CA2419975A1 - Enzymes having high temperature polymerase activity and methods of use thereof - Google Patents

Abstract

The invention relates to thermostable polymerases that have polymerase activity temperatures in the range from 9~ C up to 113~ C, such as those derived from Pyrolobus fumaria, and to polynucleotides encoding the polymerases In addition, methods of designing new thermostable DNA polymerases and methods of use thereof are also provided. The polymerases have increased activity and stability at increased pH and temperature.

Description

r tr n, t . ,.,err, ~ .. r ., a,.~n~ r o i "~..7n " ~,.a,' m f''ii ~r:fj~~a o,y ' 1,~~ ~ ~ar~~y~i w.
n... . f , s ~;~~~s "a,~~ .,'~A ~ r ins 1~~ .o , l~ .a Is ' '.i,~n 'o u>~"i , 3:
s . .1. , , . . r ENZYMES HAVING HIGH TEMPERATURE POLYMERASE
ACTIVITY AND METHODS OF USE THEREOF
FIELD OF THE INVENTION
This invention relates generally to enzymes, polynucleotides encoding the enzymes, the use of such polynucleotides and polypeptides, and more specifically to enzymes having polymerase activity at high temperature.
BACKGROUND
Thermophilic bacteria have received considerable attention as sources of highly active and thermostable enzymes. Interest in DNA polymerases from thermophilic microbes increased with the invention of nucleic acid amplification processes. The use of thermostable enzymes, such as those described in U.S.
Pat. No.
4,165,188, to amplify existing nucleic acid sequences in amounts that are large compared to the amount initially present was described U.S. Pat. Nos.
4,683,195 and 4,683,202, which describe the PCR process. These patents are incorporated herein by reference.
The PCR process involves denaturation of a target nucleic acid, hybridization of primers, and synthesis of complementary strands catalyzed by a DNA
polymerase.
The amplification product of each primer becomes a template for the production of the desired nucleic acid sequence. If the polymerase employed is a thermostable enzyme, polymerase need not be added after every denaturation step, because heat will not destroy the polymerase activity. Thermostable DNA polymerases are not irreversibly inactivated even when heated to 93° C to 95° C for brief periods of time, as, for example, in the practice of DNA amplification by PCR. In contrast, at this elevated temperature E. coli DNA Pol I is inactivated.
Archaeal hyperthermophiles, such as Pyrodictium and Methanopyrus species, grow at temperatures up to about 110° C and are unable to grow below 80 degree. C.
(see, Stetter et al., 1990, FEMS Microbiology Reviews 75:1170124, which is incorporated herein by reference). These sulfur reducing, strict anaerobes are isolated from submarine environments. For example, P. abyssi was isolated from a deep sea active "smoker'° chimney off Guaymas Mexico at 2,000 meters depth and in 320° C.

of venting water (Pley et al., 1991, Systematic and Applied Microbiology 14:245).
The hyperthermophile that lives at the highest known temperature, Pyrolobus fumaria, grows in the walls of hydrothermal vents, sometimes called smokers, through which superheated, mineral-rich fluids erupt. Pyrolobus fumaria reproduces best in an environment of about 105 ° C and can multiply in temperatures of up to 113 °C, but stops growing at temperatures below 90 ° C.
The more common thermophilic microorganisms have an optimum growth temperature at or about 90° C and a maximum growth temperature at or about 100° C.
These less extreme hypertherrnophiles can be grown in culture. For example, a gene encoding DNA polymerase has been cloned and sequenced from Thermococcus litoralis (EP No. 455,430).
~Iowever, culture of the extreme hyperthermophilic microorganisms is made difficult by their inability to grow on agar solidified media. For example, individual cells of the Pyrodictium species are extremely fragile, and the organisms grow as fibrous networks, clogging the steel parts of conventional fermentation apparatus.
Thus, standard bacterial fermentation techniques are extremely difficult for culturing Pyrodictium. (See Staley, J. T. et al. eds., Bergey"s Manual of Systematic Bacteriology, 1989, dVilliams and Wilkins, Baltimore, which is incorporated herein by reference.) These and other difficulties may preclude laboratory culture for preparing large amounts of purified nucleic acid polymerase enzymes for characterization and amino acid sequence analysis.
There is a desire in the art to produce thermostable DNA polymerases having enhanced thermostability that may be used to improve the PCR process and to improve the results obtained when using a thermostable DNA polymerase in other recombinant techniques such as DNA sequencing, nick-translation, and reverse transcription.
SUMMARY OF THE INVENTION
The present invention meets these and other needs by providing an isolated nucleic acid having a sequence as set forth in SEQ m NO: 1, 3, 5, 7, 9, 1 l, 13, 15 and variants thereof having at least 50% sequence identity to SEQ m NO: 1, 3, 5, 7, 9, 1 l, 13, 15 and encoding polypeptides having polymerase activity at extreme high temperature, such as temperatures of 95° C to 113° C, for four or more hours.
One aspect of the invention is an isolated nucleic acid having a sequence as set forth in SEQ m NO: 1, 3, 5, 7, 9, 11, 13, 15 sequences substantially identical thereto, and sequences complementary thereto.
Another aspect of the invention is an isolated nucleic acid including at least consecutive bases of a sequence as set forth in SEQ ~ NO: 1, 3, 5, 7, 9, 11, 13, 15 sequences substantially identical thereto, and the sequences complementary thereto.
In yet another aspect, the invention provides an isolated nucleic acid encoding a polypeptide having a sequence as set forth in SEQ 117 NO: 2, 4, 6, 8, 10, 12, 14, 16 and variants thereof having at least 50% sequence identity to such sequences and encoding a polypeptide having thermostable polymerase activity at a temperature in a range from about 95°C to 113°C.
Another aspect of the invention is an isolated nucleic acid encoding a polypeptide or a functional fragment thereof having a sequence as set forth in SEQ Il3 No: 2, 4, 6,8,10, 12, 14 or 16 and sequences substantially identical thereto.
Another aspect of the invention is an isolated nucleic acid encoding a polypeptide having at least 10 consecutive amino acids of a sequence as set forth in SEQ m No: 2, 4, 6,8,10, 12, 14 or 16, and sequences substantially identical thereto.
In yet another aspect, the invention provides a purified polypeptide having a sequence as set forth in SEQ ~ No: 2, 4, 6,8,10, 12, 14 or 16 and sequences substantially identical thereto.
Another aspect of the invention is an isolated or purified antibody that specifically binds to a polypeptide having a sequence as set forth in SEQ m No: 2, 4, 6,8,10, 12, 14 or 16 and sequences substantially identical thereto.

Another aspect of the invention is an isolated or purified antibody or binding fragment thereof, which specifically binds to a polypeptide having at least 10 consecutive amino acids of one of the polypeptides of SEQ B3 NO: 2, 4, 6, 8, 10, 12, 14, l6and sequences substantially identical thereto.
Another aspect of the invention is a method of making a polypeptide having a sequence as set forth in SEQ m NO: 2, 4, 6, 8, 10, 12, 14, l6and sequences substantially identical thereto. The method includes introducing a nucleic acid encoding the polypeptide into a host cell, wherein the nucleic acid is operably linked to a promoter, and culturing the host cell under conditions that allow expression of the nucleic acid.
Another aspect of the invention is a method of making a polypeptide having at least 10 amino acids of a sequence as set forth in SEQ >D NO: 2, 4, 6, 8, 10, 12, 14, l6and sequences substantially identical thereto. The method includes introducing a nucleic acid encoding the polypeptide into a host cell, wherein the nucleic acid is operably linked to a promoter, and culturing the host cell under conditions that allow expression of the nucleic acid, thereby producing the polypeptide.
Another aspect of the invention is a method of generating a variant including obtaining a nucleic acid having a sequence as set forth in SEQ m NO: l, 3, 5, 7, 9, 11, 13, 15 sequences substantially identical thereto, sequences complementary to the sequences of SEQ )D NO: 1, 3, 5, 7, 9, 11, 13, 15 fragments comprising at least 30 consecutive nucleotides of the foregoing sequences, and changing one or more nucleotides in the sequence to another nucleotide, deleting one or more nucleotides in the sequence, or adding one or more nucleotides to the sequence.
Another aspect of the invention is a computer readable medium having stored thereon a sequence as set forth in SEQ m NO: 1, 3, 5, 7, 9, 11, 13, 15 and sequences substantially identical thereto, or a polypeptide sequence as set forth in SEQ
~ NO:
2, 4, 6, 8, 10, 12, 14,16 and sequences substantially identical thereto.
Another aspect of the invention is a computer system including a processor and a data storage device wherein the data storage device has stored thereon a sequence as set forth in SEQ m NO: 1, 3, 5, 7, 9, 11, 13, 15 and sequences substantially identical thereto, or a polypeptide having a sequence as set forth in SEQ
ID NO: 2, 4, 6, 8, 10, 12, 14, 16 and sequences substantially identical thereto.
Another aspect of the invention is a method for comparing a first sequence to a 5 reference sequence wherein the first sequence is a nucleic acid having a sequence as set forth in SEQ m NO: 1, 3, 5, 7, 9, 11, 13, 15 and sequences substantially identical thereto, or a polypeptide code of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16 and sequences substantially identical thereto. The method includes reading the first sequence and the reference sequence through use of a computer program which compares sequences;
and determining differences between the first sequence and the reference sequence with the computer program.
Another aspect of the invention is a method for identifying a feature in a sequence as set forth in SEQ 1D NO: 1, 3, 5, 7, 9, 11, 13, 15 and sequences substantially identical thereto, or a polypeptide having a sequence as set forth in SEQ
1D NO: 2, 4, 6, 8, 10, 12, 14, 16 and sequences substantially identical thereto, including reading the sequence through the use of a computer program which identifies features in sequences; and identifying features in the sequence with the computer program.
Another aspect of the invention is an assay for identifying fragments or variants of SEQ m NO: 2, 4, 6, 8, 10, 12, 14, 16 and sequences substantially identical thereto, and sequences substantially identical thereto, which retain the extreme high temperature polymerase activity of the polypeptides of SEQ m NO: 2, 4, 6, 8, 10, 12, 14, 16 (i.e., at temperatures of 95° C to 113° C, for four or more hours. The assay includes utilizing a polypeptide encoded by a nucleic acid having at least 50%
homology to SEQ m NO: 1, 3, 5, 7, 9,11,13, 15 and sequences substantially identical thereto, or polypeptide fragment or variant encoded by SEQ m NO: l, 3, 5, 7, 9, 11, 13, 15 to effect DNA polymerase activity in a PCR amplification at extreme high temperature for four or more hours and under conditions that allow the polypeptide or fragment or variant to function, and detecting formation of an amplification product, wherein formation of the amplification product is indicative of a fixnctional DNA
polymerase polypeptide or fragment or variant.
In one embodiment, the invention provides a method of sequencing a DNA
molecule using a polymerase of the invention. The method includes (a) hybridizing a primer to a first DNA molecule; (b) contacting the first DNA molecule with deoxyribonucleoside triphosphates, a DNA polymerase of the invention (e.g., SEQ ~
N0:16), and a terminator molecule to form a mixture; (c) incubating the mixture under conditions sufficient to synthesize a random population of DNA molecules complementary to the first DNA molecule and wherein the synthesized DNA
molecules comprise a terminator nucleotide at their S' termini; and (d) separating the synthesized DNA molecules by size so that at least a portion of the nucleotide sequence of the first DNA molecule can be determined. Such deoxyribonucleoside triphosphates include but are not limited to are inosine dATP, dCTP, dGTP, dTTP, dITP, 7-deaza-dGTP, dUTP, [a-S]dATP, [a-S]dTTP, [a-S]dGTP, or [a-S]dCTP.
Terminator nucleotides may include ddTTP, ddATP, ddGTP, ddITP, or ddCTP, for example.
In another embodiment, the invention provides a method of preparing cDNA
from mRNA utilizing a polyrnerase of the invention and relying on the reverse transcriptase (RT) activity of the polymerase. The method includes (a) contacting mRNA with an oligo(dT) primer or other complementary primer to form a hybrid;
(b) contacting the hybrid formed in step (a) with a DNA polymerase of claim 1 and four different dNTPs, under conditions whereby a cDNA is obtained.
The invention also provides a method of amplifying a double-stranded DNA
molecule, such as by a PCR reaction. The method includes providing a first and second primer, wherein the first primer is complementary to a sequence at or near the 3'-termini of the first strand of the DNA molecule and the second primer is complementary to a sequence at or near the 3'-termini of the second strand of the DNA molecule; hybridizing the primer to the first strand and the second primer to the second strand in the presence of a DNA polymerase of the invention (e.g., SEQ
ID
NO:16), under conditions such that a third DNA molecule complementary to the first strand and a fourth DNA molecule complementary to the second strand are synthesized; denaturing the first and third strand, and second and fourth strands; and repeating steps one through three one or more times to generate an amplified DNA
molecule. Once amplified DNA is obtained, one can clone the DNA molecules) into a vector, such as a plasmid (i.e., blunt end cloning).
The invention also provides a method for incorporating non-natural nucleotides or nucleotide analogs into a DNA molecule comprising contacting a polypeptide encoded by a polynucleotide encoding a polymerase of the invention with a DNA template in a PCR amplification reaction. Such nucleotides include, for example, inosine, 2-aminopurine, or 5-methylcytosine.
BRIEF DESCRIPTION OF THE DRAWINGS
The following drawings are illustrative of embodiments of the invention and are not meant to limit the scope of the invention as encompassed by the claims.
Figures 1A through 1E show the nucleotide and deduced amino acid sequence of DNA polymerase (1PY2) from Pyrolobus fumaria (SEQ ID N0:13 and 14, respectively). Upon resequencing, the nucleotide and deduced amino acid sequence were shown to have greater than 99% homology to SEQ ID NO: I3 and 14.
(See SEQ ID NO:IS and 16, respectively) (Figures 1F-1H (DNA) and 1I (amino acid)).
Figure 2 is a block diagram of a computer system.
Figure 3 is a flow diagram illustrating one embodiment of a process for comparing a new nucleotide or protein sequence with a database of sequences in order to determine the homology levels between the new sequence and the sequences in the database.
Figure 4 is a flow diagram illustrating one embodiment of a process in a computer for determining whether two sequences are homologous.

Figure 5 is a flow diagram illustrating one embodiment of an identifier process 300 for detecting the presence of a feature in a sequence.
Figure 6 is a chart showing the Relative frequency of mutation using the polymerase encoded by SEQ ID NO: 15 (polypeptide = SEQ ID N0:16) and Taq polymerase, as set forth in Example 2.
Figure 7 shows a gel where SEQ ID N0:16 was able to amplify multiple templates and produce robust yields relative to Taq polymerase.
Figure 8 shows a gel indicating that SEQ ID N0:16 was able to amplify lambda phage genomic DNA templates up to 25 kb without additional optimization.
Figure 9 is a gel and lane 1 demonstrates that SEQ ID N0:16 successfully amplified a portion of IGFRII cDNA, which is greater than 90% GC-rich.
Figure 10 shows a comparison of RT activity between SEQ D3 NO:16 in the presence and absence of Mg++.
Figure 11 shows a graph of SEQ ID NO:16 stability and polymerase activity at 85C, 90C and 95C for a period of up to 4 hours.
DETAILED DESCRIPTION OF THE INVENTION
The present invention relates to DNA polymerases and polynucleotides encoding them. The polynucleotide SEQ ID NO:1 S was originally recovered from a genomic gene library derived from Pyrolobus fumaria. This 2412 base pair polynucleotide encodes a protein having a deduced 803 amino acid sequence (SEQ
ID
N0:16). SEQ ID NO: 1, 3, 5, 7, 9, 11, 13 encode additional novel nucleic acid sequences encoding polymerases and SEQ ID NO: 2, 4, 6, 8, 10, 12, and 14 are the corresponding proteins.
The present invention provides purified thermostable DNA polymerases that catalyze DNA synthesis by addition of deoxynucleotides to the 3' end of a polynucleotide chain, using a complementary polynucleotide strand as a template.

The resulting yield is higher than with previously identified polymerases. In addition to the ability to add naturally-occurring nucleotides adenine, guanine, cytosine, thymine, uracil, polymerases of the invention are also useful for incorporation of modified, or non-natural nucleotides (e.g., analogs of guanine, cytosine, thymine, uracil, including deoxy). For example, an invention polyrnerase is useful for the addition of 2-aminopurine, inosine, 5-methylcytosine or other non-natural or modified nucleotides.
An exemplary purified enzyme is a polymerase derived from an organism referred herein as "Pyrolobus fumaria," a hyperthermophile that grows in the walls of hydrothermal vents through which superheated, mineral-rich fluids erupt.
Pyrolobus fumaria reproduces best in an environment of about 105 ° C and can multiply in temperatures of up to 113 °C, but stops growing at temperatures below 90 ° C. This exemplary enzyme (sequence shown in Figure 1B) may be used to polymerize DNA
where desired. The polymerase enzyme of the present invention has a very high 1 S thermostability and processivity The Pyrolobus fumaria polymerase remains robustly active even after four or more hours at temperatures as high as 95° C
to 113°C.
Therefore it is particularly useful and reliable for PCR amplification of template molecules greater than 20 kb in length and/or having a GC content of greater than about 90%, templates which typically require longer amplification times and higher temperatures.
One property found in the Pyrolobus fumaria IaNA polyrnerase enzymes, but lacking in native Taq DNA polymerase and native Tth DNA polymerase, is 3'~5' exonuclease activity. This 3'-~5'exonuclease activity, which is commonly known as a "proof reading" activity, is generally considered to be desirable because misincorporated or unmatched bases of the synthesized nucleic acid sequence are eliminated by this activity. Therefore, the fidelity of PCR utilizing a polymerase with 3'-~5' exonuclease activity (e.g. the invention Pyrolobus fumaria DNA
polymerase enzymes) is increased. However, the 3'->5' exonuclease activity found in DNA
polymerase enzymes can also increase non-specific background amplification in PCR
by modifying the 3' end of the primers. The 3'->5' exonuclease activity can eliminate single-stranded DNAs, such as primers or single-stranded template. In essence, every 3'-nucleotide of a single-stranded primer or template is treated by the enzyme as unmatched and is therefore degraded. To avoid primer degradation in PCR, one can add phosphorothioate to the 3' ends of the primers. Phosphorothioate modified 5 nucleotides are more resistant to removal by 3'--j5' exonucleases.
Whether one desires to produce an enzyme identical to native Pyrolobus fu~ca~ia DNA polymerase or a derivative or homologue of that enzyme, the production of a recombinant form of the polymerase typically involves the construction of an expression vector, the transformation of a host cell with the vector, 10 and culture of the transformed host cell under conditions such that expression will occur. To construct the expression vector, a DNA is obtained that encodes the mature (used here to include all muteins) enzyme or a fusion of the polymerase to an additional sequence that does not destroy activity or to an additional sequence cleavable under controlled conditions (such as treatment with peptidase) to give an active protein. The coding sequence is then placed in operable linkage with suitable control sequences in an expression vector. The vector can be designed to replicate autonomously in the host cell or to integrate into the chromosomal DNA of the host cell. The vector is used to transform a suitable host, and the transformed host is cultured under conditions suitable for expression of recombinant polymerase.
The recombinant polymerase is isolated from the medium or from the cells; recovery and purification of the protein may not be necessary in some instances, where some impurities may be tolerated.
De anitions As used herein, the term "DNA polymerase" encompasses enzymes having hydrolase activity, for example, enzymes capable of use to amplify a template sequence during PCR amplification procedures.
The phrases "nucleic acid" or "nucleic acid sequence" as used herein refer to an oligonucleotide, nucleotide, polynucleotide, or to a fragment of any of these, to DNA or RNA of genomic or synthetic origin which may be single-stranded or double-stranded and may represent a sense or antisense strand, to peptide nucleic acid (PNA), or to any DNA-like or RNA-like material, natural or synthetic in origin.
As used herein "nucleotide" refers to a base-sugar-phosphate combination.
Nucleotides are monomeric units of a nucleic acid sequence (DNA and RNA). The term nucleotide includes deoxyribonucleoside triphosphates such as dATP, dCTP, dITP, dUTP, dGTP, dTTP, or derivatives thereof. Such derivatives include, for example, [a]dATP, 7-deaza-dGTP and 7-deaza-dATP. The term nucleotide as used herein also refers to dideoxyribonucleoside triphosphates (ddNTPs) and their derivatives. Illustrated examples of dideoxyribonucleoside triphosphates include, but Y 0 are not limited to, ddATP, ddCTP, ddGTP, ddITP, and ddTTP. According to the present invention, a "nucleotide" may be unlabeled or detestably labeled by well known techniques. Detectable labels include, for example, radioactive isotopes, fluorescent labels, chemiluminescent labels, bioluminescent labels and enzyme labels.
A "coding sequence" or a "nucleotide sequence.encoding" a particular 15 polypeptide or protein, is a nucleic acid sequence which is transcribed and translated into a polypeptide or protein when placed under the control of appropriate regulatory sequences.
The term "gene" means the segment of DNA involved in producing a polypeptide chain; it includes regions preceding and following the coding region 20 (leader and trailer) as well as, where applicable, intervening sequences (introns) between individual coding segments (exons).
"Amino acid" or "amino acid sequence" as used herein refer to an oligopeptide, peptide, polypeptide, or protein sequence, or to a fragment, portion, or subunit of any of these, and to naturally occurring or synthetic molecules.
25 The term "polypeptide" as used herein, refers to amino acids joined to each other by peptide bonds or modified peptide bonds, i.e., peptide isosteres, and may contain modified amino acids other than the 20 gene-encoded amino acids. The polypeptides may be modified by either natural processes, such as post-translational processing, or by chemical modification techniques which are well known in the art.

Modifications can occur anywhere in the polypeptide, including the peptide backbone, the amino acid side-chains and the amino or carboxyl termini. It will be appreciated that the same type of modification may be present in the same or varying degrees at several sites in a given polypeptide. Also a given polypeptide may have many types of modifications. Modifications include acetylation, acylation, ADP-ribosylation, amidation, covalent attachment of flavin, covalent attachment of a heme moiety, covalent attachment of a nucleotide or nucleotide derivative, covalent attachment of a lipid or lipid derivative, covalent attachment of a phosphytidylinositol, cross-linking cyclization, disulfide bond formation, demethylation, formation of covalent cross-links, formation of cysteine, formation of pyroglutamate, formylation, gamma-carboxylation, glycosylation, GPI anchor formation, hydroxylation, iodination, methylation, myristolyation, oxidation, pergylation, proteolytic processing, phosphorylation, prenylation, racemization, selenoylation, sulfation, and transfer-RNA mediated addition of amino acids to protein such as arginylation. (See Proteins - Structure and Molecular Properties 2"d Ed., T.E. Creighton, W.H. Freeman and Company, New York (1993); Posttranslational Covalent Modification of Proteins, E.C. Johnson, Ed., Academic Press, New York, pp. 1-12 (1983)).
As used herein, the term "isolated" means that the material is removed from its original environment (e.g., the natural environment if it is naturally occurring). For example, a naturally-occurring polynucleotide or polypeptide present in a living animal is not isolated, but the same polynucleotide or polypeptide, separated from some or all of the coexisting materials in the natural system, is isolated.
Such polynucleotides could be part of a vector and/or such polynucleotides or polypeptides could be part of a composition, and still be isolated in that such vector or composition is not part of its natural environment.
As used herein, the term "purified" does not require absolute purity; rather, it is intended as a relative definition. Individual nucleic acids obtained from a library have been conventionally purified to electrophoretic homogeneity. The sequences obtained from these clones could not be obtained directly either from the library or from total human DNA. The purified nucleic acids of the invention have been purified from the remainder of the genomic DNA in the organism by at least 104-106 fold.
However, the term "purified" also includes nucleic acids which have been purified from the remainder of the genomic DNA or from other sequences in a library or other environment by at least one order of magnitude, typically two or three orders, and more typically four or five orders of magnitude.
As used herein °'amplification" refers to any in vitro or in vivo method for increasing the number of copies of a nucleotide sequence with the use of a DNA
polymerase. Nucleic acid amplification results in the incorporation of nucleotides into a DNA molecule or primer thereby forming a new DNA molecule complementary to a DNA template. The formed DNA molecule and its template can be used as templates to synthesize additional DNA molecules. As used herein, one amplification reaction may consist of many rounds of DNA replication. DNA amplification reactions include, for example, polymerase chain reactions (PCR). One PCR reaction may consist of several to 30 to 100 "cycles" of denaturation and synthesis of a DNA molecule, for example.
The term "primer" as used herein refers to an oligonucleotide, whether natural or synthetic, which is capable of acting as a point of initiation of synthesis when placed under conditions in which primer extension is initiated. Synthesis of a primer extension product which is complementary to a nucleic acid strand is initiated in the presence of nucleoside triphosphates and a DNA polymerase or reverse transcriptase enzyme in an appropriate buffer at a suitable temperature. A "buffer" includes cofactors (such as divalent metal ions) and salt (to provide the appropriate ionic strength), adjusted to the desired pH. For invention polymerases, the buffer preferably contains about 60 mM Tris-HCI, pH 10.0, 25 mM NaOAc, 2 mM Mg(OAc)2 to provide divalent magnesium ions, and 0.002% NP-40/Tween-20.
A primer is preferably a single-stranded oligodeoxyribonucleotide. The appropriate length of a primer depends on the intended use of the primer but typically ranges from 15 to 35 nucleotides. Short primer molecules generally require cooler temperatures to form sufficiently stable hybrid complexes with the template. A
primer need not reflect the exact sequence of the template but must be sufficiently complementary to hybridize with a template.

The term "primer" may refer to more than one primer, particularly in the case where there is some ambiguity in the information regarding one or both ends of the target region to be amplified. For instance, if a nucleic acid sequence is inferred from a protein sequence, a "primer" is actually a collection of primer oligonucleotides S containing sequences representing all possible codon variations based on the degeneracy of the genetic code. One of the primers in this collection will be homologous with the end of the target sequence. Likewise, if a "conserved'° region shows significant levels of polymorphism in a population, mixtures of primers can be prepared that will amplify adjacent sequences.
A primer may be "substantially" complementary to a strand of specific sequence of the template. A primer must be sufficiently complementary to hybridize with a template strand for primer elongation to occur. . A primer sequence need not reflect the exact sequence of the template. For example, a non-complementary nucleotide fragment may be attached to the S° end of the primer, with the remainder of the primer sequence being substantially complementary to the strand. Non-complementary bases or longer sequences can be interspersed into the primer, provided that the primer sequence has sufficient complementarity with the sequence of the template to hybridize and thereby form a template primer complex for synthesis of the extension product of the primer.
A primer can be labeled, if desired, by incorporating a label detectable by spectroscopic, photochemical, biochemical, immunochemical, or chemical means.
For example, useful labels include 3a P, fluorescent dyes, electron-dense reagents, enzymes (as commonly used in ELISAS), biotin, or haptens and proteins for which antisera or monoclonal antibodies are available. A label can also be used to "capture°°
2S the primer, so as to facilitate the immobilization of either the primer or a primer extension product, such as amplified DNA, on a solid support The terms "thermostable polymerise" and "thermostable enzyme" as used herein refer to an enzyme which is stable to heat and is heat resistant at extreme high temperatures for four or more hours and which catalyzes combination of the nucleotides in the proper manner to form primer extension products that are complementary to a template nucleic acid strand. Generally, synthesis of a primer extension product begins at the 3' end of the primer and proceeds in the 5' direction along the template strand, until synthesis terminates.
The thermostable enzymes of the present invention satisfy the requirements 5 for effective use in the amplification reaction known as the polymerase chain reaction or PCR as described in U.S. Pat. No. 4,965, 188 (incorporated herein by reference).
The invention enzymes do not become irreversibly denatured (inactivated) when subjected to the elevated temperatures for the time necessary to effect denaturation of double-stranded nucleic acids, a key step in the PCR process. Irreversible 10 denaturation for purposes herein refers to permanent and complete loss of enzymatic activity. The heating conditions necessary for nucleic acid denaturation will depend, e.g., on the buffer salt concentration and the composition and length of the nucleic acids being denatured, but typically range from about 90° C to about 105° C for a time depending mainly on the temperature and the nucleic acid length, typically from 15 a few seconds up to four minutes.
Higher temperatures may be required as the buffer salt concentration and/or GC composition of the nucleic acid is increased. The invention enzymes do not become irreversibly denatured from exposures to temperatures of about 95° C to 113°
C for four hours or more. The extreme thermostability of the invention DNA
polymerase enzymes provides additional advantages over previously characterized thermostable enzymes. Prior to the present invention, efficient PCR at denaturation temperatures as high as 113° C had not been demonstrated. No thermostable DNA
polymerases have been described for this purpose. However, as the G/C content of a target nucleic acid increases, the temperature necessary to denature the duplex also increases. For target sequences that require a denaturization step of over 95° C, previous protocols require that solvents are included in the PCR for partially destabilizing the duplex, thus, lowering the effective denaturization temperature.
Agents such as glycerol, DMSO, or formamide have been used in this manner in PCR (Korge et al., 1992, Proc. Natl. Acad. Sci. U.S.A. 89:910-914, and Wong et al., 1991, Nuc. Acids Res. 19:225 1- 2259, incorporated herein by reference).

However, these agents, in addition to destabilizing duplex DNA, will affect primer stability, can inhibit enzyme activity, and varying concentrations of DMSO or formamide decrease the thermoresistance (i.e., half life) of thermophilic DNA
polymerases. Accordingly, a significant number of optimization experiments and reaction conditions need to be evaluated when utilizing these cosolvents. Yn contrast, simply raising the denaturization temperature to 100° to 113° C
with the invention DNA polymerases in an otherwise standard PCR can facilitate complete strand separation of PCR product, eliminating the need for DNA helix destabilizing agents.
The extreme hyperthermophilic polymerases disclosed herein are stable at temperatures exceeding 100° C, and even as high as 113° C
without sacrificing the integrity of the target DNA, as is expected with other known polymerases (Ekert and I~unkel, 1992, In PCR: A Practical Approach, eds. McPherson, ~uirke and Taylor, Oxford lJniversity Press, pages 225-244, incorporated herein by reference).
As used herein, the term "recombinant" means that the nucleic acid is adjacent to "backbone" nucleic acid to which it is not adjacent in its natural environment.
Additionally, to be "enriched" the nucleic acids will represent 5% or more of the number of nucleic acid inserts in a population of nucleic acid backbone molecules.
l3ackbone molecules according to the invention include nucleic acids such as expression vectors, self replicating nucleic acids, viruses, integrating nucleic acids, and other vectors or nucleic acids used to maintain or manipulate a nucleic acid insert of interest. Typically, the enriched nucleic acids represent 15% or more of the number of nucleic acid inserts in the population of recombinant backbone molecules.
More typically, the enriched nucleic acids represent 50% or more of the number of nucleic acid inserts in the population of recombinant backbone molecules. In a one embodiment, the enriched nucleic acids represent 90% or more of the number of nucleic acid inserts in the population of recombinant backbone molecules.
"Recombinant" polypeptides or proteins refer to polypeptides or proteins produced by recombinant DNA techniques; i.e., produced from cells transformed by an exogenous DNA construct encoding the desired polypeptide or protein.
"Synthetic" polypeptides or protein are those prepared by chemical synthesis.
Solid-phase chemical peptide synthesis methods can also be used to synthesize the polypeptide or fragments of the invention. Such method have been known in the art since the early 1960's (Mernfield, R. B., J. Am. Chem. Soc., 85:2149-2154, 1963) (See also Stewart, J. M. and Young, J. D., Solid Phase Peptide Synthesis, 2 ed., Pierce Chemical Co., Rockford, Ill., pp. 11-12)) and have recently been employed in commercially available laboratory peptide design and synthesis kits (Cambridge Research Biochemicals). Such commercially available laboratory kits have generally utilized the teachings of H. M. Geysen et al, Proc. Natl. Acad. Sci., USA, 81:3998 (1984) and provide for synthesizing peptides upon the tips of a multitude of "rods" or "pins" all of which are connected to a single plate. When such a system is utilized, a plate of rods or pins is inverted and inserted into a second plate of corresponding wells or reservoirs, which contain solutions for attaching or anchoring an appropriate amino acid to the pin's or rod's tips. By repeating such a process step, i.e., inverting and inserting the rod's and pin°s tips into appropriate solutions, amino acids are built 1 S into desired peptides. In addition, a number of available FMOC peptide synthesis systems are available. For example, assembly of a polypeptide or fragment can be carried out on a solid support using an Applied Biosystems, Inc. Model 431A
automated peptide synthesizer. Such equipment provides ready access to the peptides of the invention, either by direct synthesis or by synthesis of a series of fragments that can be coupled using other known techniques.
A promoter sequence is "operably linked to" a coding sequence when RNA
polymerase which initiates transcription at the promoter will transcribe the coding sequence into mRNA.
"Plasmids" are designated by a lower case p preceded andlor followed by capital letters and/or numbers. The starting plasmids herein are either commercially available, publicly available on an unrestricted basis, or can be constructed from available plasmids in accord with published procedures. In addition, equivalent plasmids to those described herein are known in the art and will be apparent to the ordinarily skilled artisan.

