CA2746527A1 - Rna interference in skin indications - Google Patents

Abstract

The present invention relates to RNAi constructs with improved tissue and cellular uptake characteristics and methods of use of these compounds in dermal applications.

Description

RNA INTERFERENCE IN SKIN INDICATIONS

RELATED APPLICATIONS
This application claims the benefit under 35 U.S.C. 119(e) of U.S.
provisional application serial number US 61/192,954, entitled "Chemically Modified Polynucleotides and Methods of Using the Same," filed on September 22, 2008, US
61/149,946, entitled "Minimum Length Triggers of RNA Interference," filed on February 4, 2009, and US 61/224,031, entitled "Minimum Length Triggers of RNA
Interference," filed on July 8, 2009, the disclosure of each of which is incorporated by 1o reference herein in its entirety.
FIELD OF INVENTION
The invention pertains to the field of RNA interference (RNAi). The invention more specifically relates to nucleic acid molecules with improved in vivo delivery properties without the use of a delivering agent and their use in efficient gene silencing.
BACKGROUND OF INVENTION

Complementary oligonucleotide sequences are promising therapeutic agents and useful research tools in elucidating gene functions. However, prior art oligonucleotide molecules suffer from several problems that may impede their clinical development, and frequently make it difficult to achieve intended efficient inhibition of gene expression (including protein synthesis) using such compositions in vivo.

A major problem has been the delivery of these compounds to cells and tissues.
Conventional double-stranded RNAi compounds, 19-29 bases long, form a highly negatively-charged rigid helix of approximately 1.5 by 10-15 nm in size. This rod type molecule cannot get through the cell-membrane and as a result has very limited efficacy both in vitro and in vivo. As a result, all conventional RNAi compounds require some kind of a delivery vehicle to promote their tissue distribution and cellular uptake. This is considered to be a major limitation of the RNAi technology.

There have been previous attempts to apply chemical modifications to oligonucleotides to improve their cellular uptake properties. One such modification was the attachment of a cholesterol molecule to the oligonucleotide. A first report on this approach was by Letsinger et al., in 1989. Subsequently, ISIS Pharmaceuticals, Inc.

(Carlsbad, CA) reported on more advanced techniques in attaching the cholesterol molecule to the oilgonucleotide (Manoharan, 1992).

With the discovery of siRNAs in the late nineties, similar types of modifications were attempted on these molecules to enhance their delivery profiles.
Cholesterol molecules conjugated to slightly modified (Soutschek, 2004) and heavily modified (Wolfrum, 2007) siRNAs appeared in the literature. Yamada et al., 2008 also reported on the use of advanced linker chemistries which further improved cholesterol mediated uptake of siRNAs. In spite of all this effort, the uptake of these types of compounds appears to be inhibited in the presence of biological fluids resulting in highly limited efficacy in gene silencing in vivo, limiting the applicability of these compounds in a clinical setting.

Therefore, it would be of great benefit to improve upon the prior art oligonucleotides by designing oligonucleotides that have improved delivery properties in vivo and are clinically meaningful.

SUMMARY OF INVENTION
Described herein are asymmetric chemically modified nucleic acid molecules with minimal double stranded regions, and the use of such molecules in gene silencing.
RNAi molecules associated with the invention contain single stranded regions and double stranded regions, and can contain a variety of chemical modifications within both the single stranded and double stranded regions of the molecule. Additionally, the RNAi molecules can be attached to a hydrophobic conjugate such as a conventional and advanced sterol-type molecule. This new class of RNAi molecules has superior efficacy both in vitro and in vivo than previously described RNAi molecules.
In some aspects the invention is a method involving administering a double stranded nucleic acid molecule selected from the nucleic acid molecules contained in Tables 1-3 such that an antisense and a sense strand make up the double stranded nucleic acid molecule, to a subject, wherein the nucleic acid molecule is administered on the skin of the subject.
In other aspects the invention is a method involving administering a double stranded nucleic acid molecule selected from the nucleic acid molecules contained in Tables 1-3 such that an antisense and a sense strand make up the double stranded nucleic acid molecule, to a subject, wherein the nucleic acid molecule is administered via intradermal injection.
A method for treating compromised skin is provided according to other aspects of the invention. The method involves administering to a subject a therapeutically effective amount for treating compromised skin of a double stranded nucleic acid molecule comprising a guide strand, with a minimal length of 16 nucleotides, and a passenger strand forming a double stranded nucleic acid, having a double stranded region and a single stranded region, the double stranded region having 8-15 nucleotides in length, the single stranded region having 4-12 nucleotides in length, wherein position 1 of the guide strand is 5' phosphorylated or has a 2' O-methyl modification, wherein the passenger strand is linked to a lipophilic group, wherein at least 40% of the nucleotides of the double stranded nucleic acid are modified, and wherein the double stranded nucleic acid molecule has one end that is blunt or includes a one nucleotide overhang.
In another aspect the invention is a method for delivering a nucleic acid to a subject by administering to a subject prior to or simultaneous with a medical procedure a therapeutically effective amount for treating compromised skin of a double stranded nucleic acid molecule comprising a guide strand, with a minimal length of 16 nucleotides, and a passenger strand forming a double stranded nucleic acid, having a double stranded region and a single stranded region, the double stranded region having 8-15 nucleotides in length, the single stranded region having 4-12 nucleotides in length, wherein position 1 of the guide strand is 5' phosphorylated or has a 2' O-methyl modification, wherein the passenger strand is linked to a lipophilic group, wherein at least 40% of the nucleotides of the double stranded nucleic acid are modified, and wherein the double stranded nucleic acid molecule has one end that is blunt or includes a one nucleotide overhang. In one embodiment the medical procedure is surgery.
Optionally the surgery is elective.
A method for promoting wound healing is provided in another aspect. The method involves administering a therapeutically effective amount for promoting wound healing of a double stranded nucleic acid molecule comprising a guide strand, with a minimal length of 16 nucleotides, and a passenger strand forming a double stranded nucleic acid, having a double stranded region and a single stranded region, the double stranded region having 8-15 nucleotides in length, the single stranded region having 4-12 nucleotides in length, wherein position 1 of the guide strand is 5' phosphorylated or has a 2' O-methyl modification, wherein the passenger strand is linked to a lipophilic group, wherein at least 40% of the nucleotides of the double stranded nucleic acid are modified, and wherein the double stranded nucleic acid molecule has one end that is blunt or includes a one nucleotide overhang.
In some embodiments the subject has a wound, such as a chronic wound. The wound may be a result of elective surgery. In some embodiments the wound is external.
In other embodiments the wound is internal.
The nucleic acid molecule may in some embodiments be administered before or after an injury. For example the nucleic acid molecule may be administered before or after the injury via intradermal injection or locally to the skin.
In some embodiments the nucleic acid molecule is administered before a surgery.
The surgery may be for instance epithelial grafting or skin grafting.
In some embodiments the nucleic acid molecule is administered to a graft donor site. In other embodiments the nucleic acid molecule is administered to a graft recipient site. In yet other embodiments the nucleic acid molecule is administered after burn injury.
Optionally the nucleic acid molecule may be administered prior to injury or surgery.
The double stranded nucleic acid molecule is directed against a gene encoding for a protein selected from the group consisting of. Transforming growth factor (3 (TGF(3I, TGF(32), Osteopontin, Connective tissue growth factor (CTGF), Platelet-derived growth factor (PDGF), Hypoxia inducible factor-1 a (HIF 1 a), Collagen I and/or III, Prolyl 4-hydroxylase (P4H), Procollagen C-protease (PCP), Matrix metalloproteinase 2, 9 (MMP2, 9), Integrins, Connexin, Histamine H1 receptor, Tissue transglutaminase, Mammalian target of rapamycin (mTOR), HoxB 13, VEGF, IL-6, SMAD proteins, Ribosomal protein S6 kinases (RSP6) and Cyclooxygenase-2 (COX-2) in some embodiments.
In one embodiment the double stranded nucleic acid molecule is administered on the skin of the subject in need thereof. It may be in the form of a cream or ointment. In other embodiments the nucleic acid molecule is administered by local injection.
A composition of a double stranded nucleic acid molecule selected from the nucleic acid molecules contained in Tables 1-3 such that an antisense and a sense strand make up the double stranded nucleic acid molecule formulated for delivery to the skin is provided according to another aspect of the invention.
In another aspect the invention is a composition of a double stranded nucleic acid molecule comprising a guide strand, with a minimal length of 16 nucleotides, and a passenger strand forming a double stranded nucleic acid, having a double stranded region and a single stranded region, the double stranded region having 8-15 nucleotides in length, the single stranded region having 4-12 nucleotides in length, wherein position 1 of the guide strand is 5' phosphorylated or has a 2' 0-methyl modification, wherein the passenger strand is linked to a lipophilic group, wherein at least 40% of the nucleotides of the double stranded nucleic acid are modified, and wherein the double stranded nucleic acid molecule has one end that is blunt or includes a one nucleotide overhang formulated for delivery to the skin. In one embodiment the nucleic acid molecule is in the form of a cream or ointment.
In some aspects the invention is methods for inhibiting scar tissue formation or for promoting epithelial regeneration. The methods involve administering a therapeutically effective amount for inhibiting scar tissue formation of a double stranded nucleic acid molecule selected from the nucleic acid molecules listed in Tables 1-3, to a subject in need thereof, to a subject in need thereof, to a subject in need thereof.
Alternatively the methods for inhibiting scar tissue formation or for promoting epithelial regeneration involve contacting epithelial cells with an effective amount for promoting epithelial regeneration of a double stranded nucleic acid molecule comprising a guide strand and a passenger strand, wherein the region of the molecule that is double stranded is from 8-14 nucleotides long, wherein the guide strand contains a single stranded region that is 4-12 nucleotides long, and wherein the single stranded region of the guide strand contains 2-12 phosphorothioate modifications, to a subject in need thereof Alternatively the methods for inhibiting scar tissue formation or for promoting epithelial regeneration involve administering to skin of a subject a therapeutically effective amount for inhibiting scar tissue formation or for promoting epithelial regeneration of a double stranded nucleic acid molecule comprising a guide strand, with a minimal length of 16 nucleotides, and a passenger strand forming a double stranded nucleic acid, having a double stranded region and a single stranded region, the double stranded region having 8-15 nucleotides in length, the single stranded region having 4-12 nucleotides in length, wherein position 1 of the guide strand is 5' phosphorylated and/or has a 2' O-methyl modification, wherein the passenger strand is linked to a lipophilic group, wherein at least 40% of the nucleotides of the double stranded nucleic acid are modified, and wherein the double stranded nucleic acid molecule has one end that is blunt or includes a one or two nucleotide overhang.
BRIEF DESCRIPTION OF DRAWINGS
The accompanying drawings are not intended to be drawn to scale. In the drawings, each identical or nearly identical component that is illustrated in various figures is represented by a like numeral. For purposes of clarity, not every component may be labeled in every drawing. In the drawings:
FIG. 1 is a schematic depicting proposed structures of asymmetric double stranded RNA molecules (adsRNA). Bold lines represent sequences carrying modification patterns compatible with RISC loading. Striped lines represent polynucleotides carrying modifications compatible with passenger strands.
Plain lines represent a single stranded polynucleotide with modification patterns optimized for cell interaction and uptake. FIG 1 A depicts adsRNA with extended guide or passenger strands; FIG 1 B depicts adsRNA with length variations of a cell penetrating polynucleotide; FIG 1 C depicts adsRNA with 3' and 5' conjugates; FIG 1 D
depicts adsRNAs with mismatches.
FIG. 2 is a schematic depicting asymmetric dsRNA molecules with different chemical modification patterns. Several examples of chemical modifications that might be used to increase hydrophobicity are shown including 4-pyridyl, 2-pyridyl, isobutyl and indolyl based position 5 uridine modifications.
FIG. 3 is a schematic depicting the use of dsRNA binding domains, protamine (or other Arg rich peptides), spermidine or similar chemical structures to block duplex charge to facilitate cellular entry.
FIG. 4 is a schematic depicting positively charged chemicals that might be used for polynucleotide charge blockage.
FIG. 5 is a schematic depicting examples of structural and chemical compositions of single stranded RISC entering polynucleotides. The combination of one or more modifications including 2'd, 2'Ome, 2'F, hydrophobic and phosphothioate modifications can be used to optimize single strand entry into the RISC.

FIG. 6 is a schematic depicting examples of structural and chemical composition of RISC substrate inhibitors. Combinations of one or more chemical modifications can be used to mediate efficient uptake and efficient binding to preloaded RISC
complex.
FIG. 7 is a schematic depicting structures of polynucleotides with sterol type molecules attached, where R represent a polycarbonic tail of 9 carbons or longer. FIG.
7A depicts an adsRNA molecule; FIG. 7B depicts an siRNA molecule of approximately 17-30 bp long; FIG. 7C depicts a RISC entering strand; FIG 7D depicts a substrate analog strand. Chemical modification patterns, as depicted in FIG. 7, can be optimized to promote desired function.
FIG. 8 is a schematic depicting examples of naturally occurring phytosterols with a polycarbon chain that is longer than 8, attached at position 17. More than 250 different types of phytosterols are known.
FIG. 9 is a schematic depicting examples of sterol-like structures, with variations in the size of the polycarbon chains attached at position 17.
FIG. 10 presents schematics and graphs demonstrating that the percentage of liver uptake and plasma clearance of lipid emulsions containing sterol type molecules is directly affected by the size of the polycarbon chain attached at position 17.
This figure is adapted from Martins et al, Journal of Lipid Research (1998).
FIG. 11 is a schematic depicting micelle formation. FIG. 11 A depicts a polynucleotide with a hydrophobic conjugate; FIG. 11 B depicts linoleic acid;
FIG. 11 C
depicts a micelle formed from a mixture of polynucleotides containing hydrophobic conjugates combined with fatty acids.
FIG. 12 is a schematic depicting how alteration in lipid composition can affect pharmacokinetic behavior and tissue distribution of hydrophobically modified and/or hydrophobically conjugated polynucleotides. In particular, use of lipid mixtures enriched in linoleic acid and cardiolipin results in preferential uptake by cardiomyocites.
FIG. 13 is a schematic showing examples of RNAi constructs and controls used to target MAP4K4 expression. RNAi construct 12083 corresponds to SEQ ID
NOs:597 and 598. RNAi construct 12089 corresponds to SEQ ID NO:599.
FIG. 14 is a graph showing MAP4K4 expression following transfection with RNAi constructs associated with the invention. RNAi constructs tested were:

(Nicked), 12085 (13nt Duplex), 12089 (No Stem Pairing) and 12134 (13nt miniRNA).
Results of transfection were compared to an untransfected control sample. RNAi construct 12083 corresponds to SEQ ID NOs:597 and 598. RNAi construct 12085 corresponds to SEQ ID NOs:600 and 601. RNAi construct 12089 corresponds to SEQ
ID NO:599. RNAi construct 12134 corresponds to SEQ ID NOs:602 and 603.
FIG. 15 is a graph showing expression of MAP4K4 24 hours post-transfection with RNAi constructs associated with the invention. RNAi constructs tested were:
11546 (MAP4K4 rxRNA), 12083 (MAP4K4 Nicked Construct), 12134 (12bp soloRNA) and 12241 (14/3/14 soloRNA). Results of transfection were compared to a filler control sample. RNAi construct 11546 corresponds to SEQ ID NOs:604 and 605. RNAi construct 12083 corresponds to SEQ ID NOs:597 and 598. RNAi construct 12134 corresponds to SEQ ID NOs:602 and 603. RNAi construct 12241 corresponds to SEQ
ID NOs:606 and 607.
FIG. 16 presents a graph and several tables comparing parameters associated with silencing of MAP4K4 expression following transfection with RNAi constructs associated with the invention. The rxRNA construct corresponds to SEQ ID NOs:604 and 605.
The 14-3-14 soloRNA construct corresponds to SEQ ID NOs:606 and 607. The 13/19 duplex (nicked construct) corresponds to SEQ ID NOs:597 and 598. The 12-bp soloRNA construct corresponds to SEQ ID NOs:602 and 603.
FIG. 17 is a schematic showing examples of RNAi constructs and controls used to target SOD1 expression. The 12084 RNAi construct corresponds to SEQ ID
NOs:612 and 613.
FIG. 18 is a graph showing SOD 1 expression following transfection with RNAi constructs associated with the invention. RNAi constructs tested were: 12084 (Nicked), 12086 (13nt Duplex), 12090 (No Stem Pairing) and 12035 (l3nt MiniRNA). Results of transfection were compared to an untransfected control sample. The 12084 RNAi construct corresponds to SEQ ID NOs:612 and 613. The 12086 RNAi construct corresponds to SEQ ID NOs:608 and 609. The 12035 RNAi construct corresponds to SEQ ID NOs:610 and 611.
FIG. 19 is a graph showing expression of SOD1 24 hours post-transfection with RNAi constructs associated with the invention. RNAi constructs tested were:

(SOD 1 rxRNA) and 12084 (SOD 1 Nicked Construct). Results of transfection were compared to a filler control sample. The 10015 RNAi construct corresponds to SEQ ID
NOs:614 and 615. The 12084 RNAi construct corresponds to SEQ ID NOs:612 and 613.

FIG. 20 is a schematic indicating that RNA molecules with double stranded regions that are less than 10 nucleotides are not cleaved by Dicer.
FIG. 21 is a schematic revealing a hypothetical RNAi model for RNA induced gene silencing.
FIG. 22 is a graph showing chemical optimization of asymmetric RNAi compounds. The presence of chemical modifications, in particular 2'F UC, phosphorothioate modifications on the guide strand, and complete CU 2'OMe modification of the passenger strands results in development of functional compounds.
Silencing of MAP4K4 following lipid-mediated transfection is shown using RNAi molecules with specific modifications. RNAi molecules tested had sense strands that were 13 nucleotides long and contained the following modifications:
unmodified; C and U 2'OMe; C and U 2'OMe and 3' Chl; rxRNA 2'OMe pattern; or full 2'OMe, except base 1. Additionally, the guide (anti-sense) strands of the RNAi molecules tested contained the following modifications: unmodified; unmodified with 5'P; C and U 2'F;
C and U 2'F with 8 PS 3' end; and unmodified (17 nt length). Results for rxRNA

Duplex and negative controls are also shown.
FIG. 23 demonstrates that the chemical modifications described herein significantly increase in vitro efficacy in un-assisted delivery of RNAi molecules in HeLa cells. The structure and sequence of the compounds were not altered; only the chemical modification patterns of the molecules were modified. Compounds lacking 2' F, 2'O-me, phosphorothioate modification, or cholesterol conjugates were completely inactive in passive uptake. A combination of all 4 of these types of modifications produced the highest levels of activity (compound 12386).
FIG. 24 is a graph showing MAP4K4 expression in Hela cells following passive uptake transfection of. NT Accell modified siRNA, MAP4K4 Accell siRNA, Non-Chl nanoRNA (12379) and sd-nanoRNA (12386).
FIG. 25 is a graph showing expression of MAP4K4 in HeLa cells following passive uptake transfection of various concentrations of RNA molecules containing the following parameters: Nano Lead with no 3'Chl; Nano Lead; Accell MAP4K4; 21mer GS with 8 PS tail; 21mer GS with 12 PS tail; and 25mer GS with 12 PS tail.
FIG. 26 is a graph demonstrating that reduction in oligonucleotide content increases the efficacy of unassisted uptake. Similar chemical modifications were applied to asymmetric compounds, traditional siRNA compounds and 25 mer RNAi compounds.
The asymmetric small compounds demonstrated the most significant efficacy.
FIG. 27 is a graph demonstrating the importance of phosphorothioate content for un-assisted delivery. FIG. 27A demonstrates the results of a systematic screen that revealed that the presence of at least 2-12 phosphorothioates in the guide strand significantly improves uptake; in some embodiments, 4-8 phosphorothioate modifications were found to be preferred. FIG. 27 B reveals that the presence or absence of phosphorothioate modifications in the sense strand did not alter efficacy.
FIG. 28 is a graph showing expression of MAP4K4 in primary mouse hepatocytes following passive uptake transfection of. Accell Media-Ctrl-UTC;
MM
APOB Alnylam; Active APOB Alnylam; nanoRNA without chl; nanoRNA MAP4K4;
Mouse MAP4K4 Accell Smartpool; DY547 Accell Control; Luc Ctrl rxRNA with Dy547; MAP4K4 rxRNA with DY547; and AS Strand Alone (nano).
FIG. 29 is a graph showing expression of ApoB in mouse primary hepatocytes following passive uptake transfection of. Accell Media-Ctrl-UTC; MM APOB
Alnylam;
Active APOB Alnylam; nanoRNA without chl; nanoRNA MAP4K4; Mouse MAP4K4 Accell Smartpool; DY547 Accell Control; Luc Ctrl rxRNA with Dy547; MAP4K4 rxRNA with DY547; and AS Strand Alone (nano).
FIG. 30 is a graph showing expression of MAP4K4 in primary human hepatocytes following passive uptake transfection of. 11550 MAP4K4 rxRNA;

MM MAP4K4 nanoRNA; 12539 Active MAP4K4 nanoRNA; Accell Media; and UTC.
FIG. 31 is a graph showing ApoB expression in primary human hepatoctyes following passive uptake transfection of: 12505 Active ApoB chol-siRNA; 12506 MM
ApoB chol-siRNA; Accell Media; and UTC.
FIG. 32 is an image depicting localization of sd-rxRNA"a10 localization.
FIG. 33 is an image depicting localization of Chol-siRNA (Alnylam).
FIG. 34 is a schematic of ls` generation (G1) sd-rxRNA"'O molecules associated with the invention indicating regions that are targeted for modification, and functions associated with different regions of the molecules.
FIG. 35 depicts modification patterns that were screened for optimization of sd-rxRNA"a" (G1). The modifications that were screened included, on the guide strand, lengths of 19, 21 and 25 nucleotides, phosphorothioate modifications of 0-18 nucleotides, and replacement of 2'F modifications with 2'OMe, 5 Methyl C
and/or ribo Thymidine modifications. Modifications on the sense strand that were screened included nucleotide lengths of 11, 13 and 19 nucleotides, phosphorothiote modifications of 0-4 nucleotides and 2'OMe modifications.
FIG. 36 is a schematic depicting modifications of sd- rxRNA' that were screened for optimization.
FIG. 37 is a graph showing percent MAP4K4 expression in Hek293 cells following transfection of: Risc Free siRNA; rxRNA; Nano (unmodified); GS
alone;
Nano Lead (no Chl); Nano (GS: (3) 2'OMe at positions 1, 18, and 19, 8 PS, 19 nt); Nano (GS: (3) 2'OMe at positions 1, 18, and 19, 8 PS, 21 nt); Nano (GS: (3) 2'OMe at positions 1, 18, and 19, 12 PS, 21 nt); and Nano (GS: (3) 2'OMe at positions 1, 18, and 19, 12 PS, 25 nt);
FIG. 38 is a graph showing percent MAP4K4 expression in HeLa cells following passive uptake transfection of. GS alone; Nano Lead; Nano (GS: (3) 2'OMe at positions 1, 18, and 19, 8 PS, 19 nt); Nano (GS: (3) 2'OMe at positions 1, 18, and 19, 8 PS, 21 nt);
Nano (GS: (3) 2'OMe at positions 1, 18, and 19, 12 PS, 21 nt); Nano (GS: (3) 2'OMe at positions 1, 18, and 19, 12 PS, 25 nt).
FIG. 39 is a graph showing percent MAP4K4 expression in Hek293 cells following lipid mediated transfection of. Guide Strand alone (GS: 8PS, 19 nt);
Guide Strand alone (GS: 18PS, 19 nt); Nano (GS: no PS, 19 nt); Nano (GS: 2 PS, 19 nt); Nano (GS: 4 PS, 19 nt); Nano (GS: 6 PS, 19 nt); Nano Lead (GS: 8 PS, 19 nt); Nano (GS: 10 PS, 19 nt); Nano (GS: 12 PS, 19 nt); and Nano (GS: 18 PS, 19 nt).
FIG. 40 is a graph showing percent MAP4K4 expression in Hek293 cells following lipid mediated transfection of. Guide Strand alone (GS: 8PS, 19 nt);
Guide Strand alone (GS: 18PS, 19 nt); Nano (GS: no PS, 19 nt); Nano (GS: 2 PS, 19 nt); Nano (GS: 4 PS, 19 nt); Nano (GS: 6 PS, 19 nt); Nano Lead (GS: 8 PS, 19 nt); Nano (GS: 10 PS, 19 nt); Nano (GS: 12 PS, 19 nt); and Nano (GS: 18 PS, 19 nt).
FIG. 41 is a graph showing percent MAP4K4 expression in HeLa cells following passive uptake transfection of: Nano Lead (no Chl); Guide Strand alone (18 PS); Nano (GS: 0 PS, 19 nt); Nano (GS: 2 PS, 19 nt); Nano (GS: 4 PS, 19 nt); Nano (GS: 6 PS, 19 nt); Nano Lead (GS: 8 PS, 19 nt); Nano (GS: 10 PS, 19 nt); Nano (GS: 12 PS, 19 nt); and Nano (GS: 18 PS, 19 nt).
FIG. 42 is a graph showing percent MAP4K4 expression in HeLa cells following passive uptake transfection of. Nano Lead (no Chl); Guide Strand alone (18 PS); Nano (GS: 0 PS, 19 nt); Nano (GS: 2 PS, 19 nt); Nano (GS: 4 PS, 19 nt); Nano (GS: 6 PS, 19 nt); Nano Lead (GS: 8 PS, 19 nt); Nano (GS: 10 PS, 19 nt); Nano (GS: 12 PS, 19 nt); and Nano (GS: 18 PS, 19 nt).
FIG. 43 is a schematic depicting guide strand chemical modifications that were screened for optimization.
FIG. 44 is a graph showing percent MAP4K4 expression in Hek293 cells following reverse transfection of. RISC free siRNA; GS only (2'F C and Us); GS
only (2'OMe C and Us); Nano Lead (2'F C and Us); nano (GS: (3) 2'OMe, positions 16-18);
nano (GS: (3) 2'OMe, positions 16, 17 and 19); nano (GS: (4) 2'OMe, positions 11, 16-18); nano (GS: (10) 2'OMe,C and Us); nano (GS: (6) 2'OMe, positions 1 and 5-9); nano (GS: (3) 2'OMe, positions 1, 18 and 19); and nano (GS: (5) 2'OMe Cs).
FIG. 45 is a graph demonstrating efficacy of various chemical modification patterns. In particular, 2-OMe modification in positions 1 and 11-18 was well tolerated.
2'OMe modifications in the seed area resulted in a slight reduction of efficacy (but were still highly efficient). Ribo- modifications in the seed were well tolerated.
This data enabled the generation of self delivering compounds with reduced or no 2'F
modifications. This is significant because 2'F modifications may be associated with toxicity in vivo.
FIG. 46 is a schematic depicting sense strand modifications.
FIG. 47 is a graph demonstrating sense strand length optimization. A sense strand length between 10-15 bases was found to be optimal in this assay.
Increasing sense strand length resulted in a reduction of passive uptake of these compounds but may be tolerated for other compounds. Sense strands containing LNA modification demonstrated similar efficacy to non-LNA containing compounds. In some embodiments, the addition of LNA or other thermodynamically stabilizing compounds can be beneficial, resulting in converting non-functional sequences into functional sequences.
FIG. 48 is a graph showing percent MAP4K4 expression in HeLa cells following passive uptake transfection of. Guide Strand Alone (2'F C and U); Nano Lead;
Nano Lead (No Chl); Nano (SS: 11 nt 2'OMe C and Us, Chl); Nano (SS: l lnt, complete 2'OMe, Chl); Nano (SS: 19 nt, 2'OMe C and Us, Chl); Nano (SS: 19 nt, 2'OMe C
and Us, no Chl).

FIG. 49 is a graph showing percent MAP4K4 expression in HeLa cells following passive uptake transfection of. Nano Lead (No Chl); Nano (SS no PS); Nano Lead (SS:2 PS); Nano (SS:4 PS).
FIG. 50 is a schematic depicting a sd-rxRNA' second generation (GII) lead molecule.
FIG. 51 presents a graph indicating EC50 values for MAP4K4 silencing in the presence of sd-rxRNA, and images depicting localization of DY547-labeled rxRNA
"
and DY547-labeled sd-rxRNA.
FIG. 52 is a graph showing percent MAP4K4 expression in HeLa cells in the presence of optimized sd-rxRNA molecules.
FIG. 53 is a graph depicting the relevance of chemistry content in optimization of sd-rxRNA efficacy.
FIG. 54 presents schematics of sterol-type molecules and a graph revealing that sd-rxRNA compounds are fully functional with a variety of linker chemistries.
GII
asymmetric compounds were synthesized with sterol type molecules attached through TEG and amino caproic acid linkers. Both linkers showed identical potency.
This functionality independent of linker chemistry indicates a significant difference between the molecules described herein and previously described molecules, and offers significant advantages for the molecules described herein in terms of scale up and synthesis.
FIG. 55 demonstrates the stability of chemically modified sd-rxRNA compounds in human serum in comparison to non modified RNA. The oligonucleotides were incubated in 75% serum at 37 C for the number of hours indicated. The level of degradation was determined by running the samples on non-denaturing gels and staining with SYBGR.
FIG. 56 is a graph depicting optimization of cellular uptake of sd-rxRNA
through minimizing oligonucleotide content.
FIG. 57 is a graph showing percent MAP4K4 expression after spontaneous cellular uptake of sd-rxRNA in mouse PEC-derived macrophages, and phase and fluorescent images showing localization of sd-rxRNA.
FIG. 58 is a graph showing percent MAP4K4 expression after spontaneous cellular uptake of sd-rxRNA (targeting) and sd-rxRNA (mismatch) in mouse primary hepatocytes, and phase and fluorescent images showing localization of sd-rxRNA.

FIG. 59 presents images depicting localization of DY547-labeled sd-rxRNA
delivered to RPE cells with no formulation.
FIG. 60 is a graph showing silencing of MAP4K4 expression in RPE cells treated with sd-rxRNA"a10 without formulation.
FIG. 61 presents a graph and schematics of RNAi compounds showing the chemical/ structural composition of highly effective sd-rxRNA compounds.
Highly effective compounds were found to have the following characteristics:
antisense strands of 17-21 nucleotides, sense strands of 10-15 nucleotides, single-stranded regions that contained 2-12 phosphorothioate modifications, preferentially 6-8 phosphorothioate modifications, and sense strands in which the majority of nucleotides were 2'OMe modified, with or without phosphorothioate modification. Any linker chemistry can be used to attach these molecules to hydrophobic moieties such as cholesterol at the 3' end of the sense strand. Version GIIa-b of these RNA compounds demonstrate that elimination of 2'F content has no impact on efficacy.
FIG. 62 presents a graph and schematics of RNAi compounds demonstrating the superior performance of sd-rxRNA compounds compared to compounds published by Wolfrum et. al. Nature Biotech, 2007. Both generation I and II compounds (GI
and GIIa) developed herein show great efficacy. By contrast, when the chemistry described in Wolfrum et al. (all oligos contain cholesterol conjugated to the 3' end of the sense strand) was applied to the same sequence in a context of conventional siRNA
(19 bp duplex with two overhang) the compound was practically inactive. These data emphasize the significance of the combination of chemical modifications and assymetrical molecules described herein, producing highly effective RNA
compounds.
FIG. 63 presents images showing that sd-rxRNA accumulates inside cells while other less effective conjugate RNAs accumulate on the surface of cells.
FIG. 64 presents images showing that sd-rxRNA molecules, but not other molecules, are internalized into cells within minutes.
FIG. 65 presents images demonstrating that sd-rxRNA compounds have drastically better cellular and tissue uptake characteristics when compared to conventional cholesterol conjugated siRNAs (such as those published by Soucheck et al).
FIG. 65A,B compare uptake in RPE cells, FIG. 65C,D compare uptake upon local administration to skin and FIG. 65E,F compare uptake by the liver upon systemic administration. The level of uptake is at least an order of magnitude higher for the sd-rxRNA compounds relative to the regular siRNA-cholesterol compounds.
FIG. 66 presents images depicting localization of rxRNA " and sd-rxRNA
following local delivery.
FIG. 67 presents images depicting localization of sd-rxRNA and other conjugate RNAs following local delivery.
FIG. 68 presents a graph revealing the results of a screen performed with sd-rxRNAGII chemistry to identify functional compounds targeting the SPP 1 gene.
Multiple effective compounds were identified, with 14131 being the most effective. The compounds were added to A-549 cells and the level of the ratio of SPP1/ PPIB
was determined by B-DNA after 48 hours.
FIG. 69 presents a graph and several images demonstrating efficient cellular uptake of sd-rxRNA within minutes of exposure. This is a unique characteristics of the sd-rxRNA compounds described herein, not observed with any other RNAi compounds.
The Soutschek et al. compound was used as a negative control.
FIG. 70 presents a graph and several images demonstrating efficient uptake and silencing of sd-rxRNA compounds in multiple cell types with multiple sequences. In each case silencing was confirmed by looking at target gene expression using a Branched DNA assay.
FIG. 71 presents a graph revealing that sd-rxRNA is active in the presence and absence of serum. A slight reduction in efficacy (2-5 fold) was observed in the presence of serum. This minimal reduction in efficacy in the presence of serum differentiates the sd-rxRNA compounds described herein from previously described RNAi compounds, which had a greater reduction in efficacy, and thus creates a foundation for in vivo efficacy of the sd-rxRNA molecules described herein.
FIG. 72 presents images demonstrating efficient tissue penetration and cellular uptake upon single intradermal injection of sd-rxRNA compounds described herein. This represents a model for local delivery of sd-rxRNA compounds as well as an effective demonstration of delivery of sd-rxRNA compounds and silencing of genes in dermatological applications.
FIG. 73 presents images and a graph demonstrating efficient cellular uptake and in vivo silencing with sd-rxRNA following intradermal injection.

FIG. 74 presents graphs demonstrating that sd-rxRNA compounds have improved blood clearance and induce effective gene silencing in vivo in the liver upon systemic administration.

FIG. 75 presents a graph demonstrating that the presence of 5-Methyl C in an RNAi compound resulted in an increase in potency of lipid mediated transfection, demonstrating that hydrophobic modification of Cs and Us in the content of RNAi compounds can be beneficial. In some embodiments, these types of modifications can be used in the context of 2' ribose modified bases to insure optimal stability and efficacy.
FIG. 76 presents a graph showing percent MAP4K4 expression in HeLa cells following passive uptake transfection of. Guide strand alone; Nano Lead; Nano Lead (No cholesterol); Guide Strand w/5MeC and 2'F Us Alone; Nano Lead w/GS 5MeC
and 2'F Us; Nano Lead w/GS riboT and 5 Methyl Cs; and Nano Lead w/Guide dT and 5 Methyl Cs.
FIG. 77 presents images comparing localization of sd-rxRNA and other RNA
conjugates following systemic delivery to the liver.
FIG. 78 presents schematics demonstrating 5-uridyl modifications with improved hydrophobicity characteristics. Incorporation of such modifications into sd-rxRNA
compounds can increase cellular and tissue uptake properties. FIG. 78B
presents a new type of RNAi compound modification which can be applied to compounds to improve cellular uptake and pharmacokinetic behavior. This type of modification, when applied to sd-rxRNA compounds, may contribute to making such compounds orally available.
FIG. 79 presents schematics revealing the structures of synthesized modified sterol type molecules, where the length and structure of the C 17 attached tail is modified.
Without wishing to be bound by any theory, the length of the C 17 attached tail may contribute to improving in vitro and in vivo efficacy of sd-rxRNA compounds.
FIG. 80 presents a schematic demonstrating the lithocholic acid route to long side chain cholesterols.
FIG. 81 presents a schematic demonstrating a route to 5-uridyl phosphoramidite synthesis.
FIG. 82 presents a schematic demonstrating synthesis of tri-functional hydroxyprolinol linker for 3'-cholesterol attachment.
FIG. 83 presents a schematic demonstrating synthesis of solid support for the manufacture of a shorter asymmetric RNAi compound strand.

FIG. 84 demonstrates SPPI sd-rxRNA compound selection. Sd-rxRNA
compounds targeting SPP 1 were added to A549 cells (using passive transfection) and the level of SPP1 expression was evaluated after 48 hours. Several novel compounds effective in SPP 1 silencing were identified, the most potent of which was compound 14131.

FIG. 85 demonstrates independent validation of sd-rxRNA compounds 14116, 14121, 14131, 14134, 14139, 14149, and 14152 efficacy in SPP1 silencing.
FIG. 86 demonstrates results of sd-rxRNA compound screens to identify sd-rxRNA compounds functional in CTGF knockdown.
FIG. 87 demonstrates results of sd-rxRNA compound screens to identify sd-rxRNA functional in CTGF knockdown.
FIG. 88 demonstrates a systematic screen identifying the minimal length of the asymmetric compounds. The passenger strand of 10-19 bases was hybridized to a guide strand of 17-25 bases. In this assay, compounds with duplex regions as short as 10 bases were found to be effective in inducing.
FIG. 89 demonstrates that positioning of the sense strand relative to the guide strand is critical for RNAi Activity. In this assay, a blunt end was found to be optimal, a 3' overhang was tolerated, and a 5' overhang resulted in complete loss of functionality.
FIG. 90 demonstrates that the guide strand, which has homology to the target only at nucleotides 2-17, resulted in effective RNAi when hybridized with sense strands of different lengths. The compounds were introduced into HeLa cells via lipid mediated transfection.

FIG. 91 is a schematic depicting a panel of sterol-type molecules which can be used as a hydrophobic entity in place of cholesterol. In some instances, the use of sterol-type molecules comprising longer chains results in generation of sd-rxRNA
compounds with significantly better cellular uptake and tissue distribution properties.
FIG. 92 presents schematics depicting a panel of hydrophobic molecules which might be used as a hydrophobic entity in place of cholesterol. These list just provides representative examples; any small molecule with substantial hydrophobicity can be used.

DETAILED DESCRIPTION
Aspects of the invention relate to methods and compositions involved in gene silencing. The invention is based at least in part on the surprising discovery that asymmetric nucleic acid molecules with a double stranded region of a minimal length such as 8-14 nucleotides, are effective in silencing gene expression.
Molecules with such a short double stranded region have not previously been demonstrated to be effective in mediating RNA interference. It had previously been assumed that that there must be a double stranded region of 19 nucleotides or greater. The molecules described herein are optimized through chemical modification, and in some instances through attachment of hydrophobic conjugates.
The invention is based at least in part on another surprising discovery that asymmetric nucleic acid molecules with reduced double stranded regions are much more effectively taken up by cells compared to conventional siRNAs. These molecules are highly efficient in silencing of target gene expression and offer significant advantages over previously described RNAi molecules including high activity in the presence of serum, efficient self delivery, compatibility with a wide variety of linkers, and reduced presence or complete absence of chemical modifications that are associated with toxicity.
In contrast to single-stranded polynucleotides, duplex polynucleotides have been difficult to deliver to a cell as they have rigid structures and a large number of negative charges which makes membrane transfer difficult. Unexpectedly, it was found that the polynucleotides of the present invention, although partially double-stranded, are recognized in vivo as single-stranded and, as such, are capable of efficiently being delivered across cell membranes. As a result the polynucleotides of the invention are capable in many instances of self delivery. Thus, the polynucleotides of the invention may be formulated in a manner similar to conventional RNAi agents or they may be delivered to the cell or subject alone (or with non-delivery type carriers) and allowed to self deliver. In one embodiment of the present invention, self delivering asymmetric double-stranded RNA molecules are provided in which one portion of the molecule resembles a conventional RNA duplex and a second portion of the molecule is single stranded.
The polynucleotides of the invention are referred to herein as isolated double stranded or duplex nucleic acids, oligonucleotides or polynucleotides, nano molecules, nano RNA, sd-rxRNA"a"0, sd-rxRNA or RNA molecules of the invention.

The oligonucleotides of the invention in some aspects have a combination of asymmetric structures including a double stranded region and a single stranded region of nucleotides or longer, specific chemical modification patterns and are conjugated to lipophilic or hydrophobic molecules. This new class of RNAi like compounds have 5 superior efficacy in vitro and in vivo. Based on the data described herein it is believed that the reduction in the size of the rigid duplex region in combination with phosphorothioate modifications applied to a single stranded region are new and important for achieving the observed superior efficacy. Thus, the RNA
molecules described herein are different in both structure and composition as well as in vitro and in vivo activity.
In a preferred embodiment the RNAi compounds of the invention comprise an asymmetric compound comprising a duplex region (required for efficient RISC
entry of 10-15 bases long) and single stranded region of 4-12 nucleotides long; with a nucleotide duplex. A 6 nucleotide single stranded region is preferred in some embodiments. The single stranded region of the new RNAi compounds also comprises 2-12 phosphorothioate internucleotide linkages (referred to as phosphorothioate modifications). 6-8 phosphorothioate internucleotide linkages are preferred in some embodiments. Additionally, the RNAi compounds of the invention also include a unique chemical modification pattern, which provides stability and is compatible with RISC
entry. The combination of these elements has resulted in unexpected properties which are highly useful for delivery of RNAi reagents in vitro and in vivo.
The chemically modification pattern, which provides stability and is compatible with RISC entry includes modifications to the sense, or passenger, strand as well as the antisense, or guide, strand. For instance the passenger strand can be modified with any chemical entities which confirm stability and do not interfere with activity.
Such modifications include 2' ribo modifications (0-methyl, 2' F, 2 deoxy and others) and backbone modification like phosphorothioate modifications. A preferred chemical modification pattern in the passenger strand includes Omethyl modification of C and U
nucleotides within the passenger strand or alternatively the passenger strand may be completely Omethyl modified.
The guide strand, for example, may also be modified by any chemical modification which confirms stability without interfering with RISC entry. A
preferred chemical modification pattern in the guide strand includes the majority of C
and U

nucleotides being 2' F modified and the 5' end being phosphorylated. Another preferred chemical modification pattern in the guide strand includes 2'Omethyl modification of position 1 and C/U in positions 11-18 and 5' end chemical phosphorylation. Yet another preferred chemical modification pattern in the guide strand includes 2'Omethyl modification of position 1 and C/U in positions 11-18 and 5' end chemical phosphorylation and and 2'F modification of C/U in positions 2-10.
It was surprisingly discovered according to the invention that the above-described chemical modification patterns of the oligonucleotides of the invention are well tolerated and actually improved efficacy of asymmetric RNAi compounds. See, for instance, 1 o Figure 22.
It was also demonstrated experimentally herein that the combination of modifications to RNAi when used together in a polynucleotide results in the achievement of optimal efficacy in passive uptake of the RNAi. Elimination of any of the described components (Guide strand stabilization, phosphorothioate stretch, sense strand stabilization and hydrophobic conjugate) or increase in size results in sub-optimal efficacy and in some instances complete lost of efficacy. The combination of elements results in development of compound, which is fully active following passive delivery to cells such as HeLa cells. (Figure 23). The degree to which the combination of elements results in efficient self delivery of RNAi molecules was completely unexpected.
The data shown in Figures 26, 27 and 43 demonstrated the importance of the various modifications to the RNAi in achieving stabilization and activity. For instance, Figure 26 demonstrates that use off asymmetric configuration is important in getting efficacy in passive uptake. When the same chemical composition is applied to compounds of traditional configurations (19-21 bases duplex and 25 mer duplex) the efficacy was drastically decreased in a length dependent manner. Figure 27 demonstrated a systematic screen of the impact of phosphorothioate chemical modifications on activity. The sequence, structure, stabilization chemical modifications, hydrophobic conjugate were kept constant and compound phosphorothioate content was varied (from 0 to 18 PS bond). Both compounds having no phosphorothioate linkages and having 18 phosphorothioate linkages were completely inactive in passive uptake.
Compounds having 2-16 phosphorothioate linkages were active, with compounds having 4-10 phosphorothioate being the most active compounds.

The data in the Examples presented below demonstrates high efficacy of the oligonucleotides of the invention both in vitro in variety of cell types (supporting data) and in vivo upon local and systemic administration. For instance, the data compares the ability of several competitive RNAi molecules having different chemistries to silence a gene. Comparison of sd-rxRNA (oligonucleotides of the invention) with RNAs described in Soucheck et al. and Wolfrum at al., as applied to the same targeting region, demonstrated that only sd-rxRNA chemistry showed a significant functionality in passive uptake. The composition of the invention achieved EC50 values of 10-50 pM.
This level of efficacy is un-attainable with conventional chemistries like those described in Sauthceck at al and Accell. Similar comparisons were made in other systems, such as in vitro (RPE cell line), in vivo upon local administration (wounded skin) and systemic (50 mg/kg) as well as other genes (Figures 65 and 68). In each case the oligonucleotides of the invention achieved better results. Figure 64 includes data demonstrating efficient cellular uptake and resulting silencing by sd-rxRNA compounds only after 1 minute of exposure. Such an efficacy is unique to this composition and have not been seen with other types of molecules in this class. Figure 70 demonstrates efficient uptake and silencing of sd-rxRNA compounds in multiple cell types with multiple sequences. The sd-rxRNA compounds are also active in cells in presence and absence of serum and other biological liquids. Figure 71 demonstrates only a slight reduction in activity in the presence of serum. This ability to function in biologically aggressive environment effectively further differentiates sd-rxRNA compounds from other compounds described previously in this group, like Accell and Soucheck et al, in which uptake is drastically inhibited in a presence of serum.
Significant amounts of data also demonstrate the in vivo efficacy of the compounds of the invention. For instance Figures 72-74 involve multiple routes of in vivo delivery of the compounds of the invention resulting in significant activity. Figure 72, for example, demonstrates efficient tissue penetration and cellular uptake upon single intradermal injection. This is a model for local delivery of sd-rxRNA
compounds as well as an effective delivery mode for sd-rxRNA compounds and silencing genes in any 3o dermatology applications. Figure 73 demonstrated efficient tissue penetration, cellular uptake and silencing upon local in vivo intradermal injection of sd-rxRNA
compounds.
The data of Figure 74 demonstrate that sd-rxRNA compounds result in highly effective liver uptake upon IV administration. Comparison to Souicheck at al molecule showed that the level of liver uptake at identical dose level was quite surprisingly, at least 50 fold higher with the sd-rxRNA compound than the Souicheck at al molecule.
The sd-rxRNA can be further improved in some instances by improving the hydrophobicity of compounds using of novel types of chemistries. For example one chemistry is related to use of hydrophobic base modifications. Any base in any position might be modified, as long as modification results in an increase of the partition coefficient of the base. The preferred locations for modification chemistries are positions 4 and 5 of the pyrimidines. The major advantage of these positions is (a) ease of synthesis and (b) lack of interference with base-pairing and A form helix formation, which are essential for RISC complex loading and target recognition. Examples of these chemistries is shown in Figures 75-83. A version of sd-rxRNA compounds where multiple deoxy Uridines are present without interfering with overall compound efficacy was used. In addition major improvement in tissue distribution and cellular uptake might be obtained by optimizing the structure of the hydrophobic conjugate. In some of the preferred embodiment the structure of sterol is modified to alter (increase/
decrease) C 17 attached chain. This type of modification results in significant increase in cellular uptake and improvement of tissue uptake prosperities in vivo.
This invention is not limited in its application to the details of construction and the arrangement of components set forth in the following description or illustrated in the drawings. The invention is capable of other embodiments and of being practiced or of being carried out in various ways. Also, the phraseology and terminology used herein is for the purpose of description and should not be regarded as limiting. The use of "including," "comprising," or "having," "containing," "involving," and variations thereof herein, is meant to encompass the items listed thereafter and equivalents thereof as well as additional items.
Thus, aspects of the invention relate to isolated double stranded nucleic acid molecules comprising a guide (antisense) strand and a passenger (sense) strand. As used herein, the term "double-stranded" refers to one or more nucleic acid molecules in which at least a portion of the nucleomonomers are complementary and hydrogen bond to form a double-stranded region. In some embodiments, the length of the guide strand ranges from 16-29 nucleotides long. In certain embodiments, the guide strand is 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, or 29 nucleotides long. The guide strand has complementarity to a target gene. Complementarity between the guide strand and the target gene may exist over any portion of the guide strand. Complementarity as used herein may be perfect complementarity or less than perfect complementarity as long as the guide strand is sufficiently complementary to the target that it mediates RNAi. In some embodiments complementarity refers to less than 25%, 20%, 15%, 10%, 5%, 4%, 3%, 2%, or 1% mismatch between the guide strand and the target. Perfect complementarity refers to 100% complementarity. Thus the invention has the advantage of being able to tolerate sequence variations that might be expected due to genetic mutation, strain polymorphism, or evolutionary divergence. For example, siRNA
sequences with insertions, deletions, and single point mutations relative to the target sequence have also been found to be effective for inhibition. Moreover, not all positions of a siRNA contribute equally to target recognition. Mismatches in the center of the siRNA are most critical and essentially abolish target RNA cleavage.
Mismatches upstream of the center or upstream of the cleavage site referencing the antisense strand are tolerated but significantly reduce target RNA cleavage. Mismatches downstream of the center or cleavage site referencing the antisense strand, preferably located near the 3' end of the antisense strand, e.g. 1, 2, 3, 4, 5 or 6 nucleotides from the 3' end of the antisense strand, are tolerated and reduce target RNA cleavage only slightly.
While not wishing to be bound by any particular theory, in some embodiments, the guide strand is at least 16 nucleotides in length and anchors the Argonaute protein in RISC. In some embodiments, when the guide strand loads into RISC it has a defined seed region and target mRNA cleavage takes place across from position 10-11 of the guide strand. In some embodiments, the 5' end of the guide strand is or is able to be phosphorylated. The nucleic acid molecules described herein may be referred to as minimum trigger RNA.
In some embodiments, the length of the passenger strand ranges from 8-14 nucleotides long. In certain embodiments, the passenger strand is 8, 9, 10, 11, 12, 13 or 14 nucleotides long. The passenger strand has complementarity to the guide strand.
Complementarity between the passenger strand and the guide strand can exist over any portion of the passenger or guide strand. In some embodiments, there is 100%
complementarity between the guide and passenger strands within the double stranded region of the molecule.
Aspects of the invention relate to double stranded nucleic acid molecules with minimal double stranded regions. In some embodiments the region of the molecule that is double stranded ranges from 8-14 nucleotides long. In certain embodiments, the region of the molecule that is double stranded is 8, 9, 10, 11, 12, 13 or 14 nucleotides long. In certain embodiments the double stranded region is 13 nucleotides long. There can be 100% complementarity between the guide and passenger strands, or there may be one or more mismatches between the guide and passenger strands. In some embodiments, on one end of the double stranded molecule, the molecule is either blunt-ended or has a one-nucleotide overhang. The single stranded region of the molecule is in some embodiments between 4-12 nucleotides long. For example the single stranded region can be 4, 5, 6, 7, 8, 9, 10, 11 or 12 nucleotides long. However, in certain embodiments, the single stranded region can also be less than 4 or greater than 12 nucleotides long. In certain embodiments, the single stranded region is 6 nucleotides long.
RNAi constructs associated with the invention can have a thermodynamic stability (AG) of less than -13 kkal/mol. In some embodiments, the thermodynamic stability (AG) is less than -20 kkal/mol. In some embodiments there is a loss of efficacy when (AG) goes below -21 kkal/mol. In some embodiments a (AG) value higher than -13 kkal/mol is compatible with aspects of the invention. Without wishing to be bound by any theory, in some embodiments a molecule with a relatively higher (AG) value may become active at a relatively higher concentration, while a molecule with a relatively lower (AG) value may become active at a relatively lower concentration. In some embodiments, the (AG) value may be higher than -9 kkcal/mol. The gene silencing effects mediated by the RNAi constructs associated with the invention, containing minimal double stranded regions, are unexpected because molecules of almost identical design but lower thermodynamic stability have been demonstrated to be inactive (Rana et al. 2004).
Without wishing to be bound by any theory, results described herein suggest that a stretch of 8-10 bp of dsRNA or dsDNA will be structurally recognized by protein components of RISC or co-factors of RISC. Additionally, there is a free energy requirement for the triggering compound that it may be either sensed by the protein components and/or stable enough to interact with such components so that it may be loaded into the Argonaute protein. If optimal thermodynamics are present and there is a double stranded portion that is preferably at least 8 nucleotides then the duplex will be recognized and loaded into the RNAi machinery.

In some embodiments, thermodynamic stability is increased through the use of LNA bases. In some embodiments, additional chemical modifications are introduced.
Several non-limiting examples of chemical modifications include: 5' Phosphate, 2'-O-methyl, 2'-O-ethyl, 2'-fluoro, ribothymidine, C-5 propynyl-dC (pdC) and C-5 propynyl-dU (pdU); C-5 propynyl-C (pC) and C-5 propynyl-U (pU); 5-methyl C, 5-methyl U, methyl dC, 5-methyl dU methoxy, (2,6-diaminopurine), 5'-Dimethoxytrityl-N4-ethyl-2'-deoxyCytidine and MGB (minor groove binder). It should be appreciated that more than one chemical modification can be combined within the same molecule.
Molecules associated with the invention are optimized for increased potency and/or reduced toxicity. For example, nucleotide length of the guide and/or passenger strand, and/or the number of phosphorothioate modifications in the guide and/or passenger strand, can in some aspects influence potency of the RNA molecule, while replacing 2'-fluoro (2'F) modifications with 2'-O-methyl (2'OMe) modifications can in some aspects influence toxicity of the molecule. Specifically, reduction in 2'F content of a molecule is predicted to reduce toxicity of the molecule. The Examples section presents molecules in which 2'F modifications have been eliminated, offering an advantage over previously described RNAi compounds due to a predicted reduction in toxicity. Furthermore, the number of phosphorothioate modifications in an RNA
molecule can influence the uptake of the molecule into a cell, for example the efficiency of passive uptake of the molecule into a cell. Preferred embodiments of molecules described herein have no 2'F modification and yet are characterized by equal efficacy in cellular uptake and tissue penetration. Such molecules represent a significant improvement over prior art, such as molecules described by Accell and Wolfrum, which are heavily modified with extensive use of 2'F.
In some embodiments, a guide strand is approximately 18-19 nucleotides in length and has approximately 2-14 phosphate modifications. For example, a guide strand can contain 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or more than 14 nucleotides that are phosphate-modified. The guide strand may contain one or more modifications that confer increased stability without interfering with RISC entry. The phosphate modified nucleotides, such as phosphorothioate modified nucleotides, can be at the 3' end, 5' end or spread throughout the guide strand. In some embodiments, the 3' terminal 10 nucleotides of the guide strand contains 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 phosphorothioate modified nucleotides. The guide strand can also contain 2'F and/or 2'OMe modifications, which can be located throughout the molecule. In some embodiments, the nucleotide in position one of the guide strand (the nucleotide in the most 5' position of the guide strand) is 2'OMe modified and/or phosphorylated. C and U nucleotides within the guide strand can be 2'F modified. For example, C and U nucleotides in positions 2-10 of a 19 nt guide strand (or corresponding positions in a guide strand of a different length) can be 2'F modified. C and U nucleotides within the guide strand can also be 2' OMe modified. For example, C and U nucleotides in positions 11-18 of a 19 nt guide strand (or corresponding positions in a guide strand of a different length) can be 2'OMe modified. In some embodiments, the nucleotide at the most 3' end of the guide strand is unmodified. In certain embodiments, the majority of Cs and Us within the guide strand are 2'F modified and the 5' end of the guide strand is phosphorylated. In other embodiments, position 1 and the Cs or Us in positions 11-18 are 2'OMe modified and the 5' end of the guide strand is phosphorylated. In other embodiments, position 1 and the Cs or Us in positions 11-18 are 2'OMe modified, the 5' end of the guide strand is phosphorylated, and the Cs or Us in position 2-10 are 2'F modified.
In some aspects, an optimal passenger strand is approximately 11-14 nucleotides in length. The passenger strand may contain modifications that confer increased stability. One or more nucleotides in the passenger strand can be 2'OMe modified. In some embodiments, one or more of the C and/or U nucleotides in the passenger strand is 2'OMe modified, or all of the C and U nucleotides in the passenger strand are 2'OMe modified. In certain embodiments, all of the nucleotides in the passenger strand are 2'OMe modified. One or more of the nucleotides on the passenger strand can also be phosphate-modified such as phosphorothioate modified. The passenger strand can also contain 2' ribo, 2'F and 2 deoxy modifications or any combination of the above. As demonstrated in the Examples, chemical modification patterns on both the guide and passenger strand are well tolerated and a combination of chemical modifications is shown herein to lead to increased efficacy and self-delivery of RNA molecules.
Aspects of the invention relate to RNAi constructs that have extended single-stranded regions relative to double stranded regions, as compared to molecules that have been used previously for RNAi. The single stranded region of the molecules may be modified to promote cellular uptake or gene silencing. In some embodiments, phosphorothioate modification of the single stranded region influences cellular uptake and/or gene silencing. The region of the guide strand that is phosphorothioate modified can include nucleotides within both the single stranded and double stranded regions of the molecule. In some embodiments, the single stranded region includes 2-12 phosphorothioate modifications. For example, the single stranded region can include 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 phosphorothioate modifications. In some instances, the single stranded region contains 6-8 phosphorothioate modifications.
Molecules associated with the invention are also optimized for cellular uptake. In RNA molecules described herein, the guide and/or passenger strands can be attached to a conjugate. In certain embodiments the conjugate is hydrophobic. The hydrophobic conjugate can be a small molecule with a partition coefficient that is higher than 10. The conjugate can be a sterol-type molecule such as cholesterol, or a molecule with an increased length polycarbon chain attached to C 17, and the presence of a conjugate can influence the ability of an RNA molecule to be taken into a cell with or without a lipid transfection reagent. The conjugate can be attached to the passenger or guide strand through a hydrophobic linker. In some embodiments, a hydrophobic linker is 5-12C in length, and/or is hydroxypyrrolidine-based. In some embodiments, a hydrophobic conjugate is attached to the passenger strand and the CU residues of either the passenger and/or guide strand are modified. In some embodiments, at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or 95% of the CU residues on the passenger strand and/or the guide strand are modified. In some aspects, molecules associated with the invention are self-delivering (sd). As used herein, "self-delivery" refers to the ability of a molecule to be delivered into a cell without the need for an additional delivery vehicle such as a transfection reagent.
Aspects of the invention relate to selecting molecules for use in RNAi. Based on the data described herein, molecules that have a double stranded region of 8-nucleotides can be selected for use in RNAi. In some embodiments, molecules are selected based on their thermodynamic stability (AG). In some embodiments, molecules will be selected that have a (AG) of less than -13 kkal/mol. For example, the (AG) value may be -13,-14,-15,-16,-17,-18,-19,-21, -22 or less than -22 kkal/mol. In other embodiments, the (AG) value may be higher than -13 kkal/mol. For example, the (AG) value may be -12, -11, -10, -9, -8, -7 or more than -7 kkal/mol. It should be appreciated that AG can be calculated using any method known in the art. In some embodiments AG
is calculated using Mfold, available through the Mfold internet site (http://mfold.bioinfo.rpi.edu/cgi-bin/rna-forml.cgi). Methods for calculating AG are described in, and are incorporated by reference from, the following references: Zuker, M.
(2003) Nucleic Acids Res., 31(13):3406-15; Mathews, D. H., Sabina, J., Zuker, M. and Turner, D. H. (1999) J. Mol. Biol. 288:911-940; Mathews, D. H., Disney, M. D., Childs, J. L., Schroeder, S. J., Zuker, M., and Turner, D. H. (2004) Proc. Natl. Acad.
Sci.
101:7287-7292; Duan, S., Mathews, D. H., and Turner, D. H. (2006) Biochemistry 45:9819-9832; Wuchty, S., Fontana, W., Hofacker, I. L., and Schuster, P.
(1999) Biopolymers 49:145-165.
Aspects of the invention relate to using nucleic acid molecules described herein, with minimal double stranded regions and/or with a (AG) of less than -13 kkal/mol, for gene silencing. RNAi molecules can be administered in vivo or in vitro, and gene silencing effects can be achieved in vivo or in vitro.

In certain embodiments, the polynucleotide contains 5'- and/or 3'-end overhangs.
The number and/or sequence of nucleotides overhang on one end of the polynucleotide may be the same or different from the other end of the polynucleotide. In certain embodiments, one or more of the overhang nucleotides may contain chemical modification(s), such as phosphorothioate or 2'-OMe modification.

In certain embodiments, the polynucleotide is unmodified. In other embodiments, at least one nucleotide is modified. In further embodiments, the modification includes a 2'-H or 2'-modified ribose sugar at the 2nd nucleotide from the 5'-end of the guide sequence. The "2nd nucleotide" is defined as the second nucleotide from the 5'-end of the polynucleotide.

As used herein, "2'-modified ribose sugar" includes those ribose sugars that do not have a 2'-OH group. "2'-modified ribose sugar" does not include 2'-deoxyribose (found in unmodified canonical DNA nucleotides). For example, the 2'-modified ribose sugar may be 2'-O-alkyl nucleotides, 2'-deoxy-2'-fluoro nucleotides, 2'-deoxy nucleotides, or combination thereof.

In certain embodiments, the 2'-modified nucleotides are pyrimidine nucleotides (e.g., C /U). Examples of 2'-O-alkyl nucleotides include 2'-O-methyl nucleotides, or 2'-O-allyl nucleotides.

In certain embodiments, the miniRNA polynucleotide of the invention with the above-referenced 5'-end modification exhibits significantly (e.g., at least about 25%, 30%, 35%,40%,45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or more) less "off-target" gene silencing when compared to similar constructs without the specified 5'-end modification, thus greatly improving the overall specificity of the RNAi reagent or therapeutics.

As used herein, "off-target" gene silencing refers to unintended gene silencing due to, for example, spurious sequence homology between the antisense (guide) sequence and the unintended target mRNA sequence.

According to this aspect of the invention, certain guide strand modifications further increase nuclease stability, and/or lower interferon induction, without significantly decreasing RNAi activity (or no decrease in RNAi activity at all).

In some embodiments, wherein the RNAi construct involves a hairpin, the 5'-stem sequence may comprise a 2'-modified ribose sugar, such as 2'-O-methyl modified nucleotide, at the 2d nucleotide on the 5'-end of the polynucleotide and, in some embodiments, no other modified nucleotides. The hairpin structure having such modification may have enhanced target specificity or reduced off-target silencing compared to a similar construct without the 2'-O-methyl modification at said position.
Certain combinations of specific 5'-stem sequence and 3'-stem sequence modifications may result in further unexpected advantages, as partly manifested by enhanced ability to inhibit target gene expression, enhanced serum stability, and/or increased target specificity, etc.

In certain embodiments, the guide strand comprises a 2'-O-methyl modified nucleotide at the 2nd nucleotide on the 5'-end of the guide strand and no other modified nucleotides.

In other aspects, the miniRNA structures of the present invention mediates sequence-dependent gene silencing by a microRNA mechanism. As used herein, the term "microRNA" ("miRNA"), also referred to in the art as "small temporal RNAs"
("stRNAs"), refers to a small (10-50 nucleotide) RNA which are genetically encoded (e.g., by viral, mammalian, or plant genomes) and are capable of directing or mediating RNA silencing. An "miRNA disorder" shall refer to a disease or disorder characterized by an aberrant expression or activity of an miRNA.

microRNAs are involved in down-regulating target genes in critical pathways, such as development and cancer, in mice, worms and mammals. Gene silencing through a microRNA mechanism is achieved by specific yet imperfect base-pairing of the miRNA and its target messenger RNA (mRNA). Various mechanisms may be used in microRNA-mediated down-regulation of target mRNA expression.

miRNAs are noncoding RNAs of approximately 22 nucleotides which can regulate gene expression at the post transcriptional or translational level during plant and animal development. One common feature of miRNAs is that they are all excised from an approximately 70 nucleotide precursor RNA stem-loop termed pre-miRNA, probably by Dicer, an RNase III-type enzyme, or a homolog thereof. Naturally-occurring miRNAs are expressed by endogenous genes in vivo and are processed from a hairpin or stem-loop precursor (pre-miRNA or pri-miRNAs) by Dicer or other RNAses. miRNAs can exist transiently in vivo as a double-stranded duplex but only one strand is taken up by the RISC complex to direct gene silencing.

In some embodiments a version of sd-rxRNA compounds, which are effective in cellular uptake and inhibiting of miRNA activity are described. Essentially the compounds are similar to RISC entering version but large strand chemical modification patterns are optimized in the way to block cleavage and act as an effective inhibitor of the RISC action. For example, the compound might be completely or mostly Omethyl modified with the PS content described previously. For these types of compounds the 5' phosphorilation is not necessary. The presence of double stranded region is preferred as it is promotes cellular uptake and efficient RISC loading.

Another pathway that uses small RNAs as sequence-specific regulators is the RNA interference (RNAi) pathway, which is an evolutionarily conserved response to the presence of double-stranded RNA (dsRNA) in the cell. The dsRNAs are cleaved into -20-base pair (bp) duplexes of small-interfering RNAs (siRNAs) by Dicer. These small RNAs get assembled into multiprotein effector complexes called RNA-induced silencing complexes (RISCs). The siRNAs then guide the cleavage of target mRNAs with perfect complementarity.

Some aspects of biogenesis, protein complexes, and function are shared between the siRNA pathway and the miRNA pathway. The subject single-stranded polynucleotides may mimic the dsRNA in the siRNA mechanism, or the microRNA in the miRNA mechanism.

In certain embodiments, the modified RNAi constructs may have improved stability in serum and/or cerebral spinal fluid compared to an unmodified RNAi constructs having the same sequence.

In certain embodiments, the structure of the RNAi construct does not induce interferon response in primary cells, such as mammalian primary cells, including primary cells from human, mouse and other rodents, and other non-human mammals. In certain embodiments, the RNAi construct may also be used to inhibit expression of a target gene in an invertebrate organism.

To further increase the stability of the subject constructs in vivo, the 3'-end of the hairpin structure may be blocked by protective group(s). For example, protective groups such as inverted nucleotides, inverted abasic moieties, or amino-end modified nucleotides may be used. Inverted nucleotides may comprise an inverted deoxynucleotide. Inverted abasic moieties may comprise an inverted deoxyabasic moiety, such as a 3',3'-linked or 5',5'-linked deoxyabasic moiety.

The RNAi constructs of the invention are capable of inhibiting the synthesis of any target protein encoded by target gene(s). The invention includes methods to inhibit expression of a target gene either in a cell in vitro, or in vivo. As such, the RNAi constructs of the invention are useful for treating a patient with a disease characterized by the overexpression of a target gene.

The target gene can be endogenous or exogenous (e.g., introduced into a cell by a virus or using recombinant DNA technology) to a cell. Such methods may include introduction of RNA into a cell in an amount sufficient to inhibit expression of the target gene. By way of example, such an RNA molecule may have a guide strand that is complementary to the nucleotide sequence of the target gene, such that the composition inhibits expression of the target gene.

The invention also relates to vectors expressing the subject hairpin constructs, and cells comprising such vectors or the subject hairpin constructs. The cell may be a mammalian cell in vivo or in culture, such as a human cell.

The invention further relates to compositions comprising the subject RNAi constructs, and a pharmaceutically acceptable carrier or diluent.

Another aspect of the invention provides a method for inhibiting the expression of a target gene in a mammalian cell, comprising contacting the mammalian cell with any of the subject RNAi constructs.

The method may be carried out in vitro, ex vivo, or in vivo, in, for example, mammalian cells in culture, such as a human cell in culture.

The target cells (e.g., mammalian cell) may be contacted in the presence of a delivery reagent, such as a lipid (e.g., a cationic lipid) or a liposome.

Another aspect of the invention provides a method for inhibiting the expression of a target gene in a mammalian cell, comprising contacting the mammalian cell with a vector expressing the subject RNAi constructs.

In one aspect of the invention, a longer duplex polynucleotide is provided, including a first polynucleotide that ranges in size from about 16 to about 30 nucleotides;
a second polynucleotide that ranges in size from about 26 to about 46 nucleotides, wherein the first polynucleotide (the antisense strand) is complementary to both the second polynucleotide (the sense strand) and a target gene, and wherein both polynucleotides form a duplex and wherein the first polynucleotide contains a single stranded region longer than 6 bases in length and is modified with alternative chemical modification pattern, and/or includes a conjugate moiety that facilitates cellular delivery.
In this embodiment, between about 40% to about 90% of the nucleotides of the passenger strand between about 40% to about 90% of the nucleotides of the guide strand, and between about 40% to about 90% of the nucleotides of the single stranded region of the first polynucleotide are chemically modified nucleotides.

In an embodiment, the chemically modified nucleotide in the polynucleotide duplex may be any chemically modified nucleotide known in the art, such as those discussed in detail above. In a particular embodiment, the chemically modified nucleotide is selected from the group consisting of 2' F modified nucleotides ,2'-O-methyl modified and 2'deoxy nucleotides. In another particular embodiment, the chemically modified nucleotides results from "hydrophobic modifications" of the nucleotide base. In another particular embodiment, the chemically modified nucleotides are phosphorothioates. In an additional particular embodiment, chemically modified nucleotides are combination of phosphorothioates, 2'-O-methyl, 2'deoxy, hydrophobic modifications and phosphorothioates. As these groups of modifications refer to modification of the ribose ring, back bone and nucleotide, it is feasible that some modified nucleotides will carry a combination of all three modification types.
In another embodiment, the chemical modification is not the same across the various regions of the duplex. In a particular embodiment, the first polynucleotide (the passenger strand), has a large number of diverse chemical modifications in various positions. For this polynucleotide up to 90% of nucleotides might be chemically modified and/or have mismatches introduced. In another embodiment, chemical modifications of the first or second polynucleotide include, but not limited to, 5' position modification of Uridine and Cytosine (4-pyridyl, 2-pyridyl, indolyl, phenyl (C6H5OH);
tryptophanyl (C8H6N)CH2CH(NH2)CO), isobutyl, butyl, aminobenzyl; phenyl;
naphthyl, etc), where the chemical modification might alter base pairing capabilities of a nucleotide. For the guide strand an important feature of this aspect of the invention is the position of the chemical modification relative to the 5' end of the antisense and sequence.. For example, chemical phosphorylation of the 5' end of the guide strand is usually beneficial for efficacy. 0-methyl modifications in the seed region of the sense strand (position 2-7 relative to the 5' end) are not generally well tolerated, whereas 2'F
and deoxy are well tolerated. The mid part of the guide strand and the 3' end of the guide strand are more permissive in a type of chemical modifications applied.
Deoxy modifications are not tolerated at the 3' end of the guide strand.
A unique feature of this aspect of the invention involves the use of hydrophobic modification on the bases. In one embodiment, the hydrophobic modifications are preferably positioned near the 5' end of the guide strand, in other embodiments, they localized in the middle of the guides strand, in other embodiment they localized at the 3' end of the guide strand and yet in another embodiment they are distributed thought the whole length of the polynucleotide. The same type of patterns is applicable to the passenger strand of the duplex.

The other part of the molecule is a single stranded region. The single stranded region is expected to range from 7 to 40 nucleotides.

In one embodiment, the single stranded region of the first polynucleotide contains modifications selected from the group consisting of between 40% and 90%
hydrophobic base modifications, between 40%-90% phosphorothioates, between 40% -90%
modification of the ribose moiety, and any combination of the preceding.

Efficiency of guide strand (first polynucleotide) loading into the RISC
complex might be altered for heavily modified polynucleotides, so in one embodiment, the duplex polynucleotide includes a mismatch between nucleotide 9, 11, 12, 13, or 14 on the guide strand (first polynucleotide) and the opposite nucleotide on the sense strand (second polynucleotide) to promote efficient guide strand loading.

More detailed aspects of the invention are described in the sections below.
Duplex Characteristics Double-stranded oligonucleotides of the invention may be formed by two separate complementary nucleic acid strands. Duplex formation can occur either inside or outside the cell containing the target gene.

As used herein, the term "duplex" includes the region of the double-stranded nucleic acid molecule(s) that is (are) hydrogen bonded to a complementary sequence.
Double-stranded oligonucleotides of the invention may comprise a nucleotide sequence that is sense to a target gene and a complementary sequence that is antisense to the target gene. The sense and antisense nucleotide sequences correspond to the target gene sequence, e.g., are identical or are sufficiently identical to effect target gene inhibition (e.g., are about at least about 98% identical, 96% identical, 94%, 90%
identical, 85%
identical, or 80% identical) to the target gene sequence.

In certain embodiments, the double-stranded oligonucleotide of the invention is double-stranded over its entire length, i.e., with no overhanging single-stranded sequence at either end of the molecule, i.e., is blunt-ended. In other embodiments, the individual nucleic acid molecules can be of different lengths. In other words, a double-stranded oligonucleotide of the invention is not double-stranded over its entire length. For instance, when two separate nucleic acid molecules are used, one of the molecules, e.g., the first molecule comprising an antisense sequence, can be longer than the second molecule hybridizing thereto (leaving a portion of the molecule single-stranded).
Likewise, when a single nucleic acid molecule is used a portion of the molecule at either end can remain single-stranded.

In one embodiment, a double-stranded oligonucleotide of the invention contains mismatches and/or loops or bulges, but is double-stranded over at least about 70% of the length of the oligonucleotide. In another embodiment, a double-stranded oligonucleotide of the invention is double-stranded over at least about 80% of the length of the oligonucleotide. In another embodiment, a double-stranded oligonucleotide of the invention is double-stranded over at least about 90%-95% of the length of the oligonucleotide. In another embodiment, a double-stranded oligonucleotide of the invention is double-stranded over at least about 96%-98% of the length of the oligonucleotide. In certain embodiments, the double-stranded oligonucleotide of the invention contains at least or up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 mismatches.
Modifications The nucleotides of the invention may be modified at various locations, including the sugar moiety, the phosphodiester linkage, and/or the base.
Sugar moieties include natural, unmodified sugars, e.g., monosaccharide (such as pentose, e.g., ribose, deoxyribose), modified sugars and sugar analogs. In general, possible modifications of nucleomonomers, particularly of a sugar moiety, include, for example, replacement of one or more of the hydroxyl groups with a halogen, a heteroatom, an aliphatic group, or the functionalization of the hydroxyl group as an ether, an amine, a thiol, or the like.
One particularly useful group of modified nucleomonomers are 2'-O-methyl nucleotides. Such 2'-O-methyl nucleotides may be referred to as "methylated,"
and the corresponding nucleotides may be made from unmethylated nucleotides followed by alkylation or directly from methylated nucleotide reagents. Modified nucleomonomers may be used in combination with unmodified nucleomonomers. For example, an oligonucleotide of the invention may contain both methylated and unmethylated nucleomonomers.
Some exemplary modified nucleomonomers include sugar- or backbone-modified ribonucleotides. Modified ribonucleotides may contain a non-naturally occurring base (instead of a naturally occurring base), such as uridines or cytidines modified at the 5'-position, e.g., 5'-(2-amino)propyl uridine and 5'-bromo uridine; adenosines and guanosines modified at the 8-position, e.g., 8-bromo guanosine; deaza nucleotides, e.g., 7-deaza-adenosine; and N-alkylated nucleotides, e.g., N6-methyl adenosine.
Also, sugar-modified ribonucleotides may have the 2'-OH group replaced by a H, alxoxy (or OR), R or alkyl, halogen, SH, SR, amino (such as NH2, NHR, NR2,), or CN group, wherein R is lower alkyl, alkenyl, or alkynyl.
Modified ribonucleotides may also have the phosphodiester group connecting to adjacent ribonucleotides replaced by a modified group, e.g., of phosphorothioate group.
More generally, the various nucleotide modifications may be combined.
Although the antisense (guide) strand may be substantially identical to at least a portion of the target gene (or genes), at least with respect to the base pairing properties, the sequence need not be perfectly identical to be useful, e.g., to inhibit expression of a target gene's phenotype. Generally, higher homology can be used to compensate for the use of a shorter antisense gene. In some cases, the antisense strand generally will be substantially identical (although in antisense orientation) to the target gene.
The use of 2'-O-methyl modified RNA may also be beneficial in circumstances in which it is desirable to minimize cellular stress responses. RNA having 2'-O-methyl nucleomonomers may not be recognized by cellular machinery that is thought to recognize unmodified RNA. The use of 2'-O-methylated or partially 2'-O-methylated RNA may avoid the interferon response to double-stranded nucleic acids, while maintaining target RNA inhibition. This may be useful, for example, for avoiding the interferon or other cellular stress responses, both in short RNAi (e.g., siRNA) sequences that induce the interferon response, and in longer RNAi sequences that may induce the interferon response.
Overall, modified sugars may include D-ribose, 2'-O-alkyl (including 2'-O-methyl and 2'-O-ethyl), i.e., 2'-alkoxy, 2'-amino, 2'-S-alkyl, 2'-halo (including 2'-fluoro), 2'- methoxyethoxy, 2'-allyloxy (-OCH2CH=CH2), 2'-propargyl, 2'-propyl, ethynyl, ethenyl, propenyl, and cyano and the like. In one embodiment, the sugar moiety can be a hexose and incorporated into an oligonucleotide as described (Augustyns, K., et al., Nucl. Acids. Res. 18:4711 (1992)). Exemplary nucleomonomers can be found, e.g., in U.S. Pat. No. 5,849,902, incorporated by reference herein.
The term "alkyl" includes saturated aliphatic groups, including straight-chain alkyl groups (e.g., methyl, ethyl, propyl, butyl, pentyl, hexyl, heptyl, octyl, nonyl, decyl, etc.), branched-chain alkyl groups (isopropyl, tert-butyl, isobutyl, etc.), cycloalkyl (alicyclic) groups (cyclopropyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl), alkyl substituted cycloalkyl groups, and cycloalkyl substituted alkyl groups. In certain embodiments, a straight chain or branched chain alkyl has 6 or fewer carbon atoms in its backbone (e.g., C1-C6 for straight chain, C3-C6 for branched chain), and more preferably 4 or fewer. Likewise, preferred cycloalkyls have from 3-8 carbon atoms in their ring structure, and more preferably have 5 or 6 carbons in the ring structure. The term C1-C6 includes alkyl groups containing 1 to 6 carbon atoms.
Moreover, unless otherwise specified, the term alkyl includes both "unsubstituted alkyls" and "substituted alkyls," the latter of which refers to alkyl moieties having independently selected substituents replacing a hydrogen on one or more carbons of the hydrocarbon backbone. Such substituents can include, for example, alkenyl, alkynyl, halogen, hydroxyl, alkylcarbonyloxy, arylcarbonyloxy, alkoxycarbonyloxy, aryloxycarbonyloxy, carboxylate, alkylcarbonyl, arylcarbonyl, alkoxycarbonyl, aminocarbonyl, alkylaminocarbonyl, dialkylaminocarbonyl, alkylthiocarbonyl, alkoxyl, phosphate, phosphonato, phosphinato, cyano, amino (including alkyl amino, dialkylamino, arylamino, diarylamino, and alkylarylamino), acylamino (including alkylcarbonylamino, arylcarbonylamino, carbamoyl and ureido), amidino, imino, sulfhydryl, alkylthio, arylthio, thiocarboxylate, sulfates, alkylsulfinyl, sulfonato, sulfamoyl, sulfonamido, nitro, trifluoromethyl, cyano, azido, heterocyclyl, alkylaryl, or an aromatic or heteroaromatic moiety. Cycloalkyls can be further substituted, e.g., with the substituents described above. An "alkylaryl" or an "arylalkyl" moiety is an alkyl substituted with an aryl (e.g., phenylmethyl (benzyl)). The term "alkyl" also includes the side chains of natural and unnatural amino acids. The term "n-alkyl" means a straight chain (i.e., unbranched) unsubstituted alkyl group.
The term "alkenyl" includes unsaturated aliphatic groups analogous in length and possible substitution to the alkyls described above, but that contain at least one double bond. For example, the term "alkenyl" includes straight-chain alkenyl groups (e.g., ethylenyl, propenyl, butenyl, pentenyl, hexenyl, heptenyl, octenyl, nonenyl, decenyl, etc.), branched-chain alkenyl groups, cycloalkenyl (alicyclic) groups (cyclopropenyl, cyclopentenyl, cyclohexenyl, cycloheptenyl, cyclooctenyl), alkyl or alkenyl substituted cycloalkenyl groups, and cycloalkyl or cycloalkenyl substituted alkenyl groups. In certain embodiments, a straight chain or branched chain alkenyl group has 6 or fewer carbon atoms in its backbone (e.g., C2-C6 for straight chain, C3-C6 for branched chain).
Likewise, cycloalkenyl groups may have from 3-8 carbon atoms in their ring structure, and more preferably have 5 or 6 carbons in the ring structure. The term C2-C6 includes alkenyl groups containing 2 to 6 carbon atoms.
Moreover, unless otherwise specified, the term alkenyl includes both "unsubstituted alkenyls" and "substituted alkenyls," the latter of which refers to alkenyl moieties having independently selected substituents replacing a hydrogen on one or more carbons of the hydrocarbon backbone. Such substituents can include, for example, alkyl groups, alkynyl groups, halogens, hydroxyl, alkylcarbonyloxy, arylcarbonyloxy, alkoxycarbonyloxy, aryloxycarbonyloxy, carboxylate, alkylcarbonyl, arylcarbonyl, alkoxycarbonyl, aminocarbonyl, alkylaminocarbonyl, dialkylaminocarbonyl, alkylthiocarbonyl, alkoxyl, phosphate, phosphonato, phosphinato, cyano, amino (including alkyl amino, dialkylamino, arylamino, diarylamino, and alkylarylamino), acylamino (including alkylcarbonylamino, arylcarbonylamino, carbamoyl and ureido), amidino, imino, sulfhydryl, alkylthio, arylthio, thiocarboxylate, sulfates, alkylsulfinyl, sulfonato, sulfamoyl, sulfonamido, nitro, trifluoromethyl, cyano, azido, heterocyclyl, alkylaryl, or an aromatic or heteroaromatic moiety.
The term "alkynyl" includes unsaturated aliphatic groups analogous in length and possible substitution to the alkyls described above, but which contain at least one triple bond. For example, the term "alkynyl" includes straight-chain alkynyl groups (e.g., ethynyl, propynyl, butynyl, pentynyl, hexynyl, heptynyl, octynyl, nonynyl, decynyl, etc.), branched-chain alkynyl groups, and cycloalkyl or cycloalkenyl substituted alkynyl groups. In certain embodiments, a straight chain or branched chain alkynyl group has 6 or fewer carbon atoms in its backbone (e.g., C2-C6 for straight chain, C3-C6 for branched chain). The term C2-C6 includes alkynyl groups containing 2 to 6 carbon atoms.
Moreover, unless otherwise specified, the term alkynyl includes both "unsubstituted alkynyls" and "substituted alkynyls," the latter of which refers to alkynyl moieties having independently selected substituents replacing a hydrogen on one or more carbons of the hydrocarbon backbone. Such substituents can include, for example, alkyl groups, alkynyl groups, halogens, hydroxyl, alkylcarbonyloxy, arylcarbonyloxy, alkoxycarbonyloxy, aryloxycarbonyloxy, carboxylate, alkylcarbonyl, arylcarbonyl, alkoxycarbonyl, aminocarbonyl, alkylaminocarbonyl, dialkylaminocarbonyl, alkylthiocarbonyl, alkoxyl, phosphate, phosphonato, phosphinato, cyano, amino (including alkyl amino, dialkylamino, arylamino, diarylamino, and alkylarylamino), acylamino (including alkylcarbonylamino, arylcarbonylamino, carbamoyl and ureido), amidino, imino, sulfhydryl, alkylthio, arylthio, thiocarboxylate, sulfates, alkylsulfinyl, sulfonato, sulfamoyl, sulfonamido, nitro, trifluoromethyl, cyano, azido, heterocyclyl, alkylaryl, or an aromatic or heteroaromatic moiety.
Unless the number of carbons is otherwise specified, "lower alkyl" as used herein means an alkyl group, as defined above, but having from one to five carbon atoms in its backbone structure. "Lower alkenyl" and "lower alkynyl" have chain lengths of, for example, 2-5 carbon atoms.
The term "alkoxy" includes substituted and unsubstituted alkyl, alkenyl, and alkynyl groups covalently linked to an oxygen atom. Examples of alkoxy groups include methoxy, ethoxy, isopropyloxy, propoxy, butoxy, and pentoxy groups. Examples of substituted alkoxy groups include halogenated alkoxy groups. The alkoxy groups can be substituted with independently selected groups such as alkenyl, alkynyl, halogen, hydroxyl, alkylcarbonyloxy, arylcarbonyloxy, alkoxycarbonyloxy, aryloxycarbonyloxy, carboxylate, alkylcarbonyl, arylcarbonyl, alkoxycarbonyl, aminocarbonyl, alkylaminocarbonyl, dialkylaminocarbonyl, alkylthiocarbonyl, alkoxyl, phosphate, phosphonato, phosphinato, cyano, amino (including alkyl amino, dialkylamino, arylamino, diarylamino, and alkylarylamino), acylamino (including alkylcarbonylamino, arylcarbonylamino, carbamoyl and ureido), amidino, imino, sulffydryl, alkylthio, arylthio, thiocarboxylate, sulfates, alkylsulfmyl, sulfonato, sulfamoyl, sulfonamido, nitro, trifluoromethyl, cyano, azido, heterocyclyl, alkylaryl, or an aromatic or heteroaromatic moieties. Examples of halogen substituted alkoxy groups include, but are not limited to, fluoromethoxy, difluoromethoxy, trifluoromethoxy, choromethoxy, diflhoromethoxy, trichoromethoxy, etc.
The term "hydrophobic modifications' include bases modified in a fashion, where (1) overall hydrophobicity of the base is significantly increases, (2) the base is still capable of forming close to regular Watson -Crick interaction. Some, of the examples of base modifications include but are not limited to 5-position uridine and cytidine modifications like phenyl, 4-pyridyl, 2-pyridyl, indolyl, and isobutyl, phenyl (C6H5OH); tryptophanyl (C8H6N)CH2CH(NH2)CO), Isobutyl, butyl, aminobenzyl; phenyl; naphthyl, For purposes of the present invention, the term "overhang" refers to terminal non-base pairing nucleotide(s) resulting from one strand or region extending beyond the terminus of the complementary strand to which the first strand or region forms a duplex. One or more polynucleotides that are capable of forming a duplex through hydrogen bonding can have overhangs. The overhand length generally doesn't exceed 5 bases in length.
The term "heteroatom" includes atoms of any element other than carbon or hydrogen. Preferred heteroatoms are nitrogen, oxygen, sulfur and phosphorus.
The term "hydroxy" or "hydroxyl" includes groups with an -OH or -0 (with an appropriate counterion).
The term "halogen" includes fluorine, bromine, chlorine, iodine, etc. The term "perhalogenated" generally refers to a moiety wherein all hydrogens are replaced by halogen atoms.
The term "substituted" includes independently selected substituents which can be placed on the moiety and which allow the molecule to perform its intended function.
Examples of substituents include alkyl, alkenyl, alkynyl, aryl, (CR'R")o-3NR'R", (CR'R")0-3CN, NO2, halogen, (CR'R")0-3C(halogen)3, (CR'R")0-3CH(halogen)2, (CR'R")o-3CH2(halogen), (CR'R")0-3CONR'R", (CR'R")0-3S(0)1-2NR'R", (CR'R")0-3CHO, (CR'R")0-30(CR'R" )0-3H, (CR'R")0-3S(0)0-2R', (CR'R" )0-30(CR'R" )o-3H, (CR'R")0-3COR', (CR'R")0-3CO2R', or (CR'R")0-30R' groups; wherein each R' and R" are each independently hydrogen, a C1-C5 alkyl, C2-C5 alkenyl, C2-C5 alkynyl, or aryl group, or R' and R" taken together are a benzylidene group or a -(CH2)20(CH2)2- group.
The term "amine" or "amino" includes compounds or moieties in which a nitrogen atom is covalently bonded to at least one carbon or heteroatom. The term "alkyl amino" includes groups and compounds wherein the nitrogen is bound to at least one additional alkyl group. The term "dialkyl amino" includes groups wherein the nitrogen atom is bound to at least two additional alkyl groups.
The term "ether" includes compounds or moieties which contain an oxygen bonded to two different carbon atoms or heteroatoms. For example, the term includes "alkoxyalkyl," which refers to an alkyl, alkenyl, or alkynyl group covalently bonded to an oxygen atom which is covalently bonded to another alkyl group.
The term "base" includes the known purine and pyrimidine heterocyclic bases, deazapurines, and analogs (including heterocyclic substituted analogs, e.g., aminoethyoxy phenoxazine), derivatives (e.g., 1-alkyl-, 1-alkenyl-, heteroaromatic- and 1-alkynyl derivatives) and tautomers thereof. Examples of purines include adenine, guanine, inosine, diaminopurine, and xanthine and analogs (e.g., 8-oxo-N6-methyladenine or 7-diazaxanthine) and derivatives thereof. Pyrimidines include, for example, thymine, uracil, and cytosine, and their analogs (e.g., 5-methylcytosine, 5-methyluracil, 5-(1-propynyl)uracil, 5-(1-propynyl)cytosine and 4,4-ethanocytosine).
Other examples of suitable bases include non-purinyl and non-pyrimidinyl bases such as 2-aminopyridine and triazines.
In a preferred embodiment, the nucleomonomers of an oligonucleotide of the invention are RNA nucleotides. In another preferred embodiment, the nucleomonomers of an oligonucleotide of the invention are modified RNA nucleotides. Thus, the oligonucleotides contain modified RNA nucleotides.
The term "nucleoside" includes bases which are covalently attached to a sugar moiety, preferably ribose or deoxyribose. Examples of preferred nucleosides include ribonucleosides and deoxyribonucleosides. Nucleosides also include bases linked to amino acids or amino acid analogs which may comprise free carboxyl groups, free amino groups, or protecting groups. Suitable protecting groups are well known in the art (see P.
G. M. Wuts and T. W. Greene, "Protective Groups in Organic Synthesis", 2nd Ed., Wiley-Interscience, New York, 1999).
The term "nucleotide" includes nucleosides which further comprise a phosphate group or a phosphate analog.
As used herein, the term "linkage" includes a naturally occurring, unmodified phosphodiester moiety (-O-(PO 2-)-O-) that covalently couples adjacent nucleomonomers. As used herein, the term "substitute linkage" includes any analog or derivative of the native phosphodiester group that covalently couples adjacent nucleomonomers. Substitute linkages include phosphodiester analogs, e.g., phosphorothioate, phosphorodithioate, and P-ethyoxyphosphodiester, P-ethoxyphosphodiester, P-alkyloxyphosphotriester, methylphosphonate, and nonphosphorus containing linkages, e.g., acetals and amides. Such substitute linkages are known in the art (e.g., Bjergarde et al. 1991. Nucleic Acids Res. 19:5843;
Caruthers et al. 1991. Nucleosides Nucleotides. 10:47). In certain embodiments, non-hydrolizable linkages are preferred, such as phosphorothioate linkages.
In certain embodiments, oligonucleotides of the invention comprise hydrophobicly modified nucleotides or "hydrophobic modifications." As used herein "hydrophobic modifications" refers to bases that are modified such that (1) overall hydrophobicity of the base is significantly increased, and/or (2) the base is still capable of forming close to regular Watson -Crick interaction. Several non-limiting examples of base modifications include 5-position uridine and cytidine modifications such as phenyl, 4-pyridyl, 2-pyridyl, indolyl, and isobutyl, phenyl (C6H5OH); tryptophanyl (C8H6N)CH2CH(NH2)CO), Isobutyl, butyl, aminobenzyl; phenyl; and naphthyl.
In certain embodiments, oligonucleotides of the invention comprise 3' and 5' termini (except for circular oligonucleotides). In one embodiment, the 3' and 5' termini of an oligonucleotide can be substantially protected from nucleases e.g., by modifying the 3' or 5' linkages (e.g., U.S. Pat. No. 5,849,902 and WO 98/13526). For example, oligonucleotides can be made resistant by the inclusion of a "blocking group."
The term "blocking group" as used herein refers to substituents (e.g., other than OH
groups) that can be attached to oligonucleotides or nucleomonomers, either as protecting groups or coupling groups for synthesis (e.g., FITC, propyl (CH2-CH2-CH3), glycol (-O-0-) phosphate (P032-), hydrogen phosphonate, or phosphoramidite). "Blocking groups"
also include "end blocking groups" or "exonuclease blocking groups" which protect the 5' and 3' termini of the oligonucleotide, including modified nucleotides and non-nucleotide exonuclease resistant structures.
Exemplary end-blocking groups include cap structures (e.g., a 7-methylguanosine cap), inverted nucleomonomers, e.g., with 3'-3' or 5'-5' end inversions (see, e.g., Ortiagao et al. 1992. Antisense Res. Dev. 2:129), methylphosphonate, phosphoramidite, non-nucleotide groups (e.g., non-nucleotide linkers, amino linkers, conjugates) and the like. The 3' terminal nucleomonomer can comprise a modified sugar moiety. The 3' terminal nucleomonomer comprises a 3'-O that can optionally be substituted by a blocking group that prevents 3'-exonuclease degradation of the oligonucleotide. For example, the 3'-hydroxyl can be esterified to a nucleotide through a 3'-- 3' internucleotide linkage. For example, the alkyloxy radical can be methoxy, ethoxy, or isopropoxy, and preferably, ethoxy. Optionally, the 3'-+3'linked nucleotide at the 3' terminus can be linked by a substitute linkage. To reduce nuclease degradation, the 5' most Y-5' linkage can be a modified linkage, e.g., a phosphorothioate or a P-alkyloxyphosphotriester linkage. Preferably, the two 5' most 3'-*5' linkages are modified linkages. Optionally, the 5' terminal hydroxy moiety can be esterified with a phosphorus containing moiety, e.g., phosphate, phosphorothioate, or P-ethoxyphosphate.
Another type of conjugates that can be attached to the end (3' or 5' end), the loop region, or any other parts of the miniRNA might include a sterol, sterol type molecule, peptide, small molecule, protein, etc. In some embodiments, a miniRNA may contain more than one conjugates (same or different chemical nature). In some embodiments, the conjugate is cholesterol.
Another way to increase target gene specificity, or to reduce off-target silencing effect, is to introduce a 2'-modification (such as the 2'-O methyl modification) at a position corresponding to the second 5'-end nucleotide of the guide sequence.
This allows the positioning of this 2'-modification in the Dicer-resistant hairpin structure, thus enabling one to design better RNAi constructs with less or no off-target silencing.
In one embodiment, a hairpin polynucleotide of the invention can comprise one nucleic acid portion which is DNA and one nucleic acid portion which is RNA.
Antisense (guide) sequences of the invention can be "chimeric oligonucleotides" which comprise an RNA-like and a DNA-like region.
The language "RNase H activating region" includes a region of an oligonucleotide, e.g., a chimeric oligonucleotide, that is capable of recruiting RNase H to cleave the target RNA strand to which the oligonucleotide binds. Typically, the RNase activating region contains a minimal core (of at least about 3-5, typically between about 3-12, more typically, between about 5-12, and more preferably between about 5-contiguous nucleomonomers) of DNA or DNA-like nucleomonomers. (See, e.g., U.S.
Pat. No. 5,849,902). Preferably, the RNase H activating region comprises about nine contiguous deoxyribose containing nucleomonomers.
The language "non-activating region" includes a region of an antisense sequence, e.g., a chimeric oligonucleotide, that does not recruit or activate RNase H.
Preferably, a non-activating region does not comprise phosphorothioate DNA. The oligonucleotides of the invention comprise at least one non-activating region. In one embodiment, the non-activating region can be stabilized against nucleases or can provide specificity for the target by being complementary to the target and forming hydrogen bonds with the target nucleic acid molecule, which is to be bound by the oligonucleotide.
In one embodiment, at least a portion of the contiguous polynucleotides are linked by a substitute linkage, e.g., a phosphorothioate linkage.
In certain embodiments, most or all of the nucleotides beyond the guide sequence (2'-modified or not) are linked by phosphorothioate linkages. Such constructs tend to have improved pharmacokinetics due to their higher affinity for serum proteins. The phosphorothioate linkages in the non-guide sequence portion of the polynucleotide generally do not interfere with guide strand activity, once the latter is loaded into RISC.

