CA2410371C - Methods for enhancing antibody-induced cell lysis and treating cancer - Google Patents
Methods for enhancing antibody-induced cell lysis and treating cancer Download PDFInfo
- Publication number
- CA2410371C CA2410371C CA2410371A CA2410371A CA2410371C CA 2410371 C CA2410371 C CA 2410371C CA 2410371 A CA2410371 A CA 2410371A CA 2410371 A CA2410371 A CA 2410371A CA 2410371 C CA2410371 C CA 2410371C
- Authority
- CA
- Canada
- Prior art keywords
- nucleic acid
- antibody
- cancer
- antigen
- cell
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Lifetime
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/2896—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against molecules with a "CD"-designation, not provided for elsewhere
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
- A61K39/39533—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals
- A61K39/39541—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals against normal tissues, cells
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
- A61P35/02—Antineoplastic agents specific for leukemia
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
- A61P35/04—Antineoplastic agents specific for metastasis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/2803—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/2878—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the NGF-receptor/TNF-receptor superfamily, e.g. CD27, CD30, CD40, CD95
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
Abstract
The invention relates to methods and products for treating cancer. In particular the invention relates to combinations of nucleic acids and antibodies for the treatment and prevention of cancer. The invention also relates to diagnostic methods for screening cancer cells. In one embodiment, the invention relates to the use of an immunostimulatory nucleic acid comprising at least one unmethylated CpG dinucleotide and an antibody specific for CD19, CD20, CD22 or CD40 antigen in the treatment or prevention of a B cell malignancy, wherein the immunostimulatory nucleic acid upregulates expression of the antigen.
Description
DEMANDES OU BREVETS VOLUMINEUX
LA PRESENTE PARTIE DE CETTE DEMANDE OU CE BREVETS
COMPREND PLUS D'UN TOME.
NOTE: Pour les tomes additionels, veillez contacter le Bureau Canadien des Brevets.
JUMBO APPLICATIONS / PATENTS
THIS SECTION OF THE APPLICATION / PATENT CONTAINS MORE
THAN ONE VOLUME.
NOTE: For additional volumes please contact the Canadian Patent Office.
METHODS FOR ENHANCING ANTIBODY-INDUCED CELL LYSIS AND
TREATING CANCER
PRIORITY
This application claims the benefit of U.S. Provisional Application No.
60/213,346, filed June 22, 2000.
FIELD OF THE INVENTION
The invention relates to the treatment and prevention of cancer using immunostimulatory nucleic acids and antibodies.
BACKGROUND OF THE INVENTION
Cancer is the second leading cause of death, resulting in one out of every four deaths in the United States. In 1997, the estimated total number of new diagnoses for lung, breast, prostate, colorectal and ovarian cancer was approximately two million. Due to the ever increasing aging population in the United States, it is reasonable to expect that rates of cancer incidence will continue to grow.
Cancer is a disease which involves the uncontrolled growth (i.e., division) of cells. Some of the known mechanisms which contribute to the uncontrolled proliferation of cancer cells include growth factor independence, failure to detect genomic mutation, and inappropriate cell signaling. The ability of cancer cells to ignore normal growth controls may result in an increased rate of proliferation. Although the causes of cancer have not been firmly established, there are some factors known to contribute, or at least predispose a subject, to cancer. Such factors include particular genetic mutations (e.g., BRCA gene mutation for breast cancer, APC for colon cancer), exposure to suspected cancer-causing agents, or carcinogens (e.g., asbestos, UV radiation) and familial disposition for particular cancers such as breast cancer.
Cancer is currently treated using a variety of modalities including surgery, radiation therapy and chemotherapy. The choice of treatment modality will depend upon the type, location and dissemination of the cancer. For example, surgery and radiation therapy may be more appropriate in the case of solid well-defined tumor masses and less practical in the case of non-solid tumor cancers such as leukemia and lymphoma. One of the advantages of
LA PRESENTE PARTIE DE CETTE DEMANDE OU CE BREVETS
COMPREND PLUS D'UN TOME.
NOTE: Pour les tomes additionels, veillez contacter le Bureau Canadien des Brevets.
JUMBO APPLICATIONS / PATENTS
THIS SECTION OF THE APPLICATION / PATENT CONTAINS MORE
THAN ONE VOLUME.
NOTE: For additional volumes please contact the Canadian Patent Office.
METHODS FOR ENHANCING ANTIBODY-INDUCED CELL LYSIS AND
TREATING CANCER
PRIORITY
This application claims the benefit of U.S. Provisional Application No.
60/213,346, filed June 22, 2000.
FIELD OF THE INVENTION
The invention relates to the treatment and prevention of cancer using immunostimulatory nucleic acids and antibodies.
BACKGROUND OF THE INVENTION
Cancer is the second leading cause of death, resulting in one out of every four deaths in the United States. In 1997, the estimated total number of new diagnoses for lung, breast, prostate, colorectal and ovarian cancer was approximately two million. Due to the ever increasing aging population in the United States, it is reasonable to expect that rates of cancer incidence will continue to grow.
Cancer is a disease which involves the uncontrolled growth (i.e., division) of cells. Some of the known mechanisms which contribute to the uncontrolled proliferation of cancer cells include growth factor independence, failure to detect genomic mutation, and inappropriate cell signaling. The ability of cancer cells to ignore normal growth controls may result in an increased rate of proliferation. Although the causes of cancer have not been firmly established, there are some factors known to contribute, or at least predispose a subject, to cancer. Such factors include particular genetic mutations (e.g., BRCA gene mutation for breast cancer, APC for colon cancer), exposure to suspected cancer-causing agents, or carcinogens (e.g., asbestos, UV radiation) and familial disposition for particular cancers such as breast cancer.
Cancer is currently treated using a variety of modalities including surgery, radiation therapy and chemotherapy. The choice of treatment modality will depend upon the type, location and dissemination of the cancer. For example, surgery and radiation therapy may be more appropriate in the case of solid well-defined tumor masses and less practical in the case of non-solid tumor cancers such as leukemia and lymphoma. One of the advantages of
- 2 -surgery and radiation therapy is the ability to control to some extent the impact of the therapy, and thus to limit the toxicity to normal tissues in the body.
However, surgery and radiation therapy are often followed by chemotherapy to guard against any remaining or radio-resistant cancer cells. Chemotherapy is also the most appropriate treatment for disseminated cancers such as leukemia and lymphoma as well as metastases.
More recently, the use of CpG containing nucleic acids has been proposed for the treatment and prevention of cancer. We have found that unmethylated CG-dinucleotides within certain sequence contexts (CpG DNA) are recognized by the vertebrate immune system as foreign DNA (bacterial or viral). CpG DNA activates a coordinated set of immune responses that include innate immunity (macrophages, dendritic cells, and natural killer cells), humoral immunity, and cellular immunity. Krieg AM et al., Pharmacol Ther 84:113-(1999); Krieg AM et al., Curr Top Microbiol Immunol 247:1-21 (2000); Wagner H, Adv Immunol 73:329-68 (1999). As a vaccine adjuvant, CpG DNA is at least as effective as the gold standard complete Freund's adjuvant (CFA), but induces higher Thl activity and 15 demonstrates less toxicity. Chu RS et al., J Exp Med 186:1623-31 (1997);
Weiner GJ et al., Proc Natl Acad Sci USA 94:10833-7 (1997); Roman M et al., Nat Med 3:849-54 (1997);
Lipford GB et al., Eur J Immunol 27:2340-4 (1997); Davis HL et al., J Immunol 160:870-6 (1998). Recently, we identified a human CpG motif which triggers proliferation and activation of primary human B cells. Hartmann G et al., J Immunol 164:944-53 (2000).
SUMMARY OF THE INVENTION
The invention relates in some aspects to methods for treating and preventing cancer using immunostimulatory nucleic acids and antibodies. Thus in one aspect the invention is a method for treating or preventing cancer. The method involves administering to a subject having or at risk of developing cancer an effective amount to upregulate CD20 expression of a nucleic acid, and an anti-CD20 antibody. The cancer, in some embodiments, is B-cell lymphoma associated with low levels of CD20 expression. The B-cell lymphoma in other embodiments is B-cell chronic lymphocytic leukemia (B-CLL) or a marginal zone lymphoma. In some embodiments the CD20 antibody is C2B8 or Rituximab.
The invention in other aspects relates to a method for diagnosing lymphoma by isolating a B cell from a subject and identifying a change in cell surface markers when the B
cell is contacted with an immunostimulatory nucleic acid, wherein the cell surface marker
However, surgery and radiation therapy are often followed by chemotherapy to guard against any remaining or radio-resistant cancer cells. Chemotherapy is also the most appropriate treatment for disseminated cancers such as leukemia and lymphoma as well as metastases.
More recently, the use of CpG containing nucleic acids has been proposed for the treatment and prevention of cancer. We have found that unmethylated CG-dinucleotides within certain sequence contexts (CpG DNA) are recognized by the vertebrate immune system as foreign DNA (bacterial or viral). CpG DNA activates a coordinated set of immune responses that include innate immunity (macrophages, dendritic cells, and natural killer cells), humoral immunity, and cellular immunity. Krieg AM et al., Pharmacol Ther 84:113-(1999); Krieg AM et al., Curr Top Microbiol Immunol 247:1-21 (2000); Wagner H, Adv Immunol 73:329-68 (1999). As a vaccine adjuvant, CpG DNA is at least as effective as the gold standard complete Freund's adjuvant (CFA), but induces higher Thl activity and 15 demonstrates less toxicity. Chu RS et al., J Exp Med 186:1623-31 (1997);
Weiner GJ et al., Proc Natl Acad Sci USA 94:10833-7 (1997); Roman M et al., Nat Med 3:849-54 (1997);
Lipford GB et al., Eur J Immunol 27:2340-4 (1997); Davis HL et al., J Immunol 160:870-6 (1998). Recently, we identified a human CpG motif which triggers proliferation and activation of primary human B cells. Hartmann G et al., J Immunol 164:944-53 (2000).
SUMMARY OF THE INVENTION
The invention relates in some aspects to methods for treating and preventing cancer using immunostimulatory nucleic acids and antibodies. Thus in one aspect the invention is a method for treating or preventing cancer. The method involves administering to a subject having or at risk of developing cancer an effective amount to upregulate CD20 expression of a nucleic acid, and an anti-CD20 antibody. The cancer, in some embodiments, is B-cell lymphoma associated with low levels of CD20 expression. The B-cell lymphoma in other embodiments is B-cell chronic lymphocytic leukemia (B-CLL) or a marginal zone lymphoma. In some embodiments the CD20 antibody is C2B8 or Rituximab.
The invention in other aspects relates to a method for diagnosing lymphoma by isolating a B cell from a subject and identifying a change in cell surface markers when the B
cell is contacted with an immunostimulatory nucleic acid, wherein the cell surface marker
3 induced on the B cell is indicative of the type of lymphoma. In some embodiments the subject has a type of lymphoma. In some embodiments the subject is suspected of having a type of lymphoma. The method may optionally include a method for treating cancer by administering to the subject an immunostimulatory nucleic acid and an antibody specific for the cell surface antigens induced on the B cell in order to treat the cancer.
In another aspect the invention is a method for treating or preventing cancer by administering to a subject having or at risk of developing cancer an effective amount to induce expression of a surface antigen on a cancer cell surface, of a nucleic acid, and administering to the subject an antibody selected from the group consisting of an anti-CD22 antibody and an anti-CD19 antibody.
According to another aspect of the invention, a method for treating lymphoma is provided. The method includes the steps of isolating a B cell from a subject having lymphoma, identifying a surface antigen which is not expressed or which is expressed on the surface of the B cell in an amount lower than that of a control B cell, administering to the subject an antibody specific for the identified surface antigen and an immunostimulatory nucleic acid in order to treat the lymphoma, wherein the nucleic acid is administered in an effective amount to upregulate expression of the surface antigen on the lymphoma cell surface.
A method for treating a lymphoma resistant to antibody therapy is provided according to another aspect of the invention. The method includes administering to a subject having a lymphoma resistant to therapy with an antibody specific for a surface antigen, an antibody specific for the surface antigen to which the lymphoma is resistant and a nucleic acid in order to treat the lymphoma, wherein the nucleic acid is administered in an effective amount to upregulate expression of the surface antigen on the lymphoma cell surface.
The surface antigen may be any type of surface antigen which is capable of being expressed on the surface of a cancer cell and which is induced by stimulation with immunostimulatory nucleic acids. In some embodiments the surface antigen is CD20, CD40, CD22, or CD19. In other embodiments the lymphoma is B-CLL or marginal zone lymphoma. In some embodiments the antibody is an anti-CD20 antibody. In some embodiments the anti-CD20 antibody is C2B8. In another embodiment the anti-antibody is Rituximab.
=
In another aspect the invention is a method for treating or preventing cancer by administering to a subject having or at risk of developing cancer an effective amount to induce expression of a surface antigen on a cancer cell surface, of a nucleic acid, and administering to the subject an antibody selected from the group consisting of an anti-CD22 antibody and an anti-CD19 antibody.
According to another aspect of the invention, a method for treating lymphoma is provided. The method includes the steps of isolating a B cell from a subject having lymphoma, identifying a surface antigen which is not expressed or which is expressed on the surface of the B cell in an amount lower than that of a control B cell, administering to the subject an antibody specific for the identified surface antigen and an immunostimulatory nucleic acid in order to treat the lymphoma, wherein the nucleic acid is administered in an effective amount to upregulate expression of the surface antigen on the lymphoma cell surface.
A method for treating a lymphoma resistant to antibody therapy is provided according to another aspect of the invention. The method includes administering to a subject having a lymphoma resistant to therapy with an antibody specific for a surface antigen, an antibody specific for the surface antigen to which the lymphoma is resistant and a nucleic acid in order to treat the lymphoma, wherein the nucleic acid is administered in an effective amount to upregulate expression of the surface antigen on the lymphoma cell surface.
The surface antigen may be any type of surface antigen which is capable of being expressed on the surface of a cancer cell and which is induced by stimulation with immunostimulatory nucleic acids. In some embodiments the surface antigen is CD20, CD40, CD22, or CD19. In other embodiments the lymphoma is B-CLL or marginal zone lymphoma. In some embodiments the antibody is an anti-CD20 antibody. In some embodiments the anti-CD20 antibody is C2B8. In another embodiment the anti-antibody is Rituximab.
=
- 4 -In some preferred embodiments the antibody is a human IgG1 antibody. In some preferred embodiments the antibody is a murine IgG2a antibody.
In some embodiments the methods also include administering an anti-cancer therapy to the subject.
The invention also includes a method for treating cancer in a human by administering to a human an immunostimulatory nucleic acid and an antibody of IgG1 isotype (an IgG1 isotype antibody as used herein refers to a human or humanized IgG1 unless otherwise specified), which binds to a cell surface antigen of a cancer cell and wherein the nucleic acid and the antibody are administered in an effective amount for killing the cancer cell.
Optionally the nucleic acid and the antibody are administered together.
Alternatively the nucleic acid and the antibody may be administered separately.
In some embodiments the method includes the step of administering a cancer therapy.
As used herein the term "a cancer therapy" is meant to embrace a single medicament, a plurality of medicaments of a particular class and a plurality of medicaments of different classes, and includes but is not limited to chemotherapeutic agents, cancer vaccines, biological response modifiers, and hormone therapies.
A chemotherapeutic agent may be selected from the group consisting of methotrexate, vincristine, adriamycin, cisplatin, non-sugar containing chloroethylnitrosoureas, 5-fluorouracil, mitomycin C, bleomycin, doxorubicin, dacarbazine, taxol, fragyline, Meglamine GLA, valrubicin, carmustaine and poliferposan, MMI270, BAY 12-9566, RAS
famesyl transferase inhibitor, farnesyl transferase inhibitor, MTA/LY231514 LY264618/Lometexol, Glarriolec, C1-994, TNP-470, Hycamtikopotecan, PKC412, Valspodar/PSC833, NovantronnegiMitroxantrone, Metaret/Suramin, Batimastat, E7070, BCH-4556, CS-682, 9-AC, AG3340,=AG3433, Incel/VX-710, VX-853, ZD0101, IS1641, ODN
698, TA 2516/Marmistat, BB2516/Marmistat, CDP 845, D2163, PD183805, DX8951f, Lemonal DP 2202, FK 317, Picibani1/0K-432, AD 32/Valrubicin, Metastrot/strontium = 1m derivative, TeModal/Temozolomide, Evacet/liposoinal doxombicin, Yewtaxan/Paclitaxel, Taxonl)Paclitaxel, Xeload/Capecitabine, Furtulon/Dwdfiuridine, Cyclopax/oral paclitaxel, Oral Taxoid, SFU-077/Cisplatin, HMR 1275/Flavopiridol, CP-358 (774)/EGFR, CP-(754)/RAS oncogene inhibitor, BMS-182751/oral platinum, UFT(Tegafur/Uracil), Ergamisol/Levamisole, Eniluraci1/776C85/5FU enhancer, Campto/Levamisole, CamptosarTmilrinotecan, Tinnodex/Raltitrexed, Leustatin/Cladribine, Paxex/Paclitaxel,
In some embodiments the methods also include administering an anti-cancer therapy to the subject.
The invention also includes a method for treating cancer in a human by administering to a human an immunostimulatory nucleic acid and an antibody of IgG1 isotype (an IgG1 isotype antibody as used herein refers to a human or humanized IgG1 unless otherwise specified), which binds to a cell surface antigen of a cancer cell and wherein the nucleic acid and the antibody are administered in an effective amount for killing the cancer cell.
Optionally the nucleic acid and the antibody are administered together.
Alternatively the nucleic acid and the antibody may be administered separately.
In some embodiments the method includes the step of administering a cancer therapy.
As used herein the term "a cancer therapy" is meant to embrace a single medicament, a plurality of medicaments of a particular class and a plurality of medicaments of different classes, and includes but is not limited to chemotherapeutic agents, cancer vaccines, biological response modifiers, and hormone therapies.
A chemotherapeutic agent may be selected from the group consisting of methotrexate, vincristine, adriamycin, cisplatin, non-sugar containing chloroethylnitrosoureas, 5-fluorouracil, mitomycin C, bleomycin, doxorubicin, dacarbazine, taxol, fragyline, Meglamine GLA, valrubicin, carmustaine and poliferposan, MMI270, BAY 12-9566, RAS
famesyl transferase inhibitor, farnesyl transferase inhibitor, MTA/LY231514 LY264618/Lometexol, Glarriolec, C1-994, TNP-470, Hycamtikopotecan, PKC412, Valspodar/PSC833, NovantronnegiMitroxantrone, Metaret/Suramin, Batimastat, E7070, BCH-4556, CS-682, 9-AC, AG3340,=AG3433, Incel/VX-710, VX-853, ZD0101, IS1641, ODN
698, TA 2516/Marmistat, BB2516/Marmistat, CDP 845, D2163, PD183805, DX8951f, Lemonal DP 2202, FK 317, Picibani1/0K-432, AD 32/Valrubicin, Metastrot/strontium = 1m derivative, TeModal/Temozolomide, Evacet/liposoinal doxombicin, Yewtaxan/Paclitaxel, Taxonl)Paclitaxel, Xeload/Capecitabine, Furtulon/Dwdfiuridine, Cyclopax/oral paclitaxel, Oral Taxoid, SFU-077/Cisplatin, HMR 1275/Flavopiridol, CP-358 (774)/EGFR, CP-(754)/RAS oncogene inhibitor, BMS-182751/oral platinum, UFT(Tegafur/Uracil), Ergamisol/Levamisole, Eniluraci1/776C85/5FU enhancer, Campto/Levamisole, CamptosarTmilrinotecan, Tinnodex/Raltitrexed, Leustatin/Cladribine, Paxex/Paclitaxel,
- 5 -TM
TM
Doxil/liposomal doxorubicin, Caelyx/liposomal doxorubicin, FludarTa/Fludarabine, Pharmarubicin/Epirubicin, DepoCyi7ZD1839, LU 79553/Bis-Naphtalimide, LU
TM TM
103793/Dolastain, Caetyx/liposomal doxorubicin, Gemzar/Gemcitabine, ZD
0473/Anormed, YM 116, Iodine seeds, CDK4 and CDK2 inhibitors, PARP inhibitors, D4809/Dexifosamide, Ifes/MesneZ/Ifosamide, Vumon/Teniposide, Paraplatin/Carboplatin, Plantinol/cisplatin, VepesidTm/Etoposide, ZD 9331, TaxoterTem/Docetaxel, prodrug of guanine arabinoside, Taxane Analog, nitrosoureas, allcylating agents such as Melphalan, Cyclophosphamide, Aminoglutethimide, Asparaginase, Busulfan, Carboplatin, Chlorombucil, Cytarabine HC1, Dactinomycin, Daunorubicin HC1, Estramustine phosphate sodium, Etopo side (VP16-213), Floxuridine, Fluorouracil (5-FU), Flutamide, Hydroxyurea (hydroxycarbamide), Ifosfamide, Interferon Alfa-2a, Interferon Alfa-2b, Leuprolide acetate (LHRH-releasing factor analogue), Lomustine (CCNU), Mechlorethamine HC1 (nitrogen mustard), Mercaptopurine, Mesna, Mitotane (o,p'-DDD), Mitoxantrone HC1, Octreotide, Plicamycin, Procarbazine HC1, Streptozocin, Tamoxifen citrate, Thioguanine, Thiotepa, Vinblastine sulfate, Amsacrine (m-AMSA), Azacitidine, Erythropoietin, Hexamethylmelamine (HIVfM), Interleukin 2, Mitoguazone (methyl-GAG; methyl glyoxal bis-guanylhydrazone; MGBG), Pentostatin (2'deoxycoformycin), Semustine (methyl-CCNU), Teniposide (VM-26) and Vindesine sulfate.
In some preferred embodiments the chemotherapeutic agent may be selected from the group consisting of methotrexate, vincristine, adriamycin, cisplatin, mitomycin C, bleomycin, TM TM
doxorubicin, dacarbazine, taxol, valrubicin, Novantrone/Mitroxantrone, Evacet/liposomal TM
doxorubicin, Yewtaxan/Paclitaxel, Taxol/Paclitaxel, SPU-077/Cisplatin, HMR
1275/Flavopiridol, BMS-182751/oral platinum, Leustatin/Cladribine, Paxex/Paclitaxel, TM TM
Doxil/liposomal doxorubicin, Caelyx/liposomal doxorubicin, Fludar3/FlUdarahine, Pharmarubicin/Epirubicin, DepoCytTM, Caetyx/liposomal doxorubicin, GemzarTm/Gemcitabine, TM TM Ifes/MesneZ/Ifosamide, Vinnon/Teniposide, Paraplatikarboplatin, Plantinolkisplatin, = TM
VepesidT7Etoposide, Taxotere/Docetaxel, pro drug of guanine arabinoside, nitrosoureas, alkylating agents such as melphalan and cyclophosphamide, Asparaginase, Busulfan, Carboplatin, Chlorombucil, Cytarabine HC1, Daunorubicin HC1, Etoposide (VP16-213), Hydroxyurea (hydroxycarbamide), Ifosfamide, Interferon Alfa-2a, Interferon Alfa-2b, Lomustine (CCNU), Mechlorethamine HC1 (nitrogen mustard), Mercaptopurine, Mitoxantrone HC1, Procarbazine HC1, Thioguanine, Thiotepa, Vinblastine sulfate,
TM
Doxil/liposomal doxorubicin, Caelyx/liposomal doxorubicin, FludarTa/Fludarabine, Pharmarubicin/Epirubicin, DepoCyi7ZD1839, LU 79553/Bis-Naphtalimide, LU
TM TM
103793/Dolastain, Caetyx/liposomal doxorubicin, Gemzar/Gemcitabine, ZD
0473/Anormed, YM 116, Iodine seeds, CDK4 and CDK2 inhibitors, PARP inhibitors, D4809/Dexifosamide, Ifes/MesneZ/Ifosamide, Vumon/Teniposide, Paraplatin/Carboplatin, Plantinol/cisplatin, VepesidTm/Etoposide, ZD 9331, TaxoterTem/Docetaxel, prodrug of guanine arabinoside, Taxane Analog, nitrosoureas, allcylating agents such as Melphalan, Cyclophosphamide, Aminoglutethimide, Asparaginase, Busulfan, Carboplatin, Chlorombucil, Cytarabine HC1, Dactinomycin, Daunorubicin HC1, Estramustine phosphate sodium, Etopo side (VP16-213), Floxuridine, Fluorouracil (5-FU), Flutamide, Hydroxyurea (hydroxycarbamide), Ifosfamide, Interferon Alfa-2a, Interferon Alfa-2b, Leuprolide acetate (LHRH-releasing factor analogue), Lomustine (CCNU), Mechlorethamine HC1 (nitrogen mustard), Mercaptopurine, Mesna, Mitotane (o,p'-DDD), Mitoxantrone HC1, Octreotide, Plicamycin, Procarbazine HC1, Streptozocin, Tamoxifen citrate, Thioguanine, Thiotepa, Vinblastine sulfate, Amsacrine (m-AMSA), Azacitidine, Erythropoietin, Hexamethylmelamine (HIVfM), Interleukin 2, Mitoguazone (methyl-GAG; methyl glyoxal bis-guanylhydrazone; MGBG), Pentostatin (2'deoxycoformycin), Semustine (methyl-CCNU), Teniposide (VM-26) and Vindesine sulfate.
In some preferred embodiments the chemotherapeutic agent may be selected from the group consisting of methotrexate, vincristine, adriamycin, cisplatin, mitomycin C, bleomycin, TM TM
doxorubicin, dacarbazine, taxol, valrubicin, Novantrone/Mitroxantrone, Evacet/liposomal TM
doxorubicin, Yewtaxan/Paclitaxel, Taxol/Paclitaxel, SPU-077/Cisplatin, HMR
1275/Flavopiridol, BMS-182751/oral platinum, Leustatin/Cladribine, Paxex/Paclitaxel, TM TM
Doxil/liposomal doxorubicin, Caelyx/liposomal doxorubicin, Fludar3/FlUdarahine, Pharmarubicin/Epirubicin, DepoCytTM, Caetyx/liposomal doxorubicin, GemzarTm/Gemcitabine, TM TM Ifes/MesneZ/Ifosamide, Vinnon/Teniposide, Paraplatikarboplatin, Plantinolkisplatin, = TM
VepesidT7Etoposide, Taxotere/Docetaxel, pro drug of guanine arabinoside, nitrosoureas, alkylating agents such as melphalan and cyclophosphamide, Asparaginase, Busulfan, Carboplatin, Chlorombucil, Cytarabine HC1, Daunorubicin HC1, Etoposide (VP16-213), Hydroxyurea (hydroxycarbamide), Ifosfamide, Interferon Alfa-2a, Interferon Alfa-2b, Lomustine (CCNU), Mechlorethamine HC1 (nitrogen mustard), Mercaptopurine, Mitoxantrone HC1, Procarbazine HC1, Thioguanine, Thiotepa, Vinblastine sulfate,
- 6 -Azacitidine, Interleukin 2, Pentostatin (2'deoxycoformycin), Teniposide (VM-26), GM-CSF, and Vindesine sulfate.
A cancer vaccine may be selected from the group consisting of EGF, Anti-idiotypic cancer vaccines, Gp75 antigen, GMK melanoma vaccine, MGV ganglioside conjugate TM TM TM
vaccine, Her2/neu, Ovarex, M-Vax, 0-Vax, L-Vax, STn-KHL theratope, BLP25 (MUC-1), liposomal idiotypic vaccine, MelacineT,mpeptide antigen vaccines, toxin/antigen vaccines, MVA-based vaccine, PACTS, BCG vaccine, TA-1-J1PV, TA-C1N, DISC-virus and IM ImmuCysi/TheraCism. Biological response modifiers include interferon, and lymphokines such as IL-2. Hormone replacement therapy includes tamoxifen alone or in combination with to progesterone. In a further embodiment, the cancer therapy is interferon-a (e.g., 1NTRONO
A, Schering).
The cancer may be selected from the group consisting of basal cell carcinoma, bladder cancer, bone cancer, brain and central nervous system (CNS) cancer, breast cancer, cervical cancer, colon and rectum cancer, connective tissue cancer, esophageal cancer, eye cancer, kidney cancer, larynx cancer, leukemia, liver cancer, lung cancer, Hodgkin's lymphoma, non-Hodgkin's lymphoma, melanoma, myeloma, oral cavity cancer (e.g., lip, tongue, mouth, and pharynx), ovarian cancer, pancreatic cancer, prostate cancer, rhabdomyosarcoma, skin cancer, stomach cancer, testicular cancer, and uterine cancer. In preferred embodiments, the cancer to be treated may be selected from the group consisting of bone cancer, brain and CNS
cancer, connective tissue cancer, esophageal cancer, eye cancer, Hodgkin's lymphoma, larynx cancer, oral cavity cancer (e.g., lip, tongue, mouth, and pharynx), skin cancer, and testicular cancer.
In another aspect the invention encompasses a kit. The kit includes a package including at least two containers, the first container housing an immunostimulatory nucleic acid, the second container housing an antibody specific for a cell surface antigen, and instructions for screening a cell to determine whether the inununostimulatory nucleic acid upregulates expression of the cell surface antigen. In one embodiment the antibody is selected from the group consisting of an anti-CD20 antibody, an anti-CD19 antibody, and an anti-CD22 antibody.
The nucleic acids useful according to the invention are immunostimulatory nucleic acids and in some embodiments are immunostimulatory CpG nucleic acids having an
A cancer vaccine may be selected from the group consisting of EGF, Anti-idiotypic cancer vaccines, Gp75 antigen, GMK melanoma vaccine, MGV ganglioside conjugate TM TM TM
vaccine, Her2/neu, Ovarex, M-Vax, 0-Vax, L-Vax, STn-KHL theratope, BLP25 (MUC-1), liposomal idiotypic vaccine, MelacineT,mpeptide antigen vaccines, toxin/antigen vaccines, MVA-based vaccine, PACTS, BCG vaccine, TA-1-J1PV, TA-C1N, DISC-virus and IM ImmuCysi/TheraCism. Biological response modifiers include interferon, and lymphokines such as IL-2. Hormone replacement therapy includes tamoxifen alone or in combination with to progesterone. In a further embodiment, the cancer therapy is interferon-a (e.g., 1NTRONO
A, Schering).
The cancer may be selected from the group consisting of basal cell carcinoma, bladder cancer, bone cancer, brain and central nervous system (CNS) cancer, breast cancer, cervical cancer, colon and rectum cancer, connective tissue cancer, esophageal cancer, eye cancer, kidney cancer, larynx cancer, leukemia, liver cancer, lung cancer, Hodgkin's lymphoma, non-Hodgkin's lymphoma, melanoma, myeloma, oral cavity cancer (e.g., lip, tongue, mouth, and pharynx), ovarian cancer, pancreatic cancer, prostate cancer, rhabdomyosarcoma, skin cancer, stomach cancer, testicular cancer, and uterine cancer. In preferred embodiments, the cancer to be treated may be selected from the group consisting of bone cancer, brain and CNS
cancer, connective tissue cancer, esophageal cancer, eye cancer, Hodgkin's lymphoma, larynx cancer, oral cavity cancer (e.g., lip, tongue, mouth, and pharynx), skin cancer, and testicular cancer.
In another aspect the invention encompasses a kit. The kit includes a package including at least two containers, the first container housing an immunostimulatory nucleic acid, the second container housing an antibody specific for a cell surface antigen, and instructions for screening a cell to determine whether the inununostimulatory nucleic acid upregulates expression of the cell surface antigen. In one embodiment the antibody is selected from the group consisting of an anti-CD20 antibody, an anti-CD19 antibody, and an anti-CD22 antibody.
The nucleic acids useful according to the invention are immunostimulatory nucleic acids and in some embodiments are immunostimulatory CpG nucleic acids having an
- 7 -=methylated CpG motif, immunostimulatory T-rich nucleic acids, immunostimulatory poly-G nucleic acids, bacterial DNA, yeast DNA, or eulcaryotic DNA.
In some embodiments the nucleic acid does not hybridize with genomic DNA or RNA
under stringent conditions. In other embodiments the nucleic acid does hybridize with genornic DNA or RNA under strinRent conditions.
Known stringent conditions include hybridization in 50% formamide, 1 M NaC1, 1% SDS at 37 C, and a wash in 0.1X SSC at 60 C. Hybridization procedures are well-known in the art and are described in Ausubel etal., (Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons Inc., 1994).
The nucleic acid may have natural linkages or may include at least one modified backbone intemucleotide linkage. In some embodiments the modified backbone is a phosphate backbone modification. In other embodiments the modified backbone is a peptide modified oligonucleotide backbone. The nucleic acid may also include native bases or modified bases. The nucleotide backbone may be chimeric, or the nucleotide backbone is entirely modified.
The immunostimulatory nucleic acid can have any length greater than 6 nucleotides, but in some embodiments is between 8 and 100 nucleotide residues in length. In other embodiments the nucleic acid comprises at least 20 nucleotides, at least 24 nucleotides, at least 27, nucleotides, or at least 30 nucleotides. The nucleic acid may be single-stranded or double-stranded. In some embodiments the nucleic acid is isolated and in other embodiments the nucleic acid may be a synthetic nucleic acid.
The CpG nucleic acid in one embodiment contains at least one =methylated CpG
dinucleotide having a sequence including at least the following formula: 5' X1X2CGX3X4 3' wherein C is =methylated, wherein X1, X2, X3, and Xi are nucleotides. In one embodiment the 5' X1X2CGX3X4 3' sequence of the CpG nucleic acid is a non-palindromic sequence, and in other embodiments it is a palindromic sequence.
In some embodiments X1X2 are nucleotides selected from the group consisting of:
GpT, GpG, GpA, ApA, ApT, ApG, CpT, CpA, CpG, TpA, TpT, and TpG; and X3X4 are nucleotides selected from the group consisting of: TpT, CpT, ApT, TpG, ApG, CpG, TpC, ApC, CpC, TpA, ApA, and CpA. In other embodiments X1X2 are CpA or GpT and X3X4 are TpT. In yet other embodiments X1 or X2 or both are ptuines and X3 or X4 or both are pyrimidines or X1X2 are GpA and X3 or X4 or both are pyrimidines. In one embodiment X2 is a T and X3 is a pyrimidine.
In other embodiments the CpG nucleic acid has a sequence selected from the group consisting of SEQ ID NOs: 19, 35-37, 39-42, 91,92, 101, 108, 111, 135, 141, 151, 274, 277, 280, 286, 319, 350, 363, 368, 375, 495-498, 517, 518, 524, 529, 545, 548, 549, 555, 557,
In some embodiments the nucleic acid does not hybridize with genomic DNA or RNA
under stringent conditions. In other embodiments the nucleic acid does hybridize with genornic DNA or RNA under strinRent conditions.
Known stringent conditions include hybridization in 50% formamide, 1 M NaC1, 1% SDS at 37 C, and a wash in 0.1X SSC at 60 C. Hybridization procedures are well-known in the art and are described in Ausubel etal., (Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons Inc., 1994).
The nucleic acid may have natural linkages or may include at least one modified backbone intemucleotide linkage. In some embodiments the modified backbone is a phosphate backbone modification. In other embodiments the modified backbone is a peptide modified oligonucleotide backbone. The nucleic acid may also include native bases or modified bases. The nucleotide backbone may be chimeric, or the nucleotide backbone is entirely modified.
The immunostimulatory nucleic acid can have any length greater than 6 nucleotides, but in some embodiments is between 8 and 100 nucleotide residues in length. In other embodiments the nucleic acid comprises at least 20 nucleotides, at least 24 nucleotides, at least 27, nucleotides, or at least 30 nucleotides. The nucleic acid may be single-stranded or double-stranded. In some embodiments the nucleic acid is isolated and in other embodiments the nucleic acid may be a synthetic nucleic acid.
The CpG nucleic acid in one embodiment contains at least one =methylated CpG
dinucleotide having a sequence including at least the following formula: 5' X1X2CGX3X4 3' wherein C is =methylated, wherein X1, X2, X3, and Xi are nucleotides. In one embodiment the 5' X1X2CGX3X4 3' sequence of the CpG nucleic acid is a non-palindromic sequence, and in other embodiments it is a palindromic sequence.
In some embodiments X1X2 are nucleotides selected from the group consisting of:
GpT, GpG, GpA, ApA, ApT, ApG, CpT, CpA, CpG, TpA, TpT, and TpG; and X3X4 are nucleotides selected from the group consisting of: TpT, CpT, ApT, TpG, ApG, CpG, TpC, ApC, CpC, TpA, ApA, and CpA. In other embodiments X1X2 are CpA or GpT and X3X4 are TpT. In yet other embodiments X1 or X2 or both are ptuines and X3 or X4 or both are pyrimidines or X1X2 are GpA and X3 or X4 or both are pyrimidines. In one embodiment X2 is a T and X3 is a pyrimidine.
In other embodiments the CpG nucleic acid has a sequence selected from the group consisting of SEQ ID NOs: 19, 35-37, 39-42, 91,92, 101, 108, 111, 135, 141, 151, 274, 277, 280, 286, 319, 350, 363, 368, 375, 495-498, 517, 518, 524, 529, 545, 548, 549, 555, 557,
-8-560-563, 566, 585, 590, 591, 595, 599, 603, 605, 611, 614-616, 650, 676, 679, 682, 684, 702, 703, 707-710, 717-720, 729-732, 752, 755, 770, and 801-803.
In some embodiments the T-rich immunostimulatory nucleic acid is a poly-T
nucleic acid comprising 5' TTTT 3'. In yet other embodiments the poly-T nucleic acid comprises 5' X1X2TTTTX3X4 3' wherein X1, X2, X3, and X4 are nucleotides. In some embodiments X1X2 is TT and/or X3X4 is TT. In other embodiments X1X2 is selected from the group consisting of TA, TG, TC, AT, AA, AG, AC, CT, CC, CA, CG, GT, GG, GA, and GC;
and/or X3X4 is selected from the group consisting of TA, TG, TC, AT, AA, AG, AC, CT, CC, CA, CG, GT, GG, GA, and GC.
The T-rich immunostimulatory nucleic acid may have only a single poly-T motif or it may have a plurality of poly-T nucleic acid motifs. In some embodiments the T-rich immunostimulatory nucleic acid comprises at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, or at least 8 T motifs. In other embodiments it comprises at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, or at least 8 CpG motifs. In some embodiments the plurality of CpG motifs and poly-T motifs are interspersed.
In yet other embodiments at least one of the plurality of poly-T motifs comprises at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, or at least 9 contiguous T
nucleotide residues. In other embodiments the plurality of poly-T motifs is at least 3 motifs and wherein at least 3 motifs each comprises at least 3 contiguous T
nucleotide residues or the plurality of poly-T motifs is at least 4 motifs and wherein the at least 4 motifs each comprises at least 3 contiguous T nucleotide residues.
The T-rich immunostimulatory nucleic acid may include one or more CpG motifs.
In other embodiments the T-rich immunostimulatory nucleic acid is free of one or more CpG
dinucleotides.
In other embodiments the T-rich immunostimulatory nucleic acid has poly A, poly-G, and/or poly C motifs. In other embodiments the T-rich immunostimulatory nucleic acid is free of two poly C sequences of at least 3 contiguous C nucleotide residues.
Preferably the T-rich immunostimulatory nucleic acid is free of two poly A sequences of at least 3 contiguous A nucleotide residues. In other embodiments the T-rich immunostimulatory nucleic acid comprises a nucleotide composition of greater than 25% C or greater than 25%
A. In yet other embodiments the T-rich immunostimulatory nucleic acid is free of poly-C
sequences, poly-G sequences or poly-A sequences.
In some embodiments the T-rich immunostimulatory nucleic acid is a poly-T
nucleic acid comprising 5' TTTT 3'. In yet other embodiments the poly-T nucleic acid comprises 5' X1X2TTTTX3X4 3' wherein X1, X2, X3, and X4 are nucleotides. In some embodiments X1X2 is TT and/or X3X4 is TT. In other embodiments X1X2 is selected from the group consisting of TA, TG, TC, AT, AA, AG, AC, CT, CC, CA, CG, GT, GG, GA, and GC;
and/or X3X4 is selected from the group consisting of TA, TG, TC, AT, AA, AG, AC, CT, CC, CA, CG, GT, GG, GA, and GC.
The T-rich immunostimulatory nucleic acid may have only a single poly-T motif or it may have a plurality of poly-T nucleic acid motifs. In some embodiments the T-rich immunostimulatory nucleic acid comprises at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, or at least 8 T motifs. In other embodiments it comprises at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, or at least 8 CpG motifs. In some embodiments the plurality of CpG motifs and poly-T motifs are interspersed.
In yet other embodiments at least one of the plurality of poly-T motifs comprises at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, or at least 9 contiguous T
nucleotide residues. In other embodiments the plurality of poly-T motifs is at least 3 motifs and wherein at least 3 motifs each comprises at least 3 contiguous T
nucleotide residues or the plurality of poly-T motifs is at least 4 motifs and wherein the at least 4 motifs each comprises at least 3 contiguous T nucleotide residues.
The T-rich immunostimulatory nucleic acid may include one or more CpG motifs.
In other embodiments the T-rich immunostimulatory nucleic acid is free of one or more CpG
dinucleotides.
In other embodiments the T-rich immunostimulatory nucleic acid has poly A, poly-G, and/or poly C motifs. In other embodiments the T-rich immunostimulatory nucleic acid is free of two poly C sequences of at least 3 contiguous C nucleotide residues.
Preferably the T-rich immunostimulatory nucleic acid is free of two poly A sequences of at least 3 contiguous A nucleotide residues. In other embodiments the T-rich immunostimulatory nucleic acid comprises a nucleotide composition of greater than 25% C or greater than 25%
A. In yet other embodiments the T-rich immunostimulatory nucleic acid is free of poly-C
sequences, poly-G sequences or poly-A sequences.
- 9 -In some cases the T-rich immunostimulatory nucleic acid may be free of poly-T
motifs, but rather, comprises a nucleotide composition of greater than 25% T.
In other embodiments the T-rich immunostimulatory nucleic acid may have poly-T motifs and also comprise a nucleotide composition of greater than 25% T. In some embodiments the T-rich immunostimulatory nucleic acid comprises a nucleotide composition of greater than 25% T, greater than 30% T, greater than 40% T, greater than 50% T, greater than 60%
T, greater than 80% T, or greater than 90% T nucleotide residues.
In some embodiments the poly-G nucleic acid comprises: 5' X1X2GGGX3X4 3' wherein X1, X2, X3, and X4 are nucleotides. In embodiments at least one of X3 and X4 are a G or both of X3 and X4 are a G. In other embodiments the poly-G nucleic acid comprises the following formula: 5' GGGNGGG 3' wherein N represents between 0 and 20 nucleotides. In yet other embodiments the poly-G nucleic acid comprises the following formula:
5' GGGNGGGNGGG 3' wherein N represents between 0 and 20 nucleotides.
The poly-G immunostimulatory nucleic acid may include one or more CpG motifs or T-rich motifs. In other embodiments the poly-G nucleic acid is free of one or more CpG
dinucleotides or poly-T motifs.
- 9a -In one aspect, the invention relates to the use of an immunostimulatory nucleic acid comprising at least one unmethylated CpG dinucleotide comprising the sequence 5'X1 X2CGX3X43' wherein C is unmethylated and X1, X2, X3 and X4 are nucleotides, wherein X3 and X4 are TT, and wherein the nucleic acid is 8-40 nucleotides in length, and an antibody specific for a CD19, CD20, CD22 or CD40 antigen, for use in the treatment or prevention of a B cell malignancy, wherein the immunostimulatory nucleic acid upregulates expression of the antigen.
In another aspect, the invention relates to the use of an immunostimulatory nucleic acid comprising at least one unmethylated CpG dinucleotide comprising the sequence 5'XIX2CGX3X431 wherein C is unmethylated and X1, X2, X3 and X4 are nucleotides, wherein X3 and X4 are TT, and wherein the nucleic acid is 8-40 nucleotides in length for the manufacture of a medicament for use, with an antibody specific for a CD19, CD20, CD22 or CD40 antigen, in the treatment or prevention of a B cell malignancy, wherein the immunostimulatory nucleic acid upregulates expression of the antigen.
1 5 In another aspect, the invention relates to the use of an antibody specific for a CD19, CD20, CD22 or CD40 antigen for the manufacture of a medicament for use, in conjunction with an immunostimulatory nucleic acid comprising at least one unmethylated CpG dinucleotide comprising the sequence 5'XIX2CGX3X43' wherein C is unmethylated and X1, X2, X3 and X4 are nucleotides, wherein X3 and X4 are TT, and wherein the nucleic acid is 8-40 nucleotides in length in the treatment or prevention of a B cell malignancy, wherein the immunostimulatory nucleic acid upregulates expression of the antigen.
In another aspect, the invention relates to a composition comprising an immunostimulatory nucleic acid comprising at least one unmethylated CpG
dinucleotide comprising the sequence 5'XIX2CGX3X43' wherein C is unmethylated and X1, X2, X3 and X4 are nucleotides, wherein X3 and X4 are TT, and wherein the nucleic acid is 8-40 nucleotides in length, and an antigen specific antibody, wherein the antigen is a CD19, CD20, CD22 or CD40 antigen, for use in the treatment or prevention of a B cell malignancy, wherein the immunostimulatory nucleic acid upregulates expression of the antigen.
- 9b -In another aspect, the invention relates to a kit comprising a package including at least two containers, the first container housing an immunostimulatory nucleic acid comprising at least one unmethylated CpG dinucleotide comprising the sequence 5' X IX2CGX3X4 3' wherein C is unmethylated and Xi, X2, X3 and X4 are nucleotides, wherein X3 and X4 are TT, and wherein the nucleic acid is 8-40 nucleotides in length, the second container housing an antibody specific for a cell surface antigen, and instructions for screening a cell to determine whether the immunostimulatory nucleic acid up-regulates expression of the cell surface antigen in the cell; wherein the antigen is a CD19, CD20, CD22 or CD40 antigen, wherein the kit is for use in the treatment or prevention of a B cell malignancy, wherein the immunostimulatory nucleic acid upregulates expression of the antigen.
Each of the limitations of the invention can encompass various embodiments of the invention. It is, therefore, anticipated that each of the limitations of the invention involving any one element or combinations of elements can be included in each aspect of the invention.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 depicts data from flow cytometry which demonstrates the induction of a morphologic change in marginal zone lymphoma cells upon CpG oligonucleotide stimulation. Malignant B cells from a patient with marginal zone lymphoma were stimulated with no oligonucleotide (A and D), control oligonucleotide (ODN 2017, SEQ ID
NO: 168, B
and E) or CpG oligonucleotide (ODN 2006, SEQ ID NO: 729, C and F) and analyzed by flow cytometry. A, B, and C illustrate forward scatter (FSC; x-axis) vs. side scatter (SSC; y-axis).
D, E and F illustrate CD19 expression (x-axis) against FSC (y-axis).
Figure 2 depicts data from flow cytometry which demonstrates the change in expression of surface antigens on marginal zone lymphoma cells upon CpG
oligodoexynucleotide (ODN) treatment. Flow cytometric analysis of surface antigen expression on malignant B cells from a patient with marginal zone lymphoma was performed
motifs, but rather, comprises a nucleotide composition of greater than 25% T.
In other embodiments the T-rich immunostimulatory nucleic acid may have poly-T motifs and also comprise a nucleotide composition of greater than 25% T. In some embodiments the T-rich immunostimulatory nucleic acid comprises a nucleotide composition of greater than 25% T, greater than 30% T, greater than 40% T, greater than 50% T, greater than 60%
T, greater than 80% T, or greater than 90% T nucleotide residues.
In some embodiments the poly-G nucleic acid comprises: 5' X1X2GGGX3X4 3' wherein X1, X2, X3, and X4 are nucleotides. In embodiments at least one of X3 and X4 are a G or both of X3 and X4 are a G. In other embodiments the poly-G nucleic acid comprises the following formula: 5' GGGNGGG 3' wherein N represents between 0 and 20 nucleotides. In yet other embodiments the poly-G nucleic acid comprises the following formula:
5' GGGNGGGNGGG 3' wherein N represents between 0 and 20 nucleotides.
The poly-G immunostimulatory nucleic acid may include one or more CpG motifs or T-rich motifs. In other embodiments the poly-G nucleic acid is free of one or more CpG
dinucleotides or poly-T motifs.
- 9a -In one aspect, the invention relates to the use of an immunostimulatory nucleic acid comprising at least one unmethylated CpG dinucleotide comprising the sequence 5'X1 X2CGX3X43' wherein C is unmethylated and X1, X2, X3 and X4 are nucleotides, wherein X3 and X4 are TT, and wherein the nucleic acid is 8-40 nucleotides in length, and an antibody specific for a CD19, CD20, CD22 or CD40 antigen, for use in the treatment or prevention of a B cell malignancy, wherein the immunostimulatory nucleic acid upregulates expression of the antigen.
In another aspect, the invention relates to the use of an immunostimulatory nucleic acid comprising at least one unmethylated CpG dinucleotide comprising the sequence 5'XIX2CGX3X431 wherein C is unmethylated and X1, X2, X3 and X4 are nucleotides, wherein X3 and X4 are TT, and wherein the nucleic acid is 8-40 nucleotides in length for the manufacture of a medicament for use, with an antibody specific for a CD19, CD20, CD22 or CD40 antigen, in the treatment or prevention of a B cell malignancy, wherein the immunostimulatory nucleic acid upregulates expression of the antigen.
1 5 In another aspect, the invention relates to the use of an antibody specific for a CD19, CD20, CD22 or CD40 antigen for the manufacture of a medicament for use, in conjunction with an immunostimulatory nucleic acid comprising at least one unmethylated CpG dinucleotide comprising the sequence 5'XIX2CGX3X43' wherein C is unmethylated and X1, X2, X3 and X4 are nucleotides, wherein X3 and X4 are TT, and wherein the nucleic acid is 8-40 nucleotides in length in the treatment or prevention of a B cell malignancy, wherein the immunostimulatory nucleic acid upregulates expression of the antigen.
In another aspect, the invention relates to a composition comprising an immunostimulatory nucleic acid comprising at least one unmethylated CpG
dinucleotide comprising the sequence 5'XIX2CGX3X43' wherein C is unmethylated and X1, X2, X3 and X4 are nucleotides, wherein X3 and X4 are TT, and wherein the nucleic acid is 8-40 nucleotides in length, and an antigen specific antibody, wherein the antigen is a CD19, CD20, CD22 or CD40 antigen, for use in the treatment or prevention of a B cell malignancy, wherein the immunostimulatory nucleic acid upregulates expression of the antigen.
- 9b -In another aspect, the invention relates to a kit comprising a package including at least two containers, the first container housing an immunostimulatory nucleic acid comprising at least one unmethylated CpG dinucleotide comprising the sequence 5' X IX2CGX3X4 3' wherein C is unmethylated and Xi, X2, X3 and X4 are nucleotides, wherein X3 and X4 are TT, and wherein the nucleic acid is 8-40 nucleotides in length, the second container housing an antibody specific for a cell surface antigen, and instructions for screening a cell to determine whether the immunostimulatory nucleic acid up-regulates expression of the cell surface antigen in the cell; wherein the antigen is a CD19, CD20, CD22 or CD40 antigen, wherein the kit is for use in the treatment or prevention of a B cell malignancy, wherein the immunostimulatory nucleic acid upregulates expression of the antigen.
Each of the limitations of the invention can encompass various embodiments of the invention. It is, therefore, anticipated that each of the limitations of the invention involving any one element or combinations of elements can be included in each aspect of the invention.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 depicts data from flow cytometry which demonstrates the induction of a morphologic change in marginal zone lymphoma cells upon CpG oligonucleotide stimulation. Malignant B cells from a patient with marginal zone lymphoma were stimulated with no oligonucleotide (A and D), control oligonucleotide (ODN 2017, SEQ ID
NO: 168, B
and E) or CpG oligonucleotide (ODN 2006, SEQ ID NO: 729, C and F) and analyzed by flow cytometry. A, B, and C illustrate forward scatter (FSC; x-axis) vs. side scatter (SSC; y-axis).
D, E and F illustrate CD19 expression (x-axis) against FSC (y-axis).
Figure 2 depicts data from flow cytometry which demonstrates the change in expression of surface antigens on marginal zone lymphoma cells upon CpG
oligodoexynucleotide (ODN) treatment. Flow cytometric analysis of surface antigen expression on malignant B cells from a patient with marginal zone lymphoma was performed
- 10 -using either CpG or non-CpG oligonucleotide. Thin curves indicate incubation with medium alone, dotted curves indicate incubation with control oligonucleotide, and bold curves indicate incubation with CpG oligonucleotide.
Figure 3 is a set of bar graphs depicting changes in expression of surface antigens on primary cells representing different B-cell malignancies and cells of a benign follicular hyperplasia upon treatment with, from left to right in each panel: negative control, no oligonucleotide, control oligonucleotide (ODN 2017, SEQ ID NO: 168), or CpG
oligonucleotide (ODN 2006, SEQ ID NO: 729). Each panel represents one experiment.
Figure 4 is a set of graphs depicting the observation that the effect of CpG
oligonucleotide on CD20 (top) and CD40 (bottom) is dependent on the baseline level of expression of CD20 and CD40. Cells from lymph node biopsies, peripheral blood or pleural fluid from patients with different B-cell malignancies were incubated with or without CpG
oligonucleotide, and expression of CD20 and CD40 was measured by flow cytometry.
Figure 5 depicts data from flow cytometry which demonstrates the effect of CpG
oligonucleotide-induced proliferation of malignant and normal B cells.
Peripheral blood mononuclear cells from patients with B-CLL (left) or marginal zone lymphoma with circulating malignant cells (right), were incubated with CpG oligonucleotide (bottom) or medium alone (top) and evaluated by two-color flow cytometry. CFSE
fluorescence (x-axis) and expression of CD5 (B-CLL) or CD19 (marginal zone lymphoma) (y-axis) were evaluated.
Figure 6 is a graph depicting the survival of mice injected on Day 0 with tumor cells in response to CpG simulation in combination with murine IgG2a and murine IgG1 anti-tumor antibodies. Treatments are shown as filled squares, untreated controls;
filled circles, murine IgGl; filled triangles, murine IgG1 plus CpG; filled diamonds, murine IgG2a; and open squares, murine IgG2a plus CpG.
DETAILED DESCRIPTION
Present cancer treatments are often ineffective as well as being associated with a high degree of patient morbidity. The invention provides methods and products for the more effective treatment of cancer using a combination of immunostimulatory nucleic acids, antibodies, and optionally cancer therapies.
Figure 3 is a set of bar graphs depicting changes in expression of surface antigens on primary cells representing different B-cell malignancies and cells of a benign follicular hyperplasia upon treatment with, from left to right in each panel: negative control, no oligonucleotide, control oligonucleotide (ODN 2017, SEQ ID NO: 168), or CpG
oligonucleotide (ODN 2006, SEQ ID NO: 729). Each panel represents one experiment.
Figure 4 is a set of graphs depicting the observation that the effect of CpG
oligonucleotide on CD20 (top) and CD40 (bottom) is dependent on the baseline level of expression of CD20 and CD40. Cells from lymph node biopsies, peripheral blood or pleural fluid from patients with different B-cell malignancies were incubated with or without CpG
oligonucleotide, and expression of CD20 and CD40 was measured by flow cytometry.
Figure 5 depicts data from flow cytometry which demonstrates the effect of CpG
oligonucleotide-induced proliferation of malignant and normal B cells.
Peripheral blood mononuclear cells from patients with B-CLL (left) or marginal zone lymphoma with circulating malignant cells (right), were incubated with CpG oligonucleotide (bottom) or medium alone (top) and evaluated by two-color flow cytometry. CFSE
fluorescence (x-axis) and expression of CD5 (B-CLL) or CD19 (marginal zone lymphoma) (y-axis) were evaluated.
Figure 6 is a graph depicting the survival of mice injected on Day 0 with tumor cells in response to CpG simulation in combination with murine IgG2a and murine IgG1 anti-tumor antibodies. Treatments are shown as filled squares, untreated controls;
filled circles, murine IgGl; filled triangles, murine IgG1 plus CpG; filled diamonds, murine IgG2a; and open squares, murine IgG2a plus CpG.
DETAILED DESCRIPTION
Present cancer treatments are often ineffective as well as being associated with a high degree of patient morbidity. The invention provides methods and products for the more effective treatment of cancer using a combination of immunostimulatory nucleic acids, antibodies, and optionally cancer therapies.
- 11 -The invention is based, in part, on the surprising discovery that administration to a subject of immunostimulatory nucleic acids induces the expression of cell surface antigens including CD20, CD19, and CD22 on the surface of a cancer cell and that the induction of these antigens leads to enhanced antibody-dependent cellular cytotoxicity (ADCC). It was previously believed that CpG oligonucleotides enhanced ADCC by influencing the effector cell (e.g., by activating natural killer (NK) cells). Now it has been discovered according to the invention that immunostimulatory nucleic acids actually cause the induction of specific antigens CD20, CD19, and CD22, each of which can be targeted by specific antibody therapies. The discovery that immunostimulatory nucleic acids are capable of upregulating expression of certain target antigens on the surface of cancer cells, supports the development of therapies using immunostimulatory nucleic acids in combination with specific antibodies which interact with these cell surface antigens. Thus, in one aspect, the invention provides a method for treating or preventing cancer which involves the administration to a subject of a combination of an immunostimulatory nucleic acid and an antibody which specifically interacts with CD20, CD19, and CD22 in an effective amount to prevent or treat the cancer.
Additionally, it was discovered that the increased expression of these and other cell surface antigens varies widely depending upon the histological state of the tumor cell studied.
The effect of immunostimulatory nucleic acids on different types of primary malignant B
cells and reactive follicular hyperplasia was extensively examined. All B-cell lymphoma cells tested increased in size and granularity, upregulated activation markers (CD80, CD86, CD40, CD54, CD69), and upregulated antigen presentation molecules (class I
major histocompatibility complex (MHC I), class II major histocompatibilty complex (MHC II)) in response to immunostimulatory nucleic acids. A control poly-C
oligodeoxynucleotide (ODN) showed only minor effects. The extent of phenotypic change induced by immunostimulatory nucleic acids differed from sample to sample.
Immunostimulatory nucleic acids, but not control nucleic acids, increased the expression of co-stimulatory molecules (e.g., CD40, CD80, CD86, CD54) on malignant B cells without altering the phenotype of B cells derived from reactive follicular hyperplasia.
Immunostimulatory nucleic acids also enhanced expression of both class I and class II MHC in most samples.
CD20 expression was increased in response to immunostimulatory nucleic acids, most notably in B-CLL and marginal zone lymphoma.
Additionally, it was discovered that the increased expression of these and other cell surface antigens varies widely depending upon the histological state of the tumor cell studied.
The effect of immunostimulatory nucleic acids on different types of primary malignant B
cells and reactive follicular hyperplasia was extensively examined. All B-cell lymphoma cells tested increased in size and granularity, upregulated activation markers (CD80, CD86, CD40, CD54, CD69), and upregulated antigen presentation molecules (class I
major histocompatibility complex (MHC I), class II major histocompatibilty complex (MHC II)) in response to immunostimulatory nucleic acids. A control poly-C
oligodeoxynucleotide (ODN) showed only minor effects. The extent of phenotypic change induced by immunostimulatory nucleic acids differed from sample to sample.
Immunostimulatory nucleic acids, but not control nucleic acids, increased the expression of co-stimulatory molecules (e.g., CD40, CD80, CD86, CD54) on malignant B cells without altering the phenotype of B cells derived from reactive follicular hyperplasia.
Immunostimulatory nucleic acids also enhanced expression of both class I and class II MHC in most samples.
CD20 expression was increased in response to immunostimulatory nucleic acids, most notably in B-CLL and marginal zone lymphoma.
- 12 -Furthermore, an inverse correlation was found between baseline expression of specific cell surface antigens and their expression after exposure to immunostimulatory nucleic acids. Thus the most significant increase in expression of these molecules was found in those samples that had the lowest (or no) baseline levels. These data indicate that immunostimulatory nucleic acids may reverse low expression of co-stimulatory molecules on malignant B cells that correspond to a low level of activation, while their effects on cells that are already in an activated state are less profound.
Thus, the invention relates to methods for identifying an appropriate therapy for a lymphoma patient, and for treating the patient using that therapy. The method can be accomplished by isolating a B cell from a lymphoma patient and comparing the surface antigens expressed on the malignant B cell with those expressed on normal B
cells. The antigens which are expressed in low levels or not at all on the malignant B
cell can be identified. The subject can then be treated using a combination of an immunostimulating nucleic acid and an antibody which specifically recognizes the antigen(s) which are expressed in low levels or not at all on the malignant B cell.
The invention is also useful for treating cancers which are resistant to monoclonal antibody therapy. It has been discovered according to the invention, that immunostimulatory nucleic acids can reverse the resistance of tumor cells and render tumor cells which were previously non-responsive or only weakly responsive, sensitive to therapy. In particular it has been discovered that immunostimulatory nucleic acids can cause a phenotypic change to a resistant tumor cell that renders it sensitive to monoclonal antibody therapy. For instance, the monoclonal anti-CD20 antibody Rituximab has been shown to be effective clinically in several trials and has recently been approved for the therapy of follicular B
cell lymphoma.
Maloney DG, Semin Oncol 26:74-8 (1999); Form JM et al., J Clin Oncol 18:317-24 (2000);
Witzig TE et al., J Clin Oncol 17:3793-803 (1999); Davis TA etal., JClin Oncol 17:1851-7 (1999); Wiseman GA et al., Gin Cancer Res 5:3281s-3286s (1999); Grillo-Lopez AJ et al, Semin Oncol 26:66-73 (1999). There are reports that with lymphomas a small minority of tumors that re-emerge following Rituximab therapy can lack CD20 expression.
Davis TA et al., Clin Cancer Res 5:611-5 (1999); Kinoshita T et al., J Clin Oncol 16:3916 (1998). The immunostimulatory nucleic acids of the invention are useful for treating this set of resistant tumors. Additionally, Rituximab has not been useful for the treatment of all types of B cell malignancies. Expression of CD20 is relatively low on B-CLL cells, which provides an
Thus, the invention relates to methods for identifying an appropriate therapy for a lymphoma patient, and for treating the patient using that therapy. The method can be accomplished by isolating a B cell from a lymphoma patient and comparing the surface antigens expressed on the malignant B cell with those expressed on normal B
cells. The antigens which are expressed in low levels or not at all on the malignant B
cell can be identified. The subject can then be treated using a combination of an immunostimulating nucleic acid and an antibody which specifically recognizes the antigen(s) which are expressed in low levels or not at all on the malignant B cell.
The invention is also useful for treating cancers which are resistant to monoclonal antibody therapy. It has been discovered according to the invention, that immunostimulatory nucleic acids can reverse the resistance of tumor cells and render tumor cells which were previously non-responsive or only weakly responsive, sensitive to therapy. In particular it has been discovered that immunostimulatory nucleic acids can cause a phenotypic change to a resistant tumor cell that renders it sensitive to monoclonal antibody therapy. For instance, the monoclonal anti-CD20 antibody Rituximab has been shown to be effective clinically in several trials and has recently been approved for the therapy of follicular B
cell lymphoma.
Maloney DG, Semin Oncol 26:74-8 (1999); Form JM et al., J Clin Oncol 18:317-24 (2000);
Witzig TE et al., J Clin Oncol 17:3793-803 (1999); Davis TA etal., JClin Oncol 17:1851-7 (1999); Wiseman GA et al., Gin Cancer Res 5:3281s-3286s (1999); Grillo-Lopez AJ et al, Semin Oncol 26:66-73 (1999). There are reports that with lymphomas a small minority of tumors that re-emerge following Rituximab therapy can lack CD20 expression.
Davis TA et al., Clin Cancer Res 5:611-5 (1999); Kinoshita T et al., J Clin Oncol 16:3916 (1998). The immunostimulatory nucleic acids of the invention are useful for treating this set of resistant tumors. Additionally, Rituximab has not been useful for the treatment of all types of B cell malignancies. Expression of CD20 is relatively low on B-CLL cells, which provides an
- 13 explanation for why Rituximab is less effective for CLL than for some other B-cell malignancies. Grinaldi L et al., J Clin Pathol 51:364-9 (1998). The immunostimulatory nucleic acids of the invention are also useful for treating these tumors.
The humanized monoclonal antibody 1D10 recognizes an HLA-DR variant antigen.
Link BK et al., Blood 81:3343-9 (1993). This antibody is currently being tested in a phase I
clinical trial in patients with lymphoma. One limitation to the use of this antibody is that the target antigen is only expressed by approximately 50% of B-cell lymphomas.
Interestingly, its expression was upregulated by immunostimulatory nucleic acids in all lymphoma samples tested. It was discovered according to the invention that immunostimulatory nucleic acids may enhance the efficacy of therapy with these and other antibodies by increasing expression of target antigen. Thus in another aspect the invention includes methods for treating lymphoma by administering to a subject an immunostimulatory nucleic acid and antibodies specific for HLA-DR. One useful antibody is the humanized monoclonal antibody 1D10. It is particularly useful for treating resistant tumors.
The invention also relates to the discovery of a specific subclass, or isotype, of antibody which when combined with immunostimulatory nucleic acids produces a synergistic immune response. Another subclass, or isotype, does not even provide an additive response when combined with immunostimulatory nucleic acids. It was discovered according to the invention that the combination of immunostimulatory nucleic acids and human antibodies of the IgG1 isotype results in an increased (synergistic) survival rate. When immunostimulatory nucleic acids are combined with human antibodies of the IgG2 isotype, no increase in survival rate is observed over the use of the IgG2 antibody alone. The IgG2 isotype (which correlates with the murine IgG1 isotype) is believed to be recognized by the Fc receptor designated CD16 that is expressed largely by NK cells. Immunostimulatory nucleic acids are known to activate NK cells, and thus, it is surprising that immunostimulatory nucleic acids do not enhance the therapeutic effect of human IgG2 or murine IgG1 antibodies.
Since NK cells are believed to be involved in ADCC and are activated by immunostimulatory nucleic acids, it was surprising that antibodies of the human IgG2 (or murine IgG1) isotype do not produce a synergistic or even additive response when administered with immunostimulatory nucleic acids.
A cancer cell is a cell that divides and reproduces abnormally due to a loss of normal growth control. Cancer cells almost always arise from at least one genetic mutation. In some
The humanized monoclonal antibody 1D10 recognizes an HLA-DR variant antigen.
Link BK et al., Blood 81:3343-9 (1993). This antibody is currently being tested in a phase I
clinical trial in patients with lymphoma. One limitation to the use of this antibody is that the target antigen is only expressed by approximately 50% of B-cell lymphomas.
Interestingly, its expression was upregulated by immunostimulatory nucleic acids in all lymphoma samples tested. It was discovered according to the invention that immunostimulatory nucleic acids may enhance the efficacy of therapy with these and other antibodies by increasing expression of target antigen. Thus in another aspect the invention includes methods for treating lymphoma by administering to a subject an immunostimulatory nucleic acid and antibodies specific for HLA-DR. One useful antibody is the humanized monoclonal antibody 1D10. It is particularly useful for treating resistant tumors.
The invention also relates to the discovery of a specific subclass, or isotype, of antibody which when combined with immunostimulatory nucleic acids produces a synergistic immune response. Another subclass, or isotype, does not even provide an additive response when combined with immunostimulatory nucleic acids. It was discovered according to the invention that the combination of immunostimulatory nucleic acids and human antibodies of the IgG1 isotype results in an increased (synergistic) survival rate. When immunostimulatory nucleic acids are combined with human antibodies of the IgG2 isotype, no increase in survival rate is observed over the use of the IgG2 antibody alone. The IgG2 isotype (which correlates with the murine IgG1 isotype) is believed to be recognized by the Fc receptor designated CD16 that is expressed largely by NK cells. Immunostimulatory nucleic acids are known to activate NK cells, and thus, it is surprising that immunostimulatory nucleic acids do not enhance the therapeutic effect of human IgG2 or murine IgG1 antibodies.
