US20050118585A1 - Bone morphogenic proteins (bmp),bmp receptors and bmp binding proteins and their use in the diagnosis and treatment of glaucoma - Google Patents

Bone morphogenic proteins (bmp),bmp receptors and bmp binding proteins and their use in the diagnosis and treatment of glaucoma Download PDF

Info

Publication number
US20050118585A1
US20050118585A1 US10/492,380 US49238004A US2005118585A1 US 20050118585 A1 US20050118585 A1 US 20050118585A1 US 49238004 A US49238004 A US 49238004A US 2005118585 A1 US2005118585 A1 US 2005118585A1
Authority
US
United States
Prior art keywords
bmp
seq
glaucoma
cells
human
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US10/492,380
Inventor
Abbot Clark
Robert Wordinger
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Alcon Inc
University of North Texas Health Science Center
Original Assignee
Alcon Inc
University of North Texas Health Science Center
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Alcon Inc, University of North Texas Health Science Center filed Critical Alcon Inc
Priority to US10/492,380 priority Critical patent/US20050118585A1/en
Assigned to UNIVERSITY OF NORTH TEXAS HEALTH SCIENCE CENTER reassignment UNIVERSITY OF NORTH TEXAS HEALTH SCIENCE CENTER ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: WORDINGER, ROBERT J.
Assigned to ALCON, INC. reassignment ALCON, INC. ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: CLARK, ABBOT F.
Assigned to UNIVERSITY OF NORTH TEXAS HEALTH SCIENCE CENTER reassignment UNIVERSITY OF NORTH TEXAS HEALTH SCIENCE CENTER ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: WORDINGER, ROBERT J.
Assigned to ALCON, INC. reassignment ALCON, INC. ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: CLARK, ABBOT F.
Publication of US20050118585A1 publication Critical patent/US20050118585A1/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/1703Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/1703Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • A61K38/1709Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/502Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing non-proliferative effects
    • G01N33/5023Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing non-proliferative effects on expression patterns
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P27/00Drugs for disorders of the senses
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P27/00Drugs for disorders of the senses
    • A61P27/02Ophthalmic agents
    • A61P27/06Antiglaucoma agents or miotics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/502Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing non-proliferative effects
    • G01N33/5041Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing non-proliferative effects involving analysis of members of signalling pathways
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6893Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/158Expression markers
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/475Assays involving growth factors
    • G01N2333/51Bone morphogenetic factor; Osteogenins; Osteogenic factor; Bone-inducing factor

Definitions

  • the present invention discloses methods and reagents for diagnosing and treating glaucoma and related disorders.
  • Glaucomas are a group of debilitating eye diseases that are the leading cause of irreversible blindness in the United States and other developed countries.
  • POAG Primary Open Angle Glaucoma
  • a characteristic of such obstruction in this disease is an increased intraocular pressure (“IOP”), resulting in progressive visual loss and blindness if not treated appropriately and in a timely fashion.
  • the disease is estimated to affect between 0.4% and 3.3% of all adults over 40 years old (Leske, M. C. et al. (1986); Bengtsson, B. (1989); Strong, N. P. (1992)). Moreover, the prevalence of the disease rises with age to over 6% of those 75 years or older (Strong, N. P., (1992)).
  • Glaucoma affects three separate tissues in the eye.
  • the elevated IOP associated with POAG is due to morphological and biochemical changes in the trabecular meshwork (TM), a tissue located at the angle between the cornea and iris.
  • TM trabecular meshwork
  • the progressive loss of TM cells and the build-up of extracellular debris in the TM of glaucomatous eyes leads to increased resistance to aqueous outflow (Lutjen-Drecoll and Rohen 1996; Rohen 1983; Rohen et al. 1993; Grierson and Calthorpe 1988), thereby raising IOP.
  • Elevated IOP causes degenerative changes in the optic nerve head (ONH) leading to progressive “cupping” of the ONH (Varma and Minckler 1996; Hernandez and Gong 1996; Hernandez et al. 1990; Hernandez and Pena 1997; Morrison et al. 1990) and loss of retinal ganglion cells (Quigley et al. 2000; Quigley 1999; Quigley et al. 1995; Kerrigan et al. 1997) and axons.
