CA2239360C - G-csf analog compositions and methods - Google Patents

Abstract

Provided herein are granulocyte colony stimulating factor ("G-CSF") analogs, compositions containing such analogs, and related compositions. In another aspect, provided herein are nucleic acids encoding the present analogs or related nucleic acids, related host cells and vectors. In yet another aspect, provided herein are computer programs and apparatuses for expressing the three dimensional structure of G-CSF and analogs thereof. In another aspect, provided herein are methods for rationally designing G-CSF analogs and related compositions. In yet another aspect, provided herein are methods for treatment using the present G-CSF analogs.

Description

CA 02239360 1998-08-0~

WO94117185 PCT~S94100913 G-CSF ANALO(; COMPOSITIONS AND M~THODS

Field of the Invention This invention relates to granulocyte colony stimulating factor ("G-CSF") analogs, compositions containing such analogs, and related compositions. In another aspect, the present invention relates to nucleic acids encoding the present analogs or related nucleic acids, related host cells and vectors. In another aspect, the invention relates to computer programs and apparatuses for expressing the three dimensional structure of G-CSF ancl analogs thereof. In another asperL, the invention relates to methods for rationally designing G-CSF analocrs and related compositions. In yet another aspect, the present invention relates to methods for treatment using the present G-CSF analogs.

~ckaround Hematopoies;s is controlled by two systems:
the cells within the bone marrow microenvironment and growth factors. The growth factors, also called colony stimulating factors, stimulate committed progenitor cells to proliferate and to form colonies of differentiating blood cells. One of these factors is granulocyte colony stimulating factor, herein called G-CSF, which preferentially stimulates the growth and development of neutrophils, indicating a potential use in neutropenic states. Welte et al., PNAS-USA 82: 1526-1530 (1985); Souza et al., Science 232: 61-65 (1986) and Gabrilove, J. Seminars in Hematology ~ 2) 1-14 (1989).
In humans, endogenous G-CSF is detectable in blood plasma. Jones et al., Bailliere's Clinical Hematology 2 (1): 83-111 (1989). G-CSF is produced by fibroblasts, macrophages, T cells trophoblasts, endothelial cells and epithelial cells and is the CA 02239360 1998-08-0~

WO94/17185 PCT~S94100913 expression product of a single copy gene comprised of four exons and five introns located on chromosome seventeen. Transcription of this locus produces a mRNA
species which is differentially processed, resulting in two forms of G-CSF mRNA, one version coding for a protein of 177 amino acids, the other coding for a protein of 174 amino acids, Nagata et al., EMBO J ~:
575-581 (1986), and the form comprised of 174 amino acids has been found to have the greatest specific n v vo biological activity. G-CSF is species cross-reactive, such that when human G-CSF is administered to another mammal such as a mouse, canine or monkey, sus~ained neutrophil leukocytosis is elicited. Moore et al., PNAS-USA 84: 7134-7138 (1987).
Human G-CSF can be obtained and purified from a number of sources. Natural human G-CSF (nhG-CSF) can be isolated from the supernatants of cultured human tumor cell lines. The development of recombinant DNA
technology, see, for instance, U.S. Patent 4,810,643 (Souza), has enabled the production of commercial scale qua~tities of G-CSF
in glycosylated form as a product of eukaryotic host cell expression, and of G-CSF in non-glycosylated form as a product of prok~ryotic host cell expression.
G-CSF has been found to be useful in the treatment of indications where an increase in neutrophils will provide benefits. For example, for cancer patients, G-CSF is beneficial as a means of selectively stimulat:ing neutrophil production to compensate for hematopoietic deficits resulting from chemotherapy or radi~tion therapy. Other indications include treatment of various infectious diseases and related conditions, such as sepsis, which is typically caused by a metabolit:e of bacteria. G-CSF is also useful alone, or in combination with other compounds, such as other cytokines, for growth or expansion of CA 02239360 1998-08-0~

WO94117185 PCT~S94/00913 cells in culture, for example, for bone marrow transplants.
Signal transduction, the way in which G-CSF
effects cellular metabolism, is not currentl'y thoroughly understood. G-CSF b'nds to a cell-surface receptor which apparently init:iates the changes within particular progenitor cells, leading to cell differentiation.
Various altered G-CSF's have been reported.
Generally, for design of drugs, certain changes are known to have certain structural effects. For example, deleting one cysteine could result in the unfolding of a molecule which is, in its unaltered state, is normally folaed via a disulficle bridge. There are other known methods for adding, cLeleting or substituting amino acids in order to change the function of a protein.
Recombinant: human G-CSF mutants have been prepared, but the method of preparation does not include overall structure/function relationship information. For example, the mutation and biochemical modification of Cys 18 has been reported. Kuga et al., Biochem. Biophy. Res. Comm 159: 103-111 ~1989); Lu et al., Arch. Biochem. ~iophys. 268: 81-92 (1989).
In U.S. Pat:ent No. 4, 810, 643, entitled, "Production--of Pluripotent Granulocyte Colony- -Stimulating Factor" (as cited above), polypeptideanalogs and peptide fragments of G-CSF are disclosed generally. Specific G-CSF analogs disclosed include those with the cysteins at positions 17, 36, 42, 64, and 74 (of the 174 amino acid species or of those having 175 amino acids, the additional amino acid being an N-terminal methionine) substituted with another amino acid, (such as serine), and G-CSF with an alanine in the first (N-terminal) position.
EP 0 335 423 entitled "Modified human G-CSF"
reportedly discloses the modification of at least one amino group in a polypeptide having hG-CSF activity.

CA 02239360 1998-08-0~
WO94117185 PCT~S94/00913 EP 0 272 703 entitled "Novel Polypeptide"
reportedly discloses G-CSF derivatives having an amino acid substituted or deleted at or "in the neighborhood"
of the N terminus.
~P 0 459 630, entitled "Polypeptides"
reportedly discloses derivatives of naturally occurring G-CSF having at least: one of the biological properties of naturally occurring G-CSF and a solution stability of at least 35% at 5 mg/'ml in which the derivative has at least Cysl7 of the native sequence replaced by a Ser17 residue and Asp27 of the native sequence replaced by a Ser27 residue.
_ EP 0 256 843 entitled "Expression of G-CSF and Muteins Thereof and Their Uses" reportedly discloses a modified DNA sequence encoding G-CSF wherein the N-terminus is modified for enhanced expression of protein in recombinant host cells, without changing the amino acid sequence of the protein.
EP 0 243 153 entitled "Human G-CSF Protein Expression" reportedl.y discloses G-CSF to be modified by inactivating at least. one yeast KEX2 protease processing site for increased yi.eld in recombinant production using yeast.
Shaw, U.S. Patent No. 4,904,584, entitled "Site-Specific Homogeneous Modification of Polypeptides," reportedly discloses lysine altered proteins.
WO/9012874 reportedly discloses cysteine altered variants of proteins.
Australian patent application Document No. AU-A-10948/92, entitled, "Improved Activation of Recombinant Proteins" reportedly discloses the addition of amino acids to either terminus of a G-CSF molecule for the purpose of aiding in the folding of the molecule after prokaryotic expression.

CA 02239360 1998-08-0~

WOg4117185 PCT~S94/00913 Australian patent application Document No. AU-A-76380/91, entitled, "Muteins of the Granulocyte Colony - Stimulating Factor (G-CSF)" reportedly dlscloses muteins of the granulocyte stimulating factor G-CSF in the sequence Leu-Gly-His-Ser-LeU-Gly-Ile at position 50-56 of G-CSF with 174 amino acids, and position 53 to 59 of the G-CSF with 177 amino acids, or/and at least one of the four histidine residues at positions 43, 79, 156 and 170 of the mature G-CSF with 174 amino acids or at positions 46, 82, 159, or 173 of the mature G-CSF with 177 amino acids.
GB 2 213 821, entitled "Synthetic Human Grar.~-~locyte Colony Stimulating Factor Gene" reportedly discloses a synthetic G-CSF-encoding nucleic acid sequence incorporating restriction sites to facilitate the cassette mutagenesis of selected regions, and flanking restriction sites to facilitate the incorporation of the ~ene into a desired expression system.
G-CSF has reportedly been crystallized to some extent, e.g., EP 344 796, and the overall structure of G-CSF has been surmised, but only on a gross level.
Bazan, Immunology Tod~y 11: 350-354 ~1990); Parry et al., J. Mole-cular Recognition 8: 107-110 (1988).- To date, there have been no reports of the overall structure of G-CSF, and no systematic studies of the relationship of the overall structure and function of the molecule, studies which are essential to the systematic design of (,-CSF analogs. Accordingly, there exists a need for a method of this systematic design of G-CSF analogs, and the resultant compositions.

Sllmm~ry of the Invention The three dimensional structure of G-CSF has now been determined to the atomic level. From this three-dimensional stnlcture, one can now forecast with CA 02239360 1998-08-0~

W O 94117185 PCT~US94/00913 substantial certalnt~ how changes in the composition of a G-CSF molecule may result in structural changes.
These structural characteristics may be correlated with biological activity to design and produce G-CSF analogs.
Although others had speculated regarding the three dimensional structure of G-CSF, Bazan, Immunology Today 11: 350-354 (1990); Parry et al., J. Molecular Recognition 8: 107-110 (1988), these speculations were of no help to those wishing to prepare G-CSF analogs either because the surmised structure was incorrect (Parry et al., supra) and/or because the surmised structure provided nc detail correlating the constituent mo ~ ies with structure. The present determination of the three-dimensional structure to the atomic level is by far the most complete analysis to date, and provides important information to those wishing to design and prepare G-CSF analogs. For example, from the present three dimensional structural analysis, precise areas of hydrophobicity and hydrophilicity have been determined.
Relative hydrophobicity is important because it directly relates to the stability of the molecule.
Generally, biological molecules, found in aqueous environments, are externally-hydrophilic and internally hydrophobic; in accordance with the second law of thermodynamics provides, this is the lowest energy state and provides for stability. Although one could have speculated that G-CSF's internal core would be hydrophobic, and the outer areas would be hydrophilic, one would have had no way of knowing specific hydrophobic or hydrophilic areas. With the presently provided knowledge of areas of hydrophobicity/-philicity, one may forecast with substantial certainty which changes to the G-CSF molecule will affect the overall structure of the molecule.
As a general rule, one may use knowledge of the geography of the hydrophobic and hydrophilic regions CA 02239360 1998-08-0~
W~94/17~85 PCT~S94/~913 to design analogs ln which the overall G-CSF structure is not changed, but change does affect biological activity ("biological activity" being used here in its broadest sense to denote function). One may correlate biological activity t:o structure. If the structure is not changed, and the mutation has no effect on biological activity, then the mutation has no biological function. If, however, the structure is not changed and the mutation does affect biological actlvity, then the residue ~or atom) is essential to at least one biological function. Some of the present working examples were designed to provide no change in overall structure, yet have a change in biological function.
Based on the correlation of structure to biological activity, one aspect of the present invention relates to G-CSF analogs. These analogs are molecules which have more, fewer, different or modified amino acid residues from the G-CSF amino acid sequence. The modifications may be by addition, substitution, or deletion of one or more amino acid residues. The modification may include the addition or substitution of analogs of the amino acids themselves, such as peptidomimetics or amino acids with altered moieties such as altered side groups. The G-CSF used as a basis for comparison may be of human, animal or recombinant nucleic acid-technology origin (although the working examples disclosed herein are based on the recombinant production of the 174 amino acid species of human G-CSF, having an extra N-terminus methionyl residue). The analogs may possess functions different from natural human G-CSF molecule, or may exhibit the same functions, or varying degrees of the same functions. For example, the analogs may be designed to have a higher or lower biological activity, have a longer shelf-life or a decrease in stability, be easier to formulate, or more difficult to combine with other ingredients. The CA 02239360 1998-08-0~
WO94~17185 PCT~S94100913 analogs may have no hematopoietic activity, and may therefore be useful as an antagonist against G-CSF
effect (as, for example, in the overproduction of G-CSF). From time t~ time herein the present analogs are referred to as proteins or peptides for convenience, but contemplated herein are other types of molecules, such as peptidomimetics or chemically modified peptides.
In another aspect, the present invention relates to related compositions containing a G-CSF
analog as an active ingredient. The term, "related composition," as used herein, is meant to denote a composition which may be obtained once the identity of th~ -CSF analog is ascertained (such as a G-CSF analog labeled with a detectable label, related receptor or pharmaceutical compo;ition). Also considered a related composition are chem:Lcally modified versions of the G-CSF analog, such a-, those having attached at least one polyethylene glycol rnolecule.
For example, one may prepare a G-CSF analog to which a detectable label is attached, such as a fluorescent, chemiluminescent or radioactive molecule.
Another ex,~mple is a pharmaceutical composition which may be formulated by known technicIues using known materials, see, ~_g., Remington's Pharmaceutical Sciences, 18th Ed. (1990, Mack Publishing Co., Easton, Pennsylvania 18042) pages 1435-1712.
Generally, the formulation will depend on a variety ~f factors such as administration, stability, production concerns and other factors. The G-CSF analog may be administered by injection or by pulmonary administration via inhalation.
Enteric dosage forms may also be available for the present G-CSF analog compositions, and therefore oral administration may be effective. G-CSF analogs may be inserted into liposomes or other microcarriers for delivery, and may be formulated in gels or other CA 02239360 l998-08-0~

WO 94/17185 PCTrUS94/00913 compositions for sustained release. Although preferred compositions will vary depending on the use to which the composition will be put, generally, for G-CSF analogs having at least one of the biological activities of natural G-CSF, preferred pharmaceutical compositions are those prepared for subcutaneous injection or for pulmonary administration via inhalation, although the particular formulations for each type of administration will depend on the characteristics of the analog.
Another example of related composition is a receptor for the present analog. As used herein, the ter~m "receptor" indicates a moiety which selectively binds to the present analog molecule. For example, antibodies, or fragments thereof, or "recombinant antibodies" (see Huse et al., Science 246:1275 (1989)) may be used as receptors. Selective binding does not mean only specific binding (although binding-specific receptors are encompassed herein), but rather that the binding is not a random event. Receptors may be on the cell surface or intra- or extra-cellular, and may act to effectuate, inhibit or localize the biological activity of the present analogs. Receptor binding may also be a triggering mechanism for a cascade of activity indirectly related to the analog itself. Also contemplated herein are nucleic acids, vectors containing such nucleic acids and host cells containing such nucleic acids which encode such receptors.
Another example of a related composition is a G-CSF analog with a chemical moiety attached.
Generally, chemical modification may alter biological activity or antigenicity of a protein, or may alter other characteristics, and these factors will be taken into account by a skilled practitioner. As noted above, one example of such chemical moiety is polyethylene glycol. Modification may include the addition of one or more hydrophilic or hydrophobic polymer molecules, fatty CA 02239360 1998-08-0~

W O 94J17185 P~rAUS94/00913 acid molecules, or p~lysaccharide molecules. Examples of chemical modifiers include polyethylene glycol, alklpolyethylene glycols, DI-poly~amino acids), polyvinylpyrrolidone, polyvinyl alcohol, pyran copolymer, acetic acid/acylation, proprionic acid, palmitic acid, stearic acid, dextran, carboxymethyl cellulose, pullulan, or agarose. See, Francis, Focus on Growth Factors 3: 4-l0 (May 1992)(published by Mediscript, Mountview Court, Friern Barnet Lane, London N20 OLD, UK). Also, chemical modification may include an additional protein or portion thereof, use of a cytotoxic agent, or an antibody. The chemical mo-~~ication may also include lecithin.
In another aspect, the present invention relates to nucleic acids encoding such analogs. The nucleic acids may be DNAs or RNAs or derivatives thereof, and will ty~ically be cloned and expressed on a ~ vector, such as a phage or plasmid containing appropriate regulatory sequences. The nucleic acids may be labeled ~such as using a radioactive, chemiluminescent, or fluorescent label) for diagnostic or prognostic purposes, for example. The nucleic acid sequence may be optirnized for expression, such as including codons preferred for bacterial expression.
The nucleic acid and its complementary strand, and modifications thereof- which do not prevent encoding of the desired analog are here contemplated.
In another aspect, the present invention relates to host cells containing the above nucleic acids encoding the present analogs. Host cells may be eukaryotic or prokaryotic, and expression systems may include extra steps relating to the attachment ~or prevention) of sugar groups ~glycosylation), proper folding of the molecule, the addition or deletion of leader sequences or other factors incident to recombinant expression.

CA 02239360 l998-08-0~

W O 94/17185 PCTrUS94/00913 In another aspect the present invention relates to antisense nucleic acids which act to prevent or modify the type or amount of expression of such nucleic acid sequences. These may be prepared by known methods.
In another aspect of the present invention, the nucleic acids encoding a present analog may be used for gene therapy purposes, for example, by placing a vector containing the analog-encoding sequence into a recipient so the nucleic acid itself is expressed inside the recipient who is in need of the analog composition.
The vector may first be placed in a carrier, such as a cell-, and then the carrier placed into the recipient.
Such expression may be localized or systemic. Other carriers include non-naturally occurring carriers, such as liposomes or other microcarriers or particles, which may act to mediate gene transfer into a recipient.
The present: invention also provides for computer programs for the expression (such as visual display) of the G-CSE or analog three dimensional structure, and further, a computer program which expresses the identity of each constituent of a G-CSF
molecule and the precise location within the overall structure of that constituent, down to the atoml~c level.
Set forth below is one example of such program. There are many currently available computer programs for the expression of the three dimensional structure of a molecule. Generally, these programs provide for inputting of the coordinates for the three dimensional structure of a molecule (i.e., for example, a numerical assignment for each atom of a G-CSF molecule along an x, y, and z axis), means to express (such as visually display) such coordinates, means to alter such coordinates and means to express an image of a molecule having such altered coordinates. One may program crystallographic information, i.e., the coordinates of CA 02239360 1998-08-0~
WO94/1718~ PCT~S94/00913 the location of the atoms of a G-CSF molecule in three dimension space, wherein such coordinates have been obtained from crystallographic analysis of said G-CSF
molecule, into such programs to generate a computer 5 program for the expression ~such as visual display) of the G-CSF three dimensional structure. Also provided, therefore, is a computer program for the expression of G-CSF analog three climensional structure. Preferred is the computer program Insight II, version 4, available from Biosym, San Diego, California, with the coordinates as set forth in FIG~FE 5 input. Preferred expression means is on a Siliccn Graphics 320 VGX computer, with C ~ al Eyes glasses (also available from Silicon Graphics), which allows one to view the G-CSF molecule or its analog stereoscopically. Alternatively, the present G-CSF crystallographic coordinates and diffraction data are also deposited in the Protein Data Bank, Chemistry Department, Brookhaven National Laboratory, Upton, New York 119723, USA. One may use these data in preparing a different computer program for expression of the three dimensional structure of a G-CSF
molecule or analog thereof. Therefore, another aspect of the present invention is a computer program for the expression-of the three dimensional structure of a G-CSF
molecule. Also provided is said computer program for visual display of the three dimensional structure of a G-CSF molecule; and further, said program having means for altering such visual display. Apparatus useful for expression of such computer program, particularly for the visual display of the computer image of said three dimensional structure of a G-CSF molecule or analog thereof is also therefore here provided, as well as means for preparing said computer program and apparatus.
The computer program is useful for preparation of G-CSF analogs bec~use one may select specific sites on the G-CSF molecule for alteration and readily * Trade-~ark CA 02239360 1998-08-0~
WO94117185 PCT~S941~913 ascertain the effect the alteration will have on the overall structure of the G-CSF molecule. Selection of said site for alteration will depend on the desired biological characteristic of the G-CSF analog. If one were to randomly change said G-CSF molecule (r-met-hu-G-CSF) there would be 1752~ possible substitutions, and even more analogs having multiple changes, additions or deletions. By viewing the three dimensional structure wherein said structure is correlated with the composition of the molecule, the selection for sites of alteration is no longer a random event, but sites for alteration may be determined ra ~ ally.
As set forth above, identity of the three dimensional structure of G-CSF, including the placement of each constituent down to the atomic level has now yielded information regarding which moieties are necessary to maintain the overall structure of the G-CSF
molecule. One may therefore select whether to maintain the overall structure of the G-CSF molecule when preparing a G-CSF analog of the present invention, or whether (and how) to change the overall structure of the G-CSF molecule when preparing a G-CSF analog of the present invention. Optionally, once one has prepared such analog, one may l_est such analog for a desired characteristic.
One may, for example, seek to maintain the overall structure possessed by a non-altered natural or recombinant G-CSF molecule. The overall structure is presented in Figures ;~, 3, and 4, and is described in more detail below. Maintenance of the overall structure may ensure receptor binding, a necessary characteristic for an analog possessLng the hematopoietic capabilities of natural G-CSF (if no receptor binding, signal transduction does not result from the presence of the analog). It is contemplated that one class of G-CSF

CA 02239360 1998-08-0~

WO 94117185 PCTrUS94/OOgl3 analogs will possess the three dimensional core structure of a natural or recombinant (non-altered) G-CSF molecule, yet possess different characteristics, such as an increased ability to selectively stimulate neutrophils. Another class of G-CSF analogs are those with a different overall structure which diminishes the ability of a G-CSF analog molecule to bind to a G-CSF
receptor, and possesses a diminished ability to selectively stimulate neutrophils as compared to non-altered natural or recombinant G-CSF.
For example, it is now known which moieties within the internal regions of the G-CSF molecule are hyd~ophobic, and, correspondingly, which moieties on the external portion of l_he G-CSF molecule are hydrophilic.
Without knowledge of the overall three dimensional structure, preferably to the atomic level as provided herein, one could nol forecast which alterations within this hydrophobic internal area would result in a change in the overall struclural conformation of the molecule.
An overall structura:L change could result in a functional change, such as lack of receptor binding, for example, and therefore, diminishment of biological activity as found in non-altered G-CSF. Another class of G-CSF analogs is t:herefore G-CSF analogs whi'ch possess the same hydrophobicity as (non-altered) natural or recombinant G-CSF More particularly, another class of G-CSF analogs possesses the same hydrophobic moieties within the four helical bundle of its internal core as those hydrophobic moieties possessed by (non-altered) natural or recombinant G-CSF yet have a composition different from said non-altered natural or recombinant G-CSF.
Another ex,~mple relates to external loops which are structures which connect the internal core ~helices) of the G-CSF molecule. From the three dimensional structure -- including information regarding the spatial location of the amino acid residues -- one may forecast that certain changes in certain loops will not result in overal:! conformational changes.
Therefore, another c:ass of G-CSF analogs provided herein is that havinc~ an altered external loop but possessing the same overall structure as (non-altered) natural or recombinant G-CSF. More particularly, another class of G-C',F analogs provided herein are those having an altered ext:ernal loop, said loop being selected from the loop present between helices A and B;
between helices B anci C; between helices C and D;
between helices D ancl A, as those loops and helices are 7_ ider.-cified herein. More particularly, said loops, preferably the AB loop and/or the CD loop are altered to increase the half life of the molecule by stabilizing said loops. Such stabilization may be by connecting all or a portion of said loop(s) to a portion of an alpha helical bundle found in the core of a G-CSF (or analog) molecule. Such connec:tion may be via beta sheet, salt bridge, disulfide bonds, hydrophobic interaction or other connecting means available to those skilled in the art, wherein such connecting means serves to stabilize said external loop or loops. For example, one may stabilize the AB or C:D loops by connecting the AB loop to one of the helices within the internal region of the molecule.
The N-term:Lnus also may be altered without change in the overall structure of a G-CSF molecule, because the N-terminus does not effect structural stability of the internal helices, and, although the external loops are preferred for modification, the same general statements apply to the N-terminus.
Additionally, such external loops may be the site(s) for chemical modification because in (non-altered) natural or recombinant G-CSF such loops are relatively flexible and tend not to interfere with W O 9411718~ PCTAUS94/009 receptor binding. Thus, there would be additional room for a chemical moiety to be directly attached (or indirectly attached via another chemical moiety which serves as a chemlcal connecting means). The chemical moiety may be selected from a variety of moieties available for modification of one or more function of a G-CSF molecule. For example, an external loop may provide sites for the addition of one or more polymer which serves to increase serum half-life, such as a polyethylene glycol molecule. Such polyethylene glycol molecule(s) may be added wherein said loop is altered to include additional lysines which have reactive side grQ~ps to which polyethylene glycol moieties are capable of attaching. Other classes of chemical moieties may also be attached to one or more external loops, including but not limited to other biologically active molecules, such as receptors, other therapeutic proteins (such as other hematopoietic factors which would engender a hybrid molecule), or cytotoxic agents ~such as diphtheria toxin). This list is of course not complete; one skilled in the art possessed of the desired chemical moiety will have the means to effect attachment of said desired m~iety to the desired external loop. Therefore, another class of the;present G-CSF analogs includes those with at least one alteration in an external loop wherein said alteration provides for the addition of a chemical moiety such as at least one polyethylene glycol molecule.
Deletions, such as deletions of sites recognized by proteins for degradation of the molecule, may also be effectua:L in the external loops. This provides alternative means for increasing half-life of a molecule otherwise having the G-CSF receptor binding and signal transduction capabilities (i.e., the ability to selectively stimulate the maturation of neutrophils).
Therefore, another c:Lass of the present G-CSF analogs CA 02239360 1998-08-0~

