly Ser Tyr Ser Ser Phe Pro Ser Asp Pro Val Asn Phe Arg Ala Asn Gln Asp Cys Pro Ala Leu Ser Thr Ser Pro Tyr His Phe Ala Met Asn Thr Glu Lys Ala Arg Leu Leu Thr Tyr Glu Thr Trp Pro Leu Ser Phe Leu Ser Pro Ala Lys Leu Ala Lys Ala Gly Phe Tyr Tyr Ile Gly Pro Gly Asp Arg Val Ala Cys Pha Ala Cys Asp Gly Lys Leu Ser Asn Trp Glu Arg Lys Asp Asp Ala Met Ser Glu His Gln Arg His Phe Pro Ser Cys Pro Phe Leu Lys Asp Leu Gly Gln Ser Ala Ser Arg Tyr Thr Val Ser Asn Leu Ser Met Gln Thr His Ala Ala Arg Ile Arg Thr Phe Ser Asn Trp Pro Ser Ser Ala Leu Val His Ser Gln Glu Leu Ala Ser Ala Gly Phe Tyr Tyr Thr Gly His Ser Asp Asp Val Lys Cys Leu Cys Cys Asp Gly Gly Leu Arg Cys Trp Glu Ser Gly Asp Asp Pro Trp Val Glu His Ala Lye Trp Phe Pro Arg Cys Glu Tyr Leu Leu Arg Ile Lys Gly Gln Glu Phe Val Ser Gln Val Gln Ala Gly Tyr Pro His Leu Leu Glu Gln Leu Leu Ser Thr Ser Asp Ser Pro Glu Asp Glu Asn Ala Asp Ala Ala Ile Val His Phe Gly Pro Gly Glu Ser Ser Glu Asp Val Val Met Met Ser Thr Pro Val Val Lys Ala Ala Leu Glu Met Gly Phe Ser Arg Ser Leu Val Arg Gln Thr Val Gln Trp Gln Ile Leu Ala Thr Gly Glu Asn Tyr Arg Thr Val Ser Asp Leu Val Ile Gly Leu Leu Asp Ala Glu Asp Glu Met Arg Glu Glu Gln Met Glu Gln Ala Ala Glu Glu Glu Glu Ser Asp Asp Leu Ala Leu Ile Arg Lys Asn Lys Met Val Leu Phe Gln His Leu Thr Cys Val Thr Pro Met Leu Tyr Cys Leu Leu Ser Ala Arg Ala Ile Thr Glu Gln Glu Cys Asn Ala Val Lys Gln Lys Pro His Thr Leu Gln Ala Ser Thr Leu Ile Asp Thr Val Leu Ala Lys Gly Asn Thr Ala Ala Thr Ser Phe Arg Asn Ser Leu Arg Glu Ile Asp Pro Ala Leu Tyr Arg Asp Ile Phe Val Gln Gln Asp Ile Arg Ser Leu Pro Thr Asp Asp Ile Ala Ala Leu Pro Met Glu Glu Gln Leu Arg Pro Leu Pro Glu Asp Arg Met Cys Lys Val Cys Met Asp _ gg Arg Glu Val Ser Ile Val Phe Ile Pro Cys Gly Hia Leu Val Val Cys Lys Asp Cys Ala Pro Ser Leu Arg Lys Cys Pro Ile Cys Arg Gly Thr '' Ile Lys Gly Thr Val Arg Thr Phe Leu Ser (2),INFORMATION FOR SEQ ID N0:41:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 2416 base pairs (8) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ
ID N0:41:

.