Antisense (guide) sequences of the present invention may include "morpholino oligonucleotides." Morpholino oligonucleotides are non-ionic and function by an RNase H-independent mechanism. Each of the 4 genetic bases (Adenine, Cytosine, Guanine, and Thymine/Uracil) of the morpholino oligonucleotides is linked to a 6-membered morpholine ring. Morpholino oligonucleotides are made by joining the 4 different subunit types by, e.g., non-ionic phosphorodiamidate inter-subunit linkages.
Morpholino oligonucleotides have many advantages including: complete resistance to nucleases (Antisense & Nucl. Acid Drug Dev. 1996. 6:267); predictable targeting (Biochemica Biophysica Acta. 1999. 1489:141); reliable activity in cells (Antisense &
Nucl. Acid Drug Dev. 1997. 7:63); excellent sequence specificity (Antisense & Nucl. Acid Drug Dev. 1997. 7:15 1); minimal non-antisense activity (Biochemica Biophysica Acta. 1999.
1489:14 1); and simple osmotic or scrape delivery (Antisense & Nucl. Acid Drug Dev.
1997. 7:291). Morpholino oligonucleotides are also preferred because of their non-toxicity at high doses. A discussion of the preparation of morpholino oligonucleotides can be found in Antisense & Nucl. Acid Drug Dev. 1997. 7:187.
The chemical modifications described herein are believed, based on the data described herein, to promote single stranded polynucleotide loading into the RISC.
Single stranded polynucleotides have been shown to be active in loading into RISC and inducing gene silencing. However, the level of activity for single stranded polynucleotides appears to be 2 to 4 orders of magnitude lower when compared to a duplex polynucleotide.
The present invention provides a description of the chemical modification patterns, which may (a) significantly increase stability of the single stranded polynucleotide (b) promote efficient loading of the polynucleotide into the RISC
complex and (c) improve uptake of the single stranded nucleotide by the cell.
Figure 5 provides some non-limiting examples of the chemical modification patterns which may be beneficial for achieving single stranded polynucleotide efficacy inside the cell. The chemical modification patterns may include combination of ribose, backbone, hydrophobic nucleoside and conjugate type of modifications. In addition, in some of the 3o embodiments, the 5' end of the single polynucleotide may be chemically phosphorylated.
In yet another embodiment, the present invention provides a description of the chemical modifications patterns, which improve functionality of RISC
inhibiting polynucleotides. Single stranded polynucleotides have been shown to inhibit activity of a preloaded RISC complex through the substrate competition mechanism. For these types of molecules, conventionally called antagomers, the activity usually requires high concentration and in vivo delivery is not very effective. The present invention provides a description of the chemical modification patterns, which may (a) significantly increase stability of the single stranded polynucleotide (b) promote efficient recognition of the polynucleotide by the RISC as a substrate and/or (c) improve uptake of the single stranded nucleotide by the cell. Figure 6 provides some non-limiting examples of the chemical modification patterns that may be beneficial for achieving single stranded polynucleotide efficacy inside the cell. The chemical modification patterns may include combination of ribose, backbone, hydrophobic nucleoside and conjugate type of modifications.
The modifications provided by the present invention are applicable to all polynucleotides. This includes single stranded RISC entering polynucleotides, single stranded RISC inhibiting polynucleotides, conventional duplexed polynucleotides of variable length (15- 40 bp),asymmetric duplexed polynucleotides, and the like.
Polynucleotides may be modified with wide variety of chemical modification patterns, including 5' end, ribose, backbone and hydrophobic nucleoside modifications.
Synthesis Oligonucleotides of the invention can be synthesized by any method known in the art, e.g., using enzymatic synthesis and/or chemical synthesis. The oligonucleotides can be synthesized in vitro (e.g., using enzymatic synthesis and chemical synthesis) or in vivo (using recombinant DNA technology well known in the art).

In a preferred embodiment, chemical synthesis is used for modified polynucleotides. Chemical synthesis of linear oligonucleotides is well known in the art and can be achieved by solution or solid phase techniques. Preferably, synthesis is by solid phase methods. Oligonucleotides can be made by any of several different synthetic procedures including the phosphoramidite, phosphite triester, H-phosphonate, and phosphotriester methods, typically by automated synthesis methods.

Oligonucleotide synthesis protocols are well known in the art and can be found, e.g., in U.S. Pat. No. 5,830,653; WO 98/13526; Stec et al. 1984. J. Am. Chem.
Soc.
106:6077; Stec et al. 1985. J. Org. Chem. 50:3908; Stec et al. J. Chromatog.
1985.

326:263; LaPlanche et al. 1986. Nucl. Acid. Res. 1986. 14:9081; Fasman G. D., 1989.
Practical Handbook of Biochemistry and Molecular Biology. 1989. CRC Press, Boca Raton, Fla.; Lamone. 1993. Biochem. Soc. Trans. 21:1; U.S. Pat. No. 5,013,830;
U.S.
Pat. No. 5,214,135; U.S. Pat. No. 5,525,719; Kawasaki et al. 1993. J. Med.
Chem.
36:831; WO 92/03568; U.S. Pat. No. 5,276,019; and U.S. Pat. No. 5,264,423.
The synthesis method selected can depend on the length of the desired oligonucleotide and such choice is within the skill of the ordinary artisan.
For example, the phosphoramidite and phosphite triester method can produce oligonucleotides having 175 or more nucleotides, while the H-phosphonate method works well for oligonucleotides of less than 100 nucleotides. If modified bases are incorporated into the oligonucleotide, and particularly if modified phosphodiester linkages are used, then the synthetic procedures are altered as needed according to known procedures. In this regard, Uhlmann et al. (1990, Chemical Reviews 90:543-584) provide references and outline procedures for making oligonucleotides with modified bases and modified phosphodiester linkages. Other exemplary methods for making oligonucleotides are taught in Sonveaux. 1994. "Protecting Groups in Oligonucleotide Synthesis";
Agrawal.
Methods in Molecular Biology 26:1. Exemplary synthesis methods are also taught in "Oligonucleotide Synthesis - A Practical Approach" (Gait, M. J. IRL Press at Oxford University Press. 1984). Moreover, linear oligonucleotides of defined sequence, including some sequences with modified nucleotides, are readily available from several commercial sources.

The oligonucleotides may be purified by polyacrylamide gel electrophoresis, or by any of a number of chromatographic methods, including gel chromatography and high pressure liquid chromatography. To confirm a nucleotide sequence, especially unmodified nucleotide sequences, oligonucleotides may be subjected to DNA
sequencing by any of the known procedures, including Maxam and Gilbert sequencing, Sanger sequencing, capillary electrophoresis sequencing, the wandering spot sequencing procedure or by using selective chemical degradation of oligonucleotides bound to Hybond paper. Sequences of short oligonucleotides can also be analyzed by laser desorption mass spectroscopy or by fast atom bombardment (McNeal, et al., 1982, J.
Am. Chem. Soc. 104:976; Viari, et al., 1987, Biomed. Environ. Mass Spectrom.
14:83;
Grotjahn et al., 1982, Nuc. Acid Res. 10:4671). Sequencing methods are also available for RNA oligonucleotides.

The quality of oligonucleotides synthesized can be verified by testing the oligonucleotide by capillary electrophoresis and denaturing strong anion HPLC
(SAX-HPLC) using, e.g., the method of Bergot and Egan. 1992. J. Chrom. 599:35.

Other exemplary synthesis techniques are well known in the art (see, e.g., Sambrook et al., Molecular Cloning: a Laboratory Manual, Second Edition (1989); DNA
Cloning, Volumes I and II (DN Glover Ed. 1985); Oligonucleotide Synthesis (M J
Gait Ed, 1984; Nucleic Acid Hybridisation (B D Haines and S J Higgins eds. 1984); A
Practical Guide to Molecular Cloning (1984); or the series, Methods in Enzymology (Academic Press, Inc.)).

In certain embodiments, the subject RNAi constructs or at least portions thereof are transcribed from expression vectors encoding the subject constructs. Any art recognized vectors may be use for this purpose. The transcribed RNAi constructs may be isolated and purified, before desired modifications (such as replacing an unmodified sense strand with a modified one, etc.) are carried out.
Delivery/Carrier Uptake of Oligonucleotides by Cells Oligonucleotides and oligonucleotide compositions are contacted with (i.e., brought into contact with, also referred to herein as administered or delivered to) and taken up by one or more cells or a cell lysate. The term "cells" includes prokaryotic and eukaryotic cells, preferably vertebrate cells, and, more preferably, mammalian cells. In a preferred embodiment, the oligonucleotide compositions of the invention are contacted with human cells.

Oligonucleotide compositions of the invention can be contacted with cells in vitro, e.g., in a test tube or culture dish, (and may or may not be introduced into a subject) or in vivo, e.g., in a subject such as a mammalian subject.
Oligonucleotides are taken up by cells at a slow rate by endocytosis, but endocytosed oligonucleotides are generally sequestered and not available, e.g., for hybridization to a target nucleic acid molecule. In one embodiment, cellular uptake can be facilitated by electroporation or calcium phosphate precipitation. However, these procedures are only useful for in vitro or ex vivo embodiments, are not convenient and, in some cases, are associated with cell toxicity.

In another embodiment, delivery of oligonucleotides into cells can be enhanced by suitable art recognized methods including calcium phosphate, DMSO, glycerol or dextran, electroporation, or by transfection, e.g., using cationic, anionic, or neutral lipid compositions or liposomes using methods known in the art (see e.g., WO
90/14074; WO
91/16024; WO 91/17424; U.S. Pat. No. 4,897,355; Bergan et al. 1993. Nucleic Acids Research. 21:3567). Enhanced delivery of oligonucleotides can also be mediated by the use of vectors (See e.g., Shi, Y. 2003. Trends Genet 2003 Jan. 19:9; Reichhart J M et al.
Genesis. 2002. 34(1-2):1604, Yu et al. 2002. Proc. Natl. Acad Sci. USA
99:6047; Sui et al. 2002. Proc. Natl. Acad Sci. USA 99:5515) viruses, polyamine or polycation conjugates using compounds such as polylysine, protamine, or Ni, N12-bis (ethyl) spermine (see, e.g., Bartzatt, R. et al. 1989. Biotechnol. Appl. Biochem.
11:133; Wagner E. et al. 1992. Proc. Natl. Acad. Sci. 88:4255).

In certain embodiments, the miniRNA of the invention may be delivered by using various beta-glucan containing particles, such as those described in US
2005/0281781 Al, WO 2006/007372, and WO 2007/050643 (all incorporated herein by reference). In certain embodiments, the beta-glucan particle is derived from yeast. In certain embodiments, the payload trapping molecule is a polymer, such as those with a molecular weight of at least about 1000 Da, 10,000 Da, 50,000 Da, 100 kDa, 500 kDa, etc. Preferred polymers include (without limitation) cationic polymers, chitosans, or PEI
(polyethylenimine), etc.

Such beta-glucan based delivery system may be formulated for oral delivery, where the orally delivered beta-glucan / miniRNA constructs may be engulfed by macrophages or other related phagocytic cells, which may in turn release the miniRNA
constructs in selected in vivo sites. Alternatively or in addition, the miniRNA may changes the expression of certain macrophage target genes.

The optimal protocol for uptake of oligonucleotides will depend upon a number of factors, the most crucial being the type of cells that are being used.
Other factors that are important in uptake include, but are not limited to, the nature and concentration of the oligonucleotide, the confluence of the cells, the type of culture the cells are in (e.g., a suspension culture or plated) and the type of media in which the cells are grown.

Encapsulating Agents Encapsulating agents entrap oligonucleotides within vesicles. In another embodiment of the invention, an oligonucleotide may be associated with a carrier or vehicle, e.g., liposomes or micelles, although other carriers could be used, as would be appreciated by one skilled in the art. Liposomes are vesicles made of a lipid bilayer having a structure similar to biological membranes. Such carriers are used to facilitate the cellular uptake or targeting of the oligonucleotide, or improve the oligonucleotides pharmacokinetic or toxicological properties.

For example, the oligonucleotides of the present invention may also be administered encapsulated in liposomes, pharmaceutical compositions wherein the active ingredient is contained either dispersed or variously present in corpuscles consisting of aqueous concentric layers adherent to lipidic layers. The oligonucleotides, depending upon solubility, may be present both in the aqueous layer and in the lipidic layer, or in what is generally termed a liposomic suspension. The hydrophobic layer, generally but not exclusively, comprises phopholipids such as lecithin and sphingomyelin, steroids such as cholesterol, more or less ionic surfactants such as diacetylphosphate, stearylamine, or phosphatidic acid, or other materials of a hydrophobic nature. The diameters of the liposomes generally range from about 15 nm to about 5 microns.

The use of liposomes as drug delivery vehicles offers several advantages.
Liposomes increase intracellular stability, increase uptake efficiency and improve biological activity. Liposomes are hollow spherical vesicles composed of lipids arranged in a similar fashion as those lipids which make up the cell membrane. They have an internal aqueous space for entrapping water soluble compounds and range in size from 0.05 to several microns in diameter. Several studies have shown that liposomes can deliver nucleic acids to cells and that the nucleic acids remain biologically active. For example, a lipid delivery vehicle originally designed as a research tool, such as Lipofectin or LIPOFECTAMINETM 2000, can deliver intact nucleic acid molecules to cells.

Specific advantages of using liposomes include the following: they are non-toxic and biodegradable in composition; they display long circulation half-lives;
and recognition molecules can be readily attached to their surface for targeting to tissues.
Finally, cost-effective manufacture of liposome-based pharmaceuticals, either in a liquid suspension or lyophilized product, has demonstrated the viability of this technology as an acceptable drug delivery system.

In some aspects, formulations associated with the invention might be selected for a class of naturally occurring or chemically synthesized or modified saturated and unsaturated fatty acid residues. Fatty acids might exist in a form of triglycerides, diglycerides or individual fatty acids. In another embodiment, the use of well-validated mixtures of fatty acids and/or fat emulsions currently used in pharmacology for parenteral nutrition may be utilized.

Liposome based formulations are widely used for oligonucleotide delivery.
However, most of commercially available lipid or liposome formulations contain at least one positively charged lipid (cationic lipids). The presence of this positively charged lipid is believed to be essential for obtaining a high degree of oligonucleotide loading and for enhancing liposome fusogenic properties. Several methods have been performed and published to identify optimal positively charged lipid chemistries.
However, the commercially available liposome formulations containing cationic lipids are characterized by a high level of toxicity. In vivo limited therapeutic indexes have revealed that liposome formulations containing positive charged lipids are associated with toxicity (i.e. elevation in liver enzymes) at concentrations only slightly higher than concentration required to achieve RNA silencing.
New liposome formulations, lacking the toxicity of the prior art liposomes have been developed according to the invention. These new liposome formulations are neutral fat-based formulations for the efficient delivery of oligonucleotides, and in particular for the delivery of the RNA molecules of the invention. The compositions are referred to as neutral nanotransporters because they enable quantitative oligonucleotide incorporation into non-charged lipids mixtures. The lack of toxic levels of cationic lipids in the neutral nanotransporter compositions of the invention is an important feature.
The neutral nanotransporters compositions enable efficient loading of oligonucleotide into neutral fat formulation. The composition includes an oligonucleotide that is modified in a manner such that the hydrophobicity of the molecule is increased (for example a hydrophobic molecule is attached (covalently or no-covalently) to a hydrophobic molecule on the oligonucleotide terminus or a non-terminal nucleotide, base, sugar, or backbone), the modified oligonucleotide being mixed with a neutral fat formulation (for example containing at least 25 % of cholesterol and 25% of DOPC or analogs thereof). A cargo molecule, such as another lipid can also be included in the composition. This composition, where part of the formulation is build into the oligonucleotide itself, enables efficient encapsulation of oligonucleotide in neutral lipid particles.
One of several unexpected observations associated with the invention was that the oligonucleotides of the invention could effectively be incorporated in a lipid mixture that was free of cationic lipids and that such a composition could effectively deliver the therapeutic oligonucleotide to a cell in a manner that it is functional.
Another unexpected observation was the high level of activity observed when the fatty mixture is composed of a phosphatidylcholine base fatty acid and a sterol such as a cholesterol. For instance, one preferred formulation of neutral fatty mixture is composed of at least 20%
of DOPC or DSPC and at least 20% of sterol such as cholesterol. Even as low as 1:5 lipid to oligonucleotide ratio was shown to be sufficient to get complete encapsulation of the oligonucleotide in a non charged formulation. The prior art demonstrated only a 1-5% oligonucleotide encapsulation with non-charged formulations, which is not sufficient to get to a desired amount of in vivo efficacy. Compared to the prior art using neutral lipids the level of oligonucleotide delivery to a cell was quite unexpected.
Stable particles ranging in size from 50 to 140 nm were formed upon complexing of hydrophobic oligonucleotides with preferred formulations. It is interesting to mention that the formulation by itself typically does not form small particles, but rather, forms agglomerates, which are transformed into stable 50-120 nm particles upon addition of the hydrophobic modified oligonucleotide.
The neutral nanotransporter compositions of the invention include a hydrophobic modified polynucleotide, a neutral fatty mixture, and optionally a cargo molecule. A
"hydrophobic modified polynucleotide" as used herein is a polynucleotide of the invention(i.e. sd-rxRNA) that has at least one modification that renders the polynucleotide more hydrophobic than the polynucleotide was prior to modification.
The modification may be achieved by attaching (covalently or non-covalently) a hydrophobic molecule to the polynucleotide. In some instances the hydrophobic molecule is or includes a lipophilic group.
The term "lipophilic group" means a group that has a higher affinity for lipids than its affinity for water. Examples of lipophilic groups include, but are not limited to, cholesterol, a cholesteryl or modified cholesteryl residue, adamantine, dihydrotesterone, long chain alkyl, long chain alkenyl, long chain alkynyl, olely-lithocholic, cholenic, oleoyl-cholenic, palmityl, heptadecyl, myrisityl, bile acids, cholic acid or taurocholic acid, deoxycholate, oleyl litocholic acid, oleoyl cholenic acid, glycolipids, phospholipids, sphingolipids, isoprenoids, such as steroids, vitamins, such as vitamin E, fatty acids either saturated or unsaturated, fatty acid esters, such as triglycerides, pyrenes, porphyrines, Texaphyrine, adamantane, acridines, biotin, coumarin, fluorescein, rhodamine, Texas-Red, digoxygenin, dimethoxytrityl, t-butyldimethylsilyl, t-butyldiphenylsilyl, cyanine dyes (e.g. Cy3 or Cy5), Hoechst 33258 dye, psoralen, or ibuprofen. The cholesterol moiety may be reduced (e.g. as in cholestan) or may be substituted (e.g. by halogen). A combination of different lipophilic groups in one molecule is also possible.
The hydrophobic molecule may be attached at various positions of the polynucleotide. As described above, the hydrophobic molecule may be linked to the terminal residue of the polynucleotide such as the 3' of 5'-end of the polynucleotide.
Alternatively, it may be linked to an internal nucleotide or a nucleotide on a branch of the polynucleotide. The hydrophobic molecule may be attached, for instance to a 2'-position of the nucleotide. The hydrophobic molecule may also be linked to the heterocyclic base, the sugar or the backbone of a nucleotide of the polynucleotide.
The hydrophobic molecule may be connected to the polynucleotide by a linker moiety. Optionally the linker moiety is a non-nucleotidic linker moiety. Non-nucleotidic linkers are e.g. abasic residues (dSpacer), oligoethyleneglycol, such as triethyleneglycol (spacer 9) or hexaethylenegylcol (spacer 18), or alkane-diol, such as butanediol. The spacer units are preferably linked by phosphodiester or phosphorothioate bonds. The linker units may appear just once in the molecule or may be incorporated several times, e.g. via phosphodiester, phosphorothioate, methylphosphonate, or amide linkages.
Typical conjugation protocols involve the synthesis of polynucleotides bearing an aminolinker at one or more positions of the sequence, however, a linker is not required.
The amino group is then reacted with the molecule being conjugated using appropriate coupling or activating reagents. The conjugation reaction may be performed either with the polynucleotide still bound to a solid support or following cleavage of the polynucleotide in solution phase. Purification of the modified polynucleotide by HPLC
typically results in a pure material.

In some embodiments the hydrophobic molecule is a sterol type conjugate, a PhytoSterol conjugate, cholesterol conjugate, sterol type conjugate with altered side chain length, fatty acid conjugate, any other hydrophobic group conjugate, and/or hydrophobic modifications of the internal nucleoside, which provide sufficient hydrophobicity to be incorporated into micelles.
For purposes of the present invention, the term "sterols", refers or steroid alcohols are a subgroup of steroids with a hydroxyl group at the 3-position of the A-ring.
They are amphipathic lipids synthesized from acetyl-coenzyme A via the HMG-CoA
reductase pathway. The overall molecule is quite flat. The hydroxyl group on the A ring is polar. The rest of the aliphatic chain is non-polar. Usually sterols are considered to have an 8 carbon chain at position 17.
For purposes of the present invention, the term "sterol type molecules", refers to steroid alcohols, which are similar in structure to sterols. The main difference is the structure of the ring and number of carbons in a position 21 attached side chain.
For purposes of the present invention, the term "PhytoSterols" (also called plant sterols) are a group of steroid alcohols, phytochemicals naturally occurring in plants.
There are more then 200 different known PhytoSterols For purposes of the present invention, the term "Sterol side chain" refers to a chemical composition of a side chain attached at the position 17 of sterol-type molecule.
In a standard definition sterols are limited to a 4 ring structure carrying a 8 carbon chain at position 17. In this invention, the sterol type molecules with side chain longer and shorter than conventional are described. The side chain may branched or contain double back bones.
Thus, sterols useful in the invention, for example, include cholesterols, as well as unique sterols in which position 17 has attached side chain of 2-7 or longer then 9 carbons. In a particular embodiment, the length of the polycarbon tail is varied between 5 and 9 carbons. Figure 9 demonstrates that there is a correlation between plasma clearance, liver uptake and the length of the polycarbon chain. Such conjugates may have significantly better in vivo efficacy, in particular delivery to liver.
These types of molecules are expected to work at concentrations 5 to 9 fold lower then oligonucleotides conjugated to conventional cholesterols.
Alternatively the polynucleotide may be bound to a protein, peptide or positively charged chemical that functions as the hydrophobic molecule. The proteins may be selected from the group consisting of protamine, dsRNA binding domain, and arginine rich peptides. Exemplary positively charged chemicals include spermine, spermidine, cadaverine, and putrescine.
In another embodiment hydrophobic molecule conjugates may demonstrate even higher efficacy when it is combined with optimal chemical modification patterns of the polynucleotide (as described herein in detail), containing but not limited to hydrophobic modifications, phosphorothioate modifications, and 2' ribo modifications.
In another embodiment the sterol type molecule may be a naturally occurring PhytoSterols such as those shown in Figure 8. The polycarbon chain may be longer than 9 and may be linear, branched and/or contain double bonds. Some PhytoSterol containing polynucleotide conjugates may be significantly more potent and active in delivery of polynucleotides to various tissues. Some PhytoSterols may demonstrate tissue preference and thus be used as a way to delivery RNAi specifically to particular tissues.
The hydrophobic modified polynucleotide is mixed with a neutral fatty mixture to form a micelle. The neutral fatty acid mixture is a mixture of fats that has a net neutral or slightly net negative charge at or around physiological pH that can form a micelle with the hydrophobic modified polynucleotide. For purposes of the present invention, the term "micelle" refers to a small nanoparticle formed by a mixture of non charged fatty acids and phospholipids. The neutral fatty mixture may include cationic lipids as long as they are present in an amount that does not cause toxicity. In preferred embodiments the neutral fatty mixture is free of cationic lipids. A mixture that is free of cationic lipids is one that has less than 1% and preferably 0% of the total lipid being cationic lipid. The term "cationic lipid" includes lipids and synthetic lipids having a net positive charge at or around physiological pH. The term "anionic lipid" includes lipids and synthetic lipids having a net negative charge at or around physiological pH.

The neutral fats bind to the oligonucleotides of the invention by a strong but non-covalent attraction (e.g., an electrostatic, van der Waals, pi-stacking, etc.
interaction).
The neutral fat mixture may include formulations selected from a class of naturally occurring or chemically synthesized or modified saturated and unsaturated fatty acid residues. Fatty acids might exist in a form of triglycerides, diglycerides or individual fatty acids. In another embodiment the use of well-validated mixtures of fatty acids and/or fat emulsions currently used in pharmacology for parenteral nutrition may be utilized.

The neutral fatty mixture is preferably a mixture of a choline based fatty acid and a sterol. Choline based fatty acids include for instance, synthetic phosphocholine derivatives such as DDPC, DLPC, DMPC, DPPC, DSPC, DOPC, POPC, and DEPC.
DOPC (chemical registry number 4235-95-4) is dioleoylphosphatidylcholine (also known as dielaidoylphosphatidylcholine, dioleoyl-PC, dioleoylphosphocholine, dioleoyl-sn-glycero-3 -phosphocho line, dioleylphosphatidylcholine). DSPC (chemical registry number 816-94-4) is dietearoylphosphatidylcholine (also known as 1,2-Distearoyl-sn-Glycero-3-phosphocholine).
The sterol in the neutral fatty mixture may be for instance cholesterol. The neutral fatty mixture may be made up completely of a choline based fatty acid and a sterol or it may optionally include a cargo molecule. For instance, the neutral fatty mixture may have at least 20% or 25% fatty acid and 20% or 25% sterol.
For purposes of the present invention, the term "Fatty acids" relates to conventional description of fatty acid. They may exist as individual entities or in a form of two-and triglycerides. For purposes of the present invention, the term "fat emulsions"
refers to safe fat formulations given intravenously to subjects who are unable to get enough fat in their diet. It is an emulsion of soy bean oil (or other naturally occurring oils) and egg phospholipids. Fat emulsions are being used for formulation of some insoluble anesthetics. In this disclosure, fat emulsions might be part of commercially available preparations like Intralipid, Liposyn, Nutrilipid, modified commercial preparations, where they are enriched with particular fatty acids or fully de novo-formulated combinations of fatty acids and phospholipids.

In one embodiment, the cells to be contacted with an oligonucleotide composition of the invention are contacted with a mixture comprising the oligonucleotide and a mixture comprising a lipid, e.g., one of the lipids or lipid compositions described supra for between about 12 hours to about 24 hours. In another embodiment, the cells to be contacted with an oligonucleotide composition are contacted with a mixture comprising the oligonucleotide and a mixture comprising a lipid, e.g., one of the lipids or lipid compositions described supra for between about 1 and about five days. In one embodiment, the cells are contacted with a mixture comprising a lipid and the oligonucleotide for between about three days to as long as about 30 days. In another embodiment, a mixture comprising a lipid is left in contact with the cells for at least about five to about 20 days. In another embodiment, a mixture comprising a lipid is left in contact with the cells for at least about seven to about 15 days.

50%-60% of the formulation can optionally be any other lipid or molecule. Such a lipid or molecule is referred to herein as a cargo lipid or cargo molecule.
Cargo molecules include but are not limited to intralipid, small molecules, fusogenic peptides or lipids or other small molecules might be added to alter cellular uptake, endosomal release or tissue distribution properties. The ability to tolerate cargo molecules is important for modulation of properties of these particles, if such properties are desirable.
For instance the presence of some tissue specific metabolites might drastically alter tissue distribution profiles. For example use of Intralipid type formulation enriched in shorter or longer fatty chains with various degrees of saturation affects tissue distribution profiles of these type of formulations (and their loads).
An example of a cargo lipid useful according to the invention is a fusogenic lipid.
For instance, the zwiterionic lipid DOPE (chemical registry number 4004-5-1, 1,2-Dioleoyl-sn-Glycero-3-phosphoethanolamine) is a preferred cargo lipid.
Intralipid may be comprised of the following composition: 1 000 mL contain:
purified soybean oil 90 g, purified egg phospholipids 12 g, glycerol anhydrous 22 g, water for injection q.s. ad 1 000 mL. pH is adjusted with sodium hydroxide to pH
approximately 8. Energy content/L: 4.6 MJ (190 kcal). Osmolality (approx.):

mOsm/kg water. In another embodiment fat emulsion is Liposyn that contains 5%
safflower oil, 5% soybean oil, up to 1.2% egg phosphatides added as an emulsifier and 2.5% glycerin in water for injection. It may also contain sodium hydroxide for pH
adjustment. pH 8.0 (6.0 - 9.0). Liposyn has an osmolarity of 276 in Osmol/liter (actual).
Variation in the identity, amounts and ratios of cargo lipids affects the cellular uptake and tissue distribution characteristics of these compounds. For example, the length of lipid tails and level of saturability will affect differential uptake to liver, lung, fat and cardiomyocytes. Addition of special hydrophobic molecules like vitamins or different forms of sterols can favor distribution to special tissues which are involved in the metabolism of particular compounds. Complexes are formed at different oligonucleotide concentrations, with higher concentrations favoring more efficient complex formation (Figs. 21-22).

In another embodiment, the fat emulsion is based on a mixture of lipids. Such lipids may include natural compounds, chemically synthesized compounds, purified fatty acids or any other lipids. In yet another embodiment the composition of fat emulsion is entirely artificial. In a particular embodiment, the fat emulsion is more then 70% linoleic acid. In yet another particular embodiment the fat emulsion is at least 1% of cardiolipin.
Linoleic acid (LA) is an unsaturated omega-6 fatty acid. It is a colorless liquid made of a carboxylic acid with an 18-carbon chain and two cis double bonds.
In yet another embodiment of the present invention, the alteration of the composition of the fat emulsion is used as a way to alter tissue distribution of hydrophobicly modified polynucleotides. This methodology provides for the specific delivery of the polynucleotides to particular tissues (Figure 12).
In another embodiment the fat emulsions of the cargo molecule contain more then 70% of Linoleic acid (C 18H3202) and/or cardiolipin are used for specifically delivering RNAi to heart muscle.
Fat emulsions, like intralipid have been used before as a delivery formulation for some non-water soluble drugs (such as Propofol, re-formulated as Diprivan).
Unique features of the present invention include (a) the concept of combining modified polynucleotides with the hydrophobic compound(s), so it can be incorporated in the fat micelles and (b) mixing it with the fat emulsions to provide a reversible carrier. After injection into a blood stream, micelles usually bind to serum proteins, including albumin, HDL, LDL and other. This binding is reversible and eventually the fat is absorbed by cells. The polynucleotide, incorporated as a part of the micelle will then be delivered closely to the surface of the cells. After that cellular uptake might be happening though variable mechanisms, including but not limited to sterol type delivery.

Complexing Agents Complexing agents bind to the oligonucleotides of the invention by a strong but non-covalent attraction (e.g., an electrostatic, van der Waals, pi-stacking, etc.
interaction). In one embodiment, oligonucleotides of the invention can be complexed with a complexing agent to increase cellular uptake of oligonucleotides. An example of a complexing agent includes cationic lipids. Cationic lipids can be used to deliver oligonucleotides to cells. However, as discussed above, formulations free in cationic lipids are preferred in some embodiments.

The term "cationic lipid" includes lipids and synthetic lipids having both polar and non-polar domains and which are capable of being positively charged at or around physiological pH and which bind to polyanions, such as nucleic acids, and facilitate the delivery of nucleic acids into cells. In general cationic lipids include saturated and unsaturated alkyl and alicyclic ethers and esters of amines, amides, or derivatives thereof. Straight-chain and branched alkyl and alkenyl groups of cationic lipids can contain, e.g., from 1 to about 25 carbon atoms. Preferred straight chain or branched alkyl or alkene groups have six or more carbon atoms. Alicyclic groups include cholesterol and other steroid groups. Cationic lipids can be prepared with a variety of counterions (anions) including, e.g., Cl-, Br, I-, F-, acetate, trifluoroacetate, sulfate, nitrite, and nitrate.

Examples of cationic lipids include polyethylenimine, polyamidoamine (PAMAM) starburst dendrimers, Lipofectin (a combination of DOTMA and DOPE), Lipofectase, LIPOFECTAMINETM (e.g., LIPOFECTAMINETM 2000), DOPE, Cytofectin (Gilead Sciences, Foster City, Calif.), and Eufectins (JBL, San Luis Obispo, Calif.). Exemplary cationic liposomes can be made from N-[l-(2,3-dioleoloxy)-propyl]-N,N,N-trimethylammonium chloride (DOTMA), N-[1 -(2,3-dioleoloxy)-propyl]-N,N,N-trimethylammonium methylsulfate (DOTAP), 3[3-[N-(N',N'-dimethylaminoethane)carbamoyl]cholesterol (DC-Chol), 2,3,-dioleyloxy-N-[2(sperminecarboxamido)ethyl]-N,N-dimethyl- l -propanaminium trifluoroacetate (DOSPA), 1,2-dimyristyloxypropyl-3-dimethyl-hydroxyethyl ammonium bromide; and dimethyldioctadecylammonium bromide (DDAB). The cationic lipid N-(1-(2,3-dioleyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTMA), for example, was found to increase 1000-fold the antisense effect of a phosphorothioate oligonucleotide.
(Vlassov et al., 1994, Biochimica et Biophysica Acta 1197:95-108).
Oligonucleotides can also be complexed with, e.g., poly (L-lysine) or avidin and lipids may, or may not, be included in this mixture, e.g., steryl-poly (L-lysine).

Cationic lipids have been used in the art to deliver oligonucleotides to cells (see, e.g., U.S. Pat. Nos. 5,855,910; 5,851,548; 5,830,430; 5,780,053; 5,767,099;
Lewis et al.
1996. Proc. Natl. Acad. Sci. USA 93:3176; Hope et al. 1998. Molecular Membrane Biology 15:1). Other lipid compositions which can be used to facilitate uptake of the instant oligonucleotides can be used in connection with the claimed methods.
In addition to those listed supra, other lipid compositions are also known in the art and include, e.g., those taught in U.S. Pat. No. 4,235,871; U.S. Pat. Nos. 4,501,728; 4,837,028;
4,737,323.

In one embodiment lipid compositions can further comprise agents, e.g., viral proteins to enhance lipid-mediated transfections of oligonucleotides (Kamata, et al., 1994. Nucl. Acids. Res. 22:536). In another embodiment, oligonucleotides are contacted with cells as part of a composition comprising an oligonucleotide, a peptide, and a lipid as taught, e.g., in U.S. patent 5,736,392. Improved lipids have also been described which are serum resistant (Lewis, et al., 1996. Proc. Natl. Acad. Sci. 93:3176).
Cationic lipids and other complexing agents act to increase the number of oligonucleotides carried into the cell through endocytosis.

In another embodiment N-substituted glycine oligonucleotides (peptoids) can be used to optimize uptake of oligonucleotides. Peptoids have been used to create cationic lipid-like compounds for transfection (Murphy, et al., 1998. Proc. Natl. Acad.
Sci.
95:1517). Peptoids can be synthesized using standard methods (e.g., Zuckermann, R. N., et al. 1992. J Am. Chem. Soc. 114:10646; Zuckermann, R. N., et al. 1992. Int.
J. Peptide Protein Res. 40:497). Combinations of cationic lipids and peptoids, liptoids, can also be used to optimize uptake of the subject oligonucleotides (Hunag, et al., 1998.
Chemistry and Biology. 5:345). Liptoids can be synthesized by elaborating peptoid oligonucleotides and coupling the amino terminal submonomer to a lipid via its amino group (Hunag, et al., 1998. Chemistry and Biology. 5:345).

It is known in the art that positively charged amino acids can be used for creating highly active cationic lipids (Lewis et al. 1996. Proc. Natl. Acad. Sci. USA.
93:3176). In one embodiment, a composition for delivering oligonucleotides of the invention comprises a number of arginine, lysine, histidine or ornithine residues linked to a lipophilic moiety (see e.g., U.S. Pat. No. 5,777,153).

In another embodiment, a composition for delivering oligonucleotides of the invention comprises a peptide having from between about one to about four basic residues. These basic residues can be located, e.g., on the amino terminal, C-terminal, or internal region of the peptide. Families of amino acid residues having similar side chains 3o have been defined in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine (can also be considered non-polar), asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). Apart from the basic amino acids, a majority or all of the other residues of the peptide can be selected from the non-basic amino acids, e.g., amino acids other than lysine, arginine, or histidine.
Preferably a preponderance of neutral amino acids with long neutral side chains are used.

In one embodiment, a composition for delivering oligonucleotides of the invention comprises a natural or synthetic polypeptide having one or more gamma carboxyglutamic acid residues, or y-Gla residues. These gamma carboxyglutamic acid residues may enable the polypeptide to bind to each other and to membrane surfaces. In other words, a polypeptide having a series of y-Gla may be used as a general delivery modality that helps an RNAi construct to stick to whatever membrane to which it comes in contact. This may at least slow RNAi constructs from being cleared from the blood stream and enhance their chance of homing to the target.

The gamma carboxyglutamic acid residues may exist in natural proteins (for example, prothrombin has 10 y-Gla residues). Alternatively, they can be introduced into the purified, recombinantly produced, or chemically synthesized polypeptides by carboxylation using, for example, a vitamin K-dependent carboxylase. The gamma carboxyglutamic acid residues may be consecutive or non-consecutive, and the total number and location of such gamma carboxyglutamic acid residues in the polypeptide can be regulated / fine tuned to achieve different levels of "stickiness" of the polypeptide.

In one embodiment, the cells to be contacted with an oligonucleotide composition of the invention are contacted with a mixture comprising the oligonucleotide and a mixture comprising a lipid, e.g., one of the lipids or lipid compositions described supra for between about 12 hours to about 24 hours. In another embodiment, the cells to be contacted with an oligonucleotide composition are contacted with a mixture comprising the oligonucleotide and a mixture comprising a lipid, e.g., one of the lipids or lipid compositions described supra for between about 1 and about five days. In one embodiment, the cells are contacted with a mixture comprising a lipid and the oligonucleotide for between about three days to as long as about 30 days. In another embodiment, a mixture comprising a lipid is left in contact with the cells for at least about five to about 20 days. In another embodiment, a mixture comprising a lipid is left in contact with the cells for at least about seven to about 15 days.

For example, in one embodiment, an oligonucleotide composition can be contacted with cells in the presence of a lipid such as cytofectin CS or GSV
(available from Glen Research; Sterling, Va.), GS3815, GS2888 for prolonged incubation periods as described herein.

In one embodiment, the incubation of the cells with the mixture comprising a lipid and an oligonucleotide composition does not reduce the viability of the cells.
Preferably, after the transfection period the cells are substantially viable.
In one embodiment, after transfection, the cells are between at least about 70% and at least about 100% viable. In another embodiment, the cells are between at least about 80% and at least about 95% viable. In yet another embodiment, the cells are between at least about 85% and at least about 90% viable.

In one embodiment, oligonucleotides are modified by attaching a peptide sequence that transports the oligonucleotide into a cell, referred to herein as a "transporting peptide." In one embodiment, the composition includes an oligonucleotide which is complementary to a target nucleic acid molecule encoding the protein, and a covalently attached transporting peptide.

The language "transporting peptide" includes an amino acid sequence that facilitates the transport of an oligonucleotide into a cell. Exemplary peptides which facilitate the transport of the moieties to which they are linked into cells are known in the art, and include, e.g., HIV TAT transcription factor, lactoferrin, Herpes VP22 protein, and fibroblast growth factor 2 (Pooga et al. 1998. Nature Biotechnology.
16:857; and Derossi et al. 1998. Trends in Cell Biology. 8:84; Elliott and O'Hare. 1997.
Cell 88:223).

Oligonucleotides can be attached to the transporting peptide using known techniques, e.g., (Prochiantz, A. 1996. Curr. Opin. Neurobiol. 6:629; Derossi et al.
1998. Trends Cell Biol. 8:84; Troy et al. 1996. J. Neurosci. 16:253), Vives et al. 1997. J.
Biol. Chem. 272:16010). For example, in one embodiment, oligonucleotides bearing an activated thiol group are linked via that thiol group to a cysteine present in a transport peptide (e.g., to the cysteine present in the 0 turn between the second and the third helix of the antennapedia homeodomain as taught, e.g., in Derossi et al. 1998.
Trends Cell Biol. 8:84; Prochiantz. 1996. Current Opinion in Neurobiol. 6:629; Allinquant et al.
1995. J Cell Biol. 128:919). In another embodiment, a Boc-Cys-(Npys)OH group can be coupled to the transport peptide as the last (N-terminal) amino acid and an oligonucleotide bearing an SH group can be coupled to the peptide (Troy et al.
1996. J.
Neurosci. 16:253).

In one embodiment, a linking group can be attached to a nucleomonomer and the transporting peptide can be covalently attached to the linker. In one embodiment, a linker can function as both an attachment site for a transporting peptide and can provide stability against nucleases. Examples of suitable linkers include substituted or unsubstituted CI-C20 alkyl chains, C2-C20 alkenyl chains, C2-C20 alkynyl chains, peptides, and heteroatoms (e.g., S, 0, NH, etc.). Other exemplary linkers include bifunctional crosslinking agents such as sulfosuccinimidyl-4-(maleimidophenyl)-butyrate (SMPB) (see, e.g., Smith et al. Biochem J 1991.276: 417-2).

In one embodiment, oligonucleotides of the invention are synthesized as molecular conjugates which utilize receptor-mediated endocytotic mechanisms for delivering genes into cells (see, e.g., Bunnell et al. 1992. Somatic Cell and Molecular Genetics. 18:559, and the references cited therein).

Targeting Agents The delivery of oligonucleotides can also be improved by targeting the oligonucleotides to a cellular receptor. The targeting moieties can be conjugated to the oligonucleotides or attached to a carrier group (i.e., poly(L-lysine) or liposomes) linked to the oligonucleotides. This method is well suited to cells that display specific receptor-mediated endocytosis.

For instance, oligonucleotide conjugates to 6-phosphomannosylated proteins are internalized 20-fold more efficiently by cells expressing mannose 6-phosphate specific receptors than free oligonucleotides. The oligonucleotides may also be coupled to a ligand for a cellular receptor using a biodegradable linker. In another example, the delivery construct is mannosylated streptavidin which forms a tight complex with biotinylated oligonucleotides. Mannosylated streptavidin was found to increase 20-fold the internalization of biotinylated oligonucleotides. (Vlassov et al. 1994.
Biochimica et BiophysicaActa 1197:95-108).

In addition specific ligands can be conjugated to the polylysine component of polylysine-based delivery systems. For example, transferrin-polylysine, adenovirus-polylysine, and influenza virus hemagglutinin HA-2 N-terminal fusogenic peptides-polylysine conjugates greatly enhance receptor-mediated DNA delivery in eucaryotic cells. Mannosylated glycoprotein conjugated to poly(L-lysine) in aveolar macrophages has been employed to enhance the cellular uptake of oligonucleotides. Liang et al. 1999.
Pharmazie 54:559-566.

