CA2388049A1

CA2388049A1 - Immunostimulatory oligonucleotides and uses thereof

Info

Publication number: CA2388049A1
Application number: CA002388049A
Authority: CA
Inventors: Ricardo Augustin Lopez
Original assignee: Immunotech SA
Current assignee: Immunotech SA; Immunotech SAS
Priority date: 2002-05-30
Filing date: 2002-05-30
Publication date: 2003-11-30
Also published as: AU2003250334B2; ATE541039T1; US8871436B2; US20090060937A1; KR20050005521A; US7038029B2; AU2003250334A1; MXPA04011937A; WO2003101375A3; JP4568907B2; DK1511845T3; ES2380796T3; PT1511845E; CY1112588T1; JP2005533491A; US7381807B2; US7943316B2; US20040006032A1; WO2003101375A2; EP1511845A2

Abstract

Oligonucleotides containing the non-palindromic sequence motif: X1X2X3X4X5X6X7X8, wherein X1 is C, T, G or A (preferably T or C); X2 is C, T, G or A; X7 is C, T, G or A (preferably G); at least three, and preferably all, of X3, X4, X5, X6 and X8 are T; with the proviso that, in the motif, a C does not precede a G (in other terms, the nucleic acid motif does not consist of a CpG oligonucleotide), that modulate the immune response of animals of the order Primate, including humans are disclosed. This immune modulation is characterized by stimulation of proliferation, differentiation, cytokine production and antibody production on B-cells and cell differentiation, cytokine production and antibody production on B-cells and cell differentiation on plasmacytoid dendritic cells.

Description

IMMUNOSTIMULATORY OLIGONUCLEOTIDES
AND USES THEREOF
FIELD OF THE INVENTION
The present invention relates generally to oligonucleotides and more specifically to immunostimulatory oligonucleotides and their use in the treatment or prevention of diseases and/or immunological disorders.
BACKGROUND OF THE INVENTION
Oligonucleotides containing therapeutic utilities based on their ability to stimulate an immune response are known in the art. Indeed, experimental studies indicate therapeutic utility for the oligonucleotides as a vaccine adjuvant and for the immunotherapy of cancer and infectious and allergic disE~ases.
For instance, several polynucleotides have been demonstrated to have immunostimulatory properties, such as poly (1,C) as an inducer of interferon (IFN) production, macrophage activation and NK cell activation (Talmadge et a1.1985.
Cancer Res. 45:1058; Wiltrout et al. 1985. J. Biol. Resp. Mod. 4:512), poly (dG,dC) as a mitogen for B cells (Messing et al 1993. Cell. Irnmunol. 147:148) and as an inducer for IFN and NK activity (Tocunaga et al 1988. Jpn.J. Cancer Res.
79:682).
Bacterial DNA has also been reported to have immunostimulatory properties. These properties include the induction of cytokines (interferon gamma (IFN y), alpha (IFN a ), beta (IFN Vii); tumor necrosis factor alpha (TNF a ), interleukin 6 (1L6), 12 (IL 12) and 18 (IL 18), as well as the direct stimulation of B
cells (Yamamoto et al. 1988, Jpn. J. Cancer Res. (Gann) 79: 866-873; Yamamoto et al., 1992, Microbiol. Immunol. 36: 983-997.; Klinman et al. 1996. Proc.
Natl.
Acad. Sci. USA 93, 2879-2883.; Halpern et al. 1996. Cell. Immunol. 167: 72-78.

Sparwasser et al. 1997. Eur. J. Immunol. 27: 1671-1679; Krieg et al. 1995.
Nature 374: 345-349).
In contrast, it has been reported that mammalian DNA has no significant immune effects (Pisetsky 1996. J. Immunol. 156: 421-423 ; lVlessina et al.
1991. J.
Immunol. 147: 1759). Synthetic DNA has also been reported to be irnmunostimulatory if it contains unmethylated CpG motifs. (Yamamoto et al.;
1992. J. Immunol. 148: 4072-4076; Ballas et al. 1996. J. Immunol. 157: 1840-1845; Hartmann et al. 2000. J. Immunol. 164:944; Hartmann et al. 2000.
J. Immunol. 164:1617; Verthelyi et al. 2001. J. Immunol. 166:2372). Examples of immunostimulatory oligonucleotides containing unmethylated CpG motifs are also shown in US patent no.6,239,116 and international PC;T patent application no.WO 96/02555. Furthermore, EP 0 468 520 teaches that to be immunostimulatory, oligonucleotides require a palindromic sequence of at least nucleotides long.
However, at least one oligonucleotide containing phophorothioate bonds that lack CpG motifs has been found to have some immunostimulatory activity on human B cells (Liang et al. 1996. J. Clin. Invest. 98:1119). This particular non-CpG oligonucleotide containing phophorothioate bonds is a poly-T chain of 20 nucleotides long.
Although the immunostimulatory oligonucleotides known in the art have resulted in advancement within the present field, there is still a need for novel oligonucleotides with more effective immunostimulatory properties.
SUMMARY OF THE INVENTION
An object of the invention is to provide immunostimulatory oligonucleotides for their use in the treatment or prevention of tumoral diseases and/or immunological disorders.

According to an aspect of the invention, the irnmunostimulatory oligonucleotide has 8 to 100 nucleotides, and comprises a nucleic acid sequence motif which consists of the following formula:
X1X2X3X4X5X6X7X$r wherein X1, and X2, are C,T,G or A;
and wherein at least two of X3, X4, X5, X6 and X~ are Ts.
However, in the motif, a C does not precede a G (non CpG). According to a preferred embodiment, X~ consists of a C. Even more preferably, X3X4X5X6X7Xg of the nucleic acid sequence motif advantageously consists of TTTTGT or TTTTCT.
According to another aspect of the invention, there are provided compositions useful for treating and/or preventing infectious diseases or turnoral diseases or immunological disorders in a Prirr~ate. The compositions of the invention may comprise an immunostimulatory oligonucleotide as defined above or a plasmid including the immunostimulatory oligonucleotide of the invention, and a pharmaceutically acceptable carrier.
According to another aspect of the invention, there is provided a method for treating and/or preventing infectious diseases or tumoral diseases or immunological disorders in a Primate comprising administering to the primate an effective amount of an immunostimulatory oligonucleotide or a composition as defined above.
According to a further aspect of the invention, there is provided a method for treating and/or preventing infectious diseases or tumoral diseases or immunological disorders in a Primate comprising the steps of:
a) contacting lymphocytes obtained from the primate with an immunostimulatory oligonucleotide or a composition as defined above ex vivo, thereby producing activated lymphocytes; and b) administering the activated lymphocytes obtained in step a) to the primate.
According to a preferred embodiment, the compositions and methods of the invention are useful for treating and/or preventing a tumoral disease such as Chronic Myelogenous Leukemia; Precursor B-lymphoblastic lymphoma, B-cell chronic lymphocytic leukaemia, Lymphoplasmacytic lymphoma, Mantle cell lymphoma, Follicle center lymphoma, (follicular and diffuse), Marginal zone-B
lymphoma, Extranodal lymphoma, Nodal marginal zone B-cell lymphoma, Splenic marginal zone B-cell lymphoma, Hairy cell leukaemia, Plasmocytoma, Diffuse large B-cell lymphoma, Burkitt's lymphoma, High grade B-cell lymphoma, Burkitt like, Melanoma, Kaposi's Sarcoma, Multiple Myeloma, Renal Cell Carcinoma, Bladder Cancer, Lung Cancer, Skin Cancer, Breast Cancer, Colon Cancer and Uterus Cancer or an immune disorder such as an Allergy, Severe Combined Immunodeficiency, Chronic Granulomatous disease, and Acquired Immunodeficiency Disease.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 is a graph showing the proliferation index of human peripheric mononuclear blood leukocytes (PBMC) cultured with an oligonucleotide according to a preferred embodiment of the invention (Phosphorothioate ODN IMT 21 ), an oligonucleotide of the prior art (Phosphorothioate ODN 2006) and an oligonucleotide with very poor immunostimulatory activity (Phosphorothioate ODN
iMT 23). Data present the mean standard deviation of five independent assays.
Figures 2a and 2b are graphs showing the results from a flow cytometry study using human peripheric mononuclear blood leukocytes (PBMC) to determine the comparative effect of an oligonucleotide according to a preferred embodiment of the invention (the Phosphorothioate non-CpG ODN IMT21 ), and an oligonucleotide of the prior art (Phosphorothioate CpG ODN 2006) and an oligonucleotide with very poor immunostimulatory activity (Phosphorothioate ODN