Y

GATGAGCACG

ACAGACGGTT

TGTCTCAGTA

GAGAAGAGAA GAGGAGAAGG AAAGACAGAC GCATCAGGTG ACTTATCACT1440 ' TGAAGAGATG

ACAGTTGACA

ACAGGAACAT

TGACACCGTT

AATTGACTCC

AGAAGACGTT

TTGCAAAGTG

AGTCTGCCAG

GGGGACTGTG

CAGAAGCTGT

TCTCTTTCAA

CTGTTGCAAG

GTTGGGATGC

TTTGGAATCC

GATAGGGTAC

GCTGGTAAAA

TCAGTGTAGT

(2) INFORMATION FOR SEQ ID N0:42:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 591 amino acids (8) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID N0:42:
Met Glu Lys Ser Thr Ile Leu Se-- Asn Trp Thr Lys Glu Ser Glu Glu Lys Met Lys Phe Asp Phe Ser Cys Glu Leu Tyr Arg Met Ser Thr Tyr - ~o~ -Ser Ala Phe Pro Arg Gly Val Pro Val Ser Glu Arg Ser Leu Ala Arg Ala Gly Phe Tyr Tyr Thr Gly Val Asn Asp Lys Val Lys Cys Phe Cys Cys Gly Leu Met Leu Asp Asn Trp Lys Gln Gly Asp Ser Pro Val Glu Lye His Arg Gln phe Tyr Pro Ser Cys Ser Phe Val Gln Thr Leu Leu z Ser Ala Ser Leu Gln Ser Pro Ser Lys Asn Met Ser Pro Val Lys Ser Arg Phe Ala His Ser Ser Pro Leu Glu Arg Gly Gly Ile His Ser Asn Leu Cys Ser Ser Pro Leu Asn Ser Arg Ala Val Glu Asp Phe Ser Ser Arg Met Asp Pro Cys Ser Tyr Ala Met Ser Thr Glu Glu Ala Arg Phe Leu Thr Tyr Ser Met Trp Pro Leu Ser Phe Leu Ser Pro Ala Glu Leu Ala Arg Ala Gly Phe Tyr Tyr Ile Gly Pro Gly Asp Arg Val Ala Cys Phe Ala Cys Gly Gly Lye Leu Ser Asn Trp Glu Pro Lys Asp Tyr Ala Met Ser Glu His Arg Arg His Phe Pro His Cys Pro Phe Leu Glu Asn Thr Ser Glu Thr Gln Arg Phe Ser Ile Ser Asn Leu Ser Met Gln Thr His Ser Ala Arg Leu Arg Thr Phe Leu Tyr Trp Pro Pro Ser Val Pro Val Gln Pro Glu Gln Leu Ala Ser Ala Gly Phe Tyr Tyr Val Asp Arg Asn Asp Asp Val Lys Cys Leu Cys Cys Asp Gly Gly Leu Arg Cys Trp Glu Pro Gly Asp Asp Pro Trp Ile Glu His Ala Lys Trp Phe Pro Arg Cys Glu Phe Leu Ile Arg Met Lys Gly Gln Glu Phe Val Asp Glu Ile Gln Ala Arg Tyr Pro His Leu Leu Glu Gln Leu Leu Ser Thr Ser Asp Thr Pro Gly Glu Glu Asn Ala Asp Pro Thr Glu Thr Val Val His Phe Gly Pro Gly Glu Ser Ser Lys Asp Val Val Met Met Ser Thr Pro Val - tot -Val Lye Ala Ala Leu Glu Met Gly Phe Ser Arg Ser Leu Val Arg Gln Thr Val Gln Arg Gln Ile Leu Ala Thr Gly Glu Asn Tyr Arg Thr Val Asn Asp Ile Val Ser Val Leu Leu Asn Ala Glu Asp Glu Arg Arg Glu ' Glu Glu Lys Glu Arg Gln Thr Glu Glu Met Ala Ser Gly Asp Leu Ser Leu Ile Arg Lys Asn Arg Met Ala Leu Phe Gln Gln Leu Thr His Val Leu Pro Ile Leu Asp Asn Leu Leu Glu Ala Ser Val Ile Thr Lys Gln Glu His Asp Ile Ile Arg Gln Lys Thr Gln Ile Pro Leu Gln Ala Arg Glu Leu Ile Asp Thr Val Leu Val Lys Gly Asn Ala Ala Ala Asn Ile Phe Lys Asn Ser Leu Lys Gly Ile Asp Ser Thr Leu Tyr Glu Asn Leu Phe Val Glu Lys Asn Met Lys Tyr Ile Pro Thr Glu Asp Val Ser Gly Leu Ser Leu Glu Glu Gln Leu Arg Arg Leu Gln Glu Glu Arg Thr Cys Lys Val Cys Met Asp Arg Glu Val Ser Ile Val Phe Ile Pro Cys Gly His Leu Val Val Cys Gln Glu Cys Ala Pro Ser Leu Arg Lys Cys Pro Ile Cys Arg Gly Thr Ile Lys Gly Thr Val Arg Thr Phe Leu Ser (2) INFORMATION FOR SEQ ID N0:43:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1i amino acids (B) TYPE: amino acid (C) STRANDEDNESS: not relevant (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID N0:43: -Met Glu Gln Lys Leu Ile Ser Glu Glu Asp Leu (2) INFORMATION FOR SEQ ID N0:44:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 21 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID N0:44:

(2) INFORMATION FOR SEQ ID N0:45:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 25 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID N0:45:

Claims (56)