Because malignant cells have an increased need for essential nutrients such as folic acid and transferrin, these nutrients can be used to target oligonucleotides to cancerous cells. For example, when folic acid is linked to poly(L-lysine) enhanced oligonucleotide uptake is seen in promyelocytic leukaemia (HL-60) cells and human melanoma (M-14) cells. Ginobbi et al. 1997. Anticancer Res. 17:29. In another example, liposomes coated with maleylated bovine serum albumin, folic acid, or ferric protoporphyrin IX, show enhanced cellular uptake of oligonucleotides in murine macrophages, KB cells, and 2.2.15 human hepatoma cells. Liang et al. 1999.
Pharmazie 54:559-566.

Liposomes naturally accumulate in the liver, spleen, and reticuloendothelial system (so-called, passive targeting). By coupling liposomes to various ligands such as antibodies are protein A, they can be actively targeted to specific cell populations. For example, protein A-bearing liposomes may be pretreated with H-2K specific antibodies which are targeted to the mouse major histocompatibility complex-encoded H-2K
protein expressed on L cells. (Vlassov et al. 1994. Biochimica et Biophysica Acta 1197:95-108).

Other in vitro and/or in vivo delivery of RNAi reagents are known in the art, and can be used to deliver the subject RNAi constructs. See, for example, U.S.
patent application publications 20080152661, 20080112916, 20080107694, 20080038296, 20070231392,20060240093,20060178327,20060008910,20050265957,20050064595, 20050042227,20050037496,20050026286,20040162235,20040072785,20040063654, 20030157030, WO 2008/036825, W004/065601, and AU2004206255B2, just to name a few (all incorporated by reference).

Administration The optimal course of administration or delivery of the oligonucleotides may vary depending upon the desired result and/or on the subject to be treated. As used herein "administration" refers to contacting cells with oligonucleotides and can be performed in vitro or in vivo. The dosage of oligonucleotides may be adjusted to optimally reduce expression of a protein translated from a target nucleic acid molecule, e.g., as measured by a readout of RNA stability or by a therapeutic response, without undue experimentation.

For example, expression of the protein encoded by the nucleic acid target can be measured to determine whether or not the dosage regimen needs to be adjusted accordingly. In addition, an increase or decrease in RNA or protein levels in a cell or produced by a cell can be measured using any art recognized technique. By determining whether transcription has been decreased, the effectiveness of the oligonucleotide in inducing the cleavage of a target RNA can be determined.

Any of the above-described oligonucleotide compositions can be used alone or in conjunction with a pharmaceutically acceptable carrier. As used herein, "pharmaceutically acceptable carrier" includes appropriate solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like. The use of such media and agents for pharmaceutical active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active ingredient, it can be used in the therapeutic compositions.
Supplementary active ingredients can also be incorporated into the compositions.
Oligonucleotides may be incorporated into liposomes or liposomes modified with polyethylene glycol or admixed with cationic lipids for parenteral administration.
Incorporation of additional substances into the liposome, for example, antibodies reactive against membrane proteins found on specific target cells, can help target the oligonucleotides to specific cell types.

Moreover, the present invention provides for administering the subject oligonucleotides with an osmotic pump providing continuous infusion of such oligonucleotides, for example, as described in Rataiczak et al. (1992 Proc.
Natl. Acad.
Sci. USA 89:11823-11827). Such osmotic pumps are commercially available, e.g., from Alzet Inc. (Palo Alto, Calif.). Topical administration and parenteral administration in a cationic lipid carrier are preferred.

With respect to in vivo applications, the formulations of the present invention can be administered to a patient in a variety of forms adapted to the chosen route of administration, e.g., parenterally, orally, or intraperitoneally. Parenteral administration, which is preferred, includes administration by the following routes:
intravenous;
intramuscular; interstitially; intraarterially; subcutaneous; intra ocular;
intrasynovial;
trans epithelial, including transdermal; pulmonary via inhalation; ophthalmic;
sublingual and buccal; topically, including ophthalmic; dermal; ocular; rectal; and nasal inhalation via insufflation.

Pharmaceutical preparations for parenteral administration include aqueous solutions of the active compounds in water-soluble or water-dispersible form.
In addition, suspensions of the active compounds as appropriate oily injection suspensions may be administered. Suitable lipophilic solvents or vehicles include fatty oils, for example, sesame oil, or synthetic fatty acid esters, for example, ethyl oleate or triglycerides. Aqueous injection suspensions may contain substances which increase the viscosity of the suspension include, for example, sodium carboxymethyl cellulose, sorbitol, or dextran, optionally, the suspension may also contain stabilizers.
The oligonucleotides of the invention can be formulated in liquid solutions, preferably in physiologically compatible buffers such as Hank's solution or Ringer's solution. In addition, the oligonucleotides may be formulated in solid form and redissolved or suspended immediately prior to use. Lyophilized forms are also included in the invention.

Pharmaceutical preparations for topical administration include transdermal patches, ointments, lotions, creams, gels, drops, sprays, suppositories, liquids and powders. In addition, conventional pharmaceutical carriers, aqueous, powder or oily bases, or thickeners may be used in pharmaceutical preparations for topical administration.

Pharmaceutical preparations for oral administration include powders or granules, suspensions or solutions in water or non-aqueous media, capsules, sachets or tablets. In addition, thickeners, flavoring agents, diluents, emulsifiers, dispersing aids, or binders may be used in pharmaceutical preparations for oral administration.

For transmucosal or transdermal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are known in the art, and include, for example, for transmucosal administration bile salts and fusidic acid derivatives, and detergents. Transmucosal administration may be through nasal sprays or using suppositories. For oral administration, the oligonucleotides are formulated into conventional oral administration forms such as capsules, tablets, and tonics.
For topical administration, the oligonucleotides of the invention are formulated into ointments, salves, gels, or creams as known in the art.

Drug delivery vehicles can be chosen e.g., for in vitro, for systemic, or for topical administration. These vehicles can be designed to serve as a slow release reservoir or to deliver their contents directly to the target cell. An advantage of using some direct delivery drug vehicles is that multiple molecules are delivered per uptake.
Such vehicles have been shown to increase the circulation half-life of drugs that would otherwise be rapidly cleared from the blood stream. Some examples of such specialized drug delivery vehicles which fall into this category are liposomes, hydrogels, cyclodextrins, biodegradable nanocapsules, and bioadhesive microspheres.

The described oligonucleotides may be administered systemically to a subject.
Systemic absorption refers to the entry of drugs into the blood stream followed by distribution throughout the entire body. Administration routes which lead to systemic absorption include: intravenous, subcutaneous, intraperitoneal, and intranasal. Each of these administration routes delivers the oligonucleotide to accessible diseased cells.
Following subcutaneous administration, the therapeutic agent drains into local lymph nodes and proceeds through the lymphatic network into the circulation. The rate of entry into the circulation has been shown to be a function of molecular weight or size. The use of a liposome or other drug carrier localizes the oligonucleotide at the lymph node. The oligonucleotide can be modified to diffuse into the cell, or the liposome can directly participate in the delivery of either the unmodified or modified oligonucleotide into the cell.

The chosen method of delivery will result in entry into cells. Preferred delivery methods include liposomes (10-400 nm), hydrogels, controlled-release polymers, and other pharmaceutically applicable vehicles, and microinjection or electroporation (for ex vivo treatments).

The pharmaceutical preparations of the present invention may be prepared and formulated as emulsions. Emulsions are usually heterogeneous systems of one liquid dispersed in another in the form of droplets usually exceeding 0.1 gm in diameter. The emulsions of the present invention may contain excipients such as emulsifiers, stabilizers, dyes, fats, oils, waxes, fatty acids, fatty alcohols, fatty esters, humectants, hydrophilic colloids, preservatives, and anti-oxidants may also be present in emulsions as needed. These excipients may be present as a solution in either the aqueous phase, oily phase or itself as a separate phase.

Examples of naturally occurring emulsifiers that may be used in emulsion formulations of the present invention include lanolin, beeswax, phosphatides, lecithin and acacia. Finely divided solids have also been used as good emulsifiers especially in combination with surfactants and in viscous preparations. Examples of finely divided solids that may be used as emulsifiers include polar inorganic solids, such as heavy metal hydroxides, nonswelling clays such as bentonite, attapulgite, hectorite, kaolin, montrnorillonite, colloidal aluminum silicate and colloidal magnesium aluminum silicate, pigments and nonpolar solids such as carbon or glyceryl tristearate.

Examples of preservatives that may be included in the emulsion formulations include methyl paraben, propyl paraben, quaternary ammonium salts, benzalkonium chloride, esters of p-hydroxybenzoic acid, and boric acid. Examples of antioxidants that may be included in the emulsion formulations include free radical scavengers such as tocopherols, alkyl gallates, butylated hydroxyanisole, butylated hydroxytoluene, or reducing agents such as ascorbic acid and sodium metabisulfite, and antioxidant synergists such as citric acid, tartaric acid, and lecithin.

In one embodiment, the compositions of oligonucleotides are formulated as microemulsions. A microemulsion is a system of water, oil and amphiphile which is a single optically isotropic and thermodynamically stable liquid solution.
Typically microemulsions are prepared by first dispersing an oil in an aqueous surfactant solution and then adding a sufficient amount of a 4th component, generally an intermediate chain-length alcohol to form a transparent system.

Surfactants that may be used in the preparation of microemulsions include, but are not limited to, ionic surfactants, non-ionic surfactants, Brij 96, polyoxyethylene oleyl ethers, polyglycerol fatty acid esters, tetraglycerol monolaurate (ML3 10), tetraglycerol monooleate (M03 10), hexaglycerol monooleate (P0310), hexaglycerol pentaoleate (P0500), decaglycerol monocaprate (MCA750), decaglycerol monooleate (M0750), decaglycerol sequioleate (S0750), decaglycerol decaoleate (DA0750), alone or in combination with cosurfactants. The cosurfactant, usually a short-chain alcohol such as ethanol, 1-propanol, and 1-butanol, serves to increase the interfacial fluidity by penetrating into the surfactant film and consequently creating a disordered film because of the void space generated among surfactant molecules.

Microemulsions may, however, be prepared without the use of cosurfactants and alcohol-free self-emulsifying microemulsion systems are known in the art. The aqueous phase may typically be, but is not limited to, water, an aqueous solution of the drug, glycerol, PEG300, PEG400, polyglycerols, propylene glycols, and derivatives of ethylene glycol. The oil phase may include, but is not limited to, materials such as Captex 300, Captex 355, Capmul MCM, fatty acid esters, medium chain (C8-C12) mono, di, and tri-glycerides, polyoxyethylated glyceryl fatty acid esters, fatty alcohols, polyglycolized glycerides, saturated polyglycolized C8-C10 glycerides, vegetable oils and silicone oil.

Microemulsions are particularly of interest from the standpoint of drug solubilization and the enhanced absorption of drugs. Lipid based microemulsions (both oil/water and water/oil) have been proposed to enhance the oral bioavailability of drugs.

Microemulsions offer improved drug solubilization, protection of drug from enzymatic hydrolysis, possible enhancement of drug absorption due to surfactant-induced alterations in membrane fluidity and permeability, ease of preparation, ease of oral administration over solid dosage forms, improved clinical potency, and decreased toxicity (Constantinides et al., Pharmaceutical Research, 1994, 11:1385; Ho et al., J.
Pharm. Sci., 1996, 85:138-143). Microemulsions have also been effective in the transdermal delivery of active components in both cosmetic and pharmaceutical applications. It is expected that the microemulsion compositions and formulations of the present invention will facilitate the increased systemic absorption of oligonucleotides from the gastrointestinal tract, as well as improve the local cellular uptake of oligonucleotides within the gastrointestinal tract, vagina, buccal cavity and other areas of administration.

In an embodiment, the present invention employs various penetration enhancers to affect the efficient delivery of nucleic acids, particularly oligonucleotides, to the skin of animals. Even non-lipophilic drugs may cross cell membranes if the membrane to be crossed is treated with a penetration enhancer. In addition to increasing the diffusion of non-lipophilic drugs across cell membranes, penetration enhancers also act to enhance the permeability of lipophilic drugs.

Five categories of penetration enhancers that may be used in the present invention include: surfactants, fatty acids, bile salts, chelating agents, and non-chelating non-surfactants. Other agents may be utilized to enhance the penetration of the administered oligonucleotides include: glycols such as ethylene glycol and propylene glycol, pyrrols such as 2-15 pyrrol, azones, and terpenes such as limonene, and menthone.

The oligonucleotides, especially in lipid formulations, can also be administered by coating a medical device, for example, a catheter, such as an angioplasty balloon catheter, with a cationic lipid formulation. Coating may be achieved, for example, by dipping the medical device into a lipid formulation or a mixture of a lipid formulation and a suitable solvent, for example, an aqueous-based buffer, an aqueous solvent, ethanol, methylene chloride, chloroform and the like. An amount of the formulation will naturally adhere to the surface of the device which is subsequently administered to a patient, as appropriate. Alternatively, a lyophilized mixture of a lipid formulation may be specifically bound to the surface of the device. Such binding techniques are described, for example, in K. Ishihara et al., Journal of Biomedical Materials Research, Vol. 27, pp.
1309-1314 (1993), the disclosures of which are incorporated herein by reference in their entirety.

The useful dosage to be administered and the particular mode of administration will vary depending upon such factors as the cell type, or for in vivo use, the age, weight and the particular animal and region thereof to be treated, the particular oligonucleotide and delivery method used, the therapeutic or diagnostic use contemplated, and the form of the formulation, for example, suspension, emulsion, micelle or liposome, as will be readily apparent to those skilled in the art. Typically, dosage is administered at lower levels and increased until the desired effect is achieved. When lipids are used to deliver the oligonucleotides, the amount of lipid compound that is administered can vary and generally depends upon the amount of oligonucleotide agent being administered.
For example, the weight ratio of lipid compound to oligonucleotide agent is preferably from about 1:1 to about 15:1, with a weight ratio of about 5:1 to about 10:1 being more preferred. Generally, the amount of cationic lipid compound which is administered will vary from between about 0.1 milligram (mg) to about 1 gram (g). By way of general guidance, typically between about 0.1 mg and about 10 mg of the particular oligonucleotide agent, and about 1 mg to about 100 mg of the lipid compositions, each per kilogram of patient body weight, is administered, although higher and lower amounts can be used.

The agents of the invention are administered to subjects or contacted with cells in a biologically compatible form suitable for pharmaceutical administration. By "biologically compatible form suitable for administration" is meant that the oligonucleotide is administered in a form in which any toxic effects are outweighed by the therapeutic effects of the oligonucleotide. In one embodiment, oligonucleotides can be administered to subjects. Examples of subjects include mammals, e.g., humans and other primates; cows, pigs, horses, and farming (agricultural) animals; dogs, cats, and other domesticated pets; mice, rats, and transgenic non-human animals.

Administration of an active amount of an oligonucleotide of the present invention is defined as an amount effective, at dosages and for periods of time necessary to achieve the desired result. For example, an active amount of an oligonucleotide may vary according to factors such as the type of cell, the oligonucleotide used, and for in vivo uses the disease state, age, sex, and weight of the individual, and the ability of the oligonucleotide to elicit a desired response in the individual. Establishment of therapeutic levels of oligonucleotides within the cell is dependent upon the rates of uptake and efflux or degradation. Decreasing the degree of degradation prolongs the intracellular half-life of the oligonucleotide. Thus, chemically-modified oligonucleotides, e.g., with modification of the phosphate backbone, may require different dosing.

The exact dosage of an oligonucleotide and number of doses administered will depend upon the data generated experimentally and in clinical trials. Several factors such as the desired effect, the delivery vehicle, disease indication, and the route of administration, will affect the dosage. Dosages can be readily determined by one of ordinary skill in the art and formulated into the subject pharmaceutical compositions.
Preferably, the duration of treatment will extend at least through the course of the disease symptoms.

Dosage regime may be adjusted to provide the optimum therapeutic response.
For example, the oligonucleotide may be repeatedly administered, e.g., several doses may be administered daily or the dose may be proportionally reduced as indicated by the exigencies of the therapeutic situation. One of ordinary skill in the art will readily be able to determine appropriate doses and schedules of administration of the subject oligonucleotides, whether the oligonucleotides are to be administered to cells or to subjects.

Physical methods of introducing nucleic acids include injection of a solution containing the nucleic acid, bombardment by particles covered by the nucleic acid, soaking the cell or organism in a solution of the nucleic acid, or electroporation of cell membranes in the presence of the nucleic acid. A viral construct packaged into a viral particle would accomplish both efficient introduction of an expression construct into the cell and transcription of nucleic acid encoded by the expression construct.
Other methods known in the art for introducing nucleic acids to cells may be used, such as lipid-mediated carrier transport, chemical-mediated transport, such as calcium phosphate, and the like. Thus the nucleic acid may be introduced along with components that perform one or more of the following activities: enhance nucleic acid uptake by the cell, inhibit annealing of single strands, stabilize the single strands, or other-wise increase inhibition of the target gene.

Nucleic acid may be directly introduced into the cell (i.e., intracellularly);
or introduced extracellularly into a cavity, interstitial space, into the circulation of an organism, introduced orally, or may be introduced by bathing a cell or organism in a solution containing the nucleic acid. Vascular or extravascular circulation, the blood or lymph system, and the cerebrospinal fluid are sites where the nucleic acid may be introduced.

The cell with the target gene may be derived from or contained in any organism.
The organism may a plant, animal, protozoan, bacterium, virus, or fungus. The plant may be a monocot, dicot or gymnosperm; the animal may be a vertebrate or invertebrate.
Preferred microbes are those used in agriculture or by industry, and those that are pathogenic for plants or animals.

Alternatively, vectors, e.g., transgenes encoding a siRNA of the invention can be engineered into a host cell or transgenic animal using art recognized techniques.

A further preferred use for the agents of the present invention (or vectors or transgenes encoding same) is a functional analysis to be carried out in eukaryotic cells, or eukaryotic non-human organisms, preferably mammalian cells or organisms and most preferably human cells, e.g. cell lines such as HeLa or 293 or rodents, e.g.
rats and mice.
By administering a suitable priming agent/RNAi agent which is sufficiently complementary to a target mRNA sequence to direct target-specific RNA
interference, a specific knockout or knockdown phenotype can be obtained in a target cell, e.g. in cell culture or in a target organism.

Thus, a further subject matter of the invention is a eukaryotic cell or a eukaryotic non-human organism exhibiting a target gene-specific knockout or knockdown phenotype comprising a fully or at least partially deficient expression of at least one endogenous target gene wherein said cell or organism is transfected with at least one vector comprising DNA encoding an RNAi agent capable of inhibiting the expression of the target gene. It should be noted that the present invention allows a target-specific knockout or knockdown of several different endogenous genes due to the specificity of the RNAi agent.

Gene-specific knockout or knockdown phenotypes of cells or non-human organisms, particularly of human cells or non-human mammals may be used in analytic to procedures, e.g. in the functional and/or phenotypical analysis of complex physiological processes such as analysis of gene expression profiles and/or proteomes.
Preferably the analysis is carried out by high throughput methods using oligonucleotide based chips.

Assays of Oligonucleotide Stability In some embodiments, the oligonucleotides of the invention are stabilized, i.e., substantially resistant to endonuclease and exonuclease degradation. An oligonucleotide is defined as being substantially resistant to nucleases when it is at least about 3-fold more resistant to attack by an endogenous cellular nuclease, and is highly nuclease resistant when it is at least about 6-fold more resistant than a corresponding oligonucleotide. This can be demonstrated by showing that the oligonucleotides of the invention are substantially resistant to nucleases using techniques which are known in the art.

One way in which substantial stability can be demonstrated is by showing that the oligonucleotides of the invention function when delivered to a cell, e.g., that they reduce transcription or translation of target nucleic acid molecules, e.g., by measuring protein levels or by measuring cleavage of mRNA. Assays which measure the stability of target RNA can be performed at about 24 hours post-transfection (e.g., using Northern blot techniques, RNase Protection Assays, or QC-PCR assays as known in the art).
Alternatively, levels of the target protein can be measured. Preferably, in addition to testing the RNA or protein levels of interest, the RNA or protein levels of a control, non-targeted gene will be measured (e.g., actin, or preferably a control with sequence similarity to the target) as a specificity control. RNA or protein measurements can be made using any art-recognized technique. Preferably, measurements will be made beginning at about 16-24 hours post transfection. (M. Y. Chiang, et al. 1991.
J Biol Chem. 266:18162-71; T. Fisher, et al. 1993. Nucleic Acids Research. 21 3857).

The ability of an oligonucleotide composition of the invention to inhibit protein synthesis can be measured using techniques which are known in the art, for example, by detecting an inhibition in gene transcription or protein synthesis. For example, Nuclease Si mapping can be performed. In another example, Northern blot analysis can be used to measure the presence of RNA encoding a particular protein. For example, total RNA
can be prepared over a cesium chloride cushion (see, e.g., Ausebel et al., 1987. Current Protocols in Molecular Biology (Greene & Wiley, New York)). Northern blots can then be made using the RNA and probed (see, e.g., Id.). In another example, the level of the specific mRNA produced by the target protein can be measured, e.g., using PCR.
In yet another example, Western blots can be used to measure the amount of target protein present. In still another embodiment, a phenotype influenced by the amount of the protein can be detected. Techniques for performing Western blots are well known in the art, see, e.g., Chen et al. J. Biol. Chem. 271:28259.

In another example, the promoter sequence of a target gene can be linked to a reporter gene and reporter gene transcription (e.g., as described in more detail below) can be monitored. Alternatively, oligonucleotide compositions that do not target a promoter can be identified by fusing a portion of the target nucleic acid molecule with a reporter gene so that the reporter gene is transcribed. By monitoring a change in the expression of the reporter gene in the presence of the oligonucleotide composition, it is possible to determine the effectiveness of the oligonucleotide composition in inhibiting the expression of the reporter gene. For example, in one embodiment, an effective oligonucleotide composition will reduce the expression of the reporter gene.

A "reporter gene" is a nucleic acid that expresses a detectable gene product, which may be RNA or protein. Detection of mRNA expression may be accomplished by Northern blotting and detection of protein may be accomplished by staining with antibodies specific to the protein. Preferred reporter genes produce a readily detectable product. A reporter gene may be operably linked with a regulatory DNA sequence such that detection of the reporter gene product provides a measure of the transcriptional to activity of the regulatory sequence. In preferred embodiments, the gene product of the reporter gene is detected by an intrinsic activity associated with that product. For instance, the reporter gene may encode a gene product that, by enzymatic activity, gives rise to a detectable signal based on color, fluorescence, or luminescence.
Examples of reporter genes include, but are not limited to, those coding for chloramphenicol acetyl transferase (CAT), luciferase, beta-galactosidase, and alkaline phosphatase.

One skilled in the art would readily recognize numerous reporter genes suitable for use in the present invention. These include, but are not limited to, chloramphenicol acetyltransferase (CAT), luciferase, human growth hormone (hGH), and beta-galactosidase. Examples of such reporter genes can be found in F. A. Ausubel et al., Eds., Current Protocols in Molecular Biology, John Wiley & Sons, New York, (1989).
Any gene that encodes a detectable product, e.g., any product having detectable enzymatic activity or against which a specific antibody can be raised, can be used as a reporter gene in the present methods.

One reporter gene system is the firefly luciferase reporter system. (Gould, S.
J., and Subramani, S. 1988. Anal. Biochem., 7:404-408 incorporated herein by reference).
The luciferase assay is fast and sensitive. In this assay, a lysate of the test cell is prepared and combined with ATP and the substrate luciferin. The encoded enzyme luciferase catalyzes a rapid, ATP dependent oxidation of the substrate to generate a light-emitting product. The total light output is measured and is proportional to the amount of luciferase present over a wide range of enzyme concentrations.

CAT is another frequently used reporter gene system; a major advantage of this system is that it has been an extensively validated and is widely accepted as a measure of promoter activity. (Gorman C. M., Moffat, L. F., and Howard, B. H. 1982. Mol.
Cell.
Biol., 2:1044-1051). In this system, test cells are transfected with CAT
expression vectors and incubated with the candidate substance within 2-3 days of the initial transfection. Thereafter, cell extracts are prepared. The extracts are incubated with acetyl CoA and radioactive chloramphenicol. Following the incubation, acetylated chloramphenicol is separated from nonacetylated form by thin layer chromatography. In this assay, the degree of acetylation reflects the CAT gene activity with the particular promoter.

Another suitable reporter gene system is based on immunologic detection of hGH. This system is also quick and easy to use. (Selden, R., Burke-Howie, K.
Rowe, M.
E., Goodman, H. M., and Moore, D. D. (1986), Mol. Cell, Biol., 6:3173-3179 incorporated herein by reference). The hGH system is advantageous in that the expressed hGH polypeptide is assayed in the media, rather than in a cell extract. Thus, this system does not require the destruction of the test cells. It will be appreciated that the principle of this reporter gene system is not limited to hGH but rather adapted for use with any polypeptide for which an antibody of acceptable specificity is available or can be prepared.

In one embodiment, nuclease stability of a double-stranded oligonucleotide of the invention is measured and compared to a control, e.g., an RNAi molecule typically used in the art (e.g., a duplex oligonucleotide of less than 25 nucleotides in length and comprising 2 nucleotide base overhangs) or an unmodified RNA duplex with blunt ends.
The target RNA cleavage reaction achieved using the siRNAs of the invention is highly sequence specific. Sequence identity may determined by sequence comparison and alignment algorithms known in the art. To determine the percent identity of two nucleic acid sequences (or of two amino acid sequences), the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in the first sequence or second sequence for optimal alignment). A preferred, non-limiting example of a local alignment algorithm utilized for the comparison of sequences is the algorithm of Karlin and Altschul (1990) Proc. Natl. Acad. Sci. USA 87:2264-68, modified as in Karlin and Altschul (1993) Proc. Natl. Acad. Sci. USA 90:5873-77. Such an algorithm is incorporated into the BLAST programs (version 2.0) of Altschul, et al. (1990) J. Mol.
Biol. 215:403-10. Greater than 90% sequence identity, e.g., 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or even 100% sequence identity, between the siRNA and the portion of the target gene is preferred. Alternatively, the siRNA may be defined functionally as a nucleotide sequence (or oligonucleotide sequence) that is capable of hybridizing with a portion of the target gene transcript. Examples of stringency conditions for polynucleotide hybridization are provided in Sambrook, J., E.
F. Fritsch, and T. Maniatis, 1989, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., chapters 9 and 11, and Current Protocols in Molecular Biology, 1995, F. M. Ausubel et al., eds., John Wiley & Sons, Inc., sections 2.10 and 6.3-6.4, incorporated herein by reference.

Therapeutic use By inhibiting the expression of a gene, the oligonucleotide compositions of the present invention can be used to treat any disease involving the expression of a protein.
Examples of diseases that can be treated by oligonucleotide compositions, just to illustrate, include: cancer, retinopathies, autoimmune diseases, inflammatory diseases (i.e., ICAM-1 related disorders, Psoriasis, Ulcerative Colitus, Crohn's disease), viral diseases (i.e., HIV, Hepatitis C), miRNA disorders, and cardiovascular diseases.

In one embodiment, in vitro treatment of cells with oligonucleotides can be used for ex vivo therapy of cells removed from a subject (e.gõ for treatment of leukemia or viral infection) or for treatment of cells which did not originate in the subject, but are to be administered to the subject (e.g., to eliminate transplantation antigen expression on cells to be transplanted into a subject). In addition, in vitro treatment of cells can be used in non-therapeutic settings, e.g., to evaluate gene function, to study gene regulation and protein synthesis or to evaluate improvements made to oligonucleotides designed to modulate gene expression or protein synthesis. In vivo treatment of cells can be useful in certain clinical settings where it is desirable to inhibit the expression of a protein. There are numerous medical conditions for which antisense therapy is reported to be suitable (see, e.g., U.S. Pat. No. 5,830,653) as well as respiratory syncytial virus infection (WO
95/22,553) influenza virus (WO 94/23,028), and malignancies (WO 94/08,003).
Other examples of clinical uses of antisense sequences are reviewed, e.g., in Glaser. 1996.
Genetic Engineering News 16:1. Exemplary targets for cleavage by oligonucleotides include, e.g., protein kinase Ca, ICAM-1, c-raf kinase, p53, c-myb, and the bcr/abl fusion gene found in chronic myelogenous leukemia.

The subject nucleic acids can be used in RNAi-based therapy in any animal .having RNAi pathway, such as human, non-human primate, non-human mammal, non-human vertebrates, rodents (mice, rats, hamsters, rabbits, etc.), domestic livestock animals, pets (cats, dogs, etc.), Xenopus, fish, insects (Drosophila, etc.), and worms (C.
elegans), etc.

The invention provides methods for preventing in a subject, a disease or condition associated with an aberrant or unwanted target gene expression or activity, by administering to the subject a therapeutic agent (e.g., a RNAi agent or vector or transgene encoding same). If appropriate, subjects are first treated with a priming agent so as to be more responsive to the subsequent RNAi therapy. Subjects at risk for a disease which is caused or contributed to by aberrant or unwanted target gene expression or activity can be identified by, for example, any or a combination of diagnostic or prognostic assays as described herein. Administration of a prophylactic agent can occur prior to the manifestation of symptoms characteristic of the target gene aberrancy, such that a disease or disorder is prevented or, alternatively, delayed in its progression.
Depending on the type of target gene aberrancy, for example, a target gene, target gene agonist or target gene antagonist agent can be used for treating the subject.

In another aspect, the invention pertains to methods of modulating target gene expression, protein expression or activity for therapeutic purposes.
Accordingly, in an exemplary embodiment, the modulatory method of the invention involves contacting a cell capable of expressing target gene with a therapeutic agent of the invention that is specific for the target gene or protein (e.g., is specific for the mRNA
encoded by said gene or specifying the amino acid sequence of said protein) such that expression or one or more of the activities of target protein is modulated. These modulatory methods can be performed in vitro (e.g., by culturing the cell with the agent), in vivo (e.g., by administering the agent to a subject), or ex vivo. Typically, subjects are first treated with a priming agent so as to be more responsive to the subsequent RNAi therapy. As such, the present invention provides methods of treating an individual afflicted with a disease or disorder characterized by aberrant or unwanted expression or activity of a target gene polypeptide or nucleic acid molecule. Inhibition of target gene activity is desirable in situations in which target gene is abnormally unregulated and/or in which decreased target gene activity is likely to have a beneficial effect.

The therapeutic agents of the invention can be administered to individuals to treat (prophylactically or therapeutically) disorders associated with aberrant or unwanted target gene activity. In conjunction with such treatment, pharmacogenomics (i.e., the study of the relationship between an individual's genotype and that individual's response to a foreign compound or drug) may be considered. Differences in metabolism of therapeutics can lead to severe toxicity or therapeutic failure by altering the relation between dose and blood concentration of the pharmacologically active drug.
Thus, a physician or clinician may consider applying knowledge obtained in relevant pharmacogenomics studies in determining whether to administer a therapeutic agent as well as tailoring the dosage and/or therapeutic regimen of treatment with a therapeutic agent. Pharmacogenomics deals with clinically significant hereditary variations in the response to drugs due to altered drug disposition and abnormal action in affected persons. See, for example, Eichelbaum, M. et al. (1996) Clin. Exp. Pharmacol.
Physiol.
23(10-11): 983-985 and Linder, M. W. et al. (1997) Clin. Chem. 43(2):254-266 RNAi in skin indications Nucleic acid molecules, or compositions comprising nucleic acid molecules, described herein may in some embodiments be administered to pre-treat, treat or prevent compromised skin. As used herein "compromised skin" refers to skin which exhibits characteristics distinct from normal skin. Compromised skin may occur in association with a dermatological condition. Several non-limiting examples of dermatological conditions include rosacea, common acne, seborrheic dermatitis, perioral dermatitis, acneform rashes, transient acantholytic dermatosis, and acne necrotica miliaris. In some instances, compromised skin may comprise a wound and/or scar tissue. In some instances, methods and compositions associated with the invention may be used to promote wound healing, prevention, reduction or inhibition of scarring, and/or promotion of re-epithelialisation of wounds.
A subject can be pre-treated or treated prophylactically with a molecule associated with the invention, prior to the skin of the subject becoming compromised.
As used herein "pre-treatment" or "prophylactic treatment" refers to administering a nucleic acid to the skin prior to the skin becoming compromised. For example, a subject could be pre-treated 15 minutes, 30 minutes, 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 24 hours, 48 hours, or more than 48 hours prior to the skin becoming compromised. In other embodiments, a subject can be treated with a molecule associated with the invention immediately before the skin becomes compromised and/or simultaneous to the skin becoming compromised and/or after the skin has been compromised. In some embodiments, the skin is compromised through a medical procedure such as surgery, including elective surgery.
In certain embodiments methods and compositions may be applied to areas of the skin that are believed to be at risk of becoming compromised. It should be appreciated that one of ordinary skill in the art would be able to optimize timing of administration using no more than routine experimentation.
In some aspects, methods associated with the invention can be applied to promote healing of compromised skin. Administration can occur at any time up until the compromised skin has healed, even if the compromised skin has already partially healed.
The timing of administration can depend on several factors including the nature of the compromised skin, the degree of damage within the compromised skin, and the size of the compromised area. In some embodiments administration may occur immediately after the skin is compromised, or 30 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 8 hours, 12 hours, 24 hours, 48 hours, or more than 48 hours after the skin has been compromised. Methods and compositions of the invention may be administered one or more times as necessary. For example, in some embodiments, compositions may be administered daily or twice daily. In some instances, compositions may be administered both before and after formation of compromised skin.
Compositions associated with the invention may be administered by any suitable route. In some embodiments, administration occurs locally at an area of compromised skin. For example, compositions may be administered by intradermal injection.
Compositions for intradermal injection may include injectable solutions.
Intradermal injection may in some embodiments occur around the are of compromised skin or at a site where the skin is likely to become compromised. In some embodiments, compositions may also be administered in a topical form, such as in a cream or ointment.
In some embodiments, administration of compositions described herein comprises part of an initial treatment or pre-treatment of compromised skin, while in other embodiments, administration of such compositions comprises follow-up care for an area of compromised skin.

The appropriate amount of a composition or medicament to be applied can depend on many different factors and can be determined by one of ordinary skill in the art through routine experimentation. Several non-limiting factors that might be considered include biological activity and bioavailability of the agent, nature of the agent, mode of administration, half-life, and characteristics of the subject to be treated.
In some aspects, nucleic acid molecules associated with the invention may also be used in treatment and/or prevention of fibrotic disorders, including pulmonary fibrosis, liver cirrhosis, scleroderma and glomerulonephritis, lung fibrosis, liver fibrosis, skin fibrosis, muscle fibrosis, radiation fibrosis, kidney fibrosis, proliferative vitreoretinopathy and uterine fibrosis.
A therapeutically effective amount of a nucleic acid molecule described herein may in some embodiments be an amount sufficient to prevent the formation of compromised skin and/or improve the condition of compromised skin. In some embodiments, improvement of the condition of compromised skin may correspond to promotion of wound healing and/or inhibition of scarring and/or promotion of epithelial regeneration. The extent of prevention of formation of compromised skin and/or improvement to the condition of compromised skin may in some instances be determined by, for example, a doctor or clinician.
The ability of nucleic acid molecules associated with the invention to prevent the formation of compromised skin and/or improve the condition of compromised skin may in some instances be measured with reference to properties exhibited by the skin. In some instances, these properties may include rate of epithelialisation and/or decreased size of an area of compromised skin compared to control skin at comparable time points.
As used herein, prevention of formation of compromised skin, for example prior to a surgical procedure, and/or improvement of the condition of compromised skin, for example after a surgical procedure, can encompass any increase in the rate of healing in the compromised skin as compared with the rate of healing occurring in a control sample. In some instances, the condition of compromised skin may be assessed with respect to either comparison of the rate of re-epithelialisation achieved in treated and control skin, or comparison of the relative areas of treated and control areas of compromised skin at comparable time points. In some aspects, a molecule that prevents formation of compromised skin or promotes healing of compromised skin may be a molecule that, upon administration, causes the area of compromised skin to exhibit an increased rate of re-epithelialisation and/or a reduction of the size of compromised skin compared to a control at comparable time points. In some embodiments, the healing of compromised skin may give rise to a rate of healing that is 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100% greater than the rate occurring in controls.
In some aspects, subjects to be treated by methods and compositions associated with the invention may be subjects who will undergo, are undergoing or have undergone a medical procedure such as a surgery. In some embodiments, the subject may be prone to defective, delayed or otherwise impaired re-epithelialisation, such as dermal wounds in the aged. Other non-limiting examples of conditions or disorders in which wound healing is associated with delayed or otherwise impaired re-epithelialisation include patients suffering from diabetes, patients with polypharmacy, post-menopausal women, patients susceptible to pressure injuries, patients with venous disease, clinically obese patients, patients receiving chemotherapy, patients receiving radiotherapy, patients receiving steroid treatment, and immuno-compromised patients. In some instances, defective re-epithelialisation response can contributes to infections at the wound site, and to the formation of chronic wounds such as ulcers.
In some embodiments, methods associated with the invention may promote the re-epithelialisation of compromised skin in chronic wounds, such as ulcers, and may also inhibit scarring associated with wound healing. In other embodiments, methods associated with the invention are applied to prevention or treatment of compromised skin in acute wounds in patients predisposed to impaired wound healing developing into chronic wounds. In other aspects, methods associated with the invention are applied to promote accelerated healing of compromised skin while preventing, reducing or inhibiting scarring for use in general clinical contexts. In some aspects, this can involve the treatment of surgical incisions and application of such methods may result in the prevention, reduction or inhibition of scarring that may otherwise occur on such healing.
Such treatment may result in the scars being less noticeable and exhibiting regeneration of a more normal skin structure. In other embodiments, the compromised skin that is treated is not compromised skin that is caused by a surgical incision. The compromised skin may be subject to continued care and continued application of medicaments to encourage re-epithelialisation and healing.
In some aspects, methods associated with the invention may also be used in the treatment of compromised skin associated with grafting procedures. This can involve treatment at a graft donor site and/or at a graft recipient site. Grafts can in some embodiments involve skin, artificial skin, or skin substitutes. Methods associated with the invention can also be used for promoting epithelial regeneration. As used herein, promotion of epithelial regeneration encompasses any increase in the rate of epithelial regeneration as compared to the regeneration occurring in a control-treated or untreated epithelium. The rate of epithelial regeneration attained can in some instances be compared with that taking place in control-treated or untreated epithelia using any suitable model of epithelial regeneration known in the art. Promotion of epithelial regeneration may be of use to induce effective re-epithelialisation in contexts in which the re-epithelialisation response is impaired, inhibited, retarded or otherwise defective.
Promotion of epithelial regeneration may be also effected to accelerate the rate of defective or normal epithelial regeneration responses in patients suffering from epithelial damage.
Some instances where re-epithelialisation response may be defective include conditions such as pemphigus, Hailey-Hailey disease (familial benign pemphigus), toxic epidermal necrolysis (TEN)/Lyell's syndrome, epidermolysis bullosa, cutaneous leishmaniasis and actinic keratosis. Defective re-epithelialisation of the lungs may be associated with idiopathic pulmonary fibrosis (IPF) or interstitial lung disease. Defective re-epithelialisation of the eye may be associated with conditions such as partial limbal stem cell deficiency or corneal erosions. Defective re-epithelialisation of the gastrointestinal tract or colon may be associated with conditions such as chronic anal fissures (fissure in ano), ulcerative colitis or Crohn's disease, and other inflammatory bowel disorders.
In some aspects, methods associated with the invention are used to prevent, reduce or otherwise inhibit compromised skin associated with scarring. This can be applied to any site within the body and any tissue or organ, including the skin, eye, nerves, tendons, ligaments, muscle, and oral cavity (including the lips and palate), as well as internal organs (such as the liver, heart, brain, abdominal cavity, pelvic cavity, thoracic cavity, guts and reproductive tissue). In the skin, treatment may change the morphology and organization of collagen fibers and may result in making the scars less visible and blend in with the surrounding skin. As used herein, prevention, reduction or inhibition of scarring encompasses any degree of prevention, reduction or inhibition in scarring as compared to the level of scarring occurring in a control-treated or untreated wound.

Prevention, reduction or inhibition of compromised skin, such as compromised skin associated with dermal scarring, can be assessed and/or measured with reference to microscopic and/or macroscopic characteristics. Macroscopic characteristics may include color, height, surface texture and stiffness of the skin. In some instances, prevention, reduction or inhibition of compromised skin may be demonstrated when the color, height, surface texture and stiffness of the skin resembles that of normal skin more closely after treatment than does a control that is untreated. Microscopic assessment of compromised skin may involve examining characteristics such as thickness and/or orientation and/or composition of the extracellular matrix (ECM) fibers, and cellularity of the compromised skin. In some instances, prevention, reduction or inhibition of compromised skin may be demonstrated when the thickness and/or orientation and/or composition of the extracellular matrix (ECM) fibers, and/or cellularity of the compromised skin resembles that of normal skin more closely after treatment than does a control that is untreated.

In some aspects, methods associated with the invention are used for cosmetic purposes, at least in part to contribute to improving the cosmetic appearance of compromised skin. In some embodiments, methods associated with the invention may be used to prevent, reduce or inhibit compromised skin such as scarring of wounds covering joints of the body. In other embodiments, methods associated with the invention may be used to promote accelerated wound healing and/or prevent, reduce or inhibit scarring of wounds at increased risk of forming a contractile scar, and/or of wounds located at sites of high skin tension.
In some embodiments, methods associated with the invention can be applied to promoting healing of compromised skin in instances where there is an increased risk of pathological scar formation, such as hypertrophic scars and keloids, which may have more pronounced deleterious effects than normal scarring. In some embodiments, methods described herein for promoting accelerated healing of compromised skin and/or preventing, reducing or inhibiting scarring are applied to compromised skin produced by surgical revision of pathological scars.
Aspects of the invention can be applied to compromised skin caused by burn injuries. Healing in response to burn injuries can lead to adverse scarring, including the formation of hypertrophic scars. Methods associated with the invention can be applied to treatment of all injuries involving damage to an epithelial layer, such as injuries to the skin in which the epidermis is damaged. Other non-limiting examples of injuries to epithelial tissue include injuries involving the respiratory epithelia, digestive epithelia or epithelia surrounding internal tissues or organs.
Target genes It should be appreciated that based on the RNAi molecules designed and disclosed herein, one of ordinary skill in the art would be able to design such RNAi molecules to target a variety of different genes depending on the context and intended use. For purposes of pre-treating, treating, or preventing compromised skin and/or promoting wound healing and/or preventing, reducing or inhibiting scarring, one of ordinary skill in the art would appreciate that a variety of suitable target genes could be identified based at least in part on the known or predicted functions of the genes, and/or the known or predicted expression patterns of the genes. Several non-limiting examples of genes that could be targeted by RNAi molecules for pre-treating, treating, or preventing compromised skin and/or promoting wound healing and/or preventing, reducing or inhibiting scarring include genes that encode for the following proteins:
Transforming growth factor 0 (TGF(31, TGF02, TGF(33), Osteopontin, Connective tissue growth factor (CTGF), Platelet-derived growth factor (PDGF), Hypoxia inducible factor-1 a (HIF 1 a), Collagen I and/or III, Prolyl 4-hydroxylase (P4H), Procollagen C-protease (PCP), Matrix metalloproteinase 2, 9 (MMP2, 9), Integrins, Connexin, Histamine receptor, Tissue transglutaminase, Mammalian target of rapamycin (mTOR), HoxB
13, VEGF, IL-6, SMAD proteins, Ribosomal protein S6 kinases (RSP6) and Cyclooxygenase-2 (COX-2).

Transforming growth factor (3 proteins, for which three isoforms exist in mammals (TGF131, TGF(32, TGF(33), are secreted proteins belonging to a superfamily of growth factors involved in the regulation of many cellular processes including proliferation, migration, apoptosis, adhesion, differentiation, inflammation, immuno-suppression and expression of extracellular proteins. These proteins are produced by a wide range of cell types including epithelial, endothelial, hematopoietic, neuronal, and connective tissue cells. Representative Genbank accession numbers providing DNA and protein sequence information for human TGFf31, TGF(32 and TGFI33 are BT007245, BC096235, and X14149, respectively. Within the TGF(3 family, TGF(31 and TGF(32 but not TGF(33 represent suitable targets. The alteration in the ratio of TGF(3 variants will promote better wound healing and will prevent excessive scar formation.
Osteopontin (OPN), also known as Secreted phosphoprotein 1 (SPP1), Bone Sinaloprotein 1 (BSP-1), and early T-lymphocyte activation (ETA-1) is a secreted glycoprotein protein that binds to hydroxyapatite. OPN has been implicated in a variety of biological processes including bone remodeling, immune functions, chemotaxis, cell activation and apoptosis.
Osteopontin is produced by a variety of cell types including fibroblasts, preosteoblasts, osteoblasts, osteocytes, odontoblasts, bone marrow cells, hypertrophic chondrocytes, dendritic cells, macrophages, smooth muscle, skeletal muscle myoblasts, endothelial cells, and extraosseous (non-bone) cells in the inner ear, brain, kidney, deciduum, and placenta. Representative Genbank accession number providing DNA and protein sequence information for human Osteopontin are NM_000582.2 and X13694.
Connective tissue growth factor (CTGF), also known as Hypertrophic chondrocyte-specific protein 24, is a secreted heparin-binding protein that has been implicated in wound healing and scleroderma. Connective tissue growth factor is active in many cell types including fibroblasts, myofibroblasts, endothelial and epithelial cells.
Representative Genbank accession number providing DNA and protein sequence information for human CTGF are NM-00 1901.2 and M92934.
The Platelet-derived growth factor (PDGF) family of proteins, including several isoforms, are secreted mitogens. PDGF proteins are implicated in wound healing, at least in part, because they are released from platelets following wounding.
Representative Genbank accession numbers providing DNA and protein sequence information for human PDGF genes and proteins include X03795 (PDGFA), X02811 (PDGFB), AF091434 (PDGFC), AB033832 (PDGFD).

