CN1434054A - Dowble-stranded RNA and use thereof - Google Patents

Abstract

The present invention relates to a double-stranded RNA and its application for inhibiting mammalian tumor cell. Said invention adopts the RNA interference technique to introduce the externally-synthetic double-stranded RNA into mammalian tumor cell by means of combination of non-viral carrier and/or viral carrier, and can inhibit the expression of epidermal growth factor receptor so as to change NSCLC cell biological character and raise the sensitivity of mammalian tumor cell to radiation therapy and chemical therapy. Said invented double-strand RNA can be used for preparing antitumor biological preparation and antitumor medicine to make direct injection in tumor body in travenous medication for effectively inhibiting tumor growth.

Description

A kind of double-stranded RNA and uses thereof

Technical field

The invention belongs to biological technical field, relate to a kind of double-stranded RNA and anticancer usage thereof.Be specifically related to a kind of 21-nt double-stranded RNA and in the purposes that suppresses non-small cell lung cancer cell strain expression of epidermal growth factor receptor.

Background technology

Malignant tumour is one of principal disease that threatens at present human health, and its sickness rate presents year by year the trend that rises, and according to statistics, tumour has become second of the Chinese population cause of the death, first of city crowd's cause of the death.With lung cancer is example, and over nearly 20 years, its sickness rate sharply rises, and has accounted for the kinds of tumor first place at the sickness rate of American-European developed country lung cancer, and with annual 0.5% speed increase.In big and medium-sized cities such as China Beijing, Shanghai, lung cancer has occupied the first place of tumor incidence and mortality ratio.At present, the most effectual way that tackles tumour remains operation, 3 kinds of methods of chemotherapy and radiation, but most patient is still died from the inefficacy and the Side effects of pharmaceutical drugs of recurrence, transfer or the chemotherapeutics of tumour at last.With lung cancer is example, although drop into a large amount of energy aspect its early diagnosis and therapy, the five year survival rate of lung cancer is only about 10% at present.Except early diagnostic rate is low, most of case has been lost when making a definite diagnosis outside the reason of best surgical engine meeting, and lung carcinoma cell is a big reason that causes treating failure to the intrinsic or Secondary cases resistance and the high metastases of chemotherapeutics commonly used.

At present, the development of antitumor drug be primarily aimed at the treatment target high-flux medicaments sifting and at the treatment target the rationalization medicinal design.The antisense technology that is subjected in recent years extensively paying attention to is the latter's an important representative, and the antisense nucleic acid by design and target proteins gene imports in the cell, and the expression of target proteins is suppressed, and reaches the purpose of killing and treating tumour.Antisense nucleic acid is because clear, the easy design preparation of its action target spot sequence is considered to have the anti-tumor medicine of potentiality, but in actual applications, exists inhibition efficient low, and specificity is poor, and bigger toxicity and dosage are than defectives such as big and cost height.

RNA disturb (RNA interference, RNAi) be by double-stranded RNA (double-stranded RNA, dsRNA) the PTGS mechanism of the sequence dependent of Yin Faing (posttranscriptional genesilencing, PTGS).In mammalian cell, after 21-23nt dsRNA enters cell, can be template with it, the corresponding mRNA of sequence with it that degrades, thus reach the albumen generation that specificity suppresses specific gene.RNAi is ubiquitous opposing poisoning intrusion in the eukaryote, the monitoring mechanism that suppresses transposon activity, regulate gene expression.Aspect drug development, RNAi also has the specificity height that suppresses at target spot except having the advantage identical with antisense nucleic acid, and consumption is few, the characteristics that drug toxicity is little.It is in the ascendant at present the RNAi technology to be used for antiviral (as HIV virus) and the research of cell signal transfer system, does not appear in the newspapers but be used for oncotherapy.

Summary of the invention

The purpose of this invention is to provide a kind of double-stranded RNA, for therapy of tumor provides New Policy.

Further purpose of the present invention provides new antineoplastic biologic preparation and antitumor drug.

The selected mammalian tumor cell EGF-R ELISA (EGFR) of the present invention is as the oncotherapy target spot, adopt RNA to disturb (RNAi) technology, external synthetic and EGFR cDNA sequence complementary 21nt double-stranded RNA, combine the importing mammalian tumor cell with non-virus carrier and/or virus vector, suppress expression of epidermal growth factor receptor, thereby change the NSCLC characteristics of cell biology, increase chemicotherapy susceptibility.

Mammalian tumor cell EGF-R ELISA of the present invention (epidermal growthfactor receptor, EGFR) be that a part amount is the transmembrane glycoprotein of 170KD, the adjustable cell cycle, regulate hyperplasia, survival, adhesion, migration and differentiation, promote injury repairing.(non-small-cell-lung cancer, NSCLC) overexpression in interior multiple epithelium source property tumour descend in close relations with tumor proliferative, transfer, chemicotherapy susceptibility EGFR comprising nonsmall-cell lung cancer.

The present invention carries out with step as follows,

1, measures the EGFR acceptor

(1) selects EGFR positive cells strain A549, SPC-A-1 for use,, location qualitative to EGFR by immunohistochemical methods method and immunofluorescence technique.

Immunohistochemical methods is established low power lens, high power lens negative control and positive control.Positive control is at cytolemma as a result for immunohistochemical methods, and cytoplasm and nucleus show brown particle, and negative control does not see that specificity is painted.

Aforesaid method used one is anti-to be to be provided mouse-anti people EGFR monoclonal antibody by Chinese Academy of Sciences's cell biological, and two resist and are the rabbit anti-mouse igg of SABC mark.

Described cell strain is provided by Shanghai RESEARCH ON CELL-BIOLOGY institute of Chinese Academy of Sciences cell bank.

Immunofluorescence technique is established negative and positive control fluorescence photo.The same immunohistochemical staining of test-results.The described two anti-rabbit anti-mouse iggs that adopt the FITC mark.

(2). measure acceptor quantity

Adopt the cells were tested by flow cytometry acceptor quantity, the result is A549:%gated:78.58%; Mean:54.51, SPC-A-1:%gated:98.89%mean:103.79, H69:%gated:0.67%mean:67.54.

2, screening EGFR high expressing cell strain

Get cell strain A549, SPC-A-1, ECV, HFL, H ₇₄₀₂, BEL ₇₄₀₂, SKOV ₃Screen with H69, the result shows A549, and SPC-A-1 is the strain of EGFR high expressing cell, ECV, HFL, H ₇₄₀₂, BEL ₇₄₀₂, SKOV ₃Cell strain EGFR expresses lower.The H69 cell strain does not have EGFR expresses.If the negative contrast of H69 cell strain.

Described cell strain is provided by Shanghai RESEARCH ON CELL-BIOLOGY institute of Chinese Academy of Sciences cell bank.

3, by following principle design ssRNA,

1) the 75 base places, cDNA promotor AUG downstream of EGFR,

2) find first AA dimer,

3) record AA 19 Nucleotide in downstream (siRNA-EGFR), its nucleotides sequence is classified as:

5’AAGGAGCUGCCCAUGAGAAAU……mRNA

4) per-cent (G/C) of calculating purine and pyrimidine, G/C ratio is 30% to 70%, 50% the best.

4, by the synthetic siRNA-EGFR of known external chemical synthesis process, its nucleotides sequence is classified as:

GGAGCUGCCCAUGAGAAAUdTdT……siRNA

AUUUCUCAUGGGCAGCUCCdTdT……siRNA?complement

5, fit (annealing) siRNA two strands

1) RNA single strand of the above-mentioned chemosynthesis of independent packing, with no RNase water dilution,

2) justice, sense-rna mix, add to fit damping fluid,

3) hatch for 90 ℃, centrifugal, liquid at the bottom of the collection tube.

4) hatched 1 hour for 37 ℃.

The final concentration of the double-stranded RNA that 5) fits is 20uM.The two strands that forms has following sequence.GGAGCUGCCCAUGAGAAAUdTdT……siRNAAUUUCUCAUGGGCAGCUCCdTdT……siRNA?complement

6, the design of sRNA-unrelated, synthetic and fit same dsRNA-EGFR.Sequence is:

5’-GAACUUCAGGGUCAGCUUGCCUU-3’——dsRNA-unrelated

5’-GGCAAGCUGACCCUGAAGUUCUU-3’——unrelated?completement

7, the 15%PAGE-SDS electrophoresis is identified the two strands that fits, and fits fully, and double-stranded clip size is correct.

8, screening cationic-liposome

Get cationic-liposome TKO, Oligofectamine, Lipofectamine ^TM2000 screen, and adopt the Lipofectamine of high transduction efficiency ^TM2000 are used for the transduction of dsRNA.

9, the RNA perturbation technique is used for tumour cell:

1) preparation attached cell,

2) preparation dsRNA-Lipofectamine mixture,

3) flow cytometer detects EGFR acceptor number.

Experimental result confirms that A549 cell strain EGFR expresses and reduced by 73.23%, and SPC-A-1 cell strain expression of receptor has reduced by 76.01%.The present invention imports mammalian tumor cell with external synthetic dsRNA by cationic-liposome, can suppress expression of epidermal growth factor receptor, thereby change the NSCLC characteristics of cell biology, increase the susceptibility of mammalian tumor cell, obtain sure RNAi effect chemicotherapy.

Double-stranded RNA of the present invention can combine with non-virus carrier and/or virus vector, prepares new antineoplastic biologic preparation and antitumor drug, and direct injection or intravenously administrable effectively suppress tumor growth in the row knurl body.

Description of drawings

Fig. 1 is that two strands fits electrophorogram.

Wherein 1: molecular weight standard, 2: just RNA-EGFR, 3: sense-rna-EGFR,

4: double-stranded RNA-EGFR, 5: non-special double-stranded RNA

Fig. 2 is the restraining effect of RNAi to SPC-A-1 cell EGFR.

Embodiment

Embodiment 1

External synthetic siRNA-EGFR fits siRNA two strands (dsRNA).

By the synthetic siRNA-EGFR of known external chemical synthesis process, its sequence is: 5 ' AAGGAGCUGCCCAUGAGAAAU ... mRNA, GGAGCUGCCCAUGAGAAAUdTdT ... siRNA, length: 21, molecular weight: 6732.9 (g/mole), ODU260:31.9 (ug/ODU260), quantity: 50nmol/ pipe * 2 pipes, AUUUCUCAUGGGCAGCUCCdTdT ... siRNA complement length: 21, molecular weight: 6583.7 (g/mole), ODU260:33.4 (ug/ODU260), quantity: 50nmol/ pipe * 2 pipes

The packing of every RNA single strand independence of above-mentioned synthetic, the water of RNase deactivation is diluted to 50uM, justice RNA30ul mixes with sense-rna 30ul, adding 15ul 5 * fit damping fluid, final volume is 75ul, hatches 1 minute for 90 ℃, centrifugal 15 seconds, liquid at the bottom of the collection tube was hatched 1 hour for 37 ℃, and the double-stranded final concentration of dsRNA is 20uM.Fit consisting of of damping fluid: 100mMKOAc, 30mMHEPES-KOHpH7.4,2mM MgOAc.Through the 15%PAGE-SDS electrophoresis, the result shows that the two strands that fits fits fully, and double-stranded clip size is correct.

Embodiment 2 RNA perturbation techniques are used for non-small cell lung cancer cell

The preparation attached cell: transfection is inoculated A549 or SPC-A-1 cell the day before yesterday in 12 well culture plates, and cell density reaches 40-50% (0.5-2 * 10 when making the next day transfection ⁵Cells/well/12 well culture plates), change nutrient solution (DMEM+10%FBS), volume 1ml.

Preparation dsRNA-Lipofectamine mixture:

1) dsRNA is diluted in 100ul serum-free DMEM, mixing.

2) mixing, 4ul Lipofectamine and 100ul serum-free DMEM mixing then before Lipofectamine uses.Incubated at room 5min.

3) with dsRNA diluent and Lipofectamine diluent mixing, cumulative volume 200ul, incubated at room 20min, room temperature preservation.

4) add 12 well culture plates, mixing was hatched in the incubator 24-48 hour.

Flow cytometer detects the acceptor number, and the result is:

A549 cell strain EGFR expresses and has reduced by 73.23% (dsRNA-EGFR16ul/lipofectamine2000 4ul/12 well culture plate).SPC-A-1 cell strain expression of receptor has reduced by 76.01% (dsRNA-EGFR16 ul/lipofectamine 2000 4ul/12 well culture plates).

The result confirms that dsRNA of the present invention can suppress expression of epidermal growth factor receptor, changes the NSCLC characteristics of cell biology, increases the susceptibility of mammalian tumor cell to chemicotherapy, obtains sure RNAi effect.

Claims (7)

1, a kind of double-stranded RNA, the 21-nt double-stranded RNA that it is characterized in that having following sequence.

GGAGCUGCCCAUGAGAAAUdTdT……siRNA

AUUUCUCAUGGGCAGCUCCdTdT……siRNA?complement

2,, it is characterized in that described double-stranded RNA is external synthetic by the described double-stranded RNA of claim 1.

3,, it is characterized in that described double-stranded RNA combines importing tumour cell, preparation antineoplastic biologic preparation and antitumor drug with non-virus carrier and/or virus vector by claim 1 and 2 described double-stranded RNAs.

4, by the described double-stranded RNA of claim 3, it is characterized in that described non-virus carrier is a cationic-liposome.

5, by the described double-stranded RNA of claim 4, it is characterized in that described cationic-liposome is Lipofecta-mine ^TM2000.

6, by the described double-stranded RNA of claim 3, it is characterized in that described tumour cell is a mammalian tumor cell.

7, by the described double-stranded RNA of claim 3, it is characterized in that described tumour cell is a non-small cell lung cancer cell.