  • the detailed molecular mechanisms responsible for glaucomatous damage to the TM, ONH, and the retinal ganglion cells are unknown.
  • Glaucoma therapy is directed to lowering IOP, a major risk factor for the development and progression of glaucoma.
  • These therapies lower IOP, but they do not directly address the pathogenic mechanisms, and the disease continues to progress.
  • At least half of patients with glaucoma are undiagnosed, and by the time patients are diagnosed with glaucoma, they have already lost approximately 40% of their retinal ganglion cells. Therefore, methods for earlier detection and diagnosis of glaucoma are needed.
  • the present invention overcomes these and other drawbacks of the prior art by providing methods and kits for the early diagnosis of glaucoma, for treating glaucoma, and for the identification of compounds useful in the treatment of glaucoma.
  • the invention provides a method for diagnosing glaucoma in a sample obtained from a cell or bodily fluid by detecting altered expression of a bone morphogenic protein family member gene.
  • the method generally includes the steps of:
  • the methods of the invention may include obtaining a sample from an individual and extracting DNA from said sample. Select PCR primers for specific members of the BMP gene family are then used to amplify relevant regions of the extracted gene to obtain a PCR product.
  • the PCR product is resolved by a technique that effectively identifies DNA sequence differences between the normal and mutated form of the specific BMP family gene being evaluated (the extracted DNA). Identified differences between the sequences are indicative of glaucoma.
  • tissue or fluid sample for use in the methods of the invention may be blood or buccal cells.
  • the primer sequences will have a length of between about 10, 15 or 18 nucleotides to about 20, or to about 30 nucleotides. Longer sequences, e.g., 40, 50, 80, 90, 95, 100, even up to full length, are even more preferred for certain embodiments. Lengths of oligonucleotides of at least about 18 to 20 nucleotides are well accepted by those of skill in the art as sufficient to allow sufficiently specific hybridization so as to be useful as a molecular probe, as described by Lathe (1985), which reference is specifically incorporated herein by reference for this purpose.
  • the nucleotide sequence will consist of from 20 to 100 contiguous nucleotides of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:37, SEQ ID NO:39, SEQ ID NO:41, SEQ ID NO:43, SEQ ID NO:45, SEQ ID NO:47, or SEQ ID NO:53. It is also contemplated that the primer sequences may consist of sequences of at least 10, 15 or 18 contiguous nucleotides from the sequences of BMP receptor genes and from BMP-associated proteins, the sequences of which are known.
  • SEQ ID NO:43, SEQ ID NO:45, SEQ ID NO:47, or SEQ ID NO:53 have utility as hybridization probes.
  • Primers or probes having a nucleotide length of about 18 nucleotides are recognized by those of skill in the art to provide highly specific hybridization to a target sequence.
  • the total size of the fragment, as well as the size of the complementary stretches, will ultimately depend on the intended use of application of the particular nucleic acid segment. Smaller fragments will generally find use in hybridization embodiments, wherein the length of the complementary region may be varied, such as between about 10, 18, 20 or 30 and about 50, 60, 70, 80, 80 or 100 nucleotides, or even is full length according to the complementary sequences one wishes to detect.
  • the primers will consist of contiguous sequences from SEQ ID NO: 1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:37, SEQ ID NO:39, SEQ ID NO:41, SEQ ID NO:43, SEQ ID NO:45, SEQ ID NO:47, or SEQ ID NO:53.
  • the primers will consist of contiguous sequences from BMP receptor genes (disclosed in ten Dijke et al. 1993; Astrom et al. 1999; Nohno et al.
  • the primers will consist of contiguous sequence from SEQ ID NO:3. In certain aspects, at least some of the primers may further include a detectable label.
