CN1384116A - New-type alpha-interferon - Google Patents
New-type alpha-interferon Download PDFInfo
- Publication number
- CN1384116A CN1384116A CN 02111690 CN02111690A CN1384116A CN 1384116 A CN1384116 A CN 1384116A CN 02111690 CN02111690 CN 02111690 CN 02111690 A CN02111690 A CN 02111690A CN 1384116 A CN1384116 A CN 1384116A
- Authority
- CN
- China
- Prior art keywords
- ifn
- alpha
- amino
- acid residue
- interferon
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Abstract
The present invention relates to medicinal bioengineering technology. The new-type alpha-interferon consists of 165 or 166 amino acid residue and is prepared through residue mutation or replacement of amino acid residue(s) of Tyr in Site 122, Phe in Sites 36 and 38 and Pro in Site 39 of opioid functional sites in prototype alpha-interferon. Alpha-interferon is one of the clinically widely applied biological products for treating various serious diseases and has some toxic side effect related to opium acceptor. The present invention can weaken or eliminate the toxic side effect on nervous internal secretion system via the structure of opioid functional sites in alpha-interferon.
Description
Technical field: the present invention relates to the medical bioengineering technical field, is a kind of novel interferon-alpha.
Background technology: interferon-alpha (IFN α) is present one of biological products of widespread use clinically, mainly treats viral illness, as chronic hepatitis B, acute and chronic hepatitis C, pointed condyloma etc., and as the assisting therapy of tumour and malignant hematologic disease.But, heating, apocleisis, granulocytopenia and other neuroendocrine system toxic side effect are arranged in clinical use.Heating due to the IFN α clinical application, architecture basics and receptor mechanism that itself is arranged, IFN α can see through hemato encephalic barrier weak link place and act on central nervous system, can directly act on opiate receptor and changes preoptic anterior hypothalamus temperature-sensitive and cold sensitive neuron discharge frequency.IFN α acts on other toxic side effect due to the neuroendocrine system, as apocleisis, the threshold of pain improve, drowsiness, tetanic etc. all relevant with opiate receptor.
Summary of the invention:
IFN α is made up of many hypotypes, and they are protein molecule [Hou Jian, Wang Dongxing, Xu the army and the people of containing 165 or 166 amino-acid residues.Human cell's factor handbook.1996, Shanghai, press of Tongji University, 1].The inventor finds that this molecule exists the opium sample functional site separate with the immunoloregulation function site, the effect of mediation opium sample neuroregulation.As IFN α 2b, to form by 165 amino-acid residues, opium sample functional site is positioned near the area of space the 122nd the Tyr residue, is made of jointly the 122nd Tyr, the 36th and 38 Phe and the 39th Pro that space structure is close with it.And for example IFN α 1b then is made up of 166 amino-acid residues, and its opium sample functional site is positioned near the 123rd the residing space structure of Tyr residue, comprises the 123rd Tyr, the 36th and 38 Phe and the 39th Pro.The opium sample effect of IFN α mainly is to be acted on due to the opiate receptor by IFN alpha molecule opium sample functional site.The present invention is by changing the structure of IFN α opium sample functional site, reduces it and acts on toxic side effect due to the neuroendocrine system thereby reach.
The present invention adopts targeted mutagenesis to realize to the change of IFN α opium sample functional site structure.The targeted mutagenesis method is carried out [White BA.PCR cloning protocols.Totowa, New Jersey, Humana Press, 1997,141] with reference to the method for White.With the codon of coding IFN α opium sample functional site amino-acid residue, sport the codon of other amino-acid residue, just can change the structure of its opium sample functional site.Both can change the wherein codon of any one amino-acid residue, also can change the codon of two or three or four amino-acid residues simultaneously, all can reach the purpose that reduces IFN α toxic side effect.
The concrete operations step comprises:
1.IFN the targeted mutagenesis of α
(1) primer is synthetic: according to the recombinant PCR principle, except that the primer of the synthetic outside, also according to the synthetic corresponding inboard primer of the difference of mutant, introduce the mutational site.
(2) be template with IFN α gene, pcr amplification is carried out in outside primer and corresponding inboard mutant primer combination, forms short PCR product respectively.Be template with corresponding two short PCR products then,, carry out the PCR reaction second time, obtain the PCR product thus again with two outside primers.