CLAIMS:
1. A substantially pure nucleic acid encoding a mammalian IAP polypeptide.
2. The nucleic acid of claim 1, wherein said polypeptide comprises a ring zinc finger domain and at least one BIR
domain.
3. The nucleic acid of claim 2, wherein said polypeptide has at least two BIR domains.
4. The nucleic acid of claim 3, wherein said polypeptide has at least three BIR domains.
5. The nucleic arid of claim 1, wherein said polypeptide comprises at least one BIR domain but lacks a ring zinc finger domain.
6. The nucleic acid of claim 5, wherein said polypeptide has at least two BIR domains.
7. The nucleic arid of claim 6, wherein said polypeptide has at least three BIR domains.
8. The nucleic acid of claim 1, wherein said polypeptide comprises a ring zinc finger domain but lacks a BIR domain.
9. The nucleic acid of claim 1, wherein said mammal is a human.
10. The nucleic acid of claim 1, wherein said polypeptide is human X-linked IAP-1 (XIAP-1, SEQ ID NO: 4), human HIAP-1 (SEQ ID NO: 6), human HIAP-2 (SEQ ID NO: 8), murine XIAP-1 (SEQ
ID NO: 10), murine HIAP-1 (SEQ ID NO: 40), or murine HIAP-2 (SEQ ID NO: 42).
11. A substantially pure nucleic acid comprising the sequence of Fig. 1, or degenerate variants thereof, and encoding the amino acid sequence of Fig. 1, the sequence of Fig. 2, or degenerate variants thereof, and encoding the amino acid sequence of Fig. 2, the sequence of Fig. 3, or degenerate variants thereof, and encoding the amino acid sequence of Fig. 3, or the sequence of Fig. 4, or degenerate variants thereof, and encoding the amino acid sequence of Fig. 4.
12. A substantially pure nucleic acid having about 50%
or greater nucleotide sequence identity to the DNA sequence of Fig. 1, Fig. 2, Fig. 3, or Fig. 4.
13. The nucleic acid of claim 1, wherein said nucleic acid is operably linked to regulatory sequences for expression of said polypeptide and wherein said regulatory sequences comprise a promoter.
14. The nucleic acid of claim 13, wherein said promoter is a constitutive promoter, is inducible by one or more external agents, or is cell-type specific.
15. A vector comprising the nucleic acid of claim 1, said vector being capable of directing expression of the peptide encoded by said nucleic arid in a vector-containing cell.
16. A transgenic cell that contains the nucleic acid of claim 1, wherein said nucleic acid is expressed in said transgenic cell.
17. A substantially pure mammalian IAP polypeptide, or fragment thereof capable of modulating apoptosis.
18. The polypeptide of claim 17, wherein said polypeptide is human X-linked IAP-1 (XIAP-1, SEQ ID NO: 4), human HIAP-1 (SEQ ID NO: 6), human HIAP-2 (SEQ ID NO: 8), murine XIAP-1 (SEQ ID NO: 10), murine HIAP-1 (SEQ ID NO:
40), or murine HIAP-2 (SEQ ID NO: 42).
19. The polypeptide of claim 17, wherein said polypeptide is a human polypeptide.
20. A therapeutic composition comprising, as an active ingredient, human X-linked IAP-1 (XIAP-1, SEQ ID NO: 4), human HIAP-1 (SEQ ID NO: 6), human HIAP-2 (SEQ ID NO: 8), murine XIAP-1 (SEQ ID NO: 10), murine HIAP-1 (SEQ ID NO:
40), or murine HIAP-2 (SEQ ID NO: 42).
21. Use of a recombinant mammalian IAP polypeptide for inhibiting apoptosis in a cell.
22. Use of a mammalian IAP polypeptide for the manufacture of a medicament for inhibiting apoptosis in a cell.
23. The use of claim 21 or 22, wherein said polypeptide is human X-linked IAP-1 (XTAP-1, SEQ ID NO: 4), human HIAP-1 (SEQ ID NO: 6), human HIAP-2 (SEQ ID NO: 8), murine XIAP-1 (SEQ ID NO: 10), murine HIAP-1 (SEQ ID NO:
40), or murine HIAP-2 (SEQ ID NO: 42).
24. The use of claim 21 or 22, wherein said cell is in a mammal.
25. The use of claim 24, wherein said mammal is a human.
26. The use of claim 25, wherein said human has been diagnosed as being HIV-positive, or as having AIDS, a neurodegenerative disease, a myelodysplastic syndrome, or an ischemic injury.
27. The use of claim 26, wherein said ischemic injury is caused by a myocardial infarction, a stroke, a reperfusion injury, or a toxin-induced liver disease.
28. Use of a recombinant nucleic acid encoding a mammalian IAP polypeptide for inhibiting apoptosis in a cell.
29. Use of a nucleic acid encoding a mammalian IAP
polypeptide for the manufacture of a medicament for inhibiting apoptosis in a cell.
30. The use of claim 28 or 29, wherein said polypeptide is human X-linked IAP-1 (XIAP-1, SEQ ID NO: 4), human HIAP-1 (SEQ ID NO: 6), human HIAP-2 (SEQ ID NO: 8), murine XIAP-1 (SEQ ID NO: 10), murine HIAP-1 (SEQ ID NO:
40), or murine HIAP-2 (SEQ ID NO: 42).
31. The use of claim 28 or 29, wherein said cell is in a mammal.
32. The use of claim 31, wherein said mammal is a human.
33. The use of claim 32, wherein said human has been diagnosed as being HIV-positive, or as having AIDS, a neurodegenerative disease, a myelodysplastic syndrome, or an ischemic injury.
34. The use of claim 33, wherein said ischemic injury is caused by a myocardial infarction, a stroke, a reperfusion injury, or a toxin-induced liver disease.
35. A method of detecting an IAP gene in an animal cell, said method comprising the step of contacting the nucleic acid of claim 2, or a portion thereof that is greater than about 18 nucleotides in length, with a preparation of genomic DNA from said animal cell, said method providing detection of DNA sequences having about 50%
or greater nucleotide sequence identity with the sequence of Fig. 1, Fig. 2, Fig. 3, or Fig. 4.
36. A method of obtaining a mammalian IAP polypeptide, said method comprising:
(a) providing a cell with nucleic acid encoding an IAP polypeptide, said nucleic acid being positioned for expression in said cell;
