CN101041690B - Recombinant dog hookworm coagulate peptide resistant 5 mutant, its encoding gene, preparation and application thereof - Google Patents

Abstract

The invention discloses an anticoagulant peptide 5 mutant (rAcAP5m) and coded gene of recombinant ancylostoma caninum as well as application to treat thrombus, which possesses 54 amino acids sequence as SEQ ID NO:2 with molecular weight at 6.1KD, wherein the peptide contains 8 Cys residues, which reduces immunogen to inhibit FXa activity obviously.

Description

Recombinant dog hookworm coagulate peptide resistant 5 mutant, its encoding gene, its preparation and application

Technical field

The present invention relates to a class recombinant polypeptide and an encoding gene thereof, relate in particular to a class and have anticoagulant factor Xa (FactorXa, FXa) active recombinant dog hookworm coagulate peptide resistant 5 mutant (rAcAP ₅M) and the gene of this recombinant polypeptide of encoding.In addition, the invention still further relates to the preparation of this recombinant polypeptide, comprise the structure of this recombinant polypeptide expression vector, constructed expression vector is transformed in the host bacterium, induce the expression of recombinant polypeptide and expressed polypeptide is carried out purifying; The present invention also relates to the application of this recombinant polypeptide in the treatment thrombotic diseases in addition, belongs to biological technical field.

Background technology

The caused blood vessel injury of a variety of causes can start blood coagulation reaction, and blood coagulation can prevent further hemorrhagely under the normal circumstances, but under many pathological conditions, over-drastic blood coagulation meeting causes thrombosis, thereby causes a series of thrombotic diseases.The blood coagulation reaction is the cascade reaction of a series of amplifications, and the multiple serine protease in reaction process in the blood plasma is hydrolyzed activation.Coagulate reaction and can cause forming the insolubles that is constituted by scleroproein and cellular constituent, thereby further form thrombus (Mann, K.G., Nesheim, M.E., Church, W.R., Haley, P.and Krishnaswamy, S. (1990) Blood 76:1-16.and Lawson, J.H., Kalafatis, M., Stram, S., and Mann, K.G. (1994) J.Biol.Chem.269:23357-23366).

FXa is the joint of endogenous and exogenous cruor pathway, and it is a kind of serine protease, and the cleavable thrombogen generates zymoplasm.FXa is the important component part of thrombogen enzyme complex, and it forms the thrombogen enzyme complex with cofactor FVa on activatory platelet membrane phosphatide surface in the presence of calcium ion.The catalytic activity of free F Xa is very low, but in case form the thrombogen enzyme complex, and the activity of FXa can show and improves.Thrombogen is by cracking fast, and a large amount of zymoplasms are assembled at vascular injury site, finally form thrombus (Fuster, V., Badimon, L., Badimon, J.J.and Chesebro, J.H. (1992) New Engl.J.Med.326:310-318).

Anticoagulation medicine is the treatment of thrombotic diseases and important drugs (Kessler, C.M. (1991) Chest99:97S-112S and Cairns, J.A., the Hirsh in the prevention, J., Lewis, H.D., Resnekov, L., and Theroux, P. (1992) Chest 10:456S-481S).But existing antithrombotics such as heparin class, direct thrombin inhibitors in use all show serious side reaction such as hemorrhage grade, have limited their application.Therefore press for the anticoagulant new, more effective, that side effect is littler clinically.Thereby but the generation anticoagulant of FXa inhibitor Trombin inhibiting, because it does not suppress the active thereby side reaction that seldom causes bleeding of the zymoplasm that generated, but the FXa catalysis of a part generates the zymoplasm greater than 1000 molecules, that is to say, FXa concentration in the blood is low more than 1000 times than zymoplasm, and the Plasma Concentration during FXa inhibitor performance drug effect is much lower than thrombin inhibitors.Therefore suppress the anti-freezing better effects if that FXa produces than Trombin inhibiting, hemorrhage and other side effect is littler, so the FXa inhibitor has become the focus that anticoagulation medicine is studied.All containing material that different having overcome host's normal hemostatic function in their saliva such as bloodthirsty animal such as tick, bat, leech, nematode, humanlice helps them and sucks blood.Therefore can from their salivas, extract specificity FXa inhibitor (K.Y.MUMCUOGLU (1999) J.Insect Physilol 42:1083-1087).

Dog hookworm coagulate peptide resistant 5 (Ancylostoma caninum anticoagulant peptide, AcAP ₅) be that a kind of peptide class FXa inhibitor of separating in ancylostoma caninum (Ancylostoma caninum) soluble extract is made up of 77 amino acid from the adult hookworm of food blood, molecular weight 8.7KD has obtained its recombinant products rAcAP5.AcAP ₅Be the strongest polypeptide class specificity FXa inhibitor of reporting up to now of activity, can suppress artery, venothrombotic formation (United States Patent5,427,937,6,534,629et al.).In dog coronary artery thrombosis model, only subcutaneous administration once just can be kept drug effect 6 hours, compared AcAP with other protein FXa inhibitor ₅An outstanding advantage be exactly convenient drug administration and acting duration long (Sam S.Rebello, Howard S. (2000) Thrombosis Research98:531-540).But AcAP ₅Molecular weight (molecular weight 8.7KD) slightly bigger than normal, during clinical application, may need big consumption can reach significant quantity, resultant the possibility of result can make its immunogenicity improve, and causes a series of untoward reactions.

Summary of the invention

The present invention's technical problem at first to be solved is to overcome the deficiencies in the prior art, and the new recombinant dog hookworm coagulate peptide resistant 5 mutant of a class (recombinant Ancylostoma caninum anticoagulant peptide 5 mutants, rAcAP are provided ₅M), this recombinant polypeptide suppresses FXa activity or antithrombotic acitivity and rAcAP ₅Quite, but the more former AcAP of its molecular weight ₅Low, as the medicinal administered dose that then can reduce foreign protein, thereby may reduce a series of untoward reactions that cause body owing to entering of foreign protein.