2. make up IFN alpha-mutant expression plasmid: after the PCR product was purified, order-checking identifies, pLy-5 was connected with expression plasmid, acquisition expression plasmid pLy-5-IFN α.
3. make up IFN alpha-mutant engineering bacteria: change expression plasmid pLy-5-IFN α over to intestinal bacteria RR-competence bacteria, promptly get IFN alpha-mutant engineering bacteria.
4. prepare IFN alpha-mutant albumen: cultivate IFN alpha-mutant engineering bacteria, centrifugal collection thalline, ultrasonic disruption adopts the affinity chromatography method to carry out purifying, obtains IFN alpha-mutant albumen.
With the IFN alpha-mutant albumen of gained, adopt cytopathic-effect inhibition assay [Van Heuvel M, et al.J GenVirol, 1986; 67:2215], electricity irritation tail-flick method [Jiang CL, et al.Neurochem Int, 2000; 36 (3): 193] etc., detect its antiviral activity, opium sample analgesic activities; Simultaneously, the influence and pyrogenic action [Zawada WM, et al.Neurochem Int, 1997 that measure the influence of cAMP content in its pair cell, hypothalamus brain sheet PGE2 are discharged; 30:441] etc.The result shows, by changing the structure of IFN α opium sample functional site, i.e. displacement or sudden change constitute the 122nd (or 123) Tyr of IFN α opium sample functional site, any one amino-acid residue among the 36th and 38 Phe and the 39th Pro, or the sudden change of the various combination of several amino acid residue or displacement, its opium sample analgesic activity obviously weakens even disappears, and then obviously weaken even disappear because of IFN α acts on toxic side effect such as heating due to the neuroendocrine system, and the immunologic competences such as antiviral activity of part IFN alpha-mutant do not have obvious influence even increased activity.
Description of drawings:
Fig. 1 is an IFN α 2b molecule stereo structure synoptic diagram.CA-122, CA-36, CA-38 and CA-39 represent the locus at the 122nd, the 36th, the 38th and the 39th amino acids residue place respectively among the figure, and this zone is the opium sample functional site of IFN α 2b.
Fig. 2 is preparation 38Leu-IFN α 2b mutant schematic flow sheet.
Embodiment:
Embodiment 1: preparation 38Leu-IFN α 2b mutant (referring to Fig. 2).38Leu-IFN α 2b mutant is about to the 38th Phe residue of IFN α 2b and sports the Leu residue.
The targeted mutagenesis method is carried out [White BA.PCR cloning protocols.Totowa, New Jersey, Humana Press, 1997,141] with reference to the method for White.Its ultimate principle is overlapping extension, and promptly two kinds of PCR product sequence one ends are overlapping, and it is overlapping to be the gene with the acquisition rite-directed mutagenesis that causes by the inboard primer of two complementary.These two primers add the base of replacing respectively in identical position, just introduce same mutational site by the PCR primer, remove uncorporated unnecessary primer after, two kinds of product sex change mix, and can form the heteroduplex of 3 ' recessed end.This 3 ' recessed end can extend the recombinant chou that produces one two overlapping product by the TaqDNA polymerase.This recombinant chou can carry out pcr amplification by two segmental outside primers.Thus, can produce a kind of mutant away from the fragment end.Concrete steps are as follows:
1. synthetic primer: synthetic routinely following primer:
Outside primer 1:5 ' CGGAATTCAT GCAGGAC3 '
Outside primer 2: 5 ' CGCGGTCGACTCATTCCTTACT3 '
Inboard mutant primer 1:5 ' CTCCTCCTGGGG
TAATCCAAAGTC3 '
Inboard mutant primer 2:5 ' CATGACTTTGGA
TTACCCCAGGAG3 '
In inboard mutant primer, introduced leucine codon TTA, so that the 38th Phe of IFN α 2b sported Leu.
2.IFN the targeted mutagenesis of α 2b:
With IFN α 2b gene is template, and outside primer 1 and inboard mutant primer 1 combination carry out pcr amplification, form short PCR product.Equally, outside primer 2 and 2 combinations of inboard mutant primer form another short PCR product.By reclaiming short PCR product on the glue, be template with corresponding two short PCR products, again with two outside primers, carry out the PCR reaction second time, obtain mutant gene thus.