(b) culturing said cell under conditions for expressing said nucleic acid; and (c) isolating said mammalian IAP polypeptide.
37. The method of claim 36, wherein said nucleic acid further comprises a promotor inducible by one or more external agents.
38. The method of claim 36 wherein said IAP
polypeptide is human X-linked IAP-1 (XIAP-1, SEQ ID NO: 4), human HIAP-1 (SEQ ID NO: 6), human HIAP-2 (SEQ ID NO: 8), murine XIAP-1 (SEQ ID NO: 10), murine HIAP-1 (SEQ ID NO:
40), or murine HIAP-2 (SEQ ID NO: 42).
39. A substantially pure polypeptide comprising a ring zinc finger domain having the sequence: Glu-Xaa1-Xaa1-Xaa1-Xaa1-Xaa1-Xaa1-Xaa2-Xaa1-Xaa1-Xaa1-Cys-Lys-Xaa3-Cys-Met-Xaa1-Xaa1-Xaa1-Xaa1-Xaa1-Xaa3-Xaa1-Phe-Xaa1-Pro-Cys-Gly-His-Xaa1-Xaa1-Xaa1-Cys-Xaa1-Xaa1-Cys-Ala-Xaa1-Xaa1-Xaa1-Xaa1-Xaa1-Cys-Pro-Xaa1-Cys, wherein Xaa1 is any amino acid, Xaa2 is Glu or Asp and Xaa3 is Val or Ile.
40. The polypeptide of claim 39, further comprising at least one BIR domain having a copy of the sequence: Xaa1-Xaa1-Xaa1-Arg-Leu-Xaa1-Thr-Phe-Xaa1-Xaa1-Trp-Pro-Xaa2-Xaa1-Xaa1-Xaa2-Xaa2-Xaa1-Xaa1-Xaa1-Xaa1-Leu-Ala-Xaa1-Ala-Gly-Phe-Tyr-Tyr-Xaa1-Gly-Xaa1-Xaa1-Asp-Xaa1--Val-Xaa1-Cys-Phe-Xaa1-Cys-Xaa1-Xaa1-Xaa1-Xaa1--Xaa1--Xaa1-Trp-Xaa1-Xaa1-Xaa1-Asp-Xaa1-Xaa1-Xaa1-Xaa1-Xaa1-His-Xaa1-Xaa1-Xaa1-Xaa1-Pro-Xaa1-Cys-Xaa1-Phe-Val, wherein Xaa1 may be any amino acid and Xaa2 may be any amino acid or may be absent.
41. The polypeptide of claim 40, said polypeptide comprising at least two of said BIR domains.
42. The polypeptide of claim 41, said polypeptide comprising at least three of said BIR domains.
43. A recombinant IAP nucleic acid encoding the polypeptide of claim 39.
44. A recombinant mammalian polypeptide capable of inhibiting apoptosis wherein said polypeptide comprises a ring zinc finger having the sequence Glu-Xaa1-Xaa1-Xaa1-Xaa1-Xaa1-Xaa1-Xaa2-Xaa1-Xaa1-Xaa1-Cys-Lys-Xaa3-Cys-Met-Xaa1-Xaa1-Xaa1-Xaa1-Xaa1-Xaa3-Xaa1-Phe-Xaa1-Pro-Cys-Gly-His-Xaa1-Xaa1-Xaa1-Cys-Xaa1-Xaa1-Cys-Ala-Xaa1-Xaa1-Xaa1-Xaa1-Xaa1-Cys-Pro-Xaa1-Cys, wherein Xaa1 is any amino acid, Xaa2 is Glu or Asp and Xaa3 is Val or Ile; and at least one BIR domain having the sequence Xaa1-Xaa1-Xaa1-Arg-Leu-Xaa1-Thr-Phe-Xaa1-Xaa1-Trp-Pro-Xaa2-Xaa1-Xaa1-Xaa2-Xaa2-Xaa1-Xaa:l~-Xaa:1-Xaa1-Leu-Ala-Xaa1-Ala-Gly-Phe-Tyr-Tyr-Xaa1-Gly-Xaa1-Xaa1-Asp-Xaa1-Val-Xaa1-Cys-Phe-Xaa1-Cys-Xaa1-Xaa1-Xaa1-Xaa1-Xaa1-Xaa1-Trp-Xaa1-Xaa1-Xaa1-Asp-Xaa1-Xaa1-Xaa1-Xaa1-Xaa1-His--Xaa1-Xaa1-Xaa1-Xaa1-Pro-Xaa1-Cys-Xaa1-Phe-Val, wherein Xaa1 may be any amino acid and Xaa2 is any amino acid or is absent.
45. A method of identifying a compound that modulates apoptosis, said method comprising:
(a) providing a cell expressing an IAP gene;
(b) contacting said cell with a candidate compound; and (c) monitoring the expression of said IAP gene, an alteration in the level of expression of said gene indicating the presence of a compound which modulates apoptosis.
46. The method of claim 45, wherein said IAP gene is human X-linked iap-1 (xiap-1, SEQ ID NO: 3), human hiap-1 (SEQ ID NO: 5), human hiap-2 (SEQ ID NO: 7), murine xiap-1 (SEQ ID NO: 9), murine hiap-1 (SEQ ID NO: 39), or murine hiap-2 (SEQ ID NO: 41).
47. The method of claim 45, wherein said cell is a lymphocyte, said IAP is selected from the group consisting of hiap-1 and hiap-2, and said modulating is an increase in hiap-1 or hiap-2 expression.
48. A method of diagnosing a mammal for the presence of an apoptosis disease or an increased likelihood of developing a disease involving apoptosis in a mammal, said method comprising isolating a sample of nucleic acid from said mammal and determining whether said nucleic acid comprises an IAP mutation, said mutation being an indication that said mammal has an apoptosis disease or an increased likelihood of developing a disease involving apoptosis.
49. A method of diagnosing a mammal for the presence of an apoptosis disease or an increased likelihood of developing an apoptosis disease, said method comprising measuring IAP gene expression in a sample from said mammal, an alteration in said expression relative to a sample from an unaffected mammal being an indication that said mammal has an apoptosis disease or increased likelihood of developing an apoptosis disease.
50. The method of claim 48 or 49, wherein said IAP
gene is human X-linked iap-1 (xiap-1, SEQ ID NO: 3), human hiap-1 (SEQ ID NO: 5), human hiap-2 (SEQ ID NO: 7), murine xiap-1 (SEQ ID NO: 9), murine hiap-1 (SEQ ID NO: 39), or murine hiap-2 (SEQ ID NO: 41).
51. The method of claim 48 or 49, wherein said gene expression is measured by assaying the amount of IAP
polypeptide in said sample.
52. The method of claim 51, wherein said IAP
polypeptide is measured by immunological methods or by assaying the amount of IAP RNA in said sample.
53. A kit for diagnosing a mammal for the presence of an apoptosis disease or an increased likelihood of developing an apoptosis disease, said kit comprising a substantially pure antibody that specifically binds an IAP
polypeptide.
54. The kit of claim 53, further comprising a means for detecting said binding of said antibody to said IAP
polypeptide.
55. A substantially pure mammalian IAP polypeptide, or fragment thereof that comprises the BIR domains, but not the RZF, or that comprises the RZF domain but not the BIR
domains.
56. A substantially pure mammalian IAP polypeptide, or fragment thereof that specifically binds an antisera directed to an IAP.
CA002228635A 1995-08-04 1996-08-05 Mammalian apoptosis inhibitor protein gene family, primers, probes and detection methods Expired - Fee Related CA2228635C (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CA002403947A CA2403947C (en) 1995-08-04 1996-08-05 Bir domains of mammalian iap gene family