  • the invention provides a method for treating glaucoma by administering to a patient in need thereof a composition comprising a sequence consisting of at least one compound selected from the group consisting of a BMP2 agonist, a BMP4 agonist, a BMP5 agonist, a BMP7 agonist, a Smad 1 ⁇ 5 agonist, a chordin antagonist, a gremlin antagonist and a follistatin antagonist.
  • the present invention provides a method for identifying a therapeutic agent for the treatment of glaucoma.
  • Therapeutic agents may be identified, for example, by:
  • diagnostic kits containing sequences of the present invention and suitable reagents such as a detectable label linked to a protein, peptide or the antibody itself.
  • suitable reagents such as a detectable label linked to a protein, peptide or the antibody itself.
  • the detectable label may be linked to a second sequence which selectively hybridizes to a sequence of the invention.
  • kits which include pharmaceutically-acceptable formulations of either the nucleic acid sequences or peptide or protein sequences disclosed herein. Such kits are useflul in the detection of altered expression of the BMP genes and proteins in clinical samples for the diagnosis of glaucoma.
  • FIG. 1 Nucleotide and amino acid sequence of BMP2A.
  • FIG. 2 Nucleotide and amino acid sequence of BMP4.
  • FIG. 3 Nucleotide and amino acid sequence of BMP5.
  • FIG. 4 Nucleotide and amino acid sequence of BMP7.
  • FIG. 5 Bone morphogenic protein signaling pathway.
  • Bone Morphogenic Protein (BMP) dimers bind to a membrane complex composed of BMP receptors 1 and 2, which are serin/threonine kinases.
  • the regulatory Smads (Smad1/Smad5) become phosphorylated and associate with a co-Smad (Smad 4).
  • Smad 4 This resulting Smad complex enters the nucleus where it associates with transcription factors (TF) and regulates gene expression.
  • BMP associated proteins act as BMP antagonists by binding BMPs and preventing BMP interaction with BMP receptors.
  • FIG. 12 Western immunoblot of BMP and BMP receptor expression in cultured human TM cells, optic nerve head astrocytes (ONA), and lamina cribrosa cells. Chemiluminescent detection of BMP proteins and BMP receptors in human trabecular meshwork cells (lanes 1-2), ONH astrocytes (lanes 3-4), and lamina cribrosa cells (lanes 5-6). Protein size indicated in kDa.
  • FIG. 15 Illustrates increased expression of the BMP antagonist gremlin (CKTSF1B1) in glaucomatous TM cells. Gene expression was assessed using Affymetrix gene arrays (Affymetrix gene chip U133A).
  • HTM cells Human trabecular meshwork (HTM) cells are specialized cells which line the outflow channels by which aqueous humor exits the eye. Altered synthetic function of the cells may be involved in the pathogenesis of POAG, steroid glaucoma, and other types of glaucoma.
  • growth factors may be important in maintaining normal homeostasis in the ocular tissues associated with glaucoma, and alterations in growth factor/growth factor receptors may play a role in glaucoma pathogenesis.
  • Growth factors area very large family of polypeptides that control cell growth and differentiation. These molecules have a variety of cell-specific effects on gene expression, extracellular matrix composition and deposition, cytoskeletal organization, and regulation of cellular functions.
  • the TM expresses a wide variety of growth factors, growth factor receptors (Tripathi et al. 1993a; Tripathi et al. 1993b; Tripathi et al.
  • aqueous humor also contains a variety of growth factors including FGF2, EGF, TGF ⁇ , HGF (Tripathi et al. 1996; Tripathi et al. 1991; Tripathi et al.
  • the present invention stems in part from the recognition that bone morphogenic proteins (BMPs) not only induce bone and cartilage formation but are multifunctional cytokines having a wide range of effects on numerous cell types (Hogan 1996; Reddi 1997) and are expressed by both human trabecular meshwork (HTM) and optic nerve head (ONH) cells (Wordinger et al. 2002).
  • BMPs are members of the TGFP superfamily, and there are approximately 15-20 BMPs genes in man, 3 BMP receptors, and a number of BMP associated proteins that function as BMP antagonists (Yamashita et al. 1996).
  • BMPs signal via a receptor complex consisting of BMPR-I and BMPR-II.