IMT 23) on activation of the B cell population. More ;~pecificaffy, Figure 2a shows representative flow cytornetry diagrams comparing B cell activation by IMT23, 2006 and IMT21. Figure 2b shows representative histograms of the flow cytometry diagrams shown in Figure 2.
DETAILED DESCRIPTION OF THE INVENTION
The present invention relates generally to oligonucleotides and more specifically to immunostimulatory oligonucleotides and their use in compositions and methods for the treatment or prevention of diseases and/or immunological disorders.
1. Immunostimulatory oligonucleotides According to a first aspect, the present invention relates to immunostimulatory oligonucleotides and more specifically to immunostimulatory oligonucleotides having 8 to 100 nucleotides, and comprising a single or many copies of a nucleic acid sequence motif consisting of the following formula:
x1X2X3X4X5X6x7X8~
wherein X1, and X2, are C,T,G or A (preferably, X~, is C);
wherein at least two, and preferably three, of X3, X~, X5, X6 and X8 are T;
and wherein X~ is C or G; and with the proviso that, in the motif, a C does not precede a G. In other terms, the nucleic acid motif does not consist of a CpG
oligonucleotide.
As used herein, the term "CpG oligonucleotide" refers to an oligonucleotide that stimulates a cell of the immune system and its immunostimulatory activity critically depends of the presence of at least one CpG in its sequence.
Furthermore, the immunostimulatory oligonucleotide of the invention is preferably a non-palindromic oligonucleotide.

As used herein, the term "oligorucleotide" or "oligo" shall mean multiple nucleotides (i.e. molecules comprising a sugar (e.g. ribose or deoxyribose) linked to a phosphate group and to an exchangeable organic base, which is either a substituted pyrimidine (e.g. cytosine {C), thymine (T) or uracil (U)) or a substituted purine (e.g. adenine (A) or guanine (G)). The term "oligonucleotide" as used herein refers to both oligoribonucleotides (ORNs) and oligodeoxyribonucleotides (ODNs). The term "oligonucleotide" shall also include oiigonucleosides (i.e.
an oligonucleotide minus the phosphate) and any other organic base containing polymer. Oligonucleotides can be obtained from existing nucleic acid sources (e.g.
genomic or cDNA), but are preferably synthetic (e.g. produced by oligonucleotide synthesis) As used herein, the term "immunostimulatory oligonucleotide" refers to an oligonucleotide which stimulates {i.e. has a mitogenic effect on, or induces or increases cytokine expression by) a cell of the immune system (i.e.: a lymphocyte, a macrophage).
As used herein, the term "treating" refers to a process by which the symptoms of a disease, and more particularly infectious diseases or tumoral diseases or immunological disorders are ameliorated or completely eliminated.
As used herein, the term "preventing" refers to a process by which a disease, and more particularly infectious diseases or tumoral diseases or immunological disorders are obstructed or delayed..
In a preferred embodiment, the immunostimulatory oligonucleotides of the invention are advantageously modified into stabilized oligonucleotides. Such stabilized immunostimulatory oligonucleotide may be particularly useful to obtain a prolonged immunostimulation. As used herein, a "stabilized oligonucleotide"
refers to an oligonucleotide that is relatively resistant to in vivo degradation (e.g. via an exo- or endo-nuclease). Preferred stabilized oligonucleotides of the present invention comprise a phosphate backbone modification. More particularly, the phosphate backbone modification is preferably a 5' inter-nucleotide linkage modification, for instance, at the first two nucleotides of the 5' end of the oligonucleotide of the invention. Furthermore, the phosphate backbone modification may be a 3' inter-nucleotide linkage modification. In such a case, the modification may occur, for instance, at the last two nucleotides of the 3' end of the oligonucleotide of the invention. Even more preferably, the immunostimulatory oligonucleotide of the invention may be stably modified so as to comprise a phosphorothioate-linked nucleotide (i.e. at least one of the phosphate oxygens is replaced by sulfur). In the most preferred embodiment, most if not all the nucleotides of the immunostimulatory oligonucleotides of the invention comprise a phosphorothioate-linked nucleotide.
Other stabilized oligonucleotides may alternatively include: nonionic DNA
analogs, such as alkyl- and aryl- phosphonates (in which the charged phosphonate oxygen is replaced by an alkyl or aryl group), phosphodiester and alkylphosphotriesters, in which the charged oxygen moiety is alkylated.
Oligonucleotides which contain a diol, such as tetraethyleneglycol or hexaethyleneglycol, at either or both termini have also been shown to be substantially resistant to nuclease degradation.
In a particularly preferred embodiment, XaX4X5X6X~X8 of the nucleic acid sequence motif advantageously consist of TTl-TGT or TTTTCT. Preferred immunostimulatory oligonucleotides of the invention comprise at least one nucleotide sequence of the following nucleotide sequence or consist of an oligonucleotide with the following nucleotide sequence:
a) SEQ ID N°1 (IMT21) . TGCTGCTTTTGTGCTTTTGTGCTT
b) SEQ ID N2 (IMT504) :TCATCATTTTGTCATTTTGTCATT

c) SEQ ID N3 (IMT505) TCCTCCTTTTGTCCTTTTGTCCTT

d) SEQ ID N4 (IMT506): TCTTCTTTTTGTCTTTTTGTCTTT

e) SEQ ID N5 (IMT501): TGCTGTCTTTTTTTCTTTTTTTTT

f) SEQ ID N6 (IMT502):TGGTGGTTTTC-~TGGTTT'1'GTGGTT

g) SEQ ID N7 (IMT503): TTGTTGTT~fTGTTGTT-fTGTTGTT

h) SEQ ID N10 (IMT58): GGGGTGTTTTTTTGTTTTTTTGTT

i) SEQ ID N11 (IMT49): GGTCTTTTTTTCTTTTTTTCTTGG

j) SEQ ID N12 (IMT50): TCTTTTTTTCTTTTTTTC~TTGGGG

k) SEQ ID N13 (IMT37): GGGGTCTTTTTTTCTTTTTTTCTT

I) SEQ ID N33 (IMT35): GGGGCCTTTTCTCCTTTTCTCCTT

m) SEQ ID N37 (IMT108): TGCTGTCTTTTTTTCTTTTTTTTT

n) SEQ ID N38 (IMT101 ): TTTTTTCTTTTTTTCTTTTTTTTT

o) SEQ 1D N42 (IMT60): TGCTGTCTTTTTTTCTTTTTTTTT
and p) SEQ ID N46 (IMT513): TGCTGTCTT'fTTTTCTTTTTTTTT
.