Applications Claiming Priority (5)

Application Number Priority Date Filing Date Title
US08/511,485 1995-08-04
US08/511,485 US5919912A (en) 1995-08-04 1995-08-04 Mammalian IAP antibodies and diagnostic kits
US08/576,956 1995-12-22
US08/576,956 US6156535A (en) 1995-08-04 1995-12-22 Mammalian IAP gene family, primers, probes, and detection methods
PCT/IB1996/001022 WO1997006255A2 (en) 1995-08-04 1996-08-05 Mammalian apoptosis inhibitor protein gene family, primers, probes and detection methods

Related Child Applications (1)

Application Number Title Priority Date Filing Date
CA002403947A Division CA2403947C (en) 1995-08-04 1996-08-05 Bir domains of mammalian iap gene family

Publications (2)

Publication Number Publication Date
CA2228635A1 CA2228635A1 (en) 1997-02-20
CA2228635C true CA2228635C (en) 2002-11-26

Family

ID=27057240

Family Applications (1)

Application Number Title Priority Date Filing Date
CA002228635A Expired - Fee Related CA2228635C (en) 1995-08-04 1996-08-05 Mammalian apoptosis inhibitor protein gene family, primers, probes and detection methods

Country Status (8)

Country Link
US (17) US6156535A (en)
EP (2) EP1757689A3 (en)
JP (1) JP4458551B2 (en)
AT (1) ATE310819T1 (en)
CA (1) CA2228635C (en)
DE (1) DE69635482T2 (en)
ES (1) ES2253756T3 (en)
WO (1) WO1997006255A2 (en)