W O 94117185 PCTrUS94/00913 includes those with ~t least one alteration in an external loop wherein said alteration decreases the turnover of said analog by proteases. Preferred loops for such alterations are the AB loop and the CD loop.
One may prepare an abbreviated G-CSF molecule by deleting a portion oE the amino acid residues found in the external loops (:Ldentified in more detail below), said abbreviated G-C'iF molecule may have addltional advantages in preparation or in biological function.
Another ex~mple relates to the relative charges between amino acid residues which are in proximity to each other. As noted above, the G-CSF
mo-~-~ule contains a relatively tightly packed four helical bundle. Some of the faces on the helices face other helices. At the point (such as a residue) where a helix faces another helix, the two amino acid moieties which face each other may have the same charge, and thus tend to repel each other, which lends instability to the overall molecule. This may be eliminated by changing the charge (to an opposite charge or a neutral charge) of one or both of the amino acid moieties so that there is no repelling. Therefore, another class of G-CSF
analogs includes those G-CSF analogs having been altered to modify instability due to surface interactions, such as electron charge lccation.
In another aspect, the present invention relates to methods fcr designing G-CSF analogs and related compositions and the products of those methods.
The end products of the methods may be the G-CSF analogs as defined above or related compositions. For instance, the examples disclosed herein demonstrate (a) the effects of changes in the constituents (i.e., chemical moieties) of the G-CSF molecule on the G-CSF structure and (b) the effects of changes in structure on biological function. Essentially, therefore, another CA 02239360 1998-08-0~

WO941171~ PCT~S94/00913 aspect of the presen.t invention is a method for preparing a G-CSF an.alog comprising the steps of:
(a) viewi.ng information conveying the three dimensional structure of a G-CSF molecule wherein the chemical moieties, such as each amino acid residue or each atom of each amino acid residue, of the G-CSF
molecule are correlated with said structure;
~ b) selec:ting from said information a site on a G-CSF molecule for alteration;
(c) prepa.ring a G-CSF analog molecule having such alteration; and (d) opticnally, testing such G-CSF analog mo ~ ule for a desired characteristic.
One may use the here provided computer programs for a computer-based method for preparing a G-CSF analog. Another aspect of the present invention is therefore a computer based method for preparing a G-CSF analog compris.ing the steps of:
(a) providing computer expression of the three dimensional st:ructure of a G-CSF molecule wherein the chemical moietie " such as each amino acid residue or each atom of each amino acid residue, of the G-CSF
molecule are correlaled with said structure;
-~b) selecting from said computer expression a site on a G-CSF molecule for alteration;
(c) preparing a G-CSF molecule having such alteration; and ~ (d) optio:nally, testing such G-CSF molecule for a desired charact:eristic.
More specifically, the present invention provides a method for. preparing a G-CSF analog comprising the steps of:
(a) viewing the three dimensional structure of a G-CSF molecule via a computer, said computer programmed (i) to express the coordinates of a G-CSF
molecule in three dimensional space, and (ii) to allow CA 02239360 1998-08-0~

WO 94/17185 PCTrUS94/00913 for entry of informalion for alteration of said G-CSF
expression and viewing thereof;
(b) selecting a site on said visual image of said G-CSF molecule :Eor alteration;
~c) entering information for said alteration on said computer;
(d) viewing a three dimensional structure of said altered G-CSF molecule via said computer;
te) option~lly repeating steps (a)-(e);
(f) preparing a G-CSF analog with said alteration; and (g) optionally testing said G-CSF analog for a deslred characteristic.
In another aspect, the present invention -relates to methods of using the present G-CSF analogs and related compositions and methods for the treatment or protection of mammals, either alone or in combination with other hematopoietic factors or drugs in the treatment of hematopoietic disorders. It is contemplated that one aspect of designing G-CSF analogs will be the goal of enhancing or modifying the characteristics non-modified G-CSF is known to have.
For example, the present analogs may possess enhanced or---modified activities, so, where G-CSF is useful in the treatment of (for example) neutropenia, the present compositions and methods may also be of such use.
Another example is the modification of G-CSF
for the purpose of interacting more effectively when used in combination with other factors particularly in the treatment of hematopoietic disorders. One example of such combination use is to use an early-acting hematopoietic factor (i.e., a factor which acts earlier in the hematopoiesis cascade on relatively undifferentiated cells) and either simultaneously or in seriatim use of a later-acting hematopoietic factor, CA 02239360 1998-08-0~

WO94117185 PCT~S94/00913 such as G-CSF or analog thereof (as G-CSF acts on the CFU-GM lineage in the selectlve stimulation of neutrophils). The present methods and compositions may be useful in therapy involving such combinations or "cocktails" of hematopoietic factors.
The present compositions and methods may also be useful in the treatment of leukopenia, mylogenous leukemia, severe chronic neutropenia, aplastic anemia, glycogen storage disease, mucosistitis, and other bone marrow failure states. The present compositions and methods may also be useful in the treatment of hematopoietic deficits arising from chemotherapy or from r~tion therapy. ~he success of bone marrow transplantation, or the use of peripheral blood progenitor cells for transplantation, for example, may be enhanced by application of the present compositions (proteins or nucleic acids for gene therapy) and - methods. The presenl~ compositions and methods may also be useful in the trei~tment of infectious diseases, such in the context of wound healing, burn treatment, bacteremia, septicemia, fungal infections, endocarditis, osteopyelitis, infecl:ion related to abdominal trauma, infections not responding to antibiotics, pneumonia and the treatment of baclerial inflammation may als-o benefit from the application of the present compositions and methods. In addition, the present compositions and methods may be usefu:L in the treatment of leukemia based upon a reported ability to differentiate leukemic cells.
Welte et al., PNAS-U'iA 82: 1526-1530 (1985). Other applications include the treatment of individuals with tumors, using the present compositions and methods, optionally in the presence of receptors (such as antibodies) which bind to the tumor cells. For review articles on therapeut:ic applications, see Lieshhke and Burgess, N.Engl.J.Mecl. 327: 28-34 and 99-106 (1992).

CA 02239360 1998-08-0~

WO9411718~ PCT~S94J00913 The present: compositions and methods may also be useful to act as intermediaries in the production of other moleties; for example, G-CSF has been reported to influence the production of other hematopoietic factors and this function (if ascertained~ may be enhanced or modified via the present compositions and/or methods.
The compositions related to the present G-CSF
analogs, such as receptors, may be useful to act as an antagonist which prevents the activity of G-CSF or an analog. One may obtain a composition with some or all of the activity of non-altered G-CSF or a G-CSF analog, and add one or more chemical moieties to alter one or more_properties of su~h G-CSF or analog. With knowledge of the three dimensional conformation, one may forecast the best geographic location for such chemical modification to achieve the desired effect.
General objectives in chemical modification may include improved half-life (such as reduced renal, immunological or celllllar clearance), altered bioactivity (such as ,~ltered enzymatic properties, dissociated bioactivilies or activity in organic solvents), reduced toxicity (such as concealing toxic epitopes, compartment~lization, and selective biodistribution), altered immunoreactivity ~redu~ed immunogenicity, reduced antigenicity or adjuvant action), or altered physical properties ~such as increased solubility, improved thermal stability, improved mechanical st:ability, or conformational stabilization). See Francis, Focus on Growth Factors ~:
4-l0 (May l992)~published by Mediscript, Mountview Court, Friern Barnet I.ane, London N20 OLD, UK).
The examples below are illustrative of the present invention and are not intended as a limitation.
It is understood that variations and modifications will occur to those skilled in the art, and it is intended that the appended clai.ms cover all such equivalent CA 02239360 1998-08-0~

WO 94J1~18~ PCT/US94/00913 variations which come within the scope of the invention as claimed.

r!etailed Description of the Drawings FIGURE 1 is an illustration of the amino acid sequence of the 174 ~mino acid species of G-CSF with an additional N-terminal methionine (Seq. ID No.: 1) (Seq.
ID No.: 2).
FIGURE 2 is an topology diagram of the crystalline structure of G-CSF, as well as hGH, pGH, GM-CSF, INF-B, IL-2, and IL-4. These illustrations are based on inspection of cited references. The length of secopdary structural elements are drawn in proportion to the number of residues. A, B, C, and D helices are labeled according to the scheme used herein for G-CSF.
For INF-~3, the original labeling of helices is indicated in parentheses.
FIGURE 3 is an "ribbon diagram" of the three dimensional structure of G-CSF. Helix A is amino acid residues 11-39 (numbered according to Figure 1, above), helix B is amino acid residues 72-91, helix C is amino acid residues 100-12:3, and helix D is amino acid residues 143-173. The relatively short 310 helix is at amino acid-residues 45-48, and the alpha helix -is at amino acid residues 48-53. Residues 93-95 form almost one turn of a left handed helix.
FIGURE 4 i, a "barrel diagram" of the three dimensional structure of G-CSF. Shown in various shades of gray are the overall cylinders and their orientations for the three dimensional structure of G-CSF. The numbers indicate amino acid residue position according to FIGURE 1 above.
FIGURE 5 i; a list of the coordinates used to generate a computer-aided visual image of the three-dimensional structure of G-CSF. The coordinates are set forth below. The columns correspond to separate field:

CA 02239360 1998-08-0~

WO ~4J1718~ PCT~US94/00913 (i) Field 1 (from the left hand side) is the atom, (ii) Field 2 is the assigned atom number, ~ iii) FieLd 3 is the atom name (accord~ng to the periodic table standard nomenclature, with CB being carbon atom Beta, CG is Carbon atom Gamma, etc.);
(iv) Fielt~ 4 is the residue type (according to three letter nomenclature for amino acids as found in, e.a., Stryer, Biochemistry, 3d Ed., W.H. Freeman and Company, N.Y. 1988, inside back cover);
(v) Fields 5-7 are the x-axis, y-axis and z-axis positions of the atom;
-~q~ (vi) Fielcl 8 (often a "1.00") designates occupancy at that position;
(vii) Field 9 designates the B-factor;
(viii) Field 10 designates the molecule designation. Three molecules (designated a, b, and c) of G-CSF crystallized together as a unit. The designation a, b, or c indicates which coordinates are from which molecule. The number after the letter (1, 2, or 3) indicates the assigned amino acid residue position, with molecule A having assigned positions 10-175, molecule B having asslgned positions 210-375, and molecule C having assigned positions 410-575. These positions were so designated so that there would be no overlap among the three molecules which crystallized together. (The "W" designation indicates water).
FIGURE 6 is a schematic representation of the strategy involved in refining the crystallization matrix for parameters involv~ed in crystallization. The crystallization matrix corresponds to the final concentration of the -omponents (salts, buffers and precipitants) of the crystallization solutions in the wells of a 24 well tissue culture plate. These concentrations are produced by pipetting the appropriate volume of stock solutions into the wells of the CA 02239360 l998-08-0~

WO 94/17185 PCTnUS94/00913 microtiter plate. To design the matrix, the crystallographer decides on an upper and lower concentration of the component. These upper and lower concentrations can be pipetted along either the rows ~e.g., A1-A6, B1-B6, C1-C6 or D1-D6) or along the entire tray (A1-D6). The former method is useful for checking reproducibility of cr-ystal growth of a single component along a limited number of wells, whereas the later method is more useful in initial screening. The results of several stages of refinement of the crystallization matrix are illustrated by a representation of three plates. The increase in shading in the wells indicates a posltive crystallization result which, in the final stages, would be X-ray quality crystals but in the initial stages could be oil droplets, granular precipitates or small crystals approximately less than 0.05 mm in size. Part A represents an initial screen of one parameter in which the range of concentration between the first well (A1) and last well (D6) is large and the concentration increase between wells is calculated as ((concentration A1)-(concentration D6))/23). Part B represents that in later stages of the crystallization matrix refinement of the concentration spread between A1 and D6 would be reduced which-would result in more crystals formed per plate. Part C
indicates a final stage of matrix refinement in which quality crystals are found in most wells of the plate.

Det~ile~ Description ~f the Invention The present invention grows out of the discovery of the three dimensional structure of G-CSF.
This three dimensional structure has been expressed via computer program for stereoscopic viewing. By viewing this stereoscopically, structure-function relationships identified and G-CSF ,~nalogs have been designed and made.

CA 02239360 1998-08-0~

WO94/171~ PCT~S94100913 The OveralL Three Di~ensional Structure of G-CSF
The G-CSF used to ascertain the structure was a non-glycosylated 174 amino acid species having an extra N-terminal methionine residue incident to bacterial expression. The DNA and amino acid sequence of this G-CSF are illustrated in FIGURE 1.
Overall, the three dimensional structure of G-CSF is predominantly helical, with 103 of the 175 residues forming a 4-alpha-helical bundle. The only other secondary structure is found in the loop between the first two long helices where a 4 residue 310 helix is -~mediately followed by a 6 residue alpha helix. As shown in FIGURE 2, the overall structure has been compared with the structure reported for other proteins:
growth hormone tAbdel-Meguid et al., PNAS-USA 84: 6434 (1987) and Vos et al., Science 255: 305-312 (1992)), granulocyte macrophage colony stimulating factor (Diederichs et al., Science 254: 1779-1782 (1991), interferon-~ (Senda et al., EMBO J. 11: 3193-3201 (1992)), interleukin-2 ~McKay Science 257: 1673-1677 (1992)) and interleukin-4 (Powers et al., Science 256:
1673-1677 (1992), and Smith et al., J. Mol. Biol. 224:
899-904 (1992)). Structural similarity among these growth factors occurs despite the absence of similarity in their amino acid sequences.
Presently, the structural information was correlation of G-CSF biochemistry, and this can be CA 02239360 1998-08-0~
WO94117185 PCT~S94/00913 summarized as follows (with sequence position l being at the N-terminus):

5 Sequence Description Posltion of St:ructure Analysis l-lO Extended chain Deletion causes no loss of biological activity Cys l8 Partially buried Reactive with DTNB and Thimersososl but not with iodo-acetate 34 Alternati.ve splice Insertion reduces -- _ site biological activity 20-47 Helix A, first Predicted receptor (inclusive) disulfide and binding region based portion c,f AB helix on neutralizing antibody data 20, 23, 24 Helix A Single alanine mutation of residue(s) reduces biological activity. Predicted ~ receptor binding (Site B).
165-175 Carboxy terminus (inclusive) Deletion reduces biological activity This biochemical information, having been gleaned from antibody binding studies, see Layton et al., Biochemistry 266: 23815-23823 (l99l), was superimposed on the t:hree-dimensional structure in order to design G-CSF analogs. The design, preparation, and testing of these G-CSF analogs is described in Example l below.

F.X~PT.F. 1 This Example describes the preparation of crystalline G-CSF, the visualization of the three dimensional structure of recombinant human G-CSF via CA 02239360 1998-08-0~

WO~411718~ PCT~S94/00913 computer-generated image, the preparation of analogs, using site-directed mutagenesis or nucleic acid amplification method;, the biological assays and HPLC
analysis used to anaLyze the G-CSF analogs, and the resulting determinat:Lon of overall structure/function relationships.

A. Use of Automated Crystallization The need for a three-dimensional structure of recombinant human granulocyte colony stimulating factor (r-hu-G-CSF), and the availability of large quantities of~ e purified protein, led to methods of crystal growth by incomplete factorial sampling and seeding.
Starting with the implementation of incomplete factorial crystallization described by Jancarik and Kim~ J. Appl.
Crystallogr. 2~: 409 (1991) solution conditions that yielded oil droplets and birefringence aggregates were ascertained. Also, software and hardware of an automated pipetting system were modified to produce some 400 different crystallization conditions per day.
Weber, J. Appl. Crystallogr. 20: 366-373 (1987). This procedure led to a crystallization solution which produced r-hu-G-CSF crystals.
The size, reproducibility and quality of the crystals was improved by a seeding method in which the number of "nucleation initiating units" was estimated by serial dilution of a seeding solution. These methods yielded reproducible growth of 2.0 mm r-hu-G-CSF
crystals. The space group of these crystals is P212121 with cell dimensions of a=90 A, b=110 A and c=49 A, and they diffract to a resolution of 2.0 A.
1. Over~ll Methodology To search f'or the crystallizing conditions of a new protein, Carter and Carter, J. Biol. Chem. 254:

WO 94/17185 PCT~US941009 122219-12223 (1979) ~)roposed the lncomplete factorial method. They suggest:ed that a sampling of a large number of randomly selected, but generally probable, crystallizing conditions may lead to a successful combination of reagents that produce protein crystallization. This idea was implemented by Jancarik and Kim, J. Appl. Crystallogr. 24: 409(1991), who described 32 solutions for the initial crystallization trials which cover a range of pH, salts and precipitants. Here we describe an extension of their implementation to an expanded set of 70 solutions. To minimize the human effort and error of solution preparation, the method has been programmed for an automatic pipetting machine.
Following Weber's method of successive automated grid searching (SAGS), J.Cryst. Growth ~:
318-324(1988), the robotic system was used to generate a series of solutions which continually refined the crystallization conditions of temperature, pH, salts and precipitant. Once a solution that could reproducibly grow crystals was determined, a seeding technique which greatly improved the quality of the crystals was developed. When these methods were combined, hundreds of diffraction quality crystals (crystals diffracting to at least about 2.5 Angstroms, preferably having at least portions diffracting to below 2 Angstroms, and more preferably, approximately 1 Angstrom) were produced in a few days.
Generally, the method for crystallization, which may be used with any protein one desires to crystallize, comprises the steps of:
(a) combining aqueous aliquots of the desired protein with either (i) aliquots of a salt solution, each aliquot having a different concentration of salt;
or (ii) aliquots of a precipitant solution, each aliquot having a different concentration of precipitant, CA 02239360 1998-08-0~

WO 94117185 P~r~US94100913 optionally wherein each combined allquot is combined in the presence of a range of pH;
(b) observing said combined aliquots for precrystalline formations, and selecting said salt or precipitant combination and said pH which is efficacious in producing precrystalline forms, or, if no precrystalline forms are so produced, increasing the protein starting concentration of said aqueous aliquots of protein;
(c) after said salt or said precipitant concentration is selected, repeating step (a) with said previously unselected solution in the presence of said se~ ted concentration; and (d) repeating step (b) and step ~a) until a crystal of desired ~lality is obtained.
The above ~method may optionally be automated, which provides vast savings in time and labor.
Preferred protein starting concentrations are between lOmg/ml and 20mg/ml, however this starting concentration will vary with the protein (the G-CSF below was analyzed using 33mg/ml). A preferred range of salt solution to begin analysis with :LS (NaCl) of 0-2.5M. A preferred precipitant is polyet:hylene glycol 8000, however, other precipitants include organic solvents (such as ethanol), polyethylene glycol molecules having a molecular weight in the range of 500-20,000, and other precipitants known to those skilled in t:he art. The preferred pH range is pH 4.5 , 5.0, 5.5, 6 0, 6.5, 7.0, 7.5, 8.0, 8.5, and 9Ø Precrystallization forms include oils, birefringement precipitants, small crystals (< approximately 0.05 mm), medium crystals (approximately 0.5 to .5 mm) and large crystals (> approximately 0.5 mm). The preferred time for waiting to see a crystalline structure is 48 hours, although weekly observation is also preferred, and generally, after about one month, a different protein CA 02239360 1998-08-0~

WO94/17185 PCT~S94/00913 concentration is utilized (generally the protein concentration is increased). Automation is preferred, using the Accuflex s~stem as modified. The preferred automation parameters are described below.
Generally, protein with a concentration between 10 mg/ml and 20 mg/ml was combined with a range of NaCl solutions from 0-2.5 M, and each such combination was performed (separately) in the presence of the above range of concentrations. Once a precrystallization structure is observed, that salt concentration and pH range are optimized in a separate experiment, until the desired crystal quality is ac ~ ved. Next, the precipitant concentration, in the presence of varying levels of pH is also optimized.
When both are optimized, the optimal conditions are performed at once to achieve the desired result (this is diagrammed in FIGUR~ 6).
a. Implementation of an ~utomate~
pipetting system Drops and reservoir solutions were prepared by an Accuflex pipetting system ~ICN Pharmaceuticals, Costa Mesa, CA) which is ccntrolled by a personal computer that sends ASCII codes through a standard serial interface. The pipetter samples six different solutions by means of a rotating valve and pipettes these solutions onto a plate whose translation in a x-y coordinate system can be controlled. The vertical component of the system manipulates a syringe that is capable both of dispensing and retrieving liquid.
The software provided with the Accuflex*was based on the SAGS method as proposed by Cox and Weber, J.Appl. Crystallogr. 20: 366-373 (1987). This method involves the systematic varlation of two major crystallization parameters, pH and precipitant concentration, with provision to vary two others. While * Trade-mark CA 02239360 1998-08-0~

WO94117185 PCT~S94100913 building on these concepts, the software used here provided greater flexibility in the design and implementation of the crystallization solutions used in the automated grid searching strate~y. As a result of this flexibility the present software also created a larger number of difEerent solutions. This is essential for the implementation of the incomplete factorial method as described :Ln that section below.
To improve the speed and design of the automated grid searching strategy, the Accuflex pipetting system re~lired software and hardware modifications. The hardware changes allowed the use of two_different micro-t:iter trays, one used for handing drop and one used for sitting drop experiments, and a Plexiglas tray which held 24 additional buffer, salt and precipitant solutions. These additional solutions expanded the grid of crystallizing conditions that could be surveyed.
To utilize the hardware modifications, the pipetting software was written in two subroutines; one subroutine allows the crystallographer to design a matrix of crystallization solutions based on the concentrations of their components and the second subroutine to translate these concentrations into the computer code which pipettes the proper volumes of the solutions into the crystallization trays. The concentration matrices can be generated by either of two programs. The first program (MRF, available from Amgen, Inc., Thousand Oaks, CA) refers to a list of stock solution concentrations supplied by the crystallographer and calculates the required volume to be pipette to achieve the designated concentration. The second method, which is preferred, incorporates a spread sheet program (Lotus~) which can be used to make more sophisticated gradients of precipitants or pH. The concentration matrix created by either program is * Trade-~ark CA 02239360 1998-08-0~
WO94117185 PCT~S94/00913 interpreted by the control program (SU~, a modification of the program found in the Accufle* pipetter originally and available from A~lgen, Inc., Thousand Oaks, CA) and the wells are filled accordingly.
b. Implementation of the Incomplete Factorial Method The convenience of the modified plpetting system for preparing diverse solutions improved the implementation of an expanded incomplete factorial method. The development of a new set of crystallization solutions having "random" components was generated using the~ ogram INFAC, Carter et al., J.Cryst. Growth 90:
60-73~l988) which produced a list containing 96 random combinations of one factor from three variables.
Combinations of calcium and phosphate which immediately precipitated were eliminated, leaving 70 distinct combinations of precipitants, salts and buffers. These combinations were prepared using the automated pipetter and incubated for l week. The mixtures were inspected and solutions which formed precipitants were prepared again with lower concentrations of their components.
This was repeated until all wells were clear of precipitant.
c. Crystalliz~tion of r-hu-~-CSF
Several different crystallization strategies were used to find a solution which produced x-ray quality crystals. These strategies included the use of the incomplete factorial method, refinement of the crystallization conditions using successive automated grid searches (SAGS), implementation of a seeding technique and development of a crystal production procedure which ylelded hundreds of quality crystals overnight. Unless otherwise noted the screening and production of r-hu-G-CSF crystals utilized the hanging drop vapor diffusion method. Afinsen et al., Physical * Trade-mark CA 02239360 1998-08-0~