The PCR reaction system is:
Taq enzyme 2.5 units
H
2O 30μl
buffer 10μl
2.5mM?dNTP 8μl
Primer 15 μ l (50pmol)
Primer 25 μ l (50pmol)
Template 10 μ l
Add H
2O to 100 μ l
The condition of PCR reaction is:
94 ℃ 10 minutes; 72 ℃ 2 minutes; 94 ℃ 30 seconds, 45 ℃ 45 seconds, 72 ℃ 1 minute 30 seconds, totally 30 circulations; 72 ℃ 7 minutes; Remain in 4 ℃ at last.
The reaction solution of PCR is used with after the chloroform extracting of volume 1 time, the agarose electrophoresis through 1%.Cut off 600bp left and right sides electrophoresis adhesive tape, utilize genome company's test kit recovery, purifying DNA fragment.The dna fragmentation that obtains is connected with the T carrier, transformed into escherichia coli DH5 α then, transformation mixture is coated on the LB penbritin flat board that contains 2%X-gal.The single bacterium colony of the some whites of picking carries out plasmid extraction after the cultivation amplification, and again through EcoRI, SalI double digestion, with 1% agarose gel electrophoresis, preliminary evaluation goes out to contain the corresponding transformant of the dna fragmentation about above-mentioned 600bp.Single bacterium colony of these transformants of picking carries out determined dna sequence by plant physiology institute of the Chinese Academy of Sciences, filters out the mutant 38Leu-IFN α 2b that contains correct sequence.
3. make up mutant expression plasmid pLy-5-38Leu-IFN α 2b:
The T vector plasmid and the expression plasmid pLy-5 that will contain correct sequence 38Leu-IFN α 2b gene use EcoRI, SalI double digestion respectively, reaction solution after enzyme is cut is with 1% agarose gel electrophoresis, after treating that dna fragmentation is separated, under ultraviolet lamp, downcut the corresponding adhesive tape of 38Leu-IFN α 2b mutator gene and expression plasmid pLy-5 respectively, with genome company's test kit recovery, purify DNA.The 38Leu-IFN α 2b dna fragmentation and the pLy-5 expression vector that reclaim are pressed 10: 1 mixed of molecule number, add the T4 dna ligase, transformed competence colibacillus bacillus coli DH 5 alpha after 16 ℃ of connections are spent the night.Picking list bacterium colony enlarged culturing, and extracting plasmid is at random cut evaluation through enzyme again with EcoRI and SalI, obtains mutant expression plasmid pLy-5-38Leu-IFN α 2b.
4. make up 38Leu-IFN α 2b mutant engineering bacteria: change expression plasmid pLy-5-38Leu-IFN α 2b over to competence intestinal bacteria RR-, promptly get 38Leu-IFN α 2b mutant engineering bacteria.
5. prepare 38Leu-IFN α 2b mutant protein:
Mutant 38Leu-IFN α 2b engineering bacteria is inoculated in 50ml M9 substratum, 37 ℃ of overnight incubation, transferred in containing 0.2% caseic 500ml M9 substratum with 1: 20,37 ℃ are cultured to cell concentration A600 is 1.0, centrifugal collection thalline, and the 0.01M pH that is suspended in 100ml is 7.4 phosphoric acid buffer, and is centrifugal behind the ultrasonic disruption, and supernatant adopts the affinity chromatography method to carry out purifying (affinity column is available from biological high-technology company limited of Anhui peace section).Washings in the purge process is the 1M NaCl that contains 0.4%Tween20, and elutriant is 0.02MHAc, 0.135MNaCl.Obtain the 38Leu-IFN α 2b mutant protein of purifying at last, interferon-alpha promptly of the present invention, and carry out following detection:
1. adopt conventional cytopathic-effect inhibition assay, the antiviral activity of measuring 38Leu-IFN α 2b [sees VanHeuvel M for details, et al.J Gen Virol, 1986; 67:2215], find that it has kept very strong antiviral activity, be 71% of natural reorganization IFN α 2b.
