CA2376634A1 - Immunostimulant oligonucleotide - Google Patents
Immunostimulant oligonucleotide Download PDFInfo
- Publication number
- CA2376634A1 CA2376634A1 CA002376634A CA2376634A CA2376634A1 CA 2376634 A1 CA2376634 A1 CA 2376634A1 CA 002376634 A CA002376634 A CA 002376634A CA 2376634 A CA2376634 A CA 2376634A CA 2376634 A1 CA2376634 A1 CA 2376634A1
- Authority
- CA
- Canada
- Prior art keywords
- oligonucleotide
- sequence
- cytosine
- oligonucleotides
- cells
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Abandoned
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/117—Nucleic acids having immunomodulatory properties, e.g. containing CpG-motifs
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/39—Medicinal preparations containing antigens or antibodies characterised by the immunostimulating additives, e.g. chemical adjuvants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
- A61P37/04—Immunostimulants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/555—Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
- A61K2039/55511—Organic adjuvants
- A61K2039/55561—CpG containing adjuvants; Oligonucleotide containing adjuvants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/18—Type of nucleic acid acting by a non-sequence specific mechanism
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/31—Chemical structure of the backbone
- C12N2310/315—Phosphorothioates
Abstract
The invention relates to an oligonucleotide which can stimulate human cells of the immune system, characterized in that it comprises at least one nucleotide sequence of formula 5'TTN1N2TT3' wherein T represents thymine, and N1 and N2 can both represent adenine, thymine, cytosine or guanine. The invention is further characterized in that it is devoid of the CG dinucleotide in which cytosine C is not methylated. One oligonucleotide of particular interest has the following sequence: 5'TTAGTTCTTAGTTN3TTAGTT 3'. Said oligonucleotide can be used in a particularly advantageous manner as an adjuvant for vaccines.
Description
' CA 02376634 2001-12-07 IMMUNOSTIMULANT OLIGONUCLEOTIDE
The present invention relates to the domain of immunostimulants. More particularly, the invention relates to oligonucleotides capable of stimulating human cells involved in the immune system, and to the use thereof as an immunization adjuvant.
A large number of oligonucleotides have already been 1U described in the prior art, in relation to their immunostimulant properties. Thus, application EP0468520 describes immunostimulant polynucleotides consisting of a linear DNA single strand comprising from 10 to 100 nucleotides linked together according to a palindromic sequence.
According to application WO 96/02555, the immunostimulatory activity of oligonucleotides is linked to the presence of a 5' CG 3' dinucleotide sequence in which C is not methylated, the immunostimulant activity being greater i.f the CG unit is preceded in 5' by the dinucleotide GA and/or followed in 3' by the dinucleotide TC or TT.
On the other hand, according to patent application 2, it is not necessar=y for the oligonucleotides to have a minimum of 8 nucleotides, as had been described previously, or for their sequence to be a palindrome, or even for them to comprise the dinucleotide CG; thus, this application describes the following 3 oligonucleotides for their use as an immunization adjuvant:
5' GACGTT 3', 5' GAGCTT 3', and 5' TCCGGA 3'.
According to US patent 5,663,153, the immunostimulant activity of oligonucleotides is not linked to the sequence of the nucleotides, but to the nature of the bond between nucleotides, the presence of at least one _ 2 _ phosphorothioate bond making it possible to induce stimulation of the immune system.
Most tests of the prior art for evaluating the immunostimulant activity of the oligonucleotides provided are carried out either in vitro, on animal cells (essentially murine cells), or in vivo on mice.
However, the differences which exist between the immune system of mice and that of humans have led to differences between the results obtained on murine cells and those obtained on human cells. It is therefore not certain that all the oligonucleotides which have been described as immunostimulant in the prior art really are immunostimulant with respect to humans.
Now, the pharmaceutical industry is in great need of immunostimulants which can be administered to humans, in particular in the field of vaccines.
The aim of the present invention is therefore to propose oligonucleotides capable of stimulating cells of the immune system of humans.
In order to achieve this aim, a subject of the invention is an oligonucleotide capable of stimulating human cells of the immune system, characterized in that it comprises at least one sequence 5' T 'r N1 N2 T T 3' in which T is thymine, and N1 and NZ may each represent adenine, thymine, cytosine or guanine, and in that it lacks a dinucleotide CG in which the cytosine C is not methylated.
A subject of the invention is also the use of such an oligonucleotide, for manufacturing a medicinal product.
According to one characteristic of the :invention, the oligonucleotide comprises from 6 to 100 nucleotides.
The present invention relates to the domain of immunostimulants. More particularly, the invention relates to oligonucleotides capable of stimulating human cells involved in the immune system, and to the use thereof as an immunization adjuvant.
A large number of oligonucleotides have already been 1U described in the prior art, in relation to their immunostimulant properties. Thus, application EP0468520 describes immunostimulant polynucleotides consisting of a linear DNA single strand comprising from 10 to 100 nucleotides linked together according to a palindromic sequence.
According to application WO 96/02555, the immunostimulatory activity of oligonucleotides is linked to the presence of a 5' CG 3' dinucleotide sequence in which C is not methylated, the immunostimulant activity being greater i.f the CG unit is preceded in 5' by the dinucleotide GA and/or followed in 3' by the dinucleotide TC or TT.
On the other hand, according to patent application 2, it is not necessar=y for the oligonucleotides to have a minimum of 8 nucleotides, as had been described previously, or for their sequence to be a palindrome, or even for them to comprise the dinucleotide CG; thus, this application describes the following 3 oligonucleotides for their use as an immunization adjuvant:
5' GACGTT 3', 5' GAGCTT 3', and 5' TCCGGA 3'.
According to US patent 5,663,153, the immunostimulant activity of oligonucleotides is not linked to the sequence of the nucleotides, but to the nature of the bond between nucleotides, the presence of at least one _ 2 _ phosphorothioate bond making it possible to induce stimulation of the immune system.
Most tests of the prior art for evaluating the immunostimulant activity of the oligonucleotides provided are carried out either in vitro, on animal cells (essentially murine cells), or in vivo on mice.
However, the differences which exist between the immune system of mice and that of humans have led to differences between the results obtained on murine cells and those obtained on human cells. It is therefore not certain that all the oligonucleotides which have been described as immunostimulant in the prior art really are immunostimulant with respect to humans.
Now, the pharmaceutical industry is in great need of immunostimulants which can be administered to humans, in particular in the field of vaccines.
The aim of the present invention is therefore to propose oligonucleotides capable of stimulating cells of the immune system of humans.
In order to achieve this aim, a subject of the invention is an oligonucleotide capable of stimulating human cells of the immune system, characterized in that it comprises at least one sequence 5' T 'r N1 N2 T T 3' in which T is thymine, and N1 and NZ may each represent adenine, thymine, cytosine or guanine, and in that it lacks a dinucleotide CG in which the cytosine C is not methylated.
A subject of the invention is also the use of such an oligonucleotide, for manufacturing a medicinal product.
According to one characteristic of the :invention, the oligonucleotide comprises from 6 to 100 nucleotides.
According to a particular characteristic, the oligonucleotide according to the invention is characterized in that N1 represents adenine and in that NZ represents guanine.
According to another characteristic, the oligonucleotide according to the invention is characterized in that the 5' T T Nl NZ T T 3' unit is repeated at least once.
According to another characteristic, the oligonucleotide according to the invention is characterized in that the 5' T T N1 N2 T 'r 3' unit unit is repeated twice.
According to another characteristic, the oligonucleotide according to the invention is characterized in that the repeated 5' T 'T N1 Nz T T 3' units are separated by a nucleotide N,3 which, each time, may be identical or different, and which may represent A, C, T or G.
According to a particular characteristic, the oligonucleotide according to the invention is characterized in that the nucleotide N3 separating the first two TTN1N2TT units read when the sequence is in the 5' -~ 3' orientation represents cytosine.
According to another characteristic, the oligonucleotide according to the invention is characterized in that it comprises the sequence 5' TTAGTTCTTAGTTN3TTAGTT 3', in which A represents adenine, T represents thymine, G represents guanine and C represents cytosine, and in which N3 may signify A, T, C or G.
According to another characteristic, the oligonucleotide according to the invention is capable of inducing human lymphocyte proliferation.
According to another characteristic, the oligonucleotide according to the invention is characterized in that the 5' T T Nl NZ T T 3' unit is repeated at least once.
According to another characteristic, the oligonucleotide according to the invention is characterized in that the 5' T T N1 N2 T 'r 3' unit unit is repeated twice.
According to another characteristic, the oligonucleotide according to the invention is characterized in that the repeated 5' T 'T N1 Nz T T 3' units are separated by a nucleotide N,3 which, each time, may be identical or different, and which may represent A, C, T or G.
According to a particular characteristic, the oligonucleotide according to the invention is characterized in that the nucleotide N3 separating the first two TTN1N2TT units read when the sequence is in the 5' -~ 3' orientation represents cytosine.
According to another characteristic, the oligonucleotide according to the invention is characterized in that it comprises the sequence 5' TTAGTTCTTAGTTN3TTAGTT 3', in which A represents adenine, T represents thymine, G represents guanine and C represents cytosine, and in which N3 may signify A, T, C or G.
According to another characteristic, the oligonucleotide according to the invention is capable of inducing human lymphocyte proliferation.
According to another characteristic, the oligonucleotide according to the invention is capable of increasing the expression of the activation marker CD86 and of the receptor CD25 on human B lymphocytes.
According to another characteristic, the oligonucleotide according to the invention is capable of inducing cytokine secretion.
A subject of the invention is also an immunization adjuvant, characterized in that it comprises at least one oligonucleotide which is capable of stimulating human cells of the immune system and which contains at least one sequence 5' T T N1 NZ T T 3' in which T is thymine, and N1 and N2 may each represent adenine, thymine, cytosine or guanine, the oligonucleotide lacking a CG dinucleotide sequence :in which the cytosine C is not methylated.
A subject of the invention is also an immunization composition for human use, comprising at least one immunization antigen, characterized in that it also comprises at least one oligonucleotide which is capable of stimulating human cells of the immune system and which contains at least one sequence 5' T T N1 NZ T T 3' in which T signifies thymine, and N1 and N2 may each represent adenine, thymine, cytosine or guanine, the oligonucleotide lacking a CG dinucleotide sequence in which the cytosine C is not methylated.
The present invention will be more clearly understood upon reading the following description, with reference to figures 1 to 11 which illustrate the results obtained in the tests described in Examples 2 to 7.
In particular, figures 1 and 2 indicate the number of counts per minute obtained in the test of the example.
According to another characteristic, the oligonucleotide according to the invention is capable of inducing cytokine secretion.
A subject of the invention is also an immunization adjuvant, characterized in that it comprises at least one oligonucleotide which is capable of stimulating human cells of the immune system and which contains at least one sequence 5' T T N1 NZ T T 3' in which T is thymine, and N1 and N2 may each represent adenine, thymine, cytosine or guanine, the oligonucleotide lacking a CG dinucleotide sequence :in which the cytosine C is not methylated.
A subject of the invention is also an immunization composition for human use, comprising at least one immunization antigen, characterized in that it also comprises at least one oligonucleotide which is capable of stimulating human cells of the immune system and which contains at least one sequence 5' T T N1 NZ T T 3' in which T signifies thymine, and N1 and N2 may each represent adenine, thymine, cytosine or guanine, the oligonucleotide lacking a CG dinucleotide sequence in which the cytosine C is not methylated.
