CN101363027B - Method for preparing recombination plasmid carrying short hairpin RNA and use - Google Patents
Method for preparing recombination plasmid carrying short hairpin RNA and use Download PDFInfo
- Publication number
- CN101363027B CN101363027B CN2007100528991A CN200710052899A CN101363027B CN 101363027 B CN101363027 B CN 101363027B CN 2007100528991 A CN2007100528991 A CN 2007100528991A CN 200710052899 A CN200710052899 A CN 200710052899A CN 101363027 B CN101363027 B CN 101363027B
- Authority
- CN
- China
- Prior art keywords
- pegfp
- plasmid
- shtert
- shvegf
- vegf
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Abstract
The invention discloses a method for preparing recombinant plasmid carrying short hairpin RNA and the usage thereof; the method comprises the steps that firstly, siRNA target sequence is selected out; secondly, three pairs of sense strands and antisense strands of siRNAs are designed along the target direction; thirdly, the three pairs of siRNAs along the target direction are synthesized; fourthly, linearization is carried out on a plasmid vector; fifthly, plasmid PEGFP-shVEGF, PEGFP-shTERT and PEGFP-shBcl-xl are constructed; sixthly, plasmid pEGFP-shVEGF-shTERT is constructed; seventhly, plasmid pEGFP-shVEGF-shTERT-shBcl-x1 is constructed. The method is easy to carry out, and the operation is easy. The recombinant plasmid is applied in the preparation of medicine of RNA interference genetherapy for treating squamous cell carcinoma, thereby effectively inhibiting the growth and proliferation of tumour cell.
Description
Technical field
The invention belongs to the biotechnology invention field.Be specifically related to a kind of preparation method who carries the recombinant plasmid pEGFP-shVEGF-shTERT-shBcl-xl of three rnai oligonucleotide transcriptional units, three genes of target tumor cell (TERT, VEGF, Bcl-xl).The invention still further relates to the purposes of this recombinant plasmid.
Background technology
Malignant tumour is the No.1 killer who threatens human life's health.According to World Health Organization's statistics, there are 2,460 ten thousand cancer patientss in the whole world at present; To the year two thousand twenty, estimation will reach 3,000 ten thousand, can cause more than 1,000 ten thousand people's death every year.Larynx squama cancer is as the modal malignant tumour of throat, and its sickness rate had obvious ascendant trend in recent years.The traditional therapy of larynx squama cancer comprises operation, radiotherapy, chemotherapy, reaches complex therapy etc.Yet 5 years survival rates of many patients are not greatly improved.Along with the development of molecular biology and related discipline thereof, the gene therapy of larynx squama cancer has become the research focus.The at present single-gene therapies that adopt of the gene therapy of larynx squama cancer, its target gene comprises oncogene, anti-apoptotic genes expression, Telomerase, signaling molecule etc. more.
In recent years, RNA disturbed that (RNA interference, RNAi) technology has obtained development fast as a new gene disruption technology, has very big potentiality in gene therapy, for the research of tumour provides new strategy and technology platform.Chinese scholars has been carried out a large amount of RNAi treatment research at different tumour cells and transplanted tumor animal model, has obtained remarkable progress.RNA disturbs characteristics such as the sequence-specific, the effect that have the gene inhibition definite effect, suppress to have strictness are rapid, so compare with the therapy of tumor method that gene substitution, antisense strategy, cytokine gene treatment etc. are traditional, the RNA perturbation technique has incomparable advantage.Therefore, the RNA perturbation technique earns widespread respect in the antitumor drug exploitation, though find RNAi phenomenon less than 10 years, becomes the research focus and has only for six years, and its development is advanced by leaps and bounds, and existing multiple related drugs is in clinical development.
At present, the relevant patent of RNAi is mainly grasped abroad.In recent years, Chinese also the startup utilized the RNA perturbation technique to carry out the preclinical study of cancer therapy drug, obtained some progress.Bai Chunxue etc. are at the siRNA (siRNA) of the selectively targeted EGF-R ELISA of external chemosynthesis (EGFR) sequence, by cationic-liposome transfection human lung adenocarcinoma cell line A549 cell, and detection EGFR change of Expression, found that, the expression of EGFR is obviously reduced in the A549 cell, and growth and proliferation of cell is suppressed, and inhibiting rate is 67.8%, tumour cell strengthens the susceptibility of chemicotherapy, and this invention has obtained national inventing patent mandate (application number: 03115489.1).The siRNA that this invention is used for RNAi research is external chemosynthesis, and its preparation method is simple, fast, but siRNA easily degraded in vivo, retention time is short, is not suitable for studying for a long period of time; And it is target spot with the individual gene that this invention utilizes RNA interference treatment tumour, does not consequently suppress the growth of tumour cell fully.The generation development of malignant tumour is the coefficient result of several genes in multifactor presence, and the single-gene treatment may not reach the ideal effect.Therefore, start with from a plurality of paths of tumour and vasculogenesis, utilization RNA perturbation technique targeted therapy tumour, from the expression that too many levels, many-side are sealed aberrant gene, it is more reasonable to seem on the strategy of oncotherapy, also may further improve curative effect.Still the research report that does not have at present the polygenic short hairpin RNA treatment of target larynx squama cancer both at home and abroad.Recombinant plasmid treatment larynx squama cancer provided by the invention will provide new approaches for the gene therapy of larynx squama cancer.
Summary of the invention
The objective of the invention is to be to provide a kind of preparation method who carries the recombinant plasmid (pEGFP-shVEGF-shTERT-shBcl-xl) of short hairpin RNA.Easy to implement the method, simple to operate, this recombinant plasmid is good than external chemosynthesis siRNA preparation method method quality controllability, and the carrier that has antibiotic marker can continue to suppress target gene expression in cell, continue a few weeks longer even more of a specified duration, can increase in a large number etc.
Another object of the present invention provides the application of recombinant plasmid in the RNA interference gene therapy medicament of preparation treatment larynx squama cancer of carrying short hairpin RNA.
The invention reside in and make up a kind of recombinant plasmid, this plasmid carries three rnai oligonucleotide transcriptional units, can express three kinds of different short hairpin RNAs (shRNA) simultaneously, these shRNA will distinguish target VEGF (vascular endothelial growth factor), TERT (reverse transcriptase of telomere), Bcl-xl gene.
The present invention provides the application of recombinant plasmid (pEGFP-shVEGF-shTERT-shBcl-xl) in the RNA of larynx squama cancer interference gene therapy of carrying short hairpin RNA.This recombinant plasmid mediation siRNA expresses basic ideas in vivo and is: three shRNA sequences of tandem expression are directly transcribed out corresponding separately shRNA structural unit in cell on same plasmid vector, cut the loop ring through enzyme and generate corresponding siRNA.Use this recombinant plasmid treatment larynx squama cancer and have plurality of advantages,, only just three incoherent genes of sequence can be rejected simultaneously with a kind of plasmid of injection as simple to operate; Integrate and diffusion dangerous less; Antigenicity is low, can repeatedly offer medicine and does not cause serious immune response as virus vector; Can in born of the same parents, continue to produce siRNA, be applicable to study for a long period of time.
