CN101619335B - Method for preparing single chain DNA by using primer with stem-loop sample structure through PCR - Google Patents
Method for preparing single chain DNA by using primer with stem-loop sample structure through PCR Download PDFInfo
- Publication number
- CN101619335B CN101619335B CN2008101329148A CN200810132914A CN101619335B CN 101619335 B CN101619335 B CN 101619335B CN 2008101329148 A CN2008101329148 A CN 2008101329148A CN 200810132914 A CN200810132914 A CN 200810132914A CN 101619335 B CN101619335 B CN 101619335B
- Authority
- CN
- China
- Prior art keywords
- primer
- pcr
- loop
- stem
- single stranded
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to the technical field of biology, and relates to a method for preparing single chain DNA by processes of preparing positive and negative chain products with different lengths, cutting the colloid and recycling by using primer with a stem-loop sample structure through PCR. In the invention, by downstream stem-loop sample structure primer designed regarding different DNA templates, PCR condition is improved, thus proving that PCR products are all expected two chains: a long chain and a short chain, and can be separated and purified easily through modified colloid. The invention has extensive application prospect in related single chain DNA preparation bio-medical research field comprising SELEX.
Description
Invention field:
The present invention relates to a kind of utilization and have the stem-loop sample structure primer and prepare the method for single stranded DNA through PCR, principal character is the use that has the primer molecule of loop-stem structure, comprises the inverted repeats of 5 ' end, GC content and secondary structure; Relate to the PCR reaction conditions; Relate to the primer and the application of PCR in the single stranded DNA preparation of loop-stem structure in the invention.
Background technology:
The same with the RNA molecule; Single stranded DNA (ssDNA) structure is variable flexibly; Three-dimensional structure is complicated, be easy to form and target bonded bag structure, so single strand dna oligonucleotide aglucon (aptamer) has broad prospect of application at molecular recognition, chemical analysis and biomedicine field.Particularly in SELEX (Systematic Evolution of Ligandsby EXponential Enrichment) technical research and application, the preparation of ssDNA is crucial especially.The SELEX technology be through repeatedly with strand random dna library and target molecule hatch, the single stranded DNA of separation and combination, pcr amplification, finally obtain high-affinity and the ssDNA sequence target molecule specific combination (aptamer) (Tuerk C, et al.Science1990; 249:505-510).A refabrication that committed step is a single-stranded DNA banks after the enrichment of SELEX screening is removed the minus strand in the double-stranded product of PCR generation, keeps the normal chain with binding ability.Suppose to be mixed with the dsDNA composition in a certain ssDNA library; Along with the increase of screening wheel number, the ratio of dsDNA not only can increase in the library so, and can form stable double-spiral structure and do not combine with target molecule; Finally cause specific ssDNA aglucon to be lost, SELEX screens failure.Except the SELEX screening, other biomedical sector also usually need prepare the DNA of strand.Therefore, effective ssDNA preparation method is with convenient biomedical research.
Current, the method for preparing ssDNA is a lot,, RNA rt synthetic like: direct chemical, asymmetric PCR, the separation of avidin mark magnetic bead etc.But in practical application; All there are some problems in these methods; For example: 1, the direct chemical synthesis method is convenient and simple, but the stochastic sequence ssDNA library that utilizes this method can only synthesize known array or design in advance is inapplicable for the unknown nucleotide sequence that obtains through SELEX screening enrichment.Disperse took place in product easily when 2, asymmetric PCR prepared single stranded product; Reason maybe be relevant with PCR system ionic intensity, dNTP concentration etc.; Particularly,, asymmetric PCR more is prone to diffusing phenomenon again when preparing single stranded product to become dsDNA as template elder generation pcr amplification through the library after the number wheel SELEX screening; In addition; Asymmetric PCR all produces double-stranded product usually preceding 10-15 circulation, and the strand purity of therefore this method preparation is not high, when existing complementary minus strand interferential drawback 3, avidin mark magnetic bead to separate the preparation single stranded DNA; The minus strand of biotin labeling PCR product; The isolating means of the magnetic bead that avidin encapsulates can obtain highly purified positive chain DNA, but this method needs first purified pcr product to remove the interference of biotinylation primer before separating, and organic efficiency often can not satisfy the experiment demand.It also is a factor of restriction experiment that magnetic bead costs an arm and a leg; In addition, if the downstream experiment will be used biotin labeled positive chain DNA, the method that then can't use magnetic bead prepares strand; 4, the RNA rt prepares the single stranded DNA needs and earlier ssDNA is transcribed into RNA; RNA molecule degraded easily causes losing of aglucon, and transcribes template and need introduce the transcriptase recognition sequence, if these sequences and ssDNA annealing; Just possibly influence screening, so complicated operation is impracticable.
