EP0815137A1 - Human g-protein chemokine receptor hdgnr10 - Google Patents

Human g-protein chemokine receptor hdgnr10

Info

Publication number
EP0815137A1
EP0815137A1 EP95921613A EP95921613A EP0815137A1 EP 0815137 A1 EP0815137 A1 EP 0815137A1 EP 95921613 A EP95921613 A EP 95921613A EP 95921613 A EP95921613 A EP 95921613A EP 0815137 A1 EP0815137 A1 EP 0815137A1
Authority
EP
European Patent Office
Prior art keywords
polypeptide
receptor
compound
dna
polynucleotide
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP95921613A
Other languages
German (de)
French (fr)
Other versions
EP0815137A4 (en
Inventor
Yi Li
Steven M. Ruben
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Human Genome Sciences Inc
Original Assignee
Human Genome Sciences Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Human Genome Sciences Inc filed Critical Human Genome Sciences Inc
Priority to EP01108492A priority Critical patent/EP1146122A3/en
Priority to EP01108495A priority patent/EP1148127A3/en
Priority to EP01108494A priority patent/EP1145721A3/en
Priority to EP01108493A priority patent/EP1149582A3/en
Priority to EP01108496A priority patent/EP1146055A3/en
Priority to EP01108491A priority patent/EP1148126A3/en
Publication of EP0815137A1 publication Critical patent/EP0815137A1/en
Publication of EP0815137A4 publication Critical patent/EP0815137A4/en
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/715—Receptors; Cell surface antigens; Cell surface determinants for cytokines; for lymphokines; for interferons
    • C07K14/7158—Receptors; Cell surface antigens; Cell surface determinants for cytokines; for lymphokines; for interferons for chemokines
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2799/00—Uses of viruses
    • C12N2799/02—Uses of viruses as vector
    • C12N2799/021—Uses of viruses as vector for the expression of a heterologous nucleic acid
    • C12N2799/026—Uses of viruses as vector for the expression of a heterologous nucleic acid where the vector is derived from a baculovirus

Definitions

  • This invention relates to newly identified polynucleotides, polypeptides encoded by such polynucleotides, the use of such polynucleotides and t polypeptides, as well as the production of such polynucleotides and polypeptides. More particularly, the polypeptide of the present invention is a human 7- transmembrane receptor which has been putatively identified as a chemokine receptor, sometimes hereinafter referred to as "G-Protein Chemokine Receptor" or "HDGNRIO”. The invention also relates to inhibiting the action of such polypeptides.
  • proteins participating in signal transduction pathways that involve G-proteins and/or second messengers, e.g., cAMP (Lefkowitz, Nature, 351:353-354 (1991)).
  • these proteins are referred to as proteins participating in pathways with G-proteins or PPG proteins.
  • Some examples of these proteins include the GPC receptors, such as those for adrenergic agents and dopamine (Kobilka, B.K., et al., PNAS, 84:46-50 (1987); Kobilka, B.K., et al., Science, 238:650-656 (1987); Bunzow, J.R.
  • G-proteins themselves, effector proteins, e.g., phospholipase C, adenyl cyclase, and phosphodiesterase, and actuator proteins, e.g., protein kinase A and protein kinase C (Simon, M.I., et al., Science, 252:802-8 (1991)).
  • effector proteins e.g., phospholipase C, adenyl cyclase, and phosphodiesterase
  • actuator proteins e.g., protein kinase A and protein kinase C (Simon, M.I., et al., Science, 252:802-8 (1991)).
  • the effect of hormone binding is activation of an enzyme, adenylate cyclase, inside the cell.
  • Enzyme activation by hormones is dependent on the presence of the nucleotide GTP, and GTP also influences hormone binding.
  • a G-protein connects the hormone receptors to adenylate cyclase. G- protein was shown to exchange GTP for bound GDP when activated by hormone receptors. The GTP-carrying form then binds to an activated adenylate cyclase. Hydrolysis of GTP to GDP, catalyzed by the G-protein itself, returns the G- protein to its basal, inactive form.
  • the G-protein serves a dual role, as an intermediate that relays the signal from receptor to effector, and as a clock that controls the, duration of the signal.
  • G-protein coupled receptors The membrane protein gene superfamily of G-protein coupled receptors has been characterized as having seven putative transmembrane domains. The domains are believed to represent transmembrane of-helices connected by extracellular or cytoplasmic loops. G-protein coupled receptors include a wide range of biologically active receptors, such as hormone, viral, growth factor and neuroreceptors.
  • G-protein coupled receptors have been characterized as including these seven conserved hydrophobic stretches of about 20 -to 30 amino acids, connecting at least eight divergent hydrophilic loops.
  • the G-protein family of coupled receptors includes dopamine receptors which bind to neuroleptic drugs used for treating psychotic and neurological disorders.
  • G-protein coupled receptors can be intraceilularly coupled by heterotrimeric G-proteins to various intracellular enzymes, ion channels and transporters (see, Johnson et al . , Endoc, Rev., 10:317-331 (1989)).
  • G-protein o;- subunits preferentially stimulate particular effectors to modulate various biological function ⁇ in a cell.
  • Phosphorylation of cytoplasmic residues of G-protein coupled receptors have been identified as an important mechanism for the regulation of G-protein coupling of some G-protein coupled receptors.
  • G-protein coupled receptors are found in numerous sites within a mammalian host.
  • Chemokines also referred to as intercrine cytokines, are a subfamily of structurally and functionally related cytokines. These molecules are 8-10 kd in size. In general, chemokines exhibit 20% to 75% homology at the amino acid level and are characterized by four conserved cysteine ⁇ residues that form two disulfide bonds. Based on the arrangement of the first two cysteine residues, chemokines have been classified into two subfamilies, alpha and beta. In the alpha subfamily, the first two cysteine ⁇ are separated by one amino acid and hence are referred to as the "C-X-C" subfamily. In the beta subfamily; the two cysteines are in an adjacent position and are, therefore, referred to a ⁇ the "C-C n subfamily. Thus far, at least nine different members of thi ⁇ family have been identified in humans.
  • the intercrine cytokines exhibit a wide variety of functions. A hallmark feature is their ability to elicit chemotactic migration of distinct cell types, including monocyte ⁇ , neutrophils, T lymphocytes, basophils and fibroblasts. Many chemokines have proinflammatory activity and are involved in multiple steps during an inflammatory reaction. These activities include stimulation of histamine release, lysosomal enzyme and leukotriene release, increased adherence of target immune cells to endothelial cell ⁇ , enhanced binding of complement proteins, induced expression of granulocyte adhesion molecules and complement receptors, and respiratory burst. In addition to their involvement in inflammation, certain chemokines have been ⁇ hown to exhibit other activitie ⁇ .
  • macrophage inflammatory protein 1 i ⁇ able to ⁇ uppress hematopoietic stem cell proliferation
  • platelet factor-4 PF-4
  • IL-8 Interleukin-8 promote ⁇ proliferation of keratinocyte ⁇
  • GRO an autocrine growth factor for melanoma cells.
  • chemokine ⁇ have been implicated in a number of phy ⁇ iological and di ⁇ ea ⁇ e condition ⁇ , including lymphocyte trafficking, wound healing, hematopoietic regulation and immunological di ⁇ order ⁇ ⁇ uch as allergy, asthma and arthritis.
  • novel mature receptor polypeptides as well a ⁇ biologically active and diagno ⁇ tically or therapeutically useful fragments, analogs and derivatives thereof.
  • the receptor polypeptides of the present invention are of human origin.
  • nucleic acid molecules encoding the receptor polypeptides of the pre ⁇ ent invention, including mRNAs, DNAs, cDNA ⁇ , genomic DNA a ⁇ well a ⁇ an isense - analog ⁇ thereof and biologically active and diagno ⁇ tically or therapeutically useful fragments thereof.
  • proces ⁇ e ⁇ for producing ⁇ uch receptor polypeptide ⁇ by recombinant techniques comprising culturing recombinant prokaryotic and/or eukaryotic host cells, containing nucleic acid sequence ⁇ encoding the receptor polypeptide ⁇ of the pre ⁇ ent invention, under condition ⁇ promoting expre ⁇ ion of ⁇ aid polypeptides and sub ⁇ equent recovery of ⁇ aid polypeptides.
  • antibcdie ⁇ against such receptor polypeptide ⁇ there are provided.
  • processe ⁇ of administering compounds to a host which bind to and activate the receptor polypeptide of the pre ⁇ ent invention which are useful in stimulating haematopoiesi ⁇ , wound healing, coagulation, angiogene ⁇ i ⁇ , to treat solid tumors, chronic infections, leukemia, T-cell mediated auto-immune diseases, parasitic infections, psoriasis, and to stimulate growth, factor activity.
  • processes of administering compounds to a host which bind to and inhibit activation of the receptor polypeptides of the present invention which are useful in the prevention and/or treatment of allergy, atherogene ⁇ i ⁇ , anaphylaxi ⁇ , malignancy, chronic and acute inflammation, hi ⁇ tamine and IgE-mediated allergic reaction ⁇ , prostaglandin-independent fever, bone marrow failure, silicosis, sarcoidosi ⁇ , rheumatoid arthriti ⁇ , ⁇ hock and hyper-eo ⁇ inophilic ⁇ yndrome.
  • nucleic acid probes comprising nucleic acid molecules of sufficient length to ⁇ pecifically hybridize to the polynucleotide sequences of the present invention.
  • diagnostic assays for detecting diseases related to mutations in the nucleic acid sequences encoding such polypeptides and for detecting an altered level of the ⁇ oluble form of the receptor polypeptides.
  • proce ⁇ ses for utilizing such receptor polypeptides, or polynucleotides encoding such polypeptide ⁇ , for in vitro purpo ⁇ e ⁇ related to ⁇ cientific re ⁇ earch, ⁇ ynthe ⁇ is of DNA and manufacture of DNA vectors.
  • Figure 1 shows the cDNA sequence and the corresponding deduced amino acid sequence of the G-protein coupled receptor of the present invention.
  • Figure 2 illustrates an amino acid alignment of the G- protein chemokine receptor of the present invention and the human MCP-1 receptor.
  • nucleic acid which encode ⁇ for the mature polypeptide having the deduced amino acid sequence of Figure 1 (SEQ ID NO:2) or for the mature polypeptide encoded by the cDNA of the clone depo ⁇ ited a ⁇ ATCC Depo ⁇ it No. on June 1, 1995.
  • the polynucleotide of this invention was di ⁇ covered in a cDNA library derived from human monocyte ⁇ . It is structurally related to the G protein-coupled receptor family. It contains an open reading frame encoding a protein of 352 amino acid residues. The protein exhibits the highest degree of homology to a human MCP-1 receptor with 70.1 % identity and 82.9 % similarity over a 347 amino acid stretch.
  • the polynucleotide of the present invention may be in the form of RNA or in the form of DNA, which DNA includes cDNA, genomic DNA, and ⁇ ynthetic DNA.
  • the DNA may be double- ⁇ tranded or single- ⁇ tranded, and if single stranded may be the coding strand or non-coding (anti-sense) strand.
  • the coding ⁇ equence which encode ⁇ the mature polypeptide may be identical to the coding ⁇ equence ⁇ hown in Figure 1 (SEQ ID NO:l) or that of the depo ⁇ ited clone or may be a different coding sequence which coding ⁇ equence, a ⁇ a result of the redundancy or degeneracy of the genetic code, encode ⁇ th ⁇ ame mature polypeptide a ⁇ the DNA of Figure l (SEQ ID NO:l) > ⁇ or the deposited cDNA.
  • the polynucleotide which encode ⁇ for the mature polypeptide of Figure 1 or for the mature polypeptide encoded by the deposited cDNA may include: only the coding sequence for the mature polypeptide; the coding sequence for the mature polypeptide and additional coding sequence such as a tran ⁇ membrane (TM) or intra-cellular domain; the coding ⁇ equence for the mature polypeptide (and optionally additional coding sequence) and non-coding sequence, ⁇ uch as introns or non-coding sequence 5' and/or 3' of the coding sequence for the mature polypeptide.
  • TM tran ⁇ membrane
  • polynucleotide encoding a polypeptide encompasses a polynucleotide which includes only coding ⁇ equence for the polypeptide a ⁇ well a ⁇ a polynucleotide which include ⁇ additional coding and/or non-coding ⁇ equence.
  • the pre ⁇ ent invention further relate ⁇ to variant ⁇ of the hereinabove described polynucleotides which encode for fragments, analog ⁇ and derivative ⁇ of the polypeptide having the deduced amino acid sequence of Figure 1 or the polypeptide encoded by the cDNA of the deposited clone.
  • the variant of the polynucleotide may be a naturally occurring allelic variant of the polynucleotide or a non-naturally occurring variant of the polynucleotide.
  • the present invention includes polynucleotides encoding the same mature polypeptide as shown in Figure 1 (SEQ ID NO:2) or the same mature polypeptide encoded by the cDNA of the deposited clone as well a ⁇ variant ⁇ of ⁇ uch polynucleotides which variants encode for a fragment, derivative or analog of the polypeptide of Figure 1 (SEQ ID NO:2) or the polypeptide encoded by the cDNA of the depo ⁇ ited clone.
  • nucleotide variant ⁇ include deletion variant ⁇ , substitution variants and addition or in ⁇ ertion variant ⁇ .
  • the polynucleotide may have a coding ⁇ equence which i ⁇ a naturally occurring allelic variant of the coding ⁇ equence ⁇ hown in Figure l (SEQ ID* N0:1) or of the coding ⁇ equence of the deposited clone.
  • an allelic variant is an alternate form of a polynucleotide sequence which may have a substitution, deletion or addition of one or more nucleotides, which doe ⁇ not ⁇ ubstantially alter the function of the encoded polypeptide.
  • the polynucleotides may also encode for a soluble form of the G-protein chemokine receptor polypeptide which is the extracellular portion of the polypeptide which ha ⁇ been cleaved from the TM and intracellular domain of the full- length polypeptide of the present invention.
  • the polynucleotides of the present invention may also have the coding sequence fused in frame to a marker sequence which allows for purification of the polypeptide of the present invention.
  • the marker sequence may be a hexa- hi ⁇ tidine tag ⁇ upplied by a pQE-9 vector to provide for purification of the mature polypeptide fu ⁇ ed to the marker in the ca ⁇ e of a bacterial ho ⁇ t, or, for example, the marker ⁇ equence may be a hemagglutinin (HA) tag when a mammalian host, e.g. COS-7 cells, is used.
  • the HA tag corresponds to an epitope derived from the influenza hemagglutinin protein (Wilson, I., et al., Cell, 37:767 (1984)).
  • gene means the segment of DNA involved in producing a polypeptide chain; it includes regions preceding and following the coding region (leader and trailer) as well as intervening sequence ⁇ (intron ⁇ ) between individual coding segments (exons) .
  • Fragment ⁇ of the full length gene of the pre ⁇ ent invention may be u ⁇ ed a ⁇ a hybridization probe for a cDNA library to i ⁇ olate the full length cDNA and to isolate other cDNA ⁇ which have a high sequence similarity to the gene or similar biological activity.
  • Probes of thi ⁇ type preferably have at least 30 base ⁇ and may contain, for example, 50 or more base ⁇ .
  • the probe may al ⁇ o be used to identify a cDNA clone corresponding to a full length transcript and a genomic L clone or clones that contain the complete gene including regulatory and promotor region ⁇ , exon ⁇ , and introns.
  • An example of a screen comprises isolating the coding region of the gene by using the known DNA sequence to ⁇ ynthe ⁇ ize an oligonucleotide probe.
  • Labeled oligonucleotides having a ⁇ equence complementary to that of the gene of the pre ⁇ ent invention are used to screen a library of human cDNA, genomic DNA or mRNA to determine which member ⁇ of the library the probe hybridize ⁇ to.
  • the - pre ⁇ ent invention further relates to polynucleotides which hybridize to the hereinabove-described sequences if there is at least 70%, preferably at least 90%, and more preferably at least 95% identity between the sequences.
  • the present invention particularly relates to polynucleotides which hybridize under ⁇ tringent condition ⁇ to the hereinabove-de ⁇ cribed polynucleotide ⁇ .
  • ⁇ tringent condition ⁇ mean ⁇ hybridization will occur only if there i ⁇ at lea ⁇ t 95% and preferably at lea ⁇ t 97% identity between the ⁇ equences.
  • polypeptides which hybridize to the hereinabove described polynucleotides in a preferred embodiment encode polypeptides which either retain sub ⁇ tantially the same biological function or activity as the mature polypeptide encoded by the cDNAs of Figure l (SEQ ID N0:1) or the deposited cDNA( ⁇ ) .
  • the polynucleotide may have at lea ⁇ t 20 bases, preferably 30 base ⁇ , and more preferably at lea ⁇ t 50 base ⁇ which hybridize to a polynucleotide of the present invention and which ha ⁇ an identity thereto, a ⁇ hereinabove described, and which may or may not retain activity.
  • such polynucleotides may be employed as probes for the polynucleotide of SEQ ID NO:l, for example, for recovery of the polynucleotide or as a diagnostic probe or a ⁇ a PCR primer.
  • the present invention is directed to polynucleotides having at lea ⁇ t a 70% identity, preferably at lea ⁇ t 90% and more preferably at least a 95% identity to a polynucleotide which encode ⁇ the polypeptide of SEQ ID NO:2 as well a ⁇ fragments thereof, which fragments have at least 30 bases and preferably at least 50 base ⁇ and to polypeptide ⁇ encoded by such polynucleotides.
  • the deposi (s) referred to herein will be maintained under the terms of the Budapest Treaty on the International Recognition of the Deposit of Micro-organisms for purposes of Patent Procedure. These deposit ⁇ are provided merely a ⁇ convenience to tho ⁇ e of ⁇ kill in the art and are not an admi ⁇ sion that a deposit is required under 35 U.S.C. ⁇ 112.
  • the sequence of the polynucleotides contained in the depo ⁇ ited material ⁇ , as well a ⁇ the amino acid sequence of the polypeptides encoded thereby, are incorporated herein by reference and are controlling in the event of any conflict with any description of sequence ⁇ herein.
  • a licen ⁇ e may be required to make, or ⁇ ell the depo ⁇ ited materials, and no such licen ⁇ e is hereby granted.
  • the present invention further relate ⁇ to a G-protein chemokine receptor polypeptide which has the deduced amino acid sequence of Figure 1 (SEQ ID NO:2) or which ha ⁇ the amino acid ⁇ equence encoded by the depo ⁇ ited cDNA, as well as fragments, analogs and derivative ⁇ of such polypeptide.
  • fragment when referring to the polypeptide of Figure 1 or that encoded by the depo ⁇ ited cDNA, means a polypeptide which either retains substantially the same biological function or activity as ⁇ uch polypeptide, i.e. functions as a G-protein chemokine receptor, or retains the ability to bind the ligand or the receptor even though the polypeptide does not function as a G-protein chemokine receptor, for example, a soluble form of the receptor.
  • An analog includes a proprotein which can be activated by cleavage of the proprotein portion to produce an active mature polypeptide.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide or a synthetic polypeptide, preferably a recombinant polypeptide.
  • the fragment, derivative or analog of the polypeptide of Figure 1 (SEQ ID NO:2) or that encoded by the deposited cDNA may be (i) one in which one or more of the amino acid re ⁇ idues are sub ⁇ tituted with a conserved or non-conserved amino acid residue (preferably a conserved amino acid residue) and ⁇ uch ⁇ ub ⁇ tituted amino acid re ⁇ idue may or may not be one encoded by the genetic code, or ⁇ ii) one in which one or more of the amino acid residues includes a substituent group, or (iii) one in which the mature polypeptide is fused with another compound, such a ⁇ a compound to increa ⁇ e the half-life of the polypeptide (for example, polyethylene glycol) , or (iv) one in which the additional amino acid ⁇ are fused to the mature polypeptide for purification of the polypeptide or (v) one in which a fragment of the polypeptide is soluble, i.e. not
  • polypeptides and polynucleotides of the present invention are preferably provided in an isolated form, and preferably are purified to homogeneity.
  • polypeptides of the pre ⁇ ent invention include the polypeptide of SEQ ID NO:2 (in particular the mature polypeptide) as well as polypeptides which have at lea ⁇ t 70% ⁇ imilarity (preferably a 70% identity) to the polypeptide of SEQ ID NO:2 and more preferably a 90% similarity (more preferably a 90% identity) to the polypeptide of SEQ ID NO:2 and still more preferably a 95% similarity (still more preferably a 90% identity) to the polypeptide of SEQ ID NO:2 and to portions of such polypeptide with such portion of the polypeptide generally containing at least 30 amino acids and more preferably at least 50 amino acids.
  • Fragments or portion ⁇ of the polypeptide ⁇ of the pre ⁇ ent invention may be employed for producing the corre ⁇ ponding full-length polypeptide by peptide ⁇ ynthe ⁇ i ⁇ , therefore, the fragme ts may be employed as intermediates for producing the full-length polypeptide ⁇ .
  • Fragment ⁇ or portion ⁇ of the polynucleotide ⁇ of the pre ⁇ ent invention may be u ⁇ ed to ⁇ ynthe ⁇ ize full-length polynucleotides of the present invention.
  • gene means the segment of DNA involved in producing a polypeptide chain; it includes regions preceding and following the coding region "leader and trailer” as well a ⁇ intervening ⁇ equences (introns) between individual coding segments (exons) .
  • isolated means that the material is removed from its original environment (e.g., the natural environment if it is naturally occurring) .
  • a naturally- occurring polynucleotide or polypeptide present in a living animal is not isolated, but the same polynucleotide or polypeptide, separated from some or all of the coexisting materials in the natural system, is isolated.
  • Such polynucleotides could be part of a vector and/or such polynucleotide ⁇ or polypeptide ⁇ could be part of a compo ⁇ ition, and ⁇ till be isolated in that such vector or composition is not part of its natural environment.
  • polypeptides of the present invention include the polypeptide of SEQ ID NO:2 (in particular the mature polypeptide) as well a ⁇ polypeptides which have at least 70% similarity (preferably at least 70% identity) to the polypeptide of SEQ ID NO:2 and more preferably at lea ⁇ t 90% ⁇ imilarity (more preferably at least 90% identity) to the polypeptide of SEQ ID NO:2 and ⁇ till more preferably at least 95% similarity (still more preferably at least 95% identity) to the polypeptide of SEQ ID NO:2 and also include portions of such polypeptides with such portion of the polypeptide generally containing at least 30 amino acids and more preferably at least 50 amino acids.
  • Fragments or portions of the polypeptides of the present invention may be employed for producing the corresponding full-length polypeptide by peptide synthesi ⁇ ; therefore, the fragments may be employed as intermediates for producing the full-length polypeptides. Fragments or portions of the polynucleotides of the present invention may be used to synthesize full-length polynucleotides of the present invention.
  • the present invention also relates to vectors which include polynucleotides of the present invention, ho ⁇ t cell ⁇ which are genetically engineered with vectors of the invention and the production of polypeptides of the invention by recombinant techniques.
  • Host cells are genetically engineered (transduced or transformed or tran ⁇ fected) with the vector ⁇ of this invention which may be, for example, a cloning vector or an expres ⁇ ion vector.
  • the vector may be, for example, in the form of a pla ⁇ mid, a viral particle, a phage, etc.
  • the engineered ho ⁇ t cell ⁇ can be cultured in conventional nutrient media modified a ⁇ appropriate for activating promoters, selecting transformants or amplifying the genes of the present invention.
  • the culture conditions such a ⁇ temperature, pH and the like, are those previously used with the host cell selected for expres ⁇ ion, and will be apparent to the ordinarily skilled artisan.
  • the polynucleotides of the present invention may be employed for producing polypeptides by recombinant technique ⁇ . Thu ⁇ , for example, the polynucleotide may be included in any one of a variety of expre ⁇ ion vector ⁇ for expre ⁇ sing a polypeptide.
  • Such vectors include chromosomal, nonchromosomal and synthetic DNA sequence ⁇ , e.g., derivative ⁇ of SV40; bacterial pla ⁇ mid ⁇ ; phage DNA; baculoviru ⁇ ; yea ⁇ t pla ⁇ mid ⁇ ; vectors derived from combinations of plasmids and phage DNA, viral DNA such a ⁇ vaccinia, adenovirus, fowl pox virus, and pseudorabie ⁇ .
  • any other vector may be used as long as it is replicable and viable in the ho ⁇ t.
  • the appropriate DNA sequence may be inserted into the vector by a variety of procedures.
  • the DNA sequence is inserted into an appropriate restriction endonuclease ⁇ ite( ⁇ ) by procedure ⁇ known in the art.
  • procedure ⁇ and other ⁇ are deemed to be within the ⁇ cope of tho ⁇ e skilled in the art.
  • the DNA sequence in the expression vector is operatively linked to an appropriate expression control sequence(s) (promoter) to direct mRNA synthesis.
  • promoters there may be mentioned: LTR or SV40 promoter, the E. coli. lac or trp, the phage lambda P L promoter and other promoters known to control expression of genes in prokaryotic or eukaryotic cells or their viruses.
  • the expression vector also contains a ribosome binding site for translation initiation and a tran ⁇ cription terminator.
  • the vector may also include appropriate sequence ⁇ for amplifying expre ⁇ ion.
  • the expre ⁇ ion vector ⁇ preferably contain one or more selectable marker genes to provide a phenotypic trait for selection of transformed host cells such as dihydrofolate reductase or neomycin resistance for eukaryotic cell culture, or such a ⁇ tetracycline or ampicillin re ⁇ istance in E. coli.
  • the vector containing the appropriate DNA sequence as hereinabove described, as well as an appropriate promoter or control sequence, may be employed to transform an appropriate host to permit the host to express the protein.
  • bacterial cells such as E. coli. Streptomyces. Salmonella typhimurium ⁇ • fungal cells, such as yea ⁇ t; insect cells ⁇ uch a ⁇ Dro ⁇ ophila and Spodoptera Sf9; animal cells such as CHO, COS or Bowe ⁇ melanoma; adenovirus; plant cell ⁇ , etc.
  • Salmonella typhimurium ⁇ • fungal cells such as yea ⁇ t
  • insect cells ⁇ uch a ⁇ Dro ⁇ ophila and Spodoptera Sf9
  • animal cells such as CHO, COS or Bowe ⁇ melanoma
  • adenovirus adenovirus
  • the present invention also includes recombinant construct ⁇ compri ⁇ ing one or more of the sequences a ⁇ broadly de ⁇ cribed above.
  • the con ⁇ truct ⁇ compri ⁇ e a vector, such as a plasmid or viral vector, into which a sequence of the invention has been inserted, in a forward or reverse orientation.
  • the construct further comprises regulatory sequence ⁇ , including, for example, a promoter, operably linked to the ⁇ equence.
  • suitable vectors and promoter ⁇ are known to those of skill in the art, and are commercially available. The following vectors are provided by way of example.
  • Eukaryotic pWLNEO, pSV2CAT, pOG44, pXTl, pSG (Stratagene) pSVK3, pBPV, pMSG, pSVL (Pharmacia) .
  • any other plasmid or vector may be used as long a ⁇ they are replicable and viable in the ho ⁇ t.
  • Promoter region ⁇ can be ⁇ elected from any de ⁇ ired gene using CAT (chloramphenicol transfera ⁇ e) vector ⁇ or other vectors with selectable markers.
  • Two appropriate vectors are PKK232-8 and PCM7.
  • Particular named bacterial promoters include lad, lacZ, T3, T7, gpt, lambda P R , P L and trp.
  • Eukaryotic promoter ⁇ include CMV immediate early, HSV thymidine kinase, early and late SV40, LTRs from retrovirus, and mouse metallothionein-I. Selection of the appropriate vector and promoter is well within the level of ordinary skill in the art.
  • the present invention relates to host cells containing the above-described constructs.
  • the host cell can be a higher eukaryotic cell, such as a mammalian cell, or a lower eukaryotic cell, such a ⁇ a yea ⁇ t cell, or the ho ⁇ t cell can be a prokaryotic cell, such as a bacterial cell.
  • Introduction of the construct into the ho ⁇ t cell can be effected by calcium pho ⁇ phate tran ⁇ fection, DEAE- Dextran mediated tran ⁇ fection, or electroporation. (Davis, L., Dibner, M., Battey, I., Basic Method ⁇ in Molecular Biology, (1986)).
  • the con ⁇ truct ⁇ in ho ⁇ t cell ⁇ can be used in a conventional manner to produce the gene product encoded by the recombinant sequence.
  • the polypeptides of the invention can be synthetically produced by conventional peptide synthesizers.
  • Mature proteins can be expressed in mammalian cells, yeast, bacteria, or other cells under the control of appropriate promoters.
  • Cell-free translation ⁇ ystems can also be employed to produce such proteins using RNAs derived from the DNA construct ⁇ of the present invention.
  • Appropriate cloning and expression vectors for use with prokaryotic and eukaryotic host ⁇ are de ⁇ cribed by Sambrook, et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor, N.Y., (1989), the di ⁇ clo ⁇ ure of which i ⁇ hereby incorporated by reference.
  • Enhancers are cis-acting element ⁇ of DNA, usually about from 10 to 300 bp that act on a promoter to increase its transcription. Examples including the SV40 enhancer on the late side of the replication origin bp 100 to 270, a cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers.
  • recombinant expression vectors will include origins of replication and selectable markers permitting transformation of the host cell, e.g., the ampicillin resistance gene of E. coli and S. cerevisiae TRPl gene, and a promoter derived from a highly-expressed gene to direct transcription of a downstream structural sequence.
  • promoters can be derived from operons encoding glycolytic enzymes such a ⁇ 3-pho ⁇ phoglycerate kina ⁇ e (PGK) , ⁇ -factor, acid phosphata ⁇ e, or heat shock proteins, among others.
  • the heterologous ⁇ tructural sequence is as ⁇ embled in appropriate pha ⁇ e with translation initiation and termination sequences, and preferably, a leader sequence capable of directing secretion of translated protein into the peripla ⁇ mic space or extracellular medium.
  • the heterologou ⁇ sequence can encode a fusion protein including an N-terminal identification peptide imparting desired characteristics, e.g., stabilization or simplified purification of expressed recombinant product.
  • Useful expres ⁇ ion vector ⁇ for bacterial use are constructed by inserting a structural DNA sequence encoding a desired protein together with suitable translation initiation and termination signals in operable reading phase with a functional promoter.
  • the vector will comprise one or more phenotypic selectable markers and an origin of replication to en ⁇ ure maintenance of the vector and to, if de ⁇ irable, provide amplification within the ho ⁇ t.
  • Suitable prokaryotic ho ⁇ ts for transformation include E. coli. Bacillus ⁇ ubtilis. Salmonella typhimurium and various specie ⁇ within the genera P ⁇ eudomonas, Streptomyce ⁇ , and Staphylococcu ⁇ , although other ⁇ may also be employed a ⁇ a matter of choice.
  • u ⁇ eful expre ⁇ sion vectors for bacterial u ⁇ e can compri ⁇ e a ⁇ electable marker and bacterial origin of replication derived from commercially available plasmids comprising genetic elements of the well known cloning vector pBR322 (ATCC 37017) .
  • cloning vector pBR322 ATCC 37017
  • Such commercial vectors include, for example, pKK223-3 (Pharmacia Fine Chemicals, Uppsala, Sweden) and GEMl (Promega Biotec, Madison, WI, USA) .
  • pBR322 "backbone" section ⁇ are combined with an appropriate promoter and the ⁇ tructural ⁇ equence to be expre ⁇ ed.
  • the ⁇ elected promoter is induced by appropriate means (e.g., temperature shift or chemical induction) and cells are cultured for an additional period.
  • Microbial cells employed in expression of proteins can be di ⁇ rupted by any convenient method, including freeze-thaw cycling, sonication, mechanical disruption, or use of cell lysing agents, such methods are well know to those ⁇ killed in the art.
  • mammalian cell culture sy ⁇ tem ⁇ can al ⁇ o be employed to express recombinant protein.
  • mammalian expres ⁇ ion system ⁇ include the COS-7 lines of monkey kidney fibroblasts, described by Gluzman, Cell, 23:175 (1981) , and other cell lines capable of expressing a compatible vector, for example, the C127, 3T3, CHO, HeLa and BHK cell lines.
  • Mammalian expres ⁇ ion vector ⁇ will comprise an origin of replication, a suitable promoter and enhancer, and also any necessary ribosome binding sites, polyadenylation site, splice donor and acceptor site ⁇ , transcriptional termination sequences, and 5' flanking nontranscribed sequences. DNA sequences derived from the SV40 splice, and polyadenylation sites may be used to provide the required nontranscribed genetic element ⁇ .
  • the G-protein chemokine receptor polypeptide ⁇ can be recovered and purified from recombinant cell culture ⁇ by method ⁇ including ammonium ⁇ ulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, pho ⁇ phocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography and lectin chromatography. Protein refolding ⁇ teps can be used, as necessary, in completing configuration of the mature protein. Finally, high performance liquid chromatography (HPLC) can be employed for final purification step .
  • HPLC high performance liquid chromatography
  • the polypeptide ⁇ of the pre ⁇ ent invention may be a naturally purified product, or a product of chemical synthetic procedures, or produced by recombinant technique ⁇ from a prokaryotic or eukaryotic ho ⁇ t (for example, by bacterial, yeast, higher plant, insect and mammalian cell ⁇ in culture) .
  • a prokaryotic or eukaryotic ho ⁇ t for example, by bacterial, yeast, higher plant, insect and mammalian cell ⁇ in culture
  • the polypeptides of the present invention may be glycosylated or may be non-glycosylated.
  • Polypeptides of the invention may also include an initial methionine amino acid re ⁇ idue.
  • polynucleotides and polypeptides of the present invention may be employed as research reagents and material ⁇ for di ⁇ covery of treatment ⁇ and diagno ⁇ tic ⁇ to human di ⁇ ease.
  • the G-protein chemokine receptors of the present invention may be employed in a proce ⁇ for ⁇ creening for compounds which activate (agonists) or inhibit activation (antagonist ⁇ ) of the receptor polypeptide of the pre ⁇ ent invention .
  • ⁇ uch ⁇ creening procedure ⁇ involve providing appropriate cell ⁇ which expre ⁇ the receptor polypeptide of the present invention on the surface thereof.
  • Such cells include cells from mammals, yeast, drosophila or E. Coli .
  • a polynucleotide encoding the receptor of the present invention is employed to transfect cells to thereby expres ⁇ the G-protein chemokine receptor.
  • the expressed receptor is then contacted with a test compound to ob ⁇ erve binding, ⁇ timulation or inhibition of a functional response.
  • such assay may be employed for screening for a compound which inhibits activation of the receptor polypeptide of the present invention by contacting the melanophore cells which encode the receptor with both the receptor ligand and a compound to be screened. Inhibition of the ⁇ ignal generated by the ligand indicate ⁇ that a compound i ⁇ a potential antagonist for the receptor, i.e., inhibits activation of the receptor.
  • the screen may be employed for determining a compound which activate ⁇ the receptor by contacting such cells with compounds to be screened and determining whether ⁇ uch compound generate ⁇ a signal, i.e., activates the receptor.
  • G-protein chemokine receptor for example, transfected CHO cell ⁇
  • Other screening techniques include the use of cells which express the G-protein chemokine receptor (for example, transfected CHO cell ⁇ ) in a system which measures extracellular pH changes cau ⁇ ed by receptor activation, for example, a ⁇ de ⁇ cribed in Science, volume 246, page ⁇ 181-296 (October 1989) .
  • compound ⁇ may be contacted with a cell which expre ⁇ e ⁇ the receptor polypeptide of the present invention and a second mes ⁇ enger response, e.g. signal transduction or pH changes, may be measured to determine whether the potential compound activates or inhibits the receptor.
  • a second mes ⁇ enger response e.g. signal transduction or pH changes
  • Another such ⁇ creening technique involves introducing _ RNA encoding the G-protein chemokine receptor into Xenopus oocytes to transiently express the receptor.
  • the receptor oocytes may then be contacted with the receptor ligand and a compound to be screened, followed by detection of inhibition or activation of a calcium signal in the case of ⁇ creening for compounds which are thought to inhibit activation of the receptor.
  • Another screening technique involves expressing the G- protein chemokine receptor in which the receptor is linked to a phospholipa ⁇ e C or D.
  • a phospholipa ⁇ e C or D As representative examples of such cells, there may be mentioned endothelial cells, smooth muscle cell ⁇ , embryonic kidney cells, etc.
  • the screening may be accomplished as hereinabove de ⁇ cribed by detecting activation of the receptor or inhibition of activation of the receptor from the pho ⁇ pholipase second signal.
  • Another method involve ⁇ ⁇ creening for compounds which inhibit activation of the receptor polypeptide of the present invention antagoni ⁇ t ⁇ by determining inhibition binding of labeled ligand to cells which have the receptor on the surface thereof.
  • Such a method involves tran ⁇ fecting a eukaryotic cell with DNA encoding the G-protein chemokine receptor such that the cell expresses the receptor on its surface and contacting the cell with a compound in the presence of a labeled form of a known ligand.
  • the ligand can be labeled, e.g., by radioactivity.
  • the amount of labeled ligand bound to the receptors is measured, e.g. , by measuring radioactivity of the receptors. If the compound binds to the receptor as determined by a reduction of labeled ligand which binds to the receptors, the binding of labeled ligand to the receptor is inhibited.
  • An antibody may antagonize a G-protein chemokine receptor of the present invention, or in some ca ⁇ es an oligopeptide, which bind to the G-protein chemokine receptor but does not elicit a ⁇ econd me ⁇ enger re ⁇ pon ⁇ e ⁇ uch that the activity of the G-protein chemokine receptors is prevented.
  • Antibodie ⁇ include anti-idiotypic antibodie ⁇ which recognize unique determinant ⁇ generally associated with the antigen- binding site of an antibody.
  • Potential antagonist compounds also include proteins which are closely related to the ligand of the G-protein chemokine receptors, i.e. a fragment of the ligand, which have lost biological function and when binding to the G-protein chemokine receptor elicit no response.
  • An antisense construct prepared through the use of antisen ⁇ e technology may be u ⁇ ed to control gene expression through triple-helix formation or antisense DNA or RNA, both of which methods are ba ⁇ ed on binding of a polynucleotide to DNA or RNA.
  • the 5' coding portion of the polynucleotide ⁇ equence, which encode ⁇ for the mature polypeptide ⁇ of the present invention is used to design an antisense RNA oligonucleotide of from about 10 to 40 base pairs in length.
  • a DNA oligonucleotide is designed to be complementary to a region of the gene involved in transcription (triple helix -see Lee et al., Nucl.
  • the antisen ⁇ e RNA oligonucleotide hybridize ⁇ to the mRNA in vivo and block ⁇ tran ⁇ lation of mRNA molecule ⁇ into G-protein coupled receptor (antisense - Okano, J. Neurochem. , 56:560 (1991) ; Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression, CRC Press, Boca Raton, FL (1988)) .
  • the oligonucleotides described above can also be delivered to cells such that the anti ⁇ en ⁇ e RNA or DNA may be expre ⁇ ed in vivo to inhibit production of G-protein chemokine receptor.
  • a ⁇ mall molecule which bind ⁇ to the G-protein chemokine receptor, making it inaccessible to ligands such that normal biological activity is prevented for example small peptides or peptide-like molecules, may also be used to inhibit activation of the receptor polypeptide of the present invention.
  • a soluble form of the G-protein chemokine receptor e.g. a fragment of the receptors, may be used to inhibit activation of the receptor by binding to the ligand to a polypeptide of the present invention and preventing the ligand from interacting with membrane bound G-protein chemokine receptors.
  • the compound ⁇ which bind to and activate the G-protein chemokine receptor ⁇ of the present invention may be employed to stimulate haematopoiesis, wound healing, coagulation, angiogenesis, to treat solid tumors, chronic infections, leukemia, T-cell mediated auto-immune disease ⁇ , para ⁇ itic infection ⁇ , p ⁇ oriasis, and to stimulate growth factor activity.
  • the compounds which bind to and inhibit the G-protein chemokine receptors of the present invention may be employed to treat allergy, atherogenesi ⁇ , anaphylaxis, malignancy, chronic and acute inflammation, histamine and IgE-mediated allergic reactions, prostaglandin-independent fever, bone _ _
  • compositions comprise a therapeutically effective amount of the compound and a pharmaceutically acceptable carrier or excipient.
  • a carrier includes but is not limited to saline, buffered saline, dextrose, water, glycerol, ethanol, and combinations thereof.
  • the formulation should suit the mode of administration.
  • the invention also provide ⁇ a pharmaceutical pack or kit compri ⁇ ing one or more container ⁇ filled with one or more of the ingredient ⁇ of the pharmaceutical compositions of the invention.
  • Associated Iwith such container(s) can be a notice in the form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which notice reflects approval by the agency of manufacture, use or sale for human admini ⁇ tration.
  • the compound ⁇ of the pre ⁇ ent invention may be employed in conjunction with other therapeutic compound ⁇ .
  • the pharmaceutical compo ⁇ itions may be administered in a convenient manner such as by the topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intrade ⁇ nal (applicable?) routes.
  • the pharmaceutical compositions are administered in an amount which is effective for treating and/or prophylaxis of the specific indication.
  • the pharmaceutical compositions will be administered in an amount of at least about 10 g/kg body weight and in most cases they will be administered in an amount not in exces ⁇ of about 8 g/Kg body weight per day.
  • the dosage is from about 10 ⁇ g/kg to about 1 mg/kg body weight daily, taking into account the routes of administration, symptoms, etc. (CONFIRM DOSAGES)
  • G-protein chemokine receptor polypeptide ⁇ and antagonists or agonist ⁇ which are polypeptide ⁇ may al ⁇ o be employed in accordance with the present invention by expression of such polypeptides in vivo, which is often referred to as "gene therapy.”
  • cells from a patient may be engineered with a polynucleotide (DNA or RNA) encoding a polypeptide ex vivo, with the engineered cell ⁇ then being provided to a patient to be treated with the polypeptide.
  • a polynucleotide DNA or RNA
  • cell ⁇ may be engineered by procedures known in the art by use of a retroviral particle containing RNA encoding a polypeptide of the present invention.
  • cells may be engineered in vivo for expression of a polypeptide in vivo by, for example, procedures known in the art.
  • a producer cell for producing a retroviral particle containing RNA encoding the polypeptide of the present invention may be administered to a patient for engineering cell ⁇ in vivo and expression of the polypeptide in vivo.
  • the expression vehicle for engineering cells may be other than a retrovirus, for example, an adenovirus which may be used to engineer cells in vivo after combination with a suitable delivery vehicle.
  • Retroviruses from which the retroviral plasmid vectors hereinabove mentioned may be derived include, but are not limited to, Moloney Murine Leukemia Virus, spleen necrosis virus, retroviruses such a ⁇ Rous Sarcoma Virus, Harvey Sarcoma Virus, avian leukosi ⁇ virus, gibbon ape leukemia viru ⁇ , human immunodeficiency virus, adenovirus, Myeloproliferative Sarcoma Virus, and mammary tumor viru ⁇ .
  • the retroviral plasmid vector is derived from Moloney Murine Leukemia Virus.
  • the vector includes one or more promoters .
  • Suitable promoters which may be employed include, but are not limited to, the retroviral LTR; the SV40 promoter; and the human cytomegalovirus (CMV) promoter described in Miller, et al., Biotechni ⁇ ues. Vol. 7, No. 9, 980-990 (1989) , or any other promoter (e.g., cellular promoters such as eukaryotic cellular promoters including, but not limited to, the histone, pol III, and 0-actin promoters) .
  • Other viral promoters which may be employed include, but are not limited to, adenovirus promoters, thymidine kinase (TK) promoters, and B19 parvovirus promoters. The selection of a ⁇ uitable promoter will be apparent to those skilled in the art from the teachings contained herein.
  • Suitable promot e rs which may be employed include, but are not limited to, adenoviral promoters, such a ⁇ the adenoviral major late promoter; or hetorologou ⁇ promoters, such as the cytomegalovirus (CMV) promoter; the respiratory ⁇ yncytial viru ⁇ (RSV) promoter; inducible promoter ⁇ , such as the MMT promoter, the metallothionein promoter; heat shock promoters; the albumin promoter; the ApoAI promoter; human globin promoters,- viral thymidine kinase promoters, such as the Herpes Simplex thymidine kinase promoter,- retroviral LTRs (including the modified retroviral LTRs hereinabove described).,- the 3-actin promoter,- and human growth hormone promoters.
  • the promoter such as the cytomegalovirus (CMV) promoter; the respiratory ⁇ yncytial viru ⁇
  • the retroviral plasmid vector is employed to tran ⁇ duce packaging cell line ⁇ to form producer cell lines.
  • packaging cells which may be tran ⁇ fected include, but are not limited to, the PE501, PA317, ⁇ -2 , ⁇ -AM, PA12, T19-14X, VT-19-17-H2, i ⁇ CRE, ⁇ i-CRIP, GP+E-86, GP+envAml2, and DAN cell lines a ⁇ de ⁇ cribed in Miller, Human Gene Therapy. Vol. l, pg ⁇ . 5-14 (1990) , which is incorporated herein by reference in its entirety.
  • the vector may transduce the packaging cells through any means known in the art.
  • retroviral plasmid vector may be encapsulated into a liposome, or coupled to a lipid, and then administered to a host.
  • the producer cell line generates infectious retroviral vector particles which include the nucleic acid sequence(s) encoding the polypeptide ⁇ .
  • retroviral vector particle ⁇ then may be employed, to tran ⁇ duce eukaryotic cells, either in vitro or in vivo.
  • the transduced eukaryotic cells will express the nucleic acid sequence(s) encoding the polypeptide.
  • Eukaryotic cells which may be transduced include, but are not limited to, embryonic stem cells, embryonic carcinoma cells, as well as hematopoietic ⁇ tem cell ⁇ , hepatocytes, fibroblasts, myoblasts, keratinocytes, endothelial cells, and bronchial epithelial cells.
  • the present invention also provides a method for determining whether a ligand not known to be capable of binding to a G-protein chemokine receptor can bind to such receptor which comprises contacting a mammalian cell which expre ⁇ e ⁇ a G-protein chemokine receptor with the ligand under conditions permitting binding of ligands to the G- protein chemokine receptor, detecting the presence of a ligand which binds to the receptor and thereby determining whether the ligand binds to the G-protein chemokine receptor.
  • the systems hereinabove described for determining agonists and/or antagonists may also be employed for determining ligands which bind to the receptor.
  • Thi ⁇ invention al ⁇ o provides a method of detecting expression of a G-protein chemokine receptor polypeptide of the present invention on the surface of a cell by detecting the presence of mRNA coding for the receptor which comprises obtaining total mRNA from the cell and contacting the mRNA so obtained with a nucleic acid probe comprising a nucleic acid molecule of at least 10 nucleotides capable of specifically hybridizing with a sequence included within the sequence of a nucleic acid molecule encoding the receptor under hybridizing conditions, detecting the presence of mRNA hybridized to the probe, and thereby detecting the expression of the receptor by the cell.
  • the present invention also provides a method for identifying receptors related to the receptor polypeptides of the present invention. These related receptors may be identified by homology to a G-protien chemokine receptor polypeptide of the present invention, by low stringency cross hybridization, or by identifying receptors that interact with related natural or synthetic ligands and or elicit similar behaviors after genetic or pharmacological blockade of the chemokine receptor polypeptides of the present invention.
  • Probe ⁇ of thi ⁇ type are at least 20 bases, preferably at least 30 bases and most preferably at least 50 bases or more.
  • the probe may also be used to identify a cDNA clone corresponding to a full length transcript and a genomic clone or clones that contain the complete gene of the present invention including .regulatory and promoter regions, exons and introns.
  • An example of a ⁇ creen of thi ⁇ type comprises isolating the coding region of the gene by using the known DNA ⁇ equence to ⁇ ynthe ⁇ ize an oligonucleotide probe.
  • Labeled oligonucleotide ⁇ having a sequence complementary to that of the genes of the present invention are used to screen a library of human cDNA, genomic DNA or mRNA to determine which member ⁇ of the library the probe hybridize ⁇ to.
  • the pre ⁇ ent invention al ⁇ o contemplates the use of the genes of the present invention as a diagnostic, for example, some diseases result from inherited defective genes. • These genes can be detected by comparing the sequences of the defective gene with that of a normal one. Subsequently, one can verify that a "mutant" gene is as ⁇ ociated with abnormal receptor activity. In addition, one can insert mutant receptor genes into a suitable vector for expression in a functional assay system (e.g., colorimetric assay, expression on MacConkey plates, complementation experiments, in a receptor deficient strain of HEK293 cells) as yet another raean ⁇ to verify or identify mutations. Once "mutant" genes have been identified, one can then screen population for carriers of the "mutant" receptor gene.
  • a functional assay system e.g., colorimetric assay, expression on MacConkey plates, complementation experiments, in a receptor deficient strain of HEK293 cells
  • Nucleic acids used for diagnosi ⁇ may be obtained from a patient' ⁇ cells, including but not limited to such as from blood, urine, saliva, tissue biopsy and autopsy material.
  • the genomic DNA may be used directly for detection or may be amplified enzymatically by using PCR (Saiki, et al., Nature. 324:163-166 1986) prior to analysi ⁇ .
  • RNA or cDNA may al ⁇ o be u ⁇ ed for the same purpose.
  • PCR primers complimentary to the nucleic acid of the instant invention can be used to identify and analyze mutations in the gene of the pre ⁇ ent invention.
  • deletion ⁇ and insertions can be detected by a change in size of the amplified product in comparison to the normal genotype.
  • Point mutations can be identified by hybridizing amplified DNA to radio labeled RNA of the invention or alternatively, radio labeled anti ⁇ en ⁇ e DNA sequences of the invention. Perfectly matched sequence ⁇ can be di ⁇ tinguished from mismatched duplexes by RNase A digestion or by differences in melting temperatures. Such a diagnostic would be particularly useful for prenatal or even neonatal testing.
  • Sequence differences between the reference gene and "mutants" may be revealed by the direct DNA sequencing method.
  • cloned DNA segments may be used as pro b es to detect specific DNA segments.
  • the sensitivity of this method is greatly enhanced when combined with PCR.
  • a sequence primer is used with double stranded PCR product or a single stranded template molecule generated by a modified PCR.
  • the sequence determination is performed by conventional procedures with radio labeled nucleotide or b.. an automatic sequencing procedure with fluorescent-tags.
  • Genetic testing based on DNA sequence differences may be achieved by detection of alterations in the electrophoretic mobility of DNA fragments in gel ⁇ with or without denaturing agents. Sequences changes at specific locations may al ⁇ o be revealed by nucleu ⁇ protection a ⁇ says, ⁇ uch RNa ⁇ e and SI protection or the chemical cleavage method (e.g. Cotton, et al., PNAS. USA. 85:4397-4401 1985).
  • genes of the present invention can be used as a reference to identify individuals expre ⁇ ing a decrease of functions associated with receptors of this type.
  • the present invention also relates to a diagnostic a ⁇ ay for detecting altered levels of soluble forms of the G-proein chemokine receptor polypeptides of the present invention in various tis ⁇ ues.
  • Assays used to detect levels of the soluble receptor polypeptides in a sample derived from a host are well known to those of skill in the art and include radioimmunoassay ⁇ , competitive-binding assays, Western blot analysis and preferably as ELISA assay.
  • An ELISA assay initially comprises preparing an antibody specific to antigens of the G-protein chemokine receptor polypeptides, preferably a monoclonal antibody.
  • a reporter antibody i ⁇ prepared against the monoclonal antibody.
  • a detectable reagent such as radioactivity, fluorescence or in this example a hor ⁇ eradish peroxidase enzyme.
  • a sample is now removed from a host and incubated on a solid support, e.g. a polystyrene dish, that binds the proteins in the sample. Any free protein binding sites on the dish are then covered by incubating with a non-specific protein such as bovine serum albumin.
  • the monoclonal antibody is incubated in the dish during which time the monoclonal antibodies attach to any G-protein chemokine receptor proteins attached to the poly ⁇ tyrene dish. All unbound monoclonal antibody is washed out with buffer.
  • the reporter antibody linked to horseradish peroxidase is now placed in the di ⁇ h re ⁇ ulting in binding of the reporter antibody to any monoclonal antibody bound to G- protein chemokine receptor proteins. Unattached reporter antibody is then washed out.
  • Peroxidase substrates are then added to the dish and the amount of color developed in a given time period is a measurement of the amount of G-protein chemokine receptor proteins present in a given volume of patient ⁇ ample when compared again ⁇ t a standard curve.
  • the sequence ⁇ of the pre ⁇ ent invention are al ⁇ o valuable for chromo ⁇ ome identification.
  • the sequence is specifically targeted to and can hybridize with a particular location on an individual human chromosome.
  • Few chromosome marking reagents based on actual sequence data (repeat polymorphisms) are presently available for marking chromosomal location.
  • the mapping of DNAs to chromosomes according to the present invention is an important first step in correlating those sequences with genes a ⁇ sociated with disease.
  • sequences can be mapped to chromosome ⁇ by preparing PCR primer ⁇ (preferably 15-25 bp) from the cDNA.
  • Computer analy ⁇ i ⁇ of the cDNA is used to rapidly select primers that do not span more than one exon in the genomic DNA, thus complicating the amplification process.
  • These primers are then used for PCR screening of somatic cell hy b rids containing individual human chromosomes. Only.those hy b rids containing the human gene corresponding to the primer will yield an amplified fragment.
  • mapping of somatic cell hybrids is a rapid procedure for assigning a particular DNA to a particular chromosome.
  • sublocalization can be achieved with panels of fragments from specific chromosomes or pools of large genomic clones in an analogous manner.
  • Other mapping strategie ⁇ that can ⁇ imilarly be used to map to its chromosome include in situ hybridization, prescreening with labeled flow-sorted chromo ⁇ ome ⁇ and preselection by hybridization to construct chromosome specific-cDNA libraries.
  • Fluorescence in situ hybridization of a cDNA clone to a metaphase chromosomal spread can be used to provide a precise chromosomal location in one step.
  • This technique can be used with cDNA as short as 50 or 60 bases.
  • ⁇ ee Verma et al. Human Chromo ⁇ omes: a Manual of Basic Techniques, Pergamon Press, New York (1988) .
  • a cDNA precisely localized to a chromosomal region associated with the disease could be one of between 50 and 500 potential causative genes. (This assumes 1 megabase mapping resolution and one gene per 20 kb) .
  • the polypeptides, their fragments or other derivatives, or analogs thereof, or cells expressing them can be used as an immunogen to produce antibodies thereto.
  • These antibodies can be, for example, polyclonal or monoclonal antibodies.
  • the pre ⁇ ent invention al ⁇ o include ⁇ chimeric, ⁇ ingle chain, and humanized antibodies, as well as Fab fragments, or the product of an Fab expression library. Various procedures known in the art may be used for the production of such antibodies and fragments.
  • Antibodies generated against the polypeptides corre ⁇ ponding to a ⁇ equence of the present invention can be obtained by direct injection of the polypeptides into an animal or by administering the polypeptides to an animal, preferably a nonhuman. The antibody so obtained will then bind the polypeptides it ⁇ elf. In thi ⁇ manner, even a sequence encoding only a fragment, of the polypeptides can be used to generate antibodies binding the whole native polypeptides. Such antibodies can then be used to isolate the polypeptide from tis ⁇ ue expressing that polypeptide.
  • any technique which provides antibodies produced by continuous cell line cultures can be u ⁇ ed. Examples include the hybridoma technique (Kohler and Milstein, 1975, Nature, 256:495-497), the trioma technique, the human B-cell hybridoma technique (Kozbor et al., 1983, Immunology Today 4:72), and the EBV- hybridoma technique to produce human monoclonal antibodie ⁇ (Cole, et al., 1985, in Monoclonal Antibodie ⁇ and Cancer Therapy, Alan R. Li ⁇ s, Inc., pp. 77-96). Techniques described for the production of single chain antibodies (U.S. Patent 4,946,778) can be adapted to produce single chain antibodies to immunogenic polypeptide products of this invention. Also, tran?- , enic mice may be used to express humanized antibodies to immunogenic polypeptide products of this invention.
  • Plasmid ⁇ are de ⁇ ignated by a lower case p preceded and/or followed by capital letters and/or numbers.
  • the starting plasmids herein are either commercially available, publicly available on an unrestricted ba ⁇ is, or can be constructed from available plasmid ⁇ in accord with published procedures.
  • equivalent plasmids to those described are known in the art and will be apparent to the ordinarily skilled arti ⁇ an.
  • “Digestion” of DNA refers to catalytic cleavage of the DNA with a restriction enzyme that acts only at certain sequences in the DNA.
  • the various restriction enzymes used herein are commercially available and their reaction conditions, cofactors and other requirements were used as would be known to the ordinarily skilled artisan.
  • For analytical purpose ⁇ typically 1 ⁇ g of pla ⁇ mid or DNA fragment is used with about 2 units of enzyme in about 20 ⁇ l of buffer solution.
  • For the purpose of isolating DNA fragments for plasmid construction typically 5 to 50 ⁇ g of DNA are digested with 20 to 250 units of enzyme in a larger volume. Appropriate buffers and substrate amounts for particular restriction enzymes are specified by the manufacturer. Incubation times of about l hour at 37-°C are ordinarily used, but may vary in accordance with the supplier's instruction ⁇ . After digestion the reaction is electrophoresed directly on a polyacrylamide gel to isolate the desired fragment.
  • Size separation of the cleaved fragments is performed using 8 percent polyacrylamide gel de ⁇ cribed by Goeddel, D. et al . , Nucleic Acid ⁇ Re ⁇ ., 8:4057 (1980) .
  • Oligonucleotide ⁇ refers to either a single stranded polydeoxynucleotide or two complementary polydeoxynucleotide strands which may be chemically synthe ⁇ ized. Such ⁇ ynthetic oligonucleotides have no 5' phosphate and thus will not ligate to another oligonucleotide without adding a phosphate with an ATP in the presence of a kinase. A synthetic oligonucleotide will ligate to a fragment that has not been dephosphorylated.
  • Ligase refers to the proce ⁇ of forming pho ⁇ phodie ⁇ ter bond ⁇ between two double stranded nucleic acid fragments (Maniatis, T. , et al., Id., p. 146) . Unle ⁇ s otherwise provided, ligation may be accompli ⁇ hed u ⁇ ing known buffer ⁇ and conditions with 10 units to T4 DNA ligase ("ligase”) per 0.5 ⁇ g of approximately equimolar amounts of the DNA fragments to be ligated.
  • ligase T4 DNA ligase
  • the DNA sequence encoding for HDGNRlO, ATCC # _ is initially amplified using PCR oligonucleotide primers corresponding to the 5' and sequence ⁇ of the proces ⁇ ed HDGNRlO protein (minus the ⁇ ignal peptide ⁇ equence) and the vector sequences 3' to the HDGNRlO gene. Additional nucleotide ⁇ corre ⁇ ponding to HDGNRlO were added to the 5' and 3' ⁇ equences respectively.
  • the 5' oligonucleotide primer has the sequence 5' CGGAATTCCTCCATGGATTATCAAGTGTCA 3' contains an EcoRI restriction enzyme site followed by 18 nucleotides of HDGNRlO coding sequence starting from the presumed terminal amino acid of the processed protein codon.
  • the 3' sequence 5' CGGAAGCTTCGTCACAAGCCCACAGATAT 3' contains complementary sequences to a Hindlll site and is followed by 18 nucleotides of HDGNRlO coding sequence.
  • the restriction enzyme sites correspond to the restriction enzyme sites on the bacterial expres ⁇ ion vector pQE-9 (Qiagen, Inc. 9259 Eton Avenue, Chat ⁇ worth, CA, 91311) .
  • Ml5/rep4 contains multiple copies of the plasmid pREP4, which expre ⁇ e ⁇ the lad repre ⁇ or and al ⁇ o confer ⁇ kanamycin resistance (Kan r ) .
  • Transformant ⁇ are identified by their ability to grow on LB plates and ampicillin/kanamycin resistant colonies were selected. Plasmid DNA was isolated and confirmed by restriction analysi ⁇ .
  • Clone ⁇ containing the de ⁇ ired con ⁇ tructs were grown overnight (O/N) in liquid culture in LB media supplemented with both Amp (100 ug/ml) and Kan (25 ug/ml) .
  • the O/N culture is used to inoculate a large culture at a ratio of 1:100 to 1:250.
  • the cells were grown to an optical density 600 (O.D. 600 ) of between 0.4 and 0.6.
  • IPTG optical density 600
  • IPTG induces by inactivating the lad repressor, clearing the ?/0 leading to increased gene expres ⁇ ion.
  • Cells were grown an extra 3 to 4 hours. Cells were then harvested by centrifugation. The cell pellet was solubilized in the chaotropic agent 6 Molar Guanidine HCI. After clarification, solubilized HDGNRlO was purified from this solution by chromatography on a Nickel-Chelate column under conditions that allow for tight binding by proteins containing the 6-His tag. Hochuli, E. et al., J. Chromatography 411:177-184 (1984) .
  • HDGNRlO was eluted from the column in 6 molar guanidine HCI pH 5.0 and for the purpose of renaturation adjusted to 3 molar guanidine HCI, lOOmM sodium phosphate, 10 mmolar glutathione (reduced) and 2 mmolar glutathione (oxidized) . After incubation in this solution for 12 hours the protein was dialyzed to 10 mmolar sodium phosphate.
  • HDGNRlO HA The expression of plasmid, HDGNRlO HA is derived from a vector pcDNAI/Amp (Invitrogen) containing: 1) SV40 origin of replication, 2) ampicillin resi ⁇ tance gene, 3) E.coli replication origin, 4) CMV promoter followed by a polylinker region, a SV40 intron and polyadenylation ⁇ ite.
  • the HA tag correspond to an epitope derived from the influenza hemagglutinin protein as previously described (I. Wilson, H. Niman, R. Heighten, A Cherenson, M. Connolly, and R. Lerner, 1984, Cell 37, 767) .
  • the infusion of HA tag to the target protein allows easy detection of the recombinant protein with an antibody that recognizes the HA epitope.
  • the plasmid construction strategy is described as follows:
  • the DNA sequence encoding for HDGNRlO, ATCC # was constructed by PCR using two primers: the 5' primer 5' GTCC AAGCTTGCCACCATGGATTATCAAGTGTCA 3 ' and contains a Hindlll site followed by 18 nucleotides of HDGNRlO coding sequence starting from the initiation codon; the 3' sequence 5'
  • the PCR product contains complementary sequences to an Xhol site, translation stop codon, HA tag and the last 18 nucleotides of the HDGNRlO coding sequence (not including the stop codon) . Therefore, the PCR product contains a Hindlll ⁇ ite HDGNRlO coding ⁇ equence followed by HA tag fu ⁇ ed in frame, a translation termination stop codon next to the HA tag, and an Xhol site.
  • the PCR amplified DNA fragment and the vector, pcDNAI/Amp were digested with Hindlll and Xhol restriction enzyme and ligated. The ligation mixture was transformed into E.
  • HDGNRlO HA protein The expression of the HDGNRlO HA protein was detected by radiolabelling and immunoprecipitation method.
  • E. Harlow, D. Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, (1988) Cells were labelled for 8 hours with 35 S-cysteine two days post transfection. Culture media were then collected and cells were ly ⁇ ed with detergent (RIPA buffer (150 M NaCl, 1% NP-40, 0.1% SDS, 1% NP-40, 0.5% DOC, 50mM Tri ⁇ , pH 7.5) .
  • RIPA buffer 150 M NaCl, 1% NP-40, 0.1% SDS, 1% NP-40, 0.5% DOC, 50mM Tri ⁇ , pH 7.5
  • the DNA sequence encoding the full length HDGNRlO protein, ATCC # was amplified using PCR oligonucleotide primers corresponding to the 5' and 3 ' sequences of the gene-.
  • the 5' primer has the ⁇ equence 5' CGGGATCCCTCCATGGATTAT CAAGTGTCA 3' and contains a BamHI restriction enzyme site followed by 4 nucleotides resembling an efficient signal for the initiation of translation in eukaryotic cells (J. Mol. Biol. 1987, 196. 947-950, Kozak, M.) , and just behind the first 18 nucleotides of the HDGNRlO gene (the initiation codon for translation is "ATG”) .
  • the 3' primer has the sequence 5' CGGGATCCCGCT CACAAGCCCACAGATAT 3' and contains the cleavage site for the restriction endonuclea ⁇ e BamHI and 18 nucleotide ⁇ complementary to the 3' non-translated sequence of the HDGNRlO gene.
  • the amplified sequences were isolated from a 1% agarose gel using a commercially available kit ("Geneclean, " BIO 101 Inc., La Jolla, Ca.) . The fragment was then digested with the endonuclease BamHI and purified as described above. This fragment is de ⁇ ignated F2.
  • the vector pRGl (modification of pVL941 vector, discus ⁇ ed below) is used for the expression of the HDGNRlO protein using the baculovirus expression system (for review see: Summers, M.D. and Smith, G.E. 1987, A manual of methods for baculovirus vectors and insect cell culture procedures, Texas Agricultural Experimental Station Bulletin No. 1555) .
  • This expression vector contains the strong polyhedrin promoter of the Autographa californica nuclear polyhedrosis virus (AcMNPV) followed by the recognition sites for the restriction endonuclease BamHI .
  • the polyadenylation site of the simian virus (SV)40 is used for efficient polyadenylation.
  • the beta-galactosidase gene from E.coli is inserted in the same orientation as the polyhedrin promoter followed by the polyadenylation signal of the polyhedrin gene.
  • the polyhedrin sequence ⁇ are flanked at both sides by viral sequence ⁇ for the cell-mediated homologous recombination of co-transfected wild-type viral DNA.
  • Many other baculovirus vectors could be used in place of pRGl such as pAc373, pVL941 and pAcIMl (Luckow, V.A. and Summers, M.D., Virology, 170:31- 39) .
  • the DNA was then isolated from a 1% agarose gel as described above. This vector DNA is designated V2.
  • Fragment F2 and the dephosphorylated plasmid V2 were ligated with T4 DNA ligase.
  • E.coli HB101 cells were then transformed and bacteria identified that contained the plasmid (pBacHDGNRlO) with the HDGNRlO gene using the enzyme BamHI. The sequence of the cloned fragment was confirmed by DNA sequencing.
  • plaque assay performed similar as described by Summers and Smith (supra) .
  • an agarose gel with "Blue Gal” (Life Technologies Inc., Gaithersburg) was used which allows an easy isolation of blue stained plaques.
  • a detailed description of a "plaque assay” can also be found in the u ⁇ er's guide for insect cell culture and baculovirology distributed by Life Technologies Inc., Gaithersburg, page 9- 10) .
  • the viruse ⁇ were added to the cell ⁇ , blue ⁇ tained plaques were picked with the tip of an Eppendorf pipette.
  • the agar containing the recombinant viruse ⁇ was then resu ⁇ pended in an Eppendorf tube containing 200 ⁇ l of Grace's medium.
  • the agar was removed by a brief centrifugation and the supernatant containing the recombinant baculoviru ⁇ es was used to infect Sf9 cells ⁇ eeded in 35 mm di ⁇ he ⁇ .
  • the ⁇ upernatants of these culture dishes were harvested and then stored at 4°C.
  • Sf9 cells were grown in Grace's medium supplemented with 10% heat-inactivated FBS.
  • the cells were infected with the recombinant baculovirus V-HDGNR10 at a multiplicity of infection (MOD of 2.
  • MOD multiplicity of infection
  • the medium was removed and replaced with SF900 II medium minus methionine and cysteine (Life Technologies Inc., Gaithersburg). 42 hours later 5 ⁇ Ci of 3S S-methionine and 5 ⁇ Ci 35 S cysteine (Amer ⁇ ham) were added.
  • the cells were further incubated for 16 hours before they were harvested by centrifugation and the labelled proteins visualized by SDS-PAGE and autoradiography.
  • Fibroblasts are obtained from a subject by skin biopsy.
  • the resulting tissue is placed in tissue-culture medium and separated into small pieces. Small chunks of the tissue are placed on a wet surface of a tissue culture flask, approximately ten pieces are placed in each flask.
  • the flask is turned upside down, closed tight and left at room temperature over night. After 24 hours at room temperature, the flask is inverted and the chunks of tissue remain fixed to the bottom of the flask and fresh media (e.g., Ham's F12 media, with 10% FBS, penicillin and streptomycin, is added. This is then incubated at 37°C for approximately one week. At this time, fresh media is added and subsequently changed every several days.
  • fresh media e.g., Ham's F12 media, with 10% FBS, penicillin and streptomycin
  • pMV-7 (Kir ⁇ chmeier, P.T. et al, DNA, 7:219-25 (1988) flanked by the long terminal repeats of the Moloney murine sarcoma virus, is digested with EcoRI and Hindlll and subsequently treated with calf intestinal phosphata ⁇ e.
  • the linear vector is fractionated on agarose gel and purified, using glass beads.
  • the cDNA encoding a polypeptide of the present invention is amplified using PCR primers which correspond to the 5' and 3' end sequences respectively.
  • the 5' primer contains an EcoRI site
  • the 3' primer contains a Hindlll site.
  • Equal quantities of the Moloney murine sarcoma virus linear backbone and the EcoRI and Hindlll fragment are added together, in the presence of T4 DNA ligase.
  • the resulting mixture is maintained under conditions appropriate for ligation of the two fragments.
  • the ligation mixture is used to transform bacteria HB101, which are then plated onto agar- containing kanamycin for the purpose of confirming that the vector had the gene of interest properly inserted.
  • the amphotropic pA317 or GP+aml2 packaging cells are grown in tissue culture to confluent density in Dulbecco's Modified Eagles Medium (DMEM) with 10% calf serum (CS) , penicillin and streptomycin.
  • DMEM Dulbecco's Modified Eagles Medium
  • CS calf serum
  • penicillin and streptomycin The MSV vector containing the gene is then added to the media and the packaging cells are transduced with the vector.
  • the packaging cells now produce infectious viral particles containing the gene (the packaging cells are now referred to as producer cells) .
  • Fresh media is added to the transduced producer cell ⁇ , and ⁇ ub ⁇ equently, the media is harvested from a 10 cm plate of confluent producer cells.
  • the spent media containing the infectiou ⁇ viral particles, is filtered through a millipore filter to remove detached producer cells and this media is then used to infect fibroblast cells.
  • Media is removed from a sub-confluent plate of fibroblasts and quickly replaced with the media from the producer cells. This media is removed and replaced with fresh media. If the titer of viru ⁇ i ⁇ high, then virtually all fibroblasts will be infected and no selection is required. If the titer is very low, then it is neces ⁇ ary to u ⁇ e a retroviral vector that has a selectable marker, ⁇ uch as neo or his.
  • the engineered fibroblasts are then injected into the host, either alone or after having been grown to confluence on cytodex 3 microcarrier beads.
  • the fibroblast ⁇ now produce the protein product.
  • ADDRESSEE CARELLA, BYRNE, BAIN, GIL7ILLAN,
  • TELECOMMUNICATION INFORMATION (A) TELEPHONE: 201-994-1700 (B) "TELEFAX: 201-994-1744

Abstract

Human G-protein chemokine receptor polypeptides and DNA (RNA) encoding such polypeptides and a procedure for producing such polypeptides by recombinant techniques is disclosed. Also disclosed are methods for utilizing such polypeptides for identifying antagonists and agonists to such polypeptides and methods of using the agonists and antagonists therapeutically to treat conditions related to the underexpression and overexpression of the G-protein chemokine receptor polypeptides, respectively. Also disclosed are diagnostic methods for detecting a mutation in the G-protein chemokine receptor nucleic acid sequences and detecting a level of the soluble form of the receptors in a sample derived from a host.

Description

HUMAN G-PROTEIN CHEMOKINE RECEPTOR ΞDGNR10
This invention relates to newly identified polynucleotides, polypeptides encoded by such polynucleotides, the use of such polynucleotides andt polypeptides, as well as the production of such polynucleotides and polypeptides. More particularly, the polypeptide of the present invention is a human 7- transmembrane receptor which has been putatively identified as a chemokine receptor, sometimes hereinafter referred to as "G-Protein Chemokine Receptor" or "HDGNRIO". The invention also relates to inhibiting the action of such polypeptides.
It is well established that many medically significant biological processes are mediated by proteins participating in signal transduction pathways that involve G-proteins and/or second messengers, e.g., cAMP (Lefkowitz, Nature, 351:353-354 (1991)). Herein these proteins are referred to as proteins participating in pathways with G-proteins or PPG proteins. Some examples of these proteins include the GPC receptors, such as those for adrenergic agents and dopamine (Kobilka, B.K., et al., PNAS, 84:46-50 (1987); Kobilka, B.K., et al., Science, 238:650-656 (1987); Bunzow, J.R. , et al., Nature, 336:783-787 (1988)), G-proteins themselves, effector proteins, e.g., phospholipase C, adenyl cyclase, and phosphodiesterase, and actuator proteins, e.g., protein kinase A and protein kinase C (Simon, M.I., et al., Science, 252:802-8 (1991)).
For example, in one form of signal transduction, the effect of hormone binding is activation of an enzyme, adenylate cyclase, inside the cell. Enzyme activation by hormones is dependent on the presence of the nucleotide GTP, and GTP also influences hormone binding. A G-protein connects the hormone receptors to adenylate cyclase. G- protein was shown to exchange GTP for bound GDP when activated by hormone receptors. The GTP-carrying form then binds to an activated adenylate cyclase. Hydrolysis of GTP to GDP, catalyzed by the G-protein itself, returns the G- protein to its basal, inactive form. Thus, the G-protein serves a dual role, as an intermediate that relays the signal from receptor to effector, and as a clock that controls the, duration of the signal.
The membrane protein gene superfamily of G-protein coupled receptors has been characterized as having seven putative transmembrane domains. The domains are believed to represent transmembrane of-helices connected by extracellular or cytoplasmic loops. G-protein coupled receptors include a wide range of biologically active receptors, such as hormone, viral, growth factor and neuroreceptors.
G-protein coupled receptors have been characterized as including these seven conserved hydrophobic stretches of about 20 -to 30 amino acids, connecting at least eight divergent hydrophilic loops. The G-protein family of coupled receptors includes dopamine receptors which bind to neuroleptic drugs used for treating psychotic and neurological disorders. Other examples of members of thiε family include calcitonin, adrenergic, endothelin, cAMP, adenosine, muscarinic, acetylcholine, serotonin, histamine, thrombin, kinin, follicle stimulating hormone, opεins, endothelial differentiation gene-1 receptor and rhodopsins, odorant, cytomegalovirus receptors, etc. G-protein coupled receptors can be intraceilularly coupled by heterotrimeric G-proteins to various intracellular enzymes, ion channels and transporters (see, Johnson et al . , Endoc, Rev., 10:317-331 (1989)). Different G-protein o;- subunits preferentially stimulate particular effectors to modulate various biological functionε in a cell. Phosphorylation of cytoplasmic residues of G-protein coupled receptors have been identified as an important mechanism for the regulation of G-protein coupling of some G-protein coupled receptors. G-protein coupled receptors are found in numerous sites within a mammalian host.
Chemokines, also referred to as intercrine cytokines, are a subfamily of structurally and functionally related cytokines. These molecules are 8-10 kd in size. In general, chemokines exhibit 20% to 75% homology at the amino acid level and are characterized by four conserved cysteine < residues that form two disulfide bonds. Based on the arrangement of the first two cysteine residues, chemokines have been classified into two subfamilies, alpha and beta. In the alpha subfamily, the first two cysteineε are separated by one amino acid and hence are referred to as the "C-X-C" subfamily. In the beta subfamily; the two cysteines are in an adjacent position and are, therefore, referred to aε the "C-Cn subfamily. Thus far, at least nine different members of thiε family have been identified in humans.
The intercrine cytokines exhibit a wide variety of functions. A hallmark feature is their ability to elicit chemotactic migration of distinct cell types, including monocyteε, neutrophils, T lymphocytes, basophils and fibroblasts. Many chemokines have proinflammatory activity and are involved in multiple steps during an inflammatory reaction. These activities include stimulation of histamine release, lysosomal enzyme and leukotriene release, increased adherence of target immune cells to endothelial cellε, enhanced binding of complement proteins, induced expression of granulocyte adhesion molecules and complement receptors, and respiratory burst. In addition to their involvement in inflammation, certain chemokines have been εhown to exhibit other activitieε. For example, macrophage inflammatory protein 1 (MIP-1) iε able to εuppress hematopoietic stem cell proliferation, platelet factor-4 (PF-4) is a potent inhibitor of endothelial cell growth, Interleukin-8 (IL-8) promoteε proliferation of keratinocyteε, and GRO iε an autocrine growth factor for melanoma cells.
In light of the diverse biological activities, it iε not εurpriεing that chemokineε have been implicated in a number of phyεiological and diεeaεe conditionε, including lymphocyte trafficking, wound healing, hematopoietic regulation and immunological diεorderε εuch as allergy, asthma and arthritis.
In accordance with one aspect of the present invention, . there are provided novel mature receptor polypeptides as well aε biologically active and diagnoεtically or therapeutically useful fragments, analogs and derivatives thereof. The receptor polypeptides of the present invention are of human origin.
In accordance with another aspect of the present invention, there are provided isolated nucleic acid molecules encoding the receptor polypeptides of the preεent invention, including mRNAs, DNAs, cDNAε, genomic DNA aε well aε an isense - analogε thereof and biologically active and diagnoεtically or therapeutically useful fragments thereof.
In accordance with a further aspect of the present invention, there are provided procesεeε for producing εuch receptor polypeptideε by recombinant techniques comprising culturing recombinant prokaryotic and/or eukaryotic host cells, containing nucleic acid sequenceε encoding the receptor polypeptideε of the preεent invention, under conditionε promoting expreεεion of εaid polypeptides and subεequent recovery of εaid polypeptides. In accordance with yet a further aεpect of the preεent invention, there are provided antibcdieε against such receptor polypeptideε.
In accordance with another aspect of the present invention there are provided methods of screening for compounds which bind to and activate or inhibit activation of the receptor polypeptides of the present invention.
In accordance with still another embodiment of the present invention there are provided processeε of administering compounds to a host which bind to and activate the receptor polypeptide of the preεent invention which are useful in stimulating haematopoiesiε, wound healing, coagulation, angiogeneεiε, to treat solid tumors, chronic infections, leukemia, T-cell mediated auto-immune diseases, parasitic infections, psoriasis, and to stimulate growth, factor activity.
In accordance with another aspect of the present invention there is provided a method of administering the receptor polypeptides of the preεent invention via gene therapy to treat conditionε related to underexpreεεion of the polypeptides or underexpression of a ligand for the receptor polypeptide.
In accordance with still another embodiment of the present invention there are provided processes of administering compounds to a host which bind to and inhibit activation of the receptor polypeptides of the present invention which are useful in the prevention and/or treatment of allergy, atherogeneεiε, anaphylaxiε, malignancy, chronic and acute inflammation, hiεtamine and IgE-mediated allergic reactionε, prostaglandin-independent fever, bone marrow failure, silicosis, sarcoidosiε, rheumatoid arthritiε, εhock and hyper-eoεinophilic εyndrome.
In accordance with yet another aspect ofr.the present invention, there are provided nucleic acid probes comprising nucleic acid molecules of sufficient length to εpecifically hybridize to the polynucleotide sequences of the present invention.
In accordance with still another aspect of the present invention, there are provided diagnostic assays for detecting diseases related to mutations in the nucleic acid sequences encoding such polypeptides and for detecting an altered level of the εoluble form of the receptor polypeptides.
In accordance with yet a further aspect of the present invention, there are provided proceεses for utilizing such receptor polypeptides, or polynucleotides encoding such polypeptideε, for in vitro purpoεeε related to εcientific reεearch, εyntheεis of DNA and manufacture of DNA vectors.
These and other aspects of the present invention should be apparent to thoεe εkilled in the art from the teachingε herein.
The following drawingε are illuεtrative of embodimentε ' of the invention and are not meant to limit the scope of the invention as encompassed by the claims.
Figure 1 shows the cDNA sequence and the corresponding deduced amino acid sequence of the G-protein coupled receptor of the present invention. The standard one-letter abbreviation for amino acids iε uεed. Sequencing waε performed using a 373 Automated DNA sequencer (Applied Biosyεtems, Inc.) .
Figure 2 illustrates an amino acid alignment of the G- protein chemokine receptor of the present invention and the human MCP-1 receptor.
In accordance with an aspect of the present invention, there is provided an isolated nucleic acid (polynucleotide) which encodeε for the mature polypeptide having the deduced amino acid sequence of Figure 1 (SEQ ID NO:2) or for the mature polypeptide encoded by the cDNA of the clone depoεited aε ATCC Depoεit No. on June 1, 1995.
The polynucleotide of this invention was diεcovered in a cDNA library derived from human monocyteε. It is structurally related to the G protein-coupled receptor family. It contains an open reading frame encoding a protein of 352 amino acid residues. The protein exhibits the highest degree of homology to a human MCP-1 receptor with 70.1 % identity and 82.9 % similarity over a 347 amino acid stretch.
The polynucleotide of the present invention may be in the form of RNA or in the form of DNA, which DNA includes cDNA, genomic DNA, and εynthetic DNA. The DNA may be double- εtranded or single-εtranded, and if single stranded may be the coding strand or non-coding (anti-sense) strand. The coding εequence which encodeε the mature polypeptide may be identical to the coding εequence εhown in Figure 1 (SEQ ID NO:l) or that of the depoεited clone or may be a different coding sequence which coding εequence, aε a result of the redundancy or degeneracy of the genetic code, encodeε th εame mature polypeptide aε the DNA of Figure l (SEQ ID NO:l) >■ or the deposited cDNA.
The polynucleotide which encodeε for the mature polypeptide of Figure 1 or for the mature polypeptide encoded by the deposited cDNA may include: only the coding sequence for the mature polypeptide; the coding sequence for the mature polypeptide and additional coding sequence such as a tranεmembrane (TM) or intra-cellular domain; the coding εequence for the mature polypeptide (and optionally additional coding sequence) and non-coding sequence, εuch as introns or non-coding sequence 5' and/or 3' of the coding sequence for the mature polypeptide.
Thus, the term "polynucleotide encoding a polypeptide" encompasses a polynucleotide which includes only coding εequence for the polypeptide aε well aε a polynucleotide which includeε additional coding and/or non-coding εequence.
The preεent invention further relateε to variantε of the hereinabove described polynucleotides which encode for fragments, analogε and derivativeε of the polypeptide having the deduced amino acid sequence of Figure 1 or the polypeptide encoded by the cDNA of the deposited clone. The variant of the polynucleotide may be a naturally occurring allelic variant of the polynucleotide or a non-naturally occurring variant of the polynucleotide.
Thus, the present invention includes polynucleotides encoding the same mature polypeptide as shown in Figure 1 (SEQ ID NO:2) or the same mature polypeptide encoded by the cDNA of the deposited clone as well aε variantε of εuch polynucleotides which variants encode for a fragment, derivative or analog of the polypeptide of Figure 1 (SEQ ID NO:2) or the polypeptide encoded by the cDNA of the depoεited clone. Such nucleotide variantε include deletion variantε, substitution variants and addition or inεertion variantε.
Aε hereinabove indicated, the polynucleotide may have a coding εequence which iε a naturally occurring allelic variant of the coding εequence εhown in Figure l (SEQ ID* N0:1) or of the coding εequence of the deposited clone. As known in the art, an allelic variant is an alternate form of a polynucleotide sequence which may have a substitution, deletion or addition of one or more nucleotides, which doeε not εubstantially alter the function of the encoded polypeptide.
The polynucleotides may also encode for a soluble form of the G-protein chemokine receptor polypeptide which is the extracellular portion of the polypeptide which haε been cleaved from the TM and intracellular domain of the full- length polypeptide of the present invention.
The polynucleotides of the present invention may also have the coding sequence fused in frame to a marker sequence which allows for purification of the polypeptide of the present invention. The marker sequence may be a hexa- hiεtidine tag εupplied by a pQE-9 vector to provide for purification of the mature polypeptide fuεed to the marker in the caεe of a bacterial hoεt, or, for example, the marker εequence may be a hemagglutinin (HA) tag when a mammalian host, e.g. COS-7 cells, is used. The HA tag corresponds to an epitope derived from the influenza hemagglutinin protein (Wilson, I., et al., Cell, 37:767 (1984)).
The term "gene" means the segment of DNA involved in producing a polypeptide chain; it includes regions preceding and following the coding region (leader and trailer) as well as intervening sequenceε (intronε) between individual coding segments (exons) .
Fragmentε of the full length gene of the preεent invention may be uεed aε a hybridization probe for a cDNA library to iεolate the full length cDNA and to isolate other cDNAε which have a high sequence similarity to the gene or similar biological activity. Probes of thiε type preferably have at least 30 baseε and may contain, for example, 50 or more baseε. The probe may alεo be used to identify a cDNA clone corresponding to a full length transcript and a genomic L clone or clones that contain the complete gene including regulatory and promotor regionε, exonε, and introns. An example of a screen comprises isolating the coding region of the gene by using the known DNA sequence to εyntheεize an oligonucleotide probe. Labeled oligonucleotides having a εequence complementary to that of the gene of the preεent invention are used to screen a library of human cDNA, genomic DNA or mRNA to determine which memberε of the library the probe hybridizeε to.
The - preεent invention further relates to polynucleotides which hybridize to the hereinabove-described sequences if there is at least 70%, preferably at least 90%, and more preferably at least 95% identity between the sequences. The present invention particularly relates to polynucleotides which hybridize under εtringent conditionε to the hereinabove-deεcribed polynucleotideε. Aε herein uεed, the term "εtringent conditionε" meanε hybridization will occur only if there iε at leaεt 95% and preferably at leaεt 97% identity between the εequences. The polynucleotides which hybridize to the hereinabove described polynucleotides in a preferred embodiment encode polypeptides which either retain subεtantially the same biological function or activity as the mature polypeptide encoded by the cDNAs of Figure l (SEQ ID N0:1) or the deposited cDNA(ε) .
Alternatively, the polynucleotide may have at leaεt 20 bases, preferably 30 baseε, and more preferably at leaεt 50 baseε which hybridize to a polynucleotide of the present invention and which haε an identity thereto, aε hereinabove described, and which may or may not retain activity. For example, such polynucleotides may be employed as probes for the polynucleotide of SEQ ID NO:l, for example, for recovery of the polynucleotide or as a diagnostic probe or aε a PCR primer.
Thuε, the present invention is directed to polynucleotides having at leaεt a 70% identity, preferably at leaεt 90% and more preferably at least a 95% identity to a polynucleotide which encodeε the polypeptide of SEQ ID NO:2 as well aε fragments thereof, which fragments have at least 30 bases and preferably at least 50 baseε and to polypeptideε encoded by such polynucleotides.
The deposi (s) referred to herein will be maintained under the terms of the Budapest Treaty on the International Recognition of the Deposit of Micro-organisms for purposes of Patent Procedure. These depositε are provided merely aε convenience to thoεe of εkill in the art and are not an admiεsion that a deposit is required under 35 U.S.C. §112. The sequence of the polynucleotides contained in the depoεited materialε, as well aε the amino acid sequence of the polypeptides encoded thereby, are incorporated herein by reference and are controlling in the event of any conflict with any description of sequenceε herein. A licenεe may be required to make, or εell the depoεited materials, and no such licenεe is hereby granted. The present invention further relateε to a G-protein chemokine receptor polypeptide which has the deduced amino acid sequence of Figure 1 (SEQ ID NO:2) or which haε the amino acid εequence encoded by the depoεited cDNA, as well as fragments, analogs and derivativeε of such polypeptide.
The terms "fragment," "derivative" and "analog" when referring to the polypeptide of Figure 1 or that encoded by the depoεited cDNA, means a polypeptide which either retains substantially the same biological function or activity as εuch polypeptide, i.e. functions as a G-protein chemokine receptor, or retains the ability to bind the ligand or the receptor even though the polypeptide does not function as a G-protein chemokine receptor, for example, a soluble form of the receptor. An analog includes a proprotein which can be activated by cleavage of the proprotein portion to produce an active mature polypeptide.
The polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide or a synthetic polypeptide, preferably a recombinant polypeptide.
The fragment, derivative or analog of the polypeptide of Figure 1 (SEQ ID NO:2) or that encoded by the deposited cDNA may be (i) one in which one or more of the amino acid reεidues are subεtituted with a conserved or non-conserved amino acid residue (preferably a conserved amino acid residue) and εuch εubεtituted amino acid reεidue may or may not be one encoded by the genetic code, or <ii) one in which one or more of the amino acid residues includes a substituent group, or (iii) one in which the mature polypeptide is fused with another compound, such aε a compound to increaεe the half-life of the polypeptide (for example, polyethylene glycol) , or (iv) one in which the additional amino acidε are fused to the mature polypeptide for purification of the polypeptide or (v) one in which a fragment of the polypeptide is soluble, i.e. not membrane bound, yet still binds ligands to the membrane bound receptor. Such fragments, derivativeε and analogs are deemed to be within the scope of those skilled in the art from the teachings herein.
The polypeptides and polynucleotides of the present invention are preferably provided in an isolated form, and preferably are purified to homogeneity.
The polypeptides of the preεent invention include the polypeptide of SEQ ID NO:2 (in particular the mature polypeptide) as well as polypeptides which have at leaεt 70% εimilarity (preferably a 70% identity) to the polypeptide of SEQ ID NO:2 and more preferably a 90% similarity (more preferably a 90% identity) to the polypeptide of SEQ ID NO:2 and still more preferably a 95% similarity (still more preferably a 90% identity) to the polypeptide of SEQ ID NO:2 and to portions of such polypeptide with such portion of the polypeptide generally containing at least 30 amino acids and more preferably at least 50 amino acids.
As known in the art "similarity" between two polypeptides iε determined by comparing the amino acid εequence and conserved amino acid substituteε thereto of the polypeptide to the sequence of a second polypeptide.
Fragments or portionε of the polypeptideε of the preεent invention may be employed for producing the correεponding full-length polypeptide by peptide εyntheεiε, therefore, the fragme ts may be employed as intermediates for producing the full-length polypeptideε. Fragmentε or portionε of the polynucleotideε of the preεent invention may be uεed to εyntheεize full-length polynucleotides of the present invention.
The term "gene" means the segment of DNA involved in producing a polypeptide chain; it includes regions preceding and following the coding region "leader and trailer" as well aε intervening εequences (introns) between individual coding segments (exons) .
The term "isolated" means that the material is removed from its original environment (e.g., the natural environment if it is naturally occurring) . For example, a naturally- occurring polynucleotide or polypeptide present in a living animal is not isolated, but the same polynucleotide or polypeptide, separated from some or all of the coexisting materials in the natural system, is isolated. Such polynucleotides could be part of a vector and/or such polynucleotideε or polypeptideε could be part of a compoεition, and εtill be isolated in that such vector or composition is not part of its natural environment.
The polypeptides of the present invention include the polypeptide of SEQ ID NO:2 (in particular the mature polypeptide) as well aε polypeptides which have at least 70% similarity (preferably at least 70% identity) to the polypeptide of SEQ ID NO:2 and more preferably at leaεt 90% εimilarity (more preferably at least 90% identity) to the polypeptide of SEQ ID NO:2 and εtill more preferably at least 95% similarity (still more preferably at least 95% identity) to the polypeptide of SEQ ID NO:2 and also include portions of such polypeptides with such portion of the polypeptide generally containing at least 30 amino acids and more preferably at least 50 amino acids.
Aε known in the art "similarity" between two polypeptideε iε determined by comparing the amino acid εequence and its conserved amino acid substitutes of one polypeptide to the sequence of a second polypeptide.
Fragments or portions of the polypeptides of the present invention may be employed for producing the corresponding full-length polypeptide by peptide synthesiε; therefore, the fragments may be employed as intermediates for producing the full-length polypeptides. Fragments or portions of the polynucleotides of the present invention may be used to synthesize full-length polynucleotides of the present invention.
The present invention also relates to vectors which include polynucleotides of the present invention, hoεt cellε which are genetically engineered with vectors of the invention and the production of polypeptides of the invention by recombinant techniques.
Host cells are genetically engineered (transduced or transformed or tranεfected) with the vectorε of this invention which may be, for example, a cloning vector or an expresεion vector. The vector may be, for example, in the form of a plaεmid, a viral particle, a phage, etc. The engineered hoεt cellε can be cultured in conventional nutrient media modified aε appropriate for activating promoters, selecting transformants or amplifying the genes of the present invention. The culture conditions, such aε temperature, pH and the like, are those previously used with the host cell selected for expresεion, and will be apparent to the ordinarily skilled artisan.
The polynucleotides of the present invention may be employed for producing polypeptides by recombinant techniqueε. Thuε, for example, the polynucleotide may be included in any one of a variety of expreεεion vectorε for expreεsing a polypeptide. Such vectors include chromosomal, nonchromosomal and synthetic DNA sequenceε, e.g., derivativeε of SV40; bacterial plaεmidε; phage DNA; baculoviruε; yeaεt plaεmidε; vectors derived from combinations of plasmids and phage DNA, viral DNA such aε vaccinia, adenovirus, fowl pox virus, and pseudorabieε. However, any other vector may be used as long as it is replicable and viable in the hoεt.
The appropriate DNA sequence may be inserted into the vector by a variety of procedures. In general, the DNA sequence is inserted into an appropriate restriction endonuclease εite(ε) by procedureε known in the art. Such procedureε and otherε are deemed to be within the εcope of thoεe skilled in the art.
The DNA sequence in the expression vector is operatively linked to an appropriate expression control sequence(s) (promoter) to direct mRNA synthesis. As representative examples of such promoters, there may be mentioned: LTR or SV40 promoter, the E. coli. lac or trp, the phage lambda PL promoter and other promoters known to control expression of genes in prokaryotic or eukaryotic cells or their viruses. The expression vector also contains a ribosome binding site for translation initiation and a tranεcription terminator. The vector may also include appropriate sequenceε for amplifying expreεεion.
In addition, the expreεεion vectorε preferably contain one or more selectable marker genes to provide a phenotypic trait for selection of transformed host cells such as dihydrofolate reductase or neomycin resistance for eukaryotic cell culture, or such aε tetracycline or ampicillin reεistance in E. coli.
The vector containing the appropriate DNA sequence as hereinabove described, as well as an appropriate promoter or control sequence, may be employed to transform an appropriate host to permit the host to express the protein.
As representative examples of appropriate hostε, there may be mentioned: bacterial cells, such as E. coli. Streptomyces. Salmonella typhimurium■• fungal cells, such as yeaεt; insect cells εuch aε Droεophila and Spodoptera Sf9; animal cells such as CHO, COS or Boweε melanoma; adenovirus; plant cellε, etc. The selection of an appropriate host is deemed to-be within the scope of those skilled in the art from the teachings herein.
More particularly, the present invention also includes recombinant constructε compriεing one or more of the sequences aε broadly deεcribed above. The conεtructε compriεe a vector, such as a plasmid or viral vector, into which a sequence of the invention has been inserted, in a forward or reverse orientation. In a preferred aspect of this embodiment, the construct further comprises regulatory sequenceε, including, for example, a promoter, operably linked to the εequence. Large numbers of suitable vectors and promoterε are known to those of skill in the art, and are commercially available. The following vectors are provided by way of example. Bactei.al: pQE70, pQE60, pQE-9 (Qiagen), pbs, pDIO, phagescript, psiX174, pbluescript SK, pbεkε, pNH8A, pNH16a, pNH18A, pNH46A (Stratagene); ptrc99a, pKK223- 3, pKK233-3, pDR540, pRIT5 (Pharmacia). Eukaryotic: pWLNEO, pSV2CAT, pOG44, pXTl, pSG (Stratagene) pSVK3, pBPV, pMSG, pSVL (Pharmacia) . However, any other plasmid or vector may be used as long aε they are replicable and viable in the hoεt.
Promoter regionε can be εelected from any deεired gene using CAT (chloramphenicol transferaεe) vectorε or other vectors with selectable markers. Two appropriate vectors are PKK232-8 and PCM7. Particular named bacterial promoters include lad, lacZ, T3, T7, gpt, lambda PR, PL and trp. Eukaryotic promoterε include CMV immediate early, HSV thymidine kinase, early and late SV40, LTRs from retrovirus, and mouse metallothionein-I. Selection of the appropriate vector and promoter is well within the level of ordinary skill in the art.
In a further embodiment, the present invention relates to host cells containing the above-described constructs. The host cell can be a higher eukaryotic cell, such as a mammalian cell, or a lower eukaryotic cell, such aε a yeaεt cell, or the hoεt cell can be a prokaryotic cell, such as a bacterial cell. Introduction of the construct into the hoεt cell can be effected by calcium phoεphate tranεfection, DEAE- Dextran mediated tranεfection, or electroporation. (Davis, L., Dibner, M., Battey, I., Basic Methodε in Molecular Biology, (1986)).
The conεtructε in hoεt cellε can be used in a conventional manner to produce the gene product encoded by the recombinant sequence. Alternatively, the polypeptides of the invention can be synthetically produced by conventional peptide synthesizers.
Mature proteins can be expressed in mammalian cells, yeast, bacteria, or other cells under the control of appropriate promoters. Cell-free translation εystems can also be employed to produce such proteins using RNAs derived from the DNA constructε of the present invention. Appropriate cloning and expression vectors for use with prokaryotic and eukaryotic hostε are deεcribed by Sambrook, et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor, N.Y., (1989), the diεcloεure of which iε hereby incorporated by reference.
Transcription of the DNA encoding the polypeptides of the present invention by higher eukaryotes is increased by inserting an enhancer εequence into the vector. Enhancers are cis-acting elementε of DNA, usually about from 10 to 300 bp that act on a promoter to increase its transcription. Examples including the SV40 enhancer on the late side of the replication origin bp 100 to 270, a cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers.
Generally, recombinant expression vectors will include origins of replication and selectable markers permitting transformation of the host cell, e.g., the ampicillin resistance gene of E. coli and S. cerevisiae TRPl gene, and a promoter derived from a highly-expressed gene to direct transcription of a downstream structural sequence. Such promoters can be derived from operons encoding glycolytic enzymes such aε 3-phoεphoglycerate kinaεe (PGK) , α-factor, acid phosphataεe, or heat shock proteins, among others. The heterologous εtructural sequence is asεembled in appropriate phaεe with translation initiation and termination sequences, and preferably, a leader sequence capable of directing secretion of translated protein into the peripla^mic space or extracellular medium. Optionally, the heterologouε sequence can encode a fusion protein including an N-terminal identification peptide imparting desired characteristics, e.g., stabilization or simplified purification of expressed recombinant product.
Useful expresεion vectorε for bacterial use are constructed by inserting a structural DNA sequence encoding a desired protein together with suitable translation initiation and termination signals in operable reading phase with a functional promoter. The vector will comprise one or more phenotypic selectable markers and an origin of replication to enεure maintenance of the vector and to, if deεirable, provide amplification within the hoεt. Suitable prokaryotic hoεts for transformation include E. coli. Bacillus εubtilis. Salmonella typhimurium and various specieε within the genera Pεeudomonas, Streptomyceε, and Staphylococcuε, although otherε may also be employed aε a matter of choice.
Aε a repreεentative but nonlimiting example, uεeful expreεsion vectors for bacterial uεe can compriεe a εelectable marker and bacterial origin of replication derived from commercially available plasmids comprising genetic elements of the well known cloning vector pBR322 (ATCC 37017) . Such commercial vectors include, for example, pKK223-3 (Pharmacia Fine Chemicals, Uppsala, Sweden) and GEMl (Promega Biotec, Madison, WI, USA) . These pBR322 "backbone" sectionε are combined with an appropriate promoter and the εtructural εequence to be expreεεed.
Following tranεformation of a suitable host εtrain and growth of the hoεt εtrain to an appropriate cell denεity, the εelected promoter is induced by appropriate means (e.g., temperature shift or chemical induction) and cells are cultured for an additional period.
Cells are typically harvested by centrifugation, disrupted by physical or chemical means, and the reεulting crude extract retained for further purification. Microbial cells employed in expression of proteins can be diεrupted by any convenient method, including freeze-thaw cycling, sonication, mechanical disruption, or use of cell lysing agents, such methods are well know to those εkilled in the art.
Various mammalian cell culture syεtemε can alεo be employed to express recombinant protein. Examples of mammalian expresεion systemε include the COS-7 lines of monkey kidney fibroblasts, described by Gluzman, Cell, 23:175 (1981) , and other cell lines capable of expressing a compatible vector, for example, the C127, 3T3, CHO, HeLa and BHK cell lines. Mammalian expresεion vectorε will comprise an origin of replication, a suitable promoter and enhancer, and also any necessary ribosome binding sites, polyadenylation site, splice donor and acceptor siteε, transcriptional termination sequences, and 5' flanking nontranscribed sequences. DNA sequences derived from the SV40 splice, and polyadenylation sites may be used to provide the required nontranscribed genetic elementε.
The G-protein chemokine receptor polypeptideε can be recovered and purified from recombinant cell cultureε by methodε including ammonium εulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phoεphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography and lectin chromatography. Protein refolding εteps can be used, as necessary, in completing configuration of the mature protein. Finally, high performance liquid chromatography (HPLC) can be employed for final purification step .
The polypeptideε of the preεent invention may be a naturally purified product, or a product of chemical synthetic procedures, or produced by recombinant techniqueε from a prokaryotic or eukaryotic hoεt (for example, by bacterial, yeast, higher plant, insect and mammalian cellε in culture) . Depending upon the host employed in a recombinant production procedure, the polypeptides of the present invention may be glycosylated or may be non-glycosylated. Polypeptides of the invention may also include an initial methionine amino acid reεidue.
The polynucleotides and polypeptides of the present invention may be employed as research reagents and materialε for diεcovery of treatmentε and diagnoεticε to human diεease.
The G-protein chemokine receptors of the present invention may be employed in a proceεε for εcreening for compounds which activate (agonists) or inhibit activation (antagonistε) of the receptor polypeptide of the preεent invention .
In general, εuch εcreening procedureε involve providing appropriate cellε which expreεε the receptor polypeptide of the present invention on the surface thereof. Such cells include cells from mammals, yeast, drosophila or E. Coli . In particular, a polynucleotide encoding the receptor of the present invention is employed to transfect cells to thereby expresε the G-protein chemokine receptor. The expressed receptor is then contacted with a test compound to obεerve binding, εtimulation or inhibition of a functional response.
One such screening procedure involves the use of melanophores which are transfected to expreεε the G-protein chemokine receptor of the preεent invention. Such a εcreening .technique is described in PCT WO 92/01810 published February 6, 1992.
Thus, for example, such assay may be employed for screening for a compound which inhibits activation of the receptor polypeptide of the present invention by contacting the melanophore cells which encode the receptor with both the receptor ligand and a compound to be screened. Inhibition of the εignal generated by the ligand indicateε that a compound iε a potential antagonist for the receptor, i.e., inhibits activation of the receptor. The screen may be employed for determining a compound which activateε the receptor by contacting such cells with compounds to be screened and determining whether εuch compound generateε a signal, i.e., activates the receptor.
Other screening techniques include the use of cells which express the G-protein chemokine receptor (for example, transfected CHO cellε) in a system which measures extracellular pH changes cauεed by receptor activation, for example, aε deεcribed in Science, volume 246, pageε 181-296 (October 1989) . For example, compoundε may be contacted with a cell which expreεεeε the receptor polypeptide of the present invention and a second mesεenger response, e.g. signal transduction or pH changes, may be measured to determine whether the potential compound activates or inhibits the receptor.
Another such εcreening technique involves introducing _ RNA encoding the G-protein chemokine receptor into Xenopus oocytes to transiently express the receptor. The receptor oocytes may then be contacted with the receptor ligand and a compound to be screened, followed by detection of inhibition or activation of a calcium signal in the case of εcreening for compounds which are thought to inhibit activation of the receptor.
Another screening technique involves expressing the G- protein chemokine receptor in which the receptor is linked to a phospholipaεe C or D. As representative examples of such cells, there may be mentioned endothelial cells, smooth muscle cellε, embryonic kidney cells, etc. The screening may be accomplished as hereinabove deεcribed by detecting activation of the receptor or inhibition of activation of the receptor from the phoεpholipase second signal.
Another method involveε εcreening for compounds which inhibit activation of the receptor polypeptide of the present invention antagoniεtε by determining inhibition binding of labeled ligand to cells which have the receptor on the surface thereof. Such a method involves tranεfecting a eukaryotic cell with DNA encoding the G-protein chemokine receptor such that the cell expresses the receptor on its surface and contacting the cell with a compound in the presence of a labeled form of a known ligand. The ligand can be labeled, e.g., by radioactivity. The amount of labeled ligand bound to the receptors is measured, e.g. , by measuring radioactivity of the receptors. If the compound binds to the receptor as determined by a reduction of labeled ligand which binds to the receptors, the binding of labeled ligand to the receptor is inhibited.
An antibody may antagonize a G-protein chemokine receptor of the present invention, or in some caεes an oligopeptide, which bind to the G-protein chemokine receptor but does not elicit a εecond meεεenger reεponεe εuch that the activity of the G-protein chemokine receptors is prevented. Antibodieε include anti-idiotypic antibodieε which recognize unique determinantε generally associated with the antigen- binding site of an antibody. Potential antagonist compounds also include proteins which are closely related to the ligand of the G-protein chemokine receptors, i.e. a fragment of the ligand, which have lost biological function and when binding to the G-protein chemokine receptor elicit no response.
An antisense construct prepared through the use of antisenεe technology, may be uεed to control gene expression through triple-helix formation or antisense DNA or RNA, both of which methods are baεed on binding of a polynucleotide to DNA or RNA. For example, the 5' coding portion of the polynucleotide εequence, which encodeε for the mature polypeptideε of the present invention, is used to design an antisense RNA oligonucleotide of from about 10 to 40 base pairs in length. A DNA oligonucleotide is designed to be complementary to a region of the gene involved in transcription (triple helix -see Lee et al., Nucl. Acids Res., 6:3073 (1979); Cooney et al, Science, 241:456 (1988); and Dervan et al., Science, 251: 1360 (1991)) , thereby preventing transcription and the production of G-protein chemokine receptor. The antisenεe RNA oligonucleotide hybridizeε to the mRNA in vivo and blockε tranεlation of mRNA moleculeε into G-protein coupled receptor (antisense - Okano, J. Neurochem. , 56:560 (1991) ; Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression, CRC Press, Boca Raton, FL (1988)) . The oligonucleotides described above can also be delivered to cells such that the antiεenεe RNA or DNA may be expreεεed in vivo to inhibit production of G-protein chemokine receptor.
A εmall molecule which bindε to the G-protein chemokine receptor, making it inaccessible to ligands such that normal biological activity is prevented, for example small peptides or peptide-like molecules, may also be used to inhibit activation of the receptor polypeptide of the present invention.
A soluble form of the G-protein chemokine receptor, e.g. a fragment of the receptors, may be used to inhibit activation of the receptor by binding to the ligand to a polypeptide of the present invention and preventing the ligand from interacting with membrane bound G-protein chemokine receptors.
The compoundε which bind to and activate the G-protein chemokine receptorε of the present invention may be employed to stimulate haematopoiesis, wound healing, coagulation, angiogenesis, to treat solid tumors, chronic infections, leukemia, T-cell mediated auto-immune diseaseε, paraεitic infectionε, pεoriasis, and to stimulate growth factor activity.
The compounds which bind to and inhibit the G-protein chemokine receptors of the present invention may be employed to treat allergy, atherogenesiε, anaphylaxis, malignancy, chronic and acute inflammation, histamine and IgE-mediated allergic reactions, prostaglandin-independent fever, bone _ _
marrow failure, silicosis, sarcoidosis, rheumatoid arthritis, shock and hyper-eoεinophilic syndrome.
The compounds may be employed in combination with a suitable pharmaceutical carrier. Such compositions comprise a therapeutically effective amount of the compound and a pharmaceutically acceptable carrier or excipient. Such a carrier includes but is not limited to saline, buffered saline, dextrose, water, glycerol, ethanol, and combinations thereof. The formulation should suit the mode of administration.
The invention also provideε a pharmaceutical pack or kit compriεing one or more containerε filled with one or more of the ingredientε of the pharmaceutical compositions of the invention. Associated Iwith such container(s) can be a notice in the form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which notice reflects approval by the agency of manufacture, use or sale for human adminiεtration. In addition, the compoundε of the preεent invention may be employed in conjunction with other therapeutic compoundε.
The pharmaceutical compoεitions may be administered in a convenient manner such as by the topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradeπnal (applicable?) routes. The pharmaceutical compositions are administered in an amount which is effective for treating and/or prophylaxis of the specific indication. In general, the pharmaceutical compositions will be administered in an amount of at least about 10 g/kg body weight and in most cases they will be administered in an amount not in excesε of about 8 g/Kg body weight per day. In moεt caεeε, the dosage is from about 10 μg/kg to about 1 mg/kg body weight daily, taking into account the routes of administration, symptoms, etc. (CONFIRM DOSAGES)
The G-protein chemokine receptor polypeptideε and antagonists or agonistε which are polypeptideε, may alεo be employed in accordance with the present invention by expression of such polypeptides in vivo, which is often referred to as "gene therapy."
Thuε, for example, cells from a patient may be engineered with a polynucleotide (DNA or RNA) encoding a polypeptide ex vivo, with the engineered cellε then being provided to a patient to be treated with the polypeptide. Such methodε are well-known in the art. For example, cellε may be engineered by procedures known in the art by use of a retroviral particle containing RNA encoding a polypeptide of the present invention.
Similarly, cells may be engineered in vivo for expression of a polypeptide in vivo by, for example, procedures known in the art. As known in the art, a producer cell for producing a retroviral particle containing RNA encoding the polypeptide of the present invention may be administered to a patient for engineering cellε in vivo and expression of the polypeptide in vivo. These and other methods for administering a polypeptide of the present invention by such method should be apparent to those skilled in the art from the teachings of the present invention. For example, the expression vehicle for engineering cells may be other than a retrovirus, for example, an adenovirus which may be used to engineer cells in vivo after combination with a suitable delivery vehicle.
Retroviruses from which the retroviral plasmid vectors hereinabove mentioned may be derived include, but are not limited to, Moloney Murine Leukemia Virus, spleen necrosis virus, retroviruses such aε Rous Sarcoma Virus, Harvey Sarcoma Virus, avian leukosiε virus, gibbon ape leukemia viruε, human immunodeficiency virus, adenovirus, Myeloproliferative Sarcoma Virus, and mammary tumor viruε. In one embodiment, the retroviral plasmid vector is derived from Moloney Murine Leukemia Virus. The vector includes one or more promoters . Suitable promoters which may be employed include, but are not limited to, the retroviral LTR; the SV40 promoter; and the human cytomegalovirus (CMV) promoter described in Miller, et al., Biotechniσues. Vol. 7, No. 9, 980-990 (1989) , or any other promoter (e.g., cellular promoters such as eukaryotic cellular promoters including, but not limited to, the histone, pol III, and 0-actin promoters) . Other viral promoters which may be employed include, but are not limited to, adenovirus promoters, thymidine kinase (TK) promoters, and B19 parvovirus promoters. The selection of a εuitable promoter will be apparent to those skilled in the art from the teachings contained herein.
The nucleic acid sequence encoding the polypeptide of the preεent invention is under the control of a suitable promoter. Suitable promoters which may be employed include, but are not limited to, adenoviral promoters, such aε the adenoviral major late promoter; or hetorologouε promoters, such as the cytomegalovirus (CMV) promoter; the respiratory εyncytial viruε (RSV) promoter; inducible promoterε, such as the MMT promoter, the metallothionein promoter; heat shock promoters; the albumin promoter; the ApoAI promoter; human globin promoters,- viral thymidine kinase promoters, such as the Herpes Simplex thymidine kinase promoter,- retroviral LTRs (including the modified retroviral LTRs hereinabove described).,- the 3-actin promoter,- and human growth hormone promoters. The promoter alεo may be the native promoter which controlε the genes encoding the polypeptides.
The retroviral plasmid vector is employed to tranεduce packaging cell lineε to form producer cell lines. Examples of packaging cells which may be tranεfected include, but are not limited to, the PE501, PA317, ψ-2 , ι -AM, PA12, T19-14X, VT-19-17-H2, i^CRE, \i-CRIP, GP+E-86, GP+envAml2, and DAN cell lines aε deεcribed in Miller, Human Gene Therapy. Vol. l, pgε. 5-14 (1990) , which is incorporated herein by reference in its entirety. The vector may transduce the packaging cells through any means known in the art. Such means include, but are not limited to, electroporation, the use of liposomes, and CaP04 precipitation. In one alternative, the retroviral plasmid vector may be encapsulated into a liposome, or coupled to a lipid, and then administered to a host.
The producer cell line generates infectious retroviral vector particles which include the nucleic acid sequence(s) encoding the polypeptideε. Such retroviral vector particleε then may be employed, to tranεduce eukaryotic cells, either in vitro or in vivo. The transduced eukaryotic cells will express the nucleic acid sequence(s) encoding the polypeptide. Eukaryotic cells which may be transduced include, but are not limited to, embryonic stem cells, embryonic carcinoma cells, as well as hematopoietic εtem cellε, hepatocytes, fibroblasts, myoblasts, keratinocytes, endothelial cells, and bronchial epithelial cells.
The present invention also provides a method for determining whether a ligand not known to be capable of binding to a G-protein chemokine receptor can bind to such receptor which comprises contacting a mammalian cell which expreεεeε a G-protein chemokine receptor with the ligand under conditions permitting binding of ligands to the G- protein chemokine receptor, detecting the presence of a ligand which binds to the receptor and thereby determining whether the ligand binds to the G-protein chemokine receptor. The systems hereinabove described for determining agonists and/or antagonists may also be employed for determining ligands which bind to the receptor.
Thiε invention alεo provides a method of detecting expression of a G-protein chemokine receptor polypeptide of the present invention on the surface of a cell by detecting the presence of mRNA coding for the receptor which comprises obtaining total mRNA from the cell and contacting the mRNA so obtained with a nucleic acid probe comprising a nucleic acid molecule of at least 10 nucleotides capable of specifically hybridizing with a sequence included within the sequence of a nucleic acid molecule encoding the receptor under hybridizing conditions, detecting the presence of mRNA hybridized to the probe, and thereby detecting the expression of the receptor by the cell.
The present invention also provides a method for identifying receptors related to the receptor polypeptides of the present invention. These related receptors may be identified by homology to a G-protien chemokine receptor polypeptide of the present invention, by low stringency cross hybridization, or by identifying receptors that interact with related natural or synthetic ligands and or elicit similar behaviors after genetic or pharmacological blockade of the chemokine receptor polypeptides of the present invention.
Fragments of the genes may be used as a hybridization probe for a cDNA library to isolate other genes which have a high sequence εimilarity to the geneε of the preεent invention, or which have εimilar biological activity. Probeε of thiε type are at least 20 bases, preferably at least 30 bases and most preferably at least 50 bases or more. The probe may also be used to identify a cDNA clone corresponding to a full length transcript and a genomic clone or clones that contain the complete gene of the present invention including .regulatory and promoter regions, exons and introns. An example of a εcreen of thiε type comprises isolating the coding region of the gene by using the known DNA εequence to εyntheεize an oligonucleotide probe. Labeled oligonucleotideε having a sequence complementary to that of the genes of the present invention are used to screen a library of human cDNA, genomic DNA or mRNA to determine which memberε of the library the probe hybridizeε to.
The preεent invention alεo contemplates the use of the genes of the present invention as a diagnostic, for example, some diseases result from inherited defective genes. • These genes can be detected by comparing the sequences of the defective gene with that of a normal one. Subsequently, one can verify that a "mutant" gene is asεociated with abnormal receptor activity. In addition, one can insert mutant receptor genes into a suitable vector for expression in a functional assay system (e.g., colorimetric assay, expression on MacConkey plates, complementation experiments, in a receptor deficient strain of HEK293 cells) as yet another raeanε to verify or identify mutations. Once "mutant" genes have been identified, one can then screen population for carriers of the "mutant" receptor gene.
Individuals carrying mutationε in the gene of the preεent invention may be detected at the DNA level by a variety of techniques. Nucleic acids used for diagnosiε may be obtained from a patient'ε cells, including but not limited to such as from blood, urine, saliva, tissue biopsy and autopsy material. The genomic DNA may be used directly for detection or may be amplified enzymatically by using PCR (Saiki, et al., Nature. 324:163-166 1986) prior to analysiε. RNA or cDNA may alεo be uεed for the same purpose. As an example, PCR primers complimentary to the nucleic acid of the instant invention can be used to identify and analyze mutations in the gene of the preεent invention. For example, deletionε and insertions can be detected by a change in size of the amplified product in comparison to the normal genotype. Point mutations can be identified by hybridizing amplified DNA to radio labeled RNA of the invention or alternatively, radio labeled antiεenεe DNA sequences of the invention. Perfectly matched sequenceε can be diεtinguished from mismatched duplexes by RNase A digestion or by differences in melting temperatures. Such a diagnostic would be particularly useful for prenatal or even neonatal testing.
Sequence differences between the reference gene and "mutants" may be revealed by the direct DNA sequencing method. In addition, cloned DNA segments may be used as probes to detect specific DNA segments. The sensitivity of this method is greatly enhanced when combined with PCR. For example, a sequence primer is used with double stranded PCR product or a single stranded template molecule generated by a modified PCR. The sequence determination is performed by conventional procedures with radio labeled nucleotide or b.. an automatic sequencing procedure with fluorescent-tags.
Genetic testing based on DNA sequence differences may be achieved by detection of alterations in the electrophoretic mobility of DNA fragments in gelε with or without denaturing agents. Sequences changes at specific locations may alεo be revealed by nucleuε protection aεsays, εuch RNaεe and SI protection or the chemical cleavage method (e.g. Cotton, et al., PNAS. USA. 85:4397-4401 1985).
In addition, some diseases are a result of, or are characterized by changes in gene expression which can be detected by changes in the mRNA. Alternatively, the genes of the present invention can be used as a reference to identify individuals expreεεing a decrease of functions associated with receptors of this type.
The present invention also relates to a diagnostic aεεay for detecting altered levels of soluble forms of the G-proein chemokine receptor polypeptides of the present invention in various tisεues. Assays used to detect levels of the soluble receptor polypeptides in a sample derived from a host are well known to those of skill in the art and include radioimmunoassayε, competitive-binding assays, Western blot analysis and preferably as ELISA assay.
An ELISA assay initially comprises preparing an antibody specific to antigens of the G-protein chemokine receptor polypeptides, preferably a monoclonal antibody. In addition a reporter antibody iε prepared against the monoclonal antibody. To the reporter antibody is attached a detectable reagent such as radioactivity, fluorescence or in this example a horεeradish peroxidase enzyme. A sample is now removed from a host and incubated on a solid support, e.g. a polystyrene dish, that binds the proteins in the sample. Any free protein binding sites on the dish are then covered by incubating with a non-specific protein such as bovine serum albumin. Next, the monoclonal antibody is incubated in the dish during which time the monoclonal antibodies attach to any G-protein chemokine receptor proteins attached to the polyεtyrene dish. All unbound monoclonal antibody is washed out with buffer. The reporter antibody linked to horseradish peroxidase is now placed in the diεh reεulting in binding of the reporter antibody to any monoclonal antibody bound to G- protein chemokine receptor proteins. Unattached reporter antibody is then washed out. Peroxidase substrates are then added to the dish and the amount of color developed in a given time period is a measurement of the amount of G-protein chemokine receptor proteins present in a given volume of patient εample when compared againεt a standard curve.
The sequenceε of the preεent invention are alεo valuable for chromoεome identification. The sequence is specifically targeted to and can hybridize with a particular location on an individual human chromosome. Moreover, there is a current need for identifying particular siteε on the chromoεome. Few chromosome marking reagents based on actual sequence data (repeat polymorphisms) are presently available for marking chromosomal location. The mapping of DNAs to chromosomes according to the present invention is an important first step in correlating those sequences with genes aεsociated with disease.
Briefly, sequences can be mapped to chromosomeε by preparing PCR primerε (preferably 15-25 bp) from the cDNA. Computer analyεiε of the cDNA is used to rapidly select primers that do not span more than one exon in the genomic DNA, thus complicating the amplification process. These primers are then used for PCR screening of somatic cell hybrids containing individual human chromosomes. Only.those hybrids containing the human gene corresponding to the primer will yield an amplified fragment.
PCR mapping of somatic cell hybrids is a rapid procedure for assigning a particular DNA to a particular chromosome. Using the present invention with the same oligonucleotide primers, sublocalization can be achieved with panels of fragments from specific chromosomes or pools of large genomic clones in an analogous manner. Other mapping strategieε that can εimilarly be used to map to its chromosome include in situ hybridization, prescreening with labeled flow-sorted chromoεomeε and preselection by hybridization to construct chromosome specific-cDNA libraries.
Fluorescence in situ hybridization (FISH) of a cDNA clone to a metaphase chromosomal spread can be used to provide a precise chromosomal location in one step. This technique can be used with cDNA as short as 50 or 60 bases. For a review of this technique, εee Verma et al. , Human Chromoεomes: a Manual of Basic Techniques, Pergamon Press, New York (1988) .
Once a sequence has been mapped to a preciεe chromoεomal location, the physical position of the sequence on the chromosome can be correlated with genetic map data. Such data are found, for example, in V. McKusick, Mendelian Inheritance in Man (available on line through Johns Hopkins University Welch Medical Library) . The relationship between genes and diseases that have been mapped to the same chromosomal region are then identified through linkage analysiε (coinheritarice of phyεically adjacent geneε) .
Next, it is necesεary to determine the differences in the cDNA or genomic sequence between affected and unaffected individuals. If a mutation is observed in some or all of the affected individualε but not in any normal individuals, then the mutation is likely to be the causative agent of the diseaεe. With current resolution of physical mapping and genetic mapping techniques, a cDNA precisely localized to a chromosomal region associated with the disease could be one of between 50 and 500 potential causative genes. (This assumes 1 megabase mapping resolution and one gene per 20 kb) .
The polypeptides, their fragments or other derivatives, or analogs thereof, or cells expressing them can be used as an immunogen to produce antibodies thereto. These antibodies can be, for example, polyclonal or monoclonal antibodies. The preεent invention alεo includeε chimeric, εingle chain, and humanized antibodies, as well as Fab fragments, or the product of an Fab expression library. Various procedures known in the art may be used for the production of such antibodies and fragments.
Antibodies generated against the polypeptides correεponding to a εequence of the present invention can be obtained by direct injection of the polypeptides into an animal or by administering the polypeptides to an animal, preferably a nonhuman. The antibody so obtained will then bind the polypeptides itεelf. In thiε manner, even a sequence encoding only a fragment, of the polypeptides can be used to generate antibodies binding the whole native polypeptides. Such antibodies can then be used to isolate the polypeptide from tisεue expressing that polypeptide.
For preparation of monoclonal antibodies, any technique which provides antibodies produced by continuous cell line cultures can be uεed. Examples include the hybridoma technique (Kohler and Milstein, 1975, Nature, 256:495-497), the trioma technique, the human B-cell hybridoma technique (Kozbor et al., 1983, Immunology Today 4:72), and the EBV- hybridoma technique to produce human monoclonal antibodieε (Cole, et al., 1985, in Monoclonal Antibodieε and Cancer Therapy, Alan R. Liεs, Inc., pp. 77-96). Techniques described for the production of single chain antibodies (U.S. Patent 4,946,778) can be adapted to produce single chain antibodies to immunogenic polypeptide products of this invention. Also, tran?-,enic mice may be used to express humanized antibodies to immunogenic polypeptide products of this invention.
The present invention will be further described with reference to the following examples; however, it is to be understood that the present invention is not limited to such examples. All partε or amounts, unless otherwise specified, are by weight.
In order to facilitate understanding of the following examples certain frequently occurring methods and/or terms will be described.
"Plasmidε" are deεignated by a lower case p preceded and/or followed by capital letters and/or numbers. The starting plasmids herein are either commercially available, publicly available on an unrestricted baεis, or can be constructed from available plasmidε in accord with published procedures. In addition, equivalent plasmids to those described are known in the art and will be apparent to the ordinarily skilled artiεan.
"Digestion" of DNA refers to catalytic cleavage of the DNA with a restriction enzyme that acts only at certain sequences in the DNA. The various restriction enzymes used herein are commercially available and their reaction conditions, cofactors and other requirements were used as would be known to the ordinarily skilled artisan. For analytical purposeε, typically 1 μg of plaεmid or DNA fragment is used with about 2 units of enzyme in about 20 μl of buffer solution. For the purpose of isolating DNA fragments for plasmid construction, typically 5 to 50 μg of DNA are digested with 20 to 250 units of enzyme in a larger volume. Appropriate buffers and substrate amounts for particular restriction enzymes are specified by the manufacturer. Incubation times of about l hour at 37-°C are ordinarily used, but may vary in accordance with the supplier's instructionε. After digestion the reaction is electrophoresed directly on a polyacrylamide gel to isolate the desired fragment.
Size separation of the cleaved fragments is performed using 8 percent polyacrylamide gel deεcribed by Goeddel, D. et al . , Nucleic Acidε Reε., 8:4057 (1980) .
"Oligonucleotideε" refers to either a single stranded polydeoxynucleotide or two complementary polydeoxynucleotide strands which may be chemically syntheεized. Such εynthetic oligonucleotides have no 5' phosphate and thus will not ligate to another oligonucleotide without adding a phosphate with an ATP in the presence of a kinase. A synthetic oligonucleotide will ligate to a fragment that has not been dephosphorylated.
"Ligation" refers to the proceεε of forming phoεphodieεter bondε between two double stranded nucleic acid fragments (Maniatis, T. , et al., Id., p. 146) . Unleεs otherwise provided, ligation may be accompliεhed uεing known bufferε and conditions with 10 units to T4 DNA ligase ("ligase") per 0.5 μg of approximately equimolar amounts of the DNA fragments to be ligated.
Unlesε otherwiεe εtated, transformation was performed as described in the method of Graham, F. and Van der Eb, A., Virology, .52:456-457 (1973) .
Example 1 Bacterial Expression and Purification of HDGNRlO
The DNA sequence encoding for HDGNRlO, ATCC # _ is initially amplified using PCR oligonucleotide primers corresponding to the 5' and sequenceε of the procesεed HDGNRlO protein (minus the εignal peptide εequence) and the vector sequences 3' to the HDGNRlO gene. Additional nucleotideε correεponding to HDGNRlO were added to the 5' and 3' εequences respectively. The 5' oligonucleotide primer has the sequence 5' CGGAATTCCTCCATGGATTATCAAGTGTCA 3' contains an EcoRI restriction enzyme site followed by 18 nucleotides of HDGNRlO coding sequence starting from the presumed terminal amino acid of the processed protein codon. The 3' sequence 5' CGGAAGCTTCGTCACAAGCCCACAGATAT 3' contains complementary sequences to a Hindlll site and is followed by 18 nucleotides of HDGNRlO coding sequence. The restriction enzyme sites correspond to the restriction enzyme sites on the bacterial expresεion vector pQE-9 (Qiagen, Inc. 9259 Eton Avenue, Chatεworth, CA, 91311) . pQE-9 encodeε antibiotic resistance
(Ampr) , a bacterial origin of replication (ori) , an IPTG- regulatable promoter operator (P/O) , a ribosome binding site
(RBS) , a 6-His tag and reεtriction enzyme εites. pQE-9 was then digeεted with EcoRI and Hindlll. The amplified εequenceε were ligated into pQE-9 and were inserted in frame with the εequence encoding for the hiεtidine tag and the RBS. The ligation mixture waε then uεed to tranεform E. coli εtrain M15/rep 4 (Qiagen, Inc.) by the procedure deεcribed in Sambroo , J. et al. , Molecular Cloning: A Laboratory Manual, Cold Spring Laboratory Press, (1989) . Ml5/rep4 contains multiple copies of the plasmid pREP4, which expreεεeε the lad repreεεor and alεo conferε kanamycin resistance (Kanr) . Transformantε are identified by their ability to grow on LB plates and ampicillin/kanamycin resistant colonies were selected. Plasmid DNA was isolated and confirmed by restriction analysiε. Cloneε containing the deεired conεtructs were grown overnight (O/N) in liquid culture in LB media supplemented with both Amp (100 ug/ml) and Kan (25 ug/ml) . The O/N culture is used to inoculate a large culture at a ratio of 1:100 to 1:250. The cells were grown to an optical density 600 (O.D.600) of between 0.4 and 0.6. IPTG
("Isopropyl-B-D-thiogalacto pyranoside") was then added to a final concentration of 1 mM. IPTG induces by inactivating the lad repressor, clearing the ?/0 leading to increased gene expresεion. Cells were grown an extra 3 to 4 hours. Cells were then harvested by centrifugation. The cell pellet was solubilized in the chaotropic agent 6 Molar Guanidine HCI. After clarification, solubilized HDGNRlO was purified from this solution by chromatography on a Nickel-Chelate column under conditions that allow for tight binding by proteins containing the 6-His tag. Hochuli, E. et al., J. Chromatography 411:177-184 (1984) . HDGNRlO was eluted from the column in 6 molar guanidine HCI pH 5.0 and for the purpose of renaturation adjusted to 3 molar guanidine HCI, lOOmM sodium phosphate, 10 mmolar glutathione (reduced) and 2 mmolar glutathione (oxidized) . After incubation in this solution for 12 hours the protein was dialyzed to 10 mmolar sodium phosphate.
Example 2 Expression of Recombinant HDGNRlO in COS cells
The expression of plasmid, HDGNRlO HA is derived from a vector pcDNAI/Amp (Invitrogen) containing: 1) SV40 origin of replication, 2) ampicillin resiεtance gene, 3) E.coli replication origin, 4) CMV promoter followed by a polylinker region, a SV40 intron and polyadenylation εite. A DNA fragment encoding the entire HDGNRlO precursor and a HA tag fused in frame to its 3' end was cloned into the polylinker region of the vector, therefore, the recombinant protein expresεion is directed under the CMV promoter. The HA tag correspond to an epitope derived from the influenza hemagglutinin protein as previously described (I. Wilson, H. Niman, R. Heighten, A Cherenson, M. Connolly, and R. Lerner, 1984, Cell 37, 767) . The infusion of HA tag to the target protein allows easy detection of the recombinant protein with an antibody that recognizes the HA epitope.
The plasmid construction strategy is described as follows:
The DNA sequence encoding for HDGNRlO, ATCC # , was constructed by PCR using two primers: the 5' primer 5' GTCC AAGCTTGCCACCATGGATTATCAAGTGTCA 3 ' and contains a Hindlll site followed by 18 nucleotides of HDGNRlO coding sequence starting from the initiation codon; the 3' sequence 5'
CTAGCΓCGAGTCAAG∞TAGTC GGGACGTCGTATGGGTAGCACΆAGCCCΆCAGATAT^
3' contains complementary sequences to an Xhol site, translation stop codon, HA tag and the last 18 nucleotides of the HDGNRlO coding sequence (not including the stop codon) . Therefore, the PCR product contains a Hindlll εite HDGNRlO coding εequence followed by HA tag fuεed in frame, a translation termination stop codon next to the HA tag, and an Xhol site. The PCR amplified DNA fragment and the vector, pcDNAI/Amp, were digested with Hindlll and Xhol restriction enzyme and ligated. The ligation mixture was transformed into E. coli strain SURE (available from Stratagene Cloning Systemε, 11099 North Torrey Pineε Road, La Jolla, CA 92037) the tranεfor ed culture was plated on ampicillin media plates and resiεtant colonies were selected. Plasmid DNA was isolated from transformants and examined by restriction analysiε for the presence of the correct fragment. For expression of the recombinant HDGNRlO, COS cells were transfected with the expreεεion vector by DEAE-DEXTRAN method. (J. Sambrook, E. Fritsch, T. Maniatis, Molecular Cloning: A Laboratory Manual, Cold Spring Laboratory Presε, (1989) ) . The expression of the HDGNRlO HA protein was detected by radiolabelling and immunoprecipitation method. (E. Harlow, D. Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, (1988)) . Cells were labelled for 8 hours with 35S-cysteine two days post transfection. Culture media were then collected and cells were lyεed with detergent (RIPA buffer (150 M NaCl, 1% NP-40, 0.1% SDS, 1% NP-40, 0.5% DOC, 50mM Triε, pH 7.5) . (Wilson, I. et al., Id. 37:767 (1984)) . Both cell lysate and culture media were precipitated with a HA εpecific monoclonal antibody. Proteins precipitated were analyzed on 15% SDS-PAGE gels. Example 3 Cloning and expression of HDGNRlO using the baculovirus expression system
The DNA sequence encoding the full length HDGNRlO protein, ATCC # , was amplified using PCR oligonucleotide primers corresponding to the 5' and 3 ' sequences of the gene-.
The 5' primer has the εequence 5' CGGGATCCCTCCATGGATTAT CAAGTGTCA 3' and contains a BamHI restriction enzyme site followed by 4 nucleotides resembling an efficient signal for the initiation of translation in eukaryotic cells (J. Mol. Biol. 1987, 196. 947-950, Kozak, M.) , and just behind the first 18 nucleotides of the HDGNRlO gene (the initiation codon for translation is "ATG") .
The 3' primer has the sequence 5' CGGGATCCCGCT CACAAGCCCACAGATAT 3' and contains the cleavage site for the restriction endonucleaεe BamHI and 18 nucleotideε complementary to the 3' non-translated sequence of the HDGNRlO gene. The amplified sequences were isolated from a 1% agarose gel using a commercially available kit ("Geneclean, " BIO 101 Inc., La Jolla, Ca.) . The fragment was then digested with the endonuclease BamHI and purified as described above. This fragment is deεignated F2.
The vector pRGl (modification of pVL941 vector, discusεed below) is used for the expression of the HDGNRlO protein using the baculovirus expression system (for review see: Summers, M.D. and Smith, G.E. 1987, A manual of methods for baculovirus vectors and insect cell culture procedures, Texas Agricultural Experimental Station Bulletin No. 1555) . This expression vector contains the strong polyhedrin promoter of the Autographa californica nuclear polyhedrosis virus (AcMNPV) followed by the recognition sites for the restriction endonuclease BamHI . The polyadenylation site of the simian virus (SV)40 is used for efficient polyadenylation. For an easy selection of recombinant viruses the beta-galactosidase gene from E.coli is inserted in the same orientation as the polyhedrin promoter followed by the polyadenylation signal of the polyhedrin gene. The polyhedrin sequenceε are flanked at both sides by viral sequenceε for the cell-mediated homologous recombination of co-transfected wild-type viral DNA. Many other baculovirus vectors could be used in place of pRGl such as pAc373, pVL941 and pAcIMl (Luckow, V.A. and Summers, M.D., Virology, 170:31- 39) .
The plasmid waε digeεted with the reεtriction enzyme BamHI and then dephoεphorylated using calf intestinal phosphataεe by procedures known in the art. The DNA was then isolated from a 1% agarose gel as described above. This vector DNA is designated V2.
Fragment F2 and the dephosphorylated plasmid V2 were ligated with T4 DNA ligase. E.coli HB101 cells were then transformed and bacteria identified that contained the plasmid (pBacHDGNRlO) with the HDGNRlO gene using the enzyme BamHI. The sequence of the cloned fragment was confirmed by DNA sequencing.
5 μg of the plaF-nid pBacHDGNRlO were co-transfected with 1.0 μg of a commercially available linearized baculovirus ("BaculoGold™ baculoviruε DNA", Pharmingen, San Diego, CA.) uεing the lipofection method (Feigner et al. Proc. Natl. Acad. Sci. USA, 84:7413-7417 (1987)) . lμg of BaculoGold™ virus DNA and 5 μg of the plaεmid pBacHDGNRlO were mixed in a sterile well of a microtiter plate containing 50 μl of serum free Grace's medium (Life Technologies Inc., Gaithersburg, MD) . Afterwards 10 μl Lipofectin plus 90 μl Grace's medium were added, mixed and incubated for 15 minutes at room temperature. Then the transfection mixture was added drop wise to the Sf9 insect cells (ATCC CRL 1711) seeded in a 35 mm tissue culture plate with 1 ml Grace' medium without serum. The plate was rocked back and forth to mix the newly added solution. The plate was then incubated for 5 hours at 27°C. After 5 hours the transfection solution was removed from the plate and l ml of Grace's insect medium supplemented with 10% fetal calf serum waε added. The plate was put back into an incubator and cultivation continued at 27°C for four days.
After four days the supernatant was collected and a plaque assay performed similar as described by Summers and Smith (supra) . As a modification an agarose gel with "Blue Gal" (Life Technologies Inc., Gaithersburg) was used which allows an easy isolation of blue stained plaques. (A detailed description of a "plaque assay" can also be found in the uεer's guide for insect cell culture and baculovirology distributed by Life Technologies Inc., Gaithersburg, page 9- 10) .
Four days after the serial dilution, the viruseε were added to the cellε, blue εtained plaques were picked with the tip of an Eppendorf pipette. The agar containing the recombinant viruseε was then resuεpended in an Eppendorf tube containing 200 μl of Grace's medium. The agar was removed by a brief centrifugation and the supernatant containing the recombinant baculoviruεes was used to infect Sf9 cells εeeded in 35 mm diεheε. Four dayε later the εupernatants of these culture dishes were harvested and then stored at 4°C.
Sf9 cells were grown in Grace's medium supplemented with 10% heat-inactivated FBS. The cells were infected with the recombinant baculovirus V-HDGNR10 at a multiplicity of infection (MOD of 2. Six hours later the medium was removed and replaced with SF900 II medium minus methionine and cysteine (Life Technologies Inc., Gaithersburg). 42 hours later 5 μCi of 3SS-methionine and 5 μCi 35S cysteine (Amerεham) were added. The cells were further incubated for 16 hours before they were harvested by centrifugation and the labelled proteins visualized by SDS-PAGE and autoradiography.
Example 4 Expression via Gene Therapy
Fibroblasts are obtained from a subject by skin biopsy. The resulting tissue is placed in tissue-culture medium and separated into small pieces. Small chunks of the tissue are placed on a wet surface of a tissue culture flask, approximately ten pieces are placed in each flask. The flask is turned upside down, closed tight and left at room temperature over night. After 24 hours at room temperature, the flask is inverted and the chunks of tissue remain fixed to the bottom of the flask and fresh media (e.g., Ham's F12 media, with 10% FBS, penicillin and streptomycin, is added. This is then incubated at 37°C for approximately one week. At this time, fresh media is added and subsequently changed every several days. After an additional two weeks in culture, a monolayer of fibroblasts emerge. The monolayer is trypsinized and scaled into larger flaskε. pMV-7 (Kirεchmeier, P.T. et al, DNA, 7:219-25 (1988) flanked by the long terminal repeats of the Moloney murine sarcoma virus, is digested with EcoRI and Hindlll and subsequently treated with calf intestinal phosphataεe. The linear vector is fractionated on agarose gel and purified, using glass beads.
The cDNA encoding a polypeptide of the present invention is amplified using PCR primers which correspond to the 5' and 3' end sequences respectively. The 5' primer contains an EcoRI site, and the 3' primer contains a Hindlll site. Equal quantities of the Moloney murine sarcoma virus linear backbone and the EcoRI and Hindlll fragment are added together, in the presence of T4 DNA ligase. The resulting mixture is maintained under conditions appropriate for ligation of the two fragments. The ligation mixture is used to transform bacteria HB101, which are then plated onto agar- containing kanamycin for the purpose of confirming that the vector had the gene of interest properly inserted. The amphotropic pA317 or GP+aml2 packaging cells are grown in tissue culture to confluent density in Dulbecco's Modified Eagles Medium (DMEM) with 10% calf serum (CS) , penicillin and streptomycin. The MSV vector containing the gene is then added to the media and the packaging cells are transduced with the vector. The packaging cells now produce infectious viral particles containing the gene (the packaging cells are now referred to as producer cells) .
Fresh media is added to the transduced producer cellε, and εubεequently, the media is harvested from a 10 cm plate of confluent producer cells. The spent media, containing the infectiouε viral particles, is filtered through a millipore filter to remove detached producer cells and this media is then used to infect fibroblast cells. Media is removed from a sub-confluent plate of fibroblasts and quickly replaced with the media from the producer cells. This media is removed and replaced with fresh media. If the titer of viruε iε high, then virtually all fibroblasts will be infected and no selection is required. If the titer is very low, then it is necesεary to uεe a retroviral vector that has a selectable marker, εuch as neo or his.
The engineered fibroblasts are then injected into the host, either alone or after having been grown to confluence on cytodex 3 microcarrier beads. The fibroblastε now produce the protein product.
Numerous modifications and variations of the present invention are possible in light of the above teachings and, therefore, within the scope of the appended claims, the invention may be practiced otherwise than as particularly described.
SEQUENCE LISTING
(1) GENERAL INFORMATION: (i) APPLICANT: Li, ET AL.
(ii) TITLE OF INVENTION: Human G-Protein Chemokine
Receptor
(iii) NUMBER OF SEQUENCES:
(iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: CARELLA, BYRNE, BAIN, GIL7ILLAN,
CECCHI, STEWART & OLSTEIN
(B) STREET: 6 BECKER FARM ROAD
(C) CITY: ROSELAND
(D) STATE: NEW JERSEY
(E) COUNTRY: USA
(F) ZIP: 07068
(v) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: 3.5 INCH DISKETTE
(B) COMPUTER: IBM PS/2
(C) OPERATING SYSTEM: MS-DOS
(D) SOFTWARE: WORD PERFECT 5.1
(vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER:
(B) FILING DATE: concurrently
(C) CLASSIFICATION:
(vii) ATTORNEY/AGENT INFORMATION:
(A) NAME: FERRARO, GREGORY D.
(B) REGISTRATION NUMBER: 36.134
(C) REFERENCE/DOCKET NUMBER: 325800-
(viii) TELECOMMUNICATION INFORMATION: (A) TELEPHONE: 201-994-1700 (B) "TELEFAX: 201-994-1744
(2) INFORMATION FOR SEQ ID NO:l:
(i) SEQUENCE CHARACTERISTI S
(A) LENGTH: 1414 BASE PAIRS
(B) TYPE: NUCLEIC AC1L
(C) STRANDEDNESS : SINGLE
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE : cDNA
(Xi) SEQUENCE DESCRIPTION : SEQ ID NO : l :
GTGAGATGGT GCTTTCATGA ATTCCCCCAA CAAGAGCCAA GCTCTCCATC TAGTGGACAG 60 GGAAGCTAGC AGCAAACCTT CCCTTCACTA CGAAACTTCA TTGCTTGGCC CAAAAGAGAG 120
TTAATTCAAT GTAGACATCT ATGTAGGCAA TTAAAAACCT ATTGATGTAT AAAACAGTTT 180
GCATTCATGG AGGGCAACTA AATACATTCT AGGACTTTAT AAAAGATCAC TTTTTATTTA 240
TGCACAGGGT GGAACAAG ATG GAT TAT CAA GTG TCA AGT CCA ATC TAT GAC 291
Met Asp Tyr Gin Val Ser Ser Pro lie Tyr Asp
ATC AAT TAT TAT ACA TCG GAG CCC TGC CCA AAA ATC AAT GTG AAG CAA 339 lie Asn Tyr Tyr T r Ser Glu Pro Cys Pro Lys lie Asn Val ys Gin
ATC GCA GCC CGC CTC CTG CCT CCG CTC TAC TCA CTG GTG TTC ATC TTT 387 lie Ala Ala Arg Leu Leu Pro Pro Leu Tyr Ser Leu Val P e lie P e
GGT TTT GTG GGC AAC ATG CTG GTC ATC CTC ATC CTG ATA AAC TGC CAA 435 Gly Phe Val Gly Asn Met Leu Val lie Leu lie Leu He Asn Cys Gin
AGG CTG GAG AGC ATG ACT GAC ATC TAC CTG CTC AAC CTG GCC ATC TCT 483 Arg Leu Glu Ser Met Thr Asp He Tyr Leu Leu Asn Leu Ala He Ser
GAC CTG TTT TTC CTT CTT ACT GTC CCC TTC TGG GCT CAC TAT GCT GCC 531 Asp Leu Phe Phe Leu Leu Thr Val Pro Phe Trp Ala His Tyr Ala Ala
GCC CAG TGG GAC TTT GGA AAT ACA ATG TGT CAA CTC TTG ACA GGG CTC 579 Ala Gin Trp Asp Phe Gly Asn Thr Met Cys Leu Leu Thr Gly Leu Tyr
TAT TTT ATA GGC TTC TTC TCT GGA ATC TTC TTC ATC ATC CTC CTG ACA 627 Phe He Gly Phe Phe Ser Giy He Phe Phe He He Gin Leu Leu Thr
ATC GAT AGG TAC CTG GCT ATC GTC CAT GCT GTG TTT GCT TTA AAA GCC 675 He Asp Arg Tyr Leu Ala He Val His Ala Val Phe Ala Leu Lys Ala
AGG ACG GTC ACC TTT GGG GTG GTG ACA AGT GTG ATC ACT TGG GTG GTG 723 Arg Thr VaL Thr Phe Gly Val Val Thr Ser Val He Thr Trp Val Val
GCT GTG TTT GCG TCT CTC CCA GGA ATC ATC TTT ACC AGA TCT CAA AAA 771 Ala Val Phe Ala Ser Leu Pro Gly He He Phe Thr Arg Ser Gin Lys
GAA GGT CTT CAT TAC ACC TGC AGC TCT CAT TTT CCA TAC AGT CAG TAT 819 Glu Gly Leu His Tyr Thr cys Ser Ser His Phe Pro Tyr Ser Gin Tyr
CAA TTC TGG AAG AAT TTC CAG ACA TTA AAG ATA GTC ATC TTG GGG CTG 867 Gin Phe Trp Lys Asn Phe Gin Thr Leu Lys He Val He Leu Gly Leu
GTC CTG CCG .CTG CTT GTC ATG GTC ATC TGC TAC TCG GGA ATC CTA AAA 915 Val Leu Pro Leu Leu Val Met Val He Cys Tyr Ser Giy He Leu Lys
ACT CTG CTT CGG TGT CGA AAT GAG AAC- AAG AGG CAC AGG GCT GTG AGG 963 Thr Leu Leu Arg Cys Arg Asn Giu Lys Lys Arg His Arg Ala Val Arg
CTT ATC TTC ACC ATC ATG ATT GTT TAT TTT CTC TTC TGG GCT CCC TAC 1011 Leu He Phe Thr He Met He Val Tyr Phe Leu Phe Trp Ala Pro Tyr
AAC ATT GTC CTT CTC CTG AAC ACC TTC CAG GAA TTC TTT GGC CTG AAT 1059 Asn He Val Leu Leu Leu Asn Tnr Pne Gin Glu Phe Phe Gly Leu Asn
AAT TGC AGT AGC TCT AAC AGG TTG GAC CAA GCT ATG CAG GTG ACA GAG 1107 Asn Cys Ser Ser Ser Asn Arg Leu Asp Gin Ala Met Gin Val Thr Glu
ACT CTT GGG ATG ACG CAC TGC TGC ATC AAC CCC ATC ATC TAT GCC TTT 1155 Thr Leu Gly Met Thr His Cys Cys He Asn Pro He He Tyr Ala Phe GTC GGG GAG AAG TTC AGA AAC TAC CTC TTA GTC TTC TTC CAA AAG CAC . 1203 Val Gly Glu Lys Phe Arg Asn Tyr Leu Leu Val Phe Phe Gin Lys His
ATT GCC AAA CGC TTC TGC AAA TGC TGT TCT ATT TTC CAG CAA GAG GCT 1251 He Ala Lys Arg Phe Cys Lys Cys Cys Ser He Phe Gin Gin Glu Ala
CCC GAG CGA GCA AGC TCA GTT TAC ACC CGA TCC ACT GGG GAG CAG GAA 1299 Pro Glu Arg Ala Ser Ser Val Tyr Thr Arg Ser Thr Gly Glu Gin Glu
ATA TCT GTG GGC TTG TGACACGGAC TCAAGTGGGC TGGTGACCCA GTCAGAGTTG 1354 He Ser Val Gly Leu
TGCACATGGC TTAGTTTTCA TACACAGCCT GGGCTGGGGG TGGGGTGGAA GAGGTCTTTT 1414
(2) INFORMATION FOR SEQ ID NO:2: (i) SEQUENCE CHARACTERISTICS
(A) LENGTH: AMINO ACIDS
(B) TYPE: AMINO ACID
(C) STRANDEDNESS:
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: PROTEIN
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:
Met Asp Tyr Gin Val Ser Ser Pro lie Tyr Aεp lie Aεn Tyr Tyr
5 10 15
Thr Ser Glu Pro Cys Pro Lyε lie Asn Val Lys Gin lie Ala Ala
20 25 30
Arg Leu Leu Pro Pro Leu Tyr Ser Leu Val Phe lie Phe Gly Phe
35 40 45
Val Gly Aεn Met Leu Val lie Leu lie Leu lie Aεn Cys Gin Arg
50 55 60
Leu Glu Ser Met Thr Asp lie Tyr Leu Leu Asn Leu Ala lie Ser
65 70 75
Asp Leu Phe Phe Leu Leu Thr Val Pro Phe Trp Ala His Tyr Ala
80 85 90
Ala Ala Gin Trp Asp Phe Gly Asn Thr Met Cys Leu Leu Thr Gly
95 100 105
Leu Tyr Phe lie Gly Pne Phe Ser Gly lie Phe Phe lie lie Gin
110 115 120
Leu Leu Thr lie Asp Arg Tyr Leu Ala lie Val His Ala Val Phe
125 13C 135
Ala Leu Lyε Ala Arg Thr Val Thr Phe Gly Val Val Thr Ser Val
140 145 150
He Thr Trp Val Val Ala Val Phe Ala Ser Le Pro Gly He He
155 160 165
Phe Thr Arg Ser Gin Lys Glu Gly Leu His Tyr Thr cys Ser Ser
170 175 180
His Phe Pro Tyr Ser Gin Tyr Gin Phe Trp Lys Asn Phe Gin Thr
185 19C 195
Leu Lys He Val He Leu Gly Le Val Leu Pro Leu Leu Val Met
200 205 210 al He Cys Tyr Ser Gly He Leu Lys Thr Leu Leu Arg Cys Arg
215 220 225
Asn Glu Lys Lys Arg His Arg Ala Val Arg Leu He Phe Thr He
230 235 240
Met He Val Tyr Phe Leu Phe Trp Ala Pro Tyr Asn He Val Leu
245 250 255
Leu Leu Asn Thr Phe Gin Glu Phe Phe Gly Leu Asn Asn Cys Ser
260 265 270
Ser Ser Asn Arg Leu Asp Gin Ala Met Gin Val Thr Glu Thr Leu
275 280 285
Gly Met Thr His Cys Cyε He Aεn Pro He He Tyr Ala Phe Val
290 295 300
Gly Glu Lys Phe Arg Asn Tyr Leu Leu Val Phe Phe Gin Lys Hiε
305 310 315
He Ala Lyε Arg Phe Cys Lys Cys Cys Ser He Phe Gin Gin Glu
320 325 330
Ala Pro Glu Arg Ala Ser Ser Val Tyr Thr Arg Ser Thr Gly Glu
335 340 345
Gin Glu He Ser Val Gly Leu
350

Claims

WHAT IS CLAIMED IS:
1. An isolated polynucleotide comprising a member selected from the group consisting of:
(a) a polynucleotide encoding the polypeptide as set forth in SEQ ID NO:2;
(b) a polynucleotide encoding a mature polypeptide encoded by the DNA contained in ATCC Deposit No. ;
(c) a polynucleotide capable of hybridizing to and which is at least 70% identical to the polynucleotide of (a) or (b) ,- and
(d) a polynucleotide fragment of the polynucleotide of (a) , (b) or (c) .
2. Tϊ- - polynucleotide of claim l wherein the polynucleotide is DNA.
3. A vector containing the DNA of Claim 2.
4. A host cell transformed or transfected with the vector of Claim 3.
5. A proceεε for producing a polypeptide compriεing: expressing from the host cell of Claim 4 the polypeptide encoded by said DNA.
6. A process for producing cells capable of expressing a polypeptide comprising transforming or transfecting the cellε with the vector of Claim 3.
7. A receptor polypeptide corrpriεing a member εelected from the group conεisting of:
(i) a polypeptide having the deduced amino acid sequence of SEQ ID NO:2 and fragments, analogs and derivativeε thereof; and (ii) a polypeptide encoded by the cDNA of ATCC
Deposit No. and fragments, analogs and derivatives of said polypeptide.
8. The polypeptide of Claim 7 wherein the polypeptide haε the deduced amino acid sequence of SEQ ID NO:2.
9. An antibody against the polypeptide of claim 7 selected from the group consisting of an antibody which agonizes the activity of the polypeptide and an antibody which antagonizes the activity of the polypeptide.
10. A compound which activates the polypeptide of claim 7.
11. A compound which inhibits activation the polypeptide of claim 7.
12. A method for the treatment of a patient having need to activate a G-protein chemokine receptor comprising: adminiεtering to the patient a therapeutically effective amount of the compound of claim 10.
13. A method for the treatment of a patient having need to inhibit a G-protein chemokine receptor comprising: administering to the patient a therapeutically effective amount of the compound of claim 11.
14. The method of claim 12 wherein said compound is a polypeptide and a therapeutically effective amount of the compound is administered by providing to tne patient DNA encoding said agonist and expressing said agonist in vivo. __ __
15. The method of claim 13 wherein said compound is a polypeptide and a therapeutically effective amount of the compound is administered by providing to the .patient DNA encoding said antagonist and expressing said antagonist in vivo.
16. A method for identifying compounds which bind to and activate the receptor polypeptide of claim 7 comprising: contacting a cell expressing on the surface thereof the receptor polypeptide, said receptor being associated with a second component capable of providing a detectable signal in response to the binding of a compound to said receptor polypeptide, with a compound under conditions sufficient to permit binding of the compound to the receptor polypeptide; and identifying if the compound is an effective agonist by detecting the signal produced by said second component.
17. A method for identifying compounds which bind to and inhibit activation the polypeptide of claim 7 comprising: contacting a cell expreεsing on the εurface thereof the receptor polypep ide, said receptor being associated with a second component capable of providing a detectable signal in response to the binding of a compound to εaid receptor polypeptide, wich a compound to be screened under conditions to permit binding to the receptor polypeptide; and determining whether the compound inhibits activation of the polypeptide by detecting the absence of a signal generated from the interaction of the ligand with the polypeptide.
18. A proceεs for diagnosing a disease or a susceptibility to a disease related to an under-expresεion of the polypeptide of claim 7 compriεing: determining a mutation in the nucleic acid εequence encoding εaid polypeptide.
19. The polypeptide of Claim 7 wherein the polypeptide iε a εoluble fragment of the polypeptide and iε capable of binding a ligand for the receptor.
20. A diagnoεtic process comprising: analyzing for the presence of the polypeptide of claim 19 in a sample derived from a host.
EP95921613A 1995-06-06 1995-06-06 Human g-protein chemokine receptor hdgnr10 Withdrawn EP0815137A4 (en)

Priority Applications (6)

Application Number Priority Date Filing Date Title
EP01108492A EP1146122A3 (en) 1995-06-06 1995-06-06 Human G-protein chemokine receptor HDGNR10 (CCR5 receptor)
EP01108495A EP1148127A3 (en) 1995-06-06 1995-06-06 Human G-protein chemokine receptor HDGNR10 (CCR5 receptor). Its uses
EP01108494A EP1145721A3 (en) 1995-06-06 1995-06-06 Human G-protein chemokine receptor HDGNR10 (CCR5 receptor). Pharmaceutical composition
EP01108493A EP1149582A3 (en) 1995-06-06 1995-06-06 Human G-protein chemokine receptor HDGNR10 (CCR5 receptor). Uses thereof
EP01108496A EP1146055A3 (en) 1995-06-06 1995-06-06 Antibody against Human G-protein chemokine receptor HDGNR10 (CCR5 receptor)
EP01108491A EP1148126A3 (en) 1995-06-06 1995-06-06 Human G-protein chemokine receptor HDGNR10 (CCR5 receptor)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
PCT/US1995/007173 WO1996039437A1 (en) 1995-06-06 1995-06-06 Human g-protein chemokine receptor hdgnr10
CA002216990A CA2216990A1 (en) 1995-06-06 1997-11-27 Human g-protein chemokine receptor hdgnr10

Related Child Applications (6)

Application Number Title Priority Date Filing Date
EP01108496A Division EP1146055A3 (en) 1995-06-06 1995-06-06 Antibody against Human G-protein chemokine receptor HDGNR10 (CCR5 receptor)
EP01108493A Division EP1149582A3 (en) 1995-06-06 1995-06-06 Human G-protein chemokine receptor HDGNR10 (CCR5 receptor). Uses thereof
EP01108494A Division EP1145721A3 (en) 1995-06-06 1995-06-06 Human G-protein chemokine receptor HDGNR10 (CCR5 receptor). Pharmaceutical composition
EP01108492A Division EP1146122A3 (en) 1995-06-06 1995-06-06 Human G-protein chemokine receptor HDGNR10 (CCR5 receptor)
EP01108495A Division EP1148127A3 (en) 1995-06-06 1995-06-06 Human G-protein chemokine receptor HDGNR10 (CCR5 receptor). Its uses
EP01108491A Division EP1148126A3 (en) 1995-06-06 1995-06-06 Human G-protein chemokine receptor HDGNR10 (CCR5 receptor)

Publications (2)

Publication Number Publication Date
EP0815137A1 true EP0815137A1 (en) 1998-01-07
EP0815137A4 EP0815137A4 (en) 1998-08-05

Family

ID=25679666

Family Applications (1)

Application Number Title Priority Date Filing Date
EP95921613A Withdrawn EP0815137A4 (en) 1995-06-06 1995-06-06 Human g-protein chemokine receptor hdgnr10

Country Status (5)

Country Link
EP (1) EP0815137A4 (en)
JP (1) JPH10510719A (en)
AU (1) AU2663295A (en)
CA (1) CA2216990A1 (en)
WO (1) WO1996039437A1 (en)

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7122185B2 (en) 2002-02-22 2006-10-17 Progenics Pharmaceuticals, Inc. Anti-CCR5 antibody
US7345153B2 (en) 1996-01-17 2008-03-18 Progenics Pharmaceuticals, Inc. Compounds capable of inhibiting HIV-1 infection
US7736649B2 (en) 2000-09-15 2010-06-15 Progenics Pharmaceuticals, Inc. Methods of inhibiting human immunodeficiency virus infection through the administration of synergistic combinations of anti-CCR5 monoclonal antibodies, fusion inhibitors, and CD4-GP120 binding inhibitors
US7858298B1 (en) 1996-04-01 2010-12-28 Progenics Pharmaceuticals Inc. Methods of inhibiting human immunodeficiency virus type 1 (HIV-1) infection through the administration of CCR5 chemokine receptor antagonists
US7862994B2 (en) 1995-06-07 2011-01-04 Progenics Pharmaceuticals Inc. Methods for inhibiting HIV-1 envelope glycoprotein-medicated membrane fusion
US8821877B2 (en) 2005-07-22 2014-09-02 Cytodyn Inc. Methods for inhibiting HIV-1 replication involving the administration of an anti-CCR5 receptor monoclonal antibody and small molecule CCR5 receptor antagonist

Families Citing this family (19)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6025154A (en) 1995-06-06 2000-02-15 Human Genome Sciences, Inc. Polynucleotides encoding human G-protein chemokine receptor HDGNR10
US6743594B1 (en) 1995-06-06 2004-06-01 Human Genome Sciences, Inc. Methods of screening using human G-protein chemokine receptor HDGNR10 (CCR5)
US6265184B1 (en) 1995-12-20 2001-07-24 Icos Corporation Polynucleotides encoding chemokine receptor 88C
ATE428785T1 (en) * 1996-03-01 2009-05-15 Euroscreen Sa ACTIVE AND INACTIVE CC CHEMOKINE RECEPTORS AND NUCLEIC ACID MOLECULES THAT CODE FOR THIS RECEPTOR
CA2252432A1 (en) * 1996-04-26 1997-11-06 Incyte Pharmaceuticals, Inc. Mammalian mixed lymphocyte receptors, chemokine receptors [mmlr-ccr]
WO1997045543A2 (en) 1996-05-28 1997-12-04 The Government Of The United States Of America, As Represented By The Secretary Of Health And Human Services, National Institutes Of Health Cc chemokine receptor 5, antibodies thereto, transgenic animals
AU3390297A (en) * 1996-06-14 1998-01-07 Aaron Diamond Aids Research Center, The Uses of a chemokine receptor for inhibiting hiv-1 infection
US5928881A (en) * 1996-07-11 1999-07-27 Smithkline Beecham Corporation Method of identifying agonists and antagonist for CC-CKR5 receptor
US6388055B1 (en) 1996-10-03 2002-05-14 Smithkline Beecham Corporation Mouse CC-CKR5 receptor polypeptide
US6528625B1 (en) 1996-10-28 2003-03-04 Millennium Pharmaceuticals, Inc. Anti-CCR5 antibodies and kits comprising same
US6153431A (en) * 1997-05-30 2000-11-28 Fond Mondiale Rech & Prev Sida Human immunodeficiency virus co-receptor variants associated with resistance to virus infection
US6204024B1 (en) 1997-09-12 2001-03-20 Akzo Nobel N.V. CCR5 RNA transcription based amplification assay
US6383746B1 (en) 1997-10-23 2002-05-07 The United States Of America As Represented By The Department Of Health And Human Services Functional promoter for CCR5
US6287805B1 (en) 1998-03-20 2001-09-11 Millennium Pharmaceuticals, Inc. Nucleic acid molecules of the protein-coupled heptahelical receptor superfamily and uses therefor
MXPA02007730A (en) * 2000-02-09 2002-10-11 Human Genome Sciences Inc Human g protein chemokine receptor (ccr5) hdgnr10.
EP1278838A2 (en) * 2000-03-27 2003-01-29 PE Corporation (NY) Isolated human g-protein coupled receptors, nucleic acid molecules encoding human gpcr proteins, and uses thereof
US7175988B2 (en) 2001-02-09 2007-02-13 Human Genome Sciences, Inc. Human G-protein Chemokine Receptor (CCR5) HDGNR10
US7393934B2 (en) 2001-12-21 2008-07-01 Human Genome Sciences, Inc. Human G-protein chemokine receptor (CCR5) HDGNR10
WO2005105841A2 (en) 2004-03-12 2005-11-10 Human Genome Sciences, Inc. Human g-protein chemokine receptor (ccr5) hdgnr10

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1995019436A1 (en) * 1994-01-13 1995-07-20 The Regents Of The University Of California Mammalian monocyte chemoattractant protein receptors

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1995019436A1 (en) * 1994-01-13 1995-07-20 The Regents Of The University Of California Mammalian monocyte chemoattractant protein receptors

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
CHARO I F ET AL: "MOLECULAR CLONING AND FUNCTIONAL EXPRESSION OF TWO MONOCYTE CHEMOATTRACTANT PROTEIN 1 RECEPTORS REVEALS ALTERNATIVE SPLICING OFTHE CARBOXYL-TERMINAL TAILS" PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF USA, vol. 91, 1 March 1994, pages 2752-2756, XP000571082 *
See also references of WO9639437A1 *
YAMAGAMI S ET AL: "CDNA CLONING AND FUNCTIONAL EXPRESSION OF A HUMAN MONOCYTE CHEMOATTRACTANT PROTEIN 1 RECEPTOR" BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS, vol. 202, no. 2, 29 July 1994, pages 1156-1162, XP000571066 *

Cited By (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7862994B2 (en) 1995-06-07 2011-01-04 Progenics Pharmaceuticals Inc. Methods for inhibiting HIV-1 envelope glycoprotein-medicated membrane fusion
US7901685B2 (en) 1995-06-07 2011-03-08 Progenics Pharmaceuticals Inc. Methods for assaying inhibition of HIV-1 envelope glycoprotein-mediated membrane fusion
US7345153B2 (en) 1996-01-17 2008-03-18 Progenics Pharmaceuticals, Inc. Compounds capable of inhibiting HIV-1 infection
US7858298B1 (en) 1996-04-01 2010-12-28 Progenics Pharmaceuticals Inc. Methods of inhibiting human immunodeficiency virus type 1 (HIV-1) infection through the administration of CCR5 chemokine receptor antagonists
US7935797B2 (en) 1996-04-01 2011-05-03 Progenics Pharmaceuticals Inc. CCR5 chemokine receptor-specific monoclonal antibodies capable of inhibiting HIV-1 cell fusion
US7736649B2 (en) 2000-09-15 2010-06-15 Progenics Pharmaceuticals, Inc. Methods of inhibiting human immunodeficiency virus infection through the administration of synergistic combinations of anti-CCR5 monoclonal antibodies, fusion inhibitors, and CD4-GP120 binding inhibitors
US7122185B2 (en) 2002-02-22 2006-10-17 Progenics Pharmaceuticals, Inc. Anti-CCR5 antibody
US7666419B2 (en) 2002-02-22 2010-02-23 Progenics Pharmaceuticals Inc. Anti-CCR5 antibody
US7851600B2 (en) 2002-02-22 2010-12-14 Progenics Pharmaceuticals Inc. Anti-CCR5 antibody
US8821877B2 (en) 2005-07-22 2014-09-02 Cytodyn Inc. Methods for inhibiting HIV-1 replication involving the administration of an anti-CCR5 receptor monoclonal antibody and small molecule CCR5 receptor antagonist

Also Published As

Publication number Publication date
AU2663295A (en) 1996-12-24
EP0815137A4 (en) 1998-08-05
JPH10510719A (en) 1998-10-20
WO1996039437A1 (en) 1996-12-12
CA2216990A1 (en) 1997-12-27

Similar Documents

Publication Publication Date Title
US6511826B2 (en) Polynucleotides encoding human G-protein chemokine receptor (CCR5) HDGNR10
US6743594B1 (en) Methods of screening using human G-protein chemokine receptor HDGNR10 (CCR5)
WO1996039437A1 (en) Human g-protein chemokine receptor hdgnr10
US20110201030A1 (en) Human G-Protein Chemokine Receptor (CCR5) HDGNR10
EP0822984A1 (en) Human tumor necrosis factor receptors
EP0817800A1 (en) Human g-protein coupled receptors
WO1996039521A1 (en) Human chemokine beta-13
WO1996016087A1 (en) G-protein coupled receptor
WO1997025340A1 (en) Human g-protein chemokine receptor hsatu68
EP1149582A2 (en) Human G-protein chemokine receptor HDGNR10 (CCR5 receptor). Uses thereof
EP1145721A2 (en) Human G-protein chemokine receptor HDGNR10 (CCR5 receptor)
EP0835264A1 (en) Human g-protein receptor hcegh45
US20040126371A9 (en) Immune cell cytokine
WO1997018224A1 (en) Human stem cell antigen 2
WO1996039438A1 (en) G-protein receptor hibeb69
EP0832124A1 (en) Human amine receptor
EP0833846A1 (en) Human g-protein coupled receptor (hetgq23)
WO1996025432A1 (en) Human g-protein coupled receptor
US20060014243A1 (en) Human G-protein chemokine receptor HSATU68
EP0871668A1 (en) Human g-protein receptor hibef51
CA2216912A1 (en) Human g-protein chemokine receptor hdgnr10

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 19970718

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LI LU MC NL PT SE

A4 Supplementary search report drawn up and despatched

Effective date: 19980622

AK Designated contracting states

Kind code of ref document: A4

Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LI LU MC NL PT SE

RHK1 Main classification (correction)

Ipc: C12N 15/12

17Q First examination report despatched

Effective date: 19981028

RIN1 Information on inventor provided before grant (corrected)

Inventor name: RUBEN, STEVEN, M.

Inventor name: LI, YI

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20010405

RIN1 Information on inventor provided before grant (corrected)

Inventor name: RUBEN, STEVEN, M.

Inventor name: LI, YI