Families Citing this family (39)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030073159A1 (en) * 1992-05-11 2003-04-17 Human Genome Sciences, Inc. Human inhibitor of apoptosis gene 1
US5958771A (en) * 1998-12-03 1999-09-28 Isis Pharmaceuticals, Inc. Antisense modulation of cellular inhibitor of Apoptosis-2 expression
US6087173A (en) * 1999-09-09 2000-07-11 Isis Pharmaceuticals Inc. Antisense modulation of X-linked inhibitor of apoptosis expression
US6156535A (en) * 1995-08-04 2000-12-05 University Of Ottawa Mammalian IAP gene family, primers, probes, and detection methods
AUPN727595A0 (en) * 1995-12-22 1996-01-18 Walter And Eliza Hall Institute Of Medical Research, The Therapeutic compositions
GB9601108D0 (en) * 1996-01-19 1996-03-20 Univ Ottawa Neuronal apoptosis inhibitor protein (NAIP)
US8043835B1 (en) 1996-03-26 2011-10-25 Oncomedx, Inc. Methods for detecting and monitoring cancer using extracellular RNA
ATE471150T1 (en) * 1996-03-26 2010-07-15 Kopreski Michael S METHODS USING EXTRACELLURAER RNA EXTRACTED FROM PLASMA OR SERUM FOR DIAGNOSTIC MONITORING OR EVALUATION OF CANCER
US7785842B2 (en) * 1996-03-26 2010-08-31 Oncomedx, Inc. Comparative analysis of extracellular RNA species
US6133437A (en) * 1997-02-13 2000-10-17 Apoptogen, Inc. Modulation of IAPs for the treatment of proliferative diseases
DE69738776D1 (en) 1996-04-26 2008-07-31 Univ Ottawa USE OF NAIP OR IAP FOR THE TREATMENT AND PREVENTION OF NEURAL DISEASES
US6511828B1 (en) 1996-05-31 2003-01-28 Arch Development Corporation Human and drosophila inhibitors of apoptosis proteins (IAPs)
US5840535A (en) * 1997-06-02 1998-11-24 Incyte Pharmaceuticals, Inc. DNA encoding a zinc ring protein
US6326481B1 (en) 1998-06-02 2001-12-04 Millennium Pharmaceuticals. Inc. Molecules of the AIP-related protein family and uses thereof
US6171821B1 (en) * 1998-07-24 2001-01-09 Apoptogen, Inc. XIAP IRES and uses thereof
US6472172B1 (en) * 1998-07-31 2002-10-29 Schering Aktiengesellschaft DNA encoding a novel human inhibitor-of-apoptosis protein
US20080261292A1 (en) * 1998-09-22 2008-10-23 Oncomedx, Inc. Method Enabling the Use of Extracellular Ribonucleic Acid (RNA) Extracted from Plasma or Serum to Detect, Monitor or Evaluate Cancer or Premalignant Conditions
CN1301769A (en) * 1999-12-29 2001-07-04 复旦大学 New polypeptide-human latexin protein 46 and polynucleotide coding such polypeptide
ATE428116T1 (en) * 2000-06-16 2009-04-15 Rudel Thomas Dr METHOD FOR IDENTIFYING MODIFIED PROTEINS DURING APOPTOSIS
EP1164374A1 (en) * 2000-06-16 2001-12-19 Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V. Method for identifying apoptosis-modified proteins
US20020164576A1 (en) * 2000-09-22 2002-11-07 Pedersen Finn Skou Methods for diagnosis and treatment of diseases associated with altered expression of Nrf2
US20030044803A1 (en) * 2000-09-22 2003-03-06 Pedersen Finn Skou Methods for diagnosis and treatment of diseases associated with altered expression of JAK1
US6673917B1 (en) * 2000-09-28 2004-01-06 University Of Ottawa Antisense IAP nucleic acids and uses thereof
US6901173B2 (en) * 2001-04-25 2005-05-31 Lockheed Martin Corporation Scene-based non-uniformity correction for detector arrays
US20070098728A1 (en) * 2001-09-24 2007-05-03 Pedersen Finn S Novel compositions and methods in cancer
US20100159464A1 (en) * 2001-11-05 2010-06-24 Oncomedx, Inc. Method for Detection of DNA Methyltransferase RNA in Plasma and Serum
US7820132B2 (en) * 2001-12-14 2010-10-26 Alliance For Sustainable Energy, Llc Hot wire production of single-wall and multi-wall carbon nanotubes
EP1539189A4 (en) * 2002-03-25 2007-05-09 Univ Boston Method of using anti-apoptotic factors in gene expression
CA2480308C (en) * 2002-03-27 2011-10-04 Aegera Therapeutics Inc. Antisense iap nucleobase oligomers and uses thereof
US20050233411A9 (en) * 2003-02-07 2005-10-20 Chunying Du Compositions and methods for cleaving IAP
WO2005017109A2 (en) * 2003-06-30 2005-02-24 Massachusetts Institute Of Technology Nucleic acids and polypeptides required for cell survival in the absence of rb
US8012944B2 (en) * 2003-10-30 2011-09-06 Pharmascience Inc. Method for treating cancer using IAP antisense oligomer and chemotherapeutic agent
US7342093B2 (en) 2004-07-23 2008-03-11 University Of Massachusetts Compounds that inhibit Hsp90 protein-protein interactions with IAP proteins
EP1807157A2 (en) * 2004-10-22 2007-07-18 Neurologix, Inc. Use of apoptosis inhibiting compounds in degenerative neurological disorders
PT1889065E (en) 2005-05-18 2013-09-27 Novartis Ag Methods for diagnosis and treatment of diseases having an autoimmune and/or inflammatory component
KR101506466B1 (en) 2006-05-16 2015-03-27 파마사이언스 인크. IAP BIR domain binding compounds
WO2011098904A1 (en) 2010-02-12 2011-08-18 Aegera Therapeutics, Inc. Iap bir domain binding compounds
KR101215201B1 (en) 2010-07-21 2012-12-26 단국대학교 산학협력단 Composition for preventing or treating ischemic disease comprising X-chromosome linked inhibitor of apoptosis
US20140127438A1 (en) 2012-11-08 2014-05-08 Robert L. Sherman, Jr. Stabilized high-density polyethylene composition with improved resistance to deterioration and stabilizer system