WO9411718~ PCT~S94/00913 principles of protein crystallization. In: Eisenberg (ed.), Advances in Protein Chemistry ~ 33 (l99l).
The initial screening for crystallization conditions of r-hu-G-CSF used the Jancarik and Kim, J.Appl.Crystallogr. ~4: 409(1991) incomplete factorial method which resulted in several solutions that produced "precrystallization" results. These results included birefringent precipitants, oils and very small crystals (< .05 mm). These precrystallizations solutions then served as the starting points for systematic screening.
The screening process required the development of crystallizatlon matrices. These matrices corr~sponded to the c~ncentration of the components in the crystallization solutions and were created using the IBM-PC based spread sheet Lotus~ and implemented with the modified Accuflex pipetting system. The strategy in designing the matrice, was to vary one crystallization condition (such as salt concentration) while holding the other conditions such as pH, and precipitant concentration constanl. At the start of screening, the concentration range o:E the varied condition was large but the concentration was successively refined until all wells in the micro-tit:er tray produced the same crystallization result:. These results were scored as follows: crystals, birefringement precipitate, granular precipitate, oil drop]ets and amorphous mass. If the concentration of a crystallization parameter did not produce at least a precipitant, the concentration of that parameter was inc:reased until a precipitant formed.
After each tray was produced, it was left undisturbed for at least two days and then inspected for crystal growth. After this initial screening, the trays were then inspected on a weekly basis.
From this screening process, two independent solutions with the sa~le pH and precipitant but differing in salts (MgCl2, LiSo4, were identified which produced * Trade-mark CA 02239360 1998-08-0~
WO94/1718~ PCT~S94100913 small (0.1 x 0.05 x 0.05 mm) crystals. Based on these results, a new serles of concentration matrices were produced which varied MgCl2 with respect to LiSO4 while keeping the other crystallization parameters constant.
This series of experiments resulted in identification of a solution which produced diffraction quality crystals (> approximately 0.5 mm) in about three weeks. To find this crystallization growth solution (100 mM Mes pH 5.8, 380 mM MgC12, 220 mM LiS04 and 8% PEG 8k) approximately 8,000 conditions had been screened which consumed about 300 mg of protein.
The size of the crystals depended on the nu~ r of crystals forming per drop. Typically 3 to 5 crystals would be formed with average size of (1.0 x 0.7 x 0.7 mm). Two morphologies which had an identical space group (P212121) and unit cell dimensions a=90.2, b=110.2, c=49.5 were obtained depending on whether or not seeding (see below) was implemented. Without seeding, the r-hu-G-~'SF crystals had one long flat surface and rounded edges.
When seeding was employed, crystals with sharp faces were observed :Ln the drop within 4 to 6 hours (0.05 by 0.05 by 0.05 mm). Within 24 hours, crystals had grown to (0.7 by 0.7 by 0.7 mm) and continued to grow beyond 2 mm depending on the number of crystals forming in the drop.
d. See~;ng ~n~ ~etermin~tion of nucle~t;on initiation sites.
The presen~ly provided method for seeding crystals establishes the number of nucleation initiation units in each indiviclual well used (here, after the optimum conditions for growing crystals had been determined). The met:hod here is advantageous in that the number of "seeds" affects the quality of the crystals, and this in turn affects the degree of resolution. The present seeding here also provides CA 02239360 1998-08-0~

WO9~11718~ PCT~S94/~913 advantages in that with seeding, G-CSF crystal grows in a period of about 3 (~ays, whereas without seeding, the growth takes approximately three weeks.
In one series of production growth (see S methods), showers of small but well defined crystals were produced overnight (<0.0l x 0.0l x0.0l mm).
Crystallization cond:itions were followed as described above except that a pipette tip employed in previously had been reused. Presumably, the crystal showering effect was caused by small nucleation units which had formed in the used t:Lp and which provided sites of nucleation for the crystals. Addition of a small amount (0.~ ul) of the drops containing the crystal showers to a new drop under standard production growth conditions resulted in a shower of crystals overnight. This method was used to produce several trays of drops containing crystal showers which we termed i'seed stock".
The number of nucleation initiation units (NIU) contained within the "seed stock" drops was estimated to attempt to improve the reproducibility and quality of the r-hu-(;CSF crystals. To determine the number of NIU in the "seed stock", an al-iquot of the drop was serially diluted along a 96 well microtiter plate. The microtiter plate was prepared by adding 50 ul of a solution containing equal volumes of r-hu-G-CSF
(33 mg/ml) and the crystal growth solution (described above) in each well. An aliquot (3 ul) of one of the "seed stock" drops was transferred to the first well of the microtiter plate. The solution in the well was mixed and 3 ul was then transferred to the next well along the row of the microtiter plate. Each row of the microtiter plate was similarly prepared and the tray was sealed with plastic tape. Overnight, small crystals formed in the bottom of the wells of the microtiter plate and the number of crystals in the wells were correlated to the dilution of the original "seed stock".

CA 02239360 1998-08-0~
WO94/1718~ PCT~S94/00913 To produce large single crystals, the "seed stock" drop was appropriately diluted into fresh CGS and then an aliquot of this solution containing the NIU was transferred to a drop Once cryst:allization conditions had been optimized, crystals were grown in a production method in which 3 ml each of CGS and r-hu-G-CSF (33 mg/ml) were mixed to create 5 trays (each having 24 wells). This method included the production of the refined crystallization solution in liter quantities, mixing this solution with protein and placing the protein/crystallization solution in either hanging drop o~tting drop trays. This process typically yielded 100 to 300 quality crystals (>0.5 mm) in about 5 days.
e. Fxperimental Metho~
M~teri~ls Crystallographic information was obtained starting with r-hu-met-G-CSF with the amino acid sequence as provided in FIGURE 1 with a specific activity of 1.0 +/- 0.6 x 108U/mg (as measured by cell mitogenesis assay in a 10 mM acetate buffer at pH 4.0 (in Water for Injection) at a concentration of approximately 3 mg/ml solution was concentrated with an Amicon concentrator at 75 psi using a YM10 filter. The solution was typically concentrated 10 fold at 4 C and stored for several months.
Initi~l Screening Crystals cuitable for X-ray analysis were obtained by vapor-diffusion equilibrium using hanging drops. For preliminary screening, 7 ul of the protein solution at 33 mg/ml (as prepared above) was mixed with an equal volume of the well solution, placed on siliconized glass plates and suspended over the well solution utilizing Linbro tissue culture plates (Flow Laboratories, McLean, Va). A11 of the pipetting was performed with the Accuflex pipetter, however, trays * Trade-mark CA 02239360 1998-08-0~

W O 94117185 PCT~US94/00913 were removed from the automated pipetter after the well solutions had been created and thoroughly mixed for at least 10 minutes with a table top shaker. The Linbro trays were then returned to the pipetter which added the well and protein solutions to the siliconized cover slips. The cover slips were then inverted and sealed over l ml of the well solutions with silicon grease.
The components of the automated crystallization system are as follows. A PC-DOS*
computer system was used to design a matrix of crystallization solutions based on the concentration of their components. These matrices were produced with ei~r MRE of the Lotus* spread sheet (described above).
The final product of these programs is a data file.
This file contains the information required by the SUX
program to pipette the appropriate volume of the stock solutions to obtain the concentrations described in the - matrices. The SUX program information was passed through a serial I/O port and used to dictate to the Accuflex pipetting system the position of the valve relative to the stock solutions, the amount of solution to be retrieved, and then pipetted into the wells of the microtiter plates and the X-Y position of each well ~the column/row of each well~. Addition information was transmitted to the pipetter which included the Z
position (height) of the syringe during filling as well as the position of a drain where the system pauses to purge the syringe between fillings of different solutions. The 24 well microtiter plate (either Linbr~
or Crysche~ and cover slip holder was placed on a plate which was moved in the X-Y plane. Movement of the plate allowed the pipetter to position the syringe to pipette into the wells. It also positioned the coverslips and vials and extract solutions from these sources. Prior the pipetting, the Linbro microtiter plates had a thin film of grease applied around the edges of the wells.
* ~rade-mark CA 02239360 1998-08-0~

WO!~4tl7185 PCT~S94100913 After the crystalli~ation solutions were prepared in the wells and before they were transferred to the cover slips, the microtiter plate was removed from the pipetting system, ani solutions were allowed to mix on a table top shaker for ten minutes. After mixing, the well solution was either transferred to the cover slips (in the case of the hanging drop protocol) or transferred to the middle post in the well (in the case of the sitting drop ]?rotocol). Protein was extracted from a vial and adde(~ to the coverslip drop containing the well solution (or to the post). Plastic tape was applied to the top of the Cryschem plate to seal the wel-ls.
Pro~uction Growth Once conditions for crystallization had been optimized, crystal growth was performed utilizing a "production" method. The crystallization solution which contained l00 mM Mes pH 5.8, 380 mM MgCl2, 220 mM LiSO4, and 8% PEG 8K was made in l liter quantities. Utilizing an Eppendorf* syringe pipetter, l ml aliquots of this solution were pipetted into each of the wells of the Linbro* plate. A solution containing 50% of this solution and 50% G-CSF (33 mg/ml) was mixed and pipetted onto the slliconized cover slips. Typical volumes of these drops were between 50 and l00 ul and because of the large size of these drops, great care was taken in flipping the coversl:Lps and suspending the drops over the wells.
D~t~ Collection The structure has been refined with X-PLOR*
(Bruniger, X-PLOR ve~sion 3.0, A system for crystallography and ~MR, Yale Vniversity, New Haven CT) against 2.2A data co:Llected on an R-AXIS*(Molecular Structure, Corp. Hou<;ton, TX) imaging plate detector.

* ~rade-~ark CA 02239360 1998-08-0~

WO 94117185 PCTrUS94/00913 f. Observations As an effective recombinant human therapeutic, r-hu-G-CSF has been l~roduced in large quantities and gram levels have been made available for structural analysis. The crystallization methods provided herein are likely to find ot:her applications as other proteins of interest become available. This method can be applied to any crystallographic project which has large quantities of protein (approximately >200 mg). As one skilled in the art will recognize, the present materials and methods may be modified and equivalent materials and methods may be available for crystallization of other proteins.
B. Computer Proaram For Visu~lizing The-Three Dimensional Structure of G-CSF
Although diagrams, such as those in the Figures herein, are useful for visualizing the three dimensional structure of G-CSF, a computer program which allows for stereoscopic viewing of the molecule is contemplated as preferred. This stereoscopic viewing, or "virtual reality" as those in the art sometimes refer to it, allows one to visualize the structure in its three dimensional form from every angle in a wide range of resolution, from macromolecular structure down to the atomic level. The computer programs contemplated herein also allow one to change perspective of the viewing angle of tne molecule, for example by rotating the molecule. The contemplated programs also respond to changes so that one may, for example, delete, add, or substitute one or more images of atoms, including entire amino acid residues, or add chemical moieties to existing or substituted groups, and visualize the change in structure.
Other computer based systems may be used; the elements being: (a) a means for entering information, such as orthogonal coordinates or other numerically CA 02239360 1998-08-0~

W O 9411718~ PCTrUS94/00913 asslgned coordinates of the three dimensional structure of G-CSF; (b) a means for expressing such coordinates, such as visual means so that one may view the three dimensional structure and correlate such three dimensional structure with the composltion of the G-CSF
molecule, such as the amino acid composition; (c) optionally, means for entering information which alters the composition of the G-CSF molecule expressed, so that the image of such three dimensional structure displays the altered composition.
The coordinates for the preferred computer program used are presented in FIGURE 5. The preferred comp~lter program is lnsight II, version 4, available from Biosym in San Diego, CA. For the raw crystallographic structure, the observed intensities of the diffraction data ("F-obs") and the orthogonal coordinates are also deposited in the Protein Data Bank, Chemistry Department, Brookhaven National Laboratory, Upton, New York 119723, USA.
Once the coordinates are entered into the Insight I~ program, cne can easily display the three dimensional G-CSF molecule representation on a computer screen. The preferred computer system for display is Silicon Graphics 320 VGX (San Diego, CA). For stereoscopic viewing, one may wear eyewear (Crystal Eyes, Silicon Graphics) which allows one to visualize the G-CSF molecule in three dimensions stereoscopically, so one may turn the molecule and envision molecular design.
Thus, the present invention provides a method of designing or preparing a G-CSF analog with the aid of a computer comprising:
(a) providing said computer with the means for displaying the three dimensional structure of a G-CSF
molecule including displaying the composition of * Trade-~ark CA 02239360 1998-08-0~
WO9411718~ PCT~S94100913 moieties of said G-CSF molecule, preferably displaying the three dimensional location of each amino acid, and more preferably displaying the three dimensional location of each atom of a G-CSF molecule;
(b) viewing said display;
~c) selecting a site on said display for alteration in the composition of said molecule or the location of a moiety: and (d) preparing ~ G-CSF analog with such alteration.
The alteration may be selected based on the desired structural characteristics of the end-product G-CSF
analog, and considerations for such design are described in-~rre detail below Such considerations include the location and composit:ions of hydrophobic amino acid residues, particular]y residues internal to the helical structures of a G-CSE molecule which residues, when altered, alter the overall structure of the internal core of the molecule and may prevent receptor binding;
the location and compositions of external loop structures, alteration of which may not affect the overall structure of the G-CSF molecule.
FIGURES 2-4 illustrate the overall three dimensional conformation in different ways. The topological diagram, the ribbon diagram, and the barrel diagram all illustrate aspects of the conformation of G-CSF.
FIGURE 2 illustrates a comparison between G-CSF and other molecules. There is a similarity of architecture, although these growth factors differ in the local conformations of their loops and bundle geometrics. The up-up-down-down topology with two long crossover connections is conserved, however, among all six of these molecules, despite the dissimilarity in amino acid sequence.

CA 02239360 1998-08-0~
WO9~117185 PCT~S94/~913 FIGURE 3 illustrates in more detail the secondary structure of recombinant human G-CSF. This ribbon diagram illust:rates the handedness of the helices and their positions relative to each other.
- FIGURE 4 illustrates in a different way the conformation of recombinant human G-CSF. This "barrel"
diagram illustrates the overall architecture of recombinant human G-('SF.
C. Preparation of Analogs Using Ml3 Mutagenesis This example relates to the preparation of G-CSF analogs using site directed mutagenesis techniques in ~ ving the single stranded bacteriophage Ml3, according to methods published in PCT Application No.
WP 85/00817 (Souza et al., published February 28, 1985) This method essentially involves using a single-stranded nucleic acid template of the non-mutagenized sequence, and binding to it a smaller oligonucleotide containing the desired change in the sequence. Hybridization conditions allow for non-identical sequences to hybridize and the remaining sequence is filled in to be identical to the original template. What results is a double stra~ded molec:ule, with one of the two strands containing the desired change. This mutagenized single strand is separated, and used itself as a template for its complementary strand. This creates a double stranded molecule with the desired change.
The origin~l G-CSF nucleic acid sequence used is presented in FIGURE l, and the oligonucleotides containing the mutagenized nucleic acid(s) are presented in Table 2. Abbreviations used herein for amino acid residues and nucleotides are conventional, see Stryer, Biochemistry, 3d Ed., W.H. Freeman and Company, N.Y., N.Y. l988, inside bac:k cover.

CA 02239360 1998-08-0~

WO94/17185 PCT~S94/00913 The original G-CSF nucleic acid sequence was first placed into vector M13mp21. The DNA from single stranded phage M13mp71 containing the original G-CSF
sequence was then isolated, and resuspended in water.
For each reaction, 2()0 ng of this DNA was mixed with a 1.5 pmole of phosphorylated oligonucleotide (Table 2) and suspended in 0.1M Tris, 0.01M MgCl2, 0.005M DTT, 0.lmM ATP, pH 8Ø The DNAs were annealed by heating to 65~C and slowly cooling to room temperature.
Once coole~1, 0.5mM of each ATP, dATP, dCTP, dGTP, TTP, 1 unit of T4 DNA ligase and 1 unit of Klenow fragment of ~. ~Qll polymerase 1 were added to the 1 un-~F~of annealed DNA in 0 .1M Tris, 0.025M NaCl, 0.01M
MgC12, 0.01M DTT, pH 7.5.
The now double stranded, closed circular DNA
was used to transfect E. col; without further purification. Plaques were screened by lifting the plaques with nitroce~lulose filters, and then hybridizing the filters with single stranded DNA end-labeled with p32 for 1 hour at 55-60~C. After hybridization, the filters were washed at 0-3~C below the melt temperature of the oligo (2~C for A-T, 4~C for G-C) which selectively left -autoradiography signals corresponding to plaques with phage containing the mutated sequence. Positive clones were confirmed by sequenclng .
Set forth below are the oligonucleotides used for each G-CSF analog prepared via the M13 mutagenesis method. The nomenclature indicates the residue and the position of the original amino acid (e.g., Lysine at position 17), and the residue and position of the substituted amino acid (e.g., arginine 17). A
substitution involving more than one residue is indicated via superscript notation, with commas between the noted positions or a semicolon indicating different residues. Deletions with no substitutions are so noted.

CA 02239360 1998-08-0~

WO914/17185 PCT~S94/~913 The oligonucleotide sequences used for M13-based mutagenesis are next indicatedi these oligonucleotides were manufactured synthetically, although the method of preparation is not critical, any nucleic acid synthesis method and/or equipment may be used. The length of the oligo is also indicated. As indicated above, these oligos were allowed -o contact the single stranded phage vector, and then sin~le nucleotides were added to complete the G-CSF analog nucleic acid sequence.

-a~
U) ~5 -_, .r. ~ ~1 ~ ~~ ~ ~ ~ ~ ~ ~J N ~ ~ ~J N

,-~

~) V ~ V U ~ O ~ C~ U ~ V

U V ~ E~ V V V V V E~ V ~ E~ V V ~
E~ V E~ V E~ V E~ E~ V V E~ E~ V V E~ V
V E~ V E~VV E~ E~ V V E~ E~ V ~
E~ VE~ ~ V E~ ~ V ~ E~ V
V E~V E~ V E~ E~ V E~
v v v v ~ vv v vv v vv v vv A U V ~ V U V ~ V V V V ~ V V ~ V
V E~ ~ V V E~ ~ V E~ V V ~ V E~ ~ V
u~ ~ V V ~V VE~ V ~ V ~ ~ V ~:
-- V V ~ E~U V ~V U E~ U ~ E~ V ~ E~
u~ V E~ V E~ ~:V E~ ~ V ~
V VE~ E~ VE~ E~ U ~ U V E~ V U
~ v v v ~v vvv v~ u v~: v v~:
V E~ V E~ V E~ E~
- E~ ~ V VE~ ~ UE~ ~ V E~ V V ~ V V
V ~ VE~ V ~ E~ ~ V V ~ V
~: V ~ U VU ~UV ~U V VV ~ VV

A A A A

h A A

u ~n U~ n tn ~n ~ ~n crl ~n ~ cn WO S'4117185 PCTIUS94100913 O ~ ~ ~ ~ u~ ~ r~ ~ a~ o J N N N N N ~\1 t~ N N r~7 ~ ~') t~
a U~

-,t o U
-- ~r ~1 ~ ~ ~ r7 r N N C~ r) N N N
S N N N N N ~ ~rl N t~l ~ N N N ~1 N
C
.~ ' ,, .

U ,¢ ~ ~ ~ ~¢ C) V ~ '¢ ~ (~

~ ~ v ~ o ~ c~ ~ ~ v V C~ ~ ~ ~ E~ V C~
u~

~ ~ ~r o r--z ~ ~ ~ ~ ~ ~ ~ A A A C
,~c ~ ~ ~ ~ ~ ~ A I I I o A

c u~ ~ C C ~ CJ' ~ u~

~ o ~ N t~ ~ u~

-,~
o -c ~ ", ~ ~ ~7 ~ ~ ~) ~r N N N ~ N N N N N N N t~
C;

c ~ ~ E~

R
- ~ O V E~~) V O O E~

U~
~ V (~ C.) U C~
Z ~ V ~ ~ ~ ~ V C~

U~ N ~ N ~ N N
O N N N N
Z ~ ~ ~ ~ A A ~ A ~ ~ A
~ A A A A I I I I A A l I

I L~ ~ 'r O 0 N ~ N ~ ~I r-- N N
C/~ N N N N ~ ~ ~--I ~ ~1 ~ ~ ~1 CA 02239360 l998-08-05 WO 9~4/1718~ PCTAUS94/00913 O
C
h aJ
a) _, X
~r ~ u~ O
h . ~ C, ~ ~
C~l t~ C
o O
o O ~ ~7 C) C~ ~ U~
::~, ~ h --o ~ ~ O
O S
C ~1 ~) t~ o I
C
O ~ --~
C ~ C,O
O ~

h c, E~ _ f ~-) '¢ ~ ~ rC

U C~
z ~ ~ ~ _ ~ a ,~

a~
~ o ~
c ~a h C' o ~ O a, ~ a UJ C~
G I ,~ ,~ C a) ,~ h ~~ ~~ ~ 1~ r~ h :~ a) ~ r~
Z ~ ~ I I ~ 3 o ~) -,i ~ ,~
n I o ~N ~1 :~ J ~ G
U~~ ~ r-~ ~1) C, ~
C~~ ~ ~ C~ o ~ ~:
a~ a) z u. a CA 02239360 1998-08-0~

WO!~4117185 PCT~S94100913 D. Preparation of G-CSF Analogs Using DNA Amplification This example relates to methods for producing G-CSF analogs using ~ DNA amplification technique.
Essentially, DNA encoding each analog was amplified in two separate pieces, combined, and then the total sequence itself amplified. Depending upon where the desired change in the original G-CSF DNA was to be made, internal primers were used to incorporate the change, and generate the two separate amplified pieces. For example, for amplification of the 5' end of the desired analog DNA, a 5' flanking primer (complementary to a _~ .
se~ence of the plasmid upstream from the G-CSF original DNA) was used at one end of the region to be amplified, and an internal primer, capable of hybridizing to the original DNA but incorporating the desired change, was used for priming the other end. The resulting amplified region stretched from the 5' flanking primer through the internal primer. The same was done for the 3' terminus, using a 3' flanking primer (complementary to a sequence of the plasmid downst:ream from the G-CSF original DNA) and an internal primer complementary to the region of the intended mutation. Once the two "halves" ~which may or may not be equal in size, depending on the location of the internal primer) were amplified, the two "halves"
were allowed to connect. Once connected, the 5' flanking primer and t.he 3' flanking primer were used to amplify the entire sequence containing the desired change.
If more th~n one change is desired, the above process may be modified to incorporate the change into the internal primer, or the process may be repeated using a different internal primer. Alternatively, the gene amplification process may be used with other methods for creating changes in nucleic acid sequence, such as the phage bas;ed mutagenesis technique as CA 02239360 l998-08-0 W O S~4/17185 PCTrUS94/009 described above. Examples of process for preparing analogs with more than one change are described below.
To create the G-CSF analogs described below, the template DNA used was the sequence as in FIGURE 1 plus certain flanking regions (from a plasmid containing the G-CSF coding region). These flanking regions were used as the 5' and 3' flanking primers and are set forth below. The amplification reactions were performed in 40 ul volumes containing 10 mM Tris-HCl, 1.5 mM MgC12, 0 50 mM KCl, 0.1 mg/ml gelatin, pH 8.3 at 20~C. The 40 ul reactions also contained 0.lmM of each dNTP, 10 pmoles of each primer, and 1 ng of template DNA. Each am~lification was repeated for 15 cycles. F.ach cycle consisted of 0. 5 minutes at 94~C, 0.5 minutes at 50~C, and 0.75 minutes at 72~C. Flanking primers were 20 nucleotides in length and internal primers were 20 to 25 nucleotides in length. This resulted in multiple copies of double stranded D~A encoding either the front portion or the back portion ~f the desired G-CSF analog.
For combining the two "halves," one fortieth of each of the two reactions was combined in a third DNA
amplification reaction. The two portions were allowed to anneal at the internal primer location, as their ends bearing the_mutation were complementary, and following a cycle of polymerization, give rise to a full length DNA
sequence. Once so annealed, the whole analog was amplified using the 5' and 3' flanking primers. This amplification process was repeated for 15 cycles as described above.
The completed, amplified analog DNA sequence was cleaved with Xba r and XhoI restriction endonuclease to produce cohesive ends for insertion into a vector.
The cleaved DNA was placed into a plasmid vector, and that vector was used to transform F~. 5 ~ .
Transformants were challenged with kanamycin at 50 ug/ml and incubated at 30~('. Production of G-CSF analog CA 02239360 1998-08-0~

