CA2651309A1 - Compounds and methods for modulating gene expression - Google Patents

Compounds and methods for modulating gene expression Download PDF

Info

Publication number
CA2651309A1
CA2651309A1 CA002651309A CA2651309A CA2651309A1 CA 2651309 A1 CA2651309 A1 CA 2651309A1 CA 002651309 A CA002651309 A CA 002651309A CA 2651309 A CA2651309 A CA 2651309A CA 2651309 A1 CA2651309 A1 CA 2651309A1
Authority
CA
Canada
Prior art keywords
short antisense
antisense compound
certain embodiments
monomers
certain
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CA002651309A
Other languages
French (fr)
Other versions
CA2651309C (en
Inventor
Sanjay Bhanot
Richard S. Geary
Robert Mckay
Brett P. Monia
Punit P. Seth
Andrew M. Siwkowski
Eric E. Swayze
Edward Wancewicz
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Ionis Pharmaceuticals Inc
Original Assignee
Isis Pharmaceuticals, Inc.
Sanjay Bhanot
Richard S. Geary
Robert Mckay
Brett P. Monia
Punit P. Seth
Andrew M. Siwkowski
Eric E. Swayze
Edward Wancewicz
Ionis Pharmaceuticals, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=40134111&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=CA2651309(A1) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Priority claimed from PCT/US2007/061183 external-priority patent/WO2007090071A2/en
Application filed by Isis Pharmaceuticals, Inc., Sanjay Bhanot, Richard S. Geary, Robert Mckay, Brett P. Monia, Punit P. Seth, Andrew M. Siwkowski, Eric E. Swayze, Edward Wancewicz, Ionis Pharmaceuticals, Inc. filed Critical Isis Pharmaceuticals, Inc.
Priority to CA3044969A priority Critical patent/CA3044969A1/en
Publication of CA2651309A1 publication Critical patent/CA2651309A1/en
Application granted granted Critical
Publication of CA2651309C publication Critical patent/CA2651309C/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/87Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/16Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • A61P3/04Anorexiants; Antiobesity agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • A61P3/06Antihyperlipidemics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • A61P3/08Drugs for disorders of the metabolism for glucose homeostasis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • A61P3/08Drugs for disorders of the metabolism for glucose homeostasis
    • A61P3/10Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P5/00Drugs for disorders of the endocrine system
    • A61P5/38Drugs for disorders of the endocrine system of the suprarenal hormones
    • A61P5/46Drugs for disorders of the endocrine system of the suprarenal hormones for decreasing, blocking or antagonising the activity of glucocorticosteroids
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P5/00Drugs for disorders of the endocrine system
    • A61P5/48Drugs for disorders of the endocrine system of the pancreatic hormones
    • A61P5/50Drugs for disorders of the endocrine system of the pancreatic hormones for increasing or potentiating the activity of insulin
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00Drugs for disorders of the blood or the extracellular fluid
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • A61P9/10Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1137Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y203/00Acyltransferases (2.3)
    • C12Y203/01Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)
    • C12Y203/0102Diacylglycerol O-acyltransferase (2.3.1.20)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/11Antisense
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • C12N2310/315Phosphorothioates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/3212'-O-R Modification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/3222'-R Modification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/323Chemical structure of the sugar modified ring structure
    • C12N2310/3231Chemical structure of the sugar modified ring structure having an additional ring, e.g. LNA, ENA
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/34Spatial arrangement of the modifications
    • C12N2310/341Gapmers, i.e. of the type ===---===
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/35Nature of the modification
    • C12N2310/351Conjugate
    • C12N2310/3515Lipophilic moiety, e.g. cholesterol

Abstract

The present disclosure describes short antisense compounds, including such compounds comprising chemically-modified high-affinity monomers 8-16 monomers in length. Certain such short antisense compound are useful for the reduction of target nucleic acids and/or proteins in cells, tissues, and animals with increased potency and improved therapeutic index. Thus, provided herein are short antisense compounds comprising high-affinity nucleotide modifications useful for reducing a target RNA in vivo. Such short antisense compounds are effective at lower doses than previously described antisense compounds, allowing for a reduction in toxicity and cost of treatment. In addition, the described short antisense compounds have greater potential for oral dosing.

Description

DEMANDE OU BREVET VOLUMINEUX

LA PRESENTE PARTIE DE CETTE DEMANDE OU CE BREVET COMPREND
PLUS D'UN TOME.

NOTE : Pour les tomes additionels, veuillez contacter le Bureau canadien des brevets JUMBO APPLICATIONS/PATENTS

THIS SECTION OF THE APPLICATION/PATENT CONTAINS MORE THAN ONE
VOLUME

NOTE: For additional volumes, please contact the Canadian Patent Office NOM DU FICHIER / FILE NAME:

NOTE POUR LE TOME / VOLUME NOTE:

COMPOUNDS AND METHODS FOR MODULATING GENE EXPRESSION
SEQUENCE LISTING
The present application is being filed along with a Sequence Listing in electronic format. The Sequence Listing is provided as a file entitled CORE0061 WO7SEQ.txt, created on May 7, 2007 which is 700 Kb in size. The information in the electronic format of the sequence listing is incorporated herein by reference in its entirety.

BACKGROUND
Targeting disease-causing gene sequences was first suggested nearly 40 years ago (Belikova et al., Tet. Lett., 1967, 37, 3557-3562), and antisense activity was demonstrated in cell culture a decade later (Zamecnik et al., Proc. Natl. Acad. Sci. U.S.A., 1978, 75, 280-284). One advantage of antisense technology in the treatment of a disease or condition that stems from a disease-causing gene is that it is a direct genetic approach that has the ability to modulate expression of specific disease-causing genes.
Generally, the principle behind antisense technology is that an antisense compound hybridizes to a target nucleic acid and effects modulation of gene expression activity or function, such as transcription, translation or splicing. The modulation of gene expression can be achieved by, for example, target degradation or occupancy-based inhibition. An example of modulation of RNA
target function by degradation is RNase H-based degradation of the target RNA upon hybridization with a DNA-like antisense compound. Another example of modulation of gene expression by target degradation is RNA
interference (RNAi). RNAi is a form of antisense-mediated gene silencing involving the introduction of dsRNA leading to the sequence-specific reduction of targeted endogenous mRNA
levels. Sequence-specificity makes antisense compounds extremely attractive as tools for target validation and gene functionalization, as well as research tools for identifying and characterizing nucleases and as therapeutics to selectively modulate the expression of genes involved in the pathogenesis of any one of a variety of diseases.
Antisense technology is an effective means for reducing the expression of one or more specific gene products and can therefore prove to be uniquely useful in a number of therapeutic, diagnostic, and research applications. Chemically modified nucleosides are routinely used for incorporation into
-2-antisense compounds to enhance one or more properties, such as nuclease resistance, pharmacokinetics or affinity for a target RNA.
Despite the expansion of knowledge since the discovery of antisense technology, there remains an unmet need for antisense compounds with greater efficacy, reduced toxicity and lower cost. Until the present disclosure, high-affinity modifications have not been employed in the design of short antisense compounds for reducing target RNA in vivo. This is because of concerns regarding the degree of target specificity that a sequence 15 nucleotides or shorter would have when employed to reduce target in a living system. Previous studies have described that greater specificity, and therefore greater potential for potency, is achieved by antisense compounds between 16 and 20 nucleobases in length.
The present disclosure describes incorporation of chemically-modified high-affmity nucleotides into antisense compounds allows for short antisense compounds about 8-16 nucleobases in length useful in the reduction of target RNAs in animals with increased potency and improved therapeutic index. Thus, provided herein are short antisense compounds comprising high-affinity nucleotide modifications useful for reducing a target RNA in vivo. Such short antisense compounds are effective at lower doses than previously described antisense compounds, allowing for a reduction in toxicity and cost of treatment.
SUMMARY
Disclosed herein are short antisense compounds and methods of using said compounds to reduce target RNA expression in cells or tissues. In certain embodiments, provided herein is a method of reducing expression of a target in an animal, comprising administering to the animal a short antisense compound targeted to a nucleic acid of such target. In certain embodiments, shorts antisense compounds are oligonucleotide compounds. In certain embodiments short antisense oligonucleotides are about 8 to 16, preferably 9 to 15, more preferably 9 to 14, more preferably 10 to 14 nucleotides in length and comprises a gap region flanked on each side by a wing, wherein each wing independently consists of 1 to
3 nucleotides. Preferred motifs include but are not limited to wing - deoxy gap -wing motifs selected from 3-10-3, 2-10-3, 2-10-2, 1-10-1, 2-8-2, 1-8-1, 3-6-3 or 1-6-1. In a preferred embodiment, the short antisense oligonucleotide comprise at least one high-affinity modification. In a further embodiment, the high-affinity modification includes chemically-modified high-affinity nucleotides. In a preferred embodiment, each wing independently consists of 1 to 3 high-affinity modified nucleotides. In one embodiment the high affinity modified nucleotides are sugar-modified nucleotides.
In certain embodiments short antisense compounds exhibit greater uptake in the gut as compared to antisense compounds of greater length. Thus, also provided herein are methods of reducing a target in an animal, comprising orally administering the short antisense compounds of the present invention.
In certain embodiments, short antisense compounds are targeted to a nucleic acid encoding a protein selected from ApoB, SGLT2, PCSK9, SOD1, CRP, GCCR, GCGR, DGAT2, PTP1B
and PTEN.
Further provided are methods of treating a metabolic disorder in an animal, comprising administering to an animal in need of such therapy a short antisense compound targeted to a nucleic acid involved in regulating glucose metabolism or clearance, lipid metabolism, cholesterol metabolism, or insulin signaling.
Also provided are methods of increasing insulin sensitivity, decreasing blood glucose or decreasing HbAlc in an animal, comprising administering to said animal a short antisense compound targeted to a nucleic acid encoding a target involved in regulating glucose metabolism or clearance, lipid metabolism, cholesterol metabolism, or insulin signaling.
Further provided are methods of decreasing total serum cholesterol, serum LDL, serum VLDL, serum HDL, serum triglycerides, serum apolipoprotein(a) or free fatty acids in an animal, comprising administering to said animal a short antisense compound targeted to a nucleic acid encoding a target that is involved in regulating glucose metabolism or clearance, lipid metabolism, cholesterol metabolism, or insulin signaling, wherein said short antisense compound is 8 to 16 nucleotides in length and comprises a gap region flanked on each side by a wing, wherein each wing independently consists of 1 to 3 high-affinity modified nucleotides.
Certain targets involved in regulating glucose metabolism or clearance, lipid metabolism, cholesterol metabolism, or insulin signaling include, but are not limited to, GCGR and ApoB-100. Thus, provided are short antisense compounds targeting nucleic acids encoding GCGR
and ApoB-100 and methods of reducing expression of said targets and/or target nucleic acids in animal. In addition, provided is the use of short antisense compounds targeting nucleic acids encoding GCGR, and ApoB-100 for the treatment of a metabolic or cardiovascular disease or condition.
In certain embodiments, short antisense compounds further comprise a conjugate group.
Conjugate groups include, but are not limited to, C16 and cholesterol.
In certain embodiments short antisense compounds comprise at least one modified nucleobase, internucleoside linkage or sugar moiety. In certain embodiments, such modified internucleoside linkage is a phosphorothioate internucleoside linkage. In certain embodiments, each internucleoside linkage is a phosphorothioate intemucleoside linkage.
In certain embodiments, short antisense compounds comprise at least one high affinity modification. In certain such embodiments, the high-affmity modification is a chemically-modified high-affinity nucleotide. In certain embodiments, chemically-modified high affinity nucleotides are sugar-modified nucleotides. In certain embodiments, at least one of the sugar-modified nucleotides comprises a bridge between the 4' and the 2' position of the sugar. Each of the sugar-modified nucleotides is, independently, in the (3-D or a-L sugar conformation. In certain embodiments, each of said high-affinity modified nucleotides confers a T. of at least 1 to 4 degrees per nucleotide.
In certain embodiments, each of said sugar-modified nucleotides comprises a 2'-substituent group that is other than H or OH.
Such sugar-modified nucleotides include those having a 4' to 2' bridged bicyclic sugar moiety. In certain embodiments, each of the 2'-substituent groups is, independently, alkoxy, substituted alkoxy, or halogen. In certain embodiments, each of the 2'-substituent groups is OCHZCH2OCH3 (2'-MOE).
In certain embodiments, short antisense compounds have one or more sugar-modified nucleotides comprising a bridge between the 4' and 2' position of the sugar, wherein each of said bridges
-4-independently comprises from 2 to 4 linked groups independently selected from -[C(Ri)(RZ)]n-, -C(Ri)=C(R2)-, -C(R,)=N-, -C(=NRI)-, -C(=0)-, -C(=S)-, -0-, -Si(RI)Z-, -S(=O),.- and -N(Ri)-;
wherein x is 0, 1, or 2;
n is 1, 2, 3, or 4;
each Rl and R2 is, independently, H, a protecting group, hydroxyl, Ci-C12 alkyl, substituted CI-C1Z alkyl, C2-C12 alkenyl, substituted C2-C12 alkenyl, C2 The C12 alkynyl, substituted C2-C12 alkynyl, C5-C20 aryl, substituted C5-C20 aryl, heterocycle radical, substituted heterocycle radical, heteroaryl, substituted heteroaryl, C5-C7 alicyclic radical, substituted C5-C7 alicyclic radical, halogen, OJI, NJiJ2, SJI, N3, COOJI, acyl (C(=O)-H), substituted acyl, CN, sulfonyl (S(=O)z-Ji), or sulfoxyl (S(=O)-JI); and each J, and J2 is, independently, H, C1-C12 alkyl, substituted CX12 alkyl, C2-alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, CS-CZo aryl, substituted C5-C2o aryl, acyl (C(=O)-H), substituted acyl, a heterocycle radical, a substituted heterocycle radical, Ci-CiZ aminoalkyl, substituted C1-C12 aminoalkyl or a protecting group.
In one aspect, each of said bridges is, independently, -[C(Rl)(R2)].-,-[C(Rl)(R2)].-O-, -C(R1R2)-N(Ri)-O- or -C(RIR2)-O-N(Ri)-. In another aspect, each of said bridges is, independently, 4'-(CH2)3-2', 4'-(CH2)2-2', 4'-CHZ-O-2', 4'-(CHZ)2-0-2', 4'-CH2-O-N(Ri)-2' and 4'-CH2-N(Ri)-0-2'- wherein each R, is, independently, H, a protecting group or CI-C1Z alkyl.
In certain embodiments, provided herein are short antisense compounds useful in the reduction of targets and/or target RNAs associated with disease states in animals. In certain embodiments, provided are methods of using the short antisense compounds for reducing expression of a target RNA in an animal. In certain embodiments, provided herein is the use of a short antisense compound in the preparation of a medicament for the treatment of a metabolic disorder in an animal. In certain embodiments, provided herein is the use of a short antisense compound in the preparation of a medicament for increasing insulin sensitivity, decreasing blood glucose or decreasing HbAIc in an animal.
Also provided is the use of a short antisense compound in the preparation of a medicament for decreasing total serum cholesterol, serum LDL, serum VLDL, serum HDL, serum triglycerides, serum apolipoprotein(a) or free fatty acids in an animal.
In certain embodiments, short antisense compounds provided herein exhibit equal or increased potency with regard to target RNA knockdown as compared to longer parent antisense oligonucleotide at least 20 nucleotides in length. In certain embodiments, short antisense compounds exhibit a faster onset of action (target RNA reduction) as compared to the parent antisense oligonucleotide. In certain embodiments, increased potency is in the kidney. In certain embodiments, target RNA is predominately expressed in the kidney. In certain embodiments, increased potency is in the liver. In certain embodiments, target RNA is predominately expressed in the liver.
-5-DETAILED DESCRIPTION
It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the invention, as claimed.
Herein, the use of the singular includes the plural unless specifically stated otherwise. As used herein, the use of "or" means "and/or" unless stated otherwise. Furthermore, the use of the term "including" as well as other forms, such as "includes" and "included", is not limiting. Also, terms such as "element" or "component" encompass both elements and components comprising one unit and elements and components that comprise more than one subunit, unless specifically stated otherwise.
The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described. All documents, or portions of documents, cited in this application, including, but not limited to, patents, patent applications, articles, books, and treatises, are hereby expressly incorporated by reference in their entirety for any purpose.
US patent application serial nos 10/712,795 and 10/200,710 are hereby expressly incorporated by reference in their entirety for any purpose.
A. Definitions Unless specific definitions are provided, the nomenclature utilized in connection with, and the procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well known and commonly used in the art. Standard techniques may be used for chemical synthesis, chemical analysis, pharmaceutical preparation, formulation and delivery, and treatment of subjects. Certain such techniques and procedures may be found for example in "Carbohydrate Modifications in Antisense Research" Edited by Sangvi and Cook, American Chemical Society, Washington D.C., 1994; and "Remington's Pharmaceutical Sciences,"
Mack Publishing Co., Easton, Pa., 18th edition, 1990; and which is hereby incorporated by reference for any purpose. Where permitted, all patents, applications, published applications and other publications and sequences from GenBank and other data bases referred to throughout in the disclosure herein are incorporated by reference in their entirety.
Unless otherwise indicated, the following terms have the following meanings:
As used herein, the term "nucleoside" means a glycosylamine comprising a nucleobase and a sugar. Nucleosides includes, but are not limited to, naturally occurring nucleosides, abasic nucleosides, modified nucleosides, and nucleosides having mimetic bases and/or sugar groups.
As used herein, the term "nucleotide" refers to a glycosomine comprising a nucleobase and a sugur having a phosphate group covalently linked to the sugar. Nucleotides may be modified with any of a variety of substituents.
As used herein, the term "nucleobase" refers to the base portion of a nucleoside or nucleotide.
A nucleobase may comprise any atom or group of atoms capable of hydrogen bonding to a base of another nucleic acid.
-6-As used herein, the term "heterocyclic base moiety" refers to a nucleobase comprising a heterocycle.
As used herein, the term "deoxyribonucleotide" means a nucleotide having a hydrogen at the 2' position of the sugar portion of the nucleotide. Deoxyribonucleotides may be modified with any of a variety of substituents.
As used herein, the term "ribonucleotide" means a nucleotide having a hydroxy at the 2' position of the sugar portion of the nucleotide. Ribonucleotides may be modified with any of a variety of substituents.
As used herein, the term "oligomeric compound" refers to a polymeric structure comprising two or more sub-structures and capable of hybridizing to a region of a nucleic acid molecule. In certain embodiments, oligomeric compounds are oligonucleosides. In certain embodiments, oligomeric compounds are oligonucleotides. In certain embodiments, oligomeric compounds are antisense compounds. In certain embodiments, oligomeric compounds are antisense oligonucleotides. In certain embodiments, oligomeric compounds are short antisense compounds. In certain embodiments, oligomeric compounds are short antisense oligonucleotides. In certain embodiments, oligomeric compounds are chimeric oligonucleotides.
As used herein, the term "monomer" refers to a single unit of an oligomer.
Monomers include, but are not limited to, nucleosides and nucleotides, whether naturally occuring or modified.
As used herein "oligonucleoside" refers to an oligonucleotide in which the internucleoside linkages do not contain a phosphorus atom.
As used herein, the term "oligonucleotide" refers to an oligomeric compound comprising a plurality of linked nucleotides. In certain embodiment, one or more nucleotides of an oligonucleotide is modified. In certain embodiments, an oligonucleotide comprises ribonucleic acid (RNA) or deoxyribonucleic acid (DNA). In certain embodiments, oligonucleotides are composed of naturally-and/or non-naturally-occurring nucleobases, sugars and covalent internucleotide linkages, and may further include non-nucleic acid conjugates.
As used herein "internucleotide linkage" refers to a covalent linkage between adjacent nucleotides.
As used herein, the term "monomeric linkage" refers to a covalent linkage between two monmers. Monomeric linkages include, but are not limited to intemucleotide linkages and internucleoside linkages.
As used herein "naturally occuring internucleotide linkage" refers to a 3' to 5' phosphodiester linkage.
As used herein, the term "antisense compound" refers to an oligomeric compound that is at least partially complementary to a target nucleic acid molecule to which it hybridizes. In certain embodiments, an antisense compound modulates (increases or decreases) expression of a target nucleic acid. Antisense compounds include, but are not limited to, compounds that are oligonucleotides, oligonucleosides,
-7-oligonucleotide analogs, oligonucleotide mimetics, and chimeric combinations of these. Consequently, while all antisense compounds are oligomeric compounds, not all oligomeric compounds are antisense compounds.
As used herein, the term "antisense oligonucleotide" refers to an antisense compound that is an oligonucleotide.
As used herein, the term "parent antisense oligonucleotide" refers to an oligonucleotide 20 nucleotides in length having a deoxy gap region having ten 2'-deoxyribonucleotides, flanked by a first and a second wing region each having five 2'-O-(2-methoxyethyl) ribonucleotides (a 5-10-5 MOE
gapmer) and comprising the sequence of the corresponding short antisense compound to which it is a parent.
As used herein, the term "short antisense compound" refers to an antisense compound about 8, 9, 10, 11, 12, 13, 14, 15 or 16 monomers in length. In certain embodiments, a short antisense compound has at least one high-affinity modification.
As used herein, the term "short antisense oligonucleotide" or refers to an antisense oligonucleotide about 8, 9, 10, 11, 12, 13, 14, 15 or 16 nucleotides in length. In certain embodiments, a short antisense oligonucleotide has at least one high-affinity modification.
As used herein, the term "short gapmer" refers to a short antisense oligonucleotide having a first and a second wing region each independently 1 to 3 nucleotides in length and a gap region 2 to 14 nucleobase in length.
As used herein, the term "motif' refers to the pattem of unmodified and modified nucleotides in a short antisense compound As used herein, the term "chimeric antisense oligomer" refers to an antisense oligomeric compound, having at least one sugar, nucleobase or intemucleoside linkage that is differentially modified as compared to at least on other sugar, nucleobase or internucleoside linkage within the same antisense oligomeric compound. The remainder of the sugars, nucleobases and intemucleoside linkages can be independently modified or unmodified, the same or different.
As used herein, the term "chimeric antisense oligonucleotide" refers to an antisense oligonucleotide, having at least one sugar, nucleobase or internucleoside linkage that is differentially modified as compared to at least on other sugar, nucleobase or internucleoside linkage within the same antisense oligonucleotide. The remainder of the sugars, nucleobases and intemucleoside linkages can be independently modified or unmodified, the same or different.
As used herein, the term "mixed-backbone antisense oligonucleotide" refers to an antisense oligonucleotide wherein at least one internucleoside linkage of the antisense oligonucleotide is different from at least one other internucleotide linkage of the antisense oligonucleotide.
As used herein, the term "target" refers to a protein, the modulation of which is desired.
As used herein, the term "target gene" refers to a gene encoding a target.
As used herein, the terms "target nucleic acid" and "nucleic acid molecule encoding a target"
-8-refer to any nucleic acid molecule the expression or activity of which is capable of being modulated by an antisense compound. Target nucleic acids include, but are not limited to, RNA
(including, but not limited to pre-mRNA and mRNA or portions thereof) transcribed from DNA encoding a target, and also cDNA
derived from such RNA, and miRNA. For example, the target nucleic acid can be a cellular gene (or mRNA transcribed from the gene) whose expression is associated with a particular disorder or disease state, or a nucleic acid molecule from an infectious agent.
As used herein, the term "targeting" or "targeted to" refers to the association of an antisense compound to a particular target nucleic acid molecule or a particular region of nucleotides within a target nucleic acid molecule.
As used herein, the term "5' target site" refers to the nucleotide of a target nucleic acid which is complementary to the 5'-most nucleotide of a particular antisense compound.
As used herein, the term "3' target site" refers to the nucleotide of a target nucleic acid which is complementary to the 3'-most nucleotide of a particular antisense compound.
As used herein, the term "target region," refers to a portion of a target nucleic acid to which one or more antisense compounds is complementary.
As used herein, the term "target segment" refers to a smaller or sub-portions of a region within a target nucleic acid.
As used herein, the term "nucleobase complementarity" refers to a nucleobase that is capable of base pairing with another nucleobase. For example, in DNA, adenine (A) is complementary to thymine (T). For example, in RNA, adenine (A) is complementary to uracil (U). In certain embodiments, complementary nucleobase refers to a nucleobase of an antisense compound that is capable of base pairing with a nucleobase of its target nucleic acid. For example, if a nucleobase at a certain position of an antisense compound is capable of hydrogen bonding with a nucleobase at a certain position of a target nucleic acid, then the position of hydrogen bonding between the oligonucleotide and the target nucleic acid is considered to be complementary at that nucleobase pair.
As used herein, the term "non-complementary nucleobase" refers to a pair of nucleobases that do not form hydrogen bonds with one another or otherwise support hybridization.
As used herein, the term "complementary" refers to the capacity of an oligomeric compound to hybridize to another oligomeric compound or nucleic acid through nucleobase complementarity. In certain embodiments, an antisense compound and its target are complementary to each other when a sufficient number of corresponding positions in each molecule are occupied by nucleobases that can bond with each other to allow stable association between the antisense compound and the target. One skilled in the art recognizes that the inclusion of mismatches is possible without eliminating the ability of the oligomeric compounds to remain in association. Therefore, described herein are antisense compounds that may comprise up to about 20% nucleotides that are mismatched (i.e., are not nucleobase complementary to the corresponding nucleotides of the target). Preferably the antisense compounds contain no more than about 15%, more preferably not more than about 10%, most preferably not more
-9-than 5% or no mismatches. The remaining nucleotides are nucleobase complementary or otherwise do not disrupt hybridization (e.g., universal bases). One of ordinary skill in the art would recognize the compounds provided herein are at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% complementary to a target nucleic acid.
As used herein, the term "mismatch" refers to a non-complementary nucleobase within a complementary oligomeric compound.
As used herein, "hybridization" means the pairing of complementary oligomeric compounds (e.g., an antisense compound and its target nucleic acid). While not limited to a particular mechanism, the most common mechanism of pairing involves hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleoside or nucleotide bases (nucleobases). For example, the natural base adenine is nucleobase complementary to the natural nucleobases thymidine and uracil which pair through the formation of hydrogen bonds. The natural base guanine is nucleobase complementary to the natural bases cytosine and 5-methyl cytosine. Hybridization can occur under varying circumstances.
As used herein, the term "specifically hybridizes" refers to the ability of an oligomeric compound to hybridize to one nucleic acid site with greater affinity than it hybridizes to another nucleic acid site. In certain embodiments, an antisense oligonucleotide specifically hybridizes to more than one target site.
As used herein, "designing" or "designed to" refer to the process of designing an oligomeric compound that specifically hybridizes with a selected nucleic acid molecule.
As used herein, the term "modulation" refers to a perturbation of function or activity when compared to the level of the function or activity prior to modulation. For example, modulation includes the change, either an increase (stimulation or induction) or a decrease (inhibition or reduction) in gene expression. As further example, modulation of expression can include perturbing splice site selection of pre-mRNA processing.
As used herein, the term "expression" refers to all the functions and steps by which a gene's coded information is converted into structures present and operating in a cell. Such structures include, but are not limited to the products of transcription and translation.
As used herein, "variant" refers to an alternative RNA transcript that can be produced from the same genomic region of DNA. Variants include, but are not limited to "pre-mRNA
variants" which are transcripts produced from the same genomic DNA that differ from other transcripts produced from the same genomic DNA in either their start or stop position and contain both intronic and exonic sequence.
Variants also include, but are not limited to, those with alternate splice junctions, or alternate initiation and termination codons.
As used herein, "high-affinity modified monomer" refers to a monomer having at least one modified nucleobase, internucleoside linkage or sugar moiety, when compared to naturally occurring monomers, such that the modification increases the affinity of an antisense compound comprising the high-affinity modified monomer to its target nucleic acid. High-affinity modifications include, but are
-10-not limited to, monomers (e.g., nucleosides and nucleotides) comprising 2'-modifed sugars.
As used herein, the term "2'-modified" or "2'-substituted" means a sugar comprising substituent at the 2' position other than H or OH. 2'-modified monomers, include, but are not limited to, BNA's and monomers (e.g., nucleosides and nucleotides) with 2'- substituents, such as allyl, amino, azido, thio, 0-allyl, O-Ci-Cio alkyl, -OCF3, O-(CHZ)Z-O-CH3, 2'-O(CH2)2SCH3, O-(CHZ)Z-O-N(Rm)(Rõ), or O-CH2-C(=O)-N(R,,,)(Rõ), where each R,,, and Rõ is, independently, H or substituted or unsubstituted Cl-Cio alkyl. In certain embodiments, short antisense compounds comprise a 2'modified monomer that does not have the formula 2'-O(CH2)õH, wherein n is one to six. In certain embodiments, short antisense compounds comprise a 2'modified monomer that does not have the formula 2'-OCH3. In certain embodiments, short antisense compounds comprise a 2'modified monomer that does not have the formula or, in the alternative, 2'-O(CHZ)ZOCH3.
As used herein, the term "bicyclic nucleic acid" or "BNA" or "bicyclic nucleoside" or "bicyclic nucleotide" refers to a nucleoside or nucleotide wherein the furanose portion of the nucleoside includes a bridge connecting two carbon atoms on the furanose ring, thereby forming a bicyclic ring system.
As used herein, unless otherwise indicated, the term "methyleneoxy BNA" alone refers to (3-D-methyleneoxy BNA.
As used herein, the term "MOE" refers to a 2'-methoxyethyl substituent.
As used herein, the term "gapmer" refers to a chimeric oligomeric compound comprising a central region (a "gap") and a region on either side of the central region (the "wings"), wherein the gap comprises at least one modification that is different from that of each wing.
Such modifications include nucleobase, monomeric linkage, and sugar modifications as well as the absence of modification (unxnodified). Thus, in certain embodiments, the nucleotide linkages in each of the wings are different than the nucleotide linkages in the gap. In certain embodiments, each wing comprises nucleotides with high affmity modifications and the gap comprises nucleotides that do not comprise that modification. In certain embodiments the nucleotides in the gap and the nucleotides in the wings all comprise high affinity modifications, but the high affinity modifications in the gap are different than the high affmity modifications in the wings. In certain embodiments, the modifications in the wings are the same as one another. In certain embodiments, the modifications in the wings are different from each other. In certain embodiments, nucleotides in the gap are unmodified and nucleotides in the wings are modified. In certain embodiments, the modification(s) in each wing are the same. In certain embodiments, the modification(s) in one wing are different from the modification(s) in the other wing. In certain embodiments, short antisense compounds are gapmers having 2'-deoxynucleotides in the gap and nucleotides with high-affinity modifications in the wing.
As used herein, the term "prodrug" refers to a therapeutic agent that is prepared in an inactive form that is converted to an active form (i.e., drug) within the body or cells thereof by the action of endogenous enzymes or other chemicals and/or conditions.
As used herein, the term "pharmaceutically acceptable salts" refers to salts of active compounds
11 PCT/US2007/068401 that retain the desired biological activity of the active compound and do not impart undesired toxicological effects thereto.
As used herein, the term "cap structure" or "terminal cap moiety" refers to chemical modifications, which have been incorporated at either terminus of an antisense compound.
As used herein, the tenm "prevention" refers to delaying or forestalling the onset or development of a condition or disease for a period of time from hours to days, preferably weeks to months.
As used herein, the term "amelioration" refers to a lessening of at least one indicator of the severity of a condition or disease. The severity of indicators may be determined by subjective or objective measures which are known to those skilled in the art.
As used herein, the term "treatment" refers to administering a composition of the invention to effect an alteration or improvement of the disease or condition. Prevention, amelioration, and/or treatment may require administration of multiple doses at regular intervals, or prior to onset of the disease or condition to alter the course of the disease or condition. Moreover, a single agent may be used in a single individual for each prevention, amelioration, and treatment of a condition or disease sequentially, or concurrently.
As used herein, the term "pharmaceutical agent" refers to a substance provides a therapeutic benefit when administered to a subject.
As used herein, the term "therapeutically effective amount" refers to an amount of a pharmaceutical agent that provides a therapeutic benefit to an animal.
As used herein, "administering" means providing a pharmaceutical agent to an animal, and includes, but is not limited to administering by a medical professional and self-administering.
As used herein, the term "co-administration" refers to administration of two or more pharmaceutical agents to an animal. The two or more pharmaceutical agents may be in a single pharmaceutical composition, or may be in separate pharmaceutical compositions.
Each of the two or more pharmaceutical agents may be administered through the same or different routes of administration.
Co-administration encompasses administration in parallel or sequentially.
As used herein, the term "pharmaceutical composition" refers to a mixture of substances suitable for administering to an individual. For example, a pharmaceutical composition may comprise an antisense oligonucleotide and a sterile aqueous solution.
As used herein, the term "individual" refers to a human or non-human animal selected for treatment or therapy.
As used herein, the term "animal" refers to a human or non-human animal, including, but not limited to, mice, rats, rabbits, dogs, cats, pigs, and non-human primates, including, but not limited to, monkeys and chimpanzees.
As used herein, the term "subject" refers to an animal, including, but not limited to a human, to whom a pharmaceutical composition is administered.
As used herein, the term "duration" refers to the period of time during which an activity or
-12-event continues. In certain embodiments, the duration of treatment is the period of time during which doses of a pharmaceutical agent are administered.
As used herein, the term "parenteral administration," refers to administration through injection or infusion. Parenteral administration includes, but is not limited to, subcutaneous administration, intravenous administration, or intramuscular administration.
As used herein, the term "subcutaneous administration" refers to administration just below the skin. "Intravenous administration" means administration into a vein.
As used herein, the term "dose" refers to a specified quantity of a phannaceutical agent provided in a single administration. In certain embodiments, a dose may be administered in two or more boluses, tablets, or injections. For example, in certain embodiments, where subcutaneous administration is desired, the desired dose requires a volume not easily accommodated by a single injection. In such embodiments, two or more injections may be used to achieve the desired dose.
In certain embodiments, a dose may be administered in two or more injections to minimize injection site reaction in an individual.
As used herein, the term "dosage unit" refers to a form in which a pharmaceutical agent is provided. In certain embodiments, a dosage unit is a vial comprising lyophilized antisense oligonucleotide. In certain embodiments, a dosage unit is a vial comprising reconstituted antisense oligonucleotide.
As used herein, the term "pharmaceutical agent" refers to a substance provides a therapeutic benefit when administered to an individual. For example, in certain embodiments, an antisense oligonucleotide is a pharmaceutical agent.
As used herein, the term "active pharmaceutical ingredient" refers to the substance in a pharmaceutical composition that provides a desired effect.
As used herein, the term "therapeutically effective amount" refers to an amount of a pharmaceutical agent that provides a therapeutic benefit to an individual. In certain embodiments, a therapeutically effective amount of an antisense compound is the amount that needs to be administered to result in an observable benefit.
As used herein, the term "hypercholesterolemia" refers to a condition characterized by elevated serum cholesterol.
As used herein, the term "hyperlipidemia" refers to a condition characterized by elevated serum lipids.
As used herein, the term "hypertriglyceridemia" refers to a condition characterized by elevated triglyceride levels.
As used herein, the term "non-familial hypercholesterolemia" refers to a condition characterized by elevated cholesterol that is not the result of a single inherited gene mutation.
As used herein, the term "polygenic hypercholesterolemia" refers to a condition characterized by elevated cholesterol that results from the influence of a variety of genetic factors. In certain embodiments, polygenic hypercholesterolemia may be exacerbated by dietary intake of lipids.
-13-As used herein, the term "familial hypercholesterolemia (FH)" refers to an autosomal dominant metabolic disorder characterized by a mutation in the LDL-receptor (LDL-R) gene, markedly elevated LDL-C and premature onset of atherosclerosis. A diagnosis of familial hypercholesterolemia is made when a individual meets one or more of the following criteria: genetic testing confirming 2 mutated LDL-receptor genes; genetic testing confirming one mutated LDL-receptor gene;
document history of untreated serum LDL-cholesterol greater than 500 mg/dL; tendinous and/or cutaneous xanthoma prior to age 10 years; or, both parents have documented elevated serum LDL-cholesterol prior to lipid-lowering therapy consistent with heterozygous familial hypercholesterolemia.
As used herein, the term "homozygous familial hypercholesterolemia" or "HoFH"
refers to a condition characterized by a mutation in both maternal and paternal LDL-R
genes.
As used herein, the term "heterozygous familial hypercholesterolemia" or "HeFH" refers to a condition characterized by a mutation in either the maternal or paternal LDL-R
gene.
As used herein, the term "mixed dyslipidemia" refers to a condition characterized by elevated serum cholesterol and elevated serum triglycerides.
As used herein, the term "diabetic dyslipidemia" or "Type II diabetes with dyslipidemia" refers to a condition characterized by Type II diabetes, reduced HDL-C, elevated serum triglycerides, and elevated small, dense LDL particles.
As used herein, the term "CHD risk equivalents," refers to indicators of clinical atherosclerotic disease that confer a high risk for coronary heart disease. For example, in certain embodiments, CHD risk equivalents include, without limitation, clinical coronary heart disease, symptomatic carotid artery disease, peripheral arterial disease, and/or abdominal aortic aneurysm.
As used herein, the term "non-alcoholic fatty liver disease (NAFLD)" refers to a condition characterized by fatty inflammation of the liver that is not due to excessive alcohol use (for example, alcohol consumption of over 20 g/day). In certain embodiments, NAFLD is related to insulin resistance and the metabolic syndrome.
As used herein, the term "non-alcoholic steatohepatitis (NASH)" refers to a condition characterized by inflammation and the accumulation of fat and fibrous tissue in the liver, that is not due to excessive alcohol use. NASH is an extreme fonm of NAFLD.
As used herein, the term "major risk factors" refers to factors that contribute to a high risk for a particular disease or condition. In certain embodiments, major risk factors for coronary heart disease include, without limitation, cigarette smoking, hypertension, low HDL-C, family history of coronary heart disease, and age.
As used herein, the term "CHD risk factors" refers to CHD risk equivalents and major risk factors.
As used herein, the term "coronary heart disease (CHD)" refers to a narrowing of the small blood vessels that supply blood and oxygen to the heart, which is often a result of atherosclerosis.
As used herein, the term "reduced coronary heart disease risk" refers to a reduction in the
-14-likelihood that a individual will develop coronary heart disease. In certain embodiments, a reduction in coronary heart disease risk is measured by an improvement in one or more CHD
risk factors, for example, a decrease in LDL-C levels.
As used herein, the term "atherosclerosis" refers to a hardening of the arteries affecting large and medium-sized arteries and is characterized by the presence of fatty deposits. The fatty deposits are called "atheromas" or "plaques," which consist mainly of cholesterol and other fats, calcium and scar tissue, and damage the lining of arteries.
As used herein, the term "history of coronary heart disease" refers to the occurrence of clinically evident coronary heart disease in the medical history of a individual or a individual's family member.
As used herein, the term "Early onset coronary heart disease" refers to a diagnosis of coronary heart disease prior to age 50.
As used herein, the term "statin intolerant individual" refers to a individual who as a result of statin therapy experiences one or more of creatine kinase increases, liver function test abnormalities, muscle aches, or central nervous system side effects.
As used herein, the term "efficacy" refers to the ability to produce a desired effect. For example, efficacy of a lipid-lowering therapy may be reduction in the concentration of one or more of LDL-C, VLDL-C, IDL-C, non-HDL-C, ApoB, lipoprotein(a), or triglycerides.
As used herein, the term "acceptable safety profile" refers to a pattern of side effects that is within clinically acceptable limits.
As used herein, the term "side effects" refers to physiological responses attributable to a treatment other than desired effects. In certain embodiments, side effects include, without limitation, injection site reactions, liver function test abnormalities, renal function abnormalities, liver toxicity, renal toxicity, central nervous system abnormalities, and myopathies. For example, increased aminotransferase levels in serum may indicate liver toxicity or liver function abnormality. For example, increased bilirubin may indicate liver toxicity or liver function abnormality.
As used herein, the term "injection site reaction" refers to inflammation or abnormal redness of skin at a site of injection in an individual.
As used herein, the term "individual compliance" refers to adherence to a reconnnended or prescribed therapy by an individual.
As used herein, the term "lipid-lowering therapy" refers to a therapeutic regimen provided to a individual to reduce one or more lipids in a individual. In certain embodiments, a lipid-lowering therapy is provide to reduce one or more of ApoB, total cholesterol, LDL-C, VLDL-C, IDL-C, non-HDL-C, triglycerides, small dense LDL particles, and Lp(a) in an individual.
As used herein, the term "lipid-lowering agent" refers to a pharmaceutical agent provided to a individual to achieve a lowering of lipids in the individual. For example, in certain embodiments, a lipid-lowering agent is provided to an individual to reduce one or more of ApoB, LDL-C, total cholesterol, and triglycerides.
-15-As used herein, the term "LDL-C target" refers to an LDL-C level that is desired following lipid-lowering therapy.
As used herein, the term "comply" refers to the adherence with a recommended therapy by an individual.
As used herein, the term "recommended therapy" refers to a therapeutic regimen recommended by a medical professional for the treatment, amelioration, or prevention of a disease.
As used herein, the term "low LDL-receptor activity" refers to LDL-receptor activity that is not sufficiently high to maintain clinically acceptable levels of LDL-C in the bloodstream.
As used herein, the term "cardiovascular outcome" refers to the occurrence of major adverse cardiovascular events.
As used herein, the term "improved cardiovascular outcome" refers to a reduction in the occurrence of major adverse cardiovascular events, or the risk thereof.
Examples of major adverse cardiovascular events include, without limitation, death, reinfarction, stroke, cardiogenic shock, pulmonary edema, cardiac arrest, and atrial dysrhythmia.
As used herein, the term "surrogate markers of cardiovascular outcome" refers to indirect indicators of cardiovascular events, or the risk thereof. For example, surrogate markers of cardiovascular outcome include carotid intimal media thickness (CIMT). Another example of a surrogate marker of cardiovascular outcome includes atheroma size. Atheroma size may be determined by intravascular ultrasound (IVUS).
As used herein, the term "increased HDL-C" refers to an increase in serum HDL-C in an individual over time.
As used herein, the term "lipid-lowering" refers to a reduction in one or more serum lipids in an individual over time.
As used herein, the term "metabolic disorder" refers to a condition characterized by an alteration or disturbance in metabolic function. "Metabolic" and "metabolism" are terms well know in the art and generally include the whole range of biochemical processes that occur within a living organism.
Metabolic disorders include, but are not limited to, hyperglycemia, prediabetes, diabetes (type I and type II), obesity, insulin resistance and metabolic syndrome.
As used herein, the term "metabolic syndrome" refers to a clustering of lipid and non-lipid cardiovascular risk factors of metabolic origin. It has been closely linked to the generalized metabolic disorder known as insulin resistance. The National Cholesterol Education Program (NCEP) Adult Treatment Panel III (ATPIII) established criteria for diagnosis of metabolic syndrome when three or more of five risk determinants are present. The five risk determinants are abdominal obesity defined as waist circumference of greater than 102 cm for men or greater than 88cm for women, triglyceride levels greater than or equal to 150 mg/dL, HDL cholesterol levels of less than 40 mg/dL for men and less than 50 mg/dL for women, blood pressure greater than or equal to 130/85 mm Hg and fasting glucose levels greater than or equal to 110 mg/dL. These determinants can be readily measured in clinical practice
-16-(JAMA, 2001, 285: 2486-2497).
The term "alkyl," as used herein, refers to a saturated straight or branched hydrocarbon radical containing up to twenty four carbon atoms. Examples of alkyl groups include, but are not limited to, methyl, ethyl, propyl, butyl, isopropyl, n-hexyl, octyl, decyl, dodecyl and the like. Alkyl groups typically include from 1 to about 24 carbon atoms, more typically from 1 to about 12 carbon atoms (Cl-Ci2 alkyl) with from 1 to about 6 carbon atoms being more preferred. The term "lower alkyl" as used herein includes from 1 to about 6 carbon atoms. Alkyl groups as used herein may optionally include one or more further substituent groups.
The term "alkenyl," as used herein, refers to a straight or branched hydrocarbon chain radical containing up to twenty four carbon atoms and having at least one carbon-carbon double bond.
Examples of alkenyl groups include, but are not limited to, ethenyl, propenyl, butenyl, 1-methyl-2-buten-1-yl, dienes such as 1,3-butadiene and the like. Alkenyl groups typically include from 2 to about 24 carbon atoms, more typically from 2 to about 12 carbon atoms with from 2 to about 6 carbon atoms being more preferred. Alkenyl groups as used herein may optionally include one or more further substituent groups.
The term "alkynyl," as used herein, refers to a straight or branched hydrocarbon radical containing up to twenty four carbon atoms and having at least one carbon-carbon triple bond. Examples of alkynyl groups include, but are not limited to, ethynyl, 1-propynyl, 1-butynyl, and the like. Alkynyl groups typically include from 2 to about 24 carbon atoms, more typically from 2 to about 12 carbon atoms with from 2 to about 6 carbon atoms being more preferred. Alkynyl groups as used herein may optionally include one or more further substitutent groups.
The term "aminoalkyl" as used herein, refers to an amino substituted alkyl radical. This term is meant to include CI-CIZ alkyl groups having an amino substituent at any position and wherein the alkyl group attaches the aminoalkyl group to the parent molecule. The alkyl and/or amino portions of the aminoalkyl group can be further substituted with substituent groups.
The term "aliphatic," as used herein, refers to a straight or branched hydrocarbon radical containing up to twenty four carbon atoms wherein the saturation between any two carbon atoms is a single, double or triple bond. An aliphatic group preferably contains from I
to about 24 carbon atoms, more typically from 1 to about 12 carbon atoms with from 1 to about 6 carbon atoms being more preferred. The straight or branched chain of an aliphatic group may be interrupted with one or more heteroatoms that include nitrogen, oxygen, sulfur and phosphorus. Such aliphatic groups interrupted by heteroatoms include without limitation polyalkoxys, such as polyalkylene glycols, polyamines, and polyimines. Aliphatic groups as used herein may optionally include further substitutent groups.
The term "alicyclic" or "alicyclyl" refers to a cyclic ring system wherein the ring is aliphatic.
The ring system can comprise one or more rings wherein at least one ring is aliphatic. Preferred alicyclics include rings having from about 5 to about 9 carbon atoms in the ring. Alicyclic as used herein may optionally include fiirther substitutent groups.
-17-The term "alkoxy," as used herein, refers to a radical formed between an alkyl group and an oxygen atom wherein the oxygen atom is used to attach the alkoxy group to a parent molecule.
Examples of alkoxy groups include, but are not limited to, methoxy, ethoxy, propoxy, isopropoxy, n-butoxy, sec-butoxy, tert-butoxy, n-pentoxy, neopentoxy, n-hexoxy and the like.
Alkoxy groups as used herein may optionally include further substitutent groups.
The terms "halo" and "halogen," as used herein, refer to an atom selected from fluorine, chlorine, bromine and iodine.
The terms "aryl" and "aromatic," as used herein, refer to a mono- or polycyclic carbocyclic ring system radicals having one or more aromatic rings. Examples of aryl groups include, but are not limited to, phenyl, naphthyl, tetrahydronaphthyl, indanyl, idenyl and the like.
Preferred aryl ring systems have from about 5 to about 20 carbon atoms in one or more rings. Aryl groups as used herein may optionally include further substitutent groups.
The terms "aralkyl" and "arylalkyl," as used herein, refer to a radical formed between an alkyl group and an aryl group wherein the alkyl group is used to attach the aralkyl group to a parent molecule.
Examples include, but are not limited to, benzyl, phenethyl and the like.
Aralkyl groups as used herein may optionally include further substitutent groups attached to the alkyl, the aryl or both groups that form the radical group.
The term "heterocyclic radical" as used herein, refers to a radical mono-, or poly-cyclic ring system that includes at least one heteroatom and is unsaturated, partially saturated or fully saturated, thereby including heteroaryl groups. Heterocyclic is also meant to include fused ring systems wherein one or more of the fused rings contain at least one heteroatom and the other rings can contain one or more heteroatoms or optionally contain no heteroatoms. A heterocyclic group typically includes at least one atom selected from sulfur, nitrogen or oxygen. Examples of heterocyclic groups include, [1,3]dioxolane, pyrrolidinyl, pyrazolinyl, pyrazolidinyl, imidazolinyl, imidazolidinyl, piperidinyl, piperazinyl, oxazolidinyl, isoxazolidinyl, morpholinyl, thiazolidinyl, isothiazolidinyl, quinoxalinyl, pyridazinonyl, tetrahydrofuryl and the like. Heterocyclic groups as used herein may optionally include further substitutent groups.
The terms "heteroaryl," and "heteroaromatic," as used herein, refer to a radical comprising a mono- or poly-cyclic aromatic ring, ring system or fused ring system wherein at least one of the rings is aromatic and includes one or more heteroatom. Heteroaryl is also meant to include fused ring systems including systems where one or more of the fused rings contain no heteroatoms.
Heteroaryl groups typically include one ring atom selected from sulfur, nitrogen or oxygen.
Examples of heteroaryl groups include, but are not limited to, pyridinyl, pyrazinyl, pyrimidinyl, pyrrolyl, pyrazolyl, imidazolyl, thiazolyl, oxazolyl, isooxazolyl, thiadiazolyl, oxadiazolyl, thiophenyl, furanyl, quinolinyl, isoquinolinyl, benzimidazolyl, benzooxazolyl, quinoxalinyl, and the like. Heteroaryl radicals can be attached to a parent molecule directly or through a linking moiety such as an aliphatic group or hetero atom.
Heteroaryl groups as used herein may optionally include further substitutent groups.
-18-The term "heteroarylalkyl," as used herein, refers to a heteroaryl group as previously defined having an alky radical that can attach the heteroarylalkyl group to a parent molecule. Examples include, but are not limited to, pyridinylmethyl, pyrimidinylethyl, napthyridinylpropyl and the like.
Heteroarylalkyl groups as used herein may optionally include further substitutent groups on one or both of the heteroaryl or alkyl portions.
The term "mono or poly cyclic structure" as used in the present invention includes all ring systems that are single or polycyclic having rings that are fused or linked and is meant to be inclusive of single and mixed ring systems individually selected from aliphatic, alicyclic, aryl, heteroaryl, aralkyl, arylalkyl, heterocyclic, heteroaryl, heteroaromatic, heteroarylalkyl. Such mono and poly cyclic structures can contain rings that are uniform or have varying degrees of saturation including fully saturated, partially saturated or fully unsaturated. Each ring can comprise ring atoms selected from C, N, 0 and S to give rise to heterocyclic rings as well as rings comprising only C
ring atoms which can be present in a mixed motif such as for example benzimidazole wherein one ring has only carbon ring atoms and the fused ring has two nitrogen atoms. The mono or poly cyclic structures can be further substituted with substituent groups such as for example phthalimide which has two =0 groups attached to one of the rings. In another aspect, mono or poly cyclic structures can be attached to a parent molecule directly through a ring atom, through a substituent group or a bifunctional linking moiety.
The term "acyl," as used herein, refers to a radical formed by removal of a hydroxyl group from an organic acid an d has the general formula -C(O)-X where X is typically aliphatic, alicyclic or aromatic.
Examples include aliphatic carbonyls, aromatic carbonyls, aliphatic sulfonyls, aromatic sulfinyls, aliphatic sulfinyls, aromatic phosphates, aliphatic phosphates and the like.
Acyl groups as used herein may optionally include further substitutent groups.
The term "hydrocarbyl includes groups comprising C, 0 and H. Included are straight, branched and cyclic groups having any degree of saturation. Such hydrocarbyl groups can include one or more heteroatoms selected from N, 0 and S and can be further mono or poly substituted with one or more substituent groups.
The terms "substituent" and "substituent group," as used herein, include groups that are typically added to other groups or parent compounds to enhance desired properties or give desired effects.
Substituent groups can be protected or unprotected and can be added to one available site or to many available sites in a parent compound. Substituent groups may also be further substituted with other substituent groups and may be attached directly or via a linking group such as an alkyl or hydrocarbyl group to a parent compound. Such groups include without limitation, halogen, hydroxyl, alkyl, alkenyl, alkynyl, acyl (-C(O)Raa), carboxyl (-C(O)O-Raa), aliphatic groups, alicyclic groups, alkoxy, substituted oxo (-O-Raa), aryl, aralkyl, heterocyclic, heteroaryl, heteroarylalkyl, amino (-NRbbRc,,), imino(=NRbb), amido (-C(O)NRbbRccor -N(Rbb)C(O)Raa), azido (-N3), nitro (-NO2), cyano (-CN), carbamido (-OC(O)NRbbRcc or -N(Rbb)C(O)ORaa), ureido (-N(Rbb)C(O)NRbbRcc), thioureido (-N(Rbb)C(S)NRbbRcJ, guanidinyl (-N(Rbb)C(=NRbb)NRbbRj, amldmyl (-C(-NRbb)NRbb&c or -N(Rbb)C(NRbb)Raa), thiol (-SRbb),
-19-sulfinyl (-S(O)Rbb), sulfonyl (-S(O)ZRbb), sulfonamidyl (-S(O)ZNRbb&,, or -N(Rbb)S(O)2Rbb) and conjugate groups. Wherein each Raa, Rbb and &,, is, independently, H, an optionally linked chemical functional group or a further substituent group with a preferred list including without limitation H, alkyl, alkenyl, alkynyl, aliphatic, alkoxy, acyl, aryl, aralkyl, heteroaryl, alicyclic, heterocyclic and heteroarylalkyl.
B. Certain Oligomeric Compounds In certain embodiments, it is desirable to chemically modify oligomeric compounds, compared to naturally occuring oligomers, such as DNA or RNA. Certain such modifications alter the activity of the oligomeric compound. Certain such chemical modifications can alter activity by, for example:
increasing affinity of an antisense compound for its target nucleic acid, increasing its resistance to one or more nucleases, and/or altering the pharmacokinetics or tissue distribution of the oligomeric compound.
In certain instances, the use of chemistries that increase the affmity of an oligomeric compound for its target can allow for the use of shorter oligomeric compounds.
1. Certain monomers In certain embodiment, oligomeric compounds comprise one or more modified monomer. In certain such embodiments, oligomeric compounds comprise one or more high affinity monomer. In certain embodiments, such high-affinity monomer is selected from monomers (e.g., nucleosides and nucleotides) comprising 2'-modifed sugars, including, but not limited to:
BNA's and monomers (e.g., nucleosides and nucleotides) with 2'- substituents such as allyl, amino, azido, thio, 0-allyl, O-CI-CIo alkyl, -OCF3, O-(CH2)2-O-CH3, 2'-O(CH2)2SCH3, O-(CH2)2-O-N(R.õ)(Rõ), or O-CH2-C(=O)-N(R,õ)(Rõ), where each R. and Rn is, independently, H or substituted or unsubstituted Ci-Clo alkyl.
In certain embodiments, the oligomeric compounds including, but no limited to short antisense compounds of the present invention, comprise one or more high affinity monomers provided that the oligomeric compound does not comprise a nucleotide comprising a 2'-O(CHZ)õH, wherein n is one to six.
In certain embodiments, the oligomeric compounds including, but no limited to short antisense compounds of the present invention, comprise one or more high affinity monomer provided that the oligomeric compound does not comprise a nucleotide comprising a 2'-OCH3 or a 2'-O(CHZ)20CH3.
In certain embodiments, the oligomeric compounds including, but no limited to short antisense compounds of the present invention, comprise one or more high affinity monomer provided that the oligomeric compound does not comprise a a-L-Methyleneoxy (4'-CH2-O-2') BNA.
In certain embodiments, the oligomeric compounds including, but no limited to short antisense compounds of the present invention, comprise one or more high affinity monomer provided that the oligomeric compound does not comprise a(3-D-Methyleneoxy (4'-CH2-O-2') BNA.
In certain embodiments, the oligomeric compounds including, but no limited to short antisense compounds of the present invention, comprise one or more high affinity monomer provided that the oligomeric compound does not comprise a a-L-Methyleneoxy (4'-CHZ-O-2') BNA or a(3-D-Methyleneoxy (4'-CHZ-O-2') BNA.
-20-a. Certain Nucleobases The naturally occurring base portion of a nucleoside is typically a heterocyclic base. The two most common classes of such heterocyclic bases are the purines and the pyrimidines. For those nucleosides that include a pentofuranosyl sugar, a phosphate group can be linked to the 2', 3' or 5' hydroxyl moiety of the sugar. In forming oligonucleotides, those phosphate groups covalently link adjacent nucleosides to one another to form a linear polymeric compound.
Within oligonucleotides, the phosphate groups are commonly referred to as forming the internucleotide backbone of the oligonucleotide. The naturally occurring linkage or backbone of RNA and of DNA
is a 3' to 5' phosphodiester linkage.
In addition to "unmodified" or "natural" nucleobases such as the purine nucleobases adenine (A) and guanine (G), and the pyrimidine nucleobases thymine (T), cytosine (C) and uracil (U), many modified nucleobases or nucleobase mimetics known to those skilled in the art are amenable with the compounds described herein. In certain embodiments, a modified nucleobase is a nucleobase that is fairly similar in structure to the parent nucleobase, such as for example a 7-deaza purine, a 5-methyl cytosine, or a G-clamp. In certain embodiments, nucleobase mimetic include more complicated structures, such as for example a tricyclic phenoxazine nucleobase mimetic.
Methods for preparation of the above noted modified nucleobases are well known to those skilled in the art.
b. Certain sugars Oligomeric compounds provided herein may comprise one or more monomer, including a nucleoside or nucleotide, having a modified sugar moiety. For example, the furanosyl sugar ring of a nucleoside can be modified in a number of ways including, but not limited to, addition of a substituent group, bridging of two non-geminal ring atoms to form a bicyclic nucleic acid (BNA).
In certain embodiments, oligomeric compounds comprise one or more monomers that is a BNA. In certain such embodiments, BNA s include, but are not limited to, (A) a-L-Methyleneoxy (4'-CHZ-O-2') BNA, (B) (3-D-Methyleneoxy (4'-CH2-O-2') BNA, (C) Ethyleneoxy (4'-(CH2)2-O-2') BNA, (D) Aminooxy (4'-CHZ-O-N(R)-2') BNA and (E) Oxyamino (4'-CH2-N(R)-0-2') BNA, as depicted in Figure 1.

0 Bx O Bx 0 Bx O,i Bx O Bx N-, ~ O
~O ~` -N R wh, -O ", (A) (B) ~ (C) (D) (E) Figure 1. Certain BNA Structures In certain embodimnents, BNA compounds include, but are not limited to, compounds having at least one bridge between the 4' and the 2' position of the sugar wherein each of the bridges independently
-21-comprises 1 or from 2 to 4 linked groups independently selected from -[C(Ri)(R2)]õ-, -C(Ri)=C(RZ)-, -C(Ri)=N-, -C(=NRi)-, -C(=0)-, -C(=S)-, -0-, -Si(Rj)2-, -S(=O),,- and -N(Rj)-;
wherein:
x is 0, 1, or 2;
n is 1, 2, 3, or 4;
each R, and R2 is, independently, H, a protecting group, hydroxyl, Ci-C12 alkyl, substituted Cl-CiZ alkyl, C2-C12 alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, C5-C20 aryl, substituted C5-CZO aryl, heterocycle radical, substituted heterocycle radical, heteroaryl, substituted heteroaryl, C5-C7 alicyclic radical, substituted CS-C7 alicyclic radical, halogen, OJI, NJIJ2, SJI, N3, COOJi, acyl (C(=O)-H), substituted acyl, CN, sulfonyl (S(=O)2-Ji), or sulfoxyl (S(=O)-Ji); and each J, and J2 is, independently, H, Cl-C1z alkyl, substituted CI-C12 alkyl, C2-C12 alkenyl, substituted C2-C12 alkenyl, C2-Ci2 alkynyl, substituted C2-C12 alkynyl, C5-C20 aryl, substituted C5-C20 aryl, acyl (C(=O)-H), substituted acyl, a heterocycle radical, a substituted heterocycle radical, Ci-C12 aminoalkyl, substituted Cl-C1Z aniinoalkyl or a protecting group.
In one embodiment, each of the bridges of the BNA compounds is, independently, -[C(Rl)(R2)]n-,-[C(Rj)(R2)]o O-, -C(R1R2)-N(Ri)-O- or -C(RiRz)-O-N(Ri)-. In another embodiment, each of said bridges is, independently, 4'-CH2-2', 4'-(CH2)2-2', 4'-(CH2)3-2', 4'-CH2-O-2', 4'-(CH2)2-0-2', 4'-CH2-O-N(Ri)-2' and 4'-CH2-N(R,)-0-2'- wherein each Ri is, independently, H, a protecting group or Ci-C12 alkyl.
Certain BNA's have been prepared and disclosed in the patent literature as well as in scientific literature (Singh et al., Chem. Commun., 1998, 4, 455-456; Koshkin et al., Tetrahedron, 1998, 54, 3607-3630; Wahlestedt et al., Proc. Natl. Acad. Sci. U. S. A., 2000, 97, 5633-5638;
Kumar et al., Bioorg.
Med. Chem. Lett., 1998, 8, 2219-2222; WO 94/14226; WO 2005/021570; Singh et al., J. Org. Chem., 1998, 63, 10035-10039; Examples of issued US patents and published applications that disclose BNA s include, for example, U.S. Patent Nos. 7,053,207; 6,268,490; 6,770,748;
6,794,499; 7,034,133; and 6,525,191; and U.S. Pre-Grant Publication Nos. 2004-0171570; 2004-0219565;
2004-0014959; 2003-0207841; 2004-0143114; and 20030082807.
Also provided herein are BNAs in which the 2'-hydroxyl group of the ribosyl sugar ring is linked to the 4' carbon atom of the sugar ring thereby forming a methyleneoxy (4'-CHZ-O-2') linkage to form the bicyclic sugar moiety (reviewed in Elayadi et al., Curr. Opinion Invens. Drugs, 2001, 2, 558-561; Braasch et al., Chem. Biol., 2001, 8 1-7; and Orum et al., Curr. Opinion Mol. Ther., 2001, 3, 239-243; see also U.S. Patents: 6,268,490 and 6,670,461). The linkage can be a methylene (-CH2-) group bridging the 2' oxygen atom and the 4' carbon atom, for which the term methyleneoxy (4'-CH2-O-2') BNA is used for the bicyclic moiety; in the case of an ethylene group in this position, the term ethyleneoxy (4'-CH2CH2-O-2') BNA is used (Singh et al., Chem. Commun., 1998, 4, 455-456: Morita et al., Bioorganic Medicinal Chemistry, 2003, 11, 2211-2226). Methyleneoxy (4'-CHZ-O-2') BNA and other bicyclic sugar analogs display very high duplex thermal stabilities with complementary DNA and
-22-RNA (Tm =+3 to +10 C), stability towards 3'-exonucleolytic degradation and good solubility properties.
Potent and nontoxic antisense oligonucleotides compriseing BNAs have been described (Wahlestedt et al., Proc. Natl. Acad. Sci. U. S. A., 2000, 97, 5633-5638).
An isomer of methyleneoxy (4'-CH2-O-2') BNA that has also been discussed is alpha-L-methyleneoxy (4'-CHZ-O-2') BNA which has been shown to have superior stability against a 3'-exonuclease. The alpha-L- methyleneoxy (4'-CH2-O-2') BNA's were incorporated into antisense gapmers and chimeras that showed potent antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372).
The synthesis and preparation of the methyleneoxy (4'-CHZ-O-2') BNA monomers adenine, cytosine, guanine, 5-methyl-cytosine, thymine and uracil, along with their oligomerization, and nucleic acid recognition properties have been described (Koshkin et al., Tetrahedron, 1998, 54, 3607-3630).
BNAs and preparation thereof are also described in WO 98/39352 and WO
99/14226.
Analogs of methyleneoxy (4'-CH2-O-2') BNA, phosphorothioate- methyleneoxy (4'-CHZ-O-2') BNA and 2'-thio-BNAs, have also been prepared (Kumar et al., Bioorg. Med.
Chem. Lett., 1998, 8, 2219-2222). Preparation of locked nucleoside analogs compriseing oligodeoxyribonucleotide duplexes as substrates for nucleic acid polymerases has also been described (Wengel et al., WO 99/14226 ).
Furthermore, synthesis of 2'-amino-BNA, a novel comfonmationally restricted high-affinity oligonucleotide analog has been described in the art (Singh et al., J. Org.
Chem., 1998, 63, 10035-10039). In addition, 2'-Amino- and 2'-methylamino-BNA's have been prepared and the thermal stability of their duplexes with complementary RNA and DNA strands has been previously reported.
Modified sugar moieties are well known and can be used to alter, typically increase, the affinity of the antisense compound for its target and/or increase nuclease resistance.
A representative list of preferred modified sugars includes but is not limited to bicyclic modified sugars (BNA's), including methyleneoxy (4'-CH2-O-2') BNA and ethyleneoxy (4'-(CH2)Z-O-2' bridge) BNA ;
substituted sugars, especially 2'-substituted sugars having a 2'-F, 2'-OCH3 or a 2'-O(CH2)2-OCH3 substituent group; and 4'-thio modified sugars. Sugars can also be replaced with sugar mimetic groups among others. Methods for the preparations of modified sugars are well known to those skilled in the art. Some representative patents and publications that teach the preparation of such modified sugars include, but are not limited to, U.S. Patents: 4,981,957; 5,118,800; 5,319,080; 5,359,044; 5,393,878;
5,446,137; 5,466,786; 5,514,785;
5,519,134; 5,567,811; 5,576,427; 5,591,722; 5,597,909; 5,610,300; 5,627,053;
5,639,873; 5,646,265;
5,658,873; 5,670,633; 5,792,747; 5,700,920; 6,531,584; and 6,600,032; and WO
2005/121371.
In certain embodiments, BNA's include bicyclic nucleoside having the formula:
Ti O 1Q Bx Z p 0 i wherein:
-23-Bx is a heterocyclic base moiety;
Ti is H or a hydroxyl protecting group;
T2 is H, a hydroxyl protecting group or a reactive phosphorus group;
Z is C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, substituted C1-C6 alkyl, substituted C2-C6 alkenyl, substituted C2-C6 alkynyl, acyl, substituted acyl, or substituted amide.
In one embodiment, each of the substituted groups, is, independently, mono or poly substituted with optionally protected substituent groups independently selected from halogen, oxo, hydroxyl, OJI, NJIJ2, SJI, N3, OC(=X)JI, OC(=X)NJiJZ, NJ3C(=X)NJ,J2 and CN, wherein each JI, J2 and J3 is, independently, H or C1-C6 alkyl, and X is 0, S or NJI.
In certain such embodiments, each of the substituted groups, is, independently, mono or poly substituted with substituent groups independently selected from halogen, oxo, hydroxyl, OJi, NJiJ2, SJI, N3, OC(=X)Ji, and NJ3C(=X)NJIJ2, wherein each Ji, J2 and J3 is, independently, H, Ci-C6 alkyl, or substituted C1-C6 alkyl and X is 0 or NJi.
In certain embodiments, the Z group is C1-C6 alkyl substituted with one or more X", wherein each X' is independently OJi, NJIJz, SJI, N3, OC(=X)Jl, OC(=X)NJiJz, NJ3C(=X)NJ1J2 or CN; wherein each Ji, J2 and J3 is, independently, H or C1-C6 alkyl, and X is 0, S or NJ,. In another embodiment, the Z group is C1-C6 alkyl substituted with one or more X', wherein each X" is independently halo (e.g., fluoro), hydroxyl, alkoxy (e.g., CH30-), substituted alkoxy or azido.
In certain embodiments, the Z group is -CH2X', wherein X" is OJI, NJIJZ, SJI, N3, OC(=X)Ji, OC(=X)NJIJZ, NJ3C(=X)NJ1J2 or CN; wherein each JI, J2 and J3 is, independently, H or C1-C6 alkyl, and X is 0, S or NJi. In another embodiment, the Z group is -CH2X", wherein X" is halo (e.g., fluoro), hydroxyl, alkoxy (e.g., CH3O-) or azido.
In certain such embodiments, the Z group is in the (R)-configuration:
Ti O 0 Bx Z`
O

In certain such embodiments, the Z group is in the (S')-configuration:
TI-O Bx Z p` ~O

In certain embodiments, each Tl and T2 is a hydroxyl protecting group. A
preferred list of hydroxyl protecting groups includes benzyl, benzoyl, 2,6-dichlorobenzyl, t-butyldimethylsilyl, t-butyl-diphenylsilyl, mesylate, tosylate, dimethoxytrityl (DMT), 9-phenylxanthine-9-yl (Pixyl) and 9-(p-methoxyphenyl)xanthine-9-yl (MOX). In certain embodiments, T, is a hydroxyl protecting group selected from acetyl, benzyl, t-butyldimethylsilyl, t-butyldiphenylsilyl and dimethoxytrityl wherein a
-24-more preferred hydroxyl protecting group is T, is 4,4'-dimethoxytrityl.
In certain embodiments, T2 is a reactive phosphorus group wherein preferred reactive phosphorus groups include diisopropylcyanoethoxy phosphoramidite and H-phosphonate. In certain embodiments Ti is 4,4'-dimethoxytrityl and T2 is diisopropylcyanoethoxy phosphoramidite.
In certain embodiments, oligomeric compounds have at least one monomer of the formula:
"0 Bx or of the formula:
1-O ~O Bx Z
O
,1.
or of the formula:

T3-O A Bx wherein Bx is a heterocyclic base moiety;
T3 is H, a hydroxyl protecting group, a linked conjugate group or an internucleoside linking group attached to a nucleoside, a nucleotide, an oligonucleoside, an oligonucleotide, a monomeric subunit or an oligomeric compound;
T4 is H, a hydroxyl protecting group, a linked conjugate group or an internucleoside linking group attached to a nucleoside, a nucleotide, an oligonucleoside, an oligonucleotide, a monomeric subunit or an oligomeric compound;
wherein at least one of T3 and T4 is an internucleoside linking group attached to a nucleoside, a nucleotide, an oligonucleoside, an oligonucleotide, a monomeric subunit or an oligomeric compound; and Z is C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, substituted C1-C6 alkyl, substituted C2-C6 alkenyl, substituted C2-C6 alkynyl, acyl, substituted acyl, or substituted amide.
In one embodiment, each of the substituted groups, is, independently, mono or poly substituted with optionally protected substituent groups independently selected from halogen, oxo, hydroxyl, OJI, NJiJ2, SJI, N3, OC(=X)Jl, OC(=X)NJ1JZ, NJ3C(=X)NJ1J2 and CN, wherein each JI, J2 and J3 is, independently, H or Cl-C6 alkyl, and X is 0, S or NJi.
In one embodiment, each of the substituted groups, is, independently, mono or poly substituted with substituent groups independently selected from halogen, oxo, hydroxyl, OJI, NJ1JZ, SJI, N3,
-25-OC(=X)Ji, and NJ3C(=X)NJIJZ, wherein each JI, J2 and J3 is, independently, H
or C1-C6 alkyl, and X is 0 or NJi.
In certain such embodiments, at least one Z is C1-C6 alkyl or substituted Ci-C6 alkyl. In certain embodiments, each Z is, independently, C1-C6 alkyl or substituted Cl-C6 alkyl.
In certain embodiments, at least one Z is C1-C6 alkyl. In certain embodiments, each Z is, independently, Cl-C6 alkyl. In certain embodiments, at least one Z is methyl. In certain embodiments, each Z is methyl. In certain embodiments, at least one Z is ethyl. In certain embodiments, each Z is ethyl.
In certain embodiments, at least one Z is substituted C1-C6 alkyl. In certain embodiments, each Z is, independently, substituted Cl-C6 alkyl. In certain embodiments, at least one Z is substituted methyl. In certain embodiments, each Z is substituted methyl. In certain embodiments, at least one Z is substituted ethyl. In certain embodiments, each Z is substituted ethyl.
In certain embodiments, at least one substituent group is CI-C6 alkoxy (e.g., at least one Z is Cl-C6 alkyl substituted with one or more C1-C6 alkoxy). In another embodiment, each substituent group is, independently, C1-C6 alkoxy (e.g., each Z is, independently, C1-C6 alkyl substituted with one or more Cl-C6 alkoxy).
In certain embodiments, at least one Ci-C6 alkoxy substituent group is CH3O-(e.g., at least one Z
is CH3OCH2-). In another embodiment, each C1-C6 alkoxy substituent group is CH3O- (e.g., each Z is CH3OCH2-).
In certain embodiments, at least one substituent group is halogen (e.g., at least one Z is C1-C6 alkyl substituted with one or more halogen). In certain embodiments, each substituent group is, independently, halogen (e.g., each Z is, independently, C1-C6 alkyl substituted with one or more halogen).
In certain embodiments, at least one halogen substituent group is fluoro (e.g., at least one Z is CH2FCH2-, CHF2CH2- or CF3CH2-). In certain embodiments, each halo substituent group is fluoro (e.g., each Z is, independently, CH2FCH2-, CHF2CH2- or CF3CH2-).
In certain embodiments, at least one substituent group is hydroxyl (e.g., at least one Z is C1-C6 alkyl substituted with one or more hydroxyl). In certain embodiments, each substituent group is, independently, hydroxyl (e.g., each Z is, independently, C1-C6 alkyl substituted with one or more hydroxyl). In certain embodiments, at least one Z is HOCH2-. In another embodiment, each Z is HOCH2-.
In certain embodiments, at least one Z is CH3-, CH3CH2-, CH2OCH3-, CH2F- or HOCH2-. In certain embodiments, each Z is, independently, CH3-, CH3CH2-, CH2OCH3-, CHzF-or HOCHZ-.
In certain embodiments, at least one Z group is Q-C6 alkyl substituted with one or more X", wherein each X' is, independently, OJI, NJiJ2, SJI, N3, OC(=X)Ji, OC(=X)NJIJZ, NJ3C(=X)NJ1J2 or CN;
wherein each Jl, J2 and J3 is, independently, H or C1-C6 alkyl, and X is 0, S
or NJI. In another embodiment, at least one Z group is C1-C6 alkyl substituted with one or more X", wherein each X" is, independently, halo (e.g., fluoro), hydroxyl, alkoxy (e.g., CH3O-) or azido.
In certain embodiments, each Z group is, independently, C1-C6 alkyl substituted with one or more
-26-X", wherein each XX is independently OJI, NJIJz, SJI, N3, OC(=X)Jl, OC(=X)NJiJ2, NJ3C(=X)NJIJ2 or CN; wherein each Ji, J2 and J3 is, independently, H or C1-C6 alkyl, and X is 0, S or NJi. In another embodiment, each Z group is, independently, CI-C6 alkyl substituted with one or more X", wherein each X' is independently halo (e.g., fluoro), hydroxyl, alkoxy (e.g., CH3O-) or azido.
In certain embodiments, at least one Z group is -CH2X", wherein X' is OJI, NJ1J2, SJI, N3, OC(=X)Jl, OC(=X)NJIJZ, NJ3C(=X)NJIJZ or CN; wherein each Ji, J2 and J3 is, independently, H or C1-C6 alkyl, and X is 0, S or NJ, In certain embodiments, at least one Z group is -CH2X', wherein X' is halo (e.g., fluoro), hydroxyl, alkoxy (e.g., CH3O-) or azido.
In certain embodiments, each Z group is, independently, -CH2X', wherein each X" is, independently, OJi, NJiJ2i SJI, N3, OC(=X)JI, OC(=X)NJiJ2, NJ3C(=X)NJiJ2 or CN; wherein each JI, JZ
and J3 is, independently, H or C1-C6 alkyl, and X is 0, S or NJ,. In another embodiment, each Z group is, independently, -CH2X', wherein each X" is, independently, halo (e.g., fluoro), hydroxyl, alkoxy (e.g., CH3O-) or azido.
In certain embodiments, at least one Z is CH3-. In another embodiment, each Z
is, CH3-.
In certain embodiments, the Z group of at least one monomer is in the (R)-configuration represented by the fonnula:

,p Bx Z`

or the formula:
~-0 Bx or the formula:

p Bx T3-0 q-8 O
i In certain embodiments, the Z group of each monomer of the formula is in the (R)- configuration.