Since NK cells are believed to be involved in ADCC and are activated by immunostimulatory nucleic acids, it was surprising that antibodies of the human IgG2 (or murine IgG1) isotype do not produce a synergistic or even additive response when administered with immunostimulatory nucleic acids.
A cancer cell is a cell that divides and reproduces abnormally due to a loss of normal growth control. Cancer cells almost always arise from at least one genetic mutation. In some
- 14 -instances, it is possible to distinguish cancer cells from their normal counterparts based on profiles of expressed genes and proteins, as well as to the level of their expression. Genes commonly affected in cancer cells include oncogenes, such as ras, neu/HER2/erbB, myb, myc and abl, as well as tumor suppressor genes such as p53, Rb, DCC, RET and WT.
Cancer-related mutations in some of these genes leads to a decrease in their expression or a complete deletion. In others, mutations cause an increase in expression or the expression of an activated variant of the normal counterpart.
The terni "tumor" is usually equated with neoplasm, which literally means "new growth" and is used interchangeably with "cancer." A "neoplastic disorder" is any disorder associated with cell proliferation, specifically with a neoplasm. A "neoplasm"
is an abnormal mass of tissue that persists and proliferates after withdrawal of the carcinogenic factor that initiated its appearance. There are two types of neoplasms, benign and malignant. Nearly all benign tumors are encapsulated and are noninvasive; in contrast, malignant tumors are almost never encapsulated but invade adjacent tissue by infiltrative destructive growth. This infiltrative growth can be followed by tumor cells implanting at sites discontinuous with the original tumor. The method of the invention can be used to treat neoplastic disorders in humans, including but not limited to: sarcoma, carcinoma, fibroma, glioma, leukemia, lymphoma, melanoma, myeloma, neuroblastoma, retinoblastoma, and rhabdomyosarcoma, as well as each of the other tumors described herein.
"Cancer" as used herein refers to an uncontrolled growth of cells which interferes with the normal functioning of the bodily organs and systems. Cancers which migrate from their original location and seed vital organs can eventually lead to the death of the subject through the functional deterioration of the affected organs. Hemopoietic cancers, such as leukemia, are able to out-compete the normal hemopoietic compartments in a subject, thereby leading to hemopoietic failure (in the form of anemia, thrombocytopenia and neutropenia), ultimately causing death.
A metastasis is a region of cancer cells, distinct from the primary tumor location, resulting from the dissemination of cancer cells from the primary tumor to other parts of the body. At the time of diagnosis of the primary tumor mass, the subject may be monitored for the presence of metastases. Metastases are most often detected through the sole or combined use of magnetic resonance imaging (MIRE) scans, computed tomography (CT) scans, blood
Cancer-related mutations in some of these genes leads to a decrease in their expression or a complete deletion. In others, mutations cause an increase in expression or the expression of an activated variant of the normal counterpart.
The terni "tumor" is usually equated with neoplasm, which literally means "new growth" and is used interchangeably with "cancer." A "neoplastic disorder" is any disorder associated with cell proliferation, specifically with a neoplasm. A "neoplasm"
is an abnormal mass of tissue that persists and proliferates after withdrawal of the carcinogenic factor that initiated its appearance. There are two types of neoplasms, benign and malignant. Nearly all benign tumors are encapsulated and are noninvasive; in contrast, malignant tumors are almost never encapsulated but invade adjacent tissue by infiltrative destructive growth. This infiltrative growth can be followed by tumor cells implanting at sites discontinuous with the original tumor. The method of the invention can be used to treat neoplastic disorders in humans, including but not limited to: sarcoma, carcinoma, fibroma, glioma, leukemia, lymphoma, melanoma, myeloma, neuroblastoma, retinoblastoma, and rhabdomyosarcoma, as well as each of the other tumors described herein.
"Cancer" as used herein refers to an uncontrolled growth of cells which interferes with the normal functioning of the bodily organs and systems. Cancers which migrate from their original location and seed vital organs can eventually lead to the death of the subject through the functional deterioration of the affected organs. Hemopoietic cancers, such as leukemia, are able to out-compete the normal hemopoietic compartments in a subject, thereby leading to hemopoietic failure (in the form of anemia, thrombocytopenia and neutropenia), ultimately causing death.
A metastasis is a region of cancer cells, distinct from the primary tumor location, resulting from the dissemination of cancer cells from the primary tumor to other parts of the body. At the time of diagnosis of the primary tumor mass, the subject may be monitored for the presence of metastases. Metastases are most often detected through the sole or combined use of magnetic resonance imaging (MIRE) scans, computed tomography (CT) scans, blood
- 15 -and platelet counts, liver function studies, chest X-rays and bone scans in addition to the monitoring of specific symptoms.
Cancers include, but are not limited to, basal cell carcinoma, biliary tract cancer;
bladder cancer; bone cancer; brain and CNS cancer; breast cancer; cervical cancer;
choriocarcinoma; colon and rectum cancer; connective tissue cancer; cancer of the digestive system; endometrial cancer; esophageal cancer; eye cancer; cancer of the head and neck;
gastric cancer; intra-epithelial neoplasm; kidney cancer; larynx cancer;
leukemia; liver cancer; lung cancer (e.g., small cell and non-small cell); lymphoma including Hodgkin's and non-Hodgkin's lymphoma; melanoma; myeloma; neuroblastoma; oral cavity cancer (e.g., lip, tongue, mouth, and pharynx); ovarian cancer; pancreatic cancer; prostate cancer;
retinoblastoma; rhabdomyosarcoma; rectal cancer; renal cancer; cancer of the respiratory system; sarcoma; skin cancer; stomach cancer; testicular cancer; thyroid cancer; uterine cancer; cancer of the urinary system, as well as other carcinomas and sarcomas.
The immunostimulatory nucleic acids and antibodies are useful for treating or preventing cancer in a subject. A "subject" unless otherwise specified shall mean a human or vertebrate mammal including but not limited to a dog, cat, horse, cow, pig, sheep, goat, or primate, e.g., monkey. Thus the invention can be used to treat cancer and tumors in human and non human subjects. Cancer is one of the leading causes of death in companion animals (i.e., cats and dogs). Cancer usually strikes older animals which, in the case of house pets, have become integrated into the family. Forty-five percent of dogs older than 10 years of age are likely to succumb to the disease. The most common treatment options include surgery, chemotherapy and radiation therapy. Other treatment modalities which have been used with some success are laser therapy, cryotherapy, hyperthermia and immunotherapy.
The choice of treatment depends on the type of cancer and degree of dissemination. Unless the malignant growth is confined to a discrete area in the body, it is difficult to remove only malignant tissue without also affecting normal cells.
Malignant disorders commonly diagnosed in dogs and cats include but are not limited to lymphosarcoma, osteosarcoma, mammary tumors, mastocytoma, brain tumor, melanoma, adenosquamous carcinoma, carcinoid lung tumor, bronchial gland tumor, bronchiolar adenocarcinoma, fibroma, myxochondroma, pulmonary sarcoma, neurosarcoma, osteoma, papilloma, retinoblastoma, Ewing's sarcoma, Wilms' tumor, Burkitt's lymphoma, microglioma, neuroblastoma, osteoclastoma, oral neoplasia, fibrosarcoma, osteosarcoma and
Cancers include, but are not limited to, basal cell carcinoma, biliary tract cancer;
bladder cancer; bone cancer; brain and CNS cancer; breast cancer; cervical cancer;
choriocarcinoma; colon and rectum cancer; connective tissue cancer; cancer of the digestive system; endometrial cancer; esophageal cancer; eye cancer; cancer of the head and neck;
gastric cancer; intra-epithelial neoplasm; kidney cancer; larynx cancer;
leukemia; liver cancer; lung cancer (e.g., small cell and non-small cell); lymphoma including Hodgkin's and non-Hodgkin's lymphoma; melanoma; myeloma; neuroblastoma; oral cavity cancer (e.g., lip, tongue, mouth, and pharynx); ovarian cancer; pancreatic cancer; prostate cancer;
retinoblastoma; rhabdomyosarcoma; rectal cancer; renal cancer; cancer of the respiratory system; sarcoma; skin cancer; stomach cancer; testicular cancer; thyroid cancer; uterine cancer; cancer of the urinary system, as well as other carcinomas and sarcomas.
The immunostimulatory nucleic acids and antibodies are useful for treating or preventing cancer in a subject. A "subject" unless otherwise specified shall mean a human or vertebrate mammal including but not limited to a dog, cat, horse, cow, pig, sheep, goat, or primate, e.g., monkey. Thus the invention can be used to treat cancer and tumors in human and non human subjects. Cancer is one of the leading causes of death in companion animals (i.e., cats and dogs). Cancer usually strikes older animals which, in the case of house pets, have become integrated into the family. Forty-five percent of dogs older than 10 years of age are likely to succumb to the disease. The most common treatment options include surgery, chemotherapy and radiation therapy. Other treatment modalities which have been used with some success are laser therapy, cryotherapy, hyperthermia and immunotherapy.
The choice of treatment depends on the type of cancer and degree of dissemination. Unless the malignant growth is confined to a discrete area in the body, it is difficult to remove only malignant tissue without also affecting normal cells.
Malignant disorders commonly diagnosed in dogs and cats include but are not limited to lymphosarcoma, osteosarcoma, mammary tumors, mastocytoma, brain tumor, melanoma, adenosquamous carcinoma, carcinoid lung tumor, bronchial gland tumor, bronchiolar adenocarcinoma, fibroma, myxochondroma, pulmonary sarcoma, neurosarcoma, osteoma, papilloma, retinoblastoma, Ewing's sarcoma, Wilms' tumor, Burkitt's lymphoma, microglioma, neuroblastoma, osteoclastoma, oral neoplasia, fibrosarcoma, osteosarcoma and
- 16 -rhabdomyosarcoma. Other neoplasias in dogs include genital squamous cell carcinoma, transmissable venereal tumor, testicular tumor, seminoma, Sertoli cell tumor, hemangiopericytoma, histiocytoma, chloroma (granulocytic sarcoma), corneal papilloma, corneal squamous cell carcinoma, hemangiosarcoma, pleural mesothelioma, basal cell tumor, thymoma, stomach tumor, adrenal gland carcinoma, oral papillomatosis, hemangioendothelioma and cystadenoma. Additional malignancies diagnosed in cats include follicular lymphoma, intestinal lymphosarcoma, fibrosarcoma and pulmonary squamous cell carcinoma. The ferret, an ever-more popular house pet, is known to develop insulinoma, lymphoma, sarcoma, neuroma, pancreatic islet cell tumor, gastric MALT lymphoma and gastric adenocarcinoma.
Neoplasias affecting agricultural livestock include leukemia, hemangiopericytoma and bovine ocular neoplasia (in cattle); preputial fibrosarcoma, ulcerative squamous cell carcinoma, preputial carcinoma, connective tissue neoplasia and mastocytoma (in horses);
hepatocellular carcinoma (in swine); lymphoma and pulmonary adenomatosis (in sheep);
pulmonary sarcoma, lymphoma, Rous sarcoma, reticuloendotheliosis, fibrosarcoma, nephroblastoma, B-cell lymphoma and lymphoid leukosis (in avian species);
retinoblastoma, hepatic neoplasia, lymphosarcoma (lymphoblastic lymphoma), plasmacytoid leukemia and swimbladder sarcoma (in fish), caseous lymphadenitis (CLA): chronic, infectious, contagious disease of sheep and goats caused by the bacterium Corynebacterium pseudotuberculosis, and contagious lung tumor of sheep caused by jaagsiekte.
In one aspect, a method for treating cancer is provided which involves administering the compositions of the invention to a subject having cancer. A "subject having cancer" is a subject that has been diagnosed with a cancer. In some embodiments, the subject has a cancer type characterized by a solid mass tumor. The solid tumor mass, if present, may be a primary tumor mass. A primary tumor mass refers to a growth of cancer cells in a tissue resulting from the transformation of a normal cell of that tissue. In most cases, the primary tumor mass is identified by the presence of a cyst, which can be found through visual inspection or palpation methods, or by irregularity in shape, texture or weight of the tissue.
However, some primary tumors are not palpable and can be detected only through medical imaging techniques such as X-rays (e.g., mammography), or by needle aspirations.
The use of these latter techniques is more common in early detection.
Molecular and
Neoplasias affecting agricultural livestock include leukemia, hemangiopericytoma and bovine ocular neoplasia (in cattle); preputial fibrosarcoma, ulcerative squamous cell carcinoma, preputial carcinoma, connective tissue neoplasia and mastocytoma (in horses);
hepatocellular carcinoma (in swine); lymphoma and pulmonary adenomatosis (in sheep);
pulmonary sarcoma, lymphoma, Rous sarcoma, reticuloendotheliosis, fibrosarcoma, nephroblastoma, B-cell lymphoma and lymphoid leukosis (in avian species);
retinoblastoma, hepatic neoplasia, lymphosarcoma (lymphoblastic lymphoma), plasmacytoid leukemia and swimbladder sarcoma (in fish), caseous lymphadenitis (CLA): chronic, infectious, contagious disease of sheep and goats caused by the bacterium Corynebacterium pseudotuberculosis, and contagious lung tumor of sheep caused by jaagsiekte.
In one aspect, a method for treating cancer is provided which involves administering the compositions of the invention to a subject having cancer. A "subject having cancer" is a subject that has been diagnosed with a cancer. In some embodiments, the subject has a cancer type characterized by a solid mass tumor. The solid tumor mass, if present, may be a primary tumor mass. A primary tumor mass refers to a growth of cancer cells in a tissue resulting from the transformation of a normal cell of that tissue. In most cases, the primary tumor mass is identified by the presence of a cyst, which can be found through visual inspection or palpation methods, or by irregularity in shape, texture or weight of the tissue.
However, some primary tumors are not palpable and can be detected only through medical imaging techniques such as X-rays (e.g., mammography), or by needle aspirations.
The use of these latter techniques is more common in early detection.
Molecular and
- 17 -phenotypic analysis of cancer cells within a tissue will usually confirm if the cancer is endogenous to the tissue or if the lesion is due to metastasis from another site.
With respect to the prophylactic treatment methods, the invention is aimed at administering the compositions of the invention to a subject at risk of developing cancer. A
subject at risk of developing a cancer is one who has a high probability of developing cancer.
These subjects include, for instance, subjects having a genetic abnormality, the presence of which has been demonstrated to have a correlative relation to a higher likelihood of developing a cancer. Subjects exposed to cancer-causing agents such as tobacco, asbestos, or other chemical toxins are also subjects at risk of developing cancers used herein. When a subject at risk of developing a cancer is treated with an immunostimulatory nucleic acid, an antibody and optionally a cancer therapy, on a regular basis, such as monthly, the cancer growth will be prevented from initiating. This aspect of the invention is particularly advantageous when the subjects employed in certain trades which are exposed to cancer-causing agents on an ongoing basis. For example, many airborne, or inhaled, carcinogens such as tobacco smoke and asbestos have been associated with lung cancer.
A carcinogen is an agent capable of initiating development of malignant cancers.
Exposure to carcinogens generally increases the risk of neoplasms in subjects, usually by affecting DNA directly. Carcinogens may take one of several forms such as chemical, electromagnetic radiation, or may be an inert solid body.
Substances for which there is sufficient evidence to establish a causal relationship in cancer in humans are referred to as confirmed human carcinogens. Included in this category are the following substances: Aflatoxins, Alcoholic beverages, Aluminium production, 4-aminobiphenyl, Arsenic and arsenic compounds, Asbestos, Manufacture of auramine, Azathioprine, Benzene, Benzidine, Beryllium and beryllium compounds, Betel quid with tobacco, Bis(chloromethyl)ether and chloromethyl methyl ether (technical grade), Boot and shoe manufacture and repair (occupational exposure), 1,4 Butanediol dimethanesulphonate (Myleran), Cadmium and cadmium compounds, Chlorambucil, Chlornaphazine, 1-(2-Chloroethyl)-3-(4-methylcyclohexyl)-1 nitrosourea, Chloromethyl methyl ether (technical), Chromium compounds (hexavalent), Coal gasification, Coal tar pitches, Coal tars, Coke production, Cyclophosphamide, Cyclosporin, Brionite, Ethylene oxide, Furniture and cabinet making, Underground haematite mining with exposure to radon, Iron and steel founding, Isopropyl alcohol manufacture (strong acid process), Manufacture of magenta, Melphalan, 8-
With respect to the prophylactic treatment methods, the invention is aimed at administering the compositions of the invention to a subject at risk of developing cancer. A
subject at risk of developing a cancer is one who has a high probability of developing cancer.
These subjects include, for instance, subjects having a genetic abnormality, the presence of which has been demonstrated to have a correlative relation to a higher likelihood of developing a cancer. Subjects exposed to cancer-causing agents such as tobacco, asbestos, or other chemical toxins are also subjects at risk of developing cancers used herein. When a subject at risk of developing a cancer is treated with an immunostimulatory nucleic acid, an antibody and optionally a cancer therapy, on a regular basis, such as monthly, the cancer growth will be prevented from initiating. This aspect of the invention is particularly advantageous when the subjects employed in certain trades which are exposed to cancer-causing agents on an ongoing basis. For example, many airborne, or inhaled, carcinogens such as tobacco smoke and asbestos have been associated with lung cancer.
A carcinogen is an agent capable of initiating development of malignant cancers.
Exposure to carcinogens generally increases the risk of neoplasms in subjects, usually by affecting DNA directly. Carcinogens may take one of several forms such as chemical, electromagnetic radiation, or may be an inert solid body.
Substances for which there is sufficient evidence to establish a causal relationship in cancer in humans are referred to as confirmed human carcinogens. Included in this category are the following substances: Aflatoxins, Alcoholic beverages, Aluminium production, 4-aminobiphenyl, Arsenic and arsenic compounds, Asbestos, Manufacture of auramine, Azathioprine, Benzene, Benzidine, Beryllium and beryllium compounds, Betel quid with tobacco, Bis(chloromethyl)ether and chloromethyl methyl ether (technical grade), Boot and shoe manufacture and repair (occupational exposure), 1,4 Butanediol dimethanesulphonate (Myleran), Cadmium and cadmium compounds, Chlorambucil, Chlornaphazine, 1-(2-Chloroethyl)-3-(4-methylcyclohexyl)-1 nitrosourea, Chloromethyl methyl ether (technical), Chromium compounds (hexavalent), Coal gasification, Coal tar pitches, Coal tars, Coke production, Cyclophosphamide, Cyclosporin, Brionite, Ethylene oxide, Furniture and cabinet making, Underground haematite mining with exposure to radon, Iron and steel founding, Isopropyl alcohol manufacture (strong acid process), Manufacture of magenta, Melphalan, 8-
- 18 -Methoxypsoralen (Methoxsalen) plus ultraviolet radiation, Mineral oils-untreated and mildly-treated oils, MOPP and other combined chemotherapy for cancer, Mustard gas (sulphur mustard), 2-Naphthylamine, Nickel and nickel compounds (essentially sulphate and sulphide), Nonsteroidal estrogens (not necessarily all in group) includes diethylstilbestrol, Estrogen replacement therapy, and Combined oral contraceptives and sequential oral contraceptives, Steroidal estrogens (not all in group), Painter (occupational exposure as a painter), Phenacetin (analgesic mixtures containing), Rubber industry, Salted fish (Chinese style), Solar radiation, Shale oils, Soots, Sulphuric acid (occupational exposures to strong-inorganic-acid mists of sulphuric acid), Talc containing asbestiform fibres, Thiotepa, Tobacco products (smokeless), Tobacco smoke, Treosulphan, and Vinyl chloride.
Substances for which there is a lesser degree of evidence in humans but sufficient evidence in animal studies, or degrees of evidence considered unequivocal of mutagenicity in mammalian cells, are referred to as probable human carcinogens. This category of substances includes: Acrylamide, Acrylonitrile, Adriamycin, Anabolic steroids, Azacitidine, Benzanthracene, Benzidine-based dyes (technical grade), Direct Black 38, Direct Blue 6, Direct Brown 95, Benzopyrene1,3-Butadiene, Captafol, Bischloroethyl nitrosourea (BCNU), 1-(2-Chloroethyl)-3-cyclohexyl-1-nitrosourea (CCNU), Chloramphenicolpara-Chloro-ortho-toluidine and its strong acid salts, Chlorozotocin, Cisplatin, Creosotes, Dibenzanthracene, Diesel engine exhaust, Diethyl sulphate, Dimethylcarbamoyl chloride, Dimethyl sulphate, Epichlorohydrin, Ethylene dibromide, N-ethyl-N-nitrosourea, Formaldehyde, Glass manufacturing industry (occupational exposure), Art glass (glass containers and pressed ware), Hairdresser or barber (occupational exposure, probably dyes), Insecticide use (occupational), IQ (2-Amino-3-methylimidazo[4,5-f]quinoline), Mate drinking (hot), 5-Methoxypsoralen, 4,4'-Methylenebis(2-chloroaniline) (MOCA), N-Methyl-N-nitro-N-nitrosoguanidine (MNNG), N-Methyl-N-nitrosourea, Nitrogen mustard, N-Nitrosodiethylamine, N-Nitrosodimethylamine, Petroleum refining (occupational refining exposures), Phenacetin, Polychlorinated biphenyls, Procarbazine hydrochloride, Silica (crystalline), Styrene-7,8-oxide, Tris(1-azaridinyl)phosphine sulphide (Thiotepa), Tris(2,3-dibromopropyl) phosphate, Ultraviolet radiation: A, B and C including sunlamps and sunbeds, and Vinyl bromide.
Substances for which there is sufficient evidence in animal tests are referred to as possible human carcinogens. This category of substances includes: A-C(2-Amino-
Substances for which there is a lesser degree of evidence in humans but sufficient evidence in animal studies, or degrees of evidence considered unequivocal of mutagenicity in mammalian cells, are referred to as probable human carcinogens. This category of substances includes: Acrylamide, Acrylonitrile, Adriamycin, Anabolic steroids, Azacitidine, Benzanthracene, Benzidine-based dyes (technical grade), Direct Black 38, Direct Blue 6, Direct Brown 95, Benzopyrene1,3-Butadiene, Captafol, Bischloroethyl nitrosourea (BCNU), 1-(2-Chloroethyl)-3-cyclohexyl-1-nitrosourea (CCNU), Chloramphenicolpara-Chloro-ortho-toluidine and its strong acid salts, Chlorozotocin, Cisplatin, Creosotes, Dibenzanthracene, Diesel engine exhaust, Diethyl sulphate, Dimethylcarbamoyl chloride, Dimethyl sulphate, Epichlorohydrin, Ethylene dibromide, N-ethyl-N-nitrosourea, Formaldehyde, Glass manufacturing industry (occupational exposure), Art glass (glass containers and pressed ware), Hairdresser or barber (occupational exposure, probably dyes), Insecticide use (occupational), IQ (2-Amino-3-methylimidazo[4,5-f]quinoline), Mate drinking (hot), 5-Methoxypsoralen, 4,4'-Methylenebis(2-chloroaniline) (MOCA), N-Methyl-N-nitro-N-nitrosoguanidine (MNNG), N-Methyl-N-nitrosourea, Nitrogen mustard, N-Nitrosodiethylamine, N-Nitrosodimethylamine, Petroleum refining (occupational refining exposures), Phenacetin, Polychlorinated biphenyls, Procarbazine hydrochloride, Silica (crystalline), Styrene-7,8-oxide, Tris(1-azaridinyl)phosphine sulphide (Thiotepa), Tris(2,3-dibromopropyl) phosphate, Ultraviolet radiation: A, B and C including sunlamps and sunbeds, and Vinyl bromide.
Substances for which there is sufficient evidence in animal tests are referred to as possible human carcinogens. This category of substances includes: A-C(2-Amino-
- 19 -pyrido[2,3-b]indole), Acetaldehyde, Acetamide, AF-2[2-(2-Fury1)-3-(5-nitro-2-furypacrylamide, para-Aminoazobenzene, ortho-Aminoazobenzene, 2-Amino-5-(5-nitro-2-fury1)-1,3,4-thiadiazole, Amitrole, ortho-Anisidine, Antimony trioxide, Aramite, Atrazine, Attapulgite, Azaserine, Benzo[b]fluoranthene, Benzo[j]fluoranthene, Benzo[k]fluoranthene, Benzyl violet, Bitumens (extracts of steam-refined and air-refined bitumens), Bleomycins, Bracken ferns, Bromodichloromethane, Butylated hydroxyanisole (BHA), d-Butyrolactone, Caffeic acid, Carbon black extract, Carbon tetrachloride, Carrageenan (degraded), Ceramic fibres, Chloramphenicol, Chlordane, Chlordecone, Chlorendic acid, Chlorinated paraffins of average carbon-chain length C12 and average degree of chlorination approx 60%, alpha-Chlorinated toluenes (not necessarily all in group), Benzotrichloride, para-Chloroaniline, Chloroform, Chlorophenols, Pentachlorophenol, 2,4,6-Trichlorophenol, Chlorophenoxy herbicides (not necessarily all in group), 4-Chloro-ortho-phenylenediamine, CI
Acid Red 114, CI Basic Red 9, CI Direct Blue 15, Citrus Red No.2, Cobalt and cobalt compounds, Coffee (bladder), para-Cresidine, Cycasin, Dacarbazine, Dantron (1,8-dihydroxyanthraquinone), Daunomycin, DDT, N,N-Diacetylbenzidine, 4,4'-Diaminodiphenyl ether, 2,4-Diaminotoluene, Dibenz[a,h]acridine, Dibenz[a,j]acridine, 7H-Dibenzo[c,g]carbazole, Dibenzo[a,e]pyrene, Dibenzo[a,h]pyrene, Dibenzo[a,i]pyrene, Dibenzo[a,l]pyrene, 1,2-Dibromo-3-chloropropane, para-Dichlorobenzene, 3,3'-Dichlorobenzene, 3,3'-Dichloro-4,4'-diaminodiphenyl ether, 1,2-Dichloroethane, Dichloromethane, 1,3-Dichloropropene (technical grade), Dichlorvos, Diepoxybutane, Diesel fuel (marine), Di(2-ethylhexyl)phthalate, 1,2-Diethylhydrazine, Diglycidyl resorcinol ether, Dihydrosafrole, Diisopropyl sulfate, 3,3'-Dimethoxybenzidine, para-Dimethylaminoazobenzene, trans-2-[(Dimethylamino)methylimino]-512-(5-nitro-2-furyl[viny1]-1,3,4-oxidiazole, 2,6-Dirnethylaniline (2,6-Xylidene), 3,3'-Dimethylbenzidine (ortho-tolidine), Dimethylforrnamide, 1,1-Dimethylhydrazine, 1,2-Dimethylhydrazine, 1,6-Dinitropyrene, 1,8-Dinitropyrene, 1,4-Dioxane, Disperse Blue, lEthyl acrylate, Ethylene thiourea, Ethyl methanesulphonate, 2-(2-Formylhydrazino)-4-(5-nitro-2-furyl)thiazole, Fuel oils (residual, heavy), Fusarium moniliforme (toxins derived from), Fumonisin Bl;
Fumonisin B2; Fusarin C, Gasoline, Gasoline engine exhausts, Glasswool, Glu-P-1 (2-Amino-6-methyldipyrido[1,2-a:3'2'-d]imidazole), Glu-P-2(-Aminodipyrido[1,2-a:3'2'-d]imidazole), Glycidaldehyde, Griseofulvin, HC Blue No 1, Heptachlor, Hexachlorobenzene, Hexachlorocyclohexanes Technical grades alpha isomer gamma isomer (lindane),
Acid Red 114, CI Basic Red 9, CI Direct Blue 15, Citrus Red No.2, Cobalt and cobalt compounds, Coffee (bladder), para-Cresidine, Cycasin, Dacarbazine, Dantron (1,8-dihydroxyanthraquinone), Daunomycin, DDT, N,N-Diacetylbenzidine, 4,4'-Diaminodiphenyl ether, 2,4-Diaminotoluene, Dibenz[a,h]acridine, Dibenz[a,j]acridine, 7H-Dibenzo[c,g]carbazole, Dibenzo[a,e]pyrene, Dibenzo[a,h]pyrene, Dibenzo[a,i]pyrene, Dibenzo[a,l]pyrene, 1,2-Dibromo-3-chloropropane, para-Dichlorobenzene, 3,3'-Dichlorobenzene, 3,3'-Dichloro-4,4'-diaminodiphenyl ether, 1,2-Dichloroethane, Dichloromethane, 1,3-Dichloropropene (technical grade), Dichlorvos, Diepoxybutane, Diesel fuel (marine), Di(2-ethylhexyl)phthalate, 1,2-Diethylhydrazine, Diglycidyl resorcinol ether, Dihydrosafrole, Diisopropyl sulfate, 3,3'-Dimethoxybenzidine, para-Dimethylaminoazobenzene, trans-2-[(Dimethylamino)methylimino]-512-(5-nitro-2-furyl[viny1]-1,3,4-oxidiazole, 2,6-Dirnethylaniline (2,6-Xylidene), 3,3'-Dimethylbenzidine (ortho-tolidine), Dimethylforrnamide, 1,1-Dimethylhydrazine, 1,2-Dimethylhydrazine, 1,6-Dinitropyrene, 1,8-Dinitropyrene, 1,4-Dioxane, Disperse Blue, lEthyl acrylate, Ethylene thiourea, Ethyl methanesulphonate, 2-(2-Formylhydrazino)-4-(5-nitro-2-furyl)thiazole, Fuel oils (residual, heavy), Fusarium moniliforme (toxins derived from), Fumonisin Bl;
Fumonisin B2; Fusarin C, Gasoline, Gasoline engine exhausts, Glasswool, Glu-P-1 (2-Amino-6-methyldipyrido[1,2-a:3'2'-d]imidazole), Glu-P-2(-Aminodipyrido[1,2-a:3'2'-d]imidazole), Glycidaldehyde, Griseofulvin, HC Blue No 1, Heptachlor, Hexachlorobenzene, Hexachlorocyclohexanes Technical grades alpha isomer gamma isomer (lindane),
- 20 -Hexamethylphosphoramide, Hydrazine, Indeno[1,2,3-cd]pyrene, Iron-dextran complex, Isoprene, Lasiocarpine, Lead and lead compounds (inorganic), Magenta (containing CI Basic Red 9), Man-made mineral fibres (see glasswool, rockwool, slagvvool, and ceramic fibres), MeA-a-C (2-Amino-3-methyl-9H-pyrido[2,3-b]indoie), MeIQ (2-Amino-3,4-dimethylimidazo[4,5-1]-quinolone), MeIQx (2-Amino-3,8-dimethylamidazo[4,5-f]quinoxaline), Methylmercury compounds (methylmercuric chloride), Melphalan, Methylaziridine, Methylazoxymethanol and its acetate, 5-Methylchrysene, 4,4'-Methylenebis(2-methylaniline), 4,4'-Methylenedianiline, Methylmethanesulphonate, 2-methyl-l-nitroanthraquinone (uncertain purity), N-methyl-N-nitrosourethane, Methylthiouracil, Metronidazole, Mirex, Mitomycin, Monocrotaline 5-(Morpholinomethyl)-3-[(5-nitrofurfurylidene)amino]-2-oxazolidinone, Nafenopin, Niridazole, 5-Nitroacenaphthene, 6-Nitrochrysene, Nitrofen (technical grade), 2-Nitrofluorenel-[(5-Nitrofurfurylidene)amino]-2-imidazolidinone, N-14-(5-Nitro-2-fury1)-2-thiazolyl]acetamide, Nitrogen mustard, N-oxide, Nitrolotriacetic acid and its salts, 2-Nitropropanel-Nitropyrene, 4-Nitropyrene, N-Nitrosodi-n-butylamine, N-Nitrosodiethanolamine, N-Nitrosodi-n-propylamine, 3-(N-Nitrosomethylamino)propionitrile, 4-(N-Nitrosomethylamino)-1-(3-pyridy1)-1-butanone (NNK), N-Nitrosomethylethylamine, N-Nitrosomethylvinylamine, N-Nitrosomorpholine, N-Nitrosonomicotine, N-Nitrosopiperidene, N-Nitrosopyrrolidine, N-Nitrososarcosine, Ochratoxin A, Oil Orange, Panfaran S (containing dihydroxymethylfuratzine), Phenazopyridine hydrochloride, Phenobarbital, Phenoxybenzamine hydrochloride, Phenyl glycidyl ether, PhenytoinPhIP (2-Amino-l-methy1-6-phenylimidazo[4,5-b]pyridine, Pickled vegetables, traditional Asian, Polybrominated biphenyls, Ponceau MXPonceau 3R, Potassium bromate, 1,3-Propane sultone, Propylene oxide, Progestins, Medroxyprogesterone acetate, 6.-Propiolactone, Propylthiouracil, Rockwool, Saccharin, Safi-ole, Slagwool, Sodium ortho-phenylphenate, Sterigmatocystin, Streptozotocin, Styrene, Sulfallate, 2,3,7,8-Tetrachlorodibenzo-para-dioxin (TCDD), Tetrachloroethylene, Textile manufacturing (occupational exposures), Thiocetamide, 4,4'-Thiodianiline, Thiourea, Toluene, diisocyanatesortho-Toluidine, Toxaphene (polychlorinated camphenes), Trichlormethine (trimustine hydrochloride), Trp-P-1 (3-Amino-1,4-dimethy1-5-H-pyrido[4,3-b]indole), Trp-P-2 (3-Amino-l-methy1-5H-pyrido[4,3-b]indole), Trypan blue, Uracil mustard, Urethane, 4-Vinylcyclohexene, 4-Vinylcyclohexene diepoxide, Welding fumes, Wood industries and Carpentry and joinery.
-21 -Subjects at risk of developing cancer also include those who have a genetic predisposition to cancer. In many cases, genetic predisposition to cancer can be identified by studying the occurrence of cancer in family members. Examples of genetic predisposition to common forms of cancer include, but are not limited to, mutation of BRCA1 and BRCA2 in familial breast cancer, mutation of APC in familial colony cancer (familial polyposis coli), mutation of MSH2 and MLH1 in hereditary nonpolyposis colon cancer (HNPCC), mutation of p53 in Li-Fraumeni syndrome, mutation of Rbl in retinoblastoma, mutation of RET in multiple endocrine neoplasia type 2 (MEN2), mutation of VHL in renal cancer and mutation of WT1 in Wilms' tumor. Other cancers for which a familial predisposition has been identified include ovarian, prostate, melanoma and lung cancer.
It has been estimated that almost half of all currently diagnosed cancers will be treated with some form of cancer medicament. However, many forms of cancer, including melanoma, colorectal, prostate, endometrial, cervical and bladder cancer, do not respond well to treatment with cancer medicaments. In fact, only about 5-10 percent of cancers can be cured using cancer medicaments alone. These include some forms of leukemias and lymphomas, testicular cancer, choriocarcinoma, Wilms' tumor, Ewing's sarcoma, neuroblastoma, small-cell lung cancer and ovarian cancer. Treatment of still other cancers, including breast cancer, requires a combination therapy of surgery or radiotherapy in conjunction with a cancer medicament.
The immunostimulatory nucleic acids are administered in combination with antibodies which specifically bind to cancer cell surface antigens. These antibodies include but are not limited to anti-CD20 antibodies, anti-CD40 antibodies, anti-CD19 antibodies, anti-CD22 antibodies, anti-HLA-DR antibodies, anti-CD80 antibodies, anti-CD86 antibodies, anti-CD54 antibodies, and anti-CD69 antibodies. These antibodies are available from commercial sources or may be synthesized de novo.
Commercially available anti-CD20 antibodies include but are not limited to those presented in Table 1 below.
Table 1. Commercially Available Anti-CD20 Antibodies.
Product/Supplier Catalog #
Monoclonal Antibody to CD20, Human, ANC-169-020 Purified, 1001.tg Alexis Corp.
It has been estimated that almost half of all currently diagnosed cancers will be treated with some form of cancer medicament. However, many forms of cancer, including melanoma, colorectal, prostate, endometrial, cervical and bladder cancer, do not respond well to treatment with cancer medicaments. In fact, only about 5-10 percent of cancers can be cured using cancer medicaments alone. These include some forms of leukemias and lymphomas, testicular cancer, choriocarcinoma, Wilms' tumor, Ewing's sarcoma, neuroblastoma, small-cell lung cancer and ovarian cancer. Treatment of still other cancers, including breast cancer, requires a combination therapy of surgery or radiotherapy in conjunction with a cancer medicament.
The immunostimulatory nucleic acids are administered in combination with antibodies which specifically bind to cancer cell surface antigens. These antibodies include but are not limited to anti-CD20 antibodies, anti-CD40 antibodies, anti-CD19 antibodies, anti-CD22 antibodies, anti-HLA-DR antibodies, anti-CD80 antibodies, anti-CD86 antibodies, anti-CD54 antibodies, and anti-CD69 antibodies. These antibodies are available from commercial sources or may be synthesized de novo.
Commercially available anti-CD20 antibodies include but are not limited to those presented in Table 1 below.
Table 1. Commercially Available Anti-CD20 Antibodies.
Product/Supplier Catalog #
Monoclonal Antibody to CD20, Human, ANC-169-020 Purified, 1001.tg Alexis Corp.
-22 -Product/Supplier Catalog #
CD20, B-Cell Bab Mouse: anti-Human V6021 Clone: L26 Isotype: IgG2a, Kappa; Concentrated Biomeda Corporation CD20, B-Cell Mab Mouse: anti-Human V1018 Clone: L26 Isotype: IgG2a, Kappa; Concentrated Biomeda Corporation CD20, B-Cell MAb Mouse: anti-Human K026 Clone: L26 Isotype: IgG2a, Kappa; Dehydrated Biomeda Corporation CD20, B-Cell Mab Mouse: anti-Human 058D
Clone: L26 Isotype: IgG2a, Kappa; Prediluted Biomeda Corporation Mouse anti-Human CD20 AHS2022 BioSource International Mouse anti-Human CD20 AHS2001 BioSource International Mouse anti-Human CD20 AHS2028 BioSource International Mouse anti-Human CD20 AHS2002 BioSource International Mouse anti-Human CD20 AHS2021 BioSource International Mouse Anti-CD20, B-Cell, Human IgG2a MOB004 Antibody, Kappa, Supernatant, Clone L26,1 mL
BIOTREND Chemikalien GmbH
AnTesti-CD20, Human, Mouse, 100 jig 217670 Calbiochem Mouse Monoclonal Anti-(Human CD20) MHCD2000 IgG3 Antibody, Clone 11147, 0.5 mL
Caltag Laboratories Mouse Monoclonal Anti-(Human CD20) MHCD2000-4 IgG3 Antibody, Clone B-ly 1, 1 mL
Caltag Laboratories Mouse Monoclonal Anti-(Human CD20), MON1111 Mature B-cell) IgG1 Antibody, Clone MEM-97, 1 mL
Caltag Laboratories CD20, B-cell, Mouse Anti-Human, Clone: N150230 L26, Isotype: IgG2a, kappa, Ready-to-Use, LSAB2, EnVision & EnVision Doublestain, Monoclonal Antibody, 12 mL
DAKO Corp.
CD20, B-cell, Mouse Anti-Human, Clone: N150289 L26, Isotype: IgG2a, kappa, Ready-to-Use, LSAB2, EnVision & EnVision Doublestain, Monoclonal Antibody, Packaged for DAKO
Autostainer, 33 mL\
DAKO Corp.
CD20, L26 B-cell Marker, Mouse Anti-Human, M075501 Human, Monoclonal Antibody, 1 mL
DAKO Corp.
CD20, L26 B-cell Marker, Mouse Anti-Human M077401 Monoclonal Antibody, 1 mL
DAKO Corp.
Mxll B cell, CD20 RTU, 12 mL L185030 DAKO Corp.
CD20, B-Cell Bab Mouse: anti-Human V6021 Clone: L26 Isotype: IgG2a, Kappa; Concentrated Biomeda Corporation CD20, B-Cell Mab Mouse: anti-Human V1018 Clone: L26 Isotype: IgG2a, Kappa; Concentrated Biomeda Corporation CD20, B-Cell MAb Mouse: anti-Human K026 Clone: L26 Isotype: IgG2a, Kappa; Dehydrated Biomeda Corporation CD20, B-Cell Mab Mouse: anti-Human 058D
Clone: L26 Isotype: IgG2a, Kappa; Prediluted Biomeda Corporation Mouse anti-Human CD20 AHS2022 BioSource International Mouse anti-Human CD20 AHS2001 BioSource International Mouse anti-Human CD20 AHS2028 BioSource International Mouse anti-Human CD20 AHS2002 BioSource International Mouse anti-Human CD20 AHS2021 BioSource International Mouse Anti-CD20, B-Cell, Human IgG2a MOB004 Antibody, Kappa, Supernatant, Clone L26,1 mL
BIOTREND Chemikalien GmbH
AnTesti-CD20, Human, Mouse, 100 jig 217670 Calbiochem Mouse Monoclonal Anti-(Human CD20) MHCD2000 IgG3 Antibody, Clone 11147, 0.5 mL
Caltag Laboratories Mouse Monoclonal Anti-(Human CD20) MHCD2000-4 IgG3 Antibody, Clone B-ly 1, 1 mL
Caltag Laboratories Mouse Monoclonal Anti-(Human CD20), MON1111 Mature B-cell) IgG1 Antibody, Clone MEM-97, 1 mL
Caltag Laboratories CD20, B-cell, Mouse Anti-Human, Clone: N150230 L26, Isotype: IgG2a, kappa, Ready-to-Use, LSAB2, EnVision & EnVision Doublestain, Monoclonal Antibody, 12 mL
DAKO Corp.
CD20, B-cell, Mouse Anti-Human, Clone: N150289 L26, Isotype: IgG2a, kappa, Ready-to-Use, LSAB2, EnVision & EnVision Doublestain, Monoclonal Antibody, Packaged for DAKO
Autostainer, 33 mL\
DAKO Corp.
CD20, L26 B-cell Marker, Mouse Anti-Human, M075501 Human, Monoclonal Antibody, 1 mL
DAKO Corp.
CD20, L26 B-cell Marker, Mouse Anti-Human M077401 Monoclonal Antibody, 1 mL
DAKO Corp.
Mxll B cell, CD20 RTU, 12 mL L185030 DAKO Corp.
- 23 -Product/Supplier Catalog #
Monoclonal Anti-B-Cell, CD20 IgG2a Mob 004 Antibody, Clone L26, concentrated, 1 mL
Diagnostic BioSystems Monoclonal Anti-CD20, B-Cell IgG1 Mob 241 Antibody, Clone 7D1, concentrated, 1 mL
Diagnostic BioSystems Monoclonal Anti-CD20, B-Cell IgG2a Mob 004-01 Antibody, Clone L26, Concentrated, 1 mL
Diagnostic BioSystems Rabbit Polyclonal Anti-CD20, B-cell RP 041 Antibody, Concentrated, 1 mL
Diagnostic Biosystems Coulter* Antibodies to Human CDs::CD20 COIM 1455 Fisher Scientific Co.
Coulter* Antibodies to Human CDs::CD20 C06603858 Fisher Scientific Co.
Coulter* Antibodies to Human CDs::CD20 COIM 1342 Fisher Scientific Co.
Coulter* Antibodies to Human CDs::CD20 COIM 1565 Fisher Scientific Co.
Coulter* Antibodies to Human CDs::CD20 COIM 1454 Fisher Scientific Co.
Coulter* Antibodies to Human CDs::CD20 C06604106 Fisher Scientific Co.
Coulter* Antibodies to Human CDs::CD20 C06603446 Fisher Scientific Co.
Coulter* Antibodies to Human CDs::CD20 COIM 1456 Fisher Scientific Co.
Coulter* Antibodies to Human CDs::CD20 COIM 1151 Fisher Scientific Co.
Coulter* Antibodies to Human CDs::CD20 C06602381 Fisher Scientific Co.
Coulter* Antibodies to Human CDs::CD20 COIM1925 Fisher Scientific Co.
Coulter* Antibodies to Human CDs::CD20 C06602140 Fisher Scientific Co.
CD20, Pan B-cell marker, Mouse Anti- M077401 Human, Monoclonal Antibody, 1 mL
DAKO Corp.
MxH B Cell, CD20 RTU, 12 mL L185030 DAKO Corp.
Monoclonal Anti-B-Cell, CD20 IgG2a Mob 004 Antibody, Clone L26, Concentrated, 1 mL
Diagnostic BioSystems Monoclonal Anti-CD20, B-Cell IgG1 Mob 241 Antibody, Clone 7D1, Concentrated,, 1 mL
Diagnostic BioSystems Monoclonal Anti-CD20, B-Cell IgG2a Mob 004-01 Antibody, Clone L26, Concentrated, 1 mL
Diagnostic BioSystems Rabbit Polyclonal Anti-CD20, B-cell RP 041 Antibody, Concentrated, 1 mL
Diagnostic BioSystems Coulter* Antibodies to Human CDs::CD20 COIM 1455 Fisher Scientific Co.
Monoclonal Anti-B-Cell, CD20 IgG2a Mob 004 Antibody, Clone L26, concentrated, 1 mL
Diagnostic BioSystems Monoclonal Anti-CD20, B-Cell IgG1 Mob 241 Antibody, Clone 7D1, concentrated, 1 mL
Diagnostic BioSystems Monoclonal Anti-CD20, B-Cell IgG2a Mob 004-01 Antibody, Clone L26, Concentrated, 1 mL
Diagnostic BioSystems Rabbit Polyclonal Anti-CD20, B-cell RP 041 Antibody, Concentrated, 1 mL
Diagnostic Biosystems Coulter* Antibodies to Human CDs::CD20 COIM 1455 Fisher Scientific Co.
Coulter* Antibodies to Human CDs::CD20 C06603858 Fisher Scientific Co.
Coulter* Antibodies to Human CDs::CD20 COIM 1342 Fisher Scientific Co.
Coulter* Antibodies to Human CDs::CD20 COIM 1565 Fisher Scientific Co.
Coulter* Antibodies to Human CDs::CD20 COIM 1454 Fisher Scientific Co.
Coulter* Antibodies to Human CDs::CD20 C06604106 Fisher Scientific Co.
Coulter* Antibodies to Human CDs::CD20 C06603446 Fisher Scientific Co.
Coulter* Antibodies to Human CDs::CD20 COIM 1456 Fisher Scientific Co.
Coulter* Antibodies to Human CDs::CD20 COIM 1151 Fisher Scientific Co.
Coulter* Antibodies to Human CDs::CD20 C06602381 Fisher Scientific Co.
Coulter* Antibodies to Human CDs::CD20 COIM1925 Fisher Scientific Co.
Coulter* Antibodies to Human CDs::CD20 C06602140 Fisher Scientific Co.
CD20, Pan B-cell marker, Mouse Anti- M077401 Human, Monoclonal Antibody, 1 mL
DAKO Corp.
MxH B Cell, CD20 RTU, 12 mL L185030 DAKO Corp.
Monoclonal Anti-B-Cell, CD20 IgG2a Mob 004 Antibody, Clone L26, Concentrated, 1 mL
Diagnostic BioSystems Monoclonal Anti-CD20, B-Cell IgG1 Mob 241 Antibody, Clone 7D1, Concentrated,, 1 mL
Diagnostic BioSystems Monoclonal Anti-CD20, B-Cell IgG2a Mob 004-01 Antibody, Clone L26, Concentrated, 1 mL
Diagnostic BioSystems Rabbit Polyclonal Anti-CD20, B-cell RP 041 Antibody, Concentrated, 1 mL
Diagnostic BioSystems Coulter* Antibodies to Human CDs::CD20 COIM 1455 Fisher Scientific Co.
- 24 -Product/Supplier Catalog #
Coulter* Antibodies to Human CDs::CD20 C06603858 Fisher Scientific Co.
Coulter* Antibodies to Human CDs::CD20 COIM 1342 Fisher Scientific Co.
Coulter* Antibodies to Human CDs::CD20 COIM 1565 Fisher Scientific Co.
Coulter* Antibodies to Human CDs::CD20 COIM 1454 Fisher Scientific Co. _ Coulter* Antibodies to Human CDs::CD20 C06604106 Fisher Scientific Co.
Coulter* Antibodies to Human CDs::CD20 C06603446 Fisher Scientific Co.
Coulter* Antibodies to Human CDs::CD20 COIM 1456 Fisher Scientific Co.
Coulter* Antibodies to Human CDs::CD20 COIM 1451 Fisher Scientific Co.
Coulter* Antibodies to Human CDs::CD20 C06602381 Fisher Scientific Co.
Coulter* Antibodies to Human CDs::CD20 COIM 1925 Fisher Scientific Co.
Coulter* Antibodies to Human CDs::CD20 C06602140 Fisher Scientific Co.
Coulter* Antibodies to Human CDs::CD20 C06602471 Fisher Scientific Co.
CD20 (B Cell) AM-1165-11 InnoGenex _ Coulter* Antibodies to Human CDs::CD20 C06602471 Fisher Scientific Co.
CD20 (B Cell) AM-1165-11 InnoGenex CD20 (B Cell), Unpurified AM-1165-11 (0.1 mg/0.1 mL), Clone: Bl, Isotype:
InnoGenex Mouse Monoclonal Anti-CD20 Ab-1 (B- MS-340-SO
Cell Marker) IgG2a/K Antibody, Clone:
L26, Workshop, 0.1 mL
Lab Vision Corp.
Mouse Monoclonal Anti-CD20 Ab-1 (B- MS-340-S1 Cell Marker) IgG2a/K Antibody, Clone:
L26, Workshop, 0.5 mL
Lab Vision Corp.
Mouse Monoclonal Anti-CD20 Ab-1 (B- MS-340-S
Cell Marker) IgG2a/K Antibody, Clone:
L26, Workshop, 1.0 mL
=
Lab Vision Corp.
Mouse Monoclonal Anti-CD20 Ab-1 (B- MS-340-R7 Cell Marker) IgG2a/K Antibody, Clone:
L26, Workshop, 7.0 mL
Lab Vision Corp.
Mouse Monoclonal Anti-CD20 Ab-1 (B- MS-431-P1 Cell Marker) IgG2a/K Antibody, Clone:
B9E9, Workshop V; 100 g Lab Vision Corp.
Coulter* Antibodies to Human CDs::CD20 C06603858 Fisher Scientific Co.
Coulter* Antibodies to Human CDs::CD20 COIM 1342 Fisher Scientific Co.
Coulter* Antibodies to Human CDs::CD20 COIM 1565 Fisher Scientific Co.
Coulter* Antibodies to Human CDs::CD20 COIM 1454 Fisher Scientific Co. _ Coulter* Antibodies to Human CDs::CD20 C06604106 Fisher Scientific Co.
Coulter* Antibodies to Human CDs::CD20 C06603446 Fisher Scientific Co.
Coulter* Antibodies to Human CDs::CD20 COIM 1456 Fisher Scientific Co.
Coulter* Antibodies to Human CDs::CD20 COIM 1451 Fisher Scientific Co.
Coulter* Antibodies to Human CDs::CD20 C06602381 Fisher Scientific Co.
Coulter* Antibodies to Human CDs::CD20 COIM 1925 Fisher Scientific Co.
Coulter* Antibodies to Human CDs::CD20 C06602140 Fisher Scientific Co.
Coulter* Antibodies to Human CDs::CD20 C06602471 Fisher Scientific Co.
CD20 (B Cell) AM-1165-11 InnoGenex _ Coulter* Antibodies to Human CDs::CD20 C06602471 Fisher Scientific Co.
CD20 (B Cell) AM-1165-11 InnoGenex CD20 (B Cell), Unpurified AM-1165-11 (0.1 mg/0.1 mL), Clone: Bl, Isotype:
InnoGenex Mouse Monoclonal Anti-CD20 Ab-1 (B- MS-340-SO
Cell Marker) IgG2a/K Antibody, Clone:
L26, Workshop, 0.1 mL
Lab Vision Corp.
Mouse Monoclonal Anti-CD20 Ab-1 (B- MS-340-S1 Cell Marker) IgG2a/K Antibody, Clone:
L26, Workshop, 0.5 mL
Lab Vision Corp.
Mouse Monoclonal Anti-CD20 Ab-1 (B- MS-340-S
Cell Marker) IgG2a/K Antibody, Clone:
L26, Workshop, 1.0 mL
=
Lab Vision Corp.
Mouse Monoclonal Anti-CD20 Ab-1 (B- MS-340-R7 Cell Marker) IgG2a/K Antibody, Clone:
L26, Workshop, 7.0 mL
Lab Vision Corp.
Mouse Monoclonal Anti-CD20 Ab-1 (B- MS-431-P1 Cell Marker) IgG2a/K Antibody, Clone:
B9E9, Workshop V; 100 g Lab Vision Corp.
- 25 -Product/Supplier Catalog #
Mouse Monoclonal Anti-CD20 Ab-1 (B- MS-431-P
Cell Marker) IgG2a/K Antibody, Clone:
B9E9, Workshop V; 200 gig Lab Vision Corp.
Mouse Monoclonal Anti-CD20 (Ab-1 (B- MS-431-P0 Cell Marker) IgG2ahc Antibody, Clone:
B9E9, Workshop V; 20 fig Lab Vision Corp.
Mouse Monoclonal Anti-CD20 Ab-1 (B- MS-758-P1 Cell Marker) IgGi/K Antibody, Clone:
93-1B3, Workshop V; Code: CD20.4, 100 fig Lab Vision Corp.
Mouse Monoclonal Anti-CD20 Ab-3 (B- MS-758-P
Cell Marker) IgWI( Antibody, Clone:
93-1B3, Workshop V; Code: CD20.4, 200 ug Lab Vision Corp.
Mouse Monoclonal Anti-CD20 Ab-3 (B- MS-758-P0 Cell Marker) IgGI/ Antibody, Clone:
93-1B3, Workshop V; Code: CD20.4 Lab Vision Corp.
Human CD20, B Cell, 6 mL MAB-0020 Maxim Biotech Inc.
Mouse Monoclonal Anti-B Cell, CD20 A9004C
IgG2a, lc Antibody, Concentrate, 1 mL
Scytek Mouse Monoclonal Anti-B Cell, CD20 A20003 IgG2a, K Antibody, Ready-to-Use, 1 mL
Scytek Mouse Monoclonal Anti-CD20, B Cell A9001C
IgG2a lc Antibody, Concentrate, 1 mL (Clone: L26) Scytek Mouse Monoclonal Anti-CD20, B Cell A00003 IgG2a, K Antibody, Ready-to-Use, 6 mL
Scytek Mouse Monoclonal Anti-(Human CD20 MCA 1807 IgG1 Antibody, Clone 7D1, 1 mL
Serotec, Inc.
Mouse Monoclonal Anti-(Human CD20 MCA 1822 IgG1 Antibody, Clone AT80, 0.2 mg Serotec, Inc.
Mouse Monoclonal Anti-(Human CD20 MCA 1710 IgG2b Antibody, Clone 2H7, 0.2 mg Serotec, Inc.
Antibody Panels, Hematopoietic 324-01 Markers, Lymphocyte Related Antigens, CD20, B Cell, Clone L26, Concentrated, 1 ml., Ab Source Mouse, Ab# 324 Signet Patholomr Systems, Inc.
Antibody Panels, Hematopoietic 324-13 Markers, Lymphocyte Related Antigens, CD20, B Cell, Clone L26, Level 1, 3 mL, Ab 324 Signet Pathology Systems, Inc.
Mouse Monoclonal Anti-CD20 Ab-1 (B- MS-431-P
Cell Marker) IgG2a/K Antibody, Clone:
B9E9, Workshop V; 200 gig Lab Vision Corp.
Mouse Monoclonal Anti-CD20 (Ab-1 (B- MS-431-P0 Cell Marker) IgG2ahc Antibody, Clone:
B9E9, Workshop V; 20 fig Lab Vision Corp.
Mouse Monoclonal Anti-CD20 Ab-1 (B- MS-758-P1 Cell Marker) IgGi/K Antibody, Clone:
93-1B3, Workshop V; Code: CD20.4, 100 fig Lab Vision Corp.
Mouse Monoclonal Anti-CD20 Ab-3 (B- MS-758-P
Cell Marker) IgWI( Antibody, Clone:
93-1B3, Workshop V; Code: CD20.4, 200 ug Lab Vision Corp.
Mouse Monoclonal Anti-CD20 Ab-3 (B- MS-758-P0 Cell Marker) IgGI/ Antibody, Clone:
93-1B3, Workshop V; Code: CD20.4 Lab Vision Corp.
Human CD20, B Cell, 6 mL MAB-0020 Maxim Biotech Inc.
Mouse Monoclonal Anti-B Cell, CD20 A9004C
IgG2a, lc Antibody, Concentrate, 1 mL
Scytek Mouse Monoclonal Anti-B Cell, CD20 A20003 IgG2a, K Antibody, Ready-to-Use, 1 mL
Scytek Mouse Monoclonal Anti-CD20, B Cell A9001C
IgG2a lc Antibody, Concentrate, 1 mL (Clone: L26) Scytek Mouse Monoclonal Anti-CD20, B Cell A00003 IgG2a, K Antibody, Ready-to-Use, 6 mL
Scytek Mouse Monoclonal Anti-(Human CD20 MCA 1807 IgG1 Antibody, Clone 7D1, 1 mL
Serotec, Inc.
Mouse Monoclonal Anti-(Human CD20 MCA 1822 IgG1 Antibody, Clone AT80, 0.2 mg Serotec, Inc.
Mouse Monoclonal Anti-(Human CD20 MCA 1710 IgG2b Antibody, Clone 2H7, 0.2 mg Serotec, Inc.
Antibody Panels, Hematopoietic 324-01 Markers, Lymphocyte Related Antigens, CD20, B Cell, Clone L26, Concentrated, 1 ml., Ab Source Mouse, Ab# 324 Signet Patholomr Systems, Inc.
Antibody Panels, Hematopoietic 324-13 Markers, Lymphocyte Related Antigens, CD20, B Cell, Clone L26, Level 1, 3 mL, Ab 324 Signet Pathology Systems, Inc.
- 26 -Product/Supplier Catalog #
Antibody Panels, Hematopoietic 324-16 Markers, Lymphocyte Related Antigens, CD20, B Cell, Clone L26, level 1, 6 InL, Ab Source Mouse, Ab# 324 Signet Pathology Systems, Inc.
Antibody Panels, Hematopoietic 324-26 Markers, Lymphocyte Related Antigens, CD20, B Cell, Clone L26, Level 2, 6 mL, Ab Source Mouse, Ab# 324 Signet Pathology Systems, Inc.
Monoclonal Mouse anti-CD20, B9E9, Epitope- 07-2003 Affinity Purified-Unconjugated, IgG2a-K, 200 lig Zyrned Laboratories, Inc.
Antibodies are well known to those of ordinary skill in the science of immunology.
As used herein, the term "antibody" means not only intact antibody molecules but also fragments of antibody molecules retaining specific binding ability. Such fragments are also well known in the art and are regularly employed both in vitro and in vivo. In particular, as used herein, the term "antibody" means not only intact immunoglobulin molecules but also the well-known active fragments F(a1702, and Fab. F(ab')2, and Fab fragments which lack the Fe fragment of intact antibody, clear more rapidly from the circulation, and may have less non-specific tissue binding of an intact antibody. Wahl RL et al., J Nud Med 24:316-25 (1983). Antibody fragments which are particularly useful according to the methods of the invention are those which are bispecific and constructed to enhance FcR
binding, e.g., include an Fe portion. These include, but are not limited to Medarex antibodies (MDX-210, 220, 22, 447, and 260). Other non-Fe containing fragments which interact with the antigens induced on the cell surface are also useful. These are particularly useful in combination with immunotoxins and/or radioactivity. The fragments can be delivered separately from the immunotoxins or radioactivity or conjugated thereto (e.g., radiolabled antibodies or antibody fragments).
Within the antigen-binding portion of an antibody, as is well-known in the art, there are complementarity-determining regions (CDRs), which directly interact with the epitope of the antigen, and framework regions (FRs), which maintain the tertiary structure of the paratope (see, in general, Clark, 1986; Roitt, 1991). In both the heavy chain Fd fragment and the light chain of IgG immunoglobulins, there are four framework regions (FR1 through FR4) separated respectively by three complementarity-determining regions (CDR1 through CDR3). The CDRs, and in particular the CDR3 regions, and more particularly the heavy chain CDR3, are largely responsible for antibody specificity.
Antibody Panels, Hematopoietic 324-16 Markers, Lymphocyte Related Antigens, CD20, B Cell, Clone L26, level 1, 6 InL, Ab Source Mouse, Ab# 324 Signet Pathology Systems, Inc.
Antibody Panels, Hematopoietic 324-26 Markers, Lymphocyte Related Antigens, CD20, B Cell, Clone L26, Level 2, 6 mL, Ab Source Mouse, Ab# 324 Signet Pathology Systems, Inc.
Monoclonal Mouse anti-CD20, B9E9, Epitope- 07-2003 Affinity Purified-Unconjugated, IgG2a-K, 200 lig Zyrned Laboratories, Inc.
Antibodies are well known to those of ordinary skill in the science of immunology.
As used herein, the term "antibody" means not only intact antibody molecules but also fragments of antibody molecules retaining specific binding ability. Such fragments are also well known in the art and are regularly employed both in vitro and in vivo. In particular, as used herein, the term "antibody" means not only intact immunoglobulin molecules but also the well-known active fragments F(a1702, and Fab. F(ab')2, and Fab fragments which lack the Fe fragment of intact antibody, clear more rapidly from the circulation, and may have less non-specific tissue binding of an intact antibody. Wahl RL et al., J Nud Med 24:316-25 (1983). Antibody fragments which are particularly useful according to the methods of the invention are those which are bispecific and constructed to enhance FcR
binding, e.g., include an Fe portion. These include, but are not limited to Medarex antibodies (MDX-210, 220, 22, 447, and 260). Other non-Fe containing fragments which interact with the antigens induced on the cell surface are also useful. These are particularly useful in combination with immunotoxins and/or radioactivity. The fragments can be delivered separately from the immunotoxins or radioactivity or conjugated thereto (e.g., radiolabled antibodies or antibody fragments).
Within the antigen-binding portion of an antibody, as is well-known in the art, there are complementarity-determining regions (CDRs), which directly interact with the epitope of the antigen, and framework regions (FRs), which maintain the tertiary structure of the paratope (see, in general, Clark, 1986; Roitt, 1991). In both the heavy chain Fd fragment and the light chain of IgG immunoglobulins, there are four framework regions (FR1 through FR4) separated respectively by three complementarity-determining regions (CDR1 through CDR3). The CDRs, and in particular the CDR3 regions, and more particularly the heavy chain CDR3, are largely responsible for antibody specificity.
- 27 It is now well-established in the art that the non-CDR regions of a mammalian antibody may be replaced with similar regions of conspecific or heterospecific antibodies while retaining the epitopic specificity of the original antibody. This is most clearly manifested in the development and use of "humanized" antibodies in which non-human CDRs are covalently joined to human FR and/or Fc/pFc' regions to produce a functional antibody. Thus, for example, PCT International Publication Number WO 92/04381 teaches the production and use of humanized murine RSV antibodies in which at least a portion of the murine FR regions have been replaced by FR regions of human origin. Such antibodies, including fragments of intact antibodies with antigen-binding ability, are often referred to as io "chimeric" antibodies. A "humanized monoclonal antibody" as used herein is a human monoclonal antibody or functionally active fragment thereof having human constant regions and a binding CDR3 region from a mammal of a species other than a human.
Humanized monoclonal antibodies may be made by any method known in the art. Humanized monoclonal antibodies, for example, may be constructed by replacing the non-CDR regions of a non-human mammalian antibody with similar regions of human antibodies while retaining the epitopic specificity of the original antibody. For example, non-human CDRs and optionally some of the framework regions may be covalently joined to human FR and/or Fc/pFc' regions to produce a functional antibody. There are entities in the United States which will synthesize humanized antibodies from specific murine antibody regions commercially, such as Protein Design Labs (Mountain View California).
European Patent Application 0239400 provides an exemplary teaching of the production and use of humanized monoclonal antibodies in which at least the CDR portion of a murine (or other non-human mammal) antibody is included in the humanized antibody. Briefly, the following methods are useful for constructing a humanized CDR monoclonal antibody including at least a portion of a mouse CDR. A first replicable expression vector including a suitable promoter operably linked to a DNA sequence encoding at least a variable domain of an Ig heavy or light chain and the variable domain comprising framework regions from a human antibody and a CDR region of a murine antibody is prepared. Optionally a second replicable expression vector is prepared which includes a suitable promoter operably linked to a DNA
sequence encoding at least the variable domain of a complementary human Ig light or heavy chain respectively. A cell line is then transformed with the vectors.
Preferably the cell line is =
Humanized monoclonal antibodies may be made by any method known in the art. Humanized monoclonal antibodies, for example, may be constructed by replacing the non-CDR regions of a non-human mammalian antibody with similar regions of human antibodies while retaining the epitopic specificity of the original antibody. For example, non-human CDRs and optionally some of the framework regions may be covalently joined to human FR and/or Fc/pFc' regions to produce a functional antibody. There are entities in the United States which will synthesize humanized antibodies from specific murine antibody regions commercially, such as Protein Design Labs (Mountain View California).
European Patent Application 0239400 provides an exemplary teaching of the production and use of humanized monoclonal antibodies in which at least the CDR portion of a murine (or other non-human mammal) antibody is included in the humanized antibody. Briefly, the following methods are useful for constructing a humanized CDR monoclonal antibody including at least a portion of a mouse CDR. A first replicable expression vector including a suitable promoter operably linked to a DNA sequence encoding at least a variable domain of an Ig heavy or light chain and the variable domain comprising framework regions from a human antibody and a CDR region of a murine antibody is prepared. Optionally a second replicable expression vector is prepared which includes a suitable promoter operably linked to a DNA
sequence encoding at least the variable domain of a complementary human Ig light or heavy chain respectively. A cell line is then transformed with the vectors.
Preferably the cell line is =
- 28 -an immortalized mammalian cell line of lymphoid origin, such as a myeloma, hybridoma, trioma, or quadroma cell line, or is a normal lymphoid cell which has been immortalized by transformation with a virus. The transformed cell line is then cultured under conditions known to those of skill in the art to produce the humanized antibody.
As set forth in European Patent Application 0239400 several techniques are well known in the art for creating the particular antibody domains to be inserted into the replicable vector. (Preferred vectors and recombinant techniques are discussed in greater detail below.) For example, the DNA sequence encoding the domain may be prepared by oligonucleotide synthesis. Alternatively a synthetic gene lacking the CDR regions in which four framework regions are fused together with suitable restriction sites at the junctions, such that double-stranded synthetic or restricted subcloned CDR cassettes with sticky ends could be ligated at the junctions of the framework regions. Another method involves the preparation of the DNA sequence encoding the variable CDR containing domain by oligonucleotide site-directed mutagenesis. Each of these methods is well known in the art.
Therefore, those skilled in the art may construct humanized antibodies containing a murine CDR
region without destroying the specificity of the antibody for its epitope.