Kelly P.Williams (Nucleic acids research, 1995,4220-4221) wait and to have introduced a kind of new special primer PCR that utilizes and prepare the method for strand, this antisense primer is made up of three parts, the 5 ' end sequence-terminator-complementary sequence that extends.Complementary sequence and template annealing, the function of performance primer; Terminator is the non-nucleotide material that a Taq enzyme can not pass through, and six ethylene glycols (HEGL) molecule is used to stop the extension of positive-sense strand; 5 ' lengthening sequence be 20 dA form gather the A tail, be used to generate the PCR product of long-chain.Therefore; Antisense primer and template annealing also can extend minus strand product of being longer than 20 bases of template of generation under the effect of Taq enzyme, and when sense primer is the template extension with this antisense strand, because the Taq enzyme can not be crossed HEGL; Therefore the extension of normal chain stops, so the length of normal chain is the same with template.On the PAGE of sex change gel, two chains can obviously separate and then the separation and purification single stranded DNA.This method has obvious superiority aspect the preparation of single stranded DNA, and for example cheap, PCR one goes on foot acquisition etc., but the restriction of being modified needs HEGL to modify when synthetic primer, and a lot of companies do not possess this ability.The lengthening sequence of strand also may influence amplification efficiency with template region annealing, especially in the in-vitro screening later stage, when the situation of enrichment sequences such as a plurality of dT may be contained in the district at random.
Inspired by above-mentioned thinking, the characteristic that the present invention has utilized the dna profiling of secondary structure to stop the Taq enzyme to extend is dexterously improved antisense primer, does not need special modification can produce the PCR product of different lengths.Antisense primer contains two portions; Template complementary sequence except 3 ' end; 5 ' end is introduced one section inverted repeats that can form stem ring secondary structure, because inverted repeats is rich in the GC base, has higher Tm value; (55 ℃-65 ℃) still can keep secondary structure in the TR that the Taq enzyme can play a role preferably, thereby stop the extension of normal chain.Therefore, two chain length differences of PCR product differ the length of inverted repeats, and two strands can separate and then separation and purification ssDNA significantly on the PAGE of sex change gel.
The method for preparing ssDNA according to the invention is except can be used in preclinical medicine, medicine and pharmacology, all can being used widely in the SELEX technology.
Summary of the invention:
The object of the invention is to design the primer that has loop-stem structure, utilizes PCR to produce the positive and negative chain product of different lengths, and proposition prepares the method for single stranded DNA through loop-stem structure primer and PCR.
The present invention realizes through following technical scheme:
At first design has the downstream primer Pstemloop of loop-stem structure.Its 3 ' end is and 20 bases of template complementary that 5 ' end can produce a segment length complementary stem and circlet structure for being rich in one section inverted repeats of GC base, stops the Taq enzyme to extend, thereby causes the downstream primer extension products long.Upstream primer is and template complementary base sequence.
PCR reaction: sex change program and PCR usually with, annealing conditions decide according to the complementary district of primer sequence base sequence, elongating temperature suitably reduces, and is set between 55 ℃-65 ℃, the appropriateness prolongation of extension time is looked template length and is decided.
Behind the pcr amplification, identify two product chains, cut glue and reclaim the purpose single stranded DNA through sex change glue.
Advantage of the present invention:
1) the present invention has the primer and optimization PCR reaction conditions of stable loop-stem structure through design, and primer need not to modify, and reacts the single stranded product that can obtain different lengths through PCR, directly cuts glue and reclaims the purpose single stranded DNA.Therefore, simple to operate, save time, cheapness, the single stranded DNA purity of acquisition is high, organic efficiency is high.