Family Cites Families (56)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5665550A (en) * 1990-10-19 1997-09-09 Board Of Trustees Of The University Of Illinois-Urbana Genes and genetic elements associated with sensitivity to chemotherapeutic drugs
WO1994008003A1 (en) * 1991-06-14 1994-04-14 Isis Pharmaceuticals, Inc. ANTISENSE OLIGONUCLEOTIDE INHIBITION OF THE ras GENE
US5594076A (en) * 1991-09-24 1997-01-14 The Pennsylvania Research Foundation Hydrodegradable polyesters
US6265157B1 (en) 1991-12-03 2001-07-24 Allegheny University Of The Health Sciences Compositions and methods for detecting altered COL1A1 gene sequences
US20030073159A1 (en) * 1992-05-11 2003-04-17 Human Genome Sciences, Inc. Human inhibitor of apoptosis gene 1
CA2123406A1 (en) * 1992-09-14 1994-03-31 Katia Georgopoulos Ikaros: a t cell pathway regulatory gene
US6087173A (en) 1999-09-09 2000-07-11 Isis Pharmaceuticals Inc. Antisense modulation of X-linked inhibitor of apoptosis expression
US5958771A (en) 1998-12-03 1999-09-28 Isis Pharmaceuticals, Inc. Antisense modulation of cellular inhibitor of Apoptosis-2 expression
US5958772A (en) * 1998-12-03 1999-09-28 Isis Pharmaceuticals Inc. Antisense inhibition of cellular inhibitor of apoptosis-1 expression
WO1994023760A1 (en) * 1993-04-14 1994-10-27 The United States Of America As Represented By The Secretary Of The Navy Transgenic animal model for autoimmune diseases
US5691179A (en) * 1993-08-26 1997-11-25 Washington University Cell death regulators
US5624803A (en) * 1993-10-14 1997-04-29 The Regents Of The University Of California In vivo oligonucleotide generator, and methods of testing the binding affinity of triplex forming oligonucleotides derived therefrom
US5801154A (en) * 1993-10-18 1998-09-01 Isis Pharmaceuticals, Inc. Antisense oligonucleotide modulation of multidrug resistance-associated protein
US5510239A (en) * 1993-10-18 1996-04-23 Isis Pharmaceuticals, Inc. Oligonucleotide modulation of multidrug resistance-associated protein
WO1995019431A1 (en) * 1994-01-18 1995-07-20 The Scripps Research Institute Zinc finger protein derivatives and methods therefor
WO1995028497A1 (en) * 1994-04-13 1995-10-26 La Jolla Cancer Research Foundation Interaction of proteins involved in a cell death pathway
WO1995030435A2 (en) 1994-05-10 1995-11-16 Immulogic Pharmaceutical Corporation Compositions and treatment for multiple sclerosis
DE69534720D1 (en) * 1994-10-18 2006-02-02 Univ Ottawa NEURONAL APOTOSIS INHIBITOR PROTEIN, GENE SEQUENCE AND MUTATIONS CAUSING SPINAL MUSCLE ATROPHY
CA2203629A1 (en) 1994-10-25 1996-05-02 Dawn Smilek Compositions and treatment for multiple sclerosis
AU4695296A (en) 1995-01-06 1996-07-24 Immulogic Pharmaceutical Corporation Compositions and methods for treating rheumatoid arthritis
CA2220670A1 (en) 1995-05-11 1996-11-14 Peter L. Hudson Human inhibitor of apoptosis gene 1
US5770690A (en) * 1995-06-27 1998-06-23 Neurex Corporation Bax omega protein and methods
US5877021A (en) 1995-07-07 1999-03-02 Ribozyme Pharmaceuticals, Inc. B7-1 targeted ribozymes
US6156535A (en) * 1995-08-04 2000-12-05 University Of Ottawa Mammalian IAP gene family, primers, probes, and detection methods
US5919912A (en) * 1995-08-04 1999-07-06 University Of Ottawa Mammalian IAP antibodies and diagnostic kits
AU6692996A (en) 1995-08-08 1997-03-05 Tularik Inc. Inhibitors of apoptosis
US6187557B1 (en) 1995-08-08 2001-02-13 Tularik Inc. c-IAP1 and c-IAP2: inhibitors of apoptosis
US5834216A (en) * 1995-09-06 1998-11-10 Arch Development Corporation Screening methods for the identification of inducers and inhibitors of programmed cell death (apoptosis)
AUPN727595A0 (en) * 1995-12-22 1996-01-18 Walter And Eliza Hall Institute Of Medical Research, The Therapeutic compositions
US5605022A (en) * 1995-12-26 1997-02-25 Nci Building Systems, Inc. Vented closure
GB9601108D0 (en) * 1996-01-19 1996-03-20 Univ Ottawa Neuronal apoptosis inhibitor protein (NAIP)
US6133437A (en) 1997-02-13 2000-10-17 Apoptogen, Inc. Modulation of IAPs for the treatment of proliferative diseases
WO1997049819A1 (en) * 1996-06-24 1997-12-31 Takara Shuzo Co., Ltd. Novel amino-terminal deblocking enzyme
WO1998022131A2 (en) 1996-11-15 1998-05-28 University Of Ottawa Modulators of ovarial apoptosis related to iap
US5994076A (en) * 1997-05-21 1999-11-30 Clontech Laboratories, Inc. Methods of assaying differential expression
US6228603B1 (en) 1997-05-22 2001-05-08 The Burnham Institute Screening assays for agents that alter inhibitor of apoptosis (IAP) protein regulation of caspase activity
CA2225187A1 (en) * 1997-07-14 1999-01-14 Universite D'ottawa/ University Of Ottawa Xaf genes and polypeptides: methods and reagents for modulating apoptosis
US6133246A (en) * 1997-08-13 2000-10-17 Isis Pharmaceuticals Inc. Antisense oligonucleotide compositions and methods for the modulation of JNK proteins
AU1080899A (en) 1997-10-14 1999-05-03 Nadine A. Tatton Methods for increasing schwann cell survival
US6506559B1 (en) * 1997-12-23 2003-01-14 Carnegie Institute Of Washington Genetic inhibition by double-stranded RNA
US6171821B1 (en) 1998-07-24 2001-01-09 Apoptogen, Inc. XIAP IRES and uses thereof
US6077709A (en) 1998-09-29 2000-06-20 Isis Pharmaceuticals Inc. Antisense modulation of Survivin expression
CA2346773A1 (en) * 1998-10-09 2000-04-20 L. Sai Latha Shankar Methods for treating multiple sclerosis
US6187657B1 (en) * 1999-03-24 2001-02-13 Advanced Micro Devices, Inc. Dual material gate MOSFET technique
KR20000065690A (en) 1999-04-08 2000-11-15 박종구 Specific and stable antisense oligonucleotide, antisense DNA and process for preparation thereof
US5998148A (en) * 1999-04-08 1999-12-07 Isis Pharmaceuticals Inc. Antisense modulation of microtubule-associated protein 4 expression
US6395771B1 (en) 2000-05-31 2002-05-28 Dabur Research Foundation Paclitaxel derivatives for the treatment of cancer
US6673917B1 (en) * 2000-09-28 2004-01-06 University Of Ottawa Antisense IAP nucleic acids and uses thereof
US20020119168A1 (en) * 2001-02-20 2002-08-29 Rudnic Edward M. Therapeutic agent delivery
KR100397275B1 (en) * 2001-03-08 2003-09-17 주식회사 웰진 Novel high-throughput system for functional genomics using unidirectional antisense cDNA library
EP1572923A4 (en) 2002-03-06 2007-10-31 Rigel Pharmaceuticals Inc Novel method for delivery and intracellular synthesis of sirna molecules
CA2480308C (en) * 2002-03-27 2011-10-04 Aegera Therapeutics Inc. Antisense iap nucleobase oligomers and uses thereof
EP1469070A1 (en) 2003-04-15 2004-10-20 Deutsches Krebsforschungszentrum Stiftung des öffentlichen Rechts Livin-specific siRNAs for the treatment of therapy-resistant tumors
CN101579529A (en) * 2003-09-29 2009-11-18 托皮根药品公司 Oligonucleotide compositions and method for treating disease including inflammatory conditions
US8012944B2 (en) 2003-10-30 2011-09-06 Pharmascience Inc. Method for treating cancer using IAP antisense oligomer and chemotherapeutic agent
US6946917B2 (en) * 2003-11-25 2005-09-20 Texas Instruments Incorporated Generating an oscillating signal according to a control current