Human monoclonal antibodies may be made by any of the methods known in the art, such as those disclosed in U.S. Patent No. 5,567,610, issued to Borrebaeck et al., U.S. Patent No. 5,565,354, issued to Ostberg, U.S. Patent No. 5,571,893, issued to Baker et al, Kozbor D
et al., J Immuitol 133:3001-5 (1984), Brodeur et al., Monoclonal Antibody Production Techniques and Applications, pp. 51-63 (Marcel Dekker, Inc, New York, 1987), and Boemer P et al., J Immunol 147:86-95 (1991). In addition to the conventional methods for preparing human monoclonal antibodies, such antibodies may also be prepared by immunizing transgenic animals that are capable of producing human antibodies (e.g., Jakobovits A et al., Proc Natl Acad Sci USA 90:2551-5 (1993); Jakobovits A et al., Nature 362:255-8 (1993);
Bruggermann et al., Year in Immunology 7:33 (1993); and U.S. Patent No.
5,569,825 issued to Lonberg).
Significantly, as is well-known in the art, only a small portion of an antibody molecule, the paratope, is involved in the binding of the antibody to its epitope (see, in general, Clark, W.R. (1986) The Experimental Foundations of Modern Immunology Wiley &
Sons, Inc., New York; Roitt, I. (1991) Essential Immunology, 7th Ed., Blackwell Scientific Publications, Oxford). The pFc' and Fc regions, for example, are effectors of the
As set forth in European Patent Application 0239400 several techniques are well known in the art for creating the particular antibody domains to be inserted into the replicable vector. (Preferred vectors and recombinant techniques are discussed in greater detail below.) For example, the DNA sequence encoding the domain may be prepared by oligonucleotide synthesis. Alternatively a synthetic gene lacking the CDR regions in which four framework regions are fused together with suitable restriction sites at the junctions, such that double-stranded synthetic or restricted subcloned CDR cassettes with sticky ends could be ligated at the junctions of the framework regions. Another method involves the preparation of the DNA sequence encoding the variable CDR containing domain by oligonucleotide site-directed mutagenesis. Each of these methods is well known in the art.
Therefore, those skilled in the art may construct humanized antibodies containing a murine CDR
region without destroying the specificity of the antibody for its epitope.
Human monoclonal antibodies may be made by any of the methods known in the art, such as those disclosed in U.S. Patent No. 5,567,610, issued to Borrebaeck et al., U.S. Patent No. 5,565,354, issued to Ostberg, U.S. Patent No. 5,571,893, issued to Baker et al, Kozbor D
et al., J Immuitol 133:3001-5 (1984), Brodeur et al., Monoclonal Antibody Production Techniques and Applications, pp. 51-63 (Marcel Dekker, Inc, New York, 1987), and Boemer P et al., J Immunol 147:86-95 (1991). In addition to the conventional methods for preparing human monoclonal antibodies, such antibodies may also be prepared by immunizing transgenic animals that are capable of producing human antibodies (e.g., Jakobovits A et al., Proc Natl Acad Sci USA 90:2551-5 (1993); Jakobovits A et al., Nature 362:255-8 (1993);
Bruggermann et al., Year in Immunology 7:33 (1993); and U.S. Patent No.
5,569,825 issued to Lonberg).
Significantly, as is well-known in the art, only a small portion of an antibody molecule, the paratope, is involved in the binding of the antibody to its epitope (see, in general, Clark, W.R. (1986) The Experimental Foundations of Modern Immunology Wiley &
Sons, Inc., New York; Roitt, I. (1991) Essential Immunology, 7th Ed., Blackwell Scientific Publications, Oxford). The pFc' and Fc regions, for example, are effectors of the
- 29 -complement cascade but are not involved in antigen binding. An antibody from which the pFc' region has been enzymatically cleaved, or which has been produced without the pFc' region, designated an F(ab1)2 fragment, retains both of the antigen binding sites of an intact antibody. Similarly, an antibody from which the Fc region has been enzymatically cleaved, or which has been produced without the Fc region, designated an Fab fragment, retains one of the antigen binding sites of an intact antibody molecule. Proceeding further, Fab fragments consist of a covalently bound antibody light chain and a portion of the antibody heavy chain denoted Fd. The Pd. fragments are the major determinant of antibody specificity (a single Fd fragment may be associated with up to ten different light chains without altering antibody specificity) and Pd fragments retain epitope-binding ability in isolation.
Other antibodies useful according to the invention are antibodies of the IgG1 isotype.
As mentioned above, anti-IgG1 isotype antibody as used herein refers to a human or humanized anti-IgG1 unless otherwise specified. IgG1 isotype antibodies are well known in the art and include at least the antibodies listed in Table 2 below.
Table 2: Cancer Irnmunotherapies In Development Or On The Market Marketer Brand (lin) Name (Generic Name) Indication IDEC/Genentech, Ritiocanni (rituximab, Mabthera) (IDEC- non-Hodgkin's lymphoma Inc./Hoffmann-LaRoche (first C2B8, chimeric rnurine/human anti-CD20 monoclonal antibody licensed for MAb) the treatment of cancer in the U.S.) Genentech/Hoffmann-La Roche Herceptin, anti-Her2 hMAb Breast/ovarian Cytogen Corp. Quadramet (CYT-424) radiotherapetnic Bone metastases agent Centocor/Glaxo/Ajinomoto Panorex (17-1A) (murine monoclonal Adjuvant therapy for antibody) colorectal (Dukes-C) Centocor/Ajinomoto Panorex (17-1A) (chimeric murine Pancreatic, lung, breast, monoclonal antibody) ovary IDEC IDEC-Y2B8 (murine, anti-CD20 MAb non-Hodgkin's lymphoma labeled with Yttrium-90) ImClone Systems BEC2 (anti-idiotypic MAb, mimics the GD3 Small cell lung epitope) (with BCG) ImClone Systems C225 (chimeric monoclonal antibody to Renal cell epidermal growth factor receptor (EGFr)) Techniclone International/Alpha Oncolym (Lym-1 monoclonal antibody non-Hodgkin's lymphoma Therapeutics linked to 131 iodine) Protein Design Labs SMART M195 Ab, humanized Acute myleoid leukemia
Other antibodies useful according to the invention are antibodies of the IgG1 isotype.
As mentioned above, anti-IgG1 isotype antibody as used herein refers to a human or humanized anti-IgG1 unless otherwise specified. IgG1 isotype antibodies are well known in the art and include at least the antibodies listed in Table 2 below.
Table 2: Cancer Irnmunotherapies In Development Or On The Market Marketer Brand (lin) Name (Generic Name) Indication IDEC/Genentech, Ritiocanni (rituximab, Mabthera) (IDEC- non-Hodgkin's lymphoma Inc./Hoffmann-LaRoche (first C2B8, chimeric rnurine/human anti-CD20 monoclonal antibody licensed for MAb) the treatment of cancer in the U.S.) Genentech/Hoffmann-La Roche Herceptin, anti-Her2 hMAb Breast/ovarian Cytogen Corp. Quadramet (CYT-424) radiotherapetnic Bone metastases agent Centocor/Glaxo/Ajinomoto Panorex (17-1A) (murine monoclonal Adjuvant therapy for antibody) colorectal (Dukes-C) Centocor/Ajinomoto Panorex (17-1A) (chimeric murine Pancreatic, lung, breast, monoclonal antibody) ovary IDEC IDEC-Y2B8 (murine, anti-CD20 MAb non-Hodgkin's lymphoma labeled with Yttrium-90) ImClone Systems BEC2 (anti-idiotypic MAb, mimics the GD3 Small cell lung epitope) (with BCG) ImClone Systems C225 (chimeric monoclonal antibody to Renal cell epidermal growth factor receptor (EGFr)) Techniclone International/Alpha Oncolym (Lym-1 monoclonal antibody non-Hodgkin's lymphoma Therapeutics linked to 131 iodine) Protein Design Labs SMART M195 Ab, humanized Acute myleoid leukemia
- 30 -, _______________________________ Marketer Brand (ft") Name (Generic Name) Indication Techniclone n II LYM-1 (Oncolynirm) non-Hodgkin's lymphoma Corporation/Cambridge Antibody Technology Aronex Pharmaceuticals, Inc. ATRAGEN Acute promyelocytic leukemia Imaone Systems ' C225 (chimeric anti-EGFr monoclonal Head & neck, non-small antibody) -I- cisplatin or radiation cell lung cancer Altarex, Canada Ovarex (B43.13, anti-idiotypic CA125, Ovarian , mouse MAb) Coulter Pharma (Clinical results 1 Bexxar (anti-CD20 Mab labeled with1311) non-Hodgkin's lymphoma have been positive, but the drug has been associated with significant bone marrow toxicity) Aronex Pharmaceuticals, Inc. ATRAGEN Kaposi's sarcoma IDEC Pharmaceuticals Rituxanni (MAb against CD20) pan-B Ab in B cell lymphoma Corp./Genentech combo, with chemotherapy LeulcoSite/Ilex Oncology LDP-03, huMAb to the leukocyte antigen Chronic lymphocytic CAMPATH leukemia (CLL) ____________________________________________________________________ _ Center of Molecular Immunology ior t6 (anti CD6, murine MAb) CTCL Cancer Medarex/Novartis MDX-210 (humanized anti-HER-2 bispecific Breast, ovarian antibody) Medarex/Novartis MDX-210 (humanized anti-HER-2 bispecific Prostate, non-small cell antibody) lung, pancreatic, breast Medarex MDX-11 (complement activating receptor Acute myelogenous (CAR) monoclonal antibody) leukemia (AML) Medarex/Novartis MDX-210 (humanized anti-HER-2 bispecific Renal and colon antibody) Medarex MDX-11 (complement activating receptor Ex vivo bone marrow (CAR) monoclonal antibody) purging in acute myelogenous leukemia (AML) Medarex MDX-22 (humanized bispecific antibody) Acute myleoid leukemia MAb-conjugates) (complement cascade activators) CYtoBen 0V103 (Yttrium-90 labelled antibody) Ovarian Cytogen 0V103 (Yttrium-90 labelled antibody) Prostate Aronex Pharmaceuticals, Inc. ATRAGEN non-Hodgkin's lymphoma Glaxo Wellcome plc 3622W94 MAb that binds to EGP40 (17-1A) non-small cell lung, pancarcinoma antigen on adenocarcinomas prostate (adjuvant) Genentech Anti-VEGF, RhuMAb (inhibits Lung, breast, prostate, angiogenesis) colorectal Protein Design Labs Zenapax (SMART Anti-Tac (IL-2 receptor) Leukemia, lymphoma Ab, humanized) Protein Design Labs SMART M195 Ab, humanized Acute promyelocytic leukemia
- 31 -________________________ Marketer Brand (tin) Name (Generic Name) I Indication ImClone Systems C225 (chimeric anti-EGFr monoclonal Breast antibody) 4- taxol ImClone Systems (licensed from C225 (chimeric anti-EGFr monoclonal prostate RPR) antibody) + doxorubicin ImClone Systems C225 (chiraeric anti-EGFr monoclonal prostate antibody) + adriamycin ImClone Systems BEC2 (anti-idiotypic MAb, mimics the GD3 Melanoma epitope) Medarex MDX-210 (humanized anti-HER-2 bispecific Cancer antibody) Medarex MDX-220 (bispecific for tumors that express Lung, colon, prostate, TAG-72) ovarian, endometrial, pancreatic and gastric Medarex/Novartis MDX-210 (humanized anti-HER-2 bispecific Prostate antibody) Medarex/Merck KgaA MDX-447 (humanized anti-EGF receptor EGF receptor cancers bispecific antibody) (head & neck, prostate, lung, bladder, cervical, ovarian) Medarex/Novartis MDX-210 (humanized anti-HER-2 bispecific Comb. Therapy with G-antibody) CSF for various cancers, esp. breast 1DEC MELIMMUNE-2 (murine monoclonal Melanoma antibody therapeutic vaccine) MEC MELIMMUNE-1 (muine monoclonal Melanoma antibody therapeutic vaccine) Immunomedics, Inc. CEACIDETM (I-131) Colorectal and other NeoRx PretargetTM radioactive antibodies non-Hodgkin's B
cell lymphoma Novopharm Biotech, Inc. NovoMAb-G2 (pancarcinoma specific Ab) Cancer - .
Techniclone Corporation/ TNT (chimeric MAb to histone antigens) Brain Cambridge Antibody Technology Techniclone TNT (chimeric MAb to histone antigens) Brain International/Cambridge Antibody Technology Novopharm Gliornab-H (Monoclonals - Humanized Abs) Brain, melanomas, neuroblastomas Genetics Institute/AHP GNI-250 Mab Colorectal Merck KgaA EMD-72000 (chinteric-EGF antagonist) Cancer Immunornedics LymphoCide (humanized LL2 antibody) non-Hodgkin's B-cell lymphoma Immunex/AHP CMA 676 (monoclonal antibody conjugate) Acute myelogenous leukemia Novopharm Biotech, Inc. Monopharm-C Colon, lung, pancreatic Novopharm Biotech, Inc. 4B5 anti-idio type Ab Melanoma, small-cell lung =
=
cell lymphoma Novopharm Biotech, Inc. NovoMAb-G2 (pancarcinoma specific Ab) Cancer - .
Techniclone Corporation/ TNT (chimeric MAb to histone antigens) Brain Cambridge Antibody Technology Techniclone TNT (chimeric MAb to histone antigens) Brain International/Cambridge Antibody Technology Novopharm Gliornab-H (Monoclonals - Humanized Abs) Brain, melanomas, neuroblastomas Genetics Institute/AHP GNI-250 Mab Colorectal Merck KgaA EMD-72000 (chinteric-EGF antagonist) Cancer Immunornedics LymphoCide (humanized LL2 antibody) non-Hodgkin's B-cell lymphoma Immunex/AHP CMA 676 (monoclonal antibody conjugate) Acute myelogenous leukemia Novopharm Biotech, Inc. Monopharm-C Colon, lung, pancreatic Novopharm Biotech, Inc. 4B5 anti-idio type Ab Melanoma, small-cell lung =
=
- 32 -Marketer Brand ") Name (Generic Name) Indication Center of Molecular Immunology ior egUr3 (anti EGF-R humanized Ab) Radioimmunotherapy Center of Molecular Immunology ior c5 (murine MAb colorectal) for Colorectal radioimmunotherapy Creative BioMolecules/ BABS (biosynthetic antibody binding site) Breast cancer Chiron Proteins ImClone Systems/Chugai FLK-2 (monoclonal antibody to fetal liver Tumor-associated ldnase-2 (FLK-2)) angiogenesis ImmunoGen, Inc. Humanized MAb/srnall-drug conjugate Small-cell lung Medarex, Inc. . MDX-260 bispecific, targets GD-2 Melanoma, glionia, neuroblastoma Procyon Biophanna, Inc. ANA Ab Cancer Protein Design Labs SMART IDI 0 Ab B-cell lymphoma Protein Design Labs/Novartis SMART ABL 364 Ab Breast, lung, colon Immunomedics, Inc. IznmuRAIT-CEA Colorectal In some embodiments the nucleic acid and antibody are administered in combination with a cancer therapy. As used herein, a "cancer therapy" refers to an agent which prevents growth of a cancer cell by decreasing or slowing the rate of growth, by inhibiting growth altogether, or by killing or inducing apoptosis of the cancer cell. Thus, as used herein, "treating cancer" includes preventing the development of a cancer, reducing the symptoms of cancer, and/or inhibiting the growth of an established cancer. In other aspects, the cancer therapy is administered to a subject at risk of developing a cancer for the purpose of reducing the risk of developing the cancer. Various types of medicaments for the treatment of cancer are described herein. For the purpose of this specification, cancer therapies are classified as chemotherapeutic agents, cancer vaccines, hormone therapy, biological response modifiers, surgical procedures, and radiotherapy aimed at treating cancer. Additionally, the methods of the invention are intended to embrace the use of more than one cancer therapy along with the immunostimulatory nucleic acids and antibody. As an example, where appropriate, the immunostimulatory nucleic acids may be administered with a both a chemotherapeutic agent and a radiotherapy. =
Cancer therapies function in a variety of ways. Some cancer therapies work by targeting physiological mechanisms that are specific to tumor cells. Examples include the targeting of specific genes and their gene products (i.e., proteins primarily) which are mutated in cancers. Such genes include but are not limited to oncogenes (e.g., Ras, Her2, bc1-2), tumor suppressor genes (e.g., EGF, p53, Rb), and cell cycle targets (e.g., CDK4, p21,
Cancer therapies function in a variety of ways. Some cancer therapies work by targeting physiological mechanisms that are specific to tumor cells. Examples include the targeting of specific genes and their gene products (i.e., proteins primarily) which are mutated in cancers. Such genes include but are not limited to oncogenes (e.g., Ras, Her2, bc1-2), tumor suppressor genes (e.g., EGF, p53, Rb), and cell cycle targets (e.g., CDK4, p21,
- 33 -telomerase). Cancer therapies can alternately target signal transduction pathways and molecular mechanisms which are altered in cancer cells.
Other cancer therapies target cells other than cancer cells. For example, some medicaments prime the immune system to attack tumor cells (i.e., cancer vaccines). Still other medicaments, called angiogenesis inhibitors, function by attacking the blood supply of solid tumors. Since the most malignant cancers are able to metastasize (i.e.,.
exit the primary tumor site and seed a distal tissue, thereby farming a secondary tumor), medicaments that impede this 'metastasis are also useful in the treatment of cancer. Angiogenic mediators include basic FGF, VEGF, angiopoietins, angiostatin, endostatin, TNF-a, TNP-470, -thrombospondin-1, platelet factor 4, CM, and certain members of the integrin family of proteins. One category of this type of medicament is a metalloproteinase inhibitor, which inhibits the enzymes used by the cancer cells to exit the primary tumor site and extravasate into another tissue.
As used herein, chemotherapeutic agents encompass both chemical and biological agents. These agents function to inhibit a cellular activity which the cancer cell is dependent upon for continued survival. Categories of chemotherapeutic agents include alkylatingjalkaloid agents, antimetabolites, hormones or hormone analogs, and miscellaneous antineoplastic drugs. Most if not all of these agents are directly toxic to cancer cells and do not require immune stimulation. Chemotherapeutic agents which are currently in development or in use in a clinical setting are shown in Table 3 below.
Table 3: Cancer Drugs In Development Or On The Market Marketer _ Brand") Name Generic Name Indication Abbott TN!' 470/AGM 1470 Fragyline Anti-Angiogenesis in Cancer Takeda TN? 470/AGM 1470 Fragyline Anti-Angiogenesis in Cancer Scotia Meglamine GLA Megiamine GLA Bladder Cancer Medeva Valstar Valrubicin Bladder Cancer -Refractory in situ carcinoma Medeva Valstar Valrubicin Bladder Cancer - Papillary Cancer Rhone Poulenc Gliadel Wafer Carmustaine + Polifepr Osan Brain Tumor Warner Lambert Undisclosed Cancer (b) Undisclosed Cancer (b) Cancer Bristol-Myers RAS Farnesyl Transferase RAS
Farnesyl Transferase Cancer Squibb Inhibitor Inhibitor Novartis MM! 270 MM! 270 Cancer Bayer BAY 12-9566 BAY 12-9566 Cancer Merck Farnesyl Transferase Inhibitor Farnesyl Transferase Cancer (Solid tumors -Inhibitor pancreas, colon, lung, breast) Pfizer PFE Cancer, angiagenesis .
Other cancer therapies target cells other than cancer cells. For example, some medicaments prime the immune system to attack tumor cells (i.e., cancer vaccines). Still other medicaments, called angiogenesis inhibitors, function by attacking the blood supply of solid tumors. Since the most malignant cancers are able to metastasize (i.e.,.
exit the primary tumor site and seed a distal tissue, thereby farming a secondary tumor), medicaments that impede this 'metastasis are also useful in the treatment of cancer. Angiogenic mediators include basic FGF, VEGF, angiopoietins, angiostatin, endostatin, TNF-a, TNP-470, -thrombospondin-1, platelet factor 4, CM, and certain members of the integrin family of proteins. One category of this type of medicament is a metalloproteinase inhibitor, which inhibits the enzymes used by the cancer cells to exit the primary tumor site and extravasate into another tissue.
As used herein, chemotherapeutic agents encompass both chemical and biological agents. These agents function to inhibit a cellular activity which the cancer cell is dependent upon for continued survival. Categories of chemotherapeutic agents include alkylatingjalkaloid agents, antimetabolites, hormones or hormone analogs, and miscellaneous antineoplastic drugs. Most if not all of these agents are directly toxic to cancer cells and do not require immune stimulation. Chemotherapeutic agents which are currently in development or in use in a clinical setting are shown in Table 3 below.
Table 3: Cancer Drugs In Development Or On The Market Marketer _ Brand") Name Generic Name Indication Abbott TN!' 470/AGM 1470 Fragyline Anti-Angiogenesis in Cancer Takeda TN? 470/AGM 1470 Fragyline Anti-Angiogenesis in Cancer Scotia Meglamine GLA Megiamine GLA Bladder Cancer Medeva Valstar Valrubicin Bladder Cancer -Refractory in situ carcinoma Medeva Valstar Valrubicin Bladder Cancer - Papillary Cancer Rhone Poulenc Gliadel Wafer Carmustaine + Polifepr Osan Brain Tumor Warner Lambert Undisclosed Cancer (b) Undisclosed Cancer (b) Cancer Bristol-Myers RAS Farnesyl Transferase RAS
Farnesyl Transferase Cancer Squibb Inhibitor Inhibitor Novartis MM! 270 MM! 270 Cancer Bayer BAY 12-9566 BAY 12-9566 Cancer Merck Farnesyl Transferase Inhibitor Farnesyl Transferase Cancer (Solid tumors -Inhibitor pancreas, colon, lung, breast) Pfizer PFE Cancer, angiagenesis .
- 34 -________________________ _ Marketer Brandrni Name Generic Name I
Indication Pfizer PFE _ Tyrosine Kinase Cancer, angiog_enesis Lilly MTA/LY 231514__ MTA/LY 231514 Cancer Solid Tumors Lilly LY 264618/Lometexol Lometexol Cancer Solid Tumors Scotia Glamolec LiGLA (lithium-gamma Cancer, pancreatic, breast, linolenate) colon Warner Lambert CI-994 C1-994 Cancer, Solid Tumors /
Leukemia Schering AG Angiogenesis inhibitor , A_ngiogenesis Inhibitor Cancer / Cardio Takeda TNP-470 u/k Malignant Tumor _ Smithldine Hycamtin Topotecan Metastatic Ovarian Cancer Beecham _ Novartis PKC 412 PKC 412 _i Multi-Drug Resistant Cancer Novartis Valspodar PSC 833 1 Myeloid Leukemia/Ovarian Cancer Immunex Novantrone Mitoxantrone Pain related to hormone refractory prostate cancer.
Warner Lambert Metaret Suramin Prostate _ Genentech Anti-VEGF Anti-VEGF Prostate / Breast / Colorectal J i NSCL Cancer British Biotech Batimastat Batimastat (BB94) i Pterygium Eisai E 7070 E 7070 Solid Tumors Biochem BCH-4556 BCH-4556 Solid Tumors Phamia Sank-yo CS-682 CS-682 Solid Tumors _ Agouron AG2037 A02037 Solid Tumors , IDEC Pharma 9-AC 9-AC ' Solid Tumors Agouron VEGF/b-FGF Inhibitors 'VEGF/b-FGF
Inhibitors Solid Tumors , Agouron AG3340 AG3340 Solid Tumors /
Macular Degeneration Vertex Ince' VX-710 Solid Tumors -IV
Vertex VX-853 VX-853 Solid Tumors - Oral Zeneca ZD 0101 (inj) ZD 0101 Solid Tumors Novartis ISI 641 ISI 641 Solid Tumors Novartis ODN 698 ODN 698 Solid Tumors , Tanube Seiyalcu TA 2516 Marirnistat Solid Tumors , British Biotech Marimastat Marimastat (BB 2516) Solid Tumors Celltech CDP 845 Aggrecanase Inhibitor Solid Tumors /
Breast Cancer Chiroscience D2163 D2163 Solid Tumors /
Metastases Warner Lambert PD 183805 PD 183805 Daiichi DX895 If DX8951f Anti-Cancer Daiichi Lemonal DP 2202 Lemonal DP 2202 Anti-Cancer Fujisawa _ FK 317 FK 317 Anticancer Antibiotic Chugai Picibanil OK-432 Antimalignant Tumor Nycomed AD 32/valrubicin Valrubicin Bladder Cancer-Refractory Amersharn In situ Carcinoma Nycomed Metastron Strontium Derivative Bone Cancer (adjunct Arnersham therapy, Pain) Scheringplough_. Temodal Temozolomide Brain Tumors Schering Plough Temodal Temozolonide Brain Tumors Liposome Evacet Doxorubicin, Liposomal Breast Cancer _ Nycomed Yevrtaxan Paclitaxel Breast Cancer Advanced, Arnersham _ Ovarian Cancer Advanced . 64371-539
Indication Pfizer PFE _ Tyrosine Kinase Cancer, angiog_enesis Lilly MTA/LY 231514__ MTA/LY 231514 Cancer Solid Tumors Lilly LY 264618/Lometexol Lometexol Cancer Solid Tumors Scotia Glamolec LiGLA (lithium-gamma Cancer, pancreatic, breast, linolenate) colon Warner Lambert CI-994 C1-994 Cancer, Solid Tumors /
Leukemia Schering AG Angiogenesis inhibitor , A_ngiogenesis Inhibitor Cancer / Cardio Takeda TNP-470 u/k Malignant Tumor _ Smithldine Hycamtin Topotecan Metastatic Ovarian Cancer Beecham _ Novartis PKC 412 PKC 412 _i Multi-Drug Resistant Cancer Novartis Valspodar PSC 833 1 Myeloid Leukemia/Ovarian Cancer Immunex Novantrone Mitoxantrone Pain related to hormone refractory prostate cancer.
Warner Lambert Metaret Suramin Prostate _ Genentech Anti-VEGF Anti-VEGF Prostate / Breast / Colorectal J i NSCL Cancer British Biotech Batimastat Batimastat (BB94) i Pterygium Eisai E 7070 E 7070 Solid Tumors Biochem BCH-4556 BCH-4556 Solid Tumors Phamia Sank-yo CS-682 CS-682 Solid Tumors _ Agouron AG2037 A02037 Solid Tumors , IDEC Pharma 9-AC 9-AC ' Solid Tumors Agouron VEGF/b-FGF Inhibitors 'VEGF/b-FGF
Inhibitors Solid Tumors , Agouron AG3340 AG3340 Solid Tumors /
Macular Degeneration Vertex Ince' VX-710 Solid Tumors -IV
Vertex VX-853 VX-853 Solid Tumors - Oral Zeneca ZD 0101 (inj) ZD 0101 Solid Tumors Novartis ISI 641 ISI 641 Solid Tumors Novartis ODN 698 ODN 698 Solid Tumors , Tanube Seiyalcu TA 2516 Marirnistat Solid Tumors , British Biotech Marimastat Marimastat (BB 2516) Solid Tumors Celltech CDP 845 Aggrecanase Inhibitor Solid Tumors /
Breast Cancer Chiroscience D2163 D2163 Solid Tumors /
Metastases Warner Lambert PD 183805 PD 183805 Daiichi DX895 If DX8951f Anti-Cancer Daiichi Lemonal DP 2202 Lemonal DP 2202 Anti-Cancer Fujisawa _ FK 317 FK 317 Anticancer Antibiotic Chugai Picibanil OK-432 Antimalignant Tumor Nycomed AD 32/valrubicin Valrubicin Bladder Cancer-Refractory Amersharn In situ Carcinoma Nycomed Metastron Strontium Derivative Bone Cancer (adjunct Arnersham therapy, Pain) Scheringplough_. Temodal Temozolomide Brain Tumors Schering Plough Temodal Temozolonide Brain Tumors Liposome Evacet Doxorubicin, Liposomal Breast Cancer _ Nycomed Yevrtaxan Paclitaxel Breast Cancer Advanced, Arnersham _ Ovarian Cancer Advanced . 64371-539
- 35 --Marketer _ Brand"r-Name Generic Name Indication , _ Bristol-Myers Taxol Paclitaxel Breast Cancer Advanced, Squibb Ovarian Cancer Advanced, NSCLC
Roche Xeloda Capecitabine Breast Cancer, Colorectal Cancer , Roche Furtulon Dozdfluridine Breast Cancer, Colorectal Cancer, Gastric Cancer Pharmacia & Adriamycin Doxorubicin Breast Cancer, Leukemia Upjohn Ivax Cyclopax Paclitaxel, Oral Breast/Ovarian Cancer Rhone Poulenc Oral Taxoid Oral Taxoid Broad Cancer , ARP Novantrone Mitoxantrone Cancer , Sequus SPI-077 Cisplatin, Stealth Cancer _ Hoechst FIMR 1275 Flavopiridol Cancer Pfizer _ CP-358, 774 EGFR Cancer _ Pfizer CP-609, 754 RAS Oncogene Inhibitor Cancer Bristol-Myers BMS-182751 Oral Platinum Cancer (Lung, Ovarian) , Squibb , Bristol-Myers UFT (Tegafur/Uracil) UFT
(Tegafur/Uracil) Cancer Oral Squibb Johnson & Ergamisol Levamisole Cancer Therapy Johnson Gla:co Wellcome Eniluraci1/776C85 5FU Enhancer Cancer, Refractory Solid &
Colorectal Cancer Johnson & 1 Ergamisol Levaznisole Colon Cancer Johnson , i Rhone Poulenc Campto Irinotecan Colorectal Cancer, Cervical -Cancer Pharmacia & Camptosar Irinotecan Colorectal Cancer, Cervical Upjohn Cancer _ -Zeneca Tomudex Ralitrexed Colorectal Cancer, Lung Cancer, Breast Cancer Johnson & Leustain Cladribine Hairy Cell Leukaemia Johnson Ivax i Paxene Paclitaxel Kaposi Sarcoma _ , Sequus Doxil Doxorubicin, Liposomal KS/Cancer _ Sequus ,_ Caelyx Doxorubicin, Liposomal KS/Cancer Schering AG Fludara Fludarabine Leukaemia Pharmacia & Phannorubicin Epirubicin Lung/Breast Cancer Upjohn .
Chiron DepoCyt DepoCyt Neoplastic Meningitis Zeneca ZD1839 ZD 1839 Non Small Cell Lung Cancer, Pancreatic Cancer BASF , LU 79553 Bis-Naphtalimide Oncology = BASF LU 103793 Dolastain Oncology .
Schering Plough Caetyx Doxorubicin-Liposome _ Ovarian/Breast Cancer _ Lilly Genazar Gemcitabine Pancreatic Cancer, Non Small Cell Lung Cancer, Breast, Bladder and Ovarian Zeneca ZD 0473/Anormed ZD 0473/Anormed Platinum based NSCL, ovarian etc.
Yarnanouchi YM 116 YM 116 Prostate Cancer , Nycomed Seeds/I-125 Rapid St Iodine Seeds Prostate Cancer Amersham .
_ Agouron , Cdk4/cdk2 inhibitors cd1c4/cdk2 inhibitors Solid Tumors '
Roche Xeloda Capecitabine Breast Cancer, Colorectal Cancer , Roche Furtulon Dozdfluridine Breast Cancer, Colorectal Cancer, Gastric Cancer Pharmacia & Adriamycin Doxorubicin Breast Cancer, Leukemia Upjohn Ivax Cyclopax Paclitaxel, Oral Breast/Ovarian Cancer Rhone Poulenc Oral Taxoid Oral Taxoid Broad Cancer , ARP Novantrone Mitoxantrone Cancer , Sequus SPI-077 Cisplatin, Stealth Cancer _ Hoechst FIMR 1275 Flavopiridol Cancer Pfizer _ CP-358, 774 EGFR Cancer _ Pfizer CP-609, 754 RAS Oncogene Inhibitor Cancer Bristol-Myers BMS-182751 Oral Platinum Cancer (Lung, Ovarian) , Squibb , Bristol-Myers UFT (Tegafur/Uracil) UFT
(Tegafur/Uracil) Cancer Oral Squibb Johnson & Ergamisol Levamisole Cancer Therapy Johnson Gla:co Wellcome Eniluraci1/776C85 5FU Enhancer Cancer, Refractory Solid &
Colorectal Cancer Johnson & 1 Ergamisol Levaznisole Colon Cancer Johnson , i Rhone Poulenc Campto Irinotecan Colorectal Cancer, Cervical -Cancer Pharmacia & Camptosar Irinotecan Colorectal Cancer, Cervical Upjohn Cancer _ -Zeneca Tomudex Ralitrexed Colorectal Cancer, Lung Cancer, Breast Cancer Johnson & Leustain Cladribine Hairy Cell Leukaemia Johnson Ivax i Paxene Paclitaxel Kaposi Sarcoma _ , Sequus Doxil Doxorubicin, Liposomal KS/Cancer _ Sequus ,_ Caelyx Doxorubicin, Liposomal KS/Cancer Schering AG Fludara Fludarabine Leukaemia Pharmacia & Phannorubicin Epirubicin Lung/Breast Cancer Upjohn .
Chiron DepoCyt DepoCyt Neoplastic Meningitis Zeneca ZD1839 ZD 1839 Non Small Cell Lung Cancer, Pancreatic Cancer BASF , LU 79553 Bis-Naphtalimide Oncology = BASF LU 103793 Dolastain Oncology .
Schering Plough Caetyx Doxorubicin-Liposome _ Ovarian/Breast Cancer _ Lilly Genazar Gemcitabine Pancreatic Cancer, Non Small Cell Lung Cancer, Breast, Bladder and Ovarian Zeneca ZD 0473/Anormed ZD 0473/Anormed Platinum based NSCL, ovarian etc.
Yarnanouchi YM 116 YM 116 Prostate Cancer , Nycomed Seeds/I-125 Rapid St Iodine Seeds Prostate Cancer Amersham .
_ Agouron , Cdk4/cdk2 inhibitors cd1c4/cdk2 inhibitors Solid Tumors '
- 36 -Marketer _ Brand(lin) Name Generic Name Indication Agouron PARP inhibitors PARP Inhibitors Solid Tumors Chiroscience D4809 Dexifosamide Solid Tumors Bristol-Myers OFT (Tegafur/Uracil) UFT
(Tegafur/Uracil) Solid Tumors Squibb Sankyo Krestin Krestin Solid Tumors Asta Medica Ifex/Mesnex Ifosamide Solid Tumors Bristol-Myers Ifex/Mesnex Ifosamide Solid Tumors Sat ibb Bristol-Myers Vumon Teniposide Solid Tumors Squibb Bristol-Myers Paraplatin Carboplatin Solid Tumors Squibb Bristol-Myers Plantinol Cisplatin, Stealth Solid Tumors Squibb Bristol-Myers Plantinol Cisplatin Solid Tumors Squibb Bristol-Myers Vepeside Etoposide Solid Tumors Melanoma Squibb Zeneca ZD 9331 ZD 9331 Solid Tumors, Advanced Colorectal Chugai Taxotere Docetaxel Solid Tumors, Breast Cancer Rhone Poulenc Taxotere Docetaxel Solid Tumors, Breast Cancer Glaxo Wellcome Prodrug of guanine arabinside prodrug of arabinside T Cell Leuk-emia/Lymphoind & B Cell Neoplasm Bristol-Myers Taxane Analog Taxane Analog Taxol follow up Squibb Another useful anti-cancer therapy is Interferon-a (e.g., INTRON A, Schering).
The compounds useful according to the invention are nucleic acids. The nucleic acids may be double-stranded or single-stranded. Generally, double-stranded molecules may be more stable in vivo, while single-stranded molecules may have increased activity. The terms "nucleic acid" and "oligonucleotide" refer to multiple nucleotides (i.e., molecules comprising a sugar (e.g., ribose or deoxyribose) linked to a phosphate group and to an exchangeable organic base, which is either a substituted pyrimidine (e.g., cytosine (C), thymine (T) or uracil (U)) or a substituted purine (e.g., adenine (A) or guanine (G)) or a modified base. As used herein, the terms refer to oligoribonucleotides as well as oligodeoxyribonucleotides.
The terms shall also include polynucleosides (i.e., a polynucleotide minus the phosphate) and any other organic base-containing polymer. The terms "nucleic acid" and "oligonucleotide"
also encompass nucleic acids or oligonucleotides with a covalently modified base and/or sugar. For example, they include nucleic acids having backbone sugars which are covalently attached to low molecular weight organicgrog ups other than a hydroxyl group at the 3' position and other than a phosphate group at the 5' position. Thus modified nucleic acids may include a 2'-0-aLkylated ribose group. In addition, modified nucleic acids may include
(Tegafur/Uracil) Solid Tumors Squibb Sankyo Krestin Krestin Solid Tumors Asta Medica Ifex/Mesnex Ifosamide Solid Tumors Bristol-Myers Ifex/Mesnex Ifosamide Solid Tumors Sat ibb Bristol-Myers Vumon Teniposide Solid Tumors Squibb Bristol-Myers Paraplatin Carboplatin Solid Tumors Squibb Bristol-Myers Plantinol Cisplatin, Stealth Solid Tumors Squibb Bristol-Myers Plantinol Cisplatin Solid Tumors Squibb Bristol-Myers Vepeside Etoposide Solid Tumors Melanoma Squibb Zeneca ZD 9331 ZD 9331 Solid Tumors, Advanced Colorectal Chugai Taxotere Docetaxel Solid Tumors, Breast Cancer Rhone Poulenc Taxotere Docetaxel Solid Tumors, Breast Cancer Glaxo Wellcome Prodrug of guanine arabinside prodrug of arabinside T Cell Leuk-emia/Lymphoind & B Cell Neoplasm Bristol-Myers Taxane Analog Taxane Analog Taxol follow up Squibb Another useful anti-cancer therapy is Interferon-a (e.g., INTRON A, Schering).
The compounds useful according to the invention are nucleic acids. The nucleic acids may be double-stranded or single-stranded. Generally, double-stranded molecules may be more stable in vivo, while single-stranded molecules may have increased activity. The terms "nucleic acid" and "oligonucleotide" refer to multiple nucleotides (i.e., molecules comprising a sugar (e.g., ribose or deoxyribose) linked to a phosphate group and to an exchangeable organic base, which is either a substituted pyrimidine (e.g., cytosine (C), thymine (T) or uracil (U)) or a substituted purine (e.g., adenine (A) or guanine (G)) or a modified base. As used herein, the terms refer to oligoribonucleotides as well as oligodeoxyribonucleotides.
The terms shall also include polynucleosides (i.e., a polynucleotide minus the phosphate) and any other organic base-containing polymer. The terms "nucleic acid" and "oligonucleotide"
also encompass nucleic acids or oligonucleotides with a covalently modified base and/or sugar. For example, they include nucleic acids having backbone sugars which are covalently attached to low molecular weight organicgrog ups other than a hydroxyl group at the 3' position and other than a phosphate group at the 5' position. Thus modified nucleic acids may include a 2'-0-aLkylated ribose group. In addition, modified nucleic acids may include
- 37 -sugars such as arabinose instead of ribose. Thus the nucleic acids may be heterogeneous in backbone composition thereby containing any possible combination of polymer units linked together such as peptide-nucleic acids (which have amino acid backbone with nucleic acid bases). In some embodiments the nucleic acids are homogeneous in backbone composition.
Nucleic acids also can include base analogs such as C-5 propyne modified bases.
Wagner RW et al., Nature Biotechnol 14:840-4 (1996). Purines and pyrimidines include but are not limited to adenine, cytosine, guanine, thymine, 5-methylcytosine, 2-aminopurine, 2-amino-6-chloropurine, 2,6-diaminopurine, hypoxanthine, and other naturally and non-naturally occurring nucleobases, substituted and unsubstituted aromatic moieties.
The nucleic acid is a linked polymer of bases or nucleotides. As used herein with respect to linked units of a nucleic acid, "linked" or "linkage" means two entities are bound to one another by any physicochemical means. Any linkage known to those of ordinary skill in the art, covalent or non-covalent, is embraced. Such linkages are well known to those of ordinary skill in the art. Natural linkages, which are those ordinarily found in nature connecting the individual units of a nucleic acid, are most common. The individual units of a nucleic acid may be linked, however, by synthetic or modified linkages.
Whenever a nucleic acid is represented by a sequence of letters it will be understood that the nucleotides are in 5' -> 3' order from left to right and that "A"
denotes adenosine, "C"
denotes cytosine, "G" denotes guanosine, "T" denotes thymidine, and "U"
denotes uracil unless otherwise noted.
Nucleic acid molecules useful according to the invention can be obtained from natural nucleic acid sources (e.g., genomic nuclear or mitochondrial DNA or cDNA), or are synthetic (e.g., produced by oligonucleotide synthesis). Nucleic acids isolated from existing nucleic acid sources are referred to herein as native, natural, or isolated nucleic acids. The nucleic acids useful according to the invention may be isolated from any source, including eukaryotic sources, prokaryotic sources, nuclear DNA, mitochondrial DNA, etc. Thus, the term nucleic acid encompasses both synthetic and isolated nucleic acids. The term "isolated" as used herein refers to a nucleic acid which is substantially free of other nucleic acids, proteins, lipids, carbohydrates or other materials with which it is naturally associated. The nucleic acids can be produced on a large scale in plasmids, (see Sambrook T et al., "Molecular Cloning: A Laboratory Manual", Cold Spring Harbor Laboratory Press, New York, 1989) and separated into smaller pieces or administered whole. After being administered to a
Nucleic acids also can include base analogs such as C-5 propyne modified bases.
Wagner RW et al., Nature Biotechnol 14:840-4 (1996). Purines and pyrimidines include but are not limited to adenine, cytosine, guanine, thymine, 5-methylcytosine, 2-aminopurine, 2-amino-6-chloropurine, 2,6-diaminopurine, hypoxanthine, and other naturally and non-naturally occurring nucleobases, substituted and unsubstituted aromatic moieties.
The nucleic acid is a linked polymer of bases or nucleotides. As used herein with respect to linked units of a nucleic acid, "linked" or "linkage" means two entities are bound to one another by any physicochemical means. Any linkage known to those of ordinary skill in the art, covalent or non-covalent, is embraced. Such linkages are well known to those of ordinary skill in the art. Natural linkages, which are those ordinarily found in nature connecting the individual units of a nucleic acid, are most common. The individual units of a nucleic acid may be linked, however, by synthetic or modified linkages.
Whenever a nucleic acid is represented by a sequence of letters it will be understood that the nucleotides are in 5' -> 3' order from left to right and that "A"
denotes adenosine, "C"
denotes cytosine, "G" denotes guanosine, "T" denotes thymidine, and "U"
denotes uracil unless otherwise noted.
Nucleic acid molecules useful according to the invention can be obtained from natural nucleic acid sources (e.g., genomic nuclear or mitochondrial DNA or cDNA), or are synthetic (e.g., produced by oligonucleotide synthesis). Nucleic acids isolated from existing nucleic acid sources are referred to herein as native, natural, or isolated nucleic acids. The nucleic acids useful according to the invention may be isolated from any source, including eukaryotic sources, prokaryotic sources, nuclear DNA, mitochondrial DNA, etc. Thus, the term nucleic acid encompasses both synthetic and isolated nucleic acids. The term "isolated" as used herein refers to a nucleic acid which is substantially free of other nucleic acids, proteins, lipids, carbohydrates or other materials with which it is naturally associated. The nucleic acids can be produced on a large scale in plasmids, (see Sambrook T et al., "Molecular Cloning: A Laboratory Manual", Cold Spring Harbor Laboratory Press, New York, 1989) and separated into smaller pieces or administered whole. After being administered to a
- 38 -subject the plasmid can be degraded into oligonucleotides. One skilled in the art can purify viral, bacterial, eukaryotic, etc., nucleic acids using standard techniques, such as those employing restriction enzymes, exonucleases or endonucleases.
For use in the instant invention, the nucleic acids can be synthesized de novo using any of a number of procedures well known in the art. For example, the b-cyanoethyl phosphoramidite method (Beaucage SL et al., Tetrahedron Lett 22:1859, 1981);
nucleoside H-phosphonate method (Garegg et al., Tetrahedron Lett 27:4051-4, 1986;
Froehler et al., Nucl Acid Res 14:5399-407, 1986; Garegg et al., Tetrahedron Lett 27:4055-8, 1986; Gaffney et al., Tetrahedron Lett 29:2619-22, 1988). These chemistries can be performed by a variety of automated oligonucleotide synthesizers available in the market.
In some embodiments, the nucleic acids useful according to the invention are immunostimulatory nucleic acids. An immunostimulatory nucleic acid is any nucleic acid, as described above, which is capable of modulating an immune response. A nucleic acid which modulates an immune response is one which produces any form of immune stimulation, including, but not limited to, induction of cytokines, B-cell activation, T-cell activation, monocyte activation. Immunostimulatory nucleic acids include, but are not limited to, CpG
nucleic acids, methylated CpG nucleic acids, T-rich nucleic acids, poly-G
nucleic acids, and nucleic acids having phosphate modified backbones, such as phosphorothioate backbones.
A "CpG nucleic acid" or a "CpG immunostimulatory nucleic acid" as used herein is a nucleic acid containing at least one unmethylated CpG dinucleotide (cytosine-guanine dinucleotide sequence, i.e., "CpG DNA" or DNA containing a 5' cytosine followed by 3' guanosine and linked by a phosphate bond) and activates a component of the immune system.
The entire CpG nucleic acid can be unmethylated or portions may be unmethylated but at least the C of the 5' CG 3' must be unmethylated.
In one embodiment the invention provides a CpG nucleic acid represented by at least the formula:
5' NiXiCGX2N2 3' wherein X1 and X2 are nucleotides and N is any nucleotide and N1 and N2 are nucleic acid sequences composed of from about 0-25 N's each. In some embodiments X1 is adenine, guanine, or thymine and X2 is cytosine, adenine, or thymine. In other embodiments X1 is cytosine and/or X2 is guanine.
In other embodiments the CpG nucleic acid is represented by at least the formula:
For use in the instant invention, the nucleic acids can be synthesized de novo using any of a number of procedures well known in the art. For example, the b-cyanoethyl phosphoramidite method (Beaucage SL et al., Tetrahedron Lett 22:1859, 1981);
nucleoside H-phosphonate method (Garegg et al., Tetrahedron Lett 27:4051-4, 1986;
Froehler et al., Nucl Acid Res 14:5399-407, 1986; Garegg et al., Tetrahedron Lett 27:4055-8, 1986; Gaffney et al., Tetrahedron Lett 29:2619-22, 1988). These chemistries can be performed by a variety of automated oligonucleotide synthesizers available in the market.
In some embodiments, the nucleic acids useful according to the invention are immunostimulatory nucleic acids. An immunostimulatory nucleic acid is any nucleic acid, as described above, which is capable of modulating an immune response. A nucleic acid which modulates an immune response is one which produces any form of immune stimulation, including, but not limited to, induction of cytokines, B-cell activation, T-cell activation, monocyte activation. Immunostimulatory nucleic acids include, but are not limited to, CpG
nucleic acids, methylated CpG nucleic acids, T-rich nucleic acids, poly-G
nucleic acids, and nucleic acids having phosphate modified backbones, such as phosphorothioate backbones.
A "CpG nucleic acid" or a "CpG immunostimulatory nucleic acid" as used herein is a nucleic acid containing at least one unmethylated CpG dinucleotide (cytosine-guanine dinucleotide sequence, i.e., "CpG DNA" or DNA containing a 5' cytosine followed by 3' guanosine and linked by a phosphate bond) and activates a component of the immune system.
The entire CpG nucleic acid can be unmethylated or portions may be unmethylated but at least the C of the 5' CG 3' must be unmethylated.
In one embodiment the invention provides a CpG nucleic acid represented by at least the formula:
5' NiXiCGX2N2 3' wherein X1 and X2 are nucleotides and N is any nucleotide and N1 and N2 are nucleic acid sequences composed of from about 0-25 N's each. In some embodiments X1 is adenine, guanine, or thymine and X2 is cytosine, adenine, or thymine. In other embodiments X1 is cytosine and/or X2 is guanine.
In other embodiments the CpG nucleic acid is represented by at least the formula:
-39-.
5' N1X1X2CGX3X4N2 3' wherein X1, X2, X3, and X4 are nucleotides. In some embodiments, X1X2 are nucleotides selected from the group consisting of: GpT, GpG, GpA, ApA, ApT, ApG, CpT, CpA, CpG, TpA, TpT, and TpG; and X3X4 are nucleotides selected from the group consisting of: TpT, CpT, ApT, TpG, ApG, CpG, TpC, ApC, CpC, TpA, ApA, and CpA; N is any nucleotide and N1 and N2 are nucleic acid sequences composed of from about 0-25 N's each. In some embodiments, X1X2 are GpA or GpT and X3X4 are TpT. In other embodiments X1 or X2 or both are purines and X3 or X4 or both are pyrimidines or X1X2 are GpA and X3 or X4 or both are pyrimidines.
In some embodiments N1 and N2 of the nucleic acid do not contain a CCGG or CGCG
quadmer or more than one CCG or CGG trimer. The effect of a CCGG or CGCG
quadmer or more than one CCG or CGG trimer depends in part on the status of the nucleic acid backbone. For instance, if the nucleic acid has a phosphodiester backbone or a chimeric backbone the inclusion of these sequences in the nucleic acid will only have minimal if any affect on the biological activity of the nucleic acid. If the backbone is completely phosphorothioate or significantly phosphorothioate then the inclusion of these sequences may have more influence on the biological activity or the kinetics of the biological activity, but compounds containing these sequences are still useful. In another embodiment the CpG
nucleic acid has the sequence 5' TCN1TXIX2CGX3X4 3'.
A "T-rich nucleic acid" or "T-rich immunostimulatory nucleic acid" is a nucleic acid which includes at least one poly-T sequence and/or which has a nucleotide composition of greater than 25% T nucleotide residues and which activates a component of the immune system. A nucleic acid having a poly-T sequence includes at least four Ts in a row, such as 5' TTTT 3'. Preferably the T-rich nucleic acid includes more than one poly-T
sequence. In preferred embodiments the T-rich nucleic acid may have 2, 3, 4, etc., poly-T
sequences, such as oligonucleotide #2006 (5' TCGTCGTTTTGTCGTTTTGTCGTT 3', SEQ ID NO: 729).
One of the most highly immunostimulatory T-rich oligonucleotides discovered according to the invention is a nucleic acid composed entirely of T nucleotide residues, e.g., oligonucleotide #2183 (5' TTTTTTTTTTTTTTTTTTTTTTTT 3', SEQ ID NO: 841). Other T-rich nucleic acids have a nucleotide composition of greater than 25% T
nucleotide residues, but do not necessarily include a poly-T sequence. In these T-rich nucleic acids the T
nucleotide resides may be separated from one another by other types of nucleotide residues,
5' N1X1X2CGX3X4N2 3' wherein X1, X2, X3, and X4 are nucleotides. In some embodiments, X1X2 are nucleotides selected from the group consisting of: GpT, GpG, GpA, ApA, ApT, ApG, CpT, CpA, CpG, TpA, TpT, and TpG; and X3X4 are nucleotides selected from the group consisting of: TpT, CpT, ApT, TpG, ApG, CpG, TpC, ApC, CpC, TpA, ApA, and CpA; N is any nucleotide and N1 and N2 are nucleic acid sequences composed of from about 0-25 N's each. In some embodiments, X1X2 are GpA or GpT and X3X4 are TpT. In other embodiments X1 or X2 or both are purines and X3 or X4 or both are pyrimidines or X1X2 are GpA and X3 or X4 or both are pyrimidines.
In some embodiments N1 and N2 of the nucleic acid do not contain a CCGG or CGCG
quadmer or more than one CCG or CGG trimer. The effect of a CCGG or CGCG
quadmer or more than one CCG or CGG trimer depends in part on the status of the nucleic acid backbone. For instance, if the nucleic acid has a phosphodiester backbone or a chimeric backbone the inclusion of these sequences in the nucleic acid will only have minimal if any affect on the biological activity of the nucleic acid. If the backbone is completely phosphorothioate or significantly phosphorothioate then the inclusion of these sequences may have more influence on the biological activity or the kinetics of the biological activity, but compounds containing these sequences are still useful. In another embodiment the CpG
nucleic acid has the sequence 5' TCN1TXIX2CGX3X4 3'.
A "T-rich nucleic acid" or "T-rich immunostimulatory nucleic acid" is a nucleic acid which includes at least one poly-T sequence and/or which has a nucleotide composition of greater than 25% T nucleotide residues and which activates a component of the immune system. A nucleic acid having a poly-T sequence includes at least four Ts in a row, such as 5' TTTT 3'. Preferably the T-rich nucleic acid includes more than one poly-T
sequence. In preferred embodiments the T-rich nucleic acid may have 2, 3, 4, etc., poly-T
sequences, such as oligonucleotide #2006 (5' TCGTCGTTTTGTCGTTTTGTCGTT 3', SEQ ID NO: 729).
One of the most highly immunostimulatory T-rich oligonucleotides discovered according to the invention is a nucleic acid composed entirely of T nucleotide residues, e.g., oligonucleotide #2183 (5' TTTTTTTTTTTTTTTTTTTTTTTT 3', SEQ ID NO: 841). Other T-rich nucleic acids have a nucleotide composition of greater than 25% T
nucleotide residues, but do not necessarily include a poly-T sequence. In these T-rich nucleic acids the T
nucleotide resides may be separated from one another by other types of nucleotide residues,
- 40 -i.e., G, C, and A. In some embodiments the T-rich nucleic acids have a nucleotide composition of greater than 30%, 40%, 50%, 60%, 70%, 80%, 90%, and 99%, T
nucleotide residues and every integer % in between. Preferably the T-rich nucleic acids have at least one poly-T sequence and a nucleotide composition of greater than 25% T
nucleotide residues.
In one embodiment the T-rich nucleic acid is represented by at least the formula:
5' X1X2TTTTX3X4 3' wherein Xi, X2, X3, and X4 are nucleotides. In one embodiment X1X2 is TT
and/or X3X4 is TT. In another embodiment X1X2 are any one of the following nucleotides TA, TG, TC, AT, AA, AG, AC, CT, CC, CA, CG, GT, GG, GA, and GC; and X3X4 are any one of the following nucleotides TA, TG, TC, AT, AA, AG, AC, CT, CC, CA, CG, GT, GG, GA, and GC.
In some embodiments it is preferred that the T-rich nucleic acid does not contain poly-C (CCCC), poly-A (AAAA), poly-G (GGGG), CpG motifs, or multiple GGs. In other embodiments the T-rich nucleic acid includes these motifs. Thus in some embodiments of the invention the T-rich nucleic acids include CpG dinucleotides and in other embodiments the T-rich nucleic acids are free of CpG dinucleotides. The CpG dinucleotides may be methylated or unmethylated.
Poly-G containing nucleic acids are also immunostimulatory. A variety of references, including Pisetsky DS et al., Mol Biol Rep 18:217-21 (1993); Krieger M et al., Arum Rev Biochem 63:601-37 (1994); Macaya RF et al., Proc Natl Acad Sci USA 90:3745-9 (1993);
Wyatt JR et al., Proc Natl Acad Sci USA 91:1356-60 (1994); Rando and Hogan, 1998, In:
Applied Antisense Oligonucleotide Technology, eds. Krieg AM and Stein C, pp.
335-352;
and Kimura Y et al., J Biochem (Tokyo) 116:991-4 (1994) also describe the immunostimulatory properties of poly-G nucleic acids.
Poly G nucleic acids preferably are nucleic acids having the following formulas:
5' XiX2GGGX3X4 3' wherein X1, X2, X3, and X4 are nucleotides. In preferred embodiments at least one of X3 and X4 are a G. hi other embodiments both of X3 and X4 are a G. In yet other embodiments the preferred formula is 5' GGGNGGG 3', or 5' GGGNGGGNGGG 3' wherein N represents between 0 and 20 nucleotides. In other embodiments the poly-G nucleic acid is free of unmethylated CG dinucleotides, such as, for example, the nucleic acids listed in Table 4 below as SEQ 1D NOs: 12-14, 23, 56, 100, 155, 163, 182, 227, 237, 246, 400, 407, 429, 430,
nucleotide residues and every integer % in between. Preferably the T-rich nucleic acids have at least one poly-T sequence and a nucleotide composition of greater than 25% T
nucleotide residues.
In one embodiment the T-rich nucleic acid is represented by at least the formula:
5' X1X2TTTTX3X4 3' wherein Xi, X2, X3, and X4 are nucleotides. In one embodiment X1X2 is TT
and/or X3X4 is TT. In another embodiment X1X2 are any one of the following nucleotides TA, TG, TC, AT, AA, AG, AC, CT, CC, CA, CG, GT, GG, GA, and GC; and X3X4 are any one of the following nucleotides TA, TG, TC, AT, AA, AG, AC, CT, CC, CA, CG, GT, GG, GA, and GC.
In some embodiments it is preferred that the T-rich nucleic acid does not contain poly-C (CCCC), poly-A (AAAA), poly-G (GGGG), CpG motifs, or multiple GGs. In other embodiments the T-rich nucleic acid includes these motifs. Thus in some embodiments of the invention the T-rich nucleic acids include CpG dinucleotides and in other embodiments the T-rich nucleic acids are free of CpG dinucleotides. The CpG dinucleotides may be methylated or unmethylated.
Poly-G containing nucleic acids are also immunostimulatory. A variety of references, including Pisetsky DS et al., Mol Biol Rep 18:217-21 (1993); Krieger M et al., Arum Rev Biochem 63:601-37 (1994); Macaya RF et al., Proc Natl Acad Sci USA 90:3745-9 (1993);
Wyatt JR et al., Proc Natl Acad Sci USA 91:1356-60 (1994); Rando and Hogan, 1998, In:
Applied Antisense Oligonucleotide Technology, eds. Krieg AM and Stein C, pp.
335-352;
and Kimura Y et al., J Biochem (Tokyo) 116:991-4 (1994) also describe the immunostimulatory properties of poly-G nucleic acids.
Poly G nucleic acids preferably are nucleic acids having the following formulas:
5' XiX2GGGX3X4 3' wherein X1, X2, X3, and X4 are nucleotides. In preferred embodiments at least one of X3 and X4 are a G. hi other embodiments both of X3 and X4 are a G. In yet other embodiments the preferred formula is 5' GGGNGGG 3', or 5' GGGNGGGNGGG 3' wherein N represents between 0 and 20 nucleotides. In other embodiments the poly-G nucleic acid is free of unmethylated CG dinucleotides, such as, for example, the nucleic acids listed in Table 4 below as SEQ 1D NOs: 12-14, 23, 56, 100, 155, 163, 182, 227, 237, 246, 400, 407, 429, 430,
-41-432, 435, 438, 439, 446, 450, 451, 480, 487, 493, 522, 661, 662, 671-673, 807, 808, 821, 823, and 834. In other embodiments the poly-G nucleic acid includes at least one unmethylated CG dinucleotide, such as, for example, the nucleic acids listed in Table 4 below as SEQ ID
NOs: 6, 7, 22,26, 28-30, 87, 115, 141, 177, 191, 209, 254, 258, 267, 303, 317, 329, 335, 344, 345, 395, 414, 417, 418, 423-426, 428, 431, 433, 434, 436, 437, 440, 442-445, 447-449, 458, 460, 463, 467-469, 474, 515, 516, 594, 638-640, 663, 664, 727, 752, 776, 795, 799, 817, 818, 831, and 832.
Nucleic acids having modified backbones, such as phosphorothioate backbones, also fall within the class of immunostimulatory nucleic acids. U.S. Patents Nos.
5,723,335 and 5,663,153 issued to Hutcherson, et al. and related PCT publication W095/26204 describe immune stimulation using phosphorothioate oligonucleotide analogues. These patents describe the ability of the phosphorothioate backbone to stimulate an immune response in a non-sequence specific manner.
The immunostimulatory nucleic acids may be any size but in some embodiments are in the range of between 6 and 100 or in some embodiments between 8 and 35 nucleotides in size. Immunostimulatory nucleic acids can be produced on a large scale in plasmids. These may be administered in plasmid form or alternatively they can be degraded into oligonucleotides.
"Palindromic sequence" shall mean an inverted repeat (i.e., a sequence such as ABCDEE'D'C'B'A' in which A and A' are bases capable of forming the usual Watson-Crick base pairs and which includes at least 6 nucleotides in the palindrome. In vivo, such sequences may form double-stranded structures. In one embodiment the nucleic acid contains a palindromic sequence. In some embodiments when the nucleic acid is a CpG
nucleic acid, a palindromic sequence used in this context refers to a palindrome in which the CpG is part of the palindrome, and optionally is the center of the palindrome.
In another embodiment the nucleic acid is free of a palindrome. A nucleic acid that is free of a palindrome does not have any regions of 6 nucleotides or greater in length which are palindromic. A nucleic acid that is free of a palindrome can include a region of less than 6 nucleotides which are palindromic.
A "stabilized nucleic acid molecule" shall mean a nucleic acid molecule that is relatively resistant to in vivo degradation (e.g., via an exonuclease or endonuclease).
Stabilization can be a function of length or secondary structure. Nucleic acids that are tens to
NOs: 6, 7, 22,26, 28-30, 87, 115, 141, 177, 191, 209, 254, 258, 267, 303, 317, 329, 335, 344, 345, 395, 414, 417, 418, 423-426, 428, 431, 433, 434, 436, 437, 440, 442-445, 447-449, 458, 460, 463, 467-469, 474, 515, 516, 594, 638-640, 663, 664, 727, 752, 776, 795, 799, 817, 818, 831, and 832.
Nucleic acids having modified backbones, such as phosphorothioate backbones, also fall within the class of immunostimulatory nucleic acids. U.S. Patents Nos.
5,723,335 and 5,663,153 issued to Hutcherson, et al. and related PCT publication W095/26204 describe immune stimulation using phosphorothioate oligonucleotide analogues. These patents describe the ability of the phosphorothioate backbone to stimulate an immune response in a non-sequence specific manner.
The immunostimulatory nucleic acids may be any size but in some embodiments are in the range of between 6 and 100 or in some embodiments between 8 and 35 nucleotides in size. Immunostimulatory nucleic acids can be produced on a large scale in plasmids. These may be administered in plasmid form or alternatively they can be degraded into oligonucleotides.
"Palindromic sequence" shall mean an inverted repeat (i.e., a sequence such as ABCDEE'D'C'B'A' in which A and A' are bases capable of forming the usual Watson-Crick base pairs and which includes at least 6 nucleotides in the palindrome. In vivo, such sequences may form double-stranded structures. In one embodiment the nucleic acid contains a palindromic sequence. In some embodiments when the nucleic acid is a CpG
nucleic acid, a palindromic sequence used in this context refers to a palindrome in which the CpG is part of the palindrome, and optionally is the center of the palindrome.
In another embodiment the nucleic acid is free of a palindrome. A nucleic acid that is free of a palindrome does not have any regions of 6 nucleotides or greater in length which are palindromic. A nucleic acid that is free of a palindrome can include a region of less than 6 nucleotides which are palindromic.
A "stabilized nucleic acid molecule" shall mean a nucleic acid molecule that is relatively resistant to in vivo degradation (e.g., via an exonuclease or endonuclease).
Stabilization can be a function of length or secondary structure. Nucleic acids that are tens to
- 42 -hundreds of kbs long are relatively resistant to in vivo degradation. For shorter nucleic acids, secondary structure can stabilize and increase their effect. For example, if the 3' end of an oligonucleotide has self-complementarity to an upstream region, so that it can fold back and form a sort of stem loop structure, then the oligonucleotide becomes stabilized and therefore exhibits more activity.
Some stabilized oligonucleotides of the instant invention have a modified backbone.
It has been demonstrated that modification of the oligonucleotide backbone provides enhanced activity of the nucleic acids when administered in vivo. Nucleic acids, including at least two phosphorothioate linkages at the 5' end of the oligonucleotide and multiple phosphorothioate linkages at the 3' end, preferably 5, may provide maximal activity and protect the oligonucleotide from degradation by intracellular exo- and endo-nucleases. Other modified oligonucleotides include phosphodiester modified oligonucleotide, combinations of phosphodiester and phosphorothioate oligonucleotide, methylphosphonate, methylphosphorothioate, phosphorodithioate, and combinations thereof. Each of these combinations and their particular effects on immune cells is discussed in more detail in PCT
Published Patent Application W098/18810 claiming priority to U.S. Serial Nos.
08/738,652 (now issued as U.S. Patent No. 6,207,646 B1) and 08/960,774 (now issued as U.S. Patent No.
6,239,116 B1), filed on October 30, 1996 and October 30, 1997 respectively, the entire contents of which is hereby incorporated by reference. It is believed that these modified oligonucleotides may show more stimulatory activity due to enhanced nuclease resistance, increased cellular uptake, increased protein binding, and/or altered intracellular localization.
Both phosphorothioate and phosphodiester nucleic acids are active in immune cells.
Other stabilized oligonucleotides include: nonionic DNA analogs, such as alkyl-and aryl-phosphates (in which the charged phosphonate oxygen is replaced by an alkyl or aryl group), phosphodiester and alkylphosphotriesters, in which the charged oxygen moiety is alkylated. Oligonucleotides which contain diol, such as tetraethyleneglycol or hexaethyleneglycol, at either or both termini have also been shown to be substantially resistant to nuclease degradation.
For use in vivo, nucleic acids are preferably relatively resistant to degradation (e.g., via endonucleases and exonucleases). Secondary structures, such as stem loops, can stabilize nucleic acids against degradation. Alternatively, nucleic acid stabilization can be accomplished via phosphate backbone modifications. One type of stabilized nucleic acid has
Some stabilized oligonucleotides of the instant invention have a modified backbone.
It has been demonstrated that modification of the oligonucleotide backbone provides enhanced activity of the nucleic acids when administered in vivo. Nucleic acids, including at least two phosphorothioate linkages at the 5' end of the oligonucleotide and multiple phosphorothioate linkages at the 3' end, preferably 5, may provide maximal activity and protect the oligonucleotide from degradation by intracellular exo- and endo-nucleases. Other modified oligonucleotides include phosphodiester modified oligonucleotide, combinations of phosphodiester and phosphorothioate oligonucleotide, methylphosphonate, methylphosphorothioate, phosphorodithioate, and combinations thereof. Each of these combinations and their particular effects on immune cells is discussed in more detail in PCT
Published Patent Application W098/18810 claiming priority to U.S. Serial Nos.
08/738,652 (now issued as U.S. Patent No. 6,207,646 B1) and 08/960,774 (now issued as U.S. Patent No.
6,239,116 B1), filed on October 30, 1996 and October 30, 1997 respectively, the entire contents of which is hereby incorporated by reference. It is believed that these modified oligonucleotides may show more stimulatory activity due to enhanced nuclease resistance, increased cellular uptake, increased protein binding, and/or altered intracellular localization.
Both phosphorothioate and phosphodiester nucleic acids are active in immune cells.
Other stabilized oligonucleotides include: nonionic DNA analogs, such as alkyl-and aryl-phosphates (in which the charged phosphonate oxygen is replaced by an alkyl or aryl group), phosphodiester and alkylphosphotriesters, in which the charged oxygen moiety is alkylated. Oligonucleotides which contain diol, such as tetraethyleneglycol or hexaethyleneglycol, at either or both termini have also been shown to be substantially resistant to nuclease degradation.
For use in vivo, nucleic acids are preferably relatively resistant to degradation (e.g., via endonucleases and exonucleases). Secondary structures, such as stem loops, can stabilize nucleic acids against degradation. Alternatively, nucleic acid stabilization can be accomplished via phosphate backbone modifications. One type of stabilized nucleic acid has
43 at least a partial phosphorothioate modified backbone. Phosphorothioates may be synthesized using automated techniques employing either phosphoramidate or H-phosphonate chemistries. Aryl- and alkyl-phosphonates can be made, e.g., as described in U.S. Patent No. 4,469,863; and alkylphosphotriesters (in which the charged oxygen moiety is alkylated as described in U.S. Patent No. 5,023,243 and European Patent No.
