US20040235774A1

US20040235774A1 - Immunostimulatory nucleic acids for the treatment of asthma and allergy

Info

Publication number: US20040235774A1
Application number: US10/831,778
Authority: US
Inventors: Robert Bratzler; Deanna Petersen; Yves Fouron
Original assignee: Coley Pharmaceutical Group Inc
Current assignee: Coley Pharmaceutical Group Inc
Priority date: 2000-02-03
Filing date: 2004-04-23
Publication date: 2004-11-25
Also published as: US20040067902A9; US20060154890A1; US20030087848A1; US20070037767A1; US7585847B2

Abstract

The invention involves administration of an immunostimulatory nucleic acid alone or in combination with an asthma/allergy medicament for the treatment or prevention of asthma and allergy in subjects. The combination of drugs are administered in synergistic amounts or in various dosages or at various time schedules. The invention also relates to kits and compositions concerning the combination of drugs.

Description

PRIORITY OF THE INVENTION

This application claims priority under Title 35 § 119(e), of U.S. Provisional Application No. 60/179,991, filed Feb. 3, 2000, entitled IMMUNOSTIMULATORY NUCLEIC ACIDS FOR THE TREATMENT OF ASTHMA AND ALLERGY, the entire contents of which are incorporated herein by reference.[0001]

BACKGROUND OF THE INVENTION

Asthma is a chronic inflammatory disease effecting 14-15 million persons in the U.S. alone. Symptoms of asthma include recurrent episodes of wheezing, breathlessness, and chest tightness, and coughing, resulting from airflow obstruction. Airway inflammation associated with asthma can be detected through observation of a number of physiological changes, such as, denudation of airway epithelium, collagen deposition beneath basement membrane, edema, mast cell activation, inflammatory cell infiltration, including neutrophils, eosinophils, and lymphocytes. As a result of the airway inflammation, asthma patients often experience airway hyper-responsiveness, airflow limitation, respiratory symptoms, and disease chronicity. Airflow limitations include acute bronchoconstriction, airway edema, mucous plug formation, and airway remodeling, features which often lead to bronchial obstruction. In some cases of asthma, subbasement membrane fibrosis may occur, leading to persistent abnormalities in lung function.

Research over the past several years has revealed that asthma likely results from complex interactions among inflammatory cells, mediators, and other cells and tissues resident in the airway. Mast cells, eosinophils, epithelial cells, macrophage, and activated T-cells all play an important role in the inflammatory process associated with asthma (Djukanovic et al., Am. Rev. Respir. Dis; 142:434-457; 1990). It is believed that these cells can influence airway function through secretion of preformed and newly synthesized mediators which can act directly or indirectly on the local tissue. It has also been recognized that subpopulations of T-lymphocytes (TH-2) play an important role in regulating allergic inflammation in the airway by releasing selective cytokines and establishing disease chronicity (Robinson, et al. N. Engl. J. Med.; 326:298-304; 1992).

Asthma is a complex disorder which arises at different stages in development and can be classified based on the degree of symptoms of acute, subacute or chronic. An acute inflammatory response is associated with an early recruitment of cells into the airway. The subacute inflammatory response involves the recruitment of cells as well as the activation of resident cells causing a more persistent pattern of inflammation. Chronic inflammatory response is characterized by a persistent level of cell damage and an ongoing repair process, which may result in permanent abnormalities in the airway.

Medications for the treatment of asthma are generally separated into two categories, quick-relief medications and long-term control medications. Asthma patients take the long-Jo term control medications on a daily basis to achieve and maintain control of persistent asthma. Long-term control medications include anti-inflammatory agents such as corticosteroids, chromolyn sodium and medacromil; long-acting bronchodilators, such as long-acting β ₂-agonists and methylxanthines; and leukotriene modifiers. The quick-relief medications include short-acting β₂agonists, anti-cholinergics, and systemic corticosteroids. There are many side effects associated with each of these drugs and none of the drugs alone or in combination is capable of preventing or completely treating asthma.

Allergy is a disease associated with the production of antibodies from a particular class of immunoglobulin, IgE, against allergens. The development of an IgE-mediated response to common aeroallergens is also a factor which indicates predisposition towards the development of asthma. If an allergen encounters a specific IgE which is bound to an Fc IgE receptor on the surface of a basophil (circulating in the blood) or mast cell (dispersed throughout solid tissue), the cell becomes activated, resulting in the production and release of mediators such as histamine, scrotonin, and lipid mediators. Allergic diseases include but are not limited to rhinitis (hay fever) asthma, urticaria and atopic dermatitis.

Conventional methods for treating or preventing allergy have involved the use of anti-histamines or desensitization therapies. Anti-histamines and other drugs which block the effects of chemical mediators of the allergic reaction help to regulate the severity of the allergic symptoms but do not prevent the allergic reaction and have no effect on subsequent allergic responses. Desensitization therapies are performed by giving small doses of an allergen, usually by injection under the skin, in order to induce an IgG-type response against the allergen. The presence of IgG antibody helps to neutralize the production of mediators resulting from the induction of IgE antibodies, it is believed. Initially, the subject is treated with a very low dose of the allergen to avoid inducing a severe reaction and the dose is slowly increased. This type of therapy is dangerous because the subject is actually administered the compounds which cause the allergic response and severe allergic reactions can result.

SUMMARY OF THE INVENTION

Improved methods and products for the prevention and/or treatment of asthma and allergy are provided according to the invention. The invention is based, in some aspects, on the finding that when immunostimulatory nucleic acid molecules are used in conjunction with medicaments for the treatment of asthma and allergy, some unexpected and improved results are observed. For instance, the efficacy of the combination of immunostimulatory nucleic acids and asthma and allergy medicaments is profoundly improved over the use of each of the medicaments alone. The results are surprising in part because the drugs act through different mechanisms and would not necessarily be expected to improve the efficacy of one another in a synergistic manner.

In some aspects, the invention is a method for preventing or treating asthma or allergy by administering a synergistic combination of an immunostimulatory nucleic acid and an asthma/allergy medicament, wherein the combination is administered in an effective amount for synergistically reducing the immune or inflammatory response caused by a mediator of asthma or allergy. It was surprisingly discovered according to the invention that the combination of the immunostimulatory nucleic acid and the asthma/allergy medicament worked synergistically to reduce the immune or inflammatory response initiated when a mediator of asthma or allergy is encountered.

In other aspects, the invention is a method for altering the dosage of the asthma/allergy medicament that is required to treat a subject suffering from asthma or allergy. The invention in one aspect is a method for increasing the dose of an asthma/allergy medicament without inducing the level of side effects ordinarily observed with that dose of an asthma/allergy medicament. The method is accomplished by administering to a subject suffering from asthma or allergy or at risk of developing asthma or allergy, an asthma/allergy medicament in a dose which would ordinarily induce side effects, administering an immunostimulatory nucleic acid to the subject, wherein administration of the immunostimulatory nucleic acid prevents the side effects associated with the high dose of the asthma/allergy medicament. The method provides a basis for administering higher therapeutic doses of an asthma/allergy medicament to a subject in order to prevent or reduce the symptoms associated with an asthmatic or an allergic response more sufficiently than a lower dose. It is not desirable to administer such high doses alone, in the absence of the immunostimulatory nucleic acid, because of the side effects resulting from the high dose.

In another aspect, the invention includes a method for decreasing the dose of an asthma/allergy medicament by administering to a subject having asthma or allergy or at risk of developing asthma or allergy an asthma/allergy medicament in a sub-therapeutic dosage and an immunostimulatory nucleic acid, wherein the combination of the sub-therapeutic dose of the asthma/allergy medicament and the immunostimulatory nucleic acid produce a therapeutic result in the prevention or treatment of asthma or allergy in the subject. The method allows a lower dose of the asthma/allergy medicament to be used. This provides several advantages, including lower costs associated with using less drugs and less chances of inducing side effects resulting from the medications by using lower doses.

According to other aspects, the invention involves methods for treating or preventing asthma and/or allergy by administering an immunostimulatory nucleic acid and an asthma/allergy medicament in different dosing schedules. In one aspect, the invention is a method for preventing or treating asthma or allergy by administering to a subject an effective amount of an immunostimulatory nucleic acid in an effective amount for producing the immune response and subsequently administering to the subject an asthma/allergy medicament. In other aspects, the invention is a method for preventing or treating asthma or allergy by administering to a subject an allergy/asthma medicament in an effective amount for providing some symptomatic relief and subsequently administering an immunostimulatory nucleic acid to the subject. In some embodiments, the immunostimulatory nucleic acid is administered in an effective amount for redirecting the immune response from a Th2 to a Th1 immune response. In some embodiments, the immunostimulatory nucleic acid is administered consistently over a period of time, such as, for instance, in a sustained release vehicle.

In another aspect of the invention is a method for treating asthma or allergy by administering to a subject having asthma or allergy or at risk of developing asthma or allergy an immunostimulatory nucleic acid and an asthma/allergy medicament, wherein the immunostimulatory nucleic acid is administered systemically and the asthma/allergy medicament is administered locally. In yet another aspect, the immunostimulatory nucleic acid is administered locally and the asthma/allergy medicament is administered systemically.

According to yet another aspect of the invention, a method for treating or preventing asthma/allergy is provided. The method is accomplished by administering to a subject having asthma or allergy or at risk of developing asthma or allergy, an immunostimulatory nucleic acid and an asthma/allergy medicament on a routine schedule. In some embodiments, the routine schedule is a daily, weekly, monthly, or quarterly administration of the medicaments. In other embodiments, the immunostimulatory nucleic acid and/or the asthma/allergy medicament is administered in two or more doses.

The immunostimulatory nucleic acid can be administered on a recurring basis, such as daily, weekly, or monthly in one or more doses. Alternatively, it can be administered on a non-regular basis e.g. whenever symptoms being. In yet other embodiments, the asthma/allergy medicament is a quick relief asthma/allergy medicament and in other embodiments it is a long-lasting asthma/allergy medicament.

According to yet another aspect of the invention, methods for treating or preventing asthma or allergy using specific immunostimulatory nucleic acid molecules are provided. The method in one aspect involves a method for preventing or treating asthma or allergy by administering to a subject suffering from asthma or allergy or at risk of developing asthma or allergy, an immunostimulatory nucleic acid having a sequence selected from the group consisting of SEQ ID NO: 1 through to SEQ ID NO: 1093 and administering to the subject an asthma/allergy medicament.

In yet another aspect of the invention, a method for preventing or treating asthma or allergy utilizing different routes of administration is provided. In one aspect, the method involves the step of administering toga subject having asthma or allergy or at risk of developing asthma or allergy, an immunostimulatory nucleic acid, wherein the immunostimulatory is administered systemically and wherein the asthma/allergy medicament is administered locally. In a related embodiment, the immunostimulatory nucleic acid molecule may be administered locally and the asthma/allergy medicament is administered systemically. In still other embodiments, the immunostimulatory nucleic acid and the asthma/allergy medicament are administered by the same route (i.e., both delivered locally or both delivered systemically), and optionally at the same time.

The invention according to another aspect is a method of preventing or treating asthma or allergy by administering a poly-G nucleic acid, in an effective amount for treating or preventing asthma or allergy. In some embodiments the poly-G nucleic acid is administered alone and in other embodiments the poly-G nucleic acid is administered in conjunction with an asthma/allergy medicament. The poly-G nucleic acid in preferred embodiments comprises one of the following formulas: 5′ X ₁X₂GGGX₃X₄3′, wherein X₁, X₂, X₃, and X₄are nucleotides, 5′ GGGNGGG 3′ or 5′ GGGNGGGNGGG 3′, wherein N represents between 0 and 20 nucleotides. In some embodiments at least one of X₃and X₄are a G and in other embodiments both of X₃and X₄are a G. Accordingly, in some embodiments, the poly-G nucleic acid may comprise a sequence of 5′ X₁X₂GGGGX₄3′. In still other embodiments, the poly-G nucleic acid is one which is rich in G (e.g., six out of seven bases are G, or six out of eight bases are G).

The poly-G may be free of unmethylated CG dinucleotides, or may include at least one unmethylated CG dinucleotide.

The poly G nucleic acid in some embodiments is selected from the group consisting of SEQ ID NO: 5, 6, 73, 215, 267-269, 276, 282, 288, 297-299, 355, 359, 386, 387, 444, 476, 531, 557-559, 733, 768, 795, 796, 914-925, 928-931, 933-936, and 938. In other embodiments the poly G nucleic acid includes a sequence selected from the group consisting of SEQ ID NO: 67, 80-82, 141, 147, 148, 173, 178, 183, 185, 214, 224, 264, 265, 315, 329, 434, 435, 475, 519, 521-524, 526, 527, 535, 554, 565, 609, 628, 660, 661, 662, 725, 767, 825, is 856, 857, 876, 892, 909, 926, 927, 932, and 937.

The invention provides, in yet another aspect, a method for treating or preventing asthma or allergy in a hypo-responsive subject. The method involves administering to a hypo-responsive subject having asthma or allergy or at risk of developing asthma or allergy an immunostimulatory nucleic acid. In one embodiment, the method further comprises administering to the hypo-responsive subject an asthma/allergy medicament. If the asthma/allergy medicament is not administered to the hypo-responsive subject, then the immunostimulatory nucleic acid is administered in an amount to treat or prevent the asthma or allergy. If the asthma/allergy medicament is administered to the hypo-responsive subject, then the immunostimulatory nucleic acid and the asthma/allergy medicament are administered in an effective amount to treat or prevent the asthma or allergy. In this latter instance, the amount of the immunostimulatory nucleic acid and the amount of the asthma/allergy medicament may be insufficient (i.e., ineffective) in treating or preventing the asthma or allergy if administered alone. In other words, in some embodiments, the immunostimulatory nucleic acid may be administered to the hypo-responsive subject in a sub-therapeutic amount. Similarly, the asthma/allergy medicament may also be administered in a sub-therapeutic amount. However, the combination of the immunostimulatory nucleic acid and the asthma/allergy medicament allows for lower doses of one or both in order to treat or prevent the asthma or allergy. The immunostimulatory nucleic acid may be administered concurrently with the asthma/allergy medicament, but need not be.

The hypo-responsive subject may be one who is hypo-responsive to an asthma/allergy medicament. In one embodiment, the hypo-responsive subject is selected from the group consisting of a subject who is refractory to an asthma/allergy medicament, a subject who is a non-responder to an asthma/allergy medicament, an elderly subject and a neonatal subject.

According to yet another aspect of the invention, a method is provided for preventing asthma or allergy in a subject at risk of developing asthma or allergy which involves administering to a subject at risk of developing asthma or allergy an effective amount of an immunostimulatory nucleic acid substantially prior to an asthmatic or an allergic event.

In one embodiment, the immunostimulatory nucleic acid is administered at least three months, at least two months, at least one month, or at least 20 days prior to the asthmatic or allergic event. In another embodiment, the immunostimulatory nucleic acid is administered at least two weeks prior to the asthmatic or allergic event. In yet another embodiment, the immunostimulatory nucleic acid is administered at least 10 days, at least 5 days or at least 2 days prior to the asthmatic or allergic event.

In one embodiment, the asthmatic or allergic event is selected from the group consisting of an asthma attack, seasonal allergic rhinitis, and perennial allergic rhinitis.

In one embodiment, the immunostimulatory nucleic acid is administered in a routine schedule. In a related embodiment, the routine schedule is selected from the group consisting of a daily routine, a weekly routine, a bi-weekly routine, a monthly routine, and a bi-monthly routine.

In a further aspect, the invention provides another method for decreasing a dose of an asthma/allergy medicament. The method involves administering to a subject at risk of developing asthma or allergy, substantially prior to an asthmatic or allergic event, an immunostimulatory nucleic acid in an amount to decrease an effective amount of an asthma/allergy medicament subsequently administered to the subject in order to treat the asthma or allergy.

In one embodiment, the immunostimulatory nucleic acid is administered at least three months, at least two months, at least one month or at least 20 days prior to the asthmatic or allergic event. In another embodiment, the immunostimulatory nucleic acid is administered at least two weeks, at least 10 days, at least one week, at least 5 days or at least 2 days prior to the asthmatic or allergic event.

In one embodiment, the immunostimulatory nucleic acid is administered in a routine schedule. The routine schedule may be selected from the group consisting of a daily routine, a weekly routine, a bi-weekly routine, a monthly routine, and a bimonthly routine.

The method may further comprise administering to the subject the asthma/allergy medicament subsequent to the administration of the immunostimulatory nucleic acid. In one embodiment, the asthma/allergy medicament is administered immediately prior to, concurrently with, or following the asthmatic or allergic event. The method may further comprise administering the immunostimulatory nucleic acid concurrently with or following the asthmatic or allergic event. In one embodiment, the immunostimulatory nucleic acid is administered concurrently with the asthma/allergy medicament. In one embodiment, the asthma/allergy medicament is administered in a sub-therapeutic dose.

In these and other aspects of the invention, the immunostimulatory nucleic acids have a number of attributes. The immunostimulatory nucleic acids may have a modified backbone. In some embodiments, the modified backbone is a phosphate modified backbone, and in related embodiments, the phosphate modified backbone is a phosphorothioate backbone. In certain embodiments, the immunostimulatory nucleic acid is a CpG nucleic acid, in other embodiments, the immunostimulatory nucleic acid is a T-rich nucleic acid, while in still other embodiments, the immunostimulatory nucleic acid is a poly-G nucleic acid. Preferably, the T-rich and poly-G nucleic acids are also CpG nucleic acids. In still other embodiments, the immunostimulatory nucleic acid comprises a poly-G motif (e.g., 5′ GGGG 3′) and a palindrome. Preferably, the immunostimulatory nucleic acid comprises two poly-G motifs, one 5′ and one 3′ to a centrally located palindrome sequence. Even more preferably, the backbone of these latter immunostimulatory nucleic acids is chimeric (i.e., it is partially, but riot completely, composed of phosphorothioate linkages). In some embodiments, a plurality of immunostimulatory nucleic acids is administered, wherein the plurality comprises CpG nucleic acids and T-rich nucleic acids, or CpG nucleic acids and poly-G nucleic acids, or T-rich nucleic acids and poly-G nucleic acids.

In these and other aspects of the invention, the asthma/allergy medicaments have a number of attributes. In some embodiments, the asthma/allergy medicament is an asthma medicament, while in still other embodiments, the asthma/allergy medicament is an allergy medicament.

In some embodiments, the asthma/allergy medicament is selected from the group consisting of a steroid and an immunomodulator. In certain embodiments, the steroid may be selected from the group consisting of beclomethasone, fluticasone, tramcinolone, budesonide, and budesonide. In certain embodiments, the immunomodulator may be selected from the group consisting of an anti-inflammatory agent, a leukotriene antagonist, an IL-4 mutein, a soluble IL-4 receptor, an immunosuppressant, anti-IL-4 antibody, an IL-4 antagonist, an anti-IL-5 antibody, a soluble IL-13 receptor-Fc fusion protein, an anti-IL-9 antibody, a CCR3 antagonist, a CCR5 antagonist, a VLA-4 inhibitor, and a downregulator of IgE. The downregulator of IgE may be an anti-Ig antibody or a fragment thereof, but need not be so limited. The immunosuppressant may be a tolerizing peptide vaccine, but need not be so limited.

In some embodiments, the asthma/allergy medicament is a medicament selected from the group consisting of a PDE-4 inhibitor, a bronchodilator/beta-2 agonist, a K+ channel opener, a VLA-4 antagonist, a neurokin antagonist, a TXA2 synthesis inhibitor, Xanthanine, an arachidonic acid antagonist, a 5 lipoxygenase inhibitor, a thromboxin A2 receptor antagonist, a thromboxane A2 antagonist, an inhibitor of 5-lipox activation-protein, and a protease inhibitor. In certain embodiments, the bronchodilator/beta-2 agonist may be selected from the group consisting of salmeterol, salbutamol, terbutaline, D2522/formoterol, fenoterol and orciprenaline.

In some embodiments, the asthma/allergy medicament is a medicament selected from the group consisting of an anti-histamine and a prostaglandin inducer. In certain embodiments, the anti-histamine is selected from the group consisting of loratidine, cetirizine, buclizine, ceterizine analogues, fexofenadine, terfenadine, desloratadine, norastemizole, epinastine, ebastine, ebastine, astemizole, levocabastine, azelastine, tranilast, terfenadine, mizolastine, betatastine, CS 560 and HSR 609. The prostaglandin inducer may-be S-5751, but is not so limited.

In still other embodiments, the asthma/allergy medicament is a prostaglandin inhibitor in the form of a cyclooxygenase-2 (COX-2) inhibitor. The COX-2 inhibitor may be selected from the group consisting of celecoxib, rofecoxib, NS-398, 1-745,337, meloxicam, nimesulide, SC236, and C-phycocyanin.

A composition comprising a poly-G nucleic acid in an aerosol formulation is provided according to other aspects of the invention.

A kit is provided according to another aspect of the invention. The kit in one aspect includes a sustained-release vehicle containing an immunostimulatory nucleic acid and at least one container housing an asthma/allergy medicament, and instructions for timing of administration of the immunostimulatory nucleic acid and the asthma/allergy medicament. In another aspect, the kit includes containers for multiple administrations of immunostimulatory nucleic acid and/or multiple administrations of immunostimulatory nucleic acid and at least one container housing an asthma/allergy medicament.

A composition is provided according to another aspect of the invention. The composition includes an immunostimulatory nucleic acid and an asthma/allergy medicament, formulated in a pharmaceutically-acceptable carrier and in an effective amount for preventing or treating an immune response associated with exposure to a mediator of asthma or allergy.

Formulations of poly-G nucleic acids are also encompassed by the invention. For instance the invention includes a pharmaceutical composition of a poly-G nucleic acid in an aerosol formulation.

The immunostimulatory nucleic acid may be any of the immunostimulatory nucleic acids described above, and may have any of the attributes of the immunostimulatory nucleic acids described above which are useful in other aspects of the invention.

The asthma/allergy medicament may be any of the asthma medicaments-or allergy medicaments described above which are useful in other aspects of the invention.

Each of the limitations of the invention can encompass various embodiments of the invention. It is, therefore, anticipated that each of the limitations of the invention involving any one element or combinations of elements can be included in each aspect of the invention.

DETAILED DESCRIPTION OF THE INVENTION

The invention relates to methods and products for the treatment of asthma/allergy using a combination of immunostimulatory nucleic acids and asthma/allergy medicaments. The compositions can be administered in higher doses without as many side effects as are ordinarily achieved at those dosage levels or in lower doses with higher efficacy than is ordinarily achieved with those doses. The compositions can also be administered on-fixed schedules or in different temporal relationships to one another. The various combinations have many advantages over the prior art methods of treating asthma and allergy. [0045]
One method for treating or preventing asthma or allergy includes the step of administering a synergistic combination of an immunostimulatory nucleic acid and an asthma/allergy medicament in an effective amount to treat or prevent the asthma or allergy. [0046]
An “immunostimulatory nucleic acid” as used herein is any nucleic acid containing an immunostimulatory motif or backbone that induces a Th1 immune response and/or suppresses a Th2 immune response. Immunostimulatory motifs include, but are not limited to, CpG motifs, poly-G motifs, and T-rich motifs. Immunostimulatory backbones include, but are not limited to, phosphate modified backbones, such as phosphorothioate backbones. Immunostimulatory nucleic acids have been described extensively in the prior art and a brief summary of these nucleic acids is presented below. [0047]
The immunostimulatory nucleic acids when combined with the asthma/allergy medicaments have many advantages over each composition alone for the treatment of asthma so and allergy. The immunostimulatory nucleic acid functions in some aspects by simultaneously suppressing Th2-type immune responses (IL-4, IgE production, histamine release) that can result in airway inflammation and bronchial spasm, and/or inducing Th1-type immune responses (IFN-γ and IL-12 production) that promote harmless antibody and cellular responses. This creates an environment inside the body that safely and effectively prevents hypersensitive reactions from occurring, thereby eliminating symptoms. [0048]
The immunostimulatory nucleic acids eliminate/reduce bronchial hyperreactivity, bronchoconstriction, bronchial obstruction, airway inflammation and atopy (which improves asthma control, normalizes lung function, prevents irreversible airway injury); and may also inhibit acute response to exercise, cold dry air, and SO[0049] ₂. The nucleic acids provide long-lasting effects, thus reducing dosing regimes, improving compliance and maintenance therapy, reducing emergency situations; and improving quality of life. These compounds are also useful because they provide early anti-infective activity, which leads to decreasing infectious episodes, which further reduces hyperreactive immune responses. This is especially true in subjects like children or immuno-compromised subjects. Furthermore, use of the immunostimulatory nucleic acids reduces/eliminates use of inhalers, which can exacerbate hypersensitive reactions by providing simpler and safer delivery and by allowing less drugs to be used.
Immunostimulatory nucleic acids stimulate the immune system to prevent or treat allergy and/or asthma. The strong yet balanced, cellular and humoral immune-responses that result from the nucleic acid's stimulation reflect the body's own natural defense system against invading allergens and initiators. [0050]
The terms “nucleic acid” and “oligonucleotide” are used interchangeably to mean multiple nucleotides (i.e. molecules comprising a sugar (e.g. ribose or deoxyribose) linked to a phosphate group and to an exchangeable organic base, which is either a substituted pyrimidine (e.g. cytosine (C), thymine (T) or uracil (U)) or a substituted purine (e.g. adenine (A) or guanine (G)). As used herein, the terms refer to oligoribonucleotides as well as oligodeoxyribonucleotides. The terms shall also include polynucleosides (i.e. a polynucleotide minus the phosphate) and any other organic base containing polymer. Nucleic acids include vectors, e.g., plasmids as well as oligonucleotides. Nucleic acid molecules can be obtained from existing nucleic acid sources (e.g. genomic or cDNA), but are preferably synthetic (e.g. produced by oligonucleotide synthesis). [0051]

Exemplary immunostimulatory nucleic acids as those described herein as well as various control nucleic acids include but are-not limited to those presented in Table 1.