The present invention will be more clearly understood upon reading the following description, with reference to figures 1 to 11 which illustrate the results obtained in the tests described in Examples 2 to 7.
In particular, figures 1 and 2 indicate the number of counts per minute obtained in the test of the example.
Figures 3 and 5 indicate the percentage of CD20+ cells expressing the CD25 receptor, for the ol_igonucleotides obtained according to Example 1.
Similarly, figures 4 and 6 indicate the percentage of CD20+ cells expressing the CD86 marker.
Figure 7 indicates the number of counts per minute obtained in the test of Example 4.
Figure 8 indicates the percentage of CD20+ cells expressing the CD25 receptor, for the oligonucleotides obtained according to Example 4, Similarly, Figure 9 indicates the percentage of CD20+ expressing the CD86 marker.
Figure 10 indicates the number of spots measured for the secretion of y interferon by cells stimulated in the presence of the oligonucleotides having the sequences 9 to 12 described in Example 4.
Figure 11 indicates the number of spots measured for the secretion of IL10 by cells stimulated in the presence of the oligonucleotides having the sequences 9 to 12 described in Example 4.
For the purposes of the present invention, the term "oligonucleotide" is intended to mean a polynucleotide comprising at least six nucleotides. Specifically, contrary to the teaching of the article entitled "CpG
motifs in bacterial DNA trigger direct B-cell actiT,ration", Krieg et al., Nature 1995, it was noted that it is not necessary for the oligonucleotide to have at least 8 nucleotides. On the other hand, the upper limit of the size of the oligonucleotides is not really determined. It may, however, be noted that, the longer the oligonucleotide, the more difficult it will be to purify it during the steps of synthesis and the higher the cost price thereof. In addition, it is probable that a very long oligonucleotide will find it more difficult to penetrate cells. Thus, for the needs of the present invention, it is considered that limiting the size of the oligonucleotide to 100 nucleotides is suitable. This oligonucleotide is preferably a single-stranded oligonucleotide; it may be an oligodeoxyribonucleotide or an oligoribonucleotide.
Particularly good results have been obtained using an oligodeoxyribonucleotide. The oligonucleotides which are suitable for the purposes of the invention may be in phosphodiester form or, in order to be more stable, in the form of phosphorot.hioates or phosphodiester/phosphorothioate hybrids. Those preferred are phosphorothioate oligonucleotides.
The oligonucleotide according to the invention is capable of stimulating human cells of the immune system, such as B lymphocytes, T lymphocytes, monocytes and d~ndritic cells. This stimulation is assessed, in particular, by lymphoproliferation or by the expression of markers, such as the cytokine receptor CD25 or the activation marker CD86 on B lymphocytes. It is possible to select the oligonucleotides of interest using tests other than those provided in the present application, on the condition, however, that they ax-e tests which evaluate the capacity for stimulating human cells and not, as in most of the documents of the prior art, tests which evaluate the capacity for stimulating murine cells. It would, in particular, be possible to test the expression of other B lymphocyte activation markers, such as the CD69 markers, or the expression of proliferation markers, such as the KI67 marker; tests relating to an increase in activation markers and maturation markers of dendritic cells may also be used.
Simi=arty, tests for assessing an increase in production of certain cytokines may also be used.
According to one characteristic of the invention, the oligonucleotide comprises at least one nucleotide _ 7 _ sequence 5' T T N1 N2 T T 3' in which T signifies thymine, and N1 and NZ may each represent adenine, thymine, cytosine or guanine. This formula thus covers 16 possibilities. This sequence may be 5'-terminal or 3'-terminal, or be surrounded by other nucleotides. It may be unique or repeated several times identically within the same oligonucleotide. An oligonucleotide according to the invention may also comprise several different sequences each corresponding to the 5' T T N1 NZ T T 3' unit.
According to the invention, the oligonucleotide does not comprise a palindromic sequence. Despite this absence of palindromic sequence, such an oligonucleotide is capable of stimulating human cells of the immune system.
According to one characteristic, the oligonucleotide according to the invention lacks a dinuc:leotide CG in which the cytosine is not methylated. This exclusion also applies to the N1 NZ unit. The ability of the oligonucleotides of the prior art to be immunostimulant has almost always been interpreted as being linked to the presence of nonmethylated CpG units (cf. in particular the article by Krieg et al. in Nature of April 1995, mentioned above), this interpretation being coherent with the observation according to which the frequency of this dinucleotide is approximately four times greater in the genome of bacteria than in that of vertebrates. Surprisingly, it has now been found that oligonucleotides completely lacking this dinucleotide unit are, however, entirely capable of stimulating the cells of the human immune system.
According to a particular embodiment of the present invention, the N1N2 unit corresponds to the dinucleotide AG in which A signifies adenine and G signifies guanine.
According to an advantageous characteristic, the 5' TTAGTT 3' unit is repeated at least once in the oligonucleotide, and preferably at least twice. More preferably, the repeated units are separated by at least one nucleotide N3, which represents adenine, cytosine, guanine or thymine. Within an oligonucleotide, this separating nucleotide may always be the same or may be different each time. Preferably, the nucleotide separating the first two TTAGTT units of the oligonucleotide (taking the direction for reading to be 5'-~3') consists of cytosine.
In particular, for the purpose of the present invention, those oligonucleotides in which the nucleotide sequences correspond to the formula 5' TTAGTTCTTAGTTN3TTAGTT 3', in which N3 represents A, T, C
or G, are preferred.
According to a particular characteristic, the oligonucleotide according to the invention lacks or is low in nucleotide sequence capable of inhibiting the cells of the human immune system. In fact, in order to obtain an overall immunostimulant effect, if inhibitory or neutralizing units such as, for example, those described in application WO 98/52581 are present, their effect must be suppressed or decreased, through the presence of a sequence with more pronounced immunostimulant effect or through the presence of a greater number of 5' T T N1 NZ T T 3' sequences.
A subject of the present invention is also an immunization adjuvant comprising at least one immunostimulant oligonucleotide having at least one 5' T T N1 NZ T T 3' unit as mentioned above. The term "immunization adjuvant" is intended to mean a product which makes it possible to increase or to modify the response of the immune system of an organism with respect to the administration of an antigen. In particular, it may be an increase in the humoral response or in the cellular response.
The action of an immunization adjuvant may also be, not an increase in the response which would. occur in the absence of adjuvant, but a different orientation of the response produced: for example, orientation toward a cellular response rather than a humoral response, production of certain cytokines rather than others, production of certain antibody types or subtypes rather than others, stimulation of certain cells rather than others, etc.
The immunostimulant oligonucleotide of the present invention may be used as an immunization adjuvant whatever the nature of the antigen administered and whatever the number of valencies used. It may be the only adjuvant used or, on the contrary, it may be one element of an adjuvant combination.
The adjuvant action of the oligonucleotide according to the invention may be obtained either when it is combined with the antigens) when they are administered, i.e. when they are part of the same immunization composition, or when it is administered separately from the antigen(s). It is, however, preferred to use it in the same immunization composition as the antigens) to be administered.
The oligonucleotide according to the invention may advantageously be administered via all the routes which can be used for an immunization composition: mucosal route or systemic route.
One of the subjects of the invention is an immunization composition comprising at least one immunostimulant oligonucleotide having a 5' T T N1N2 T T 3' sequence as described above.
An immunization composition according to the invention may be intended for immunization against a single disease or intended for immunization against several diseases. It may be a liquid immunization composition or a lyophilized composition. It may comprise, besides the antigens, all or some of the components conventionally present in a vaccine, such as buffers, stabilizers, preserving agents, etc. It may also comprise one or more adjuvant(s) other than those which are subjects of the present invention. It may also comprise several adjuvants which are subjects of the present invention, consisting either of oligonucleotides which all have the same 5' T T N1 N2 TT
3' unit but which differ by the nucleotides in 5' and/or in 3', or nucleotides which have different 5' T
T N1 NZ T T 3' units, the sequence in 5' and in 3' of which are identical or different.
The immunization composition according to the invention may be intended for prophylactic administration or for therapeutic administration.
The immunization composition according to the invention may be formulated sa as to optimize the adjuvant action of the oligonucleotide which is the subject of the invention. Thus, the oligonucleotide may be coupled to a lipid, such as cholesterol; it may be integrated into an emulsion of the oil/water type or formulated in the form of liposomes.
The following examples illustrate particular embodiments of the present invention.
E-xample 1: Oligonucleotide synthesis 15 oligonucleotides were synthesized, each having one of the following units:
' CA 02376634 2001-12-07 5'TTAATT 3' 5'TTACTT 3' 5' '~ T A T T T 3' Series A
5'TTAGTT 3' 5' TTTTTT 3' 5' TTTATT 3' 5' T T T C T T ~' Series T
5' TTTGTT 3' 5' TTCCTT 3' 5' TTCATT 3' SeriesC
~' 'i"tL TTT 3' 5'TTGGTT 3' 5'TTrATT 3' ,. ; T ~',1 T T Series G
5'TTGCTT 3' and having 4 adenines in 5' and 5 adenines in 3'.
These oligonuc'eotides are synthesized using an automatic synthesizer supplied by Applied Biosystems, wr~icr~ ases the . ~andard phosphoramidite chemical method ar_d whi~h comprises, in each cycle, an oxidation step, which is carried out using a tetraethylthiuram/acetonitrile solution, in order to obtain a phosphorothioate bond.
An ol,'_gonucleoti.de A15(S) which comprises only As and which .is phospho-~othioate throughout its length is also prepa_ed, in the same way. This oligonucleotide is a neg~.tive control since it causes neither proliferation nor an increase in the expression of activation markers on B lymphocytes.
An oligonucleotide 3Db(S), the sequence of which is identified in patent application W096/02555 under SEQ
ID No. 15 (5'GAGAACGCTCGACCTTCGAT3'), is also prepared;
this oligonucleotide comprises phosphorothioate bonds throughout its length and is used as a positive control.
All the oligonucleotides are maintained in solution in PBS buffer.
Example 2: Lymphoproliferation test Lymphocytes are isolated from the peripheral blood of a donor by carrying out a centrifugation on a Ficoll gradient. These lymphocytes are adjusted to 2x106 cells/ml in culture medium (RPMI 1640 + 10% fetal calf serum, and also glutamine, streptomycin and penicillin).
The cells are distributed into 96-well plates (round bottomed) in 100 ~,1, i . a . 2x105 cells pe:r well . 100 ~,1 of a 4 ~,M solution of oligonucleotides to be tested produced in Example 1 (a single type of oligonucleotide per well) are then added in order to obtain a 2 ~,M
final concentration.
The cells are incubated for 48 to 72 hours.
Tritiated thymidine (Amersham TRK 120) is diluted in culture medium and then distributed in the plates in the proportion of 1 ~Ci per well in 50 ~1. After incubation for 7 to 8 hours in an incubator (5% C02, 37°C), the plates can be frozen at -80"C and treated later.
Using a "Harvester", the content of the wells is harvested onto Unif_ilter GF/C plates and 6 washes in distilled water are carried out followed by a wash in 70~ ethanol in order to precipitate the DNA.