The present invention's technical problem at first to be solved realizes by following technological approaches:

One class recombinant dog hookworm coagulate peptide resistant 5 mutant (rAcAP ₅M), it contains following (a) or aminoacid sequence (b):

(a) has the aminoacid sequence shown in the SEQ ID NO:2; Or

What (b) replacement, disappearance or the insertion of the aminoacid sequence shown in the SEQ ID NO:2 by one or more amino-acid residues obtained still has a polypeptide derivative that suppresses FXa activity or antithrombotic acitivity or function.

Preferably, recombinant polypeptide rAcAP of the present invention ₅M has the aminoacid sequence shown in the SEQ ID NO:2, is made up of 54 amino acid, and molecular weight is 6.1KD, comprises 8 cysteine residues, with rAcAP ₅Compare recombinant polypeptide rAcAP of the present invention ₅An amino acid surplus m has left out 20, molecular weight reduces to have surpassed 1/4, has reduced immunogenicity, and vitro inhibition FXa is active and interior antithrombotic acitivity of body and rAcAP ₅Quite (see test example 1 and 2),, thereby may reduce a series of untoward reactions that cause body owing to entering of foreign protein therefore if as the medicinal administered dose that then can reduce foreign protein.Since these advantages, recombinant polypeptide rAcAP of the present invention ₅M promises to be the medicine of the novel treatment thrombotic disease of a class.

Herein, described " a plurality of " mean 2～8 usually, are preferably 2～4, and these depend on the position or the amino acid whose kind of amino-acid residue in the dog hookworm coagulate peptide resistant 5 mutant three-dimensional structure; Described " replacement " is meant respectively and replaces one or more amino-acid residues with different amino-acid residues; Described " disappearance " is meant the change of aminoacid sequence, wherein lacks one or more amino-acid residues respectively; Described " insertion " is meant the change of aminoacid sequence, relative natural molecule, and described change causes adding one or more amino-acid residues.

According to the analysis and research of related experiment data, the inventor finds, carries out the serial polypeptide that point mutation produces on the basis of the aminoacid sequence shown in the SEQ ID NO:2, can strengthen binding ability and the biological activity of peptide molecule and FXa.Because sudden change back sequence has increased the similarity with human thrombin former (the endogenous substrate of FXa) reactive site aminoacid sequence.For example, can on the basis of the aminoacid sequence shown in the SEQ ID NO:2, carry out following sudden change and produce the serial polypeptide that still has inhibition FXa activity or antithrombotic acitivity or function: the 3rd Try is lacked; Or the 22nd Leu replaced with Glu; Or the 23rd Pro replaced with Asp; Or respectively the 22nd Leu is replaced with Glu, the 23rd Pro simultaneously and replace with Asp; Or the 31st Phe replaced with Ser.So replacement, disappearance or the insertion on the basis of the aminoacid sequence shown in the SEQ ID NO:2, carried out and still having of obtaining suppressed the FXa activity and the antithrombotic acitivity polypeptide derivative should be included within the scope of the invention.

Another technical problem to be solved by this invention provides a kind of coding rAcAP ₅The cDNA sequence of m.

Another technical problem to be solved by this invention realizes by following technological approaches:

A kind of coding rAcAP ₅The cDNA sequence of m, this cDNA sequence has following (a) and (b), (c) or nucleotide sequence (d):

(a) has the nucleotide sequence shown in the SEQ ID NO:1; Or

(b) under rigorous condition can with the nucleotide sequence of the complementary sequence hybridization of the nucleotide sequence shown in (a), and this nucleotide sequence codedly has the polypeptide that suppresses FXa activity or antithrombotic acitivity; Or

(c) nucleotide sequence of aminoacid sequence shown in the coding SEQ ID NO:2; Or

(d) nucleotide sequence of coding with the polypeptide derivative that suppresses FXa activity or antithrombotic acitivity (for example has the NO:3 as SEQ ID, SEQ ID NO:4, SEQ ID NO:5, nucleotide sequence shown in SEQ ID NO:6 and the SEQ ID NO:7), this polypeptide derivative obtains by one or more amino-acid residues of the aminoacid sequence shown in the SEQ ID NO:2 are replaced, lacked or insert.

Preferably, the present invention rAcAP that encodes ₅The cDNA sequence of m has the nucleotide sequence shown in the SEQ ID NO:1.

Described " rigorous condition " is meant that hybridization solution is 5～6 * SSC, and 42～75 ℃ of hybridization are spent the night, and room temperature to 37 ℃ is with one to twice of 2 * SSC washing, preferably, described " rigorous condition " is 6 * SSC for hybridization solution, and 68 ℃ of hybridization are spent the night, and 37 ℃ with 2 * SSC washed twice.

CDNA of the present invention can prepare by the following method: (a) according to proteic aminoacid sequence and the yeast nucleotide sequence to the preferences design cDNA molecule of codon; (b) utilize the method for chemosynthesis to synthesize this cDNA molecule.

Another technical problem to be solved by this invention provides a kind of structure and contains the present invention rAcAP that encodes ₅The method of m recombinant expression vector.

Recombinant expression vector of the present invention can make up by the ordinary method of this area and form, be about to the nucleotide sequence shown in the SEQ ID NO.1 and be inserted between the suitable restriction enzyme site of expression vector, make that the nucleotide sequence shown in the SEQ ID NO:1 is exercisable to be connected with expression regulation sequence.As the most preferred embodiment of the present invention, be preferably 5 of the nucleotide sequence shown in the SEQ ID NO:1 ' end is introduced the nucleotide sequence shown in SEQ.ID.NO:8 and the SEQ.ID.NO:9; Again this fusion sequence is inserted between the EcoRI and NotI restriction enzyme site on the plasmid pPIC9K, makes this sequence be positioned at the downstream of AOX1 promotor and regulated and control by it, obtain recombinant yeast expression vector pPIC9K-rAcAP ₅M.