"Digestion" of DNA refers to catalytic cleavage of the DNA with a restriction enzyme that acts only at certain sequences in the DNA. The various restriction enzymes used herein are commercially available and their reaction conditions, cofactors and other requirements were used as would be known to the ordinarily S skilled artisan. For analytical purposes, typically 1 ug of plasmid or DNA
fragment is used with about 2 units of enzyme in about 20 u1 of buffer solution. For the purpose of isolating DNA fragments for plasmid construction, typically S to 50 ug of DNA are digested with 20 to 250 units of enzyme in a larger volume. Appropriate buffers and substrate amounts for particular restriction enzymes are specified by the manufacturer. Incubation times of about 1 hour at 37 ° C are ordinarily used, but may vary in accordance with the supplier's instructions. After digestion the gel electrapharesis may be performed to isolate the desired fragment.
"Oligonucleotide" refers to either a single stranded polydeoxynucleotide or two complementary polydeoxynucleotide strands which may be chemically 1 S synthesized. Such synthetic oligonucleotides have no 5' phosphate and thus will not ligate to another oligonucleotide without adding a phosphate with an ATP in the presence of a kinase. A synthetic oligonucleotide will ligate to a fragment that has not been dephosphorylated.
The phrase "substantially identical" in the context of two nucleic acids or polypeptides, refers to two or more sequences that have at least 50%, 60%, 70%, 80%, and in some aspects 90-9S% nucleotide or amino acid residue identity, when compared and aligned for maximum correspondence, as measured using one of the known sequence comparison algorithms or by visual inspection. Typically, the substantial identity exists over a region of at least about 100 residues, and most commonly the sequences are substantially identical over at least about 150-200 residues. In some embodiments, the sequences are substantially identical over the entire length of the coding regions.
Additionally a "substantially identical" amino acid sequence is a sequence that differs from a reference sequence by one or more conservative or non-conservative amino acid substitutions, deletions, or insertions, particularly when such a substitution occurs at a site that is not the active site of the molecule, and provided that the polypeptide essentially retains its functional properties. A conservative amino acid substitution, for example, substitutes one amino acid for another of the same class (e.g., substitution of one hydrophobic amino acid, such as isoleucin, valine, leucine, or methionine, for another, or substitution of one polar amino acid for another, such as substitution of arginine for lysine, glutamic acid for aspartic acid or glutamine for asparagine). One or more amino acids can be deleted, for example, from a polymerise polypeptide, resulting in modification of the structure of the polypeptide, without significantly altering its biological activity. For example, amino- or carboxyl-I O terminal amino acids that are not required for polymerise biological activity can be removed.
Polymerise polypeptide sequences of the invention, including those modified as above described, can be assayed for polymerise biological activity by any number of methods, including polymerizing DNA (e.g., the speed and proofreading accuracy of polymerization). For example an assay for the proofreading accuracy of the invention polymerise can include a comparison of the sequence of a DNA
polymerized by the invention polymerise with a known sequence for accuracy, and the like.
Polymerise polypeptides included in the invention may have the amino acid sequence of the of polymerise shown in Figure 1B (SEQ ID N0:2) or 50% homology with SEQ 113 NO: 2, 4, 6, 8, 10, 12, 14, 16 wherein the polymerise retains polymerise activity at extreme high temperature, such as temperatures of about 90°
C to 113° C, from about 95° C to 113° C, from about 100°C to 107° C, or from about I00° C to 105° C. Preferably, the polymerise is active at such temperatures for one or more hours, for two or more hours and preferably for four or more hours. Figure 11 shows a graph indicating thermostability of SEQ ID N0:16 at 85C, 90C, and 95C over a 4 hour period of time.
"Fragments" as used herein are a portion of a naturally occurring protein which can exist in at least two different conformations. Fragments can have the same or substantially the same amino acid sequence as the naturally occurnng protein.

"Substantially the same" means that an amino acid sequence is largely, but not entirely, the same, but retains at least one functional activity of the sequence to which it is related. in general two amino acid sequences are "substantially the same" or "substantially homologous" if they are at least about 85% identical. Fragments which 5 have different three dimensional structures as the naturally occurring protein are also included. An example of this, is a "pro-form" molecule, such as a low activity proprotein that can be modified by cleavage to produce a mature polymerase with significantly higher activity.
"Hybridization" refers to the process by which a nucleic acid strand joins with 10 a complementary strand through base pairing. Hybridization reactions can be sensitive and selective so that a particular sequence of interest can be identified even in samples in which it is present at low concentrations. Suitably stringent conditions can be defined by, for example, the concentrations of salt or formamide in the prehybridization and hybridization solutions, or by the hybridization temperature, and 15 are well known in the art. In particular, stringency can be increased by reducing the concentration of salt, increasing the concentration of formamide, or raising the hybridization temperature.
For example, hybridization under high stringency conditions could occur in about 50% formamide at about 37°C to 42°C. Hybridization could occur under 20 reduced stringency conditions in about 35% to 25% formamide at about 30°C to 35°C. In particular, hybridization could occur under high stringency conditions at 42°C in 50% formamide, 5X SSPE, 0.3% SDS, and 200 ng/ml sheared and denatured salmon sperm DNA. Hybridization could occur under reduced stringency conditions as described above, but in 35% formamide at a reduced temperature of 35°C. The temperature range corresponding to a particular level of stringency can be further narrowed by calculating the purine to pyrimidine ratio of the nucleic acid of interest and adjusting the temperature accordingly. Variations on the above ranges and conditions are well known in the art.
The term "variant" refers to polynucleotides or polypeptides of the invention modified at one or more base pairs, codons, introns, exons, or amino acid residues (respectively) yet still retain the biological activity of a polymerase of the invention.
Variants can be produced by any number of means included methods such as, for example, error-prone PCR, shuffling, oligonucleotide-directed mutagenesis, assembly PCR, sexual PCR mutagenesis, in vivo mutagenesis, cassette mutagenesis, recursive ensemble mutagenesis, exponential ensemble mutagenesis, site-specific mutagenesis, ligation reassembly, GSSM and any combination thereof.
The term "template" as used herein refers to a double-stranded or single-stranded DNA molecule which is to be amplified, synthesized or sequenced. In the case of a double-stranded DNA molecule, denaturation of its strands to form a first and a second strand is performed before these molecules may be amplified, synthesized or sequenced. A primer, complementary to a portion of a DNA
template is hybridized under appropriate conditions and the DNA polymerase of the invention may then synthesize a DNA molecule complementary to said template or a portion thereof. The newly synthesized DNA molecule, according to the invention, may be equal or shorter in length than the original DNA template. Mismatch incorporation during the synthesis or extension of the newly synthesized DNA molecule may result in one or a number of mismatched base pairs. Thus, the synthesized DNA
molecule need not be exactly complementary to the DNA template.
In a particular aspect, the invention polymerases are especially useful in well known DNA sequencing, DNA labeling, DNA amplification and cloning reactions and cDNA synthesis reactions. In a particular aspect, the invention polyrnerases are nondiscriminatory for dNTPs and ddNTPs and are therefore especially useful for DNA sequencing, DNA labeling, and DNA amplification reactions and cDNA
synthesis. As is well known, sequencing reactions (isothermal DNA sequencing and cycle sequencing of DNA) require the use of DNA polymerases. Dideoxy-mediated sequencing involves the use of a chain-termination technique which uses a specific polymer for extension by DNA polymerase, a base-specific chain terminator and the use of polyacrylamide gels to separate the newly synthesized chain-terminated DNA
molecules by size so that at least a part of the nucleotide sequence of the original DNA molecule can be determined. Specifically, a DNA molecule is sequenced by using four separate DNA sequence reactions, each of which contains different base-specific terminators. For example, the first reaction will contain a G-specific terminator, the second reaction will contain a T-specific terminator, the third reaction will contain an A-specific terminator, and a fourth reaction may contain a C-specific terminator. Preferred terminator nucleotides include dideoxyribonucleoside triphosphates (ddNTPs) such as ddATP, ddTTP, ddGTP, ddITP and ddCTP. Analogs of dideoxyribonucleoside triphosphates rnay also be used and arc well known in the art.
When sequencing a DNA molecule, ddNTPs lack a hydroxyl residue at the 3°
position of the deoxyribose base and thus, although they can be incorporated by DNA
polymerises into the growing DNA chain, the absence of the 3'-hydroxy residue prevents formation of the next phosphodiester bond resulting in termination of extension of the DNA molecule. Thus, when a small amount of one ddNTP is included in a sequencing reaction mixture, there is competition between extension of the chain and base-specific termination resulting in a population of synthesized DNA
molecules which are shorter in length than the DNA template to be sequenced.
By using four different ddNTPs in four separate enzymatic reactions, populations of the synthesized DNA molecules can be separated by size so that at least a part of the nucleotide sequence of the original DNA molecule can be determined. DNA
sequencing by dideoxy-nucleotides is well known and is described by Sambrook et al., In: Molecular Cloning, a Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989). As will be readily recognized, the DNA
polymerises of the present invention may be used in such sequencing reactions.
As is well known, detectably labeled nucleotides are typically included in sequencing reactions. Any number of labeled nucleotides can be used in sequencing (or labeling) reactions, including, but not limited to, radioactive isotopes, fluorescent labels, chemiluminescent labels, bioluminescent labels, and enzyme labels. It has been discovered that the wild type and mutant DNA polymerise of the present invention may be useful for incorporating aS nucleotides during sequencing (or labeling) reactions. For example, [a35S]dATP, a commonly used detectably labeled nucleotide in sequencing reactions, may be incorporated more efficiently with an invention DNA
polymerise, than with Taq DNA polyrnerase. Thus, an enzyme of the present invention is particularly suited for sequencing or labeling DNA molecules with [~3sS]dNTPs.
Polymerise chain reaction (PCR), a well known DNA amplification technique, is a process by which DNA polymerise and deoxyribonucleoside triphosphates are used to amplify a target DNA template. In such PCR
reactions, two primers, one complementary to the 3' termini (or near the 3'-termini) of the first strand of the DNA molecule to be amplified, and a second primer complementary to the 3' termini (or near the 3'-termini) of the second strand of the DNA molecule to be amplified, are hybridized to their respective DNA strands. After hybridization, DNA
polymerise, in the presence of deoxyribonucleoside triphosphates, allows the synthesis of a third DNA molecule complementary to the first strand and a fourth DNA molecule complementary to the second strand of the DNA molecule to be amplified. This synthesis results in two double stranded DNA molecules. Such double stranded DNA molecules may then be used as DNA templates for synthesis of additional DNA molecules by providing a DNA polymerise, primers, and deoxyribonucleoside triphosphates. As is well known, the additional synthesis is carried out by "cycling" the original reaction (with excess primers and deoxyribonucleoside triphosphates) allowing multiple denaturing and synthesis steps.
Typically, denaturing of double stranded DNA molecules to form single stranded DNA templates is accomplished by high temperatures. The wild type and variant DNA polymerises of the present invention are heat stable DNA polymerises, ind thus will survive such thermal cycling during DNA amplification reactions.
Thus, the wild type and variant DNA polymerises of the invention are ideally suited for PCR
reactions, particularly where high temperatures are used to denature the DNA
molecules during amplification.
The DNA polymerise and mutants of the present invention may also be used to prepare cDNA from mRNA templates. See, U.S. Pat. Nos. 5,405,776 and 5,244,797, the disclosures of which are incorporated by reference herein.
Thus, the invention also relates to a method of preparing cDNA from mRNA, including (a) contacting mRNA with an oligo(dT) primer or other complementary primer to form a hybrid, and (b) contacting the hybrid formed in step (a) with the DNA
polymerise or variant thereof of the invention and the four dNTPs, whereby a cDNA-1ZNA
hybrid is obtained.
Tf the reaction mixture is step (b) further comprises an appropriate oligonucleotide which is complementary to the cDNA being produced, it is also possible to obtain dsDNA following first strand synthesis. Thus, the invention is also directed to a method of preparing dsDNA with a DNA polymerise or variant thereof of the present invention.
Enzymes are highly selective catalysts. Their hallmark is the ability to catalyze reactions with exquisite stereo-, regio-, and chemo- selectivities that are unparalleled in conventional synthetic chemistry. Moreover, enzymes are remarkably versatile.
They can be tailored to function in organic solvents, operate at extreme pHs (for example, high pHs and low pHs) extreme temperatures (for example, high temperatures and low temperatures), extreme salinity levels (for example, high salinity and Iow salinity), and catalyze reactions with compounds that are structurally unrelated to their natural, physiological substrates.
Enzymes are reactive toward a wide range of natural and unnatural substrates, thus enabling the modification of virtually any organic lead compound.
Moreover, unlike traditional chemical catalysts, enzymes are highly enantio- and regio-selective.
The high degree of functional group specificity exhibited by enzymes enables one to keep track of each reaction in a synthetic sequence leading to a new active compound.
Enzymes are also capable of catalyzing many diverse reactions unrelated to their physiological function in nature. For example, peroxidases catalyze the oxidation of phenols by hydrogen peroxide. Peroxidases can also catalyze hydroxylation reactions that are not related to the native function of the enzyme. Other examples are proteases which catalyze the breakdown of polypeptides. In organic solution some proteases can also acylate sugars, a function unrelated to the native function of these enzymes.

The present invention exploits the unique catalytic properties of enzymes.
Whereas the use of biocatalysts (i.e., purified or crude enzymes, non-living or living cells) in chemical transformations normally requires the identification of a particular biocatalyst that reacts with a specific starting compound, the present invention uses selected biocatalysts and reaction conditions that are specific for functional groups that are present in many starting compounds.
Each biocatalyst is specific for one functional group, or several related functional groups, and can react with many starting compounds containing this functional group.
I O The biocatalytic reactions produce a population of derivatives from a single starting compound. These derivatives can be subjected to another round of biocatalytic reactions to produce a second population of derivative compounds.
Thousands of variations of the original compound can be produced with each iteration of biocatalytic derivatization.
I5 Enzymes react at specific sites of a starting compound without affecting the rest of the molecule, a process which is very difficult to achieve using traditional chemical methods. This high degree of biocatalytic specificity provides the means to identify a single active compound within the library. The library is characterized by the series of biocatalytic reactions used to produce it, a so-called "biosynthetic 20 history". Screening the library for biological activities and tracing the biosynthetic history identifies the specific reaction sequence producing the active compound. The reaction sequence is repeated and the structure of the synthesized compound determined. This mode of identification, unlike other synthesis and screening approaches, does not require immobilization technologies, and compounds can be 25 synthesized and tested free in solution using virtually any type of screening assay. It is important to note, that the high degree of specificity of enzyme reactions on functional groups allows for the "tracking" of specific enzymatic reactions that make up the biocatalytically produced library.

Many of the procedural steps are performed using robotic automation enabling the execution of many thousands of biocatalytic reactions and screening assays per day as well as ensuring a high level of accuracy and reproducibility. As a result, a library of derivative compounds can be produced in a matter of weeks which would take years to produce using current chemical methods. (For further teachings on modification of molecules, including small molecules, see PCT/CJS94/0917~, herein incorporated by reference in its entirety).
In one aspect, the present invention provides a non-stochastic method termed synthetic gene reassembly, that is somewhat related to stochastic shuffling, save that the nucleic acid building blocks are not shuffled or concatenated or chimerized randomly, but rather are assembled non-stochastically.
The synthetic gene reassembly method does not depend on the presence of a high level of homology between polynucleotides to be shuffled. The invention can be used to non-stochastically generate libraries (or sets) of progeny molecules comprised of over lOloo different chimeras. Conceivably, synthetic gene reassembly can even be used to generate libraries comprised of over 101000 different progeny chimeras.
Thus, in one aspect, the invention provides a non-stochastic method of producing a set of finalized chimeric nucleic acid molecules having an overall assembly order that is chosen by design, which method is comprised of the steps of generating by design a plurality of specific nucleic acid building blocks having serviceable mutually compatible ligatable ends, and assembling these nucleic acid building blocks, such that a designed overall assembly order is achieved.
The mutually compatible ligatable ends of the nucleic acid building blocks to be assembled are considered to be "serviceable" for this type of ordered assembly if they enable the building blocks to be coupled in predetermined orders. Thus, in one aspect, the overall assembly order in which the nucleic acid building blocks can be coupled is specified by the design of the ligatable ends and, if more than one assembly step is to be used, then the overall assembly order in which the nucleic acid building blocks can be coupled is also specified by the sequential order of the assembly step(s).

In a one embodiment of the invention, the annealed building pieces are treated with an enzyme, such as a ligase (e.g., T4 DNA ligase) to achieve covalent bonding of the building pieces.
In a another embodiment, the design of nucleic acid building blocks is obtained upon analysis of the sequences of a set of progenitor nucleic acid templates that serve as a basis for producing a progeny set of finalized chimeric nucleic acid molecules. These progenitor nucleic acid templates thus serve as a source of sequence information that aids in the design of the nucleic acid building blocks that are to be mutagenized, i.e. chimerized or shuffled.
In one exemplification, the invention provides for the chimerization of a family of related genes and their encoded family of related polymerases. The polymerases of the present invention can be mutagenized in accordance with the methods described herein.
Thus according to one aspect of the invention, the sequences of a plurality of progenitor nucleic acid templates (e.g., polynucleotides of SEQ II7 NO: 1, 3, S, 7, 9, 11, 13,15) are aligned in order to select one or more demarcation points, which demarcation points can be located at an area of homology. The demarcation points can be used to delineate the boundaries of nucleic acid building blocks to be generated. Thus, the demarcation points identified and selected in the progenitor molecules serve as potential chimerization points in the assembly of the progeny molecules.
Typically a serviceable demarcation point is an area of homology (comprised of at least one homologous nucleotide base) shared by at least two progenitor templates, but the demarcation point can be an area of homology that is shared by at least half of the progenitor templates, at least two thirds of the progenitor templates, at least three fourths of the progenitor templates, and preferably at almost all of the progenitor templates. Even more preferably still a serviceable demarcation point is an area of homology that is shared by all of the progenitor templates.

In a one embodiment, the ligation reassembly process is performed exhaustively in order to generate an exhaustive library. In other words, all possible ordered combinations of the nucleic acid building blocks are represented in the set of finalized chimeric nucleic acid molecules. At the same time, the assembly order (i.e.
the order of assembly of each building block in the 5' to 3 sequence of each finalized chimeric nucleic acid) in each combination is by design (or non-stochastic).
Because of the non-stochastic nature of the method, the possibility of unwanted side products is greatly reduced.
In another embodiment, the method provides that, the ligation reassembly process is performed systematically, for example in order to generate a systematically compartmentalized library, with compartments that can be screened systematically, e.g., one by one. In other words the invention provides that, through the selective and judicious use of specific nucleic acid building blocks, coupled with the selective and judicious use of sequentially stepped assembly reactions, an experimental design can be achieved where specific sets of progeny products are made in each of several reaction vessels. This allows a systematic examination and screening procedure to be performed. Thus, it allows a potentially very large number of progeny molecules to be examined systematically in smaller groups.
Because of its ability to perform chimerizations in a manner that is highly flexible yet exhaustive and systematic as well, particularly when there is a low level of homology among the progenitor molecules, the instant invention provides for the generation of a library (or set) comprised of a large number of progeny molecules.
Because of the non-stochastic nature of the instant ligation reassembly invention, the progeny molecules generated preferably comprise a library of finalized chimeric nucleic acid molecules having an overall assembly order that is chosen by design. In a particularly embodiment, such a generated library is comprised of greater than 103 to greater than l Olooo different progeny molecular species.
In one aspect, a set of finalized chimeric nucleic acid molecules, produced as described is comprised of a polynucleotide encoding a polypeptide. According to one embodiment, this polynucleotide is a gene, which may be a man-made gene.

According to another embodiment, this polynucleotide is a gene pathway, which may be a man-made gene pathway. The invention provides that one or more man-made genes generated by the invention may be incorporated into a man-made gene pathway, such as pathway operable in a eukaryotic organism (including a plant).
In another exemplification, the synthetic nature of the step in which the building blocks are generated allows the design and introduction of nucleotides (e.g., one or more nucleotides, which may be, for example, codons or introns or regulatory sequences) that can later be optionally removed in an in vitro process (e.g., by mutagenesis) or in an in vivo process (e.g., by utilizing the gene splicing ability of a host organism). It is appreciated that in many instances the introduction of these nucleotides may also be desirable for many other reasons in addition to the potential benefit of creating a serviceable demarcation point.
Thus, according to another embodiment, the invention provides that a nucleic acid building block can be used to introduce an intron. Thus, the invention provides that functional introns rnay be introduced into a man-made gene of the invention. The invention also provides that functional introns may be introduced into a man-made gene pathway of the, invention. Accordingly, the invention provides for the generation of a chimeric polynucleotide that is a man-made gene containing one (or more) artificially introduced intron(s).
Accordingly, the invention also provides for the generation of a chimeric polynucleotide that is a man-made gene pathway containing one (or more) artificially introduced intron(s). Preferably, the artificially introduced intron(s) are functional in one or more host cells for gene splicing much in the way that naturally-occurring introns serve functionally in gene splicing. The invention provides a process of producing man-made intron-containing polynucleotides to be introduced into host organisms for recombination and/or splicing.
A man-made genes produced using the invention can also serve as a substrate for recombination with another nucleic acid. Likewise, a man-made gene pathway produced using the invention can also serve as a substrate for recombination with another nucleic acid. In a preferred instance, the recombination is facilitated by, or occurs at, areas of homology between the man-made intron-containing gene and a nucleic acid with serves as a recombination partner. In a particularly preferred instance, the recombination partner may also be a nucleic acid generated by the 5 invention, including a man-made gene or a man-made gene pathway.
Recombination may be facilitated by or may occur at areas of homology that exist at the one (or more) artificially introduced intron(s) in the man-made gene.
The synthetic ligation reassembly method of the invention utilizes a plurality of nucleic acid building blocks, each of which preferably has two ligatable ends. The 10 two ligatable ends on each nucleic acid building block may be two blunt ends (i.e.
each having an overhang of zero nucleotides), or preferably one blunt end and one overhang, or more preferably still two overhangs.
A serviceable overhang for this purpose may be a 3' overhang or a S' overhang. Thus, a nucleic acid building block may have a 3' overhang or 15 alternatively a 5' overhang or alternatively two 3' overhangs or alternatively two 5' overhangs. The overall order in which the nucleic acid building blocks are assembled to form a finalized chimeric nucleic acid molecule is determined by purposeful experimental design and is not random.
According to one preferred embodiment, a nucleic acid building block is 20 generated by chemical synthesis of two single-stranded nucleic acids (also referred to as single-stranded oligos) and contacting them so as to allow them to anneal to form a double-stranded nucleic acid building block.
A double-stranded nucleic acid building block can be of variable size. The sizes of these building blocks can be small or large. Preferred sizes for building block 25 range from 1 base pair (not including any overhangs) to 100,000 base pairs (not including any overhangs). Other preferred size ranges are also provided, which have lower limits of from 1 by to 10,000 by (including every integer value in between), and upper limits of from 2 by to 100, 000 by (including every integer value in between).

Many methods exist by which a double-stranded nucleic acid building block can be generated that is serviceable for the invention; and these are known in the art and can be readily performed by the skilled artisan.
According to one embodiment, a double-stranded nucleic acid building block is generated by first generating two single stranded nucleic acids and allowing them to anneal to form a double-stranded nucleic acid building block. The two strands of a double-stranded nucleic acid building block may be complementary at every nucleotide apart from any that form an overhang; thus containing no mismatches, apart from any overhang(s). According to another embodiment, the two strands of a double-stranded nucleic acid building block are complementary at fewer than every nucleotide apart from any that form an overhang. Thus, according to this embodiment, a double-stranded nucleic acid building block can be used to introduce codon degeneracy. Preferably the codon degeneracy is introduced using the site-saturation mutagenesis described herein, using one or more N,N,Cp/T or N,N,C/T
cassettes or alternatively using one or more N,N,N cassettes.
The in vivo recombination method of the invention can be performed blindly on a pool of unknown hybrids or alleles of a specific polynucleatide or sequence.
However, it is not necessary to know the actual DNA or RNA sequence of the specifac polynucleotide.
The approach of using recombination within a mixed population of genes can be useful for the generation of any useful proteins, for example, interleukin I, antibodies, tPA and growth hormone. This approach may be used to generate proteins having altered specificity or activity. The approach may also be useful for the generation of hybrid nucleic acid sequences, for example, promoter regions, introns, exons, enhancer sequences, 31 untranslated regions or 51 untranslated regions of genes. Thus this approach may be used to generate genes having increased rates of expression. This approach may also be useful in the study of repetitive DNA
sequences. Finally, this approach may be useful to mutate ribozymes or aptamers.

In one aspect the invention described herein is directed to the use of repeated cycles of reductive reassortment, recombination and selection which allow for the directed molecular evolution of highly complex linear sequences, such as DNA, RNA
or proteins thorough recombination.
S he vivo shuffling of molecules is useful in providing variants and can be performed utilizing the natural property of cells to recombine multimers.
while recombination in vivo has provided the major natural route to molecular diversity, genetic recombination remains a relatively complex process that involves 1) the recognition of homologies; 2) strand cleavage, strand invasion, and metabolic steps leading to the production of recombinant chiasma; and finally 3) the resolution of chiasma into discrete recombined molecules. The formation of the chiasma requires the recognition of homologous sequences.
In another embodiment, the invention includes a method for producing a hybrid polynucleotide from at least a first polynucleotide and a second polynucleotide. The invention can be used to produce a hybrid polynucleotide by introducing at least a first polynucleotide and a second polynucleotide which share at least one region of partial sequence homology into a suitable host cell. The regions of partial sequence homology promote processes which result in sequence reorganization producing a hybrid polynucleotide. The term "hybrid polynucleotide", as used herein, is any nucleotide sequence which results from the method of the present invention and contains sequence from at least two original polynucleotide sequences. Such hybrid polynucleotides can result from intermolecular recombination events which promote sequence integration between DNA molecules. In addition, such hybrid polynucleotides can result from intramolecular reductive reassortment processes 2S which utilize repeated sequences to alter a nucleotide sequence within a DNA
molecule.
The invention provides a means for generating hybrid polynucleotides which may encode biologically active hybrid polypeptides {e.g., hybrid polymerases).
In one aspect, the original polynucleotides encode biologically active polypeptides. The method of the invention produces new hybrid polypeptides by utilizing cellular processes which integrate the sequence of the original polynucleotides such that the resulting hybrid polynucleotide encodes a polypeptide demonstrating activities derived from the original biologically active polypeptides. Fox example, the original polynucleotides may encode a particular polymerase from different microorganisms.
A polymerase encoded by a first polynucleotide from one organism or variant may, for example; function effectively under a particular environmental condition, e.g. high salinity. A polymerise encoded by a second polynucleotide from a different organism or variant may function effectively under a different environmental condition, such as extremely high temperatures. A hybrid polynucleotide containing sequences from the first and second original polynucleotides may encode an enzyme which exhibits characteristics of both enzymes encoded by the original polynucleotides. Thus, the enzyme encoded by the hybrid polynucleotide may function effectively under environmental conditions shared by each of the enzymes encoded by the first and second polynucleotides, e.g., high salinity and extreme temperatures, especially polymerise activity at extreme high temperature , such as a temperature from about 95° C to 113°C. Some modified polynucleotides may achieve polymerise activity at temperatures up to 150° C, which is presently considered to be the theoretical limit at which life forms could prevent dissolution of the chemical bonds that maintain the integrity of DNA and other essential molecules..
Enzymes encoded by the polynucleotides of the invention include, but are not limited to, hydrolases, such as polymerises. A hybrid polypeptide resulting from the method of the invention may exhibit specialized enzyme activity not displayed in the original enzymes. For example, following recombination and/or reductive reassortment of polynucleotides encoding polymerise activities, the resulting hybrid polypeptide encoded by a hybrid polynucleotide can be screened for specialized polymerise activities obtained from each of the original enzymes, i. e.
whether the polymerise has or is free of a 3'-S' exonuclease activity, the DNA extension rate of the polymerise, the % residual activity at altered pH as compared to the wild-type polymerise, and the optimum temperature and upper temperature limit of polymerise activity. Thus, for example, the polymerise may be screened to ascertain those chemical functionalities which distinguish the hybrid polymerise from the original polymerase, for example, the upper limit of thermal stability, the duration of thermal stability at the upper temperature limit, or the pI~ or salt concentration at which the hybrid polypeptide functions. Additional desirable polymerase characteristics that may be screened for include utility of the hybrid polymerase for PCR of template molecules greater than 20 kb in length or containing greater than 90%
guanidine-cytosine (GC) content.
Sources of the original polynucleotides may be isolated from individual organisms ("isolates"), collections of organisms that have been grown in defined media ("enrichment cultures"), or, uncultivated organisms ("environmental samples").
The use of a culture-independent approach to derive polynucleotides encoding novel bioactivities from environmental samples is most preferable since it allows one to access untapped resources of biodiversity.
"Environmental libraries" are generated from environmental samples and represent the collective genomes of naturally occurring organisms archived in cloning vectors that can be propagated in suitable prokaryotic hosts. Because the cloned DNA
is initially extracted directly from environmental samples, the libraries are not limited to the small fraction of prokaryotes that can be grown in pure culture.
Additionally, polymerases that can be produced in a prokaryotic host can be readily scaled up for commercial production. A normalization of the environmental DNA present in these samples could allow more equal representation of the DNA from all of the species present in the original sample. This can dramatically increase the efficiency of finding interesting genes from minor constituents of the sample which may be under-represented by several orders of magnitude compared to the dominant species.
For example, gene libraries generated from one or more uncultivated microorganisms are screened for an activity of interest. Potential pathways encoding bioactive molecules of interest are first captured in prokaryotic cells in the form of gene expression libraries. Polynucleotides encoding activities of interest are isolated from such libraries and introduced into a host cell. The host cell is grown under conditions which promote recombination and/or reductive reassortment creating potentially active biomolecules with novel or enhanced activities.

The microorganism from which the invention polynucleotide having SEQ ID
NO: 1, 3, 5, 7, 9, 11, 13, 15 is derived is Pyrolobus fumaria. Additional polynucleotides may be prepared from prokaryotic microorganisms, such as Eubacteria and Archaebacteria, and lower eukaryotic microorganisms such as fian.gi, S some algae and protozoa. Polynucleotides may be isolated from environmental samples, in which case the nucleic acid may be recovered without culturing of an organism or recovered from one or more cultured organisms. In order to have polymerase activity in the range above 90°C up to 150°C (e.g., up to 113°C), such microorganisms are preferably hyperthermophiles that function at temperatures above 10 100° C in terrestrial hot springs and deep sea thermal vents. The polymerases produced by hyperthermophiles may have a lower temperature at which enzymatic activity fails. For example, Pyrolobus fumaria ceases to grow at a temperature below 90° C.
Polynucleotides selected and isolated as hereinabove described are introduced 15 into a suitable host cell. A suitable host cell is any cell which is capable of promoting recombination and/or reductive reassortment. The selected polynucleotides are preferably already in a vector which includes appropriate control sequences.
The host cell can be a higher eukaryotic cell, such as a mammalian cell, or a lower eukaryotic cell, such as a yeast cell, or preferably, the host cell can be a prokaryotic cell, such as 20 a bacterial cell. Introduction of the construct into the host cell can be effected by calcium phosphate transfection, DEAF-Dextran mediated transfection, or electroporation (Davis et al., 196).
As representative examples of appropriate hosts, there may be mentioned:
bacterial cells, such as E. coli, Streptomyces, Salmonella typhimurium; fungal cells, 25 such as yeast; insect cells such as Drosophila S2 and Spodoptera Sfl;
animal cells such as CHO, COS or Bowes melanoma; adenoviruses; and plant cells. The selection of an appropriate host is deemed to be within the scope of those skilled in the art from the teachings herein.
With particular references to various mammalian cell culture systems that can 30 be employed to express recombinant protein, examples of mammalian expression systems include the COS-7 lines of monkey kidney fibroblasts, described in "SV40-transformed simian cells support the replication of early SV40 mutants"
(Gluzman, 1981), and other cell lines capable of expressing a compatible vector, for example, the 0127, 3T3, CHO, HeLa and BHI~ cell lines. Mammalian expression vectors will comprise an origin of replication, a suitable promoter and enhancer, and also any necessary ribosome binding sites, polyadenylation site, splice donor and acceptor sites, transcriptional termination sequences, and 5' flanking nontranscribed sequences.
DNA sequences derived from the SV40 splice, and polyadenylation sites may be used to provide the required nontranscribed genetic elements.
Host cells containing the polynucleotides of interest can be cultured in conventional nutrient media modified as appropriate for activating promoters, selecting transformants or amplifying genes. The culture conditions, such as temperature, pH and the like, are those previously used with the host cell selected fox expression, and will be apparent to the ordinarily skilled artisan. The clones which are identified as having the specified polymerase activity at temperatures in the range from 70° C up to about 113° C may then be sequenced to identify the polynucleotide sequence encoding the polymerase.
Gene cluster DNA can be isolated from different organisms and ligated into vectors, particularly vectors containing expression regulatory sequences which can control and regulate the production of a detectable protein or protein-related array activity from the ligated gene clusters. Use of vectors which have an exceptionally large capacity for exogenous DNA introduction are particularly appropriate for use with such gene clusters and are described by way of example herein to include the f factor (or fertility factor) of E, coli. This f factor of E. coli is a plasmid which affect high-frequency transfer of itself during conjugation and is ideal to achieve and stably propagate large DNA fragments, such as gene clusters from mixed microbial samples.
A particularly preferred embodiment is to use cloning vectors, referred to as "fosmids" or bacterial artificial chromosome (BAC) vectors. These are derived from E. coli f factor which is able to stably integrate large segments of genomic DNA.
When integrated with DNA from a mixed uncultured environmental sample, this makes it possible to achieve large genomic fragments in the form of a stable "environmental DNA library." Another type of vector for use in the present invention is a cosmid vector. Cosmid vectors were originally designed to clone and propagate large segments of genomic DNA. Cloning into cosmid vectors is described in detail in "Molecular Cloning: A laboratory Manual" (Sambrook et al., 1989). ~nce ligated into an appropriate vector, two or more vectors containing different polyketide synthase gene clusters can be introduced into a suitable host cell. legions of partial sequence homology shared by the gene clusters will promote processes which result in sequence reorganization resulting in a hybrid gene cluster. The novel hybrid gene I O cluster can then be screened for polymerase activities not found in the original gene clusters, or altered from that found in the original gene clusters.
Therefore, in a one embodiment, the invention relates to a method for producing a biologically active hybrid polypeptide and screening such a polypeptide for enhanced activity by:
IS 1) introducing at least a first polynucleotide in operable linkage and a second polynucleotide in operable linkage, the at least first polynucleotide and second polynucleotide sharing at least one region of partial sequence homology, into a suitable host cell;
2) growing the host cell under conditions which promote sequence 20 reorganization resulting in a hybrid polynucleotide in operable linkage;
3) expressing a hybrid polypeptide encoded by the hybrid polynucleotide;
4) screening the hybrid polypeptide under conditions which promote identification of enhanced biological activity; and 25 5) isolating the a polynucleotide encoding the hybrid polypeptide.
Methods for screening for polymerase activities are known to those of skill in the art and are discussed throughout the present specification. Such methods may be employed when isolating the polypeptides and polynucleotides of the invention.

