CA2482904A1 - Means and methods for the specific modulation of target genes in the cns and the eye and methods for their identification - Google Patents

Means and methods for the specific modulation of target genes in the cns and the eye and methods for their identification Download PDF

Info

Publication number
CA2482904A1
CA2482904A1 CA002482904A CA2482904A CA2482904A1 CA 2482904 A1 CA2482904 A1 CA 2482904A1 CA 002482904 A CA002482904 A CA 002482904A CA 2482904 A CA2482904 A CA 2482904A CA 2482904 A1 CA2482904 A1 CA 2482904A1
Authority
CA
Canada
Prior art keywords
cell
nucleic acid
disorder
acid molecule
gene
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
CA002482904A
Other languages
French (fr)
Inventor
Karina Drumm
Stefan Hubert Schlor
Frank Gohring
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Acuity Pharmaceuticals Inc
Original Assignee
Individual
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Individual filed Critical Individual
Publication of CA2482904A1 publication Critical patent/CA2482904A1/en
Abandoned legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1136—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against growth factors, growth regulators, cytokines, lymphokines or hormones
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/713—Double-stranded nucleic acids or oligonucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/1703—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • A61K38/1709—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/04—Centrally acting analgesics, e.g. opioids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/06—Antimigraine agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/14—Drugs for disorders of the nervous system for treating abnormal movements, e.g. chorea, dyskinesia
    • A61P25/16—Anti-Parkinson drugs
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/20—Hypnotics; Sedatives
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/22—Anxiolytics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/24—Antidepressants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/30—Drugs for disorders of the nervous system for treating abuse or dependence
    • A61P25/32—Alcohol-abuse
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P27/00—Drugs for disorders of the senses
    • A61P27/02—Ophthalmic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/111—General methods applicable to biologically active non-coding nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5091—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing the pathological state of an organism
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6893—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6893—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
    • G01N33/6896—Neurological disorders, e.g. Alzheimer's disease
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A01K2217/07—Animals genetically altered by homologous recombination
    • A01K2217/075—Animals genetically altered by homologous recombination inducing loss of function, i.e. knock out
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00—Applications; Uses
    • C12N2320/10—Applications; Uses in screening processes
    • C12N2320/12—Applications; Uses in screening processes in functional genomics, i.e. for the determination of gene function
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00—Applications; Uses
    • C12N2320/30—Special therapeutic applications
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00—Applications; Uses
    • C12N2320/30—Special therapeutic applications
    • C12N2320/32—Special delivery means, e.g. tissue-specific
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2500/00—Screening for compounds of potential therapeutic value
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/16—Ophthalmology
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/28—Neurological disorders

Abstract

Provided are methods for the treatment of disorders of the central nervous system (CNS) and the eye. In particular, use of compositions comprising a compound capable of modulating a target gene or gene product is described for the preparation of a pharmaceutical composition for the treatment of disorders of the CNS and/or the eye, wherein the composition is designed to be administered outside the blood-CNS and the blood-retina barriers. Furthermore, methods are provided for identifying and obtaining nucleic acid molecules encoding polypeptides involved in CNS disorders or of the eye, methods for diagnosing said disorders as well as transgenic animal deficient in the expression of target genes identified in accordance with the described method.
In addition, methods of identifying and isolating drugs that are particularly useful for the treatment of disorders related to the CNS and/or the eye are disclosed.

Description

Means and Methods for the Specific Modulation of Target Genes in the CNS and the Eye and Methods for their Identification Field of the invention The present invention relates to methods for the treatment of disorders of the central nervous system (CNS) and the eye. In particular, the present invention relates to the use of compositions comprising a compound capable of modulating a target gene or gene product for the preparation of a pharmaceutical composition for the treatment of disorders of the CNS
and/or the eye, wherein the composition is designed to be administered outside the blood-CNS and the blood-retina barriers. The instant invention further relates to methods of identifying and isolating nucleic acid molecules encoding polypeptides involved in CNS
disorders or of the eye, methods for diagnosing said disorders as well as to transgenic animals, wherein the expression of target genes identified in accordance with the method of the invention has been modulated. In addition, the present invention relates to methods of identifying and isolating drugs that are particularly useful for the treatment of disorders related to the CNS and/or the eye.
Several doctunents are cited throughout the text of this specification. Each of the documents cited herein (including any manufacturer's specifications, instructions, etc.) are hereby incorporated herein by reference; however, there is no admission that any document cited is indeed prior art as to the present invention.
Background art A variety of approaches currently exist for delivering biologically active agents to the CNS
and/or the eye. These include, among possible others, oral administration, intravenous-, intramuscular- and transcutaneous administration as well as intra-bulbous injection or application as eye-drops. If the drug is delivered into the systemic circulation, it is being carried to all internal organs and tissues and it has to pass through the blood-brain and/or blood retina barrier (in order to access the CNS and/or the inner parts of the eye). Obviously, all other organs are being exposed to the drug, which may lead to a high incidence of side effects, particularly when the drug exerts its effects on target genes or gene products, which are not specific for the disorder to be treated and/or the target cell or tissue.
Another strategy often employed in brain delivery is the use of invasive methods such as intraventricular infusion systems, intracerebral (polymeric) implants, transplantation of genetically engineered protein-secreting cells and cell implants. These methods are unfortunately only effective for drug delivery to the surface of the brain or to cells immediately adj acent to the depot or infusion site and can be used for example in the treatment of carcinomatous infiltration of the meninges. However, these methods have many limitations because effective drug concentrations in brain parenchyma cannot be achieved.
Like the human central nervous system the human eye is an organ characterized by high complexity and the coordinated functioning of numerous specific structures and tissues. Both are protected by barriers (tear secretion, enzymes, transport mechanisms, blood-retina and blood-CNS barrier) against harmful environmental influences. Like the blood-brain barrier, the blood-retina barrier also represents a physiological barrier for the uptake of medication by the inner part of the eye, and makes pharmacological therapy of ocular diseases very difficult indeed - if at all possible - at the present state of technology.
Medication currently available on the market for the treatment of disorders of the CNS
0 including ophthalmological diseases is therefore almost exclusively available for treatment of clinical symptoms often associated with side effects due to the high doses necessary. A causal therapy of the CNS, and particularly of the back sections of the eye, was not possible apart from the injections. Furthermore, the current state of information on the complex molecular metabolic interrelationship underlying the etiology of retinal diseases of multi-factorial origin ;5 is only limited. Consequently, medicaments available on the market are suitable to treat the symptoms of such diseases only.
In view of the need of therapeutic means for the treatment of diseases related to CNS and/or the eye, the technical problem of the present invention is to provide means and methods for i0 the identification and modulation of genes involved in disorders of the CNS
andlor the eye.
More specifically, the technical problem of present invention is to provide non-invasive methods for the controlled modulation of taxget genes and gene products in the mammalian CNS and/or eye while overcoming the blood-brain and/or blood retina barrier without injuring it.
The solution to said technical problem is achieved by providing the embodiments characterized in the claims, and described further below.
Summary of the invention The present invention is directed to a method for the treatment of a disorder of the central nervous system (CNS) and/or the eye comprising administering to a subject a composition comprising a compound capable of modulating a target gene or gene product in a therapeutically effective amount, wherein said composition is administered outside the blood-0 brain and/or the blood-retina barriers. In particular, said composition can comprise one or more double-stranded oligoribonucleotides (dsRNA), which mediate an RNA
interference of the corresponding mRNA of one or more target genes.
In another aspect, the present invention is directed to a method of identifying and isolating a l5 nucleic acid molecule encoding a polypeptide involved in a disorder of the CNS and/or the eye comprising the steps of:
(a) culturing a cell, tissue or non-human animal under stress conditions which lead to simulation of a pathological condition related to a CNS or eye disorder;
(b) isolating nucleic acids and/or proteins from a sample of said cell, tissue or animal;
?0 (c) comparing the expression or activity profile of at least one of said nucleic acids and/or proteins with that of a corresponding non-treated cell, tissue or animal, and/or with that of a cell, tissue or animal, which has been treated under different stress conditions;
(d) determining at least one nucleic acid and/or protein which is differentially expressed, whereby a change of expression or of the active amount of said at least one nucleic acid 25 or activity of at least one of said proteins or an altered localization of the protein is indicative for its role in a disorder of the CNS or eye.
The present invention also relates to nucleic acid molecules obtainable by the method described above, particularly if the encoded polypeptide is involved in angiogenesis and/or 30 neovascularization and/or retinal disorder as well as to vectors comprising such nucleic acid molecules and host cells comprising said vector.
The present invention is also directed to a method for the production of a polypeptide capable of inducing a responsive change in a phenotype comprising culturing said host cell under 35 conditions allowing the expression of the polypeptide and recovering the produced polypeptide from the culture as well as to polypeptides obtainable by said method or encoded by the nucleic acid molecules mentioned above.
Furthermore, the present invention relates to an antibody specifically recognizing such a polypeptide and pharmaceutical and/or diagnostic compositions comprising such an antibody or any one of the above described nucleic acid molecules, nucleic acid molecules which are complementary to such a nucleic acid molecules, vectors, host cells, and/or polypeptides, and optionally a pharmaceutically acceptable carrier and suitable means for detection, respectively.

In addition, the present invention is directed to methods for treating a disorder of the CNS
and/or the eye comprising administering to the subject said pharmaceutical compositions in an effective dose, 5 Futhermore, the present invention relates to a method for detecting expression of a gene involved in a disorder of the CNS and/or eye comprising:
(a) obtaining mRNA from a cell;
(b) incubating the mRNA so obtained with a probe comprising a nucleic acid molecule described above or a fragment thereof under hybridizing conditions; and ;0 (c) detecting the presence of mRNA hybridized to the probe;
or (a) obtaining a cell sample from the subject;
(b) contacting the cell sample so obtained with an antibody described above;
and (c) detecting the presence of the antibody bound to the protein encoded by said gene.
'S
The invention furthermore is directed to a method for diagnosing in a subject said disorder or a predisposition to such disorder which comprises:
(a) isolating DNA from patient suffering from the disorder;
(b) digesting the isolated DNA of step (a) with at least one restriction enzyme;
S 0 (c) electrophoretically separating the resulting DNA fragments on a sizing gel;
(d) incubating the resulting gel with a probe comprising a nucleic acid molecule of the invention or a fragment thereof labelled with a detectable marker;
(e) detecting labelled bands on a gel which have hybridized to the probe as defined to create a band pattern specific to the DNA of patients of the disorder;
>5 (~ preparing subject's DNA by steps (a) to (e) to produce detectable labeled bands on a gel; and (g) comparing the band pattern specific to the DNA of patients of the disorder of step (e) and the subject's DNA of step (f) to determine whether the patterns are the same or different and to diagnose thereby the disorder or a predisposition to the disorder, if the patterns are the same;
or (a) analyzing a sample of nucleic acids of a subject by means of a diagnostic chip, primer extension, single nucleotide polymorphisms or sequencing comprising a nucleic acid molecule as described above; and (b) comparing the result with that of a sample obtained from a patient suffering from the 0 disorder;
wherein the identity of expression profil and/or nucleotide sequence is indicative for the disorder.
In further embodiment, the present invention relates to a method of determining whether a test substance has an effect on a nucleic acid molecule or polypeptide involved in a CNS or eye disorder comprising the steps:
(a) contacting a cell which expresses the target gene or gene product identified and isolated in accordance with the above decribed method with a compound to be screened;
and (b) determining if the compound modulates the expression or the activity of said taregt gene ,0 or gene product.
In a further aspect, the present invention relates to a drug or prodrug for the treatment of a disorder as defined above comprising:
(a) synthezising a test substance or a collection of test substances;
'S (b) subjecting said the test substance or collection of test substances to the screening method of the invention; and (c) producing a compound identified as a modulator of a target gene or gene product or a derivative thereof.
30 In addition, the present invention is directed to a transgenic non-human animal which displays an aberrant expression or activity of the target gene or gene product definend above and to its use for a process in drug discovery for the treatment of said disorder.
Detailed Description of the Invention The present invention relates to the use of a compound capable of modulating a target gene or gene product for the preparation of a pharmaceutical composition for the treatment of a disorder of the central nervous system (CNS) and/or the eye, wherein said composition is designed to be applied outside the blood-CNS and/or blood-retina barriers.
In one aspect, the present invention is based on the surprising finding that the blood-retina barrier could be overcome by the administration of compounds not considered to be capable of doing so in the therapy of ocular diseases by specific modulation of protein function in the tissues of the eye. Due to the functional similarity of the blood-retina barrier to the blood-0 brain barrier, providing an improved method to overcome the blood-retina barrier with the aim to treat a given eye disease is expected to be suitable for the treatment of CNS disorders, too.
Hence, in accordance with the present invention the compositions comprising a compound 5 capable of modulating a target gene or gene product in the CNS or the eye are preferably designed to be administered without any substantial, i.e. substantially effective amount of delivery-enhancing agents facilitating passage of compounds through the blood-brain barrier and/or without the necessity of applying invasive methods and devices; see, e.g., those compounds , methods and devices described in IJS2002183683 and W003/000018.
However, !0 for some embodiments, which represent independent aspects of the invention, such as the use of compounds mediating RNA interference, the use of such methods and compounds may be encompassed for the enhanced and controlled delivery of a compound capable of modulating a target gene or gene product into the mammalian CNS and/or eye while circumventing the blood-brain and blood-retina barriers.
?5 Those later embodiments are based, inter alia, on the provision of novel methods that overcome the difficulty of the application of conventional experimental strategies for the identification of genes, which cause CNS disorders and/or eye diseases, and their validation as targets for diagnosis and for pharmacological intervention strategies. This applies especially for AMD, since the symptoms of this disorder appear only late, generally in the 7th 30 decade of life. The current state of knowledge regarding the pathological metabolic interrelationships is not sufficient for the medical treatment of most CNS and eye diseases.
Suitable animal or cell culture models are not available for such diseases, due to the complexity of the disease patterns and the lack of appropriate strategies for simple intervention and manipulation in the CNS and at the eye.

- 'J _ Hence, in one important aspect, the present invention relates to a cell, tissue and animal model based assay for the identification and isolation of target genes and gene products involved in disorders of the CNS and/or the eye and their use as targets for therapeutic intervention and/or diagnosis of such disorders.
Examples for CNS disorders are, for example, Alzheimer's disease, Parkinson disease, depression, bipolar disorder, schizophrenia, amnesia, migraine-headache, stroke, insomnia, alcohol abuse, anxiety, obsessive compulsive disorder, cerebral acquired human immuno-0 deficiency syndrome, chronic pain and many others.
The compositions of the invention may be administered locally or systemically e.g., intravenously. Preparations for parenteral administration include sterile aqueous or non-aque-ous solutions, suspensions, and emulsions. Examples of non-aqueous solvents are propylene 5 glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Aqueous carriers include water, alcoholic/aqueous solutions, emulsions or suspensions, including saline and buffered media. Parenteral vehicles include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's, or fixed oils.
Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers (such as ?0 those based on Ringer's dextrose), and the like. Preservatives and other additives may also be present such as, for example, antimicrobials, anti-oxidants, chelating agents, and inert gases and the like. Furthermore, the pharmaceutical composition of the invention may comprise further agents such as interleukins or interferons depending on the intended use of the pharmaceutical composition.
?5 In accordance with the present invention the pharmaceutical compositions are administered to a subject in an effective dose of between about 0,1 ~.g to about 10 mg units/day and/or units/kg body weight; see also infra. Furthermroe, the appropriate dosage regimen can be determined according to Example 21.
30 In a preferred embodiment, the disorder to be treated is related to eye.
Such disorders include chorioretinitis and herpes retinitis, which may be considered as acquired forms of retinal disease, the majority of retinal disease disorders are reduced to a genetic predisposition. These include for example primary retinal detachment (ablatio retinae), retinal blastoma, retinal astrocytoma (Bourneville-Pringle), angiomatosis retinae (Hippel-Lindau), Coat's disease _g_ (exudative retinitis), Eale's disease, central serous retinopathy, ocular albinism, retinitis pigmentosa, retinitis punctata albescens, Usher syndrome, Leber's congenital amaurosis, cone dystrophy, vitelliform macular degeneration (Best's disease), juvenile retinoschisis, North Carolina macular dystrophy, Sorsby's fundus dystrophy, Doyne's honey comb retinal dystrophy (Malattia Leventinese), Stargardt's disease, Wagner vitreoretinal degeneration or Age-related macular degeneration (AMD) as well as single-gene retinopathies like Morbus Best or Morbus Stargardt. Various genetic defects are known which lead or predispose to this wide range of eye disease phenotypes.
0 Some of these clinical phenotypes are characterized by a pathological de novo generation of blood vessels, which is called neoangiogenesis or neovascularization. Starting from the choriokapillaris, the growth of new blood vessels into the inner eye then leads to an increasing degeneration of photoreceptor cells in the affected areas of the human retina.
In the field of opthalmology, one can distinguish between two forms of neovascularization:
subretinal 5 (choroidal CNV) neovascularization and retinal neovascularization.
Subretinal neovascularization, which is also called subfoveal neovascularization, is associated with degenerative disorders like Makular degeneration and characterized by loss of visual acuity and metamorphopsy. On the other hand, retinal neovascularization, vitreous body or Iris neovascularization is associated with ischemic processes (e.g. retinal vasculitis and diabetic ,0 retinopathy). Furthermore, neoangiogenesis is an important pathomechanism in different, non ophthalmological disease patterns such as tumor growth, arthritis and diabetic nephropathy.
Therefore, in a preferred embodiment of the methods and uses of the present invention said disorder to be treated is related to angiogenesis and/or neovascularization and particularly preferred to the retinal pigment epithelium (RPE), neurosensory retina and/or choriodea. Most ;5 preferred, the disorder is wet age-related macular degeneration (AMD) or diabetic retinopathy.
The following description deals with AMD as example for a complex eye disease with a genetic component. Considering the wet form of AMD, it also serves as an example for a >0 disease pattern, which is characterized by a distinct neovascularization.
The example shall illustrate the associated technical problems with reference to the study of molecular causes and the development of diagnostic and pharmacological intervention strategies.
AMD, which can be thought as a sub-type of retinal degeneration, is the most common cause of visual morbidity in the developed world with a prevalence increasing from 9°1o in persons over 52 years to more than 25% in persons over the age of 75 (Paetkau et al.
1978, Leibowitz et al. 1980, Banks and Hutton 1981, Ghafour et al. 1983, Hyman 1987, Hyman et al. 1983, Grey et al. 1989, Yap and Weatherill 1989, Heiba et al. 1994).
An early stage in the evolution of AMD pathology is accompagnied by an increasing accumulation of yellowish lipofuscin-like particles within the retinal pigment epithelium (RPE; Feeney 1978). It is thought that these particles represent remnants of undigested phagocytosed photoreceptor outer segment membranes which, in the normal process, are excreted basally through Bruch's membrane into the choriocapillaris. Over time, accumulation 0 of lipofuscin-like particles affect Bruch's membrane and lead to its progressive destruction (Hogan and Alvarado 1967, Sarks 1976, Feeney-Burns and Ellersieck 1985, Pauleikhoff et al.
1990). The deposits in the RPE and Bruch's membrane consists largely of lipids although their exact composition may vary between individuals with some deposits revealing more polar phospholipids while others contain predominantly apolar neutral lipids.
5 These individual differences in drusen composition are thought to be the basis for the clinical heterogeneity in AMD (Green et al. 1985). While some patients present with an ingrowth of vessels from the choriocapillaris through Bruch's membrane (neovascularization) (Bressler et al. 1982), others show pigment epithelial detachment due to excudation underneath the RPE
(Gass 1967, Green et al. 1985), and a third group of patients experiences a slow decrease of ;0 visual loss due to atrophic changes in the RPE and the overlying sensory neuroretina (Maguire and Vine 1986).
Although much less common the excudative/neovascular form of AMD accounts for more than 80% of blindness with a visual acuity of <_ 20/200 (Bressler et a.l.
2002). In contrast to the '.5 above described "dry" form of AMD, the exudative "wet" AMD is associated with a choroidal neovascularization (CNV), leading to blindness and, thus, to a loss of life quality (followed by psychic disorders, increased risk of injury etc; Bressler et al.
2002). There is a high risk of developing (> 40%) CNV in the second eye within 5 years of the development of CNV-AMD in the first eye (Bressler et al. 2002). Neovascular AMD is characterized by i0 choroidal neovascular lesions. These lesions develop when abnormal blood vessels from the choroid grow and proliferate through breaks in the Bruch membrane to beneath the retinal pigment epithelium (Bressler et al. 2002, Campochiaro et al. 1999). The abnormal leakage from these vessels can result in hemorrhage or detachment of the retinal pigment epithelium or the neurosensory retina (which overlies the retinal pigment epithelium).
Accompanying scar formation can replace retinal tissue and result in permanent vision loss.
AMD is a complex disease caused by exogenous as well as endogenous factors (Meyers and Zachary 1988; Seddon et al. 1997). In addition to environmental factors, several personal risk factors such as hypermetropia, light skin and iris colour, elevated serum cholesterol levels, hypertension or cigarette smoking have been suggested (Hyman et al. 1983, Klein et al. 1993, Sperduto and Hiller 1986, The Eye Disease Case-Control Study Group 1992, Bressler and Bressler 1995). A genetic component for AMD has been documented by several groups (Gass 0 1973, Piguet et al. 1993, Silvestri et al. 1994) and has lead to the.hypothesis that the disease may be triggered by environmental/individual factors in those persons who are genetically predisposed.~The number of genes which, when mutated, can confer susceptibility to AMD is not known but may be numerous.
5 The late onset of symptoms generally in the 7th decade of life as well as the clinical and likely genetic heterogeneity make it difficult to apply conventional approaches for the identification of genes predisposing to AMD. Due to the complexity of the clinical phenotype, it may be assumed that the number of genes is large, which, when mutated contribute to AMD
susceptibility.
,0 With recent physical approaches for the treatment of AMD such as laser photocoagulation, photodynamic therapy (using verteprofin, trade name Visudyne ~, Novartis), irradiation or surgical therapies, success was only achieved with a moderate percentage of the patients (Bressler et al. 2002, Yuzawa et al. 2001).
!5 Hence, the methods, uses and compositions of the present invention described herein represent an important improvement and alternative therapeutic intervention for the treatment of this particular disease as well as of others. For those embodiments the pharmaceutical compositions are preferably designed to be effective in (and applied to) the posterior segment of the eye, preferably in a form designed to be applied outside the retinal region of the blood-i0 retina barrier.
In one embodiment of the invention said compound is an inhibitor/antagonist of said target gene or gene product and preferably inhibits the expression of a gene or the activity of a gene product involved in angiogenesis and/or neovascularization; see supra.

The term "antagonist/inhibitor" in accordance with the present invention includes chemical agents that modulate the action of a gene or the activity of a gene product either through altering its enzymatic activity or through modulation of expression, e.g., by affecting S transcription or translation. In some cases the antagonist/inhibitor may also be a substrate of a a gene product involved in the disoder or a ligand binding molecule.
The term "inhibitor" includes both substances which reduce the activity of the polypeptide and those which nullify it altogether.
An "antagonist''' that modulates the activity of the gene product and causes for example a 0 response in a cell based assay described below, refers to a compound that alters directly or indirectly the activity the gene product or the amount of active product. The effect of an antagonist may be observed as a blocking of agonist-induced activation of a target gene.
Antagonists include competitive as well as non-competitive antagonists. A
competitive antagonist (or competitive blocker) interacts with or near the site specific for agoust binding.
A non-competitive antagonist or blocker inactivates the function of the gene product by interacting with a site other than the agonist interaction site. Preferably, the antagonist/inhibitor is small chemical agent which directly interacts with the target gene product involved in the disorder, preferably with a gene product involved in angiogenesis and/or neovascularization. Therefore, there will preferably be a direct relationship between ;0 the molar amount of compound required to inhibit or stimulate the target gene activity and the molar amount of gene product present or lacking in the cell. The compounds can be derived from a polypeptide, an anti-polypeptide antibody, an RNA molecule encoding (part of) a polypeptide or its antisense sequence, a transcription regulator, a ligand binding molecule, a polypeptide substrate or a known agonist/activator or antagonist/inhibitor.
?S
In a preferred embodiment of the present invention said antagonist is based on nucleic acids, for example a ribozyme, antisense or sense nucleic acid molecules to said gene or gene or dsRNA molecules which are capable of mediating RNA interference. Methods and computer programs for the preparation rational selection of for example antisense oligonucleotide 30 sequences are described in the prior art; see for example Smith, Eur. J.
Pharm. Sci. 11 (2000), 191-198; Toschi, Methods 22 (2000), 261-269; Sohail, Adv. Drug Deliv. Rev. 44 (2000), 23-34; Moulton, J. Comput. Biol. 7 (2000), 277-292. These procedures comprise how to find optimal hybridization sites, and secondly on how to select sequences that bind to for example mRNAs overexpressed in a CNS or eye disorder. These methods can include the more empirical testing of large numbers of mRNA complementary sequences to the more systematic techniques, i.e. RNase H mapping, use of combinatorial arrays and prediction of secondary structure of mRNA by computational methods. Structures that bind to structured RNA, i.e. aptastructures and tethered oligonucleotide probes, and foldback triplex-forming oligonucleotides can also be employed for the purpose of the present invention. Relating to selection of antisense sequences by aid of computational analysis, valuable www addresses are given below.
In a particularly preferred embodiment of the present invention said antagonist/inhibitor 0 substantially consists of ribonucleotides which preferbly contain a portion of double-stranded oligoribonucleotides (dsRNA). Secondary structure prediction and in vitro accessibility of mRNA as tools in the selection of target sites is described for example in Amarzguioui, Nucleic Acids Res. 28 (2000), 4113-4124. Minimising the secondary structure of DNA
targets by incorporation of a modified deoxynucleoside: implications for nucleic acid analysis by hybridisation is described in Nguyen, Nucleic Acids Res. 28 (2000), 3904-3909.
dsRNA between 21 and 23 nucleotides in length is preferred. The dsRNA molecule can also contain a terminal 3'-hydroxyl group and may represent an analogue of naturally occurring RNA, differing from the nucleotide sequence of said gene or gene product by addition, deletion, substitution or modification of one or more nucleotides. General processes of .0 introducing an RNA into a living cell to inhibit gene expression of a target gene in that cell comprising RNA with double-stranded structure, i.e. dsRNA or RNAi are known to the person skilled in the art and are described, for in WO99/32619, WO01/68836, WO01/77350, WO00/44895, WO02/055692 and W002/055693, the disclosure content of which is hereby incorporated by reference.
!5 The target mRNA of said dsRNA is preferably encoded by gene or a cDNA
obtained in accordance with the method of the present invention described below. In one embodiment the target nucleotide sequence encodes an amino acid sequence of SEQ ID NO: 2 or 4 and/or comprises a nucleotide sequence of SEQ ID NO: 1 or 3.
i0 In one embodiment of the invention the compound to be used in the compositions is a nucleic acid molecule or encoded by a nucleic acid molecule and is designed to be expressed in cells of the CNS and/or eye. For those embodiments gene therapy intervention is envisaged; see also infra.

In a preferred embodiment of the methods and uses of the present invention the composition is in a form designed to be introduced into the cells or tissue of the CNS or eye by a suitable carrier, characterized by the application occurring outside the blood-CNS
and/or blood-retina barriers, for instance as eye drops. It can also be administered systemically, iontophoretically or by retrobulbar inj ection.
Iontophoresis has been defined as the active introduction of ionised molecules into tissues by means of an electric current. The technique has been used to enhance drug delivery into tissues underlying the donor electrode (e.g. skin) as well as to the general blood circulation, thus providing systemic delivery of a drug to the entire body. Iontophoresis devices require at 0 least two electrodes, both being in electrical contact with some portion of a biological membrane surface of the body. One electrode commonly referred to as the "donor" or "active"
electrode, is- the electrode from which the biologically active substance, such as a drug or prodrug, is delivered into the body. Another electrode having an opposite polarity functions to complete the electric circuit between the body and the electrical power source. This electrode .5 is commonly referred to as the "receptor" or "passive" electrode. During iontophoresis, an electrical potential is applied over the electrodes, in order to create an electrical current to pass through the drug solution and the adjacent tissue. Iontophoresis has been described for the treatment of blood-vessel related disorders (e.g. restenosis), bladder, uterus, urethra and prostate disorders. U.S. Patent Nos. 6,219,557; 5,588,961; 5,843016;
5,486,160; 5,222,936;
?0 5,232,441; 5,401,239 and 5,728,068 disclose different types of iontophoresis catheters for insertion into hollow, tubular organs (bladder, urethra and prostate) or into blood vessels. US
2002183683 suggests the method for delivery of active substances into the CNS.
Numerous active, often specifically expressed genes are required to perform and control the ZS processes in the cells of the CNS and the retina and the metabolic exchanges across the blood-CNS and blood-retina barrier. Specific genetic activity is also necessary for maintaining the structure and functional integrity of numerous components of these complex tissues. As a consequence, this unique and highly evolved system is especially susceptible to various genetic defects, thus leading to a wide range of disease phenotypes. While studying 30 monogenetic disorders is relatively easy, provided the patients are members of a family sufficiently large enough to allow positional cloning, the identification of genes that contribute to multigeneic disorders or confer or susceptibility to a disease is far more difficult.