The constructed recombinant yeast expression vector of the present invention can be by conventional method transformed host cell, and described host cell can be pichia spp cell (Pichic pastoris), cerevisiae (Saccharomyces cerevisiae) or saccharomyces lactis cell (Hansenula polymorpha).As the most preferred embodiment of the present invention, be preferably recombinant yeast expression vector pPIC9K-rAcAP ₅M transforms pichia spp cell (Pichic pastoris) GS115, obtains recombinant yeast cell.

Another technical problem to be solved by this invention provides a kind of preparation rAcAP ₅The method of m.

Another technical problem to be solved by this invention realizes by following technological approaches:

A kind of preparation rAcAP ₅The method of m may further comprise the steps:

Cultivate usefulness expression vector of the present invention institute transformed host cells, induce rAcAP ₅The expression of m is reclaimed and the expressed rAcAP of purifying ₅M.

Above-mentioned preparation rAcAP ₅In the method for m, preferred, described recombinant expression vector is Yeast expression carrier pPIC9K-rAcAP ₅M; Described host cell is pichia spp cell (Pichic pastoris) GS115; Described induction method is for using methanol induction rAcAP ₅The expression of m; Described purification process may further comprise the steps: (a) utilize NTA-Ni ²⁺The affinitive layer purification recombinant products; (b) enteropeptidase cuts 6 * His label of N-terminal behind the purifying.

The present invention passes through the interior and external test of body respectively respectively to recombinant polypeptide rAcAP of the present invention ₅Activity and the antithrombotic acitivity of the inhibition FXa of m are measured: (a) external, utilize the method for chromophoric substrate Spectrozyme FXa, measure recombinant polypeptide rAcAP of the present invention ₅M is to the restraining effect of FXa; (b) in vivo, utilize the ligation of mouse postcava, cause the postcava thrombus model, subcutaneous this recombinant polypeptide that gives is estimated its anti-venothrombotic effect.Test-results shows, recombinant polypeptide rAcAP of the present invention ₅The vitro inhibition FXa of m active and interior antithrombotic acitivity of body and rAcAP ₅Quite, promise to be the medicine of the novel treatment thrombotic disease of a class.

Recombinant polypeptide rAcAP of the present invention ₅The dosage of m depends on concrete formulation, and factor such as age of patient, body weight, healthy state.As guidance: during subcutaneous injection, adult's consumption is the 0.145mg/kg body weight.

Description of drawings

Fig. 1 is the collection of illustrative plates of plasmid pPIC9K.PPIC9K contains 9726 Nucleotide.Contain the long AOX1 gene promoter 5 ' P of 942bp _AOX1The high level expression that is used for the foreign gene of methanol induction, it derives from AOX1 gene transcription terminator sequence (TT), the termination and the polyAization that are used for the mRNA of foreign gene, 3 ' AOX1 sequence derives from 3 ' downstream, AOX1 gene transcription terminator, is essential when plasmid vector and the integration of host bacterium genome homology; α-Factor the signal peptide sequence that also contains 296bp, the signal peptide that the coding secretion is required.On multiple clone site, there are 10 single enzymes to cut the site of sequence, to insert foreign gene, Not I wherein, Bgl II, Sal I, Sac I single endonuclease digestion site is used for linearization plasmid, thereby carries out homologous recombination, produces Mut ⁺Or Mut ^-Recon; Contain HIS4, be the wild type gene of Pichia Pastoris, encoding histidine desaturase (about 2200bp) is used for complementary Pichia Pastoris His4 ^-Bacterial strain is reorganization bacterium selective marker; Contained ColE1 replication orgin and ammonia benzyl resistant gene (Ap ^r) plasmid is duplicated in bacterium and go down to posterity, and produce ammonia benzyl resistance.

Fig. 2 is the vector construction synoptic diagram.CDNA of the present invention and pPIC9K are behind the EcoRI/NotI double digestion, by T ₄Dna ligase connects, between " S " and " 3 ' AOX1 " in the cDNA sequence insertion plasmid.

Fig. 3 is the order-checking collection of illustrative plates, and wherein 384-545 Nucleotide is proteic encoding sequence.

Fig. 4 is 0.8% agarose gel electrophoresis figure.Swimming lane 1: empty swimming lane; Swimming lane 2:DNA molecular weight standard (564bp, 2027bp, 2322bp, 4361bp, 6507bp, 9416bp, 23130bp); Swimming lane 3: plasmid pPIC9K-rAcAP ₅M (9.52kb); Swimming lane 4: the pPIC9K-rAcAP behind Sac I single endonuclease digestion ₅M.

Fig. 5 is that expression product is through the 15%SDS-PAGE electrophorogram.Swimming lane 1: protein molecular weight standard (6.5KD, 14.2KD, 20KD, 24KD, 29KD, 36KD, 45KD, 66KD); Swimming lane 2 and 4:GS115/pPIC9K express the nutrient solution supernatant; Swimming lane 3:GS115/pPIC9K-rAcAP ₅M expresses the nutrient solution supernatant, and (this is the molecular weight of fusion rotein: 6.1KD+1.5KD) at the 7.6KD place one obvious band.

Fig. 6 detects the typical curve of protein content for the Bradford method.With bovine serum albumin (BSA) concentration (mg/ml) is ordinate zou, the light absorption value (OD of 595nm place ₅₉₅) do curve for X-coordinate.

Fig. 7 is the recombinant polypeptide rAcAP of the present invention of different concns ₅M is to the active inhibition percentage of FXa logarithmic curve.With concentration is X-coordinate, and suppressing percentage is that ordinate zou is done curve.