092,574) can be prepared by automated solid phase synthesis using commercially available reagents.
Methods for making other DNA backbone modifications and substitutions have been described. Uhlmann E et al., Chem Rev 90:544-84 (1990); Goodchild J, Bioconjugate Chem 1:165-87 (1990).
The immunostimulatory nucleic acids having backbone modifications useful according to the invention in some embodiments are S- or R-chiral immunostimulatory nucleic acids. An "S chiral immunostimulatory nucleic acid" as used herein is an immunostimulatory nucleic acid wherein at least two nucleotides have a backbone modification forming a chiral center and wherein a plurality of the chiral centers have S
chirality. An "R chiral immunostimulatory nucleic acid" as used herein is an immunostimulatory nucleic acid wherein at least two nucleotides have a backbone modification forming a chiral center and wherein a plurality of the chiral centers have R
chirality. The backbone modification may be any type of modification that forms a chiral center. The modifications include but are not limited to phosphorothioate, methylphosphonate, methylphosphorothioate, phosphoroclithioate, T-OMe and combinations thereof. In other embodiments they are non-chiral. A non-chiral nucleic acid is any nucleic acid which does not have at least two chiral centers.
The chiral immunostimulatory nucleic acids must have at least two nucleotides within the nucleic acid that have a backbone modification. All or less than all of the nucleotides in the nucleic acid, however, may have a modified backbone. Of the nucleotides having a modified backbone (referred to as chiral centers), a plurality have a single chirality, S or R.
A "plurality" as used herein refers to an amount greater than or equal to 75%.
Thus, less than all of the chiral centers may have S or R chirality as long as a plurality of the chiral centers have S or R chirality. In some embodiments at least 75%, 80%, 85%, 90%, 95%, or 100% of the chiral centers have S or R chirality. In other embodiments at least 75%, 80%, 85%, 90%, 95%, or 100% of the nucleotides have backbone modifications.
092,574) can be prepared by automated solid phase synthesis using commercially available reagents.
Methods for making other DNA backbone modifications and substitutions have been described. Uhlmann E et al., Chem Rev 90:544-84 (1990); Goodchild J, Bioconjugate Chem 1:165-87 (1990).
The immunostimulatory nucleic acids having backbone modifications useful according to the invention in some embodiments are S- or R-chiral immunostimulatory nucleic acids. An "S chiral immunostimulatory nucleic acid" as used herein is an immunostimulatory nucleic acid wherein at least two nucleotides have a backbone modification forming a chiral center and wherein a plurality of the chiral centers have S
chirality. An "R chiral immunostimulatory nucleic acid" as used herein is an immunostimulatory nucleic acid wherein at least two nucleotides have a backbone modification forming a chiral center and wherein a plurality of the chiral centers have R
chirality. The backbone modification may be any type of modification that forms a chiral center. The modifications include but are not limited to phosphorothioate, methylphosphonate, methylphosphorothioate, phosphoroclithioate, T-OMe and combinations thereof. In other embodiments they are non-chiral. A non-chiral nucleic acid is any nucleic acid which does not have at least two chiral centers.
The chiral immunostimulatory nucleic acids must have at least two nucleotides within the nucleic acid that have a backbone modification. All or less than all of the nucleotides in the nucleic acid, however, may have a modified backbone. Of the nucleotides having a modified backbone (referred to as chiral centers), a plurality have a single chirality, S or R.
A "plurality" as used herein refers to an amount greater than or equal to 75%.
Thus, less than all of the chiral centers may have S or R chirality as long as a plurality of the chiral centers have S or R chirality. In some embodiments at least 75%, 80%, 85%, 90%, 95%, or 100% of the chiral centers have S or R chirality. In other embodiments at least 75%, 80%, 85%, 90%, 95%, or 100% of the nucleotides have backbone modifications.
-44 -The S- and R- chiral irnmunostimulatory nucleic acids may be prepared by any method known in the art for producing chirally pure oligonucleotides. Stec et al. teach methods for producing stereopure phosphorothioate oligodeoxynucleotides using an oxathiaphospholane. Stec WI et al., .1Im Chem Soc 117:12019 (1995). Other methods for making chirally pure oligonucleotides have been described by companies such as ISIS
Pharmaceuticals. U.S. Patents which disclose methods for generating stereopure oligonucleotides include 5,212,295, 5,359,052, 5,506,212,5,512,668, 5,521,302,5,599,797, 5,837,856, 5,856,465, and 5,883,237.
Other sources of nucleic acids useful according to the invention include standard viral and bacterial vectors, many of which are commercially available. In its broadest sense, a "vector" is any nucleic acid material which is ordinarily used to deliver and facilitate the transfer of nucleic acids to cells. The vector as used herein may be an empty vector or a vector carrying a gene which can be expressed. In the case when the vector is carrying a gene the vector generally transports the gene to the target cells with reduced degradation relative to the extent of degradation that would result in the absence of the vector. In this case the vector optionally includes gene expression sequences to enhance expression of the gene in target cells such as immune cells, but it is not required that the gene be expressed in the cell.
In general, vectors include, but are not limited to, plasmids, phagemids, viruses, other vehicles derived from viral or bacterial sources. Viral vectors are one type of vector and include, but are not limited to, nucleic acid sequences from the following viruses: retrovirus, such as Moloney murine leukemia virus, Harvey murine sarcoma virus, murine mammary tumor virus, and Rous sarcoma virus; adenovirus, adeno-associated virus; SV40-type viruses;
polyoma viruses; Epstein-Barr viruses; papilloma viruses; herpes virus;
vaccinia virus; polio virus; and RNA virus such as a retrovirus. One can readily employ other vectors not named but known to the art. Some viral vectors are based on non-cytopathic eukaryotic viruses in which non-essential genes have been replaced with a nucleic acid to be delivered.
Non-cytopathic viruses include retroviruses, the life cycle of which involves reverse transcription of genomic viral RNA into DNA.
Standard protocols for producing empty vectors or vectors carrying genes (including the steps of incorporation of exogenous genetic material into a plasmid, transfection of a
Pharmaceuticals. U.S. Patents which disclose methods for generating stereopure oligonucleotides include 5,212,295, 5,359,052, 5,506,212,5,512,668, 5,521,302,5,599,797, 5,837,856, 5,856,465, and 5,883,237.
Other sources of nucleic acids useful according to the invention include standard viral and bacterial vectors, many of which are commercially available. In its broadest sense, a "vector" is any nucleic acid material which is ordinarily used to deliver and facilitate the transfer of nucleic acids to cells. The vector as used herein may be an empty vector or a vector carrying a gene which can be expressed. In the case when the vector is carrying a gene the vector generally transports the gene to the target cells with reduced degradation relative to the extent of degradation that would result in the absence of the vector. In this case the vector optionally includes gene expression sequences to enhance expression of the gene in target cells such as immune cells, but it is not required that the gene be expressed in the cell.
In general, vectors include, but are not limited to, plasmids, phagemids, viruses, other vehicles derived from viral or bacterial sources. Viral vectors are one type of vector and include, but are not limited to, nucleic acid sequences from the following viruses: retrovirus, such as Moloney murine leukemia virus, Harvey murine sarcoma virus, murine mammary tumor virus, and Rous sarcoma virus; adenovirus, adeno-associated virus; SV40-type viruses;
polyoma viruses; Epstein-Barr viruses; papilloma viruses; herpes virus;
vaccinia virus; polio virus; and RNA virus such as a retrovirus. One can readily employ other vectors not named but known to the art. Some viral vectors are based on non-cytopathic eukaryotic viruses in which non-essential genes have been replaced with a nucleic acid to be delivered.
Non-cytopathic viruses include retroviruses, the life cycle of which involves reverse transcription of genomic viral RNA into DNA.
Standard protocols for producing empty vectors or vectors carrying genes (including the steps of incorporation of exogenous genetic material into a plasmid, transfection of a
- 45 -packaging cell lined with plasmid, production of recombinant retroviruses by the packaging cell line, collection of viral particles from tissue culture media, and/or infection of the target cells with viral particles) are provided in Kriegler M, "Gene Transfer and Expression, A
Laboratory Manual," W.H. Freeman Co., New York (1990) and Murry EJ, Ed., "Methods in Molecular Biology," vol. 7, Humana Press, Inc., Cliffton, New Jersey (1991).
Other vectors include plasmid vectors. Plasmid vectors have been extensively described in the art and are well-known to those of skill in the art. See e.g., Sambrook et al., "Molecular Cloning: A Laboratory Manual," Second Edition, Cold Spring Harbor Laboratory Press, 1989. In the last few years, plasmid vectors have been found to be particularly advantageous for delivering genes to cells in vivo because of their inability to replicate within and integrate into a host genome. Some plasmids, however, having a promoter compatible with the host cell, can express a peptide from a gene operatively encoded within the plasmid.
Some commonly used plasmids include pBR322, pUC18, pUC19, pcDNA3.1, pSV40, and pBlueScript. Other plasmids are well-known to those of ordinary skill in the art.
Additionally, plasmids may be custom designed using restriction enzymes and ligation reactions to remove and add specific fragments of DNA.
It has recently been discovered that plasmids (empty or gene-carrying) can be delivered to the immune system using bacteria. Modified forms of bacteria such as Salmonella can be transfected with the plasmid and used as delivery vehicles.
The bacterial delivery vehicles can be administered to a host subject orally or by other administration means. The bacteria deliver the plasmid to immune cells, e.g., dendritic cells, probably by passing through the gut barrier. High levels of immune protection have been established using this methodology. Such methods of delivery are useful for the aspects of the invention utilizing systemic delivery of nucleic acid.
As used herein, administration of an immunostimulatory nucleic acid is intended to embrace the administration of one or more immunostimulatory nucleic acids which may or may not differ in terms of their profile, sequence, backbone modifications and biological effect. As an example, CpG nucleic acids and T-rich nucleic acids may be administered to a single subject along with an antibody and optionally a cancer therapy. In another example, a plurality of CpG nucleic acids which differ in nucleotide sequence may also be administered to a subject.
Laboratory Manual," W.H. Freeman Co., New York (1990) and Murry EJ, Ed., "Methods in Molecular Biology," vol. 7, Humana Press, Inc., Cliffton, New Jersey (1991).
Other vectors include plasmid vectors. Plasmid vectors have been extensively described in the art and are well-known to those of skill in the art. See e.g., Sambrook et al., "Molecular Cloning: A Laboratory Manual," Second Edition, Cold Spring Harbor Laboratory Press, 1989. In the last few years, plasmid vectors have been found to be particularly advantageous for delivering genes to cells in vivo because of their inability to replicate within and integrate into a host genome. Some plasmids, however, having a promoter compatible with the host cell, can express a peptide from a gene operatively encoded within the plasmid.
Some commonly used plasmids include pBR322, pUC18, pUC19, pcDNA3.1, pSV40, and pBlueScript. Other plasmids are well-known to those of ordinary skill in the art.
Additionally, plasmids may be custom designed using restriction enzymes and ligation reactions to remove and add specific fragments of DNA.
It has recently been discovered that plasmids (empty or gene-carrying) can be delivered to the immune system using bacteria. Modified forms of bacteria such as Salmonella can be transfected with the plasmid and used as delivery vehicles.
The bacterial delivery vehicles can be administered to a host subject orally or by other administration means. The bacteria deliver the plasmid to immune cells, e.g., dendritic cells, probably by passing through the gut barrier. High levels of immune protection have been established using this methodology. Such methods of delivery are useful for the aspects of the invention utilizing systemic delivery of nucleic acid.
As used herein, administration of an immunostimulatory nucleic acid is intended to embrace the administration of one or more immunostimulatory nucleic acids which may or may not differ in terms of their profile, sequence, backbone modifications and biological effect. As an example, CpG nucleic acids and T-rich nucleic acids may be administered to a single subject along with an antibody and optionally a cancer therapy. In another example, a plurality of CpG nucleic acids which differ in nucleotide sequence may also be administered to a subject.
- 46 -Some of the nucleic acids useful according to the invention and described herein are presented in Table 4 below.
Table 4: Exemplary Nucleic Acids.
SEQUENCE BACKBONE SEQ ID
NO:
aaaaaa S 1 aaaaaaaaaaaaaaaaaaaa 0 2 aaaaaccccccccccaaaaa o 3 aaaacatgacgttcaaaaaa sos 4 aaaacatgacgttcaaaaaa s2 5 aaaacatgacgttcgggggg sos 6 aaaacatgacgttcgggggg s2 7 aaaacgtt o 8 aaaatcaacgttgaaaaaaa sos 9 aaaatctgtgcttttaaaaaa sos 10 aaaattgacgttttaaaaaa sos 11 aaacattctgggggaattttaagaagtaaacat 0 12 aaacattctgggggaattttaagaagttcctccctcccc o 13 aaacattctgggggaattttgtctagtaaacat 0 14 aacgctcgaccttcgat 0 15 aacgctggaccttccat o 16 aacgctggaccttccatgtc sos 17 aacgtt 0 18 aacgttct o 19 aacgttg 5 20 aacgttga 0 21 aacgttgaggggcat 0 22 aaggtggggcagtctcaggga 23 aatagtcgccataacaaaac o 24 aatagtcgccatcccccccc o 25 aatagtcgccatcccgggac 0 26 aatagtcgccatcgcgcgac o 27 aatagtcgccatggcggggc 0 28 aattctctatcggggcttctgtgtctgttgctggttccgctttat o 29 acaaccacgagaacgggaac 30 acaacgtt 0 31 acaacgttga 0 32 accacaacgagaggaacgca 33 accatcctgaggccattcgg 34 accatggacgaactgtttcccctc 5 35 accatggacgacctgtttcccctc 5 36 accatggacgagctgtttcccctc S 37 accatggacgagctgtttcccctc 38 accatggacgatctgtttcccctc S 39 accatggacggtctgtttcccctc S 40 accatggacgtactgtttcccctc 5 41 accatggacgttctgtttcccctc s 42 acccatcaatagctctgtgc 5 43 acccgtcgtaattatagtaaaaccc o 44 accgcatggattctaggcca 5 45 accttattaagattgtgcaatgtgacgtcctttagcatcgcaaga o 46 acgctggaccttccat 47 acgtcgttcccccccccccc 0 48 VIM) 01/97843
Table 4: Exemplary Nucleic Acids.
SEQUENCE BACKBONE SEQ ID
NO:
aaaaaa S 1 aaaaaaaaaaaaaaaaaaaa 0 2 aaaaaccccccccccaaaaa o 3 aaaacatgacgttcaaaaaa sos 4 aaaacatgacgttcaaaaaa s2 5 aaaacatgacgttcgggggg sos 6 aaaacatgacgttcgggggg s2 7 aaaacgtt o 8 aaaatcaacgttgaaaaaaa sos 9 aaaatctgtgcttttaaaaaa sos 10 aaaattgacgttttaaaaaa sos 11 aaacattctgggggaattttaagaagtaaacat 0 12 aaacattctgggggaattttaagaagttcctccctcccc o 13 aaacattctgggggaattttgtctagtaaacat 0 14 aacgctcgaccttcgat 0 15 aacgctggaccttccat o 16 aacgctggaccttccatgtc sos 17 aacgtt 0 18 aacgttct o 19 aacgttg 5 20 aacgttga 0 21 aacgttgaggggcat 0 22 aaggtggggcagtctcaggga 23 aatagtcgccataacaaaac o 24 aatagtcgccatcccccccc o 25 aatagtcgccatcccgggac 0 26 aatagtcgccatcgcgcgac o 27 aatagtcgccatggcggggc 0 28 aattctctatcggggcttctgtgtctgttgctggttccgctttat o 29 acaaccacgagaacgggaac 30 acaacgtt 0 31 acaacgttga 0 32 accacaacgagaggaacgca 33 accatcctgaggccattcgg 34 accatggacgaactgtttcccctc 5 35 accatggacgacctgtttcccctc 5 36 accatggacgagctgtttcccctc S 37 accatggacgagctgtttcccctc 38 accatggacgatctgtttcccctc S 39 accatggacggtctgtttcccctc S 40 accatggacgtactgtttcccctc 5 41 accatggacgttctgtttcccctc s 42 acccatcaatagctctgtgc 5 43 acccgtcgtaattatagtaaaaccc o 44 accgcatggattctaggcca 5 45 accttattaagattgtgcaatgtgacgtcctttagcatcgcaaga o 46 acgctggaccttccat 47 acgtcgttcccccccccccc 0 48 VIM) 01/97843
-47 -SEQUENCE BACKBONE SEQ ID
NO:
acgtgt S 49 actagacgttagtgtga o 50 actagacgttagtgtga S 51 actggacgttagcgtga 0 52 acttctcatagtccctttggt ccag 0 53 agaacgt t 0 54 agacagacacgaaacgaccg 55 agactcatgggaaaat cccacat ttga 0 56 agatagcaaatcggctgacg 0 57 agatggtt ctcagat aaagcggaa 58 agcaccgaacgtgagagg 0 59 agcacggtagcctt ccta GO
agcagctttagagct tt agagctt S 61 agcat caggaacgacatgga 0 62 agcatcaggaccgacatgga 0 63 agcgctga 0 64 agctcaacgt catgc 0 65 agctccatggtgc t cactg S 66 aggatatc 0 67 aggtacagccaggactacga 68 agicccgigaacgiattcac 0 69 agtgact ctccagcgtt ctc 0 70 agtgcgatt cgagat cg 0 71 agtgcgattgcagat cg 0 72 agtgct S 73 agtgc t a 74 agttgcaact 0 75 ataaagcgaaac tagcagcagtt tc 0 76 ataacgtt 0 77 ataatagagctt caagcaag S 78 ataatccagcttgaaccaag S 79 ataatcgacgtt caagcaag S 80 ataatcgacgtt cccccccc S 81 ataat cgtcgtt caagcaag S 82 ataatcgtgcgtt caagaaag S 83 atagacaaaaatt ccct ccccggagcc 0 84 atatatatatat at at at S 85 atatctaatcaaaacattaacaaa 0 86 at caggaacgtcatgggaagc 0 87 atcgacctacgtgcgtt ct c 0 88 atcgacct acgtgcgtt z tc 0 89 atcgactcgagcgt tctc 0 90 atcgact ctcgagcgt tctc 0 91 at cgactct cgagcgttct c sos 92 atcgact ctcgagtgttctc 93 at cgact ct cgagzgtt ct c o 94 atcgact ctctcgagcgttctc 95 atcgactt cgagcgttctc o 96 atcgat cgagcgtt ctc o 97 at cgatgt o 98 atcggaggactggcgcgccg 99 at ctggtgagggcaagct atg 100 atgacgttcctgacgtt S 101 atgcactctgcagcgttctc 102 atgcatgt o 103
NO:
acgtgt S 49 actagacgttagtgtga o 50 actagacgttagtgtga S 51 actggacgttagcgtga 0 52 acttctcatagtccctttggt ccag 0 53 agaacgt t 0 54 agacagacacgaaacgaccg 55 agactcatgggaaaat cccacat ttga 0 56 agatagcaaatcggctgacg 0 57 agatggtt ctcagat aaagcggaa 58 agcaccgaacgtgagagg 0 59 agcacggtagcctt ccta GO
agcagctttagagct tt agagctt S 61 agcat caggaacgacatgga 0 62 agcatcaggaccgacatgga 0 63 agcgctga 0 64 agctcaacgt catgc 0 65 agctccatggtgc t cactg S 66 aggatatc 0 67 aggtacagccaggactacga 68 agicccgigaacgiattcac 0 69 agtgact ctccagcgtt ctc 0 70 agtgcgatt cgagat cg 0 71 agtgcgattgcagat cg 0 72 agtgct S 73 agtgc t a 74 agttgcaact 0 75 ataaagcgaaac tagcagcagtt tc 0 76 ataacgtt 0 77 ataatagagctt caagcaag S 78 ataatccagcttgaaccaag S 79 ataatcgacgtt caagcaag S 80 ataatcgacgtt cccccccc S 81 ataat cgtcgtt caagcaag S 82 ataatcgtgcgtt caagaaag S 83 atagacaaaaatt ccct ccccggagcc 0 84 atatatatatat at at at S 85 atatctaatcaaaacattaacaaa 0 86 at caggaacgtcatgggaagc 0 87 atcgacctacgtgcgtt ct c 0 88 atcgacct acgtgcgtt z tc 0 89 atcgactcgagcgt tctc 0 90 atcgact ctcgagcgt tctc 0 91 at cgactct cgagcgttct c sos 92 atcgact ctcgagtgttctc 93 at cgact ct cgagzgtt ct c o 94 atcgact ctctcgagcgttctc 95 atcgactt cgagcgttctc o 96 atcgat cgagcgtt ctc o 97 at cgatgt o 98 atcggaggactggcgcgccg 99 at ctggtgagggcaagct atg 100 atgacgttcctgacgtt S 101 atgcactctgcagcgttctc 102 atgcatgt o 103
-48 -SEQUENCE BACKBONE SEQ ID NO:
atgcccctcaacgtt o 104 atgctaaaggacgtcacattgca o 105 atggaa.ggtccacgttctc o 106 atggaaggtccagcgttct o 107 atggaaggtccagogttctc o 108 atggaaggtccagtgttctc o 109 atggaaggtcgagcgttctc o 110 atggactctccagcgttctc o 111 atgtcctcggtcctgatgct o 112 atgtttactagacaaaattcccccagaatgttt o 113 atgtttacttcttaaaattcccccagaatgttt o 114 at tcgatcggggcggggcgag o 115 at zgacctacgtgcgttctc o 116 atzgactctzgagzgttctc o 117 batggaaggtccagcgttctc o 118 bgagaacgctccagcactgat o 119 bgagaacgctcgaccttcgat o 120 bgagaazgctccagcactgat o 121 bgagaazgctcgaccttcgat o 122 bgagcaagctggaccttccat o 123 bgagcaagztggaccttccat o 124 bgctagacgttagcgtga o 125 btcaacgtt o 126 btccatgacgttcctgatgct o 127 btccatgagcttcctgatgct o 128 btccattccatgacgttcctgatgcttcca os 129 btccattccattetaggcctgagtcttccat os 130 btcgtcgttttgtcgttttgtcgttttttt os 131 btttttccatgtcgttcctgatgcttttt Os 132 _ btttttcgtcgttcccccccccccc os 133 caaacgtt o 134 caacgtt o 135 caagagatgctaacaatgca s 136 caatcaatctgaggagaccc 137 cacaccttggtcaatgtcacgt o 138 caccaccttggtcaatgtcacgt o 139 cacggtagccttccta 140 cacgttgaggggcat s 141 cactgtccttcgtcga sos 142 cagacacagaagcccgatagacg 143 cagattgtgcaatgtctcga o 144 cataacataggaatatttactcctcgc o 145 cataggatctcgagctcggaaagtcccctac o 146 catgagctcatctggaggaagcgg o 147 catttccacgatttccca o 148 cattttacgggcgggcgggc 149 ccaaatatcggtggtcaagcac 150 .
ccaacgtt s 151 .
ccacgtcgaccctcaggcga s 152 ccacgtggacctctagc o 153 ccactcacatctgctgctccacaag o 154 _ ccagatgagctcatgggtttctcc o 155 _ ccaggttaagaggaaatgacttcggg o 156 ccaggttgtatagaggc 157 ccagtgctgatcaccgatatcctgttcggcagtcg 158 _
atgcccctcaacgtt o 104 atgctaaaggacgtcacattgca o 105 atggaa.ggtccacgttctc o 106 atggaaggtccagcgttct o 107 atggaaggtccagogttctc o 108 atggaaggtccagtgttctc o 109 atggaaggtcgagcgttctc o 110 atggactctccagcgttctc o 111 atgtcctcggtcctgatgct o 112 atgtttactagacaaaattcccccagaatgttt o 113 atgtttacttcttaaaattcccccagaatgttt o 114 at tcgatcggggcggggcgag o 115 at zgacctacgtgcgttctc o 116 atzgactctzgagzgttctc o 117 batggaaggtccagcgttctc o 118 bgagaacgctccagcactgat o 119 bgagaacgctcgaccttcgat o 120 bgagaazgctccagcactgat o 121 bgagaazgctcgaccttcgat o 122 bgagcaagctggaccttccat o 123 bgagcaagztggaccttccat o 124 bgctagacgttagcgtga o 125 btcaacgtt o 126 btccatgacgttcctgatgct o 127 btccatgagcttcctgatgct o 128 btccattccatgacgttcctgatgcttcca os 129 btccattccattetaggcctgagtcttccat os 130 btcgtcgttttgtcgttttgtcgttttttt os 131 btttttccatgtcgttcctgatgcttttt Os 132 _ btttttcgtcgttcccccccccccc os 133 caaacgtt o 134 caacgtt o 135 caagagatgctaacaatgca s 136 caatcaatctgaggagaccc 137 cacaccttggtcaatgtcacgt o 138 caccaccttggtcaatgtcacgt o 139 cacggtagccttccta 140 cacgttgaggggcat s 141 cactgtccttcgtcga sos 142 cagacacagaagcccgatagacg 143 cagattgtgcaatgtctcga o 144 cataacataggaatatttactcctcgc o 145 cataggatctcgagctcggaaagtcccctac o 146 catgagctcatctggaggaagcgg o 147 catttccacgatttccca o 148 cattttacgggcgggcgggc 149 ccaaatatcggtggtcaagcac 150 .
ccaacgtt s 151 .
ccacgtcgaccctcaggcga s 152 ccacgtggacctctagc o 153 ccactcacatctgctgctccacaag o 154 _ ccagatgagctcatgggtttctcc o 155 _ ccaggttaagaggaaatgacttcggg o 156 ccaggttgtatagaggc 157 ccagtgctgatcaccgatatcctgttcggcagtcg 158 _
- 49 -SEQUENCE BACKBONE SEQ
ID NO:
ccatcgat 0 159 ccatgcat 0 160 ccatgctaacctctagc 0 161 ccatgtcggtcctgatgct 0 162 ccccaaagggatgagaagtt 0 163 cccccaaaaaaaaaaccccc o 164 cccccc s 165 cccccccc s 166 cccccccccccc S 167 cccccccccccccccccccc S 168 cccccccccccccccccccc sos 169 cccccccccccccccccccccccc S 170 cccccccccccccccccccccccccocc 5 171 cccccccccccccccecccccccccaccccccccc S 172 ccccttgacgttttcccccc sos 173 cccgaagtcatttcctcttaacctgg o 174 ccgaacaggatatcggtgatcagcac 175 ccgcttcctccagatgagctcatg o 176 ccgcttcctccagatgagctcatgggtttctccaccaag 0 177 ccggccggccggccggccgg o 178 ccgtcgttcccccccccccc o 179 cctacgttgtatgcgcccagct 0 180 cctccaaatgaaagaccccc 181 cctctatacaacctgggac 182 ccttccatgtcggtcctgat sos 183 ccttcgat o 184 cgaacgtt o 185 cgacga o 186 cgacgt S 187 cgactctcgagcgttctc 0 188 cgactgccgaacaggatatcggtgatcagcactgg 189 cgccgtcgcggcggttgg 0 190 cgcctggggctggtctgg 0 191 cgcgcgcgcgcgcgcgcgcg S 192 cgcgcgcgcgcgcgcgcgcg o 193 cgcgta 5 194 cgctagaggttagegtga 0 195 cgctggaccttccat o 196 cgctggaccttccatgtcgg sos 197 cggctgacgtcatcaa 5 198 cgggcgactcagtctatcgg 199 cgggcttacggcggatgctg 200 cggtagccttccta 201 cgtaccttacggtga 0 202 cgta.cg S 203 cgtcga S 204 cgtcga 205 cgtcgt S 206 cgtcgtcgt 0 207 cgtcgtcgtcgtcgtcgtcgt S 208 cgtctatcgggcttctgtgtctg 209 cgttcg 5 210 ctaacgtt 211 ctaatctttctaatttttttctaa S 212 ctagataaagcggaaccagcaacagacacagaagccccgatagag o 213 SEQUENCE BACKBONE SEQ ID
NO:
ctagcgct o 214 ctagcggctgacgtcataaagctagc S 215 ctagcggctgacgtcatcaagctag 0 216 ctagcggctgacgtcatcaatctag 0 217 ctagcggctgagctcataaagctagc S 218 ctagcttgatgacgtcagccgctag 0 219 ctagcttgatgagctcagccgctag 0 220 ctagctttatgacgtcagccgctagc 5 221 ctaggctgacgtcatcaagctagt 0 222 ctagtggctgacgtcatcaagctag 5 223 ctatcggaggactggcgcgcc 224 ctatcggaggactggcgcgccg 225 ctcaacgctggaccttccat a 226 ctcatgggtttctccaccaag a 227 ctccagctccaagaaaggacg o 228 ctcgccccgccccgatcgaat o 229 ctctccaagctcacttacag 230 ctctctgtaggcccgcttgg 5 231 ctcttgcgacctggaaggta 232 ctgacgtcat 0 233 ctgacgtg 234 ctgattgctctctcgtga sos 235 ctgattgctctctcgtga 0 236 ctgcagcctgggac o 237 ctgcgttagcaatttaactgtg a 238 ctgctgagactggag 239 ctgctgctgctgctgctgctg S 240 ctggaccttccatgtc sos 241 ctggaccttccatgtcgg sop 242 ctggtctttctggtttttttctgg 5 243 ctggtctttctggtttttttctgg a 244 ctgtaagtgagcttggagag 245 ctgtatgaaacaaattttcctctttgggca 0 246 ctgtca 5 247 ctgtcaggaactgcaggtaagg 0 248 ctgtcccatatttttagaca 249 ctgtcg S 250 ctgtcg a 251 ctgtcgttcccccccccccc 0 252 ctgtgctttctgtgtttttctgtg 5 253 cttggagggcctcccggcgg 254 cttggtggagaaacccatgag 0 255 cttggtggagaaacccatgagctcatctggaggaagcgg 0 256 ctttccgttggacccctggg 5 257 czggczggczgggczccgg a 258 faacgttga 0 259 fcgcgaattcgcg 0 260 ftcaacgtt a 261 gaaacgtt a 262 gaaactgctgctagtttcgctttat a 263 gaaccttccatgctgtt 264 gaaccttccatgctgttccg 265 gaacgctggaccttccat 266 gaagttcacgttgaggggcat 0 267 gaagtttctggtaagtcttcg 0 268 EZE o 5a6gpoE.
= Es 6q.qBp-e64-ea6 = E 0 3-e54eo.6 OZE sos qp.6p64q..6p.e5q-eD6 Sgo6.2.6qq.Bae.64pDE.
8T E sos qab-e6q.q.Boae.TeD.6 LIE
p.66.6ap.66ÃqooppopTegaqp36-205 SpEDaBpa6apaq.6oTeopo6 ST E
0joBgq:eq.epaB
= E 0 cp.6.4q.ezepa.6 LIE 0 E.oppoB
o6Ereqq3q:eoga.6a6q.q3ppoqq:e6 .6Boa6poq&e6q.p.645.eqoq-eb OIL
Boa63.6o564op.6.6s6Bogv5 60E sos 63q.a.6Tepqa4p64o6oTe5 .6.2qopoqvagae.6-406.6paTeB
6p3pa45.e3aqp.6 90E 0 5q34-euEe3BB.q.aap.6q.B-eovaq..6.epoq.e.6 SO E
04v5.643.e.645gaup4Be54a6qoqq.e5upaq.p6 f70E
0Te5.6qop5q..6qopaq.5.6-epobgaggp5Pooq.-e6 a5.66opq.qqq-eao-e65.66-e6 DvEcre66TET.66.66-e.6 0.2.66gEog6o.e.e.65-e5p66-4-23.4.6opp.65a6-e56.4PDq.BoPp6.6p5 cpppaggoop.65q.D.6p-eDEreS
3aqqoap664oBv-ea6p.6 qp5aqqaps6oqa6oap5.26 oaqqapp.66q.DEapp.6.e.6 opP.6.6q.a6Tes6p6 0qupagEBEgoBapp.6p.6 t,6Z0 oqgzoP66.436appEv.6 04poogq.D.2.6.6.43.6app5a6 0TeDameoqoBaeBEgaBapp5u6 aP.6.6q.D6a-e-e6p.6 0Pg5aggapP5.6ga6appEre5 683 0 63qq3D-E5Eg3bapP6e.6 z6qpooqqoae.6.6qoba-ere.6-a6 oqqoas65qa6apP6p.6 zepagg3oP.6.6go53pp6e5 paggooe.6.6qaBopp.6p6 = Z
TeaDgPogoopEZqaBov.e.6p6 pozeaTeaq.DaPE6q3Baev.6p6 pooqpqaaPB.64a6opp.6p6 183 Scp-eBog.gooPEogo6app.6.E6 Das5343.63sebp.6 5o4q.posSaoq.D5opp.6-e5 6oqqoBPDaq.o6oppae6 pErepaqo63e.e.6-e6 0q.pooqqoaeoaqaBoPuBp.6 SL
qpq.oqqoaP6pqaBop.e.6-e.6 PLZ
gypoggooPEBTaSaps5.25 5paq6aeEqopE.
3/2 Teog6o.e5 64aD46.6DgEr4p4pq.qoae6 qp5qaoq..653q.B.4-epagqoapB
gpaoqqaa.e.5 :ON ca bus HNOEDIDVEE aoNanbas - IS -e tSIOZ/IOSII/I3c1 178L6/I0 OM
L3-TT-3003 TLEOTT730 'VD
8L E o q535e4g5z.e6eq.3.6 LLE . o p.6q.Bo5pq.q.5q.P6Pq.DE, 9LE s SLE o gBoBpq.q..6.4.2.6.eqa6 T7LE o q.53-e.eq.q5q.P.5.egoB
ELE s p.6q..6oEreq.q.6.Ere.6Pq.o.6 ZLE o p5q.606-eq.q.6.6pEreq.a6 ILE o p5q6abt,qq.o6P.6P4o5 OLE o 05.2.4q.4.6aPaeq.3.6 69E o .4.6z.Ereqq6De5Pq.DE.
89E o q.6q.6.egq.5aPErego6 L9E o p.6q.06.6pTA.6a.e6.24a5 99E sos P.6.6go.6.egg.6o-e6eqa6 59E o p6.6.4o6P4gEop.Ere4D6 "e5q6a6se q z6a.e.6.2g DE.
E9E o q..6o6vqq.5aP5u.q.p.6 Z9E o 3.6P4q6op.6o.6 19E o 3Ereq.aq6asEreq.36 09E o pBq..5a6p-eq..6opEeq.pE.
, 65E o qbae.6e4o.5 85E o P6q5a6pgpEopEego.6 LSE o .46DEveq..e5oEB.eq.o.6 95E o P5q.5a6Pqqa.eq.3.6 SSE o vEq..6z,Ereq.qoaPqa.6 T7SE o .e.645a6Pq.q.aaegoE.
ESE o .e6z6a6Pq..463.e.eqa.5 ZSE o q..6DB.eqq.6ape.eq.D6 TSE s 605q4q4gq4T4506 OSE s qq.5oq.6q.q.5aq.5q.q6o6q5o5 6E o oaappoopoopogq5oz6D6 8E s oaa.6a6o6a6Boq.q.6aÃ.63.6 LE s apaeo6a6a56a6q636.6a5 9E s Daabo.636D563q.E.BoS6DB
SE s oaa6DE.35D56355.6a66a6 T7PE o paa6o5a6DE.6a6.6.53.6.63.6 e6q.a36eq.65Daeqo63.6 ZT7E o .6o5D5a6a6p6a6pEo6a6 -EVE
OP6pqa6aDqopq6pao6D6 OVE o q.35-4..e6q.oaqq.6pq..6q.p5a6 6EE o .6364e64aDqq6aq..6.Te.636 8EE s pa36353.6a5.6o-A.q.6ae636 LEE s oaa6a6a63Ã5a6q6D'e.63.6 .9EE s 333.60636o6.63;65apEo.6 SEE s 333.63.6a636.6a6.66635 VEE s 3q.3333aq.q.E.q.aseBo-e6.6q.p336 EEE o u.6.6q.o6p44.6qp.6vaa6 ZEE
.E.Teoaq.Eq.qa.e=ep=eaaeao6 TEE o qp.EreS6p5oq..44-e35 OEE sos go.6.e.6qq.5a6gTe35 6ZE o TeeEeeaBB.6aBBeoTeoqqeoh 8E sos q.pEceEq.q.E.aq.Bg.paE, LE o go6pEr4oEreqEq.po5 9E sos qp5e6q..46o6E.Te35 SZE o q.aae.6qq..6zp.6TeD5 T7ZE o q.DEre.6T464pEq..eo.6 :om ca bas '31\10EDIDVEL aomanbas - Zg -tSIOZ/IOSII/I3c1 178L6/I0 OM
LZ-TT-ZOOZ TLEOTVZO 'VD
SEQUENCE BACKBONE SEQ
ID NO:
gctagazgttagtgt o 379 gctagctttagagctttagagctt o 380 gctaggcgttagcgt 0 381 gctagtcgatagc a 382 gctagtcgatagcgt 0 383 gctagtcgctagc 0 384 gctandcghhagc o 385 gctatgacgttccaaggg S 386 gctcga S 387 gctcgttcagcgcgtct sos 388 gctgaaccttccatgctgtt 389 gctgagctcatgccgtctgc sos 390 gctggaccttccat 391 gctggaccttccat 0 392 gctggccagcttacctcccg 393 gctgtaaaatgaatcggccg sos 394 gctgtggggeggctcctg 5 395 gcttgacgtcaagc a 396 gcttgacgtctagc o 397 gcttgacgtttagc a 398 gcttgcgttgcgttt sos 399 gcttggagggcctgtaagtg 400 ggaacgtt a 401 ggaagacgttaga a 402 ggaattagtaatagatatagaagtt a 403 ggagaaacccatgagctcatctgg a 404 ggagctcttcgaacgccata 405 ggcagtgcaggctcaccggg 406 ggccaactttcaatgtgggatggcctc 407 ggccatcccacattgaaagtt 408 ggccttttcccccccccccc 0 409 ggcggcggcggcggcggcgg o 410 ggcgttattcctgactcgcc a 411 ggctatgtcgatcctagcc a 412 ggctatgtcgttcctagcc 0 413 ggctccggggagggaatttttgtctat 0 414 ggctgtattcctgactgccc 5 415 gggaatgaaagattttattataag 0 416 ggggactttccgctggggactttccagggggactttcc sos 417 ggggagggaggaacttcttaaaattcccccagaatgttt a 418 ggggagggg 5 419 ggggagggt 5 420 ggggcatgacgttcaaaaaa 5 421 ggggcatgacgttcaaaaaa sos 422 ggggcatgacgttcgggggg s2 423 =
ggggoatgacgtt cgggggg sos 424 ggggc atgagc t t c gggggg s 425 ggggcatgagcttcgggggg SOS 426 ggggcctctatacaacctggg 427 gggggacgttggggg a 428 gggggggg9g9g9g9ggggg sos 429 g999ggggaggggggggggg 0 430 ggggggttggggaaaacccggactecctgca a 431 gggggttttttttttggggg 432 ggggtaatcgatcagggggg 55 433 VIM) 01/97843 SEQUENCE BACKBONE SEQ
ID NO:
ggggtaatcgatgagggggg 0 434 ggggtaatgcatcagggggg sos 435 ggggtcaacgttgagggggg sos 436 ggggtcaacgttgagggggg 5 437 ggggtcaagcttgagggggg sos 438 ggggtcaagtctgagggggg sos 439 ggggtccagcgtgcgccatggggg sos 440 ggggtccctgagactgcc 441 ggggtcgaccttggagggggg sos 442 ggggtcgacgtcgagggggg S 443 ggggtcgtcgttttgggggg 444 ggggtctgtcgttttgggggg sos 445 ggggtctgtgcttttgggggg sos 446 ggggtgacgttcagggggg sos 447 ggggtgtcgttcagggggg sos 448 ggggttgacgttttgggggg sos 449 ggggttgggggtt 450 ggtacctgtggggacattgtg 0 451 ggtgaggtg S 452 ggtggtgtaggttttgg o 453 ggttacggtctgtcccatat 454 ggttcacgtgctcatggctg 0 455 gtaacgtt o 456 gtagccttccta 457 gtaggggactttccgagctcgagatcctatg 0 458 gtcactcgtggtacctcga S 459 gtccatggcgtgcgggatga 460 gtcccaggttgtatagaggctgc 461 gtccccatttcccagaggaggaaat 0 462 gtccgggccaggccaaagtc 5 463 gteggtcctgatgctgttcc sos 464 gtctatcggaggactggcgc 465 gtctgtcccatgatctcgaa 466 gtgaaticgttcicgggict o 467 gtgccggggtctccgggc S 468 gtgccggggtctccgggc o 469 gtgcgcgcgagcccgaaatc 5 470 gtgctgatcaccgatatcctgttcgg 471 gtgcttgaccaccgatatttgg 472 gtggttacggtcgtgcccat 473 gtgtcggggtctccgggc 474 gttctcagataaagcggaaccagcaacagacacagaa 475 gttgaaacccgagaacatcat S 476 gttggatacaggccagactttgttg 0 477 gtttttatataatttggg o 478 gzaatattgcb 0 479 gzggzgggzggzgzgzgccc 480 taaacgtt 5 481 taagcgct o 482 taagctctgtcaacgccagg 483 taccgagcttcgacgagatttca 0 484 _taccgcgtgcgaccctct S 485 tactcttcggatcccttgcg sos 486 tagaaacagcattcttcttttagggcagcaca 487 tagacgtc 488 SEQUENCE BACKBONE SEQ
ID NO:
tagacgttagcgtga 0 489 tatagtccctgagactgccccaccttctcaacaacc 490 tatcggaggactggcgcgccg 491 tatgccgcgcccggacttat sos 492 tcaaatgtgggattttcccatgagtct o 493 tcaacg s 494 tcaacgtc o 495 tcaacgtt p-ethoxy 496 tcaacgtt S 497 tcaacgtt 0 498 tcaacgttaacgttaacgtt o 499 tcaacgttaacgttaacgttaacgttaacgttb S 500 tcaacgttga 5 501 tcaacgttga 0 502 tcaacgttgab o 503 tcaacgttgaf o 504 tcaagctt p- ethoxy 505 tcaagctt 0 506 tcaatgctgaf o 507 tcaazgtt 0 508 tcaazgttgab o 509 tcaccggt S 510 tcacgctaacctctagc o 511 tcacgctaacctctgac o 512 tcacgctaacgtctagc o 513 tcacgt o 514 tcagaccacgtggtcgggtgttcctga o 515 tcagaccagctggtcgggtgttcctga o 516 tcagcgct 0 517 tcagcgtgcgcc S 518 tcagctctggtactttttca 519 tcaggaacacccgaccacgtggtctga o 520 tcaggaacacccgaccagctggtctga 0 521 tcaggggtggggggaacctt sos 522 tcagzgct o 523 tcatcgat 0 524 tccaagacgttcctgatgct 0 525 tccaagtagttcctagttct 0 526 tccaccacgtggctgatgct o 527 tccaccacgtggtctatgct S 528 tccacgacgttttcgacgtt s 529 tccagacggtgaagt o 530 tccagacgttgaagt 531 tccagagcttgaagt o 532 tccagcgtgcgccata sos 533 tccaggacgttcctagttct 534 tccaggacttctctcaggtt 535 tccaggacttctctcaggtt sos 536 tccaggactttcctcaggtt 5 537 tccaggactttcctcaggtt 0 538 tccaggagcttcctagttct 0 539 tccaggatgttcctagttct o 540 tccagtctaggcctagttct 541 tccagttccttcctcagtct 0 542 tccagttcgagcctagttct 0 543 VIM) 01/97843 PCT/US01/20154 SEQUENCE BACKBONE SEQ
ID NO:
tccataacgttcctgagtct sos 544 tccataacgttcctgatgct o 545 tccatagcgatcctagcgat o 546 tccatagcggtcctagcggt o 547 tccatagcgttcctagcgtt s 548 tccatagcgttcctagcgtt o 549 tccatcacgtgcctgagtct sos 550 tccatgacattcctgatgct o 551 tccatgacggtcctgacggt s 552 tccatgacggtcctgacggt o 553 tccatgacggtcctgagtct sos 554 tccatgacggtcctgatgct o 555 tccatgacgtccctgagtct sos 556 tccatgacgtccctgatgct o 557 tccatgacgttcctagttct o 558 tccatgacgttcctctccatgacgttcctctccatgacgttcctc o 559 tccatgacgttcctgacgtt s 560 tccatgacgttcctgacgtt 561 tccatgacgttcctgacgtt sos 562 tccatgacgttcctgacgtt o 563 tccatgacgttcctgagtct sos 564 tccatgacgttcctgatcc 565 tccatgacgttcctgatgct o 566 tccatgacgttcctgatgct s 567 tccatgacgttcctgcagttcctgacgtt s 568 tccatgacgttcctgccgtt s 569 tccatgacgttcctgcgttt s 570 tccatgacgttcctggcggg s 571 tccatgacgttcztgatgct o 572 tccatgagcttcctgagctt s 573 tccatgagcttcctgagtct o 574 tccatgagcttcctgagtct p-ethoxy 575 tccatgagcttcctgagtct s 576 tccatgagcttcctgatgct s2 577 tccatgagcttccttgagtct 578 tccatgaigttcctgaigtt s 579 tccatgatgttcctagttct o 580 tccatgazgttcctagttct o 581 tccatgazgttcctgatgct o 582 tccatgazgttcctgazgtt s 583 tccatgccggtcctgagtct sos 584 tccatgccggtcctgatgct o 585 tccatgccggtcctgccggt o 586 tccatgccgttcctgccgtt s 587 tccatgccgttcctgccgtt o 588 tccatgcgcgtcctgcgcgt o 589 tccatgcgtgcgtgcgtttt s 590 tccatgcgttgcgttgcgtt s 591 tccatgctggtcctgagtct sos 592 tccatgctggtcctgatgct o 593 tccatggcgggcctggcggg s 594 tccatggcggtcctgatgct o 595 tccatgtagttcctagttct o 596 tccatgtccttcctgatgct 597 tccatgtcgatcctgagtct sos 598 SEQUENCE BACKBONE SEQ
ID NO:
tccatgtcgatcctgatgct o 599 tccatgtcgctcctgagtct sos 600 tccatgtcgctcctgatcct o 601 tccatgtcggtcctgagtct sos 602 tccatgtcggtcctgatgct 603 tccatgtcggtcctgatgct s 604 tccatgtcggtcctgctgat o 605 tccatgtcggtzctgatgct o 606 tccatgtcgttccgcgcgcg o 607 tccatgtcgttcctagttct 608 tccatgtcgttcctgagtct sos 609 tccatgtcgttcctgatgcg o 610 tccatgtcgttcctgatgct o 611 tccatgtcgttcctgccgct o 612 tccatgtcgttcctgtagct o 613 tccatgtcgttcctgtcgtt s 614 tccatgtcgttcctgtcgtt o 615 tccatgtcgtttttgtcgtt s 616 tccatgtgcttcctgatgct o 617 tccatgtzggtcctgagtct sos 618 tccatgtzggtcctgatgct o 619 tccatgtzgttcctgatget o 620 tccatgtzgttcctgtzgtt s 621 tccattgcgttccttgcgtt o 622 tcccgacggtgaagt o 623 tcccgccgttgaagt o 624 tcccgcgcgttccgcgcgtt s 625 tccctgagactgccccacctt 626 tccgatcg o 627 tccggacggtgaagt o 628 tccggccgttgaagt o 629 tccgtacg o 630 tcctaacgttgaagt 0 631 tcctagcgttgaagt o 632 tcctcacgttgaagt o 633 tcctga o 634 tcctgaaaaggaagt s 635 tcctgacgatgaagt o 636 tcctgacgctgaagt o 637 tcctgacggggaagt o 638 tcctgacggggaagt s 639 tcctgacggggagt s 640 tcctgacggtgaagt o 641 tcctgacggtgaagt s 642 tcctgacgtagaagt o 643 tcctgacgtcgaagt o 644 tcctgacgtggaagt o 645 tcctgacgtggaagt s 646 tcctgacgttaga o 647 tcctgacgttccc o 648 tcctgacgttcccctggcggtcccctgtcgct o 649 tcctgacgttcctgacgtt s 650 tcctgacgttcctggcggtcctgtcgct o 651 tcctgacgttccttc o 652 _ tcctgacgttcggcgcgcgccc s 653 SEQUENCE BACKBONE
SEO ID NO: .
tcctgacgttgaagt o 654 _ tcctgacgttgaagt s 655 tcctgagcttgaagt o 656 tcctgagcttgaagt s 657 tcctgazgttgaagt o 658 tcctgccgttgaagt o 659 tcctgccgttgaagt s 660 tcctggaggggaagt o 661 _ tcctggaggggaagt s 662 tcctggcggggaagt o 663 tcctggcggggaagt s 664 tcctggcggtcctggcggtt s 665 tcctggcggtgaagt o 666 tcctggcggtgaagt s 667 tcctggcgtggaagt s 668 tcctggcgttgaagt o 669 tcctggcgttgaagt s 670 t cc tgggggggaagt o 671 tcctggtggggaagt o 672 tcctggzggggaagt o 673 tcctgtcgctcctgtcgct o 674 tcctgtcgctcctgtcgctcctgtcgct o 675 tcctgtcgttcctgtcgtt s 676 tcctgtcgttcctgtcgttggaacgacagg o 677 tcctgtcgttcctgtcgtttcaacgtcaggaacgacagga o 678 tcctgtcgttccttgtcgtt s 679 tcctgtcgttgaagt o 680 tcctgtcgttgaagtttttt o 681.
tcctgtcgttttttgtcgtt s 682 tccttacgttgaagt o 683 tccttgtcgttcctgtcgtt s 684 tcgacgtc o 685 tcgacgttcccccccccccc o 686 tcgagacattgcacaatcatctg o 687 tcgccgttcccccccccccc 0 688 tcgcgtgcgttttgtcgttttgacgtt s 689 tcgga o 690 tcggcgttcccccccccccc o 691 tcgtag s 692 tcgtca o 693 tcgtcattcccccccccccc o 694 tcgtcgatcccccccccccc o 695 tcgtcgctcccccccccccc o 696 tcgtcgctgtctccg s 697 tcgtcgctgtctccgcttctt s 698 tcgtcgctgtctccgcttctt so 699 tcgtcgctgtctccgcttctt 52o 700 tcgtcgctgtctccgcttcttcttgcc s 701 tcgtcgctgtctgcccttctt s 702 tcgtcgctgttgtcgtttctt s 703 _ tcgtcggtcccccccccccc o 704 tcgtcgtcagttcgctgtcg sos 705 tcgtcgtcgtcgtcgtcgtcgtt sos 706 tcgtcgtcgtcgtt s 707 tcgtcgtcgtcgtt s2 708 SEQUENCE BACKBONE SEQ ID
NO:
tcgtcgtcgtcgtt s20 709 tcgtcgtcgtcgtt os2 710 tcgtcgttccccccccc s 711 tcgtcgttcccccccccccc o 712 -tcgtcgttcoccccoccoccb o 713 tcgtcgttccccccczcccc o 714 tcgtcgttggtgtcgttggtgtcgtt s 715 tcgtcgttggttgtcgttttggtt s 716 tcgtcgttgtcgttgtcgtt s 717 tcgtcgttgtcgttgtcgtt sos 718 tcgtcgttgtcgttttgtcgtt s 719 tcgtcgttgtcgttttgtcgtt sos 720 tegtcgtttcgtcgttttgacgtt s 721 tcgtcgtttgcgtgcgtttcgtcgtt s 722 tcgtcgtttgtcgttttgtcgtt s 723 tcgtcgttttgacgttttgacgtt s 724 tcgtcgttttgacgttttgtcgtt s 725 tcgtcgttttgcgtgcgttt s 726 tcgtcgttttgtcgttttgggggg 727 tcgtcgttttgtcgttttgtcgt s2 728 tcgtcgttttgtcgttttgtcgtt s 729 tcgtcgttttgtcgttttgtcgtt sos 730 tcgtcgttttgtcgttttgtcgtt o 731 tcgtcgttttgtcgttttgtegtt s2 732 tcgtcgttttgtcgttttgtcgttb o 733 tcgtcgttttgtcgttttgtcgttttgtcgtt s 734 tcgtcgttttgtggttttgtggtt s 735 tcgtcgttttttgtcgttttttgtcgtt s 736 tcgtcgtttttttttttttt s 737 tcgtga s 738 tcgtga o 739 tcgtgg s 740 tcgtzgttcccccccceccc o 741 tcntcgtnttntcgtnttntcgtn s 742 tctaaaaaccatctattcttaaccct o 743 tctagcgtttttagcgttcc sos 744 tctatcccaggtggttcctgttag o 745 tctatcgacgttcaagcaag s 746 tctccatcctatggttttatcg 0 747 tctccatgatggttttatcg 748 tctcccagcgagcgagcgccat s 749 tctcccagcgagcgccat s 750 tctcccagcgcgcgccat s 751 tetcccagcgggcgcat s 752 tctcccagcgtacgccat s 753 tctcccagcgtcgccat s 754 tctcccagcgtgcgccat s 755 tctcccagcgtgcgccat o 756 tctcccagcgtgcgccatat sos 757 tctcccagcgtgcgcctttt sos 758 tctcccagcgtgcgtgcgccat s 759 tctcccagcgtgcgttatat sos 760 tctcccagcgtgcgtttt s 761 tctcccagcgttgcgccatat sos 762 tctcccatcgtcgccat s 763 SEQUENCE BACKBONE SEQ ID
NO:
tctcccgacgtgcgccat S 764 tctcccgtcgtgcgccat s 765 tctccctgcgtgcgccatat sos 766 tetcctagcgtgcgccatat sos 767 tctgacgtcatctgacgttggctgacgtct 0 768 tctgcgtgcgtgcgccatat sos 769 tcttcgaa 0 770 tcttgcgatgctaaaggacgtcacattgcacaatcttaataaggt 0 771 tctttattagtgactcagcacttggca 0 772 tcztgacgttgaagt 0 773 tgaacgtt 0 774 tgcaatgtgacgtcctttagcat 0 775 tgcaggaagtccgggttttccccaacccccc 0 776 tgcatcagctct 5 777 tgcatcagctct sos 778 tgcatcccccaggccaccat s 779 tgcatgccgtacacagctct sos 780 tgcatgccgtacacagctct 5 781 tgcatgccgtacacagctct o 782 tgcatgccgtgcatccgtacacagctct S 783 tgccaagtgctgagtcactaataaaga 0 784 tgcccaaagaggaaaatttgtttcatacag o 785 tgcgctct S 786 tgctagctgtgcctgtacct 787 tgctagctgtgcctgtacct s 788 tgctgcttcccccccccecc o 789 tgctgcttcccccccccccc s 790 tgctgcttttgtgcttttgtgctt o 791 tgctgcttttgtgcttttgtgctt s 792 tggaccttccat 793 tggaccttctatgteggtcc 794 tggagggtgagggtggggccagagcgggtggggctgattggaa 0 795 tggaggtcccaccgagatcggag 0 796 tggttacggtctgtcccatg 797 tgtatctctctgaaggact 0 798 tgtccagccgaggggaccat 799 tgtcccatgtttttagaagc 800 tgtcgttgtcgtt s 801 tgtcgttgtcgttgtcgttgtcgtt 5 802 tgtcgtttgtcgtttgtcgtt s 803 ttaacggtggtagcggtattggtc 0 804 ttaacgtt o 805 ttaagaccaataccgctaccaccg 0 806 ttaggacaaggtctagggtg 807 ttagggttagggttagggtt s2 808 ttcagttgtcttgctgcttagctaa 0 809 ttcatgccttgcaaaatggcg 810 ttccaatcagccccacccgctctggccccaccctcaccctcca o 811 ttccatgctgttccggctgg 812 ttccatgtcggtcctgat sos 813 ttccgccgaatggcctcaggatggtac 814 ttccgctttatctgagaaccatct 815 ttcctctctgcaagagact 0 816 ttcgggcggactcctccatt sos 817 ttcgggcggactcctccatt 0 818 SEQUENCE BACKBONE
SEQ ID NO:
_ ttcgtcgttttgtcgttttgtcgtt 5 ttctgtgtctgttgctggttccgctttatctgagaac ttgaaactgaggtgggac ttgccccatattttagaaac ttggggggggtt s ttgtactctccatgatggtt tttaccttttataaacataactaaaacaaa 0 tttgaatcctcagcggtctccagtggc 0 tttgaattcaggactggtgaggttgag o tttgaattccgtgtacagaagcgagaagc 0 tttgagaacgctggaccttc sos tttgcggccgctagacttaacctgagagata 0 tttgggcccacgagagacagagacacttc 0 tttgggcccgcttctcgcttctgtacacg 0 ttttctagagaggtgcacaatgctctgg o tttttggggggggggttttt 0 tttttttttttttf o tttttttttttttf so tttttttttttttttttt s tttttttttttttttttttt s tttttttttttttttttttt o ttttttttttttttttttttt s tttttttttttttttttttttttt s ttttttttttttttttttttttttttt s tzaacgtt o tzgtcgttcccccccccccc o tzgtcgttttgtcgttttgtcgtt o tzgtggttcccccccccccc o tzgtzgttttgtzgttttgtzgtt 0 tzgtzgttttgtzgttttgtzgtt S
In Table 4 with respect to sequences the letter symbols aside from a, c, t, and g are defined as follows: "b" indicates a biotin moiety attached to that end of the oligonucleotide when it is single and is listed on the 5' or 3' end of oligonucleotide; "d"
represents a, g, or t;
"f" represents fluorescein isothiocyanate (FITC) moiety attached to the 5' or 3' end of oligonucleotide; "h" represents a, c, or t; "i" represents inosine; "n"
represents any nucleotide; "z" represents 5-methylcytosine.
Also in Table 4 with respect to backbones the notations are defined as follows: "o"
represents phosphodiester; "os" represents phosphorothioate and phosphodiester chimeric with phosphodiester on 5' end; "os2" represents phosphorodithioate and phosphodiester chimeric with phosphodiester on 5' end; "p-ethoxy" represents p-ethoxy backbone (see, e.g., U.S. Patent No. 6,015,886); "po" represents phosphodiester; "s" represents phosphorothioate;
"s2" represents phosphorodithioate; "s2o" represents phosphorodithioate and phosphodiester chimeric with phosphodiester on 3' end; "so" represents phosphorothioate and phosphodiester chimeric with phosphodiester on 3' end; and "sos" represents chimeric phosphorothioate/phosphodiester with phosphorothioate at the 5' and 3' ends.
The nucleic acids are delivered in effective amounts. The term "effective amount" of a immunostimulatory nucleic acid refers to the amount necessary or sufficient to realize a desired biologic effect. For example, an effective amount of an immunostimulatory nucleic acid could be that amount necessary to cause activation of the immune system.
According to some aspects of the invention, an effective amount is that amount of an immunostimulatory nucleic acid and that amount of an antibody, which when combined or co-administered, results in the prevention or the treatment of the cancer. In some embodiments a synergistic w effect is observed. A synergistic amount is that amount which produces an anti-cancer response that is greater than the sum of the individual effects of either the immunostimulatory nucleic acid and the antibody alone. For example, a synergistic combination of an immunostimulatory nucleic acid and an antibody provides a biological effect which is greater than the combined biological effect which could have been achieved using each of the components (i.e., the nucleic acid and the antibody) separately. The biological effect may be the amelioration and or absolute elimination of symptoms resulting from the cancer. In another embodiment, the biological effect is the complete abrogation of the cancer, as evidenced for example, by the absence of a tumor or a biopsy or blood smear which is free of cancer cells.
The effective amount of immunostimulatory nucleic acid necessary to treat a cancer or in the reduction of the risk of developing a cancer may vary depending upon the sequence of the immunostimulatory nucleic acid, the backbone constituents of the nucleic acid, and the mode of delivery of the nucleic acid. The effective amount for any particular application can also vary depending on such factors as the cancer being treated, the particular immunostimulatory nucleic acid being administered (e.g., the nature, number or location of immunostimulatory motifs in the nucleic acid), the size of the subject, or the severity of the disease or condition. One of ordinary skill in the art can empirically determine the effective amount of a particular immunostimulatory nucleic acid and antibody combination without necessitating undue experimentation. Combined with the teachings provided herein, by choosing among the various active compounds and weighing factors such as potency, relative bioavailability, patient body weight, severity of adverse side-effects and preferred mode of administration, an effective prophylactic or therapeutic treatment regimen can be planned which does not cause substantial toxicity and yet is entirely effective to treat the particular subject.
Therapeutic doses of cancer therapies are well known in the field of medicine for the treatment of cancer. These dosages have been extensively described in references such as Remington's Pharmaceutical Sciences, 18th ed., 1990; as well as many other medical references relied upon by the medical profession as guidance for the treatment of cancer.
Therapeutic dosages of immunostimulatory nucleic acids have also been described in the art and methods for identifying therapeutic dosages in subjects are described in more detail herein.
Subject doses of the compounds described herein typically range from about 0.1 1..tg to 10 mg per administration, which depending on the application could be given daily, weekly, or monthly and any other amount of time therebetween. More typically mucosal or local doses range from about 10 pg to 5 mg per administration, and most typically from about 100 i-tg to 1 mg, with 2 - 4 administrations being spaced hours, days or weeks apart. More typically, immune stimulant doses range from 1 i_tg to 10 mg per administration, and most typically 10 i.tg to 1 mg, with daily or weekly administrations. Subject doses of the compounds described herein for parenteral delivery, wherein the compounds are delivered without another therapeutic agent are typically 5 to 10,000 times higher than the effective mucosal dose or for immune stimulant applications, and more typically 10 to 1,000 times higher, and most typically 20 to 100 times higher. More typically parenteral doses for these purposes range from about 101.1g to 5 mg per administration, and most typically from about 100 i_tg to 1 mg, with 2 - 4 administrations being spaced hours, days or weeks apart. In some embodiments, however, parenteral doses for these purposes may be used in a range of 5 to 10,000 times higher than the typical doses described above.
For any compound described herein the therapeutically effective amount can be initially determined from animal models, e.g., the animal models described herein. A
therapeutically effective dose can also be determined from human data for CpG
nucleic acids which have been tested in humans (human clinical trials have been initiated and the results publicly disseminated) and for compounds which are known to exhibit similar pharmacological activities. Higher doses may be required for parenteral administration, as described above. The applied dose can be adjusted based on the relative bioavailability and potency of the administered compound. Adjusting the dose to achieve maximal efficacy based on the methods described above and other methods as are well-known in the art is well within the capabilities of the ordinarily skilled artisan.
The formulations of the invention are administered in pharmaceutically acceptable solutions, which may routinely contain pharmaceutically acceptable concentrations of salt, buffering agents, preservatives, compatible carriers, adjuvants, and optionally other therapeutic ingredients.
For use in therapy, an effective amount of the nucleic acid can be administered to a subject by any mode that delivers the nucleic acid to a subject.
"Administering" the pharmaceutical composition of the present invention may be accomplished by any means known to the skilled artisan. Some routes of administration include but are not limited to oral, intranasal, intratracheal, inhalation, ocular, vaginal, rectal, parenteral (e.g., intramuscular, intradermal, intravenous or subcutaneous injection) and direct injection.
For oral administration, the compounds (i.e., nucleic acids and antibodies) can be delivered alone without any pharmaceutical carriers or formulated readily by combining the active compound(s) with pharmaceutically acceptable carriers well known in the art. The term "pharmaceutically-acceptable carrier" means one or more compatible solid or liquid filler, dilutants or encapsulating substances which are suitable for administration to a human or other vertebrate animal. The term "carrier" denotes an organic or inorganic ingredient, natural or synthetic, with which the active ingredient is combined to facilitate the application.
The components of the pharmaceutical compositions also are capable of being commingled with the compounds of the present invention, and with each other, in a manner such that there is no interaction which would substantially impair the desired pharmaceutical efficiency.
Such carriers enable the compounds of the invention to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions and the like, for oral ingestion by a subject to be treated. Pharmaceutical preparations for oral use can be obtained as solid excipient, optionally grinding a resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries, if desired, to obtain tablets or dragee cores. Suitable excipients are, in particular, fillers such as sugars, including lactose, sucrose, mannitol, or sorbitol; cellulose preparations such as, for example, maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose, hydroxypropylmethyl-cellulose, sodium carboxymethylcellulose, and/or polyvinylpyrrolidone (PVP). If desired, disintegrating agents may be added, such as the cross-linked polyvinyl pyrrolidone, agar, or alginic acid or a salt thereof such as sodium alginate. Optionally the oral formulations may also be formulated in saline or buffers for neutralizing internal acid conditions.
Dragee cores may be provided with suitable coatings. For this purpose, concentrated sugar solutions may be used, which may optionally contain gum arabic, talc, polyvinyl pyrrolidone, carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures. Dyestuffs or pigments may be added to the tablets or dragee coatings for identification or to characterize different combinations of active compound doses.
Pharmaceutical preparations which can be used orally include push-fit capsules made to of gelatin, as well as soft, sealed capsules made of gelatin and a plasticizer, such as glycerol or sorbitol. The push-fit capsules can contain the active ingredients in admixture with filler such as lactose, binders such as starches, and/or lubricants such as talc or magnesium stearate and, optionally, stabilizers. In soft capsules, the active compounds may be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycols. In addition, stabilizers may be added. Microspheres formulated for oral administration may also be used. Such microspheres have been well defined in the art. All formulations for oral administration should be in dosages suitable for such administration.
For buccal administration, the compositions may take the form of tablets or lozenges formulated in conventional manner.
For administration by inhalation, the compounds for use according to the present invention may be conveniently delivered in the form of an aerosol spray, from pressurized packs or a nebulizer, with the use of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas. In the case of a pressurized aerosol the dosage unit may be determined by providing a valve to deliver a metered amount. Capsules and cartridges of e.g., gelatin for use in an inhaler or insufflator may be formulated containing a powder mix of the compound and a suitable powder base such as lactose or starch.
The compounds, when it is desirable to deliver them systemically, may be formulated for parenteral administration by injection, e.g., by bolus injection or continuous infusion.
Formulations for injection may be presented in unit dosage form, e.g., in ampoules or in multi-dose containers, with an added preservative. The compositions may take such forms as suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
Pharmaceutical formulations for parenteral administration include aqueous solutions of the active compounds in water-soluble form. Additionally, suspensions of the active compounds may be prepared as appropriate oily injection suspensions. Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acid esters, such as ethyl oleate or triglycerides, or liposomes. Aqueous injection suspensions may contain substances which increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran. Optionally, the suspension may also contain suitable stabilizers or agents which increase the solubility of the compounds to allow for the preparation of highly concentrated solutions.
Alternatively, the active compounds may be in powder form for constitution with a suitable vehicle, e.g., sterile pyrogen-free water, before use.
The compounds may also be formulated in rectal or vaginal compositions such as suppositories or retention enemas, e.g., containing conventional suppository bases such as cocoa butter or other glycerides.
In addition to the formulations described previously, the compounds may also be formulated as a depot preparation. Such long acting formulations may be formulated with suitable polymeric or hydrophobic materials (for example as an emulsion in an acceptable oil) or ion exchange resins, or as sparingly soluble derivatives, for example, as a sparingly soluble salt.
The pharmaceutical compositions also may comprise suitable solid or gel phase carriers or excipients. Examples of such carriers or excipients include but are not limited to calcium carbonate, calcium phosphate, various sugars, starches, cellulose derivatives, gelatin, and polymers such as polyethylene glycols.