As representative examples of expression vectors which may be used there may be mentioned viral particles, baculovirus, phage, plasmids, phagemids, cosmids, fosmids, bacterial artificial chromosomes, viral DNA (e.g., vaccinia, adenovirus, foul pox virus, pseudorabies and derivatives of SV40), P1-based artificial chromosomes, yeast plasmids, yeast artificial chromosomes, and any other vectors specific for specific hosts of interest (such as bacillus, aspergillus and yeast). Thus, for example, the DNA may be included in any one of a variety of expression vectors for expressing a polypeptide. Such vectors include chromosomal, nonchromosomal and synthetic DNA sequences. Large numbers of suitable vectors are known to those of skill in the art, and are commercially available. The following vectors are provided by way of example; Bacterial: pQE vectors (Qiagen), pBluescript plasmids, pNgI vectors, (lambda-ZAP vectors (Stratagene); ptrc99a, pKI~223-3, pDR540, pRIT2T
(Pharmacia); Eukaryotic: pXTl, pSGS (Stratagene), pSVK3, pBPV, pMSG, pSVLSV40 (Pharmacia). giowever, any other plasmid or other vector may be used so long as they are replicable and viable in the host. Low copy number or high copy number vectors may be employed with the present invention.
The DNA sequence in the expression vector is operatively linked to an appropriate expression control sequences) (promoter) to direct RNA synthesis.
Particular named bacterial promoters include lael, lacZ, T3, T7, gpt, lambda 1R, 1L
and trp. Eukaryotic promoters include CIVIV immediate early, I~SV thymidine kinase, early and late SV40, LTRs from retrovirus, and mouse metallothionein-I.
Selection of the appropriate vector and promoter is well within the level of ordinary skill in the art.
The expression vector also contains a ribosome binding site for translation initiation and a transcription terminator. The vector may also include appropriate sequences for amplifying expression. Promoter regions can be selected from any desired gene using CAT (chloramphenicol transferase) vectors or other vectors with selectable markers.
In addition, the expression vectors preferably contain one or more selectable marker genes to provide a phenotypic trait for selection of transformed host cells such as dihydrofolate reductase or neomycin resistance for eukaryotic cell culture, or such as tetracycline or ampicillin resistance in E. coli.

Ih vivo reassortment is focused on "inter-molecular" processes collectively referred to as "recombination" which in bacteria, is generally viewed as a "RecA-dependent" phenomenon. The invention can rely on recombination processes of a host cell to recombine and re-assort sequences, or the cells' ability to mediate reductive processes to decrease the complexity of quasi-repeated sequences in the cell by deletion. This process of "reductive reassortment" occurs by an "infra-molecular", RecA-independent process.
Therefore, in another aspect of the invention, novel polynucleotides can be generated by the process of reductive reassortment. The method involves the generation of constructs containing consecutive sequences (original encoding sequences), their insertion into an appropriate vector, and their subsequent introduction into an appropriate host cell. The reassortment of the individual molecular identities occurs by combinatorial processes between the consecutive sequences in the construct possessing regions of homology, or between quasi-repeated units. The reassortment process recombines and/or reduces the complexity and extent of the repeated sequences, and results in the production of novel molecular species.
~larious treatments may be applied to enhance the rate of reassortment. These could include treatment with ultra-violet Light, or DNA damaging chemicals, and/or the use of host cell lines displaying enhanced levels of "genetic instability". Thus the reassortment process may involve homologous recombination or the natural property of quasi-repeated sequences to direct their own evolution.
Repeated or "quasi-repeated" sequences play a role in genetic instability. In the present invention, "quasi-repeats" are repeats that are not restricted to their original unit structure. Quasi-repeated units can be presented as an array of sequences in a construct; consecutive units of similar sequences. Once ligated, the junctions between the consecutive sequences become essentially invisible and the quasi-repetitive nature of the resulting construct is now continuous at the molecular level.
The deletion process the cell performs to reduce the complexity of the resulting construct operates between the quasi-repeated sequences. The quasi-repeated units provide a practically Limitless repertoire of templates upon which slippage events can occur. The constructs containing the quasi-repeats thus effectively provide sufficient molecular elasticity that deletion (and potentially insertion) events can occur virtually anywhere within the quasi-repetitive units.
When the quasi-repeated sequences are all ligated in the same orientation, for 5 instance head to tail or vice versa, the cell cannot distinguish individual units.
Consequently, the reductive process can occur throughout the sequences. In contrast, when for example, the units are presented head to head, rather than head to tail, the inversion delineates the endpoints of the adjacent unit so that deletion formation will favor the loss of discrete units, Thus, it is preferable with the present method that the 10 sequences are in the same orientation. Random orientation of quasi-repeated sequences will result in the loss of reassortment efficiency, while consistent orientation of the sequences will offer the highest efficiency. giowever, while having fewer of the contiguous sequences in the same orientation decreases the efficiency, it may still provide sufficient elasticity for the effective recovery of novel molecules.
15 Constructs can be made with the quasi-repeated sequences in the same orientation to allow higher efficiency.
Sequences can be assembled in a head to tail orientation using any of a variety of methods, including the following:
a) Primers that include a poly-A head and poly-T tail which when 20 made single-stranded would provide orientation can be utilized. This is accomplished by having the first few bases of the primers made from RNA
and hence easily removed RNAseFi.
b) Primers that include unique restriction cleavage sites can be utilized. Multiple sites, a battery of unique sequences, and repeated synthesis 25 and ligation steps would be required.
c) The inner few bases of the primer could be thiolated and an exonuclease used to produce properly tailed molecules.

The recovery of the re-assorted sequences relies on the identification of cloning vectors with a reduced RI. The re-assorted encoding sequences can then be recovered by amplification. The products are re-cloned and expressed. The recovery of cloning vectors with reduced RI can be effected by:
S 1) The use of vectors only stably maintained when the construct is reduced in complexity.
2) The physical recovery of shortened vectors by physical procedures. In this case, the cloning vector would be recovered using standard plasmid isolation procedures and size fractionated on either an agarose gel, or column with a low molecular weight cut off utilizing standard procedures.
3) The recovery of vectors containing interrupted genes which can be selected when insert size decreases.
4) The use of direct selection techniques with an expression vector and the appropriate selection.
Encoding sequences (for example, genes) from related organisms may demonstrate a high degree of homology and encode quite diverse protein products.
These types of sequences are particularly useful in the present invention as quasi-repeats. However, while the examples illustrated below demonstrate the reassortment of nearly identical original encoding sequences (quasi-repeats), this process is not limited to such nearly identical repeats.
The following example demonstrates a method of the invention. Encoding nucleic acid sequences (quasi-repeats) derived from three (3) unique species are described. Each sequence encodes a protein with a distinct set of properties.
Each of the sequences differs by a single or a few base pairs at a unique position in the sequence. The quasi-repeated sequences are separately or collectively amplified and ligated into random assemblies such that all possible permutations and combinations are available in the population of ligated molecules. The number of quasi-repeat units can be controlled by the assembly conditions. The average number of quasi-repeated units in a construct is defined as the repetitive index (1~.
Once formed, the constructs may, or may not be size fractionated on an agarose gel according to published protocols, inserted into a cloning vector, and transfected into an appropriate host cell. The cells are then propagated and "reductive reassortment" is effected. The rate of the reductive reassortment process may be stimulated by the introduction of DNA damage if desired. ~VVhether the reduction in RI is mediated by deletion formation between repeated sequences by an "intra-molecular" mechanism, or mediated by recombination-like events through "inter-molecular" mechanisms is immaterial. The end result is a reassortment of the molecules into all possible combinations.
Optionally, the method comprises the additional step of screening the library members of the shuffled pool to identify individual shuffled library members having the ability to bind or otherwise interact, or catalyze a particular amplification reaction (e.g., such as catalytic domain of a DNA polymerase) with a predetermined macromolecule, such as for example a proteinaceous receptor, an oligosaccharide, viron, or other predetermined compound or structure.
The polypeptides that are identified from such libraries can be used for therapeutic, diagnostic, research and related purposes (e.g., catalysts, solutes for increasing osmolarity of an aqueous solution, and the like), and/or can be subjected to one or more additional cycles of shuffling and/or selection.
In another aspect, it is envisioned that prior to or during recombination or reassortment, polynucleotides generated by the method of the invention can be subjected to agents or processes which promote the introduction of mutations into the original polynucleotides. The introduction of such mutations would increase the diversity of resulting hybrid polynucleotides and polypeptides encoded therefrom.
The agents or processes which promote mutagenesis can include, but are not limited to: (+)-CC-1065, or a synthetic analog such as (+)-CC-1065-(N3-Adenine, see Sun and Hurley, 1992); an N-acelylated or deacetylated 4'-fluro-4-aminobiphenyl adduct capable of inhibiting DNA synthesis (see, for example, van de Poll et al., 1992); or a N-acetylated or deacetylated 4-aminobiphenyl adduct capable of inhibiting DNA
synthesis (see also, van de Poll et al., 1992, pp. 751-758); trivalent chromium, a trivalent chromium salt, a polycyclic aromatic hydrocarbon ("PAI-I") DNA
adduct capable of inhibiting DNA replication, such as 7-bromomethyl-bent[a]anthracene ("BMA"), tris(2,3-dibromopropyl)phosphate ("iris-BP"), 1,2-dibromo-3-chloropropane ("DBCP"), 2-bromoacrolein (2BA), benzo[a]pyrene-7,8-dihydrodiol-9-10-epoxide ("BPDE"), a platinum(II) halogen salt, N-hydroxy-2-amino-3-methylimidazo[4,5 f J-quinoline ("N-hydroxy-IQ"), and N-hydroxy-2-amino-1-methyl-6-phenylimidazo[4,5 f]-pyridine ("N-hydroxy-PhIP"). Especially preferred means for slowing or halting PCR amplification consist of W light (+)-CC-1065 and (+)-CC-1065-(N3-Adenine). Particularly encompassed means are DNA adducts or polynucleotides comprising the DNA adducts from the polynucleotides or polynucleotides pool, which can be released or removed by a process including heating the solution comprising the polynucleotides prior to further processing.
In another aspect the invention is directed to a method of producing recombinant proteins having biological activity by treating a sample comprising double-stranded template polynucleotides encoding a wild-type protein under conditions according to the invention which provide for the production of hybrid or re-assorted polynucleotides.
The invention also provides for the use of proprietary colon primers (containing a degenerate N,N,N sequence) to introduce point mutations into a polynucleotide, so as to generate a set of progeny polypeptides in which a full range of single amino acid substitutions is represented at each amino acid position (gene site saturated mutagenesis (GSSM)). The oligos used are comprised contiguously of a first homologous sequence, a degenerate N,N,N sequence, and preferably but not necessarily a second homologous sequence. The downstream progeny translational products from the use of such oligos include all possible amino acid changes at each amino acid site along the polypeptide, because the degeneracy of the N,N,N
sequence includes colons for all 20 amino acids.

In one aspect, one such degenerate oligo (comprised of one degenerate N,N,N
cassette) is used for subjecting each original codon in a parental polynucleotide template to a full range of codon substitutions. In another aspect, at least two degenerate N,N,N cassettes are used - either in the same oligo or not, for subjecting at least two original codons in a parental polynucleotide template to a full range of codon substitutions. Thus, more than one N,N,N sequence can be contained in one oligo to introduce amino acid mutations at more than one site. This plurality of N,N,N sequences can be directly contiguous, or separated by one or more additional nucleotide sequence(s). In another aspect, oligos serviceable for introducing additions and deletions can be used either alone or in combination with the codons containing an N,N,N sequence, to introduce any combination or permutation of amino acid additions, deletions, and/or substitutions.
In a particular exemplification, it is possible to simultaneously mutagenize two or more contiguous amino acid positions using an oligo that contains contiguous N,N,N triplets, i. e, a degenerate (N,N,N)" sequence.
In another aspect, the present invention provides for the use of degenerate cassettes having less degeneracy than the N,N,N sequence. For example, it may be desirable in some instances to use (e.g. in an oligo) a degenerate triplet sequence comprised of only one N, where the N can be in the first second or third position of the triplet. Any other bases including any combinations and permutations thereof can be used in the remaining two positions of the triplet. Alternatively, it may be desirable in some instances to use (e.g., in an oligo) a degenerate N,N,N
triplet sequence, N,N,G/T, or an N,N, GlC triplet sequence.
It is appreciated, however, that the use of a degenerate triplet (such as N,N,GIT or an N,N, G/C triplet sequence) as disclosed in the instant invention is advantageous for several reasons. In one aspect, this invention provides a means to systematically and fairly easily generate the substitution of the full range of possible amino acids (for a total of 20 amino acids) into each and every amino acid position in a polypeptide. Thus, for a 100 amino acid polypeptide, the invention provides a way to systematically and fairly easily generate 2000 distinct species (i.e., 20 possible 4~5 amino acids per position times 100 amino acid positions). It is appreciated that there is provided, through the use of an oligo containing a degenerate N,N,G/T or an N,N, G/C triplet sequence, 32 individual sequences that code for 20 possible amino acids.
Thus, in a reaction vessel in which a parental polynucleotide sequence is subjected to saturation mutagenesis using one such oligo, there are generated 32 distinct progeny polynucleotides encoding 20 distinct polypeptides. In contrast, the use of a non-degenerate oligo in site-directed mutagenesis leads to only one progeny polypeptide product per reaction vessel.
This invention also provides for the use of nondegenerate oligos, which can optionally be used in combination with degenerate primers disclosed. It is appreciated that in some situations, it is advantageous to use nondegenerate oligos to generate specific point mutations in a working polynucleotide. This provides a means to generate specific silent point mutations, point mutations leading to corresponding amino acid changes, and point mutations that cause the generation of stop codons and 1 S the corresponding expression of polypeptide fragments.
Thus, in a preferred embodiment of this invention, each saturation mutagenesis reaction vessel contains polynucleotides encoding at least 20 progeny polypeptide molecules such that all 20 amino acids are represented at the one specific amino acid position corresponding to the codon position mutagenized in the parental polynucleotide. The 32-fold degenerate progeny polypeptides generated from each saturation mutagenesis reaction vessel can be subjected to clonal amplification (e.g., cloned into a suitable E. coli host using an expression vector) and subjected to expression screening. When an individual progeny polypeptide is identified by screening to display a favorable change in property (when compared to the parental polypeptide), it can be sequenced to identify the correspondingly favorable amino acid substitution contained therein.
It is appreciated that upon mutagenizing each and every amino acid position in a parental polypeptide using saturation mutagenesis as disclosed herein, favorable amino acid changes may be identified at more than one amino acid position. One or more new progeny molecules can be generated that contain a combination of all or part of these favorable amino acid substitutions. For example, if 2 specific favorable amino acid changes are identified in each of 3 amino acid positions in a polypeptide, the permutations include 3 possibilities at each position (no change from the original amino acid, and each of two favorable changes) and 3 positions. Thus, there are 3 x 3 x 3 or 27 total possibilities, including 7 that were previously examined - 6 single point mutations (i.e., 2 at each of three positions) and no change at any position.
In yet another aspect, site-saturation mutagenesis can be used together with shuffling, chimerization, recombination and other mutagenizing processes, along with screening. This invention provides for the use of any mutagenizing process(es), including saturation mutagenesis, in an iterative manner. In one exemplification, the iterative use of any mutagenizing processes) is used in combination with screening.
Thus, in a non-limiting exemplification, this invention provides for the use of saturation mutagenesis in combination with additional mutagenization processes, such as process where two or more related polynucleotides are introduced into a suitable host cell such that a hybrid polynucleotide is generated by recombination and reductive reassortment.
In addition to performing mutagenesis along the entire sequence of a gene, the instant invention provides that mutagenesis can be use to replace each of any number of bases in a polynucleotide sequence, wherein the number of bases to be mutagenized is preferably every integer from 15 to 100,000. Thus, instead of mutagenizing every position along a molecule, one can subject every or a discrete number of bases (preferably a subset totaling from 15 to 100,000) to mutagenesis.
Preferably, a separate nucleotide is used for mutagenizing each position or group of positions along a polynucleotide sequence. A group of 3 positions to be mutagenized may be a codon. The mutations are preferably introduced using a mutagenic primer, containing a heterologous cassette, also referred to as a mutagenic cassette.
Preferred cassettes can have from 1 to 500 bases. Each nucleotide position in such heterologous cassettes be N, A, C, G, T, A/C, A/G, A/T, C/G, C/T, G/T, C/G/T, A/G/T, A/C/T, A/C/G, or E, where E is any base that is not A, C, G, or T (E can be referred to as a designer oligo).

In a general sense, saturation mutagenesis is comprised of mutagenizing a complete set of mutagenic cassettes (wherein each cassette is preferably about bases in length) in defined polynucleotide sequence to be mutagenized (wherein the sequence to be mutagenized is preferably from about 15 to 100,000 bases in length).
Thus, a group of mutations (ranging from 1 to 100 mutations) is introduced into each cassette to be mutagenized. A grouping of mutations to be introduced into one cassette can be different or the same from a second grouping of mutations to be introduced into a second cassette during the application of one round of saturation mutagenesis. Such groupings are exemplified by deletions, additions, groupings of particular codons, and groupings of particular nucleotide cassettes.
Defined sequences to be mutagenized include a whole gene, pathway, cDNA, an entire open reading frame (ORF), and entire promoter, enhancer, repressorltransactivator, origin of replication, intron, operator, or any polynucleotide functional group. Generally, a "defined sequences" for this purpose may be any polynucleotide that a 15 base-polynucleotide sequence, and polynucleotide sequences of lengths between 15 bases and 15,000 bases (this invention specifically names every integer in between). Considerations in choosing groupings of codons include types of amino acids encoded by a degenerate mutagenic cassette.
In a particularly preferred exemplification a grouping of mutations that can be introduced into a mutagenic cassette, this invention specifically provides for degenerate codon substitutions (using degenerate oligos) that code for 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 1 S, 16, 17, 18, 19, and 20 amino acids at each position, and a library of polypeptides encoded thereby.
One aspect of the invention is an isolated nucleic acid comprising one of the sequences of 1, 3, 5, 7, 9, 11, 13, 15 and sequences substantially identical thereto, the sequences complementary thereto, or a fragment comprising at least 10,15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive bases of one of the sequences of a Group A nucleic acid sequence (or the sequences complementary thereto). The isolated, nucleic acids may comprise DNA, including cDNA, genomic DNA, and synthetic DNA. The DNA may be double-stranded or single-stranded, and if single stranded may be the coding strand or non-coding (anti-sense) strand.
Alternatively, the isolated nucleic acids may comprise IZNA.
As discussed in more detail below, the isolated nucleic acids of one of the SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 1S and sequences substantially identical thereto, S may be used to prepare one of the polypeptides of a Group B amino acid sequence, and sequences substantially identical thereto, or fragments comprising at least S, 10, 1S, 20, 2S, 30, 3S, 40, S0, 7S, 100, or 1S0 consecutive amino acids of one of the polypeptides of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16 and sequences substantially identical thereto. ' Accordingly, another aspect of the invention is an isolated nucleic acid which encodes one of the polypeptides of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16 and sequences substantially identical thereto, or fragments comprising at least 5,10,1 S, 20, 2S, 30, 3S, 40, S0, 7S, 100, or 1S0 consecutive amino acids of one of the polypeptides of the SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16. The coding sequences of 1 S these nucleic acids may be identical to one of the coding sequences of one of the nucleic acids of SEQ ID NO: 1, 3, S, 7, 9, 11, 13,15, or a fragment thereof or may be different coding sequences which encode one of the polypeptides of SEQ III NO:
2, 4, 6, 8, 10, 12, 14, 16, sequences substantially identical thereto, and fragments having at least S, 10, 1S, 20, 2S, 30, 3S, 40, S0, 7S, 100, or 1S0 consecutive amino acids of one of the polypeptides of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, as a result of the redundancy or degeneracy of the genetic code. The genetic code is well known to those of skill in the art and can be obtained, for example, on page 214 of B.
L,ewin, Genes VI, Oxford University Press, 1997, the disclosure of which is incorporated herein by reference.
2S The isolated nucleic acid which encodes one of the polypeptides of SEQ ID
NO: 2, 4, 6, 8, 10, 12, 14, 16, and sequences substantially identical thereto, rnay include, but is not limited to: only the coding sequence of one of SEQ ID NO:
1, 3, S, 7, 9, 11, 13,15, and sequences substantially identical thereto, and additional coding sequences, such as leader sequences or proprotein sequences and non-coding sequences, such as introns or non-coding sequences S' and/or 3' of the coding sequence. Thus, as used herein, the term "polynucleotide encoding a polypeptide"
encompasses a polynucleotide which includes only coding sequence for the polypeptide as well as a polynucleotide which includes additional coding and/or non-coding sequence.
Alternatively, the nucleic acid sequences of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13,15, and sequences substantially identical thereto, may be mutagenized using conventional techniques, such as site directed mutagenesis, or other techniques familiar to those skilled in the art, to introduce silent changes into the polynucleotides of SEQ ID NO: 1, 3, 5, 7, 9, I I, 13,15, and sequences substantially identical thereto.
As used herein, "silent changes" include, for example, changes which do not alter the amino acid sequence encoded by the polynucleotide. Such changes may be desirable in order to increase the level of the polypeptide produced by host cells containing a vector encoding the polypeptide by introducing codons or codon pairs which occur frequently in the host organism.
The invention also relates to polynucleotides which have nucleotide changes which result in amino acid substitutions, additions, deletions, fusions and truncations in the polypeptides of SEQ 117 NO: 2, 4, 6, 8, 10, 12, I4, 16, and sequences substantially identical thereto. Such nucleotide changes may be introduced using techniques such as site directed mutagenesis, random chemical mutagenesis, exonuclease III deletion, and other recombinant DNA techniques. Alternatively, such nucleotide changes may be naturally occurnng allelic variants which are isolated by identifying nucleic acids which specifically hybridize to probes comprising at least I0, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive bases of one of the sequences of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13,15, and sequences substantially identical thereto (or the sequences complementary thereto) under conditions of high, moderate, or Iow stringency as provided herein.
The isolated nucleic acids of SEQ m NO: I, 3, 5, 7, 9, l I, 13,15, and sequences substantially identical thereto, the sequences complementary thereto, or a fragment comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive bases of one of the sequences of SEQ m NO: 1, 3, 5, 7, 9, 11, 13,15, and sequences substantially identical thereto, or the sequences complementary thereto may also be used as probes to determine whether a biological sample, such as a soil sample, contains an organism having a nucleic acid sequence of the invention or an organism from which the nucleic acid was obtained. In such procedures, a biological sample potentially harboring the organism from which the nucleic acid was isolated is obtained and nucleic acids are obtained from the sample. The nucleic acids are contacted with the probe under conditions which permit the probe to specifically hybridize to any complementary sequences from which are present therein.
Where necessary, conditions which permit the probe to specifically hybridize 10 to complementary sequences may be determined by placing the probe in contact with complementary sequences from samples known to contain the complementary sequence as well as control sequences which do not contain the complementary sequence. Hybridization conditions, such as the salt concentration of the hybridization buffer, the formamide concentration of the hybridization buffer, or the 15 hybridization temperature, may be varied to identify conditions which allow the probe to hybridize specifically to complementary nucleic acids.
If the sample contains the organism from which the nucleic acid was isolated, specific hybridization of the probe is then detected. Hybridization may be detected by labeling the probe with a detectable agent such as a radioactive isotope, a fluorescent 20 dye or an enzyme capable of catalyzing the formation of a detectable product.
Many methods for using the labeled probes to detect the presence of complementary nucleic acids in a sample are familiar to those skilled in the art. These include Southern Blots, Northern Blots, colony hybridization procedures, and dot blots. Protocols for each of these procedures are provided in Ausubel et al.
Current 25 Protocols in Molecular Biology, John Wiley 503 Sons, Inc. 1997 and Sambrook et al., Molecular Cloning: A Laboratory Manual 2d Ed., Cold Spring Harbor Laboratory Press, 1959, the entire disclosures of which are incorporated herein by reference.
Alternatively, more than one probe (at least one of which is capable of specifically hybridizing to any complementary sequences which are present in the nucleic acid sample), may be used in an amplification reaction to determine whether the sample contains an organism containing a nucleic acid sequence of the invention (e.g., an organism from which the nucleic acid was isolated). Typically, the probes comprise oligonucleotides. In one embodiment, the amplification reaction may S comprise a PCR reaction. PCR protocols are described in Ausubel and Sambrook, supra. Alternatively, the amplification may comprise a ligase chain reaction, 35R, or strand displacement reaction. (See Barany, F., "The I,igase Chain Reaction in a PCR
World", PCR Methods and Applications 1:5-16, 1991; E. Fahy et al., "Self sustained Sequence Replication (35R): An Isothermal Transcription-based .Amplification System Alternative to PCR", PCR Methods and Applications 1:25-33, 1991; and Walker G.T. et al., "Strand Displacement Amplification-an Isothermal in vitro DNA
Amplification Technique", Nucleic Aeid Research 20:1691-1696,1992, the disclosures of which are incorporated herein by reference in their entireties). In such procedures, the nucleic acids in the sample are contacted with the probes, the amplification reaction is 1 S performed, and any resulting amplification product is detected. The amplification product may be detected by performing gel electrophoresis on the reaction products and staining the gel with an interculator such as ethidium bromide. Alternatively, one or more of the probes may be labeled with a radioactive isotope and the presence of a radioactive amplification product may be detected by autoradiography after gel electrophoresis.
Probes derived from sequences near the ends of the sequences of SEQ ~ NO: 1, 3, S, 7, 9,11, 13,15, and sequences substantially identical thereto, may also be used in chromosome walking procedures to identify clones containing genomic sequences located adjacent to the sequences of SEQ ID NO: 1, 3, S, 7, 9, 11, 13,15, and sequences 2S substantially identical thereto. Such methods allow the isolation of genes which encode additional proteins from the host organism.
The isolated nucleic acids of SEQ ID NO: 1, 3, S, 7, 9, 11, 13,15, and sequences substantially identical thereto, the sequences complementary thereto, or a fragment comprising at least 10,15, 20, 25, 30, 3S, 40, S0, 7S, 100, 150, 200, 300, 400, or 500 consecutive bases of one of the sequences of SEQ ID NO: 1, 3, S, 7, 9, 1 l, 13, and sequences substantially identical thereto, or the sequences complementary thereto may be used as probes to identify and isolate related nucleic acids. In some embodiments, the related nucleic acids may be cDNAs or genomic DNAs from organisms other than the one from which the nucleic acid was isolated. For example, the other organisms may be related organisms. In such procedures, a nucleic acid sample is contacted with the probe under conditions which permit the probe to specifically hybridize to related sequences. Hybridization of the probe to nucleic acids from the related organism is then detected using any of the methods described above.
In nucleic acid hybridization reactions, the conditions used to achieve a particular level of stringency will vary, depending on the nature of the nucleic acids being hybridized. For example, the length, degree of complementarity, nucleotide sequence composition (e.g., GC v. AT content), and nucleic acid type (e.g., I~NA v.
DNA) of the hybridizing regions of the nucleic acids can be considered in selecting hybridization conditions. An additional consideration is whether one of the nucleic acids is immobilized, for example, on a filter.
Hybridization may be carried out under conditions of low stringency, moderate stringency or high stringency. As an example of nucleic acid hybridization, a polymer membrane containing immobilized denatured nucleic acids is first prehybridized for 30 minutes at 45°C in a solution consisting of 0.91V1 NaCI, 50 mlVl NaH2PO4, pH 7.0, S.0 mM Na2EDTA, 0.5% SDS, lOX Denhardt's, and 0.5 mg/ml polyriboadenylic acid. Approximately 2 X 107 cpm (specific activity 4-9 X 1 O8 cpmlug) of 32P end-labeled oligonucleotide probe are then added to the solution.
After 12-16 hours of incubation, the membrane is washed for 30 minutes at room temperature in 1X SET (150 mM NaCI, 20 mM Tris hydrochloride, pH 7.8, 1 mM
NaaEDTA) containing 0.5% SDS, followed by a 30 minute wash in fresh 1X SET at Tm-10°C for the oligonucleotide probe. The membrane is then exposed to auto-radiographic film for detection of hybridization signals.
By varying the stringency of the hybridization conditions used to identify nucleic acids, such as cDNAs or genomic DNAs, which hybridize to the detectable probe, nucleic acids having different levels of homology to the probe can be identified and isolated. Stringency may be varied by conducting the hybridization at varying temperatures below the melting temperatures of the probes. The melting temperature, Tm, is the temperature (under defined ionic strength and pI~ at which 50% of the target sequence hybridizes to a perfectly complementary probe. very stringent conditions are selected to be equal to or about 5°C lower than the Tm for a particular probe. The melting temperature of the probe may be calculated using the following formulas:
For probes between 14 and 70 nucleotides in length the melting temperature (Tm) is calculated using the formula: Tm=81.5+16.6(log [Na+])+0.41(fraction G+C)-(600/I~
where N is the length of the probe.
If the hybridization is carned out in a solution containing formamide, the melting temperature may be calculated using the equation: Tm 81.5+16.6(log [Na+])+0.41(fraction G+C)-(0.63% formamide)-(600/I~ where N is tha length of the probe.
Prehybridization may be carried out in 6X SSC, SX Denhardt°s reagent, 0.5%
SDS, I00 ~,g denatured fragmented salmon sperm DNA or 6X SSC, SX Denhardt's reagent, 0.5% SDS, 100 ~.g denatured fragmented salmon sperm DNA, 50%
formamide.
The formulas for SSC and Denhardt's solutions are listed in Sambroolc et al., supra.
hybridization is conducted by adding the detectable probe to the prehybridization solutions listed above. Where the probe comprises double stranded DNA, it is denatured before addition to the hybridization solution. The filter is contacted with the hybridization solution for a sufficient period of time to allow the probe to hybridize to cDNAs or genomic DNAs containing sequences complementary thereto or homologous thereto. For probes over 200 nucleotides in length, the hybridization may be carried out at I S-25°C below the Tm. For shorter probes, such as oligonucleotide probes, the hybridization may be conducted at 5-10°C below the Tm.
Typically, for hybridizations in 6X SSC, the hybridization is conducted at approximately 68°C.
Usually, for hybridizations in 50% formamide containing solutions, the hybridization is conducted at approximately 42°C.

All of the foregoing hybridizations would be considered to be under conditions of high stringency.
Following hybridization, the filter is washed to remove any non-specifically bound detectable probe. The stringency used to wash the filters can also be varied depending on the nature of the nucleic acids being hybridized, the length of the nucleic acids being hybridized, the degree of complementarity, the nucleotide sequence composition (e.g., GC v. AT content), and the nucleic acid type (e.g., l~TA
v. DNA). Examples of progressively higher stringency condition washes are as follows: 2X SSC, 0.1% SDS at room temperature for 15 minutes (low stringency);
O.1X SSC, 0.5% SDS at room temperature for 30 minutes to 1 hour (moderate stringency); O.1X SSC, 0.5% SDS for 15 to 30 minutes at between the hybridization temperature and 68°C (high stringency); and O.15M NaCI for 15 minutes at 72°C
(very high stringency). A final low stringency wash can be conducted in O.1X
SSC at room temperature. The examples above are merely illustrative of one set of conditions that can be used to wash filters. One of skill in the art would know that there are numerous recipes for different stringency washes. Some other examples are given below.
Nucleic acids which have hybridized to the probe are identified by autoradiography or other conventional techniques.
The above procedure may be modified to identify nucleic acids having decreasing levels of homology to the probe sequence. For example, to obtain nucleic acids of decreasing homology to the detectable probe, less stringent conditions may be used. For example, the hybridization temperature may be decreased in increments of 5°C from 68°C to 42°C in a hybridization buffer having a Na+ concentration of approximately 1M. Following hybridization, the filter may be washed with 2X
SSC, 0.5% SDS at the temperature of hybridization. These conditions are considered to be "moderate" conditions above 50°C and "low" conditions below 50°C. A specific example of "moderate" hybridization conditions is when the above hybridization is conducted at 55°C. A specific example of "low stringency" hybridization conditions is when the above hybridization is conducted at 45°C.