2) the invention solves bottleneck problem in the single stranded DNA preparation in the traditional SELEX operation, also have a wide range of applications at other biomedical sector that relates to the single stranded DNA preparation, thereby vast market prospect and economic benefit will be arranged.
Description of drawings:
The loop-stem structure that Fig. 1 designed primer of the present invention produces.
The amplification of Fig. 2 loop-stem structure primer PCR produces different lengths extension products schematic diagram.
Fig. 3 different templates single stranded DNA produces the electrophorogram of different lengths single stranded product through the loop-stem structure primer amplification.
1, GP45ssDNA template; 2, GP45ssDNA is through the product of loop-stem structure primer PCR amplification; 3, LG45ssDNA is through the product of loop-stem structure primer PCR amplification; 4, LG45ssDNA template; M, double chain DNA molecule amount standard.
The extension products radioactive automatic developing figure of Fig. 4 primer.
Embodiment:
Specify the present invention through loop-stem structure downstream primer and the PCR that is directed against different single stranded DNA stencil design respectively below.
1. be directed against the downstream primer of different single stranded DNA stencil design loop-stem structures:
GP45 template (88nt):
5’-GCAATGGTACGGTACTTCC(45N)CAAAAGTGCACGCTACTTTGCTAA-3’
Primer:
Upstream primer (Plong-1): 5 '-GCAATGGTACGGTACTTCC-3 '
Downstream primer (P11): 5 '-TTAGCAAAGTAGCGTGCACTTTTG-3 '
Loop-stem structure downstream primer (Pstemloop) is (Fig. 1):
5’-
GCTAAGCGGGTGGGACTTCCTAGTCCCACCCGCTTAGCAAAGTAGCGTGCACTTTTG-3’
LG45 template (81nt):
5’-GCCTGTTGTGAGCCTCCT(45N)CGCTTATTCTTGTCTCCC-3’
Primer:
Upstream primer (LGP5): 5 '-GCCTGTTGTGAGCCTCCT
Loop-stem structure downstream primer (LGP3stemloop) is (Fig. 1):
5’-
GCGTCGCGAGGTGCGACTTAATAGTCGCACCTCGCGACGCGGGAGACAAGAATAAGCG-3’
Annotate: the underscore sequence is the loop-stem structure part that contains inverted repeats.
After above-mentioned template and primer sequence were synthesized by Invitrogen company, with the distilled water dissolving, primer is diluted to 50 μ M, deposits for-20 ℃, and was subsequent use respectively.
2. labelled with radioisotope primer:
Utilize T4 Polynucleotide Kinase with [γ-
32P] ATP, carry out radio-labeling through phosphorylation reaction to 5 ' end of synthetic Oligonucleolide primers.Press DNA 5 ' end mark test kit (MEGALABEL Kit, TaKaRaBiotechnology Co., Ltd, D6070) explanation carry out.Contain the 5-10pmole primer in the 10 μ l systems, 50 μ Ci [γ-32P] ATP and 10U T4PNK.37 ℃ of phosphorylation reaction 40min, 70 ℃ of 10min inactivators.The method of ethanol sedimentation remove most of unreacted [γ-
32P] ATP, the primer of purifying mark.
3.PCR amplification:
PCR system: contain 10 μ l10X damping fluids, 0.2mM dNTPs, the 0.5 μ M upper reaches and downstream primer, 10nM template, 2U Taq archaeal dna polymerase in the 100 μ l systems.
PCR condition: 95 ℃ of preparatory sex change 5min; 94 ℃ of sex change 1min, 37 ℃ of annealing 30sec, 58 ℃ are extended 40sec, 30 circulations of increasing; Last 58 ℃ are extended 2min eventually.
4. identify:
7M urea 10% denaturing polyacrylamide gel electrophoresis, Goldview dyeing or silver dye evaluation (Fig. 3).Perhaps radioactive automatic developing is analyzed primer extension position (Fig. 4).
