DE10258770B4 - Test for inhibitors of heparanase, useful for treatment of e.g. cancer and inflammatory disease, using immobilized, labeled heparanase substrate - Google Patents

Abstract

Testing agents (I) for inhibition of the catalytic activity of heparanase (II) comprising: - (a) allowing a binding partner (III) for a heparanase substrate (IV), immobilized on a solid support, to interact with labeled (IV), to form an immobilized, labeled substrate (X); - (b) treating (X) with (II) in presence of test compound; and - (c) testing for presence/absence of the label in the separated solution, is new. - Independent claims are also included for the following: - (1) similar method in which (IV) is bound, by bridging, to molecules immobilized on the support; - (2) testing potential of agents to inhibit binding between FGF (fibroblast growth factor) and (IV), by incubating immobilized FGF with test compound and labeled (IV), then detecting absence or presence of the label in the seprated solution; - (3) kits for performing the new processes; and - (4) inhibitors of the catalytic activity of (II) identified by the new methods. - ACTIVITY - Immunosuppressive; Antiinflammatory; Cytostatic. - No biological data given. - MECHANISM OF ACTION - Catalytic Activity of Heparanase Inhibitor; Inhibitor of Binding between Heparanase and Fibroblast Growth Factor.

Description

The The present invention provides methods for testing an agent on his ability ready, the catalytic activity to inhibit heparanase. The methods of the invention include Immobilizing a heparanase substrate via a heparanase substrate binding Protein. The procedures are easy to perform and can easily be performed as automated systems for HTS.

heparan sulfate (HS) and heparan sulfate proteoglycans (HSPG) are in the extracellular matrix (ECM) and on the cell surface in front. They play an important role in cell regulatory processes Role, such as adhesion, Migration, Differentiation and Proliferation (Jackson, R.L., Busch, S.J., and Cardin, A.L., (1991), Glycoaminoglycans: Molecular properties, protein interactions and roles in physiological processes; Physiol. Rev. 71, 481-539; Kjellen, L., and Lindahl, U., (1991), Proteoglycans: Structures and interactions; Annu. Rev. Biochem. 60, 443-475; Wight, T.N., Kinsella, M.G., and Qwarnstromn, E.E., (1992), The role of proteoglycans in cell adhesion, migration and proliferation; Curr. Opin. Cell Biol. 4, 793-801). Furthermore they interact with numerous molecules, including growth factors (e.g., fibroblast growth factors and platelet-derived Growth factor), cytokines, extracellular matrix proteins, lipoproteins and β-amyloid proteins (Ishai-Michaeli, R., Eldor, A., and Vlodavsky, I., (1990), Heparanase activity expressed by platelets, neutrophils and lymphoma cells releases active fibroblast growth factor from extracellular matrix; Cell Reg. 1, 833-842; Schlessinger, J., Lax, I., and Lemmon, M., (1995), Regulation of growth factor activation by proteoglycans: What is the role of the low affinity receptors? Cell. 83, 357-360; Najjam, S., Gibbs, R. V., Gordon, M.Y., and Rider, C.C., (1997), Characterization of human recombinant interleukin 2 binding to heparin and heparan sulfate using an ELISA approach; Cytokines 9, 1013-1022; Eisenberg, S., Sehayek, E., Olivercrona, T., and Vlodavsky, I., (1992), lipoprotein, lipase enhances binding of lipoproteins to heparan sulfate on cell surfaces and extracellular matrix; J. Clin. Invest. 90, 2013-2021; Schulz, J.G., Megow, D., Reszka, R., Villringer, A., Einhaupl, K.M., and Dirnagl, U., (1998), Evidence that glypican is a receptor mediating betaamyloid neurotoxicity in PC12 cells; Eur. J. Neurosci. 10, 2085-2093). The release of these proteins by proteases or glycosidases represents a regulatory mechanism in normal processes and in processes of disease the induction of growth, the Chemotaxis and extravasation of cells causes.

Heparanase is an endo (D) -glucuronidase that cleaves heparan sulfate proteoglycans (HSPG) at specific sites. Their activity has been demonstrated in various cell types, including human platelets, fibroblasts, neutrophils, activated T lymphocytes, monocytes and human umbilical vein endothelial cells (HUVEC) (Ishai-Michaeli, R., Eldor, A., and Vlodavsky, I., ( Cell Reg 1, 833-842; Schlessinger, J., Lax, I., and Lemmon, M., (1995), Heparanase activity expressed by platelets, neutrophils and lymphoma cells releases active fibroblast growth factor from extracellular matrix; Cell, 83, 357-360, Najjam, S., Gibbs, RV, Gordon, MY, and Rider, CC, (1997), Characterization of human recombinant interleukin 2 binding to heparin and heparan sulfate using ELISA approach; Cytokine. 9, 1013-1022; Eisenberg S., Sehayek, E., Olivercrona, T., and Vlodavsky, I., (1992), Lipoprotein lipase enhances binding of lipoproteins to heparan sulfate on cell and extracellular matrix J. Clin. Invest. 90, 2013-2021; Schulz, JG, Megow, D., Reszka, R., Villringer, A., Einhaupl, KM, and Dirnagl, U., (1998), evidence that glypican is a receptor mediating beta-amyloid neurotoxicity in PC12 cells; Eur. J. Neurosci. 10, 2085-2093; Kosir, MA, Quinn, CC, Zukowski, KL, Grignon, DJ, and Ledbetter, S., (1997), Human prostate carcinoma cells produce extracellular heparanase; J. Surg. Res. 67, 98-105; Godder, K., Vlodavsky, I., Eldor, A., Weksler, BB, Haimovith-Friedman, A., and Fuks, Z., (1991), heparanase activity in cultured endothelial cells; J. Cell Physiol. 148, 274-280; Bame, KJ, (1993), Release of heparin sulfate glycosaminoglycans from proteoglycans in Chinese hamster ovary cells does not require proteolysis of the core protein; J. Biol. Chem. 268, 19956-19964). In addition, elevated heparanase levels are associated with melanoma and other tumor cell types (Vlodavsky, I., Fuks, Z., Bar-Ner, M., Ariav, Y., and Schirrmacher, V., (1983), Lymphoma cell mediated degradation of sulfated proteoglycans into the subendothelial extracellular matrix relationship to tumor cell metastasis; Cancer Res. 43, 2704-2711; Vlodavsky, I., Eldor, A., Haimovitz-Friedman, A., Metzner, Y., Ishai-Michaeli, R., Lider, O., Naparstek, Y., Cohen, IR, and Fuks, Z., (1992), expression of heparanase by platelets and circulating cells of the immune system: possible involvement in diapedesis and extravasation; invasion metastasis 12 , 112-127; Nakajima, M., Irimura, T., DiFerranta, D., DiFerranta, N., and Nicholson, GL, (1983), Heparan sulfate degradation; relation to tumor invasion and metastatic properties of mouse B16 melanoma sublines Science 220, 611-613, Ikuta, M., Podyma, KA, Maruyama, K., Enomoto, S., Yanagishita, M., (2001), expression of heparanase in oral cancer cell lines and oral cancer tissues; Oral Oncol. 37, 177-184). There is evidence that the cleavage of HSPG HS chains by heparanase results in the destruction of the ECM and thereby the Cell migration is facilitated. This is an important process in tissue invasion of blood-derived malignant tumor cells and leukocytes (Hanahan, D., and Folkman, J., (1996) Patterns and Emergments of the angiogenic switch during tumorigenesis; 86, 353-364; Zetter, BR, (1998), Angiogenesis and tumor metastasis; Ann Rev. Med. 49, 407-424; Nakajima, M., Irimura, T., and Nicholson, GL, (1988). Heparanase and tumor metastasis; J. Cell Biochem., 36: 157-167). Indeed, treatment of experimental animals with heparanase inhibitors markedly reduces the incidence of lung metastases (Vlodavsky, I., Mohsen, M., Lider, O., Svahn, CM, Ekre, HP, Vigoda, M., Ishai-Michaeli, R. , Peretz, T., (1995), Inhibition of tumor metastasis by heparanase inhibiting species of heparin, Invasion Metastasis 14, 290-302, Parish, CR, Coombe, DR, Kakobsen, KB, and Underwood, PA, (1987). Evidence that sulfated polysaccharides inhibit tumor metastasis by blocking tumor cell-derived heparanase; Int. J. Cancer 40, 511-517, Parish, CR, Freeman, C., Brown, KJ, Francis, DJ, and Cowden, WB, (1999 ), Identification of sulfated oligosaccharide-based inhibitors of tumor growth and metastasis using novel in vitro assays for angiogenesis and heparanase activity; Cancer Res. 59, 3433-3441), demonstrating that heparanase inhibitors may possibly be used to prevent invasion of tumor cells and to inhibit metastasis.

It was found that ability of activated lymphocytes, macrophages and granulocytes, the ECM to permeate and migrate to target tissues on which heparanase activity is dependent (Lider, O., Baharav, E., Mekori, Y.A., Miller, T., Naparstek, Y., Vlodavsky, I., and Cohen, I.R., (1989), Suppression of experimental autoimmune diseases and prolongation of allograft survival by treatment of animals with low doses of heparin; J. Clin. Invest. 83, 752-756).

The Heparanase is given in response to various activation signals (e.g., immune complexes, antigens, nitrogens) from intracellular compartments (e.g., lysosomes, specific granules), this sets theirs Involvement in inflammatory and autoimmune reactions. The treatment of experimental animals with Heparanase inhibitors markedly reduced the frequency of T-cell mediated hypersensitivity delayed Type, an experimental autoimmune encephalomyelitis and a adjuvant arthritis (Willenborg, D.O., and Parish, C.R., (1988), Inhibition of allergic encephalomyelitis in rats by treatment with sulfated polysaccharides; J. Immunol. 140, 3401-3405), this shows that heparanase inhibiting Connections may be used for inhibiting autoimmune and inflammatory diseases can be.

Consequently Heparanase plays an important role in the degradation of the extracellular matrix. She is at the inflammation, involved in tumor angiogenesis and metastasis. Although hints present that heparanase as a therapeutic target for intervention would be attractive The development of drugs was previously limited by the fact that There was no method with a high Duchsatzleistung with which the ability of agents that inhibit heparanase activity can.

Heparanase tests were performed using radiolabeled ECM-associated HSPG (Bartlett et al., (1995), Comparative Analysis of the ability of leukocytes, entothelial cells and platelets to degrade the subendothelial basement membrane: Evidence for cytokine dependence and detection of a novel sulfatase; Immunol. Cell Biol. 73, 113-124; Vlodavsky et al., (1992), Expression of heparanase by platelets and circulating cells of the immune system: Possible involvement in diapedesis and extravasation; Invasion Metastasis 12, 112-127). there the radiolabelled material detected by heparanase cleavage is detected ECM is released. Among the disadvantages that often requires proteases are to the HS chains for to expose the heparanase degradation. It's difficult to do the gel filtration analysis adapt so that a high throughput is possible in the test. Furthermore have to certain safety standards when using radioactive material be respected.

Satoh et al. (Satoh, A., et al., (1999), Comparison of methods of immobilization to enzyme-linked immunosorbent assay plates for the detection of sugar chains; Anal. Biochem. 275, 231-235) describe methods, wherein oligosaccharides are covalently attached to the methyl vinyl ether-maleic anhydride copolymer (MMAC) coated microtiter plates are bound. This procedure However, they are labor-intensive, since there are several chemical reactions are required to transfer the oligosaccharides to the MMAC-coated plates to bind. Some of the organic reagents and solvents can possibly destroy the microtiter plates. Furthermore could it may be that the total yield after several steps of the chemical Reactions only very low.

Freeman and Parish describe a rapid method for measuring heparanase activity (Freeman, C., and Parish, CR, (1997), A rapid quantitative assay for the detection of mammalian heparanase activity; Biochem J. 324, 229-237) , Chicken histidine-rich glycoprotein (cHRG) was coupled to Sepharose and used to isolate uncleaved HS. Although in these procedures the heparana se-cleaved products are separated from the HS substrate, but large amounts of cHRG-Sepharose are required to quantitatively remove the cleaved HS from the reaction mixtures. In addition, the use of Sepharose beads in combination with column chromatography and centrifugation methods is not suitable for high throughput screening.

Ben-Artzi et al. (Ben-Artzi et al., (2001), Methods of screening for potential anti-metastatic and anti-inflammatory agents using mammalian heparanase as a probe. US 6,190,875 ) describe a high throughput assay for measuring heparanase activity. Using HS or certain types of heparin as substrate, the heparanase reaction is performed in 96-well microtiter plates and quenched by the addition of tetrazolium blue. The tetrazolium blue reacts with the reactive ends of sugars exposed by heparanase cleavage. The number of cleavages of the substrate is measured calorimetrically. This test requires the use of large amounts of HS as a substrate (50 μg HS per 100 μl), and the incubation time must be at least two hours (two to 24 hours). These test conditions, which are not optimal in nature, will favor cleavage of the sugars of the HS substrate. In order to compensate for the low signal-to-background ratio to some extent, it is required that a larger number of reactive sugars be measured. Another disadvantage of the assay is the use of the tetrazolium salt, which can react with many types of groups, possibly resulting in inaccurate results. Therefore, the purity of the test reagents and test compounds is a very important issue.

The catalytic activity the heparanase could also be indirectly inhibited by an agent that inhibits the binding of the Heparanase substrate to fibroblast growth factor (FGF) prevented or changed. Because such agents are likely FGF-mediated signal events can block are they possible candidates for medicines against cancer and diseases caused by abnormal neovascularization (Folkman, J., (1995), Angiogenesis in Cancer, vascular, rheumatoid and outher diseases; Nat. Med. 1, 27-31).

Parish (1999), Cancer Research 59, 3433-3444 describes an in vitro assay system for angiogenesis and heparanase activity, wherein the heparanase assay is based on the observation that serum protein binds HRG (histidine-rich glycoprotein) to heparan sulfate chains and thereby masks the heparanase cleavage sites , Similarly, Nakajima (1986) describes in Anal. Biochem. 157, 1672-1771 into immobilized, labeled heparan sulfates useful as substrates for assays of heparanase activity. Here ¹⁴ C-labeled heparan sulfate are released in the process. Oosta (1992) describes in J. Biol. Chem. 257, 11249-11255 the investigations of a Heparitinaseaktivität, wherein in the corresponding test system to Sepharose bound, iodine-labeled heparin is used. Another label in the test system is described by Sewell (1989), Biochem. J. 264, 763-777 using ³⁵ S-labeled glycosaminoglycan-Sepharose. Again, a heparin dinase activity is determined. In US 5,332,817 and EP-A2 0 244 932 describes solid-phase tests for the hydrolysis of a glycosaminoglycan endoglycosidase, in particular soluble, modified substrate fragments are bound via proteins to a solid phase. The soluble substrates are mediated in particular by an avidin-biotin system as Immobilisierungsbrücke. In the DE-A1 199 55 803 describes the use of heparanase inhibitors for the treatment of heart failure. Again, heparanase activities are employed using labeled substances which may also be solid phase coupled.

• (a) Interagieren eines auf einem festen Träger immobilisierten Heparanase-Substrat-bindenden Proteins mit einem markierten Heparanase-Substrat, wodurch ein immobilisiertes markiertes Heparanase-Substrat bereitgestellt wird,
• (b) Interagieren einer Heparanase-Enzymlösung mit dem immobilisierten markierten Heparanase-Substrat in Gegenwart des Mittels, und
• (c) Nachweisen des Vorliegens oder der Abwesenheit der Markierung in der Lösung entfernt vom festen Träger, wodurch bestimmt wird, ob das Mittel die Fähigkeit besitzt oder nicht besitzt, die Heparanase zu hemmen, wobei das Heparanase-Substrat-bindende Protein ausgewählt ist aus Fibroblasten-Wachstumsfaktor (FGF), VEGF und PDGF.

The present invention provides a method of assaying an agent for its ability to inhibit the catalytic activity of the heparanase, the method comprising the steps of:

• (a) interacting with a heparanase substrate-binding protein immobilized on a solid support with a labeled heparanase substrate to provide an immobilized labeled heparanase substrate,
• (b) interacting with a heparanase enzyme solution with the immobilized labeled heparanase substrate in the presence of the agent, and
• (c) detecting the presence or absence of the label in the solution away from the solid support, thereby determining whether or not the agent has the ability to inhibit the heparanase, wherein the heparanase substrate-binding protein is selected from fibroblasts Growth factor (FGF), VEGF and PDGF.

• (a) Interagieren in Lösung des auf einem festen Träger immobilisierten FGF mit dem Mittel und dem markierten Heparanase-Substrat, und
• (b) Nachweisen des Vorliegens oder der Abwesenheit der Markierung in der Lösung entfernt vom festen Träger, wodurch bestimmt wird, ob das Mittel die Fähigkeit besitzt oder nicht besitzt, die Bindung zwischen dem Fibroblasten-Wachstumsfaktor und dem Heparanase-Substrat zu hemmen.

In addition, the present invention provides a method of testing one described above in accordance with the method of inhibiting the catalytic activity of heparanase, its ability to inhibit the binding between the fibroblast growth factor (FGF) and the heparanase substrate, the method comprising the steps of:

• (a) Interacting in solution of the FGF immobilized on a solid support with the agent and the labeled heparanase substrate, and
• (b) detecting the presence or absence of the label in the solution away from the solid support, thereby determining whether or not the agent has the ability to inhibit binding between the fibroblast growth factor and the heparanase substrate.

The The present invention provides methods for measuring heparanase activity and Testing a means or means by which his / her ability can be measured to inhibit heparanase activity. The proceedings The present invention can be easily performed. Besides, they can easily as automated systems for high throughput screening (HTS) become.

The HS component of HSPG serves as a low affinity receptor in vivo for the Fibroblast growth factor (FGF) on the cell surface. at heparanase cleavage releases the FGF / HS complex from the cell surface, whereupon cell proliferation is stimulated. During the Angiogenesis, metastasis and inflammation promotes increased heparanase activity release of the FGF / HS complex from the cell surface, the extracellular matrix and the basement membrane. In the present invention, the physiological Relevance of the heparanase catalytic activity for the activity of the cell surface FGF / heparanase substrate complex used for it to scrutinize their ability to the catalytic activity to inhibit heparanase.

The The present invention includes assays in which the heparanase substrate is transferred via a Heparanase substrate-binding protein is immobilized.

The The present invention involves interacting with an immobilized one Heparanase substrate-binding protein with a labeled heparanase substrate. The heparanase substrate binding Protein is on a solid carrier immobilized. When interacting with the immobilized heparanase substrate-binding protein with the labeled heparanase substrate binds the labeled heparanase substrate to the immobilized Heparanase substrate-binding protein, thereby binding the heparanase substrate Protein plus immobilized labeled heparanase substrate is formed. The heparanase substrate binding Protein plus immobilized labeled heparanase substrate is added a heparanase enzyme solution incubated so that the heparanase is the labeled heparanase substrate can cleave enzymatically. The resulting from the enzyme cleavage cleaved fragments are released into the solution. The enzyme-cleavage product solution becomes removed from the solid support tested, with the label being measured to the catalytic activity to determine the heparanase. This incubation with heparanase in Absence of a means to be tested serves to make the point to determine 100% of the catalytic activity of heparanase then the percentage inhibition of heparanase activity a test substance can be calculated.

To the Testing an agent for its ability to the catalytic activity heparanase, the heparanase enzyme and the heparanase substrate-binding Protein plus the immobilized labeled heparanase substrate in Incubated presence of the agent. The enzyme-cleavage product solution becomes removed from the solid support The mark is measured to determine if the means the ability possesses or does not possess to inhibit the heparanase. A percentage Inhibition of heparanase activity can for a specific agent based on the point of 100% of the catalytic activity the heparanase can be calculated.

The Heparanase substrate-binding protein is a peptide or fragment which binds to a heparanase substrate, namely FGF, VEGF or PDGF.

Of the FGF can be the naturally occurring product or it can be synthesized. FGF leaves cheap by cloning and expression, e.g. as in Prats et al. (Prats, H., et al., (1989), High Molecular Mass forms of basic fibroblast growth factor are initiated by alternative CUG codons; Proc. Natl. Acad. Sci. USA 86, 1836-1840).

The Heparanase enzyme may be the naturally occurring product or it can be synthesized. The heparanase can be by cloning and expression, e.g. as in example 2 described.

The labeled heparanase substrate contains a heparanase substrate and at least one label for detection linked to the heparanase substrate. In the present invention, the heparanase substrate refers to a substrate which can be cleaved by the enzyme heparanase into cleavage products and which has the ability to bind to the FGF. The heparanase substrate may be selected from heparan sulfate (HS), heparan sulfate proteoglycans (HSPG) and heparan sulfate analogs. The heparan sulfate analogs of the present invention are analogs cleaved by the heparanase enzyme. Although heparin is generally considered to be a heparanase inhibitor, certain types of heparin serving as heparanase substrates (Ben-Artzi, H., et al., US Pat. US 6,190,875 ), also as heparan sulfate analogs according to the present invention. However, it has been shown that the structural properties of heparin required for FGF binding are different from those sufficient for the replacement of the βFGF bound to HS on cell surfaces and ECM (Ben-Artzi, H., et al. , US Pat. US 6,190,875 ; Ishai-Michaeli, R., et al., (1992), Importance of size and sulfation of heparin in the release of βFGF from the vascular endothelium and extracellular matrix; Biochemistry 31, 2080-2088). Thus, heparin species that do not substitute βFGF in vivo, for example, in a assay using immobilized FGF would not have the same physiological relevance as heparan sulfate.

The at least one mark for the heparanase substrate may be selected from fluorescent, radioactive, chemiluminescent and chromogenic molecules. The Heparanase substrate can be labeled with one or more labels be. If desired can, can the marks) for the heparanase substrate should be selected according to whether they are sensitive Provides proof of signal.

A fluorescent label refers to a fluorophore or a group containing a fluorophore. Since the fluorophore emits absorbed light at a characteristic wavelength, the fluorescently labeled heparanase substrate can be measured using known fluorescence detection devices. The fluorescent label may be, for example, fluorescein (such as fluorescein isothiocyanate FITC or F ₂ FITC), lanthanide chelates, rhodamine, etc. The currently commercial lanthanides are Europium (Eu), Samarium (Sm), Terbium (Tb) and Dysprosium (Dy).

The use of FITC as a label allows sensitive detection of fluorescence intensity and is suitable for testing a large number of agents. F ₂ FITC has somewhat better photostability and fluorescence and requires less quenching than FITC. An Eu chelate, a lanthanide chelate, shows fluorescence with a long-lasting decay. By testing using an Eu chelate, the involvement of fluorescence detected by the agent to be tested can be excluded.

So far were disseminated time-resolved Fluorometric (TRF) tests using Eu chelates as Fluorophores for HTS (Hemmila, I., Dakubu, S., Mukkala, V.M., Siitari, H., Lovgren, T., (1984), Europium as a label in time-resolved immunofluorometric assays; Anal. Biochem. 137, 335-343; Hemmila, I., and Webb, S., (1997), Time-resolved fluorometry: An overview of the labels and core technologies for drug screening applications; Drug Discovery Today 2, 373-381). These fluorophores show an intense and long-lasting fluorescence emission, which is why it possible is to measure the fluorescence after a delay time. hereby become the background counts of short-lived fluorescent emissions from organic fluorophores, that are contained in the sample, avoided because they are crumbling, before proof is given. The time-delayed fluorescence in combination with a big one Stokes shift (340-625 nm) effectively reduces background emissions and contributes to sensitivity of the test. Tests using an Eu-labeled HS and an Eu-labeled biotin-HS have been shown higher Sensitivity than those using a FITC label becomes. Eu (DPTA), where DPTA is 1- (p-isothio-cyanatobenzyl) diethylenetriamine-N1, N1, N2, N3, N3-pentaacetic acid, is also sensitive, taking it in the acidic conditions of heparanase cleavage (i.e., pH 5.4) is more stable than an Eu chelate.

If a fluorescent label is used, the enzyme cleavage product samples passed through a light source, e.g. a laser, the light at the excitation wavelength the fluorophore emits. The fluorescence is measured by the emitted photons at the emission wavelength of Fluorophores are determined. For example, is the excitation wavelength for fluorescein at about 494 nm and the for Eu chelate at about 340 nm. The emission wavelength for fluorescein is e.g. at about 518 nm and for Eu-chelate at about 615 nm.

An example of a radioactive label is tritium ( ³ H). An example of a chromogenic label is paranitrophenyl (PNP).

The Means or the means to be screened may include means of any type. They can occur in nature Substances or man-made (synthetic) substances be. For example, can the agents are compounds of low molecular weight, peptides, Proteins or antibodies be. It is known that the catalytic activity of a Enzyme can be inhibited by placing an antibody to the active site is bound. The term "antibody" as used herein refers to a monoclonal or a monoclonal antibody polyclonal immunoglobulin or a fragment of an immunoglobulin, e.g. Fab1 or Fab2. The immunoglobulin may be a "humanized" antibody comprising fused or transplanted antibody regions in which at least one of the regions is derived from a human antibody.

The Heparanase substrate is immobilized on a solid support suitable for in vitro testing suitable is. Examples of a solid support include a microtiter plate, Sepharose beads and polymer beads.

The Procedure is sensitive. Only about one in ten possible Cleavage sites on the labeled heparanase substrate is determined by the Binding to the FGF masked.

The high throughput of the FGF / labeled heparanase substrate assay can be realized when executed as an automated system. For example, was for the FGF / FITC-HS test using a Zeiss uHTS system Screening throughput of more than 25,000 compounds per day achieved. To positive results due to own fluorescence of the test compounds can exclude the FGF / Eu-HS test e.g. be used to recycle the funds who tested positive in the FITC-HS / FGF test.

In another aspect not covered by this invention a heparanase substrate to at least one label and to a Immobilisierungsbrücke bound. An immobilization bridge is a group or groups, (a) capable of binding to a heparanase substrate, (b) when bound to a labeled heparanase substrate, (i) not the catalytic activity of heparanase on the labeled Heparanase substrate interferes and (ii) does not interfere with the measurement of the at least one label or does not add external signals, and (c) the to a molecule binds that to a solid carrier can be immobilized. That bound to an immobilization bridge labeled heparanase substrate is in contact with the immobilized molecule which specifically binds to the immobilization bridge. The resulting, over the bridge immobilized labeled heparanase substrate is then treated with heparanase implemented. The products of heparanase cleavage are labeled as Fragments in the solution released. In the solution will the label measured away from the solid support.

For example, can the immobilization bridge and the corresponding biotin immobilized on the solid support or streptavidin (SA) or avidin.

In an embodiment In the present invention, the heparanase substrate is HS and the label is one fluorescent label.

When Alternative to using a heparanase substrate that is attached to at least a label and an immobilization bridge is bound, the Heparanase substrate bound to an immobilization bridge without labeling be. In this aspect of the invention, a test is as above specified, being a means to its ability to the catalytic activity to inhibit, using a FGF-immobilized labeled Heparanase substrate is tested. In addition, a test is carried out with the agent using a bound to an immobilized bridge Heparanase substrate is tested. This test using one to an immobilization bridge bound heparanase substrate is suitable for the determination of whether test substances, for the in the FGF / labeled heparanase substrate assay was found to inhibit heparanase activity, this heparanase inhibitory activity is confirmed may or not.

Of the IC50 value refers to the concentration of an agent that is required to inhibit 50% of a specific measured activity. In the present invention, the specific measured activity is meant is, the catalytic activity the heparanase. For Each test substance can be determined to have an IC50 value. additional Information for the determination of the IC 50 value can be found in Example 16.

The presence or absence of a label in the enzyme cleavage product solution is detected at a site remote from the solid support. The measurement is performed at the remote location so that the measurement of the label is not corrupted by the label, which may remain immobilized on the solid support. The location remote from the solid support need not be at a certain distance from the solid support. The measurement of the label could take place very close to the solid support, for example using a protective screen against the detection of the label remaining on the solid support and thus being removed from the solid support according to the present invention.

The Means determined by the FGF / labeled heparanase substrate assay method that they have the heparanase activity were tested in kinetic assays as in Example 17. The Results (not shown here) showed that these agents are competitive or mixed inhibitors of heparanase at the enzymatically active Center of heparanase were. Also examples 18 to 21 offer a confirmation of the FGF / labeled heparanase substrate assay.

In addition, the present invention encompasses a method for screening agents to determine whether or not they interfere with HS / FGF interactions, because then they could release labeled heparanase substrate fragments even in the absence of heparanase. Further, such agents could be useful as drugs in the treatment of cancer and diseases caused by abnormal neovascularization. The binding of a labeled heparanase substrate to FGF-coated plates can be monitored (see 3 and 11A ). To the FGF-coated plates is added a labeled heparanase substrate in an amount sufficient to bind to the immobilized FGF. In the supernatant, the label is measured remotely from the solid support, which can provide a measure of the background. For testing an agent, the agent and the labeled heparanase substrate are contacted in solution with the immobilized FGF. The supernatant is tested away from the solid support to detect the presence or absence of the label to determine if the agent has or does not have the ability to inhibit binding between the fibroblast growth factor and the heparanase substrate. The agents which have the ability to inhibit binding therefore have a higher label value in the supernatant than the background measurement.

Out For this reason, the present invention also provides the use of the above-described method for the identification of Inhibitors of binding between the FGF and the heparanase substrate ready. additionally The use of these agents, which is the bond between the FGF and the heparanase substrate for the manufacture of a medicament for the Treatment of cancer and diseases provided by a abnormal neovascularization are caused.

In another embodiment The present invention relates to the use of the methods of the present invention for the identification of inhibitors of catalytic activity the heparanase.

In a further embodiment The present invention relates to a kit containing the components includes, to carry out a method according to the invention are required from the group containing a solid support, a heparanase substrate-binding Protein on the solid carrier is immobilized or can be immobilized, a labeled one Heparanase substrate and heparanase.

By the present invention can new inhibitors of the catalytic activity of heparanase and new inhibitors the binding between the FGF and the heparanase substrate identified become.

These can be provided as a drug, wherein the drug a pharmaceutically acceptable carrier and a therapeutically effective amount of a catalytic inhibitor activity the heparanase obtained by the methods of the present invention Invention has been identified; and also pharmaceutically acceptable salts from that.

Accordingly can Process for preparing a drug are carried out the methods being the steps of the methods of the invention wherein the identified agent is modified and the resulting Agent with a pharmaceutically acceptable carrier or diluent is formulated.

Of the term used herein "pharmaceutically compatible "refers to those compounds, substances, compositions and / or dosage forms, the after the usual medical opinion for the Use in contact with tissues of humans and animals suitable are, without causing severe toxicity, irritation, allergic reaction or cause another problem or complication being a reasonable reasonable Benefit / risk ratio.

Of the term used herein "pharmaceutically compatible Salts "refers on derivatives of identified funds, the original Agent is modified by producing acidic or basic salts thereof become. Examples of pharmaceutically acceptable salts include but not limited on mineral or organic acid salts basic radicals such as amines; Alkali or organic salts acidic residues such as carboxylic acids; and the same. The pharmaceutically acceptable salts include the conventional ones non-toxic salts or the quaternary ammonium salts of the original Compound, e.g. made of non-toxic inorganic or organic acids be formed. Such conventional non-toxic Salts include e.g. Salts derived from inorganic acids, like hydrochloric acid, hydrobromic, Sulfuric acid, sulfamic, Phosphoric acid, nitric acid and the same; and the salts made from organic acids were, like acetic acid, propionic acid, Succinic acid, Glycolic acid, stearic acid, Lactic acid, Malic acid, Tartaric acid, citric acid, ascorbic acid, pamoic, maleic acid, hydroxymaleic, phenylacetic acid, glutamic acid, benzoic acid, salicylic acid, Sulfanilic acid, 2-acetoxybenzoic acid, fumaric acid, benzenesulfonic acid, toluenesulfonic acid, methanesulfonic acid, ethanedisulfonic acid, oxalic acid, isethionic acid and like.

The pharmaceutically acceptable Salts of the present invention may be derived from the original agent, which contains a basic or acidic group, by conventional chemical processes are synthesized. In general, such Salts are prepared by the free acid or base forms of this Compounds with a stoichiometric Amount of suitable base or acid in water or in an organic solvent or in a mixture is implemented from both; in general, non-aqueous media, such as ether, ethyl acetate, Ethanol, isopropanol or acetonitrile preferred. Lists with appropriate Salts are found in Remington's Pharmaceutical Sciences, 17th ed., Mack Publishing Company, Easton, PA, 1985, p. 1418, the specification of which is incorporated herein by reference is.

The by the method according to the invention identified means can be modified so that the following is achieved; (i) a modified one active center, activity spectrum, and / or (ii) better efficacy, and / or (iii) less toxicity (a better therapeutic index), and / or (iv) weaker side effects, and / or (v) a modified onset of action, a modified one Duration of action, and / or (vi) modified kinetic parameters (absorption, Distribution, metabolism and excretion), and / or (vii) modified physico-chemical parameters (solubility, hygroscopic Behavior, color, taste, smell, stability, condition), and / or (viii) a better general specificity, Organ / tissue specificity, and / or (ix) an optimized application form and application route by (i) esterification of carboxyl groups, or (ii) esterification of hydroxyl groups with carbonic acids, or (iii) esterification of hydroxyl groups to e.g. Phosphates, pyrophosphates or sulfates or hemisuccinates, or (iv) formation of pharmaceutical acceptable Salts, or (v) formation of pharmaceutically acceptable Complex, or (vi) synthesis of pharmacologically active polymers, or (vii) introduction of hydrophilic residues, or (viii) introduction / replacement of substituents on aromatics or side chains, change of the substituent pattern, or (ix) modification by introduction of isosteric or bioisosteric residues, or (x) synthesis of homologous compounds or (xi) introduction of branched side chains, or (xii) conversion of alkyl substituents to cyclic analogs, or (xiii) derivatization of hydroxyl groups to ketals, acetals, or (xiv) N-acetylation to amides, phenylcarbamates, or (xv) Synthesis of Mannich bases, imines, or (xvi) transformation of Ketones or aldehydes to Schiff bases, oximes, acetals, ketals, Enol esters, oxazolidines, thiozolidines or combinations thereof: Furthermore, the method according to the invention comprises formulating the product of this modification with a pharmaceutically acceptable carrier or a carrier / diluent, the one for the smell or taste of compositions or products suitable is.

The Inhibitors of the catalytic activity of heparanase produced by the methods of the invention have been identified for the manufacture of a medicament for the treatment of autoimmune diseases and inflammatory diseases and cancer, in particular tumor angiogenesis and metastasis be used.

The The present invention has now been generally described for the better understanding are the specific examples, here for explanation only serve and in no way limit the invention unless otherwise stated indicated in connection with the following figures.

The Pictures show:

In 1A are the products of heparanase cleavage of F ₂ FITC-HS shown eluted from a Superose 6 FPLC.

In 1B are the products of heparanase cleavage of ³ H-HS shown eluted from a Superose 6 FPLC.

In 2 the FGF concentration-dependent binding to microtiter plates is shown graphically at pH 7.5 and pH 9.5.

In 3 the F ₂ FITC-HS concentration-dependent binding to the FGF-coated plates is shown graphically.

In 4 the heparanase activity of the expressed products from the transfected CHO cells is shown graphically.

In 5 the heparanase-dependent cleavage of F ₂ FITC-HS on the FGF-coated plates is shown graphically.

In 6 For example, Superose 6-FPLC elution of the heparanase cleavage product from the F ₂ FITC-HS / FGF heparanase assay is shown graphically.

In 7 the timing of heparanase cleavage is shown graphically.

In 8th the pH dependence of heparanase activity is shown graphically.

In 9 Figure ₂ is a scatter plot of the plate numbers to fluorescence units (FU) in the F ₂ FITC-HS / FGF assay, showing the total heparanase activity signal, ie, the average fluorescence intensity of the cleavage product after addition of the heparanase Inhibitor, and it shows the background signal, ie the average fluorescence intensity of the test buffer.

In 10 a scatter plot is shown showing the calculated Z 'factors for the indicated disks.

In 11A the Eu-HS concentration-dependent binding to the FGF-coated plates is shown graphically.

In 11B Figure 3 is a graph of the heparanase concentration versus time resolved fluorometric units (TRF) showing the heparanase-dependent cleavage of Eu-HS on the FGF-coated plates.

In 12A For example, the F ₂ FITC-HS-biotin concentration-dependent binding to SA-coated plates is plotted.

In 12B the heparanase-dependent cleavage of F ₂ FITC-HS-biotin is plotted on the SA-coated plates.

In 13A the Eu-HS biotin concentration-dependent binding to SA-coated plates is plotted in a plot of concentration versus measured TRF.

In 13B the heparanase-dependent cleavage of Eu-HS-biotin on the SA-coated plates is plotted on a plot of concentration versus measured TRF.

In the following examples, heparin sulfate from the bovine kidney of Seikagaku Corp. was used. Fluororecein 5-isothiocyanate (FITC "isomer I") and Oregon Green 488 isothiocyanate (F ₂ FITC) were purchased from Molecular Probes The DELFIA Eu-DTPA-ITC chelate, wash concentrate, reinforcing solution was from Perkin Elmer Biotin-LC-Hydrizde was purchased from Pierce N-acetylmannosamine was from Lancaster Bovine serum albumin (BSA), Triton X 100 and Tween 20 were purchased from Roche Molecular Biochemicals The abbreviations "M", "mM" and "μM "represent the units mol / l, mmol / l and μmol / l.

Example 1: Cloning, Expression and purification of FGF

bFGF was cloned and expressed as described (Prats, H., et al., (1989), High molecular mass forms of basic fibroblast growth factor are initiated by alternative CUG codons; Proc. Natl. Acad Sci., USA 86, 1836- 1840). E. coli cells expressing bFGF were suspended in lysis buffer (20 mM NaPO ₄ , 5 mM EDTA, pH 7.0) at a ratio of 1 g cells / 5 ml lysis buffer. Protease inhibitor cocktail tablets (EDTA-free, Roche Molecular Biochemicals) and lysozyme (200 μg / ml) were added and the suspension stirred at 4 ° C for 30 minutes. The sample was sonicated, RNAase and DNAase (Roche Molecular Biochemicals) were added (1 μg / ml) and the sample incubated for a further 30 minutes. After centrifugation of the sample at 20,000 x g, 20 minutes, the supernatant was filtered through a 0.8 μM filter and applied to an SP Sepharose column packed with 20 mM NaPO ₄ , 100 mM NaCl, 5 mM EDTA, pH 7.0, had been equilibrated. After washing the column with the equilibration buffer, the bFGF was eluted from the column with 20 mM NaPO ₄ , 600 mM NaCl, 5 mM EDTA, pH 7.0. The eluted fraction was concentrated and applied to a heparin-Sepharose column equilibrated with the SP-Sepharose elution buffer. The bFGF was eluted with 20mM NaPO ₄ , 2M NaCl, 5mM EDTA, pH 7.0. The purified bFGF was concentrated to the sample after addition of 1 mM DTT. To induce oligomer formation, the concentrated bFGF was dialysed for 72 hours at 4 ° C against dialysis buffer (50 mM NH ₄ HCO ₃ , 50 mM NaCl, pH 8.0), which was changed several times.

Example 2: Cloning Expression and purification of heparanase

A full-length human heparanase cDNA clone was purchased from the ATCC. Using the sequence published in GenBank (Accession No. AF152376), Oligos were designed to PCR amplify the 1632 bp open reading frame (ORF) while simultaneously adding (i) subcloning restriction sites (5'-KpnI-3 '). -NotI), (ii) a 6-amino acid epitope tag was attached to the C-terminus of the ORF ("EE-tag", NH ₂ -EFMPME-COOH), preceded by a flexible 4-amino acid linker (SGSG) and followed by a single ala residue before the stop codon.

The forward primer (SEQ ID NO: 1) was
5'-GGGTACCATGCTGCTGCGCTCGAAGCCTGCGCTGCCGCCGCCGCTGATGCTG-3 '

The reverse primer (SEQ ID NO: 2) was
5'-ATAGTTTAGCGGCCGCTCACGCTTCCATCGGCATGAATTCACCAGAACCAGAGA TGCAAGCAGCAACTTTGGCATTTCTTATCACAAAAAACTATATGAG-3 '

The Amplicon was prepared using a "proof-reading" polymerase and the ATCC plasmid as a template. The resulting amplicon was cleaved with KpnI and NotI and into the mammalian expression vector pEFBOS subcloned. The sequence of the cloned ORF was confirmed before CHO cells with the heparanase expression construct and a NEO selection plasmid co-transfected.

Dihydrofolate reductase-defective Chinese hamster cells (CHOdhfr-) were used as hosts for transfection. Cells (2 x 10 ⁵ cells per well) were grown on DMEM supplemented with 10% (v / v) FBS plus 100 μM sodium hypoxanthine and 16 μM thymidine (1 x HT) in a six-well tissue culture plate. Transfection was carried out by adding 0.5 μg of plasmid DNA encoded for the heparanase (pEF-BOS), neomycin resistance gene (pRSV-Neo) and dihydrofolate reductase gene (pSV-dhfr) in a ratio of 15: 1: 1 in the presence of 2 μl FuGene6 reagent (Roche Molecular Biochemicals) to the culture. After 72 hours incubation in a 37 ° C CO ₂ incubator, the culture medium was replaced with HT minus DMEM supplemented with 10% dialysed FBS. The transfected culture was further incubated for four to eight weeks with the medium being changed three times a week. Subsequently, the cells surviving in the selective medium were transferred to 150 mm dishes containing 1 x 10 ⁶ cells / dish in HT minus DMEM containing 10% dialysed FBS and increasing concentrations of methotrexate (MTX) from 0.1 to 3 , 0 μM, were sown. From over 100 colonies, a CHOB3 designated clone was selected which showed heparanase activity. The expression of heparanase by the clone CHOB3 is about four times higher than that by the non-transfected CHO cells.

• a) Heparanase-Produktion in Rollerflaschen: Corning 850-cm²-Rollerflaschen wurden verwendet. Jede Flasche wurde beimpft mit 2,4 × 10⁷ Zellen in 150 ml DMEM, angereichert mit 10 % (Vol./Vol.) dialysiertem FBS plus 3 μM MTX und 25 mM Hepes-Puffer. Ein Ansatz mit 100 Flaschen wurde bearbeitet, indem die Flaschen fünf bis sieben Tage auf einem Rollerflaschen-Ständer inkubiert wurden, wobei sie mit einer Geschwindigkeit von fünf Umdrehungen pro Minuten gerollt wurden. Nach einer Trypsin-Behandlung wurden die Zellpellets aus den Flaschen nach Waschen mit Phosphat-Kochsalzlösung-Puffer abzentrifugiert.
• b) Heparanase-Produktion in Suspensionskultur: Ein 10-L-Bioreaktor, enthaltend 7 L Excel 301-Medium (JRH), angereichert mit 5 % dialysiertem FBS, 3 μM MTX, 0,1 % „pluronic acid" und 25 mM Hepes, wurde mit einer CHOB3-Kultur beimpft, so dass eine anfängliche Zellkonzentration von 5 × 10⁵ Zellen/ml erhalten wurde. Die Suspensionskultur wurde vier bis fünf Tage bei 35°C inkubiert, bis die Zelldichte 3 × 10⁶ erreichte. Danach wurden die Zellen für die Isolierung und Reinigung der Heparanase geerntet.

The production of heparanase with the clone CHOB3 was carried out by the following two methods:

• a) Roller bottle heparanase production: Corning 850cc ^2- roll bottles were used. Each flask was inoculated with 2.4 x 10 ⁷ cells in 150 ml of DMEM supplemented with 10% (v / v) dialyzed FBS plus 3 μM MTX and 25 mM Hepes buffer. A 100-bottle approach was carried out by incubating the bottles on a roller bottle stand for five to seven days, rolling at a speed of five revolutions per minute. After a trypsin treatment were the cell pellets are centrifuged out of the bottles after washing with phosphate-saline buffer.
• b) Heparanase Production in Suspension Culture: A 10 L bioreactor containing 7 L of Excel 301 medium (JRH) supplemented with 5% dialysed FBS, 3 μM MTX, 0.1% "pluronic acid" and 25 mM Hepes, was inoculated with a CHOB3 culture to give an initial cell concentration of 5 x 10 ⁵ cells / ml The suspension culture was incubated at 35 ° C for four to five days until the cell density reached 3 x 10 ⁶ harvested for the isolation and purification of heparanase.

CHO cells expressing heparanase were suspended in lysis buffer (50 mM Tris, 150 mM NaCl, 0.5% Triton X-100, pH 7.5) at 2 x 10 ⁷ cells / ml, protease inhibitor cocktail tablets ( Roche Molecular Biochemicals) were added and the sample briefly sonicated. Subsequently, the sample was stirred for 30 minutes at 4 ° C, followed by centrifugation at 100,000 xg, 60 minutes. The soluble fraction ("100kxg-sup") was run through 0.8 and 0.45 μM filters and used for enzymatic assays to confirm that the activity detected in the "100kxg-sup" fraction was on heparanase based, a small amount of heparanase was purified essentially as described by a method (Prats, H., et al., (1989), High molecular mass forms of basic fibroblast growth factor are initiated by alternative CUG codons; Proc. Natl Acad Sci USA 86, 1836-1840).

Example 3 Preparation of Fluorescein-labeled HS (FITC-HS or F ₂ FITC-HS)

HS was labeled with Oregon Green 488 isothiocyanate (F ₂ FITC) and another HS was labeled with fluorescein 5-isothiocyanate (FITC) by the method as described. Typically, HS from bovine kidney (60 mg) was dissolved in 16 ml of 0.1 M Na ₂ CO ₃ (pH 9.35). FITC (94 mg) or F ₂ FITC (103 mg) in 0.8 ml of DMSO was added slowly (dropwise) to the HS solution and stirred at 4 ° C for 18 hours in the dark. The reaction was quenched with 1 M Tris-HCl, pH 8.0, (0.5 mL) and the solution stirred for 20 minutes at room temperature. Subsequently, the sample was applied to a Sephadex G-25 column (2.5 × 30 cm) in PBS to remove the excess FITC reagent. The fractions containing fluorescein-labeled HS were pooled. The extent of fluorescein labeling was determined by reading the absorbance at 490 nm (ε = 72,000 M ^-1 ). Typically, the molar ratio of fluorescein to HS was 0.6.

Example 4: Preparation of Eu-chelate-labeled HS

HS (3.3 mg) was dissolved in 0.2 ml of 0.2 M Na ₂ CO ₃ (pH 9.35). To the solution was added DELFIA Eu-DTPA-ITC chelate (1 mg in 0.1 ml H ₂ O) and stirred for one hour at room temperature and then at 4 ° C for 14 hours. Subsequently, the sample was applied to a Sephadex G-50 column (fine quality, 1.5 cm x 50 cm) in TBS (50 mM Tris-HCl, pH 7.5, 100 mM NaCl). Before applying the sample, 10 mg of BSA (to saturate non-specific binding) and 20 ml of 20 mM EDTA were loaded onto the column, followed by 60 ml of TBS. The fractions containing Eu-labeled HS were pooled. The extent of labeling was determined by a standard curve of known concentrations of Eu-chelate solutions. Typically, the molar ratio of Eu chelate to HS was 0.54.

Example 5: Preparation of biotin HS

HS (4.5 mg) was dissolved in 0.2 ml H2O followed by 0.6 ml methanol. The solution was admixed with 5.0 mg of solid biotin-LC-hydride followed by 4 μl of 0.5 M NaHCO ₃ in 10% methanol. The reaction was allowed to proceed for one day at 50 ° C. Next, NaCNBH ₃ (25 mg) was added to the solution. The solution was clarified by adding 0.2 ml H ₂ O. The reaction mixture was incubated at 50 ° C for two days. Two additional amounts (25 mg each) of NaCNBH ₃ were added and the reaction mixture was incubated at 50 ° C for 2 days after each addition. The sample was then concentrated by vacuum centrifugation to 0.3 ml, diluted to 0.5 ml with H ₂ O and applied to a Sephadex G-25 column in PBS. The fractions containing HS were combined and the pH was adjusted to 9.4 by addition of 30 μl of 1 M Na ₂ CO ₃ .

Example 6 Preparation of Fluorescein-labeled Biotin-HS (F ₂ FITC-HS-Biotin)

F ₂ FITC (0.8 mg in 80 μl DMSO) was added to the biotin-HS solution of Example 5 with stirring, then the reaction was allowed to proceed overnight in the dark at 4 ° C. The sample was applied to a Sephadex G-25 column and eluted with PBS. The fractions containing F ₂ FITC-labeled biotin-HS were pooled. The extent of fluorescein labeling was determined by reading absorbance at 490 nm. The molar ratio of fluorescein to HS was 0.6.

Example 7: Preparation of Eu-Chelate-labeled Biotin-HS (Eu-HS-Biotin)

To the biotin-HS solution (0.34 ml, 4.5 mg / ml in PBS) prepared as described in Example 5, 6.5 mg Na ₂ CO _{3 was} added to bring the pH to 9 To set 4. Eu-DTPA-ITC chelate (1 mg) was dissolved in 0.1 ml of 10 mM sodium acetate (pH 4.8) and 50 μl of this solution was added with stirring to the biotin-HS solution. The reaction mixture was shaken for one hour at 25 ° C followed by 15 hours at 4 ° C and a further four hours at 25 ° C followed. Thereafter, the samples were applied to a Sephadex G-50 column (fine quality, 1.5 cm × 50 cm) in TBS. Before loading the sample, 10 mg of BSA (to saturate the non-specific binding) and 20 ml of 20 mM EDTA were loaded onto the column, followed by 60 ml of TBS. The fractions containing Eu-labeled HS were pooled. The extent of labeling was determined by a standard curve with known concentrations of Eu-chelate solutions. The molar ratio of Eu-chelate to HS was 0.34.

Example 8: Preparation of ³ H-labeled HS

³ H-labeled HS was prepared as previously described (Toyoshima, M., and Nakamjima, M., (1999), Human heparanase purification, characterization, cloning and expresssion, J. Biol. Chem. 274, 24153-24160). Typically, HS (10 mg) was dissolved in 0.38 ml of hydrazine hydrate containing 7.6 mg of hydrazine sulfate, and the mixture was heated to 100 ° C in a sealed glass jar for two hours. The mixture was cooled and dried under argon. Toluene (0.4 ml) was added and the mixture was dried by rotary vacuum evaporation. This procedure was repeated twice. The residue was dissolved in 0.9 ml of 1 M NaCl and desalted in water on a Sephadex G-25 column. The desalted material was applied to a Dowex 50 column (X-8, Na ⁺ form) (1.0 cm x 3.0 cm) and washed with 5 ml of water. The "flow" and "wash" fractions were pooled and freeze-dried. The resulting N-deacetylated HS was dissolved in 0.5 ml of 0.5 M NaHCO ₃ containing 10% (v / v) methanol, cooled to 0 ° C. in an ice-bath and washed with 30 μl of [ ³ H] -. Acetic anhydride (3 mCi, 500 mCi / mmol) in toluene. The mixture was stirred vigorously at 0 ° C for three hours. Then, another 0.5 ml of 0.5 M Na ₂ CO ₃ , 20 μl of MeOH and 25 μl of acetic anhydride were added with stirring for 30 minutes at 0 ° C. This procedure was repeated once more. After the reaction had warmed to room temperature, the toluene was removed under argon flow and the solution desalted on a Sephadex G-25 column in 20 mM ammonium acetate, pH 6.8. The [ ³ H] -labeled HS was pooled and the aliquots stored at -20 ° C.

Example 9 Heparanase Assay Using FITC-HS or F ₂ FITC-HS and FGF-Coated Plates (FITC-HS / FGF Test)

FGF (1.97 mg / ml) was diluted to 18.75 μg / ml with PBS and used to coat Costar's 384-well solid black tie plates (40 μl / well) overnight at 4 ° C. The plates were blocked with 1% BSA / PBS (60 μl / well) for one hour at 37 ° C and washed with PBS / 0.02 Tween 20 (60 μl / well, four times). Then, FITC-HS or F ₂ FITC-HS (0.15 μg / well / 40 μl in PBS, 1% BSA, 0.02% Tween 20) was added and incubated at 37 ° C for one to one and one-half hours. Thereafter, the plates were washed with PBS / 0.02% Tween 20 (60 μl / well, three times). The crude heparanase from transfected CHO cells (1 μl of "100kxg-sup" from Example 2 containing 5 μg total protein in lysis buffer) and the purified heparanase (20 ng) were each incubated with 40 μl assay buffer (50 mM sodium acetate, pH 5, 0, 0.2 mg / ml BSA, 5 mM N-acetylmannosamine, 0.05% Triton X 100), added to each well and incubated for 30 minutes at 37 ° C. The enzyme reaction was monitored by addition of 5 μl / well 1 M Tris-HCl, pH 8.0, and then the solution (35 μl / well) was transferred to a microtiter plate and the fluorescence (excitation at 485 nm and emission at 535 nm) was read on a Victor-2 reader (Perkin Elmer Life Sciences).

Example 10: Heparanase Test to the high throughput screen (HTS) using FITC-HS on FGF-coated plates

Of the HTS-FITC-HS / FGF heparanase assay was performed on a Zeiss uHTS system from a pipetting device for 384 Wells, three pipettors for 96 Wells, two washers, two "multidrop" dispensers, four "cybidrop" donors, three incubators and two Zeiss HTS readers. The microtiter plates (384 wells) were coated with FGF, blocked with BSA and stored at 4 ° C for up to three weeks. The plates were washed with PBS / 0.02% Tween 20 and then incubated with FITC-HS. For heparanase cleavage the crude enzyme was removed from the "100kxg-sup" (1 μl / well) used by Example 2. All steps to move the plates, for transmission of liquids and the fluorescence measurements were performed by machines.

The overall signal-to-background ratio was 7.5 ( 9 ) and the average Z'-factor was 0.32 ( 10 ). Agents have been identified which have the ability to inhibit the heparanase catalytic activity, inhibiting more than 65% of the activity at a concentration of 25 μM. Since some of these potential inhibitors were fluorescent agents, they were also tested in the Eu-HS / FGF assay (Example 11) on the Zeiss uHTS, with agents that showed a positive result to be confirmed as heparanase inhibitors.

Example 11: Heparanase Test using Eu (DTPA) -labeled HS on FGF-coated Plates (Eu-HS / FGF test)

FGF was applied to 384-well microtiter plates as in Example 9 coated. The plates were incubated with 1% BSA / PBS (50 μl / well) one hour at 37 ° C blocked and washed with TBS (60 μl / well, three times). Eu-labeled HS (40 μl / well, 0.375 μg / ml in TBS, 0.5% BSA, 0.02% Tween 20) was added to the plates and this one hour at 37 ° C incubated. Thereafter, the plates were washed with TBS (60 μl / well, 3 times). The crude heparanase (1 μl of "100kxg-sup" of Example 2, containing 5 μg Total protein in lysis buffer) and the purified heparanase (20 ng) were each with 40 .mu.l Test buffer diluted (50 mM sodium acetate, pH 5.4, 0.2 mg / ml BSA, 5 mM N-acetylmannosamine, 0.025% Triton X 100), added to each well and allowed to stand for 30 minutes at 37 ° C incubated. The reaction was carried out by adding 1.0 M Tris-HCl, pH 8.0, (5 μl / well) stopped. Subsequently became the solution (8 μl / well) transferred to a microtiter plate and with 60 μl / well the reinforcing solution 30 Mixed minutes at room temperature. The signal became quantitative determined by the time-resolved Fluorescence (TRF) at the wavelengths EX (340 nm) and EM (615 nm) was read on a Wallace Victor 2 reader.

Example 12: HTS-heparanase assay using Eu-HS on FGF coated plates

Of the Heparanase assay using Eu-HS as a substrate was revealed a Zeiss uHTS system. The movement of the plates and the transfer of liquids were carried out by vending machines. The TFR measurements done separately on a Victor-2 reader.

Example 13: Heparanase Assay Using FITC-HS-Biotin (or F ₂ FITC-HS-Biotin) on Streptavidin (SA) Coated Plates (FITC-HS-Biotin / SA Test)

To produce FITC-HS-biotin, the HS was first treated with biotin-LC-hydrazide to attach the biotin group to the terminal sugar of HS. The resulting imine was then reduced by NaCNBH ₃ to the amine. Subsequently, the labeled material (biotin-HS) was purified by passage through a gel filtration column and labeled with FITC as described above. 12A shows a concentration-dependent binding of F ₂ FITC-HS-biotin to the SA-coated plates. Binding reached plateau when 1 μg / well of F ₂ FITC-HS-biotin was used. For the heparanase test, 0.5 μg / well of F ₂ FITC-HS-biotin was used. A heparanase-dependent cleavage of the bound F ₂ FITC-HS on the SA-coated plates is in 12B shown.

Streptavidin (10 μg / ml in PBS, 40 μl / well) was used to coat 384-well solid black "reinforcing surface" microtiter plates (Becton Dickinson) overnight at 4 ° C. Plates were incubated with 1% BSA in PBS ( 40 μl / well) for one hour at 37 ° C (or overnight at 4 ° C) and washed with TBS (50 μl / well, three times) F ₂ FITC-HS-Biotin (40 μl / well, 12.5%) TBS was added to the plates and incubated for one hour at 37 ° C. The plates were washed with TBS Since the biotin / SA interaction is extremely strong (Kd = 10 ^-16 M), very few agents (eg, biotin-like agents) would be able to block the interaction, the crude heparanase (1 μl of "100kxg-sup" containing 5 μg total protein in lysis buffer) or the purified heparanase (20ng) diluted with 40 μl of assay buffer (50 mM sodium acetate, pH 5.4, 0.2 mg / ml BSA, 5 mM N-acetylmannosamine), added to each well and incubated at 37 ° C for 25 minutes. 1 M Tris-HCl, pH 8.0, (5 μl / well) was added and 35 μl / well of the solution transferred to a microtiter plate and the fluorescence measured (excitation at 470 nm and emission at 535 nm).

Example 14: Heparanase Assay using Eu-HS-biotin on SA-coated plates (Eu-HS-biotin / SA test)

Biotin-HS was labeled with Eu (DTPA) ITC. The binding of Eu-HS-biotin to SA-coated plates is in 13A This is similar to that of F ₂ FITC-HS-biotin. Also, a heparanase-dependent cleavage is similar to that of F ₂ FITC-HS-biotin ( 13B ).

The Plates were streptavidin coated and blocked with BSA, as described above. The Eu-HS biotin (40 μl / well, 7.5 μg / ml) in 1% BSA, TBS was added to the plates and added for one hour Incubated at 37 ° C. The plates were washed with TBS. The crude heparanase (1 μl of "100kxg-sup" from Example 2, containing 5 μg Total protein in lysis buffer) or the purified heparanase (20 ng) was 40 μl Test buffer diluted (50 mM sodium acetate, pH 5.4, 0.2 mg / ml BSA, 5 mM N-acetylmannosamine), added to each well and incubated at 37 ° C for 25 minutes. 1 M Tris-HCl, pH 8.0, (5 μl / well) added and 8 μl / well the solution transferred to a microtiter plate, the 60 μl / well containing the "enhancement solution." The time-resolved fluorescence was through a Victor-2 reader measured.

Medium, which has been demonstrated by the Eu-HS / FGF screening tests, that they have the ability to inhibit heparanase were tested in this test (Eu-HS-biotin-SA). The results showed that the IC50 values were similar in both tests (Results not shown).

Example 15: TRF Heparanase Assay using Eu-HS as a substrate on FGF-coated plates

To develop a TRF assay for heparanase, HS was labeled with Eu-chelate (DTPA) ITC. 11A shows a concentration-dependent binding of Eu-HS to FGF-coated plates. The binding reaches a plateau at 20 ng / well of Eu-HS. Eu-HS (15 ng / well) was incubated with the FGF-coated plates and washed well with TBS, the bound Eu-HS was digested with heparanase. 11B shows a time-dependent cleavage of Eu-HS by the purified heparanase. After 30 minutes, the signal-to-background ratio reached 8.0.

Example 16: Determination of the IC50 value

For the determination of the IC 50 value of agents in which heparanase inhibitory activity had been detected, the agents were dissolved in DMSO at a concentration of 10 mM. An aliquot (4 μl) was further diluted with DMSO (16 μl) to a concentration of 2 mM. A dilution series of 1: 3 dilutions in DMSO was performed to give a concentration range of 0.1 μM to 2 mM. Each sample was further diluted 25-fold with assay buffer. Then aliquots (30 μl / well) were added to the test plates containing the immobilized substrates. Thereafter, an aliquot (20 ng / 10 μl / well) of the purified heparanase was added and the plates incubated at 37 ° C for 20-30 minutes. The reactions were stopped by the addition of 1.0 M Tris-HCl, pH 8.0, (5 μl / well). The signals were quantitated by reading either the fluorescence or TRF on a Victor-2 reader. The percent inhibition of heparanase catalytic activity by an agent at various concentrations was calculated by the following formula:
% Inhibition = 100 * [1 - (F _s -F _b ) / (F _{t -Fb} )], where F _{s represents} the fluorescence signal of the sample containing the agent, F _b the fluorescence signal in the absence of heparanase and agent _{Ft represents} the fluorescent signal in the presence of heparanase but without means.

Example 17: Kinetic analysis

A mechanical analysis of means for which it was determined that they have the heparanase activity in the FGF / labeled heparanase substrate assay of the present invention by measuring heparanase activity at various concentrations of labeled HS in the presence of the agent. Typically were different concentrations of labeled HS on the test plates immobilized. The heparanase solutions (with or without agent) were then added to the wells (40 μl / well), the different concentrations of immobilized labeled HS and incubated plates at 37 ° C for 25 minutes. The reactions were prepared by adding 1.0 M Tris-HCl, pH 8.0, (5 μl / well). stopped and measured the mark remotely. Subsequently were the heparanase activities the reaction solutions, which contained no agent, and the heparanase inhibitory activities of Mean quantified.

The Heparanase activity without inhibitor and with different concentrations of an inhibitor analyzed by double-reciprocal representation of 1 / v versus 1 / s, where v is the reaction rate and s is the substrate concentration is. Subsequently becomes the inhibitory mechanism (competitive, non-competitive, uncompetitive or mixed) of an inhibitor by the slope and position (X- and Y-axis) of the curves obtained at the various inhibitory concentrations were obtained.

Example 18: F ₂ FITC-HS (or FITC-HS) as substrate for the heparanase

In the heparanase assay using F ₂ FITC-HS (or FITC-HS) as substrate on FGF-be coated slabs (Example 9), the cleavage products were analyzed by gel filtration FPLC analysis. Toyoshima reported that FITC-HS is a substrate when the molar ratio of FITC to HS is less than 1.0 (Toyoshima, M., and Nakamjima, M., (1999), Human heparanase purification, characterization, cloning and expresssion, J. Biol. Chem. 274, 24153-24160). HS was labeled with F ₂ FITC at a molar ratio of 0.6. (The molar ratio of FITC would be the same.) To confirm that it is a heparanase substrate, the cleavage products were analyzed by gel filtration (Superose 6) -FPLC ( 1A ). For comparison, [ ³ H] -HS was also cleaved as substrate with heparanase and the products were analyzed by FPLC ( 1B ). In both cases, the cleavage products eluted at the same positions, indicating that both FITC-HS and [ ³ H] -HS are substrates for heparanase.

Example 19: Binding of F ₂ FITC-HS to FGF-coated plates

The binding of F ₂ FITC-HS to various concentrations of FGF (oligomeric form) coated on 384-well microtiter plates was investigated. 2 shows that binding reached plateau when the plates were coated with an FGF concentration of 18.75 μg / ml (or 0.75 μg / 40 μl / well). In addition, the results show that the F ₂ FITC-HS binding was higher when the FGF was coated at pH 7.5 instead of pH 9.5. When the same experiment was performed using the monomeric FGF (the form reduced by DTT), the binding was lower. It is not clear whether the observed lower binding was due to a low coating efficiency or to a low binding affinity of the monomeric FGF (MW ~ 16 k). It was found that the F ₂ FITC-HS binding was higher when the FGF was coated on Costar "high binding" plates than when coated on the "regular" plates. 3 shows a concentration-dependent binding of F ₂ FITC-HS to FGF coated at the concentration of 18.75 μg / ml. Binding reached a plateau when 0.1 to 0.2 μg / well of F ₂ FITC-HS was used.

Example 20: Heparanase cleavage of F ₂ FITC-HS on FGF-coated plates

F ₂ FITC-HS was bound to FGF-coated plates and cleaved with the "100kxg-sup" from transfected CHO cells (Example 2) 4 the fluorescence intensity in the medium increased compared to the lysis buffer, indicating that F ₂ FITC-HS fragments were released into the medium during heparanase cleavage. In the control, when bound F ₂ FITC-HS was incubated with the "100kxg-sup" from non-transfected cells, no significant increase in fluorescence was observed Heparanase-dependent cleavage of F ₂ FITC-HS is known to occur in 5 shown. The fluorescence intensity released into the medium increased proportionally as increasing amounts of heparanase were used.

Example 21: Measured fluorescence intensity due to heparanase cleavage of F ₂ FITC-HS

To confirm that the fluorescence intensity detected in the medium was due to heparanase cleavage of F ₂ FITC-HS, four series of experiments were performed. First, the cleavage products of heparanase cleavage in the medium were analyzed by Superose 6 FPLC ( 6 ). The fluorescent material eluted more slowly than that of intact F ₂ FITC-HS, indicating that these were F ₂ FITC-HS fragments generated by the heparanase reaction. Second, a time-dependent heparanase cleavage of F ₂ FITC-HS was performed. The extent of hydrolysis was registered by the release of cleaved fragments into the medium leaving the non-cleaved material on the plate. As in 7 As can be seen, the fluorescence intensity in the supernatant during cleavage increased while the fluorescence intensity associated with the plate decreased, indicating that the intact F ₂ FITC-HS was cleaved and released into the medium. Third, heparanase activity was measured in the "100kxg-sup" at various pHs to find that the optimal pH for the activity was 5.1 ( 8th This agrees with the published results (Freeman, C., and Parish, C., (1998), Human platelet heparanase: Purification, characterization and catalytic activity, Biochem J. 330, 1341-1350). Fourth, the F ₂ FITC-HS was cleaved with the purified heparanase. A concentration-dependent cleavage curve was found which was similar to the curve in FIG 4 ,

Further Information regarding the figures are as follows:

1 : Analysis of heparanase-cleaved products by Superose 6 FPLC

• (A) F ₂ FITC-HS (20 μl, 1.9 mg / ml) was diluted with 80 μl of 50 mM sodium acetate, pH 5.0, 0.1 mg / ml BSA and 5 mM N-acetylmannosamine. An aliquot (20 μl) was incubated with the heparanase expressed by transfected CHO cells, ie "100kxg-sup" (5 μl in lysis buffer as described in Example 2) for 20 hours split at 37 ° C. The sample was then diluted with PBS and loaded on a Superose 6 FPLC in PBS at a flow rate of 0.25 ml / min. applied. Collected was 0.5 ml per fraction. An aliquot (25 μl) was taken from each fraction and transferred to a 384 well microtiter plate for fluorescence determination.
• (B) ³ H-labeled HS (20 μl, 2.6 mg / ml) was diluted with the buffer as described in (A). An aliquot (20 μl) was digested with heparanase and the products analyzed by Superose 6 FPLC as described in (A). The radioactivity in each fraction was measured by a scintillation counter.

2 : FGF concentration-dependent coating at two different pH values

FGF (1.81 mg / ml) was diluted to various concentrations with either PBS (pH 7.5) or 50 mM Na ₂ CO ₃ and 100 mM NaCl (pH 9.5) (2.5 μg / ml to 50 ug / ml). Aliquots (40 μl / well) were coated on 384-well microtiter plates (Costar solid black "tie-down" plates) overnight at 4 ° C. The plates were blocked with 1% BSA in PBS for 1 hour at 37 ° C F ₂ FITC-HS (1.5 μg / well / 40 μl in PBS, 1% BSA, 0.02% Tween 20) was added and incubated for one hour at 37 ° C. The plates were washed with PBS / 0 , 02% Tween 20. Then, bound material was eluted from the plates with 0.1% SDS in PBS and quantified by fluorescence intensity, FU is a fluorescence unit measured by the Victor-2 reader.

3 : F ₂ FITC-HS concentration-dependent binding to FGF-coated plates

FGF (18.75 μg / ml in PBS) was coated on 384-well plates (40 μl / well) at 4 ° C overnight and blocked with 1% BSA / PBS. Various amounts (0.012 to 0.375 μg / 40 μl / well) of F ₂ FITC-HS in PBS, 1% BSA, 0.02% Tween 20 were added and incubated for one hour at 37 ° C. The plates were washed with PBS / 0.02% Tween 20. The bound material was eluted with 0.1% SDS in PBS and quantitated by measuring fluorescence.

4 : Heparanase activity from the expressed product of transfected CHO cells

FGF was coated on microtiter plates and incubated with F ₂ FITC-HS as described. The bound F ₂ FITC-HS was treated with the "100kxg-sup" sample from transfected or non-transfected CHO cells (1 μl of sample in lysis buffer diluted with 40 μl of assay buffer in each well) for 30 minutes at 37 ° C Control, bound F ₂ FITC-HS was also treated with the lysis buffer (1 μl of lysis buffer diluted with 40 μl of assay buffer in each well) Reactions were monitored by 1.0 M Tris-HCl, pH 8.0, (5 μl / well). Aliquots (35 μl / well) were taken for the determination of the fluorescence.

5 Heparanase concentration-dependent cleavage of F ₂ FITC-HS on FGF-coated plates

The F ₂ FITC-HS / FGF assay was performed as described except that different amounts of heparanase in "100kxg-sup" from transfected CHO cells were used.

6 : Superose 6-FPLC analysis of fission products in the F ₂ FITC-HS / FGF assay

The F ₂ FITC-HS / FGF assay using the crude heparanase was performed as described. After cleavage, the reaction mixture was loaded in medium (140 μl, combined from four wells) onto a Superose 6 FPLC in PBS. The fractions were collected and the fluorescence intensity in each fraction as in 1 described determined. As a control, intact F ₂ FITC-HS was also applied to a Superose 6 FPLC and analyzed.

7 : Time course of heparanase cleavage

The F ₂ FITC-HS / FGF assay was performed using the crude heparanase as described. At various times of cleavage, 1.0 M Tris-HCl pH 8.0 was added to the wells (5 μl / well) to quench the reactions. The supernatant was taken by fluorescence measurement for the analysis of the cleaved F ₂ FITC-HS fragments (o). Uncleaved F ₂ FITC-HS remaining on the plates was extracted by 0.1% SDS in PBS and analyzed by fluorescence measurement (Δ).

8th : pH dependence of heparanase activity

FGF was coated on microtiter plates and incubated with F ₂ FITC-HS as described. The crude heparanase was diluted in 50 mM citric acid-Na ₂ HPO ₄ buffer at various pHs (3.6 to 7.0) containing 0.2 mg / ml BSA and 5 mM N-acetylmannosamine. Subsequently, the heparanase reaction was carried out at different pH's for one hour at 37 ° C. In addition, bound F ₂ FITC-HS was incubated with buffer at various pH (no heparanase) and used as background. Heparanase activity was calculated after subtraction of background fluorescence.

9 : Signal and background of the F ₂ FITC-HS / FGF test on a Zeiss-uHTS

The F ₂ FITC-HS / FGF assay was run for screening for inhibitors on a Zeiss uHTS system. For each 394-well assay plate, columns 1 and 2 contained only the assay buffer (ie no heparanase and no test compounds). The mean fluorescence intensity from these wells was taken as a "background." The wells in columns 3 and 4 contained the heparanase, but no test compounds, and the average fluorescence intensity from these wells was taken as a "total signal." These two values were used to calculate the percent inhibition by a specific compound (the test compounds were placed in the wells of columns 5 through 24). To test the quality of the survey, the "total signal" and "background" were plotted from the screened panels. The X-axis represents the plate number and the Y-axis the fluorescence intensity. If the "total signal" for a particular plate is higher or lower than the mean plus or minus twice the standard deviation (M +/- 2 σ) retested this plate.

10 : Z'-factor of the F ₂ FITC-HS / FGF test on the Zeiss-uHTS

The Z 'factor was calculated from each test plate by the formula: Z'-factor = 1 - 3 (σ _T + σ _B ) / (m _T -m _B ) where m _T = the mean of the total signal (the pits in columns 3 and 4), m _B = average of the background (the wells in columns 1 and 2), σ _T = the standard deviation of the total signal and σ _B = the standard deviation of the background. To determine the quality of the survey, the Z'-factors of the plates were plotted. The X axis represents the plate number and the Y axis represents the Z 'factor. If the Z' factor for a particular plate was lower than the mean minus two times the standard deviation (M - 2 σ), the plate became retested. The Z 'values ranging from about 0.3 to 0.7 show agreement and reproducibility of the test.

11 : (A) Eu-HS binding to FGF-coated plates

plates 384 wells were FGF coated (0.75 μg / 40 μl / well), then followed a blockage with BSA as described. After that, the plates became incubated with different amounts of Eu-HS for one hour at 37 ° C and washed with TBS. Subsequently the bound Eu-HS was incubated with 0.1% SDS / TBS (40 μl / well) from the plates eluted. An aliquot (8 μl) was taken and for mix the TRF measurement with 60 μl of "boost solution".

(B) Heparanase concentration dependent Cleavage of Eu-HS on FGF-coated plates

Of the Eu-HS / FGF test was performed as described except that different amounts of the purified heparanase were used.

12 : (A) F ₂ FITC-HS-biotin binding to SA-coated plates

384-well plates were coated with SA followed by blocking with BSA as described. Subsequently, the plates were incubated with various amounts of F ₂ FITC-HS-biotin for one hour at 37 ° C and washed with TBS. Thereafter, the bound F ₂ FITC-HS-biotin was eluted from the plates with 0.1 SDS / TBS (40 μl / well) and fluorescence was measured.

(B) heparanase-dependent cleavage of F ₂ FITC-HS-biotin on SA-coated plates

The F ₂ FITC HS biotin / SA assay was performed as described except that different amounts of the purified heparanase were used.

13A : (A) Eu-HS-biotin binding to SA-coated plates

plates 384 wells were coated with SA followed by blocking followed with BSA as described. Subsequently, the plates were with various amounts of Eu-HS-biotin incubated for one hour at 37 ° C and washed with TBS. Thereafter, the bound Eu-HS-biotin with 0.1% SDS / TBS (40 μl / well) eluted from the plates. An aliquot (8 μl) was taken and for TRF measurement mixed with 60 μl "reinforcing solution".

(B) Heparanase concentration dependent Cleavage of Eu-HS-biotin on SA-coated plates

Of the Eu-HS biotin / SA test was performed as described except that different amounts of the purified heparanase were used.

sequence Listing

Claims (13)

A method of assaying an agent for its ability to inhibit the heparanase catalytic activity, comprising the steps of: (a) interacting a solid support-immobilized heparanase substrate-binding protein with a labeled heparanase substrate to produce an immobilized labeled heparanase Substrate is provided, (b) interacting with a heparanase enzyme solution with the immobilized labeled heparanase substrate in the presence of the agent, and (c) detecting the presence or absence of the label in the solution away from the solid support, thereby determining whether the agent possesses the ability or not to inhibit heparanase, wherein the heparanase substrate-binding protein is selected from fibroblast growth factor FGF, VEGF and PDGF. The method of claim 1, wherein the mark of the labeled heparanase substrate at least one molecule is that of fluorescent, radioactive, chemiluminescent and chromogenic molecules is selected. The method of claim 2, wherein the fluorophores Fluorescein, lanthanide chelate and Eu (DPTA) chelate. The method of claim 3, wherein the fluorescein selected from FITC and F2FITC is. The method of claim 3, wherein the lanthanide chelate of europium chelate, samarium chelate, terbium chelate and dysprosium chelate selected is. The method of claim 5, wherein the lanthanide chelate an eu chelate is. A method according to any one of claims 1 to 6, wherein the heparanase substrate of the labeled heparanase substrate from heparan sulfate, heparan sulfate proteoglycan and heparan sulfate analogs is. The method of claim 7, wherein the heparanase substrate Heparan sulfate is. A method according to any one of claims 1 to 8, wherein the heparanase substrate binds Protein is FGF. A method of testing one according to the methods of the claims 1 to 9 tested agent with the ability to catalyze the activity of heparanase to inhibit his ability to the binding between the fibroblast growth factor FGF and the heparanase substrate to inhibit, comprising the following steps: (a) Interact in solution on a solid support immobilized FGF with the agent and the labeled heparanase substrate, and (b) evidence of the presence or absence of Mark in the solution away from the solid support, whereby it is determined whether the agent has the ability or not has, the binding between the fibroblast growth factor and the heparanase substrate to inhibit. Use of the methods according to claims 1 to 10 for the identification of inhibitors of the catalytic activity of heparanase. Use of the method according to claim 10 for identification inhibitors of binding between the FGF and the heparanase substrate. Kit, contain the components necessary to carry out the Process according to the claims 1 to 9 are required, selected from the group that has a solid support, a heparanase substrate-binding protein immobilized on the solid support or can be immobilized, a labeled heparanase substrate and heparanase.