SS
Alternatively, the hybridization may be carried out in buffers, such as 6X
SSC, containing formamide at a temperature of 42°C. In this case, the concentration of formamide in the hybridization buffer may be reduced in S% increments from 50%
to 0% to identify clones having decreasing levels of homology to the probe.
Following S hybridization, the filter rnay be washed with 6X SSC, O.S% SDS at SO°C. These conditions are considered to be "moderate" conditions above 2S% formamide and "low" conditions below 2S% formamide. A specific example of "moderate"
hybridization conditions is when the above hybridization is conducted at 30°/~
formamide. A specific example of "low stringency" hybridization conditions is when the above hybridization is conducted at I O% formamide.
For example, the preceding methods may be used to isolate nucleic acids having a sequence with at Least about 97%, at Least 9S%, at Least 90%, at least 8S%, at least 80%, at least 7S%, at least 70%, at least 6S%, at least 60%, at least SS%, or at least SO% homology to a nucleic acid sequence selected from the group consisting of I S one of the sequences of SEQ ~ NO: I, 3, S, 7, 9, I l, I3, I S, and sequences substantially identical thereto, or fragments comprising at least about 10, 1 S, 20, 2S, 30, 3S, 40, S0, 7S, 100, 150, 200, 300, 400, or S00 consecutive bases thereof, and the sequences complementary thereto. Homology may be measured using the alignment algorithm. For example, the homologous polynucleotides may have a coding sequence which is a naturally occurring allelic variant of one of the coding sequences described herein. Such allelic variants may have a substitution, deletion or addition of one or more nucleotides when compared to the nucleic acids of SEQ ~ N~: 1, 3, S, 7, 9, 11, I3, I S or the sequences complementary thereto.
Additionally, the above procedures may be used to isolate nucleic acids which 2S encode polypeptides having at least about 99%, 9S%, at least 90%, at least 8S%, at least 80%, at least 7S%, at least 70%, at least 6S%, at least 60%, at least SS%, or at least 50% homology to a polypeptide having the sequence of one of SEQ ID N~:
2, 4, 6, 8, 10, 12, 14, 16, and sequences substantially identical thereto, or fragments comprising at least 5, 10, 1S, 20, 2S, 30, 3S, 40, S0, 7S, 100, or 1S0 consecutive amino acids thereof as determined using a sequence alignment algorithm (e.g., such as the FASTA version 3.0t78 algorithm with the default parameters).
Another aspect of the invention is an isolated or purified polypeptide comprising the sequence of one of SEQ ID NO: 1, 3, S, 7, 9, 1 l, I3, I5, and sequences substantially identical thereto, or fragments comprising at least about 5, 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, or 150 consecutive amino acids thereof.
As discussed above, such polypeptides may be obtained by inserting a nucleic acid encoding the polypeptide into a vector such that the coding sequence is operably linked to a sequence capable of driving the expression of the encoded polypeptide in a suitable host cell. For example, the expression vector may comprise a promoter, a ribosome binding site for translation initiation and a transcription terminator. The vector may also include appropriate sequences for amplifying expression.
Promoters suitable fox expressing the polypeptide or fragment thereof in bacteria include the E. coli lac or trp promoters, the lacl promoter, the lacZ
promoter, I S the T3 promoter, the T7 promoter, the gpt promoter, the lambda PR
promoter, the lambda PL promoter, promoters from operons encoding glycolytic enzymes such as phosphoglycerate kinase (PGK), and the acid phosphatase promoter. Fungal promoters include the f! factor promoter. Eukaryotic promoters include the CMV
immediate early promoter, the HSV thymidine kinase promoter, heat shock promoters, the early and late SV40 promoter, LTRs from retroviruses, and the mouse metallothionein-I promoter. Other promoters known to control expression of genes in prokaryotic or eukaryotic cells or their viruses may also be used.
Mammalian expression vectors may also comprise an origin of replication, any necessary ribosome binding sites, a polyadenylation site, splice donor and acceptor sites, transcriptional termination sequences, and 5' flanking nontranscribed sequences. In some embodiments, DNA sequences derived from the SV40 splice and polyadenylation sites may be used to provide the required nontranscribed genetic elements.

Vectors for expressing the polypeptide or fragment thereof in eukaryotic cells may also contain enhancers to increase expression levels. Enhancers are cis-acting elements of DNA, usually from about 10 to about 300 by in length that act on a promoter to increase its transcription. Examples include the SV40 enhancer on the S late side of the replication origin by 100 to 270, the cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and the adenovirus enhancers.
In addition, the expression vectors typically contain one or more selectable marker genes to permit selection of host cells containing the vector. Such selectable markers include genes encoding dihydrofolate reductase or genes conferring neomycin resistance for eukaryotic cell culture, genes conferring tetracycline or ampicillin resistance in E. coli, and the S. ceYevisiae TRPl gene.
In some embodiments, the nucleic acid encoding one of the polypeptides of SEQ )D NO: 2, 4, 6, 8, 10, 12, 14, 16, and sequences substantially identical thereto, or 1 S fragments comprising at least about S, 10, 1 S, 20, 2S, 30, 3 S, 40, S0, 7S, I00, or 1 SO
consecutive amino acids thereof is assembled in appropriate phase with a leader sequence capable of directing secretion of the translated polypeptide or fragment thereof. Optionally, the nucleic acid can encode a fusion polypeptide in which one of the polypeptides of SEQ m NO: 2, 4, 6, 8, 10, 12, 14, 16, and sequences substantially identical thereto, or fragments comprising at least S, 10, 1S, 20, 2S, 30, 3S, 40, S0, 7S, 100, or 1 SO consecutive amino acids thereof is fused to heterologous peptides or polypeptides, such as N-terminal identification peptides which impart desired characteristics, such as increased stability or simplified purification.
The appropriate DNA sequence may be inserted into the vector by a variety of 2S procedures. In general, the DNA sequence is ligated to the desired position in the vector following digestion of the insert and the vector with appropriate restriction endonucleases. Alternatively, blunt ends in both the insert and the vector rnay be ligated. A variety of cloning techniques are disclosed in Ausubel et al.
Current Protocols in Molecular Biology, John Wiley S03 Sons, Inc. 1997 and Sambrook et al., Molecular Cloning: A Laboratory Manual 2d Ed., Cold Spring Harbor Laboratory Press, 1989, the entire disclosures of which are incorporated herein by reference.
Such procedures and others are deemed to be within the scope of those skilled in the art.
The vector may be, for example, in the form of a plasmid, a viral particle, or a phage. Other vectors include chromosomal, nonchromosomal and synthetic DNA
sequences, derivatives of SV40; bacterial plasmids, phage DNA, baculovirus, yeast plasmids, vectors derived from combinations of plasmids and phage DNA, viral DNA
such as vaccinia, adenovirus, fowl pox virus, and pseudorabies. A variety of cloning and expression vectors for use with prokaryotic and eukaryotic hosts are described by Sambrook, et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor, N.Y., (1989), the disclosure of which is hereby incorporated by reference.
Particular bacterial vectors which may be used include the commercially available plasmids comprising genetic elements of the well known cloning vector pBR322 (ATCC 37017), pKK223-3 (Pharmacia Fine Chemicals, Uppsala, Sweden), GEM1 (Promega Biotec, Madison, WI, USA) pQE70, pQE60, pQE-9 (Qiagen), pDlO, psiX174 pBluescript II KS, pNHBA, pNHl6a, pNHl8A, pNH46A
(Stratagene), ptrc99a, pKK223-3, pKK233-3, pDR540, pRITS (Pharmacia), pKK232-8 and pCM7. Particular eukaryotic vectors include pSV2CAT, pOG44, pXTl, pSG
(Stratagene) pSVK3, pBPV, pMSG, and pSVL (Pharmacia). However, any other vector may be used as long as it is replicable and viable in the host cell.
The host cell may be any of the host cells familiar to those skilled in the art, including prokaryotic cells, eukaryotic cells, mammalian cells, insect cells, or plant cells. As representative examples of appropriate hosts, there may be mentioned:
bacterial cells, such as E. coli, Streptomyces, Bacillus subtilis= Salmonella typhimurium and various species within the genera Pseudomonas, Streptomyces, and Staphylococcus, fungal cells, such as yeast, insect cells such as Drosophila S2 and Spodoptera Sfg, animal cells such as CHO, COS or Bowes melanoma, and adenoviruses. The selection of an appropriate host is within the abilities of those skilled in the art.

The vector may be introduced into the host cells using any of a variety of techniques, including transformation, transfection, transduction, viral infection, gene guns, or Ti-mediated gene transfer. Particular methods include calcium phosphate transfection, DEAF-Dextran mediated transfection, lipofection, or electroporation S (Davis, L., Dibner, M., Battey, L, Basic Methods in Molecular Biology, (1986)).
Where appropriate, the engineered host cells can be cultured in conventional nutrient media modified as appropriate for activating promoters, selecting transformants or amplifying the genes of the invention. Following transformation of a suitable host strain and growth of the host strain to an appropriate cell density, the selected promoter may be induced by appropriate means (e.g., temperature shift or chemical induction) and the cells may be cultured for an additional period to allow them to produce the desired polypeptide or fragment thereof.
Cells are typically harvested by centrifugation, disrupted by physical or chemical means, and the resulting crude. extract is retained for further purification.
Microbial cells employed for expression of proteins can be disrupted by any convenient method, including freeze-thaw cycling, sonication, mechanical disruption, or use of cell lysing agents. Such methods are well known to those skilled in the art.
The expressed polypeptide or fragment thereof can be recovered and purified from recombinant cell cultures by methods including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography and lectin chromatography.
Protein refolding steps can be used, as necessary, in completing configuration of the polypeptide. If desired, high performance liquid chromatography (HPLC) can be employed for final purif cation steps.
Various mammalian cell culture systems can also be employed to express recombinant protein. Examples of mammalian expression systems include the COS-lines of monkey kidney fibroblasts (described by Gluzman, Cell, 23:175, 1981), and other cell lines capable of expressing proteins from a compatible vector, such as the C127, 3T3, CHO, HeLa and BHK cell lines.

The constructs in host cells can be used in a conventional manner to produce the gene product encoded by the recombinant sequence. Depending upon the host employed in a recombinant production procedure, the polypeptides produced by host cells containing the vector may be glycosylated or may be non-glycosylated.
5 Polypeptides of the invention may or may not also include an initial methionine amino acid residue.
Alternatively, the polypeptides of SEQ m NO: 2, 4, 6, 8, 10, 12,14, 16, and sequences substantially identical thereto, or fragments comprising at least 5, 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, or 150 consecutive amino acids thereof can be 10 synthetically produced by conventional peptide synthesizers. In other embodiments, fragments or portions of the polypeptides may be employed for producing the corresponding full-length polypeptide by peptide synthesis; therefore, the fragments may be employed as intermediates for producing the full-length polypeptides.
Cell-free translation systems can also be employed to produce one of the 15 polypeptides of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, and sequences substantially identical thereto, or fragments comprising at least 5, 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, or 150 consecutive amino acids thereof using mRNAs transcribed from a DNA
construct comprising a promoter operably linked to a nucleic acid encoding the polypeptide or fragment thereof. In some embodiments, the DNA construct may be 20 linearized prior to conducting an in vitro transcription reaction. The transcribed mRNA is then incubated with an appropriate cell-free translation extract, such as a rabbit reticulocyte extract, to produce the desired polypeptide or fragment thereof.
The invention also relates to variants of the polypeptides of SEQ m NO: 2, 4, 6, 8, 10, 12, 14, 16, and sequences substantially identical thereto, or fragments 25 comprising at least 5, 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, or 150 consecutive amino acids thereof. The term "variant" includes derivatives or analogs of these polypeptides. In particular, the variants may differ in amino acid sequence from the polypeptides of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, and sequences substantially identical thereto, by one or more substitutions, additions, deletions, fusions and 30 truncations, which may be present in any combination.

The variants may be naturally occurnng or created in vitro. In particular, such variants may be created using genetic engineering techniques such as site directed mutagenesis, random chemical mutagenesis, Exonuclease III deletion procedures, and standard cloning techniques. Alternatively, such variants, fragments, analogs, or derivatives may be created using chemical synthesis or modification procedures.
Other methods of making variants are also familiar to those skilled in the art.
These include procedures in which nucleic acid sequences obtained from natural isolates are modified to generate nucleic acids which encode polypeptides having characteristics which enhance their value in industrial or laboratory applications. In such procedures, a large number of variant sequences having one or more nucleotide differences with respect to the sequence obtained from the natural isolate are generated and characterized. Typically, these nucleotide differences result in amino acid changes with respect to the polypeptides encoded by the nucleic acids from the natural isolates.
For example, variants may be created using error prone PCR. In error prone PCR, PCR is performed under conditions where the copying fidelity of the DNA
polymerase is low, such that a high rate of point mutations is obtained along the entire length of the PCR product. Error prone PCR is described in Leung, D.W., et al., Technique, 1:11-15, 1989) and Caldwell, R. C. & Joyce G.F., PCR Methods Applic., 2:28-33, 1992, the disclosure of which is incorporated herein by reference in its entirety. Eriefly, in such procedures, nucleic acids to be mutagenized are mixed with PGR primers, reaction buffer, MgCl2, MnCl2, Taq polymerase and an appropriate concentration of dNTPs for achieving a high rate of point mutation along the entire length of the PCR product. For example, the reaction may be performed using 20 finoles of nucleic acid to be mutagenized, 30pmole of each PCR primer, a reaction buffer comprising 50mM KCl, lOmM Tris HCl (pH 8.3) and 0.01% gelatin, 7mM
MgCl2, O.SmM MnGl2, 5 units of Taq polymerase, 0.2mM dGTP, 0.2mM dATP, 1mM dCTP, and 1mM dTTP. PCR may be performed for 30 cycles of 94° C for min, 45° C for 1 min, and 72° C for 1 min. However, it will be appreciated that these parameters may be varied as appropriate. The mutagenized nucleic acids are cloned 6~
into an appropriate vector and the activities of the polypeptides encoded by the mutagenized nucleic acids is evaluated.
Variants mayalso be created using oligonucleotide directed mutagenesis to generate site-specific mutations in any cloned DNA of interest.
Oligonucleotide mutagenesis is described in Reidhaar-Olson, J.F. & Sauer, R.T., et al., Science, 241:53-57, 1988, the disclosure of which is incorporated herein by reference in its entirety. Briefly, in such procedures a plurality of double stranded oligonucleotides bearing one or more mutations to be introduced into the cloned DNA are synthesized and inserted into the cloned DNA to be mutagenized. Clones containing the mutagenized DNA are recovered and the activities of the polypeptides they encode are assessed.
Another method for generating variants is assembly PCR. Assembly PCR
involves the assembly of a PCR product from a mixture of small DNA fragments.
A
large number of different PGR reactions occur in parallel in the same vial, with the I S products of one reaction priming the products of another reaction.
Assembly PCR is described in U.S. Patent No. 5,965,408, filed July 9, 1996, entitled, "Method of DNA
Reassembly by Interrupting Synthesis", the disclosure of which is incorporated herein by reference in its entirety.
Still another method of generating variants is sexual PCR mutagenesis. In sexual PCR mutagenesis, forced homologous recombination occurs between DNA
molecules of different but highly related DNA sequence in vitro, as a result of random fragmentation of the DNA molecule based on sequence homology, followed by fixation of the crossover by primer extension in a PCR reaction. Sexual PCR
mutagenesis is described in Stemmer, W.P., PNAS, USA, 91:10747-I075I, 1994, the disclosure of which is incorporated herein by reference. Briefly, in such procedures a plurality of nucleic acids to be recombined are digested with DNAse to generate fragments having an average size of 50-200 nucleotides. Fragments of the desired average size are purified and resuspended in a PCR mixture. PCR is conducted under conditions which facilitate recombination between the nucleic acid fragments.
For example, PCR may be performed by resuspending the purified fragments at a concentration of 10-30ng/:1 in a solution of 0.2mM of each dNTP, 2.2mM MgCl2, 50mM KCL, lOmM Tris HCI, pH 9.0, and 0.1% Triton X-100. 2.5 units of Taq polymerise per 100:1 of reaction mixture is added and PCR is performed using the following regime: 94° C for 60 seconds, 94° C for 30 seconds, 50-55° C for 30 seconds, 72° C for 30 seconds (30-45 times) and 72° C for 5 minutes. However, it will be appreciated that these parameters may be varied as appropriate. In some embodiments, oligonucleotides may be included in the PCR reactions. In other embodiments, the Klenow fragment of DNA polymerise I may be used in a first set of PCR reactions and Taq polymerise rnay be used in a subsequent set of PCR
reactions.
Recombinant sequences are isolated and the activities of the polypeptides they encode are assessed.
Variants may also be created by i~z vivo mutagenesis. In some embodiments, random mutations in a sequence of interest are generated by propagating the sequence of interest in a bacterial strain, such as an E. coli strain, which carnes mutations in one or more of the DNA repair pathways. Such "mutator" strains have a higher random mutation rate than that of a wild-type parent. Propagating the DNA in one of these strains will eventually generate random mutations within the DNA.
Mutator strains suitable for use for in vivo mutagenesis are described in PCT
Publication No.
VdO 91116427, published October 31, 1991, entitled "Methods for Phenotype Creation from Multiple Gene Populations" the disclosure of which is incorporated herein by reference in its entirety.
Variants may also be generated using cassette mutagenesis. In cassette mutagenesis a small region of a double stranded DNA molecule is replaced with a synthetic oligonucleotide "cassette" that differs from the native sequence.
The oligonucleotide often contains completely and/or partially randomized native sequence.
Recursive ensemble mutagenesis may also be used to generate variants.
Recursive ensemble mutagenesis is an algorithm for protein engineering (protein mutagenesis) developed to produce diverse populations of phenotypically related mutants whose members differ in amino acid sequence. This method uses a feedback mechanism to control successive rounds of combinatorial cassette mutagenesis.
Recursive ensemble mutagenesis is described in Arkin, A.P. and Youvan, D.C., PNAS, USA, 89:7811-7815, 1992, the disclosure of which is incorporated herein by reference in its entirety.
S In some embodiments, variants are created using exponential ensemble mutagenesis. Exponential ensemble mutagenesis is a process for generating combinatorial libraries with a high percentage of unique and functional mutants, wherein small groups of residues are randomized in parallel to identify, at each altered position, amino acids which lead to functional proteins. Exponential ensemble mutagenesis is described in Delegrave, S. and Youvan, D.C., Biotechnology Research, 11:1548-1552, 1993, the disclosure of which incorporated herein by reference in its entirety. Random and site-directed mutagenesis are described in Arnold, F.H., Current Opinion in Biotechnology, 4.:450-455, 1993, the disclosure of which is incorporated herein by reference in its entirety.
In some embodiments, the variants are created using shuffling procedures wherein portions of a plurality of nucleic acids which encode distinct polypeptides are fused together to create chimeric nucleic acid sequences which encode chimeric polypeptides as described in U.S. Patent No. 5,965,408, filed July 9, 1996, entitled, "Method of DNA Reassernbly by Interrupting Synthesis", and U.S. Patent No.
5,939,250, filed May 22, 1996, entitled, "Production of Enzymes Having Desired Activities by Mutagenesis", both of which are incorporated herein by reference.
The variants of the polypeptides of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16 may be variants in which one or more of the amino acid residues of the polypeptides of the SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16 are substituted with a conserved or non-conserved amino acid residue (preferably a conserved amino acid residue) and such substituted amino acid residue may or may not be one encoded by the genetic code.
Conservative substitutions are those that substitute a given amino acid in a polypeptide by another amino acid of like characteristics. Typically seen as conservative substitutions are the following replacements: replacements of an aliphatic amino acid such as Ala, Val, Leu and Ile with another aliphatic amino acid;
replacement of a Ser with a Thr or vice versa; replacement of an acidic residue such as Asp and Glu with another acidic residue; replacement of a residue bearing an amide group, such as Asn and Gln, with another residue bearing an amide group;
exchange of a basic residue such as Lys and Arg with another basic residue;
and replacement of an aromatic residue such as Phe, Tyr with another aromatic residue.
Other variants are those in which one or more of the amino acid residues of the polypeptides of the SEQ m NO: 2, 4, 6, 8, 10, 12, 14, 16 includes a substituent group.
10 Still other variants are those in which the polypeptide is associated with another compound, such as a compound to increase the half life of the polypeptide (for example, polyethylene glycol).
Additional variants are those in which additional amino acids are fused to the polypeptide, such as a leader sequence, a secretory sequence, a proprotein sequence or 15 a sequence which facilitates purification, enrichment, or stabilization of the polypeptide.
In some embodiments, the fragments, derivatives and analogs retain the same biological function or activity as the polypeptides of SEQ ~ NO: 2, 4, 6, 8, 10, 12, 14, 16, and sequences substantially identical thereto. In other embodiments, the 20 fragment, derivative, or analog includes a proprotein, such that the fragment, derivative, or analog can be activated by cleavage of the proprotein portion to produce an active polypeptide.
Another aspect of the invention is polypeptides or fragments thereof which have at least about 50%, at least about 55%, at least about 60%, at least about 65%, at 25 least about 70%, at least about 75%, least about 80%, at least about 85%, at least about 90%, at least about 95%, or more than about 95% homology to one of the polypeptides of SEQ 117 NO: 2, 4, 6, 8, 10, 12, 14, 16, and sequences substantially identical thereto, or a fragment comprising at least 5, 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, or 150 consecutive amino acids thereof. Homology may be determined using any of the programs described above which aligns the polypeptides or fragments being compared and determines the extent of amino acid identity or similarity between them. It will be appreciated that amino acid "homology" includes conservative amino acid substitutions such as those described above.
The polypeptides or fragments having homology to one of the polypeptides of SEQ ID NO: 2, 4, 6, 8, I0, 12, 14, I6, and sequences substantially identical thereto, or a fragment comprising at least about 5, 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, or 150 consecutive amino acids thereof may be obtained by isolating the nucleic acids encoding them using the techniques described above.
Alternatively, the homologous polypeptides or fragments may be obtained through biochemical enrichment or purification procedures. The sequence of potentially homologous polypeptides or fragments may be determined by proteolytic digestion, gel electrophoresis and/or microsequencing. The sequence of the prospective homologous polypeptide or fragment can be compared to one of the I5 polypeptides of SEQ >D NO: 2, 4, 6, 8, 10, 12, 14, 16, and sequences substantially identical thereto, or a fragment comprising at least about 5, 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, or 150 consecutive amino acids thereof using any of the programs described above.
Another aspect of the invention is an assay for identifying fragments or variants of SEQ ID NO: 2, 4, 6, 8, 10, I2, 14, I6, and sequences substantially identical thereto, which retain the enzymatic function of the polypeptides of NO: 2, 4, 6, 8, 10, 12, 14, 16, and sequences substantially identical thereto.
For example the fragments or variants of the polypeptides, may be used to catalyze biochemical reactions, which indicate that the fragment or variant retains the enzymatic activity of the polypeptides in the SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16.
The assay for determining if fragments of variants retain the enzymatic activity of the polypeptides of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, and sequences substantially identical thereto includes the steps of; contacting the polypeptide fragment or variant with a substrate molecule under conditions which allow the polypeptide fragment or variant to function, and detecting either a decrease in the level of substrate or an increase in the level of the specific reaction product of the reaction between the polypeptide and substrate.
The polypeptides of SEQ m NO: 2, 4, 6, 8, 10, 12, 14, 16, and sequences substantially identical thereto or fragments comprising at least 5,10, 15, 20, 25, 30, 35, 40, S0, 75, 100, or 150 consecutive amino acids thereof may be used in a variety of applications. Fox example, the polypeptides or fragments thereof may be used to catalyze biochemical reactions. In accordance with one aspect of the invention, there is provided a process for utilizing the polypeptides of SEQ ~ NO: 2, 4, 6, 8, 10, 12, 14, 16, and sequences substantially identical thereto or polynucleotides encoding such polypeptides for hydrolyzing glycosidic linkages. In such procedures, a substance containing a glycosidic linkage (e.g., a starch) is contacted with one of the polypeptides of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, or sequences substantially identical thereto under conditions which facilitate the hydrolysis of the glycosidic linkage.
The polypeptides of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, and sequences substantially identical thereto or fragments comprising at least 5,10, 15, 20, 25, 30, 35, 40, 50, 75,100, or 150 consecutive amino acids thereof, may also be used to generate antibodies which bind specifically to the polypeptides or fragments. The resulting antibodies may be used in immunoaffinity chromatography procedures to isolate or purify the polypeptide or to determine whether the polypeptide is present in a biological sample. In such procedures, a protein preparation, such as an extract, or a biological sample is contacted with an antibody capable of specifically binding to one of the polypeptides of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, and sequences substantially identical thereto, or fragments comprising at least 5, 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, or 150 consecutive amino acids thereof.
In immunoaffinityprocedures, the antibody is attached to a solid support, such as a bead or other column matrix. The protein preparation is placed in contact with the antibody under conditions in which the antibody specifically binds to one of the polypeptides of SEQ m NO: 2, 4, 6, 8, 10, 12, 14, 16, and sequences substantially identical thereto, or fragment thereof. After a wash to remove non-specifically bound proteins, the specifically bound polypeptides are eluted.
The ability of proteins in a biological sample to bind to the antibody may be determined using any of a variety of procedures familiar to those skilled in the art.
For example, binding may be determined by labeling the antibody with a detectable label such as a fluorescent agent, an enzymatic label, or a radioisotope.
Alternatively, binding of the antibody to the sample may be detected using a secondary antibody having such a detectable label thereon. Particular assays include ELISA
assays, sandwich assays, radioimmunoassays, and Western Blots.
Polyclonal antibodies generated against the polypeptides of SEQ II3 NO: 2, 4, 6, 8, 10, 12, 14, 16, and sequences substantially identical thereto, or fragments comprising at least 5, 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, or 150 consecutive amino acids thereof can be obtained by direct injection of the polypeptides into an animal or by administering the polypeptides to an animal, for example, a nonhuman. The 1 S antibody so obtained will then bind the polypeptide itself. In this manner, even a sequence encoding only a fragment of the polypeptide can be used to generate antibodies which may bind to the whole native polypeptide. Such antibodies can then be used to isolate the polypeptide from cells expressing that polypeptide.
For preparation of monoclonal antibodies, any technique which provides antibodies produced by continuous cell line cultures can be used. Examples include the hybridoma technique (Kohler and Milstein, Nature, 256:495-497, 1975, the disclosure of which is incorporated herein by reference), the trioma technique, the human B-cell hybridoma technique (Kozbor et al., hnmunology Today 4:72, 1983, the disclosure of which is incorporated herein by reference), and the EBV-hybridoma technique (Cole, et al., 1985, in Monoclonal Antibodies and Cancer Therapy, Alan R.
Liss, Inc., pp. 77-96, the disclosure of which is incorporated herein by reference).
Techniques described for the production of single chain antibodies (U.S.
Patent No. 4,946,778, the disclosure of which is incorporated herein by reference) can be adapted to produce single chain antibodies to the polypeptides of SEQ m NO:
2, 4, 6, 8, 10, 12, 14, 16, and sequences substantially identical thereto, or fragments comprising at least 5, 10, 15, 20, 2S, 30, 35, 40, 50, 75, 100, or 150 consecutive amino acids thereof. Alternatively, transgenic mice may be used to express humanized antibodies to these polypeptides or fragments thereof.
S Antibodies generated against the polypeptides of SEQ 1T7 NO: 2, 4, 6, 8, 10, 12, 14, 16, and sequences substantially identical thereto, or fragments comprising at least S, 10,15, 20, 2S, 30, 3S, 40, S0, 7S, 100, or 1S0 consecutive amino acids thereof may be used in screening for similar polypeptides from other organisms and samples.
gn such techniques, polypeptides from the organism are contacted with the antibody and those polypeptides which specifically bind the antibody are detected. Any of the procedures described above may be used to detect antibody binding. One such screening assay is described in "Methods for Measuring Cellulase Activities", ld~fethods ih E~zymology, Vol 160, pp. 87-116, which is hereby incorporated by reference in its entirety.
1 S As used herein the term "nucleic acid sequence as set forth in SEQ ID NO:
1, 3, S, 7, 9, 11, 13, 15" encompasses the nucleotide sequences of SEQ ID NO: 1, 3, S, 7, 9, 11, 13, 1S, and sequences substantially identical thereto, as well as sequences homologous to SEQ l~ NO: 1, 3, S, 7, 9, 11, 13, 1 S, and fragments thereof and sequences complementary to all of the preceding sequences. The fragments include portions of SEQ ID NO: 1, 3, S, 7, 9, 11, 13, 1S, comprising at least 10,15, 20, 2S, 30, 3S, 40, 50, 7S, 100, 150, 200, 300, 400, or S00 consecutive nucleotides of SEQ
1~9 NO:
1, 3, S, 7, 9, 11, 13, 1S, and sequences substantially identical thereto.
Homologous sequences and fragments of SEQ )D NO: 1, 3, S, 7, 9, 11, 13, 1S, and sequences substantially identical thereto, refer to a sequence having at least 99%, 98%, 97%, 96%, 2S 9S%, 90%, 8S%, 80%, 7S%, 70%, 6S%, 60%, SS%, or SO% homology to these sequences. Homology may be determined using any of the computer programs and parameters described herein, including FASTA version 3.0t78 with the default parameters. Homologous sequences also include RNA sequences in which uridines replace the thymines in the nucleic acid sequences as set forth in the SEQ D7 NO: 1, 3, 5, 7, 9, 11, 13, 1 S. The homologous sequences may be obtained using any of the procedures described herein or may result from the correction of a sequencing error. It will be appreciated that the nucleic acid sequences as set forth in SEQ ID NO:
1, 3, 5, 7, 9, 11, I3, 15, and sequences substantially identical thereto, can be represented in the traditional single character format (See the inside back cover of Stryer, Lubert.
5 Biochemistry, 3rd edition. W. H Freeman & Co., New York.) or in any other format which records the identity of the nucleotides in a sequence.
As used herein the term "a polypeptide sequence as set forth in SEQ ID NO: 2, 4, 6, 8, 10, 12, I4, 16" encompasses the polypeptide sequence of SEQ ~ NO: 2, 4, 6, 8,10,12,14,16, and sequences substantially identical thereto, which are encoded by a 10 sequence as set forth in SEQ ID NO: l, 3, 5, 7, 9, 11, I3, 15, polypeptide sequences homologous to the polypeptides of SEQ 1D NO: 2, 4, 6, 8, 10, 12, 14, 16, and sequences substantially identical thereto, or fragments of any of the preceding sequences. Homologous polypeptide sequences refer to a polypeptide sequence having at least 99%, 98%, 97%, 96%, 95%, 90%, 85%, $0%, 75%, 70%, 65%, 60%, 55%, or I S 50% homology to one of the polypeptide sequences of the SEQ ~ NO: 2, 4, 6, 8, 10, I2, I4, 16. homology may be determined using any of the computer programs and parameters described herein, including PASTA version 3.0t78 with the default parameters or with any modified parameters. The homologous sequences may be obtained using any of the procedures described herein or may result from the correction 20 of a sequencing error. The polypeptide fragments comprise at least 5, 10,15, 20, 25, 30, 35, 40, S0, 75, I00, or 150 consecutive amino acids of the polypeptides of SEQ
III NO:
2, 4, 6, 8, I0, 12, 14, 16, and sequences substantially identical thereto. It will be appreciated that the polypeptide codes as set forth in SEQ 1D NO: 2, 4, 6, 8, 10, 12, 14, 16, and sequences substantially identical thereto, can be represented in the traditional 25 single character format or three letter format (See the inside back cover of Starrier, Lubert. Biochemistry, 3rd edition. W. H Freeman & Co., New York.) or in any other format which relates the identity of the polypeptides in a sequence.
It will be appreciated by those skilled in the art that a nucleic acid sequence as set forth SEQ I<? NO: 1, 3, 5, 7, 9, I 1, 13, 15 and a polypeptide sequence as set forth 30 in SEQ ID NO: 2, 4, 6, 8, 10, 12, I4, 16 can be stored, recorded, and manipulated on any medium which can be read and accessed by a computer. As used herein, the words "recorded" and "stored" refer to a process for storing information on a computer medium. A skilled artisan can readily adopt any of the presently known methods for recording information on a computer readable medium to generate manufactures comprising one or more of the nucleic acid sequences as set forth in SEQ ~ NO:
1, 3, 5, 7, 9, 11, 13, 15, and sequences substantially identical thereto, one ~r more of the polypeptide sequences as set forth in SEQ m NO: 2, 4, 6, 8, 10, 12, 14, 16, and sequences substantially identical thereto. Another aspect ofthe invention is a computer readable medium having recorded~thereon at least 2, 5, 10, 15, or 20 nucleic acid sequences as set forth in SEQ E7 NO: 1, 3, 5, 7, 9, 11, 13, 15, and sequences substantially identical thereto.
Another aspect of the invention is a computer readable medium having recorded thereon one or more of the nucleic acid sequences as set forth in SEQ
~
NO: 1, 3, 5, 7, 9, 11, 13, 15, and sequences substantially identical thereto.
Another aspect of the invention is a computer readable medium having recorded thereon one or more of the polypeptide sequences as set forth in SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, and sequences substantially identical thereto. Another aspect of the invention is a computer readable medium having recorded thereon at least 2, 5,10, 15, or 20 of the sequences as set forth above.
Computer readable media include magnetically readable media, optically readable media, electronically readable media and magnetic/optical media. For example, the computer readable media may be a hard disk, a floppy disk, a magnetic tape, ~D-ROM, Digital Versatile Disk (DVD), Random Access Memory (RAM), or Read Only Memory (ROM) as well as other types of other media known to those skilled in the art.
2S Embodiments of the invention include systems (e.g., Internet based systems), particularly computer systems which store and manipulate the sequence information described herein. One example of a computer system 100 is illustrated in block diagram form in Figure 2. As used herein, "a computer system" refers to the hardware components, software components, and data storage components used to analyze a nucleotide sequence of a nucleic acid sequence as set forth in SEQ m NO: 1, 3, 5, 7, 9, 11, 13, 15, and sequences substantially identical thereto, or a polypeptide sequence as set forth in the SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, I6. The computer system typically includes a processor for processing, accessing and manipulating the sequence data. The processor 105 can be any well-known type of central processing unit, such as, for example, the Pentium III from Intel Corporation, or similar processor from Sun, Motorola, Compaq, AMD or International Business Machines.
Typically the computer system 100 is a general purpose system that comprises the processor 105 and one or more internal data storage components 110 for storing data, and one or more data retrieving devices for retrieving the data stored on the data storage components. A skilled artisan can readily appreciate that any one of the currently available computer systems are suitable.
In one particular embodiment, the computer system 100 includes a processor 105 connected to a bus which is connected to a main memory I 1 S (preferably implemented as RAM) and one or more internal data storage devices 110, such as a hard drive and/or other computer readable media having data recorded thereon. In some embodiments, the computer system 100 further includes one or more data retrieving device I 18 for reading the data stored on the internal data storage devices 110.
The data retrieving device 118 may represent, for example, a floppy disk drive, a compact disk drive, a magnetic tape drive, or a modem capable of connection to a remote data storage system (e.g., via the irzternet) etc. In some embodiments, the internal data storage device 110 is a removable computer readable medium such as a floppy disk, a compact disk, a magnetic tape, etc. containing control logic and/or data recorded thereon. The computer system 100 may advantageously include or be programmed by appropriate software for reading the control logic and/or the data from the data storage component once inserted in the data retrieving device.
The computer system 100 includes a display 120 which is used to display output to a computer user. It should also be noted that the computer system 100 can be linked to other computer systems 125a-c in a network or wide area network to provide centralized access to the computer system 100.