2. Compositions and vaccines 2.1 Immunostimulatory oligonucleotides According to another aspect, the immunostimulatory oligonucleotides of the invention are incorporated in a composition comprising at least one of the immunostimulatory oligonucleotides defined previously, and a pharmaceutically acceptable carrier.
The pharmaceutically acceptable carrier of the composition may be selected from the group consisting of solid carrier,, liquid carriers and gas phase carriers. Advantageously, the carrier is selected from the group consisting of lipid particles, lipid vesicles, microcrystals and surfactants.
Further agents can be added to the composition of the invention. For instance, the composition of the invention may also comprise agents such as drugs, immunostimulants (such as a-interferon, ~3-interferon, y-interferon, granulocyte macrophage colony stimulator factor (GM-CSF;), macrophage colony stimulator factor (M-CSF), interleukin 2 (1L2), interleukin 12 (1L12), CpG
oligonucleotides and Mycobacterium bovis BCG cells), antioxidants, surfactants, flavoring agents, volatile oils, buffering agents, dispersants, propellants, and preservatives. For preparing such compositions, methods well known in the art may be used.
2.2 Immunostimulatory oliaonucleotides and antigens According to a preferred embodiment, the composition of the invention further comprises at least one antigen such as viruses, bacteria, fungi, parasites, allergens, proteins, glycolipids and/or polysaccharides. The antigen may alternatively be a viral antigen, a bacterial antigen, a human or animal tumoral cell and/or a fungal antigen.
Preferably, the antigenic component of the composition of the invention is:
- one or more, natural or recombinant, antigens of viruses like: Human immunodeficiency viruses, such as HI'V-1 and HIV-2, polio viruses, hepatitis A virus, human coxsackie viruses, rhinoviruses, echoviruses, equine encephalitis viruses, rubella viruses, dengue viruses, encephalitis viruses, yellow fever viruses, coronaviruses), vesicular stomatitis viruses, rabies viruses, ebola viruses, parainfluenza viruses, mumps virus, measles virus, respiratory syncytial virus, influenza viruses, Hantaan viruses, Nipah virus, bunga viruses, hemorrhagic fever viruses (filoviruses [e.g., Ebola, Marburg]; arenaviruses [e.g., Lassa, Machupo]), reoviruses, orbiviuises, rotaviruses, Hepatitis B virus, parvoviruses, papilloma viruses, polyoma viruses, adenoviruses), herpes simplex virus (HSV) 1 and 2, varicella zoster virus, cytomegalovirus (CMV), variola viruses, vaccinia viruses, pox viruses, African swine fever virus, the unclassified agent of delta hepatitis, the agents of non-A, non-B
hepatitis; alphaviruses (e.g., Venezuelan equine encephalitis, eastern equine encephalitis, western equine encephalitis);
one or more, natural or recombinant, antigens of infectious bacteria like:
Helicobacter pylori, Borrelia bcrrgdorl'eri, Legionella pneumophila, Mycobacterium tuberculosis, Mycobacterium bovis (l3GG;, Mycobacterium avium, Mycobacterium intracellulare, Staphylococcus aureus, Neisseria gonorrhoeae, Neisseria meningitidis, Listeria monocytogenes, Streptococcus pyogenes, Streptococcus pneumoniae, 5 Haemophilus influenzae, Moraxella catharralis, Klebsiella pneumoniae, Bacillus anthracis, Corynebacterium diphtheriae, Clostridium perfringers, Clostridium tetani, Clostridium botulinum; Enterobacter aerogenes, Klebsiella pneumoniae, Pasturella multocida, 'Treponema pallidum;
Yersinia pesos; Francisella tularensis; Brucella species; Salmonella 10 species, Escherichia coli, Shigella; Burkholderia mallei; Burkholderia pseudomallei; Chlamydia psittaci; Coxiella burnetii; Ricinus communis;
Rickettsia prowazekii; Vibrio cholerae;
- one or more, natural or recombinant, antigens of infectious fungi like:
Cryptococcus neoformans, Histoplasma capsulatum, Coccidioides immitis, Blastomyces dermatitidis, Candida albicans; , Cryptosporidium parvum;
one or more, natural or recombinant, antigens of infectious protozoa like:
Plasmodium falciparum, Trypanosoma cruzi, Leishmania donovani and Toxoplasma gondii; and - one or more, natural or recombinant, antigens of human tumoral cells.
According to a preferred embodiment, the composition of the invention is a vaccine formulation. fn such a case, the immunostimulatory oligonucleotide of the invention may be advantageously used as such or as adjuvant in the vaccine formulation for prophylactic or therapeutic purposes. Preferably, the vaccine formulation may contain one or more antigens as defined above and one or more of the oligonucleotides of the invention. As it is known, a prophylactic vaccine is designed to elicit protection from a disease caused by an infectious agent through the induction of specific immunity, whereas a therapeutic vaccine is designed to induce remission of an illness (i.e. a tumor and metastasis or illness associated with an infectious agent like the human immunodeficiency virus).
More specifically, a preferred vaccine formulation according to the present invention incorporates one or more of the immunostimulatory oligonucleotides of the invention and the antigens) into any suitable delivery vehicle known to one skilled in that art. Preferred delivery vehicles contemplated by the present invention are the ones capable of providing delayed release of the active compounds of the vaccine over time. This can be accomplished by various means known in the art. Examples of these means are encapsulation into Poly (Lactide-Coglicolide) micro particles, liposomes and poly (methyl methacrylate) nanoparticles (see: S.H.E. Kaufmann, ed. Concepts in Vaccine Development.
Editions 1996 and 2000, Walter de Gruyter, Berlin-New York).
Another refinement of the vaccine formulation is to preferably conjugate the antigens) and one or more of the oligonucleotides of the invention, by chemical means (Mier et al .2000. Bioconjug. Ghem. 11:855).
According to another embodiment, the vaccine formulation comprises i) a vector for encoding the antigens) and ii) at least one of the immunostimulatory ofigonucleotides of the invention. The immunostimulatory oligonucleotides may be a distinct component of the vaccine or may be an integral part of the vector.
As used herein, the term "vector" refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked. Preferred vectors are those capable of autonomous replication and expression of nucleic acids to which they are linked (e.g., an episome). Vectors capable of directing the expression of genes to which they are operatively linked are referred to herein as "expression vectors." In general, expression vectors of utilifiy in recombinant DNA
techniques are often in the form of "plasmids" which refer generally to circular double stranded DNA loops which, in their vector form, are not bound to the chromosome. In the present specification, "plasmid" and "vector" are used interchangeably as the plasmid is the most commonly used form of vector.