In certain embodiments, the Z group of at least one monomer is in the (S')-configuration represented by the formula:
-27-,.O Bx Z ~\0 or the formula:
1-O "0 Bx Z p`\O

or the formula:
T3-O Bx Z p \O

In certain embodiments, the Z group of each monomer of the formula is in the (S)- configuration.
In certain embodiments, T3 is H or a hydroxyl protecting group. In certain embodiments, T4 is H
or a hydroxyl protecting group. In a further embodiment T3 is an intemucleoside linking group attached to a nucleoside, a nucleotide or a monomeric subunit. In certain embodiments, T4 is an internucleoside linking group attached to a nucleoside, a nucleotide or a monomeric subunit.
In certain embodiments,T3 is an internucleoside linking group attached to an oligonucleoside or an oligonucleotide. In certain embodiments, T4 is an internucleoside linking group attached to an oligonucleoside or an oligonucleotide.
In certain embodiments, T3 is an internucleoside linking group attached to an oligomeric compound. In certain embodiments, T4 is an internucleoside linking group attached to an oligomeric compound. In In certain embodiments, at least one of T3 and T4 comprises an internucleoside linking group selected from phosphodiester or phosphorothioate.
In certain embodiments, oligomeric compounds have at least one region of at least two contiguous monomers of the formula:

~ .O Bx or of the formula:

~-O ,~0 Bx Z p~\O
or of the fornula:
-28-Ts-0 ,p Bx Z

to T4 In certain embodiments, the oligomeric compound comprises at least two regions of at least two contiguous monomers of the above formula. In certain embodiments, the oligomeric compound comprises a gapped oligomeric compound. In certain embodiments, the oligmeric compound comprises at least one region of from about 8 to about 14 contiguous (3-D-2'-deoxyribofuranosyl nucleosides. In certain embodiments, the oligomeric compound comprises at least one region of from about 9 to about 12 contiguous (3-D-2'-deoxyribofuranosyl nucleosides.
In certain embodiments, monmers include sugar mimetics. In certain such embodiments, a mimetic is used in place of the sugar or sugar-intemucleoside linkage combination, and the nucleobase is maintained for hybridization to a selected target. Representative examples of a sugar mimetics include, but are not limited to, cyclohexenyl or morpholino. Representative examples of a mimetic for a sugar-internucleoside linkage combination include, but are not limited to, peptide nucleic acids (PNA) and morpholino groups linked by uncharged achiral linkages. In some instances a mimetic is used in place of the nucleobase. Representative nucleobase mimetics are well known in the art and include, but are not limited to, tricyclic phenoxazine analogs and universal bases (Berger et al., Nuc Acid Res. 2000, 28:2911-14, incorporated herein by reference). Methods of synthesis of sugar, nucleoside and nucleobase mimetics are well known to those skilled in the art.

3. Monomeric Linkages Described herein are linking groups that link monomers (including, but not limited to, modified and unmodified nucleosides and nucleotides) together, thereby forming an oligomeric compound. The two main classes of linking groups are defined by the presence or absence of a phosphorus atom.
Representative phosphorus containing linkages include, but are not limited to, phosphodiesters (P=O), phosphotriesters, methylphosphonates, phosphoramidate, and phosphorothioates (P=S). Representative non-phosphorus containing linking groups include, but are not limited to, methylenemethylimino (-CH2-N(CH3)-O-CHZ-), thiodiester (-O-C(O)-S-), thionocarbamate (-O-C(O)(NH)-S-);
siloxane (-O-Si(H)2-0-); and N,N'-dimethylhydrazine (-CH2-N(CH3)-N(CH3)-). Oligomeric compounds having non-phosphorus linking groups are referred to as oligonucleosides. Modified linkages, compared to natural phosphodiester linkages, can be used to alter, typically increase, nuclease resistance of the oligomeric compound. In certain embodiments, linkages having a chiral atom can be prepared a racemic mixtures, as separate enantomers. Representative chiral linkages include, but are not limited to, alkylphosphonates and phosphorothioates. Methods of preparation of phosphorous-containing and non-phosphorous-containing linkages are well known to those skilled in the art.
The oligomeric compounds described herein contain one or more asymmetric centers and thus
-29-give rise to enantiomers, diastereomers, and other stereoisomeric configurations that may be defined, in terms of absolute stereochemistry, as (R) or (S), a or (3 such as for sugar anomers, or as (D) or (L) such as for amino acids et al. Included in the antisense compounds provided herein are all such possible isomers, as well as their racemic and optically pure forms.
4. Oligomeric Compounds In certain embodiments, provided herein are oligomeric compounds having reactive phosphorus groups useful for forming linkages including for example phosphodiester and phosphorothioate internucleoside linkages. Methods of preparation and/or purification of precursors or oligomeric compounds are not a limitation of the compositions or methods provided herein.
Methods for synthesis and purification of oligomeric compounds including DNA, RNA, oligonucleotides, oligonucleosides, and antisense compounds are well known to those skilled in the art.
Generally, oligomeric compounds comprise a plurality of monomeric subunits linked together by linking groups. Nonlimiting examples of oligomeric compounds include primers, probes, antisense compounds, antisense oligonucleotides, external guide sequence (EGS) oligonucleotides, alternate splicers, and siRNAs. As such, these compounds can be introduced in the form of single-stranded, double-stranded, circular, branched or hairpins and can contain structural elements such as internal or tenninal bulges or loops. Oligomeric double-stranded compounds can be two strands hybridized to form double-stranded compounds or a single strand with sufficient self complementarity to allow for hybridization and formation of a fully or partially double-stranded compound.
In certain embodiments, the present invention provides chimeric oligomeric compounds. In certain such embodiments, chimeric oligomeric compounds are chimeric oligonucleotides. In certain such embodiments, the chimeric oligonucleotides comprise differently modified nucleotides. In certain embodiments, chimeric oligonucleotides are mixed-backbone antisense oligonucleotides.
In general a chimeric oligomeric compound will have modified nucleosides that can be in isolated positions or grouped together in regions that will define a particular motif. Any combination of modifications and/or mimetic groups can comprise a chimeric oligomeric compound as described herein.
In certain embodiments, chimeric oligomeric compounds typically comprise at least one region modified so as to confer increased resistance to nuclease degradation, increased cellular uptake, and/or increased binding affinity for the target nucleic acid. In certain embodiments, an additional region of the oligomeric compound may serve as a substrate for enzymes capable of cleaving RNA:DNA or RNA:RNA hybrids. By way of example, RNase H is a cellular endonuclease that cleaves the RNA
strand of an RNA:DNA duplex. Activation of RNase H, therefore, results in cleavage of the RNA target, thereby greatly enhancing the efficiency of inhibition of gene expression.
Consequently, comparable results can often be obtained with shorter oligomeric compounds when chimeras are used, compared to for example phosphorothioate deoxyoligonucleotides hybridizing to the same target region. Cleavage of the RNA target can be routinely detected by gel electrophoresis and, if necessary, associated nucleic acid hybridization techniques known in the art.
-30-In certain embodiments, chimeric oligomeric compounds are gapmers. In certain embodiments, chimeric compounds are short antisense compounds. In certain embodiments, short antisense compounds are gapmers. In certain such embodiments, a mixed-backbone antisense oligomer has one type of internucleotide linkages in one or both wings and a different type of internucleotide linkages in the gap.
In certain such embodiments, the mixed-backbone antisense oligonucleotide has phosphodiester linkages in the wings and phosphorothioate linkages in the gap. In certain embodiments in which the internucleotide linkages in a wing is different from the internucleotide linkages in the gap, the internucleotide linkage bridging that wing and the gap is the same as the internucleotide linkage in the wing. In certain embodiments in which the internucleotide linkages in a wing is different from the internucleotide linkages in the gap, the internucleotide linkage bridging that wing and the gap is the same as the intemucleotide linkage in the gap.
C. Certain Short Antisense Compounds Disclosed herein are short antisense compounds 8 to 16, preferably 9 to 15, more preferably 9 to 14, more preferably 10 to 14 nucleotides in length. In certain embodiments, short antisense compounds are 9 to 14 nucleotides in length. In certain embodiments, short antisense compounds are 10 to 14 nucleotides in length. In certain embodiments, such short antisense compounds are short antisense oligonucleotides.
In certain embodiments, short antisense compounds comprise one or more chemical modifications. In certain such embodiments, short antisense compounds comprise at least one modified nucleotide. In certain embodiments short antisense compounds comprise at least two or more modified nucleotides. In certain embodiments, short antisense compounds comprise at least one modified intemucleotide linkage. In certain embodiments, short antisense compounds are mixed-backbone oligonucleotides. In certain embodiments, short antisense compounds are chimeric oligonucleotides. In certain embodiments, short antisense oligonucleotides are uniformly modified.
In certain embodiments, short antisense oligonucleotides comprise modifications independently selected at each nucleobase and at each linkage.
In certain embodiments, short antisense compounds are short gapmers. In certain such embodiments, short gapmers comprise at least one high affinity modification in one or more wings of the compound. In certain embodiments, short antisense compounds comprise 1 to 3 high-affinity modifications in each wing. In certain embodiments, high affinity modifications of the short antisense compounds allow for a target affinity similar to, or even greater than, the target affmity of longer antisense compounds. In certain embodiments, the high-affinity modified nucleotides are sugar modified nucleotides. Such sugar modified nucleotides include those comprising a bridge between the 4' and 2' position of the sugar. Exemplary high affinity sugar modifications include, but are not limited to, BNA s and other 2'-modifications such as 2'-MOE. In an alternate embodiment of the invention, the high affinity modification is not a 2'-O-(CH2)õH (n=1-6) sugar-modified nucleotide.
In an additional alternate embodiment, the high affinity modified nucleotide is not a 2'-OCH3 or a 2'-OCH2CH2OCH3 nucleotide.
-31-In certain embodiments, the high-affinity modified nucleotides confer a T. of at least 1, at least 1.5, at least 2, at least 2.5, at least 3.0, at least 3.5 or at least 4.0 degrees per nucleotide. Some high-affinity nucleotide modifications are known in the art to increase toxicity. As shown herein, short antisense compounds having a limited number (generally 2 to 6) of high affinity modifications exhibit little to no increase in toxicity but retain or increase affinity for the target RNA, while also significantly reducing expression of the RNA target. Short antisense compounds of the invention may optionally comprise a conjugate group, such as, for example, cholesterol or C16.

1. Certain Wings In certain embodiments, the short antisense compounds comprise a 5' wing and/or a 3' wing. In such embodiments, the features of the 3' wing and the features of the 5' wing are selected independently.
Thus, in such embodiments, the number of monomers in the 5' wing and the number of monomers (length) in the 3' wing may be the same or may be different; the modifications, if any, in the 5' wing may be the same as the modifications, if any, in the 3' wing or such modifications, if any, may be different;
and the monomeric linkages in the 5' wing and the monomeric linkages in the 3' wing may be the same or they may be different.
In certain embodiments a wing comprises one, two or three monomers (i.e. has a length of 1, 2, or 3). In certain embodiments, the monomers of a wing are modified. In certain such embodiments, the monomers of the wing are modified to increase affmity of the antisense compound for its target nucleic acid. In certain embodiments, the monomers of a wing are nucleosides or nucleotides. In certain such embodiments, the nucleosides or nucleotides of the wing comprise a 2' modification. In certain such embodiments, the monomers (nucleosides or nucleotides) of the wing are BNA's.
In certain such embodiments, the monomers of the wing are selected from a-L-Methyleneoxy (4'-CHZ-O-2') BNA,(3-D-Methyleneoxy (4'-CH2-O-2') BNA , Ethyleneoxy (4'-(CH2)2-0-2') BNA , Aminooxy (4'-CHZ-O-N(R)-2') BNA and Oxyamino (4'-CHZ-N(R)-0-2') BNA. In certain embodiments, the monomers of a wing comprise a substituent at the 2' position selected from allyl, amino, azido, thio, 0-allyl, O-Cl-CIo alkyl, -OCF3, O-(CH2)Z-O-CH3, 2'-O(CH2)2SCH3i 0-(CH2)2-0-N(Rm)(Rõ), and O-CH2-C(=0)-N(Rm)(Rn), where each R. and Rn is, independently, H or substituted or unsubstituted Cl-Cio alkyl. In certain embodiments, the monomers of a wing are 2'MOE nucleotides.
In certain embodiments, the monomeric linkages in a wing are naturally occurring internucleotide linkages. In certain embodiments, the monomeric linkages in a wing are non-naturally occurring intemucleotide or intemucleoside linkages. In certain such embodiments, the monomeric linkages in the wing are more resistant to one or more nucleases than naturally occurring internucleotide linkages. In certain such embodiments, the monomeric linkages in the wing are phosphorothioate linkages (P=S). In certain embodiments where a wing has more than one monomeric linkage, the monomeric linkages are the same as one another. In certain embodiments where a wing has more than one monomers linkage, the monomers linkages are different from each other.
-32-One of ordinary skill in the art will recognize that the features and modifications discussed above may be used in any combination to prepare a wing. The table below provides non-limiting examples showing how one might prepare a wing by selecting a certain number of monomers, monomeric modifications (if any), and monomeric linkages both within the wing.

Length Monomer type/ monomeric linkages within modifications wing 1 2' MOE None 1 BNA None 1 Methyleneoxy None BNA
1 ENA None 2 2'MOE P=S
2 BNA P=S
2 Methyleneoxy P=S
BNA
2 ENA P=S
2 2'MOE P=O
2 BNA P=O
2 Methyleneoxy P=O
BNA
2 ENA P=O
3 2'MOE P=S
3 BNA P=S
3 Methyleneoxy P=S
BNA
3 ENA P=S
3 2'MOE P=O
3 BNA P=O
3 Methyleneoxy P=O
BNA
3 ENA P=O

In certain embodiments in which a wing comprises two, three or four monomers, those two, three or four monomers all comprise the same modifications, if any. In certain embodiments in which a wing comprises two, three or four monomers, one or more of those two, three or four nucleobases comprises one or more modifications that is different from one or more of the modifications of one or more of the
-33-remaining monomers.
2. Certain Gans In certain embodiments, the short antisense compounds comprise a gap between the 5' wing and the 3' wing. In certain embodiments the gap comprises five, six, seven, eight, nine, ten, eleven, twelve, thirteen, or fourteen monomers. In certain embodiments, the monomers of the gap are unmodified deoxyribonucleotides. In certain embodiments, the monomers of the gap are unmodified ribonucleotides.
In certain embodiments, gap modifications (if any) gap result in an antisense compound that, when bound to its target nucleic acid, supports cleavage by an RNase, including, but not limited to, RNase H.
In certain embodiments, the monomeric linkages in the gap are naturally occurring internucleotide linkages. In certain embodiments, the monomeric linkages in the gap are non-naturally occurring linkages. In certain such embodiments, the monomeric linkages in the gap are more resistant to one or more nuclease than naturally occurring internucleotide linkages. In certain such embodiments, the monomeric linkages in the gap are phosphorothioate linkages (P=S). In certain embodiments, the monomeric linkages in the gap are all the same as one another. In certain embodiments, the monomeric linkages within the gap are not all the same.
One of ordinary skill in the art will recognize that the features and modifications discussed above may be used in any combination to prepare a gap. The table below provides non-limiting examples showing how one might prepare a gap by selecting a certain number of monomers, monomeric modifications (if any), and monomeric linkages within the gap region.

Length Monomer type/ Monomeric linkages within modifications gap 5 DNA P=S
6 DNA P=S
7 DNA P=S
8 DNA P=S
9 DNA P=S
10 DNA P=S
11 DNA P=S
12 DNA P=S
13 DNA P=S
14 DNA P=S
6 DNA P=O
7 DNA P=O
8 DNA P=O
9 DNA P=O
10 DNA P=O
-34-11 DNA P=O
12 DNA P=O
8 RNA P=S
9 RNA P=S
RNA P=S
11 RNA P=S
12 RNA P=S

3. Certain Gapped Antisense Oligomeric Compounds One of ordinary skill in the art will recognize that the wings and the gaps discussed above may be selected and then combined in a variety of combinations to generate gapped oligomeric compounds, 5 including, but not limited to, gapped antisense oligomeric compounds, and gapped antisense oligonucleotides. The features (length, modifications, linkages) of the 5' wing and the 3' wing may be selected independently of one another. The features of the gap include at least one difference in modification compared to the features of the 5' wing and at least one difference compared to the features of the 3' wing (i.e., there must be at least one difference in modification between neighboring regions to 10 distinguish those neighboring regions from one another). The features of the gap may otherwise be selected independently.
In certain embodiments, the monomeric linkages within a wing and the monomeric linkages within the gap are the same. In certain embodiments, the monomeric linkages within a wing and the monomeric linkages within the gap are different. In certain such embodiments, the monomeric linkage bridging the wing and the gap are the same as the monomeric linkages in the wing. In certain embodiments, the monomeric linkage bridging the wing and the gap are the same as the monomeric linkages in the gap. In certain embodiments, short antisense compounds have uniform linkages throughout the compound. In certain such embodiments, all of the linkages are phosphorothioate (P=S) linkages.
One of ordinary skill in the art will recognize that the 3' wings, 5' wings, gaps, and linkages discussed above may be used in any combination to prepare a gapmer. The table below provides non-limiting examples showing how one might prepare a gapmer by selecting a certain 5' wing, a gap, a 3' wing and certain linkages bridging the gap and each wing.

5' Wing 5'Bridge Gap 3' 3' Wing Bridge Length Monomer Link Link Length Monomer Link Link Length Monomer Link 2 MOE P=S P=S 6 DNA P=S P=S 2 MOE P=S
2 BNA P=S P=O 8 DNA P=O P=S 3 BNA P=S
1 MOE None P=S 10 DNA P=S P=S 1 MOE P=S
-35-2 MOE P=S P=S 8 RNA P=S P=S 2 MOE P=S
3 Methyleneoxy P=S P=S 8 RNA P=S P=S 3 MOE P=S
BNA
3 DNA P=O P=O 10 RNA P=S P=O 3 2'OH P=O
2 2-F P=S P=S 5 RNA P=S P=S 2 2'-F P=S
I MOE P=O P=S 5 DNA P=O P=S 4 MOE P=S
In certain embodiments, the oligomeric compounds disclosed herein may comprise from about 8 to about 16, preferably 9 to 15, more preferably 9 to 14, more preferably 10 to 14 monomers (i.e. from about 8 to about 16 linked monomers). One of ordinary skill in the art will appreciate that this comprehends antisense compounds of 8, 9, 10, 11, 12, 13, 14, 15 or 16 nucleobases. In certain embodiments, oligomeric compounds are antisense compounds.
In certain embodiments, short antisense compounds are 8 nucleobases in length.
In certain embodiments, short antisense compounds are 9 nucleobases in length.
In certain embodiments, short antisense compounds are 10 nucleobases in length.
In certain embodiments, short antisense compounds are 11 nucleobases in length.
In certain embodiments, short antisense compounds are 12 nucleobases in length.
In certain embodiments, short antisense compounds are 13 nucleobases in length.
In certain embodiments, short antisense compounds are 14 nucleobases in length.
In certain embodiments, short antisense compounds are 15 nucleobases in length.
In certain embodiments, short antisense compounds are 16 nucleobases in length.
In certain embodiments, short antisense compounds are 8 monomers in length. In certain embodiments, short antisense compounds are 9 monomers in length. In certain embodiments, short antisense compounds are 10 monomers in length. In certain embodiments, short antisense compounds are 11 monomers in length. In certain embodiments, short antisense compounds are monomers in length. In certain embodiments, short antisense compounds are 13 monomers in length. In certain embodiments, short antisense compounds are 14 monomers in length. In certain embodiments, short antisense compounds are 15 monomers in length. In certain embodiments, short antisense compounds are 16 monomers in length. In certain embodiments, short antisense compounds comprise 9 to 15 monomers. In certain embodiments, short antisense compounds comprise 10 to 15 monomers. In certain embodiments, short antisense compounds comprise 12 to 14 monomers. In certain embodiments, short antisense compounds comprise 12 to 14 nucleotides or nucleosides.
One having skill in the art and informed by the short antisense compounds illustrated herein will be able, without undue experimentation, to identify further short antisense compounds.
In certain embodiments, short antisense compounds comprise a gap flanked by more than one wing on either or both sides. Thus, in certain embodiments, a short antisense compound comprises two or more 5' wings and two or more 3' wings. In certain embodiments, a short antisense compound comprises
-36-one 5' wing and two or more 3' wings. In certain embodiments, a short antisense compound comprises one 3' wing and two or more 5' wings. Certain such embodiments comprise, for example, the following regions: a first 5' wing - a bridge - a second 5' wing - a bridge - a gap - a bridge - a second 3' wing -a bridge - a first 3'wing. In such embodiments, each region has at least one difference in modification when compared to its neighboring region. Thus, in such embodiments, the second 5' wing and the second 3' wing each independently comprises one or more differences in modification compared to the gap and compared to the first 5' wing and the first 3' wing. In such embodiments, the modifications of the first 3' wing and first 5' wing may either or both be the same or different from the modifications of the gap, if any.
4. Certain Conjugate Groups In one aspect, oligomeric compounds are modified by covalent attachment of one or more conjugate groups. In general, conjugate groups modify one or more properties of the attached oligomeric compound including but not limited to pharmacodynamic, pharmacokinetic, binding, absorption, cellular distribution, cellular uptake, charge and clearance. Conjugate groups are routinely used in the chemical arts and are linked directly or via an optional linking moiety or linking group to a parent compound such as an oligomeric compound. A preferred list of conjugate groups includes without limitation, intercalators, reporter molecules, polyamines, polyamides, polyethylene glycols, thioethers, polyethers, cholesterols, thiocholesterols, cholic acid moieties, folate, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluoresceins, rhodamines, coumarins and dyes.
Preferred conjugate groups amenable to the present invention include lipid moieties such as a cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553); cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4, 1053); a thioether, e.g., hexyl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660, 306; Manoharan et al., Bioorg. Med. Chem. Let., 1993, 3, 2765); a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533); an aliphatic chain, e.g., dodecandiol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10, 111; Kabanov et al., FEBS Lett., 1990, 259, 327; Svinarchuk et al., Biochimie, 1993, 75, 49); a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethylammonium-1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651; Shea et al., Nucl. Acids Res., 1990, 18, 3777); a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides &
Nucleotides, 1995, 14, 969);
adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651);
a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229); or an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923).
Linking groups or bifunctional linking moieties such as those known in the art are amenable to the compounds provided herein. Linking groups are useful for attachment of chemical functional groups, conjugate groups, reporter groups and other groups to selective sites in a parent compound such as for example an oligomeric compound. In general a bifunctional linking moiety comprises a hydrocarbyl moiety having two functional groups. One of the functional groups is selected to bind to a parent
-37-molecule or compound of interest and the other is selected to bind essentially any selected group such as chemical functional group or a conjugate group. In some embodiments, the linker comprises a chain structure or an oligomer of repeating units such as ethylene glycol or amino acid units. Examples of functional groups that are routinely used in a bifunctional linking moiety include, but are not limited to, electrophiles for reacting with nucleophilic groups and nucleophiles for reacting with electrophilic groups. In some embodiments, bifunctional linking moieties include amino, hydroxyl, carboxylic acid, thiol, unsaturations (e.g., double or triple bonds), and the like. Some nonlimiting examples of bifunctional linking moieties include 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl) cyclohexane-l-carboxylate (SMCC) and 6-aminohexanoic acid (AHEX or AHA).
Other linking groups include, but are not limited to, substituted Cl-Clo alkyl, substituted or unsubstituted C2-C10 alkenyl or substituted or unsubstituted C2-C10 alkynyl, wherein a nonlimiting list of preferred substituent groups includes hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl and alkynyl.
5. Synthesis, Purification and Analysis Oligomerization of modified and unmodified nucleosides and nucleotides can be routinely perfonned according to literature procedures for DNA (Protocols for Oligonucleotides and Analogs, Ed.
Agrawal (1993), Humana Press) and/or RNA (Scaringe, Methods (2001), 23, 206-217. Gait et al., Applications of Chemically synthesized RNA in RNA: Protein Interactions, Ed.
Smith (1998), 1-36.
Gallo et al., Tetrahedron (2001), 57, 5707-5713).
Oligomeric compounds provided herein can be conveniently and routinely made through the well-known technique of solid phase synthesis. Equipment for such synthesis is sold by several vendors including, for example, Applied Biosystems (Foster City, CA). Any other means for such synthesis known in the art may additionally or alternatively be employed. It is well known to use similar techniques to prepare oligonucleotides such as the phosphorothioates and alkylated derivatives. The invention is not limited by the method of antisense compound synthesis.
Methods of purification and analysis of oligomeric compounds are known to those skilled in the art. Analysis methods include capillary electrophoresis (CE) and electrospray-mass spectroscopy. Such synthesis and analysis methods can be performed in multi-well plates. The method of the invention is not limited by the method of oligomer purification.
D. Antisense Antisense mechanisms are all those involving the hybridization of a compound with target nucleic acid, wherein the outcome or effect of the hybridization is either target degradation or target occupancy with concomitant stalling of the cellular machinery involving, for example, transcription or splicing.
One type of antisense mechanism involving target degradation includes an RNase H. RNase H is a cellular endonuclease which cleaves the RNA strand of an RNA:DNA duplex. It is known in the art that single-stranded antisense compounds which are "DNA-like" elicit RNAse H
activity in mammalian
-38-cells. Activation of RNase H, therefore, results in cleavage of the RNA
target, thereby greatly enhancing the efficiency of DNA-like oligonucleotide-mediated inhibition of gene expression.
In certain embodiments, chemically-modified antisense compounds have a higher affinity for target RNAs than does non-modified DNA. In certain such embodiments, that higher affinity in turn provides increased potency allowing for the administration of lower doses of such compounds, reduced potential for toxicity and improvement in therapeutic index and decreased overall cost of therapy.
The present disclosure demonstrates that the incorporation of chemically-modified high-affinity nucleotides and nucleosides into antisense compounds allows for the design of short antisense compounds 8-16 nucleobases in length useful for the reduction of target RNAs and/or target proteins in cells, tissues, and animals, including, but not limited to, humans with increased potency and improved therapeutic index. Thus, in certain embodiments, provided herein are short antisense compounds comprising high-affinity nucleotide modifications useful for reducing a target RNA in vivo.
Certain such short antisense compounds are effective at lower doses than previously described antisense compounds, allowing for a reduction in toxicity and cost of treatment. In addition, certain short antisense compounds have greater potential for oral dosing.
To address the need for more potent antisense compounds, provided herein are short antisense compounds (8-16, preferably 9 to 15, more preferably 9 to 14, more preferably 10 to 14 nucleotides in length) with increased activity in vivo relative to longer compounds. Certain short antisense compounds are gapmer compounds comprising high-affinity chemically-modified nucleotides on the 3' and 5' ends (wings) of the compound. In certain embodiments, the addition of high-affinity modified nucleotides allows antisense compounds to be active against, and specific for, their intended target RNA in vivo despite being shorter in length. Contemplated herein are short antisense compounds wherein each of the wings independently comprises 1 to 3 high-affinity modified nucleotides. In certain embodiments, the high-affinity modifications are sugar modifications. High-affinity modified nucleotides include, but are not limited to, BNA s or other 2'-modified nucleotides, such as 2'-MOE
nucleotides. Also contemplated are short antisense compounds having at least one modified internucleotide linkage, such as a phosphorothioate internucleotide linkage. In certain embodiments, the short antisense compounds of the present invention can have all phosphorothioate intemucleoside linkages. The short antisense compounds optionally comprise a conjugate group. As shown herein, short antisense compounds have greater affinity for target RNA than they have for DNA and are significantly more potent in vivo as shown by reduction of target mRNA as well as by amelioration of a variety of disease indications.
As used herein, an RNA which is involved in regulating glucose metabolism or clearance, lipid metabolism, cholesterol metabolism or insulin metabolism is any RNA involved in the biochemical pathways that regulate these processes. Such RNAs are well known in the art.
Examples of target genes include, but are not limited to, ApoB-100 (also known as APOB; Ag(x) antigen;
apoB-48; apolipoprotein B; apolipoprotein B-100; apolipoprotein B-48) and GCGR (also known as glucagon receptor; GR), CRP, DGAT2, GCCR, PCSK9, PTEN, PTP1B, SGLT2, and SOD1.
-39-1. Modulation of Tar eg t Expression In certain embodiments, a target is identified and antisense oligonucleotides are designed to modulate that target or its expression. In certain embodiments, designing an oligomeric compound to a target nucleic acid molecule can be a multistep process. Typically the process begins with the identification of a target protein, the activity of which is to be modulated, and then identifying the nucleic acid the expression of which yields the target protein. In certain embodiments, designing of an antisense compound results in an antisense compound that is hybridizable to the targeted nucleic acid molecule. In certain embodiments, the antisense compound is an antisense oligonucleotide or antisense oligonucleoside. In certain embodiments, an antisense compound and a target nucleic acid are complementary to one another. In certain such embodiments, an antisense compound is perfectly complementary to a target nucleic acid. In certain embodiments, an antisense compound includes one mismatch. In certain embodiments, an antisense compound includes two mismatches. In certain embodiments, an antisense compound includes three or more mismatches.
Modulation of expression of a target nucleic acid can be achieved through alteration of any number of nucleic acid functions. In certain embodiments, the functions of RNA
to be modulated include, but are not limited to, translocation functions, which include, but are not limited to, translocation of the RNA to a site of protein translation, translocation of the RNA to sites within the cell which are distant from the site of RNA synthesis, and translation of protein from the RNA. RNA processing functions that can be modulated include, but are not limited to, splicing of the RNA to yield one or more RNA species, capping of the RNA, 3' maturation of the RNA and catalytic activity or complex formation involving the RNA which may be engaged in or facilitated by the RNA.
Modulation of expression can result in the increased level of one or more nucleic acid species or the decreased level of one or more nucleic acid species, either temporally or by net steady state level. Thus, in one embodiment modulation of expression can mean increase or decrease in target RNA or protein levels.
In another embodiment modulation of expression can mean an increase or decrease of one or more RNA
splice products, or a change in the ratio of two or more splice products.
In certain embodiments, expression of a target gene is modulated using an oligomeric compound comprising from about 8 to about 16, preferably 9 to 15, more preferably 9 to 14, more preferably 10 to 14 monomers (i.e. from about 8 to about 16 linked monomers). One of ordinary skill in the art will appreciate that this comprehends methods of modulating expression of a target gene using one or more antisense compounds of 8, 9, 10, 11, 12, 13, 14, 15 or 16 nucleobases.
In certain embodiments, methods of modulating a target gene comprises use of a short antisense compound that is 8 nucleobases in length. In certain embodiments, methods of modulating a target gene comprises use of a short antisense compound that is 9 nucleobases in length.
In certain embodiments, methods of modulating a target gene comprises use of a short antisense compound that is 8 nucleobases in length. In certain embodiments, methods of modulating a target gene comprises use of a short antisense compound that is 10 nucleobases in length. In certain embodiments, methods of modulating a target gene
-40-comprises use of a short antisense compound that is 10 nucleobases in length.
In certain embodiments, methods of modulating a target gene comprises use of a short antisense compound that is 11 nucleobases in length. In certain embodiments, methods of modulating a target gene comprises use of a short antisense compound that is 12 nucleobases in length. In certain embodiments, methods of modulating a target gene comprises use of a short antisense compound that is 13 nucleobases in length. In certain embodiments, methods of modulating a target gene comprises use of a short antisense compound that is 14 nucleobases in length. In certain embodiments, methods of modulating a target gene comprises use of a short antisense compound that is 15 nucleobases in length. In certain embodiments, methods of modulating a target gene comprises use of a short antisense compound that is 16 nucleobases in length.
In certain embodiments, methods of modulating expression of a target gene comprises use of a short antisense compound comprising 9 to 15 monomers. In certain embodiments, methods of modulating expression of a target gene comprises use of a short antisense compound comprising 10 to 15 monomers. In certain embodiments, methods of modulating expression of a target gene comprises use of a short antisense compound comprising 12 to 14 monomers. In certain embodiments, methods of modulating expression of a target gene comprises use of a short antisense compound comprising 12 or 14 nucleotides or nucleosides.

2. Hybridization In certain embodiments, antisense compounds specifically hybridize when there is a sufficient degree of complementarity to avoid non-specific binding of the antisense compound to non-target nucleic acid sequences under conditions in which specific binding is desired, i.e., under physiological conditions in the case of in vivo assays or therapeutic treatment, and under conditions in which assays are performed in the case of in vitro assays.
As used herein, "stringent hybridization conditions" or "stringent conditions"
refers to conditions under which an antisense compound will hybridize to its target sequence, but to a minimal number of other sequences. Stringent conditions are sequence-dependent and will be different in different circumstances, and "stringent conditions" under which antisense compounds hybridize to a target sequence are determined by the nature and composition of the antisense compounds and the assays in which they are being investigated.
3. Complementari ty It is understood in the art that incorporation of nucleotide affinity modifications may allow for a greater number of mismatches compared to an unmodified compound. Similarly, certain oligonucleotide sequences may be more tolerant to mismatches than other oligonucleotide sequences. One of ordinary skill in the art is capable of determining an appropriate number of mismatches between oligonucleotides, or between an oligonucleotide and a target nucleic acid, such as by determining melting temperature (Tm).
T. or T. can be calculated by techniques that are familiar to one of ordinary skill in the art. For example, techniques described in Freier et al. (Nucleic Acids Research, 1997, 25, 22: 4429-4443) allow
-41-one of ordinary skill in the art to evaluate nucleotide modifications for their ability to increase the melting temperature of an RNA:DNA duplex.
4. Identity Antisense compounds, or a portion thereof, may have a defined percent identity to a SEQ ID NO, or a compound having a specific Isis number. As used herein, a sequence is identical to the sequence disclosed herein if it has the same nucleobase pairing ability. For example, an RNA which contains uracil in place of thymidine in the disclosed sequences of the compounds described herein would be considered identical as they both pair with adenine. This identity may be over the entire length of the oligomeric compound, or in a portion of the antisense compound (e.g., nucleobases 1-20 of a 27-mer may be compared to a 20-mer to determine percent identity of the oligomeric compound to the SEQ ID NO. It is understood by those skilled in the art that an antisense compound need not have an identical sequence to those described herein to function similarly to the antisense compound described herein. Shortened versions of antisense compounds taught herein, or non-identical versions of the antisense compounds taught herein, are also provided herein. Non-identical versions are those wherein each base does not have the same pairing activity as the antisense compounds disclosed herein. Bases do not have the same pairing activity by being shorter or having at least one abasic site.
Alternatively, a non-identical version can include at least one base replaced with a different base with different pairing activity (e.g., G can be replaced by C, A, or T). Percent identity is calculated according to the number of bases that have identical base pairing corresponding to the SEQ ID NO or antisense compound to which it is being compared. The non-identical bases may be adjacent to each other, dispersed through out the oligonucleotide, or both.
For example, a 16-mer having the same sequence as nucleobases 2-17 of a 20-mer is 80%
identical to the 20-mer. Alternatively, a 20-mer containing four nucleobases not identical to the 20-mer is also 80% identical to the 20-mer. A 14-mer having the same sequence as nucleobases 1-14 of an 18-mer is 78% identical to the 18-mer. Such calculations are well within the ability of those skilled in the art.
The percent identity is based on the percent of nucleobases in the original sequence present in a portion of the modified sequence. Therefore, a 30 nucleobase antisense compound comprising the full sequence of the complement of a 20 nucleobase active target segment would have a portion of 100%
identity with the complement of the 20 nucleobase active target segment, while further comprising an additional 10 nucleobase portion. In the context of the instant description, the complement of an active target segment may constitute a single portion. In preferred embodiments, the oligonucleotides provided herein are at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identical to at least a portion of the complement of the active target segments presented herein.
E. Target Nucleic Acids, Regions and Segments In certain embodiments, short antisense compounds may be designed to target any target nucleic
-42-acid. In certain embodiments, the target nucleic acid encodes a target that is clinically relevant. In such embodiments, modulation of the target nucleic acid results in clinical benefit. Certain target nucleic acids include, but are not limited to, the target nucleic acids illustrated in Table 1.
In certain embodiments, a target nucleic acid is a nucleic acid molecule encoding ApoB.
Nucleic acid molecules that encode ApoB include, without limitation, SEQ ID
NO: 1 and SEQ ID NO: 2.
In certain embodiments, a target nucleic acid is a nucleic acid molecule encoding SGLT2.
Nucleic acid molecules that encode SGLT2 include, without limitation, SEQ ID
NO: 3.
In certain embodiments, a target nucleic acid is a nucleic acid molecule encoding PCSK9.
Nucleic acid molecules that encode PCSK9 include, without limitation, SEQ ID
NO: 4.
In certain embodiments, a target nucleic acid is a nucleic acid molecule encoding SOD 1.
Nucleic acid molecules that encode SOD1 include, without limitation, SEQ ID
NO: 5.
In certain embodiments, a target nucleic acid -is a nucleic acid molecule encoding CRP. Nucleic acid molecules that encode CRP include, without limitation, SEQ ID NO: 6.
In certain embodiments, a target nucleic acid is a nucleic acid molecule encoding GCCR.
Nucleic acid molecules that encode GCCR include, without limitation, SEQ ID
NO: 7 and SEQ ID NO:
8.
In certain embodiments, a target nucleic acid is a nucleic acid molecule encoding GCGR.
Nucleic acid molecules that encode GCGR include, without limitation, SEQ ID
NO: 9.
In certain embodiments, a target nucleic acid is a nucleic acid molecule encoding DGAT2.
Nucleic acid molecules that encode DGAT2 include, without limitation, SEQ ID
NO: 10.
In certain embodiments, a target nucleic acid is a nucleic acid molecule encoding PTP 1 B.
Nucleic acid molecules that encode PTP1B include, without limitation, SEQ ID
NO: 11 and SEQ ID NO:
12.
In certain embodiments, a target nucleic acid is a nucleic acid molecule encoding PTEN.
Nucleic acid molecules that encode PTEN include, without limitation, SEQ ID
NO: 14 or SEQ ID NO:
15.
Table 1: Certain Target Nucleic Acids Target Species GENBANK Accession Number SEQ ID
NO
ApoB Human NM 000384.1 1 ApoB Mouse X1VI 137955.5 2 SGLT2 Human NM 003041.1 3 PCSK9 Human NM 174936.2 4 SOD1 Human X02317.1 5 CRP Human NM 000567.1 6 GCCR Mouse BC031885.1 7 GCCR Human Nucleotides 1 to 10600 of AC012634 8 GCGR Human NM 000160.1 9 DGAT2 Human NM 032564.2 10
-43-PTP 1 B Human NM002827.2 11 PTPIB Human Nucleotides 1417800 to 1425600 of 12 NT 011362.9 PTEN Mouse U92437.1 13 PTEN Human NM_000314.4 14 PTEN Human Nucleotides 8063255 to 8167140 of 15 NT 033890.3 The targeting process usually includes determination of at least one target region, segment, or site within the target nucleic acid for the antisense interaction to occur such that the desired effect will result.
In certain embodiments, the 5'-most nucleotide of a target region is the 5' target site of a short antisense compound and the 3'-most nucleotide of a target region is the 3' target site of the same short antisense compound. In certain embodiments, the 5'-most nucleotide of a target region is the 5' target site of a short antisense compound and the 3'-most nucleotide of a target region is the 3' target site of a different short antisense compound. In certain embodiments, a target region comprises a nucleotide sequence within 10, 15, or 20 nucleotides of a 5' target site or a 3' target site.
In certain embodiments, a target region is a structurally defined region of the nucleic acid. For example, in certain such embodiments, a target region may encompass a 3' UTR, a 5' UTR, an exon, an intron, a coding region, a translation initiation region, translation termination region, or other defined nucleic acid region.
The locations on the target nucleic acid defined by having one or more active short antisense compounds targeted thereto are referred to as "active target segments." In certain embodiments, the target nucleic acid having one or more active short antisense compounds targeted thereto is a target RNA.
When an active target segment is defined by multiple short antisense compounds, the compounds are preferably separated by no more than about 10 nucleotides on the target sequence, more preferably no more than about 5 nucleotides on the target sequence, even more preferably the short antisense compounds are contiguous, most preferably the short antisense compounds are overlapping. There may be substantial variation in activity (e.g., as defined by percent inhibition) of the short antisense compounds within an active target segment. Active short antisense compounds are those that modulate the expression of their target nucleic acid, including but not limited to a target RNA. Active short antisense compounds inhibit expression of their target RNA at least 10%, preferably 20%. In a preferred embodiment, at least about 50%, preferably about 70% of the short antisense compounds targeted to the active target segment modulate expression of their target RNA at least 40%. In a more preferred embodiment, the level of inhibition required to define an active short antisense compound is defined based on the results from the screen used to define the active target segments.
A suitable target segment is at least about an 8-nucleobase portion of a target region to which an active short antisense compound is targeted. Target segments can include DNA
or RNA sequences that comprise at least the 8 consecutive nucleobases from the 5'-terminus of one of the illustrative target segments (the remaining nucleobases being a consecutive stretch of the same DNA or RNA beginning
-44-immediately upstream of the 5'-terminus of the target segment and continuing until the DNA or RNA
comprises about 8 to about 16 nucleobases). Target segments are also represented by DNA or RNA
sequences that comprise at least the 8 consecutive nucleobases from the 3'-terminus of one of the illustrative target segments (the remaining nucleobases being a consecutive stretch of the same DNA or RNA beginning immediately downstream of the 3'-terminus of the target segment and continuing until the DNA or RNA comprises about 8 to about 16 nucleobases). It is also understood that antisense target segments may be represented by DNA or RNA sequences that comprise at least 8 consecutive nucleobases from an internal portion of the sequence of an illustrative target segment, and may extend in either or both directions until the short antisense compound comprises about 8 to about 16 nucleobases.
One having skill in the art armed with the target segments illustrated herein will be able, without undue experimentation, to identify further target segments.
Once one or more target regions, segments or sites have been identified, short antisense compounds are chosen which are sufficiently complementary to the target, i.e., hybridize sufficiently well and with sufficient specificity, to give the desired effect.
The short antisense compounds may also be targeted to regions of the target nucleobase sequence comprising any consecutive nucleobases 8 to 16 nucleobases in length along the target nucleic acid molecule.
Target segments 8-16 nucleobases in length comprising a stretch of at least eight (8) consecutive nucleobases selected from within the illustrative target segments are considered to be suitable for targeting as well. Thus, the short antisense compounds may also encompass 8-16 nucleobases within those segments identified herein as beginning at a particular 5' target site.
Any segment of 8, 9, 10, 11, or more preferably 12, 13, 14, 15 or 16 contiguous nucleobases in a 50, preferably 25, more preferably 16 nucleobase perimeter around these regions are also considered to be suitable for targeting.
In a further embodiment, the "suitable target segments" identified herein may be employed in a screen for additional short antisense compounds that modulate the expression of a target nucleic acid.
"Modulators" are those compounds that decrease or increase the expression of a target nucleic acid and which comprise at least an 8-nucleobase portion which is complementary to a target segment. The screening method comprises the steps of contacting a target segment of a nucleic acid with one or more candidate modulators, and selecting for one or more candidate modulators which decrease or increase the expression of a target nucleic acid. Once it is shown that the candidate modulator or modulators are capable of modulating (e.g. either decreasing or increasing) the expression of a target nucleic acid, the modulator may then be employed in further investigative studies of the function of the target, or for use as a research, diagnostic, or therapeutic agent in accordance with the present invention.
For all short antisense compounds discussed herein, sequence, monomer, monomeric modification, and monomeric linkage may each be selected independently. In certain embodiments, short antisense compounds are described by a motif. In such embodiments, any motif may be used with any sequence, whether or not the sequence and/or the motif is specifically disclosed herein. In certain
-45-embodiments, short antisense compounds comprise modifications that are not amenable to description by motif (for example, short antisense compounds comprising several different modifications and/or linkages at various positions throughout the compound). Such combinations may be incorporated for any sequence, whether or not it is disclosed herein. The sequence listing accompanying this filing provides certain nucleic acid sequences independent of chemical modification. Though that listing identifies each sequence as either "RNA" or "DNA" as required, in reality, those sequences may be modified with any combination of chemical modifications and/or motifs.
In certain embodiments, short antisense compounds comprise at least one high-affinity modified monomer. In certain embodiments, provided are short antisense compounds targeted to nucleic acid molecules encoding targets including, but not limited to, ApoB-100 (also known as APOB; Ag(x) antigen; apoB-48; apolipoprotein B; apolipoprotein B-100; apolipoprotein B-48), GCGR (also known as glucagon receptor; GR), CRP, DGAT2, GCCR, PCSK9, PTEN, PTP1B, SGLT2, and SOD1.
In certain such embodiments, such short antisense compounds are targeted to a nucleic acid molecule encoding any of those targets.
F. Certain Targets In certain embodiments, short antisense compounds may be designed to modulate any target. In certain embodiments, the target is clinically relevant. In such embodiments, modulation of the target results in clinical benefit. Certain targets are preferentially expressed in the kidney. Certain targets are preferentially expressed in the liver. Certain targets are associated with a metabolic disorder. Certain targets are associated to a cardiovascular disorder. In certain embodiments, a target is selected from:
ApoB, SGLT2, PCSK9, SODI, CRP, GCCR, GCGR, DGAT2, PTP1B, and PTEN. In certain embodiments, a target is selected from: ApoB, SGLT2, PCSK9, SOD1, CRP, GCCR, GCGR, DGAT2, and PTP1B. In certain embodiments, a target is any protein other than SGLT2.
In certain embodiments, short antisense compounds exhibit liver and kidney-specific target RNA reduction in vivo. Such property renders those short antisense compounds particularly useful for inhibition of many target RNAs involved in metabolic and cardiovascular diseases. Thus, provided herein are methods of treating cardiovascular or metabolic disorders by contacting said kidney or liver tissues with short antisense compounds targeted to RNAs associated with said disorders. Thus, also provided are methods for ameliorating any of a variety of metabolic or cardiovascular disease indications with the short antisense compounds of the present invention.

1. ApoB
ApoB (also known as apolipoprotein B-100; ApoB-100, apolipoprotein B-48; ApoB-48 and Ag(x) antigen), is a large glycoprotein that serves an indispensable role in the assembly and secretion of lipids and in the transport and receptor-mediated uptake and delivery of distinct classes of lipoproteins.
ApoB performs a variety of activities, from the absorption and processing of dietary lipids to the regulation of circulating lipoprotein levels (Davidson and Shelness, Annu.
Rev. Nutr., 2000, 20, 169-193).
-46-This latter property underlies its relevance in terms of atherosclerosis susceptibility, which is highly correlated with the ambient concentration of ApoB-containing lipoproteins (Davidson and Shelness, Annu. Rev. Nutr., 2000, 20, 169-193). ApoB-100 is the major protein component of LDL-C and contains the domain required for interaction of this lipoprotein species with the LDL
receptor. Elevated levels of LDL-C are a risk factor for cardiovascular disease, including atherosclerosis.

Definitions "ApoB" is the gene product or protein of which expression is to be modulated by administration of a short antisense compound.
"ApoB nucleic acid" means any nucleic acid encoding ApoB. For example, in certain embodiments, a ApoB nucleic acid includes, without limitation, a DNA sequence encoding ApoB, an RNA sequence transcribed from DNA encoding ApoB, and an mRNA sequence encoding ApoB.
"ApoB mRNA" means an mRNA encoding ApoB.
ApoB Therapeutic Indications In certain embodiments, the invention provides methods of modulating the expression of ApoB
in an individual comprising administering a short antisense compound targeted to an ApoB nucleic acid.
In certain embodiments, the invention provides methods of treating an individual comprising administering one or more pharmaceutical compositions comprising a short antisense compound targeted to an ApoB nucleic acid. In certain embodiments, the individual has hypercholesterolemia, non-familial hypercholesterolemia, familial hypercholesterolemia, heterozygous familial hypercholesterolemia, homozygous familial hypercholesterolemia, mixed dyslipidemia, atherosclerosis, a risk of developing atherosclerosis, coronary heart disease, a history of coronary heart disease, early onset coronary heart disease, one or more risk factors for coronary heart disease, type II
diabetes, type II diabetes with dyslipidemia, dyslipidemia, hypertriglyceridemia, hyperlipidemia, hyperfattyacidemia, hepatic steatosis, non-alcoholic steatohepatitis, or non-alcoholic fatty liver disease.
Guidelines for lipid-lowering therapy were established in 2001 by Adult Treatment Panel III
(ATP III) of the National Cholesterol Education Program (NCEP), and updated in 2004 (Grundy et al., Circulation, 2004, 110, 227-239). The guidelines include obtaining a complete lipoprotein profile, typically after a 9 to 12 hour fast, for determination of LDL-C, total cholesterol, and HDL-C levels.
According to the most recently established guidelines, LDL-C levels of 130-159 mg/dL, 160-189 mg/dL, and greater than or equal to 190 mg/dL are considered borderline high, high, and very high, respectively.
Total cholesterol levels of 200-239 and greater than or equal to 240 mg/dL are considered borderline high and high, respectively. HDL-C levels of less than 40 mg/dL are considered low.
In certain embodiments, the individual has been identified as in need of lipid-lowering therapy. In certain such embodiments, the individual has been identified as in need of lipid-lowering therapy according to the guidelines established in 2001 by Adult Treatment Panel III
(ATP III) of the National
-47-Cholesterol Education Program (NCEP), and updated in 2004 (Grundy et al., Circulation, 2004, 110, 227-239). In certain such embodiments, the individual in need of lipid-lowering therapy has LDL-C above 190 mg/dL. In certain such embodiments, the individual in need of lipid-lowering therapy has LDL-C above 160 mg/dL. In certain such embodiments, the individual in need of lipid-lowering therapy has LDL-C
above 130 mg/dL. In certain such embodiments the individual in need of lipid-lowering therapy has LDL-C above 100 mg/dL. In certain such embodiments the individual in need of lipid-lowering therapy should maintain LDL-C below 160 mg/dL. In certain such embodiments the individual in need of lipid-lowering therapy should maintain LDL-C below 130 mg/dL. In certain such embodiments the individual in need of lipid-lowering therapy should maintain LDL-C below 100 mg/dL. In certain such embodiments the individual should maintain LDL-C below 70 mg/dL.
In certain embodiments the invention provides methods for reducing ApoB in an individual. In certain embodiments the invention provides methods for reducing ApoB-containing lipoprotein in an individual. In certain embodiments the invention provides methods for reducing LDL-C in an individual.
In certain embodiments the invention provides methods for reducing VLDL-C in an individual. In certain embodiments the invention provides methods for reducing IDL-C in an individual. In certain embodiments the invention provides methods for reducing non-HDL-C in an individual. In certain embodiments the invention provides methods for reducing Lp(a) in an individual. In certain embodiments the invention provides methods for reducing serum triglyceride in an individual. In certain embodiments the invention provides methods for reducing liver triglyceride in an individual. In certain embodiments the invention provides methods for reducing Ox-LDL-C in an individual. In certain embodiments the invention provides methods for reducing small LDL particles in an individual.
In certain embodiments the invention provides methods for reducing small VLDL particles in an individual.
In certain embodiments the invention provides methods for reducing phospholipids in an individual. In certain embodiments the invention provides methods for reducing oxidized phospholipids in an individual.
In certain embodiments the invention provides methods for reducing Ox-LDL-C
concentration in a subject. In certain such embodiments, the reduction in ApoB, LDL-C, VLDL-C, IDL-C, total cholesterol, non-HDL-C, Lp(a), triglyerides, or Ox-LDL-C is, independently, selected from at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, and at least 100%. In certain such embodiments, the reduction in ApoB, LDL-C, VLDL-C, IDL-C, total cholesterol, non-HDL-C, Lp(a), triglyerides, or Ox-LDL-C
is, independently, selected from at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, and at least 70%. In certain such embodiments, the reduction in ApoB, LDL-C, VLDL-C, IDL-C, total cholesterol, non-HDL-C, Lp(a), triglyerides, or Ox-LDL-C is, independently, selected from at least 40%, at least 50%, at least 60%, and at least 70%.
In certain embodiments, the invention provides method for raising HDL-C
concentration in a subject.
-48-In certain embodiments, the methods provided by the present invention do not lower HDL-C. In certain embodiments, the methods provided by the present invention do not result in accumulation of lipids in the liver. In certain embodiments, the methods provided by the present invention do not cause hepatic steatosis.
In certain embodiments, the invention provides methods for lowering ApoB
concentration in a subject while reducing side effects associated with treatment. In certain such embodiments, a side effect is liver toxicity. In certain such embodiments, a side effect is abnormal liver function. In certain such embodiments, a side effect is elevated alanine aminotransferase (ALT). In certain such embodiments, a side effect is elevated aspartate aminotransferase (AST).
In certain embodiments, the invention provides methods for lowering ApoB
concentration in a subject who is not reaching target LDL-C levels as a result of lipid-lowering therapy. In certain such embodiments, a short antisense compound targeted to an ApoB nucleic acid is the only lipid-lowering agent administered to the subject. In certain such embodiments, the subject has not complied with recommended lipid-lowering therapy. In certain such embodiments, a pharmaceutical composition of the invention is co-administered with an additional different lipid-lowering therapy. In certain such embodiments, an additional lipid-lowering therapy is LDL-apheresis. In certain such embodiments, an additional lipid-lowering therapy is a statin. In certain such embodiments, an additional lipid-lowering therapy is ezetimibe.
In certain embodiments, the invention provides methods for lowering ApoB
concentration in a statin-intolerant subject. In certain such embodiments, the subject has creatine kinase concentration increases as a result of statin administration. In certain such embodiments, the subject has liver function abnormalities as a result of statin administration. In certain such embodiments the subject has muscle aches as a result of statin administration. In certain such embodiments the subject has central nervous system side effects as a result of statin administration. In certain embodiments, the subject has not complied with recommended statin administration.
In certain embodiments, the invention provides methods for lowering liver triglycerides in a subject. In certain such embodiments, the subject has elevated liver triglycerides. In certain such embodiments, the subject has steatohepatitis. In certain such embodiments, the subject has steatosis. In certain such embodiments, liver triglyceride levels are measured by magnetic resonance imaging.
In certain embodiments, the invention provides methods for reducing coronary heart disease risk in a subject. In certain embodiments the invention provides methods for slowing the progression of atherosclerosis in a subject. In certain such embodiments the invention provides methods for stopping the progression of atherosclerosis in a subject. In certain such embodiments the invention provides methods for reducing the size and/or prevalence of atherosclerotic plaques in a subject. In certain embodiments the methods provided reduce a subject's risk of developing atherosclerosis.
In certain embodiments the methods provided improve the cardiovascular outcome in a subject.
In certain such embodiments improved cardiovascular outcome is the reduction of the risk of developing
-49-coronary heart disease. In certain such embodiments, improved cardiovascular outcome is a reduction in the occurrence of one or more major cardiovascular events, which include, but are not limited to, death, myocardial infarction, reinfarction, stroke, cardiogenic shock, pulmonary edema, cardiac arrest, and atrial dysrhythmia. In certain such embodiments, the improved cardiovascular outcome is evidenced by improved carotid intimal media thickness. In certain such embodiments, improved carotid intimal media thickness is a decrease in thickness. In certain such embodiments, improved carotid intimal media thickness is a prevention an increase of intimal media thickness.
In certain embodiments a pharmaceutical composition comprising a short antisense compound targeted to an ApoB nucleic acid is for use in therapy. In certain embodiments, the therapy is the reduction of LDL-C, ApoB, VLDL-C, IDL-C, non-HDL-C, Lp(a) , serum triglyceride, liver triglyceride, Ox-LDL-C, small LDL particles, small VLDL, phospholipids, or oxidized phospholipids in an individual.
In certain embodiments, the therapy is the treatment of hypercholesterolemia;
non-familial hypercholesterolemia, familial hypercholesterolemia, heterozygous familial hypercholesterolemia, homozygous familial hypercholesterolemia, mixed dyslipidemia, atherosclerosis, a risk of developing atherosclerosis, coronary heart disease, a history of coronary heart disease, early onset coronary heart disease, one or more risk factors for coronary heart disease, type II
diabetes, type II diabetes with dyslipidemia, dyslipidemia, hypertriglyceridemia, hyperlipidemia, hyperfattyacidemia, hepatic steatosis, non-alcoholic steatohepatitis, or non-alcoholic fatty liver disease. In additional embodiments, the therapy is the reduction of CHD risk. In certain the therapy is prevention of atherosclerosis. In certain embodiments, the therapy is the prevention of coronary heart disease.
In certain embodiments a pharmaceutical composition comprising a short antisense compound targeted to an ApoB nucleic acid is used for the preparation of a medicament for reducing LDL-C, ApoB, VLDL-C, IDL-C, non-HDL-C, Lp(a) , serum triglyceride, liver triglyceride, Ox-LDL-C, small LDL
particles, small VLDL, phospholipids, or oxidized phospholipids in an individual. In certain embodiments pharmaceutical composition comprising a short antisense compound targeted to an ApoB nucleic acid is used for the preparation of a medicament for reducing coronary heart disease risk. In certain embodiments a short antisense compound targeted to an ApoB nucleic acid is used for the preparation of a medicament for the treatment of hypercholesterolemia, non-familial hypercholesterolemia, familial hypercholesterolemia, heterozygous familial hypercholesterolemia, homozygous familial hypercholesterolemia, mixed dyslipidemia, atherosclerosis, a risk of developing atherosclerosis, coronary heart disease, a history of coronary heart disease, early onset coronary heart disease, one or more risk factors for coronary heart disease, type II diabetes, type II diabetes with dyslipidemia, dyslipidemia, hypertriglyceridemia, hyperlipidemia, hyperfattyacidemia, hepatic steatosis, non-alcoholic steatohepatitis, or non-alcoholic fatty liver disease.
ApoB Combination Therapies In certain embodiments, one or more pharmaceutical compositions comprising a short antisense
-50-compound targeted to an ApoB nucleic acid are co-administered with one or more other pharmaceutical agents. In certain embodiments, such one or more other pharmaceutical agents are designed to treat the same disease or condition as the one or more pharmaceutical compositions of the present invention. In certain such embodiments, the one or more pharmaceutical agents are lipid-lowering agents. In certain embodiments, such one or more other pharmaceutical agents are designed to treat a different disease or condition as the one or more pharmaceutical compositions of the present invention. In certain embodiments, such one or more other pharmaceutical agents are designed to treat an undesired effect of one or more pharmaceutical compositions of the present invention. In certain embodiments, one or more pharmaceutical compositions of the present invention are co-administered with another pharmaceutical agent to treat an undesired effect of that other pharmaceutical agent. In certain embodiments, one or more pharmaceutical compositions of the present invention and one or more other pharmaceutical agents are administered at the same time. In certain embodiments, one or more pharmaceutical compositions of the present invention and one or more other pharmaceutical agents are administered at different times. In certain embodiments, one or more pharmaceutical compositions of the present invention and one or more other pharmaceutical agents are prepared together in a single formulation. In certain embodiments, one or more pharmaceutical compositions of the present invention and one or more other pharmaceutical agents are prepared separately.
In certain embodiments, pharmaceutical agents that may be co-administered with a pharmaceutical composition comprising a short antisense compound targeted to an ApoB nucleic acid include lipid-lowering agents. In certain such embodiments, pharmaceutical agents that may be co-administered with a pharmaceutical composition of the present invention include, but are not limited to atorvastatin, simvastatin, rosuvastatin, and ezetimibe. In certain such embodiments, the lipid-lowering agent is administered prior to administration of a pharmaceutical composition of the present invention. In certain such embodiments, the lipid-lowering agent is administered following administration of a pharmaceutical composition of the present invention. In certain such embodiments the lipid-lowering agent is administered at the same time as a pharmaceutical composition of the present invention. In certain such embodiments the dose of a co-administered lipid-lowering agent is the same as the dose that would be administered if the lipid-lowering agent was administered alone. In certain such embodiments the dose of a co-administered lipid-lowering agent is lower than the dose that would be administered if the lipid-lowering agent was administered alone. In certain such embodiments the dose of a co-administered lipid-lowering agent is greater than the dose that would be administered if the lipid-lowering agent was administered alone.
In certain embodiments, a co-administered lipid-lowering agent is a HMG-CoA
reductase inhibitor. In certain such embodiments the HMG-CoA reductase inhibitor is a statin. In certain such embodiments the statin is selected from atorvastatin, simvastatin, pravastatin, fluvastatin, and rosuvastatin.
In certain embodiments, a co-administered lipid-lowering agent is a cholesterol absorption
-51-inhibitor. In certain such embodiments, cholesterol absorption inhibitor is ezetimibe.
In certain embodiments, a co-administered lipid-lowering agent is a co-formulated HMG-CoA
reductase inhibitor and cholesterol absorption inhibitor. In certain such embodiments the co-formulated lipid-lowering agent is ezetimibe/simvastatin.
In certain embodiments, a co-administered lipid-lowering agent is a microsomal triglyceride transfer protein inhibitor (MTP inhibitor).
In certain embodiments, a co-administered pharmaceutical agent is a bile acid sequestrant. In certain such embodiments, the bile acid sequestrant is selected from cholestyramine, colestipol, and colesevelam.
In certain embodiments, a co-administered pharmaceutical agent is a nicotinic acid. In certain such embodiments, the nicotinic acid is selected from immediate release nicotinic acid, extended release nicotinic acid, and sustained release nicotinic acid.
In certain embodiments, a co-administered pharmaceutical agent is a fibric acid. In certain such embodiments, a fibric acid is selected from gemfibrozil, fenofibrate, clofibrate, bezafibrate, and ciprofibrate.
Further examples of pharmaceutical agents that may be co-administered with a pharmaceutical composition comprising a short antisense compound targeted to an ApoB nucleic acid include, but are not limited to, corticosteroids, including but not limited to prednisone;
immunoglobulins, including, but not limited to intravenous inununoglobulin (IVIg); analgesics (e.g., acetaminophen); anti-inflammatory agents, including, but not limited to non-steroidal anti-inflammatory drugs (e.g., ibuprofen, COX-1 inhibitors, and COX-2, inhibitors); salicylates; antibiotics; antivirals;
antifungal agents; antidiabetic agents (e.g., biguanides, glucosidase inhibitors, insulins, sulfonylureas, and thiazolidenediones);
adrenergic modifiers; diuretics; hormones (e.g., anabolic steroids, androgen, estrogen, calcitonin, progestin, somatostan, and thyroid hormones); immunomodulators; muscle relaxants; antihistamines;
osteoporosis agents (e.g., biphosphonates, calcitonin, and estrogens);
prostaglandins, antineoplastic agents; psychotherapeutic agents; sedatives; poison oak or poison sumac products; antibodies; and vaccines.
In certain embodiments, a pharmaceutical composition comprising a short antisense compound targeted to an ApoB nucleic acid may be administered in conjunction with a lipid-lowering therapy. In certain such embodiments, a lipid-lowering therapy is therapeutic lifestyle change. In certain such embodiments, a lipid-lowering therapy is LDL apheresis.
In one embodiment, the antisense compounds provided herein can be used to lower the level of apolipoprotein B-containing lipoproteins in a human subject. As used herein, "apolipoprotein B-containing lipoprotein" refers to any lipoprotein that has apolipoprotein B as its protein component, and is understood to include LDL, VLDL, IDL, and lipoprotein(a). LDL, VLDL, IDL and lipoprotein(a) each contain one molecule of apolipoprotein B, thus a serum apolipoprotein B
measurement reflects the total number of these lipoproteins. As is known in the art, each of the aforementioned lipoproteins is
-52-atherogenic. Thus, lowering one or more apolipoprotein B-containing lipoproteins in serum may provide a therapeutic benefit to a human subject. Small LDL particles are considered to be particularly atherogenic relative to large LDL particles, thus lowering small LDL particles can provide a therapeutic benefit to a human subject. Additional lipid parameters can also be determined in a subject. Reduction of total cholesterol:HDL ratio or LDL:HDL ratio is a clinically desirable improvement in cholesterol ratio.
Similarly, it is clinically desirable to reduce serum triglycerides in humans who exhibit elevated lipid levels.
Other indications of cardiovascular disease that can be measured in a subject include serum LDL particle size; serum LDL cholesteryl ester concentration; serum LDL
cholesteryl ester composition;
the extent of polyunsaturation of serum LDL cholesteryl esters; and serum HDL
cholesterol levels. As used herein, "serum LDL particle size" refers to the classification of serum LDL particle size, which may be very small, small, medium, or large, and is typically expressed in g/ mol.
In the context of the present invention, "serum LDL cholesteryl ester concentration" means the amount of cholesteryl ester present in LDL particles, and is typically measured as mg/dL. In the context of the present invention, "serum LDL
cholesteryl ester composition" is a measurement of the percentage of saturated, monounsaturated and polyunsaturated cholesteryl ester fatty acids present in serum LDL particles.
"Polyunsaturation of serum LDL cholesteryl esters" means the percentage of polyunsaturated cholesteryl ester fatty acids in serum LDL particles.
Methods of obtaining serum or plasma samples for analysis and methods of preparation of the serum samples to allow for analysis are well known to those skilled in the art. With regard to measurements of lipoproteins, cholesterol, triglyceride and cholesteryl esters, the terms "serum" and "plasma" are herein used interchangeably.
In another embodiment, the antisense compounds provided herein can be used to treat metabolic disorders. A variety of biomarkers can be used for evaluating metabolic disease. For example, blood glucose levels can be determined by a physician or even by the patient using a commonly available test kit or glucometer (for example, the Ascensia ELITETM kit, Ascensia (Bayer), Tarrytown NY, or Accucheck, Roche Diagnostics). Glycated hemoglobin (HbAiJ can also be measured. HbAlc is a stable minor hemoglobin variant formed in vivo via posttranslational modification by glucose, and it contains predominantly glycated NH2-terminal 13-chains. There is a strong correlation between levels of HbAic and the average blood glucose levels over the previous 3 months. Thus HbA1, is often viewed as the "gold standard" for measuring sustained blood glucose control (Bunn, H.F. et al., 1978, Science. 200, 21-7). HbA1, can be measured by ion-exchange HPLC or immunoassay; home blood collection and mailing kits for HbA1c measurement are now widely available. Serum fructosamine is another measure of stable glucose control and can be measured by a colorimetric method (Cobas Integra, Roche Diagnostics).

Certain Short Antisense Compounds Targeted to an ApoB Nucleic Acid
-53-In certain embodiments, short antisense compounds are targeted to an ApoB
nucleic acid having the sequence of GENBANK Accession No. NM_000384.1, incorporated herein as SEQ
ID NO: 1. In certain such embodiments, a short antisense compound targeted to SEQ ID NO: 1 is at least 90%
complementary to SEQ ID NO: 1. In certain such embodiments, a short antisense compound targeted to SEQ ID NO: 1 is at least 95% complementary to SEQ ID NO: 1. In certain such embodiments, a short antisense compound targeted to SEQ ID NO: 1 is 100% complementary to SEQ ID
NO: 1. In certain embodiments, a short antisense compound targeted to SEQ ID NO: 1 comprises a nucleotide sequence selected from the nucleotide sequences set forth in Table 2 and Table 3.
The nucleotide sequence set forth in each SEQ ID NO in Tables 2 and 3 is independent of any modification to a sugar moiety, a monomeric linkage, or a nucleobase. As such, short antisense compounds defined by a SEQ ID NO may comprise, independently, one or more modifications to a sugar moiety, an internucleoside linkage, or a nucleobase. Antisense compounds described by Isis Number (Isis NO.) indicate a combination of nucleobase sequence and one or more modifications to a sugar moiety, an internucleoside linkage, or a nucleobase.
Tables 2 and 3 illustrate examples of short antisense compounds targeted to SEQ ID NO: 1. Table 2 illustrates short antisense compounds that are 100% complementary to SEQ ID
NO: 1. Table 3 illustrates short antisense compounds that have one or two mismatches with respect to SEQ ID NO: 1.
The column labeled `gapmer motif indicates the wing-gap-wing motif of each short antisense compounds. The gap segment comprises 2'-deoxynucleotides and each nucleotide of each wing segment comprises a 2'-modified sugar. The particular 2'-modified sugar is also indicated in the `gapmer motif colunm. For example, `2-10-2 MOE' means a 2-10-2 gapmer motif, where a gap segment of ten 2'-deoxynucleotides is flanked by wing segments of two nucleotides, where the nucleotides of the wing segments are 2'-MOE nucleotides. Internucleoside linkages are phosphorothioate. The short antisense compounds comprise 5-methylcytidine in place of unmodified cytosine, unless "unmodified cytosine" is listed in the gapmer motif column, in which case the indicated cytosines are unmodified cytosines. For example, "5-mC in gap only" indicates that the gap segment has 5-methylcytosines, while the wing segments have unmodified cytosines.

Table 2: Short Antisense Compounds targeted to SEQ ID NO: 1 5' 3' ISIS Target Target SEQ
No Site Site Se uence 5'-3' Ga mer Motif ID NO
-54-3-10-3 Methyleneoxy BNA Unmodified 387461 3409 3424 TTGTTCTGAATGTCCA cytosines in gap 70 3-10-3 Methyleneoxy
-55-
-56-Table 3: Short antisense compounds targeted to SEQ ID NO: 1 and having 1 or 2 mismatches 5' 3' SEQ
Isis Target Target ID
NO. Site Site Sequence (5'-3') Gapmer Motif NO
-57-2-10-2 Methyleneoxy 1-1-10-2 2'-(butylacetomido)-palmitamide Methyleneoxy BNA/Methyleneoxy BNA
Unmodified cytosines in 391872 8256 8269 GGTACATGGAAGTC gap 190 2-10-2 Methyleneoxy 1-1-10-2 2'-(butylacetomido)-palmitamide/MOE/MOE
Unmodified cytosines in 391871 8256 8269 GGTACATGGAAGTC gap 190 391755 8256 8269 GGTACATGGAAGTC mC in wing only 190 2-10-2 (6'S)-6'-methyl-Methyleneoxy BNA
398296 8256 8269 GGTACATGGAAGTC Unmodified Cytosines 190
-58-In certain embodiments, a target region is nucleotides 263-278 of SEQ ID NO:
1. In certain such embodiments, short antisense compounds targeted to nucleotides 263-278 of SEQ
ID NO: 1 comprise a nucleotide sequence selected from SEQ ID NO: 16 or 17. In certain such embodiments, a short antisense compound targeted to nucleotides 263-278 of SEQ ID NO: 1 is selected from Isis NO. 372816 or 372894.
In certain embodiments, a target region is nucleotides 428-483 of SEQ ID NO:
1. In certain such embodiments, a short antisense compound targeted to nucleotides 428-483 of SEQ
ID NO: 1 comprises a nucleotide sequence selected from SEQ ID NO 18, 19, 20, 21, 22, 23, 24, 25, 26, or 27. In certain such embodiments, a short antisense compound targeted to nucleotides 428-483 of SEQ
ID NO: I is selected from Isis NO. 372817, 372895, 372818, 372896, 372819, 372897, 372820, 372898, 372821, or 372899.
In certain embodiments, a target region is nucleotides 428-458 of SEQ ID NO:
1. In certain such embodiments, a short antisense compound targeted to nucleotides 428-458 of SEQ
ID NO: 1 comprises a nucleotide sequence selected from SEQ ID NO 18, 19, 20, 21, 22, 23, 24, or 25.
In certain such embodiments, a short antisense compound targeted to nucleotides 428-458 of SEQ
ID NO: 1 is selected from Isis NO. 372817, 372895, 372818, 372896, 372819, 372897, 372820, or 372898.
In certain embodiments, a target region is nucleotides 468-483 of SEQ ID NO:
1. In certain such embodiments, a short antisense compound targeted to nucleotides 468-483 of SEQ
ID NO: 1 comprises a nucleotide sequence selected from SEQ ID NO 26 or 27. In certain such embodiments, a short antisense compound targeted to nucleotides 468-483 of SEQ ID NO: 1 is selected from Isis NO. 372821 or 372899.
In certain embodiments, a target region is nucleotides 587-607 of SEQ ID NO:
1. In certain such embodiments, a short antisense compound targeted to nucleotides 587-607 of SEQ
ID NO: I comprises a nucleotide sequence selected from SEQ ID NO 28, 29, 30, or 31. In certain such embodiments, a short antisense compound targeted to nucleotides 587-607 of SEQ ID NO: 1 is selected from ISIS NO. 372822, 372900, 372823, or 372901.
In certain embodiments, a target region is nucleotides 715-736 of SEQ ID NO:
1. In certain such embodiments, a short antisense compound targeted to nucleotides 715-736 of SEQ
ID NO: 1 comprises a nucleotide sequence selected from SEQ ID NO 32, 33, 34, 35, 36, 37, 38, 39, or 40. In certain such embodiments, a short antisense compound targeted to nucleotides 715-736 of SEQ
ID NO: 1 is selected from Isis NO. 346583, 346584, 346585, 346586, 346587, 346588, 346589, 346590, or 346591.
In certain embodiments, a target region is nucleotides 929-944 of SEQ ID NO:
1. In certain such embodiments, a short antisense compound targeted to nucleotides 929-944 of SEQ
ID NO: 1 comprises a
-59-nucleotide sequence selected from SEQ ID NO 41 or 42. In certain such embodiments, a short antisense compound targeted to nucleotides 929-944 of SEQ ID NO: 1 is selected from Isis NO. 372824 or 372902.
In certain embodiments, a target region is nucleotides 1256-1319 of SEQ ID NO:
1. In certain such embodiments, a short antisense compound targeted to nucleotides 1256-1319 of SEQ ID NO: 1 comprises a nucleotide sequence selected from SEQ ID NO 43, 44, 45, or 46. In certain such embodiments, a short antisense compound targeted to nucleotides 1256-1319 of SEQ ID NO: 1 is selected from Isis NO. 372825, 372903, 372826, or 372904.
In certain embodiments, a target region is nucleotides 1256-1271 of SEQ ID NO:
1. In certain such embodiments, a short antisense compound targeted to nucleotides 1256-1271 of SEQ ID NO: I
comprises a nucleotide sequence selected from SEQ ID NO 43 or 44. In certain such embodiments, a short antisense compound targeted to nucleotides 1256-1271 of SEQ ID NO: 1 is selected from Isis NO.
372825 or 372903.
In certain embodiments, a target region is nucleotides 1304-1319 of SEQ ID NO:
1. In certain such embodiments, a short antisense compound targeted to nucleotides 1304-1319 of SEQ ID NO: 1 comprises a nucleotide sequence selected from SEQ ID NO 45 or 46. In certain such embodiments, a short antisense compound targeted to nucleotides 1304-1319 of SEQ ID NO: 1 is selected from Isis NO.
372826 or 372904.
In certain embodiments, a target region is nucleotides 2135-2150 of SEQ ID NO:
1. In certain such embodiments, a short antisense compound targeted to nucleotides 2135-2150 of SEQ ID NO: 1 comprises a nucleotide sequence selected from SEQ ID NO 47 or 48. In certain such embodiments, a short antisense compound targeted to nucleotides 2135-2150 of SEQ ID NO: 1 is selected from ISIS NO.
372829 or 372907.
In certain embodiments, a target region is nucleotides 2774-2794 of SEQ ID NO:
1. In certain such embodiments, a short antisense compound targeted to nucleotides 2774-2794 of SEQ ID NO: 1 comprises a nucleotide sequence selected from SEQ ID NO 49, 50, 51, or 52. In certain such embodiments, a short antisense compound targeted to nucleotides 2774-2794 of SEQ ID NO: 1 is selected from ISIS NO. 372832, 372910, 372833, or 372911.
In certain embodiments, a target region is nucleotides 2961-2976 of SEQ ID NO:
1. In certain such embodiments, a short antisense compound targeted to nucleotides 2961-2976 of SEQ ID NO: 1 comprises a nucleotide sequence selected from SEQ ID NO 53 or 54. In certain such embodiments, a short antisense compound targeted to nucleotides 2961-2976 of SEQ ID NO: 1 is selected from ISIS NO.
372835 or 372913.
In certain embodiments, a target region is nucleotides 3248-3269 of SEQ ID NO:
1. In certain such embodiments, a short antisense compound targeted to nucleotides 3248-3269 of SEQ ID NO: 1 comprises a nucleotide sequence selected from SEQ ID NO 55, 56, 57, 58, 59,
60, 61, 62, or 63. In certain such embodiments, a short antisense compound targeted to nucleotides 3248-3269 of SEQ ID NO: 1 is selected from ISIS NO. 346592, 346593, 346594, 346595, 346596, 346597, 346598, 346599, or 346600.