  • BMPs and BMP receptors are expressed in ocular tissues (Obata et al. 1999; You et al. 1999), but previous reports have focused on ocular development.
  • the function of BMPs is important in ocular development since targeted disruption of genes encoding BMPs in mice leads to severe developmental defects in the retina and the lens (Jena et al. 1997; Luo et al. 1995; Dudley et al. 1995).
  • BMP-2, BMP-4 and BMP-7 are involved in the development of the lens and retina (Jena et al. 1997; Furuta and Hogan 1998; Reddi 2000; Trousse et al. 2001).
  • BMP-6 and BMP-7 also appear to play a role in protecting neurons from hypoglycemic or ischemic damage (Nonner et al. 2001; Liu et al. 2001), and BMP2 has been shown to enhance ganglion cell neurotrophin expression (Zhang et al. 1998). Heterozygous knock-out mice haploinsufficient for Bmp4 have ocular phenotypes including anterior segment dysgenesis, elevated IOP, and optic nerve abnormalities (Chang et al. 2001). There has been very limited information published concerning the role of BMPs in the human postnatal eye.
  • BMP-2 and BMP-4 and BMP receptors were expressed in cells of the adult cornea and suggested that BMP function might include corneal keratocyte proliferation and apoptosis.
  • You and colleagues (1999) verified this study and also reported the expression of BMP-3, BMP-5, and BMP-7 in ex vivo and cultured corneal epithelium and stromal cells. They reported that the level of BMP transcription was higher in the stroma while the level for receptors was higher in cultured corneal epithelial cells.
  • the present inventors discovered mRNAs for BMPs, BMP receptors BMPR-IA, BMPR-IB and BMPR-II, as well as BMP binding proteins gremlin, chordin, follistatin, and banbi, in HTM, lamina cribosa (LC) and ONH astrocyte cell lines and tissues (Wordinger et al. 2002).
  • the present inventors further discovered that HTM and ONH cells express proteins BMP-2, BMP-4, BMP-5 and BMP-7.
  • Glaucoma will be diagnosed by characterization of genetic changes in genes of members of the BMP signaling family.
  • the phrases “bone morphogenic protein family member gene” and “BMP signaling family” refer to all BMPs, BMP receptors and associated proteins.
  • the term “genetic changes” is well known by those skilled in the art. There are numerous examples of diseases associated with genetic changes in specific genes (for examples see Cummings 1997; Strachan, et al. 1996; Jorde, et al. 1999). Genetic changes in a specific gene (e.g.
  • BMP can be determined using a variety of techniques well known by those skilled in the art, such as: SSCP, DGGE, ASO, RFLP, heteroduplex analysis, CCM, PTT, and RNase cleavage (see Birren, et al. 1998).
  • Glaucoma may be caused by altered expression of one or more BMP family genes in the eye, which leads to elevated IOP and/or glaucomatous optic neuropathy.
  • altered BMP gene expression means expression of this gene product that is different from normal. The term may also refer to alterations in the sequence of the gene or protein. The normal BMP gene has been well characterized (see above), and the expression of BMP has been reported in a variety of tissues including the TM and ONH. Genetic changes in the coding region of BMP family genes may alter the function of these proteins. Genetic changes outside the coding region may also lead to glaucoma.
  • the region upstream (5′) of the coding region of most genes is known as the promoter region which “promotes” and regulates the expression of that gene.
  • the promoter region contains numerous nucleotide sequences recognized by various transcription factors and DNA binding proteins that are responsible for activation or repression of gene expression. Regions downstream (3′) of the gene can determine poly-adenylation of the gene product, thereby regulating RNA processing and translation of the gene product.
  • BMP genes or mutations in the sequence of the genes that is indicative of glaucoma may be detected using techniques well known to those of skill in the art.
  • a nucleic acid fragment of almost any length may be employed, with the total length preferably being limited by the ease of preparation and use in the intended protocol.
  • the nucleic acid sequences disclosed herein may also have utility as probes or primers in nucleic acid hybridization embodiments.