W O'14117185 PCTAUS94/00913 protein was confirmed by polyacrylamide gel electrophoresis of a whole cell lysate. The presence of the desired mutation was confirmed by DNA sequence analysis of plasmid purified from the production isolate. Cultures were then grown, and cells were harvested, and the G-CSF analogs were purified as set forth below.
Set forth below in Table 3 are the specific primers used for each analog made using gene amplification.
T~hle 3 g Internal Primer(5'->3') Seq. ID
15His44->Ala44 5'primer-TTCCGGAGCGCACAGTTTG 49 3'primer-CAAACTGTGGGCTCCGGAAGAGC 50 Thr117_~Alall7 s~primer-ATGccAAATTGcAGTAGcAAAG 51 3'primer-CTTTGCTACTGCAATTTGGCAACA 52 Asp110->AlallO 5'primer-ATCAGCTACTGCTAGCTGCAGA 53 3'primer-TCTGCAGCTAGCAGTAGCTGACT 54 Gln21->Ala21 5'primer-TTACGAACCGCTTCCAGACATT 55 253'primer-AATGTCTGGAAGCGGTTCGTAAAAT 56 Aspl13->Ala113 5'primer-GTAGCAAATGCAGCTACATCTA 57 3'primer-TAGATGTAGCTGCATTTGCTACTAC 58 30His53->Ala53 5'primer-CCAAGAGAAGCACCCAGCAG 5g 3'primer-CTGCTGGGTGCTTCTCTTGGGA 60 For each analog, the following 5' flanking primer was used:
5'-CACTGGCGGTGATAATGAGC 61 CA 02239360 1998-08-0~

WO5~4/17185 PCT~S94/00913 (Table 3 con't) For each analog, the following 3' flanking primer was used:
3'-GGTCATTACGGA~CGGATC 62 l. Construction of Double Mutation To make G-CSF analog Glnl2~2l->Glul2~2l two separate DNA amplifications were conducted to create the two DNA mutations. The template DNA used was the sequence as in FIGU~ l plus certain flanking regions (from a plasmid cont~ining the G-CSF coding region).
The-precise sequence, are listed below. Each of the two DNA amplification re~ctions were carried out using a Perkin Elmer/Cetus DNA Thermal Cycler. The 40 ul reaction mix consisted of lX PCR Buffer (Cetus), 0.2 mM
each of the 4 dXTPs (Cetus), 50 pmoles of each primer oligonucleotide, 2 ng of G-CSF template DNA (on a plasmid vector), and l unit of Taq polymerase (Cetus).
The amplification process was carried out for 30 cycles.
Each cycle consisted of lminute at 94~C, 2 minutes at 50~C, and 3 minutes ~t 72~C.
DNA amplification "A" used the oligonucleotides:
5' CCACTGGCGG~GATACTGAGC 3' (Seq. ID 63) and 25 5' AGCAt:AAAGCTTTCCGG~'AG~I-7AAG~AGCAGGA 3' (Seq. ID 64) DNA amplification "B" used the oligonucleotides:

5' GCCGCAAAGC~ GCTGAAATGTCTGGAAGAGGTTCGTAAAATCCAGGGTGA 3 (Seq. ID 65) and 5' CTGGAATGCAGAAGCAAATGCCGGCATAGCACCTTCAGTCGGTTGCAGAGCTGGTGCCA 3 (Seq. ID 66) From the lO9 base pair double stranded DNA
product obtained after DNA amplification "A", a 64 base pair XbaI to HindIII DNA fragment was cut and isolated that contained the DNA mutation Glnl2->Glul2. From the 509 base pair double stranded DNA product obtained after DNA amplification "B", a 197 base pair HindIII to BsmI

* ~rade-mark CA 02239360 1998-08-0~

WO 5~41171~ PCT~S94/~913 DNA fragment was cut and isolated that contained the DNA
mutation Gln21->Glu21.
The "A" and "B" fragments were ligated together with a 4.8 ]cilo-base pair XbaI to BsmI DNA
plasmid vector fragment. The ligation mix consisted of equal molar DNA restriction fragments, ligation buffer (25 mM Tris-HCl pH 7.8, 10 mM MgC12, 2 mM DTT, 0.5 mM
rATP, and 100 ug/ml 13SA) and T4 DNA ligase and was incubated overnight at i4~C. The ligated DNA was then transformed into F. ~Li FM5 cells by electroporati~n using a Bio-Rad Gene Pulser* apparatus (BioRad, Richmond, CA). A clone was lsolated and the plasmid construct ver~-fied to contain 1he two mutations by DNA sequencing.
This 'intermediate' ~Jector also contained a deletion of a 153 base pair BsmI to BsmI DNA fragment. The final plasmid vector was constructed by ligation and transformation (as described above) of DNA fragments obtained by cutting and isolating a 2 kilo-base pair SstI to BamHI DNA fragment from the intermediate vector, a 2.8 kbp SstI to EcoRI DNA fragment from the plasmid vector, and a 360 bp BamHI to EcoRI DNA fragment from the plasmid vector. The final construct was verified by DNA sequencing the G--CSF gene. Cultures were grown, and the cells were harvested, and the G-CSF analogs were purified as set forth below.
As indicated above, any combination of mutagenesis techniques may be used to generate a G-CSF
analog nucleic acid (and expression product) having one or more than one alteration. The two examples above, using M13-based mutagenesis and gene amplification-based mutagenesis, are illustrative.
E. Fxpression of G-CSF An~log DNA
The G-CSF analog DNAs were then placed into a plasmid vector and used to transform E. coli strain FM5 (ATCC#53911). The present G-CSF analog DNAs contained on plasmids and in bacterial host cells are available * Trade-mark CA 02239360 1998-08-0~

WO 9~4117185 PCTIUS94/00913 from the American Type Culture Collection, Rockville, MD, and the accession designations are indicated below.
One liter cultures were grown in broth containing 10g tryptone, 5g yeast extract and 5g NaCl) at 30~C until reaching a density at A600 of 0.5, at which point they were rapiclly heated to 42~C. The flasks were allowed to continue shaking at for three hours.
Other prokaryotic or eukaryotic host cells may also be used, such as other bacterial cells, strains or species, mammalian cells in culture ~COS, CHO or other types) insect cells or multicellular organs or organisms, or plant cells or multicellular organs or org~isms, and a skilled practitioner will recognize the appropriate host. The present G-CSF analogs and related compositions may alsc, be prepared synthetically, as, for example, by solid phase peptide synthesis methods, or other chemical manufacturing techniques. Other cloning and expression systems will be apparent to those skilled in the art.
F. Purification of G-CSF Analog Prote'n Cells were harvested by centrifugation (10,000 x G, 20 minutes, 4~C). The pellet (usually 5 grams) was resuspended in 30 ml of lmM DTT and passed three times through a F~ench press cell at 10,000 psi. The-broken cell suspension was centrifuged at 10,000g for 30 minutes, the supernatant removed, and the pellet resuspended in 30-40 ml water. This was recentrifuged at 10,000 x G for 30 minutes, and this pellet was dissolved in 25 ml of 2% Sarkosyl and 50mM Tris at pH 8.
Copper sulfate was acded to a concentration of 40uM, and the mixture was allowed to stir for at least 15 hours at 15-25~C. The mixture was then centrifuged at 20,000 x G
for 30 minutes. The resultant solubilized protein mixture was diluted four-fold with 13.3 mM Tris, pH 7.7, the Sarkosyl was remcved, and the supernatant was then applied to a DEAE-cellulose (Whatman DE-52~ column * Trad e -n~a rk CA 02239360 l998-08-0 WO 94/17185 PCT~US94tO09 equilibrated in 20mM Tris, pH 7.7. After loading and washing the column with the same buffer, the analogs were eluted with 20mM Tris /NaCl (between 35mM to lOOmM
depending on the analog, as indicated below), pH 7.7.
For most of the analogs, the eluent from the DEAE column was adjusted to a pH of 5.4, with 50% acetic acid and diluted as necessary (to obtain the proper conductivity) with 5mM sodium acetate pH 5.4. The solution was then loaded onto a CM-sepharose* column equilibrated in 20 mM
sodium acetate, pH 5.4. The column was then washed with 20mM NaAc, pH 5.4 until the absorbance at 280 nm was approximately zero. The G-CSF analog was then eluted wit~ sodium acetate/NaCl in concentrations as described below in Table 4. The DEAE column eluents for those analogs not applied to the CM-sepharose*column were dialyzed directly into lOmM NaAc, ph 4.0 buffer. The purified G-CSF analogs were then suitably isolated for vitro analysis. The salt concentrations used for eluting the analogs varied, as noted above. Below, the salt concentrations for the DEAE cellulose column and for the CM-sepharose column are listed:

T~hle 4 S~lt Concentrations Pn~logDF~F Cellulose CM-Sepharose Lysl7->Argl7 35mM 37.5mM
Lys24->Arg24 35mM 37.5mM
Lys35->Arg35 35mM 37.5mM
Lys4l->Arg41 35mM 37.5mM
Lys17,24,3s_ 35mM 37.5mM
>Argl7~24,3s Lysl7,35,41_ 35mM 37.5mM
>Arg17,35,41 * Trade-~ark CA 02239360 1998-08-0~
W0941171~ PCT~S94/00913 T~hle 4 Con't ~n~logDFZ~F, Cellulose CM-Sepharose Lys24,35,41_ 35 37.5mM
>Arg24,35,41 Lys17,24,35,4135mM 37.5mM
->Arg17,24,35,41 Lys17,24,41_ 35 37.5mM
>Arg17,24,41 Gln68->Glu68 60mM 37,5mM
Cys37,43->ser37,43 40mM 37.5mM
Gl ~ ->Ala26 40mM 40mM
Gln~74->Alal74 40mM 40mM
Argl70->Alal70 40mM
Argl67->Alal67 40mM
Deletion 167* N/A N/A
Lys41->Ala41 160mM 40mM
His44->Lys44 40 60mM
GlU47->Ala47 40 40mM
Arg23->Ala23 40mM 40mM
Lys24->Ala24 120mM 40mM
Glu20->Ala2o 40mM 60mM
Asp28->Ala28 40mM 8OmM
Metl27->Glu~27 80mM 40mM
Metl38->Glu138 80mM 40mM
Metl27-->Leu12740mM
Metl38->Leu138 40mM 40mM
Cysl8->Alal8 40mM 37.5mM
Glnl2,21->GlU12,2160mM 37.5mM

Glnl2,21,68_ 60mM 37.5mM
>Glul2,21,68 Glu20->Ala2o;
Serl3 ->Glyl3 40mM 80mM

* Trade-mark CA 02239360 1998-08-0~

WO 94117185 PCT~S94/00913 Table 4 Con't An~lo~ DE~ Cellulose CM-Sepharose Metl27,138_ 40mM 40mM
>Leu127,138 Ser13->Alal3 40 40mM
Lysl7->Alal7 80mM 40mM
Gln121->A1al21 40mM 60mM
Gln21->Ala21 50Gradient 0 -150mM
His44->Ala44** 40mM N/A
His53->Ala53** 50mM N/A
As ~10->Alallo** 40mM N/A
Asp~13->Alall3** 40mM N/A
Thrll7->Alall7** 50mM N/A
Asp28->Ala28; 50mM N/A
AspllO
AlallO**

Glul24->Alal24** 40mM 40mM

* For Deletion 167, the data are unavailable.
** For these analogs, the DEAE cellulose column alone was use for purification.
The above purification methods are illustrative, and a skilled practitioner will recognize that other means are available for obtaining the present G-CSF analogs.
G. Biolocic~l Assays Regardless of which methods were used to create the present G-CSF analogs, the analogs were subject to assays for biological activity. Tritiated thymidine assays were conducted to ascertain the degree of cell division. Other biological assays, however, may be used to ascertain the desired activity. Biological assays such as assaying for the ability to induce terminal differentiation in mouse WEHI-3B (D+) leukemic cell line, also provides indication of G-CSF activity.

* Irade-mark CA 02239360 1998-08-0~

WO~4/17185 PCT~S94/~913 See Nicola, et al., Blood 54: 614-27 (1979). Other 1 vitro assays may be used to ascertain biological activity. See Nicola, Annu. Rev. Biochem. ~: 45-77 (1989). In general, the test for biological activity should provide analysis for the desired result, such as increase or decrease in biological activity (as compared to non-altered G-CSF), different biological activity (as compared to non-altered G-CSF), receptor affinity analysis, or serum half-life analysis. The list is incomplete, and those skilled in the art will recognize other assays useful for testing for the desired end result.
- The 3H-thymidine assay was performed using standard methods. Bone marrow was obtained from sacrificed female Balb C mice. Bone marrow cells were briefly suspended, centrifuged, and resuspended in a growth medium. A 160 ul aliquot containing approximately 10,000 cells was placed into each well of a 96 well micro-titer plate. Samples of the purified G-CSF analog(as prepared above) were added to each well, and incubated for 68 hours. Tritiated thymidine was added to the wells and allowed to incubate for 5 additional hours. After the 5 hour incubation time, the cells were ~arvested, filtered, and thoroughly rinsed.
The filters were added to a vial containing scintillation fluid. The beta emissions were counted (LKB Betaplate*scintillation counter). Standards and analogs were analyzed in triplicate, and samples which fell substantially above or below the standard curve were re-assayed with the proper dilution. The results reported here are the average of the triplicate analog data relative to the unaltered recombinant human G-CSF
standard results.
H. HPTC Analysis High pressure liquid chromatography was performed on purified samples of analog. Although peak * Trade-mark CA 02239360 1998-08-0~
WOg4/17185 PCT~S94/00913 - 5g -position on a reverse phase HPLC column is not a definitive indication of structural similarity between two proteins, analogs which have similar retention times may have th~ same type of hydrophobic interactions with the HPLC column as the non-altered molecule. This is one indication of an overall similar structure.
Samples of the analog and the non-altered recombinant human G-CSF were analyzed on a reverse phase (0.46 x 25 cm) Vydac 214TP54 column (Separations Group, Inc. Hesperia, CA). The purified analog G-CSF samples were prepared in 20 mM acetate and 40 mM NaCl solution buffered at pH 5.2 to a final concentration of 0.1 mg/ml t~S~mg/ml, depending on how the analog performed in the column. Varying amounts (depending on the concentration) were loaded onto the HPLC column, which had been equilibrated with an aqueous solution containing 1% isopropanol, 52.8% acetonitrile, and .38%
trifluoro acetate (TFA). The samples were subjected to a gradient of 0.86%/minute acetonitrile, and .002% TFA.
I. Results Presented below are the results of the above biological assays and HPLC analysis. Biological activity is the average of triplicate data and reported as a percentage of the control standard (non-altered G-CSF). Relative HPLC peak position is the position of the analog G-CSF relative to the control standard (non-altered G-CSF) peak. The "+" or "-" symbols indicate whether the analog HPLC peak was in advance of or followed the control standard peak (in minutes). Not all of the variants had been analyzed for relative HPLC
peak, and only those so analyzed are included below.
Also presented are the American Type Culture Collection designations for E. coli host cells containing the nucleic acids coding for the present analogs, as prepared above.

* Trade-mark WO 9411~185 P~rrUS94100913 ~ ~ ~ ~ o o ~ I 'Z Z Z Z Z Z Z Z Z Z Z Lr) ~ ~
d~

~ ~n ~ r ~ ~ ~ ~ o C~ CO CO C~ ~D :~ a~ ~ a~ ~ a~ a~ o o o lC O ~ ~ ~
a P~
~ x z z z z z z z z z z z + + +
u~

~ ~ ~ ~ O

A A A A N ~1 t~ N ~-- N A ~ A
~--1 ~1 N ~) er ~ ~ N ~I h ~ ~ ~) N

~ N ~ ~ ~ ~ ~I N t'-) a O ~I N (~7 ~ U-1 ~ O

~n W O 94117185 PCTrUS94/00913 O ~ - ' ~ z a~ ~ ~ ~~ ~ ~ ~ Z Z Z Z Z Z Z ~
oP

~ r a7 N ~) ~D t~ ~1 o ~) C~
V O O O ~ o o ~ ~ ~1 ~ ~ ~ a~ o _~_ Y

~n r . ~
V ~a~ u~ Ln ~ ~ a~ o o r ~ ~ ~ ~ ~ O ~ ~
o ~ + I + I + ~ + I I Z Z Z Z Z Z Z +
U~
a~
Q

N ~ a ~ c"
r r ~ r ~ ~ V
r ~ ~ r ~ ~r o c~ ~ ~ ~ ~ ~ ~ I O
0 ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ A ~ ~
C ~ ~ ~ ~ ~ ~ ~ A A ~ A ~ ~ ~ ~¢
O A A A A A A A I I I I A ~ ~ A
~ 1- -,~ I I I I I I r ~ r ~) I ~ ~ I
o ~ ~ ~ ~ r ~ o c~ ~ ~ t~ 0 ~ c~ o ~: a ~ v ~ ~ v D r a~ a~ o ~ ~ ~ ~D r ~~ a~ o ~

H
~ D r co a~ o~ c~ 9 r cn WO 941171~5 PCTIUS94100913 :>
E ~ -~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~
o I -~ ~ ~ r~ ~ o ' N ~ ~ ~

o ~ ~ ~ r ~ ~ ~ ~ ~ o ~_) O~\I ~ ~ ~ ~1 .--1 ~ ~ ~I N
C ) N N ~ N ~1 ~ N ~ N N (~

--~ .Y
a~
~ a~
_ ~ ~ ~ ~ ~ r ~ ~ ~ ~ o r ~ ~ ~ ~ ~ ~ ~
(_) ~1) ~ ~1 ~ N O~1 0 ~ O O f'-+ O+ + + + + + ~ + +

Q
E~
~) o r u~
a) ~ O ~~--A ~ r ~ ~ ~ ~ ~ ~ ~ 0 ~/ ~ ~ N ~ ~ a N
A ~ ~ ~ A
A A I ~ A A I I I A
~ ~ r I I ~ I I I o ~ r I o O ~ ~ ~ r ~ ~ ~ ~ ~ ~ r 0 ~ o >
a ~ o o N ~ o U) ~0 r 0 u~

W O 94/17185 PCTrUS94100913 o S
.C' O .r-o~) -,1 ~ o o ~~
U
S
a~
C
~ a~
O Q, Z ~ U) S
~_,y ~ C
C
-. C4 -~1 ' -- I ~D ~ _ a ~ ~ ~ C r--O . ~ ~ ~ ~ ~ ~
c~ ~ ~o o ~ ~a ~ ~ + +
~n o Q ~ ~ ~
E~ ~ ~ ~ O
A ~ ~ C

E~ C SU

,, A~ ~ ~ C,~5 g N ~ C) ~ S
O ~ C ~) ~7 aJ C a~ ~ ~C
~ ,, C S ~
~ ~ o ~n -a) a ~o a~ o ~ O ~
a~ ~ s 3 ~

CA 02239360 1998-08-0~

W O ~4117185 P~rrUS94100913 1. Identification of Structure-Function Relationships The first step used to design the present analogs was to determine what moieties are necessary for structural integrity of the G-CSF molecule. This was done at the amino acid residue level, although the atomic level is also available for analysis.
Modification of the residues necessar~ for structural integrity results in change in the overall structure of the G-CSF molecule. This may or may not be desirable, depending on the analog one wishes to produce. The working examples here were designed to maintain the ove~ll structural integrity of the G-CSF molecule, for the purpose of maintain G-CSF receptor binding of the analog to the G-CSF receptor (as used in this section below, the "G-CSF receptor" refers to the natural G-CSF
receptor, found on hematopoietic cells). It was ~ assumed, and confirmed by the studies presented here, that G-CSF receptor binding is a necessary step for at 20 least one biological activity, as determined by the above biological assays.
As can be seen from the figures, G-CSF (here, recombinant human met-G-CSF) is an antiparallel 4-alpha helical bundle with a left-handed twist, and with overall dimensions of 95 A x 30A x 24A. The four helices within the bundle are referred to as helices A, B, C and D, and their connecting loops are known as the AB, BC and CD loops. The helix crossing angles range from -167.5~ to -159.4~. Helices A, B, and C are 30 straight, whereas helix D contains two kinds of structural characteristics, at Gly 150 and Ser 160 (of the recombinant human met-G-CSF). Overall, the G-CS~
molecules is a bundle of four helices, connected in series by external loops. This structural information 35 was then correlated with known functional information.
It was known that residues (including methionine at CA 02239360 1998-08-0~

W O 94/17185 P~rAUS94/00913 position 1) 47, 23, 24, 20, 21, 44, 53, 113, 110, 28 and 114 may be modified, and the effect on biological activity would be substantial.
The majority of single mutations which lowered biological activity were centered around two regions of G-CSF that are separated by 30A, and are located on different faces of the four helix bundle. One region involves interactions between the A helix and the D
helix. This is further confirmed by the presence of salt bridges in the non-altered molecule as follows:

Atom Helix Atom Helix Distance Arg~r~0 N1 D Tyr 166 OH A 3.3 Tyr 166 OH D Arg 23 N2 A 3.3 Glu 163 OE1 D Arg 23 N1 A 2.8 Arg 23 N1 A Gln 26 OE1 A 3.1 Gln 159 NE2 D Gln 26 O A 3.3 Distances-reported here were for molecule A, as indicated in FIGURE 5 (wherein three G-CSF molecules crystallized together and were designated as A, B, and C). As can be seen, there is a web of salt bridges between helix A and helix D, which act to stabilize the helix A structure, and therefore affect the overall structure of the G-CSF molecule.
The area centering around residues Glu 20, Arg 23 and Lys 24 are found on the hydrophilic face of the A
helix (residues 20-37). Substitution of the residues with the non-charged alanine residue at positions 20 and 23 resulted in similar HPLC retention times, indicating similarity in structure. Alteration of these sites altered the biological activity ~as indicated by the present assays). Substitution at Lys 24 altered biological activity, but did not result in a similar HPLC retention time as the other two alterations.