TABLE 1


SEQ ID NO:	ODN SEQUENCE	BACKBONE

1	tctcccagcgtgcgccat	s

2	ataatccagcttgaaccaag	s

3	ataatcgacgttcaagcaag	s

4	taccgcgtgcgaccctct	s

5	ggggagggt	s

6	ggggagggg	s

7	ggtgaggtg	s

8	tccatgtzgttcctgatgct	o

9	gctaccttagzgtga	o

10	tccatgazgttcctgatgct	o

11	tccatgacgttcztgatgct	o

12	gctagazgttagtgt	o

13	agctccatggtgctcactg	s

14	ccacgtcgaccctcaggcga	s

15	gcacatcgtcccgcagccga	s

16	gtcactcgtggtacctcga	s

17	gttggatacaggccagactttgttg	o

18	gattcaacttgcgatcatcttaggc	o

19	accatggacgaactgtttcccctc	s

20	accatggacgagctgtttcccctc	s

21	accatggacgacctgtttcccctc	s

22	accatggacgtactgtttcccctc	s

23	accatggacggtctgtttcccctc	s

24	accatggacgttctgtttcccctc	s

25	ccactaacatctgctgctccacaag	o

26	acttctcatagtccctttggtccag	o

27	tccatgagcttcctgagtct	o

28	gaggaaggigiggaigacgt	o

29	gtgaaticgttcicgggict	o

30	aaaaaa	s

31	cccccc	s

32	ctgtca	s

33	tcgtag	s

34	tcgtgg	s

35	cgtcgt	s

36	tccatgtcggtcctgagtct	sos

37	tccatgccggtcctgagtct	sos

38	tccatgacggtcctgagtct	sos

39	tccatgacggtcctgagtct	sos

40	tccatgtcgatcctgagtct	sos

41	tccatgtcgctcctgagtct	sos

42	tccatgtcgttcctgagtct	sos

43	tccatgacgttcctgagtct	sos

44	tccataacgttcctgagtct	sos

45	tccatgacgtccctgagtct	sos

46	tccatcacgtgcctgagtct	sos

47	tccatgctggtcctgagtct	sos

48	tccatgtzggtcctgagtct	sos

49	ccgcttcctccagatgagctcatgggtttctccaccaag	o

50	cttggtggagaaacccatgagctcatctggaggaagcgg	o

51	ccccaaagggatgagaagtt	o

52	agatagcaaatcggctgacg	o

53	ggttcacgtgctcatggctg	o

54	tctcccagcgtgcgccat	s

55	tctcccagcgtgcgccat	s

56	taccgcgtgcgaccctct	s

57	ataatccagcttgaaacaag	s

58	ataatcgacgttcaagcaag	s

59	tccatgattttcctgatttt	o

60	ttgtttttttgtttttttgttttt	s

61	ttttttttgtttttttgttttt	o

62	tgctgcttttgtgcttttgtgctt	s

63	tgctgcttgtgcttttgtgctt	o

64	gcattcatcaggcgggcaagaat	o

65	taccgagcttcgacgagatttca	o

66	gcatgacgttgagct	s

67	cacgttgaggggcat	s

68	ctgctgagactggag	s

69	tccatgacgttcctgacgtt	s

70	gcatgagcttgagctga	o

71	tcagcgtgcgcc	s

72	atgacgttcctgacgtt	s

73	ttttggggttttggggtttt	s

74	tctaggctttttaggcttcc	s

75	tgcattttttaggccaccat	s

76	tctcccagcgtgcgtgcgccat	s

77	tctcccagcgggcgcat	s

78	tctcccagcgagcgccat	s

79	tctcccagcgcgcgccat	s

80	ggggtgacgttcagggggg	sos

81	ggggtcaagcgtgcgccatggggg	sos

82	ggggtgtcgttcagggggg	sos

83	tccatgtcgttcctgtcgtt	s

84	tccatagcgttcctagcgtt	s

85	tcgtcgctgtctccgcttctt	s

86	gcatgacgttgagct	sos

87	tctcccagcgtgcgccatat	sos

88	tccatgazgttcctgazgtt	s

89	gcatgazgttgagct	o

90	tccagcgtgcgccata	sos

91	tctcccagcgtgcgccat	o

92	tccatgagcttcctgagtct	o

93	gcatgtcgttgagct	sos

94	tcctgacgttcctgacgtt	s

95	gcatgatgttgagct	o

96	gcatttcgaggagct	o

97	gcatgtagctgagct	o

98	tccaggacgttcctagttct	o

99	tccaggagcttcctagttct	o

100	tccaggatgttcctagttct	o

101	tccagtctaggcctagttct	o

102	tccagttcgagcctagttct	o

103	gcatggcgttgagct	sos

104	gcatagcgttgagct	sos

105	gcattgcgttgagct	sos

106	gcttgcgttgcgttt	sos

107	tctcccagcgttgcgccatat	sos

108	tctcccagcgtgagttatat	sos

109	tctccctgcgtgcgccatat	sos

110	tctgcgtgcgtgcgccatat	505

111	tctcctagcgtgcgccatat	sos

112	tctcccagcgtgcgcctttt	sos

113	gctandcghhagc	o

114	tcctgacgttccc	o

115	ggaagacgttaga	o

116	tcctgacgttaga	o

117	tcagaccagctggtcgggtgttcctga	o

118	tcaggaacacccgaccagctggtctga	o

119	gctagtcgatagc	o

120	gctagtcgctagc	o

121	gcttgacgtctagc	o

122	gcttgacgtttagc	o

123	gcttgacgtcaagc	o

124	gctagacgtttagc	o

125	tccatgacattcctgatgct	o

126	gctagacgtctagc	o

127	ggctatgtcgttcctagcc	o

128	ggctatgtcgatcctagcc	o

129	ctcatgggtttctccaccaag	o

130	cttggtggagaaacccatgag	o

131	tccatgacgttcatagttct	o

132	ccgcttcctccagatgagctcatg	o

133	catgagctcatctggaggaagcgg	o

134	ccagatgagctcatgggtttctcc	o

135	ggagaaacccatgagctcatctgg	o

136	agcatcaggaacgacatgga	o

137	tccatgacgttcctgacgtt	rna

138	gcgcgcgcgcgcgcgcgcg	o

139	ccggccggccggccggccgg	o

140	ttccaatcagccccacccgctctggccccaccctcaccctcca	o

141	tggagggtgagggtggggccagagcgggtggggctgattggaa	o

142	tcaaatgtgggattttcccatgagtct	o

143	agactcatgggaaaatcccacatttga	o

144	tgccaagtgctgagtcactaataaaga	o

145	tctttattagtgactcagcacttggca	o

146	tgcaggaagtccgggttttccccaacccccc	o

147	ggggggttggggaaaacccggacttcctgca	o

148	ggggactttccgctggggactttccagggggactttcc	sos

149	tccatgacgttcctctccatgacgttcctctccatgacgttaatc	o

150	gaggaacgtcatggagaggaacgtcatggagaggaacgtcatgga	o

151	ataatagagcttcaagcaag	s

152	tccatgacgttcctgacgtt	s

153	tccatgacgttcctgacgtt	sos

154	tccaggactttcctcaggtt	s

155	tcttgcgatgctaaaggacgtcacattgcacaatcttaataaggt	o

156	accttattaagattgtgcaatgtgacgtcctttagcatcgcaaga	o

157	tcctgacgttcctggcggtcctgtcgct	o

158	tcctgtcgctcctgtcgct	o

159	tcctgacgttgaagt	o

160	tcctgtcgttgaagt	o

161	tcctggcgttgaagt	o

162	tcctgccgttgaagt	o

163	tccttacgttgaagt	o

164	tcctaacgttgaagt	o

165	tcctcacgttgaagt	o

166	tcctgacgatgaagt	o

167	tcctgacgctgaagt	o

168	tcctgacggtgaagt	o

169	tcctgacgtagaagt	o

170	tcctgacgtcgaagt	o

171	tcctgacgtggaagt	o

172	tcctgagcttgaagt	o

173	gggggacgttggggg	o

174	tcctgacgttccttc	o

175	tctcccagcgagcgagcgccat	s

176	tcctgacgttcccctggcggtcccctgtcgct	o

177	tcctgtcgctcctgtcgctcctgtcgct	o

178	tcctggcggggaagt	o

179	tcatgazgttgaagt	o

180	tcztgacgttgaagt	o

181	tcctagcgttgaagt	o

182	tccagacgttgaagt	o

183	tcctgacggggaagt	o

184	tcctggcggtgaagt	o

185	ggctccggggagggaatttttgtctat	o

186	atagacaaaaattccatccccggagcc	o

187	tccatgagcttccttgagtct	rna

188	tcgtcgctgtctccgcttctt	so

189	tcgtcgctgtctccgcttctt	s20

190	tcgagacattgcacaatcatctg	o

191	cagattgtgcaatgtctcga	o

192	tccatgtcgttcctgatgcg	o

193	gcgatgtcgttcctgatgct	o

194	gcgatgtcgttcctgatgcg	o

195	tccatgtcgttccgcgcgcg	o

196	tccatgtcgttcctgccgct	o

197	tccatgtcgttcctgtagct	o

198	gcggcgggcggcgcgcgccc	o

199	atcaggaacgtcatgggaagc	o

200	tccatgagcttcctgagtct	p-ethoxy

201	tcaacgtt	p-ethoxy

202	tcaagctt	p-ethoxy

203	tcctgtcgttcctgtcgtt	s

204	tccatgtcgtttttgtcgtt	s

205	tcctgtcgttccttgtcgtt	s

206	tccttgtcgttcctgtcgtt	s

207	btccattccatgacgttcctgatgcttcca	os

208	tcctgtcgttttttgtcgtt	s

209	tcgtcgctgtctccgcttctt	s

210	tcgtcgctgtctgcccttctt	s

211	tcgtcgctgttgtcgtttctt	s

212	tcctgtcgttcctgtcgttggaacgacagg	o

213	tcctgtcgttcctgtcgtttcaacgtcaggaacgacagga	o

214	ggggtctgtcgttttgggggg	sos

215	ggggtctgtgcttttgggggg	sos

216	tccggccgttgaagt	o

217	tccggacggtgaagt	o

218	tcccgccgttgaagt	o

219	tccagaaggtgaagt	o

220	tcccgacggtgaagt	o

221	tccagagcttgaagt	o

222	tccatgtzgttcctgtzgtt	s

223	tccatgacgttcctgacgtt	sos

224	ggggttgacgttttgggggg	sos

225	tccaggacttctctcaggtt	s

226	tttttttttttttttttttt	s

227	tccatgccgttcctgccgtt	s

228	tccatggcgggcctggcggg	s

229	tccatgacgttcctgccgtt	s

230	tccatgacgttcctggcggg	s

231	tccatgacgttcctgcgttt	s

232	tccatgacggtcctgacggt	s

233	tccatgcgtgcgtgcgtttt	s

234	tccatgcgttgcgttgcgtt	s

235	btccattccattctaggcctgagtcttccat	os

236	tccatagcgttcctagcgtt	o

237	tccatgtcgttcctgtcgtt	o

238	tccatagcgatcctagcgat	o

239	tccattgcgttccttgcgtt	o

240	tccatagcggtcctagcggt	o

241	tccatgattttcctgcagttcctgatttt

242	tccatgacgttcctgcagttcctgacgtt	s

243	ggcggcggcggcggcggcgg	o

244	tccacgacgttttcgacgtt	s

245	tcgtcgttgtcgttgtcgtt	s

246	tcgtcgttttgtcgttttgtcgtt	s

247	tcgtcgttgtcgttttgtcgtt	s

248	gcgtgcgttgtcgttgtcgtt	s

249	czggczggczgggczccgg	o

250	gcggcgggcggcgcgcgccc	s

251	agicccgigaacgiattcac	o

252	tgtcgtttgtcgtttgtcgtt	s

253	tgtcgttgtcgttgtcgttgtcgtt	s

254	tgtcgttgtcgttgtcgttgtcgtt	s

255	tcgtcgtcgtcgtt	s

256	tgtcgttgtcgtt	s

257	cccccccccccccccccccc	s

258	tctagcgtttttagcgttcc	sos

259	tgcatcccccaggccaccat	s

260	tcgtcgtcgtcgtcgtcgtcgtt	sos

261	tcgtcgttgtcgttgtcgtt	sos

262	tcgtcgttttgtcgttttgtcgtt	sos

263	tcgtcgttgtcgttttgtcgtt	sos

264	ggggagggaggaacttcttaaaattcccccagaatgttt	o

265	aaacattctgggggaattttaagaagttcctccctcccc	o

266	atgtttacttcttaaaattcccccagaatgttt	o

267	aaacattctgggggaattttaagaagtaaacat	o

268	atgtttactagacaaaattcccccagaatgttt	o

269	aaacattctgggggaattttgtctagtaaacat	o

270	aaaattgacgttttaaaaaa	sos

271	ccccttgacgttttcccccc	sos

272	ttttcgttgtttttgtcgtt

273	tcgtcgttttgtcgttttgtcgtt	sos

274	ctgcagcctgggac	o

275	acccgtcgtaattatagtaaaaccc	o

276	ggtacctgtggggacattgtg	o

277	agcaccgaacgtgagagg	o

278	tccatgccgttcctgccgtt	o

279	tccatgacggtcctgacggt	o

280	tccatgccggtcctgccggt	o

281	tccatgcgcgtcctgcgcgt	o

282	ctggtctttctggtttttttctgg	s

283	tcaggggtggggggaacctt	sos

284	tacatgazgttcctagttct	o

285	tccatgatgttcctagttct	o

286	cccgaagtcatttcctcttaacctgg	o

287	ccaggttaagaggaaatgacttcggg	o

288	tcctggzggggaagt	o

289	gzggzgggzggzgzgzgccc	x

290	tccatgtgcttcctgatgct	o

291	tccatgtccttcctgatgct

292	tccatgtcgttcctagttct

293	tccaagtagttcctagttct	o

294	tccatgtagttcctagttct	o

295	tcccgcgcgttccgcgcgtt	s

296	tcctggcggtcctggcggtt	s

297	tcctggaggggaagt	o

298	tcctgggggggaagt	o

299	tcctggtggggaagt	o

300	tcgtcgttttgtcgttttgtcgtt	o

301	ctggtctttctggtttttttctgg	o

302	tccatgacgttcctgacgtt	o

303	tccaggacttctctcaggtt	sos

304	tzgtzgttttgtzgttttgtzgtt	o

305	btcgtcgttttgtcgttttgtcgttttttt	os

306	gctatgacgttccaaggg	s

307	tcaacgtt	s

308	tccaggactttcctcaggtt	o

309	ctctctgtaggcccgcttgg	s

310	ctttccgttggacccctggg	s

311	gtccgggccaggccaaagtc	s

312	gtgcgcgcgagcccgaaatc	s

313	tccatgaigttcctgaigtt	s

314	aatagtcgccataacaaaac	o

315	aatagtcgccatggcggggc	o

316	btttttccatgtcgttcctgatgcttttt	os

317	tcctgtcgttgaagtttttt	o

318	gctagctttagagctttagagctt	o

319	tgctgcttcccccccccccc	o

320	tcgacgttcccccccccccc	o

321	tcgtcgttcccccccccccc	o

322	tcgtcgttcccccccccccc	o

323	tcgccgttcccccccccccc	o

324	tcgtcgatcccccccccccc	o

325	tcctgacgttgaagt	s

326	tcctgccgttgaagt	s

327	tcctgacggtgaagt	s

328	tcctgagcttgaagt	s

329	tcctggcggggaagt	s

330	aaaatctgtgcttttaaaaaa	sos

331	gatccagtcacagtgacctggcagaatctggat	o

332	gatccagattctgccaggtcactgtgactggat	o

333	gatccagtcacagtgactcagcagaatctggat	o

334	gatccagattctgctgagtcactgtgactggat	o

335	tcgtcgttccccccczcccc	o

336	tzgtggttccccccaccccc	o

337	tzgtcgttcccccccccccc	o

338	tcgtzgttcccccacccccc	o

339	tcgtcgctccaccccccccc	o

340	tcgtcggtcccccccccccc	o

341	tcggcgttcccccccccccc	o

342	ggccttttcccccccccccc	o

343	tcgtcgttttgacgttttgtcgtt	s

344	tcgtcgttttgacgttttgacgtt	s

345	ccgtcgttcccccccccccc	o

346	gcgtcgttcccccccccccc	o

347	tcgtcattcccccccccccc	o

348	acgtcgttcccccccccccc	o

349	ctgtcgttcccccccccccc	o

350	btttttcgtcgttcccccccccccc	os

351	tcgtcgttccccccccccccb	o

352	tcgtcgttttgtcgttttgtcgttb	o

353	tccagttccttcctcagtct	o

354	tzgtcgttttgtcgttttgtcgtt	o

355	tcctggaggggaagt	s

356	tcctgaaaaggaagt	s

357	tcgtcgttccccccccc	s

358	tzgtzgttttgtzgttttgtzgtt	s

359	ggggtcaagcttgagggggg	sos

360	tgctgcttcccccccccccc	s

361	tcgtcgtcgtcgtt	s2

362	tcgtcgtcgtagtt	s20

363	tcgtcgtcgtcgtt	os2

364	tcaacgttga	s

365	tcaacgtt	s

366	atagttttccatttttttac

367	aatagtcgccatcgcgcgac	o

368	aatagtcgccatcccgggac	o

369	aatagtcgccatcccccccc	o

370	tgctgcttttgtgcttttgtgctt	o

371	ctgtgctttctgtgtttttctgtg	s

372	ctaatctttctaatttttttctaa	s

373	tcgtcgttggtgtcgttggtgtcgtt	s

374	tcgtcgttggttgtcgttttggtt	s

375	accatggacgagctgtttcccctc

376	tcgtcgttttgcgtgcgttt	s

377	ctgtaagtgagcttggagag

378	gagaacgctggaccttcc

379	cgggcgactcagtctatcgg

380	gttctcagataaagcggaaccagcaacagacacagaa

381	ttctgtgtctgttgctggttccgctttatctgagaac

382	cagacacagaagcccgatagacg

383	agacagacacgaaacgaccg

384	gtctgtcccatgatctcgaa

385	gctggccagcttacctcccg

386	ggggcctctatacaacctggg

387	ggggtccctgagactgcc

388	gagaacgctggaccttccat

389	tccatgtcggtcctgatgct

390	ctcttgcgacctggaaggta

391	aggtacagccaggactacga

392	accatggacgacctgtttcccctc

393	accatggattacctttttcccctt

394	atggaaggtccagcgttctc	o

395	agcatcaggaccgacatgga	o

396	ctctccaagctcacttacag

397	tccctgagactgccccacctt

398	gccaccaaaacttgtccatg

399	gtccatggcgtgcgggatga

400	cctctatacaacctgggac

401	cgggcgactcagtctatcgg

402	gcgctaccggtagcctgagt

403	cgactgccgaacaggatatcggtgatcagcactgg

404	ccagtgctgatcaccgatatcctgttcggcagtcg

405	ccaggttgtatagaggc

406	tctcccagcgtacgccat	s

407	tctcccagcgtgcgtttt	s

408	tctcccgacgtgcgccat	s

409	tctcccgtcgtgcgccat	s

410	ataatcgtcgttcaagcaag	s

411	tcgtcgttttgtcgttttgtcgt	s2

412	tcgtcgttttgtcgttttgtcgtt	s2

413	tcgtcgttttgtcgttttgtcgtt	s2

414	tcntcgtnttntcgtnttntcgtn	s

415	tctcccagcgtcgccat	s

416	tctcccatcgtcgccat	s

417	ataatcgtgcgttcaagaaag	s

418	ataatcgacgttcccccccc	s

419	tctatcgacgttcaagcaag	s

420	tcc tga cgg gg agt	s

421	tccatgacgttcctgatcc

422	tccatgacgttcctgatcc

423	tccatgacgttcctgatcc

424	tcc tgg cgt gga agt	s

425	tccatgacgttcctgatcc

426	tcgtcgctgttgtcgtttctt	s

427	agcagctttagagctttagagctt	s

428	cccccccccccccccccccccccc	s

429	tcgtcgttttgtcgttttgtcgttttgtcgtt	s

430	tcgtcgttttttgtcgttttttgtcgtt	s

431	tcgtcgtttttttttttttt	s

432	tttttcaacgttgatttttt	sos

433	tttttttttttttttttttttttt	s

434	ggggtcgtcgttttgggggg

435	tcgtcgttttgtcgttttgggggg

436	tcgtcgctgtctccgcttcttcttgcc	s

437	tcgtcgctgtctccg	s

438	ctgtaagtgagcttggagag

439	gagaacgctggaccttccat

440	ccaggttgtatagaggc

441	gctagacgttagcgtga

442	ggagctcttcgaacgccata

443	tctccatgatggttttatcg

444	aaggtggggcagtctcaggga

445	atcggaggactggcgcgccg

446	ttaggacaaggtctagggtg

447	accacaacgagaggaacgca

448	ggcagtgcaggctcaccggg

449	gaaccttccatgctgtt

450	gctagacgttagcgtga

451	gcttggagggcctgtaagtg

452	gtagccttccta

453	cggtagccttccta

454	cacggtagccttccta

455	agcacggtagccttccta

456	gaacgctggaccttccat

457	gaccttccat

458	tggaccttccat

459	gctggaccttccat

460	acgctggaccttccat

461	taagctctgtcaacgccagg

462	gagaacgctggaccttccatgt

463	tccatgtcggtcctgatgct

464	ttcatgccttgcaaaatggcg

465	tgctagctgtgcctgtacct

466	agcatcaggaccgacatgga

467	gaccttccatgtcggtcctgat

468	acaaccacgagaacgggaac

469	gaaccttccatgctgttccg

470	caatcaatctgaggagaccc

471	tcagctctggtactttttca

472	tggttacggtctgtcccatg

473	gtctatcggaggactggcgc

474	cattttacgggcgggcgggc

475	gaggggaccattttacgggc

476	tgtccagccgaggggaccat

477	cgggcttacggcggatgctg

478	tggaccttctatgtcggtcc

479	tgtcccatgtttttagaagc

480	gtggttacggtcgtgcccat

481	cctccaaatgaaagaccccc

482	ttgtactctccatgatggtt

483	ttccatgctgttccggctgg

484	gaccttctatgtcggtcctg

485	gagaccgctcgaccttcgat

486	ttgccccatattttagaaac

487	ttgaaactgaggtgggac

488	ctatcggaggactggcgcgcc

489	cttggagggcctcccggcgg

490	gctgaaccttccatgctgtt

491	tagaaacagcattcttcttttagggcagcaca

492	agatggttctcagataaagcggaa

493	ttccgctttatctgagaaccatct

494	gtcccaggttgtatagaggctgc

495	gcgccagtcctccgatagac

496	atcggaggactggcgcgccg

497	ggtctgtcccatatttttag

498	tttttcaacgttgagggggg	sos

499	tttttcaagcgttgatttttt	sos

500	ggggtcaacgttgatttttt	sos

501	ggggttttcaacgttttgagggggg	sos

502	ggttacggtctgtcccatat

503	ctgtcccatatttttagaca

504	accatcctgaggccattcgg

505	cgtctatcgggcttctgtgtctg

506	ggccatcccacattgaaagtt

507	ccaaatatcggtggtcaagcac

508	gtgcttgaccaccgatatttgg

509	gtgctgatcaccgatatcctgttcgg

510	ggccaactttcaatgtgggatggcctc

511	ttccgccgaatggcctcaggatggtac

512	tatagtccctgagactgccccaccttctcaacaacc

513	gcagcctctatacaacctgggacggga

514	ctatcggaggactggcgcgccg

515	tatcggaggactggcgcgccg

516	gatcggaggactggcgcgccg

517	ccgaacaggatatcggtgatcagcac

518	ttttggggtcaacgttgagggggg

519	ggggtcaacgttgagggggg	sos

520	cgcgcgcgcgcgcgcgcgcg	s

521	ggggcatgacgttcgggggg	ss

522	ggggcatgacgttcaaaaaa	s

523	ggggcatgagcttcgggggg	s

524	ggggcatgacgttcgggggg	sos

525	aaaacatgacgttcaaaaaa	sos

526	aaaacatgacgttcgggggg	sos

527	ggggcatgacgttcaaaaaa	sos

528	accatggacgatctgtttcccctc	s

529	gccatggacgaactgttccccctc	s

530	cccccccccccccccccccc	sos

531	gggggggggggggggggggg	sos

532	gctgtaaaatgaatcggccg	sos

533	ttcgggcggactcctccatt	sos

534	tatgccgcgcccggacttat	sos

535	ggggtaatcgatcagggggg	sos

536	tttgagaacgctggaccttc	sos

537	gatcgctgatctaatgctcg	sos

538	gtcggtcctgatgctgttcc	sos

539	tcgtcgtcagttcgctgtcg	sos

540	ctggaccttccatgtcgg	sos

541	gctcgttcagcgcgtct	sos

542	ctggaccttccatgtc	sos

543	cactgtccttcgtcga	sos

544	cgctggaccttccatgtcgg	sos

545	gctgagctcatgccgtctgc	sos

546	aacgctggaccttccatgtc	sos

547	tgcatgccgtacacagctct	sos

548	ccttccatgtcggtcctgat	sos

549	tactcttcggatcccttgcg	Sos

550	ttccatgtcggtcctgat	sos

551	ctgattgctctctcgtga	sos

552	ggcgttattcctgactcgcc	o

553	cctacgttgtatgcgcccagct	o
554	ggggtaatcgatgagggggg	o

555	ttcgggcggactcctccatt	o

556	tttttttttttttttttttt	o

557	gggggttttttttttggggg	o

558	tttttggggggggggttttt	o

559	ggggggggggggggggggt	o

560	aaaaaaaaaaaaaaaaaaaa	o

561	cccccaaaaaaaaaaccccc	o

562	aaaaaccccccccccaaaaa	o

563	tttgaattcaggactggtgaggttgag	o

564	tttgaatcctcagcggtctccagtggc	o

565	aattctctatcggggcttctgtgtctgttgctggttccgctttat	o

566	ctagataaagcggaaccagcaacagacacagaagccccgatagag	o

567	ttttctagagaggtgcacaatgctctgg	o

568	tttgaattccgtgtacagaagcgagaagc	o

569	tttgcggccgctagacttaacctgagagata	o

570	tttgggcccacgagagacagagacacttc	o

571	tttgggcccgcttctcgcttctgtacacg	o

572	gagaacgctggaccttccat	s

573	tccatgtcggtcctgatgct	s

574	ctgtcg	s

575	tcgtga	s

576	cgtcga	s

577	agtgct	s

578	ctgtcg	o

579	agtgct	o

580	cgtcga	o

581	tcgtga	o

582	gagaacgctccagcttcgat	o

583	gctagacgtaagcgtga	o

584	gagaacgctcgaccttccat	o

585	gagaacgctggacctatccat	o

586	gctagaggttagcgtga	o

587	gagaacgctggacttccat	o

588	tcacgctaacgtctagc	o

589	bgctagacgttagcgtga	o

590	atggaaggtcgagcgttctc	o

591	gagaacgctggaccttcgat	o

592	gagaacgatggaccttccat	o

593	gagaacgctggatccat	o

594	gagaacgctccagcactgat	o

595	tccatgtcggtcctgctgat	o

596	atgtcctcggtcctgatgct	o

597	gagaacgctccaccttccat	o

598	gagaacgctggaccttcgta	o

599	batggaaggtccagcgttctc	o

600	tcctga	o

601	tcaacgtt	o

602	aacgtt	o

603	aacgttga	o

604	tcacgctaacctctagc	o

605	gagaacgctggaccttgcat	o

606	gctggaccttccat	o

607	gagaacgctggacctcatccat	o

608	gagaacgctggacgctcatccat	o

609	aacgttgaggggcat	o

610	atgcccctcaacgtt	o

611	tcaacgttga	o

612	gctggaccttccat	o

613	caacgtt	o

614	acaacgttga	o

615	tcacgt	o

616	tcaagctt	o

617	tcgtca	o

618	aggatatc	o

619	tagacgtc	o

620	gacgtcat	o

621	ccatcgat	o

622	atcgatgt	o

623	atgcatgt	o

624	ccatgcat	o

625	agcgctga	o

626	tcagcgct	o

627	ccttcgat	o

628	gtgccggggtctccgggc	s

629	gctgtggggcggctcctg	s

630	btcaacgtt	o

631	ftcaacgtt	o

632	faacgttga	o

633	tcaacgt	s

634	aacgttg	s

635	cgacga	o

636	tcaacgtt	o

637	tcgga	o

638	agaacgtt	o

639	tcatcgat	o

640	taaacgtt	s

641	ccaacgtt	s

642	gctcga	s

643	cgacgt	s

644	cgtcgt	s

645	acgtgt	s

646	cgttcg	s

647	gagcaagctggaccttccat	s

648	cgcgta	s

649	cgtacg	s

650	tcaccggt	s

651	caagagatgctaacaatgca	s

652	acccatcaatagctctgtgc	s

653	ccatcgat	o

654	tcgacgtc	o

655	ctagcgct	o

656	taagcgct	o

657	tcgcgaattcgcg	o

658	atggaaggtccagcgttct	o

659	actggacgttagcgtga	o

660	cgcctggggctggtctgg	o

661	gtgtcggggtctccgggc	o

662	gtgccggggtctccgggc	o

663	cgccgtcgcggcggttgg	o

664	gaagttcacgttgaggggcat	o

665	atctggtgagggcaagctatg	s

666	gttgaaacccgagaacatcat	s

667	gcaacgtt	o

668	gtaacgtt	o

669	cgaacgtt	o

670	gaaacgtt	o

671	caaacgtt	o

672	ctaacgtt	o

673	ggaacgtt	o

674	tgaacgtt	o

675	acaacgtt	o

676	ttaacgtt	o

677	aaaacgtt	o

678	ataacgtt	o

679	aacgttct	o

680	tccgatcg	o

681	tccgtacg	o

682	gctagacgctagcgtga	o

683	gagaacgctggacctcatcatccat	o

684	gagaacgctagaccttctat	o

685	actagacgttagtgtga	o

686	cacaccttggtcaatgtcacgt	o

687	tctccatcctatggttttatcg	o

688	cgctggaccttccat	o

689	caccaccttggtcaatgtcacgt	o

690	gctagacgttagctgga	o

691	agtgcgattgcagatcg	o

692	ttttcgttttgtggttttgtggtt

693	ttttcgtttgtcgttttgtcgtt

694	tttttgttttgtggttttgtggtt

695	accgcatggattctaggcca	s

696	gctagacgttagcgt	o

697	aacgctggaccttccat	o

698	tcaazgtt	o

699	ccttcgat	o

700	actagacgttagtgtga	s

701	gctagaggttagcgtga	s

702	atggactctccagcgttctc	o

703	atcgactctcgagcgttctc	o

704	gctagacgttagc	o

705	gctagacgt	o

706	agtgcgattcgagatcg	o

707	tcagzgct	o

708	ctgattgctctctcgtga	o

709	tzaacgtt	o

710	gagaazgctggaccttccat	o

711	gctagacgttaggctga	o

712	gctacttagcgtga	o

713	gctaccttagcgtga	o

714	atcgacttcgagcgttctc	o

715	atgcactctgcagcgttctc	o

716	agtgactctccagcgttctc	o

717	gccagatgttagctgga	o

718	atcgactcgagcgttctc	o

719	atcgatcgagcgttctc	o

720	bgagaacgctcgaccttcgat	o

721	gctagacgttagctgga	sos

722	atcgactctcgagcgttctc	sos

723	tagacgttagcgtga	o

724	cgactctcgagcgttctc	o

725	ggggtcgaccttggagggggg	sos

726	gctaacgttagcgtga	o

727	cgtcgtcgt	o

728	gagaacgctggaczttccat	o

729	atcgacctacgtgcgttztc	o

730	atzgacctacgtgcgttctc	o

731	gctagazgttagagt	o

732	atcgactctcgagzgttctc	o

733	ggggtaatgcatcagggggg	sos

734	ggctgtattcctgactgccc	s

735	ccatgctaacctctaga	o

736	gctagatgttagcgtga	o

737	cgtaccttacggtga	o

738	tccatgctggtcctgatgct	o

739	atcgactctctcgagcgttctc	o

740	gctagagcttagcgtga	o

741	atcgactctcgagtgttctc	o

742	aacgctcgaccttcgat	o

743	ctcaacgctggaccttccat	o

744	atcgacctacgtgcgttctc	o

745	gagaatgctggaccttccat	o

746	tcacgctaacctctgac	o

747	bgagaacgctccagcactgat	o

748	bgagcaagctggaccttccat	o

749	cgctagaggttagcgtga	o

750	gctagatgttaacgt	o

751	atggaaggtccacgttctc	o

752	gctagatgttagcgt	o

753	gctagacgttagtgt	o

754	tccatgacggtcctgatgct	o

755	tccatggcggtcctgatgct	o

756	gctagacgatagcgt	o

757	gctagtcgatagcgt	o

758	tccatgacgttcctgatgct	o

759	tccatgtcgttcctgatgct	o

760	gctagacgttagzgt	o

761	gctaggcgttagcgt	o

762	tccatgtzggtcctgatgct	o

763	tccatgtcggtzctgatgct	o

764	atzgactctzgagzgttctc	o

765	atggaaggtccagtgttctc	o

766	gcatgacgttgagct	o

767	ggggtcaacgttgagggggg	s

768	ggggtcaagtctgagggggg	sos

769	cgcgcgcgcgcgcgcgcgcg	o

770	cccccccccccccccccccccccccccc	s

771	ccccccccccccccccccccccccccccccccccc	s

772	tccatgtcgctcctgatcct	o

773	gctaaacgttagcgt	o

774	tccatgtcgatcctgatgct	o

775	tccatgccggtcctgatgct	o

776	aaaatcaacgttgaaaaaaa	sos

777	tccataacgttcctgatgct	o

778	tggaggtcccaccgagatcggag	o

779	cgtcgtcgtcgtcgtcgtcgt	s

780	ctgctgctgctgctgctgctg	s

781	gagaacgctccgaccttcgat	s

782	gctagatgttagcgt	s

783	gcatgacgttgagct	s

784	tcaatgctgaf	o

785	tcaacgttgaf	o

786	tcaacgttgab	o

787	gcaatattgcb	o

788	gcaatattgcf	o

789	agttgcaact	o

790	tcttcgaa	o

791	tcaacgtc	o

792	ccatgtcggtcctgatgct	o

793	gtttttatataatttggg	o

794	tttttgtttgtcgttttgtcgtt	o

795	ttggggggggtt	s

796	ggggttgggggtt	s

797	ggtggtgtaggttttgg	o

798	bgagaazgctcgaccttcgat	o

799	tcaacgttaacgttaacgtt	o

800	bgagcaagztggaccttccat	o

801	bgagaazgctccagcactgat	o

802	tcaazgttgax	o

803	gzaatattgcx	o

804	tgctgcttttgtcgttttgtgctt	o

805	ctgcgttagcaatttaactgtg	o

806	tccatgacgttcctgatgct	s

807	tgcatgccgtgcatccgtacacagctct	s

808	tgcatgccgtacacagctct	s

809	tgcatcagctct	s

810	tgcgctct	s

811	cccccccccccccccccccc	s

812	cccccccccccc	s

813	cccccccc	s

814	tgcatcagctct	sos

815	tgcatgccgtacacagctct	o

816	gagcaagctggaccttccat	s

817	tcaacgttaacgttaacgttaacgttaacgtt	s

818	gagaacgctcgaccttcgat	s

819	gtccccatttcccagaggaggaaat	o

820	ctagcggctgacgtcatcaagctag	o

821	ctagcttgatgacgtcagccgctag	o

822	cggctgacgtcatcaa	s

823	ctgacgtg	o

824	ctgacgtcat	o

825	attcgatcggggcggggcgag	o

826	ctcgccccgccccgatcgaat	o

827	gactgacgtcagcgt	o

828	ctagcggctgacgtcataaagctagc	s

829	ctagctttatgacgtcagccgctagc	s

830	ctagcggctgagctcataaagctagc	s

831	ctagtggctgacgtcatcaagctag	s

832	tccaccacgtggtctatgct	s

833	gggaatgaaagattttattataag	o

834	tctaaaaaccatctattattaaccct	o

835	agctcaacgtcatgc	o

836	ttaacggtggtagcggtattggtc	o

837	ttaagaccaataccgctaccaccg	o

838	gatctagtgatgagtcagccggatc	o

839	gatccggctgactcatcactagatc	o

840	tccaagacgttcctgatgct	o

841	tccatgacgtccctgatgct	o

842	tccaccacgtggctgatgct	o

843	ccacgtggacctctagc	o

844	tcagaccacgtggtcgggtgttcctga	o

845	tcaggaacacccgaccacgtggtctga	o

846	catttccacgatttccca	o

847	ttcctctctgcaagagaat	o

848	tgtatctctctgaaggact	o

849	ataaagcgaaactagcagcagtttc	o

850	gaaactgctgctagtttcgctttat	o

851	tgcccaaagaggaaaatttgtttcatacag	o

852	ctgtatgaaacaaattttactctttgggca	o

853	ttagggttagggttagggtt	ss

854	tccatgagcttcctgatgct	ss

855	aaaacatgacgttcaaaaaa	ss

856	aaaacatgacgttcgggggg	ss

857	ggggcatgagcttcgggggg	sos

858	ctaggctgacgtcatcaagctagt	o

859	tctgacgtcatctgacgttggctgacgtct	o

860	ggaattagtaatagatatagaagtt	o

861	tttaccttttataaacataactaaaacaaa	o

862	gcgtttttttttgcg	s

863	atatctaatcaaaacattaacaaa	o

864	tctatcccaggtggttcctgttag	o

865	btccatgacgttcctgatgct	o

866	btccatgagcttcctgatgct	o

867	tttttttttttttf	o

868	tttttttttttttf	so

869	ctagcttgatgagctcagccgctag	o

870	ttcagttgtcttggtgcttagctaa	o

871	tccatgagcttcctgagtct	s

872	ctagcggctgacgtcatcaatctag	o

873	tgctagctgtgcctgtacct	s

874	atgctaaaggacgtcacattgca	o

875	tgcaatgtgacgtcctttagcat	o

876	gtaggggactttccgagctcgagatcctatg	o

877	cataggatctcgagctcggaaagtcccctac	o

878	ctgtcaggaactgcaggtaagg	o

879	cataacataggaatatttactcctcgc	o

880	ctccagctccaagaaaggacg	o

881	gaagtttctggtaagtcttcg	o

882	tgctgcttttgtgcttttgtgctt	s

883	tcgtcgttttgtggttttgtggtt	s

884	tcgtcgtttgtcgttttgtcgtt	s

885	tcctgacgttcggcgcgcgccc	s

886	tgctgcttttgtgcttttgtgctt

887	tccatgagcttcctgagctt	s

888	tcgtcgtttcgtcgttttgacgtt	s

889	tcgtcgtttgcgtgcgtttcgtcgtt	s

890	tcgcgtgcgttttgtcgttttgacgtt	s

891	ttcgtcgttttgtcgttttgtcgtt	s

892	tcctgacggggaagt	s

893	tcctggcgtggaagt	s

894	tcctggcggtgaagt	s

895	tcctggcgttgaagt	s

896	tcctgacgtggaagt	s

897	gcgacgttcggcgcgcgccc	s

898	gcgacgggcggcgcgcgccc	s

899	gcggcgtgcggcgcgcgccc	s

900	gcggcggtcggcgcgcgccc	s

901	gcgacggtcggcgcgcgccc	s

902	gcggcgttcggcgcgcgccc	s

903	gcgacgtgcggcgcgcgccc	s

904	tcgtcgctgtctccg	s

905	tgtgggggttttggttttgg	s

906	aggggaggggaggggagggg	s

907	tgtgtgtgtgtgtgtgtgtgt	s

908	ctctctctctctctctctctct	chimeric

909	ggggtcgacgtcgagggggg	s

910	atatatatatatatatatatat	s

911	ttttttttttttttttttttttttttt	s

912	ttttttttttttttttttttt	s

913	tttttttttttttttttt	s

914	gctagaggggagggt

915	gctagatgttagggg

916	gcatgagggggagct

917	atggaaggtccagggggctc

918	atggactctggagggggctc

919	atggaaggtccaaggggctc

920	gagaaggggggaccttggat

921	gagaaggggggaccttccat

922	gagaaggggccagcactgat

923	tccatgtggggcctgatgct

924	tccatgaggggcctgatgct

925	tccatgtggggcctgctgat

926	atggactctccggggttctc

927	atggaaggtccggggttctc

928	atggactctggaggggtctc

929	atggaggctccatggggctc

930	atggactctggggggttctc

931	tccatgtgggtggggatgct

932	tccatgcgggtggggatgct

933	tccatgggggtcctgatgct

934	tccatggggtccctgatgct

935	tccatggggtgcctgatgct

936	tccatggggttcctgatgct

937	tccatcgggggcctgatgct

938	gctagagggagtgt

939	tttttttttttttttttt	s

940	gmggtcaacgttgagggmggg	s

941	ggggagttcgttgaggggggg	s

942	tcgtcgtttccccccccccc	s

943	ttggggggttttttttttttttttt	s

944	tttaaattttaaaatttaaaata	s

945	ttggtttttttggtttttttttgg	s

946	tttcccttttccccttttcccctc	s

947	ggggtcatcgatgagggggg s	sos

948	tccatgacgttcctgacgtt

949	tccatgacgttcctgacgtt

950	tccatgacgttcctgacgtt

951	tccatgacgttcctgacgtt

952	tccatgacgttcctgacgtt

953	tccatgacgttcctgacgtt

954	tccatgacgttcctgacgtt

955	tccatgacgttcctgacgtt

956	tccatgacgttcctgacgtt

957	tccatgacgttcctgacgtt

958	tccatgacgttcctgacgtt

959	gggggacgatcgtcggggg	sos

960	gggggtcgtacgacgggggg	sos

961	tttttttttttttttttttttttt	po

962	aaaaaaaaaaaaaaaaaaaaaaaa	po

963	cccccccccccccccccccccccc	po

964	tcgtcgttttgtcgttttgtcgtt

965	tcgtcgttttgtcgttttgtcgtt

966	tcgtcgttttgtcgttttgtcgtt

967	tcgtcgttttgtcgttttgtcgtt

968	ggggtcaacgttgagggggg

969	ggggtcaacgttgagggggg

970	ggggtcaagcttgagggggg

971	tgctgcttcccccccccccc

972	ggggacgtcgacgtgggggg	sos

973	ggggtcgtcgacgagggggg	sos

974	ggggtcgacgtacgtcgagggggg	sos

975	ggggaccggtaccggtgggggg	sos

976	gggtcgacgtcgagggggg	sos

977	ggggtcgacgtogaggggg	sos

978	ggggaacgttaacgttgggggg	sos

979	ggggtcaccggtgagggggg	sos

980	ggggtcgttcgaacgagggggg	sos

981	ggggacgttcgaacgtgggggg	sos

982	tcaactttga	s

983	tcaagcttga	s

984	tcacgatcgtga	s

985	tcagcatgctga	s

986	gggggagcatgctggggggg	sos

987	gggggggggggggggggggg	sos

988	gggggacgatatcgtcgggggg	sos

989	gggggacgacgtcgtcgggggg	sos

990	gggggacgagctcgtcgggggg	sos

991	gggggacgtacgtcgggggg	sos

992	tcaacgtt

993	tccataccggtcctgatgct

994	tccataccggtcctaccggt	s

995	gggggacgatcgttgggggg	sos

996	ggggaacgatcgtcgggggg	sos

997	ggg ggg acg atc gtc ggg ggg	sos

998	ggg gga cga tcg tcg ggg ggg	sos

999	aaa gac gtt aaa	po

1000	aaagagcttaaa	po

1001	aaagazgttaaa	po

1002	aaattcggaaaa	po

1003	gggggtcatcgatgagggggg	sos

1004	gggggtcaacgttgagggggg	sos

1005	atgtagcttaataacaaagc	po

1006	ggatcccttgagttacttct	po

1007	ccattccacttctgattacc	po

1008	tatgtattatcatgtagata	po

1009	agcctacgtattcaccctcc	po

1010	ttcctgcaactactattgta	po

1011	atagaaggccctacaccagt	po

1012	ttacaccggtctatggaggt	po

1013	ctaaccagatcaagtctagg	po

1014	cctagacttgatctggttag	po

1015	tataagcctcgtccgacatg	po

1016	catgtcggacgaggcttata	po

1017	tggtggtggggagtaagctc	po

1018	gagctactcccccaccacca	po

1019	gccttcgatcttcgttggga	po

1020	tggacttctctttgccgtct	po

1021	atgctgtagcccagcgataa	po

1022	accgaatcagcggaaagtga	po

1023	tccatgacgttcctgacgtt

1024	ggagaaacccatgagctcatctgg

1025	accacagaccagcaggcaga

1026	gagcgtgaactgcgcgaaga

1027	tcggtacccttgcagcggtt

1028	ctggagccctagccaaggat

1029	gcgactccatcaccagcgat

1030	cctgaagtaagaaccagatgt

1031	ctgtgttatctgacatacacc

1032	aattagccttaggtgattggg

1033	acatctggttcttacttcagg

1034	ataagtcatattttgggaactac

1035	cccaatcacctaaggctaatt

1036	ggggtcgtcgacgagggggg	sos

1037	ggggtcgttcgaacgagggggg	sos

1038	ggggacgttcgaacgtgggggg	sos

1039	tcctggcggggaagt	s

1040	ggggaacgacgtcgttgggggg	sos

1041	ggggaacgtacgtcgggggg	sos

1042	ggggaacgtacgtacgttgggggg	sos

1043	ggggtcaccggtgagggggg	sos

1044	ggggtcgacgtacgtcgagggggg	sos

1045	ggggaccggtaccggtgggggg	sos

1046	gggtcgacgtcgagggggg	sos

1047	ggggtcgacgtcgagggg	sos

1048	ggggaacgttaacgttgggggg	sos

1049	ggggacgtcgacgtggggg	sos

1050	gcactcttcgaagctacagccggcagcctctgat

1051	cggctcttccatgaggtctttgctaatcttgg

1052	cggctcttccatgaaagtctttggacgatgtgagc

1053	tcctgcaggttaagt	s

1054	gggggtcgttcgttgggggg	sos

1055	gggggatgattgttgggggg	sos

1056	gggggazgatzgttgggggg	sos

1057	gggggagctagcttgggggg	sos

1058	ggttcttttggtccttgtct	s

1059	ggttcttttggtcctcgtct	s

1060	ggttcttttggtccttatct	s

1061	ggttcttggtttccttgtct	s

1062	tggtcttttggtccttgtct	s

1063	ggttcaaatggtccttgtct	s

1064	gggtcttttgggccttgtct	s

1065	tccaggacttctctcaggtttttt	s

1066	tccaaaacttctctcaaatt	s

1067	tactacttttatacttttatactt	s

1068	tgtgtgtgtgtgtgtgtgtgtgtg	s

1069	ttgttgttgttgtttgttgttgttg	s

1070	ggctccggggagggaatttttgtctat	s

1071	gggacgatcgtcggggggg	sos

1072	gggtcgtcgacgaggggggg	sos

1073	ggtcgtcgacgaggggggg	sos

1074	gggtcgtcgtcgtggggggg	sos

1075	ggggacgatcgtcggggggg	sos

1076	ggggacgtcgtcgtgggggg	sos

1077	ggggtcgacgtcgacgtcgaggggggg	sos

1078	ggggaaccgcggttggggggg	sos

1079	ggggacgacgtcgtggggggg	sos

1080	tcgtcgtcgtcgtcgtggggggg	sos

1081	tcctgccggggaagt	s

1082	tcctgcaggggaagt	s

1083	tcctgaaggggaagt	s

1084	tcctggcgggcaagt	s

1085	tcctggcgggtaagt	s

1086	tcctggcgggaaagt	s

1087	tccgggcggggaagt	s

1088	tcggggcggggaagt	s

1089	tcccggcggggaagt	s

1090	gggggacgttggggg	s

1091	ggggttttttttttgggggg	sos

1092	ggggccccccccccgggggg	sos

1093	ggggttgttgttgttgggggg	sos

In some embodiments, the immunostimulatory nucleic acid is a CpG nucleic acid. CpG sequences, while relatively rare in human DNA are commonly found in the DNA of infectious organisms such as bacteria. The human immune system has apparently evolved to recognize CpG sequences as an early warning sign of infection and to initiate an immediate and powerful immune response against invading pathogens without causing adverse reactions frequently seen with other immune stimulatory agents. Thus CpG containing nucleic acids, relying on this innate immune defense mechanism can utilize a unique and natural pathway for immune therapy. The effects of CpG nucleic acids on immune modulation have been described extensively in published patent applications, such as PCT US95/01570), PCT/US97/19791, PCT/US98/03678; PCT/US98/10408; PCT/US98/04703; PCT/US99/07335; and PCT/US99/09863. The entire contents of each of these patent applications is hereby incorporated by reference. [0053]
A CpG nucleic acid is a nucleic acid which includes at least one unmethylated CpG dinucleotide. A nucleic acid containing at least one unmethylated CpG dinucleotide is a nucleic acid molecule which contains an unmethylated cytosine in a cytosine-guanine dinucleotide sequence (i.e. “CpG DNA” or DNA containing a 5′ cytosine followed by 3′ guanosine and linked by a phosphate bond) and activates the immune system. The CpG nucleic acids can be double-stranded or single-stranded. Generally, double-stranded molecules are more stable in vivo, while single-stranded molecules have increased immune activity. Thus in some aspects of the invention it is preferred that the nucleic acid be single stranded and in other aspects it is preferred that the nucleic acid be double stranded. The terms CpG nucleic acid or CpG oligonucleotide as used herein refer to an immunostimulatory CpG nucleic acid or a nucleic acid unless otherwise indicated. The entire immunostimulatory nucleic acid can be unmethylated or portions may be unmethylated but at least the C of the 5′ CG 3′ must be unmethylated. [0054]
In one preferred embodiment the invention provides an immunostimulatory nucleic acid which is a CpG nucleic acid represented by at least the formula: [0055]
5′X₁X₂CGX₃X₄3′
wherein X[0056] ₁, X₂, X₃, and X₄are nucleotides. In one embodiment X₂is adenine, guanine, cytosine, or thymine. In another embodiment X₃is cytosine, guanine, adenine, or thymine. In other embodiments X₂is adenine, guanine, or thymine and X₃is cytosine, adenine, or thymine.
In another embodiment the immunostimulatory nucleic acid is an isolated CpG nucleic acid represented by at least the formula: [0057]
5′N₁X₁X₂CGX₃X₄N₂3′
wherein X[0058] ₁, X₂, X₃, and X₄are nucleotides and N is any nucleotide and N₁and N₂are nucleic acid sequences composed of from about 0-25 N's each. In one embodiment X₁X₂are nucleotides selected from the group consisting of: GpT, GpG, GpA, ApA, ApT, ApG, CpT, CpA, CpG, TpA, TpT, and TpG; and X₃X₄are nucleotides selected from the group consisting of: TpT, ApT, TpG, ApG, CpG, TpC, ApC, CpC, TpA, ApA, and CpA. Preferably X₁X₂are GpA or GpT and X₃X₄are TpT. In other embodiments X₁or X₂or both are purines and X₃or X₄or both are pyrimidines or X₁X₂are GpA and X₃or X₄or both are pyrimidines. In another preferred embodiment X₁X₂are nucleotides selected from the group consisting of: TpA, ApA, ApC, ApG, and GpG. In yet another embodiment X₃X₄are nucleotides selected from the group consisting of: TpT, TpA, TpG, ApA, ApG, ApC, and CpA. X₁X₂in another embodiment are nucleotides selected from the group consisting of: TpT, TpG, ApT, GpC, CpC, CpT, TpC, GpT and CpG.
In another preferred embodiment the immunostimulatory nucleic acid has the sequence 5′TCN[0059] ₁TX₁X₂CGX₃X₄3′. The immunostimulatory nucleic acids of the invention in some embodiments include X₁X₂selected from the group consisting of GpT, GpG, GpA and ApA and X₃X₄is selected from the group consisting of TpT, CpT and TpC.
In other embodiments, the CpG oligonucleotide has a sequence selected from the group consisting of SEQ ID NO: 1, 3, 4, 14-16, 18-24, 28, 29, 33-46, 49, 50, 52-56, 58, 64-67, 69, 71, 72, 76-87, 90, 91, 93, 94, 96, 98, 102-124, 126-128, 131-133; 136-141, 146-150, 152-153, 155-171, 173-178, 180-186, 188-198, 201, 203-214, 216-220, 223, 224, 227-240, 242-256, 258, 260-265, 270-273, 275, 277-281, 286-287, 292, 295-296, 300, 302, 1305-307, 309-312, 314-317, 320-327, 329, 335, 337-341, 343-352, 354, 357, 361-365, 367-369, 373-376, 378-385, 388-392, 394, 395, 399, 401-404, 406-426, 429-433, 434-437, 439, 441-443, 445, 447, 448, 450, 453-456, 460-464, 466-469, 472-475, 477, 478, 480, 483-485, 488, 489, 492, 493, 495-502, 504-505, 507-509, 511, 513-529, 532-541, 543-555, 564-566, 568-576, 578, 580, 599, 601-605, 607-611, 613-615, 617, 619-622, 625-646, 648-650, 653-664, 666-697, 699-706, 708, 709, 711-716, 718-732, 736, 737, 739-744, 746, 747, 749-761, 763, 766-767, 769, 772-779, 781-783, 785-786, 7900792, 798-799, 804-808, 810, 815, 817, 818, 820-832, 835-846, 849-850, 855-859, 862, 865, 872, 874-877, 879-881, 883-885, 888-904, and 909-913. [0060]
For facilitating uptake into cells, the immunostimulatory nucleic acids are preferably in the range of 6 to 100 bases in length. However, nucleic acids of any size greater than 6 nucleotides (even many kb long) are capable of inducing an immune response according to the invention if sufficient immunostimulatory motifs are present. Preferably the immunostimulatory nucleic acid is in the range of between 8 and 100 and in some embodiments between 8 and 50 or 8 and 30 nucleotides in size. [0061]
“Palindromic sequence” shall mean an inverted repeat (i.e. a sequence such as ABCDEE′D′C′B′A′ in which A and A′ are bases capable of forming the usual Watson-Crick base pairs. In vivo, such sequences may form double-stranded structures. In one embodiment the CpG nucleic acid contains a palindromic sequence. A palindromic sequence used in this context refers to a palindrome in which the CpG is part of the palindrome, and preferably is the center of the palindrome. In another embodiment the CpG nucleic acid is free of a palindrome. An immunostimulatory nucleic acid that is free of a palindrome is one in which the CpG dinucleotide is not part of a palindrome. Such an oligonucleotide may include a palindrome in which the CpG is not the center of the palindrome. [0062]
The CpG nucleic acid sequences of the invention are those broadly described above as well as disclosed in PCT Published Patent Applications PCT/US95/01570 and PCT/US97/19791 claiming priority to U.S. Ser. Nos. 08/386,063 and 08/960,774, filed on Feb. 7, 1995 and Oct. 30, 1997 respectively. [0063]
The immunostimulatory nucleic acids of the invention also include nucleic acids having T-rich motifs. It was recently discovered by Dr. Arthur Krieg that T-rich nucleic acids were immunostimulatory. It was presented by Dr. Krieg at the International Workshop on “Immunobiology of Bacterial CpG-DNA” held in Upper Bavaria on Sep. 26-29, 1999 that poly-T nucleic acids of 24 bases in length are immunostimulatory, whereas the same length poly-C oligonucleotide is non-stimulatory. These concepts are also described and claimed in US Provisional Patent Application No. 60/156,113 filed on Sep. 25, 1999, which is hereby incorporated by reference. [0064]
Poly-G containing nucleic acids are also immunostimulatory. PCT published patent application number WO 00/14217, which claims priority to German Patent Application No. 98 11 6652.3, filed on Sep. 3, 1998 describes poly-G-containing oligonucleotides and their uses. A variety of other references, including Pisetsky and Reich, 1993 [0065] Mol. Biol. Reports, 18:217-221; Krieger and Herz, 1994, Ann. Rev. Biochem., 63:601-637; Macaya et al., 1993, PNAS, 90:3745-3749; Wyatt et al., 1994, PNAS, 91:1356-1360; Rando and Hogan, 1998, In Applied Antisense Oligonucleotide Technology, ed. Krieg and Stein, p. 335-352; and Kimura et al., 1994, J. Biochem. 116, 991-994 also describe the immunostimulatory properties of poly-G nucleic acids. Poly-G-containing nucleotides are useful for treating and preventing bacterial and viral infections.
In some aspects of the invention the poly-G containing nucleic acids are administered alone for the treatment of asthma and allergy. It was previously suggested in the prior art that poly-G rich oligonucleotides inhibit the production of IFN-δ by compounds such as CpG oligonucleotides, concanavalin A, bacterial DNA, or the combination of PMA and the calcium ionophore A 23187 (Halperin and Pisetsky, 1995[0066] , Immunopharmacol., 29:47-52, as well as block the downstream effects of IFN-δ. For instance, Ramanathan et al., 1994, Transplantation, 57:612-615, has shown that a poly-G oligonucleotide inhibits the binding of IFN-δ to its receptor, which prevents the normal enhancement of MHC Class 1 and ICAM-1 in response to IFN-δ. Poly-G oligonucleotides were also found to be able to inhibit the secretion of IFN-δ from lymphocytes (Halperin and Pisetsky, 1995, Immunopharmacol., 29:47-52). It was surprisingly, discovered according to the invention that when poly-G nucleic acids are administered in vivo, they are useful for treating or preventing allergy or asthma. Thus, in this aspect of the invention, poly-G nucleic acids are administered alone or optionally with other asthma/allergy medicaments for the treatment of allergy and/or asthma.
Poly-G nucleic acids preferably are nucleic acids having the following formulas: [0067]
5′X₁X₂GGGX₃X₄3′
wherein X[0068] ₁, X₂, X₃, and X₄are nucleotides. In preferred embodiments at least one of X₃and X₄are a G. In other embodiments both of X₃and X₄are a G. In yet other embodiments the preferred formula is 5′ GGGNGGG 3′, or 5′ GGGNGGGNGGG 3′ wherein N represents between 0 and 20 nucleotides. In other embodiments the poly-G nucleic acid is free of unmethylated CG dinucleotides, while in other embodiments the poly-G nucleic acid includes at least one unmethylated CG dinucleotide.
The poly G nucleic acid in some embodiments is selected from the group consisting of SEQ ID NO: 5, 6, 73, 215, 267-269, 276, 282, 288, 297-299, 355, 359, 386, 387, 444, 476, 531, 557-559, 733, 768, 795, 796, 914-925, 928-931, 933-936, and 938. In other embodiments, the poly G nucleic acid includes a sequence selected from the group consisting of SEQ ID NO: 67, 80-82, 141, 147, 148, 173, 178, 183, 185, 214, 224, 264, 265, 315, 329, 434, 435, 475, 519, 521-524, 526, 527, 535, 554, 565, 609, 628, 660, 661, 662, 725, 767, 825, 856, 857, 876, 892, 909, 926, 927, 932, and 937. In some embodiments, the entire backbone of the poly-G nucleic acid is phosphorothioate. [0069]
In related embodiments, the invention also contemplates the use of immunostimulatory nucleic acids that comprise one and preferably two poly-G motifs, even more preferably flanking a palindrome. Such immunostimulatory nucleic acids preferably have a chimeric backbone (i.e., their backbone is comprised of both phosphodiester and phosphorothioate linkages). Even more preferably, the phosphorothioate linkages in these latter immunostimulatory nucleic acids are located at the 5′ and 3′ ends of the nucleic acid. Examples of suitable palindromes include, but are not limited to AACGTT; AAGCTT; AGCGCT; TCGA; TTCGAA; ACGT; GACGTC; and CACGTG. [0070]
Nucleic acids having modified-backbones, such as phosphorothioate backbones, fall within the class of immunostimulatory nucleic acids. U.S. Pat. Nos. 5,723,335 and 5,663,153 issued to Hutcherson, et al. and related PCT publication WO95/26204 describe immune stimulation using phosphorothioate oligonucleotide analogues. These patents describe the ability of the phosphorothioate backbone to stimulate an immune response in a non-sequence specific manner. [0071]
The backbone characteristics of the nucleic acids listed in Table 1 are also shown. Some of the designations in the Table are as follows: o or po=phosphodiester, s=phosphorothioate, sos=chimeric. [0072]
In the case when the immunostimulatory nucleic acid is administered in conjunction with a nucleic acid vector, it is preferred that the backbone of the immunostimulatory nucleic acid be a chimeric combination of phosphodiester and phosphorothioate (or other phosphate modification). The cell may have a problem taking up a plasmid vector in the presence of completely phosphorothioate oligonucleotide. Thus when both a vector and an oligonucleotide are delivered to a subject, it is preferred that the oligonucleotide have a chimeric backbone or have a phosphorothioate backbone but that the plasmid is associated with a vehicle that delivers it directly into the cell, thus avoiding the need for cellular uptake. Such vehicles are known in the art and include, for example, liposomes and gene guns. [0073]
For use in the instant invention, the immunostimulatory nucleic acids can be synthesized de novo using any of a number of procedures well known in the art. Such compounds are referred to as “synthetic nucleic acids.” For example, the b-cyanoethyl phosphoramidite method (Beaucage, S. L., and Caruthers, M. H., [0074] Tet. Let. 22:1859, 1981); nucleoside H-phosphonate method (Garegg et al., Tet. Let. 27:4051-4054, 1986; Froehler et al., Nucl. Acid. Res. 14:5399-5407, 1986; Garegg et al., Tet. Let. 27:4055-4058, 1986, Gaffney et al., Tet. Let. 29:2619-2622, 1988). These chemistries can be performed by a variety of automated oligonucleotide synthesizers available in the market. These nucleic acids are referred to as synthetic nucleic acids. Alternatively, immunostimulatory nucleic acids can be produced on a large scale in plasmids, (see Sambrook, T., et al., “Molecular Cloning: A Laboratory Manual”, Cold Spring Harbor laboratory Press, New York, 1989) and separated into smaller pieces or administered whole. Nucleic acids can be prepared from existing nucleic acid sequences (e.g., genomic or cDNA) using known techniques, such as those employing restriction enzymes, exonucleases or endonucleases. Nucleic acids prepared in this manner are referred to as isolated nucleic acids. The term “immunostimulatory nucleic acid” encompasses both synthetic and isolated immunostimulatory nucleic acids.