Suitable liquid or solid pharmaceutical preparation forms are, for example, aqueous or saline solutions for inhalation, microencapsulated, encochleated, coated onto microscopic gold particles, contained in liposomes, nebulized, aerosols, pellets for implantation into the skin, or dried onto a sharp object to be scratched into the skin. The pharmaceutical compositions may also include granules, powders, tablets, coated tablets, (micro)capsules, suppositories, syrups, emulsions, suspensions, creams, drops or preparations with protracted release of active compounds, in whose preparation excipients and additives and/or auxiliaries such as disintegrants, binders, coating agents, swelling agents, lubricants, flavorings, sweeteners or solubilizers are customarily used as described above. The pharmaceutical compositions are suitable for use in a variety of drug delivery systems. For a brief review of present methods for drug delivery, see Langer R, Science 249:1527-33 (1990).
The nucleic acids and/or antibodies may be administered per se (neat) or in the form of a pharmaceutically acceptable salt. When used in medicine the salts should be pharmaceutically acceptable, but non-pharmaceutically acceptable salts may conveniently be used to prepare pharmaceutically acceptable salts thereof. Such salts include, but are not limited to, those prepared from the following acids: hydrochloric, hydrobromic, sulphuric, nitric, phosphoric, maleic, acetic, salicylic, p-toluene sulphonic, tartaric, citric, methane sulphonic, formic, malonic, succinic, naphthalene-2-sulphonic, and benzene sulphonic. Also, such salts can be prepared as alkaline metal or alkaline earth salts, such as sodium, potassium or calcium salts of the carboxylic acid group.
Suitable buffering agents include: acetic acid and a salt (1-2% w/v); citric acid and a salt (1-3% w/v); boric acid and a salt (0.5-2.5% w/v); and phosphoric acid and a salt (0.8-2%
w/v). Suitable preservatives include benzalkonium chloride (0.003-0.03% w/v);
chlorobutanol (0.3-0.9% w/v); parabens (0.01-0.25% w/v) and thimerosal (0.004-0.02% w/v).
The nucleic acids or other therapeutics useful in the invention may be delivered in mixtures with additional antibodies. A mixture may consist of several antibodies in addition to the nucleic acid.
A variety of administration routes are available. The particular mode selected will depend, of course, upon the particular nucleic acids or antibodies selected, the particular condition being treated and the dosage required for therapeutic efficacy. The methods of this invention, generally speaking, may be practiced using any mode of administration that is medically acceptable, meaning any mode that produces effective levels of an immune response without causing clinically unacceptable adverse effects. Preferred modes of administration are discussed above.
The compositions may conveniently be presented in unit dosage form and may be prepared by any of the methods well known in the art of pharmacy. All methods include the step of bringing the compounds into association with a carrier which constitutes one or more accessory ingredients. In general, the compositions are prepared by uniformly and intimately bringing the compounds into association with a liquid carrier, a finely divided solid carrier, or both, and then, if necessary, shaping the product. Liquid dose units are vials or ampoules.
Solid dose units are tablets, capsules and suppositories.
Other delivery systems can include time-release, delayed release or sustained release delivery systems. Such systems can avoid repeated administrations of the compounds, increasing convenience to the subject and the physician. Many types of release delivery systems are available and known to those of ordinary skill in the art. They include polymer base systems such as poly(lactide-glycolide), copolyoxalates, polycaprolactones, polyesteramides, polyorthoesters, polyhydroxybutyric acid, and polyanhydrides.
Microcapsules of the foregoing polymers containing drugs are described in, for example, U.S.
Patent No. 5,075,109. Delivery systems also include non-polymer systems that are: lipids including sterols such as cholesterol, cholesterol esters and fatty acids or neutral fats such as mono-, di-, and tri-glycerides; hydrogel release systems; sylastic systems;
peptide based systems; wax coatings; compressed tablets using conventional binders and excipients;
partially fused implants; and the like. Specific examples include, but are not limited to: (a) erosional systems in which an agent of the invention is contained in a form within a matrix such as those described in U.S. Patent Nos. 4,452,775, 4,675,189, and 5,736,152, and (b) diffusional systems in which an active component permeates at a controlled rate from a polymer such as described in U.S. Patent Nos. 3,854,480, 5,133,974 and 5,407,686. In addition, pump-based hardware delivery systems can be used, some of which are adapted for implantation.
The nucleic acid may be directly administered to the subject or may be administered in conjunction with a pharmaceutically acceptable carrier or a delivery vehicle. The nucleic acid and optionally other therapeutic agents may be administered alone (e.g., in saline or buffer) or using any delivery vehicles known in the art. One type of delivery vehicle is referred to herein as a nucleic acid delivery complex. A "nucleic acid delivery complex"
shall mean a nucleic acid molecule associated with (e.g., ionically or covalently bound to; or encapsulated within) a targeting means (e.g., a molecule that results in higher affinity binding to target cell (e.g., dendritic cell surfaces and/or increased cellular uptake by target cells).
Examples of nucleic acid delivery complexes include nucleic acids associated with: a sterol (e.g., cholesterol), a lipid (e.g., a cationic lipid, virosome or liposome), or a target cell specific binding agent (e.g., a ligand recognized by target cell specific receptor). Preferred complexes may be sufficiently stable in vivo to reduce significant uncoupling prior to internalization by the target cell. However, the complex may be cleavable under appropriate conditions within the cell so that the nucleic acid may be released in a functional form.
The nucleic acids may be delivered by non-invasive methods as described above.
Non-invasive delivery of compounds is desirable for treatment of children, elderly, animals, and even adults and also to avoid the risk of needle-stick injury. Delivery vehicles for delivering compounds to mucosal surfaces have been described and include but are not limited to: Cochleates (Gould-Fogerite et al., 1994, 1996); Emulsomes (Vancott et al., 1998, Lowell et al., 1997); ISCOMs (Mowat et al., 1993, Carlsson et al., 1991, Hu et al., 1998, Morein et al., 1999); Liposomes (Childers et al., 1999, Michalek et al., 1989, 1992, de Haan 1995a, 1995b); Live bacterial vectors (e.g., Salmonella, Eschericlzia coil, Bacillus Cabnette-Guerin, Shigella, Lactobacillus) (Hone et al., 1996, Pouwels et al., 1998, Chatfield et al., 1993, Stover et al., 1991, Nugent et al., 1998); Live viral vectors (e.g., Vaccinia, adenovirus, Herpes Simplex) (Gallichan et al., 1993, 1995, Moss et al., 1996, Nugent et al., 1998, Flexner et al., 1988, Morrow et al., 1999); Microspheres (Gupta et al., 1998, Jones et al., 1996, Maloy et al., 1994, Moore et al., 1995, O'Hagan et al., 1994, Eldridge et al., 1989); nucleic acid vaccines (Fynan et al., 1993, Kuklin et al., 1997, Sasaki et al., 1998, Okada et al., 1997, Ishii et al., 1997); Polymers (e.g., carboxymethylcellulose, chitosan) (Hamajima et al., 1998, Jabbal-Gill et al., 1998); Polymer rings (Wyatt et al., 1998); Proteosomes (Vancott et al., 1998, Lowell et al., 1988, 1996, 1997); Sodium Fluoride (Hashi et al., 1998);
Transgenic plants (Tacket et al., 1998, Mason et al., 1998, Hag et al., 1995); Virosomes (Gluck et al., 1992, Mengiardi et al., 1995, Cryz et al., 1998); Virus-like particles (Jiang et al., 1999, Leibl et al., 1998).
The invention also includes kits. The kits generally include a package with a plurality of containers housing active agents and instructions for carrying out the methods of the invention. The active agents include but are not limited to immunostimulatory nucleic acids, antibodies such as antibodies specific for a cell surface antigen, and anti-cancer therapies.
The following examples are provided to illustrate specific instances of the practice of the present invention and are not to be construed as limiting the present invention to these examples. As will be apparent to one of ordinary skill in the art, the present invention will find application in a variety of compositions and methods.
Examples Introduction:
Extensive cross-talk exists between healthy B cells and T cells. There is evidence that malignant B cells also communicate with T cells. However, malignant cells appear to differ from their normal counterparts in a number of ways, including a decreased tendency to undergo apoptosis in response to normal signals, altered expression of a variety of surface markers, and altered ability to function as effective antigen presenting cells. Lagneaux L et al., Blood 91:2387-96 (1998); Gordon J et al., Leukemia 7 Suppl 2:S5-9 (1993);
Gordon J et al., Adv Exp Med Biol 406:139-44 (1996); Chaperot L et al., Exp Hematol 27:479-88 (1999).
Immunotherapeutic approaches have recently become part of our therapy of some subtypes of B-cell malignancy. Improved immunotherapy of B-cell malignancy will need to be designed based on the growing understanding of the cellular immunology of this disease.
Schultze JL
et al., J Mol Med 77:322-32 (1999).
A variety of cellular receptors and antigens are involved in growth, differentiation and apoptosis of B-cell malignancies. Antibodies or ligands against a variety of antigens can cause growth inhibition or even apoptosis including CD20, surface immunoglobulins, MHC
CD80, CD86 and CD40. Maloney DG, Semin Oncol 26:74-8 (1999); McLaughlin P et al., Semin Oncol 26:79-87 (1999); Shan D et al., Blood 91:1644-52 (1998); Coiffier B et al., Blood 92:1927-32 (1998); McLaughlin P et al., Oncology (Huntingt) 12:1763-70, (1998); Tutt AL et al., J Immunol 161:3176-85 (1998); Funakoshi S et al., Blood 83:2787-94 (1994); Mayumi M et al., J Allergy Clin Immunol 98:S238-47 (1996); Higaki Y et al., Immunol Cell Biol 72:205-14 (1994); Elsasser D et al., Blood 87:3803-12 (1996); Link BK et al., Blood 81:3343-9 (1993); Link BK et al., Int J Cancer 77:251-6 (1998). The relative contribution of antibody dependent cellular cytotoxicity (AD CC) versus trans-membrane signaling mediated by anti-B cell antibodies remains unclear. In the present study, we examined how CpG-DNA impacts on the phenotype, apoptosis and proliferation of different types of B-cell malignancy including follicular B-cell lymphoma and B-CLL.
Materials and Methods:
Cell culture: Fresh lymph node samples were obtained from the operating suite and were minced with a scalpel under aseptic conditions. The resulting suspension was passed sequentially through a sterilized sieve-tissue grinder containing a nylon mesh screen, a 150 gm mesh screen and a 60 gm mesh screen. Alternatively, mononuclear cells were obtained from peripheral blood or pleural fluid as described. Hartmann G et al., J
Pharmacol Exp Tlzer 285:920-8 (1998). Red blood cells were removed by resuspending the cells in 5 ml ACK lysis buffer according to standard procedures. Cells were frozen slowly and stored in liquid nitrogen. For analysis, cells were thawed and resuspended in 10 % (v/v) heat-inactivated (56 C, 1 h) FCS (HyClone, Logan, UT), 1.5 mM L-glutamine (all from Gibco BRL, Grand Island, NY) and incubated on a 96-well-plate (1 x 106 cells/nil) in the presence of ODN as indicated below. Not all assays were performed for all samples because of the limited number of cells available for some samples.
Oligonucleotides: Nuclease-resistant phosphorothioate-modified oligodeoxynucleotide (ODN) were purchased from Operon Technologies (Alameda, CA) and Hybridon Specialty Products (Milford, MA). Sequences were as follows: CpG ODN
2006:
5'-TCGTCGTTTTGTCGTTTTGTCGTT-3' (SEQ ID NO: 729), and control ODN 2017:
5'-CCCCCCCCCCCCCCCCCCCC-3' (SEQ 1D NO: 168). ODN was diluted in TE (10 mM
Tris-HC1, 1 mM EDTA, pH 8) using pyrogen-free reagents. ODN was added at a final concentration of 5 g/ml.
Flow cytometry: Cells were washed and resuspended in ice-cold PBS or Annexin V
binding buffer (10 mM HEPES/Na0H, 140 mM NaC1, 2.5 mM CaC12, pH 7.4). Murine or human serum was added (final concentration 1%) to block non-specific binding of antibodies.
Surface antigen staining was performed as described. Hartmann G et al., J
Pharnzacol Exp Ther 285:920-8 (1998). In brief, 1 x 105 cells per sample were stained with CyChrome-labeled anti-CD19 and FITC- or PE-labeled antibodies as indicated for 20 min on ice. They were then washed and analyzed by flow cytometry. Monoclonal antibodies to CD40 (5C3), CD69 (FN50), CD80 (L307.4), CD86 (IT2.2), CD54 (HASS), MHC I (G46-2.6) and MHC
II
(TU39) as well as isotype controls (IgG1, MOPC-21 and IgG2a, G155-178) were purchased from PharMingen, San Diego, CA. FITC-labeled polyclonal anti-human Ig was purchased from Southern Biotech, Birmingham, AL. 1D10, a monoclonal humanized antibody directed against a variant of HLA-DR was produced in our laboratory as described earlier. Link BK
et al., Blood 81:3343-9 (1993). C2B8, a monoclonal humanized anti-CD20 antibody, was purchased from IDEC Pharmaceuticals, San Diego, CA. 1D10 and C2B8 were labeled with FITC according to standard protocols. The analysis gate was set on viable cells identified according to FSC/SSC characteristics and Annexin V staining (> 97 % viable cells within analysis gate). Spectral overlap was corrected by appropriate compensation.
Flow cytometric data from 1 x 104 cells per sample were acquired on a FACScan (Beckton Dickinson Immunocytometry Systems, San Jose, CA). Data were analyzed using the computer program FlowJo (version 2.5.1, Tree Star, Inc., Stanford, CA).
CFSE staining: CFSE 5- (and 6-) carboxyfluorescein diacetate succinimidyl ester, Molecular Probes, USA, is a fluorescein-derived intracellular fluorescent label which is divided equally between daughter cells upon cell division. Staining of cells with CFSE
allows both quantification and immunophenotyping of proliferating cells in a mixed cell suspension. Interference between oligonucleotide degradation products and thymidine uptake (standard proliferation assay) is avoided by using this method. The technique has described in detail previously. Lyons AB et al., J Immunol Methods 171:131-7 (1994).
Briefly, cells were washed twice in PBS, resuspended in PBS (1 x 107 cells/ml) containing CFSE at a final concentration of 1 IuM, and incubated at 37 C for 10 minutes. Cells were washed three times with PBS.
TUNEL assay: A two-color DNA strand break labeling assay, based on a modification of the assay described by Li et al. (Li X et al., ExpCell Res 222:28-37 (1996)) was used to assess B-cell proliferation in response to CpG ODN. This assay involved terminal transferase-mediated dUTP nick end labeling (TUNEL) before and after induction of DNA strand breaks in BrdU-labeled cells. Briefly, cells were cultured for 3 days with and without ODN. They were then incubated for 16 hours in 10 M BrdU and placed onto slides by cytospin. Cells were then in 1% paraformaldehyde in PBS for 15 minutes followed by 20 minutes in 70% ethanol. DNA cleavage indicative of apoptosis cells was detected by labeling the 3'-DNA end of nicked strands with FITC-ddUTP (Boehringer-Mannheim). The use of dideoxy-dUTP prevented further elongation of the 3'-ends in subsequent steps. Slides were then placed face-down on a 2mm support at both ends on a UV
transilluminator and exposed for 5 minutes. The new DNA strand breaks induced by photolysis at sites of BrdU
incorporation (i.e., proliferating cells) were detected by a second TUNEL
labeling using tetramethylrhodamine-dUTP (TMR-dUTP, Boehringer-Mannheim). Both TUNEL staining steps included incubating slides in 500 of TdT mix (34 1 distilled water, 10R1 of 5X TdT
buffer, 5 1 of 25mM cobalt chloride, 12.5 units terminal transferase and 0.5nmol fluorochrome-conjugated-dUTP) (Boehringer-Mannheim) under a coverslip for one hour at 37 C in a humidified chamber. The slides were then washed in 5 quick changes of distilled water followed by 3 changes of 2XSSC containing 30% formamide for 5 minutes each at room temperature. After the second TUNEL labeling step, cells were counterstained for CD19, and also stained with Wright solution for blood cell differentiation and mounted in TM
Vectashiekt media containing DAPI counterstain (Vector Laboratories, Burlingame, CA).
The morphology and staining of cells were assessed using both visible light and fluorescence microscopy. Apoptotic cells were identified by green fluorescence (FITC
label), and proliferating cells by red fluorescence (TMR label). The percentage of apoptotic and proliferating cells was determined by counting at least 200 cells per sample by three observers blinded to whether cells were treated with ODN. Mean and standard error were determined for each sample based on these three readings.
Example 1: Immunostimulatory nucleic acids induce morphological and phenotypic changes in malignant B cells.
Our prior studies demonstrated that activation of naive human B cells by CpG
ODN
results in increased cell size (FSC) and granularity (SSC). Hartmann G et al., J Immunol 164:944-53 (2000). We therefore first determined whether such changes also occur in malignant B cells. Primary malignant B cells were obtained from lymph node biopsies, peripheral blood, or pleural fluid of patients with various types of B-cell malignancy. In addition, cells from the lymph node of a patient with benign reactive follicular hyperplasia were studied. Nine samples in total were evaluated (see Table 5). Cells were incubated for 72 hours in media containing CpG ODN 2006 (5 pg,/m1) or control ODN 2017. FSC
and SSC were examined with gating on CD19+ viable cells (Figure 1). Varying degrees of change in FSC and SSC were noted in response to CpG ODN 2006 when compared to control ODN 2017 or medium alone. Comparable changes were not found in the cells from the patient with benign reactive follicular hyperplasia.
Figure 1 depicts the morphologic changes of marginal zone lymphoma cells upon CpG ODN stimulation. Malignant .B cells from a patient with marginal zone lymphoma were stimulated with 5 pg/ml of no ODN (A and D), control ODN (B and E) or CpG ODN
(C and F) for 72 hours and analyzed by flow cytometry. A, B, and C illustrate FSC (x-axis) vs. SSC
(y-axis). D, E and F illustrate CD19 expression (x-axis) against FSC (y-axis), allowing for separation of B cells from other leukocyte subpopulations. Upon stimulation with CpG
ODN, B cells shifted up and to the right, indicating an increase in granularity and size. No changes could be detected without stimulation or on stimulation with the non-CpG ODN.
Expression of CD20, CD40, CD69, CD80, CD86, surface Ig, CD54, MHC I, MHC
and an HLA-DR variant antigen (moAb 1D10) were examined on viable CD19+ cells after incubation of cells with CpG ODN for 72 hours. Each of these markers was upregulated to varying extents in response to the CpG ODN 2006 compared to the control ODN
2017 (Fig.
2, Fig. 3).
Figure 2 depicts the expression of surface antigens on marginal zone lymphoma cells upon CpG ODN treatment. Flow cytometric analysis of surface antigen expression on malignant B cells from a patient with marginal zone lymphoma was performed 72 hours after stimulation with 5 g/ml of either CpG ODN or non-CpG ODN. On stimulation with CpG
ODN, median fluorescence intensity for all markers tested shifted to the right, indicating an increase in surface expression. Thin curves indicate incubation with medium alone, dotted curves incubation with control ODN, and bold curves incubation with CpG ODN.
Figure 3 depicts the expression of surface antigens on primary cells representing different B-cell malignancies and cells of a benign follicular hyperplasia upon CpG ODN
treatment. Cells from lymph node biopsies, peripheral blood or pleural fluid from patients with different B-cell malignancies were incubated for 72 hours with either media alone, control ODN or CpG ODN. Each panel represents one experiment.
CD20 was expressed to varying degrees in all samples tested. As is well known, baseline CD20 expression was lower in the B-CLL samples when compared to the B-cell malignancies of other histologies. CpG-ODN 2006 but not the control ODN 2017 increased CD20 expression in both B-CLLs and both marginal zone lymphomas. No or only little upregulation was seen in the other lymphoma samples. Non-malignant CD19+ cells derived from the reactive follicular hyperplasia decreased CD20 expression in response to CpG (Fig.
3). This data demonstrated a reverse correlation between the baseline expression of CD20 and CD40, and expression of these markers after incubation with CpG ODN; thus the lower the baseline level of CD20 and CD40, the higher was the responsiveness to CpG
ODN (r: -0.6; -0.4) (Fig. 4). This correlation was less clear for the other markers.
CD19+ cells derived from the reactive follicular hyperplasia showed high baseline expression of activation markers which was not further upregulated by CpG.
Figure 4 shows the CpG ODN effect on CD20 and CD40 is dependent on the baseline level of expression. Cells from lymph node biopsies, peripheral blood or pleural fluid from patients with different B-cell malignancies (see Table 5) were incubated with or without CpG ODN for 72 hours. Expression of CD20 and CD40 was measured by flow cytometry. Baseline expression of CD20 and CD40 with medium alone was compared to the expression of CD20 and CD40 in the presence of CpG ODN. The coefficients of correlation are indicated.
Table 5: Percentage Of CD19+ Cells In Samples Tested.
Sample Histology Source % CD19+ Cells Number 1 Chronic Lymphocytic Leukemia 1 Peripheral >98 %
Blood 2 Chronic Lymphocytic Leukemia 2 Peripheral 70 %
Blood 3 Large Cell Lymphoma 1 Pleural Fluid 55 %
4 Large Cell Lymphoma 2 Lymph Node 75 %
5 Mantle Cell Lymphoma Lymph Node 98 %
Diffuse Mixed Small and Large Cell 6 Lymph Node 50 %
Lymphoma 7 Marginal Zone Lymphoma 1 Lymph Node 80 %
Peripheral 8 Marginal Zone Lymphoma 2 > 94 %
Blood 9 Reactive Follicular Hyperplasia Lymph Node 35 %
Example 2: Immunostimulatory nucleic acids induce proliferation and apoptosis of malignant B cells.
CpG induces a strong proliferative response of primary human B cells. Hartmann G
et al., J Immunol 164:944-53 (2000). Two techniques were used to assess whether CpG ODN
is capable of inducing proliferation of B-CLL cells. For select samples, cells were stained with CFSE and incubated for four days. Proliferation of cells is indicated by a loss of CFSE
stain with every cell division. In B-CLL, CD5 can be used to identify malignant B cells among CD19+ cells. Proliferation of malignant B cells (CD 5+ and CD19+) was lower than proliferation of normal B cells (CD5- and CD19+) (Fig. 5). For the marginal zone lymphoma, CpG ODN 2006 induced proliferation of the CD19+ cell population (Fig. 5).
Figure 5 shows a comparison of CpG ODN induced proliferation of malignant and normal B cells. Peripheral blood mononuclear cells from two patients, one with B-CLL and one with marginal zone lymphoma with circulating malignant cells, were incubated for 72 hours with CpG ODN or medium alone and evaluated by two-color flow cytometry.
CFSE
fluorescence (x-axis) and expression of CD5 (CLL) or CD19 (marginal zone lymphoma) (y-axis) were evaluated. In CLL, CpG ODN enhanced proliferation of both CD5+ and the CD5-cells. However the relative number of proliferating cells and the number of divisions is lower in the CD5- subset than in the CD5+ subset. In marginal zone lymphoma CpG ODN
enhanced proliferation in the CD19+ cell subset.
No consistent pattern was apparent related to determining whether CpG ODN
altered the percent of dead cells as determined by morphological criteria (see Table 6).
Table 6: Percent Apoptotic Cells Based On Morphologic Criteria.
Sample Histology Media CpG ODN 2006 Number Chronic Lymphocytic 1 25.9 21.5 Leukemia 1 Chronic Lymphocytic 2 32.6 45.3 Leukemia 2 3 Large Cell Lymphoma 1 33.9 26.2 4 Large Cell Lymphoma 2 16.0 9.8 5 Mantle Cell Lymphoma 55.1 60.0 Diffuse Mixed Small and 6 27.6 26.6 Large Cell Lymphoma Marginal Zone 7 32.9 32.8 Lymphoma 1 Marginal Zone 8 38.8 56.0 Lymphoma 2 Reactive Follicular 9 8.6 18.0 Hyperplasia A TLTNEL assay was utilized to assess the effect of CpG ODN on both proliferation and apoptosis. The results are shown in Table 7.
Table 7: Apoptosis And Proliferation As Determined By TLTNEL.
Sample Baseline CpG ODN
Control ODN
Apop Prolif Apop Prolif Apop Prolif 12142812 3 <1 1 10 2 12 12141811 <1 <1 <1 11 Example 3: CpG ODN enhance the therapeutic effect of murine IgG2a (which relates to human IgG1) but not murine IgG1 (which relates to human IgG2) anti-tumor antibody.
A
CpG ODN when combined with antibody of murine subtype IgG2a dramatically promotes survival in mice having tumors. Mice were injected i.p. with 5000 T3C
cells on day 0. They were then given 100 [tg anti-idiotype monoclonal antibody as either IgG1 (MS5A10) or IgG2a (MS11G6) on days 5,7, and 10. In this model, the target antigen is the idiotype expressed by the lymphoma cells. Therefore, the anti-tumor antibodies are also "anti-idiotype." These antibodies (MS5A10 and MS11G6) are simultaneously both anti-tumor antibodies and anti-idiotype antibodies. Twenty micrograms of CpG ODN
(5' TCCATGACGTTCCTGACGTT 3'; SEQ ID NO: 560) was given at the same time.
Results are shown in Figure 6. Untreated controls had a median survival time (MST) of 17 days after inoculation with tumor. Mice treated with murine IgG1 antibody plus CpG ODN
had survival that was similar to those treated with murine IgG1 antibody alone (MST 28 days and 27 days, respectively). In contrast, mice treated with murine IgG2a plus CpG ODN had survival that was significantly improved when compared to mice treated with murine IgG2a alone (MST 45 days and 37 days, respectively).
The foregoing written specification is considered to be sufficient to enable one skilled in the art to practice the invention. The present invention is not to be limited in scope by examples provided, since the examples are intended as a single illustration of one aspect of the invention and other functionally equivalent embodiments are within the scope of the invention. Various modifications of the invention in addition to those shown and described herein will become apparent to those skilled in the art from the foregoing description and fall within the scope of the appended claims. The advantages and objects of the invention are not necessarily encompassed by each embodiment of the invention.
SEQUENCE LISTING
<110> University of Iowa Research Foundation <120> Methods for Enhancing Antibody-Induced Cell Lysis and Treating Cancer <130> C1039/7052W0 (AWS) <150> US 60/213,346 <151> 2000-06-22 <160> 848 <170> FastSEQ for Windows Version 3.0 <210> 1 <211> 6 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 1 aaaaaa 6 <210> 2 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 2 aaaaaaaaaa aaaaaaaaaa 20 <210> 3 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 3 aaaaaccccc cccccaaaaa 20 <210> 4 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> Chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 4 aaaacatgac gttcaaaaaa 20 <210> 5 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorodithioate backbone <400> 5 aaaacatgac gttcaaaaaa 20 <210> 6 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 6 aaaacatgac gttcgggggg 20 <210> 7 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorodithioate backbone <400> 7 aaaacatgac gttcgggggg 20 <210> 8 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 8 aaaacgtt 8 <210> 9 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 9 aaaatcaacg ttgaaaaaaa 20 <210> 10 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 10 aaaatctgtg cttttaaaaa a 21 <210> 11 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 11 aaaattgacg ttttaaaaaa 20 <210> 12 <211> 33 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 12 aaacattctg ggggaatttt aagaagtaaa cat 33 <210> 13 <211> 39 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 13 aaacattctg ggggaatttt aagaagttcc tccctcccc 39 <210> 14 <211> 33 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide =
<221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 14 aaacattctg ggggaatttt gtctagtaaa cat 33 <210> 15 <211> 17 VIM) 01/97843 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 15 aacgctcgac cttcgat 17 <210> 16 <211> 17 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 16 aacgctggac cttccat 17 <210> 17 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 17 aacgctggac cttccatgtc 20 <210> 18 <211> 6 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 18 aacgtt 6 <210> 19 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 19 aacgttct 8 <210> 20 <211> 7 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 20 aacgttg 7 <210> 21 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 21 aacgttga 8 <210> 22 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 22 aacgttgagg ggcat 15 <210> 23 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 23 aaggtggggc agtctcaggg a 21 <210> 24 =
<211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 24 aatagtcgcc ataacaaaac 20 <210> 25 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 25 aatagtcgcc atcccccccc 20 <210> 26 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 26 aatagtcgcc atcccgggac 20 <210> 27 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 27 aatagtcgcc atcgcgcgac 20 <210> 28 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 28 aatagtcgcc atggcggggc 20 <210> 29 <211> 45 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 29 aattctctat cggggcttct gtgtctgttg ctggttccgc tttat 45 <210> 30 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 30 acaaccacga gaacgggaac 20 <210> 31 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 31 acaacgtt 8 <210> 32 <211> 10 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 32 acaacgttga 10 <210> 33 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 33 accacaacga gaggaacgca 20 <210> 34 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 34 accatcctga ggccattcgg 20 <210> 35 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 35 accatggacg aactgtttcc cctc 24 <210> 36 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 36 accatggacg acctgtttcc cctc 24 <210> 37 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 37 accatggacg agctgtttcc cctc 24 <210> 38 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 38 accatggacg agctgtttcc cctc 24 <210> 39 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 39 accatggacg atctgtttcc cctc 24 <210> 40 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 40 accatggacg gtctgtttcc cctc 24 <210> 41 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 41 accatggacg tactgtttcc cctc 24 <210> 42 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 42 accatggacg ttctgtttcc cctc 24 <210> 43 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 43 acccatcaat agctctgtgc 20 VIM) 01/97843 <210> 44 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 44 acccgtcgta attatagtaa aaccc 25 <210> 45 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 45 accgcatgga ttctaggcca 20 <210> 46 <211> 45 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 46 accttattaa gattgtgcaa tgtgacgtcc tttagcatcg caaga 45 <210> 47 <211> 16 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 47 acgctggacc ttccat 16 <210> 48 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 48 acgtcgttcc cccccccccc 20 <210> 49 <211> 6 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 49 acgtgt 6 <210> 50 <211> 17 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 50 actagacgtt agtgtga 17 <210> 51 <211> 17 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 51 actagacgtt agtgtga 17 <210> 52 <211> 17 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 52 actggacgtt agcgtga 17 <210> 53 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 53 acttctcata gtccctttgg tccag 25 <210> 54 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 54 agaacgtt 8 <210> 55 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 55 agacagacac gaaacgaccg 20 <210> 56 <211> 27 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 56 agactcatgg gaaaatccca catttga 27 <210> 57 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 57 agatagcaaa tcggctgacg 20 <210> 58 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 58 agatggttct cagataaagc ggaa 24 <210> 59 <211> 18 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 59 agcaccgaac gtgagagg 18 <210> 60 <211> 18 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 60 agcacggtag ccttccta 18 <210> 61 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 61 agcagcttta gagctttaga gctt 24 <210> 62 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 62 agcatcagga acgacatgga 20 <210> 63 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 63 agcatcagga ccgacatgga 20 <210> 64 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 64 agcgctga 8 <210> 65 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 65 agctcaacgt catgc 15 <210> 66 <211> 19 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 66 agetccatgg tgctcactg 19 <210> 67 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 67 aggatatc 8 <210> 68 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 68 aggtacagcc aggactacga 20 <210> 69 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <221> modified_base <222> (3)...(3) <223> I
<221> modified_base <222> (8)...(8) <223> I
<221> modified_base <222> (14)...(14) <223> I
<400> 69 agncccgnga acgnattcac 20 <210> 70 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 70 agtgactctc cagcgttctc 20 <210> 71 <211> 17 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 71 agtgcgattc gagatcg 17 <210> 72 <211> 17 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 72 agtgcgattg cagatcg 17 <210> 73 <211> 6 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 73 agtgct 6 <210> 74 <211> 6 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 74 agtgct 6 <210> 75 <211> 10 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 75 agttgcaact 10 <210> 76 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 76 ataaagcgaa actagcagca gtttc 25 <210> 77 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 77 ataacgtt 8 <210> 78 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 78 ataatagagc ttcaagcaag 20 <210> 79 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 79 ataatccagc ttgaaccaag 20 <210> 80 <211> 20 <212> DNA .
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 80 ataatcgacg ttcaagcaag 20 <210> 81 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 81 ataatcgacg ttcccccccc 20 <210> 82 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 82 ataatcgtcg ttcaagcaag 20 <210> 83 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 83 ataatcgtgc gttcaagaaa g 21 <210> 84 <211> 27 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 84 atagacaaaa attccctccc cggagcc 27 <210> 85 <211> 18 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 85 atatatatat atatatat 18 <210> 86 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 86 atatctaatc aaaacattaa caaa 24 <210> 87 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 87 atcaggaacg tcatgggaag c 21 <210> 88 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 88 atcgacctac gtgcgttctc 20 <210> 89 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <221> modified_base <222> (18)...(18) <223> m5c <400> 89 atcgacctac gtgcgttntc 20 <210> 90 <211> 18 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 90 atcgactcga gcgttctc 18 <210> 91 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 91 atcgactctc gagcgttctc 20 <210> 92 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 92 atcgactctc gagcgttctc 20 <210> 93 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 93 atcgactctc gagtgttctc 20 <210> 94 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <221> modified_base <222> (14)...(14) <223> m5c <400> 94 atcgactctc gagngttctc 20 VIM) 01/97843 <210> 95 <211> 22 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 95 atcgactctc tcgagcgttc tc 22 <210> 96 <211> 19 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 96 atcgacttcg agcgttctc 19 <210> 97 <211> 17 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 97 atcgatcgag cgttctc 17 <210> 98 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 98 atcgatgt 8 <210> 99 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 99 atcggaggac tggcgcgccg 20 <210> 100 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 100 atctggtgag ggcaagctat g 21 <210> 101 <211> 17 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 101 atgacgttcc tgacgtt 17 <210> 102 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 102 atgcactctg cagcgttctc 20 <210> 103 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 103 atgcatgt 8 <210> 104 <211> 15 <212> DNA
<213> Artificial Sequence <220>
. <223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 104 atgcccctca acgtt 15 <210> 105 <211> 23 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 105 atgctaaagg acgtcacatt gca 23 <210> 106 <211> 19 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 106 atggaaggtc cacgttctc 19 <210> 107 <211> 19 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 107 atggaaggtc cagcgttct 19 <210> 108 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 108 atggaaggtc cagcgttctc 20 <210> 109 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 109 atggaaggtc cagtgttctc 20 <210> 110 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 110 atggaaggtc gagcgttctc 20 <210> 111 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 111 atggactctc cagcgttctc 20 <210> 112 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 112 atgtcctcgg tcctgatgct 20 <210> 113 <211> 33 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 113 atgtttacta gacaaaattc ccccagaatg ttt 33 <210> 114 <211> 33 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 114 atgtttactt cttaaaattc ccccagaatg ttt 33 <210> 115 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 115 attcgatcgg ggcggggcga g 21 <210> 116 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <221> modified_base <222> (3)...(3) <223> m5c <400> 116 atngacctac gtgcgttctc 20 <210> 117 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <221> modified_base <222> (3)...(3) <223> m5c <221> modified_base <222> (10)...(0) <223> m5c <221> modified_base <222> (14)...(14) <223> m5c <400> 117 atngactctn gagngttctc 20 <210> 118 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <221> misc_feature <222> (1)...(1) <223> biotinylated at 5' end <400> 118 atggaaggtc cagcgttctc 20 <210> 119 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <221> misc_feature <222> (1)...(1) <223> biotinylated 5' end <400> 119 gagaacgctc cagcactgat 20 <210> 120 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <221> misc_feature <222> (1)...(1) <223> biotinylated 5' end <400> 120 gagaacgctc gaccttcgat 20 <210> 121 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <221> misc_feature <222> (1)...(1) <223> biotinylated 5' end <221> modified base <222> (6)...(6) <223> m5c <400> 121 gagaangctc cagcactgat 20 <210> 122 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <221> misc_feature <222> (1)...(1) <223> biotinylated 5' end <221> modified_base <222> (6)...(6) <223> m5c <400> 122 gagaangctc gaccttcgat 20 <210> 123 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <221> misc_feature <222> (1)...(1) <223> biotinylated at 5' end <400> 123 gagcaagctg gaccttccat 20 <210> 124 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <221> misc_feature <222> (1)...(1) <223> biotinylated at 5' end <221> modified_base <222> (8)...(8) <223> m5c <400> 124 gagcaagntg gaccttccat 20 <210> 125 <211> 17 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <221> misc_feature <222> (1)...(1) <223> biotinylated at 5' end <400> 125 gctagacgtt agcgtga 17 <210> 126 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <221> misc_feature <222> (1)...(1) <223> biotinylated at 5' end <400> 126 tcaacgtt 8 <210> 127 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <221> misc_feature <222> (1)...(1) <223> biotinylated at 5' end <400> 127 tccatgacgt tcctgatgct 20 <210> 128 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) .<223> phosphodiester backbone <221> misc_feature <222> (1)...(1) <223> biotinylated at 5' end <400> 128 tccatgagct tcctgatgct 20 <210> 129 <211> 29 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphodiester on 5' end <221> misc_feature <222> (1)...(1) <223> biotinylated at 5' end <400> 129 tccattccat gacgttcctg atgcttcca 29 <210> 130 <211> 30 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphodiester on 5' end <221> misc_feature <222> (1)...(1) <223> biotinylated at 5' end <400> 130 tccattccat tctaggcctg agtcttccat 30 <210> 131 <211> 29 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphodiester on 5' end <221> misc_feature <222> (1)...(1) <223> biotinylated at 5' end <400> 131 tcgtcgtttt gtcgttttgt cgttttttt 29 <210> 132 <211> 28 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphodiester on 5' end <221> misc_feature <222> (1)...(1) <223> biotinylated at 5' end <400> 132 tttttccatg tcgttcctga tgcttttt 28 <210> 133 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphodiester on 5' end <221> misc_feature <222> (1)...(1) <223> biotinylated at 5' end <400> 133 tttttcgtcg ttcccccccc cccc 24 <210> 134 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 134 caaacgtt 8 <210> 135 <211> 7 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_featnre <222> (0)...(0) <223> phosphodiester backbone <400> 135 caacgtt 7 VIM) 01/97843 <210> 136 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 136 caagagatgc taacaatgca 20 <210> 137 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 137 caatcaatct gaggagaccc 20 <210> 138 <211> 22 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 138 cacaccttgg tcaatgtcac gt 22 <210> 139 <211> 23 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)¨(0) <223> phosphodiester backbone <400> 139 caccaccttg gtcaatgtca cgt 23 <210> 140 <211> 16 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 140 cacggtagcc ttccta 16 <210> 141 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)¨(0) <223> phosphorothioate backbone <400> 141 cacgttgagg ggcat 15 <210> 142 <211> 16 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3 ends <400> 142 cactgtcctt cgtcga 16 <210> 143 <211> 23 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 143 cagacacaga agcccgatag acg 23 <210> 144 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 144 cagattgtgc aatgtctcga 20 <210> 145 <211> 27 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 145 cataacatag gaatatttac tcctcgc 27 <210> 146 <211> 31 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 146 cataggatct cgagctcgga aagtccccta c 31 <210> 147 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 147 catgagctca tctggaggaa gcgg 24 <210> 148 <211> 18 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)... (0) <223> phosphodiester backbone <400> 148 catttccacg atttccca 18 <210> 149 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 149 cattttacgg gcgggcgggc 20 <210> 150 <211> 22 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 150 ccaaatatcg gtggtcaagc ac 22 <210> 151 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 151 ccaacgtt 8 <210> 152 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 152 ccacgtcgac cctcaggcga 20 <210> 153 <211> 17 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 153 ccacgtggac ctctagc 17 <210> 154 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 154 ccactcacat ctgctgctcc acaag 25 <210> 155 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 155 ccagatgagc tcatgggttt ctcc 24 <210> 156 <211> 26 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 156 ccaggttaag aggaaatgac ttcggg 26 <210> 157 <211> 17 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 157 ccaggttgta tagaggc 17 <210> 158 <211> 35 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 158 ccagtgctga tcaccgatat cctgttcggc agtcg 35 <210> 159 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 159 ccatcgat 8 <210> 160 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 160 ccatgcat 8 <210> 161 <211> 17 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 161 ccatgctaac ctctagc 17 <210> 162 <211> 19 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 162 ccatgtcggt cctgatgct 19 <210> 163 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 163 ccccaaaggg atgagaagtt 20 <210> 164 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide =
<221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 164 cccccaaaaa aaaaaccccc 20 <210> 165 <211> 6 <212> DNA
<213> Artificial Sequence .220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 165 cccccc 6 <210> 166 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 166 cccccccc 8 <210> 167 <211> 12 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 167 cccccccccc cc 12 <210> 168 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 168 cccccccccc cccccccccc 20 <210> 169 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 169 cccccccccc cccccccccc 20 <210> 170 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 170 cccccccccc cccccccccc cccc 24 <210> 171 <211> 28 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 171 cccccccccc cccccccccc cccccccc 28 <210> 172 <211> 35 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 172 cccccccccc cccccccccc cccccccccc ccccc 35 <210> 173 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 173 ccccttgacg ttttcccccc 20 <210> 174 <211> 26 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 174 cccgaagtca tttcctctta acctgg 26 <210> 175 <211> 26 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 175 ccgaacagga tatcggtgat cagcac 26 <210> 176 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 176 ccgcttcctc cagatgagct catg 24 <210> 177 <211> 39 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 177 ccgcttcctc cagatgagct catgggtttc tccaccaag 39 <210> 178 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 178 ccggccggcc ggccggccgg 20 <210> 179 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_difference <222> (0)...(0) <223> phosphodiester backbone <400> 179 ccgtcgttcc cceccccecc 20 <210> 180 <211> 22 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 180 cctacgttgt atgcgcccag ct 22 <210> 181 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 181 cctccaaatg aaagaccccc 20 <210> 182 <211> 19 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 182 cctctataca acctgggac 19 <210> 183 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 183 ccttccatgt cggtcctgat 20 <210> 184 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_difference <222> (0)...(0) <223> phosphodiester backbone <400> 184 ccttcgat 8 <210> 185 <211> 8 <212> DNA
. <213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) ... (0) <223> phosphodiester backbone <400> 185 cgaacgtt 8 <210> 186 <211> 6 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 186 cgacga 6 <210> 187 <211> 6 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 187 cgacgt 6 <210> 188 <211> 18 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 188 cgactctcga gcgttctc 18 <210> 189 <211> 35 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 189 cgactgccga acaggatatc ggtgatcagc actgg 35 <210> 190 <211> 18 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 190 cgccgtcgcg gcggttgg 18 <210> 191 <211> 18 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 191 cgcctggggc tggtctgg 18 <210> 192 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 192 cgcgcgcgcg cgcgcgcgcg 20 <210> 193 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone
ID NO:
ccatcgat 0 159 ccatgcat 0 160 ccatgctaacctctagc 0 161 ccatgtcggtcctgatgct 0 162 ccccaaagggatgagaagtt 0 163 cccccaaaaaaaaaaccccc o 164 cccccc s 165 cccccccc s 166 cccccccccccc S 167 cccccccccccccccccccc S 168 cccccccccccccccccccc sos 169 cccccccccccccccccccccccc S 170 cccccccccccccccccccccccccocc 5 171 cccccccccccccccecccccccccaccccccccc S 172 ccccttgacgttttcccccc sos 173 cccgaagtcatttcctcttaacctgg o 174 ccgaacaggatatcggtgatcagcac 175 ccgcttcctccagatgagctcatg o 176 ccgcttcctccagatgagctcatgggtttctccaccaag 0 177 ccggccggccggccggccgg o 178 ccgtcgttcccccccccccc o 179 cctacgttgtatgcgcccagct 0 180 cctccaaatgaaagaccccc 181 cctctatacaacctgggac 182 ccttccatgtcggtcctgat sos 183 ccttcgat o 184 cgaacgtt o 185 cgacga o 186 cgacgt S 187 cgactctcgagcgttctc 0 188 cgactgccgaacaggatatcggtgatcagcactgg 189 cgccgtcgcggcggttgg 0 190 cgcctggggctggtctgg 0 191 cgcgcgcgcgcgcgcgcgcg S 192 cgcgcgcgcgcgcgcgcgcg o 193 cgcgta 5 194 cgctagaggttagegtga 0 195 cgctggaccttccat o 196 cgctggaccttccatgtcgg sos 197 cggctgacgtcatcaa 5 198 cgggcgactcagtctatcgg 199 cgggcttacggcggatgctg 200 cggtagccttccta 201 cgtaccttacggtga 0 202 cgta.cg S 203 cgtcga S 204 cgtcga 205 cgtcgt S 206 cgtcgtcgt 0 207 cgtcgtcgtcgtcgtcgtcgt S 208 cgtctatcgggcttctgtgtctg 209 cgttcg 5 210 ctaacgtt 211 ctaatctttctaatttttttctaa S 212 ctagataaagcggaaccagcaacagacacagaagccccgatagag o 213 SEQUENCE BACKBONE SEQ ID
NO:
ctagcgct o 214 ctagcggctgacgtcataaagctagc S 215 ctagcggctgacgtcatcaagctag 0 216 ctagcggctgacgtcatcaatctag 0 217 ctagcggctgagctcataaagctagc S 218 ctagcttgatgacgtcagccgctag 0 219 ctagcttgatgagctcagccgctag 0 220 ctagctttatgacgtcagccgctagc 5 221 ctaggctgacgtcatcaagctagt 0 222 ctagtggctgacgtcatcaagctag 5 223 ctatcggaggactggcgcgcc 224 ctatcggaggactggcgcgccg 225 ctcaacgctggaccttccat a 226 ctcatgggtttctccaccaag a 227 ctccagctccaagaaaggacg o 228 ctcgccccgccccgatcgaat o 229 ctctccaagctcacttacag 230 ctctctgtaggcccgcttgg 5 231 ctcttgcgacctggaaggta 232 ctgacgtcat 0 233 ctgacgtg 234 ctgattgctctctcgtga sos 235 ctgattgctctctcgtga 0 236 ctgcagcctgggac o 237 ctgcgttagcaatttaactgtg a 238 ctgctgagactggag 239 ctgctgctgctgctgctgctg S 240 ctggaccttccatgtc sos 241 ctggaccttccatgtcgg sop 242 ctggtctttctggtttttttctgg 5 243 ctggtctttctggtttttttctgg a 244 ctgtaagtgagcttggagag 245 ctgtatgaaacaaattttcctctttgggca 0 246 ctgtca 5 247 ctgtcaggaactgcaggtaagg 0 248 ctgtcccatatttttagaca 249 ctgtcg S 250 ctgtcg a 251 ctgtcgttcccccccccccc 0 252 ctgtgctttctgtgtttttctgtg 5 253 cttggagggcctcccggcgg 254 cttggtggagaaacccatgag 0 255 cttggtggagaaacccatgagctcatctggaggaagcgg 0 256 ctttccgttggacccctggg 5 257 czggczggczgggczccgg a 258 faacgttga 0 259 fcgcgaattcgcg 0 260 ftcaacgtt a 261 gaaacgtt a 262 gaaactgctgctagtttcgctttat a 263 gaaccttccatgctgtt 264 gaaccttccatgctgttccg 265 gaacgctggaccttccat 266 gaagttcacgttgaggggcat 0 267 gaagtttctggtaagtcttcg 0 268 EZE o 5a6gpoE.
= Es 6q.qBp-e64-ea6 = E 0 3-e54eo.6 OZE sos qp.6p64q..6p.e5q-eD6 Sgo6.2.6qq.Bae.64pDE.
8T E sos qab-e6q.q.Boae.TeD.6 LIE
p.66.6ap.66ÃqooppopTegaqp36-205 SpEDaBpa6apaq.6oTeopo6 ST E
0joBgq:eq.epaB
= E 0 cp.6.4q.ezepa.6 LIE 0 E.oppoB
o6Ereqq3q:eoga.6a6q.q3ppoqq:e6 .6Boa6poq&e6q.p.645.eqoq-eb OIL
Boa63.6o564op.6.6s6Bogv5 60E sos 63q.a.6Tepqa4p64o6oTe5 .6.2qopoqvagae.6-406.6paTeB
6p3pa45.e3aqp.6 90E 0 5q34-euEe3BB.q.aap.6q.B-eovaq..6.epoq.e.6 SO E
04v5.643.e.645gaup4Be54a6qoqq.e5upaq.p6 f70E
0Te5.6qop5q..6qopaq.5.6-epobgaggp5Pooq.-e6 a5.66opq.qqq-eao-e65.66-e6 DvEcre66TET.66.66-e.6 0.2.66gEog6o.e.e.65-e5p66-4-23.4.6opp.65a6-e56.4PDq.BoPp6.6p5 cpppaggoop.65q.D.6p-eDEreS
3aqqoap664oBv-ea6p.6 qp5aqqaps6oqa6oap5.26 oaqqapp.66q.DEapp.6.e.6 opP.6.6q.a6Tes6p6 0qupagEBEgoBapp.6p.6 t,6Z0 oqgzoP66.436appEv.6 04poogq.D.2.6.6.43.6app5a6 0TeDameoqoBaeBEgaBapp5u6 aP.6.6q.D6a-e-e6p.6 0Pg5aggapP5.6ga6appEre5 683 0 63qq3D-E5Eg3bapP6e.6 z6qpooqqoae.6.6qoba-ere.6-a6 oqqoas65qa6apP6p.6 zepagg3oP.6.6go53pp6e5 paggooe.6.6qaBopp.6p6 = Z
TeaDgPogoopEZqaBov.e.6p6 pozeaTeaq.DaPE6q3Baev.6p6 pooqpqaaPB.64a6opp.6p6 183 Scp-eBog.gooPEogo6app.6.E6 Das5343.63sebp.6 5o4q.posSaoq.D5opp.6-e5 6oqqoBPDaq.o6oppae6 pErepaqo63e.e.6-e6 0q.pooqqoaeoaqaBoPuBp.6 SL
qpq.oqqoaP6pqaBop.e.6-e.6 PLZ
gypoggooPEBTaSaps5.25 5paq6aeEqopE.
3/2 Teog6o.e5 64aD46.6DgEr4p4pq.qoae6 qp5qaoq..653q.B.4-epagqoapB
gpaoqqaa.e.5 :ON ca bus HNOEDIDVEE aoNanbas - IS -e tSIOZ/IOSII/I3c1 178L6/I0 OM
L3-TT-3003 TLEOTT730 'VD
8L E o q535e4g5z.e6eq.3.6 LLE . o p.6q.Bo5pq.q.5q.P6Pq.DE, 9LE s SLE o gBoBpq.q..6.4.2.6.eqa6 T7LE o q.53-e.eq.q5q.P.5.egoB
ELE s p.6q..6oEreq.q.6.Ere.6Pq.o.6 ZLE o p5q.606-eq.q.6.6pEreq.a6 ILE o p5q6abt,qq.o6P.6P4o5 OLE o 05.2.4q.4.6aPaeq.3.6 69E o .4.6z.Ereqq6De5Pq.DE.
89E o q.6q.6.egq.5aPErego6 L9E o p.6q.06.6pTA.6a.e6.24a5 99E sos P.6.6go.6.egg.6o-e6eqa6 59E o p6.6.4o6P4gEop.Ere4D6 "e5q6a6se q z6a.e.6.2g DE.
E9E o q..6o6vqq.5aP5u.q.p.6 Z9E o 3.6P4q6op.6o.6 19E o 3Ereq.aq6asEreq.36 09E o pBq..5a6p-eq..6opEeq.pE.
, 65E o qbae.6e4o.5 85E o P6q5a6pgpEopEego.6 LSE o .46DEveq..e5oEB.eq.o.6 95E o P5q.5a6Pqqa.eq.3.6 SSE o vEq..6z,Ereq.qoaPqa.6 T7SE o .e.645a6Pq.q.aaegoE.
ESE o .e6z6a6Pq..463.e.eqa.5 ZSE o q..6DB.eqq.6ape.eq.D6 TSE s 605q4q4gq4T4506 OSE s qq.5oq.6q.q.5aq.5q.q6o6q5o5 6E o oaappoopoopogq5oz6D6 8E s oaa.6a6o6a6Boq.q.6aÃ.63.6 LE s apaeo6a6a56a6q636.6a5 9E s Daabo.636D563q.E.BoS6DB
SE s oaa6DE.35D56355.6a66a6 T7PE o paa6o5a6DE.6a6.6.53.6.63.6 e6q.a36eq.65Daeqo63.6 ZT7E o .6o5D5a6a6p6a6pEo6a6 -EVE
OP6pqa6aDqopq6pao6D6 OVE o q.35-4..e6q.oaqq.6pq..6q.p5a6 6EE o .6364e64aDqq6aq..6.Te.636 8EE s pa36353.6a5.6o-A.q.6ae636 LEE s oaa6a6a63Ã5a6q6D'e.63.6 .9EE s 333.60636o6.63;65apEo.6 SEE s 333.63.6a636.6a6.66635 VEE s 3q.3333aq.q.E.q.aseBo-e6.6q.p336 EEE o u.6.6q.o6p44.6qp.6vaa6 ZEE
.E.Teoaq.Eq.qa.e=ep=eaaeao6 TEE o qp.EreS6p5oq..44-e35 OEE sos go.6.e.6qq.5a6gTe35 6ZE o TeeEeeaBB.6aBBeoTeoqqeoh 8E sos q.pEceEq.q.E.aq.Bg.paE, LE o go6pEr4oEreqEq.po5 9E sos qp5e6q..46o6E.Te35 SZE o q.aae.6qq..6zp.6TeD5 T7ZE o q.DEre.6T464pEq..eo.6 :om ca bas '31\10EDIDVEL aomanbas - Zg -tSIOZ/IOSII/I3c1 178L6/I0 OM
LZ-TT-ZOOZ TLEOTVZO 'VD
SEQUENCE BACKBONE SEQ
ID NO:
gctagazgttagtgt o 379 gctagctttagagctttagagctt o 380 gctaggcgttagcgt 0 381 gctagtcgatagc a 382 gctagtcgatagcgt 0 383 gctagtcgctagc 0 384 gctandcghhagc o 385 gctatgacgttccaaggg S 386 gctcga S 387 gctcgttcagcgcgtct sos 388 gctgaaccttccatgctgtt 389 gctgagctcatgccgtctgc sos 390 gctggaccttccat 391 gctggaccttccat 0 392 gctggccagcttacctcccg 393 gctgtaaaatgaatcggccg sos 394 gctgtggggeggctcctg 5 395 gcttgacgtcaagc a 396 gcttgacgtctagc o 397 gcttgacgtttagc a 398 gcttgcgttgcgttt sos 399 gcttggagggcctgtaagtg 400 ggaacgtt a 401 ggaagacgttaga a 402 ggaattagtaatagatatagaagtt a 403 ggagaaacccatgagctcatctgg a 404 ggagctcttcgaacgccata 405 ggcagtgcaggctcaccggg 406 ggccaactttcaatgtgggatggcctc 407 ggccatcccacattgaaagtt 408 ggccttttcccccccccccc 0 409 ggcggcggcggcggcggcgg o 410 ggcgttattcctgactcgcc a 411 ggctatgtcgatcctagcc a 412 ggctatgtcgttcctagcc 0 413 ggctccggggagggaatttttgtctat 0 414 ggctgtattcctgactgccc 5 415 gggaatgaaagattttattataag 0 416 ggggactttccgctggggactttccagggggactttcc sos 417 ggggagggaggaacttcttaaaattcccccagaatgttt a 418 ggggagggg 5 419 ggggagggt 5 420 ggggcatgacgttcaaaaaa 5 421 ggggcatgacgttcaaaaaa sos 422 ggggcatgacgttcgggggg s2 423 =
ggggoatgacgtt cgggggg sos 424 ggggc atgagc t t c gggggg s 425 ggggcatgagcttcgggggg SOS 426 ggggcctctatacaacctggg 427 gggggacgttggggg a 428 gggggggg9g9g9g9ggggg sos 429 g999ggggaggggggggggg 0 430 ggggggttggggaaaacccggactecctgca a 431 gggggttttttttttggggg 432 ggggtaatcgatcagggggg 55 433 VIM) 01/97843 SEQUENCE BACKBONE SEQ
ID NO:
ggggtaatcgatgagggggg 0 434 ggggtaatgcatcagggggg sos 435 ggggtcaacgttgagggggg sos 436 ggggtcaacgttgagggggg 5 437 ggggtcaagcttgagggggg sos 438 ggggtcaagtctgagggggg sos 439 ggggtccagcgtgcgccatggggg sos 440 ggggtccctgagactgcc 441 ggggtcgaccttggagggggg sos 442 ggggtcgacgtcgagggggg S 443 ggggtcgtcgttttgggggg 444 ggggtctgtcgttttgggggg sos 445 ggggtctgtgcttttgggggg sos 446 ggggtgacgttcagggggg sos 447 ggggtgtcgttcagggggg sos 448 ggggttgacgttttgggggg sos 449 ggggttgggggtt 450 ggtacctgtggggacattgtg 0 451 ggtgaggtg S 452 ggtggtgtaggttttgg o 453 ggttacggtctgtcccatat 454 ggttcacgtgctcatggctg 0 455 gtaacgtt o 456 gtagccttccta 457 gtaggggactttccgagctcgagatcctatg 0 458 gtcactcgtggtacctcga S 459 gtccatggcgtgcgggatga 460 gtcccaggttgtatagaggctgc 461 gtccccatttcccagaggaggaaat 0 462 gtccgggccaggccaaagtc 5 463 gteggtcctgatgctgttcc sos 464 gtctatcggaggactggcgc 465 gtctgtcccatgatctcgaa 466 gtgaaticgttcicgggict o 467 gtgccggggtctccgggc S 468 gtgccggggtctccgggc o 469 gtgcgcgcgagcccgaaatc 5 470 gtgctgatcaccgatatcctgttcgg 471 gtgcttgaccaccgatatttgg 472 gtggttacggtcgtgcccat 473 gtgtcggggtctccgggc 474 gttctcagataaagcggaaccagcaacagacacagaa 475 gttgaaacccgagaacatcat S 476 gttggatacaggccagactttgttg 0 477 gtttttatataatttggg o 478 gzaatattgcb 0 479 gzggzgggzggzgzgzgccc 480 taaacgtt 5 481 taagcgct o 482 taagctctgtcaacgccagg 483 taccgagcttcgacgagatttca 0 484 _taccgcgtgcgaccctct S 485 tactcttcggatcccttgcg sos 486 tagaaacagcattcttcttttagggcagcaca 487 tagacgtc 488 SEQUENCE BACKBONE SEQ
ID NO:
tagacgttagcgtga 0 489 tatagtccctgagactgccccaccttctcaacaacc 490 tatcggaggactggcgcgccg 491 tatgccgcgcccggacttat sos 492 tcaaatgtgggattttcccatgagtct o 493 tcaacg s 494 tcaacgtc o 495 tcaacgtt p-ethoxy 496 tcaacgtt S 497 tcaacgtt 0 498 tcaacgttaacgttaacgtt o 499 tcaacgttaacgttaacgttaacgttaacgttb S 500 tcaacgttga 5 501 tcaacgttga 0 502 tcaacgttgab o 503 tcaacgttgaf o 504 tcaagctt p- ethoxy 505 tcaagctt 0 506 tcaatgctgaf o 507 tcaazgtt 0 508 tcaazgttgab o 509 tcaccggt S 510 tcacgctaacctctagc o 511 tcacgctaacctctgac o 512 tcacgctaacgtctagc o 513 tcacgt o 514 tcagaccacgtggtcgggtgttcctga o 515 tcagaccagctggtcgggtgttcctga o 516 tcagcgct 0 517 tcagcgtgcgcc S 518 tcagctctggtactttttca 519 tcaggaacacccgaccacgtggtctga o 520 tcaggaacacccgaccagctggtctga 0 521 tcaggggtggggggaacctt sos 522 tcagzgct o 523 tcatcgat 0 524 tccaagacgttcctgatgct 0 525 tccaagtagttcctagttct 0 526 tccaccacgtggctgatgct o 527 tccaccacgtggtctatgct S 528 tccacgacgttttcgacgtt s 529 tccagacggtgaagt o 530 tccagacgttgaagt 531 tccagagcttgaagt o 532 tccagcgtgcgccata sos 533 tccaggacgttcctagttct 534 tccaggacttctctcaggtt 535 tccaggacttctctcaggtt sos 536 tccaggactttcctcaggtt 5 537 tccaggactttcctcaggtt 0 538 tccaggagcttcctagttct 0 539 tccaggatgttcctagttct o 540 tccagtctaggcctagttct 541 tccagttccttcctcagtct 0 542 tccagttcgagcctagttct 0 543 VIM) 01/97843 PCT/US01/20154 SEQUENCE BACKBONE SEQ
ID NO:
tccataacgttcctgagtct sos 544 tccataacgttcctgatgct o 545 tccatagcgatcctagcgat o 546 tccatagcggtcctagcggt o 547 tccatagcgttcctagcgtt s 548 tccatagcgttcctagcgtt o 549 tccatcacgtgcctgagtct sos 550 tccatgacattcctgatgct o 551 tccatgacggtcctgacggt s 552 tccatgacggtcctgacggt o 553 tccatgacggtcctgagtct sos 554 tccatgacggtcctgatgct o 555 tccatgacgtccctgagtct sos 556 tccatgacgtccctgatgct o 557 tccatgacgttcctagttct o 558 tccatgacgttcctctccatgacgttcctctccatgacgttcctc o 559 tccatgacgttcctgacgtt s 560 tccatgacgttcctgacgtt 561 tccatgacgttcctgacgtt sos 562 tccatgacgttcctgacgtt o 563 tccatgacgttcctgagtct sos 564 tccatgacgttcctgatcc 565 tccatgacgttcctgatgct o 566 tccatgacgttcctgatgct s 567 tccatgacgttcctgcagttcctgacgtt s 568 tccatgacgttcctgccgtt s 569 tccatgacgttcctgcgttt s 570 tccatgacgttcctggcggg s 571 tccatgacgttcztgatgct o 572 tccatgagcttcctgagctt s 573 tccatgagcttcctgagtct o 574 tccatgagcttcctgagtct p-ethoxy 575 tccatgagcttcctgagtct s 576 tccatgagcttcctgatgct s2 577 tccatgagcttccttgagtct 578 tccatgaigttcctgaigtt s 579 tccatgatgttcctagttct o 580 tccatgazgttcctagttct o 581 tccatgazgttcctgatgct o 582 tccatgazgttcctgazgtt s 583 tccatgccggtcctgagtct sos 584 tccatgccggtcctgatgct o 585 tccatgccggtcctgccggt o 586 tccatgccgttcctgccgtt s 587 tccatgccgttcctgccgtt o 588 tccatgcgcgtcctgcgcgt o 589 tccatgcgtgcgtgcgtttt s 590 tccatgcgttgcgttgcgtt s 591 tccatgctggtcctgagtct sos 592 tccatgctggtcctgatgct o 593 tccatggcgggcctggcggg s 594 tccatggcggtcctgatgct o 595 tccatgtagttcctagttct o 596 tccatgtccttcctgatgct 597 tccatgtcgatcctgagtct sos 598 SEQUENCE BACKBONE SEQ
ID NO:
tccatgtcgatcctgatgct o 599 tccatgtcgctcctgagtct sos 600 tccatgtcgctcctgatcct o 601 tccatgtcggtcctgagtct sos 602 tccatgtcggtcctgatgct 603 tccatgtcggtcctgatgct s 604 tccatgtcggtcctgctgat o 605 tccatgtcggtzctgatgct o 606 tccatgtcgttccgcgcgcg o 607 tccatgtcgttcctagttct 608 tccatgtcgttcctgagtct sos 609 tccatgtcgttcctgatgcg o 610 tccatgtcgttcctgatgct o 611 tccatgtcgttcctgccgct o 612 tccatgtcgttcctgtagct o 613 tccatgtcgttcctgtcgtt s 614 tccatgtcgttcctgtcgtt o 615 tccatgtcgtttttgtcgtt s 616 tccatgtgcttcctgatgct o 617 tccatgtzggtcctgagtct sos 618 tccatgtzggtcctgatgct o 619 tccatgtzgttcctgatget o 620 tccatgtzgttcctgtzgtt s 621 tccattgcgttccttgcgtt o 622 tcccgacggtgaagt o 623 tcccgccgttgaagt o 624 tcccgcgcgttccgcgcgtt s 625 tccctgagactgccccacctt 626 tccgatcg o 627 tccggacggtgaagt o 628 tccggccgttgaagt o 629 tccgtacg o 630 tcctaacgttgaagt 0 631 tcctagcgttgaagt o 632 tcctcacgttgaagt o 633 tcctga o 634 tcctgaaaaggaagt s 635 tcctgacgatgaagt o 636 tcctgacgctgaagt o 637 tcctgacggggaagt o 638 tcctgacggggaagt s 639 tcctgacggggagt s 640 tcctgacggtgaagt o 641 tcctgacggtgaagt s 642 tcctgacgtagaagt o 643 tcctgacgtcgaagt o 644 tcctgacgtggaagt o 645 tcctgacgtggaagt s 646 tcctgacgttaga o 647 tcctgacgttccc o 648 tcctgacgttcccctggcggtcccctgtcgct o 649 tcctgacgttcctgacgtt s 650 tcctgacgttcctggcggtcctgtcgct o 651 tcctgacgttccttc o 652 _ tcctgacgttcggcgcgcgccc s 653 SEQUENCE BACKBONE
SEO ID NO: .
tcctgacgttgaagt o 654 _ tcctgacgttgaagt s 655 tcctgagcttgaagt o 656 tcctgagcttgaagt s 657 tcctgazgttgaagt o 658 tcctgccgttgaagt o 659 tcctgccgttgaagt s 660 tcctggaggggaagt o 661 _ tcctggaggggaagt s 662 tcctggcggggaagt o 663 tcctggcggggaagt s 664 tcctggcggtcctggcggtt s 665 tcctggcggtgaagt o 666 tcctggcggtgaagt s 667 tcctggcgtggaagt s 668 tcctggcgttgaagt o 669 tcctggcgttgaagt s 670 t cc tgggggggaagt o 671 tcctggtggggaagt o 672 tcctggzggggaagt o 673 tcctgtcgctcctgtcgct o 674 tcctgtcgctcctgtcgctcctgtcgct o 675 tcctgtcgttcctgtcgtt s 676 tcctgtcgttcctgtcgttggaacgacagg o 677 tcctgtcgttcctgtcgtttcaacgtcaggaacgacagga o 678 tcctgtcgttccttgtcgtt s 679 tcctgtcgttgaagt o 680 tcctgtcgttgaagtttttt o 681.
tcctgtcgttttttgtcgtt s 682 tccttacgttgaagt o 683 tccttgtcgttcctgtcgtt s 684 tcgacgtc o 685 tcgacgttcccccccccccc o 686 tcgagacattgcacaatcatctg o 687 tcgccgttcccccccccccc 0 688 tcgcgtgcgttttgtcgttttgacgtt s 689 tcgga o 690 tcggcgttcccccccccccc o 691 tcgtag s 692 tcgtca o 693 tcgtcattcccccccccccc o 694 tcgtcgatcccccccccccc o 695 tcgtcgctcccccccccccc o 696 tcgtcgctgtctccg s 697 tcgtcgctgtctccgcttctt s 698 tcgtcgctgtctccgcttctt so 699 tcgtcgctgtctccgcttctt 52o 700 tcgtcgctgtctccgcttcttcttgcc s 701 tcgtcgctgtctgcccttctt s 702 tcgtcgctgttgtcgtttctt s 703 _ tcgtcggtcccccccccccc o 704 tcgtcgtcagttcgctgtcg sos 705 tcgtcgtcgtcgtcgtcgtcgtt sos 706 tcgtcgtcgtcgtt s 707 tcgtcgtcgtcgtt s2 708 SEQUENCE BACKBONE SEQ ID
NO:
tcgtcgtcgtcgtt s20 709 tcgtcgtcgtcgtt os2 710 tcgtcgttccccccccc s 711 tcgtcgttcccccccccccc o 712 -tcgtcgttcoccccoccoccb o 713 tcgtcgttccccccczcccc o 714 tcgtcgttggtgtcgttggtgtcgtt s 715 tcgtcgttggttgtcgttttggtt s 716 tcgtcgttgtcgttgtcgtt s 717 tcgtcgttgtcgttgtcgtt sos 718 tcgtcgttgtcgttttgtcgtt s 719 tcgtcgttgtcgttttgtcgtt sos 720 tegtcgtttcgtcgttttgacgtt s 721 tcgtcgtttgcgtgcgtttcgtcgtt s 722 tcgtcgtttgtcgttttgtcgtt s 723 tcgtcgttttgacgttttgacgtt s 724 tcgtcgttttgacgttttgtcgtt s 725 tcgtcgttttgcgtgcgttt s 726 tcgtcgttttgtcgttttgggggg 727 tcgtcgttttgtcgttttgtcgt s2 728 tcgtcgttttgtcgttttgtcgtt s 729 tcgtcgttttgtcgttttgtcgtt sos 730 tcgtcgttttgtcgttttgtcgtt o 731 tcgtcgttttgtcgttttgtegtt s2 732 tcgtcgttttgtcgttttgtcgttb o 733 tcgtcgttttgtcgttttgtcgttttgtcgtt s 734 tcgtcgttttgtggttttgtggtt s 735 tcgtcgttttttgtcgttttttgtcgtt s 736 tcgtcgtttttttttttttt s 737 tcgtga s 738 tcgtga o 739 tcgtgg s 740 tcgtzgttcccccccceccc o 741 tcntcgtnttntcgtnttntcgtn s 742 tctaaaaaccatctattcttaaccct o 743 tctagcgtttttagcgttcc sos 744 tctatcccaggtggttcctgttag o 745 tctatcgacgttcaagcaag s 746 tctccatcctatggttttatcg 0 747 tctccatgatggttttatcg 748 tctcccagcgagcgagcgccat s 749 tctcccagcgagcgccat s 750 tctcccagcgcgcgccat s 751 tetcccagcgggcgcat s 752 tctcccagcgtacgccat s 753 tctcccagcgtcgccat s 754 tctcccagcgtgcgccat s 755 tctcccagcgtgcgccat o 756 tctcccagcgtgcgccatat sos 757 tctcccagcgtgcgcctttt sos 758 tctcccagcgtgcgtgcgccat s 759 tctcccagcgtgcgttatat sos 760 tctcccagcgtgcgtttt s 761 tctcccagcgttgcgccatat sos 762 tctcccatcgtcgccat s 763 SEQUENCE BACKBONE SEQ ID
NO:
tctcccgacgtgcgccat S 764 tctcccgtcgtgcgccat s 765 tctccctgcgtgcgccatat sos 766 tetcctagcgtgcgccatat sos 767 tctgacgtcatctgacgttggctgacgtct 0 768 tctgcgtgcgtgcgccatat sos 769 tcttcgaa 0 770 tcttgcgatgctaaaggacgtcacattgcacaatcttaataaggt 0 771 tctttattagtgactcagcacttggca 0 772 tcztgacgttgaagt 0 773 tgaacgtt 0 774 tgcaatgtgacgtcctttagcat 0 775 tgcaggaagtccgggttttccccaacccccc 0 776 tgcatcagctct 5 777 tgcatcagctct sos 778 tgcatcccccaggccaccat s 779 tgcatgccgtacacagctct sos 780 tgcatgccgtacacagctct 5 781 tgcatgccgtacacagctct o 782 tgcatgccgtgcatccgtacacagctct S 783 tgccaagtgctgagtcactaataaaga 0 784 tgcccaaagaggaaaatttgtttcatacag o 785 tgcgctct S 786 tgctagctgtgcctgtacct 787 tgctagctgtgcctgtacct s 788 tgctgcttcccccccccecc o 789 tgctgcttcccccccccccc s 790 tgctgcttttgtgcttttgtgctt o 791 tgctgcttttgtgcttttgtgctt s 792 tggaccttccat 793 tggaccttctatgteggtcc 794 tggagggtgagggtggggccagagcgggtggggctgattggaa 0 795 tggaggtcccaccgagatcggag 0 796 tggttacggtctgtcccatg 797 tgtatctctctgaaggact 0 798 tgtccagccgaggggaccat 799 tgtcccatgtttttagaagc 800 tgtcgttgtcgtt s 801 tgtcgttgtcgttgtcgttgtcgtt 5 802 tgtcgtttgtcgtttgtcgtt s 803 ttaacggtggtagcggtattggtc 0 804 ttaacgtt o 805 ttaagaccaataccgctaccaccg 0 806 ttaggacaaggtctagggtg 807 ttagggttagggttagggtt s2 808 ttcagttgtcttgctgcttagctaa 0 809 ttcatgccttgcaaaatggcg 810 ttccaatcagccccacccgctctggccccaccctcaccctcca o 811 ttccatgctgttccggctgg 812 ttccatgtcggtcctgat sos 813 ttccgccgaatggcctcaggatggtac 814 ttccgctttatctgagaaccatct 815 ttcctctctgcaagagact 0 816 ttcgggcggactcctccatt sos 817 ttcgggcggactcctccatt 0 818 SEQUENCE BACKBONE
SEQ ID NO:
_ ttcgtcgttttgtcgttttgtcgtt 5 ttctgtgtctgttgctggttccgctttatctgagaac ttgaaactgaggtgggac ttgccccatattttagaaac ttggggggggtt s ttgtactctccatgatggtt tttaccttttataaacataactaaaacaaa 0 tttgaatcctcagcggtctccagtggc 0 tttgaattcaggactggtgaggttgag o tttgaattccgtgtacagaagcgagaagc 0 tttgagaacgctggaccttc sos tttgcggccgctagacttaacctgagagata 0 tttgggcccacgagagacagagacacttc 0 tttgggcccgcttctcgcttctgtacacg 0 ttttctagagaggtgcacaatgctctgg o tttttggggggggggttttt 0 tttttttttttttf o tttttttttttttf so tttttttttttttttttt s tttttttttttttttttttt s tttttttttttttttttttt o ttttttttttttttttttttt s tttttttttttttttttttttttt s ttttttttttttttttttttttttttt s tzaacgtt o tzgtcgttcccccccccccc o tzgtcgttttgtcgttttgtcgtt o tzgtggttcccccccccccc o tzgtzgttttgtzgttttgtzgtt 0 tzgtzgttttgtzgttttgtzgtt S
In Table 4 with respect to sequences the letter symbols aside from a, c, t, and g are defined as follows: "b" indicates a biotin moiety attached to that end of the oligonucleotide when it is single and is listed on the 5' or 3' end of oligonucleotide; "d"
represents a, g, or t;
"f" represents fluorescein isothiocyanate (FITC) moiety attached to the 5' or 3' end of oligonucleotide; "h" represents a, c, or t; "i" represents inosine; "n"
represents any nucleotide; "z" represents 5-methylcytosine.