CA 02239360 l998-08-0~

W O 94/1718~ PCTrUS94/00913 The second site at which alteration lowered biological activity involves the AB helix. Changing glutamine at position 47 to alanine (analog no. 19, above) reduced biological activity (in the thymidine uptake assay) to zero. The AB helix is predominantly hydrophobic, except at the amino and carboxy termini; it contains one turn of a 310 helix. There are two histidines at each termini ~His 44 and His 56) and an additional glutamate at residue 46 which has the potential to form a salt bridge to His 44. The fourier transformed infra red spectrographic analysis (FTIR) of the analog suggests this analog is structurally similar to~ non-altered recombinant G-CSF molecule. Further testing showed that this analog would not crystallize under the same conditions as the non-altered recombinant molecule.
Alterations at the carboxy terminus (Gln 174, Arg 167 and Arg 170) had little effect on biological activity. In contrast, deletion of the last eight residues (167-175) lowered biological activity. These results may indicate that the deletion destabilizes the overall structure which prevents the mutant from proper binding to the G-CSF receptor (and thus initiating signal trans~duction).
Generally, for the G-CSF internal core -- the internal four helix bundle lacking the external loops --the hydrophobic internal residues are essential for structural integrity. For example, in helix A, the internal hydrophobic residues are (with methionine being position 1) Phe 14, Cys 18, Val 22, Ile 25, Ile 32 and Leu 36. Generally, for the G-CSF internal core -- the internal four helix bundle lacking the external loops --the hydrophobic internal residues are essential for structural integrity. For example, in helix A, the internal hydrophobic residues are (with methionine being position 1 as in FIGURE 1) Phe 14, Cys 18, Val 22, Ile CA 02239360 l998-08-0~

W O 94/17185 PCTrUS94100913 25, Ile 32 and Leu 36. The other hydrophobic residues ~again with the met at position 1) are: helix B, Ala 72, Leu 76, Leu 79, Leu 83, Tyr 86, Leu 90 Leu 93; helix C, Leu 104, Leu 107, Val 111, Ala 114, Ile 118, Met 122;
and helix D, Val 154, Val 158, Phe 161, Val 164, Val 168, Leu 172.
The above biological activity data, from the presently prepared G-CSF analogs, demonstrate that modification of the external loops interfere least with G-CSF overall structure. Preferred loops for analog preparation are the AB loop and the CD loop. The loops are relatively flexible structures as compared to the hellces. The loops may contribute to the proteolysis of the molecule. G-CSF is relatively fast acting in v vo as the purpose the molecule serves is to generate a response to a biological challenge, i.e., selectively stimulate neutrophils. The G-CSF turnover rate is also relatively fast. The flexibility of the loops may provide a "handle" for proteases to attach to the molecule to inactivate the molecule. Modification of the loops to prevent protease degradation, yet have (via retention of the overall structure of non-modified G-CSF) no loss in biological activity may be accomplished.
This phenomenon is probably not limited to the G-CSF molecule but may also be common to the other molecules with known similar overall structures, as presented in Figure 2. Alteration of the external loop of, for example hGH, Interferon B, IL-2, GM-CSF and IL-4 may provide the least change to the overall structure.
The external loops on the GM-CSF molecule are not as flexible as those found on the G-CSF molecule, and this may indicate a longer serum life, consistent with the broader biological activity of GM-CSF. Thus, the external loops of GM-CSF may be modified by releasing the external loops from the beta-sheet structure, which CA 02239360 1998-08-0~

WO~4/17185 PCT~S941~913 may make the loops more flexible ~similar to those G-CSF) and therefore make the molecule more susceptible to protease degradation (and thus lncrease the turnover rate).
Alteration of these external loops may be effected by stabilizing the loops by connection to one or more of the internal helices. Connecting means are known to those in the art, such as the formation of a beta sheet, salt bridge, disulfide bonding or hydrophobic interactions, and other means are available.
Also, deletion of one or more moieties, such as one or more amino acid residues or portions thereof, to prepare an ~ breviated molecule and thus eliminate certain portions of the external loops may be effected.
Thus, by alteration of the external loops, preferably the AB loop (amino acids 58-72 of r-hu-met G-CSF) or the CD loop ~amino acids 119 to 145 of r-hu-met-G-CSF), and less preferably the amino terminus (amino acids 1-10), one may therefore modify the biological function without elimination of G-CSF G-CSF
receptor binding. For example, one may: (1) increase half-life (or prepare an oral dosage form, for example) of the G-CSF molecule by, for example, decreasing the ability of-proteases to act on the G-CSF molecule or adding chemical modifications to the G-CSF molecule, such as one or more polyethylene glycol molecules or enteric coatings for oral formulation which would act to change some characteristic of the G-CSF molecule as described above, such as increasing serum or other half-life or decreasing antigenicity; t2) prepare a hybridmolecule, such as combining G-CSF with part or all of aAother protein such as another cytokine or another protein which effects signal transduction via entry through the cell through a G-CSF G-CSF receptor transport mechanism; or (3) increase the biological activity as in, for example, the ability to selectively CA 02239360 1998-08-0~

WO94117185 PCT~S94/00913 stimulate neutrophils (as compared to a non-modified G-CSF molecule). This list is not limited to the above exemplars.
Another aspect observed from the above data is that stabilizing surface interactions may affect biological activity. This is apparent from comparing analogs 23 and 40. Analog 23 contains a substitution of the charged asparagine residue at position 28 for the neutrally-charged alanine residue in that position, and such substitution resulted in a 50% increase in the biological activity ~as measured by the disclosed thymidine uptake assays). The asparagine residue at po~ on 28 has a surface interaction with the asparagine residue at position 113; both residues being negatively charged, there is a certain amount of instability (due to the repelling of like charged moieties). When, however the asparagine at position 113 is replaced with the neutrally-charged alanine, the biological activity drops to zero (in the present assay system). This indicates that the asparagine at position 113 is critical to biological activity, and elimination of the asparagine at position 28 serves to increase the effect that asparagine at position 113 possesses.
The domains required for G-CSF receptor binding were also determined based on the above analogs prepared and the G-CSF structure. The G-CSF receptor binding domain is located at residues (with methionine being position 1) 11-57 (between the A and AB helix) and 100-118 (between the B and C helices). One may also prepare abbreviated molecules capable of binding to a G-CSF receptor and initiate signal transduction for selectively stimulating neutrophils by changing the external loop structure and having the receptor binding domains remain intact.
Residues essential for biological activity and presumably G-CSF receptor binding or signal transduction CA 02239360 1998-08-0~

W094117185 PCT~S94tO0913 have been identified. Two distinct sites are located on two different regions of the secondary structure. What is here called "Site A" is located on a helix which is constrained by salt bridge contacts between two other members of the helical bundle. The second site, "Site B"
is located on a relatively more flexible helix, AB. The AB helix is potentially more sensitive to local pH
changes because of the type and position of the residues at the carboxy and amino termini. The functional importance of this flexible helix may be important in a conformationally induced fit when binding to the G-CSF
receptor. Additionally, the extended portion of the D
hel-~x is also indicated to be a G-CSF receptor binding domain, as ascertained by direct mutational and indirect comparative protein structure analysis. Deletion of the carboxy terminal end of r-hu-met-G-CSF reduces activity as it does for hGH, ~ee, Cunningham and Wells, Science 244: 1081-1084 (1989). Cytokines which have similar structures, such a-s IL-6 and GM-CSF with predicted similar topology also center their biological activity along the carboxy end of the D helix, see Bazan, Immunology Today ll: 350-354 (l990) A comparison of the structures and the positions o~ G-CSF receptor binding determinant~s between G-CSF and hGH suggests both molecules have similar means of signal transduction. Two separate G-CSF receptor binding sites have been identified for hGH De Vos et al., Science 255: 306-32 (l99l). One of these binding sites (called "Site I") is formed by residues on the exposed faces of hGH's helix l, the connection region between helix l and 2, and helix 4. The second binding site (called "Site II") is formed by surface residues of helix l and helix 3.
The G-CSF receptor binding determinates identified for G-CSF are located in the same relative positions as those identified for hGH. The G-CSF

CA 02239360 1998-08-0~

W O 94117185 PCTrUS94/00913 receptor binding site located in the connecting region between helix A and B on the AB helix (Site A) is similar in position to that reported for a small piece of helix (residues 38-47) of hGH. A single point mutation in the AB helix of G-CSF signiflcantly reduces biological activity (as ascertained in the present assays), indicating the role in a G-CSF receptor-ligand interface. Binding of the G-CSF receptor may destabilize the 310 helical nature of this region and induce a conformation change improving the binding energy of the ligand/G-CSF receptor complex.
In the hGH receptor complex, the first helix of~e bundle donates residues to both of the binding sites required to dimerize the hGH receptor Mutational analysis of the corresponding helix of G-CSF (helix A) has identified three residues which are required for biological activity. Of these three residues, Glu 20 and Arg 24 lie on one face of the helical bundle towards helix C, whereas the side chain of Arg 23 (in two of the three molecules in the asymmetric unit) points to the face of the bundle towards helix D. The position of side chains of these biologically important residues indicates that similar to hGH, G-CSF may have a second G-CSF receptor binding site along the lnterface between helix A and helix C. In contrast with the hGH molecule, the amino terminus of G-CSF has a limited biological role as deletion of the first ll residues has little effect on the biological activity.
As indicated above (see FIGURE 2, for example), G-CSF has a topological similarity with other cytokines. A correlation of the structure with previous biochemical studies, mutational analysis and direct comparison of specific residues of the hGH receptor complex indicates that G-CSF has two receptor binding sites. Site A lies along the interface of the A and D
helices and includes residues in the small AB helix.

CA 02239360 1998-08-0~

WO94/17185 PCT~S94/00913 Site B also includes residues in the A hellx but lies along the interface between helices A and C. The conservation of structure and relative positions of biologically important residues between G-CSF and hGH is one indication of a common method of signal transduction in that the receptor is bound in two places. It is therefore found that G-CSF analogs possessing altered G-CSF receptor binding domains may be prepared by alteration at either of the G-CSF receptor binding sites (residues 20-57 and 145-175).
Knowledge of the three dimensional structure and correlation of the compositlon of G-CSF protein ma~ possible a systematic, rational method for preparing G-CSF analogs. The above working examples have demonstrated that the limitations of the size and polarity of the side chains within the core of the structure dictate how much change the molecule can tolerate before the overall structure is changed.

CA 02239360 l998-08-0~

WO 94117185 PCTrUS94~00913 SEQUENCE LISTING

(1) GENERAL INFORMATION:
(i) APPLICANT: Amgen Inc.
(ii) TITLE OF INVENTION: G-CSF ANALOG COMPOSITIONS AND METHODS
(iii) NUMBER OF SEQUENCES: 110 (iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: Amgen, Inc.
(B) STREET: Amgen Center, 1840 DeHavilland Drive ~C) CITY: Thousand Oaks (D) STATE: California ~E) COUNTRY: United States of America (F) ZIP: 91320-1789 (v) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Floppy disk - _ (B) COMPUTER: IBM PC compati~le (C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: PatentIn Release #1.0, Version #1.25 (vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER:
(B) FILING DATE:
(C) CLASSIFICATION:
(viii) ATTORNEY/AGENT INFORMATION:
(A~ NAME: Peq~in, Karol (B) REGISTRATION NUMBER: 34,899 (ix) TELECOMMUNICATION INFORMATION:
(A) TELEPHONE: 805~499-5725 (B) TELEFAX: 805/499-8011 (2) INFORMATION FOR SEQ ID NO:1:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 565 ba~e pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 30..554 * Trade-mark CA 02239360 1998-08-0~

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:
TCTAGAAAAA ACCAAGGAGG TAATAAATA ATG ACT CCA TTA GGT CCT GCT TCT s 3 Met Thr Pro Leu Gly Pro Ala Ser Ser Leu Pro Gln Ser Phe Leu Leu Lys Cys Leu Glu Gln Val Arg Lys lo 15 20 Ile Gln Gly Asp Gly Ala Ala Leu Gln Glu Lys Leu Cys Ala Thr Tyr Lys Leu Cys His Pro Glu Glu Leu Val Leu Leu Gly His Ser Leu Gly ATC: CCG TGG GCT CCG CTG TCT TCT TGC CCA TCT CAA GCT CTT CAG CTG 245 Ile Pro Trp Ala Pro Leu Ser Ser Cys Pro Ser Gln Ala Leu Gln Leu Ala Gly Cys Leu Ser Gln Leu Hls Ser Gly Leu Phe Leu Tyr Gln Gly Leu Leu Gln Ala Leu Glu Gly Ile Ser Pro Glu Leu Gly Pro Thr Leu 90 95 loo Asp Thr Leu Gln Leu Asp Val Ala Asp Phe Ala Thr Thr Ile Trp Gln Gln Met Glu Glu Leu Gly Met Ala Pro Ala Leu Gln Pro Thr Gln Gly GCT ATG CCG GCA TT~ GCT TCT GCA TTC CAG CGT CGT GCA GGA GGT-GTA 485 Ala Met Pro Ala Phe Ala Ser Ala Phe Gln Arg Arg Ala Gly Gly Val Leu Val Ala Ser His Leu Gln Ser Phe Leu Glu Val Ser Tyr Arg Val Leu Arg His Leu Ala Gln Pro ~2) INFORMATION FOR SEQ ID NO: 2:
~i) SEQUENCE CHARACTERISTICS:
~A) LENGTH: 175 amino acids ~3) TYPE: amino acid ~D) TOPOLOGY: linear CA 02239360 l998-08-0~

WO 94117185 PCTrUS94100913 (ii) MOLECULE TYPE: protein (xi~ SEQUENCE DESCRIPTION- SEQ ID NO:2:
Met Thr Pro Leu Gly Pro Ala Ser Ser Leu Pro Gln Ser Phe Leu Leu ~ys Cys Leu Glu Gln Val Arg Ly9 Ile Gln Gly Asp Gly Ala Ala Leu Gln Glu Lys Leu Cys Ala Thr Tyr Lys Leu Cys His Pro Glu Glu Leu Val Leu Leu Gly His Ser Leu Gly Ile Pro Trp Ala Pro Leu Ser Ser Cy.s Pro Ser Gln Ala Leu Gln Leu Ala Gly Cys Leu Ser Gln Leu His ~ex Gly Leu Phe Leu Tyr Gln Gly Leu Leu Gln Ala Leu Glu Gly Ile ~er Pro G-lu Leu Gly Pro Thr Leu Asp Thr Leu Gln Leu Asp Val Ala Asp Phe Ala Thr Thr Ile Trp Gln Gln Met Glu Glu Leu Gly Met Ala Pro Ala Leu Gln Pro Thr Gln Gly Ala Met Pro Ala Phe Ala Ser Ala Phe Gln Arg Arg Ala Gly Gly Val Leu Val Ala Ser His Leu Gln Ser Phe Leu Glu Val Ser Tyr Arg Val Leu Arg His Leu Ala Gln Pro (2) INFORMATION FOR SEQ ID NO:3:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 24 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:
C~ll~lGCTG CGTTGTCTGG AACA 24 (2) INFORMATION FOR SEQ ID NO:4:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 23 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single CA 02239360 1998-08-0~

WO 94/17185 PCT~US94100913 (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:

(2) INFORMATION FOR SEQ ID NO:5:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 23 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:

(2) INFORMATION FOR SEQ ID NO:6:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 23 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID No:6:

(2) INFORMATION FOR SEQ ID NO:7:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 24 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:
CTTTCTGCTG CGTTGTCTGG AACA _;

(2) INFORMATION FOR SEQ ID NO:8:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 23 base pairs CA 02239360 1998-08-0~

WO 94/17185PCTrUS94/OOgl3 (B~ TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:

(2) INFORMATION FOR SEQ ID NO:9:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 23 base pairs (B) TYPE: nucleic acid -(C) STRANDEDNESS: single ~D) TOPOLOGY: linear ~ii) MOLECULE TYPE: DNA
~xi~ EQUENCE DESCRIPTION: SEQ ID NO:9:

(2) INFORMATION FOR SEQ ID NO:l0:
~i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 24 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:l0:

(2) INFORMATION FOR SEQ ID NO:ll:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 23 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:ll:

CA 02239360 1998-08-0~

WO 94J17185 PCTrUS94/00913 (2~ INFORMATION FOR SEQ ID NO:12:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 23 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single ~D) TOPOLOGY: linear (il~ MOLECULE TYPE: DNA
(xi~ SEQUENCE DESCRIPTION: SEQ ID NO:12:

(2) INFORMATION FOR SEQ ID NO:13:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 24 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single ~ ~D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
~xi) SEQUENCE DESCRIPTION: SEQ ID NO:13:

~2) INFORMATION FOR SEQ ID NO:14:
(i) SEQUENCE CHARACTERISTICS:
~A) LENGTH: 23 base pairs ~B) TYPE: nucleic acid ~C) STRANDEDNESS: single tD) TOPOLOGY: linear ~ii) MOLECUL-E_TYPE: DNA

~xi) SEQUENCE DESCRIPTION: SEQ ID NO:14:
CACTGCAAGA ACGl~L~IGC GCT 23 ~2) INFORMATION FOR SEQ ID NO:15:
~i) SEQUENCE CHARACTERISTICS:
~A) LENGTH: 23 base pairs ~B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA

CA 02239360 l998-08-0~
W O 94/17185PCTrUS94/00913 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:15:
CGCTACTTAC CG'lCTGTGCC ATC 23 (2) INFORMATION FOR SEQ ID NO:16:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 23 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:16:

(2) INFO~M~TION FOR SEQ ID NO:17:
SEQUENCE CHARACTERISTICS:
(A) LENGTH: 23 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:17:

(2) INFORMATION FOR SEQ ID NO:18:
~i) SEQUENCE CHARACTERISTICS:
tA) LENGTH: 23 base pairs tB) TYPE: nucleic acid tC) STRANDEDNESS: single ~D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:18:

(2) INFORMATION FOR SEQ ID NO:l9:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 24 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear CA 02239360 1998-08-0~

WO 94/1718~PCTrUS94100913 (ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:l9:

(2) INFORMATION FOR SEQ ID NO:20:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 23 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:20:

(2) INFORMATION FOR SEQ ID NO:21:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 23 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D~ TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:21:

(2) INFORMATION FOR SEQ ID NO:22:
(i) SEQUENCE CHARACTERISTICS:
~A) LENGTH: 23 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:22:

(2) INFORMATION FOR SEQ ID NO:23:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 23 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single CA 02239360 l998-08-0~

WO ~4l1718~PC~AUS94l00913 (D~ TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:23:

(2) INFORMATION FOR SEQ ID NO:24:
(i) SEQUENCE CHARACTER]:STICS:
(A) LENGTH: 23 base pairs (B) TYPE: nucleic: acid (C) STRANDEDNESS: single (D) TOPOLOGY: li~iear (ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:24:
cTrrGTccATc TGAAGCTCTT CAG 23 (2) INFORMiATION FOR SEQ ID NO:25:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 37 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:25:

(2) INFORMATION FOR SEQ ID NO:26:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 22 base pairs ~B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:26:

(2) INFORMATION FOR SEQ ID NO:27:
(i) SEQUENCE CHARACTERI';TICS:
(A) LENGTH: 22 base pairs (B) TYPE: nucleic acid CA 02239360 1998-08-0~

~C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:27:

(2) INFORMATION FOR SEQ ID NO:28:
(i) SEQUENCE CH2~ACTERI:STICS:
(A) LENGTH: 22 ba.se pairs (B) TYPE: nucleic: acid (C) STRANDEDNESS: single -(D) TOPOLOGY: lin,ear (ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:28:

(2) INFORMATION FOR SEQ ID NO:29:
(i) SEQUENCE CHARACTERI:STICS:
(A) LENGTH: 24 ba.se pairs (B) TYPE: nucleic acid tC) STRANDEDNESS: single ~D) TOPOLOGY: lin.ear ~ii) MOLECULE TYPE: DNA
~xi) SEQUENCE DESCRIPTION: SEQ ID NO:29:
G2~GTATCTT ACGCTGTTCT GCGT 24 _, ~2) INFORMATION FOR SEQ ID No:30:
~i) SEQUENCE CHARACTERI:STICS:
~A) LENGTH: 25 ba.se pairs ~B) TYPE: nucleic: acid ~C) STRANDEDNESS: single ~D) TOPOLOGY: linear ~ii) MOLECULE TYPE: DNA
~xi) SEQUENCE DESCRIPTION: SEQ ID NO:30:

CA 02239360 1998-08-0~

WO 94117185 PCT/US941~0913 - ~3 -(2) INFORMATION FOR SEQ ID NO:31:
(i) SEQUENCE CHARACTrRIST1CS:
tA) LENGTH: 22 ba~e pair~
(B) TYPE: nuclei.c acid (C) STRANDEDNES',: single (D) TOPOLOGY: li.near (ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTI~N: SEQ ID NO:31:

(2) INFORMATION FOR SEQ ID NO:32:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 22 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear ~ ~.MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:32:
CP,AACTGTGC AAGCCGGAAG AG 22 (2) INFORMATION FOR SEQ ID NO:33:
(i) SEQUENCE CHARACTERrSTICS:
(A) LENGTH: 22 b.lse pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTICIN: SEQ ID NO:33:

(2) INFORMATION FOR SEQ ID NO:34:
(i) SEQUENCE CHARACTER]:STICS:
(A) LENGTH: 23 base pairs ~B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:34:

WO ~4117185 PCTrUS94/00913 (2) INFORMATION FOR SEQ ID No:35:
(i) SEQUENCE CHARACTERISTICS:
(A~ LENGTH: 25 base pairs (B~ TYPE: nucleic acid (C) STRANDEDNESS: single (D~ TOPOLOGY: linear MOLECULE TYPE: DNA
~xi~ SEQUENCE DESCRIPTION: SEQ ID NO:35:

(2~ INFORMATION FOR SEQ ID NO:36:
~i) SEQUENCE CHARACTER::STICS:
~A) LENGTH: 22 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS:: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTICN: SEQ ID No:36:

(21 INFORMATION FOR SEQ ID NO:37:
~i) SEQUENCE CHARACTER]:STICS:
(A) LENGTH: l9 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear ~ii) MOLECULE TYPE: DNA
~xi~ SEQUENCE DESCRIPTION: SEQ ID NO:37:
TCCAGGGTGC CGGTGCTGC l9 (21 INFORMATION FOR SEQ ID NC):3B:
(i~ SEQUENCE CHARACTERISTICS:
(A) LENGTH: 23 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID No:33:
AAt;AGCTCGG TGAGGCACCA GCT 23 CA 02239360 1998-08-0~
WO 94/17185 PC'r~US94100913 _ ~5 _ (~2) INFORMATION FOR SEQ ID NO:39:
(i) SEQUENCE CHARACTERISTICS:
tA) LENGTH: 23 base pairs (B) TYPE: nuclei~ acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:39:

(2) INFORMATION FOR SEQ ID NO:40:
(i) SEQUENCE CHARACTER::STICS:
(A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single ~ , (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:40:

(2'l INFORMATION FOR SEQ ID NO:41.
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 21 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTIOI~: SEQ ID NO:41:

(2) INFORMATION FOR SEQ ID NO:42:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 23 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA

(xi) SEQUEN OE DESCRIPTION: SEQ ID NO:42:

(2'~ INFORMATION FOR SEQ ID NO:43:
~i) SEQUENCE CHARACTER]:STICS:
(A) LENGTH: 24 baqe pairs (B) TYPE: nucleic: acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
~xi) SEQUENCE DESCRIPTION: SEQ ID NO:43:

(2) INFORMATION FOR SEQ ID NO:44:
~i) SEQUENCE CHARACTERISTICS:
-~~~' tA) LENGTH: 24 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:44:

(2) INFORMATION FOR SEQ ID NO:45:
(i) SEQUENCE CHARACTERTSTICS:
(A) LENGTH: 21 base pairs (B) TYPE: nucleic acid (C) S~RANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTIO:N: SEQ ID NO:45:
CACiATGGAAG CGCTCGGTAT G 21 (2) INFORMATION FOR SEQ ID NC:46:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA

CA 02239360 1998-08-0~

WO !~4/17185PCTJUS94/00913 (xi~ SEQUENCE DESCRIPTION: SEQ ID NO:46:

~2'1 INFORMATION FOR SEQ ID NO:47:
(i) SEQUENCE CHARACTER~STICS:
(A) LENGTH: 21 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: slngle (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:47:

(2) INFORM TION FOR SEQ ID No:48:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 22 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: lin,-ar (ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTIO~I: SEQ ID NO:48:

(2) INFORMATION FOR SEQ ID NO:49:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 19 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:49:

(2) INFORMATION FOR SEQ ID NO:50:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 23 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear CA 02239360 l998-08-0~
WO ~411~185PCr/US941~0913 ~ii) MOLECULE TYPE: DNA
(xi) SEQVENCE DESCRIPTION: SEQ ID NO:50:

(2) INFORMATION FOR SEQ ID NO:51:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 22 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:51:
ATCiCCAAATT GCAGTAGCAA AG 22 (2) INFORMATION FOR SEQ ID NO:52:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 24 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:52:

(2) INFORMATION FOR SEQ ID NO:53:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 22 baqe pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:53:

(2) INFORMATION FOR SEQ ID NO:54:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 23 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: sin~le (D) TOPOLOGY: linear CA 02239360 1998-08-0;i W O 9-1117185Pcrrusg4/00g13 ~ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:54:

(2) INFORMATION FOR SEQ ID NO:55:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 22 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:55:

__ (2) INFOR~ATION FOR SEQ ID NO:56:
(i) SEQUENCE CHARACTERI!iTICS:
(A) LENGTH: 25 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:56:
TAA~ATGCTT GGCGAAGGTC TGTAA 25 (2) INFORMATION FOR SEQ ID NO:57:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 22 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: sin~le (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:57:

(2) INFORMATION FOR SEQ ID NO:58:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 25 base pairs (B) TYPE: nucleic acid CA 02239360 1998-08-0~
WO '~4/17185 PCTtUS94/00913 (C~ STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTIC)N: SEQ ID NO:58:

(2) INFORMATION FOR SEQ ID NO:5g:
(i) SEQUENCE CHARACTER:tSTICS:
(A) LENGTH: 20 base pairs (~) TYPE: nucleic acld (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA

(xi~ EQUENCE DESCRIPTION: SEQ ID NO:59:
C~AA~A~AAG CACCCAGCAG 20 ~2) INFORMATION FOR SEQ ID No:60:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 22 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:60:

(2) INFORMATION FOR SEQ ID NO:61:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:61:

CA 02239360 1998-08-0~

W O 94/17185 PCTrUS94100913 (2) INFORMATION FOR SEQ ID NO:62:
(i) SEQUENCE CHARACTERISTICS:
tA) LENGTH: l9 base pairs (B) TYPE: nuclei.c acid (C) STRANDEDNES'i: single (D) TOPOLOGY: li.near (ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:62:
CTAGGCCAGG CATTACTGG l9 ~2~ INFORMATION FOR SEQ ID NO:63:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 21 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single - _ (D) TOPOLOGY: linear (il) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:63:
CC:ACTGGCGG TGATACTGAG C 2l (2) INFORMATION FOR SEQ ID NO:64:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 33 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTIt)N: SEQ ID NO:64:
ACiCAGAAAGC TTTCCGGCAG AGAAGA~GCA GGA 33 (2) INFORMATION FOR SEQ ID NO:65:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 54 base pairs (B) TYPE: nuclei,- acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:65:
GCCGCAAAGC TTTCTGCTGA AATGTCTGGA AGAGGTTCGT AAAATCCAGG GTGA ~;

CA 02239360 l998-08-0~

WO 94~17185 PCT/US94/00913 ~2) INFORMATION FOR SEQ ID NO:66:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 59 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear ~ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:66:

(2) INFORMATION FOR SEQ ID No:67:
(i) SEQUENCE CHARACTERISTICS:
(A~ LENGTH: 175 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear ,__ (li) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:67:
Met Thr Pro Leu Gly Pro Ala Ser Ser Leu Pro Gln Ser Phe Leu Leu ~rg Cys Leu Glu Gln Val Arg Lys Ile Gln Gly Asp Gly Ala Ala Leu ~ln Glu Lys Leu Cys Ala Thr Tyr Lys Leu Cys His Pro Glu Glu Leu Val Leu Leu Gly His Ser Leu Gly Ile Pro Trp Ala Pro Leu Ser Ser Cys Pro Ser Gln Ala Leu Gln Leu Ala Gly Cys Leu Ser Gln Leu His ~_ 70 75 - 80 ~er Gly Leu Phe Leu Tyr Gln Gly Leu Leu Gln Ala Leu Glu Gly Ile g5 ~er Pro Glu Leu Gly Pro Thr Leu Asp Thr Leu Gln Leu Asp Val Ala Asp Phe Ala Thr Thr Ile Trp Gln Gln Met Glu Glu Leu Gly Met Ala Pro Ala Leu Gln Pro Thr Gln Gly Ala Met Pro Ala Phe Ala Ser Ala Phe Gln Arg Arg Ala Gly Gly Val Leu Val Ala Ser His Leu Gln Ser Phe Leu Glu Val Ser Tyr Arg Val Leu Arg His Leu Ala Gln Pro CA 02239360 1998-08-0~

WO 94/1718~ PCTruS94/00913 (2) INFORMATION FOR SEQ ID NO:68:
~i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 175 amino acids ~B) TYPE: amino acid (D) TOPOLOGY: llnear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:68:
Met Thr Pro Leu Gly Pro Ala Ser Ser Leu Pro Gln Ser Phe Leu Leu 1 5 10 lS
~ys Cys Leu Glu Gln Val Arg Arg Ile Gln Gly Asp Gly Ala Ala Leu Gln Glu Lys Leu Cys Ala Thr Tyr Lys Leu Cys His Pro Glu Glu Leu Val Leu Leu Gly His Ser Leu Gly Ile Pro Trp Ala Pro Leu Ser Ser -5~' 55 60 Cys Pro Ser Gln Ala Leu Gln Leu Ala Gly Cys Leu Ser Gln Leu His ~ 75 80 ~er Gly Leu Phe Leu Tyr Gln Gly Leu Leu Gln Ala Leu Glu Gly Ile ~er Pro Glu Leu Gly Pro Thr Leu Asp Thr Leu Gln Leu Asp Val Ala Asp Phe Ala Thr Thr Ile Trp Gln Gln Met Glu Glu Leu Gly Met Ala Pro Ala Leu Gln Pro Thr Gln Gly Ala Met Pro Ala Phe Ala Ser Ala Phe Gln Arg Arg Ala Gly Gly Val Leu Val Ala Ser His Leu Gln Ser Phe Leu Glu Val Ser Tyr Arg Val Leu Arg His Leu Ala Gln Pro (2) INFORMATION FOR SEQ ID NO:69:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 17S amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear tii) MOLECULE TYPE: protein CA 02239360 l998-08-0~

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:69:
Met Thr Pro Leu Gly Pro Ala Ser Ser Leu Pro Gln Ser Phe Leu Leu Lys Cys Leu Glu Gln Val Arg Lys Ile Gln Gly Asp Gly Ala Ala Leu Gln Glu Arg Leu Cys Ala Thr Tyr Lys Leu Cys His Pro Glu Glu Leu Val Leu Leu Gly His Ser Leu Gly Ile Pro Trp Ala Pro Leu Ser Ser Cyq Pro Ser Gln Ala Leu Gln Leu Ala Gly Cys Leu Ser Gln Leu His Ser Gly Leu Phe Leu Tyr Gln Gly Leu Leu Gln Ala Leu Glu Gly Ile Ser Pro_G~u Leu Gly Pro Thr Leu Asp Thr Leu Gln Leu Asp Val Ala _ 100 105 110 Asp Phe Ala Thr Thr Ile Trp Gln Gln Met Glu Glu Leu Gly Met Ala Pro Ala Leu Gln Pro Thr Gln Gly Ala Met Pro Ala Phe Ala Ser Ala Phe Gln Arg Arg Ala Gly Gly Val Leu Val Ala Ser His Leu Gln Ser Phe Leu Glu Val Ser Tyr Arg Val Leu Arg His Leu Ala Gln Pro (2) INFORMATION FOR SEQ ID NO:70:
~i) SEQUENCE CHARACTERISTICS:
~A~ LENGTH: 175 amino acids ~B~ TYPE: amino acid ~D~ TOPOLOGY: linear ~ii) MOLECULE TYPE: protein ~xi) SEQUENCE DESCRIPTION: SEQ ID NO:70:
Met Thr Pro Leu Gly Pro Ala Ser Ser Leu Pro Gln Ser Phe Leu Leu Lys Cys Leu Glu Gln Val Arg Lys Ile Gln Gly Asp Gly Ala Ala Leu Gln Glu Lys Leu Cys Ala Thr Tyr Arg Leu Cys His Pro Glu Glu Leu Val Leu Leu Gly His Ser Leu Gly Ile Pro Trp Ala Pro Leu Ser Ser CA 02239360 1998-08-0~

O 94~17185 PCTrUS94100913 _ 95 _ Cys Pro Ser Gln Ala Leu Gln Leu Ala Gly Cys Leu Ser Gln Leu Hls Qo ~er Gly Leu Phe Leu Tyr Gln Gly Leu Leu Gln Ala Leu Glu Gly Ile ~er Pro Glu Leu Gly Pro Thr Leu Asp Thr Leu Gln Leu Asp Val Ala Asp Phe Ala Thr Thr Ile Trp Gln Gln Met Glu Glu Leu Gly Met Ala Pro Ala Leu Gln Pro Thr Gln Gly Ala Met Pro Ala Phe Ala Ser Ala Phe Gln Arg Arg Ala Gly Gly Val Leu Val Ala Ser His Leu Gln Ser Phe Leu Glu Val Ser Tyr Arg Val Leu Arg His Leu Ala Gln Pro (2) INFORMATION FOR SEQ ID NO:71:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 175 amino acids (~) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:71:
Met Thr Pro Leu Gly Pro Ala Ser Ser Leu Pro Gln Ser Phe Leu Leu ~rg Cys Leu Glu Gln Val Arg Arg Ile Gln Gly Asp Gly Ala Ala Leu Gln Glu Arg Leu Cys Ala Thr Tyr Lys Leu Cys His Pro Glu Glu Leu Val Leu Leu Gly His Ser Leu Gly Ile Pro Trp Ala Pro Leu Ser Ser Cys Pro Ser Gln Ala Leu Gln Leu Ala Gly Cys Leu Ser Gln Leu His ~0 ~er Gly Leu Phe Leu Tyr Gln Gly Leu Leu Gln Ala Leu Glu Gly Ile ~er Pro Glu Leu Gly Pro Thr Leu Asp Thr Leu Gln Leu Asp Val Ala Asp Phe Ala Thr Thr Ile Trp Gln Gln Met Glu Glu Leu Gly Met Ala CA 02239360 1998-08-0~

WO 941171~5 PCTrUS94/00913 Pro Ala Leu Gln Pro Thr Gln Gly Ala Met Pro Ala Phe Ala Ser Ala Phe Gln Arg Arg Ala Gly Gly Val Leu Val Ala Ser His Leu Gln Ser Phe Leu Glu Val Ser Tyr Arg Val Leu Arg His Leu Ala Gln Pro ~2) INFORMATION FOR SEQ ID NO: 72:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 175 amino acids ~) TYPE: amino acid ~D) TOPOLOGY: linear ~ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 72:
Met Th~~~~o Leu Gly Pro Ala Ser Ser Leu Pro Gln Ser Phe Leu Leu 1 5 lo 15 Arg Cys Leu Glu Gln Val Arg Lys Ile Gln Gly Asp Gly Ala Ala Leu 2s 30 Gln Glu Arg Leu Cys Ala Thr Tyr Arg Leu Cys His Pro Glu Glu Leu Val Leu Leu Gly Hiq Ser Leu Gly Ile Pro Trp Ala Pro Leu Ser Ser Cys Pro Ser Gln Ala Leu Gln Leu Ala Gly Cys Leu Ser Gln Leu His 6s 70 75 80 Ser Gly Leu Phe Leu Tyr Gln Gly Leu Leu Gln Ala Leu Glu Gly Ile go 95 ~er Pro Glu Leu Gly Pro Thr Leu Asp Thr Leu Gln Leu Asp Val Ala Asp Phe Ala Thr Thr Ile Trp Gln Gln Met Glu Glu Leu Gly Met Ala Pro Ala Leu Gln Pro Thr Gln Gly Ala Met Pro Ala Phe Ala Ser Ala Phe Gln Arg Arg Ala Gly Gly Val Leu Val Ala Ser His Leu Gln Ser Phe Leu Glu Val Ser Tyr Arg Val Leu Arg His Leu Ala Gln Pro CA 02239360 l998-08-0~

O 94~17185 PCTAUS94/00913 (~) INFORMATION FOR SEQ ID NO:73:
(i) SEQUENCE CHARACTERIST~CS:
(A) LENGTH: 175 amino acids ~B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:73:
Met Thr Pro Leu Gly Pro Ala Ser Ser Leu Pro Gln Ser Phe Leu Leu ~ys Cys Leu Glu Gln Val Arg Arg Ile Gln Gly Asp Gly Ala Ala Leu Gln Glu Arg Leu Cys Ala Thr Tyr Arg Leu Cys His Pro Glu Glu Leu Val Leu Leu Gly His Ser Leu Gly Ile Pro Trp Ala Pro Leu Ser Ser ~S~~~' 55 60 Cys Pro Ser Gln Ala Leu Gln Leu Ala Gly Cys Leu Ser Gln Leu His ~er Gly Leu Phe Leu Tyr Gln Gly Leu Leu Gln Ala Leu Glu Gly Ile ~er Pro Glu Leu Gly Pro Thr Leu Asp Thr Leu Gln Leu Asp Val Ala Asp Phe Ala Thr Thr Ile Trp Gln Gln Met Glu Glu Leu Gly Met Ala Pro Ala Leu Gln Pro Thr Gln Gly Ala Met Pro Ala Phe Ala Ser Ala Phe Gln Arg Arg Ala Gly Gly Val Leu Val Ala Ser His Leu Gln Ser Phe Leu Glu Val Ser Tyr Arg Val Leu Arg His Leu Ala Gln Pro (2) INFORMATION FOR SEQ ID NO:74:
~i) SEQUENCE CHARACTERISTICS:
~A) LENGTH: 175 amino acids ~B) TYPE: amino acid ~D) TOPOLOGY: linear ~ii) MOLECULE TYPE: protein CA 02239360 l998-08-0~

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:74:
Met Thr Pro Leu Gly Pro Ala Ser Ser Leu Pro Gln Ser Phe Leu Leu ~rg Cys Leu Glu Gln Val Arg Arg Ile Gln Gly Asp Gly Ala Ala Leu Gln Glu Arg Leu Cys Ala Thr Tyr Arg Leu Cys HLs Pro Glu Glu Leu Val Leu Leu Gly HLs Ser Leu Gly Ile Pro Trp Ala Pro Leu Ser Ser Cys Pro Ser Gln Ala Leu Gln Leu Ala Gly Cys Leu Ser Gln Leu His ~er Gly Leu Phe Leu Tyr Gln Gly Leu Leu Gln Ala Leu Glu Gly Ile . 85 90 95 ~er Pro _lu Leu Gly Pro Thr Leu Asp Thr Leu Gln Leu Asp Val Ala Asp Phe Ala Thr Thr Ile Trp Gln Gln Met Glu Glu Leu Gly Met Ala Pro Ala Leu Gln Pro Thr Gln Gly Ala Met Pro Ala Phe Ala Ser Ala Phe Gln Arg Arg Ala Gly Gly Val Leu Val Ala Ser His Leu Gln Ser Phe Leu Glu Val Ser Tyr Arg Val Leu Arg His Leu Ala Gln Pro (2) INFORMATION FOR SEQ ID NO:75:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 175 amino acids (B) TYPE: amino acid ~D~ TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:75:
Met Thr Pro Leu Gly Pro Ala Ser Ser Leu Pro Gln Ser Phe Leu Leu ~rg Cys Leu Glu Gln Val Arg Arg Ile Gln Gly Asp Gly Ala Ala Leu Gln Glu Lys Leu Cys Ala Thr Tyr Arg Leu Cys His Pro Glu Glu Leu CA 02239360 l998-08-0~

WO 94/1718~ PCTrus94100913 _ 99 _ Val Leu Leu Gly His Ser Leu Gly Ile Pro Trp Ala Pro Leu Ser Ser Cys Pro Ser Gln Ala Leu Gln Leu Ala Gly Cys Leu Ser Gln Leu Hls ~er Gly Leu Phe Leu Tyr Gln Gly Leu Leu Gln Ala Leu Glu Gly Ile ~er Pro Glu Leu Gly Pro Thr Leu Asp Thr Leu Gln Leu Asp Val Ala A~p Phe Ala Thr Thr Ile Trp Gln Gln Met Glu Glu Leu Gly Met Ala Pro Ala Leu Gln Pro Thr Gln Gly Ala Met Pro Ala Phe Ala Ser Ala Phe Gln Arg Arg Ala Gly Gly Val Leu Val Ala Ser His Leu Gln Ser Phe Leu~~ Val Ser Tyr Arg Val Leu Arg His Leu Ala Gln Pro (2) INFORMATION FOR SEQ ID NO:76:
(i) SEQUENCE CHARACTERISTICS:
(A~ LENGTH: 175 amino acid~
(B~ TYPE: amino acld (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:76:
Met Thr Pro Leu Gly Pro Ala Ser Ser Leu Pro Gln Ser Phe Leu Leu ~ys Cys Leu Glu Gln Val Arg Lys Ile Gln Gly Asp Gly Ala Ala Leu Gln Glu Ly~ Leu Cys Ala Thr Tyr Lys Leu Cys His Pro Glu Glu Leu Val Leu Leu Gly Hi~ Ser Leu Gly Ile Pro Trp Ala Pro Leu Ser Ser Cy~ Pro Ser Glu Ala Leu Gln Leu Ala Gly Cy9 Leu Ser Gln Leu His ~er Gly Leu Phe Leu Tyr Gln Gly Leu Leu Gln Ala Leu Glu Gly Ile ~er Pro Glu Leu Gly Pro Thr Leu A~p Thr Leu Gln Leu Asp Val Ala Asp Phe Ala Thr Thr Ile Trp Gln Gln Met Glu Glu Leu Gly Met Ala CA 02239360 l998-08-0~

W O 94/17185 PCTrUs94100913 Pro Ala Leu Gln Pro Thr Gln Gly Ala Met Pro Ala Phe Ala Ser Ala Phe Gln Arg Arg Ala Gly Gly Val Leu Val Ala Ser Hls Leu Gln Ser Phe Leu Glu Val Ser Tyr Arg Val Leu Arg His Leu Ala Gln Pro (2) INFORMATION FOR SEQ ID NO:77:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 175 amino acids ~B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein -(2~ SEQUENCE DESCRIPTION: SEQ ID NO:77:
Met Thr Pro Leu Gly Pro Ala Ser Ser Leu Pro Gln Ser Phe Leu Leu Lys Cys Leu Glu Gln Val Arg Lys Ile Gln Gly Asp Gly Ala Ala Leu Gln Glu Lys Leu Ser Ala Thr Tyr Lys Leu Ser His Pro Glu Glu Leu Val Leu Leu Gly His Ser Leu Gly Ile Pro Trp Ala Pro Leu Ser Ser Cys Pro Ser Gln Ala Leu Gln Leu Ala Gly Cys Leu Ser Gln Leu His Ser Gly Leu Phe Leu Tyr Gln Gly Leu Leu Gln Ala Leu Glu Gly Ile Ser Pro Glu Leu Gly Pro Thr Leu Asp Thr Leu Gln Leu Asp Val Ala Asp Phe Ala Thr Thr Ile Trp Gln Gln Met Glu Glu Leu Gly Met Ala Pro Ala Leu Gln Pro Thr Gln Gly Ala Met Pro Ala Phe Ala Ser Ala Phe Gln Arg Arg Ala Gly Gly Val Leu Val Ala Ser His Leu Gln Ser Phe Leu Glu Val Ser Tyr Arg Val Leu Arg His Leu Ala Gln Pro CA 02239360 l998-08-0~

WO 94117185 PCTrus94/00913 (2) INFORMATION FOR SEQ ID NO:78:
~i) SEQUENCE CHARACTERISTICS:
~A) LENGTH: 175 amino acids ~B) TYPE: amino acid ~D~ TOPOLOGY: linear ~ii) MOLECULE TYPE: protein ~xi) SEQUENCE DESCRIPTION: SEQ ID NO:78:
Met Thr Pro Leu Gly Pro Ala Ser Ser Leu Pro Gln Ser Phe Leu Leu ~ys Cys Leu Glu Gln Val Arg Lys Ile Ala Gly Asp Gly Ala Ala Leu Gln Glu Lys Leu Cys Ala Thr Tyr Lys Leu Cys His Pro Glu Glu Leu Val Leu Leu Gly His Ser Leu Gly Ile Pro Trp Ala Pro Leu Ser Ser 5~-- 55 60 Cys Pro Ser Gln Ala Leu Gln Leu Ala Gly Cys Leu Ser Gln Leu His ~5 80 ~er Gly Leu Phe Leu Tyr Gln Gly Leu Leu Gln Ala Leu Glu Gly Ile ~er Pro Glu Leu Gly Pro Thr Leu Asp Thr Leu Gln Leu Asp Val Ala A~p Phe Ala Thr Thr Ile Trp Gln Gln Met Glu Glu Leu Gly Met Ala 115 ' 120 125 Pro Ala Leu Gln Pro Thr Gln Gly Ala Met Pro Ala Phe Ala Ser Ala Phe Gln Arg Arg Ala Gly Gly Val Leu Val Ala Ser His Leu Gln Ser Phe Leu Glu Val Ser Tyr Arg Val Leu Arg Hi~ Leu Ala Gln Pro (2) INFORMATION FOR SEQ ID NO:79:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 175 amino acid~
(B) TYPE: amino acid (D) TOPOLOGY: linear ~ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:79:
Met Thr Pro Leu Gly Pro Ala Ser Ser Leu Pro Gln Ser Phe Leu Leu CA 02239360 l998-08-0~

WO 94/17185 PCTrUS94/00913 Lys Cys Leu Glu Gln Val Arg Lys Ile Gln Gly Asp Gly Ala Ala Leu Gln Glu Lys Leu Cys Ala Thr Tyr Lys Leu Cys His Pro Glu Glu Leu Val Leu Leu Gly His Ser Leu Gly Ile Pro Trp Ala Pro Leu Ser Ser Cys Pro Ser Gln Ala Leu Gln Leu Ala Gly Cys Leu Ser Gln Leu His Ser Gly Leu Phe Leu Tyr Gln Gly Leu Leu Gln Ala Leu Glu Gly Ile Ser Pro Glu Leu Gly Pro Thr Leu Asp Thr Leu Gln Leu Asp Val Ala Asp Phe Ala Thr Thr Ile Trp Gln Gln Met Glu Glu Leu Gly Met Ala __eql15 120 125 Pro Ala Leu Gln ero Thr Gln Gly Ala Met Pro Ala Phe Ala Ser Ala Phe Gln Arg Arg Ala Gly Gly Val Leu Val Ala Ser His Leu Gln Ser Phe Leu Glu Val Ser Tyr Arg Val Leu Arg His Leu Ala Ala Pro (2) INFORMATION FOR SEQ ID NO:80:
ti) SEQUENCE CHARACTERISTICS:
~A~ LENGTH: 175 amino acidc (B) TYPE: amino acid ~D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:80:
Met Thr Pro Leu Gly Pro Ala Ser Ser Leu Pro Gln Ser Phe Leu Leu Lys Cys Leu Glu Gln Val Arg Lys Ile Gln Gly Asp Gly Ala Ala Leu Gln Glu Lys Leu Cys Ala Thr Tyr Lys Leu Cys His Pro Glu Glu Leu Val Leu Leu Gly His Ser Leu Gly Ile Pro Trp Ala Pro Leu Ser Ser Cy~ Pro Ser Gln Ala Leu Gln Leu Ala Gly Cy~ Leu Ser Gln Leu His CA 02239360 l998-08-0~

WO 94117183 PCTrUS94/00913 Ser Gly Leu Phe Leu Tyr Gln Gly Leu Leu Gln Ala Leu Glu Gly Ile 8~ 90 95 Ser Pro Glu Leu Gly Pro Thr Leu Asp Thr Leu Gln Leu Asp Val Ala Asp Phe Ala Thr Thr Ile Trp Gln Gln Met Glu Glu Leu Gly Met Ala Pro Ala Leu Gln Pro Thr Gln Gly Ala Met Pro Ala Phe Ala Ser Ala Phe Gln Arg Arg Ala Gly Gly Val Leu Val Ala Ser His Leu Gln Ser Phe Leu Glu Val Ser Tyr Arg Val Leu Ala His Leu Ala Gln Pro (2) INFORMATION FOR SEQ ID NO:81:
SEQUENCE CHARACTERISTICS:
(A) LENGTH: 175 amino acids (E~ TYPE: amino acid ~D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi~ SEQUENCE DESCRIPTION: SEQ ID NO:81:
Met Thr Pro Leu Gly Pro Ala Ser Ser Leu Pro Gln Ser Phe Leu Leu Lys Cy~ Leu Glu Gln Val Arg Ly~ Ile Gln Gly A~p Gly Ala Ala Leu Gln Glu Lys Leu Cys Ala Thr Tyr Lys Leu Cy~ His Pro Glu Glu Leu Val Leu Leu Gly HiC Ser Leu Gly Ile Pro Trp Ala Pro Leu Ser Ser Cy-~ Pro Ser Gln Ala Leu Gln Leu Ala Gly Cys Leu Ser Gln Leu Hi~
~er Gly Leu Phe Leu Tyr Gln Gly Leu Leu Gln Ala Leu Glu Gly Ile ~er Pro Glu Leu Gly Pro Thr Leu A~p Thr Leu Gln Leu A~p Val Ala Asp Phe Ala Thr Thr Ile Trp Gln Gln Met Glu Glu Leu Gly Met Ala Pro Ala Leu Gln Pro Thr Gln Gly Ala Met Pro Ala Phe Ala Ser Ala CA 02239360 1998-08-0~