In certain embodiments, a target region is nucleotides 3350-3375 of SEQ ID NO:
1. In certain such embodiments, a short antisense compound targeted to nucleotides 3350-3375 of SEQ ID NO: 1 comprises a nucleotide sequence selected from SEQ ID NO 64, 65, 66, 67, 68, or 69. In certain such embodiments, a short antisense compound targeted to nucleotides 3350-3375 of SEQ ID NO: 1 is selected from ISIS NO. 372836, 372914, 372837, 372915, 372838, or 372916.
In certain embodiments, a target region is nucleotides 3409-3424 of SEQ ID NO:
1. In certain such embodiments, a short antisense compound targeted to nucleotides 3409-3424 of SEQ ID NO: 1 comprises a nucleotide sequence selected from SEQ ID NO 70 or 73. In certain such embodiments, a short antisense compound targeted to nucleotides 3409-3424 of SEQ ID NO: 1 is selected from ISIS NO.
372839, 387461, 380147, or 372917.
In certain embodiments, a target region is nucleotides 3573-3588 of SEQ ID NO:
1. In certain such embodiments, a short antisense compound targeted to nucleotides 3573-3588 of SEQ ID NO: 1 comprises a nucleotide sequence selected from SEQ ID NO 74 or 75. In certain such embodiments, a short antisense compound targeted to nucleotides 3573-3588 of SEQ ID NO: 1 is selected from ISIS NO.
372840 or 372918.
In certain embodiments, a target region is nucleotides 3701-3716 of SEQ ID NO:
1. In certain such embodiments, a short antisense compound targeted to nucleotides 3701-3716 of SEQ ID NO: 1 comprises a nucleotide sequence selected from SEQ ID NO 76 or 77. In certain such embodiments, a short antisense compound targeted to nucleotides 3701-3716 of SEQ ID NO: 1 is selected from ISIS NO.
372841 or 372919.
In certain embodiments, a target region is nucleotides 4219-4234 of SEQ ID NO:
1. In certain such embodiments, a short antisense compound targeted to nucleotides 4219-4234 of SEQ ID NO: 1 comprises a nucleotide sequence selected from SEQ ID NO 78 or 79. In certain such embodiments, a short antisense compound targeted to nucleotides 4219-4234 of SEQ ID NO: 1 is selected from ISIS NO.
372843 or 372921.
In certain embodiments, a target region is nucleotides 4301-4323 of SEQ ID NO:
1. In certain such embodiments, a short antisense compound targeted to nucleotides 4301-4323 of SEQ ID NO: 1 comprises a nucleotide sequence selected from SEQ ID NO 80, 81, 82, or 83. In certain embodiments, a short antisense compound targeted to nucleotides 4301-4323 of SEQ ID NO: 1 is selected from ISIS NO.
372844, 372922, 372845, or 372923.
In certain embodiments, a target region is nucleotides 5588-5609 of SEQ ID NO:
1. In certain such embodiments, a short antisense compound targeted to nucleotides 5588-5609 of SEQ ID NO: 1 comprises a nucleotide sequence selected from SEQ ID NO 84, 85, 86, 87, 88, 89, 90, 91, or 92. In certain such embodiments, a short antisense compound targeted to nucleotides 5588-5609 of SEQ ID NO: 1 is selected from ISIS NO. 346601, 346602, 346603, 346604, 346605, 346606, 346607, 346608, or 346609.
In certain embodiments, a target region is nucleotides 5924-5939 of SEQ ID NO:
1. In certain such embodiments, a short antisense compound targeted to nucleotides 5924-5939 of SEQ ID NO: 1
-61-comprises a nucleotide sequence selected from SEQ ID NO 93 or 94. In certain such embodiments, a short antisense compound targeted to nucleotides 5924-5939 of SEQ ID NO: 1 is selected from ISIS NO.
372851 or 372929.
In certain embodiments, a target region is nucleotides 6664-6679 of SEQ ID NO:
1. In certain such embodiments, a short antisense compound targeted to nucleotides 6664-6679 of SEQ ID NO: 1 comprises a nucleotide sequence selected from SEQ ID NO 95 or 96. In certain such embodiments, a short antisense compound targeted to nucleotides 6664-6679 of SEQ ID NO: 1 is selected from ISIS NO.
372854 or 372932.
In certain embodiments, a target region is nucleotides 6908-6923 of SEQ ID NO:
1. In certain such embodiments, a short antisense compound targeted to nucleotides 6908-6923 of SEQ ID NO: 1 comprises a nucleotide sequence selected from SEQ ID NO 97 or 98. In certain such embodiments, a short antisense compound targeted to nucleotides 6908-6923 of SEQ ID NO: 1 is selected from ISIS NO.
372855 or 372933.
In certain embodiments, a target region is nucleotides 7190-7205 of SEQ ID NO:
1. In certain such embodiments, a short antisense compound targeted to nucleotides 7190-7205 of SEQ ID NO: 1 comprises a nucleotide sequence selected from SEQ ID NO 99 or 100. In certain such embodiments, a short antisense compound targeted to nucleotides 7190-7205 of SEQ ID NO: 1 is selected from ISIS NO.
372856 or 372934.
In certain embodiments, a target region is nucleotides 7817-7839 of SEQ ID NO:
1. In certain such embodiments, a short antisense compound targeted to nucleotides 7817-7839 of SEQ ID NO: 1 comprises a nucleotide sequence selected from SEQ ID NO 101, 102, 104, 105, 106, 107, 108, 109, 110, or 111. In certain such embodiments, a short antisense compound targeted to nucleotides 7817-7839 of SEQ ID NO: 1 is selected from ISIS NO. 372858, 372936, 346610, 346611, 346612, 346613, 346614, 346615, 346616, 346617, or 346618.
In certain embodiments, a target region is nucleotides 7995-8010 of SEQ ID NO:
1. In certain such embodiments, a short antisense compound targeted to nucleotides 7995-8010 of SEQ ID NO: 1 comprises a nucleotide sequence selected from SEQ ID NO 112 or 113. In certain such embodiments, a short antisense compound targeted to nucleotides 7995-8010 of SEQ ID NO: 1 is selected from ISIS NO.
372859 or 372937.
In certain embodiments, a target region is nucleotides 8336-8356 of SEQ ID NO:
1. In certain such embodiments, a short antisense compound targeted to nucleotides 8336-8356 of SEQ ID NO: 1 comprises a nucleotide sequence selected from SEQ ID NO 114, 115, 116, or 117.
In certain such embodiments, a short antisense compound targeted to nucleotides 8336-8356 of SEQ ID NO: 1 is selected from ISIS NO. 372861, 372939, 372862, or 372940.
In certain embodiments, a target region is nucleotides 8539-8554 of SEQ ID NO:
1. In certain such embodiments, a short antisense compound targeted to nucleotides 8539-8554 of SEQ ID NO: 1 comprises a nucleotide sequence selected from SEQ ID NO 118 or 119. In certain such embodiments, a
-62-short antisense compound targeted to nucleotides 8539-8554 of SEQ ID NO: 1 is selected from ISIS NO.
372863 or 372941.
In certain embodiments, a target region is nucleotides 9344-9359 of SEQ ID NO:
1. In certain such embodiments, a short antisense compound targeted to nucleotides 9344-9359 of SEQ ID NO: 1 comprises a nucleotide sequence selected from SEQ ID NO 120 or 121. In certain such embodiments, a short antisense compound targeted to nucleotides 9344-9359 of SEQ ID NO: 1 is selected from ISIS NO.
372871 or 372949.
In certain embodiments, a target region is nucleotides 9515-9530 of SEQ ID NO:
1. In certain such embodiments, a short antisense compound targeted to nucleotides 9515-9530 of SEQ ID NO: 1 comprises a nucleotide sequence selected from SEQ ID NO 122 or 123. In certain such embodiments, a short antisense compound targeted to nucleotides 9515-9530 of SEQ ID NO: 1 is selected from ISIS NO.
372872 or 372950.
In certain embodiments, a target region is nucleotides 9794-9809 of SEQ ID NO:
1. In certain such embodiments, a short antisense compound targeted to nucleotides 9794-9809 of SEQ ID NO: 1 comprises a nucleotide sequence selected from SEQ ID NO 124 or 125. In certain such embodiments, a short antisense compound targeted to nucleotides 9794-9809 of SEQ ID NO: 1 is selected from ISIS NO.
372875 or 372953.
In certain embodiments, a target region is nucleotides 10157-10187 of SEQ ID
NO: 1. In certain such embodiments, a short antisense compound targeted to nucleotides 10157-10187 of SEQ ID NO: 1 comprises a nucleotide sequence selected from SEQ ID NO 126, 127, 128, 129, 130, 131, 132, or 133. In certain such embodiments, a short antisense compound targeted to nucleotides 10157-10187 of SEQ ID
NO: 1 is selected from ISIS NO. 372877, 372955, 372878, 372956, 372879, 372957, 372880, or 372958.
In certain embodiments, a target region is nucleotides 10838-10859 of SEQ ID
NO: 1. In certain such embodiments, a short antisense compound targeted to nucleotides 10838-10859 of SEQ ID NO: 1 comprises a nucleotide sequence selected from SEQ ID NO 134, 135, 136, 137, 138, 139, 140, 141, or 142. In certain such embodiments, a short antisense compound targeted to nucleotides 10838-10859 of SEQ ID NO: 1 is selected from ISIS NO. 346619, 346620, 346621, 346622, 346623, 346624, 346625, 346626, or 346627.
In certain embodiments, a target region is nucleotides 13689-13714 of SEQ ID
NO: 1. In certain such embodiments, a short antisense compound targeted to nucleotides 13689-13714 of SEQ ID NO: 1 comprises a nucleotide sequence selected from SEQ ID NO 143, 144, 145, 146, 147, or 148. In certain such embodiments, a short antisense compound targeted to nucleotides 13689-13714 of SEQ ID NO: 1 is selected from ISIS NO. 372890, 372968, 372891, 372969, 372892, or 372970.
In certain embodiments, a target region is nucleotides 13907-13928 of SEQ ID
NO: 1. In certain such embodiments, a short antisense compound targeted to nucleotides 13907-13928 of SEQ ID NO: 1 comprises a nucleotide sequence selected from SEQ ID NO 149, 150, 151, 152, 153, 154, 155, 156, or 157. In certain such embodiments, a short antisense compound targeted to nucleotides 13907-13928 of
-63-SEQ ID NO: 1 is selected from ISIS NO. 346628, 346629, 346630, 346631, 346632, 346633, 346634, 346635, or 346636.
In certain embodiments, a target region is nucleotides 13963-13984 of SEQ ID
NO: 1. In certain such embodiments, a short antisense compound targeted to nucleotides 13963-13984 of SEQ ID NO: 1 comprises a nucleotide sequence selected from SEQ ID NO 158, 159, 160, 161, 162, 163, 164, 165, or 166. In certain such embodiments, a short antisense compound targeted to nucleotides 13963-13984 of SEQ ID NO: 1 is selected from ISIS NO. 346637, 346638, 346639, 346640, 346641, 346642, 346643, 346644, or 346645.
In certain embodiments, a target region is nucleotides 14051-14072 of SEQ ID
NO: 1. In certain such embodiments, a short antisense compound targeted to nucleotides 14051-14072 of SEQ ID NO: 1 comprises a nucleotide sequence selected from SEQ ID NO 167, 168, 169, 170, 171, 172, 173, 174, or 175. In certain such embodiments, a short antisense compound targeted to nucleotides 14051-14072 of SEQ ID NO: 1 is selected from ISIS NO. 346646, 346647, 346648, 346649, 346650, 346651, 346652, 346653, or 346654.
In certain embodiments, short antisense compounds targeted to an ApoB nucleic acid are 8 to 16, preferably 9 to 15, more preferably 9 to 14, more preferably 10 to 14 nucleotides in length. In certain embodiments, short antisense compounds targeted to an ApoB nucleic acid are 9 to 14 nucleotides in length. In certain embodiments, short antisense compounds targeted to an ApoB
nucleic acid are 10 to 14 nucleotides in length. In certain embodiments, such short antisense compounds are short antisense oligonucleotides.
In certain embodiments, short antisense compounds targeted to an ApoB nucleic acid are short gapmers. In certain such embodiments, short gapmers targeted to an ApoB
nucleic acid comprise at least one high affinity modification in one or more wings of the compound. In certain embodiments, short antisense compounds targeted to an ApoB nucleic acid comprise 1 to 3 high-affinity modifications in each wing. In certain such embodiments, the nucleosides or nucleotides of the wing comprise a 2' modification. In certain such embodiments, the monomers of the wing are BNA's.
In certain such embodiments, the monomers of the wing are selected from a-L-Methyleneoxy (4'-CH2-O-2') BNA ,P-D-Methyleneoxy (4'-CH2-O-2') BNA , Ethyleneoxy (4'-(CHZ)2-0-2') BNA , Aminooxy (4'-CH2-O-N(R)-2') BNA and Oxyamino (4'-CHZ-N(R)-0-2') BNA. In certain embodiments, the monomers of a wing comprise a substituent at the 2' position selected from allyl, amino, azido, thio, O-allyl, O-Cl-CIo alkyl, -OCF3, 0-(CH2)2-O-CH3, 2'-O(CH2)2SCH3, O-(CH2)2-O-N(Rm)(Rõ), and O-CH2-C(=O)-N(R,n)(Rõ), where each R. and Rn is, independently, H or substituted or unsubstituted Cl-Cio alkyl. In certain embodiments, the monomers of a wing are 2'MOE nucleotides.
In certain embodiments, short antisense compounds targeted to an ApoB nucleic acid comprise a gap between the 5' wing and the 3' wing. In certain embodiments the gap comprises five, six, seven, eight, nine, ten, eleven, twelve, thirteen, or fourteen monomers. In certain embodiments, the monomers of the gap are unmodified deoxyribonucleotides. In certain embodiments, the monomers of the gap are
-64-unmodified ribonucleotides. In certain embodiments, gap modifications (if any) gap result in an antisense compound that, when bound to its target nucleic acid, supports cleavage by an RNase, including, but not limited to, RNase H.
In certain embodiments, short antisense compounds targeted to an ApoB nucleic acid have uniform monomeric linkages. In certain such embodiments, those linkages are all phosphorothioate linkages. In certain embodiments, the linkages are all phosphodiester linkages. In certain embodiments, short antisense compounds targeted to an ApoB nucleic acid have mixed backbones.
In certain embodiments, short antisense compounds targeted to an ApoB nucleic acid are 8 monomers in length. In certain embodiments, short antisense compounds targeted to an ApoB nucleic acid are 9 monomers in length. In certain embodiments, short antisense compounds targeted to an ApoB
nucleic acid are 10 monomers in length. In certain embodiments, short antisense compounds targeted to an ApoB nucleic acid are 11 monomers in length. In certain embodiments, short antisense compounds targeted to an ApoB nucleic acid are monomers in length. In certain embodiments, short antisense compounds targeted to an ApoB nucleic acid are 13 monomers in length. In certain embodiments, short antisense compounds targeted to an ApoB nucleic acid are 14 monomers in length. In certain embodiments, short antisense compounds targeted to an ApoB nucleic acid are 15 monomers in length.
In certain embodiments, short antisense compounds targeted to an ApoB nucleic acid are 16 monomers in length. In certain embodiments, short antisense compounds targeted to an ApoB
nucleic acid comprise 9 to 15 monomers. In certain embodiments, short antisense compounds targeted to an ApoB nucleic acid comprise 10 to 15 monomers. In certain embodiments, short antisense compounds targeted to an ApoB
nucleic acid comprise 12 to 14 monomers. In certain embodiments, short antisense compounds targeted to an ApoB nucleic acid comprise 12 to 14 nucleotides or nucleosides.
In certain embodiments, the invention provides methods of modulating expression of ApoB. In certain embodiments, such methods comprise use of one or more short antisense compound targeted to an ApoB nucleic acid, wherein the short antisense compound targeted to an ApoB
nucleic acid is from about 8 to about 16, preferably 9 to 15, more preferably 9 to 14, more preferably 10 to 14 monomers (i.e. from about 8 to about 16 linked monomers). One of ordinary skill in the art will appreciate that this comprehends methods of modulating expression of ApoB using one or more short antisense compounds targeted to an ApoB nucleic acid of 8, 9, 10, 11, 12, 13, 14, 15 or 16 monomers.
In certain embodiments, methods of modulating ApoB comprise use of a short antisense compound targeted to an ApoB nucleic acid that is 8 monomers in length. In certain embodiments, methods of modulating ApoB comprise use of a short antisense compound targeted to an ApoB nucleic acid that is 9 monomers in length. In certain embodiments, methods of modulating ApoB comprise use of a short antisense compound targeted to an ApoB nucleic acid that is 10 monomers in length. In certain embodiments, methods of modulating ApoB comprise use of a short antisense compound targeted to an ApoB nucleic acid that is 11 monomers in length. In certain embodiments, methods of modulating ApoB
comprise use of a short antisense compound targeted to an ApoB nucleic acid that is 12 monomers in
-65-length. In certain embodiments, methods of modulating ApoB comprise use of a short antisense compound targeted to an ApoB nucleic acid that is 13 monomers in length. In certain embodiments, methods of modulating ApoB comprise use of a short antisense compound targeted to an ApoB nucleic acid that is 14 monomers in length. In certain embodiments, methods of modulating ApoB comprise use of a short antisense compound targeted to an ApoB nucleic acid that is 15 monomers in length. In certain embodiments, methods of modulating ApoB comprise use of a short antisense compound targeted to an ApoB nucleic acid that is 16 monomers in length.
In certain embodiments, methods of modulating expression of ApoB comprise use of a short antisense compound targeted to an ApoB nucleic acid comprising 9 to 15 monomers. In certain embodiments, methods of modulating expression of ApoB comprise use of a short antisense compound targeted to an ApoB nucleic acid comprising 10 to 15 monomers. In certain embodiments, methods of modulating expression of ApoB comprise use of a short antisense compound targeted to an ApoB nucleic acid comprising 12 to 14 monomers. In certain embodiments, methods of modulating expression of ApoB comprise use of a short antisense compound targeted to an ApoB nucleic acid comprising 12 or 14 nucleotides or nucleosides.
In certain embodiments, short antisense compounds targeting a ApoB nucleic acid may have any one or more properties or characteristics of the short antisense compounds generally described herein. In certain embodiments, short antisense compounds targeting a ApoB nucleic acid have a motif (wing -deoxy gap -wing) selected from 1-12-1, 1-1-10-2, 2-10-1-1, 3-10-3, 2-10-3, 2-10-2, 1-10-1,1-10-2, 3-8-3, 2-8-2, 1-8-1, 3-6-3 or 1-6-1, more preferably 1-10-1, 2-10-2, 3-10-3, and 1-9-2.

2. SGLT-2 Sodium dependent glucose transporter 2 (SGLT-2) is expressed in the kidney proximal tubule epithelial cells, and functions to reabsorb glucose preventing glucose loss in the urine. For the human genome SGLT-2 is a member of an 11-membered family of sodium substrate co-transporters. Many of these family members share sequence homology, for example SGLT-1 shares about 59% sequence identity with SGLT-2 and about 70% sequence identity with SGLT-3. SGLT-1 is a glucose transporter found in the heart and the CNS. SGLT-3 is a glucose sensing sodium channel in the small intestine. The separate localization patterns for these SGLTs is one point of distinction between the homologous family members. (Handlon, A.L., Expert Opin. Ther. Patents (2005) 15(11):1532-1540;
Kanai et al., J. Clin.
Invest., 1994, 93, 397-404; Wells et al., Am. J. Physiol. Endocrinol. Metab., 1992, 263, F459-465).
Studies of human SGLT2 injected into Xenopus oocytes demonstrated that this protein mediates sodium-dependent transport of D-glucose and .alpha.-methyl-D-glucopyranoside (.alpha.-MeGlc; a glucose analog) with a Km value of 1.6 mM for .alpha.-MeGlc and a sodium to glucose coupling ratio of 1:1 (Kanai et al., J. Clin. Invest., 1994, 93, 397-404; You et al., J. Biol.
Chem., 1995, 270, 29365-29371).
This transport activity was suppressed by phlorizin, a plant glycoside that binds to the glucose site of the
-66-SGLTs but is not transported and thus inhibits SGLT action (You et al., J.
Biol. Chem., 1995, 270, 29365-29371).
Diabetes is a disorder characterized by hyperglycemia due to deficient insulin action. Chronic hyperglycemia is a major risk factor for diabetes-associated complications, including heart disease, retinopathy, nephropathy and neuropathy. As the kidneys play a major role in the regulation of plasma glucose levels, renal glucose transporters are becoming attractive drug targets (Wright, Am. J. Physiol.
Renal Physiol., 2001, 280, F10-18). Diabetic nephropathy is the most conunon cause of end-stage renal disease that develops in many patients with diabetes. Glucotoxicity, which results from long-term hyperglycemia, induces tissue-dependent insulin resistance in diabetic patients (Nawano et al., Am. J.
Physiol. Endocrinol. Metab., 2000, 278, E535-543).

Defznitions "Sodium dependent glucose transporter 2" is the gene product or protein of which expression is to be modulated by administration of a short antisense compound. Sodium dependent glucose transporter 2 is generally referred to as SGLT2 but may also be referred to as SLC5A2;
sodium-glucose transporter 2;
sodium-glucose cotransporter, kidney low affmity; sodium-glucose cotransporter, renal; solute carrier family 5 (sodium/glucose cotransporter), member 2; SL52.
"SGLT2 nucleic acid" means any nucleic acid encoding SGLT2. For example, in certain embodiments, a SGLT2 nucleic acid includes, without limitation, a DNA sequence encoding SGLT2, an RNA sequence transcribed from DNA encoding SGLT2, and an mRNA sequence encoding SGLT2.
"SGLT2 mRNA" means an mRNA encoding a SGLT2 protein.
Therapeutic indications In certain embodiments, short antisense compounds are used to modulate expression of SGLT-2 and related proteins. In certain embodiments, such modulation is accomplished by providing short antisense compounds that hybridize with one or more target nucleic acid molecules encoding SGLT-2, including, but is not limited to, SGLT2, SL52, SLC5A2, Sodium-Glucose Co-Transporter, Kidney Low Affinity Sodium-Glucose Co-Transporter, Renal Sodium-Glucose Co-Transporter 2 and Solute Carrier Family 5 Sodium/Glucose Co-Transporter Member 2. Also provided are methods of treating metabolic and/or cardiovascular disease and disorders as described herein. In particular embodiments, short antisense compounds that inhibit the expression of SGLT2 are used in methods of lowering blood glucose levels in an animal and methods of delaying or preventing the onset of type 2 diabetes. Such methods comprise administering a therapeutically or prophylactically effective amount of one or more of the compounds of the invention to the animal, which may be in need of treatment. The one or more compounds can be a short antisense compound targeting a nucleic acid encoding SGLT2. Provided herein are methods of enhancing inhibition of expression of SGLT2 in kidney cells or kidney tissues, comprising contacting the cells or tissues with one or more of the compounds of the invention, such as short antisense compounds targeting a nucleic
-67-acid encoding SGLT2.
While certain compounds, compositions and methods have been described with specificity in accordance with certain embodiments, the following examples serve only to illustrate the compounds of the invention and are not intended to limit the same.
In certain embodiments, short antisense compounds are chimeric oligomeric compounds having mixed phosphorothioate and phosphodiester backbones,. Certain mixed backbone short antisense compounds have a central gap comprising at least 5 contiguous 2'-deoxy nucleosides flanked by two wings each of which comprises at least one 2'-O-methoxyethyl nucleoside. In certain embodiments, the internucleoside linkages of the mixed backbone compounds are phosphorothioate linkages in the gap and phosphodiester linkages in the two wings. In certain embodiments, mixed backbone compounds have phosphorothioate linkages in the wings, except for one phosphodiester linkage at one or both of the extreme 5' and 3' ends of the oligonucleotide. In certain embodiments short antisense compounds targeted to SGLT2 have a motif (wing - deoxy gap -wing) selected from 3-10-3, 2-10-3, 2-10-2, 1-10-1,1-10-2, 2-8-2, 1-9-2, 1-8-1, 3-6-3 or 1-6-1. In certain embodiments short antisense compounds targeted to SGLT2 have a motif (wing - deoxy gap -wing) selected from 1-10-1, 1-10-2, 2-8-2, 1-9-2, 1-8-1, 3-6-3 or 1-6-1.
In certain embodiments, short antisense compounds targeted to an SGLT2 nucleic acid and having a mixed backbone are efficiently delivered to the kidney. In certain embodiments, administration of short antisense compounds targeted to an SGLT2 nucleic acid and having a mixed backbone results in modulation of target gene expression in the kidney. In certain such embodiments, there is little or no liver or kidney toxicity. In certain embodiments, short antisense compounds targeted to an SGLT2 nucleic acid and having a mixed backbone are more potent for reducing SGLT-2 mRNA and have a faster onset compared with a short antisense compound that does not have a mixed back-bone, but is otherwise identical. In certain such embodiments, such increase potency and/or reduced toxicity is in mouse and/or rat. In certain such embodiments, such increase potency and/or reduced toxicity is in a human.
By way of example, and only for illustrative purposes, ISIS 145733, which comprises uniform phosphorothioate linkages and ISIS 257016 which comprises phosphodiester linkage in the wings and phosphorothioate linkages in the gap, are otherwise identical. Both comprise the sequence GAAGTAGCCACCAACTGTGC (SEQ ID NO. 1572). Both of the oligonucleotides further comprise a gap consisting of ten 2'-deoxynucleotides, flanked on each side by five-nucleotide "2'-methoxyethyl (2'-MOE) nucleotides. All cytidine residues are 5-methylcytidines. The mixed back-bone compound, ISIS
257016, was about 50 times more potent for reducing SGLT-2 mRNA compared to the non-mixed parent compound, ISIS 145733 (see EXAMPLE 9).
Pharmacokinetic studies of certain mixed backbone compound ISIS 257016 indicate that in certain embodiments, the compound acts as a prodrug that is metabolized to a 12 nucleobase pharmacophore. Studies with ISIS 370717, a 12 nucleobase short antisense compound corresponding to
-68-ISIS 257016, show that the compound has a similar pharmacological profile to ISIS 257016 but with a faster onset of action. ISIS 370717 is a 12 nucleobase antisense oligonucleotide targeted to SGLT-2 comprising the sequence TAGCCACCAACT (SEQ ID NO. 1554), further comprising a gap consisting of ten 2'-deoxynucleotides, flanked on both sides by one-nucleotide wings. The wings are composed of 2'-methoxyethyl (2'-MOE) nucleotides. All cytidine residues are 5-methylcytidines. The intemucleoside linkages are phosphorothioate (P=S) throughout the oligonucleotide. The similarity in pharmacological activity of ISIS 257016 and ISIS 370717 supports the pharmacokinetic studies indicating ISIS 257016 was a prodrug having a 12 nucleotide pharmacophore (see EXAMPLE 10). Further, studies with stabilized (end-capped) versions of ISIS 257016 show dramatic loss of activity.
In certain embodiments, short antisense compounds comprising 2' MOE monomers in the wings are efficiently delivered to the kidney and treatment with such compounds results in efficient modulation of target gene expression in the kidney without -liver or kidney toxicity. It is further shown herein that in certain embodiments, short antisense compounds are more potent for reducing SGLT-2 mRNA and have a faster onset compared with parent oligonucleotides targeted to SGLT-2 mRNA
in mouse and rat. 2' MOE gap shortmers are shown herein to improve potency and bioavailability over parent compounds.
By way of example, and only for illustrative purposes studies with ISIS 370717 reveal significantly higher accumulation of the short antisense compound in the kidney tissue (approximately 500 micro grams per gram of tissue) compared to the longer parent. Moreover, SGLT-2 mRNA was reduced by more than 80% over the controls (see EXAMPLE 11). ISIS 370717 1-10-1 gapmer was used as a template to make sequence related oligos with varying motifs. Studies evaluating wing, gap and total length variations around the ISIS 370717 12 mer oligonucleotide can be seen in EXAMPLE 12. Certain motifs evaluated included 1-10-1, 2-8-2, 1-8-1, 3-6-3, and 1-6-1 (see Table 60 in EXAMPLE 12). The compounds were analyzed for their effect on SGLT2 mRNA levels. All the motifs inhibited the expression of SGLT2 in vivo in a dose-dependent manner. The 1-10-1, 2-8-2 and 1-8-1 gapmers were found to be particularly potent. SGLT-2 mRNA was reduced by more than 80% over the controls using these motifs.
In certain embodiments, the invention provides short antisense compounds targeted to an SGLT2 nucleic acid and having a motif selected from: 1-10-1 and 1-10-2 MOE gapmer.
(see Table 62 in EXAMPLE 13). Certain such compounds were analyzed for their effect on rat SGLT2 mRNA. Results in Table 63 illustrate that both the 1-10-1 and 1-10-2 MOE gapmers inhibit the expression of SGLT2 in vivo in a dose-dependent manner and over 80% reduction of SGLT-2 mRNA could be achieved.
Certain additional 1-10-1 and 2-8-2 MOE gapmers were evaluated in both mouse and rat in vivo models (see, e.g., EXAMPLE 14 and 15). Greater than 80% reduction in SGLT-2 mRNA was achieved with many of the 1-10-1 and 2-8-2 MOE gapmers at relatively low concentrations of oligo and in the absence of any toxicity effects.
In another non-limiting example, the effect of ISIS 388625 on dog SGLT2 mRNA
levels was also analyzed. Dog studies illustrate that greater than 80% inhibition of the expression of SGLT2 can be
-69-achieved at a 1 mg/kg/wk dose. Even greater inhibition can be achieved at slightly higher doses.
Administration of ISIS 388625 in dog was also shown to improved glucose tolerance. Peak plasma glucose levels were decreased by over 50% on average and the subsequent drop in glucose was lessened compared to saline controls in a standard glucose tolerance test (See EXAMPLE
17). Also, in a rat model of diabetes, short antisense compounds were shown to significantly decrease plasma glucose levels and HbA1C over time compared to PBS and control treated animals (See Example 16).
The animals in all studies were further evaluated for toxicity. For example, total body weight, liver, spleen and kidney weight were evaluated. Significant changes in spleen, liver or body weight can indicate that a particular compound causes toxic effects. All changes were found to be within the margin of error. No significant changes in body weight were observed during the treatment or at study termination. No significant changes in liver or spleen weights were observed.

Certain Short Antisense Compounds Targeted to an SGLT2 nucleic acid In certain embodiments, short antisense compounds are targeted to an SGLT2 nucleic acid having the sequence of GENBANK Accession No. NM_003041.1, incorporated herein as SEQ ID NO:
2. In certain such embodiments, a short antisense compound targeted to SEQ ID
NO: 3 is at least 90%
complementary to SEQ ID NO: 3. In certain such embodiments, a short antisense compound targeted to SEQ ID NO: 3 is at least 95% complementary to SEQ ID NO: 3. In certain such embodiments, a short antisense compound targeted to SEQ ID NO: 3 is 100% complementary to SEQ ID
NO: 1. In certain embodiments, a short antisense compound targeted to SEQ ID NO: 3 comprises a nucleotide sequence selected from the nucleotide sequences set forth in Table 4 and 5.
The nucleotide sequence set forth in each SEQ ID NO set forth in Tables 4 and 5 is independent of any modification to a sugar moiety, a monomeric linkage, or a nucleobase.
As such, short antisense compounds defined by a SEQ ID NO may comprise, independently, one or more modifications to a sugar moiety, an internucleoside linkage, or a nucleobase. Antisense compounds described by Isis Number (Isis NO.) indicate a combination of nucleobase sequence and one or more modifications to a sugar moiety, an internucleoside linkage, or a nucleobase.
Tables 4 and 5 illustrate examples of short antisense compounds targeted to SEQ ID NO: 3. Table 4 illustrates short antisense compounds that are 100% complementary to SEQ ID
NO: 3. Table 5 illustrates short antisense compounds that have one or two mismatches with respect to SEQ ID NO: 3.
The column labeled `gapmer motifl indicates the wing-gap-wing motif of each short antisense compounds. The gap segment comprises 2'-deoxynucleotides and each nucleotide of each wing segment comprises a 2'-modified sugar. The particular 2'-modified sugar is also indicated in the `gapmer motif column. For example, `2-10-2 MOE' means a 2-10-2 gapmer motif, where a gap segment of ten 2'-deoxynucleotides is flanked by wing segments of two nucleotides, where the nucleotides of the wing segments are 2'-MOE nucleotides. Internucleoside linkages are phosphorothioate. The short antisense compounds comprise 5-methylcytidine in place of unmodified cytosine, unless "unmodified cytosine" is
-70-listed in the gapmer motif column, in which case the indicated cytosines are unmodified cytosines. For example, "5-mC in gap only" indicates that the gap segment has 5-methylcytosines, while the wing segments have unmodified cytosines.

Table 4: Short Antisense Compounds Targeted to SEQ ID NO: 3 5' 3' ISIS Target Target SEQ ID
No Site Site Sequence (5'-3') Gapmer Motif NO

Methyleneoxy Methyleneoxy
-71-Table 5: Short antisense compounds targeted to SEQ ID NO: 3 and having 1 or 2 mismatches 5' 3' ISIS Target Target SEQ ID
No Site Site Sequence (5'-3') Gapmer Motif NO
-72-In certain embodiments, a target region is nucleotides 85-184 of SEQ ID NO: 3.
In certain embodiments, a short antisense compound is targeted to nucleotides 85-184 of SEQ ID NO: 3. In certain such embodiments, a short antisense compound targeted to nucleotides 85-184 comprises a nucleotide sequence selected from SEQ ID NO 214, 215, 216, 217, 218, 219, 221, 222, 223, 224, 225, or 227. In certain such embodiments, a short antisense compound targeted to nucleotides 85-184 of SEQ ID NO: 3 is selected from Isis No 379684, 405193, 405194, 405195, 405196, 405197, 379685, 405198, 405199, 405200, 405201, 379686, 379711 or 388628.
In certain embodiments, a target region is nucleotides 113-132 of SEQ ID NO:
3. In certain embodiments, a short antisense compound is targeted to nucleotides 113-132 of SEQ ID NO: 3. In certain such embodiments, a short antisense compound targeted to nucleotides 113-132 comprises a nucleotide sequence selected from SEQ ID NO 215, 216, 217, 218, 219, 221, 222, 223, or 224. In certain such embodiments, a short antisense compound targeted to nucleotides 113-132 of SEQ
ID NO: 3 is selected from Isis No 405193, 405194, 405195, 405196, 405197, 379685, 405198, 405199, 405200, or 405201.
In certain embodiments, a target region is nucleotides 207-329 of SEQ ID NO:
3. In certain
-73-embodiments, a short antisense compound is targeted to nucleotides 207-329 of SEQ ID NO: 3. In certain such embodiments, a short antisense compound targeted to nucleotides 207-329 comprises a nucleotide sequence selected from SEQ ID NO 228, 229, 230, 232, 233, 234, 235, 236, 237, 238, 239, 240, or 241.
In certain such embodiments, a short antisense compound targeted to nucleotides 207-329 of SEQ ID NO:
3 is selected from Isis No 405202, 405203, 405204, 379687, 405205, 405206, 405207, 405208, 405209, 405210, 405211, 405212, 379688, or 379689.
In certain embodiments, a target region is nucleotides 207-273 of SEQ ID NO:
3. In certain embodiments, a short antisense compound is targeted to nucleotides 207-273 of SEQ ID NO: 3. In certain such embodiments, a short antisense compound targeted to nucleotides 207-273 comprises a nucleotide sequence selected from SEQ ID NO 228, 229, 230, 232, 233, 234, 235, 236, 237, 238, or 239. In certain such embodiments, a short antisense compound targeted to nucleotides 207-273 of SEQ ID NO: 3 is selected from Isis No 405202, 405203, 405204, 379687, 405205, 405206, 405207, 405208, 405209, 405210, 405211, or 405212.
In certain embodiments, a target region is nucleotides 207-219 of SEQ ID NO:
3. In certain embodiments, a short antisense compound is targeted to nucleotides 207-219 of SEQ ID NO: 3. In certain such embodiments, a short antisense compound targeted to nucleotides 207-219 comprises a nucleotide sequence selected from SEQ ID NO 228 or 229. In certain such embodiments, a short antisense compound targeted to nucleotides 207-219 of SEQ ID NO: 3 is selected from Isis NO.. 405202 or 405203.
In certain embodiments, a target region is nucleotides 236-252 of SEQ ID NO:
3. In certain embodiments, a short antisense compound is targeted to nucleotides 236-252 of SEQ ID NO: 3. In certain such embodiments, a short antisense compound targeted to nucleotides 236-252 comprises a nucleotide sequence selected from SEQ ID NO 230, 232, 233, 234, 235, or 236. In certain such embodiments, a short antisense compound targeted to nucleotides 236-252 of SEQ ID NO: 3 is selected from Isis NO. 405204, 379687, 405205, 405206, 405207, 405208, or 405209.
In certain embodiments, a target region is nucleotides 260-273 of SEQ ID NO:
3. In certain embodiments, a short antisense compound is targeted to nucleotides 260-273 of SEQ ID NO: 3. In certain such embodiments, a short antisense compound targeted to nucleotides 260-273 comprises a nucleotide sequence selected from SEQ ID NO 237, 238, or 239. In certain such embodiments, a short antisense compound targeted to nucleotides 260-273 of SEQ ID NO: 3 is selected from Isis NO. 405210, 405211, or 405212.
In certain embodiments, a target region is nucleotides 435-640 of SEQ ID NO:
3. In certain embodiments, a short antisense compound is targeted to nucleotides 435-640 of SEQ ID NO: 3. In certain such embodiments, a short antisense compound targeted to nucleotides 435-640 comprises a nucleotide sequence selected from SEQ ID NO 242, 243, 245, 246, 251, 252, 253, 254, 256, 257, 258, 259, 260, 261, 262, 263, or 264. In certain such embodiments, a short antisense compound targeted to nucleotides 435-640 of SEQ ID NO: 3 is selected from Isis NO. 379690, 405248, 379691, 389780, 379692, 382676,
-74-388625, 392170, 392173, 405213, 405214, 405215, 405216, 379693, 405217, 405218, 405219, 405220, 405221, 405222, 405223, 405224, or 379694.
In certain embodiments, a target region is nucleotides 527-540 of SEQ ID NO:
3. In certain embodiments, a short antisense compound is targeted to nucleotides 527-540 of SEQ ID NO: 3. In certain such embodiments, a short antisense compound targeted to nucleotides 527-540 comprises a nucleotide sequence selected from SEQ ID NO 245, 246, or 251. In certain such embodiments, a short antisense compound targeted to nucleotides 527-540 of SEQ ID NO: 3 is selected from Isis NO. 389780, 379692, 382676, 388626, 392170, 392173, or 405213.
In certain embodiments, a target region is nucleotides 564-603 of SEQ ID NO:
3. In certain embodiments, a short antisense compound is targeted to nucleotides 564-603 of SEQ ID NO: 3. In certain such embodiments, a short antisense compound targeted to nucleotides 564-603 comprises a nucleotide sequence selected from SEQ ID NO 252, 253, 254, 256, 257, 258, 259, 260, 261, 262, or 263. In certain such embodiments, a short antisense compound targeted to nucleotides 564-603 of SEQ ID NO: 3 is selected from Isis NO. 405214, 405215, 405216, 379693, 405217, 405218, 405219, 405220, 405221, 405222, 405223, or 405224.
In certain embodiments, a target region is nucleotides 564-579 of SEQ ID NO:
3. In certain embodiments, a short antisense compound is targeted to nucleotides 564-579 of SEQ ID NO: 3. In certain such embodiments, a short antisense compound targeted to nucleotides 564-579 comprises a nucleotide sequence selected from SEQ ID NO 252, 253, 254, 256, or 257. In certain such embodiments, a short antisense compound targeted to nucleotides 564-579 of SEQ ID NO: 3 is selected from Isis NO. 405214, 405215, 405216, 379693, 405217, or 405218.
In certain embodiments, a target region is nucleotides 587-603 of SEQ ID NO:
3. In certain embodiments, a short antisense compound is targeted to nucleotides 587-603 of SEQ ID NO: 3. In certain such embodiments, a short antisense compound targeted to nucleotides 587-603 comprises a nucleotide sequence selected from SEQ ID NO 258, 259, 260, 261, 262, or 263. In certain such embodiments, a short antisense compound targeted to nucleotides 587-603 of SEQ ID NO: 3 is selected from Isis NO.
405219, 405220, 405221, 405222, 405223, or 405224.
In certain embodiments, a target region is nucleotides 974-1014 of SEQ ID NO:
3. In certain embodiments, a short antisense compound is targeted to nucleotides 974-1014 of SEQ ID NO: 3. In certain such embodiments, a short antisense compound targeted to nucleotides 974-1014 comprises a nucleotide sequence selected from SEQ ID NO 267, 268, 269, 270, 271, 272, or 274. In certain such embodiments, a short antisense compound targeted to nucleotides 974-1014 of SEQ ID NO: 3 is selected from Isis NO. 379696, 405226, 405227, 405228, 405229, 405230, 379697, or 405231.
In certain embodiments, a target region is nucleotides 998-1014 of SEQ ID NO:
3. In certain embodiments, a short antisense compound is targeted to nucleotides 998-1014 of SEQ ID NO: 3. In certain such embodiments, a short antisense compound targeted to nucleotides 998-1014 comprises a nucleotide sequence selected from SEQ ID NO 268, 269, 270, 271, 272, or 274.
In certain such
-75-embodiments, a short antisense compound targeted to nucleotides 998-1014 of SEQ ID NO: 3 is selected from Isis NO. 405226, 405227, 405228, 405229, 405230, 379697, or 405231.
In certain embodiments, a target region is nucleotides 1091-1170 of SEQ ID NO:
3. In certain embodiments, a short antisense compound is targeted to nucleotides 1091-1170 of SEQ ID NO: 3. In certain such embodiments, a short antisense compound targeted to nucleotides 1091-1170 comprises a nucleotide sequence selected from SEQ ID NO 275, 276, 277, 278, 279, 280, 281, 283, 284, 285, 286, or 287. In certain such embodiments, a short antisense compound targeted to nucleotides 1091-1170 of SEQ
ID NO: 3 is selected from Isis NO. 379698, 405232, 405233, 405234, 405235, 388626, 379699, 382677, 405236, 405237, 405238, 379700, or 405239.
In certain embodiments, a target region is nucleotides 1091-1104 of SEQ ID NO:
3. In certain embodiments, a short antisense compound is targeted to nucleotides 1091-1104 of SEQ ID NO: 3. In certain such embodiments, a short antisense compound targeted to nucleotides 1091-1104 comprises a nucleotide sequence selected from SEQ ID NO 275, 276, or 277. In certain such embodiments, an short antisense compound targeted to nucleotides 1091-1104 of SEQ ID NO: 3 is selected from Isis NO.
379698, 405232, or 405233.
In certain embodiments, a target region is nucleotides 1130-1144 of SEQ ID NO:
3. In certain embodiments, a short antisense compound is targeted to nucleotides 1130-1144 of SEQ ID NO: 3. In certain such embodiments, a short antisense compound targeted to nucleotides 1130-1144 comprises a nucleotide sequence selected from SEQ ID NO 278, 279, 280, 281, or 283. In certain such embodiments, a short antisense compound targeted to nucleotides 1130-1144 of SEQ ID NO: 3 is selected from Isis NO.
405234, 405235, 388626, 379699, 382677, or 405236.
In certain embodiments, a target region is nucleotides 1157-1170 of SEQ ID NO:
3. In certain embodiments, a short antisense compound is targeted to nucleotides 1157-1170 of SEQ ID NO: 3. In certain such embodiments, a short antisense compound targeted to nucleotides 1157-1170 comprises a nucleotide sequence selected from SEQ ID NO 284, 285, or 287. In certain such embodiments, a short antisense compound targeted to nucleotides 1157-1170 of SEQ ID NO: 3 is selected from Isis NO.
405237, 405238, 379700, or 405239.
In certain embodiments, a target region is nucleotides 1542-1556 of SEQ ID NO:
3. In certain embodiments, a short antisense compound is targeted to nucleotides 1542-1556 of SEQ ID NO: 3. In certain such embodiments, a short antisense compound targeted to nucleotides 1542-1556 comprises a nucleotide sequence selected from SEQ ID NO 289, 290, 291, 292, or 293. In certain such embodiments, a short antisense compound targeted to nucleotides 1542-1556 of SEQ ID NO: 3 is selected from Isis NO.
405240, 405241, 405242, 388629, 379702, or 382678.
In certain embodiments, a target region is nucleotides 1976-1991 of SEQ ID NO:
3. In certain embodiments, a short antisense compound is targeted to nucleotides 1976-1991 of SEQ ID NO: 3. In certain such embodiments, a short antisense compound targeted to nucleotides 1976-1991 comprises a nucleotide sequence selected from SEQ ID NO 296, 297, 298, 299, or 300. In certain such embodiments,
-76-a short antisense compound targeted to nucleotides 1976-1991 of SEQ ID NO: 3 is selected from Isis NO.
405243, 405244, 405245, 405246, or 405247.
In certain embodiments, short antisense compounds targeted to an SGLT2 nucleic acid are 8 to 16, preferably 9 to 15, more preferably 9 to 14, more preferably 10 to 14 nucleotides in length. In certain embodiments, short antisense compounds targeted to an SGLT2 nucleic acid are 9 to 14 nucleotides in length. In certain embodiments, short antisense compounds targeted to an SGLT2 nucleic acid are 10 to 14 nucleotides in length. In certain embodiments, such short antisense compounds are short antisense oligonucleotides.
In certain embodiments, short antisense compounds targeted to an SGLT2 nucleic acid are short gapmers. In certain such embodiments, short gapmers targeted to an SGLT2 nucleic acid comprise at least one high affinity modification in one or more wings of the compound. In certain embodiments, short antisense compounds targeted to an SGLT2 nucleic acid comprise 1 to 3 high-affinity modifications in each wing. In certain such embodiments, the nucleosides or nucleotides of the wing comprise a 2' modification. In certain such embodiments, the monomers of the wing are BNA's.
In certain such embodiments, the monomers of the wing are selected from a-L-Methyleneoxy (4'-CH2-O-2') BNA,(3-D-Methyleneoxy (4'-CHZ-O-2') BNA , Ethyleneoxy (4'-(CH2)2-0-2') BNA , Aminooxy (4'-CH2-O-N(R)-2') BNA and Oxyamino (4'-CH2-N(R)-0-2') BNA. In certain embodiments, the monomers of a wing comprise a substituent at the 2' position selected from allyl, amino, azido, thio, 0-allyl, O-CI-Clo alkyl, -OCF3, O-(CH2)2-O-CH3, 2'-O(CH2)2SCH3, O-(CHZ)Z-O-N(Rm)(Rõ), and O-CH2-C(=O)-N(R,,,)(Rõ), where each R. and R. is, independently, H or substituted or unsubstituted Cl-Clo alkyl. In certain embodiments, the monomers of a wing are 2'MOE nucleotides.
In certain embodiments, short antisense compounds targeted to an SGLT2 nucleic acid comprise a gap between the 5' wing and the 3' wing. In certain embodiments the gap comprises five, six, seven, eight, nine, ten, eleven, twelve, thirteen, or fourteen monomers. In certain embodiments, the monomers of the gap are unmodified deoxyribonucleotides. In certain embodiments, the monomers of the gap are unmodified ribonucleotides. In certain embodiments, gap modifications (if any) gap result in an antisense compound that, when bound to its target nucleic acid, supports cleavage by an RNase, including, but not limited to, RNase H.
In certain embodiments, short antisense compounds targeted to an SGLT2 nucleic acid have uniform monomeric linkages. In certain such embodiments, those linkages are all phosphorothioate linkages. In certain embodiments, the linkages are all phosphodiester linkages. In certain embodiments, short antisense compounds targeted to an SGLT2 nucleic acid have mixed backbones.
In certain embodiments, short antisense compounds targeted to an SGLT2 nucleic acid are 8 monomers in length. In certain embodiments, short antisense compounds targeted to an SGLT2 nucleic acid are 9 monomers in length. In certain embodiments, short antisense compounds targeted to an SGLT2 nucleic acid are 10 monomers in length. In certain embodiments, short antisense compounds targeted to an SGLT2 nucleic acid are 11 monomers in length. In certain embodiments, short antisense
-77-compounds targeted to an SGLT2 nucleic acid are monomers in length. In certain embodiments, short antisense compounds targeted to an SGLT2 nucleic acid are 13 monomers in length. In certain embodiments, short antisense compounds targeted to an SGLT2 nucleic acid are 14 monomers in length.
In certain embodiments, short antisense compounds targeted to an SGLT2 nucleic acid are 15 monomers in length. In certain embodiments, short antisense compounds targeted to an SGLT2 nucleic acid are 16 monomers in length. In certain embodiments, short antisense compounds targeted to an SGLT2 nucleic acid comprise 9 to 15 monomers. In certain embodiments, short antisense compounds targeted to an SGLT2 nucleic acid comprise 10 to 15 monomers. In certain embodiments, short antisense compounds targeted to an SGLT2 nucleic acid comprise 12 to 14 monomers. In certain embodiments, short antisense compounds targeted to an SGLT2 nucleic acid comprise 12 to 14 nucleotides or nucleosides.
In certain embodiments, the invention provides methods of modulating expression of SGLT2. In certain embodiments, such methods comprise use of one or more short antisense compound targeted to an SGLT2 nucleic acid, wherein the short antisense compound targeted to an SGLT2 nucleic acid is from about 8 to about 16, preferably 9 to 15, more preferably 9 to 14, more preferably 10 to 14 monomers (i.e.
from about 8 to about 16 linked monomers). One of ordinary skill in the art will appreciate that this comprehends methods of modulating expression of SGLT2 using one or more short antisense compounds targeted to an SGLT2 nucleic acid of 8, 9, 10, 11, 12, 13, 14, 15 or 16 monomers.
In certain embodiments, methods of modulating SGLT2 comprise use of a short antisense compound targeted to an SGLT2 nucleic acid that is 8 monomers in length. In certain embodiments, methods of modulating SGLT2 comprise use of a short antisense compound targeted to an SGLT2 nucleic acid that is 9 monomers in length. In certain embodiments, methods of modulating SGLT2 comprise use of a short antisense compound targeted to an SGLT2 nucleic acid that is 10 monomers in length. In certain embodiments, methods of modulating SGLT2 comprise use of a short antisense compound targeted to an SGLT2 nucleic acid that is 11 monomers in length. In certain embodiments, methods of modulating SGLT2 comprise use of a short antisense compound targeted to an SGLT2 nucleic acid that is 12 monomers in length. In certain embodiments, methods of modulating SGLT2 comprise use of a short antisense compound targeted to an SGLT2 nucleic acid that is 13 monomers in length. In certain embodiments, methods of modulating SGLT2 comprise use of a short antisense compound targeted to an SGLT2 nucleic acid that is 14 monomers in length. In certain embodiments, methods of modulating SGLT2 comprise use of a short antisense compound targeted to an SGLT2 nucleic acid that is 15 monomers in length. In certain embodiments, methods of modulating SGLT2 comprise use of a short antisense compound targeted to an SGLT2 nucleic acid that is 16 monomers in length.
In certain embodiments, methods of modulating expression of SGLT2 comprise use of a short antisense compound targeted to an SGLT2 nucleic acid comprising 9 to 15 monomers. In certain embodiments, methods of modulating expression of SGLT2 comprise use of a short antisense compound targeted to an SGLT2 nucleic acid comprising 10 to 15 monomers. In certain embodiments, methods of modulating expression of SGLT2 comprise use of a short antisense compound targeted to an SGLT2
-78-nucleic acid comprising 12 to 14 monomers. In certain embodiments, methods of modulating expression of SGLT2 comprise use of a short antisense compound targeted to an SGLT2 nucleic acid comprising 12 or 14 nucleotides or nucleosides.

3. PCSK9 In individuals with autosomal dominant hypercholesterolemia (ADH), elevated LDL-C levels have been linked to mutations in the genes encoding LDL-receptor (LDL-R), apolipoprotein B (apoB), or proprotein convertase subtilisin/kexin type 9 (PCSK9) (Abifadel et al., Nat.
Genet., 2003, 34:154-156).
PCSK9 was identified as a third locus associated with ADH when gain-of-function mutations in PCSK9 were found to be linked to elevated LDL-C levels. ApoB participates in the intracellular assembly and secretion of triglyceride-rich lipoproteins and is a ligand for the LDL-R.
PCSK9 is proposed to reduce LDL-R expression levels in the liver. Reduced LDL-R expression results in reduced hepatic uptake of circulating ApoB-containing lipoproteins, which in turn leads to elevated cholesterol.

Definitions "PCSK9" is the gene product or protein of which expression is to be modulated by administration of a short antisense compound.
"PCSK9 nucleic acid" means any nucleic acid encoding PCSK9. For example, in certain embodiments, a PCSK9nucleic acid includes, without limitation, a DNA sequence encoding PCSK9, an RNA sequence transcribed from DNA encoding PCSK9, and an mRNA sequence encoding PCSK9.
"PCSK9 mRNA" means an mRNA encoding PCSK9.
PCSK9 Therapeutic Indications In certain embodiments, the invention provides methods of modulating the expression of PCSK9 in an individual comprising administering a short antisense compound targeted to a PCSK9 nucleic acid. In certain embodiments, the invention provides methods of treating an individual comprising administering one or more pharmaceutical compositions of the present invention. In certain embodiments, the individual has hypercholesterolemia, mixed dyslipidemia, atherosclerosis, a risk of developing atherosclerosis, coronary heart disease, a history of coronary heart disease, early onset coronary heart disease, one or more risk factors for coronary heart disease, type II
diabetes, type II diabetes with dyslipidemia, dyslipidemia, hypertriglyceridemia, hyperlipidemia, hyperfattyacidemia, hepatic steatosis, non-alcoholic steatohepatitis, or non-alcoholic fatty liver disease.
Guidelines for lipid-lowering therapy were established in 2001 by Adult Treatment Panel III
(ATP III) of the National Cholesterol Education Program (NCEP), and updated in 2004 (Grundy et al., Circulation, 2004, 110, 227-239). The guidelines include obtaining a complete lipoprotein profile, typically after a 9 to 12 hour fast, for determination of LDL-C, total cholesterol, and HDL-C levels.
According to the most recently established guidelines, LDL-C levels of 130-159 mg/dL, 160-189 mg/dL,
-79-and greater than or equal to 190 mg/dL are considered borderline high, high, and very high, respectively.
Total cholesterol levels of 200-239 and greater than or equal to 240 mg/dL are considered borderline high and high, respectively. HDL-C levels of less than 40 mg/dL are considered low.
In certain embodiments, the individual has been identified as in need of lipid-lowering therapy. In certain such embodiments, the individual has been identified as in need of lipid-lowering therapy according to the guidelines established in 2001 by Adult Treatment Panel III
(ATP III) of the National Cholesterol Education Program (NCEP), and updated in 2004 (Grundy et al., Circulation, 2004, 110, 227-239). In certain such embodiments, the individual in need of lipid-lowering therapy has LDL-C above 190 mg/dL. In certain such embodiments, the individual in need of lipid-lowering therapy has LDL-C above 160 mg/dL. In certain such embodiments, the individual in need of lipid-lowering therapy has LDL-C
above 130 mg/dL. In certain such embodiments the individual in need of lipid-lowering therapy has LDL-C above 100 mg/dL. In certain such embodiments the individual in need of lipid-lowering therapy should maintain LDL-C below 160 mg/dL. In certain such embodiments the individual in need of lipid-lowering therapy should maintain LDL-C below 130 mg/dL. In certain such embodiments the individual in need of lipid-lowering therapy should maintain LDL-C below 100 mg/dL. In certain such embodiments the individual should maintain LDL-C below 70 mg/dL.
In certain embodiments the invention provides methods for reducing ApoB in an individual. In certain embodiments the invention provides methods for reducing ApoB-containing lipoprotein in an individual. In certain embodiments the invention provides methods for reducing LDL-C in an individual.
In certain embodiments the invention provides methods for reducing VLDL-C in an individual. In certain embodiments the invention provides methods for reducing IDL-C in an individual. In certain embodiments the invention provides methods for reducing non-HDL-C in an individual. In certain embodiments the invention provides methods for reducing Lp(a) in an individual. In certain embodiments the invention provides methods for reducing serum triglyceride in an individual. In certain embodiments the invention provides methods for reducing liver triglyceride in an individual. In certain embodiments the invention provides methods for reducing Ox-LDL-C in an individual. In certain embodiments the invention provides methods for reducing small LDL particles in an individual.
In certain embodiments the invention provides methods for reducing small VLDL particles in an individual.
In certain embodiments the invention provides methods for reducing phospholipids in an individual. In certain embodiments the invention provides methods for reducing oxidized phospholipids in an individual.
In certain embodiments, the methods provided by the present invention do not lower HDL-C. In certain embodiments, the methods provided by the present invention do not result in accumulation of lipids in the liver.
In certain embodiments a pharmaceutical composition comprising a short antisense compound targeted to a PCSK9 nucleic acid is for use in therapy. In certain embodiments, the therapy is the reduction of LDL-C, ApoB, VLDL-C, IDL-C, non-HDL-C, Lp(a) , serum triglyceride, liver triglyceride, Ox-LDL-C, small LDL particles, small VLDL, phospholipids, or oxidized phospholipids in an individual.
-80-In certain embodiments, the therapy is the treatment of hypercholesterolemia, mixed dyslipidemia, atherosclerosis, a risk of developing atherosclerosis, coronary heart disease, a history of coronary heart disease, early onset coronary heart disease, one or more risk factors for coronary heart disease, type II
diabetes, type II diabetes with dyslipidemia, dyslipidemia, hypertriglyceridemia, hyperlipidemia, hyperfattyacidemia, hepatic steatosis, non-alcoholic steatohepatitis, or non-alcoholic fatty liver disease. In additional embodiments, the therapy is the reduction of CHD risk. In certain the therapy is prevention of atherosclerosis. In certain embodiments, the therapy is the prevention of coronary heart disease.
In certain embodiments a pharmaceutical composition comprising a short antisense compound targeted to a PCSK9 nucleic acid is used for the preparation of a medicament for reducing LDL-C, ApoB, VLDL-C, IDL-C, non-HDL-C, Lp(a) , serum triglyceride, liver triglyceride, Ox-LDL-C, small LDL
particles, small VLDL, phospholipids, or oxidized phospholipids in an individual. In certain embodiments pharmaceutical composition comprising a short antisense compound targeted to PCKS9 is used for the preparation of a medicament for reducing coronary heart disease risk. In certain embodiments a short antisense compound targeted to a PCSK9 nucleic acid is used for the preparation of a medicament for the treatment of hypercholesterolemia, mixed dyslipidemia, atherosclerosis, a risk of developing atherosclerosis, coronary heart disease, a history of coronary heart disease, early onset coronary heart disease, one or more risk factors for coronary heart disease, type II
diabetes, type II diabetes with dyslipidemia, dyslipidemia, hypertriglyceridemia, hyperlipidemia, hyperfattyacidemia, hepatic steatosis, non-alcoholic steatohepatitis, or non-alcoholic fatty liver disease.
PCSK9 Combination Therapies In certain embodiments, one or more pharmaceutical compositions of the present invention are co-administered with one or more other pharmaceutical agents. In certain embodiments, such one or more other pharmaceutical agents are designed to treat the same disease or condition as the one or more pharmaceutical compositions of the present invention. In certain embodiments, such one or more other pharmaceutical agents are designed to treat a different disease or condition as the one or more pharmaceutical compositions of the present invention. In certain embodiments, such one or more other pharmaceutical agents are designed to treat an undesired effect of one or more pharmaceutical compositions of the present invention. In certain embodiments, one or more pharmaceutical compositions of the present invention are co-administered with another pharmaceutical agent to treat an undesired effect of that other pharmaceutical agent. In certain embodiments, one or more pharmaceutical compositions of the present invention and one or more other pharmaceutical agents are administered at the same time. In certain embodiments, one or more pharmaceutical compositions of the present invention and one or more other pharmaceutical agents are administered at different times. In certain embodiments, one or more pharmaceutical compositions of the present invention and one or more other pharmaceutical agents are prepared together in a single formulation. In certain embodiments, one or more pharmaceutical compositions of the present invention and one or more other pharmaceutical agents are prepared
-81-separately.
In certain embodiments, pharmaceutical agents that may be co-administered with a pharmaceutical composition of the present invention include lipid-lowering agents. In certain such embodiments, pharmaceutical agents that may be co-administered with a pharmaceutical composition of the present invention include, but are not limited to atorvastatin, simvastatin, rosuvastatin, and ezetimibe.
In certain such embodiments, the lipid-lowering agent is administered prior to administration of a pharmaceutical composition of the present invention. In certain such embodiments, the lipid-lowering agent is administered following administration of a pharmaceutical composition of the present invention.
In certain such embodiments the lipid-lowering agent is administered at the same time as a pharmaceutical composition of the present invention. In certain such embodiments the dose of a co-administered lipid-lowering agent is the same as the dose that would be administered if the lipid-lowering agent was administered alone. In certain such embodiments the dose of a co-administered lipid-lowering agent is lower than the dose that would be administered if the lipid-lowering agent was administered alone. In certain such embodiments the dose of a co-administered lipid-lowering agent is greater than the dose that would be administered if the lipid-lowering agent was administered alone.
In certain embodiments, a co-administered lipid-lowering agent is a HMG-CoA
reductase inhibitor. In certain such embodiments the HMG-CoA reductase inhibitor is a statin. In certain such embodiments the statin is selected from atorvastatin, simvastatin, pravastatin, fluvastatin, and rosuvastatin.
In certain embodiments, a co-administered lipid-lowering agent is a cholesterol absorption inhibitor. In certain such embodiments, cholesterol absorption inhibitor is ezetimibe.
In certain embodiments, a co-administered lipid-lowering agent is a co-formulated HMG-CoA
reductase inhibitor and cholesterol absorption inhibitor. In certain such embodiments the co-formulated lipid-lowering agent is ezetimibe/simvastatin.
In certain embodiments, a co-administered lipid-lowering agent is a microsomal triglyceride transfer protein inhibitor (MTP inhibitor).
In certain embodiments, a co-administered lipid-lowering agent is an oligonucleotide targeted to an ApoB nucleic acid.
In certain embodiments, a co-administered pharmaceutical agent is a bile acid sequestrant. In certain such embodiments, the bile acid sequestrant is selected from cholestyramine, colestipol, and colesevelam.
In certain embodiments, a co-administered pharmaceutical agent is a nicotinic acid. In certain such embodiments, the nicotinic acid is selected from immediate release nicotinic acid, extended release nicotinic acid, and sustained release nicotinic acid.
In certain embodiments, a co-administered pharmaceutical agent is a fibric acid. In certain such embodiments, a fibric acid is selected from gemfibrozil, fenofibrate, clofibrate, bezafibrate, and ciprofibrate.
-82-Further examples of pharmaceutical agents that may be co-administered with a pharmaceutical composition of the present invention include, but are not limited to, corticosteroids, including but not limited to prednisone; immunoglobulins, including, but not limited to intravenous immunoglobulin (IVIg); analgesics (e.g., acetaminophen); anti-inflanunatory agents, including, but not limited to non-steroidal anti-inflammatory drugs (e.g., ibuprofen, COX-1 inhibitors, and COX-2, inhibitors); salicylates;
antibiotics; antivirals; antifungal agents; antidiabetic agents (e.g., biguanides, glucosidase inhibitors, insulins, sulfonylureas, and thiazolidenediones); adrenergic modifiers;
diuretics; hormones (e.g., anabolic steroids, androgen, estrogen, calcitonin, progestin, somatostan, and thyroid hormones);
immunomodulators; muscle relaxants; antihistamines; osteoporosis agents (e.g., biphosphonates, calcitonin, and estrogens); prostaglandins, antineoplastic agents;
psychotherapeutic agents; sedatives;
poison oak or poison sumac products; antibodies; and vaccines.
In certain embodiments, the pharmaceutical compositions of the present invention may be administered in conjuction with a lipid-lowering therapy. In certain such embodiments, a lipid-lowering therapy is therapeutic lifestyle change. In certain such embodiments, a lipid-lowering therapy is LDL
apheresis.

Certain Short Antisense Compounds Targeted to a PCSK9 Nucleic Acid In certain embodiments, short antisense compounds are targeted to a PCSK9 nucleic acid having the sequence of GENBANK Accession No. NM_174936.2, incorporated herein as SEQ ID NO:
4. In certain such embodiments, a short antisense compound targeted to SEQ ID
NO: 4 is at least 90%
complementary to SEQ ID NO: 4. In certain such embodiments, a short antisense compound targeted to SEQ ID NO: 4 is at least 95% complementary to SEQ ID NO: 4. In certain such embodiments, a short antisense compound targeted to SEQ ID NO: 4 is 100% complementary to SEQ ID
NO: 4. In certain embodiments, a short antisense compound targeted to SEQ ID NO: 4 comprises a nucleotide sequence selected from the nucleotide sequences set forth in Table 6 or Table 7.
The nucleotide sequence set forth in each SEQ ID NO in Tables 6 and 7 is independent of any modification to a sugar moiety, an intemucleoside linkage, or a nucleobase. As such, short antisense compounds defined by a SEQ ID NO may comprise, independently, one or more modifications to a sugar moiety, an intemucleoside linkage, or a nucleobase. Short antisense compounds described by Isis Number (Isis NO.) indicate a combination of nucleobase sequence and one or more modifications to a sugar moiety, an intemucleoside linkage, or a nucleobase.
Tables 6 and 7 illustrate examples of short antisense compounds targeted to SEQ ID NO: 4. Table 6 illustrates short antisense compounds that are 100% complementary to SEQ ID
NO: 4. Table 7 illustrates short antisense compounds that have one or two mismatches with respect to SEQ ID NO: 4.
The column labeled `gapmer motif indicates the wing-gap-wing motif of each short antisense compounds. The gap segment comprises 2'-deoxynucleotides and each nucleotide of each wing segment comprises a 2'-modified sugar. The particular 2'-modified sugar is also indicated in the `gapmer motif
-83-column. For example, `2-10-2 MOE' means a 2-10-2 gapmer motif, where a gap segment of ten 2'-deoxynucleotides is flanked by wing segments of two nucleotides, where the nucleotides of the wing segments are 2'-MOE nucleotides. Internucleoside linkages are phosphorothioate. The short antisense compounds comprise 5-methylcytidine in place of unmodified cytosine, unless "unmodified cytosine" is listed in the gapmer motif column, in which case the indicated cytosines are unmodified cytosines. For example, "5-mC in gap only" indicates that the gap segment has 5-methylcytosines, while the wing segments have unmodified cytosines.

Table 6: Short Antisense Compounds targeted to SEQ ID NO: 4 5' 3' SEQ
ISIS Target Target ID
NO. Site Site Sequence (5'-3') Gapmer Motif NO
-84-(6'S)-6'-methyl-403739 988 1001 CGGCCGCTGACCAC Methyleneoxy BNA 339 (6'S)-6'-methyl-403740 1455 1468 CCACGTGGGCAGCA Methyleneoxy BNA 362 Table 7: Short antisense compounds targeted to SEQ ID NO: 4 and having 1 or 2 mismatches 5' 3' SEQ
ISIS Target Target ID
NO. Site Site Sequence (5'-3') Gapmer Motif NO
-85-In certain embodiments, a target region is nucleotides 695-710 of SEQ ID NO:
4. In certain such embodiments, short antisense compounds targeted to nucleotides 695-710 of SEQ
ID NO: 4 comprise a nucleotide sequence selected from SEQ ID NO: 329, 330, or 331. In certain such embodiments, a short antisense compound targeted to nucleotides 695-710 of SEQ ID NO: 4 is selected from Isis NO. 400297, 400298, or 400299.
In certain embodiments, a target region is nucleotides 742-770 of SEQ ID NO:
4. In certain such embodiments, a short antisense compound targeted to nucleotides 742-770 of SEQ
ID NO: 4 comprises a nucleotide sequence selected from SEQ ID NO 332 or 333. In certain such embodiments, a short antisense compound targeted to nucleotides 742-770 of SEQ ID NO: 4 is selected from Isis NO. 400300 or400301.
In certain embodiments, a target region is nucleotides 828-843 of SEQ ID NO:
4. In certain such embodiments, a short antisense compound targeted to nucleotides 828-843 of SEQ
ID NO: 4 comprises a nucleotide sequence selected from SEQ ID NO 334, 335, or 336. In certain such embodiments, a short antisense compound targeted to nucleotides 828-843 of SEQ ID NO: 4 is selected from ISIS No. 400302, 400303,or400304.
In certain embodiments, a target region is nucleotides 937-1007 of SEQ ID NO:
4. In certain such embodiments, a short antisense compound targeted to nucleotides 937-1007 of SEQ ID NO: 4 comprises a nucleotide sequence selected from SEQ ID NO 337, 338, 339, 340, 341, 342, 343, 344, or 345. In certain such embodiments, a short antisense compound targeted to nucleotides 937-1007 of SEQ ID NO:
4 is selected from Isis NO. 400305, 400306, 400307, 400308, 400309, 400310, 400311, 400312, 400313, or 403739.
In certain embodiments, a target region is nucleotides 937-965 of SEQ ID NO:
4. In certain such embodiments, a short antisense compound targeted to nucleotides 937-965 of SEQ
ID NO: 4 comprises a nucleotide sequence selected from SEQ ID NO 337 or 338. In certain such embodiments, a short antisense compound targeted to nucleotides 937-965 of SEQ ID NO: 4 is selected from Isis NO. 400305 or 400306.
In certain embodiments, a target region is nucleotides 988-1007 of SEQ ID NO:
4. In certain such embodiments, a short antisense compound targeted to nucleotides 988-1007 of SEQ ID NO: 4 comprises a nucleotide sequence selected from SEQ ID NO 339, 340, 341, 342, 343, 344, or 345. In certain such
-86-embodiments, a short antisense compound targeted to nucleotides 937-1007 of SEQ ID NO: 4 is selected from Isis NO. 400307, 400308, 400309, 400310, 400311, 400312, 4003313, or 403739.
In certain embodiments, a target region is nucleotides 1057-1160 of SEQ ID NO:
4. In certain such embodiments, a short antisense compound targeted to nucleotides 1057-1160 of SEQ ID NO: 4 comprises a nucleotide sequence selected from SEQ ID NO 346, 347, 348, 349, 350, 351, 352, 353, 354, or 355. In certain such embodiments, a short antisense compound targeted to nucleotides 1057-1160 of SEQ ID NO: 4 is selected from ISIS NO. 400314, 400315, 400316, 400317, 400318, 400319, 400320, 400321, 400322, or 400323.
In certain embodiments, a target region is nucleotides 1057-1109 of SEQ ID NO:
4. In certain such embodiments, a short antisense compound targeted to nucleotides 1057-1109 of SEQ ID NO: 4 comprises a nucleotide sequence selected from SEQ ID NO 346, 347, 348, 349, 350, 351, 352, 353, or 354. In certain such embodiments, a short antisense compound targeted to nucleotides 1057-1109 of SEQ
ID NO: 4 is selected from ISIS NO. 400314, 400315, 400316, 400317, 400318, 400319, 400320, 400321, or 400322.
In certain embodiments, a target region is nucleotides 1057-1091 of SEQ ID NO:
4. In certain such embodiments, a short antisense compound targeted to nucleotides 1057-1091 of SEQ ID NO: 4 comprises a nucleotide sequence selected from SEQ ID NO 346, 347, 348, 349, or 350. In certain such embodiments, a short antisense compound targeted to nucleotides 1057-1091 of SEQ ID NO: 4 is selected from ISIS NO. 400314, 400315, 400316, 400317, or 400318.
In certain embodiments, a target region is nucleotides 1093-1109 of SEQ ID NO:
4. In certain such embodiments, a short antisense compound targeted to nucleotides 1093-1109 of SEQ ID NO: 4 comprises a nucleotide sequence selected from SEQ ID NO 351, 352, 353, or 354.
In certain such embodiments, a short antisense compound targeted to nucleotides 1057-1109 of SEQ ID NO: 4 is selected from ISIS NO. 400319, 400320, 400321, or 400322.
In certain embodiments, a target region is nucleotides 1334-1349 of SEQ ID NO:
4. In certain such embodiments, a short antisense compound targeted to nucleotides 1334-1349 of SEQ ID NO: 4 comprises a nucleotide sequence selected from SEQ ID NO 357, 358, or 359. In certain such embodiments, a short antisense compound targeted to nucleotides 1334-1349 of SEQ ID NO: 4 is selected from ISIS NO 400325, 400326, or 400327.
In certain embodiments, a target region is nucleotides 1453-1469 of SEQ ID NO:
4. In certain such embodiments, a short antisense compound targeted to nucleotides 1453-1469 of SEQ ID NO: 4 comprises a nucleotide sequence selected from SEQ ID NO 360, 361, 362, or 363.
In certain such embodiments, a short antisense compound targeted to nucleotides 1453-1469 of SEQ ID NO: 4 is selected from ISIS NO 400328, 400329, 400330, 400331, or 403470.
In certain embodiments, a target region is nucleotides 1569-1591 of SEQ ID NO:
4. In certain such embodiments, a short antisense compound targeted to nucleotides 1569-1591 of SEQ ID NO: 4 comprises a nucleotide sequence selected from SEQ ID NO 364, 365, 366, 367, 368, 369, 370, 371, 372,
-87-or 373. In certain such embodiments, a short antisense compound targeted to nucleotides 1569-1591 of SEQ ID NO: 4 is selected from ISIS NO 400332, 400333, 400334, 400335, 400336, 400337, 400338, 400339, 400340, or 400341.
In certain embodiments, a target region is nucleotides 1621-1637 of SEQ ID NO:
4. In certain such embodiments, a short antisense compound targeted to nucleotides 1621-1637 of SEQ ID NO: 4 comprises a nucleotide sequence selected from SEQ ID NO 374, 375, 376, or 377.
In certain such embodiments, a short antisense compound targeted to nucleotides 1621-1637 of SEQ ID NO: 4 is selected from ISIS NO 400342, 400343, 400344, or 400345.
In certain embodiments, a target region is nucleotides 1738-1754 of SEQ ID NO:
4. In certain such embodiments, a short antisense compound targeted to nucleotides 1738-1754 of SEQ ID NO: 4 comprises a nucleotide sequence selected from SEQ ID NO 378, 379, 380, or 381.
In certain such = embodiments, a short antisense compound targeted to nucleotides 1738-1754 of SEQ ID NO: 4 is selected from ISIS NO 400346, 400347, 400348, or 400349.
In certain embodiments, a target region is nucleotides 1834-1853 of SEQ ID NO:
4. In certain such embodiments, a short antisense compound targeted to nucleotides 1834-1853 of SEQ ID NO: 4 comprises a nucleotide sequence selected from SEQ ID NO 382, 383, 384, 385, 386, 387, or 388. In certain embodiments, a short antisense compound targeted to nucleotides 1834-1853 of SEQ ID NO: 4 is selected from ISIS NO 400350, 400351, 400352, 400353, 400354, 400355, or 400356.
In certain embodiments, a target region is nucleotides 2083-2099 of SEQ ID NO:
4. In certain such embodiments, a short antisense compound targeted to nucleotides 2083-2099 of SEQ ID NO: 4 comprises a nucleotide sequence selected from SEQ ID NO 389, 390, 391, or 392.
In certain such embodiments, a short antisense compound targeted to nucleotides 2083-2099 of SEQ ID NO: 4 is selected from ISIS NO 400357, 400358, 400359, or 400360.
In certain embodiments, a target region is nucleotides 2316-2338 of SEQ ID NO:
4. In certain such embodiments, a short antisense compound targeted to nucleotides 2316-2338 of SEQ ID NO: 4 comprises a nucleotide sequence selected from SEQ ID NO 393, 394, 395, 396, 397, 398, 399, 400, 401, or 402. In certain such embodiments, a short antisense compound targeted to nucleotides 2316-2338 of SEQ ID NO: 4 is selected from ISIS NO 400361, 400362, 400363, 400364, 400365, 400366, 400367, 400368, 400369, or 400370.
In certain embodiments, short antisense compounds targeted to a PCSK9 nucleic acid are 8 to 16, preferably 9 to 15, more preferably 9 to 14, more preferably 10 to 14 nucleotides in length. In certain embodiments, short antisense compounds targeted to a PCSK9 nucleic acid are 9 to 14 nucleotides in length. In certain embodiments, short antisense compounds targeted to a PCSK9 nucleic acid are 10 to 14 nucleotides in length. In certain embodiments, such short antisense compounds are short antisense oligonucleotides.
In certain embodiments, short antisense compounds targeted to a PCSK9 nucleic acid are short gapmers. In certain such embodiments, short gapmers targeted to a PCSK9 nucleic acid comprise at least
-88-one high affinity modification in one or more wings of the compound. In certain embodiments, short antisense compounds targeted to a PCSK9 nucleic acid comprise 1 to 3 high-affinity modifications in each wing. In certain such embodiments, the nucleosides or nucleotides of the wing comprise a 2' modification. In certain such embodiments, the monomers of the wing are BNA's.
In certain such embodiments, the monomers of the wing are selected from a-L-Methyleneoxy (4'-CH2-O-2') BNA,(3-D-Methyleneoxy (4'-CH2-0-2') BNA , Ethyleneoxy (4'-(CH2)2-0-2') BNA , Aminooxy (4'-CH2-O-N(R)-2') BNA and Oxyamino (4'-CH2-N(R)-0-2') BNA. In certain embodiments, the monomers of a wing comprise a substituent at the 2' position selected from allyl, amino, azido, thio, O-allyl, O-Ci-Clo alkyl, -OCF3, O-(CH2)2-O-CH3, 2'-O(CHz)ZSCH3, 0-(CH2)2-0-N(Rm)(Rõ), and O-CH2-C(=0)-N(Rm)(Rõ), where each R. and Rõ is, independently, H or substituted or unsubstituted Cl-Clo alkyl. In certain embodiments, the monomers of a wing are 2'MOE nucleotides.
In certain embodiments, short antisense compounds targeted to a PCSK9 nucleic acid comprise a gap between the 5' wing and the 3' wing. In certain embodiments the gap comprises five, six, seven, eight, nine, ten, eleven, twelve, thirteen, or fourteen monomers. In certain embodiments, the monomers of the gap are unmodified deoxyribonucleotides. In certain embodiments, the monomers of the gap are unmodified ribonucleotides. In certain embodiments, gap modifications (if any) gap result in an antisense compound that, when bound to its target nucleic acid, supports cleavage by an RNase, including, but not limited to, RNase H.
In certain embodiments, short antisense compounds targeting a PCSK9 nucleic acid may have any one or more properties or characteristics of the short antisense compounds generally described herein.
In certain embodiments, short antisense compounds targeting a PCSK9 nucleic acid have a motif (wing -deoxy gap -wing) selected from 1-12-1, 1-1-10-2, 2-10-1-1, 3-10-3, 2-10-3, 2-10-2, 1-10-1,1-10-2, 3-8-3, 2-8-2, 1-8-1, 3-6-3 or 1-6-1, more preferably 1-10-1, 2-10-2, 3-10-3, and 1-9-2.
In certain embodiments, short antisense compounds targeted to a PCSK9 nucleic acid have unifomi monomeric linkages. In certain such embodiments, those linkages are all phosphorothioate linkages. In certain embodiments, the linkages are all phosphodiester linkages. In certain embodiments, short antisense compounds targeted to a PCSK9 nucleic acid have mixed backbones.
In certain embodiments, short antisense compounds targeted to a PCSK9 nucleic acid are 8 monomers in length. In certain embodiments, short antisense compounds targeted to a PCSK9 nucleic acid are 9 monomers in length. In certain embodiments, short antisense compounds targeted to a PCSK9 nucleic acid are 10 monomers in length. In certain embodiments, short antisense compounds targeted to a PCSK9 nucleic acid are 11 monomers in length. In certain embodiments, short antisense compounds targeted to a PCSK9 nucleic acid are monomers in length. In certain embodiments, short antisense compounds targeted to a PCSK9 nucleic acid are 13 monomers in length. In certain embodiments, short antisense compounds targeted to a PCSK9 nucleic acid are 14 monomers in length. In certain embodiments, short antisense compounds targeted to a PCSK9 nucleic acid are 15 monomers in length.
In certain embodiments, short antisense compounds targeted to a PCSK9 nucleic acid are 16 monomers in
-89-length. In certain embodiments, short antisense compounds targeted to a PCSK9 nucleic acid comprise 9 to 15 monomers. In certain embodiments, short antisense compounds targeted to a PCSK9 nucleic acid comprise 10 to 15 monomers. In certain embodiments, short antisense compounds targeted to a PCSK9 nucleic acid comprise 12 to 14 monomers. In certain embodiments, short antisense compounds targeted to a PCSK9 nucleic acid comprise 12 to 14 nucleotides or nucleosides.
In certain embodiments, the invention provides methods of modulating expression of PCSK9. In certain embodiments, such methods comprise use of one or more short antisense compound targeted to a PCSK9 nucleic acid, wherein the short antisense compound targeted to a PCSK9 nucleic acid is from about 8 to about 16, preferably 9 to 15, more preferably 9 to 14, more preferably 10 to 14 monomers (i.e.
from about 8 to about 16 linked monomers). One of ordinary skill in the art will appreciate that this comprehends methods of modulating expression of PCSK9 using one or more short antisense compounds targeted to a PCSK9 nucleic acid of 8, 9, 10, 11, 12, 13, 14, 15 or 16 monomers.
In certain embodiments, methods of modulating PCSK9 comprise use of a short antisense compound targeted to a PCSK9 nucleic acid that is 8 monomers in length. In certain embodiments, methods of modulating PCSK9 comprise use of a short antisense compound targeted to a PCSK9 nucleic acid that is 9 monomers in length. In certain embodiments, methods of modulating PCSK9 comprise use of a short antisense compound targeted to a PCSK9 nucleic acid that is 10 monomers in length. In certain embodiments, methods of modulating PCSK9 comprise use of a short antisense compound targeted to a PCSK9 nucleic acid that is 11 monomers in length. In certain embodiments, methods of modulating PCSK9 comprise use of a short antisense compound targeted to a PCSK9 nucleic acid that is 12 monomers in length. In certain embodiments, methods of modulating PCSK9 comprise use of a short antisense compound targeted to a PCSK9 nucleic acid that is 13 monomers in length. In certain embodiments, methods of modulating PCSK9 comprise use of a short antisense compound targeted to a PCSK9 nucleic acid that is 14 monomers in length. In certain embodiments, methods of modulating PCSK9 comprise use of a short antisense compound targeted to a PCSK9 nucleic acid that is 15 monomers in length. In certain embodiments, methods of modulating PCSK9 comprise use of a short antisense compound targeted to a PCSK9 nucleic acid that is 16 monomers in length.
In certain embodiments, methods of modulating expression of PCSK9 comprise use of a short antisense compound targeted to a PCSK9 nucleic acid comprising 9 to 15 monomers. In certain embodiments, methods of modulating expression of PCSK9 comprise use of a short antisense compound targeted to a PCSK9 nucleic acid comprising 10 to 15 monomers. In certain embodiments, methods of modulating expression of PCSK9 comprise use of a short antisense compound targeted to a PCSK9 nucleic acid comprising 12 to 14 monomers. In certain embodiments, methods of modulating expression of PCSK9 comprise use of a short antisense compound targeted to a PCSK9 nucleic acid comprising 12 or 14 nucleotides or nucleosides.

4. Superoxide Dismutase 1 Enzyme (SOD1)
-90-The enzymes known as the superoxide dismutases (SODs) provide defense against oxidative damage of biomolecules by catalyzing the dismutation of superoxide to hydrogen peroxide (H202) (Fridovich, Annu. Rev. Biochem., 1995, 64, 97-112). Two major classes of superoxide dismutases exist.
One consists of a group of enzymes with active sites containing copper and zinc while the other class has either manganese or iron at the active site (Fridovich, Annu. Rev. Biochem., 1995, 64, 97-112).
Mutations in the superoxide dismutase 1 gene are associated with a dominantly-inherited form of amyotrophic lateral sclerosis (ALS, also known as Lou Gehrig's disease) a disorder characterized by a selective degeneration of upper and lower motor neurons (Cleveland and Liu, Nat. Med., 2000, 6, 1320-1321). The deleterious effects of various mutations on superoxide dismutase 1 are most likely mediated through a gain of toxic function rather than a loss of superoxide dismutase 1 activity, as the complete absence of superoxide dismutase I in mice neither diminishes life nor provokes overt disease (Al-Chalabi and Leigh, Curr. Opin. Neurol., 2000, 13, 397-405; Alisky and Davidson, Hum.
Gene Ther., 2000, 11;
2315-2329).
Over 100 mutations of the human SOD1 gene have been identified, and altogether account for approximately 20% of familial amyotrophic lateral sclerosis (ALS) cases. Some mutations, such as the A4V mutation most commonly found in the United States, are highly lethal and result in survival only nine months from the onset of disease symptoms. Other mutations of SODI
manifest in a slower disease course.

Definitions "SOD1" means the gene product or protein of which expression is to be modulated by administration of a short antisense compound.
"SOD1 nucleic acid" means any nucleic acid encoding SOD1. For example, in certain embodiments, a SODI nucleic acid includes, without limitations, a DNA sequence encoding SOD1, an RNA sequence transcribed from DNA encoding SOD1, and an mRNA sequence encoding SOD1.
"SODI mRNA" means an mRNA encoding SOD1.
SODI Therapeutic Indications It has been discovered that antisense inhibition of superoxide dismutase 1(SOD1) in an animal model of familial ALS reduces both SOD1 mRNA and protein, and further results in a slowing of disease progression and, importantly, increased survival time. Accordingly, in certain embodiments, the invention provides methods for the slowing of disease progression in an individual suffering from familial ALS by administering to such an individual a short antisense compound targeted to an SOD1 nucleic acid. In certain such embodiments, a short antisense compound targeted to SODI are delivered directly to the cerebrospinal fluid of the individual. In certain such embodiments, methods further comprise increasing survival time of an individual suffering from familial ALS. Slowing of disease progression is indicated by an improvement in one or more indicators of ALS disease progression, including, without limitation,
-91-the revised ALS functional rating scale, pulmonary function tests, and muscle strength measurements.
SODI Combination Therapies In certain embodiments, one or more pharmaceutical compositions comprising a short antisense compound targeted to an SOD1 nucleic acid is co-administered with one or more other pharmaceutical agents. In certain embodiments, such one or more other pharmaceutical agents are designed to treat the same disease or condition as the one or more pharmaceutical compositions of the present invention. In certain embodiments, such one or more other pharmaceutical agents are designed to treat a different disease or condition as the one or more pharmaceutical compositions of the present invention. In certain embodiments, such one or more other pharmaceutical agents are designed to treat an undesired effect of one or more pharmaceutical compositions of the present invention. In certain embodiments, one or more pharmaceutical compositions of the present invention are co-administered with another pharmaceutical agent to treat an undesired effect of that other pharmaceutical agent. In certain embodiments, one or more pharmaceutical compositions of the present invention and one or more other pharmaceutical agents are administered at the same time. In certain embodiments, one or more pharmaceutical compositions of the present invention and one or more other pharmaceutical agents are administered at different times. In certain embodiments, one or more pharmaceutical compositions of the present invention and one or more other pharmaceutical agents are prepared together in a single formulation. In certain embodiments, one or more pharmaceutical compositions of the present invention and one or more other phannaceutical agents are prepared separately.
In certain embodiments, a co-administered pharmaceutical agent is a nicotinic acid. In certain such embodiments, the nicotinic acid is selected from immediate release nicotinic acid, extended release nicotinic acid, and sustained release nicotinic acid.
In certain embodiments, a co-administered pharmaceutical agent is a fibric acid. In certain such embodiments, a fibric acid is selected from gemfibrozil, fenofibrate, clofibrate, bezafibrate, and ciprofibrate.
Further examples of pharmaceutical agents that may be co-administered with a pharmaceutical composition comprising a short antisense compound targeted to SOD1 include, but are not limited to, corticosteroids, including but not limited to prednisone; immunoglobulins, including, but not limited to intravenous immunoglobulin (IVIg); analgesics (e.g., acetaminophen); anti-inflammatory agents, including, but not limited to non-steroidal anti-inflammatory drugs (e.g., ibuprofen, COX-1 inhibitors, and COX-2, inhibitors); salicylates; antibiotics; antivirals; antifungal agents; antidiabetic agents (e.g., biguanides, glucosidase inhibitors, insulins, sulfonylureas, and thiazolidenediones); adrenergic modifiers;
diuretics; hormones (e.g., anabolic steroids, androgen, estrogen, calcitonin, progestin, somatostan, and thyroid hormones); immunomodulators; muscle relaxants; antihistamines;
osteoporosis agents (e.g., biphosphonates, calcitonin, and estrogens); prostaglandins, antineoplastic agents; psychotherapeutic agents; sedatives; poison oak or poison sumac products; antibodies; and vaccines.
-92-Certain Short Antisense Compounds Targeted to a SODI Nucleic Acid In certain embodiments, short antisense compounds are targeted to a SODI
nucleic acid having the sequence of GENBANK Accession No. NM_X02317.1, incorporated herein as SEQ
ID NO: 5. In certain such embodiments, a short antisense compound targeted to SEQ ID NO: 5 is at least 90%
complementary to SEQ ID NO: 5. In certain such embodiments, a short antisense compound targeted to SEQ ID NO: 5 is at least 95% complementary to SEQ ID NO: 5. In certain such embodiments, a short antisense compound targeted to SEQ ID NO: 5 is 100% complementary to SEQ ID
NO: 5. In certain embodiments, a short antisense compound targeted to SEQ ID NO: 5 comprises a nucleotide sequence selected from the nucleotide sequences set forth in Table 8 or Table 9.
The nucleotide sequence set forth in each SEQ ID NO in Tables 8 and 9 is independent of any modification to a sugar moiety, an internucleoside linkage, or a nucleobase.
As such, short antisense compounds defined by a SEQ ID NO may comprise, independently, one or more modifications to a sugar moiety, an intemucleoside linkage, or a nucleobase. Short antisense compounds described by Isis Number (Isis NO.) indicate a combination of nucleobase sequence and one or more modifications to a sugar moiety, an internucleoside linkage, or a nucleobase.
Table 8 illustrates examples of short antisense compounds targeted to SEQ ID
NO: 5. Table 8 illustrates short antisense compounds that are 100% complementary to SEQ ID
NO: 5. The column labeled `gapmer motif indicates the wing-gap-wing motif of each short antisense compounds. The gap segment comprises 2'-deoxynucleotides and each nucleotide of each wing segment comprises a 2'-modified sugar. The particular 2'-modified sugar is also indicated in the `gapmer motif column. For example, `2-10-2 MOE' means a 2-10-2 gapmer motif, where a gap segment of ten 2'-deoxynucleotides is flanked by wing segments of two nucleotides, where the nucleotides of the wing segments are 2'-MOE
nucleotides. Internucleoside linkages are phosphorothioate. The short antisense compounds comprise 5-methylcytidine in place of unmodified cytosine, unless "unmodifted cytosine"
is listed in the gapmer motif column, in which case the indicated cytosines are unmodified cytosines.
For example, "5-mC in gap only" indicates that the gap segment has 5-methylcytosines, while the wing segments have unmodified cytosines.
In certain embodiments, short antisense compounds targeting a SOD1 nucleic acid may have any one or more properties or characteristics of the short antisense compounds generally described herein. In certain embodiments, short antisense compounds targeting a SOD1 nucleic acid have a motif (wing -deoxy gap -wing) selected from 1-12-1, 1-1-10-2, 2-10-1-1, 3-10-3, 2-10-3, 2-10-2, 1-10-1,1-10-2, 3-8-3, 2-8-2, 1-8-1, 3-6-3 or 1-6-1, more preferably 1-10-1, 2-10-2, 3-10-3, and 1-9-2.

Table 8: Short Antisense Compounds targeted to SEQ ID NO: 5
-93-5' 3' ISIS Target Target Gapmer SEQ ID
NO. Site Site Sequence (5'-3') Motif NO

In certain embodiments, a target region is nucleotides 85-100 of SEQ ID NO: 5.
In certain such embodiments, short antisense compounds targeted to nucleotides 85-100 of SEQ
ID NO: 5 comprise a nucleotide sequence selected from SEQ ID NO: 406, 407, or 408. In certain such embodiments, a short antisense compound targeted to nucleotides 85-100 of SEQ ID NO: 5 is selected from Isis No. 387541, 387540, or 387539.
In certain embodiments, short antisense compounds targeted to a SOD1 nucleic acid are 8 to 16, preferably 9 to 15, more preferably 9 to 14, more preferably 10 to 14 nucleotides in length. In certain embodiments, short antisense compounds targeted to a SOD 1 nucleic acid are 9 to 14 nucleotides in length. In certain embodiments, short antisense compounds targeted to a SOD1 nucleic acid are 10 to 14 nucleotides in length. In certain embodiments, such short antisense compounds are short antisense oligonucleotides.
In certain embodiments, short antisense compounds targeted to a SOD1 nucleic acid are short gapmers. In certain such embodiments, short gapmers targeted to a SOD1 nucleic acid comprise at least one high affinity modification in one or more wings of the compound. In certain embodiments, short antisense compounds targeted to a SOD1 nucleic acid comprise I to 3 high-affinity modifications in each wing. In certain such embodiments, the nucleosides or nucleotides of the wing comprise a 2' modification. In certain such embodiments, the monomers of the wing are BNA's.
In certain such embodiments, the monomers of the wing are selected from a-L-Methyleneoxy (4'-CH2-O-2') BNA,(3-D-Methyleneoxy (4'-CHZ-O-2') BNA , Ethyleneoxy (4'-(CH2)2-O-2') BNA , Aminooxy (4'-CH2-O-N(R)-2') BNA and Oxyamino (4'-CHZ-N(R)-0-2') BNA. In certain embodiments, the monomers of a wing comprise a substituent at the 2' position selected from allyl, amino, azido, thio, 0-allyl, O-Cl-Cio alkyl, -OCF3, 0-(CH2)2-O-CH3, 2'-O(CHZ)ZSCH3, O-(CH2)2-O-N(R.)(Rõ), and O-CH2-C(=O)-N(R,,,)(Rõ), where each R,,, and Rõ is, independently, H or substituted or unsubstituted Ci-Clo alkyl. In certain embodiments, the monomers of a wing are 2'MOE nucleotides.
In certain embodiments, short antisense compounds targeted to a SOD1 nucleic acid comprise a gap between the 5' wing and the 3' wing. In certain embodiments the gap comprises five, six, seven, eight, nine, ten, eleven, twelve, thirteen, or fourteen monomers. In certain embodiments, the monomers of the gap are unmodified deoxyribonucleotides. In certain embodiments, the monomers of the gap are unmodified ribonucleotides. In certain embodiments, gap modifications (if any) gap result in an antisense compound that, when bound to its target nucleic acid, supports cleavage by an RNase, including, but not limited to, RNase H.
In certain embodiments, short antisense compounds targeted to a SOD1 nucleic acid have
-94-uniform monomeric linkages. In certain such embodiments, those linkages are all phosphorothioate linkages. In certain embodiments, the linkages are all phosphodiester linkages. In certain embodiments, short antisense compounds targeted to a SOD1 nucleic acid have mixed backbones.
In certain embodiments, short antisense compounds targeted to a SOD1 nucleic acid are 8 monomers in length. In certain embodiments, short antisense compounds targeted to a SOD 1 nucleic acid are 9 monomers in length. In certain embodiments, short antisense compounds targeted to a SOD1 nucleic acid are 10 monomers in length. In certain embodiments, short antisense compounds targeted to a SOD1 nucleic acid are 11 monomers in length. In certain embodiments, short antisense compounds targeted to a SOD1 nucleic acid are monomers in length. In certain embodiments, short antisense compounds targeted to a SOD1 nucleic acid are 13 monomers in length. In certain embodiments, short antisense compounds targeted to a SOD1 nucleic acid are 14 monomers in length.
In certain embodiments, short antisense compounds targeted to a SOD1 nucleic acid are 15 monomers in length. In certain embodiments, short antisense compounds targeted to a SOD1 nucleic acid are 16 monomers in length. In certain embodiments, short antisense compounds targeted to a SOD1 nucleic acid comprise 9 to 15 monomers. In certain embodiments, short antisense compounds targeted to a SOD1 nucleic acid comprise 10 to 15 monomers. In certain embodiments, short antisense compounds targeted to a SOD 1 nucleic acid comprise 12 to 14 monomers. In certain embodiments, short antisense compounds targeted to a SOD1 nucleic acid comprise 12 to 14 nucleotides or nucleosides.
In certain embodiments, the invention provides methods of modulating expression of SOD1. In certain embodiments, such methods comprise use of one or more short antisense compound targeted to a SOD1 nucleic acid, wherein the short antisense compound targeted to a SOD1 nucleic acid is from about 8 to about 16, preferably 9 to 15, more preferably 9 to 14, more preferably 10 to 14 monomers (i.e. from about 8 to about 16 linked monomers). One of ordinary skill in the art will appreciate that this comprehends methods of modulating expression of SOD1 using one or more short antisense compounds targeted to a SOD1 nucleic acid of 8, 9, 10, 11, 12, 13, 14, 15 or 16 monomers.
In certain embodiments, methods of modulating SOD1 comprise use of a short antisense compound targeted to a SOD1 nucleic acid that is 8 monomers in length. In certain embodiments, methods of modulating SOD1 comprise use of a short antisense compound targeted to a SOD1 nucleic acid that is 9 monomers in length. In certain embodiments, methods of modulating SOD1 comprise use of a short antisense compound targeted to a SOD1 nucleic acid that is 10 monomers in length. In certain embodiments, methods of modulating SOD1 comprise use of a short antisense compound targeted to a SOD1 nucleic acid that is 11 monomers in length. In certain embodiments, methods of modulating SOD1 comprise use of a short antisense compound targeted to a SOD1 nucleic acid that is 12 monomers in length. In certain embodiments, methods of modulating SOD1 comprise use of a short antisense compound targeted to a SOD1 nucleic acid that is 13 monomers in length. In certain embodiments, methods of modulating SOD1 comprise use of a short antisense compound targeted to a SOD1 nucleic acid that is 14 monomers in length. In certain embodiments, methods of modulating SOD1 comprise use
-95-of a short antisense compound targeted to a SOD1 nucleic acid that is 15 monomers in length. In certain embodiments, methods of modulating SOD1 comprise use of a short antisense compound targeted to a SOD1 nucleic acid that is 16 monomers in length.
In certain embodiments, methods of modulating expression of SOD1 comprise use of a short antisense compound targeted to a SOD1 nucleic acid comprising 9 to 15 monomers. In certain embodiments, methods of modulating expression of SOD1 comprise use of a short antisense compound targeted to a SOD1 nucleic acid comprising 10 to 15 monomers. In certain embodiments, methods of modulating expression of SOD1 comprise use of a short antisense compound targeted to a SOD1 nucleic acid comprising 12 to 14 monomers. In certain embodiments, methods of modulating expression of SOD1 comprise use of a short antisense compound targeted to a SOD 1 nucleic acid comprising 12 or 14 nucleotides or nucleosides.

5. CRP
CRP (also known as C-reactive protein and PTX1) is an essential human acute-phase reactant produced in the liver in response to a variety of inflammatory cytokines. The protein, first identified in 1930, is highly conserved and considered to be an early indicator of infectious or inflammatory conditions. Plasma CRP levels increase 1,000-fold in response to infection, ischemia, trauma, burns, and inflammatory conditions. In clinical trials where patients receive lipid-lowering therapy, such as statin therapy, it has been demonstrated that patients having reductions in both LDL-C and CRP have a reduced risk of future coronary events relative to patients experiencing only reductions in LDL-C.

Definitions "CRP" means the gene product or protein of which expression is to be modulated by a short antisense compound.
"CRP nucleic acid" means any nucleic acid encoding CRP. For example, in certain embodiments, a CRP nucleic acid includes, without limitations, a DNA sequence encoding CRP, an RNA
sequence transcribed from DNA encoding CRP, and an mRNA sequence encoding CRP.
"CRP mRNA" means an mRNA encoding CRP.
CRP Therapeutic Indications In certain embodiments, the invention provides methods of modulating CRP
expression in an individual comprising administering to the individual a short antisense compound targeted to a CRP
nucleic acid. In certain embodiments, the invention provides methods of treating an individual comprising administering one or more pharmaceutical compositions comprising a short antisense compound targeted to a CRP nucleic acid. In certain embodiments, the individual has hypercholesterolemia, non-familial hypercholesterolemia, familial hypercholesterolemia, heterozygous familial hypercholesterolemia, homozygous familial hypercholesterolemia, mixed dyslipidemia, atherosclerosis, a risk of developing
-96-atherosclerosis, coronary heart disease, a history of coronary heart disease, early onset coronary heart disease, one or more risk factors for coronary heart disease. In certain embodiments, the individual has acute coronary syndrome, vascular injury, arterial occlusion, unstable angina, post peripheral vascular disease, post myocardial infarction (MI), thrombosis, deep vein thrombus, end-stage renal disease (ESRD), chronic renal failure, complement activation, congestive heart failure, or systemic vasculitis. In certain embodiments, the individual has had a stroke.
In certain embodiments, the individual has undergone a procedure selected from elective stent placement, angioplasty, post percutaneous transluminal angioplasty (PTCA), cardiac transplantation, renal dialysis or cardiopulmonary bypass.
In certain embodiments, the individual has an inflammatory disease. In certain such embodiments, the inflammatory disease is selected from inflammatory bowel disease, ulcerative colitis, rheumatoid arthritis, or osteoarthritis.
Guidelines for lipid-lowering therapy were established in 2001 by Adult Treatment Panel III
(ATP III) of the National Cholesterol Education Program (NCEP), and updated in 2004 (Grundy et al., Circulation, 2004, 110, 227-239). The guidelines include obtaining a complete lipoprotein profile, typically after a 9 to 12 hour fast, for determination of LDL-C, total cholesterol, and HDL-C levels.
According to the most recently established guidelines, LDL-C levels of 130-159 mg/dL, 160-189 mg/dL, and greater than or equal to 190 mg/dL are considered borderline high, high, and very high, respectively.
Total cholesterol levels of 200-239 and greater than or equal to 240 mg/dL are considered borderline high and high, respectively. HDL-C levels of less than 40 mg/dL are considered low.
In certain embodiments, the individual has been identified as in need of lipid-lowering therapy. In certain such embodiments, the individual has been identified as in need of lipid-lowering therapy according to the guidelines established in 2001 by Adult Treatment Panel III
(ATP III) of the National Cholesterol Education Program (NCEP), and updated in 2004 (Grundy et al., Circulation, 2004, 110, 227-239). In certain such embodiments, the individual in need of lipid-lowering therapy has LDL-C above 190 mg/dL. In certain such embodiments, the individual in need of lipid-lowering therapy has LDL-C above 160 mg/dL. In certain such embodiments, the individual in need of lipid-lowering therapy has LDL-C
above 130 mg/dL. In certain such embodiments the individual in need of lipid-lowering therapy has LDL-C above 100 mg/dL. In certain such embodiments the individual in need of lipid-lowering therapy should maintain LDL-C below 160 mg/dL. In certain such embodiments the individual in need of lipid-lowering therapy should maintain LDL-C below 130 mg/dL. In certain such embodiments the individual in need of lipid-lowering therapy should maintain LDL-C below 100 mg/dL. In certain such embodiments the individual should maintain LDL-C below 70 mg/dL.
In certain embodiments the invention provides methods for reducing CRP in an individual. In certain such embodiments, the reduction in CRP is at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, and at least 100%.
-97-In certain embodiments, the methods provided by the present invention do not lower HDL-C. In certain embodiments, the methods provided by the present invention do not result in accumulation of lipids in the liver. In certain embodiments, the methods provided by the present invention do not cause hepatic steatosis.
In certain embodiments, the invention provides methods for lowering CRP
concentration in a subject while reducing side effects associated with treatment. In certain such embodiments, a side effect is liver toxicity. In certain such embodiments, a side effect is abnormal liver function. In certain such embodiments, a side effect is elevated alanine aminotransferase (ALT). In certain such embodiments, a side effect is elevated aspartate aminotransferase (AST).
In certain embodiments, the invention provides methods for lowering CRP
concentration in a subject who is not reaching target LDL-C levels as a result of lipid-lowering therapy. In certain such embodiments, a short antisense compound targeted to a CRP nucleic acid is the only pharmaceutical agent administered to the subject. In certain such embodiments, the subject has not complied with recommended lipid-lowering therapy. In certain such embodiments, a pharmaceutical composition of the invention is co-administered with an additional different lipid-lowering therapy. In certain such embodiments, an additional lipid-lowering therapy is LDL-apheresis. In certain such embodiments, an additional lipid-lowering therapy is a statin. In certain such embodiments, an additional lipid-lowering therapy is ezetimibe.
In certain embodiments, the invention provides methods for lowering CRP
concentration in a statin-intolerant subject. In certain such embodiments, the subject has creatine kinase concentration increases as a result of statin administration. In certain such embodiments, the subject has liver function abnormalities as a result of statin administration. In certain such embodiments the subject has muscle aches as a result of statin administration. In certain such embodiments the subject has central nervous system side effects as a result of statin administration. In certain embodiments, the subject has not complied with recommended statin administration.
In certain embodiments, the invention provides methods for reducing coronary heart disease risk in a subject. In certain embodiments the invention provides methods for slowing the progression of atherosclerosis in a subject. In certain such embodiments the invention provides methods for stopping the progression of atherosclerosis in a subject. In certain such embodiments the invention provides methods for reducing the size and/or prevalence of atherosclerotic plaques in a subject. In certain embodiments the methods provided reduce a subject's risk of developing atherosclerosis.
In certain embodiments the methods provided improve the cardiovascular outcome in a subject.
In certain such embodiments improved cardiovascular outcome is the reduction of the risk of developing coronary heart disease. In certain such embodiments, improved cardiovascular outcome is a reduction in the occurance of one or more major cardiovascular events, which include, but are not limited to, death, myocardial infarction, reinfarction, stroke, cardiogenic shock, pulmonary edema, cardiac arrest, and atrial dysrhythmia. In certain such embodiments, the improved cardiovascular outcome is evidenced by
-98-improved carotid intimal media thickness. In certain such embodiments, improved carotid intimal media thickness is a decrease in thickness. In certain such embodiments, improved carotid intimal media thickness is a prevention an increase of intimal media thickness.
In certain embodiments a pharmaceutical composition comprising a short antisense compound targeted to a CRP nucleic acid is for use in therapy. In certain embodiments, the therapy is the reduction of CRP in an individual. In certain embodiments, the therapy is the treatment of hypercholesterolemia, non-familial hypercholesterolemia, familial hypercholesterolemia, heterozygous familial hypercholesterolemia, homozygous familial hypercholesterolemia, mixed dyslipidemia, atherosclerosis, a risk of developing atherosclerosis, coronary heart disease, a history of coronary heart disease, or early onset coronary heart disease. In additional embodiments, the therapy is the reduction of CHD risk. In certain the therapy is prevention of atherosclerosis. In certain embodiments, the therapy is the prevention of coronary heart disease. In certain embodiments, the therapy is the treatment of acute coronary syndrome, chronic renal failure, vascular injury, arterial occlusion, atherothrombosis, unstable angina, post peripheral vascular disease, post myocardial infarction (MI), thrombosis, deep vein thrombus, end-stage renal disease (ESRD), complement activation, congestive heart failure, or systemic vasculitis. In certain embodiments the therapy is the treatment of an individual who has undergone a procedure selected from elective stent placement, angioplasty, post percutaneous transluminal angioplasty (PTCA), cardiac transplantation, renal dialysis or cardiopulmonary bypass. In certain embodiments, the therapy is the treatment of an inflammatory disorder.
In certain embodiments a pharmaceutical composition comprising a short antisense compound targeted to a CRP nucleic acid is used for the preparation of a medicament for reducing CRP in an individual. In certain embodiments pharmaceutical composition comprising a short antisense compound targeted to a CRP nucleic acid is used for the preparation of a medicament for reducing coronary heart disease risk. In certain embodiments a short antisense compound targeted to a CRP nucleic acid is used for the preparation of a medicament for the treatment of hypercholesterolemia, non-familial hypercholesterolemia, familial hypercholesterolemia, heterozygous familial hypercholesterolemia, homozygous familial hypercholesterolemia, mixed dyslipidemia, atherosclerosis, a risk of developing atherosclerosis, coronary heart disease, a history of coronary heart disease, early onset coronary heart disease, or one or more risk factors for coronary heart disease.
In certain embodiments, a short antisense compound targeted to a CRP nucleic acid is used for the preparation of a medicament for the treatment of acute coronary syndrome, chronic renal failure, vascular injury, arterial occlusion, atherothrombosis, unstable angina, post peripheral vascular disease, post myocardial infarction (MI), thrombosis, deep vein thrombus, end-stage renal disease (ESRD), complement activation, congestive heart failure, or systemic vasculitis. In certain embodiments, a short antisense compound targeted to a CRP nucleic acid is used for the preparation of a medicament for the treatment of an individual who has had a stroke.
In certain embodiments, a short antisense compound targeted to a CRP nucleic acid is used for
-99-the preparation of a medicament for the treatment in an individual who has undergone a procedure selected from elective stent placement, angioplasty, post percutaneous transluminal angioplasty (PTCA), cardiac transplantation, renal dialysis or cardiopulmonary bypass.
In certain embodiments, a short antisense compound targeted to a CRP nucleic acid is used for the preparation of a medicament for the treatment of an inflammatory disease.
In certain such embodiments, a short antisense compound targeted to a CRP nucleic acid is used for the preparation of a medicament for the treatment of inflammatory bowel disease, ulcerative colitis, rheumatoid arthritis, or osteoarthritis.

CRP Combination Therapies In certain embodiments, one or more pharmaceutical compositions comprising a short antisense compound-targeted to a CRP nucleic acid are co-administered with one or more other pharmaceutical agents. In certain embodiments, the one or more other pharmaceutical agents is a lipid-lowering agent. In certain embodiments, such one or more other pharmaceutical agents are designed to treat the same disease or condition as the one or more pharmaceutical compositions of the present invention. In certain embodiments, such one or more other phannaceutical agents are designed to treat a different disease or condition as the one or more pharmaceutical compositions of the present invention. In certain embodiments, such one or more other pharmaceutical agents are designed to treat an undesired effect of one or more pharmaceutical compositions of the present invention. In certain embodiments, one or more pharmaceutical compositions of the present invention are co-administered with another pharmaceutical agent to treat an undesired effect of that other pharmaceutical agent. In certain embodiments, one or more pharmaceutical compositions of the present invention and one or more other pharmaceutical agents are administered at the same time. In certain embodiments, one or more pharmaceutical compositions of the present invention and one or more other phannaceutical agents are administered at different times. In certain embodiments, one or more pharmaceutical compositions of the present invention and one or more other pharmaceutical agents are prepared together in a single formulation. In certain embodiments, one or more pharmaceutical compositions of the present invention and one or more other pharmaceutical agents are prepared separately.
In certain embodiments, pharmaceutical agents that may be co-administered with a pharmaceutical composition comprising a short antisense compound targeted to a CRP nucleic acid include lipid-lowering agents. In certain such embodiments, phannaceutical agents that may be co-administered with a pharmaceutical composition of the present invention include, but are not limited to atorvastatin, simvastatin, rosuvastatin, and ezetimibe. In certain such embodiments, the lipid-lowering agent is administered prior to administration of a pharmaceutical composition of the present invention. In certain such embodiments, the lipid-lowering agent is administered following administration of a pharmaceutical composition of the present invention. In certain such embodiments the lipid-lowering agent is administered at the same time as a pharmaceutical composition of the present invention. In
-100-certain such embodiments the dose of a co-administered lipid-lowering agent is the same as the dose that would be administered if the lipid-lowering agent was administered alone. In certain such embodiments the dose of a co-administered lipid-lowering agent is lower than the dose that would be administered if the lipid-lowering agent was administered alone. In certain such embodiments the dose of a co-administered lipid-lowering agent is greater than the dose that would be administered if the lipid-lowering agent was administered alone.
In certain embodiments, a co-administered lipid-lowering agent is a HMG-CoA
reductase inhibitor. In certain such embodiments the HMG-CoA reductase inhibitor is a statin. In certain such embodiments the statin is selected from atorvastatin, simvastatin, pravastatin, fluvastatin, and rosuvastatin.
In certain embodiments, a co-administered lipid-lowering agent is ISIS 301012.
In certain embodiments, a co-administered lipid-lowering agent is a cholesterol absorption inhibitor. In certain such embodiments, cholesterol absorption inhibitor is ezetimibe.
In certain embodiments, a co-administered lipid-lowering agent is a co-formulated HMG-CoA
reductase inhibitor and cholesterol absorption inhibitor. In certain such embodiments the co-formulated lipid-lowering agent is ezetimibe/simvastatin.
In certain embodiments, a co-administered lipid-lowering agent is a microsomal triglyceride transfer protein inhibitor (MTP inhibitor).
In certain embodiments, a co-administered pharmaceutical agent is a bile acid sequestrant. In certain such embodiments, the bile acid sequestrant is selected from cholestyramine, colestipol, and colesevelam.
In certain embodiments, a co-administered pharmaceutical agent is a nicotinic acid. In certain such embodiments, the nicotinic acid is selected from immediate release nicotinic acid, extended release nicotinic acid, and sustained release nicotinic acid.
In certain embodiments, a co-administered pharmaceutical agent is a fibric acid. In certain such embodiments, a fibric acid is selected from gemfibrozil, fenofibrate, clofibrate, bezafibrate, and ciprofibrate.
Further examples of pharmaceutical agents that may be co-administered with a pharmaceutical composition comprising a short antisense compound targeted to a CRP nucleic acid include, but are not limited to, corticosteroids, including but not limited to prednisone;
inununoglobulins, including, but not limited to intravenous immunoglobulin (IVIg); analgesics (e.g., acetaminophen); anti-inflammatory agents, including, but not limited to non-steroidal anti-inflammatory drugs (e.g., ibuprofen, COX-1 inhibitors, and COX-2, inhibitors); salicylates; antibiotics; antivirals;
antifungal agents; antidiabetic agents (e.g., biguanides, glucosidase inhibitors, insulins, sulfonylureas, and thiazolidenediones);
adrenergic modifiers; diuretics; hormones (e.g., anabolic steroids, androgen, estrogen, calcitonin, progestin, somatostan, and thyroid hormones); immunomodulators; muscle relaxants; antihistamines;
osteoporosis agents (e.g., biphosphonates, calcitonin, and estrogens);
prostaglandins, antineoplastic
-101-agents; psychotherapeutic agents; sedatives; poison oak or poison sumac products; antibodies; and vaccines.
In certain embodiments, a pharmaceutical composition comprising a short antisense compound targeted to a CRP nucleic acid may be administered in conjuction with a lipid-lowering therapy. In certain such embodiments, a lipid-lowering therapy is therapeutic lifestyle change. In certain such embodiments, a lipid-lowering therapy is LDL apheresis.

Certain Short Antisense Compounds Targeted to a CRP nucleic acid In certain embodiments, short antisense compounds are targeted to a CRP
nucleic acid having the sequence of GENBANK Accession No. NM 000567.1, incorporated herein as SEQ
ID NO: 6. In certain such embodiments, a short antisense compound targeted to SEQ ID NO: 6 is at least 90%
complementary to SEQ ID NO: 6. In certain such embodiments, a short antisense-compound targeted to SEQ ID NO: 6 is at least 95% complementary to SEQ ID NO: 6. In certain such embodiments, a short antisense compound targeted to SEQ ID NO: 6 is 100% complementary to SEQ ID
NO: 6. In certain embodiments, a short antisense compound targeted to SEQ ID NO: 6 comprises a nucleotide sequence selected from the nucleotide sequences set forth in Table 9.
The nucleotide sequence set forth in each SEQ ID NO in Table 9 is independent of any modification to a sugar moiety, an intemucleoside linkage, or a nucleobase. As such, short antisense compounds defined by a SEQ ID NO may comprise, independently, one or more modifications to a sugar moiety, an intemucleoside linkage, or a nucleobase. Short antisense compounds described by Isis Number (Isis NO.) indicate a combination of nucleobase sequence and one or more modifications to a sugar moiety, an intemucleoside linkage, or a nucleobase.
Table 9 illustrates examples of short antisense compounds targeted to SEQ ID
NO: 6. Table 9 illustrates short antisense compounds that are 100% complementary to SEQ ID
NO: 6. The column labeled `gapmer motif indicates the wing-gap-wing motif of each short antisense compounds. The gap segment comprises 2'-deoxynucleotides and each nucleotide of each wing segment comprises a 2'-modified sugar. The particular 2'-modified sugar is also indicated in the `gapmer motif column. For example, `2-10-2 MOE' means a 2-10-2 gapmer motif, where a gap segment of ten 2'-deoxynucleotides is flanked by wing segments of two nucleotides, where the nucleotides of the wing segments are 2'-MOE
nucleotides. Internucleoside linkages are phosphorothioate. The short antisense compounds comprise 5-methylcytidine in place of unmodified cytosine, unless "unmodified cytosine"
is listed in the gapmer motif column, in which case the indicated cytosines are unmodified cytosines.
For example, "5-mC in gap only" indicates that the gap segment has 5-methylcytosines, while the wing segments have unmodified cytosines.
In certain embodiments, short antisense compounds targeting a CRP nucleic acid may have any one or more properties or characteristics of the short antisense compounds generally described herein. In certain embodiments, short antisense compounds targeting a CRP nucleic acid have a motif (wing -
-102-deoxy gap -wing) selected from 1-12-1, 1-1-10-2, 2-10-1-1, 3-10-3, 2-10-3, 2-10-2, 1-10-1,1-10-2, 3-8-3, 2-8-2, 1-8-1, 3-6-3 or 1-6-1, more preferably 1-10-1, 2-10-2, 3-10-3, and 1-9-2.

Table 9: Short Antisense Compounds targeted to SEQ ID NO: 6 5' 3' Seq ID
ISIS Target Target NO
NO. Site Site Sequence (5'-3') Gapmer Motif In certain embodiments, a target region is nucleotides 1305-1320 of NM
000567.1. In certain such embodiments, short antisense compounds targeted to nucleotides 1305-1320 of NM 000567.1 comprise a nucleotide sequence selected from SEQ ID NO: 1305 or 1306. In certain such embodiments, a short antisense compound targeted to nucleotides 263-278 of NM 000567.1 is selected from Isis NO.
353484 or 353485.
In certain embodiments, a target region is nucleotides 1257-1272 of NM
000567.1. In certain such embodiments, a short antisense compound targeted to nucleotides 1257-1272 of NM 000567.1 comprises a nucleotide sequence selected from SEQ ID NO 1257 or 1258. In certain such embodiments, a short antisense compound targeted to nucleotides 428-483 of NM000567.1 is selected from Isis NO.
353506 or 353507.
In certain embodiments, short antisense compounds targeted to a CRP nucleic acid are 8 to 16, preferably 9 to 15, more preferably 9 to 14, more preferably 10 to 14 nucleotides in length. In certain embodiments, short antisense compounds targeted to a CRP nucleic acid are 9 to 14 nucleotides in length.
In certain embodiments, short antisense compounds targeted to a CRP nucleic acid are 10 to 14 nucleotides in length. In certain embodiments, such short antisense compounds are short antisense oligonucleotides.
In certain embodiments, short antisense compounds targeted to a CRP nucleic acid are short gapmers. In certain such embodiments, short gapmers targeted to a CRP nucleic acid comprise at least one high affinity modification in one or more wings of the compound. In certain embodiments, short antisense compounds targeted to a CRP nucleic acid comprise 1 to 3 high-affinity modifications in each wing. In certain such embodiments, the nucleosides or nucleotides of the wing comprise a 2' modification. In certain such embodiments, the monomers of the wing are BNA's.
In certain such embodiments, the monomers of the wing are selected from a-L-Methyleneoxy (4'-CH2-O-2') BNA,(3-D-Methyleneoxy (4'-CH2-O-2') BNA , Ethyleneoxy (4'-(CH2)2-O-2') BNA , Aminooxy (4'-CH2-O-N(R)-2') BNA and Oxyamino (4'-CH2-N(R)-0-2') BNA. In certain embodiments, the monomers of a wing comprise a substituent at the 2' position selected from allyl, amino, azido, thio, O-allyl, O-CI-Cio alkyl, -OCF3, O-(CH2)2-O-CH3, 2'-O(CH2)2SCH3, O-(CHZ)Z-O-N(Rm)(Rn), and O-CH2-C(=O)-N(Rm)(Rõ), where
-103-each R. and Rõ is, independently, H or substituted or unsubstituted Cl-Clo alkyl. In certain embodiments, the monomers of a wing are 2'MOE nucleotides.
In certain embodiments, short antisense compounds targeted to a CRP nucleic acid comprise a gap between the 5' wing and the 3' wing. In certain embodiments the gap comprises five, six, seven, eight, nine, ten, eleven, twelve, thirteen, or fourteen monomers. In certain embodiments, the monomers of the gap are unmodified deoxyribonucleotides. In certain embodiments, the monomers of the gap are unmodified ribonucleotides. In certain embodiments, gap modifications (if any) gap result in an antisense compound that, when bound to its target nucleic acid, supports cleavage by an RNase, including, but not limited to, RNase H.
In certain embodiments, short antisense compounds targeted to a CRP nucleic acid have uniform monomeric linkages. In certain such embodiments, those linkages are all phosphorothioate linkages. In certain embodiments, the linkages are all phosphodiester linkages. In certain embodiments, short antisense compounds targeted to a CRP nucleic acid have mixed backbones.
In certain embodiments, short antisense compounds targeted to a CRP nucleic acid are 8 monomers in length. In certain embodiments, short antisense compounds targeted to a CRP nucleic acid are 9 monomers in length. In certain embodiments, short antisense compounds targeted to a CRP nucleic acid are 10 monomers in length. In certain embodiments, short antisense compounds targeted to a CRP
nucleic acid are 11 monomers in length. In certain embodiments, short antisense compounds targeted to a CRP nucleic acid are monomers in length. In certain embodiments, short antisense compounds targeted to a CRP nucleic acid are 13 monomers in length. In certain embodiments, short antisense compounds targeted to a CRP nucleic acid are 14 monomers in length. In certain embodiments, short antisense compounds targeted to a CRP nucleic acid are 15 monomers in length. In certain embodiments, short antisense compounds targeted to a CRP nucleic acid are 16 monomers in length.
In certain embodiments, short antisense compounds targeted to a CRP nucleic acid comprise 9 to 15 monomers. In certain embodiments, short antisense compounds targeted to a CRP nucleic acid comprise 10 to 15 monomers.
In certain embodiments, short antisense compounds targeted to a CRP nucleic acid comprise 12 to 14 monomers. In certain embodiments, short antisense compounds targeted to a CRP
nucleic acid comprise 12 to 14 nucleotides or nucleosides.
In certain embodiments, the invention provides methods of modulating expression of CRP. In certain embodiments, such methods comprise use of one or more short antisense compound targeted to a CRP nucleic acid, wherein the short antisense compound targeted to a CRP
nucleic acid is from about 8 to about 16, preferably 9 to 15, more preferably 9 to 14, more preferably 10 to 14 monomers (i.e. from about 8 to about 16 linked monomers). One of ordinary skill in the art will appreciate that this comprehends methods of modulating expression of CRP using one or more short antisense compounds targeted to a CRP nucleic acid of 8, 9, 10, 11, 12, 13, 14, 15 or 16 monomers.
In certain embodiments, methods of modulating CRP comprise use of a short antisense compound targeted to a CRP nucleic acid that is 8 monomers in length. In certain embodiments, methods
-104-of modulating CRP comprise use of a short antisense compound targeted to a CRP
nucleic acid that is 9 monomers in length. In certain embodiments, methods of modulating CRP comprise use of a short antisense compound targeted to a CRP nucleic acid that is 10 monomers in length. In certain embodiments, methods of modulating CRP comprise use of a short antisense compound targeted to a CRP nucleic acid that is 11 monomers in length. In certain embodiments, methods of modulating CRP
comprise use of a short antisense compound targeted to a CRP nucleic acid that is 12 monomers in length.
In certain embodiments, methods of modulating CRP comprise use of a short antisense compound targeted to a CRP nucleic acid that is 13 monomers in length. In certain embodiments, methods of modulating CRP comprise use of a short antisense compound targeted to a CRP
nucleic acid that is 14 monomers in length. In certain embodiments, methods of modulating CRP comprise use of a short antisense compound targeted to a CRP nucleic acid that is 15 monomers in length. In certain embodiments, methods of modulating CRP comprise use of a short antisense compound targeted to a CRP nucleic acid that is 16 monomers in length.
In certain embodiments, methods of modulating expression of CRP comprise use of a short antisense compound targeted to a CRP nucleic acid comprising 9 to 15 monomers.
In certain embodiments, methods of modulating expression of CRP comprise use of a short antisense compound targeted to a CRP nucleic acid comprising 10 to 15 monomers. In certain embodiments, methods of modulating expression of CRP comprise use of a short antisense compound targeted to a CRP nucleic acid comprising 12 to 14 monomers. In certain embodiments, methods of modulating expression of CRP
comprise use of a short antisense compound targeted to a CRP nucleic acid comprising 12 or 14 nucleotides or nucleosides.

6. Glucocorticoid Receptor (GCCR) Glucocorticoids were among the first steroid hormones to be identified and are responsible for a multitude of physiological functions, including the stimulation of gluconeogenesis, decreased glucose uptake and utilization in peripheral tissues, increased glycogen deposition, suppression of immune and inflammatory responses, inhibition of cytokine synthesis and acceleration of various developmental events. Glucocorticoids are also especially important for combating stress.
Stress-induced elevation of glucocorticoid synthesis and release leads to, among other responses, increased ventricular workload, inhibition of inflammatory mediators, inhibition of cytokine synthesis and increased glucose production (Karin, Cell, 1998, 93, 487-490).
Both natural glucocorticoids and their synthetic derivatives exert their action through the glucocorticoid receptor, a ubiquitously expressed cytoplasmic member of the nuclear hormone superfamily of receptors. Human glucocorticoid receptor is also known as nuclear receptor subfamily 3, group C, member 1; NR3C1; GCCR; GCR; GRL; Glucocorticoid receptor, lymphocyte.
The gene is located on human chromosome 5q11-q13 and consists of 9 exons (Encio and Detera-Wadleigh, J Biol Chem, 1991, 266, 7182-7188; Gehring et al., Proc Natl Acad Sci U S A, 1985, 82, 3751-3755). Multiple
-105-forms of human glucocorticoid receptor mRNA exist: a 5.5 kb human glucocorticoid receptor a cDNA
containing exons 1-8 and exon 9a; a 4.3 kb human glucocorticoid receptor 0 cDNA containing exons 1-8 and exon 9(3; and a 7.0 kb human glucocorticoid receptor a cDNA containing exons 1-8 and the entire exon 9, which includes exon 9a, exon 9(3 and the `J region', which is flanked by exons 9a and 9(3 (Hollenberg et al., Nature, 1985, 318, 635-641; Oakley et al., J Biol Chem, 1996, 271, 9550-9559).
Human glucocorticoid receptor a is the predominant isoform of the receptor and the one that exhibits steroid binding activity (Hollenberg et al., Nature, 1985, 318, 635-641).
Additionally, through usage of three different promoters three different exon 1 variants can be transcribed, and alternative splicing of one exon 1 variant can result in three different versions of this exon. Thus, human glucocorticoid receptor mRNA may contain 5 different versions of exon 1(Breslin et al., Mol Endocrinol, 2001, 15, 1381-1395).
Examination of the expression patterns of the a and (3 isoforms of human glucocorticoid receptor mRNA reveals that the a isoform is more abundantly expressed. Both isoforms are expressed in similar tissues and cell types, including lung, kidney, heart, liver, skeletal muscle, macrophages, neutrophils and peripheral blood mononuclear cells. Only human glucocorticoid receptor a is expressed in colon. At the level of protein, while the a isoform is detected in all tissues examined, the 0 isoform is undetectable, suggesting that under physiological conditions, the default splicing pathway is the one that produces the a isoform (Pujols et al., Am J Physiol Cell Physiol, 2002, 283, C1324-1331). The 0 isoform of glucocorticoid receptor binds neither a glucocorticoid agonist nor an antagonist. Furthermore, the (3 isoform is localized primarily in the nucleus in transfected cells, independent of hormone stimulation.
When both isoforms are expressed in the same cell, the glucocorticoid receptor 0 inhibits the hormone-induced, glucocorticoid receptor a-mediated stimulation of gene expression, suggesting that the 0 isoform functions as an inhibitor of glucocorticoid receptor a activity (Oakley et al., J Biol Chem, 1996, 271, 9550-9559). Unless otherwise noted, the human glucocorticoid receptor described herein is defined as the ubiquitous product(s) of the gene located on chromosome 5q11-q13.
Cell lines transfected with a complementary glucocorticoid receptor antisense RNA strand exhibited a reduction in glucocorticoid receptor mRNA levels and a decreased response to the glucocorticoid receptor agonist dexamethasone (Pepin and Barden, Mol Cell Biol, 1991, 11, 1647-1653).
Transgenic mice bearing an antisense glucocorticoid receptor gene construct were used to study the glucocorticoid feedback effect on the hypothalamus-pituitary-adrenal axis (Pepin et al., Nature, 1992, 355, 725-728). In another study of similarly genetically engineered mice, energy intake and expenditure, heart and vastus lateralis muscle lipoprotein lipase activity, and heart and brown adipose tissue norepinephrine were lower than in control animals. Conversely, fat content and total body energy were significantly higher than in control animals. These results suggest that a defective glucocorticoid receptor system may affect energy balance through increasing energetic efficiency, and they emphasize the modulatory effects of hypothalamic-pituitary-adrenal axis changes on muscle lipoprotein lipase activity (Richard et al., Am JPhysiol, 1993, 265, R146-150).
Behavorial effects of glucocorticoid receptor antagonists have been measured in animal models
-106-designed to assess anxiety, learning and memory. Reduced expression of glucocorticoid receptor in rats long-term intracerebroventricularly infused with antisense oligodeoxynucleotides targeting glucocorticoid receptor mRNA did not interfere with spatial navigation in the Morris water maze test (Engelmann et al., Eur JPharmacol, 1998, 361, 17-26). Bilateral infusion of an antisense oligodeoxynucleotide targeting the glucocorticoid receptor mRNA into the dentate gyrus of the rat hippocampus reduced the immobility of rats in the Porsolt forced swim test (Korte et al., Eur JPharmacol, 1996, 301, 19-25).
Glucocorticoids are frequently used for their immunosuppressive, anti-inflammatory effects in the treatment of diseases such as allergies, athsma, rheumatoid arthritis, AIDS, systemic lupus erythematosus and degenerative osteoarthritis. Negative regulation of gene expression, such as that caused by the interaction of glucocorticoid receptor with NF-kB, is proposed to be at least partly responsible for the anti-inflammatory action of glucocorticoids in vivo. Interleukin-6, tumor necrosis factor a and interleukin-1 are the three cytokines that account for most of the hypothalamic-pituitary-adrenal (HPA) axis stimulation during the stress of inflammation. The HPA axis and the systemic sympathetic and adrenomedullary system are the peripheral components of the stress system, responsible for maintaining basal and stress-related homeostasis. Glucocorticoids, the end products of the HPA axis, inhibit the production of all three inflammatory cytokines and also inhibit their effects on target tissues, with the exception of interleukin-6, which acts synergistically with glucocorticoids to stimulate the production of acute-phase reactants. Glucocorticoid treatment decreases the activity of the HPA axis (Chrousos, N Engl J Med, 1995, 332, 1351-1362).
In some cases, patients are refractory to glucocorticoid treatment. One reason for this resistance to steroids lies with mutations or polymorphisms present in the glucocorticoid receptor gene. A total of 15 missense, three nonsense, three frameshift, one splice site, and two alternative spliced mutations, as well as 16 polymorphisms, have been reported in the NR3C1 gene in association with glucocorticoid resistance (Bray and Cotton, Hum Mutat, 2003, 21, 557-568). Additional studies in humans have suggested a positive association between metabolic syndrome incidence and progression, with alleles at the glucocorticoid receptor (GR) gene (Rosmond, Obes Res, 2002, 10, 1078-1086).
Other cases of glucocorticoid insensitivity are associated with altered expression of glucocorticoid receptor isoforms. A study of human glucocorticoid receptor 0 isoform mRNA expression in glucocorticoid-resistant ulcerative colitis patients revealed the presence of this mRNA was significantly higher than in the glucocorticoid-sensitive patients, suggesting that the expression of human glucocorticoid receptor 0 mRNA in the peripheral blood mononuclear cells may serve as a predictor of glucocorticoid response in ulcerative colitis (Honda et al., Gastroenterology, 2000, 118, 859-866).
Increased expression of glucocorticoid receptor (i is also observed in a significantly high number of glucocorticoid-insensitive asthmatics. Additionally, cytokine-induced abnormalities in the DNA binding capacity of the glucocorticoid receptor were found in peripheral blood mononuclear cells from glucocorticoid-insensitive patients transfection, and HepG2 cells with the glucocorticoid receptor (3 gene resulted in a significant reduction of glucocorticoid receptor a DNA-binding capacity (Leung et al., J Exp
-107-Med, 1997, 186, 1567-1574). Dexamethasone binding studies demonstrate that human glucocorticoid receptor 0 does not alter the affinity of glucocorticoid receptor a for hormonal ligands, but rather its ability to bind to the GRE (Bamberger et al., J Clin Invest, 1995, 95, 2435-2441). Taken together, these results illustrate that glucocorticoid receptor (3, through competition with glucocorticoid receptor a for GRE target sites, may function as a physiologically and pathophysiologically relevant endogenous inhibitor of glucocorticoid action.
In the liver, glucocorticoid agonists increase hepatic glucose production by activating the glucocorticoid receptor, which subsequently leads to increased expression of the gluconeogenic enzymes phosphoenolpyruvate carboxykinase (PEPCK) and glucose-6-phosphatase. Through gluconeogenesis, glucose is formed through non-hexose precursors, such as lactate, pyruvate and alanine (Link, Curr Opin Investig Drugs, 2003, 4, 421-429). Steroidal glucocorticoid receptor antagonists such as RU 486 have been tested in rodent models of diabetes. Mice deficient in the leptin receptor gene, termed db/db mice, are genetically obese, diabetic and hyperinsulinemic. Treatment of hyperglycemic db/db mice with RU
486 decreased blood glucose levels by approximately 49%, without affecting plasma insulin levels.
Additionally, RU 486 treatment reduced the expression of glucocorticoid receptor responsive genes PEPCK, glucose-6-phosphatase, glucose transporter type 2 and tyrosine aminotransferase in db/db mice as compared to untreated animals (Friedman et al., J Biol Chem, 1997, 272, 31475-31481). RU 486 also ameliorates diabetes in the ob/ob mouse model of diabetes, obesity and hyperinsulinemia, through a reduction in serum insulin and blood glucose levels (Gettys et al., Int J Obes Relat Metab Disord, 1997, 21, 865-873).
As increased gluconeogenesis is considered to be the major source of increased glucose production in diabetes, a number of therapeutic targets for the inhibition of hepatic glucose production have been investigated. Due to the ability of antagonists of the glucocorticoid receptor to ameliorate diabetes in animal models, such compounds are among the potential therapies being explored. However, there are detrimental systemic effects of glucocorticoid receptor antagonists, including activation of the HPA axis (Link, Curr Opin Investig Drugs, 2003, 4, 421-429). Increased HPA
axis activity is associated with suppression of immune-related inflammatory action, which can increase susceptibility to infectious agents and neoplasms. Conditions associated with suppression of immune-mediated inflammation through defects in the HPA axis, or its target tissues, include Cushing's syndrome, chronic stress, chronic alcoholism and melancholic depression (Chrousos, N Engl J Med, 1995, 332, 1351-1362). Thus, it is of great value to develop liver-specific glucocorticoid receptor antagonists.
Steroidal glucocorticoid receptor antagonists have been conjugated to bile acids for the purpose of targeting them to the liver (Apelqvist et al., 2000). Currently, there are no known therapeutic agents that target the glucocorticoid receptor without undesired peripheral effects (Link, Curr Opin Investig Drugs, 2003, 4, 421-429).
Consequently, there remains a long felt need for agents capable of effectively inhibiting hepatic glucocorticoid receptor.
-108-Definitions "Glucocorticoid receptor" is the gene product or protein of which expression is to be modulated by administration of a short antisense compound. Glucocorticoid receptor is generally referred to as GCCR.
"GCCR nucleic acid" means any nucleic acid encoding GCCR. For example, in certain embodiments, a GCCR nucleic acid includes, without limitation, a DNA sequence encoding GCCR, an RNA sequence transcribed from DNA encoding GCCR, and an mRNA sequence encoding GCCR.
"GCCR mRNA" means an mRNA encoding GCCR.

Therapeutic indications Antisense technology is an effective means of reducing the expression of specific gene products and therefore is useful in a number of therapeutic, diagnostic and research applications for the modulation of glucocorticoid receptor expression. Furthermore, in certain embodiments, liver is one of the tissues in which the highest concentrations of antisense oligonucleotides are found following administration (Geary et al., Curr. Opin. Investig. Drugs, 2001, 2, 562-573). Therefore, in such embodiments, antisense technology represents an attractive method for the liver-specific inhibition of glucocorticoid receptor.
In certain embodiments, short antisense compounds targeted to a nucleic acid encoding glucocorticoid receptor are preferentially distributed to the liver. In certain embodiments, short antisense compounds have increased potency in the liver when compared to a longer parent compound. In certain embodiments, target RNA is predominantly expressed in the liver.
For therapeutics, a subject, suspected of having a disease or disorder which can be treated by modulating the expression of GCCR is treated by administering one or more short antisense compound.
In a non-limiting example, the methods comprise the step of administering to an animal a therapeutically effective amount of a short antisense compound. Certain short antisense compounds inhibit the activity of GCCR and/ or inhibit expression of GCCR. In certain embodiments, the activity or expression of GCCR in a subject is inhibited by at least 10%, by at least 20%, by at least 25%, by at least 30%, by at least 40%, by at least 50%, by at least 60%, by at least 70%, by at least 75%, by at least 80%, by at least 85%, by at least 90%, by at least 95%, by at least 98%, by at least 99%, or by 100%. In certain embodiments, the activity or expression of GCCR in a subject is inhibited by at least 30%. In certain embodiments, the activity or expression of GCCR in a subject is inhibited by at least 50% or more.
The reduction of the expression of GCCR may be measured, for example, in blood, plasma, serum, adipose tissue, liver or any other body fluid, tissue or organ of the animal. In certain embodiments, cells contained within such fluids, tissues or organs being analyzed comprise nucleic acids encoding GCCR and/or they contain the GCCR protein itself.
Certain phannaceutical and other compositions comprising short antisense compounds are also provided. In certain embodiments, short antisense compounds are be utilized in pharmaceutical compositions by adding to them an effective amount of a compound to a suitable pharmaceutically
-109-acceptable diluent or carrier.
In certain embodiments, short antisense compounds targeting a GCCR nucleic acid have any one or more properties or characteristics of the short antisense compounds generally described herein. In certain embodiments, short antisense compounds targeting a GCCR nucleic acid have a motif (wing -deoxy gap -wing) selected from 1-12-1, 1-1-10-2, 2-10-1-1, 3-10-3, 2-10-3, 2-10-2, 1-10-1,1-10-2, 3-8-3, 2-8-2, 1-8-1, 3-6-3 or 1-6-1, . In certain embodiments, short antisense compounds targeting a GCCR
nucleic acid have a motif (wing - deoxy gap -wing) selected from 1-10-1, 2-10-2, 3-10-3, and 1-9-2. . In certain embodiments, short antisense compounds targeting a GCCR nucleic acid have a motif (wing -deoxy gap -wing) selected from 3-10-3, 2-10-3, 2-10-2, 1-10-1,1-10-2, 2-8-2, 1-8-1, 3-6-3 or 1-6-1, more preferably 2-10-2 and 2-8-2.
In certain embodiments, provided herein are methods of treating an individual by administering one or more short antisense compound targeted to a GCCR nucleic acid or a pharmaceutical composition comprising such compound. Further provided are methods of treating a subject having a disease or conditions associated with GCCR activity by administering a short antisense compound targeted to a GCCR nucleic acid. In addition to diabetes, particularly type 2 diabetes, diseases and conditions associated with GCCR include but are not limited to, obesity, Metabolic syndrome X, Cushing's Syndrome, Addison's disease, inflammatory diseases such as asthma, rhinitis and arthritis, allergy, autoimmune disease, immunodeficiency, anorexia, cachexia, bone loss or bone frailty, and wound healing. Metabolic syndrome, metabolic syndrome X or simply Syndrome X refers to a cluster of risk factors that include obesity, dyslipidemia, particularly high blood triglycerides, glucose intolerance, high blood sugar and high blood pressure. In certain embodiments, short antisense compounds targeted to GCCR are used for amelioration of hyperglycemia induced by systemic steroid therapy. Moreover, antisense technology provides a means of inhibiting the expression of the glucocorticoid receptor isoform, demonstrated to be overexpressed in patients refractory to glucocorticoid treatment.
In certain embodiments, the invention provides short antisense compounds targeted to a nucleic acid encoding GCGR, and which modulate the expression of glucocorticoid receptor. Pharmaceutical and other compositions comprising the compounds of the invention are also provided. Further provided are methods of screening for modulators of glucocorticoid receptor and methods of modulating the expression of glucocorticoid receptor in cells, tissues or animals comprising contacting said cells, tissues or animals with one or more of the compounds or compositions of the invention.
Methods of treating an animal, particularly a human, suspected of having or being prone to a disease or condition associated with expression of glucocorticoid receptor are also set forth herein. Such methods comprise administering a therapeutically or prophylactically effective amount of one or more of the compounds or compositions of the invention to the person in need of treatment.
Certain Short Antisense Compounds Targeted to a GCCR nucleic acid In certain embodiments, short antisense compounds are targeted to a GCCR
nucleic acid having
-110-the sequence of nucleotides 1 to 106000 of GENBANK Accession No. AC012634, incorporated herein as SEQ ID NO: 8. In certain such embodiments, a short antisense compound targeted to SEQ ID NO: 8 is at least 90% complementary to SEQ ID NO: 8. In certain such embodiments, a short antisense compound targeted to SEQ ID NO: 8 is at least 95% complementary to SEQ ID NO: 8. In certain such embodiments, a short antisense compound targeted to SEQ ID NO: 8 is 100% complementary to SEQ ID NO: 8. In certain embodiments, a short antisense compound targeted to SEQ ID NO: 8 includes a nucleotide sequence selected from the nucleotide sequences set forth in Tables 10 and 11.
The nucleotide sequence set forth in each SEQ ID NO in Tables 10 and 11 is independent of any modification to a sugar moiety, an internucleoside linkage, or a nucleobase.
As such, short antisense compounds defined by a SEQ ID NO may comprise, independently, one or more modifications to a sugar moiety, an internucleoside linkage, or a nucleobase. Short antisense compounds described by Isis Number (Isis NO.) indicate a combination of nucleobase sequence and one or more modifications to a sugar moiety, an intemucleoside linkage, or a nucleobase.
In certain embodiments, short antisense compounds targeted to a GCCR nucleic acid comprise a gapmer motif. In certain embodiments, a short antisense compound targeted to a GCCR nucleic acid comprises a 2-10-2 gapmer motif.
Tables 10 and 11 illustrate examples of short antisense compounds targeted to SEQ ID NO: 8.
Table 10 illustrates short antisense compounds that are 100% complementary to SEQ ID NO: 8. Table 11 illustrates short antisense compounds that have one or two mismatches with respect to SEQ ID NO: 8.
The column labeled `gapmer motif indicates the wing-gap-wing motif of each short antisense compounds. The gap segment comprises 2'-deoxynucleotides and each nucleotide of each wing segment comprises a 2'-modified sugar. The particular 2'-modified sugar is also indicated in the `gapmer motif' column. For example, `2-10-2 MOE' means a 2-10-2 gapmer motif, where a gap segment of ten 2'-deoxynucleotides is flanked by wing segments of two nucleotides, where the nucleotides of the wing segments are 2'-MOE nucleotides. Internucleoside linkages are phosphorothioate. The short antisense compounds comprise 5-methylcytidine in place of unmodified cytosine, unless "unmodified cytosine" is listed in the gapmer motif column, in which case the indicated cytosines are unmodified cytosines. For example, "5-mC in gap only" indicates that the gap segment has 5-methylcytosines, while the wing segments have unmodified cytosines.
Table 10: Short Antisense Compounds targeted to SEQ ID NO: 8 5' 3' SEQ
ISIS Target Target ID
NO. Site Site Sequence (5'-3') Gapmer Motif NO
-111-Table 11: Short antisense compounds targeted to SEQ ID NO: 8 and having 1 or 2 mismatches 5' 3' SEQ
Target Target ID
ISIS NO Site Site Se uence 5'-3' Gapmer Motif NO
-112-In certain embodiments, a target region is nucleotides 88142-88269 of SEQ ID
NO: 8. In certain embodiments, a short antisense compound is targeted to nucleotides 88142-88269 of SEQ ID NO: 8. In certain such embodiments, a short antisense compound targeted to nucleotides 88142-88269 comprises a nucleotide sequence selected from SEQ ID NO 413, 414, 415, 416, 417, or 418.
In certain such embodiments, an antisense compound targeted to nucleotides 88142-88269 of SEQ
ID NO: 8 is selected from Isis NO. 371644, 371645, 371649, 371651, 371652, or 371653.
In certain embodiments, a target region is nucleotides 88142-88169 of SEQ ID
NO: 8. In certain embodiments, a short antisense compound is targeted to nucleotides 88142-88169 of SEQ ID NO: 8. In certain such embodiments, a short antisense compound targeted to nucleotides 88142-88169 comprises a nucleotide sequence selected from SEQ ID NO 413 or 414. In certain such embodiments, an antisense compound targeted to nucleotides 88142-88169 of SEQ ID NO: 8 is selected from Isis NO. 371644 or 371645.
In certain embodiments, a target region is nucleotides 88242-88269 of SEQ ID
NO: 8. In certain embodiments, a short antisense compound is targeted to nucleotides 88242-88269 of SEQ ID NO: 8. In certain such embodiments, a short antisense compound targeted to nucleotides 88242-88269 comprises a nucleotide sequence selected from SEQ ID NO 416, 417, or 418. In certain such embodiments, an antisense compound targeted to nucleotides 88242-88269 of SEQ ID NO: 8 is selected from Isis NO.
-113-371651, 371652, or 371653.
In certain embodiments, a target region is nucleotides 92037-92155 of SEQ ID
NO: 8. In certain embodiments, a short antisense compound is targeted to nucleotides 92037-92155 of SEQ ID NO: 8. In certain such embodiments, a short antisense compound targeted to nucleotides 92037-92155 comprises a nucleotide sequence selected from SEQ ID NO 419, 420, 421, or 422. In certain such embodiments, an antisense compound targeted to nucleotides 92037-92155 of SEQ ID NO: 8 is selected from Isis NO.
371665, 371669, 371671, or 171673.
In certain embodiments, a target region is nucleotides 92114-92155 of SEQ ID
NO: 8. In certain embodiments, a short antisense compound is targeted to nucleotides 92 1 1 4-92 1 55 of SEQ ID NO: 8. In certain such embodiments, a short antisense compound targeted to nucleotides 92114-92155 comprises a nucleotide sequence selected from SEQ ID NO 421 or 422. In certain such embodiments, an antisense compound targeted to nucleotides 92114-92155 of SEQ ID NO: 8 is selected from Isis NO. 371671 or 171673.
In certain embodiments, short antisense compounds targeted to a GCCR nucleic acid are 8 to 16, preferably 9 to 15, more preferably 9 to 14, more preferably 10 to 14 nucleotides in length. In certain embodiments, short antisense compounds targeted to a GCCR nucleic acid are 9 to 14 nucleotides in length. In certain embodiments, short antisense compounds targeted to a GCCR
nucleic acid are 10 to 14 nucleotides in length. In certain embodiments, such short antisense compounds are short antisense oligonucleotides.
In certain embodiments, short antisense compounds targeted to a GCCR nucleic acid are short gapmers. In certain such embodiments, short gapmers targeted to a GCCR nucleic acid comprise at least one high affinity modification in one or more wings of the compound. In certain embodiments, short antisense compounds targeted to a GCCR nucleic acid comprise 1 to 3 high-affinity modifications in each wing. In certain such embodiments, the nucleosides or nucleotides of the wing comprise a 2' modification. In certain such embodiments, the monomers of the wing are BNA's.
In certain such embodiments, the monomers of the wing are selected from a-L-Methyleneoxy (4'-CH2-O-2') BNA,(3-D-Methyleneoxy (4'-CHZ-O-2') BNA , Ethyleneoxy (4'-(CH2)2-0-2') BNA , Aminooxy (4'-CH2-O-N(R)-2') BNA and Oxyamino (4'-CH2-N(R)-O-2') BNA. In certain embodiments, the monomers of a wing comprise a substituent at the 2' position selected from allyl, amino, azido, thio, 0-allyl, O-Ci-Clo alkyl, -OCF3, O-(CH2)2-O-CH3, 2'-O(CHZ)ZSCH3, O-(CH2)2-O-N(R.)(Rn), and O-CH2-C(=O)-N(R.)(Rõ), where each R., and Rõ is, independently, H or substituted or unsubstituted Ci-Clo alkyl. In certain embodiments, the monomers of a wing are 2'MOE nucleotides.
In certain embodiments, short antisense compounds targeted to a GCCR nucleic acid comprise a gap between the 5' wing and the 3' wing. In certain embodiments the gap comprises five, six, seven, eight, nine, ten, eleven, twelve, thirteen, or fourteen monomers. In certain embodiments, the monomers of the gap are unmodified deoxyribonucleotides. In certain embodiments, the monomers of the gap are unmodified ribonucleotides. In certain embodiments, gap modifications (if any) gap result in an
-114-antisense compound that, when bound to its target nucleic acid, supports cleavage by an RNase, including, but not limited to, RNase H.
In certain embodiments, short antisense compounds targeted to a GCCR nucleic acid have uniform monomeric linkages. In certain such embodiments, those linkages are all phosphorothioate linkages. In certain embodiments, the linkages are all phosphodiester linkages. In certain embodiments, short antisense compounds targeted to a GCCR nucleic acid have mixed backbones.
In certain embodiments, short antisense compounds targeted to a GCCR nucleic acid are 8 monomers in length. In certain embodiments, short antisense compounds targeted to a GCCR nucleic acid are 9 monomers in length. In certain embodiments, short antisense compounds targeted to a GCCR
nucleic acid are 10 monomers in length. In certain embodiments, short antisense compounds targeted to a GCCR nucleic acid are 11 monomers in length. In certain embodiments, short antisense compounds targeted to a GCCR nucleic acid are monomers in length. In certain embodiments, short antisense compounds targeted to a GCCR nucleic acid are 13 monomers in length. In certain embodiments, short antisense compounds targeted to a GCCR nucleic acid are 14 monomers in length.
In certain embodiments, short antisense compounds targeted to a GCCR nucleic acid are 15 monomers in length. In certain embodiments, short antisense compounds targeted to a GCCR nucleic acid are 16 monomers in length. In certain embodiments, short antisense compounds targeted to a GCCR
nucleic acid comprise 9 to 15 monomers. In certain embodiments, short antisense compounds targeted to a GCCR nucleic acid comprise 10 to 15 monomers. In certain embodiments, short antisense compounds targeted to a GCCR
nucleic acid comprise 12 to 14 monomers. In certain embodiments, short antisense compounds targeted to a GCCR nucleic acid comprise 12 to 14 nucleotides or nucleosides.
In certain embodiments, the invention provides methods of modulating expression of GCCR. In certain embodiments, such methods comprise use of one or more short antisense compound targeted to a GCCR nucleic acid, wherein the short antisense compound targeted to a GCCR
nucleic acid is from about 8 to about 16, preferably 9 to 15, more preferably 9 to 14, more preferably 10 to 14 monomers (i.e. from about 8 to about 16 linked monomers). One of ordinary skill in the art will appreciate that this comprehends methods of modulating expression of GCCR using one or more short antisense compounds targeted to a GCCR nucleic acid of 8, 9, 10, 11, 12, 13, 14, 15 or 16 monomers.
In certain embodiments, methods of modulating GCCR comprise use of a short antisense compound targeted to a GCCR nucleic acid that is 8 monomers in length. In certain embodiments, methods of modulating GCCR comprise use of a short antisense compound targeted to a GCCR nucleic acid that is 9 monomers in length. In certain embodiments, methods of modulating GCCR comprise use of a short antisense compound targeted to a GCCR nucleic acid that is 10 monomers in length. In certain embodiments, methods of modulating GCCR comprise use of a short antisense compound targeted to a GCCR nucleic acid that is 11 monomers in length. In certain embodiments, methods of modulating GCCR comprise use of a short antisense compound targeted to a GCCR nucleic acid that is 12 monomers in length. In certain embodiments, methods of modulating GCCR comprise use of a short antisense
-115-compound targeted to a GCCR nucleic acid that is 13 monomers in length. In certain embodiments, methods of modulating GCCR comprise use of a short antisense compound targeted to a GCCR nucleic acid that is 14 monomers in length. In certain embodiments, methods of modulating GCCR comprise use of a short antisense compound targeted to a GCCR nucleic acid that is 15 monomers in length. In certain embodiments, methods of modulating GCCR comprise use of a short antisense compound targeted to a GCCR nucleic acid that is 16 monomers in length.
In certain embodiments, methods of modulating expression of GCCR comprise use of a short antisense compound targeted to a GCCR nucleic acid comprising 9 to 15 monomers. In certain embodiments, methods of modulating expression of GCCR comprise use of a short antisense compound targeted to a GCCR nucleic acid comprising 10 to 15 monomers. In certain embodiments, methods of modulating expression of GCCR comprise use of a short antisense compound targeted to a GCCR nucleic acid comprising 12 to 14 monomers. In certain embodiments, methods of modulating expression of GCCR comprise use of a short antisense compound targeted to a GCCR nucleic acid comprising 12 or 14 nucleotides or nucleosides.
7. Glucagon Receptor (GCGR) The maintenance of normal glycemia is a carefully regulated metabolic event.
Glucagon, the 29-amino acid peptide responsible for maintaining blood glucose levels in the postabsorbative state, increases glucose release from the liver by activating hepatic glycogenolysis, gluconeogenesis, stimulating lipolysis in adipose tissue, and stimulating insulin secretion.
During high blood glucose levels, insulin reverses the glucagon-mediated enhancement of glycogenolysis and gluconeogenesis. In patients with diabetes, insulin is either not available or not fully effective. While treatment for diabetes has traditionally focused on increasing insulin levels, antagonism of glucagon function has been considered as an alternative therapy. As glucagon exerts its physiological effects by signaling through the glucagon receptor, the glucagon receptor has been proposed as a potential therapeutic target for diabetes (Madsen et al., Curr. Pharm. Des., 1999, 5, 683-691).
Glucagon receptor is belongs to the superfamily of G-protein-coupled receptors having seven transmembrane domains. It is also a member of the smaller sub-family of homologous receptors which bind peptides that are structurally similar to glucagon. The gene encoding human glucagon receptor was cloned in 1994 and analysis of the genomic sequence revealed multiple introns and an 82% identity to the rat glucagon receptor gene (Lok et al., Gene, 1994, 140, 203-209.; MacNeil et al., Biochem. Biophys.
Res. Commun., 1994, 198, 328-334). Cloning of the rat glucagon receptor gene also led to the description of multiple alternative splice variants (Maget et al., FEBS Lett., 1994, 351, 271-275). The human glucagon receptor gene is localized to chromosome 17q25 (Menzel et al., Genomics, 1994, 20, 327-328). A missense mutation of Gly to Ser at codon 40 in the glucagon receptor gene leads to a 3-fold lower affinity for glucagon (Fujisawa et al., Diabetologia, 1995, 38, 983-985) and this mutation has been linked to several disease states, including non-insulin-dependent diabetes mellitus (Fujisawa et al.,
-116-Diabetologia, 1995, 38, 983-985), hypertension (Chambers and Morris, Nat.
Genet., 1996, 12, 122), and central adiposity (Siani et al., Obes. Res., 2001, 9, 722-726).

Definitions "Glucagon receptor" is the gene product or protein of which expression is to be modulated by administration of a short antisense compound. Glucagon receptor is generally referred to as GCGR but may also be referred to as GR, GGR, MGC138246, MGC93090.
"GCGR nucleic acid" means any nucleic acid encoding GCGR. For example, in certain embodiments, a GCGR nucleic acid includes, without limitation, a GCGR sequence encoding GCGR, an RNA sequence transcribed from DNA encoding GCGR, and an mRNA sequence encoding GCGR.
"GCGR mRNA" means an mRNA encoding a GCGR protein.

Therapeutic Indications Antisense technology is an effective means for reducing glucagon receptor (GCGR) expression and has proven to be uniquely useful in a number of therapeutic, diagnostic, and research applications.
As such, in certain embodiments, the present invention provides short antisense compounds targeted to a nucleic acid encoding glucagon receptor, and which modulate the expression of glucagon receptor.
Further provided herein are short antisense compounds capable of inhibiting GCGR expression. Also provided herein are methods of treating an individual comprising administering one or more pharmaceutical compositions comprising a short antisense compound targeted to a GCGR nucleic acid.
In certain embodiments, because short antisense compounds targeted to a GCGR
nucleic acid inhibit GCGR expression, provided herein are methods of treating a subject having a disease or condition associated with GCGR activity by administering one or more pharmaceutical compositions comprising a short antisense compound targeted to a GCGR nucleic acid. For example, provided herein are methods of treating a subject having high blood glucose, hyperglycemia, prediabetes, diabetes, Type 2 diabetes, metabolic syndrome, obesity and/or insulin resistance.
Also contemplated herein are pharmaceutical composition comprising one or more short antisense compounds targeted to GCGR and optionally a pharmaceutically acceptable carrier, diluent, enhancer or excipient. Certain compounds of the invention can also be used in the manufacture of a medicament for the treatment of diseases and disorders related to glucagon effects mediated by GCGR.
Certain embodiments of the present invention include methods of reducing the expression of GCGR in tissues or cells comprising contacting said cells or tissues with a short antisense compound targeted to a nucleic acid encoding GCGR or pharmaceutical composition comprising such a short antisense compound. In certain such embodiments, the invention provides methods of decreasing blood glucose levels, blood triglyceride levels, or blood cholesterol levels in a subject comprising administering to the subject a short antisense compound or a pharmaceutical composition.
Blood levels may be plasma levels or serum levels. Also contemplated are methods of improving insulin sensitivity, methods of
-117-increasing GLP-1 levels and methods of inhibiting hepatic glucose output in an animal comprising administering to said animal an antisense oligonucleotide or a pharmaceutical composition of the invention. An improvement in insulin sensitivity may be indicated by a reduction in circulating insulin levels.
In certain embodiments, the invention provides methods of treating a subject having a disease or condition associated with glucagon activity via GCGR comprising administering to the subject a therapeutically or prophylactically effective amount of a short antisense compound or a pharmaceutical composition. In certain embodiments, such disease or condition may be a metabolic disease or condition.
In certain embodiments, the metabolic disease or condition is diabetes, hyperglycemia, hyperlipidemia, metabolic syndrome X, obesity, primary hyperglucagonemia, insulin deficiency, or insulin resistance. In some embodiments, the diabetes is Type 2 diabetes. In some embodiments the obesity is diet-induced. In some embodiments, hyperlipidemia is associated with elevated blood lipid levels. Lipids include cholesterol and triglycerides. In one embodiment, the condition is liver steatosis. In some embodiments, the steatosis is steatohepatitis or non-alcoholic steatohepatitis.
In certain embodiments, the invention provides methods of preventing or delaying the onset of elevated blood glucose levels in an animal as well as methods of preserving beta-cell function in an animal using the oligomeric compounds delineated herein.
Certain short antisense compounds targeted to GCGR can be used to modulate the expression of GCGR in a subject in need thereof, such as an animal, including, but not limited to, a human In certain embodiments, such methods comprise the step of administering to said animal an effective amount of a short antisense compound that reduces expression of GCGR RNA. In certain embodiments, short antisense compounds effectively reduce the levels or function of GCGR RNA.
Because reduction in GCGR mRNA levels can lead to alteration in GCGR protein products of expression as well, such resultant alterations can also be measured. Certain antisense compounds that effectively reduce the levels or function of GCGR RNA or protein products of expression is considered an active antisense compound.
In certain embodiments, short antisense compounds reduce the expression of GCGR causing a reduction of RNA by at least 10%, by at least 20%, by at least 25%, by at least 30%, by at least 40%, by at least 50%, by at least 60%, by at least 70%, by at least 75%, by at least 80%, by at least 85%, by at least 90%, by at least 95%, by at least 98%, by at least 99%, or by 100%.
Further provided are methods of screening for modulators of glucagon receptor and methods of modulating the expression of glucagon receptor in cells, tissues or animals comprising contacting said cells, tissues or animals with one or more short antisense compounds targeted to GCGR or with compositions comprising such compounds. Methods of treating an animal, particularly a human, suspected of having or being prone to a disease or condition associated with expression of glucagon receptor are also set forth herein. Certain such methods comprise administering a therapeutically or prophylactically effective amount of one or more of the compounds or compositions of the invention to the person in need of treatment.
-118-The reduction of the expression of glucagon receptor may be measured, for example, in blood, plasma, serum, adipose tissue, liver or any other body fluid, tissue or organ of the animal. Preferably, the cells contained within said fluids, tissues or organs being analyzed contain a nucleic acid molecule encoding glucagon receptor protein and/or the glucagon receptor protein itself.
Pharmaceutical and other compositions comprising short antisense compounds are also provided.
In certain embodiments short antisense compounds targeted to a nucleic acid encoding GCGR are utilized in pharmaceutical compositions by adding an effective amount of a compound to a suitable pharmaceutically acceptable diluent or carrier.
The short antisense compounds targeting a GCGR nucleic acid may have any one or more properties or characteristics of the short antisense compounds generally described herein. In certain embodiments, short antisense compounds targeting a GCGR nucleic acid have a motif (wing - deoxy gap -wing) selected from 1-12-1, 1-1-10-2, 2-10-1-1, 3-10-3, 2-10-3, 2-10-2, 1-10-1,1-10-2, 3-8-3, 2-8-2, 1-8-1, 3-6-3 or 1-6-1. In certain embodiments, short antisense compounds targeting a GCGR nucleic acid have a motif (wing - deoxy gap -wing) selected from 1-12-1, 2-10-2, 3-10-3, 3-8-3, 1-1-10-2.
Certain Short Antisense Compounds Targeted to a GCGR nucleic acid In certain embodiments, short antisense compounds are targeted to a GCGR
nucleic acid having the sequence GENBANK Accession No. NM 000160.1, incorporated herein as SEQ ID
NO: 9. In certain such embodiments, a short antisense compound targeted to SEQ ID NO: 9 is at least 90%
complementary to SEQ ID NO: 9. In certain such embodiments, a short antisense compound targeted to SEQ ID NO: 9 is at least 95% complementary to SEQ ID NO: 9. In certain such embodiments, a short antisense compoundI targeted to SEQ ID NO: 9 is 100% complementary to SEQ ID
NO: 9. In certain embodiments, a short antisense compound targeted to SEQ ID NO: 9 includes a nucleotide sequence selected from the nucleotide sequences set forth in Tables 12 and 13.
The nucleotide sequences set forth in each SEQ ID NO in Tables 12 and 13 are independent of any modification to a sugar moiety, an internucleoside linkage, or a nucleobase. As such, short antisense compounds defined by a SEQ ID NO may comprise, independently, one or more modifications to a sugar moiety, an intemucleoside linkage, or a nucleobase. Short antisense compounds described by Isis Number (Isis NO.) indicate a combinatiori of nucleobase sequence and one or more modifications to a sugar moiety, an internucleoside linkage, or a nucleobase.
In certain embodiments, short antisense compounds targeted to a GCCR nucleic acid comprise a gapmer motif. In certain embodiments, a short antisense compound targeted to a GCCR nucleic acid comprises a 3-10-3 gapmer motif. In certain embodiments, short antisense compounds targeted to a GCCR nucleic acid comprise a gapmer motif. In certain embodiments, a short antisense compound targeted to a GCCR nucleic acid comprises a 3-8-3 gapmer motif. In certain embodiments, short antisense compounds targeted to a GCCR nucleic acid comprise a gapmer motif. In certain embodiments, a short antisense compound targeted to a GCCR nucleic acid comprises a 2-10-2 gapmer motif.
-119-Tables 12 and 13 illustrate examples of short antisense compounds targeted to SEQ ID NO: 9.
Table 12 illustrates short antisense compounds that are 100% complementary to SEQ ID NO: 9. Table 13 illustrates short antisense compounds that have one or two mismatches with respect to SEQ ID NO: 9.
The column labeled `gapmer motif indicates the wing-gap-wing motif of each short antisense compounds. The gap segment comprises 2'-deoxynucleotides and each nucleotide of each wing segment comprises a 2'-modified sugar. The particular 2'-modified sugar is also indicated in the `gapmer motif' column. For example, `2-10-2 MOE' means a 2-10-2 gapmer motif, where a gap segment of ten 2'-deoxynucleotides is flanked by wing segments of two nucleotides, where the nucleotides of the wing segments are 2'-MOE nucleotides. Internucleoside linkages are phosphorothioate. The short antisense compounds comprise 5-methylcytidine in place of unmodified cytosine, unless "unmodified cytosine" is listed in the gapmer motif column, in which case the indicated cytosines are unmodified cytosines. For -example, "5-mC in gap only" indicates that the gap segment has 5-methylcytosines, while the wing segments have unmodified cytosines.

Table 12: Short Antisense Compounds targeted to SEQ ID NO: 9 5' 3' SEQ
ISIS Target Target Gapmer ID
NO. Site Site Sequence (5'-3') Motif NO
-120-
-121-Table 13: Short antisense compounds targeted to SEQ ID NO: 1 and having 1 or 2 mismatches 5' 3' ISIS Target Target SEQ
NO. Site Site Sequence (5'-3') Ga mer Motif ID NO
-122-1-1-10-2 2'-(butylacetamido)-palmitaniide/OMe/
396149 1384 1397 GGGCATGCTCGTCA OMe 648 Methyleneoxy
-123-In certain embodiments, a target region is nucleotides 378-391 of SEQ ID NO:
9. In certain embodiments, a short antisense compound is targeted to nucleotides 378-391 of SEQ ID NO: 9. In certain such embodiments, a short antisense compound targeted to nucleotides 378-391 comprises a nucleotide sequence selected from SEQ ID NO 486 or 487. In certain such embodiments, a short antisense compound targeted to nucleotides 378-391 of SEQ ID NO: 9 is selected from Isis No 338463 or 338534.
In certain embodiments, a target region is nucleotides 499-521 of SEQ ID NO:
9. In certain embodiments, a short antisense compound is targeted to nucleotides 499-521 of SEQ ID NO: 9. In certain such embodiments, a short antisense compound targeted to nucleotides 499-521 comprises a nucleotide sequence selected from SEQ ID NO 488, 489, 490, 491, 492, 493, 494, 495, 496, or 497. In certain such embodiments, a short antisense compound targeted to nucleotides 499-521 of SEQ
ID NO: 9 is selected from Isis No 327130, 327131, 327132, 327133, 327134, 327135, 327136, 327137, 327138, or 327139.
In certain embodiments, a target region is nucleotides 531-553 of SEQ ID NO:
9. In certain embodiments, a short antisense compound is targeted to nucleotides 531-553 of SEQ ID NO: 9. In certain such embodiments, a short antisense compound targeted to nucleotides 531-553 comprises a nucleotide sequence selected from SEQ ID NO 498, 499, 500, 501, 502, 503, 504, 505, 506, or 507. In certain such embodiments, a short antisense compound targeted to nucleotides 531-553 of SEQ
ID NO: 9 is selected from Isis No 327140, 327141, 327142, 327143, 327144, 327145, 327146, 327147, 327148, or 327149.
In certain embodiments, a target region is nucleotides 545-567 of SEQ ID NO:
9. In certain embodiments, a short antisense compound is targeted to nucleotides 545-567 of SEQ ID NO: 9. In certain such embodiments, a short antisense compound targeted to nucleotides 545-567 comprises a nucleotide sequence selected from SEQ ID NO 508, 509, 510, 511, 512, 513, 514, 515, 516, or 517. In certain such embodiments, a short antisense compound targeted to nucleotides 545-567 of SEQ
ID NO: 9 is selected from Isis No 327150, 327151, 327152, 327153, 327154, 327155, 327156, 327157, 327158, or 327159.
In certain embodiments, a target region is nucleotides 531-567 of SEQ ID NO:
9. In certain
-124-embodiments, a short antisense compound is targeted to nucleotides 531-567 of SEQ ID NO: 9. In certain such embodiments, a short antisense compound targeted to nucleotides 531-567 comprises a nucleotide sequence selected from SEQ ID NO 498, 499, 500, 501, 502, 503, 504, 505, 506, 507, 508, 509, 510, 511, 512, 513, 514, 515, 516, or 517. In certain such embodiments, a short antisense compound targeted to nucleotides 531-567 of SEQ ID NO: 9 is selected from Isis No 327140, 327141, 327142, 327143, 327144, 327145, 327146, 327147, 327148, 327149, 327150, 327151, 327152, 327153, 327154, 327155, 327156, 327157, 327158, or 327159.
In certain embodiments, a target region is nucleotides 684-714 of SEQ ID NO:
9. In certain embodiments, a short antisense compound is targeted to nucleotides 684-714 of SEQ ID NO: 9. In certain such embodiments, a short antisense compound targeted to nucleotides 684-714 comprises a nucleotide sequence selected from SEQ ID NO 518, 520, 521, 522, 523, 524, 525, 526, 527, 528, 529, 530, 531, 532, 533, 534, 535, or 536. In certain such embodiments, a short antisense compound targeted to nucleotides 684-714 of SEQ ID NO: 9 is selected from Isis No 345897, 327160, 327161, 327162, 327163, 327164, 327165, 327166, 327167, 327168, 327169, 327170, 327171, 327172, 327173, 327174, 327175, 327176, or 327177.
In certain embodiments, a target region is nucleotides 869-891 of SEQ ID NO:
9. In certain embodiments, a short antisense compound is targeted to nucleotides 869-891 of SEQ ID NO: 9. In certain such embodiments, a short antisense compound targeted to nucleotides 869-891 comprises a nucleotide sequence selected from SEQ ID NO 537, 538, 539, 540, 541, 542, 543, 544, 545, or 546. In certain such embodiments, a short antisense compound targeted to nucleotides 869-891 of SEQ
ID NO: 9 is selected from Isis No 327178, 327179, 327180, 327181, 327182, 327183, 327184, 327185, 327186, or 327187.
In certain embodiments, a target region is nucleotides 955-977 of SEQ ID NO:
9. In certain embodiments, a short antisense compound is targeted to nucleotides 955-977 of SEQ ID NO: 9. In certain such embodiments, a short antisense compound targeted to nucleotides 955-977 comprises a nucleotide sequence selected from SEQ ID NO 547, 548, 549, 550, 551, 552, 553, 554, 555, or 556. In certain such embodiments, a short antisense compound targeted to nucleotides 955-977 of SEQ
ID NO: 9 is selected from Isis No 327188, 327189, 327190, 327191, 327192, 327193, 327194, 327195, 327196, or 327197.
In certain embodiments, a target region is nucleotides 1019-1041 of SEQ ID NO:
9. In certain embodiments, a short antisense compound is targeted to nucleotides 1019-1041 of SEQ ID NO: 9. In certain such embodiments, a short antisense compound targeted to nucleotides 1019-1041 comprises a nucleotide sequence selected from SEQ ID NO 557, 558, 559, 560, 561, 562, 563, 564, 565, or 566. In certain such embodiments, a short antisense compound targeted to nucleotides 1019-1041 of SEQ ID NO:
9 is selected from Isis No 327198, 327199, 327200, 327201, 327202, 327203, 327204, 327205, 327206, or 327207.
In certain embodiments, a target region is nucleotides 1160-1175 of SEQ ID NO:
9. In certain embodiments, a short antisense compound is targeted to nucleotides 1160-1175 of SEQ ID NO: 9. In certain such embodiments, a short antisense compound targeted to nucleotides 1160-1175 comprises a
-125-nucleotide sequence selected from SEQ ID NO 567 or 568. In certain such embodiments, a short antisense compound targeted to nucleotides 1160-1175 of SEQ ID NO: 9 is selected from Isis No 338491 or 338562.
In certain embodiments, a target region is nucleotides 1307-1377 of SEQ ID NO:
9. In certain embodiments, a short antisense compound is targeted to nucleotides 1307-1377 of SEQ ID NO: 9. In certain such embodiments, a short antisense compound targeted to nucleotides 1307-1377 comprises a nucleotide sequence selected from SEQ ID NO 569, 570, 571, 572, or 573. In certain such embodiments, a short antisense compound targeted to nucleotides 1307-1377 of SEQ ID NO: 9 is selected from Isis No 338498, 338569, 338499, 338570, or 385067.
In certain embodiments, a target region is nucleotides 1307-1414 of SEQ ID NO:
9. In certain embodiments, a short antisense compound is targeted to nucleotides 1307-1414 of SEQ ID NO: 9. In certain such embodiments, a short antisense compound targeted to nucleotides 1307-1414 comprises a nucleotide sequence selected from SEQ ID NO 569, 570, 571, 572, 573, or 574.
In certain such embodiments, a short antisense compound targeted to nucleotides 1307-1414 of SEQ ID NO: 9 is selected from Isis No 338498, 338569, 338499, 338570, 385067, or 338573.
In certain embodiments, short antisense compounds targeted to a GCGR nucleic acid are 8 to 16, preferably 9 to 15, more preferably 9 to 14, more preferably 10 to 14 nucleotides in length. In certain embodiments, short antisense compounds targeted to a GCGR nucleic acid are 9 to 14 nucleotides in length. In certain embodiments, short antisense compounds targeted to a GCGR
nucleic acid are 10 to 14 nucleotides in length. In certain embodiments, such short antisense compounds are short antisense oligonucleotides.
In certain embodiments, short antisense compounds targeted to a GCGR nucleic acid are short gapmers. In certain such embodiments, short gapmers targeted to a GCGR nucleic acid comprise at least one high affinity modification in one or more wings of the compound. In certain embodiments, short antisense compounds targeted to a GCGR nucleic acid comprise 1 to 3 high-affinity modifications in each wing. In certain such embodiments, the nucleosides or nucleotides of the wing comprise a 2' modification. In certain such embodiments, the monomers of the wing are BNA's.
In certain such embodiments, the monomers of the wing are selected from a-L-Methyleneoxy (4'-CH2-O-2') BNA,(3-D-Methyleneoxy (4'-CH2-O-2') BNA , Ethyleneoxy (4'-(CH2)2-0-2') BNA , Aminooxy (4'-CH2-O-N(R)-2') BNA and Oxyamino (4'-CHZ-N(R)-0-2') BNA. In certain embodiments, the monomers of a wing comprise a substituent at the 2' position selected from allyl, amino, azido, thio, O-allyl, O-CI-CIo alkyl, -OCF3, O-(CH2)2-O-CH3, 2'-O(CHZ)ZSCH3, O-(CH2)2-0-N(Rm)(Rõ), and O-CHZ-C(=O)-N(Rm)(Rõ), where each R. and Rn is, independently, H or substituted or unsubstituted Cl-Clo alkyl. In certain embodiments, the monomers of a wing are 2'MOE nucleotides.
In certain embodiments, short antisense compounds targeted to a GCGR nucleic acid comprise a gap between the 5' wing and the 3' wing. In certain embodiments the gap comprises five, six, seven, eight, nine, ten, eleven, twelve, thirteen, or fourteen monomers. In certain embodiments, the monomers
-126-of the gap are umnodified deoxyribonucleotides. In certain embodiments, the monomers of the gap are unmodified ribonucleotides. In certain embodiments, gap modifications (if any) gap result in an antisense compound that, when bound to its target nucleic acid, supports cleavage by an RNase, including, but not limited to, RNase H.
In certain embodiments, short antisense compounds targeted to a GCGR nucleic acid have uniform monomeric linkages. In certain such embodiments, those linkages are all phosphorothioate linkages. In certain embodiments, the linkages are all phosphodiester linkages. In certain embodiments, short antisense compounds targeted to a GCGR nucleic acid have mixed backbones.
In certain embodiments, short antisense compounds targeted to a GCGR nucleic acid are 8 monomers in length. In certain embodiments, short antisense compounds targeted to a GCGR nucleic acid are 9 monomers in length. In certain embodiments, short antisense compounds targeted to a GCGR
nucleic acid are 10 monomers in length. In certain embodiments, short antisense compounds targeted to a GCGR nucleic acid are 11 monomers in length. In certain embodiments, short antisense compounds targeted to a GCGR nucleic acid are monomers in length. In certain embodiments, short antisense compounds targeted to a GCGR nucleic acid are 13 monomers in length. In certain embodiments, short antisense compounds targeted to a GCGR nucleic acid are 14 monomers in length.
In certain embodiments, short antisense compounds targeted to a GCGR nucleic acid are 15 monomers in length. In certain embodiments, short antisense compounds targeted to a GCGR nucleic acid are 16 monomers in length. In certain embodiments, short antisense compounds targeted to a GCGR
nucleic acid comprise 9 to 15 monomers. In certain embodiments, short antisense compounds targeted to a GCGR nucleic acid comprise 10 to 15 monomers. In certain embodiments, short antisense compounds targeted to a GCGR
nucleic acid comprise 12 to 14 monomers. In certain embodiments, short antisense compounds targeted to a GCGR nucleic acid comprise 12 to 14 nucleotides or nucleosides.
In certain embodiments, the invention provides methods of modulating expression of GCGR. In certain embodiments, such methods comprise use of one or more short antisense compound targeted to a GCGR nucleic acid, wherein the short antisense compound targeted to a GCGR
nucleic acid is from about 8 to about 16, preferably 9 to 15, more preferably 9 to 14, more preferably 10 to 14 monomers (i.e. from about 8 to about 16 linked monomers). One of ordinary skill in the art will appreciate that this comprehends methods of modulating expression of GCGR using one or more short antisense compounds targeted to a GCGR nucleic acid of 8, 9, 10, 11, 12, 13, 14, 15 or 16 monomers.
In certain embodiments, methods of modulating GCGR comprise use of a short antisense compound targeted to a GCGR nucleic acid that is 8 monomers in length. In certain embodiments, methods of modulating GCGR comprise use of a short antisense compound targeted to a GCGR nucleic acid that is 9 monomers in length. In certain embodiments, methods of modulating GCGR comprise use of a short antisense compound targeted to a GCGR nucleic acid that is 10 monomers in length. In certain embodiments, methods of modulating GCGR comprise use of a short antisense compound targeted to a GCGR nucleic acid that is 11 monomers in length. In certain embodiments, methods of modulating
-127-GCGR comprise use of a short antisense compound targeted to a GCGR nucleic acid that is 12 monomers in length. In certain embodiments, methods of modulating GCGR comprise use of a short antisense compound targeted to a GCGR nucleic acid that is 13 monomers in length. In certain embodiments, methods of modulating GCGR comprise use of a short antisense compound targeted to a GCGR nucleic acid that is 14 monomers in length. In certain embodiments, methods of modulating GCGR comprise use of a short antisense compound targeted to a GCGR nucleic acid that is 15 monomers in length. In certain embodiments, methods of modulating GCGR comprise use of a short antisense compound targeted to a GCGR nucleic acid that is 16 monomers in length.
In certain embodiments, methods of modulating expression of GCGR comprise use of a short antisense compound targeted to a GCGR nucleic acid comprising 9 to 15 monomers. In certain embodiments, methods of modulating expression of GCGR comprise use of a short antisense compound targeted to a GCGR nucleic acid comprising 10 to 15 monomers. In certain embodiments, methods of modulating expression of GCGR comprise use of a short antisense compound targeted to a GCGR nucleic acid comprising 12 to 14 monomers. In certain embodiments, methods of modulating expression of GCGR comprise use of a short antisense compound targeted to a GCGR nucleic acid comprising 12 or 14 nucleotides or nucleosides.

8. DGAT2 Diacylglycerol transferase 2 (also known as DGAT2, diacylglycerol 0-transferase 2, acyl-CoA:diacylglycerol acyltransferase 2), Diacylglycerol transferase 2 has been shown to be implicated in the absorption process of triglycerides (also called triacylglycerols) from food.
The absorption of triglycerides from food is a very efficient process which occurs by a series of steps wherein the dietary triacylglycerols are hydrolyzed in the intestinal lumen and then resynthesized within enterocytes. The resynthesis of triacylglycerols can occur via the monoacylglycerol pathwaywhich commences with monoacylglycerol acyltransferase (MGAT) catalyzing the synthesis of diacylglycerol from monoacylglycerol and fatty acyl-CoA. An alternative synthesis of diacylglycerols is provided by the glycerol-phosphate pathway which describes the coupling of two molecules of fatty acyl-CoA to glycerol-3-phosphate. In either case, diacylglycerol is then acylated with another molecule of fatty acyl-CoA in a reaction catalyzed by one of two diacylglycerol acyltransferase enzymes to form the triglyceride (Farese et al., Curr. Opin. Lipidol., 2000, 11, 229-234).
The reaction catalyzed by diacylglycerol acyltransferase is the final and only committed step in triglyceride synthesis. As such, diacylglycerol acyltransferase is involved in intestinal fat absorption, lipoprotein assembly, regulating plasma triglyceride concentrations, and fat storage in adipocytes. The first diacylglycerol acyltransferase, diacylglycerol transferase 1, was identified in 1960 and the human and mouse genes encoding this protein were isolated in 1998 (Cases et al., Proc. Natl. Acad. Sci. U. S. A., 1998, 95, 13018-13023; Oelkers et al., J. Biol. Chem., 1998, 273, 26765-26771). Mice lacking diacylglycerol acyltransferase 1 are viable and can still synthesize triglycerides through other biological
-128-routes, suggesting the existence of multiple mechanisms- for triglyceride synthesis (Smith et al., Nat.
Genet., 2000, 25, 87-90).
A second diacylglycerol transferase, diacylglycerol transferase 2 (also known as DGAT2, diacylglycerol 0-transferase 2, acyl-CoA:diacylglycerol acyltransferase 2), was subsequently identified in the fungus Mortierella, humans and mice (Cases et al., J. Biol. Chem., 2001, 276, 38870-38876;
Lardizabal et al., J. Biol. Chem., 2001, 276, 38862-38869). Enzymatic assays indicate that this recently identified protein does possess diacylglycerol transferase activity that utilizes a broad range of long chain fatty acyl-CoA substrates (Cases et al., J. Biol. Chem., 2001, 276, 38870-38876).
Diacylglycerol transferase 2 is a member of a family of genes whose sequences are unrelated to diacylglycerol transferase 1. In addition to differing in sequence compared to diacylglycerol transferase 1, in vitro assays illustrate that diacylglycerol transferase 2 has higher activity at lower concentrations of magnesium chloride and oleoyl-CoA (Cases et al., J. Biol. Chem., 2001, 276, 38870-38876). The predicted protein sequence of diacylglycerol transferase 2 contains at least one putative transmembrane domain, three potential N-linked glycosylation sites, six potential protein kinase C phosphorylation consensus sites, as well as sequences in common with a putative glycerol phosphorylation site found in acyltransferase enzymes (Cases et al., J. Biol. Chem., 2001, 276, 38870-38876). The International Radiation Hybrid Mapping Consortium has mapped human diacylglycerol transferase 2 to chromosome 11q13.3.
In human tissues, the highest levels of diacylglycerol transferase 2 are detected in liver and white adipose tissues, with lower levels found in mammary gland, testis and peripheral blood leukocytes (Cases et al., J. Biol. Chem., 2001, 276, 38870-38876). Two mRNA species of 2.4 and 1.8 kilobases are detected in human tissues, whereas the major diacylglycerol transferase 2 mRNA species in mouse tissues is 2.4 kilobases. In addition to liver and white adipose tissues, diacylglycerol transferase 2 is expressed in all segments of the small intestine in mice, with higher expression in the proximal intestine and lower expression in the distal intestine (Cases et al., J. Biol. Chem., 2001, 276, 38870-38876).
Diacylglycerol transferase activity exhibits distinct patterns during postnatal development of the rat liver. As there is no correlation between the mRNA expression and activity patterns, post-translational modifications may participate in the regulation of diacylglycerol transferase 2 activity during rat development (Waterman et al., J. Lipid. Res., 2002, 43, 1555-1562).
Diacylglycerol transferase 2 mRNA is preferentially upregulated by insulin treatment, as shown by in vitro assays measuring the diacylglycerol activity from the membrane fraction of cultured mouse adipocytes (Meegalla et al., Biochem. Biophys. Res. Commun., 2002, 298, 317-323). In fasting mice, diacylglycerol transferase 2 expression is greatly reduced, and dramatically increases upon refeeding.
The expression patterns of two enzymes that participate in fatty acid synthesis, acetyl-CoA carboxylase and fatty acid synthase, respond to fasting and refeeding in a similar fashion. These results, combined with the observation that diacylglycerol transferase 2 is abundantly expressed in liver, suggest that diacylglycerol transferase 2 is tightly linked to the endogenous fatty acid synthesis pathway (Meegalla et
-129-al., Biochem. Biophys. Res. Commun., 2002, 298, 317-323).
Studies of mice harboring a disruption in the diacylglycerol acyltransferase 1 gene provide evidence that diacylglycerol acyltransferase 2 contributes to triglyceride synthesis. Levels of diacylglycerol transferase 2 mRNA expression are similar in intestinal segments from both wild type and diacylglycerol transferase 1-deficient mice (Buhman et al., J. Biol. Chem., 2002, 277, 25474-25479).
Using magnesium chloride to distinguish between diacylglycerol transferase 1 and 2 activity, Buhman, et al. observed that, in diacylglycerol transferase 1-deficient mice, diacylglycerol transferase activity is reduced to 50% in the proximal intestine and to 10-15% in the distal intestine (Buhman et al., J. Biol.
Chem., 2002, 277, 25474-25479).
Additionally, diacylglycerol transferase 2 mRNA levels are not up-regulated the liver or adipose tissues of diacylglycerol transferase 1-deficient mice, even after weeks of high-fat diet (Cases et al., J.
Biol. Chem., 2001, 276, 38870-38876; Chen et al., J. Clin. Invest., 2002, 109, 1049-1055). However, in ob/ob mice, which have a mutation in the leptin gene that results in obesity, diacylglycerol transferase 2 is more highly expressed than in wild type mice, suggesting that diacylglycerol transferase 2 may be partly responsible for the highly accumulated fat mass seen in these mice.
Furthermore, the combined mutations of leptin and diacylglycerol transferase 1 leads to a three-fold elevation in diacylglycerol transferase 2 expression in white adipose tissue, compared to the levels in the same tissue from diacylglycerol transferase 1-deficient mice (Chen et al., J. Clin. Invest., 2002, 109, 1049-1055). Diacylglycerol transferase 2 mRNA is also upregulated in the skin of these mice (Chen et al., J. Clin. Invest., 2002, 109, 175-181). These data suggest leptin normally downregulates diacylglycerol transferase 2 expression, and that the upregulation of diacylglycerol transferase 2 in white adipose tissue in these mice may provide an alternate pathway for the triglyceride synthesis that still occurs in leptin deficient/ diacylglycerol transferase 1-deficient mice (Chen et al., J. Clin. Invest., 2002, 109, 1049-1055).
Diacylglycerol acyltransferase 1 knockout mice exhibit interesting phenotypes in that they are lean, resistant to diet-induce obesity, have decreased levels of tissue triglycerides and increased sensitivity to insulin and leptin (Chen et al., J. Clin. Invest., 2002, 109, 1049-1055;
Smith et al., Nat. Genet., 2000, 25, 87-90). As diacylglycerol transferase 2 also participates in triglyceride synthesis, interfering with diacylglycerol transferase 2 may similarly lead to reduced body fat content.

Definitions "DGAT2" means the gene product or protein of which expression is to be modulated by administration of a short antisense compound.
"DGAT2 nucleic acid" means any nucleic acid encoding DGAT2. For example, in certain embodiments, a DGAT2 nucleic acid includes, without limitation, a DNA sequence encoding DGAT2, an RNA sequence transcribed from DNA encoding DGAT2, and an mRNA sequence encoding DGAT2.
"DGAT2 mRNA" means an mRNA encoding DGAT2.
-130-Therapeutic indications Antisense technology is an effective means for reducing DGAT2 expression and has proven to be uniquely useful in a number of therapeutic, diagnostic, and research applications. As such, in certain embodiments, the present invention provides compounds targeted to nucleic acid encoding DGAT2, which modulate the expression of DGAT2. Further provided herein are short antisense compounds capable of effectively inhibiting DGAT2 expression.
In certain embodiments, a subject, suspected of having a disease or associated with DGAT2 is treated by administering one or more short antisense compounds targeted to a nucleic acid encoding DGAT2. For example, in a non-limiting embodiment, such methods comprise the step of administering to an animal a therapeutically effective amount of a short antisense compound.
In certain such embodiments, short antisense compounds effectively inhibit the activity of DGAT2 or inhibit the expression of DGAT2. In one embodiment, the activity or expression of DGAT2 in a subject is inhibited by at least 10%, by at least 20%, by at least 25%, by at least 30%, by at least 40%, by at least 50%, by at least 60%, by at least 70%, by at least 75%, by at least 80%, by at least 85%, by at least 90%, by at least 95%, by at least 98%, by at least 99%, or by 100%. In certain embodiments, the activity or expression of DGAT2 in a subject is inhibited by about 30%. More preferably, the activity or expression of DGAT2 in a subject is inhibited by 50% or more.
The reduction of the expression of DGAT2 may be measured, for example, in blood, plasma, serum, adipose tissue, liver or any other body fluid, tissue or organ of the animal. Preferably, the cells contained within said fluids, tissues or organs being analyzed contain a nucleic acid molecule encoding DGAT2 and/or the DGAT2 protein itself.
In certain embodiments, pharmaceutical and other compositions comprising the compounds of the invention are also provided. For example, short antisense compounds targeted to a DGAT2 nucleic acid can be utilized in pharmaceutical compositions by adding an effective amount of a compound to a suitable pharmaceutically acceptable diluent or carrier.
Certain short antisense compounds targeting DGAT2 may have any one or more properties or characteristics of the short antisense compounds generally described herein.
In certain embodiments, short antisense compounds targeting a DGAT2 nucleic acid have a motif (wing -deoxy gap -wing) selected from 1-12-1, 1-1-10-2, 2-10-1-1, 3-10-3, 2-10-3, 2-10-2, 1-10-1,1-10-2, 3-8-3, 2-8-2, 1-8-1, 3-6-3 or 1-6-1. In certain embodiments, short antisense compounds targeting a DGAT2 nucleic acid have a motif (wing - deoxy gap -wing) selected from 1-10-1, 2-10-2 and 3-10-3.
Provided herein are methods of treating an individual by administering one or more short antisense compound targeted to a DGAT2 nucleic acid or a pharmaceutical composition comprising such compound. Further provided are methods of treating a subject having a disease or conditions associated with DGAT2 activity by administering a short antisense compound targeted to a DGAT2 nucleic acid.
Diseases and conditions associated with DGAT2 include, but are not limited to, cardiovascular disorders, obesity, diabetes, cholesterolemia, and liver steatosis.
-131-Certain Short Antisense Compounds Targeted to a DGAT2 Nucleic Acid In certain embodiments, short antisense compounds are targeted to a DGAT2 nucleic acid having the sequence of GENBANK Accession No. NM_032564.2, incorporated herein as SEQ ID NO:
10. In certain such embodiments, a short antisense compound targeted to SEQ ID
NO: 10 is at least 90%
complementary to SEQ ID NO: 10. In certain such embodiments, a short antisense compound targeted to SEQ ID NO: 10 is at least 95% complementary to SEQ ID NO: 10. In certain such embodiments, a short antisense compound targeted to SEQ ID NO: 10 is 100% complementary to SEQ ID
NO: 10. In certain embodiments, a short antisense compound targeted to SEQ ID NO: 10 includes a nucleotide sequence selected from the nucleotide sequences set forth in Tables 14 and 15.
Each nucleotide sequence set forth in each Tables 14 and 15 is independent of any modification to a sugar moiety, an intemucleoside linkage, or a nucleobase. As such, short antisense compounds comprising a nucleotide sequence as set forth in Tables 14 and 15 may comprise, independently, one or more modifications to a sugar moiety, an intemucleoside linkage, or a nucleobase. Antisense compounds described by Isis Number (Isis NO.) indicate a combination of nucleobase sequence and one or more modifications to a sugar moiety, an intemucleoside linkage, or a nucleobase.
Tables 14 and 15 illustrate examples of short antisense compounds targeted to SEQ ID NO: 10.
Table 14 illustrates short antisense compounds that are 100% complementary to SEQ ID NO: 10. Table 15 illustrates short antisense compounds that have one or two mismatches with respect to SEQ ID NO:
10. The column labeled `gapmer motif indicates the wing-gap-wing motif of each short antisense compounds. The gap segment comprises 2'-deoxynucleotides and each nucleotide of each wing segment comprises a 2'-modified sugar. The particular 2'-modified sugar is also indicated in the `gapmer motif column. For example, `2-10-2 MOE' means a 2-10-2 gapmer motif, where a gap segment of ten 2'-deoxynucleotides is flanked by wing segments of two nucleotides, where the nucleotides of the wing segments are 2'-MOE nucleotides. Internucleoside linkages are phosphorothioate. The short antisense compounds comprise 5-methylcytidine in place of unmodified cytosine, unless "unmodified cytosine" is listed in the gapmer motif colunm, in which case the indicated cytosines are unmodified cytosines. For example, "5-mC in gap only" indicates that the gap segment has 5-methylcytosines, while the wing segments have unmodified cytosines.

Table 14: Short Antisense Compounds targeted to SEQ ID NO: 10 5' 3' Target Target Gapmer SEQ
ISIS NO. Site Site Se uence 5'-3') Motif ID NO
-132-
-133-Table 15: Short antisense compounds targeted to SEQ ID NO: 10 and having 1 or 2 mismatches 5' 3' Target Target Gapmer SEQ
ISIS NO Site Site Se uence (5'-3') Motif ID NO
-134-In certain embodiments, a target region is nucleotides 231-267 of SEQ ID NO:
10. In certain embodiments, a short antisense compound is targeted to nucleotides 231-267 of SEQ ID NO: 10. In
-135-certain such embodiments, a short antisense compound targeted to nucleotides 231-267 comprises a nucleotide sequence selected from SEQ ID NO 681, 682, 683, 684, 685, 686, or 687. In certain such embodiments, a short antisense compound targeted to nucleotides 231-267 of SEQ
ID NO: 10 is selected from Isis No 372556, 372557, 382601, 372480, 372481, 372558, or 372559.
In certain embodiments, a target region is nucleotides 249-267 of SEQ ID NO:
10. In certain embodiments, a short antisense compound is targeted to nucleotides 249-267 of SEQ ID NO: 10. In certain such embodiments, a short antisense compound targeted to nucleotides 249-267 comprises a nucleotide sequence selected from SEQ ID NO 683, 684, 685, 686, or 687. In certain such embodiments, a short antisense compound targeted to nucleotides 249-267 of SEQ ID NO: 10 is selected from Isis No 382601, 372480, 372481, 372558, or 372559.
In certain embodiments, a target region is nucleotides 331-493 of SEQ ID NO:
10. In certain embodiments, a short antisense compound is targeted to nucleotides 331-493 of SEQ ID NO: 10. In certain such embodiments, a short antisense compound targeted to nucleotides 331-493 comprises a nucleotide sequence selected from SEQ ID NO 688, 689, 690, 691, 692, 693, or 694. In certain such embodiments, a short antisense compound targeted to nucleotides 331-493 of SEQ
ID NO: 10 is selected from Isis No 382603, 382604, 372485, 372563, 382605, 372565, or 382606.
In certain embodiments, a target region is nucleotides 331-427 of SEQ ID NO:
10. In certain embodiments, a short antisense compound is targeted to nucleotides 331-427 of SEQ ID NO: 10. In certain such embodiments, a short antisense compound targeted to nucleotides 331-427 comprises a nucleotide sequence selected from SEQ ID NO 688, 689, 690, 691, 692, or 693.
In certain such embodiments, a short antisense compound targeted to nucleotides 331-427 of SEQ
ID NO: 10 is selected from Isis No 382603, 382604, 372485, 372563, 382605, or 372565.
In certain embodiments, a target region is nucleotides 392-408 of SEQ ID NO:
10. In certain embodiments, a short antisense compound is targeted to nucleotides 392-408 of SEQ ID NO: 10. In certain such embodiments, a short antisense compound targeted to nucleotides 392-408 comprises a nucleotide sequence selected from SEQ ID NO 690, 691, or 692. In certain such embodiments, a short antisense compound targeted to nucleotides 392-408 of SEQ ID NO: 10 is selected from Isis No 372485, 372563, or 382605.
In certain embodiments, a target region is nucleotides 651-707 of SEQ ID NO:
10. In certain embodiments, a short antisense compound is targeted to nucleotides 651-707 of SEQ ID NO: 10. In certain such embodiments, a short antisense compound targeted to nucleotides 651-707 comprises a nucleotide sequence selected from SEQ ID NO 695, 696, 697, 698, 699, 700, 701, 702, 703, 704, 705, 706, 707, 708, 709, 710, 711, 712, 713, 714, 715, 716, 717, 718, 719, 720, 721, 722, 723, 724, 725, 726, 727, or 728. In certain such embodiments, a short antisense compound targeted to nucleotides 651-707 of SEQ ID NO: 10 is selected from Isis No 372497, 372498, 372575, 372576, 382607, 372499, 372577, 372500, 372578, 372501, 372579, 372502, 372580, 372503, 372581, 372504, 372582, 372505, 372506, 372583, 372584, 372507, 372585, 382608, 372508, 372586, 372509, 372587, 372510, 372588, 372511,
-136-372512, 372589, or 372590.
In certain embodiments, a target region is nucleotides 724-745 of SEQ ID NO:
10. In certain embodiments, a short antisense compound is targeted to nucleotides 724-745 of SEQ ID NO: 10. In certain such embodiments, a short antisense compound targeted to nucleotides 724-745 comprises a nucleotide sequence selected from SEQ ID NO 729, 730, 731, 732, or 733. In certain such embodiments, a short antisense compound targeted to nucleotides 724-745 of SEQ ID NO: 10 is selected from Isis No 382609, 372514, 372592, 372515, or 372593.
In certain embodiments, a target region is nucleotides 651-745 of SEQ ID NO:
10. In certain embodiments, a short antisense compound is targeted to nucleotides 651-745 of SEQ ID NO: 10. In certain such embodiments, a short antisense compound targeted to nucleotides 651-745 comprises a nucleotide sequence selected from SEQ ID NO 695, 696, 697, 698, 699, 700, 701, 702, 703, 704, 705, 706, 707, 708, 709, 710, 711, 712, 713, 714, 715, 716, 717, 718, 719, 720, 721, 722, 723, 724, 725, 726, 727, 728, 729, 730, 731, 732, or 733. In certain such embodiments, a short antisense compound targeted to nucleotides 651-745 of SEQ ID NO: 10 is selected from Isis No 372497, 372498, 372575, 372576, 382607, 372499, 372577, 372500, 372578, 372501, 372579, 372502, 372580, 372503, 372581, 372504, 372582, 372505, 372506, 372583, 372584, 372507, 372585, 382608, 372508, 372586, 372509, 372587, 372510, 372588, 372511, 372512, 372589, 372590, 382609, 372514, 372592, 372515, or 372593.
In certain embodiments, a target region is nucleotides 851-922 of SEQ ID NO:
10. In certain embodiments, a short antisense compound is targeted to nucleotides 851-922 of SEQ ID NO: 10. In certain such embodiments, a short antisense compound targeted to nucleotides 851-922 comprises a nucleotide sequence selected from SEQ ID NO 734, 735, 736, or 737. In certain such embodiments, a short antisense compound targeted to nucleotides 851-922 of SEQ ID NO: 10 is selected from Isis No 382610, 382611, 382602, or 382612.
In certain embodiments, a target region is nucleotides 851-879 of SEQ ID NO:
10. In certain embodiments, a short antisense compound is targeted to nucleotides 851-879 of SEQ ID NO: 10. In certain such embodiments, a short antisense compound targeted to nucleotides 851-879 comprises a nucleotide sequence selected from SEQ ID NO 734, 735, or 736. In certain such embodiments, a short antisense compound targeted to nucleotides 851-879 of SEQ ID NO: 10 is selected from Isis No 382610, 382611, or 382602.
In certain embodiments, a target region is nucleotides 965-1007 of SEQ ID NO:
10. In certain embodiments, a short antisense compound is targeted to nucleotides 965-1007 of SEQ ID NO: 10. In certain such embodiments, a short antisense compound targeted to nucleotides 965-1007 comprises a nucleotide sequence selected from SEQ ID NO 738, 739, 740, 741, 742, 743, 744, or 745. In certain such embodiments, a short antisense compound targeted to nucleotides 965-1007 of SEQ ID NO: 10 is selected from Isis No 372524, 372602, 382613, 382614, 372525, 372603, 372526, or 372604.
In certain embodiments, a target region is nucleotides 965-979 of SEQ ID NO:
10. In certain embodiments, a short antisense compound is targeted to nucleotides 965-979 of SEQ ID NO: 10. In
-137-certain such embodiments, a short antisense compound targeted to nucleotides 965-979 comprises a nucleotide sequence selected from SEQ ID NO 738, 739, or 740. In certain such embodiments, a short antisense compound targeted to nucleotides 965-979 of SEQ ID NO: 10 is selected from Isis No 372524, 372602,or382613.
In certain embodiments, a target region is nucleotides 987-1007 of SEQ ID NO:
10. In certain embodiments, a short antisense compound is targeted to nucleotides 987-1007 of SEQ ID NO: 10. In certain such embodiments, a short antisense compound targeted to nucleotides 987-1007 comprises a nucleotide sequence selected from SEQ ID NO 741, 742, 743, 744, or 745. In certain such embodiments, a short antisense compound targeted to nucleotides 987-1007 of SEQ ID NO: 10 is selected from Isis No 382614, 372525, 372603, 372526, or 372604.
In certain embodiments, a target region is nucleotides 1106-1132 of SEQ ID NO:
10. In certain embodiments, a short antisense compound is targeted to nucleotides 1106-1132 of SEQ ID NO: 10. In certain such embodiments, a short antisense compound targeted to nucleotides 1106-1132 comprises a nucleotide sequence selected from SEQ ID NO 746, 747, 748, 749, 750, 751, 752, 753, or 754. In certain such embodiments, a short antisense compound targeted to nucleotides 1106-1132 of SEQ ID NO: 10 is selected from Isis No 372530, 372608, 372531, 372609, 372532, 372610, 372533, 382615, or 372611.
In certain embodiments, a target region is nucleotides 1199-1233 of SEQ ID NO:
10. In certain embodiments, a short antisense compound is targeted to nucleotides 1199-1233 of SEQ ID NO: 10. In certain such embodiments, a short antisense compound targeted to nucleotides 1199-1233 comprises a nucleotide sequence selected from SEQ ID NO 755, 756, 757, 758, 759, 760, 761, 762, or 763. In certain such embodiments, a short antisense compound targeted to nucleotides 1199-1233 of SEQ ID NO: 10 is selected from Isis No 372536, 372614, 372537, 372615, 372538, 372616, 382616, 372539, or 372617.
In certain embodiments, a target region is nucleotides 1293-1394 of SEQ ID NO:
10. In certain embodiments, a short antisense compound is targeted to nucleotides 1293-1394 of SEQ ID NO: 10. In certain such embodiments, a short antisense compound targeted to nucleotides 1293-1394 comprises a nucleotide sequence selected from SEQ ID NO 764, 765, 766, 767, 768, 769, 770, 771, 772, 773, 774, 775, 776, or 777. In certain such embodiments, a short antisense compound targeted to nucleotides 1293-1394 of SEQ ID NO: 10 is selected from Isis No 372540, 372618, 382617, 372541, 372619, 372542, 372620, 372543, 372621, 372544, 372622, 382618, 382619, or 382620.
In certain embodiments, a target region is nucleotides 1293-1336 of SEQ ID NO:
10. In certain embodiments, a short antisense compound is targeted to nucleotides 1293-1336 of SEQ ID NO: 10. In certain such embodiments, a short antisense compound targeted to nucleotides 1293-1336 comprises a nucleotide sequence selected from SEQ ID NO 764, 765, 766, 767, 768, 769, 770, 771, 772, 773, 774, 775, or 776. In certain such embodiments, a short antisense compound targeted to nucleotides 1293-1336 of SEQ ID NO: 10 is selected from Isis No 372540, 372618, 382617, 372541, 372619, 372542, 372620, 372543, 372621, 372544, 372622, 382618, or 382619.
In certain embodiments, a target region is nucleotides 1293-1324 of SEQ ID NO:
10. In certain
-138-embodiments, a short antisense compound is targeted to nucleotides 1293-1324 of SEQ ID NO: 10. In certain such embodiments, a short antisense compound targeted to nucleotides 1293-1324 comprises a nucleotide sequence selected from SEQ ID NO 764, 765, 766, 767, 768, 769, 770, 771, 772, 773, 774, or 775. In certain such embodiments, a short antisense compound targeted to nucleotides 1293-1324 of SEQ
ID NO: 10 is selected from Isis No 372540, 372618, 382617, 372541, 372619, 372542, 372620, 372543, 372621, 372544, 372622, or 382618.
In certain embodiments, short antisense compounds targeted to a DGAT2 nucleic acid are 8 to 16, preferably 9 to 15, more preferably 9 to 14, more preferably 10 to 14 nucleotides in length. In certain embodiments, short antisense compounds targeted to a DGAT2 nucleic acid are 9 to 14 nucleotides in length. In certain embodiments, short antisense compounds targeted to a DGAT2 nucleic acid are 10 to 14 nucleotides in length. In certain embodiments, such short antisense compounds are short antisense oligonucleotides.
In certain embodiments, short antisense compounds targeted to a DGAT2 nucleic acid are short gapmers. In certain such embodiments, short gapmers targeted to a DGAT2 nucleic acid comprise at least one high affinity modification in one or more wings of the compound. In certain embodiments, short antisense compounds targeted to a DGAT2 nucleic acid comprise 1 to 3 high-affmity modifications in each wing. In certain such embodiments, the nucleosides or nucleotides of the wing comprise a 2' modification. In certain such embodiments, the monomers of the wing are BNA's.
In certain such embodiments, the monomers of the wing are selected from a-L-Methyleneoxy (4'-CH2-O-2') BNA ,(3-D-Methyleneoxy (4'-CH2-O-2') BNA , Ethyleneoxy (4'-(CH2)2-0-2') BNA , Aminooxy (4'-CH2-O-N(R)-2') BNA and Oxyamino (4'-CHZ-N(R)-0-2') BNA. In certain embodiments, the monomers of a wing comprise a substituent at the 2' position selected from allyl, amino, azido, thio, 0-allyl, O-Ci-Cio alkyl, -OCF3, O-(CH2)2-O-CH3, 2'-O(CH2)2SCH3, O-(CHZ)Z-O-N(R,,,)(Rõ), and O-CHZ-C(=O)-N(Rm)(Rõ), where each R,,, and Rn is, independently, H or substituted or unsubstituted Cl-Clo alkyl. In certain embodiments, the monomers of a wing are 2'MOE nucleotides.
In certain embodiments, short antisense compounds targeted to a DGAT2 nucleic acid comprise a gap between the 5' wing and the 3' wing. In certain embodiments the gap comprises five, six, seven, eight, nine, ten, eleven, twelve, thirteen, or fourteen monomers. In certain embodiments, the monomers of the gap are unmodified deoxyribonucleotides. In certain embodiments, the monomers of the gap are unmodified ribonucleotides. In certain embodiments, gap modifications (if any) gap result in a short antisense compound that, when bound to its target nucleic acid, supports cleavage by an RNase, including, but not limited to, RNase H.
In certain embodiments, short antisense compounds targeted to a DGAT2 nucleic acid have uniform monomeric linkages. In certain such embodiments, those linkages are all phosphorothioate linkages. In certain embodiments, the linkages are all phosphodiester linkages. In certain embodiments, short antisense compounds targeted to a DGAT2 nucleic acid have mixed backbones.
In certain embodiments, short antisense compounds targeted to a DGAT2 nucleic acid are 8
-139-monomers in length. In certain embodiments, short antisense compounds targeted to a DGAT2 nucleic acid are 9 monomers in length. In certain embodiments, short antisense compounds targeted to a DGAT2 nucleic acid are 10 monomers in length. In certain embodiments, short antisense compounds targeted to a DGAT2 nucleic acid are 11 monomers in length. In certain embodiments, short antisense compounds targeted to a DGAT2 nucleic acid are monomers in length. In certain embodiments, short antisense compounds targeted to a DGAT2 nucleic acid are 13 monomers in length. In certain embodiments, short antisense compounds targeted to a DGAT2 nucleic acid are 14 monomers in length. In certain embodiments, short antisense compounds targeted to a DGAT2 nucleic acid are 15 monomers in length.
In certain embodiments, short antisense compounds targeted to a DGAT2 nucleic acid are 16 monomers in length. In certain embodiments, short antisense compounds targeted to a DGAT2 nucleic acid comprise 9 to 15 monomers. In certain embodiments, short antisense compounds targeted to a DGAT2 nucleic acid comprise 10 to 15 monomers. In certain embodiments, short antisense compounds targeted to a DGAT2 nucleic acid comprise 12 to 14 monomers. In certain embodiments, short antisense compounds targeted to a DGAT2 nucleic acid comprise 12 to 14 nucleotides or nucleosides.
In certain embodiments, the invention provides methods of modulating expression of DGAT2. In certain embodiments, such methods comprise use of one or more short antisense compound targeted to a DGAT2 nucleic acid, wherein the short antisense compound targeted to a DGAT2 nucleic acid is from about 8 to about 16, preferably 9 to 15, more preferably 9 to 14, more preferably 10 to 14 monomers (i.e.
from about 8 to about 16 linked monomers). One of ordinary skill in the art will appreciate that this comprehends methods of modulating expression of DGAT2 using one or more short antisense compounds targeted to a DGAT2 nucleic acid of 8, 9, 10, 11, 12, 13, 14, 15 or 16 monomers.
In certain embodiments, methods of modulating DGAT2 comprise use of a short antisense compound targeted to a DGAT2 nucleic acid that is 8 monomers in length. In certain embodiments, methods of modulating DGAT2 comprise use of a short antisense compound targeted to a DGAT2 nucleic acid that is 9 monomers in length. In certain embodiments, methods of modulating DGAT2 comprise use of a short antisense compound targeted to a DGAT2 nucleic acid that is 10 monomers in length. In certain embodiments, methods of modulating DGAT2 comprise use of a short antisense compound targeted to a DGAT2 nucleic acid that is 11 monomers in length. In certain embodiments, methods of modulating DGAT2 comprise use of a short antisense compound targeted to a DGAT2 nucleic acid that is 12 monomers in length. In certain embodiments, methods of modulating DGAT2 comprise use of a short antisense compound targeted to a DGAT2 nucleic acid that is 13 monomers in length. In certain embodiments, methods of modulating DGAT2 comprise use of a short antisense compound targeted to a DGAT2 nucleic acid that is 14 monomers in length. In certain embodiments, methods of modulating DGAT2 comprise use of a short antisense compound targeted to a DGAT2 nucleic acid that is 15 monomers in length. In certain embodiments, methods of modulating DGAT2 comprise use of a short antisense compound targeted to a DGAT2 nucleic acid that is 16 monomers in length.
-140-In certain embodiments, methods of modulating expression of DGAT2 comprise use of a short antisense compound targeted to a DGAT2 nucleic acid comprising 9 to 15 monomers. In certain embodiments, methods of modulating expression of DGAT2 comprise use of a short antisense compound targeted to a DGAT2 nucleic acid comprising 10 to 15 monomers. In certain embodiments, methods of modulating expression of DGAT2 comprise use of a short antisense compound targeted to a DGAT2 nucleic acid comprising 12 to 14 monomers. In certain embodiments, methods of modulating expression of DGAT2 comprise use of a short antisense compound targeted to a DGAT2 nucleic acid comprising 12 or 14 nucleotides or nucleosides.

9. PTP1B
PTP 1 B(also known as protein phosphatase 1 B and PTPN 1) is an endoplasmic reticulum (ER)-associated enzyme originally isolated as the major protein tyrosine phosphatase of the human placenta (Tonks et al., J. Biol. Chem., 1988, 263, 6731-6737; Tonks et al., J. Biol.
Chem., 1988, 263, 6722-6730).
An essential regulatory role in signaling mediated by the insulin receptor has been established for PTP1B. In certain instances, PTP1B interacts with and dephosphorylates the activated insulin receptor both in vitro and in intact cells resulting in the downregulation of the signaling pathway (Goldstein et al., Mol. Cell. Biochem., 1998, 182, 91-99; Seely et al., Diabetes, 1996, 45, 1379-1385). In addition, PTP1B
modulates the mitogenic actions of insulin (Goldstein et al., Mol. Cell.
Biochem., 1998, 182, 91-99). In rat adipose cells overexpressing PTPIB, the translocation of the GLUT4 glucose transporter was inhibited, implicating PTP1B as a negative regulator of glucose transport as well (Chen et al., J. Biol. Chem., 1997, 272, 8026-8031).
Mouse knockout models lacking the PTP1B gene also point toward the negative regulation of insulin signaling by PTP1B. Mice harboring a disrupted PTP1B gene showed increased insulin sensitivity and increased phosphorylation of the insulin receptor. When placed on a high-fat diet, PTP1B
-/- mice were resistant to weight gain and remained insulin sensitive (Elchebly et al., Science, 1999, 283, 1544-1548). These studies clearly establish PTP1B as a therapeutic target in the treatment of diabetes and obesity.
Diabetes and obesity (sometimes now collectively referred to as "diabesity") are interrelated.
Most human obesity is associated with insulin resistance and leptin resistance. In fact obesity may have an even greater impact on insulin action than does diabetes itself (Sindelka et al., Physiol Res., 2002, 51, 85-91). Syndrome X or metabolic syndrome is a new term for a cluster of conditions, that, when occurring together, may indicate a predisposition to diabetes and cardiovascular disease. These symptoms, including high blood pressure, high triglycerides, decreased HDL and obesity, tend to appear together in some individuals. Because of its role in both diabetes and obesity, PTP1B is believed to be a therapeutic target for a range of metabolic conditions, including diabetes, obesity and metabolic syndrome. By improving blood glucose control, inhibitors of PTP1B may also be useful in slowing, preventing, delaying or ameliorating the sequelae of diabetes, which include retinopathy, neuropathy,
-141-cardiovascular complications and nephropathy.
PTP1B, which is differentially regulated during the cell cycle (Schievella et al., Cell. Growth Differ., 1993, 4, 239-246), is expressed in insulin sensitive tissues as two different isofonns that arise from alternate splicing of the pre-mRNA (Shifrin and Neel, J. Biol. Chem., 1993, 268, 25376-25384).
The ratio of the alternatively spliced products is affected by growth factors, such as insulin, and differs in various tissues examined (Sell and Reese, Mol. Genet. Metab., 1999, 66, 189-192). In these studies the levels of the variants correlated with the plasma insulin concentration and percentage body fat. These variants may therefore be used as a biomarker for patients with chronic hyperinsulinemia or type 2 diabetes.
Definitions "Protein tyrosine phosphatase IB" is the gene product or protein of which expression is to be modulated by administration of a short antisense compound. Protein tyrosine phosphatase 1B is generally referred to as PTP 1 B but may also be referred to as protein tyrosine phosphatase; PTPN 1; RKPTP;
protein tyrosine phosphatase, non-receptor type 1.
"PTP1B nucleic acid" means any nucleic acid encoding PTP1B. For example, in certain embodiments, a PTP 1 B nucleic acid includes, without limitation, a DNA
sequence encoding PTP 1 B, an RNA sequence transcribed from DNA encoding PTP1B, and an mRNA sequence encoding PTP1B.
"PTP 1 B mRNA" means an mRNA encoding a PTP 1 B protein.
Therapeutic indications Antisense technology is an effective means for reducing PTP1B expression and has proven to be uniquely useful in a number of therapeutic, diagnostic, and research applications. As such, in certain embodiments, the present invention provides compounds targeted to a nucleic acid encoding PTP1B, which modulate the expression of PTP1B. Further provided herein are short antisense compounds capable of effectively inhibiting PTP1B expression.
In certain therapeutics, a subject, suspected of having a disease or disorder which can be treated by modulating the expression of PTP1B is treated by administering one or more short antisense compounds targeted to a nucleic acid encoding PTP1B. For example, in one non-limiting embodiment, the methods comprise the step of administering to an animal a therapeutically effective amount of a short antisense compound. The short antisense compounds of the present invention effectively inhibit the activity of PTP 1 B or inhibit the expression of PTP 1 B. In one embodiment, the activity or expression of PTP1B in a subject is inhibited by at least 10%, by at least 20%, by at least 25%, by at least 30%, by at least 40%, by at least 50%, by at least 60%, by at least 70%, by at least 75%, by at least 80%, by at least 85%, by at least 90%, by at least 95%, by at least 98%, by at least 99%, or by 100%. In certain embodiments, activity or expression of PTP1B in a subject is inhibited by about 30%. In certain embodiments, the activity or expression of PTP1B in a subject is inhibited by 50% or more.
-142-The reduction of the expression of PTP1B may be measured, for example, in blood, plasma, serum, adipose tissue, liver or any other body fluid, tissue or organ of the animal. Preferably, the cells contained within said fluids, tissues or organs being analyzed contain a nucleic acid molecule encoding PTP 1 B and/or the PTP I B protein itself.
Certain pharmaceutical and other compositions comprising the compounds of the invention are also provided. In certain embodiments short antisense compounds targeted to a PTP1B nucleic acid are utilized in pharmaceutical compositions by adding an effective amount of a compound to a suitable pharmaceutically acceptable diluent or carrier.
The short antisense compounds targeting PTP1B may have any one or more properties or characteristics of the short antisense compounds generally described herein.
In certain embodiments, short antisense compounds targeting a PTP1B nucleic acid have a motif (wing -deoxy gap -wing) selected from 1-12-1, 1-1-10-2, 2-10-1-1, 3-10-3, 2-10-3, 2-10-2, 1-10-1,1-10-2, 3-8-3, 2-8-2, 1-8-1, 3-6-3 or 1-6-1, more preferably 1-10-1, 2-10-2, 3-10-3, and 1-9-2.
In certain embodiments provided herein are methods of treating an individual by administering one or more short antisense compound targeted to a PTP 1 B nucleic acid or a pharmaceutical composition comprising such compound. Further provided are methods of treating a subject having a disease or conditions associated with PTP1B activity by administering a short antisense compound targeted to a PTP1B nucleic acid. Diseases and conditions associated with PTP1B include but are not limited to high blood glucose or hyperglycemia, prediabetes, diabetes, Type 2 diabetes, metabolic syndrome, obesity and insulin resistance. Therefore, provided herein are methods of treating to high blood glucose or hyperglycemia, prediabetes, diabetes, Type 2 diabetes, metabolic syndrome, obesity and insulin resistance by administering a short antisense compound targeted to a PTP1B nucleic acid.
In certain embodiments the present invention provides compositions and methods for decreasing blood glucose levels in a subject or for preventing or delaying the onset of a rise in blood glucose levels in a subject, by administering to the subject a short antisense inhibitor of PTP1B expression.
In certain embodiments, the present invention provides compositions and methods for improving insulin sensitivity in a subject or for preventing or delaying the onset of insulin resistance in a subject, by administering to the subject a short antisense inhibitor of PTP1B expression.
In certain embodiments, the present invention provides compositions and methods for treating a metabolic condition in a subject or for preventing or delaying the onset of a metabolic condition in a subject, by administering to the subject a short antisense compound targeted to a PTP1B nucleic acid.
Such metabolic condition may be any metabolic condition associated with PTP1B
expression, including but not limited to diabetes and obesity. Also provided are methods of reducing adiposity. Also provided is a method of treating obesity wherein metabolic rate is increased.
In certain embodiments, the subject has Type 2 diabetes. In certain embodiments the subject exhibits elevated HbAl c levels In certain embodiments, HbAlc levels are at least about 6%, at least about 7%, at least about 8%, at least about 9%, at least about 10% or at least about 11%. In preferred
-143-embodiments, HbAI, levels are reduced to about 7% or below about 7%. In certain embodiments, the subject exhibits an elevated body mass index In certain embodiments, the elevated body mass index is greater than 25 kg/m2. In certain embodiments, the subject exhibits hyperglycemia or elevated blood glucose levels. In a particular embodiment, the blood glucose levels are fasting blood glucose levels. In certain embodiments, the elevated fasting blood glucose levels are at least 130 mg/dL. In certain embodiments, the subject exhibits hyperglycemia prior to the start of treatment or exhibits fasting blood glucose levels above about 130 mg/dL, baseline HbA1, levels of at least about 7%, or body mass index of greater than 25 kg/m2 or any combination thereof.
In certain embodiments a method of reducing one or more such levels by administering a short antisense compound targeted to a PTP1B nucleic acid is provided. For example, provided is a method of reducing fasting glucose levels, HbAi, levels or, body mass index levels or any combination thereof in a subject by administering to a subject a short antisense compound targeting PTP1B. Fasting glucose may be fasting blood glucose, fasting serum glucose, or fasting plasma glucose. In some embodiments, fasting plasma glucose levels are reduced by at least about 25 mg/dL or by at least about 10 mg/dL. In a certain embodiments, said subject does not achieve normal glucose levels on a therapeutic regimen of a glucose-lowering agent such as insulin, sulfonylurea, or metformin.
In certain embodiments the invention provides methods of altering lipid levels. Certain such methods reduce cholesterol, LDL and/or VLDL levels or any combination thereof in a subject by administering to the subject a short antisense compound targeted to a PTP1B
nucleic acid. In certain embodiments HDL levels in a subject are increased by administering to the subject a short antisense compound targeted to a PTP1B nucleic acid. In certain embodiments, LDL:HDL
ratio and/or total cholesterol:HDL ratio in a subject is reduced by administering to the subject a short antisense compound targeted to a PTP1B nucleic acid. In certain embodiments HDL:LDL ratio and/or HDL:total cholesterol ratio in a subject's increased by administering to the subject a short antisense compound targeted to a PTP1B nucleic acid. In certain embodiments lipid profile in a subject is improved by increasing HDL, lowering LDL, lowering VLDL, lowering triglycerides, lowering apolipoprotein B
levels, or lowering total cholesterol levels, or a combination thereof, by administering to the subject a short antisense compound targeted to a PTP1B nucleic acid. In such embodiments, the subject is an animal, including a human.
Combination Therapy In certain embodiments, one or more pharmaceutical compositions comprising a short antisense compound targeted to a PTP1B nucleic acid are co-administered with one or more other pharmaceutical agents. In certain embodiments, such one or more other pharmaceutical agents are designed to treat the same disease or condition as the one or more pharmaceutical compositions of the present invention. In certain embodiments, such one or more other pharmaceutical agents are designed to treat a different disease or condition as the one or more pharmaceutical compositions of the present invention. In certain
-144-embodiments, such one or more other pharmaceutical agents are designed to treat an undesired effect of one or more pharmaceutical compositions of the present invention. In certain embodiments, one or more pharmaceutical compositions of the present invention are co-administered with another pharmaceutical agent to treat an undesired effect of that other pharmaceutical agent. In certain embodiments, one or more pharmaceutical compositions of the present invention and one or more other pharmaceutical agents are administered at the same time. In certain embodiments, one or more phannaceutical compositions of the present invention and one or more other pharmaceutical agents are administered at different times. In certain embodiments, one or more pharmaceutical compositions of the present invention and one or more other pharmaceutical agents are prepared together in a single formulation. In certain embodiments, one or more pharmaceutical compositions of the present invention and one or more other pharmaceutical agents are prepared separately.
In certain embodiments, pharmaceutical agents that may be co-administered with a pharmaceutical composition comprising a short antisense compound targeted to a PTP1B nucleic acid include glucose-lowering agents and therapies. In some embodiments, the glucose-lowering agent is a PPAR agonist (gamma, dual, or pan), a dipeptidyl peptidase (N) inhibitor, a GLP-1 analog, insulin or an insulin analog, an insulin secretagogue, a SGLT2 inhibitor, a human amylin analog, a biguanide, an alpha-glucosidase inhibitor, a meglitinide, a thiazolidinedione, or a sulfonylurea.
In some embodiments, the glucose-lowering therapeutic is a GLP-1 analog. In some embodiments, the GLP-1 analog is exendin-4 or liraglutide.
In other embodiments, the glucose-lowering therapeutic is a sulfonylurea. In some embodiments, the sulfonylurea is acetohexamide, chlorpropamide, tolbutamide, tolazamide, glimepiride, a glipizide, a glyburide, or a gliclazide.
In some embodiments, the glucose lowering drug is a biguanide. In some embodiments, the biguanide is metformin, and in some embodiments, blood glucose levels are decreased without increased lactic acidosis as compared to the lactic acidosis observed after treatment with metformin alone.
In some embodiments, the glucose lowering drug is a meglitinide. In some embodiments, the meglitinide is nateglinide or repaglinide.
In some embodiments, the glucose-lowering drug is a thiazolidinedione. In some embodiments, the thiazolidinedione is pioglitazone, rosiglitazone, or troglitazone. In some embodiments, blood glucose levels are decreased without greater weight gain than observed with rosiglitazone treatment alone.
In some embodiments, the glucose-lowering drug is an alpha-glucosidase inhibitor. In some embodiments, the alpha-glucosidase inhibitor is acarbose or miglitol.
In a certain embodiment, a co-administered glucose-lowering agent is ISIS
113715.
In a certain embodiment, glucose-lowering therapy is therapeutic lifestyle change.
In certain such embodiments, the glucose-lowering agent is administered prior to administration of a pharmaceutical composition of the present invention. In certain such embodiments, the glucose -lowering agent is administered following administration of a pharmaceutical composition of the present
-145-invention. In certain such embodiments the glucose -lowering agent is administered at the same time as a pharmaceutical composition of the present invention. In certain such embodiments the dose of a co-administered glucose -lowering agent is the same as the dose that would be administered if the glucose -lowering agent was administered alone. In certain such embodiments the dose of a co-administered glucose -lowering agent is lower than the dose that would be administered if the glucose -lowering agent was administered alone. In certain such embodiments the dose of a co-administered glucose -lowering agent is greater than the dose that would be administered if the glucose -lowering agent was administered alone.
In certain embodiments, pharmaceutical agents that may be co-administered with a pharmaceutical composition comprising a short antisense compound targeted to a PTP1B nucleic acid include lipid-lowering agents. Such lipid lowering agents are discussed elsewhere in the application and are included here with respect to PTP1B. Such lipid lowering agents may be administered as described above for glucose lowering agents.
In certain embodiments, pharmaceutical agents that may be co-administered with a pharmaceutical composition comprising a short antisense compound targeted to a PTP1B nucleic acid include anti-obesity agents therapeutics. Such anti-obesity agents therapeutics may be administered as described above for glucose lowering agents.
Further provided is a method of administering a short antisense compound targeted to a PTP1B
nucleic acid via injection and further including administering a topical steroid at the injection site.
Medicaments Also provided herein are uses of a short antisense compound which is targeted to a PTP1B
nucleic acid for the preparation of a medicament for reducing blood glucose levels including fasting glucose levels, and HbAlc levels, body mass index levels or any combination thereof. The medicament can be administered during a loading period and a maintenance period. In some embodiments, the medicament is administered subcutaneously or intravenously. In other embodiments, the administration of said medicament occurs at least once daily, at least once weekly, or at least once monthly. In a particular embodiment the short antisense compound present in the medicament is administered in a dose lower than a short antisense compound with a longer sequence and particularly a sequence 20 or more nucleobases. The medicament may be administered to a subject that exhibits high blood glucose or hyperglycemia, prediabetes, diabetes, Type 2 diabetes, metabolic syndrome, obesity and insulin resistance.
Other aspects and advantages of short antisense compounds are provided herein.
All aspect and advantages disclosed herein and specifically with regard to other targets is applicable with regard to compositions including short antisense compounds targeted to a PTP1B nucleic acid and methods of their use.
-146-Certain Short Antisense Compounds Targeted to a PTPIB Nucleic Acid In certain embodiments, short antisense compounds are targeted to a PTP I B
nucleic acid having the sequence of GENBANK Accession No. NM_002827.2, incorporated herein as SEQ
ID NO: 11 or the nucleotides 14178000 to 1425600 of the sequence of GENBANK Accession No.
NT 011362.9, incorporated herein as SEQ ID NO: 12. In certain such embodiments, a short antisense compound targeted to SEQ ID NO: 11 is at least 90% complementary to SEQ ID NO: 11. In certain such embodiments, a short antisense compound targeted to SEQ ID NO: 11 is at least 95% complementary to SEQ ID NO: 11. In certain such embodiments, a short antisense compound targeted to SEQ ID NO: 12 is 100% complementary to SEQ ID NO: 12. In certain such embodiments, a short antisense compound targeted to SEQ ID NO: 12 is at least 90% complementary to SEQ ID NO: 12. In certain such embodiments, a short antisense compound targeted to SEQ ID NO: 12 is at least 95% complementary to SEQ ID NO: 12. In certain such,embodiments, a short antisense compound targeted to SEQ ID NO: 12 is 100% complementary to SEQ ID NO: 12.
In certain embodiments, a short antisense compound targeted to SEQ ID NO: 11 comprises a nucleotide sequence selected from the nucleotide sequences set forth in Tables 16 and 17. In certain embodiments, a short antisense compound targeted to SEQ ID NO: 12 comprises a nucleotide sequence selected from the nucleotide sequences set forth in Tables 18 and 19.
Each nucleotide sequence set forth in each Tables 16, 17, 18, and 19 is independent of any modification to a sugar moiety, an internucleoside linkage, or a nucleobase.
As such, short antisense compounds comprising a nucleotide sequence as set forth in Tables 16, 17, 18, and 19 may comprise, independently, one or more modifications to a sugar moiety, an intemucleoside linkage, or a nucleobase.
Antisense compounds described by Isis Number (Isis NO.) indicate a combination of nucleobase sequence and one or more modifications to a sugar moiety, an internucleoside linkage, or a nucleobase.
Tables 16 and 17 illustrate examples of short antisense compounds targeted to SEQ ID NO: 11.
Table 16 illustrates short antisense compounds that are 100% complementary to SEQ ID NO: 11. Table 17 illustrates short antisense compounds that have one or two mismatches with respect to SEQ ID NO:
11. Table 18 illustrates short antisense compounds that are 100% complementary to SEQ ID NO: 12.
Table 19 illustrates short antisense compounds that have 1 or 2 mismatches with respect to SEQ ID NO:
12. The column labeled `gapmer motif indicates the wing-gap-wing motif of each short antisense compounds. The gap segment comprises 2'-deoxynucleotides and each nucleotide of each wing segment comprises a 2'-modified sugar. The particular 2'-modified sugar is also indicated in the `gapmer motif column. For example, `2-10-2 MOE' means a 2-10-2 gapmer motif, where a gap segment of ten 2'-deoxynucleotides is flanked by wing segments of two nucleotides, where the nucleotides of the wing segments are 2'-MOE nucleotides. Internucleoside linkages are phosphorothioate. The short antisense compounds comprise 5-methylcytidine in place of unmodified cytosine, unless "unmodified cytosine" is listed in the gapmer motif column, in which case the indicated cytosines are unmodified cytosines. For example, "5-mC in gap only" indicates that the gap segment has 5-methylcytosines, while the wing
-147-segments have unmodified cytosines.

Table 16: Short Antisense Compounds targeted to SEQ ID NO: 11 5' 3' ISIS Target Target Gapmer SEQ
NO. Site Site Sequence (5'-3') Motif ID NO
-148-
-149-147060 7059 '7070 GCAATTTAATCC 1-10-1 MOE 861
-150-147044 24487 24498 GTGGTCAAAAGG 1-10=1 MOE 869
-151-
-152-
-153-
-154-Table 17: Short antisense compounds targeted to SEQ ID NO: 11 and having 1 or 2 mismatches 5' 3' ISIS Target Target Gapmer SEQ ID
NO. Site Site Se uence 5'-3') Motif NO
-155-
-156-
-157-Table 18: Short Antisense Compounds targeted to SEQ ID NO: 12 5' 3' Seq ISIS Target Target ID
NO. Site Site Sequence (5'-3') Gapmer Motif NO
-158-
-159-
-160-
-161-
-162-
-163-
-164-
-165-
-166-
-167-
-168-
-169-
-170-Table 19: Short antisense compounds targeted to SEQ ID NO: 12 and having 1 or 2 mismatches ISIS NO. 5' Target 3' Target Sequence (5'-3') Gapmer Seq ID
Site Site Motif NO
-171-
-172-
-173-
-174-
-175-
-176-
-177-
-178-
-179-
-180-
-181-
-182-
-183-
-184-
-185-
-186-
-187-
-188-
-189-
-190-
-191-
-192-
-193-
-194-
-195-In certain embodiments, a target region is nucleotides 177-190 of SEQ ID NO:
11. In certain
-196-embodiments, a short antisense compound is targeted to nucleotides 177-190 of SEQ ID NO: 11. In certain such embodiments, a short antisense compound targeted to nucleotides 177-190 comprises a nucleotide sequence selected from SEQ ID NO 886, 859, or 853. In certain such embodiments, a short antisense compound targeted to nucleotides 177-190 of SEQ ID NO: 11 is selected from Isis No 147022, 147023, or 147024.
In certain embodiments, a target region is nucleotides 195-228 of SEQ ID NO:
11. In certain embodiments, a short antisense compound is targeted to nucleotides 195-228 of SEQ ID NO: 11. In certain such embodiments, a short antisense compound targeted to nucleotides 195-228 comprises a nucleotide sequence selected from SEQ ID NO 877, 868, 882, 886, 859, 853, 865, 835, 843, 846, 842, 848, 874, 849, 863, 855, 850, 864, or 834. In certain such embodiments, a short antisense compound targeted to nucleotides 195-228 of SEQ ID NO: 11 is selected from Isis No 147019, 147020, 147021, 147022, 147023, 147024, 147025, 147026, 147027, 147028, 147073, 147029, 147030, 147036, 147037, 147038, 147039, 147040, or 147041.
In certain embodiments, a target region is nucleotides 323-353 of SEQ ID NO:
11. In certain embodiments, a short antisense compound is targeted to nucleotides 323-353 of SEQ ID NO: 11. In certain such embodiments, a short antisense compound targeted to nucleotides 323-353 comprises a nucleotide sequence selected from SEQ ID NO 866, 881, 869, 883, 858, 833, 875, 837, 829, 871, 884, 887, 839, 830, 840, 861, or 879. In certain such embodiments, a short antisense compound targeted to nucleotides 323-353 of SEQ ID NO: 11 is selected from Isis No 147042, 147043, 147044, 147045, 147046, 147047, 147051, 147052, 147053, 147054, 147055, 147056, 147057, 147058, 147059, 147060, or 147061.
In certain embodiments, a target region is nucleotides 322-353 of SEQ ID NO:
11. In certain embodiments, a short antisense compound is targeted to nucleotides 322-353 of SEQ ID NO: 11. In certain such embodiments, a short antisense compound targeted to nucleotides 322-353 comprises a nucleotide sequence selected from SEQ ID NO 842, 866, 881, 869, 883, 858, 833, 875, 837, 829, 871, 884, 887, 839, 830, 840, 861, or 879. In certain such embodiments, a short antisense compound targeted to nucleotides 322-353 of SEQ ID NO: 11 is selected from Isis No 147073, 147042, 147043, 147044, 147045, 147046, 147047, 147051, 147052, 147053, 147054, 147055, 147056, 147057, 147058, 147059, 147060, or 147061.
In certain embodiments, a target region is nucleotides 679-799 of SEQ ID NO:
11. In certain embodiments, a short antisense compound is targeted to nucleotides 679-799 of SEQ ID NO: 11. In certain such embodiments, a short antisense compound targeted to nucleotides 679-799 comprises a nucleotide sequence selected from SEQ ID NO 883, 858, 883, or 858. In certain such embodiments, a short antisense compound targeted to nucleotides 679-799 of SEQ ID NO: 11 is selected from Isis No 147045, 147046, 147045, or 147046.
In certain embodiments, a target region is nucleotides 679-827 of SEQ ID NO:
11. In certain embodiments, a short antisense compound is targeted to nucleotides 679-827 of SEQ ID NO: 11. In certain such embodiments, a short antisense compound targeted to nucleotides 679-827 comprises a nucleotide sequence selected from SEQ ID NO 883, 858, 883, 858, or 851. In certain such embodiments,
-197-a short antisense compound targeted to nucleotides 679-827 of SEQ ID NO: 11 is selected from Isis No 147045, 147046, 147045, 147046, or 147066.
In certain embodiments, a target region is nucleotides 1024-1046 of SEQ ID NO:
11. In certain embodiments, a short antisense compound is targeted to nucleotides 1024-1046 of SEQ ID NO: 11. In certain such embodiments, a short antisense compound targeted to nucleotides 1024-1046 comprises a nucleotide sequence selected from SEQ ID NO 841, 862, 880, 857, 851, 876, 838, 860, 878, 856, 832, or 842. In certain such embodiments, a short antisense compound targeted to nucleotides 1024-1046 of SEQ
ID NO: I 1 is selected from Isis No 147062, 147063, 147064, 147065, 147066, 147067, 147068, 147069, 147070, 147071, 147072, or 147073.
In certain embodiments, a target region is nucleotides 992-1046 of SEQ ID NO:
11. In certain embodiments, a short antisense compound is targeted to nucleotides 992-1046 of SEQ ID NO: 11. In certain such embodiments, a short antisense compound targeted to nucleotides 992-1046 comprises a nucleotide sequence selected from SEQ ID NO 831, 841, 862, 880, 857, 851, 876, 838, 860, 878, 856, 832, or 842. In certain such embodiments, a short antisense compound targeted to nucleotides 992-1046 of SEQ ID NO: 11 is selected from Isis No 404131, 147062, 147063, 147064, 147065, 147066, 147067, 147068, 147069, 147070, 147071, 147072, or 147073.
In certain embodiments, a target region is nucleotides 1868-1881 of SEQ ID NO:
11. In certain embodiments, a short antisense compound is targeted to nucleotides 1868-1881 of SEQ ID NO: 11. In certain such embodiments, a short antisense compound targeted to nucleotides 1868-1881 comprises a nucleotide sequence selected from SEQ ID NO 886, 859, or 853. In certain such embodiments, a short antisense compound targeted to nucleotides 1868-1881 of SEQ ID NO: 11 is selected from Isis No 147022, 147023, or 147024.
In certain embodiments, a target region is nucleotides 1886-1919 of SEQ ID NO:
11. In certain embodiments, a short antisense compound is targeted to nucleotides 1886-1919 of SEQ ID NO: 11. In certain such embodiments, a short antisense compound targeted to nucleotides 1886-1919 comprises a nucleotide sequence selected from SEQ ID NO 877, 868, 882, 886, 859, 865, 843, 846, 874, 863, 855, 864, or 834. In certain such embodiments, a short antisense compound targeted to nucleotides 1886-1919 of SEQ ID NO: 11 is selected from Isis No 147019, 147020, 147021, 147022, 147023, 147025, 147027, 147028, 147030, 147037, 147038, 147040, or 147041.
In certain embodiments, a target region is nucleotides 1869-1919 of SEQ ID NO:
11. In certain embodiments, a short antisense compound is targeted to nucleotides 1869-1919 of SEQ ID NO: 11. In certain such embodiments, a short antisense compound targeted to nucleotides 1869-1919 comprises a nucleotide sequence selected from SEQ ID NO 859, 853, 877, 868, 882, 886, 859, 865, 843, 846, 874, 863, 855, 864, or 834. In certain such embodiments, a short antisense compound targeted to nucleotides 1869-1919 of SEQ ID NO: 11 is selected from Isis No 147023, 147024, 147019, 147020, 147021, 147022, 147023, 147025, 147027, 147028, 147030, 147037, 147038, 147040, or 147041.
In certain embodiments, a target region is nucleotides 1976-1989 of SEQ ID NO:
11. In certain embodiments, a short antisense compound is targeted to nucleotides 1976-1989 of SEQ ID NO: 11. In certain such embodiments, a short antisense compound targeted to nucleotides 1976-1989 comprises a
-198-nucleotide sequence selected from SEQ ID NO 886, 859, or 853. In certain such embodiments, a short antisense compound targeted to nucleotides 1976-1989 of SEQ ID NO: 11 is selected from Isis No 147022, 147023, or 147024.
In certain embodiments, a target region is nucleotides 1995-2027 of SEQ ID NO:
11. In certain embodiments, a short antisense compound is targeted to nucleotides 1995-2027 of SEQ ID NO: 11. In certain such embodiments, a short antisense compound targeted to nucleotides 1995-2027 comprises a nucleotide sequence selected from SEQ ID NO 868, 882, 886, 859, 853, 865, 835, 843, 846, 848, 874, 849, 863, 855, 850, 864, or 834. In certain such embodiments, a short antisense compound targeted to nucleotides 1995-2027 of SEQ ID NO: 11 is selected from Isis No 147020, 147021, 147022, 147023, 147024, 147025, 147026, 147027, 147028, 147029, 147030, 147036, 147037, 147038, 147039, 147040, or 147041.
In certain embodiments, a target region is nucleotides 2366-2382 of SEQ ID NO:
11. In certain embodiments, a short antisense compound is targeted to nucleotides 2366-2382 of SEQ ID NO: 11. In certain such embodiments, a short antisense compound targeted to nucleotides 2366-2382 comprises a nucleotide sequence selected from SEQ ID NO 867 or 873. In certain such embodiments, a short antisense compound targeted to nucleotides 2366-2382 of SEQ ID NO: 11 is selected from Isis No 404199 or 404134.
In certain embodiments, a target region is nucleotides 6220-6233 of SEQ ID NO:
11. In certain embodiments, a short antisense compound is targeted to nucleotides 6220-6233 of SEQ ID NO: 11. In certain such embodiments, a short antisense compound targeted to nucleotides 6220-6233 comprises a nucleotide sequence selected from SEQ ID NO 870, 836, or 844. In certain such embodiments, a short antisense compound targeted to nucleotides 6220-6233 of SEQ ID NO: 11 is selected from Isis No 147032, 147033, or 147034.
In certain embodiments, a target region is nucleotides 6288-6300 of SEQ ID NO:
11. In certain embodiments, a short antisense compound is targeted to nucleotides 6288-6300 of SEQ ID NO: 11. In certain such embodiments, a short antisense compound targeted to nucleotides 6288-6300 comprises a nucleotide sequence selected from SEQ ID NO 869 or 883. In certain such embodiments, a short antisense compound targeted to nucleotides 6288-6300 of SEQ ID NO: 11 is selected from Isis No 147044 or 147045.
In certain embodiments, a target region is nucleotides 6329-6342 of SEQ ID NO:
11. In certain embodiments, a short antisense compound is targeted to nucleotides 6329-6342 of SEQ ID NO: 11. In certain such embodiments, a short antisense compound targeted to nucleotides 6329-6342 comprises a nucleotide sequence selected from SEQ ID NO 870, 836, or 844. In certain such embodiments, a short antisense compound targeted to nucleotides 6329-6342 of SEQ ID NO: 11 is selected from Isis No 147032, 147033, or 147034.
In certain embodiments, a target region is nucleotides 6397-6409 of SEQ ID NO:
11. In certain embodiments, a short antisense compound is targeted to nucleotides 6397-6409 of SEQ ID NO: 11. In certain such embodiments, a short antisense compound targeted to nucleotides 6397-6409 comprises a nucleotide sequence selected from SEQ ID NO 869 or 883. In certain such embodiments, a short
-199-antisense compound targeted to nucleotides 6397-6409 of SEQ ID NO: 11 is selected from Isis No 147044 or 147045.
In certain embodiments, a target region is nucleotides 7057-7178 of SEQ ID NO:
11. In certain embodiments, a short antisense compound is targeted to nucleotides 7057-7178 of SEQ ID NO: 11. In certain such embodiments, a short antisense compound targeted to 7057-7178 comprises a nucleotide sequence selected from SEQ ID NO 830, 840, 861, 830, or 840. In certain such embodiments, a short antisense compound targeted to nucleotides 7057-7178 of SEQ ID NO: 11 is selected from Isis No 147058, 147059, 147060, 147058, or 147059.
In certain embodiments, a target region is nucleotides 8630-8750 of SEQ ID NO:
11. In certain embodiments, a short antisense compound is targeted to nucleotides 8630-8750 of SEQ ID NO: 11. In certain such embodiments, a short antisense compound targeted to 8630-8750 comprises a nucleotide sequence selected from SEQ ID NO 843, 846, 843, or 846. In certain such embodiments, a short antisense compound targeted to nucleotides 8630-8750 of SEQ ID NO: 11 is selected from Isis No 147027, 147028, 147027, or 147028.
In certain embodiments, a target region is nucleotides 10957-11077 of SEQ ID
NO: 11. In certain embodiments, a short antisense compound is targeted to nucleotides 10957-11077 of SEQ ID NO: 11. In certain such embodiments, a short antisense compound targeted to 10957-11077 comprises a nucleotide sequence selected from SEQ ID NO 881, 869, 881, or 869. In certain such embodiments, a short antisense compound targeted to nucleotides 10957-11077 of SEQ ID NO: 11 is selected from Isis No 147043, 147044, 147043, or 147044.
In certain embodiments, a target region is nucleotides 1 1 605-1 1 623 of SEQ
ID NO: 11. In certain embodiments, a short antisense compound is targeted to nucleotides 11605-11623 of SEQ ID NO: 11. In certain such embodiments, a short antisense compound targeted to 11605-11623 comprises a nucleotide sequence selected from SEQ ID NO 856, 878, or 856. In certain such embodiments, a short antisense compound targeted to nucleotides 11605-11623 of SEQ ID NO: 11 is selected from Isis No 147071, 147070, or 147071.
In certain embodiments, a target region is nucleotides 12805-12817 of SEQ ID
NO: 11. In certain embodiments, a short antisense compound is targeted to nucleotides 12805-12817 of SEQ ID NO: 11. In certain such embodiments, a short antisense compound targeted to 12805-12817 comprises a nucleotide sequence selected from SEQ ID NO 874 or 885. In certain such embodiments, a short antisense compound targeted to nucleotides 12805-12817 of SEQ ID NO: 11 is selected from Isis No 147030 or 147031.
In certain embodiments, a target region is nucleotides 12986-12998 of SEQ ID
NO: 11. In certain embodiments, a short antisense compound is targeted to nucleotides 12986-12998 of SEQ ID NO: 11. In certain such embodiments, a short antisense compound targeted to 12986-12998 comprises a nucleotide sequence selected from SEQ ID NO 874 or 885. In certain such embodiments, a short antisense compound targeted to nucleotides 12986-12998 of SEQ ID NO: 11 is selected from Isis No 147030 or 147031.
In certain embodiments, a target region is nucleotides 15560-15572 of SEQ ID
NO: 11. In certain
-200-embodiments, a short antisense compound is targeted to nucleotides 15560-15572 of SEQ ID NO: 11. In certain such embodiments, a short antisense compound targeted to 15560-15572 comprises a nucleotide sequence selected from SEQ ID NO 876 or 838. In certain such embodiments, a short antisense compound targeted to nucleotides 15560-15572 of SEQ ID NO: 11 is selected from Isis No 147067 or 147068.
In certain embodiments, a target region is nucleotides 17787-17941 of SEQ ID
NO: 11. In certain embodiments, a short antisense compound is targeted to nucleotides 17787-17941 of SEQ ID NO: 11. In certain such embodiments, a short antisense compound targeted to 17787-17941 comprises a nucleotide sequence selected from SEQ ID NO 874 or 880. In certain such embodiments, a short antisense compound targeted to nucleotides 17787-17941 of SEQ ID NO: 11 is selected from Isis No 147030 or 147064.
In certain embodiments, a target region is nucleotides 21190-21202 of SEQ ID
NO: 11. In certain embodiments, a short antisense compound is targeted to nucleotides 2 1 1 90-2 1 202 of SEQ ID NO: 11. In certain such embodiments, a short antisense compound targeted to 21190-21202 comprises a nucleotide sequence selected from SEQ ID NO 843 or 846. In certain such embodiments, a short antisense compound targeted to nucleotides 21190-21202 of SEQ ID NO: 11 is selected from Isis No 147027 or 147028.
In certain embodiments, a target region is nucleotides 21358-21370 of SEQ ID
NO: 11. In certain embodiments, a short antisense compound is targeted to nucleotides 21358-21370 of SEQ ID NO: 11. In certain such embodiments, a short antisense compound targeted to 21358-21370 comprises a nucleotide sequence selected from SEQ ID NO 843 or 846. In certain such embodiments, a short antisense compound targeted to nucleotides 21358-21370 of SEQ ID NO: 11 is selected from Isis No 017027 or 147028.
In certain embodiments, a target region is nucleotides 24318-24332 of SEQ ID
NO: 11. In certain embodiments, a short antisense compound is targeted to nucleotides 24318-24332 of SEQ ID NO: 11. In certain such embodiments, a short antisense compound targeted to 24318-24332 comprises a nucleotide sequence selected from SEQ ID NO 881, 869, 883, or 858. In certain such embodiments, a short antisense compound targeted to nucleotides 24318-24332 of SEQ ID NO: 11 is selected from Isis No 147043, 147044, 147045, or 147046.
In certain embodiments, a target region is nucleotides 24486-24501 of SEQ ID
NO: 11. In certain embodiments, a short antisense compound is targeted to nucleotides 24486-24501 of SEQ ID NO: 11. In certain such embodiments, a short antisense compound targeted to 24486-24501 comprises a nucleotide sequence selected from SEQ ID NO 881, 869, 858, or 833. In certain such embodiments, a short antisense compound targeted to nucleotides 24486-24501 of SEQ ID NO: 11 is selected from Isis No 147043, 147044, 147046, or 147047.
In certain embodiments, a target region is nucleotides 25065-25077 of SEQ ID
NO: 11. In certain embodiments, a short antisense compound is targeted to nucleotides 25065-25077 of SEQ ID NO: 11. In certain such embodiments, a short antisense compound targeted to 25065-25077 comprises a nucleotide sequence selected from SEQ ID NO 864 or 834. In certain such embodiments, a short antisense
-201-compound targeted to nucleotides 25065-25077 of SEQ ID NO: I 1 is selected from Isis No 147040 or 147041.
In certain embodiments, a target region is nucleotides 25232-25245 of SEQ ID
NO: 11. In certain embodiments, a short antisense compound is targeted to nucleotides 25232-25245 of SEQ ID NO: 11. In certain such embodiments, a short antisense compound targeted to 25232-25245 comprises a nucleotide sequence selected from SEQ ID NO 850, 864, or 834. In certain such embodiments, a short antisense compound targeted to nucleotides 25232-25245 of SEQ ID NO: 11 is selected from Isis No 147039, 147040,or147041.
In certain embodiments, a target region is nucleotides 25508-25523 of SEQ ID
NO: 11. In certain embodiments, a short antisense compound is targeted to nucleotides 25508-25523 of SEQ ID NO: 11. In certain such embodiments, a short antisense compound targeted to 25508-25523 comprises a nucleotide sequence selected from SEQ ID NO 839 or 879. In certain such embodiments, a short antisense compound targeted to nucleotides 25508-25523 of SEQ ID NO: 11 is selected from Isis No 147057 or 147061.
In certain embodiments, a target region is nucleotides 25676-28890 of SEQ ID
NO: 11. In certain embodiments, a short antisense compound is targeted to nucleotides 25676-28890 of SEQ ID NO: 11. In certain such embodiments, a short antisense compound targeted to 25676-28890 comprises a nucleotide sequence selected from SEQ ID NO 839, 860, or 878. In certain such embodiments, a short antisense compound targeted to nucleotides 25676-28890 of SEQ ID NO: 11 is selected from Isis No 147057, 147069, or 147070.
In certain embodiments, a target region is nucleotides 33056-33069 of SEQ ID
NO: 11. In certain embodiments, a short antisense compound is targeted to nucleotides 33056-33069 of SEQ ID NO: 11. In certain such embodiments, a short antisense compound targeted to 33056-33069 comprises a nucleotide sequence selected from SEQ ID NO 860, 878, or 856. In certain such embodiments, a short antisense compound targeted to nucleotides 33056-33069 of SEQ ID NO: 11 is selected from Isis No 147069, 147070, or 147071.
In certain embodiments, a target region is nucleotides 33205-33217 of SEQ ID
NO: 11. In certain embodiments, a short antisense compound is targeted to nucleotides 33205-33217 of SEQ ID NO: 11. In certain such embodiments, a short antisense compound targeted to 33205-33217 comprises a nucleotide sequence selected from SEQ ID NO 878 or 856. In certain such embodiments, a short antisense compound targeted to nucleotides 33205-33217 of SEQ ID NO: 11 is selected from Isis No 14707 or 147071.
In certain embodiments, a target region is nucleotides 33318-33334 of SEQ ID
NO: 11. In certain embodiments, a short antisense compound is targeted to nucleotides 33318-33334 of SEQ ID NO: 11. In certain such embodiments, a short antisense compound targeted to 33318-33334 comprises a nucleotide sequence selected from SEQ ID NO 858, 854, or 875. In certain such embodiments, a short antisense compound targeted to nucleotides 33318-33334 of SEQ ID NO: 11 is selected from Isis No 147046, 147049, or 147051.
In certain embodiments, a target region is nucleotides 33466-33482 of SEQ ID
NO: 11. In certain
-202-embodiments, a short antisense compound is targeted to nucleotides 33466-33482 of SEQ ID NO: 11. In certain such embodiments, a short antisense compound targeted 33466-33482 comprises a nucleotide sequence selected from SEQ ID NO 858, 833, or 875. In certain such embodiments, a short antisense compound targeted to nucleotides 33466-33482 of SEQ ID NO: 11 is selected from Isis No 147046, 147047, or 147051.
In certain embodiments, a target region is nucleotides 33640-33656 of SEQ ID
NO: 11. In certain embodiments, a short antisense compound is targeted to nucleotides 33640-33656 of SEQ ID NO: 11. In certain such embodiments, a short antisense compound targeted 33640-33656 comprises a nucleotide sequence selected from SEQ ID NO 858 or 875. In certain such embodiments, a short antisense compound targeted to nucleotides 33640-33656 of SEQ ID NO: I 1 is selected from Isis No 147046 or 147051.
In certain embodiments, a target region is nucleotides 33788-33804 of SEQ ID
NO: 11. In certain embodiments, a short antisense compound is targeted to nucleotides 33788-33804 of SEQ ID NO: 11. In certain such embodiments, a short antisense compound targeted 33788-33804 comprises a nucleotide sequence selected from SEQ ID NO 858 or 875. In certain such embodiments, a short antisense compound targeted to nucleotides 33788-33804 of SEQ ID NO: 11 is selected from Isis No 147046 or 147051.
In certain embodiments, a target region is nucleotides 35437-35449 of SEQ ID
NO: 11. In certain embodiments, a short antisense compound is targeted to nucleotides 35437-35449 of SEQ ID NO: 11. In certain such embodiments, a short antisense compound targeted 35437-35449 comprises a nucleotide sequence selected from SEQ ID NO 840 or 861. In certain such embodiments, a short antisense compound targeted to nucleotides 35437-35449 of SEQ ID NO: 11 is selected from Isis No 147059 or 147060.
In certain embodiments, a target region is nucleotides 40353-40373 of SEQ ID
NO: 11. In certain embodiments, a short antisense compound is targeted to nucleotides 40353-40373 of SEQ ID NO: 11. In certain such embodiments, a short antisense compound targeted 40353-40373 comprises a nucleotide sequence selected from SEQ ID NO 879 or 881. In certain such embodiments, a short antisense compound targeted to nucleotides 40353-40373 of SEQ ID NO: 11 is selected from Isis No 147061 or 147043.
In certain embodiments, a target region is nucleotides 42527-42541 of SEQ ID
NO: 11. In certain embodiments, a short antisense compound is targeted to nucleotides 42527-42541 of SEQ ID NO: 11. In certain such embodiments, a short antisense compound targeted 42527-42541 comprises a nucleotide sequence selected from SEQ ID NO 885, 870, or 844. In certain such embodiments, a short antisense compound targeted to nucleotides 42527-42541 of SEQ ID NO: 11 is selected from Isis No 147031, 147032, or 147034.
In certain embodiments, a target region is nucleotides 42675-42689 of SEQ ID
NO: 11. In certain embodiments, a short antisense compound is targeted to nucleotides 42675-42689 of SEQ ID NO:
11. In certain such embodiments, a short antisense compound targeted 42675-42689 comprises a nucleotide sequence selected from SEQ ID NO 885, 870, 836, or 844. In certain such embodiments, a
-203-short antisense compound targeted to nucleotides 42675-42689 of SEQ ID NO: 11 is selected from Isis No 147031, 147032, 147033, or 147034.
In certain embodiments, a target region is nucleotides 46313-46328 of SEQ ID
NO: 11. In certain embodiments, a short antisense compound is targeted to nucleotides 46313-46328 of SEQ ID NO:
11. In certain such embodiments, a short antisense compound targeted 46313-46328 comprises a nucleotide sequence selected from SEQ ID NO 839, 830, 840, or 879. In certain such embodiments, a short antisense compound targeted to nucleotides 46313-46328 of SEQ ID NO: 11 is selected from Isis No 147057, 147058, 147059, or 147061.
In certain embodiments, a target region is nucleotides 46461-46476 of SEQ ID
NO: 11. In certain embodiments, a short antisense compound is targeted to nucleotides 46461-46476 of SEQ ID NO:
11. In certain such embodiments, a short antisense compound targeted 46461-46476 comprises a nucleotide sequence selected from SEQ ID NO 839, 840, or 879. In certain such embodiments, a short antisense compound targeted to nucleotides 46461-46476 of SEQ ID NO: 11 is selected from Isis No 147057, 147059, or 147061.
In certain embodiments, a target region is nucleotides 48369-48381 of SEQ ID
NO: 11. In certain embodiments, a short antisense compound is targeted to nucleotides 48369-48381 of SEQ ID NO: 11. In certain such embodiments, a short antisense compound targeted 48369-48381 comprises a nucleotide sequence selected from SEQ ID NO 842 or 845. In certain such embodiments, a short antisense compound targeted to nucleotides 48369-48381 of SEQ ID NO: 11 is selected from Isis No 147073 or 147074.
In certain embodiments, a target region is nucleotides 48714-48726 of SEQ ID
NO: 11. In certain embodiments, a short antisense compound is targeted to nucleotides 48714-48726 of SEQ ID NO: 11. In certain such embodiments, a short antisense compound targeted 48714-48726 comprises a nucleotide sequence selected from SEQ ID NO 843 or 846. In certain such embodiments, a short antisense compound targeted to nucleotides 48714-48726 of SEQ ID NO: 11 is selected from Isis No 147027 or 147028.
In certain embodiments, a target region is nucleotides 49050-49062 of SEQ ID
NO: 11. In certain embodiments, a short antisense compound is targeted to nucleotides 49050-49062 of SEQ ID NO: 11. In certain such embodiments, a short antisense compound targeted 49050-49062 of comprises a nucleotide sequence selected from SEQ ID NO 876 or 838. In certain such embodiments, a short antisense compound targeted to nucleotides 49050-49062 of SEQ ID NO: 11 is selected from Isis No 147067 or 147068.
In certain embodiments, a target region is nucleotides 49672-49684 of SEQ ID
NO: 11. In certain embodiments, a short antisense compound is targeted to nucleotides 49672-49684 of SEQ ID NO: 11. In certain such embodiments, a short antisense compound targeted 49672-49684 of comprises a nucleotide sequence selected from SEQ ID NO 842 or 845. In certain such embodiments, a short antisense compound targeted to nucleotides 49672-49684 of SEQ ID NO: 11 is selected from Isis No 147073 or 147074.
In certain embodiments, a target region is nucleotides 52292-52304 of SEQ ID
NO: 11. In certain
-204-embodiments, a short antisense compound is targeted to nucleotides 52292-52304 of SEQ ID NO: 11. In certain such embodiments, a short antisense compound targeted 52292-52304 of comprises a nucleotide sequence selected from SEQ ID NO 849 or 863. In certain such embodiments, a short antisense compound targeted to nucleotides 52292-52304 of SEQ ID NO: 11 is selected from Isis No 147036 or 147037.
In certain embodiments, a target region is nucleotides 52438-52450 of SEQ ID
NO: 11. In certain embodiments, a short antisense compound is targeted to nucleotides 52438-52450 of SEQ ID NO: 11. In certain such embodiments, a short antisense compound targeted 52438-52450 of comprises a nucleotide sequence selected from SEQ ID NO 849 or 863. In certain such embodiments, a short antisense compound targeted to nucleotides 52438-52450 of SEQ ID NO: 11 is selected from Isis No 147036 or 147037.
In certain embodiments, a target region is nucleotides 53445-53458 of SEQ ID
NO: 11. In certain embodiments, a short antisense compound is targeted to nucleotides 53445-53458 of SEQ ID NO: 11. In certain such embodiments, a short antisense compound targeted 53445-53458 of comprises a nucleotide sequence selected from SEQ ID NO 866, 881, or 869. In certain such embodiments, a short antisense compound targeted to nucleotides 53445-53458 of SEQ ID NO: 11 is selected from Isis No 147042, 147043, or 147044.
In certain embodiments, a target region is nucleotides 53591-53604 of SEQ ID
NO: 11. In certain embodiments, a short antisense compound is targeted to nucleotides 53591-53604 of SEQ ID NO: 11. In certain such embodiments, a short antisense compound targeted 53591-53604 of comprises a nucleotide sequence selected from SEQ ID NO 866, 874, 881, 885, or 869. In certain such embodiments, a short antisense compound targeted to nucleotides 53591-53604 of SEQ ID NO: 11 is selected from Isis No 147042, 147030, 147043, 147031, or 147044.
In certain embodiments, a target region is nucleotides 53738-53750 of SEQ ID
NO: 11. In certain embodiments, a short antisense compound is targeted to nucleotides 53738-53750 of SEQ ID NO:
11. In certain such embodiments, a short antisense compound targeted 53738-53750 of comprises a nucleotide sequence selected from SEQ ID NO 874 or 885. In certain such embodiments, a short antisense compound targeted to nucleotides 53738-53750 of SEQ ID NO: 11 is selected from Isis No 147030 or 147031.
In certain embodiments, a target region is nucleotides 53783-53795 of SEQ ID
NO: 11. In certain embodiments, a short antisense compound is targeted to nucleotides 53783-53795 of SEQ ID NO:
11. In certain such embodiments, a short antisense compound targeted 53783-53795 of comprises a nucleotide sequence selected from SEQ ID NO 864 or 834. In certain such embodiments, a short antisense compound targeted to nucleotides 53783-53795 of SEQ ID NO: 11 is selected from Isis No 147040 or 147041.
In certain embodiments, a target region is nucleotides 55008-55020 of SEQ ID
NO: 11. In certain embodiments, a short antisense compound is targeted to nucleotides 55008-55020 of SEQ ID NO: 11. In certain such embodiments, a short antisense compound targeted 55008-55020 of comprises a nucleotide sequence selected from SEQ ID NO 866 or 881. In certain such embodiments, a short antisense
-205-compound targeted to nucleotides 55008-55020 of SEQ ID NO: 11 is selected from Isis No 147042 or 147043.
In certain embodiments, a target region is nucleotides 55154-55166 of SEQ ID
NO: 11. In certain embodiments, a short antisense compound is targeted to nucleotides 55154-55166 of SEQ ID NO: 11. In certain such embodiments, a short antisense compound targeted 55154-55166 of comprises a nucleotide sequence selected from SEQ ID NO 866 or 881. In certain such embodiments, a short antisense compound targeted to nucleotides 55154-55166 of SEQ ID NO: 11 is selected from Isis No 147042 or 147043.
In certain embodiments, a target region is nucleotides 55682-55695 of SEQ ID
NO: 11. In certain embodiments, a short antisense compound is targeted to nucleotides 55682-55695 of SEQ ID NO: 11. In certain such embodiments, a short antisense compound targeted 55682-55695 of comprises a nucleotide sequence selected from SEQ ID NO 877 or 882. In certain such embodiments, a short antisense compound targeted to nucleotides 55682-55695 of SEQ ID NO: 11 is selected from Isis No 147019 or 147021.
In certain embodiments, a target region is nucleotides 56275-56293 of SEQ ID
NO: 11. In certain embodiments, a short antisense compound is targeted to nucleotides 56275-56293 of SEQ ID NO: 11. In certain such embodiments, a short antisense compound targeted 56275-56293 of comprises a nucleotide sequence selected from SEQ ID NO 871, 884, 887, 830, 840, 861, or 879. In certain such embodiments, a short antisense compound targeted to nucleotides 56275-56293 of SEQ ID NO: 11 is selected from Isis No 147054, 147055, 147056, 147058, 147059, 147060, or 147061.
In certain embodiments, a target region is nucleotides 56418-56439 of SEQ ID
NO: 11. In certain embodiments, a short antisense compound is targeted to nucleotides 56418-56439 of SEQ ID NO: 11. In certain such embodiments, a short antisense compound targeted 56418-56439 of comprises a nucleotide sequence selected from SEQ ID NO 875, 829, 871, 884, 887, 839, 830, or 879. In certain such embodiments, a short antisense compound targeted to nucleotides 56418-56439 of SEQ ID NO: 11 is selected from Isis No 147051, 147053, 147054, 147055, 147056, 147057, 147058, or 147061.
In certain embodiments, a target region is nucleotides 57264-57276 of SEQ ID
NO: 11. In certain embodiments, a short antisense compound is targeted to nucleotides 57264-57276 of SEQ ID NO: 11. In certain such embodiments, a short antisense compound targeted 57264-57276 of comprises a nucleotide sequence selected from SEQ ID NO 883 or 858. In certain such embodiments, a short antisense compound targeted to nucleotides 57264-57276 of SEQ ID NO: 11 is selected from Isis No 147045 or 147046.
In certain embodiments, a target region is nucleotides 61276-61293 of SEQ ID
NO: 11. In certain embodiments, a short antisense compound is targeted to nucleotides 61276-61293 of SEQ ID NO: 11. In certain such embodiments, a short antisense compound targeted 61276-61293 of comprises a nucleotide sequence selected from SEQ ID NO 856, 847, 849, 863, 855, 850, or 864. In certain such embodiments, a short antisense compound targeted to nucleotides 61276-61293 of SEQ ID NO: 11 is selected from Isis No 147071, 147035, 147036, 147037, 147038, 147039, or 147040.
In certain embodiments, a target region is nucleotides 61257-61320 of SEQ ID
NO: 11. In certain
-206-embodiments, a short antisense compound is targeted to nucleotides 61257-61320 of SEQ ID NO: 11. In certain such embodiments, a short antisense compound targeted 61257-61320 of comprises a nucleotide sequence selected from SEQ ID NO 881, 856, 847, 849, 863, 855, 850, 864, or 886. In certain such embodiments, a short antisense compound targeted to nucleotides 61257-61320 of SEQ ID NO: 11 is selected from Isis No 147043, 147071, 147035, 147036, 147037, 147038, 147039, 147040, or 147071.
In certain embodiments, a target region is nucleotides 61422-61439 of SEQ ID
NO: 11. In certain embodiments, a short antisense compound is targeted to nucleotides 61422-61439 of SEQ ID NO: 11. In certain such embodiments, a short antisense compound targeted 61422-61439 of comprises a nucleotide sequence selected from SEQ ID NO 844, 847, 849, 863, 855, or 864. In certain such embodiments, a short antisense compound targeted to nucleotides 61422-61439 of SEQ ID NO: 11 is selected from Isis No 147034, 147035, 147036, 147037, 147038, or 147040.
In certain embodiments, a target region is nucleotides 61422-61466 of SEQ ID
NO: 11. In certain embodiments, a short antisense compound is targeted to nucleotides 61422-61466 of SEQ ID NO: 11. In certain such embodiments, a short antisense compound targeted 61422-61466 of comprises a nucleotide sequence selected from SEQ ID NO 844, 847, 849, 863, 855, 864, or 856. In certain such embodiments, a short antisense compound targeted to nucleotides 61422-61466 of SEQ ID NO: 11 is selected from Isis No 147034, 147035, 147036, 147037, 147038, 147040, or 147071.
In certain embodiments, a target region is nucleotides 63065-63078 of SEQ ID
NO: 11. In certain embodiments, a short antisense compound is targeted to nucleotides 63065-63078 of SEQ ID NO: 11. In certain such embodiments, a short antisense compound targeted 63065-63078 of comprises a nucleotide sequence selected from SEQ ID NO 851 or 838. In certain such embodiments, a short antisense compound targeted to nucleotides 63065-63078 of SEQ ID NO: 11 is selected from Isis No 147066 or 147068.
In certain embodiments, a target region is nucleotides 63207-63222 of SEQ ID
NO: 11. In certain embodiments, a short antisense compound is targeted to nucleotides 63207-63222 of SEQ ID NO: 11. In certain such embodiments, a short antisense compound targeted 63207-63222 of comprises a nucleotide sequence selected from SEQ ID NO 841 or 851. In certain such embodiments, a short antisense compound targeted to nucleotides 63207-63222 of SEQ ID NO: 11 is selected from Isis No 147062 or 147066.
In certain embodiments, a target region is nucleotides 64538-64550 of SEQ ID
NO: 11. In certain embodiments, a short antisense compound is targeted to nucleotides 64538-64550 of SEQ ID NO: 11. In certain such embodiments, a short antisense compound targeted 64538-64550 of comprises a nucleotide sequence selected from SEQ ID NO 849 or 863. In certain such embodiments, a short antisense compound targeted to nucleotides 64538-64550 of SEQ ID NO: 11 is selected from Isis No 147036 or 147037.
In certain embodiments, a target region is nucleotides 64864-64876 of SEQ ID
NO: 11. In certain embodiments, a short antisense compound is targeted to nucleotides 64864-64876 of SEQ ID NO: 11. In certain such embodiments, a short antisense compound targeted 64864-64876 of comprises a nucleotide sequence selected from SEQ ID NO 851 or 876. In certain such embodiments, a short antisense
-207-compound targeted to nucleotides 64864-64876 of SEQ ID NO: 11 is selected from Isis No 147066 or 147067.
In certain embodiments, a target region is nucleotides 65010-65028 of SEQ ID
NO: 11. In certain embodiments, a short antisense compound is targeted to nucleotides 65010-65028 of SEQ ID NO: 11. In certain such embodiments, a short antisense compound targeted 65010-65028 of comprises a nucleotide sequence selected from SEQ ID NO 851, 876, or 883. In certain such embodiments, a short antisense compound targeted to nucleotides 65010-65028 of SEQ ID NO: 11 is selected from Isis No 147066, 147067, or 147045.
In certain embodiments, a target region is nucleotides 65163-65175 of SEQ ID
NO: 11. In certain embodiments, a short antisense compound is targeted to nucleotides 65163-65175 of SEQ ID NO: 11. In certain such embodiments, a short antisense compound targeted 65163-65175 of comprises a nucleotide sequence selected from SEQ ID NO 883 or 858. In certain such embodiments, a short antisense compound targeted to nucleotides 65163-65175 of SEQ ID NO: 11 is selected from Isis No 147045 or 147046.
In certain embodiments, a target region is nucleotides 65408-65422 of SEQ ID
NO: 11. In certain embodiments, a short antisense compound is targeted to nucleotides 65408-65422 of SEQ ID NO: 11. In certain such embodiments, a short antisense compound targeted 65408-65422 of comprises a nucleotide sequence selected from SEQ ID NO 883 or 856. In certain such embodiments, a short antisense compound targeted to nucleotides 65408-65422 of SEQ ID NO: 11 is selected from Isis No 147068 or 147071.
In certain embodiments, a target region is nucleotides 65549-65568 of SEQ ID
NO: 11. In certain embodiments, a short antisense compound is targeted to nucleotides 65549-65568 of SEQ ID NO: 11. In certain such embodiments, a short antisense compound targeted 65549-65568 of comprises a nucleotide sequence selected from SEQ ID NO 860, 838, or 856. In certain such embodiments, a short antisense compound targeted to nucleotides 65549-65568 of SEQ ID NO: 11 is selected from Isis No 147069, 147068, or 147071.
In certain embodiments, a target region is nucleotides 67741-67754 of SEQ ID
NO: 11. In certain embodiments, a short antisense compound is targeted to nucleotides 67741-67754 of SEQ ID NO: 11. In certain such embodiments, a short antisense compound targeted 67741-67754 of comprises a nucleotide sequence selected from SEQ ID NO 848, 874, or 885. In certain such embodiments, a short antisense compound targeted to nucleotides 67741-67754 of SEQ ID NO: 11 is selected from Isis No 147029, 147030, or 147031.
In certain embodiments, a target region is nucleotides 67886-67900 of SEQ ID
NO: 11. In certain embodiments, a short antisense compound is targeted to nucleotides 67886-67900 of SEQ ID NO: 11. In certain such embodiments, a short antisense compound targeted 67886-67900 of comprises a nucleotide sequence selected from SEQ ID NO 846, 848, 874, or 885. In certain such embodiments, a short antisense compound targeted to nucleotides 67886-67900 of SEQ ID NO: 11 is selected from Isis No 147028, 147029, 147030, or 147031.
In certain embodiments, a target region is nucleotides 68867-68880 of SEQ ID
NO: 11. In certain
-208-embodiments, a short antisense compound is targeted to nucleotides 68867-68880 of SEQ ID NO: 11. In certain such embodiments, a short antisense compound targeted 68867-68880 of comprises a nucleotide sequence selected from SEQ ID NO 881, 869, or 883. In certain such embodiments, a short antisense compound targeted to nucleotides 68867-68880 of SEQ ID NO: 11 is selected from Isis No 147043, 147044, or 147045.
In certain embodiments, a target region is nucleotides 69013-69532 of SEQ ID
NO: 11. In certain embodiments, a short antisense compound is targeted to nucleotides 69013-69532 of SEQ ID NO: 11. In certain such embodiments, a short antisense compound targeted 69013-69532 of comprises a nucleotide sequence selected from SEQ ID NO 881, 869, 883, 858, 856, 832, or 842. In certain such embodiments, a short antisense compound targeted to nucleotides 69013-69532 of SEQ ID NO: 11 is selected from Isis No 147043, 147044, 147045, 147046, 147071, 147072, or 147073.
In certain embodiments, a target region is nucleotides 69665-69880 of SEQ ID
NO: 11. In certain embodiments, a short antisense compound is targeted to nucleotides 69665-69880 of SEQ ID NO: 11. In certain such embodiments, a short antisense compound targeted 69665-69880 of comprises a nucleotide sequence selected from SEQ ID NO 856, 832, 842, 845, or 851. In certain such embodiments, a short antisense compound targeted to nucleotides 69665-69880 of SEQ ID NO: 11 is selected from Isis No 147071, 147072, 147073, 147074, or 147066.
In certain embodiments, a target region is nucleotides 70611-70630 of SEQ ID
NO: 11. In certain embodiments, a short antisense compound is targeted to nucleotides 70611-70630 of SEQ ID NO: 11. In certain such embodiments, a short antisense compound targeted 70611-70630 of comprises a nucleotide sequence selected from SEQ ID NO 859, 841, 862, 880, 857, or 851. In certain such embodiments, a short antisense compound targeted to nucleotides 70611-70630 of SEQ ID NO: 11 is selected from Isis No 147023, 147062, 147063, 147064, 147065, or 147066.
In certain embodiments, a target region is nucleotides 70762-70776 of SEQ ID
NO: 11. In certain embodiments, a short antisense compound is targeted to nucleotides 70762-70776 of SEQ ID NO: 11. In certain such embodiments, a short antisense compound targeted 70762-70776 of comprises a nucleotide sequence selected from SEQ ID NO 862, 880, 857, or 851. In certain such embodiments, a short antisense compound targeted to nucleotides 70762-70776 of SEQ ID NO: 11 is selected from Isis No 147063, 147064, 147065, or 147066.
In certain embodiments, a target region is nucleotides 70998-71010 of SEQ ID
NO: 11. In certain embodiments, a short antisense compound is targeted to nucleotides 70998-71010 of SEQ ID NO:
11. In certain such embodiments, a short antisense compound targeted 70998-71010 of comprises a nucleotide sequence selected from SEQ ID NO 832 or 842. In certain such embodiments, a short antisense compound targeted to nucleotides 70998-71010 of SEQ ID NO: 11 is selected from Isis No 147072 or 147073.
In certain embodiments, a target region is nucleotides 71144-714364 of SEQ ID
NO: 11. In certain embodiments, a short antisense compound is targeted to nucleotides 71144-714364 of SEQ ID
NO: 11. In certain such embodiments, a short antisense compound targeted 7 1 144-7 14364 of comprises a nucleotide sequence selected from SEQ ID NO 832, 842, 845, 863, 855, or 850.
In certain such
-209-embodiments, a short antisense compound targeted to nucleotides 71144-714364 of SEQ ID NO: 11 is selected from Isis No 147072, 147073, 147074, 147037, 147038, or 147039.
In certain embodiments, a target region is nucleotides 71497-71652 of SEQ ID
NO: 11. In certain embodiments, a short antisense compound is targeted to nucleotides 71497-71652 of SEQ ID NO: 11. In certain such embodiments, a short antisense compound targeted 71497-71652 of comprises a nucleotide sequence selected from SEQ ID NO 863, 855, 850, or 879. In certain such embodiments, a short antisense compound targeted to nucleotides 71497-71652 of SEQ ID NO: 11 is selected from Isis No 147037, 147038, 147039, or 147061.

In certain embodiments, short antisense compounds targeted to a PTP1B nucleic acid are 8 to 16, preferably 9 to 15, more preferably 9 to 14, more preferably 10 to 14 nucleotides in length. In certain embodiments, short antisense compounds targeted to a PTPIB nucleic acid are 9 to 14 nucleotides in length. In certain embodiments, short antisense compounds targeted to a PTP1B
nucleic acid are 10 to 14 nucleotides in length. In certain embodiments, such short antisense compounds are short antisense oligonucleotides.
In certain embodiments, short antisense compounds targeted to a PTP1B nucleic acid are short gapmers. In certain such embodiments, short gapmers targeted to a PTP1B
nucleic acid comprise at least one high affinity modification in one or more wings of the compound. In certain embodiments, short antisense compounds targeted to a PTP1B nucleic acid comprise 1 to 3 high-affinity modifications in each wing. In certain such embodiments, the nucleosides or nucleotides of the wing comprise a 2' modification. In certain such embodiments, the monomers of the wing are BNA's.
In certain such embodiments, the monomers of the wing are selected from a-L-Methyleneoxy (4'-CHZ-O-2') BNA ,(3-D-Methyleneoxy (4'-CH2-O-2') BNA , Ethyleneoxy (4'-(CHZ)2-0-2') BNA , Aminooxy (4'-CH2-O-N(R)-2') BNA and Oxyamino (4'-CH2-N(R)-0-2') BNA. In certain embodiments, the monomers of a wing comprise a substituent at the 2' position selected from allyl, amino, azido, thio, 0-allyl, O-Cl-Clo alkyl, -OCF3, O-(CH2)2-O-CH3, 2'-O(CH2)2SCH3, O-(CHZ)Z-O-N(Rm)(Rõ), and O-CH2-C(=O)-N(Rn)(Ro), where each R. and R. is, independently, H or substituted or unsubstituted CI-CIo alkyl. In certain embodiments, the monomers of a wing are 2'MOE nucleotides.
In certain embodiments, short antisense compounds targeted to a PTP1B nucleic acid comprise a gap between the 5' wing and the 3' wing. In certain embodiments the gap comprises five, six, seven, eight, nine, ten, eleven, twelve, thirteen, or fourteen monomers. In certain embodiments, the monomers of the gap are unmodified deoxyribonucleotides. In certain embodiments, the monomers of the gap are unmodified ribonucleotides. In certain embodiments, gap modifications (if any) gap result in an antisense compound that, when bound to its target nucleic acid, supports cleavage by an RNase, including, but not limited to, RNase H.
In certain embodiments, short antisense compounds targeted to a PTP1B nucleic acid have uniform monomeric linkages. In certain such embodiments, those linkages are all phosphorothioate
-210-linkages. In certain embodiments, the linkages are all phosphodiester linkages. In certain embodiments, short antisense compounds targeted to a PTP1B nucleic acid have mixed backbones.
In certain embodiments, short antisense compounds targeted to a PTP1B nucleic acid are 8 monomers in length. In certain embodiments, short antisense compounds targeted to a PTP 1 B nucleic acid are 9 monomers in length. In certain embodiments, short antisense compounds targeted to a PTP I B
nucleic acid are 10 monomers in length. In certain embodiments, short antisense compounds targeted to a PTP1B nucleic acid are 11 monomers in length. In certain embodiments, short antisense compounds targeted to a PTP1B nucleic acid are monomers in length. In certain embodiments, short antisense compounds targeted to a PTP1B nucleic acid are 13 monomers in length. In certain embodiments, short antisense compounds targeted to a PTPIB nucleic acid are 14 monomers in length. In certain embodiments, short antisense compounds targeted to a PTP1B nucleic acid are 15 monomers in length.
In certain embodiments, short antisense compounds targeted to a PTP1B nucleic acid are 16 monomers in length. In certain embodiments, short antisense compounds targeted to a PTP1B
nucleic acid comprise 9 to 15 monomers. In certain embodiments, short antisense compounds targeted to a PTP1B nucleic acid comprise 10 to 15 monomers. In certain embodiments, short antisense compounds targeted to a PTPIB
nucleic acid comprise 12 to 14 monomers. In certain embodiments, short antisense compounds targeted to a PTP1B nucleic acid comprise 12 to 14 nucleotides or nucleosides.
In certain embodiments, the invention provides methods of modulating expression of PTP1B. In certain embodiments, such methods comprise use of one or more short antisense compound targeted to a PTP1B nucleic acid, wherein the short antisense compound targeted to a PTP1B
nucleic acid is from about 8 to about 16, preferably 9 to 15, more preferably 9 to 14, more preferably 10 to 14 monomers (i.e.
from about 8 to about 16 linked monomers). One of ordinary skill in the art will appreciate that this comprehends methods of modulating expression of PTP1B using one or more short antisense compounds targeted to a PTP1B nucleic acid of 8, 9, 10, 11, 12, 13, 14, 15 or 16 monomers.
In certain embodiments, methods of modulating PTP1B comprise use of a short antisense compound targeted to a PTP1B nucleic acid that is 8 monomers in length. In certain embodiments, methods of modulating PTP 1 B comprise use of a short antisense compound targeted to a PTP 1 B nucleic acid that is 9 monomers in length. In certain embodiments, methods of modulating PTP1B comprise use of a short antisense compound targeted to a PTP1B nucleic acid that is 10 monomers in length. In certain embodiments, methods of modulating PTP1B comprise use of a short antisense compound targeted to a PTP 1 B nucleic acid that is 11 monomers in length. In certain embodiments, methods of modulating PTP1B comprise use of a short antisense compound targeted to a PTP1B nucleic acid that is 12 monomers in length. In certain embodiments, methods of modulating PTP1B
comprise use of a short antisense compound targeted to a PTP1B nucleic acid that is 13 monomers in length. In certain embodiments, methods of modulating PTP1B comprise use of a short antisense compound targeted to a PTP1B nucleic acid that is 14 monomers in length. In certain embodiments, methods of modulating PTP1B comprise use of a short antisense compound targeted to a PTP1B nucleic acid that is 15
-211-monomers in length. In certain embodiments, methods of modulating PTP1B
comprise use of a short antisense compound targeted to a PTP1B nucleic acid that is 16 monomers in length.
In certain embodiments, methods of modulating expression of PTP1B comprise use of a short antisense compound targeted to a PTPIB nucleic acid comprising 9 to 15 monomers. In certain embodiments, methods of modulating expression of PTP1B comprise use of a short antisense compound targeted to a PTP1B nucleic acid comprising 10 to 15 monomers. In certain embodiments, methods of modulating expression of PTP1B comprise use of a short antisense compound targeted to a PTP1B
nucleic acid comprising 12 to 14 monomers. In certain embodiments, methods of modulating expression of PTP1B comprise use of a short antisense compound targeted to a PTP1B
nucleic acid comprising 12 or 14 nucleotides or nucleosides.

10. PTEN
In certain embodiments, the invention provides short antisense compounds targeted to a nucleic acid encoding PTEN. In certain embodiments, such compounds are used to modulate PTEN expression if cells. In certain such embodiments, short antisense compounds targeted to a PTEN nucleic acid are administered to an animal. In certain embodiments, short antisense compounds targeted to a PTEN
nucleic acid are useful for studying PTEN, for studying certain nucleases and/or for assessing antisense activity. In certain such embodiments, short antisense compounds targeted to PTEN nucleic acids are useful for assessing certain motifs and/or chemical modifications. In certain embodiments, administration of a short antisense compound targeted to PTEN nucleic acid to an animal results in a measurable phenotypic change.
The short antisense compounds targeting PTEN may have any one or more properties or characteristics of the short antisense compounds generally described herein.
In certain embodiments, short antisense compounds targeting a PTP1B nucleic acid have a motif (wing -deoxy gap -wing) selected from 1-12-1, 1-1-10-2, 2-10-1-1, 3-10-3, 2-10-3, 2-10-2, 1-10-1,1-10-2, 3-8-3, 2-8-2, 1-8-1, 3-6-3 or 1-6-1, more preferably 1-10-1, 2-10-2, 3-10-3, and 1-9-2.

Certain Short Antisense Compounds Targeted to a PTENNucleicAcid In certain embodiments, short antisense compounds are targeted to a PTEN
nucleic acid having the sequence of GENBANK Accession No. NM 000314.4, incorporated herein as SEQ
ID NO: 14. In certain embodiments, short antisense compounds are targeted to a PTEN nucleic acid having the sequence of nucleotides 8063255 to 8167140 of the sequence of GENBANK Accession No.
NT_033890.3, incorporated herein as SEQ ID NO: 15. In certain such embodiments, a short antisense compound targeted to SEQ ID NO: 14 is at least 90% complementary to SEQ ID NO: 14. In certain such embodiments, a short antisense compound targeted to SEQ ID NO: 14 is at least 95% complementary to SEQ ID NO: 14. In certain such embodiments, a short antisense compound targeted to SEQ ID NO: 15 is 100% complementary to SEQ ID NO: 15. In certain such embodiments, a short antisense compound
-212-targeted to SEQ ID NO: 15 is at least 90% complementary to SEQ ID NO: 15. In certain such embodiments, a short antisense compound targeted to SEQ ID NO: 15 is at least 95% complementary to SEQ ID NO: 15. In certain such embodiments, a short antisense compound targeted to SEQ ID NO: 15 is 100% complementary to SEQ ID NO: 15.
In certain embodiments, a short antisense compound targeted to SEQ ID NO: 14 comprises a nucleotide sequence selected from the nucleotide sequences set forth in Tables 20 and 21. In certain embodiments, a short antisense compound targeted to SEQ ID NO: 15 comprises a nucleotide sequence selected from the nucleotide sequences set forth in Tables 22 and 23.
Each nucleotide sequence set forth in Tables 20, 21, 22, and 23 is independent of any modification to a sugar moiety, an internucleoside linkage, or a nucleobase.
As such, short antisense compounds comprising a nucleotide sequence as set forth in Tables 20, 21, 22, and 23 may comprise, independently, one or more modifications to a sugar moiety, an internucleoside linkage, or a nucleobase.
Antisense compounds described by Isis Number (Isis NO.) indicate a combination of nucleobase sequence and one or more modifications to a sugar moiety, an internucleoside linkage, or a nucleobase.
Table 20 illustrates short antisense compounds that are 100% complementary to SEQ ID NO: 14.
Table 22 illustrates short antisense compounds that are 100% complementary to SEQ ID NO: 15. The column labeled `gapmer motif indicates the wing-gap-wing motif of each short antisense compounds.
The gap segment comprises 2'-deoxynucleotides and each nucleotide of each wing segment comprises a 2'-modifed sugar. The particular 2'-modified sugar is also indicated in the `gapmer motif column. For example, `2-10-2 MOE' means a 2-10-2 gapmer motif, where a gap segment of ten 2'-deoxynucleotides is flanked by wing segments of two nucleotides, where the nucleotides of the wing segments are 2'-MOE
nucleotides. Internucleoside linkages are phosphorothioate. The short antisense compounds comprise 5-methylcytidine in place of unmodified cytosine, unless "unmodified cytosine"
is listed in the gapmer motif column, in which case the indicated cytosines are unmodified cytosines.
For example, "5-mC in gap only" indicates that the gap segment has 5-methylcytosines, while the wing segments have unmodified cytosines.
The 2'-modified nucleotides and abbreviations include: 2'-O-methoxyethyl (MOE); 2'-O-methyl (OMe); 2'-O-(2,2,3,3,3-pentafluoropropyl) (PentaF); 2'-O-[(2-methoxy)ethyl]-4'-thio (2'-MOE-4'-thio);.
(R)-CMOE-BNA. As illustrated in Tables 20 and 22, a wing may comprise monomers comprising more than type of 2' substituent. For example, 1-2-10-2 MOE/PentaF/MOE indicates one MOE-modified nucleotide, followed by two PentaF-modified nucleotides, followed by a gap of ten deoxynucleotides, followed by two PentaF-modified nucleotides. For example, 1-1-10-2 2'-(butylacetomido)-palmitamide Methyleneoxy BNA/Methyleneoxy BNA indicates that the 5'-most nucleotide is 2'-(butylacetomide)-palmitamide, the second nucleotide is a methyleneoxy BNA nucleotide, and the 3' wing is methyleneoxy BNA. Unless otherwise indicated, cytosines are 5-methylcytosines and internucleoside linkages are phosphorothioate.
-213-Table 20: Short Antisense Compounds Targeted to SEQ ID NO: 14 5' 3' INo Target Target Sequence (5'-3') Gapmer Motif SEQ
Site Site NO

2-10-2 Methyleneoxy BNA
392067 4832 4845 CTGCTGCACATCCA Unmodified cytosines in gap 1510 390075 4576 4587 GTAAGCAAGGCT 1-10-1 MOE #N/A
-214-390430 2099 2111 GCTAGCCTCTGGA Unmodified cytosines 1163 Unmodified cytosines 390431 2099 2111 GCTAGCCTCTGGA C in wing 9- 1163
-215-(aminoethox ) henoxazine Unmodified cytosines 390433 2099 2111 GCTAGCCTCTGGA Nt 6 is 9-(aminoethox ) henoxazine 1163 Unmodified cytosines 390434 2099 2111 GCTAGCCTCTGGA Nt 7 is 9-(aminoethoxy)phenoxazine 1163 Unmodified cytosines 390435 2099 2111 GCTAGCCTCTGGA Nt 9 is 9-(aminoethoxy)phenoxazine 1163 335367 2097 2110 CTAGCCTCTGGATT 2-10-2 Meth leneox BNA 1431 335378 2097 2110 CTAGCCTCTGGATT 2-10-2 Methyleneoxy BNA 1431 2-10-2 Methyleneoxy BNA
392061 2097 2110 CTAGCCTCTGGATT Unrnodified cytosines in gap 1431 2'-(acetylamino-butyl-acetamido)-383991 2097 2109 TAGCCTCTGGATT cholesterol/MOE 1432 2'-(acetylamino-butyl-acetamido)-383992 2097 2109 TAGCCTCTGGATT cholic acid/MOE 1432 Unmodified cytosines 390578 2097 2109 TAGCCTCTGGATT Ts in wings are 2-thiothymines 1432 390614 2097 2109 TAGCCTCTGGATT 1-10-2 PentaF 1432 1-10-2 2'-(butylacetamido)-386683 2097 2109 TAGCCTCTGGATT palmitamide/MOE 1432 3-10-3 Methyleneoxy BNA
335368 2096 2111 GCTAGCCTCTGGATTT Phosphodiester linkages in wings 1428 335379 2096 2111 GCTAGCCTCTGGATTT 3-10-3 Methyleneoxy BNA 1428 383739 2096 2111 GCTAGCCTCTGGATTT 5-methylcytosine in gap 1428 3-10-3 OMe 384071 2096 2111 GCTAGCCTCTGGATTT 5-methylcytosine in gap 1428 3-10-3 Methyleneoxy BNA
384073 2096 2111 GCTAGCCTCTGGATTT 5-methylcytosine in gap 1428 5-methylcytosine in gap 390576 2096 2111 GCTAGCCTCTGGATTT T's in wings are 2-thiothymines 1428 Pyrimidines in wings are 5-thiazole 390580 2096 2111 GCTAGCCTCTGGATTT Unmodified cytosines in gap 1428 390581 2096 2111 GCTAGCCTCTGGATTT Unmodified cytosines in gap 1428
-216-391863 2096 2111 GCTAGCCTCTGGATTT Unmodified cytosines 1428 3-10-3 Methyleneoxy BNA
391864 2096 2111 GCTAGCCTCTGGATTT Unmodified cytosines in gap 1428 3-10-3 Methyleneoxy BNA
391865 2096 2111 GCTAGCCTCTGGATTT Unmodified cytosines 1428 2-10-2 Methyleneoxy BNA
391172 2096 2110 CTAGCCTCTGGATTT Unmodified cytosines 1429 391175 2096 2110 CTAGCCTCTGGATTT 2-10-3 Methyleneoxy BNA 1429 391449 2096 2110 CTAGCCTCTGGATTT Unmodified cytosines 1429 2-10-3 Methyleneoxy BNA
392054 2096 2110 CTAGCCTCTGGATTT Unmodified cytosines in gap 1429 392055 2096 2110 CTAGCCTCTGGATTT Unmodified cytosines in gap 1429 Unmodified cytosines 390577 2096 2109 TAGCCTCTGGATTT T's in wings are 2-thiothymines 1427 1-1-1-10-3 MOE/4'-thio/2'-O-[(2-methoxy)ethyl]-4'-th io/2'-O-[(2-m eth oxy )et h yl ]-4'-t h i o Unmodified cytosines in wings 390579 2096 2111 GCTAGCCTCTGGATTT Phosphorodiester linkage in wings 1428 2-10-3 (5'R)-5'-methyl-Methyleneoxy BNA
391173 2096 2110 CTAGCCTCTGGATTT Unmodified cytosines 1429 2-10-3 (5'S)-5'-methyl-Methyleneoxy BNA
391174 2096 2110 CTAGCCTCTGGATTT Unmodified cytosines 1429 390607 2096 2111 GCTAGCCTCTGGATTT 3-10-3 MOE/pentaF 1428 Unmodified cytosines in wing 390609 2096 2111 GCTAGCCTCTGGATTT 3-10-2-1 MOE/MOE/pentaF 1428 Unmodified cytosines in wing 384072 2096 2111 GCTAGCCTCTGGATTT 1-2-10-3 MOE/pentaF/pentaF 1428 Unmodified cytosines in wings 390606 2096 2111 GCTAGCCTCTGGATTT 1-2-10-3 MOE/pentaF/pentaF 1428 Unmodified cytosines in wing 390608 2096 2111 GCTAGCCTCTGGATTT 1-2-10-3 MOE/pentaF/pentaF 1428 Unmodified cytosines in wing 391869 2096 2111 GCTAGCCTCTGGATTT 1-2-10-3 Methyleneoxy BNA / 5'S - 1428 5'-methyl- Methyleneoxy BNA
/(5'S)-5'-methyl- Methyleneoxy BNA
Unmodified cytosines 385036 2096 2111 GCTAGCCTCTGGATTT 1-2-10-3 OMe/2'-O-methyl-4'- 1428 thio/2'-O-methyl-4'-thio Unmodified cytosines in wing 385871 2096 2111 GCTAGCCTCTGGATTT 1-2-10-3 OMe/ 2'-O-[(2- 1428 methoxy)ethyl]-4'-thio/ 2'-O-[(2-methoxy)ethyl]-4'-thio Unmodified cytosines in wing
-217-386682 2096 2111 GCTAGCCTCTGGATTT 1-2-10-3 2'-(butylacetamido)- 1428 palmitamide /MOE /MOE
390582 2096 2111 GCTAGCCTCTGGATTT 1-2-10-3 MOE/2'-O-[(2- 1428 methoxy)ethyl]-4'-thio / 2'-O-[(2-methoxy)ethyl]-4'-thio Unmodified cytosines in wings Phos hodiester linkage in wings 391868 2096 2111 GCTAGCCTCTGGATTT 1-2-10-3 (5'R)-5'-methyl- 1428 Methyleneoxy BNA / Methyleneoxy BNA /(5'R)-5'-methyl-Methyleneoxy BNA
Unmodified cytosines 335376 2095 2109 TAGCCTCTGGATTTG 1-10-4 Meth leneox BNA 1426 1-10-4 Methyleneoxy BNA
335377 2095 2109 TAGCCTCTGGATTTG Phosphodiester in 3' wing 1426
-218-2-10-2 Methyleneoxy BNA
392060 1675 1688 CTGGCAGACCACAA Unmodified cytosines in gap 1380 335355 1503 1516 TCTCTGGTCCTTAC Phosphodiester linkage in wings 1363 335370 1503 1516 TCTCTGGTCCTTAC 2-10-2 Methyleneoxy BNA 1363
-219-Phos hodiester linkage in wings 335381 1503 1516 TCTCTGGTCCTTAC 2-10-2 Meth leneox BNA 1363 335411 1503 1516 TCTCTGGTCCTTAC 3' C is 9- aminoethox ) henoxazine 1363 C in 5' wing is 9-335412 1503 1516 TCTCTGGTCCTTAC (aminoethoxy) henoxazine 1363 C in wings are 335413 1503 1516 TCTCTGGTCCTTAC 9-(aminoethoxy)phenoxazine 1363 335356 1502 1517 GTCTCTGGTCCTTACT Phosphodiester linkage in wings 1362 3-10-3 Methyleneoxy BNA
335371 1502 1517 GTCTCTGGTCCTTACT Phosphodiester linkage in wings 1362 335382 1502 1517 GTCTCTGGTCCTTACT 3-10-3 Methyleneoxy BNA 1362 C in 3' wing is 9-335414 1502 1517 GTCTCTGGTCCTTACT (aminoethox ) henoxazine 1362 C in 5' wing is 9-335415 1502 1517 GTCTCTGGTCCTTACT aminoethox henoxazine 1362 C's in wings are 335416 1502 1517 GTCTCTGGTCCTTACT 9-(anminoethoxy)phenoxazine 1362
-220-
-221-2-10-2 Methyleneoxy BNA
392059 1055 1068 TGTTTCTGCTAACG Unmodified cytosines in gap 1291 2-10-2 Methyleneoxy BNA
392058 1020 1033 ATGTCTGGGAGCCT Unmodified cytosines in gap 1285 392056 204 217 TCATGGCTGCAGCT 2-10-2 Methyleneoxy BNA 1263 2-10-2 (R)-CMOE BNA
396007 204 217 TCATGGCTGCAGCT Unmodified cytosines 1263
-222-2-10-2 (S)-CMOE BNA
396008 204 217 TCATGGCTGCAGCT Unmodified cytosines 1263 2-10-2 a-L-methyleneoxy BNA
396009 204 217 TCATGGCTGCAGCT Unmodified cytosines 1263 2-10-2 Oxyamino BNA
396566 204 217 TCATGGCTGCAGCT Unmodified cytosines 1263 2-10-2 N-Methyl-Oxyamino BNA
396567 204 217 TCATGGCTGCAGCT Unmodified cytosines 1263 2-10-2 (6R)-6-Methyl Methyleneoxy BNA
396568 204 217 TCATGGCTGCAGCT Unmodified cytosines 1263 2-10-2 OMe 397913 204 217 TCATGGCTGCAGCT Unmodified cytosines in gap 1263 2-10-2 OMe 401974 204 217 TCATGGCTGCAGCT Unrnodified cytosines 1263 2-10-2 Methyleneoxy BNA
403737 204 217 TCATGGCTGCAGCT 5-thiazole nucleobases in wings 1263 2-10-2 Methyleneoxy BNA
5-methylcytosine in gaps 404121 204 217 TCATGGCTGCAGCT 3' Terminal THF phosphorothioate 1263 2-10-2 Methyleneoxy BNA
5-methylcytosinse in gaps 404228 204 217 TCATGGCTGCAGCT 5'-terminal reverse abasic 1263 2-10-2 (6'S)-6'-methyl-Methyleneoxy BNA
396024 204 217 TCATGGCTGCAGCT Unmodified cytosines 1263 2-10-2 (5'S)-5'-methyl-Methyleneoxy BNA
396569 204 217 TCATGGCTGCAGCT Unmodified cytosines 1263 2-10-1-1 Methyleneoxy BNA /
Methyleneoxy BNA /2'-(butylacetamido)-palmitamide/
396577 204 217 TCATGGCTGCAGCT Unmodified cytosines in gap 1263 396576 204 217 TCATGGCTGCAGCT 1-1-10-2 2'-(butylacetamido)- 1263 palmitamide/ Methyleneoxy BNA /
Methyleneoxy BNA
Unmodified cytosines in gap Table 22: Short Antisense Compounds targeted to SEQ ID NO: 15 ISIS 5' 3' Sequence (5'-3') Gapmer Motif SEQ
No. Target Target ID
Site Site NO
-223-2-10-2 OMe 397913 604 617 TCATGGCTGCAGCT Unmodified cytosines in gap 1263 2-10-2 Ome 401974 604 617 TCATGGCTGCAGCT Unmodified cytosines 1263 2-10-2 Methyleneoxy BNA
5-thiazole nucleobases in 403737 604 617 TCATGGCTGCAGCT wings 1263 2-10-2 Methyleneoxy BNA
392056 604 617 TCATGGCTGCAGCT Unmodified cytosines in gap 1263 1-1-10-2 2'-(butylacetamido)-palmitamide / Methyleneoxy BNA / Methyleneoxy BNA
396576 604 617 TCATGGCTGCAGCT Unmodified cytosines in gap 1263 2-10-1-2 Methyleneoxy BNA / Methyleneoxy BNA
/2'-(butylacetamido)-palmitamide/
396577 604 617 TCATGGCTGCAGCT Unrnodified cytosines in gap 1263 2-10-2 Methyleneoxy BNA
5-methylcytosine in gaps 3' Terminal THF
404121 604 617 TCATGGCTGCAGCT phosphorothioate 1263 2-10-2 Methyleneoxy BNA
5-methylcytosinse in gaps 404228 604 617 TCATGGCTGCAGCT 5'-terminal reverse abasic 1263 2-10-2 (R)-CMOE BNA
396007 604 617 TCATGGCTGCAGCT Unmodified cytosines 1263 2-10-2 (S)-CMOE BNA
396008 604 617 TCATGGCTGCAGCT Unmodified cytosines 1263 2-10-2 a-L-methyleneoxy BNA
396009 604 617 TCATGGCTGCAGCT Unmodified cytosines 1263 2-10-2 (6'S)-6'-methyl-Methyleneoxy BNA
396024 604 617 TCATGGCTGCAGCT Unmodified cytosines 1263 2-10-2 Oxyamino BNA
396566 604 617 TCATGGCTGCAGCT Unmodified cytosines 1263 2-10-2 N-Methyl-Oxyamino BNA
396567 604 617 TCATGGCTGCAGCT Unmodified cytosines 1263 2-10-2 (6R)-6-Methyl Methyleneoxy BNA
396568 604 617 TCATGGCTGCAGCT Unmodified cytosines 1263 2-10-2 (5'S)-5'-methyl-Methyleneoxy BNA
396569 604 617 TCATGGCTGCAGCT Unmodified cytosines 1263
-224-2-10-2 Methyleneoxy BNA
392058 1420 1433 ATGTCTGGGAGCCT 5-methylcytosine in wing 1285 2-10-2 Methyleneoxy BNA
392059 1455 1468 TGTTTCTGCTAACG 5-methylcytosine in wing 1291
-225-
-226-Phosphodiester linkage in 335356 70161 70176 GTCTCTGGTCCTTACT wings 1362 C in 3' wing is 9-335414 70161 70176 GTCTCTGGTCCTTACT (aminoethoxy) henoxazine 1362 C in 5' wing is 9-335415 70161 70176 GTCTCTGGTCCTTACT (aminoethoxy)phenoxazine 1362 C's in wings are 335416 70161 70176 GTCTCTGGTCCTTACT (aminoethoxy)phenoxazine 1362
-227-3-10-3 Methyleneoxy BNA
Phosphodiester linkage in 335371 70161 70176 GTCTCTGGTCCTTACT wings 1362 335382 70161 70176 GTCTCTGGTCCTTACT 3-10-3 Methyleneoxy BNA 1362 Phosphodiester linkage in 335355 70162 70175 TCTCTGGTCCTTAC wings 1363 3' C is 9-335411 70162 70175 TCTCTGGTCCTTAC (aminoethoxy) henoxazine 1363 2 d C is 9-335412 70162 70175 TCTCTGGTCCTTAC (aminoethoxy) henoxazine 1363 2 d and 3' terminal C's are 335413 70162 70175 TCTCTGGTCCTTAC (aminoethoxy)phenoxazine 1363 2-10-2 Methyleneoxy BNA
Phosphodiester linkage in 335370 70162 70175 TCTCTGGTCCTTAC wings 1363 335381 70162 70175 TCTCTGGTCCTTAC 2-10-2 Meth leneox BNA 1363 2-10-2 Methyleneoxy BNA
392060 94790 94803 CTGGCAGACCACAA Unmodified cytosines in gap 1380
-228-
-229-1-10-4 Methyleneoxy BNA
335377 102252 102266 TAGCCTCTGGATTTG Phosphodiester in 3' wing 1426 335376 102252 102266 TAGCCTCTGGATTTG 1-10-4 Meth leneox BNA 1426 Unmodified cytosines T's in wings are 2-390577 102253 102266 TAGCCTCTGGATTT thiothymines 1427 391449 102253 102267 CTAGCCTCTGGATTT Unmodified cytosines 1429 392055 102253 102267 CTAGCCTCTGGATTT Unmodified cytosines in gap 1429 383739 102253 102268 GCTAGCCTCTGGATTT 5-meth Ic osine in gap 1428 5-methylcytosine in gap T's in wings are 2-390576 102253 102268 GCTAGCCTCTGGATTT thiothymines 1428 Pyrimidines in wings are 5-thiazole 390580 102253 102268 GCTAGCCTCTGGATTT Unmodified cytosines in gap 1428 390581 102253 102268 GCTAGCCTCTGGATTT Unmodified cytosines in gap 1428 391863 102253 102268 GCTAGCCTCTGGATTT Unmodified cytosines 1428 3-10-3 OMe 384071 102253 102268 GCTAGCCTCTGGATTT 5-methylcytosine in gap 1428 1-2-10-3 OMe/2'-O-methyl-4'-thio/2'-O-methyl-4'-thio Unmodified cytosines in 385036 102253 102268 GCTAGCCTCTGGATTT wing 1428 3-10-3 Methyleneoxy BNA
Phosphodiester linkages in 335368 102253 102268 GCTAGCCTCTGGATTT wings 1428 3-10-3 Methyleneoxy BNA
391864 102253 102268 GCTAGCCTCTGGATTT Unmodified cytosines in gap 1428 2-10-3 Methyleneoxy BNA
392054 102253 102267 CTAGCCTCTGGATTT Unmodified cytosines in gap 1429 2-10-3 Methyleneoxy BNA
391172 102253 102267 CTAGCCTCTGGATTT Unmodified cytosines 1429 3-10-3 Methyleneoxy BNA
391865 102253 102268 GCTAGCCTCTGGATTT Unmodified cytosines 1428 1-2-10-3 (5'R)-5'-methyl-Methyleneoxy BNA /
391868 102253 102268 GCTAGCCTCTGGATTT Methyleneoxy BNA /(5'R)- 1428
-230-5'-methyl- Methyleneoxy BNA
Unmodified cytosines 1-2-10-3 Methyleneoxy BNA /(5'S)-5'-methyl-Methyleneoxy BNA /(5'S)-5'-methyl- Methyleneoxy BNA
391869 102253 102268 GCTAGCCTCTGGATTT Unmodified cytosines 1428 3-10-3 Methyleneoxy BNA
384073 102253 102268 GCTAGCCTCTGGATTT 5-meth lc osine in gap 1428 335379 102253 102268 GCTAGCCTCTGGATTT 3-10-3 Methyleneoxy BNA 1428 1-1-1-10-3 MOE/4'thio/2'-O-[(2-methoxy)ethyl]-4'-thio/2'-O-[(2-methoxy)ethyl]-4'-thio Unmodified cytosines in wings Phosphorodiester linkage in 390579 102253 102268 GCTAGCCTCTGGATTT wings 1428 1-2-10-3 MOE/4'thio/2'-O-[(2-methoxy)ethyl]-4'-thio Unmodified cytosines in wings Phosphorodiester linkage in 390582 102253 102268 GCTAGCCTCTGGATTT wings 1428 MOE/pentaF/pentaF
Unrnodified cytosines in wings Phosphodiester linkage in 390606 102253 102268 GCTAGCCTCTGGATTT wings 1428 MOE/pentaF/pentaF
Unmodified cytosines in 384072 102253 102268 GCTAGCCTCTGGATTT wings 1428 1-2-10-3 OMe/ 2'-O-[(2-methoxy)ethyl]-4'-thio/ 2'-O-[(2-methoxy)ethyl]-4'-thio Unmodified cytosines in 385871 102253 102268 GCTAGCCTCTGGATTT wing 1428 3-10-3 MOE/pentaF
Unmodified cytosines in 390607 102253 102268 GCTAGCCTCTGGATTT wing 1428 MOE/pentaF/pentaF
Unmodified cytosines in 390608 102253 102268 GCTAGCCTCTGGATTT win 1428 3-10-2-1 MOE/MOE/pentaF
Unrnodified cytosines in 390609 102253 102268 GCTAGCCTCTGGATTT wing 1428 1-2-10-3 2'-(butylacetamido)-386682 102253 102268 GCTAGCCTCTGGATTT palmitamide /MOE /MOE 1428 391173 102253 102267 CTAGCCTCTGGATTT 2-10-3 (5'R)-5'-meth v1- 1429
-231-Methyleneoxy BNA
Unmodified cytosines 2-10-3 (5'S)-5'-methyl-Methyleneoxy BNA
391174 102253 102267 CTAGCCTCTGGATTT Unmodified cytosines 1429 Unmodified cytosines Ts in wings are 2-390578 102254 102266 TAGCCTCTGGATT thiothyniines 1432 2-10-2 Methyleneoxy BNA
Phosphodiester linkages in 335367 102254 102267 CTAGCCTCTGGATT wings 1431 2-10-2 Methyleneoxy BNA
392061 102254 102267 CTAGCCTCTGGATT Unmodified cytosines in gap 1431 335378 102254 102267 CTAGCCTCTGGATT 2-10-2 Methyleneoxy BNA 1431 2'-(acetylamino-butyl-acetamido)-cholesterol 2'-(acetylamino-butyl-383992 102254 102266 TAGCCTCTGGATT acetamido)-cholic acid/MOE 1432 5' terminal 2'-(butylacetamido)-386683 102254 102266 TAGCCTCTGGATT palmitamide/MOE 1432 390614 102254 102266 TAGCCTCTGGATT 1-10-2 PentaF 1432 390430 102256 102268 GCTAGCCTCTGGA Unmodified cytosines 1163 Unmodified cytosines C in wing 9-390431 102256 102268 GCTAGCCTCTGGA (aminoethoxy)phenoxazine 1163 Unmodified cytosines Nt 6 is 9-390433 102256 102268 GCTAGCCTCTGGA (aminoethoxy)phenoxazine 1163 Unmodified cytosines Nt 7 is 9-390434 102256 102268 GCTAGCCTCTGGA (aminoethoxy)phenoxazine 1163 Unmodified cytosines Nt9is9-390435 102256 102268 GCTAGCCTCTGGA (aminoethoxy)phenoxazine 1163
-232-
-233-Salts, prodrugs and bioequivalents The antisense compounds provided herein comprise any pharmaceutically acceptable salts, esters, or salts of such esters, or any other functional chemical equivalent which, upon administration to an animal including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, for example, the disclosure is also drawn to prodrugs and pharmaceutically acceptable salts of the antisense compounds, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents.
The term "prodrug" indicates a therapeutic agent that is prepared in an inactive or less active form that is converted to an active form (i.e., drug) within the body or cells thereof by the action of endogenous enzymes, chemicals, and/or conditions. In particular, prodrug versions of the oligonucleotides are prepared as SATE ((S-acetyl-2-thioethyl) phosphate) derivatives according to the methods disclosed in WO 93/24510 or WO 94/26764. Prodrugs can also include antisense compounds wherein one or both ends comprise nucleobases that are cleaved (e.g., by incorporating phosphodiester backbone linkages at the ends) to produce the active compound. In certain embodiments, one or more non-drug moieties is cleaved from a prodrug to yield the active form. In certain such embodiments, such non-drug moieties is not a nucleotide or oligonucleotide.
The term "pharmaceutically acceptable salts" refers to physiologically and pharmaceutically acceptable salts of the compounds described herein: i.e., salts that retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto.
Sodium salts of antisense oligonucleotides are useful and are well accepted for therapeutic administration to humans.
In certain- embodiments, salts, including, but not limited to sodium salts, of double stranded
-234-nucleic acids (including but not limited to dsRNA compounds) are also provided.
G. Certain Pharmaceutical Compositions In certain embodiments, pharmaceutical compositions of the present invention comprise one or more short antisense compound and one or more excipients. In certain such embodiments, excipients are selected from water, salt solutions, alcohol, polyethylene glycols, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose and polyvinylpyrrolidone.
In certain embodiments, a pharmaceutical composition of the present invention is prepared using known techniques, including, but not limited to mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping or tabletting processes.
In certain embodiments, a pharmaceutical composition of the present invention is a liquid (e.g., a suspension, elixir and/or solution). In certain of such embodiments, a liquid pharmaceutical composition is prepared using ingredients known in the art, including, but not limited to, water, glycols, oils, alcohols, flavoring agents, preservatives, and coloring agents.
In certain embodiments, a pharmaceutical composition of the present invention is a solid (e.g., a powder, tablet, and/or capsule). In certain of such embodiments, a solid pharmaceutical composition comprising one or more oligonucleotides is prepared using ingredients known in the art, including, but not limited to, starches, sugars, diluents, granulating agents, lubricants, binders, and disintegrating agents.
In certain embodiments, a pharmaceutical composition of the present invention is formulated as a depot preparation. Certain such depot preparations are typically longer acting than non-depot preparations. In certain embodiments, such preparations are administered by implantation (for example subcutaneously or intramuscularly) or by intramuscular injection. In certain embodiments, depot preparations are prepared using suitable polymeric or hydrophobic materials (for example an emulsion in an acceptable oil) or ion exchange resins, or as sparingly soluble derivatives, for example, as a sparingly soluble salt.
In certain embodiments, a pharmaceutical composition of the present invention comprises a delivery system. Examples of delivery systems include, but are not limited to, liposomes and emulsions.
Certain delivery systems are useful for preparing certain pharmaceutical compositions including those comprising hydrophobic compounds. In certain embodiments, certain organic solvents such as dimethylsulfoxide are used.
In certain embodiments, a pharmaceutical composition of the present invention comprises one or more tissue-specific delivery molecules designed to deliver the one or more pharmaceutical agents of the present invention to specific tissues or cell types. For example, in certain embodiments, pharmaceutical compositions include liposomes coated with a tissue-specific antibody.
In certain embodiments, a phannaceutical composition of the present invention comprises a co-solvent system. Certain of such co-solvent systems comprise, for example, benzyl alcohol, a nonpolar surfactant, a water-miscible organic polymer, and an aqueous phase. In certain embodiments, such co-
-235-solvent systems are used for hydrophobic compounds. A non-limiting example of such a co-solvent system is the VPD co-solvent system, which is a solution of absolute ethanol comprising 3% w/v benzyl alcohol, 8% w/v of the nonpolar surfactant Polysorbate 80.TM., and 65% w/v polyethylene glycol 300.
The proportions of such co-solvent systems may be varied considerably without significantly altering their solubility and toxicity characteristics. Furthermore, the identity of co-solvent components may be varied: for example, other surfactants may be used instead of Polysorbate 80.TM.; the fraction size of polyethylene glycol may be varied; other biocompatible polymers may replace polyethylene glycol, e.g., polyvinyl pyrrolidone; and other sugars or polysaccharides may substitute for dextrose.
In certain embodiments, a phannaceutical composition of the present invention comprises a sustained-release system. A non-limiting example of such a sustained-release system is a semi-permeable matrix of solid hydrophobic polymers. In certain embodiments, sustained-release systems may, depending on their chemical nature, release pharmaceutical agents over a period of hours, days, weeks or months.
In certain embodiments, a pharmaceutical composition of the present invention is prepared for oral administration. In certain of such embodiments, a pharmaceutical composition is formulated by combining one or more oligonucleotides with one or more pharmaceutically acceptable carriers. Certain of such carriers enable pharmaceutical compositions to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions and the like, for oral ingestion by a subject. In certain embodiments, pharmaceutical compositions for oral use are obtained by mixing oligonucleotide and one or more solid excipient. Suitable excipients include, but are not limited to, fillers, such as sugars, including lactose, sucrose, mannitol, or sorbitol; cellulose preparations such as, for example, maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose, hydroxypropylmethyl-cellulose, sodium carboxymethylcellulose, and/or polyvinylpyrrolidone (PVP).
In certain embodiments, such a mixture is optionally ground and auxiliaries are optionally added. In certain embodiments, pharmaceutical compositions are formed to obtain tablets or dragee cores. In certain embodiments, disintegrating agents (e.g., cross-linked polyvinyl pyrrolidone, agar, or alginic acid or a salt thereof, such as sodium alginate) are added.
In certain embodiments, dragee cores are provided with coatings. In certain such embodiments, concentrated sugar solutions may be used, which may optionally comprise gum arabic, talc, polyvinyl pyrrolidone, carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures. Dyestuffs or pigments may be added to tablets or dragee coatings.
In certain embodiments, pharmaceutical compositions for oral administration are push-fit capsules made of gelatin. Certain of such push-fit capsules comprise one or more pharmaceutical agents of the present invention in admixture with one or more filler such as lactose, binders such as starches, and/or lubricants such as talc or magnesium stearate and, optionally, stabilizers. In certain embodiments, phannaceutical compositions for oral administration are soft, sealed capsules made of gelatin and a plasticizer, such as glycerol or sorbitol. In certain soft capsules, one or more pharmaceutical agents of the present invention are be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or
-236-liquid polyethylene glycols. In addition, stabilizers may be added.
In certain embodiments, pharmaceutical compositions are prepared for buccal administration.
Certain of such pharmaceutical compositions are tablets or lozenges formulated in conventional manner.
In certain embodiments, a pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, etc.). In certain of such embodiments, a pharmaceutical composition comprises a carrier and is formulated in aqueous solution, such as water or physiologically compatible buffers such as Hanks's solution, Ringer's solution, or physiological saline buffer. In certain embodiments, other ingredients are included (e.g., ingredients that aid in solubility or serve as preservatives). In certain embodiments, injectable suspensions are prepared using appropriate liquid carriers, suspending agents and the like. Certain pharmaceutical compositions for injection are presented in unit dosage form, e.g., in ampoules or in multi-dose containers. Certain pharmaceutical compositions for injection are suspensions, solutions or emulsions in oily or aqueous vehicles, and may comprise formulatory agents such as suspending, stabilizing and/or dispersing agents.
Certain solvents suitable for use in pharmaceutical compositions for injection include, but are not limited to, lipophilic solvents and fatty oils, such as sesame oil, synthetic fatty acid esters, such as ethyl oleate or triglycerides, and liposomes. Aqueous injection suspensions may comprise substances that increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran.
Optionally, such suspensions may also comprise suitable stabilizers or agents that increase the solubility of the pharmaceutical agents to allow for the preparation of highly concentrated solutions.
In certain embodiments, a pharmaceutical composition is prepared for transmucosal administration. In certain of such embodiments penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art.
In certain embodiments, a pharmaceutical composition is prepared for administration by inhalation. Certain of such pharmaceutical compositions for inhalation are prepared in the form of an aerosol spray in a pressurized pack or a nebulizer. Certain of such pharmaceutical compositions comprise a propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas. In certain embodiments using a pressurized aerosol, the dosage unit may be determined with a valve that delivers a metered amount. In certain embodiments, capsules and cartridges for use in an inhaler or insufflator may be formulated. Certain of such formulations comprise a powder mixture of a pharmaceutical agent of the invention and a suitable powder base such as lactose or starch.
In certain embodiments, a pharmaceutical composition is prepared for rectal administration, such as a suppositories or retention enema. Certain of such pharmaceutical compositions comprise known ingredients, such as cocoa butter and/or other glycerides.
In certain embodiments, a pharmaceutical composition is prepared for topical administration.
Certain of such pharmaceutical compositions comprise bland moisturizing bases, such as ointments or creams. Exemplary suitable ointment bases include, but are not limited to, petrolatum, petrolatum plus volatile silicones, lanolin and water in oil emulsions such as Eucerin.TM., available from Beiersdorf
-237-(Cincinnati, Ohio). Exemplary suitable cream bases include, but are not limited to, Nivea.TM. Cream, available from Beiersdorf (Cincinnati, Ohio), cold cream (USP), Purpose Cream.TM., available from Johnson & Johnson (New Brunswick, N.J.), hydrophilic ointment (USP) and Lubridenn.TM., available from Pfizer (Morris Plains, N.J.).
In certain embodiments, a pharmaceutical composition of the present invention comprises an oligonucleotide in a therapeutically effective amount. In certain embodiments, the therapeutically effective amount is sufficient to prevent, alleviate or ameliorate symptoms of a disease or to prolong the survival of the subject being treated. Determination of a therapeutically effective amount is well within the capability of those skilled in the art.
In certain embodiments, one or more short antisense compound of the present invention is formulated as a prodrug. In certain embodiments, upon in vivo administration, a prodrug is chemically converted to the biologically, pharmaceutically or therapeutically more active form of the short antisense compound. In certain embodiments, prodrugs are useful because they are easier to administer than the corresponding active form. For example, in certain instances, a prodrug may be more bioavailable (e.g., through oral administration) than is the corresponding active form. In certain instances, a prodrug may have improved solubility compared to the corresponding active form. In certain embodiments, prodrugs are less water soluble than the corresponding active form. In certain instances, such prodrugs possess superior transmittal across cell membranes, where water solubility is detrimental to mobility. In certain embodiments, a prodrug is an ester. In certain such embodiments, the ester is metabolically hydrolyzed to carboxylic acid upon administration. In certain instances the carboxylic acid containing compound is the corresponding active form. In certain embodiments, a prodrug comprises a short peptide (polyaminoacid) bound to an acid group. In certain of such embodiments, the peptide is cleaved upon administration to form the corresponding active form.
In certain embodiments, a prodrug is produced by modifying a pharmaceutically active compound such that the active compound will be regenerated upon in vivo administration. The prodrug can be designed to alter the metabolic stability or the transport characteristics of a drug, to mask side effects or toxicity, to improve the flavor of a drug or to alter other characteristics or properties of a drug.
By virtue of knowledge of pharmacodynamic processes and drug metabolism in vivo, those of skill in this art, once a pharmaceutically active compound is known, can design prodrugs of the compound (see, e.g., Nogrady (1985) Medicinal Chemistry A Biochemical Approach, Oxford University Press, New York, pages 388-392).
In certain embodiments, a pharmaceutical composition comprising one or more pharmaceutical agents of the present invention is useful for treating a conditions or disorders in a mammalian, and particularly in a human, subject. Suitable administration routes include, but are not limited to, oral, rectal, transmucosal, intestinal, enteral, topical, suppository, through inhalation, intrathecal, intraventricular, intraperitoneal, intranasal, intraocular and parenteral (e.g., intravenous, intramuscular, intramedullary, and subcutaneous). In certain embodiments, pharmaceutical intrathecals are administered to achieve local
-238-rather than systemic exposures. For example, pharmaceutical compositions may be injected directly in the area of desired effect (e.g., in the renal or cardiac area).
In certain embodiments, short antisense compounds, compared to their parent oligonucleotides, make them particularly suited to oral administration. In certain embodiments, short antisense compounds are better suited for oral administration than their parent oligonucleotides because they have increased potency compared to those parent oligonucleotides. In certain embodiments, short antisense compounds are better suited for oral administration than their parent oligonucleotides because they have better stability, availability or solubility properties compared to those parent oligonucleotides.
In a further aspect, a pharmaceutical agent is sterile lyophilized oligonucleotide that is reconstituted with a suitable diluent, e.g., sterile water for injection. The reconstituted product is administered as a subcutaneous injection or as an intravenous infusion after dilution into saline. The lyophilized drug product consists of the oligonucleotide which has been prepared in water for injection, adjusted to pH 7.0-9.0 with acid or base during preparation, and then lyophilized. The lyophilized oligonucleotide may be 25-800 mg of the oligonucleotide. It is understood that this encompasses 25, 50, 75, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 425, 450, 475, 500, 525, 550, 575, 600, 625, 650, 675, 700, 725, 750, 775, and 800 mg of lyophilized oligonucleotide.
The lyophilized drug product may be packaged in a 2 mL Type I, clear glass vial (ammonium sulfate-treated), stoppered with a bromobutyl rubber closure and sealed with an aluminum FLIP-OFF overseal.
The compositions of the present invention may additionally comprise other adjunct components conventionally found in pharmaceutical compositions, at their art-established usage levels. Thus, for example, the compositions may comprise additional, compatible, pharmaceutically-active materials such as, for example, antipruritics, astringents, local anesthetics or anti-inflammatory agents, or may comprise additional materials useful in physically formulating various dosage forms of the compositions of the present invention, such as dyes, flavoring agents, preservatives, antioxidants, opacifiers, thickening agents and stabilizers. However, such materials, when added, should not unduly interfere with the biological activities of the components of the compositions of the present invention. The formulations can be sterilized and, if desired, mixed with auxiliary agents, e.g., lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, colorings, flavorings and/or aromatic substances and the like which do not deleteriously interact with the oligonucleotide(s) of the formulation.
The antisense compounds provided herein may also be admixed, encapsulated, conjugated or otherwise associated with other molecules, molecule structures or mixtures of compounds.
Also described herein are pharmaceutical compositions and formulations which include the antisense compounds provided herein. The pharmaceutical compositions may be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. In a preferred embodiment, administration is topical to the surface of the respiratory tract, particularly pulmonary, e.g., by nebulization, inhalation, or insufflation of powders or aerosols, by mouth and/or nose.
-239-The pharmaceutical formulations described herein, which may conveniently be presented in unit dosage form, may be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the step of bringing into association the active ingredients with the pharmaceutical carrier(s) or excipient(s). In general, the formulations are prepared by uniformly and intimately bringing into association the active ingredients with liquid carriers, finely divided solid carriers, or both, and then, if necessary, shaping the product (e.g., into a specific particle size for delivery). In a preferred embodiment, the pharmaceutical formulations are prepared for pulmonary administration in an appropriate solvent, e.g., water or normal saline, possibly in a sterile formulation, with carriers or other agents to allow for the formation of droplets of the desired diameter for delivery using inhalers, nasal delivery devices, nebulizers, and other devices for pulmonary delivery.
Alternatively, the pharmaceutical formulations may be formulated as dry powders for use in dry powder inhalers.
A"pharmaceutical carrier" or "excipient" can be a pharmaceutically acceptable solvent, suspending agent or any other pharmacologically inert vehicle for delivering one or more nucleic acids to an individual and are known in the art. The excipient may be liquid or solid and is selected, with the planned manner of administration in mind, so as to provide for the desired bulk, consistency, etc., when combined with a nucleic acid and the other components of a given pharmaceutical composition.
H. Certain Therapeutic Uses In certain embodiments, antisense compounds are used to modulate the expression of a target gene in an animal, such as a human. In certain embodiments, such compounds can be used to treat metabolic disorders or modulate one or more disease indications. For example, the methods comprise the step of administering to said animal in need of therapy for a disease or condition associated with a target gene an effective amount of an antisense compound that modulates expression of the target gene.
Antisense compounds provided herein which effectively modulate expression of a target RNA or protein products of expression are considered active antisense compounds. Active antisense compounds also include compounds which effectively modulate one or more of a number of disease indications, including metabolic and cardiovascular disease indications, examples of which are described below.
Modulation of expression of a target gene can be measured in a bodily fluid, which may or may not contain cells; tissue; or organ of the animal. Methods of obtaining samples for analysis, such as body fluids (e.g., sputum, serum, urine), tissues (e.g., biopsy), or organs, and methods of preparation of the samples to allow for analysis are well known to those skilled in the art.
Methods for analysis of RNA and protein levels are discussed above and are well known to those skilled in the art. The effects of treatment can be assessed by measuring biomarkers, or disease indications, associated with the target gene expression in the aforementioned fluids, tissues or organs, collected from an animal contacted with one or more compounds described herein, by routine clinical methods known in the art.
These biomarkers include but are not limited to: liver transaminases, bilirubin, albumin, blood urea nitrogen, creatine and other markers of kidney and liver function; interleukins, tumor necrosis factors, intracellular adhesion DEMANDE OU BREVET VOLUMINEUX

LA PRESENTE PARTIE DE CETTE DEMANDE OU CE BREVET COMPREND
PLUS D'UN TOME.

NOTE : Pour les tomes additionels, veuillez contacter le Bureau canadien des brevets JUMBO APPLICATIONS/PATENTS

THIS SECTION OF THE APPLICATION/PATENT CONTAINS MORE THAN ONE
VOLUME

NOTE: For additional volumes, please contact the Canadian Patent Office NOM DU FICHIER / FILE NAME:

NOTE POUR LE TOME / VOLUME NOTE:

Claims (55)

1. A short antisense compound 8 to 16 monomers in length, comprising a 2'-deoxyribonucleotide gap region flanked on each side by a wing, wherein each wing independently comprises 1 to 3 high-affinity modified monomers.
2. The short antisense compound of claim 1, wherein said high-affinity modified monomers are sugar-modified nucleotides.
3. The short antisense compound of claim 2, wherein at least one of the sugar-modified nucleotides comprises a bridge between the 4' and the 2' position of the sugar.
4. The short antisense compound of claim 2, wherein each of said high-affinity modified nucleotides confers a T m of 1 to 4 degrees per nucleotide.
5. The short antisense compound of claim 2, wherein each of said sugar-modified nucleotides comprises a 2'-substituent group that is other than H or OH.
6. The short antisense compound of claim 5, wherein at least one of said sugar-modified nucleotides is a 4' to 2' bridged bicyclic nucleotide.
7. The short antisense compound of claim 5, wherein each of the 2'-substituent groups is, independently, alkoxy, substituted alkoxy, or halogen.
8. The short antisense compound of claim 7, wherein each of the 2'-substituent groups is OCH2CH2OCH3.
9. The short antisense compound claim 3, wherein the conformation of each of said sugar-modified nucleotides is, independently, .beta.-D or .alpha.-L.
10. The short antisense compound claim 5, wherein each of said bridges independently comprises 1 or from 2 to 4 linked groups independently selected from -[C(R1)(R2)]n-,-C(R1)=C(R2)-, -C(R1)=N-, -C(=NR1)-, -C(=O)-, -C(=S)-, -O-, -Si(R1)2-, -S(=O)x- and -N(R1)-;
wherein x is 0, 1, or 2;
n is 1, 2, 3, or 4;
each R1 and R2 is, independently, H, a protecting group, hydroxyl, C1-C12 alkyl, substituted C1-C12 alkyl, C2-C12 alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, C5-C20 aryl, substituted C5-C20 aryl, heterocycle radical, substituted heterocycle radical, heteroaryl, substituted heteroaryl, C5-C7 alicyclic radical, substituted C5-C7 alicyclic radical, halogen, OJ1, NJ1J2, SJ1, N3, COOJ1, acyl (C(=O)-H), substituted acyl, CN, sulfonyl (S(=O)2-J1), or sulfoxyl (S(=O)-J1); and each J1 and J2 is, independently, H, C1-C12 alkyl, substituted C1-C12 alkyl, alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, C5-C20 aryl, substituted C5-C20 aryl, acyl (C(=O)-H), substituted acyl, a heterocycle radical, a substituted heterocycle radical, C1-C12 aminoalkyl, substituted C1-C12 aminoalkyl or a protecting group.
11. The short antisense compound of claim 10, wherein each of said bridges is, independently, 4'-CH2-2', 4'-(CH2)2-2', 4'-CH2-O-2', 4'-(CH2)2-O-2', 4'-CH2-O-N(R1)-2' and 4'-CH2-N(R1)-O-2'- wherein each R1 is, independently, H, a protecting group or C1-C12 alkyl.
12. The short antisense compound of claim 1, wherein each of the high-affinity modified monomer is independently selected from bicyclic nucleotides or other 2'-modified nucleotides.
13. The short antisense compound of claim 12, wherein the 2'-modified nucleotides are selected from halogen, allyl, amino, azido, thio, O-allyl, O-C1-C10 alkyl, -OCF3, O-(CH2)2-O-CH3, 2'-O(CH2)2SCH3, O-(CH2)2-O-N(R m)(R n) or O-CH2-C(=O)-N(R m)(R n), where each R m and R n is, independently, H or substituted or unsubstituted C1-C10 alkyl.
14. The short antisense compound of claim 13, wherein the 2'-modified nucleotide is a 2'-OCH2CH2OCH3 nucleotide.
15. The short antisense compound of claim 1, wherein at least one monomeric linkage is a modified monomeric linkage.
16. The antisense compound of claim 15, wherein the modified monomeric linkage is a phosphorothioate linkage.
17. The short antisense compound of claim 1, wherein each monomeric linkage is a phosphorothioate internucleoside linkage.
18. The short antisense compound of any of claims 1-17, that is 8-15 monomers in length.
19. The short antisense compound of claim 18 that is 9-15 monomers in length.
20. The short antisense compound of claim 18 that is 10-15 monomers in length.
21. The short antisense compound of claim 18 that is 9-14 monomers in length.
22. The short antisense compound of claim 18 that is 10-14 monomers in length.
23. The short antisense compound of claim 18 that is 9-13 monomers in length.
24. The short antisense compound of claim 18 that is 10-13 monomers in length.
25. The short antisense compound of claim 18 that is 9-12 monomers in length.
26. The short antisense compound of claim 18 that is 10-12 monomers in length.
27. The short antisense compound of claim 18 that is 9-11 monomers in length.
28. The short antisense compound of claim 18 that is 10-11 monomers in length.
29. The short antisense compound of claim 18 that is 8 monomers in length.
30. The short antisense compound of claim 18 that is 9 monomers in length.
31. The short antisense compound of claim 18 that is 10 monomers in length.
32. The short antisense compound of claim 18 that is 11 monomers in length.
33. The short antisense compound of claim 18 that is 12 monomers in length.
34. The short antisense compound of claim 18 that is 13 monomers in length.
35. The short antisense compound of claim 18 that is 14 monomers in length.
36. The short antisense compound of claim 18 that is 15 monomers in length.
37. The short antisense compound of claim 18 that is 16 monomers in length.
38. The short antisense compound of any of claims 1-18, having a motif selected from 1-12-1; 3-10-3;
2-10-3; 2-10-2; 1-10-1; 1-10-2; 3-8-3; 2-8-2; 1-8-1; 3-6-3; and 1-6-11 wherein, the first number represents the number of monomers in the 5'-wing, the second number represents the number of monomers in the gap, and the third number represents the number of monomers in the 3' wing.
39. The short antisense compound of claim 38 wherein the motif is selected from 1-10-1; 2-10-2; 3-10-3; and 1-9-2.
40. The short antisense compound of any of claims 1-18 having a motif selected from 1-1-10-2, 1-1-8-2, 1-1-6-3, and 1-2-8-2, wherein the first number represents the number of monomers in a first 5' wing, the second number represents the number of monomers in a second 5' wing, the third number represents the number of monomers in the gap, and the fourth number represents the number of monomers in the 3' wing.
41. The short antisense compound of any of claims 1-18 having a motif selected from 2-10-1-1, 2-8-1-1, 3-6-1-1,and 2-8-2-1, wherein the first number represents the number of monomers in the 5' wing, the second number represents the number of monomers in the gap, the third number represents the number of monomers in a first 3' wing, and the fourth number represents the number of monomers in a second 3' wing.
42. The short antisense compound of any of claims 1-18 having a motif selected from 1-2-10-1-1; 1-1-8-1-1; 2-1-6-1-1; and 1-2-8-2-1, wherein the first number represents the number of monomers in a first 5' wing, the second number represents the number of monomers in a second 5' wing, the third number represents the number of monomers in the gap, the fourth number represents the number of monomers in a first 3' wing and the fifth number represents the number of monomers in a second 3'wing.
43. The short antisense compound of any of claims 1-42, wherein the short antisense compound is targeted to a nucleic acid encoding a target protein selected from ApoB, SGLT2, PCSK9, SOD1, CRP, GCCR, GCGR, DGAT2, PTP1B and PTEN.
44. A method of modulating expression of a target by contacting a target nucleic acid with a short antisense compound.
45. The method of claim 44 wherein the target nucleic acid is in a cell.
46. The method of claim 44, wherein the target nucleic acid is in an animal.
47. The method of claim 45, wherein the animal is a human.
48. The method of any of claims 44-47, wherein the target is selected from ApoB, SGLT2, PCSK9, SOD1, CRP, GCCR, GCGR, DGAT2, PTP1B and PTEN.
49. The method of any of claims 44-48, wherein the short antisense compound is the short antisense compound of any of claims 1-38.
50. Use of the short antisense compound of any of claims 1-43 for the preparation of a medicament for reducing the expression of a target RNA in an animal.
51. The use of claim 50, wherein the medicament treats a metabolic disorder in an animal.
52. The use of claim 51, wherein the medicament increases insulin sensitivity, decreases blood glucose and/or decreases HbA1c in the animal.
53. The use of claim 51, wherein the medicament decreases total serum cholesterol, serum LDL, serum VLDL, serum HDL, serum triglycerides, serum apolipoprotein(a) and/or free fatty acids in an animal.
54. A method of inhibiting expression of a target RNA in an animal, comprising administering to said animal the short antisense compound of any of claims 1-43.
55. A method of treating a metabolic disorder in an animal, comprising administering to an animal in need of such therapy the short antisense compound of any of claims 1-43.
CA2651309A 2006-05-05 2007-05-07 Compounds and methods for modulating gene expression Active CA2651309C (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CA3044969A CA3044969A1 (en) 2006-05-05 2007-05-07 Compounds and methods for modulating gene expression

Applications Claiming Priority (11)

Application Number Priority Date Filing Date Title
US74663106P 2006-05-05 2006-05-05
US60/746,631 2006-05-05
US74705906P 2006-05-11 2006-05-11
US60/747,059 2006-05-11
US80566006P 2006-06-23 2006-06-23
US60/805,660 2006-06-23
US86455406P 2006-11-06 2006-11-06
US60/864,554 2006-11-06
USPCT/US2007/061183 2007-01-27
PCT/US2007/061183 WO2007090071A2 (en) 2006-01-27 2007-01-27 6-modified bicyclic nucleic acid analogs
PCT/US2007/068401 WO2007146511A2 (en) 2006-05-05 2007-05-07 Compounds and methods for modulating gene expression

Related Child Applications (1)

Application Number Title Priority Date Filing Date
CA3044969A Division CA3044969A1 (en) 2006-05-05 2007-05-07 Compounds and methods for modulating gene expression

Publications (2)

Publication Number Publication Date
CA2651309A1 true CA2651309A1 (en) 2007-12-21
CA2651309C CA2651309C (en) 2019-06-11

Family

ID=40134111

Family Applications (3)

Application Number Title Priority Date Filing Date
CA3044969A Abandoned CA3044969A1 (en) 2006-05-05 2007-05-07 Compounds and methods for modulating gene expression
CA2651309A Active CA2651309C (en) 2006-05-05 2007-05-07 Compounds and methods for modulating gene expression
CA002651042A Abandoned CA2651042A1 (en) 2006-05-05 2007-05-07 Compounds and methods for modulating expression of sglt2

Family Applications Before (1)

Application Number Title Priority Date Filing Date
CA3044969A Abandoned CA3044969A1 (en) 2006-05-05 2007-05-07 Compounds and methods for modulating gene expression

Family Applications After (1)

Application Number Title Priority Date Filing Date
CA002651042A Abandoned CA2651042A1 (en) 2006-05-05 2007-05-07 Compounds and methods for modulating expression of sglt2

Country Status (16)

Country Link
US (14) US20090326041A1 (en)
EP (10) EP2363481B1 (en)
JP (7) JP5372745B2 (en)
KR (1) KR101441700B1 (en)
CN (1) CN103554205A (en)
AT (2) ATE513912T1 (en)
AU (4) AU2007257094B2 (en)
BR (1) BRPI0711429A2 (en)
CA (3) CA3044969A1 (en)
DK (5) DK2021472T3 (en)
ES (2) ES2471978T3 (en)
HK (1) HK1128418A1 (en)
MX (1) MX2008014100A (en)
NO (1) NO20084738L (en)
PT (1) PT2015758E (en)
WO (9) WO2007136988A2 (en)