  • nucleic acid segments that comprise a sequence region that consists of at least a 14 nucleotide long contiguous sequence that has the same sequence as, or is complementary to, a 14 nucleotide long contiguous sequence of BMP-2A (SEQ ID NO:1), BMP-4 (SEQ ID NO:3), BMP-5 (SEQ ID NO:5), BMP-7 (SEQ ID NO:7), BMP-RIA (SEQ ID NO:37), BMP-RIB (SEQ ID NO:39), BMP-RH (SEQ ID NO:41), chordin (SEQ ID NO:43), gremlin (SEQ ID NO:45), follistatin (SEQ ID NO:47), or bambi (SEQ ID NO:53) will find particular utility.
  • BMP-2A SEQ ID NO:1
  • BMP-4 SEQ ID NO:3
  • BMP-5 SEQ ID NO:5
  • BMP-7 SEQ ID NO:7
  • BMP-RIA SEQ ID NO:37
  • Longer contiguous identical or complementary sequences e.g., those of about 20, 30, 40, 50, 100, 200, 500, 1000 nucleotides (including all intermediate lengths), and even up to full length sequences of about 1547 nucleotides (for BMP-2A), 1946 nucleotides (for BMP-4), 2153 nucleotides (for BMP-5) and 1878 nucleotides (for BMP-7), 2932 nucleotides (for BMP-RIA), 2032 nucleotides (for BMP-RIB), 3611 nucleotides (for BMP-RII), 3561 nucleotides (for chordin), 4049 nucleotides (for gremlin), 1386 nucleotides (for follistatin), and 1523 nucleotides (for bambi) will also be of use in certain embodiments.
  • intermediate lengths means any length between the quoted ranges, such as 14, 15, 16, 17, 18, 19, 20, etc.; 21, 22, 23, etc.; 30, 31, 32, etc.; 50, 51, 52, 53, etc.; 100, 101, 102, 103, etc.; 150, 151, 152, 153, etc.; including all integers through the 200-500; 500-1,000; 1,000-2,000 ranges, up to and including sequences of 2,001, 2002, 2050, 2051, and the like.
  • nucleic acid probes and primers to specifically hybridize to BMP coding sequences and primers to specifically amplify BMP sequences will enable them to be of use in detecting the presence of complementary sequences in a given sample.
  • sequence information for the preparation of mutant species primers, or primers for use in preparing other genetic constructions.
  • Nucleic acid molecules having sequence regions consisting of contiguous nucleotide stretches of 10, 20, 30, 50, or even of 100-200 nucleotides or so, identical or complementary to BMP-2A (SEQ ID NO:1), BMP4 (SEQ ID NO:3), BMP-5 (SEQ ID NO:5), BMP7 (SEQ ID NO:7), BMP-RIA (SEQ ID NO:37), BMP-RIB (SEQ ID NO:39), BMP-RII (SEQ ID NO:41), chordin (SEQ ID NO:43), gremlin (SEQ ID NO:45), follistatin (SEQ ID NO:47), or bambi (SEQ ID NO:53) are particularly contemplated as hybridization probes for use in, e.g., SNP evaluation and solid phase hybridization assays, in addition to Southern and northern blotting.
  • the total size of fragment, as well as the size of the complementary stretch(es), will ultimately depend on the intended use of application of the particular nucleic acid segment. Smaller fragments will generally find use in hybridization embodiments, wherein the length of the contiguous complementary region may be varied, such as between about 10 and about 100 nucleotides, but larger contiguous complementary stretches of up to about 1547 nucleotides (for BMP-2A), 1946 nucleotides (for BMP-4), 2153 nucleotides (for BMP-5) and 1878 nucleotides (for BMP-7), 2932 nucleotides (for BMP-RIA), 2032 nucleotides (for BMP-RIB), 3611 nucleotides (for BMP-RII), 3561 nucleotides (for chordin), 4049 nucleotides (for gremlin), 1386 nucleotides (for follistatin), and 1523 nucleotides (for BMP-2A), 1946 nucleotides (for
  • hybridization probe of about 10-14 nucleotides in length allows the formation of a duplex molecule that is both stable and selective.