However, the invention is intended to include such other forms of expression vectors which serve equivalent functions and which become known in the art subsequently hereto.
The amount of oligonucleotides present in the compositions or in the vaccine formulations of the present invention is preferably a therapeutically effective amount. A therapeutically effective amount of immunostimulatory oligonucleotides is that amount necessary so that the oligonucleotide performs its immunostimulatory function without causing, into the host to which the composition is administered, overly negative effects. The exact amount of oligonucleotides to be used and the composition to be administered will vary according to factors such as the oligo immunastimulatory activity, the type of condition being treated, the mode of administration, as well as the other ingredients in the composition. Preferably, the composition or the vaccine formulation is composed of from about 10 pg to about 10 mg of oligonucleotide.
Some examples are given hereinafter.
During a Hepatitis B vaccination program for instance, humans from about birth to about 12 years old, could be subjected to a three dose schedule of from about 2.5 ~,g to about 20 ~g of antigen, such as Hepatitis B surface antigen (rHBsAg), at 0, 1-3 months afterward and 4-18 months afterward, and more preferably at 0, 2 and 6 months. One or more of the oligonucleotides of this invention could be present in the vaccine formulation from about 10 p,g to about 1,000 ~g per dose. For humans from about 12 to about r~0 years old, a three dose schedule of from about 5 p.g to about 40 ug of rHBsAg may be administered at 0, 1-3 months afterward and 4-18 months afterward, preferably at 0, 2 and 6 months. One or more of the oligonucleotides of this invention may be present in the formulation from about 10 ~,g to about 1,000 ~g per dose.
In cases where the composition of the invention is used to treat humans for tumoral disease, such as Melanoma, the amount of oligonucleotides in each dose, and the administration schedule, will vary in light of the corporal mass of the subject and stage of the disease. For instance, for G human of about 70 Kg having an advanced, unresectable metastatic melanoma, a dose of about 1 mg of the oligonucleotide according to the invention could be administered 3 times per week for about 10 weeks.
3) Methods of use Another aspect of the invention relates to methods far inducing B-cell proliferation, IL-6 secretion and/or IgM secretion in animals of the order Primate by administering to the primate an effective amount of an immunostimulatory oligonucleotide or a composition as defined previously. As used herein, the term "animal of the order Primate " refers preferably to a human, but may also refer to a monkey.
A further aspect of the invention relates to methods for treating or preventing infectious diseases or tumoral diseases or immunological disorders in animals of the order Primate. Therefore, the present invention specifically relates to a method which comprises the step of administering to the primate in need thereof, an effective amount of an immunostimulatory oligonucleotide or a composition as defined previously.
Yet another aspect of the invention relates to a methad for treating or preventing infectious diseases or tumoral diseases or immunological disorders in animals of the order Primate comprising the steps of:
a) contacting lymphocytes obtained from the primate with an immunostimulatory oligonucleotide or a composition as defined previously ex vivo, thereby producing activated lymphocytes; and b) administering the activated lymphocytes obtained in step a) to the primate.
A non-exhaustive list of tumoral diseases against which the methods, compositions and immunostimulatory oligonucleotides of the invention may be useful, inciudES: Chronic Myelogenous Leukemia, Precursor B-lymphoblastic lymphoma, B-cell chronic lymphocytic leukaemia, Lymphoplasmacytic lymphoma, Mantle cell lymphoma, Follicle center lymphoma, (follicular and diffuse), Marginal zone-B lymphoma, Extranodal lymphoma, Nodal marginal zone B-cell lymphoma, Splenic marginal zone B-cell lymphoma, Hairy cell leukaemia, Plasmocytoma, Diffuse large B-cell lymphoma, Burkitt's lymphoma, High grade B-cell lymphoma, Burkitt like, Melanoma, Kaposi's Sarcoma, Multiple Myeloma, Renal Cell Carcinoma, Bladder Cancer, Lung Cancer, Skin Cancer, Breast Cancer, Colon Cancer and Uterus Cancer.
A non-exhaustive list of immunological disorders against which the methods, compositions and immunostimulatory oligonucleotides of the invention could be useful, includes: Allergy, Severe Combined Immunodeficiency, Chronic Granulomatous disease, and Acquired Immunodeficiency Disease.
The oligonucleotides and the composition of the invention may be given to a human through various routes of administration. For instance; the composition may be administered in the form of sterile injectable preparations, such as sterile injectable aqueous or oleaginous suspensions. These suspensions may be formulated according to techniques known in the art using suitable dispersing or wetting agents and suspending agents. The sterile injectable preparations may also be sterile injectable solutions or suspensions in non-toxic parenterally-acceptable diluents or solvents. They may be given parenterally, for example intravenously, intramuscularly or sub-cutaneously by injection or by infusion.
The oligonucleotides and the composition of the invention may also be formulated as creams, ointments, lotions, gels, drops, suppositories, sprays, liquids or powders for topical administration. They may also be administered into the airways of a subject by way of a pressurized aerosol dispenser, a nasal sprayer, a nebulizer, a metered dose inhaler, a dry powder inhaler, or a capsule. Suitabie dosages will vary, depending upon factors such as the amount of each of the components in the composition, the desired effect (fast or long term), the disease or disorder to be treated, the route of administration and the age and weight of the individual to be treated. Anyhow, for administering the oligonucleotides and the compasition of the invention, methods well known in the art may be used.
EXAMPLES
5 The following example is illustrative of the wide range of applicability of the present invention and is not intended to limit its scope. Modifications and variations can be made therein without departing from the spirit and scope of the invention. Although any method and material similar or equivalent to those described herein may be used in practice for testing of the present invention, the 10 preferred methods and materials are described.
Materials and Methods 1) Oliaonucleotides Oligonucleotides having phosphorothioate internucleotide linkages were 15 purchased, purified by high-pressure liquid chromatography (HPLC), from Operon Technologies (Alameda, California) or Annovis (Aston, Pennsylvania) or Oligos Etc (Bethel, Maine). Oligonucleotides were suspended in depyrogenated water and kept at -20° C until used.
2) Antibodies Antibodies used in assays were purchased from Serotec (Raleigh, NC).
3) Peripheric mononuclear blood leukocytes (PBMC) PBMC were obtained from a subject as described (Ballas et al. 1990. J.
Allergy Clin. Immunol. 85:453; Ballas et al. 1990. J. Immunol. 145:1039;
Ballas et al. 1993. J. Immunol. 150;17).
4) Cell Proliferation assays PBMC were cultured at 1 x105 /well, at 37°C in a 5% C02 humidified atmosphere in RPMI-1640 media supplemented with 10% (v/v) heat inactivated fetal calf serum, 2.0 mM glutamine, 50.0 ~.g/ml gentamicin, in 96 well microtiter plates (NUNC, Denmark) with oligodeoxynucleotides {1.5 pglml or 0.375 ~g/ml as stated) for 54 hours. One (1) pCi of th3~midii~e (Amersham, Sp.Activity 30 Ci/mmol) was added to each well, and the cells were harvested by filtration, after additional 18 hours of culture. Filters were counted by scintillation counting.
Standard deviations of the triplicate wells were <10%.
5) Cytokine IL6 Secretion Assay PBMC (3 x105 /ml) were cultured in RPMI-1fi40 media supplemented with 10% (v/v) heat inactivated fetal calf serum, 2.0 mM glutamine, 50.0 ~g/ml gentarnicin, in 96 well microtiter plates (NUNC, Denmark) with CpG or non-CpG
oligodeoxynucleotides (1.5 ~g/ml) for 24 hr. After this, supernatant were harvested and assayed by ELISA. For ELISA tests, ninety-six-well microtiter plates (NUNC, Denmark) were coated with anti-IL6 antibodies and blocked with RPMS media supplemented with 10% (v/v) heat inactivated fetal calf serum. 1L6 in cultures was detected colorimetrically using biotin-labeled antibodies followed by peroxidase-conjugated strepto-avidin and then peroxidase-specific colorimetric substrate.
Standard curves were generated to quantitate ELISA results using known amounts of recombinant IL6. The detection limit of the assays was 30 pg/ml.
All assays were performed in duplicate.

6) IgM Secretion Assa~,r PBMC (3 x 10' /ml) were cultured in RPMI-1640 media supplemented with 10% (v/v) heat inactivated fetal calf serum, 2.0 mM glutamine, 50.0 yglml gentamicin, in 96 well microtiter plates (NUNC, Denmark) 'with CpG or non-CpG
oligodeoxynucleotides (1.5 Elg/ml) for 72 hrs. After this, supernatants were harvested and assayed by ELISA. For ELISA tests, ninety-six-well microtiter plates (NUNC, Denmark) were coated with anti-IgM antibodies and blocked with RPMIT"' 1640 media. IgM in cultures was detected colorirnetrically using peroxidase-labeled antibodies followed by peroxidase-specific colorimetric substrate. Standard curves were generated to quantitate ELISA results using known amounts of purified IgM. The detection limit of the assays were 100 ng/ml.
All assays were performed in duplicate.

7) Flow c~itometry Staining of surface antigens was performed as described (Flo et al 1997.
Developmental and comparative Immunology 21: 443-453). CD19 (Clone LT19) and CD86 (Clone BU63) antibodies were purchased from Serotec (Raleigh, NC).
Flow cytometric data of 20,000 cells/sample were acquired on a FACScanTM (Becton Dickinson Immunocytometry Systems, San Jose, CA). Data were analyzed using the computer program lNin MDI, ;?.8T"", Interface Flow Cytometry Application (Joseph Trotter Copyright 1993-1998).
EXAMPLE 1: Selection of oligonucleotide seauences Several non-CpG oligonucleotides, without palindromic sequences of at least 6 nucleotides long were probed using proliferation assays, cell differentiation assays, cytokine IL6 secretion assays and IgM secretion. Assays were performed on human peripheric mononuclear blood leukocytes (PBMC). As a positive control, the phophorothioate CpG oligonucleotide 2005 (ODN 2006):
5' TCGTCGTTTTGTCGTTTTGTCGTT 3' described by Hartman and Krieg (J. Immunol. 164:944. 2000) was used. As a background control the phophorothioate oligonucleotide IMT'23 (SEQ ID NO 3) or IMT22 (SEQ ID NO 8) with low activity on human cells was used.
Also as a "presumably" negative control an oligonucleotide with the same composition of the oligonucleotide 2006 but in which all the CpG dinucleotides have been replaced by GpC dinucleotides:
5' TGCTGCTTTTGTGCTTTTGTGCTT 3' was used. This oligonucleotide was named ODN IMT21 (SEQ ID NO 1 ).
Fig. 1 shows a proliferation assay performed with the above described oligonucleotides. It was found, surprisingly, that the non CpG oligonucleotide IMT21 was as active as the 2006 CpG oligonucleot~de in prc~iiferation assays (Fig.