Fig. 8 is that the rAcAP5 of different concns is to the active inhibition percentage of FXa logarithmic curve.With concentration is X-coordinate, and suppressing percentage is that ordinate zou is done curve.

Further describe preparation method of the present invention and beneficial effect by the following examples, it should be understood that these embodiment only are used for the purpose of illustration, never limit protection scope of the present invention.

Embodiment

Illustrate: make the experimental methods of molecular biology specify in following examples, all carry out, perhaps carry out according to test kit and product description with reference to listed concrete grammar in " molecular cloning experiment guide " (third edition) J. Sa nurse Brooker one book.

Embodiment 1 coding rAcAP ₅Synthesizing of the cDNA molecule of m

One. design of primers, primer sequence is as follows

GAATTCCACCACCACCACCACCACGGTGGTGACGACGACGACAAGAAGGCTTACCCAGA[SEQ.ID.NO：10]

GGACACTCGTTCTCACCACACTCTGGGTAAGCCTTCTTGTCG[SEQ.ID.NO：11]

GTGTGGTGAGAACGAGTGTCCAATCTGTAGAAGTAGAGGTTGTTTGT[SEQ.ID.NO：12]

CAGACACAAGCTGGTGGCAACAAACAACCTCTACTTCTACAGATT[SEQ.ID.NO：13]

TGCCACCAGCTTGTGTCTGTAAGGACGGTTTCTACAGAGACA[SEQ.ID.NO：14]

GACACAGTCACCGATGACGGTGTCTCTGTAGAAACCGTCCTTA[SEQ.ID.NO：15]

CCGTCATCGGTGACTGTGTCAGAGAGGAGGAGTGTGACCAG[SEQ.ID.NO：16]

GCGGCCGCTCATCAGACATGGATGATCTCATGCTGGTCACACTCCTCCTCTCT[SEQ.ID.NO：17]

Two. synthetic primer

Three. the laboratory is synthetic

1. primer is diluted to identical concentration (5pmol/ul) with deionized water;

2. primer mixing PCR (primer each 1ul mix)

Mix primer 8ul

10 * PCR damping fluid 2ul

H ₂O 8ul

dNTP 1ul

Enzyme 1ul

V 20ul

In the pcr amplification condition is 94 ℃, 1min; 55 ℃, 1min; 72 ℃, 1min, 25 circulations.

3. electrophoresis detection: reclaim the purpose band.

The structure of embodiment 2 expression vectors

1, pPIC9k carrier (available from invitrogen company) and purpose fragment (1 synthetic cDNA of embodiment) are carried out double digestion with EcoRI/NotI.

2, T ₄Dna ligase connects: connection diagram is seen Fig. 2.

3, transfection competence bacillus coli DH 5 alpha, ammonia benzyl substratum screening positive clone.

4, cultivate positive colony.

5, extraction, plasmid purification.

6, with 5 ' AOX ₁(5 '-GACTGGTTCCAATTGACAAGC-3 ') [SEQ.ID.NO.18] and 3 ' AOX ₁(5 '-GCAAATGGCATTCTGACATCC-3 ') [SEQ.ID.NO.19] carries out gene sequencing (sequencing result is seen Fig. 3) for sequencing primer, sequencing result shows, contain the segmental recombinant expression vector of purpose and successfully construct, with this recombinant expression vector called after pPIC9K-rAcAP ₅M.More than each working method referring to " molecular cloning experiment guide " (third edition), J. Sa nurse Brooker D.W. Russell work.

Embodiment 3 chemical methods are transformed into recombinant expression vector among the expressive host pichia spp GS115

1, the preparation of reagent (annotate: agents useful for same all needs sterilising treatment: autoclaving or filtration sterilization) YPD substratum: 1% yeast extract, 2% peptone, 2% glucose.

(1) take by weighing the 10g yeast extract, the 20g peptone is dissolved in (solid medium adds the 20g agar powder again) in the 900ml deionized water;

(2) autoclaving is 20 minutes;

Add 20% glucose solution 100ml when (3) generation is cooled to 60 ℃.

MD: the basic nitrogenous source of yeast (YNB) 1.34%, vitamin H 4 * 10 ^-5%, glucose 2%.

(1) autoclaving 800ml water;

(2) add after cooling: 100ml 13.4%YNB, 2ml 0.02% vitamin H, 20% glucose solution 100ml;

(3) if the preparation solid medium adds the 15g agar powder in (1) step.

MM: the basic nitrogenous source of yeast (YNB) 1.34%, vitamin H 4 * 10 ^-5%, methyl alcohol 0.5%.

(1) autoclaving 800ml water;

(2) generation cooling back adding: 100ml 13.4%YNB, 2ml 0.02% vitamin H, 5% methanol solution 100ml;

(3) if the preparation solid medium adds the 15g agar powder in (1) step.

SCED (1M sorbyl alcohol, 10mM Trisodium Citrate, PH7.5,10mM EDTA, 10mM DTT).

2, transform the linearizing of plasmid

Change the necessary linearizing of zymic plasmid DNA over to, otherwise need the DNA of ten times of amounts just can reach the expection transformation efficiency.Wizard

Plus Minipreps DNA purification kit extracts about 10 μ g pPIC9K-rAcAP ₅The m plasmid DNA, with Sac I single endonuclease digestion, the electrophoresis detection enzyme carries out purifying with the DNA purification kit after cutting entirely, is dissolved in 50 μ l ddH ₂Among the O.The endonuclease reaction condition is as follows:

ddH ₂O 5μl

Damping fluid 2 μ l

10 * BSA (1mg/ml) } 37 ℃ of water-bath 4h behind the mixing, 65 ℃ of deactivation 20min

DNA 10μl

Sac?I 1μl

Enzyme is cut and be the results are shown in Figure 4.

3, the preparation of yeast competent cell:

(1) streak culture recovery GS115 bacterial strain 48h on the YPD substratum, picking mono-clonal are inoculated among the 3ml YPD 30 ℃, 280r/m shaking culture 18h;

(2) get 50 μ l and be inoculated in the 50ml YPD nutrient solution 30 ℃, 280r/m shaking culture 16-18h is to OD ₆₀₀≈ 0.8-1.0;

The centrifugal 5min of (3) 4000 * g room temperatures removes supernatant, with 25ml sterile purified water re-suspended cell;

The centrifugal 10min of (4) 1500 * g room temperatures discards water, and re-suspended cell is in 1ml 100mM LiCl;

(5) transitional cell suspension is to 1.5ml EP pipe;

The centrifugal 15min of (6) 5000 * g room temperatures discards LiCl;

(7) re-suspended cell is in 400 μ l 100mM LiCl;

(8) get 50 μ l cell suspending liquids to 1.5ml EP pipe, prepare to transform.

4. the LiCl of yeast competent cell transforms

(1) 2mg/ml strand salmon sperm dna is boiled 5min, then ice bath immediately;

(2) with the centrifugal 5min of LiCl-cells liquid 4000 * g room temperature in above-mentioned the 8th step, supernatant discarded;

(3) in each conversion tube, add following reagent: 240 μ l 50%PEG3350,36 μ l 1M LiCl, 25 μ l2mg/ml salmon sperm dnas, 50 μ l plasmid DNA;

(4) whirlpool mixes until the complete mixing of cell mass;

(5) 30 ℃ of incubation 30min need not vibration;

(6) 42 ℃ of water-bath heat-shocked 20～25min;

(7) the centrifugal 5min of 7000rmp discards conversion fluid;

(8) 100 μ l are coated with the MD plate, cultivate 3～5 days for 28 ℃, grow the mono-clonal bacterium colony on the visible MD substratum

5, His ⁺/ Mut ⁺The Screening and Identification of phenotype bacterium

Because His ⁺Mut can appear in the recon ⁺And Mut ^STwo kinds of genotype are in order to select His ⁺/ Mut ⁺The phenotype bacterium, we are with the His that is sieved in the first step ⁺Thalline dibbling simultaneously is on MM and MD flat board, according to Mut ⁺And Mut ^STwo kinds of genotype are distinguished Mut on MM (carbon source the is a methyl alcohol) substratum and the difference of the growth conditions on MD (carbon source the is a glucose) substratum ⁺And Mut ^STwo kinds of phenotypes.Mut ⁺Can utilize methyl alcohol to be carbon source fast, thereby the upgrowth situation indifference on MD and two kinds of flat boards of MM; And Mut ^SThe speed of utilizing methyl alcohol is well below the speed of utilizing glucose, and the size of same bacterium colony on different flat boards has notable difference after for some time of therefore growing, and distinguishes His according to method in this ⁺/ Mut ⁺And His ⁺/ Mut ^STransformant.Picking His ⁺Transformant inserts MM and MD flat board simultaneously, cultivates after 2-3 days for 28 ℃, occurs bacterium colony on the MD and MM goes up no bacterium colony or be Mut than the small colonies person ^SType, otherwise be Mut ⁺Picking all well-grown bacterium colony on MD and MM carries out PCR to be identified, identifies whether goal gene correctly is integrated in the yeast chromosomal dna.

5, the PCR of transformant identifies

All well-grown single bacterium colony on picking MD and the MM, extract pastoris genomic dna as follows:

In 10mlMD 28 ℃ cultivate single bacterium colonies to OD ₆₀₀=5-10 (about 20h), centrifugal 10min under 1500 * g room temperature;

2. after the 10ml aqua sterilisa washs thalline, 1500 * g recentrifuge 10min under the room temperature;

3. re-suspended cell adds the 0.1mg hydrolytic enzyme in the SCED solution of the new preparation of 2ml, places 50min for 37 ℃;

4. add the SDS solution of 2ml 1%, it is even to shake gently, ice bath 5min;

5. add 1.5ml 5M KAc, 4 ℃ of centrifugal 5min of 10,000 * g;

6. the dehydrated alcohol that adds 2 times of volumes in the supernatant, 15min under the room temperature;

7. 4 ℃ of centrifugal 20min of 10,000 * g;

8. re-suspended cell gently moves to the EP pipe in 0.4ml TE buffer (pH=7.4) gently;

9. isopyknic chloroform/Virahol (24: 1) ice bath 5min extracting is used in equal-volume phenol/chloroform (1: 1) ice bath 5min extracting again, shifts in water to the two EP pipe of upper strata;

10. add 1/2 volume 7.5M ammonium acetate (pH=7.5), add 2 times of volume dehydrated alcohols again, ice bath 20min places 60min for-20 ℃;

11. 4 ℃ of centrifugal 20min of 10,000 * g, after 1ml 70% washing with alcohol, recentrifuge 10min;

12. be resuspended among the TE (pH=7.4) ,-20 ℃ of preservations are stand-by;

Each genomic dna with extraction is a template, with 5 ' AOX ₁(5 '-GACTGGTTCCAATTGACAAGC-3 ') [SEQ.ID.NO.18] and 3 ' AOX ₁(5 '-GCAAATGGCATTCTGACATCC-3 ') [SEQ.ID.NO.19] primer carries out the PCR reaction, identifies positive recombinant, with do not contain insert gene pPIC9K transformant DNA in contrast.The PCR reaction conditions is as follows: 94 ℃, and 1min; 55 ℃, 1min; 72 ℃, 1min, 30 circulations.

With 1% gelose detected through gel electrophoresis PCR product, the result shows, coding rAcAP ₅The cDNA molecule of m correctly is integrated in the yeast chromosomal dna.