Software for accessing and processing the nucleotide sequences of a nucleic acid sequence as set forth in SEQ )D NO: 1, 3, S, 7, 9, 1 l, 13, I5, and sequences substantially identical thereto, or a polypeptide sequence as set forth in SEQ
~ NO: 2, 4, 6, 8, 10, I2, 14, 16, and sequences substantially identical thereto, (such as search tools, compare tools, and modeling tools etc.) may reside in main memory 115 during execution.
In some embodiments, the computer system 100 may further comprise a sequence comparison algorithm for comparing a nucleic acid sequence as set forth in SEQ ID NO: 1, 3, 5, 7, 9, I 1, 13, 15, and sequences substantially identical thereto, or a polypeptide sequence as set forth in SEQ ll7 NO: 2, 4, 6, 8,10, 12,14,16, and sequences substantially identical thereto, stored on a computer readable medium to a reference nucleotide or polypeptide sequences) stored on a computer readable medium.
A "sequence comparison algorithm" refers to one or more programs which are implemented (locally or remotely) on the computer system 100 to compare a nucleotide I S sequence with other nucleotide sequences and/or compounds stored within a data storage means. For example, the sequence comparison algorithm may compare the nucleotide sequences of a nucleic acid sequence as set forth in SEQ m NO: 1, 3, 5, 7, 9, 11, 13, 1 S, and sequences substantially identical thereto, or a polypeptide sequence as set forth in SEQ 1D NO: 2, 4, 6, 8, 10, 12, I4, 16, and sequences substantially identical thereto, stored on a computer readable medium to reference sequences stored on a computer readable medium to identify homologies or structural motifs. ~Iarious sequence comparison programs identified elsewhere in this patent specification are particularly contemplated for use in this aspect of the invention. Protein and/or nucleic acid sequence homologies may be evaluated using any of the variety of sequence comparison algorithms and programs known in the art. Such algorithms and programs include, but are by no means limited to, TBLASTN, BLASTP, PASTA, TFASTA, and CLUSTALW (Pearson and Lipman, Proc. Natl. Acad. Sci. USA
85(8):2444-2448, 1988; Altschul et al., J. Mol. Biol. 215(3):403-410, 1990;
Thompson et al., Nucleic Acids Res. 22(2):4673-4680, 1994; Higgins et al., Methods Enzymol. 266:383-402, 1996; Altschul et al., J. Mol. Biol. 215(3):403-410, 1990;
Altschul et al., Nature Genetics 3:266-272, 1993).

Homology or identity is often measured using sequence analysis software (e.g., Sequence Analysis Software Package of the Genetics Computer Group, University of Wisconsin Biotechnology Center, 1710 University Avenue, Madison, WI 53705).
Such software matches similar sequences by assigning degrees of homology to various deletions, substitutions and other modifications. The terms "homology' and "identity' in the context of two or more nucleic acids or polypeptide sequences, refer to two or more sequences or subsequences that are the same or have a specified percentage of amino acid residues or nucleotides that are the same when compared and aligned for maximum correspondence over a comparison window or designated region as measured using any number of sequence comparison algorithms or by manual alignment and visual inspection.
For sequence comparison, typically one sequence acts as a reference sequence, to which test sequences are compared. When using a sequence comparison algorithm, test and reference sequences are entered into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated.
Default program parameters can be used, or alternative parameters can be designated.
The sequence comparison algorithm then calculates the percent sequence identities for the test sequences relative to the reference sequence, based on the program parameters.
A "comparison window", as used herein, includes reference to a segment of any one of the number of contiguous positions selected from the group consisting of from 20 to 600, usually about 50 to about 200, more usually about 100 to about 1 SO in which a sequence may be compared to a reference sequence of the same number of contiguous positions after the two sequences are optimally aligned. Methods of alignment of sequence for comparison are well-known in the art. Optimal alignment of sequences for 2S comparison can be conducted, e.g., by the local homology algorithm of Smith &
Waterman, Adv. Appl. Math. x:482, 1981, by the homology alignment algorithm of Needleman & Wunsch, J. Mol. Biol 48:443, 1970, by the search for similarity method of person & Lipman, Proc. Nafl. Acad. Sci. USA 85:2444, 1988, by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, WI), or by manual alignment and visual inspection. Other algorithms for determining homology or identity include, for example, in addition to a BLAST
program (Basic Local Alignment Search Tool at the National Center for Biological Information), ALIGN, AMAS (Analysis of Multiply Aligned Sequences), AMPS
5 (Protein Multiple Sequence Alignment), ASSET (Aligned Segment Statistical Evaluation Tool), BANDS, BESTSCOR, BIOSCAN (Biological Sequence Comparative Analysis Node), BLIMPS (BLocks IMProved Searcher), FASTA, Intervals & Points, BMB, CLUSTAL V, CLUSTAL W, CONSENSUS, LCONSENSUS, WCONSENSUS, Smith-Waterman algorithm, DARWIN, Las Vegas 10 algorithm, FNAT (Forced Nucleotide Alignment Tool), Framealign, Framesearch, D~'NAMIC, FILTER, FSAP (Fristensky Sequence Analysis Package), GAP (Global Alignment Program), GENAL, GIBBS, GenQuest, ISSC (Sensitive Sequence Comparison), LALIGN (Local Sequence Alignment), LCP (Local Content Program), MACAW (Multiple Alignment Construction & Analysis Workbench), MAP
15 (Multiple Alignment Program), MBLI~P, MBLKN, PIMA (Pattern-Induced Multi-sequence Alignment), SAGA (Sequence Alignment by Genetic Algorithm) and WHAT-IF. Such alignment programs can also be used to screen genome databases to identify polynucleotide sequences having substantially identical sequences. A
number of genome databases are available, for example, a substantial portion of the human 20 genome is available as part of the Human Genome Sequencing Project (J.
Roach, http:l/weber.u.Washington.edu/~roach/human genome progress 2.html) (Gibbs, 1995). At least twenty-one other genomes have already been sequenced, including, for example, M. genitalium (Eraser et al., 1995), M. jannaschii (Butt et al., 1996), H.
ihflue~azae (Fleischrnann et al., 1995), E. coli (Blattner et al.,1997), and yeast (S.
25 cerevisiae) (Mewes et al.,1997), and D. melanogaster (Adams et al., 2000).
Significant progress has also been made in sequencing the genomes of model organism, such as mouse, C. elegans, and Arabadopsis sp. Several databases containing genomic information annotated with some functional information are maintained by different organization, and are accessible via the Internet, for example, http://wwwtigr.org/tdb;
30 http://www.genetics.wisc.edu; http://genome-www.stanford.edu/ ball;
http:l/hiv-web.lanl.gov; http://www.ncbi.nlm.nih.gov; http://www.ebi.ac.uk;
http://Pasteur.fr/other/biology; and http:// www.~enome.wi.mit.edu.

One example of a useful algorithm is BLAST and BLAST 2.0 algorithms, which are described in Altschul et al., Nuc. Acids Res. 25:3389-3402, 1977, and Altschul et al., J. Mol. Biol. 215:403-410, 1990, respectively. Software for performing BLAST
analyses is publicly available through the National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov~. This algorithm involves first identifying high scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence, which either match or satisfy some positive-valued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighborhood word score threshold (Altschul et al., supra). These initial neighborhood word hits act as seeds for initiating searches to find longer HSPs containing them. The word hits are extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Cumulative scores are calculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching residues;
always >0).
For amino acid sequences, a scoring matrix is used to calculate the cumulative score.
Extension of the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached. The BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment. The BLASTN
program (for nucleotide sequences) uses as defaults a wordlength (W) of 11, an expectation (E) of 10, M=5, N=-4 and a comparison of both strands. For amino acid sequences, the BLASTP program uses as defaults a wordlength of 3, and expectations (E) of 10, and the BLOSUM62 scoring matrix (see Henikoff & Henikoff, Proc.
Natl.
Acad. Sci. USA 89:10915, 1989) alignments (B) of S0, expectation (E) of 10, M=5, N= -4, and a comparison of both strands.
The BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see, e.g., Karlin & Altschul, Proc. Natl. Acad. Sci.
USA
90:5873, 1993). One measure of similarity provided by BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance.
For example, a nucleic acid is considered similar to a references sequence if the smallest sum probability in a comparison of the test nucleic acid to the reference nucleic acid is Iess than about 0.2, more preferably less than about 0.01, and most preferably less than about 0.001.
In one embodiment, protein and nucleic acid sequence homologies are S evaluated using the Basic Local Alignment Search Tool ("BLAST'°) Tn particular, five specific BLAST programs are used to perform the following task:
(1) BLASTP and BLAST3 compare an amino acid query sequence against a protein sequence database;
(2) BLASTN compares a nucleotide query sequence against a nucleotide sequence database;
(3) BLASTX compares the six-frame conceptual translation products of a query nucleotide sequence (both strands) against a protein sequence database;
(4) TBLASTN compares a query protein sequence against a nucleotide sequence database translated in all six reading frames (both strands); and (5) TBLASTX compares the six-frame translations of a nucleotide query sequence against the six-frame translations of a nucleotide sequence database.
The BLAST programs identify homologous sequences by identifying similar segments, which axe referred to herein as "high-scoring segment pairs,"
between a query amino or nucleic acid sequence and a test sequence which is preferably obtained from a protein or nucleic acid sequence database. High-scoring segment pairs are preferably identified (i. e., aligned) by means of a scoring matrix, many of which are known in the art. Preferably, the scoring matrix used is the matrix (Gonnet et al., Science 256:1443-1445, 1992; Henikoff and Henikoff, Proteins 17:49-61, 1993). Less preferably, the PAM or PAM250 matrices may also be used (see, e.g., Schwartz and Dayhoff, eds., 1978, Matrices for Detecting Distance 7~
Relationships: Atlas of Protein Sequence and Structure, Washington: National Biomedical Research Foundation). BLAST programs are accessible through the ZJ.S.
National Library of Medicine, e.g.,.at www.ncbi.nlin.nih. og-vv.
The parameters used with the above algorithms may be adapted depending on the sequence length and degree of homology studied. In some embodiments, the parameters may be the default parameters used by the algorithms in the absence of instructions from the user.
Figure 3 is a flow diagram illustrating one embodiment of a process 200 for comparing a new nucleotide or protein sequence with a database of sequences in order to determine the homology levels between the new sequence and the sequences in the database. The database of sequences can be a private database stored within the computer system 100, or a public database such as GENBANK that is available through the Internet.
The process 200 begins at a start state 201 and then moves to a state 202 wherein the new sequence to be compared is stored to a memory in a computer system 100. As discussed above, the memory could be any type of memory, including RAM or an internal storage device.
The process 200 then moves to a state 204 wherein a database of sequences is opened for analysis and comparison. The process 200 then moves to a state 206 wherein the first sequence stored in the database is read into a memory on the computer. A
comparison is then performed at a state 210 to determine if the first sequence is the same as the second sequence. It is important to note that this step is not limited to performing an exact comparison between the new sequence and the first sequence in the database.
Well-known methods are known to those of skill in the art for comparing two nucleotide or protein sequences, even if they are not identical. For example, gaps can be introduced into one sequence in order to raise the homology level between the two tested sequences.
The parameters that control whether gaps or other features are introduced into a sequence during comparison are normally entered by the user of the computer system.

Once a comparison of the two sequences has been performed at the state 210, a determination is made at a decision state 210 whether the two sequences are the same.
Of course, the term "same" is not limited to sequences that are absolutely identical.
Sequences that are within the homology parameters entered by the user will be marked as "same" in the process 200.
If a determination is made that the two sequences are the same, the process moves to a state 214 wherein the name of the sequence from the database is displayed to the user. This state notifies the user that the sequence with the displayed name fulfills the homology constraints that were entered. Once the name of the stored sequence is displayed to the user, the process 200 moves to a decision state 218 wherein a determination is made whether more sequences exist in the database. If no more sequences exist in the database, then the process 200 terminates at an end state 220.
however, if more sequences do exist in the database, then the process 200 moves to a state 224 wherein a pointer is moved to the next sequence in the database so that it can be compared to the new sequence. In this manner, the new sequence is aligned and compared with every sequence in the database.
It should be noted that if a determination had been made at the decision state that the sequences were not homologous, then the process 200 would move immediately to the decision state 218 in order to determine if any other sequences were available in the database for comparison.
Accordingly, one aspect of the invention is a computer system comprising a processor, a data storage device having stored thereon a nucleic acid sequence as set forth in SEQ ID NO: 1, 3, S, 7, 9, 11, 13, 1 S, and sequences substantially identical thereto, or a polypeptide sequence as set forth in SEQ ID NO: 2, 4, 6, 8,10,12, 14,16, 2S and sequences substantially identical thereto, a data storage device having retrievably stored thereon reference nucleotide sequences or polypeptide sequences to be compared to a nucleic acid sequence as set forth in SEQ ID NO: 1, 3, S, 7, 9, 11, 13, 1 S, and sequences substantially identical thereto, or a polypeptide sequence as set forth in SEQ ll~ NO: 1, 3, S, 7, 9,11,13,15, and sequences substantially identical thereto, and a sequence comparer for conducting the comparison. The sequence comparer may indicate a homology level between the sequences compared or identify structural motifs in the above described nucleic acid code of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, and sequences substantially identical thereto, or a polypeptide sequence as set forth in SEQ )D NO: 2, 4, 6, 8, 10,12,14,16, and sequences substantially identical thereto, or it may identify structural motifs in sequences which are compared to these nucleic acid codes and polypeptide codes. In some embodiments, the data storage device may have stored thereon the sequences of at least 2, 5,10, 15, 20, 25, 30 or 40 or more of the nucleic acid sequences as set forth in SEQ n7 NO: 1, 3, 5, 7, 9, 11, 13, 15, and sequences substantially identical thereto, or the polypeptide sequences as set forth in 10 SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, and sequences substantially identical thereto.
Another aspect of the invention is a method for determining the level of homology between a nucleic acid sequence as set forth in SEQ ~ NO: 1, 3, 5, 7, 9, 11, 13, 15, and sequences substantially identical thereto, or a polypeptide sequence as set forth in SEQ )D NO: 2, 4, 6, 8,10,12, 14,16, and sequences substantially identical 15 thereto, and a reference nucleotide sequence. The method including reading the nucleic acid code or the palypeptide code and the reference nucleotide or polypeptide sequence through the use of a computer program which determines homology levels and determining homology between the nucleic acid code or polypeptide code and the reference nucleotide or polypeptide sequence with the computer program. The computer 20 program may be any of a number of computer programs for determining homology levels, including those specifically enumerated herein, (e.g., BLAST2N with the default parameters or with any modified parameters). The method may be implemented using the computer systems described above. The method may also be performed by reading at least 2, 5,10,15, 20, 25, 30 or 40 or more of the above described nucleic acid 25 sequences as set forth in the SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, or the polypeptide sequences as set forth in the Group B nucleic acid sequences through use of the computer program and determining homology between the nucleic acid codes or polypeptide codes and reference nucleotide sequences or polypeptide sequences.
Figure 4 is a flow diagram illustrating one embodiment of a process 250 in a 30 computer for determining whether two sequences are homologous. The process ~1 begins at a start state 252 and then moves to a state 254 wherein a first sequence to be compared is stored to a memory. The second sequence to be compared is then stored to a memory at a state 256. The process 250 then moves to a state 260 wherein the first character in the first sequence is read and then to a state 262 wherein the first character of the second sequence is read. It should be understood that if the sequence is a nucleotide sequence, then the character would normally be either A, T, C, Cp or I1.
If the sequence is a protein sequence, then it is preferably in the single letter amino acid code so that the first and sequence sequences can be easily compared.
~ determination is then made at a decision state 264 whether the two characters are the same. If they are the same, then the process 250 moves to a state 268 wherein the next characters in the first and second sequences are read. A
determination is then made whether the next characters are the same. If they are, then the process 250 continues this loop until two characters are not the same. If a determination is made that the next two characters are not the same, the process 250 moves to a decision state 274 to determine whether there are any more characters either sequence to read.
If there are not any more characters to read, then the process 250 moves to a state 276 wherein the level of homology between the first and second sequences is displayed to the user. The level of homology is determined by calculating the proportion of characters between the sequences that were the same out of the total number of sequences in the first sequence. Thus, if every character in a first nucleotide sequence aligned with a every character in a second sequence, the homology level would be I00%.
Alternatively, the computer program may be a computer program which compares the nucleotide sequences of a nucleic acid sequence as set forth in the invention, to one or more reference nucleotide sequences in order to determine whether the nucleic acid code of SE(~ ID NO: 1, 3, 5, 7, 9, 11, 13, I5, and sequences substantially identical thereto, differs from a reference nucleic acid sequence at one or more positions. Optionally such a program records the length and identity of inserted, deleted or substituted nucleotides with respect to the sequence of either the reference polynucleotide or a nucleic acid sequence as set forth in SEQ )~ N0: I, 3, 5, 7, 9, 1 I, 13, 1 S, and sequences substantially identical thereto. In one embodiment, the computer program may be a program which determines whether a nucleic acid sequence as set forth in SEQ m NO: 1, 3, 5, 7, 9, 11, 13, 15, and sequences substantially identical thereto, contains a single nucleotide polymorphism (SNP) with respect to a reference nucleotide sequence.
Accordingly, another aspect of the invention is a method for determining whether a nucleic acid sequence as sat forth in SEQ )D NO: 1, 3, 5, 7, 9, I I, I3, I5, and sequences substantially identical thereto, differs at one or more nucleotides from a reference nucleotide sequence comprising the steps of reading the nucleic acid code and the reference nucleotide sequence through use of a computer program which identifies differences between nucleic acid sequences and identifying differences between the nucleic acid code and the reference nucleotide sequence with the computer program. In some embodiments, the computer program is a program which identifies single nucleotide polymorphisms. The method may be implemented by the computer systems described above and the method illustrated in Figure 4. The method may also be performed by reading at least 2, S, 10,15, 20, 25, 30, or 40 or more of the nucleic acid sequences as set forth in SEQ >D NO: 1, 3, 5, 7, 9, 11, 13, 15, and sequences substantially identical thereto, and the reference nucleotide sequences through the use of the computer program and identifying differences between the nucleic acid codes and the reference nucleotide sequences with the computer program.
In other embodiments the computer based system may further comprise an identifier for identifying features within a nucleic acid sequence as set forth in the SEQ m NO: 1, 3, 5, 7, 9, 11, 13, 15 or a polypeptide sequence as set forth in SEQ )I~
NO: 2, 4, 6, 8, I0, 12, 14, 16, and sequences substantially identical thereto.
An "identifier" refers to one or more programs which identifies certain features within a nucleic acid sequence as set forth in SEQ m N0: 1, 3, 5, 7, 9, 11, 13, 15, and sequences substantially identical thereto, or a polypeptide sequence as set forth in SEQ ll~ NO: 2, 4, 6, 8,10, 12,14, 16, and sequences substantially identical thereto. In one embodiment, the identifier may comprise a program which identifies an open reading frame in a nucleic acid sequence as set forth in SEQ m NO: 1, 3, 5, 7, 9, 11, 13, 15, and sequences substantially identical thereto.
Figure 5 is a flow diagram illustrating one embodiment of an identifier process 300 for detecting the presence of a feature in a sequence. The process 300 begins at a start state 302 and then moves to a state 304 wherein a first sequence that is to be checked for features is stored to a memory 115 in the computer system 100. The process 300 then moves to a state 306 wherein a database of sequence features is opened. Such a database would include a list of each feature's attributes along with the name of the feature. For example, a feature name could be "Initiation Codon" and the attribute would be "ATG". Another example would be the feature name "TAATAA Box" and the feature attribute would be "TAATAA". An example of such a database is produced by the University of Wisconsin Genetics Computer Group (www.gcg.com). Alternatively, the features may be structural polypeptide motifs such as alpha helices, beta sheets, or functional polypeptide motifs such as enzymatic active sites, helix-turn-helix motifs or other motifs known to those skilled in the art.
Once the database of features is opened at the state 306, the process 300 moves to a state 308 wherein the first feature is read from the database. A
comparison of the attribute of the first feature with the first sequence is then made at a state 310. A determination is then made at a decision state 316 whether the attribute of the feature was found in the first sequence. If the attribute was found, then the process 300 moves to a state 318 wherein the name of the found feature is displayed to the user.
The process 300 then moves to a decision state 320 wherein a determination is made whether move features exist in the database. If no more features do exist, then the process 300 terminates at an end state 324. However, if more features do exist in the database, then the process 300 reads the next sequence feature at a state 326 and loops back to the state 310 wherein the attribute of the next feature is compared against the first sequence.

It should be noted, that if the feature attribute is not found in the first sequence at the decision state 316, the process 300 moves directly to the decision state 320 in order to determine if any more features exist in the database.
Accordingly, another aspect of the invention is a method of identifying a feature within a nucleic acid sequence as set forth in SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, and sequences substantially identical thereto, or a polypeptide sequence as set forth in SEQ ID NO: 2, 4, 6, 8,10,12, 14,16, and sequences substantially identical thereto, comprising reading the nucleic acid codes) or polypeptide codes) through the use of a computer program which identifies features therein and identifying features within the nucleic acid codes) with the computer program. In one embodiment, computer program comprises a computer program which identifies open reading frames. The method may be performed by reading a single sequence or at least 2, 5, 10, 15, 20, 25, 30, or 40 of the nucleic acid sequences as set forth in SEQ ID NO: 1, 3, S, 7, 9, 11, 13, 15, and sequences substantially identical thereto, or the polypeptide sequences as set forth in SEQ ID NO: 2, 4, 6, 8,10,12,14,16, and sequences substantially identical thereto, through the use of the computer program and identifying features within the nucleic acid codes or polypeptide codes with the computer program.
A nucleic acid sequence as set forth in SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, and sequences substantially identical thereto, or a polypeptide sequence as set forth in SEQ ~ NO: 2, 4, 6, 8, 10,12,14,16, and sequences substantially identical thereto, may be stored and manipulated in a variety of data processor programs in a variety of formats. For example, a nucleic acid sequence as set forth in SEQ ID NO: 1, 3, S, 7, 9, 11, 13, 15, and sequences substantially identical thereto, or a polypeptide sequence as set forth in SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, and sequences substantially identical thereto, may be stored as text in a word processing file, such as MicrosoftWOIZD or WORDPERFECT or as an ASCII file in a variety of database programs familiar to those of skill in the art, such as DB2, SYBASE, or ORACLE. In addition, many computer programs and databases may be used as sequence comparison algorithms, identifiers, or sources of reference nucleotide sequences or polypeptide sequences to be compared to a nucleic acid sequence as set forth in SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, and sequences substantially identical thereto, or a polypeptide sequence as set forth in SEQ
ID NO: 2, 4, 6, 8,10, 12,14, 16, and sequences substantially identical thereto. The following list is intended not to limit the invention but to provide guidance to programs and databases which are useful with the nucleic acid sequences as set forth in SEQ ~
NO: 1, 3, 5, 7, 9, 11, 13, 15, and sequences substantially identical thereto, or the polypeptide sequences as set forth in SEQ ll~ NO: 2, 4, 6, 8, 10,12, 14, 16, and sequences substantially identical thereto.
The programs and databases which may be used include, but are not limited to:
MacPattern (EMBL), DiscoveryBase (Molecular Applications Group), GeneMine 10 (Molecular Applications Group), Look (Molecular Applications Group), Macl,ook (Molecular Applications Group), BLAST and BLAST2 (NCBI), BLASTN and BLASTX (Altschul et al, J. MoI. Biol. 2I5: 403, 1990), FASTA (Pearson and Lipman, Proc. Natl. Aced. Sci. USA, 85: 2444, 1988), FASTDB (Brutlag et al. Comp. App.
Biosci. 6:237-245, 1990), Catalyst (Molecular Simulations Inc.), Catalyst/SHAPE
15 (Molecular Simulations Inc.), Ceriusa.DBAccess (Molecular Simulations Inc.), HypoGen (Molecular Simulations Inc.), Insight II, (Molecular Simulations Inc.), Discover (Molecular Simulations Inc.), CHARMm (Molecular Simulations Inc.), Felix (Molecular Simulations Inc.), Delphi, (Molecular Simulations Inc.), QuanteMM, (Molecular Simulations Inc.), Homology (Molecular Simulations Inc.), Modeler 20 (Molecular Simulations Inc.), ISIS (Molecular Simulations Tnc.), QuantalProtein Design (Molecular Simulations Inc.), WebLab (Molecular Simulations Inc.), WebLab Diversity Explorer (Molecular Simulations Inc.), Gene Explorer (Molecular Simulations Inc.), SeqFold (Molecular Simulations Inc.), the MDL Available Chemicals Directory database, the MDL Drug Data Report data base, the Comprehensive Medicinal 25 Chemistry database, Derwent's World Drug Index database, the BioByteMasterFile database, the Genbank database, and the Genseqn database. Many other programs and data bases would be apparent to one of skill in the art given the present disclosure.
Motifs which may be detected using the above programs include sequences encoding leucine zippers, helix-turn-helix motifs, glycosylation sites, ubiquitination 30 sites, alpha helices, and beta sheets, signal sequences encoding signal peptides which direct the secretion of the encoded proteins, sequences implicated in transcription regulation such as homeoboxes, acidic stretches, enzymatic active sites, substrate binding sites, and enzymatic cleavage sites.
The present invention exploits the unique catalytic properties of enzymes.
Whereas the use of biocatalysts (i.e., purified or crude enzymes, non-living or living cells) in chemical transformations normally requires the identification of a particular biocatalyst that reacts with a specific starting compound, the present invention uses selected biocatalysts and reaction conditions that are specific for functional groups that are present in many starting compounds, such as small molecules. Each Y 0 biocatalyst is specif c for one functional group, or several related functional groups, and can react with many starting compounds containing this functional group.
The biocatalytic reactions produce a population of derivatives from a single starting compound. These derivatives can be subjected to another round of biocatalytic reactions to produce a second population of derivative compounds. Thousands of 15 variations of the original small molecule or compound can be produced with each iteration of biocatalytic derivatization.
Enzymes react at specific sites of a starting compound without affecting the rest of the molecule, a process which is very difficult to achieve using traditional chemical methods. This high degree of biocatalytic specificity provides the means to 20 identify a single active compound within the library. The library is characterized by the series of biocatalytic reactions used to produce it, a so called "biosynthetic history". Screening the library for biological activities and tracing the biosynthetic history identifies the specific reaction sequence producing the active compound. The reaction sequence is repeated and the structure of the synthesized compound 25 determined. This mode of identification, unlike other synthesis and screening approaches, does not require immobilization technologies, and compounds can be synthesized and tested free in solution using virtually any type of screening assay. It is important to note, that the high degree of specificity of enzyme reactions on functional groups allows for the "tracking" of specific enzymatic reactions that make up the 30 biocatalytically produced library.

Many of the procedural steps are performed using robotic automation enabling the execution of many thousands of biocatalytic reactions and screening assays per day as well as ensuring a high level of accuracy and reproducibility. As a result, a library of derivative compounds can be produced in a matter of weeks which would take years to produce using current chemical methods.
In a particular embodiment, the invention provides a method for modifying small molecules, comprising contacting a polypeptide encoded by a polynucleotide described herein or enzymatically active fragments thereof with a small molecule to produce a modified small molecule. A library of modified small molecules is tested to determine if a modified small molecule is present within the library which exhibits a desired activity. A specific biocatalytic reaction which produces the modified small molecule of desired activity is identified by systematically eliminating each of the biocatalytic reactions used to produce a portion of the library, and then testing the small molecules produced in the portion of the library for the presence or absence of the modified small molecule with the desired activity. The specific biocatalytic reactions which produce the modified small molecule of desired activity is optionally repeated. The biocatalytic reactions are conducted with a group of biocatalysts that react with distinct structural moieties found within the structure of a small molecule, each biocatalyst is specific for one structural moiety or a group of related structural moieties; and each biocatalyst reacts with many different small molecules which contain the distinct structural moiety.
The components of the present invention are suitable for formation of a kit.
In particular, the invention provides a kit containing at least one container containing a purified protein having an amino acid sequence of SEQ m N0:2, 4, 6, 8, 10, 12, or 14, 16 or homologous sequences thereof having polymerase activity at a temperature in a range from about 90°C to 113°C.. In a preferred embodiment, the protein is SEQ
m N0:16 or homologous sequences thereof having polymerase activity at a temperature in a range from about 90°C to 113°C. In one aspect, the kit contains at least one additional container, containing dNTPs, PCR-ready water, standard long and GC-rich positive control templates, control primer sets or any combination thereof.

The invention will be further described with reference to the following examples; however, it is to be understood that the invention is not limited to such examples.
EXAMPLE 1-OPTIMIZATION TESTING FOR SEA Il) NO~16 POLYMERASE
Optimization tests were conducted to determine the most favorable conditions for utilizing the DNA polymerise of SEQ m NO: 14, 16 for polymerise activity in PCR at temperatures in the range from 85° C to 95° C. The parameters tested were buffer, pH, salt and salt concentration, Mg ion source, detergent and detergent concentration.
The buffers tested were Tris-HCI, Tris-HOAc, phosphate buffer, Dicine, HEPES, MOPS, and TAPS. The most ideal buffer was Tris HCI.
The pH range tested was from 7.5 to 10Ø The most ideal pH was 10Ø
The salts tested were NaCI, NaOAc, KCI, (NH4)aSO4, NH4OAc, and LiCI at concentrations from S mM to 200 mM. The most favorable salt was 25mM NaOAc.
The magnesium ion sources tested were MgCl2, Mg(OAc)2, MgS04 at concentrations from 0.5 mM to 5 mM. The most favorable of these was 2 to 2.5 mM
Mg(KOAc)2.
The detergents tested were NP-40, Tween-20~, and Triton X-100~ detergents at concentrations of O.OO1T to 0.5% by volume. The best condition was 0.002%
concentration of a mixture of NP-40 and Tween-20 detergents, In view of these results, it was concluded that the most favorable buffer for conducting PCR using the DNA polymerise of SEQ m N0:16 utilizes 60 mM Tris-HCI, pH 10.0, 25 mM NaOAc, 2 mM Mg(OAc)2, and 0.002% NP-40/Tween-20.

EXAMPLE 2 - High fidelity of the DNA nalymerase of SEQ gD N~~1Ca The 3.3 kb lacZ gene was amplified and cloned. A (3-galactosidase assay, as described by Barnes was performed. (Barnes, W.M. (1994) Proc. Natl. Acid.
Sci., 91 /:2216-2220.) The results of the comparison of the DNA polymerise of SEQ m NO:16 and Taq are shown in Figure 6. It can be seen from the Figure that the relative frequency of mutation is greater in Taq, than in DNA polymerise of SEQ ~ NO:I6. With DNA polymerise of SEQ m N0:16, the mutational frequency per base pair per template doubling was 6.0 x 10-5, while it was 1.~ x 10'4 with Taq.
EXAMPLE 3 - Yield and Versatility of the DNA uolymerase of SEQ ID NO~lf Three cDNA templates, long templates and GC-rich templates were amplified using DNA polymerise of SEQ ID N0:16. The results are set forth in Figures 7, and 9.
Three cDNA templates were prepared, a 3.0 kb thyroid hormone receptor coactivating gene, a 3.3 kb Oncostatin-M specific receptor beta gene and a 2.1 kb portion of protein tyrosine Phosphatase Receptor beta gene. All three templates were amplified using 10 nanograms of HeLa first strand cDNA for 30 cycles of PCR.
PCR
was performed twice on each template, first using DNA polymerise of SEQ 117 N0:16 as the polymerise and second using Taq. SDS-PAGE gels were run to compare the results with DNA polymerise of SEQ IIJ N0:16 versus Taq. The resulting gels indicated that DNA polymerise of SEQ ID N0:16 was able to amplify all three templates with a yield similar to that achieved with Taq.
Additionally, a lambda phage genomic DNA of varying length were amplified by PCR, using DNA polymerise of SEQ ID N0:16 without optimization. SDS-PAGE gels were run to determine the amount of amplification of each of the templates. The gels showed the DNA polymerise of SEQ ID N0:16 was able to amplify templates of 10, 15, 20 and 25 kb without optimization.

Insulin-like growth factor receptor II (IGFRII), with a GC content of greater that 90%, was amplified by PCR using three separate polymerises, DNA
polymerise of SEQ ID N0:16 , Taq polymerise, and Advantage- GCTM. Each amplification used 25 cycles of PCR without optimization. SDS-PAGE gels were run to compare the 5 results with each enzyme. The results showed that the DNA polymerise of SEQ
~
N0:16 successfully amplified the template.
Figure 7 clearly shows that SEQ ID N0:16 was able to amplify multiple templates and produce robust yields relative to Taq polymerise. Samples were amplified using either SEQ ID NO:16 or Taq, as indicated above the lanes.
10 Amplifications used ten nanograms of bIeLa first strand cDNA for 30 cycles of PCR.
Lanes 1, 4: 3.0 kb thyroid hormone receptor coactivating gene; Lanes 2, 5: 3.3 kb Oncostatin-M specific receptor beta gene; Lanes 3, 6: 2.1 kb Portion of protein tyrosine Phosphatase Receptor beta gene.
Figure 8 clearly demonstrates that SEQ ID N0:16 was able to amplify lambda 1 S phage genomic DNA templates up to 25 kb without additional optimization.
Figure 9 shows the amplification of a 500 by region of Insulin-like growth factor receptor II (IGFRII), which has a >90% GC content, using three DNA
polymerises. Each amplification was performed with 25 cycles of PCR without optimization. Lane 1: SEQ ID N0:16; Lane 2: Taq polymerise; Lane 3: Advantage-20 GCTM (Invitrogen). Lane 1 in Figure 9 demonstrates that SEQ ID N0:16 successfully amplified a portion of IGFRII cDNA, which is greater than 90% GC-rich, better than other commercially available DNA polymerises.
EXAMPLE 4-PROOFREADING ACTIVITY OF SEQ ID NO:lf The proofreading activity of SEQ ID N0:16 results in PCR products with 25 blunt ends. Thus, the PCR products can be cloned using, for example, TOPO~
Blunt Cloning methods (see Invitrogen, San Diego, CA) or analogous systems. TOPO~
Cloning makes cloning PCR products faster and more efficient with a quick S-minute ligation method. The key to TOPO~ Cloning is the enzyme topoisomerase I. This enzyme's normal role is to nick and relax supercoiled DNA and then rejoin the ends during replication. A variety of cloning and expression vectors have been designed that take advantage of the rejoining activity of topoisomerase I and allow one to ligate PCR products in just 5 minutes. The list below outlines some of the TOPO~
vectors currently available for cloning PCR products amplified with SEQ 113 N0:16 DNA
Polymerase (pCR~-Blunt II-TOPO~ ; pCR~4Blunt-TOPO~ ; pUniBlunt/VS-His-TOPO~ ; pUniD/VS-His-TOPO~). It should be understood that these are provided only by way of example and not by way of limitation.