1 and table 1) if used at 1.5 ~g/rr~l and approximately 60% active if used at 0.375 p.g/m I.
Immunostimulation was also evaluated by Flow Cytometry using the CD 19 general marker for human B cells and the CD 86 activation marker for human B
cells.
Fig. 2 shows the activation of human B cells incubated with the non CpG
ODN (S) IMT21 as compared to the activation induced by incubation with the CpG
ODN (S) 2006. As can be observed, both ODNs show similar activation patterns as compared with the ODN(S) IMT23 background control.
1L6 secretion was also evaluated in supernatants of PBMC incubated with the CpG ODN (S) 2006 and the nan CpG ODN (S) IMT21 (fable 2).
Results of this assay also indicate that the non-CpG ODN (S) IMT21 is an effective immunostimulant. Therefore, other non-CpG sequence variants of the 2006 oligonucleotide were investigated. Table 3 shows the results for six of these variants in which, the Cs or Gs of all the CpGs of this ODN
were replaced by other nucleotides. As can be observed, the Gs of the CpGs in the ODN(S) 2006 are not necessary for B cell proliferation or 1L6 secretion.
However, modification of the Cs of the CpGs is detrimental if the replacement is for As or Gs but not if it is for Ts. These results clearly indicate that stimulation of the B cell proliferation and IL6 secretion by the ODN(S) 2006 is not at all associated with integrity of the CpG group.
EXAMPLE 2: Effect of structure modification on the immunostimulatory activity of non-CpG olia_ onucleotides: definition of the active motif.
In order to study the influence of the primary structure on the immunostimulatory activity of non-CpG ODNs, several variants of the 2006 and IMT21 oligonucleotides were synthesized. Table 4 shows the primary structure of some of the IMT21 variants and the results of a proliferation and IL-6 assays performed in order to evaluate its immunostimulatory activity.
The ODN(S) IMT 21 contains T in positions 7,8,9,10,12,15,16,17,18,20,23 and 24. Replacement of these Ts with As (ODN IMT22) or Cs (ODN IMT23) results in a dramatic loss of activity in the proliferation assay and also in the IL-6 secretion assay. These results indicate that some or all the Ts in positions 7,8,9,10,12,15,16,17,18,20,23 and 24 are very important for the ODN IMT 21 immunostimulatory activity, and that at least some Ts are highly preferable.
The analysis of hundreds of ODNs, some of which are shown in Table 5, allowed definition of a core sequence (motif) responsible of the immunostimulatory activity as measured by B cell proliferation and IL6 secretion. This motif is X~XZX3X4X5X6X~X8, wherein X~, X2, X3, X4, X5, Xs X~ and X8 are nucleotides and X, is preferably a C and wherein X2 is C,T,G or A and wherein at least three (preferably all) of X3, X4, X5 X6 and Xs are Ts and X~ is preferably C or G.
Table 6 shows the effect of changes in the Ts present at the first, second, third, fourth, fifth and sixth position of the non-CpG immunostimulatory motif. As can be observed, each of these Ts makes an important and equal contribution to the activity. These results suggest that Ts are very important to the activity of the motif sequence.
Table 7 shows the effect of changes in the immunostimulatory motif GCTTTGT used in tandem in an oligonucleotide. -these results indicate that both copies of the motif are equally (or near equally) important for maximal activity of the oligonucleotide.
Table 8 shows the effect of replacements in the first and seventh positions of the non-CpG immunostimulatory motif GCTTTTGT. These results indicate that replacement of the G in positions first and seventh of the immunostimulatory motif by C does not result in any significant loss of activity, while replacement by A ur T

is detrimental.
Table 9 shows the effect of changes in position X~ within the non-CpG
immunostimulatory motif CTTTTTGT. According to this, the advantageous choice 5 for the X1 position of the motif is C. The presence of A at this position may result in more than 50°l0 loss of activity.
Table 10 shows the effect of changes in position X2 within the non-CpG
immunostimulatory motif CTTTTTGT. The results show that C, G, A or T for this 10 position are almost equivalent.
EXAMPLE 3: Effect of structure modification on the immunostimulatory activity of non-CaG oliaonucleotides: influence of the nucleotide composition outside of the active motif:
Results shown in Table 5 (see Example 2) indicate that composition of the oligonucleotide outside the non-CpG core motif is important in order to reach optimal immunostimulatory activity. Therefore, a number of oligonucleotides were synthesized in order to improve the immunostimulatory activity of oligos by modifying their sequence outside the core motif.
Table 11 shows the effect of the composition of the first five nucleotides of the 5' end in the activity of the immunostimulatory non-CpG oligonucleotides.
As can be observed, a homogenous track of Gs is detrimental while a homogeneous track of As or Cs are better choices. The best result was obtained with a non homogeneous track (see IMT108) similar to the one present in the 5' end of the ODN(S) IMT21. Of course, other nucleotide combinations not represented in this table may have equal or even better effect on the activity of the non CpG
immunostimulatory oligonucleotides. One of ordinary skill in the art can empirically determine other effective combinations.

Table 12 shows the effect of the con-~position of the last three nucleotides of the 3' end in the activity of the immunostimulatory non-CpC~ ODN(S)s. As can be observed, a homogenous track of Ts seems to be the best choice. Of course, other nucleotide combinations not presented in this table may also have equal or even better effect on the activity of the immunostimulatory non-CpG ODN(S)s.
One of ordinary skill in the art can empirically determine other effective combinations.
EXAMPLE 5: Induction of peripheric white blood cell IgM secretion by Phosphorothioate non-CpG oligonucleotides Induction of IgM secretion in peripheric white blood cells is another important marker of immunostimulatory activity of oligonucleotides. Table 13 shows the stimulation of IgM secretion by several of the F'hosphorothioate non-CpG oligonucleotides described above. As can be observed, the most active non-CpG ODN(S)s in induction of proliferation and IL6 secretion are also the best in induction of 1gM secretion.
EXAMPLE 6: Induction of cell proliferation in peripheric white blood cells of Brown Capuchin monkeys (Cebus apella) by non-CuG ODN(S)s Table 14 shows the immunostimulatory activity of non-CpG ODN(S) on peripheric white blood cells of several mammals. As can be observed non-CpG
ODN(s) are only effective in humans and monkeys. Therefore, these results support the use of monkeys as animal models for research on human clinical applications of non-CpG ODN(S)s. On the other hand, these results indicate that oligos according to the present invention are useful as immunostimulants in animals within the order Primate.

Although preferred embodiments of the present invention have been described in detail herein and illustrated in the accompanying drawings, it is to be understood that the invention is not limited to these precise embodiments and that various changes and modifications may be effected therein without departing from the scope or spirit of the present invention.

~

O ' tS~N
~' O

O

O
s N M
H
O

cB

O M N
N '" ~ 00 O

O

.y.- 1 e-'' O h-U
U O D ~
c .~. ' O O ~ ~ c~
' ~ -1~ N N
~

.i9 S~' C ~ D
U O r- Z .a c Z

(4 O O o o U t~ rn p O Q h- I' D

O
E
o z o z o W

-c ~ >

Q, Cp r- N Q
O N
Q

O
M ~ O
NJ N V M ~C5 iH
O
Q M (~
X V In OMO
O

.Q O N O l'S~
c ~ Q. M ~ d.

M
J

U
Q O
u~ c O

I- ._ O ~ '_ o Q o.. .r7 ~
U '-- a~

c c co 4- c o .o c c o c~

-v ~ 4 U O

o z ~ a 0 o u, Q., ~ r O N O N
O f-V N

v.

Z

n a w V_i c9 H

fn 'a' 1,(7r O O ~ In M m M ~- c/- r O
00 M O lf? O r r N

7 a 1 ~t N N V' N N N

00 N O Cn 00 !~ a) !,- ,~ r O t N CO CO M
N N N N M

N
O

O (~ Z
D

t!7 0~Of~ f~~~O N
U W ~ .- M <t N N cW - V

c Z V N N V N N N
o M r o J O '_. ~
O ....!. p z M N
6 C~ ~ ",., 0 0 ~ O ~ D
~ Q
Q ~ ~ ,., O O d7 (D t - CO d p N Z Q C'~ M CV r tn ~ aj Q r r r r-O M

z ~-- p _ D H H E~ ~' H H H 'o U ~ H H H H H H
O N U U~ C~ U FC C7 H .
p ,-C M E-a H E- ~i H H E-' _ C7 C~ C.'7 C7 C U c H H H H H ~ H Z
S H H H H H H H
- H H E-i N E~ H EH.,D
U ~ ~cCU H cH.7~' U C~
U CH.7 c~n~
C H H E~ ~' E~-~ H
C7 ~ C~ N
U U U C~ o H E-~H ~i H C~ H

E~ E_iH E-1H H H
H _ C -, i U N H y U CC U ~C H H n E.-~ E-,U C7 z U U FC H CH7 ~
C? C? U U rC CH7 D
E-~ H E--a~' H C7 '1 H W
r M
d' 1~ fl N cO

O N - - _ . - . _ N

N

O N

O O

tr~ ~ ~
U ~, ~J ,mq.
O

C - ~(?
Q O Cp *-. ~ V N M
.O v Q cts z 'C~ (~ ~ M O O

~ O r Q Q
O ~ .~" ~ 00 M V
;t:, r V

L

U
O
(6 CD _ O

J E_ Z - _ O_ ~ D N O O
r LLI ~ M Z ~ N
O
0 o Z ~ ~' o N a L O M
H ~
'O ~.... C~
U i-. U

O O ~ H ~ U
C~ C.~U
H U o c o .~ H ~ U a U ; w U ~ ~ ~ ~ ,,r o a E ~ U~
. _ 1.LJ E-, ~ v L E-i ci .O ~ E-~ U
O ~U
U

U U ',-r O ~ ~ Z
U W E-~ E--~r_i o ~ c.ai~~
O ~ c7 D
U E-' w C ~~~
a w' _ _ N N N N
O

o cy-, 7 ~ b-'C

.
O
~' ~
_ a C~ M :.:

G

Z

'~'r ~ W ~ O

H H i.7 H H a: H C N H E H H F-~ ' - z a H Ci H H F f FC U CV

wr H C7 F f9 Et H EC H H E H H H ~ ~ ~ N
O H H H t_~ H H F H FC V - V

I-C7 U L.~ f_7 V U U V V U U rL O
U '.: U U U U U f.) U V

O U
V E H C7 l H CJ C~ C? f.7 r_~
t7 FC C7 H f9 H C7 U C7 C7 C~
C7 C,7 ~7 D cn, O ~

w MNz '- (>n E"
N D

N O ~ ~O

T f~-~ ~ ~.; z C~

N .' m p w N

~- ~ o v.~

n ~ . _ z a f~~

. M

o U a o n~

z -ca ~

v ~ ~ ~~ N

O' a o cc ~ ~N

O

Q N ._ C H E H H G H En C: V C7 f.9 t~ ~ z a ~ C7 f' C7 C7 C9 C7 C7 H C7 I7 H E

~t C7 U U U U C'.7 C~ C7 t7 c.~ ~ r ~ f>~
(7 47 C7 C7 C~ f7 C9 C.7 C7 U -(9 C7 V U

v E~ N c~ r~ H c~ ca ~.~ fa c~ o Cl ~ fs c~ ~ c~ .:~ c~ ~o c.7 c~
c~ (~ ~ c7 H (~ C7 F C7 En L (,7 C7 C7 f.~ t,~p Z
C7 V' U t.J t7 f 7 (5 H (? f~ w H E

.c ~ ~

;~, a -__~~"

1-~ o a ~ o , y n c a, m r N Two L,. ~~ .a rn h o ~ ~ o ~ N

M f'~ M c N M G1 m M 01 M .-t N ~ ~ D_ Ov N M f N ~ f I 1 I 1 _ Z Cl V ~ = ~ ~ CV M C C' a ef f ,y :~ M :~ v z._ M ~ v r1 a ct x~ v~ M v~ ~T N w f'1 N lO 1P M fu (p f'~ uf', C .-1 ' r-I u' r1 N ~.1 ~q, .. O O O O O O O N w 1 Q1 lD H 01 M C7t (%i W M r1 D C'd r1 M h'7 t~'1 N M M M M M
M
GO M O

OD N m f7f1 dp ~ p~ (7p W p7 M
Q r1 V uf1 V V V V V V
N r1 ri r1 e-1 r!

co 0 U O ~ 0 ~ ~o Z

o .-t co ,..I fn ~ v~ rn o ~ M w M . _ ~o r~ M r1 (n m (v ~mo ~ .-, z D
o~ r o c.7 W O 41 N ~a lO (-.I ,-.i p~ f~
~ ~
M
~

' r ' v r (T CD If7 O a v~ M M ~~

f'1 M fJ r-i r-I V ry r-n n ri _ N r1 r1 ,-i ri N O O O r1 O O ~' ~ w O O O
Za En ..

N v~ v ~.n a ~o N o~ fd v ~r v, M M ~r rt "a ~cr <.I m rt M ur7 N a ~ ~ .

p ~o f w ' f ~
l ~

D v r L O
) N f ) 1n N f , N H ~ aJ ~~ O Gf1 t~J m ,-1 O (T cf m v, f~
O C~'1 M O ~0 N ,-I r7 ama 01 (X7 M r1 H O~ T Ib 40 01 N I~
M N O

C[ rh c ao ao r r r~ l9 Vft tn v' v' V' v' V' C'1 M M M N N
i r r r n r-f r1 N

Z
U o -D
~
z ._ ~

~ o ci ca a, .-a o r-r o, o~ m ~a v M r- ~ u~ O tp r <r v, .-r r) cJ r7 N
u'1 If1 c N In M N N N M M M M
vW f1 v u1 v~ N a' u1 C M N N

(~ H F H E l H E~ H E' H E H F E h"
E E H H E~ H H H H H E~ '-F E ~; S ~ ; F 'F ~: ~ t7D
~' ~:

O H H H H H H 1-1 H 'r-, H Fa H ~
H H H H i-I H H H H H H H 1-1 0 ~ T ~ (\J

r-z (U ~=- p ."_' O
.p ~ d O
.~, N
C c4 U E "
N
y Z
~Y ~ t~ O
M N cr7 N ~~'- wU' .. ~."~w.. ~ fn C~ ~. O
O J ~ ,,,_, ~ ~t ~~ N M v 2 v g p , ._ O ~ ~ ,r, T .- ~r v p o O '~ ~ m ~ ~ ~ z v i~
Z
O O
C ,~ U' D l_3a M (fl r,M, ~ 00 c- r. ~- r" Q ~ M
J ~ 'c (Y W c H'a'~~Z~Zrnvv vvN~,.~ '-.r t~T
O o O ~ c~ ono o~ ~ ocao «i '~
Q cfl ~t v uy;
U .~ M
_ f~
O ~ E
E-a H E~ E~ E1 E-i H
O "= U U U U U U U o0 -Q ~ t7 C~ U C~ t~ C~ ,' ~ z o -., o U
a t ~
w ~ U ~ ~ ~.7'a '~ c~ ~ ~ .
W
j ~ r ~C ice= ~~ ~ . _ ..-.. ~3 ~''t~,~''! ~ :E--~. dE-~- W o p ~ a V ; :~k k~"3 U U "~ ' 0 0 o ~n W z-?'~ c~.. a.~. ~~ Ate:: z z a~ cn t_~ to to t 7 t_7 ~~ t~ c~ a U ~- C ~ C7 C') U C ,) CJ> (~ -' --, t-~ C~ ~ ~~ C.~ c> ~ a a c ~ t~ ~~ ~ ~ c ~) c.~ t~ ~ c'~n h1 M M M ~i' N <t N V' O

Z
Q Z7 ~C 0 ~n r- co I

Uf7 M

-Q ~ N
C ~ ~ ~'G ' o ' p ~ J ~ !" tfi V V ~ Z
~

:-' _ '~~- ~ D
O

tn O O
p D' ~ m ~; ~ a o ~ ~ ~ ~ m M
M

_ ~ v H

Or ~ a' M
._ N

c- r c- O M

,4? ~ ~L _ .+.. N d ~ ~ M

~...I N y .n r~ cn 0 0 o z a ~ ~ ~ ,-M
~

I
U O O E-1 E-~ H H

'a ~ U U U U
T

U

a v ~ U

L O ~ c :~ ., M
j ~ ~ ~' ~

. . = :
E.
~, ~ ~ a ~ ~ ~~ r H ~H

o ~ ~ ~ C~.7C,U~t,~

c~ c7 ~ C~ o O U
C7 t~ .~ C
' - ca c~ ~ U
U (( j C~ C~ U L7 M N

N M M

g C
C
O
.C
f6 a O "-a) p 0 ; r~

,~. ' ' i C d M V
~

O ~ ~ C1 tn CO ~ C1 q o0 co co v C.

Q ~ ~ d7 M ~ i"J
r" N c'J

U Q~ o ~ 'y ~ o z ~ W Z ~ :~ c~

o a, M ~ ~
cs a ~ .~ ~~ o o~ ~ ~ ~ N
O

E~~ _ a . q CD 'ct M F
O

, CO Q E-~ E~ E-.,H

H E-1 H E~
U U U C--~
as -p O C~ U H o C .

, t - Z:
~; Ci C . ~ ci o ~

co > m i t U
n Z ; IE~.: i -v o ~ j H ~ v E~-~
: E~-r'~ ' E~ ~~ :~, .H ~H: E~ ~.,:

~ ; ' z ' a~ ~~ ~ ;~ :
C C~ ' ~
~ C') C7 .Q . C~ Lj U ci ~

C~ C7 U C.) N m c'~~r~nMl V

X

c c~ X

U X r~ o .c- M

Q ~ rn cv o .
N T' ~r- CV d' . \ Q
Z

o ~ o N I""" l(7 p X nqCW a Z ~ N .n N

o !.~ w C~ .,.., O Q, ~ ~ ~ ~ cj .~

f~f o W _(6 [~ ~ ~ CJD L(~

_ O c4 Q c H U ~ o 'p ~ E-~ E-~ E~ E-~
~

O ' E-~ C~ U C.7 U E-~ t.~
H' V ;-~ t~:
~ ~H.

t O M cue' ~

, U ~ ~-- ':~'- O

W H

U ~., ~ ~.,, O , : :: o Wi .C LL! ~.,, H; ~ ~.-' t.;

H H H C-~-~
n ' H.
H~, H;

O ~ ~ ~' ~ ~, ~ ,, , : , O ~ j ~
~ C?. H :: ~
, +-, u~ H E-~ H
V O H L7 (J O
~ _ U E--a(.~~
'p --~ E--~ H ~:~ E--~

(fl M

Q H ~- y I- ~-~2 C
N

n (6 U ~

y n O c~ r..

v- M 'G' N

V N ' N cf r O ~ O

:~ ~

O ~

c p ~ Q ~ _ O ~7 0 O ,~
"

~ ' > Z

f~3 '-' ~ M M N r r r r r ' l C~

O .-U p ~

-p E--~E-~H Ea ~ Ea H E-~ Ev O ' O U ry CJ E-1 .
_ ~ U U U U M

O
U ;-. z .c ~ M

a O

U ~ uJ

'L

U a ~ ~= ~'~~ "

W

..