Also Published As

Publication number Publication date
US6656704B1 (en) 2003-12-02
US6977158B1 (en) 2005-12-20
WO1997006255A2 (en) 1997-02-20
US20070042446A1 (en) 2007-02-22
EP1757689A2 (en) 2007-02-28
US20070026470A1 (en) 2007-02-01
JP4458551B2 (en) 2010-04-28
US20070026494A1 (en) 2007-02-01
US7776552B2 (en) 2010-08-17
US6541457B2 (en) 2003-04-01
US20070027304A1 (en) 2007-02-01
US20040157232A1 (en) 2004-08-12
ES2253756T3 (en) 2006-06-01
EP0837939A2 (en) 1998-04-29
US7067281B2 (en) 2006-06-27
US20060205021A1 (en) 2006-09-14
WO1997006255A3 (en) 1997-10-30
DE69635482T2 (en) 2006-07-13
US20070048772A1 (en) 2007-03-01
US6689562B1 (en) 2004-02-10
US20070066524A1 (en) 2007-03-22
EP0837939B1 (en) 2005-11-23
US6156535A (en) 2000-12-05
US20060127927A1 (en) 2006-06-15
US20020187946A1 (en) 2002-12-12
DE69635482D1 (en) 2005-12-29
JPH11511013A (en) 1999-09-28
US20070031904A1 (en) 2007-02-08
ATE310819T1 (en) 2005-12-15
CA2228635A1 (en) 1997-02-20
US20070031903A1 (en) 2007-02-08
US20070009971A1 (en) 2007-01-11
EP1757689A3 (en) 2007-05-23

Similar Documents

Publication Publication Date Title
CA2228635C (en) Mammalian apoptosis inhibitor protein gene family, primers, probes and detection methods
CA2273821C (en) Detection and modulation of the iaps and naip for the diagnosis and treatment of proliferative disease
US20070202096A1 (en) XAF genes and polypeptides: methods and reagents for modulating apoptosis
US5919912A (en) Mammalian IAP antibodies and diagnostic kits
US20060172348A1 (en) Use of neuronal apoptosis inhibitor protein (NAIP)
CA2403947C (en) Bir domains of mammalian iap gene family
CA2512366A1 (en) Mammalian iap gene family, primers, probes and detection methods
US20070219360A1 (en) Detection and modulation of IAPs and NAIP for the diagnosis and treatment of proliferative disease

Legal Events

Date Code Title Description
EEER Examination request
MKLA Lapsed

Effective date: 20140805