Three kinds of genes of the present invention, VEGF (vascular endothelial growth factor), be one with the directly related factor of the generation of tumour development, by promoting vascular endothelial growth, increase vascular permeability, promote metastases, in tumor growth and transfer process, play a significant role; Activation of telomerase is to make cell obtain the key factor that unlimited multiplication capacity becomes immortalized cells, TERT (reverse transcriptase of telomere) is the active main component of adjustable side granzyme, and TERT only expresses in Telomerase male tumour cell and immortalized cells specifically; Bcl-xl is an important anti-apoptotic genes expression in the bcl-2 family, and the generation of Bcl-xl up-regulated and tumour, development and prognosis are closely related.Existing studies show that, these three kinds of genes are high expression level in larynx squama cancerous tissue, the closely related (Tao Zezhang of the generation of its up-regulated and laryngocarcinoma, development and prognosis mala, Liu Jianfeng, Xiao Baikui is etc. incidence squama cancer and cancer beside organism's telomerase activation research cancer, 2000,19:671-673; Teknos TN, Cox C, Yoo S, et al.Elevated serum vascular endothelial growth factor and decreased survival inadvanced laryngeal carcinoma.Head Neck, 2002,24:1004-1011; Krecicki T, Fraczek M, Kozlak J, et al.Bcl-xl protein expression in laryngeal squamous cell carcinoma.Clin otolaryngol Allied Sci, 2004,29:55-58).In larynx squama cancer or other solid tumor, suppress these several expression of gene, can effectively suppress growth of tumor (Chen Xiong, Kong Weijia, Dong Jihua, siRNA Deng the target vascular therapy endothelial cell growth factor (ECGF) expresses the restraining effect of framework to the growth of laryngeal cancer cell strain Hep-2 cell. Chinese hals,Nasen und Ohrenheilkunde neck surgical magazine, 2005,40:759-763; Chen SM, Tao ZZ (Tao Zezhang), Hua QQ, et al.Inhibition of human telomerase reverse transcriptase in Hep-2cells usingshort hairpin RNA expression vectors.Arch Otolaryngol Head Neck Surg, 2006,132:200-205; Zhu H, Guo W, Zhang L, et al.Bcl-xl small interfering RNA suppresses the proliferation of5-fluorouracil-resistant human colon cancer cells.Mol Cancer Ther, 2005,4:451-456).
To achieve these goals, the present invention will use following technical measures: recombinant plasmid
The structure of pEGFP-shVEGF-shTERT-shBcl-xl, it comprises the following steps:
Plasmid vector PEGFP-1, PEGFP-3, PEGFP-4, competent cell DH5 α used among the present invention purchase from Wuhan City crystalline substance match company; Used enzyme: T4DNA Ligase, BamHI, HindIII, EcoRI, SalI, XbaI, PstI are available from Niu Yinglun Bioisystech Co., Ltd; " (＜40 μ g) plasmid purification test kit on a small scale " of being used for extracting plasmid is available from ancient cooking vessel company.Its preparation method is as follows:
1. selected siRNA target sequence: the standard sequence of from GenBank, finding out people VEGF mRNA, TERT mRNA, Bcl-xl mRNA; According to the shRNA principle of design, selected RNA interferential target sequence.
The shRNA principle of design is as follows:
(1) 75 to 100 base positions, target gene open reading frame initiation codon (" ATG ") downstream begin, and seek 19 base sequences after " AA " two connects sequence;
(2) analyze the sequence that obtains, select the target-gene sequence of G/C value between 40-55% as potential preferred;
(3) the hair clip partial-length is generally 6-9nt, and the 9nt effect is best;
(4) potential sequence and corresponding genome database (people, mouse or rat etc.) are compared, get rid of and other encoding sequence/EST homologous sequence.
(5) negative control is set: a complete RNA interference experiment should have negative control, and in this experiment, one section of applicant's picked at random and Human genome do not have the plasmid that contains luciferin gene of base sequence HK construction expression shRNA of homology as negative control.
Selected RNA at VEGF, TERT, Bcl-xl, HK disturbs target sequence as follows:
VEGF：5-AAACCUCACCAAGGCCAGCAC-3(328-348)；
TERT：5-GTTCCTGCACTGGCTGATG-3(1629-1647)；
Bcl-xl：5-GGAGATGCAGGTATTGGTGAG-3(605-625)；
HK：5-ACTACCGTTGTTATAGGTG-3。
2. positive-sense strand and the antisense strand of four couples of shRNA of design target VEGF, TERT, Bcl-xl, HK are as follows:
The VEGF-positive-sense strand:
5 '-GATCCACCTCACCAAGGCCAGCACTTCAAGACGGTGCTGGCCTTGGTGAGGTTTTT TTGAATTCA-3 ', shown in SEQ ID NO.1.
The VEGF-antisense strand:
3 '-GTGGAGTGGTTCCGGTCGTGAAGTTCTGCCACGACCGGAACCACTCCAAAAAAACT TAAGTTCGA-5 is shown in SEQ ID NO.2.
The TERT-positive-sense strand:
5 '-GATCCGTTCCTGCACTGGCTGATGTTCAAGACGCATCAGCCAGTGCAGGAACTTTT TTGTCGACA-3 ', shown in SEQ IDNO.3.
The TERT-antisense strand:
3 '-GCAAGGACGTGACCGACTACAAGTTCTGCGTAGTCGGTCACGTCCTTGAAAAAACA GCTGTTCGA-5 ' is shown in SEQ ID NO.4.
The Bcl-xl-positive-sense strand:
5 '-GATCCGGAGATGCAGGTATTGGTGAGTTCAAGACGCTCACCAATACCTGCATCTCC TTTTTTTCTAGAA-3 ', shown in SEQ ID NO.5.
The Bcl-xl-antisense strand:
3 '-GCCTCTACGTCCATAACCACTCAAGTTCTGCGAGTGGTTATGGACGTAGAGGAAAA AAAGATCTTTCGA-5 ' is shown in SEQ ID NO.6.
The HK-positive-sense strand:
5′-GATCCACTACCGTTGTTATAGGTGTTCAAGACGCACCTATAACAACGGTAGTTTTTTTGTCGACA-3’
The HK-antisense strand:
3’-GTGATGGCAACAATATCCACAAGTTCTGCGTGGATATTGTTGCCATCAAAAAAACAGCTGTTCGA-5’
The primer structure: BamHI+Sense+Loop+Antisense+ termination signal+EcoRI/SalI/XbaI+HindIII. template strand back is connected with the transcription pausing site (6 T) of rna plymerase iii, be respectively the restriction enzyme site of BamHI and HindIII simultaneously, and we have designed one and are used for doing enzyme and cut the enzyme of evaluation and cut the position after ending the site at the template two ends.
3. four couples of shRNA's of target VEGF, TERT, Bcl-xl, HK mRNA is synthetic: two dna single chain annealing connections are dna double chain template, link to each other four couples of shRNA (Figure 1A) of acquisition with the loop ring.
The shRNA of target VEGF, TERT, Bcl-xl mRNA will be building up in the plasmid that contains the U6 promotor, plasmid changes cell over to, under promotor is handled, transcribe and generate siRNA,, promptly suppress the expression of VEGF, TERT, Bcl-xl mRNA to carry out the reticent function of specific gene.The shRNA of target HK mRNA to people's gene order without any effect, as just negative control.
4. the linearizing of plasmid vector PEGFP-1, PEGFP-3, PEGFP-4: with BamHI and the above three kinds of plasmids of the complete double digestion of HindIII, big fragment is reclaimed in the 1%Agase gel electrophoresis, is linear carrier; More than three kinds of plasmid carriers except that the MCS difference, all the other sequences are just the same.
The MCS of PEGFP-1 is as follows:
-HindIII-Insert?DNA-BamHI-U6?Promotor-EcoRI-SacI-KpnI-SalI-BssHII-XbaI-NotI-PstI-DraIII-
The MCS of PEGFP-3 is as follows:
-HindIII-Insert?DNA-BamHI-U6Promotor-EcoRI-BssHII-XbaI-NotI-PstI-DraIII-
The MCS of PEGFP-4 is as follows:
-HindIII-Insert?DNA-BamHI-U6Promotor-EcoRI-PstI-DraIII-
5. make up plasmid PEGFP-shVEGF, PEGFP-shTERT, PEGFP-shBcl-xl, reach negative control plasmid PEGFP-shHK; ShVEGF is connected with the PEGFP-1 carrier, and shTERT is connected with the PEGFP-3 carrier, and shBcl-xl is connected with the PEGFP-4 carrier, and shHK is connected with the PEGFP-4 carrier; To connect product transformed competence colibacillus cell DH5 α, separate application on the LB flat board that contains the Kanar resistance, 37 ℃ of constant incubator overnight incubation; (＜40 μ g) extracts plasmid in a small amount, and does enzyme and cut evaluation; The correct plasmid transformed bacteria liquid of picking clone goes order-checking, does not have the base sudden change through the sequencing result analysis, and the target gene sequences of the plasmid of structure is correct.
6. make up plasmid pEGFP-shVEGF-shTERT: the SalI+PstI double digestion of plasmid PEGFP-shVEGF, PEGFP-shTERT, reclaim big fragment and small segment respectively; Connect big fragment of PEGFP-shVEGF and PEGFP-shTERT small segment; To connect product transformed competence colibacillus cell DH5 α, separate application is in containing Kana
rOn the LB flat board of resistance, 37 ℃ of constant incubator overnight incubation; (＜40 μ g) extracts plasmid in a small amount, and does enzyme with BamHI and cut evaluation, and the result shows, target gene fragment VEGF and target gene fragment TERT successful connection; The correct plasmid transformed bacteria liquid of picking clone goes order-checking, does not have the base sudden change through the sequencing result analysis, and the target gene sequences of the plasmid of structure is correct.
7. make up plasmid pEGFP-shVEGF-shTERT-shBcl-xl: the XbaI+PstI double digestion of plasmid pEGFP-shVEGF-shTERT and plasmid PEGFP-shBcl-xl, reclaim big fragment and small segment respectively; Being connected of big fragment of pEGFP-shVEGF-shTERT and plasmid PEGFP-shBcl-xl small segment; To connect product transformed competence colibacillus cell DH5 α, separate application on the LB flat board that contains the Kanar resistance, 37 ℃ of constant incubator overnight incubation; (＜40 μ g) extracts plasmid in a small amount, and does enzyme with HindIII+PstI respectively and cut evaluation, and the result shows, target gene fragment VEGF+TERT and target gene fragment bcl-xl successful connection (Fig. 2); The correct plasmid transformed bacteria liquid of picking clone goes order-checking, through the sequencing result analysis, does not have the base sudden change through the sequencing result analysis, the target gene sequences of the plasmid of structure correct (Figure 1B).
This recombinant plasmid feature is as follows:
A morphological specificity: be the circular double stranded DNA structure, it is characterized in that comprising site (the pUCOri-intestinal bacteria pUC series plasmid replication initiation site of three control replication initiations, the SV40Ori-SV40 replication origin, f1 Ori-f1 phage replication initiation site), U6 promotor, placed in-line three short hairpin RNA structures (shVEGF, shTERT, shBcl-xl), scavenger cell virus early promoter (CMV), green fluorescence plain gene albumen (EGFP), antibiotics resistance gene (Kanar protokaryon resistant gene, Neo
rThe eucaryon resistant gene), Poly A tailing signal (keeping the mRNA stability of molecule) and U6 stop molecular structure;
The b physiological and biochemical property: this recombinant plasmid transfection in the cell of vitro culture or the animal body after, can independent self-replicating, thus in cell or animal body, transcribe out corresponding separately shRNA structural unit endlessly; Have the antibiotics resistance sign, recipient cell is placed on when containing on this microbiotic culture plate incubation growth so that screening; But this plasmid is expressing green fluorescent protein (GFP) under the driving of CMV, so that detect transfection efficiency;
The c functional character: this recombinant plasmid can mediate three rnai oligonucleotide transcriptional units and enter in the tumour cell, to produce the shRNA structural unit of targeting human VEGF, TERT, Bcl-xl mRNA after transcribing, cut the loop ring through enzyme and generate corresponding siRNA, simultaneously reticent VEGF, TERT, these three expression of gene of Bcl-xl; Can share separately or with methods such as chemicotherapies, be used for the gene therapy of larynx squama cancer.
In another aspect of the present invention, also provide the application of this plasmid in the RNA interference gene therapy medicament of preparation treatment larynx squama cancer.The larynx squamous cell carcinoma of choosing is that the Hep-2 cell derives from abroad, and available from Wuhan University preservation center (but public offering, numbering GDC004), nude mice is available from Hubei Province's Center for Disease Control, and lipofectamine Metafectene is available from German Biontex company.May further comprise the steps:
1. plasmid pEGFP-shVEGF-shTERT-shBcl-xl is to the outer therapeutic action of larynx squama corpus carcinosus:
(1) method by liposome transfection imports this plasmid in the Hep-2 cell of vitro culture, and conventional the cultivation behind the 24h in Laser Scanning Confocal Microscope (German Leica company, TCS SP2MP) detected the luciferase expression situation down; The result shows, people's larynx squama cancer Hep-2 cell (Fig. 3) of the importing vitro culture of plasmid pEGFP-shVEGF-shTERT-shBcl-xl and negative control plasmid pEGFP-shHK success;
(2) 24h behind the plasmid transfection, 48h, 72h collects respectively and respectively organizes cell, extract respectively and respectively organize mRNA and total protein, detect the influence of recombinant plasmid vector to three destination gene expressions of people's larynx squama cancer Hep-2 cell from gene and protein expression level: the real-time quantitative RT-PCR result all shows VEGF, TERT and Bcl-xl mRNA express and are obviously suppressed, and this retarding effect is time-dependent manner, handled back 72 hours, retarding effect is the most obvious, show the expression of three goal gene of this plasmid efficient specific inhibition of energy, concrete data see Table 1; The protein blot result shows treatment back 24h, 48h and 72h, compares three all obviously downward modulations (Fig. 4) of goal gene protein expression levels with control group.Vegf protein is adjusted downward to 63.12%, 38.67%, 20.36% (P＜0.05); TERT albumen is adjusted downward to 58.57%, 27.63%, 15.21% (P＜0.05); The Bcl-xl protein expression is adjusted downward to 50.32%, 29.46%, 17.35% (P＜0.05);
3 destination gene expression amounts behind the table 1. plasmid pEGFP-shVEGF-shTERT-shBcl-xl transfectional cell
A.. the negative plasmid control group of polygene treatment group B. C. blank group
*Compare P＜0.05 with the C group
(2) MTT result shows (Fig. 5), and the cell-proliferation activity after pEGFP-shVEGF-shTERT-shBcl-xl handles significantly reduces, compare with control group, and 24h, 48h and 72h after processing, cell-proliferation activity reduces to 62.22%, 28.77% and 10.24% respectively;
(3) under fluorescent microscope and under the Electronic Speculum, all observe cell after the Hoechst dyeing and typical apoptosis morphological change (Fig. 6) occurs.
Above result shows the expression of three goal gene of this plasmid efficient specific inhibition of energy, and larynx squama cancer Hep-2 cell is had the significant cytotoxicity effect, proliferation activity capable of inhibiting cell and cell death inducing.
2. plasmid pEGFP-shVEGF-shTERT-shBcl-xl is to the interior therapeutic effect of larynx squama cancer:
(1) forms larynx squama carcinoma animal model through nude mice in subcutaneous vaccination people larynx squamous cell cancer Hep-2 cell;
(2) this recombinant plasmid of multi-point injection around the knurl body, every 20 μ g (20 μ g plasmids+30 μ l transfection reagents+300 μ l serum-free antibiotic-free DMEM nutrient solutions), negative control plasmid group injection pEGFP-shHK, dosage is with the treatment group; Multi-point injection physiological saline in the physiological saline control group, knurl body, each 0.3ml, injection in per 2 days 1 time, totally 7 times;
(3) measure the tumour size during the administration, treated for the last time back 14 days, after the sacrificed by decapitation, take out tumour; Real-time quantitative RT-PCR is the result show, VEGF, TERT, Bcl-xl mRNA express the downward modulation that has respectively in various degree in the tumor tissues, and concrete data see Table 2;
Respectively organize goal gene mRNA relative expression quantity in the transplanted tumor in nude mice tissue after table 2. treatment
A. the negative plasmid control group of polygene treatment group B. C. blank group
*Relatively preceding with treatment, P＜0.05
(4) growth curve shows (Fig. 7), and treatment group transplanted tumor volume is significantly less than control group, treats inhibitory rate 91.2% back 14 days;
(5) microvessel density obviously descends in the treatment group tumor tissues, and the tumor tissues new vessel reduces (Fig. 8);
(6) see the apoptotic cell that is dispersed in distribution in a large number in the tumor tissues, apoptotic index is (60.34 ± 5.32) % (Fig. 9).
Above data show, show that this plasmid can effectively be transfected into tumor bearing nude mice and expression, further is suppressed at the growing multiplication of body tumour cell effectively.
The present invention proves that first described recombinant plasmid vector can efficient specificly suppress the expression of three genes in people's larynx squama cancer Hep-2 cell simultaneously, and shows powerful inhibition tumor proliferation effect with external in vivo.
The present invention compared with prior art has the following advantages and effect:
1. three shRNA sequences of tandem expression are on same plasmid vector, in cell, directly transcribe out corresponding separately shRNA structural unit, cut the loop ring through enzyme and generate corresponding siRNA, bring into play the effect that RNAi suppresses three genes simultaneously, and suppress effect and do not disturb mutually, therefore, only just three incoherent genes of sequence can be rejected simultaneously with a kind of plasmid of injection;
2. this recombinant plasmid preparation quality controllability is good, has the kalamycin resistance sign so that screening;
But 3. this recombinant plasmid expressing green fluorescent protein under the driving of CMV promotor, but simple and effective be used to the label that detects the transfection situation or carry out selected by flow cytometry apoptosis;
4. plasmid energy self-replicating in tumour cell can continue to produce siRNA in born of the same parents, is applicable to study for a long period of time;
5. utilize this recombinant plasmid treatment larynx squama cancer; start with from a plurality of (three or more than) path of tumor growth and vasculogenesis; utilization RNA perturbation technique targeted therapy tumour means, the expression of sealing aberrant gene from too many levels, many-side is for the gene therapy of larynx squama cancer provides new approaches.
Description of drawings
Figure 1A is the shRNA of targeting human VEGF, TERT, Bcl-xl, HK mRNA.
Figure 1B is a kind of construction of recombinant plasmid structural representation of taking three band short hairpin RNAs: the template of three short hairpin RNAs of coding is inserted between the BamHI and HindIII restricted area in U6 promotor downstream, will produce the shRNA structural unit of targeting human VEGF, TERT, Bcl-xl after transcribing.Its multiple clone site (MCS) is :-HindIII-VEGF-BamHI-U6Promotor-EcoRI-SacI-KpnI-TERT-BamHI-U6Promotor-EcoRI-BssHII-bcl-xl-BamHI-U6Promotor-EcoRI-Ps tI-DraIII-
CMV: scavenger cell virus early promoter, EGFP: green fluorescence plain gene albumen, Kanar, Neor: antibiotics resistance gene,
PUC Ori: intestinal bacteria pUC series plasmid replication initiation site, SV40Ori:SV40 replication origin, f1Ori:fl phage replication initiation site, MCS: multiple clone site
Fig. 2 shows the 1%Agase gel electrophoresis spectrum of recombinant plasmid.
The DL2000Marker electrophoretic band is respectively 2000bp, 1000bp, 750bp, 500bp, 250bp and 100bp.1,3,5: the plasmid VEGF+TERT+Bcl-xl electrophoresis of cutting without enzyme; 2,4,6: the DNA band after plasmid VEGF+TERT+Bcl-xl cuts with the HindIII+PstI enzyme, about about 1200bp.
Fig. 3 shows plasmid transfection Hep-2 cell luciferase expression situation (* 40) after 24 hours.
A. the negative plasmid control group of polygene treatment group B. C. blank group
Fig. 4 shows plasmid transfection Hep-2 cell 24h, behind 48h and the 72h, and VEGF, TERT, Bcl-xl protein expression level and β-actin contrast.
(1) .VEGF albumen (2) .TERT albumen (3) .Bcl-xl albumen (4). β-actin contrast.
A. the negative plasmid control group of polygene treatment group B. C. blank group
Fig. 5 shows the growth curve of Hep-2 cell.
A. the negative plasmid control group of polygene treatment group B. C. blank group
After Fig. 6 shows plasmid pEGFP-shVEGF-shTERT-shBcl-xl transfection Hep-2 cell, the apoptosis situation, (1) Hoechst dyeing detects apoptosis (* 400), (2) electron microscopy observation apoptosis (* 7000).
A. the negative plasmid control group of polygene treatment group (arrow is depicted as apoptotic nucleus) B. C. blank group
Fig. 7 shows nude mice subcutaneous transplantation knurl growth curve behind the plasmid transfection.
The negative plasmid control group of A polygene treatment group B. C. blank group
Fig. 8 shows the variation of treatment back nude mice tumor tissues microvessel density: visible a large amount of forms are irregular in negative control plasmid treatment group (B) and physiological saline treatment group (C) tumor tissues, and the new vessel that does not have obvious tube chamber, polygene plasmid treatment group (A) tumor tissues microvessel density obviously reduces.
Fig. 9 shows treatment back apoptosis observations: polygene plasmid treatment group (A) finds to be dispersed in a large number the apoptotic cell of distribution, and its nucleus contains brown particle.Negative control plasmid treatment group (B) and the rarely seen only a few of physiological saline treatment group (C) are dispersed in the apoptotic cell of distribution.
Embodiment
The present invention is further elaborated below in conjunction with accompanying drawing:
Four couples of shRNA's of target VEGF, TERT, Bcl-xl, HK mRNA is synthetic, referring to Figure 1A.
1. design the siRNA target sequence: the standard sequence of from GenBank, finding out people VEGF mRNA, TERT mRNA, Bcl-xl mRNA; According to the shRNA principle of design, selected RNA at VEGF, TERT, Bcl-xl disturbs target sequence; One section of picked at random and Human genome do not have the plasmid that contains luciferin gene of base sequence HK construction expression shRNA of homology as negative control;
2. synthesize positive-sense strand and antisense strand at the shRNA of VEGF, TERT, Bcl-xl and HKmRNA;
3. the annealing of synthesizing single-stranded target gene fragment connects:
Each dissolves above-mentioned strand goal gene (2OD) fragment → respectively get 2ul (being 2ulVEGF-A+2ul VEGF-B)+16ul annealing buffer → 94 ℃ annealing with 50ul annealing buffer and naturally cools to room temperature (20-25 ℃) → respectively the get 1ul product+99ul H2O that anneals and be 100 times of four couples of shRNA that dilute → obtain target VEGF, TERT, Bcl-xl, HK respectively.
The structure of plasmid PEGFP-shVEGF, PEGFP-shTERT, PEGFP-shBcl-xl
1. the linearizing of empty plasmid carrier: PEGFP-1, PEGFP-3, PEGFP-4 are with BamHI and the above three kinds of plasmids of the complete double digestion of HindIII, and big fragment is reclaimed in the 1%Agase gel electrophoresis, is linear carrier;
Dilution annealing fragment respectively with being connected of linearization plasmid PEGFP-1, PEGFP-3, PEGFP-4 carrier:
VEGF annealing fragment is connected with the PEGFP-1 carrier, and TERT annealing fragment is connected with the PEGFP-3 carrier, and bcl-xl annealing fragment is connected with the PEGFP-4 carrier; HK annealing fragment is connected with the PEGFP-4 carrier; Its ligation condition is as follows: dilution annealing fragment (1ul), linearization plasmid carrier (1ul), 10 * Ligase Buffer (1ul), T4DNALigase (1ul), H
2O (6ul), 22 ℃ of water-baths spend the night.
3. the conversion of plasmid and screening:
Respectively get 5ul and connect product transformed competence colibacillus cell DH5a, separate application is in containing Kana
rOn the LB flat board of resistance (final concentration is 30ug/ml), 37 ℃ of constant incubator overnight incubation; 3 mono-clonal colony inoculations of each picking contain Kana in 3ml from each culture dish
rIn the LB nutrient solution of resistance (final concentration is 30ug/ml), 37 ℃ of constant temperature shaking table overnight incubation.
4. the enzyme of plasmid PEGFP-shVEGF, PEGFP-shTERT, PEGFP-shBcl-xl is cut and is identified and order-checking: extract plasmid in a small amount with test kit:
1. plasmid PEGFP-shVEGF does enzyme with EcoRI and cuts evaluation: DNA8.5ul, 10x H Buffer lul, EcoRI0.5ul, 37 ℃ of water-bath 3h.The result shows that target gene fragment VEGF has been inserted in the plasmid vector PEGFP-1.
2. plasmid PEGFP-shTERT does enzyme with SalI and cuts evaluation: DNA8.5ul, 10xH Buffer1ul, SalI0.5ul, 37 ℃ of water-bath 3h.The result shows that target gene fragment TERT has been inserted in the plasmid vector PEGFP-3.
3. plasmid PEGFP-shbcl-xl does enzyme with XbaI and cuts evaluation: DNA7.5ul, 10xH Buffer 1ul, 0.1%BSA1ul, XbaI0.5ul, 37 ℃ of water-bath 3h.The result shows that target gene fragment bcl-xl has been inserted in the plasmid vector PEGFP-4.
The correct plasmid transformed bacteria liquid of picking clone goes order-checking, through the sequencing result analysis: be and insert correct cloned plasmids, and quality all meets standard.
The structure of embodiment 3. plasmid PEGFP-shVEGF-shTERT
1. big fragment and small segment are not reclaimed in the SalI+PstI enzyme cutting of plasmid PEGFP-shVEGF, PEGFP-shTERT:
1. cut with the SalI enzyme earlier: DNA5ul, 10xH Buffer2ul, SalI1ul, H
2O12ul, 37 ℃ of water-bath 3h; Each adds 2ul5M Nacl, and mixing adds 51ul alcohol again, mixing, and-70 ℃ of refrigerators are placed 15min, the centrifugal 15min of 15000rpm, with 70% alcohol washing twice, each dissolves with 17ul H2O then;
2. cut with the PstI enzyme again: on go on foot reactant 17ul, 10xH Buffer2ul, PstI1ul, 37 ℃ of water-baths spend the night, big fragment and small segment (about 400bp) are reclaimed in the 1%Agase gel electrophoresis respectively, use 30ul H respectively
2The O wash-out.
2.PEGFP-shVEGF being connected of big fragment and PEGFP-shTERT small segment: reaction conditions is as follows: reclaim big fragment 4ul, reclaim small segment 4ul, 10x Ligase Buffer1ul, T4DNA Ligase1ul, 22 ℃ of water-baths spend the night; 1. the conversion of plasmid PEGFP-shVEGF-shTERT and screening: method and reaction conditions are with step 2 among the embodiment 2
2. extract plasmid PEGFP-shVEGF-shTERT in a small amount with test kit, and do enzyme with the BamHI enzyme and cut evaluation: DNA8ul, 10xK Buffer1ul, BamHI1ul, 37 ℃ of water-bath 3h; The result shows, target gene fragment VEGF and target gene fragment TERT successful connection; The correct plasmid transformed bacteria liquid of picking clone goes order-checking, through the sequencing result analysis: be and insert correct cloned plasmids, and quality all meets standard.
The structure of plasmid pEGFP-shVEGF-shTERT-shBcl-xl, referring to Figure 1B, Fig. 2.
1. the XbaI+PstI double digestion of plasmid PEGFP-shVEGF-shTERT, PEGFP-shbcl-xl reclaims big fragment and small segment: DNA6ul respectively, 10xM Buffer2ul, XbaI1ul, PstI1ul, H
2O10ul, 37 ℃ of water-baths spend the night; Big fragment and small segment (about 400bp) are reclaimed in the 1%Agase gel electrophoresis respectively, use 30ul H respectively
2The O wash-out.
2. the big fragment of plasmid PEGFP-shVEGF-shTERT is connected with the PEGFP-shbcl-xl small segment: reaction conditions is with step 2 among the embodiment 2
3. the conversion of plasmid and screening: method and reaction conditions are with step 2 among the embodiment 2;
4. extract plasmid pEGFP-shVEGF-shTERT-shBcl-xl in a small amount with test kit and do the double digestion evaluation: DNA7ul, 10xM Buffer2ul, HindIII0.5ul, PstI0.5ul, H with HindIII+PstI
2O10ul, 37 ℃ of water-bath 1h, 1%Agase gel electrophoresis; Referring to Fig. 2, cut evaluation through enzyme: the MCS after target gene fragment VEGF+hTERT and the target gene fragment bcl-xl successful connection should be :-HindIII-VEGF-BamHI-U6Promotor-EcoRI-SacI-KpnI-TERT-BamHI-U6Promotor-EcoRI-BssHII-bcl-xl-BamHI-U6Promotor-EcoRI-Ps tI-DraIII-, the DL2000Marker electrophoretic band is respectively 2000bp, 1000bp, 750bp, 500bp, 250bp and 100bp, and the DNA band that plasmid pEGFP-shVEGF-shTERT-shBcl-xl cuts out with the HindIII+PstI enzyme is about about 1200bp, just adhere to specification, insert correct plasmid so be.
Recombinant plasmid vector is to the influence of three destination gene expressions of people's larynx squama cancer Hep-2 cell.
Recombinant plasmid vector through liposome transfection in people's larynx squama cancer Hep-2 cell: get 0.5 * 10
5The Hep-2 cell 2ml of individual/ml concentration is inoculated in the culture dish of 35mm diameter, the conventional cultivation 1 day; The RPMI-1640 of 2 μ g plasmid pEGFP-shVEGF-shTERT-shBcl-xl+6 μ l transfection reagent+100 μ l serum-frees and antibiotic-free is managed in 1.5ml EP; Negative control plasmid group cell adds pEGFP-shHK,, method and consumption are with the treatment group; The nutrient solution that adds 100 μ l serum-frees and antibiotic-free in the blank group cell; The said mixture room temperature was placed after 20 minutes, added and respectively organized in the cell.The conventional cultivation behind the 24h in Laser Scanning Confocal Microscope (German Leica company, TCS SP2MP) detected the luciferase expression situation down; Referring to Fig. 3, the result shows, people's larynx squama cancer Hep-2 cell of the importing vitro culture of plasmid pEGFP-shVEGF-shTERT-shBcl-xl and negative control plasmid pEGFP-shHK success; Referring to table 1,24h after the transfection, 48h, 72h extracts respectively and respectively organizes mRNA, and fluorescence quantitative RT-RCR detects the mRNA expression of three kinds of goal gene.Referring to Fig. 4; Westernblotting detects three kinds of proteic expression: 24h behind the plasmid transfection; 48h; 72h collects and respectively organizes cell; extract each histone; each group is got the equivalent total protein; after separating, the SDS-PAGE gel electrophoresis is transferred to the NC film; spend the night with the 4 ℃ of sealings of TBS damping fluid that contain 5% skim-milk then; add the anti-people VEGF of 1:500 rabbit respectively after washing film; TERT (U.S. Santa cruz company); Bcl-xl; β-actin polyclonal antibody (U.S. Cell signaling company); use the goat anti-rabbit igg (1:5000) of horseradish peroxidase-labeled to carry out two anti-hybridization more respectively, add the immunoblotting chemical illuminating reagent at last and carry out radioautograph.
Referring to Fig. 5, Fig. 6, recombinant plasmid is measured the cytotoxic effect of larynx squama cancer Hep-2 cell.
Larynx squama cancer Hep-2 cell is in containing the RPMI1640 substratum that volume fraction is 10% calf serum, 100u/ml penicillin, 100 μ g/ml Vetstreps, and volume fraction is 5%CO
2, conventionally under 37 ℃ of conditions cultivate the cell experiment in the vegetative period of taking the logarithm.Cell-proliferation activity behind the plasmid transfection detects with mtt assay.Get 2 * 10
4The cell of individual/ml concentration is inoculated in 96 well culture plates, every hole 150 μ l.Cell is after routine is cultivated 24h, and every hole adds 0.3 μ g plasmid pEGFP-shVEGF-shTERT-shBcl-xl, respectively at 8h after the transfection, 20h, 44h, 68h, 92h adds MTT (5mg/ml, Sigma company) 20 μ l, continue to cultivate after 4 hours and remove supernatant, every hole adds dimethyl sulfoxide (DMSO) 150 μ l, shakes up 10 minutes, the enzyme linked immunological monitor is measured each hole absorbance A value of 492nm place, draws cell growth curve.Establish five multiple holes for every group, every group of experiment repeats 3 times.With recombinant plasmid pEGFP-shHK treatment group and blank the group in contrast.
Hoechst dyeing and this recombinant plasmid inductive apoptosis of electron microscopy observation.
Referring to Fig. 7, this recombinant plasmid is to the influence of larynx squama cancer at the growing multiplication of body tumour cell.
The foundation of people's larynx squama cancer nude mice subcutaneous transplantation knurl animal model, 5～6 ages in week, the BALB/c nude mice of body weight 16～18g, back, right side subcutaneous vaccination 2.0 * 10
6Individual Hep-2 cell.When treating that diameter of tumor reaches 5～7mm, be divided into three groups at random, 6 every group.The A group is experimental group, multi-point injection pEGFP-shVEGF-shTERT-shBcl-xl in the knurl body, every 20 μ g (20 μ g plasmids+30 μ l transfection reagents+300 μ l serum-free antibiotic-free DMEM nutrient solutions); B organizes negative control plasmid group, multi-point injection pEGFP-shHK in the knurl body, and dosage is organized with A; The C group is physiology saline control group, multi-point injection physiological saline in the knurl body, each 0.3ml.Injection in per 2 days 1 time, totally 7 times.Measure the major diameter and the minor axis of mouse weight, tumour every day during the administration, calculates tumor size, knurl volume V=major diameter * minor axis
2/ 2.Calculate tumour inhibiting rate, tumour inhibiting rate=(1-experimental group average-volume/control group average-volume) * 100%.Back 14 days of last treatment after the sacrificed by decapitation, is taken out tumour.Every group of part tumor tissues-80 is ℃ frozen standby, and remainder tumor tissues 4% Paraformaldehyde 96 is fixed, paraffin embedding, cut into serving pieces.
Embodiment 8.
Referring to table 2, for detecting three destination gene expression situations in this recombinant plasmid treatment back transplanted tumor tissue: nude mice is put to death the back and separates the tumor tissues fresh specimens, and fluorescence quantitative RT-RCR detects VEGF, TERT, the Bcl-xl expression of respectively organizing in the tumor tissues.
Embodiment 9.
Referring to Fig. 8, apoptosis is measured: each is operated by original position apoptosis detection kit specification sheets (Roche) after organizing the tumor biopsy dewaxing treatment, the microscopically observations, and being pale brown look person with nucleus is apoptotic cell.Under high power lens (* 400) visual field, apoptotic cell shared ratio in whole cancer cells is calculated in 5 visuals field of picked at random.Apoptotic index (apoptosis index, AI)=(apoptosis cell/cancer cells sum) * 100%.
Embodiment 10.
Referring to Fig. 9, microvessel density (MVD) is measured: the paraffin section conventional processing is cured to taking off through dimethylbenzene, and gradient alcohol is to aquation; Antigen retrieval, 3% H
2O
2Handle the activity of blocking-up endogenous peroxydase, 10% sheep blood serum is hatched 15min, drips rabbit antihuman CD 34 polyclonal antibody, 4 ℃ are spent the night, and drip the biotinylation goat anti-rabbit igg, hatch 10min for 37 ℃, drip the strepto-affinity element of horseradish enzyme labelling, hatch 10min for 37 ℃.Wash 3 times each 5min behind per step antibody incubation with PBS liquid; The control colour developing down of DAB mirror, Hematorylin is redyed, mounting.Replace one to resist with normal rabbit serum and PBS as negative control.The result judges: the MVD counting carries out with reference to the method that Weidner introduces, and finds out the compact district of capillary blood vessel under * 40 times of mirrors, and the CD34 in 5 visuals field of * 200 times countings dyes brown number of blood vessel afterwards, gets its mean value as microvessel density.
SEQUENCE?LISTING
＜110〉Wuhan University
＜120〉carry the Preparation method and use of the recombinant plasmid of short hairpin RNA
＜130〉carry the Preparation method and use of the recombinant plasmid of short hairpin RNA
<160>6
<170>PatentIn?version3.1
<210>1
<211>65
<212>DNA
<213>Aritfical?Sequence
<400>1
<210>2
<211>65
<212>DNA
<213>Aritfical?Sequence
<400>2
<210>3
<211>65
<212>DNA
<213>Aritfical?Sequence
<400>3
<210>4
<211>65
<212>DNA
<213>Aritfical?Sequence
<400>4
<210>5
<211>69
<212>DNA
<213>Aritfical?Sequence
<400>5
<210>6
<211>69
<212>DNA
<213>Aritfical?Sequence
<400>6
Claims (2)
1. a preparation method who carries the recombinant plasmid of short hairpin RNA the steps include:
A, selected siRNA target sequence: the sequence of from GenBank, finding out people VEGF mRNA, TERTmRNA, Bcl-xl mRNA; According to the shRNA principle of design, selected RNA at VEGF, TERT, Bcl-xl disturbs target sequence as follows: VEGF:5-AAACCUCACCAAGGCCAGCAC-3; TERT:5-GTTCCTGCACTGGCTGATG-3; Bcl-xl:5-GGAGATGCAGGTATTGGTGAG-3;
HK target gene target sequence is: 5-ACTACCGTTGTTATAGGTG-3;
Positive-sense strand and the antisense strand of four couples of shRNA of B, design target VEGF, TERT, Bcl-xl, HK mRNA are as follows: the VEGF-positive-sense strand:
5′-GATCCACCTCACCAAGGCCAGCACTTCAAGACGGTGCTGGCCTTGGTGAGGTTTTTTTGAATTCA-3’
The VEGF-antisense strand:
3’-GTGGAGTGGTTCCGGTCGTGAAGTTCTGCCACGACCGGAACCACTCCAAAAAAACTTAAGTTCGA-5
The TERT-positive-sense strand:
5′-GATCCGTTCCTGCACTGGCTGATGTTCAAGACGCATCAGCCAGTGCAGGAACTTTTTTGTCGACA-3’
The TERT-antisense strand:
3’-GCAAGGACGTGACCGACTACAAGTTCTGCGTAGTCGGTCACGTCCTTGAAAAAACAGCTGTTCGA-5’
The Bcl-xl-positive-sense strand:
5′-GATCCGGAGATGCAGGTATTGGTGAGTTCAAGACGCTCACCAATACCTGCATCTCCTTTTTTTCTAGAA-3’
The Bcl-xl-antisense strand:
3’-GCCTCTACGTCCATAACCACTCAAGTTCTGCGAGTGGTTATGGACGTAGAGGAAAAAAAGATCTTTCGA-5’
The HK-positive-sense strand:
5′-GATCCACTACCGTTGTTATAGGTGTTCAAGACGCACCTATAACAACGGTAGTTTTTTTGTCGACA-3’
The HK-antisense strand:
3’-GTGATGGCAACAATATCCACAAGTTCTGCGTGGATATTGTTGCCATCAAAAAAACAGCTGTTCGA-5’
Four couples of shRNA's of C, target VEGF, TERT, Bcl-xl, HK is synthetic: two dna single chain annealing connect the shRNA that four pairs of acquisitions contain the loop ring;
The linearizing of D, plasmid vector PEGFP-1, PEGFP-3, PEGFP-4: with BamHI and the above three kinds of plasmids of the complete double digestion of HindIII, fragment is reclaimed in the 1%Agase gel electrophoresis, is linear carrier;
The MCS of PEGFP-1 is as follows:
-HindIII-Insert?DNA-BamHI-U6Promotor-EcoRI-SacI-KpnI-SalI-BssHII-XbaI-NotI-PstI-DraIII-
The MCS of PEGFP-3 is as follows:
-HindIII-Insert?DNA-BamHI-U6Promotor-EcoRI-BssHII-XbaI-NotI-PstI-DraIII-
The MCS of PEGFP-4 is as follows:
-HindIII-Insert?DNA-BamHI-U6Promotor-EcoRI-PstI-DraIII-；
E, structure plasmid PEGFP-shVEGF, PEGFP-shTERT, PEGFP-shBcl-xl:shVEGF are connected with the PEGFP-1 carrier, and shTERT is connected with the PEGFP-3 carrier, and shBcl-xl is connected with the PEGFP-4 carrier; To connect product transformed competence colibacillus cell DH5 α, separate application on the LB flat board that contains the Kanar resistance, 37 ℃ of constant incubator overnight incubation; Extract plasmid, identify; Picking cloned plasmids transformed bacteria liquid goes order-checking, and result's proof is inserts correct cloned plasmids;
F, structure plasmid pEGFP-shVEGF-shTERT: the SalI+PstI double digestion of plasmid PEGFP-shVEGF, PEGFP-shTERT, reclaim fragment respectively; Connect big fragment of PEGFP-shVEGF and PEGFP-shTERT small segment; To connect product transformed competence colibacillus cell DH5 α, separate application is in containing Kana
rOn the LB flat board of resistance, 37 ℃ of constant incubator overnight incubation; Extract plasmid, identify; Picking cloned plasmids transformed bacteria liquid goes order-checking, and target gene fragment VEGF is connected with target gene fragment TERT, and result's proof is inserts correct cloned plasmids;
G, structure plasmid pEGFP-shVEGF-shTERT-shBcl-xl: the XbaI+PstI double digestion of plasmid pEGFP-shVEGF-shTERT and plasmid PEGFP-shBcl-xl, reclaim fragment respectively; Being connected of big fragment of PEGFP-shVEGF-shTERT and PEGFP-shBcl-xl small segment; To connect product transformed competence colibacillus cell DH5 α, separate application is in containing Kana
rOn the LB flat board of resistance, 37 ℃ of constant incubator overnight incubation; Extract plasmid, identify that the result shows that target gene fragment VEGF+TERT is connected with target gene fragment bcl-xl; Picking cloned plasmids transformed bacteria liquid goes order-checking, and result's proof is inserts correct cloned plasmids.
2. the application of recombinant plasmid in the RNA interference gene therapy medicament of preparation treatment larynx squama cancer of carrying TERT, VEGF and Bcl-xl short hairpin RNA.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2007100528991A CN101363027B (en) | 2007-08-06 | 2007-08-06 | Method for preparing recombination plasmid carrying short hairpin RNA and use |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2007100528991A CN101363027B (en) | 2007-08-06 | 2007-08-06 | Method for preparing recombination plasmid carrying short hairpin RNA and use |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101363027A CN101363027A (en) | 2009-02-11 |
| CN101363027B true CN101363027B (en) | 2011-07-27 |
Family
ID=40389631
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2007100528991A Expired - Fee Related CN101363027B (en) | 2007-08-06 | 2007-08-06 | Method for preparing recombination plasmid carrying short hairpin RNA and use |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101363027B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102643819B (en) * | 2012-04-25 | 2014-07-16 | 中国人民解放军第四军医大学 | ShRNA of Rab23 and ientiviral vector and applications thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1580259A (en) * | 2003-08-07 | 2005-02-16 | 徐根兴 | SiRAN and expression carrier for inhibiting human VEGF gene expression and their pharmaceutical use |
| WO2006110813A2 (en) * | 2005-04-12 | 2006-10-19 | Intradigm Corporation | Composition and methods of rnai therapeutics for treatment of cancer and other neovascularization diseases |
-
2007
- 2007-08-06 CN CN2007100528991A patent/CN101363027B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1580259A (en) * | 2003-08-07 | 2005-02-16 | 徐根兴 | SiRAN and expression carrier for inhibiting human VEGF gene expression and their pharmaceutical use |
| WO2006110813A2 (en) * | 2005-04-12 | 2006-10-19 | Intradigm Corporation | Composition and methods of rnai therapeutics for treatment of cancer and other neovascularization diseases |
Non-Patent Citations (1)
| Title |
|---|
| 刘丹等.短发夹RNA 沉默hTERT 基因对人喉癌裸鼠移植瘤的生长抑制作用.癌症.2006,25(1),11-16. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101363027A (en) | 2009-02-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102203290B (en) | Molecular marker for cancer stem cell | |
| US20140323551A1 (en) | Targeting micrornas mir-409-5p, mir-379 and mir-154* to treat prostate cancer bone metastasis and drug resistant lung cancer | |
| CN106591306B (en) | Application of the siRNA of targeting interference tumour PTN-PTPRZ1 access in immunotherapy of tumors | |
| CN112226510B (en) | Application of MTX1 gene or expression product thereof in preparation of product for diagnosing, preventing or treating liver cancer and related reagent | |
| CN102453713B (en) | HULC siRNA and use of HULC siRNA in preparation of drugs for treatment of liver cancer | |
| CN103773802B (en) | HIP-55 albumen suppresses the application in tumour medicine in exploitation | |
| CN109908369B (en) | Application of novel circular RNA circCRKL in prostate cancer treatment | |
| CN110251529A (en) | MiR-124-3p and its analog are preparing the application in anti-breast cancer disease medicament | |
| CN103920164B (en) | MiR-424-5p is suppressing the application in secondary liver cancer | |
| CN100478034C (en) | A siRNA and expression carrier capable of inhibiting Bax gene expression and application of the same used as virus hepatitis B treatment medicament | |
| CN101353656B (en) | siRNA inhibiting expression of epidermal growth factor receptor genes and use thereof | |
| CN101363027B (en) | Method for preparing recombination plasmid carrying short hairpin RNA and use | |
| Zhang et al. | Extracellular vesicles promote esophageal cancer progression by delivering lncZEB1-AS1 between cells. | |
| CN108265116A (en) | Klf4 is as liver cancer diseases diagnose and treat target spot | |
| CN110101704A (en) | Application of the c-Abl kinase inhibitor in FoxM1 high expression oncotherapy | |
| CN111549139A (en) | ZNF695 as prostate cancer bone metastasis marker and therapeutic target | |
| CN110423812A (en) | Skiv2l2(MTR4) purposes of the gene in oncotherapy | |
| CN109745335A (en) | MiR-218 is preparing the application in mammary cancer chemotherapy drug sensitizer | |
| CN110317878A (en) | A kind of long-chain non-coding RNA and its application for bladder cancer diagnosis and treatment monitoring | |
| CN101445534A (en) | Use of high efficiency siRNA for preparing tumor migration inhibition drug | |
| CN115501340B (en) | Application of CircPIAS1 as target in preparation of liver cancer diagnostic reagent or therapeutic drug | |
| CN106039312B (en) | Application of the ZNF367 gene in preparation treatment breast cancer medicines, diagnosis and prognosis evaluation reagent | |
| CN105837678B (en) | D-type human M1 forkhead protein isomer and coding gene thereof | |
| CN110358765A (en) | Inhibit siRNA and its application of people TNFAIP1 gene expression | |
| CN102793930A (en) | Novel bifunctional triphosphate-small interfering ribonucleic acid (3p-siRNA) for inhibiting proliferation of tumor cells and application of novel bifunctional 3p-siRNA |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20110727 Termination date: 20120806 |