Hence, in another aspect the present invention relates to a method of identifying and isolating s' a nucleic acid molecule encoding a polypeptide involved in a disorder of the CNS and/or the eye comprising:
(a) culturing a cell, tissue or non-human animal under stress conditions which lead to simulation of a pathological condition related to a CNS or eye disorder;
(b) isolating nucleic acids and/or proteins from a sample of said cell, tissue or animal;
(c) comparing the expression or activity profile of at least one of said nucleic acids and/or proteins with that of a corresponding non-treated cell, tissue or animal, and/or with that of a cell, tissue or animal, which has been treated under different stress conditions;
0 (d) determining at least one nucleic acid and/or protein which is differentially expressed, whereby a change of expression or of the active amount of said at least one nucleic acid or activity of at least one of said proteins or an altered localization of the protein is indicative for its role in a disorder of the CNS or eye.
5 First, a cell, tissue or non-human animal is cultured under stress conditions which lead to simulation of a pathological condition related to a CNS or eye disorder.
Preferably, said method is a cell culture based method. Preferred cells and tissue investigated (either in culture or comprised in a test animal) are those which belong to the CNS and/or eye, for example neuronal cells, glial cells, retinal cells, etc.
!0 In a particular preferred embodiment of the method of the present invention said cell is an RPE cell or an established cell line derived from an RPE cell such as the cell line ARPE-19;
see also infra. The isolation of RPE cells is described, e.g., in Example 1 below. ARPE-19 cell line is described in Dune et al., Exp. Eye Res. 62 (1996), 155-169. For example, ARPE-19 cell line is partiuclarly suitable for mimicking the repair response observed in vivo during ?5 proliferative vitreoretinopathy by vitreous treatment.
The mentioned stress condition can be generated by an aberrant supply of the cell, tissue or animal culture conditions and comprise, for example, oxidative stress, hypoxic culture conditions, insufficient nutrition and/or supply with growth factors, change of pH-value 30 and/or pathophysiological concentration of rod outer segments (ROS) and/or A2-E; see also Examples 3 to 10. Preferred stress conditions are those conferred by pathophysiological concentration of rod outer segments (ROS) and/or A2-E. As an example the tissue of the interior segment of the eye can be supplied in an aberrant manner, which is a preferred embodiment of the method of the invention. Table 1 shows commonly marker genes, whose altered expression indicates apoptosis, hypoxic culture conditions or oxidative stress and which can thereby be used to verify and/or quantify the applied stress and the cellular response, respectively.
> A further step of the method of the present invention involves isolating the nucleic acids and/or proteins from a sample of said cell, tissue or animal and in a further step comparing the expression or activity profile of at least one of said nucleic acids and/or proteins with that of a corresponding non-treated cell, tissue or animal, and/or with that of a cell, tissue or animal, which has been treated under different stress conditions. The isolation of nucleic acids and proteins can be done by methods known to the person skilled in the art and described in the cited literature; see also Examples 1 l and 12.
In the last step at least one nucleic acid and/or protein which is differentially expressed is determined, whereby a change of expression or of the active amount of said at least one nucleic acid or activity of at least one of said proteins or an altered localization of the protein is indicative for its role in a disorder of the CNS or eye.
In one embodiment of the screening method of the invention the expression of nucleic acids is analyzed with an expression array and/or realtime PCR. Chip and array technology are well 0 known to the person skilled in the art; see also Examples 14 to 20. Advances in approaches to DNA-based diagnostics are reviewed, for example, by Whitcombe et al. in Curr.
Opin.
Biotechnol. 9 (1998), 602-608. Furthermore, DNA chips and microarray technology devices, systems, and applications are described by, e.g. Cuzin, Transfus. Clin. Biol.
8 (2001), 291-296 and Heller, Annu. Rev. Biomed. Eng. (2002), 129-153. Likewise, biomedical applications of ,5 protein chips is known and described in, e.g., Ng, J. Cell. Mol. Med. 6 (2002), 329-340.
In another embodiment the protein expression is analyzed with immunoblot or ELISA assay, or 2 D gel electrophoresis or MALDI-TOF and particularly preferred antibodies are used which are specific for proteins involved in angiogenesis and/or neovascularization.
.0 Detailed descriptions of conventional methods, such as those employed in the construction of vectors and plasmids, the insertion of genes encoding polypeptides into such vectors and plasmids, the introduction of plasmids into host cells, and the expression and determination thereof of genes and gene products can be obtained from numerous publication, including Sambrook et al., (1989) Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory Press. Candidate nucleic acids or encoded polypeptides identified in such a manner can be validated by expressing them and observing the phenotype. A
further embodiment of the screening method therefore comprises the overexpression or inhibition of expression of the identified candidate nucleic acid or encoded polypeptide in said cell, tissue or animal for their capability of inducing a responsive change in the phenotype of said cell, tissue or animal, wherein said phenotype is related to a disorder of the CNS
or eye.
The responsive change in the phenotype of said cells can be observed by subjecting the cells, secreted factors thereof, or cell lysates thereof, to endothelial cell cultures; and/or analyzing different parameters like cell proliferation, electrophysiological activity, DNA synthesis, out-0 growth of cells, cell migration, chemokinesis, chemotaxis, development of vessels, marker gene expression or activity, apoptosis and/or vitality. Examples for such assays are:
Proliferating cell nuclear antigen assay (PCNA) or TUNEL-assay are described in Montesano, R.: Regulation of angiogenesis in vitro. Eur J Clin Invest, 22: 504-515, 1992.
Montesano, R.
5 et al.: Basic fibroblast growth factor induces angiogenesis in vitro. Proc Natl Acad Sci USA, 83: 7297-7301, 1986. Holmgren, L. et al.: Dormancy of mictrometastases:
Balanced proliferation and apoptosis in the presence of angiogenesis suppression.
Nature Med, 1: 149-153, 1995.
',0 Boyden chamber assay is described in Holmgren, L. et al.: Dormancy of mictrometastases:
Balanced proliferation and apoptosis in the presence of angiogenesis suppression. Nature Med, 1: 149-153, 1995. Albini, A. et al.: A rapid in vitro assay for quantitating the invassive potential of tumor cells. Cancer Research,47: 3239-3245, 1987. Hu, G. et al.:
Angiogenen promotes invasiveness of cultured endothelial cells by stimulation of cell-associated ?5 proteolytic activities. Proc Natl Acad Sci USA, 6: 12096-12100, 1994.
Alessandri, G. et al.:
Mobilization of capillary endothelium in vitro induced by effectors of angiogenesisi in vivo.
Cancer res, 43: 1790-1797, 1983.
Aortic ring angiogenesis assay is described in Zuh, W.H., et al.: Regulation of vascular 30 growth and regression by matrix metalloproteinases in the rat aorta model of angiogenesis.
Lab Invest, 80: 545-555, 2000. Kruger, EA. et al.: UCNO1, a protein kinase C
inhibitor, inhibits endothelial cell proliferation and angiogenic hypoxic response.
Invasion Metastas, 18:
209-218, 2000. Kruger, E.A. et al.: Endostatin inhibits microvessel formation in the rat aortic ring angiogenesis assay. Biochem Biophys Res Commun, 268: 183-191, 2000.
Bauer, K.S. et 35 al.: Inhibition of angiogenesis by thalidomide requires metabolic activation, which is species dependent. Biochem Pharmacol, 55: 1827-1834, 1998. Bauer, K.S. et al.:
Carboxyamidotriazole inhibits angiogenesis by blocking the calcium-mediated nitric-oxide synthase-vascular endothelial growth factor pathway. J Pharmacol Exp Ther, 292: 31-37, 2000. Berger, A.C. et al.: Endothelial monocyte activating polypeptide III
induces endothelial cell apoptosis and may inhibit tumor angiogenesis. Microvasc Res, 60: 70-80, 2000.
Saphenous vein angiogenesis assay is described in Kruger, E.A. et al.:
Endostatin inhibits microvessel formation in the rat aortic ring angiogenesis assay. Biochem Biophys Res Commun, 268: 183-191, 2000.

Comes mircropocket assay is described in Gimbrone, E.A. et al: Tumor growth and neovascularization: an experimental model using the rabbit cornea. J Natl Cancer Inst, 52:
413-427, 1974. Kenyon, B.M. et al.: A model of angiogenesis in the mouse cornea. Invest Ophthalmol Vis Sci, 37: 1625-1632, 1996. Kenyon, B.M. et al.: Effects of thalidomide and 5 related metabolites in a mouse corneal model of neovascularization. Exp Eye Res, 64: 971-978, 1997. Proia, A.D. et al.: The effect of angiostatic steroids and beta-cyclodextrin tetradecasulfate on corneal neovascularization in the rat. Exp Eye Res, 57:
693-698, 1993.
Chick embryo chorioallantoic membrane assay is described in Knighton, D. et al.: Avascu1ar 0 and vascular phases of tumor growth factor in the chicken embryo. Br J
Cancer, 35: 347-356, 1977. Auerbach, R. et al.: A simple procedure for the long-term cultivation of chicken embryos. Dev Biol, 41: 391-394, 1974. Ausprunk, D.H. et al.: Differentiation of vascular endothelium in the chick chorioallantois: A structural and autoradiographic study. Dev Biol, 38: 237-248, 1974. Nguyen, M. et al.: Quantitation of angiogenesis and antiangiogenesis in .5 the chick embryo chorioallantoic membrane. Microvasc Res, 47: 31-40, 1994.
Furthermore a sample of said cells can be treated with an inhibitor specific for the candidate nucleic acid or encoded polypeptide to be validated and in a second step it is determined whether said cells, secreted factors thereof or cell lysates thereof have lost their capability of 0 inducing the responsive change in the phenotype observed when no inhibitor is used. In a preferred embodiment the phenotype is angiogenesis and/or neovascularization.
As an inhibitor the molecules described above can be used. Preferably, siRNA
technique is used for inhibiting the expression of the target gene. A collection of protocols for siRNA-mediated knockdown of mammalian gene expression, which can be adapted to a method of the invention as mentioned herein is described for example in Elbashir et al., Methods 26 (2002), 199-213 and Martinez et al., Cell 110 (2002), 563-574.
For the development of assays and drugs for treatment of disorders caused by the genes it is often necessary to identify the sequence of those nucleic acids and/or proteins, and optionally identifying the corresponding encoding gene or cDNA as well. Based on the specific functions of the cells of the CNS andlor eye specific, it is presumed that genes, the aberrant function of which cause a CNS or eye disease, are specifically expressed in the respective tissues and cells, thus representing preferred targets for drug interventions.
Therefore, the 0 identified gene, cDNA or a fragment thereof is usually also cloned and nucleic acid molecules obtainable by the methods described herein form also part of the invention, particularly if they encode polypeptides involved in angiogenesis and/or neovascularization. Such a nucleic acid molecule can be DNA or cDNA and be derived from a mammal and in a preferred embodiment is from a mouse or a human.

Hence, in a first set of experiments several nucleic acid molecules could be identified which indeed were known to be involved in autosomal recessive retinitis pigmentosa (ARRP), which inter alia is characterized by the degeneration of retinal photoreceptor cells. For example, nucleic acid molecules could be indentified corresponding to the gene encoding the human 0 cyclic nucleotide gated channel alpha 1 (CNGA1, accession No. NM 000087; SEQ
ID NO: 1 and 2). Mutations in this gene have been described to be involved in autosomal recessive retinitis pigmentosa; see Dryja et al., Proc. Nat. Acad. Sci. IJSA 92 (1995), 10177-10181. In another experiment, nucleic acid molecules corresponding to the human gene encoding the beta-subunit of rod cGMP phosphodiesterase (accession No. NM 000283; SEQ ID
NO: 3 and ,5 4) have been identified. Malfunction of this gene has also been associated with autosomal recessive retinitis pigmentosa, in particular with congenital stationary night blindness 3, CSNB3. These results confirm that the method of the present invention works.
In another embodiment the nucleic acid molecule specifically hybridizes to one of the nucleic ~0 acid molecules described above wherein the latter encodes a mutated version of the protein which has lost its capability of inducing a responsive change in a phenotype.
In additon or alternatively, nucleic acid molecules are encompassed of at least 15 nucleotides in length and able to hybridize specifically to a nucleic acid molecule described above or with a complementary strand thereof. These nucleic acid molecules are particularly useful as probes;
see infra.
The nucleic acid molecules described above can be contained in a vector and preferably be operatively linked to regulatory elements permitting expression in prokaryotic or eukaryotic host cells. Expression of said nucleic acid molecule comprises transcription into a translatable mRNA. Regulatory elements ensuring expression in eukaryotic cells, preferably mammalian cells, are well known to those skilled in the art. They usually comprise regulatory sequences ensuring initiation of transcription and optionally poly-A signals ensuring termination . of 0 transcription and stabilization of the transcript. Additional regulatory elements may include transcriptional as well as translational enhancers, and/or naturally associated or heterologous promoter regions.
Possible regulatory elements permitting expression in prokaryotic host cells comprise, e.g., 5 the PL, lac, trp or tac promoter in E. coli, and examples for regulatory elements permitting expression in eukaryotic host cells are the AOX1 or GALL promoter in yeast or the CMV-, SV40- , RSV-promoter, CMV-enhancer, SV40-enhancer or a globin intron in mammalian and other animal cells.
,0 Beside elements which are responsible for the initiation of transcription such regulatory elements may also comprise transcription termination signals, such as the SV40-poly-A site or the tk-poly-A site, downstream of the nucleic acid molecule. Furthermore, depending on the expression system used leader sequences capable of directing the polypeptide to a cellular compartment or secreting it into the medium may be added to the coding sequence of the ! 5 polynucleotide of the invention and are well known in the art. The leader sequences) is (are) assembled in appropriate phase with translation, initiation and termination sequences, and preferably, a leader sequence capable of directing secretion of translated protein, or a portion thereof, into the periplasmic space or extracellular medium. Optionally, the heterologous sequence can encode a fusion protein including a C- or N-terminal identification peptide SO imparting desired characteristics, e.g., stabilization or simplified purification of expressed recombinant product. In this context, suitable expression vectors are known in the art such as Okayama-Berg cDNA expression vector pcDVl (Pharmacia), pCDMB, pRc/CMV, pcDNAl, pcDNA3 (Invitrogen), or pSPORTl (GIBCO BRL).

Preferably, the expression control sequences will be eukaryotic promoter systems in vectors capable of transforming or transfecting eukaryotic host cells, but control sequences for prokaryotic hosts may also be used. Once the vector has been incorporated into the appropriate host, the host is maintained under conditions suitable for high level expression of the nucleotide sequences, and, as desired, the collection and purification of the protein so produced.
Furthermore, the present invention relates to vectors, particularly plasmids, cosmids, viruses and bacteriophages used conventionally in genetic engineering that comprise a nucleic acid 0 molecule of the invention. Preferably, said vector is an expression vector and/or a gene transfer or targeting vector. Expression vectors derived from viruses such as retroviruses, vaccinia virus, adeno-associated virus, herpes viruses, or bovine papilloma virus, may be used for delivery of the polynucleotides or vector of the invention into targeted cell population.
Methods which are well known to those skilled in the art can be used to construct '.5 recombinant viral vectors; see, for example, the techniques described in Sambrook, Molecular Cloning A Laboratory Manual, Cold Spring Harbor Laboratory (1989) N.Y. and Ausubel, Current Protocols in Molecular Biology, Green Publishing Associates and Wiley Interscience, N.Y. (1994). Alternatively, the polynucleotides and vectors of the invention can be recon-stituted into liposomes for delivery to target cells. The vectors containing the nucleic acid ?0 molecules of the invention can be transferred into the host cell by well known methods, which vary depending on the type of cellular host. For example, calcium chloride transfection is commonly utilized for prokaryotic cells, whereas calcium phosphate treatment or electroporation may be used for other cellular hosts; see Sambrook, supra.
?5 Vectors that can be used for therapeutic and/or diagnostic purposes in accordance with the teaching of the present invention are known to the person skilled in the art;
see, e.g., heritable and inducible genetic interference by double-stranded RNA encoded by transgenes described in Tavernarakis et al., Nat. Genet. 24 (2000), 180-183. Further vectors and methods for gene tranfer and generation of transgenic animals are described in the prior art;
see, e.g., adeno-30 associated virus related vectors described in Qing et al., Virol. 77 (2003), 2741-2746; human immunodeficiency virus type 2 (HIV-2) vector-mediated in vivo gene transfer into adult rabbit retina described in Gheng et al. Curr. Eye Res. 24 (2002), 196-201, long-term transgene expression in the RPE after gene transfer with a high-capacity adenoviral vector described in Kreppel et al., Invest. Ophthalmol. Vis. Sci. 43 (2002), 1965-1970 and non-invasive observation of repeated adenoviral GFP gene delivery to the anterior segment of the monkey eye in vivo described in Borras et al., J. Gene Med. 3 (2001) , 437-449.
CNS gene transfer has also been described in Leone et al., Curr. Opin. Mol.
Ther. 1 (1999), Said vector in turn can be contained in a host cell. A bacterial, fungal, plant or animal cell can be used as a host but mammalian cells are preferred, especially RPE or neurosensory retina 0 cells.
If these host cells are cultured under conditions allowing the expression of the polypeptide and recovering the produced polypeptide from the culture this constitutes a method for the production of a polypeptide capable of inducing a responsive change in a phenotype.
5 Polypeptides encoded by a nucleic acid molecule as defined above or obtainable by this method are therefore preferred embodiments of this invention as well as antibodies specifically recognizing such a polypeptide. Antibodies or fragments thereof to the aforementioned polypeptides can be obtained by using methods which are described, e.g., in Harlow and Lane "Antibodies, A Laboratory Manual", CSH Press, Cold Spring Harbor, 1988.
,0 Furthermore, the polypeptides encoded by the identified and isolated nucleic acid molecules can be used to identify synthetic chemical peptide mimetics that bind to or can function as a ligand, substrate, binding partner or the receptor of the polypeptide as effectively as does (e.g.) the natural ligand; see, e.g., Engleman, J. Clin. Invest. 99 (1997), 2284-2292. For example, folding ;5 simulations and computer redesign of structural motifs of the polypeptide can be performed using appropriate computer programs (Olszewski, Proteins 25 (1996), 286-299;
Hoffinan, Comput.
Appl. Biosci. 11 (1995), 675-679). Computer modeling of protein folding can be used for the conformational and energetic analysis of detailed peptide and protein models (Monge, J. Mol. Biol.
247 (1995), 995-1012; Renouf, Adv. Exp. Med. Biol. 376 (1995), 37-45). In particular, the >0 appropriate programs can be used for the identification of interactive sites of the polypeptide and its ligand or other interacting proteins by computer assistant searches for complementary peptide sequences (Fassina, hnmunomethods 5 (1994), 114-120. Further appropriate computer systems for the design of protein and peptides are described in the prior art, for example in Berry, Biochem.
Soc. Trans. 22 (1994), 1033-1036; Wodak, Ann. N. Y. Acad. Sci. 501 (1987), 1-13; Pabo, Biochemistry 25 (1986), 5987-5991. Methods for the generation and use of peptidomimetic combinatorial libraries are described in the prior art, for example in Ostresh, Methods in Enzymology 267 (1996), 220-234 and Dorner, Bioorg. Med. Chem. 4 (1996), 709-715.
Furthermore, a three-dimensional and/or crystallographic structure of the polypeptide can be used for the design of mimetic inhibitors of the biological activity of the protein of the invention (Rose, Biochemistry 35 (1996), 12933-12944; Rutenber, Bioorg. Med. Chem. 4 (1996), 1545-1558).
The structure-based design and synthesis of low-molecular-weight synthetic molecules that mimic the activity of a native biological polypeptide is further described in, e.g., Dowd, Nature Biotechnol. 16 (1998), 190-195; I~ieber-Emmons, Current Opinion Biotechnol. 8 0 (1997), 435-441; Moore, Proc. West Pharmacol. Soc. 40 (1997), 115-119;
Mathews, Proc.
West Pharmacol. Soc. 40 (1997), 121-125; Mukhija, European J. Biochem. 254 (1998), 433-438.
The nucleic acid molecules identified and isolated by the method of the present invention can 5 also serve as a target for activators and inhibitors. Activators may comprise, for example, proteins that bind to the mRNA of the corresponding gene, thereby stabilizing the native conformation of the mRNA and facilitating transcription and/or translation, e.g., in like manner as Tat protein acts on HIV-RNA. Furthermore, methods are described in the literature for identifying nucleic acid molecules such as an RNA fragment that mimics the structure of a ?0 defined or undefined target RNA molecule to which a compound binds inside of a cell resulting in retardation of cell growth or cell death; see, e.g., WO 98/18947 and references cited therein. These nucleic acid molecules can be used for identifying unknown compounds of pharmaceutical and/or agricultural interest, and for identifying unknown RNA targets for use in treating a disease. Alternatively, for example, the conformational structure of the RNA
? 5 fragment which mimics the binding site can be employed in rational drug design to modify known ligands to make them bind more avidly to the target. One such methodology is nuclear magnetic resonance (NMR), which is useful to identify drug and RNA
conformational structures. Still other methods are, for example, the drug design methods as described in WO
95/35367, US-A-5,322,933, where the crystal structure of the RNA fragment can be deduced 30 and computer programs are utilized to design novel binding compounds which can act as antibiotics.
Hence, the antagonist/inhibitor can be, for example, an antibody, an antisense nucleic acid molecule or a ligand binding molecule. Preferably, said antagonist/inhibitor interferes with change of conformation/function of the polypeptide, most preferably with a biological activity related to angiogenesis and/or neovascularization.
The antibodies, nucleic acid molecules, inhibitors and activators used in the compositions of S the present invention preferably have a specificity at least substantially identical to the binding specificity of the natural ligand or binding partner of the protein, in particular if stimulation is desired. An antibody or inhibitor can have a binding affinity to the protein of at least 105 M'1, preferably higher than 10' M-1 and advantageously up to 101° M-1 in case suppression should be mediated. In a preferred embodiment, a suppressive antibody .or 0 inhibitor has an affinity of at least about 10-~ M, preferably at least about 10-9 M and most preferably at least about 10-11 M; and an activator has an affinity of less than about 10-~ M, preferably less than about 10-6 M and most preferably in order of 10-SM.
In case of antisense nucleic acid molecules it is preferred that they have a binding affinity to those encoding the protein of at most 2-, 5- or 10-fold less than an exact complement of 20 consecutive nucleotides of the coding sequence.
Another embodiment of this invention is a pharmaceutical composition comprising a nucleic acid molecule described above, a vector, a host cell, a polypeptide and/or an antibody as defined above, and optionally a pharmaceutically acceptable carrier; see supra and infra.
,0 Those compositions can be used in a method for treating of a disorder of the CNS or the eye comprising administering to the subject such a pharmaceutical compositions in an effective dose.
Similarly the nucleic acid molecule, vector, host cell, polypeptide and/or antibody described ?5 above can be used in a diagnostic composition that optionally contains suitable means for detection as well. Expression of a gene involved in a disorder of the CNS or the eye can be detected by obtaining mRNA from a cell; incubating the mRNA so obtained with a probe comprising a nucleic acid molecule as described above or a fragment thereof under hybridizing conditions; and detecting the presence of mRNA hybridized to the probe. On the i0 protein level the method for detecting expression of a gene involves obtaining a cell sample from the subject; contacting the cell sample so obtained with an antibody as defined above;
and detecting the presence of antibody so bound. This way the detection of the expression of a protein encoded by a mutated nucleic acid molecule which has lost its capability to induce a responsive change in phenotype is also possible.

The invention also provides a method for diagnosing in a subject a disorder or a predisposition to such disorder of the CNS or the eye which comprises:
(a) isolating DNA from patient suffering from the disorder;
(b) digesting the isolated DNA of step (a) with at least one restriction enzyme;
(c) electrophoretically separating the resulting DNA fragments on a sizing gel;
(d) incubating the resulting gel with a probe comprising a nucleic acid molecule described above or a fragment thereof labelled with a detectable marker;
(e) detecting labelled bands on a gel which have hybridized to the probe as defined. to 0 create a band pattern specific to the DNA of patients of the disorder;
(f) preparing subject's DNA by steps (a) to (e) to produce detectable labelled bands on a gel; and (g) comparing the band pattern specific to the DNA of patients of the disorder of step (e) and the subject's DNA of step (f) to determine whether the patterns are the same or L 5 different and to diagnose thereby the disorder or a predisposition to the disorder, if the patterns are the same.
Another method provided by this invention for diagnosing in a subject a disorder or a predisposition to such disorder of the CNS or the eye comprises:
?0 (a) analyzing a sample of nucleic acids of a subject by means of a diagnostic chip, primer extension, single nucleotide polymorphisms or sequencing comprising a nucleic acid molecule as defined above, and (b) comparing the result with that of a sample obtained from a patient suffering from the disorder, ZS wherein the identity of expression profile and/or nucleotide sequence is indicative for the disorder.
In these embodiments, the nucleic acid molecules, (poly)peptide, antibodies or compounds identified above are preferably detectably labeled. A variety of techniques are available for labeling biomolecules, are well known to the person skilled in the art and are considered to be 30 within the scope of the present invention. Such techniques are, e.g., described in Tijssen, "Practice and theory of enzyme immuno assays", Burden, RH and von Knippenburg (Eds), Volume 15 (1985), "Basic methods in molecular biology"; Davis LG, Dibmer MD;
Battey Elsevier (1990), Mayer et al., (Eds) "Immunochemical methods in cell and molecular biology" Academic Press, London (1987), or in the series "Methods in Enzymology", Academic Press, Inc. There are many different labels and methods of labeling known to those of ordinary skill in the art. Commonly used labels comprise, inter alia, fluorochromes (like fluorescein, rhodamine, Texas Red, etc.), enzymes (like horse radish peroxidase, (3-galactosidase, alkaline phosphatase), radioactive isotopes (like 32P or IZSI), biotin, digoxygenin, colloidal metals, chemi- or bioluminescent compounds (like dioxetanes, luminol or acridiniums). Labeling procedures, like covalent coupling of enzymes or biotinyl groups, iodinations, phosphorylations, biotinylations, random priming, nick-translations, tailing (using terminal transferases) are well known in the art. Detection methods comprise, but are not limited to, autoradiography, fluorescence microscopy, direct and indirect enzymatic reactions, 0 etc.
In addition, the above-described compounds etc. may be attached to a solid phase. Solid phases are known to those in the art and may comprise polystyrene beads, latex beads, magnetic beads, colloid metal particles, glass and/or silicon chips and surfaces, nitrocellulose 5 strips, membranes, sheets, animal red blood cells, or red blood cell ghosts, duracytes and the walls of wells of a reaction tray, plastic tubes or other test tubes. Suitable methods of immobilizing nucleic acids, (poly)peptides, proteins, antibodies, etc. on solid phases include but are not limited to ionic, hydrophobic, covalent interactions and the like.
The solid phase can retain one or more additional receptors) which has/have the ability to attract and ?0 immobilize the region as defined above. This receptor can comprise a charged substance that is oppositely charged with respect to the reagent itself or to a charged substance conjugated to the capture reagent or the receptor can be any specific binding partner which is immobilized upon (attached to) the solid phase and which is able to immobilize the reagent as defined above.
?5 Commonly used detection assays can comprise radioisotopic or non-radioisotopic methods.
These comprise, inter alia, RIA (Radioisotopic Assay) and IRMA (Immune Radioimmunometric Assay), EIA (Enzym Immuno Assay), ELISA (Enzyme Linked Immuno Assay), FIA (Fluorescent Immuno Assay), and CLIA (Chemioluminescent Immune Assay).
30 Other detection methods that are used in the art are those that do not utilize tracer molecules.
One prototype of these methods is the agglutination assay, based on the property of a given molecule to bridge at least two particles.

For diagnosis and quantification of (poly)peptides, polynucleotides, etc. in clinical and/or scientific specimens, a variety of immunological methods, as described above as well as molecular biological methods, like nucleic acid hybridization assays, PCR
assays or DNA
Enzyme Immunoassays (Mantero et al., Clinical Chemistry 37 (1991), 422-429) have been developed and are well known in the art. In this context, it should be noted that the nucleic acid molecules may also comprise PNAs, modified DNA analogs containing amide backbone linkages. Such PNAs are useful, inter alia, as probes for DNA/RNA
hybridization.
The above-described compositions may be used for methods for detecting expression of a 0 target gene by detecting the presence of mRNA coding for a (poly)peptide which comprises, for example, obtaining mRNA from cells of a subject and contacting the mRNA so obtained with a probe/primer comprising a nucleic acid molecule capable of specifically hybridizing with the target gene under suitable hybridization conditions, and detecting the presence of mRNA hybridized to the probe/primer. Further diagnostic methods leading to the detection of 5 nucleic acid molecules in a sample comprise, e.g., polymerase chain reaction (PCR), ligase chain reaction (LCR), Southern blotting in combination with nucleic acid hybridization, comparative genome hybridization (CGH) or representative difference analysis (RDA). These methods for assaying for the presence of nucleic acid molecules are known in the art and can be carried out without any undue experimentation.
?0 Furthermore, the invention comprises methods of detecting the presence of a target gene product, i.e. a protein in a sample, for example, a cell sample, which comprises obtaining a cell sample from a subject, contacting said sample with one of the aforementioned antibodies under conditions permitting binding of the antibody to the protein, and detecting the presence ?5 of the antibody so bound, for example, using immuno assay techniques such as radioimmunoassay or enzymeimmunoassay. Furthermore, one skilled in the art may specifically detect and distinguish polypeptides which are functional target proteins from mutated forms which have lost or altered their activity by using an antibody which either specifically recognizes a (poly)peptide which has native activity but does not recognize an 30 inactive form thereof or which specifically recognizes an inactive form but not the corresponding polypeptide having native activity.
The invention also encompasses a method for diagnosing in a subject a predisposition to a CNS and/or eye disorder associated with the expression of a target gene allele; see supra. The detectable markers of the present invention may be labeled with commonly employed radioactive labels, such as, for example, 32P and 3sS, although other labels such as biotin or mercury as well as those described above may be employed as well. Various methods well-known to the person skilled in the art may be used to label the detectable markers. For > example, DNA sequences and RNA sequences may be labeled with 32P or 35S
using the random primer method. Once a suitable detectable marker has been obtained, various methods well-known to the person skilled in the art may be employed for contacting the detectable marker with the sample of interest. For example, DNA-DNA, RNA-RNA and DNA-RNA
hybridizations may be performed using standard procedures. Various methods for the detection of nucleic acids are well-known in the art, e.g., Southern and northern blotting, PCR, primer extension and the like. Suitable further DNA amplification techniques are known in the art and comprise, inter alia, Ligase Chain reaction, Strand Displacement Amplification, Nucleic Acid Sequence based Amplification (NASBA), or Q-beta replicase.
Furthermore, the mRNA, cRNA, cDNA or genomic DNA obtained from the subject may be sequenced to identify mutations which may be characteristic fingerprints of target gene mutations in CNS and/or eye disorders such as described above associated with the expression of the target gene or mutated versions thereof. The present invention further comprises methods, wherein such a fingerprint may be generated by RFLPs or AFLP of DNA
0 or RNA obtained from the subj ect, optionally the DNA or RNA may be amplified prior to analysis, the methods of which are well known in the art. RNA fingerprints may be performed by, for example, digesting an RNA sample obtained from the subject with a suitable RNA-Enzyme, for example RNase Tl, RNase T2 or the like or a ribozyme and, for example, electrophoretically separating and detecting the RNA fragments on PAGE as described above.
!5 Preferably, hybridization (and subsequent washing) is effected under stringent conditions; see, e.g., Sambrook et al., loc. cit and supra.
Furthermore, the present invention relates to a method as described above wherein said sample is or is derived from hair, blood, serum, sputum, feces or another body fluid. The >0 sample to be analyzed may be treated such as to extract, inter alia, nucleic acid molecules, (poly)peptides, or antibodies.
The present invention also relates to kit compositions containing specific reagents such as those described herein-before. Kits containing oligonucleotides, DNA or RNA, antibodies or 35 protein may be prepared. Such kits are used to detect for example DNA which hybridizes to DNA of the target gene or to detect the presence of protein or peptide fragments in a sample.
Such characterization is useful for a variety of purposes including but not limited to forensic analyses, diagnostic applications, and epidemiological studies in accordance with the above-described methods of the present invention. The recombinant target proteins, DNA molecules, RNA molecules and antibodies lend themselves to the formulation of kits suitable for the detection and typing of the target gene. Such a kit would typically comprise a compartmentalized carrier suitable to hold in close confinement at least one container. The carrier would further comprise reagents such as recombinant protein or antibodies suitable for detecting the expression or activity of the target gene or gene product. The carrier may also 0 contain a means for detection such as labeled antigen or enzyme substrates or the like.
Another embodiment of this invention comprises the use of an effective dose of a nucleic acid molecule described above or a nucleic acid molecule which is complementary to such a nucleic acid molecule, or a vector as defined previously for the preparation of a composition 5 for treating, preventing and/or delaying a disorder of the CNS and/or the eye in a subject by somatic gene therapy.
As used herein, the term " effective dose" means the total amount of the drug or pro-drug that is sufficient to show a meaningful patient benefit, i.e., treatment, healing, prevention or amelioration of a condition related to the disorder of the CNS, for example ?0 neovascularization, or an increase in rate of treatment, healing, prevention or amelioration of such conditions. In addition or alternatively, in particular with respect to pre-clinical testing of the drug the term "effective dose" includes the total amount of the drug or pro-drug that is sufficient to elicit a physiological response in a non-human animal test.
?5 As mentioned above, the vectors of the present invention may also be an expression, a gene transfer or gene targeting vector. Gene therapy, which is based on introducing therapeutic genes into cells by ex-vivo or in-vivo techniques is one of the most important applications of gene transfer. Transgenic mice expressing a neutralizing antibody directed against nerve growth factor have been generated using the "neuroantibody" technique;
Capsoni, Proc. Natl.
i0 Acad. Sci. USA 97 (2000), 6826-6831 and Biocca, Embo J. 9 (1990), 101-108.
Suitable vectors, methods or gene-delivering systems for in-vitro or in-vivo gene therapy are described in the literature and are known to the person skilled in the art; see, e.g., Giordano, Nature Medicine 2 (1996), X34-539; Schaper, Circ. Res. 79 (1996), 911-919; Anderson, Science 256 (1992), 808-813, Isner, Lancet 348 (1996), 370-374; Muhlhauser, Circ. Res. 77 (1995), 1077-1086; Onodua, Blood 91 (1998), 30-36; Verzeletti, Hum. Gene Ther. 9 (1998), 2243-2251;
Verma, Nature 389 (1997), 239-242; Anderson, Nature 392 (Supp. 1998), 25-30;
Wang, Gene Therapy 4 (1997), 393-400; Wang, Nature Medicine 2 (1996), 714-716; WO
94/29469; WO
97/00957; US 5,580,859; US 5,589,466; US 4,394,448 or Schaper, Current Opinion in Biotechnology 7 (1996), 635-640, and references cited therein. In particular, said vectors and/or gene delivery systems are also described in gene therapy approaches in neurological tissue/cells (see, inter alia Blomer, J. Virology 71 (1997) 6641-6649) or in the hypothalamus (see, inter alia, Geddes, Front Neuroendocrinol. 20 (1999), 296-316 or Geddes, Nat. Med. 3 (1997), 1402-1404). Further suitable gene therapy constructs for use in neurological 0 cells/tissues are known in the art, for example in Meier (1999), J.
Neuropathol. Exp. Neurol.
58, 1099-1110. The nucleic acid molecules and vectors of the invention may be designed for direct introduction or for introduction via liposomes, viral vectors (e.g.
adenoviral, retroviral), electroporation, ballistic (e.g. gene gun) or other delivery systems into the cell. The introduction and gene therapeutic approach should, preferably, lead to the expression of a l5 functional copy of the target gene of the invention. On the other hand, if target gene expression should be reduced, the expression of the introduced vector preferably leads to the production of an inhibitor as decribed above, for example antisense RNA or RNAi molecules.
In those embodiments, the nucleic acid molecules are perferably linked to cell and/or tissue specific promoters, particularly preferred to promoters directing the expression in the cells ?0 and tissue of the eye. Examples for suitable promoters include the angiopoietin 2 promoter (see in Hackett, J. Cell. Physiol. 184 (2000), 275-284) and particularly preferred promoters which are capable of targeting expression to the retinal pigment epithelium such as the tyrosinase related protein-1 (Tyrpl) promoter; see Beermann, Cell Mol. Biol.
45 (1999), 961-968.
?5 In a further aspect, the present invention also provides a method for the screening for compounds modulating the expression or the activity of a polypeptide involved in a disorder of the CNS or the eye. This method involves contacting a cell which expresses a polypeptide as described above identified by the methods illustrated previously with a compound to be 30 screened and determining if the expression or the activity is altered.
The amount of time necessary for cellular contact with the compound is empirically determined, for example, by running a time course with a known modulator and measuring cellular changes as a function of time. The measurement means of the method of the present invention can be further defined by comparing a cell that has been exposed to a compound to an identical cell that has not been similarly expose to the compound.
Alternatively two cells, one containing a functional target gene and a second cell identical to the first, but lacking a functional target gene could be both be contacted with the same compound and compared for differences between the two cells. This technique is also useful in establishing the background noise of these assays. One of average skill in the art will appreciate that these control mechanisms also allow easy selection of cellular changes that are responsive to modulation of the functional target gene or gene product.
The term "cell" refers to at least one cell, but includes a plurality of cells appropriate for the 0 sensitivity of the detection method. Cells suitable for the present invention may be bacterial, yeast, or preferably eukaryotic. The methods of this invention employ certain types of cells, certain observations of changes in aspects of the biological state of a cell, and certain comparisons of these observed changes. Preferred cell lines to be used in the assays of the present invention, especially cells and cell lines derived from the CNS or eye of, for example 5 human, porcine, or marine origin, are described in the examples and in the prior art, for example human retinal pigment epithelial cells (see e.g. Dunaief et al. Curr.
Eye Res. 24 (2002), 392-396), immortalized human corneal epithelial cell line (see e.g.
Athmanathan et al., BMC Ophthalmol. 30 (2002), 3), and also cells of the CNS, for example human neuronal cell lines (see e.g. Li et al., J. Neurosci. Res. 71 (2003), 559-566), CNS
cell line immortalized 0 with an N-terminal fragment of SV40 large T (see e.g. Truckenmiller et al., Exp. Neurol. 175 (2002), 318-337), immortalized 2310 choroidal epithelial cell line from marine choroid plexus (see Zheng and Zhao, Brain Res. 958 (2002), 371-380.
Suitable cell lines, in particular animal and human cell lines as well as technical information on the characteristics of cell lines, cytogenetic analysis, suggestions for handling cell cultures, 5 etc can be obtained from depository institutions, for example the American Type Culture Collection (ATCC), P.O. Box 1549, Manassas, VA 20108, USA and DSMZ - Deutsche Sammlung von Mikroorganismen and Zellkulturen GmbH, Mascheroder Weg lb, 38124 Braunschweig, GERMANY. Preferred are RPE cells or RPE derived celllines such as ARPE-19, cells overexpressing or with inhibited expression of candidate genes involved in CNS or 0 eye disorders or host cells as described previously.
In a preferred embodiment said polypeptide is expressed under the control of the GGTB-promoter, which is described in van Bokhoven et al., Genomics 38 (1996), 133-140. The test substance can be a single chemotherapeutic agent or a mixture of chemotherapeutic agents.

The cell that is contacted with the test substance can be derived from a single cell or a multi-cellular organism. Said mufti-cellular organism can be selected from the group consisting of a vertebrate animal, a mammal, a primate, an invertebrate animal, an insect and a plant. The above-described cells can also be comprised in a tissue or organism, i.e. non-human animal.
General methods for the screening of compounds that have a desired effect on a cell or organism as measured in a specific assay are described in the prior art; see for example US-A-6,165,709 and references cited herein.
Cells, non-human animals and target gene expression and/or knock out systems can be found 0 in the prior art and adapted for the method of the present invention; see for example the documents cited herein.
The cellular changes suitable for the method of the present invention .comprise directly measuring changes in the function or quantity of the target gene product, or by measuring 5 downstream effects, for example by measuring secondary messanger concentrations or changes in transcription or by changes in protein levels of genes that are transcriptionally influenced by the target gene product, or by measuring phenotypic changes in the cell.
Preferred measurement means include changes in the quantity of protein, changes in the functional activiy, changes in the quantity of mRNA, changes in intracellular protein, changes !0 in cell surface protein, or secreted protein, or changes in Ca2+, cAMP or GTP concentration.
Changes in the quantity or functional activity of target gene products are described herein.
Changes in the levels of mRNA are detected by reverse transcription polymerase chain reaction (RT-PCR), by differential gene expression or by microarrays.
Immunoaffinity, ligand affinity, or enzymatic measurement quantitates changes in levels of protein in host cells.
!5 Protein-specific affinity beads or specific antibodies are used to isolate for example 35S-methionine labelled or unlabelled protein. Labelled protein is analyzed by SDS-PAGE.
Unlabelled protein is detected by Western blotting, cell surface detection by fluorescent cell sorting, cell image analysis, ELISA or RIA employing specific antibodies.
Where the protein is an enzyme, the induction of protein is monitored by cleavage of a flourogenic or ~0 colorimetric substrate.
Where the endogenous gene encodes a soluble intracellular protein, changes in the endogenous gene may be measured by changes of the specific protein contained within the cell lysate. The soluble protein may be measured by the methods described herein.

The assays may be simple "yes/no" assays to determine whether there is a change in expression or function, or may comprise any one of the above described methods, for example for the detection of angiogenic activity. The assay may be made quantitative by comparing the expression or function of a test sample with the levels of expression or function in a standard sample. Modulators identified in this process axe useful as therapeutic agents.
The above-described methods can, of course, be combined with one or more steps of any of the above-described screening methods or other screening methods well known in the art.
Methods for clinical compound discovery comprises for example ultrahigh-throughput screening (Sundberg, Curr. Opin. Biotechnol. 11 (2000), 47-53) for lead identification, and structure-based drug design (Verlinde and Hol, Structure 2 (1994), 577-5~7) and combinatorial chemistry (Salemme et al., Structure 15 (1997), 319-324) for lead optimization.
Once a drug has been selected, the method can have the additional step of repeating the method used to perform rational drug design using the modified drug and to assess whether said modified drug displays better affinity according to for example interaction/energy analysis.
In a preferred embodiment of the method of the present invention, said cell, tissue or non-human animal is a transgenic cell, tissue or non-human animal which displays a substantially reduced or enhanced level of target gene expression and/or gene product activity compared to a corresponding wild-type animal. Usually, said transgenic non-human animal displaying a reduced level of target gene activity comprises at least one mutant allele of the target gene or a corresponding traps-dominant allele of a different gene. Preferably, said transgenic non-human animal is a knock-out animal.
Preferably said substantially reduced or enhanced level of target gene expression and/or gene product activity results in an altered and a phenotypic response of the transgenic cell, tissue or 0 non-human animal. An agonist/activator or antagonist/inhibitor will then be identified by observing whether a candidate compound is able at a certain concentration to revert the phenotypic response of said transgenic cell, tissue or non-human animal back to normal. In a paxticular preferred embodiment, said transgenic non-human animal displays a CNS and/or eye disorder as defined above.

The assay methods of the present invention can be in conventional laboratory format or adapted for high throughput. The term "high throughput" (HTS) refers to an assay design that allows easy analysis of multiple samples simultaneously, and capacity for robotic manipulation. Another desired feature of high throughput assays is an assay design that is optimized to reduce reagent usage, or minimize the number of manipulations in order to achieve the analysis desired. Examples of assay formats include 96-well, 384-well or more-well plates, levitating droplets, and "lab on a chip" microchannel chips used for liquid handling experiments. It is well known by those in the art that as miniaturization of plastic L 0 molds and liquid handling devices are advanced, or as improved assay devices are designed, that greater numbers of samples may be performed using the design of the present invention.
The test substances which can be tested and identified according to a method of the invention may be expression libraries, e.g., cDNA expression libraries, peptides, proteins, nucleic acids, antibodies, small organic compounds, hormones, peptidomimetics, PNAs, aptamers or the like (Milner, Nature Medicine 1 (1995), 879-880; Hupp, Cell 83 (1995), 237-245; Gibbs, Cell 79 (1994), 193-198 and references cited supra). The test substances to be tested also can be so called "fast seconds" of known drugs. The invention also relates to further contacting the test cells with a second test substance or mixture of test substances in the presence of the first test 2,0 substance.
In the method of the invention, said cells are preferably contained in a container, for example in a well in a microtiter plate, which may be a 24, 96, 384 or 1586 well plate. Alternatively, the cells can be introduced into a microfluidics device, such as those provided by Caliper (Newton, MA, USA). In another preferred embodiment, step (b) of the method of the present invention comprises taking 2, 3, 4, 5, 7, 10 or more measurements, optionally at different positions within the container. In some embodiments of the method of the present invention, a compound known to activate or inhibit the target gene or gene product is added to the medium prior to step (b).

Preferably, in a first screen said test substance is comprised in and subjected as a collection of compounds. Said collection of compounds may have a diversity of about 103 to about 105.
Methods for the generation and use of peptidomimetic combinatorial libraries are described in the prior art, for example in Ostresh, Methods in Enzymology 267 (1996), 220-234 and Dorner, Bioorg. Med. Chem. 4 (1996), 709-715. Drug discovery by dynamic combinatorial libraries is described, for example, in Nat. Rev. Drug Discov. 1 (2002), 26-36 and Drug Discov. Today 7 (2002), 117-125.
i Furthermore, the above-described methods can, of course, be combined with one or more steps of any of the above-described screening methods or other screening methods well known in the art. Methods for clinical compound discovery comprises for example ultrahigh-throughput screening (Sundberg, Curr. Opin. Biotechnol. 11 (2000), 47-53) for lead identification, and structure-based drug design (Verlinde and Hol, Structure 2 (1994), 577-587) and combinatorial chemistry (Salemme et al., Structure 15 (1997), 319-324) for lead optimization. Once a drug has been selected, the method can have the additional step of repeating the method used to perform rational drug design using the modified drug and to assess whether said modified drug displays better affinity according to for example interaction/energy analysis. The method of the present invention may be repeated one or more times such that the diversity of said collection of compounds is successively reduced.
Preferably, the target polypeptide is involved in angiogenesis or neovascularization.
As mentioned above, the present invention provides convenient assays, preferably cell based and in vivo assays for identifying and obtaining drugs capable of modulating the gene 0 activity, thereby being useful as a therapeutic agent for the treatment of diseases related to CNS disorders including (e.g.) Schizophrenia, Parkinson's Disease, Alzheimer's Disease, and eye diseases such as those described above. In accordance with this, the present invention provides also a use for compounds which have been known in the art, properly also known to be able to modulate target gene activity but which hitherto have not been suggested for ,5 medical use because of the lack of knowledge of phenotypic responses of an organism evoked by target gene activity or the lack of it.
One embodiment of this invention comprises a method for the production of a drug or prodrug identified by such a screening as a modulator or a derivative thereof, particularly if the substance has hitherto not been known as a drug for the treatment of a disorder of the CNS
~ 0 or the eye.
Substances are metabolized after their in vivo administration in order to be eliminated either by excretion or by metabolism to one or more active or inactive metabolites (Meyer, J.
Pharmacokinet. Biopharm. 24 (1996), 449-459). Thus, rather than using the actual compound or drug identified and obtained in accordance with the methods of the present invention a corresponding formulation as a pro-drug can be used which is converted into its active form in the patient by his/her metabolism. Precautionary measures that may be taken for the application of pro-drugs and drugs are described in the literature; see, for review, Ozama, J.
i Toxicol. Sci. 21 (1996), 323-329.
Furthermore, the present invention relates to the use of a compound identified, isolated and/or produced by any of these methods for the preparation of a composition for the treatment of said CNS and eye disorders. As a method for treatment the identified substance or the 0 composition containing it can be administered to a subject suffering from such a disorder.
Compounds identified, isolated and/or produced by the method described above can also be used as lead compounds in drug discovery and preparation of drugs or prodrugs.
This usually involves modifying the lead compound or a derivative thereof or an isolated compound as a to achieve (i) modified site of action, spectrum of activity, organ specificity, and/or (ii) improved potency, and/or (iii) decreased toxicity (improved therapeutic index), and/or (iv) decreased side effects, and/or (v) modified onset of therapeutic action, duration of effect, andlor (vi) modified pharmakinetic parameters (resorption, distribution, metabolism and excretion), and/or (vii) modified physico-chemical parameters (solubility, hygroscopicity, ,0 color, taste, odor, stability, state), and/or (viii) improved general specificity, organ/tissue specificity, and/or (ix) optimized application form and route by (i) esterification of carboxyl groups, or (ii) esterification of hydroxyl groups with carbon acids, or (iii) esterification of hydroxyl groups to, e.g. phosphates, pyrophosphates or sulfates or hemi succinates, or (iv) formation of pharmaceutically acceptable salts, or (v) formation of pharmaceutically 'S acceptable complexes, or (vi) synthesis of pharmacologically active polymers, or (vii) introduction of hydrophilic moieties, or (viii) introduction/exchange of substituents on aromates or side chains, change of substituent pattern, or (ix) modification by introduction of isosteric or bioisosteric moieties, or (x) synthesis of homologous compounds, or (xi) introduction of branched side chains, or (xii) conversion of alkyl substituents to cyclic i0 analogues, or (xiii) derivatisation of hydroxyl group to ketales, acetates, or (xiv) N-acetylation to amides, phenylcarbamates, or (xv) synthesis of Mannich bases, imines, or (xvi) transformation of ketones or aldehydes to Schiffs bases, oximes, acetates, ketales, molesters, oxazolidines, thiozolidines or combinations thereof; and (b) formulating the product of said modification with a pharmaceutically acceptable carrier.

The various steps recited above are generally known in the art. For example, computer programs for implementing these techniques are available; e.g., Rein, Computer-Assisted Modeling of Receptor-Ligand Interactions (Alan Liss, New York, 1989). Methods for the preparation of chemical derivatives and analogues are well known to those skilled in the art and are described in, for example, Beilstein, Handbook of Organic Chemistry, Springer edition New York Inc., 175 Fifth Avenue, New York, N.Y. 10010 U.S.A. and Organic Synthesis, Wiley, New York, USA. Furthermore, peptidomimetics and/or computer aided design of appropriate derivatives and analogues can be used, for example, according to the l0 methods described above. Methods for the lead generation in drug discovery also include using proteins and detection methods such as mass spectrometry (Cheng et al.
J. Am. Chem.
Soc. 117 (1995), 8859-8860) and some nuclear magnetic resonance (NMR) methods (Fejzo et al., Chem. Biol. 6 (1999), 755-769; Lin et al., J. Org. Chem. 62 (1997), 8930-8931). They may also include or rely on quantitative structure-action relationship (QSAR) analyses (Kubinyi, J. Med. Chem. 41 (1993), 2553-2564, I~ubinyi, Pharm. Unserer Zeit 23 (1994), 281-290) combinatorial biochemistry, classical chemistry and others (see, for example, Holzgrabe and Bechtold, Pharm. Acta Helv. 74 (2000), 149-155). Furthermore, examples of carriers and methods of formulation may be found in Remington's Pharmaceutical Sciences.
Once a drug has been selected in accordance with any one of the above-described methods of the present invention, the drug or a pro-drug thereof can be synthesized in a therapeutically effective amount. As used herein, the term "therapeutically effective amount"
means the total amount of the drug or pro-drug that is sufficient to show a meaningful patient benefit, i.e., treatment, healing, prevention or amelioration of a condition related to disorders of the CNS
and/or the eye, or an increase in rate of treatment, healing, prevention or amelioration of such conditions. In addition or alternatively, in particular with respect to pre-clinical testing of the drug the term "therapeutically effective amount" includes the total amount of the drug or pro-drug that is sufficient to elicit a physiological response in a non-human animal test.
Furthermore the nucleic acid molecules described above can in turn be used for the validation of test substances, lead compounds, drugs and prodrugs for the treatment of a disorder of the CNS or the eye or for the identification and isolation of downstream genes.

The present invention also relates to a chip or array comprising a solid support and attached thereto one or more of the nucleic acid molecules or encoded (poly)peptides described above, which chip or assay is useful for performing any one of the above described methods. Chip-based or other means for the detection of expression and/or activity of a nucleic acid molecule described above or the respective polypeptides can be provided for in form of a kit, wluch constitutes a preferred embodiment of the invention. Similarly kit can be developed for the methods for identification, production and screening of active molecules.
In a still further embodiment, the present invention relates to a transgenic non-human anirilal 0 which displays an aberrant expression or activity of the target gene and/or gene product mentioned previously or identified and obtained by the methods described above, especially when said animal reproduces a disorder of the CNS and/or the eye. Preferably, said animal is a mammal.
A method for the production of a transgenic non-human animal, which is also encompassed 5 by the present invention, for example transgenic mouse, comprises introduction of a polynucleotide or targeting vector encoding said polypeptide into a germ cell, an embryonic cell, stem cell or an egg or a cell derived therefrom. The non-human animal can be used in accordance with a screening method of the invention described herein.
Production of transgenic embryos and screening of those can be performed, e.g., as described by A. L.
!0 Joyner Ed., Gene Targeting, A Practical Approach (1993), Oxford University Press. A general method for making transgenic non-human animals is described in the art, see for example WO
94/24274. For making transgenic non-human organisms (which include homologously targeted non-human animals), embryonal stem cells (ES cells) are preferred.
Murine ES cells, such as AB-1 line grown on mitotically inactive SNL76/7 cell feeder layers (McMahon and ?5 Bradley, Cell 62: 1073-1085 (1990)) essentially as described (Robertson, E.
J. (1987) in Teratocarcinomas and Embryonic Stem Cells: A Practical Approach. E. J.
Robertson, ed.
(Oxford: IRL Press), p. 71-112) may be used for homologous gene targeting.
Other suitable ES lines include, but are not limited to, the E14 line (Hooper et al., Nature 326: 292-295 (1987)), the D3 line (Doetschman et al., J. Embryol. Exp. Morph. 87: 27-45 (1985)), the CCE
i0 line (Robertson et al., Nature 323: 445-448 (1986)), the AK-7 line (Zhuang et al., Cell 77:
875-884 (1994)). The success of generating a mouse line from ES cells bearing a specific targeted mutation depends on the pluripotence of the ES cells (i. e., their ability, once injected into a host developing embryo, such as a blastocyst or morula, to participate in embryogenesis and contribute to the germ cells of the resulting animal). The blastocysts containing the injected ES cells are allowed to develop in the uteri of pseudopregnant nonhuman females and are born as chimeric mice. The resultant transgenic mice are chimeric for cells having either the recombinase or reporter loci and are backcrossed and screened for the presence of the correctly targeted transgene (s) by PCR or Southern blot analysis on tail biopsy DNA of offspring so as to identify transgenic mice heterozygous for either the recombinase or reporter locus/loci.
Methods for producing transgenic flies, such as Drosophila melanogaster are also described in the art, see for example US-A-4,670,388, Brand & Perrimon, Development (1993) 118: 401-415; and Phelps & Brand, Methods (April 1998) 14: 367-379. Transgenic worms such as C.
elegans can be generated as described in Mello, et al., Embo J. 10 (1991), 3959-3970, Plasterk, Methods Cell Biol 48 (1995), 59-80.
Preferably, the transgenic non-human animal comprises at least one inactivated or suppressed wild type allele of the corresponding gene, involved in an CNS and/or eye disorder; see supra.
This embodiment allows for example the study of the interaction of various mutant forms of these genes or gene products on the onset of the clinical symptoms andlor may be used to verify the involvement of said genes) in the disorder to be studied. All the applications that have been herein before discussed with regard to a transgenic animal also apply to animals ?0 carrying two, three or more transgenes. It might be also desirable to inactivate target gene expression or function at a certain stage of development and/or life of the transgenic animal.
This can be achieved by using, for example, tissue specific (see supra), developmental and/or cell regulated and/or inducible promoters which drive the expression of, e.g., an antisense or ribozyme directed against the RNA transcript encoding the target gene mRNA;
see also supra.
?5 A suitable inducible system is for example tetracycline-regulated gene expression as described, e.g., by Gossen and Bujard (Proc. Natl. Acad. Sci. 89 USA (1992), 5547-5551) and Gossen et al. (Trends Biotech. 12 (1994), 58-62). Similar, the expression of a mutant target gene may be controlled by such regulatory elements. Preferably, the presence of the transgenes in cells of the transgenic animals leads to to various physiological, developmental 30 and/or morphological changes, preferably to conditions related to disorders of the CNS and/or eye such as those described above.
In another embodiment said transgenic non-human animal is used for a process in the discovery of drugs for the treatment of a disorder of the CNS and/or the eye.
In particular, mammlian animals are preferred, especially mice and rats. Corresponding animal systems that can be adapted in accordance with the present invention are known to person skilled in the art;
see, e.g., molecular biological approaches to neurological disorders including knockout and transgenic mouse models described in Shibata et al., Neuropathology 22 (2002), :337-349.
p However, the widely used zebra fish may also be used since this model system has also been shown to provide valuable predicitve results; see, e.g. Gerlai et al., Pharmacol. Biochem.
Behav. 67 (2000), 773-782.
In a preferred embodiment of the invention the pharmaceutical composition for use in the D treatment of the above described CNS and/or eye disorders comprise one or more double-stranded oligoribonucleotides (dsRNA), see supra, which mediate an RNA
interference of the corresponding mRNA of one or more nucleic acid molecules which have been shown to be involved in said disorders, and optionally a pharmaceutically acceptable carrier. The method for specific inhibition of genes by double-stranded oligoribonucleotides (dsRNA) is known from W~ 01/75164. The disclosure of this application is hereby included in this present description.
This application describes that double-stranded oligoribonucleotides (dsRNA) induce specific degradation of mRNA after delivery to the target cells. The specificity of this process is 0 mediated by the complementarity of one of the two dsRNA strands to the mRNA
of the target gene.
The process of gene-specific, post-transcriptional switching off of genes by dsRNA molecules is referred to as RNA interference (RNAi). This term was originally developed by Fire and 5 co-workers to describe the blockage of gene expression observed by delivery of dsRNA
molecules to the threadworm Caenorhabditis elegans (Fire et al., 1999).
Subsequently, RNAi could also be demonstrated in plants, protozoa, insects (Kasschau and Carrington 1998) and recently also in mammalian cells (Caplen et al., 2001; Elbashir et al., 2001).
The mechanism by which RNAi suppresses gene expression is not yet fully understood. Studies of non-~0 mammalian cells have shown that dsRNA molecules are transformed into small interfering RNA molecules (siRNA molecules) by endogenous ribonucleases (Bernstein et al., 2001;
Grishok et al., 2001; Hamilton and Baulcombe, 1999; Knight and Bass, 2001;
Zainore et al., 2000).

Desirably, the region of the double stranded RNA that is present in a double stranded conformation includes at least 5, 10, 20, 30, 50, 75, 100 or 200. Preferably, the double stranded region includes between 15 and 30 nucleotides, most preferably 20 to 25 and particularly preferred 21 to 23 nucleotides, since for the specific inhibition of a target gene, it suffices that a double-stranded oligoribonucleotide exhibits a sequence of 21 to 23 nucleotides (base pairs) in length identical to the target gene; see, e.g., Elbashir et al., Methods 26 (2002), 199-213 and Martinez et al., Cell 110 (2002), 563-574. General means and methods for cell based assays for for identifying nucleic acid sequences that modulate the function of a cell, by the use of post-transcriptional gene silencing including definitions, methods for the 0 preparation of dsRNA, vectors, selectable markers, compositions, detection means, etc., and which can be adapted in accordance with the teaching of the present invention are described in Euopean patent application EP 1 229 134 A2, the disclosure content of which is incorporated herein by reference .5 In contrast to the cited literature in which the use of siRNA and other RNA
based molecules is described for cell culture only, experiments performed in accordance with the present invention surprisingly demonstrate that dsRNA molecules of a length of 21 to 23 nucleotides are capbale of, after systemic application, for example by intravenous injection, to cross the blood-retina barrier, and specifically inactivate target genes in the tissues of the back of the ?0 eye. This overcoming the blood-retina barrier is all the more remarkable, because no experiment could demonstrate overcoming the blood-brain barrier by dsRNA so far. The methods and uses of the invention, explained below by means of examples, are thus suitable for the provision of animal models with which targets, the restricted function of which causing diseases of the eye, can be identified and validated. Those methods are moreover ?5 suitable for the specific intervention in CNS and eye diseases on a molecular level, without necessitating direct application to the site of, for example affected cells or tissue. The specificity of selected inhibitors such as preferably RNAi for the inhibition of genes expressed specifically in target cells minimizes the risk of unwanted side effects.
>0 The dosage regimen of the pharmaceutical compositions in all of the above described methods and uses of the present invention will be determined by the attending physician and clinical factors. As is well known in the medical arts, dosages for any one patient depends upon many factors, including the patient's size, body surface area, age, the particular compound to be administered, sex, time and route of administration, general health, and other drugs being administered concurrently. A typical dose can be, for example, in the range of 0.001 q.g to 10 mg (or of nucleic acid for expression or for inhibition of expression in this range); however, doses below or above this exemplary range are envisioned, especially considering the aforementioned factors. Generally, the regimen as a regular administration of the pharmaceutical composition should be in the range of 0.01 ~,g to 10 mg units per day. If the regimen is a continuous infusion, it should also be in the range of 0.01 ~,g to 10 mg units per kilogram of body weight per minute, respectively. Progress can be monitored by periodic assessment. Dosages will vary but a preferred dosage for intravenous administration of nucleics acids is from approximately 106 to l Ola copies of the nucleic acid molecule.

Therapeutic or diagnostic compositions of the invention are administered to an individual in an effective dose sufficient to treat or diagnose disorders in which modulation of a target gene or gene product is indicated. The effective amount may vary according to a variety of factors such as the individual's condition, weight, sex and age. Other factors include the mode of 5 administration. The pharmaceutical compositions may be provided to the individual by a variety of routes such as by intracoronary, intraperitoneal, subcutaneous, intravenous, transdermal, intrasynovial, intramuscular or oral routes. In addition, co-administration or sequential administration of other agents may be desirable.
?0 A therapeutically effective dose refers to that amount of compounds described in accordance with the present invention needed to ameliorate the symptoms or condition.
Therapeutic efficacy and toxicity of such compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., ED50 (the dose therapeutically effective in 50% of the population) and LD50 (the dose lethal to 50% of the population). The ?5 dose ratio between therapeutic and toxic effects is the therapeutic index, and it can be expressed as the ratio, LD50/ED50.
These and other embodiments are disclosed and encompassed by the description and Ex-amples of the present invention. Further literature concerning any one of the materials, 30 methods, uses and compounds to be employed in accordance with the present invention may be retrieved from public libraries and databases, using for example electronic devices. For example the public database "Medline" may be utilized, which is hosted by the National Center for Biotechnology Information and/or the National Library of Medicine at the National Institutes of Health. Further databases and web addresses, such as those of the European Bioinformatics Institute (EBI), which is part of the European Molecular Biology Laboratory (EMBL) are known to the person skilled in the art and can also be obtained using Internet search engines. An overview of patent information in biotechnology and a survey of relevant sources of patent information useful for retrospective searching and for current awareness is given in Berks, TIBTECH 12 (1994), 352-364.
The above disclosure generally describes the present invention. A more complete under-standing can be obtained by reference to the following specific examples and figure which are provided herein for purposes of illustration only and are not intended to limit the scope of the 0 invention. The contents of all cited references (including literature references, issued patents, published patent applications as cited throughout this application and manufacturer's specifications, instructions, etc) are hereby expressly incorporated by reference; however, there is no admission that any document cited is indeed prior art as to the present invention.
l5 The practice of the present invention will employ, unless otherwise indicated, conventional techniques of cell biology, cell culture, molecular biology, transgenic biology, microbiology, recombinant DNA, and immunology, which are within the skill of the art. Such techniques are explained fully in the literature; see, for example, DNA Cloning, Volumes I
and II (D. N.
Glover ed., 1985); Oligonucleotide Synthesis (M. J. Gait ed., 1984); Mullis et al. U.S. Pat.
?0 No. 4,683,195; Nucleic Acid Hybridization (B. D. Hames & S. J. Higgins eds.
1984);
Transcription And Translation (B. D. Hames & S. J. Higgins eds. 1984); Culture Of Animal Cells (R. I. Freshney, Alan R. Liss, Inc., 1987); Immobilized Cells And Enzymes (IRL Press, 1986); B. Perbal, A Practical Guide To Molecular Cloning (1984); the treatise, Methods In Enzymology (Academic Press, Inc., N.Y.); Gene Transfer Vectors For Mammalian Cells (J.
?5 H. Miller and M. P. Calos eds., 1987, Cold Spring Harbor Laboratory);
Methods In Enzymology, Vols. 154 and 155 (Wu et al. eds.), Immunochemical Methods In Cell And Molecular Biology (Mayer and Walker, eds., Academic Press, London, 1987);
Handbook Of Experimental Immunology, Volumes I-IV (D. M. Weir and C. C. Blackwell, eds., 1986).
Detailed descriptions of conventional methods, such as those employed in the construction of 30 vectors and plasmids, the insertion of genes encoding polypeptides into such vectors and plasmids, the introduction of plasmids into host cells, and the expression and determination thereof of genes and gene products can be obtained from numerous publication, including Sambrook et al., (1989) Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory Press.

The figure shows:
Figure l: eGFP-expression in retina and retinal pigment epithel (RPE) of systemically dsRNA-treated FVB.CG-TG(GFPU)SNAGY mice. The figure shows eGFP-expression in eye paraffin sections of dsRNA-treated FVB.Cg-Tg(GFPU)SNagy mice. Expression in retina and retinal pigment epithet (RPE) of systemically dsRNA-treated FVB.CG-TG(GFPU)SNAGY
mice is highest in the buffer control, slightly decreased in mice treated with non-silencing dsRNA and clearly decreased in eGFP-specific dsRNA treated mice (buffer control > 200 ~.g/kg BW non-silencing dsRNA > 100 ~g/kg BW eGFP-specific dsRNA > 200 ~g/kg BW
0 eGFP-specific dsRNA).
EXAMPLES
Example 1 Isolation of primary porcine retinal pigment epithelial cells (RPE
cells).
5 The following example describes exemplary the isolation of primary porcine RPE cells which is carried out under sterile conditions. The isolation of RPE-cells from pork, human and cattle is in principal the same.
Porcine eyes were obtained from a local slaughter house. After the eyes were liberated from ?0 rests of ocular muscle, they were washed once with sterile ice cold phosphate buffered saline (IxPBS: 1.15g/1 Na2HP04, 0.20g/1 KH2P04 x H20, x.00 g/1 NaCI, 0.20g/1 KCl, O.lOg/1 MgClz, O.IOg/1 CaCl2) containing penicillin (100 U/ml) and streptomycin (100 ~g/ml). The eyes were sliced around the ora serrata and the ocular lens and the vitreous were removed.
From the eye cups the retinae were carefully detached with a hitch and removed after cutting ?5 the optic nerve. The retinae were used for the isolation of the rod outer segments as described in example 2. The remaining eye cup was covered with lml lxPBS to wash the cells. The solution was rejected and the cells were incubated in 1 to l.Sm1 of a trypsin/EDTA solution (0.25%/0.02%) for 15 minutes at 37°C. The solution was rejected and the cups were again covered with 1 ml of the trypsin/EDTA solution for 1 hour at 37°C. The RPE cells were 30 carefully removed by pipetting up and down and cells from six eyes were diluted in 20m1 cell culture medium (DMEM F12 (Bio Whittaker) with 10% fetal calf serum (FCS), penicillin (100 U/ml) and streptomycin (100 ~g/ml), 2mM glutamine, l.Sg/ml sodium bicarbonate). The cells were centrifuged 5 minutes with 120xg at room temperature and washed twice with the cell culture medium. Per T25 cell culture flask, cells according to three retinae were plated.
To get rid of cell debris the cells were washed with lxPBS on the next day.
For approximately one week RPE-cells were cultivated in cell culture medium containing 10% FCS.
After they have reached confluency the culture medium was substituted against medium containing 2%
FCS. After a further one week-incubation the cells were splitted on cell culture dishes in the ratio 1:2 for further experimental use.
Example 2 Isolation of rod outer segments (ROS) from porcine eyes.
The ROS isolation was carried out under sterile conditions. Thirty retinae isolated during the RPE-cell preparation (see example 1) were transferred to 15 ml of a ice cold homogenisation buffer (containing 20 % (w/v) sucrose, 20 mM tris-acetat pH 7.2, 2 mM MgCl2, 10 mM
glucose). The suspension was shaken gently for 1 minute, filtered 3 times through cheesecloth to remove tissue fragments and layered on a 24 ml 25-60% w/v continuous sucrose gradient containing 20 mM Tris acetate pH 7.2, 10 mM glucose. Centrifugation was carried out in a Beckman SW-27 rotor at 24,000 rpm for 1 hour at 4°C. The upper white-yellow band of the gradient was collected, diluted with the same volume of 10 mM Hepes buffer pH
7.4, 115 mM NaCI, 2.5 mM KCI, 1 mM DTT, 1 mM MgCl2, mixed cautious and centrifuged 10 minutes in a Sigma 4K15 centrifuge, 2989xg, 4°C. The supernatant was removed carefully and the ROS pellet was stored for further use at -20°C. From one retina were approximately 1x10 ROS isolated.
?0 Example 3 Incubation of primary porcine RPE-cells with (physiological concentrations) of ROS.
Since the incubation of RPE-cells from pork, human and cattle with ROS is in principal the same, the following example refers to the incubation of RPE cells isolated from porcine eyes (see example 2).

ROS pellet stored at -20°C was warmed-up slowly to room temperature.
According to the number of primary RPE-cells, an amount of 10 to 100 ROS per cell was taken from the ROS-suspension. During incubation, the cell culture medium was changed every day and new ROS
were added.

The phagocytosis of ROS by RPE cells was controlled in parallel by two approaches.
Approach one comprises the detection of ROS covalently labelled with the dual wavelength fluorescent dye SNAFL-2 (Molecular Probes , Leiden Netherlands). The acid form (pH 5) appears green-yellow whereas the alkaline form (pH 9) appears yellow-orange.
(10~,g SNAFL-2 in 1 ~1 dimethylformimide) was added to isolated ROS in 1001 sucrose buffer (20% sucrose, 2mM MgCl2, lOmM glucose, 20mM tris acetate pH 8.0) and the ROS
were labelled for 1 hour at room temperature in the dark with gentle stirring.
The labelled ROS were diluted with the same volume of the hepes buffer pH 8.0 spun down for 5 minutes at 2000rpm in a Heraeus Biofuge pico and washed two times with 100.1 the hepes buffer pH
8Ø The labelled ROS were resuspended in cell culture medium and added to the cells. After an incubation time of 4 to 8 hours cells were washed and cell culture medium pH 9.0 was added for fluorescence microscopy.
In approach two ROS treated cells were washed in lxPBS (containing Ca2+ and Mg2+) and 0 analyzed by fluorescence microscopy for autofluorescence-activity of internalized ROS.
Example 4 - Post transcriptional gene silencing (PTGS) of a given target gene.
The following example describes PTGS of a given target gene (growth factor) X
in primary cells isolated from different organisms (i.e. pork, human, cattle) or in cell lines (i.e. ARPE-5 19).
After optimizing the experimental conditions with respect to the dsRNA
identity, its concentration and the appropriate transfection reagent, PTGS was performed using three (to five) dsRNAs homologous to different regions of the mRNA of the target gene synthesized !0 either by a commercial provider (preferential Proligo) or from corresponding oligonucleotides using a commercially available kit (preferential Silencers siRNA Construction Kit, Ambion). lng up to 100~.g of each siRNA was introduced into the cells by commercially available transfection reagents (preferential Gene Eraser/Stratagene, Transmessenger/Qiagen, Oligofectamin/ Invitrogen).
'.5 Up to five days post transfection cells were harvested for the analysis of mRNA expression profile by real time PCR and up to one week post transfection cells were harvested for the analysis of protein expression by western blot analysis or ELISA.
Example 5 Synthesis and purification of A2-E.
.0 A2-E was synthesized from all-trans-retinal and ethanolamine as described from Parish et al.
(1998) (Parish CA, Hashimoto M, Nakanishi K, Dillon J, Sparrow J.: Isolation and one-step preparation of A2E and iso-A2E, fluorophores from human retinal pigment epithelium. Proc Natl Acad Sci U S A. 1998 Dec 8;95(25):14609-13) and purified chromatographically on silica gel 60 thin layer chromatography plates using the primary developing system from Eldred and Katz (1988) (Eldred GE, Katz ML.: Fluorophores of the human retinal pigment epithelium: separation and spectral characterization. Exp Eye Res. 1988 Ju1;47(1):71-86). 50-150 mg retinal were dissolved in 1,5-5,5 ml ethanol. 5-15 ~,l ethanolamine was added and stirred. While stirring 5-15 ~,1 acetic acid were slowly added. The mixture was wraped in aluminium foil, and stirred for two days at room temperature. The reaction mix was distributed 4 times into four Eppendorf tubes and concentrated to dryness in a speedvac overnight. The content of two Eppendorf reaction tubes was dissolved in a total of 200-600 ~.l "primary developing system" (14,5 ml heptane, 8,8 ml hexane, 9,8 ml chloroform, 3 ml ether, 3 ml acetone, 14,8 ml iso-propanol, 27 ml ethanol, 2,5 ml methanol, 0,4 ml acetic acid, 7,4 ml H20). Then 5-15 aliquots, containing 20-60 ~l each, of this solution were applied to a silica chromatography plate that was developed with the "primary developing system"
for about 2 hours. A2-E.was detected an the plates by their fluorescence upon illumination with 366-nm light. The material containing A2-E was scraped off (A2-E: upper spot; iso-A2-E: lower spot) and eluted 2-3 times with chloroform/methanol/water by vortexing. The supernatants were combined and dried in a speedvac for few hours. The dried material was taken up in 200-600 ~1 "primary developing system" and rechromatographed. The extraction and the drying were also repeated. The dried material was taken up as a A2-E stock solution in about 1 ml Me2S0 or ethanol and stored at -20°C in the dark. Total A2-E diluted in Me2SO
or ethanol was quantified using a molar extinction coefficient of 36,900 at 439 nm (Parish CA, Hashimoto ZO M, Nakanishi K, Dillon J, Sparrow J.: Isolation and one-step preparation of A2E and iso-A2E, fluorophores from human retinal pigment epithelium. Proc Natl Acad Sci U S A.
1998 Dec 8;95(25):14609-13).
Example 6 Incubation of RPE cells with A2-E and the analysis of A2-E
accumulation.
ZS A2-E was diluted into the RPE cell culture medium to a concentration of 1 to 100 ~M A2-E
and 0,5% Me2S0 or ethanol. With the aim to find out sub-apoptocical A2E
concentrations, control incubations were done with 0,5% Me2S0 or ethanol in the absence of A2-E as a negative control and with 1 to 200 ~M staurosporine as a apoptosis control.
Incubation was carried out at 37°C with 5% C02 for 24 to 144 h in the darkness (wrapped in aluminium foil) 30 once each day. Cells can also placed under a light source and exposed to light at 390 to 550 nm of various times up to 144 hours. Controls were also run with medium alone.
To determine the mean autofluorescence per population of RPE the intracellular fluorescence was assessed using a fluorescence microscope (Nikon; excitation 450-490 nm, emission > 510 nm) and a Safire (Tecan; excitation 456 nm, emission 610 nm) at various times after feeding.

Example 7 Apoptosis assay.
The following example describes the analysis of the induction of apoptosis with the Cell Death Detection ELISA Plus (Roche) (Wyllie AH, Kerr JF, Currie AR.: Cell death: the significance of apoptosis. Int Rev Cytol. 1980;68:251-306. Review). The assay based on a quantitative sandwich-enzyme-immunoassay-principle using mouse monoclonal antibodies directed against DNA and histones, respectively. This allows the specific determination of mono- and oligonucleosomes which are released into the cytoplasm of cells which die from apoptosis. The sample (cell-lysate, serum, culture-supernatant etc.) was placed into a streptavidin-coated microplate. Subsequently, a mixture of anti-histone-biotin and anti-DNA-POD was added and incubated for 2 hours. During the incubation period, the anti-histone antibody binds to the histone-component of the nucleosomes and simultaneously fixes the immunocomplex to the streptavidin-coated microplate via its biotinylation.
Additionally, the anti-DNA-POD antibody reacts with the DNA-component of the nucleosomes. After removal of unbound antibodies by a washing step, the amount of nucleosomes was quantified by the POD retained in the immunocomplex. POD was determined photometrically with ABTS
(2,2'-Azino-di[3-ethyl-Benz-thiazolin- sulfonat]) as substrate.
Example 8 Induction of hypoxia RPE cells were incubated in an incubator (Heracell, Kendro) maintained at 37°C and 95% air, 5% C02 by vol (normoxic conditions) to 100% confluence (about 10' cells/100-mm plate).
Cells were then subjected to hypoxic conditions by placing them in an automatic C02/02 incubator (B 5061 EC/02, Kendro) maintained at 37°C and 02 levels ranging from 0 to 8%, 5% COZ, 95 to 87% N2 (N2 to balance) for 1 h to 7 days. Uninduced cells remained in normoxic conditions. P02 and PC02 of the medium were measured in a blood gas analyzer (Corning model 178). Normoxic values were as follows: pH=7.2 +/- 0.1, P02=39.3 +/- 0.6 mmHg and PC02=131.5 +/- 0.9 mmHg. Hypoxic values were as follows: pH=7.2 +/-0.1, POZ=7 to 35 +/- 1.1 mmHg and PC02=14.9 +/- 1.2 mmHg (Liu et al., 1995; Palmer et al., 1998) (Liu Y, Cox SR, Morita T, Kourembanas S.: Hypoxia regulates vascular endothelial growth factor gene expression in endothelial cells. Identification of a 5' enhancer. Circ Res.
1995 Sep;77(3):638-43; Palmer LA, Semenza GL, Stoler MH, Johns RA.: Hypoxia induces type II NOS gene expression in pulmonary artery endothelial cells via HIF-1.
Am J Physiol.
1998 Feb;274(2 Pt 1):L212-9).