SEO ID N0:16 A poly dT DNA primer was used to hybridize to poly A tailed messenger RNA. To this was added PCR buffer (with and without Mg++, and with varying concentrations of Mn++), dATP, dCTP, dGTP, SEQ ID N0:16 polymerase and alpha-3H-dTTP. The mix was incubated at 72C and was followed by a TCA precipitation.
This precipitaion separates and removes the free nucleotides from enzyme incorporated ones. The radioactive activity (in CPM - counts per minute) in the incorporated sample is indicative of the amount of reverse transcriptase activity in the reaction. Figure 10 shows a comparison of RT activity between SEQ B7 N0:16 in the presence and absence of Mg++.

Enzyme activity was measured by incoporation of alpha-3H-dTTP in anextension reaction of activated calf thymus DNA by a polymerase. A reaction mix was set up using PCR buffer, dATP, dGTP, dCTP, activated calf thymus DNA, and alpha-3H-dTTP. A polymerase enzyme (in buffer) was preincubated at 85°C, 90°C, or 95°C for various time periods (0 through 240 minutes). Following this heat treatment, the enzyme was added to thereaction mix and incubated at the same temperature for a fixed timeperiod. This was followed by a TCA precipitation which separates free nucleotides from enzyme incorporated ones. The radioactive activity (in CPM) in the incorporated sample is indicative of the amount of polymerase activity in the reaction. A plot of the CPM vs. preincubation time can be constructed for each temperature which is indicative of the thermostability of the enzyme (See Figure 11).
Although the invention has been described with reference to the above examples, it will be understood that modifications and variations are encompassed within the spirit and scope of the invention. Accordingly, the invention is limited only by the following claims.

1.
SEQUENCE LISTING
<110> DIVERSA CORPORATION
<120> ENZYMES HAVING HIGH TEMPERATURE POLYMERASE ACTIVITY AND METHODS OF USE
THEREOF
<130> DIVER1350-3W0 <150> US 09/656,309 <151> 2000-09-06 <150> US 09/391,340 <151> 1999-09-07 <150> US 08/907,166 <151> 1997-O8-06 <160> 16 <170> PatentIn version 3.0 <210>

<211>

<212>
DNA

<213>
Ammonifex degensii <400>

gtgaagggaaaaaccttgctccttttggacggctcgagcatagcctaccgggcctttttc 60 gcccttccctccctccgcacccgtaccggcctgcccaccggtgccgtgtacggctttacc 120 tccatgctcttcaaagtgctggaagaaaggcgtcccacggccatagtggcggctttcgat 180 aaaagcaagaccaccttccggcacgccctggcggagacctacaaggcccaccgccccgcc 240 actccggatgaactgcgccagcagttcaacctcatcaaggaagtgctgactgccctcaac 300 gttccggtagtggaaagggagggttttgaggccgacgacctcatcggcactctggtagac 360 cgggcggaaaaagagggttggcagtgccttatcgtcaccggcgacctcgacgccctgcag 420 ctggtttcccccctcaccaccgtcgtcctcatgcgcaaggggataagcgaaatagcggtc 480 tttaacgaggcggaggtgaaacgccgcttcggcgtcacaccccgccaactccccgacttc 540 aaagccttggccggagatgcctcggacaacatccccgggcttccgggcatagggcccaaa 600 actgcctcccgtctgctacagtcccaccagagcctggagaaattgctggagagcaaggaa 660 ttttttccggccaagctgcgcgaaaccttagaaaggcacaaggaagaagcggttttggcc 720 aagaaactggccctcatccgccgcgatgtgccgctggaagaggagatcatccggccctgg 780 ccgggacccaacattttagccacgctggaggtcttctcgcgcctggaattccgcaccttg 840 gccaagagattcctcgagcttttccccgaggcacgcctcctgtccgccagtggccttacc 900 ccctccgctgtccgcgtaaaggtagaaagacccgaagaactagaaagactgggggaagag 960 WO 02/20735 _ PCT/USO1/28007 ctcggaaggcaagaatttgcggCCCtggCttaCCCCCCCgttCttCggCgcaaagccact1020 tcttctttcttggctctctgtctgggaggggaaaaggtcttcctgctggaagggccggag1080 gtgctcaagagcttcttccggctgctcgaagaaaagggaggtcttgtcagtacctacgac1140 gctaaatcctgccttcacgccctggaaccttacggcttcaagcccgaaatgatcgggttt1200 gacgtcctgctggcagcctacctggtgaaccccgccgccaacaacgaactgggggcgatc1260 gccttcgagcacgcgggctttatgctctccccgggagcagagctcccggaaaaagcccag1320 gcgatctaccagctcacccccatcctaaaaagtaagattaagcttcaggaacaggagtac1380 ctttattactccgtggagcttcccttagccgccgtcttggccgacatggagaaagtcggg1440 gtgaaagtttcggaggaaaggctgcgttctctctccaaggagctgggagagcagctggct1500 cagctttccgaggaaatctataagctcgccggcgagcgcttcaacctgaattccccccgc1560 cagctcggctacatcctgttcgagaagttgggactcaaaccggtcaagaagaccaaaacc1620 ggctactccaccgacgcttcggtcctagaaaagctagccgagcacgagatcgtggctaag1680 gtgctcgtctaccggcagctggccaaactaaagagcacttacaccgacgcacttccagag1740 ctcatcgacccggccaccgggcgcctgcacaccaccttcttgcaggcagggacggcaacg1800 ggaagactggcctccgccgagcccaacctgcagaacattcccgtacgcgattctctggga1860 aggcgcatccggcaggccttcgtggctgagggccccgactacgtgctactaagcgccgac1920 tactcccagatagagcttcgggtcttggcccacctttccgaagatccggggctgtgtgag1980 gcctttgttaaaggagaagacattcacgcccgcacggcggccgagatcttcggcgtttct2040 cctcaggaagtgacgccggagatgcgggccaaggccaaggtggtaaacttcgggatcgtt2100 tacggcatgagcgattacggcctttcccaggagctcaagatcgagcccggcgaggcgcac2160 gagtatatagaacggtacttccggcgctatccgcgcgtgaagcagttcatcgagcgggtg2220 atcgcccaggcccgagagaagggctacgtgaccactattctcaaccgccgccgctacatc2280 cctgaaatactgagcagcaaccgcaaccagcgtcagctgggggagcgcctggccatcaac2340 accaccattcaaggaagtgcggccgatcttataaaaaaggccatggtggacatccaccgg2400 caactgaaagggcaaggatttaaatgccggatgatcctccaggtgcacgacgaactcctc2460 tccgaggtgcctaaagaagaactggaaaaggtggcacctataataaaaagcaccatggag2520 caagccttaccttttaaggttcccataaaggccaacctcaaggtagggcctaactggcaa2580 gacatggaagagtacgaggtggaatga 2607 <210>

<211>

<212>
PRT

<213>
Ammonifeac degensii WO 02/20735 _ PCT/USO1/28007 <400> 2 Val Lys Gly Lys Thr Leu Leu Leu Leu Asp Gly Ser Ser Ile Ala Tyr Arg Ala Phe Phe Ala Leu Pro Ser Leu Arg Thr Arg Thr Gly Leu Pro Thr Gly Ala Val Tyr Gly Phe Thr Ser Met Leu Phe Lys Val Leu Glu Glu Arg Arg Pro Thr Ala Ile Val Ala Ala Phe Asp Lys Ser Lys Thr Thr Phe Arg His Ala Leu Ala Glu Thr Tyr Lys Ala His Arg Pro Ala Thr Pro Asp Glu Leu Arg Gln Gln Phe Asn~Leu Ile Lys Glu Val Leu Thr Ala Leu Asn Val Pro Val Val Glu Lys Glu Gly Phe Glu Ala Asp Asp Leu Ile Gly Thr Leu Val Asp Arg Ala Glu Lys Glu Gly Trp Gln Cys Leu Ile Val Thr Gly Asp Leu Asp Ala Leu Gln Leu Val Ser Pro Leu Thr Thr Val Val Leu Met Arg Lys Gly Ile Ser Glu Ile Ala Val Phe Asn Glu Ala Glu Val Lys Arg Arg Phe Gly Val Thr Pro Arg Gln Leu Pro Asp Phe Lys Ala Leu Ala Gly Asp Ala Ser Asp Asn Ile Pro Gly Leu Pro Gly Ile Gly Pro Lys Thr Ala Ser Arg Leu Leu Gln Ser His Gln Ser Leu Glu Lys Leu Leu Glu Ser Lys Glu Phe Phe Pro Ala Lys Leu Arg Glu Thr Leu Glu Arg His Lys Glu Glu Ala Val Leu Ala Lys Lys Leu Ala Leu Ile Arg Arg Asp Val Pro Leu Glu Glu Glu Ile Ile Arg Pro Trp Pro Gly Pro Asn Ile Leu Ala Thr Leu Glu Val Phe Ser Arg Leu Glu Phe Arg Thr Leu Ala Lys Arg Phe Leu Glu Leu Phe Pro Glu Ala Arg Leu Leu Ser Ala Ser Gly Leu Thr Pro Ser Ala Val Arg Val Lys Val Glu Arg Pro Glu Glu Leu Glu Arg Leu Gly Glu Glu Leu Gly Arg Gln Glu Phe Ala Ala Leu Ala Tyr Pro Pro Val Leu Arg Arg Lys Ala Thr Ser Ser Phe Leu Ala Leu Cys Leu Gly Gly Glu Lys Val Phe Leu Leu Glu Gly Pro Glu Val Leu Lys Ser Phe Phe Arg Leu Leu Glu Glu Lys Gly Gly Leu Val Ser Thr Tyr Asp Ala Lys Ser Cys Leu His Ala Leu Glu Pro Tyr Gly Phe Lys Pro Glu Met Ile Gly Phe 385 390 395 , 400 Asp Val Leu Leu Ala Ala Tyr Leu Val Asn Pro Ala Ala Asn Asn Glu Leu Gly Ala Ile Ala Phe Glu His Ala Gly Phe Met Leu Ser Pro Gly Ala Glu Leu Pro Glu Lys Ala Gln Ala Ile Tyr Gln Leu Thr Pro Ile Leu Lys Ser Lys Ile Lys Leu Gln Glu Gln Glu Tyr Leu Tyr Tyr Ser Val Glu Leu Pro Leu Ala Ala Val Leu Ala Asp Met Glu Lys Val Gly Val Lys Val Ser Glu Glu Arg Leu Arg Ser Leu Ser Lys Glu Leu Gly Glu Gln Leu Ala Gln Leu Ser Glu Glu Ile Tyr Lys Leu AIa Gly Glu Arg Phe Asn Leu Asn Ser Pro Arg Gln Leu Gly Tyr Ile Leu Phe Glu Lys Leu Gly Leu Lys Pro Val Lys Lys Thr Lys Thr Gly Tyr Ser Thr Asp Ala Ser Val Leu Glu Lys Leu Ala Glu His Glu Ile Val Ala Lys Val Leu Val Tyr Arg Gln Leu Ala Lys Leu Lys Ser Thr Tyr Thr Asp Ala Leu Pro Glu Leu Ile Asp Pro Ala Thr Gly Arg Leu His Thr Thr Phe Leu Gln Ala Gly Thr Ala Thr Gly Arg Leu Ala Ser Ala Glu Pro Asn Leu Gln Asn Ile Pro Val Arg Asp Ser Leu Gly Arg Arg Ile Arg 67.0 y 615 620 Gln Ala Phe Val Ala Glu Gly Pro Asp Tyr Val Leu Leu Ser Ala Asp Tyr Ser Gln Ile Glu Leu Arg Val Leu Ala His Leu Ser Glu Asp Pro Gly Leu Cys Glu Ala Phe Val Lys Gly Glu Asp Ile His Ala Arg Thr Ala Ala Glu Ile Phe Gly Val Ser Pro Gln Glu Val Thr Pro Glu Met Arg Ala Lys Ala Lys Val Val Asn Phe Gly Ile Val Tyr Gly Met Ser Asp Tyr Gly Leu Ser Gln Glu Leu Lys Ile Glu Pro Gly Glu Ala His Glu Tyr Ile Glu Arg Tyr Phe Arg Arg Tyr Pro Arg Val Lys Gln Phe Ile Glu Arg Val Ile Ala Gln Ala Arg Glu Lys Gly Tyr Val Thr Thr Ile Leu Asn Arg Arg Arg Tyr Ile Pro Glu Ile Leu Ser Ser Asn Arg Asn Gln Arg Gln Leu Gly Glu Arg Leu Ala Ile Asn Thr Thr Ile Gln Gly Ser Ala Ala Asp Leu Ile Lys Lys Ala Met Val Asp Ile His Arg Gln Leu Lys Gly Gln Gly Phe Lys Cys Arg Met Ile Leu Gln Val His Asp Glu Leu Leu Phe Glu Val Pro Lys Glu Glu Leu Glu Lys Val Ala Pro Ile Ile Lys Ser Thr Met Glu Gln Ala Leu Pro Phe Lys Val Pro Ile Lys Ala Asn Leu Lys Val Gly Pro Asn Trp Gln Asp Met GIu Glu Tyr Glu Val Glu <210> 3 <211> 2412 <212> DNA
<213> Pyrolobus fumarius <400> 3 atgactgaag ttgtattcac ggttttagac tctagctacg aggttgttgg taaagagcct 60 caggtaatca tatggggtat tgctgagaac ggcgagaggg tagtcctcat tgacaggtct 120 tttcgcccat acttctatgc gctgcttgca ccgggcgccg atcctaagca ggtagcacaa 180 cgtattcgtg cattgagtag gccaaagagc ccgattatag gtgtagagga tgacaagagg 240 aagtacttcg ggaggcctcg tagggtctta cgtattcgca ccgtgctacc cgaggctgtt 300 agggagtatcgcgaactcgtaaagaacgttgatggtgttgaggatgttctagaggcggat36.0 atacgcttcgctatgcgctatctcatagatcacgatctatttcctttcacctggtaccgt420 gtagaggctgagcccctcgagaacaagatgggcttccgtgtcgacaaggtatacctggtt480 aagagcaggccggagccactttatggtgaggctctcgcaccaaccaagcttcccgatctt540 aggatactcgcgttcgatattgaagtttatagcaagcaagggtcgccgcgtccagagcgc600 gatcctgtaatagtgatagctgtgaagactgacgatggcgatgaggtgctattcattgca660 gagggcaaagacgatcgaaaaccgatacgcgagtttgtagagtacgtgaagaggtatgac720 cccgacataatagtcggttataacaacaatcatttcgattggccttatcttttgaggcgc780 gcccgcatcctaggcataaagcttgatgtgactagaagagttggcgccgagcccaccact840 agcgtacatgggcacgtctctgtccctggcaggcttaacgtagatctgtacgactatgcc900 gaagagatgccagagatcaagataaagagtctcgaggaggtcgcagagtatctaggcgtg960 atgaagaagagtgaacgcgttatcatcaattggtgggagattccagactattgggacgac1020 ccgaagaagagaccactattactgcaatacgcgcgcgacgatgtccgcgctacttacggc1080 ttagccgagaagatattgccgtttgctatccagttgtcgtacgtaacaggtctcccacta1140 gaccaggtaggtgcgatgagtgttggctttcgacttgaatggtacctgatacgcgcggcg1200 tttaagatgaaagagcttgtgccgaaccgcgttgagcgcccagaagagacttaccgtggc1260 gctatagttcttgagccgttgagaggcgtgcacgagaatatagccgtactcgactttagc1320 tcgatgtacccaaacatcatgataaagtacaatgttggtcctgacacgcttgtgaggcct1380 ggtgaaaagtgtggcgagtgtggttgctgggaggccccggaggtcaagcacaggttccgt1440 aggtgtccgcccggcttcttcaagacagttcttgagaggctgttagagcttcgtaagcgt1500 gtgcgtgctgaaatgaagaagtatcctccggatagcccagaatatcgactgttggatgaa1560 aggcagaaggcgttgaaggttcttgcaaacgctagttacggctacatgggttggagcggc1620 gctaggtggtattgcagggagtgcgcaaaggctgtcacggcttggggtaggcacctcata1680 cgcaccgccatcaacatagctcgtaaactaggcctcaaggtgatctacggtgacacagat1740 tcgctcttcgtgacctatgatccggagaaggtggaaaatttcatcaaaattataaaggag1800 gagctggggttcgaaatcaagctagagaaggtgtacaaacgcttattctttacagaggct1860 aagaagaggtacgctggccttctcgaggacggacgtatagatattgtcggtttcgaggct1920 gtacgtggcgattggtgtgaactcgccaaggaggttcagactaaggttgtcgaaatagta1980 ttgaagacgagtgaggtgaacaaggctgtagagtacgtcaggaagattgtgaaagagttg2040 gaggagggcaaggttcccatagagaagcttgtaatctggaagacccttagtaagcgtctt2100 -gaggagtacacaacggaggcaccacacgtcgttgcagcgaagaggatgctgtcagcaggc 2160 taccgggtaagcccaggcgacaagatagggtatgtaatagtgaagggtggtggccgtatc 2220 agtcaaagagcatggccatacttcatggtcaaggatcctagccagatagacgtgacctac 2280 tatgttgaccaccaaatcatcccggctgcattgagaatactgggctactttggcatcacc 2340 gagaagaagctgaaagcaagtgcaactgggcagaagactctcttcgactttctagccaag 2400 aagagcaagtas 2412 <2l0> 4 <211> 803 <212> PRT
<213> Pyrolobus fumarius <400> 4 Met Thr Glu Val Val Phe Thr Val Leu Asp Ser Ser Tyr Glu Val Val Gly Lys Glu Pro Gln Val Ile Ile Trp Gly Ile Ala Glu Asn Gly Glu Arg Val Val Leu Ile Asp Arg Ser Phe Arg Pro Tyr Phe Tyr Ala Leu Leu Ala Pro Gly Ala Asp Pro Lys Gln Val Ala Gln Arg Ile Arg Ala Leu Ser Arg Pro Lys Ser Pro Ile Ile Gly Val Glu Asp Asp Lys Arg Lys Tyr Phe Gly Arg Pro Arg Arg Val Leu Arg Ile Arg Thr Val Leu Pro Glu Ala Val Arg Glu Tyr Arg Glu Leu Val Lys Asn Val Asp Gly Val Glu Asp Val Leu Glu Ala Asp Ile Arg Phe Ala Met Arg Tyr Leu Ile Asp His Asp Leu Phe Pro Phe Thr Trp Tyr Arg VaI Glu Ala Glu Pro Leu Glu Asn Lys Met Gly Phe Arg Val Asp Lys Val Tyr Leu Val Lys Ser Arg Pro Glu Pro Leu Tyr Gly Glu Ala Leu Ala Pro Thr Lys Leu Pro Asp Leu Arg Ile Leu Ala Phe Asp Ile Glu Val Tyr Ser Lys Gln Gly Ser Pro Arg Pro Glu Arg Asp Pro Val Ile Val Ile Ala Val Lys Thr Asp Asp Gly Asp Glu Val Leu Phe Ile Ala Glu Gly Lys Asp Asp Arg Lys Pro Ile Arg Glu Phe Val Glu Tyr Val Lys Arg Tyr Asp Pro Asp Ile Ile Val Gly Tyr Asn Asn Asn His Phe Asp Trp Pro Tyr Leu Leu Arg Arg Ala Arg Ile Leu Gly Ile Lys Leu Asp Val Thr Arg Arg Val Gly Ala Glu Pro Thr Thr Ser Val His Gly His Val Ser Val Pro Gly Arg Leu Asn Val Asp Leu Tyr Asp Tyr Ala Glu Glu Met Pro Glu Ile Lys Ile Lys Ser Leu Glu Glu Val Ala Glu Tyr Leu Gly Val Met Lys Lys Ser Glu Arg Val Ile Ile Asn Trp Trp Glu Ile Pro Asp Tyr Trp Asp Asp Pro Lys Lys Arg Pro Leu Leu Leu Gln Tyr Ala Arg Asp Asp Val Arg Ala Thr Tyr Gly Leu Ala Glu Lys Ile Leu Pro Phe Ala Ile Gln Leu Ser Tyr Val Thr Gly Leu Pro Leu Asp Gln Val Gly Ala Met Ser Val Gly Phe Arg Leu Glu Trp Tyr Leu Ile Arg Ala Ala Phe Lys Met Lys Glu Leu Val Pro Asn Arg Val Glu Arg Pro Glu Glu Thr Tyr Arg Gly Ala Ile Val Leu Glu Pro Leu Arg Gly Val His Glu Asn Ile Ala Val Leu Asp Phe Ser Ser Met Tyr Pro Asn Ile Met Ile Lys Tyr Asn Val Gly Pro Asp Thr Leu Val Arg Pro Gly Glu Lys Cys Gly Glu Cys Gly Cys Trp Glu Ala Pro Glu Val Lys His Arg Phe Arg Arg Cys Pro Pro Gly Phe Phe Lys Thr Val Leu Glu Arg Leu Leu Glu Leu Arg Lys Arg Val Arg Ala Glu Met Lys Lys Tyr Pro Pro Asp Ser Pro Glu Tyr Arg Leu Leu Asp Glu Arg Gln Lys Ala Leu Lys Val Leu Ala Asn Ala Ser Tyr Gly Tyr Met Gly Trp Ser Gly Ala Arg Trp Tyr WO 02/20735 _ PCT/USO1/28007 Cys Arg Glu Cys Ala Lys Ala Val Thr Ala Trp Gly Arg His Leu Tle Arg Thr Ala Ile Asn Ile Ala Arg Lys Leu Gly Leu Lys Val Ile Tyr Gly Asp Thr Asp Ser Leu Phe Val Thr Tyr Asp Pro Glu Lys Val Glu Asn Phe Ile Lys Ile Ile Lys Glu Glu Leu Gly Phe Glu Ile Lys Leu Glu Lys Val Tyr Lys Arg Leu Phe Phe Thr Glu Ala Lys Lys Arg Tyr Ala Gly Leu Leu Glu Asp Gly Arg Ile Asp Ile Val Gly Phe Glu Ala Val Arg Gly Asp Trp Cys Glu Leu Ala Lys Glu Val Gln Thr Lys Val Val Glu Ile Val Leu Lys Thr Ser Glu Val Asn Lys Ala Val Glu Tyr Val Arg Lys Ile Val Lys Glu Leu Glu Glu Gly Lys Val Pro Ile Glu Lys Leu Val Ile Trp Lys Thr Leu Ser Lys Arg Leu Glu Glu Tyr Thr Thr Glu Ala Pro His Val Val Ala Ala Lys Arg Met Leu Ser Ala Gly Tyr Arg Val Ser Pro Gly Asp Lys Ile Gly Tyr Val Ile Val Lys Gly Gly Gly Arg Ile Ser Gln Arg Ala Trp Pro Tyr Phe Met Val Lys Asp Pro Ser Gln Ile Asp Val Thr Tyr Tyr Val Asp His Gln Ile Ile Pro Ala Ala Leu Arg Ile Leu Gly Tyr Phe Gly Ile Thr Glu Lys Lys Leu Lys Ala Ser Ala Thr Gly Gln Lys Thr Leu Phe Asp Phe Leu Ala Lys Lys Ser Lys <210> 5 <211> 2367 <212> DNA
<213> Archaeoglobus lithotrophicus <400> 5 atgataaagg tcaagggctg gctgctcgat gcagattata tcaccgaaaa cgatcgagcc 60 gttataaggc tatggtgtaa ggatgaggaa ggaatattta tcgcatacga tcactcattc 120 WO 02/20735 _ PCT/USO1/28007 cagccctacttttacgcactcaaagaagagggtatcactgccgaagatatagtgaaaata180 aaggttcaaacgaaaaaagaagtaattacgccgttaaaagttgaggaaaccacagccaaa240 aatcttggtagggaggttgaagttttcaagatatatgcaagacaccctcagcacgtcccc300 aaacttcgtgaggttgtttcgcagtatctggagattagggaggcagacataccttttgcc360 tatcgatacctcatagataaaaatcttgcgtgtatggatggagttgtaattgaaggcgtt420 gaaagacgtgagaaggggttgagatgttacgaaatcaagagaatagaaagagattccaga480 caggattttcccgaactcaaggttatggcgtttgattgcgaaatgctctcagaggttggt540 atgcccgatccagagaaagatcctatcatagtcatatcaattaaatcgggtgaatacgag600 gaaatcctcaacggtgataacgagagagaattgcttaccagatttgtcaagataattcgc660 gatattgatcccgacattatagttggatacaatcaggacagctttgactggccctatatc720 aagaagagagctgagaaactgagggttaagcttgacatcggaagagatagaagcgaactg780 gctatcaggggaggaagaccaaagattgctggcaggttgaacgtggatctctatgatatt840 gcaatgaggagtctcgatgtaaaggtgaagaagctcgaaaacgttgcagagtttctgggt900 aagaaaatagagcttgcagatattgaagcgaaggatatctacaagcactggacatcgggc960 gacagggaaagcgtaatcaaatactcccggcaggacatcctgcacacgtacttcatagct1020 gaagaattgctgccaatgcattacgaactttccagaatgatacgcatacctctcgatgat1080 gtgacaaggagcgggagaggtaagcaggttgagtggctgctgttaagcgaagcacacaaa1140 cttggcgaacttgcacccaaccccagagagatggccgacagctatgaaggagcattcgtg1200 ctcgagcccgcaagaggattgcatgagaacgtaatctgcctggactttgcgtccatgtat1260 ccctcaataatgatttcatacaacatcagccccgacacgcttgtaataggcaaatgcgac1320 gattgcaatgtagcgccggaggtggggcacaaattcaggaaacatcctgatggttttttc1380 aaaagaatactcaaaatgctgattgagaaaagaagagaaataaagaaggttatgaaaaca1440 cttgactacaactcgccagaatacaagctgctcgatataaagcaggcaacgctgaaagtt1500 cttacaaactcgttttacggttatactgggtggagtcttgcgagatggtactgcaaggag1560 tgcgctgaagctacaacggcatggggcagacactttatcaaaacatctgcaagaattgcg1620 aaagagcttggatttgaagtgctatatggggatacagatagcatctttgttaaaaaagat1680 ggattgagcctggaagagctcaaaaaagaagttaaaaagctcataggtaaactttcggaa1740 gagatgccaatacaaatagagatagatgaatactacgagacaatattcttcgttgaaaag1800 aaaaggtatgctggattgacacaggatggaagaataattgtaaagggtcttgaagtcaga1860 agaggcgactggtgcgagcttgcaaagaagatacagaaaggtgtaatagaaatcattctg1920 aaggaaaagaatcctgaaaaagctgctgagtatgtgaaaggagtcatagaggagataaag1980 WO 02/20735 _ PCT/USO1/28007 gcaggcaaaattccgcttgaagattatatcatctacaagggattgacgagaaaaccatca2040 aagtacgagagtatgcaggctcacgtaaaagctgccatgaaggcggcaaagagaggaata2100 gtatacacaatcggctcaaaggttggttttgtcgttacaaaaggtgtggggaacataggt2160 gatagggcttttccatctgatctgatagaggactttgacggtgaagtgatcacagatctt2220 gacggaaacaagtacaagatcgacaaggaatactatatagaccatcaggtactgccatcg2280 gttcttcgaattctcgagaggttcggatacaccgaggcacagctaaaaggtgctgcggag2340 cagcaaacgctagatgctttctggtaa 2367 <210> 6 <211> 788 <212> PRT
<213> Archaeoglobus lithotrophicus <400> 6 Met Ile Lys Val Lys Gly Trp Leu Leu Asp Ala Asp Tyr Ile Thr Glu Asn Asp Arg Ala Val Ile Arg Leu Trp Cys Lys Asp Glu Glu Gly Ile Phe Ile Ala Tyr Asp His Ser Phe Gln Pro Tyr Phe Tyr Ala Leu Lys Glu Glu Gly Ile Thr Ala Glu Asp Ile Val Lys Ile Lys Val Gln Thr Lys Lys Glu Val Ile Thr Pro Leu Lys Val Glu Glu Thr Thr Ala Lys Asn Leu Gly Arg Glu Val Glu Val Phe Lys Ile Tyr Ala Arg His Pro Gln His Val Pro Lys Leu Arg Glu Val Val Ser Gln Tyr Leu Glu Ile Arg Glu Ala Asp Ile Pro Phe Ala Tyr Arg Tyr Leu Ile Asp Lys Asn Leu Ala Cys Met Asp Gly Val Val Ile Glu Gly Val Glu Arg Arg Glu Lys Gly Leu Arg Cys Tyr Glu Ile Lys Arg Ile Glu Arg Asp Ser Arg Gln Asp Phe Pro Glu Leu Lys Val Met Ala Phe Asp Cys Glu Met Leu Ser Glu Val Gly Met Pro Asp Pro Glu Lys Asp Pro Ile Ile Val Ile Ser Ile Lys Ser Gly Glu Tyr Glu Glu Ile Leu Asn Gly Asp Asn Glu WO 02/20735 _ PCT/USO1/28007 Arg Glu Leu Leu Thr Arg Phe Val Lys Ile Ile Arg Asp Ile Asp Pro Asp Ile Tle Val Gly Tyr Asn Gln Asp Ser Phe Asp Trp Pro Tyr Ile Lys Lys Arg Ala Glu Lys Leu Arg Val Lys Leu Asp Ile Gly Arg Asp Arg Ser Glu Leu Ala Ile Arg Gly Gly Arg Pro Lys Ile Ala Gly Arg Leu Asn Val Asp Leu Tyr Asp Ile Ala Met Arg Ser Leu Asp Val Lys Val Lys Lys Leu Glu Asn Val Ala Glu Phe Leu Gly Lys Lys Ile Glu Leu Ala Asp Ile Glu Ala Lys Asp Ile Tyr Lys His Trp Thr Ser Gly Asp Arg Glu Ser Val Ile Lys Tyr Ser Arg Gln Asp Ile Leu His Thr Tyr Phe Ile Ala Glu Glu Leu Leu Pro Met His Tyr Glu Leu Sex Arg Met Ile Arg Ile Pro Leu Asp Asp Val Thr Arg Ser Gly Arg Gly Lys Gln Val Glu Trp Leu Leu Leu Ser Glu Ala His Lys Leu Gly Glu Leu Ala Pro Asn Pro Arg Glu Met Ala Asp Ser Tyr Glu Gly Ala Phe Val Leu Glu Pro Ala Arg Gly Leu His Glu Asn Val Ile Cys Leu Asp Phe Ala Ser Met Tyr Pro Ser Ile Met Ile Ser Tyr Asn Ile Sex Pro Asp Thr Leu Val Ile Gly Lys Cys Asp Asp Cys Asn Val Ala Pro Glu Val Gly His Lys Phe Arg Lys His Pro Asp Gly Phe Phe Lys Arg Ile Leu Lys Met Leu Ile Glu Lys Arg Arg Glu Ile Lys Lys Val Met Lys Thr Leu Asp Tyr Asn Ser Pro Glu Tyr Lys Leu Leu Asp Ile Lys Gln Ala Thr Leu Lys Val Leu Thr Asn Ser Phe Tyr Gly Tyr Thr Gly Trp Ser Leu Ala Arg Trp Tyr Cys Lys Glu Cys Ala Glu Ala Thr Thr Ala Trp Gly Arg His Phe Ile Lys Thr Ser Ala Arg Ile Ala Lys Glu Leu Gly Phe Glu Val Leu Tyr Gly Asp Thr Asp Ser Ile Phe Val Lys Lys Asp Gly Leu Ser Leu Glu Glu Leu Lys Lys Glu Val Lys Lys Leu Ile Gly Lys Leu Ser Glu Glu Met Pro Ile Gln Ile Glu Ile Asp Glu Tyr Tyr Glu Thr Ile Phe Phe Val Glu Lys Lys Arg Tyr Ala Gly Leu Thr Gln Asp Gly Arg Ile Ile Val Lys Gly Leu Glu Val Arg Arg Gly Asp Trp Cys Glu Leu Ala Lys Lys Ile Gln Lys Gly Val Ile Glu Ile Ile Leu Lys Glu Lys Asn Pro Glu Lys Ala Ala Glu Tyr Val Lys Gly Val Ile Glu Glu Ile Lys Ala Gly Lys Ile Pro Leu Glu Asp Tyr Ile Ile Tyr Lys Gly Leu Thr Arg Lys Pro Ser Lys Tyr Glu Ser Met Gln Ala His Val Lys Ala Ala Met Lys Ala Ala Lys Arg Gly Ile Val Tyr Thr Ile Gly Ser Lys Val Gly Phe Val Val Thr Lys Gly Val Gly Asn Ile Gly Asp Arg Ala Phe Pro Ser Asp Leu Ile Glu Asp Phe Asp Gly Glu Val Ile Thr Asp Leu Asp Gly Asn Lys Tyr Lys Ile Asp Lys Glu Tyr Tyr Ile Asp His Gln Val Leu Pro Ser Val Leu Arg Ile Leu Glu Arg Phe Gly Tyr Thr Glu Ala Gln Leu Lys Gly Ala Ala Glu Gln Gln Thr Leu Asp Ala Phe Trp <210> 7 <211> 2634 <212> DNA
<213> Metallosphaera prunae <400> 7 atgagtataa tggccagaca gcttaccctt gctgacttct ctgggatcaa gagagaggaa 60 ccagttaaac aggaagagaa gacgcaggag gaagagaggc ctctggaaag gccagcgagg 120 WO 02/20735 _ PCT/USO1/28007 ctaagaaaggacacagttaaacaggcgcaggaggagagaaagtactttcttctctccgta180 gactatgatggtaaaatggggaaggctgtctgcaagctttatgatcctgaaacgggtgag240 ctacacgtcctttacgacagcacgggtcacaagtcatacttccttgtggatttagagcca300 gatcagatccaaaaaattccaaagattgttaaggatgagtcctttgttaggcttgagaag360 accactaaaatagacccctacacttggaaacctattaacctaaccaagattgtggtgaat420 gaccccctcgctgtgagacgcctaagagaatatgtcccaagggcctatgaagctcatata480 aaatattttaacaattatatttacgatttcagcctcataccagggatgccctacgtggta540 aagaaggggaagctagtcccccttaagccggaggttgacgtcaaagaggtaaaggaagcg600 ttcaaggatgctgaccagatagctcaagagatggcgctagactgggctcccctctttgag660 tccgagattccgtcggtgaagagggtcgcaatagatatagaggtttatactcccatgatg720 ggtagggtaccggatccagtaaaggccgagtaccccgtgataagcgtagccctagcaggg780 agcgatggcctgaaactggtcctagtccttgataggggagatagtccgattcaaagtaag840 gatatcaaggttgaggtcttccgcacagagagggagcttctctccaggttgtttgacatt900 cttaaggaatatcccatggttctgacctttaacggagacgacttcgatatcccatacctg960 atcttcagaggtttcaagctcgggttactacaggatgagatacccttcgagatctctagt1020 tttggcaggaaacctgacgcgaagttcagatatggatttcacatagatttgtacaggttc1080 ttcttcaacaaggcggtcaggaactatgcatttgaggggaagtactcagagtacaacctt1140 gacaccgtagcccaggcactcttgggtctctccaaggtcaagttggacgagtccattagc1200 gacctaaacatgtctaaactcgtggagtacaactacagggactcggagatcacgctgaag1260 ttgaccacgttcaacaacgaactagtatggaagttgattgtactcttctccagaatttcc1320 aagcttggtatagaggagctaactaggacagagatatcagcctgggtaaagaacctgtac1380 tactgggaacataggaaaaggaactggttaatccccctcaaggaggaaatccttgaacgc1440 tcctctgggttgaagacagctgccattatcaagggaaagggatacaagggcgcagtggtc1500 atagacccacctgtgggggtttactttgacgtagttgttctggacttcgcctcactgtat1560 ccctccatcatcaggaactggaacctcagttatgaaaccgttgatgtgaaggaatgtaac1620 aagaaaagggatataagggatgagagtggggcgaaaatccatgaggtgtgcgtggacagg1680 cccgggattactgcagtggtaactggcttacttagggacttcagggtcaaaatttacaag1740 aagaaagggaaacagagcaacatagacgaggagagaaagatgttgtacgacgtggtacag1800 aggggcatgaaggtgttcattaatgcgacctatggcgtcttcggtgcggagaccttcccc1860 ttgtacgccccagcagttgcagagagcgtt~acagccctaggtaggtacgtaatcacgtcc1920 accaaggaaatggctaacaagcttgggctgaaggttgtgtacggggatacggactcgetc1980 WO 02/20735 _ PCT/USO1/28007 ttcattcaccagcctgataagaagaagctggaggaactggtggagtggaccaggcagaac2040 ttcgggcttgatctagaggtggacaaaacttacaggttcattgccttctccggtcttaag2100 aagaactacttcggtgtgttcaaggattccaaggttgacataaagggcatgttggcaaag2160 aagaggaacaccccagagtttctgaagcaggccttcaatgaggctaaggagaggctagcg2220 aaggttcagaaccaggaggagctcgaaaaggcaattcaagacttaacggcgcaggttaag2280 gaggtgtacaggaagcttaagatgaaggaatataacttggatgagctcgccttcagggtc2340 atgttatccagggacgtgaagtcctatgagaagaacaccccacagcacgttaaggctgcg2400 gcacagctggcggagatgaacgtacaagtgatgtcaagggatataattagcttcgtaaag2460 gtaaagactaaggagggagttaaacctgtccagctagctaagctttcagagattgatgtg2520 gataaatactatgagagcgtgagaagtaccttcgaacagttattgaaaagcttcaatgtg2580 agctgggatagaatagagtccacgacatcaatcgactcgttcttcaagacttag 2634 <210> 8 <211> 877 <212> PRT
<213> Metallosphaera prunae <400> 8 Met Ser Ile Met Ala Arg Gln Leu Thr Leu Ala Asp Phe Ser Gly Ile Lys Arg Glu Glu Pro Val Lys Gln Glu Glu Lys Thr Gln Glu Glu Glu Arg Pro Leu Glu Arg Pro Ala Arg Leu Arg Lys Asp Th.r Val Lys Gln Ala Gln Glu Glu Arg Lys Tyr Phe Leu Leu Ser Val Asp Tyr Asp Gly Lys Met Gly Lys Ala Val Cys Lys Leu Tyr Asp Pro Glu Thr Gly Glu Leu His Val Leu Tyr Asp Ser Thr Gly His Lys Ser Tyr Phe Leu VaI