Also in Table 4 with respect to backbones the notations are defined as follows: "o"
represents phosphodiester; "os" represents phosphorothioate and phosphodiester chimeric with phosphodiester on 5' end; "os2" represents phosphorodithioate and phosphodiester chimeric with phosphodiester on 5' end; "p-ethoxy" represents p-ethoxy backbone (see, e.g., U.S. Patent No. 6,015,886); "po" represents phosphodiester; "s" represents phosphorothioate;
"s2" represents phosphorodithioate; "s2o" represents phosphorodithioate and phosphodiester chimeric with phosphodiester on 3' end; "so" represents phosphorothioate and phosphodiester chimeric with phosphodiester on 3' end; and "sos" represents chimeric phosphorothioate/phosphodiester with phosphorothioate at the 5' and 3' ends.
The nucleic acids are delivered in effective amounts. The term "effective amount" of a immunostimulatory nucleic acid refers to the amount necessary or sufficient to realize a desired biologic effect. For example, an effective amount of an immunostimulatory nucleic acid could be that amount necessary to cause activation of the immune system.
According to some aspects of the invention, an effective amount is that amount of an immunostimulatory nucleic acid and that amount of an antibody, which when combined or co-administered, results in the prevention or the treatment of the cancer. In some embodiments a synergistic w effect is observed. A synergistic amount is that amount which produces an anti-cancer response that is greater than the sum of the individual effects of either the immunostimulatory nucleic acid and the antibody alone. For example, a synergistic combination of an immunostimulatory nucleic acid and an antibody provides a biological effect which is greater than the combined biological effect which could have been achieved using each of the components (i.e., the nucleic acid and the antibody) separately. The biological effect may be the amelioration and or absolute elimination of symptoms resulting from the cancer. In another embodiment, the biological effect is the complete abrogation of the cancer, as evidenced for example, by the absence of a tumor or a biopsy or blood smear which is free of cancer cells.
The effective amount of immunostimulatory nucleic acid necessary to treat a cancer or in the reduction of the risk of developing a cancer may vary depending upon the sequence of the immunostimulatory nucleic acid, the backbone constituents of the nucleic acid, and the mode of delivery of the nucleic acid. The effective amount for any particular application can also vary depending on such factors as the cancer being treated, the particular immunostimulatory nucleic acid being administered (e.g., the nature, number or location of immunostimulatory motifs in the nucleic acid), the size of the subject, or the severity of the disease or condition. One of ordinary skill in the art can empirically determine the effective amount of a particular immunostimulatory nucleic acid and antibody combination without necessitating undue experimentation. Combined with the teachings provided herein, by choosing among the various active compounds and weighing factors such as potency, relative bioavailability, patient body weight, severity of adverse side-effects and preferred mode of administration, an effective prophylactic or therapeutic treatment regimen can be planned which does not cause substantial toxicity and yet is entirely effective to treat the particular subject.
Therapeutic doses of cancer therapies are well known in the field of medicine for the treatment of cancer. These dosages have been extensively described in references such as Remington's Pharmaceutical Sciences, 18th ed., 1990; as well as many other medical references relied upon by the medical profession as guidance for the treatment of cancer.
Therapeutic dosages of immunostimulatory nucleic acids have also been described in the art and methods for identifying therapeutic dosages in subjects are described in more detail herein.
Subject doses of the compounds described herein typically range from about 0.1 1..tg to 10 mg per administration, which depending on the application could be given daily, weekly, or monthly and any other amount of time therebetween. More typically mucosal or local doses range from about 10 pg to 5 mg per administration, and most typically from about 100 i-tg to 1 mg, with 2 - 4 administrations being spaced hours, days or weeks apart. More typically, immune stimulant doses range from 1 i_tg to 10 mg per administration, and most typically 10 i.tg to 1 mg, with daily or weekly administrations. Subject doses of the compounds described herein for parenteral delivery, wherein the compounds are delivered without another therapeutic agent are typically 5 to 10,000 times higher than the effective mucosal dose or for immune stimulant applications, and more typically 10 to 1,000 times higher, and most typically 20 to 100 times higher. More typically parenteral doses for these purposes range from about 101.1g to 5 mg per administration, and most typically from about 100 i_tg to 1 mg, with 2 - 4 administrations being spaced hours, days or weeks apart. In some embodiments, however, parenteral doses for these purposes may be used in a range of 5 to 10,000 times higher than the typical doses described above.
For any compound described herein the therapeutically effective amount can be initially determined from animal models, e.g., the animal models described herein. A
therapeutically effective dose can also be determined from human data for CpG
nucleic acids which have been tested in humans (human clinical trials have been initiated and the results publicly disseminated) and for compounds which are known to exhibit similar pharmacological activities. Higher doses may be required for parenteral administration, as described above. The applied dose can be adjusted based on the relative bioavailability and potency of the administered compound. Adjusting the dose to achieve maximal efficacy based on the methods described above and other methods as are well-known in the art is well within the capabilities of the ordinarily skilled artisan.
The formulations of the invention are administered in pharmaceutically acceptable solutions, which may routinely contain pharmaceutically acceptable concentrations of salt, buffering agents, preservatives, compatible carriers, adjuvants, and optionally other therapeutic ingredients.
For use in therapy, an effective amount of the nucleic acid can be administered to a subject by any mode that delivers the nucleic acid to a subject.
"Administering" the pharmaceutical composition of the present invention may be accomplished by any means known to the skilled artisan. Some routes of administration include but are not limited to oral, intranasal, intratracheal, inhalation, ocular, vaginal, rectal, parenteral (e.g., intramuscular, intradermal, intravenous or subcutaneous injection) and direct injection.
For oral administration, the compounds (i.e., nucleic acids and antibodies) can be delivered alone without any pharmaceutical carriers or formulated readily by combining the active compound(s) with pharmaceutically acceptable carriers well known in the art. The term "pharmaceutically-acceptable carrier" means one or more compatible solid or liquid filler, dilutants or encapsulating substances which are suitable for administration to a human or other vertebrate animal. The term "carrier" denotes an organic or inorganic ingredient, natural or synthetic, with which the active ingredient is combined to facilitate the application.
The components of the pharmaceutical compositions also are capable of being commingled with the compounds of the present invention, and with each other, in a manner such that there is no interaction which would substantially impair the desired pharmaceutical efficiency.
Such carriers enable the compounds of the invention to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions and the like, for oral ingestion by a subject to be treated. Pharmaceutical preparations for oral use can be obtained as solid excipient, optionally grinding a resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries, if desired, to obtain tablets or dragee cores. Suitable excipients are, in particular, fillers such as sugars, including lactose, sucrose, mannitol, or sorbitol; cellulose preparations such as, for example, maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose, hydroxypropylmethyl-cellulose, sodium carboxymethylcellulose, and/or polyvinylpyrrolidone (PVP). If desired, disintegrating agents may be added, such as the cross-linked polyvinyl pyrrolidone, agar, or alginic acid or a salt thereof such as sodium alginate. Optionally the oral formulations may also be formulated in saline or buffers for neutralizing internal acid conditions.
Dragee cores may be provided with suitable coatings. For this purpose, concentrated sugar solutions may be used, which may optionally contain gum arabic, talc, polyvinyl pyrrolidone, carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures. Dyestuffs or pigments may be added to the tablets or dragee coatings for identification or to characterize different combinations of active compound doses.
Pharmaceutical preparations which can be used orally include push-fit capsules made to of gelatin, as well as soft, sealed capsules made of gelatin and a plasticizer, such as glycerol or sorbitol. The push-fit capsules can contain the active ingredients in admixture with filler such as lactose, binders such as starches, and/or lubricants such as talc or magnesium stearate and, optionally, stabilizers. In soft capsules, the active compounds may be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycols. In addition, stabilizers may be added. Microspheres formulated for oral administration may also be used. Such microspheres have been well defined in the art. All formulations for oral administration should be in dosages suitable for such administration.
For buccal administration, the compositions may take the form of tablets or lozenges formulated in conventional manner.
For administration by inhalation, the compounds for use according to the present invention may be conveniently delivered in the form of an aerosol spray, from pressurized packs or a nebulizer, with the use of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas. In the case of a pressurized aerosol the dosage unit may be determined by providing a valve to deliver a metered amount. Capsules and cartridges of e.g., gelatin for use in an inhaler or insufflator may be formulated containing a powder mix of the compound and a suitable powder base such as lactose or starch.
The compounds, when it is desirable to deliver them systemically, may be formulated for parenteral administration by injection, e.g., by bolus injection or continuous infusion.
Formulations for injection may be presented in unit dosage form, e.g., in ampoules or in multi-dose containers, with an added preservative. The compositions may take such forms as suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
Pharmaceutical formulations for parenteral administration include aqueous solutions of the active compounds in water-soluble form. Additionally, suspensions of the active compounds may be prepared as appropriate oily injection suspensions. Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acid esters, such as ethyl oleate or triglycerides, or liposomes. Aqueous injection suspensions may contain substances which increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran. Optionally, the suspension may also contain suitable stabilizers or agents which increase the solubility of the compounds to allow for the preparation of highly concentrated solutions.
Alternatively, the active compounds may be in powder form for constitution with a suitable vehicle, e.g., sterile pyrogen-free water, before use.
The compounds may also be formulated in rectal or vaginal compositions such as suppositories or retention enemas, e.g., containing conventional suppository bases such as cocoa butter or other glycerides.
In addition to the formulations described previously, the compounds may also be formulated as a depot preparation. Such long acting formulations may be formulated with suitable polymeric or hydrophobic materials (for example as an emulsion in an acceptable oil) or ion exchange resins, or as sparingly soluble derivatives, for example, as a sparingly soluble salt.
The pharmaceutical compositions also may comprise suitable solid or gel phase carriers or excipients. Examples of such carriers or excipients include but are not limited to calcium carbonate, calcium phosphate, various sugars, starches, cellulose derivatives, gelatin, and polymers such as polyethylene glycols.
Suitable liquid or solid pharmaceutical preparation forms are, for example, aqueous or saline solutions for inhalation, microencapsulated, encochleated, coated onto microscopic gold particles, contained in liposomes, nebulized, aerosols, pellets for implantation into the skin, or dried onto a sharp object to be scratched into the skin. The pharmaceutical compositions may also include granules, powders, tablets, coated tablets, (micro)capsules, suppositories, syrups, emulsions, suspensions, creams, drops or preparations with protracted release of active compounds, in whose preparation excipients and additives and/or auxiliaries such as disintegrants, binders, coating agents, swelling agents, lubricants, flavorings, sweeteners or solubilizers are customarily used as described above. The pharmaceutical compositions are suitable for use in a variety of drug delivery systems. For a brief review of present methods for drug delivery, see Langer R, Science 249:1527-33 (1990).
The nucleic acids and/or antibodies may be administered per se (neat) or in the form of a pharmaceutically acceptable salt. When used in medicine the salts should be pharmaceutically acceptable, but non-pharmaceutically acceptable salts may conveniently be used to prepare pharmaceutically acceptable salts thereof. Such salts include, but are not limited to, those prepared from the following acids: hydrochloric, hydrobromic, sulphuric, nitric, phosphoric, maleic, acetic, salicylic, p-toluene sulphonic, tartaric, citric, methane sulphonic, formic, malonic, succinic, naphthalene-2-sulphonic, and benzene sulphonic. Also, such salts can be prepared as alkaline metal or alkaline earth salts, such as sodium, potassium or calcium salts of the carboxylic acid group.
Suitable buffering agents include: acetic acid and a salt (1-2% w/v); citric acid and a salt (1-3% w/v); boric acid and a salt (0.5-2.5% w/v); and phosphoric acid and a salt (0.8-2%
w/v). Suitable preservatives include benzalkonium chloride (0.003-0.03% w/v);
chlorobutanol (0.3-0.9% w/v); parabens (0.01-0.25% w/v) and thimerosal (0.004-0.02% w/v).
The nucleic acids or other therapeutics useful in the invention may be delivered in mixtures with additional antibodies. A mixture may consist of several antibodies in addition to the nucleic acid.
A variety of administration routes are available. The particular mode selected will depend, of course, upon the particular nucleic acids or antibodies selected, the particular condition being treated and the dosage required for therapeutic efficacy. The methods of this invention, generally speaking, may be practiced using any mode of administration that is medically acceptable, meaning any mode that produces effective levels of an immune response without causing clinically unacceptable adverse effects. Preferred modes of administration are discussed above.
The compositions may conveniently be presented in unit dosage form and may be prepared by any of the methods well known in the art of pharmacy. All methods include the step of bringing the compounds into association with a carrier which constitutes one or more accessory ingredients. In general, the compositions are prepared by uniformly and intimately bringing the compounds into association with a liquid carrier, a finely divided solid carrier, or both, and then, if necessary, shaping the product. Liquid dose units are vials or ampoules.
Solid dose units are tablets, capsules and suppositories.
Other delivery systems can include time-release, delayed release or sustained release delivery systems. Such systems can avoid repeated administrations of the compounds, increasing convenience to the subject and the physician. Many types of release delivery systems are available and known to those of ordinary skill in the art. They include polymer base systems such as poly(lactide-glycolide), copolyoxalates, polycaprolactones, polyesteramides, polyorthoesters, polyhydroxybutyric acid, and polyanhydrides.
Microcapsules of the foregoing polymers containing drugs are described in, for example, U.S.
Patent No. 5,075,109. Delivery systems also include non-polymer systems that are: lipids including sterols such as cholesterol, cholesterol esters and fatty acids or neutral fats such as mono-, di-, and tri-glycerides; hydrogel release systems; sylastic systems;
peptide based systems; wax coatings; compressed tablets using conventional binders and excipients;
partially fused implants; and the like. Specific examples include, but are not limited to: (a) erosional systems in which an agent of the invention is contained in a form within a matrix such as those described in U.S. Patent Nos. 4,452,775, 4,675,189, and 5,736,152, and (b) diffusional systems in which an active component permeates at a controlled rate from a polymer such as described in U.S. Patent Nos. 3,854,480, 5,133,974 and 5,407,686. In addition, pump-based hardware delivery systems can be used, some of which are adapted for implantation.
The nucleic acid may be directly administered to the subject or may be administered in conjunction with a pharmaceutically acceptable carrier or a delivery vehicle. The nucleic acid and optionally other therapeutic agents may be administered alone (e.g., in saline or buffer) or using any delivery vehicles known in the art. One type of delivery vehicle is referred to herein as a nucleic acid delivery complex. A "nucleic acid delivery complex"
shall mean a nucleic acid molecule associated with (e.g., ionically or covalently bound to; or encapsulated within) a targeting means (e.g., a molecule that results in higher affinity binding to target cell (e.g., dendritic cell surfaces and/or increased cellular uptake by target cells).
Examples of nucleic acid delivery complexes include nucleic acids associated with: a sterol (e.g., cholesterol), a lipid (e.g., a cationic lipid, virosome or liposome), or a target cell specific binding agent (e.g., a ligand recognized by target cell specific receptor). Preferred complexes may be sufficiently stable in vivo to reduce significant uncoupling prior to internalization by the target cell. However, the complex may be cleavable under appropriate conditions within the cell so that the nucleic acid may be released in a functional form.
The nucleic acids may be delivered by non-invasive methods as described above.
Non-invasive delivery of compounds is desirable for treatment of children, elderly, animals, and even adults and also to avoid the risk of needle-stick injury. Delivery vehicles for delivering compounds to mucosal surfaces have been described and include but are not limited to: Cochleates (Gould-Fogerite et al., 1994, 1996); Emulsomes (Vancott et al., 1998, Lowell et al., 1997); ISCOMs (Mowat et al., 1993, Carlsson et al., 1991, Hu et al., 1998, Morein et al., 1999); Liposomes (Childers et al., 1999, Michalek et al., 1989, 1992, de Haan 1995a, 1995b); Live bacterial vectors (e.g., Salmonella, Eschericlzia coil, Bacillus Cabnette-Guerin, Shigella, Lactobacillus) (Hone et al., 1996, Pouwels et al., 1998, Chatfield et al., 1993, Stover et al., 1991, Nugent et al., 1998); Live viral vectors (e.g., Vaccinia, adenovirus, Herpes Simplex) (Gallichan et al., 1993, 1995, Moss et al., 1996, Nugent et al., 1998, Flexner et al., 1988, Morrow et al., 1999); Microspheres (Gupta et al., 1998, Jones et al., 1996, Maloy et al., 1994, Moore et al., 1995, O'Hagan et al., 1994, Eldridge et al., 1989); nucleic acid vaccines (Fynan et al., 1993, Kuklin et al., 1997, Sasaki et al., 1998, Okada et al., 1997, Ishii et al., 1997); Polymers (e.g., carboxymethylcellulose, chitosan) (Hamajima et al., 1998, Jabbal-Gill et al., 1998); Polymer rings (Wyatt et al., 1998); Proteosomes (Vancott et al., 1998, Lowell et al., 1988, 1996, 1997); Sodium Fluoride (Hashi et al., 1998);
Transgenic plants (Tacket et al., 1998, Mason et al., 1998, Hag et al., 1995); Virosomes (Gluck et al., 1992, Mengiardi et al., 1995, Cryz et al., 1998); Virus-like particles (Jiang et al., 1999, Leibl et al., 1998).
The invention also includes kits. The kits generally include a package with a plurality of containers housing active agents and instructions for carrying out the methods of the invention. The active agents include but are not limited to immunostimulatory nucleic acids, antibodies such as antibodies specific for a cell surface antigen, and anti-cancer therapies.
The following examples are provided to illustrate specific instances of the practice of the present invention and are not to be construed as limiting the present invention to these examples. As will be apparent to one of ordinary skill in the art, the present invention will find application in a variety of compositions and methods.
Examples Introduction:
Extensive cross-talk exists between healthy B cells and T cells. There is evidence that malignant B cells also communicate with T cells. However, malignant cells appear to differ from their normal counterparts in a number of ways, including a decreased tendency to undergo apoptosis in response to normal signals, altered expression of a variety of surface markers, and altered ability to function as effective antigen presenting cells. Lagneaux L et al., Blood 91:2387-96 (1998); Gordon J et al., Leukemia 7 Suppl 2:S5-9 (1993);
Gordon J et al., Adv Exp Med Biol 406:139-44 (1996); Chaperot L et al., Exp Hematol 27:479-88 (1999).
Immunotherapeutic approaches have recently become part of our therapy of some subtypes of B-cell malignancy. Improved immunotherapy of B-cell malignancy will need to be designed based on the growing understanding of the cellular immunology of this disease.
Schultze JL
et al., J Mol Med 77:322-32 (1999).
A variety of cellular receptors and antigens are involved in growth, differentiation and apoptosis of B-cell malignancies. Antibodies or ligands against a variety of antigens can cause growth inhibition or even apoptosis including CD20, surface immunoglobulins, MHC
CD80, CD86 and CD40. Maloney DG, Semin Oncol 26:74-8 (1999); McLaughlin P et al., Semin Oncol 26:79-87 (1999); Shan D et al., Blood 91:1644-52 (1998); Coiffier B et al., Blood 92:1927-32 (1998); McLaughlin P et al., Oncology (Huntingt) 12:1763-70, (1998); Tutt AL et al., J Immunol 161:3176-85 (1998); Funakoshi S et al., Blood 83:2787-94 (1994); Mayumi M et al., J Allergy Clin Immunol 98:S238-47 (1996); Higaki Y et al., Immunol Cell Biol 72:205-14 (1994); Elsasser D et al., Blood 87:3803-12 (1996); Link BK et al., Blood 81:3343-9 (1993); Link BK et al., Int J Cancer 77:251-6 (1998). The relative contribution of antibody dependent cellular cytotoxicity (AD CC) versus trans-membrane signaling mediated by anti-B cell antibodies remains unclear. In the present study, we examined how CpG-DNA impacts on the phenotype, apoptosis and proliferation of different types of B-cell malignancy including follicular B-cell lymphoma and B-CLL.
Materials and Methods:
Cell culture: Fresh lymph node samples were obtained from the operating suite and were minced with a scalpel under aseptic conditions. The resulting suspension was passed sequentially through a sterilized sieve-tissue grinder containing a nylon mesh screen, a 150 gm mesh screen and a 60 gm mesh screen. Alternatively, mononuclear cells were obtained from peripheral blood or pleural fluid as described. Hartmann G et al., J
Pharmacol Exp Tlzer 285:920-8 (1998). Red blood cells were removed by resuspending the cells in 5 ml ACK lysis buffer according to standard procedures. Cells were frozen slowly and stored in liquid nitrogen. For analysis, cells were thawed and resuspended in 10 % (v/v) heat-inactivated (56 C, 1 h) FCS (HyClone, Logan, UT), 1.5 mM L-glutamine (all from Gibco BRL, Grand Island, NY) and incubated on a 96-well-plate (1 x 106 cells/nil) in the presence of ODN as indicated below. Not all assays were performed for all samples because of the limited number of cells available for some samples.
Oligonucleotides: Nuclease-resistant phosphorothioate-modified oligodeoxynucleotide (ODN) were purchased from Operon Technologies (Alameda, CA) and Hybridon Specialty Products (Milford, MA). Sequences were as follows: CpG ODN
2006:
5'-TCGTCGTTTTGTCGTTTTGTCGTT-3' (SEQ ID NO: 729), and control ODN 2017:
5'-CCCCCCCCCCCCCCCCCCCC-3' (SEQ 1D NO: 168). ODN was diluted in TE (10 mM
Tris-HC1, 1 mM EDTA, pH 8) using pyrogen-free reagents. ODN was added at a final concentration of 5 g/ml.
Flow cytometry: Cells were washed and resuspended in ice-cold PBS or Annexin V
binding buffer (10 mM HEPES/Na0H, 140 mM NaC1, 2.5 mM CaC12, pH 7.4). Murine or human serum was added (final concentration 1%) to block non-specific binding of antibodies.
Surface antigen staining was performed as described. Hartmann G et al., J
Pharnzacol Exp Ther 285:920-8 (1998). In brief, 1 x 105 cells per sample were stained with CyChrome-labeled anti-CD19 and FITC- or PE-labeled antibodies as indicated for 20 min on ice. They were then washed and analyzed by flow cytometry. Monoclonal antibodies to CD40 (5C3), CD69 (FN50), CD80 (L307.4), CD86 (IT2.2), CD54 (HASS), MHC I (G46-2.6) and MHC
II
(TU39) as well as isotype controls (IgG1, MOPC-21 and IgG2a, G155-178) were purchased from PharMingen, San Diego, CA. FITC-labeled polyclonal anti-human Ig was purchased from Southern Biotech, Birmingham, AL. 1D10, a monoclonal humanized antibody directed against a variant of HLA-DR was produced in our laboratory as described earlier. Link BK
et al., Blood 81:3343-9 (1993). C2B8, a monoclonal humanized anti-CD20 antibody, was purchased from IDEC Pharmaceuticals, San Diego, CA. 1D10 and C2B8 were labeled with FITC according to standard protocols. The analysis gate was set on viable cells identified according to FSC/SSC characteristics and Annexin V staining (> 97 % viable cells within analysis gate). Spectral overlap was corrected by appropriate compensation.
Flow cytometric data from 1 x 104 cells per sample were acquired on a FACScan (Beckton Dickinson Immunocytometry Systems, San Jose, CA). Data were analyzed using the computer program FlowJo (version 2.5.1, Tree Star, Inc., Stanford, CA).
CFSE staining: CFSE 5- (and 6-) carboxyfluorescein diacetate succinimidyl ester, Molecular Probes, USA, is a fluorescein-derived intracellular fluorescent label which is divided equally between daughter cells upon cell division. Staining of cells with CFSE
allows both quantification and immunophenotyping of proliferating cells in a mixed cell suspension. Interference between oligonucleotide degradation products and thymidine uptake (standard proliferation assay) is avoided by using this method. The technique has described in detail previously. Lyons AB et al., J Immunol Methods 171:131-7 (1994).
Briefly, cells were washed twice in PBS, resuspended in PBS (1 x 107 cells/ml) containing CFSE at a final concentration of 1 IuM, and incubated at 37 C for 10 minutes. Cells were washed three times with PBS.
TUNEL assay: A two-color DNA strand break labeling assay, based on a modification of the assay described by Li et al. (Li X et al., ExpCell Res 222:28-37 (1996)) was used to assess B-cell proliferation in response to CpG ODN. This assay involved terminal transferase-mediated dUTP nick end labeling (TUNEL) before and after induction of DNA strand breaks in BrdU-labeled cells. Briefly, cells were cultured for 3 days with and without ODN. They were then incubated for 16 hours in 10 M BrdU and placed onto slides by cytospin. Cells were then in 1% paraformaldehyde in PBS for 15 minutes followed by 20 minutes in 70% ethanol. DNA cleavage indicative of apoptosis cells was detected by labeling the 3'-DNA end of nicked strands with FITC-ddUTP (Boehringer-Mannheim). The use of dideoxy-dUTP prevented further elongation of the 3'-ends in subsequent steps. Slides were then placed face-down on a 2mm support at both ends on a UV
transilluminator and exposed for 5 minutes. The new DNA strand breaks induced by photolysis at sites of BrdU
incorporation (i.e., proliferating cells) were detected by a second TUNEL
labeling using tetramethylrhodamine-dUTP (TMR-dUTP, Boehringer-Mannheim). Both TUNEL staining steps included incubating slides in 500 of TdT mix (34 1 distilled water, 10R1 of 5X TdT
buffer, 5 1 of 25mM cobalt chloride, 12.5 units terminal transferase and 0.5nmol fluorochrome-conjugated-dUTP) (Boehringer-Mannheim) under a coverslip for one hour at 37 C in a humidified chamber. The slides were then washed in 5 quick changes of distilled water followed by 3 changes of 2XSSC containing 30% formamide for 5 minutes each at room temperature. After the second TUNEL labeling step, cells were counterstained for CD19, and also stained with Wright solution for blood cell differentiation and mounted in TM
Vectashiekt media containing DAPI counterstain (Vector Laboratories, Burlingame, CA).
The morphology and staining of cells were assessed using both visible light and fluorescence microscopy. Apoptotic cells were identified by green fluorescence (FITC
label), and proliferating cells by red fluorescence (TMR label). The percentage of apoptotic and proliferating cells was determined by counting at least 200 cells per sample by three observers blinded to whether cells were treated with ODN. Mean and standard error were determined for each sample based on these three readings.
Example 1: Immunostimulatory nucleic acids induce morphological and phenotypic changes in malignant B cells.
Our prior studies demonstrated that activation of naive human B cells by CpG
ODN
results in increased cell size (FSC) and granularity (SSC). Hartmann G et al., J Immunol 164:944-53 (2000). We therefore first determined whether such changes also occur in malignant B cells. Primary malignant B cells were obtained from lymph node biopsies, peripheral blood, or pleural fluid of patients with various types of B-cell malignancy. In addition, cells from the lymph node of a patient with benign reactive follicular hyperplasia were studied. Nine samples in total were evaluated (see Table 5). Cells were incubated for 72 hours in media containing CpG ODN 2006 (5 pg,/m1) or control ODN 2017. FSC
and SSC were examined with gating on CD19+ viable cells (Figure 1). Varying degrees of change in FSC and SSC were noted in response to CpG ODN 2006 when compared to control ODN 2017 or medium alone. Comparable changes were not found in the cells from the patient with benign reactive follicular hyperplasia.
Figure 1 depicts the morphologic changes of marginal zone lymphoma cells upon CpG ODN stimulation. Malignant .B cells from a patient with marginal zone lymphoma were stimulated with 5 pg/ml of no ODN (A and D), control ODN (B and E) or CpG ODN
(C and F) for 72 hours and analyzed by flow cytometry. A, B, and C illustrate FSC (x-axis) vs. SSC
(y-axis). D, E and F illustrate CD19 expression (x-axis) against FSC (y-axis), allowing for separation of B cells from other leukocyte subpopulations. Upon stimulation with CpG
ODN, B cells shifted up and to the right, indicating an increase in granularity and size. No changes could be detected without stimulation or on stimulation with the non-CpG ODN.
Expression of CD20, CD40, CD69, CD80, CD86, surface Ig, CD54, MHC I, MHC
and an HLA-DR variant antigen (moAb 1D10) were examined on viable CD19+ cells after incubation of cells with CpG ODN for 72 hours. Each of these markers was upregulated to varying extents in response to the CpG ODN 2006 compared to the control ODN
2017 (Fig.
2, Fig. 3).
Figure 2 depicts the expression of surface antigens on marginal zone lymphoma cells upon CpG ODN treatment. Flow cytometric analysis of surface antigen expression on malignant B cells from a patient with marginal zone lymphoma was performed 72 hours after stimulation with 5 g/ml of either CpG ODN or non-CpG ODN. On stimulation with CpG
ODN, median fluorescence intensity for all markers tested shifted to the right, indicating an increase in surface expression. Thin curves indicate incubation with medium alone, dotted curves incubation with control ODN, and bold curves incubation with CpG ODN.
Figure 3 depicts the expression of surface antigens on primary cells representing different B-cell malignancies and cells of a benign follicular hyperplasia upon CpG ODN
treatment. Cells from lymph node biopsies, peripheral blood or pleural fluid from patients with different B-cell malignancies were incubated for 72 hours with either media alone, control ODN or CpG ODN. Each panel represents one experiment.
CD20 was expressed to varying degrees in all samples tested. As is well known, baseline CD20 expression was lower in the B-CLL samples when compared to the B-cell malignancies of other histologies. CpG-ODN 2006 but not the control ODN 2017 increased CD20 expression in both B-CLLs and both marginal zone lymphomas. No or only little upregulation was seen in the other lymphoma samples. Non-malignant CD19+ cells derived from the reactive follicular hyperplasia decreased CD20 expression in response to CpG (Fig.
3). This data demonstrated a reverse correlation between the baseline expression of CD20 and CD40, and expression of these markers after incubation with CpG ODN; thus the lower the baseline level of CD20 and CD40, the higher was the responsiveness to CpG
ODN (r: -0.6; -0.4) (Fig. 4). This correlation was less clear for the other markers.
CD19+ cells derived from the reactive follicular hyperplasia showed high baseline expression of activation markers which was not further upregulated by CpG.
Figure 4 shows the CpG ODN effect on CD20 and CD40 is dependent on the baseline level of expression. Cells from lymph node biopsies, peripheral blood or pleural fluid from patients with different B-cell malignancies (see Table 5) were incubated with or without CpG ODN for 72 hours. Expression of CD20 and CD40 was measured by flow cytometry. Baseline expression of CD20 and CD40 with medium alone was compared to the expression of CD20 and CD40 in the presence of CpG ODN. The coefficients of correlation are indicated.
Table 5: Percentage Of CD19+ Cells In Samples Tested.
Sample Histology Source % CD19+ Cells Number 1 Chronic Lymphocytic Leukemia 1 Peripheral >98 %
Blood 2 Chronic Lymphocytic Leukemia 2 Peripheral 70 %
Blood 3 Large Cell Lymphoma 1 Pleural Fluid 55 %
4 Large Cell Lymphoma 2 Lymph Node 75 %
5 Mantle Cell Lymphoma Lymph Node 98 %
Diffuse Mixed Small and Large Cell 6 Lymph Node 50 %
Lymphoma 7 Marginal Zone Lymphoma 1 Lymph Node 80 %
Peripheral 8 Marginal Zone Lymphoma 2 > 94 %
Blood 9 Reactive Follicular Hyperplasia Lymph Node 35 %
Example 2: Immunostimulatory nucleic acids induce proliferation and apoptosis of malignant B cells.
CpG induces a strong proliferative response of primary human B cells. Hartmann G
et al., J Immunol 164:944-53 (2000). Two techniques were used to assess whether CpG ODN
is capable of inducing proliferation of B-CLL cells. For select samples, cells were stained with CFSE and incubated for four days. Proliferation of cells is indicated by a loss of CFSE
stain with every cell division. In B-CLL, CD5 can be used to identify malignant B cells among CD19+ cells. Proliferation of malignant B cells (CD 5+ and CD19+) was lower than proliferation of normal B cells (CD5- and CD19+) (Fig. 5). For the marginal zone lymphoma, CpG ODN 2006 induced proliferation of the CD19+ cell population (Fig. 5).
Figure 5 shows a comparison of CpG ODN induced proliferation of malignant and normal B cells. Peripheral blood mononuclear cells from two patients, one with B-CLL and one with marginal zone lymphoma with circulating malignant cells, were incubated for 72 hours with CpG ODN or medium alone and evaluated by two-color flow cytometry.
CFSE
fluorescence (x-axis) and expression of CD5 (CLL) or CD19 (marginal zone lymphoma) (y-axis) were evaluated. In CLL, CpG ODN enhanced proliferation of both CD5+ and the CD5-cells. However the relative number of proliferating cells and the number of divisions is lower in the CD5- subset than in the CD5+ subset. In marginal zone lymphoma CpG ODN
enhanced proliferation in the CD19+ cell subset.
No consistent pattern was apparent related to determining whether CpG ODN
altered the percent of dead cells as determined by morphological criteria (see Table 6).
Table 6: Percent Apoptotic Cells Based On Morphologic Criteria.
Sample Histology Media CpG ODN 2006 Number Chronic Lymphocytic 1 25.9 21.5 Leukemia 1 Chronic Lymphocytic 2 32.6 45.3 Leukemia 2 3 Large Cell Lymphoma 1 33.9 26.2 4 Large Cell Lymphoma 2 16.0 9.8 5 Mantle Cell Lymphoma 55.1 60.0 Diffuse Mixed Small and 6 27.6 26.6 Large Cell Lymphoma Marginal Zone 7 32.9 32.8 Lymphoma 1 Marginal Zone 8 38.8 56.0 Lymphoma 2 Reactive Follicular 9 8.6 18.0 Hyperplasia A TLTNEL assay was utilized to assess the effect of CpG ODN on both proliferation and apoptosis. The results are shown in Table 7.
Table 7: Apoptosis And Proliferation As Determined By TLTNEL.
Sample Baseline CpG ODN
Control ODN
Apop Prolif Apop Prolif Apop Prolif 12142812 3 <1 1 10 2 12 12141811 <1 <1 <1 11 Example 3: CpG ODN enhance the therapeutic effect of murine IgG2a (which relates to human IgG1) but not murine IgG1 (which relates to human IgG2) anti-tumor antibody.
A
CpG ODN when combined with antibody of murine subtype IgG2a dramatically promotes survival in mice having tumors. Mice were injected i.p. with 5000 T3C
cells on day 0. They were then given 100 [tg anti-idiotype monoclonal antibody as either IgG1 (MS5A10) or IgG2a (MS11G6) on days 5,7, and 10. In this model, the target antigen is the idiotype expressed by the lymphoma cells. Therefore, the anti-tumor antibodies are also "anti-idiotype." These antibodies (MS5A10 and MS11G6) are simultaneously both anti-tumor antibodies and anti-idiotype antibodies. Twenty micrograms of CpG ODN
(5' TCCATGACGTTCCTGACGTT 3'; SEQ ID NO: 560) was given at the same time.
Results are shown in Figure 6. Untreated controls had a median survival time (MST) of 17 days after inoculation with tumor. Mice treated with murine IgG1 antibody plus CpG ODN
had survival that was similar to those treated with murine IgG1 antibody alone (MST 28 days and 27 days, respectively). In contrast, mice treated with murine IgG2a plus CpG ODN had survival that was significantly improved when compared to mice treated with murine IgG2a alone (MST 45 days and 37 days, respectively).
The foregoing written specification is considered to be sufficient to enable one skilled in the art to practice the invention. The present invention is not to be limited in scope by examples provided, since the examples are intended as a single illustration of one aspect of the invention and other functionally equivalent embodiments are within the scope of the invention. Various modifications of the invention in addition to those shown and described herein will become apparent to those skilled in the art from the foregoing description and fall within the scope of the appended claims. The advantages and objects of the invention are not necessarily encompassed by each embodiment of the invention.
SEQUENCE LISTING
<110> University of Iowa Research Foundation <120> Methods for Enhancing Antibody-Induced Cell Lysis and Treating Cancer <130> C1039/7052W0 (AWS) <150> US 60/213,346 <151> 2000-06-22 <160> 848 <170> FastSEQ for Windows Version 3.0 <210> 1 <211> 6 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 1 aaaaaa 6 <210> 2 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 2 aaaaaaaaaa aaaaaaaaaa 20 <210> 3 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 3 aaaaaccccc cccccaaaaa 20 <210> 4 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> Chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 4 aaaacatgac gttcaaaaaa 20 <210> 5 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorodithioate backbone <400> 5 aaaacatgac gttcaaaaaa 20 <210> 6 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 6 aaaacatgac gttcgggggg 20 <210> 7 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorodithioate backbone <400> 7 aaaacatgac gttcgggggg 20 <210> 8 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 8 aaaacgtt 8 <210> 9 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 9 aaaatcaacg ttgaaaaaaa 20 <210> 10 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 10 aaaatctgtg cttttaaaaa a 21 <210> 11 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 11 aaaattgacg ttttaaaaaa 20 <210> 12 <211> 33 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 12 aaacattctg ggggaatttt aagaagtaaa cat 33 <210> 13 <211> 39 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 13 aaacattctg ggggaatttt aagaagttcc tccctcccc 39 <210> 14 <211> 33 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide =
<221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 14 aaacattctg ggggaatttt gtctagtaaa cat 33 <210> 15 <211> 17 VIM) 01/97843 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 15 aacgctcgac cttcgat 17 <210> 16 <211> 17 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 16 aacgctggac cttccat 17 <210> 17 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 17 aacgctggac cttccatgtc 20 <210> 18 <211> 6 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 18 aacgtt 6 <210> 19 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 19 aacgttct 8 <210> 20 <211> 7 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 20 aacgttg 7 <210> 21 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 21 aacgttga 8 <210> 22 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 22 aacgttgagg ggcat 15 <210> 23 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 23 aaggtggggc agtctcaggg a 21 <210> 24 =
<211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 24 aatagtcgcc ataacaaaac 20 <210> 25 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 25 aatagtcgcc atcccccccc 20 <210> 26 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 26 aatagtcgcc atcccgggac 20 <210> 27 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 27 aatagtcgcc atcgcgcgac 20 <210> 28 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 28 aatagtcgcc atggcggggc 20 <210> 29 <211> 45 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 29 aattctctat cggggcttct gtgtctgttg ctggttccgc tttat 45 <210> 30 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 30 acaaccacga gaacgggaac 20 <210> 31 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 31 acaacgtt 8 <210> 32 <211> 10 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 32 acaacgttga 10 <210> 33 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 33 accacaacga gaggaacgca 20 <210> 34 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 34 accatcctga ggccattcgg 20 <210> 35 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 35 accatggacg aactgtttcc cctc 24 <210> 36 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 36 accatggacg acctgtttcc cctc 24 <210> 37 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 37 accatggacg agctgtttcc cctc 24 <210> 38 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 38 accatggacg agctgtttcc cctc 24 <210> 39 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 39 accatggacg atctgtttcc cctc 24 <210> 40 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 40 accatggacg gtctgtttcc cctc 24 <210> 41 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 41 accatggacg tactgtttcc cctc 24 <210> 42 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 42 accatggacg ttctgtttcc cctc 24 <210> 43 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 43 acccatcaat agctctgtgc 20 VIM) 01/97843 <210> 44 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 44 acccgtcgta attatagtaa aaccc 25 <210> 45 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 45 accgcatgga ttctaggcca 20 <210> 46 <211> 45 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 46 accttattaa gattgtgcaa tgtgacgtcc tttagcatcg caaga 45 <210> 47 <211> 16 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 47 acgctggacc ttccat 16 <210> 48 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 48 acgtcgttcc cccccccccc 20 <210> 49 <211> 6 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 49 acgtgt 6 <210> 50 <211> 17 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 50 actagacgtt agtgtga 17 <210> 51 <211> 17 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 51 actagacgtt agtgtga 17 <210> 52 <211> 17 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 52 actggacgtt agcgtga 17 <210> 53 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 53 acttctcata gtccctttgg tccag 25 <210> 54 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 54 agaacgtt 8 <210> 55 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 55 agacagacac gaaacgaccg 20 <210> 56 <211> 27 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 56 agactcatgg gaaaatccca catttga 27 <210> 57 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 57 agatagcaaa tcggctgacg 20 <210> 58 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 58 agatggttct cagataaagc ggaa 24 <210> 59 <211> 18 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 59 agcaccgaac gtgagagg 18 <210> 60 <211> 18 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 60 agcacggtag ccttccta 18 <210> 61 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 61 agcagcttta gagctttaga gctt 24 <210> 62 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 62 agcatcagga acgacatgga 20 <210> 63 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 63 agcatcagga ccgacatgga 20 <210> 64 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 64 agcgctga 8 <210> 65 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 65 agctcaacgt catgc 15 <210> 66 <211> 19 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 66 agetccatgg tgctcactg 19 <210> 67 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 67 aggatatc 8 <210> 68 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 68 aggtacagcc aggactacga 20 <210> 69 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <221> modified_base <222> (3)...(3) <223> I
<221> modified_base <222> (8)...(8) <223> I
<221> modified_base <222> (14)...(14) <223> I
<400> 69 agncccgnga acgnattcac 20 <210> 70 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 70 agtgactctc cagcgttctc 20 <210> 71 <211> 17 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 71 agtgcgattc gagatcg 17 <210> 72 <211> 17 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 72 agtgcgattg cagatcg 17 <210> 73 <211> 6 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 73 agtgct 6 <210> 74 <211> 6 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 74 agtgct 6 <210> 75 <211> 10 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 75 agttgcaact 10 <210> 76 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 76 ataaagcgaa actagcagca gtttc 25 <210> 77 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 77 ataacgtt 8 <210> 78 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 78 ataatagagc ttcaagcaag 20 <210> 79 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 79 ataatccagc ttgaaccaag 20 <210> 80 <211> 20 <212> DNA .