2. experimentation on animals detects the analgesic activities of 38Leu-IFN α 2b: get male SD rat (available from Shanghai birth control institute), body weight is 160～180g, observe of the influence of 38Leu-IFN α 2b mutant with the administration of tricorn pipe laying, electricity irritation tail-flick method to the rat threshold of pain, measure its opium sample analgesic activities and [see JiangCL for details, et al.Neurochem Int, 2000; 36 (3): 193], find the completely dissolve of opium sample analgesic activities.
With mutant 38Leu-IFN α 2b and transfection the Chinese hamster ovary cell of mu opioid receptor (Shanghai cell biological institute of the Chinese Academy of Sciences) hatch, measure the influence (cAMP measures test kit available from Shanghai Univ. of Traditional Chinese Medicine's isotopic laboratory) of cAMP content in the pair cell, find that 38Leu-IFN α 2b does not have obvious influence to cyclic amp (cAMP) content.
4. adopt 5～7 days SD newborn rat of birth, cultivate hypothalamus brain sheet [Scott IM, et al.Am JPhysiol.1987; 253 (1 Pt 2): R71], measure the influence (PGE2 measures test kit available from Beijing Bang Ding biotech firm) that 38Leu-IFN α 2b mutant discharges hypothalamus brain sheet PGE2, find that 38Leu-IFN α 2b does not have obvious influence to the release of prostaglandin E2 (PGE2).
5. adopt the mode of tricorn pipe laying administration, measure variation [Zawada WM, et al.Neurochem Int, 1997 of 38Leu-IFN α 2b mutant the rat rectal temperature; 30:441], find that 38Leu-IFN α 2b pyrogenic action disappears.
Embodiment 2: preparation 39Gly-IFN α 2b mutant (referring to Fig. 2).39Gly-IFN α 2b mutant is about to the 39th Pro residue of IFN α 2b and sports the Gly residue.
Synthetic inboard mutant primer is as follows:
Primer 1:5 ' CTCCTCCTG
CCGAAATCCAAAGTC 3 '
Primer 2: 5 ' GACTTTGGATTT
GGCCAGGAGGAG 3 '
In inboard mutant primer, introduced codon glycine GGC, so that the 39th Pro of IFN α 2b sported Gly.Other operation steps is with embodiment 1.Found that 39Gly-IFN α 2b antiviral activity increases to 130% of natural recombinant human IFN α 2b, and opium sample analgesic activity disappears, toxic side effect such as heating also disappear.
Embodiment 3: preparation 122Ser-IFN α 2b mutant (referring to Fig. 2).122Ser-IFN α 2b mutant is about to the 122nd Tyr residue of IFN α 2b and sports the Ser residue.
Synthetic inboard mutant primer is as follows:
Primer 1:5 ' GATTCTTTGGAA
GGATTTCCTCACAGC3 '
Primer 2: 5 ' GCTGTGAGGAAA
TCCTTCCAAAGAATC3 '
In inboard mutant primer, introduced Serine codon TCC, so that the 122nd Tyr of IFN α 2b sported Ser.Other operation steps is with embodiment 1.Found that toxic side effect such as the opium sample analgesic activity of 122Ser-IFN α 2b and heating disappear.
Embodiment 4: preparation 36Ser-IFN α 2b mutant (referring to Fig. 2).36Ser-IFN α 2b mutant is about to the 36th Phe residue of IFN α 2b and sports the Ser residue.
Synthetic inboard mutant primer is as follows:
Primer 1:5 ' CTGGGGAAATCC
AGAGTCGTCATG3 '
Primer 2: 5 ' AGACATGAC
TCTGGATTTCCCCAGGAG3 '
In inboard mutant primer, introduced Serine codon TCT, so that the 36th Phe of IFN α 2b sported Ser.Other operation steps is with embodiment 1.Found that toxic side effect such as the opium sample analgesic activity of 36Ser-IFN α 2b and heating disappear.
Embodiment 5: preparation 38Leu-39Gly-IFN α 2b mutant (referring to Fig. 2).38Leu-39Gly-IFN α 2b mutant is about to the 38th Phe residue of IFN α 2b and sports the Leu residue, and the 39th Pro residue sports the Gly residue.