Hypoxia inducible factor-1 a (HIF 1 a), is a transcription factor involved in cellular response to hypoxia. HIFla is implicated in cellular processes such as embryonic vascularization, tumor angiogenesis and pathophysiology of ischemic disease.
A representative Genbank accession number providing DNA and protein sequence information for human HIF 1 a is U2243 1.
Collagen proteins are the most abundant mammalian proteins and are found in tissues such as skin, tendon, vascular, ligature, organs, and bone. Collagen I
proteins (such as COL1A1 and COL1A2) are detected in scar tissue during wound healing, and are expressed in the skin. Collagen III proteins (including COL3A1) are detected in connective tissue in wounds (granulation tissue), and are also expressed in skin.
Representative Genbank accession numbers providing DNA and protein sequence information for human Collagen proteins include: Z74615 (COL 1 A 1), J03464 (COL1A2) and X14420 (COL3A1).
Prolyl 4-hydroxylase (P4H), is involved in production of collagen and in oxygen sensing. A representative Genbank accession number providing DNA and protein sequence information for human P4H is AY198406.
Procollagen C-protease (PCP) is another target.
Matrix metalloproteinase 2, 9 (MMP2, 9) belong to the metzincin metalloproteinase superfamily and are zinc-dependent endopeptidases. These proteins are implicated in a variety of cellular processes including tissue repair.
Representative Genbank accession numbers providing DNA and protein sequence information for human MMP proteins are M55593 (MMP2) and J05070 (MMP9).
Integrins are a family of proteins involved in interaction and communication between a cell and the extracellular matrix. Vertebrates contain a variety of integrins including ai(3i, a2R1, a401, a501, a6Rl, aLI32, aMJ32, a11bj33, av133, avf35, avf36, a6134=
Connexins are a family of vertebrate transmembrane proteins that form gap junctions. Several examples of Connexins, with the accompanying gene name shown in brackets, include Cx23 (GJE 1), Cx25 (GJB7), Cx26 (GJB2), Cx29 (GJE 1), Cx30 (GJB6), Cx30.2 (GJC3), Cx30.3 (GJB4), Cx31 (GJB3), Cx31.1 (GJB5), Cx31.9 (GJC1/GJD3), Cx32 (GJB1), Cx33 (GJA6), Cx36 (GJD2/GJA9), Cx37 (GJA4), Cx39 (GJD4), Cx40 (GJA5), Cx40.1 (GJD4), Cx43 (GJA1), Cx45 (GJC1/GJA7), Cx46 (GJA3), Cx47 (GJC2/GJA12), Cx50 (GJA8), Cx59 (GJA10), and Cx62 (GJA10).
Histamine H1 receptor (HRH1) is a metabotropic G-protein-coupled receptor involved in the phospholipase C and phosphatidylinositol (PIP2) signaling pathways. A
representative Genbank accession number providing DNA and protein sequence information for human HRH1 is Z34897.
Tissue transglutaminase, also called Protein-glutamine gamma-glutamyltransferase 2, is involved in protein crosslinking and is implicated is biological processes such as apoptosis, cellular differentiation and matrix stabilization. A
representative Genbank accession number providing DNA and protein sequence information for human Tissue transglutaminase is M55153.

Mammalian target of rapamycin (mTOR), also known as Serine/threonine-protein kinase mTOR and FK506 binding protein 12-rapamycin associated protein 1 (FRAP
1), is involved in regulating cell growth and survival, cell motility, transcription and translation. A representative Genbank accession number providing DNA and protein sequence information for human mTOR is L34075.
HoxB 13 belongs to the family of Homeobox proteins and has been linked to functions such as cutaneous regeneration and fetal skin development. A
representative Genbank accession number providing DNA and protein sequence information for human HoxB13 is U57052.
Vascular endothelial growth factor (VEGF) proteins are growth factors that bind to tyrosine kinase receptors and are implicated in multiple disorders such as cancer, age-related macular degeneration, rheumatoid arthritis and diabetic retinopathy.
Members of this protein family include VEGF-A, VEGF-B, VEGF-C and VEGF-D. Representative Genbank accession numbers providing DNA and protein sequence information for human VEGF proteins are M32977 (VEGF-A), U43368 (VEGF-B), X94216 (VEGF-C), and D89630 (VEGF-D).
Interleukin-6 (IL-6) is a cytokine involved in stimulating immune response to tissue damage. A representative Genbank accession number providing DNA and protein sequence information for human IL-6 is X04430.
SMAD proteins (SMAD 1-7, 9) are a family of transcription factors involved in regulation of TGF(3 signaling. Representative Genbank accession numbers providing DNA and protein sequence information for human SMAD proteins are U59912 (SMAD 1), U59911 (SMAD2), U68019 (SMAD3), U44378 (SMAD4), U59913 (SMAD5), U59914 (SMAD6), AF015261 (SMAD7), and BCO11559 (SMAD9).
Ribosomal protein S6 kinases (RSK6) represent a family of serine/threonine kinases involved in activation of the transcription factor CREB. A
representative Genbank accession number providing DNA and protein sequence information for human Ribosomal protein S6 kinase alpha-6 is AF 184965.
Cyclooxygenase-2 (COX-2), also called Prostaglandin G/H synthase 2 (PTGS2), is involved in lipid metabolism and biosynthesis of prostanoids and is implicated in inflammatory disorders such as rheumatoid arthritis. A representative Genbank accession number providing DNA and protein sequence information for human COX-is AY462100.

EXAMPLES
Example 1: Inhibition of Gene Expression using Minimum Length Trigger RNAs Transfection of Minimum Length Trigger (mlt) RNA
m1tRNA constructs were chemically synthesized (Integrated DNA Technologies, Coralville, IA) and transfected into HEK293 cells (ATCC, Manassas, VA) using the Lipofectamine RNAiMAX (Invitrogen, Carlsbad, CA) reagent according to manufacturer's instructions. In brief, RNA was diluted to a 12X concentration and then combined with a 12X concentration of Lipofectamine RNAiMAX to complex. The RNA and transfection reagent were allowed to complex at room temperature for minutes and make a 6X concentration. While complexing, HEK293 cells were washed, trypsinized and counted. The cells were diluted to a concentration recommended by the manufacturer and previously described conditions which was at 1 x 105 cells/ml. When RNA had completed complexing with the RNAiMAX transfection reagent, 20u1 of the complexes were added to the appropriate well of the 96-well plate in triplicate. Cells were added to each well (100ul volume) to make the final cell count per well at 1 x 104 cells/well. The volume of cells diluted the 6X concentration of complex to 1X
which was equal to a concentration noted (between 10-0.05 nM). Cells were incubated for 24 or 48 hours under normal growth conditions.
After 24 or 48 hour incubation cells were lysed and gene silencing activity was measured using the QuantiGene assay (Panomics, Freemont, CA) which employs bDNA
hybridization technology. The assay was carried out according to manufacturer's instructions.

AG calculation AG was calculated using Mfold, available through the Mfold internet site (http://mfold.bioinfo.rpi.edu/cgi-bin/ma-forml.cgi). Methods for calculating AG are described in, and are incorporated by reference from, the following references: Zuker, M.
(2003) Nucleic Acids Res., 31(13):3406-15; Mathews, D. H., Sabina, J., Zuker, M. and Turner, D. H. (1999) J. Mol. Biol. 288:911-940; Mathews, D. H., Disney, M. D., Childs, J. L., Schroeder, S. J., Zuker, M., and Turner, D. H. (2004) Proc. Natl. Acad.
Sci.
101:7287-7292; Duan, S., Mathews, D. H., and Turner, D. H. (2006) Biochemistry 45:9819-9832; Wuchty, S., Fontana, W., Hofacker, I. L., and Schuster, P.
(1999) Biopolymers 49:145-165.

Example 2: Optimization of sd-rxRNA' '1 Molecules for Gene Silencing Asymmetric double stranded RNAi molecules, with minimal double stranded regions, were developed herein and are highly effective at gene silencing.
These molecules can contain a variety of chemical modifications on the sense and/or anti-sense strands, and can be conjugated to sterol-like compounds such as cholesterol.
Figs. 1-3 present schematics of RNAi molecules associated with the invention.
In the asymmetric molecules, which contain a sense and anti-sense strand, either of the strands can be the longer strand. Either strand can also contain a single-stranded region.
There can also be mismatches between the sense and anti-sense strand, as indicated in Fig. 1 D. Preferably, one end of the double-stranded molecule is either blunt-ended or contains a short overhang such as an overhang of one nucleotide. Fig.2 indicates types of chemical modifications applied to the sense and anti-sense strands including 2'F, 2'OMe, hydrophobic modifications and phosphorothioate modifications.
Preferably, the single stranded region of the molecule contains multiple phosphorothioate modifications.
Hydrophobicity of molecules can be increased using such compounds as 4-pyridyl at 5-U, 2-pyridyl at 5-U, isobutyl at 5-U and indolyl at 5-U (Fig. 2). Proteins or peptides such as protamine (or other Arg rich peptides), spermidine or other similar chemical structures can also be used to block duplex charge and facilitate cellular entry (Fig.
3). Increased hydrophobicity can be achieved through either covalent or non-covalent modifications.
Several positively charged chemicals, which might be used for polynucleotide charge blockage are depicted in Fig. 4.
Chemical modifications of polynucleotides, such as the guide strand in a duplex molecule, can facilitate RISC entry. Fig. 5 depicts single stranded polynucleotides, representing a guide strand in a duplex molecule, with a variety of chemical modifications including 2'd, 2'OMe, 2'F, hydrophobic modifications, phosphorothioate modifications, and attachment of conjugates such as "X" in Fig. 5, where X can be a small molecule with high affinity to a PAZ domain, or sterol-type entity.
Similarly, Fig.
6 depicts single stranded polynucleotides, representing a passenger strand in a duplex molecule, with proposed structural and chemical compositions of RISC substrate inhibitors. Combinations of chemical modifications can ensure efficient uptake and efficient binding to preloaded RISC complexes.
Fig. 7 depicts structures of polynucleotides with sterol-type molecules attached, where R represents a polycarbonic tail of 9 carbons or longer. Fig. 8 presents examples of naturally occurring phytosterols with a polycarbon chain longer than 8 attached at position 17. More than 250 different types of phytosterols are known. Fig. 9 presents examples of sterol-like structures with variations in the sizes of the polycarbon chains attached at position 17. Fig. 91 presents further examples of sterol-type molecules that can be used as a hydrophobic entity in place of cholesterol. Fig. 92 presents further examples of hydrophobic molecules that might be used as hydrophobic entities in place of cholesterol. Optimization of such characteristics can improve uptake properties of the RNAi molecules. Fig. 10 presents data adapted from Martins et al. (J Lipid Research), showing that the percentage of liver uptake and plasma clearance of lipid emulsions containing sterol-type molecules is directly affected by the size of the attached polycarbon chain at position 17. Fig. 11 depicts a micelle formed from a mixture of polynucleotides attached to hydrophobic conjugates and fatty acids. Fig. 12 describes how alteration in lipid composition can affect pharmacokinetic behavior and tissue distribution of hydrophobically modified and/or hydrophobically conjugated polynucleotides. In particular, the use of lipid mixtures that are enriched in linoleic acid and cardiolipin results in preferential uptake by cardiomyocites.
Fig. 13 depicts examples of RNAi constructs and controls designed to target MAP4K4 expression. Figs. 14 and 15 reveal that RNAi constructs with minimal duplex regions (such as duplex regions of approximately 13 nucleotides) are effective in mediating RNA silencing in cell culture. Parameters associated with these RNA
molecules are shown in Fig. 16. Fig. 17 depicts examples of RNAi constructs and controls designed to target SOD1 expression. Figs. 18 and 19 reveal the results of gene silencing experiments using these RNAi molecules to target SOD1 in cells. Fig.

presents a schematic indicating that RNA molecules with double stranded regions that are less than 10 nucleotides are not cleaved by Dicer, and Fig. 21 presents a schematic of a hypothetical RNAi model for RNA induced gene silencing.
The RNA molecules described herein were subject to a variety of chemical modifications on the sense and antisense strands, and the effects of such modifications were observed. RNAi molecules were synthesized and optimized through testing of a variety of modifications. In first generation optimization, the sense (passenger) and anti-sense (guide) strands of the sd-rxRNA", molecules were modified for example through incorporation of C and U 2'OMe modifications, 2'F modifications, phosphorothioate modifications, phosphorylation, and conjugation of cholesterol. Molecules were tested for inhibition of MAP4K4 expression in cells including HeLa, primary mouse hepatocytes and primary human hepatocytes through both lipid-mediated and passive uptake transfection.
Fig. 22 reveals that chemical modifications can enhance gene silencing. In particular, modifying the guide strand with 2'F UC modifications, and with a stretch of phosphorothioate modifications, combined with complete CU O'Me modification of the passenger strands, resulted in molecules that were highly effective in gene silencing.
The effect of chemical modification on in vitro efficacy in un-assisted delivery in HeLa cells was also examined. Fig. 23 reveals that compounds lacking any of 2'F, 2'OMe, a stretch of phosphorothioate modifications, or cholesterol conjugates, were completely inactive in passive uptake. A combination of all 4 types of chemical modifications, for example in compound 12386, was found to be highly effective in gene silencing.
Fig. 24 also shows the effectiveness of compound 12386 in gene silencing.
Optimization of the length of the oligonucleotide was also investigated. Figs.

and 26 reveal that oligonucleotides with a length of 21 nucleotides were more effective than oligonucleotides with a length of 25 nucleotides, indicating that reduction in the size of an RNA molecule can improve efficiency, potentially by assisting in its uptake.
Screening was also conducted to optimize the size of the duplex region of double stranded RNA molecules. Fig. 88 reveals that compounds with duplexes of 10 nucleotides were effective in inducing gene silencing. Positioning of the sense strand relative to the guide strand can also be critical for silencing gene expression (Fig. 89). In this assay, a blunt end was found to be most effective. 3' overhangs were tolerated, but 5' overhangs resulted in a complete loss of functionality. The guide strand can be effective in gene silencing when hybridized to a sense strand of varying lengths (Fig.
90). In this assay presented in Fig. 90, the compounds were introduced into HeLa cells via lipid mediated transfection.
The importance of phosphorothioate content of the RNA molecule for unassisted delivery was also investigated. Fig. 27 presents the results of a systematic screen that identified that the presence of at least 2-12 phosphorothioates in the guide strand as being highly advantageous for achieving uptake, with 4-8 being the preferred number.
Fig. 27 also shows that presence or absence of phosphorothioate modifications in the sense strand did not alter efficacy.
Figs. 28-29 reveal the effects of passive uptake of RNA compounds on gene silencing in primary mouse hepatocytes. nanoRNA molecules were found to be highly effective, especially at a concentration of 1 M (Fig. 28). Figs. 30 and 31 reveal that the RNA compounds associated with the invention were also effective in gene silencing following passive uptake in primary human hepatocytes. The cellular localization of the RNA molecules associated with the invention was examined and compared to the localization of Chol-siRNA (Alnylam) molecules, as shown in Figs. 32 and 33.
A summary of 1St generation sd-rxRNA molecules is presented in Fig. 21.
Chemical modifications were introduced into the RNA molecules, at least in part, to increase potency, such as through optimization of nucleotide length and phosphorothioate content, to reduce toxicity, such as through replacing 2'F
modifications on the guide strand with other modifications, to improve delivery such as by adding or conjugating the RNA molecules to linker and sterol modalities, and to improve the ease of manufacturing the RNA molecules. Fig. 35 presents schematic depictions of some of the chemical modifications that were screened in 1St generation molecules.
Parameters that were optimized for the guide strand included nucleotide length (e.g., 19, 21 and 25 nucleotides), phosphorothioate content (e.g., 0-18 phosphorothioate linkages) and replacement of 2'F groups with 2'OMe and 5 Me C or riboThymidine. Parameters that were optimized for the sense strand included nucleotide length (e.g., 11, 13 and 19 nucleotides), phosphorothioate content (e.g., 0-4 phosphorothioate linkages), and 2'OMe modifications. Fig. 36 summarizes parameters that were screened. For example, the nucleotide length and the phosphorothioate tail length were modified and screened for optimization, as were the additions of 2'OMe C and U modifications. Guide strand length and the length of the phosphorothioate modified stretch of nucleotides were found to influence efficacy (Figs. 37-38). Phosphorothioate modifications were tolerated in the guide strand and were found to influence passive uptake (Figs. 39-42).
Fig. 43 presents a schematic revealing guide strand chemical modifications that were screened. Figs. 44 and 45 reveal that 2'OMe modifications were tolerated in the 3' end of the guide strand. In particular, 2'OMe modifications in positions 1 and were well tolerated. The 2'OMe modifications in the seed area were tolerated but resulted in slight reduction of efficacy. Ribo- modifications in the seed were also well tolerated. These data indicate that the molecules associated with the invention offer the significant advantage of having reduced or no 2'F modification content. This is advantageous because 2'F modifications are thought to generate toxicity in vivo. In some instances, a complete substitution of 2'F modifications with 2'OMe was found to lead to some reduction in potency. However, the 2' OMe substituted molecules were still very active. A molecule with 50% reduction in 2'F content (including at positions 11, 16-18 which were changed to 2'OMe modifications), was found to have comparable efficacy to a compound with complete 2'F C and U modification. 2'OMe modification in position was found in some instances to reduce efficacy, although this can be at least partially compensated by 2'OMe modification in position 1 (with chemical phosphate).
In some instances, 5 Me C and/or ribothymidine substitution for 2'F
modifications led to a reduction in passive uptake efficacy, but increased potency in lipid mediated transfections compared to 2'F modifications. Optimization results for lipid mediated transfection were not necessarily the same as for passive uptake.
Modifications to the sense strand were also developed and tested, as depicted in Fig. 46. Fig. 47 reveals that in some instances, a sense strand length between bases was found to be optimal. For the molecules tested in Fig. 47, an increase in the sense strand length resulted in reduction of passive uptake, however an increase in sense strand length may be tolerated for some compounds. Fig. 47 also reveals that LNA
modification of the sense strand demonstrated similar efficacy to non-LNA
containing compounds. In general, the addition of LNA or other thermodynamically stabilizing compounds has been found to be beneficial, in some instances resulting in converting non-functional sequences to functional sequences. Fig. 48 also presents data on sense strand length optimization, while Fig. 49 shows that phosphorothioate modification of the sense strand is not required for passive uptake.
Based on the above-described optimization experiments, 2"d generation RNA
molecules were developed. As shown in Fig. 50, these molecules contained reduced phosphorothioate modification content and reduced 2'F modification content, relative to 1St generation RNA molecules. Significantly, these RNA molecules exhibit spontaneous cellular uptake and efficacy without a delivery vehicle (Fig. 51). These molecules can achieve self-delivery (i.e., with no transfection reagent) and following self-delivery can exhibit nanomolar activity in cell culture. These molecules can also be delivered using lipid-mediated transfection, and exhibit picomolar activity levels following transfection.
Significantly, these molecules exhibit highly efficient uptake, 95% by most cells in cell culture, and are stable for more than three days in the presence of 100% human serum.
These molecules are also highly specific and exhibit little or no immune induction. Figs.
52 and 53 reveal the significance of chemical modifications and the configurations of such modifications in influencing the properties of the RNA molecules associated with the invention.
Linker chemistry was also tested in conjunction with the RNA molecules associated with the invention. As depicted in Fig. 54, 2nd generation RNA
molecules were synthesized with sterol-type molecules attached through TEG and amino caproic acid linkers. Both linkers showed identical potency. This functionality of the RNA
molecules, independent of linker chemistry offers additional advantages in terms of scale up and synthesis and demonstrates that the mechanism of function of these RNA
molecules is very different from other previously described RNA molecules.
Stability of the chemically modified sd-rxRNA molecules described herein in human serum is shown in Fig. 55 in comparison to unmodified RNA. The duplex molecules were incubated in 75% serum at 37 C for the indicated periods of time. The level of degradation was determined by running the samples on non-denaturing gels and staining with SYBGR.
Figs. 56 and 57 present data on cellular uptake of the sd-rxRNA molecules.
Fig.
56 shows that minimizing the length of the RNA molecule is importance for cellular uptake, while Fig. 57 presents data showing target gene silencing after spontaneous cellular uptake in mouse PEC-derived macrophages. Fig. 58 demonstrates spontaneous uptake and target gene silencing in primary cells. Fig. 59 shows the results of delivery of sd-rxRNA molecules associated with the invention to RPE cells with no formulation.
Imaging with Hoechst and DY547 reveals the clear presence of a signal representing the RNA molecule in the sd-rxRNA sample, while no signal is detectable in the other samples including the samples competing a competing conjugate, an rxRNA, and an untransfected control. Fig. 60 reveals silencing of target gene expression in RPE cells treated with sd-rxRNA molecules associated with the invention following 24-48 hours without any transfection formulation.
Fig. 61 shows further optimization of the chemical/structural composition of sd-rxRNA compounds. In some instances, preferred properties included an antisense strand that was 17-21 nucleotides long, a sense strand that was 10-15 nucleotides long, phosphorothioate modification of 2-12 nucleotides within the single stranded region of the molecule, preferentially phosphorothioate modification of 6-8 nucleotides within the single stranded region, and 2'OMe modification at the majority of positions within the sense strand, with or without phosphorothioate modification. Any linker chemistry can be used to attach the hydrophobic moiety, such as cholesterol, to the 3' end of the sense strand. Version GIIb molecules, as shown in Fig. 61, have no 2'F
modifications.
Significantly, there is was no impact on efficacy in these molecules.
FIG. 62 demonstrates the superior performance of sd-rxRNA compounds to compared to compounds published by Wolfrum et. al. Nature Biotech, 2007.
Both generation I and II compounds (GI and GIIa) developed herein show great efficacy in reducing target gene expression. By contrast, when the chemistry described in Wolfrum et al. (all oligos contain cholesterol conjugated to the 3' end of the sense strand) was applied to the same sequence in a context of conventional siRNA (19 bp duplex with two overhang) the compound was practically inactive. These data emphasize the significance of the combination of chemical modifications and assymetrical molecules described herein, producing highly effective RNA compounds.
Fig. 63 shows localization of sd-rxRNA molecules developed herein compared to localization of other RNA molecules such as those described in Soutschek et al. (2004) Nature, 432:173. sd-rxRNA molecules accumulate inside the cells whereas competing conjugate RNAs accumulate on the surface of cells. Significantly, Fig. 64 shows that sd-rxRNA molecules, but not competitor molecules such as those described in Soutschek et al. are internalized within minutes. Fig. 65 compares localization of sd-rxRNA
molecules compared to regular siRNA-cholesterol, as described in Soutschek et al. A
signal representing the RNA molecule is clearly detected for the sd-rxRNA
molecule in tissue culture RPE cells, following local delivery to compromised skin, and following systemic delivery where uptake to the liver is seen. In each case, no signal is detected for the regular siRNA-cholesterol molecule. The sd-rxRNA molecule thus has drastically better cellular and tissue uptake characteristics when compared to conventional cholesterol conjugated siRNAs such as those described in Soutschek et al.
The level of uptake is at least order of magnitude higher and is due at least in part to the unique combination of chemistries and conjugated structure. Superior delivery of sd-rxRNA relative to previously described RNA molecules is also demonstrated in Figs. 66 and 67.

Based on the analysis of 2"d generation RNA molecules associated with the invention, a screen was performed to identify functional molecules for targeting the SPP1/PPIB gene. As revealed in Fig. 68, several effective molecules were identified, with 14131 being the most effective. The compounds were added to A-549 cells and then the level of SPP1/ PPIB ratio was determined by B-DNA after 48 hours.
Fig. 69 reveals efficient cellular uptake of sd-rxRNA within minutes of exposure.
This is a unique characteristics of these molecules, not observed with any other RNAi compounds. Compounds described in Soutschek et al. were used as negative controls.
Fig. 70 reveals that the uptake and gene silencing of the sd-rxRNA is effective in multiple different cell types including SH-SY5Y neuroblastoma derived cells, (retinal pigment epithelium) cells, primary hepatocytes, and primary macrophages. In each case silencing was confirmed by looking at target gene expression by a Branched DNA assay.
Fig. 70 reveals that sd-rxRNA is active in the presence or absence of serum.
While a slight reduction in efficacy (2-5 fold) was observed in the presence of serum, this small reduction in efficacy in the presence of serum differentiate the sd-rxRNA
molecules from previously described molecules which exhibited a larger reduction in efficacy in the presence of serum. This demonstrated level of efficacy in the presence of serum creates a foundation for in vivo efficacy.
Fig. 72 reveals efficient tissue penetration and cellular uptake upon single intradermal injection. This data indicates the potential of the sd-rxRNA
compounds described herein for silencing genes in any dermatology applications, and also represents a model for local delivery of sd-rxRNA compounds. Fig. 73 also demonstrates efficient cellular uptake and in vivo silencing with sd-rxRNA following intradermal injection.
Silencing is determined as the level of MAP4K4 knockdown in several individual biopsies taken from the site of injection as compared to biopsies taken from a site injected with a negative control. Fig. 74 reveals that sd-rxRNA compounds has improved blood clearance and induced effective gene silencing in vivo in the liver upon systemic administration. In comparison to the RNA molecules described by Soutschek et al., the level of liver uptake at identical dose level is at least 50 fold higher with the sd-rxRNA molecules. The uptake results in productive silencing. sd-rxRNA
compounds are also characterized by improved blood clearance kinetics.
The effect of 5-Methly C modifications was also examined. Fig. 75 demonstrates that the presence of 5-Methyl C in an RNAi molecule resulted in increased potency in lipid mediated transfection. This suggests that hydrophobic modification of Cs and Us in an RNAi molecule can be beneficial. These types of modifications can also be used in the context 2' ribose modified bases to ensure optimal stability and efficacy.
Fig. 76 presents data showing that incorporation of 5-Methyl C and/or ribothymidine in the guide strand can in some instances reduce efficacy.
Fig. 77 reveals that sd-rxRNA molecules are more effective than competitor molecules such as molecules described in Soutschek et al., in systemic delivery to the liver. A signal representing the RNA molecule is clearly visible in the sample containing sd-rxRNA, while no signal representing the RNA molecule is visible in the sample containing the competitor RNA molecule.
The addition of hydrophobic conjugates to the sd-rxRNA molecules was also explored (Figs 78-83). FIG. 78 presents schematics demonstrating 5-uridyl modifications with improved hydrophobicity characteristics. Incorporation of such modifications into sd-rxRNA compounds can increase cellular and tissue uptake properties. FIG. 78B presents a new type of RNAi compound modification which can be applied to compounds to improve cellular uptake and pharmacokinetic behavior.
Significantly, this type of modification, when applied to sd-rxRNA compounds, may contribute to making such compounds orally available. FIG. 79 presents schematics revealing the structures of synthesized modified sterol-type molecules, where the length and structure of the C17 attached tail is modified. Without wishing to be bound by any theory, the length of the C 17 attached tail may contribute to improving in vitro and in vivo efficacy of sd-rxRNA compounds.
FIG. 80 presents a schematic demonstrating the lithocholic acid route to long side chain cholesterols. FIG. 81 presents a schematic demonstrating a route to 5-uridyl phosphoramidite synthesis. FIG. 82 presents a schematic demonstrating synthesis of tri-functional hydroxyprolinol linker for 3'-cholesterol attachment. FIG. 83 presents a schematic demonstrating synthesis of solid support for the manufacture of a shorter asymmetric RNAi compound strand.

A screen was conducted to identify compounds that could effectively silence expression of SPP1 (Osteopontin). Compounds targeting SPP1 were added to A549 cells (using passive transfection), and the level of SPP1 expression was evaluated at 48 hours.
Several novel compounds effective in SPP 1 silencing were identified.
Compounds that were effective in silencing of SPP1 included 14116, 14121, 14131, 14134, 14139, 14149, and 14152 (Figs. 84-86). The most potent compound in this assay was 14131 (Fig. 84).
The efficacy of these sd-rxRNA compounds in silencing SPP 1 expression was independently validated (Fig. 85).
A similar screen was conducted to identify compounds that could effectively silence expression of CTGF (Figs. 86-87). Compounds that were effective in silencing of CTGF included 14017, 14013, 14016, 14022, 14025, 14027.

Methods Transfection of sd-rxRNA""
Lipid mediated transfection sd-rxRNAOe" constructs were chemically synthesized (Dharmacon, Lafayette, CO) and transfected into HEK293 cells (ATCC, Manassas, VA) using Lipofectamine RNAiMAX (Invitrogen, Carlsbad, CA) according to the manufacturer's instructions. In brief, RNA was diluted to a 12X concentration in Opti-MEMO 1 Reduced Serum Media (Invitrogen, Carlsbad, California) and then combined with a 12X concentration of Lipofectamine RNAiMAX. The RNA and transfection reagent were allowed to complex at room temperature for 20 minutes and make a 6X concentration. While complexing, HEK293 cells were washed, trypsinized and counted. The cells were diluted to a concentration recommended by the manufacturer and previously described of lx cells/ml. When RNA had completed complexing with the RNAiMAX transfection reagent, 20 ul of the complexes were added to the appropriate well of the 96-well plate in triplicate. Cells were added to each well (100 ul volume) to make the final cell count per well 1 x 104 cells/well. The volume of cells diluted the 6X concentration of complex to 1X (between 10-0.05 nM). Cells were incubated for 24 or 48 hours under normal growth conditions. After 24 or 48 hour incubation, cells were lysed and gene silencing activity was measured using the QuantiGene assay (Panomics, Freemont, CA) which employs bDNA hybridization technology. The assay was carried out according to manufacturer's instructions.

Passive uptake transfection sd-rxRNAano constructs were chemically synthesized (Dharmacon, Lafayette, CO). 24 hours prior to transfection, HeLa cells (ATCC, Manassas, VA) were plated at 1x104 cells/well in a 96 well plate under normal growth conditions (DMEM, 10 %
FBS
and I% Penicillin and Streptomycin). Prior to transfection of HeLa cells, sd-rxRNAnano were diluted to a final concentration of 0.01 uM to 1 uM in Accell siRNA
Delivery Media (Dharmacon, Lafayette, CO). Normal growth media was aspirated off cells and 100 uL of Accell Delivery media containing the appropriate concentration of sd-rxRNAnano was applied to the cells. 48 hours post transfection, delivery media was aspirated off the cells and normal growth media was applied to cells for an additional 24 hours.
After 48 or 72 hour incubation, cells were lysed and gene.silencing activity was measured using the QuantiGene assay (Panomics, Freemont, CA) according to manufacturer's instructions.

ID Number Oligo Accession Gene Name Gene Number number Symbol APOB-10167- 12138 NM 000384 Apolipoprotein B (including Ag(x) antigen) APOB

APOB-10167- 12139 NM 000384 Apolipoprotein B (including Ag(x) antigen) APOB

MAP4K4-2931- 12266 NM 004834 Mitogen-Activated Protein Kinase Kinase Kinase Kinase 4 MAP4K4 13-12266 - (MAP4K4), transcript variant 1 MAP4K4-2931- 12293 Protein Kinase Kinase Kinase Kinase 4 16-12293 93 NM-004834 (MAP4K4), transcript variant 1 MAP4K4 MAP4K4-2931- 12383 NM 004834 Mitogen-Activated Protein Kinase Kinase Kinase Kinase 4 MAP4K4 16-12383 - (MAP4K4), transcript variant 1 MAP4K4-2931- 12384 NM 004834 Mitogen-Activated Protein Kinase Kinase Kinase Kinase 4 MAP4K4 16-12384 - (MAP4K4), transcript variant 1 MAP4K4-2931- 12385 NM Mitogen-Activated Protein Kinase Kinase Kinase Kinase 4 16-12385 -004834 (MAP4K4), transcript variant 1 MAP4K4-2931- 12386 NM 004834 Mitogen-Activated Protein Kinase Kinase Kinase Kinase 4 MAP4K4 16-12386 - (MAP4K4), transcript variant 1 MAP4K4-2931- 12387 Protein Kinase Kinase Kinase Kinase 4 MAP4K4 16-12387 387 NM -004834 (MAP4K4), transcript variant 1 MAP4K4-2931- 12388 NM 004834 Mitogen-Activated Protein Kinase Kinase Kinase Kinase 4 MAP4K4 15-12388 - (MAP4K4), transcript variant 1 MAP4K4-2931- 12432 NM 004834 Mitogen-Activated Protein Kinase Kinase Kinase Kinase 4 MAP4K4 13-12432 - (MAP4K4), transcript variant 1 MAP4K4-2931- 12266. NM 004834 Mitogen-Activated Protein Kinase Kinase Kinase Kinase 4 MAP4K4 13-12266.2 2 - (MAP4K4), transcript variant 1 APOB--21- 12434 NM 000384 Apolipoprotein B (including Ag(x) antigen) APOB

APOB--21- 12435 NM 000384 Apolipoprotein B (including Ag(x) antigen) APOB

MAP4K4-2931- 12451 Protein Kinase Kinase Kinase Kinase 4 MAP4K4 16-12451 51 NM - 004834 (MAP4K4), transcript variant 1 MAP4K4-2931- 12452 NM 004834 Protein Kinase Kinase Kinase Kinase 4 MAP4K4 16-12452 -34 (MAP4K4), transcript variant 1 MAP4K4-2931- 12453 NM 004834 Protein Kinase Kinase Kinase Kinase 4 MAP4K4 16-12453 -834 (MAP4K4), transcript variant 1 MAP4K4-2931- 12454 NM 004834 Protein Kinase Kinase Kinase Kinase 4 MAP4K4 17-12454 -4 (MAP4K4), transcript variant 1 MAP4K4-2931- 12455 Protein Kinase Kinase Kinase Kinase 4 MAP4K4 17-12455 55 NM - 004834 (MAP4K4), transcript variant 1 ID Accession Gene Number Number number Gene Name Symbol MAP4K4-2931- 12456 NM 004834 Protein Kinase Kinase Kinase Kinase 4 MAP4K4 19-12456 _834 (MAP4K4), transcript variant 1 APOB-10167- 12505 NM 000384 Apolipoprotein B (including Ag(x) antigen) APOB

APOB-10167- 12506 NM 000384 Apolipoprotein B (including Ag(x) antigen) APOB

MAP4K4-2931- 12539 NM 004834 Mitogen-Activated Protein Kinase Kinase Kinase Kinase 4 MAP4K4 16-12539 - (MAP4K4), transcript variant 1 APOB-10167- 12505. NM 000384 Apolipoprotein B (including Ag(x) antigen) APOB
21-12505.2 2 -APOB-10167- 12506. NM 000384 Apolipoprotein B (including Ag(x) antigen) APOB
21-12506.2 2 -MAP4K4-2931- 12386. NM 004834 Protein Kinase Kinase Kinase Kinase 4 MAP4K4 16-12386.2 2 -34 (MAP4K4), transcript variant 1 MAP4K4-2931- 12815 NM 004834 Mitogen-Activated Protein Kinase Kinase Kinase Kinase 4 MAP4K4 13-12815 - (MAP4K4), transcript variant 1 APOB--13- 12957 NM 000384 Apolipoprotein B (including Ag(x) antigen) APOB

MAP4K4--16- 12983 Protein Kinase Kinase Kinase Kinase 4 MAP4K4 12983 983 (MAP4K4), transcript variant 1 MAP4K4--16- 12984 Protein Kinase Kinase Kinase Kinase 4 MAP4K4 12984 984 (MAP4K4), transcript variant 1 MAP4K4--16- Mitogen-Activated Protein Kinase Kinase Kinase Kinase 4 12985 12985 (MAP4K4), transcript variant 1 MAP4K4 MAP4K4--16- Mitogen-Activated Protein Kinase Kinase Kinase Kinase 4 12986 12986 (MAP4K4), transcript variant 1 MAP4K4 MAP4K4--16- 12987 Mitogen-Activated Protein Kinase Kinase Kinase Kinase 4 12987 (MAP4K4), transcript variant 1 MAP4K4--16- Mitogen-Activated Protein Kinase Kinase Kinase Kinase 4 12988 12988 (MAP4K4), transcript variant 1 MAP4K4 MAP4K4--16- Mitogen-Activated Protein Kinase Kinase Kinase Kinase 4 12989 12989 (MAP4K4), transcript variant 1 MAP4K4 MAP4K4--16- 12990 Protein Kinase Kinase Kinase Kinase 4 MAP4K4 12990 990 (MAP4K4), transcript variant 1 ID Number Oligo Accession Gene Name Gene Number number Symbol MAP4K4--16- 12991 Mitogen-Activated Protein Kinase Kinase Kinase Kinase 4 12991 (MAP4K4), transcript variant 1 MAP4K4 MAP4K4--16- Mitogen-Activated Protein Kinase Kinase Kinase Kinase 4 12992 12992 (MAP4K4), transcript variant 1 MAP4K4 MAP4K4--16- Mitogen-Activated Protein Kinase Kinase Kinase Kinase 4 12993 12993 (MAP4K4), transcript variant 1 MAP4K4 MAP4K4--16- Mitogen-Activated Protein Kinase Kinase Kinase Kinase 4 12994 12994 (MAP4K4), transcript variant 1 MAP4K4 MAP4K4--16- Mitogen-Activated Protein Kinase Kinase Kinase Kinase 4 12995 12995 (MAP4K4), transcript variant 1 MAP4K4 MAP4K4-2931- 13012 NM 004834 Protein Kinase Kinase Kinase Kinase 4 MAP4K4 19-13012 _34 (MAP4K4), transcript variant 1 MAP4K4-2931- 13016 NM 004834 Mitogen-Activated Protein Kinase Kinase Kinase Kinase 4 MAP4K4 19-13016 - (MAP4K4), transcript variant 1 PPIB--13- 13021 NM 000942 Peptidylprolyl Isomerase B (cyclophilin B) PPIB

pGL3-1172- 13038 U47296 Cloning vector pGL3-Control pGL3 pGL3-1172- 13040 U47296 Cloning vector pGL3-Control pGL3 SOD1-530-13- 13090 NM 000454 Dismutase 1, soluble (amyotrophic lateral SOD1 13090 _54 sclerosis 1 (adult)) SOD1-523-13- 13091 NM 000454 Dismutase 1, soluble (amyotrophic lateral SOD1 13091 _54 sclerosis 1 (adult)) SOD1-535-13- 13092 NM 000454 Dismutase 1, soluble (amyotrophic lateral SOD1 13092 _54 sclerosis 1 (adult)) SOD1-536-13- 13093 NM 000454 Dismutase 1, soluble (amyotrophic lateral SOD1 13093 _54 sclerosis 1 (adult)) SOD1-396-13- 13094 NM 000454 Dismutase 1, soluble (amyotrophic lateral SOD1 13094 _54 sclerosis 1 (adult)) SOD1-385-13 13095 NM 000454 Dismutase 1, soluble (amyotrophic lateral SOD1 13095 -54 sclerosis 1 (adult)) SOD1-195-13 13096 NM 000454 Dismutase 1, soluble (amyotrophic lateral SOD1 13096 -54 sclerosis 1 (adult)) APOB-4314- 13115 NM 000384 Apolipoprotein B (including Ag(x) antigen) APOB

APOB-3384- 13116 NM 000384 Apolipoprotein B (including Ag(x) antigen) APOB

ID Number Oligo Accession Gene Name Gene Number number Symbol APOB-3547- 13117 NM 000384 Apolipoprotein B (including Ag(x) antigen) APOB

APOB-4318- 13118 NM 000384 Apolipoprotein B (including Ag(x) antigen) APOB

APOB-3741- 13119 NM 000384 Apolipoprotein B (including Ag(x) antigen) APOB

PPIB--16- 13136 NM 000942 Peptidylprolyl Isomerase B (cyclophilin B) PPIB

APOB-4314- 13154 NM 000384 Apolipoprotein B (including Ag(x) antigen) APOB

APOB-3547- 13155 NM 000384 Apolipoprotein B (including Ag(x) antigen) APOB

APOB-4318- 13157 NM 000384 Apolipoprotein B (including Ag(x) antigen) APOB

APOB-3741- 13158 NM 000384 Apolipoprotein B (including Ag(x) antigen) APOB

APOB--13- 13159 NM 000384 Apolipoprotein B (including Ag(x) antigen) APOB

APOB--15- 13160 NM 000384 Apolipoprotein B (including Ag(x) antigen) APOB

SOD1-530-16- 13163 Dismutase 1, soluble (amyotrophic lateral 13163 163 NM -000454 sclerosis 1 (adult)) SOD1 SOD1-523-16- 13164 NM 000454 Dismutase 1, soluble (amyotrophic lateral SOD1 13164 -54 sclerosis 1 (adult)) SOD1-535-16- 13165 Dismutase 1, soluble (amyotrophic lateral 13165 65 NM _000454 sclerosis 1 (adult)) SOD1 SOD1-536-16- 13166 NM 000454 Dismutase 1, soluble (amyotrophic lateral SOD1 13166 -54 sclerosis 1 (adult)) SOD1-396-16- 13167 Dismutase 1, soluble (amyotrophic lateral SOD1 13167 167 NM -000454 sclerosis 1 (adult)) SOD1-385-16- 13168 NM 000454 Dismutase 1, soluble (amyotrophic lateral SOD1 13168 _54 sclerosis 1 (adult)) SOD1-195-16 13169 NM 000454 Dismutase 1, soluble (amyotrophic lateral SOD1 13169 -54 sclerosis 1 (adult)) pGL3-1172- 13170 U47296 Cloning vector pGL3-Control pGL3 pGL3-1172- 13171 U47296 Cloning vector pGL3-Control pGL3 MAP4k4-2931- 13189 NM 004 Mitogen-Activated Protein Kinase Kinase Kinase Kinase 4 MAP4k4 19-13189 -834 (MAP4K4), transcript variant 1 ID Number Oligo Accession Gene Name Gene Number number Symbol CTGF-1222- 13190 NM_001901. connective tissue growth factor CTGF

CTGF-813-13- 13192 NM-001901. connective tissue growth factor CTGF

CTGF-747-13- 13194 NM-001901. connective tissue growth factor CTGF

CTGF-817-13- 13196 NM-001901. connective tissue growth factor CTGF

CTGF-1174- 13198 NM-001901. connective tissue growth factor CTGF

CTGF-1005- 13200 NM-001901. connective tissue growth factor CTGF

CTGF-814-13- 13202 NM-001901. connective tissue growth factor CTGF

CTGF-816-13- 13204 NM-001901. connective tissue growth factor CTGF

CTGF-1001- 13206 Nt~__001901. connective tissue growth factor CTGF

CTGF-1173- 13208 NM-001901. connective tissue growth factor CTGF

CTGF-749-13- 13210 NM_001901. connective tissue growth factor CTGF

CTGF-792-13- 13212 NM_001901. connective tissue growth factor CTGF

CTGF-1162- 13214 NM_001901. connective tissue growth factor CTGF

CTGF-811-13- 13216 NM_001901. connective tissue growth factor CTGF

CTGF-797-13- 13218 NM_001901. connective tissue growth factor CTGF

CTGF-1175- 13220 NM-001901. connective tissue growth factor CTGF

CTGF-1172- 13222 NM_001901. connective tissue growth factor CTGF

CTGF-1177- 13224 -001901. connective tissue growth factor CTGF

CTGF-1176- 13226 NM_001901. connective tissue growth factor CTGF

CTGF-812-13- 13228 NM_001901. connective tissue growth factor CTGF

ID Number Oligo Accession Gene Name Gene Number number Symbol CTGF-745-13- 13230 NM_001901. connective tissue growth factor CTGF

CTGF-1230- 13232 NM _001901. connective tissue growth factor CTGF

CTGF-920-13- 13234 NM-001901. connective tissue growth factor CTGF

CTGF-679-13- 13236 NM_001901. connective tissue growth factor CTGF

CTGF-992-13- 13238 NM_001901. connective tissue growth factor CTGF

CTGF-1045- 13240 NM-001901. connective tissue growth factor CTGF

CTGF-1231- 13242 NM_001901. connective tissue growth factor CTGF

CTGF-991-13- 13244 NM_001901. connective tissue growth factor CTGF

CTGF-998-13- 13246 NM _001901. connective tissue growth factor CTGF

CTGF-1049- 13248 NM _001901. connective tissue growth factor CTGF

CTGF-1044- 13250 NM-001901. connective tissue growth factor CTGF

CTGF-1327- 13252 NM-001901. connective tissue growth factor CTGF

CTGF-1196- 13254 NM_001901. connective tissue growth factor CTGF

CTGF-562-13- 13256 NM_001901. connective tissue growth factor CTGF

CTGF-752-13- 13258 NM-001901. connective tissue growth factor CTGF

CTGF-994-13- 13260 NM-001901. connective tissue growth factor CTGF

CTGF-1040- 13262 NM_001901. connective tissue growth factor CTGF

CTGF-1984- 13264 NM_001901. connective tissue growth factor CTGF

CTGF-2195- 13266 NM_001901. connective tissue growth factor CTGF

CTGF-2043- 13268 NM_001901. connective tissue growth factor CTGF

ID Number Oligo Accession Gene Name Gene Number number Symbol CTGF-1892- 13270 NM_001901. connective tissue growth factor CTGF

CTGF-1567- 13272 NM-001901. connective tissue growth factor CTGF

CTGF-1780- 13274 M001901. connective tissue growth factor CTGF

CTGF-2162- 13276 NM-001901. connective tissue growth factor CTGF

CTGF-1034- 13278 NM-001901. connective tissue growth factor CTGF

CTGF-2264- 13280 NM-001901. connective tissue growth factor CTGF

CTGF-1032- 13282 NM-001901. connective tissue growth factor CTGF

CTGF-1535- 13284 NM-001901. connective tissue growth factor CTGF

CTGF-1694- 13286 2 NM-001901.
13-13286 connective tissue growth factor CTGF
CTGF-1588- 13288 NM-001901. connective tissue growth factor CTGF

CTGF-928-13- 13290 NM_001901. connective tissue growth factor CTGF

CTGF-1133- 13292 NM_001901. connective tissue growth factor CTGF

CTGF-912-13- 13294 NM-001901. connective tissue growth factor CTGF

CTGF-753-13- 13296 NM_001901. connective tissue growth factor CTGF

CTGF-918-13- 13298 NM_001901. connective tissue growth factor CTGF

CTGF-744-13- 13300 NM-001901. connective tissue growth factor CTGF

CTGF-466-13- 13302 NM_001901. connective tissue growth factor CTGF

CTGF-917-13- 13304 NM_001901. connective tissue growth factor CTGF

CTGF-1038- 13306 NM _001901. connective tissue growth factor CTGF

CTGF-1048- 13308 NM-001901. connective tissue growth factor CTGF

ID Number Oligo Accession Gene Name Gene Number number Symbol CTGF-1235- 13310 NM-001901. connective tissue growth factor CTGF