U' E~. ,, ~~' t-~
~

c W .C9 ~ rr o O . ~

c ;~ ~ ~J! ; e.7 :c.~.z E-, Ea E, E~ D

'-' O C:) ~ 'J E-n -U CJ ' C' C~
;

Ei E-NE-i H u.1 w O O

O O

C~ O t- I- F-- E--r=

M

W p O r1 Z

D ~ r:
Q

N r1 "" -d WW M Z

O EL C~ N N N N

~ ~ Z ~

V _ ~...

Q" ~

z U ~ ~ ~ ~ ~ o D
~

O m ~

C ~ N ~n .o r"' CJ

O

J > cW

~+=

o Q N

~ L
~

F-O H H H H

;~ H H E-~H

, H H H H
~,..

U o O -a H E--iH H

C M E~ E~' E~'H O

O O ~ H H E-~E-~ -_O ~, jl.~ H H E E-i a , U, U' y' U a c ~ Z ~ ~ ~ _ o ~

' -,,. .., ~. ~.

o H Y
' U ~ ...~
~, M

H H E-aE

C7 U C7 z h U U

~ U H

~.
h O

~ 4n cc> r- ao m o O O o 0 t- .- r--~- r-~c N
C
'C
(a 'a' Z

+_. C D
N n o ~ o o - ci ci o D O ~ ~

H

C~ W M Z N N cv cv .
I _ U D o C O . CO o lL, ~ .,~, O O J '' C
W ~ O 4.. ~ ~ ~- r. .-- ~,, O

J O ~....5, .- c~ r..r~~
r- Sri an ~
'~

C~ r>
Q ..... o r U

o ~ N ~ U CU.7 M'' N ~G U C7 .Q O ~. E-~ H E-n H Z

M ~, E, E..iE-. o E-~ H E--~E-~ --C O tf~ H E-' E~' ~~' C~
N H

U O 11.9 cO

a~
w 0 M
0 ~ 4~ ~,.:-~~ ~' O
, C
=H H C~ L~ D
' O E.-3 H E-K .
, ' f ' v ~ E~ H ~. o f , .

-p ~ H ~. ~ ~, cn C

Z .- N m .~

O ~- i- ~. H

,..,o ~

~
c~7 Z

s9 . N CT t~ ;.. w-' U; r~ o N D
~ ~1~

Z a __ A I \O I l0 01 C~ N u~ r-~ u7 Z
CP t~ c' U1 I o I c~ v' ~ ~ u~
h 1 ~
0 ~

._; a , r1 (~ U~

c~ ~n ~ n o p ~

,7.,N ; V N ~ N N CV f. N r J C r C ~ N CV cJ i-'. Z, CV

u~ 'n ~

.f7 Lf7 U G U u'7 ~ O
:7 O M ~.S

y ~

f71r1 ~.C N l0 l~7 ~
O cJ G O N 'Q' f ' tf1 ~J G r- O", C> N r-~ N c'7 00 c27 ~'~ '~' ~ O

Q',r-: C1 O r-~ c1' .--1 f~ ) p O Z
G C51 ('J ~'~ ''J ~'~

V M ul M ~J fV M N r-a r-I Z Z p M ~'~ M

n u?

\D - - rf ~, ~r> m x o-, o G

~ :n r-ii p r-~ cra C' N CV
CC

U1 I ;J M 01 ~ Cp lU ~D r1 O ~ N Q

N N M r-I ,1 ~ ~y t17 M ~ N t-q 0 n p ~ ~ ~
~

\p r. .
~
r-~.n N

Z N

-a <V N M .-i O u7 M Z z O
Z

~ p "n . .
m ' n C
~
~
~

O Q
'~ ~
I
~
. ~ \
o ~
r7 M

a o ~ ~ :-r. a,~ ~, ,-. ~, r~ \~ a a a ,~ ~

~ '-' wWw U ~ ~J.J ~ ~ cn -~., Q ~Y ~ ~
~

'~ M
I
~ I

CAl)I r I _ I I I I I I I I
~ ~ m I I ~ ~ I I I I a~ I
I N ~

O ~ N

N
- t ~ p ~ ~ N
(J ~ M --~ Z M 2 .-I .--i r-w ,--~
. ~-I r-; r-i r~ N r--1 .-J
N r-I

O Z Z Z

M O ~ Z o M o N r ~~~' r~ o u~ r-~ D D
e-O Q u~ tr G ,n ~ 0 W ,p () ~ tT ~s~ r~ e' ~ ,--i o~ r-i a; _ of ci cW o Q; ,~ r' a d Cj b o ~. ca, o, ~r c~ N M r ~r ~ ~ W
~' M M ,.o r7 yo ~
~

C . sr r ~ ~r O~ r N m) u~ oo O
~ ( -~
-.i -i N
-~ ~ N N <-I M
--~ CV ~

a .
. MO M
.
.
r a~

~

U ~ .c~ ,r' M \o <r' G a. \o ~r, 'C cJ o r' r r-a M

O O fa I ,-~ CG M l0 f-I N t'~ CV
G M M l17 O r-i 01 U7 I rye Q N ,-i l0 01 t-- Q1 -01 O N rwl t~ N 61 '..p r-- r-I W ~ N ~ u'~ .~
f-i ~ N lD

O .--i .-'i ~L O O O

N O ~..' p G1 Z Z Z

.C Q M '.."J <\ N Z N N N M CJ N Q Q D
CJ N ('J N M Z N

z C O ~ ~'~ C t17 Cf1 G ~ ~': U O O
O -~ O tt1 O f~ tJ7 (~ (n ~

Q' ~ O vT (~'": ,.f' r-1 t' l9 f~ N ~ d.
~' CC N M O O c' CO
' ~
' tf7 (;~ O~ OW f I,() 1 0Cr1 rrl CO N OJ 01 C
J Lf1 CV t ~

~, H .T iP f'W !l r11 tn tf'1 ' CSl n-~I l0 O~ CJ r-1 h'1 p,~
' a :~ r-~ N W 7 ~ ~ M u~ ('J N H ~
U7 c' ~~ l~
V yt C ~ . .

N
T

H H H C7 H H H H H H H H H ~ , H -~ O p O
-, H E-~ H H C~ H H H H H H
H H H

..,, -~ UUUUUHC~UL7C~C~FCUH H ZZZ

.> C; C-) C7 C~ H H H H FC

H

E~ H ~C H H H U E~ E~ H H H
H H H
C,~ W~ C7 U' H H E~ H C-) CJ
C) C~ (-) C7 C~

I,n H H H H H H H E H H H H H H d Cj H Q

c-. H H ~ H N H H H H H H H
H V H

H H H E-~ H H H H H H H H E-a H
H

.., H H E-' E~ H F~ E- H H
H H H ~
U U U U C:~ H U C) t~ C~ C~
~C U E-~ H

U c~ C~ t~ H H E-i E~ FC C~ O
H C) U U U ~

E.:. H ry H En H U E-~ E~ H H f-H H H H H H
C
H H H C7 C~ U' C~ U' U
~
' ' ~ f-- c~
.
CJ H

U

E= H H H E~ H H H H H H H H ~ - -E, H H H H H H H H H H H H -- -H H H H H
H
=
c ~

L() H E H t- .-~ E~ H N
H
, E-E.., E, H E~ H E~ K~ H H H
E H E-~ U H

;.7 U U C_7 U U H C~ C.) C7 C~ C'7 ~C U E-~ H Z
' 7HUUU C_> ZZ
Ci(7C~C7~E~-'E-1~:C

, E- H C.'7 C~ C7 U 'rW~ E
H H H H H F H D D D
' ' ' ~

-~ ~C U H C7 ~ C~ U C7 ~ E~
OJ
W. U C7 U C.