After drying the plates, 25 ~tl of liquid scintillant (Microscint-40, Packard) are distributed into each well and allow the radioactivity (radiation emitted by tritium) to be quantified by measuring the number of counts/minute (cpm) emitted by each well on a Top Count counter (Packard).
The results obtained for each of the oligonucleotides tested are represented on figures 1 and 2, which indicate, for each oligonucleotide tested, the number of counts per minute; it is noted that all the nucleotides according to the invention have a result which is clearly greater than the result obtained with the medium alone or the negative control A15(S), which means that they are all capable of stimulating lymphocyte proliferation.
Example 3:
Test relating to activation markers The test is carried out using lymphocytes isolated from a donor as described in the previous example, and adjusted to 2x106 cells/ml in the same culture medium.
The cells are then distributed into 12-well plates in a volume of 2 ml, i.e. 4x106 cells/well. An amount of oligonucleotides to be tested prepared in Example 1 (1 oligonucleotide/well) which is sufficient to obtain a 2 ~M oligonucleotide concentration is added to each we~yl. The cells are then incubated for 72 hours at 37''C. The cells are then double-.Labeled using CD25PE/CD20FITC or CD86PE/CD20FITC, followed by analysis on a FACScan. The results obtained are illustrated on figures 3, 4, 5 and 6, which represent, for each oligonucleotide tested, the percentage of B
cells (CD20+) which express the CD25 receptor (those which are CD25+) or the CD86 marker (those which are CD86+). The results represented on figures 3 and 4 were obtained in a test carried out at a different time from the test for which the results are illustrated on figures 5 and 6, which explains the difference in the order of magnitude of the results obtained.
Specifically, in this type of manipulation, the tests are very variable from one assay to the other, and only the results obtained in the same test are comparable with one another, hence the necessity of including, in each test, an oligonucleotide-control and also an assay of the medium alone.
It is noted that all the oligonucleotides which are subjects of the invention activate the B lymphocytes which express their activation marker CD86, and also the cytokine receptor CD25.
Example 4:
In the same way as in Example 1, a series of 16 oligonucleotides are prepared, which have the following sequences:
Seq ID1 5' TTAGTTATTAGTTATTAGTT 3' .
Seq ID2 5' TTAGTTATTAGTTTTTAGTT 3' .
Seq ID3 5' TTAGTTATTAGTTCTTAGTT 3' .
Seq ID4 5' TTAGTTATTAGTTGTTAGTT 3' .
Seq ID5 5' TTAGTTTTTAGTTATTAGTT 3' .
Seq ID6 5' TTAGTTTTTAGTTTTTAGTT 3' .
Seq ID7 5' TTAGTTTTTAGTTCTTAGTT 3' .
Seq ID8 5' TTAGTTTTTAGTTGTTAGTT 3' .
Seq ID9 5' TTAGTTCTTAGTTATTAGTT 3' .
Seq ID10 . TTAGTTCTTAGTTTTTAGTT 3' 5' Seq ID11 . TTAGTTCTTAGTTCTTAGTT 3' 5' Seq ID12 . TTAGTTCTTAGTTGTTAGTT 3' 5' Seq ID13 . TTAGTTGTTAGTTATTAGTT 3' 5' Seq IJ14 . TTAGTTGTTAGTTTTTAGTT 3' 5' Seq ID15 . TTAGTTGTTAGTTCTTAGTT 3' 5' Seq ID16 . TTAGTTGTTAGTTGTTAGTT 3' 5' These oligonucleotides are of the phosphorothioate type throughout their length.
Example 5:
The capacity of the oligonucleotides prepared in Example 4 to induce human lymphocyte proliferation is evaluated using a lymphoproliferation test such as the one described in Example 2. In the same way as in Example 2, the oligonucleotide concentration per well is 2 ~,M and the controls consist of the medium alone, the oligonucleotide A15(S) and the oligonucleotide 3Db (S) .
The results obtained, expressed in counts per minute, are represented in figure 7, which shows that all the oligonucleotides according to the invention are capable of inducing lymphocyte proliferation and that particularly good results are obtained when the sequences of the oligonucleotides are those identified by Seq IDs 9 to 12, i.e. when cytosine separates the first two TTN1NZTT units of the oligonucleotide .
2.5 Example 6:
The capacity of the oligonucleotides prepared in Example 4 to induce the expression of l.he activation marker CD86 and of the receptor CD25 on B lymphocytes is evaluated. This evaluation is carried out using the test described in Example 3. The results obtained with the oligonucleotides prepared according to Example 4 are represented on figures 8 and 9, which illustrate the percentages of B cells (CD20+) which also express the receptor CD25 (figure 8) or the marker CD86 (figure 9) .
The results obtained in this test confirm those obtained in the lymphoproliferation test: all the oligonucleotides according to the invention induce the expression of activation markers on human B
lyrnphocytes; particularly good results are obtained when the first 2 TTN1N2TT units of the oligonucleotide are separated by cytosine.
Example 7:
The capacity of the oligonucleotides according to the present invention to induce cytokine secretion is evaluated.
For this evaluation, lymphocytes are isolated from the peripheral blood of a donor by carrying out a centrifugation on a Ficoll gradient. These lymphocytes are adjusted to 2x106 cells/ml in culture medium (AIM V
medium + streptomycin + penicillin).
ELISPOT 96-well plates (flat bottom made of nitrocellulose) are pre-incubated the day before with a solution of antibodies for capturing cytokines (IL-10 or y IFN depending on the test carried out), and then saturated with culture medium.
Ne:a, 100 ~l of cells are distributed into the ELISPOT
plates, i.e. 2x105 cells per well, and then 100 ~1 of a 4 ~M solution of oligonucleotides to be tested, produced according to Example 4 (a single type of oligonucleotide per well) are added in order to obtain a 2 ~,M final concentration. The test i.s carried out with the oligonucleotides having t:he sequences described under Seq ID 9, Seq ID 10, Seq ID 11 and Seq ID 12.
The plates are incubated at 37°C, under a 5o C02 atmosphere. After incubation for 72 hours, the cells are removed by washing in the presence of detergent (10 Tween) and the cytokines attached tc the capture antibodies are revealed by successively adding biotinylated detection antibodies (anti-IL-10 or anti-y-IFN depending on the test carried out), streptavidin-HR~ and the AEC substrate.
The spots (1 spot corresponding to 1 cytokine-secreting cell) are counted using an automatic counter. The results are expressed as number of spots (number of secretor cells) per million cells.
The results obtained for each of the oligonucleotides tested are represented on figures 10 and 11, which indicate, for each oligonucleotide tested, the number of cytokine-secreting cells per million total cells it is noted that all the oligonucleotides according to the invention have a result which is clearly greater than the =esult obtained with the medium alone or the negative control A15(S), which means that they are all capable of inducing cytokine secretion, in particular IL10 and Y interferon secretion.
SEQUENCE LISTING
<110> AVENTIS PASTEUR
<120> IMMUNOSTIMULANT OLIGONUCLEOTIDE
<130> PM9908W0 <140>
<141>
<150> 16 <170> Patentin Ver. 2.1 <210> 1 <211> 20 <212> DNA
<213> Artificial sequence <220>
<223> Artificial sequence description: ol:igonucleotide <400> 1 ttagttatta gttattagtt 20 <210> 2 <211> 20 <212> DNA
<213> Artificial sequence <220>
<223> Artificial sequence description: oligonucleotide <400> 2 ttagttatta gtttttagtt 20 <210> 3 <211> 20 <212> DNA
<213> Artificial sequence <220>
<223> Artificial sequence description: oligonucleotide <400> 3 ttag-ttatta gttcttagtt 20 <210> 4 <211> 20 <212> DNA
<213> Artificial sequence <220>
<223> Artificial sequence description: ol:igonucleotide <400> 4 ttagttatta gttgttagtt 20 <210> 5 <211> 20 <212> DNA
<213> Artificial sequence <220>
<223> Artificial sequence description: ol:igonucleotide <400> 5 ttagttttta gttattagtt 20 <210> 6 <211> 20 <212> DNA
<213> Artificial sequence <22G>
<223> Artificial sequence description; ol:igonucleotide <400> 6 ttagttttta gtttttagtt 20 <210> 7 <211> 20 <2i2> DNA
<2i.~> Artificial sequence <220>
<223> Artificial sequence description: oligonucleotide <400> 7 ttagttttta gttcttagtt 20 <210> 8 <211> 20 <212> DNA
<213> Artificial sequence <220>
<223> Artificial sequence description: oli.gonucleotide <400> 8 ttagttttta gttgttagtt 2G
<210> 9 <211> 20 <212> DNA
<213> Artificial sequence <220>
<223> Artificial sequence description: oli.gonucleotide <400> 9 ttagttctta gttattagtt 2G
<210> 10 <211> 20 <212> DNA
<213> Artificial sequence <220>
<223> Artificial sequence description: oligonucleotide 2.5 <400> 10 ttaattcata gtttttagtt 20 <210> 11 <211> 20 <212> DNA
<213> Artificial sequence <220>
<223> Artificial sequence description: oli_gonucleotide <40C> ~~1 ttaattctta gttcttagtt 20 <210> 12 <2~-1> 20 <2i2> DNA
<2~3> Artificial sequence <220>
<223> Artificial sequence description: oligonucleotide <400> 12 ttacttctta gttgttagtt 20 <210> 13 <2_~_.'L> 20 <212> DNA
<213> Artificial sequence <220>
<223> Artificial sequence description: oligonucleotide <400> 13 ttagttgtta gttattagtt 20 <210> 14 <211> 20 <212> DNA
<213> Artificial sequence <22(>
<223> Artificial sequence description: oligonucleotide <400> 14 ttagttgtta gtttttagtt 20 <2~.0> 15 <21 1> 20 <212> DNA
<21~> Artificial sequence <22C~>
<223> Artificial sequence description: ol:igonucleotide <400> 15 ttaattgtta gttcttagtt 20 <210> 16 <211> 20 <2i2> DNA
<<"~3> Artificial sequence <2.~'0>
<223> Artificial sequence description: oligonucleotide LISTE DE SEQUENCES
<110> AVENTIS PASTEUR
s <120> OLIGONUCLEOTIDE IMMUNOSTIMULANT
<130> PM9908W0 <140>
io <141>
<160> 16 <170> Patentln Ver. 2.1 is <210> 1 <211 > 20 <212> ADN
<213> Sequence artificielle 20 <220>
<223> Description de la sequence artificielle:
oligonucleotide <400> 1 ttagttatta gttattagtt 20 2s <210> 2 <211 > 20 <212> ADN
30 <213> Sequence artificielle <220>
<223> Description de la sequence artificielle:
oligonucleotide <400> 2 3s ttagttatta gtttttagtt 20 <210> 3 <211 > 20 40 <212> ADN
<213> Sequence artificielle <220>
<223> Description de la sequence artificielle:
oligonucleotide 4s <400> 3 ttagttatta gttcttagtt 20 <210> 4 <211 > 20 <212> ADN
<213> Sequence artificielle s <220>
<223> Description de la sequence artificielle:
oligonucleotide <400> 4 ttagttatta gttgttagtt 20 to <210> 5 <211 > 20 <212> ADN
is <213> Sequence artificielle <220>
<223> Description de la sequence artificielle:
oligonucleotide <400> 5 2o ttagttttta gttattagtt 20 <210> 6 <211 > 20 2s <212> ADN
<213> Sequence artificielle <220>
<223> Description de la sequence artificielle:
oligonucleotide 30 <400> 6 ttagttttta gtttttagtt 20 <210> 7 3s <211 > 20 <212> ADN
<213> Sequence artificielle <220>
<223> Description de la sequence artificielle:
40 oligonucleotide <400> 7 ttagttttta gttcttagtt 20 <210> 8 <211 > 20 <212> ADN
s <213> Sequence artificielle <220>
<223> Description de la sequence artificielle:
oligonucleotide <400> 8 io ttagttttta gttgttagtt 20 <210> 9 <211 > 20 Is <212> ADN
<213> Sequence artificielle <220>
<223> Description de la sequence artificielle:
oligonucleotide 20 <400> 9 ttagttctta gttattagtt 20 <210> 10 2s <211 > 20 <212> ADN
<213> Sequence artificielle <220>
<223> Description de la sequence artificielle:
30 oligonucleotide <400> 10 ttagttctta gtttttagtt 20 3s <210> 11 <211 > 20 <212> ADN
<213> Sequence artificielle <220>
40 <223> Description de la sequence artificielle:
oligonucleotide <400> 11 ttagttctta gttcttagtt 20 <210> 12 <211 > 20 <212> ADN
s <213> Sequence artificielle <220>
<223> Description de la sequence artificielle:
oligonucleotide <400> 12 io ttagttctta gttgttagtt 20 <210> 13 <211 > 20 is <212> ADN
<213> Sequence artificielle <220>
<223> Description de la sequence artificielle:
oligonucleotide 20 <400> 13 ttagttgtta gttattagtt 20 <210> 14 2s <211 > 20 <212> ADN
<213> Sequence artificielle <220>
<223> Description de la sequence artificielle:
30 oligonucleotide <400> 14 ttagttgtta gtttttagtt 20 3s <210> 15 <211 > 20 <212> ADN
<213> Sequence artificielle <220>
40 <223> Description de la sequence artificielle:
oligonucleotide <400> 15 ttagttgtta gttcttagtt 20 <210> 16 <211 > 20 <212> ADN
s <213> Sequence artificielle <220>
<223> Description de la sequence artificielle:
oligonucleotide <400> 16 to ttagttgtta gttgttagtt 20 is
Similarly, figures 4 and 6 indicate the percentage of CD20+ cells expressing the CD86 marker.