CTGF-868-13- 13312 N-001901. connective tissue growth factor CTGF

CTGF-1131- 13314 NM-001901. connective tissue growth factor CTGF

CTGF-1043- 13316 NM_001901. connective tissue growth factor CTGF

CTGF-751-13- 13318 NM-001901. connective tissue growth factor CTGF

136133207 13320 NM-001901. connective tissue growth factor CTGF 2 CTGF-867-13- 13322 NM-001901. connective tissue growth factor CTGF

CTGF-1128- 13324 NM-001901. connective tissue growth factor CTGF

CTGF-756-13- 13326 NM-001901. connective tissue growth factor CTGF

CTGF-1234- 13328 -001901. connective tissue growth factor CTGF

CTGF-916-13- 13330 NM -001901. connective tissue growth factor CTGF

CTGF-925-13- 13332 NM-001901. connective tissue growth factor CTGF

CTGF-1225- 13334 NM_001901. connective tissue growth factor CTGF

CTGF-445-13- 13336 NM-001901. connective tissue growth factor CTGF

CTGF-446-13- 13338 NM-001901. connective tissue growth factor CTGF

CTGF-913-13- 13340 NM-001901. connective tissue growth factor CTGF

CTGF-997-13- 13342 NM-001901. connective tissue growth factor CTGF

CTGF-277-13- 13344 NM-001901. connective tissue growth factor CTGF

CTGF-1052- 13346 NM_001901. connective tissue growth factor CTGF

CTGF-887-13- 13348 NM_001901. connective tissue growth factor CTGF

ID Number Oligo Accession Gene Name Gene Number number Symbol CTGF-914-13- 13350 N-001901. connective tissue growth factor CTGF

CTGF-1039- 13352 NM_001901. connective tissue growth factor CTGF

CTGF-754-13- 13354 N-001901. connective tissue growth factor CTGF

CTGF-1130- 13356 M-001901. connective tissue growth factor CTGF

CTGF-919-13- 13358 NM-001901. connective tissue growth factor CTGF

CTGF-922-13- 13360 NM_001901. connective tissue growth factor CTGF

CTGF-746-13- 13362 NM_001901. connective tissue growth factor CTGF

CTGF-993-13- 13364 NM_001901. connective tissue growth factor CTGF

CTGF-825-13- 13366 NM -001901. connective tissue growth factor CTGF

CTGF-926-13- 13368 NM-001901. connective tissue growth factor CTGF

CTGF-923-13- 13370 NM _001901. connective tissue growth factor CTGF

CTGF-866-13- 13372 NM_001901. connective tissue growth factor CTGF

CTGF-563-13- 13374 NM _001901. connective tissue growth factor CTGF

CTGF-823-13- 13376 NM-001901. connective tissue growth factor CTGF

CTGF-1233- 13378 NM-001901. connective tissue growth factor CTGF

CTGF-924-13- 13380 NM_001901. connective tissue growth factor CTGF

CTGF-921-13- 13382 NM-001901. connective tissue growth factor CTGF

CTGF-443-13- 13384 NM-001901. connective tissue growth factor CTGF

CTGF-1041- 13386 NM-001901. connective tissue growth factor CTGF

CTGF-1042- 13388 NM_001901. connective tissue growth factor CTGF

2D Number Oligo Accession Gene Name Gene Number number Symbol CTGF-755-13- 13390 NM_001901. connective tissue growth factor CTGF

CTGF-467-13- 13392 NM_001901. connective tissue growth factor CTGF

CTGF-995-13- 13394 NM_001901. connective tissue growth factor CTGF

CTGF-927-13- 13396 NM-001901. connective tissue growth factor CTGF

SPP1-1025- 13398 NM_000582. Osteopontin SPP1 SPP1-1049- 13400 NM_000582. Osteopontin SPP1 SPP1-1051- 13402 Nb~__000582. Osteopontin SPP1 SPP1-1048- 13404 NM_000582. Osteopontin SPP1 SPP1-1050- 13406 NM-000582. Osteopontin SPP1 SPP1-1047- 13408 NM_000582. Osteopontin SPP1 SPP1-800-13- 13410 NM_000582. Osteopontin SPP1 SPP1-492-13- 13412 NM_000582. Osteopontin SPP1 SPP1-612-13- 13414 NM_000582. Osteopontin SPP1 SPP1-481-13- 13416 NM-000582. Osteopontin SPP1 SPP1-614-13- 13418 NM_000582. Osteopontin SPP1 SPP1-951-13- 13420 NM_000582. Osteopontin SPP1 SPP1-482-13- 13422 -000582. Osteopontin SPP1 SPP1-856-13- 13424 NM_000582. Osteopontin SPP1 SPP1-857-13- 13426 NM-000582. Osteopontin SPP1 SPP1-365-13- 13428 NM_000582. Osteopontin SPP1 ID Number Oligo Accession Gene Name Gene Number number Symbol SPP1-359-13- 13430 NM_000582. Osteopontin SPP1 SPP1-357-13- 13432 NM_000582. Osteopontin SPP1 SPP1-858-13- 13434 NM-000582. Osteopontin SPP1 SPP1-1012- 13436 NM-000582. Osteopontin SPP1 SPP1-1014- 13438 NM-000582. Osteopontin SPP1 SPP1-356-13- 13440 NM-000582. Osteopontin SPP1 SPP1-368-13- 13442 NM-000582. Osteopontin SPP1 SPP1-1011- 13444 NM-000582. Osteopontin SPP1 SPP1-754-13- 13446 NM-000582. Osteopontin SPP1 SPP1-1021- 13448 NM-000582. Osteopontin SPP1 SPP1-1330- 13450 NM-000582. Osteopontin SPP1 SPP1-346-13- 13452 NM_000582. Osteopontin SPP1 SPP1-869-13- 13454 NM-000582. Osteopontin SPP1 SPP1-701-13- 13456 NM_000582. Osteopontin SPP1 SPP1-896-13- 13458 NM-000582. Osteopontin SPP1 SPP1-1035- 13460 NM -000582. Osteopontin SPP1 SPP1-1170- 13462 NM_000582. Osteopontin SPP1 SPP1-1282- 13464 NM_000582. Osteopontin SPP1 SPP1-1537- 13466 NM_000582. Osteopontin SPP1 SPP1-692-13- 13468 NM-000582. Osteopontin SPP1 ID Number Oligo Accession Gene Name Gene Number number Symbol SPP1-840-13- 13470 NM-000582. Osteopontin SPP1 SPP1-1163- 13472 NM-000582. Osteopontin SPP1 SPP1-789-13- 13474 NM_000582. Osteopontin SPP1 SPP1-841-13- 13476 NM-000582. Osteopontin SPP1 SPP1-852-13- 13478 NM-000582. Osteopontin SPP1 SPP1-209-13- 13480 NM_000582. Osteopontin SPP1 SPP1-1276- 13482 NM-000582. Osteopontin SPP1 SPP1-137-13- 13484 NM-000582. Osteopontin SPP1 SPP1-711-13- 13486 NM-000582. Osteopontin SPP1 SPP1-582-13- 13488 NM-000582. Osteopontin SPP1 SPP1-839-13- 13490 NM-000582. Osteopontin SPP1 SPP1-1091- 13492 NM-000582. Osteopontin SPP1 SPP1-884-13- 13494 NM_000582. Osteopontin SPP1 SPP1-903-13- 13496 NM-000582. Osteopontin SPP1 SPPl-1090- 13498 NM_000582. Osteopontin SPPl SPP1-474-13- 13500 NM_000582. Osteopontin SPP1 SPP1-575-13- 13502 NM-000582. Osteopontin SPP1 SPP1-671-13- 13504 NM-000582. Osteopontin SPP1 SPP1-924-13- 13506 NM-000582. Osteopontin SPP1 SPP1-1185- 13508 NM-000582. Osteopontin SPP1 ID Number Oligo Accession Gene Name Gene Number number Symbol SPP1-1221- 13510 NM-000582. Osteopontin SPP1 SPP1-347-13- 13512 NM-000582. Osteopontin SPP1 SPP1-634-13- 13514 NM-000582. Osteopontin SPP1 SPP1-877-13- 13516 NM_000582. Osteopontin SPP1 SPP1-1033- 13518 NM_000582. Osteopontin SPP1 SPP1-714-13- 13520 NM-000582. Osteopontin SPP1 SPP1-791-13- 13522 NM-000582. Osteopontin SPP1 SPP1-813-13- 13524 NM_000582. Osteopontin SPP1 SPP1-939-13- 13526 NM_000582. Osteopontin SPP1 SPP1-1161- 13528 MM-000582. Osteopontin SPP1 SPP1-1164- 13530 NM-000582. Osteopontin SPP1 SPP1-1190- 13532 NM_000582. Osteopontin SPP1 SPP1-1333- 13534 NM-000582. Osteopontin SPP1 SPP1-537-13- 13536 NM_000582. Osteopontin SPP1 SPP1-684-13 13538 NM-000582. Osteopontin SPP1 SPP1-707-13- 13540 NM-000582. Osteopontin SPP1 SPP1-799-13- 13542 NM_000582. Osteopontin SPP1 SPP1-853-13- 13544 NM_000582. Osteopontin SPP1 SPP1-888-13- 13546 NM_000582. Osteopontin SPP1 SPP1-1194- 13548 NM_000582. Osteopontin SPP1 ID Number Oligo Accession Gene Name Gene Number number Symbol SPP1-1279- 13550 NM-000582. Osteopontin SPP1 SPP1-1300- 13552 NM_000582. Osteopontin Sppl SPPl-1510- 13554 NM-000582. Osteopontin SPP1 SPP1-1543- 13556 NM_000582. Osteopontin SPP1 SPP1-434-13- 13558 NM-000582. Osteopontin Sppl SPP1-600-13- 13560 NM-000582. Osteopontin SPP1 SPP1-863-13- 13562 NM-000582. Osteopontin SPP1 SPP1-902-13- 13564 NM-000582. Osteopontin SPP1 SPP1-921-13- 13566 NM-000582. Osteopontin Sppl SPPl-154-13- 13568 NM-000582. Osteopontin Sppl SPP1-217-13- 13570 NM-000582. Osteopontin SPP1 SPP1-816-13- 13572 NM-000582. Osteopontin Sppl SPP1-882-13- 13574 NM-000582. Osteopontin Sppl SPP1-932-13- 13576 NM-000582. Osteopontin Sppl SPP1-1509- 13578 NM-000582. Osteopontin Sppl SPP1-157-13- 13580 NM-000582. Osteopontin Sppl SPPl-350-13- 13582 NM-000582. Osteopontin Sppl SPPl-511-13- 13584 NM-000582. Osteopontin SPP1 SPP1-605-13- 13586 -000582. Osteopontin Sppl SPP1-811-13- 13588 NM -000582. Osteopontin SPP1 ID Number Oligo Accession Gene Name Gene Number number Symbol SPP1-892-13- 13590 NM -000582. Osteopontin SPP1 SPP1-922-13- 13592 NM_000582. Osteopontin SPP1 SPP1-1169- 13594 NM-000582. Osteopontin SPP1 SPP1-1182- 13596 NM-000582. Osteopontin SPP1 SPP1-1539- 13598 NM-000582. Osteopontin SPP1 SPP1-1541- 13600 NM-000582. Osteopontin SPP1 SPP1-427-13- 13602 NM-000582. Osteopontin SPP1 SPP1-533-13- 13604 NM-000582. Osteopontin SPP1 APOB--13- 13763 NM 000384 Apolipoprotein B (including Ag(x) antigen) APOB

APOB--13- 13764 NM 000384 Apolipoprotein B (including Ag(x) antigen) APOB

PPIB--13- 13767 NM 000942 peptidylprolyl isomerase B (cyclophilin B) PPIB

PPIB--15- 13768 NM 000942 peptidylprolyl isomerase B (cyclophilin B) PPIB

PPIB -17 13769 NM 000942 peptidylprolyl isomerase B (cyclophilin B) PPIB

APOB-4314- 13940 NM 000384 Apolipoprotein B (including Ag(x) antigen) APOB

APOB-4314- 13941 NM 000384 Apolipoprotein B (including Ag(x) antigen) APOB

APOB--16- 13942 NM 000384 Apolipoprotein B (including Ag(x) antigen) APOB

APOB--18- 13943 NM 000384 Apolipoprotein B (including Ag(x) antigen) APOB

APOB--17- 13944 NM 000384 Apolipoprotein B (including Ag(x) antigen) APOB

ID Number Oligo Accession Gene Name Gene Number number Symbol APOB--19- 13945 NM 000384 Apolipoprotein B (including Ag(x) antigen) APOB

APOB-4314- 13946 NM 000384 Apolipoprotein B (including Ag(x) antigen) APOB

APOB-4314- 13947 NM 000384 Apolipoprotein B (including Ag(x) antigen) APOB

APOB--16- 13948 NM 000384 Apolipoprotein B (including Ag(x) antigen) APOB

APOB--17- 13949 NM 000384 Apolipoprotein B (including Ag(x) antigen) APOB

APOB--16- 13950 NM 000384 Apolipoprotein B (including Ag(x) antigen) APOB

APOB--18- 13951 NM 000384 Apolipoprotein B (including Ag(x) antigen) APOB

APOB--17- 13952 NM 000384 Apolipoprotein B (including Ag(x) antigen) APOB

APOB--19- 13953 NM 000384 Apolipoprotein B (including Ag(x) antigen) APOB

MAP4K4--16- 13766. - MAP4K4 13766.2 2 CTGF-1222- 13980 NM_001901. connective tissue growth factor CTGF

CTGF-813-16- 13981 NM-001901. connective tissue growth factor CTGF

CTGF-747-16- 13982 NM-001901. connective tissue growth factor CTGF

CTGF-817-16- 13983 NM-001901. connective tissue growth factor CTGF

CTGF-1174- 13984 NM-001901. connective tissue growth factor CTGF

CTGF-1005- 13985 NM-001901. connective tissue growth factor CTGF

CTGF-814-16- 13986 NM-001901. connective tissue growth factor CTGF

CTGF-816-16- 13987 NM-001901. connective tissue growth factor CTGF

CTGF-1001- 13988 NM -001901. connective tissue growth factor CTGF

CTGF-1173- 13989 NM-001901. connective tissue growth factor CTGF

ID Number Oligo Accession Gene Name Gene Number number Symbol CTGF-749-16- 13990 NM_001901. connective tissue growth factor CTGF

CTGF-792-16- 13991 NM -001901. connective tissue growth factor CTGF

CTGF-1162- 13992 NM-001901. connective tissue growth factor CTGF

CTGF-811-16- 13993 NM _001901. connective tissue growth factor CTGF

CTGF-797-16- 13994 NM_001901. connective tissue growth factor CTGF

CTGF-1175- 13995 NM-001901. connective tissue growth factor CTGF

CTGF-1172- 13996 NM-001901. connective tissue growth factor CTGF

CTGF-1177- 13997 NM-001901. connective tissue growth factor CTGF

CTGF-1176- 13998 NM_001901. connective tissue growth factor CTGF

CTGF-812-16- 13999 NM _001901. connective tissue growth factor CTGF

CTGF-745-16- 14000 -001901. connective tissue growth factor CTGF

166140010 14001 NM-001901. connective tissue growth factor CTGF 2 CTGF-920-16- 14002 NM-001901. connective tissue growth factor CTGF

CTGF-679-16- 14003 NM-001901. connective tissue growth factor CTGF

CTGF-992-16- 14004 NM-001901. connective tissue growth factor CTGF

CTGF-1045- 14005 NM_001901. connective tissue growth factor CTGF

CTGF-1231- 14006 NM-001901. connective tissue growth factor CTGF

CTGF-991-16- 14007 NM-001901. connective tissue growth factor CTGF

CTGF-998-16- 14008 NM_001901. connective tissue growth factor CTGF

CTGF-1049- 14009 NM-001901. connective tissue growth factor CTGF

ID Number Oligo Accession Gene Name Gene Number number Symbol CTGF-1044- 14010 NM _001901. connective tissue growth factor CTGF

CTGF-1327- 14011 NM-001901. connective tissue growth factor CTGF

CTGF-1196- 14012 NM -001901. connective tissue growth factor CTGF

CTGF-562-16- 14013 NM-001901. connective tissue growth factor CTGF

CTGF-752-16- 14014 N-001901. connective tissue growth factor CTGF

CTGF-994-16- 14015 NM-001901. connective tissue growth factor CTGF

CTGF-1040- 14016 NM _001901. connective tissue growth factor CTGF

CTGF-1984- 14017 NM_001901. connective tissue growth factor CTGF

CTGF-2195- 14018 N-001901. connective tissue growth factor CTGF

CTGF-2043- 14019 N-001901. connective tissue growth factor CTGF

CTGF-1892- 14020 NM-001901. connective tissue growth factor CTGF

CTGF-1567- 14021 NM-001901. connective tissue growth factor CTGF

CTGF-1780- 14022 NM _001901. connective tissue growth factor CTGF

CTGF-2162- 14023 NM_001901. connective tissue growth factor CTGF

CTGF-1034- 14024 NM-001901. connective tissue growth factor CTGF

CTGF-2264- 14025 NM-001901. connective tissue growth factor CTGF

CTGF-1032- 14026 NM_001901. connective tissue growth factor CTGF

CTGF-1535- 14027 Tom-001901. connective tissue growth factor CTGF

CTGF-1694- 14028 NM-001901. connective tissue growth factor CTGF

166140298 14029 M-001901. connective tissue growth factor CTGF 2 ID Number Oligo Accession Gene Name Gene Number number Symbol CTGF-928-16- 14030 NM-001901. connective tissue growth factor CTGF

CTGF-1133- 14031 NM-001901. connective tissue growth factor CTGF

CTGF-912-16- 14032 NM_001901. connective tissue growth factor CTGF

CTGF-753-16- 14033 NM-001901. connective tissue growth factor CTGF

CTGF-918-16- 14034 NM_001901. connective tissue growth factor CTGF

CTGF-744-16- 14035 NM-001901. connective tissue growth factor CTGF

CTGF-466-16- 14036 NM-001901. connective tissue growth factor CTGF

CTGF-917-16- 14037 NM_001901. connective tissue growth factor CTGF

CTGF-1038- 14038 NM-001901. connective tissue growth factor CTGF

CTGF-1048- 14039 NM-001901. connective tissue growth factor CTGF

CTGF-1235- 14040 NM_001901. connective tissue growth factor CTGF

CTGF-868-16- 14041 NM-001901. connective tissue growth factor CTGF

CTGF-1131- 14042 NM-001901. connective tissue growth factor CTGF

166140433 14043 NM_001901. connective tissue growth factor CTGF 2 CTGF-751-16- 14044 NM-001901. connective tissue growth factor CTGF

CTGF-1227- 14045 NM_001901. connective tissue growth factor CTGF

CTGF-867-16- 14046 NM -001901. connective tissue growth factor CTGF

CTGF-1128- 14047 NM-001901. connective tissue growth factor CTGF

CTGF-756-16- 14048 NM-001901. connective tissue growth factor CTGF

CTGF-1234- 14049 NM-001901. connective tissue growth factor CTGF

ID Number Oligo Accession Gene Name Gene Number number Symbol CTGF-916-16- 14050 NM-001901. connective tissue growth factor CTGF

CTGF-925-16- 14051 NM-001901. connective tissue growth factor CTGF

CTGF-1225- 14052 NM-001901. connective tissue growth factor CTGF

CTGF-445-16- 14053 NM-001901. connective tissue growth factor CTGF

CTGF-446-16- 14054 NM_001901. connective tissue growth factor CTGF

CTGF-913-16- 14055 NM-001901. connective tissue growth factor CTGF

CTGF-997-16- 14056 NM -001901. connective tissue growth factor CTGF

CTGF-277-16- 14057 NM-001901. connective tissue growth factor CTGF

166140582 14058 NM_001901. connective tissue growth factor CTGF 2 CTGF-887-16- 14059 NM-001901. connective tissue growth factor CTGF

CTGF-914-16- 14060 NM-001901. connective tissue growth factor CTGF

CTGF-1039- 14061 NM -001901. connective tissue growth factor CTGF

CTGF-754-16- 14062 NM-001901. connective tissue growth factor CTGF

CTGF-1130- 14063 NM-001901. connective tissue growth factor CTGF

CTGF-919-16- 14064 M001901. connective tissue growth factor CTGF

CTGF-922-16- 14065 NDI_001901. connective tissue growth factor CTGF

CTGF-746-16- 14066 NM_001901. connective tissue growth factor CTGF

CTGF-993-16- 14067 NM-001901. connective tissue growth factor CTGF

CTGF-825-16- 14068 NM -001901. connective tissue growth factor CTGF

CTGF-926-16- 14069 NM_001901. connective tissue growth factor CTGF

ID Number Oligo Accession Gene Name Gene Number number Symbol CTGF-923-16- 14070 NM_001901. connective tissue growth factor CTGF

CTGF-866-16- 14071 NM_001901. connective tissue growth factor CTGF

CTGF-563-16- 14072 NM_001901. connective tissue growth factor CTGF

CTGF-823-16- 14073 NM-001901. connective tissue growth factor CTGF

CTGF-1233- 14074 NM-001901. connective tissue growth factor CTGF

CTGF-924-16- 14075 NM _001901. connective tissue growth factor CTGF

CTGF-921-16- 14076 NM-001901. connective tissue growth factor CTGF

CTGF-443-16- 14077 NM_001901. connective tissue growth factor CTGF

CTGF-1041- 14078 NM_001901. connective tissue growth factor CTGF

CTGF-1042- 14079 NM_001901. connective tissue growth factor CTGF

CTGF-755-16- 14080 NM_001901. connective tissue growth factor CTGF

CTGF-467-16- 14081 NM_001901. connective tissue growth factor CTGF

CTGF-995-16- 14082 NM_001901. connective tissue growth factor CTGF

CTGF-927-16- 14083 -001901. connective tissue growth factor CTGF

SPPl-1091- 14131 N-000582. Osteopontin SPPl PPIB--16- 14188 NM 000942 peptidylprolyl isomerase B (cyclophilin B) PPIB

PPIB -17 14189 NM 000942 peptidylprolyl isomerase B (cyclophilin B) PPIB

PPIB -18 14190 NM 000942 peptidylprolyl isomerase B (cyclophilin B) PPIB

pGL3-1172- 14386 U47296 Cloning vector pGL3-Control pGL3 pGL3-1172- 14387 U47296 Cloning vector pGL3-Control pGL3 ID Number Oligo Accession Gene Name Gene Number number Symbol MAP4K4-2931- 14390 NM 004834 Mitogen-Activated Protein Kinase Kinase Kinase Kinase 4 MAP4K4 25-14390 - (MAP4K4), transcript variant 1 miR-122--23- 14391 miR-122 14084 NK-000582. Osteopontin SPP1 14085 IIM_000582. Osteopontin SPP1 14086 NM-000582. Osteopontin SPP1 14087 NM-000582. Osteopontin SPP1 14088 NM -000582. Osteopontin SPP1 14089 NM -000582. Osteopontin SPP1 14090 NM-000582. Osteopontin SPP1 14091 NM -000582. Osteopontin SPP1 14092 NM-000582. Osteopontin SPP1 14093 -000582. Osteopontin SPP1 14094 NM-000582. Osteopontin SPP1 14095 NM-000582. Osteopontin SPP1 14096 NM-000582. Osteopontin SPP1 14097 NM -000582. Osteopontin SPP1 14098 -000582. Osteopontin SPP1 14099 -000582. Osteopontin SPP1 14100 NM-000582. Osteopontin SPP1 14101 -000582. Osteopontin SPP1 ID Number Oligo Accession Gene Name Gene Number number Symbol 14102 NM -000582. Osteopontin SPP1 14103 NM-000582. Osteopontin SPP1 14104 NM-000582. Osteopontin SPP1 14105 NM -000582. Osteopontin SPP1 14106 NM -000582. Osteopontin SPP1 14107 -000582. Osteopontin SPP1 14108 NM-000582. Osteopontin SPP1 14109 -000582. Osteopontin SPP1 14110 NM-000582. Osteopontin SPP1 14111 NM-000582. Osteopontin SPP1 14112 NM-000582. Osteopontin SPP1 14113 NM-000582. Osteopontin SPP1 14114 NM -000582. Osteopontin SPP1 14115 NM-000582. Osteopontin SPP1 14116 NM-000582. Osteopontin SPP1 14117 -000582. Osteopontin SPP1 14118 NM-000582. Osteopontin SPP1 14119 NM -000582. Osteopontin SPP1 14120 NM-000582. Osteopontin SPP1 14121 NM -000582. Osteopontin SPP1 ID Number Oligo Accession Gene Name Gene Number number Symbol 14122 NM-000582. Osteopontin SPP1 14123 NM-000582. Osteopontin SPP1 14124 1111_000582. Osteopontin SPP1 14125 NM-000582. Osteopontin SPP1 14126 -000582. Osteopontin SPP1 14127 NM-000582. Osteopontin SPP1 14128 -000582. Osteopontin SPP1 14129 NM-000582. Osteopontin SPP1 14130 ND4__000582. Osteopontin SPP1 14132 NM-000582. Osteopontin SPP1 14133 NM-000582. Osteopontin SPP1 14134 NM-000582. Osteopontin SPP1 14135 NM-000582. Osteopontin SPP1 14136 NM-000582. Osteopontin SPP1 14137 NM-000582. Osteopontin SPP1 14138 -000582. Osteopontin SPP1 14139 NM-000582. Osteopontin SPP1 14140 NM-000582. Osteopontin SPP1 14141 NM-000582. Osteopontin SPP1 14142 NM-000582. Osteopontin SPP1 ID Number Oligo Accession Gene Name Gene Number number Symbol 14143 NM-000582. Osteopontin SPP1 14144 NM-000582. Osteopontin SPP1 14145 IIM_000582. Osteopontin SPP1 14146 NM-000582. Osteopontin sppl 14147 NM-000582. Osteopontin SPP1 14148 -000582. Osteopontin SPP1 14149 NM-000582. Osteopontin SPP1 14150 NIj_O Osteopontin SPP1 14151 M-000582. Osteopontin SPP1 14152 NM -000582. Osteopontin SPP1 14153 NM-000582. Osteopontin SPP1 14154 NM-000582. Osteopontin SPP1 14155 Nl~__000582. Osteopontin SPP1 14156 NM-000582. Osteopontin SPP1 14157 NM-000582. Osteopontin SPP1 14158 NM-000582. Osteopontin SPP1 14159 NM-000582. Osteopontin SPP1 14160 NM-000582. Osteopontin SPP1 14161 N-000582. Osteopontin SPP1 14162 NM-000582. Osteopontin SPP1 ID Number Oligo Accession Gene Name Gene Number number Symbol 14163 NM-000582. Osteopontin SPP1 14164 NM-000582. Osteopontin SPP1 14165 NM-000582. Osteopontin SPP1 14166 NM -000582. Osteopontin SPP1 14167 NM -000582. Osteopontin SPP1 14168 NM-000582. Osteopontin SPP1 14169 NM-000582. Osteopontin SPP1 14170 NM-000582. Osteopontin SPP1 14171 NM-000582. Osteopontin SPP1 14172 -000582. Osteopontin SPP1 14173 NM-000582. Osteopontin SPP1 14174 NM-000582. Osteopontin SPP1 14175 NM -000582. Osteopontin SPP1 14176 NM-000582. Osteopontin SPP1 14177 NM-000582. Osteopontin SPP1 14178 NM-000582. Osteopontin SPP1 14179 NM -000582.. Osteopontin SPP1 14180 NM-000582. Osteopontin SPP1 14181 NM -000582. Osteopontin SPP1 14182 NM-000582. Osteopontin SPP1 ID Number Oligo Accession Gene Name Gene Number number Symbol 14183 NM-000582. Osteopontin SPP1 14184 -000582. Osteopontin SPP1 14185 NM -000582. Osteopontin SPP1 14186 N-000582. Osteopontin SPP1 14187 NM-000582. Osteopontin SPP1 Table 1 Oligo AntiSense SEQ ID
ID Number Numbe Backbone AntiSense Chemistry AntiSense Sequence NO:
r 12138 000000 m 12139 000000 m 2931-16- 12293 0000000000000 Pf000fffffOf0000fffO UAGACUUCCACAGAACUCU 3 2931-16- 12385 0000000000000 PfOOOfffffOf0000fffO UAGACUUCCACAGAACUCU 6 2931-16- 12386 000000000osss Pf000fffffOfO000fffO UAGACUUCCACAGAACUCU 7 12386 ssssso 2931-16- 12387 000000000osss P0000000000000000000 UAGACUUCCACAGAACUCU 8 12387 ssssso Oligo AntiSense SEQ ID
ID Number Numbe Backbone AntiSense Chemistry AntiSense Sequence NO:
r 12266.2 12434 00000000 m C

12435 00000000 m C

2931-16- 12451 000000000osss Pf000fffffOf0000ffmm UAGACUUCCACAGAACUCU 12 12451 ssssso 2931-16- 12452 0000000000sss Pm000fffffOf0000ffmm UAGACUUCCACAGAACUCU 13 12452 ssssso 2931-16- 12453 00000osssssss Pm000fffffOf0000ffmm UAGACUUCCACAGAACUCU 14 12453 ssssso MAP4K4- 000000000000s Pm000fffffOf0000ffff UAGACUUCCACAGAACUCUU

12454 ssssssso mm C

MAP4K4- 000ooooosssss Pm000fffffOf0000ffff UAGACUUCCACAGAACUCUU
2931-17- 12455 ssssssso mm C 16 MAP4K4- 00000000o000s Pm000fffffOf0000ffff UAGACUUCCACAGAACUCUU
2931-19- 12456 ssssssssssso ffOOmm CAAAG 17 10167-21- 12505 0000000s m C 18 Oligo AntiSense SEQ ID
ID Number Numbe Backbone AntiSense Chemistry AntiSense Sequence NO:
r 10167-21- 12506 0000000s m C 19 2931-16- 12539 0000000000oss Pf000fffffOfO000fffO UAGACUUCCACAGAACUCU 20 12539 ssssss APOB 12505 oooo0000o0000 00000000000000000000 AUUGGUAUJCAGUGUGAUGA
10167-21- 2 00000000 m C 21 12505.2 10167-21- 2 00000000 m C 22 12506.2 MAP4K4- 12386 00000ooooosss 2931-16- .2 ssssso Pf000fffffOf0000fffO UAGACUUCCACAGAACUCU 23 12386.2 MAP4K4-- 12983 000000000000s Pm000fffffOm0000mmmO uagacuuccacagaacucu 24 16-12983 ssssso MAP4K4-- 12984 000000000000s Pm000fffffOm0000mmmO uagacuuccacagaacucu 25 16-12984 sssss MAP4K4-- 12985 000000000000s Pm000fffffOm0000mmmO uagacuuccacagaacucu 26 16-12985 ssssso MAP4K4-- 12986 0000000000sss Pf000fffffOf0000fffO UAGACUUCCACAGAACUCU 27 16-12986 ssssso MAP4K4-- 12987 0000000000000 POOOOfOOffOmO000mOmO UagacUUccacagaacUcU 28 16-12987 ssssss MAP4K4-- 12988 0000000000000 POOOOfOOffOm0000mOmO UagacUUccacagaacUcu 29 16-12988 ssssss Oligo AntiSense SEQ ID
ID Number Numbe Backbone AntiSense Chemistry AntiSense Sequence NO:
r MAP4K4-- 12989 0000000000000 POOOOffOffOm0000mOmO UagacuUccacagaacUcu 30 16-12989 ssssss MAP4K4-- 12990 0000000000000 Pf0000ff000000000mOO uagaCuuCCaCagaaCuCu 31 16-12990 ssssss MAP4K4-- 12991 0000000000000 Pf0000fffOOm00000mmO uagaCuucCacagaaCucu 32 16-12991 ssssss MAP4K4-- 12992 0000000000000 Pf000fffff0000000mOO uagacuuccaCagaaCuCu 33 16-12992 ssssss MAP4K4-- 12993 0000000000000 P0000000000000000000 UagaCUUCCaCagaaCUCU 34 16-12993 ssssss MAP4K4-- 12994 0000000000000 P0000fOfOf0000000mOO UagacUuCcaCagaaCuCu 35 16-12994 ssssss MAP4K4-- 12995 000000000000s Pf000fffff0000000000 uagacuuccaCagaaCUCU 36 16-12995 ssssso pGL3-1172- 13038 pGL3-1172- 13040 --16-13047 13047 000000000000s Pm000000000m0000mmmO UAGACUUCCACAGAACUCU 37 sssss Oligo AntiSense SEQ ID
ID Number Numbe Backbone AntiSense Chemistry AntiSense Sequence NO:
r PPIB--16- 13136 000000000000s PmOfffffOf00mm000mmO UGUUUUUGUAGCCAAAUCC 38 13136 sssss Oligo AntiSense SEQ ID
ID Number Numbe Backbone AntiSense Chemistry AntiSense Sequence NO:
r SOD1-530- 13163 000000000000s PmOffffffff0mmmmmOmO UACUUUCUUCAUUUCCACC 39 16-13163 ssssso SOD1-523- 13164 000000000000s PmffOfffffOfmmmmOmmO UUCAUUUCCACCUUUGCCC 40 16-13164 ssssso SOD1-535- 13165 000000000000s Pmfff0f0ffffmmmm0mm0 CUUUGUACUUUCUUCAUUU 41 16-13165 ssssso SOD1-536- 13166 000000000000s PmffffOfOfffmmmmmOmO UCUUUGUACUUUCUUCAUU 42 16-13166 ssssso SOD1-396- 13167 000000000000s Pmf00f00ffOfOmmOmmmO UCAGCAGUCACAUUGCCCA 43 16-13167 ssssso SOD1-385- 13168 000000000000s PmffOfff000fmmmm00mO AUUGCCCAAGUCUCCAACA 44 16-13168 ssssso SOD1-195- 13169 000000000000s PmfffOfff0000mm00m00 WCUGCUCGAAAWGAUGA 45 16-13169 ssssso pGL3-1172- 13170 000000000000S Pm00ff0f0ffmOff00mm0 AAAUCGUAUUUGUCAAUCA 46 16-13170 ssssso pGL3-1172- 13171 0000000000000 Pm00ff0f0ffmOffo0mm0 AAAUCGUAUUUGUCAAUCA 47 16-13171 ssssss MAP4k4-Oligo AntiSense SEQ ID
ID Number Numbe Backbone AntiSense Chemistry AntiSense Sequence NO:
r Oligo AntiSense SEQ ID
ID Number Numbe Backbone AntiSense Chemistry AntiSense Sequence NO:
r Oligo AntiSense SEQ ID
ID Number Numbe Backbone AntiSense Chemistry AntiSense Sequence NO:
r Oligo AntiSense SEQ ID
ID Number Numbe Backbone AntiSense Chemistry AntiSense Sequence NO:
r Oligo AntiSense SEQ ID
ID Number Numbe Backbone AntiSense Chemistry AntiSense Sequence NO:
r Oligo AntiSense SEQ ID
ID Number Numbe Backbone AntiSense Chemistry AntiSense Sequence NO:
r Oligo AntiSense SEQ ID
ID Number Numbe Backbone AntiSense Chemistry AntiSense Sequence NO:
r Oligo AntiSense SEQ ID
ID Number Numbe Backbone AntiSense Chemistry AntiSense Sequence NO:
r Oligo AntiSense SEQ ID
ID Number Numbe Backbone AntiSense Chemistry AntiSense Sequence NO:
r 13-13440.

Oligo AntiSense SEQ ID
ID Number Numbe Backbone AntiSense Chemistry AntiSense Sequence NO:
r Oligo AntiSense SEQ ID
ID Number Numbe Backbone AntiSense Chemistry AntiSense Sequence NO:
r Oligo AntiSense SEQ ID
ID Number Numbe Backbone AntiSense Chemistry AntiSense Sequence NO:
r Oligo AntiSense SEQ ID
ID Number Numbe Backbone AntiSense Chemistry AntiSense Sequence NO:
r Oligo AntiSense SEQ ID
ID Number Numbe Backbone AntiSense Chemistry AntiSense Sequence NO:
r Oligo AntiSense SEQ ID
ID Number Numbe Backbone AntiSense Chemistry AntiSense Sequence NO:
r Oligo AntiSense SEQ ID
ID Number Numbe Backbone AntiSense Chemistry AntiSense Sequence NO:
r MAP4K4-- 13766 000000000000s Pm000fffffOm0000mmmO UAGACUUCCACAGAACUCU 49 16-13766 ssssso MAP4K4-- 13939 000000000000s m00ofOffffOm0m00mOm UAGACAUCCUACACAGCAC 50 16-13939 ssssso APOB-4314- 13940 000000000000s PmOfffffff000mmmmm00 UGUUUCUCCAGAUCCUUGC 51 16-13940 ssssso APOB-4314- 13941 000000000000s Pm0fffffff000mmmmm00 UGUUUCUCCAGAUCCUUGC 52 17-13941 ssssso APOB--16- 13942 OOOOOOOOOOOOS Pm00f000f000mmmOmmmO UAGCAGAUGAGUCCAUUUG 53 13942 ssssso APOB--18- 13943 0000000000000 Pm00f000f000mmmOmmmO UAGCAGAUGAGUCCAUUUGG 54 13943 ooosssssso 0000 AGA

APOB--17- 13944 000000000000s Pm00f000f000mmmOmmmO UAGCAGAUGAGUCCAUUUG 55 13944 ssssso APOB--19- 13945 0000000000000 Pm00f000f000mmmOmmmO UAGCAGAUGAGUCCAUUUGG 56 13945 ooosssssso 0000 AGA

APOB-4314- 13946 000000000000s Pmf0ff0ffffmmm000mm0 AUGUTJGUUUCUCCAGAUCC 57 16-13946 ssssso APOB-4314- 13947 000000000000s Pmf0ff0ffffmmm000mm0 AUGUUGUUUCUCCAGAUCC 58 17-13947 ssssso APOB--16- 13948 0000000ooooos PmOfff000000mmmmOm00 UGUUUGAGGGACUCUGUGA 59 13948 ssssso Oligo AntiSense SEQ ID
ID Number Numbe Backbone AntiSense Chemistry AntiSense Sequence NO:
r APOB--17- 13949 00000000o000s PmOfff000000mmmmOmOO UGUUUGAGGGACUCUGUGA 60 13949 ssssso APOB--16- 13950 000000000000s Pmff00fOfffOOmOmOOmO AUUGGUAUUCAGUGUGAUG 61 13950 ssssso APOB--18- 13951 0000000000000 PmffOOfOfffOOmOm00mO AUUGGUAUUCAGUGUGAUGA 62 13951 ooosssssso OmOO CAC

APOB--17- 13952 0000000o0000s PmffOOfOfffOOmOmOOmO AUUGGUAUUCAGUGUGAUG 63 13952 ssssso APOB--19- 0000000000000 PmffOOfOfffOOmOmOOmO AUUGGUAUUCAGUGUGAUGA
13953 13953 ooosssssso OmOO CAC 64 MAP4K4-- 13766 0000000ooooos Pm000fffffOm0000mmm0 UAGACUUCCACAGAACUCU 65 16-13766.2 .2 ssssso CTGF-1222- 13980 0000000000oos PmOfOffffffmOmOOmOmO UACAUCUUCCUGUAGUACA 66 16-13980 ssssso CTGF-813- 13981 000000000000s PmOfOffffOmmmmOm000 AGGCGCUCCACUCUGUGGU 67 16-13981 ssssso CTGF-747- 13982 000000000000s Pmoffffff00mmOm0000 UGUCUUCCAGUCGGUAAGC 68 16-13982 ssssso CTGF-817- 13983 0000000000oos Pm00f000fOfmmmOmmmmO GAACAGGCGCUCCACUCUG 69 16-13983 ssssso CTGF-1174- 13984 00000000000os PmOOffOfOOfOOmO00mOO CAGUUGUAAUGGCAGGCAC 70 16-13984 ssssso CTGF-1005- 13985 000000000000s Pmff000000mmm000mmO AGCCAGAAAGCUCAAACUU 71 16-13985 ssssso CTGF-814- 13986 000000000000s Pm000foffffOmmmmOm00 CAGGCGCUCCACUCUGUGG 72 16-13986 ssssso CTGF-816- 13987 000000000000s PmOf000fOffmmOmmmm00 AACAGGCGCUCCACUCUGU 73 16-13987 ssssso Oligo AntiSense SEQ ID
ID Number Numbe Backbone AntiSense Chemistry AntiSense Sequence NO:
r CTGF-1001- 13988 000000000000s Pm0000fff000mmmOOmO AGAAAGCUCAAACUUGAUA 74 16-13988 ssssso CTGF-1173- 13989 000000000000s PmffOfOOfOOmO00mOmO AGUUGUAAUGGCAGGCACA 75 16-13989 ssssso CTGF-749- 13990 000000000000s Pmfoffffff00mm00m00 CGUGUCWCCAGUCGGUAA 76 16-13990 ssssso CTGF-792- 13991 000000000000s PmOOff000fOOmmOOmmmO GGACCAGGCAGUUGGCUCU 77 16-13991 ssssso CTGF-1162- 13992 0000000ooooos Pm000fOf000mmmmOOmOO CAGGCACAGGUCUUGAUGA 78 16-13992 ssssso CTGF-811- 13993 000000000000s PmfOffffOffmmOm00mmO GCGCUCCACUCUGUGGUCU 79 16-13993 ssssso CTGF-797- 13994 000000000000s PmOfff000ff000mOOmmO GGUCUGGACCAGGCAGWG 80 16-13994 ssssso CTGF-1175- 13995 000000000000s PmfOOffOfOOmOOmO00mO ACAGUUGUAAUGGCAGGCA 81 16-13995 ssssso CTGF-1172- 13996 000000000000s PmffOfOOfOOmO00mOmOO GUUGUAAUGGCAGGCACAG 82 16-13996 ssssso CTGF-1177- 13997 000000000000s Pm00fOOffOf00m00m000 GGACAGUUGUAAUGGCAGG 83 16-13997 ssssso CTGF-1176- 13998 000000000000s PmOfOOffOfOOmOOmO000 GACAGUUGUAAUGGCAGGC 84 16-13998 ssssso CTGF-812- 13999 000000000000s PmOfOffffOfmmmOmOOmO GGCGCUCCACUCUGUGGUC 85 16-13999 ssssso CTGF-745- 14000 000000000000s Pmfffff00ff00m000mmO UCUUCCAGUCGGUAAGCCG 86 16-14000 ssssso CTGF-1230- 14001 000000000000s PmOfffffOfOmOmmmmmmO UGUCUCCGUACAUCUUCCU 87 16-14001 ssssso Oligo AntiSense SEQ ID
ID Number Numbe Backbone AntiSense Chemistry AntiSense Sequence NO:
r CTGF-920- 14002 000000000000s Pmffff0f0000mmmO0m0 AGCUUCGCAAGGCCUGACC 88 16-14002 ssssso CTGF-679- 14003 000000000000s PmOffffffOfOOmOmmmmO CACUCCUCGCAGCAUUUCC 89 16-14003 ssssso CTGF-992- 14004 000000000000s PmOOfffOOf000mmm0000 AAACUUGAUAGGCUUGGAG 90 16-14004 ssssso CTGF-1045- 14005 000000000000s PmffffOf0000mmm00mmO ACUCCACAGAAUUUAGCUC 91 16-14005 ssssso CTGF-1231- 14006 000000000000s PmfOfffffofOmOmmmmmO AUGUCUCCGUACAUCWCC 92 16-14006 ssssso CTGF-991- 14007 0000000000005 PmOfffOOf000mmm00000 AACUUGAUAGGCUUGGAGA 93 16-14007 ssssso CTGF 998 14008 ssssso 0000000ooooos 16-14008 PmOOfff000fmmOOm0000 AAGCUCAAACUUGAUAGGC 94 CTGF-1049- 14009 000000000000s PmfOfOffffOm0000mmmO ACAUACUCCACAGAAUUUA 95 16-14009 ssssso CTGF-1044- 14010 000000000000s Pmfff0f0000mmm00mmm0 CUCCACAGAAUUUAGCUCG 96 16-14010 ssssso CTGF-1327- 14011 000000000000s Pmofoffoff0000mmOmmO UGUGCUACUGAAAUCAUUU 97 16-14011 ssssso CTGF-1196- 14012 000000000000s Pm0000fOff0mmOmmmmmO AAAGAUGUCAUUGUCUCCG 98 16-14012 ssssso CTGF-562- 14013 000000000000s PmfOfOffOOfOmmmOm000 GUGCACUGGUACUUGCAGC 99 16-14013 ssssso CTGF-752- 14014 0000000o0000s PmOOfOfOfffmmm00mm00 AAACGUGUCUUCCAGUCGG 100 16-14014 ssssso CTGF-994- 14015 000000000000s Pmf000fffOOmO00mmmOO UCAAACUUGAUAGGCUUGG 101 16-14015 ssssso Oligo AntiSense SEQ ID
ID Number Numbe Backbone AntiSense Chemistry AntiSense Sequence NO:
r CTGF-1040- 14016 000000000000s Pmf0000fffOOmmmOOmOO ACAGAAUUUAGCUCGGUAU 102 16-14016 ssssso CTGF-1984- 14017 0000000o000os Pmf0f0ffff0mmm0m00m0 UUACAUUCUACCUAUGGUG 103 16-14017 ssssso CTGF-2195- 14018 000000000000s PmOOffOOffOOmmOmOmOO AAACUGAUCAGCUAUAUAG 104 16-14018 ssssso CTGF-2043- 14019 000000000000s PmOfff000fO000mmmmmO UAUCUGAGCAGAAUUUCCA 105 16-14019 ssssso CTGF-1892- 14020 oooooooooooos PmfOOfff000mOOmmOmOO UUAACUUAGAUAACUGUAC 106 16-14020 ssssso CTGF-1567- 14021 oooooooooooos PmOffOfffOfOm0000mOO UAUUACUCGUAUAAGAUGC 107 16-14021 ssssso CTGF-1780- 14022 0000000ooooos Pm00ffOfffOOmmmOOmmO AAGCUGUCCAGUCUAAUCG 108 16-14022 ssssso CTGF-2162- 14023 000000000000s PmOOf00000fmOmmmOmmO UAAUAAAGGCCAUUUGWC 109 16-14023 ssssso CTGF-1034- 14024 000000000000s Pmff00fff00mOmOmmmmO UUUAGCUCGGUAUGUCUUC 110 16-14024 ssssso CTGF-2264- 14025 000000000000s PmfOfffffOOm000m0000 ACACUCUCAACAAAUAAAC 111 16-14025 ssssso CTGF-1032- 14026 0000000ooooos PmO0fff00f0m0mmmmm00 UAGCUCGGUAUGUCUUCAU 112 16-14026 ssssso CTGF-1535- 14027 0000000ooooos Pm00fffffff0mm00m0m0 UAACCUUUCUGCUGGUACC 113 16-14027 ssssso CTGF-1694- 14028 000000000000s Pmf000000fOOmmmOOmmO UUAAGGAACAACWGACUC 114 16-14028. ssssso CTGF-1588- 14029 ssssso 0000000oo000s 16-14029 PmfOfOffff000m00m000 UUACACUUCAAAUAGCAGG 115 Oligo AntiSense SEQ ID
ID Number Numbe Backbone AntiSense Chemistry AntiSense Sequence NO:
r CTGF-928- 14030 000000000000s Pmff000ffOOmmmmOm000 UCCAGGUCAGCUUCGCAAG 116 16-14030 ssssso CTGF-1133- 14031 000000000000s Pmffffff0f00mmmmOmmO CUUCUUCAUGACCUCGCCG 117 16-14031 ssssso CTGF-912- 14032 000000000000s Pm000fffOOfmOmOmOmOO AAGGCCUGACCAUGCACAG 118 16-14032 ssssso CTGF-753- 14033 0000000o0ooos Pm000fOfOffmmmmOOmmO CAAACGUGUCUUCCAGUCG 119 16-14033 ssssso CTGF-918- 14034 000000000000s PmfffOf0000mmmOOmmOO CUUCGCAAGGCCUGACCAU 120 16-14034 ssssso CTGF-744- 14035 000000000000s PmffffOOffOOm000mmOO CUUCCAGUCGGUAAGCCGC 121 16-14035 ssssso CTGF-466- 14036 000000000000s Pmf00ffff0fO0mmOOmm0 CCGAUCUUGCGGUUGGCCG 122 16-14036 ssssso CTGF-917- 14037 0000000ooooos PmffOf0000fmmOOmmOmO UUCGCAAGGCCUGACCAUG 123 16-14037 ssssso CTGF-1038- 14038 000000000000s PmOOfffOOfmmOmOmOO AGAAUUUAGCUCGGUAUGU 124 16-14038 ssssso CTGF-1048- 14039 000000000000s PmOfOffffOf0000mmmOO CAUACUCCACAGAAUUUAG 125 16-14039 ssssso CTGF-1235- 14040 000000000000s PmOffOfOfffmmnOmOmO UGCCAUGUCUCCGUACAUC 126 16-14040 ssssso CTGF-868- 14041 000000000000s Pr000fOffOfmOmmOOrOO GAGGCGUUGUCAUUGGUAA 127 16-14041 ssssso CTGF-1131- 14042 00000000oo00s PmffffOfOOfmmmOmrOmO UCUUCAUGACCUCGCCGUC 128 16-14042 ssssso CTGF-1043- 14043 000000000000s PmffOf0000fmmOOmmmOO UCCACAGAAUUUAGCUCGG 129 16-14043 ssssso Oligo AntiSense SEQ ID
ID Number Numbe Backbone AntiSense Chemistry AntiSense Sequence NO:
r CTGF-751- 14044 000000000000s PmofOfOffffmm00mm000 AACGUGUCUUCCAGUCGGU 130 16-14044 ssssso CTGF-1227- 14045 000000000000s Pmfffofofofmmmmmmomo CUCCGUACAUCUUCCUGUA 131 16-14045 ssssso CTGF-867- 14046 000000000000s PmOfOffOffOmmOOm000 AGGCGUUGUCAUUGGUAAC 132 16-14046 ssssso CTGF-1128- 14047 000000000000s PmfOfOOffffOmmOmm000 UCAUGACCUCGCCGUCAGG 133 16-14047 ssssso CTGF-756- 14048 0000000ooooos PmOff000fOfOmmmmmm00 GGCCAAACGUGUCUUCCAG 134 16-14048 ssssso CTGF-1234- 14049 000000000000s PmffofoffffmmOmOmmO GCCAUGUCUCCGUACAUCU 135 16-14049 ssssso CTGF-916- 14050 0000000o0000s PmfOf000OffmOOmmOmOO UCGCAAGGCCUGACCAUGC 136 16-14050 ssssso CTGF-925- 14051 000000000000s PmOffOOfffmm0000mO AGGUCAGCUUCGCAAGGCC 137 16-14051 ssssso CTGF-1225- 14052 000000000000s PmfofOfOfffmmmmOm000 CCGUACAUCUUCCUGUAGU 138 16-14052 ssssso CTGF-445- 14053 000000000000s PmOOff000ofmOm000000 GAGCCGAAGUCACAGAAGA 139 16-14053 ssssso CTGF-446- 14054 000000000000s Pm000ff0000mmOm00000 GGAGCCGAAGUCACAGAAG 140 16-14054 ssssso CTGF-913- 14055 000000000000s Pm0000fffOOmmOmOmOmO CAAGGCCUGACCAUGCACA 141 16-14055 ssssso CTGF-997- 14056 000000000000s Pmfff000ffmOOm000mO AGCUCAAACUUGAUAGGCU 142 16-14056 ssssso CTGF-277- 14057 000000000000s PmfOfOoffffOOmmOOmOO CUGCAGWCUGGCCGACGG 143 16-14057 ssssso Oligo AntiSense SEQ ID
ID Number Numbe Backbone AntiSense Chemistry AntiSense Sequence NO:
r CTGF-1052- 14058 00000000000os PmOfOfOfOffmmOm00000 GGUACAUACUCCACAGAAU 144 16-14058 ssssso CTGF-887- 14059 0000000000oos Pmfofffffff00mmmom00 CUGCUUCUCUAGCCUGCAG 145 16-14059 ssssso CTGF-914- 14060 000000000000s Pmf0000fffOOmmOmOmOO GCAAGGCCUGACCAUGCAC 146 16-14060 ssssso CTGF-1039- 14061 000000000000s Pm000offf00mmm00mOmO CAGAAUUUAGCUCGGUAUG 147 16-14061 ssssso CTGF-754- 14062 000000000000s Pmf000f0f0fmmmmm00m0 CCAAACGUGUCUUCCAGUC 148 16-14062 ssssso CTGF-1130- 14063 0000000ooooos Pmfff0f00ffmmmrOmmO CUUCAUGACCUCGCCGUCA 149 16-14063 ssssso CTGF-919- 14064 000000000ooos PmffffOf0000mmm00mmO GCUUCGCAAGGCCUGACCA 150 16-14064 ssssso CTGF-922- 14065 00000000000os PmfOOffffOf0000mmmOO UCAGCUUCGCAAGGCCUGA 151 16-14065 ssssso CTGF-746- 14066 0000000oooo0s Pmffffff00fm0m000m0 GUCUUCCAGUCGGUAAGCC 152 16-14066 ssssso CTGF-993- 14067 ssss0000000000oos 16-14067 Pm00offf00f000mmm000 CAAACUUGAUAGGCUUGGA 153 so CTGF-825- 14068 000000000000s Pmoffff0000m000mom0 AGGUCUUGGAACAGGCGCU 154 16-14068 ssssso CTGF-926- 14069 000000000000s Pm000ffOOffmmm00000 CAGGUCAGCUUCGCAAGGC 155 16-14069 ssssso CTGF-923- 14070 000000000000s PmffOOffffOm0000mmmO GUCAGCUUCGCAAGGCCUG 156 16-14070 ssssso CTGF-866- 14071 000000000000s PmOfOffOffOmm00m00m0 GGCGUUGUCAUUGGUAACC 157 16-14071 ssssso Oligo AntiSense SEQ ID
ID Number Numbe Backbone AntiSense Chemistry AntiSense Sequence NO:
r CTGF-563- 14072 000000000000s Pmfofoffoomommmomoo CGUGCACUGGUACUUGCAG 158 16-14072 ssssso CTGF-823- 14073 000000000000s Pmffff0000f000mOmmmO GUCUUGGAACAGGCGCUCC 159 16-14073 ssssso CTGF-1233- 14074 000000000000s Pmf0f0fffff0m0m0mmm0 CCAUGUCUCCGUACAUCUU 160 16-14074 ssssso CTGF-924- 14075 000000000000s PmOffOOffffOm0000mm0 GGUCAGCUUCGCAAGGCCU 161 16-14075 ssssso CTGF-921- 14076 000000000000s PmOOffffOf0000mmm000 CAGCUUCGCAAGGCCUGAC 162 16-14076 ssssso CTGF-443- 14077 000000000000s Pmff0000ffOm00000000 GCCGAAGUCACAGAAGAGG 163 16-14077 ssssso CTGF-1041- 14078 000000000000s PmOf0000fff00mmm00m0 CACAGAAUUUAGCUCGGUA 164 16-14078 ssssso CTGF-1042- 14079 00000000000os PmfOf0000ffm00mmm000 CCACAGAAUWAGCUCGGU 165 16-14079 ssssso CTGF-755- 14080 0000000o0000s Pmff000fOfOmmmmmm000 GCCAAACGUGUCUUCCAGU 166 16-14080 ssssso CTGF-467- 14081 000000000000s PmfOf00ffffOmOmmOOmO GCCGAUCUUGCGGWGGCC 167 16-14081 ssssso CTGF-995- 14082 0000000ooooos Pmff000fffOOm000mmmO CUCAAACUUGAUAGGCUUG 168 16-14082 ssssso CTGF-927- 14083 000000000000s Pmf000ff00fmmmOm0000 CCAGGUCAGCWCGCAAGG 169 16-14083 ssssso sPPl-1091- 14131 0000000ooo0os PmffOOff000mOmO000mO UUUGACUAAAUGCAAAGUG 170 16-14131 ssssso PPIB--16- 14188 0000000000000 PmOfffffOfOOmm000mmO UGUUUUUGUAGCCAAAUCC 171 14188 ssssss Oligo AntiSense SEQ ID
ID Number Numbe Backbone AntiSense Chemistry AntiSense Sequence NO:
r PPIB -17 14189 0000000000000 PmofffffOf00mm000mmO UGUUUUUGUAGCCAAAUCC 172 14189 ssssss PPIB -18 14190 0000000000000 PmOfffffOf00mm00ommO UGUUUUUGUAGCCAAAUCC 173 14190 ssssss pGL3-1172- 14386 000000000000s Pm00ffOfOffmOmmoommO AAAUCGUAUUUGUCAAUCA 174 16-14386 ssssso pGL3-1172- 14387 0000000ooooos Pm00ff0f0ffm0mmoomm0 AAAUCGUAUUUGUCAAUCA 175 16-14387 ssssso miR-122-- 14391 14084 000000000000s PmffOOfffOf000000mOO UCUAAUUCAUGAGAAAUAC 616 ssssso 14085 000000000000s PmOOffOOfffm00000omO UAAUUGACCUCAGAAGAUG 617 ssssso 14086 000000000000s PmffOOffOOfmmm000000 UUUAAUUGACCUCAGAAGA 618 ssssso 14087 000000000000s PmOffO0ffff000000m00 AAUUGACCUCAGAAGAUGC 619 ssssso 14088 000000000000s Pmf00ffOOffmm0000000 UUAAUUGACCUCAGAAGAU 620 ssssso 14089 000000000000s PmffOOffff00000omOmO AUUGACCUCAGAAGAUGCA 621 ssssso 14090 000000000000s PmfOfff00ffOommmOmmO UCAUCCAGCUGACUCGUUU 622 ssssso 14091 000000000000s PmOfffOff0o0omoom00 AGAUUCAUCAGAAUGGUGA 623 ssssso Oligo AntiSense SEQ ID
ID Number Numbe Backbone AntiSense Chemistry AntiSense Sequence NO:
r 14092 000000000000s PmOOffffOOfmmOm000mO UGACCUCAGUCCAUAAACC 624 ssssso 14093 000000000000s PmOfOOf0000mmmOmm000 AAUGGUGAGACUCAUCAGA 625 ssssso 14094 000000000000s Pmff00ffffoommmOm000 UUUGACCUCAGUCCAUAAA 626 ssssso 14095 000000000000s PmffOfOOffOm0000mmmO UUCAUGGCUGUGAAAWCA 627 ssssso 14096 000000000000s PmOOfOOfO000mmmOmmOO GAAUGGUGAGACUCAUCAG 628 ssssso 14097 000000000000s Pm00ffffffommmOmOm00 UGGCUUUCCGCWAUAUAA 629 ssssso 14098 000000000000s Pmf00ffffffommmOmOmO UUGGCUUUCCGCUUAUAUA 630 ssssso 14099 000000000000s PmfOfffOfOfOOmmOm000 UCAUCCAUGUGGUCAUGGC 631 ssssso 14100 000000000000s PmfOfOOffOfOOmmmmm00 AUGUGGUCAUGGCUUUCGU 632 ssssso 14101 000000000000s Pmf00ffOf00mmmmmOmmO GUGGUCAUGGCUUUCGUUG 633 ssssso 14102 000000000000s PmffOOfffffmmmmOm00 AUUGGCUUUCCGCUUAUAU 634 ssssso 14103 000000000000s PmOOfOf0000mmmm000mO AAAUACGAAAUUUCAGGUG 635 ssssso 14104 000000000000s Pm000fOf0000mmmm000 AGAAAUACGAAAUUUCAGG 636 ssssso 14105 000000000000s Pm00ffOfOOfmmmmOmmOO UGGUCAUGGCUUUCGUUGG 637 ssssso Oligo AntiSense SEQ ID
ID Number Numbe Backbone AntiSense Chemistry AntiSense Sequence NO:
r 14106 000000000000s Pmf0ff0fff0m0m00mm00 AUAUCAUCCAUGUGGUCAU 638 ssssso 14107 000000000000s PmOfOf0000fmmm000m00 AAUACGAAAUUUCAGGUGU 639 ssssso 14108 000000000000s PmOff000000mmOmmm00 AAUCAGAAGGCGCGUUCAG 640 ssssso 14109 0000000000005 PmfffOf000000mOm0000 AWCAUGAGAAAUACGAAA 641 ssssso 14110 000000000000s PmfOfffOf0000000m000 CUAUUCAUGAGAGAAUAAC 642 ssssso 14111 000000000000s PmfffOff000mmmOmmm00 UUUCGUUGGACUUACUUGG 643 ssssso 14112 000000000000s PmfOfffffOfmOmm00mmO UUGCUCUCAUCAUUGGCUU 644 ssssso 14113 000000000000s Pmff00fffffmmmmmmm0 UUCAACUCCUCGCUWCCA 645 ssssso 14114 000000000000s PmOOffOffOOmmOmOmmOO UGACUAUCAAUCACAUCGG 646 ssssso 14115 0000000000005 Pmofofoffommm00mmm0 AGAUGCACUAUCUAAUUCA 647 ssssso 14116 000000000000s PmOf000fOfOmOmmm00m0 AAUAGAUACACAUUCAACC 648 ssssso 14117 000000000000s PmffffffOf0000m000m0 UUCUUCUAUAGAAUGAACA 649 ssssso 14118 000000000000s PmOffOff000m00mmOm00 AAUUGCUGGACAACCGUGG 650 ssssso 14119 000000000000s PmfOffffffOmOmOm0000 UCGCUUUCCAUGUGUGAGG 651 ssssso Oligo AntiSense SEQ ID
ID Number Numbe Backbone AntiSense Chemistry AntiSense Sequence NO:
r 14120 000000000000s PmOOfff000fmOmmmOmOO UAAUCUGGACUGCUUGUGG 652 ssssso 14121 000000000000s PmfOfOfffOOmmOOm0000 ACACAUUCAACCAAUAAAC 653 ssssso 14122 000000000000s PmfffOffffOm00mmOmmO ACUCGUUUCAUAACUGUCC 654 ssssso 14123 000000000000s Pmf00fff000mmOmmmOmO AUAAUCUGGACUGCUUGUG 655 ssssso 14124 000000000000s PmffffOfffOmOm00mmmO UUUCCGCUUAUAUAAUCUG 656 ssssso 14125 000000000000s PmOfffOOffOOmOmOOmOO UGUUUAACUGGUAUGGCAC 657 ssssso 14126 000000000000s PmOf0000f000mOm000mO UAUAGAAUGAACAUAGACA 658 ssssso 14127 000000000000s Pmffffff00fmomommmo UUUCCUUGGUCGGCGUUUG 659 ssssso 14128 000000000000s PmfOfOfOff0mmm00mmmO GUAUGCACCAUUCAACUCC 660 ssssso 14129 000000000000s Pmf00ffOffOmOmOmOmmO UCGGCCAUCAUAUGUGUCU 661 ssssso 14130 000000000000s PmOfff000ffOmmmOm000 AAUCUGGACUGCUUGUGGC 662 ssssso 14132 000000000000s PmfOff0000fOmmmOmm00 ACAUCGGAAUGCUCAUUGC 663 ssssso 14133 000000000000s Pm00fffff00mmOmm00mO AAGUUCCUGACUAUCAAUC 664 ssssso 14134 000000000000s PmfOOff000fOm0000mOO UUGACUAAAUGCAAAGUGA 665 ssssso Oligo AntiSense SEQ ID
ID Number Numbe Backbone AntiSense Chemistry AntiSense Sequence NO:
r 14135 000000000000s PmOfffOff000mmOOmOO AGACUCAUCAGACUGGUGA 666 ssssso 14136 000000000000s PmfOfOfOfOfmmOmmOm00 UCAUAUGUGUCUACUGUGG 667 ssssso 14137 000000000000s PmfofffffOfmmOm00m00 AUGUCCUCGUCUGUAGCAU 668 ssssso 14138 000000000000s Pm00fffOf00mm00mmmmO GAAUUCACGGCUGACUUUG 669 ssssso 14139 000000000000s Pmfofffff000mmm000mO UUAUUUCCAGACUCAAAUA 670 ssssso 14140 000000000000s Pm000ffOf000mm000mmO GAAGCCACAAACUAAACUA 671 ssssso 14141 000000000000s PmffffOff000mmmOmmmO CUUUCGUUGGACUUACUUG 672 ssssso 14142 000000000000s PmfffOf0000mmmmmm000 GUCUGCGAAACUUCUUAGA 673 ssssso 14143 000000000000s PmofOfffOffommmmmOmO AAUGCUCAUUGCUCUCAUC 674 ssssso 14144 000000000000s PmfOfOffOffm00mmmOmO AUGCACUAUCUAAUUCAUG 675 ssssso 14145 000000000000s Pmff0fOf0fOmmOmmm000 CUUGUAUGCACCAUUCAAC 676 ssssso 14146 000000000000s Pm00fffOfffmOmOOmm00 UGACUCGUUUCAUAACUGU 677 ssssso 14147 000000000000s Pmff00fOfffm00mmOmmO UUCAGCACUCUGGUCAUCC 678 ssssso 14148 000000000000s PmOOfffOfOOmmOm00000 AAAUUCAUGGCUGUGGAAU 679 ssssso Oligo AntiSense SEQ ID
ID Number Numbe Backbone AntiSense Chemistry AntiSense Sequence NO:
r 14149 000000000000s PmfOfffOOffOOm000mmO ACAUUCAACCAAUAAACUG 680 ssssso 14150 000000000000s PmOfOfOfffOOmmOOm000 UACACAUUCAACCAAUAAA 681 ssssso 14151 000000000000s Pmff00ffoffmmm000mmO AUUAGUUAUUUCCAGACUC 682 ssssso 14152 000000000000s PmffffOfffOm00000000 UUUCUAUUCAUGAGAGAAU 683 ssssso 14153 000000000000s PmffOOffOffOOm000mmO UUCGGUUGCUGGCAGGUCC 684 ssssso 14154 000000000000s PmOfOfOfO00OmOOmOmmO CAUGUGUGAGGUGAUGUCC 685 ssssso 14155 000000000000s PmfOffOfff00mmmmmm00 GCACCAUUCAACUCCUCGC 686 ssssso 14156 000000000000s PmOfff00ff00mmmOmmmO CAUCCAGCUGACUCGUUUC 687 ssssso 14157 000000000000S PmfffffofffomOm00mmO CUUUCCGCUUAUAUAAUCU 688 ssssso 14158 000000000000s PmOffOfOff0000mOmmmO AAUCACAUCGGAAUGCUCA 689 ssssso 14159 000000000000s PmfOfOffOOfmOmmmmm00 ACACAWAGUUAUUUCCAG 690 ssssso 14160 000000000000s PmfffOf0000m000mOmOO UUCUAUAGAAUGAACAUAG 691 ssssso 14161 000000000000s PmOfOOfOOfOOmmmOmOmO UACAGUGAUAGUUUGCAUU 692 ssssso 14162 000000000000s Pmf000fOOffOOmOmmOmO AUAAGCAAUUGACACCACC 693 ssssso Oligo AntiSense SEQ ID
ID Number Numbe Backbone AntiSense Chemistry AntiSense Sequence NO:
r 14163 000000000000s PmffOffOOffOmm000mOO UUUAUUAAUUGCUGGACAA 694 ssssso 14164 000000000000s PmfOff0000fmmmm0000 UCAUCAGAGUCGUUCGAGU 695 ssssso 14165 000000000000s pmf000ffOfOmmOmmOmmO AUAAACCACACUAUCACCU 696 ssssso 14166 000000000000s PmfOffOff00mmmmmmOmO UCAUCAUUGGCUUUCCGCU 697 ssssso 14167 000000000000s Pmfffff00fmOmm00mmO AGUUCCUGACUAUCAAUCA 698 ssssso 14168 000000000000s PmffOfOOffOOmmmm0000 UUCACGGCUGACUUUGGAA 699 ssssso 14169 000000000000s PmffffOfOOfOOm000mmO UUCUCAUGGUAGUGAGUUU 700 ssssso 14170 000000000000s PmOff00fff0mmmOOmmOO AAUCAGCCUGUUUAACUGG 701 ssssso 14171 000000000000s PmOffff00fOmmmmOOmmO GGUUUCAGCACUCUGGUCA 702 ssssso 14172 000000000000s Pmff0000fOfmmOmmOmmO AUCGGAAUGCUCAUUGCUC 703 ssssso 14173 000000000000s PmOOffOf0000mmmOm000 UGGCUGUGGAAUUCACGGC 704 ssssso 14174 000000000000s Pm000fOOffOOmOmmOmmO UAAGCAAUUGACACCACCA 705 ssssso 14175 000000000000s PMOOfffffOfOOmOOm000 CAAUUCUCAUGGUAGUGAG 706 ssssso 14176 000000000000s Pm00fffffOfm000mmm00 UGGCUUUCGUUGGACUUAC 707 ssssso Oligo AntiSense SEQ ID
ID Number Numbe Backbone AntiSense Chemistry AntiSense Sequence NO:
r 14177 000000000000s PmOffOOfOOfmOOmmmOmO AAUCAGUGACCAGUUCAUC 708 ssssso 14178 00000000000os Pmfffof000mmomommoo AGUCCAUAAACCACACUAU 709 ssssso 14179 00000000000os Pmoofoffffoommommmoo CAGCACUCUGGUCAUCCAG 710 ssssso 14180 000000000000s Pm0ff0OffOfOmm0000m0 UAUCAAUCACAUCGGAAUG 711 ssssso 14181 000000000000s Pmfff0f00ff00mmmm000 AUUCACGGCUGACUUUGGA 712 ssssso 14182 000000000000s Pmf000fOfOfOmmm00mm0 AUAGAUACACAUUCAACCA 713 ssssso 14183 000060000000S Pmffff000ffm00om0000 UUUCCAGACUCAAAUAGAU 714 .ssssso 14184 000000000000s PmfOOffOff000mOOmmOO UUAAUUGCUGGACAACCGU 715 ssssso 14185 000000000000s PmOffOOffOfm000mOOmO UAUUAAUUGCUGGACAACC 716 ssssso 14186 000000000000s PmffOfff00omm00m000 AGUCGUUCGAGUCAAUGGA 717 ssssso 14187 00000000000os PmffOffOOfO0ommmOmOO GUUGCUGGCAGGUCCGUGG 718 ssssso TABLE 2: Antisense backbone, chemistry, and sequence information. o:
phosphodiester; s:
phosphorothioate; P: 5' phosphorylation; 0: 2'-OH; F: 2'-fluoro; m: 2' 0-methyl; +: LNA
modification. Capital letters in the sequence signify riobonucleotides, lower case letters signify deoxyribonucleotides.

OHang T ID Number Number Sense Sense Backbone Sense Chemistry Sense Sequence SEQ ID
Chem.
APOB-10167- 12138 chl 000000000000000 00000000000000000 GUCAUCACACUGAAUAC 176 20-12138 0000so 000 CAAU

Oligo OHang ID Number Number Sense Sense Backbone Sense Chemistry Sense Sequence SEQ ID
Chem.
APOB-10167- 12139 chi 000000000000000 00000000000000000 GUGAUCAGACUCAAUAC 177 20-12139 ooooso 000 GAAU
MAP4K4-2931- 12266 chi oooooooooosso mmOm00000mmmO CUGUGGAAGUCUA 178 MAP4K4-2931- 12293 chi oooooooooosso mmOm00000mmmO CUGUGGAAGUCUA 179 MAP4K4-2931- 12383 chi ooooooooooooo mmOm00000mmmO CUGUGGAAGUCUA 180 MAP4K4-2931- 12384 chi ooooooooooooo mmOm00000mmmO CUGUGGAAGUCUA 181 MAP4K4-2931- 12385 chi ooooooooooooo mmOm00000mmmO CUGUGGAAGUCUA 182 MAP4K4-2931- 12386 chi oooooooooosso OmmOm00000mmm0 CUGUGGAAGUCUA 183 16-12387 12387 chi ooooooooooooo mmOm00000mmmO CUGUGGAAGUCUA 184 MAP4K4-2931- 12388 chi ooooooooooooo mmOm00000mmmO CUGUGGAAGUCUA 185 MAP4K4-2931- 12432 chi 0000000000000 oY547mmOm00000mmm CUGUGGAAGUCUA 186 -122-2931- 12266 chi oooooooooooss mmOm00000mmmO CUGUGGAAGUCUA 187 13-12266.2 .2 12434 12434 chi ooooso 000 CAAU 188 APOB--21- 12435 chi 000000000000000 DY547000000000000 GUGAUCAGACUCAAUAC 189 12435 ooooso 00000000 GAAU

16-12451 12451 chi oooooooooooss 0mmOm00000mmm0 CUGUGGAAGUCUA 190 16-122452 12452 chi oooooooooooss mmOm00000mmmO CUGUGGAAGUCUA 191 MAP4K4-2931- 12453 chi oooooooooooss mmOm00000mmmO CUGUGGAAGUCUA 192 17-12454 12454 chi oooooooooooss OmmOm00000mmm0 CUGUGGAAGUCUA 193 17-12455 12455 chi oooooooooooss mmOm00000mmmO CUGUGGAAGUCUA 194 MAP4K4-2931- 12456 chi oooooooooooss mmOm00000mmmO CUGUGGAAGUCUA 195 --27-12480 12480 chi 000000000000000 DY547mmOf000fOO55 UCAUAGGUAACCUCUGG 196 ooooooooosso f5fOOmm00000m000 UUGAAAGUGA
--27-12481 12481 chi 000000000000000 DY547mm05f05000f0 CGGCUACAGGUGCUUAU 197 0000ooooosso 5ffOm00000000m00 GAAGAAAGUA

21-12505 12505 chi OOOOOS 0000 CAAU 198 APOB-10167- 12506 chi 000000000000000 00000000000000000 GUGAUCAGACUCAAUAC 199 MAP4K4-2931- 12539 chi oooooooooooss DY547mmOm00000mmm 21-12505.2 .2 chi ooooso 000 CAAU 201 21-12506.2 .2 chi ooooso 000 GAAU 202 MAP4K4--13- 12565 Chi 0000000000000 mOm0000mOmmmO UGUAGGAUGUCUA 203 .2 12386 16-122386..2 , chi 0000000000000 OmmOm00000mmmO CUGUGGAAGUCUA 204 MAP4K4-2931- 12815 chi 0000000000000 0MOMOmOmO mOmOmOmOmOm 13-12815 mOmO CUGUGGAAGUCUA 205 APOB--13- 12957 Chi oooooooooooss Ommmmmmmmmmmmm ACUGAAUACCAAU 206 Oligo ID Number Number Sense Sense Backbone Sense Chemistry Sense Sequence SEQ
ID
Chem.

MAP4K4--16- 12983 chl o00000oooooss mmOm00000mmmO CUGUGGAAGUCUA 207 MAP4K4--16- 12984 Chl 00000000000000 mmOm00000mmm0 CUGUGGAAGUCUA 208 MAP4K4--16- 12985 chl oooooooooosso mmmmmmmmmmmmm CUGUGGAAGUCUA 209 MAP4K4--16- 12986 chl oooooooooosso mmmmmmmmmmmmm CUGUGGAAGUCUA 210 MAP4K4--16- 12987 chl oooooooooosso mmOm00000mmmO CUGUGGAAGUCUA 211 MAP4K4--16- 12988 chl oooooooooosso mmOm00000mmmO CUGUGGAAGUCUA 212 MAP4K4--16- 12989 chl oooooooooosso mmOm00000mmmO CUGUGGAAGUCUA 213 MAP4K4--16- 12990 chl oooooooooosso mmOm00000mmmO CUGUGGAAGUCUA 214 MAP4K4--16- 12991 chl oooooooooosso mmOm00000mmmO CUGUGGAAGUCUA 215 MAP4K4--16- 12992 chl oooooooooosso mmOm00000mmmO CUGUGGAAGUCUA 216 12993 12993 chl oooooooooosso mmOm00000mmmO CUGUGGAAGUCUA 217 MAP4K4--16- 12994 chl oooooooooosso mmOm00000mmmO CUGUGGAAGUCUA 218 MAP4K4--16- 12995 chl oooooooooosso mmOm00000mmmO CUGUGGAAGUCUA 219 MAP4K4-2931- 13012 chl 000000000000000 00000000000000000 AGAGUUCUGUGGAAGUC 220 19-13016 13016 chl 0000 000000000 UA 221 PPIB--13- 13021 Chl 0000000000000 OmmmOOmmOm000 AUUUGGCUACAAA 222 pGL3-1172 13038 chl 0000 13-13038 000000000 OOm000mOm00mmm ACAAAUACGAUUU 223 pGL3-1172- 13040 chl 0000000000000 DY5470m000mOmOOmm ACAAAUACGAUUU 224 13-13040 m --16-13047 13047 Chl 00000000000000 mmOm00000mmmO CUGUGGAAGUCUA 225 S0D1-530-13- 13090 chl 0000000000000 OOm00000000mO AAUGAAGAAAGUA 226 SOD1-523-13- 13091 chl 0000000000000 000m00000m000 AGGUGGAAAUGAA 227 SOD1-535-13- 13092 chl 0000000000000 000000mOm0000 AGAAAGUACAAAG 228 SOD1-536-13- 13093 chl 0000000000000 00000mOm00000 GAAAGUACAAAGA 229 SOD1-396-13- 13094 chl 0000000000000 OmOmOOmmOmm00 AUGUGACUGCUGA 230 SOD1-385-13- 13095 chl 0000000000000 000mmm000m00m AGACUUGGGCAAU 231 SOD1-195-13- 13096 chl 0000000000000 Ommmm000m0000 AUUUCGAGCAGAA 232 APOB-4314- 13115 Chl 0000000000000 Ommm0000000mO AUCUGGAGAAACA 233 APOB-3384- 13116 Chl 0000000000000 mm0000m000000 UCAGAACAAGAAA 234 APOB-3547- 13117 Chl 0000000000000 00mmm0mmm0mm0 GACUCAUCUGCUA 235 APOB-4318- 13118 Chl 0000000000000 0000000mOOmOm GGAGAAACAACAU 236 APOB-3741- 13119 Chl 0000000000000 00mmmmmm000m0 AGUCCCUCAAACA 237 Oligo OHang ID Number Number Sense Sense Backbone Sense Chemistry Sense Sequence SEQ ID
:
Chem.
PPIB--16- 13136 Chl 00000000000000 OOmmOm00000mO GGCUACAAAAACA 238 APOB-4314- 13154 chl 00000000000000 000mmm0000000m0 AGAUCUGGAGAAACA 239 APOB-3547- 13155 chl 00000000000000 m000mmmOmmmOmmO UGGACUCAUCUGCUA 240 APOB-4318- 13157 chl 00000000000000 mm0000000mOOmOm CUGGAGAAACAACAU 241 APOB-3741- 13158 chl 00000000000000 0000mmmmmm000m0 AGAGUCCCUCAAACA 242 APOB--13- 13159 chl 000000000000 Omm000mOmmOOm ACUGAAUACCAAU 243 APOB--15- 13160 chl 00000000000000 OmOmm000mOmmOOm ACACUGAAUACCAAU 244 SOD1-530-16- 13163 chl 0000000000000 OOm00000000mO AAUGAAGAAAGUA 245 SOD1-523-16- 13164 chl 0000000000000 000m00000m000 AGGUGGAAAUGAA 246 SOD1-535-16- 13165 chl 0000000000000 000000mOm0000 AGAAAGUACAAAG 247 SOD1-536-16- 13166 chl 0000000000000 00000mOm00000 GAAAGUACAAAGA 248 SOD1-396-16- 13167 chl 0000000000000 OmOmOOmmOmmOO AUGUGACUGCUGA 249 SOD1-385 16 13168 chi 0000000000000 000mmm000m00m AGACUUGGGCAAU 250 SOD1-195-16- 13169 chl 0000000000000 0mmmm000m0000 AUUUCGAGCAGAA 251 pGL3-1172- 13170 chl 0000000000000 0m000mOm00mmm ACAAAUACGAUUU 252 pGL3-1172- 13171 chl 0000000000000 DY5470m000mOm00mm ACAAAUACGAUUU 253 16-13171 m MAP4k4-2931- 000000000000000 00000000000000000 AGAGUUCUGUGGAAGUC
19-13189 13189 chl 0000 0000 UA 254 CTGF-1222 13190 Chl 0000000000000 Om0000000mOmO ACAGGAAGAUGUA 255 CTGF-813-13- 13192 Chl 0000000000000 000m0000mOmmm GAGUGGAGCGCCU 256 CTGF-747-13- 13194 Chl 0000000000000 m00mm000000m0 CGACUGGAAGACA 257 CTGF-817-13- 13196 Chl 0000000000000 0000m0mmm0mmm GGAGCGCCUGUUC 258 CTGF-1174- 13198 Chl 0000000000000 OmmOmmOmOOmmO GCCAUUACAACUG 259 CTGF-1005- 13200 Chl 0000000000000 000mmmmmm00mm GAGCUUUCUGGCU 260 CTGF-814-13- 13202 Chl 0000000000000 00m0000mOmmm0 AGUGGAGCGCCUG 261 CTGF-816-13- 13204 Chl 0000000000000 m0000mOmmmOmm UGGAGCGCCUGUU 262 CTGF-1001- 13206 Chl 0000000000000 0mmm000mmmmmm GUUUGAGCUUUCU 263 CTGF-1173- 13208 Chl 0000000000000 mOmmOmmOm00mm UGCCAUUACAACU 264 CTGF-749-13- 13210 Chl 0000000000000 Omm000000mOmO ACUGGAAGACACG 265 CTGF-792-13- 13212 Chl 0000000000000 00mm0mmm00mmm AACUGCCUGGUCC 266 CTGF-1162- 13214 Chl 0000000000000 000mmmOmOmmmO AGACCUGUGCCUG 267 CTGF-811-13- 13216 Chl 0000000000000 m0000m0000mOm CAGAGUGGAGCGC 268 CTGF-797-13- 13218 Chl 0000000000000 mmm00mmm000mm CCUGGUCCAGACC 269 OHang SEQ ID Number Number sense Sense Backbone Sense Chemistry Sense Sequence ID
Chem. NO:
O
CTGF-1175- 13220 Chl 0000000000000 mmOmmOm00mmOm CCAUUACAACUGU 270 CTGF-1172- 13222 Chl 0000000000000 mmOmmOmm0m00m CUGCCAUUACAAC 271 CTGF-1177- 13224 Chl 0000000000000 OmmOm00mmOmmm AUUACAACUGUCC 272 CTGF-1176- 13226 Chl 0000000000000 m0mm0m00mm0mm CAUUACAACUGUC 273 CTGF-812-13- 13228 Chl 0000000000000 0000m0000mOmm AGAGUGGAGCGCC 274 CTGF-745-13- 13230 Chl 0000000000000 OmmOOmm000000 ACCGACUGGAAGA 275 CTGF-1230- 13232 Chl 0000000000000 OmOmOm00000mO AUGUACGGAGACA 276 CTGF-920-13- 13234 Chl 0000000000000 OmmmmOm0000mm GCCUUGCGAAGCU 277 CTGF-679-13- 13236 Chl 0000000000000 OmmOm000000mO GCUGCGAGGAGUG 278 CTGF-992-13- 13238 Chl 0000000000000 Ommm0mm000mmm GCCUAUCAAGUUU 279 CTGF-1045- 13240 Chl 0000000000000 OOmmmmOm0000m AAUUCUGUGGAGU 280 CTGF-1231 13242 Chi 0000000000000 mOmOm00000mOm UGUACGGAGACAU 281 13244 Chi 0000000000000 OOmmmOmm000mm AGCCUAUCAAGUU 282 CTGF-998-13- 13246 Chl 0000000000000 m000mmm000mmm CAAGUUUGAGCUU 283 CTGF-1049 13248 Chl 0000000000000 mmOm0000mOmOm CUGUGGAGUAUGU 284 CTGF-1044 13250 Chl 0000000000000 000mmmmOm0000 AAAUUCUGUGGAG 285 CTGF-1327- 13252 Chl 0000000000000 mmmm00m00m0m0 UUUCAGUAGCACA 286 CTGF-1196 13254 Chl 0000000000000 mO0m00mOmmmmm CAAUGACAUCUUU 287 CTGF-562-13 13256 Chl 0000000000000 OOmOmmOOmOmOm AGUACCAGUGCAC 288 CTGF-752-13 13258 Chi 0000000000000 000000mOmOmmm GGAAGACACGUUU 289 13260 Chi 0000000000000 mm0mm000mmm00 CUAUCAAGUUUGA 290 CTGF-1040- 13262 Chl 0000000000000 OOmm000mmmm0m AGCUAAAUUCUGU 291 13-13264 13264 Chl 0000000000000 000m0000mOmOO AGGUAGAAUGUAA 292 CTGF-2195- 13266 Chl 0000000000000 OOmm00mmO0mmm AGCUGAUCAGUUU 293 CTGF-2043 13268 Chl 0000000000000 mmmmOmmm000m0 UUCUGCUCAGAUA 294 CTGF-1892- 13270 Chl 0000000000000 mm0mmm000mm00 UUAUCUAAGUUAA 295 CTGF-1567 13272 Chi 0000000000000 mOmOm000mOOmO UAUACGAGUAAUA 296 CTGF-1780- 13274 Chl 0000000000000 OOmm000mOOmmm GACUGGACAGCUU 297 CTGF-2162- 13276 Chl 0000000000000 Om00mmmmmOmmO AUGGCCUUUAUUA 298 CTGF-1034- 13278 Chl 0000000000000 OmOmm000mm000 AUACCGAGCUAAA 299 CTGF-2264- 13280 Chl 0000000000000 mmOmm00000mOm UUGUUGAGAGUGU 300 CTGF-1032- 13282 Chl 0000000000000 OmOmOmm000mmO ACAUACCGAGCUA 301 Oligo OHang SEQ ID Number Number Sense Sense Backbone Sense Chemistry Sense Sequence NO: ID
Chem.
CTGF-1535- 13284 Chl 0000000000000 00m0000000mm0 AGCAGAAAGGUUA 302 CTGF-1694- 13286 Chl 0000000000000 00mm0mmmmmm00 AGUUGUUCCUUAA 303 CTGF-1588- 13288 Chl 0000000000000 Ommm0000mOm00 AUUUGAAGUGUAA 304 CTGF-928-13- 13290 Chl 0000000000000 000mm00mmm000 AAGCUGACCUGGA 305 CTGF-1133- 13292 Chl 0000000000000 OOmmOm0000000 GGUCAUGAAGAAG 306 CTGF-912-13- 13294 Chl 0000000000000 0m00mm000mmmm AUGGUCAGGCCUU 307 CTGF-753-13- 13296 Chl 0000000000000 00000mOmOmmmO GAAGACACGUUUG 308 CTGF-918-13- 13298 Chl 0000000000000 000mmmmOm0000 AGGCCUUGCGAAG 309 CTGF-744-13- 13300 Chl 0000000000000 mOmmOmm00000 UACCGACUGGAAG 310 CTGF-466-13- 13302 Chl 0000000000000 0mm0m0000mm0 ACCGCAAGAUCGG 311 CTGF-917-13- 13304 Chl 0000000000000 m000mmmmOm000 CAGGCCUUGCGAA 312 CTGF-1038 13306 Chl 0000000000000 m000mm000mmmm CGAGCUAAAUUCU 313 CTGF-1048 13308 Chi 0000000000000 mmmOm0000mOm0 UCUGUGGAGUAUG 314 CTGF-1235 13310 Chi 0000000000000 m00000mOmOOm0 CGGAGACAUGGCA 315 CTGF-868-13- 13312 Chl 0000000000000 0m00m00m0mmmm AUGACAACGCCUC 316 CTGF-1131 13314 Chi 0000000000000 0000mmOm00000 GAGGUCAUGAAGA 317 13-1-1043 13316 Chl 0000000000000 m000mmmmOm000 UAAAUUCUGUGGA 318 CTGF-751-13- 13318 Chl 0000000000000 m000000mOmOmm UGGAAGACACGUU 319 CTGF-1227- 13320 Chl 0000000000000 0000mOmOm0000 AAGAUGUACGGAG 320 CTGF-867-13- 13322 Chl 0000000000000 OOmOOmOOmOmmm AAUGACAACGCCU 321 CTGF 13324 Chl 0000000000000 00m0000mmOm00 GGCGAGGUCAUGA 322 CTGF-756 13 13326 Chl 0000000000000 00m0m0mmmOOmm GACACGUUUGGCC 323 CTGF-1234- 13328 Chl 0000000000000 Om00000mOmOOm ACGGAGACAUGGC 324 13330 Chl 0000000000000 mm000mmmm0m00 UCAGGCCUUGCGA 325 CTGF-925-13- 13332 Chl 0000000000000 0m0000mm00mmm GCGAAGCUGACCU 326 CTGF-1225- 13334 Chl 0000000000000 000000mOmOm00 GGAAGAUGUACGG 327 13336 Chi 0000000000000 Om00mmmmoommm GUGACUUCGGCUC 328 CTGF-446-13- 13338 Chl 0000000000000 m0ommmm00mmmm UGACUUCGGCUCC 329 CTGF-913-13- 13340 Chl 0000000000000 m00mm000mmmm0 UGGUCAGGCCUUG 330 13342 13342 Chl 0000000000000 mm000mmm000mm UCAAGUUUGAGCU 331 CTGF-277-13- 13344 Chl 0000000000000 Omm0000mmOm00 GCCAGAACUGCAG 332 CTGF-1052 13346 Chl 0000000000000 m0000mOmOmOmm UGGAGUAUGUACC 333 OHang ID Number N r Sense Sense Backbone Sense Chemistry Sense Sequence SEQ ID umb Chem.