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 80 ataatcgacg ttcaagcaag 20 <210> 81 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 81 ataatcgacg ttcccccccc 20 <210> 82 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 82 ataatcgtcg ttcaagcaag 20 <210> 83 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 83 ataatcgtgc gttcaagaaa g 21 <210> 84 <211> 27 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 84 atagacaaaa attccctccc cggagcc 27 <210> 85 <211> 18 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 85 atatatatat atatatat 18 <210> 86 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 86 atatctaatc aaaacattaa caaa 24 <210> 87 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 87 atcaggaacg tcatgggaag c 21 <210> 88 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 88 atcgacctac gtgcgttctc 20 <210> 89 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <221> modified_base <222> (18)...(18) <223> m5c <400> 89 atcgacctac gtgcgttntc 20 <210> 90 <211> 18 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 90 atcgactcga gcgttctc 18 <210> 91 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 91 atcgactctc gagcgttctc 20 <210> 92 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 92 atcgactctc gagcgttctc 20 <210> 93 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 93 atcgactctc gagtgttctc 20 <210> 94 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <221> modified_base <222> (14)...(14) <223> m5c <400> 94 atcgactctc gagngttctc 20 VIM) 01/97843 <210> 95 <211> 22 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 95 atcgactctc tcgagcgttc tc 22 <210> 96 <211> 19 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 96 atcgacttcg agcgttctc 19 <210> 97 <211> 17 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 97 atcgatcgag cgttctc 17 <210> 98 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 98 atcgatgt 8 <210> 99 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 99 atcggaggac tggcgcgccg 20 <210> 100 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 100 atctggtgag ggcaagctat g 21 <210> 101 <211> 17 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 101 atgacgttcc tgacgtt 17 <210> 102 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 102 atgcactctg cagcgttctc 20 <210> 103 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 103 atgcatgt 8 <210> 104 <211> 15 <212> DNA
<213> Artificial Sequence <220>
. <223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 104 atgcccctca acgtt 15 <210> 105 <211> 23 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 105 atgctaaagg acgtcacatt gca 23 <210> 106 <211> 19 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 106 atggaaggtc cacgttctc 19 <210> 107 <211> 19 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 107 atggaaggtc cagcgttct 19 <210> 108 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 108 atggaaggtc cagcgttctc 20 <210> 109 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 109 atggaaggtc cagtgttctc 20 <210> 110 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 110 atggaaggtc gagcgttctc 20 <210> 111 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 111 atggactctc cagcgttctc 20 <210> 112 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 112 atgtcctcgg tcctgatgct 20 <210> 113 <211> 33 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 113 atgtttacta gacaaaattc ccccagaatg ttt 33 <210> 114 <211> 33 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 114 atgtttactt cttaaaattc ccccagaatg ttt 33 <210> 115 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 115 attcgatcgg ggcggggcga g 21 <210> 116 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <221> modified_base <222> (3)...(3) <223> m5c <400> 116 atngacctac gtgcgttctc 20 <210> 117 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <221> modified_base <222> (3)...(3) <223> m5c <221> modified_base <222> (10)...(0) <223> m5c <221> modified_base <222> (14)...(14) <223> m5c <400> 117 atngactctn gagngttctc 20 <210> 118 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <221> misc_feature <222> (1)...(1) <223> biotinylated at 5' end <400> 118 atggaaggtc cagcgttctc 20 <210> 119 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <221> misc_feature <222> (1)...(1) <223> biotinylated 5' end <400> 119 gagaacgctc cagcactgat 20 <210> 120 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <221> misc_feature <222> (1)...(1) <223> biotinylated 5' end <400> 120 gagaacgctc gaccttcgat 20 <210> 121 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <221> misc_feature <222> (1)...(1) <223> biotinylated 5' end <221> modified base <222> (6)...(6) <223> m5c <400> 121 gagaangctc cagcactgat 20 <210> 122 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <221> misc_feature <222> (1)...(1) <223> biotinylated 5' end <221> modified_base <222> (6)...(6) <223> m5c <400> 122 gagaangctc gaccttcgat 20 <210> 123 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <221> misc_feature <222> (1)...(1) <223> biotinylated at 5' end <400> 123 gagcaagctg gaccttccat 20 <210> 124 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <221> misc_feature <222> (1)...(1) <223> biotinylated at 5' end <221> modified_base <222> (8)...(8) <223> m5c <400> 124 gagcaagntg gaccttccat 20 <210> 125 <211> 17 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <221> misc_feature <222> (1)...(1) <223> biotinylated at 5' end <400> 125 gctagacgtt agcgtga 17 <210> 126 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <221> misc_feature <222> (1)...(1) <223> biotinylated at 5' end <400> 126 tcaacgtt 8 <210> 127 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <221> misc_feature <222> (1)...(1) <223> biotinylated at 5' end <400> 127 tccatgacgt tcctgatgct 20 <210> 128 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) .<223> phosphodiester backbone <221> misc_feature <222> (1)...(1) <223> biotinylated at 5' end <400> 128 tccatgagct tcctgatgct 20 <210> 129 <211> 29 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphodiester on 5' end <221> misc_feature <222> (1)...(1) <223> biotinylated at 5' end <400> 129 tccattccat gacgttcctg atgcttcca 29 <210> 130 <211> 30 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphodiester on 5' end <221> misc_feature <222> (1)...(1) <223> biotinylated at 5' end <400> 130 tccattccat tctaggcctg agtcttccat 30 <210> 131 <211> 29 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphodiester on 5' end <221> misc_feature <222> (1)...(1) <223> biotinylated at 5' end <400> 131 tcgtcgtttt gtcgttttgt cgttttttt 29 <210> 132 <211> 28 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphodiester on 5' end <221> misc_feature <222> (1)...(1) <223> biotinylated at 5' end <400> 132 tttttccatg tcgttcctga tgcttttt 28 <210> 133 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphodiester on 5' end <221> misc_feature <222> (1)...(1) <223> biotinylated at 5' end <400> 133 tttttcgtcg ttcccccccc cccc 24 <210> 134 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 134 caaacgtt 8 <210> 135 <211> 7 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_featnre <222> (0)...(0) <223> phosphodiester backbone <400> 135 caacgtt 7 VIM) 01/97843 <210> 136 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 136 caagagatgc taacaatgca 20 <210> 137 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 137 caatcaatct gaggagaccc 20 <210> 138 <211> 22 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 138 cacaccttgg tcaatgtcac gt 22 <210> 139 <211> 23 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)¨(0) <223> phosphodiester backbone <400> 139 caccaccttg gtcaatgtca cgt 23 <210> 140 <211> 16 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 140 cacggtagcc ttccta 16 <210> 141 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)¨(0) <223> phosphorothioate backbone <400> 141 cacgttgagg ggcat 15 <210> 142 <211> 16 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3 ends <400> 142 cactgtcctt cgtcga 16 <210> 143 <211> 23 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 143 cagacacaga agcccgatag acg 23 <210> 144 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 144 cagattgtgc aatgtctcga 20 <210> 145 <211> 27 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 145 cataacatag gaatatttac tcctcgc 27 <210> 146 <211> 31 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 146 cataggatct cgagctcgga aagtccccta c 31 <210> 147 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 147 catgagctca tctggaggaa gcgg 24 <210> 148 <211> 18 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)... (0) <223> phosphodiester backbone <400> 148 catttccacg atttccca 18 <210> 149 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 149 cattttacgg gcgggcgggc 20 <210> 150 <211> 22 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 150 ccaaatatcg gtggtcaagc ac 22 <210> 151 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 151 ccaacgtt 8 <210> 152 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 152 ccacgtcgac cctcaggcga 20 <210> 153 <211> 17 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 153 ccacgtggac ctctagc 17 <210> 154 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 154 ccactcacat ctgctgctcc acaag 25 <210> 155 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 155 ccagatgagc tcatgggttt ctcc 24 <210> 156 <211> 26 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 156 ccaggttaag aggaaatgac ttcggg 26 <210> 157 <211> 17 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 157 ccaggttgta tagaggc 17 <210> 158 <211> 35 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 158 ccagtgctga tcaccgatat cctgttcggc agtcg 35 <210> 159 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 159 ccatcgat 8 <210> 160 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 160 ccatgcat 8 <210> 161 <211> 17 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 161 ccatgctaac ctctagc 17 <210> 162 <211> 19 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 162 ccatgtcggt cctgatgct 19 <210> 163 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 163 ccccaaaggg atgagaagtt 20 <210> 164 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide =
<221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 164 cccccaaaaa aaaaaccccc 20 <210> 165 <211> 6 <212> DNA
<213> Artificial Sequence .220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 165 cccccc 6 <210> 166 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 166 cccccccc 8 <210> 167 <211> 12 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 167 cccccccccc cc 12 <210> 168 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 168 cccccccccc cccccccccc 20 <210> 169 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 169 cccccccccc cccccccccc 20 <210> 170 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 170 cccccccccc cccccccccc cccc 24 <210> 171 <211> 28 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 171 cccccccccc cccccccccc cccccccc 28 <210> 172 <211> 35 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 172 cccccccccc cccccccccc cccccccccc ccccc 35 <210> 173 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 173 ccccttgacg ttttcccccc 20 <210> 174 <211> 26 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 174 cccgaagtca tttcctctta acctgg 26 <210> 175 <211> 26 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 175 ccgaacagga tatcggtgat cagcac 26 <210> 176 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 176 ccgcttcctc cagatgagct catg 24 <210> 177 <211> 39 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 177 ccgcttcctc cagatgagct catgggtttc tccaccaag 39 <210> 178 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 178 ccggccggcc ggccggccgg 20 <210> 179 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_difference <222> (0)...(0) <223> phosphodiester backbone <400> 179 ccgtcgttcc cceccccecc 20 <210> 180 <211> 22 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 180 cctacgttgt atgcgcccag ct 22 <210> 181 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 181 cctccaaatg aaagaccccc 20 <210> 182 <211> 19 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 182 cctctataca acctgggac 19 <210> 183 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 183 ccttccatgt cggtcctgat 20 <210> 184 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_difference <222> (0)...(0) <223> phosphodiester backbone <400> 184 ccttcgat 8 <210> 185 <211> 8 <212> DNA
. <213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) ... (0) <223> phosphodiester backbone <400> 185 cgaacgtt 8 <210> 186 <211> 6 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 186 cgacga 6 <210> 187 <211> 6 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 187 cgacgt 6 <210> 188 <211> 18 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 188 cgactctcga gcgttctc 18 <210> 189 <211> 35 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 189 cgactgccga acaggatatc ggtgatcagc actgg 35 <210> 190 <211> 18 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 190 cgccgtcgcg gcggttgg 18 <210> 191 <211> 18 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 191 cgcctggggc tggtctgg 18 <210> 192 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 192 cgcgcgcgcg cgcgcgcgcg 20 <210> 193 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone
- 50 -<400> 193 cgcgcgcgcg cgcgcgcgcg 20 <210> 194 <211> 6 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 194 cgcgta 6 <210> 195 <211> 18 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 195 cgctagaggt tagcgtga 18 <210> 196 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 196 cgctggacct tccat 15 <210> 197 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0)
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 194 cgcgta 6 <210> 195 <211> 18 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 195 cgctagaggt tagcgtga 18 <210> 196 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 196 cgctggacct tccat 15 <210> 197 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0)
- 51 -<223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 197 cgctggacct tccatgtcgg 20 <210> 198 <211> 16 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 198 cggctgacgt catcaa 16 <210> 199 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 199 cgggcgactc agtctatcgg 20 <210> 200 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 200 cgggcttacg gcggatgctg 20 <210> 201 <211> 14 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 201 cggtagcctt ccta 14 <210> 202 <211> 15 <212> DNA
<213> Artificial Sequence
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 198 cggctgacgt catcaa 16 <210> 199 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 199 cgggcgactc agtctatcgg 20 <210> 200 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 200 cgggcttacg gcggatgctg 20 <210> 201 <211> 14 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 201 cggtagcctt ccta 14 <210> 202 <211> 15 <212> DNA
<213> Artificial Sequence
- 52 -VIM) 01/97843 <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 202 cgtaccttac ggtga 15 <210> 203 <211> 6 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 203 cgtacg 6 <210> 204 <211> 6 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 204 cgtcga 6 <210> 205 <211> 6 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 205 cgtcga 6 <210> 206 <211> 6 <212> DNA
<213> Artificial Sequence
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 202 cgtaccttac ggtga 15 <210> 203 <211> 6 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 203 cgtacg 6 <210> 204 <211> 6 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 204 cgtcga 6 <210> 205 <211> 6 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 205 cgtcga 6 <210> 206 <211> 6 <212> DNA
<213> Artificial Sequence
- 53 -<220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 206 cgtcgt 6 <210> 207 <211> 9 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 207 cgtcgtcgt 9 <210> 208 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 208 cgtcgtcgtc gtcgtcgtcg t 21 <210> 209 <211> 23 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 209 cgtctatcgg gcttctgtgt ctg 23 <210> 210 <211> 6 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 206 cgtcgt 6 <210> 207 <211> 9 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 207 cgtcgtcgt 9 <210> 208 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 208 cgtcgtcgtc gtcgtcgtcg t 21 <210> 209 <211> 23 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 209 cgtctatcgg gcttctgtgt ctg 23 <210> 210 <211> 6 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide
- 54 -<221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 210 cgttcg 6 <210> 211 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 211 ctaacgtt 8 <210> 212 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 212 ctaatctttc taattttttt ctaa 24 <210> 213 <211> 45 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 213 ctagataaag cggaaccagc aacagacaca gaagccccga tagag 45 <210> 214 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 211 ctaacgtt 8 <210> 212 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 212 ctaatctttc taattttttt ctaa 24 <210> 213 <211> 45 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 213 ctagataaag cggaaccagc aacagacaca gaagccccga tagag 45 <210> 214 <211> 8 <212> DNA
<213> Artificial Sequence <220>
- 55 -<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 214 ctagcgct 8 <210> 215 <211> 26 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 215 ctagcggctg acgtcataaa gctagc 26 <210> 216 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 216 ctagcggctg acgtcatcaa gctag 25 <210> 217 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 217 ctagcggctg acgtcatcaa tctag 25 <210> 218 <211> 26 <212> DNA
<213> Artificial Sequence
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 215 ctagcggctg acgtcataaa gctagc 26 <210> 216 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 216 ctagcggctg acgtcatcaa gctag 25 <210> 217 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 217 ctagcggctg acgtcatcaa tctag 25 <210> 218 <211> 26 <212> DNA
<213> Artificial Sequence
- 56 -<220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 218 ctagcggctg agctcataaa gctagc 26 <210> 219 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 219 ctagcttgat gacgtcagcc gctag 25 <210> 220 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 220 ctagcttgat gagctcagcc gctag 25 <210> 221 <211> 26 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 221 ctagctttat gacgtcagcc gctagc 26 <210> 222 <211> 24 <212> DNA
<213> Artificial Sequence
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 218 ctagcggctg agctcataaa gctagc 26 <210> 219 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 219 ctagcttgat gacgtcagcc gctag 25 <210> 220 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 220 ctagcttgat gagctcagcc gctag 25 <210> 221 <211> 26 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 221 ctagctttat gacgtcagcc gctagc 26 <210> 222 <211> 24 <212> DNA
<213> Artificial Sequence
- 57 -<220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 222 ctaggctgac gtcatcaagc tagt 24 <210> 223 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 223 ctagtggctg acgtcatcaa gctag 25 <210> 224 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 224 ctatcggagg actggcgcgc C 21 <210> 225 <211> 22 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 225 ctatcggagg actggcgcgc cg 22 <210> 226 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 222 ctaggctgac gtcatcaagc tagt 24 <210> 223 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 223 ctagtggctg acgtcatcaa gctag 25 <210> 224 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 224 ctatcggagg actggcgcgc C 21 <210> 225 <211> 22 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 225 ctatcggagg actggcgcgc cg 22 <210> 226 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone
- 58 -<400> 226 ctcaacgctg gaccttccat 20 <210> 227 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 227 ctcatgggtt tctccaccaa g 21 <210> 228 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone =
<400> 228 ctccagctcc aagaaaggac g 21 <210> 229 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 229 ctcgccccgc cccgatcgaa t 21 <210> 230 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 230 ctctccaagc tcacttacag 20
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 227 ctcatgggtt tctccaccaa g 21 <210> 228 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone =
<400> 228 ctccagctcc aagaaaggac g 21 <210> 229 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 229 ctcgccccgc cccgatcgaa t 21 <210> 230 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 230 ctctccaagc tcacttacag 20
- 59 -, <210> 231 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 231 ctotctgtag gcccgcttgg 20 <210> 232 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 232 ctcttgcgac ctggaaggta 20 <210> 233 <211> 10 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 233 ctgacgtcat 10 <210> 234 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 234 ctgacgtg 8 <210> 235 <211> 18
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 231 ctotctgtag gcccgcttgg 20 <210> 232 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 232 ctcttgcgac ctggaaggta 20 <210> 233 <211> 10 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 233 ctgacgtcat 10 <210> 234 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 234 ctgacgtg 8 <210> 235 <211> 18
- 60 -<212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 235 ctgattgctc tctcgtga 18 <210> 236 <211> 18 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 236 ctgattgctc tctcgtga 18 <210> 237 <211> 14 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 237 ctgcagcctg ggac 14 <210> 238 <211> 22 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 238 ctgcgttagc aatttaactg tg 22
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 235 ctgattgctc tctcgtga 18 <210> 236 <211> 18 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 236 ctgattgctc tctcgtga 18 <210> 237 <211> 14 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 237 ctgcagcctg ggac 14 <210> 238 <211> 22 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 238 ctgcgttagc aatttaactg tg 22
- 61 -<210> 239 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 239 ctgctgagac tggag 15 <210> 240 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 240 ctgctgctgc tgctgctgct g 21 <210> 241 <211> 16 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 241 ctggaccttc catgtc 16 <210> 242 <211> 18 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 239 ctgctgagac tggag 15 <210> 240 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 240 ctgctgctgc tgctgctgct g 21 <210> 241 <211> 16 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 241 ctggaccttc catgtc 16 <210> 242 <211> 18 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends
- 62 -<400> 242 ctggaccttc catgtcgg 18 <210> 243 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 243 ctggtctttc tggttttttt ctgg 24 <210> 244 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 244 ctggtctttc tggttttttt ctgg 24 <210> 245 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 245 ctgtaagtga gcttggagag 20 <210> 246 <211> 30 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 246 ctgtatgaaa caaattttcc tctttgggca 30
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 243 ctggtctttc tggttttttt ctgg 24 <210> 244 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 244 ctggtctttc tggttttttt ctgg 24 <210> 245 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 245 ctgtaagtga gcttggagag 20 <210> 246 <211> 30 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 246 ctgtatgaaa caaattttcc tctttgggca 30
- 63 -VIM) 01/97843 <210> 247 <211> 6 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 247 ctgtca 6 <210> 248 <211> 22 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 248 ctgtcaggaa ctgcaggtaa gg 22 <210> 249 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 249 ctgtcccata tttttagaca 20 <210> 250 <211> 6 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 250 ctgtcg 6 <210> 251 <211> 6 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 247 ctgtca 6 <210> 248 <211> 22 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 248 ctgtcaggaa ctgcaggtaa gg 22 <210> 249 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 249 ctgtcccata tttttagaca 20 <210> 250 <211> 6 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 250 ctgtcg 6 <210> 251 <211> 6 <212> DNA
- 64 -<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 251 ctgtcg 6 <210> 252 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 252 ctgtcgttcc ccoccccccc 20 <210> 253 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 253 ctgtgctttc tgtgtttttc tgtg 24 <210> 254 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 254 cttggagggc ctcccggcgg 20 <210> 255 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 251 ctgtcg 6 <210> 252 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 252 ctgtcgttcc ccoccccccc 20 <210> 253 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 253 ctgtgctttc tgtgtttttc tgtg 24 <210> 254 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 254 cttggagggc ctcccggcgg 20 <210> 255 <211> 21 <212> DNA
<213> Artificial Sequence <220>
- 65 -<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 255 cttggtggag aaacccatga g 21 <210> 256 <211> 39 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 256 cttggtggag aaacccatga gctcatctgg aggaagcgg 39 <210> 257 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 257 ctttccgttg gacccctggg 20 <210> 258 <211> 19 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <221> modified_base <222> (2)...(2) <223> m5c <221> modified_base <222> (6)...(6) <223> m5c
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 256 cttggtggag aaacccatga gctcatctgg aggaagcgg 39 <210> 257 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 257 ctttccgttg gacccctggg 20 <210> 258 <211> 19 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <221> modified_base <222> (2)...(2) <223> m5c <221> modified_base <222> (6)...(6) <223> m5c
- 66 -<221> modified base <222> (10)...(10) <223> m5c <221> modified base <222> (15)...(15) <223> m5c <400> 258 cnggcnggcn gggcnccgg 19 <210> 259 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <221> misc_feature <222> (1)...(1) <223> FITC labeled <400> 259 aacgttga 8 <210> 260 <211> 12 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <221> misc_feature <222> (1)...(1) <223> FITC labeled <400> 260 cgcgaattcg cg 12 <210> 261 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0)
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <221> misc_feature <222> (1)...(1) <223> FITC labeled <400> 259 aacgttga 8 <210> 260 <211> 12 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <221> misc_feature <222> (1)...(1) <223> FITC labeled <400> 260 cgcgaattcg cg 12 <210> 261 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0)
- 67 -<223> phosphodiester backbone <221> misc_feature <222> (1)...(1) <223> FITC labeled <400> 261 tcaacgtt 8 <210> 262 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 262 gaaacgtt 8 <210> 263 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 263 gaaactgctg ctagtttcgc tttat 25 <210> 264 <211> 17 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 264 gaaccttcca tgctgtt 17 <210> 265 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 265
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 262 gaaacgtt 8 <210> 263 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 263 gaaactgctg ctagtttcgc tttat 25 <210> 264 <211> 17 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 264 gaaccttcca tgctgtt 17 <210> 265 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 265
- 68 -gaaccttcca tgctgttccg 20 <210> 266 <211> 18 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 266 gaacgctgga ccttccat 18 <210> 267 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 267 gaagttcacg ttgaggggca t 21 <210> 268 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 268 gaagtttctg gtaagtcttc g 21 <210> 269 <211> 10 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 269 gaccttccat 10 <210> 270 <211> 22 <212> DNA
<213> Artificial Sequence
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 266 gaacgctgga ccttccat 18 <210> 267 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 267 gaagttcacg ttgaggggca t 21 <210> 268 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 268 gaagtttctg gtaagtcttc g 21 <210> 269 <211> 10 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 269 gaccttccat 10 <210> 270 <211> 22 <212> DNA
<213> Artificial Sequence
- 69 -<220>
<223> Synthetic oligonucleotide <400> 270 gaccttccat gtcggtcctg at 22 <210> 271 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 271 gaccttctat gtcggtcctg 20 <210> 272 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 272 gacgtcat 8 <210> 273 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 273 gactgacgtc agcgt 15 <210> 274 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone
<223> Synthetic oligonucleotide <400> 270 gaccttccat gtcggtcctg at 22 <210> 271 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 271 gaccttctat gtcggtcctg 20 <210> 272 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 272 gacgtcat 8 <210> 273 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 273 gactgacgtc agcgt 15 <210> 274 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone
- 70 -<400> 274 gagaacgatg gaccttccat 20 <210> 275 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 275 gagaacgcta gaccttctat 20 <210> 276 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 276 gagaacgctc caccttccat 20 <210> 277 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 277 gagaacgctc cagcactgat 20 <210> 278 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 275 gagaacgcta gaccttctat 20 <210> 276 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 276 gagaacgctc caccttccat 20 <210> 277 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 277 gagaacgctc cagcactgat 20 <210> 278 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone
- 71 -VIM) 01/97843 <400> 278 gagaacgctc cagcttcgat 20 <210> 279 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 279 gagaacgctc cgaccttcga t 21 <210> 280 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 280 gagaacgctc gaccttccat 20 <210> 281 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <221> misc_feature <222> (20)...(20) <223> biotinylated at 3' end <400> 281 gagaacgctc gaccttcgat 20 <210> 282 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 279 gagaacgctc cgaccttcga t 21 <210> 280 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 280 gagaacgctc gaccttccat 20 <210> 281 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <221> misc_feature <222> (20)...(20) <223> biotinylated at 3' end <400> 281 gagaacgctc gaccttcgat 20 <210> 282 <211> 21 <212> DNA
<213> Artificial Sequence <220>
- 72 -<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 282 gagaacgctg gacctatcca t 21 <210> 283 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 283 gagaacgctg gacctcatca tccat 25 <210> 284 <211> 22 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 284 gagaacgctg gacctcatcc at 22 <210> 285 <211> 18 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 285 gagaacgctg gaccttcc 18 <210> 286 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 286
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 283 gagaacgctg gacctcatca tccat 25 <210> 284 <211> 22 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 284 gagaacgctg gacctcatcc at 22 <210> 285 <211> 18 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 285 gagaacgctg gaccttcc 18 <210> 286 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 286
- 73 -gagaacgctg gaccttccat 20 <210> 287 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 287 gagaacgctg gaccttccat 20 <210> 288 <211> 22 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 288 gagaacgctg gaccttccat gt 22 <210> 289 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 289 gagaacgctg gaccttcgat 20 <210> 290 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 290 gagaacgctg gaccttcgta 20 <210> 291
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 287 gagaacgctg gaccttccat 20 <210> 288 <211> 22 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 288 gagaacgctg gaccttccat gt 22 <210> 289 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 289 gagaacgctg gaccttcgat 20 <210> 290 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 290 gagaacgctg gaccttcgta 20 <210> 291
- 74 -<211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 291 gagaacgctg gaccttgcat 20 <210> 292 <211> 23 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 292 gagaacgctg gacgctcatc cat 23 <210> 293 <211> 19 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 293 gagaacgctg gacttccat 19 <210> 294 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <221> modified base ¨
<222> (14)(7:4) <223> m5c
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 291 gagaacgctg gaccttgcat 20 <210> 292 <211> 23 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 292 gagaacgctg gacgctcatc cat 23 <210> 293 <211> 19 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 293 gagaacgctg gacttccat 19 <210> 294 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <221> modified base ¨
<222> (14)(7:4) <223> m5c
- 75 -<400> 294 gagaacgctg gacnttccat 20 <210> 295 <211> 17 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 295 gagaacgctg gatccat 17 <210> 296 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 296 gagaatgctg gaccttccat 20 <210> 297 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <221> modified_base <222> (6)...(6) <223> m5c <400> 297 gagaangctg gaccttccat 20 <210> 298 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 295 gagaacgctg gatccat 17 <210> 296 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 296 gagaatgctg gaccttccat 20 <210> 297 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <221> modified_base <222> (6)...(6) <223> m5c <400> 297 gagaangctg gaccttccat 20 <210> 298 <211> 20 <212> DNA
<213> Artificial Sequence <220>
- 76 -<223> Synthetic oligonucleotide <400> 298 gagaccgctc gaccttcgat 20 <210> 299 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 299 gagcaagctg gaccttccat 20 <210> 300 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <221> misc_feature <222> (20)...(20) <223> biotinylated at 3' end <400> 300 gagcaagctg gaccttccat 20 <210> 301 <211> 45 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 301 gaggaacgtc atggagagga acgtcatgga gaggaacgtc atgga 45 <210> 302 <211> 20 <212> DNA
<213> Artificial Sequence
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 299 gagcaagctg gaccttccat 20 <210> 300 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <221> misc_feature <222> (20)...(20) <223> biotinylated at 3' end <400> 300 gagcaagctg gaccttccat 20 <210> 301 <211> 45 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 301 gaggaacgtc atggagagga acgtcatgga gaggaacgtc atgga 45 <210> 302 <211> 20 <212> DNA
<213> Artificial Sequence
- 77 -<220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <221> modified base <222> (9)...(9) <223> I
<221> modified base <222> (11)...(I1) <223> I
<221> modified base <222> (15)...(55) <223> I
<400> 302 gaggaaggng nggangacgt 20 <210> 303 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 303 gaggggacca ttttacgggc 20 <210> 304 <211> 33 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 304 gatccagatt ctgccaggtc actgtgactg gat 33 <210> 305 <211> 33 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <221> modified base <222> (9)...(9) <223> I
<221> modified base <222> (11)...(I1) <223> I
<221> modified base <222> (15)...(55) <223> I
<400> 302 gaggaaggng nggangacgt 20 <210> 303 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 303 gaggggacca ttttacgggc 20 <210> 304 <211> 33 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 304 gatccagatt ctgccaggtc actgtgactg gat 33 <210> 305 <211> 33 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone
- 78 -<400> 305 gatccagatt ctgctgagtc actgtgactg gat 33 <210> 306 <211> 33 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 306 gatccagtca cagtgacctg gcagaatctg gat 33 <210> 307 <211> 33 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 307 gatccagtca cagtgactca gcagaatctg gat 33 <210> 308 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 308 gatccggctg actcatcact agatc 25 <210> 309 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0)
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 306 gatccagtca cagtgacctg gcagaatctg gat 33 <210> 307 <211> 33 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 307 gatccagtca cagtgactca gcagaatctg gat 33 <210> 308 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 308 gatccggctg actcatcact agatc 25 <210> 309 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0)
- 79 -<223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 309 gatcgctgat ctaatgctcg 20 <210> 310 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 310 gatcggagga ctggcgcgcc g 21 <210> 311 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 311 gatctagtga tgagtcagcc ggatc 25 <210> 312 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 312 gattcaactt gcgctcatct taggc 25 <210> 313 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 310 gatcggagga ctggcgcgcc g 21 <210> 311 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 311 gatctagtga tgagtcagcc ggatc 25 <210> 312 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 312 gattcaactt gcgctcatct taggc 25 <210> 313 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone
- 80 -<400> 313 gcaacgtt 8 <210> 314 <211> 10 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <221> misc_feature <222> (10)...(10) <223> biotinylated at 3' end <400> 314 gcaatattgc 10 <210> 315 <211> 10 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <221> misc_feature <222> (10)...(10) <223> FITC labeled <400> 315 gcaatattgc 10 <210> 316 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 316 gcacatcgtc ccgcagccga 20 <210> 317 <211> 27 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <221> misc_feature <222> (10)...(10) <223> biotinylated at 3' end <400> 314 gcaatattgc 10 <210> 315 <211> 10 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <221> misc_feature <222> (10)...(10) <223> FITC labeled <400> 315 gcaatattgc 10 <210> 316 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 316 gcacatcgtc ccgcagccga 20 <210> 317 <211> 27 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide
- 81 -<400> 317 gcagcctcta tacaacctgg gacggga 27 <210> 318 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 318 gcatagcgtt gagct 15 <210> 319 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 319 gcatgacgtt gagct 15 <210> 320 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 320 gcatgacgtt gagct 15 <210> 321 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 318 gcatagcgtt gagct 15 <210> 319 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 319 gcatgacgtt gagct 15 <210> 320 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 320 gcatgacgtt gagct 15 <210> 321 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide
- 82 -<221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 321 gcatgacgtt gagct 15 <210> 322 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 322 gcatgacgtt gagct 15 <210> 323 <211> 17 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 323 gcatgagctt gagctga 17 <210> 324 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 324 gcatgatgtt gagct 15 <210> 325 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 322 gcatgacgtt gagct 15 <210> 323 <211> 17 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 323 gcatgagctt gagctga 17 <210> 324 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 324 gcatgatgtt gagct 15 <210> 325 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide
- 83 -<221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <221> modified base <222> (7)...(7) <223> m5c <400> 325 gcatgangtt gagct 15 <210> 326 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 326 gcatggcgtt gagct 15 <210> 327 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 327 gcatgtagct gagct 15 <210> 328 <211> 15 <212> DNA =
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioateiphosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 328 gcatgtcgtt gagct 15
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 326 gcatggcgtt gagct 15 <210> 327 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 327 gcatgtagct gagct 15 <210> 328 <211> 15 <212> DNA =
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioateiphosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 328 gcatgtcgtt gagct 15
- 84 -<210> 329 <211> 23 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 329 gcattcatca ggcgggcaag aat 23 <210> 330 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 330 gcattgcgtt gagct 15 <210> 331 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 331 gcatttcgag gagct 15 <210> 332 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 332 gccaccaaaa cttgtccatg 20 <210> 333 <211> 17
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 329 gcattcatca ggcgggcaag aat 23 <210> 330 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 330 gcattgcgtt gagct 15 <210> 331 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 331 gcatttcgag gagct 15 <210> 332 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 332 gccaccaaaa cttgtccatg 20 <210> 333 <211> 17
- 85 -<212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 333 gccagatgtt agctgga 17 <210> 334 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 334 gccatggacg aactgttccc cctc 24 <210> 335 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 335 gcgacgggcg gcgcgcgccc 20 <210> 336 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 336 gcgacggtcg gcgcgcgccc 20 <210> 337
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 333 gccagatgtt agctgga 17 <210> 334 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 334 gccatggacg aactgttccc cctc 24 <210> 335 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 335 gcgacgggcg gcgcgcgccc 20 <210> 336 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 336 gcgacggtcg gcgcgcgccc 20 <210> 337
- 86 -<211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 337 gcgacgtgcg gcgcgcgccc 20 <210> 338 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 338 gcgacgttcg gcgcgcgccc 20 <210> 339 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 339 gcgatgtcgt tcctgatgcg 20 <210> 340 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 340 gcgatgtcgt tcctgatgct 20
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 337 gcgacgtgcg gcgcgcgccc 20 <210> 338 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 338 gcgacgttcg gcgcgcgccc 20 <210> 339 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 339 gcgatgtcgt tcctgatgcg 20 <210> 340 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 340 gcgatgtcgt tcctgatgct 20
- 87 -=
<210> 341 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 341 gcgccagtcc tccgatagac 20 <210> 342 <211> 19 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 342 gegcgcgcgc gcgcgcgcg 19 <210> 343 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 343 gcgctaccgg tagcctgagt 20 <210> 344 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 344 gcggcgggcg gcgcgcgccc 20 <210> 345 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide
<210> 341 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 341 gcgccagtcc tccgatagac 20 <210> 342 <211> 19 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 342 gegcgcgcgc gcgcgcgcg 19 <210> 343 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 343 gcgctaccgg tagcctgagt 20 <210> 344 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 344 gcggcgggcg gcgcgcgccc 20 <210> 345 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide
- 88 -<221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 345 gcggcgggcg gcgcgcgccc 20 <210> 346 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 346 gcggcggtcg gcgcgcgccc 20 <210> 347 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 347 gcggcgtgcg gcgcgcgccc 20 <210> 348 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 348 gcggcgttcg gcgcgcgccc 20 <210> 349 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 346 gcggcggtcg gcgcgcgccc 20 <210> 347 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 347 gcggcgtgcg gcgcgcgccc 20 <210> 348 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 348 gcggcgttcg gcgcgcgccc 20 <210> 349 <211> 20 <212> DNA
<213> Artificial Sequence <220>
- 89 -<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 349 gcgtcgttcc cccccccccc 20 <210> 350 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 350 gcgtgcgttg tcgttgtcgt t 21 <210> 351 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 351 gcgttttttt ttgcg 15 <210> 352 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 352 gctaaacgtt agcgt 15 <210> 353 <211> 16 <212> DNA
<213> Artificial Sequence
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 350 gcgtgcgttg tcgttgtcgt t 21 <210> 351 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 351 gcgttttttt ttgcg 15 <210> 352 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 352 gctaaacgtt agcgt 15 <210> 353 <211> 16 <212> DNA
<213> Artificial Sequence
- 90 -<220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 353 gctaacgtta gcgtga 16 <210> 354 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 354 gctaccttag cgtga 15 <210> 355 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <221> modified_base <222> (11)...(11) <223> m5c <400> 355 gctaccttag ngtga 15 <210> 356 <211> 14 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 356 gctacttagc gtga 14
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 353 gctaacgtta gcgtga 16 <210> 354 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 354 gctaccttag cgtga 15 <210> 355 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <221> modified_base <222> (11)...(11) <223> m5c <400> 355 gctaccttag ngtga 15 <210> 356 <211> 14 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 356 gctacttagc gtga 14
- 91 -<210> 357 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 357 gctagacgat agcgt 15 <210> 358 <211> 17 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 358 gctagacgct agcgtga 17 <210> 359 <211> 9 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 359 gctagacgt 9 <210> 360 <211> 17 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 360 gctagacgta agcgtga 17
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 357 gctagacgat agcgt 15 <210> 358 <211> 17 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 358 gctagacgct agcgtga 17 <210> 359 <211> 9 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 359 gctagacgt 9 <210> 360 <211> 17 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 360 gctagacgta agcgtga 17
- 92 -<210> 361 <211> 14 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 361 gctagacgtc tagc 14 <210> 362 <211> 13 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 362 gctagacgtt agc 13 <210> 363 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 363 gctagacgtt agcgt 15 <210> 364 <211> 17 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 364 gctagacgtt agcgtga 17 <210> 365 <211> 17
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 361 gctagacgtc tagc 14 <210> 362 <211> 13 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 362 gctagacgtt agc 13 <210> 363 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 363 gctagacgtt agcgt 15 <210> 364 <211> 17 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 364 gctagacgtt agcgtga 17 <210> 365 <211> 17
- 93 -<212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 365 gctagacgtt agctgga 17 <210> 366 <211> 17 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 366 gctagacgtt agctgga 17 <210> 367 <211> 17 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 367 gctagacgtt aggctga 17 <210> 368 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 368 gctagacgtt agtgt 15
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 365 gctagacgtt agctgga 17 <210> 366 <211> 17 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 366 gctagacgtt agctgga 17 <210> 367 <211> 17 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 367 gctagacgtt aggctga 17 <210> 368 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 368 gctagacgtt agtgt 15
- 94 -<210> 369 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <221> modified_base <222> (13)...(13) <223> m5c <400> 369 gctagacgtt agngt 15 <210> 370 <211> 14 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 370 gctagacgtt tagc 14 <210> 371 <211> 17 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 371 gctagagctt agcgtga 17 <210> 372 <211> 17 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0)
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <221> modified_base <222> (13)...(13) <223> m5c <400> 369 gctagacgtt agngt 15 <210> 370 <211> 14 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 370 gctagacgtt tagc 14 <210> 371 <211> 17 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 371 gctagagctt agcgtga 17 <210> 372 <211> 17 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0)
- 95 -<223> phosphodiester backbone <400> 372 gctagaggtt agcgtga 17 <210> 373 <211> 17 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 373 gctagaggtt agcgtga 17 <210> 374 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 374 gctagatgtt aacgt 15 <210> 375 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 375 gctagatgtt agcgt 15 <210> 376 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 373 gctagaggtt agcgtga 17 <210> 374 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 374 gctagatgtt aacgt 15 <210> 375 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 375 gctagatgtt agcgt 15 <210> 376 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature
- 96 -VIM) 01/97843 <222> (0)...(0) <223> phosphorothioate backbone <400> 376 gctagatgtt agcgt 15 <210> 377 <211> 17 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 377 gctagatgtt agcgtga 17 <210> 378 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <221> modified base <222> (7)...(7) <223> m5c <400> 378 gctagangtt agcgt 15 <210> 379 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <221> modified_base <222> (7)...(7) <223> m5c <400> 379 gctagangtt agtgt 15
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 377 gctagatgtt agcgtga 17 <210> 378 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <221> modified base <222> (7)...(7) <223> m5c <400> 378 gctagangtt agcgt 15 <210> 379 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <221> modified_base <222> (7)...(7) <223> m5c <400> 379 gctagangtt agtgt 15
- 97 -<210> 380 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 380 gctagcttta gagctttaga gctt 24 <210> 381 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 381 gctaggcgtt agcgt 15 <210> 382 <211> 13 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 382 gctagtcgat agc 13 <210> 383 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 383 gctagtcgat agcgt 15
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 380 gctagcttta gagctttaga gctt 24 <210> 381 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 381 gctaggcgtt agcgt 15 <210> 382 <211> 13 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 382 gctagtcgat agc 13 <210> 383 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 383 gctagtcgat agcgt 15
- 98 -<210> 384 <211> 13 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 384 gctagtcgct agc 13 <210> 385 <211> 13 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 385 gctandcghh agc 13 <210> 386 <211> 18 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 386 gctatgacgt tccaaggg 18 <210> 387 <211> 6 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_difference <222> (0)...(0) <223> phosphorothioate backbone <400> 387
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 384 gctagtcgct agc 13 <210> 385 <211> 13 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 385 gctandcghh agc 13 <210> 386 <211> 18 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 386 gctatgacgt tccaaggg 18 <210> 387 <211> 6 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_difference <222> (0)...(0) <223> phosphorothioate backbone <400> 387
- 99 -gctcga 6 <210> 388 <211> 17 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 388 gctcgttcag cgcgtct 17 <210> 389 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 389 gctgaacctt ccatgctgtt 20 <210> 390 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 390 gctgagctca tgccgtctgc 20 <210> 391 <211> 14 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 391 gctggacctt ccat 14 <210> 392 <211> 14 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 388 gctcgttcag cgcgtct 17 <210> 389 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 389 gctgaacctt ccatgctgtt 20 <210> 390 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 390 gctgagctca tgccgtctgc 20 <210> 391 <211> 14 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 391 gctggacctt ccat 14 <210> 392 <211> 14 <212> DNA
- 100 -<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 392 gctggacctt ccat 14 <210> 393 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 393 gctggccagc ttacctcccg 20 <210> 394 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 394 gctgtaaaat gaatcggccg 20 <210> 395 <211> 18 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 395 gctgtggggc ggctcctg 18 <210> 396 <211> 14 <212> DNA
<213> Artificial Sequence
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 392 gctggacctt ccat 14 <210> 393 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 393 gctggccagc ttacctcccg 20 <210> 394 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 394 gctgtaaaat gaatcggccg 20 <210> 395 <211> 18 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 395 gctgtggggc ggctcctg 18 <210> 396 <211> 14 <212> DNA
<213> Artificial Sequence
- 101 -<220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 396 gcttgacgtc aagc 14 <210> 397 <211> 14 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 397 gcttgacgtc tagc 14 <210> 398 <211> 14 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 398 gcttgacgtt tagc 14 <210> 399 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3, ends <400> 399 gcttgcgttg cgttt 15 <210> 400 <211> 20 <212> DNA
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 396 gcttgacgtc aagc 14 <210> 397 <211> 14 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 397 gcttgacgtc tagc 14 <210> 398 <211> 14 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 398 gcttgacgtt tagc 14 <210> 399 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3, ends <400> 399 gcttgcgttg cgttt 15 <210> 400 <211> 20 <212> DNA
- 102 -<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 400 gcttggaggg cctgtaagtg 20 <210> 401 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 401 ggaacgtt 8 <210> 402 <211> 13 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 402 ggaagacgtt aga 13 <210> 403 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 403 ggaattagta atagatatag aagtt 25 <210> 404 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 400 gcttggaggg cctgtaagtg 20 <210> 401 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 401 ggaacgtt 8 <210> 402 <211> 13 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 402 ggaagacgtt aga 13 <210> 403 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 403 ggaattagta atagatatag aagtt 25 <210> 404 <211> 24 <212> DNA
<213> Artificial Sequence <220>
- 103 -<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 404 ggagaaaccc atgagctcat ctgg 24 <210> 405 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 405 ggagctcttc gaacgccata 20 <210> 406 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 406 ggcagtgcag gctcaccggg 20 <210> 407 <211> 27 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 407 ggccaacttt caatgtggga tggcctc 27 <210> 408 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 408 ggccatccca cattgaaagt t 21 <210> 409 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 405 ggagctcttc gaacgccata 20 <210> 406 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 406 ggcagtgcag gctcaccggg 20 <210> 407 <211> 27 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 407 ggccaacttt caatgtggga tggcctc 27 <210> 408 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 408 ggccatccca cattgaaagt t 21 <210> 409 <211> 20 <212> DNA
<213> Artificial Sequence <220>
- 104 -<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 409 ggccttttcc cccccccccc 20 <210> 410 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 410 ggcggcggcg gcggcggcgg 20 <210> 411 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 411 ggcgttattc ctgactcgcc 20 <210> 412 <211> 19 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 412 ggctatgtcg atcctagcc 19 <210> 413 <211> 19 <212> DNA
<213> Artificial Sequence
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 410 ggcggcggcg gcggcggcgg 20 <210> 411 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 411 ggcgttattc ctgactcgcc 20 <210> 412 <211> 19 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 412 ggctatgtcg atcctagcc 19 <210> 413 <211> 19 <212> DNA
<213> Artificial Sequence
- 105 -<220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 413 ggctatgtcg ttcctagcc 19 <210> 414 <211> 27 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 414 ggctccgggg agggaatttt tgtctat 27 <210> 415 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 415 ggctgtattc ctgactgccc 20 <210> 416 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 416 gggaatgaaa gattttatta taag 24 <210> 417 <211> 38 <212> DNA
<213> Artificial Sequence
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 413 ggctatgtcg ttcctagcc 19 <210> 414 <211> 27 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 414 ggctccgggg agggaatttt tgtctat 27 <210> 415 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 415 ggctgtattc ctgactgccc 20 <210> 416 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 416 gggaatgaaa gattttatta taag 24 <210> 417 <211> 38 <212> DNA
<213> Artificial Sequence
- 106 -<220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 417 ggggactttc cgctggggac tttccagggg gactttcc 38 <210> 418 <211> 39 '<212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 418 ggggagggag gaacttctta aaattccccc agaatgttt 39 <210> 419 <211> 9 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 419 ggggagggg 9 <210> 420 <211> 9 <212> DNA
<213> Artificial Sequence ' <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 420 ggggagggt 9 <210> 421 <211> 20 . - 107 -<212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 421 ggggcatgac gttcaaaaaa 20 <210> 422 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 422 ggggcatgac gttcaaaaaa 20 <210> 423 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorodithioate backbone <400> 423 ggggcatgac gttcgggggg 20 <210> 424 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 424 ggggcatgac gttcgggggg 20 <210> 425 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 425 ggggcatgag cttcgggggg 20 <210> 426 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 426 ggggcatgag cttcgggggg 20 <210> 427 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 427 ggggcctcta tacaacctgg g 21 <210> 428 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 428 gggggacgtt ggggg 15 <210> 429 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 429 gggggggggg gggggggggg 20 <210> 430 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 430 gggggggggg gggggggggg 20 <210> 431 <211> 31 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 431 ggggggttgg ggaaaacccg gacttcctgc a 31 <210> 432 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 432 gggggttttt tttttggggg 20 <210> 433 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 433 ggggtaatcg atcagggggg 20 <210> 434 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 434 ggggtaatcg atgagggggg 20 <210> 435 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 435 ggggtaatgc atcagggggg 20 <210> 436 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 436 ggggtcaacg ttgagggggg 20 <210> 437 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 437 ggggtcaacg ttgagggggg 20 <210> 438 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 438 ggggtcaagc ttgagggggg 20 <210> 439 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 439 ggggtcaagt ctgagggggg 20 <210> 440 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 440 ggggtccagc gtgcgccatg gggg 24 <210> 441 <211> 18 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 441 ggggtccctg agactgcc 18 <210> 442 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 442 ggggtcgacc ttggaggggg g 21 <210> 443 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 443 ggggtcgacg tcgagggggg 20 <210> 444 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide VIM) 01/97843 <400> 444 ggggtcgtcg ttttgggggg 20 <210> 445 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 445 ggggtctgtc gttttggggg g 21 <210> 446 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 446 ggggtctgtg cttttggggg g 21 <210> 447 <211> 19 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 447 ggggtgacgt tcagggggg 19 <210> 448 <211> 19 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 448 ggggtgtcgt tcagggggg 19 <210> 449 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 449 ggggttgacg ttttgggggg 20 <210> 450 <211> 13 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 450 ggggttgggg gtt 13 <210> 451 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 451 ggtacctgtg.gggacattgt g 21 <210> 452 <211> 9 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 452 ggtgaggtg 9 <210> 453 <211> 17 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 453 ggtggtgtag gttttgg 17 <210> 454 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 454 ggttacggtc tgtcccatat 20 <210> 455 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 455 ggttcacgtg ctcatggctg 20 <210> 456 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 456 gtaacgtt 8 <210> 457 <211> 12 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 457 gtagccttcc ta 12 <210> 458 <211> 31 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 458 gtaggggact ttccgagctc gagatcctat g 31 <210> 459 <211> 19 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 459 gtcactcgtg gtacctcga 19 <210> 460 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 460 gtccatggcg tgcgggatga 20 <210> 461 <211> 23 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 461 gtcccaggtt gtatagaggc tgc 23 <210> 462 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 462 gtccccattt cccagaggag gaaat 25 <210> 463 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 463 gtccgggcca ggccaaagtc 20 <210> 464 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5 and 3' ends <400> 464 gtcggtcctg atgctgttcc 20 <210> 465 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 465 gtctatcgga ggactggcgc 20 <210> 466 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 466 gtctgtccca tgatctcgaa 20 <210> 467 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <221> modified_base <222> (7)...(7) =
<223> I
<221> modified base <222> (13)...(13) <223> I
<221> modified base <222> (18)¨(18) <223> I
<400> 467 gtgaatncgt tcncgggnct 20 <210> 468 <211> 18 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 468 gtgccggggt ctccgggc 18 <210> 469 <211> 18 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 469 gtgccggggt ctccgggc 18 <210> 470 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 470 gtgcgcgcga gcccgaaatc 20 <210> 471 <211> 26 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 471 gtgctgatca ccgatatcct gttcgg 26 <210> 472 <211> 22 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 472 gtgcttgacc accgatattt gg 22 <210> 473 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 473 gtggttacgg tcgtgcccat 20 <210> 474 <211> 18 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 474 gtgtcggggt ctccgggc 18 <210> 475 <211> 37 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 475 gttctcagat aaagcggaac cagcaacaga cacagaa 37 <210> 476 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 476 gttgaaaccc gagaacatca t 21 <210> 477 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_difference <222> (0)...(0) <223> phosphodiester backbone VIM) 01/97843 <400> 477 gttggataca ggccagactt tgttg 25 <210> 478 <211> 18 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 478 gtttttatat aatttggg 18 <210> 479 <211> 10 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <221> misc_feature <222> (10)...(10) <223> biotinylated at 3' end <221> modified_base <222> (2)...(2) <223> m5c <400> 479 gnaatattgc 10 <210> 480 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> modified_base <222> (2)...(2) <223> m5c <221> modified_base <222> (5)...(5) <223> m5c <221> modified_base <222> (9)...(9) <223> m5c <221> modified base <222> (12)¨(12) <223> m5c <221> modified base <222> (14)¨(1:4) <223> m5c <221> modified base <222> (16)¨(1.0 <223> m5c <400> 480 gnggngggng gngngngccc 20 <210> 481 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)¨(0) <223> phosphorothioate backbone <400> 481 taaacgtt 8 <210> 482 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 482 taagcgct 8 <210> 483 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 483 taagctctgt caacgccagg 20 <210> 484 <211> 23 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 484 taccgagctt cgacgagatt tca 23 <210> 485 <211> 18 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 485 taccgcgtgc gaccctct 18 <210> 486 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 486 tactcttcgg atcccttgcg 20 <210> 487 <211> 32 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 487 tagaaacagc attcttcttt tagggcagca ca 32 <210> 488 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 488 tagacgtc 8 <210> 489 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 489 tagacgttag cgtga 15 <210> 490 <211> 36 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 490 tatagtccct gagactgccc caccttctca acaacc 36 <210> 491 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 491 tatcggagga ctggcgcgcc g 21 <210> 492 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 492 tatgccgcgc ccggacttat 20 <210> 493 <211> 27 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 493 tcaaatgtgg gattttccca tgagtct 27 <210> 494 <211> 7 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 494 tcaacgt 7 <210> 495 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 495 tcaacgtc 8 <210> 496 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> p-ethoxy backbone <400> 496 tcaacgtt 8 <210> 497 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 497 tcaacgtt 8 <210> 498 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 498 tcaacgtt 8 <210> 499 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 499 tcaacgttaa cgttaacgtt 20 <210> 500 <211> 32 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <221> misc_feature <222> (32)...(32) <223> biotinylated at 3' end <400> 500 tcaacgttaa cgttaacgtt aacgttaacg tt 32 <210> 501 <211> 10 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 501 tcaacgttga 10 <210> 502 <211> 10 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 502 tcaacgttga 10 <210> 503 <211> 10 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <221> misc_feature <222> (10)...(10) <223> biotinylated at 3' end <400> 503 tcaacgttga 10 <210> 504 <211> 10 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <221> misc_feature <222> (10)...(10) <223> FITC labeled <400> 504 tcaacgttga 10 <210> 505 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> p-ethoxy backbone <400> 505 tcaagctt 8 <210> 506 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 506 tcaagctt 8 <210> 507 <211> 10 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <221> misc_feature <222> (10)...(10) <223> FITC labeled <400> 507 tcaatgctga 10 <210> 508 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <221> modified_base <222> (5)¨(5) <223> m5c <400> 508 tcaangtt 8 <210> 509 <211> 10 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <221> misc_feature <222> (10)...(10) <223> biotinylated at 3' end <221> modified_base <222> (5)...(5) <223> m5c <400> 509 tcaangttga 10 <210> 510 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 510 tcaccggt 8 <210> 511 <211> 17 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 511 tcacgctaac ctctagc 17 <210> 512 <211> 17 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 512 tcacgctaac ctctgac 17 <210> 513 <211> 17 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 513 tcacgctaac gtctagc 17 <210> 514 <211> 6 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 514 tcacgt 6 <210> 515 <211> 27 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 515 tcagaccacg tggtcgggtg ttcctga 27 <210> 516 <211> 27 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 516 tcagaccagc tggtcgggtg ttcctga 27 <210> 517 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 517 tcagcgct 8 <210> 518 <211> 12 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 518 tcagcgtgcg cc 12 <210> 519 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 519 tcagctctgg tactttttca 20 <210> 520 <211> 27 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 520 tcaggaacac ccgaccacgt ggtctga 27 <210> 521 <211> 27 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 521 tcaggaacac ccgaccagct ggtctga 27 <210> 522 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 522 tcaggggtgg ggggaacctt 20 <210> 523 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <221> modified_base <222> (5)...(5) <223> m5c <400> 523 tcagngct 8 <210> 524 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 524 tcatcgat 8 <210> 525 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 525 tccaagacgt tcctgatgct 20 <210> 526 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 526 tccaagtagt tcctagttct 20 <210> 527 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 527 tccaccacgt ggctgatgct 20 <210> 528 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 528 tccaccacgt ggtctatgct 20 <210> 529 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 529 tccacgacgt tttcgacgtt 20 <210> 530 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 530 tccagacggt gaagt 15 <210> 531 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 531 tccagacgtt gaagt 15 <210> 532 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 532 tccagagctt gaagt 15 <210> 533 <211> 16 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3, ends <400> 533 tccagcgtgc gccata 16 <210> 534 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 534 tccaggacgt tcctagttct 20 <210> 535 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 535 tccaggactt ctctcaggtt 20 <210> 536 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 536 tccaggactt ctctcaggtt 20 <210> 537 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 537 tccaggactt tcctcaggtt 20 <210> 538 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 538 tccaggactt tcctcaggtt 20 <210> 539 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 539 tccaggagct tcctagttct 20 <210> 540 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 540 tccaggatgt tcctagttct 20 <210> 541 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 541 tccagtctag gcctagttct 20 <210> 542 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 542 tccagttcct tcctcagtct 20 <210> 543 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 543 tccagttcga gcctagttct 20 <210> 544 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 544 tccataacgt tcctgagtct 20 <210> 545 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)... (0) <223> phosphodiester backbone <400> 545 tccataacgt tcctgatgct 20 <210> 546 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 546 tccatagcga tcctagcgat 20 <210> 547 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 547 tccatagcgg tcctagcggt 20 <210> 548 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 548 tccatagcgt tcctagcgtt 20 <210> 549 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 549 tccatagcgt tcctagcgtt 20 <210> 550 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 550 tccatcacgt gcctgagtct 20 <210> 551 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 551 tccatgacat tcctgatgct 20 <210> 552 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 552 tccatgacgg tcctgacggt 20 <210> 553 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 553 tccatgacgg tcctgacggt 20 <210> 554 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 554 tccatgacgg tcctgagtct 20 <210> 555 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 555 tccatgacgg tcctgatgct 20 <210> 556 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 556 tccatgacgt ccctgagtct 20 <210> 557 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 557 tccatgacgt ccctgatgct 20 <210> 558 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 558 tccatgacgt tcctagttct 20 <210> 559 <211> 45 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 559 tccatgacgt tcctctccat gacgttcctc tccatgacgt tcctc 45 <210> 560 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 560 tccatgacgt tcctgacgtt 20 <210> 561 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 561 tccatgacgt tcctgacgtt 20 <210> 562 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 562 tccatgacgt tcctgacgtt 20 <210> 563 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 563 tccatgacgt tcctgacgtt 20 <210> 564 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 564 tccatgacgt tcctgagtct 20 <210> 565 <211> 19 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 565 tccatgacgt tcctgatcc 19 <210> 566 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 566 tccatgacgt tcctgatgct 20 <210> 567 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 567 tccatgacgt tcctgatgct 20 <210> 568 <211> 29 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 568 tccatgacgt tcctgcagtt cctgacgtt 29 <210> 569 <211> 20 <212> DNA
<213> Artificial Sequence VIM) 01/97843 <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 569 tccatgacgt tcctgccgtt 20 <210> 570 <211> 20 =
<212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 570 tccatgacgt tcctgcgttt 20 <210> 571 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 571 tccatgacgt tcctggcggg 20 <210> 572 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <221> modified base ¨
<222> (13)(1.3) <223> m5c <400> 572 tccatgacgt tcntgatgct 20 <210> 573 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 573 tccatgagct tcctgagctt 20 <210> 574 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 574 tccatgagct tcctgagtct 20 <210> 575 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> p-ethoxy backbone <400> 575 tccatgagct tcctgagtct 20 <210> 576 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 576 tccatgagct tcctgagtct 20 <210> 577 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorodithioate backbone <400> 577 tccatgagct tcctgatgct 20 <210> 578 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 578 tccatgagct tccttgagtc t 21 <210> 579 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <221> modified_base <222> (8)...(8) <223> I
<221> modified_base <222> (17)...(17) <223> I
<400> 579 tccatgangt tcctgangtt 20 <210> 580 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 580 tccatgatgt tcctagttct 20 <210> 581 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <221> modified_base <222> (8)...(8) <223> m5c <400> 581 tccatgangt tcctagttct 20 <210> 582 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <221> modified_base <222> (8)...(8) <223> m5c <400> 582 tccatgangt tcctgatgct 20 <210> 583 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <221> modified_base <222> (8)...(8) <223> m5c <221> modified base <222> (17)...(17) <223> m5c <400> 583 tccatgangt tcctgangtt 20 <210> 584 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 584 tccatgccgg tcctgagtct 20 <210> 585 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 585 tccatgccgg tcctgatgct 20 <210> 586 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 586 tccatgccgg tcctgccggt 20 <210> 587 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 587 tccatgccgt tcctgccgtt 20 <210> 588 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 588 tccatgccgt tcctgccgtt 20 <210> 589 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 589 tccatgcgcg tcctgcgcgt 20 <210> 590 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 590 tccatgcgtg cgtgcgtttt 20 <210> 591 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 591 tccatgcgtt gcgttgcgtt 20 <210> 592 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 592 tccatgctgg tcctgagtct 20 <210> 593 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 593 tccatgctgg tcctgatgct 20 <210> 594 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 594 tccatggcgg gcctggcggg 20 <210> 595 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 595 tccatggcgg tcctgatgct 20 <210> 596 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 596 tccatgtagt tcctagttct 20 <210> 597 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 597 tccatgtcct tcctgatgct 20 <210> 598 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 598 tccatgtcga tcctgagtct 20 <210> 599 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 599 tccatgtcga tcctgatgct 20 <210> 600 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 600 tccatgtcgc tcctgagtct 20 <210> 601 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 601 tccatgtcgc tcctgatcct 20 <210> 602 <211> 20 <212> DNA
<213> Attificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 602 tccatgtcgg tcctgagtct 20 <210> 603 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 603 tccatgtcgg tcctgatgct 20 <210> 604 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 604 tccatgtcgg tcctgatgct 20 <210> 605 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 605 tccatgtcgg tcctgctgat 20 <210> 606 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <221> modified base ¨
<222> (12)(7:2) <223> m5c <400> 606 tccatgtcgg tnctgatgct 20 <210> 607 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 607 tccatgtcgt tccgcgcgcg 20 <210> 608 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 608 tccatgtcgt tcctagttct 20 <210> 609 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 609 tccatgtcgt tcctgagtct 20 <210> 610 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 610 tccatgtcgt tcctgatgcg 20 <210> 611 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 611 tccatgtcgt tcctgatgct 20 <210> 612 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 612 tccatgtcgt tcctgccgct 20 <210> 613 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 613 tccatgtcgt tcctgtagct 20 <210> 614 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 614 tccatgtcgt tcctgtcgtt 20 <210> 615 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 615 tccatgtcgt tcctgtcgtt 20 <210> 616 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 616 tccatgtcgt ttttgtcgtt 20 <210> 617 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 617 tccatgtgct tcctgatgct 20 <210> 618 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <221> modified_base <222> (8)...(8) <223> m5c <400> 618 tccatgtngg tcctgagtct 20 <210> 619 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <221> modified_base <222> (8)...(8) <223> m5c <400> 619 tccatgtngg tcctgatgct 20 <210> 620 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <221> modified_base <222> (8)...(8) <223> m5c <400> 620 tccatgtngt tcctgatgct 20 <210> 621 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <221> modified_base <222> (8)...(8) <223> m5c <221> modified base <222> (17)¨(1'7) <223> m5c <400> 621 tccatgtngt tcctgtngtt 20 <210> 622 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 622 tccattgcgt tccttgcgtt 20 <210> 623 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 623 tcccgacggt gaagt 15 <210> 624 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 624 tcccgccgtt gaagt 15 <210> 625 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 625 tcccgcgcgt tccgcgcgtt 20 <210> 626 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 626 tccctgagac tgccccacct t 21 <210> 627 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 627 tccgatcg 8 <210> 628 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 628 tccggacggt gaagt 15 <210> 629 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 629 tccggccgtt gaagt 15 <210> 630 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 630 tccgtacg 8 <210> 631 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 631 tcctaacgtt gaagt 15 <210> 632 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 632 tcctagcgtt gaagt 15 <210> 633 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 633 tcctcacgtt gaagt 15 <210> 634 <211> 6 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 634 tcctga 6 <210> 635 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone .
<400> 635 tcctgaaaag gaagt 15 <210> 636 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 636 tcctgacgat gaagt 15 <210> 637 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 637 tcctgacgct gaagt 15 <210> 638 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 638 tcctgacggg gaagt 15 <210> 639 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 639 tcctgacggg gaagt 15 <210> 640 <211> 14 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 640 tcctgacggg gagt 14 <210> 641 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 641 tcctgacggt gaagt 15 <210> 642 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 642 tcctgacggt gaagt 15 <210> 643 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 643 tcctgacgta gaagt 15 <210> 644 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 644 tcctgacgtc gaagt 15 <210> 645 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_difference <222> (0)...(0) <223> phosphodiester backbone <400> 645 tcctgacgtg gaagt 15 <210> 646 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 646 tcctgacgtg gaagt 15 <210> 647 <211> 13 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 647 tcctgacgtt aga 13 <210> 648 <211> 13 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 648 tcctgacgtt ccc 13 <210> 649 <211> 32 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 649 tcctgacgtt cccctggcgg tcccctgtcg ct 32 <210> 650 <211> 19 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 650 tcctgacgtt cctgacgtt 19 <210> 651 <211> 28 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 651 tcctgacgtt cctggcggtc ctgtcgct 28 <210> 652 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 652 tcctgacgtt ccttc 15 <210> 653 <211> 22 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 653 tcctgacgtt cggcgcgcgc cc 22 <210> 654 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 654 tcctgacgtt gaagt 15 <210> 655 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 655 tcctgacgtt gaagt 15 <210> 656 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 656 tcctgagctt gaagt 15 <210> 657 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 657 tcctgagctt gaagt 15 <210> 658 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <221> modified_base <222> (7)...(7) <223> m5c <400> 658 tcctgangtt gaagt 15 <210> 659 <211> 15 , <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 659 tcctgccgtt gaagt 15 <210> 660 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone , DEMANDES OU BREVETS VOLUMINEUX
LA PRESENTE PARTIE DE CETTE DEMANDE OU CE BREVETS
COMPREND PLUS D'UN TOME.
NOTE: Pour les tomes additionels, veillez contacter le Bureau Canadien des Brevets.
JUMBO APPLICATIONS / PATENTS
THIS SECTION OF THE APPLICATION / PATENT CONTAINS MORE
THAN ONE VOLUME.
NOTE: For additional volumes please contact the Canadian Patent Office.
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 417 ggggactttc cgctggggac tttccagggg gactttcc 38 <210> 418 <211> 39 '<212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 418 ggggagggag gaacttctta aaattccccc agaatgttt 39 <210> 419 <211> 9 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 419 ggggagggg 9 <210> 420 <211> 9 <212> DNA
<213> Artificial Sequence ' <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 420 ggggagggt 9 <210> 421 <211> 20 . - 107 -<212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 421 ggggcatgac gttcaaaaaa 20 <210> 422 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 422 ggggcatgac gttcaaaaaa 20 <210> 423 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorodithioate backbone <400> 423 ggggcatgac gttcgggggg 20 <210> 424 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 424 ggggcatgac gttcgggggg 20 <210> 425 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 425 ggggcatgag cttcgggggg 20 <210> 426 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 426 ggggcatgag cttcgggggg 20 <210> 427 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 427 ggggcctcta tacaacctgg g 21 <210> 428 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 428 gggggacgtt ggggg 15 <210> 429 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 429 gggggggggg gggggggggg 20 <210> 430 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 430 gggggggggg gggggggggg 20 <210> 431 <211> 31 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 431 ggggggttgg ggaaaacccg gacttcctgc a 31 <210> 432 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 432 gggggttttt tttttggggg 20 <210> 433 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 433 ggggtaatcg atcagggggg 20 <210> 434 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 434 ggggtaatcg atgagggggg 20 <210> 435 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 435 ggggtaatgc atcagggggg 20 <210> 436 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 436 ggggtcaacg ttgagggggg 20 <210> 437 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 437 ggggtcaacg ttgagggggg 20 <210> 438 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 438 ggggtcaagc ttgagggggg 20 <210> 439 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 439 ggggtcaagt ctgagggggg 20 <210> 440 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 440 ggggtccagc gtgcgccatg gggg 24 <210> 441 <211> 18 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 441 ggggtccctg agactgcc 18 <210> 442 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 442 ggggtcgacc ttggaggggg g 21 <210> 443 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 443 ggggtcgacg tcgagggggg 20 <210> 444 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide VIM) 01/97843 <400> 444 ggggtcgtcg ttttgggggg 20 <210> 445 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 445 ggggtctgtc gttttggggg g 21 <210> 446 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 446 ggggtctgtg cttttggggg g 21 <210> 447 <211> 19 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 447 ggggtgacgt tcagggggg 19 <210> 448 <211> 19 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 448 ggggtgtcgt tcagggggg 19 <210> 449 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 449 ggggttgacg ttttgggggg 20 <210> 450 <211> 13 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 450 ggggttgggg gtt 13 <210> 451 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 451 ggtacctgtg.gggacattgt g 21 <210> 452 <211> 9 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 452 ggtgaggtg 9 <210> 453 <211> 17 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 453 ggtggtgtag gttttgg 17 <210> 454 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 454 ggttacggtc tgtcccatat 20 <210> 455 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 455 ggttcacgtg ctcatggctg 20 <210> 456 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 456 gtaacgtt 8 <210> 457 <211> 12 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 457 gtagccttcc ta 12 <210> 458 <211> 31 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 458 gtaggggact ttccgagctc gagatcctat g 31 <210> 459 <211> 19 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 459 gtcactcgtg gtacctcga 19 <210> 460 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 460 gtccatggcg tgcgggatga 20 <210> 461 <211> 23 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 461 gtcccaggtt gtatagaggc tgc 23 <210> 462 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 462 gtccccattt cccagaggag gaaat 25 <210> 463 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 463 gtccgggcca ggccaaagtc 20 <210> 464 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5 and 3' ends <400> 464 gtcggtcctg atgctgttcc 20 <210> 465 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 465 gtctatcgga ggactggcgc 20 <210> 466 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 466 gtctgtccca tgatctcgaa 20 <210> 467 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <221> modified_base <222> (7)...(7) =
<223> I
<221> modified base <222> (13)...(13) <223> I
<221> modified base <222> (18)¨(18) <223> I
<400> 467 gtgaatncgt tcncgggnct 20 <210> 468 <211> 18 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 468 gtgccggggt ctccgggc 18 <210> 469 <211> 18 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 469 gtgccggggt ctccgggc 18 <210> 470 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 470 gtgcgcgcga gcccgaaatc 20 <210> 471 <211> 26 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 471 gtgctgatca ccgatatcct gttcgg 26 <210> 472 <211> 22 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 472 gtgcttgacc accgatattt gg 22 <210> 473 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 473 gtggttacgg tcgtgcccat 20 <210> 474 <211> 18 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 474 gtgtcggggt ctccgggc 18 <210> 475 <211> 37 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 475 gttctcagat aaagcggaac cagcaacaga cacagaa 37 <210> 476 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 476 gttgaaaccc gagaacatca t 21 <210> 477 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_difference <222> (0)...(0) <223> phosphodiester backbone VIM) 01/97843 <400> 477 gttggataca ggccagactt tgttg 25 <210> 478 <211> 18 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 478 gtttttatat aatttggg 18 <210> 479 <211> 10 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <221> misc_feature <222> (10)...(10) <223> biotinylated at 3' end <221> modified_base <222> (2)...(2) <223> m5c <400> 479 gnaatattgc 10 <210> 480 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> modified_base <222> (2)...(2) <223> m5c <221> modified_base <222> (5)...(5) <223> m5c <221> modified_base <222> (9)...(9) <223> m5c <221> modified base <222> (12)¨(12) <223> m5c <221> modified base <222> (14)¨(1:4) <223> m5c <221> modified base <222> (16)¨(1.0 <223> m5c <400> 480 gnggngggng gngngngccc 20 <210> 481 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)¨(0) <223> phosphorothioate backbone <400> 481 taaacgtt 8 <210> 482 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 482 taagcgct 8 <210> 483 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 483 taagctctgt caacgccagg 20 <210> 484 <211> 23 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 484 taccgagctt cgacgagatt tca 23 <210> 485 <211> 18 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 485 taccgcgtgc gaccctct 18 <210> 486 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 486 tactcttcgg atcccttgcg 20 <210> 487 <211> 32 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 487 tagaaacagc attcttcttt tagggcagca ca 32 <210> 488 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 488 tagacgtc 8 <210> 489 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 489 tagacgttag cgtga 15 <210> 490 <211> 36 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 490 tatagtccct gagactgccc caccttctca acaacc 36 <210> 491 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 491 tatcggagga ctggcgcgcc g 21 <210> 492 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 492 tatgccgcgc ccggacttat 20 <210> 493 <211> 27 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 493 tcaaatgtgg gattttccca tgagtct 27 <210> 494 <211> 7 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 494 tcaacgt 7 <210> 495 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 495 tcaacgtc 8 <210> 496 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> p-ethoxy backbone <400> 496 tcaacgtt 8 <210> 497 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 497 tcaacgtt 8 <210> 498 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 498 tcaacgtt 8 <210> 499 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 499 tcaacgttaa cgttaacgtt 20 <210> 500 <211> 32 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <221> misc_feature <222> (32)...(32) <223> biotinylated at 3' end <400> 500 tcaacgttaa cgttaacgtt aacgttaacg tt 32 <210> 501 <211> 10 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 501 tcaacgttga 10 <210> 502 <211> 10 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 502 tcaacgttga 10 <210> 503 <211> 10 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <221> misc_feature <222> (10)...(10) <223> biotinylated at 3' end <400> 503 tcaacgttga 10 <210> 504 <211> 10 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <221> misc_feature <222> (10)...(10) <223> FITC labeled <400> 504 tcaacgttga 10 <210> 505 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> p-ethoxy backbone <400> 505 tcaagctt 8 <210> 506 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 506 tcaagctt 8 <210> 507 <211> 10 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <221> misc_feature <222> (10)...(10) <223> FITC labeled <400> 507 tcaatgctga 10 <210> 508 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <221> modified_base <222> (5)¨(5) <223> m5c <400> 508 tcaangtt 8 <210> 509 <211> 10 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <221> misc_feature <222> (10)...(10) <223> biotinylated at 3' end <221> modified_base <222> (5)...(5) <223> m5c <400> 509 tcaangttga 10 <210> 510 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 510 tcaccggt 8 <210> 511 <211> 17 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 511 tcacgctaac ctctagc 17 <210> 512 <211> 17 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 512 tcacgctaac ctctgac 17 <210> 513 <211> 17 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 513 tcacgctaac gtctagc 17 <210> 514 <211> 6 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 514 tcacgt 6 <210> 515 <211> 27 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 515 tcagaccacg tggtcgggtg ttcctga 27 <210> 516 <211> 27 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 516 tcagaccagc tggtcgggtg ttcctga 27 <210> 517 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 517 tcagcgct 8 <210> 518 <211> 12 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 518 tcagcgtgcg cc 12 <210> 519 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 519 tcagctctgg tactttttca 20 <210> 520 <211> 27 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 520 tcaggaacac ccgaccacgt ggtctga 27 <210> 521 <211> 27 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 521 tcaggaacac ccgaccagct ggtctga 27 <210> 522 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 522 tcaggggtgg ggggaacctt 20 <210> 523 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <221> modified_base <222> (5)...(5) <223> m5c <400> 523 tcagngct 8 <210> 524 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 524 tcatcgat 8 <210> 525 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 525 tccaagacgt tcctgatgct 20 <210> 526 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 526 tccaagtagt tcctagttct 20 <210> 527 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 527 tccaccacgt ggctgatgct 20 <210> 528 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 528 tccaccacgt ggtctatgct 20 <210> 529 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 529 tccacgacgt tttcgacgtt 20 <210> 530 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 530 tccagacggt gaagt 15 <210> 531 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 531 tccagacgtt gaagt 15 <210> 532 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 532 tccagagctt gaagt 15 <210> 533 <211> 16 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3, ends <400> 533 tccagcgtgc gccata 16 <210> 534 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 534 tccaggacgt tcctagttct 20 <210> 535 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 535 tccaggactt ctctcaggtt 20 <210> 536 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 536 tccaggactt ctctcaggtt 20 <210> 537 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 537 tccaggactt tcctcaggtt 20 <210> 538 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 538 tccaggactt tcctcaggtt 20 <210> 539 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 539 tccaggagct tcctagttct 20 <210> 540 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 540 tccaggatgt tcctagttct 20 <210> 541 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 541 tccagtctag gcctagttct 20 <210> 542 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 542 tccagttcct tcctcagtct 20 <210> 543 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 543 tccagttcga gcctagttct 20 <210> 544 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 544 tccataacgt tcctgagtct 20 <210> 545 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)... (0) <223> phosphodiester backbone <400> 545 tccataacgt tcctgatgct 20 <210> 546 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 546 tccatagcga tcctagcgat 20 <210> 547 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 547 tccatagcgg tcctagcggt 20 <210> 548 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 548 tccatagcgt tcctagcgtt 20 <210> 549 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 549 tccatagcgt tcctagcgtt 20 <210> 550 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 550 tccatcacgt gcctgagtct 20 <210> 551 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 551 tccatgacat tcctgatgct 20 <210> 552 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 552 tccatgacgg tcctgacggt 20 <210> 553 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 553 tccatgacgg tcctgacggt 20 <210> 554 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 554 tccatgacgg tcctgagtct 20 <210> 555 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 555 tccatgacgg tcctgatgct 20 <210> 556 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 556 tccatgacgt ccctgagtct 20 <210> 557 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 557 tccatgacgt ccctgatgct 20 <210> 558 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 558 tccatgacgt tcctagttct 20 <210> 559 <211> 45 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 559 tccatgacgt tcctctccat gacgttcctc tccatgacgt tcctc 45 <210> 560 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 560 tccatgacgt tcctgacgtt 20 <210> 561 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 561 tccatgacgt tcctgacgtt 20 <210> 562 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 562 tccatgacgt tcctgacgtt 20 <210> 563 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 563 tccatgacgt tcctgacgtt 20 <210> 564 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 564 tccatgacgt tcctgagtct 20 <210> 565 <211> 19 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 565 tccatgacgt tcctgatcc 19 <210> 566 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 566 tccatgacgt tcctgatgct 20 <210> 567 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 567 tccatgacgt tcctgatgct 20 <210> 568 <211> 29 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 568 tccatgacgt tcctgcagtt cctgacgtt 29 <210> 569 <211> 20 <212> DNA
<213> Artificial Sequence VIM) 01/97843 <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 569 tccatgacgt tcctgccgtt 20 <210> 570 <211> 20 =
<212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 570 tccatgacgt tcctgcgttt 20 <210> 571 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 571 tccatgacgt tcctggcggg 20 <210> 572 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <221> modified base ¨
<222> (13)(1.3) <223> m5c <400> 572 tccatgacgt tcntgatgct 20 <210> 573 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 573 tccatgagct tcctgagctt 20 <210> 574 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 574 tccatgagct tcctgagtct 20 <210> 575 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> p-ethoxy backbone <400> 575 tccatgagct tcctgagtct 20 <210> 576 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 576 tccatgagct tcctgagtct 20 <210> 577 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorodithioate backbone <400> 577 tccatgagct tcctgatgct 20 <210> 578 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 578 tccatgagct tccttgagtc t 21 <210> 579 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <221> modified_base <222> (8)...(8) <223> I
<221> modified_base <222> (17)...(17) <223> I
<400> 579 tccatgangt tcctgangtt 20 <210> 580 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 580 tccatgatgt tcctagttct 20 <210> 581 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <221> modified_base <222> (8)...(8) <223> m5c <400> 581 tccatgangt tcctagttct 20 <210> 582 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <221> modified_base <222> (8)...(8) <223> m5c <400> 582 tccatgangt tcctgatgct 20 <210> 583 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <221> modified_base <222> (8)...(8) <223> m5c <221> modified base <222> (17)...(17) <223> m5c <400> 583 tccatgangt tcctgangtt 20 <210> 584 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 584 tccatgccgg tcctgagtct 20 <210> 585 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 585 tccatgccgg tcctgatgct 20 <210> 586 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 586 tccatgccgg tcctgccggt 20 <210> 587 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 587 tccatgccgt tcctgccgtt 20 <210> 588 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 588 tccatgccgt tcctgccgtt 20 <210> 589 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 589 tccatgcgcg tcctgcgcgt 20 <210> 590 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 590 tccatgcgtg cgtgcgtttt 20 <210> 591 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 591 tccatgcgtt gcgttgcgtt 20 <210> 592 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 592 tccatgctgg tcctgagtct 20 <210> 593 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 593 tccatgctgg tcctgatgct 20 <210> 594 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 594 tccatggcgg gcctggcggg 20 <210> 595 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 595 tccatggcgg tcctgatgct 20 <210> 596 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 596 tccatgtagt tcctagttct 20 <210> 597 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 597 tccatgtcct tcctgatgct 20 <210> 598 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 598 tccatgtcga tcctgagtct 20 <210> 599 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 599 tccatgtcga tcctgatgct 20 <210> 600 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 600 tccatgtcgc tcctgagtct 20 <210> 601 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 601 tccatgtcgc tcctgatcct 20 <210> 602 <211> 20 <212> DNA
<213> Attificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 602 tccatgtcgg tcctgagtct 20 <210> 603 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 603 tccatgtcgg tcctgatgct 20 <210> 604 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 604 tccatgtcgg tcctgatgct 20 <210> 605 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 605 tccatgtcgg tcctgctgat 20 <210> 606 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <221> modified base ¨
<222> (12)(7:2) <223> m5c <400> 606 tccatgtcgg tnctgatgct 20 <210> 607 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 607 tccatgtcgt tccgcgcgcg 20 <210> 608 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 608 tccatgtcgt tcctagttct 20 <210> 609 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 609 tccatgtcgt tcctgagtct 20 <210> 610 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 610 tccatgtcgt tcctgatgcg 20 <210> 611 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 611 tccatgtcgt tcctgatgct 20 <210> 612 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 612 tccatgtcgt tcctgccgct 20 <210> 613 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 613 tccatgtcgt tcctgtagct 20 <210> 614 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 614 tccatgtcgt tcctgtcgtt 20 <210> 615 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 615 tccatgtcgt tcctgtcgtt 20 <210> 616 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 616 tccatgtcgt ttttgtcgtt 20 <210> 617 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 617 tccatgtgct tcctgatgct 20 <210> 618 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <221> modified_base <222> (8)...(8) <223> m5c <400> 618 tccatgtngg tcctgagtct 20 <210> 619 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <221> modified_base <222> (8)...(8) <223> m5c <400> 619 tccatgtngg tcctgatgct 20 <210> 620 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <221> modified_base <222> (8)...(8) <223> m5c <400> 620 tccatgtngt tcctgatgct 20 <210> 621 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <221> modified_base <222> (8)...(8) <223> m5c <221> modified base <222> (17)¨(1'7) <223> m5c <400> 621 tccatgtngt tcctgtngtt 20 <210> 622 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 622 tccattgcgt tccttgcgtt 20 <210> 623 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 623 tcccgacggt gaagt 15 <210> 624 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 624 tcccgccgtt gaagt 15 <210> 625 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 625 tcccgcgcgt tccgcgcgtt 20 <210> 626 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 626 tccctgagac tgccccacct t 21 <210> 627 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 627 tccgatcg 8 <210> 628 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 628 tccggacggt gaagt 15 <210> 629 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 629 tccggccgtt gaagt 15 <210> 630 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 630 tccgtacg 8 <210> 631 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 631 tcctaacgtt gaagt 15 <210> 632 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 632 tcctagcgtt gaagt 15 <210> 633 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 633 tcctcacgtt gaagt 15 <210> 634 <211> 6 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 634 tcctga 6 <210> 635 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone .
<400> 635 tcctgaaaag gaagt 15 <210> 636 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 636 tcctgacgat gaagt 15 <210> 637 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 637 tcctgacgct gaagt 15 <210> 638 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 638 tcctgacggg gaagt 15 <210> 639 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 639 tcctgacggg gaagt 15 <210> 640 <211> 14 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 640 tcctgacggg gagt 14 <210> 641 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 641 tcctgacggt gaagt 15 <210> 642 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 642 tcctgacggt gaagt 15 <210> 643 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 643 tcctgacgta gaagt 15 <210> 644 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 644 tcctgacgtc gaagt 15 <210> 645 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_difference <222> (0)...(0) <223> phosphodiester backbone <400> 645 tcctgacgtg gaagt 15 <210> 646 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 646 tcctgacgtg gaagt 15 <210> 647 <211> 13 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 647 tcctgacgtt aga 13 <210> 648 <211> 13 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 648 tcctgacgtt ccc 13 <210> 649 <211> 32 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 649 tcctgacgtt cccctggcgg tcccctgtcg ct 32 <210> 650 <211> 19 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 650 tcctgacgtt cctgacgtt 19 <210> 651 <211> 28 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 651 tcctgacgtt cctggcggtc ctgtcgct 28 <210> 652 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 652 tcctgacgtt ccttc 15 <210> 653 <211> 22 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 653 tcctgacgtt cggcgcgcgc cc 22 <210> 654 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 654 tcctgacgtt gaagt 15 <210> 655 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 655 tcctgacgtt gaagt 15 <210> 656 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 656 tcctgagctt gaagt 15 <210> 657 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone <400> 657 tcctgagctt gaagt 15 <210> 658 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <221> modified_base <222> (7)...(7) <223> m5c <400> 658 tcctgangtt gaagt 15 <210> 659 <211> 15 , <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphodiester backbone <400> 659 tcctgccgtt gaagt 15 <210> 660 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0)...(0) <223> phosphorothioate backbone , DEMANDES OU BREVETS VOLUMINEUX
LA PRESENTE PARTIE DE CETTE DEMANDE OU CE BREVETS
COMPREND PLUS D'UN TOME.
NOTE: Pour les tomes additionels, veillez contacter le Bureau Canadien des Brevets.
JUMBO APPLICATIONS / PATENTS
THIS SECTION OF THE APPLICATION / PATENT CONTAINS MORE
THAN ONE VOLUME.
NOTE: For additional volumes please contact the Canadian Patent Office.
Claims (36)
1. Use of an immunostimulatory nucleic acid comprising at least one unmethylated CpG dinucleotide comprising the sequence 5' X1X2CGX3X4 3' wherein C is unmethylated and X1, X2, X3 and X4 are nucleotides, wherein X3 and X4 are TT, and wherein the nucleic acid is 8-40 nucleotides in length, and an antibody specific for a CD19, CD20, CD22 or CD40 antigen, in the treatment or prevention of a B cell malignancy, wherein the immunostimulatory nucleic acid upregulates expression of the antigen.
2. Use of an immunostimulatory nucleic acid comprising at least one unmethylated CpG dinucleotide comprising the sequence 5' X1X2CGX3X4 3' wherein C is unmethylated and X1, X2, X3 and X4 are nucleotides, wherein X3 and X4 are TT, and wherein the nucleic acid is 8-40 nucleotides in length for the manufacture of a medicament for use, with an antibody specific for a CD19, CD20, CD22 or CD40 antigen, in the treatment or prevention of a B cell malignancy, wherein the immunostimulatory nucleic acid upregulates expression of the antigen.
3. Use of an antibody specific for a CD19, CD20, CD22 or CD40 antigen for the manufacture of a medicament for use, in conjunction with an immunostimulatory nucleic acid comprising at least one unmethylated CpG dinucleotide comprising the sequence 5' X1X2CGX3X4 3' wherein C is unmethylated and X1, X2, X3 and X4 are nucleotides, wherein X3 and X4 are TT, and wherein the nucleic acid is 8-40 nucleotides in length in the treatment or prevention of a B cell malignancy, wherein the immunostimulatory nucleic acid upregulates expression of the antigen.
4. A use as claimed in any one of claims 1 to 3, wherein the B cell malignancy is a lymphoma.
5. A use as claimed in claim 4, wherein the lymphoma is B cell lymphoma associated with low levels of CD20 expression.
6. A use as claimed in claim 4, wherein the lymphoma is B-CLL or marginal zone lymphoma.
7. A use as claimed in claim 4, wherein the lymphoma is resistant to treatment with the antibody.
8. A use as claimed in any one of claims 1 to 7, wherein the antibody is a human IgG1 antibody or a murine IgG2a antibody.