For use in vivo, nucleic acids are preferably: relatively resistant to degradation (e.g., are stabilized). A “stabilized nucleic acid molecule” shall mean a nucleic acid molecule that is relatively resistant to in vivo degradation (e.g. via an exo- or endo-nuclease). Stabilization can be a function of length or secondary structure. Immunostimulatory nucleic acids that are tens to hundreds of kbs long are relatively resistant to in vivo degradation. For shorter immunostimulatory nucleic acids, secondary structure can stabilize and increase their effect. For example, if the 3′ end of a nucleic acid has self-complementarity to an upstream region, so that it can fold back and form a sort of stem loop structure, then the o nucleic acid becomes stabilized and therefore exhibits more activity. [0075]
Alternatively, nucleic acid stabilization-can be accomplished via backbone modifications. Preferred stabilized nucleic acids of the instant invention have a modified backbone. It has been demonstrated that modification of the nucleic acid backbone provides enhanced activity of the immunostimulatory nucleic acids when administered in vivo. One type of modified backbone is a phosphate backbone modification. Immunostimulatory nucleic acids, including at least two phosphorothioate linkages at the 5′ end of the oligonucleotide and multiple phosphorothioate linkages at the 3′ end, preferably 5, can in some circumstances provide maximal activity and protect the nucleic acid from degradation by intracellular exo- and endo-nucleases. Other phosphate modified nucleic acids include phosphodiester modified nucleic acids, combinations of phosphodiester and phosphorothioate nucleic acids, methylphosphonate, methylphosphorothioate, phosphorodithioate, and combinations thereof. Each of these combinations in CpG nucleic acids and their particular effects on immune cells is discussed in more detail in PCT Published Patent Applications PCT/US95/01570 and PCT/US97/19791, the entire contents of which are hereby incorporated by reference. Although Applicants are not bound by the theory, it is believed that these phosphate modified nucleic acids may show more stimulatory activity due to enhanced nuclease resistance, increased cellular uptake, increased protein binding, and/or altered intracellular localization. [0076]
Modified backbones such as phosphorothioates may be synthesized using automated techniques employing either phosphoramidate or H-phosphonate chemistries. Aryl- and alkyl-phosphonates can be made, e.g., as described in U.S. Pat. No. 4,469,863; and alkylphosphotriesters, (in which the charged oxygen moiety is alkylated as described in U.S. Pat. No. 5,023,243 and European Patent No. 092,574) can be prepared by automated solid phase synthesis using commercially available reagents. Methods for making other DNA backbone modifications and substitutions have been described (Uhlmann, E. and Peyman, A., [0077] Chem. Rev. 90:544, 1990; Goodchild; J., Bioconjugate Chem. 1:165, 1990).
Both phosphorothioate and phosphodiester nucleic acids containing immunostimulatory motifs are active in immune cells. However, based on the concentration needed to induce immunostimulatory nucleic acid specific effects, the nuclease resistant phosphorothioate backbone immunostimulatory nucleic acids are more potent (2 μg/ml for the phosphorothioate vs. a total of 90 μg/ml for phosphodiester). [0078]
Another type of modified backbone, useful according to the invention, is a peptide nucleic acid. The backbone is composed of aminoethylglycine and supports bases which provide the DNA-character. The backbone does not include any phosphate and thus may optionally have no net charge. The lack of charge allows for stronger DNA-DNA binding because the charge repulsion between the two strands does not exist. Additionally, because the backbone has an extra methylene group, the oligonucleotides are enzyme/protease resistant. Peptide nucleic acids can-be purchased from various commercial sources, e.g., Perkin Elmer, C. A. or synthesized de novo. [0079]
Another class of backbone modifications include 2′-O-methylribonucleosides (2′-Ome). These types of substitutions are described extensively in the prior art and in particular with respect to their immunostimulating properties in Zhao et al., [0080] Bioorganic and Medicinal Chemistry Letters, 1999, 9:24:3453. Zhao et al. describes methods of preparing 2′-Ome modifications to nucleic acids.
The nucleic acid molecules of the invention may include naturally-occurring or synthetic purine or pyrimidine heterocyclic bases as well as modified backbones. Purine or pyrimidine heterocyclic bases include, but are not limited to, adenine, guanine, cytosine, thymidine, uracil, and inosine. Other representative heterocyclic bases are disclosed in U.S. Pat. No. 3,687,808, issued to Merigan, et al. The term purine or pyrimidine or bases are used herein to refer to both naturally-occurring or synthetic purines, pyrimidines or bases. [0081]
Other stabilized nucleic acids include: nonionic DNA analogs, such as alkyl- and aryl-phosphates (in which the charged phosphonate oxygen is replaced by an alkyl or aryl group), phosphodiester and alkylphosphotriesters, in which the charged oxygen moiety is alkylated. Nucleic acids which contain diol, such as tetraethyleneglycol or hexaethyleneglycol, at either or both termini have also been shown to be substantially resistant to nuclease degradation. [0082]
The immunostimulatory nucleic acids having backbone modifications useful according to the invention in some embodiments are S- or R-chiral immunostimulatory nucleic acids. An “S chiral immunostimulatory nucleic acid” as used herein is an immunostimulatory nucleic acid wherein at least two nucleotides have a backbone modification forming a chiral center and wherein a plurality of the chiral centers have S chirality. An “R chiral immunostimulatory nucleic acid” as used herein is an immunostimulatory nucleic acid wherein at least two nucleotides have a backbone modification forming a chiral center and wherein a plurality of the chiral centers have R chirality. The backbone modification may be any type of modification that-forms a chiral center. The modifications include but are not-limited to phosphorothioate, methylphosphonate, methylphosphorothioate, phosphorodithioate, 2′-Ome and combinations thereof. [0083]
The chiral immunostimulatory nucleic acids must have at least two nucleotides within the nucleic acid that have a backbone modification. All or less than all of the nucleotides in the nucleic acid, however, may have a modified backbone. Of the nucleotides having a modified backbone (referred to as chiral centers), a plurality have a single chirality, S or R. A “plurality” as used herein within the context of modified backbones refers to an amount greater than 50%. Thus, less than all of the chiral centers may have S or R chirality as long as a plurality of the chiral centers have S or R chirality. In some embodiments at least 55%, 60%, 65%, 70%, 75%, 80,%, 85%, 90%, 95%, or 100% of the chiral-centers have S or R chirality. In other embodiments at least-55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% of the nucleotides have backbone modifications. [0084]
The S- and R-chiral immunostimulatory nucleic acids may be prepared by any method known in the art for producing chirally pure oligonucleotides. The Stec et al reference teaches methods for producing stereopure phosphorothioate oligodeoxynucleotides using an oxathiaphospholane. (Stec, W. J., et al., 1995[0085] , J. Am. Chem. Soc., 117:12019). Other methods for making chirally pure oligonucleotides have been described by companies such as ISIS Pharmaceuticals. US patents have also described these methods. For instance U.S. Pat. Nos. 5,883,237; 5,837,856; 5,599,797; 5,512,668; 5,856,465; 5,359,052; 5,506,212; 5,521,302; and 5,212,295, each of which is hereby incorporated by reference in its entirety, disclose methods for generating stereopure oligonucleotides.
The immunostimulatory nucleic acids are useful for treating or preventing allergy or asthma in a subject. A “subject” shall mean a human or vertebrate mammal including but not limited to a dog, cat, horse, cow, pig, sheep, goat, or primate, e.g., monkey. [0086]
The immunostimulatory nucleic acids are useful in some aspects of the invention as a prophylactic for the treatment of a subject at risk of developing an allergy or asthma where the exposure of the subject to an allergen or predisposition to asthma is known or suspected. A “subject at risk” of developing allergy or asthma as used herein is a subject who has any risk of exposure to an allergen or a risk of developing asthma, i.e. someone who has suffered from an asthmatic attack previously or has a predisposition to asthmatic attacks. For instance, a subject at risk may be a subject who is planning to travel to an area where a particular type of allergen or asthmatic initiator is found or it may even be any subject living in an area where an allergen has been identified. If the subject develops allergic responses to a particular antigen and the subject may be exposed to the antigen, i.e., during pollen season, then that subject is at risk of exposure to the antigen. A subject at risk of developing an allergy or asthma includes those subjects that have been identified as having an allergy or asthma but that don't have the active disease during the treatment of the invention as well as subjects that are considered to be at risk of developing these diseases because of genetic or environmental factors. [0087]
In addition to the use of the immunostimulatory nucleic acid and the asthma/allergy medicament for prophylactic treatment, the invention also encompasses the use of the combination of drugs for the treatment of a subject having an allergy or asthma. A “subject having an allergy” is a subject that has an allergic reaction in response to an allergen. An “allergy” refers to acquired hypersensitivity to a substance (allergen). [0088]
The allergic reaction in man and animals has been extensively studied and the basic immune mechanisms involved are well known. Allergic conditions or diseases in humans include but are not limited to eczema, allergic rhinitis or coryza, hay fever, conjunctivitis, bronchial or allergic asthma, urticaria (hives) and food allergies; atopic dermatitis; anaphylaxis; drug allergy; angioedema; and allergic conjunctivitis. Allergic diseases in dogs, include but are not limited to seasonal dermatitis; perennial dermatitis; rhinitis: conjunctivitis; allergic asthma; and drug reactions. Allergic diseases in cats include but are not limited to dermatitis and respiratory disorders; and food allergens. Allergic diseases in horses include but are not limited to respiratory disorders such as “heaves” and dermatitis. Allergic diseases in non-human primates include but are not limited to allergic asthma and allergic dermatitis. [0089]
The generic name for molecules that cause an allergic reaction is allergen. There are numerous species of allergens. The allergic reaction occurs when tissue-sensitizing immunoglobulin of the IgE type reacts with foreign allergen. The IgE antibody is bound to mast cells and/or basophils, and these specialized cells release chemical mediators (vasoactive amines) of the allergic reaction when stimulated to do so by allergens bridging the ends of the antibody molecule. Histamine, platelet activating factor, arachidonic acid metabolites, and serotonin are among the best known mediators of allergic reactions in man. Histamine and the other vasoactive amines are normally stored in mast cells and basophil leukocytes. The mast cells are dispersed throughout animal tissue and the basophils circulate within the vascular system. These cells manufacture and store histamine within the cell unless the specialized sequence of events involving IgE binding occurs to trigger its release. [0090]
The symptoms of the allergic reaction vary, depending on the location within the body where the IgE reacts with the antigen. If the reaction occurs along the respiratory epithelium the symptoms are sneezing, coughing and asthmatic reactions. If the interaction-occurs in the digestive tract, as in the case of food allergies, abdominal pain and diarrhea are common. Systematic reactions, for example following a bee sting, can be severe and often life threatening. [0091]
Delayed type hypersensitivity, also known as type IV allergy reaction is an allergic so reaction characterized by a delay period of at least 12 hours from invasion of the antigen into the allergic subject until appearance of the inflammatory or immune reaction. The T lymphocytes (sensitized T lymphocytes) of individuals in an allergic condition react with the antigen, triggering the T lymphocytes to release lymphokines (macrophage migration inhibitory factor (MIF), macrophage activating factor (MAF), mitogenic factor (MF), skin-reactive factor (SRF), chemotactic factor, neovascularization-accelerating factor, etc.), which function as inflammation mediators, and the biological activity of these lymphokines, together with the direct and indirect effects of locally appearing lymphocytes and other inflammatory immune cells, give rise to the type IV allergy reaction. Delayed allergy reactions include tuberculin type reaction, homograft rejection reaction, cell-dependent type protective reaction, contact dermatitis hypersensitivity reaction, and the like, which are known to be most strongly suppressed by steroidal agents. Consequently, steroidal agents are effective against diseases which are caused by delayed allergy reactions. Long-term use of steroidal agents at concentrations currently being used can, however, lead to the serious side-effect known as steroid dependence. The methods of the invention solve some of these problems, by providing for lower and fewer doses to be administered. [0092]
Immediate hypersensitivity (or anaphylactic response) is a form of allergic reaction which develops very quickly, i.e. within seconds or minutes of exposure of the patient to the causative allergen, and it is mediated by IgE antibodies made by B lymphocytes. In nonallergic patients, there is no IgE antibody of clinical relevance; but, in a person suffering with allergic diseases, IgE antibody mediates immediate hypersensitivity by sensitizing mast cells which are abundant in the skin, lymphoid organs, in the membranes of the eye, nose and mouth, and in the respiratory tract and intestines. [0093]
Mast cells have surface receptors for IgE, and the IgE antibodies in allergy-suffering patients become bound to them. As discussed briefly above, when the bound IgE is subsequently contacted by the appropriate allergen, the mast cell is caused to degranulate and to release various substances called bioactive mediators, such as histamine, into the surrounding tissue. It is the biologic activity of these substances which is responsible for the clinical symptoms typical of immediate hypersensitivity; namely, contraction of smooth muscle in the airways or the intestine, the dilation of small blood vessels and the increase in their permeability to water and plasma proteins, the secretion of thick sticky mucus, and in the skin, redness, swelling and the stimulation of nerve endings that results in itching or pain. [0094]
Many allergies are caused by IgE antibody generation against harmless allergens. The cytokines that are induced by administration of immunostimulatory nucleic acids are predominantly of a class called “Th1” (examples are IL-12 and IFN-γ). Cytokine production by helper CD4[0095] ⁺(and also in CD8⁺) T cells frequently fall into one of two phenotypes, Th1 and Th2, in both murine and human systems (Romagnani, 1991, Immunol Today 12: 256-257, Mosmann, 1989, Annu-Rev Immunol, 7: 145-173). Th1 cells produce interleukin 2 (IL-2), tumor necrosis factor (TNFα) and interferon gamma (IFNγ) and they are responsible primarily for cell-mediated immunity such as delayed type hypersensitivity. Th2 cells produce interleukins, IL-4, IL-5, IL-6, IL-9, IL-10 and IL-13 and are primarily involved in providing optimal help for humoral immune responses such as IgE and IgG4 antibody isotype switching (Mosmann, 1989, Annu Rev Immunol, 7: 145-173).
The types of antibodies associated with a Th1 response are generally more protective because they have high neutralization and opsonization capabilities. Th2 responses involve predominately antibodies and these have less protective effect against infection and some Th2 isotypes (e.g., IgE) are associated with allergy. Strongly polarized. Th1 and Th2 responses not only play different roles in protection, they can promote different immunopathological reactions. Th1-type responses are involved organ specific autoimmunity-such as experimental autoimmune uveoretinitis (Dubeyet al, 1991, Eur Cytokine Network 2: 147-152), experimental autoimmune encephalitis (EAE) (Beraud et al, 1991, Cell Immunol 133: 379-389) and insulin dependent diabetes mellitus (Hahnet al, 1987[0096] , Eur. J. Immunol. 18: 2037-2042), in contact dermatitis (Kapsenberg et al, Immunol Today 12: 392-395), and in some chronic inflammatory disorders. In contrast Th2-type responses are responsible for triggering allergic atopic disorders (against common environmental allergens) such as allergic asthma (Walker et al, 1992, Am Rev Resp Dis 148: 109-115) and atopic dermatitis (van der Heijden et al, 1991, J Invest Derm 97: 389-394), are thought to exacerbate infection with tissue-dwelling protozoa such as helminths (Finkelman et al, 1991, Immunoparasitol Today 12: A62-66) and Leishmania major (Caceres-Dittmar et al, 1993, Clin Exp Immunol 91: 500-505), are preferentially induced in certain primary immunodeficiencies such as hyper-IgE syndrome (Del Prete et al, 1989, J Clin Invest 84: 1830-1835) and Omenn's syndrome (Schandene et al, 1993, Eur J Immunol 23: 56-60), and are associated with reduced ability to suppress HIV replication (Barker et al, 1-995, Proc Soc Nat Acad Sci USA 92: 11135-11139).
Thus, in general, it appears that allergic diseases are mediated by Th2 type immune responses. Based on the ability of the immunostimulatory nucleic acid to shift the immune response in a subject from a Th2 (which is associated with production of IgE antibodies and allergy and asthma) to a Th1 response (which is protective against allergic and asthmatic reactions), an effective dose for inducing an immune response of a immunostimulatory nucleic acid can be administered to a subject to treat or prevent an allergy or asthma. [0097]
Th2 cytokines, especially IL-4 and IL-5 are elevated in the airways of asthmatic, subjects. These cytokines promote important aspects of the asthmatic inflammatory response, including IgE isotype switching, eosinophil chemotaxis and activation, and mast cell growth. Th1 cytokines, especially IFN-g and IL-12, can suppress the formation of Th2 clones and production of Th2 cytokines. Thus, the immunostimulatory nucleic acid has significant therapeutic utility in the treatment of allergic conditions and asthma. [0098]
An “allergen” as used herein is a molecule capable of provoking an immune response characterized by production of IgE. Thus, in the context of this invention, the term allergen means a specific type of antigen which can trigger an allergic response which is mediated by IgE antibody. The method and preparations of this invention extend to a broad class of such allergens and fragments of allergens or haptens acting as allergens. Allergens include but are not limited to Environmental Aeroallergens; plant pollens such as Ragweed/hayfever (affects 10% of pop., 25 million ppl); Weed pollen allergens; Grass pollen allergens (grasses affect 10% of pop., 25 million ppl); Johnson grass; Tree pollen allergens; Ryegrass; House dust mite allergens (affects 6% of pop., 15 million ppl); Storage mite allergens; Japanese cedar pollen/hay fever (affects 10% of pop. In Japan, 13 million ppl); Mold spore allergens; Animal allergens (cat (affects 2% of pop., 5 million ppl), dog, guinea pig, hamster, gerbil, rat, mouse); Food Allergens (e.g., Crustaceans; nuts, such-as peanuts; citrus fruits); Insect Allergens (Other than mites, listed above); Venoms: ([0099] Hymenoptera, yellow jacket, honey bee, wasp, hornet, fire ant); Other environmental insect allergens from cockroaches, fleas, mosquitoes, etc.; Bacteria such as streptococcal antigens; Parasites such as Ascaris antigen; Viral Antigens; Fungal spores; Drug Allergens; Antibiotics; penicillins and related compounds; other antibiotics; Whole Proteins such-as hormones (insulin), enzymes (Streptokinase); all drugs and their metabolites capable of acting as incomplete antigens or haptens; Industrial Chemicals and metabolites capable of acting as haptens and stimulating the immune system (Examples are the acid anhydrides (such as trimellitic anhydride) and the isocyanates (such as toluene diisocyanate)); Occupational Allergens such as flour (ie. Baker's asthma), castor bean, coffee bean, and industrial chemicals described above; flea allergens; and human proteins in non-human animals.
Allergens include but are not limited to cells, cell extracts, proteins, polypeptides, peptides, polysaccharides, polysaccharide conjugates, peptide and non-peptide mimics of polysaccharides and other molecules, small molecules, lipids, glycolipids, and carbohydrates. Many allergens, however, are protein or polypeptide in nature, as proteins and polypeptides are generally more antigenic than carbohydrates or fats. [0100]
Examples of specific natural, animal and plant allergens include but are not limited to proteins specific to the following genuses: Canine ([0101] Canis familiaris); Dermatophagoides (e.g. Dermatophagoides farinae); Felis (Felis domesticus); Ambrosia (Ambrosia artemiisfolia; Lolium (e.g. Lolium perenne or Lolium multiflorum); Cryptomeria(Cryptomeria japonica); Alternaria (Alternaria alternata); Alder; Alnus (Alnus gultinoasa); Betula (Betula verrucosa); Quercus (Quercus alba); Olea (Olea europa); Artemisia (Artemisia vulgaris); Plantago (e.g. Plantago lanceolata); Parietaria (e.g. Parietaria officinalis or Parietaria judaica); Blattella (e.g. Blattella germanica); Apis (e.g. Apis multiflorum); Cupressus (e.g. Cupressus sempervirens, Cupressus arizonica and Cupressus macrocarpa); Juniperus (e.g. Juniperus sabinoides, Juniperus virginiana, Juniperus communis and Juniperus ashei); Thuya (e.g. Thuya orientalis); Chamaecyparis (e.g. Chamaecyparis obtusa); Periplaneta (e.g. Periplaneta americana); Agropyron (e.g. Agropyron repens); -Secale (e.g. Secale cereale); Triticum (e.g. Triticum aestivum); Dactylis (e.g. Dactylis glomerata); Festuca (e.g. Festuca elatior); Poa (e.g. Poa pratensis or Poa compressa); Avena (e.g. Avena sativa); Holcus (e.g. Holcus lanatus); Anthoxanthum (e.g. Anthoxanthum odoratum); Arrhenatherum (e.g. Arrhenatherum elatius); Agrostis (e.g. Agrostis alba); Phleum (e.g. Phleum pratense); Phalaris (e.g. Phalaris aruindinacea); Paspalum (e.g. Paspalum notatum); Sorghum (e.g. Sor-ghum halepensis); and Bromus (e.g. Bromus inermis).
A “subject having asthma” is a subject that has a disorder of the respiratory system characterized by inflammation, narrowing of the airways and increased reactivity of the airways to inhaled agents. Asthma is frequently, although not exclusively associated with atopic or allergic symptoms. An “initiator” as used herein refers to a composition or environmental condition which triggers asthma. Initiators include, but are not limited to, allergens, cold temperatures, exercise, viral infections, SO[0102] ₂.
In another aspect the invention provides methods for treating or preventing asthma or allergy in a hypo-responsive subject. As used herein, a hypo-responsive subject is one who has previously failed to respond to a treatment directed at treating or preventing asthma or allergy or one who is at risk of not responding to such a treatment. The treatment directed at treating or preventing asthma or allergy may began asthma/allergy medicarnent, in which case the hypo-responsive subject is one who is hypo-responsive to an asthma/allergy medicament. [0103]
Other subjects who are hypo-responsive include those who are refractory to an asthma/allergy medicament. As used herein, the term “refractory” means resistant or failure to yield to treatment. Such subjects may be those who never responded to an asthma/allergy medicament (i.e., subjects who are non-responders), or alternatively, they may be those who at one time responded to an asthma/allergy medicament, but have since that time have become refractory to the medicament. In some embodiments, the subject is one who is refractory to a subset of medicaments. A subset of medicaments is at least one medicament. In some embodiments, a subset refers to 2, 3, 4, 5, 6, 7, 8, 9, or 10 medicaments. [0104]
In other embodiments, hypo-responsive subjects are elderly subjects, regardless of whether they have or have not previously responded to a treatment directed at treating or preventing asthma or allergy. Elderly subjects, even those who have previously responded to such treatment, are considered to be at risk of not responding to a future administration of this treatment. Similarly, neonatal subjects are also considered to be at risk of not responding to treatment directed at treating or preventing asthma or allergy. [0105]
In some embodiments, an immunostimulatory nucleic acid is administered to the hypo-responsive subject without the further administration of an asthma/allergy medicament. In yet other embodiments, an asthma/allergy medicament is administered to the hypo-responsive subject, in which case it may be administered substantially simultaneously (i.e., concurrently) with, or following the administration of the immunostimulatory nucleic acid. [0106]
An “asthma/allergy medicament” as used herein is a composition of matter which reduces the symptoms, inhibits the asthmatic or allergic reaction, or prevents the development of an allergic or asthmatic reaction. Various types of medicaments for the treatment of asthma and allergy are described in the Guidelines For The Diagnosis and Management of Asthma, Expert Panel Report 2, NIH Publication No. 97/4051, Jul. 19, 1997, the entire contents of which are incorporated herein by reference. The summary of the medicaments as described in the NIH publication is presented below. [0107]
In most embodiments the asthma/allergy medicament is useful to some degree for treating both asthma and allergy. Some asthma/allergy medicaments are preferably used in combination with the immunostimulatory nucleic acids to treat asthma. These are referred to as asthma medicaments. Asthma medicaments include, but are not limited PDE-4 inhibitors, bronchodilator/beta-2 agonists, K+ channel openers, VLA-4 antagonists, neurokin antagonists, TXA2 synthesis inhibitors, xanthanines, arachidonic acid antagonists, 5 lipoxygenase inhibitors, thromboxin A2 receptor antagonists, thromboxane A2 antagonists, inhibitor of 5-lipox activation proteins, and protease inhibitors. [0108]
Bronchodilator/beta-2 agonists are a class of compounds which cause bronchodilation or smooth muscle relaxation. Bronchodilator/beta-2-agonists include, but are not limited to, salmeterol, salbutamol, albuterol, terbutaline, D2522/formoterol, fenoterol, bitolterol, pirbuerol methylxanthines and orciprenaline. Long-acting β[0109] ₂-agonists and bronchodilators-are compounds which are used for long-term prevention of symptoms in addition to the anti-inflammatory therapies. They function by causing bronchodilation, or smooth muscle relaxation, following adenylate cyclase activation and increase in cyclic AMP producing functional antagonism of bronchoconstriction. These compounds also inhibit mast cell mediator release, decrease vascular permeability and increase mucociliary clearance. Long-acting β₂agonists include, but are not limited to, salmeterol and albuterol. These compounds are usually used in combination with corticosteroids and generally are not used without any inflammatory therapy. They have been associated with side effects such as tachycardia, skeletal muscle tremor, hypokalemia, and prolongation of QTc interval in overdose.
Methylxanthines, including for instance theophylline, have been used for long-term control and prevention of symptoms. These compounds cause bronchodilation resulting from phosphodiesterase inhibition and likely adenosine antagorni. It is also believed that these compounds may effect eosinrophilic infiltration into bronchial mucosa and decrease T-lymphocyte numbers in the epithelium. Dose-related acute toxicities are a particular problem with these types of compounds. As a result, routine serum concentration must be monitored in order to account for the toxicity and narrow therapeutic range arising from individual differences in metabolic clearance. Side effects include tachycardia, nausea and vomiting, tachyarrhythmias, central nervous system stimulation, headache, seizures, hematemesis, hyperglycemia and hypokalemia. Short-acting β[0110] ₂agonists/bronchodilators relax airway smooth muscle, causing the increase in air flow. These types of compounds are a preferred drug for the treatment of acute asthmatic systems. Previously, short-acting β₂agonists had been prescribed on a regularly-scheduled basis in order to improve overall asthma symptoms. Later reports, however, suggested that regular use of this class of drugs produced significant diminution in asthma control and pulmonary function (Sears, et al. Lancet; 336:1391-6, 1990). Other studies showed that regular use of some types of β₂agonists produced no harmful effects over a four-month period but also produced no demonstrable effects (Drazen, et al., N. Eng. J. Med., 335:841-7, 1996). As a result of these studies, the daily use of short-acting β2 agonists is not generally recommended. Short-acting β₂agonists include, but are not limited to, albuterol, bitolterol, pirbuterol, and terbutaline. Some of the adverse effects associated with the mastration of short-acting β₂agonists include tachycardia, skeletal muscle tremor, hypokalemia, increased lactic acid, headache, and hyperglycemia.
Other asthma/allergy medicaments are preferably used in combination with the imminostimulatory nucleic acids to treat allergy. These are referred to as allergy medicaments. Allergy medicaments include, but are not limited to, anti-histamines, steroids, and prostaglandin inducers. Anti-histamines are compounds which counteract histamine released by mast cells or basophils. These compounds are well known in the art and commonly used for the treatment of allergy. Anti-histamines include, but are not limited to, loratidine, cetirizine, buclizine, ceterizine analogues, fexofenadine, terfenadine, desloratadine, norastemizole, epinastine, ebastine, ebastine, astemizole, levocabastine, azelastine, tranilast, terfenadine, mizolastine, betatastine, CS 560, and HSR 609. Prostaglandin inducers are compounds which induce prostaglandin activity. Prostaglandins function by regulating smooth muscle relaxation. Prostaglandin inducers include, but are not limited to, S-5751. [0111]
The asthma/allergy medicaments useful in combination with the immunostimulatory nucleic acids also include steroids and immunomodulators. [0112]
The steroids include, but are not limited to, beclomethasone, fluticasone, tramcinolone, budesonide, corticosteroids and budesonide. The combination of immunostimulatory nucleic acids and steroids are particularly well suited to the treatment of young subjects (e.g., children). To date, the use of steroids in children has been limited by the observation that some steroid treatments have been reportedly associated with growth retardation. Thus, according to the present invention, the immunostimulatory nucleic acids can be used in combination with growth retarding steroids, and can thereby provide a “steroid sparing effect.” The combination of the two agents can result in lower required doses of steroids. [0113]
Corticosteroids are used long-term to prevent development of the symptoms, and suppress, control, and reverse inflammation arising from an initiator. Some corticosteroids can be administered by inhalation and others are administered systemically. The corticosteroids that are inhaled have an anti-inflammatory function by blocking late-reaction allergen and reducing airway hyper-responsiveness. These drugs also inhibit cytokine production, adhesion protein activation, and inflammatory cell migration and activation. [0114]
Corticosteroids include, but are not limited to, beclomethasome dipropionate, budesonide, flunisolide, fluticaosone, propionate, and triamcinoone acetonide. Although dexamethasone is a corticosteroid having anti-inflammatory action, it is not regularly used for the treatment of asthma/allergy in an inhaled form because it is highly absorbed, it has long-term suppressive side effects at an effective dose. Dexamethasone, however, can be used according to the invention for the treating of asthma/allergy because when administered in combination with immunostimulatory nucleic acids it can be administered at a low dose to reduce the side effects. Additionally, the immunostimulatory nucleic acid can be administered to reduce the side effects of dexamethasone at higher concentrations. Some of the side effects associated with corticosteroid include cough, dysphonia, oral thrush (candidiasis), and in higher doses, systemic-effects, such as adrenal suppression, osteoporosis, growth suppression, skin thinning and easy bruising. (Barnes & Peterson, [0115] Am. Rev. Respir. Dis.; 148:S1-S26, 1993; and Kamada et al., Am. J. Respir. Crit. Care Med.; 153:1739-48, 1996)
Systemic corticosteroids include, but are not limited to, methylprednisolone, [0116]
prednisolone and prednisone. Cortosteroids are used generally for moderate to severe exacerbations to prevent the progression, reverse inflammation and speed recovery. These anti-inflammatory compounds include, but are hot limited to, methylprednisolone, prednisolone, and prednisone. Cortosteroids are associated with reversible abnormalities in glucose metabolism, increased appetite, fluid retention, weight gain, mood alteration, hypertension, peptic ulcer, and rarely asceptic necrosis of femur. These compounds are useful for short-term (3-10 days) prevention of the inflammatory reaction in inadequately-controlled persistent asthma. They also function in a long-term prevention of symptoms in severe persistent asthma to suppress and control- and actually reverse inflammation. The side effects associated with systemic corticosteroids are even greater than those associated with inhaled corticosteroids. Side effects include, for instance, reversible abnormalities in glucose metabolism, increased appetite, fluid retention, weight gain, mood alteration, hypertension, peptic ulcer and asceptic necrosis of femur, which are associated with short-term use. Some side effects associated with longer term use include adrenal axis suppression, growth suppression, dermal thinning, hypertension, diabetes, Cushing's syndrome, cataracts, muscle weakness, and in rare instances, impaired immune function. It is recommended that these types of compounds be used at their lowest effective dose (guidelines for the diagnosis and management of asthma; expert panel report to; NIH Publication No. 97-4051; July 1997). The inhaled corticosteroids are believed to function by blocking late reaction to allergen and reducing airway hyper-responsiveness. Their also believed to reverse β[0117] ₂-receptor downregulation and to inhibit microvascular leakage.
The immunomodulators include, but are not limited to, the group consisting of anti-inflammatory agents, leukotriene antagonists, IL-4 muteins, soluble IL-4 receptors, immunosuppressants (such as tolerizing peptide vaccine), anti-IL-4 antibodies, IL-4 antagonists, anti-IL-5 antibodies, soluble IL-13 receptor-Fc fusion proteins, anti-IL-9 antibodies, CCR3 antagonists, CCR5 antagonists, VLA-4 inhibitors, and, and downregulators of IgE. [0118]
Leukotriene modifiers are often used for long-term control and prevention of symptoms in mild persistent asthma. Leukotriene modifiers function as leukotriene receptor antagonists by selectively competing for LTD-4 and LTE-4 receptors. These compounds include, but are not limited to, zafirlukast tablets and zileuton tablets. Zileuton tablets function as 5-lipoxygenase inhibitors. These drugs have been associated with the elevation of liver enzymes and some cases of reversible hepatitis and hyperbilirubinemia. Leukotrienes are biochemical mediators that are released from mast cells, eosinophils, and basophils that cause contraction of airway smooth muscle and increase vascular permeability, mucous secretions and activate inflammatory cells in the airways of patients with asthma. [0119]
Other immunomodulators include neuropeptides that have been shown, to have immunomodulating properties. Functional studies have shown that substance P, for instance, can influence lymphocyte function by specific receptor mediated mechanisms. Substance P also has been shown to modulate distinct immediate hypersensitivity responses by stimulating the generation of arachidonic acid-derived mediators from mucosal mast cells. J. McGillies, et al., Substance P and Immunoregulation, Fed. Proc. 46:196-9 (1987). Substance P is a neuropeptide first identified in 1931 by Von Euler and Gaddum. An unidentified depressor substance in certain tissue extracts, J. Physiol. (London) 72:74-87 (1931). Its amino acid sequence, Arg-Pro-Lys-Pro-Gln-Gln-Phe-Phe-Gly-Leu-Met-NH.sub.2 (Sequence Id. No. 1) was reported by Chang et al. in 1971. Amino acid sequence of substance P, Nature (London) New Biol. 232:86-87 (1971). The immunoregulatory activity of fragments of substance P has been studied by Siemion, et al. Immunoregulatory Activity of Substance P Fragments, Molec. Immunol. 27:887-890 (1990). [0120]
Another class of compounds is the down-regulators of IgE. These compounds include peptides or other molecules with the ability to bind to the IgE receptor and thereby prevent binding of antigen-specific IgE. Another type of downregulator of IgE is a monoclonal antibody directed against the IgE receptor-binding region of the human IgE molecule. Thus, one type of downregulator of IgE is an anti-IgE antibody or antibody fragment. Anti-IgE is being developed by Genentech. One of skill in the art could prepare functionally active antibody fragments of binding peptides which have the same function. Other types of IgE downregulators are polypeptides capable of blocking the binding of the IgE antibody to the Fc receptors on the cell surfaces and displacing IgE from binding sites upon which IgE is already bound. [0121]
One problem associated with downregulators of IgE is that many molecules don't have a binding strength to the receptor corresponding to the very strong interaction between the native IgE molecule and its receptor. The molecules having this strength tend to bind irreversibly to the receptor. However, such substances are relatively toxic since they can bind covalently and block other structurally similar molecules in the body. Of interest in this context is that the alpha chain of the IgE receptor belongs to a larger gene family where i.e. several of the different IgG Fc receptors are contained. These receptors are absolutely essential for the defense of the body against i.e. bacterial infections. Molecules activated for covalent binding are, furthermore, often relatively unstable and therefore they probably have to be administered several times a day and then in relatively high concentrations in order to make it possible to block completely the continuously renewing pool of IgE receptors on mast cells and basophilic leukocytes. [0122]
These types of asthma/allergy medicaments are sometimes classified as long-term control medications or quick-relief medications. Long-term control medications include compounds such as corticosteroids (also referred to as glucocorticoids), methylprednisolone, prednisolone, prednisone, cromolyn sodium, nedocromil, long-acting β[0123] ₂-agonists, methylxanthines, and leukotriene modifiers. Quick relief medications are useful for providing quick relief of symptoms arising from allergic or asthmatic responses. Quick relief medications include short-acting β₂agonists, anticholinergics and systemic corticosteroids.
Chromolyn sodium and medocromil are used as long-term control medications for preventing primarily asthma symptoms arising from exercise or allergic symptoms arising from allergens. These compounds are believed to block early and late reactions to allergens by interfering with chloride channel function. They also stabilize mast cell membranes and inhibit activation and release of mediators from eosinophils and epithelial cells. A four to six week period of administration is generally required to achieve a maximum benefit. [0124]
Anticholinergics are generally used for the relief of acute bronchospasm. These compounds are believed to function by competitive inhibition of muscarinic cholinergic receptors. Anticholinergics include, but are not limited to, ipratrapoium bromide. These compounds reverse only cholinerigically-mediated bronchospasm and do not modify any reaction to antigen. Side effects include drying of the mouth and respiratory secretions, increased wheezing in some individuals, blurred vision if sprayed in the eyes. [0125]
In addition to standard asthma/allergy medicaments other methods for treating asthma/allergy have been used either alone or in combination with established medicaments. One preferred, but frequently impossible, method of relieving allergies is allergen or initiator avoidance. Another method currently used for treating allergic disease involves the injection of increasing doses of allergen to induce tolerance to the allergen and to prevent further allergic reactions. [0126]
Allergen injection therapy (allergen immunotherapy) is known to reduce the severity of allergic rhinitis. This treatment has been theorized to involve the production of a different form of antibody, a protective antibody which is termed a “blocking antibody”. Cooke, R A et al., Serologic Evidence of Immunity with Coexisting Sensitization in a Type of Human Allergy, Exp. Med. 62-733 (1935). Other attempts to treat allergy involve modifying the allergen chemically so that its ability to cause an immune response in the patient is unchanged, while its ability to cause an allergic reaction is substantially altered. [0127]
These methods, however, can take several years to be effective and are associated with the risk of side effects such as anaphylactic shock. The use of an immunostimulatory nucleic acid and asthma/allergy medicament in combination with an allergen avoids many of the side effects etc. [0128]

Commonly used allergy and asthma drugs which are currently in development or on the market are shown in Tables 1 and 2 respectively.

TABLE 1


Allergy Drugs in Development or on the Market

	BRAND NAME
MARKETER	(GENERIC NAME)	MECHANISM

Schering-	Claritin + Claritin D (loratidine)	Anti-histamine
Plough
	Vancenase (beclomethasone)	Steroid
UCB	Reactine (cetirizine)(US)	Anti-histamine
	Zyrtec (cetirizine)(ex US)
	Longifene (buclizine)	Anti-histamine
	UCB 28754 (ceterizine alalogue)	Anti-histamine
Glaxo	Beconase (beclomethasone	Steroid
	Flonase (fluticasone)	Steroid
Aventis	Allegra (fexofenadine)	Anti-histamine
	Seldane (terfenadine)	Anti-histamine
Pfizer	Reactine (cetirizine) (US)	Anti-histamine
	Zyrtec/Reactine (cetirizine)(ex US)
	(both licensed from UCB)
Sepracor	Allegra (fexofenadine)	Anti-histamine
	Desloratadine (lic to Schering-	Anti-histamine
	Plough) Cetirizine (−) (lic to UCB)	Anti-histamine
	Norastemizole (option to J&J not	Anti-histamine
	exercised, 10-17-99)
B. Ingelheim	Alesion (epinastine)	Anti-histamine
Aventis	Kestin (ebastine) (US)	Anti-histamine
	Bastel (ebastine) (Eu/Ger)
	Nasacort (tramcinolone)	Steroid
Johnson &	Hismanol (astemizole)	Anti-histamine
Johnson
	Livostin/Livocarb (levocabastine)	Anti-histamine
AstraZeneca	Rhinocort (budesonide) (Astra)	Steroid
Merck	Rhinocort (budesonide)	Steroid
Eisai	Azeptin (azelastine)	Anti-histamine
Kissei	Rizaben (tranilast)	Anti-histamine
Shionogi	Triludan (terfenadine).	Anti-histamine
	S-5751	Prostaglandin
		inducer
Schwarz	Zolim (mizolastine)	Anti-histamine
Daiichi	Zyrtec (cetirizine)	Anti-histamine
Tanabe	Talion/TAU-284 (betatastine)	Anti-histamine
Seiyaku
Sankyo**	CS 560 (Hypersensitizaion	Other
	therapy for cedar pollen allergy)
Asta Medica	Azelastine-MDPI (azelastine)	Anti-histamine
BASF	HSR 609	Anti-histamine
SR Pharma	SRL 172	Immunomodulation
Peptide	Allergy vaccine (allergy (hayfever,	Downregulates
Therapeutics	anaphylaxis, atopic asthma)	specific IgE
	Tolerizing peptide vaccine (rye	Immuno-
	grass peptide (T cell epitope))	suppressant
Coley	CpG DNA	Immunomodulation
Pharmaceutical
Group
Genetech	Anti-IgE	Down-regulator of
		IgE
SR Pharma	SRL 172	Immunomodulation

TABLE 2


Asthma Drugs in Development or on the Market

MARKETER	BRAND NAME (GENERIC NAME)	MECHANISM

Glaxo	Serevent (salmeterol)	Bronchodilator/beta-2 agonist
	Flovent (fluticasone)	Steroid
	Flixotide (fluticasone)
	Becotide (betamethasone)	Steroid
	Ventolin (salbutamol)	Bronchodilator/beta-2 agonist
	Seretide (salmeterol + fluticasone)	Beta agonist + steroid
	GW215864	Steroid, hydolysable
	GW250495	Steroid, hydolysable
	GW328267	Adenosine A2 agonist
AstraZeneca	Bambec (bambuterol) (Astra)
	Pulmicort (budesonide) (Astra)	Steroid
	Bricanyl Turbuhaler (terbutaline) (Astra)	Bronchodilator/beta-2 agonist
	Accolate (zafirlukast) (Zeneca)	Leukotriene antagonist Slo-
		Phyllin (theophylline)
	Inspiryl (salbutamol) (Astra)	Bronchodilator/beta-2 agonist
	Oxis Turbuhaler (D2522/formoterol)	Bronchodilator/beta-2 agonist
	Symbicort (pulmicort-oxis combination)	Steroid
	Roflepanide (Astra)	Steroid
	Bronica (seratrodast)	TXA2 synthesis inhibitor
	ZD 4407 (Zeneca)	5 lipoxygenase inhibitor
B. Ingelheim	Atrovent (ipratropium)	Bronchodilator/anti-
		cholinergic
	Berodual (ipratropium + fenoterol)	Bronchodilator/anti-
		cholinergic
	Berotec (fenoterol)	Bronchodilator/beta-2 agonist
	Alupent (orciprenaline)	Bronchodilator/beta-2 agonist
	Ventilat (oxitropium)	Bronchodilator/anti-
		cholinergic
	Spiropent (clenbuterol)	Bronchodilator/beta-2 agonist
	Inhacort (flunisolide)	Steroid
	BI679/tiotropium bromide
	RPR 106541	Steroid
	BIIX 1	Potassium channel
	BIIL284	LTB-4 antagonist
Schering-	Proventil (salbutamol)	Bronchodilator/beta-2 agonist
Plough
	Vanceril (beclomethasone)	Steroid
	Mometasone furoate	Steroid
	Theo-Dur (theophylline (w/Astra)
	Uni-Dur (theophylline)
	Asmanex (mometasone)	Steroid
	CDP 835 (lic from Celltech)	Anti-IL-5 Mab
RPR	Intal (disodium cromoglycate)	Anti-inflammatory
(Aventis)	Intal/Aarane (disodium cromoglycate)
	Tilade (nedocromil sodium)	Anti-inflammatory
	Azmacort (triamcinolone acetonide)	Steroid
	RP 73401	PDE-4 inhibitor
Novartis	Zaditen (ketotifen)	Anti-inflammatory
	Azmacort (triamcinolone)	Steroid
	Foradil (formoterol) (lic fromYamanouchi)	Bronchodilator/beta-2 agonist
	E25	Anti-IgE
	KCO 912	K+ channel opener
Merck	Singulair (montelukast)	Leukotriene antagonist
	Pulmicort Turbuhaler (budesonide)	Steroid
	Slo-Phyllin (theophylline)
	Symbicort (Pulmicort-Oxis combination)	Steroid
	Oxis Turbuhaler (D2522/formoterol)	Bronchodilator/beta-2 agonist
	Roflepanide	Steroid
	VLA-4 antagonist (lic from Biogen)	VLA-4 antagonist
ONO	Onon (pranlukast)	Leukotriene antagonist
	Vega (ozagrel)	TXA2 synthesis inhibitor
Fujisawa	Intal (chromoglycate)	Anti-inflammatory
	FK 888	Neurokin antagonist
Forest Labs	Aerobid (flunisolide)	Steroid
IVAX	Ventolin (salbutamol)	Bronchodilator/beta-2 agonist
	Becotide (beclomethasone Easi-Breathe)	Steroid
	Serevent (salmeterol)	Bronchodilator/beta-2 agonist
	Flixotide (fluticasone)	Steroid
	Budesonide Dry Powder Inhaler	Steroid
	Salbutamol Dry Powder Inhaler	Bronchodilator/beta-2 agonist
Alza	Volmax (salbutamol)	Bronchodilator/beta-2 agonist
Altana	Euphyllin (theophylline)	Xanthanine
	Ciclesonide	Arachidonic acid antagonist
	BY 217	PDE 4 inhibitor
	BY 9010N (ciclesonide)	Steroid (nasal)
Tanabe	Flucort (fluocinolone acetonide	Steroid
Seiyaku
Kissei	Domenan (ozagrel)	TXA2 synthesis inhibitor
Abbott	Zyflo (zileuton) (4X/day dosing, not competitive w/	5 lipoxygenase inhibitor
	Singulair or Accolate, no further interest in this area)
Asta Medica	Aerobec (beclomethasone dipropionate) (w/3M)
	Allergodil (azelastine)
	Allergospasmin (sodium cromoglycate reproterol)
	Bronchospasmin (reproterol)
	Salbulair (salbutamol sulphate) (w/3M)
	TriNasal (triamcinolone)	Steroid
	Formoterol-MDPI	Beta 2 adrenoceptor agonist
	Budesonide-MDPI
UCB	Atenos/Respecal (tulobuerol)	Bronchodilator/beta-2 agonist
Recordati	Theodur (theophylline)	Xanthine
Medeva	Clickhalers Asmasal, Asmabec (salbutamol	Steroid
	beclomethasone diproprionate, dry inhaler)
Eisai	E 6123	PAF receptor antagonist
Sankyo	Zaditen (ketotifen)	Anti-inflammatory
	CS 615	Leukotriene antagonist
Shionogi	Anboxan/S 1452 (domitroban)	Thromboxin A2 receptor
		antagonist
Yamanouchi	YM 976	PDE 4 inhibitor
	YM 158	Leukotriene D4/thromboxan 2
		dual antagonist
3M Pharma	Exirel (pirbuterol)
Hoechst	Autoinhalers (3M albuterol projects)	Bronchodilator/beta-2 agonist
(Aventis)
SmithKline	Ariflo	PDE-4 inhibitor
Beecham
	SB 240563	Anti-IL5 MAb (humanized)
	SB 240683	Anti-IL4 Mab
	IDEC 151/clenoliximab	Anti-CD4 MAb, primatised
Roche	Anti-IgE(GNE)/CGO51901	Down-regulator of IgE
Sepracor	Fomoterol (R,R)	Beta 2 adrenoceptor agonist
	Xopenex (levalbuterol)	Bet 2 adrenoceptor agonist
Bayer	BAY U 3405 (ramatroban)	Thromboxane A2 antagonist
	BAY 16-9996 (once monthly dosing)	IL4 mutein
	BAY 19-8004	PDE-4 inhibitor
SR Pharma	SRL 172	Immunomodulation
Immunex	Nuvance	Soluble IL-4 receptor
		(immunomodulator)
Biogen	Anti-VLA-4	Immunosuppressant
Vanguard	VML 530	Inhibitor of 5-lipox activation
		protein
Recordati	Respix (zafirlukast)	Leukotriene antagonist
Genentech	Anti-IgE MAb	Down-regulator of IgE
Warner	CI-1018	PDE 4 inhibitor
Lambert
Celltech/	CDP 835/SCH 55700 (anti-IL-5) (lic to Schering-	IL-5 antagonist Mab
Chiroscience	Plough)
	D 4418 (w/Schering-Plough)	PDE 4 inhibitor
	CDP 840 (Celltech)	PDE 4 inhibitor
AHP	Pda-641 (asthma steroid replacement)
Peptide	RAPID Technology Platform	Protease inhibitors
Therapeutics
Coley	CpG DNA	Immunomodulation
Pharmaceutical
Group

In some cases the subject is exposed to an allergen in addition to being treated with the immunostimulatory nucleic acid and the asthma/allergy medicament. In this case the subject is said to be exposed to the allergen. As used herein, the term “exposed to” refers to either the active step of contacting the subject with an allergen or the passive exposure of the subject to the allergen in vivo. Methods for the active exposure of a subject to an allergen are well-known in the art. In general, an allergen is administered directly to the subject by any means such as intravenous, intramuscular, oral, transdermal, mucosal, intranasal, intratracheal, or subcutaneous administration. The allergen can be-administered systemically or locally. Methods for administering the allergen and the immunostimulatory nucleic acid/asthma/allergy medicament are described in more detail below. A subject is passively exposed to an allergen if an allergen becomes available for exposure to the immune cells in the body. A subject may be passively exposed to an allergen, for instance, by entry of an allergen into the body when the allergen is present in the environment surrounding the subject, i.e. pollen. [0131]
The methods in which a subject is passively exposed to an allergen can be particularly dependent on timing of administration of the immunostimulatory nucleic acid and the asthma/allergy medicament. For instance, in a subject at risk of developing an allergic or asthmatic response, the subject may be administered the immunostimulatory-nucleic acid and the asthma/allergy medicament on a regular basis when that risk is greatest, i.e., during pollen allergy season. Additionally the immunostimulatory nucleic acid and the asthma/allergy medicament may be administered to travelers before they travel to a destination where they are at risk of exposure to a particular allergen. [0132]
As used herein, the term “prevent”, “prevented”, or “preventing” when used with respect to the treatment of an allergic or asthmatic disorder refers to a prophylactic treatment which increases the resistance of a subject to an allergen or initiator or, in other words, decreases the likelihood that the subject will develop an allergic or asthmatic response to the allergen or initiator as well as a treatment after the allergic or asthmatic disorder has begun in order to fight the allergy/asthma, e.g., reduce or eliminate it altogether or prevent it from becoming worse. [0133]
The term “substantially purified” as used herein refers to a molecular species which is substantially free of other proteins, lipids, carbohydrates or other materials with which it is naturally associated. One skilled in the art can purify allergenic polypeptides using standard techniques for protein purification. The substantially pure polypeptide will often yield a single major band on a non-reducing polyacrylamide gel. In the case of partially glycosylated polypeptides or those that have several start codons, there may be several bands on a non-reducing polyacrylamide gel, but these will form a distinctive pattern for that polypeptide. The purity of the allergenic polypeptide can also be determined by amino-terminal amino acid sequence analysis. [0134]
The allergen and/or polypeptide asthma/allergy medicament may be in the form of a polypeptide when administered to the subject or it may be encoded by a nucleic acid vector. If the nucleic acid vector is administered to the subject the protein is expressed in vivo. Minor modifications of the primary amino acid sequences of polypeptide allergens may also result in a polypeptide which has substantially equivalent allergenic activity as compared to the unmodified counterpart polypeptide. Such modifications may be deliberate, as by site-directed mutagenesis, or may be spontaneous. [0135]
The nucleic acid encoding the allergen or asthma/allergy medicament is operatively linked to a gene expression sequence which directs the expression of the protein within a eukaryotic cell. The “gene expression sequence” is any regulatory-nucleotide sequence, such as a promoter sequence or promoter-enhancer combination, which facilitates the efficient transcription and translation of the protein which it is operatively linked. The gene expression sequence may, for example, be a mammalian or viral promoter, such as a constitutive or inducible promoter. Constitutive mammalian promoters include, but are not limited to, the promoters for the following genes: hypoxanthine phosphoribosyl transferase-(HPTR), adenosine deaminase, pyruvate kinase, b-actin promoter and other constitutive promoters. Exemplary viral promoters which function constitutively in eukaryotic cells include, for example, promoters from the cytomegalovirus (CMV), simian virus (e.g., SY40), papilloma virus, adenovirus, human immunodeficiency virus (HIV), Rous sarcoma virus, cytomegalovirus, the long terminal repeats (LTR) of Moloney leukemia virus and other retroviruses, and the thymidine kinase promoter of herpes simplex virus. Other constitutive promoters are known to those of ordinary skill in the art. The promoters useful as gene expression sequences of the invention also include inducible promoters. Inducible promoters are expressed in the presence of an inducing agent. For example, the metallothionein promoter is induced to promote transcription and translation in the presence of certain metal ions. Other inducible promoters are known to those of ordinary skill in the art. [0136]
In general, the gene expression sequence shall include, as necessary, 5′ non-transcribing and 5′ non-translating sequences involved with the initiation of transcription and translation, respectively, such as a TATA box, capping sequence, CAAT sequence, and the like. Especially, such 5′ non-transcribing sequences will include a promoter region which includes a promoter sequence for transcriptional control of the operably joined antigen nucleic acid. The gene expression sequences optionally include enhancer sequences or upstream activator sequences as desired. [0137]
As used herein, the nucleic acid sequence encoding the protein and the gene expression sequence are said to be “operably linked” when they are covalently linked in such a way as to place the expression or transcription and/or translation of the antigen coding sequence under the influence or control of the gene expression sequence. Two DNA sequences are said to be operably linked if induction of a promoter in the 5′ gene expression sequence results in the transcription of the gene sequence and if the nature of the linkage between the two DNA sequences does not (1) result in the introduction of a frame-shift mutation, (2) interfere with the ability of the promoter region to direct the transcription of the antigen sequence, or (3) interfere with the ability of the corresponding RNA transcript to be translated into a protein. Thus, a gene expression sequence would be operably linked to a; specific nucleic acid sequence if the gene expression sequence were capable of effecting transcription of that nucleic acid sequence such that the resulting transcript is translated into the desired-protein or polypeptide. [0138]
The immunostimulatory nucleic acids may also be delivered to the subject in the form of a plasmid vector. In some embodiments, one plasmid vector could include both the immunostimulatory nucleic acid and a nucleic acid encoding a protein asthma/allergy medicament and/or an allergen. In other embodiments, separate plasmids could be used. In yet other embodiments, no plasmids could be used. [0139]
The compositions of the invention-may be delivered to the immune system or other target cells alone or in association with a vector. In its broadest sense, a “vector” is any vehicle capable of facilitating the transfer of the compositions to the target cells. The vector generally transports the nucleic acid to the immune cells with reduced degradation relative to the extent of degradation that would result in the absence of the vector. [0140]
In general, the vectors useful in the invention are divided into two classes: biological vectors and chemical/physical vectors. Biological vectors and chemical/physical vectors are useful for delivery/uptake of nucleic acids, asthma/allergy medicaments, and/or allergens to/by a target cell. [0141]
Biological vectors include, but are not limited to, plasmids, phagemids, viruses, other vehicles derived from viral or bacterial sources that have been manipulated by the insertion or incorporation of nucleic acid sequences, and free nucleic acid fragments which can be attached to nucleic acid sequences. Viral vectors are a preferred type of biological vector and include, but are not limited to, nucleic acid sequences from the following viruses: retroviruses, such as: Moloney murine leukemia-virus; Harvey murine sarcoma virus; murine mammary tumor virus; Rous sarcoma virus; adenovirus; adeno-associated virus; SV40-type viruses; polyoma viruses; Epstein-Barr viruses; papilloma viruses; herpes viruses; vaccinia viruses; polio viruses; and RNA viruses such as any retrovirus. One can readily employ other viral vectors not named but known in the art. [0142]
Preferred viral vectors are based on non-cytopathic eukaryotic viruses in which non-essential genes have been replaced with a nucleic acid of interest. Non-cytopathic viruses include retroviruses, the life cycle of which involves reverse transcription of genomic viral RNA into DNA with subsequent proviral integration into host cellular DNA. Retroviruses have been approved for human gene therapy trials. In general, the retroviruses are replication-deficient (i.e., capable of directing synthesis of the desired proteins, but incapable of manufacturing an infectious particle). Such genetically altered retroviral expression vectors have general utility for the high-efficiency transduction of genes in vivo. Standard protocols for producing replication-deficient retroviruses (including the steps of incorporation of exogenous genetic material into a plasmid, transfection of a packaging cell lined with plasmid, production of recombinant retroviruses by the packaging cell line, collection of viral particles from tissue culture media, and infection of the target cells with viral particles) are provided in Kriegler, M., “Gene Transfer and Expression, A Laboratory Manual,” W.H. Freeman Co., New-York (1990) and Murry, E. J. Ed. “Methods in Molecular Biology,” vol. 7, Humana Press, Inc., Cliffton, N.J. (1991). [0143]
Another preferred virus for certain applications is the adeno-associated virus, a double-stranded DNA virus. The adeno-associated virus can be engineered to be replication-deficient and is capable of infecting a wide range of cell types and species. It further has advantages, such as heat and lipid solvent stability; high transduction frequencies in cells of diverse lineages; and lack of superinfection inhibition thus allowing multiple series of transductions. Reportedly, the adeno-associated virus can integrate into human insertional mutagenesis and variability of inserted gene expression. In addition, wild-type adeno-associated virus infections have been followed in tissue culture for greater than 100 passages in the absence of selective pressure, implying that the adeno-associated virus genomic integration is a relatively stable event. The adeno-associated virus can also function in an extrachromosomal fashion. [0144]
Other biological vectors include plasmid vectors. Plasmid vectors have been extensively described in the art and are well-known to those of skill in the art. See e.g., Sambrook et al., “Molecular Cloning: A Laboratory Manual,” Second Edition, Cold Spring Harbor Laboratory Press, 1989. In the last few years, plasmid vectors have been found to be particularly advantageous for delivering genes to cells in vivo because of their inability to replicate within and integrate into a host genome. These plasmids, however, having a promoter compatible with the host cell, can express a peptide from a gene operatively encoded within the plasmid. Some commonly used plasmids include pBR322, pUC18, pUC19, pRC/CMV, SV40, and pBlueScript. Other plasmids are well-known to those of ordinary skill in the art. Additionally, plasmids may be custom designed using restriction enzymes and ligation reactions to remove and add specific fragments of DNA. [0145]
It has recently been discovered that gene carrying plasmids can be delivered to the immune system using bacteria. Modified forms of bacteria such as [0146] Salmonella can be transfected with the plasmid and used as delivery vehicles. The bacterial delivery vehicles can be administered to a host subject orally or by other administration means. The bacteria deliver the plasmid to immune cells, e.g. B cells, dendritic cells, likely by passing through the gut barrier. High levels of immune protection have been established using this methodology. Such methods of delivery are useful for the aspects of the invention utilizing systemic delivery of allergen, immunostimulatory nucleic acid and/or other therapeutic agent.
In addition to the biological vectors, chemical/physical vectors may be used to deliver a nucleic acid, asthma/allergy medicament, and/or allergen to a target cell and facilitate uptake thereby. As used herein, a “chemical/physical vector” refers to a natural or synthetic molecule, other than those derived from bacteriological or viral sources, capable of delivering the nucleic acid, asthma/allergy medicament, and/or allergen to a cell. [0147]
A preferred chemical/physical vector of the invention is a colloidal dispersion system. Colloidal dispersion systems include lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, and liposomes. A preferred colloidal system of the, invention is a liposome. Liposomes are artificial membrane vessels which are useful as a delivery vector in vivo or in vitro. It has been shown that large unilamellar vessels (LUV), which range in size from 0.2-4.0 μm can encapsulate large macromolecules. RNA, DNA, and intact virions can be encapsulated within the aqueous interior and be delivered to cells in a biologically active form (Fraley, et al., [0148] Trends Biochem. Sci., (1981) 6:77).
Liposomes may be targeted to a particular tissue by coupling the liposome to a specific ligand such as a monoclonal antibody, sugar, glycolipid, or protein. Ligands which may be useful for targeting a liposome to an immune cell include, but are not limited to: intact or fragments of molecules which interact with immune cell specific receptors and molecules, such as antibodies, which interact with the cell surface markers of immune cells. Such ligands may easily be identified by binding assays well known to those of skill in the art. Additionally, the vector may be coupled to a nuclear targeting peptide, which will direct the vector to the nucleus of the host cell. [0149]
Lipid formulations for transfection are commercially available from QIAGEN, for example, as EFFECTENE™ (a non-liposomal lipid with a special DNA condensing enhancer) and SUPERFECT™ (a novel acting dendrimeric technology). [0150]
Liposomes are commercially available from Gibco BRL, for example, as LIPOFECTIN™ and LIPOFECTACE™, which are formed of cationic lipids such as N-[1-(2, 3 dioleyloxy)-propyl]-N,N, N-trimethylammonium chloride (DOTMA) and dimethyl dioctadecylammonium bromide (DDAB). Methods for making liposomes are well known in the art and have been described in many publications. Liposomes also have been reviewed by Gregoriadis, G. in [0151] Trends in Biotechnology, (1985) 3:235-241.
In one embodiment, the vehicle is a biocompatible microparticle or implant that is suitable for implantation or administration to the mammalian recipient. Exemplary bioerodible implants that are useful in accordance with this method are described in PCT International application no. PCT/US/03307 (Publication No. WO95/24929, entitled “Polymeric Gene Delivery System”. PCT/US/0307 describes a biocompatible, preferably biodegradable polymeric matrix for containing an exogenous gene under the control of an appropriate promoter. The polymeric matrix can be used to achieve sustained release of the exogenous gene in the patient. [0152]
The polymeric matrix preferably is in the form of a microparticle-such as a microsphere (wherein the a nucleic acid, asthma/allergy medicament, and/or allergen is dispersed throughout a solid polymeric matrix) or a microcapsule (wherein the a nucleic acid, asthma/allergy medicament, and/or allergen is stored in the core of a polymeric shell). Other forms of the polymeric matrix for containing the a nucleic acid, asthma/allergy medicament, and/or allergen include films, coatings, gels, implants, and stents. The size and composition of the polymeric matrix device is selected to result in favorable release kinetics in the tissue into which the matrix is introduced. The size of the polymeric matrix further is selected according to the method of delivery which is to be used, typically injection into a tissue or administration of a suspension by aerosol into the nasal and/or pulmonary areas. Preferably when an aerosol route is used the polymeric matrix and the nucleic acid, asthma/allergy medicament, and/or allergen are encompassed in a surfactant vehicle. The polymeric matrix composition can be selected to have both favorable degradation rates and also to be formed of a material which is bioadhesive, to further increase the effectiveness of transfer when the matrix is administered to a nasal and/or pulmonary surface that has sustained an injury. The matrix composition also can be selected not to degrade, but rather, to release by diffusion over an extended period of time. [0153]
In another embodiment the chemical/physical vector is a biocompatible microsphere that is suitable for delivery, such as oral or mucosal delivery. Such microspheres are disclosed in Chickering et al., [0154] Biotech. And Bioeng., (1996) 52:96-101 and Mathiowitz et al., Nature, (1997) 386:410-414 and PCT Patent Application WO97/03702.
Both non-biodegradable and biodegradable polymeric matrices can be-used to deliver the nucleic acid, asthma/allergy medicament, and/or allergen to the subject. Biodegradable matrices are preferred. Such polymers may be natural or synthetic polymers. The polymer is selected based on the period of time over which release is desired, generally in the order of a few hours to a year or longer. Typically, release over a period ranging from between a few hours and three to twelve months is most desirable. The polymer optionally is in the form of a hydrogel that can absorb up to about 90% of its weight in water and further, optionally is cross-linked with multi-valent ions or other polymers. [0155]
Bioadhesive polymers of particular interest include bioerodible hydrogels described by H. S. Sawhney, C. P. Pathak and J. A. Hubell in [0156] Macromolecules, (1993) 26:581-587, the teachings of which are incorporated herein, polyhyaluronic acids, casein, gelatin, glutin, polyanhydrides, polyacrylic acid, alginate, chitosan, poly(methyl methacrylates), poly(ethyl methacrylates), poly(butylmethacrylate), poly(isobutyl methacrylate), poly(hexylmethacrylate), poly(isodecyl methacrylate), poly(lauryl methacrylate), poly(phenyl methacrylate), poly(methyl acrylate), poly(isopropyl acrylate), poly(isobutyl acrylate), and poly(octadecyl acrylate).
Compaction agents also can be used alone, or in combination with, a biological or chemical/physical vector. A “compaction agent”, as used herein, refers to an agent, such as a histone, that neutralizes the negative charges on the nucleic acid and thereby permits compaction of the nucleic acid into a fine granule. Compaction of the nucleic acid facilitates the uptake of the nucleic acid by the target cell. The compaction agents can be used alone, i.e., to deliver a nucleic acid in a form that is more efficiently taken up by the cell or, more preferably, in combination with one or more of the above-described vectors. [0157]
Other exemplary compositions that can be used to facilitate uptake by a target cell of the nucleic acid, asthma/allergy medicament, and/or allergen include calcium phosphate and other chemical mediators of intracellular transport, microinjection compositions, electroporation and homologous recombination compositions (e.g., for integrating a nucleic acid into a preselected location within the target cell chromosome). [0158]
The immunostimulatory nucleic acid and/or the asthma/allergy medicament the antigen and/or other therapeutics may be administered alone (e.g. in saline or buffer) or using any delivery vectors known in the art. For instance the following delivery vehicles have been described: Cochleates (Gould-Fogerite et al., 1994, 1996); Emulsomes (Vancott et al., 1998, Lowell et al., 1997); ISCOMs (Mowat et al., 1993, Carlsson et al., 1991, Hu et., 1998, Morein et al., 1999); Liposomes (Childers et al., 1999, Michalek et al., 1989, 1992, de-Haan 1995a, 1995b); Live bacterial vectors (e.g., [0159] Salmonella, Escherichia coli, Bacillus calmatte-guerin, Shigella, Lactobacillus) (Hone et al., 1996, Pouwels et al., 1998, Chatfield et al., 1993, Stover et al., 1991, Nugent et al., 1998); Live viral vectors (e.g., Vaccinia, adenovirus, Herpes Simplex) (Gallichan et al., 1993, 1995, Moss et al., 1996, Nugent et al., 1998, Flexner et al., 1988, Morrow et al., 1999), Microspheres (Gupta et al., 1998, Jones et al., 1996, Maloy et al., 1994, Moore et al., 1995, O'Hagan et al., 1994, Eldridge et al., A989); Nucleic acid vaccines (Fynan et al., 1993, Kuklin et al., 1997, Sasaki et al., 1998, Okada et al., 1997, Ishii et al., 1997); Polymers (e.g. carboxymethylcellulose, chitosan) (Hamajima et al., 1998, Jabbal-Gill et al., 1998); Polymer rings (Wyatt et al., 1998); Proteosomes (Vancott et al., 1998, Lowell et al., 1988, 1996, 1997); Sodium Fluoride (Hashi et al., 1998); Transgenic plants (Tacket et al., 1998, Mason et al., 1998, Haq et al., 1995); Virosomes (Gluck et al., 1992, Mengiardi et al., 1995, Cryz et al., 1998); Virus-like particles (Jiang et al., 1999, Leibi et al., 1998).
The immunostimulatory nucleic acid and asthma/allergy medicament can be combined with other therapeutic agents such as adjuvants to enhance immune responses even further. The immunostimulatory nucleic acid, asthma/allergy medicament and other therapeutic agent may be administered simultaneously or sequentially. When the other therapeutic agents are administered simultaneously they can be administered in the same or separate formulations, but are administered at the same time. The other therapeutic agents are administered sequentially with one another and with the immunostimulatory nucleic acid and asthma/allergy medicament, when the administration of the other therapeutic agents and the immunostimulatory-nucleic acid and asthma/allergy medicament is temporally separated. The separation in time between the administration of these compounds may be a matter of minutes or it may be longer. Other therapeutic agents include but are not limited to non-nucleic acid adjuvants, cytokines, antibodies, antigens, etc. [0160]
A “non-nucleic acid adjuvant” is any molecule or compound except for the immunostimulatory nucleic acids described herein which can stimulate the humoral and/or cellular immune response. Non-nucleic acid adjuvants include, for instance, adjuvants that create a depo effect, immune stimulating adjuvants, adjuvants that create a depo effect and stimulate the immune system and mucosal adjuvants. [0161]
An “adjuvant that creates a depo effect” as used herein is an adjuvant that causes an antigen or allergen to be slowly released in the body, thus prolonging the exposure of immune cells to the antigen or allergen. This Class of adjuvants includes but is not limited to alum (e.g., aluminum hydroxide, aluminum phosphate); or emulsion-based formulations including mineral oil, non-mineral oil, water-in-oil or oil-in-water-in oil emulsion, oil-in-water emulsions such as Seppic ISA series of Montanide adjuvants (e.g., Montanide ISA 720, AirLiquide, Paris, France); MF-59 (a squalene-in-water emulsion stabilized with Span 85 and Tween 80; Chiron Corporation, Emeryville, Calif.; and PROVAX (an oil-in-water emulsion containing a stabilizing detergent and a micelle-forming agent; IDEC, Pharmaceuticals Corporation, San Diego, Calif.). [0162]
An “immune stimulating adjuvant” is an adjuvant that causes activation of a cell of the immune system. It may, for instance, cause an immune cell to produce and secrete cytokines. This class of adjuvants includes but is not limited to saponins purified from the bark of the [0163] Q. saponaria tree, such as QS21 (a glycolipid that elutes in the 21^stpeak with HPLC fractionation; Aquila Biopharmaceuticals, Inc., Worcester, Mass.); poly[di(carboxylatophenoxy)phosphazene (PCPP polymer; Virus Research Institute, USA); derivatives of lipopolysaccharides such as monophosphoryl lipid A (MPL; Ribi ImmunoChem Research, Inc., Hamilton, Mont.), muramyl dipeptide (MDP; Ribi) andthreonyl-muramyl dipeptide (t-MDP; Ribi); OM-174 (a glucosamine disaccharide related to lipid A; OM Pharma SA, Meyrin, Switzerland); and Leishmania elongation factor (a purified Leishmania protein; Corixa Corporation, Seattle, Wash.).
“Adjuvants that create a depo effect and stimulate the immune system” are those compounds which have both of the above-identified functions. This class of adjuvants includes but is not limited to ISCOMS (Immunostimulating complexes which contain mixed saponins, lipids and form virus-sized particles with pores that can hold antigen; CSL, Melbourne, Australia); SB-AS2 (SmithKline Beecham adjuvant system #2 which is an oil-in-water emulsion containing MPL and QS21: SmithKline Beecham Biologicals [SBB], Rixensart, Belgium); SB-AS4 (SmithKline Beecham adjuvant system #4 which contains alum and MPL; SBB, Belgium); non-ionic block copolymers that form micelles such as CRL 1005 (these contain a linear chain of hydrophobic polyoxpropylene flanked by chains of polyoxyethylene; Vaxcel, Inc., Norcross, Ga.); and Syntex Adjuvant Formulation (SAF, an oil-in-water emulsion containing Tween 80 and a nonionic block copolymer; Syntex Chemicals, Inc., Boulder, Colo.). [0164]
A “non-nucleic acid mucosal adjuvant” as used herein is an adjuvant-other than an immunostimulatory nucleic acid that is capable of inducing a mucosal immune response in a subject when administered to a mucosal surface in conjunction with an antigen or allergen. Mucosal adjuvants include but are not limited to Bacterial toxins: e.g., Cholera toxin (CT), CT derivatives including but not limited to CT B subunit (CTB) (Wu et al., 1998, Tochikubo et al., 1998); CTD53 (Val to Asp) (Fontana et al., 1995); CTK97 (Val to Lys) (Fontana et al., 1995); CTK104 (Tyr to Lys) (Fontana et al., 1995); CTD53/K63 (Val to Asp, Ser to Lys) (Fontana et al., 1995); CTH54 (Arg to His) (Fontana et al., 1995); CTN[0165] ₁O₇(His to Asn) (Fontana et al., 1995); CTE1 14 (Ser to Glu) (Fontana et al., 1995); CTE1 12K (Glu to Lys) (Yamamoto et al., 1997a); CTS61F (Ser to Phe) (Yamamoto et al., 1997a, 1997b); CTS106 (Pro to Lys) (Douce et al., 1997, Fontana et al. 1995); and CTK63 (Ser to Lys) (Douce et al., 1997, Fontana et al., 1995), Zonula occludens toxin, zot, Escherichia coli heat-labile enterotoxin, Labile Toxin (LT), LT derivatives including but not limited to LT B subunit (LTB) (Verweij et al., 1998); LT7K (Arg to Lys) (Komase et al., 1998, Douce et al., 1995); LT61F (Ser to Phe) (Komase et al., 1998); LT1 12K (Glu to Lys) (Komase et al., 1998); LT118E (Gly to Glu) (Komase et al., 1998); LT146E (Arg to Glu) (Komase et al., 1998); LT192G (Arg to Gly) (Komase et al., 1998); LTK63 (Ser to Lys) (Marchetti et al., 1998, Douce et al., 1997, 1998, Di Tommaso et al., 1996); and LTR72 (Ala to Arg) (Giuliani et al., 1998), Pertussis toxin, PT. (Lycke et al., 1992, Spangler B D, 1992, Freytag and Clemments, 1999, Roberts et al., 1995, Wilson et al., 1995) including PT-9K/129G (Roberts et al., 1995, Cropley et al., 1995); Toxin derivatives (see below) (Holmgren et al., 1993, Verweij et al., 1998, Rappuoli et al., 1995, Freytag and Clements, 1999); Lipid A derivatives (e.g., monophosphoryl lipid A, MPL) (Sasaki et al. 1998, Vancott et al., 1998; Muramyl Dipeptide (MDP) derivatives (Fukushima et al., 1996, Ogawa et al., 1989, Michalek et al., 1983, Morisaki et al., 1983); Bacterial outer membrane proteins (e.g., outer surface protein A (OspA) lipoprotein of Borrelia burgdorferi, outer membrane protine of Neisseria meningitidis)(Marinaro et al., 1999, Van de Verg et al., 1996); Oil-in-water emulsions (e.g., MF59) (Barchfield et al., 1999, Verschoor et al., 1999, O'Hagan, 1998); Aluminum salts (Isaka et al., 1998, 1999); and Saponins (e.g., QS21) Aquila Biopharmaceuticals, Inc., Worster, Mass.) (Sasaki et al., 1998, MacNeal-et al., 1998), ISCOMS, MF-59 (a squalene-in-water emulsion stabilized with Span 85 and Tween 80; Chiron Corporation, Emeryville, Calif.); the Seppic ISA series of Montanide adjuvants (e.g., Montanide ISA 720; AirLiquide, Paris, France); PROVAX (an oil-in-water emulsion containing a stabilizing detergent and a micell-forming agent; IDEC Pharmaceuticals Corporation, San Diego, Calif.); Syntext Adjuvant Formulation (SAF; Syntex Chemicals, Inc., Boulder, Colo.); poly[di(carboxylatophenoxy)phosphazene (PCPP polymer; Virus Research Institute, USA) and Leishmania elongation factor (Corixa Corporation, Seattle, Wash.).
Immune responses can also be induced or augmented by the co-administration or co-linear expression of cytokines (Bueler & Mulligan, 1996; Chow et al., 1997; Geissler et. al., 1997; Iwasaki et al., 1997; Kim et al., 1997) or B-7 co-stimulatory molecules (Iwasaki et al., 1997; Tsuji et al., 1997) with the immunostimulatory nucleic acids and asthma/allergy medicaments. The cytokines can be administered directly with immunostimulatory nucleic acids or may be administered in the form of a nucleic acid vector that encodes the cytokine, such that the cytokine can be expressed in vivo. In one embodiment, the cytokine is administered in the form of a plasmid expression vector. The term “cytokine” is used as a generic name for a diverse group of soluble proteins and peptides which act as humoral regulators at nano- to picomolar concentrations and which, either under normal- or pathological conditions, modulate the functional activities of individual cells and tissues. These proteins also mediate interactions between cells directly and regulate processes taking place in the extracellular environment. Examples of cytokines include, but are not limited to IL-1, IL-2, IL-4, IL-5, IL-6, IL-7, IL-10, IL-12, IL-15, IL-18-granulocyte-macrophage colony stimulating factor (GM-CSF); granulocyte colony stimulating factor (GCSF), interferon-γ (γ-IFN), IFN-a, tumor necrosis factor (TNF), TGF-β, FLT-3 ligand, and CD40 ligand. Cytokines play a role in directing the T cell response. Helper (CD4+) T cells orchestrate the immune response of mammals through production of soluble factors that-act on other immune system cells, including other T cells. Most mature CD4+ T helper cells express one of two cytokine profiles: Th1 or Th2. In some embodiments it is preferred that the cytokine be a Th1 cytokine. [0166]
The term “effective amount” of an immunostimulatory nucleic acid and an asthma/allergy medicament refers to the amount necessary or sufficient to realize a desired biologic effect. For example, an effective amount of an immunostimulatory nucleic acid and an asthma/allergy medicament for treating or preventing asthma or preventing is that amount necessary, to prevent the development of IgE in response to an allergen or initiator upon exposure to the allergen or initiator is that amount necessary to cause the shift from Th2 to Th1 response in response to an allergen or initiator. [0167]
Combined with the teachings provided herein, by choosing among the various active compounds and weighing factors such as potency, relative bioavailability, patient body weight, severity of adverse side-effects and preferred mode of administration, an effective prophylactic or therapeutic treatment regimen can be planned which does not cause substantial toxicity and yet is entirely effective to treat the particular subject. The effective amount for any particular application can vary depending on such factors as the disease or condition being treated, the particular immunostimulatory nucleic acid or asthma/allergy medicament being administered (e.g. the type of nucleic acid, i.e. a CpG nucleic acid, the number of unmethylated CpG motifs or their location in the nucleic acid, the degree of modification of the backbone to the oligonucleotide the type of medicament), the size of the subject, or the severity of the disease or condition. One of ordinary skill in the art can empirically determine the effective amount of a particular-immunostimulatory nucleic acid and/or asthma/allergy medicament and/or other therapeutic agent without necessitating undue experimentation. [0168]
Depending upon the aspect of the invention, the immunostimulatory nucleic acid and asthma/allergy medicament may be administered in a: synergistic amount effective to treat or prevent asthma or allergy. A synergistic amount is that amount which produces a physiological response that is greater than the sum of the individual effects of either the immunostimulatory nucleic acid or the asthma/allergy medicament alone. For instance, in some embodiments of the invention, the physiological effect is a reduction in IgE levels. A synergistic amount is that amount which produces a reduction in IgE that is greater than the sum of the IgE reduced by either the immunostimulatory nucleic acid or the asthma/allergy medicament alone. In other embodiments, the physiological result is a shift from Th2 cytokines, such as IL-4 and Il-5, to Th1 cytokines, such as IFN-γ and IL-12. The synergistic amount in this case is that-amount which produces the shift to a Th1 cytokine that is greater than the sum of the shift produced by either the immunostimulatory nucleic acid or the asthma/allergy medicament alone. In other embodiments the physiological result is a decrease in eosinophilia, hyperreactivity, or lung function. [0169]
In some embodiments of the invention, the immunostimulatory nucleic acid is administered in an effective amount for preventing bacterial or viral infection. Immunostimulatory nucleic acids are known to be useful for preventing bacterial and viral infections. Bacterial and viral infections exacerbate and/or induce allergy and/or asthma. In this aspect of the invention, the immunostimulatory nucleic acid is administered to the subject in an amount effective to prevent bacterial and viral infection and the asthma/allergy medicament is administered to the subject when symptoms of allergy or asthma appear. Thus, the immunostimulatory nucleic acid is administered to the subject and then the asthma/allergy medicament is subsequently administered to the subject or they are administered together at the same time. This method is particularly useful in subjects such as children and immunocompromised subjects, or elderly subjects, who are particularly susceptible to bacterial or viral disease. [0170]
In aspects of the invention directed at treating subjects in anticipation of an asthmatic or allergic event or season (e.g., in anticipation of the hay-fever season), the subjects may be administered an immunostimulatory nucleic acid in an effective amount for preventing the asthma or allergy. In related embodiments of this method, an asthma/allergy medicament is also administered to the subject. In these latter instances, the amount of the immunostimulatory nucleic acid administered may be that amount necessary to reduce the effective dose of the asthma/allergy medicament which is required to treat or prevent the asthma or allergy. [0171]
Thus, in these embodiments, the immunostimulatory nucleic acid potentiates the effect of the asthma/allergy medicament. The ability to potentiate the effect of an asthma/allergy medicament is useful since it allows for a reduction in the administered dose of an asthma/allergy medicament with the same or better therapeutic result. As an example, if the dose of the medicament is lowered, then so too are the side-effects of the medicament such as, for example, drowsiness, nervousness, dizziness or, in some instances, sleeplessness. Similarly, the administration of a lowered dose of the asthma/allergy medicament may make the medicament more compatible with the administration of other medicaments such as those which are currently not simultaneously prescribed or administered with asthma or allergy medicaments. In some instances, these include certain medicaments which are prescribed for depression, psychiatric or emotional conditions or Parkinson's disease and which contain monoamine oxidase inhibitor (MAOI). Similarly, the ability to potentiate the effect of the asthma/allergy medicament, thereby leading to a decreased effective dose, is useful for treating a wide range of subjects who have previously been contraindicated for such treatment, including subjects with heart disease or diabetes, subjects who have difficulty in urinating due to prostate gland enlargement, and subjects who are pregnant or who are nursing (i.e., breast-feeding). Thus, the invention provides a method for administering to a subject a dose of an asthma/allergy medicament which if administered alone, or if administered without previous administration of an immunostimulatory nucleic acid to the same subject, would be ineffective (and would be considered sub-therapeutic). [0172]
Subject doses of the compounds described herein typically range from about 0.1 μg to 10,000 mg, more typically from about 1 μg/day to 8000 mg, and most typically from about 10 μg to 100 μg. Stated in terms of subject body weight, typical dosages range from about 0.1 μg to 20 mg/kg/day, more typically from about 1 to 0.10 mg/kg/day, and most typically from about 1 to 5 mg/kg/day. [0173]
In some instances, a sub-therapeutic dosage of the immunostimulatory nucleic acid and the asthma/allergy medicament are used. It has been discovered according to the invention, that when the two classes of drugs are used together, they can be administered in sub-therapeutic doses and still produce a desirable therapeutic-result, a “sub-therapeutic dose” as used herein refers to a dosage which is less than that dosage which would produce a therapeutic result in the subject, if administered alone. Thus, the sub-therapeutic dose of an asthma/allergy medicament is one which would not produce the desired therapeutic result in the subject. Therapeutic doses of asthma/allergy medicaments are well known in the field of medicine for the treatment of asthma and allergy. These dosages have been extensively described in references such as Remington's Pharmaceutical Sciences, 18th ed., 1990; as well as many other medical references relied upon by the medical profession as guidance for the treatment of asthma and allergy. Therapeutic dosages of immunostimulatory nucleic acids, have also been described in the art and methods for identifying therapeutic dosages in subjects are described in more detail above. [0174]
In other aspects, the method of the invention involves administering a high dose of an asthma/allergy medicament to a subject, without inducing side effects. Ordinarily, when an asthma/allergy medicament is administered in a high dose, a variety of side effects can occur. (Discussed in more detail above, as well as in the medical literature). As a result of these side effects, the asthma/allergy medicament is not administered in such high doses, no matter what therapeutic benefits are derived. It was discovered, according to the invention, that such high doses of asthma/allergy medicaments which ordinarily induce side effects can be administered without inducing the side effects as long as the subject also receives an immunostimulatory nucleic acid. The type and extent of the side effects ordinarily induced by the asthma/allergy medicament will depend on the particular asthma/allergy medicament used. [0175]
In other embodiments of the invention, the immunostimulatory nucleic acid is administered on a routine schedule. The asthma/allergy medicament may also be administered on a routine schedule, but alternatively, may be administered as symptoms arise. A “routine schedule” as used herein, refers to a predetermined designated period of time. The routine schedule may encompass periods of time which are identical or which differ in length, as long as the schedule is predetermined. For instance, the routine schedule may involve administration of the immunostimulatory nucleic acid on a daily basis, every two days, every three days, every four days, every five days, every six days, a weekly basis, a bi-weekly basis, a monthly basis, a bimonthly basis or any set number of days or weeks there-between, every two months, three months, four months, five months, six months, seven months, eight months, nine months, ten months, eleven months, twelve months, etc. Alternatively, the predetermined routine schedule may involve administration of the immunostimulatory nucleic acid on a daily basis for the first week, followed by a monthly basis for several months, and then every three months after that. Any particular combination would be covered by the routine schedule as long as it is determined ahead of time that the appropriate schedule involves administration on a certain day. [0176]
In some aspects of the invention, the immunostimulatory nucleic acid is administered to the subject in anticipation of an asthmatic or allergic event in order to prevent an asthmatic or allergic event. The asthmatic or allergic event may be, but need not be limited to, an asthma attack, seasonal allergic rhinitis (e.g., hay-fever, pollen, ragweed hypersensitivity) or perennial allergic rhinitis (e.g., hypersensitivity to allergens such as those described herein)., In some instances, the immunostimulatory nucleic acid is administered substantially prior to, an asthmatic or an allergic event. As used herein, “substantially prior” means at least six months, at least five months, at least four months, at least three months, at least two months, at least one month, at least three weeks, at least two weeks, at least one week, at least 5 days, or at least 2 days prior to the asthmatic or allergic event. [0177]
Similarly, the asthma/allergy medicament may be administered immediately-prior to the asthmatic or allergic event (e.g., within 48 hours, within 24 hours, within 12 hours, within 6 hours, within 4 hours, within 3 hours, within 2 hours, within 1 hour, within 30 minutes or within 10 minutes of an asthmatic or allergic event), substantially simultaneously with the asthmatic or allergic event (e.g., during the time the subject is in contact with the allergen or is experiencing the asthma or allergy symptoms) or following the asthmatic or allergic event. [0178]
In some embodiments, the immunostimulatory nucleic acid and the asthma/allergy medicament are both administered to a subject. The timing of administration of both may vary. In some embodiments, it is preferred that the asthma/allergy medicament be administered subsequent to the administration of the immunostimulatory nucleic acid. In some embodiments, the immunostimulatory nucleic acid is administered to the subject prior to as well as either substantially simultaneously with or following the administration of the asthma/allergy medicament. The administration of the immunostimulatory nucleic acid and the asthma/allergy medicament may also be mutually exclusive of each other so that at any given time during the treatment period, only one of these agents is active in the subject. Alternatively, and preferably in some instances, the administration of the two agents overlaps such that both agents are active in the subject at the same time. [0179]
In some embodiments, the immunostimulatory nucleic acid is administered on a weekly or biweekly basis and the asthma/allergy medicament is administered more frequently (e.g., on a daily basis). However, if the dose of immunostimulatory nucleic acid is reduced sufficiently, it is possible that the immunostimulatory nucleic acid is administered as frequently as the asthma/allergy medicament, albeit at a reduced dose. [0180]
In other aspects, the invention relates to kits that are useful in the treatment of asthma and/or allergy. One kit of the invention includes a sustained release vehicle containing an immunostimulatory nucleic acid and a container housing an asthma/allergy medicament and instructions for timing of administration of the immunostimulatory nucleic acid in the asthma/allergy medicament. A sustained release vehicle is used herein in accordance with its prior art meaning of any device which slowly releases the immunostimulatory nucleic acid. [0181]
Such systems can avoid repeated administrations of the compounds, increasing convenience to the subject and the physician. Many types of release delivery systems are available and known to those of ordinary skill in the art. They include polymer base systems such as poly(lactide-glycolide), copolyoxalates, polycaprolactones, polyesteramides, polyorthoesters, polyhydroxybutyric acid, and polyanhydrides. Microcapsules of the foregoing polymers containing drugs are described in, for example, U.S. Pat. No. 5,075,109. Delivery systems also include non-polymer systems that are: lipids including sterols such as cholesterol, cholesterol esters and fatty acids or neutral fats such as mono-di- and tri-glycerides; hydrogel release systems; sylastic systems; peptide based systems; wax coatings; compressed tablets using conventional binders and excipients; partially fused implants; and the like. Specific examples include, but are not limited to: (a) erosional systems in which an agent of the invention is contained in a form within a matrix such as those described in U.S. U.S. Pat. Nos. 4,452,775, 4,675,189, and 5,736,152, and (b) diffusional systems in which an active component permeates at a controlled rate from a polymer such as described in U.S. Pat. Nos. 3,854,480, 5,133,974 and 5,407,686. In addition, pump-based hardware delivery systems can be used, some of which are adapted for implantation. [0182]
The asthma/allergy medicament is housed in at least one container. The container may be a single container housing all of the asthma/allergy medicament together or it may be multiple containers or chambers housing individual dosages of the asthma/allergy medicament, such as a blister pack. The kit also has instructions for timing of administration of the asthma/allergy medicament. The instructions would direct the subject having asthma/allergy or at risk of asthma/allergy to take the asthma/allergy medicament at the appropriate time. For instance, the appropriate time for delivery of the medicament may be as the symptoms occur. Alternatively, the appropriate time for administration of the medicament may be on a routine schedule such as monthly or yearly. [0183]
Another kit of the invention includes at least one container housing an immunostimulatory nucleic acid and at least one container housing an asthma/allergy medicament and instructions for administering the compositions ineffective amounts for inducing a synergistic immune response in the subject. The immunostimulatory nucleic acid and asthma/allergy medicament may be housed in single containers or in separate compartments or containers, such as single dose compartments. The instructions in the kit direct the subject to take the immunostimulatory nucleic acid and the asthma/allergy medicament in amounts which will produce a synergistic immune response. The drugs may be administered simultaneously or separately as long as they are administered close enough in time to produce a synergistic response. [0184]
In other aspects of the invention, a composition is provided. The composition-includes an immunostimulatory nucleic and an asthma/allergy medicament formulated in a pharmaceutically-acceptable carrier and present in the composition in an effective amount for preventing or treating an immune or inflammatory response associated with exposure to a mediator of asthma or allergy. The effective amount for preventing or treating an immune or inflammatory response is that amount which prevents, inhibits completely or partially the induction of the immune or inflammatory response or prevents an increase in the immune or inflammatory response associated with asthma or allergy. An immune or inflammatory response associated with asthma or allergy includes an induction in IgE, an increase in Th2 cytokines, etc. A mediator of asthma or allergy includes asthma initiators and allergens. An example of a composition is one which comprises an immunostimulatory nucleic acid, such as a CpG nucleic acid, and an asthma/allergy medicament, such as an anti-IgE agent (e.g., an anti-IgE antibody or antibody fragment). Such a composition can be administered to a subject on a routine basis such as monthly, bimonthly, or quarterly. [0185]
For any compound described herein a therapeutically effective amount can be initially determined from cell culture assays. For instance the effective amount of immunostimulatory nucleic acid useful for inducing B cell activation can be-assessed using the in vitro assays with respect to stimulation index in comparison to known immunostimulatory acids. The stimulation index can be used to determine an effective amount of the particular oligonucleotide for the particular subject, and the dosage can be adjusted upwards or downwards to achieve the desired levels in the subject. Therapeutically effective amounts can also be determined from animal models. A therapeutically effective dose can also be determined from human data for immunostimulatory nucleic acids which have been tested in humans (human clinical trials have been initiated) and for compounds which are known to exhibit similar pharmacological activities, such as other adjuvants, e.g., LT and other antigens for vaccination purposes. The applied dose can be adjusted based on the relative bioavailability and potency of the administered compound. Adjusting the dose to achieve maximal efficacy based on the methods described above and other methods as are well-known in the art is well within the capabilities of the ordinarily skilled artisan. Most of the asthma/allergy medicaments have been identified. These amounts can be adjusted when they are combined with immuno-stimulatory nucleic acids by routine experimentation. [0186]
The formulations of the invention are administered in pharmaceutically acceptable solutions, which may routinely contain pharmaceutically acceptable concentrations of salt, buffering agents, preservatives, compatible carriers, adjuvants, and optionally other therapeutic ingredients. [0187]
Asthma/allergy medicaments and immunostimulatory nucleic acids can be administered by any ordinary route for administering medications. Preferably, they are inhaled, ingested or administered by local routes (such as nasal drops) or by systemic routes. Systemic routes include oral and parenteral. Inhaled medications are preferred in some embodiments because of the direct delivery to the lung, the site of inflammation, primarily in asthmatic patients. Several types of metered dose inhalers are regularly used for administration by inhalation. These types of devices include metered dose inhalers (MDI), breath-actuated MDI, dry powder inhaler (DPI), spacer/holding chambers in combination with MDI, and nebulizers. As used herein, delivery to the nasal passages or the lungs via nasal drops or inhalation are referred to as local administration. Although it is possible that delivery to the lung (e.g., via inhalation) can eventually result in systemic delivery of the agent, the administration is still considered “local” in the sense that the majority of the agent is initially presented to the lung tissue or the nasal passages, prior to any secondary systemic effects. In some preferred embodiments, the immunostimulatory nucleic acid is administered locally, such as for example by nasal drops or inhalation. [0188]
For use in therapy, an effective amount of the immunostimulatory nucleic acid can be administered to a subject by any mode that delivers the nucleic acid to the desired surface, e.g., mucosal, systemic. “Administering” the pharmaceutical composition of the present invention may be accomplished by any means known to the skilled artisan. Preferred routes of administration include but are not limited to oral, parenteral, intramuscular, intranasal, intratracheal, inhalation, ocular, vaginal, and rectal. [0189]
For oral administration, the compounds (i.e., immunostimulatory nucleic acids, asthma/allergy medicament, other therapeutic agent) can be formulated readily by combining the active compound(s) with pharmaceutically acceptable carriers well known in the art. Such carriers enable the compounds of the invention to be formulated as-tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions and the like, for oral ingestion by a subject to be treated. Pharmaceutical preparations for oral use can be obtained as solid excipient, optionally grinding a resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries, if desired, to obtain tablets or dragee cores. Suitable excipients are, in particular, fillers such as sugars, including, lactose, sucrose, mannitol, or sorbitol; cellulose preparations such as, for example, maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose, hydroxypropylmethyl-cellulose, sodium carboxymethylcellulose, and/or polyvinylpyrrolidone (PVP). If desired, disintegrating agents may be added, such as the cross-linked polyvinyl pyrrolidone, agar, or alginic acid or a salt thereof such as sodium alginate. Optionally the oral formulations may also be formulated in saline or buffers for neutralizing internal acid conditions or may be administered without any carriers. [0190]
Dragee cores are provided with suitable coatings. For this purpose, concentrated sugar solutions may be used, which may optionally contain gum arabic, talc, polyvinyl pyrrolidone, carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures. Dyestuffs or pigments may be added to the tablets or dragee coatings for identification or to characterize different combinations of active compound doses. [0191]
Pharmaceutical preparations which can be used orally include push-fit capsules made of gelatin, as well as soft, sealed capsules made of gelatin and a plasticizer, such as glycerol or sorbitol. The push-fit capsules can contain the active ingredients in admixture with filler such as lactose, binders such as starches, and/or lubricants such as talc or magnesium stearate and, optionally, stabilizers. In soft capsules, the active compounds may be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycols. [0192]
In addition, stabilizers may be added. Microspheres formulated for oral administration may also be used. Such microspheres have been well defined in the art. All formulations for oral administration should be in dosages suitable for such administration. [0193]
For buccal administration, the compositions may take the form of tablets or lozenges formulated in conventional manner. [0194]
For administration by inhalation, the compounds for use according to the present invention may be conveniently delivered in the form of an aerosol spray presentation from pressurized packs or a nebulizer, with the use of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas. In the case of a pressurized aerosol the dosage unit may be determined by providing a valve to deliver a metered amount. Capsules and cartridges of e.g. gelatin for use in an inhaler or insufflator may be formulated containing a powder mix of the compound and a suitable powder base such as lactose or starch. Techniques for preparing aerosol delivery systems are well known to those of skill in the art. Generally, such systems should utilize components which will not significantly impair the biological properties of the therapeutic, such as the immunostimulatory capacity of the nucleic acids (see, for example, Sciarra and Cutie, “Aerosols,” in [0195] Remington's Pharmaceutical Sciences, 18th edition, 1990, pp 1694-1712; incorporated by reference). Those of skill in the art can readily determine the various parameters and conditions for producing aerosols without resort to undue experimentation.
The compounds, when it is desirable to deliver them systemically, may be formulated for parenteral administration by injection, e.g., by bolus injection or continuous infusion. Formulations for injection may be presented in unit dosage form, e.g., in ampoules or in multi-dose containers, with an added preservative. The compositions may take such forms as suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents. [0196]
Pharmaceutical formulations for parenteral administration include aqueous solutions of the active compounds in water-soluble form. Additionally, suspensions of the active compounds may be prepared as appropriate oily injection suspensions. Suitable lipophilic so solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acid: esters, such as ethyl oleate or triglycerides, or liposomes. Aqueous injection suspensions may contain substances which increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran. Optionally, the suspension may also contain suitable stabilizers or agents which increase the solubility of the compounds to allow for the preparation of highly concentrated solutions. [0197]
Alternatively, the active compounds may be in powder form for constitution with a suitable vehicle, e.g., sterile pyrogen-free water, before use. [0198]
The compounds may also be formulated in rectal or vaginal compositions such as suppositories or retention enemas, e.g., containing conventional suppository bases such as cocoa butter or other glycerides. [0199]
In addition to the formulations described previously, the compounds may also be formulated as a depot preparation. Such long acting formulations may be formulated with suitable polymeric or hydrophobic materials (for example as an emulsion in an acceptable oil) or ion exchange resins, or as sparingly soluble derivatives, for example, as a sparingly soluble salt. [0200]
The pharmaceutical compositions also may comprise suitable solid or gel phase carriers or excipients. Examples of such carriers or excipients include but are not limited to calcium carbonate, calcium phosphate, various sugars, starches, cellulose derivatives, gelatin, and polymers such as polyethylene glycols. [0201]
Suitable liquid or solid pharmaceutical preparation forms are, for example, aqueous or saline solutions for inhalation, microencapsulated, encochleated; coated onto microscopic gold particles, contained in liposomes, nebulized, aerosols, pellets for implantation into the skin, or dried onto a sharp object to be scratched into the skin. The pharmaceutical compositions also include granules, powders, tablets, coated tablets, (micro)capsules, suppositories, syrups, emulsions, suspensions, creams, drops or preparations with protracted release of active compounds, in whose preparation excipients and additives and/or auxiliaries such as disintegrants, binders, coating agents, swelling agents, lubricants, flavorings, sweeteners or solubilizers are customarily used as described above. The pharmaceutical compositions are suitable for use in a variety of drug delivery systems. For a brief review of methods for drug delivery, see Langer, [0202] Science 249:1527-1533, 1990, which is incorporated herein by reference.
The immunostimulatory nucleic acids and asthma/allergy medicament may be administered per se (neat) or in the form of a pharmaceutically acceptable salt. When used in medicine the salts should be pharmaceutically acceptable, but non-pharmaceutically acceptable salts may conveniently be used to prepare pharmaceutically acceptable salts thereof. Such salts include, but are not limited to, those prepared from the following acids: hydrochloric, hydrobromic, sulphuric, nitric, phosphoric, maleic, acetic, salicylic, p-toluene sulphonic, tartaric, citric, methane sulphonic, formic, malonic, succinic, naphthalene-2-sulphonic, and benzene sulphonic. Also, such salts can be prepared as alkaline metal or alkaline earth salts, such as sodium, potassium or calcium salts of the carboxylic acid group. [0203]
Suitable buffering agents include: acetic acid and a salt (1-2% w/v); citric acid and a salt (1-3% w/v); boric acid and a salt (0.5-2.5% w/v); and phosphoric acid and a salt (0.8-2% w/v). Suitable preservatives include benzalkonium chloride (0.003-0.03% w/v); chlorobutanol (0.3-0.9% w/v); parabens (0.01-0.25% w/v) and thimerosal (0.004-0.02% w/v). [0204]
The pharmaceutical compositions of the invention contain an effective amount of an immunostimulatory nucleic acid and optionally asthma/allergy medicament and/or other therapeutic agents optionally included in a pharmaceutically-acceptable carrier. The term “pharmaceutically-acceptable carrier” means one or more compatible solid or liquid filler, dilutants or encapsulating substances which are suitable for administration to a human or other vertebrate animal. The term “carrier” denotes an organic or inorganic ingredient, natural or synthetic, with which the active ingredient is combined to facilitate the application. The components of the pharmaceutical compositions also are capable of being commingled with the compounds of the present invention, and with each other, in a manner such that there is no interaction which would substantially impair the desired pharmaceutical efficiency. [0205]
The foregoing written specification is considered to be sufficient to enable one skilled in the art to practice the invention. The present invention is not to be limited in scope by examples provided, since the examples are intended as a single illustration of one aspect of the invention and other functionally equivalent embodiments are within the scope of the invention. Various modifications of the invention in addition to those shown and described herein will become apparent to those skilled in the art from the foregoing description and fall within the scope of the appended claims. The advantages and objects of the invention are not necessarily encompassed by each embodiment of the invention. [0206]
All references, patents and patent publications that are recited in this application are incorporated in their entirety herein by reference. [0207]
1 1093 1 18 DNA Artificial Sequence Synthetic Sequence 1 tctcccagcg tgcgccat 18 2 20 DNA Artificial Sequence Synthetic Sequence 2 ataatccagc ttgaaccaag 20 3 20 DNA Artificial Sequence Synthetic Sequence 3 ataatcgacg ttcaagcaag 20 4 18 DNA Artificial Sequence Synthetic Sequence 4 taccgcgtgc gaccctct 18 5 9 DNA Artificial Sequence Synthetic Sequence 5 ggggagggt 9 6 9 DNA Artificial Sequence Synthetic Sequence 6 ggggagggg 9 7 9 DNA Artificial Sequence Synthetic Sequence 7 ggtgaggtg 9 8 20 DNA Artificial Sequence modified_base (8)...(8) m5c 8 tccatgtngt tcctgatgct 20 9 15 DNA Artificial Sequence modified_base (11)...(11) m5c 9 gctaccttag ngtga 15 10 20 DNA Artificial Sequence modified_base (8)...(8) m5c 10 tccatgangt tcctgatgct 20 11 20 DNA Artificial Sequence modified_base (13)...(13) m5c 11 tccatgacgt tcntgatgct 20 12 15 DNA Artificial Sequence modified_base (7)...(7) m5c 12 gctagangtt agtgt 15 13 19 DNA Artificial Sequence Synthetic Sequence 13 agctccatgg tgctcactg 19 14 20 DNA Artificial Sequence Synthetic Sequence 14 ccacgtcgac cctcaggcga 20 15 20 DNA Artificial Sequence Synthetic Sequence 15 gcacatcgtc ccgcagccga 20 16 19 DNA Artificial Sequence Synthetic Sequence 16 gtcactcgtg gtacctcga 19 17 25 DNA Artificial Sequence Synthetic Sequence 17 gttggataca ggccagactt tgttg 25 18 25 DNA Artificial Sequence Synthetic Sequence 18 gattcaactt gcgctcatct taggc 25 19 24 DNA Artificial Sequence Synthetic Sequence 19 accatggacg aactgtttcc cctc 24 20 24 DNA Artificial Sequence Synthetic Sequence 20 accatggacg agctgtttcc cctc 24 21 24 DNA Artificial Sequence Synthetic Sequence 21 accatggacg acctgtttcc cctc 24 22 24 DNA Artificial Sequence Synthetic Sequence 22 accatggacg tactgtttcc cctc 24 23 24 DNA Artificial Sequence Synthetic Sequence 23 accatggacg gtctgtttcc cctc 24 24 24 DNA Artificial Sequence Synthetic Sequence 24 accatggacg ttctgtttcc cctc 24 25 25 DNA Artificial Sequence Synthetic Sequence 25 ccactcacat ctgctgctcc acaag 25 26 25 DNA Artificial Sequence Synthetic Sequence 26 acttctcata gtccctttgg tccag 25 27 20 DNA Artificial Sequence Synthetic Sequence 27 tccatgagct tcctgagtct 20 28 20 DNA Artificial Sequence Synthetic Sequence 28 gaggaaggng nggangacgt 20 29 20 DNA Artificial Sequence Synthetic Sequence 29 gtgaatncgt tcncgggnct 20 30 6 DNA Artificial Sequence Synthetic Sequence 30 aaaaaa 6 31 6 DNA Artificial Sequence Synthetic Sequence 31 cccccc 6 32 6 DNA Artificial Sequence Synthetic Sequence 32 ctgtca 6 33 6 DNA Artificial Sequence Synthetic Sequence 33 tcgtag 6 34 6 DNA Artificial Sequence Synthetic Sequence 34 tcgtgg 6 35 6 DNA Artificial Sequence Synthetic Sequence 35 cgtcgt 6 36 20 DNA Artificial Sequence Synthetic Sequence 36 tccatgtcgg tcctgagtct 20 37 20 DNA Artificial Sequence Synthetic Sequence 37 tccatgccgg tcctgagtct 20 38 20 DNA Artificial Sequence Synthetic Sequence 38 tccatgacgg tcctgagtct 20 39 20 DNA Artificial Sequence Synthetic Sequence 39 tccatgacgg tcctgagtct 20 40 20 DNA Artificial Sequence Synthetic Sequence 40 tccatgtcga tcctgagtct 20 41 20 DNA Artificial Sequence Synthetic Sequence 41 tccatgtcgc tcctgagtct 20 42 20 DNA Artificial Sequence Synthetic Sequence 42 tccatgtcgt tcctgagtct 20 43 20 DNA Artificial Sequence Synthetic Sequence 43 tccatgacgt tcctgagtct 20 44 20 DNA Artificial Sequence Synthetic Sequence 44 tccataacgt tcctgagtct 20 45 20 DNA Artificial Sequence Synthetic Sequence 45 tccatgacgt ccctgagtct 20 46 20 DNA Artificial Sequence Synthetic Sequence 46 tccatcacgt gcctgagtct 20 47 20 DNA Artificial Sequence Synthetic Sequence 47 tccatgctgg tcctgagtct 20 48 20 DNA Artificial Sequence modified_base (8)...(8) m5c 48 tccatgtngg tcctgagtct 20 49 39 DNA Artificial Sequence Synthetic Sequence 49 ccgcttcctc cagatgagct catgggtttc tccaccaag 39 50 39 DNA Artificial Sequence Synthetic Sequence 50 cttggtggag aaacccatga gctcatctgg aggaagcgg 39 51 20 DNA Artificial Sequence Synthetic Sequence 51 ccccaaaggg atgagaagtt 20 52 20 DNA Artificial Sequence Synthetic Sequence 52 agatagcaaa tcggctgacg 20 53 20 DNA Artificial Sequence Synthetic Sequence 53 ggttcacgtg ctcatggctg 20 54 18 DNA Artificial Sequence Synthetic Sequence 54 tctcccagcg tgcgccat 18 55 18 DNA Artificial Sequence Synthetic Sequence 55 tctcccagcg tgcgccat 18 56 18 DNA Artificial Sequence Synthetic Sequence 56 taccgcgtgc gaccctct 18 57 20 DNA Artificial Sequence Synthetic Sequence 57 ataatccagc ttgaaccaag 20 58 20 DNA Artificial Sequence Synthetic Sequence 58 ataatcgacg ttcaagcaag 20 59 20 DNA Artificial Sequence Synthetic Sequence 59 tccatgattt tcctgatttt 20 60 24 DNA Artificial Sequence Synthetic Sequence 60 ttgttttttt gtttttttgt tttt 24 61 22 DNA Artificial Sequence Synthetic Sequence 61 ttttttttgt ttttttgttt tt 22 62 24 DNA Artificial Sequence Synthetic Sequence 62 tgctgctttt gtgcttttgt gctt 24 63 22 DNA Artificial Sequence Synthetic Sequence 63 tgctgcttgt gcttttgtgc tt 22 64 23 DNA Artificial Sequence Synthetic Sequence 64 gcattcatca ggcgggcaag aat 23 65 23 DNA Artificial Sequence Synthetic Sequence 65 taccgagctt cgacgagatt tca 23 66 15 DNA Artificial Sequence Synthetic Sequence 66 gcatgacgtt gagct 15 67 15 DNA Artificial Sequence Synthetic Sequence 67 cacgttgagg ggcat 15 68 15 DNA Artificial Sequence Synthetic Sequence 68 ctgctgagac tggag 15 69 20 DNA Artificial Sequence Synthetic Sequence 69 tccatgacgt tcctgacgtt 20 70 17 DNA Artificial Sequence Synthetic Sequence 70 gcatgagctt gagctga 17 71 12 DNA Artificial Sequence Synthetic Sequence 71 tcagcgtgcg cc 12 72 17 DNA Artificial Sequence Synthetic Sequence 72 atgacgttcc tgacgtt 17 73 20 DNA Artificial Sequence Synthetic Sequence 73 ttttggggtt ttggggtttt 20 74 20 DNA Artificial Sequence Synthetic Sequence 74 tctaggcttt ttaggcttcc 20 75 20 DNA Artificial Sequence Synthetic Sequence 75 tgcatttttt aggccaccat 20 76 22 DNA Artificial Sequence Synthetic Sequence 76 tctcccagcg tgcgtgcgcc at 22 77 17 DNA Artificial Sequence Synthetic Sequence 77 tctcccagcg ggcgcat 17 78 18 DNA Artificial Sequence Synthetic Sequence 78 tctcccagcg agcgccat 18 79 18 DNA Artificial Sequence Synthetic Sequence 79 tctcccagcg cgcgccat 18 80 19 DNA Artificial Sequence Synthetic Sequence 80 ggggtgacgt tcagggggg 19 81 24 DNA Artificial Sequence Synthetic Sequence 81 ggggtccagc gtgcgccatg gggg 24 82 19 DNA Artificial Sequence Synthetic Sequence 82 ggggtgtcgt tcagggggg 19 83 20 DNA Artificial Sequence Synthetic Sequence 83 tccatgtcgt tcctgtcgtt 20 84 20 DNA Artificial Sequence Synthetic Sequence 84 tccatagcgt tcctagcgtt 20 85 21 DNA Artificial Sequence Synthetic Sequence 85 tcgtcgctgt ctccgcttct t 21 86 15 DNA Artificial Sequence Synthetic Sequence 86 gcatgacgtt gagct 15 87 20 DNA Artificial Sequence Synthetic Sequence 87 tctcccagcg tgcgccatat 20 88 20 DNA Artificial Sequence modified_base (8)...(8) m5c 88 tccatgangt tcctgangtt 20 89 15 DNA Artificial Sequence modified_base (7)...(7) m5c 89 gcatgangtt gagct 15 90 16 DNA Artificial Sequence Synthetic Sequence 90 tccagcgtgc gccata 16 91 18 DNA Artificial Sequence Synthetic Sequence 91 tctcccagcg tgcgccat 18 92 20 DNA Artificial Sequence Synthetic Sequence 92 tccatgagct tcctgagtct 20 93 15 DNA Artificial Sequence Synthetic Sequence 93 gcatgtcgtt gagct 15 94 19 DNA Artificial Sequence Synthetic Sequence 94 tcctgacgtt cctgacgtt 19 95 15 DNA Artificial Sequence Synthetic Sequence 95 gcatgatgtt gagct 15 96 15 DNA Artificial Sequence Synthetic Sequence 96 gcatttcgag gagct 15 97 15 DNA Artificial Sequence Synthetic Sequence 97 gcatgtagct gagct 15 98 20 DNA Artificial Sequence Synthetic Sequence 98 tccaggacgt tcctagttct 20 99 20 DNA Artificial Sequence Synthetic Sequence 99 tccaggagct tcctagttct 20 100 20 DNA Artificial Sequence Synthetic Sequence 100 tccaggatgt tcctagttct 20 101 20 DNA Artificial Sequence Synthetic Sequence 101 tccagtctag gcctagttct 20 102 20 DNA Artificial Sequence Synthetic Sequence 102 tccagttcga gcctagttct 20 103 15 DNA Artificial Sequence Synthetic Sequence 103 gcatggcgtt gagct 15 104 15 DNA Artificial Sequence Synthetic Sequence 104 gcatagcgtt gagct 15 105 15 DNA Artificial Sequence Synthetic Sequence 105 gcattgcgtt gagct 15 106 15 DNA Artificial Sequence Synthetic Sequence 106 gcttgcgttg cgttt 15 107 21 DNA Artificial Sequence Synthetic Sequence 107 tctcccagcg ttgcgccata t 21 108 20 DNA Artificial Sequence Synthetic Sequence 108 tctcccagcg tgcgttatat 20 109 20 DNA Artificial Sequence Synthetic Sequence 109 tctccctgcg tgcgccatat 20 110 20 DNA Artificial Sequence Synthetic Sequence 110 tctgcgtgcg tgcgccatat 20 111 20 DNA Artificial Sequence Synthetic Sequence 111 tctcctagcg tgcgccatat 20 112 20 DNA Artificial Sequence Synthetic Sequence 112 tctcccagcg tgcgcctttt 20 113 13 DNA Artificial Sequence Synthetic Sequence 113 gctandcghh agc 13 114 13 DNA Artificial Sequence Synthetic Sequence 114 tcctgacgtt ccc 13 115 13 DNA Artificial Sequence Synthetic Sequence 115 ggaagacgtt aga 13 116 13 DNA Artificial Sequence Synthetic Sequence 116 tcctgacgtt aga 13 117 27 DNA Artificial Sequence Synthetic Sequence 117 tcagaccagc tggtcgggtg ttcctga 27 118 27 DNA Artificial Sequence Synthetic Sequence 118 tcaggaacac ccgaccagct ggtctga 27 119 13 DNA Artificial Sequence Synthetic Sequence 119 gctagtcgat agc 13 120 13 DNA Artificial Sequence Synthetic Sequence 120 gctagtcgct agc 13 121 14 DNA Artificial Sequence Synthetic Sequence 121 gcttgacgtc tagc 14 122 14 DNA Artificial Sequence Synthetic Sequence 122 gcttgacgtt tagc 14 123 14 DNA Artificial Sequence Synthetic Sequence 123 gcttgacgtc aagc 14 124 14 DNA Artificial Sequence Synthetic Sequence 124 gctagacgtt tagc 14 125 20 DNA Artificial Sequence Synthetic Sequence 125 tccatgacat tcctgatgct 20 126 14 DNA Artificial Sequence Synthetic Sequence 126 gctagacgtc tagc 14 127 19 DNA Artificial Sequence Synthetic Sequence 127 ggctatgtcg ttcctagcc 19 128 19 DNA Artificial Sequence Synthetic Sequence 128 ggctatgtcg atcctagcc 19 129 21 DNA Artificial Sequence Synthetic Sequence 129 ctcatgggtt tctccaccaa g 21 130 21 DNA Artificial Sequence Synthetic Sequence 130 cttggtggag aaacccatga g 21 131 20 DNA Artificial Sequence Synthetic Sequence 131 tccatgacgt tcctagttct 20 132 24 DNA Artificial Sequence Synthetic Sequence 132 ccgcttcctc cagatgagct catg 24 133 24 DNA Artificial Sequence Synthetic Sequence 133 catgagctca tctggaggaa gcgg 24 134 24 DNA Artificial Sequence Synthetic Sequence 134 ccagatgagc tcatgggttt ctcc 24 135 24 DNA Artificial Sequence Synthetic Sequence 135 ggagaaaccc atgagctcat ctgg 24 136 20 DNA Artificial Sequence Synthetic Sequence 136 agcatcagga acgacatgga 20 137 20 DNA Artificial Sequence Synthetic Sequence 137 tccatgacgt tcctgacgtt 20 138 19 DNA Artificial Sequence Synthetic Sequence 138 gcgcgcgcgc gcgcgcgcg 19 139 20 DNA Artificial Sequence Synthetic Sequence 139 ccggccggcc ggccggccgg 20 140 43 DNA Artificial Sequence Synthetic Sequence 140 ttccaatcag ccccacccgc tctggcccca ccctcaccct cca 43 141 43 DNA Artificial Sequence Synthetic Sequence 141 tggagggtga gggtggggcc agagcgggtg gggctgattg gaa 43 142 27 DNA Artificial Sequence Synthetic Sequence 142 tcaaatgtgg gattttccca tgagtct 27 143 27 DNA Artificial Sequence Synthetic Sequence 143 agactcatgg gaaaatccca catttga 27 144 27 DNA Artificial Sequence Synthetic Sequence 144 tgccaagtgc tgagtcacta ataaaga 27 145 27 DNA Artificial Sequence Synthetic Sequence 145 tctttattag tgactcagca cttggca 27 146 31 DNA Artificial Sequence Synthetic Sequence 146 tgcaggaagt ccgggttttc cccaaccccc c 31 147 31 DNA Artificial Sequence Synthetic Sequence 147 ggggggttgg ggaaaacccg gacttcctgc a 31 148 38 DNA Artificial Sequence Synthetic Sequence 148 ggggactttc cgctggggac tttccagggg gactttcc 38 149 45 DNA Artificial Sequence Synthetic Sequence 149 tccatgacgt tcctctccat gacgttcctc tccatgacgt tcctc 45 150 45 DNA Artificial Sequence Synthetic Sequence 150 gaggaacgtc atggagagga acgtcatgga gaggaacgtc atgga 45 151 20 DNA Artificial Sequence Synthetic Sequence 151 ataatagagc ttcaagcaag 20 152 20 DNA Artificial Sequence Synthetic Sequence 152 tccatgacgt tcctgacgtt 20 153 20 DNA Artificial Sequence Synthetic Sequence 153 tccatgacgt tcctgacgtt 20 154 20 DNA Artificial Sequence Synthetic Sequence 154 tccaggactt tcctcaggtt 20 155 45 DNA Artificial Sequence Synthetic Sequence 155 tcttgcgatg ctaaaggacg tcacattgca caatcttaat aaggt 45 156 45 DNA Artificial Sequence Synthetic Sequence 156 accttattaa gattgtgcaa tgtgacgtcc tttagcatcg caaga 45 157 28 DNA Artificial Sequence Synthetic Sequence 157 tcctgacgtt cctggcggtc ctgtcgct 28 158 19 DNA Artificial Sequence Synthetic Sequence 158 tcctgtcgct cctgtcgct 19 159 15 DNA Artificial Sequence Synthetic Sequence 159 tcctgacgtt gaagt 15 160 15 DNA Artificial Sequence Synthetic Sequence 160 tcctgtcgtt gaagt 15 161 15 DNA Artificial Sequence Synthetic Sequence 161 tcctggcgtt gaagt 15 162 15 DNA Artificial Sequence Synthetic Sequence 162 tcctgccgtt gaagt 15 163 15 DNA Artificial Sequence Synthetic Sequence 163 tccttacgtt gaagt 15 164 15 DNA Artificial Sequence Synthetic Sequence 164 tcctaacgtt gaagt 15 165 15 DNA Artificial Sequence Synthetic Sequence 165 tcctcacgtt gaagt 15 166 15 DNA Artificial Sequence Synthetic Sequence 166 tcctgacgat gaagt 15 167 15 DNA Artificial Sequence Synthetic Sequence 167 tcctgacgct gaagt 15 168 15 DNA Artificial Sequence Synthetic Sequence 168 tcctgacggt gaagt 15 169 15 DNA Artificial Sequence Synthetic Sequence 169 tcctgacgta gaagt 15 170 15 DNA Artificial Sequence Synthetic Sequence 170 tcctgacgtc gaagt 15 171 15 DNA Artificial Sequence Synthetic Sequence 171 tcctgacgtg gaagt 15 172 15 DNA Artificial Sequence Synthetic Sequence 172 tcctgagctt gaagt 15 173 15 DNA Artificial Sequence Synthetic Sequence 173 gggggacgtt ggggg 15 174 15 DNA Artificial Sequence Synthetic Sequence 174 tcctgacgtt ccttc 15 175 22 DNA Artificial Sequence Synthetic Sequence 175 tctcccagcg agcgagcgcc at 22 176 32 DNA Artificial Sequence Synthetic Sequence 176 tcctgacgtt cccctggcgg tcccctgtcg ct 32 177 28 DNA Artificial Sequence Synthetic Sequence 177 tcctgtcgct cctgtcgctc ctgtcgct 28 178 15 DNA Artificial Sequence Synthetic Sequence 178 tcctggcggg gaagt 15 179 15 DNA Artificial Sequence modified_base (7)...(7) m5c 179 tcctgangtt gaagt 15 180 15 DNA Artificial Sequence modified_base (3)...(3) m5c 180 tcntgacgtt gaagt 15 181 15 DNA Artificial Sequence Synthetic Sequence 181 tcctagcgtt gaagt 15 182 15 DNA Artificial Sequence Synthetic Sequence 182 tccagacgtt gaagt 15 183 15 DNA Artificial Sequence Synthetic Sequence 183 tcctgacggg gaagt 15 184 15 DNA Artificial Sequence Synthetic Sequence 184 tcctggcggt gaagt 15 185 27 DNA Artificial Sequence Synthetic Sequence 185 ggctccgggg agggaatttt tgtctat 27 186 27 DNA Artificial Sequence Synthetic Sequence 186 atagacaaaa attccctccc cggagcc 27 187 21 DNA Artificial Sequence Synthetic Sequence 187 tccatgagct tccttgagtc t 21 188 21 DNA Artificial Sequence Synthetic Sequence 188 tcgtcgctgt ctccgcttct t 21 189 21 DNA Artificial Sequence Synthetic Sequence 189 tcgtcgctgt ctccgcttct t 21 190 23 DNA Artificial Sequence Synthetic Sequence 190 tcgagacatt gcacaatcat ctg 23 191 20 DNA Artificial Sequence Synthetic Sequence 191 cagattgtgc aatgtctcga 20 192 20 DNA Artificial Sequence Synthetic Sequence 192 tccatgtcgt tcctgatgcg 20 193 20 DNA Artificial Sequence Synthetic Sequence 193 gcgatgtcgt tcctgatgct 20 194 20 DNA Artificial Sequence Synthetic Sequence 194 gcgatgtcgt tcctgatgcg 20 195 20 DNA Artificial Sequence Synthetic Sequence 195 tccatgtcgt tccgcgcgcg 20 196 20 DNA Artificial Sequence Synthetic Sequence 196 tccatgtcgt tcctgccgct 20 197 20 DNA Artificial Sequence Synthetic Sequence 197 tccatgtcgt tcctgtagct 20 198 20 DNA Artificial Sequence Synthetic Sequence 198 gcggcgggcg gcgcgcgccc 20 199 21 DNA Artificial Sequence Synthetic Sequence 199 atcaggaacg tcatgggaag c 21 200 20 DNA Artificial Sequence Synthetic Sequence 200 tccatgagct tcctgagtct 20 201 8 DNA Artificial Sequence Synthetic Sequence 201 tcaacgtt 8 202 8 DNA Artificial Sequence Synthetic Sequence 202 tcaagctt 8 203 19 DNA Artificial Sequence Synthetic Sequence 203 tcctgtcgtt cctgtcgtt 19 204 20 DNA Artificial Sequence Synthetic Sequence 204 tccatgtcgt ttttgtcgtt 20 205 20 DNA Artificial Sequence Synthetic Sequence 205 tcctgtcgtt ccttgtcgtt 20 206 20 DNA Artificial Sequence Synthetic Sequence 206 tccttgtcgt tcctgtcgtt 20 207 29 DNA Artificial Sequence misc_feature (1)...(3) Conjugated to biotin moiety. 207 tccattccat gacgttcctg atgcttcca 29 208 20 DNA Artificial Sequence Synthetic Sequence 208 tcctgtcgtt ttttgtcgtt 20 209 21 DNA Artificial Sequence Synthetic Sequence 209 tcgtcgctgt ctccgcttct t 21 210 21 DNA Artificial Sequence Synthetic Sequence 210 tcgtcgctgt ctgcccttct t 21 211 21 DNA Artificial Sequence Synthetic Sequence 211 tcgtcgctgt tgtcgtttct t 21 212 30 DNA Artificial Sequence Synthetic Sequence 212 tcctgtcgtt cctgtcgttg gaacgacagg 30 213 40 DNA Artificial Sequence Synthetic Sequence 213 tcctgtcgtt cctgtcgttt caacgtcagg aacgacagga 40 214 21 DNA Artificial Sequence Synthetic Sequence 214 ggggtctgtc gttttggggg g 21 215 21 DNA Artificial Sequence Synthetic Sequence 215 ggggtctgtg cttttggggg g 21 216 15 DNA Artificial Sequence Synthetic Sequence 216 tccggccgtt gaagt 15 217 15 DNA Artificial Sequence Synthetic Sequence 217 tccggacggt gaagt 15 218 15 DNA Artificial Sequence Synthetic Sequence 218 tcccgccgtt gaagt 15 219 15 DNA Artificial Sequence Synthetic Sequence 219 tccagacggt gaagt 15 220 15 DNA Artificial Sequence Synthetic Sequence 220 tcccgacggt gaagt 15 221 15 DNA Artificial Sequence Synthetic Sequence 221 tccagagctt gaagt 15 222 20 DNA Artificial Sequence modified_base (8)...(8) m5c 222 tccatgtngt tcctgtngtt 20 223 20 DNA Artificial Sequence Synthetic Sequence 223 tccatgacgt tcctgacgtt 20 224 20 DNA Artificial Sequence Synthetic Sequence 224 ggggttgacg ttttgggggg 20 225 20 DNA Artificial Sequence Synthetic Sequence 225 tccaggactt ctctcaggtt 20 226 20 DNA Artificial Sequence Synthetic Sequence 226 tttttttttt tttttttttt 20 227 20 DNA Artificial Sequence Synthetic Sequence 227 tccatgccgt tcctgccgtt 20 228 20 DNA Artificial Sequence Synthetic Sequence 228 tccatggcgg gcctggcggg 20 229 20 DNA Artificial Sequence Synthetic Sequence 229 tccatgacgt tcctgccgtt 20 230 20 DNA Artificial Sequence Synthetic Sequence 230 tccatgacgt tcctggcggg 20 231 20 DNA Artificial Sequence Synthetic Sequence 231 tccatgacgt tcctgcgttt 20 232 20 DNA Artificial Sequence Synthetic Sequence 232 tccatgacgg tcctgacggt 20 233 20 DNA Artificial Sequence Synthetic Sequence 233 tccatgcgtg cgtgcgtttt 20 234 20 DNA Artificial Sequence Synthetic Sequence 234 tccatgcgtt gcgttgcgtt 20 235 30 DNA Artificial Sequence misc_feature (1)...(3) Conjugated to biotin moiety. 235 tccattccat tctaggcctg agtcttccat 30 236 20 DNA Artificial Sequence Synthetic Sequence 236 tccatagcgt tcctagcgtt 20 237 20 DNA Artificial Sequence Synthetic Sequence 237 tccatgtcgt tcctgtcgtt 20 238 20 DNA Artificial Sequence Synthetic Sequence 238 tccatagcga tcctagcgat 20 239 20 DNA Artificial Sequence Synthetic Sequence 239 tccattgcgt tccttgcgtt 20 240 20 DNA Artificial Sequence Synthetic Sequence 240 tccatagcgg tcctagcggt 20 241 29 DNA Artificial Sequence Synthetic Sequence 241 tccatgattt tcctgcagtt cctgatttt 29 242 29 DNA Artificial Sequence Synthetic Sequence 242 tccatgacgt tcctgcagtt cctgacgtt 29 243 20 DNA Artificial Sequence Synthetic Sequence 243 ggcggcggcg gcggcggcgg 20 244 20 DNA Artificial Sequence Synthetic Sequence 244 tccacgacgt tttcgacgtt 20 245 20 DNA Artificial Sequence Synthetic Sequence 245 tcgtcgttgt cgttgtcgtt 20 246 24 DNA Artificial Sequence Synthetic Sequence 246 tcgtcgtttt gtcgttttgt cgtt 24 247 22 DNA Artificial Sequence Synthetic Sequence 247 tcgtcgttgt cgttttgtcg tt 22 248 21 DNA Artificial Sequence Synthetic Sequence 248 gcgtgcgttg tcgttgtcgt t 21 249 19 DNA Artificial Sequence Synthetic Sequence 249 cnggcnggcn gggcnccgg 19 250 20 DNA Artificial Sequence Synthetic Sequence 250 gcggcgggcg gcgcgcgccc 20 251 20 DNA Artificial Sequence Synthetic Sequence 251 agncccgnga acgnattcac 20 252 21 DNA Artificial Sequence Synthetic Sequence 252 tgtcgtttgt cgtttgtcgt t 21 253 25 DNA Artificial Sequence Synthetic Sequence 253 tgtcgttgtc gttgtcgttg tcgtt 25 254 25 DNA Artificial Sequence Synthetic Sequence 254 tgtcgttgtc gttgtcgttg tcgtt 25 255 14 DNA Artificial Sequence Synthetic Sequence 255 tcgtcgtcgt cgtt 14 256 13 DNA Artificial Sequence Synthetic Sequence 256 tgtcgttgtc gtt 13 257 20 DNA Artificial Sequence Synthetic Sequence 257 cccccccccc cccccccccc 20 258 20 DNA Artificial Sequence Synthetic Sequence 258 tctagcgttt ttagcgttcc 20 259 20 DNA Artificial Sequence Synthetic Sequence 259 tgcatccccc aggccaccat 20 260 23 DNA Artificial Sequence Synthetic Sequence 260 tcgtcgtcgt cgtcgtcgtc gtt 23 261 20 DNA Artificial Sequence Synthetic Sequence 261 tcgtcgttgt cgttgtcgtt 20 262 24 DNA Artificial Sequence Synthetic Sequence 262 tcgtcgtttt gtcgttttgt cgtt 24 263 22 DNA Artificial Sequence Synthetic Sequence 263 tcgtcgttgt cgttttgtcg tt 22 264 39 DNA Artificial Sequence Synthetic Sequence 264 ggggagggag gaacttctta aaattccccc agaatgttt 39 265 39 DNA Artificial Sequence Synthetic Sequence 265 aaacattctg ggggaatttt aagaagttcc tccctcccc 39 266 33 DNA Artificial Sequence Synthetic Sequence 266 atgtttactt cttaaaattc ccccagaatg ttt 33 267 33 DNA Artificial Sequence Synthetic Sequence 267 aaacattctg ggggaatttt aagaagtaaa cat 33 268 33 DNA Artificial Sequence Synthetic Sequence 268 atgtttacta gacaaaattc ccccagaatg ttt 33 269 33 DNA Artificial Sequence Synthetic Sequence 269 aaacattctg ggggaatttt gtctagtaaa cat 33 270 20 DNA Artificial Sequence Synthetic Sequence 270 aaaattgacg ttttaaaaaa 20 271 20 DNA Artificial Sequence Synthetic Sequence 271 ccccttgacg ttttcccccc 20 272 20 DNA Artificial Sequence Synthetic Sequence 272 ttttcgttgt ttttgtcgtt 20 273 24 DNA Artificial Sequence Synthetic Sequence 273 tcgtcgtttt gtcgttttgt cgtt 24 274 14 DNA Artificial Sequence Synthetic Sequence 274 ctgcagcctg ggac 14 275 25 DNA Artificial Sequence Synthetic Sequence 275 acccgtcgta attatagtaa aaccc 25 276 21 DNA Artificial Sequence Synthetic Sequence 276 ggtacctgtg gggacattgt g 21 277 18 DNA Artificial Sequence Synthetic Sequence 277 agcaccgaac gtgagagg 18 278 20 DNA Artificial Sequence Synthetic Sequence 278 tccatgccgt tcctgccgtt 20 279 20 DNA Artificial Sequence Synthetic Sequence 279 tccatgacgg tcctgacggt 20 280 20 DNA Artificial Sequence Synthetic Sequence 280 tccatgccgg tcctgccggt 20 281 20 DNA Artificial Sequence Synthetic Sequence 281 tccatgcgcg tcctgcgcgt 20 282 24 DNA Artificial Sequence Synthetic Sequence 282 ctggtctttc tggttttttt ctgg 24 283 20 DNA Artificial Sequence Synthetic Sequence 283 tcaggggtgg ggggaacctt 20 284 20 DNA Artificial Sequence modified_base (8)...(8) m5c 284 tccatgangt tcctagttct 20 285 20 DNA Artificial Sequence Synthetic Sequence 285 tccatgatgt tcctagttct 20 286 26 DNA Artificial Sequence Synthetic Sequence 286 cccgaagtca tttcctctta acctgg 26 287 26 DNA Artificial Sequence Synthetic Sequence 287 ccaggttaag aggaaatgac ttcggg 26 288 15 DNA Artificial Sequence modified_base (7)...(7) m5c 288 tcctggnggg gaagt 15 289 20 DNA Artificial Sequence modified_base (2)...(2) m5c 289 gnggngggng gngngngccc 20 290 20 DNA Artificial Sequence Synthetic Sequence 290 tccatgtgct tcctgatgct 20 291 20 DNA Artificial Sequence Synthetic Sequence 291 tccatgtcct tcctgatgct 20 292 20 DNA Artificial Sequence Synthetic Sequence 292 tccatgtcgt tcctagttct 20 293 20 DNA Artificial Sequence Synthetic Sequence 293 tccaagtagt tcctagttct 20 294 20 DNA Artificial Sequence Synthetic Sequence 294 tccatgtagt tcctagttct 20 295 20 DNA Artificial Sequence Synthetic Sequence 295 tcccgcgcgt tccgcgcgtt 20 296 20 DNA Artificial Sequence Synthetic Sequence 296 tcctggcggt cctggcggtt 20 297 15 DNA Artificial Sequence Synthetic Sequence 297 tcctggaggg gaagt 15 298 15 DNA Artificial Sequence Synthetic Sequence 298 tcctgggggg gaagt 15 299 15 DNA Artificial Sequence Synthetic Sequence 299 tcctggtggg gaagt 15 300 24 DNA Artificial Sequence Synthetic Sequence 300 tcgtcgtttt gtcgttttgt cgtt 24 301 24 DNA Artificial Sequence Synthetic Sequence 301 ctggtctttc tggttttttt ctgg 24 302 20 DNA Artificial Sequence Synthetic Sequence 302 tccatgacgt tcctgacgtt 20 303 20 DNA Artificial Sequence Synthetic Sequence 303 tccaggactt ctctcaggtt 20 304 24 DNA Artificial Sequence Synthetic Sequence 304 tngtngtttt gtngttttgt ngtt 24 305 29 DNA Artificial Sequence misc_feature (1)...(3) Conjugated to biotin moiety. 305 tcgtcgtttt gtcgttttgt cgttttttt 29 306 18 DNA Artificial Sequence Synthetic Sequence 306 gctatgacgt tccaaggg 18 307 8 DNA Artificial Sequence Synthetic Sequence 307 tcaacgtt 8 308 20 DNA Artificial Sequence Synthetic Sequence 308 tccaggactt tcctcaggtt 20 309 20 DNA Artificial Sequence Synthetic Sequence 309 ctctctgtag gcccgcttgg 20 310 20 DNA Artificial Sequence Synthetic Sequence 310 ctttccgttg gacccctggg 20 311 20 DNA Artificial Sequence Synthetic Sequence 311 gtccgggcca ggccaaagtc 20 312 20 DNA Artificial Sequence Synthetic Sequence 312 gtgcgcgcga gcccgaaatc 20 313 20 DNA Artificial Sequence modified_base (8)...(8) I 313 tccatgangt tcctgangtt 20 314 20 DNA Artificial Sequence Synthetic Sequence 314 aatagtcgcc ataacaaaac 20 315 20 DNA Artificial Sequence Synthetic Sequence 315 aatagtcgcc atggcggggc 20 316 28 DNA Artificial Sequence misc_difference (1)...(3) Biotin moiety attached at 5′ end of sequence. 316 tttttccatg tcgttcctga tgcttttt 28 317 20 DNA Artificial Sequence Synthetic Sequence 317 tcctgtcgtt gaagtttttt 20 318 24 DNA Artificial Sequence Synthetic Sequence 318 gctagcttta gagctttaga gctt 24 319 20 DNA Artificial Sequence Synthetic Sequence 319 tgctgcttcc cccccccccc 20 320 20 DNA Artificial Sequence Synthetic Sequence 320 tcgacgttcc cccccccccc 20 321 20 DNA Artificial Sequence Synthetic Sequence 321 tcgtcgttcc cccccccccc 20 322 20 DNA Artificial Sequence Synthetic Sequence 322 tcgtcgttcc cccccccccc 20 323 20 DNA Artificial Sequence Synthetic Sequence 323 tcgccgttcc cccccccccc 20 324 20 DNA Artificial Sequence Synthetic Sequence 324 tcgtcgatcc cccccccccc 20 325 15 DNA Artificial Sequence Synthetic Sequence 325 tcctgacgtt gaagt 15 326 15 DNA Artificial Sequence Synthetic Sequence 326 tcctgccgtt gaagt 15 327 15 DNA Artificial Sequence Synthetic Sequence 327 tcctgacggt gaagt 15 328 15 DNA Artificial Sequence Synthetic Sequence 328 tcctgagctt gaagt 15 329 15 DNA Artificial Sequence Synthetic Sequence 329 tcctggcggg gaagt 15 330 21 DNA Artificial Sequence Synthetic Sequence 330 aaaatctgtg cttttaaaaa a 21 331 33 DNA Artificial Sequence Synthetic Sequence 331 gatccagtca cagtgacctg gcagaatctg gat 33 332 33 DNA Artificial Sequence Synthetic Sequence 332 gatccagatt ctgccaggtc actgtgactg gat 33 333 33 DNA Artificial Sequence Synthetic Sequence 333 gatccagtca cagtgactca gcagaatctg gat 33 334 33 DNA Artificial Sequence Synthetic Sequence 334 gatccagatt ctgctgagtc actgtgactg gat 33 335 20 DNA Artificial Sequence modified_base (16)...(16) m5c 335 tcgtcgttcc cccccncccc 20 336 20 DNA Artificial Sequence modified_base (2)...(2) m5c 336 tngtngttcc cccccccccc 20 337 20 DNA Artificial Sequence modified_base (2)...(2) m5c 337 tngtcgttcc cccccccccc 20 338 20 DNA Artificial Sequence modified_base (5)...(5) m5c 338 tcgtngttcc cccccccccc 20 339 20 DNA Artificial Sequence Synthetic Sequence 339 tcgtcgctcc cccccccccc 20 340 20 DNA Artificial Sequence Synthetic Sequence 340 tcgtcggtcc cccccccccc 20 341 20 DNA Artificial Sequence Synthetic Sequence 341 tcggcgttcc cccccccccc 20 342 20 DNA Artificial Sequence Synthetic Sequence 342 ggccttttcc cccccccccc 20 343 24 DNA Artificial Sequence Synthetic Sequence 343 tcgtcgtttt gacgttttgt cgtt 24 344 24 DNA Artificial Sequence Synthetic Sequence 344 tcgtcgtttt gacgttttga cgtt 24 345 20 DNA Artificial Sequence Synthetic Sequence 345 ccgtcgttcc cccccccccc 20 346 20 DNA Artificial Sequence Synthetic Sequence 346 gcgtcgttcc cccccccccc 20 347 20 DNA Artificial Sequence Synthetic Sequence 347 tcgtcattcc cccccccccc 20 348 20 DNA Artificial Sequence Synthetic Sequence 348 acgtcgttcc cccccccccc 20 349 20 DNA Artificial Sequence Synthetic Sequence 349 ctgtcgttcc cccccccccc 20 350 24 DNA Artificial Sequence misc_feature (1)...(3) Biotin moiety attached at 5′ end of sequence. 350 tttttcgtcg ttcccccccc cccc 24 351 20 DNA Artificial Sequence misc_feature (18)...(20) Biotin moiety attached at 3′ end of sequence. 351 tcgtcgttcc cccccccccc 20 352 24 DNA Artificial Sequence misc_feature (22)...(24) Biotin moiety attached at 3′ end of sequence. 352 tcgtcgtttt gtcgttttgt cgtt 24 353 20 DNA Artificial Sequence Synthetic Sequence 353 tccagttcct tcctcagtct 20 354 24 DNA Artificial Sequence modified_base (2)...(2) m5c 354 tngtcgtttt gtcgttttgt cgtt 24 355 15 DNA Artificial Sequence Synthetic Sequence 355 tcctggaggg gaagt 15 356 15 DNA Artificial Sequence Synthetic Sequence 356 tcctgaaaag gaagt 15 357 17 DNA Artificial Sequence Synthetic Sequence 357 tcgtcgttcc ccccccc 17 358 24 DNA Artificial Sequence Synthetic Sequence 358 tngtngtttt gtngttttgt ngtt 24 359 20 DNA Artificial Sequence Synthetic Sequence 359 ggggtcaagc ttgagggggg 20 360 20 DNA Artificial Sequence Synthetic Sequence 360 tgctgcttcc cccccccccc 20 361 14 DNA Artificial Sequence Synthetic Sequence 361 tcgtcgtcgt cgtt 14 362 14 DNA Artificial Sequence Synthetic Sequence 362 tcgtcgtcgt cgtt 14 363 14 DNA Artificial Sequence Synthetic Sequence 363 tcgtcgtcgt cgtt 14 364 10 DNA Artificial Sequence Synthetic Sequence 364 tcaacgttga 10 365 8 DNA Artificial Sequence Synthetic Sequence 365 tcaacgtt 8 366 20 DNA Artificial Sequence Synthetic Sequence 366 atagttttcc atttttttac 20 367 20 DNA Artificial Sequence Synthetic Sequence 367 aatagtcgcc atcgcgcgac 20 368 20 DNA Artificial Sequence Synthetic Sequence 368 aatagtcgcc atcccgggac 20 369 20 DNA Artificial Sequence Synthetic Sequence 369 aatagtcgcc atcccccccc 20 370 24 DNA Artificial Sequence Synthetic Sequence 370 tgctgctttt gtgcttttgt gctt 24 371 24 DNA Artificial Sequence Synthetic Sequence 371 ctgtgctttc tgtgtttttc tgtg 24 372 24 DNA Artificial Sequence Synthetic Sequence 372 ctaatctttc taattttttt ctaa 24 373 26 DNA Artificial Sequence Synthetic Sequence 373 tcgtcgttgg tgtcgttggt gtcgtt 26 374 24 DNA Artificial Sequence Synthetic Sequence 374 tcgtcgttgg ttgtcgtttt ggtt 24 375 24 DNA Artificial Sequence Synthetic Sequence 375 accatggacg agctgtttcc cctc 24 376 20 DNA Artificial Sequence Synthetic Sequence 376 tcgtcgtttt gcgtgcgttt 20 377 20 DNA Artificial Sequence Synthetic Sequence 377 ctgtaagtga gcttggagag 20 378 18 DNA Artificial Sequence Synthetic Sequence 378 gagaacgctg gaccttcc 18 379 20 DNA Artificial Sequence Synthetic Sequence 379 cgggcgactc agtctatcgg 20 380 37 DNA Artificial Sequence Synthetic Sequence 380 gttctcagat aaagcggaac cagcaacaga cacagaa 37 381 37 DNA Artificial Sequence Synthetic Sequence 381 ttctgtgtct gttgctggtt ccgctttatc tgagaac 37 382 23 DNA Artificial Sequence Synthetic Sequence 382 cagacacaga agcccgatag acg 23 383 20 DNA Artificial Sequence Synthetic Sequence 383 agacagacac gaaacgaccg 20 384 20 DNA Artificial Sequence Synthetic Sequence 384 gtctgtccca tgatctcgaa 20 385 20 DNA Artificial Sequence Synthetic Sequence 385 gctggccagc ttacctcccg 20 386 21 DNA Artificial Sequence Synthetic Sequence 386 ggggcctcta tacaacctgg g 21 387 18 DNA Artificial Sequence Synthetic Sequence 387 ggggtccctg agactgcc 18 388 20 DNA Artificial Sequence Synthetic Sequence 388 gagaacgctg gaccttccat 20 389 20 DNA Artificial Sequence Synthetic Sequence 389 tccatgtcgg tcctgatgct 20 390 20 DNA Artificial Sequence Synthetic Sequence 390 ctcttgcgac ctggaaggta 20 391 20 DNA Artificial Sequence Synthetic Sequence 391 aggtacagcc aggactacga 20 392 24 DNA Artificial Sequence Synthetic Sequence 392 accatggacg acctgtttcc cctc 24 393 24 DNA Artificial Sequence Synthetic Sequence 393 accatggatt acctttttcc cctt 24 394 20 DNA Artificial Sequence Synthetic Sequence 394 atggaaggtc cagcgttctc 20 395 20 DNA Artificial Sequence Synthetic Sequence 395 agcatcagga ccgacatgga 20 396 20 DNA Artificial Sequence Synthetic Sequence 396 ctctccaagc tcacttacag 20 397 21 DNA Artificial Sequence Synthetic Sequence 397 tccctgagac tgccccacct t 21 398 20 DNA Artificial Sequence Synthetic Sequence 398 gccaccaaaa cttgtccatg 20 399 20 DNA Artificial Sequence Synthetic Sequence 399 gtccatggcg tgcgggatga 20 400 19 DNA Artificial Sequence Synthetic Sequence 400 cctctataca acctgggac 19 401 20 DNA Artificial Sequence Synthetic Sequence 401 cgggcgactc agtctatcgg 20 402 20 DNA Artificial Sequence Synthetic Sequence 402 gcgctaccgg tagcctgagt 20 403 35 DNA Artificial Sequence Synthetic Sequence 403 cgactgccga acaggatatc ggtgatcagc actgg 35 404 35 DNA Artificial Sequence Synthetic Sequence 404 ccagtgctga tcaccgatat cctgttcggc agtcg 35 405 17 DNA Artificial Sequence Synthetic Sequence 405 ccaggttgta tagaggc 17 406 18 DNA Artificial Sequence Synthetic Sequence 406 tctcccagcg tacgccat 18 407 18 DNA Artificial Sequence Synthetic Sequence 407 tctcccagcg tgcgtttt 18 408 18 DNA Artificial Sequence Synthetic Sequence 408 tctcccgacg tgcgccat 18 409 18 DNA Artificial Sequence Synthetic Sequence 409 tctcccgtcg tgcgccat 18 410 20 DNA Artificial Sequence Synthetic Sequence 410 ataatcgtcg ttcaagcaag 20 411 23 DNA Artificial Sequence Synthetic Sequence 411 tcgtcgtttt gtcgttttgt cgt 23 412 24 DNA Artificial Sequence Synthetic Sequence 412 tcgtcgtttt gtcgttttgt cgtt 24 413 24 DNA Artificial Sequence Synthetic Sequence 413 tcgtcgtttt gtcgttttgt cgtt 24 414 24 DNA Artificial Sequence misc_difference (3)...(3) n is a or c or g or t/u 414 tcntcgtntt ntcgtnttnt cgtn 24 415 17 DNA Artificial Sequence Synthetic Sequence 415 tctcccagcg tcgccat 17 416 17 DNA Artificial Sequence Synthetic Sequence 416 tctcccatcg tcgccat 17 417 21 DNA Artificial Sequence Synthetic Sequence 417 ataatcgtgc gttcaagaaa g 21 418 20 DNA Artificial Sequence Synthetic Sequence 418 ataatcgacg ttcccccccc 20 419 20 DNA Artificial Sequence Synthetic Sequence 419 tctatcgacg ttcaagcaag 20 420 14 DNA Artificial Sequence Synthetic Sequence 420 tcctgacggg gagt 14 421 19 DNA Artificial Sequence Synthetic Sequence 421 tccatgacgt tcctgatcc 19 422 19 DNA Artificial Sequence Synthetic Sequence 422 tccatgacgt tcctgatcc 19 423 19 DNA Artificial Sequence Synthetic Sequence 423 tccatgacgt tcctgatcc 19 424 15 DNA Artificial Sequence Synthetic Sequence 424 tcctggcgtg gaagt 15 425 19 DNA Artificial Sequence Synthetic Sequence 425 tccatgacgt tcctgatcc 19 426 21 DNA Artificial Sequence Synthetic Sequence 426 tcgtcgctgt tgtcgtttct t 21 427 24 DNA Artificial Sequence Synthetic Sequence 427 agcagcttta gagctttaga gctt 24 428 24 DNA Artificial Sequence Synthetic Sequence 428 cccccccccc cccccccccc cccc 24 429 32 DNA Artificial Sequence Synthetic Sequence 429 tcgtcgtttt gtcgttttgt cgttttgtcg tt 32 430 28 DNA Artificial Sequence Synthetic Sequence 430 tcgtcgtttt ttgtcgtttt ttgtcgtt 28 431 20 DNA Artificial Sequence Synthetic Sequence 431 tcgtcgtttt tttttttttt 20 432 20 DNA Artificial Sequence Synthetic Sequence 432 tttttcaacg ttgatttttt 20 433 24 DNA Artificial Sequence Synthetic Sequence 433 tttttttttt tttttttttt tttt 24 434 20 DNA Artificial Sequence Synthetic Sequence 434 ggggtcgtcg ttttgggggg 20 435 24 DNA Artificial Sequence Synthetic Sequence 435 tcgtcgtttt gtcgttttgg gggg 24 436 27 DNA Artificial Sequence Synthetic Sequence 436 tcgtcgctgt ctccgcttct tcttgcc 27 437 15 DNA Artificial Sequence Synthetic Sequence 437 tcgtcgctgt ctccg 15 438 20 DNA Artificial Sequence Synthetic Sequence 438 ctgtaagtga gcttggagag 20 439 20 DNA Artificial Sequence Synthetic Sequence 439 gagaacgctg gaccttccat 20 440 17 DNA Artificial Sequence Synthetic Sequence 440 ccaggttgta tagaggc 17 441 17 DNA Artificial Sequence Synthetic Sequence 441 gctagacgtt agcgtga 17 442 20 DNA Artificial Sequence Synthetic Sequence 442 ggagctcttc gaacgccata 20 443 20 DNA Artificial Sequence Synthetic Sequence 443 tctccatgat ggttttatcg 20 444 21 DNA Artificial Sequence Synthetic Sequence 444 aaggtggggc agtctcaggg a 21 445 20 DNA Artificial Sequence Synthetic Sequence 445 atcggaggac tggcgcgccg 20 446 20 DNA Artificial Sequence Synthetic Sequence 446 ttaggacaag gtctagggtg 20 447 20 DNA Artificial Sequence Synthetic Sequence 447 accacaacga gaggaacgca 20 448 20 DNA Artificial Sequence Synthetic Sequence 448 ggcagtgcag gctcaccggg 20 449 17 DNA Artificial Sequence Synthetic Sequence 449 gaaccttcca tgctgtt 17 450 17 DNA Artificial Sequence Synthetic Sequence 450 gctagacgtt agcgtga 17 451 20 DNA Artificial Sequence Synthetic Sequence 451 gcttggaggg cctgtaagtg 20 452 12 DNA Artificial Sequence Synthetic Sequence 452 gtagccttcc ta 12 453 14 DNA Artificial Sequence Synthetic Sequence 453 cggtagcctt ccta 14 454 16 DNA Artificial Sequence Synthetic Sequence 454 cacggtagcc ttccta 16 455 18 DNA Artificial Sequence Synthetic Sequence 455 agcacggtag ccttccta 18 456 18 DNA Artificial Sequence Synthetic Sequence 456 gaacgctgga ccttccat 18 457 10 DNA Artificial Sequence Synthetic Sequence 457 gaccttccat 10 458 12 DNA Artificial Sequence Synthetic Sequence 458 tggaccttcc at 12 459 14 DNA Artificial Sequence Synthetic Sequence 459 gctggacctt ccat 14 460 16 DNA Artificial Sequence Synthetic Sequence 460 acgctggacc ttccat 16 461 20 DNA Artificial Sequence Synthetic Sequence 461 taagctctgt caacgccagg 20 462 22 DNA Artificial Sequence Synthetic Sequence 462 gagaacgctg gaccttccat gt 22 463 20 DNA Artificial Sequence Synthetic Sequence 463 tccatgtcgg tcctgatgct 20 464 21 DNA Artificial Sequence Synthetic Sequence 464 ttcatgcctt gcaaaatggc g 21 465 20 DNA Artificial Sequence Synthetic Sequence 465 tgctagctgt gcctgtacct 20 466 20 DNA Artificial Sequence Synthetic Sequence 466 agcatcagga ccgacatgga 20 467 22 DNA Artificial Sequence Synthetic Sequence 467 gaccttccat gtcggtcctg at 22 468 20 DNA Artificial Sequence Synthetic Sequence 468 acaaccacga gaacgggaac 20 469 20 DNA Artificial Sequence Synthetic Sequence 469 gaaccttcca tgctgttccg 20 470 20 DNA Artificial Sequence Synthetic Sequence 470 caatcaatct gaggagaccc 20 471 20 DNA Artificial Sequence Synthetic Sequence 471 tcagctctgg tactttttca 20 472 20 DNA Artificial Sequence Synthetic Sequence 472 tggttacggt ctgtcccatg 20 473 20 DNA Artificial Sequence Synthetic Sequence 473 gtctatcgga ggactggcgc 20 474 20 DNA Artificial Sequence Synthetic Sequence 474 cattttacgg gcgggcgggc 20 475 20 DNA Artificial Sequence Synthetic Sequence 475 gaggggacca ttttacgggc 20 476 20 DNA Artificial Sequence Synthetic Sequence 476 tgtccagccg aggggaccat 20 477 20 DNA Artificial Sequence Synthetic Sequence 477 cgggcttacg gcggatgctg 20 478 20 DNA Artificial Sequence Synthetic Sequence 478 tggaccttct atgtcggtcc 20 479 20 DNA Artificial Sequence Synthetic Sequence 479 tgtcccatgt ttttagaagc 20 480 20 DNA Artificial Sequence Synthetic Sequence 480 gtggttacgg tcgtgcccat 20 481 20 DNA Artificial Sequence Synthetic Sequence 481 cctccaaatg aaagaccccc 20 482 20 DNA Artificial Sequence Synthetic Sequence 482 ttgtactctc catgatggtt 20 483 20 DNA Artificial Sequence Synthetic Sequence 483 ttccatgctg ttccggctgg 20 484 20 DNA Artificial Sequence Synthetic Sequence 484 gaccttctat gtcggtcctg 20 485 20 DNA Artificial Sequence Synthetic Sequence 485 gagaccgctc gaccttcgat 20 486 20 DNA Artificial Sequence Synthetic Sequence 486 ttgccccata ttttagaaac 20 487 18 DNA Artificial Sequence Synthetic Sequence 487 ttgaaactga ggtgggac 18 488 21 DNA Artificial Sequence Synthetic Sequence 488 ctatcggagg actggcgcgc c 21 489 20 DNA Artificial Sequence Synthetic Sequence 489 cttggagggc ctcccggcgg 20 490 20 DNA Artificial Sequence Synthetic Sequence 490 gctgaacctt ccatgctgtt 20 491 32 DNA Artificial Sequence Synthetic Sequence 491 tagaaacagc attcttcttt tagggcagca ca 32 492 24 DNA Artificial Sequence Synthetic Sequence 492 agatggttct cagataaagc ggaa 24 493 24 DNA Artificial Sequence Synthetic Sequence 493 ttccgcttta tctgagaacc atct 24 494 23 DNA Artificial Sequence Synthetic Sequence 494 gtcccaggtt gtatagaggc tgc 23 495 20 DNA Artificial Sequence Synthetic Sequence 495 gcgccagtcc tccgatagac 20 496 20 DNA Artificial Sequence Synthetic Sequence 496 atcggaggac tggcgcgccg 20 497 20 DNA Artificial Sequence Synthetic Sequence 497 ggtctgtccc atatttttag 20 498 20 DNA Artificial Sequence Synthetic Sequence 498 tttttcaacg ttgagggggg 20 499 21 DNA Artificial Sequence Synthetic Sequence 499 tttttcaagc gttgattttt t 21 500 20 DNA Artificial Sequence Synthetic Sequence 500 ggggtcaacg ttgatttttt 20 501 25 DNA Artificial Sequence Synthetic Sequence 501 ggggttttca acgttttgag ggggg 25 502 20 DNA Artificial Sequence Synthetic Sequence 502 ggttacggtc tgtcccatat 20 503 20 DNA Artificial Sequence Synthetic Sequence 503 ctgtcccata tttttagaca 20 504 20 DNA Artificial Sequence Synthetic Sequence 504 accatcctga ggccattcgg 20 505 23 DNA Artificial Sequence Synthetic Sequence 505 cgtctatcgg gcttctgtgt ctg 23 506 21 DNA Artificial Sequence Synthetic Sequence 506 ggccatccca cattgaaagt t 21 507 22 DNA Artificial Sequence Synthetic Sequence 507 ccaaatatcg gtggtcaagc ac 22 508 22 DNA Artificial Sequence Synthetic Sequence 508 gtgcttgacc accgatattt gg 22 509 26 DNA Artificial Sequence Synthetic Sequence 509 gtgctgatca ccgatatcct gttcgg 26 510 27 DNA Artificial Sequence Synthetic Sequence 510 ggccaacttt caatgtggga tggcctc 27 511 27 DNA Artificial Sequence Synthetic Sequence 511 ttccgccgaa tggcctcagg atggtac 27 512 36 DNA Artificial Sequence Synthetic Sequence 512 tatagtccct gagactgccc caccttctca acaacc 36 513 27 DNA Artificial Sequence Synthetic Sequence 513 gcagcctcta tacaacctgg gacggga 27 514 22 DNA Artificial Sequence Synthetic Sequence 514 ctatcggagg actggcgcgc cg 22 515 21 DNA Artificial Sequence Synthetic Sequence 515 tatcggagga ctggcgcgcc g 21 516 21 DNA Artificial Sequence Synthetic Sequence 516 gatcggagga ctggcgcgcc g 21 517 26 DNA Artificial Sequence Synthetic Sequence 517 ccgaacagga tatcggtgat cagcac 26 518 24 DNA Artificial Sequence Synthetic Sequence 518 ttttggggtc aacgttgagg gggg 24 519 20 DNA Artificial Sequence Synthetic Sequence 519 ggggtcaacg ttgagggggg 20 520 20 DNA Artificial Sequence Synthetic Sequence 520 cgcgcgcgcg cgcgcgcgcg 20 521 20 DNA Artificial Sequence Synthetic Sequence 521 ggggcatgac gttcgggggg 20 522 20 DNA Artificial Sequence Synthetic Sequence 522 ggggcatgac gttcaaaaaa 20 523 20 DNA Artificial Sequence Synthetic Sequence 523 ggggcatgag cttcgggggg 20 524 20 DNA Artificial Sequence Synthetic Sequence 524 ggggcatgac gttcgggggg 20 525 20 DNA Artificial Sequence Synthetic Sequence 525 aaaacatgac gttcaaaaaa 20 526 20 DNA Artificial Sequence Synthetic Sequence 526 aaaacatgac gttcgggggg 20 527 20 DNA Artificial Sequence Synthetic Sequence 527 ggggcatgac gttcaaaaaa 20 528 24 DNA Artificial Sequence Synthetic Sequence 528 accatggacg atctgtttcc cctc 24 529 24 DNA Artificial Sequence Synthetic Sequence 529 gccatggacg aactgttccc cctc 24 530 20 DNA Artificial Sequence Synthetic Sequence 530 cccccccccc cccccccccc 20 531 20 DNA Artificial Sequence Synthetic Sequence 531 gggggggggg gggggggggg 20 532 20 DNA Artificial Sequence Synthetic Sequence 532 gctgtaaaat gaatcggccg 20 533 20 DNA Artificial Sequence Synthetic Sequence 533 ttcgggcgga ctcctccatt 20 534 20 DNA Artificial Sequence Synthetic Sequence 534 tatgccgcgc ccggacttat 20 535 20 DNA Artificial Sequence Synthetic Sequence 535 ggggtaatcg atcagggggg 20 536 20 DNA Artificial Sequence Synthetic Sequence 536 tttgagaacg ctggaccttc 20 537 20 DNA Artificial Sequence Synthetic Sequence 537 gatcgctgat ctaatgctcg 20 538 20 DNA Artificial Sequence Synthetic Sequence 538 gtcggtcctg atgctgttcc 20 539 20 DNA Artificial Sequence Synthetic Sequence 539 tcgtcgtcag ttcgctgtcg 20 540 18 DNA Artificial Sequence Synthetic Sequence 540 ctggaccttc catgtcgg 18 541 17 DNA Artificial Sequence Synthetic Sequence 541 gctcgttcag cgcgtct 17 542 16 DNA Artificial Sequence Synthetic Sequence 542 ctggaccttc catgtc 16 543 16 DNA Artificial Sequence Synthetic Sequence 543 cactgtcctt cgtcga 16 544 20 DNA Artificial Sequence Synthetic Sequence 544 cgctggacct tccatgtcgg 20 545 20 DNA Artificial Sequence Synthetic Sequence 545 gctgagctca tgccgtctgc 20 546 20 DNA Artificial Sequence Synthetic Sequence 546 aacgctggac cttccatgtc 20 547 20 DNA Artificial Sequence Synthetic Sequence 547 tgcatgccgt acacagctct 20 548 20 DNA Artificial Sequence Synthetic Sequence 548 ccttccatgt cggtcctgat 20 549 20 DNA Artificial Sequence Synthetic Sequence 549 tactcttcgg atcccttgcg 20 550 18 DNA Artificial Sequence Synthetic Sequence 550 ttccatgtcg gtcctgat 18 551 18 DNA Artificial Sequence Synthetic Sequence 551 ctgattgctc tctcgtga 18 552 20 DNA Artificial Sequence Synthetic Sequence 552 ggcgttattc ctgactcgcc 20 553 22 DNA Artificial Sequence Synthetic Sequence 553 cctacgttgt atgcgcccag ct 22 554 20 DNA Artificial Sequence Synthetic Sequence 554 ggggtaatcg atgagggggg 20 555 20 DNA Artificial Sequence Synthetic Sequence 555 ttcgggcgga ctcctccatt 20 556 20 DNA Artificial Sequence Synthetic Sequence 556 tttttttttt tttttttttt 20 557 20 DNA Artificial Sequence Synthetic Sequence 557 gggggttttt tttttggggg 20 558 20 DNA Artificial Sequence Synthetic Sequence 558 tttttggggg gggggttttt 20 559 19 DNA Artificial Sequence Synthetic Sequence 559 gggggggggg ggggggggt 19 560 20 DNA Artificial Sequence Synthetic Sequence 560 aaaaaaaaaa aaaaaaaaaa 20 561 20 DNA Artificial Sequence Synthetic Sequence 561 cccccaaaaa aaaaaccccc 20 562 20 DNA Artificial Sequence Synthetic Sequence 562 aaaaaccccc cccccaaaaa 20 563 27 DNA Artificial Sequence Synthetic Sequence 563 tttgaattca ggactggtga ggttgag 27 564 27 DNA Artificial Sequence Synthetic Sequence 564 tttgaatcct cagcggtctc cagtggc 27 565 45 DNA Artificial Sequence Synthetic Sequence 565 aattctctat cggggcttct gtgtctgttg ctggttccgc tttat 45 566 45 DNA Artificial Sequence Synthetic Sequence 566 ctagataaag cggaaccagc aacagacaca gaagccccga tagag 45 567 28 DNA Artificial Sequence Synthetic Sequence 567 ttttctagag aggtgcacaa tgctctgg 28 568 29 DNA Artificial Sequence Synthetic Sequence 568 tttgaattcc gtgtacagaa gcgagaagc 29 569 31 DNA Artificial Sequence Synthetic Sequence 569 tttgcggccg ctagacttaa cctgagagat a 31 570 29 DNA Artificial Sequence Synthetic Sequence 570 tttgggccca cgagagacag agacacttc 29 571 29 DNA Artificial Sequence Synthetic Sequence 571 tttgggcccg cttctcgctt ctgtacacg 29 572 20 DNA Artificial Sequence Synthetic Sequence 572 gagaacgctg gaccttccat 20 573 20 DNA Artificial Sequence Synthetic Sequence 573 tccatgtcgg tcctgatgct 20 574 6 DNA Artificial Sequence Synthetic Sequence 574 ctgtcg 6 575 6 DNA Artificial Sequence Synthetic Sequence 575 tcgtga 6 576 6 DNA Artificial Sequence Synthetic Sequence 576 cgtcga 6 577 6 DNA Artificial Sequence Synthetic Sequence 577 agtgct 6 578 6 DNA Artificial Sequence Synthetic Sequence 578 ctgtcg 6 579 6 DNA Artificial Sequence Synthetic Sequence 579 agtgct 6 580 6 DNA Artificial Sequence Synthetic Sequence 580 cgtcga 6 581 6 DNA Artificial Sequence Synthetic Sequence 581 tcgtga 6 582 20 DNA Artificial Sequence Synthetic Sequence 582 gagaacgctc cagcttcgat 20 583 17 DNA Artificial Sequence Synthetic Sequence 583 gctagacgta agcgtga 17 584 20 DNA Artificial Sequence Synthetic Sequence 584 gagaacgctc gaccttccat 20 585 21 DNA Artificial Sequence Synthetic Sequence 585 gagaacgctg gacctatcca t 21 586 17 DNA Artificial Sequence Synthetic Sequence 586 gctagaggtt agcgtga 17 587 19 DNA Artificial Sequence Synthetic Sequence 587 gagaacgctg gacttccat 19 588 17 DNA Artificial Sequence Synthetic Sequence 588 tcacgctaac gtctagc 17 589 17 DNA Artificial Sequence misc_feature (1)...(3) Conjugated to biotin moiety. 589 gctagacgtt agcgtga 17 590 20 DNA Artificial Sequence Synthetic Sequence 590 atggaaggtc gagcgttctc 20 591 20 DNA Artificial Sequence Synthetic Sequence 591 gagaacgctg gaccttcgat 20 592 20 DNA Artificial Sequence Synthetic Sequence 592 gagaacgatg gaccttccat 20 593 17 DNA Artificial Sequence Synthetic Sequence 593 gagaacgctg gatccat 17 594 20 DNA Artificial Sequence Synthetic Sequence 594 gagaacgctc cagcactgat 20 595 20 DNA Artificial Sequence Synthetic Sequence 595 tccatgtcgg tcctgctgat 20 596 20 DNA Artificial Sequence Synthetic Sequence 596 atgtcctcgg tcctgatgct 20 597 20 DNA Artificial Sequence Synthetic Sequence 597 gagaacgctc caccttccat 20 598 20 DNA Artificial Sequence Synthetic Sequence 598 gagaacgctg gaccttcgta 20 599 20 DNA Artificial Sequence misc_feature (1)...(3) Conjugated to biotin moiety. 599 atggaaggtc cagcgttctc 20 600 6 DNA Artificial Sequence Synthetic Sequence 600 tcctga 6 601 8 DNA Artificial Sequence Synthetic Sequence 601 tcaacgtt 8 602 6 DNA Artificial Sequence Synthetic Sequence 602 aacgtt 6 603 8 DNA Artificial Sequence Synthetic Sequence 603 aacgttga 8 604 17 DNA Artificial Sequence Synthetic Sequence 604 tcacgctaac ctctagc 17 605 20 DNA Artificial Sequence Synthetic Sequence 605 gagaacgctg gaccttgcat 20 606 14 DNA Artificial Sequence Synthetic Sequence 606 gctggacctt ccat 14 607 22 DNA Artificial Sequence Synthetic Sequence 607 gagaacgctg gacctcatcc at 22 608 23 DNA Artificial Sequence Synthetic Sequence 608 gagaacgctg gacgctcatc cat 23 609 15 DNA Artificial Sequence Synthetic Sequence 609 aacgttgagg ggcat 15 610 15 DNA Artificial Sequence Synthetic Sequence 610 atgcccctca acgtt 15 611 10 DNA Artificial Sequence Synthetic Sequence 611 tcaacgttga 10 612 14 DNA Artificial Sequence Synthetic Sequence 612 gctggacctt ccat 14 613 7 DNA Artificial Sequence Synthetic Sequence 613 caacgtt 7 614 10 DNA Artificial Sequence Synthetic Sequence 614 acaacgttga 10 615 6 DNA Artificial Sequence Synthetic Sequence 615 tcacgt 6 616 8 DNA Artificial Sequence Synthetic Sequence 616 tcaagctt 8 617 6 DNA Artificial Sequence Synthetic Sequence 617 tcgtca 6 618 8 DNA Artificial Sequence Synthetic Sequence 618 aggatatc 8 619 8 DNA Artificial Sequence Synthetic Sequence 619 tagacgtc 8 620 8 DNA Artificial Sequence Synthetic Sequence 620 gacgtcat 8 621 8 DNA Artificial Sequence Synthetic Sequence 621 ccatcgat 8 622 8 DNA Artificial Sequence Synthetic Sequence 622 atcgatgt 8 623 8 DNA Artificial Sequence Synthetic Sequence 623 atgcatgt 8 624 8 DNA Artificial Sequence Synthetic Sequence 624 ccatgcat 8 625 8 DNA Artificial Sequence Synthetic Sequence 625 agcgctga 8 626 8 DNA Artificial Sequence Synthetic Sequence 626 tcagcgct 8 627 8 DNA Artificial Sequence Synthetic Sequence 627 ccttcgat 8 628 18 DNA Artificial Sequence Synthetic Sequence 628 gtgccggggt ctccgggc 18 629 18 DNA Artificial Sequence Synthetic Sequence 629 gctgtggggc ggctcctg 18 630 8 DNA Artificial Sequence misc_feature (1)...(3) Conjugated to biotin moiety. 630 tcaacgtt 8 631 8 DNA Artificial Sequence misc_feature (1)...(3) Conjugated to FITC moiety. 631 tcaacgtt 8 632 8 DNA Artificial Sequence misc_feature (1)...(3) Conjugated to FITC moiety. 632 aacgttga 8 633 7 DNA Artificial Sequence Synthetic Sequence 633 tcaacgt 7 634 7 DNA Artificial Sequence Synthetic Sequence 634 aacgttg 7 635 6 DNA Artificial Sequence Synthetic Sequence 635 cgacga 6 636 8 DNA Artificial Sequence Synthetic Sequence 636 tcaacgtt 8 637 5 DNA Artificial Sequence Synthetic Sequence 637 tcgga 5 638 8 DNA Artificial Sequence Synthetic Sequence 638 agaacgtt 8 639 8 DNA Artificial Sequence Synthetic Sequence 639 tcatcgat 8 640 8 DNA Artificial Sequence Synthetic Sequence 640 taaacgtt 8 641 8 DNA Artificial Sequence Synthetic Sequence 641 ccaacgtt 8 642 6 DNA Artificial Sequence Synthetic Sequence 642 gctcga 6 643 6 DNA Artificial Sequence Synthetic Sequence 643 cgacgt 6 644 6 DNA Artificial Sequence Synthetic Sequence 644 cgtcgt 6 645 6 DNA Artificial Sequence Synthetic Sequence 645 acgtgt 6 646 6 DNA Artificial Sequence Synthetic Sequence 646 cgttcg 6 647 20 DNA Artificial Sequence Synthetic Sequence 647 gagcaagctg gaccttccat 20 648 6 DNA Artificial Sequence Synthetic Sequence 648 cgcgta 6 649 6 DNA Artificial Sequence Synthetic Sequence 649 cgtacg 6 650 8 DNA Artificial Sequence Synthetic Sequence 650 tcaccggt 8 651 20 DNA Artificial Sequence Synthetic Sequence 651 caagagatgc taacaatgca 20 652 20 DNA Artificial Sequence Synthetic Sequence 652 acccatcaat agctctgtgc 20 653 8 DNA Artificial Sequence Synthetic Sequence 653 ccatcgat 8 654 8 DNA Artificial Sequence Synthetic Sequence 654 tcgacgtc 8 655 8 DNA Artificial Sequence Synthetic Sequence 655 ctagcgct 8 656 8 DNA Artificial Sequence Synthetic Sequence 656 taagcgct 8 657 13 DNA Artificial Sequence Synthetic Sequence 657 tcgcgaattc gcg 13 658 19 DNA Artificial Sequence Synthetic Sequence 658 atggaaggtc cagcgttct 19 659 17 DNA Artificial Sequence Synthetic Sequence 659 actggacgtt agcgtga 17 660 18 DNA Artificial Sequence Synthetic Sequence 660 cgcctggggc tggtctgg 18 661 18 DNA Artificial Sequence Synthetic Sequence 661 gtgtcggggt ctccgggc 18 662 18 DNA Artificial Sequence Synthetic Sequence 662 gtgccggggt ctccgggc 18 663 18 DNA Artificial Sequence Synthetic Sequence 663 cgccgtcgcg gcggttgg 18 664 21 DNA Artificial Sequence Synthetic Sequence 664 gaagttcacg ttgaggggca t 21 665 21 DNA Artificial Sequence Synthetic Sequence 665 atctggtgag ggcaagctat g 21 666 21 DNA Artificial Sequence Synthetic Sequence 666 gttgaaaccc gagaacatca t 21 667 8 DNA Artificial Sequence Synthetic Sequence 667 gcaacgtt 8 668 8 DNA Artificial Sequence Synthetic Sequence 668 gtaacgtt 8 669 8 DNA Artificial Sequence Synthetic Sequence 669 cgaacgtt 8 670 8 DNA Artificial Sequence Synthetic Sequence 670 gaaacgtt 8 671 8 DNA Artificial Sequence Synthetic Sequence 671 caaacgtt 8 672 8 DNA Artificial Sequence Synthetic Sequence 672 ctaacgtt 8 673 8 DNA Artificial Sequence Synthetic Sequence 673 ggaacgtt 8 674 8 DNA Artificial Sequence Synthetic Sequence 674 tgaacgtt 8 675 8 DNA Artificial Sequence Synthetic Sequence 675 acaacgtt 8 676 8 DNA Artificial Sequence Synthetic Sequence 676 ttaacgtt 8 677 8 DNA Artificial Sequence Synthetic Sequence 677 aaaacgtt 8 678 8 DNA Artificial Sequence Synthetic Sequence 678 ataacgtt 8 679 8 DNA Artificial Sequence Synthetic Sequence 679 aacgttct 8 680 8 DNA Artificial Sequence Synthetic Sequence 680 tccgatcg 8 681 8 DNA Artificial Sequence Synthetic Sequence 681 tccgtacg 8 682 17 DNA Artificial Sequence Synthetic Sequence 682 gctagacgct agcgtga 17 683 25 DNA Artificial Sequence Synthetic Sequence 683 gagaacgctg gacctcatca tccat 25 684 20 DNA Artificial Sequence Synthetic Sequence 684 gagaacgcta gaccttctat 20 685 17 DNA Artificial Sequence Synthetic Sequence 685 actagacgtt agtgtga 17 686 22 DNA Artificial Sequence Synthetic Sequence 686 cacaccttgg tcaatgtcac gt 22 687 22 DNA Artificial Sequence Synthetic Sequence 687 tctccatcct atggttttat cg 22 688 15 DNA Artificial Sequence Synthetic Sequence 688 cgctggacct tccat 15 689 23 DNA Artificial Sequence Synthetic Sequence 689 caccaccttg gtcaatgtca cgt 23 690 17 DNA Artificial Sequence Synthetic Sequence 690 gctagacgtt agctgga 17 691 17 DNA Artificial Sequence Synthetic Sequence 691 agtgcgattg cagatcg 17 692 24 DNA Artificial Sequence Synthetic Sequence 692 ttttcgtttt gtggttttgt ggtt 24 693 23 DNA Artificial Sequence Synthetic Sequence 693 ttttcgtttg tcgttttgtc gtt 23 694 24 DNA Artificial Sequence Synthetic Sequence 694 tttttgtttt gtggttttgt ggtt 24 695 20 DNA Artificial Sequence Synthetic Sequence 695 accgcatgga ttctaggcca 20 696 15 DNA Artificial Sequence Synthetic Sequence 696 gctagacgtt agcgt 15 697 17 DNA Artificial Sequence Synthetic Sequence 697 aacgctggac cttccat 17 698 8 DNA Artificial Sequence modified_base (5)...(5) m5c 698 tcaangtt 8 699 8 DNA Artificial Sequence Synthetic Sequence 699 ccttcgat 8 700 17 DNA Artificial Sequence Synthetic Sequence 700 actagacgtt agtgtga 17 701 17 DNA Artificial Sequence Synthetic Sequence 701 gctagaggtt agcgtga 17 702 20 DNA Artificial Sequence Synthetic Sequence 702 atggactctc cagcgttctc 20 703 20 DNA Artificial Sequence Synthetic Sequence 703 atcgactctc gagcgttctc 20 704 13 DNA Artificial Sequence Synthetic Sequence 704 gctagacgtt agc 13 705 9 DNA Artificial Sequence Synthetic Sequence 705 gctagacgt 9 706 17 DNA Artificial Sequence Synthetic Sequence 706 agtgcgattc gagatcg 17 707 8 DNA Artificial Sequence modified_base (5)...(5) m5c 707 tcagngct 8 708 18 DNA Artificial Sequence Synthetic Sequence 708 ctgattgctc tctcgtga 18 709 8 DNA Artificial Sequence modified_base (2)...(2) m5c 709 tnaacgtt 8 710 20 DNA Artificial Sequence modified_base (6)...(6) m5c 710 gagaangctg gaccttccat 20 711 17 DNA Artificial Sequence Synthetic Sequence 711 gctagacgtt aggctga 17 712 14 DNA Artificial Sequence Synthetic Sequence 712 gctacttagc gtga 14 713 15 DNA Artificial Sequence Synthetic Sequence 713 gctaccttag cgtga 15 714 19 DNA Artificial Sequence Synthetic Sequence 714 atcgacttcg agcgttctc 19 715 20 DNA Artificial Sequence Synthetic Sequence 715 atgcactctg cagcgttctc 20 716 20 DNA Artificial Sequence Synthetic Sequence 716 agtgactctc cagcgttctc 20 717 17 DNA Artificial Sequence Synthetic Sequence 717 gccagatgtt agctgga 17 718 18 DNA Artificial Sequence Synthetic Sequence 718 atcgactcga gcgttctc 18 719 17 DNA Artificial Sequence Synthetic Sequence 719 atcgatcgag cgttctc 17 720 20 DNA Artificial Sequence misc_feature (1)...(3) Conjugated to biotin moiety. 720 gagaacgctc gaccttcgat 20 721 17 DNA Artificial Sequence Synthetic Sequence 721 gctagacgtt agctgga 17 722 20 DNA Artificial Sequence Synthetic Sequence 722 atcgactctc gagcgttctc 20 723 15 DNA Artificial Sequence Synthetic Sequence 723 tagacgttag cgtga 15 724 18 DNA Artificial Sequence Synthetic Sequence 724 cgactctcga gcgttctc 18 725 21 DNA Artificial Sequence Synthetic Sequence 725 ggggtcgacc ttggaggggg g 21 726 16 DNA Artificial Sequence Synthetic Sequence 726 gctaacgtta gcgtga 16 727 9 DNA Artificial Sequence Synthetic Sequence 727 cgtcgtcgt 9 728 20 DNA Artificial Sequence modified_base (14)...(14) m5c 728 gagaacgctg gacnttccat 20 729 20 DNA Artificial Sequence modified_base (18)...(18) m5c 729 atcgacctac gtgcgttntc 20 730 20 DNA Artificial Sequence modified_base (3)...(3) m5c 730 atngacctac gtgcgttctc 20 731 15 DNA Artificial Sequence modified_base (7)...(7) m5c 731 gctagangtt agcgt 15 732 20 DNA Artificial Sequence modified_base (14)...(14) m5c 732 atcgactctc gagngttctc 20 733 20 DNA Artificial Sequence Synthetic Sequence 733 ggggtaatgc atcagggggg 20 734 20 DNA Artificial Sequence Synthetic Sequence 734 ggctgtattc ctgactgccc 20 735 17 DNA Artificial Sequence Synthetic Sequence 735 ccatgctaac ctctagc 17 736 17 DNA Artificial Sequence Synthetic Sequence 736 gctagatgtt agcgtga 17 737 15 DNA Artificial Sequence Synthetic Sequence 737 cgtaccttac ggtga 15 738 20 DNA Artificial Sequence Synthetic Sequence 738 tccatgctgg tcctgatgct 20 739 22 DNA Artificial Sequence Synthetic Sequence 739 atcgactctc tcgagcgttc tc 22 740 17 DNA Artificial Sequence Synthetic Sequence 740 gctagagctt agcgtga 17 741 20 DNA Artificial Sequence Synthetic Sequence 741 atcgactctc gagtgttctc 20 742 17 DNA Artificial Sequence Synthetic Sequence 742 aacgctcgac cttcgat 17 743 20 DNA Artificial Sequence Synthetic Sequence 743 ctcaacgctg gaccttccat 20 744 20 DNA Artificial Sequence Synthetic Sequence 744 atcgacctac gtgcgttctc 20 745 20 DNA Artificial Sequence Synthetic Sequence 745 gagaatgctg gaccttccat 20 746 17 DNA Artificial Sequence Synthetic Sequence 746 tcacgctaac ctctgac 17 747 20 DNA Artificial Sequence misc_feature (1)...(3) Conjugated to biotin moiety. 747 gagaacgctc cagcactgat 20 748 20 DNA Artificial Sequence misc_feature (1)...(3) Biotin moiety attached at 5′ end of sequence. 748 gagcaagctg gaccttccat 20 749 18 DNA Artificial Sequence Synthetic Sequence 749 cgctagaggt tagcgtga 18 750 15 DNA Artificial Sequence Synthetic Sequence 750 gctagatgtt aacgt 15 751 19 DNA Artificial Sequence Synthetic Sequence 751 atggaaggtc cacgttctc 19 752 15 DNA Artificial Sequence Synthetic Sequence 752 gctagatgtt agcgt 15 753 15 DNA Artificial Sequence Synthetic Sequence 753 gctagacgtt agtgt 15 754 20 DNA Artificial Sequence Synthetic Sequence 754 tccatgacgg tcctgatgct 20 755 20 DNA Artificial Sequence Synthetic Sequence 755 tccatggcgg tcctgatgct 20 756 15 DNA Artificial Sequence Synthetic Sequence 756 gctagacgat agcgt 15 757 15 DNA Artificial Sequence Synthetic Sequence 757 gctagtcgat agcgt 15 758 20 DNA Artificial Sequence Synthetic Sequence 758 tccatgacgt tcctgatgct 20 759 20 DNA Artificial Sequence Synthetic Sequence 759 tccatgtcgt tcctgatgct 20 760 15 DNA Artificial Sequence modified_base (13)...(13) m5c 760 gctagacgtt agngt 15 761 15 DNA Artificial Sequence Synthetic Sequence 761 gctaggcgtt agcgt 15 762 20 DNA Artificial Sequence modified_base (8)...(8) m5c 762 tccatgtngg tcctgatgct 20 763 20 DNA Artificial Sequence modified_base (12)...(12) m5c 763 tccatgtcgg tnctgatgct 20 764 20 DNA Artificial Sequence Synthetic Sequence 764 atngactctn gagngttctc 20 765 20 DNA Artificial Sequence Synthetic Sequence 765 atggaaggtc cagtgttctc 20 766 15 DNA Artificial Sequence Synthetic Sequence 766 gcatgacgtt gagct 15 767 20 DNA Artificial Sequence Synthetic Sequence 767 ggggtcaacg ttgagggggg 20 768 20 DNA Artificial Sequence Synthetic Sequence 768 ggggtcaagt ctgagggggg 20 769 20 DNA Artificial Sequence Synthetic Sequence 769 cgcgcgcgcg cgcgcgcgcg 20 770 28 DNA Artificial Sequence Synthetic Sequence 770 cccccccccc cccccccccc cccccccc 28 771 35 DNA Artificial Sequence Synthetic Sequence 771 cccccccccc cccccccccc cccccccccc ccccc 35 772 20 DNA Artificial Sequence Synthetic Sequence 772 tccatgtcgc tcctgatcct 20 773 15 DNA Artificial Sequence Synthetic Sequence 773 gctaaacgtt agcgt 15 774 20 DNA Artificial Sequence Synthetic Sequence 774 tccatgtcga tcctgatgct 20 775 20 DNA Artificial Sequence Synthetic Sequence 775 tccatgccgg tcctgatgct 20 776 20 DNA Artificial Sequence Synthetic Sequence 776 aaaatcaacg ttgaaaaaaa 20 777 20 DNA Artificial Sequence Synthetic Sequence 777 tccataacgt tcctgatgct 20 778 23 DNA Artificial Sequence Synthetic Sequence 778 tggaggtccc accgagatcg gag 23 779 21 DNA Artificial Sequence Synthetic Sequence 779 cgtcgtcgtc gtcgtcgtcg t 21 780 21 DNA Artificial Sequence Synthetic Sequence 780 ctgctgctgc tgctgctgct g 21 781 21 DNA Artificial Sequence Synthetic Sequence 781 gagaacgctc cgaccttcga t 21 782 15 DNA Artificial Sequence Synthetic Sequence 782 gctagatgtt agcgt 15 783 15 DNA Artificial Sequence Synthetic Sequence 783 gcatgacgtt gagct 15 784 10 DNA Artificial Sequence misc_feature (8)...(10) Conjugated to FITC moiety. 784 tcaatgctga 10 785 10 DNA Artificial Sequence misc_feature (8)...(10) Conjugated to FITC moiety. 785 tcaacgttga 10 786 10 DNA Artificial Sequence misc_feature (8)...(10) Conjugated to biotin moiety. 786 tcaacgttga 10 787 10 DNA Artificial Sequence misc_feature (8)...(10) Conjugated to biotin moiety. 787 gcaatattgc 10 788 10 DNA Artificial Sequence misc_feature (8)...(10) Conjugated to FITC moiety. 788 gcaatattgc 10 789 10 DNA Artificial Sequence Synthetic Sequence 789 agttgcaact 10 790 8 DNA Artificial Sequence Synthetic Sequence 790 tcttcgaa 8 791 8 DNA Artificial Sequence Synthetic Sequence 791 tcaacgtc 8 792 19 DNA Artificial Sequence Synthetic Sequence 792 ccatgtcggt cctgatgct 19 793 18 DNA Artificial Sequence Synthetic Sequence 793 gtttttatat aatttggg 18 794 23 DNA Artificial Sequence Synthetic Sequence 794 tttttgtttg tcgttttgtc gtt 23 795 12 DNA Artificial Sequence Synthetic Sequence 795 ttgggggggg tt 12 796 13 DNA Artificial Sequence Synthetic Sequence 796 ggggttgggg gtt 13 797 17 DNA Artificial Sequence Synthetic Sequence 797 ggtggtgtag gttttgg 17 798 20 DNA Artificial Sequence misc_feature (1)...(3) Conjugated to biotin moiety. 798 gagaangctc gaccttcgat 20 799 20 DNA Artificial Sequence Synthetic Sequence 799 tcaacgttaa cgttaacgtt 20 800 20 DNA Artificial Sequence misc_feature (1)...(3) Conjugated to biotin moiety. 800 gagcaagntg gaccttccat 20 801 20 DNA Artificial Sequence misc_feature (1)...(3) Conjugated to biotin moiety. 801 gagaangctc cagcactgat 20 802 10 DNA Artificial Sequence modified_base (5)...(5) m5c 802 tcaangttga 10 803 10 DNA Artificial Sequence modified_base (2)...(2) m5c 803 gnaatattgc 10 804 24 DNA Artificial Sequence Synthetic Sequence 804 tgctgctttt gtcgttttgt gctt 24 805 22 DNA Artificial Sequence Synthetic Sequence 805 ctgcgttagc aatttaactg tg 22 806 20 DNA Artificial Sequence Synthetic Sequence 806 tccatgacgt tcctgatgct 20 807 28 DNA Artificial Sequence Synthetic Sequence 807 tgcatgccgt gcatccgtac acagctct 28 808 20 DNA Artificial Sequence Synthetic Sequence 808 tgcatgccgt acacagctct 20 809 12 DNA Artificial Sequence Synthetic Sequence 809 tgcatcagct ct 12 810 8 DNA Artificial Sequence Synthetic Sequence 810 tgcgctct 8 811 20 DNA Artificial Sequence Synthetic Sequence 811 cccccccccc cccccccccc 20 812 12 DNA Artificial Sequence Synthetic Sequence 812 cccccccccc cc 12 813 8 DNA Artificial Sequence Synthetic Sequence 813 cccccccc 8 814 12 DNA Artificial Sequence Synthetic Sequence 814 tgcatcagct ct 12 815 20 DNA Artificial Sequence Synthetic Sequence 815 tgcatgccgt acacagctct 20 816 20 DNA Artificial Sequence Synthetic Sequence 816 gagcaagctg gaccttccat 20 817 32 DNA Artificial Sequence Synthetic Sequence 817 tcaacgttaa cgttaacgtt aacgttaacg tt 32 818 20 DNA Artificial Sequence Synthetic Sequence 818 gagaacgctc gaccttcgat 20 819 25 DNA Artificial Sequence Synthetic Sequence 819 gtccccattt cccagaggag gaaat 25 820 25 DNA Artificial Sequence Synthetic Sequence 820 ctagcggctg acgtcatcaa gctag 25 821 25 DNA Artificial Sequence Synthetic Sequence 821 ctagcttgat gacgtcagcc gctag 25 822 16 DNA Artificial Sequence Synthetic Sequence 822 cggctgacgt catcaa 16 823 8 DNA Artificial Sequence Synthetic Sequence 823 ctgacgtg 8 824 10 DNA Artificial Sequence Synthetic Sequence 824 ctgacgtcat 10 825 21 DNA Artificial Sequence Synthetic Sequence 825 attcgatcgg ggcggggcga g 21 826 21 DNA Artificial Sequence Synthetic Sequence 826 ctcgccccgc cccgatcgaa t 21 827 15 DNA Artificial Sequence Synthetic Sequence 827 gactgacgtc agcgt 15 828 26 DNA Artificial Sequence Synthetic Sequence 828 ctagcggctg acgtcataaa gctagc 26 829 26 DNA Artificial Sequence Synthetic Sequence 829 ctagctttat gacgtcagcc gctagc 26 830 26 DNA Artificial Sequence Synthetic Sequence 830 ctagcggctg agctcataaa gctagc 26 831 25 DNA Artificial Sequence Synthetic Sequence 831 ctagtggctg acgtcatcaa gctag 25 832 20 DNA Artificial Sequence Synthetic Sequence 832 tccaccacgt ggtctatgct 20 833 24 DNA Artificial Sequence Synthetic Sequence 833 gggaatgaaa gattttatta taag 24 834 26 DNA Artificial Sequence Synthetic Sequence 834 tctaaaaacc atctattctt aaccct 26 835 15 DNA Artificial Sequence Synthetic Sequence 835 agctcaacgt catgc 15 836 24 DNA Artificial Sequence Synthetic Sequence 836 ttaacggtgg tagcggtatt ggtc 24 837 24 DNA Artificial Sequence Synthetic Sequence 837 ttaagaccaa taccgctacc accg 24 838 25 DNA Artificial Sequence Synthetic Sequence 838 gatctagtga tgagtcagcc ggatc 25 839 25 DNA Artificial Sequence Synthetic Sequence 839 gatccggctg actcatcact agatc 25 840 20 DNA Artificial Sequence Synthetic Sequence 840 tccaagacgt tcctgatgct 20 841 20 DNA Artificial Sequence Synthetic Sequence 841 tccatgacgt ccctgatgct 20 842 20 DNA Artificial Sequence Synthetic Sequence 842 tccaccacgt ggctgatgct 20 843 17 DNA Artificial Sequence Synthetic Sequence 843 ccacgtggac ctctagc 17 844 27 DNA Artificial Sequence Synthetic Sequence 844 tcagaccacg tggtcgggtg ttcctga 27 845 27 DNA Artificial Sequence Synthetic Sequence 845 tcaggaacac ccgaccacgt ggtctga 27 846 18 DNA Artificial Sequence Synthetic Sequence 846 catttccacg atttccca 18 847 19 DNA Artificial Sequence Synthetic Sequence 847 ttcctctctg caagagact 19 848 19 DNA Artificial Sequence Synthetic Sequence 848 tgtatctctc tgaaggact 19 849 25 DNA Artificial Sequence Synthetic Sequence 849 ataaagcgaa actagcagca gtttc 25 850 25 DNA Artificial Sequence Synthetic Sequence 850 gaaactgctg ctagtttcgc tttat 25 851 30 DNA Artificial Sequence Synthetic Sequence 851 tgcccaaaga ggaaaatttg tttcatacag 30 852 30 DNA Artificial Sequence Synthetic Sequence 852 ctgtatgaaa caaattttcc tctttgggca 30 853 20 DNA Artificial Sequence Synthetic Sequence 853 ttagggttag ggttagggtt 20 854 20 DNA Artificial Sequence Synthetic Sequence 854 tccatgagct tcctgatgct 20 855 20 DNA Artificial Sequence Synthetic Sequence 855 aaaacatgac gttcaaaaaa 20 856 20 DNA Artificial Sequence Synthetic Sequence 856 aaaacatgac gttcgggggg 20 857 20 DNA Artificial Sequence Synthetic Sequence 857 ggggcatgag cttcgggggg 20 858 24 DNA Artificial Sequence Synthetic Sequence 858 ctaggctgac gtcatcaagc tagt 24 859 30 DNA Artificial Sequence Synthetic Sequence 859 tctgacgtca tctgacgttg gctgacgtct 30 860 25 DNA Artificial Sequence Synthetic Sequence 860 ggaattagta atagatatag aagtt 25 861 30 DNA Artificial Sequence Synthetic Sequence 861 tttacctttt ataaacataa ctaaaacaaa 30 862 15 DNA Artificial Sequence Synthetic Sequence 862 gcgttttttt ttgcg 15 863 24 DNA Artificial Sequence Synthetic Sequence 863 atatctaatc aaaacattaa caaa 24 864 24 DNA Artificial Sequence Synthetic Sequence 864 tctatcccag gtggttcctg ttag 24 865 20 DNA Artificial Sequence misc_feature (1)...(3) Conjugated to biotin moiety. 865 tccatgacgt tcctgatgct 20 866 20 DNA Artificial Sequence misc_feature (1)...(3) Conjugated to biotin moiety. 866 tccatgagct tcctgatgct 20 867 13 DNA Artificial Sequence misc_feature (11)...(13) Conjugated to FITC moiety. 867 tttttttttt ttt 13 868 13 DNA Artificial Sequence misc_feature (11)...(13) Conjugated to biotin moiety. 868 tttttttttt ttt 13 869 25 DNA Artificial Sequence Synthetic Sequence 869 ctagcttgat gagctcagcc gctag 25 870 25 DNA Artificial Sequence Synthetic Sequence 870 ttcagttgtc ttgctgctta gctaa 25 871 20 DNA Artificial Sequence Synthetic Sequence 871 tccatgagct tcctgagtct 20 872 25 DNA Artificial Sequence Synthetic Sequence 872 ctagcggctg acgtcatcaa tctag 25 873 20 DNA Artificial Sequence Synthetic Sequence 873 tgctagctgt gcctgtacct 20 874 23 DNA Artificial Sequence Synthetic Sequence 874 atgctaaagg acgtcacatt gca 23 875 23 DNA Artificial Sequence Synthetic Sequence 875 tgcaatgtga cgtcctttag cat 23 876 31 DNA Artificial Sequence Synthetic Sequence 876 gtaggggact ttccgagctc gagatcctat g 31 877 31 DNA Artificial Sequence Synthetic Sequence 877 cataggatct cgagctcgga aagtccccta c 31 878 22 DNA Artificial Sequence Synthetic Sequence 878 ctgtcaggaa ctgcaggtaa gg 22 879 27 DNA Artificial Sequence Synthetic Sequence 879 cataacatag gaatatttac tcctcgc 27 880 21 DNA Artificial Sequence Synthetic Sequence 880 ctccagctcc aagaaaggac g 21 881 21 DNA Artificial Sequence Synthetic Sequence 881 gaagtttctg gtaagtcttc g 21 882 24 DNA Artificial Sequence Synthetic Sequence 882 tgctgctttt gtgcttttgt gctt 24 883 24 DNA Artificial Sequence Synthetic Sequence 883 tcgtcgtttt gtggttttgt ggtt 24 884 23 DNA Artificial Sequence Synthetic Sequence 884 tcgtcgtttg tcgttttgtc gtt 23 885 22 DNA Artificial Sequence Synthetic Sequence 885 tcctgacgtt cggcgcgcgc cc 22 886 24 DNA Artificial Sequence Synthetic Sequence 886 tgctgctttt gtgcttttgt gctt 24 887 20 DNA Artificial Sequence Synthetic Sequence 887 tccatgagct tcctgagctt 20 888 24 DNA Artificial Sequence Synthetic Sequence 888 tcgtcgtttc gtcgttttga cgtt 24 889 26 DNA Artificial Sequence Synthetic Sequence 889 tcgtcgtttg cgtgcgtttc gtcgtt 26 890 27 DNA Artificial Sequence Synthetic Sequence 890 tcgcgtgcgt tttgtcgttt tgacgtt 27 891 25 DNA Artificial Sequence Synthetic Sequence 891 ttcgtcgttt tgtcgttttg tcgtt 25 892 15 DNA Artificial Sequence Synthetic Sequence 892 tcctgacggg gaagt 15 893 15 DNA Artificial Sequence Synthetic Sequence 893 tcctggcgtg gaagt 15 894 15 DNA Artificial Sequence Synthetic Sequence 894 tcctggcggt gaagt 15 895 15 DNA Artificial Sequence Synthetic Sequence 895 tcctggcgtt gaagt 15 896 15 DNA Artificial Sequence Synthetic Sequence 896 tcctgacgtg gaagt 15 897 20 DNA Artificial Sequence Synthetic Sequence 897 gcgacgttcg gcgcgcgccc 20 898 20 DNA Artificial Sequence Synthetic Sequence 898 gcgacgggcg gcgcgcgccc 20 899 20 DNA Artificial Sequence Synthetic Sequence 899 gcggcgtgcg gcgcgcgccc 20 900 20 DNA Artificial Sequence Synthetic Sequence 900 gcggcggtcg gcgcgcgccc 20 901 20 DNA Artificial Sequence Synthetic Sequence 901 gcgacggtcg gcgcgcgccc 20 902 20 DNA Artificial Sequence Synthetic Sequence 902 gcggcgttcg gcgcgcgccc 20 903 20 DNA Artificial Sequence Synthetic Sequence 903 gcgacgtgcg gcgcgcgccc 20 904 15 DNA Artificial Sequence Synthetic Sequence 904 tcgtcgctgt ctccg 15 905 20 DNA Artificial Sequence Synthetic Sequence 905 tgtgggggtt ttggttttgg 20 906 20 DNA Artificial Sequence Synthetic Sequence 906 aggggagggg aggggagggg 20 907 21 DNA Artificial Sequence Synthetic Sequence 907 tgtgtgtgtg tgtgtgtgtg t 21 908 22 DNA Artificial Sequence Synthetic Sequence 908 ctctctctct ctctctctct ct 22 909 20 DNA Artificial Sequence Synthetic Sequence 909 ggggtcgacg tcgagggggg 20 910 22 DNA Artificial Sequence Synthetic Sequence 910 atatatatat atatatatat at 22 911 27 DNA Artificial Sequence Synthetic Sequence 911 tttttttttt tttttttttt ttttttt 27 912 21 DNA Artificial Sequence Synthetic Sequence 912 tttttttttt tttttttttt t 21 913 18 DNA Artificial Sequence Synthetic Sequence 913 tttttttttt tttttttt 18 914 15 DNA Artificial Sequence Synthetic Sequence 914 gctagagggg agggt 15 915 15 DNA Artificial Sequence Synthetic Sequence 915 gctagatgtt agggg 15 916 15 DNA Artificial Sequence Synthetic Sequence 916 gcatgagggg gagct 15 917 20 DNA Artificial Sequence Synthetic Sequence 917 atggaaggtc cagggggctc 20 918 20 DNA Artificial Sequence Synthetic Sequence 918 atggactctg gagggggctc 20 919 20 DNA Artificial Sequence Synthetic Sequence 919 atggaaggtc caaggggctc 20 920 20 DNA Artificial Sequence Synthetic Sequence 920 gagaaggggg gaccttggat 20 921 20 DNA Artificial Sequence Synthetic Sequence 921 gagaaggggg gaccttccat 20 922 20 DNA Artificial Sequence Synthetic Sequence 922 gagaaggggc cagcactgat 20 923 20 DNA Artificial Sequence Synthetic Sequence 923 tccatgtggg gcctgatgct 20 924 20 DNA Artificial Sequence Synthetic Sequence 924 tccatgaggg gcctgatgct 20 925 20 DNA Artificial Sequence Synthetic Sequence 925 tccatgtggg gcctgctgat 20 926 20 DNA Artificial Sequence Synthetic Sequence 926 atggactctc cggggttctc 20 927 20 DNA Artificial Sequence Synthetic Sequence 927 atggaaggtc cggggttctc 20 928 20 DNA Artificial Sequence Synthetic Sequence 928 atggactctg gaggggtctc 20 929 20 DNA Artificial Sequence Synthetic Sequence 929 atggaggctc catggggctc 20 930 20 DNA Artificial Sequence Synthetic Sequence 930 atggactctg gggggttctc 20 931 20 DNA Artificial Sequence Synthetic Sequence 931 tccatgtggg tggggatgct 20 932 20 DNA Artificial Sequence Synthetic Sequence 932 tccatgcggg tggggatgct 20 933 20 DNA Artificial Sequence Synthetic Sequence 933 tccatggggg tcctgatgct 20 934 20 DNA Artificial Sequence Synthetic Sequence 934 tccatggggt ccctgatgct 20 935 20 DNA Artificial Sequence Synthetic Sequence 935 tccatggggt gcctgatgct 20 936 20 DNA Artificial Sequence Synthetic Sequence 936 tccatggggt tcctgatgct 20 937 20 DNA Artificial Sequence Synthetic Sequence 937 tccatcgggg gcctgatgct 20 938 14 DNA Artificial Sequence Synthetic Sequence 938 gctagaggga gtgt 14 939 18 DNA Artificial Sequence Synthetic Sequence 939 tttttttttt tttttttt 18 940 21 DNA Artificial Sequence misc_difference (2)...(2) m is a or c 940 gmggtcaacg ttgagggmgg g 21 941 21 DNA Artificial Sequence Synthetic Sequence 941 ggggagttcg ttgagggggg g 21 942 20 DNA Artificial Sequence Synthetic Sequence 942 tcgtcgtttc cccccccccc 20 943 25 DNA Artificial Sequence Synthetic Sequence 943 ttggggggtt tttttttttt ttttt 25 944 23 DNA Artificial Sequence Synthetic Sequence 944 tttaaatttt aaaatttaaa ata 23 945 24 DNA Artificial Sequence Synthetic Sequence 945 ttggtttttt tggttttttt ttgg 24 946 24 DNA Artificial Sequence Synthetic Sequence 946 tttccctttt ccccttttcc cctc 24 947 21 DNA Artificial Sequence misc_difference (21)...(21) s is g or c 947 ggggtcatcg atgagggggg s 21 948 20 DNA Artificial Sequence Synthetic Sequence 948 tccatgacgt tcctgacgtt 20 949 20 DNA Artificial Sequence Synthetic Sequence 949 tccatgacgt tcctgacgtt 20 950 20 DNA Artificial Sequence Synthetic Sequence 950 tccatgacgt tcctgacgtt 20 951 20 DNA Artificial Sequence Synthetic Sequence 951 tccatgacgt tcctgacgtt 20 952 20 DNA Artificial Sequence Synthetic Sequence 952 tccatgacgt tcctgacgtt 20 953 20 DNA Artificial Sequence Synthetic Sequence 953 tccatgacgt tcctgacgtt 20 954 20 DNA Artificial Sequence Synthetic Sequence 954 tccatgacgt tcctgacgtt 20 955 20 DNA Artificial Sequence Synthetic Sequence 955 tccatgacgt tcctgacgtt 20 956 20 DNA Artificial Sequence Synthetic Sequence 956 tccatgacgt tcctgacgtt 20 957 20 DNA Artificial Sequence Synthetic Sequence 957 tccatgacgt tcctgacgtt 20 958 20 DNA Artificial Sequence Synthetic Sequence 958 tccatgacgt tcctgacgtt 20 959 19 DNA Artificial Sequence Synthetic Sequence 959 gggggacgat cgtcggggg 19 960 20 DNA Artificial Sequence Synthetic Sequence 960 gggggtcgta cgacgggggg 20 961 24 DNA Artificial Sequence Synthetic Sequence 961 tttttttttt tttttttttt tttt 24 962 24 DNA Artificial Sequence Synthetic Sequence 962 aaaaaaaaaa aaaaaaaaaa aaaa 24 963 24 DNA Artificial Sequence Synthetic Sequence 963 cccccccccc cccccccccc cccc 24 964 24 DNA Artificial Sequence Synthetic Sequence 964 tcgtcgtttt gtcgttttgt cgtt 24 965 24 DNA Artificial Sequence Synthetic Sequence 965 tcgtcgtttt gtcgttttgt cgtt 24 966 24 DNA Artificial Sequence Synthetic Sequence 966 tcgtcgtttt gtcgttttgt cgtt 24 967 24 DNA Artificial Sequence Synthetic Sequence 967 tcgtcgtttt gtcgttttgt cgtt 24 968 20 DNA Artificial Sequence Synthetic Sequence 968 ggggtcaacg ttgagggggg 20 969 20 DNA Artificial Sequence Synthetic Sequence 969 ggggtcaacg ttgagggggg 20 970 20 DNA Artificial Sequence Synthetic Sequence 970 ggggtcaagc ttgagggggg 20 971 20 DNA Artificial Sequence Synthetic Sequence 971 tgctgcttcc cccccccccc 20 972 20 DNA Artificial Sequence Synthetic Sequence 972 ggggacgtcg acgtgggggg 20 973 20 DNA Artificial Sequence Synthetic Sequence 973 ggggtcgtcg acgagggggg 20 974 24 DNA Artificial Sequence Synthetic Sequence 974 ggggtcgacg tacgtcgagg gggg 24 975 22 DNA Artificial Sequence Synthetic Sequence 975 ggggaccggt accggtgggg gg 22 976 19 DNA Artificial Sequence Synthetic Sequence 976 gggtcgacgt cgagggggg 19 977 19 DNA Artificial Sequence Synthetic Sequence 977 ggggtcgacg tcgaggggg 19 978 22 DNA Artificial Sequence Synthetic Sequence 978 ggggaacgtt aacgttgggg gg 22 979 20 DNA Artificial Sequence Synthetic Sequence 979 ggggtcaccg gtgagggggg 20 980 22 DNA Artificial Sequence Synthetic Sequence 980 ggggtcgttc gaacgagggg gg 22 981 22 DNA Artificial Sequence Synthetic Sequence 981 ggggacgttc gaacgtgggg gg 22 982 10 DNA Artificial Sequence Synthetic Sequence 982 tcaactttga 10 983 10 DNA Artificial Sequence Synthetic Sequence 983 tcaagcttga 10 984 12 DNA Artificial Sequence Synthetic Sequence 984 tcacgatcgt ga 12 985 12 DNA Artificial Sequence Synthetic Sequence 985 tcagcatgct ga 12 986 20 DNA Artificial Sequence Synthetic Sequence 986 gggggagcat gctggggggg 20 987 20 DNA Artificial Sequence Synthetic Sequence 987 gggggggggg gggggggggg 20 988 22 DNA Artificial Sequence Synthetic Sequence 988 gggggacgat atcgtcgggg gg 22 989 22 DNA Artificial Sequence Synthetic Sequence 989 gggggacgac gtcgtcgggg gg 22 990 22 DNA Artificial Sequence Synthetic Sequence 990 gggggacgag ctcgtcgggg gg 22 991 20 DNA Artificial Sequence Synthetic Sequence 991 gggggacgta cgtcgggggg 20 992 8 DNA Artificial Sequence Synthetic Sequence 992 tcaacgtt 8 993 20 DNA Artificial Sequence Synthetic Sequence 993 tccataccgg tcctgatgct 20 994 20 DNA Artificial Sequence Synthetic Sequence 994 tccataccgg tcctaccggt 20 995 20 DNA Artificial Sequence Synthetic Sequence 995 gggggacgat cgttgggggg 20 996 20 DNA Artificial Sequence Synthetic Sequence 996 ggggaacgat cgtcgggggg 20 997 21 DNA Artificial Sequence Synthetic Sequence 997 ggggggacga tcgtcggggg g 21 998 21 DNA Artificial Sequence Synthetic Sequence 998 gggggacgat cgtcgggggg g 21 999 12 DNA Artificial Sequence Synthetic Sequence 999 aaagacgtta aa 12 1000 12 DNA Artificial Sequence Synthetic Sequence 1000 aaagagctta aa 12 1001 12 DNA Artificial Sequence modified_base (6)...(6) m5c 1001 aaagangtta aa 12 1002 12 DNA Artificial Sequence Synthetic Sequence 1002 aaattcggaa aa 12 1003 21 DNA Artificial Sequence Synthetic Sequence 1003 gggggtcatc gatgaggggg g 21 1004 21 DNA Artificial Sequence Synthetic Sequence 1004 gggggtcaac gttgaggggg g 21 1005 20 DNA Artificial Sequence Synthetic Sequence 1005 atgtagctta ataacaaagc 20 1006 20 DNA Artificial Sequence Synthetic Sequence 1006 ggatcccttg agttacttct 20 1007 20 DNA Artificial Sequence Synthetic Sequence 1007 ccattccact tctgattacc 20 1008 20 DNA Artificial Sequence Synthetic Sequence 1008 tatgtattat catgtagata 20 1009 20 DNA Artificial Sequence Synthetic Sequence 1009 agcctacgta ttcaccctcc 20 1010 20 DNA Artificial Sequence Synthetic Sequence 1010 ttcctgcaac tactattgta 20 1011 20 DNA Artificial Sequence Synthetic Sequence 1011 atagaaggcc ctacaccagt 20 1012 20 DNA Artificial Sequence Synthetic Sequence 1012 ttacaccggt ctatggaggt 20 1013 20 DNA Artificial Sequence Synthetic Sequence 1013 ctaaccagat caagtctagg 20 1014 20 DNA Artificial Sequence Synthetic Sequence 1014 cctagacttg atctggttag 20 1015 20 DNA Artificial Sequence Synthetic Sequence 1015 tataagcctc gtccgacatg 20 1016 20 DNA Artificial Sequence Synthetic Sequence 1016 catgtcggac gaggcttata 20 1017 20 DNA Artificial Sequence Synthetic Sequence 1017 tggtggtggg gagtaagctc 20 1018 20 DNA Artificial Sequence Synthetic Sequence 1018 gagctactcc cccaccacca 20 1019 20 DNA Artificial Sequence Synthetic Sequence 1019 gccttcgatc ttcgttggga 20 1020 20 DNA Artificial Sequence Synthetic Sequence 1020 tggacttctc tttgccgtct 20 1021 20 DNA Artificial Sequence Synthetic Sequence 1021 atgctgtagc ccagcgataa 20 1022 20 DNA Artificial Sequence Synthetic Sequence 1022 accgaatcag cggaaagtga 20 1023 20 DNA Artificial Sequence Synthetic Sequence 1023 tccatgacgt tcctgacgtt 20 1024 24 DNA Artificial Sequence Synthetic Sequence 1024 ggagaaaccc atgagctcat ctgg 24 1025 20 DNA Artificial Sequence Synthetic Sequence 1025 accacagacc agcaggcaga 20 1026 20 DNA Artificial Sequence Synthetic Sequence 1026 gagcgtgaac tgcgcgaaga 20 1027 20 DNA Artificial Sequence Synthetic Sequence 1027 tcggtaccct tgcagcggtt 20 1028 20 DNA Artificial Sequence Synthetic Sequence 1028 ctggagccct agccaaggat 20 1029 20 DNA Artificial Sequence Synthetic Sequence 1029 gcgactccat caccagcgat 20 1030 21 DNA Artificial Sequence Synthetic Sequence 1030 cctgaagtaa gaaccagatg t 21 1031 21 DNA Artificial Sequence Synthetic Sequence 1031 ctgtgttatc tgacatacac c 21 1032 21 DNA Artificial Sequence Synthetic Sequence 1032 aattagcctt aggtgattgg g 21 1033 21 DNA Artificial Sequence Synthetic Sequence 1033 acatctggtt cttacttcag g 21 1034 23 DNA Artificial Sequence Synthetic Sequence 1034 ataagtcata ttttgggaac tac 23 1035 21 DNA Artificial Sequence Synthetic Sequence 1035 cccaatcacc taaggctaat t 21 1036 20 DNA Artificial Sequence Synthetic Sequence 1036 ggggtcgtcg acgagggggg 20 1037 22 DNA Artificial Sequence Synthetic Sequence 1037 ggggtcgttc gaacgagggg gg 22 1038 22 DNA Artificial Sequence Synthetic Sequence 1038 ggggacgttc gaacgtgggg gg 22 1039 15 DNA Artificial Sequence modified_base (9)...(9) n is 5-methylcytosine. 1039 tcctggcgng gaagt 15 1040 22 DNA Artificial Sequence Synthetic Sequence 1040 ggggaacgac gtcgttgggg gg 22 1041 20 DNA Artificial Sequence Synthetic Sequence 1041 ggggaacgta cgtcgggggg 20 1042 24 DNA Artificial Sequence Synthetic Sequence 1042 ggggaacgta cgtacgttgg gggg 24 1043 20 DNA Artificial Sequence Synthetic Sequence 1043 ggggtcaccg gtgagggggg 20 1044 24 DNA Artificial Sequence Synthetic Sequence 1044 ggggtcgacg tacgtcgagg gggg 24 1045 22 DNA Artificial Sequence Synthetic Sequence 1045 ggggaccggt accggtgggg gg 22 1046 19 DNA Artificial Sequence Synthetic Sequence 1046 gggtcgacgt cgagggggg 19 1047 18 DNA Artificial Sequence Synthetic Sequence 1047 ggggtcgacg tcgagggg 18 1048 22 DNA Artificial Sequence Synthetic Sequence 1048 ggggaacgtt aacgttgggg gg 22 1049 19 DNA Artificial Sequence Synthetic Sequence 1049 ggggacgtcg acgtggggg 19 1050 34 DNA Artificial Sequence Synthetic Sequence 1050 gcactcttcg aagctacagc cggcagcctc tgat 34 1051 32 DNA Artificial Sequence Synthetic Sequence 1051 cggctcttcc atgaggtctt tgctaatctt gg 32 1052 35 DNA Artificial Sequence Synthetic Sequence 1052 cggctcttcc atgaaagtct ttggacgatg tgagc 35 1053 15 DNA Artificial Sequence Synthetic Sequence 1053 tcctgcaggt taagt 15 1054 20 DNA Artificial Sequence Synthetic Sequence 1054 gggggtcgtt cgttgggggg 20 1055 20 DNA Artificial Sequence Synthetic Sequence 1055 gggggatgat tgttgggggg 20 1056 20 DNA Artificial Sequence modified_base (7)...(7) m5c 1056 gggggangat ngttgggggg 20 1057 20 DNA Artificial Sequence Synthetic Sequence 1057 gggggagcta gcttgggggg 20 1058 20 DNA Artificial Sequence Synthetic Sequence 1058 ggttcttttg gtccttgtct 20 1059 20 DNA Artificial Sequence Synthetic Sequence 1059 ggttcttttg gtcctcgtct 20 1060 20 DNA Artificial Sequence Synthetic Sequence 1060 ggttcttttg gtccttatct 20 1061 20 DNA Artificial Sequence Synthetic Sequence 1061 ggttcttggt ttccttgtct 20 1062 20 DNA Artificial Sequence Synthetic Sequence 1062 tggtcttttg gtccttgtct 20 1063 20 DNA Artificial Sequence Synthetic Sequence 1063 ggttcaaatg gtccttgtct 20 1064 20 DNA Artificial Sequence Synthetic Sequence 1064 gggtcttttg ggccttgtct 20 1065 24 DNA Artificial Sequence Synthetic Sequence 1065 tccaggactt ctctcaggtt tttt 24 1066 20 DNA Artificial Sequence Synthetic Sequence 1066 tccaaaactt ctctcaaatt 20 1067 24 DNA Artificial Sequence Synthetic Sequence 1067 tactactttt atacttttat actt 24 1068 24 DNA Artificial Sequence Synthetic Sequence 1068 tgtgtgtgtg tgtgtgtgtg tgtg 24 1069 25 DNA Artificial Sequence Synthetic Sequence 1069 ttgttgttgt tgtttgttgt tgttg 25 1070 27 DNA Artificial Sequence Synthetic Sequence 1070 ggctccgggg agggaatttt tgtctat 27 1071 19 DNA Artificial Sequence Synthetic Sequence 1071 gggacgatcg tcggggggg 19 1072 20 DNA Artificial Sequence Synthetic Sequence 1072 gggtcgtcga cgaggggggg 20 1073 19 DNA Artificial Sequence Synthetic Sequence 1073 ggtcgtcgac gaggggggg 19 1074 20 DNA Artificial Sequence Synthetic Sequence 1074 gggtcgtcgt cgtggggggg 20 1075 20 DNA Artificial Sequence Synthetic Sequence 1075 ggggacgatc gtcggggggg 20 1076 20 DNA Artificial Sequence Synthetic Sequence 1076 ggggacgtcg tcgtgggggg 20 1077 27 DNA Artificial Sequence Synthetic Sequence 1077 ggggtcgacg tcgacgtcga ggggggg 27 1078 21 DNA Artificial Sequence Synthetic Sequence 1078 ggggaaccgc ggttgggggg g 21 1079 21 DNA Artificial Sequence Synthetic Sequence 1079 ggggacgacg tcgtgggggg g 21 1080 23 DNA Artificial Sequence Synthetic Sequence 1080 tcgtcgtcgt cgtcgtgggg ggg 23 1081 15 DNA Artificial Sequence Synthetic Sequence 1081 tcctgccggg gaagt 15 1082 15 DNA Artificial Sequence Synthetic Sequence 1082 tcctgcaggg gaagt 15 1083 15 DNA Artificial Sequence Synthetic Sequence 1083 tcctgaaggg gaagt 15 1084 15 DNA Artificial Sequence Synthetic Sequence 1084 tcctggcggg caagt 15 1085 15 DNA Artificial Sequence Synthetic Sequence 1085 tcctggcggg taagt 15 1086 15 DNA Artificial Sequence Synthetic Sequence 1086 tcctggcggg aaagt 15 1087 15 DNA Artificial Sequence Synthetic Sequence 1087 tccgggcggg gaagt 15 1088 15 DNA Artificial Sequence Synthetic Sequence 1088 tcggggcggg gaagt 15 1089 15 DNA Artificial Sequence Synthetic Sequence 1089 tcccggcggg gaagt 15 1090 15 DNA Artificial Sequence Synthetic Sequence 1090 gggggacgtt ggggg 15 1091 20 DNA Artificial Sequence Synthetic Sequence 1091 ggggtttttt ttttgggggg 20 1092 20 DNA Artificial Sequence Synthetic Sequence 1092 ggggcccccc ccccgggggg 20 1093 21 DNA Artificial Sequence Synthetic Sequence 1093 ggggttgttg ttgttggggg g 21

Claims

We claim:

1-36. (Canceled)

37. A method of suppressing a symptom of an allergic response in a subject, the method comprising: administering to the subject a first dose of an immunostimulatory nucleic acid; and administering to the subject a second dose of an immunostimulatory nucleic acid, wherein the immunostimulatory nucleic acid comprises a nucleotide sequence comprising 5′-CG-3′, and wherein the second dose is administered from about 1 day to about 8 weeks after the first dose.

38. The method of claim 37, wherein the second dose is administered from about 1 day to about 7 days after the first dose.

39. The method of claim 37, wherein the second dose is administered from about 1 week to about 2 weeks after the first dose.

40. The method of claim 37, wherein the second dose is administered from about 2 weeks to about 4 weeks after the first dose.

41. The method of claim 37, wherein the first dose is co-administered with an antigen.

42. The method of claim 37, wherein the second dose is co-administered with an antigen.

43. The method of claim 37, wherein the first dose and second dose are co-administered with an antigen.

44. The method of claim 37, wherein the subject is a human.

45. The method of claim 37, wherein the first and the second doses are administered by inhalation.

46. A method for maintaining suppression of a Th2 immune response in a subject, the method comprising: administering to a subject a first dose of an immunostimulatory nucleic acid; and administering to the subject a second dose of an immunostimulatory nucleic acid, wherein the immunostimulatory nucleic acid comprises a nucleotide sequence comprising 5′-CG-3′, and wherein the second dose is administered from about 1 day to about 8 weeks after the first dose.

47. The method of claim 46, wherein the second dose is administered from about 1 day to about 7 days after the first dose.

48. The method of claim 46, wherein the second dose is administered from about 1 week to about 2 weeks after the first dose.

49. The method of claim 46, wherein the second dose is administered from about 2 weeks to about 4 weeks after the first dose.

50. The method of claim 46, wherein the subject is a human.

51. The method of claim 46, wherein the first and the second doses are administered by inhalation.

52. A method for maintaining stimulation of a Th1 immune response in a subject, the method comprising: administering to a subject a first dose of an immunostimulatory nucleic acid; and administering to the subject a second dose of an immunostimulatory nucleic acid, wherein the immunostimulatory nucleic acid comprises a nucleotide sequence comprising 5′-CG-3′, and wherein the second dose is administered from about 1 day to about 8 weeks after the first dose.

53. The method of claim 52, wherein the second dose is administered from about 1 day to about 7 days after the first dose.

54. The method of claim 52, wherein the second dose is administered from about 1 week to about 2 weeks after the first dose.

55. The method of claim 52, wherein the second dose is administered from about 2 weeks to about 4 weeks after the first dose.

56. The method of claim 52, wherein the subject is a human.