Embodiment 4 recombinant polypeptide rAcAP ₅The secreting, expressing of m

1, culture medium preparation: preparation and sterilising method are with embodiment 3, and each nutrient composition content is as follows:

BMGY: glycerine 1%, yeast extract 1%, peptone 2%, YNB1.34%, vitamin H 4 * 10 ^-5%, 0.1M potassium phosphate buffer (pH 6.0);

BMMY: methyl alcohol 0.5%, yeast extract 1%, peptone 2%, YNB1.34%, vitamin H 4 * 10 ^-5%, 0.1M potassium phosphate buffer (PH 6.0);

2, derivational expression method

Picking transformant list bacterium colony is inoculated among the 10mlBMGY, and 28 ℃ of 300r/min shaking culture are to OD ₆₀₀=2-6 (about 20h), the centrifugal 5min of 2000 * g room temperature, harvested cell, supernatant discarded, re-suspended cell reaches OD in the BMMY substratum ₆₀₀=1, in the expression process, add methyl alcohol one time every 24h.Regularly take out nutrient solution, the centrifugal 5min of 5000 * g room temperature gets supernatant.

3, SDS-PAGE electrophoretic analysis expression of results:

Get 500 μ l fermented liquid supernatant, more than 15% trichoroacetic acid(TCA) (TCA)-20 ℃ precipitation 1h, 12,000r/min, centrifugal 10min, careful sucking-off supernatant adds 1ml acetone, behind the jog, 12,000r/min, centrifugal 5min, careful sucking-off supernatant.Be dissolved in the 30 μ l systems after being deposited in 37 ℃ of oven dry, the fermented liquid that transforms bacterial strain with empty plasmid serves as that 15% SDS-PAGE electrophoresis is carried out in contrast, and coomassie brilliant blue staining is with the content of ultraviolet thin layer scanning direct analysis purpose band in total protein.(the electrophoresis concrete operation method is referring to " molecular cloning experiment guide " (third edition) J. Sa nurse Brooker D.W. Russell work), electrophoresis result is seen Fig. 5.

The ultraviolet thin layer scanning the results are shown in Table 1:

Table 1

The ultraviolet thin layer scanning is the result show, target protein accounts for 60.1% of total protein.

4, the Bradford method detects protein content: experimental technique is referring to " molecular cloning experiment guide " (third edition) J. Sa nurse Brooker D.W. Russell work.

The result is as follows:

With bovine serum albumin (BSA) concentration (mg/ml) is ordinate zou, and 595nm place light absorption value (OD595) is done the typical curve (see figure 6) for X-coordinate, obtains curvilinear equation: y=0.0202x-0.0002.See Table 2 according to the typical curve Equation for Calculating.

Table 2 is expressed the total protein concentration in the nutrient solution supernatant

Recombinant polypeptide rAcAP of the present invention in the culture supernatant ₅The concentration of m is: 51.5 * 60.1%=30.95mg/L.

The purifying of embodiment 5 expressing proteins

1, the preparation of reagent

Damping fluid I (100mM Na ₂HPO ₄NaH ₂PO ₄, pH7.8);

Binding buffer liquid (20mM Na ₂HPO ₄NaH ₂PO ₄, 500mM Nacl, pH7.8);

Lavation buffer solution (20mM Na ₂HPO ₄NaH ₂PO ₄, 500mM Nacl, pH6.0);

Imidazoles elution buffer (pH6.0): in lavation buffer solution, add the imidazoles elution buffer that an amount of 3mol/L imidazoles is made into 10mol/L, 50mol/L, 100mol/L and 150mol/L respectively.

2, purge process

Express supernatant liquor behind 0.45 μ m membrane filtration, add the damping fluid I (pH7.8) of 1/5 volume and the 2.5M Nacl of 1/5 volume, last sample is to NTA-Ni ²⁺On-agarose the affinity column, with the imidazoles elution buffer wash-out target protein of 10mol/L, 50mol/L, 100mol/L and 150mol/L.Remove residual imidazoles, vacuum lyophilization protein concentrate with PBS (pH7.4) dialysis after collecting the purpose peak.NTA-Ni ²⁺The processing and the purification step of post are as follows:

(1) puts upside down mixing Ni gently ²⁺Cured resin (5ml); (2) 3 times of column volume binding buffer liquid balance resins; (3) upward get 10 μ l sample determination Fxa inhibition activity before the sample; (4) sample is added to the top of chromatography column, flow velocity is 10 column volume/h, washes post with the binding buffer liquid of 6 column volumes, washes post (until A with lavation buffer solution ₂₈₀＜0.01), with the elution buffer wash-out that contains the 10mM imidazoles of 6 column volumes; (5) monitoring A ₂₈₀, collect each protein peak, detect the activity of sample in the elutriant; (6) successively respectively with the elution buffer wash-out that contains 50mM, 100mM, 150mM imidazoles of 6 column volumes; (7) monitoring A ₂₈₀, collect each protein peak, detect the protein-active in the elutriant, collect albumen and dialyse SDS-PAGE electrophoresis detection purification result.

Test example 1 recombinant polypeptide rAcAP of the present invention ₅The active mensuration of m vitro inhibition FXa

1, solution preparation

The preparation of damping fluid: 0.05M Tris (pH 7.5), 0.15M NaCl, 0.1%PEG-8000.

The preparation of FXa solution: get Bovine FXa 1 μ l, be diluted to 11.43ml with damping fluid, mixing is stand-by.

The preparation of substrate solution: accurate weighing chromophoric substrate Spectrozyme FXa 3.0mg, with the damping fluid dissolving and be diluted to 12.1ml, mixing is stand-by.

2, measuring method

All enzyme reactions are all in carrying out in 96 orifice plates under the room temperature, and the final concentration of FXa in system is 1nM, and the chromophoric substrate final concentration is 200 μ M.

(1) in 96 orifice plates, adds recombinant polypeptide rAcAP of the present invention successively by experimental design ₅M, rAcAP ₅(with reference to Enzyme andMicrobial Technology 1999 such as the Pichia Expression Kit specification sheets of invitrogen company and Mehmet Inan, 24:438-445, the method preparation of utilization reorganization), solvent (PBS) contrast 5 μ l (first row's adding, 295 μ l damping fluids are as blank), add FXa 145 μ l then, at room temperature cultivate 30min in advance, make with enzyme fully to combine.

(2) add substrate 145 μ l and start enzyme reaction.Chromophoric substrate combines with enzyme, discharge the contraposition nitro and produce color, under the 405nm wavelength, measure the OD value of reaction when just having begun, calculate the increment of OD value in the 10min, be V-bar (the Δ OD of the interior enzyme reaction of 10min with 10min with BIO-RAD 550 type microplate reader ¹⁰).

(3) with the Δ OD of solvent ¹⁰Be maximum reaction velocity, calculate the inhibition percentage (I%) of sample.

I%=(Δ OD ¹⁰ _Contrast-Δ OD ¹⁰ _Sample)/Δ OD ¹⁰ _Contrast* 100%

The result is as follows:

The rAcAP of table 3 different concns ₅M is to the active inhibition result of FXa

With concentration is X-coordinate, and suppressing percentage is that ordinate zou is done the curve (see figure 7), obtains equation

y＝14.404Ln(x)+21.462。

Calculate according to formula: IG ₅₀(the rAcAP during 50% FXa activity inhibited ₅M concentration)=7.25nM.

The rAcAP of table 4 different concns ₅Activity to the FXa inhibition

With concentration is X-coordinate, and suppressing percentage is that ordinate zou is done the curve (see figure 8), obtains equation

y＝16.578Ln(x)+45.808。

Calculate according to formula: IC ₅₀(the rAcAP during 50% FXa activity inhibited ₅Concentration)=1.28nM.

Test example 2 recombinant polypeptide rAcAP of the present invention ₅M and rAcAP ₅Antithrombotic acitivity is measured

Test method: male mouse of kunming, body weight 35～40g is divided into blank group, rAcAP at random ₅M group (dosage: 1.45mg/kg), rAcAP ₅Group (dosage: 1.45mg/kg), with reference to Enzyme and Microbial Technology1999 such as the PichiaExpression Kit specification sheets of invitrogen company and Mehmet Inan, 24:438-445 utilizes the method preparation of reorganization) and heparin group (dosage: 1030U/kg) totally four groups.Behind the subcutaneous administration 15min, 0.6g/kg vetanarcol intraperitoneal injection of anesthesia.Open the capable ligation of inferior vena cava of abdomen, removal of thromboses is weighed after 6 hours, the results are shown in Table 5.

Table 5 recombinant polypeptide rAcAP of the present invention ₅M and rAcAP ₅Raw data to mouse postcava thrombotest

Table 6 recombinant polypeptide rAcAP of the present invention ₅M and rAcAP ₅To the thrombotic restraining effect of mouse postcava

* p＜0.01: compare with blank.

Sequence table

＜110〉Peking University

＜120〉recombinant dog hookworm coagulate peptide resistant 5 mutant, its encoding gene, its preparation and application

<130>p0885

<160>19

<170>PatentIn?version?3.3

<210>1

<211>162

<212>DNA

<213>artificial

<220>

<223>

<220>

<221>CDS

<222>(1)..(162)