Figure 7 indicates the number of counts per minute obtained in the test of Example 4.
Figure 8 indicates the percentage of CD20+ cells expressing the CD25 receptor, for the oligonucleotides obtained according to Example 4, Similarly, Figure 9 indicates the percentage of CD20+ expressing the CD86 marker.
Figure 10 indicates the number of spots measured for the secretion of y interferon by cells stimulated in the presence of the oligonucleotides having the sequences 9 to 12 described in Example 4.
Figure 11 indicates the number of spots measured for the secretion of IL10 by cells stimulated in the presence of the oligonucleotides having the sequences 9 to 12 described in Example 4.
For the purposes of the present invention, the term "oligonucleotide" is intended to mean a polynucleotide comprising at least six nucleotides. Specifically, contrary to the teaching of the article entitled "CpG
motifs in bacterial DNA trigger direct B-cell actiT,ration", Krieg et al., Nature 1995, it was noted that it is not necessary for the oligonucleotide to have at least 8 nucleotides. On the other hand, the upper limit of the size of the oligonucleotides is not really determined. It may, however, be noted that, the longer the oligonucleotide, the more difficult it will be to purify it during the steps of synthesis and the higher the cost price thereof. In addition, it is probable that a very long oligonucleotide will find it more difficult to penetrate cells. Thus, for the needs of the present invention, it is considered that limiting the size of the oligonucleotide to 100 nucleotides is suitable. This oligonucleotide is preferably a single-stranded oligonucleotide; it may be an oligodeoxyribonucleotide or an oligoribonucleotide.
Particularly good results have been obtained using an oligodeoxyribonucleotide. The oligonucleotides which are suitable for the purposes of the invention may be in phosphodiester form or, in order to be more stable, in the form of phosphorot.hioates or phosphodiester/phosphorothioate hybrids. Those preferred are phosphorothioate oligonucleotides.
The oligonucleotide according to the invention is capable of stimulating human cells of the immune system, such as B lymphocytes, T lymphocytes, monocytes and d~ndritic cells. This stimulation is assessed, in particular, by lymphoproliferation or by the expression of markers, such as the cytokine receptor CD25 or the activation marker CD86 on B lymphocytes. It is possible to select the oligonucleotides of interest using tests other than those provided in the present application, on the condition, however, that they ax-e tests which evaluate the capacity for stimulating human cells and not, as in most of the documents of the prior art, tests which evaluate the capacity for stimulating murine cells. It would, in particular, be possible to test the expression of other B lymphocyte activation markers, such as the CD69 markers, or the expression of proliferation markers, such as the KI67 marker; tests relating to an increase in activation markers and maturation markers of dendritic cells may also be used.
Simi=arty, tests for assessing an increase in production of certain cytokines may also be used.
According to one characteristic of the invention, the oligonucleotide comprises at least one nucleotide _ 7 _ sequence 5' T T N1 N2 T T 3' in which T signifies thymine, and N1 and NZ may each represent adenine, thymine, cytosine or guanine. This formula thus covers 16 possibilities. This sequence may be 5'-terminal or 3'-terminal, or be surrounded by other nucleotides. It may be unique or repeated several times identically within the same oligonucleotide. An oligonucleotide according to the invention may also comprise several different sequences each corresponding to the 5' T T N1 NZ T T 3' unit.
According to the invention, the oligonucleotide does not comprise a palindromic sequence. Despite this absence of palindromic sequence, such an oligonucleotide is capable of stimulating human cells of the immune system.
According to one characteristic, the oligonucleotide according to the invention lacks a dinuc:leotide CG in which the cytosine is not methylated. This exclusion also applies to the N1 NZ unit. The ability of the oligonucleotides of the prior art to be immunostimulant has almost always been interpreted as being linked to the presence of nonmethylated CpG units (cf. in particular the article by Krieg et al. in Nature of April 1995, mentioned above), this interpretation being coherent with the observation according to which the frequency of this dinucleotide is approximately four times greater in the genome of bacteria than in that of vertebrates. Surprisingly, it has now been found that oligonucleotides completely lacking this dinucleotide unit are, however, entirely capable of stimulating the cells of the human immune system.
According to a particular embodiment of the present invention, the N1N2 unit corresponds to the dinucleotide AG in which A signifies adenine and G signifies guanine.
According to an advantageous characteristic, the 5' TTAGTT 3' unit is repeated at least once in the oligonucleotide, and preferably at least twice. More preferably, the repeated units are separated by at least one nucleotide N3, which represents adenine, cytosine, guanine or thymine. Within an oligonucleotide, this separating nucleotide may always be the same or may be different each time. Preferably, the nucleotide separating the first two TTAGTT units of the oligonucleotide (taking the direction for reading to be 5'-~3') consists of cytosine.
In particular, for the purpose of the present invention, those oligonucleotides in which the nucleotide sequences correspond to the formula 5' TTAGTTCTTAGTTN3TTAGTT 3', in which N3 represents A, T, C
or G, are preferred.
According to a particular characteristic, the oligonucleotide according to the invention lacks or is low in nucleotide sequence capable of inhibiting the cells of the human immune system. In fact, in order to obtain an overall immunostimulant effect, if inhibitory or neutralizing units such as, for example, those described in application WO 98/52581 are present, their effect must be suppressed or decreased, through the presence of a sequence with more pronounced immunostimulant effect or through the presence of a greater number of 5' T T N1 NZ T T 3' sequences.
A subject of the present invention is also an immunization adjuvant comprising at least one immunostimulant oligonucleotide having at least one 5' T T N1 NZ T T 3' unit as mentioned above. The term "immunization adjuvant" is intended to mean a product which makes it possible to increase or to modify the response of the immune system of an organism with respect to the administration of an antigen. In particular, it may be an increase in the humoral response or in the cellular response.
The action of an immunization adjuvant may also be, not an increase in the response which would. occur in the absence of adjuvant, but a different orientation of the response produced: for example, orientation toward a cellular response rather than a humoral response, production of certain cytokines rather than others, production of certain antibody types or subtypes rather than others, stimulation of certain cells rather than others, etc.
The immunostimulant oligonucleotide of the present invention may be used as an immunization adjuvant whatever the nature of the antigen administered and whatever the number of valencies used. It may be the only adjuvant used or, on the contrary, it may be one element of an adjuvant combination.
The adjuvant action of the oligonucleotide according to the invention may be obtained either when it is combined with the antigens) when they are administered, i.e. when they are part of the same immunization composition, or when it is administered separately from the antigen(s). It is, however, preferred to use it in the same immunization composition as the antigens) to be administered.
The oligonucleotide according to the invention may advantageously be administered via all the routes which can be used for an immunization composition: mucosal route or systemic route.
One of the subjects of the invention is an immunization composition comprising at least one immunostimulant oligonucleotide having a 5' T T N1N2 T T 3' sequence as described above.
An immunization composition according to the invention may be intended for immunization against a single disease or intended for immunization against several diseases. It may be a liquid immunization composition or a lyophilized composition. It may comprise, besides the antigens, all or some of the components conventionally present in a vaccine, such as buffers, stabilizers, preserving agents, etc. It may also comprise one or more adjuvant(s) other than those which are subjects of the present invention. It may also comprise several adjuvants which are subjects of the present invention, consisting either of oligonucleotides which all have the same 5' T T N1 N2 TT
3' unit but which differ by the nucleotides in 5' and/or in 3', or nucleotides which have different 5' T
T N1 NZ T T 3' units, the sequence in 5' and in 3' of which are identical or different.
The immunization composition according to the invention may be intended for prophylactic administration or for therapeutic administration.
The immunization composition according to the invention may be formulated sa as to optimize the adjuvant action of the oligonucleotide which is the subject of the invention. Thus, the oligonucleotide may be coupled to a lipid, such as cholesterol; it may be integrated into an emulsion of the oil/water type or formulated in the form of liposomes.
The following examples illustrate particular embodiments of the present invention.
E-xample 1: Oligonucleotide synthesis 15 oligonucleotides were synthesized, each having one of the following units:
' CA 02376634 2001-12-07 5'TTAATT 3' 5'TTACTT 3' 5' '~ T A T T T 3' Series A
5'TTAGTT 3' 5' TTTTTT 3' 5' TTTATT 3' 5' T T T C T T ~' Series T
5' TTTGTT 3' 5' TTCCTT 3' 5' TTCATT 3' SeriesC
~' 'i"tL TTT 3' 5'TTGGTT 3' 5'TTrATT 3' ,. ; T ~',1 T T Series G
5'TTGCTT 3' and having 4 adenines in 5' and 5 adenines in 3'.
These oligonuc'eotides are synthesized using an automatic synthesizer supplied by Applied Biosystems, wr~icr~ ases the . ~andard phosphoramidite chemical method ar_d whi~h comprises, in each cycle, an oxidation step, which is carried out using a tetraethylthiuram/acetonitrile solution, in order to obtain a phosphorothioate bond.