Synthetic inboard mutant primer and other operation steps are with embodiment 1 and 2.Found that toxic side effect such as the opium sample analgesic activity of 38Leu-39Gly-IFN α 2b and heating disappear.
Embodiment 6: preparation 38Leu-122Ser-IFN α 2b mutant (referring to Fig. 2).38Leu-122Ser-IFN α 2b mutant is about to the 38th Phe residue of IFN α 2b and sports the Leu residue, and the 122nd Tyr residue sports the Ser residue.
Synthetic inboard mutant primer and other operation steps are with embodiment 1 and 3.Found that toxic side effect such as the opium sample analgesic activity of 38Leu-122Ser-IFN α 2b and heating disappear.
Embodiment 7: preparation 36Ser-38Leu-IFN α 2b mutant (referring to Fig. 2).36Ser-38Leu-IFN α 2b mutant is about to the 36th Phe residue of IFN α 2b and sports the Ser residue, and the 38th Phe residue sports the Leu residue.
Synthetic inboard mutant primer and other operation steps are with embodiment 1 and 4.Found that toxic side effect such as the opium sample analgesic activity of 36Ser-38Leu-IFN α 2b and heating disappear.
Embodiment 8: preparation 39Gly-122Ser-IFN α 2b mutant (referring to Fig. 2).39Gly-122Ser-IFN α 2b mutant is about to the 39th Pro residue of IFN α 2b and sports the Gly residue, and the 122nd Tyr residue sports the Ser residue.
Synthetic inboard mutant primer and other operation steps are with embodiment 2 and 3.Found that toxic side effect such as the opium sample analgesic activity of 39Gly-122Ser-IFN α 2b and heating disappear.
Embodiment 9: preparation 36Ser-39Gly-IFN α 2b mutant (referring to Fig. 2).36Ser-39Gly-IFN α 2b mutant is about to the 36th Phe residue of IFN α 2b and sports the Ser residue, and the 39th Pro residue sports the Gly residue.
Synthetic inboard mutant primer and other operation steps are with embodiment 2 and 4.Found that toxic side effect such as the opium sample analgesic activity of 36Ser-39Gly-IFN α 2b and heating disappear.
Claims (10)
1. interferon-alpha, form by 165 or 166 amino-acid residues, it is characterized in that it is by any one amino-acid residue or the sudden change of several amino acid residue among the 122nd (or 123) Tyr of the opium sample functional site place area of space of prototype interferon-alpha, the 36th and 38 Phe and the 39th Pro or is replaced into other amino-acid residue and forms.
2. by the described interferon-alpha of claim 1, the amino-acid residue that it is characterized in that the 36th is Ser.
3. by the described interferon-alpha of claim 1, the amino-acid residue that it is characterized in that the 38th is Leu.
4. by the described interferon-alpha of claim 1, the amino-acid residue that it is characterized in that the 39th is Gly.
5. by the described interferon-alpha of claim 1, the amino-acid residue that it is characterized in that the 122nd is Ser.
6. by the described interferon-alpha of claim 1, the amino-acid residue that it is characterized in that the 36th is Ser, and the 38th amino-acid residue is Leu.
7. by the described interferon-alpha of claim 1, the amino-acid residue that it is characterized in that the 38th is Leu, and the 39th amino-acid residue is Gly.
8. by the described interferon-alpha of claim 1, the amino-acid residue that it is characterized in that the 38th is Leu, and the 122nd amino-acid residue is Ser.
9. by the described interferon-alpha of claim 1, the amino-acid residue that it is characterized in that the 36th is Ser, and the 39th amino-acid residue is Gly.