Example 9 Limitation of essential factors The following example describes the cultivation of RPE cells in a modified Dulbecco's modified Eagle's medium (high glucose, Life Technologies, Inc.) for inducing stress in RPE
cells by lacking essential factors. In normal RPE cell culture the cells grow in a modified Dulbecco's modified Eagle's medium (high glucose, Life Technologies, Inc.) supplemented with 2% heat inactivated fetal calf serum (Roche), 100 units/ml penicillin, 100 ~g/ml streptomycin, 1 x non-essential amino acids, 2 mM L-glutamine, ans 1 mM sodium pyruvate (all Life Technologies, Inc.) in a humidified atmosphere containing 5% COa at 37°C. Normal cell culture media contains different anorganic salts and is added with vitamins, amino acids, L 0 glucose, nucleotides and many other substances. Most cells need for growing blood serum, such as fetal calf serum. The serum supplements proteins, hormons, growth factors, and intermediate products. For limitting these essential factors cells were cultured in a serum free medium. Additionally, a modified Dulbecco's modified Eagle's medium was used.
The medium had no anorganic salts (e.g. KCI, NaCI), amino acids (e.g. L-glutamin, L-prolin), LS vitamins (e.g. biotin, riboflavin, folic acid) or other substances (e.g.
glucose, lipon acid, nucleotides).
Example 10 Induction of metabolic acidose The following example describes the induction of a metabolic acidose (pH<7.2 +/- 0.1) in 0 cultured RPE cells by changing the pH value. Like in vivo, mammalia cell cultures need a pH
optimum which is ranging from pH 7,2 - 7,4. Growing cells will cause a decrease of the pH
value due to lactate production. The pH value of the medium is measured in a blood gas analyzer (Corning model 178). Two ways were used to induce a metabolic acidose: Changing the CO2 pressure (from 5% to 0%) in combination with leaking HC03- in the culture medium ZS (Palmer et al., 1998) (Palmer LA, Semenza GL, Stoler MH, Johns RA.: Hypoxia induces type II NOS gene expression in pulmonary artery endothelial cells via HIF-1. Am J
Physiol. 1998 Feb;274(2 Pt 1):L212-9) and the use of a modified Dulbecco's modified Eagle's medium containing 20 mM Hepes buffer. A Hepes buffer medium can be used for pH stress of cells because a medium buffered with Hepes is acidified in a humidified atmosphere containing 5%
30 CO2 at 37°C.
Example 11 RNA-preparation from cultured primary RPE cells.
RNA prepared from primary RPE cells served as starting material for expression analyses for both real-time PCR and DNA-microarrays. After stress exposition (like hypoxic culture conditions, nutrient and/or growth factor deficiencies or pH changes) RPE
cells were washed once with PBS prior to cell lysis. Approximately 1 x 106 cells (e.g. one well of a six well cell culture plate) were lyzed with 800 ~,1 of (3-mercaptoethanol containing RLT
buffer (RNeasy Mini Kit from Qiagen Germany) by softly shaking the plate. Lysates were immediately frozen at - 80 °C. After thawing for 15 min at 37 °C lysates were processed for isolation of total RNA according to the manufacturer's protocol (RNeasy Mini Kit, Qiagen). The RNA on the matrix of one column (according to lx 106 cells) was eluted with with a suitable volume (10-100 ~l) RNase free water. RNA from identically cultivated cells was pooled to yield uniform RNA from one culture condition.
Example 12 DNase I digestion of contaminating genomic DNA.
For subsequent analysis of RNA care should be taken to eliminate contaminating genomic DNA. Therefore digestion of genomic DNA via enzymatic restriction with DNA
polymerase I
(RNase free DNase I) was be performed. In brief a 100 ~,l reaction volume contained up to 50 ~.g RNA together with 20 ~l of 25 mM MgS04 (final conc. 5 mM), 3.4 ~1 3M NaAc pH 4.7 (final conc. 100 mM) and 20 U DNase I (2~1 of l0U/~,1 stock e.g. from Roche Diagnostics).
Digestion was performed for 1 h at 37 °C. Subsequent purification of RNA from DNAse and restricted DNA fragments was carried out again by utilizing the RNeasy Mini Kit (Qiagen) according to the supplier's recommendations.
?0 Example 13 cDNA synthesis for expression analysis via Real-Time PCR.
Synthesis of cDNA from total RNA is a prerequisite for expression analyses both by real-time PCR and microarray technique. To allow comparison of gene expression between mRNAs derived from different culture conditions the same amount of total RNA (here:
e.g. 2 ~g per ZS different RNA) was reversely transcribed to cDNA by the following: 1 ~1 oligo-dT-primer (500 ~.g/ml, Qiagen-Operon, # 55000142), 2 ~g RNA from porcine RPE cells, 1 ~1 10 mM
dNTP-mix (Invitrogen) and RNAse-free water (Qiagen) up to 12 ~.l in total. The mixture was incubated at 65 °C for 5 min followed by 2 min on ice. After brief centrifugation following kit components (Invitrogen, # 18064-014) were added: 4 ~.l Sx First Strand buffer, 2 ~l 0,1 M
30 DTT and 1 ~1 RNasin (40 U/~1, Promega, # N2511). After mixing by pipetting up and down the reaction was incubated for 2 min at 42 °C in a water bath. Then 1 ~.l reverse transcriptase (Superscript II, Invitrogen kit see above) was added and mixed by pipetting up and down. The reaction was incubated for 50 min at 42 °C in water bath and subsequently stopped by switching the reaction tube for 15 min to a 70 °C heat block. After short incubation on ice the newly synthesized cDNA was centrifuged and stored at - 20 °C until use.
Example 14 Real-Time PCR.
Concentrations of cDNA used as template in real-time PCR varied between 100 pg and 100 ng (refering to the original RNA). For each gene of interest and control genes specific TaqManTM probes (containing a fluorescent dye and a quencher molecule) can be designed.
Alternatively, the dye SYBR~-Green can be used, which intercalates in all double stranded DNA molecules, allowing the in process measurement of arising PCR products.
Oligonucleotides for PCR amplification (in real-time PCR and microarray analysis) were designed to achieve PCR fragments of usually 150 - 600 base pairs (bp) in size. Along with the genes) of interest PCR probes were set up in duplicate or triplicate together with control or housekeeping genes like beta-actin (ACTB), glyceraldehyde 3-phosphate dehydrogenase (GAPD) or hypoxanthine phosphoribosyltransferase (HPRT1). A typical 25 ~1 PCR
reaction was composed like the following: Template cDNA (100 pg - 100 ng), HotStart Taq-polymerase (e.g. Invitrogen) 0.5 U/~1, 1 x polymerase reaction buffer, 0.2 mM
of each dNTP
(e.g. Invitrogen), 1.5 to 7 mM MgCl2 (e.g. Invitrogen), oligonucleotides in the range between 50 - 300 nM (e.g. Qiagen-Operon, Germany) and SYBR~-Green (e.g. Bio Whittaker Molecular Applications, # 50512, 10,000 x conc. ) 0.1 - 0.5 x (diluted from stock). Typical PCR conditions for real-time PCR were: 5 - 15 min activation step at 95 °C, 45 cycles with each 30 s denaturation at 94 °C, annealing of primers (temperature depending on melting temperature of primers) for 30 s and elongation of primers at 72 °C for up to 1 min. After each cycle the increase in fluorescence of the probe during PCR amplification was determined by the optical unit of the real-time PCR device (e.g. iCycler from BIORAD).
The data from real-time PCR generated from control versus treated sample gave a profound information about changes in mRNA expression.
Example 15 PCR amplification of target genes for spotting on microarray slides.
From all selected target genes PCR fragments of 1~0 - 600 by were amplified from RPE- l retina- or liver-specific cDNA (as templates) according to the following protocol: PCR
reactions were typically set up in a total of 50 ~1. They usually contained 1 x polymerase reaction buffer (e.g. Invitrogen), 1.5 - 4 mM (final concentration) MgCl2 (e.g. Invitrogen), 0.2 mM of each nucleotide (10 mM dNTP stock, e.g. Invitrogen), up to 1 pM of gene specific forward and reverse primer (Qiagen Operon), 0.025 - 1 U Taq polymerase (e.g.
Invitrogen), a suitable amount of template cDNA (1 -10 ~.1, depending on cDNA quality) and nuclease free water to a final volume of 50 ~1. Typical conditions for PCR were: a single 5 min denaturation step at 95 °C, 30 cycles with each 30 s denaturation at 94 °C, annealing of primers (usually between 45° - 65° C, temperature depending on melting temperature of primers) for 30 s and elongation of primers at 72 °C for up to 1 min.
Example 16 PCR purification.
PCR purification was performed by utilizing the QiaQuick Purification Kit (Qiagen) according to the manufacturer's recommendations.
LO
Example 17 Spotting of PCR-products on coated glass-slides.
DNA from PCR products was arrayed with splitted pins (Telechem) on CMT GAPS
coated slides (Corning) with a Genepak spotter (Genetix) using 50 % DMSO as spotting buffer.
Spotted slides were stored for up to 6 months.
Example 18 Labeling of RNAs for hybridization.
For each labeling reaction 5 qg of RNA (at least 300 ng/ql, OD26oiaso between 1.~ and 2.0) are recommended. Direct labeling of control RNA (from control/untreated cells) and test RNA (from stressed/treated cells) with Cy3 and Cy5 (supplied from Amersham Biosciences or Perkin Elmer) was done with the Qiagen kit 'Label Star' according to the supplier's protocol.
Example 19 Hybridization of RNAs with microarray.
Hybridization of mixed RNAs with the spotted DNA on the microarrays was performed at 42 °C overnight on a automated Lucidea Slidepro hybridization station (Amersham Biosciences) under well defined hybridization and washing conditions: Hybridization buffer was composed of 25% formamide, Sx SSC and 0.1% SDS.
Example 20 Image processing and data analysis of arrays After hybridization the signals on the microarrays were scanned with a laser scanner.
(ScanArray 4000, Perkin Elmer) to yield the raw image data. To extract the signal information from above generated images into tab delimited text files software tools like ScanAlyze (Mike Eisen, Stanford University, CA., http://rana.lbl.~ov/EisenSoftware.htm) were applied.
Normalization of data was done by applying Microsoft's Excel and Access programs (part of Microsoft Office packages). Such prepared data were analyzed with software programs like GeneSpring from Silicon Genetics, which enable e.g. complex cluster analysis to find differentially expressed genes.
Example 21 Inhibition of the expression of green fluorescent protein (eGFP) in the retinal pigment epithelium (RPE) and the retina of transgenic mice by dsRNA molecules.
This example describes specific post transcriptional gene silencing by dsRNA
of the target gene eGFP in the mouse animal model, during which the optimal dsRNA
concentration for post transcniptional gene sileneing on systemic application is to be determined (experimental procedure 1, results see figure 1). The procedure involves the in vivo treatment of transgenic mice (FVB.Cg-Tg(GFPU)SNagy, The Jackson Laboratory), which express the enhanced form of green fluorescent protein (eGFP) in their body cells, by systemic application of dsRNA
oligoribonucleotide molecules against the target gene eGFP. Control animals are also treated systemically with non-silencing dsRNA molecules. For the purpose of post transcriptional gene silencing, the animals not under analgesic or anesthetic influence receive daily i.v. tail vein injections (1St day of treatment: day 0, final day of treatment: day 20) of 100 or 200 ~,g eGFP-specific dsRNA/kg body weight (BW) and the control group of 200 ~,g non-silencing dsRNA/kg BW. A control group of animals treated with buffer (daily i.v.
injection of 0.1 ml buffer into the tail vein) is also kept. Each group of experimental animals consists of 8 animals, the maximum injection volume/injection being 0.1 ml. On day 21, the animals are sacrificed by C02 inhalation.
The expression of green fluorescent protein in the eye of the mice is examined immunohistologically (spontaneous eGFP fluorescence: fluorescence microscopic evaluation;
eGFP-specific immunofluorescence staining: fluorescence microscopic evaluation).
dsRNA constructs and plasmids:
For the design of the dsRNA molecules, sequences of the type AA(N19)TT (where N
represents any nucleotide) were selected from the sequence of the target mRNA, in order to obtain 21 nucleotide (nt) long sense and antisense strands with symmetrical 3'-overhangs of two nucleotides in length. In the 3'-overhangs, 2'-deoxy-thymidine was used instead of uridine. In order to ensure that the dsRNA molecules are exclusively directed against the target gene, the chosen dsRNA sequences are tested against the mouse genome in a BLAST
analysis. The 21-nt RNA molecules are synthesized chemically and purified. For the duplex formation, 100 ~ g of the sense and antisense oligoribonucleotides each are mixed in 10 mM
Tris/HCI, 20 mM NaCI (pH 7.0) and heated to 95°C and cooled to room temperature over a period of 18 hours. The dsRNA molecules are precipitated from ethanol and resuspended in sterile buffer (100 mM potassium acetate, 30 mM HEPES-I~OH, 2 mM magnesium acetate, pH 7.4). The integrity and double strand character of the dsRNA are verified by gelelectrophoresis. Alternatively, the dsRNA molecules are obtained from commercial suppliers. The sequences of the target genes and the corresponding dsRNA
molecules are as follows:
GFP dsRNA
DNA target sequence: 5' G CAA GCT GAC CCT GAA GTT CA (SEQ ID NO 5) Coding region, 121-141 relative to the first nucleotide of the start codon (Acc. No. U55761) dsRNA (sense) 5' r(GCA AGC UGA CCC UGA AGU U) (SEQ ID NO 6) dsRNA (antisense) 5' r(AA CUU CAG GGU CAG CUU GC) (SEQ ID NO 7) non-silencing dsRNA, control DNA target sequence: 5' AATTCTCCGAACGTGTCACGT (SEQ ID NO 8) dsRNA (sense) 5' r(LTUCUCCGAACGUGUCACGU)d(TT) (SEQ ID NO 9) dsRNA (antisense) 5' r(ACGUGACACGUUCGGAGAA)d(TT) (SEQ ID NO 10) Analgesia and anesthesia of the mice:
For systemic application, the animals are immobilized and the dsRNAs are injected i.v. in the tail vein (maximal injection volume: 0.1 ml), where analgesia or anesthesia are refrained from, since this would put more stress on the animals than the i.v. injection itself. For retrobulbar injection (maximal injection volume: 0.005 ml) the animals are however subjected to short-term isofluorane inhalation anaesthesia and provided with Metamizole sodium for analgesic purposes. The animals are then kept in their accustomed animal cage surroundings.
After completion of ifa vivo diagnosis (the end of each animal experiment is stated respectively in example 1 - 5) the animals are killed by CO~ inhalation, enucleated and the eyes are studied histologically (immunohistology).
Study of eGFP expression in retinal pigment epithelium and retina' After removal, the eyes are fixed in 4 % formalin/PBS solution for 24 hours.
Using standard methods, the fixed samples are subsequently dehydrated in a series of increasing alcohol and embedded in paraffin. With the aid of a microtome, standard 5 to 12 ~m serial slices are produced, stretched in a heated water bath and transferred to a polylysin-coated cover slip.
The sections are then dried in an incubator for 2 hours at a temperature of 52 °C. The dried sections are deparaffmated in xylol, transferred to a decreasing series of alcohol followed by Tris/HCl pH 7.4. After blocking, the sections are incubated for 2 hours with primary anti-s eGFP antiserum (polyclonal goat anti-eGFP antiserum, Santa Cruz No. sc-5384). Detection occurs by means of immunofluorescence staining by using a Cy2-conjugated rabbit anti-goat IgG (Dianova, No. 305-225-045). The samples are embedded and then mounted for microscopy with an Eclipse TE-2000-S microscope (Nikon), equipped with a 20x and 40x/1.3 objective. The spontaneous, eGFP-specific fluorescence in deparaffinated, untreated sections is analyzed using a fluorescence microscope.
Experimental procedure: Systemic siRNA application. Determination of optimal dsRNA
concentration for post tr-anscriptional gene silencing.
Group Substance Number of animals Control animals Buffer 8 Negative control non- silenci~zg 8 dsRNA

200 ~g dsRNA/kg BW

200 ~,g dsRNA/kg eGFP-specific 8 dsRNA

BW

100 ~,g dsRNAlkg eGFP-specific 8 dsRNA

BW

Animals per 32 experiment l 5 For results see figure 1 5S~
N

N N

r N

N N ~ N N N M M N N N N

M M ' N

O O ~ O O O O O
. . . .

N ~ ~ , O ..C .C .C .~ .-. ~ ~, ~ N

d N ~ d d ~ ~ N_ ~ d - - - - _ O O - - ._ 'V U U ~ U U U U O U 'c L t~
r r U

-~ ~ -~ ~ Q ~ -' -~ '~
Q r~

o_ ~ ~ .U ~ ~p ~ ~ p ~ (6 Il7 (if m ~ ~ ~ Lt7 ~ O ~ r ~

_ _ _ _ _ i ~ ~ O ~ ~ ~ O N O N U7 N
- r ~ ' r ~ N r ~ ' . ~ . r ~ _ _ N ~ ~ _N N as ~ ~ N c N ~:
:.. ~: ~: :~ :-: ~ ~ ~ N r r ~

(6 ~ ~ ~ ~ N i CO
~ ~ a7 ~ a ~ ~ ~ ~ ~ c ~ .
~ ~ 'O ~ ~ ~
~

N N - N N N N W N .,..
' CO Cpl NO Cpl CO Cpl C O C CO ~~- c0 O
O

'C ~O :C y.-,;~ O .Y O :~ > ~ r O
00 r- r r .Y r 07 O

~ c ~ O

~ Zt~ ~- ~- ~~ QJ QJ ~- ~Q ~~ m r N

Q ~ a- p.
' N
a a _~ ~ ~ ~ w U Ur _ a N

cu Q ~p U -~ _. ~ ~ ~ U
'a r ~' ~ o r ti = _ i U ~ O
=

~ c c _ _ cY p c J 00 o o ~ = ~ U o ~ a a' ~ -a N ~ - rz W~ m _ r d jd aQ
N ~

_ c ~ c _ ~ ~ ~LL~ c O(~ZO.. E-.; ~' ~C C L c d d ~ N Q C ~ Q- 0 Q
~ L a Q _ 0 a. (O
~ -~

, . Q= Q= -~.c a~U ~ C~cnU= a m C M r ~- _ ", N = .~... _ O .~ .C _ : Q- ~ Q

o ~ N ~ .~ .~ ~ .V ~ .~ ~ O
; cts ~ ~ ' c O c0 N (B ~ O ~ ~ .. c0 ,C ~ c Z ~ p_ Q_ .~' Q- Q ~ N ayj a~ n. n.
. X co N ~
..

, ~ ~ o ~ ~ ~ ~ ~ ~ c~ c~ 'a ~
Q ~ U U U a _ o~ c~
~-Q N ~ Q- ~ L ' ~ r C~ ~ ~ 'B 7 C Q ~ ~ ~ ' ~ C C J

. c~ . ~- d- a- - = o ~
~ pp pp ~p N a c c U
~ ~ ~

I '~ 'V ~ ~, Q Q Q ~ a~ O O N ~
~ U v ~ v c Q.r V O r ' r r . p ~ N c~ V' ~ Z ~ ,Y y~ ~ c -~ C Q O ,c .c ~ r ;, ~ U
..
'' , tO ~ J ~ ~ ~ Y U U .L U
,.~ ~ O O O Q c = O O
~ ' ~ ~ a, ,, U

v' _p U > > > '~ L ~ ~ ~ ~ -p _ ~ - .C ._ C ~ N c ~ ~ Q U
U C c C U .~. t~ tn c ~~- ~
O O O N N p c N N - , , C O O Q c . O
~ N ~ O ~ Q IB N
~ ~ ~ fa ~ ~ N
~

.J J J U ' .,..+. ~ ~ >
~ U ~ ~ ~ ~ c s ~ ' as U U ? c ~ ~ ~, c N ~ ~ , m m U O c c . ~ ~
m Q c c Q-m ,~ m ~ .fl .Q .Q U C O ..C.C .~ N
m m 0 0 ~ () U v N
j O

r O O CD

W: r r ~ Lf~ N ~ O d0'O 0~0 :~:~'M N In N Ln t~ r I' lf~ N r ~.,.CO N I~ O ' r , , r t~ , r c N ~ N ~1' c~ C~O ~ N

L(] r (YJ r I~ fY7 N r N d' r CO

L y/J ~7 f4 VI fn tn tn fn U) US tn V_) ~L Q O O O O O O O O O O O
' O O O O O O O O O O O O

r I~ M CO In I~ f~ In CO I~ CO O

O r C'~ O O O O M LC~LI~ ~ O

I~ ~ O r r r ~j' ~' r r ~ O
' M cf' O r r r 00 d' N N
~
'.

M r O O O O 1~ O O O V' N

U..
r O O O O O O O O O r O

Z Z Z Z Z Z Z Z Z Z Z Z

Q
O

U ~ U U U Y D ~ ~ p C
..

m m m m m m U uJ Z

$w M
O O ~ O
N N N U N N
N N N N ~ d' d' p d' O O
O O O W ~ ~ O M ~ O O
N N N tY7 NO ~ 00 ~ ~ ~ 00 N N
O O O ~j N M ~ ~ '- ~ ~ O O
.C .C .C N ~ d. N o0 ~ O ~0 ~ ..C
d ~ n. o_ ~ ~ ti -a U ~ -o a. o..
a~ a~ a~ m U ~ ~ ~ ~ o ~ ~ ~ a~ a~
U U U ~ o~ Q o o mM ~ o U U
U m ~ ~ Q .~ .Y '~ N Z ,~ -' -co '_n ~ 'n yn . _'t .~ O Z Z ~ ~ ~ Z ~° ~ ~ r N~ Or- Osr ('~0 ~N ON _. . ~M N _.
N ~_-: O :_-: _N .'-: Z O ~. U (0 c(3 O ~ L _~ N ._'-: N _~:
O O N ~ O O ~ ~! '~O N
c~ c~ ~_~ ~ » c a~ E E ~~ ~p E c° coy 'C r 'C r '~ r O O N O 'Y ~ ~ ~ N ~ O ~ 'C r ~ r ~ O O '~ (B (B
2 ~ ~ '~ Z U7 r Q J ~ C~ fn N m ~ C~
i Z r N m tIj ~ Q
00 ~ Y a, M m a Y -~ U ° ~ ~ = m t~ll~~yn U~j ~ 00 J I- ~ ~ ~ ~ Q ~ ~ J
YU~'~_'i,~l, Q~ °__° o- ~- ~ ~ u' ° criJ
.r Wri - Z - Q C~ O o- ri C~ ~ ~c U U N
c d ~~t-~~=' Qa- O m a u. c c !.u ° ~U
c Q ° I- N E- I- Y IL Q E-- a. uJ m N ~ > > a U' m 'V ch r O.. ~ N Q o LZLI r _N r c .' _- -__ . L O
N L U ~- O Q m ~ ~ U7 . ~ > C
a. ~ O ° ?; ~n ° ~:li. ' Z N ~ i O m c ~ .c6 N Q y a M ~ n- ~-- o m ..r O ~n o y -c ~ U' _c -a u. c n. ~ '$ _- o o Q.
'in N m tn N Z y ~ ~ c c = O N 'a z -O c~a ~ 'o N. -N -gyp ~ ~ O O O ~. Iv O ~ (0 ~ ' ~ ~ LL ~ C c ~ U _C +O..
~ N ~ O ._ 'O ~, ~ O o ~ LL~ .N ~ ~ ~
t_ L L ~ Q. ~ O c Q. N ~ 'D (~ O r O ~~ d ' O O ~ ,N~-, ' O O 'C ~ O B' O ' LO ~ ~ 4J a7 tU ~ O O ~
Q. 'Q ~ Q O Q.-Q ~ c O Q'O ~ y r O ~ M .c 'O V ~ ~ V s- Q (a J J
p .'"' O ~ f6 N E fL5 ~ l(~ ..~ O '~ +.. 7 (p ~ O
O .c O ~ E U O Z '~. ~ U O C O. .~ E ~ ~ ~' ~ (B U N (a U Q ~ U U
N O ~ ~ ~ f ~ :~_ ~ ~ c > ~N (0 ~ m m r ~ M O f~
M t0 r r ~ r ~ O ~ 00 ~ ~ I~
r r ~ O~p ~~' l~ON000~0 M
N r N M r N r M O M I~ LCD r 'O 'O 'O 'O 'O N cO
(n tn V7 U7 tp tn OU OU U U U ~ N
.n..' - = +' O O O O O O ~ 7 ~ O ~ O O
U U U U U > >
O O O Q O O U U U U U :~, O O ~ ~ ~ ~ ~O .O ~O ~O ~O
'X 'X
L L ..C .~ ~ U O
I~ I~ M c0 CO O CO CO 1~ CO ~- O
O N o0 V' O '~Y' o~ O cD tt~ 1~ f~ ~f' M r r O O I17 W. O tc~ N M M O

- I~ O r O O N Ltd r M O V' N ~I' O O O O O O N O N O
d. O r- O O O O O O O O O O
m Q Z Z Z Z Z Z Z Z Z Z Z Z
m O
r CO
r r 11 LL r Q ~ ~ a M N Q m LL Z
Z Z O ~ n0. C~ D O a > U
CL I- I- I- I- t11 ti J Z > Q m $~
c~7 0 r- Lf~ M

op p M

O ~ N

_ ~ o O O ~ O O c7 p . O O O c N N I~
1~

N
O ~ N N N ~ ~ . , nj .

N I~ O O O ~ M O O O O
O

> ? ~ N > >. >.
d:

. , .

o ~ d ~ 0..~ ~' d Q.

LJ O N N ~ W O
U U

Z U U U (n Q U o G' N ~ ~ ~ c6 ui ~ O ~ ~ ~ ~ ~ ~
cV taj ~ r O ''J .'"'''''.Q O O .~ r ..~ r '~"' O ~ ~ ~ N O V N N.r NT ,~ Oti ~ O O

N O r r r ~ ~ ~ %-: N .-. ~ _N
N :, N N 0.S c- c- 'L ~:
r ~ ~ f0 - r . . N (~ (B ~' . 'O N ~ N . ~
N ..C- r v.. 'O 3 N
' ' E

tB (a O (V O a w C O C ~ C ~ 0.S'~
+.. (> C ~ CV N O
~ +~ C C
~ ~

r :~ :C N O Y :C r ~ r r r ~

'gyp~ N ~ (B cB ~ ~ (a ~ O ~
(a m ~ -~ ~ ~ cn Q J ~ -~ ~ -W .. ~
U ~ ~ ~ G!
~ -~ -~ ~

. , Y

~ Z m ~

_Y ~ Q Q ~ Y
Y

m cfl ~- Q ~ Z
M Gr ~ I~11 Q ~
Y a' Y Y =
~ ~

r Q LL r z m Q
O ~ ~

Z ~ Z -~ fn m Y Q Q a ~ '~ fn m Q o ~ o r m o - r - z co d Z _ c ~ F ~ li Y
~- - Y
Y ~

= - o ~, a Y zz~ri~~z >~-o c~ ~QQ zQZ

7 Z D Z Z ~ ~ '~ -7 -7 Lp J d r CO U7 (I) d fl. -7 I-~

C ~ C C
r (0 X

L ~ O Oa O O' Q~ N
Q r fn 0 ~ 7C N ~ Q Q. Q. N
~ N

N N ~ N ~ N M ~ W ~ d ~ ..~ '~ O
Y

. ~ c ~Y jY O,~ U~ N __ ' U c _> _> _> ~- p :Y .~ Z
O CO ~ ~- a m Z LL
.~ V _ Q

U ~ O ~ p~ p U N U U U O .C O
t ~ fS3 fJ L Q

O N~ (B X~ 1~vC'y-,Q.COJQr C~Qr ~~ 00 N C
~ O r ' O

(l5 fn '~ N W N W N s=, .,...fIf O 4=
'~ O N O N ~ O O U C U
U N U ~ O ~ Q
U
C

~ ~ E ~ O ~ tB ~ ~ O ~ ~ ,(B U ~ p ~ N
Q U ~ ~ C d' ,f6 O ~ O O ~ O ~ ~ ~ O
V - C - C ~ ~ > ~ Q N
~ G
~

O ~ O . ~ .'N ..Y .Y +L.~ O
Q ~ .~ ~ ~ .'s-n >

N
r- d' CO N

r p ~ OM c~ N Op0 d7 p . . ~ . r r CO

~ p p d. ~ ~ M r 0~ O O
d' O O

Cfl N N CO c'~ r ~ r O r U U U U N U U O ~ N
U N N ~ O ~ N N N N

N N O N U N O N N O O

N N N N ~ N N

O N N O N O N O N N O
> > > > > > > > > >

> (~'0~ ~ ~ N ~ N ~ N
.'.' c9 ' ' ' - ' .O "O

-p O O ~ ~ O ~X ~X ~X ~X X
' ~X ~X ~ ~ ~X

X O O X X O O O O O O
O O O

N ~ N M O ~ r1' ~ O O r N O N W N N p O
p p O O O O O O O O O

O O r Z Z Z Z Z Z Z Z Z Z Z

r Y z ' Q ~ cO Q Q Q I G! L
L
' U 0 U' _ -~ g ~ ~ Z 0.. cn Sg N N N N N N

O ~ ~ O O O

d d U U U U

~j ~j ~ Sri ~ yri ~ Sri ~ ~
Sri ~ci Sri ....~.,rte.rte N T O O N ~ N N
T r' T ~-~n ~~ ~n ~~ _~n _~n _ _ _ _ (B (~
(~ ~ N (B (~ r' N ~ ~ T
' C ~_N C~ C~ C_~ C_~
O O

M

O ~ N

O M
d ~ Cr d V = z Q U

~ z o ~ cfl cry ~ o czn Q ~ W
-T N N
D

~ M

>, ~ ~ ~ p ,C y 'V
U N t6 O ~ L

_ _ ~ ~ _ O Q7 Q ~ cB
N ~ O

O .~ ~ N ~ Q N ~
O ~ (IJ r N

E . Q- ~ U 'a L L
O LL LL
-a N O U

N _ 0.~ QQ,' .

U O 'a 'O U ~ N O
U ~ ~' 'O M I- Iv-~ ~ "
~ C

_ tn X ~ U U
= X ~ ~.. ~ r ~ ~ v- ~
O C

O s Q , L L L
U , Q C
V , u E c ~-'_~~ - u. ~
_a'~ _o ~ .~ o o ,c~

(~ O N can ~ ~ H- f ~ fn O I- ~ ~
U O

'O .... UJ ~ . v- v-.~ (n N >

O O M

O M N CO

M 'd' M ~.t?

CO I~ N r- s-d' CO

O ~ O

r- ~- ~ CO I~ tf7 N N O N N N

U ~ N

N

N N U N U

N O O O N O

> > > > > >

N (~"D ~ ~ (~U

'O 'B 'D 'O a 'O
~

~X ~X ~X ~X ~X X

O O O O O O

O 'd' CO O 00 OO

N ~ M O ~ M

O d- c0 N CD

M O O CO

O O O O O N

O O O O O O

z z z z z z M

d' r- N

Q LL LL

Z O O Z

S
References Banks CN, Hutton WK. Blindness in New South Wales: an estimate of the prevalence and some of the contributing causes. Aust J Ophthalmol 9:285-288 (1981).
i Bohler C, Nielsen PE, Orgel LE. Template switching between PNA and RNA
oligonucleotides. Nature. 376(6541):578-81 (1995).
Bernstein E, Caudy AA, Hammond SM, Hannon GJ. Role for a bidentate ribonuclease in the initiation step of RNA interference. Nature 409(6818):363-6 (2001).
Bressler NM. Early detection and treatment of neovascular age-related macular degeneration.
J Am Board Fam Pract. 15:142-152 (2002).
Bressler NM, Bressler SB. Preventative ophthalmology. Age-related macular degeneration.
Ophthalmology 102:1206-1211 (1995).
Bressler NM, Bressler SB, Fine SL. Age-related macular degeneration. Surv Ophthalmol 32:375-413 (1988).
Bressler SB, Bressler NM, Fine SL, Hillis A, Murphy RP, Olk RJ, Patz A.
Natural course of choroidal neovascular membranes within the foveal avascular zone in senile macular degeneration. Am J Ophthalmol 93:157-163 (1982).
Campochiaro PA, Soloway P, Ryan SJ, Miller JW. The pathogenesis of choroidal neovascularization in patients with age-related macular degeneration. Mol Vis.
5:34 (1999).
0 Caplen N.J., Parrish S., Imam F., Fire A., and Morgan R.A. Specific inhibition og gene expression by small double-stranded RNAs in invertebrate and vertebrate systems. Proc. Natl.
Acad. Sci. 09:9742-9747 (2001).
Davis LG, Kuehl M, Kuehl MW, Battey JF. Basic methods in molecular biology.
Sec. Ed.
Elsevier (1990).
5 Elbashir S.M., Harborth J., Lendeckel W., Yalcin A., Weber K., and Tuschel T. Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells.
Nature 411:
494-498 (2001).
Feeney L. Lipofuscin and melanin of human retinal pigment epithelium.
Fluorescence, enzyme cytochemical, and ultrastructural studies. Invest Ophthalmol Vis Sci 17:583-600 0 (1978).
Feeney-Burns L, Ellersieck MR. Age-related changes in the ultrastructure of Bruch's membrane. Am J Ophthalmol 100:686-697(1985).
Finn PJ, Gibson NJ, Fallon R, Hamilton A, Brown T. Synthesis and properties of DNA-PNA
chimeric oligomers. Nucleic Acids Res. 24: 3357-3363 (1996).
.5 Fire A., Xu S., Montgomery M.K., Kostas S.A., Driver S.E., and Mello C.C.
Potent and specific genetic interference by double-stranded RNA in Coenorhabditis elegans. Nature 391:806-811 (1998).
Fischer SG, Lerman LS. DNA fragments differing by single base-pair substitutions are separated in denaturing gradient gels: correspondence with melting theory.
Proc Natl Acad EO Sci U S A. 80(6):1579-83 (1983).
Gass JD. Drusen and disciform macular detachment and degeneration. Arch Ophthalmol 90:206-217 (1973).

Gass JD. Pathogenesis of disciform detachment of the neuroepithelium. Am J
Ophthalmol 63:
Suppl: l-139(1967).
Ghafour IM, Allan D, Foulds WS. Common causes of blindness and visual handicap in the west of Scotland. Br J Ophthalmol 67: 209-213 (1983).
Gossen M, Bonin AL, Freundlieb S, Bujard H. Inducible gene expression systems for higher eukaryotic cells. Curr Opin Biotechnol. 5(5):516-20 (1994).
Gossen M, Bujard H. Tight control of gene expression in mammalian cells by tetracycline-responsive promoters. Proc Natl Acad Sci U S A. 89(12):5547-5551 (1992).
Gotoh M, Hasebe M, Ohira T, Tosu M. [Gene diagnosis with an affinity sensor, BIACORE--principle and applications]. Rinsho Byori. 45(3):224-8 (1997). Japanese.
Green WR, McDonnell PJ, Yeo JH. Pathologic features of senile macular degeneration.
Ophthalmology 92:615-27 (1985).
Grey RH, Burns-Cox CJ, Hughes A. Blind and partial sight registration in Avon.
Br J
Ophthalmol 73:88-94(1989).
~Grishok A, Pasquinelli AE, Conte D, Li N, Parrish S, Ha I, Baillie DL, Fire A, Ruvkun G, Mello CC. Genes and mechanisms related to RNA interference regulate expression of the small temporal RNAs that control C. elegans developmental timing. Cell 106(1):23-34 (2001).
Hamilton AJ and Baulcombe DC. A species of small antisense RNA in posttranscriptional ZO gene silencing in plants. Science 286: 950-952(1999).
Heiba IM, Elston RC, Klein BE, Klein R. Sibling correlations and segregation analysis of age-related maculopathy: the Beaver Dam Eye Study. Genet Epidemiol 11:51-67 (1994).
Hogan MJ, Alvarado J. Studies on the human macula. IV. Aging changes in Bruch's membrane. Arch Ophthalmol 77:410-420(1967).
Hyman LG, Lilienfeld AM, Ferris FL, Fine SL. Senile macular degeneration: a case-control study. Am J Epidemiol 118:213-227 (1983).
Hyman L. Epidemiology of eye disease in the elderly. Eye 1: 330-341 (1987).
Jalkanen M, Nguyen H, Rapraeger A, Kurn N, Bernfield M. Heparan sulfate proteoglycans from mouse mammary epithelial cells: localization on the cell surface with a monoclonal antibody. J Cell Biol. 101(3):976-984 (1985).
Jalkanen M, Rapraeger A, Saunders S, Bernfield M. Cell surface proteoglycan of mouse mammary epithelial cells is shed by cleavage of its matrix-binding ectodomain from its membrane-associated domain. J Cell Biol. 105:3087-96 (1987).
Jensen KID, Orum H, Nielsen PE, Norden B. Kinetics for hybridization of peptide nucleic acids (PNA) with DNA and RNA studied with the BIAcore technique. Biochemistry 36(16):5072-5077 (1997).
Joyner A. Gene Targeting, A Practical Approach, Second edition, Oxford University Press (1999).
Kasschau KD and Carrington JC. A counterdefensive strategy of plant viruses:
suppression of posttranscriptional gene silencing. Cell 95:461-470(1998).
Klein R, Klein BE, Franke T. The relationship of cardiovascular disease and its risk factors to age-related maculopathy. The Beaver Dam Eye Study. Ophthalmology 100:406-414 (1993).

Knight SW and Bass BL. A role for the RNase III enzyme DCR-1 in RNA
interference and germ line development in Caenorhabditis elegans. Science 2: 2269-2271 (2001 ).
Koch T, Hansen HF, Andersen P, Larsen T, Batz HG, Otteson K, Orum H.
Improvements in automated PNA synthesis using Boc/Z monomers. J Pept Res. 49(1):80-8 (1997).
Kohler G, Milstein C. Continuous cultures of fused cells secreting antibody of predefined specificity. Nature 256(5517):495-497 (1975).
Leibowitz HM, Krueger DE, Maunder LR, Milton RC, Kini MM, Kahn HA, Nickerson RJ, Pool J, Golton TL, Ganley JP, Loewenstein JI, Dawber TR. The Framingham Eye Study monograph: An ophthalmological and epidemiological study of cataract, glaucoma, diabetic retinopathy, macular degeneration, and visual acuity in a general population of 2631 adults, 1973-1975. Surv Ophthalmol 24(Suppl): 335-610 (1980).
Le Mouellic H, Lallemand Y, Brulet P. Targeted replacement of the homeobox gene Hox-3.1 by the Escherichia coli lacZ in mouse chimeric embryos. Proc Natl Acad Sci U S
A.
87(12):4712-4716 (1990).
Maguire P, Vine AK. Geographic atrophy of the retinal pigment epithelium. Am J
Ophthalmol 102:621-625 (1986).
Mantero G, Zonaro A, Albertini A, Bertolo P, Primi D. DNA enzyme immunoassay:
general method for detecting products of polymerase chain reaction. Clin Chem.
37(3):422-429 (1991).
Mayer RJ, Walker JH, eds. Immunochemical methods in cell and molecular biology.
Academic Press, London (1987).
Melani C, Rivoltini L, Parmiani G, Calabretta B, Colombo MP. Inhibition of proliferation by c-myb antisense oligodeoxynucleotides in colon adenocarcinoma cell lines that express c-myb. Cancer Res. 51:2897-2901 (1991) Meyers SM, Zachary AA. Monozygotic twins with age-related macular degeneration. Arch Ophthalmol 106:651-653 (1988).
Paetkau ME, Boyd TA, Grace M, Bach-Mills J, Winship B. Senile disciform macular degeneration and smoking. Can J Ophthalmol 13:67-71 (1978).
Pauleikhoff D, Harper CA, Marshall J, Bird AC. Aging changes in Bruch's membrane. A
histochemical and morphologic study. Ophthalmology 97:171-178(1990).
Piguet B, Wells JA, Palmvang IB, Wormald R, Chisholm IH, Bird AC. Age-related Bruch's membrane change: a clinical study of the relative role of heredity and environment. Br J
Ophthalmol 77:400-403 (1993).
Sambrook et al., Molecular Cloning, A Laboratory Manual, 2na edition (1989) Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
Sarks SH. Ageing and degeneration in the macular region: a clinico-pathological study. Br J
Ophthalmol 60:324-341 (1976).
Schuler GD. Pieces of the puzzle: expressed sequence tags and the catalog of human genes. J
Mol Med. 75(10):694-8 (1997) Seddon JM, Ajani UA, Mitchel BD. Familial aggregation of age-related maculopathy. Am J
Ophthalmol 123: 199-206 (1997).
Smith and Johnson. Single-step purification of polypeptides expressed in Escherichia coli as fusions with glutathione S-transferase. Gene 67:31-40 (1988) Silvestri G, Johnston PB, Hughes AE. Is genetic predisposition an important risk factor in age-related macular degeneration? Eye 8:564-568 (1994).
Sobol RE, Astarita RW, Chisari FV, Griffiths JC, Royston I. Use of immunoglobulin light chain analysis to detect bone marrow involvement in B-cell neoplasms. Clin Immunol Immunopathol. 24(1):139-144 (1982).
Sobol RE, Dillman RO, Collins H, Griffiths JC, Green MR, Royston I.
Applications and limitations of peripheral blood lymphocyte immunoglobulin light chain analysis in the evaluation of non-Hodgkin's lymphoma. Cancer 56(8):2005-2010 (1985).
Sperduto RD, Hiller R. Systemic hypertension and age-related maculopathy in the Framingham Study. Arch Ophthalmol 104:216-219 (1986).
Steinecke, Ribozymes, Methods in Cell Biology 50, Galbraith et al. eds Academic Press, Inc.:
449-460 (1995).
The Eye Disease Case-Control Study Group. Risk factors for neovascular age-related macular. Arch Ophthalmol 110:1701-1708 (1992).
Tijssen P.; Burden, RH and von Knippenburg (Eds). Practice and theory of enzyme immuno-assays. Elsevier, Amsterdam, Vol. 15 (1985).
Verma R.S.;Babu A. Human chromosomes; Manual of basic techniques. New York, Pergamon Press (1989).
Veselkov AG, Demidov VV, Frank-Kamenetskii MD, Nielsen PE. PNA as a rare genome-cutter. Nature. 379(6562):214 (1996).
Wahl RL, Parker CW, Philpott GW. Improved radioimaging and tumor localization with monoclonal F(ab')2. J Nucl Med. 24(4):316-25 (1983).
Weiler J, Gausepohl H, Hauser N, Jensen ON, Hoheisel JD. Hybridisation based DNA
screening on peptide nucleic acid (PNA) oligomer arrays. Nucleic Acids Res.
25(14):2792-9 (1997).
Yap M, Weatherill J. Causes of blindness and partial sight in the Bradford Metropolitan District from 1980 to 1985. Ophthalmic Physiol Opt 9:289-292 (1989).
Yuzawa M, Isomae T, Mori R, Shimada H, Utsunomiya I. Surgical excision versus laser photocoagulation for subfoveal choroidal neovascular membrane with age-related macular degeneration: comparison of visual outcomes. Jpn J Ophthalmol. 45(2):192-8 (2001).
Zamore PD, Tuschl T, Sharp PA, Bartel DP. RNAi: double-stranded RNA directs the ATP-dependent cleavage of mRNA at 21 to 23 nucleotide intervals. Cell 101: 25-33(2000).

SEQUENCE LISTING
<110> Lynkeus Biotech GmbH
<120> Means and Methods for the Specific Modulation of Target Genes in the CNS and the Eye and Methods for Their Identification <130> LY01A04/P-WO
<150> EP02008761.5 <151> 2002-04-18 <150> US 60/431,173 <151> 2002-12-05 <160> 10 <170> PatentIn version 3.1 <210> 1 <211> 2500 <212> DNA
<213> homo Sapiens <220>
<221> CDS
<222> (25)..(2097) <223> Homo Sapiens cyclic nucleotide gated channel alpha 1 <400> 1 tatattactt aaacaaccaa agat atg aaa cta tcc atg aag aac aat att 51 Met Lys Leu Ser Met Lys Asn Asn Ile atc aat aca cag cag tct ttt gta acc atg ccc aat gtg att gta cca 99 Ile Asn Thr Gln Gln Ser Phe Val Thr Met Pro Asn Val Ile Val Pro gatattgaa aaggaaata cgaaggatg gaaaatgga gcatgcagc tcc 147 AspIleGlu LysGluIle ArgArgMet GluAsnGly AlaCysSer Ser ttttctgag gatgatgac agtgcctat acatctgaa gaatcagag aat 195 PheSerGlu AspAspAsp SerAlaTyr ThrSerGlu GluSerGlu Asn gaaaaccct catgcaagg ggttccttt agttataag tcactcaga aag 243 GluAsnPro HisAlaArg GlySerPhe SerTyrLys SerLeuArg Lys ggaggacca tcacagagg gagcagtac ctgcctggt gccattgcc att 291 GlyGlyPro SerGlnArg GluGlnTyr LeuProGly AlaIleAla Ile tttaatgtg aacaacagc agcaataag gaccaggaa ccagaggaa aaa 339 PheAsnVal AsnAsnSer SerAsnLys AspGlnGlu ProGluGlu Lys aagaaaaag aaaaaagaa aagaagagc aagtcagat gataaaaac gaa 387 LysLysLys LysLysGlu LysLysSer LysSerAsp AspLysAsn Glu aataaaaac gacccagag aagaaaaag aagaaaaag gacaaagag aag 435 AsnLysAsn AspProGlu LysLysLys LysLysLys AspLysGlu Lys aaaaagaaa gaggagaaa agcaaagat aagaaagaa caccacaag aaa 483 LysLysLys GluGluLys SerLysAsp LysLysGlu HisHisLys Lys gaagttgtg gttattgat ccctcggga aacacatat tacaactgg ctg 531 GluValVal ValIleAsp ProSerGly AsnThrTyr TyrAsnTrp Leu ttttgcatc acattacct gttatgtac aactggaca atggttatt gcc 579 PheCysIle ThrLeuPro ValMetTyr AsnTrpThr MetValIle Ala agagcatgt tttgatgaa cttcaatct gattaccta gaatattgg ctc 627 ArgAlaCys PheAspGlu LeuGlnSer AspTyrLeu GluTyrTrp Leu attttggat tacgtatca gacatagtc tatttaatc gatatgttt gta 675 IleLeuAsp TyrValSer AspIleVal TyrLeuIle AspMetPhe Val cgaacaagg acaggttac ctagaacaa ggactgctg gtaaaggaa gaa 723 ArgThrArg ThrGlyTyr LeuGluGln GlyLeuLeu ValLysGlu Glu cttaaactc ataaataaa tataaatcc aacttgcaa tttaaactt gat 771 LeuLysLeu IleAsnLys TyrLysSer AsnLeuGln PheLysLeu Asp gttctgtca ctgatacca actgatttg ctgtatttt aagttaggg tgg 819 ValLeuSer LeuIlePro ThrAspLeu LeuTyrPhe LysLeuGly Trp aactatcca gaaattaga ttaaacagg ttgttacgg ttctctcgt atg 867 AsnTyrPro GluIleArg LeuAsnArg LeuLeuArg PheSerArg Met tttgagttc ttccagaga acagaaaca aggacaaac tatccaaac atc 915 PheGluPhe PheGlnArg ThrGluThr ArgThrAsn TyrProAsn Ile ttcaggatt tccaacctt gttatgtat atcgtcatc attatccac tgg 963 PheArgIle SerAsnLeu ValMetTyr IleValIle IleIleHis Trp aatgcatgt gtgttctac tctatttct aaagetatt ggatttgga aat 1011 AsnAlaCys ValPheTyr SerIleSer LysAlaIle GlyPheGly Asn gatacatgg gtctaccct gatattaat gatcctgaa tttggccgt ttg 1059 AspThrTrp ValTyrPro AspIleAsn AspProGlu PheGlyArg Leu getagaaaa tacgtatac agcctttac tggtctaca ctgactttg act 1107 AlaArgLys TyrValTyr SerLeuTyr TrpSerThr LeuThrLeu Thr _ 350 355 360 accattggt gaaacaccc cctcccgtg agggattct gagtatgtc ttt 1155 ThrIleGly GluThrPro ProProVal ArgAspSer GluTyrVal Phe gtggtggtt gatttccta attggagtg ttaattttt getaccatc gtt 1203 ValValVal AspPheLeu IleGlyVal LeuIlePhe AlaThrIle Val ggtaacata ggttctatg atttccaac atgaatgca gccagagca gaa 1251 GlyAsnIle GlySerMet IleSerAsn MetAsnAla AlaArgAla Glu tttcaagca agaattgat getatcaag caatatatg cattttcga aat 1299 PheGlnAla ArgIleAsp AlaIleLys GlnTyrMet HisPheArg Asn gtaagcaaa gatatggaa aagagggtt attaaatgg tttgactac ctg 1347 ValSerLys AspMetGlu LysArgVal IleLysTrp PheAspTyr Leu tggaccaac aaaaaaaca gttgatgag aaagaagtc ttaaagtat cta 1395 TrpThrAsn LysLysThr ValAspGlu LysGluVal LeuLysTyr Leu cctgataaa ctaagagca gaaattgcc atcaacgtt cacttagac aca 1443 ProAspLys LeuArgAla GluI1eAla IleAsnVal HisLeuAsp Thr ttaaaaaag gtacgcatt tttgetgat tgtgaaget ggtctgttg gtg 1491 LeuLysLys ValArgIle PheAlaAsp CysGluAla GlyLeuLeu Val gagttggtc ttgaaattg caaccccaa gtctacagt cctggagat tat 1539 GluLeuVal LeuLysLeu GlnProGln ValTyrSer ProGlyAsp Tyr atttgcaag aaaggggat atcggacga gagatgtac attatcaag gaa 1587 IleCysLys LysGlyAsp IleGlyArg GluMetTyr IleIleLys Glu ggcaaactc getgtggtg gcagatgat ggagtcact cagtttgtg gta 1635 GlyLysLeu AlaValVal AlaAspAsp GlyValThr GlnPheVal Val ttgagcgat ggcagcacc ttcggtgag atcagcatt cttaacatt aaa 1683 LeuSerAsp GlySerThr PheGlyGlu IleSerIle LeuAsnIle Lys gggagcaaa getggcaat cgaagaacg gccaatatt aaaagtatt ggc 1731 GlySerLys AlaGlyAsn ArgArgThr AlaAsnIle LysSerIle Gly tactcagac ctgttctgt ctctcaaaa gatgacctc atggaaget cta 1779 TyrSerAsp LeuPheCys LeuSerLys AspAspLeu MetGluAla Leu actgagtac ccagatgcc aaaactatg ctagaagaa aaagggaag caa 1827 ThrGluTyr ProAspAla LysThrMet LeuGluGlu LysGlyLys Gln attttaatg aaagatggt ctactggat ctaaacatt gcaaatget ggc 1875 IleLeuMet LysAspGly LeuLeuAsp LeuAsnIle AlaAsnAla Gly agtgatcct aaagatctt gaagagaag gttactcga atggagggg tca 1923 SerAspPro LysAspLeu GluGluLys ValThrArg MetGluGly Ser gtagacctc ctgcaaacc aggtttgcc cgaatcttg getgagtat gag 1971 ValAspLeu LeuGlnThr ArgPheAla ArgIleLeu AlaGluTyr Glu tccatgcag cagaaactg aaacaaaga ttaaccaag gttgagaaa ttt 2019 SerMetGln GlnLysLeu LysGlnArg LeuThrLys ValGluLys Phe ctgaaaccg cttattgac acagaattt tcaagtatt gagggacct tgg 2067 LeuLysPro LeuIleAsp ThrGluPhe SerSerIle GluGlyPro Trp agcgaaagt gggcccatc gactctaca tagaaccgaaaag ctggtcatta 2117 SerGluSer GlyProIle AspSerThr acagggacat gcctcatgat catcaac taaaatttaaaag 2177 ccttttgatc ctatgactga aagaggaaga ctcagttggg tgtgctt tggtgcaaggtac 2237 aaatttttcc atgaggaaaa agcccacacc tctctgagag aaaaagct ttatatc tgggatttttcac2297 atactatgat ta aactgataat gtgcaaagat acttgtca gtgtctg tattttctgattt2357 ataaactgat ta tttcacatac gctcatttta gtaatatt c cataaaaa tgaataa gtagccctcactt2417 t tt tcatgccatt tccattgt tg gtgaagcg t ttgaagtaact gagaattaccatgtaca2477 a at tcatatttgg gataacat tt ta 2500 t <210> 2 <211> 690 <212> PRT

<213> homo Sapiens <400> 2 Met Lys Leu Ser Met Lys Asn Asn Ile Ile Asn Thr Gln Gln Ser Phe Val Thr Met Pro Asn Val Ile Val Pro Asp Ile Glu Lys Glu Ile Arg Arg Met Glu Asn Gly Ala Cys Ser Ser Phe Ser Glu Asp Asp Asp Ser Ala Tyr Thr Ser Glu Glu Ser Glu Asn Glu Asn Pro His Ala Arg Gly 50 . 55 60 Ser Phe Ser Tyr Lys Ser Leu Arg Lys Gly Gly Pro Ser Gln Arg Glu Gln Tyr Leu Pro Gly Ala Ile Ala Ile Phe Asn Val Asn Asn Ser Ser Asn Lys Asp Gln Glu Pro Glu Glu Lys Lys Lys Lys Lys Lys Glu Lys Lys Ser Lys Ser Asp Asp Lys Asn Glu Asn Lys Asn Asp Pro Glu Lys Lys Lys Lys Lys Lys Asp Lys Glu Lys Lys Lys Lys Glu Glu Lys Ser Lys Asp Lys Lys Glu His His Lys Lys Glu Val Val Val Ile Asp Pro Ser Gly Asn Thr Tyr Tyr Asn Trp Leu Phe Cys Ile Thr Leu Pro Val Met Tyr Asn Trp Thr Met Val Ile Ala Arg Ala Cys Phe Asp Glu Leu Gln Ser Asp Tyr Leu Glu Tyr Trp Leu Ile Leu Asp Tyr Val Ser Asp Ile Val Tyr Leu Ile Asp Met Phe Val Arg Thr Arg Thr Gly Tyr Leu Glu Gln Gly Leu Leu Val Lys Glu Glu Leu Lys Leu Ile Asn Lys Tyr Lys Ser Asn Leu Gln Phe Lys Leu Asp Val Leu Ser Leu Ile Pro Thr Asp Leu Leu Tyr Phe Lys Leu Gly Trp Asn Tyr Pro Glu Ile Arg Leu Asn Arg Leu Leu Arg Phe Ser Arg Met Phe Glu Phe Phe Gln Arg Thr Glu Thr Arg Thr Asn Tyr Pro Asn Ile Phe Arg Ile Ser Asn Leu Val Met Tyr Ile Val Ile Ile Ile His Trp Asn Ala Cys Val Phe Tyr Ser Ile Ser Lys Ala Ile Gly Phe Gly Asn Asp Thr Trp Val Tyr Pro Asp Ile Asn Asp Pro Glu Phe Gly Arg Leu Ala Arg Lys Tyr Val Tyr Ser Leu Tyr Trp Ser Thr Leu Thr Leu Thr Thr Ile Gly Glu Thr Pro Pro Pro Val Arg Asp Ser Glu Tyr Val Phe Val Val Val Asp Phe Leu Ile Gly Val Leu Ile Phe Ala Thr Ile Val Gly Asn Ile Gly Ser Met Ile Ser Asn Met Asn Ala Ala Arg Ala Glu Phe Gln Ala Arg Ile Asp Ala Ile Lys Gln Tyr Met His Phe Arg Asn Val Ser Lys Asp Met Glu Lys Arg Val Ile Lys Trp Phe Asp Tyr Leu Trp Thr Asn Lys Lys Thr Val Asp Glu Lys Glu Val Leu Lys Tyr Leu Pro Asp Lys Leu Arg Ala Glu Ile Ala Ile Asn Val His Leu Asp Thr Leu Lys Lys Val Arg Ile Phe Ala Asp Cys Glu Ala Gly Leu Leu Val Glu Leu Val Leu Lys Leu Gln Pro Gln Val Tyr Ser Pro Gly Asp Tyr Ile Cys Lys Lys Gly Asp Ile Gly Arg Glu Met Tyr Ile Ile Lys Glu Gly Lys Leu Ala Val Val Ala Asp Asp Gly Val Thr Gln Phe Val Val Leu Ser Asp Gly Ser Thr Phe Gly Glu Ile Ser Ile Leu Asn Ile Lys Gly Ser Lys Ala Gly Asn Arg Arg Thr Ala Asn Ile Lys Ser Ile Gly Tyr Ser Asp Leu Phe Cys Leu Ser Lys Asp Asp Leu Met Glu Ala Leu Thr Glu Tyr Pro Asp Ala Lys Thr Met Leu Glu Glu Lys Gly Lys Gln Ile Leu Met Lys Asp Gly Leu Leu Asp Leu Asn Ile Ala Asn Ala Gly Ser Asp Pro Lys Asp Leu Glu Glu Lys Val Thr Arg Met Glu Gly Ser Val Asp Leu Leu Gln Thr Arg Phe Ala Arg Ile Leu Ala Glu Tyr Glu Ser Met Gln Gln Lys Leu Lys Gln Arg Leu Thr Lys Val Glu Lys Phe Leu Lys Pro Leu Ile Asp Thr Glu Phe Ser Ser Ile Glu Gly Pro Trp Ser Glu Ser Gly Pro Ile Asp Ser Thr <210> 3 <211> 3231 <212> DNA

<213> homo Sapiens <220> °
<221> CDS
<222> (22)..(2586) <223> Homo Sapiens phosphodiesterase 6B, cGMP-specific, rod, beta (tong enital stationary night blindness 3, autosomal dominant) <400>

ctccagggac atgagc ctcagtgag gagcaggcc cggagc 51 aggcagccac c MetSer LeuSerGlu GluGlnAla ArgSer tttctg gaccagaac cccgatttt gcccgccag tactttggg aagaaa 99 PheLeu AspGlnAsn ProAspPhe AlaArgGln TyrPheGly LysLys ctgagc cctgagaat gttggccgc ggctgcgag gacgggtgc ccgccg 147 LeuSer ProGluAsn ValGlyArg GlyCysGlu AspGlyCys ProPro gactgc gacagcctc cgggacctc tgccaggtg gaggagagc acggcg 195 AspCys AspSerLeu ArgAspLeu CysGlnVal GluGluSer ThrAla ctgctg gagctggtg caggatatg caggagagc atcaacatg gagcgc 243 LeuLeu GluLeuVal GlnAspMet GlnG1uSer IleAsnMet GluArg gtggtc ttcaaggtc ctgcggcgc ctctgcacc ctcctgcag gccgac 291 ValVal PheLysVal LeuArgArg LeuCysThr LeuLeuGln AlaAsp cgctgc agcctcttc atgtaccgc cagcgcaac ggcgtggcc gagctg 339 ArgCys SerLeuPhe MetTyrArg GlnArgAsn GlyValAla GluLeu gccacc aggcttttc agcgtgcag ccggacagc gtcctggag gactgc 387 AlaThr ArgLeuPhe SerValGln ProAspSer ValLeuGlu AspCys ctggtg ccccccgac tccgagatc gtcttccca ctggacatc ggggtc 435 LeuVal ProProAsp SerGluIle ValPhePro LeuAspIle GlyVal gtgggc cacgtgget cagaccaaa aagatggtg aacgtcgag gacgtg 483 ValGly HisValAla GlnThrLys LysMetVal AsnValGlu AspVal gccgag tgccctcac ttcagctca tttgetgac gagctcact gactac 531 AlaGlu CysProHis PheSerSer PheAlaAsp GluLeuThr AspTyr aagaca aagaatatg ctggccaca cccatcatg aatggcaaa gacgtc 579 LysThr LysAsnMet LeuAlaThr ProIleMet AsnGlyLys AspVal gtg gcggtg atc gtgaacaag aacggc ccattcttc acc 627 atg ctc gca Val Val Ile Val Lys AsnGly ProPhePhe Thr Ala Met Asn Leu Ala agc gaagac gaa gtg ttcttgaag ctgaat tttgccacg ttg 675 gat tac Ser GluAsp Glu PheLeuLys TyrLeuAsn PheAlaThr Leu Asp Val tac ctgaag atctatcac ctgagctac ctccacaac tgcgagacg cgc 723 Tyr LeuLys IleTyrHis LeuSerTyr LeuHisAsn CysGluThr Arg cgc ggccag gtgctgctg tggtcggcc aacaaggtg tttgaggag ctg 771 Arg GlyGln ValLeuLeu TrpSerAla AsnLysVal PheGluGlu Leu acg gacatc gagaggcag ttccacaag gccttctac acggtgcgg gcc 819 Thr AspIle GluArgGln PheHisLys AlaPheTyr ThrValArg Ala tac ctcaac tgcgagcgg tactccgtg ggcctcctg gacatgacc aag 867 Tyr LeuAsn CysGluArg TyrSerVal GlyLeuLeu AspMetThr Lys gag aaggaa ttttttgac gtgtggtct gtgctgatg ggagagtcc cag 915 Glu LysGlu PhePheAsp ValTrpSer ValLeuMet GlyGluSer Gln ccg tactcg ggcccacgc acgcctgat ggccgggaa attgtcttc tac 963 Pro TyrSer GlyProArg ThrProAsp GlyArgGlu IleValPhe Tyr aaa gtgatc gactacatc ctccacggc aaggaggag atcaaggtc att 1011 Lys ValIle AspTyrIle LeuHisGly LysGluGlu IleLysVal Ile ccc acaccc tcagccgat cactgggcc ctggccagc ggccttcca agc 1059 Pro ThrPro SerAlaAsp HisTrpAla LeuAlaSer GlyLeuPro Ser tac gtggca gaaagcggc tttatttgt aacatcatg aatgettcc get 1107 Tyr ValAla GluSerGly PheIleCys AsnIleMet AsnAlaSer Ala gac gaaatg ttcaaattt caggaaggg gccctggac gactccggg tgg 1155 Asp GluMet PheLysPhe GlnGluGly AlaLeuAsp AspSerGly Trp ctc atcaag aatgtgctg tccatgccc atcgtcaac aagaaggag gag 1203 Leu IleLys AsnValLeu SerMetPro IleValAsn LysLysGlu Glu att gtggga gtcgccaca ttttacaac aggaaagac gggaagccc ttt 1251 Ile ValGly ValAlaThr PheTyrAsn ArgLysAsp GlyLysPro Phe gac gaacag gacgaggtt ctcatggag tccctgaca cagttcctg ggc 1299 Asp GluGln AspGluVal LeuMetG1u SerLeuThr GlnPheLeu G1y tgg tca atgaacacc gacacctac gacaag aacaagctg gag 1347 gtg atg Trp Ser MetAsnThr AspThrTyr AspLysMet AsnLysLeu Glu Val aaccgc aaggacatc gcacaggac atggtcctt taccacgtg aagtgc 1395 AsnArg LysAspIle AlaGlnAsp MetValLeu TyrHisVal LysCys gacagg gacgagatc cagctcatc ctgccaacc agagcgcgc ctgggg 1443 AspArg AspGluIle GlnLeuIle LeuProThr ArgAlaArg LeuGly aaggag cctgetgac tgcgatgag gacgagctg ggcgaaatc ctgaag 1491 LysGlu ProAlaAsp CysAspGlu AspGluLeu GlyGluIle LeuLys gaggag ctgccaggg cccaccaca tttgacatc tacgaattc cacttc 1539 GluGlu LeuProGly ProThrThr PheAspIle TyrGluPhe HisPhe tctgac ctggagtgc accgaactg gacctggtc aaatgtggc atccag 1587 SerAsp LeuGluCys ThrGluLeu AspLeuVal LysCysGly IleGln _ 510 515 520 atgtac tacgagctg ggcgtggtc cgaaagttc cagatcccc caggag 1635 MetTyr TyrGluLeu GlyValVal ArgLysPhe GlnIlePro GlnGlu gtcctg gtgcggttc ctgttctcc atcagcaaa gggtaccgg agaatc 1683 ValLeu ValArgPhe LeuPheSer IleSerLys GlyTyrArg ArgIle acctac cacaactgg cgccacggc ttcaacgtg gcccagacg atgttc 1731 ThrTyr HisAsnTrp ArgHisGly PheAsnVal AlaGlnThr MetPhe acgctg ctcatgacc ggcaaactg aagagctac tacacggac ctggag 1779 ThrLeu LeuMetThr GlyLysLeu LysSerTyr TyrThrAsp LeuGlu gccttc gccatggtg acagccggc ctgtgccat gacatcgac caccgc 1827 AlaPhe AlaMetVal ThrAlaGly LeuCysHis AspIleAsp HisArg ggcacc aacaacctg taccagatg aagtcccag aaccccttg getaag 1875 GlyThr AsnAsnLeu TyrGlnMet LysSerGln AsnProLeu AlaLys ctccac ggctcctcg attttggag cggcaccac ctggagttt gggaag 1923 LeuHis GlySerSer IleLeuGlu ArgHisHis LeuGluPhe GlyLys ttcctg ctctcggag gagaccctg aacatctac cagaacctg aaccgg 1971 PheLeu LeuSerGlu GluThrLeu AsnIleTyr GlnAsnLeu AsnArg cggcag cacgagcac gtgatccac ctgatggac atcgccatc atcgcc 2019 ArgGln HisGluHis ValIleHis LeuMetAsp IleAlaIle IleAla acggac ctggccctg tacttcaag aagagagcg atgtttcag aagatc 2067 ThrAsp LeuAlaLeu TyrPheLys LysArgAla MetPheGln LysIle gtggat gagtccaag aactaccag gacaagaag agctgggtg gagtac 2115 ValAsp GluSerLys AsnTyrGln AspLysLys SerTrpVal GluTyr ctg tcc gag acg acc cgg aag gag atg gcc atg atg 2163 ctg atc gtc atg Leu Ser Glu Thr Thr Arg Lys Glu Met Ala Met Met Leu Ile Val Met aca gcc gac ctg tct gcc atc acc tgg gaa cag agc 2211 tgc aag ccc gtc Thr Ala Asp Leu Ser Ala Ile Thr Trp Glu Gln Ser Cys Lys Pro Val aag gtc ctt ctc gtg get get gag gag caa gac ttg 2259 gca ttc tgg ggt Lys Val Leu Leu Val Ala Ala Glu Glu Gln Asp Leu Ala Phe Trp Gly gaa agg gtc ttg gat cag cag ccc atg atg cgg aac 2307 aca att cct gac Glu Arg Val Leu Asp Gln Gln Pro Met Met Arg Asn Thr Ile Pro Asp aag gcg gag ctc ccc aag ctg caa ttc atc ttc gtg 2355 gcc gtg ggc gac Lys Ala Glu Leu Pro Lys Leu Gln Phe Ile Phe Val Ala Val Gly Asp tgc aca gtg tac aag gag ttc tct cac gaa atc ctg 2403 ttc cgt ttc gag Cys Thr Val Tyr Lys Glu Phe Ser His Glu Ile Leu Phe Arg Phe Glu ccc atg gac cga ctg cag aac aat gag tgg gcg ctg 2451 ttc agg aaa aag Pro Met Asp Arg Leu Gln Asn Asn Glu Trp Ala Leu Phe Arg Lys Lys get gat tat gag gcc aaa gtg aag gag gag gag gag 2499 gag get ctg aag Ala Asp Tyr Glu Ala Lys Val Lys Glu Glu Glu Glu Glu Ala Leu Lys gag gag gtg gca gcc aag aaa gta gaa att aat ggc 2547 agg ggc aca tgc Glu Glu Val Ala Ala Lys Lys Val Glu Ile Asn Gly Arg Gly Thr Cys ggc cca ccc aag tct tca acc tgc ctg tga ctggtcc 2596 gca tgt atc gca Gly Pro Pro Lys Ser Ser Thr Cys Leu Ala Cys Ile cgtggggaccctatggctcc ctcaatcttc acccactaggatttgggttctgcctgtggc2656 tatttgctacaagaggttag gaagcccaag aaaatgactgaagatcattctggatatttt2716 aatttttttttttttttttt ttttgagatg gagtcttgctctgtcacccaggctggagtg2776 ccgtggcacgatctcagctc actgcaacct ccacctcccaggttcaagcgattctcgtgc2836 ctcagcctcctgagtagctg ggactacagg cgcccaccaccacacatgctaatttttgta2896 ttttcagtacagatggggtt tcaccatatt gggcaggctggtctcgaactcctgacctca2956 ggtgatcaccgcctcagctt cctgaagtgc tgggattacaggcatgagccaccacgccca3016 gcctgtttttataaactgaa gccaactgtg aataaactgtagcctacattactcatccat3076 ttttggatagttaccactgg gagacctttg aaaagggtccatgaactctgaaatcactga3136 gaacatttgcagccacacat gtacatatgt gtacacaggtagacagatggacacaggccg3196 tttctcatccagtttaggaa aacacacatg ctcag 3231 <210>4 <211>854 <212>PRT

<213>homo sapiens <400> 4 Met Ser Leu Ser Glu Glu Gln Ala Arg Ser Phe Leu Asp Gln Asn Pro Asp Phe Ala Arg Gln Tyr Phe Gly Lys Lys Leu Ser Pro Glu Asn Val Gly Arg Gly Cys Glu Asp Gly Cys Pro Pro Asp Cys Asp Ser Leu Arg Asp Leu Cys Gln Val Glu Glu Ser Thr Ala Leu Leu Glu Leu Val Gln Asp Met Gln Glu 5er Ile Asn Met Glu Arg Val Val Phe Lys Val Leu Arg Arg Leu Cys Thr Leu Leu Gln Ala Asp Arg Cys Ser Leu Phe Met Tyr Arg Gln Arg Asn Gly Val Ala Glu Leu Ala Thr Arg Leu Phe Ser Val Gln Pro Asp Ser Val Leu Glu Asp Cys Leu Val Pro Pro Asp Ser Glu Ile Val Phe Pro Leu Asp Ile Gly Val Val Gly His Val Ala Gln Thr Lys Lys Met Val Asn Val Glu Asp Val Ala Glu Cys Pro His Phe Ser Ser Phe Ala Asp Glu Leu Thr Asp Tyr Lys Thr Lys Asn Met Leu Ala Thr Pro Ile Met Asn Gly Lys Asp Val Val Ala Val Ile Met Ala Val Asn Lys Leu Asn Gly Pro Phe Phe Thr Ser Glu Asp Glu Asp Val Phe Leu Lys Tyr Leu Asn Phe Ala Thr Leu Tyr Leu Lys Ile Tyr His Leu Ser Tyr Leu His Asn Cys Glu Thr Arg Arg Gly Gln Val Leu Leu Trp Ser Ala Asn Lys Val Phe Glu Glu Leu Thr Asp Ile Glu Arg Gln Phe His Lys Ala Phe Tyr Thr Val Arg Ala Tyr Leu Asn Cys Glu Arg Tyr Ser Val Gly Leu Leu Asp Met Thr Lys Glu Lys Glu Phe Phe Asp Val Trp Ser Val Leu Met Gly Glu Ser Gln Pro Tyr Ser Gly Pro Arg Thr Pro Asp Gly Arg Glu Ile Val Phe Tyr Lys Val Ile Asp Tyr Ile Leu His Gly Lys Glu Glu I1e Lys Val Ile Pro Thr Pro Ser Ala Asp His Trp Ala Leu Ala Ser Gly Leu Pro Ser Tyr Val Ala Glu Ser Gly Phe Ile Cys Asn Ile Met Asn Ala Ser Ala Asp Glu Met Phe Lys Phe Gln Glu Gly Ala Leu Asp Asp Ser Gly Trp Leu Ile Lys Asn Val Leu Ser Met Pro Ile Val Asn Lys Lys Glu Glu Ile Val Gly Val Ala Thr Phe Tyr Asn Arg Lys Asp Gly Lys Pro Phe Asp Glu Gln Asp Glu Val Leu Met Glu Ser Leu Thr Gln Phe Leu Gly Trp Ser Val Met Asn Thr Asp Thr Tyr Asp Lys Met Asn Lys Leu Glu Asn Arg Lys Asp Ile Ala Gln Asp Met Val Leu Tyr His Val Lys Cys Asp Arg Asp Glu Ile Gln Leu Ile Leu Pro Thr Arg Ala Arg Leu Gly Lys Glu Pro Ala Asp Cys Asp Glu Asp Glu Leu Gly Glu Ile Leu Lys Glu Glu Leu Pro Gly Pro Thr Thr Phe Asp Ile Tyr Glu Phe His Phe Ser Asp Leu Glu Cys Thr Glu Leu Asp Leu Val Lys Cys Gly Ile Gln Met Tyr Tyr Glu Leu Gly Va1 Val Arg Lys Phe Gln Ile Pro Gln Glu Val Leu Val Arg Phe Leu Phe Ser Ile Ser Lys Gly Tyr Arg Arg Ile Thr Tyr His Asn Trp Arg His Gly Phe Asn Val Ala Gln Thr Met Phe Thr Leu Leu Met Thr Gly Lys Leu Lys Ser Tyr Tyr Thr Asp Leu Glu Ala Phe Ala Met Val Thr Ala Gly Leu Cys His Asp Ile Asp His Arg Gly Thr Asn Asn Leu Tyr Gln Met Lys Ser Gln Asn Pro Leu Ala Lys Leu His Gly Ser Ser Ile Leu Glu Arg His His Leu Glu Phe Gly Lys Phe Leu Leu Ser Glu Glu Thr Leu Asn Ile Tyr Gln Asn Leu Asn Arg Arg Gln His Glu His Val Ile His Leu Met Asp Ile Ala Ile Ile Ala Thr Asp Leu Ala Leu Tyr Phe Lys Lys Arg Ala Met Phe Gln Lys Ile Val Asp Glu Ser Lys Asn Tyr Gln Asp Lys Lys Ser Trp Val Glu Tyr Leu Ser Leu Glu Thr Thr Arg Lys Glu Ile Val Met Ala Met Met Met Thr Ala Cys Asp Leu Ser Ala Ile Thr Lys Pro Trp Glu Val Gln Ser Lys Val Ala Leu Leu Val Ala Ala Glu Phe Trp Glu Gln Gly Asp Leu Glu Arg Thr Val Leu Asp Gln Gln Pro Ile Pro Met Met Asp Arg Asn Lys Ala Ala Glu Leu Pro Lys Leu Gln Val Gly Phe Ile Asp Phe Val Cys Thr Phe Val Tyr Lys Glu Phe Ser Arg Phe His Glu Glu Ile Leu Pro Met Phe Asp Arg Leu Gln Asn Asn Arg Lys Glu Trp Lys Ala Leu Ala Asp Glu Tyr Glu Ala Lys Val Lys Ala Leu Glu Glu Lys Glu Glu Glu Glu Arg Val Ala Ala Lys Lys Val Gly Thr Glu Ile Cys Asn Gly Gly Pro Ala Pro Lys Ser Ser Thr Cys Cys Ile Leu <210> 5 <211> 21 <212> DNA
<213> Artificial <400> 5 gcaagctgac cctgaagttc a 21 <210> 6 <211> 19 <212> RNA
<213> Artificial <400> 6 gcaagcugac ccugaaguu 19 <210> 7 <211> 19 <212> RNA
<213> Artificial <400> 7 aacuucaggg ucagcuugc 19 <210> 8 <211> 21 <212> DNA
<213> Artificial <400> 8 aattctccga acgtgtcacg t 21 <210> 9 <211> 21 <212> DNA/RNA
<213> Artificial <400> 9 uucuccgaac gugucacgut t 21 <210> 10 <211> 21 <212> DNA/RNA
<213> Artificial <400> 10 acgugacacg uucggagaat t 21

Claims

Claims 1. A method for the treatment of a disorder of the central nervous system (CNS) and/or the eye comprising administering to a subject a composition comprising a compound capable of modulating a target gene or gene product in a therapeutically effective amount, wherein said composition is administered outside the blood-brain and/or the blood-retina barriers.

2. Use of a compound capable of modulating a target gene or gene product for the preparation of a pharmaceutical composition for the treatment of a disorder of the central nervous system (CNS) and/or the eye, wherein said composition is designed to be applied outside the blood-brain and/or blood-retina barriers.

3. The method of claim 1 or the use of claim 2, wherein the disorder is related to the eye.

4. The method or use of any one of claims 1 to 3, wherein said disorder is related to angiogenesis and/or neovascularization.

5. The method or use of any one of claims 1 to 4, wherein said disorder is related to the retinal pigment epithelium (RPE), neurosensory retina and/or choriodea.

6. The method or use of any one of claims 1 to 5, wherein said disorder is wet age-related macular degeneration (AMD) or diabetic retinopathy.

7. The method or use of any one of claims 1 to 6, wherein the pharmaceutical composition is designated to be effective in (and applied to) the inner segment of the eye ball.

8. The method or use of any one of claims 1 to 7, wherein the composition is in a form designed to be applied outside the retinal region of the blood-retina barrier.

9. The method or use of any one of claims 1 to 8, wherein said compound is an inhibitor/antagonist of said target gene or gene product.

10. The method or use of claim 9, wherein said antagonist/inhibitor inhibits the expression of a gene or the activity of a gene product involved in angiogenesis and/or neovascularization.

11. The method or use of claim 9 or 10, wherein said antagonist/inhibitor is or is derived from an nucleic acid molecule, polypeptide, antibody, or a ligand binding molecule of said gene or gene product.

12. The method or use of any one of claims 9 to 11, wherein said antagonist/inhibitor is a ribozyme, antisense or sense nucleic acid molecule to said gene or gene product.

13. The method or use of any one of claims 9 to 12, wherein said antagonist/inhibitor substantially consists of ribonucleotides.

14. The method or use of claim 13, wherein said antagonist/inhibitor comprises substantially a portion of double-stranded oligoribonucleotides (dsRNA).

15. The method or use of claim 14, wherein said dsRNA is between 21 and 23 nucleotides in length.

16. The method or use of claim 14 or 15, wherein the dsRNA molecule contains a terminal 3'-hydroxyl group.

17. The method or use of any one of claims 12 to 16, wherein the nucleic acid molecule represents an analogue of naturally occurring RNA.

18. The method or use of claim 17, wherein the nucleotide sequence of the nucleic acid molecule differs from the nucleotide sequence of said gene or gene product by addition, deletion, substitution or modification of one or more nucleotides.

19, The method or use of any one of claims 10 to 18, wherein said gene or a cDNA
thereof comprises a nucleotide sequence or encodes an amino acid sequence selected from the group consisting of any one of SEQ ID NOs: 1 to 4.

20. The method or use of any one of claims 1 to 19, wherein said compound is a nucleic acid molecule or encoded by a nucleic acid molecule and is designed to be expressed in cells of the CNS or eye.

21. The method or use of any one of claims 1 to 20, wherein the composition is in a form designed to be introduced into the cells or tissue of the CNS or eye by a suitable corner, characterized by the application occurring outside the blood-brain or blood-retina barriers.

22. The method or use of any one of claims 1 to 21, wherein the composition is designed for systemic administration or for administration by iontophoresis.

23. The method or use of any one of claims 1 to 21, wherein the composition is designed for retrobulbar application or as eye drops.

24. A method of identifying and obtaining a nucleic acid molecule encoding a polypeptide involved in a disorder as defined in any one of claims 1 to 6 comprising the steps of:
(a) culturing a cell, tissue or non-human animal under stress conditions which lead to simulation of a pathological condition related to a CNS or eye disorder;
(b) isolating nucleic acids and/or proteins from a sample of said cell, tissue or animal;
(c) comparing the expression or activity profile of at least one of said nucleic acids and/or proteins with that of a corresponding non-treated cell, tissue or animal, and/or with that of a cell, tissue or animal, which has been treated under different stress conditions;
(d) determining at least one nucleic acid and/or protein which is differentially expressed, whereby a change of expression or of the active amount of said at least one nucleic acid or activity of at least one of said proteins or an altered localization of the protein is indicative for its role in a disorder of the CNS or eye.

25. The method of claim 24, wherein said stress condition is generated by an aberrant supply of the cell, tissue or animal culture conditions.

26. The method of claim 24 or 25, wherein said aberrant supply is an aberrant supply of the interior segment of the eye.

27. The method of any one of claims 24 to 26, wherein the method is a cell culture based method.

28. The method of claim 27, wherein said cell is an RPE cell.

29. The method of claim 28, wherein said cell is derived from an RPE derived cell line such as cell Line ARPE-19.

30. The method of any one of claims 24 to 26, wherein said method is performed with a non-human animal.

31. The method of any one of claims 24 to 30, wherein said stress conditions comprise e.g. oxidative stress, hypoxic culture conditions, insufficient nutrition and/or supply with growth factors, change of pH-value and/or pathophysiological concentration of rod outer segments (ROS) and/or A2-E.

32. The method of any one of claims 24 to 31, wherein expression of nucleic acids is analyzed with an expression array and/or realtime PCR.

33. The method of any one of claims 24 to 32, wherein protein expression is analyzed with immunoblot or ELISA assay, or 2D gel electrophoresis or MALDI-TOF.

34. The method of claim 33, wherein antibodies are used which are specific for proteins involved in angiogenesis and/or neovascularization.

35. The method of any one of Claims 24 to 34, further comprising overexpression or inhibition of expression of the identified candidate nucleic acid or encoded polypeptide in said cell, tissue or animal for their capability of inducing a responsive change in the phenotype of said cell, tissue or animal, wherein said phenotype is related to a disorder of the CNS ar eye.

36. The method of any one of claims 24 to 35, further comprising:
(e) subjecting a cell of step (a) or secreted factors thereof, or cell lysates thereof, to (f) analyzing cell proliferation, electrophysiological activity, DNA
synthesis, out-growth of cells, cell migration, chemokinesis, chemotaxis, development of vessels, marker gene expression or activity, apoptosis and/or vitality.

37. The method of any one of claims 24 to 36, wherein a sample of said cells are treated with an inhibitor specific for said candidate nucleic acid or encoded polypeptide; and further comprising determining whether said cells, secreted factors thereof or cell lysates thereof have lost their capability of inducing said responsive change in said phenotype.

38. The method of any one of claims 35 to 37, wherein said phenotype is angiogenesis and/or neovascularization and/or degenerative retinal disorder.

39. The method of claim 38, wherein said inhibitor is an inhibitor as defined in any one of claims 10 to 19.

40. The method of any one of claims 24 to 39, further comprising identifying the sequence of said at least one nucleic acid and/or protein, and optionally identifying the corresponding encoding gene or cDNA thereof.

41. The method of claims 40, further comprising cloning said gene, cDNA or a fragment thereof.

42. A nucleic acid molecule obtainable by the method of any one of claims 24 to 41.

43. The nucleic acid molecule of claim 42 encoding a polypeptide involved in angiogenesis and/or neovascularization and/or retinal disorder.

44. A nucleic acid molecule which specifically hybridizes to the nucleic acid molecule of claim 42 or 43, which encodes a mutated version of the protein which has lost its capability of inducing a responsive change in a phenotype as defined in any one of claims 35 to 38.

45. The nucleic acid molecule of any one of claims 42 to 44, which is DNA.

47. The nucleic acid molecule of any one of claim 42 to 64, which is derived from a mammal.

48. The nucleic acid molecule of claim 47, wherein the mammal is mouse or human.

49. A nucleic acid molecule of at least 15 nucleotides in length hybridizing specifically with a nucleic acid molecule of any one of claims 42 to 48 or with a complementary strand thereof.

50. A vector comprising a nucleic acid molecule of any one of claims 42 to 49.

51. The vector of claim 50, wherein the nucleic acid molecule is operatively linked to regulatory elements permitting expression in prokaryotic or eukaryotic host cells.

52. A host cell comprising a vector of claim 50 or 51.

53. The host cell of claim 52, which is a bacterial, fungal, plant or animal cell.

54. The host cell of claim 53, which is a mammalian cell.

55. The host cell of claim 54 which is an RPE cell or a neurosensory retina cell.

56. A method for the production of a polypeptide capable of inducing a responsive change in a phenotype as defined in any one of claims 35 to 38 comprising culturing a host cell of any one of claims 52 to 55 under conditions allowing the expression of the polypeptide and recovering the produced polypeptide from the culture.

57. A polypeptide encoded by a nucleic acid molecule of any one of claims 42 to 49 or obtainable by a method according to claim 56.

58. An antibody specifically recognizing a polypeptide of claim 57.

59. A pharmaceutical composition comprising a nucleic acid molecule of any one of polypeptide of claim 57 and/or an antibody of claim 58, and optionally a pharmaceutically acceptable carrier.

60. A diagnostic composition comprising a nucleic acid molecule of any one of claims 42 to 49, a vector of claim 50 or 51, a host cell of any one of claims 52 to 55, a polypeptide of claim 57 and/or an antibody of claim 58, and optionally suitable means for detection.

61. A method for treating of a disorder as defined in any one of claims 1 to 6 comprising administering to the subject a pharmaceutical compositions of claim 59 in an effective dose.

62. A method for detecting expression of a gene involved in a disorder as defined in any one of claims 1 to 6 comprising (a) obtaining mRNA from a cell;
(b) incubating the mRNA so obtained with a probe comprising a nucleic acid molecule of any one of claims 42 to 49 or a fragment thereof under hybridizing conditions; and (c) detecting the presence of mRNA hybridized to the probe.

63. A method for detecting expression of a gene involved in a disorder as defined in any one of claims 1 to 6 comprising (d) obtaining a cell sample from the subject;
(e) contacting the cell sample so obtained with an antibody of claim 58; and (f) detecting the presence of the antibody bound to the protein encoded by said gene.

64. The method of claim 62 or 63 for the detection of the expression of a protein encoded by the nucleic acid molecule of claim 44.

65. A method for diagnosing in a subject to disorder as defined in any one of claims 1 to 6 or a predisposition to such disorder which comprises:
(a) isolating DNA from patient suffering from the disorder;
digesting the isolated DNA of step (a) with at least one restriction enzyme;

(c) incubating the resulting gel with a probe comprising a nucleic acid molecule of any one of claims 42 to 49 or a fragment thereof labelled with a detectable marker;
(d) detecting labelled bands on a gel which have hybridized to the probe as defined to create a band pattern specific to the DNA of patients of the disorder;
(e) preparing subject's DNA by steps (a) to (e) to produce detectable labeled bands on a gel; and {f) comparing the band pattern specific to the DNA of patients of the disorder of step (e) and the subject's DNA of step (f) to determine whether the patterns are the same or different and to diagnose thereby the disorder or a predisposition to the disorder, if the patterns are the same.

66. A method for diagnosing a disorder as defined in any one of claims 1 to 6 or a predisposition to such a disorder comprising:
(a) analyzing a sample of nucleic acids of a subject by means of a diagnostic chip, primer extension, single nucleotide polymorphisms or sequencing comprising a nucleic acid molecule of any one of claims 42 to 49, and (b) comparing the result with that of a sample obtained from a patient suffering from the disorder, wherein the identity of expression profil and/or nucleotide sequence is indicative for the disorder.

67. Use of an effective dose of a nucleic acid molecule of any one of claims 42 to 49, or a nucleic acid molecule which is complementary to such a nucleic acid molecule or a vector of claim 50 to 51 for the preparation of a composition for treating, preventing and/or delaying a disorder as defined in any one of claims 1 to 6 in a subject by somatic gene therapy.

68. A method of determining whether a test substance has an effect on a nucleic acid molecule or polypeptide involved in a disorder as defined in any one of claims 1 to 6, comprising the steps:
(a) contacting a cell which expresses the polypeptide of claim 57 with a compound to be screened; and (b) determining if the compound modulates the expression or the activity of said 69. The method of claim 68, wherein said polypeptide is expressed under the control of the GGTB-promoter.

70. The method of claim 68 or 69, wherein the test substance is a chemotherapeutic agent.

71. The method of any one of claims 68 to 70, wherein the test substance is a mixture of chemotherapeutic agents.

72. The method of any one of claims 68 to 71, wherein said cell is derived from a single cell or a multi-cellular organism.

73. The method of any one of claims 68 to 72, wherein said cell is a cell as defined in any one of claims 28, 29, 35 or 52 to 56.

74. The method of any one of claim 68 to 73, wherein preferably in the first screen said test substance is comprised in and subjected as a collection of test substances.

75. The method of claim 74, wherein said collection of test substances has a diversity of about 10 3 to about 10 5.

76. The method of claim 74 or 75, wherein the diversity of said collection of test substances is successively reduced.

77. The method of any one of claims 68 to 76, wherein said cell is comprised in a tissue or in a non-human animal.

78. A method for producing a drug or prodrug for the treatment of a disorder as defined in any one of claim 1 to 6 comprising:
(a) synthezising a test substance or a collection of test substances;
(b) subjecting said the test substance or collection of test substances to the method of any one of claims 68 to 77; and (c) producing a compound identified as a modulator in step (b) or a derivative thereof 79. A test substance identified, isolated and/or produced by the method of any one of claims 68 to 78, wherein said test substance has hitherto not been known as a drug for the treatment of a disorder as defined in any one of claims 1 to 6.

80. Use of a compound identified, isolated and/or produced by the method of any one of claims 68 to 78 fox the preparation of a composition for the treatment of a disorder as defined in any one of claims 1 to 6.

81. A method for the treatment of a disorder as defined in any one of claims 1 to 6, comprising administering a composition prepared according to the use of claim 80 or the method of claim 78 to a subject suffering from the disorder.

82. A chip comprising a solid support and attached thereto one or more of the nucleic acid molecules of any one of claims 42 to 49.

83. A kit for use in the method of any one of claims 24 to 41 or 62 to 78 comprising a chip of claim 82 or other means for the detection of expression and/or activity of a nucleic acid molecule of any one of claims'42 to 49 or a polypeptide of claim 58.

84. Use of a compound identified, isolated and/or produced by the method of any one of claims 68 to 78 as a lead compound in drug discovery and preparation of drugs or prodrugs.

85. Use of a nucleic acid molecule of any one of claims 42 to 49 or of a polypeptide of claim 57 for the validation of test substances, lead compounds, drugs and prodrugs for the treatment of a disorder as defined in any one of claims 1 to 6 or for the identification and isolation of downstream genes, which respond to modulation of a gene comprising a nucleic acid molecule of any one of claims 42 to 49 or its encoded gene product.

86. A transgenic non-human animal which displays an aberrant expression or activity of the polypeptide of claim 57.

87. The non-human animal of claim 86, wherein said animal reproduces a disorder as 88. The animal of claim 86 or 87 which is a mammal.

89. Use of a transgenic non-human animal of any one of claims 86 to 88 for a process in drag discovery for the treatment of a disorder as defined in any one of claims 1 to 6.