9. A use as claimed in claim 8, wherein the antigen is CD22 and the antibody is an anti-CD22 human IgG1 or murine IgG2a antibody.
10. A use as claimed in claim 8, wherein the antigen is CD19 and the antibody is an anti-CD19 human IgG1 or murine IgG2a antibody.
11. A use as claimed in any one of claims 1 to 7, wherein the antigen is CD20 and the antibody is Rituximab.
12. A use as claimed in any one of claims 1 to 11, wherein the nucleic acid does not hybridize with genomic DNA or RNA under stringent conditions comprising hybridization in 50% formamide, 1 M NaCl, 1% SDS at 37°C, and washing in 0.1X SSC
at 60°C.
at 60°C.
13. A use as claimed in any one of claims 1 to 12, wherein the nucleic acid is either or both of:
a) an immunostimulatory T-rich nucleic acid; and b) bacterial DNA.
a) an immunostimulatory T-rich nucleic acid; and b) bacterial DNA.
14. A use as claimed in any one of claims 1 to 13, wherein the nucleic acid has one or both of a phosphate modified oligonucleotide backbone and a peptide modified oligonucleotide backbone.
15. A use as claimed in any one of claims 1 to 13, wherein the nucleic acid is:
a) isolated; or b) a synthetic nucleic acid.
a) isolated; or b) a synthetic nucleic acid.
16. A use as claimed in any one of claims 1 to 15, wherein the nucleic acid and the antibody are for administration together or separately.
17. A use as claimed in any one of claims 1 to 16, for use in conjunction with an anti-cancer therapy.
18. A use as claimed in claim 17, wherein the anti-cancer therapy comprises one or both of a chemotherapeutic agent and a cancer vaccine.
19. A use as claimed in claim 18, wherein the chemotherapeutic agent is selected from the group consisting of methotrexate, vincristine, adriamycin, cisplatin, mitomycin C, bleomycin, doxorubicin, dacarbazine, taxol, valrubicin, liposomal doxorubicin, Paclitaxel, Doxifluridine, oral paclitaxel, Flavopiridol, oral platinum, Cladribine, liposomal doxorubicin, Fludarabine, Epirubicin, DepoCyt.TM., Gemcitabine, Ifosamide, Teniposide, Carboplatin, Etoposide, Docetaxel, prodrug of guanine arabinoside, nitrosoureas, Asparaginase, Busulfan, Chlorambucil, Cytarabine HCl, Daunorubicin, hydroxycarbamide, Ifosfamide, Interferon Alfa-2a, Interferon Alfa-2b, Lomustine, Mechlorethamine, Mercaptopurine, Mesna, Mitoxantrone, Procarbazine HCl, Thioguanine, Thiotepa, Vinblastine sulfate, Azacitidine, Interleukin 2, Pentostatin, Teniposide, GM-CSF and Vindesine sulfate.
20. A use as claimed in claim 18, wherein the chemotherapeutic agent is selected from the group consisting of methotrexate, vincristine, adriamycin, cisplatin, non-sugar containing chloroethylnitrosoureas, 5-fluorouracil, mitomycin C, bleomycin, doxorubicin, dacarbazine, taxol, fragyline, Meglamine GLA, valrubicin, carmustaine, poliferposan, MM1270, BAY 12-9566, RAS farnesyl transferase inhibitor, farnesyl transferase inhibitor, LT231514, Lometexol, Glamolec, CI-994, TNP-470, Topotecan, PKC412, Valspodar, Metaret, Batimastat, E7070, BCH-4556, CS-682, 9-AC, AG3340, AG3433, VX-710, VX-853, ZD0101, IS1641, ODN 698, Marimastat, CDP 845, D2613, PD183805, DX 8951f, Lemonal DP 2202, FK 317, Picibanil, Valrubicin, strontium derivative, Temozolomide, liposomal doxorubicin, Paclitaxel, Capecitabine, Doxifluridine, oral paclitaxel, Flavopiridol, CP-358 (774), RAS oncogene inhibitor, oral platinum, Tegafur-Uracil, Levamisole, Fluorouracil, Levamisole, Irinotecan, Raltitrexed, Cladribine, Fludarabine, Epirubicin, DepoCyt.TM., ZD1839, Bis-Naphtalimide, Dolastain, Gemcitabine, Anormed.TM., YM 116, Iodine seeds, CDK4, CDK2 inhibitors, PARP Inhibitors, Dexifosamide, Ifosamide, Teniposide, Carboplatin, Etoposide, ZD 9331, Docetaxel, prodrug of guanine arabinoside, Taxane Analog, nitrosoureas, alkylating agents, Aminoglutethimide, Asparaginase, Busulfan, Chlorambucil, Cytarabine HC1, Dactinomycin, Daunorubicin HCl, Estramustine phosphate sodium, Floxuridine, Flutamide, hydroxycarbamide, Ifosfamide, Interferon Alfa-2a, Interferon Alfa-2b, Leuprolide acetate, Lomustine, Mechlorethamine, Mercaptopurine, Mesna, Mitotane, Mitoxantrone, Octreotide, Plicamycin, Procarbazine HC1, Streptozocin, Tamoxifen citrate, Thioguanine, Thiotepa, Amsacrine, Azacitidine, Erythropoietin, Hexamethylmelamine, Interleukin 2, Mitoguazone, Pentostatin, Semustine, Teniposide, GM-CSF and Vindesine sulfate.
21. A use as claimed in claim 18, wherein the chemotherapeutic agent is selected from the group consisting of methotrexate, vincristine, adriamycin, cisplatin, mitomycin C, bleomycin, doxorubicin, dacarbazine, taxol, valrubicin, Paclitaxel, Flavopiridol, oral platinum, Cladribine, Fludarabine, Epirubicin, DepoCyt.TM., Gemcitabine, Ifosamide, Teniposide, Carboplatin, Etoposide, Docetaxel, prodrug of guanine arabinoside, nitrosoureas, alkylating agents, Asparaginase, Busulfan, Chlorambucil, Cytarabine HCl, Daunorubicin HCl, hydroxycarbamide, Interferon Alfa-2a, Interferon Alfa-2b, Lomustine, Mechlorethamine, Mercaptopurine, Mitoxantrone, Procarbazine HCl, Thioguanine, Thiotepa, Azacitidine, Interleukin 2, Pentostatin, Teniposide, GM-CSF and Vindesine sulfate.
22. A use as claimed in claim 18, wherein the cancer vaccine is selected from the group consisting of EGF, Anti-idiotypic cancer vaccines, Gp75 antigen, GMK
melanoma vaccine, MGV ganglioside conjugate vaccine, Her2, Ovarex.TM., M-Vax.TM., O-Vax.TM., L-Vax, STn-KHL theratope, BLP25, liposomal idiotypic vaccine, Melacine.TM., peptide antigen vaccines, toxin vaccines, antigen vaccines, MVA-based vaccine, PACIS, BCG
vaccine, TA-HPV, TA-CIN, DISC-virus, ImmuCyst.TM. and TheraCys.TM..
melanoma vaccine, MGV ganglioside conjugate vaccine, Her2, Ovarex.TM., M-Vax.TM., O-Vax.TM., L-Vax, STn-KHL theratope, BLP25, liposomal idiotypic vaccine, Melacine.TM., peptide antigen vaccines, toxin vaccines, antigen vaccines, MVA-based vaccine, PACIS, BCG
vaccine, TA-HPV, TA-CIN, DISC-virus, ImmuCyst.TM. and TheraCys.TM..
23. A composition comprising an immunostimulatory nucleic acid comprising at least one unmethylated CpG dinucleotide comprising the sequence 5' X1X2CGX3X4 3' wherein C is unmethylated and X1, X2, X3 and X4 are nucleotides, wherein X3 and X4 are TT, and wherein the nucleic acid is 8-40 nucleotides in length, and an antigen specific antibody, wherein the antigen is a CD19, CD20, CD22 or CD40 antigen, for use in the treatment or prevention of a B cell malignancy, wherein the immunostimulatory nucleic acid upregulates expression of the antigen.
24. A composition as claimed in claim 23, wherein the antibody is a human IgG1 antibody or a murine IgG2a antibody.
25. A composition as claimed in claim 23, wherein the antigen is CD22 and the antibody is an anti-CD22 human IgG1 or murine IgG2a antibody.
26. A composition as claimed in claim 23, wherein the antigen is CD19 and the antibody is an anti-CD19 human IgG1 or murine IgG2a antibody.
27. A composition as claimed in claim 23, wherein the antigen is CD20 and the antibody is Rituximab.
28. A composition as claimed in any one of claims 23 to 27, wherein the nucleic acid does not hybridize with genomic DNA or RNA under stringent conditions comprising hybridization in 50% formamide, 1 M NaCl, 1% SDS at 37°C, and washing in 0.1X SSC at 60°C.
29. A composition as claimed in any one of claims 23 to 28, wherein the nucleic acid is either or both of:
a) an immunostimulatory T-rich nucleic acid; and b) bacterial DNA.
a) an immunostimulatory T-rich nucleic acid; and b) bacterial DNA.
30. A composition as claimed in any one of claims 23 to 29, wherein the nucleic acid has one or both of a phosphate modified oligonucleotide backbone and a peptide modified oligonucleotide backbone.
31. A composition as claimed in any one of claims 23 to 29, wherein the nucleic acid is:
a) isolated; or b) a synthetic nucleic acid.
a) isolated; or b) a synthetic nucleic acid.
32. A kit comprising a package including at least two containers, the first container housing an immunostimulatory nucleic acid comprising at least one unmethylated CpG dinucleotide comprising the sequence 5' X1X2CGX3X4 3' wherein C is unmethylated and X1, X2, X3 and X4 are nucleotides, wherein X3 and X4 are TT, and wherein the nucleic acid is 8-40 nucleotides in length, the second container housing an antibody specific for a cell surface antigen, and instructions for screening a cell to determine whether the immunostimulatory nucleic acid up-regulates expression of the cell surface antigen in the cell;
wherein the antigen is a CD19, CD20, CD22 or CD40 antigen, wherein the kit is for use in the treatment or prevention of a B cell malignancy, wherein the immunostimulatory nucleic acid upregulates expression of the antigen.
wherein the antigen is a CD19, CD20, CD22 or CD40 antigen, wherein the kit is for use in the treatment or prevention of a B cell malignancy, wherein the immunostimulatory nucleic acid upregulates expression of the antigen.
33. A use as claimed in any one of claims 1 to 22, wherein the nucleic acid is immunostimulatory CpG oligonucleotide ODN 2006 (SEQ ID NO:729) comprising a backbone modification and an unmethylated C.
34. A composition as claimed in any one of claims 23 to 31, wherein the nucleic acid is immunostimulatory CpG oligonucleotide ODN 2006 (SEQ ID NO:729) comprising a backbone modification and an unmethylated C.
35. A kit according to claim 32, wherein the nucleic acid is immunostimulatory CpG oligonucleotide ODN 2006 (SEQ ID NO:729) comprising a backbone modification and an unmethylated C.
36. A use as claimed in claim 20 or claim 21, wherein the alkylating agent is melphalan or cyclophosphamide.
Applications Claiming Priority (3)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US21334600P | 2000-06-22 | 2000-06-22 | |
US60/213,346 | 2000-06-22 | ||
PCT/US2001/020154 WO2001097843A2 (en) | 2000-06-22 | 2001-06-22 | Methods for enhancing antibody-induced cell lysis and treating cancer |
Publications (2)
Publication Number | Publication Date |
---|---|
CA2410371A1 CA2410371A1 (en) | 2001-12-27 |
CA2410371C true CA2410371C (en) | 2015-11-17 |
Family
ID=22794755
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CA2410371A Expired - Lifetime CA2410371C (en) | 2000-06-22 | 2001-06-22 | Methods for enhancing antibody-induced cell lysis and treating cancer |
Country Status (12)
Country | Link |
---|---|
US (1) | US7534772B2 (en) |
EP (1) | EP1296714B1 (en) |
JP (1) | JP2003535907A (en) |
AT (1) | ATE440618T1 (en) |
AU (5) | AU7013401A (en) |
CA (1) | CA2410371C (en) |
DE (1) | DE60139689D1 (en) |
DK (1) | DK1296714T3 (en) |
ES (1) | ES2332444T3 (en) |
PT (1) | PT1296714E (en) |
SI (1) | SI1296714T1 (en) |
WO (1) | WO2001097843A2 (en) |
Families Citing this family (203)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US6727230B1 (en) * | 1994-03-25 | 2004-04-27 | Coley Pharmaceutical Group, Inc. | Immune stimulation by phosphorothioate oligonucleotide analogs |
US6207646B1 (en) * | 1994-07-15 | 2001-03-27 | University Of Iowa Research Foundation | Immunostimulatory nucleic acid molecules |
US7935675B1 (en) * | 1994-07-15 | 2011-05-03 | University Of Iowa Research Foundation | Immunostimulatory nucleic acid molecules |
US6239116B1 (en) * | 1994-07-15 | 2001-05-29 | University Of Iowa Research Foundation | Immunostimulatory nucleic acid molecules |
US20030026782A1 (en) | 1995-02-07 | 2003-02-06 | Arthur M. Krieg | Immunomodulatory oligonucleotides |
US6429199B1 (en) * | 1994-07-15 | 2002-08-06 | University Of Iowa Research Foundation | Immunostimulatory nucleic acid molecules for activating dendritic cells |
EP0879284B1 (en) * | 1996-01-30 | 2009-07-29 | The Regents of The University of California | Gene expression vectors which generate an antigen specific immune response and methods of using the same |
EP0855184A1 (en) | 1997-01-23 | 1998-07-29 | Grayson B. Dr. Lipford | Pharmaceutical composition comprising a polynucleotide and an antigen especially for vaccination |
US6406705B1 (en) * | 1997-03-10 | 2002-06-18 | University Of Iowa Research Foundation | Use of nucleic acids containing unmethylated CpG dinucleotide as an adjuvant |
US20030158220A1 (en) * | 1997-11-03 | 2003-08-21 | Foss Joseph F. | Use of methylnaltrexone and related compounds to treat chronic opioid use side effects |
US6274591B1 (en) * | 1997-11-03 | 2001-08-14 | Joseph F. Foss | Use of methylnaltrexone and related compounds |
ATE356630T1 (en) * | 1998-04-03 | 2007-04-15 | Univ Iowa Res Found | METHOD AND PRODUCTS FOR STIMULATING THE IMMUNE SYSTEM USING IMMUNOTHERAPEUTIC OLIGONUCLEOTIDES AND CYTOKINE |
JP2002514397A (en) * | 1998-05-14 | 2002-05-21 | コーリー ファーマシューティカル ゲーエムベーハー | Methods for hematopoietic regulation using CpG oligonucleotides |
DK1077722T3 (en) | 1998-05-22 | 2006-11-27 | Ottawa Health Research Inst | Methods and products for the induction of mucosa immunity |
US20030022854A1 (en) | 1998-06-25 | 2003-01-30 | Dow Steven W. | Vaccines using nucleic acid-lipid complexes |
US6693086B1 (en) * | 1998-06-25 | 2004-02-17 | National Jewish Medical And Research Center | Systemic immune activation method using nucleic acid-lipid complexes |
ATE464907T1 (en) * | 1999-02-17 | 2010-05-15 | Csl Ltd | IMMUNOGENIC COMPLEXES AND METHODS RELATING THEM |
WO2000061151A2 (en) | 1999-04-12 | 2000-10-19 | The Government Of The United States Of America, Represented By The Secretary, Department Of Health And Human Services | Oligodeoxynucleotide and its use to induce an immune response |
US6977245B2 (en) | 1999-04-12 | 2005-12-20 | The United States Of America As Represented By The Department Of Health And Human Services | Oligodeoxynucleotide and its use to induce an immune response |
EP1642596A3 (en) * | 1999-05-07 | 2006-04-12 | Genentech, Inc. | Treatment of autoimmune diseases with antagonists which bind to B cell surface markers |
MXPA02000419A (en) * | 1999-07-12 | 2004-09-10 | Genentech Inc | Blocking immune response to a foreign antigen using an antagonist which binds to cd20. |
KR100863630B1 (en) * | 1999-09-25 | 2008-10-15 | 유니버시티 오브 아이오와 리써치 파운데이션 | Immunostimulatory Nucleic Acids |
US6949520B1 (en) * | 1999-09-27 | 2005-09-27 | Coley Pharmaceutical Group, Inc. | Methods related to immunostimulatory nucleic acid-induced interferon |
WO2001095935A1 (en) * | 2000-01-20 | 2001-12-20 | Ottawa Health Research Institute | Immunostimulatory nucleic acids for inducing a th2 immune response |
US7585847B2 (en) * | 2000-02-03 | 2009-09-08 | Coley Pharmaceutical Group, Inc. | Immunostimulatory nucleic acids for the treatment of asthma and allergy |
DK1255558T3 (en) * | 2000-02-16 | 2006-10-23 | Genentech Inc | Anti-April antibodies and hybridoma cells |
US20040131628A1 (en) * | 2000-03-08 | 2004-07-08 | Bratzler Robert L. | Nucleic acids for the treatment of disorders associated with microorganisms |
US7030219B2 (en) | 2000-04-28 | 2006-04-18 | Johns Hopkins University | B7-DC, Dendritic cell co-stimulatory molecules |
WO2001093902A2 (en) * | 2000-06-07 | 2001-12-13 | Biosynexus Incorporated | Immunostimulatory rna/dna hybrid molecules |
KR100917101B1 (en) * | 2000-08-04 | 2009-09-15 | 도요 보세키 가부시키가이샤 | Flexible metal laminate and production method thereof |
JP2005500806A (en) * | 2000-09-15 | 2005-01-13 | コーリー ファーマシューティカル ゲーエムベーハー | Process for high-throughput screening of immune agonist / immunoantagonists based on CpG |
KR20040023565A (en) * | 2000-09-18 | 2004-03-18 | 아이덱 파마슈티칼즈 코포레이션 | Combination therapy for treatment of autoimmune diseases using b cell depleting/immunoregulatory antibody combination |
TWI283575B (en) * | 2000-10-31 | 2007-07-11 | Eisai Co Ltd | Medicinal compositions for concomitant use as anticancer agent |
EP1350262B8 (en) * | 2000-12-08 | 2008-08-13 | Coley Pharmaceuticals GmbH | Cpg-like nucleic acids and methods of use thereof |
US7829084B2 (en) * | 2001-01-17 | 2010-11-09 | Trubion Pharmaceuticals, Inc. | Binding constructs and methods for use thereof |
US20030133939A1 (en) | 2001-01-17 | 2003-07-17 | Genecraft, Inc. | Binding domain-immunoglobulin fusion proteins |
US7754208B2 (en) | 2001-01-17 | 2010-07-13 | Trubion Pharmaceuticals, Inc. | Binding domain-immunoglobulin fusion proteins |
US7666674B2 (en) | 2001-07-27 | 2010-02-23 | The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services | Use of sterically stabilized cationic liposomes to efficiently deliver CPG oligonucleotides in vivo |
EP1501359A4 (en) * | 2001-08-03 | 2007-04-18 | Celldex Therapeutics Inc | Compositions comprising immunostimulatory oligonucleotides and uses thereof to enhance fc receptor-mediated immunotherapies |
JP2005510208A (en) * | 2001-08-03 | 2005-04-21 | ジェネンテック・インコーポレーテッド | TACIs and BR3 polypeptides and uses thereof |
WO2003020884A2 (en) * | 2001-08-14 | 2003-03-13 | The Government Of The United States Of America As Represented By The Secretary Of Health And Human Services | Method for rapid generation of mature dendritic cells |
KR100991644B1 (en) * | 2001-08-17 | 2010-11-02 | 콜리 파마슈티칼 게엠베하 | Combination Motif Immune Stimulatory Oligonucleotides with Improved Activity |
JP2005501917A (en) * | 2001-09-07 | 2005-01-20 | ザ トラスティーズ オブ ボストン ユニバーシティ | Methods and compositions for treating immune complex related diseases |
IL160837A0 (en) * | 2001-10-05 | 2004-08-31 | Coley Pharm Gmbh | Toll-like receptor 3 signaling agonists and antagonists |
CA2462203A1 (en) * | 2001-10-12 | 2003-11-20 | University Of Iowa Research Foundation | Methods and products for enhancing immune responses using imidazoquinoline compounds |
US8466116B2 (en) | 2001-12-20 | 2013-06-18 | The Unites States Of America As Represented By The Secretary Of The Department Of Health And Human Services | Use of CpG oligodeoxynucleotides to induce epithelial cell growth |
AU2002366710A1 (en) * | 2001-12-20 | 2003-07-09 | The Government Of The United States Of America As Represented By The Secretary Of The Department Of | USE OF CpG OLIGODEOXYNUCLEOTIDES TO INDUCE ANGIOGENESIS |
WO2003066649A1 (en) | 2002-02-04 | 2003-08-14 | Biomira Inc. | Immunostimulatory, covalently lipidated oligonucleotides |
US8088388B2 (en) * | 2002-02-14 | 2012-01-03 | United Biomedical, Inc. | Stabilized synthetic immunogen delivery system |
US8153141B2 (en) | 2002-04-04 | 2012-04-10 | Coley Pharmaceutical Gmbh | Immunostimulatory G, U-containing oligoribonucleotides |
US7968569B2 (en) * | 2002-05-17 | 2011-06-28 | Celgene Corporation | Methods for treatment of multiple myeloma using 3-(4-amino-1-oxo-1,3-dihydro-isoindol-2-yl)-piperidine-2,6-dione |
US20040009949A1 (en) * | 2002-06-05 | 2004-01-15 | Coley Pharmaceutical Group, Inc. | Method for treating autoimmune or inflammatory diseases with combinations of inhibitory oligonucleotides and small molecule antagonists of immunostimulatory CpG nucleic acids |
WO2004003545A1 (en) * | 2002-07-01 | 2004-01-08 | Tufts University | Methods and compositions for inhibition of multi-drug resistance by hyaluronan oligomers |
US20040053880A1 (en) * | 2002-07-03 | 2004-03-18 | Coley Pharmaceutical Group, Inc. | Nucleic acid compositions for stimulating immune responses |
US7576066B2 (en) | 2002-07-03 | 2009-08-18 | Coley Pharmaceutical Group, Inc. | Nucleic acid compositions for stimulating immune responses |
US7605138B2 (en) * | 2002-07-03 | 2009-10-20 | Coley Pharmaceutical Group, Inc. | Nucleic acid compositions for stimulating immune responses |
US7569553B2 (en) * | 2002-07-03 | 2009-08-04 | Coley Pharmaceutical Group, Inc. | Nucleic acid compositions for stimulating immune responses |
US7807803B2 (en) * | 2002-07-03 | 2010-10-05 | Coley Pharmaceutical Group, Inc. | Nucleic acid compositions for stimulating immune responses |
WO2004011611A2 (en) * | 2002-07-25 | 2004-02-05 | Genentech, Inc. | Taci antibodies and uses thereof |
AR040996A1 (en) * | 2002-08-19 | 2005-04-27 | Coley Pharm Group Inc | IMMUNE STIMULATING NUCLEIC ACIDS |
SG166673A1 (en) * | 2002-08-19 | 2010-12-29 | Coley Pharm Group Inc | Immunostimulatory nucleic acids |
FR2844455B1 (en) * | 2002-09-13 | 2007-12-14 | Lab Francais Du Fractionnement | TREATMENT OF PATHOLOGIES EXCLUDING IMMUNE RESPONSE BY OPTIMIZED ANTIBODIES |
US8263091B2 (en) * | 2002-09-18 | 2012-09-11 | The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services | Method of treating and preventing infections in immunocompromised subjects with immunostimulatory CpG oligonucleotides |
KR20100050587A (en) | 2002-10-17 | 2010-05-13 | 젠맵 에이/에스 | Human monoclonal antibodies against cd20 |
EP2241325B1 (en) * | 2002-10-29 | 2012-02-08 | Coley Pharmaceutical Group, Inc. | Use of CPG oligonucleotides in the treatment of hepatitis C virus infection |
JP2006512927A (en) | 2002-12-11 | 2006-04-20 | コーリー ファーマシューティカル グループ,インコーポレイテッド | 5 'CPG nucleic acids and methods of use thereof |
JP4351674B2 (en) * | 2002-12-16 | 2009-10-28 | ジェネンテック・インコーポレーテッド | Immunoglobulin variants and their use and use |
AU2004218090A1 (en) * | 2003-03-04 | 2004-09-16 | Sosei Co., Ltd. | GM-95-containing antitumor effect potentiator, combined antitumor preparation and antitumor agent |
AU2004226605A1 (en) * | 2003-04-02 | 2004-10-14 | Coley Pharmaceutical Group, Ltd. | Immunostimulatory nucleic acid oil-in-water formulations for topical application |
CA2521420A1 (en) * | 2003-04-08 | 2004-10-28 | Progenics Pharmaceuticals, Inc. | Combination therapy for constipation comprising a laxative and a peripheral opioid antagonist |
RU2373936C2 (en) * | 2003-04-08 | 2009-11-27 | Проджиникс Фармасьютикалз, Инк. | Application of methyl naltrexone for treating irritable colon syndrome |
DK1615646T4 (en) * | 2003-04-08 | 2022-10-10 | Progenics Pharm Inc | PHARMACEUTICAL FORMULATIONS CONTAINING METHYLNALTREXONE |
RS51686B (en) * | 2003-04-09 | 2011-10-31 | Genentech Inc. | Therapy of autoimmune disease in a patient with an inadequate response to a tnf-alpha inhibitor |
MXPA05012421A (en) * | 2003-05-16 | 2006-02-22 | Hybridon Inc | Synergistic treatment of cancer using immunomers in conjunction with chemotherapeutic agents. |
PT1631313E (en) * | 2003-06-05 | 2015-07-02 | Genentech Inc | Combination therapy for b cell disorders |
US20050163775A1 (en) * | 2003-06-05 | 2005-07-28 | Genentech, Inc. | Combination therapy for B cell disorders |
BRPI0411514A (en) * | 2003-06-20 | 2006-08-01 | Coley Pharm Gmbh | small molecule toll-like receptor antagonists |
US20050013812A1 (en) * | 2003-07-14 | 2005-01-20 | Dow Steven W. | Vaccines using pattern recognition receptor-ligand:lipid complexes |
WO2005017529A1 (en) * | 2003-07-29 | 2005-02-24 | Genentech, Inc. | Assay for human anti cd20 antibodies and uses therefor |
ZA200601218B (en) * | 2003-08-29 | 2007-05-30 | Genentech Inc | Anti-CD20 therapy of ocular disorders |
JP4989225B2 (en) * | 2003-09-25 | 2012-08-01 | コーリー ファーマシューティカル グループ,インコーポレイテッド | Nucleic acid lipophilic conjugate |
CA2542099A1 (en) * | 2003-10-11 | 2005-04-21 | Inex Pharmaceuticals Corporation | Methods and compositions for enhancing innate immunity and antibody dependent cellular cytotoxicity |
SG123799A1 (en) * | 2003-10-30 | 2006-07-26 | Coley Pharm Gmbh | C-class oligonucleotide analogs with enchanced immunostimulatory potency |
US20050239733A1 (en) * | 2003-10-31 | 2005-10-27 | Coley Pharmaceutical Gmbh | Sequence requirements for inhibitory oligonucleotides |
US20050100983A1 (en) * | 2003-11-06 | 2005-05-12 | Coley Pharmaceutical Gmbh | Cell-free methods for identifying compounds that affect toll-like receptor 9 (TLR9) signaling |
US9050378B2 (en) | 2003-12-10 | 2015-06-09 | Board Of Regents, The University Of Texas System | N2S2 chelate-targeting ligand conjugates |
AU2004305560A1 (en) * | 2003-12-19 | 2005-07-07 | Genentech, Inc. | Detection of CD20 in therapy of autoimmune diseases |
AU2004303848A1 (en) * | 2003-12-19 | 2005-07-07 | Genentech, Inc. | Detection of CD20 in transplant rejection |
US20070196269A1 (en) * | 2003-12-19 | 2007-08-23 | Karl-Hermann Schlingensiepen | Pharmaceutical composition |
US20050256073A1 (en) * | 2004-02-19 | 2005-11-17 | Coley Pharmaceutical Group, Inc. | Immunostimulatory viral RNA oligonucleotides |
TWI235440B (en) * | 2004-03-31 | 2005-07-01 | Advanced Semiconductor Eng | Method for making leadless semiconductor package |
JP2007531746A (en) * | 2004-04-02 | 2007-11-08 | コーリー ファーマシューティカル グループ,インコーポレイテッド | Immunostimulatory nucleic acid for inducing an IL-10 response |
JP2007532681A (en) * | 2004-04-16 | 2007-11-15 | ジェネンテック・インコーポレーテッド | Methods for increasing B cell depletion |
EP1740946B1 (en) | 2004-04-20 | 2013-11-06 | Genmab A/S | Human monoclonal antibodies against cd20 |
MXPA06012674A (en) * | 2004-05-05 | 2007-03-26 | Genentech Inc | Preventing autoimmune disease. |
US7531628B2 (en) * | 2004-05-28 | 2009-05-12 | Idexx Laboratories, Inc. | Canine CD20 compositions |
TW201422238A (en) | 2004-06-04 | 2014-06-16 | Genentech Inc | Use of CD20 antibody in treatment of multiple sclerosis and an article for the use |
BRPI0510885A (en) * | 2004-06-04 | 2007-12-26 | Genentech Inc | lupus treatment method and industrialized article |
EP2484374A1 (en) * | 2004-07-18 | 2012-08-08 | CSL Limited | Immuno stimulating complex and oligonucleotide formulations for inducing enhanced interferon-gamma responses |
WO2006012508A2 (en) * | 2004-07-22 | 2006-02-02 | Genentech, Inc. | Method of treating sjögren's syndrome |
SG165344A1 (en) * | 2004-10-05 | 2010-10-28 | Genentech Inc | Method for treating vasculitis |
MY159370A (en) * | 2004-10-20 | 2016-12-30 | Coley Pharm Group Inc | Semi-soft-class immunostimulatory oligonucleotides |
US20060135459A1 (en) | 2004-11-09 | 2006-06-22 | Epstein Alan L | Targeted innate immunity |
ZA200705459B (en) * | 2005-01-13 | 2008-09-25 | Genentech Inc | Treatment method |
EP1845989A1 (en) * | 2005-01-20 | 2007-10-24 | Progenics Pharmaceuticals, Inc. | Use of methylnaltrexone and related compounds to treat post-operative gastrointestinal dysfunction |
DOP2006000029A (en) * | 2005-02-07 | 2006-08-15 | Genentech Inc | ANTIBODY VARIANTS AND USES THEREOF. (VARIATIONS OF AN ANTIBODY AND USES OF THE SAME) |
US8444973B2 (en) * | 2005-02-15 | 2013-05-21 | Duke University | Anti-CD19 antibodies and uses in B cell disorders |
AU2006214121B9 (en) * | 2005-02-15 | 2013-02-14 | Duke University | Anti-CD19 antibodies and uses in oncology |
US20080009455A9 (en) * | 2005-02-24 | 2008-01-10 | Coley Pharmaceutical Group, Inc. | Immunostimulatory oligonucleotides |
TW200714289A (en) * | 2005-02-28 | 2007-04-16 | Genentech Inc | Treatment of bone disorders |
DE602006021401D1 (en) * | 2005-02-28 | 2011-06-01 | Eisai R&D Man Co Ltd | NEW COMBINED USE OF A SULFONAMIDE COMPOUND FOR THE TREATMENT OF CANCER |
US8518962B2 (en) | 2005-03-07 | 2013-08-27 | The University Of Chicago | Use of opioid antagonists |
US8524731B2 (en) | 2005-03-07 | 2013-09-03 | The University Of Chicago | Use of opioid antagonists to attenuate endothelial cell proliferation and migration |
US9662325B2 (en) | 2005-03-07 | 2017-05-30 | The University Of Chicago | Use of opioid antagonists to attenuate endothelial cell proliferation and migration |
ES2714198T3 (en) * | 2005-03-07 | 2019-05-27 | Univ Chicago | Use of opioid antagonists to attenuate the proliferation and migration of endothelial cells |
SG161260A1 (en) * | 2005-04-08 | 2010-05-27 | Coley Pharm Group Inc | Methods for treating infectious disease exacerbated asthma |
AR053579A1 (en) * | 2005-04-15 | 2007-05-09 | Genentech Inc | TREATMENT OF INTESTINAL INFLAMMATORY DISEASE (IBD) |
AU2006241149A1 (en) * | 2005-04-26 | 2006-11-02 | Coley Pharmaceutical Gmbh | Modified oligoribonucleotide analogs with enhanced immunostimulatory activity |
CA2607281C (en) * | 2005-05-05 | 2023-10-03 | Duke University | Anti-cd19 antibody therapy for autoimmune disease |
CN1865275B (en) | 2005-05-17 | 2011-06-15 | 长春华普生物技术有限公司 | Artificial single-chain deoxynucleotide having therapeutic effect to human B cell tumour |
AU2006251647A1 (en) * | 2005-05-20 | 2006-11-30 | Genentech, Inc. | Pretreatment of a biological sample from an autoimmune disease subject |
AR057325A1 (en) | 2005-05-25 | 2007-11-28 | Progenics Pharm Inc | SYNTHESIS OF (S) -N-METHYLNTREXONE, PHARMACEUTICAL COMPOSITIONS AND USES |
AR057035A1 (en) | 2005-05-25 | 2007-11-14 | Progenics Pharm Inc | SYNTHESIS OF (R) -N-METHYLNTREXONE, PHARMACEUTICAL COMPOSITIONS AND USES |
US20080194611A1 (en) * | 2005-06-03 | 2008-08-14 | Alverdy John C | Modulation of Cell Barrier Dysfunction |
PT2179737E (en) * | 2005-07-01 | 2013-12-05 | Index Pharmaceuticals Ab | Modulating responsiveness to steroids |
PL2269622T3 (en) | 2005-07-01 | 2014-05-30 | Index Pharmaceuticals Ab | CpG oligonucleotides used for enhancing steroid activity in a steroid dependent patient |
JP2009500412A (en) * | 2005-07-07 | 2009-01-08 | コーリー ファーマシューティカル グループ,インコーポレイテッド | Combination therapy of anti-CTLA-4 antibody and CPG motif-containing synthetic oligodeoxynucleotide for the treatment of cancer |
CN105012953B (en) * | 2005-07-25 | 2018-06-22 | 阿普泰沃研发有限责任公司 | B- cells are reduced with CD37- specificity and CD20- specific binding molecules |
US20080279850A1 (en) * | 2005-07-25 | 2008-11-13 | Trubion Pharmaceuticals, Inc. | B-Cell Reduction Using CD37-Specific and CD20-Specific Binding Molecules |
JP2009502936A (en) | 2005-07-25 | 2009-01-29 | トルビオン ファーマシューティカルズ, インコーポレイテッド | Single dose of CD20 specific binding molecule |
CA2622679A1 (en) * | 2005-09-16 | 2007-08-09 | Coley Pharmaceutical Gmbh | Immunostimulatory single-stranded ribonucleic acid with phosphodiester backbone |
EA013375B1 (en) * | 2005-09-16 | 2010-04-30 | Коли Фармасьютикал Гмбх | MODULATION OF IMMUNOSTIMULATORY PROPERTIES OF SHORT INTERFERING RIBONUCLEIC ACID (siRNA) BY NUCLEOTIDE MODIFICATION |
CA2625969A1 (en) | 2005-10-28 | 2007-05-03 | Index Pharmaceuticals Ab | Composition and method for the prevention, treatment and/or alleviation of an inflammatory disease |
GB0523041D0 (en) * | 2005-11-11 | 2005-12-21 | Cyclacel Ltd | Combination |
MY149159A (en) | 2005-11-15 | 2013-07-31 | Hoffmann La Roche | Method for treating joint damage |
AU2006318539B2 (en) * | 2005-11-23 | 2012-09-13 | Genentech, Inc. | Methods and compositions related to B cell assays |
PL1957647T3 (en) | 2005-11-25 | 2015-07-31 | Zoetis Belgium S A | Immunostimulatory oligoribonucleotides |
US20080045473A1 (en) * | 2006-02-15 | 2008-02-21 | Coley Pharmaceutical Gmbh | Compositions and methods for oligonucleotide formulations |
CA2654317A1 (en) * | 2006-06-12 | 2007-12-21 | Trubion Pharmaceuticals, Inc. | Single-chain multivalent binding proteins with effector function |
US20080031887A1 (en) * | 2006-06-30 | 2008-02-07 | Joseph Lustgarten | Conjugates for inducing targeted immune responses and methods of making and using same |
DE102006035618A1 (en) * | 2006-07-31 | 2008-02-07 | Curevac Gmbh | New nucleic acid useful as immuno-stimulating adjuvant for manufacture of a composition for treatment of cancer diseases e.g. colon carcinomas and infectious diseases e.g. influenza and malaria |
JP2010507361A (en) * | 2006-07-31 | 2010-03-11 | キュアバック ゲーエムベーハー | Specifically, a nucleic acid represented by the general formula (I): GlXmGn or the general formula (II): ClXmCn as an immunostimulant / adjuvant |
RS53263B (en) | 2006-08-14 | 2014-08-29 | Xencor Inc. | Optimized antibodies that target cd19 |
TW200817048A (en) * | 2006-09-08 | 2008-04-16 | Wyeth Corp | Dry powder compound formulations and uses thereof |
KR101251707B1 (en) | 2006-09-27 | 2013-04-11 | 콜리 파마슈티칼 게엠베하 | CpG oligonucleotide analogs containing hydrophobic T analogs with enhanced immunostimulatory activity |
US10925977B2 (en) | 2006-10-05 | 2021-02-23 | Ceil>Point, LLC | Efficient synthesis of chelators for nuclear imaging and radiotherapy: compositions and applications |
WO2008057529A2 (en) * | 2006-11-06 | 2008-05-15 | Coley Pharmaceutical Group, Inc. | Peptide-based vaccine compositions to endogenous cholesteryl ester transfer protein (cetp) |
GB0625283D0 (en) * | 2006-12-19 | 2007-01-24 | Cyclacel Ltd | Combination |
SI2565195T1 (en) | 2007-03-29 | 2015-09-30 | Wyeth Llc | Peripheral opioid receptor and antagonists and uses thereof |
TWI466671B (en) | 2007-03-29 | 2015-01-01 | Progenics Pharm Inc | Peripheral opioid receptor antagonists and uses thereof |
CA2865389A1 (en) | 2007-03-29 | 2008-10-09 | Progenics Pharmaceuticals, Inc. | Crystal forms and uses thereof |
WO2008132500A2 (en) * | 2007-04-27 | 2008-11-06 | Astrazeneca Ab | Chkl inhibitors with b cell depleting antibodies for the treatment of hematologic malignancies |
DK2573176T3 (en) * | 2007-05-04 | 2016-08-01 | Index Pharmaceuticals Ab | Tumor growth retardant compounds and methods of use thereof |
AU2008275229B2 (en) | 2007-07-09 | 2014-11-06 | Genentech, Inc. | Prevention of disulfide bond reduction during recombinant production of polypeptides |
WO2009030254A1 (en) | 2007-09-04 | 2009-03-12 | Curevac Gmbh | Complexes of rna and cationic peptides for transfection and for immunostimulation |
AU2008298576A1 (en) * | 2007-09-13 | 2009-03-19 | Molecular Insight Pharmaceuticals, Inc. | Infusion and transfer system for use with radioactive agents |
AU2008312406B2 (en) | 2007-10-16 | 2014-03-06 | Ares Trading S.A. | Combination of BLyS inhibition and anti-CD 20 agents for treatment of autoimmune disease |
EP2077281A1 (en) | 2008-01-02 | 2009-07-08 | Bergen Teknologioverforing AS | Anti-CD20 antibodies or fragments thereof for the treatment of chronic fatigue syndrome |
HUE025027T2 (en) | 2008-01-31 | 2016-07-28 | Curevac Gmbh | NUCLEIC ACIDS COMPRISING FORMULA (NuGiXmGnNv)a AND DERIVATIVES THEREOF AS AN IMMUNOSTIMULATING AGENTS /ADJUVANTS |
AU2008349873B2 (en) | 2008-02-06 | 2014-02-13 | Progenics Pharmaceuticals, Inc. | Preparation and use of (R),(R)-2,2'-bis-methylnaltrexone |
AU2009225434B2 (en) | 2008-03-21 | 2014-05-22 | The University Of Chicago | Treatment with opioid antagonists and mTOR inhibitors |
EP2365003A1 (en) * | 2008-04-11 | 2011-09-14 | Emergent Product Development Seattle, LLC | CD37 immunotherapeutic and combination with bifunctional chemotherapeutic thereof |
CA2722184A1 (en) | 2008-04-25 | 2009-10-29 | Duke University | Regulatory b cells and their uses |
NZ589719A (en) | 2008-06-09 | 2012-08-31 | Cyclacel Ltd | Combinations of sapacitabine or cndac with dna methyltransferase inhibitors such as decitabine and procaine |
WO2009154565A1 (en) * | 2008-06-18 | 2009-12-23 | Index Pharmaceuticals Ab | Combination therapies against cancer |
TWI351288B (en) * | 2008-07-04 | 2011-11-01 | Univ Nat Pingtung Sci & Tech | Cpg dna adjuvant in avian vaccines |
PE20110435A1 (en) * | 2008-08-25 | 2011-07-20 | Amplimmune Inc | ANTAGONIST COMPOSITIONS OF PD-1 |
TW201438738A (en) | 2008-09-16 | 2014-10-16 | Genentech Inc | Methods for treating progressive multiple sclerosis |
WO2010037408A1 (en) | 2008-09-30 | 2010-04-08 | Curevac Gmbh | Composition comprising a complexed (m)rna and a naked mrna for providing or enhancing an immunostimulatory response in a mammal and uses thereof |
CA2676881C (en) | 2008-09-30 | 2017-04-25 | Wyeth | Peripheral opioid receptor antagonists and uses thereof |
EP2350282A1 (en) * | 2008-11-04 | 2011-08-03 | Index Pharmaceuticals AB | Increased expression of specific antigens |
WO2010075249A2 (en) | 2008-12-22 | 2010-07-01 | Genentech, Inc. | A method for treating rheumatoid arthritis with b-cell antagonists |
MX2011010050A (en) | 2009-03-25 | 2011-12-14 | Univ Texas | Compositions for stimulation of mammalian innate immune resistance to pathogens. |
WO2010132622A2 (en) * | 2009-05-14 | 2010-11-18 | The Regents Of The University Of California | Anticd20-cpg conjugates and methods of treating b cell malignancies |
RU2639288C2 (en) | 2009-08-11 | 2017-12-20 | Дженентек, Инк. | Proteins production in cultural media without glutamine |
US20110053829A1 (en) | 2009-09-03 | 2011-03-03 | Curevac Gmbh | Disulfide-linked polyethyleneglycol/peptide conjugates for the transfection of nucleic acids |
RU2573994C2 (en) | 2010-02-10 | 2016-01-27 | Иммьюноджен, Инк | Anti-cd20 antibodies and thereof application |
US20130224237A1 (en) * | 2010-07-20 | 2013-08-29 | University Of Miami | Inhibition of nonsense mediated decay pathways |
BR112013002298A2 (en) | 2010-07-30 | 2016-05-24 | Curevac Gmbh | nucleic acid complexation with disulfide crosslinked cationic components for transfection and immune stimulation. |
EP2600878A4 (en) | 2010-08-04 | 2014-06-11 | Univ Duke | Regulatory b cells and their uses |
WO2012064671A1 (en) * | 2010-11-08 | 2012-05-18 | The Ohio State University Research Foundation | Compositions and methods for increasing drug efficacy in cancer |
WO2012088272A1 (en) * | 2010-12-21 | 2012-06-28 | Duke University | Methods and compositions combining immunotherapy with monocyte activation |
JP5930146B2 (en) * | 2011-03-28 | 2016-06-08 | 国立研究開発法人物質・材料研究機構 | Immunostimulatory oligonucleotide and therapeutic agent comprising said immunostimulatory oligonucleotide |
WO2012140436A1 (en) | 2011-04-14 | 2012-10-18 | Cyclacel Limited | Dosage regimen for sapacitabine and decitabine in combination for treating acute myeloid leukemia |
US20130157261A1 (en) * | 2011-06-01 | 2013-06-20 | The Methodist Hospital Research Institute | Compositions and Methods for Quantitative Histology, Calibration of Images in Fluorescence Microscopy, and ddTUNEL Analyses |
WO2013113326A1 (en) | 2012-01-31 | 2013-08-08 | Curevac Gmbh | Pharmaceutical composition comprising a polymeric carrier cargo complex and at least one protein or peptide antigen |
US10017739B2 (en) | 2012-09-06 | 2018-07-10 | Duke University | Methods of expanding and assessing B cells and using expanded B cells to treat disease |
KR20160044566A (en) | 2013-08-21 | 2016-04-25 | 큐어백 아게 | Respiratory syncytial virus (RSV) vaccine |
US10436680B2 (en) | 2013-10-15 | 2019-10-08 | Kianoosh Peyvan | Capture, disruption, and extraction apparatus and method |
US20160340439A1 (en) * | 2014-01-22 | 2016-11-24 | The Board Of Trustees Of The Leland Stanford Junior University | Methods and Compositions for Antibody and Antibody-loaded Dendritic Cell Mediated Therapy |
EP3129050A2 (en) | 2014-04-01 | 2017-02-15 | CureVac AG | Polymeric carrier cargo complex for use as an immunostimulating agent or as an adjuvant |
WO2016044839A2 (en) | 2014-09-19 | 2016-03-24 | The Board Of Regents Of The University Of Texas System | Compositions and methods for treating viral infections through stimulated innate immunity in combination with antiviral compounds |
EA201890613A1 (en) | 2015-09-21 | 2018-10-31 | Аптево Рисёрч Энд Девелопмент Ллс | POLYPEPTIDES CONNECTING CD3 |
NZ741067A (en) | 2015-10-02 | 2023-07-28 | Hoffmann La Roche | Bispecific anti-human cd20/human transferrin receptor antibodies and methods of use |
AR106189A1 (en) | 2015-10-02 | 2017-12-20 | Hoffmann La Roche | BIESPECTIFIC ANTIBODIES AGAINST HUMAN A-b AND THE HUMAN TRANSFERRINE RECEIVER AND METHODS OF USE |
CA3002073A1 (en) * | 2015-10-20 | 2017-04-27 | Sorrento Therapeutics, Inc. | Intracellular delivery compounds |
US20190185852A1 (en) * | 2016-05-05 | 2019-06-20 | M. Mahmood Hussain | Therapeutically modulating apob and apoai |
CN109843327B (en) | 2016-07-07 | 2022-05-13 | 小利兰·斯坦福大学托管委员会 | Antibody adjuvant conjugates |
CN110248668B (en) | 2016-12-15 | 2023-05-30 | 杜克大学 | Antibodies and methods for depleting regulatory B10 cells and combination with immune checkpoint inhibitors |
MX2019012295A (en) | 2017-04-14 | 2020-02-07 | Tollnine Inc | Immunomodulating polynucleotides, antibody conjugates thereof, and methods of their use. |
EP3937984A1 (en) | 2019-03-15 | 2022-01-19 | Bolt Biotherapeutics, Inc. | Immunoconjugates targeting her2 |
CN111826764B (en) * | 2020-07-28 | 2021-10-15 | 吴忠德悦纺织科技有限公司 | Preparation method of modified multi-component composite yarn |
CN114216985A (en) * | 2021-12-22 | 2022-03-22 | 珠海润都制药股份有限公司 | Method for testing diisopropyl sulfate in isosorbide |
Family Cites Families (90)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US3854480A (en) | 1969-04-01 | 1974-12-17 | Alza Corp | Drug-delivery system |
US3906092A (en) | 1971-11-26 | 1975-09-16 | Merck & Co Inc | Stimulation of antibody response |
US4469863A (en) | 1980-11-12 | 1984-09-04 | Ts O Paul O P | Nonionic nucleic acid alkyl and aryl phosphonates and processes for manufacture and use thereof |
US4675189A (en) | 1980-11-18 | 1987-06-23 | Syntex (U.S.A.) Inc. | Microencapsulation of water soluble active polypeptides |
US5023243A (en) | 1981-10-23 | 1991-06-11 | Molecular Biosystems, Inc. | Oligonucleotide therapeutic agent and method of making same |
US4452775A (en) | 1982-12-03 | 1984-06-05 | Syntex (U.S.A.) Inc. | Cholesterol matrix delivery system for sustained release of macromolecules |
US5567610A (en) | 1986-09-04 | 1996-10-22 | Bioinvent International Ab | Method of producing human monoclonal antibodies and kit therefor |
US5565354A (en) | 1986-09-05 | 1996-10-15 | Sandoz Ltd. | Production of human monoclonal antibodies specific for hepatitis B surface antigen |
US5075109A (en) | 1986-10-24 | 1991-12-24 | Southern Research Institute | Method of potentiating an immune response |
US6214804B1 (en) | 1989-03-21 | 2001-04-10 | Vical Incorporated | Induction of a protective immune response in a mammal by injecting a DNA sequence |
US5133974A (en) | 1989-05-05 | 1992-07-28 | Kv Pharmaceutical Company | Extended release pharmaceutical formulations |
US5786189A (en) | 1989-11-29 | 1998-07-28 | Smithkline Beecham Biologicals (S.A.) | Vaccine |
US5212295A (en) | 1990-01-11 | 1993-05-18 | Isis Pharmaceuticals | Monomers for preparation of oligonucleotides having chiral phosphorus linkages |
US5506212A (en) | 1990-01-11 | 1996-04-09 | Isis Pharmaceuticals, Inc. | Oligonucleotides with substantially chirally pure phosphorothioate linkages |
US5248670A (en) | 1990-02-26 | 1993-09-28 | Isis Pharmaceuticals, Inc. | Antisense oligonucleotides for inhibiting herpesviruses |
ES2246502T3 (en) | 1990-08-29 | 2006-02-16 | Genpharm International, Inc. | TRANSGENIC NON-HUMAN ANIMALS ABLE TO PRODUCE HETEROLOGICAL ANTIBODIES. |
US5208146A (en) * | 1990-11-05 | 1993-05-04 | The Regents Of The University Of California | Murine monoclonal anti-idiotype antibodies |
US5512668A (en) | 1991-03-06 | 1996-04-30 | Polish Academy Of Sciences | Solid phase oligonucleotide synthesis using phospholane intermediates |
US5359052A (en) | 1991-08-05 | 1994-10-25 | Polish Academy Of Sciences | Chalcophospholanes useful in the synthesis of oligonucleoside phosphorothioates, phosphorodithioates and related selenates |
US5599797A (en) | 1991-10-15 | 1997-02-04 | Isis Pharmaceuticals, Inc. | Oligonucleotides having phosphorothioate linkages of high chiral purity |
US5407686A (en) | 1991-11-27 | 1995-04-18 | Sidmak Laboratories, Inc. | Sustained release composition for oral administration of active ingredient |
US5585479A (en) | 1992-07-24 | 1996-12-17 | The United States Of America As Represented By The Secretary Of The Navy | Antisense oligonucleotides directed against human ELAM-I RNA |
US6015886A (en) | 1993-05-24 | 2000-01-18 | Chemgenes Corporation | Oligonucleotide phosphate esters |
US5679647A (en) | 1993-08-26 | 1997-10-21 | The Regents Of The University Of California | Methods and devices for immunizing a host against tumor-associated antigens through administration of naked polynucleotides which encode tumor-associated antigenic peptides |
US5849719A (en) | 1993-08-26 | 1998-12-15 | The Regents Of The University Of California | Method for treating allergic lung disease |
AU695552B2 (en) | 1993-11-16 | 1998-08-13 | Genta Incorporated | Chirally enriched synthetic phosphonate oligomers |
WO1995026204A1 (en) | 1994-03-25 | 1995-10-05 | Isis Pharmaceuticals, Inc. | Immune stimulation by phosphorothioate oligonucleotide analogs |
US6727230B1 (en) * | 1994-03-25 | 2004-04-27 | Coley Pharmaceutical Group, Inc. | Immune stimulation by phosphorothioate oligonucleotide analogs |
US5534615A (en) | 1994-04-25 | 1996-07-09 | Genentech, Inc. | Cardiac hypertrophy factor and uses therefor |
US6239116B1 (en) | 1994-07-15 | 2001-05-29 | University Of Iowa Research Foundation | Immunostimulatory nucleic acid molecules |
PT772619E (en) | 1994-07-15 | 2006-10-31 | Univ Iowa Res Found | OLIGONUCLEOTIDOS IMUNOMODULADORES |
US20030050263A1 (en) | 1994-07-15 | 2003-03-13 | The University Of Iowa Research Foundation | Methods and products for treating HIV infection |
US7935675B1 (en) * | 1994-07-15 | 2011-05-03 | University Of Iowa Research Foundation | Immunostimulatory nucleic acid molecules |
US6429199B1 (en) | 1994-07-15 | 2002-08-06 | University Of Iowa Research Foundation | Immunostimulatory nucleic acid molecules for activating dendritic cells |
US20030026782A1 (en) * | 1995-02-07 | 2003-02-06 | Arthur M. Krieg | Immunomodulatory oligonucleotides |
US6207646B1 (en) * | 1994-07-15 | 2001-03-27 | University Of Iowa Research Foundation | Immunostimulatory nucleic acid molecules |
US5736152A (en) | 1995-10-27 | 1998-04-07 | Atrix Laboratories, Inc. | Non-polymeric sustained release delivery system |
US5969135A (en) * | 1995-11-02 | 1999-10-19 | Icn Pharmaceuticals, Inc. | Oligonucleotide analogs with an amino acid or a modified amino alcohol residue |
US5780448A (en) | 1995-11-07 | 1998-07-14 | Ottawa Civic Hospital Loeb Research | DNA-based vaccination of fish |
US5856465A (en) | 1996-05-24 | 1999-01-05 | Polska Akademia Nauk Centrum Badan Molekularnych I Makromolekularnych | Compositions and methods for the synthesis of chirally pure organophosphorus nucleoside derivatives |
EP0855184A1 (en) | 1997-01-23 | 1998-07-29 | Grayson B. Dr. Lipford | Pharmaceutical composition comprising a polynucleotide and an antigen especially for vaccination |
JP2001513776A (en) | 1997-02-28 | 2001-09-04 | ユニバーシティ オブ アイオワ リサーチ ファウンデーション | Use of nucleic acids containing unmethylated CpG dinucleotides in the treatment of LPS-related disorders |
US6406705B1 (en) | 1997-03-10 | 2002-06-18 | University Of Iowa Research Foundation | Use of nucleic acids containing unmethylated CpG dinucleotide as an adjuvant |
DK1005368T3 (en) * | 1997-03-10 | 2010-01-04 | Ottawa Hospital Res Inst | Use of nucleic acids containing non-methylated CpG dinucleotide in combination with alum as adjuvants |
US6306393B1 (en) * | 1997-03-24 | 2001-10-23 | Immunomedics, Inc. | Immunotherapy of B-cell malignancies using anti-CD22 antibodies |
US6183744B1 (en) * | 1997-03-24 | 2001-02-06 | Immunomedics, Inc. | Immunotherapy of B-cell malignancies using anti-CD22 antibodies |
AU7690898A (en) | 1997-05-20 | 1998-12-11 | Ottawa Civic Hospital Loeb Research Institute | Vectors and methods for immunization or therapeutic protocols |
US6221882B1 (en) | 1997-07-03 | 2001-04-24 | University Of Iowa Research Foundation | Methods for inhibiting immunostimulatory DNA associated responses |
ATE356630T1 (en) * | 1998-04-03 | 2007-04-15 | Univ Iowa Res Found | METHOD AND PRODUCTS FOR STIMULATING THE IMMUNE SYSTEM USING IMMUNOTHERAPEUTIC OLIGONUCLEOTIDES AND CYTOKINE |
JP2002514397A (en) | 1998-05-14 | 2002-05-21 | コーリー ファーマシューティカル ゲーエムベーハー | Methods for hematopoietic regulation using CpG oligonucleotides |
DK1077722T3 (en) | 1998-05-22 | 2006-11-27 | Ottawa Health Research Inst | Methods and products for the induction of mucosa immunity |
EA004107B1 (en) * | 1998-08-11 | 2003-12-25 | Айдек Фармацевтикалс Корпорэйшн | Combination therapies for b-cell lymphomas comprising administration of anti-cd20 antibody |
DK1616572T3 (en) * | 1998-11-09 | 2010-12-06 | Biogen Idec Inc | Chimeric anti-CD20 antibody, rituxane, for use in the treatment of chronic lymphocytic leukemia |
AU5937100A (en) * | 1999-06-23 | 2001-01-09 | Datum, Inc. | System and method for providing a trusted third party clock and trusted local clock |
KR100863630B1 (en) * | 1999-09-25 | 2008-10-15 | 유니버시티 오브 아이오와 리써치 파운데이션 | Immunostimulatory Nucleic Acids |
US6949520B1 (en) * | 1999-09-27 | 2005-09-27 | Coley Pharmaceutical Group, Inc. | Methods related to immunostimulatory nucleic acid-induced interferon |
WO2001095935A1 (en) * | 2000-01-20 | 2001-12-20 | Ottawa Health Research Institute | Immunostimulatory nucleic acids for inducing a th2 immune response |
US7585847B2 (en) | 2000-02-03 | 2009-09-08 | Coley Pharmaceutical Group, Inc. | Immunostimulatory nucleic acids for the treatment of asthma and allergy |
US20020156033A1 (en) * | 2000-03-03 | 2002-10-24 | Bratzler Robert L. | Immunostimulatory nucleic acids and cancer medicament combination therapy for the treatment of cancer |
US20040131628A1 (en) | 2000-03-08 | 2004-07-08 | Bratzler Robert L. | Nucleic acids for the treatment of disorders associated with microorganisms |
US20020091097A1 (en) | 2000-09-07 | 2002-07-11 | Bratzler Robert L. | Nucleic acids for the prevention and treatment of sexually transmitted diseases |
JP2005500806A (en) * | 2000-09-15 | 2005-01-13 | コーリー ファーマシューティカル ゲーエムベーハー | Process for high-throughput screening of immune agonist / immunoantagonists based on CpG |
EP1350262B8 (en) | 2000-12-08 | 2008-08-13 | Coley Pharmaceuticals GmbH | Cpg-like nucleic acids and methods of use thereof |
WO2002053141A2 (en) | 2000-12-14 | 2002-07-11 | Coley Pharmaceutical Group, Inc. | Inhibition of angiogenesis by nucleic acids |
US20030050268A1 (en) | 2001-03-29 | 2003-03-13 | Krieg Arthur M. | Immunostimulatory nucleic acid for treatment of non-allergic inflammatory diseases |
WO2003012061A2 (en) | 2001-08-01 | 2003-02-13 | Coley Pharmaceutical Gmbh | Methods and compositions relating to plasmacytoid dendritic cells |
KR100991644B1 (en) | 2001-08-17 | 2010-11-02 | 콜리 파마슈티칼 게엠베하 | Combination Motif Immune Stimulatory Oligonucleotides with Improved Activity |
IL160837A0 (en) | 2001-10-05 | 2004-08-31 | Coley Pharm Gmbh | Toll-like receptor 3 signaling agonists and antagonists |
CA2462203A1 (en) * | 2001-10-12 | 2003-11-20 | University Of Iowa Research Foundation | Methods and products for enhancing immune responses using imidazoquinoline compounds |
US8153141B2 (en) | 2002-04-04 | 2012-04-10 | Coley Pharmaceutical Gmbh | Immunostimulatory G, U-containing oligoribonucleotides |
US20040009949A1 (en) | 2002-06-05 | 2004-01-15 | Coley Pharmaceutical Group, Inc. | Method for treating autoimmune or inflammatory diseases with combinations of inhibitory oligonucleotides and small molecule antagonists of immunostimulatory CpG nucleic acids |
US20040053880A1 (en) | 2002-07-03 | 2004-03-18 | Coley Pharmaceutical Group, Inc. | Nucleic acid compositions for stimulating immune responses |
US7807803B2 (en) | 2002-07-03 | 2010-10-05 | Coley Pharmaceutical Group, Inc. | Nucleic acid compositions for stimulating immune responses |
US7605138B2 (en) | 2002-07-03 | 2009-10-20 | Coley Pharmaceutical Group, Inc. | Nucleic acid compositions for stimulating immune responses |
US7576066B2 (en) | 2002-07-03 | 2009-08-18 | Coley Pharmaceutical Group, Inc. | Nucleic acid compositions for stimulating immune responses |
US7569553B2 (en) | 2002-07-03 | 2009-08-04 | Coley Pharmaceutical Group, Inc. | Nucleic acid compositions for stimulating immune responses |
AR040996A1 (en) | 2002-08-19 | 2005-04-27 | Coley Pharm Group Inc | IMMUNE STIMULATING NUCLEIC ACIDS |
EP2241325B1 (en) * | 2002-10-29 | 2012-02-08 | Coley Pharmaceutical Group, Inc. | Use of CPG oligonucleotides in the treatment of hepatitis C virus infection |
JP2006512927A (en) | 2002-12-11 | 2006-04-20 | コーリー ファーマシューティカル グループ,インコーポレイテッド | 5 'CPG nucleic acids and methods of use thereof |
AU2004226605A1 (en) | 2003-04-02 | 2004-10-14 | Coley Pharmaceutical Group, Ltd. | Immunostimulatory nucleic acid oil-in-water formulations for topical application |
BRPI0411514A (en) * | 2003-06-20 | 2006-08-01 | Coley Pharm Gmbh | small molecule toll-like receptor antagonists |
JP4989225B2 (en) * | 2003-09-25 | 2012-08-01 | コーリー ファーマシューティカル グループ,インコーポレイテッド | Nucleic acid lipophilic conjugate |
US20050215501A1 (en) * | 2003-10-24 | 2005-09-29 | Coley Pharmaceutical Group, Inc. | Methods and products for enhancing epitope spreading |
US20050239733A1 (en) * | 2003-10-31 | 2005-10-27 | Coley Pharmaceutical Gmbh | Sequence requirements for inhibitory oligonucleotides |
US20050100983A1 (en) * | 2003-11-06 | 2005-05-12 | Coley Pharmaceutical Gmbh | Cell-free methods for identifying compounds that affect toll-like receptor 9 (TLR9) signaling |
JP2007531746A (en) * | 2004-04-02 | 2007-11-08 | コーリー ファーマシューティカル グループ,インコーポレイテッド | Immunostimulatory nucleic acid for inducing an IL-10 response |
US20070129320A9 (en) * | 2004-07-18 | 2007-06-07 | Coley Pharmaceutical Group, Ltd. | Methods and compositions for inducing innate immune responses |
MY159370A (en) * | 2004-10-20 | 2016-12-30 | Coley Pharm Group Inc | Semi-soft-class immunostimulatory oligonucleotides |
US20080009455A9 (en) * | 2005-02-24 | 2008-01-10 | Coley Pharmaceutical Group, Inc. | Immunostimulatory oligonucleotides |
PL1957647T3 (en) * | 2005-11-25 | 2015-07-31 | Zoetis Belgium S A | Immunostimulatory oligoribonucleotides |
-
2001
- 2001-06-22 AU AU7013401A patent/AU7013401A/en active Pending
- 2001-06-22 DE DE60139689T patent/DE60139689D1/en not_active Expired - Lifetime
- 2001-06-22 JP JP2002503327A patent/JP2003535907A/en active Pending
- 2001-06-22 DK DK01948684T patent/DK1296714T3/en active
- 2001-06-22 US US09/888,326 patent/US7534772B2/en not_active Expired - Fee Related
- 2001-06-22 SI SI200130937T patent/SI1296714T1/en unknown
- 2001-06-22 EP EP01948684A patent/EP1296714B1/en not_active Expired - Lifetime
- 2001-06-22 AU AU2001270134A patent/AU2001270134B2/en not_active Revoked
- 2001-06-22 PT PT01948684T patent/PT1296714E/en unknown
- 2001-06-22 AT AT01948684T patent/ATE440618T1/en active
- 2001-06-22 WO PCT/US2001/020154 patent/WO2001097843A2/en active Application Filing
- 2001-06-22 CA CA2410371A patent/CA2410371C/en not_active Expired - Lifetime
- 2001-06-22 ES ES01948684T patent/ES2332444T3/en not_active Expired - Lifetime
-
2006
- 2006-09-15 AU AU2006216542A patent/AU2006216542B2/en not_active Expired
-
2009
- 2009-07-28 AU AU2009203061A patent/AU2009203061C1/en not_active Expired
- 2009-09-01 AU AU2009212978A patent/AU2009212978A1/en active Pending
Also Published As
Publication number | Publication date |
---|---|
AU7013401A (en) | 2002-01-02 |
CA2410371A1 (en) | 2001-12-27 |
SI1296714T1 (en) | 2010-01-29 |
PT1296714E (en) | 2009-10-15 |
AU2006216542B2 (en) | 2009-04-30 |
AU2009203061B2 (en) | 2012-02-23 |
ES2332444T3 (en) | 2010-02-05 |
DE60139689D1 (en) | 2009-10-08 |
AU2009203061A1 (en) | 2009-08-20 |
US7534772B2 (en) | 2009-05-19 |
EP1296714A2 (en) | 2003-04-02 |
DK1296714T3 (en) | 2009-12-07 |
EP1296714B1 (en) | 2009-08-26 |
AU2001270134B2 (en) | 2006-06-15 |
AU2006216542A1 (en) | 2006-10-12 |
AU2009203061C1 (en) | 2012-06-28 |
ATE440618T1 (en) | 2009-09-15 |
AU2009212978A1 (en) | 2009-10-01 |
JP2003535907A (en) | 2003-12-02 |
US20030026801A1 (en) | 2003-02-06 |
WO2001097843A2 (en) | 2001-12-27 |
WO2001097843A3 (en) | 2003-01-23 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CA2410371C (en) | Methods for enhancing antibody-induced cell lysis and treating cancer | |
AU2001270134A1 (en) | Methods for enhancing antibody-induced cell lysis and treating cancer | |
US20090155212A1 (en) | Immunostimulatory nucleic acids and cancer medicament combination therapy for the treatment of cancer | |
JP7236483B2 (en) | Combination of PD-1 antagonists and CpG-C type oligonucleotides for the treatment of cancer | |
JP6991857B2 (en) | Treatment of cancer with TLR9 agonists with checkpoint inhibitors | |
Johnson et al. | The mechanisms of action of rituximab in the elimination of tumor cells | |
US20120003179A1 (en) | Anti-ctla-4 and cpg-motif-containing synthetic oligodeoxynucleotide combination therapy for cancer treatment | |
JP2003513937A (en) | Treatment of B-cell malignancy using anti-CD20 antibodies and / or anti-CD40L antibodies in combination with chemotherapeutic agents and radiation therapy | |
KR20080068089A (en) | Antibodies with enhanced antibody-dependent cellular cytotoxicity activity, methods of their production and use | |
JP2022515188A (en) | Compositions and Methods for Cancer Treatment | |
CN110831622B (en) | FGL2 monoclonal antibody and application thereof in treatment of malignant tumors | |
KR20220143904A (en) | Human 4-1BB agonist antibodies and methods of use thereof | |
Ansell et al. | Antibody Therapy for Non-Hodgkin’s Lymphoma | |
CN115956088A (en) | Anti-tumor combination therapy comprising an anti-CD 19 antibody and a polypeptide that blocks a SIRPa-CD 47 innate immune checkpoint |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
EEER | Examination request | ||
MKEX | Expiry |
Effective date: 20210622 |