WO 94117185 PCTruS94/00913 Phe Gln Arg Arg Ala Gly Gly Val Leu Val Ala Ser His Leu Gln Ser 1~5 150 155 160 Phe Leu Glu Val Ser Tyr Ala Val Leu Arg His Leu Ala Gln Pro (2) INFORMATION FOR SEQ ID NO:82:
(i) SEQUENCE CHARACTERISTICS:
~A) LENGTH: 174 amino acids ~) TYPE: amino acid ~D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:~2:
Met Thr Pro Leu Gly Pro Ala Ser Ser Leu Pro Gln Ser Phe Leu Leu ~ys Cys L~u Glu Gln Val Arg Lys Ile Gln Gly Asp Gly Ala Ala Leu Gln Glu Lys Leu Cys Ala Thr Tyr Lys Leu Cys His Pro Glu Glu Leu Val Leu Leu Gly His Ser Leu Gly Ile Pro Trp Ala Pro Leu Ser Ser Cys Pro Ser Gln Ala Leu Gln Leu Ala Gly Cys Leu Ser Gln Leu His ~er Gly Leu Phe Leu Tyr Gln Gly Leu Leu Gln Ala Leu Glu Gly Ile ~er Pro Glu Leu Gly Pro Thr Leu Asp Thr Leu Gln Leu Asp Val Ala A~p Phe Ala Thr Thr Ile Trp Gln Gln Met Glu Glu Leu Gly Met Ala Pro Ala Leu Gln Pro Thr Gln Gly Ala Met Pro Ala Phe Ala Ser Ala Phe Gln Arg Arg Ala Gly Gly Val Leu Val Ala Ser His Leu Gln Ser Phe Leu Glu Val Ser Tyr Val Leu Arg His Leu Ala Gln Pro (2) INFORMATION FOR SEQ ID NO:83:
~i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 175 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear CA 02239360 l998-08-0~

W O 94/17185 PCTAUS94/OOgl3 (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:83:
Met Thr Pro Leu Gly Pro Ala .;er Ser Leu Pro Gln Ser Phe Leu Leu Lys Cys Leu Glu Gln Val Arg ].ys Ile Gln Gly Asp Gly Ala Ala Leu Gln Glu Lys Leu Cys Ala Thr Tyr Ala Leu Cys His Pro Glu Glu Leu Val Leu Leu Gly His Ser Leu (;ly Ile Pro Trp Ala Pro Leu Ser Ser Cys Pro Ser Gln Ala Leu Gln Ieu Ala Gly Cys Leu Ser Gln Leu His ~e:r Gly Leu Phe Leu Tyr Gln Gly Leu Leu Gln Ala Leu Glu Gly Ile ~e:r Pro G~u Leu Gly Pro Thr Leu Asp Thr Leu Gln Leu Asp Val Ala Asp Phe Ala Thr Thr Ile Trp Gln Gln Met Glu Glu Leu Gly Me~ Ala Pro Ala Leu Gln Pro Thr Gln Gly Ala Met Pro Ala Phe Ala Ser Ala Phe Gln Arg Arg Ala Gly Gly Val Leu Val Ala Ser His Leu Gln Ser 14'i 150 155 160 Phe Leu Glu Val Ser Tyr Arg Val Leu Arg His Leu Ala Gln Pro ~2) INFORMATION FOR SEQ ID NO:84:
ti) SEQUENCE CHARAC.ERISTICS:
~A) LENGTH: 175 amino acids (~) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:84:
Met Thr Pro Leu Gly Pro Ala Ser Ser Leu Pro Gln Ser Phe Leu Leu Lys Cys Leu Glu Gln Val Arg Lys Ile Gln Gly Asp Gly Ala Ala Leu Gln Glu Lys Leu Cys Ala Thr Tyr Lys Leu CyS Lys Pro Glu Glu Leu CA 02239360 1998-08-0~

W O 94117185 PCTrUS94J00913 Val Leu Leu Gly His Ser Leu Gly Ile Pro Trp Ala Pro Leu Ser Ser ~c 60 Cys Pro Ser Gln Ala Leu Gln Leu Ala Gly Cys Leu Ser Gln Leu His ~er Gly Leu Phe Leu Tyr Gln Gly Leu Leu Gln Ala Leu Glu Gly Ile ~er Pro Glu Leu Gly Pro Thr Leu Asp Thr Leu Gln Leu Asp Val Ala A~sp Phe Ala Thr Thr Ile Trp Gln Gln Met Glu Glu Leu Gly Met Ala Pro Ala Leu Gln Pro Thr Gln Gly Ala Met Pro Ala Phe Ala Ser Ala Phe Gln Arg Arg Ala Gly Gly Val Leu Val Ala Ser His Leu Gln Ser 1~15 150 155 160 Phe Leu~ru Val Ser Tyr Arg Val Leu Arg His Leu Ala Gln Pro (2) INFORMATION FOR SEQ ID NO:85:
(i) SEQUENCE CHARACTERISTICS:
(A~ LENGTH: 175 amino acids (8~ TYPE: am~no acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:85:
~et Thr Pro Leu Gly Pro Ala Ser Ser Leu Pro Gln Ser Phe Leu Leu ~ys Cys Leu Glu Gln Val Arg ].ys Ile Gln Gly Asp Gly Ala Ala Leu Gln Glu Lys Leu Cys Ala Thr Tyr Lys Leu Cys His Pro Glu Ala Leu Val Leu Leu Gly His Ser Leu (,ly Ile Pro Trp Ala Pro Leu Ser Ser Cys Pro Ser Gln Ala Leu Gln ].eu Ala Gly Cys Leu Ser Gln Leu His ~er Gly Leu Phe Leu Tyr Gln Gly Leu Leu Gln Ala Leu Glu Gly Ile ~er Pro Glu Leu Gly Pro Thr I.eu Asp Thr Leu Gln Leu A~p Val Ala Asp Phe Ala Thr Thr Ile Trp Gln Gln Met Glu Glu Leu Gly Met Ala Pro Ala Leu Gln Pro Thr Gln Gly Ala Met Pro Ala Phe Ala Ser Ala Phe Gln Arg Arg Ala Gly Gly Val Leu Val Ala Ser His Leu Gln Ser Phe Leu Glu Val Ser Tyr Arg Val Leu Arg His Leu Ala Gln Pro (2) INFORMATION FOR SEQ ID NO:86:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 175 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION SEQ ID NO:86:
Met Thr Pro Leu Gly Pro Ala Ser Ser Leu Pro Gln Ser Phe Leu Leu Lys Cys Leu Glu Gln Val Ala Lys Ile Gln Gly Asp Gly Ala Ala Leu Gln Glu Lys Leu Cys Ala Thr Tyr Lys Leu Cys His Pro Glu Glu Leu Val Leu Leu Gly His Ser Leu Gly Ile Pro Trp Ala Pro Leu Ser Ser Cys Pro Ser Gln Ala Leu Gln Leu Ala Gly Cys Leu Ser Gln Leu His Ser Gly Leu Phe Leu Tyr Gln Gly Leu Leu Gln Ala Leu Glu Gly Ile Ser Pro Glu Leu Gly Pro Thr Leu Asp Thr Leu Gln Leu Asp Val Ala Asp Phe Ala Thr Thr Ile Trp Gln Gln Met Glu Glu Leu Gly Met Ala Pro Ala Leu Gln Pro Thr Gln Gly Ala Met Pro Ala Phe Ala Ser Ala Phe Gln Arg Arg Ala Gly Gly Val Leu Val Ala Ser His Leu Gln Ser Phe Leu Glu Val Ser Tyr Arg Val Leu Arg His Leu Ala Gln Pro CA 02239360 1998-08-0~

W O "4117185 PCTrUS94~00913 ~2~ INFORMATION FOR SEQ ID NO:87:
~i) SEQUENCE CHARACTERISTICS:
~A) LENGTH: 175 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear ~ii) MOLECULE TYPE: protein ~xi) SEQUENCE DESCRIP.ION: SEQ ID NO:87:
Met Thr Pro Leu Gly Pro Ala 'er Ser Leu Pro Gln Ser Phe Leu Leu ~ys Cys Leu Glu Gln Val Arg P.la Ile Gln Gly Asp Gly Ala Ala Leu Gln Glu Lys Leu Cys Ala Thr Iyr Lys Leu Cys His Pro Glu Glu Leu VaL Leu Leu Gly His Ser Leu Gly Ile Pro Trp Ala Pro Leu Ser Ser ~ 55 60 Cy.s Pro Ser Gln Ala Leu Gln Leu Ala Gly Cys Leu Ser Gln Leu His ~e:c Gly Leu Phe Leu Tyr Gln Gly Leu Leu Gln Ala Leu Glu Gly Ile ~e. Pro Glu Leu Gly Pro Thr Leu Asp Thr Leu Gln Leu Aqp Val Ala Asp Phe Ala Thr Thr Ile Trp Gln Gln Met Glu Glu Leu Gly Met Ala Prc~ Ala Leu Gln Pro Thr Gln Gly Ala Met Pro Ala Phe Ala Ser Ala Phe Gln Arg Arg A~a Gly Gly Val Leu Val Ala Ser His Leu Gln Ser 14'i 150 155 160 Phe Leu Glu Val Ser Tyr Arg Val Leu Arg ~is Leu Ala Gln Pro (2) INFORMATION FOR SEQ ID NO:8B:
~i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 175 amino acidq (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein CA 02239360 l998-08-0~

WO 9411718~ PCTAuS94100913 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:88:
Mel: Thr Pro Leu Gly Pro Ala 8er Ser Leu Pro Gln Ser Phe Leu Leu Lys Cys Leu Ala Gln Val Arg Lys Ile Gln Gly Asp Gly Ala Ala Leu Gln Glu Lys Leu Cys Ala Thr Tyr Lys Leu Cys His Pro Glu Glu Leu Va:L Leu Leu Gly His Ser Leu Gly Ile Pro Trp Ala Pro Leu Ser Ser Cys Pro Ser Gln Ala Leu Gln Leu Ala Gly Cys Leu Ser Gln Leu His 6l-i 70 75 80 Sel Gly Leu Phe Leu Tyr Gln Gly Leu Leu Gln Ala Leu Glu Gly Ile Ser Pro Glu Leu Gly Pro Thr Leu Asp Thr Leu Gln Leu Asp Val Ala - _ 100 105 110 Asp Phe Ala Thr Thr Ile Trp Gln Gln Met Glu Glu Leu Gly Met Ala Pro Ala Leu Gln Pro Thr Gln Gly Ala Met Pro Ala Phe Ala Ser Ala ~ Phe Gln Arg Arg Ala Gly Gly Val Leu Val Ala Ser His Leu Gln Ser 14'i 150 155 160 Phe Leu Glu Val Ser Tyr Arg Val Leu Arg His Leu Ala Gln Pro 16g 170 175 ~2~ INFORMATION FOR SEQ ID NO:89:
(i) SEQUENCE CHARACTERISTICS:
~A~ LENGTH: 175 amino acids (B) TYPE: amino acid ~D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein ~xi) SEQUENCE DESCRIPTrON: SEQ ID NO:89:
Met Thr Pro Leu Gly Pro Ala Ser Ser Leu Pro Gln Ser Phe Leu Leu ~. 5 10 15 Lys Cys Leu Glu Gln Val Arg Lys Ile Gln Gly Ala Gly Ala Ala Leu Gln Glu Lys Leu Cys Ala Thr Tyr Lys Leu Cys His Pro Glu Glu Leu Val Leu Leu Gly His Ser Leu Gly Ile Pro Trp Ala Pro Leu Ser Ser CA 02239360 1998-08-0~

WO 94117185 PCTrUS94100913 Cys Pro Ser Gln Ala Leu Gln Leu Ala Gly Cys Leu Ser Gln Leu His 8~
~,er Gly Leu Phe Leu Tyr Gln Gly Leu Leu Gln Ala Leu Glu Gly Ile ~,er Pro Glu Leu Gly Pro Thr Leu Asp Thr Leu Gln Leu Asp Val Ala A.sp Phe Ala Thr Thr Ile Trp Gln Gln Met Glu Glu Leu Gly Met Ala pro Ala Leu Gln Pro Thr Gln Gly Ala Met Pro Ala Phe Ala Ser Ala Phe Gln Arg Arg Ala Gly Gly Val Leu Val Ala Ser His Leu Gln Ser Phe Leu Glu Val Ser Tyr Arg Val Leu Arg His Leu Ala Gln Pro ~;2) INFORMATION FOR SEQ ID NO:90:
~i) SEQUENCE CHARACTERISTICS:
~A) LENGTH: 175 amino acids tB) TYPE: anLLno acid (D) TOPOLOGY:: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:90:
Met Thr Pro Leu Gly Pro Ala Ser Ser Leu Pro Gln Ser Phe Leu Leu 1 5 ~ 10 15 Lys Cys Leu Glu Gln Val Arg Lys Ile Gln Gly Asp Gly Ala Ala Leu G].n Glu Lys Leu Cy~ Ala Thr ryr Lys Leu Cys Hi~ Pro Glu Glu-Leu Val Leu Leu Gly His Ser Leu Gly Ile Pro Trp Ala Pro Leu Ser Ser Cys Pro Ser Gln Ala Leu Gln Leu Ala Gly Cy~ Leu Ser Gln Leu His ~;s 70 75 80 ~e!r Gly Leu Phe Leu Tyr Gln Gly Leu Leu Gln Ala Leu Glu Gly Ile go 95 ~e!r Pro Glu Leu Gly Pro Thr :Leu Asp Thr Leu Gln Leu Acp Val Ala ~sp Phe Ala Thr Thr Ile Trp Gln Gln Met Glu Glu Leu Gly Glu Ala ~ro Ala Leu Gln Pro Thr Gln Gly Ala Met Pro Ala Phe Ala Ser Ala CA 02239360 1998-08-0~

WO 94~17~8~ PCTIUS94100913 Phe Gln Arg Arg Ala Gly Gly Val Leu Val Ala Ser His Leu Gln Ser P'ne Leu Glu Val Ser Tyr Arg Val Leu Arg His Leu Ala Gln Pro (2) INFORMATION FOR SEQ ID NO:91:
(i) SEQUENCE CHARACTERISTICS
(A) LENGTH: 175 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIE'TION: SEQ ID NO:91:
Met Thr Pro Leu Gly Pro Ala Ser Ser Leu Pro Gln Ser Phe Leu Leu ~ys C~ ~u Glu Gln Val Arg Lys Ile Gln Gly Asp Gly Ala Ala Leu GLn Glu Lys Leu Cys Ala Thr Tyr Lys Leu Cys His Pro Glu Glu Leu V.ll Leu Leu Gly His Ser Leu Gly Ile Pro Trp Ala Pro Leu Ser Ser Cys Pro Ser Gln Ala Leu Gln Leu Ala Gly Cy5 Leu Ser Gln Leu His ~er Gly Leu Phe Leu Tyr Gln Gly Leu Leu Gln Ala Leu Glu Gly Ile ~er Pro Glu Leu Gly Pro Thr Leu Asp Thr Leu Gln Leu Asp Val Ala A:;p Phe Ala Thr Thr Ile Trp Gln Gln Met Glu Glu Leu Gly Met Ala Pro Ala Leu Gln Pro Thr Gln Gly Ala Glu Pro Ala Phe Ala Ser Ala Phe Gln Arg Arg Ala Gly Gly Val Leu Val Ala Ser His Leu Gln Ser 1~15 150 155 160 Phe Leu Glu Val Ser Tyr Arg Val Leu Arg His Leu Ala Gln Pro (2) INFORMATION FOR SEQ ID NO:92:
(i) SEQUENCE CHARACTERISTICS:
~A) LENGTH: :L75 amino acids ~B) TYPE: am Lno acid CA 02239360 1998-08-0~

WO ~411718~ PCTrUS94/00913 (D) TOPOLOGY: linear (ii) MOLECULE TYPE: p:otein (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 92:
Met Thr Pro Leu Gly Pro Ala ';er Ser Leu Pro Gln Ser Phe Leu Leu 1 5 lo 15 Lys Cys Leu Glu Gln Val Arg I,ys Ile Gln Gly Asp Gly Ala Ala Leu Gln Glu Lys Leu Cys Ala Thr Tyr Lys Leu Cys His Pro Glu Glu Leu Val Leu Leu Gly His Ser Leu Gly Ile Pro Trp Ala Pro Leu Ser Ser Cys Pro Ser Gln Ala Leu Gln Leu Ala Gly Cys Leu Ser Gln Leu His ~er Gly Leu Phe Leu Tyr Gln Gly Leu Leu Gln Ala Leu Glu Gly Ile ~ 5 90 95 ~er Pro Glu Leu Gly Pro Thr Leu Asp Thr Leu Gln Leu Asp Val Ala loo 105 llo Asp Phe Ala Thr Thr Ile Trp Gln Gln Met Glu Glu Leu Gly Leu Ala Pro Ala Leu Gln Pro Thr Gln Gly Ala Met Pro Ala Phe Ala Ser Ala ~he Gln Arg Arg Ala Gly Gly Val Leu Val Ala Ser His Leu Gln Ser 14'j 150 155 160 Phe Leu Glu Val Ser Tyr Arg Val Leu Arg His Leu Ala Gln Pro 2) INFORMATION FOR SEQ ID NO:93:
(i) SEQUENCE CHARACTE.RISTICS:
(A) LENGTH: 175 amino acids (P) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:93:
Met Thr Pro Leu Gly Pro Ala S~sr Ser Leu Pro Gln Ser Phe Leu Leu :L 5 10 15 Lys Cyc Leu Glu Gln Val Arg Lys Ile Gln Gly Asp Gly Ala Ala Leu CA 02239360 1998-08-0~

WO 941171BS PCT~US94100913 G:Ln Glu Lys Leu Cys Ala Thr Tyr Lys I,~u Cys His Pro Glu Glu Leu Val Leu Leu Gly His Ser Leu Gly Ile :o Trp Ala Pro Leu Ser Ser Cvs Pro Ser Gln Ala Leu Gln Leu Ala Gly Cys Leu Ser Gln Leu His 1;5 70 75 80 Ser Gly Leu Phe Leu Tyr Gln Gly Leu Leu Gln Ala Leu Glu Gly Ile Ser Pro Glu Leu Gly Pro Thr Leu Asp Thr Leu Gln Leu Asp Val Ala Asp Phe Ala Thr Thr Ile Trp Jln Gln Met Glu Glu Leu Gly Met Ala Pro Ala Leu Gln Pro Thr Gln Gly Ala Leu Pro Ala Phe Ala Ser Ala P~,e Gl~ g Arg Ala Gly Gly '~al Leu Val Ala Ser His Leu Gln Ser 14,5 150 155 160 Phe Leu Glu Val Ser Tyr Arg Val Leu Arg Hiis Leu Ala Gln Pro (2) INFORMATION FOR SEQ ID NO: 94:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 175 amino acids ~B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: p:rotein ~xi) SEQUENCE DESCRIPTION: SEQ ID NO: 94:
Met Thr Pro Leu Gly Pro Ala ';er Ser Leu Pro Gln Ser Phe Leu Leu Lys Ala Leu Glu Gln Val Arg I.ys Ile Gln Gly Asp Gly Ala Ala Leu Gln Glu Lys Leu Cys Ala Thr Tyr Lys Leu Cys His Pro Glu Glu Leu Va.l Leu Leu Gly His Ser Leu Gly Ile Pro Trp Ala Pro Leu Ser Ser Cy:3 Pro Ser Gln Ala Leu Gln I.eu Ala Gly Cys Leu Ser Gln Leu His Ser Gly Leu Phe Leu Tyr Gln Gly Leu Leu Gln Ala Leu Glu Gly Ile CA 02239360 l998-08-0;i WO 94tl7185 PCTruS94/00913 Ser Pro Glu Leu Gly Pro Thr Leu Asp Thr Leu Gln Leu Asp Val Ala Asp Phe Ala Thr Thr Ile Trp Giln Gln Met Glu Glu Leu Gly Met Ala Pro Ala Leu Gln Pro Thr Gln Gily Ala Met Pro Ala Phe Ala Ser Ala Phie Gln Arg Arg Ala Gly Gly Val Leu Val Ala Ser His Leu Gln Ser 145 150 . 155 160 Ph.e Leu Glu Val Ser Tyr Arg Val Leu Arg His Leu Ala Gln Pro (2) INFORMATION FOR SEQ ID NO: 95:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 175 amino acids (3) TYPE: amino acid , (D) TOPOLOGY: linear (ii) MOLECULE TYPE: p:otein (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 95:
Met Thr Pro Leu Gly Pro Ala ';er Ser Leu Pro Glu Ser Phe Leu Leu Lys Cys Leu Glu Glu Val Arg I,ys Ile Gln Gly A~p Gly Ala Ala Leu Gln Glu Ly~ Leu Cys Ala Thr Tyr Lys Leu Cys His Pro Glu Glu Leu ' 40 45 Val Leu Leu Gly His Ser Leu Gly Ile Pro Trp Ala Pro Leu Ser Ser Cys Pro Ser Gln A~a Leu Gln I,eu Ala Gly Cys Leu Ser Gln Leu His Ser Gly Leu Phe Leu Tyr Gln Gly Leu Leu Gln Ala Leu Glu Gly Ile Ser Pro Glu Leu Gly Pro Thr Leu Asp Thr Leu Gln Leu Asp Val Ala A'~p Phe Ala Thr Thr Ile Trp Gln Gln Met Glu Glu Leu Gly Met Ala Pro Ala Leu Gln Pro Thr Gln Gly Ala Met Pro Ala Phe Ala Ser Ala Phe Gln Arg Arg Ala Gly Gly Val Leu Val Ala Ser Hi~ Leu Gln Ser 14') 150 155 160 Phe Leu Glu Val Ser Tyr Arg Val Leu Arg His Leu Ala Gln Pro CA 02239360 l998-08-0~

WO 94117185 PCTrUS94/00913 ~2) INFORMATION FOR SEQ ID NO:96:
(i) SEQUENCE CHARACTERISTICS:
~A) LENGTH: 175 amino acids (B) TYPE: a~ino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein ~xi) SEQUENCE DESCRII?TION: SEQ ID NO:96:
Met Thr Pro Leu Gly Pro Ala Ser Ser Leu Pro Glu Ser Phe Leu Leu Lys Cys Leu Glu Glu Val Arg Lys Ile Gln Gly Asp Gly Ala Ala Leu Gln Glu Lys Leu Cys Ala Thr Tyr Lys Leu Cys His Pro Glu Glu Leu Val Le ~ u Gly His Ser Leu Gly Ile Pro Trp Ala Pro Leu Ser Ser 5~_ 55 60 Cys Pro Ser Glu Ala Leu Gln Leu Ala Gly Cys Leu Ser Gln Leu His Ser Gly Leu Phe Leu Tyr Gln Gly Leu Leu Gln Ala Leu Glu Gly Ile Ser Pro Glu Leu Gly Pro Thr Leu Asp Thr Leu Gln Leu A~p Val Ala A~;p Phe Ala Thr Thr Ile Trp Gln Gln Met Glu Glu Leu Gly Met Ala 115 ' 120 125 Pro Ala Leu Gln Pro Thr Gln Gly Ala Met Pro Ala Phe Ala Ser Ala 130 135 lq0 Phe Gln Arg Arg Ala Gly Gly Val Leu Val Ala Ser His Leu Gln Ser Phe Leu Glu Val Ser Tyr Arg Val Leu Arg His Leu Ala Gln Pro (2) INFORMATION FOR SEQ ID NO:97:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 175 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein CA 02239360 l998-08-0~

WO 94/1718~ PCIIUS94/00913 (xi~ SEQUENCE DEscRIprIoN: SEQ ID NO:97:
Met Thr Pro Leu Gly Pro Ala Ser Ser Leu Pro Gln Gly Phe Leu Leu ~ys Cys Leu Ala Gln Val Arg ].ys Ile Gln Gly Asp Gly Ala Ala Leu Gln Glu Lys Leu Cys Ala Thr Tyr Lys Leu Cys His Pro Glu Glu Leu ~ 40 45 Val Leu Leu Gly His Ser Leu C;ly Ile Pro Trp Ala Pro Leu Ser Ser ~ys Pro Ser Gln Ala Leu Gln I,eu Ala Gly Cys Leu Ser Gln Leu His ~er Gly Leu Phe Leu Tyr Gln Gly Leu Leu Gln Ala Leu Glu Gly Ile ~S 90 95 ~e~ Pro Glu Leu Gly Pro Thr L,eu Asp Thr Leu Gln Leu Asp Val Ala Asp Phe Ala Thr Thr Ile Trp Gln Gln Met Glu Glu Leu Gly Met Ala Pro Ala Leu Gln Pro Thr Gln Gly Ala Met Pro Ala Phe Ala Ser Ala Phe Gln Arg Arg Ala Gly Gly Val Leu Val Ala Ser His Leu Gln Ser 14'j 150 155 160 Phe Leu Glu Val Ser Tyr Arg Val Leu Arg His Leu Ala Gln Pro (2) INFORMATION FOR SEQ ID NO:98:
(i) SEQUENCE CHARACTERlSTICS:
(A) LENGTH: 175 amino acids ~B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:98:
Met Thr Pro Leu Gly Pro Ala Ser Ser Leu Pro Gln Ser Phe Leu Leu ]~ 5 10 15 ~ys Cys Leu Glu Gln Val Arg L!JS Ile Gln Gly Asp Gly Ala Ala Leu Gln Glu Lys Leu Cys Ala Thr Tyr Lys Leu Cys His Pro Glu Glu Leu CA 02239360 1998-08-0~