<400>1

aag?gct?tac?cca?gag?tgt?ggt?gag?aac?gag?tgt?cca?atc?tgt?aga agt 48

Lys?Ala?Tyr?Pro?Glu?Cys?Gly?Glu?Asn?Glu?Cys?Pro?Ile?Cys?Arg Ser

1 5 10 15

aga?ggt?tgt?ttg?ttg?cca?cca?gct?tgt?gtc?tgt?aag?gac?ggt?ttc?tac 96

Arg?Gly?Cys?Leu?Leu?Pro?Pro?Ala?Cys?Val?Cys?Lys?Asp?Gly?Phe?Tyr

20 25 30

aga?gac?acc?gtc?atc?ggt?gac?tgt?gtc?aga?gag?gag?gag?tgt?gac?cag 144

Arg?Asp?Thr?Val?Ile?Gly?Asp?Cys?Val?Arg?Glu?Glu?Glu?Cys?Asp?Gln

35 40 45

cat?gag?atc?atc?cat?gtc 162

His?Glu?Ile?Ile?His?Val

50

<210>2

<211>54

<212>PRT

<213>artificial

<220>

<223>Synthetic?Construct

<400>2

Lys?Ala?Tyr?Pro?Glu?Cys?Gly?Glu?Asn?Glu?Cys?Pro?Ile?Cys?Arg?Ser

1 5 10 15

Arg?Gly?Cys?Leu?Leu?Pro?Pro?Ala?Cys?Val?Cys?Lys?Asp?Gly?Phe?Tyr

20 25 30

Arg?Asp?Thr?Val?Ile?Gly?Asp?Cys?Val?Arg?Glu?Glu?Clu?Cys?Asp?Gln

35 40 45

His?Glu?Ile?Ile?His?Val

50

<210>3

<211>159

<212>DNA

<213>Artificial

<220>

<223>

<400>3

aaggctccag?agtgtggtga?gaacgagtgt?ccaatctgta?gaagtagagg?ttgtttgttg 60

ccaccagctt?gtgtctgtaa?ggacggtttc?tacagagaca?ccgtcatcgg?tgactgtgtc 120

agagaggagg?agtgtgacca?gcatgagatc?atccatgtc 159

<210>4

<211>162

<212>DNA

<213>Artificial

<220>

<223>

<400>4

aaggcttacc?cagagtgtgg?tgagaacgag?tgtccaatct?gtagaagtag?aggttgtttg 60

gagccaccag?cttgtgtctg?taaggacggt?ttctacagag?acaccgtcat?cggtgactgt 120

gtcagagagg?aggagtgtga?ccagcatgag?atcatccatg?tc 162

<210>5

<211>162

<212>DNA

<213>Artificial

<220>

<223>

<400>5

aaggcttacc?cagagtgtgg?tgagaacgag?tgtccaatct?gtagaagtag?aggttgtttg 60

ttgaagccag?cttgtgtctg?taaggacggt?ttctacagag?acaccgtcat?cggtgactgt 120

gtcagagagg?aggagtgtga?ccagcatgag?atcatccatg?tc 162

<210>6

<211>162

<212>DNA

<213>Artificial

<220>

<223>

<400>6

aaggcttacc?cagagtgtgg?tgagaacgag?tgtccaatct?gtagaagtag?aggttgtttg 60

gagaagccag?cttgtgtctg?taaggacggt?ttctacagag?acaccgtcat?cggtgactgt 120

gtcagagagg?aggagtgtga?ccagcatgag?atcatccatg?tc 162

<210>7

<211>162

<212>DNA

<213>Artificial

<220>

<223>

<400>7

aaggcttacc?cagagtgtgg?tgagaacgag?tgtccaatct?gtagaagtag?aggttgtttg 60

ttgccaccag?cttgtgtctg?taaggacggt?agttacagag?acaccgtcat?cggtgactgt 120

gtcagagagg?aggagtgtga?ccagcatgag?atcatccatg?tc 162

<210>8

<211>21

<212>DNA

<213>Artificial

<220>

<223>

<400>8

caccaccacc?accaccacgg?t 21

<210>9

<211>15

<212>DNA

<213>Artificial

<220>

<223>

<400>9

gacgacgacg?acaag 15

<210>10

<211>59

<212>DNA

<213>Artificial

<220>

<223>

<400>10

gaattccacc?accaccacca?ccacggtggt?gacgacgacg?acaagaaggc?ttacccaga 59

<210>11

<211>42

<212>DNA

<213>Artificial

<220>

<223>

<400>11

ggacactcgt?tctcaccaca?ctctgggtaa?gccttcttgt?cg 42

<210>12

<211>47

<212>DNA

<213>Artificial

<220>

<223>

<400>12

gtgtggtgag?aacgagtgtc?caatctgtag?aagtagaggt?tgtttgt 47

<210>13

<211>45

<212>DNA

<213>Artificial

<220>

<223>

<400>13

cagacacaag?ctggtggcaa?caaacaacct ctacttctac?agatt 45

<210>14

<211>42

<212>DNA

<213>Artificial

<220>

<223>

<400>14

tgccaccagc?ttgtgtctgt?aaggacggtt?tctacagaga?ca 42

<210>15

<211>43

<212>DNA

<213>Artificial

<220>

<223>

<400>15

gacacagtca?ccgatgacgg?tgtctctgta?gaaaccgtcc?tta 43

<210>16

<211>41

<212>DNA

<213>Artificial

<220>

<223>

<400>16

ccgtcatcgg?tgactgtgtc?agagaggagg?agtgtgacca?g 41

<210>17

<211>53

<212>DNA

<213>Artificial

<220>

<223>

<400>17

gcggccgctc?atcagacatg?gatgatctca?tgctggtcac?actcctcctc?tct 53

<210>18

<211>21

<212>DNA

<213>Artificial

<220>

<223>

<400>18

gactggttcc?aattgacaag?c 21

<210>19

<211>21

<212>DNA

<213>Artificial

<220>

<223>

<400>19

gcaaatggca?ttctgacatc?c 21

Claims (8)

1. a class recombinant dog hookworm coagulate peptide resistant 5 mutant, it is following (a) or aminoacid sequence (b):

(a) aminoacid sequence shown in the SEQ ID NO:2; (b) with the aminoacid sequence shown in the SEQ ID NO:2 by one or more amino-acid residues replacement or disappearance obtain still have a polypeptide derivative that suppresses FXa activity or antithrombotic acitivity or function; Wherein, described replacement is meant: the 22nd Leu is replaced with Glu; Or the 23rd Pro replaced with Asp; Or respectively the 22nd Leu is replaced with Glu, the 23rd Pro simultaneously and replace with Asp; Or the 31st Phe replaced with Ser; Described disappearance is meant: the 3rd Try is lacked.

2. the cDNA sequence of the recombinant dog hookworm coagulate peptide resistant 5 mutant of the claim 1 of encoding, this cDNA sequence be (a) or (b) shown in nucleotide sequence:

(a) nucleotide sequence shown in the SEQ ID NO:1; Or

(b) nucleotide sequence of aminoacid sequence shown in the coding SEQ ID NO:2.

3. expression vector is characterized in that containing the cDNA sequence of claim 2.

4. according to the expression vector of claim 3, it is characterized in that described expression vector is Yeast expression carrier pPIC9k-rAcAP ₅M; Wherein, described rAcAP ₅The nucleotides sequence of m is classified the nucleotide sequence shown in the SEQ ID NO:1 as.

5. a host cell is characterized in that containing claim 3 or 4 described expression vectors.

6. method for preparing the recombinant dog hookworm coagulate peptide resistant 5 mutant of claim 1 may further comprise the steps:

Cultivate the described host cell of claim 5, induce the expression of recombinant dog hookworm coagulate peptide resistant 5 mutant, reclaim and the expressed recombinant dog hookworm coagulate peptide resistant 5 mutant of purifying.

7. according to the method for claim 6, it is characterized in that described host cell is pichia spp cell (Pichicpastoris) GS115; Described induction method is the expression with the methanol induction recombinant dog hookworm coagulate peptide resistant 5 mutant; Described purification process may further comprise the steps: (a) utilize NTA-Ni ²⁺The affinitive layer purification recombinant products; (b) cut 6 * His label of N-terminal behind the purifying with enteropeptidase.

8. the described recombinant dog hookworm coagulate peptide resistant 5 mutant of claim 1 is in the purposes of preparation in the antithrombotic reagent.

Images