90. A pharmaceutical composition for use in the treatment of a disorder as defined in any one of claim 1 to 6 comprising one or more double-stranded oligoribonucleotides (dsRNA), which mediate an RNA interference of the corresponding mRNA of one or more nucleic acid molecules of any one of claims 42 to 49, and optionally a pharmaceutically acceptable carrier.
CA002482904A 2002-04-18 2003-04-16 Means and methods for the specific modulation of target genes in the cns and the eye and methods for their identification Abandoned CA2482904A1 (en)

Applications Claiming Priority (5)

Application Number Priority Date Filing Date Title
EP02008761.5 2002-04-18
EP02008761 2002-04-18
US43117302P 2002-12-05 2002-12-05
US60/431,173 2002-12-05
PCT/EP2003/004003 WO2003087368A2 (en) 2002-04-18 2003-04-16 Means and methods for the specific modulation of target genes in the cns and the eye and methods for their identification

Publications (1)

Publication Number Publication Date
CA2482904A1 true CA2482904A1 (en) 2003-10-23

Family

ID=47711411

Family Applications (2)

Application Number Title Priority Date Filing Date
CA002482904A Abandoned CA2482904A1 (en) 2002-04-18 2003-04-16 Means and methods for the specific modulation of target genes in the cns and the eye and methods for their identification
CA002482903A Abandoned CA2482903A1 (en) 2002-04-18 2003-04-16 Means and methods for the specific inhibition of genes in cells and tissue of the cns and/or eye

Family Applications After (1)

Application Number Title Priority Date Filing Date
CA002482903A Abandoned CA2482903A1 (en) 2002-04-18 2003-04-16 Means and methods for the specific inhibition of genes in cells and tissue of the cns and/or eye

Country Status (9)

Country Link
US (5) US8202845B2 (en)
EP (2) EP1495121A2 (en)
JP (2) JP2006500910A (en)
AU (3) AU2003222820A1 (en)
CA (2) CA2482904A1 (en)
ES (1) ES2397060T3 (en)
HK (1) HK1072074A1 (en)
MX (2) MXPA04010283A (en)
WO (2) WO2003087367A2 (en)

Families Citing this family (49)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003087367A2 (en) 2002-04-18 2003-10-23 Lynkeus Biotech Gmbh Means and methods for the specific inhibition of genes in cells and tissue of the cns and/or eye
US7148342B2 (en) 2002-07-24 2006-12-12 The Trustees Of The University Of Pennyslvania Compositions and methods for sirna inhibition of angiogenesis
EP2929782A1 (en) * 2004-01-23 2015-10-14 Ocata Therapeutics, Inc. Improved modalities for the treatment of degenerative diseases of the retina
US7794704B2 (en) 2004-01-23 2010-09-14 Advanced Cell Technology, Inc. Methods for producing enriched populations of human retinal pigment epithelium cells for treatment of retinal degeneration
CN105251024A (en) 2004-08-23 2016-01-20 西伦蒂斯私人股份公司 Treatment of eye disorders
GB0418762D0 (en) * 2004-08-23 2004-09-22 Genomica Sau Methods and compositions to treat glaucoma
TW200639253A (en) * 2005-02-01 2006-11-16 Alcon Inc RNAi-mediated inhibition of ocular targets
GB0521351D0 (en) 2005-10-20 2005-11-30 Genomica Sau Modulation of TRPV expression levels
GB0521716D0 (en) 2005-10-25 2005-11-30 Genomica Sau Modulation of 11beta-hydroxysteriod dehydrogenase 1 expression for the treatment of ocular diseases
GB0605337D0 (en) 2006-03-17 2006-04-26 Genomica Sau Treatment of CNS conditions
US20090130212A1 (en) * 2006-05-15 2009-05-21 Physical Pharmaceutica, Llc Composition and improved method for preparation of small particles
ES2390499T3 (en) * 2006-06-12 2012-11-13 Opko Pharmaceuticals, Llc Compositions and methods for inhibition of angiogenesis by sirna
SI2056845T1 (en) 2006-08-08 2018-02-28 Rheinische Friedrich-Wilhelms-Universitaet Bonn Structure and use of 5' phosphate oligonucleotides
US7872118B2 (en) * 2006-09-08 2011-01-18 Opko Ophthalmics, Llc siRNA and methods of manufacture
JP2010507387A (en) 2006-10-25 2010-03-11 クアーク・ファーマスーティカルス、インコーポレイテッド Novel siRNA and method of using the same
JP5646997B2 (en) 2007-10-03 2014-12-24 クォーク ファーマシューティカルズ インコーポレーティッドＱｕａｒｋ Ｐｈａｒｍａｃｅｕｔｉｃａｌｓ，Ｉｎｃ． Novel siRNA structure
CA3006687C (en) 2007-10-12 2024-01-09 Astellas Institute For Regenerative Medicine Improved methods of producing rpe cells and compositions of rpe cells
US9738680B2 (en) 2008-05-21 2017-08-22 Rheinische Friedrich-Wilhelms-Universität Bonn 5′ triphosphate oligonucleotide with blunt end and uses thereof
US10138485B2 (en) 2008-09-22 2018-11-27 Rxi Pharmaceuticals Corporation Neutral nanotransporters
SG171952A1 (en) 2008-12-04 2011-07-28 Opko Ophthalmics Llc Compositions and methods for selective inhibition of pro-angiogenic vegf isoforms
WO2010080452A2 (en) 2008-12-18 2010-07-15 Quark Pharmaceuticals, Inc. siRNA COMPOUNDS AND METHODS OF USE THEREOF
US9745574B2 (en) 2009-02-04 2017-08-29 Rxi Pharmaceuticals Corporation RNA duplexes with single stranded phosphorothioate nucleotide regions for additional functionality
WO2011063005A2 (en) 2009-11-17 2011-05-26 Advanced Cell Technology, Inc. Methods of producing human rpe cells and pharmaceutical preparations of human rpe cells
US8778904B2 (en) 2009-12-09 2014-07-15 Quark Pharmaceuticals, Inc. Methods and compositions for treating diseases, disorders or injury of the CNS
RU2615143C2 (en) 2010-03-24 2017-04-04 Адвирна Self-delivered rnai compounds of reduced size
US9095504B2 (en) 2010-03-24 2015-08-04 Rxi Pharmaceuticals Corporation RNA interference in ocular indications
US8648053B2 (en) 2010-10-20 2014-02-11 Rosalind Franklin University Of Medicine And Science Antisense oligonucleotides that target a cryptic splice site in Ush1c as a therapeutic for Usher syndrome
KR20130130792A (en) * 2010-12-23 2013-12-02 로랑 알렉산드레 Method to obtain optical means adapted to a human individual suffering or susceptible to suffer from one or more genetic related eye disorder (s) or disease (s)
EP2508530A1 (en) 2011-03-28 2012-10-10 Rheinische Friedrich-Wilhelms-Universität Bonn Purification of triphosphorylated oligonucleotides using capture tags
US9353371B2 (en) 2011-05-02 2016-05-31 Ionis Pharmaceuticals, Inc. Antisense compounds targeting genes associated with usher syndrome
US10314594B2 (en) 2012-12-14 2019-06-11 Corquest Medical, Inc. Assembly and method for left atrial appendage occlusion
US10307167B2 (en) 2012-12-14 2019-06-04 Corquest Medical, Inc. Assembly and method for left atrial appendage occlusion
US10813630B2 (en) 2011-08-09 2020-10-27 Corquest Medical, Inc. Closure system for atrial wall
BR112015004452A2 (en) 2012-09-05 2017-08-08 Sylentis Sau sirna and its use in methods and compositions for the treatment and / or prevention of eye conditions
GB201215857D0 (en) 2012-09-05 2012-10-24 Sylentis Sau siRNA and their use in methods and compositions for the treatment and/or prevention of eye conditions
EP2712870A1 (en) 2012-09-27 2014-04-02 Rheinische Friedrich-Wilhelms-Universität Bonn Novel RIG-I ligands and methods for producing them
US20140142689A1 (en) 2012-11-21 2014-05-22 Didier De Canniere Device and method of treating heart valve malfunction
US9566443B2 (en) 2013-11-26 2017-02-14 Corquest Medical, Inc. System for treating heart valve malfunction including mitral regurgitation
EP3095001B1 (en) * 2014-01-17 2023-04-26 The Trustees of Columbia University in the City of New York Systems and methods for three-dimensional imaging
US10061111B2 (en) 2014-01-17 2018-08-28 The Trustees Of Columbia University In The City Of New York Systems and methods for three dimensional imaging
US10011837B2 (en) 2014-03-04 2018-07-03 Sylentis Sau SiRNAs and their use in methods and compositions for the treatment and/or prevention of eye conditions
EP3137119B1 (en) 2014-04-28 2020-07-01 Phio Pharmaceuticals Corp. Methods for treating cancer using a nucleic acid targeting mdm2
CN107073294A (en) 2014-09-05 2017-08-18 阿克赛医药公司 Use the method for targeting TYR or MMP1 exonuclease treatment aging and skin disorder
US10842626B2 (en) 2014-12-09 2020-11-24 Didier De Canniere Intracardiac device to correct mitral regurgitation
US10500273B2 (en) 2015-03-02 2019-12-10 180 Therapeutics Lp Method of treating a localized fibrotic disorder using an IL-33 antagonist
KR20170095417A (en) * 2016-02-11 2017-08-23 삼성전자주식회사 Lighting device and electronic device including the same
WO2018013489A1 (en) 2016-07-10 2018-01-18 The Trustees Of Columbia University In The City Of New York Three-dimensional imaging using swept, confocally aligned planar excitation with an image relay
US10712545B2 (en) 2017-03-07 2020-07-14 The United States Of America As Represented By The Secretary, Department Of Health And Human Services Systems and methods for conducting contact-free thickness and refractive-index measurements of intraocular lenses using a self-calibrating dual confocal microscopy system
CN108739556A (en) * 2018-08-31 2018-11-06 南京工业大学 A kind of application of photochemical induction zebra fish cerebral arterial thrombosis model

Family Cites Families (100)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4235871A (en) 1978-02-24 1980-11-25 Papahadjopoulos Demetrios P Method of encapsulating biologically active materials in lipid vesicles
US4501728A (en) * 1983-01-06 1985-02-26 Technology Unlimited, Inc. Masking of liposomes from RES recognition
US5019369A (en) * 1984-10-22 1991-05-28 Vestar, Inc. Method of targeting tumors in humans
US5545412A (en) * 1985-01-07 1996-08-13 Syntex (U.S.A.) Inc. N-[1, (1-1)-dialkyloxy]-and N-[1, (1-1)-dialkenyloxy]-alk-1-yl-n,n,n-tetrasubstituted ammonium lipids and uses therefor
US5139941A (en) * 1985-10-31 1992-08-18 University Of Florida Research Foundation, Inc. AAV transduction vectors
US4920016A (en) * 1986-12-24 1990-04-24 Linear Technology, Inc. Liposomes with enhanced circulation time
US4837028A (en) * 1986-12-24 1989-06-06 Liposome Technology, Inc. Liposomes with enhanced circulation time
US5683986A (en) * 1987-08-12 1997-11-04 Hemispherx Biopharma Inc. Elaboration of host defense mediators into biological fluids by systemic dsRNA treatment
IE72103B1 (en) * 1987-08-12 1997-03-12 Hem Res Inc Promotion of host defense by systemic dsRNA treatment
US5712257A (en) * 1987-08-12 1998-01-27 Hem Research, Inc. Topically active compositions of mismatched dsRNAs
US5498521A (en) * 1990-01-24 1996-03-12 President And Fellows Of Harvard College Diagnosis of hereditary retinal degenerative diseases
US5843738A (en) * 1990-08-14 1998-12-01 Isis Pharmaceuticals, Inc. Oligonucleotide modulation of cell adhesion
US5252479A (en) * 1991-11-08 1993-10-12 Research Corporation Technologies, Inc. Safe vector for gene therapy
US5587308A (en) 1992-06-02 1996-12-24 The United States Of America As Represented By The Department Of Health & Human Services Modified adeno-associated virus vector capable of expression from a novel promoter
JPH08501686A (en) 1992-09-25 1996-02-27 ローン−プーラン・ロレ・ソシエテ・アノニム Adenovirus vector for transfer of foreign gene to cells in central nervous system, especially brain
US6177401B1 (en) * 1992-11-13 2001-01-23 Max-Planck-Gesellschaft Zur Forderung Der Wissenschaften Use of organic compounds for the inhibition of Flk-1 mediated vasculogenesis and angiogenesis
US5478745A (en) 1992-12-04 1995-12-26 University Of Pittsburgh Recombinant viral vector system
GB9308271D0 (en) 1993-04-21 1993-06-02 Univ Edinburgh Method of isolating and/or enriching and/or selectively propagating pluripotential animal cells and animals for use in said method
US5639872A (en) * 1993-07-27 1997-06-17 Hybridon, Inc. Human VEGF-specific oligonucleotides
US5731294A (en) * 1993-07-27 1998-03-24 Hybridon, Inc. Inhibition of neovasularization using VEGF-specific oligonucleotides
US6410322B1 (en) 1993-07-27 2002-06-25 Hybridon Inc Antisense oligonucleotide inhibition of vascular endothelial growth factor expression
US5624803A (en) * 1993-10-14 1997-04-29 The Regents Of The University Of California In vivo oligonucleotide generator, and methods of testing the binding affinity of triplex forming oligonucleotides derived therefrom
US6037329A (en) * 1994-03-15 2000-03-14 Selective Genetics, Inc. Compositions containing nucleic acids and ligands for therapeutic treatment
US6150092A (en) * 1994-06-27 2000-11-21 Taogosei Company, Ltd. Antisense nucleic acid compound targeted to VEGF
US5882914A (en) * 1995-06-06 1999-03-16 The Johns Hopkins University School Of Medicine Nucleic acids encoding the hypoxia inducible factor-1
US20030216335A1 (en) * 2001-11-30 2003-11-20 Jennifer Lockridge Method and reagent for the modulation of female reproductive diseases and conditions
WO1997018855A1 (en) 1995-11-21 1997-05-29 Eduard Naumovich Lerner Device for enhanced delivery of biologically active substances and compounds in an organism
GB9524807D0 (en) * 1995-12-05 1996-02-07 Smithkline Beecham Plc Novel compounds
US5843016A (en) * 1996-03-18 1998-12-01 Physion S.R.L. Electromotive drug administration for treatment of acute urinary outflow obstruction
US7033598B2 (en) * 1996-11-19 2006-04-25 Intrabrain International N.V. Methods and apparatus for enhanced and controlled delivery of a biologically active agent into the central nervous system of a mammal
WO2001052904A2 (en) 2000-01-19 2001-07-26 Gill Parkash S Pharmaceutical compositions and methods of treatment based on vegf antisense oligonucleotides
US6165709A (en) * 1997-02-28 2000-12-26 Fred Hutchinson Cancer Research Center Methods for drug target screening
US20050096282A1 (en) * 1997-04-21 2005-05-05 Lewin Alfred S. Adeno-associated virus-delivered ribozyme compositions and methods for the treatment of retinal diseases
WO1998048009A2 (en) 1997-04-21 1998-10-29 University Of Florida Materials and methods for ribozyme treatment of retinal diseases
WO1998056361A1 (en) * 1997-06-13 1998-12-17 Medinova Medical Consulting Gmbh Drug targeting system, method of its preparation and its use
US5902598A (en) * 1997-08-28 1999-05-11 Control Delivery Systems, Inc. Sustained release drug delivery devices
WO1999012572A1 (en) 1997-09-10 1999-03-18 University Of Florida Compounds and method for the prevention and treatment of diabetic retinopathy
US6506559B1 (en) * 1997-12-23 2003-01-14 Carnegie Institute Of Washington Genetic inhibition by double-stranded RNA
US20030096775A1 (en) 2001-10-23 2003-05-22 Isis Pharmaceuticals Inc. Antisense modulation of complement component C3 expression
US6433145B1 (en) * 1998-07-21 2002-08-13 Human Genome Sciences, Inc. Keratinocyte derived interferon
EP0979869A1 (en) * 1998-08-07 2000-02-16 Hoechst Marion Roussel Deutschland GmbH Short oligonucleotides for the inhibition of VEGF expression
US6219557B1 (en) * 1998-12-11 2001-04-17 Ericsson Inc. System and method for providing location services in parallel to existing services in general packet radio services architecture
AU776150B2 (en) * 1999-01-28 2004-08-26 Medical College Of Georgia Research Institute, Inc. Composition and method for (in vivo) and (in vitro) attenuation of gene expression using double stranded RNA
DE19956568A1 (en) 1999-01-30 2000-08-17 Roland Kreutzer Method and medicament for inhibiting the expression of a given gene
IL144084A0 (en) * 1999-02-03 2002-05-23 Biosante Pharmaceuticals Inc Therapeutic calcium phosphate particles and methods of manufacture and use
US6121000A (en) * 1999-02-11 2000-09-19 Genesense Technologies, Inc. Antitumor antisense sequences directed against R1 and R2 components of ribonucleotide reductase
EP2363478B1 (en) * 1999-04-21 2019-07-24 Alnylam Pharmaceuticals, Inc. Methods and compositions for inhibiting the function of polynucleotide sequences
US6331313B1 (en) * 1999-10-22 2001-12-18 Oculex Pharmaceticals, Inc. Controlled-release biocompatible ocular drug delivery implant devices and methods
GB9927444D0 (en) 1999-11-19 2000-01-19 Cancer Res Campaign Tech Inhibiting gene expression
CN104531702A (en) * 1999-12-16 2015-04-22 孟山都技术有限公司 Novel plant expression constructs
AU3974001A (en) 2000-02-03 2001-08-14 Ali R. Fattaey Method and reagent for the inhibition of checkpoint kinase-1 (chk 1) enzyme
CA2403397A1 (en) 2000-03-16 2001-09-20 Genetica, Inc. Methods and compositions for rna interference
WO2001075164A2 (en) * 2000-03-30 2001-10-11 Whitehead Institute For Biomedical Research Rna sequence-specific mediators of rna interference
US6372250B1 (en) * 2000-04-25 2002-04-16 The Regents Of The University Of California Non-invasive gene targeting to the brain
US6375972B1 (en) * 2000-04-26 2002-04-23 Control Delivery Systems, Inc. Sustained release drug delivery devices, methods of use, and methods of manufacturing thereof
AU2001295193A1 (en) * 2000-05-01 2001-11-12 Novartis Ag Vectors for ocular transduction and use thereof for genetic therapy
US7671036B2 (en) 2000-06-23 2010-03-02 Yissum Research Development Company Of The Hebrew University Of Jerusalem Positively-charged peptide nucleic acid analogs with improved properties
US6852510B2 (en) * 2000-07-03 2005-02-08 Gala Design Inc Host cells containing multiple integrating vectors
JP2004520006A (en) 2000-07-21 2004-07-08 ザ トラスティース オブ コロンビア ユニバーシティ インザ シティ オブ ニューヨーク Nucleic acid comprising a region of rat PEG-3 promoter and use thereof
IL137672A0 (en) 2000-08-03 2001-10-31 Dpharm Ltd Derivatives of branched-chain lipophilic molecules and uses thereof
US6443145B1 (en) * 2000-08-25 2002-09-03 Learning Legacy Solar seeker
US20020132788A1 (en) * 2000-11-06 2002-09-19 David Lewis Inhibition of gene expression by delivery of small interfering RNA to post-embryonic animal cells in vivo
US20020173478A1 (en) * 2000-11-14 2002-11-21 The Trustees Of The University Of Pennsylvania Post-transcriptional gene silencing by RNAi in mammalian cells
TR200401292T3 (en) * 2000-12-01 2004-07-21 Max@Planck@Gesellschaft�Zur�F�Rderung�Der�Wissenschaften the rnaágirişimineáyoláaçanáküçükárnaámolekül
EP1229134A3 (en) 2001-01-31 2004-01-28 Nucleonics, Inc Use of post-transcriptional gene silencing for identifying nucleic acid sequences that modulate the function of a cell
US20020165158A1 (en) * 2001-03-27 2002-11-07 King George L. Methods of modulating angiogenesis
JP2002305193A (en) * 2001-04-05 2002-10-18 Sony Corp Semiconductor device and method of manufacturing the same
US20030045830A1 (en) 2001-04-17 2003-03-06 De Bizemont Therese Gene therapy with chimeric oligonucleotides delivered by a method comprising a step of iontophoresis
US20050148530A1 (en) 2002-02-20 2005-07-07 Sirna Therapeutics, Inc. RNA interference mediated inhibition of vascular endothelial growth factor and vascular endothelial growth factor receptor gene expression using short interfering nucleic acid (siNA)
US20050048529A1 (en) * 2002-02-20 2005-03-03 Sirna Therapeutics, Inc. RNA interference mediated inhibition of intercellular adhesion molecule (ICAM) gene expression using short interfering nucleic acid (siNA)
WO2003070910A2 (en) 2002-02-20 2003-08-28 Ribozyme Pharmaceuticals, Incorporated INHIBITION OF VASCULAR ENDOTHELIAL GROWTH FACTOR (VEGF) AND VEGF RECEPTOR GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA)
US20050187174A1 (en) * 2001-05-18 2005-08-25 Sirna Therapeutics, Inc. RNA interference mediated inhibition of intercellular adhesion molecule (ICAM) gene expression using short interfering nucleic acid (siNA)
US20050159380A1 (en) * 2001-05-18 2005-07-21 Sirna Therapeutics, Inc. RNA interference mediated inhibition of angiopoietin gene expression using short interfering nucleic acid (siNA)
US7517864B2 (en) * 2001-05-18 2009-04-14 Sirna Therapeutics, Inc. RNA interference mediated inhibition of vascular endothelial growth factor and vascular endothelial growth factor receptor gene expression using short interfering nucleic acid (siNA)
US20030087755A1 (en) 2001-05-29 2003-05-08 Linfeng Chen Olefin polymerization catalyst compositions and method of preparation
EP1390385A4 (en) 2001-05-29 2004-11-24 Sirna Therapeutics Inc Nucleic acid based modulation of female reproductive diseases and conditions
PT2280070E (en) * 2001-07-23 2015-10-29 Univ Leland Stanford Junior Methods and compositions for rnai mediated inhibition of gene expression in mammals
US7820178B2 (en) 2001-08-01 2010-10-26 University of Brisol VEGF isoforms and their use as anti-angiogenic, anti-vasodilatory, anti-permeability and anti-proliferative agents
AU2002348163A1 (en) * 2001-11-02 2003-05-19 Intradigm Corporation Therapeutic methods for nucleic acid delivery vehicles
AU2002343792A1 (en) * 2001-11-28 2003-06-10 Center For Advanced Science And Technology Incubation, Ltd. siRNA EXPRESSION SYSTEM AND PROCESS FOR PRODUCING FUNCTIONAL GENE-KNOCKDOWN CELLS AND THE LIKE USING THE SAME
DK2264172T3 (en) * 2002-04-05 2017-11-27 Roche Innovation Ct Copenhagen As Oligomeric Compounds for Modulating HIF-1α Expression
WO2003087367A2 (en) * 2002-04-18 2003-10-23 Lynkeus Biotech Gmbh Means and methods for the specific inhibition of genes in cells and tissue of the cns and/or eye
AU2003237686A1 (en) 2002-05-24 2003-12-12 Max-Planck Gesellschaft Zur Forderung Der Wissenschaften E.V. Rna interference mediating small rna molecules
US20040115640A1 (en) * 2002-12-11 2004-06-17 Isis Pharmaceuticals Inc. Modulation of angiopoietin-2 expression
US7148342B2 (en) * 2002-07-24 2006-12-12 The Trustees Of The University Of Pennyslvania Compositions and methods for sirna inhibition of angiogenesis
JP2005534696A (en) 2002-08-06 2005-11-17 イントラディグム、コーポレイション In vivo down-regulation of target gene expression by introduction of interfering RNA
JP5449639B2 (en) * 2002-11-01 2014-03-19 ザ トラスティーズ オブ ザ ユニバーシティ オブ ペンシルバニア Compositions and methods for siRNA inhibition of HIF-1 alpha
JP2006507841A (en) * 2002-11-14 2006-03-09 ダーマコン， インコーポレイテッド Functional and ultrafunctional siRNA
AU2004205895B2 (en) 2003-01-16 2009-02-26 The Trustees Of The University Of Pennsylvania Compositions and methods for siRNA inhibition of ICAM-1
JP2006523464A (en) * 2003-04-18 2006-10-19 ザ・トラスティーズ・オブ・ザ・ユニバーシティ・オブ・ペンシルバニア Compositions and methods for siRNA inhibition of angiopoietins 1, 2 and their receptor TIE2
US20050019927A1 (en) * 2003-07-13 2005-01-27 Markus Hildinger DECREASING GENE EXPRESSION IN A MAMMALIAN SUBJECT IN VIVO VIA AAV-MEDIATED RNAi EXPRESSION CASSETTE TRANSFER
AU2005222902B2 (en) * 2004-03-12 2010-06-10 Alnylam Pharmaceuticals, Inc. iRNA agents targeting VEGF
US20060182783A1 (en) * 2004-04-30 2006-08-17 Allergan, Inc. Sustained release intraocular drug delivery systems
TWI243957B (en) * 2004-08-16 2005-11-21 Asia Optical Co Inc Assembling method of reticle module
CA2604441A1 (en) 2005-04-12 2006-10-19 Intradigm Corporation Composition and methods of rnai therapeutics for treatment of cancer and other neovascularization diseases
MX2008008302A (en) * 2005-12-22 2009-01-21 Exegenics Inc Compositions and methods for regulating complement system.
WO2007085266A1 (en) * 2006-01-30 2007-08-02 Dako Denmark A/S High-speed quantification of antigen specific t-cells in whole blood by flow cytometry
ES2390499T3 (en) 2006-06-12 2012-11-13 Opko Pharmaceuticals, Llc Compositions and methods for inhibition of angiogenesis by sirna
US7872118B2 (en) 2006-09-08 2011-01-18 Opko Ophthalmics, Llc siRNA and methods of manufacture
GB0704678D0 (en) 2007-03-09 2007-04-18 Univ Bristol Pro- and anti-angiogenic treatments

Also Published As

Publication number Publication date
AU2003222820A1 (en) 2003-10-27
EP1495120A2 (en) 2005-01-12
US20150105448A1 (en) 2015-04-16
US20120277288A1 (en) 2012-11-01
WO2003087368A3 (en) 2004-04-29
US20110021605A1 (en) 2011-01-27
MXPA04010282A (en) 2005-08-18
AU2009200699A1 (en) 2009-03-12
US20050222061A1 (en) 2005-10-06
CA2482903A1 (en) 2003-10-23
JP2005538940A (en) 2005-12-22
US8202845B2 (en) 2012-06-19
WO2003087368A2 (en) 2003-10-23
US20060003915A1 (en) 2006-01-05
EP1495121A2 (en) 2005-01-12
AU2003224087A1 (en) 2003-10-27
WO2003087367A2 (en) 2003-10-23
EP1495120B1 (en) 2012-10-10
JP2006500910A (en) 2006-01-12
HK1072074A1 (en) 2005-08-12
JP5578388B2 (en) 2014-08-27
ES2397060T3 (en) 2013-03-04
US8946180B2 (en) 2015-02-03
WO2003087367A3 (en) 2004-04-29
MXPA04010283A (en) 2005-08-18
AU2003224087B2 (en) 2009-03-05

Similar Documents

Publication Publication Date Title
EP1495120B1 (en) Means and methods for the specific modulation of target genes in the eye
Zhao et al. Charcot-Marie-Tooth disease type 2A caused by mutation in a microtubule motor KIF1Bβ
Ashery-Padan et al. Pax6 activity in the lens primordium is required for lens formation and for correct placement of a single retina in the eye
Shen et al. Zebrafish cone-rod (crx) homeobox gene promotes retinogenesis
Bernard et al. Graded Otx2 activities demonstrate dose-sensitive eye and retina phenotypes
Valdés-Sánchez et al. Retinal pigment epithelium degeneration caused by aggregation of PRPF31 and the role of HSP70 family of proteins
US9486521B2 (en) Therapeutic applications targeting SARM1
WO2005079815A2 (en) Methods and reagents for treating autosomal dominant diseases of the eye
Hessel et al. Identification of Srp9 as a febrile seizure susceptibility gene
WO2017201425A1 (en) Anabolic enhancers for ameliorating neurodegeneration
WO2007136857A2 (en) Hox compositions and methods
Wright et al. The rpe65rd12 allele exerts a semidominant negative effect on vision in mice
CN101466410A (en) Novel therapeutic and diagnostic products and methods
JPH09503512A (en) Methods for increasing neuronal survival and agents useful therefor
CN115475247B (en) Pharmaceutical use of beta 2-microglobulin or inhibitor thereof
JP2022532874A (en) Whole animal and cell models for identifying compositions and methods for the treatment of leukodystrophy, as well as effective agents for the treatment of leukodystrophy.
GB2377635A (en) Neuron-specific calcium sensor-1
JP4592352B2 (en) Nerve axon formation / elongation using nerve growth cone localized molecule Shotin1 or its splicing variant and its application to nerve regeneration
Ishibashi et al. Enlargement of the globe with ocular malformations in c-Myc transgenic mice
Henderson et al. Clinical and molecular genetic aspects of Leber’s congenital amaurosis
Kitzmüller et al. HMG Advance Access published November 2, 2007
Manson et al. Complex Ophthalmic Disorders
Clark Future Glaucoma Medical Therapies: What’s in the Pipeline?
WO2007057173A2 (en) METHODS AND DEVICES FOR SELECTING COMPOUNDS THAT INTERACT WITH IMPORTIN α 7 AND RELATED USES THEREOF

Legal Events

Date Code Title Description
EEER Examination request
FZDE Discontinued