W O 94117185 PCTrUS94100913 Vz,l Leu Leu Gly His Ser Leu Gly Ile Pro Trp Ala Pro Leu Ser Ser Cys Pro Ser Gln Ala Leu Gln Leu Ala Gly Cys Leu Ser Gln Leu His ~iS 70 75 80 Ser Gly Leu Phe Leu Tyr Gln Gly Leu Leu Gln Ala Leu Glu Gly Ile ~5 90 95 Se~r Pro Glu Leu Gly Pro Thr :Leu Asp Thr Leu Gln Leu Asp Val Ala A~,p Phe Ala Thr Thr Ile Trp Gln Gln Met Glu Glu Leu Gly Leu Ala Pro Ala Leu Gln Pro Thr Gln Cily Ala Leu Pro Ala Phe Ala Ser Ala 130 . 135 140 Phe Gln Arg Arg Ala Gly Gly '~al Leu Val Ala Ser His Leu Gln Ser Ph.e Leu~ u Val Ser Tyr Arg Val Leu Arg His Leu Ala Gln Pro (2) ''.FORMATION FOR SEQ ID NO:99:
~i~ SEQUENCE CHARACTERISTICS:
(A~ LENGTH: 175 amino acids (B~ TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: p:cotein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:99:
Met Thr Pro Leu Gly Pro Ala 'ier Ser Leu Pro Gln Ala Phe Leu Leu Lys Cys Leu Glu Gln Val Arg I,ys Ile Gln Gly Asp Gly Ala Ala Leu Gln Glu Lys Leu Cyq Ala Thr Tyr Lyq Leu Cy~ Hiq Pro Glu Glu Leu Val Leu Leu Gly His Ser Leu C;ly Ile Pro Trp Ala Pro Leu Ser Ser Cys Pro Ser Gln Ala Leu Gln I.eu Ala Gly Cys Leu Ser Gln Leu His ~er Gly Leu Phe Leu Tyr Gln Gly Leu Leu Gln Ala Leu Glu Gly Ile ~5 90 95 ~e:r Pro Glu Leu Gly Pro Thr Leu Asp Thr Leu Gln Leu A.~p Yal Ala CA 02239360 1998-08-0~

WO 94/17185 PCTrUS94100913 A~p Phe Ala Thr Thr Ile Trp Gln Gln Met Glu Glu Leu Gly Met Ala Pro Ala Leu Gln Pro Thr Gln Gly Ala Met Pro Ala Phe Ala Ser Ala Phe Gln Arg Arg Ala Gly Gly Val Leu Val Ala Ser His Leu Gln Ser Phe Leu Glu Val Ser Tyr Arg Val Leu Arg His Leu Ala Gln Pro (2) INFORMATION FOR SEQ ID NO:l00:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 175 amino acids (B~ TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:l00:
Met Thr Pro Leu Gly Pro Ala Ser Ser Leu Pro Gln Ser Phe Leu Leu Ala Cys Leu Glu Gln Val Arg Lys Ile Gln Gly A~p Gly Ala Ala Leu Gln Glu Lys Leu Cy~ Ala Thr Tyr Lys Leu Cy~ His Pro Glu Glu Leu Val Leu Leu Gly Hiq Ser Leu Gly Ile Pro Trp Ala Pro Leu Ser Ser Cys Pro Ser Gln Ala Leu Gln Leu Ala Gly Cys Leu Ser Gln Leu Hi~

Ser Gly Leu Phe Leu Tyr Gln Gly Leu Leu Gln Ala Leu Glu Gly Ile Ser Pro Glu Leu Gly Pro Thr Leu Asp Thr Leu Gln Leu A~p Val Ala A~p Phe Ala Thr Thr Ile Trp Gln Gln Met Glu Glu Leu Gly Met Ala llS 120 12S
Pro Ala Leu Gln Pro Thr Gln Gly Ala Met Pro Ala Phe Ala Ser Ala Phe Gln Arg Arg Ala Gly Gly Val Leu Val Ala Ser His Leu Gln Ser Phe Leu Glu Val Ser Tyr Arg Val Leu Arg Hi~ Leu Ala Gln Pro CA 02239360 1998-08-0~

WO 94/1718~ PCTrUS94100913 (2) INFORMATION FOR SEQ ID NO:101:
(i~ SEQUENCE CHARACTERISTICS:
(A) LENGTH: 175 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:101:
Met Thr Pro Leu Gly Pro Ala Ser Ser Leu Pro Gln Ser Phe Leu Leu ~ys Cys Leu Glu Gln Val Arg Lys Ile Gln Gly Asp Gly Ala Ala Leu Gln Glu Lys Leu Cys Ala Thr Tyr Lys Leu Cys His Pro Glu Glu Leu Val Leu Leu Gly His Ser Leu Gly Ile Pro Trp Ala Pro Leu Ser Ser 50_ 55 60 Cys Pro Ser Gln Ala Leu Gln Leu Ala Gly Cys Leu Ser Gln Leu His ~0 ~er Gly Leu Phe Leu Tyr Gln Gly Leu Leu Gln Ala Leu Glu Gly Ile ~er Pro Glu Leu Gly Pro Thr Leu Asp Thr Leu Gln Leu Asp Val Ala Asp Phe Ala Thr Thr Ile Trp Gln Ala Met Glu Glu Leu Gly Met Ala Pro Ala Leu Gln Pro Thr Gln Gly Ala Met Pro Ala Phe Ala Ser Ala Phe Gln Arg Arg Ala Gly Gly Val Leu Val Ala Ser His Leu Gln Ser Phe Leu Glu Val Ser Tyr Arg Val Leu Arg His Leu Ala Gln Pro (2) INFORMATION FOR SEQ ID NO:102:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 175 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:102:
Met Thr Pro Leu Gly Pro Ala Ser Ser Leu Pro Gln Ser Phe Leu Leu CA 02239360 1998-08-0~

Lys Cys Leu Glu Ala Val Arg Lys Ile Gln Gly Asp Gly Ala Ala Leu 2s 30 Gln Glu Lys Leu Cys Ala Thr Tyr Lys Leu Cys His Pro Glu Glu Leu Val Leu Leu Gly His Ser Leu Gly Ile Pro Trp Ala Pro Leu Ser Ser Cys Pro Ser Gln Ala Leu Gln Leu Ala Gly Cys Leu Ser Gln Leu His Ser Gly Leu Phe Leu Tyr Gln Gly Leu Leu Gln Ala Leu Glu Gly Ile Ser Pro Glu Leu Gly Pro Thr Leu A~p Thr Leu Gln Leu Acp Val Ala Asp Phe Ala Thr Thr Ile Trp Gln Gln Met Glu Glu Leu Gly Met Ala Pro Al~ 'u Gln Pro Thr Gln Gly Ala Met Pro Ala Phe Ala Ser Ala Phe Gln Arg Arg Ala Gly Gly Val Leu Val Ala Ser His Leu Gln Ser Phe Leu Glu Val Ser Tyr Arg Val Leu Arg His Leu Ala Gln Pro (2) INFORMATION FOR SEQ ID NO:103:
ti) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 175 amino acid~
(B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:103:
Met Thr Pro Leu Gly Pro Ala Ser Ser Leu Pro Gln Ser Phe Leu Leu ~ys Cys Leu Glu Gln Val Arg Lys Ile Gln Gly Asp Gly Ala Ala Leu Gln Glu Lys Leu Cys Ala Thr Tyr Lys Leu Cys Ala Pro Glu Glu Leu Val Leu Leu Gly His Ser Leu Gly Ile Pro Trp Ala Pro Leu Ser Ser cyC Pro Ser Gln Ala Leu Gln Leu Ala Gly Cys Leu Ser Gln Leu His CA 02239360 l998-08-0~

WO 94~17~85 PCTAUS94/00913 Ser Gly Leu Phe Leu Tyr Gln Gly Leu Leu Gln Ala Leu Glu Gly Ile 9o 95 Ser Pro Glu Leu Gly Pro Thr Leu Asp Thr Leu Gln Leu Asp Val Ala l00 105 ll0 Asp Phe Ala Thr Thr Ile Trp Gln Gln Met Glu Glu Leu Gly Met Ala Pro Ala Leu Gln Pro Thr Gln Gly Ala Met Pro Ala Phe Ala Ser Ala 130 135 . 140 Phe Gln Arg Arg Ala Gly Gly Val Leu Val Ala Ser His Leu Gln Ser Phe Leu Glu Val Ser Tyr Arg Val Leu Arg His Leu Ala Gln Pro ~2) INFORMATION FOR SEQ ID NO:104:
) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 175 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:104:
Met Thr Pro Leu Gly Pro Ala Ser Ser Leu Pro Gln Ser Phe Leu Leu l 5 l0 l5 Ly~ Cyq Leu Glu Gln Val Arg Lys Ile Gln Gly A~p Gly Ala Ala Leu Gln Glu Ly Leu Cys Ala Thr Tyr Lys Leu Cys Hi~ Pro Glu Glu Leu Val Leu Leu Gly Ala Ser Leu Gly Ile Pro Trp Ala Pro Leu Ser Ser so 55 60 Cy~ Pro Ser Gln Ala Leu Gln Leu Ala Gly Cy~ Leu Ser Gln Leu His 6s 70 7s 80 ~er Gly Leu Phe Leu Tyr Gln Gly Leu Leu Gln Ala Leu Glu Gly Ile 9o 95 ~er Pro Glu Leu Gly Pro Thr Leu A~p Thr Leu Gln Leu Asp Val Ala lOO 105 llO
A.~p Phe Ala Thr Thr Ile Trp Gln Gln Met Glu Glu Leu Gly Met Ala Pro Ala Leu Gln Pro Thr Gln Gly Ala Met Pro Ala Phe Ala Ser Ala CA 02239360 1998-08-0~

WO 94/17185 PCTrUS94/00913 Phe Gln Arg Arg Ala Gly Gly Val Leu Val Ala Ser His Leu Gln Ser Phe Leu Glu Val Ser Tyr Arg Val Leu Arg His Leu Ala Gln Pro (2) INFORMATION FOR SEQ ID NO:105:
(i) SEQUENCE CHARACTERISTICS:
~A) LENGTH: 175 amino acids (B) TYPE: amino acid ~D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:l05:
Met Thr Pro Leu Gly Pro Ala Ser Ser Leu Pro Gln Ser Phe Leu Leu Lys Cy ~ eu Glu Gln Val Arg Lys Ile Gln Gly Asp Gly Ala Ala keu Gln Glu Lys Leu Cys Ala Thr Tyr Lys Leu Cys His Pro Glu Glu Leu Val Leu Leu Gly His Ser Leu Gly Ile Pro Trp Ala Pro Leu Ser Ser Cys Pro Ser Gln Ala Leu Gln Leu Ala Gly Cys Leu Ser Gln Leu His Ser Gly Leu Phe Leu Tyr Gln Gly Leu Leu Gln Ala Leu Glu Gly Ile Ser Pro Glu Leu Gly Pro Thr Leu Asp Thr Leu Gln Leu Ala Val Ala Asp Phe Ala Thr Thr Ile Trp Gln Gln Met Glu Glu Leu Gly Met Ala Pro Ala Leu Gln Pro Thr Gln Gly Ala Met Pro Ala Phe Ala Ser Ala Phe Gln Arg Arg Ala Gly Gly Val Leu Val Ala Ser His Leu Gln Ser Phe Leu Glu Val Ser Tyr Arg Val Leu Arg His Leu Ala Gln Pro ~2) INFORMATION FOR SEQ ID NO:106:
~i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 175 amino acids ~B) TYPE: amino acid ~D) TOPOLOGY: linear CA 02239360 l998-08-0~

WO 94117185 PCTrus94~00913 (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:106:
Met Thr Pro Leu Gly Pro Ala Ser Ser Leu Pro Gln Ser Phe Leu Leu Lys Cys Leu Glu Gln Val Arg Lys Ile Gln Gly Asp Gly Ala Ala Leu Gln Glu Lys Leu Cys Ala Thr Tyr Lys Leu Cys His Pro Glu Glu Leu ' 40 45 Val Leu Leu Gly His Ser Leu Gly Ile Pro Trp Ala Pro Leu Ser Ser Cys Pro Ser Gln Ala Leu Gln Leu Ala Gly Cys Leu Ser Gln Leu His ~er Gly Leu Phe Leu Tyr Gln Gly Leu Leu Gln Ala Leu Glu Gly Ile ~er Pro Glu Leu Gly Pro Thr Leu Asp Thr Leu Gln Leu Asp Val Ala Ala Phe Ala Thr Thr Ile Trp Gln Gln Met Glu Glu Leu Gly Met Ala Pro Ala Leu Gln Pro Thr Gln Gly Ala Met Pro Ala Phe Ala Ser Ala Phe Gln Arg Arg Ala Gly Gly Val Leu Val Ala Ser His Leu Gln Ser Phe Leu Glu Val Ser Tyr Arg Val Leu Arg His Leu Ala Gln Pro t2) INFORMATION FOR SEQ ID NO:107:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 175 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:107:
Met Thr Pro Leu Gly Pro Ala Ser Ser Leu Pro Gln Ser Phe Leu Leu ~y~ Cys Leu Glu Gln Val Arg Lys Ile Gln Gly A-cp Gly Ala Ala Leu Gln Glu Lys Leu Cys Ala Thr Tyr Lys Leu Cys His Pro Glu Glu Leu CA 02239360 1998-08-0~

WO 94Jl718~i PCTIUS94/00913 Val Leu Leu Gly His Ser Leu Gly Ile Pro Trp Ala Pro Leu Ser Ser 5~ 55 60 Cys Pro Ser Gln Ala Leu Gln Leu Ala Gly Cys Leu Ser Gln Leu His ~er Gly Leu Phe Leu Tyr Gln Gly Leu Leu Gln Ala Leu Glu Gly Ile ~er Pro Glu Leu Gly Pro Thr Leu Asp Thr Leu Gln Leu Asp Val Ala Asp Phe Ala Thr Ala Ile Trp Gln Gln Met Glu Glu Leu Gly Met Ala Pro Ala Leu Gln Pro Thr Gln Gly Ala Met Pro Ala Phe Ala Ser Ala Phe Gln Arg Arg Ala Gly Gly Val Leu Val Ala Ser His Leu Gln Ser Phe Le ~ u Val Ser Tyr Arg Val Leu Arg His Leu Ala Gln Pro ~2) INFORMATION FOR SEQ ID NO:108:
~i) SEQUENCE CHARACTERISTICS:
(A~ LENGTH: 175 amino acids (B) TYPE: amino acid (D~ TOPOLOGY: linear (ii) MOLECULE TYPE: protein txi) SEQUENCE DESCRIPTION: SEQ ID NO:108:
Met Thr Pro Leu Gly Pro Ala Ser Ser Leu Pro Gln Ser Phe Leu Leu ~ys Cys Leu Glu Gln Val Arg Lys Ile Gln Gly Ala Gly Ala Ala Leu Gln Glu Lys Leu Cys Ala Thr Tyr Lys Leu Cys His Pro Glu Glu Leu Val Leu Leu Gly Hi~ Ser Leu Gly Ile Pro Trp Ala Pro Leu Ser Ser Cys Pro Ser Gln Ala Leu Gln Leu Ala Gly Cys Leu Ser Gln Leu His ~er Gly Leu Phe Leu Tyr Gln Gly Leu Leu Gln Ala Leu Glu Gly Ile ~5 90 95 ~er Pro Glu Leu Gly Pro Thr Leu Acp Thr Leu Gln Leu Ala Val Ala Asp Phe Ala Thr Thr Ile Trp Gln Gln Met Glu Glu Leu Gly Met Ala Pro Ala Leu Gln Pro Thr Gln Gly Ala Met Pro Ala Phe Ala Ser Ala Phe Gln Arg Arg Ala Gly Gly Val Leu Val Ala Ser His Leu Gln Ser Phe Leu Glu Val Ser Tyr Arg Val Leu Arg His Leu Ala Gln Pro (2) INFORMATION FOR SEQ ID NO:109:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 175 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:109:
Met Thr Pro Leu Gly Pro Ala Ser Ser Leu Pro Gln Ser Phe Leu Leu Lys Cys Leu Glu Gln Val Arg Lys Ile Gln Gly Asp Gly Ala Ala Leu Gln Glu Lys Leu Cys Ala Thr Tyr Lys Leu Cys His Pro Glu Glu Leu Val Leu Leu Gly His Ser Leu Gly Ile Pro Trp Ala Pro Leu Ser Ser Cys Pro Ser Gln Ala Leu Gln Leu Ala Gly Cys Leu Ser Gln Leu His Ser Gly Leu Phe Leu Tyr Gln Gly Leu Leu Gln Ala Leu Glu Gly Ile Ser Pro Glu Leu Gly Pro Thr Leu Asp Thr Leu Gln Leu Asp Val Ala Asp Phe Ala Thr Thr Ile Trp Gln Gln Met Glu Ala Leu Gly Met Ala Pro Ala Leu Gln Pro Thr Gln Gly Ala Met Pro Ala Phe Ala Ser Ala Phe Gln Arg Arg Ala Gly Gly Val Leu Val Ala Ser His Leu Gln Ser Phe Leu Glu Val Ser Tyr Arg Val Leu Arg His Leu Ala Gln Pro CA 02239360 l998-08-0~

WO 94/17185 P~TrU594100913 12) INFORMATION FOR SEQ ID NO:110:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 175 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii~ MOLECULE TYPE: protein (xi~ SEQUENCE DESCRIPTION: SEQ ID NO:110:
Met Thr Pro Leu Gly Pro Ala Ser Ser Leu Pro Gln Ser Phe Leu Leu . 5 10 15 Lys Cys Leu Glu Gln Val Arg Lys Ile Gln Gly Asp Gly Ala Ala Leu Gln Glu Lys Leu Cys Ala Thr Tyr Lys Leu Cys His Pro Glu Glu Leu Val Leu Leu Gly His Ser Leu Gly Ile Pro Trp Ala Pro Leu Ser Ser 5~ ~ 55 60 Cys Pro Ser Gln Ala Leu Gln Leu Ala Gly Cys Leu Ser Gln Leu His ~er Gly Leu Phe Leu Tyr Gln Gly Leu Leu Gln Ala Leu Glu Gly Ile ~er Pro Glu Leu Gly Pro Thr Leu Asp Thr Leu Gln Leu Asp Val Ala Asp Val Ala Thr Ala Ile Trp Gln Gln Met Glu Glu Leu Gly Met Ala llS 120 125 Pro Ala Leu Gln Pro Thr Gln Gly Ala Met Pro Ala Phe Ala Ser Ala Phe Gln Arg Arg Al~ Gly Gly Val Leu Val Ala Ser His Leu Gln Ser Phe Leu Glu Val Ser Tyr Arg Val Leu Arg Hi~ Leu Ala Gln Pro

Claims (19)

The Embodiments Of The Invention In Which An Exclusive Property Or Privilege Is Claimed Are Defined As Follows:

1. A G-CSF hybrid molecule comprising a G-CSF moiety and a protein moiety, wherein:
(a) said G-CSF moiety comprises:
(i) a G-CSF internal core of helices A, B, C and D as set forth in Figure 4, said internal core helices consisting of corresponding amino acid residues as set forth in SEQ ID NO:2;
(ii) an external loop between helices A and B consisting of corresponding amino acid residues as set forth in SEQ ID
NO:2;
(iii) an external loop between helices B and C consisting of corresponding amino acid residues as set forth in SEQ ID
NO:2;
(iv) an external loop between helices D and A; and (v) an N-terminus and a C-terminus, said N-terminus being connected to helix D and said C-terminus being connected to helix C, said N-terminus and said C-terminus each consisting of a portion of amino acids 120-146 of SEQ ID NO:2;
(b) said protein moiety is connected to an amino acid of subpart (v).

2. The G-CSF hybrid molecule of claim 1, further comprising an N-terminal methionyl residue.

3. The G-CSF hybrid molecule of claim 1 or 2, wherein the cysteine residue at position 18 in said SEQ ID NO:2 is altered to serine or alanine residue.

4. The G-CSF hybrid molecule of claim 1, 2 or 3, wherein said protein moiety is connected to an amino acid of subpart (v) via a linker.

5. The G-CSF hybrid of claim 4, wherein said protein moiety is a cytokine or hematopoietic factor.

6. The G-CSF hybrid of claim 5, wherein said cytokine is an interleukin.

7. A G-CSF hybrid molecule comprising a G-CSF moiety and a protein moiety, wherein:
(a) said G-CSF moiety comprises:
(i) a G-CSF internal core of helices A, B, C and D as set forth in Figure 4, said internal core helices consisting of corresponding amino acid residues as set forth in SEQ ID NO:2;
(ii) an external loop between helices C and D consisting of corresponding amino acid residues as set forth in SEQ ID
NO:2;
(iii) an external loop between helices B and C consisting of corresponding amino acid residues as set forth in SEQ ID
NO:2;
(iv) an external loop between helices D and A; and (v) an N-terminus and a C-terminus, said N-terminus being connected to helix B and said C-terminus being connected to helix A, said N-terminus and said C-terminus each consisting of a portion of amino acids 39-73 of SEQ ID NO:2;
(b) said protein moiety is connected to an amino acid of subpart (v).

8. The G-CSF hybrid molecule of claim 7, further comprising an N-terminal methionyl residue.

9. The G-CSF hybrid molecule of claim 7 or 8, wherein the cysteine residue at position 18 in said SEQ ID NO:2 is altered to serine or alanine residue.

10. The G-CSF hybrid molecule of claim 7, 8 or 9, wherein said protein moiety is connected to an amino acid of subpart (v) via a linker.

11. The G-CSF hybrid of claim 10, wherein said protein moiety is a cytokine or hematopoietic factor.

12. The G-CSF hybrid of claim 11, wherein said cytokine is an interleukin.

13. A G-CSF hybrid molecule comprising a G-CSF moiety and a protein moiety, wherein:
(a) said G-CSF moiety comprises:
(i) a G-CSF internal core of helices A, B, C and D as set forth in Figure 4, said internal core helices consisting of corresponding amino acid residues as set forth in SEQ ID NO:2;
(ii) an external loop between helices A and B consisting of corresponding amino acid residues as set forth in SEQ ID
NO:2;
(iii) an external loop between helices C and D consisting of corresponding amino acid residues as set forth in SEQ ID
NO:2;
(iv) an external loop between helices D and A; and (v) an N-terminus and a C-terminus, said N-terminus being connected to helix C and said C-terminus being connected to helix B, said N-terminus and said C-terminus each consisting of a portion of amino acids 92-101 of SEQ ID NO:2;
(b) said protein moiety is connected to an amino acid of subpart (v).

14. The G-CSF hybrid molecule of claim 13, further comprising an N-terminal methionyl residue.

15. The G-CSF hybrid molecule of claim 13 or 14, wherein the cysteine residue at position 18 in said SEQ ID NO:2 is altered to serine or alanine residue.

16. The G-CSF hybrid molecule of claim 13, 14 or 15, wherein said protein moiety is connected to an amino acid of subpart (v) via a linker.

17. The G-CSF hybrid of claim 16, wherein said protein moiety is a cytokine or hematopoietic factor.

18. The G-CSF hybrid of claim 17, wherein said cytokine is an interleukin.

19. A pharmaceutical composition comprising a G-CSF hybrid molecule according to claim 1, 7 or 13 and a pharmaceutically acceptable carrier.