10. right 1～9 described interferon-alpha is used to prepare the purposes of the medicine for the treatment of viral illness, tumour and malignant hematologic disease.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB021116903A CN1176946C (en) | 2002-05-16 | 2002-05-16 | New-type alpha-interferon |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB021116903A CN1176946C (en) | 2002-05-16 | 2002-05-16 | New-type alpha-interferon |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1384116A true CN1384116A (en) | 2002-12-11 |
| CN1176946C CN1176946C (en) | 2004-11-24 |
Family
ID=4741689
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB021116903A Expired - Fee Related CN1176946C (en) | 2002-05-16 | 2002-05-16 | New-type alpha-interferon |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1176946C (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7585647B2 (en) | 2003-08-28 | 2009-09-08 | Guangwen Wei | Nucleic acid encoding recombinant interferon |
| US8114395B2 (en) | 2001-02-28 | 2012-02-14 | Sichuan Biotechnology Research Center | Treatment of viral diseases with recombinant interferon α |
| CN105575159A (en) * | 2016-03-01 | 2016-05-11 | 江苏零浩网络科技有限公司 | Vehicle-mounted positioning system based on logistics information platform |
-
2002
- 2002-05-16 CN CNB021116903A patent/CN1176946C/en not_active Expired - Fee Related
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US8114395B2 (en) | 2001-02-28 | 2012-02-14 | Sichuan Biotechnology Research Center | Treatment of viral diseases with recombinant interferon α |
| US8425896B2 (en) | 2001-02-28 | 2013-04-23 | Sichuan Biotechnology Research Center | Treatment of tumors with recombinant interferon alpha |
| US7585647B2 (en) | 2003-08-28 | 2009-09-08 | Guangwen Wei | Nucleic acid encoding recombinant interferon |
| US8287852B2 (en) | 2003-08-28 | 2012-10-16 | Superlab Far East Limited | Treatment of viral diseases with recombinant interferon α |
| CN105575159A (en) * | 2016-03-01 | 2016-05-11 | 江苏零浩网络科技有限公司 | Vehicle-mounted positioning system based on logistics information platform |
Also Published As
| Publication number | Publication date |
|---|---|
| CN1176946C (en) | 2004-11-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109071678B (en) | Nerve growth factor fusion protein, preparation method and application thereof | |
| CN1363654A (en) | Genetically engineered bacteria and process for preparing insulinotropic hormone secretion peptide GLP-1 (7-36) | |
| CN1237584A (en) | Conotoxin peptide | |
| CN1223605C (en) | Polypeptide medicine for inhibiting SARS coronavirus, and derivatives and use thereof | |
| CN1176946C (en) | New-type alpha-interferon | |
| JP2862870B2 (en) | New peptide | |
| CN101063103A (en) | Hainan sporic scorpion antibiotic and preparation method and application | |
| CN1177055C (en) | Antibacterial peptide gene of fly and its cloning process | |
| CN1861635A (en) | Human pancreas hyperglycemiacin relative peptide-2 analogue | |
| CN1281623C (en) | Human alpha interferon derivative with superstrong antiviral activity | |
| CN100335633C (en) | Method for preparing N-end acetylation modified thymosin alpha with recombined E. coli | |
| CN1724663A (en) | Method of preparing natural human thymosin a1 using series expression mode | |
| CN100336827C (en) | South China sea conus littertus linnaeus nervotoxin and its coding sequence and use | |
| CN101766808B (en) | Method for obtaining series analgesic active peptides DKK and analogs thereof and application of series analgesic active peptide DKK and analogs thereof | |
| CN105709211A (en) | Preparation and application of analgesic active peptide SYPU-AGP3 and SYPU-AGP4 | |
| CN1262559C (en) | Housefly phylaxin gene, and its cloning method and recombinant application | |
| CN1740320A (en) | Fenneropenaeus chinensis Anti-LPS factor gene and cloning process thereof | |
| CN1381587A (en) | Antibacterial peptide gene of Chinese prawn and its colon technique | |
| CN1260359C (en) | High soluble expressed tricholsanthin mutant and its preparing method | |
| CN1179975C (en) | Scorpion peptide for treating arrhythmia and its preparing process and application | |
| CN100335499C (en) | C-terminal amino acid lactone modified extrasin alpha-1 and its uses | |
| CN1597952A (en) | Nerve growth factor cDNA, clone and expresion of Chinese cobra | |
| CN1796414A (en) | New alpha - conantokins, coded polynucleotide and application | |
| CN1709909A (en) | Disintegrating element for poisonous snake and its coding gene and use | |
| CN101525378B (en) | Listonella anguillarum subunit vaccine antigenic protein and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C19 | Lapse of patent right due to non-payment of the annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |