CN100395335C - siRNA double-chain for suppressing bc1-2 gene expression - Google Patents

Abstract

The present invention discloses four sets of siRNA double-chain sequences. The siRNA double-chain sequences can inhibit the expression of bcl-2 apoptosis resisting genes, and can effectively inhibit Bcl-2 protein expression and translation for reducing Bcl2 protein synthesis for restoring the normal apoptosis regulation capability of cells for finally delaying tumor growth. The four sets of siRNA double-chain sequences are good small molecule double-chain ribonucleic acid medicines with good leukemia resistance and tumor cell medicine resistance.

Description

The siRNA two strands that suppresses bcl-2 genetic expression

Patent application of the present invention is that application number is dividing an application of " 2004100511978 ", the applying date of original application is " on August 24th, 2004 ", application number is " 2004100511978 ", and denomination of invention is " suppressing the double-stranded and application of siRNA of bcl-2 genetic expression ".

Technical field

The present invention relates to the double-stranded sequence of siRNA, especially suppress the siRNA two strands of bcl-2 genetic expression.

Background technology

RNAi be double chain RNA mediate PTGS (Post-transcriptional gene silencing, PTGS), promotor is enlivened in the case, target gene can be transcribed, but can not normally accumulate mRNA.Various experiment in vivo and vitro confirm the short dsrna of 21-23 nt, be siRNA (short interference RNA, siRNA), can in the mammalian cell tissue, cause the gene sealing process, its Stability Analysis of Structures need not be carried out chemically modified widely improving its transformation period as antisense nucleotide, and can be under the concentration that is lower than the antisense nucleotide several magnitude, make target gene reduce to extremely low-level even complete " knocking out ", thereby produce the deletion mutantion phenotype.The intervention effect key of siRNA depends on the selection of its target-gene sequence, the mistake of arbitrary nt all can cause the forfeiture of RNAi effect, and it is inserted point mutation, sequence this height sequence-specific and selected gene of disappearance is silent that very important pharmacological action arranged.Prove, the siRNA technology can be separately or together be used to suddenly change with other existing treatment means due to disease, as virus infection, SBMA, also can be used for treating tumour.

Bcl-2 is a proto-oncogene, can suppress apoptosis, and is in close relations with the generation and the chemical sproof formation of tumour.Gene therapy can increase the susceptibility of mdr cell to medicine, and has stronger specificity and nontoxicity, has opened up brand-new approach for the reverse of tumour MDR, has optimized chemotherapy, thereby has had broad application prospects.

Summary of the invention

The object of the present invention is to provide the double-stranded sequence of the siRNA that suppresses bcl-2 genetic expression, and this application of siRNA two strands in pharmacy further is provided.

For reaching above-mentioned purpose, four pairs of the present invention is that the sequence of the siRNA of target is respectively with the bcl-2 gene:

SiRNA2: antisense strand 5 '-AAG CCG GCG ACG ACT TCT CCC CCT GTC TC-3 ',

Positive-sense strand 5 '-AAG GGA GAA GTC GTC GCC GGC CCT GTC TC-3 ';

SIRNA3: antisense strand 5 '-AAC ATC GCC CTG TGG ATG ACT CCT GTC TC-3,

Positive-sense strand 5 '-AAA GTC ATC CAC AGG GCG ATG CCT GTC TC-3 ';

SIRNA5: antisense strand 5 '-AAA GCG TTC ACT CCC AAC CTG CCT GTC TC-3 ',

Positive-sense strand 5 '-AAC AGG TTG GGA GTG AAC GCT CCT GTC TC-3 ';

SIRNA6: antisense strand 5 '-AAG AAT GCA AAG CAC ATC CAA CCT GTC TC-3 ',

Positive-sense strand 5 '-AAT TGG ATG TGC TTT GCA TTC CCT GTC TC-3 '.

Above-mentioned each the siRNA sequence be can be used for preparation treatment tumour and leukemic medicine.

The present invention provides design tool software on the net according to Ambion company, design is synthetic to be 6 couples of siRNA of target with the bcl-2 gene, change synthetic siRNA over to the U251 cell strain by liposome, antisense drug G3139 with non-transfected cells and bcl-2 is contrast, detect the inhibition of siRNA cell growth and the change that flow cytometer detects the cell cycle through mtt assay, detect the restraining effect that siRNA expresses bcl-2 with RT-PCR and immunohistochemical method.The result shows: MTT shows the growth of each time point cell and survival rate, siRNA2,3,5,6 and siRNA1,4 groups and control group and liposome group between significant difference (P＜0.05) is all arranged.SiRNA1,4 groups and control group and liposome group also variant (P＜0.05).SiRNA1-6 group and antisense group all variant at 24 and 48 hours (P＜0.05) were at 72 hours indifferences (P＞0.05).RT-PCR and immunohistochemical method show, siRNA2,3,5,6 groups of obviously low control groups of bcl-2 genetic expression the liposome group antisense group and siRNA1,4 (P＜0.05).The flow cytometer result shows that siRNA1-6 group and antisense group cell block the phase in S.Conclusion: in-vitro transcription synthetic siRNA2,3,5,6 can suppress U251 cell bcl-2 expression of gene, and efficient can reach more than 50%.

RNAi is the PTGS of double chain RNA mediate, and RNAi has powerful cell-penetrating ability, can transmit and keep in the long distance of different iuntercellulars.The siRNA of 21-23 nt, can in the mammalian cell tissue, cause the gene sealing process, the intervention effect key of siRNA depends on the selection of its target-gene sequence, the mistake of arbitrary nt all can cause the forfeiture of RNAi effect, and it is inserted point mutation, sequence this height sequence-specific and selected gene of disappearance is silent that very important pharmacological action arranged.The siRNA Stability Analysis of Structures need not be carried out chemically modified widely improving its transformation period as antisense nucleotide, and can make target gene reduce to extremely low-level even complete " knocking out " under the concentration that is lower than the antisense nucleotide several magnitude.SiRNA mainly changes over to by liposome transfection, electroporation, microinjection and plasmid.

The generation of the transposition of bcl-2 gene and high expression level and tumour is closely related.Have now found that substantial connection is arranged at the generation and the poor prognosis of blood, lymphoid multiple malignant tumour, prostate cancer, colorectal carcinoma, ovarian cancer and neuroblastoma.The homeostasis of the high expression level of apoptosis suppressors such as bcl-2 and tumour escape body is closely related.Bcl-2 can suppress the factor inductive apoptosis that withers of causing under the multiple physiological condition, provides condition thereby can survive for the tumour cell after shifting.Other discovers that the oncocyte of high expression level Bcl-2 increases the chemotherapeutics resistance.Therefore, reduce or the overexpression of elimination Bcl-2 gene in tumour cell, can remove the restraining effect of Bcl-2, promote death of neoplastic cells and strengthen the susceptibility of tumour cell chemotherapeutics to apoptosis of tumor cells.The present invention is directed to synthetic 6 siRNA of bcl-2 gene design, change neurospongioma U-251 over to, compare with G3139 and estimate the effect that it suppresses bcl-2 by liposome.MTT, RT-PCR result show that all siRNA2,3,5,6 has the obvious suppression effect, compare bcl-2 with the blank group and express reduction more than 50%, and flow cytometer showed cell is as a result stagnated the phase in S.Experimental result prompting antisense nucleotide mostly occurs after 48h to the restraining effect of bcl-2, and siRNA 12h after medication promptly has obvious retarding effect, but the MTT results suggest suppresses efficient and decreases along with time lengthening.The present invention uses brand-new the means---siRNA of gene therapy in recent years, suppress the expression of this anti-apoptotic genes expression of bcl-2, can suppress Bcl-2 protein expression and translation effectively, thereby it is synthetic to reduce Bcl2 albumen, in the hope of recovering the normal apoptotic ability of regulation and control of cell, finally reach the purpose that delays tumor growth, and then it is applied in the pharmacy of tumour medicine.

Description of drawings

Fig. 1～Fig. 9 is that microscopically is observed when detecting with immunohistochemical method that bcl-2 is proteic to express respectively organizes U251 cell bcl-2 protein expression aspect graph.

Figure 10 is that RT-PCR detects the electrophorogram of respectively organizing transfectional cell bcl-2mRNA expression level.

Figure 11～Figure 19 is a cycle change curve behind the cell transfecting observed of flow cytometer.

Figure 20 respectively organizes hundred parts of rate comparison diagrams of cell S phase cell.

Embodiment

The present invention is described in further detail below in conjunction with embodiment and accompanying drawing, but embodiments of the present invention are not limited thereto.

Embodiment 1:siRNA's is synthetic.

About the siRNA sequences Design, Ambion company all provides design tool software (referring to www.ambion.com/techlib/misc/siRNA finder.html) on the net and synthesizes following six couples of siRNA according to test kit (U.S. Ambion company):

Table 1, according to six pairs of siRNA sequences of Ambion company design software design synthetic

Embodiment 2:MTT detects cell to each susceptibility to siRNA.

The U251 cell in vegetative period of taking the logarithm, preparation 1.5 * 105/mL initial concentration cell suspension is added to (U.S. Corning company production in 96 well culture plates,), every hole adds 100 μ L, establishes blank group, liposome (American I nvitrogen company) control group, antisense group (15 μ mol/L) and siRNA1-6 group (1 μ mol/L).Every group 5 hole, by dividing into groups behind inoculation 24h, abandon or adopt supernatant, add siRNA1-6 or G3139, put 37 ℃, saturated humidity, serum-free continue to be cultivated 6h in the 5%CO2 incubator, respectively adds the unparalleled anti-1,640 100 μ L that contain 10% foetal calf serum again, respectively at 24,48,72h adds MTT 20 μ L, the centrifugal supernatant of abandoning adds DMSO 150 μ L behind the 4h, reads absorbancy under the microplate reader.Cell survival rate=experimental group absorbance value/control group absorbance value * 100%.

Surface as a result, siRNA2,3,5,6 and control group and liposome group at each time point significant difference (P＜0.001) is arranged all; In each time point siRNA1,4 groups and siRNA2,3,5,6 variant (P＜0.05) and control group and liposome group also variant (P＜0.05).SiRNA1-6 group and antisense group are in 72 hours indifferences (P=0.073,0.133,0.239,0.054,0.225,0.137), all variant at 24 and 48 hours (P＜0.05).See Table 2, table 3.

※ represents respectively to organize the result after the OD value is the blank substratum background of deduction

★ represent and control group between variant (P＜0.05) * represent and to notable difference (P＜0.001) being arranged according to group

Each time point mtt assay detects cell-proliferation activity OD value behind table 2, the transfection siRNA ^※

★ represent and control group between variant (P＜0.05) * represent and control group between notable difference (P＜0.01) is arranged

Each time point mtt assay detects cell survival rate behind table 3, the transfection siRNA

Embodiment 3: immunohistochemical method detects the expression of bcl-2 albumen (the Wuhan doctor gets company and produces).

Each organizes cell with 1.5 * 105/mL, and initial concentration is inoculated in 6 orifice plates, and the cover glass of built-in one 1.5 * 1.5cm by continuing to cultivate 48h after the above-mentioned cultural method transfection, discards supernatant.Decided cover glass 15 seconds, the PBS rinsing with 3: 1 methanol acetic acids are liquid-solid; 4 ℃ of 1%Tris-Triton 100 penetrating 5min, the PBS rinsing; Peroxidase sealing 10 seconds, the PBS rinsing; Non-immune serum sealing 10 seconds discards and drips bcl-2 one and resists in 4 ℃ and hatch 12h, the PBS rinsing; Add two anti-, biotin labeling antibody successively, and the PBS rinsing, the DAB colour developing, Hematorylin is redyed nuclear.Each batch experiment is equipped with blank and replaces one to resist with PBS.

Fig. 1～Fig. 9 detects the proteic expression of bcl-2 with immunohistochemical method, and microscopically is observed respectively organizes U251 cell bcl-2 protein expression aspect graph.Table 4 has shown the difference of respectively organizing expression of cellular proteins.

★ represent and control group between variant (P＜0.05); * between expression and control group notable difference (P＜0.01) is arranged

Table 4 is respectively organized the protein expression of immunohistochemical methods bcl-2

Embodiment 4:RT-PCR (Shen, Shanghai energy betting office) detects transfectional cell bcl-2mRNA expression level.

Each is organized cell and is inoculated in 6 orifice plates with 1.5 * 105/L initial concentration, presses and continues to cultivate 12h, the centrifugal collection of trysinization after the embodiment 2 described cultural method transfections.The horizontal bcl-2 primer sequence of using Shen, Shanghai energy lottery industry company limited's cell total rna extracting and purifying reagent and RT-PCR kit measurement bcl-2mRNA is as follows: 5` holds primer: CGACGACTTCTCCCGCCGCTACCGC, and 3` holds primer: the CCGCATGCTGGGGCCGTACAGTTCC amplified production is 318bp.RNA extracts: successively use RNA extracting solution (Life Technologies, Inc.), chloroform, Virahol, 75% ethanol, and the precipitation separation washing, concrete steps are undertaken by its specification sheets.Last RNA precipitation, aseptic deionized water with an amount of DEPC processing, 56 ℃ of water-bath hydrotropies, the RNA that takes a morsel surveys OD value quantitative (OD260/OD280 ratio＞1.8) and with 1% sepharose (containing 0.5 μ g/mlEB) electrophoresis observation 28S and two clear bands of 18SrRNA, to guarantee to extract purity and the integrity of RNA.(2) the synthetic and pcr amplification of cDNA, strictness is undertaken by reverse transcription test kit specification sheets.With β-actin is internal reference, 94 ℃ of sex change 30 seconds; Annealed 1 minute for 60 ℃; 72 ℃ were extended 1 minute.Circulate after 30 times, 72 ℃ were extended 5 minutes.The electrophoresis product is observed on 2% agarose gel electrophoresis and is taken a picture, and observes on Gel-Doc1000 type ultraviolet gel images analyser, analyzes, and calculates the ratio of Bcl-2 and β-actin amplified band, and takes the photograph sheet, sees Figure 10.Get RT-PCR product 5 μ l electrophoresis on 2% sepharose, found that blank and clear band is seen at liposome control group, antisense group 318bp place, siRNA respectively organizes band all to be had and weakens, obvious with 2,3,5,6 groups.Each organizes internal reference β-actin band unanimity.The expression that suppresses cell bcl-2 after the siRNA transfection is described.

The cycle changes after embodiment 5, the transfection of flow cytometer observation of cell

Each is organized cell and is inoculated in 25cm with 1.5 * 105/L initial concentration ²Culturing bottle, continue to cultivate 48h after pressing embodiment 2 described cultural method transfections, the centrifugal collection of trysinization also is suspended among the PBS, 4 ℃ with the fixing 30min of 70% ethanol, with the staining fluid dyeing 30min that contains RNase and iodate third ingot, flow cytometer (EPICS-ELITE-ESP) is measured the variation of dna content, with MULTICYCLE software processes result.The result shows that siRNA2,3,5,6 groups of cell retarded growths are seen Figure 11～Figure 19 and Figure 20 in the S phase.

Embodiment 6, the siRNA application in preparation medicine for treating tumor thing.

Gained siRNA2 of the present invention, siRNA3, siRNA5, siRNA6 are used for preparation treatment tumour or leukemic medicine.Be used for human vivo medicine-feeding, can use separately or unite use with other medicines.

