CN1307309C

CN1307309C - Monocotyledon choline single oxygenase gene and protein coded thereby

Info

Publication number: CN1307309C
Application number: CNB2004101030797A
Authority: CN
Inventors: 张红生; 黄骥; 王建飞; 王州飞; 潘丽娟
Original assignee: Nanjing Agricultural University
Current assignee: Nanjing Agricultural University
Priority date: 2004-12-31
Filing date: 2004-12-31
Publication date: 2007-03-28
Anticipated expiration: 2024-12-31
Also published as: CN1654659A

Abstract

The present invention discloses a monocotyledon choline monooxygenase gene and a coded protein thereof, which belongs to the field of gene engineering. A rice choline monooxygenase gene OsCMO comprises the cDNA sequence of SEQ ID No. 1 and a coded amino acid sequence of SEQ ID No. 2. The gene of the present invention is the first report of monocotyledon to be taken part in the biosynthesize of rice betaine, mRNA expression analysis shows that the gene is induced by high salt content, and transgenic experiments show that the overexpression of the gene increase the salt tolerance of tobacco. OsCMO as a target gene can be transferred into a plant and can increase the salt tolerance of the plant.

Description

The application of paddy rice Monocotyledon choline single oxygenase gene

Technical field

The invention discloses the application of paddy rice Monocotyledon choline single oxygenase (OsCMO) gene, belong to the genetically engineered field, relate to the key enzyme choline single oxygenase and the encoding gene thereof of coding trimethyl-glycine route of synthesis in the plant specifically.

Technical background

Plant carries out osmoregulation by materials such as accumulation proline(Pro), trimethyl-glycine, N.F,USP MANNITOL under stress conditions such as arid, low temperature, high salt.Trimethyl-glycine is to play the topmost cell compatibility material of nontoxic osmotic protection effect in bacterium and the animals and plants organism.Genes involved in separation and the clone's trimethyl-glycine route of synthesis also carries out genetic transformation, resists abiotic stress such as arid, low temperature and high salt to improving plant, guarantees that grain security has great importance.Relevant in recent years trimethyl-glycine biosynthesizing and genetically engineered application facet have obtained bigger progress.Trimethyl-glycine is, and to be substrate with the choline generate---betaine aldehyde chloride---trimethyl-glycine that is choline through two-step catalysis, and choline single oxygenase reacts in the responsible catalysis the first step.Choline single oxygenase is by peculiar in the plant, nineteen ninety-five Burnet etc. are this enzyme of purifying from the spinach blade, in spinach, cloned the gene of single alkali monooxygenase of encoding first up to 1997, afterwards again at Herba amaranthi tricoloris (Ling et al, 2001), prunella asiatica (Shen Yiguo etc., 2001), beet (Russell et al, 1998) has been cloned this gene.

Because only in Chenopodiaceae and amaranthaceous plant, reported choline single oxygenase gene at present, and plant such as paddy rice, tobacco, potato can not accumulate trimethyl-glycine, a lot of researchists think that especially may there be choline single oxygenase gene (Nakamura et al, 1997) in other plant in the monocotyledons such as paddy rice.

Summary of the invention

Technical problem the objective of the invention is to the application of open paddy rice Monocotyledon choline single oxygenase (OsCMO) gene, and this gene can be used as goal gene and imports plant from paddy rice, improves plant salt endurance, carries out plant species improvement.

The application of technical scheme paddy rice Monocotyledon choline single oxygenase (OsCMO) gene comprises:

1) rice varieties " leek green grass or young crops " is selected in the extraction of total RNA for use, treats that rice seedling grows to 3 leaf after dates, handles with 140mM NaCl, get blade after 12 hours immediately and place the freezing preservation of liquid nitrogen, get partial blade, grind, add the 1.5mL EP pipe that fills lysate with mortar, fully after the vibration, move into again in the glass homogenizer, move in the 1.5mL EP pipe extracted total RNA after the homogenate, identify total RNA quality with the denaturing formaldehyde gel electrophoresis, on spectrophotometer, measure rna content then;

2) clone of paddy rice choline single oxygenase gene designs the two ends primer according to the complete encoding sequence of paddy rice choline single oxygenase gene

P1：GATGGCGATCGCGCAATCCG，

P2：AGAAATCACTCACCAGTCAC

The total RNA that obtains with step 1) is a template, behind synthetic cDNA first chain of reverse transcription, carry out pcr amplification with high-fidelity Tag enzyme, the PCR program is as follows: 94 ℃ of pre-sex change 4 minutes, 94 ℃ of sex change 30s, 56 ℃ of renaturation 1min, 72 ℃ are extended 1.5min, after 33 circulations, and 72 ℃ of 5min, process general T ag enzyme adds the A rear clone to the pGEM-T carrier, entrusts Shanghai to give birth to the order-checking back acquisition of worker company and has the cDNA sequence of the paddy rice choline single oxygenase gene OsCMO of complete coding region;

3) structure of plant expression vector is according to the cDNA sequence of paddy rice choline single oxygenase gene OsCMO, see the complete encoding sequence of SEQ ID NO.1, design amplifies the primer that complete coding is read frame, and on the upstream and downstream primer, introduce restriction endonuclease sites BamHI respectively, the design primer is:

Upstream primer: AGGATCCGATGGC GATCGCGCAATCCG,

Downstream primer: AGGATCCAGAAATCACTCACCAGTCAC,

With step 2) in the pcr amplification product that obtains be template, behind pcr amplification, the cDNA of OsCMO is cloned into intermediate carrier pGEM-T, further be cloned into binary expression vector pBI121, at the expression vector that guarantees to identify under the correct prerequisite of reading frame;

4) acquisition of transfer-gen plant changes the expression vector that step 3) obtains over to Agrobacterium, further change tobacco over to, the transfer-gen plant that obtains is carried out PCR, carry out the salt tolerance evaluation of plant after Southern hybridization and the RT-PCR checking, in the T2 of transfer-gen plant generation, carried out the lasting processing of 200mM NaCl, observe their growth performance, the transgenic tobacco plant that can recover under the normal growth condition after 1.2%NaCl handles 3 days is the salt tolerant transfer-gen plant that is obtained.

Beneficial effect

1, the invention discloses a kind of Monocotyledon choline single oxygenase gene (OsCMO gene) and coded protein thereof.Choline single oxygenase gene is the reported first in the monocotyledons, is expected to be applied to monocotyledonous genetic improvement.This gene can be used as goal gene and imports plant from paddy rice (Oryza sativa L.), improves plant salt endurance, to carry out plant species improvement.Coded protein has the salt tolerant function.

2, the OsCMO gene function that provides of the inventor is the biosynthesizing of participating in trimethyl-glycine.The mRNA expression analysis shows that the OsCMO gene still is that underground part is all expressed enhancing under high salt (140mM NaCl) inductive condition at the overground part of rice seedling.

3, OsCMO gene of the present invention is from paddy rice, has the optimizing codon that monocotyledonss such as being suitable for paddy rice is expressed, its genetically engineered recipient plant is except dicotyledons, as being more suitable for monocotyledonss such as paddy rice, corn, wheat outside soybean, cotton, the tobacco etc.

4, utilize OsCMO gene of the present invention to make up plant expression vector as goal gene, wherein available any promotor is cauliflower mosaic virus (CAMV) 35S promoter, Ubiquitin promotor or other promotor for example, can comprise enhanser in case of necessity in this expression vector, no matter be transcriptional enhancer or translational enhancer.Can use selected marker for the evaluation of simplifying transformant and comprise enzyme antibiotics resistance, also can utilize the enzyme of the compound that colour-change (for example B-glucuronidase GUS) or luminous (for example luciferase) discern, also available unmarked selection.Used expression vector can use Ti-plasmids, Ri plasmid, plant viral vector etc.Method for transformation can be used through agrobacterium-mediated transformation, particle bombardment, pollen tube passage method or other method and transform plant.

Embodiment

Embodiment 1

Select rice varieties " leek green grass or young crops " (be Taihu Lake basin japonica rice local variety, be strong salt tolerant kind) for use, treat that rice seedling grows to 3 leaf after dates, handle, get blade after 12 hours immediately and place the freezing preservation of liquid nitrogen with 140mM NaCl.Get partial blade, grind, add the 1.5mL EP pipe that fills lysate, fully after the vibration, move in the glass homogenizer again with mortar.Move to after the homogenate in the 1.5mL EP pipe, (TRIzolReagents is available from Invitrogen, USA) for extracted total RNA.Identify total RNA quality with the denaturing formaldehyde gel electrophoresis, on spectrophotometer, measure rna content then.Aminoacid sequence retrieval rice genome database according to the spinach choline single oxygenase gene, pass through the fragment sequence that EST comparison and sequence assembly obtain the paddy rice choline single oxygenase gene of 440bp, design 5 ' and 3 ' RACE primer (GSP5:TAGGAGGACTCCATCCAGTCCA and GSP3:GTGTGAAAGTGTCCAAGCAGAA) respectively according to this sequence, adopt the SMART-RACE method (available from Clonetech, USA) carry out the cDNA full-length clone, the RACE product is cloned the most at last, order-checking and splicing have obtained the cDNA sequence (seeing SEQ ID NO.1) of the paddy rice choline single oxygenase gene OsCMO1 of 1451bp.

The gene that the result of BLAST and molecule modeling result proof newly obtain from paddy rice really is a coding choline single oxygenase gene, because this gene encoding production is the rate-limiting enzyme in the trimethyl-glycine route of synthesis, infers that this gene has degeneration-resistant function.The complete encoding sequence of the paddy rice choline single oxygenase gene that obtains according to embodiment 1, further design two ends primer (P1:GATGGCGATCGCGCAATCCG, P2:AGAAATCACTCACCAGTCAC) be template with total RNA, behind synthetic cDNA first chain of reverse transcription, carry out pcr amplification with high-fidelity Tag enzyme (available from Roche).The PCR program is as follows: 94 ℃ of pre-sex change 4 minutes, and 94 ℃ of sex change 30s, 56 ℃ of renaturation 1min, 72 ℃ are extended 1.5min, after 33 circulations, 72 ℃ of 5min.Add the A rear clone to pGEM-T carrier (available from Promega) through general T ag enzyme (available from ancient cooking vessel state company, Beijing).Entrust Shanghai to give birth to the order-checking back acquisition of worker company and have the cDNA sequence of the paddy rice choline single oxygenase gene OsCMO of complete coding region.

Embodiment 2

Its encoded protein matter of cDNA sequence SEQ ID NO.1 of above-mentioned acquisition paddy rice choline single oxygenase gene OsCMO, from paddy rice (Oryza sativa), its aminoacid sequence is SEQ ID NO.2, and warp compares its proteins encoded in database and the amino acid similarity of spinach, prunella asiatica, Herba amaranthi tricoloris and beet choline single oxygenase is respectively 50%, 52%, 51%, 51%.(seeing SEQ ID NO.2).The signal peptide sequence of the N of OsCMO end shows that OsCMO is positioned in the plastid matrix, with the spinach choline single oxygenase at first in chloroplast(id) separated result consistent.With existing rice genome (comprising japonica rice and long-grained nonglutinous rice) database among the OsCMO search GenBank, discovery OsCMO is a single copy gene.

Embodiment 3

OsCMO two ends primer P1, P2 with design in the example 1 carry out the expression of sxemiquantitative RT-PCR analyzing rice seedling overground part and underground part, the result shows, the following 6h of 140mM NaCl processing that is expressed in of rice seedling overground part and underground part OsCMO significantly strengthens, through the gray scale scanning analysis, its mRNA expression amount is 3 times of contrast, weakens to some extent behind the processing 24h.The expression that OsCMO is described is relevant with salt stress.

Experimental example 4

The full length sequence of the OsCMO that obtains according to embodiment 1, design amplifies the primer that complete coding is read frame, and (this is decided by the carrier of selecting for use to introduce restriction endonuclease sites on the upstream and downstream primer respectively, as then to design primer be AGGATCCGATGGCGATCGCGCAATCCG in the BamHI site of inserting the pBI121 carrier, AGGATCCAGAAATCACTCACCAGTCAC), so that construction of expression vector.Amplified production with acquisition among the embodiment 1 is a template, behind pcr amplification, the cDNA of OsCMO is cloned into intermediate carrier (as pGEM-T, promega), further be cloned into binary expression vector (as pBI121 and improved pCAMBIA1301), guaranteeing to identify good expression vector under the correct prerequisite of reading frame, again it is changed in the Agrobacterium, change tobacco or paddy rice over to.The transfer-gen plant that obtains is carried out PCR, carry out the salt tolerance evaluation of plant after Southern hybridization and the RT-PCR checking.With the lasting processing that the T2 generation and the adjoining tree of transfer-gen plant carries out 200mM NaCl, observe their growth performance, the result shows that transgene tobacco can recover under the normal growth condition after 1.2%NaCl handles 3 days, contrast is then dead.

The foregoing description shows the choline single oxygenase gene OsCMO in the monocotyledons source of cloning among the present invention, with the similar protein similar in the spinach only is 51%, and this genoid maybe can not accumulate function in the trimethyl-glycine plant so far without description in monocotyledons.Experimental example 3,4 shows that the salt stress of this gene and plant is closely related.This genoid has the codon that monocotyledons is optimized owing to derive from monocotyledons, compares with the choline single oxygenase gene in dicotyledons source, is more suitable for the resistance genetic improvement of monocot cropss such as paddy rice, corn, wheat.

The inventor will clone a cDNA from monocotyledon rice (Oryza sativa L.), coding choline single oxygenase gene, called after OsCMO.Warp compares its proteins encoded in database and the amino acid similarity of spinach, prunella asiatica, Herba amaranthi tricoloris and beet choline single oxygenase is respectively 50%, 52%, 51%, 51%.OsCMO cDNA total length 1451bp contains the ORF of 1230bp, and coding contains 410 amino acid whose protein, and 5 '-UTR is 59bp, and 3 '-UTR is 159bp.The N end signal peptide sequence of OsCMO proteins encoded shows that it is positioned chloroplast stroma.

The mRNA expression analysis shows that OsCMO still is that underground part is all expressed enhancing under high salt (140mM NaCl) inductive condition at the overground part of rice seedling.Transgenic research shows, changes the OsCMO gene over to tobacco, and the transfer-gen plant comparison of similar contrast of transfer-gen plant growing way under normal operation and gene overexpression is according to obviously high salt tolerance is arranged.This gene can be used as goal gene and imports plant, improves plant salt endurance, to carry out plant species improvement.

In sum, the OsCMO gene that the inventor provides is first at the isolating new gene of monocotyledons, and its function is participated in the biosynthesizing of trimethyl-glycine.A kind of plant choline single oxygenase (gene) of the present invention may be to comprise prunella asiatica, spinach, beet, Herba amaranthi tricoloris, paddy rice etc. from all plants.A kind of in this proteinic aminoacid sequence, OsCMO is first Monocotyledon choline single oxygenase gene.Can utilize OsCMO gene of the present invention to make up plant expression vector as goal gene, wherein available any promotor is cauliflower mosaic virus (CAMV) 35S promoter, Ubiquitin promotor or other promotor for example, can comprise enhanser in case of necessity in this expression vector, no matter be transcriptional enhancer or translational enhancer.Can use selected marker for the evaluation of simplifying transformant and comprise enzyme antibiotics resistance, also can utilize the enzyme of the compound that colour-change (for example B-glucuronidase GUS) or luminous (for example luciferase) discern, also available unmarked selection.Used expression vector can use Ti-plasmids, Ri plasmid, plant viral vector etc.Method for transformation can be used through agrobacterium-mediated transformation, particle bombardment, pollen tube passage method or other method and transform plant.

OsCMO gene of the present invention is from paddy rice, has the optimizing codon that monocotyledonss such as being suitable for paddy rice is expressed, its genetically engineered recipient plant is except dicotyledons, as being more suitable for monocotyledonss such as paddy rice, corn, wheat outside soybean, cotton, the tobacco etc.

Sequence that the present invention relates to and mark apportion are as follows:

(1) information of SEQ ID NO.1

(i) sequence signature:

(A) length: 1451bp

(B) type: Nucleotide

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: Nucleotide

(iii) sequence description: SEQ ID NO.1

(2) information of SEQ ID NO.2

(i) sequence signature:

(A) length: 410a.a

(B) type: amino acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: protein

(iii) sequence description: SEQ ID NO.2

Sequence table

＜110〉Agricultural University Of Nanjing

＜120〉a kind of Monocotyledon choline single oxygenase gene and coded protein thereof

<141>2004-12-30

<160>2

<170>PatentIn?version?3.1

<210>SEQ?ID?NO.1

<211>1451

<212>DNA

＜213〉paddy rice [Oryza sativa]

<221>CDS

<222>(60)..(1292)

<221>3′UTR

<222>(1293)..(1451)

<221>mRNA

<222>(1)..(1451)

<221>polyA?site

<222>(1437)..(1451)

<221>5′UTR

<222>(1)..(59)

<400>1

gtgactcgcc?tcctctctcc?gattcccacg?cctctgcgac?tcgtgcgccg?gcgccggcg 59

atg?gcg?atc?gcg?caa?tcc?gcg?gcc?gcg?gta?tca?tcc?gcc?gca?aga?gcc 107

Met?Ala?Ile?Ala?Gln?Ser?Ala?Ala?Ala?Val?Ser?Ser?Ala?Ala?Arg?Ala

1 5 10 15

tcc?cgc?cca?agg?ccg?acc?cgc?gcc?gcg?ccg?cgc?cgc?atc?gcc?gcc?tcc 155

Ser?Arg?Pro?Arg?Pro?Thr?Arg?Ala?Ala?Pro?Arg?Arg?Ile?Ala?Ala?Ser

20 25 30

gcc?tcc?tcc?gtg?gcg?ccg?ccg?gag?ccc?gcc?gcg?cgg?cgc?clc?gtg?gcg 203

Ala?Ser?Ser?Val?Ala?Pro?Pro?Glu?Pro?Ala?Ala?Arg?Arg?Leu?Val?Ala

35 40 45

gcg?ttc?gac?ccg?gcg?gtc?ccg?ctg?gcc?tcc?gcc?gtg?acg?ccg?ccg?agc 251

Ala?Phe?Asp?Pro?Ala?Val?Pro?Leu?Ala?Ser?Ala?Val?Thr?Pro?Pro?Set

50 55 60

ggg?tgg?tac?acc?gac?ccg?gac?ttt?ctc?cgg?ctc?gag?ctc?gac?cgc?gtc 299

Gly?Trp?Tyr?Thr?Asp?Pro?Asp?Phe?Leu?Arg?Leu?Glu?Leu?Asp?Arg?Val

65 70 75 80

ttc?ctc?cgc?ggg?tgg?cag?gct?gtt?ggc?cac?ata?tgg?caa?gtc?aag?aac 347

Phe?Leu?Arg?Gly?Trp?Gln?Ala?Val?Gly?His?Ile?Trp?Gln?Val?Lys?Asn

85 90 95

cca?aat?gac?tac?ttc?aca?gga?aga?ctt?gga?aat?gta?gaa?ttt?gtc?ata 395

Pro?Asn?Asp?Tyr?Phe?Thr?Gly?Arg?Leu?Gly?Asn?Val?Glu?Phe?Val?Ile

100 105 110

tgt?cgg?gat?gca?aat?gga?gaa?ctc?cat?gct?ttt?cac?aac?gtg?tgt?cgc 443

Cys?Arg?Asp?Ala?Asn?Gly?Glu?Leu?His?Ala?Phe?His?Asn?Val?Cys?Arg

115 120 125

cat?cac?gcc?tca?ctc?ctt?gca?tgt?gga?agt?ggt?cag?aag?act?tgc?ttc 491

His?His?Ala?Ser?Leu?Leu?Ala?Cys?Gly?Ser?Gly?Gln?Lys?Thr?Cys?Phe

130 135 140

cag?tgc?cct?tat?cat?ggc?tgg?aca?tat?gga?ctg?gat?gga?gtc?ctc?cta 539

Gln?Cys?Pro?Tyr?His?Gly?Trp?Thr?Tyr?Gly?Leu?Asp?Gly?Val?Leu?Leu

145 150 155 160

aaa?gcc?gca?caa?ata?tca?gga?atc?aag?aac?ttc?aac?aaa?aat?gat?ttt 587

Lys?Ala?Ala?Gln?Ile?Ser?Gly?Ile?Lys?Asn?Phe?Asn?Lys?Asn?Asp?Phe

165 170 175

ggt?ctc?att?cct?att?aaa?gtg?gct?aca?tgg?ggg?cct?ttt?gta?ttg?gcc 635

Gly?Leu?Ile?Pro?Ile?Lys?Val?Ala?Thr?Trp?Gly?Pro?Phe?Val?Leu?Ala

180 185 190

aaa?ttt?gat?agt?ggt?ttc?tct?caa?gaa?act?gct?gat?aac?aca?gtt?gga 683

Lys?Phe?Asp?Ser?Gly?Phe?Ser?Gln?Glu?Thr?Ala?Asp?Asn?Thr?Val?Gly

195 200 205

gat?gaa?tgg?ctg?ggt?agt?gct?tcg?gat?ctg?ctg?agt?aga?aat?ggc?att 731

Asp?Glu?Trp?Leu?Gly?Ser?Ala?Ser?Asp?Leu?Leu?Ser?Arg?Asn?Gly?Ile

210 215 220

gac?acc?tcg?ttg?cct?cat?att?tgc?agg?cga?gaa?tat?ata?att?gaa?tgt 779

Asp?Thr?Ser?Leu?Pro?His?Ile?Cys?Arg?Arg?Glu?Tyr?Ile?Ile?Glu?Cys

225 230 235 240

aat?tgg?aag?gtc?ttt?tgt?gac?aac?tat?ctg?gat?ggt?ggc?tat?cat?gtt 827

Asn?Trp?Lys?Val?Phe?Cys?Asp?Asn?Tyr?Leu?Asp?Gly?Gly?Tyr?His?Val

245 250 255

cca?tat?gcg?cat?gga?acc?cta?gca?tct?ggt?cta?cag?ctt?caa?tcc?tac 875

Pro?Tyr?Ala?His?Gly?Thr?Leu?Ala?Ser?Gly?Leu?Gln?Leu?Gln?Ser?Tyr

260 265 270

gaa?aca?cat?aca?tat?gaa?aga?gtt?agt?gtt?caa?agg?tgt?gaa?agt?gtc 923

Glu?Thr?His?Thr?Tyr?Glu?Arg?Val?Ser?Val?Gln?Arg?Cys?Glu?Ser?Val

275 280 285

caa?gca?gaa?caa?aat?gat?ttc?gat?cgc?tta?ggg?aca?aaa?gct?atc?tat 971

Gln?Ala?Glu?Gln?Asn?Asp?Phe?Asp?Arg?Leu?Gly?Thr?Lys?Ala?Ile?Tyr

290 295 300

gct?ttt?gtt?tat?cca?aac?ttt?atg?att?aac?agg?tat?ggt?cca?tgg?atg 1019

Ala?Phe?Val?Tyr?Pro?Asn?Phe?Met?Ile?Asn?Arg?Tyr?Gly?Pro?Trp?Met

305 310 315 320

gac?act?aat?cta?gtg?gtc?cca?ttg?gat?gca?acc?aga?tgt?aaa?gtg?ata 1067

Asp?Thr?Asn?Leu?Val?Val?Pro?Leu?Asp?Ala?Thr?Arg?Cys?Lys?Val?Ile

325 330 335

ttt?gat?tat?ttc?ctt?gac?aag?tct?ctt?atg?gac?gac?cag?aat?ttt?att 1115

Phe?Asp?Tyr?Phe?Leu?Asp?Lys?Ser?Leu?Met?Asp?Asp?Gln?Asn?Phe?Ile

340 345 350

gag?agc?agc?tta?aaa?gac?agc?gaa?caa?gta?cag?atg?gaa?gac?att?gca 1163

Glu?Ser?Ser?Leu?Lys?Asp?Ser?Glu?Gln?Val?Gln?Met?Glu?Asp?Ile?Ala

355 360 365

ctt?tgc?gaa?gga?gtt?cag?cgg?ggc?ctg?gaa?tca?cca?gcc?tac?agt?gtg 1211

Leu?Cys?Glu?Gly?Val?Gln?Arg?Gly?Leu?Glu?Ser?Pro?Ala?Tyr?Ser?Val

370 375 380

gga?aga?tat?gca?cca?tca?gtg?gag?atg?gcc?atg?cac?cac?ttc?cac?tgc 1259

Gly?Arg?Tyr?Ala?Pro?Ser?Val?Glu?Met?Ala?Met?His?His?Phe?His?Cys

385 390 395 400

ctc?tta?cat?gcc?aat?ctt?agt?ggt?gac?tgg?tga?gtgatttcta?tgtgcatatc 1312

Leu?Leu?His?Ala?Asn?Leu?Ser?Gly?Asp?Trp

405 410

tgattggatt?tatgcatcac?aaaatttatg?tgcatatctg?cagtattttc?attacttgta 1372

cattgtaaag?tgaaaacaca?tagggatgta?atcaaactgg?ttcttcagtc?ttcacatttt 1432

gtcgaaaaaa?aaaaaaaaa 1451

<210>SEQ?ID?NO.2

<211>410

<212>PRT