An ol,'_gonucleoti.de A15(S) which comprises only As and which .is phospho-~othioate throughout its length is also prepa_ed, in the same way. This oligonucleotide is a neg~.tive control since it causes neither proliferation nor an increase in the expression of activation markers on B lymphocytes.
An oligonucleotide 3Db(S), the sequence of which is identified in patent application W096/02555 under SEQ
ID No. 15 (5'GAGAACGCTCGACCTTCGAT3'), is also prepared;
this oligonucleotide comprises phosphorothioate bonds throughout its length and is used as a positive control.
All the oligonucleotides are maintained in solution in PBS buffer.
Example 2: Lymphoproliferation test Lymphocytes are isolated from the peripheral blood of a donor by carrying out a centrifugation on a Ficoll gradient. These lymphocytes are adjusted to 2x106 cells/ml in culture medium (RPMI 1640 + 10% fetal calf serum, and also glutamine, streptomycin and penicillin).
The cells are distributed into 96-well plates (round bottomed) in 100 ~,1, i . a . 2x105 cells pe:r well . 100 ~,1 of a 4 ~,M solution of oligonucleotides to be tested produced in Example 1 (a single type of oligonucleotide per well) are then added in order to obtain a 2 ~,M
final concentration.
The cells are incubated for 48 to 72 hours.
Tritiated thymidine (Amersham TRK 120) is diluted in culture medium and then distributed in the plates in the proportion of 1 ~Ci per well in 50 ~1. After incubation for 7 to 8 hours in an incubator (5% C02, 37°C), the plates can be frozen at -80"C and treated later.
Using a "Harvester", the content of the wells is harvested onto Unif_ilter GF/C plates and 6 washes in distilled water are carried out followed by a wash in 70~ ethanol in order to precipitate the DNA.
After drying the plates, 25 ~tl of liquid scintillant (Microscint-40, Packard) are distributed into each well and allow the radioactivity (radiation emitted by tritium) to be quantified by measuring the number of counts/minute (cpm) emitted by each well on a Top Count counter (Packard).
The results obtained for each of the oligonucleotides tested are represented on figures 1 and 2, which indicate, for each oligonucleotide tested, the number of counts per minute; it is noted that all the nucleotides according to the invention have a result which is clearly greater than the result obtained with the medium alone or the negative control A15(S), which means that they are all capable of stimulating lymphocyte proliferation.
Example 3:
Test relating to activation markers The test is carried out using lymphocytes isolated from a donor as described in the previous example, and adjusted to 2x106 cells/ml in the same culture medium.
The cells are then distributed into 12-well plates in a volume of 2 ml, i.e. 4x106 cells/well. An amount of oligonucleotides to be tested prepared in Example 1 (1 oligonucleotide/well) which is sufficient to obtain a 2 ~M oligonucleotide concentration is added to each we~yl. The cells are then incubated for 72 hours at 37''C. The cells are then double-.Labeled using CD25PE/CD20FITC or CD86PE/CD20FITC, followed by analysis on a FACScan. The results obtained are illustrated on figures 3, 4, 5 and 6, which represent, for each oligonucleotide tested, the percentage of B
cells (CD20+) which express the CD25 receptor (those which are CD25+) or the CD86 marker (those which are CD86+). The results represented on figures 3 and 4 were obtained in a test carried out at a different time from the test for which the results are illustrated on figures 5 and 6, which explains the difference in the order of magnitude of the results obtained.
Specifically, in this type of manipulation, the tests are very variable from one assay to the other, and only the results obtained in the same test are comparable with one another, hence the necessity of including, in each test, an oligonucleotide-control and also an assay of the medium alone.
It is noted that all the oligonucleotides which are subjects of the invention activate the B lymphocytes which express their activation marker CD86, and also the cytokine receptor CD25.
Example 4:
In the same way as in Example 1, a series of 16 oligonucleotides are prepared, which have the following sequences:
Seq ID1 5' TTAGTTATTAGTTATTAGTT 3' .
Seq ID2 5' TTAGTTATTAGTTTTTAGTT 3' .
Seq ID3 5' TTAGTTATTAGTTCTTAGTT 3' .
Seq ID4 5' TTAGTTATTAGTTGTTAGTT 3' .
Seq ID5 5' TTAGTTTTTAGTTATTAGTT 3' .
Seq ID6 5' TTAGTTTTTAGTTTTTAGTT 3' .
Seq ID7 5' TTAGTTTTTAGTTCTTAGTT 3' .
Seq ID8 5' TTAGTTTTTAGTTGTTAGTT 3' .
Seq ID9 5' TTAGTTCTTAGTTATTAGTT 3' .
Seq ID10 . TTAGTTCTTAGTTTTTAGTT 3' 5' Seq ID11 . TTAGTTCTTAGTTCTTAGTT 3' 5' Seq ID12 . TTAGTTCTTAGTTGTTAGTT 3' 5' Seq ID13 . TTAGTTGTTAGTTATTAGTT 3' 5' Seq IJ14 . TTAGTTGTTAGTTTTTAGTT 3' 5' Seq ID15 . TTAGTTGTTAGTTCTTAGTT 3' 5' Seq ID16 . TTAGTTGTTAGTTGTTAGTT 3' 5' These oligonucleotides are of the phosphorothioate type throughout their length.
Example 5:
The capacity of the oligonucleotides prepared in Example 4 to induce human lymphocyte proliferation is evaluated using a lymphoproliferation test such as the one described in Example 2. In the same way as in Example 2, the oligonucleotide concentration per well is 2 ~,M and the controls consist of the medium alone, the oligonucleotide A15(S) and the oligonucleotide 3Db (S) .
The results obtained, expressed in counts per minute, are represented in figure 7, which shows that all the oligonucleotides according to the invention are capable of inducing lymphocyte proliferation and that particularly good results are obtained when the sequences of the oligonucleotides are those identified by Seq IDs 9 to 12, i.e. when cytosine separates the first two TTN1NZTT units of the oligonucleotide .
2.5 Example 6:
The capacity of the oligonucleotides prepared in Example 4 to induce the expression of l.he activation marker CD86 and of the receptor CD25 on B lymphocytes is evaluated. This evaluation is carried out using the test described in Example 3. The results obtained with the oligonucleotides prepared according to Example 4 are represented on figures 8 and 9, which illustrate the percentages of B cells (CD20+) which also express the receptor CD25 (figure 8) or the marker CD86 (figure 9) .
The results obtained in this test confirm those obtained in the lymphoproliferation test: all the oligonucleotides according to the invention induce the expression of activation markers on human B
lyrnphocytes; particularly good results are obtained when the first 2 TTN1N2TT units of the oligonucleotide are separated by cytosine.
Example 7:
The capacity of the oligonucleotides according to the present invention to induce cytokine secretion is evaluated.
For this evaluation, lymphocytes are isolated from the peripheral blood of a donor by carrying out a centrifugation on a Ficoll gradient. These lymphocytes are adjusted to 2x106 cells/ml in culture medium (AIM V
medium + streptomycin + penicillin).
ELISPOT 96-well plates (flat bottom made of nitrocellulose) are pre-incubated the day before with a solution of antibodies for capturing cytokines (IL-10 or y IFN depending on the test carried out), and then saturated with culture medium.
Ne:a, 100 ~l of cells are distributed into the ELISPOT
plates, i.e. 2x105 cells per well, and then 100 ~1 of a 4 ~M solution of oligonucleotides to be tested, produced according to Example 4 (a single type of oligonucleotide per well) are added in order to obtain a 2 ~,M final concentration. The test i.s carried out with the oligonucleotides having t:he sequences described under Seq ID 9, Seq ID 10, Seq ID 11 and Seq ID 12.
The plates are incubated at 37°C, under a 5o C02 atmosphere. After incubation for 72 hours, the cells are removed by washing in the presence of detergent (10 Tween) and the cytokines attached tc the capture antibodies are revealed by successively adding biotinylated detection antibodies (anti-IL-10 or anti-y-IFN depending on the test carried out), streptavidin-HR~ and the AEC substrate.
The spots (1 spot corresponding to 1 cytokine-secreting cell) are counted using an automatic counter. The results are expressed as number of spots (number of secretor cells) per million cells.
The results obtained for each of the oligonucleotides tested are represented on figures 10 and 11, which indicate, for each oligonucleotide tested, the number of cytokine-secreting cells per million total cells it is noted that all the oligonucleotides according to the invention have a result which is clearly greater than the =esult obtained with the medium alone or the negative control A15(S), which means that they are all capable of inducing cytokine secretion, in particular IL10 and Y interferon secretion.
SEQUENCE LISTING
<110> AVENTIS PASTEUR
<120> IMMUNOSTIMULANT OLIGONUCLEOTIDE
<130> PM9908W0 <140>
<141>
<150> 16 <170> Patentin Ver. 2.1 <210> 1 <211> 20 <212> DNA
<213> Artificial sequence <220>
<223> Artificial sequence description: ol:igonucleotide <400> 1 ttagttatta gttattagtt 20 <210> 2 <211> 20 <212> DNA
<213> Artificial sequence <220>
<223> Artificial sequence description: oligonucleotide <400> 2 ttagttatta gtttttagtt 20 <210> 3 <211> 20 <212> DNA
<213> Artificial sequence <220>
<223> Artificial sequence description: oligonucleotide <400> 3 ttag-ttatta gttcttagtt 20 <210> 4 <211> 20 <212> DNA
<213> Artificial sequence <220>
<223> Artificial sequence description: ol:igonucleotide <400> 4 ttagttatta gttgttagtt 20 <210> 5 <211> 20 <212> DNA
<213> Artificial sequence <220>
<223> Artificial sequence description: ol:igonucleotide <400> 5 ttagttttta gttattagtt 20 <210> 6 <211> 20 <212> DNA
<213> Artificial sequence <22G>
<223> Artificial sequence description; ol:igonucleotide <400> 6 ttagttttta gtttttagtt 20 <210> 7 <211> 20 <2i2> DNA
<2i.~> Artificial sequence <220>
<223> Artificial sequence description: oligonucleotide <400> 7 ttagttttta gttcttagtt 20 <210> 8 <211> 20 <212> DNA
<213> Artificial sequence <220>
<223> Artificial sequence description: oli.gonucleotide <400> 8 ttagttttta gttgttagtt 2G
<210> 9 <211> 20 <212> DNA
<213> Artificial sequence <220>
<223> Artificial sequence description: oli.gonucleotide <400> 9 ttagttctta gttattagtt 2G
<210> 10 <211> 20 <212> DNA
<213> Artificial sequence <220>
<223> Artificial sequence description: oligonucleotide 2.5 <400> 10 ttaattcata gtttttagtt 20 <210> 11 <211> 20 <212> DNA
<213> Artificial sequence <220>
<223> Artificial sequence description: oli_gonucleotide <40C> ~~1 ttaattctta gttcttagtt 20 <210> 12 <2~-1> 20 <2i2> DNA
<2~3> Artificial sequence <220>
<223> Artificial sequence description: oligonucleotide <400> 12 ttacttctta gttgttagtt 20 <210> 13 <2_~_.'L> 20 <212> DNA
<213> Artificial sequence <220>
<223> Artificial sequence description: oligonucleotide <400> 13 ttagttgtta gttattagtt 20 <210> 14 <211> 20 <212> DNA
<213> Artificial sequence <22(>
<223> Artificial sequence description: oligonucleotide <400> 14 ttagttgtta gtttttagtt 20 <2~.0> 15 <21 1> 20 <212> DNA
<21~> Artificial sequence <22C~>
<223> Artificial sequence description: ol:igonucleotide <400> 15 ttaattgtta gttcttagtt 20 <210> 16 <211> 20 <2i2> DNA
<<"~3> Artificial sequence <2.~'0>
<223> Artificial sequence description: oligonucleotide LISTE DE SEQUENCES
<110> AVENTIS PASTEUR
s <120> OLIGONUCLEOTIDE IMMUNOSTIMULANT
<130> PM9908W0 <140>
io <141>
<160> 16 <170> Patentln Ver. 2.1 is <210> 1 <211 > 20 <212> ADN
<213> Sequence artificielle 20 <220>
<223> Description de la sequence artificielle:
oligonucleotide <400> 1 ttagttatta gttattagtt 20 2s <210> 2 <211 > 20 <212> ADN
30 <213> Sequence artificielle <220>
<223> Description de la sequence artificielle:
oligonucleotide <400> 2 3s ttagttatta gtttttagtt 20 <210> 3 <211 > 20 40 <212> ADN
<213> Sequence artificielle <220>
<223> Description de la sequence artificielle:
oligonucleotide 4s <400> 3 ttagttatta gttcttagtt 20 <210> 4 <211 > 20 <212> ADN
<213> Sequence artificielle s <220>
<223> Description de la sequence artificielle:
oligonucleotide <400> 4 ttagttatta gttgttagtt 20 to <210> 5 <211 > 20 <212> ADN
is <213> Sequence artificielle <220>
<223> Description de la sequence artificielle:
oligonucleotide <400> 5 2o ttagttttta gttattagtt 20 <210> 6 <211 > 20 2s <212> ADN
<213> Sequence artificielle <220>
<223> Description de la sequence artificielle:
oligonucleotide 30 <400> 6 ttagttttta gtttttagtt 20 <210> 7 3s <211 > 20 <212> ADN
<213> Sequence artificielle <220>
<223> Description de la sequence artificielle:
40 oligonucleotide <400> 7 ttagttttta gttcttagtt 20 <210> 8 <211 > 20 <212> ADN
s <213> Sequence artificielle <220>
<223> Description de la sequence artificielle:
oligonucleotide <400> 8 io ttagttttta gttgttagtt 20 <210> 9 <211 > 20 Is <212> ADN
<213> Sequence artificielle <220>
<223> Description de la sequence artificielle:
oligonucleotide 20 <400> 9 ttagttctta gttattagtt 20 <210> 10 2s <211 > 20 <212> ADN
<213> Sequence artificielle <220>
<223> Description de la sequence artificielle:
30 oligonucleotide <400> 10 ttagttctta gtttttagtt 20 3s <210> 11 <211 > 20 <212> ADN
<213> Sequence artificielle <220>
40 <223> Description de la sequence artificielle:
oligonucleotide <400> 11 ttagttctta gttcttagtt 20 <210> 12 <211 > 20 <212> ADN
s <213> Sequence artificielle <220>
<223> Description de la sequence artificielle:
oligonucleotide <400> 12 io ttagttctta gttgttagtt 20 <210> 13 <211 > 20 is <212> ADN
<213> Sequence artificielle <220>
<223> Description de la sequence artificielle:
oligonucleotide 20 <400> 13 ttagttgtta gttattagtt 20 <210> 14 2s <211 > 20 <212> ADN
<213> Sequence artificielle <220>
<223> Description de la sequence artificielle:
30 oligonucleotide <400> 14 ttagttgtta gtttttagtt 20 3s <210> 15 <211 > 20 <212> ADN
<213> Sequence artificielle <220>
40 <223> Description de la sequence artificielle:
oligonucleotide <400> 15 ttagttgtta gttcttagtt 20 <210> 16 <211 > 20 <212> ADN
s <213> Sequence artificielle <220>
<223> Description de la sequence artificielle:
oligonucleotide <400> 16 to ttagttgtta gttgttagtt 20 is
Claims (19)
1. An immunostimulant oligonucleotide, characterized in that it comprises at least one nucleotide sequence having the following formula 5' TTN1N2TT 3', in which T signifies thymine, and N1 and N2 may each represent adenine, thymine, cytosine or guanine, and in that it lacks a dinucleotide CG in which the cytosine C is not methylated.
2. The oligonucleotide as claimed in claim 1, characterized in that it comprises from 6 to 100 nucleotides.
3. The oligonucleotide as claimed in claim 1, characterized in that N1 represents adenine and in that N2 represents guanine.
4. The oligonucleotide as claimed in one of the preceding claims, characterized in that the 5' T T N1 N2 T T 3' unit is repeated at least once.
5. The oligonucleotide as claimed in the preceding claim, characterized in that the 5' T T N1 N2 T T 3' unit is repeated twice.
6. The oligonucleotide as claimed in either of claims 4 and 5, characterized in that the repeated 5' T T N1 N2 T T 3' units are separated by a nucleotide N3 which, each time, may be identical or different, and which may represent A, C, T or G.
7. The oligonucleotide as claimed in the preceding claim, characterized in that the nucleotide N3 separating the first two TTN1N2TT units read when the sequence is in the 5' .fwdarw. 3' orientation represents cytosine.
8. The oligonucleotide as claimed in one of the preceding claims, characterized in that it comprises the sequence 5' TTAGTTCTTAGTTN3TTAGTT 3', in which A
represents adenine, T represents thymine, G represents guanine and C represents cytosine, and in which N3 may signify A, T, C or G.
represents adenine, T represents thymine, G represents guanine and C represents cytosine, and in which N3 may signify A, T, C or G.
9. The oligonucleotide as claimed in one of the preceding claims, characterized in that it is capable of inducing human lymphocyte proliferation.
10. The oligonucleotide as claimed in one of the preceding claims, characterized in that it is capable of inducing cytokine secretion.
11. The oligonucleotide as claimed in the preceding claim, characterized in that it is capable of producing IL 10 secretion.
12. The oligonucleotide as claimed in claim 10, characterized in that it is capable of inducing .gamma.
interferon secretion.
interferon secretion.
13. The oligonucleotide as claimed in one of the preceding claims, characterized in that it is capable of increasing the expression of the activation marker CD86 on human B lymphocytes.
14. The oligonucleotide as claimed in one of the preceding claims, characterized in that it is capable of increasing the expression of the cytokine receptor CD25 on human B lymphocytes.
15. The use of an oligonucleotide as claimed in one of the preceding claims, for manufacturing a medicinal produce.
16. The use of an oligonucleotide as claimed in one of claims 1 to 10, for manufacturing a human immunostimulant.
17. The use of an oligonucleotide as claimed in one of claims 1 to 10, for manufacturing an. immunization adjuvant.
18. The use of an oligonucleotide as claimed in one of claims 1 to 10, for manufacturing an immunization composition.
19. An immunization composition for human use, comprising at least one immunization antigen, characterized in that it also comprises at least one oligonucleotide as claimed in one of claims 1 to 10.
Applications Claiming Priority (5)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| FR99/07457 | 1999-06-08 | ||
| FR9907457 | 1999-06-08 | ||
| FR9910378A FR2797263B1 (en) | 1999-08-06 | 1999-08-06 | IMMUNOSTIMULANT OLIGONUCLEOTIDE |
| FR99/10378 | 1999-08-06 | ||
| PCT/FR2000/001566 WO2000075304A1 (en) | 1999-06-08 | 2000-06-08 | Immunostimulant oligonucleotide |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CA2376634A1 true CA2376634A1 (en) | 2000-12-14 |
Family
ID=26234986
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CA002376634A Abandoned CA2376634A1 (en) | 1999-06-08 | 2000-06-08 | Immunostimulant oligonucleotide |
Country Status (5)
| Country | Link |
|---|---|
| EP (1) | EP1196558A1 (en) |
| AU (1) | AU776268B2 (en) |
| CA (1) | CA2376634A1 (en) |
| NZ (1) | NZ515957A (en) |
| WO (1) | WO2000075304A1 (en) |
Cited By (18)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US8217016B2 (en) | 2001-12-19 | 2012-07-10 | Curevac Gmbh | Application of mRNA for use as a therapeutic agent for tumorous diseases |
| US8664194B2 (en) | 2011-12-16 | 2014-03-04 | Moderna Therapeutics, Inc. | Method for producing a protein of interest in a primate |
| US8710200B2 (en) | 2011-03-31 | 2014-04-29 | Moderna Therapeutics, Inc. | Engineered nucleic acids encoding a modified erythropoietin and their expression |
| US8822663B2 (en) | 2010-08-06 | 2014-09-02 | Moderna Therapeutics, Inc. | Engineered nucleic acids and methods of use thereof |
| US8980864B2 (en) | 2013-03-15 | 2015-03-17 | Moderna Therapeutics, Inc. | Compositions and methods of altering cholesterol levels |
| US8999380B2 (en) | 2012-04-02 | 2015-04-07 | Moderna Therapeutics, Inc. | Modified polynucleotides for the production of biologics and proteins associated with human disease |
| US9107886B2 (en) | 2012-04-02 | 2015-08-18 | Moderna Therapeutics, Inc. | Modified polynucleotides encoding basic helix-loop-helix family member E41 |
| US9283287B2 (en) | 2012-04-02 | 2016-03-15 | Moderna Therapeutics, Inc. | Modified polynucleotides for the production of nuclear proteins |
| US9334328B2 (en) | 2010-10-01 | 2016-05-10 | Moderna Therapeutics, Inc. | Modified nucleosides, nucleotides, and nucleic acids, and uses thereof |
| US9428535B2 (en) | 2011-10-03 | 2016-08-30 | Moderna Therapeutics, Inc. | Modified nucleosides, nucleotides, and nucleic acids, and uses thereof |
| US9464124B2 (en) | 2011-09-12 | 2016-10-11 | Moderna Therapeutics, Inc. | Engineered nucleic acids and methods of use thereof |
| US9572874B2 (en) | 2008-09-30 | 2017-02-21 | Curevac Ag | Composition comprising a complexed (M)RNA and a naked mRNA for providing or enhancing an immunostimulatory response in a mammal and uses thereof |
| US9572897B2 (en) | 2012-04-02 | 2017-02-21 | Modernatx, Inc. | Modified polynucleotides for the production of cytoplasmic and cytoskeletal proteins |
| US9597380B2 (en) | 2012-11-26 | 2017-03-21 | Modernatx, Inc. | Terminally modified RNA |
| US10188748B2 (en) | 2001-06-05 | 2019-01-29 | Curevac Ag | Pharmaceutical composition containing a stabilised mRNA optimised for translation in its coding regions |
| US10323076B2 (en) | 2013-10-03 | 2019-06-18 | Modernatx, Inc. | Polynucleotides encoding low density lipoprotein receptor |
| US10815291B2 (en) | 2013-09-30 | 2020-10-27 | Modernatx, Inc. | Polynucleotides encoding immune modulating polypeptides |
| US10898584B2 (en) | 2013-11-01 | 2021-01-26 | Curevac Ag | Modified RNA with decreased immunostimulatory properties |
Families Citing this family (44)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6207646B1 (en) | 1994-07-15 | 2001-03-27 | University Of Iowa Research Foundation | Immunostimulatory nucleic acid molecules |
| DE69932717T2 (en) | 1998-05-22 | 2007-08-09 | Ottawa Health Research Institute, Ottawa | METHODS AND PRODUCTS FOR INDUCING MUCOSAL IMMUNITY |
| ATE464907T1 (en) | 1999-02-17 | 2010-05-15 | Csl Ltd | IMMUNOGENIC COMPLEXES AND METHODS RELATING THEM |
| AP2006003503A0 (en) | 1999-09-25 | 2006-02-28 | Univ Iowa Res Found | Immunostimulatory nucleic acids. |
| SI1446162T1 (en) | 2001-08-17 | 2009-04-30 | Coley Pharm Gmbh | Combination motif immune stimulatory oligonucleotides with improved activity |
| CA2365732A1 (en) | 2001-12-20 | 2003-06-20 | Ibm Canada Limited-Ibm Canada Limitee | Testing measurements |
| CA2388049A1 (en) | 2002-05-30 | 2003-11-30 | Immunotech S.A. | Immunostimulatory oligonucleotides and uses thereof |
| AU2003299863B2 (en) | 2002-08-15 | 2009-09-24 | 3M Innovative Properties Company | Immunostimulatory compositions and methods of stimulating an immune response |
| AU2003300919A1 (en) | 2002-12-11 | 2004-06-30 | Coley Pharmaceutical Gmbh | 5' cpg nucleic acids and methods of use |
| US7387271B2 (en) | 2002-12-30 | 2008-06-17 | 3M Innovative Properties Company | Immunostimulatory combinations |
| WO2004071459A2 (en) | 2003-02-13 | 2004-08-26 | 3M Innovative Properties Company | Methods and compositions related to irm compounds and toll-like receptor 8 |
| US7485432B2 (en) | 2003-02-27 | 2009-02-03 | 3M Innovative Properties Company | Selective modulation of TLR-mediated biological activity |
| AU2004218349A1 (en) | 2003-03-04 | 2004-09-16 | 3M Innovative Properties Company | Prophylactic treatment of UV-induced epidermal neoplasia |
| MXPA05009694A (en) | 2003-03-13 | 2005-10-20 | 3M Innovative Properties Co | Methods of improving skin quality. |
| CA2518445A1 (en) | 2003-03-13 | 2004-09-23 | 3M Innovative Properties Company | Method of tattoo removal |
| US20040192585A1 (en) | 2003-03-25 | 2004-09-30 | 3M Innovative Properties Company | Treatment for basal cell carcinoma |
| AU2004244962A1 (en) | 2003-04-10 | 2004-12-16 | 3M Innovative Properties Company | Delivery of immune response modifier compounds using metal-containing particulate support materials |
| AU2004268616B2 (en) | 2003-08-25 | 2010-10-07 | 3M Innovative Properties Company | Delivery of immune response modifier compounds |
| BRPI0414856A (en) | 2003-10-03 | 2006-11-21 | 3M Innovative Properties Co | alkoxy-substituted imidazoquinolines |
| US8691837B2 (en) | 2003-11-25 | 2014-04-08 | 3M Innovative Properties Company | Substituted imidazo ring systems and methods |
| US8940755B2 (en) | 2003-12-02 | 2015-01-27 | 3M Innovative Properties Company | Therapeutic combinations and methods including IRM compounds |
| HUE026644T2 (en) | 2004-05-28 | 2016-07-28 | Oryxe | A mixture for transdermal delivery of low and high molecular weight compounds |
| ES2538498T3 (en) | 2004-12-30 | 2015-06-22 | Meda Ab | Use of Imiquimod for the treatment of skin metastases from a breast cancer tumor |
| US9248127B2 (en) | 2005-02-04 | 2016-02-02 | 3M Innovative Properties Company | Aqueous gel formulations containing immune response modifiers |
| DE102006007433A1 (en) * | 2006-02-17 | 2007-08-23 | Curevac Gmbh | Immunostimulant adjuvant useful in vaccines against cancer or infectious diseases comprises a lipid-modified nucleic acid |
| EP3085373A1 (en) | 2006-02-22 | 2016-10-26 | 3M Innovative Properties Company | Immune response modifier conjugates |
| AU2007280690C1 (en) | 2006-07-31 | 2012-08-23 | Curevac Gmbh | Nucleic acid of formula (I): GIXmGn, or (II): CIXmCn, in particular as an immune-stimulating agent/adjuvant |
| WO2009030254A1 (en) | 2007-09-04 | 2009-03-12 | Curevac Gmbh | Complexes of rna and cationic peptides for transfection and for immunostimulation |
| RU2545701C2 (en) | 2008-01-31 | 2015-04-10 | Куревак Гмбх | NUCLEIC ACIDS OF FORMULA (I) (NuGlXmGnNv)a AND DERIVATIVES THEREOF AS IMMUNOSTIMULATING AGENTS/ADJUVANTS |
| US20110053829A1 (en) | 2009-09-03 | 2011-03-03 | Curevac Gmbh | Disulfide-linked polyethyleneglycol/peptide conjugates for the transfection of nucleic acids |
| DK2449113T3 (en) | 2010-07-30 | 2016-01-11 | Curevac Ag | Complex formation of nucleic acids with the disulfide cross-linked cationic components for transfection and immunostimulation |
| JP6460789B2 (en) | 2011-06-03 | 2019-01-30 | スリーエム イノベイティブ プロパティズ カンパニー | Heterobifunctional linker having polyethylene glycol segment and immune response modulating complex prepared from the linker |
| CA2838023C (en) | 2011-06-03 | 2019-08-13 | 3M Innovative Properties Company | Hydrazino 1h-imidazoquinolin-4-amines and conjugates made therefrom |
| US20130023736A1 (en) | 2011-07-21 | 2013-01-24 | Stanley Dale Harpstead | Systems for drug delivery and monitoring |
| WO2013113326A1 (en) | 2012-01-31 | 2013-08-08 | Curevac Gmbh | Pharmaceutical composition comprising a polymeric carrier cargo complex and at least one protein or peptide antigen |
| MX369469B (en) | 2013-08-21 | 2019-11-08 | Curevac Ag | Respiratory syncytial virus (rsv) vaccine. |
| CA2936286A1 (en) | 2014-04-01 | 2015-10-08 | Curevac Ag | Polymeric carrier cargo complex for use as an immunostimulating agent or as an adjuvant |
| EP3349717A4 (en) | 2015-09-17 | 2019-04-17 | JRX Biotechnology, Inc. | Approaches for improving skin hydration or moisturization |
| KR20200128116A (en) | 2018-02-28 | 2020-11-11 | 화이자 인코포레이티드 | IL-15 variants and uses thereof |
| CA3100829A1 (en) | 2018-05-23 | 2019-11-28 | Pfizer Inc. | Antibodies specific for gucy2c and uses thereof |
| EP3797121A1 (en) | 2018-05-23 | 2021-03-31 | Pfizer Inc | Antibodies specific for cd3 and uses thereof |
| US20220370606A1 (en) | 2018-12-21 | 2022-11-24 | Pfizer Inc. | Combination Treatments Of Cancer Comprising A TLR Agonist |
| MX2022006578A (en) | 2019-12-17 | 2022-07-04 | Pfizer | Antibodies specific for cd47, pd-l1, and uses thereof. |
| JP2023533793A (en) | 2020-07-17 | 2023-08-04 | ファイザー・インク | Therapeutic antibodies and their uses |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1995026204A1 (en) * | 1994-03-25 | 1995-10-05 | Isis Pharmaceuticals, Inc. | Immune stimulation by phosphorothioate oligonucleotide analogs |
| AU738513B2 (en) * | 1997-02-28 | 2001-09-20 | University Of Iowa Research Foundation, The | Use of nucleic acids containing unmethylated CpG dinucleotide in the treatment of LPS-associated disorders |
-
2000
- 2000-06-08 AU AU55389/00A patent/AU776268B2/en not_active Ceased
- 2000-06-08 NZ NZ515957A patent/NZ515957A/en unknown
- 2000-06-08 EP EP00940454A patent/EP1196558A1/en not_active Ceased
- 2000-06-08 CA CA002376634A patent/CA2376634A1/en not_active Abandoned
- 2000-06-08 WO PCT/FR2000/001566 patent/WO2000075304A1/en not_active Application Discontinuation
Cited By (65)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10188748B2 (en) | 2001-06-05 | 2019-01-29 | Curevac Ag | Pharmaceutical composition containing a stabilised mRNA optimised for translation in its coding regions |
| US11369691B2 (en) | 2001-06-05 | 2022-06-28 | Curevac Ag | Pharmaceutical composition containing a stabilised mRNA optimised for translation in its coding regions |
| US11135312B2 (en) | 2001-06-05 | 2021-10-05 | Curevac Ag | Pharmaceutical composition containing a stabilised mRNA optimised for translation in its coding regions |
| US10568972B2 (en) | 2001-06-05 | 2020-02-25 | Curevac Ag | Pharmaceutical composition containing a stabilised mRNA optimised for translation in its coding regions |
| US9433670B2 (en) | 2001-12-19 | 2016-09-06 | Curevac Ag | Application of mRNA for use as a therapeutic against tumour diseases |
| US9655955B2 (en) | 2001-12-19 | 2017-05-23 | Curevac Ag | Application of mRNA for use as a therapeutic against tumour diseases |
| US9463228B2 (en) | 2001-12-19 | 2016-10-11 | Curevac Ag | Application of mRNA for use as a therapeutic against tumour diseases |
| US9439956B2 (en) | 2001-12-19 | 2016-09-13 | Curevac Ag | Application of mRNA for use as a therapeutic against tumour diseases |
| US9433669B2 (en) | 2001-12-19 | 2016-09-06 | Curevac Ag | Application of mRNA for use as a therapeutic against tumor diseases |
| US8217016B2 (en) | 2001-12-19 | 2012-07-10 | Curevac Gmbh | Application of mRNA for use as a therapeutic agent for tumorous diseases |
| US9155788B2 (en) | 2001-12-19 | 2015-10-13 | Curevac Gmbh | Application of mRNA for use as a therapeutic against tumour diseases |
| US9572874B2 (en) | 2008-09-30 | 2017-02-21 | Curevac Ag | Composition comprising a complexed (M)RNA and a naked mRNA for providing or enhancing an immunostimulatory response in a mammal and uses thereof |
| US8822663B2 (en) | 2010-08-06 | 2014-09-02 | Moderna Therapeutics, Inc. | Engineered nucleic acids and methods of use thereof |
| US9937233B2 (en) | 2010-08-06 | 2018-04-10 | Modernatx, Inc. | Engineered nucleic acids and methods of use thereof |
| US9447164B2 (en) | 2010-08-06 | 2016-09-20 | Moderna Therapeutics, Inc. | Engineered nucleic acids and methods of use thereof |
| US9181319B2 (en) | 2010-08-06 | 2015-11-10 | Moderna Therapeutics, Inc. | Engineered nucleic acids and methods of use thereof |
| US9334328B2 (en) | 2010-10-01 | 2016-05-10 | Moderna Therapeutics, Inc. | Modified nucleosides, nucleotides, and nucleic acids, and uses thereof |
| US10064959B2 (en) | 2010-10-01 | 2018-09-04 | Modernatx, Inc. | Modified nucleosides, nucleotides, and nucleic acids, and uses thereof |
| US9657295B2 (en) | 2010-10-01 | 2017-05-23 | Modernatx, Inc. | Modified nucleosides, nucleotides, and nucleic acids, and uses thereof |
| US9533047B2 (en) | 2011-03-31 | 2017-01-03 | Modernatx, Inc. | Delivery and formulation of engineered nucleic acids |
| US9950068B2 (en) | 2011-03-31 | 2018-04-24 | Modernatx, Inc. | Delivery and formulation of engineered nucleic acids |
| US8710200B2 (en) | 2011-03-31 | 2014-04-29 | Moderna Therapeutics, Inc. | Engineered nucleic acids encoding a modified erythropoietin and their expression |
| US10751386B2 (en) | 2011-09-12 | 2020-08-25 | Modernatx, Inc. | Engineered nucleic acids and methods of use thereof |
| US10022425B2 (en) | 2011-09-12 | 2018-07-17 | Modernatx, Inc. | Engineered nucleic acids and methods of use thereof |
| US9464124B2 (en) | 2011-09-12 | 2016-10-11 | Moderna Therapeutics, Inc. | Engineered nucleic acids and methods of use thereof |
| US9428535B2 (en) | 2011-10-03 | 2016-08-30 | Moderna Therapeutics, Inc. | Modified nucleosides, nucleotides, and nucleic acids, and uses thereof |
| US8754062B2 (en) | 2011-12-16 | 2014-06-17 | Moderna Therapeutics, Inc. | DLIN-KC2-DMA lipid nanoparticle delivery of modified polynucleotides |
| US9271996B2 (en) | 2011-12-16 | 2016-03-01 | Moderna Therapeutics, Inc. | Formulation and delivery of PLGA microspheres |
| US8680069B2 (en) | 2011-12-16 | 2014-03-25 | Moderna Therapeutics, Inc. | Modified polynucleotides for the production of G-CSF |
| US9295689B2 (en) | 2011-12-16 | 2016-03-29 | Moderna Therapeutics, Inc. | Formulation and delivery of PLGA microspheres |
| US9186372B2 (en) | 2011-12-16 | 2015-11-17 | Moderna Therapeutics, Inc. | Split dose administration |
| US8664194B2 (en) | 2011-12-16 | 2014-03-04 | Moderna Therapeutics, Inc. | Method for producing a protein of interest in a primate |
| US9301993B2 (en) | 2012-04-02 | 2016-04-05 | Moderna Therapeutics, Inc. | Modified polynucleotides encoding apoptosis inducing factor 1 |
| US9828416B2 (en) | 2012-04-02 | 2017-11-28 | Modernatx, Inc. | Modified polynucleotides for the production of secreted proteins |
| US9107886B2 (en) | 2012-04-02 | 2015-08-18 | Moderna Therapeutics, Inc. | Modified polynucleotides encoding basic helix-loop-helix family member E41 |
| US9095552B2 (en) | 2012-04-02 | 2015-08-04 | Moderna Therapeutics, Inc. | Modified polynucleotides encoding copper metabolism (MURR1) domain containing 1 |
| US9089604B2 (en) | 2012-04-02 | 2015-07-28 | Moderna Therapeutics, Inc. | Modified polynucleotides for treating galactosylceramidase protein deficiency |
| US9149506B2 (en) | 2012-04-02 | 2015-10-06 | Moderna Therapeutics, Inc. | Modified polynucleotides encoding septin-4 |
| US9061059B2 (en) | 2012-04-02 | 2015-06-23 | Moderna Therapeutics, Inc. | Modified polynucleotides for treating protein deficiency |
| US9303079B2 (en) | 2012-04-02 | 2016-04-05 | Moderna Therapeutics, Inc. | Modified polynucleotides for the production of cytoplasmic and cytoskeletal proteins |
| US9050297B2 (en) | 2012-04-02 | 2015-06-09 | Moderna Therapeutics, Inc. | Modified polynucleotides encoding aryl hydrocarbon receptor nuclear translocator |
| US9572897B2 (en) | 2012-04-02 | 2017-02-21 | Modernatx, Inc. | Modified polynucleotides for the production of cytoplasmic and cytoskeletal proteins |
| US9587003B2 (en) | 2012-04-02 | 2017-03-07 | Modernatx, Inc. | Modified polynucleotides for the production of oncology-related proteins and peptides |
| US9192651B2 (en) | 2012-04-02 | 2015-11-24 | Moderna Therapeutics, Inc. | Modified polynucleotides for the production of secreted proteins |
| US9283287B2 (en) | 2012-04-02 | 2016-03-15 | Moderna Therapeutics, Inc. | Modified polynucleotides for the production of nuclear proteins |
| US8999380B2 (en) | 2012-04-02 | 2015-04-07 | Moderna Therapeutics, Inc. | Modified polynucleotides for the production of biologics and proteins associated with human disease |
| US9675668B2 (en) | 2012-04-02 | 2017-06-13 | Moderna Therapeutics, Inc. | Modified polynucleotides encoding hepatitis A virus cellular receptor 2 |
| US9782462B2 (en) | 2012-04-02 | 2017-10-10 | Modernatx, Inc. | Modified polynucleotides for the production of proteins associated with human disease |
| US9814760B2 (en) | 2012-04-02 | 2017-11-14 | Modernatx, Inc. | Modified polynucleotides for the production of biologics and proteins associated with human disease |
| US9114113B2 (en) | 2012-04-02 | 2015-08-25 | Moderna Therapeutics, Inc. | Modified polynucleotides encoding citeD4 |
| US9827332B2 (en) | 2012-04-02 | 2017-11-28 | Modernatx, Inc. | Modified polynucleotides for the production of proteins |
| US9878056B2 (en) | 2012-04-02 | 2018-01-30 | Modernatx, Inc. | Modified polynucleotides for the production of cosmetic proteins and peptides |
| US9216205B2 (en) | 2012-04-02 | 2015-12-22 | Moderna Therapeutics, Inc. | Modified polynucleotides encoding granulysin |
| US9255129B2 (en) | 2012-04-02 | 2016-02-09 | Moderna Therapeutics, Inc. | Modified polynucleotides encoding SIAH E3 ubiquitin protein ligase 1 |
| US9254311B2 (en) | 2012-04-02 | 2016-02-09 | Moderna Therapeutics, Inc. | Modified polynucleotides for the production of proteins |
| US9233141B2 (en) | 2012-04-02 | 2016-01-12 | Moderna Therapeutics, Inc. | Modified polynucleotides for the production of proteins associated with blood and lymphatic disorders |
| US9220755B2 (en) | 2012-04-02 | 2015-12-29 | Moderna Therapeutics, Inc. | Modified polynucleotides for the production of proteins associated with blood and lymphatic disorders |
| US9221891B2 (en) | 2012-04-02 | 2015-12-29 | Moderna Therapeutics, Inc. | In vivo production of proteins |
| US10501512B2 (en) | 2012-04-02 | 2019-12-10 | Modernatx, Inc. | Modified polynucleotides |
| US9220792B2 (en) | 2012-04-02 | 2015-12-29 | Moderna Therapeutics, Inc. | Modified polynucleotides encoding aquaporin-5 |
| US9597380B2 (en) | 2012-11-26 | 2017-03-21 | Modernatx, Inc. | Terminally modified RNA |
| US8980864B2 (en) | 2013-03-15 | 2015-03-17 | Moderna Therapeutics, Inc. | Compositions and methods of altering cholesterol levels |
| US10815291B2 (en) | 2013-09-30 | 2020-10-27 | Modernatx, Inc. | Polynucleotides encoding immune modulating polypeptides |
| US10323076B2 (en) | 2013-10-03 | 2019-06-18 | Modernatx, Inc. | Polynucleotides encoding low density lipoprotein receptor |
| US10898584B2 (en) | 2013-11-01 | 2021-01-26 | Curevac Ag | Modified RNA with decreased immunostimulatory properties |
Also Published As
| Publication number | Publication date |
|---|---|
| EP1196558A1 (en) | 2002-04-17 |
| AU5538900A (en) | 2000-12-28 |
| WO2000075304A1 (en) | 2000-12-14 |
| AU776268B2 (en) | 2004-09-02 |
| NZ515957A (en) | 2003-08-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CA2376634A1 (en) | Immunostimulant oligonucleotide | |
| DE60100814T2 (en) | IMMUNITIMULATING OLIGODEOXYNUCLEOTIDES | |
| Verthelyi et al. | Human peripheral blood cells differentially recognize and respond to two distinct CPG motifs | |
| US8389495B2 (en) | Olioodeoxynucleotide and its use to induce an immune response | |
| Yi et al. | Rapid immune activation by CpG motifs in bacterial DNA. Systemic induction of IL-6 transcription through an antioxidant-sensitive pathway. | |
| JP4874801B2 (en) | Stabilized immunomodulatory oligonucleotide | |
| CN1604795B (en) | Combination motif immune stimulatory oligonucleotides with improved activity | |
| KR101123489B1 (en) | Modulation of immunostimulatory properties of oligonucleotide-based compounds by utilizing modified immunostimulatory dinucleotides | |
| US7960356B2 (en) | Oligodeoxynucleotide and its use to induce an immune response | |
| KR100945104B1 (en) | Modulation of immunostimulatory properties of oligonucleotide-based compounds by optimal presentation of 5' ends | |
| KR101862271B1 (en) | Non-coding immunomodulatory dna construct | |
| DE60221004T2 (en) | IMMUNOSTIMULATING OLIGODE OXYRIBONUCLEINE MOLECULES | |
| KR100721928B1 (en) | Pharmaceutical composition for treating or preventing dermatitis comprising CpG oligodeoxynucleotide | |
| EP1322655A1 (en) | Oligodeoxynucleotide and its use to induce an immune response | |
| JP2007500018A6 (en) | Stabilized immunomodulatory oligonucleotide | |
| Coban et al. | Effect of plasmid backbone modification by different human CpG motifs on the immunogenicity of DNA vaccine vectors | |
| KR20060135691A (en) | Modulation of immunostimulatory properties by small oligonucleotide-based compounds | |
| WO2006053861A1 (en) | Oligonucleotides that induce the secretion of gm-csf | |
| JP2007531510A (en) | Short immunomodulatory oligonucleotides | |
| Domeika et al. | Characteristics of oligodeoxyribonucleotides that induce interferon (IFN)-α in the pig and the phenotype of the IFN-α producing cells | |
| Dar et al. | All three classes of CpG ODNs up-regulate IP-10 gene in pigs | |
| Kandimalla et al. | Synthesis and immunological activities of novel Toll-like receptor 7 and 8 agonists | |
| Choi et al. | Identification of immunostimulatory oligodeoxynucleotide from Escherichia coli genomic DNA | |
| JP2006325540A (en) | Oligodeoxynucleotide and immunomodulating agent utilizing the same | |
| Duvanov | Selection of oligonucleotides specific to chicken peripheral blood mononuclear cells in whole blood ex vivo system |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| EEER | Examination request | ||
| FZDE | Dead |