Asp Leu Glu Pro Asp Gln Ile Gln Lys Ile Pro Lys Ile Val Lys Asp Glu Ser Phe Val Arg Leu Glu Lys Thr Thr Lys Ile Asp Pro Tyr Thr Trp Lys Pro Ile Asn Leu Thr Lys Ile Val Val Asn Asp Pro Leu Ala Val Arg Arg Leu Arg Glu Tyr Val Pro Arg Ala Tyr Glu Ala His Ile Lys Tyr Phe Asn Asn Tyr Ile Tyr Asp Phe Ser Leu Ile Pro Gly Met Pro Tyr Val Val Lys Lys Gly Lys Leu Val Pro Leu Lys Pro Glu Val Asp Val Lys Glu Val Lys Glu Ala Phe Lys Asp Ala Asp Gln Ile Ala Gln Glu Met Ala Leu Asp Trp Ala Pro Leu Phe Glu Ser Glu Ile Pro 210 2l5 220 Ser Val Lys Arg Val Ala Ile Asp Ile Glu Val Tyr Thr Pro Met Met Gly Arg Val Pro Asp Pro Val Lys Ala Glu Tyr Pro Val Ile Ser Val Ala Leu Ala Gly Ser Asp Gly Leu Lys Leu Val Leu Val Leu Asp Arg Gly Asp Ser Pro Ile Gln Ser Lys Asp Tle Lys Val Glu Val Phe Arg Thr Glu Arg Glu Leu Leu Ser Arg Leu Phe Asp Ile Leu Lys Glu Tyr Pro Met Val Leu Thr Phe Asn Gly Asp Asp Phe Asp Ile Pro Tyr Leu Ile Phe Arg Gly Phe Lys Leu Gly Leu Leu Gln Asp Glu Ile Pro Phe Glu Ile Ser Ser Phe Gly Arg Lys Pro Asp Ala Lys Phe Arg Tyr Gly Phe His Ile Asp Leu Tyr Arg Phe Phe Phe Asn Lys Ala Val Arg Asn Tyr Ala Phe Glu Gly Lys Tyr Ser Glu Tyr Asn Leu Asp Thr Val Ala Gln Ala Leu Leu Gly Leu Ser Lys Val Lys Leu Asp Glu Ser Ile Ser Asp Leu Asn Met Ser Lys Leu Val Glu Tyr Asn Tyr Arg Asp Ser Glu Ile Thr Leu Lys Leu Thr Thr Phe Asn Asn Glu Leu Val Trp Lys Leu Ile Val Leu Phe Ser Arg Ile Ser Lys Leu Gly Ile Glu Glu Leu Thr Arg Thr Glu Ile Ser Ala Trp Val Lys Asn Leu Tyr Tyr Trp Glu His 450 ~ 455 460 Arg Lys Arg Asn Trp Leu Ile Pro Leu Lys Glu Glu Ile Leu Glu Arg Ser Ser Gly Leu Lys Thr Ala Ala Ile Ile Lys Gly Lys Gly Tyr Lys Gly Ala Val Val Tle Asp Pro Pro Val Gly Val Tyr Phe Asp Val Val Val Leu Asp Phe Ala Ser Leu Tyr Pro Ser Ile Ile Arg Asn Trp Asn Leu Ser Tyr Glu Thr Val Asp Val Lys Glu Cys Asn Lys Lys Arg Asp Ile Arg Asp Glu Ser Gly Ala Lys Ile His Glu Val Cys Val Asp Arg Pro Gly Ile Thr Ala Val Val Thr Gly Leu Leu Arg Asp Phe Arg Val Lys Ile Tyr Lys Lys Lys Gly Lys Gln Ser Asn Ile Asp Glu Glu Arg Lys Met Leu Tyr Asp Val Val Gln Arg Gly Met Lys Val Phe Ile Asn Ala Thr Tyr Gly Val Phe Gly Ala Glu Thr Phe Pro Leu Tyr Ala Pro Ala Val Ala Glu Ser Val Thr Ala Leu Gly Arg Tyr Val Ile Thr Ser Thr Lys Glu Met Ala Asn Lys Leu Gly Leu Lys Val Val Tyr Gly Asp Thr Asp Ser Leu Phe Ile His Gln Pro Asp Lys Lys Lys Leu Glu Glu Leu Val Glu Trp Thr Arg Gln Asn Phe Gly Leu Asp Leu Glu Val Asp Lys Thr Tyr Arg Phe Ile Ala Phe Ser Gly Leu Lys Lys Asn Tyr Phe GIy VaI Phe Lys Asp Ser Lys Val Asp Tle Lys Gly Met Leu Ala Lys Lys Arg Asn Thr Pro Glu Phe Leu Lys Gln Ala Phe Asn Glu Ala Lys Glu Arg Leu Ala Lys Val Gln Asn Gln Glu Glu Leu Glu Lys Ala Ile Gln Asp Leu Thr Ala Gln Val Lys Glu Val Tyr Arg Lys Leu Lys Met Lys Glu Tyr Asn Leu Asp Glu Leu Ala Phe Arg Val Met Leu Ser Arg Asp Val Lys Ser Tyr Glu Lys Asn Thr Pro Gln His Val Lys Ala Ala Ala Gln Leu Ala Glu Met Asn Val Gln Val Met Ser Arg Asp Tle Ile Ser Phe Val Lys Val Lys Thr Lys Glu Gly Val Lys Pro Val Gln Leu Ala Lys Leu Ser Glu Ile Asp Val Asp Lys Tyr Tyr Glu Ser Val Arg Ser Thr Phe Glu Gln,Leu Leu Lys Ser Phe Asn Val Ser Trp Asp Arg Ile Glu Ser Thr Thr Ser Ile Asp Ser Phe Phe Lys Thr <210>

<211>

<212>
DNA

<213> sp.
Desulfurococcus <400>

atggagagggttcgcctagtgaaggtggttaccaaggatcctctaatcgtgaggaagatt60 aggagcaagtttaacactgcgtgggaggctaagataaagtatcatgcaaactacatctac7.20 gataataggctgatacctggaatgaggtatgttacagacttctccaacggtgcgcaaaag7.80 cttgtaatggttaagccagagataccccaatcccttgttgagaaagtaagggagttgttc240 aggaatgagcctcctgaaacagtgaagctggctgaggaactcctcctcttgttcgaggag300 tcaccgcccaaggtgaagcgcgtagcagtcgacatagaggttttcaccccattcaaaggg360 cgtatccccagcccgaagctcgccgaataccctgtgattagcatagcattggccggtagc420 gacggcttgaagaaaatcctcctgctggccagggaatacaagcatgatttcgactacatg480 atggaggattaccctgttgaagccgaggtggaggtgttcgactccgagaaagacatgttg540 ctggaagccttcagaataatggggagctatcccgtcgtcctcacttacaacggtgataat600 ttcgaccttcaatacctgtacgtgagagccttcaagctggggattctgagaagccatatc660 ccgttgaagataggggaggatatgattagaattgacacaagcatacacctagatctatac720 aagttcttctcgaacagggctgttaaaaactatgctttcggggggaaataccaggaggag780 aagcttgacgctgtttcaggggcactgctaggagtgtcgaaaataggtttcgaggaaaca840 atcggcggcatatcggcctcactattagccgcctacaactacagggatgccgagatcacg900 ttaaacctaaccatgttcagtaatgaactcgtttggaaactcattattcttctagctagg960 gtttccaagacaagcattgaagacctgtgtaggaggcagatttcctactggattcaaaat1020 ctgttcttctgggagcgcaggaagctcggctacctcatacctaacaaggaggacattctg1080 aggcatgtaagggggacggggacgaaggcgattattgagggtaagaagtacgctggagcc1140 ttagtggttgagcctccgaaaggggctttcttcaacgtggtcgtcctcgacatagcctcc1200 ctataccctagcattatcaaaaaatacaatctgagctatgagaccgttgacatgaagtgg1260 WO 02/20735 _ PCT/USO1/28007 tgtagcaagacaatagatattgtcgatgaaaccgggagaaggcttcacgaagtctgcgtt 1320 gacaagcccgggttgaccgcgcaactaaccggtattctaagggattacagggttggaata 1380 tataagaagaggtctaaggataagagccttccccctgaaaccctggcctggtacgaggtg 1440 gttcagagagctattaaggtgttcataaacgctagctacggggtcttcggggatgagaag 1500 ttctctctgtactccccagcagtggctgaaagcgttaccgcgatgggtaggaagtcettc 2560 tacactattgtgagaaaggccgcggatctcggggttaaaacactgtatggcgacacggac 1620 tcgatattcgtctgggccccaacccaggagcagttgaggaagctacagtcatggatcctt 1680 gagaagctaggcctggagatcgagattgacaagtcttttacatacgtggttttcacaggg 1740 cttaagaagaactacctgggcagaacggttgacggcggcatagagatcaaggggcttgtc 1800 scgaagaagaggaatactccggagttcctgaaagacttgttcgagaatgttatcgaaaag 1860 cttaaaagcgttgaaaaccccgcgggtttcatagagttcgtcaagtggttggagcatcag 1920 gtgaagacaatacataacgatattaggaggaaggagataacgctcgaccggctcgccata 1980 agggtggccttaaccaagacgccatccctctacactaagactaagccgccgcatgttaag 2040 gcagccctccaattaatgaactacgggtacagcgtggaggagggggatattataacgttt 2100 gtcaaggtgaagagcaaggagggctataaggctatacagttaacgaggcttcacgaagta 2160 gaccctgataagtacattgagcttgttaaaagcggtcttgaacaattcctctcagccttc 2220 ggaataaggtgggaggatatcataggctccggcgggttaaccgagcttttgagaaacaat 2280 agggcgtag 2289 <210> 10 <211> 762 <212> PRT
<213> Desulfurococcus sp.
<220>
<221> VARIANT
<222> (601)..(601) <223> Xaa is alanine or proline <400> 10 Met Glu Arg Val Arg Leu Val Lys Val Val Thr Lys Asp Pro Leu Tle Val Arg Lys Ile Arg Ser Lys Phe Asn Thr Ala Trp Glu Ala Lys Ile Lys Tyr His Ala Asn Tyr Ile Tyr Asp Asn Arg Leu Ile Pro Gly Met Arg Tyr Val Thr Asp Phe Ser Asn Gly Ala Gln Lys Leu Val Met Val Lys Pro Glu Ile Pro Gln Ser Leu Val Glu Lys Val Arg Glu Leu Phe Arg Asn Glu Pro Pro Glu Thr Val Lys Leu Ala Glu Glu Leu Leu Leu Leu Phe Glu Glu Ser Pro Pro Lys Val Lys Arg Val Ala Val Asp Ile Glu Val Phe Thr Pro Phe Lys Gly Arg Ile Pro Ser Pro Lys Leu Ala Glu Tyr Pro Val Ile Ser Ile Ala Leu Ala Gly Ser Asp Gly Leu Lys Lys Ile Leu Leu Leu Ala Arg Glu Tyr Lys His Asp Phe Asp Tyr Met Met Glu Asp Tyr Pro Val Glu Ala Glu Val Glu Val Phe Asp Ser Glu Lys Asp Met Leu Leu Glu Ala Phe Arg Ile Met Gly Ser Tyr Pro Val Val Leu Thr Tyr Asn Gly Asp Asn Phe Asp Leu Gln Tyr Leu Tyr Val Arg Ala Phe Lys Leu Gly Ile Leu Arg Ser His Ile Pro Leu Lys Ile Gly Glu Asp Met Ile Arg Ile Asp Thr Ser Ile His Leu Asp Leu Tyr Lys Phe Phe Ser Asn Arg Ala Val Lys Asn Tyr Ala Phe Gly Gly Lys Tyr Gln Glu Glu Lys Leu Asp Ala Val Ser Gly Ala Leu Leu Gly Val Ser Lys Ile Gly Phe Glu Glu Thr Ile Gly Gly Ile Ser Ala Ser Leu Leu Ala Ala Tyr Asn Tyr Arg Asp Ala Glu Ile Thr Leu Asn Leu Thr Met Phe Ser Asn Glu Leu Val Trp Lys Leu Ile Ile Leu Leu Ala Arg Val Ser Lys Thr Ser Ile Glu Asp Leu Cys Arg Arg Gln Ile Ser Tyr Trp Ile Gln Asn Leu Phe Phe Trp Glu Arg Arg Lys Leu Gly Tyr Leu Ile Pro Asn Lys Glu Asp Ile Leu Arg His Val Arg Gly Thr Gly Thr Lys Ala Ile Ile Glu Gly Lys Lys Tyr Ala Gly Ala Leu Val Val Glu Pro Pro Lys Gly Ala Phe Phe Asn Val Val Val Leu Asp Ile Ala Ser Leu Tyr Pro Ser Ile Ile Lys Lys Tyr Asn Leu Ser Tyr Glu Thr Val Asp Met Lys Trp Cys 5er Lys Thr Ile Asp Ile Val Asp Glu Thr Gly Arg Arg Leu His Glu Val Cys Val Asp Lys Pro Gly Leu Thr Ala Gln Leu Thr Gly Ile Leu Arg Asp Tyr Arg Val Gly Ile Tyr Lys Lys Arg Ser Lys Asp Lys Ser Leu Pro Pro Glu Thr Leu Ala Trp Tyr Glu Val Val Gln Arg Ala Ile Lys Val Phe Ile Asn Ala Ser Tyr Gly Val Phe Gly Asp Glu Lys Phe Ser Leu Tyr Ser Pro Ala Val Ala Glu Ser Val Thr Ala Met Gly Arg Lys Ser Phe Tyr Thr Ile Val Arg Lys Ala Ala Asp Leu Gly Val Lys Thr Leu Tyr Gly Asp Thr Asp Ser Ile Phe Val Trp Ala Pro Thr Gln Glu Gln Leu Arg Lys Leu Gln Ser Trp Ile Leu Glu Lys Leu Gly Leu Glu Ile Glu Ile Asp Lys Ser Phe Thr Tyr Val Val Phe Thr Gly Leu Lys Lys Asn Tyr Leu Gly Arg Thr Val Asp Gly Gly Ile Glu Ile Lys Gly Leu Val Xaa Lys Lys Arg Asn Thr Pro Glu Phe Leu Lys Asp Leu Phe Glu Asn Val Ile Glu Lys Leu Lys Ser Val Glu Asn Pro Ala Gly Phe Ile Glu Phe Val Lys Trp Leu Glu His Gln Val Lys Thr Ile His Asn Asp Ile Arg Arg Lys Glu Ile Thr Leu Asp Arg Leu Ala Ile Arg Val Ala Leu Thr Lys Thr Pro Ser Leu Tyr Thr Lys Thr Lys Pro Pro His Val Lys Ala Ala Leu Gln Leu Met Asn Tyr Gly Tyr Ser Val Glu Glu Gly Asp Ile Ile Thr Phe Val Lys Val Lys Ser Lys Glu Gly Tyr Lys Ala Ile Gln Leu Thr Arg Leu His Glu Val Asp Pro Asp Lys Tyr Ile Glu Leu Val Lys Ser Gly Leu Glu Gln Phe Leu Ser Ala Phe Gly Ile Arg Trp Glu Asp Ile Ile Gly Ser Gly Gly Leu Thr Glu Leu Leu Arg Asn Asn Arg Ala <210>

<211>

<212>
DNA

<213> fex pyrophilus Aqui <400>

atggattttgaatacgtaacgggagaagagggattaaaaaaggcaataaaaaggctcgaa 60 aattctccatacctttacctggatacggaaaccacaggagacaggataaggctcgtacaa 120 atcggagacgaagaaaacacctacgttattgacctctacgaaattcaggatatagaacct 180 ctgaggaaattaataaacgaaagggggatagtagggcacaaccttaagttcgatcttaag 240 tacctctacaggtacgggatatttccctcggcaacgtttgacactatgatagcgagctac 300 ctcctcggatacgagagacactccctcaatcacatagtttcaaacctactcggatattcc 360 atggacaagagttatcagacttccgactggggagcgagcgttctgagcgacgctcagctc 420 aagtacgctgcaaacgacgttatagtcctcagagaactcttccctaagatgagggacatg 480 ttaaacgagctagacgctgagaggggagaggaactgctcaagactagaacggcaaagatt 540 ttcgatctgaagagtcccgtagcaatagtggaaatggctttcgtaagggaagttgcaaaa 600 ctcgagataaacggctttcccgtggacgtagaagagctaaccaacaagttaaaagctgtg 660 gaaagggaaacccagaagaggatacaggagttttacataaagtacagagttgaccctctc 720 tctccgaaacagctcgcctcactcctgacgaagaagtttaaactgaaccttcccaagact 780 cctaaagggaacgtatctacagacgacaaggctcttacttcctatcaggacgtagaaccc 840 gtaaaactcgttctggaaataagaaagcttaagaagatcgcggacaagttaaaggagtta 900 aaagaacacttgaagaacgggagagtttacccggagttcaagcaaataggagctgtaacg 960 ggaaggatgtcctccgcacacccaaatatccagaacatacacagggatatgagaggaatt 1020 ttcaaggcggaggagggaaatactttcgtcatttcggacttttctcagatagagctcagg 1080 attgcggccgaatacgtaaaggacccgcttatgctggacgccttcaaaaagggaaaggac 1140 atgcacaggtacaccgcttcagtggtactcggaaagaaagaggaagaaataacaaaagag 1200 gagagacagctcgcaaaagctataaacttcggtctcatatacggcatttccgctaaaggg 1260 cttgcagaatacgcaaagcttggttacggcgttgaaatttctttagaagaagctcaggtt 1320 ttgagagagaggtttttcaagaacttcaaagctttcaaagagtggcacgacagagttaag 1380 aaagaactaaaggaaaagggagaggtaaaaggtcatacgcttcttggaaggagattttcc1440 gcaaatacctttaacgacgctgtaaattaccccatacagggaacgggtgcggacctacta1500 aaactggcagttctactttttgacgcaaacctccagaaaaagggaatagatgcaaagctc1560 gtgaacctcgtgcacgacgagatagtcgtagagtgcgaaaaggaaaaagcggaagaagta1620 aaagaaatactcgaaaaatccatgaaaacggcgggaaagataatactgaaagaggttccc1680 gtggaagtagaaagcgttataaacgaaaggtggacgaaagattaa 1725 <210> 12 <211> 574 <212> PRT
<213> Aquifex pyrophilus <400> 12 Met Asp Phe Glu Tyr Val Thr Gly Glu Glu Gly Leu Lys Lys Ala Ile Lys Arg Leu Glu Asn Ser Pro Tyr Leu Tyr Leu Asp Thr Glu Thr Thr Gly Asp Arg Ile Arg Leu Va1 Gln Ile Gly Asp Glu Glu Asn Thr Tyr Val I1e Asp Leu Tyr Glu Ile Gln Asp Ile Glu Pro Leu Arg Lys Leu Ile Asn Glu Arg Gly Ile Val G1y His Asn Leu Lys Phe Asp Leu Lys Tyr Leu Tyr Arg Tyr G1y Ile Phe Pro Ser Ala Thr Phe Asp Thr Met Ile Ala Ser Tyr Leu Leu Gly Tyr Glu Arg His Ser Leu Asn His Ile Val Ser Asn Leu Leu Gly Tyr Ser Met Asp Lys Ser Tyr Gln Thr Ser Asp Trp Gly Ala Ser Val Leu Ser Asp Ala Gln Leu Lys Tyr Ala Ala Asn Asp Val Ile Val Leu Arg Glu Leu Phe Pro Lys Met Arg Asp Met Leu Asn Glu Leu Asp Ala Glu Arg Gly Glu Glu Leu Leu Lys Thr Arg Thr Ala Lys Ile Phe Asp Leu Lys Ser Pro Val Ala Ile Val Glu Met Ala Phe Val Arg Glu Val Ala Lys Leu Glu Ile Asn Gly Phe Pro Val Asp Val Glu Glu Leu Thr Asn Lys Leu Lys Ala Val Glu Arg Glu Thr Gln Lys Arg Ile Gln G1u Phe Tyr Ile Lys Tyr Arg Val Asp Pro Leu Ser Pro Lys Gln Leu Ala Ser Leu Leu Thr Lys Lys Phe Lys Leu Asn Leu Pro Lys Thr Pro Lys Gly Asn Val Ser Thr Asp Asp Lys Ala Leu Thr Ser Tyr Gln Asp Val Glu Pro Va1 Lys Leu Val Leu Glu Ile Arg Lys Leu Lys Lys Ile Ala Asp Lys Leu Lys Glu Leu Lys Glu His Leu Lys Asn Gly Arg Val Tyr Pro Glu Phe Lys Gln Ile Gly Ala Val Thr Gly Arg Met Ser Ser Ala His Pro Asn Ile Gln Asn Ile His Arg Asp Met Arg Gly Ile Phe Lys Ala Glu Glu Gly Asn Thr Phe Val Ile Ser Asp Phe Ser Gln Ile Glu Leu Arg Ile A1a Ala Glu Tyr Val Lys Asp Pro Leu Met Leu Asp Ala Phe Lys Lys Gly Lys Asp Met His Arg Tyr Thr Ala Ser Val Val Leu Gly Lys Lys Glu Glu Glu Ile Thr Lys Glu Glu Arg Gln Leu Ala Lys Ala Ile Asn Phe Gly Leu Ile Tyr Gly Ile Ser Ala Lys Gly Leu Ala Glu Tyr Ala Lys Leu G1y Tyr Gly Val Glu Ile Ser Leu Glu Glu Ala Gln Val Leu Arg Glu Arg Phe Phe Lys Asn Phe Lys Ala Phe Lys Glu Trp His Asp Arg Val Lys Lys Glu Leu Lys Glu Lys Gly Glu Val Lys Gly His Thr Leu Leu Gly Arg Arg Phe Ser Ala Asn Thr Phe Asn Asp Ala Val Asn Tyr Pro Ile Gln Gly Thr Gly Ala Asp Leu Leu Lys Leu A1a Val Leu Leu Phe Asp Ala Asn Leu Gln Lys Lys Gly Ile Asp Ala Lys Leu Val Asn Leu Val His Asp Glu Ile Val Val Glu Cys Glu Lys Glu Lys Ala Glu Glu Val Lys Glu Ile Leu Glu Lys Ser Met Lys Thr Ala Gly Lys Ile Ile Leu Lys Glu Val Pro Val Glu Val Glu Ser Val Ile Asn Glu Arg Trp Thr Lys Asp <210> 13 <211> 2412 <212> DNA
<213> Pyrolobus fumarius <400> 13 atgactgaag ttgtattcac ggttttagac tctagctacg aggttgttgg taaagagcct 60 caggtaatca tatggggtat tgctgagaac ggcgagaggg tagtcctcat tgacaggtct 120 tttcgcccatacttctatgcgctgcttgcaccgggcgccgatcctaagcaggtagcacaa180 cgtattcgtgcattgagtaggccaaagagcccgattataggtgtagaggatgacaagagg240 aagtacttcgggaggcctcgtagggtcttacgtattcgcaccgtgctacccgaggctgtt300 agggagtatcgcgaactcgtaaagaacgttgatggtgttgaggatgttctagaggcggat360 atacgcttcgctatgcgctatctcatagatcacgatctatttcctttcacctggtaccgt420 gtagaggctgagcccctcgagaacaagatgggcttccgtgtcgacaaggtatacctggtt480 aagagcaggccggagccactttatggtgaggctctcgcaccaaccaagcttcccgatctt540 aggatactcgcgttcgatattgaagtttatagcaagcaagggtcgecgcgtccagagcgc600 gatcctgtaatagtgatagctgtgaagactgacgatggcgatgaggtgctattcattgca660 gagggcaaagacgatcgaaaaccgatacgcgagtttgtagagtacgtgaagaggtatgac720 cccgacataatagtcggttataacaacaatcatttcgattggccttatcttttgaggcgc780 gcccgcatcctaggcataaagcttgatgtgactagaagagttggcgccgagcccaccact840 agcgtacatgggcacgtctctgtccctggcaggcttaacgtagatctgtacgactatgcc900 gaagagatgccagagatcaagataaagagtctcgaggaggtcgcagagtatctaggcgtg960 atgaagaagagtgaacgcgttatcatcaattggtgggagattccagactattgggacgac1020 ccgaagaagagaccactattac.tgcaatacgcgcgcgacgatgtccgcgctacttacggc1080 ttagccgagaagatattgccgtttgctatccagttgtcgtacgtaacaggtctcccacta1140 gaccaggtaggtgcgatgagtgttggctttcgacttgaatggtacctgatacgcgcggcg1200 tttaagatgaaagagcttgtgccgaaccgcgttgagcgcccagaagagacttaccgtggc1260 gctatagttcttgagccgttgagaggcgtgcacgagaatatagccgtactcgactttagc1320 tcgatgtacccaaacatcatgataaagtacaatgttggtcctgacacgcttgtgaggcct1380 ggtgaaaagtgtggcgagtgtggttgctgggaggccccggaggtcaagcacaggttccgt1440 aggtgtccgcccggcttcttcaagacagttcttgagaggctgttagagcttcgtaagcgt1500 gtgcgtgctgaaatgaagaagtatcctccggatagcccagaatatcgactgttggatgaa1560 aggcagaaggcgttgaaggttcttgcaaacgctagttacggctacatgggttggagcggc1620 gctaggtggtattgcagggagtgcgcaaaggctgtcacggcttggggtaggcacctcata1680 cgcaccgccatcaacatagctcgtaaactaggcctcaaggtgatctacggtgacacagat1740 tcgctcttcgtgacctatgatccggagaaggtggaaaatttcatcaaaattataaaggag1800 gagctggggttcgaaatcaagctagagaaggtgtacaaacgcttattctttacagaggct1860 aagaagaggtacgctggccttctcgaggacggacgtatagatattgtcggtttcgaggct1920 gtacgtggcgattggtgtgaactcgccaaggaggttcagactaaggttgtcgaaatagta1980 ttgaagacgagtgaggtgaacaaggctgtagagtacgtcaggaagattgtgaaagagttg2040 gaggagggcaaggttcccatagagaagcttgtaatctggaagacccttagtaagcgtctt2100 gaggagtacacaacggaggcaccacacgtcgttgcagcgaagaggatgctgtcagcaggc2160 taccgggtaagcccaggcgacaagatagggtatgtaatagtgaagggtggtggccgtatc2220 agtcaaagagcatggccatacttcatggtcaaggatcctagccagatagacgtgacctac2280 tatgttgaccaccaaatcatcccggctgcattgagaatactgggctactttggcatcacc2340 gagaagaagctgaaagcaagtgcaactgggcagaagactctcttcgactttctagccaag2400 aagagcaagtas 2412 <210> 14 <211> 803 <212> PRT
<213> Pyrolobus fumarius <400> 14 Met Thr Glu Val Val Phe Thr Val Leu Asp Ser Ser Tyr Glu Val Val Gly Lys Glu Pro Gln Val Ile Ile Trp Gly Ile Ala Glu Asn Gly Glu Arg Val Val Leu Ile Asp Arg Ser Phe Arg Pro Tyr Phe Tyr Ala Leu Leu Ala Pro Gly Ala Asp Pro Lys Gln Val Ala Gln Arg Ile Arg Ala Leu Ser Arg Pro Lys Ser Pro Ile Ile Gly Val Glu Asp Asp Lys Arg Lys Tyr Phe Gly Arg Pro Arg Arg Val Leu Arg Ile Arg Thr Val Leu Pro Glu Ala Val Arg Glu Tyr Arg Glu Leu Val Lys Asn Val Asp Gly Val Glu ValLeu Glu AspIle ArgPhe MetArg Leu Asp Ala Ala Tyr Ile Asp AspLeu Phe PheThr TrpTyr ValGlu Glu His Pro Arg Ala Pro Leu AsnLys Met PheArg ValAsp ValTyr Val Glu Gly Lys Leu Lys Ser Arg Pro Glu Pro Leu Tyr Gly Glu Ala Leu Ala Pro Thr Lys Leu Pro Asp Leu Arg Ile Leu Ala Phe Asp Ile G1u Val Tyr Ser Lys Gln Gly Ser Pro Arg Pro Glu Arg Asp Pro Val Ile Val Ile Ala Val Lys Thr Asp Asp Gly Asp Glu Val Leu Phe Ile Ala Glu Gly Lys Asp Asp Arg Lys Pro Ile Arg Glu Phe Val Glu Tyr Val Lys Arg Tyr Asp Pro Asp Ile I1e Val Gly Tyr Asn Asn Asn His Phe Asp Trp Pro Tyr Leu Leu Arg Arg Ala Arg Ile Leu Gly Ile Lys Leu Asp Val Thr Arg Arg Val Gly Ala Glu Pro Thr Thr Ser Val His Gly His Val Ser Val Pro Gly Arg Leu Asn Val Asp Leu Tyr Asp Tyr Ala Glu Glu Met Pro Glu Ile Lys Ile Lys Ser Leu Glu Glu Val Ala Glu Tyr Leu Gly Val Met Lys Lys Ser Glu Arg Val Ile Ile Asn Trp Trp Glu Ile Pro Asp Tyr Trp Asp Asp Pro Lys Lys Arg Pro Leu Leu Leu Gln Tyr Ala Arg Asp Asp Val Arg Ala Thr Tyr Gly Leu Ala Glu Lys Ile Leu Pro Phe Ala Ile Gln Leu Ser Tyr Val Thr Gly Leu Pro Leu Asp Gln Val Gly Ala Met Ser Val Gly Phe Arg Leu Glu Trp Tyr Leu Ile Arg Ala Ala Phe Lys Met Lys Glu Leu Val Pro Asn Arg Val Glu Arg Pro Glu Glu Thr Tyr Arg Gly Ala Ile Val Leu Glu Pro Leu Arg Gly Val His Glu Asn Ile Ala Val Leu Asp Phe Ser Ser Met Tyr Pro Asn Ile Met Ile Lys Tyr Asn Val Gly Pro Asp Thr Leu Val Arg Pro Gly Glu Lys Cys G1y Glu Cys Gly Cys Trp Glu Ala Pro Glu Val Lys His Arg Phe Arg Arg Cys Pro Pro Gly Phe Phe Lys Thr Val Leu Glu Arg Leu Leu Glu Leu Arg Lys Arg Val Arg Ala Glu Met Lys Lys Tyr Pro Pro Asp Ser Pro Glu Tyr Arg Leu Leu Asp Glu Arg Gln Lys Ala Leu Lys Val Leu Ala Asn Ala Ser Tyr Gly Tyr Met Gly Trp Ser Gly Ala Arg Trp Tyr Cys Arg Glu Cys Ala Lys Ala Val Thr Ala Trp Gly Arg His Leu Ile Arg Thr Ala Ile Asn Ile Ala Arg Lys Leu Gly Leu Lys Val Ile Tyr Gly Asp Thr Asp Ser Leu Phe Val Thr Tyr Asp Pro Glu Lys Val Glu Asn Phe Ile Lys Ile Ile Lys Glu Glu Leu Gly Phe Glu Ile Lys Leu Glu Lys Val Tyr Lys Arg Leu Phe Phe Thr Glu Ala Lys Lys Arg Tyr Ala Gly Leu Leu Glu Asp Gly Arg Ile Asp Ile Val Gly Phe Glu Ala Val Arg Gly Asp Trp Cys Glu Leu Ala Lys Glu Val Gln Thr Lys Val Val Glu Ile Val Leu Lys Thr Ser Glu Val Asn Lys Ala Val Glu Tyr Val Arg Lys Ile Val Lys Glu Leu Glu Glu Gly Lys Val Pro Ile Glu Lys Leu Val Ile Trp Lys Thr Leu Ser Lys Arg Leu Glu Glu Tyr Thr Thr Glu Ala Pro His Val Val Ala Ala Lys Arg Met Leu Ser Ala Gly Tyr Arg Val Ser Pro Gly Asp Lys Ile GIy Tyr Val Ile Val Lys Gly Gly Gly Arg Ile Ser Gln Arg Ala Trp Pro Tyr Phe Met Val Lys Asp Pro Ser Gln Ile Asp Val Thr Tyr Tyr Val Asp His Gln Ile Ile Pro Ala Ala Leu Arg Ile Leu Gly Tyr Phe Gly Ile Thr Glu Lys Lys Leu Lys Ala Ser Ala Thr Gly Gln Lys Thr Leu Phe Asp Phe Leu Ala Lys Lys Ser Lys <210>