Families Citing this family (363)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7407943B2 (en) 2001-08-01 2008-08-05 Isis Pharmaceuticals, Inc. Antisense modulation of apolipoprotein B expression
US20060009410A1 (en) * 2002-11-13 2006-01-12 Crooke Rosanne M Effects of apolipoprotein B inhibition on gene expression profiles in animals
US7511131B2 (en) 2002-11-13 2009-03-31 Genzyme Corporation Antisense modulation of apolipoprotein B expression
JP2005244488A (en) 2004-02-25 2005-09-08 Matsushita Electric Ind Co Ltd Composite machine
US20050287558A1 (en) 2004-05-05 2005-12-29 Crooke Rosanne M SNPs of apolipoprotein B and modulation of their expression
EP1937813A2 (en) * 2005-09-19 2008-07-02 Isis Pharmaceuticals, Inc. Modulation of glucagon receptor expression
CN101437933B (en) 2005-12-28 2013-11-06 斯克里普斯研究所 Natural antisense and non-coding RNA transcripts as drug targets
US7764650B2 (en) 2006-03-02 2010-07-27 Intel Corporation Mobile station and method for fast roaming with integrity protection and source authentication using a common protocol
CA3024953A1 (en) 2006-04-03 2007-10-11 Roche Innovation Center Copenhagen A/S Pharmaceutical composition comprising anti-mirna antisense oligonucleotides
SG10201406016SA (en) 2006-04-03 2014-11-27 Stella Aps Pharmaceutical composition comprising anti-mirna antisense oligonucleotides
US20090326041A1 (en) * 2006-05-05 2009-12-31 Isis Pharmaceuticals, Inc. Compounds and methods for modulating expression of sglt2
JP2010503382A (en) * 2006-07-17 2010-02-04 サーナ・セラピューティクス・インコーポレイテッド RNA interference-mediated inhibition of proprotein convertase subtilisin kexin 9 (PCSK9) gene expression using small interfering nucleic acids (siNA)
AU2007310989B2 (en) 2006-10-18 2014-05-29 Isis Pharmaceuticals, Inc. Antisense compounds
CA2670563A1 (en) 2006-11-27 2008-06-05 Isis Pharmaceuticals, Inc. Methods for treating hypercholesterolemia
US8093222B2 (en) 2006-11-27 2012-01-10 Isis Pharmaceuticals, Inc. Methods for treating hypercholesterolemia
EP2126079A1 (en) * 2007-03-22 2009-12-02 Santaris Pharma A/S Rna antagonist compounds for the inhibition of apo-b100 expression
AU2008230886B9 (en) * 2007-03-24 2014-09-04 Kastle Therapeutics, Llc Administering antisense oligonucleotides complementary to human apolipoprotein B
EA018986B1 (en) 2007-05-01 2013-12-30 Сантарис Фарма А/С Rna antagonist compounds for the modulation of beta-catenin
KR20100024410A (en) 2007-05-11 2010-03-05 엔즌 파마슈티칼스, 인코포레이티드 Rna antagonist compounds for the modulation of her3
ES2376507T5 (en) 2007-07-05 2015-08-31 Isis Pharmaceuticals, Inc. 6-disubstituted bicyclic nucleic acid analogs
EP2025674A1 (en) 2007-08-15 2009-02-18 sanofi-aventis Substituted tetra hydro naphthalines, method for their manufacture and their use as drugs
AU2008306327B2 (en) 2007-10-04 2014-05-15 Roche Innovation Center Copenhagen A/S Micromirs
US8318496B2 (en) 2007-10-04 2012-11-27 Isis Pharmaceuticals, Inc. Compounds and methods for improving cellular uptake of oligomeric compounds
CN101932709B (en) 2007-11-26 2014-09-10 桑塔里斯制药公司 LNA antagonists targeting the androgen receptor
US8450290B2 (en) 2007-11-26 2013-05-28 Enzon Pharmaceuticals, Inc. Methods for treating androgen receptor dependent disorders including cancers
US20100323967A1 (en) * 2007-12-07 2010-12-23 Santaris Pharma A/S RNA Antagonist Compounds for the Modulation of MCL-1
US10131904B2 (en) 2008-02-11 2018-11-20 Rxi Pharmaceuticals Corporation Modified RNAi polynucleotides and uses thereof
EP2268811A1 (en) 2008-03-07 2011-01-05 Santaris Pharma A/S Pharmaceutical compositions for treatment of microrna related diseases
US8426378B2 (en) * 2008-03-21 2013-04-23 Isis Pharmaceuticals, Inc. Oligomeric compounds comprising tricyclic nucelosides and methods for their use
EP2274423A2 (en) 2008-04-04 2011-01-19 Isis Pharmaceuticals, Inc. Oligomeric compounds comprising bicyclic nucleosides and having reduced toxicity
US20110224280A1 (en) * 2008-04-16 2011-09-15 Niels Fisker Nielsen Pharmaceutical Composition Comprising Anti PCSK9 Oligomers
EP2291200A4 (en) 2008-05-22 2012-05-30 Isis Pharmaceuticals Inc Methods for modulating expression of rbp4
WO2009148605A2 (en) * 2008-06-04 2009-12-10 Isis Pharmaceuticals, Inc. Methods for treating hypercholesterolemia
WO2009149182A1 (en) 2008-06-04 2009-12-10 The Board Of Regents Of The University Of Texas System Modulation of gene expression through endogenous small rna targeting of gene promoters
EP2317847B1 (en) 2008-07-29 2019-04-17 The Board of Regents of The University of Texas System Selective inhibition of polyglutamine protein expression
EP2315832B1 (en) 2008-08-01 2015-04-08 Roche Innovation Center Copenhagen A/S Micro-rna mediated modulation of colony stimulating factors
EP3375451A1 (en) 2008-08-25 2018-09-19 Excaliard Pharmaceuticals, Inc. Method for reducing scarring during wound healing using antisense compounds directed to ctgf
EP3081648A1 (en) 2008-08-25 2016-10-19 Excaliard Pharmaceuticals, Inc. Antisense oligonucleotides directed against connective tissue growth factor and uses thereof
JP2012502991A (en) 2008-09-22 2012-02-02 アールエックスアイ ファーマシューティカルズ コーポレーション RNA interference in dermal applications
JP6128732B2 (en) 2008-10-03 2017-05-17 クルナ・インコーポレーテッド Treatment of apolipoprotein-A1 related diseases by suppression of natural antisense transcripts against apolipoprotein-A1
AU2009305636A1 (en) 2008-10-15 2010-04-22 Ionis Pharmaceuticals, Inc. Modulation of Factor 11 expression
AU2009308217B2 (en) * 2008-10-24 2016-01-21 Ionis Pharmaceuticals, Inc. 5' and 2' bis-substituted nucleosides and oligomeric compounds prepared therefrom
KR101881596B1 (en) 2008-12-02 2018-07-24 웨이브 라이프 사이언시스 재팬 인코포레이티드 Method for the synthesis of phosphorous atom modified nucleic acids
JP5971948B2 (en) 2008-12-04 2016-08-17 クルナ・インコーポレーテッド Treatment of vascular endothelial growth factor (VEGF) -related diseases by suppression of natural antisense transcripts against VEGF
WO2010065792A2 (en) 2008-12-04 2010-06-10 Curna, Inc. Treatment of erythropoietin (epo) related diseases by inhibition of natural antisense transcript to epo
ES2637063T3 (en) 2008-12-04 2017-10-10 Curna, Inc. Treatment of diseases related to tumor suppressor genes by inhibiting the natural antisense transcript to the gene
US20130064834A1 (en) 2008-12-15 2013-03-14 Regeneron Pharmaceuticals, Inc. Methods for treating hypercholesterolemia using antibodies to pcsk9
JO3672B1 (en) 2008-12-15 2020-08-27 Regeneron Pharma High Affinity Human Antibodies to PCSK9
US9493774B2 (en) 2009-01-05 2016-11-15 Rxi Pharmaceuticals Corporation Inhibition of PCSK9 through RNAi
MX2011007776A (en) * 2009-02-03 2011-08-12 Hoffmann La Roche Compositions and methods for inhibiting expression of ptp1b genes.
WO2010090762A1 (en) 2009-02-04 2010-08-12 Rxi Pharmaceuticals Corporation Rna duplexes with single stranded phosphorothioate nucleotide regions for additional functionality
US20110319476A1 (en) * 2009-02-12 2011-12-29 Opko Curna, Llc Treatment of glial cell derived neurotrophic factor (gdnf) related diseases by inhibition of natural antisense transcript to gdnf
PL2396038T3 (en) 2009-02-12 2016-05-31 Curna Inc Treatment of brain derived neurotrophic factor (bdnf) related diseases by inhibition of natural antisense transcript to bdnf
EP2408796B1 (en) 2009-03-16 2020-04-22 Ionis Pharmaceuticals, Inc. Targeting Apolipoprotein B for the reduction of Apolipoprotein C-III
US9464287B2 (en) 2009-03-16 2016-10-11 Curna, Inc. Treatment of nuclear factor (erythroid-derived 2)-like 2 (NRF2) related diseases by inhibition of natural antisense transcript to NRF2
CA2755404C (en) 2009-03-17 2020-03-24 Joseph Collard Treatment of delta-like 1 homolog (dlk1) related diseases by inhibition of natural antisense transcript to dlk1
EP2421972A2 (en) 2009-04-24 2012-02-29 The Board of Regents of The University of Texas System Modulation of gene expression using oligomers that target gene regions downstream of 3' untranslated regions
WO2010122538A1 (en) 2009-04-24 2010-10-28 Santaris Pharma A/S Pharmaceutical compositions for treatment of hcv patients that are non-responders to interferon
ES2609655T3 (en) 2009-05-06 2017-04-21 Curna, Inc. Treatment of diseases related to tristetraproline (TTP) by inhibition of natural antisense transcript for TTP
CN106237345A (en) 2009-05-06 2016-12-21 库尔纳公司 By suppression therapy lipid transfer and the metabolic gene relevant disease of the natural antisense transcript for lipid transfer and metabolic gene
ES2618572T3 (en) 2009-05-08 2017-06-21 Curna, Inc. Treatment of diseases related to the dystrophin family by inhibiting a natural antisense transcript for the dmd family
WO2010130771A2 (en) * 2009-05-15 2010-11-18 F. Hoffmann-La Roche Ag Compositions and methods for inhibiting expression of glucocorticoid receptor (gcr) genes
JP5922017B2 (en) 2009-05-18 2016-05-24 クルナ・インコーポレーテッド Treatment of reprogramming factor-related diseases by suppression of natural antisense transcripts against the reprogramming factor
WO2010135695A2 (en) 2009-05-22 2010-11-25 Curna, Inc. TREATMENT OF TRANSCRIPTION FACTOR E3 (TFE3) and INSULIN RECEPTOR SUBSTRATE 2 (IRS2) RELATED DISEASES BY INHIBITION OF NATURAL ANTISENSE TRANSCRIPT TO TFE3
EP2435571B1 (en) 2009-05-28 2016-12-14 CuRNA, Inc. Treatment of antiviral gene related diseases by inhibition of natural antisense transcript to an antiviral gene
KR101801404B1 (en) 2009-06-16 2017-12-20 큐알엔에이, 인크. Treatment of collagen gene related diseases by inhibition of natural antisense transcript to a collagen gene
ES2629339T3 (en) 2009-06-16 2017-08-08 Curna, Inc. Treatment of diseases related to paraoxonase 1 (pon1) by inhibition of natural antisense transcript to pon1
CA2765889A1 (en) 2009-06-24 2010-12-29 Opko Curna, Llc Treatment of tumor necrosis factor receptor 2 (tnfr2) related diseases by inhibition of natural antisense transcript to tnfr2
KR101807324B1 (en) 2009-06-26 2017-12-08 큐알엔에이, 인크. Treatment of down syndrome gene related diseases by inhibition of natural antisense transcript to a down syndrome gene
IN2012DN00720A (en) 2009-07-06 2015-06-19 Ontorii Inc
US8563528B2 (en) 2009-07-21 2013-10-22 Santaris Pharma A/S Antisense oligomers targeting PCSK9
CN102712925B (en) 2009-07-24 2017-10-27 库尔纳公司 It is diseases related that SIRTUIN (SIRT) is treated by suppressing SIRTUIN (SIRT) natural antisense transcript
CA2769665A1 (en) 2009-08-05 2011-02-10 Opko Curna, Llc Treatment of insulin gene (ins) related diseases by inhibition of natural antisense transcript to an insulin gene (ins)
EP2464731B1 (en) 2009-08-11 2016-10-05 CuRNA, Inc. Treatment of adiponectin (adipoq) related diseases by inhibition of natural antisense transcript to an adiponectin (adipoq)
WO2011022606A2 (en) 2009-08-21 2011-02-24 Curna, Inc. Treatment of 'c terminus of hsp70-interacting protein' (chip) related diseases by inhibition of natural antisense transcript to chip
KR101892760B1 (en) 2009-08-25 2018-08-28 큐알엔에이, 인크. Treatment of 'iq motif containing gtpase activating protein' (iqgap) related diseases by inhibition of natural antisense transcript to iqgap
EP2480667A4 (en) * 2009-09-25 2013-07-03 Isis Pharmaceuticals Inc Modulation of ttc39 expression to increase hdl
CN102791861B (en) 2009-09-25 2018-08-07 库尔纳公司 FLG relevant diseases are treated by adjusting expression and the activity of Filaggrin (FLG)
EP2488210A4 (en) 2009-10-12 2014-04-30 Smith Holdings Llc Methods and compositions for modulating gene expression using oligonucleotide based drugs administered in vivo or in vitro
JP5859970B2 (en) * 2009-10-12 2016-02-16 メディミューン,エルエルシー Quantification of IR-A and IR-B for tumor classification
US20110110860A1 (en) 2009-11-02 2011-05-12 The Board Of Regents Of The University Of Texas System Modulation of ldl receptor gene expression with double-stranded rnas targeting the ldl receptor gene promoter
WO2011054811A1 (en) 2009-11-03 2011-05-12 Santaris Pharma A/S Rna antagonists targeting hsp27 combination therapy
ES2661813T3 (en) 2009-12-16 2018-04-04 Curna, Inc. Treatment of diseases related to membrane transcription factor peptidase, site 1 (mbtps1) by inhibition of the natural antisense transcript to the mbtps1 gene
WO2011079261A2 (en) 2009-12-23 2011-06-30 Curna, Inc. Treatment of hepatocyte growth factor (hgf) related diseases by inhibition of natural antisense transcript to hgf
EP2515947B1 (en) 2009-12-23 2021-10-06 CuRNA, Inc. Treatment of uncoupling protein 2 (ucp2) related diseases by inhibition of natural antisense transcript to ucp2
RU2615450C2 (en) 2009-12-29 2017-04-04 Курна, Инк. Treating diseases associated with nuclear respiratory factor 1 (nrf1) by inhibition of natural antisense transcript to nrf1
JP5982288B2 (en) 2009-12-29 2016-08-31 カッパーアールエヌエー,インコーポレイテッド Treatment of tumor protein 63-related diseases by inhibition of natural antisense transcripts against tumor protein 63 (p63)
EP2519632B1 (en) 2009-12-31 2018-04-11 CuRNA, Inc. Treatment of insulin receptor substrate 2 (irs2) related diseases by inhibition of natural antisense transcript to irs2 and transcription factor e3 (tfe3)
DK2521784T3 (en) 2010-01-04 2018-03-12 Curna Inc TREATMENT OF INTERFERON REGULATORY FACTOR 8- (IRF8) RELATED DISEASES BY INHIBITION OF NATURAL ANTISENCE TRANSCRIPT TO IRF8
JP5963680B2 (en) 2010-01-06 2016-08-03 カッパーアールエヌエー,インコーポレイテッド Treatment of pancreatic developmental gene diseases by inhibition of natural antisense transcripts against pancreatic developmental genes
US8653047B2 (en) * 2010-01-08 2014-02-18 Isis Pharmaceuticals, Inc. Modulation of angiopoietin-like 3 expression
WO2011085347A2 (en) 2010-01-11 2011-07-14 Opko Curna, Llc Treatment of sex hormone binding globulin (shbg) related diseases by inhibition of natural antisense transcript to shbg
EP2524038A4 (en) * 2010-01-12 2013-11-20 Isis Pharmaceuticals Inc Modulation of transforming growth factor-beta 1 expression
ES2671877T3 (en) 2010-01-25 2018-06-11 Curna, Inc. Treatment of diseases related to RNASA (H1) by inhibition of the natural antisense transcript to RNASA H1
WO2011097388A1 (en) 2010-02-03 2011-08-11 Alnylam Pharmaceuticals, Inc. Selective inhibition of polyglutamine protein expression
US8957040B2 (en) 2010-02-08 2015-02-17 Isis Pharmaceuticals, Inc. Selective reduction of allelic variants
EP2534262B1 (en) 2010-02-08 2016-12-14 Ionis Pharmaceuticals, Inc. Selective reduction of allelic variants
CN102844435B (en) 2010-02-22 2017-05-10 库尔纳公司 Treatment of pyrroline-5-carboxylate reductase 1 (pycr1) related diseases by inhibition of natural antisense transcript to pycr1
WO2011107494A1 (en) 2010-03-03 2011-09-09 Sanofi Novel aromatic glycoside derivatives, medicaments containing said compounds, and the use thereof
US9068185B2 (en) * 2010-03-12 2015-06-30 Sarepta Therapeutics, Inc. Antisense modulation of nuclear hormone receptors
BR112012024049A2 (en) 2010-03-24 2017-03-01 Rxi Pharmaceuticals Corp rna interference on dermal and fibrotic indications
RU2612884C2 (en) 2010-04-02 2017-03-13 Курна, Инк. Treatment of diseases associated with colonystimulating factor 3 (csf3) by inhibition of natural antisense transcript to csf3
EP2556160A4 (en) 2010-04-09 2013-08-21 Curna Inc Treatment of fibroblast growth factor 21 (fgf21) related diseases by inhibition of natural antisense transcript to fgf21
WO2011139387A1 (en) * 2010-05-03 2011-11-10 Opko Curna, Llc Treatment of sirtuin (sirt) related diseases by inhibition of natural antisense transcript to a sirtuin (sirt)
TWI586356B (en) 2010-05-14 2017-06-11 可娜公司 Treatment of par4 related diseases by inhibition of natural antisense transcript to par4
KR20180053419A (en) 2010-05-26 2018-05-21 큐알엔에이, 인크. Treatment of atonal homolog 1 (atoh1) related diseases by inhibition of natural antisense transcript to atoh1
EP2576784B1 (en) 2010-05-26 2017-11-15 CuRNA, Inc. Treatment of methionine sulfoxide reductase a (msra) related diseases by inhibition of natural antisense transcript to msra
US8716258B2 (en) 2010-06-04 2014-05-06 The Board Of Regents, The University Of Texas System Regulation of metabolism by miR-378
WO2011156763A1 (en) * 2010-06-11 2011-12-15 Hitachi Chemical Co., Ltd. Methods for characterizing kidney function
WO2011156734A2 (en) 2010-06-11 2011-12-15 Hitachi Chemical Co., Ltd. Method of characterizing vascular diseases
WO2011159836A2 (en) * 2010-06-15 2011-12-22 Isis Pharmaceuticals, Inc. Compounds and methods for modulating interaction between proteins and target nucleic acids
WO2011157827A1 (en) 2010-06-18 2011-12-22 Sanofi Azolopyridin-3-one derivatives as inhibitors of lipases and phospholipases
US8530413B2 (en) 2010-06-21 2013-09-10 Sanofi Heterocyclically substituted methoxyphenyl derivatives with an oxo group, processes for preparation thereof and use thereof as medicaments
WO2011163499A2 (en) * 2010-06-23 2011-12-29 Opko Curna, Llc Treatment of sodium channel, voltage-gated, alpha subunit (scna) related diseases by inhibition of natural antisense transcript to scna
TW201221505A (en) 2010-07-05 2012-06-01 Sanofi Sa Aryloxyalkylene-substituted hydroxyphenylhexynoic acids, process for preparation thereof and use thereof as a medicament
TW201215388A (en) 2010-07-05 2012-04-16 Sanofi Sa (2-aryloxyacetylamino)phenylpropionic acid derivatives, processes for preparation thereof and use thereof as medicaments
TW201215387A (en) 2010-07-05 2012-04-16 Sanofi Aventis Spirocyclically substituted 1,3-propane dioxide derivatives, processes for preparation thereof and use thereof as a medicament
WO2012009402A2 (en) 2010-07-14 2012-01-19 Opko Curna Llc Treatment of discs large homolog (dlg) related diseases by inhibition of natural antisense transcript to dlg
US9127280B2 (en) * 2010-08-31 2015-09-08 Osaka University Oligonucleotide, and therapeutic agent for dyslipidemia containing oligonucleotide as active ingredient
WO2012034942A1 (en) 2010-09-13 2012-03-22 Santaris Pharma A/S Compounds for the modulation of aurora kinase b expression
US10428019B2 (en) 2010-09-24 2019-10-01 Wave Life Sciences Ltd. Chiral auxiliaries
CA2813901C (en) * 2010-10-06 2019-11-12 Curna, Inc. Treatment of sialidase 4 (neu4) related diseases by inhibition of natural antisense transcript to neu4
EP2630241B1 (en) 2010-10-22 2018-10-17 CuRNA, Inc. Treatment of alpha-l-iduronidase (idua) related diseases by inhibition of natural antisense transcript to idua
US9920317B2 (en) 2010-11-12 2018-03-20 The General Hospital Corporation Polycomb-associated non-coding RNAs
EP2638163B1 (en) 2010-11-12 2017-05-17 The General Hospital Corporation Polycomb-associated non-coding rnas
US10000752B2 (en) 2010-11-18 2018-06-19 Curna, Inc. Antagonat compositions and methods of use
WO2012066093A1 (en) 2010-11-19 2012-05-24 Santaris Pharma A/S Compounds for the modulation of pdz-binding kinase (pbk) expression
WO2012066092A1 (en) 2010-11-19 2012-05-24 Santaris Pharma A/S Compounds for the modulation of aurora kinase a expression
US8771696B2 (en) 2010-11-23 2014-07-08 Regeneron Pharmaceuticals, Inc. Method of reducing the severity of stress hyperglycemia with human antibodies to the glucagon receptor
ES2657590T3 (en) 2010-11-23 2018-03-06 Curna, Inc. Treatment of nanog related diseases by inhibiting the natural antisense transcript to nanog
JO3756B1 (en) * 2010-11-23 2021-01-31 Regeneron Pharma Human antibodies to the glucagon receptor
RU2721279C2 (en) 2011-01-28 2020-05-18 Санофи Байотекнолоджи Human antibodies to pcsk9 for use in methods of treating specific groups of individuals
TWI593416B (en) 2011-02-02 2017-08-01 艾克厘德製藥公司 Method of treating keloids or hypertrophic scars using antisense compounds targeting connective tissue growth factor (ctgf)
US10017764B2 (en) 2011-02-08 2018-07-10 Ionis Pharmaceuticals, Inc. Oligomeric compounds comprising bicyclic nucleotides and uses thereof
WO2012110457A2 (en) 2011-02-14 2012-08-23 Santaris Pharma A/S Compounds for the modulation of osteopontin expression
CN105886506A (en) 2011-04-13 2016-08-24 Isis制药公司 Antisense modulation of PTP1B expression
WO2012143427A1 (en) 2011-04-19 2012-10-26 Santaris Pharma A/S Anti polyomavirus compounds
EP2699271A4 (en) 2011-04-20 2015-10-07 Larry J Smith Methods and compositions for modulating gene expression using components that self assemble in cells and produce rnai activity
RU2620980C2 (en) 2011-06-09 2017-05-30 Курна, Инк. Treatment of diseases associated with frataxin (fxn), by inhibiting natural antisense fxn transcript
US9719129B2 (en) 2011-06-10 2017-08-01 Hitachi Chemical Co., Ltd. Methods for isolating vesicles from biological fluids
BR112014001244A2 (en) 2011-07-19 2017-02-21 Wave Life Sciences Pte Ltd methods for the synthesis of functionalized nucleic acids
AR087305A1 (en) 2011-07-28 2014-03-12 Regeneron Pharma STABILIZED FORMULATIONS CONTAINING ANTI-PCSK9 ANTIBODIES, PREPARATION METHOD AND KIT
US10202599B2 (en) 2011-08-11 2019-02-12 Ionis Pharmaceuticals, Inc. Selective antisense compounds and uses thereof
US10583128B2 (en) 2011-09-06 2020-03-10 Curna, Inc. Treatment of diseases related to alpha subunits of sodium channels, voltage-gated (SCNxA) with small molecules
WO2013037390A1 (en) 2011-09-12 2013-03-21 Sanofi 6-(4-hydroxy-phenyl)-3-styryl-1h-pyrazolo[3,4-b]pyridine-4-carboxylic acid amide derivatives as kinase inhibitors
JP6129844B2 (en) 2011-09-14 2017-05-17 ラナ セラピューティクス インコーポレイテッド Multimeric oligonucleotide compounds
JP6158813B2 (en) 2011-09-16 2017-07-05 リジェネロン・ファーマシューティカルズ・インコーポレイテッドRegeneron Pharmaceuticals, Inc. Method of reducing lipoprotein (a) levels by administering an inhibitor of proprotein convertase subtilisin kexin-9 (PCSK9)
EP3401401B1 (en) 2011-09-20 2020-04-15 Ionis Pharmaceuticals, Inc. Antisense modulation of gcgr expression
WO2013045413A1 (en) 2011-09-27 2013-04-04 Sanofi 6-(4-hydroxy-phenyl)-3-alkyl-1h-pyrazolo[3,4-b]pyridine-4-carboxylic acid amide derivatives as kinase inhibitors
RU2014119787A (en) 2011-10-25 2015-12-10 Айсис Фармасьютикалс, Инк. GCCR ANTI-SENSE REGULATION
ES2707232T3 (en) 2011-12-16 2019-04-03 Univ Nat Corp Tokyo Medical & Dental Chimeric double-stranded nucleic acid
US20150031750A1 (en) 2012-03-15 2015-01-29 The Scripps Research Institute Treatment of brain derived neurotrophic factor (bdnf) related diseases by inhibition of natural antisense transcript to bdnf
EP2831231A1 (en) 2012-03-30 2015-02-04 Isis Pharmaceuticals, Inc. Compositions and methods for modulating tau expression for reducing seizure and modifying a neurodegenerative syndrome
WO2013159108A2 (en) 2012-04-20 2013-10-24 Isis Pharmaceuticals, Inc. Oligomeric compounds comprising bicyclic nucleotides and uses thereof
US9255154B2 (en) 2012-05-08 2016-02-09 Alderbio Holdings, Llc Anti-PCSK9 antibodies and use thereof
CA2873809A1 (en) * 2012-05-16 2013-11-21 Rana Therapeutics, Inc. Compositions and methods for modulating gene expression
US20150159161A1 (en) * 2012-05-16 2015-06-11 Rana Therapeutics, Inc. Compositions and methods for modulating pten expression
AU2013262656A1 (en) 2012-05-16 2015-01-22 Rana Therapeutics, Inc. Compositions and methods for modulating UTRN expression
US10059941B2 (en) 2012-05-16 2018-08-28 Translate Bio Ma, Inc. Compositions and methods for modulating SMN gene family expression
AP2014008100A0 (en) 2012-05-16 2014-12-31 Gen Hospital Corp Compositions and methods for modulating hemoglobingene family expression
JP2015518712A (en) 2012-05-16 2015-07-06 ラナ セラピューティクス インコーポレイテッド Compositions and methods for modulating MECP2 expression
EA201492120A1 (en) 2012-05-16 2015-10-30 Рана Терапьютикс, Инк. COMPOSITIONS AND METHODS FOR MODULATING ATP2A2 EXPRESSION
US10837014B2 (en) 2012-05-16 2020-11-17 Translate Bio Ma, Inc. Compositions and methods for modulating SMN gene family expression
WO2013173789A2 (en) 2012-05-17 2013-11-21 Isis Pharmaceuticals, Inc. Antisense oligonucleotide compositions
KR20170142997A (en) * 2012-05-24 2017-12-28 아이오니스 파마수티컬즈, 인코포레이티드 Methods and compositions for modulating apolipoprotein (a) expression
US9663784B2 (en) 2012-05-26 2017-05-30 Bonac Corporation Single-stranded nucleic acid molecule for regulating expression of gene having delivering function
EP2872147B1 (en) 2012-07-13 2022-12-21 Wave Life Sciences Ltd. Method for making chiral oligonucleotides
EP2873674B1 (en) 2012-07-13 2020-05-06 Shin Nippon Biomedical Laboratories, Ltd. Chiral nucleic acid adjuvant
BR112015000784A8 (en) 2012-07-13 2018-04-03 Wave Life Sciences Japan ASYMMETRICAL AUXILIARY GROUP
EP2895200B1 (en) 2012-09-14 2019-11-06 Translate Bio MA, Inc. Multimeric oligonucleotide compounds
WO2014045126A2 (en) 2012-09-18 2014-03-27 Uti Limited Partnership Treatment of pain by inhibition of usp5 de-ubiquitinase
EP2906699A4 (en) * 2012-10-11 2016-06-08 Ionis Pharmaceuticals Inc Oligomeric compounds comprising bicyclic nucleosides and uses thereof
EP4144845B1 (en) 2012-10-12 2024-04-24 Ionis Pharmaceuticals, Inc. Antisense compounds and uses thereof
EP2906697A4 (en) 2012-10-15 2016-06-22 Ionis Pharmaceuticals Inc Methods for monitoring c9orf72 expression
BR112015008399A8 (en) 2012-10-15 2017-10-03 Ionis Pharmaceuticals Inc COMPOUND TO MODULATE C90RF72 EXPRESSION, ITS USE, MODIFIED OLIGONUCLEOTIDE, DOUBLE-STRIP COMPOUND AND COMPOSITION
WO2014076195A1 (en) * 2012-11-15 2014-05-22 Santaris Pharma A/S Oligonucleotide conjugates
WO2014080004A1 (en) 2012-11-26 2014-05-30 Santaris Pharma A/S Compositions and methods for modulation of fgfr3 expression
RU2649367C2 (en) 2013-01-30 2018-04-02 Ф. Хоффманн-Ля Рош Аг Lna oligonucleotide carbohydrate conjugates
DK2951191T3 (en) * 2013-01-31 2019-01-14 Ionis Pharmaceuticals Inc PROCEDURE FOR MANUFACTURING OLIGOMERIC COMPOUNDS USING MODIFIED CLUTCH PROTOCOLS
US10398661B2 (en) 2013-02-28 2019-09-03 The Board Of Regents Of The University Of Texas System Methods for classifying a cancer as susceptible to TMEPAI-directed therapies and treating such cancers
AU2014222150A1 (en) 2013-03-01 2015-09-10 National University Corporation Tokyo Medical And Dental University Chimeric single-stranded antisense polynucleotides and double-stranded antisense agent
EP2971142B1 (en) 2013-03-14 2020-06-24 Ionis Pharmaceuticals, Inc. Compositions and methods for modulating tau expression
PL2970970T3 (en) 2013-03-14 2019-06-28 Andes Biotechnologies Global, Inc. Antisense oligonucleotides for treatment of cancer stem cells
CN105189751B (en) 2013-03-15 2019-04-23 米拉根医疗股份有限公司 Bridged bicyclic nucleosides
WO2014170786A1 (en) 2013-04-17 2014-10-23 Pfizer Inc. N-piperidin-3-ylbenzamide derivatives for treating cardiovascular diseases
EA031393B1 (en) 2013-05-01 2018-12-28 Ионис Фармасьютикалз, Инк. Compositions and methods for modulating hbv and ttr expression
DE212013000295U1 (en) 2013-05-06 2016-02-02 Hitachi Chemical Co. America, Ltd. Devices for capturing target molecules
KR20160013110A (en) 2013-05-24 2016-02-03 로슈 이노베이션 센터 코펜하겐 에이/에스 Oligonucleotide modulators of b-cell cll/lymphoma 11a(bcl11a) and uses thereof
JP6472087B2 (en) 2013-05-30 2019-02-27 国立大学法人 東京医科歯科大学 Double-stranded agent for delivering therapeutic oligonucleotides
US10111953B2 (en) * 2013-05-30 2018-10-30 Regeneron Pharmaceuticals, Inc. Methods for reducing remnant cholesterol and other lipoprotein fractions by administering an inhibitor of proprotein convertase subtilisin kexin-9 (PCSK9)
CA2914721A1 (en) 2013-06-07 2014-12-11 Regeneron Pharmaceuticals, Inc. Methods for inhibiting atherosclerosis by administering an inhibitor of pcsk9
EP3010514B1 (en) 2013-06-16 2021-01-20 National University Corporation Tokyo Medical and Dental University Double-stranded antisense nucleic acid with exon-skipping effect
EA201592215A1 (en) 2013-06-27 2016-05-31 Рош Инновейшен Сентер Копенгаген А/С ANTISMINAL OLIGOMERS AND THEIR CONJUGATES AIMED AT PROPROTEIN CONVERTASY SUBTILYSINE / KEXIN TYPE 9 (PCSK9)
TWI657819B (en) 2013-07-19 2019-05-01 美商Ionis製藥公司 Compositions for modulating tau expression
WO2015023941A1 (en) 2013-08-16 2015-02-19 Rana Therapeutics, Inc. Oligonucleotides targeting euchromatin regions of genes
MY192689A (en) 2013-10-11 2022-09-01 Ionis Pharmaceuticals Inc Compositions for modulating c9orf72 expression
WO2015073494A1 (en) 2013-11-12 2015-05-21 Sanofi Dosing regimens for use with pcsk9 inhibitors
KR102198082B1 (en) 2013-12-24 2021-01-05 아이오니스 파마수티컬즈, 인코포레이티드 Modulation of angiopoietin-like 3 expression
CN105899663B (en) 2013-12-26 2019-07-26 学校法人东京医科大学 Manual simulation miRNA and application thereof for gene expression control
US10934542B2 (en) 2013-12-27 2021-03-02 Bonac Corporation Artificial match-type miRNA for controlling gene expression and use therefor
WO2015108047A1 (en) 2014-01-15 2015-07-23 株式会社新日本科学 Chiral nucleic acid adjuvant having immunity induction activity, and immunity induction activator
JPWO2015108046A1 (en) 2014-01-15 2017-03-23 株式会社新日本科学 Chiral nucleic acid adjuvant and antiallergic agent having antiallergic action
JPWO2015108048A1 (en) 2014-01-15 2017-03-23 株式会社新日本科学 Chiral nucleic acid adjuvant and antitumor agent having antitumor activity
KR20230152178A (en) 2014-01-16 2023-11-02 웨이브 라이프 사이언시스 리미티드 Chiral design
CA2946003A1 (en) 2014-05-01 2015-11-05 Ionis Pharmaceuticals, Inc. Compositions and methods for modulating angiopoietin-like 3 expression
ES2812099T3 (en) 2014-05-01 2021-03-16 Ionis Pharmaceuticals Inc Compositions and methods for modulating growth hormone receptor expression
BR112016022593B1 (en) * 2014-05-01 2022-04-26 Ionis Pharmaceuticals, Inc Oligomeric compounds, compositions comprising them, and uses thereof
GB201408623D0 (en) 2014-05-15 2014-07-02 Santaris Pharma As Oligomers and oligomer conjugates
WO2015179693A1 (en) 2014-05-22 2015-11-26 Isis Pharmaceuticals, Inc. Conjugated antisense compounds and their use
GB201410693D0 (en) 2014-06-16 2014-07-30 Univ Southampton Splicing modulation
AU2015289613B2 (en) 2014-07-16 2021-07-01 Regeneron Pharmaceuticals, Inc. Methods for treating patients with heterozygous familial hypercholesterolemia (heFH)
JP6680760B2 (en) * 2014-07-31 2020-04-15 アカデミア シニカAcademia Sinica Antagonist IC PD-1 aptamer and its application for use in cancer therapy
WO2016024205A1 (en) 2014-08-15 2016-02-18 Pfizer Inc. Oligomers targeting hexanucleotide repeat expansion in human c9orf72 gene
AU2015304945B2 (en) * 2014-08-20 2022-04-07 Lifesplice Pharma Llc Splice modulating oligonucleotides and methods of use thereof
WO2016040589A1 (en) 2014-09-12 2016-03-17 Alnylam Pharmaceuticals, Inc. Polynucleotide agents targeting complement component c5 and methods of use thereof
CA2960763A1 (en) 2014-09-16 2016-03-24 Regeneron Pharmaceuticals, Inc. Anti-glucagon antibodies and uses thereof
JP6867945B2 (en) 2014-10-03 2021-05-12 コールド スプリング ハーバー ラボラトリー Targeted enhancement of nuclear gene output
SG11201702877TA (en) 2014-10-10 2017-05-30 Hoffmann La Roche Galnac phosphoramidites, nucleic acid conjugates thereof and their use
WO2016061487A1 (en) 2014-10-17 2016-04-21 Alnylam Pharmaceuticals, Inc. Polynucleotide agents targeting aminolevulinic acid synthase-1 (alas1) and uses thereof
CA2966044A1 (en) 2014-10-30 2016-05-06 The General Hospital Corporation Methods for modulating atrx-dependent gene repression
EP3904519A1 (en) 2014-10-30 2021-11-03 Genzyme Corporation Polynucleotide agents targeting serpinc1 (at3) and methods of use thereof
US10266895B2 (en) 2014-11-05 2019-04-23 Hitachi Chemical Company Ltd. Exosomes and microvesicles in intestinal luminal fluids and stool and use of same for the assessment of inflammatory bowel disease
US10370719B2 (en) 2014-11-12 2019-08-06 Hitachi Chemical Co., Ltd. Method and device for diagnosing organ injury
CN114717264A (en) 2014-11-14 2022-07-08 沃雅戈治疗公司 Compositions and methods for treating Amyotrophic Lateral Sclerosis (ALS)
US10815481B2 (en) 2014-12-16 2020-10-27 Roche Innovation Center Copenhagen A/S Chiral library screen
WO2016104775A1 (en) 2014-12-27 2016-06-30 株式会社ボナック NATURALLY OCCURING miRNA FOR CONTROLLING GENE EXPRESSION, AND USE OF SAME
MX2017010066A (en) 2015-02-04 2017-11-01 Hoffmann La Roche Tau antisense oligomers and uses thereof.
ES2893114T3 (en) 2015-02-04 2022-02-08 Bristol Myers Squibb Co Methods for selecting therapeutic molecules
EP3256591A4 (en) 2015-02-13 2018-08-08 Translate Bio Ma, Inc. Hybrid oligonucleotides and uses thereof
US10900036B2 (en) 2015-03-17 2021-01-26 The General Hospital Corporation RNA interactome of polycomb repressive complex 1 (PRC1)
CA2981068C (en) 2015-03-26 2021-12-14 Women & Infants Hospital Of Rhode Island Therapy for malignant disease comprising the inhibition of human epididymal secretory protein e4 and immune checkpoint inhibitors
ES2926369T3 (en) 2015-03-27 2022-10-25 Bonac Corp Single-stranded nucleic acid molecule that has a delivery function and ability to control gene expression
WO2016164746A1 (en) 2015-04-08 2016-10-13 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of the lect2 gene
PL3283080T3 (en) 2015-04-16 2020-07-27 Ionis Pharmaceuticals, Inc. Compositions for modulating c9orf72 expression
WO2016205323A1 (en) 2015-06-18 2016-12-22 Alnylam Pharmaceuticals, Inc. Polynucleotde agents targeting hydroxyacid oxidase (glycolate oxidase, hao1) and methods of use thereof
EP3311165B1 (en) 2015-06-19 2020-12-09 University Of Rochester Septin proteins as novel biomarkers for detection and treatment of müllerian cancers
ES2917181T3 (en) * 2015-07-10 2022-07-07 Ionis Pharmaceuticals Inc Diacylglycerol acyltransferase 2 (DGAT2) modulators
MA43072A (en) 2015-07-22 2018-05-30 Wave Life Sciences Ltd COMPOSITIONS OF OLIGONUCLEOTIDES AND RELATED PROCESSES
JP2018523684A (en) 2015-08-18 2018-08-23 リジェネロン・ファーマシューティカルズ・インコーポレイテッドRegeneron Pharmaceuticals, Inc. Anti-PCSK9 inhibitory antibody for treating hyperlipidemic patients undergoing lipoprotein apheresis
US11028443B2 (en) 2015-08-31 2021-06-08 Showa Denko Materials Co., Ltd. Molecular methods for assessing urothelial disease
JP7014721B2 (en) 2015-09-18 2022-02-01 ディーエヌエーアールエックス Systems and methods for nucleic acid expression in vivo
SG11201802870RA (en) 2015-10-09 2018-05-30 Univ Southampton Modulation of gene expression and screening for deregulated protein expression
JP2018531037A (en) 2015-10-19 2018-10-25 アールエックスアイ ファーマシューティカルズ コーポレーション Reduced size self-delivering nucleic acid compounds targeting long non-coding RNAs
WO2017067970A1 (en) 2015-10-22 2017-04-27 Roche Innovation Center Copenhagen A/S In vitro toxicity screening assay
US11260073B2 (en) 2015-11-02 2022-03-01 Ionis Pharmaceuticals, Inc. Compounds and methods for modulating C90RF72
WO2017079739A1 (en) 2015-11-06 2017-05-11 Ionis Pharmaceuticals, Inc. MODULATING APOLIPOPROTEIN (a) EXPRESSION
KR102185465B1 (en) 2015-11-12 2020-12-03 에프. 호프만-라 로슈 아게 Oligonucleotides for inducing paternal UBE3A expression
US11096956B2 (en) 2015-12-14 2021-08-24 Stoke Therapeutics, Inc. Antisense oligomers and uses thereof
EP3933041B1 (en) 2015-12-14 2024-01-31 Cold Spring Harbor Laboratory Antisense oligomers for treatment of autosomal dominant retardation
JP6853537B2 (en) 2016-02-17 2021-03-31 国立大学法人東京工業大学 Artificial nucleosides and artificial nucleotides and artificial oligonucleotides
US11364258B2 (en) 2016-03-04 2022-06-21 Rhode Island Hospital Methods for treating chondrosarcoma using microrna(miR)
HUE053172T2 (en) 2016-03-14 2021-06-28 Hoffmann La Roche Oligonucleotides for reduction of pd-l1 expression
KR102468177B1 (en) 2016-04-14 2022-11-16 에프. 호프만-라 로슈 아게 Trityl-mono-GalNAc Compounds and Uses Thereof
SG11201809002RA (en) 2016-04-29 2018-11-29 Univ Nanyang Tech G-quadruplex-containing antisense oligonucleotides
WO2017194498A1 (en) * 2016-05-12 2017-11-16 Roche Innovation Center Copenhagen A/S Enhanced coupling of stereodefined oxazaphospholidine phosphoramidite monomers to nucleoside or oligonucleotide
MA45496A (en) 2016-06-17 2019-04-24 Hoffmann La Roche NUCLEIC ACID MOLECULES FOR PADD5 OR PAD7 MRNA REDUCTION FOR TREATMENT OF HEPATITIS B INFECTION
US11105794B2 (en) 2016-06-17 2021-08-31 Hoffmann-La Roche Inc. In vitro nephrotoxicity screening assay
WO2017216325A1 (en) 2016-06-17 2017-12-21 F. Hoffmann-La Roche Ag In vitro nephrotoxicity screening assay
JP7129702B2 (en) 2016-09-29 2022-09-02 国立大学法人 東京医科歯科大学 Double-stranded nucleic acid complex with overhangs
JOP20190065A1 (en) 2016-09-29 2019-03-28 Ionis Pharmaceuticals Inc Compounds and methods for reducing tau expression
KR20190065341A (en) 2016-10-06 2019-06-11 아이오니스 파마수티컬즈, 인코포레이티드 Method of joining oligomeric compounds
EP3529278A1 (en) 2016-10-20 2019-08-28 Regeneron Pharmaceuticals, Inc. Methods of lowering blood glucose levels
WO2018085656A1 (en) * 2016-11-03 2018-05-11 Ohio State Innovation Foundation Antisense oligomers targeting hoxb-as3 long non-coding rna
AU2017368050A1 (en) 2016-11-29 2019-06-20 Puretech Lyt, Inc. Exosomes for delivery of therapeutic agents
EP3568480A1 (en) 2017-01-13 2019-11-20 Roche Innovation Center Copenhagen A/S Antisense oligonucleotides for modulating nfkb2 expression
EP3568478A1 (en) 2017-01-13 2019-11-20 Roche Innovation Center Copenhagen A/S Antisense oligonucleotides for modulating rel expression
US20190345496A1 (en) 2017-01-13 2019-11-14 Roche Innovation Center Copenhagen A/S Antisense oligonucleotides for modulating relb expression
US20190367920A1 (en) 2017-01-13 2019-12-05 Roche Innovation Center Copenhagen A/S Antisense oligonucleotides for modulating nfkb1 expression
WO2018130581A1 (en) 2017-01-13 2018-07-19 Roche Innovation Center Copenhagen A/S Antisense oligonucleotides for modulating rela expression
WO2018143475A1 (en) 2017-02-06 2018-08-09 日産化学工業株式会社 Single-stranded oligonucleotide
US11261440B2 (en) 2017-02-21 2022-03-01 Osaka University Antisense oligonucleic acid
WO2018165564A1 (en) 2017-03-09 2018-09-13 Ionis Pharmaceuticals, Inc. Morpholino modified oligomeric compounds
CN110678202B (en) 2017-03-23 2023-04-14 Dnarx公司 Systems and methods for in vivo nucleic acid expression
JOP20190215A1 (en) * 2017-03-24 2019-09-19 Ionis Pharmaceuticals Inc Modulators of pcsk9 expression
EP3603648A4 (en) 2017-03-29 2020-12-30 Shionogi & Co., Ltd Complex of nucleic acid medicine and multibranched lipid
NO344051B1 (en) * 2017-05-04 2019-08-26 Patogen As Novel virus in Fish and Method for detection
WO2018204786A1 (en) 2017-05-05 2018-11-08 Voyager Therapeutics, Inc. Compositions and methods of treating amyotrophic lateral sclerosis (als)
EP3633036A4 (en) * 2017-05-26 2021-03-17 National Cerebral and Cardiovascular Center Antisense nucleic acid targeting pcsk9
EP3647423A4 (en) 2017-06-30 2021-03-24 National University Corporation Tokyo Medical and Dental University HETERO DOUBLE-STRANDED antimiR
TW201920671A (en) 2017-07-26 2019-06-01 日商日產化學股份有限公司 Single-stranded oligonucleotide
SG10202108375XA (en) 2017-08-25 2021-09-29 Stoke Therapeutics Inc Antisense oligomers for treatment of conditions and diseases
SG11202003461TA (en) 2017-10-16 2020-05-28 Hoffmann La Roche NUCLEIC ACID MOLECULE FOR REDUCTION OF PAPD5 AND PAPD7 mRNA FOR TREATING HEPATITIS B INFECTION
US20200237799A1 (en) 2017-10-16 2020-07-30 Voyager Therapeutics, Inc. Treatment of amyotrophic lateral sclerosis (als)
WO2019079240A1 (en) 2017-10-16 2019-04-25 Voyager Therapeutics, Inc. Treatment of amyotrophic lateral sclerosis (als)
CN111344408A (en) 2017-12-11 2020-06-26 哥本哈根罗氏创新中心 Oligonucleotides for modulating FNDC3B expression
BR112020012523A2 (en) 2017-12-21 2020-11-24 F. Hoffmann-La Roche Ag complementary diagnosis for htra1 rna antagonists
EP4074724A1 (en) 2017-12-22 2022-10-19 Roche Innovation Center Copenhagen A/S Oligonucleotides comprising a phosphorodithioate internucleoside linkage
US20200332289A1 (en) 2017-12-22 2020-10-22 Roche Innovation Center Copenhagen A/S Gapmer oligonucleotides comprising a phosphorodithioate internucleoside linkage
KR20200104302A (en) 2017-12-22 2020-09-03 로슈 이노베이션 센터 코펜하겐 에이/에스 New thiophosphoramidite
EP3737758A1 (en) 2018-01-10 2020-11-18 Roche Innovation Center Copenhagen A/S Oligonucleotides for modulating pias4 expression
EP3737761A1 (en) 2018-01-12 2020-11-18 Bristol-Myers Squibb Company Antisense oligonucleotides targeting alpha-synuclein and uses thereof
CR20200301A (en) 2018-01-12 2020-10-26 Roche Innovation Ct Copenhagen As Alpha-synuclein antisense oligonucleotides and uses thereof
JP2021510295A (en) 2018-01-12 2021-04-22 ロシュ イノベーション センター コペンハーゲン エーエス Oligonucleotides for regulating GSK3B expression
JP7455746B2 (en) 2018-01-12 2024-03-26 ブリストル-マイヤーズ スクイブ カンパニー Antisense oligonucleotides targeting alpha-synuclein and their uses
WO2019141656A1 (en) 2018-01-17 2019-07-25 Roche Innovation Center Copenhagen A/S Oligonucleotides for modulating erc1 expression
WO2019145386A1 (en) 2018-01-26 2019-08-01 Roche Innovation Center Copenhagen A/S Oligonucleotides for modulating csnk1d expression
JP2021513861A (en) 2018-02-21 2021-06-03 ブリストル−マイヤーズ スクイブ カンパニーBristol−Myers Squibb Company CAMK2D antisense oligonucleotide and its use
EP3760209B1 (en) 2018-02-28 2023-11-22 National University Corporation Tokyo Medical and Dental University Ischemic-lesion-site-specific gene therapy
JP7394392B2 (en) 2018-03-14 2023-12-08 国立大学法人 東京医科歯科大学 nucleic acid complex
JP7333079B2 (en) 2018-03-19 2023-08-24 国立大学法人 東京医科歯科大学 Nucleic acids with reduced toxicity
WO2019182037A1 (en) 2018-03-20 2019-09-26 国立大学法人東京工業大学 Antisense oligonucleotide having reduced toxicity
WO2019182109A1 (en) 2018-03-22 2019-09-26 国立大学法人東京医科歯科大学 Bbb-passing lipid ligand of hetero nucleic acid
SG11202009680XA (en) 2018-04-05 2020-10-29 Hoffmann La Roche Use of fubp1 inhibitors for treating hepatitis b virus infection
CU20200082A7 (en) 2018-05-09 2021-06-08 Ionis Pharmaceuticals Inc COMPOUNDS AND METHODS FOR REDUCING THE EXPRESSION OF FXI
EP3818161A1 (en) 2018-07-02 2021-05-12 Voyager Therapeutics, Inc. Treatment of amyotrophic lateral sclerosis and disorders associated with the spinal cord
PE20220013A1 (en) 2018-07-03 2022-01-11 Hoffmann La Roche OLIGONUCLEOTIDES TO MODULATE THE EXPRESSION OF TAU
EP3831408A4 (en) 2018-07-27 2021-11-17 Osaka University Composition for inhibiting aging, preventing, improving, or treating age-related diseases, or extending lifespan
MX2021001019A (en) 2018-07-31 2021-04-19 Roche Innovation Ct Copenhagen As Oligonucleotides comprising a phosphorotrithioate internucleoside linkage.
KR20210041537A (en) 2018-07-31 2021-04-15 로슈 이노베이션 센터 코펜하겐 에이/에스 Oligonucleotides Containing Linkages Between Phosphorotrithioate Nucleosides
KR20210081324A (en) 2018-08-02 2021-07-01 다인 세라퓨틱스, 인크. Muscle targeting complexes and their use for treating facioscapulohumeral muscular dystrophy
US11911484B2 (en) 2018-08-02 2024-02-27 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating myotonic dystrophy
EP3867382A4 (en) * 2018-10-18 2022-09-07 Murdoch University Antisense therapy for ptp1b related conditions
MX2021009949A (en) 2019-02-20 2021-09-21 Roche Innovation Ct Copenhagen As Novel phosphoramidites.
TW202102516A (en) 2019-02-20 2021-01-16 丹麥商羅氏創新中心哥本哈根有限公司 Phosphonoacetate gapmer oligonucleotides
JPWO2020184700A1 (en) 2019-03-14 2020-09-17
JPWO2020209285A1 (en) 2019-04-08 2020-10-15
US20220267778A1 (en) 2019-07-30 2022-08-25 Shionogi & Co., Ltd. Nucleic acid drug targeting murf1
EP4013872A1 (en) 2019-08-14 2022-06-22 Codiak BioSciences, Inc. Extracellular vesicles with antisense oligonucleotides targeting kras
JP2022544935A (en) 2019-08-14 2022-10-24 コディアック バイオサイエンシーズ, インコーポレイテッド Extracellular vesicles - NLRP3 antagonists
EP4013875A1 (en) 2019-08-14 2022-06-22 Codiak BioSciences, Inc. Extracellular vesicles with stat3-antisense oligonucleotides
US20230002764A1 (en) 2019-08-14 2023-01-05 Codiak Biosciences, Inc. Extracellular vesicle-aso constructs targeting cebp/beta
CN114729356A (en) 2019-08-14 2022-07-08 科迪亚克生物科学公司 Extracellular vesicle-ASO constructs targeting STAT6
EP4013767A4 (en) 2019-08-15 2023-10-25 Ionis Pharmaceuticals, Inc. Linkage modified oligomeric compounds and uses thereof
JP7017193B2 (en) * 2019-08-23 2022-02-08 国立大学法人東海国立大学機構 RNA action inhibitor and its use
US20220370491A1 (en) 2019-09-18 2022-11-24 National University Corporation Tokyo Medical And Dental University Nucleic acid complex
WO2021062058A1 (en) 2019-09-25 2021-04-01 Codiak Biosciences, Inc. Sting agonist comprising exosomes for treating neuroimmunological disorders
WO2021070959A1 (en) 2019-10-11 2021-04-15 国立大学法人東京医科歯科大学 Modified heteronucleic acid
JP2023509872A (en) 2019-12-24 2023-03-10 エフ. ホフマン-ラ ロシュ アーゲー Pharmaceutical combinations of antiviral agents targeting HBV and/or immunomodulatory agents for the treatment of HBV
EP4081639A1 (en) 2019-12-24 2022-11-02 F. Hoffmann-La Roche AG Pharmaceutical combination of a therapeutic oligonucleotide targeting hbv and a tlr7 agonist for treatment of hbv
WO2021153747A1 (en) 2020-01-31 2021-08-05 株式会社三和化学研究所 Antisense oligonucleotide of atn1
WO2021177418A1 (en) 2020-03-04 2021-09-10 日産化学株式会社 Antisense oligonucleotide of calm2
WO2021184020A1 (en) 2020-03-13 2021-09-16 Codiak Biosciences, Inc. Methods of treating neuroinflammation
WO2021184021A1 (en) 2020-03-13 2021-09-16 Codiak Biosciences, Inc. Extracellular vesicle-aso constructs targeting pmp22
US20230174981A1 (en) 2020-03-16 2023-06-08 National University Corporation Tokyo Medical And Dental University Heteronucleic acid containing morpholino nucleic acid
EP4121534A1 (en) 2020-03-18 2023-01-25 Alnylam Pharmaceuticals, Inc. Compositions and methods for treating subjects having a heterozygous alanine-glyoxylate aminotransferase gene (agxt) variant
JP2023525799A (en) 2020-05-11 2023-06-19 ストーク セラピューティクス,インク. OPA1 antisense oligomers for treatment of conditions and diseases
JPWO2021256297A1 (en) 2020-06-15 2021-12-23
WO2022076596A1 (en) 2020-10-06 2022-04-14 Codiak Biosciences, Inc. Extracellular vesicle-aso constructs targeting stat6
JP2024500035A (en) 2020-12-23 2024-01-04 アルゴノート アールエヌエー リミテッド Treatment of cardiovascular diseases
CN117157093A (en) 2021-02-17 2023-12-01 隆萨销售股份有限公司 Extracellular vesicle-NLRP 3 antagonists
KR20230166101A (en) 2021-04-01 2023-12-06 론자 세일즈 아게 Extracellular vesicle composition
EP4349986A1 (en) 2021-05-25 2024-04-10 National University Corporation Tokyo Medical and Dental University Heteronucleic acid containing scpbna or amna
EP4347829A1 (en) 2021-05-29 2024-04-10 1Globe Health Institute LLC Asymmetric short duplex dna as a novel gene silencing technology and use thereof
KR20240014533A (en) 2021-05-29 2024-02-01 1글로브 헬스 인스티튜트 엘엘씨 Short duplex DNA and its uses as a novel gene silencing technology
CN117412773A (en) 2021-05-31 2024-01-16 瑞纳治疗公司 Ligand binding nucleic acid complexes
US11638761B2 (en) 2021-07-09 2023-05-02 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating Facioscapulohumeral muscular dystrophy
US11633498B2 (en) 2021-07-09 2023-04-25 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating myotonic dystrophy
WO2023003805A1 (en) 2021-07-19 2023-01-26 Alnylam Pharmaceuticals, Inc. Methods and compositions for treating subjects having or at risk of developing a non-primary hyperoxaluria disease or disorder
WO2023013329A1 (en) 2021-08-04 2023-02-09 国立大学法人東京大学 Hairpin nucleic acid composition
WO2023022229A1 (en) 2021-08-19 2023-02-23 国立大学法人東京医科歯科大学 Modified heteronucleic acid containing morpholino nucleic acid
WO2023026994A1 (en) 2021-08-21 2023-03-02 武田薬品工業株式会社 Human transferrin receptor binding peptide-drug conjugate
WO2023034538A1 (en) * 2021-09-02 2023-03-09 Molecular Axiom, Llc Compositions and methods for modulating nlrp3 or nlrp1 expression
WO2023041508A2 (en) 2021-09-14 2023-03-23 Argonaute RNA Limited Treatment of cardiovascular disease
WO2023042876A1 (en) 2021-09-15 2023-03-23 国立大学法人東京医科歯科大学 Heteronucleic acid including 2'-modified nucleoside
CA3232420A1 (en) 2021-09-20 2023-03-23 Alnylam Pharmaceuticals, Inc. Inhibin subunit beta e (inhbe) modulator compositions and methods of use thereof
WO2023083906A2 (en) 2021-11-11 2023-05-19 F. Hoffmann-La Roche Ag Pharmaceutical combinations for treatment of hbv
DE102021131135A1 (en) 2021-11-26 2023-06-01 Zf Cv Systems Global Gmbh Radio communication module and method for making an emergency call via radio communication
WO2023111210A1 (en) 2021-12-17 2023-06-22 F. Hoffmann-La Roche Ag Combination of oligonucleotides for modulating rtel1 and fubp1
TW202400787A (en) 2022-03-16 2024-01-01 美商安彼瑞可股份有限公司 Galnac compositions for improving sirna bioavailability
US11931421B2 (en) 2022-04-15 2024-03-19 Dyne Therapeutics, Inc. Muscle targeting complexes and formulations for treating myotonic dystrophy
WO2024026474A1 (en) 2022-07-29 2024-02-01 Regeneron Pharmaceuticals, Inc. Compositions and methods for transferrin receptor (tfr)-mediated delivery to the brain and muscle
WO2024050261A1 (en) 2022-08-29 2024-03-07 University Of Rochester Antisense oligonucleotide-based anti-fibrotic therapeutics
EP4340411A1 (en) 2022-09-19 2024-03-20 Cellnex Italia S.p.A System for monitoring the operating state of the emergency call service into tunnels

Family Cites Families (261)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US469863A (en) * 1892-03-01 John marks
US3687808A (en) 1969-08-14 1972-08-29 Univ Leland Stanford Junior Synthetic polynucleotides
US4500707A (en) * 1980-02-29 1985-02-19 University Patents, Inc. Nucleosides useful in the preparation of polynucleotides
US5132418A (en) * 1980-02-29 1992-07-21 University Patents, Inc. Process for preparing polynucleotides
US4458066A (en) 1980-02-29 1984-07-03 University Patents, Inc. Process for preparing polynucleotides
US4469863A (en) 1980-11-12 1984-09-04 Ts O Paul O P Nonionic nucleic acid alkyl and aryl phosphonates and processes for manufacture and use thereof
US4415732A (en) 1981-03-27 1983-11-15 University Patents, Inc. Phosphoramidite compounds and processes
US4668777A (en) * 1981-03-27 1987-05-26 University Patents, Inc. Phosphoramidite nucleoside compounds
US4973679A (en) 1981-03-27 1990-11-27 University Patents, Inc. Process for oligonucleo tide synthesis using phosphormidite intermediates
US5023243A (en) * 1981-10-23 1991-06-11 Molecular Biosystems, Inc. Oligonucleotide therapeutic agent and method of making same
US4476301A (en) 1982-04-29 1984-10-09 Centre National De La Recherche Scientifique Oligonucleotides, a process for preparing the same and their application as mediators of the action of interferon
DE3329892A1 (en) * 1983-08-18 1985-03-07 Köster, Hubert, Prof. Dr., 2000 Hamburg METHOD FOR PRODUCING OLIGONUCLEOTIDES
USRE34069E (en) 1983-08-18 1992-09-15 Biosyntech Gmbh Process for the preparation of oligonucleotides
US5118800A (en) * 1983-12-20 1992-06-02 California Institute Of Technology Oligonucleotides possessing a primary amino group in the terminal nucleotide
US5550111A (en) 1984-07-11 1996-08-27 Temple University-Of The Commonwealth System Of Higher Education Dual action 2',5'-oligoadenylate antiviral derivatives and uses thereof
FR2567892B1 (en) 1984-07-19 1989-02-17 Centre Nat Rech Scient NOVEL OLIGONUCLEOTIDES, THEIR PREPARATION PROCESS AND THEIR APPLICATIONS AS MEDIATORS IN DEVELOPING THE EFFECTS OF INTERFERONS
US5367066A (en) 1984-10-16 1994-11-22 Chiron Corporation Oligonucleotides with selectably cleavable and/or abasic sites
FR2575751B1 (en) * 1985-01-08 1987-04-03 Pasteur Institut NOVEL ADENOSINE DERIVATIVE NUCLEOSIDES, THEIR PREPARATION AND THEIR BIOLOGICAL APPLICATIONS
US5185444A (en) 1985-03-15 1993-02-09 Anti-Gene Deveopment Group Uncharged morpolino-based polymers having phosphorous containing chiral intersubunit linkages
US5166315A (en) 1989-12-20 1992-11-24 Anti-Gene Development Group Sequence-specific binding polymers for duplex nucleic acids
US5034506A (en) * 1985-03-15 1991-07-23 Anti-Gene Development Group Uncharged morpholino-based polymers having achiral intersubunit linkages
US5405938A (en) * 1989-12-20 1995-04-11 Anti-Gene Development Group Sequence-specific binding polymers for duplex nucleic acids
US5235033A (en) 1985-03-15 1993-08-10 Anti-Gene Development Group Alpha-morpholino ribonucleoside derivatives and polymers thereof
DE3788914T2 (en) 1986-09-08 1994-08-25 Ajinomoto Kk Compounds for cleaving RNA at a specific position, oligomers used in the preparation of these compounds and starting materials for the synthesis of these oligomers.
US5276019A (en) 1987-03-25 1994-01-04 The United States Of America As Represented By The Department Of Health And Human Services Inhibitors for replication of retroviruses and for the expression of oncogene products
US5264423A (en) 1987-03-25 1993-11-23 The United States Of America As Represented By The Department Of Health And Human Services Inhibitors for replication of retroviruses and for the expression of oncogene products
DE3851889T2 (en) 1987-06-24 1995-04-13 Florey Howard Inst NUCLEOSIDE DERIVATIVES.
US5712257A (en) 1987-08-12 1998-01-27 Hem Research, Inc. Topically active compositions of mismatched dsRNAs
US5188897A (en) * 1987-10-22 1993-02-23 Temple University Of The Commonwealth System Of Higher Education Encapsulated 2',5'-phosphorothioate oligoadenylates
US4924624A (en) * 1987-10-22 1990-05-15 Temple University-Of The Commonwealth System Of Higher Education 2,',5'-phosphorothioate oligoadenylates and plant antiviral uses thereof
ATE151467T1 (en) 1987-11-30 1997-04-15 Univ Iowa Res Found DNA MOLECULES STABILIZED BY MODIFICATIONS TO THE 3'-TERMINAL PHOSPHODIESTER BOND, THEIR USE AS NUCLEIC ACID PROBE AND AS THERAPEUTIC AGENTS FOR INHIBITING THE EXPRESSION OF SPECIFIC TARGET GENES
US5403711A (en) * 1987-11-30 1995-04-04 University Of Iowa Research Foundation Nucleic acid hybridization and amplification method for detection of specific sequences in which a complementary labeled nucleic acid probe is cleaved
IE61148B1 (en) 1988-03-10 1994-10-05 Ici Plc Method of detecting nucleotide sequences
EP0406309A4 (en) * 1988-03-25 1992-08-19 The University Of Virginia Alumni Patents Foundation Oligonucleotide n-alkylphosphoramidates
US5278302A (en) 1988-05-26 1994-01-11 University Patents, Inc. Polynucleotide phosphorodithioates
US5216141A (en) 1988-06-06 1993-06-01 Benner Steven A Oligonucleotide analogs containing sulfur linkages
US5175273A (en) 1988-07-01 1992-12-29 Genentech, Inc. Nucleic acid intercalating agents
US5194599A (en) 1988-09-23 1993-03-16 Gilead Sciences, Inc. Hydrogen phosphonodithioate compositions
US5256775A (en) 1989-06-05 1993-10-26 Gilead Sciences, Inc. Exonuclease-resistant oligonucleotides
US5134066A (en) * 1989-08-29 1992-07-28 Monsanto Company Improved probes using nucleosides containing 3-dezauracil analogs
US5591722A (en) 1989-09-15 1997-01-07 Southern Research Institute 2'-deoxy-4'-thioribonucleosides and their antiviral activity
US5721218A (en) * 1989-10-23 1998-02-24 Gilead Sciences, Inc. Oligonucleotides with inverted polarity
US5399676A (en) * 1989-10-23 1995-03-21 Gilead Sciences Oligonucleotides with inverted polarity
EP0942000B1 (en) 1989-10-24 2004-06-23 Isis Pharmaceuticals, Inc. 2'-Modified oligonucleotides
US5264562A (en) 1989-10-24 1993-11-23 Gilead Sciences, Inc. Oligonucleotide analogs with novel linkages
US5264564A (en) 1989-10-24 1993-11-23 Gilead Sciences Oligonucleotide analogs with novel linkages
US5177198A (en) 1989-11-30 1993-01-05 University Of N.C. At Chapel Hill Process for preparing oligoribonucleoside and oligodeoxyribonucleoside boranophosphates
US5130302A (en) 1989-12-20 1992-07-14 Boron Bilogicals, Inc. Boronated nucleoside, nucleotide and oligonucleotide compounds, compositions and methods for using same
US5681941A (en) 1990-01-11 1997-10-28 Isis Pharmaceuticals, Inc. Substituted purines and oligonucleotide cross-linking
US5623065A (en) * 1990-08-13 1997-04-22 Isis Pharmaceuticals, Inc. Gapped 2' modified oligonucleotides
US5587470A (en) * 1990-01-11 1996-12-24 Isis Pharmaceuticals, Inc. 3-deazapurines
US5646265A (en) 1990-01-11 1997-07-08 Isis Pharmceuticals, Inc. Process for the preparation of 2'-O-alkyl purine phosphoramidites
US5670633A (en) 1990-01-11 1997-09-23 Isis Pharmaceuticals, Inc. Sugar modified oligonucleotides that detect and modulate gene expression
US6005087A (en) 1995-06-06 1999-12-21 Isis Pharmaceuticals, Inc. 2'-modified oligonucleotides
US5459255A (en) 1990-01-11 1995-10-17 Isis Pharmaceuticals, Inc. N-2 substituted purines
US5872232A (en) * 1990-01-11 1999-02-16 Isis Pharmaceuticals Inc. 2'-O-modified oligonucleotides
US5587361A (en) 1991-10-15 1996-12-24 Isis Pharmaceuticals, Inc. Oligonucleotides having phosphorothioate linkages of high chiral purity
US5220007A (en) * 1990-02-15 1993-06-15 The Worcester Foundation For Experimental Biology Method of site-specific alteration of RNA and production of encoded polypeptides
US5149797A (en) 1990-02-15 1992-09-22 The Worcester Foundation For Experimental Biology Method of site-specific alteration of rna and production of encoded polypeptides
US5321131A (en) * 1990-03-08 1994-06-14 Hybridon, Inc. Site-specific functionalization of oligodeoxynucleotides for non-radioactive labelling
US5470967A (en) 1990-04-10 1995-11-28 The Dupont Merck Pharmaceutical Company Oligonucleotide analogs with sulfamate linkages
GB9009980D0 (en) * 1990-05-03 1990-06-27 Amersham Int Plc Phosphoramidite derivatives,their preparation and the use thereof in the incorporation of reporter groups on synthetic oligonucleotides
DK0455905T3 (en) 1990-05-11 1998-12-07 Microprobe Corp Dipsticks for nucleic acid hybridization assays and method for covalent immobilization of oligonucleotides
US5623070A (en) 1990-07-27 1997-04-22 Isis Pharmaceuticals, Inc. Heteroatomic oligonucleoside linkages
US5618704A (en) 1990-07-27 1997-04-08 Isis Pharmacueticals, Inc. Backbone-modified oligonucleotide analogs and preparation thereof through radical coupling
US5378825A (en) 1990-07-27 1995-01-03 Isis Pharmaceuticals, Inc. Backbone modified oligonucleotide analogs
US5610289A (en) * 1990-07-27 1997-03-11 Isis Pharmaceuticals, Inc. Backbone modified oligonucleotide analogues
US5489677A (en) 1990-07-27 1996-02-06 Isis Pharmaceuticals, Inc. Oligonucleoside linkages containing adjacent oxygen and nitrogen atoms
US5608046A (en) 1990-07-27 1997-03-04 Isis Pharmaceuticals, Inc. Conjugated 4'-desmethyl nucleoside analog compounds
US5223618A (en) 1990-08-13 1993-06-29 Isis Pharmaceuticals, Inc. 4'-desmethyl nucleoside analog compounds
US5541307A (en) 1990-07-27 1996-07-30 Isis Pharmaceuticals, Inc. Backbone modified oligonucleotide analogs and solid phase synthesis thereof
US5677437A (en) 1990-07-27 1997-10-14 Isis Pharmaceuticals, Inc. Heteroatomic oligonucleoside linkages
US5602240A (en) * 1990-07-27 1997-02-11 Ciba Geigy Ag. Backbone modified oligonucleotide analogs
US5386023A (en) * 1990-07-27 1995-01-31 Isis Pharmaceuticals Backbone modified oligonucleotide analogs and preparation thereof through reductive coupling
ATE154246T1 (en) * 1990-07-27 1997-06-15 Isis Pharmaceuticals Inc NUCLEASE RESISTANT PYRIMIDINE MODIFIED OLIGONUCLEOTIDES THAT DETECTE AND MODULATE GENE EXPRESSION
WO1992002534A2 (en) 1990-08-03 1992-02-20 Sterling Drug, Inc. Compounds and methods for inhibiting gene expression
US6852536B2 (en) * 2001-12-18 2005-02-08 Isis Pharmaceuticals, Inc. Antisense modulation of CD36L 1 expression
US5177196A (en) * 1990-08-16 1993-01-05 Microprobe Corporation Oligo (α-arabinofuranosyl nucleotides) and α-arabinofuranosyl precursors thereof
US5214134A (en) * 1990-09-12 1993-05-25 Sterling Winthrop Inc. Process of linking nucleosides with a siloxane bridge
US5561225A (en) 1990-09-19 1996-10-01 Southern Research Institute Polynucleotide analogs containing sulfonate and sulfonamide internucleoside linkages
WO1992005186A1 (en) 1990-09-20 1992-04-02 Gilead Sciences Modified internucleoside linkages
US5432272A (en) 1990-10-09 1995-07-11 Benner; Steven A. Method for incorporating into a DNA or RNA oligonucleotide using nucleotides bearing heterocyclic bases
US5220006A (en) 1990-10-23 1993-06-15 The United States Of America As Represented By The Department Of Health And Human Services Identification of a suppressor of atherogenic apolipoprotein
US6582908B2 (en) * 1990-12-06 2003-06-24 Affymetrix, Inc. Oligonucleotides
JPH06505152A (en) * 1990-12-21 1994-06-16 ザ ロックフェラー ユニヴァーシティ Liver-accumulating transcription factors
US5672697A (en) 1991-02-08 1997-09-30 Gilead Sciences, Inc. Nucleoside 5'-methylene phosphonates
US5965722A (en) * 1991-05-21 1999-10-12 Isis Pharmaceuticals, Inc. Antisense inhibition of ras gene with chimeric and alternating oligonucleotides
US5578444A (en) * 1991-06-27 1996-11-26 Genelabs Technologies, Inc. Sequence-directed DNA-binding molecules compositions and methods
AU659482B2 (en) 1991-06-28 1995-05-18 Massachusetts Institute Of Technology Localized oligonucleotide therapy
US5571799A (en) 1991-08-12 1996-11-05 Basco, Ltd. (2'-5') oligoadenylate analogues useful as inhibitors of host-v5.-graft response
US5877009A (en) * 1991-08-16 1999-03-02 Trustees Of Boston University Isolated ApoA-I gene regulatory sequence elements
DE4129653A1 (en) 1991-09-06 1993-03-11 Boehringer Mannheim Gmbh PROCESS FOR DETECTION OF SIMILAR NUCLEIC ACIDS
US5408038A (en) 1991-10-09 1995-04-18 The Scripps Research Institute Nonnatural apolipoprotein B-100 peptides and apolipoprotein B-100-apolipoprotein A-I fusion peptides
EP0538194B1 (en) 1991-10-17 1997-06-04 Novartis AG Bicyclic nucleosides, oligonucleotides, their method of preparation and intermediates therein
US5594121A (en) 1991-11-07 1997-01-14 Gilead Sciences, Inc. Enhanced triple-helix and double-helix formation with oligomers containing modified purines
US5484908A (en) * 1991-11-26 1996-01-16 Gilead Sciences, Inc. Oligonucleotides containing 5-propynyl pyrimidines
TW393513B (en) 1991-11-26 2000-06-11 Isis Pharmaceuticals Inc Enhanced triple-helix and double-helix formation with oligomers containing modified pyrimidines
DE637965T1 (en) * 1991-11-26 1995-12-14 Gilead Sciences Inc INCREASED FORMATION OF TRIPLE AND DOUBLE HELICOS FROM OLIGOMERS WITH MODIFIED PYRIMIDINES.
US5792608A (en) 1991-12-12 1998-08-11 Gilead Sciences, Inc. Nuclease stable and binding competent oligomers and methods for their use
US5359044A (en) * 1991-12-13 1994-10-25 Isis Pharmaceuticals Cyclobutyl oligonucleotide surrogates
EP0726963A4 (en) * 1991-12-23 1998-05-13 Chiron Corp -i(CHLAMYDIAE) PROBES FOR USE IN SOLUTION PHASE SANDWICH HYBRIDIZATION ASSAYS
US5700922A (en) 1991-12-24 1997-12-23 Isis Pharmaceuticals, Inc. PNA-DNA-PNA chimeric macromolecules
FR2687679B1 (en) * 1992-02-05 1994-10-28 Centre Nat Rech Scient OLIGOTHIONUCLEOTIDES.
US5633360A (en) 1992-04-14 1997-05-27 Gilead Sciences, Inc. Oligonucleotide analogs capable of passive cell membrane permeation
FR2692265B1 (en) 1992-05-25 1996-11-08 Centre Nat Rech Scient BIOLOGICALLY ACTIVE COMPOUNDS OF THE PHOSPHOTRIESTER TYPE.
US5434257A (en) * 1992-06-01 1995-07-18 Gilead Sciences, Inc. Binding compentent oligomers containing unsaturated 3',5' and 2',5' linkages
NL9300058A (en) * 1992-06-18 1994-01-17 Stichting Rega V Z W 1,5-ANHYDROHEXITOL NUCLEOSIDE ANALOGA AND PHARMACEUTICAL USE THEREOF.
EP0577558A2 (en) 1992-07-01 1994-01-05 Ciba-Geigy Ag Carbocyclic nucleosides having bicyclic rings, oligonucleotides therefrom, process for their preparation, their use and intermediates
US5652355A (en) 1992-07-23 1997-07-29 Worcester Foundation For Experimental Biology Hybrid oligonucleotide phosphorothioates
JPH08502723A (en) 1992-07-27 1996-03-26 ハイブライドン インコーポレイテッド Oligonucleotide alkylphosphonothioate
US6180403B1 (en) 1999-10-28 2001-01-30 Isis Pharmaceuticals Inc. Antisense inhibition of tumor necrosis factor alpha converting enzyme (TACE) expression
JPH08504559A (en) 1992-12-14 1996-05-14 ハネウエル・インコーポレーテッド Motor system with individually controlled redundant windings
CN1121721A (en) 1993-01-25 1996-05-01 海布里顿公司 Oligonucleotido alky phosphate and alky substituted phosphate
US5476925A (en) 1993-02-01 1995-12-19 Northwestern University Oligodeoxyribonucleotides including 3'-aminonucleoside-phosphoramidate linkages and terminal 3'-amino groups
US5434058A (en) 1993-02-09 1995-07-18 Arch Development Corporation Apolipoprotein B MRNA editing protein compositions and methods
IL108340A (en) * 1993-03-04 1996-10-16 Innova Sa Citric acid extraction
GB9304618D0 (en) 1993-03-06 1993-04-21 Ciba Geigy Ag Chemical compounds
GB9304620D0 (en) 1993-03-06 1993-04-21 Ciba Geigy Ag Compounds
EP0691968B1 (en) 1993-03-30 1997-07-16 Sanofi Acyclic nucleoside analogs and oligonucleotide sequences containing them
EP0691977B1 (en) 1993-03-31 1997-11-26 Sanofi Oligonucleotides with amide linkages replacing phosphodiester linkages
HU9501994D0 (en) 1993-03-31 1995-09-28 Sterling Winthrop Inc Novel 5'-substituted nucleosides and oligomers produced therefrom
DE4311944A1 (en) 1993-04-10 1994-10-13 Degussa Coated sodium percarbonate particles, process for their preparation and detergent, cleaning and bleaching compositions containing them
FR2705099B1 (en) 1993-05-12 1995-08-04 Centre Nat Rech Scient Phosphorothioate triester oligonucleotides and process for their preparation.
US5502177A (en) * 1993-09-17 1996-03-26 Gilead Sciences, Inc. Pyrimidine derivatives for labeled binding partners
US5801154A (en) 1993-10-18 1998-09-01 Isis Pharmaceuticals, Inc. Antisense oligonucleotide modulation of multidrug resistance-associated protein
US6235470B1 (en) 1993-11-12 2001-05-22 The Johns Hopkins University School Of Medicine Detection of neoplasia by analysis of saliva
US5457187A (en) 1993-12-08 1995-10-10 Board Of Regents University Of Nebraska Oligonucleotides containing 5-fluorouracil
DE69425903T2 (en) 1993-12-09 2001-02-15 Thomas Jefferson University Ph CONNECTIONS AND METHOD FOR LOCATION-SPECIFIC MUTATION IN EUKARYOTIC CELLS
US5446137B1 (en) 1993-12-09 1998-10-06 Behringwerke Ag Oligonucleotides containing 4'-substituted nucleotides
US5519134A (en) 1994-01-11 1996-05-21 Isis Pharmaceuticals, Inc. Pyrrolidine-containing monomers and oligomers
US5596091A (en) 1994-03-18 1997-01-21 The Regents Of The University Of California Antisense oligonucleotides comprising 5-aminoalkyl pyrimidine nucleotides
US5627053A (en) * 1994-03-29 1997-05-06 Ribozyme Pharmaceuticals, Inc. 2'deoxy-2'-alkylnucleotide containing nucleic acid
US5625050A (en) * 1994-03-31 1997-04-29 Amgen Inc. Modified oligonucleotides and intermediates useful in nucleic acid therapeutics
US5646269A (en) * 1994-04-28 1997-07-08 Gilead Sciences, Inc. Method for oligonucleotide analog synthesis
US6103890A (en) 1994-05-18 2000-08-15 Ribozyme Pharmaceuticals, Inc. Enzymatic nucleic acids that cleave C-fos
US5525711A (en) * 1994-05-18 1996-06-11 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Pteridine nucleotide analogs as fluorescent DNA probes
US5656612A (en) 1994-05-31 1997-08-12 Isis Pharmaceuticals, Inc. Antisense oligonucleotide modulation of raf gene expression
US5485908A (en) * 1994-07-12 1996-01-23 Coin Acceptors, Inc. Pattern recognition using artificial neural network for coin validation
US5618065A (en) * 1994-07-21 1997-04-08 Hitachi Metals, Ltd. Electric welding pipe joint having a two layer outer member
US5597909A (en) 1994-08-25 1997-01-28 Chiron Corporation Polynucleotide reagents containing modified deoxyribose moieties, and associated methods of synthesis and use
US5792747A (en) 1995-01-24 1998-08-11 The Administrators Of The Tulane Educational Fund Highly potent agonists of growth hormone releasing hormone
US5652356A (en) 1995-08-17 1997-07-29 Hybridon, Inc. Inverted chimeric and hybrid oligonucleotides
KR0185334B1 (en) 1995-11-02 1999-04-01 김은영 Cdna coding mouse antibody of apolipoprotein b-100
WO1997035538A2 (en) 1996-03-26 1997-10-02 Glaxo Group Limited Tumor necrosis factor alpha convertase
WO1998022489A1 (en) 1996-11-18 1998-05-28 Takeshi Imanishi Novel nucleotide analogues
AU6435698A (en) 1997-02-20 1998-09-09 Johns Hopkins School Of Medicine, The Control of (il4) production as a therapeutic regulator of immune function
JP3756313B2 (en) 1997-03-07 2006-03-15 武 今西 Novel bicyclonucleosides and oligonucleotide analogues
US6770748B2 (en) 1997-03-07 2004-08-03 Takeshi Imanishi Bicyclonucleoside and oligonucleotide analogue
US6133246A (en) 1997-08-13 2000-10-17 Isis Pharmaceuticals Inc. Antisense oligonucleotide compositions and methods for the modulation of JNK proteins
US6794499B2 (en) 1997-09-12 2004-09-21 Exiqon A/S Oligonucleotide analogues
CA2303299C (en) 1997-09-12 2016-02-23 Exiqon A/S Oligonucleotide analogues
GB9721240D0 (en) 1997-10-08 1997-12-03 Zeneca Ltd Assay
US6156315A (en) 1997-10-10 2000-12-05 The Trustees Of Columbia University In The City Of New York Method for inhibiting the binding of low density lipoprotein to blood vessel matrix
EP0911344B1 (en) 1997-10-15 2004-03-03 Fujirebio Inc. Anti-Apo-B-48 monoclonal antibody, hybridoma, and methods of use
DE69926729T2 (en) 1998-01-08 2006-06-08 Aventis Pharmaceuticals Inc. Transgenic RABBIT EXPRESSING A FUNCTIONAL HUMAN LIPOPROTEIN (A)
US6238921B1 (en) 1998-03-26 2001-05-29 Isis Pharmaceuticals, Inc. Antisense oligonucleotide modulation of human mdm2 expression
US6949367B1 (en) 1998-04-03 2005-09-27 Epoch Pharmaceuticals, Inc. Modified oligonucleotides for mismatch discrimination
US20030228597A1 (en) 1998-04-13 2003-12-11 Cowsert Lex M. Identification of genetic targets for modulation by oligonucleotides and generation of oligonucleotides for gene modulation
US6300319B1 (en) 1998-06-16 2001-10-09 Isis Pharmaceuticals, Inc. Targeted oligonucleotide conjugates
US6007995A (en) 1998-06-26 1999-12-28 Isis Pharmaceuticals Inc. Antisense inhibition of TNFR1 expression
EP0979869A1 (en) 1998-08-07 2000-02-16 Hoechst Marion Roussel Deutschland GmbH Short oligonucleotides for the inhibition of VEGF expression
US6043352A (en) 1998-08-07 2000-03-28 Isis Pharmaceuticals, Inc. 2'-O-Dimethylaminoethyloxyethyl-modified oligonucleotides
US5945290A (en) 1998-09-18 1999-08-31 Isis Pharmaceuticals, Inc. Antisense modulation of RhoA expression
US6410323B1 (en) * 1999-08-31 2002-06-25 Isis Pharmaceuticals, Inc. Antisense modulation of human Rho family gene expression
US6172216B1 (en) 1998-10-07 2001-01-09 Isis Pharmaceuticals Inc. Antisense modulation of BCL-X expression
EP1152009B2 (en) 1999-02-12 2017-09-06 Daiichi Sankyo Company, Limited Novel nucleosides and oligonucleotide analogues
US6436640B1 (en) 1999-03-18 2002-08-20 Exiqon A/S Use of LNA in mass spectrometry
ATE501269T1 (en) 1999-03-18 2011-03-15 Exiqon As DETECTION OF GENE MUTATIONS USING LNA PRIMER
EP1161561B1 (en) 1999-03-18 2005-12-28 Exiqon A/S One step sample preparation and detection of nucleic acids in complex biological samples
US7084125B2 (en) 1999-03-18 2006-08-01 Exiqon A/S Xylo-LNA analogues
US6140124A (en) * 1999-04-06 2000-10-31 Isis Pharmaceuticals Inc. Antisense modulation of P38 mitogen activated protein kinase expression
US20040171566A1 (en) 1999-04-06 2004-09-02 Monia Brett P. Antisense modulation of p38 mitogen activated protein kinase expression
US5998148A (en) 1999-04-08 1999-12-07 Isis Pharmaceuticals Inc. Antisense modulation of microtubule-associated protein 4 expression
ATE356824T1 (en) 1999-05-04 2007-04-15 Santaris Pharma As L-RIBO-LNA ANALOGUE
US6525191B1 (en) * 1999-05-11 2003-02-25 Kanda S. Ramasamy Conformationally constrained L-nucleosides
US6033910A (en) 1999-07-19 2000-03-07 Isis Pharmaceuticals Inc. Antisense inhibition of MAP kinase kinase 6 expression
JP4151751B2 (en) 1999-07-22 2008-09-17 第一三共株式会社 New bicyclonucleoside analogues
AU6910100A (en) 1999-08-18 2001-03-13 Lawrence Chan Apolipoprotein b mrna-specific ribozyme
NZ517929A (en) 1999-09-25 2004-02-27 Univ Iowa Res Found Immunostimulatory nucleic acids
AU2911601A (en) * 1999-12-23 2001-07-03 Bristol-Myers Squibb Company Novel immunoglobulin superfamily members apex-1, apex-2 and apex-3 and uses thereof
CA2395320A1 (en) 1999-12-23 2001-07-05 Exiqon A/S Therapeutic uses of lna-modified oligonucleotides
US6261840B1 (en) 2000-01-18 2001-07-17 Isis Pharmaceuticals, Inc. Antisense modulation of PTP1B expression
US20020055479A1 (en) * 2000-01-18 2002-05-09 Cowsert Lex M. Antisense modulation of PTP1B expression
US6602857B1 (en) 2000-01-18 2003-08-05 Isis Pharmaceuticals, Inc. Antisense modulation of PTP1B expression
US7179796B2 (en) 2000-01-18 2007-02-20 Isis Pharmaceuticals, Inc. Antisense modulation of PTP1B expression
AU2001229501A1 (en) 2000-01-24 2001-07-31 Isis Pharmaceuticals, Inc. Antisense modulation of inducible nitric oxide synthase expression
US20030064950A1 (en) * 2001-02-23 2003-04-03 Ntambi James M. Methods for reducing body fat and increasing lean body mass by reducing stearoyl-CoA desaturase 1 activity
AU2000240366B2 (en) 2000-03-28 2005-08-04 Isis Pharmaceuticals, Inc. Alteration of cellular behavior by antisense modulation of mRNA processing
EP1268856A2 (en) 2000-04-07 2003-01-02 Epigenomics AG Detection of single nucleotide polymorphisms (snp's) and cytosine-methylations
WO2001079555A2 (en) * 2000-04-14 2001-10-25 Millennium Pharmaceuticals, Inc. Roles of jak/stat family members in tolerance induction
EP1314734A1 (en) 2000-08-29 2003-05-28 Takeshi Imanishi Novel nucleoside analogs and oligonucleotide derivatives containing these analogs
US20040024144A1 (en) * 2000-09-14 2004-02-05 Robert Solomon Aqueous dispersions of comb copolymers and coatings produced therefrom
AU2002211373A1 (en) 2000-09-29 2002-04-08 Genaissance Pharmaceuticals, Inc. Haplotypes of the por gene
US6426220B1 (en) 2000-10-30 2002-07-30 Isis Pharmaceuticals, Inc. Antisense modulation of calreticulin expression
US20030008373A1 (en) * 2001-04-17 2003-01-09 Myriad Genetics, Incorporated APOA1-interacting proteins and use thereof
JP2002355074A (en) 2001-01-24 2002-12-10 Univ Tsukuba Nucleic acid molecule and polypeptide specific to enteropathogenic escherichia coli o157:h7 and method for using the same
EP1239051A3 (en) 2001-01-30 2004-03-17 Aeomica, Inc. Human posh-like protein 1
US6660737B2 (en) 2001-05-04 2003-12-09 The Procter & Gamble Company Medicinal uses of hydrazones
US6878729B2 (en) 2001-05-04 2005-04-12 The Procter & Gamble Company Medicinal uses of dihydropyrazoles
US20030125241A1 (en) 2001-05-18 2003-07-03 Margit Wissenbach Therapeutic uses of LNA-modified oligonucleotides in infectious diseases
US20050019915A1 (en) 2001-06-21 2005-01-27 Bennett C. Frank Antisense modulation of superoxide dismutase 1, soluble expression
US7425545B2 (en) * 2001-07-25 2008-09-16 Isis Pharmaceuticals, Inc. Modulation of C-reactive protein expression
US6964950B2 (en) 2001-07-25 2005-11-15 Isis Pharmaceuticals, Inc. Antisense modulation of C-reactive protein expression
US7407943B2 (en) 2001-08-01 2008-08-05 Isis Pharmaceuticals, Inc. Antisense modulation of apolipoprotein B expression
US7888324B2 (en) * 2001-08-01 2011-02-15 Genzyme Corporation Antisense modulation of apolipoprotein B expression
EP1446412B1 (en) * 2001-09-04 2012-03-07 Exiqon A/S Novel lna compositions and uses thereof
US7297485B2 (en) * 2001-10-15 2007-11-20 Qiagen Gmbh Method for nucleic acid amplification that results in low amplification bias
JP2006508632A (en) 2002-03-01 2006-03-16 ラブジェン, インコーポレイテッド Methods for detecting genetic diseases
WO2003085110A2 (en) * 2002-04-05 2003-10-16 Santaris Pharma A/S Oligomeric compounds for the modulation hif-1alpha expression
US7569575B2 (en) 2002-05-08 2009-08-04 Santaris Pharma A/S Synthesis of locked nucleic acid derivatives
AU2003237875A1 (en) 2002-05-15 2003-12-02 Isis Pharmaceuticals, Inc. Antisense modulation of apolipoprotein b expression
JP2005525829A (en) * 2002-05-20 2005-09-02 ファルマシア・コーポレーション Antisense regulation of glucocorticoid receptor expression
US7393950B2 (en) 2002-08-29 2008-07-01 Hong Kong University Of Science & Technology Antisense oligonucleotides targeted to human CDC45
US20040219565A1 (en) 2002-10-21 2004-11-04 Sakari Kauppinen Oligonucleotides useful for detecting and analyzing nucleic acids of interest
CA2505090A1 (en) 2002-11-05 2004-05-27 Isis Pharmaceuticals, Inc. Conjugated oligomeric compounds and their use in gene modulation
AU2003291753B2 (en) 2002-11-05 2010-07-08 Isis Pharmaceuticals, Inc. Polycyclic sugar surrogate-containing oligomeric compounds and compositions for use in gene modulation
EP1560839A4 (en) * 2002-11-05 2008-04-23 Isis Pharmaceuticals Inc Chimeric oligomeric compounds and their use in gene modulation
US7511131B2 (en) * 2002-11-13 2009-03-31 Genzyme Corporation Antisense modulation of apolipoprotein B expression
EP1569695B1 (en) * 2002-11-13 2013-05-15 Genzyme Corporation Antisense modulation of apolipoprotein b expression
US20060009410A1 (en) 2002-11-13 2006-01-12 Crooke Rosanne M Effects of apolipoprotein B inhibition on gene expression profiles in animals
JP2006507841A (en) 2002-11-14 2006-03-09 ダーマコン, インコーポレイテッド Functional and ultrafunctional siRNA
DK2752488T3 (en) * 2002-11-18 2020-04-20 Roche Innovation Ct Copenhagen As Antisense design
KR20050090437A (en) 2003-01-03 2005-09-13 브리스톨-마이어스 스큅 컴퍼니 Methods of producing c-aryl glucoside sglt2 inhibitors
US20040185559A1 (en) 2003-03-21 2004-09-23 Isis Pharmaceuticals Inc. Modulation of diacylglycerol acyltransferase 1 expression
US7598227B2 (en) * 2003-04-16 2009-10-06 Isis Pharmaceuticals Inc. Modulation of apolipoprotein C-III expression
EP2664672A1 (en) 2003-04-17 2013-11-20 Alnylam Pharmaceuticals Inc. Modified iRNA agents
US7750142B2 (en) * 2003-04-28 2010-07-06 Isis Pharmaceuticals, Inc. Modulation of glucagon receptor expression
US7399853B2 (en) 2003-04-28 2008-07-15 Isis Pharmaceuticals Modulation of glucagon receptor expression
CA2524761A1 (en) 2003-05-12 2005-02-10 Union Carbide Chemicals & Plastics Technology Corporation Process for control of polymer fines in a gas-phase polymerization
CA2533701A1 (en) * 2003-07-31 2005-02-17 Isis Pharmaceuticals, Inc. Oligomeric compounds and compositions for use in modulation of small non-coding rnas
JP2005060664A (en) 2003-07-31 2005-03-10 Asahi Glass Co Ltd Fluorine containing compound, fluorine containing polymer and production process for the same, and resist composition containing the same
US7825235B2 (en) 2003-08-18 2010-11-02 Isis Pharmaceuticals, Inc. Modulation of diacylglycerol acyltransferase 2 expression
US7427672B2 (en) 2003-08-28 2008-09-23 Takeshi Imanishi Artificial nucleic acids of n-o bond crosslinkage type
US20050053981A1 (en) 2003-09-09 2005-03-10 Swayze Eric E. Gapped oligomeric compounds having linked bicyclic sugar moieties at the termini
US20050074801A1 (en) 2003-09-09 2005-04-07 Monia Brett P. Chimeric oligomeric compounds comprising alternating regions of northern and southern conformational geometry
AU2004274021B2 (en) * 2003-09-18 2009-08-13 Isis Pharmaceuticals, Inc. 4'-thionucleosides and oligomeric compounds
EP1687410A4 (en) * 2003-10-07 2008-04-09 Isis Pharmaceuticals Inc Antisense oligonucleotides optimized for kidney targeting
US20050191653A1 (en) 2003-11-03 2005-09-01 Freier Susan M. Modulation of SGLT2 expression
ES2403937T3 (en) 2003-11-13 2013-05-22 Isis Pharmaceuticals, Inc. 5,6-Dihydroxy-isoindole derivatives as connectors for solid phase oligomer synthesis
US7622453B2 (en) * 2003-12-23 2009-11-24 Santaris Pharma A/S Oligomeric compounds for the modulation of Bcl-2
EP1711606A2 (en) * 2004-01-20 2006-10-18 Isis Pharmaceuticals, Inc. Modulation of glucocorticoid receptor expression
US20050287558A1 (en) 2004-05-05 2005-12-29 Crooke Rosanne M SNPs of apolipoprotein B and modulation of their expression
AU2005252662B2 (en) 2004-06-03 2011-08-18 Isis Pharmaceuticals, Inc. Double strand compositions comprising differentially modified strands for use in gene modulation
US8394947B2 (en) * 2004-06-03 2013-03-12 Isis Pharmaceuticals, Inc. Positionally modified siRNA constructs
PT1766012E (en) * 2004-07-02 2011-09-05 Avi Biopharma Inc Antisense antibacterial method and compound
DK2997980T3 (en) 2004-08-10 2018-03-26 Kastle Therapeutics Llc PROCEDURES FOR MODULATING LIPROPROTEIN AND CHOLESTEROL LEVELS
WO2006034348A2 (en) 2004-09-17 2006-03-30 Isis Pharmaceuticals, Inc. Enhanced antisense oligonucleotides
AR051446A1 (en) * 2004-09-23 2007-01-17 Bristol Myers Squibb Co C-ARYL GLUCOSIDS AS SELECTIVE INHIBITORS OF GLUCOSE CONVEYORS (SGLT2)
MX2007005558A (en) 2004-11-09 2008-01-31 Santaris Pharma As Potent lna oligonucleotides for the inhibition of hif-1a expression.
MX2007005557A (en) 2004-11-09 2008-02-15 Santaris Pharma As Lna oligonucleotides and the treatment of cancer.
WO2007031081A2 (en) * 2005-09-15 2007-03-22 Santaris Pharma A/S RNA ANTAGONIST COMPOUNDS FOR THE INHIBITION OF APO-Bl00 EXPRESSION
US20070066557A1 (en) * 2005-09-19 2007-03-22 Monia Brett P Modulation of glucocorticoid receptor expression
EP1937813A2 (en) 2005-09-19 2008-07-02 Isis Pharmaceuticals, Inc. Modulation of glucagon receptor expression
EP2314594B1 (en) 2006-01-27 2014-07-23 Isis Pharmaceuticals, Inc. 6-modified bicyclic nucleic acid analogs
CA3024953A1 (en) 2006-04-03 2007-10-11 Roche Innovation Center Copenhagen A/S Pharmaceutical composition comprising anti-mirna antisense oligonucleotides
US20070238698A1 (en) * 2006-04-07 2007-10-11 Hsien-Chih Lin Method for manufacturing drinking water having chitosan
US20090326041A1 (en) * 2006-05-05 2009-12-31 Isis Pharmaceuticals, Inc. Compounds and methods for modulating expression of sglt2
JP2007311707A (en) * 2006-05-22 2007-11-29 Ushio Inc Ultraviolet ray emitting element package
US20100216864A1 (en) 2006-10-09 2010-08-26 Ellen Marie Straarup RNA Antagonist Compounds for the Modulation of PCSK9
AU2007310989B2 (en) 2006-10-18 2014-05-29 Isis Pharmaceuticals, Inc. Antisense compounds
AU2008230886B9 (en) 2007-03-24 2014-09-04 Kastle Therapeutics, Llc Administering antisense oligonucleotides complementary to human apolipoprotein B

Also Published As

Publication number Publication date
JP6272290B2 (en) 2018-01-31
WO2007131238A2 (en) 2007-11-15
EP2023939A2 (en) 2009-02-18
DK2015758T3 (en) 2014-06-23
CN103554205A (en) 2014-02-05
AU2007253909B2 (en) 2012-08-09
WO2007136989A2 (en) 2007-11-29
WO2007143316A2 (en) 2007-12-13
WO2007136989A3 (en) 2008-07-24
CA2651309C (en) 2019-06-11
AU2007258117B2 (en) 2013-05-30
EP2023939A4 (en) 2009-04-29
US20090306180A1 (en) 2009-12-10
WO2007146511A8 (en) 2009-04-02
AU2007257094A1 (en) 2007-12-13
US20090292006A1 (en) 2009-11-26
EP2015758B1 (en) 2014-04-02
US20130165496A1 (en) 2013-06-27
WO2007146511A2 (en) 2007-12-21
ATE514777T1 (en) 2011-07-15
US20090306357A1 (en) 2009-12-10
EP2363481B1 (en) 2017-04-12
US20090306005A1 (en) 2009-12-10
HK1128418A1 (en) 2009-10-30
PT2015758E (en) 2014-06-25
WO2007131237A2 (en) 2007-11-15
ATE513912T1 (en) 2011-07-15
EP2019692A2 (en) 2009-02-04
WO2007143315A2 (en) 2007-12-13
WO2007143316A3 (en) 2008-06-26
EP2363482A1 (en) 2011-09-07
BRPI0711429A2 (en) 2012-10-16
EP2458006B1 (en) 2018-06-20
EP2023939B1 (en) 2012-06-27
EP2505646A1 (en) 2012-10-03
EP2021472B1 (en) 2011-06-29
DK2021472T3 (en) 2011-09-19
WO2007131238A3 (en) 2008-07-10
KR101441700B1 (en) 2014-09-18
US9617540B2 (en) 2017-04-11
KR20090034310A (en) 2009-04-07
WO2007143315A3 (en) 2008-07-10
AU2007257093A1 (en) 2007-12-13
WO2007136988A3 (en) 2009-05-07
EP2019692B1 (en) 2014-06-04
WO2007136988A2 (en) 2007-11-29
JP2014033674A (en) 2014-02-24
EP2023940B1 (en) 2011-06-22
WO2007146511A3 (en) 2008-06-12
US9045754B2 (en) 2015-06-02
US8372967B2 (en) 2013-02-12
AU2007257094B2 (en) 2012-10-25
US20150344879A1 (en) 2015-12-03
NO20084738L (en) 2009-01-20
US20150057329A1 (en) 2015-02-26
ES2386578T3 (en) 2012-08-23
EP2023940A2 (en) 2009-02-18
EP2363481A1 (en) 2011-09-07
US20090326042A1 (en) 2009-12-31
JP5731115B2 (en) 2015-06-10
DK2363481T3 (en) 2017-06-26
EP2397551A1 (en) 2011-12-21
WO2007131237A3 (en) 2008-11-13
CA3044969A1 (en) 2007-12-21
EP2019692A4 (en) 2010-02-24
WO2007136988A8 (en) 2009-09-24
JP2009536664A (en) 2009-10-15
JP2016096826A (en) 2016-05-30
US8673871B2 (en) 2014-03-18
US8969316B2 (en) 2015-03-03
AU2007253909A1 (en) 2007-11-29
EP2015758A2 (en) 2009-01-21
AU2007258117A1 (en) 2007-12-21
JP2009536038A (en) 2009-10-08
US8188059B2 (en) 2012-05-29
WO2007143317A3 (en) 2008-06-26
EP2015758A4 (en) 2009-08-19
JP2009536037A (en) 2009-10-08
JP5372745B2 (en) 2013-12-18
WO2007131238A8 (en) 2009-12-17
CA2651042A1 (en) 2007-12-13
US20080015162A1 (en) 2008-01-17
JP2009536222A (en) 2009-10-08
ES2471978T3 (en) 2014-06-27
DK2019692T3 (en) 2014-07-14
EP2458006A1 (en) 2012-05-30
US20110065775A1 (en) 2011-03-17
MX2008014100A (en) 2009-02-25
US8143230B2 (en) 2012-03-27
US20120208864A1 (en) 2012-08-16
DK2458006T3 (en) 2018-08-27
EP2021472A2 (en) 2009-02-11
US8586554B2 (en) 2013-11-19
JP5825754B2 (en) 2015-12-02
US20090326041A1 (en) 2009-12-31
US20090318532A1 (en) 2009-12-24
US8362232B2 (en) 2013-01-29
US20090306179A1 (en) 2009-12-10
JP2009536039A (en) 2009-10-08
WO2007143317A2 (en) 2007-12-13
WO2007134014A2 (en) 2007-11-22
EP2023940A4 (en) 2009-06-17
WO2007134014A3 (en) 2009-04-09

Similar Documents

Publication Publication Date Title
US9617540B2 (en) Compounds and methods for modulating gene expression
EP2527442A2 (en) Compounds and methods for modulating gene expression

Legal Events

Date Code Title Description
EEER Examination request