13348 13348 Chl 0000000000000 0mm0000000m00 GCUAGAGAAGCAG 334 CTGF-914-13- 13350 Chl 0000000000000 00mm000mmmm0m GGUCAGGCCWGC 335 CTGF-1039- 13352 Chl 0000000000000 000mm000mmmm0 GAGCUAAAUUCUG 336 CTGF-754-13- 13354 Chl 0000000000000 0000mOmOmmm00 AAGACACGUUUGG 337 CTGF-1130- 13356 Chl 0000000000000 m0000mmOm0000 CGAGGUCAUGAAG 338 CTGF-919-13- 13358 Chl 0000000000000 00mmmmOm0000m GGCCUUGCGAAGC 339 CTGF-922-13- 13360 Chl 0000000000000 mmmOm0000mm00 CUUGCGAAGCUGA 340 CTGF-746-13- 13362 Chl 0000000000000 mm00mm000000m CCGACUGGAAGAC 341 CTGF-993-13- 13364 Chl 0000000000000 mmm0mm000mmm0 CCUAUCAAGUUUG 342 CTGF-825-13- 13366 Chl 0000000000000 mOmmmm0000mmm UGUUCCAAGACCU 343 CTGF-926-13- 13368 Chl 0000000000000 m0000mm00mmm0 CGAAGCUGACCUG 344 13370 Chi 0000000000000 mmOm0000mm00m UUGCGAAGCUGAC 345 CTGF-866-13- 13372 Chl 0000000000000 mOOmOOmOOmOmm CAAUGACAACGCC 346 CTGF-563-13- 13374 Chl 0000000000000 OmOmmOOmOmOmO GUACCAGUGCACG 347 CTGF-823-13- 13376 Chl ooooooooooooo mmmOmmmm0000m CCUGUUCCAAGAC 348 CTGF-1233- 13378 Chl 0000000000000 mOm00000mOm00 UACGGAGACAUGG 349 CTGF-924-13- 13380 Chl 0000000000000 mOm0000mmOOmm UGCGAAGCUGACC 350 CTGF-921-13- 13382 Chl 0000000000000 mmmmOm0000mm0 CCUUGCGAAGCUG 351 CTGF-443-13- 13384 Chl 0000000000000 mm0m00mmmm00m CUGUGACUUCGGC 352 CTGF-1041- 13386 Chl 0000000000000 0mm000mmmm0m0 GCUAAAUUCUGUG 353 CTGF-1042- 13388 Chl 0000000000000 mm000mmmm0m00 CUAAAUUCUGUGG 354 CTGF-755-13- 13390 Chl 0000000000000 000mOmOmmmOOm AGACACGUUUGGC 355 CTGF-467-13- 13392 Chl 0000000000000 mmOm0000mm00m CCGCAAGAUCGGC 356 CTGF-995-13- 13394 Chl 0000000000000 mOmm000mmm000 UAUCAAGUUUGAG 357 CTGF-927-13- 13396 Chl 0000000000000 0000mm00mmm00 GAAGCUGACCUGG 358 13-13398 13398 Chl 0000000000000 mmmOm000mm000 CUCAUGAAUUAGA 359 SPP1-1049- 13400 Chl 0000000000000 mm0000mm00mm0 CUGAGGUCAAUUA 360 SPP1-1051- 13402 Chl 0000000000000 0000mm00mm000 GAGGUCAAUUAAA 361 SPP1-1048- 13404 Chl 0000000000000 mmm0000mm00mm UCUGAGGUCAAUU 362 SPP1-1050- 13406 Chl 0000000000000 m0000mm00mm00 UGAGGUCAAUUAA 363 SPP1-1047- 13408 Chl 0000000000000 mmmm0000mm00m UUCUGAGGUCAAU 364 SPP1-800-13- 13410 Chl 0000000000000 0mm00mm000m00 GUCAGCUGGAUGA 365 OHang ID Number Number Sense Sense Backbone Sense Chemistry Sense Sequence SEQ ID
Chem.
SPP1-492-13- 13412 Chl 0000000000000 mmmm00m000mmm UUCUGAUGAAUCU 366 SPP1-612-13- 13414 Chl 0000000000000 m000mm0000mm0 UGGACUGAGGUCA 367 SPPl-481-13- 13416 Chl 0000000000000 000mmmmOmmOmm GAGUCUCACCAUU 368 SPP1-614-13- 13418 Chl 0000000000000 00mm0000mm000 GACUGAGGUCAAA 369 SPP1-951-13- 13420 Chl 0000000000000 mmOmOOmmOm000 UCACAGCCAUGAA 370 SPP1-482-13- 13422 Chl 0000000000000 00mmmmOmmOmmm AGUCUCACCAUUC 371 SPP1-856-13- 13424 Chl 0000000000000 000m000000mm0 AAGCGGAAAGCCA 372 SPP1-857-13- 13426 Chl 0000000000000 00m000000mm00 AGCGGAAAGCCAA 373 SPP1-365-13- 13428 Chl 0000000000000 OmmOmOm000mOO ACCACAUGGAUGA 374 SPP1-359-13- 13430 Chl 0000000000000 OmmOmOOmmOmOm GCCAUGACCACAU 375 SPP1-357-13- 13432 Chl 0000000000000 000mmOmOOmmOm AAGCCAUGACCAC 376 SPP1-858-13- 13434 Chl 0000000000000 0m000000mm00m GCGGAAAGCCAAU 377 SPP1-1012- 13436 Chl 0000000000000 000mmmm0m0mmm AAAUUUCGUAUUU 378 SPP1-1014- 13438 Chl 0000000000000 OmmmmOmOmmmmm AUUUCGUAUUUCU 379 SPP1-356-13- 13440 Chl 0000000000000 0000mmOmOOmmO AAAGCCAUGACCA 380 SPP1-368-13- 13442 Chl 0000000000000 OmOm000m00mOm ACAUGGAUGAUAU 381 SPP1-1011- 13444 Chl 0000000000000 0000mmmmOmOmm GAAAUUUCGUAUU 382 SPP1-754-13- 13446 Chl 0000000000000 0m0mmmmmm00mm GCGCCUUCUGAUU 383 SPP1-1021- 13448 Chl 0000000000000 OmmmmmmOm000m AUUUCUCAUGAAU 384 SPP1-1330- 13450 Chl 0000000000000 mmmmm0m000m00 CUCUCAUGAAUAG 385 SPP1-346-13- 13452 Chl 0000000000000 000mmm00m0000 AAGUCCAACGAAA 386 SPP1-869-13- 13454 Chl 0000000000000 0m00m00000m00 AUGAUGAGAGCAA 387 SPP1-701-13- 13456 Chl 0000000000000 Om000000mm000 GCGAGGAGUUGAA 388 SPP1-896-13- 13458 Chl 0000000000000 mOOmmOOmOOmmO UGAUUGAUAGUCA 389 SPP1 1035 13460 Chl 0000000000000 000mOOmOmOmmm AGAUAGUGCAUCU 390 .13-13460 SPP1-1170- 13462 Chl 0000000000000 OmOmOmOmmmOmm AUGUGUAUCUAUU 391 SPP1-1282- 13464 Chl 0000000000000 mmmmOm0000000 UUCUAUAGAAGAA 392 SPP1-1537- 13466 Chl 0000000000000 mmOmmm00m00mm UUGUCCAGCAAUU 393 13468 Chl 0000000000000 0mOm000000m00 ACAUGGAAAGCGA 394 SPP1-840-13- 13470 Chl 0000000000000 0m00mmm000mm0 GCAGUCCAGAUUA 395 SPP1-1163- 13472 Chl 0000000000000 mOOmm000mOmOm UGGUUGAAUGUGU 396 SPP1-789-13- 13474 Chi 0000000000000 mmOm0000m000m UUAUGAAACGAGU 397 OHang Oligo ID Number Number Sense Sense Backbone Sense, Chemistry Sense Sequence Chem. SEQ ID
:

SPP1-841-13- 13476 Chl 0000000000000 m00mmm000mm0m CAGUCCAGAUUAU 398 SPP1-852-13- 13478 Chl 0000000000000 0m0m000m00000 AUAUAAGCGGAAA 399 SPP1-209-13- 13480 Chl 0000000000000 mOmm00mm000mO UACCAGUUAAACA 400 SPP1-1276- 13482 Chl 0000000000000 m0mmm0mmmm0m0 UGUUCAUUCUAUA 401 SPP1-137-13- 13484 Chl 0000000000000 mm00mm0000000 CCGACCAAGGAAA 402 SPP1-711-13- 13486 Chl 0000000000000 000m00mOmOmOm GAAUGGUGCAUAC 403 SPP1-582-13- 13488 Chl 0000000000000 OmOm00mOOmm00 AUAUGAUGGCCGA 404 SPP1-839-13- 13490 Chl 0000000000000 00m00mmm000mm AGCAGUCCAGAUU 405 SPP1-1091- 13492 Chl 0000000000000 OmOmmm0Omm000 GCAUUUAGUCAAA 406 SPP1-884-13- 13494 Chl 0000000000000 00mOmmmm00m0m AGCAUUCCGAUGU 407 SPP1-903-13- 13496 Chl 0000000000000 m00mm00000mmm UAGUCAGGAACUU 408 13-13498 13498 Chl 0000000000000 mOm0mmm00mm00 UGCAUUUAGUCAA 409 SPP1-474-13- 13500 Chl 0000000000000 0mmm00m000mmm GUCUGAUGAGUCU 410 SPPl-575-13- 13502 Chl 0000000000000 m000mOmOmOm00 UAGACACAUAUGA 411 SPP1-671-13- 13504 Chl 0000000000000 m000m00000m0m CAGACGAGGACAU 412 SPP1-924-13- 13506 Chl 0000000000000 m00mm0m000mmm CAGCCGUGAAWC 413 SPP1-1185- 13508 Chl 0000000000000 00mmm00000m00 AGUCUGGAAAUAA 414 SPP1-1221- 13510 Chl 00000000 13-13510 00000 O0mmm0m00mmmm AGUUUGUGGCWC 415 SPP1-347-13- 13512 Chl 0000000000000 00mmm00m00000 AGUCCAACGAAAG 416 SPP1-634-13- 13514 Chl 0000000000000 000mmmmOm000m AAGUUUCGCAGAC 417 SPP1-877-13- 13516 Chl 0000000000000 OOm00m000mOmm AGCAAUGAGCAUU 418 SPP1-1033- 13518 Chl 0000000000000 mm000m00mOmOm UUAGAUAGUGCAU 419 SPP1-714-13- 13520 Chl 0000000000000 m00mOmOmOm000 UGGUGCAUACAAG 420 SPP1-791-13- 13522 Chl 0000000000000 0m0000m000mm0 AUGAAACGAGUCA 421 SPP1-813-13- 13524 Chl 0000000000000 mm0000mOmm000 CCAGAGUGCUGAA 422 SPPl-939-13- 13526 Chl 0000000000000 m00mmOm000mmm CAGCCAUGAAUUU 423 SPP1-1161- 13528 Chl 0000000000000 OmmOOmm000mOm AUUGGUUGAAUGU 424 SPP1-1164- 13530 Chl 0000000000000 00mm000mOmOmO GGUUGAAUGUGUA 425 SPP1-1190- 13532 Chl 0000000000000 00000m00mm00m GGAAAUAACUAAU 426 13-13534 13534 Chi 0000000000000 mmOm000m00000 UCAUGAAUAGAAA 427 SPP1-537-13- 13536 Chl 0000000000000 Omm00m00mm000 GCCAGCAACCGAA 428 SPP1-684-13 13538 Chl 0000000000000 mOmmmm0m0m0m0 CACCUCACACAUG 429 OHang ID Number Numb Number Sense Sense Backbone Sense Chemistry Sense Sequence SEQ
ID
Chem.
SPP1-707-13- 13540 Chl 0000000000000 OOmm000mOOmOm AGUUGAAUGGUGC 430 SPP1-799-13- 13542 Chl 0000000000000 00mm00mm000m0 AGUCAGCUGGAUG 431 SPP1-853-13- 13544 Chl 0000000000000 mOm000m000000 UAUAAGCGGAAAG 432 SPP1-888-13- 13546 Chl 0000000000000 mmmm00m0m00mm UUCCGAUGUGAW 433 SPP1-1194- 13548 Chl 0000000000000 OmOOmm0OmOmOm AUAACUAAUGUGU 434 SPP1-1279- 13550 Chl 0000000000000 mmOmmmmOm0000 UCAUUCUAUAGAA 435 SPP1-1300- 13552 Chl 0000000000000 00mmOmm0mm0m0 AACUAUCACUGUA 436 SPP1-1510- 13554 Chl 0000000000000 Omm00mm0mmm0m GUCAAUUGCUUAU 437 SPP1-1543- 13556 Chl 0000000000000 OOm00mm0Om000 AGCAAUUAAUAAA 438 SPP1-434-13- 13558 Chl 0000000000000 0m00mmmm00m00 ACGACUCUGAUGA 439 SPP1-600-13- 13560 Chl 0000000000000 m00m0m00mmm0m UAGUGUGGUUUAU 440 1351-863 13 13562 Chl 0000000000000 000mm00m00m00 AAGCCAAUGAUGA 441 SPP1-902-13- 13564 Chl 0000000000000 0m00mm00000mm AUAGUCAGGAACU 442 SPP1-921-13- 13566 Chl 0000000000000 OOmmOOmmOm000 AGUCAGCCGUGAA 443 SPP1-154-13- 13568 Chl 0000000000000 OmmOmmOm00000 ACUACCAUGAGAA 444 SPP1-217-13- 13570 Chl 0000000000000 000m000mm00mm AAACAGGCUGAUU 445 1331-816-13 13572 Chi 0000000000000 000mOmm0000mm GAGUGCUGAAACC 446 1351-882-13 13574 Chi 0000000000000 m000mOmmmm0Om UGAGCAUUCCGAU 447 13576 13576 Chi 0000000000000 00mmmm0m00mm0 AAUUCCACAGCCA 448 SPP1-1509- 13578 Chl 0000000000000 m0mmOOmm0mmmO UGUCAAUUGCUUA 449 SPP1-157-13- 13580 Chi 0000000000000 OmmOm00000mmO ACCAUGAGAAUUG 450 SPP1-350-13- 13582 Chl 0000000000000 mm00m00000mm0 CCAACGAAAGCCA 451 SPP1-511-13- 13584 Chl 0000000000000 mm0Omm0mm00mm CUGGUCACUGAUU 452 SPP1-605-13- 13586 Chl 0000000000000 mOOmmmOm000mm UGGUUUAUGGACU 453 SPP1-811-13- 13588 Chi 0000000000000 OOmm0000mOmmO GACCAGAGUGCUG 454 SPP1-892-13- 13590 Chl 0000000000000 OOmOmOOmm00mO GAUGUGAUUGAUA 455 SPP1-922-13- 13592 Chl 0000000000000 OmrOOmmOm000m GUCAGCCGUGAAU 456 SPP1-1169- 13594 Chl 0000000000000 00m0mOmOmmmOm AAUGUGUAUCUAU 457 SPP1-1182- 13596 Chl 0000000000000 mm000mmm00000 UUGAGUCUGGAAA 458 SPP1-1539- 13598 Chl 0000000000000 Ommm0OmOOmmOO GUCCAGCAAUUAA 459 SPP1-1541- 13600 Chl 0000000000000 mm00mOOmm00mO CCAGCAAUUAAUA 460 SPP1-427-13- 13602 Chl 0000000000000 O0mmm000m00mm GACUCGAACGACU 461 OHang ID
ID Number Nye Sense Sense Backbone Sense Chemistry Sense Sequence NO:
Chem.
SPP1-533-13- 13604 Chl 0000000000000 OmmmOmm00m00m ACCUGCCAGCAAC 462 APOB--13- 13763 Chl 0000000000000 0m+00+m0+m0+m ACtGAaUAcCAaU 463 APOB--13- 13764 Chl 0000000000000 Omm000mOmmOOm ACUGAAUACCAAU 464 MAP4K4--16- 13766 Chl 0000000000000 DY547mmOm00000mmm CUGUGGAAGUCUA 465 PPIB--13- 13767 Chl 0000000000000 mmmmmmmmmmmmm GGCUACAAAAACA 466 PPIB--15- 13768 Chl 000000000000000 mmOOmmOm00000mO UUGGCUACAAAAACA 467 PPIB -17 13769 Chl 000000000000000 OmmmOOmmOm00000mO AUUUGGCUACAAAAACA 468 MAP4K4--16- 13939 Chl 0000000000000 mOm0000mOmmmO UGUAGGAUGUCUA 469 0 13940 Chi 0000000000000 Ommm0000000mO AUCUGGAGAAACA 470 APOB-4314- 13941 Chl 000000000000000 000mmm0000000mO AGAUCUGGAGAAACA 471 APOB--16- 13942 Chl 0000000000000 00mmm0mmm0mm0 GACUCAUCUGCUA 472 APOB--1s 13943 Chi 0000000000000 OOmmmOmmmOmmO GACUCAUCUGCUA 473 APOB--17- 13944 Chl 000000000000000 m000mmm0mmmOmrO UGGACUCAUCUGCUA 474 13945 13945 Chl 000000000000000 m000mmm0mmmOmmO UGGACUCAUCUGCUA 475 16-13 13946 Chl 0000000000000 0000000mOOmOm GGAGAAACAACAU 476 7 13947 Chl 000000000000000 mm0000000mOOmOm CUGGAGAAACAACAU 477 APOB--16- 13948 Chl 0000000000000 O0mmmmmm000m0 AGUCCCUCAAACA 478 APOB--17- 13949 Chl 000000000000000 0000mmmmmm000m0 AGAGUCCCUCAAACA 479 APOB--16- 13950 Chl 0000000000000 Omm000mOmmOOm ACUGAAUACCAAU 480 APOB--18 13951 Chl 0000000000000 Omm000mOmmOOm ACUGAAUACCAAU 481 APOB--17- 13952 Chl 000000000000000 OmOmm000mOmmOOm ACACUGAAUACCAAU 482 APOB--19- 13953 Chl 000000000000000 OmOmm000mOmmOOm ACACUGAAUACCAAU 483 MAP4K4--16- 13766 Chl DY547mmOm00000mmm 13766.2 .2 0000000000000 0 CTGF-1222- 13980 Chl 0000000000000 Om0000000mOmO ACAGGAAGAUGUA 485 CTGF-813-16- 13981 Chl 0000000000000 000m0000mmmm GAGUGGAGCGCCU 486 CTGF-747-16- 13982 Chl 0000000000000 mOmm000000mO CGACUGGAAGACA 487 CTGF-817-16- 13983 Chl 0000000000000 0000mmmm0mmm GGAGCGCCUGUUC 488 CTGF-1174- 13984 Chl 0000000000000 OmmOmmOmOOmmO GCCAUUACAACUG 489 CTGF-1005- 13985 Chl 0000000000000 000mmmmmm00mm GAGCUUUCUGGCU 490 CTGF-814-16- 13986 Chl 0000000000000 00m0000mmmm0 AGUGGAGCGCCUG 491 CTG 98F-7 816-16- 13987 Chl 0000000000000 m0000mmmmOmm UGGAGCGCCUGUU 492 OHang ID Number Numibg r Sense Sense Backbone Sense Chemistry Sense Sequence SEQ ID
Chem.
CTGF-1001- 13988 Chl 0000000000000 Ommm000mmmmmm GUUUGAGCUUUCU 493 CTGF-1173- 13989 Chl 0000000000000 m0mm0mmOm00mm UGCCAUUACAACU 494 CTGF-749-16- 13990 Chl 0000000000000 Omm000000mOm ACUGGAAGACACG 495 CTGF-792-16- 13991 Chl 0000000000000 00mm0mmm00mmm AACUGCCUGGUCC 496 CTGF-1162- 13992 Chl 0000000000000 000mmm0m0mmm0 AGACCUGUGCCUG 497 CTGF-811-16- 13993 Chl 0000000000000 m0000m0000mm CAGAGUGGAGCGC 498 13994 Chl 0000000000000 mmm00mmm000mm CCUGGUCCAGACC 499 CTGF-1175- 13995 Chl 0000000000000 mm0mm0mO0mm0m CCAUUACAACUGU 500 CTGF-1172- 13996 Chl 0000000000000 mmOmm0mm0m00m CUGCCAUUACAAC 501 16-13997 13997 Chl 0000000000000 OmmOm00mmOmmm AUUACAACUGUCC 502 CTGF-1176 13998 Chl 0000000000000 m0mm0m00mm0mm CAUUACAACUGUC 503 CTGF-812-16 13999 Chl 0000000000000 0000m0000mmm AGAGUGGAGCGCC 504 CTGF-745-16- 14000 Chl 0000000000000 OmmOmm000000 ACCGACUGGAAGA 505 CTGF-1230 14001 Chl 0000000000000 0mOmOm0000mo AUGUACGGAGACA 506 CTGF-920-16- 14002 Chl 0000000000000 Ommmm0m000mm GCCUUGCGAAGCU 507 CTGF-679-16- 14003 Chl 0000000000000 OmmOm00000mo GCUGCGAGGAGUG 508 CTGF-992-16- 14004 Chl 0000000000000 0mmm0mm000mmm GCCUAUCAAGUW 509 16-1-1045 14005 Chl 0000000000000 00mmmmOm0000m AAUUCUGUGGAGU 510 CTGF-1231- 14006 Chl 0000000000000 mOmOm0000mOm UGUACGGAGACAU 511 14007 14007 Chl 0000000000000 00mmm0mm000mm AGCCUAUCAAGUU 512 CTGF-998-16- 14008 Chl 0000000000000 m000mmm000mmm CAAGUUUGAGCUU 513 CTGF-1049 14009 Chl 0000000000000 mmOm0000mOmOm CUGUGGAGUAUGU 514 CTGF-1044- 14010 Chl 0000000000000 000mmmmOm0000 AAAUUCUGUGGAG 515 16-14011 14011 Chl 0000000000000 mmmmOOm00m0m0 UUUCAGUAGCACA 516 CTGF-1196- 14012 Chl 0000000000000 m00moomOmmmmm CAAUGACAUCUUU 517 14013 Chi 0000000000000 OOmOmmOOmOmOm AGUACCAGUGCAC 518 CTGF-752-16- 14014 Chl 000000000 14014 0000 OOOOOOmOmmmm GGAAGACACGUUU 519 CTGF-994-16- 14015 Chl 0000000000000 mmomm000mmmoo CUAUCAAGUUUGA 520 CTGF-1040- 14016 Chl 0000000000000 00mm000mmmm0m AGCUAAAUUCUGU 521 CTGF-1984- 14017 Chl 0000000000000 000m0000mOm00 AGGUAGAAUGUAA 522 CTGF-2195- 14018 Chl 0000000000000 O0mmoomm00mmm AGCUGAUCAGUUU 523 CTGF-2043- 14019 Chl 000000000 16-14019 0000 mmmmOmmm000m0 UUCUGCUCAGAUA 524 Oligo ID Number Number Sense Sense Backbone Sense Chemistry Sense Sequence SEQ
ID
Chem.
CTGF-1892- 14020 Chi 0000000000000 mm0mmm000mm00 UUAUCUAAGUUAA 525 CTGF-1567- 14021 Chi 0000000000000 m 16-14021 OmOm00m00mO UAUACGAGUAAUA 526 CTGF-1780- 14022 Chi 0000000000000 OOmm000mOOmmm GACUGGACAGCUU 527 CTGF-2162- 14023 Chi 0000000000000 Om00mmnimmOmmO AUGGCCUUUAUUA 528 CTGF-1034- 14024 Chi 0000000000000 OmOmmOOmm000 AUACCGAGCUAAA 529 CTGF-2264- 14025 Chi 0000000000000 mrOmm00000mOm UUGUUGAGAGUGU 530 CTGF-1032- 14026 Chi 0000000000000 OmOmOmmOOmmO ACAUACCGAGCUA 531 CTGF-1535 14027 Chi 0000000000000 00m0000000mmO AGCAGAAAGGUUA 532 CTGF-1694- 14028 Chi 0000000000000 00mm0mmmmmm00 AGWGUUCCUUAA 533 16-1-1588 14029 Chi 0000000000000 Ommm0000mOm00 AUUUGAAGUGUAA 534 CTGF-928-16- 14030 Chi 0000000000000 000mm00mmm000 AAGCUGACCUGGA 535 C6-1-1133 14031 Chi 0000000000000 OOmmOm0000000 GGUCAUGAAGAAG 536 CTGF-912-16- 14032 Chi 0000000000000 0m00mm000mmmm AUGGUCAGGCCUU 537 CTGF-753-16- 14033 Chi 0000000000000 00000mOmmmmO GAAGACACGUUUG 538 CTGF-918-16- 14034 Chi 0000000000000 000mmmmOm000 AGGCCUUGCGAAG 539 CTGF-744-16- 14035 Chi 0000000000000 mOmmOmm00000 UACCGACUGGAAG 540 CTGF-466-16- 14036 Chi 0000000000000 0mmm0000mm0 ACCGCAAGAUCGG 541 CTGF-917-16- 14037 Chi 0000000000000 m000mmmmOm00 CAGGCCUUGCGAA 542 CTGF-1038 14038 Chi 0000000000000 m00mm000mmmm CGAGCUAAAUUCU 543 CTGF-1048- 14039 Chi 0000000000000 mmmOm0000mOm0 UCUGUGGAGUAUG 544 CTGF-1235- 14040 Chi 0000000000000 m0000mOm00m0 CGGAGACAUGGCA 545 14041 Chi 0000000000000 0m00m00mmmmm AUGACAACGCCUC 546 CTGF-1131- 14042 Chi 0000000000000 0000mmOm00000 GAGGUCAUGAAGA 547 CTGF-1043 14043 Chi 0000000000000 m000mmmmOm000 UAAAUUCUGUGGA 548 CTGF-751-16- 14044 Chi 0000000000000 m000000mOmmm UGGAAGACACGUU 549 CTGF-1227 14045 Chi 0000000000000 0000mOmOm000 AAGAUGUACGGAG 550 14046 Chi 0000000000000 00m00m00mmmm AAUGACAACGCCU 551 CTGF-1128- 14047 Chi 0000000000000 00m000mm0m00 GGCGAGGUCAUGA 552 CTGF-756-16- 14048 Chi 0000000000000 OOmOmOmmmOOmm GACACGUUUGGCC 553 CTGF-1234- 14049 Chl 0000000000000 Om00000mOm00m ACGGAGACAUGGC 554 CTGF-916-16- 14050 Chi 0000000000000 mm000mmmm0mO0 UCAGGCCUUGCGA 555 CTGF-925-16- 14051 Chi ooooooooooooo 0m0000mm00mmm GCGAAGCUGACCU 556 O: ID
OHang SEQ ID Number N r Sense Sense Backbone Sense Chemistry Sense Sequence NO
Chem.
CTGF-1225 14052 Chi 0000000000000 000000mOmOmOO GGAAGAUGUACGG 557 CTGF-445-16- 14053 Chl ooooooooooOoo Om00mmmm00mmm GUGACUUCGGCUC 558 CTGF-446-16- 14054 Chl 0000000000000 mOOmmmmOOmmmm UGACUUCGGCUCC 559 CTGF-913-16- 14055 Chl 0000000000000 m00mm000mmmm0 UGGUCAGGCCUUG 560 CTGF-997-16- 14056 Chl 0000000000000 mm000mmm000mm UCAAGUUUGAGCU 561 CTGF-277-16- 14057 Chl 0000000000000 Omm0000mmOmOO GCCAGAACUGCAG 562 CTGF-1052- 14058 Chl 0000000000000 m0000mOmOmOmm UGGAGUAUGUACC 563 CTGF-887-16- 14059 Chl 0000000000000 Omm0000000mOO GCUAGAGAAGCAG 564 CTGF-914-16- 14060 Chl 0000000000000 OOmm000mmmm0m GGUCAGGCCUUGC 565 CTGF-1039 14061 Chi 0000000000000 OOOmmO00mmmmO GAGCUAAAUUCUG 566 CTGF-754-16- 14062 Chl 0000000000000 0000mOmOmmmOO AAGACACGUUUGG 567 CTGF-1130- 14063 Chi 0000000000000 m0000mmOm0000 CGAGGUCAUGAAG 568 14064 Chl 0000000000000 OOmmmmOm0000m GGCCUUGCGAAGC 569 CTGF-922-16- 14065 Chl 0000000000000 mmmOm0000mmOO CUUGCGAAGCUGA 570 CTGF-746-16- 14066 Chl 0000000000000 mmOOmm000000m CCGACUGGAAGAC 571 CTGF-993-16- 14067 Chl 0000000000000 mmm0mm000mmmO CCUAUCAAGUUUG 572 14068 Chi 0000000000000 mOmmmm0000mmm UGUUCCAAGACCU 573 14069 Chl 0000000000000 m0000mmOOmmmO CGAAGCUGACCUG 574 CTGF-923-16- 14070 Chl 0000000000000 mmOm0000mmOOm UUGCGAAGCUGAC 575 CTGF-866 16 14071 Chi 0000000000000 mOOmOOmOOmOmm CAAUGACAACGCC 576 CTGF-563-16- 14072 Chl 0000000000000 OmOmmOOmOmOmO GUACCAGUGCACG 577 CTGF-823 16 14073 Chi 0000000000000 mmmOmmmm0000m CCUGUUCCAAGAC 578 CTGF-1233- 14074 Chl 0000000000000 mOm00000mOmOO UACGGAGACAUGG 579 CTGF-924-16 14075 Chl 0000000000000 mOm0000mmOOmm UGCGAAGCUGACC 580 CTGF-921-16- 14076 Chl 0000000000000 mmmm0m0000mm0 CCUUGCGAAGCUG 581 CTGF-443-16- 14077 Chl 0000000000000 mmOmOOmmmm00m CUGUGACUUCGGC 582 CTGF-1041- 14078 Chl 0000000000000 Omm000mmmm0m0 GCUAAAUUCUGUG 583 CTGF-1042- 14079 Chl 0000000000000 mm000mmmmOm00 CUAAAUUCUGUGG 584 CTGF-755-16- 14080 Chl 0000000000000 000mOmOmmmOOm AGACACGUUUGGC 585 CTGF-467-16- 14081 Chl 0000000000000 mmOm000ommOOm CCGCAAGAUCGGC 586 CTGF-995-16- 14082 Chl 0000000000000 mOmm000mmm000 UAUCAAGUUUGAG 587 CTGF-927-16- 14083 Chl ooooooooooooo 0000mmOOmmmOO GAAGCUGACCUGG 588 OHang ID Number Numb r Sense Sense Backbone Sense Chemistry Sense Sequence SEQ ID
Chem.
SPP1-1091- 14131 Chl 0000000000000 OmOmmmOOmm000 GCAUUUAGUCAAA 589 PPIB--16- 14188 Chl 0000000000000 mmmmmmmmmmmmm GGCUACAAAAACA 590 PPIB -17 14189 Chl 000000000000000 mmOOmmOm00000mO UUGGCUACAAAAACA 591 PPIB--18- 14190 Chl 000000000000000 OmmmOOmmOm00000mO AUUUGGCUACAAAAACA 592 pGL3-1172-16-14386 14386 chl 0000000000000 0m000mOm00mmm ACAAAUACGAUUU 593 pGL3-1172- 14387 chl 0000000000000 DY5470mOOOmOmOOmm MAP4K4-2931- 14390 Chl 000000000000000 Pmmmmmmmmmmmm000m CUUUGAAGAGUUCUGUG 595 25-14390 0000000000 mmmmmmmmm GAAGUCUA
miR-122--23- 14391 ss0000000000000 mmmmmmmmmmmmmmmmm ACAAACACCAUUGUCAC
14391 Chl oooossss mmmmmm ACUCCA 596 14084 Chl 0000000000000 mmmOm000mm000 CUCAUGAAUUAGA 719 14085 Chl 0000000000000 mm0000mm00mm0 CUGAGGUCAAUUA 720 14086 Chl 0000000000000 0000mm00mm000 GAGGUCAAWAAA 721 14087 Chl 0000000000000 mmm0000mm00mm UCUGAGGUCAAUU 722 14088 Chl 0000000000000 m0000mm00mm00 UGAGGUCAAUUAA 723 14089 Chl 0000000000000 mmmm0000mmO0m WCUGAGGUCAAU 724 14090 Chl 0000000000000 0mm00mm000m00 GUCAGCUGGAUGA 725 14091 Chl 0000000000000 mmmm00m000mmm UUCUGAUGAAUCU 726 14092 Chl 0000000000000 m000mm0000mmO UGGACUGAGGUCA 727 14093 Chl 0000000000000 000mmmmOmmOmm GAGUCUCACCAUU 728 14094 Chl 0000000000000 00mm0000mm000 GACUGAGGUCAAA 729 14095 Chl 0000000000000 mmOmOOmmOm000 UCACAGCCAUGAA 730 14096 Chl 0000000000000 00mmmm0mm0mmm AGUCUCACCAUUC 731 14097 Chl 0000000000000 000m00000mm0 AAGCGGAAAGCCA 732 14098 Chl 0000000000000 00m00000mm00 AGCGGAAAGCCAA 733 14099 Chl 0000000000000 OmmOmOm000mOO ACCACAUGGAUGA 734 14100 Chl 0000000000000 OmmOmOOmmOmOm GCCAUGACCACAU 735 14101 Chl 0000000000000 000mmOmOOmmOm AAGCCAUGACCAC 736 14102 Chl 0000000000000 0m00000mm00m GCGGAAAGCCAAU 737 14103 Chl 0000000000000 000mmmmmOmmm AAAUUUCGUAUUU 738 14104 Chl 0000000000000 OmmmmmOmmmmm AUWCGUAUUUCU 739 14105 Chl 0000000000000 0000mmOmOOmmO AAAGCCAUGACCA 740 14106 Chl 0000000000000 OmOm000mOOmOm ACAUGGAUGAUAU 741 14107 Chl 0000000000000 0000mmmmmOmm GAAAUUUCGUAUU 742 14108 Chl 0000000000000 0mmmmmmm00mm GCGCCUUCUGAUU 743 14109 Chl 0000000000000 OmmmmmmOm000m AUUUCUCAUGAAU 744 14110 Chl 0000000000000 mmmmm0m000m00 CUCUCAUGAAUAG 745 14111 Chl 0000000000000 000mmm00m000 AAGUCCAACGAAA 746 14112 Chl 0000000000000 0m00m00000m00 AUGAUGAGAGCAA 747 Oligo OHang SEQ ID Number Number sense Sense Backbone Sense Chemistry Sense Sequence No= ID
Chem.
14113 Chl 0000000000000 Om00000mm000 GCGAGGAGUUGAA 748 14114 Chl 0000000000000 mOOmmOOmOOmmO UGAUUGAUAGUCA 749 14115 Chl 0000000000000 000mOOmOnOmmm AGAUAGUGCAUCU 750 14116 Chl 0000000000000 OmOmOmOmmmOmm AUGUGUAUCUAUU 751 14117 Chl 0000000000000 mmmmOm0000000 UUCUAUAGAAGAA 752 14118 Chl 0000000000000 mmOmmmO0m00mm UUGUCCAGCAAUU 753 14119 Chl 0000000000000 OmOm000000mO ACAUGGAAAGCGA 754 14120 Chl 0000000000000 OmOOmmm000mm0 GCAGUCCAGAWA 755 14121 Chl 0000000000000 mOOmm000mOmOm UGGUUGAAUGUGU 756 14122 Chl 0000000000000 mmOm0000mOOm UUAUGAAACGAGU 757 14123 Chl 0000000000000 moommm000mm0m CAGUCCAGAUUAU 758 14124 Chl 0000000000000 0mOm000m0000 AUAUAAGCGGAAA 759 14125 Chl 0000000000000 mOmmOOmm000mO UACCAGUUAAACA 760 14126 Chl 0000000000000 rOmmmOmmmmOmo UGUUCAUUCUAUA 761 14127 Chl 0000000000000 mmOmm0000000 CCGACCAAGGAAA 762 14128 Chl 0000000000000 000mOOmOmOmOm GAAUGGUGCAUAC 763 14129 Chl 0000000000000 OmOmOOmOOmmO AUAUGAUGGCCGA 764 14130 Chl 0000000000000 00m00mmm000mm AGCAGUCCAGAUU 765 14132 Chl 0000000000000 00mOmmmmOmOm AGCAUUCCGAUGU 766 14133 Chl 0000000000000 m00mm00000mmm UAGUCAGGAACUU 767 14134 Chl 0000000000000 mOmOmmm00mm00 UGCAUUUAGUCAA 768 14135 Chl ooooooooooooo 0mmm00m000mmm GUCUGAUGAGUCU 769 14136 Chl 0000000000000 m000mOmOmOm00 UAGACACAUAUGA 770 14137 Chl 0000000000000 m000m0000mOm CAGACGAGGACAU 771 14138 Chl 0000000000000 m00mmm000mmm CAGCCGUGAAUUC 772 14139 Chl 0000000000000 00mmm00000m00 AGUCUGGAAAUAA 773 14140 Chl 0000000000000 00mmmOm00mmmm AGUUUGUGGCUUC 774 14141 Chl ooooooooooooo OOmmmOOm0000 AGUCCAACGAAAG 775 14142 Chl ooooooooooooo 000mmmmm000m AAGUUUCGCAGAC 776 14143 Chl 0000000000000 OOmOOm000mOmm AGCAAUGAGCAUU 777 14144 Chl ooooooooooooo mm000mOOmOmOm UUAGAUAGUGCAU 778 14145 Chl 0000000000000 mOOmOmOrOm000 UGGUGCAUACAAG 779 14146 Chl ooooooooooooo 0m0000m00mm0 AUGAAACGAGUCA 780 14147 Chl ooooooooooooo mm0000mOmm000 CCAGAGUGCUGAA 781 14148 Chl ooooooooooooo mOOmmOm000mmm CAGCCAUGAAUUU 782 14149 Chl ooooooooooooo OmmOOmm000mOm AUUGGUUGAAUGU 783 14150 Chl ooooooooooooo OOmm000rOmOmO GGUUGAAUGUGUA 784 14151 Chl ooooooooooooo 00000mOOmmOOm GGAAAUAACUAAU 785 114152 Chl ooooooooooooo mmOm000m00000 UCAUGAAUAGAAA 786 14153 Chl ooooooooooooo OmmOOmOOmm00 GCCAGCAACCGAA 787 Oligo OHang SEQ ID Number Number Sense Sense Backbone Sense Chemistry Sense Sequence NO:
Chem.
14154 Chl 0000000000000 mOmmmmOmomOmO CACCUCACACAUG 788 14155 Chl 0000000000000 OOmm000m00mOm AGUUGAAUGGUGC 789 14156 Chl 0000000000000 OOmmOOmm000mO AGUCAGCUGGAUG 790 14157 Chl 0000000000000 mOm000m00000 UAUAAGCGGAAAG 791 14158 Chl 0000000000000 mmmmOm0m00mm UUCCGAUGUGAUU 792 14159 Chl 0000000000000 Om00mm00mOmOm AUAACUAAUGUGU 793 14160 Chl 0000000000000 mm0mmmm0m0000 UCAUUCUAUAGAA 794 14161 Chl 0000000000000 O0mm0mm0mm0m0 AACUAUCACUGUA 795 14162 Chl 0000000000000 Omm00mm0mmm0m GUCAAUUGCUUAU 796 14163 Chl 0000000000000 OOmOOmm00m000 AGCAAUUAAUAAA 797 14164 Chl 0000000000000 OmOmmmm00mOO ACGACUCUGAUGA 798 14165 Chl 0000000000000 m0Om0mO0mmm0m UAGUGUGGUUUAU 799 14166 Chl 0000000000000 000mm00m00m00 AAGCCAAUGAUGA 800 14167 Chl 0000000000000 OmO0mm00000mm AUAGUCAGGAACU 801 14168 Chl 0000000000000 OOmmOOmmm000 AGUCAGCCGUGAA 802 14169 Chl 0000000000000 OmmOmmOm00000 ACUACCAUGAGAA 803 14170 Chl 0000000000000 000m000mm00mm AAACAGGCUGAUU 804 14171 Chl 0000000000000 000mOmm0000mm GAGUGCUGAAACC 805 14172 Chl 0000000000000 m000m0mmmm0m UGAGCAUUCCGAU 806 14173 Chl 0000000000000 OOmmmmOm00mm0 AAUUCCACAGCCA 807 14174 Chl 0000000000000 mOmm00mm0mmm0 UGUCAAUUGCUUA 808 14175 Chl 0000000000000 OmmOm00000mmO ACCAUGAGAAUUG 809 14176 Chl 0000000000000 mm00m0000mmO CCAACGAAAGCCA 810 14177 Chl 0000000000000 mm00mmOmm0omm CUGGUCACUGAUU 811 14178 Chl 0000000000000 m00mmm0m000mm UGGUUUAUGGACU 812 14179 Chl 0000000000000 OOmm0000mOmmO GACCAGAGUGCUG 813 14180 Chl 0000000000000 OOmOm00mmOOmO GAUGUGAUUGAUA 814 14181 Chl 0000000000000 OmmOOmmm000m GUCAGCCGUGAAU 815 14182 Chl 0000000000000 00mOmOmOmmmOm AAUGUGUAUCUAU 816 14183 Chl 0000000000000 mm000mmm00000 UUGAGUCUGGAAA 817 14184 Chl 0000000000000 Ommm0Om00mm00 GUCCAGCAAUUAA 818 14185 Chl 0000000000000 mmOOmOOmm00mO CCAGCAAUUAAUA 819 14186 Chl 0000000000000 O0mmm00m0mm GACUCGAACGACU 820 14187 Chl 0000000000000 Ommm0mm00m00m ACCUGCCAGCAAC 821 TABLE 3: Sense backbone, chemistry, and sequence information. o:
phosphodiester; s:
phosphorothioate; P: 5' phosphorylation; 0: 2'-OH; F: 2'-fluoro; m: 2' O-methyl; +: LNA
modification. Capital letters in the sequence signify ribonucleotides, lower case letters signify deoxyribonucleotides.

Having thus described several aspects of at least one embodiment of this invention, it is to be appreciated various alterations, modifications, and improvements will readily occur to those skilled in the art. Such alterations, modifications, and improvements are intended to be part of this disclosure, and are intended to be within the spirit and scope of the invention.
Accordingly, the foregoing description and drawings are by way of example only.
EQUIVALENTS
Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the following claims.

All references, including patent documents, disclosed herein are incorporated by reference in their entirety. This application incorporates by reference the entire contents, including all the drawings and all parts of the specification (including sequence listing or amino acid / polynucleotide sequences) of the co-pending U.S. Provisional Application No.
61/135,855, filed on July 24, 2008, entitled "SHORT HAIRPIN RNAI CONSTRUCTS
AND USES THEROF," and U.S. Provisional Application No. 61/197,768, filed on October 30, 2008, entitled "MINIRNA CONSTRUCTS AND USES THEREOF."

What is claimed is:

Claims (31)

1. A method comprising, administering a double stranded nucleic acid molecule selected from the nucleic acid molecules contained in Tables 1-3 such that an antisense and a sense strand make up the double stranded nucleic acid molecule, to a subject, wherein the nucleic acid molecule is administered on the skin of the subject.

2. A method comprising, administering a double stranded nucleic acid molecule selected from the nucleic acid molecules contained in Tables 1-3 such that an antisense and a sense strand make up the double stranded nucleic acid molecule, to a subject, wherein the nucleic acid molecule is administered via intradermal injection.

3. A method for treating compromised skin, the method comprising, administering to a subject a therapeutically effective amount for treating compromised skin of a double stranded nucleic acid molecule comprising a guide strand, with a minimal length of 16 nucleotides, and a passenger strand forming a double stranded nucleic acid, having a double stranded region and a single stranded region, the double stranded region having 8-15 nucleotides in length, the single stranded region having 4-12 nucleotides in length, wherein position 1 of the guide strand is 5' phosphorylated or has a 2' 0-methyl modification, wherein the passenger strand is linked to a lipophilic group, wherein at least 40% of the nucleotides of the double stranded nucleic acid are modified, and wherein the double stranded nucleic acid molecule has one end that is blunt or includes a one nucleotide overhang.

4. A method for delivering a nucleic acid to a subject, the method comprising, administering to a subject prior to or simultaneous with a medical procedure a therapeutically effective amount for treating compromised skin of a double stranded nucleic acid molecule comprising a guide strand, with a minimal length of 16 nucleotides, and a passenger strand forming a double stranded nucleic acid, having a double stranded region and a single stranded region, the double stranded region having 8-15 nucleotides in length, the single stranded region having 4-12 nucleotides in length, wherein position 1 of the guide strand is 5' phosphorylated or has a 2'O-methyl modification, wherein the passenger strand is linked to a lipophilic group, wherein at least 40% of the nucleotides of the double stranded nucleic acid are modified, and wherein the double stranded nucleic acid molecule has one end that is blunt or includes a one nucleotide overhang.

5. The method of claim 4, wherein the medical procedure is surgery.

6. The method of claim 5, w herein the surgery is elective.

7. A method for promoting wound healing, the method comprising:
administering a therapeutically effective amount for promoting wound healing of a double stranded nucleic acid molecule comprising a guide strand, with a minimal length of 16 nucleotides, and a passenger strand forming a double stranded nucleic acid, having a double stranded region and a single stranded region, the double stranded region having 8-15 nucleotides in length, the single stranded region having 4-12 nucleotides in length, wherein position 1 of the guide strand is 5' phosphorylated or has a 2'O-methyl modification, wherein the passenger strand is linked to a lipophilic group, wherein at least 40% of the nucleotides of the double stranded nucleic acid are modified, and wherein the double stranded nucleic acid molecule has one end that is blunt or includes a one nucleotide overhang.

8. The method of any one of claims 1-6, wherein the subject has a wound.

9. The method of any one of claims 7 or 8, wherein the wound is a chronic wound.

10. The method of any one of claims 7 or 8, wherein the wound is a result of elective surgery.

11. The method of any one of claims 7 or 8, wherein the wound is external.

12. The method of any one of claims 7 or 8, wherein the wound is internal.

13. The method of any one of claims 1-8, wherein the nucleic acid molecule is administered before an injury.

14. The method of claim 13, wherein the nucleic acid molecule is administered before the injury via intradermal injection.

15. The method of any one of claims 1-8, wherein the nucleic acid molecule is administered after an injury.

16. The method of claim 15, wherein the nucleic acid molecule is administered after injury via intradermal injection.

17. The method of claim 16, wherein the nucleic acid molecule is administered after injury via local administration to the skin.

18. The method of any one of claims 1-8, wherein the nucleic acid molecule is administered before a surgery.

19. The method of claim 18, wherein the surgery comprises epithelial grafting.

20. The method of claim 18, wherein the surgery comprises skin grafting.

21. The method of any one of claims 1-8, wherein the nucleic acid molecule is administered to a graft donor site.

22. The method of any one of claims 1-8, wherein the nucleic acid molecule is administered to a graft recipient site.

23. The method of any one of claims 1-3 and 7-8, wherein the nucleic acid molecule is administered after burn injury.

24. The method of any one of claims 1-3 and 7-8, wherein the nucleic acid molecule is administered prior to injury or surgery.

25. The method of any one of claims 1-24, wherein the double stranded nucleic acid molecule is directed against a gene encoding for a protein selected from the group consisting of. Transforming growth factor R(TGF(31, TGF(32), Osteopontin, Connective tissue growth factor (CTGF), Platelet-derived growth factor (PDGF), Hypoxia inducible factor-la (HIF1(x), Collagen I and/or III, Prolyl 4-hydroxylase (P4H), Procollagen C-protease (PCP), Matrix metalloproteinase 2, 9(MMP2, 9), Integrins, Connexin, Histamine H1 receptor, Tissue transglutaminase, Mammalian target of rapamycin (mTOR), HoxB13, VEGF, IL-6, SMAD proteins, Ribosomal protein S6 kinases (RSP6) and Cyclooxygenase-2 (COX-2).

26. The method of any one of claims 1-8, wherein the double stranded nucleic acid molecule is administered on the skin of the subject in need thereof.

27. The method of claim 26, wherein the nucleic acid molecule is in the form of a cream or ointment.

28. The method of any one of claims 1-8, wherein the nucleic acid molecule is administered by local injection.

29. A composition, comprising a double stranded nucleic acid molecule selected from the nucleic acid molecules contained in Tables 1-3 such that an antisense and a sense strand make up the double stranded nucleic acid molecule formulated for delivery to the skin.

30. A composition, comprising a double stranded nucleic acid molecule comprising a guide strand, with a minimal length of 16 nucleotides, and a passenger strand forming a double stranded nucleic acid, having a double stranded region and a single stranded region, the double stranded region having 8-15 nucleotides in length, the single stranded region having 4-12 nucleotides in length, wherein position 1 of the guide strand is 5' phosphorylated or has a 2'O-methyl modification, wherein the passenger strand is linked to a lipophilic group, wherein at least 40% of the nucleotides of the double stranded nucleic acid are modified, and wherein the double stranded nucleic acid molecule has one end that is blunt or includes a one nucleotide overhang formulated for delivery to the skin.

31. The composition of claim 29 or 30, wherein the nucleic acid molecule is in the form of a cream or ointment.