G U~ L C7 C_~ C-'? V' Ci ''? H
U' FC U H U U U
7HHHHHH E-~
n ' ~

O E~ HHC~C_ UC~
.---'C

~..~ Co M ~r 4n t0 O~ M (n Cn fv .-~. N C~ M C~ O~ 'x CU O O
G O O O O H

u7 N c" <v r~ r , ~ u, \o u~ ~ p u~ u~ u~ u~ ~r7 _n uo -1 '.~a N m ~f r--I C~ E- H E-~ E-~ H H E-~ H H H
G-i E-~ H H H N H E H

di o ~ E ~ ~ ~ ~ ~ ~ E ~ ~
(7.;V F-HHHHH~-iHHHHHHHHH .-t ,3 _' ...

z O

w O .~ o c H

- ...
a p c c L

Ct O ~ U
Q

f4 o ~? a Q o c v, ~ o I- m

Claims

1. An immunostimulatory oligonucleotide having 8 to 100 nucleotides, comprising a nucleic acid sequence motif consisting of the following formula:
X1X2X3X4X5X6X7X8, wherein X1, and X2, are C,T,G or A;
wherein at least two of X3, X4, X5, X6 and X8 are T; and wherein X7 is C or G;
with the proviso that, in said motif, a C does not precede a G.

2. The immunostimulatory oligonucleotide of claim 1, wherein at least three of X3, X4, X5, X6 and X8 are T.

3. The immunostimulatory oligonucleotide of claim 1, wherein in said motif, X3X4X5X6X7X8 consists of TTTTGT or TTTTCT.

4. The immunostimulatory oligonucleotide of any one of claim 1 to 3, wherein consists of a C.

5. The composition of any one of claim 1 to 4, wherein the nucleic acid sequence motif consists of a non-palindromic sequence.

6. The immunostimulatory oligonucleotide of claim 1, comprising a nucleotide sequence selected from the group consisting of:
a) SEQ ID N°1 (IMT21) : TGCTGCTTTTGTGCTTTTGTGCTT
b) SEQ ID N°2 (IMT504) :TCATCATTTTGTCATTTTGTCATT
c) SEQ ID N°3 (IMT505}: TCCTCCTTTTGTCCTTTTGTCCTT
d) SEQ ID N°4 (IMT506): TCTTCTTTTTGTCTTTTTGTCTTT
e) SEQ ID N°5 (IMT501): TGCTGTCTTTTTTTCTTTTTTTTT
f} SEQ ID N°6 (IMT502):TGGTGGTTTTGTGGTTTTGTGGTT
g) SEQ ID N°7 (IMT503): TTGTTGTTTTGTTGTTTTGTTGTT

h) SEQ ID N°10 (IMT58): GGGGTGTTTTTTTGTTTTTTTGTT
i) SEQ ID N°11 (IMT49): GGTCTTTTTTTCTTTTTTTCTTGG
j) SEQ ID N°12 (IMT50): TCTTTTTTTCTTTTTTTCTTGGGG
k) SEQ ID N°13 (IMT37): GGGGTCTTTTTTTCTTTTTTTCTT
l) SEQ ID N°33 (IMT35): GGGGCCTTTTCTCCTTTTCTCCTT
m) SEQ ID N°37 (IMT108): TGCTGTCTTTTTTTCTTTTTTTTT
n) SEQ ID N°38 (IMT101): TTTTTTCTTTTTTTCTTTTTTTTT
o) SEQ ID N°42 (IMT60): TGCTGTCTTTTTTTCTTTTTTTTT and p) SEQ ID N°46 (IMT513): TGCTGTCTTTTTTTCTTTTTTTTT ,

7. The immunostimulatory oligonucleotide of claim 1, wherein it consists of an oligonucleotide selected from the group consisting of:

a) SEQ ID N°1 (IMT21) : TGCTGCTTTTGTGCTTTTGTGCTT
b) SEQ ID N°2 (IMT504) :TCATCATTTTGTCATTTTGTCATT
c) SEQ ID N°3 (IMT505): TCCTCCTTTTGTCCTTTTGTCCTT
d) SEQ ID N°4 (IMT506): TCTTCTTTTTGTCTTTTTGTCTTT
e) SEQ ID N°5 (IMT501): TGCTGTCTTTTTTTCTTTTTTTTT
f) SEQ ID N°6 (IMT502):TGGTGGTTTTGTGGTTT'TGTGGTT
g) SEQ ID N°7 (IMT503): TTGTTGTTTTGTTGTTTTGTTGTT
h) SEQ ID N°10 (IMT58): GGGGTGTTTTTTTGTTTTTTTGTT
i) SEQ ID N°11 (IMT49): GGTCTTTTTTTCTTTTTTTCTTGG
j) SEQ ID N°12 (IMT50): TCTTTTTTTCTTTTTTTCTTGGGG
k) SEQ ID N°13 (IMT37): GGGGTCTTTTTTTCTTTTTTTCTT
l) SEQ ID N°33 (IMT35): GGGGCCTTTTCTCCTTTTCTCCTT
m) SEQ ID N°37 (IMT108): TGCTGTCTTTTTTTCTTTTTTTTT
n) SEQ ID N°38 (IMT101): TTTTTTCTTTTTTTCTTTTTTTTT
o) SEQ ID N°42 (IMT60): TGCTGTCTTTTTTTCTTTTTTTTT and p) SEQ ID N°46 (IMT513): TGCTGTCTTTTTTTCTTTTTTTTT .

8. The immunostimulatory oligonucleotide of any one of claims 1 to 7, comprising a phosphate backbone modification.

9. The immunostimulatory oligonucleotide of claim 8, wherein the phosphate backbone modification is a 5' inter-nucleotide linkage-modification.

10. The immunostimulatory oligonucleotide of claim 8, wherein the phosphate backbone modification is a 3' inter-nucleotide linkage modification.

11. The immunostimulatory oligonucleotide of any one of claims 1 to 10, wherein said oligonucleotide consists essentially of phophorothioate-linked nucleotides.

12. A composition comprising an immunostimulatory oligonucleotide as defined in any one of claims 1 to 11, and a pharmaceutically acceptable carrier.

13. A composition comprising a plasmid including an immunostimulatory oligonucleotide as defined in any one of claims 1 to 11, and a pharmaceutically acceptable carrier.

14. The composition of claim 12 or 13, further comprising an antigen.

15. The composition of claim 14, wherein the antigen is selected from the group consisting of viruses, bacteria, fungi, parasites, toxins, allergens, proteins, glycolipids and polysaccharides.

16. The composition of claim 14, wherein the antigen is a viral antigen, a bacterial antigen, a human or animal tumoral cell and/or a fungal antigen.

17. The composition of claim 14, wherein the antigen is encoded by a plasmid.

18. A method for treating and/or preventing infectious diseases or tumoral diseases or immunological disorders in a Primate, comprising administering to the primate an effective amount of an immunostimulatory oligonucleotide as defined in any one of claims 1 to 11 or of a composition as defined in any one of claims 12 to 17.

19. A method for treating and/or preventing infectious diseases or tumoral diseases or immunological disorders in a Primate comprising the steps of:
a) contacting lymphocytes obtained from the primate with an immunostimulatory oligonucleotide as defined in any one of claims 1 to 11 or with a composition as defined in any one of claims 12 to 17 ex vivo, thereby producing activated lymphocytes; and b) administering the activated lymphocytes obtained in step a) to the primate.

20. The method of claim 18 or 19, wherein the tumoral disease is selected from the group consisting of Chronic Myelogenous Leukemia, Precursor B-lymphoblastic lymphoma, B-cell chronic lymphocytic leukaemia, Lymphoplasmacytic lymphoma, Mantle cell lymphoma, Follicle center lymphoma, (follicular and diffuse), Marginal zone-B lymphoma, Extranodal lymphoma, Nodal marginal zone B-cell lymphoma, Splenic marginal zone B-cell lymphoma, Hairy cell leukaemia, Plasmocytoma, Diffuse large B-cell lymphoma, Burkitt's lymphoma, High grade B-cell lymphoma, Burkitt like, Melanoma, Kaposi's Sarcoma, Multiple Myeloma, Renal Cell Carcinoma, Bladder Cancer, Lung Cancer, Skin Cancer, Breast Cancer, Colon Cancer and Uterus Cancer.

21. The method of claim 18 or 19, wherein the immunological disorder is selected from the group consisting of Allergy, Severe Combined Immunodeficiency, Chronic Granulomatous disease, and Acquired Immunadeficiency Disease.

22. A method for inducing B-cell proliferation, IL-6 secretion and/or IgM
secretion in a Primate, comprising administering to the primate an effective amount of an immunostimulatory oligonucleotide as defined in any one of claims 1 to 11 or of a composition as defined in any one of claims to 17.

23. The method of any one of claims 18 to 22, wherein the Primate cansists of a human,