5. the purpose strand is cut the glue recovery:
(1) glue after will dyeing is placed on the long-wave ultra violet lamp, opens uv lamp, observes the DNA electrophoretic band;
(2) under the shield cap protection, sharp knife blade cuts the purpose band, and moves in the 1.5ml centrifuge tube.
(3) add 400 μ l gel elution buffers (1m mol/L EDTA, pH 8.0,7M urea for 0.5mol/L NH4Ac, 0.2%SDS), more than 37 ℃ of wash-out 6hr;
(4) draw elutriant in new 1.5ml centrifuge tube, not with the gel sucking-off;
(5) the 1M MgCl2 of adding 1/100 volume, the 3mol/LNaAc of 1/10 volume (pH5.2), the absolute ethyl alcohol of 2.5 times of volumes is placed more than the 6hr for-70 ℃;
(6) 4 ℃, 14000r/m, centrifugal 30min;
(7) supernatant discarded, centrifugal behind 70% alcohol flushing of deposition with 4 ℃ of precoolings with 6;
(8) supernatant discarded is deposited in drying at room temperature;
(9) drying is good DNA is dissolved in an amount of tri-distilled water.-20 ℃ of preservations are subsequent use.
Experimental result:
Utilize the loop-stem structure downstream primer to produce two positive and negative chain products that are uneven in length, on sex change glue, can obviously obtain separating through pcr amplification.
Can obtain conclusion by Fig. 3: the loop-stem structure primer has produced two positive and negative chain products that are uneven in length through pcr amplification, and this structure primer is applicable to different dna profilings.
Can be reached a conclusion by Fig. 4: loop-stem structure downstream primer extension products is a long-chain, has more the sequence of loop-stem structure part than template, thereby moves slow; The upstream primer extension products overwhelming majority is identical with template position, is purpose normal chain, produces long-chain owing to the downstream primer loop-stem structure unwinds on a small quantity.
Claims (1)
1. the primer with loop-stem structure prepares the method for single stranded DNA through PCR; With the single stranded DNA is template; It is characterized in that at first design has the downstream primer of loop-stem structure and not with the upstream primer of loop-stem structure, then pcr amplification; Amplified production is cut glue and is reclaimed the purpose single stranded DNA through sex change PAGE gel electrophoresis; The said downstream primer that has loop-stem structure is made up of 3 ' end and one section inverted repeats that 20 bases of single stranded DNA template complementary and 5 ' end are rich in the GC base; The elongating temperature of said PCR is 55-65 ℃.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2008101329148A CN101619335B (en) | 2008-07-01 | 2008-07-01 | Method for preparing single chain DNA by using primer with stem-loop sample structure through PCR |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2008101329148A CN101619335B (en) | 2008-07-01 | 2008-07-01 | Method for preparing single chain DNA by using primer with stem-loop sample structure through PCR |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101619335A CN101619335A (en) | 2010-01-06 |
| CN101619335B true CN101619335B (en) | 2012-04-18 |
Family
ID=41512747
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2008101329148A Active CN101619335B (en) | 2008-07-01 | 2008-07-01 | Method for preparing single chain DNA by using primer with stem-loop sample structure through PCR |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101619335B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102108403A (en) * | 2010-12-03 | 2011-06-29 | 陈必成 | Screening of expression difference of microRNAs through stem-loop primer with random sequence |
| CN108588050B (en) * | 2018-05-14 | 2021-06-25 | 北京艾克伦医疗科技有限公司 | DNA polymerase, and nucleic acid detection method and kit |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6090552A (en) * | 1996-07-16 | 2000-07-18 | Intergen Company | Nucleic acid amplification oligonucleotides with molecular energy transfer labels and methods based thereon |
| CN1456684A (en) * | 2003-03-26 | 2003-11-19 | 中国科学院生态环境研究中心 | Induction design plan for PCR-DGGE research on environment microorgan population |
| US20070077570A1 (en) * | 2005-05-31 | 2007-04-05 | Applera Corporation | Multiplexed amplification of short nucleic acids |
| CN101082060A (en) * | 2006-06-01 | 2007-12-05 | 上海吉玛制药技术有限公司 | New micro ribonucleic acid quantitative PCR (polymerase chain reaction) detection method |
-
2008
- 2008-07-01 CN CN2008101329148A patent/CN101619335B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6090552A (en) * | 1996-07-16 | 2000-07-18 | Intergen Company | Nucleic acid amplification oligonucleotides with molecular energy transfer labels and methods based thereon |
| CN1456684A (en) * | 2003-03-26 | 2003-11-19 | 中国科学院生态环境研究中心 | Induction design plan for PCR-DGGE research on environment microorgan population |
| US20070077570A1 (en) * | 2005-05-31 | 2007-04-05 | Applera Corporation | Multiplexed amplification of short nucleic acids |
| CN101082060A (en) * | 2006-06-01 | 2007-12-05 | 上海吉玛制药技术有限公司 | New micro ribonucleic acid quantitative PCR (polymerase chain reaction) detection method |
Non-Patent Citations (1)
| Title |
|---|
| 黄艳萍等.用凝胶电泳研究发夹型引物检测端粒酶活性.《研制与开发》.2004,(第四期),41-43. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101619335A (en) | 2010-01-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Weinberg | Nuclear RNA metabolism | |
| Yoon et al. | MS2-TRAP (MS2-tagged RNA affinity purification): tagging RNA to identify associated miRNAs | |
| Dong et al. | RTL-P: a sensitive approach for detecting sites of 2′-O-methylation in RNA molecules | |
| Ramadevi et al. | Capping and methylation of mRNA by purified recombinant VP4 protein of bluetongue virus | |
| CN112359093B (en) | Method and kit for preparing and expressing and quantifying free miRNA library in blood | |
| CN104419704B (en) | A kind of intron source annular RNA molecule and the application of cyclization key nucleotide sequence thereof | |
| Marmisollé et al. | RNA-binding protein immunoprecipitation as a tool to investigate plant miRNA processing interference by regulatory proteins of diverse origin | |
| Panda et al. | RT-qPCR detection of senescence-associated circular RNAs | |
| CN101619335B (en) | Method for preparing single chain DNA by using primer with stem-loop sample structure through PCR | |
| CN101935670B (en) | Method for constructing RNA (Ribonucleic Acid) interference vector by directly annealing multi-primers | |
| CN104388548A (en) | Method for sequencing high-flux circular RNA (ribonucleic acid) | |
| CN111235198A (en) | Method for large-scale synthesis of long-chain RNA and site-directed modification method thereof | |
| Carbonell et al. | Design, synthesis, and functional analysis of highly specific artificial small RNAs with antiviral activity in plants | |
| US20110060135A1 (en) | Selective Purification of Small RNAs from Mixtures | |
| EP1924708A2 (en) | Pure mirna sample preparation method | |
| CN101629174B (en) | Simple, efficient and cheap method for purifying forest soil sample DNA | |
| Wei et al. | Identification and characterization of piRNA-like small RNAs in the gonad of sea urchin (Strongylocentrotus nudus) | |
| Choi et al. | mirRICH, a simple method to enrich the small RNA fraction from over-dried RNA pellets | |
| CN103789447B (en) | Method for detecting 5'end tRNA semi-molecules | |
| CA2433542C (en) | Ammonium sulfate for neutralization of inhibitory effects | |
| Jelinek et al. | Origin of mRNA in HeLa cells and the implications for chromosome structure | |
| CN105986020A (en) | Method and device for constructing sequencing library | |
| Liu et al. | Multiple stem-loop primers induced cascaded loop-mediated isothermal amplification for direct recognition and specific detection of circular RNAs | |
| CN1844403A (en) | Plant RNAi binary expression vector with forward and reverse promoters | |
| CN102382813A (en) | Systematic evolution of ligands by exponential enrichment (SELEX) technical method aiming at electrophoresis gel retardation of liquid-phase non-purification composite targets |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CP01 | Change in the name or title of a patent holder | ||
| CP01 | Change in the name or title of a patent holder |
Address after: 100850 No. 27 Taiping Road, Beijing, Haidian District Patentee after: Chinese People's Liberation Army Military Medical Research Institute Address before: 100850 No. 27 Taiping Road, Beijing, Haidian District Patentee before: Institute of Basic Medical Sciences |