SEQUENCE?LISTING

＜110〉Ji'nan University

＜120〉the siRNA two strands of inhibition bcl-2 genetic expression

<130>

<160>12

<170>PatentIn?version?3.2

<210>1

<211>29

<212>DNA

<213>Artificial?sequence

<220>

＜223〉synthetic according to the design software design of Ambion company is the positive-sense strand of the siRNA1 sequence of target with the bcl-2 gene

<400>1

aacagcttat?aatggatgta?ccctgtctc 29

<210>2

<211>29

<212>DNA

<213>Artificial?sequence

<220>

＜223〉synthetic according to the design software design of Ambion company is the antisense strand of the siRNA1 sequence of target with the bcl-2 gene

<400>2

aagtacatcc?attataagct?gcctgtctc 29

<210>3

<211>29

<212>DNA

<213>Artificial?sequence

<220>

＜223〉synthetic according to the design software design of Ambion company is the positive-sense strand of the siRNA2 sequence of target with the bcl-2 gene

<400>3

aagggagaag?tcgtcgccgg?ccctgtctc 29

<210>4

<211>29

<212>DNA

<213>Artificial?sequence

<220>

＜223〉synthetic according to the design software design of Ambion company is the antisense strand of the siRNA2 sequence of target with the bcl-2 gene

<400>4

aagccggcga?cgacttctcc?ccctgtctc 29

<210>5

<211>29

<212>DNA

<213>Artificial?sequence

<220>

＜223〉synthetic according to the design software design of Ambion company is the positive-sense strand of the siRNA3 sequence of target with the bcl-2 gene

<400>5

aaagtcatcc?acagggcgat?gcctgtctc 29

<210>6

<211>29

<212>DNA

<213>Artificial?sequence

<220>

＜223〉synthetic according to the design software design of Ambion company is the antisense strand of the siRNA3 sequence of target with the bcl-2 gene

<400>6

aacatcgccc?tgtggatgac?tcctgtctc 29

<210>7

<211>29

<212>DNA

<213>Artificial?sequence

<220>

＜223〉synthetic according to the design software design of Ambion company is the positive-sense strand of the siRNA4 sequence of target with the bcl-2 gene

<400>7

aaccaggtgt?gcaggtgccg?gcctgtctc 29

<210>8

<211>29

<212>DNA

<213>Artificial?sequence

<220>

＜223〉synthetic according to the design software design of Ambion company is the antisense strand of the siRNA4 sequence of target with the bcl-2 gene

<400>8

aaccggcacc?tgcacacctg?gcctgtctc 29

<210>9

<211>29

<212>DNA

<213>Artificial?sequence

<220>

＜223〉synthetic according to the design software design of Ambion company is the positive-sense strand of the siRNA5 sequence of target with the bcl-2 gene

<400>9

aacaggttgg?gagtgaacgc?tcctgtctc 29

<210>10

<211>29

<212>DNA

<213>Artificial?sequence

<220>

＜223〉synthetic according to the design software design of Ambion company is the antisense strand of the siRNA5 sequence of target with the bcl-2 gene

<400>10

aaagcgttca?ctcccaacct?gcctgtctc 29

<210>11

<211>29

<212>DNA

<213>Artificial?sequence

<220>

＜223〉synthetic according to the design software design of Ambion company is the positive-sense strand of the siRNA6 sequence of target with the bcl-2 gene

<400>11

aattggatgt?gctttgcatt?ccctgtctc 29

<210>12

<211>29

<212>DNA

<213>Artificial?sequence

<220>

＜223〉synthetic according to the design software design of Ambion company is the antisense strand of the siRNA6 sequence of target with the bcl-2 gene

<400>12

aagaatgcaa?agcacatcca?acctgtctc 29

Claims (1)

1. siRNA two strands that suppresses bcl-2 genetic expression, its sequence is:

Antisense strand 5 '-AAC ATC GCC CTG TGG ATG ACT CCT GTC TC-3,

Positive-sense strand 5 '-AAA GTC ATC CAC AGG GCG ATG CCT GTC TC-3 '.

Images