<211>

<2I2>
DNA

<213>
Pyrolobus fumarius <400>

atgactgaagttgtattcacggttttagactctagctacgaggttgttggtaaagagcct 60 caggtaatcatatggggtattgctgagaacggcgagagggtagtcctcattgacaggtct 120 tttcgcccatacttctatgcgctgcttgcaccgggcgccgatcctaagcaggtagcacaa 180 cgtattcgtgcattgagtaggccaaagagcccgattataggtgtagaggatgacaagagg 240 aagtacttcgggaggcctcgtagggtcttacgtattcgcaccgtgctacccgaggctgtt 300 agggagtatcgcgaactcgtaaagaacgttgatggtgttgaggatgttctagaggcggat 360 atacgcttcgctatgcgctatctcatagatcacgatctatttcctttcacctggtaccgt 420 gtagaggctgagcccctcgagaacaagatgggcttccgtgtcgacaaggtatacctggtt 480 aagagcaggccggagccactttatggtgaggctctcgcaccaaccaagcttcccgatctt 540 aggatactcgcgttcgatattgaagtttatagcaagcaagggtcgccgcgtccagagcgc 600 gatcctgtaatagtgatagctgtgaagactgacgatggcgatgaggtgctattcattgca 660 gagggcaaagacgatcgaaaaccgatacgcgagtttgtagagtacgtgaagaggtatgac 720 cccgacataatagtcggttataacaacaatcatttcgattggccttatcttttgaggcgc 780 gcccgcatcctaggcataaagcttgatgtgactagaagagttggcgccgagcccaccact 840 agcgtacatgggcacgtctctgtccctggcaggcttaacgtagatctgtacgactatgcc 900 gaagagatgccagagatcaagataaagagtctcgaggaggtcgcagagtatctaggcgtg960 atgaagaagagtgaacgcgttatcatcaattggtgggagattccagactattgggacgac1020 ccgaagaagagaccactattactgcaatacgcgcgcgacgatgtccgcgctacttacggc1080 ttagccgagaagatattgccgtttgctatccagttgtcgtacgtaacaggtctcccacta1140 gaccaggtaggtgcgatgagtgttggctttcgacttgaatggtacctgatacgcgcggcg1200 tttaagatgaaagagcttgtgccgaaccgcgttgagcgcccagaagagacttaccgtggc1260 gctatagttcttgagccgttgagaggcgtgcacgagaatatagccgtactcgactttagc1320 tcgatgtacccaaacatcatgataaagtacaatgttggtcctgacacgcttgtgaggcct1380 ggtgaagagtgtggcgagtgtggttgctgggaggccccggaggtcaagcacaggttccgt1440 aggtgtccgcccggcttcttcaagacagttcttgagaggctgttagagcttcgtaagcgt1500 gtgcgtgctgaaatgaagaagtatcetccggatagcccagaatatcgactgttggatgaa1560 aggcagaaggcgttgaaggttcttgcaaacgctagttacggctacatgggttggagcggc1620 gctaggtggtattgcagggagtgcgcagaggctgtcacggcttggggtaggcacctcata1680 cgcaccgccatcaacatagctcgtaaactaggcctcaaggtgatctacggtgacacagat1740 tcgctcttcgtgacctatgatccggagaaggtggagaagttcatcaaaattatagaggag1800 gagctggggttcgaaatcaagctagagaaggtgtacaaacgcgtattctttacagaggct1860 aagaagaggtacgctggccttctcgaggacggacgtatagatattgtcggtttcgaggct1920 gtacgtggegattggtgtgaactcgccaaggaggttcagactaaggttgtcgaaatagta1980 ttgaagacgagtgacgtgaacaaggctgtagagtacgtcaggaagattgtgaaagagttg2040 gaggagggcaaggttcccatagagaagcttgtaatctggaagacccttagtaagcgtctt2100 gaggagtacacaacggaggcaccacacgtcgttgcagcgaagaggatgctgtcagcaggc2160 taccgggtaagcccaggcgacaagatagggtatgtaatagtgaagggtggtggccgtatc2220 agtcaaagagcatggccatacttcatggtcaaggatcctagccagatagacgtgacctac2280 tatgttgaccaccaaatcatcccggctgcattgagaatactgggctactttggcatcacc2340 gagaagaagctgaaagcaagtgcaactgggcagaagactctcttcgactttctagccaag2400 aagagcaagtas 2412 <210> 16 <211> 803 <212> PRT
<213> Pyrolobus fumarius <400> 16 Met Thr Glu Val Val Phe Thr Val Leu Asp Ser Ser Tyr Glu Val Val Gly Lys Glu Pro Gln Val Ile Ile Trp Gly Ile Ala Glu Asn Gly Glu Arg Val Val Leu Ile Asp Arg Ser Phe Arg Pro Tyr Phe Tyr AIa Leu Leu Ala Pro Gly Ala Asp Pro Lys Gln Val Ala Gln Arg Ile Arg Ala Leu Ser Arg Pro Lys Ser Pro Ile Ile Gly Val Glu Asp Asp Lys Arg Lys Tyr Phe Gly Arg Pro Arg Arg Val Leu Arg Tle Arg Thr Val Leu Pro Glu Ala Val Arg Glu Tyr Arg Glu Leu Val Lys Asn Val Asp Gly Val Glu Asp Val Leu Glu Ala Asp Ile Arg Phe Ala Met Arg Tyr Leu Ile Asp His Asp Leu Phe Pro Phe Thr Trp Tyr Arg Val Glu Ala Glu Pro Leu Glu Asn Lys Met Gly Phe Arg Val Asp Lys Val Tyr Leu Val 145 ~ 150 155 160 Lys Ser Arg Pro Glu Pro Leu Tyr Gly Glu Ala Leu Ala Pro Thr Lys Leu Pro Asp Leu Arg Ile Leu Ala Phe Asp Ile Glu Val Tyr Ser Lys Gln Gly Ser Pro Arg Pro Glu Arg Asp Pro Val Ile Val Ile Ala Val Lys Thr Asp Asp Gly Asp Glu Val Leu Phe Ile Ala Glu Gly Lys Asp Asp Arg Lys Pro Ile Arg Glu Phe Val Glu Tyr Val Lys Arg Tyr Asp Pro Asp Ile Ile Val Gly Tyr Asn Asn Asn His Phe Asp Trp Pro Tyr Leu Leu Arg Arg Ala Arg Ile Leu Gly Ile Lys Leu Asp Val Thr Arg Arg Val Gly Ala Glu Pro Thr Thr Ser Val His Gly His Val Ser Val Pro Gly Arg Leu Asn Val Asp Leu Tyr Asp Tyr Ala Glu Glu Met Pro Glu Ile Lys Ile Lys Ser Leu Glu Glu Val Ala Glu Tyr Leu Gly Val Met Lys Lys Ser Glu Arg Val Ile Ile Asn Trp Trp Glu Ile Pro Asp Tyr Trp Asp Asp Pro Lys Lys Arg Pro Leu Leu Leu Gln Tyr Ala Arg Asp Asp Val Arg Ala Thr Tyr Gly Leu Ala Glu Lys Ile Leu Pro Phe Ala Ile Gln Leu Ser Tyr Val Thr Gly Leu Pro Leu Asp Gln Val Gly Ala Met Ser Val Gly Phe Arg Leu Glu Trp Tyr Leu Ile Arg Ala Ala Phe Lys Met Lys Glu Leu Val Pro Asn Arg Val Glu Arg-Pro Glu Glu Thr Tyr Arg Gly Ala Ile Val Leu Glu Pro Leu Arg Gly Val His Glu Asn Ile Ala Val Leu Asp Phe Ser Ser Met Tyr Pro Asn Ile Met Ile Lys Tyr Asn Val Gly Pro Asp Thr Leu Val Arg Pro Gly Glu Glu Cys Gly Glu Cys Gly Cys Trp Glu Ala Pro Glu Val Lys His Arg Phe Arg Arg Cys Pro Pro Gly Phe Phe Lys Thr Val Leu Glu Arg Leu Leu Glu Leu Arg Lys Arg Val Arg Ala Glu Met Lys Lys Tyr Pro Pro Asp Ser Pro Glu Tyr Arg Leu Leu Asp Glu Arg Gln Lys Ala Leu Lys Val Leu Ala Asn Ala Ser Tyr Gly Tyr Met Gly Trp Ser Gly Ala Arg Trp Tyr Cys Arg Glu Cys Ala Glu Ala Val Thr Ala Trp Gly Arg His Leu Ile Arg Thr Ala Ile Asn Ile Ala Arg Lys Leu Gly Leu Lys Val Ile Tyr Gly Asp Thr Asp Ser Leu Phe Val Thr Tyr Asp Pro Glu Lys Val Glu Lys Phe Ile Lys Ile Ile Glu Glu Glu Leu Gly Phe Glu Ile Lys Leu Glu Lys Val Tyr Lys Arg Val Phe Phe Thr Glu Ala Lys Lys Arg Tyr Ala Gly Leu Leu Glu Asp Gly Arg Ile Asp Ile Val Gly Phe Glu Ala Val Arg Gly Asp Trp Cys Glu Leu Ala Lys Glu Val Gln Thr Lys Val Val Glu Ile Val Leu Lys Thr Ser Asp Val Asn Lys Ala Val Glu Tyr Val Arg Lys Ile Val Lys Glu Leu Glu Glu Gly Lys Val Pro Ile Glu Lys Leu Val Ile Trp Lys Thr Leu Ser Lys Arg Leu Glu Glu Tyr Thr Thr Glu Ala Pro His Val Val Ala Ala Lys Arg Met Leu Ser Ala Gly Tyr Arg Val Ser Pro Gly Asp Lys Ile Gly Tyr Val Ile Val Lys Gly Gly Gly Arg Ile Ser Gln Arg Ala Trp Pro Tyr Phe Met Val Lys Asp Pro Ser Gln Ile Asp Val Thr Tyr Tyr Val Asp His Gln Ile Ile Pro Ala Ala Leu Arg Ile Leu Gly Tyr Phe Gly Ile Thr Glu Lys Lys Leu 770 ~ 775 780 Lys Ala Ser Ala Thr Gly Gln Lys Thr Leu Phe Asp Phe Leu Ala Lys Lys Ser Lys

Claims (114)

WHAT IS CLAIMED IS:

1. An isolated nucleic acid comprising a sequence selected from the group consisting of SEQ ID NOS: 1, 3, 5, 7, 9, 11, 13, 15, and variants thereof having at least about 50% identity to SEQ ID NOS: 1, 3, 5, 7, 9, 11 or 13, 15, and encoding a polypeptide having polymerase activity at a temperature in a range from about 90°C to 113°C.

2. The isolated nucleic acid of claim 1, comprising a sequence selected from the group consisting of SEQ ID NOS: 1, 3, 5, 7, 9, 11, 13, 15, sequences substantially identical thereto, and sequences complementary thereto.

3. The isolated nucleic acid of claim 1, wherein the isolated nucleic acid is DNA.

4. The isolated nucleic acid of claim 3, wherein the DNA is cDNA, genomic DNA, or synthetic DNA.

5. An isolated nucleic acid that hybridizes to a nucleic acid of claim 1 under conditions of high stringency.

6. An isolated nucleic acid that hybridizes to a nucleic acid of claim 1 under conditions of moderate stringency.

7. An isolated nucleic acid that hybridizes to a nucleic acid of claim 1 under conditions of low stringency.

8. An isolated nucleic acid having at least about 55% homology to the nucleic acid of claim 1 as determined by analysis with a sequence comparison algorithm.

9. An isolated nucleic acid having at least about 60% homology to the nucleic acid of claim 1 as determined by analysis with a sequence comparison algorithm.

10. An isolated nucleic acid having at least about 65% homology to the nucleic acid of claim 1 as determined by analysis with a sequence comparison algorithm.

11. An isolated nucleic acid having at least 70% homology to the nucleic acid of claim 1 as determined by analysis with a sequence comparison algorithm.

12. An isolated nucleic acid having at least about 75% homology to the nucleic acid of claim 1 as determined by analysis with a sequence comparison algorithm.

13. An isolated nucleic acid having at least 80% homology to the nucleic acid of claim 1 as determined by analysis with a sequence comparison algorithm.

14. An isolated nucleic acid having at least about 85% homology to the nucleic acid of claim 1 as determined by analysis with a sequence comparison algorithm.

15. An isolated nucleic acid having at least 90% homology to the nucleic acid of claim 1 as determined by analysis with a sequence comparison algorithm.

16. An isolated nucleic acid having at least about 95% homology to the nucleic acid of claim 1 as determined by analysis with a sequence comparison algorithm.

17. The isolated nucleic acid of claim 1, 2, 8, 9, 10, 11, 12, 13, 14, 15 or 16, wherein the sequence comparison algorithm is FASTA version 3.0t78 with the default parameters.

18. An isolated nucleic acid comprising at least 10 consecutive bases of a sequence selected from the group consisting of SEQ ID NOS: 1, 3, 5, 7, 9, 11, 13, 15, sequences substantially identical thereto, and sequences complementary thereto.

19. An isolated nucleic acid having at least about 50% homology to the nucleic acid of claim 1 as determined by analysis with a sequence comparison algorithm or FASTA version 3.0t78 with the default parameters.

20. An isolated nucleic acid having at least about 55% homology to the nucleic acid of claim 1 as determined by analysis with a sequence comparison algorithm or FASTA version 3.0t78 with the default parameters.

21. An isolated nucleic acid having at least about 60% homology to the nucleic acid of claim 1 as determined by analysis with a sequence comparison algorithm or FASTA version 3.0t78 with the default parameters.

22. An isolated nucleic acid having at least 65% homology to the nucleic acid of claim 1 as determined by analysis with a sequence comparison algorithm or FASTA version 3.0t78 with the default parameters.

23. An isolated nucleic acid having at least 70% homology to the nucleic acid of claim 1 as determined by analysis with a sequence comparison algorithm or FASTA version 3.0t78 with the default parameters.

24. An isolated nucleic acid having at least 75% homology to the nucleic acid of claim 1 as determined by analysis with a sequence comparison algorithm or FASTA version 3.0t78 with the default parameters.

25. An isolated nucleic acid having at least 80% homology to the nucleic acid of claim 1 as determined by analysis with a sequence comparison algorithm or FASTA version 3.0t78 with the default parameters.

26. An isolated nucleic acid having at least 85% homology to the nucleic acid of claim 1 as determined by analysis with a sequence comparison algorithm or PASTA version 3.0t78 with the default parameters.

27. An isolated nucleic acid having at least 90% homology to the nucleic acid of claim 1 as determined by analysis with a sequence comparison algorithm or PASTA version 3.0t78 with the default parameters.

28. An isolated nucleic acid having at least 95% homology to the nucleic acid of claim 1 as determined by analysis with a sequence comparison algorithm or PASTA version 3.0t78 with the default parameters.

29. An isolated nucleic acid encoding a polypeptide having a sequence selected from the group consisting of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16 and sequences substantially identical thereto.

30. An isolated nucleic acid encoding a polypeptide comprising at least 10 consecutive amino acids of a polypeptide having a sequence selected from the group consisting of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, and sequences substantially identical thereto.

31. A purified polypeptide substantially identical to the polypeptide of claim 29 or 30 as determined by analysis with a sequence comparison algorithm or FASTA version 3.0t78 with the default parameters.

32. A purified polypeptide having at least about 50% homology to the polypeptide of claim 29 or 30 as determined by analysis with a sequence comparison algorithm or PASTA version 3.0t78 with the default parameters.

33. A purified polypeptide having at least about 55% homology to the polypeptide of claim 29 or 30 as determined by analysis with a sequence comparison algorithm or FASTA version 3.0t78 with the default parameters.

34. A purified polypeptide having at least about 60% homology to the polypeptide of claim 29 or 30 as determined by analysis with a sequence comparison algorithm or FASTA version 3.0t78 with the default parameters.

35. A purified polypeptide having at least about 65% homology to the polypeptide of claim 29 or 30 as determined by analysis with a sequence comparison algorithm or FASTA version 3.0t78 with the default parameters.

36. A purified polypeptide having at least 70% homology to the polypeptide of claim 29 or 30 as determined by analysis with a sequence comparison algorithm or FASTA version 3.0t78 with the default parameters.

37. A purified polypeptide having at least about 75% homology to the polypeptide of claim 29 or 30 as determined by analysis with a sequence comparison algorithm or FASTA version 3.0t78 with the default parameters.

38. A purified polypeptide having at least 80% homology to the polypeptide of claim 29 or 30 as determined by analysis with a sequence comparison algorithm or FASTA version 3.0t78 with the default parameters.

39. A purified polypeptide having at least about 85% homology to the polypeptide of claim 29 or 30 as determined by analysis with a sequence comparison algorithm or FASTA version 3.0t78 with the default parameters.

40. A purified polypeptide having at least about 90% homology to the polypeptide of claim 29 or 30 as determined by analysis with a sequence comparison algorithm or FASTA version 3.0t78 with the default parameters.

41. A purified polypeptide having at least about 95% homology to the polypeptide of claim 29 or 30 as determined by analysis with a sequence comparison algorithm or FASTA version 3.0t78 with the default parameters.

42. A purified polypeptide having a sequence selected from the group consisting of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, and sequences substantially identical thereto, wherein the polypeptide has polymerase activity at temperatures in the range from about 70°C up to about 113°C.

43. A purified polypeptide having a sequence selected from the group consisting of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, and sequences substantially identical thereto, wherein the polypeptide has 3'.fwdarw. 5'exonuclease activity.

44. A purified antibody that specifically binds to a polypeptide comprising a sequence selected from the group consisting of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, and sequences substantially identical thereto.

45. A purified antibody that specifically binds to a polypeptide having at least 10 consecutive amino acids of the polypeptides selected from the group consisting of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, and sequences substantially identical thereto.

46. The antibody of claim 44 or 45, wherein the antibodies are polyclonal.

47. The antibody of claim 44 or 45, wherein the antibodies are monoclonal.

48. A method of producing a polypeptide having a sequence selected from the group consisting of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, and sequences substantially identical thereto comprising introducing a nucleic acid encoding the polypeptide into a host cell under conditions that allow expression of the polypeptide and recovering the polypeptide.

49. A method of producing a polypeptide comprising at least 10 amino acids of a sequence selected from the group consisting of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, and sequences substantially identical thereto comprising introducing a nucleic acid encoding the polypeptide, operably linked to a promoter, into a host cell under conditions that allow expression of the polypeptide and recovering the polypeptide.

50. A method of generating a variant comprising:
obtaining a nucleic acid comprising a sequence selected from the group consisting of SEQ ID NOS: 1, 3, 5, 7, 9, 11, 13, 15, sequences substantially identical thereto, sequences complementary thereto, fragments comprising at least 30 consecutive nucleotides thereof, and fragments comprising at least 30 consecutive nucleotides of the sequences complementary to SEQ ID NOS: 1, 3, 5, 7, 9, 11 or 13, 15; and modifying one or more nucleotides in the sequence to another nucleotide, deleting one or more nucleotides in the sequence, or adding one or more nucleotides to the sequence.

51. The method of claim 50, wherein the modifications are introduced by a method selected from the group consisting of error-prone PCR, shuffling, oligonucleotide-directed mutagenesis, assembly PCR, sexual PCR mutagenesis, in vivo mutagenesis, cassette mutagenesis, recursive ensemble mutagenesis, exponential ensemble mutagenesis, site-specific mutagenesis, gene reassembly, gene site saturated mutagenesis and any combination thereof.

52. The method of claim 50, wherein the modifications are introduced by error-prone PCR.

53. The method of claim 50, wherein the modifications are introduced by shuffling.

54. The method of claim 50, wherein the modifications are introduced by oligonucleotide-directed mutagenesis.

55. The method of claim 50, wherein the modifications are introduced by assembly PCR.

56. The method of claim 50, wherein the modifications are introduced by sexual PCR mutagenesis.

57. The method of claim 50, wherein the modifications are introduced by in vivo mutagenesis.

58. The method of claim 50, wherein the modifications are introduced by cassette mutagenesis.

59. The method of claim 50, wherein the modifications are introduced by recursive ensemble mutagenesis.

60. The method of claim 50, wherein the modifications are introduced by exponential ensemble mutagenesis.

61. The method of claim 50, wherein the modifications are introduced by site-specific mutagenesis.

62. The method of claim 50, wherein the modifications are introduced by gene reassembly.

63. The method of claim 50, wherein the modifications are introduced by gene site saturated mutagenesis.

64. A computer readable medium having stored thereon a nucleic acid sequence selected from the group consisting of SEQ ID NOS: 1, 3, 5, 7, 9, 11, 13, 15, and sequences substantially identical thereto, or a polypeptide sequence selected from the group consisting of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, and sequences substantially identical thereto.

65. A computer system comprising a processor and a data storage device wherein the data storage device has stored thereon a nucleic acid sequence selected from the group consisting of SEQ ID NOS: 1, 3, 5, 7, 9, 11 and 13, 15, and sequences substantially identical thereto, or a polypeptide sequence selected from the group consisting of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, and sequences substantially identical thereto.

66. The computer system of claim 65 further comprising a sequence comparison algorithm and a data storage device having at least one reference sequence stored thereon.

67. The computer system of claim 66, wherein the sequence comparison algorithm comprises a computer program which indicates polymorphisms.

68. The computer system of claim 65, further comprising an identifier which identifies features in the sequence.

69. A method for comparing a first sequence to a reference sequence wherein the first sequence is a nucleic acid sequence selected from the group consisting of SEQ
ID NOS: 1, 3, 5, 7, 9, 11, 13, 15, and sequences substantially identical thereto, or a polypeptide sequence selected from the group consisting of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, and sequences substantially identical thereto comprising:
reading the first sequence and the reference sequence through use of a computer program which compares sequences; and determining differences between the first sequence and the reference sequence with the computer program.

70. The method of claim 69, wherein determining differences between the first sequence and the reference sequence comprises identifying polymorphisms.

71. A method for identifying a feature in a sequence wherein the sequence is selected from the group consisting of SEQ ID NOS: 1, 3, 5, 7, 9, 11, 13, 15, sequences substantially identical thereto, or a polypeptide sequence selected from the group consisting of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, and sequences substantially identical thereto comprising:
reading the sequence through the use of a computer program which identifies features in sequences; and identifying features in the sequences with the computer program.

72. A purified polypeptide of claim 1, wherein the polypeptide is an enzyme which is stable to heat, is heat resistant and catalyzes the formation or repair of a nucleic acid sequence, and wherein the enzyme is able to renature and regain activity after exposure to temperatures of from about 60° C to 113° C.

73. A method of catalyzing the formation or repair of a nucleic acid sequence, comprising contacting a sample containing nucleic acids with a polypeptide selected from the group consisting of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, and sequences having at least 50% homology and having polymerase enzyme activity under conditions which facilitate the formation or repair of the nucleic acid sequence.

74. An assay for identifying functional polypeptide fragments or variants encoded by fragments of SEQ ID NOS: 1, 3, 5, 7, 9, 11, 13, 15, and sequences substantially identical thereto, which retain the enzymatic function of the polypeptides of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, and sequences substantially identical thereto, the assay comprising:
contacting the polypeptide of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, and sequences substantially identical thereto, or polypeptide fragment or variant encoded by SEQ ID NOS: 1, 3, 5, 7, 9, 11, 13 or 15, with a substrate molecule under conditions which allow the polypeptide or fragment or variant to function, and detecting either a decrease in the level of substrate or an increase in the level of the specific reaction product of the reaction between the polypeptide and substrate, wherein a decrease in the level of substrate or an increase in the level of the reaction product is indicative of a functional polypeptide or fragment or variant.

75. A method of producing a polynucleotide, comprising contacting a polypeptide encoded by a polynucleotide of claim 1 with a DNA template in a PCR
amplification reaction, wherein the template molecule is greater than about 20 kb in length.

76. A method of producing a polynucleotide, comprising contacting a polypeptide encoded by a polynucleotide of claim 1 with a DNA template in a PCR
amplification reaction, wherein the template molecule contains greater than about 90% guanidine-cytosine (GC) content.

77. A nucleic acid probe comprising an oligonucleotide from about 10 to 50 nucleotides in length and having an area of at least 10 contiguous nucleotides that is at least 50% complementary to a nucleic acid target region of the nucleic acid sequence selected from the group consisting of SEQ ID NOS: 1, 3, 5, 7, 9, 11, 13, and 15 and which hybridizes to the nucleic acid target region under moderate to highly stringent conditions to form a detectable target:probe duplex.

78. The probe of claim 77, wherein the oligonucleotide is DNA.

79. The probe of claim 77, which is at least 55% complementary to the nucleic acid target region.

80. The probe of claim 77, which is at least 60% complementary to the nucleic acid target region.

81. The probe of claim 77, which is at least 65% complementary to the nucleic acid target region.

82. The probe of claim 77, which is at least 70% complementary to the nucleic acid target region.

83. The probe of claim 77, which is at least 75% complementary to the nucleic acid target region.

84. The probe of claim 77, wherein the oligonucleotide comprises a sequence which is 80% complementary to the nucleic acid target region.

85. The probe of claim 77, which is at least 85% complementary to the nucleic acid target region.

86. The probe of claim 77, wherein the oligonucleotide comprises a sequence which is 90% complementary to the nucleic acid target region.

87. The probe of claim 77, which is at least 95% complementary to the nucleic acid target region.

88. The probe of claim 77, which is fully complementary to the nucleic acid target region.

89. The probe of claim 77, wherein the oligonucleotide is 15-50 bases in length.

90. The probe of claim 77, wherein the probe further comprises a detectable isotopic label.

91. The probe of claim 77, wherein the probe further comprises a detectable non-isotopic label selected from the group consisting of a fluorescent molecule, a chemiluminescent molecule, an enzyme, a cofactor, an enzyme substrate, and a hapten.

92. A nucleic acid probe comprising an oligonucleotide from about 15 to 50 nucleotides in length and having an area of at least 15 contiguous nucleotides that is at least 90% complementary to a nucleic acid target region of the nucleic acid sequence selected from the group consisting of SEQ ID NOS: 1, 3, 5, 7, 9, 11, 13 and 15, and which hybridizes to the nucleic acid target region under moderate to highly stringent conditions to form a detectable target:probe duplex.

93. A nucleic acid probe comprising an oligonucleotide from about 15 to 50 nucleotides in length and having an area of at least 15 contiguous nucleotides that is at least 95% complementary to a nucleic acid target region of the nucleic acid sequence selected from the group consisting of SEQ ID NOS: 1, 3, 5, 7, 9, 11, 13, and 15 and which hybridizes to the nucleic acid target region under moderate to highly stringent conditions to form a detectable target:probe duplex.

94. A nucleic acid probe comprising an oligonucleotide from about 15 to 50 nucleotides in length and having an area of at least 15 contiguous nucleotides that is at least 97% complementary to a nucleic acid target region of the nucleic acid sequence selected from the group consisting of SEQ ID NOS: 1, 3, 5, 7, 9, 11, 13 and 15, and which hybridizes to the nucleic acid target region under moderate to highly stringent conditions to form a detectable target:probe duplex.

95. A polynucleotide probe for isolation or identification of polymerase genes having a sequence which is the same as or fully complementary to at least a portion of SEQ ID NOS: 1, 3, 5, 7, 9, 11, 13 or 15.

96. An enzyme preparation comprising a polypeptide of any one of claims 19 or 32 which is liquid.

97. An enzyme preparation comprising the polypeptide of any one of claims 19 or 32 which is dry.

98. A method for modifying small molecules, comprising mixing a polypeptide encoded by a polynucleotide of claim 1 or fragments thereof with a small molecule to produce a modified small molecule.

99. The method of claim 98 wherein a library of modified small molecules is tested to determine if a modified small molecule is present within the library which exhibits a desired activity.

100. The method of claim 99 wherein a specific biocatalytic reaction which produces the modified small molecule of desired activity is identified by systematically eliminating each of the biocatalytic reactions used to produce a portion of the library, and then testing the small molecules produced in the portion of the library for the presence or absence of the modified small molecule with the desired activity

101. The method of claim 100 wherein the specific biocatalytic reactions which produce the modified small molecule of desired activity is optionally repeated.

102. The method of Claim 100 or 101 wherein (a) the biocatalytic reactions are conducted with a group of biocatalysts that react with distinct structural moieties found within the structure of a small molecule, (b) each biocatalyst is specific for one structural moiety or a group of related structural moieties; and (c) each biocatalyst reacts with many different small molecules which contain the distinct structural moiety.

103. A kit comprising at least one container containing a purified protein having an amino acid sequence of SEQ ID NO: 2, 4, 6, 8, 10, 12, or 14,16 or homologous sequences thereof having polymerase activity at a temperature in a range from about 90°C to 113°C.

104. The kit of claim 103, wherein the protein is SEQ ID NO:16 or homologous sequences thereof having polymerase activity at a temperature in a range from about 90°C to 113°C.

105. The kit of claim 103, further comprising at least one container containing dNTPs, PCR-ready water, standard long and GC-rich positive control templates, control primer sets or any combination thereof.

106. A method of sequencing a DNA molecule comprising:
(a) hybridizing a primer to a first DNA molecule;
(b) contacting the first DNA molecule with deoxyribonucleoside triphosphates, a DNA polymerase of claim 1, and a terminator molecule to form a mixture;
(c) incubating the mixture under conditions sufficient to synthesize a random population of DNA molecules complementary to the first DNA
molecule and wherein the synthesized DNA molecules comprise a terminator nucleotide at their 5' termini; and (d) separating the synthesized DNA molecules by size so that at least a portion of the nucleotide sequence of the first DNA molecule can be determined.

107. The method of claim 106, wherein the deoxyribonucleoside triphosphates are inosine dATP, dCTP, dGTP, dTTP, dITP, 7-deaza-dGTP, dUTP, [.alpha.-S]dATP, [.alpha.-S]dTTP, [.alpha.-S]dGTP, or [.alpha.-S]dCTP.

108. The method of claim 106, wherein the terminator nucleotide is ddTTP, ddATP, ddGTP, ddITP, or ddCTP.

109. A method of preparing cDNA from mRNA, comprising:
(a) contacting mRNA with an oligo(dT) primer or other complementary primer to form a hybrid; and (b) contacting the hybrid formed in step (a) with a DNA
polymerase of claim 1 and four different dNTPs, under conditions whereby a cDNA is obtained.

110. A method of amplifying a double-stranded DNA molecule comprisinga (a) providing a first and second primer, wherein the first primer is complementary to a sequence at or near the 3'-termini of the first strand of the DNA molecule and the second primer is complementary to a sequence at or near the 3'-termini of the second strand of the DNA molecule;
(b) hybridizing the primer to the first strand and the second primer to the second strand in the presence of a DNA polymerase of claim 1, under conditions such that a third DNA molecule complementary to the first strand and a fourth DNA molecule complementary to the second strand are synthesized;
(c) denaturing the first and third strand, and second and fourth strands; and (d) repeating steps (a) to (c) one or more times to generate an amplified DNA molecule.

111. The method of claim 110, further comprising inserting the amplified DNA molecule into a vector.

112. The method of claim 111, wherein the vector is a plasmid.

113. A method for incorporating non-natural nucleotides or nucleotide analogs into a DNA molecule comprising contacting a polypeptide encoded by a polynucleotide of claim 1 with a DNA template in a PCR amplification reaction.

114. The method of claim 113, wherein the nucleotides are selected from inosine, 2-aminopurine, or 5-methylcytosine.