  • Molecules having contiguous complementary sequences over stretches greater than 10 bases in length are generally preferred, though, in order to increase stability and selectivity of the hybrid, and thereby improve the quality and degree of specific hybrid molecules obtained, one will generally prefer to design nucleic acid molecules having gene-complementary stretches of 15 to 20 contiguous nucleotides, or even longer where desired.
  • Hybridization probes may be selected from any portion of any of the sequences disclosed herein. All that is required is to review the sequence set forth in SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:37, SEQ ID NO:39, SEQ ID NO:41, SEQ ID NO:43, SEQ ID NO:45, SEQ ID NO:47 or SEQ ID NO:53 and to select any continuous portion of the sequence, from about 10 nucleotides in length up to and including the full length sequence, that one wishes to utilize as a probe or primer.
  • probe and primer sequences may be governed by various factors, such as, by way of example only, one may wish to employ primers from towards the termini of the total sequence, or from the ends of the functional domain-encoding sequences, in order to amplify further DNA.
  • the process of selecting, and preparing a nucleic acid segment that includes a contiguous sequence from within BMP-2A (SEQ ID NO:1), BMP4 (SEQ ID NO:3), BMP-5 (SEQ ID NO:5), BMP7 (SEQ ID NO:7), BMP-RIA (SEQ ID NO:37), BMP-RIB (SEQ ID NO:39), BMP-RII (SEQ ID NO:41), chordin (SEQ ID NO:43), gremlin (SEQ ID NO:45), follistatin (SEQ ID NO:47), or bambi (SEQ ID NO:53) may alternatively be described as preparing a nucleic acid fragment.
  • fragments may also be obtained by other techniques such as, e.g., by mechanical shearing or by restriction enzyme digestion.
  • Small nucleic acid segments or fragments may be readily prepared by, for example, directly synthesizing the fragment by chemical means, as is commonly practiced using an automated oligonucleotide synthesizer.
  • fragments may be obtained by application of nucleic acid reproduction technology, such as the PCRTM technology of U.S. Pat. No. 4,683,202 and U.S. Pat. No. 4,682,195 (each incorporated herein by reference), by introducing selected sequences into recombinant vectors for recombinant production, and by other recombinant DNA techniques generally known to those of skill in the art of molecular biology.
  • the nucleotide sequences of the invention may be used for their ability to selectively form duplex molecules with complementary stretches of BMP genes or cDNAs.
  • one will desire to employ varying degrees of selectivity of hybridization to achieve varying degrees of selectivity of probe towards target sequence.
  • relatively stringent conditions e.g., one will select relatively low salt and/or high temperature conditions, such as provided by 0.02M-0.15M NaCl at temperatures of 50° C. to 70° C.
  • Such selective conditions tolerate little, if any, mismatch between the probe and the template or target strand, and would be particularly suitable for examining BMP genes.
  • nucleic acid sequences of the present invention in combination with an appropriate means, such as a label, for determining hybridization.
  • appropriate indicator means include fluorescent, radioactive, enzymatic or other ligands, such as avidin/biotin, which are capable of giving a detectable signal.
  • fluorescent label or an enzyme tag such as urease, alkaline phosphatase or peroxidase, instead of radioactive or other environmental undesirable reagents.
  • enzyme tags colorimetric indicator substrates are known that can be employed to provide a means visible to the human eye or spectrophotometrically, to identify specific hybridization with complementary nucleic acid-containing samples.
  • the hybridization probes described herein will be useful both as reagents in solution hybridization as well as in embodiments employing a solid phase.
  • the test DNA or RNA
  • the test DNA is adsorbed or otherwise affixed to a selected matrix or surface.
  • This fixed, single-stranded nucleic acid is then subjected to specific hybridization with selected probes under desired conditions.
  • the selected conditions will depend on the particular circumstances based on the particular criteria required (depending, for example, on the G+C contents, type of target nucleic acid, source of nucleic acid, size of hybridization probe, etc.).
  • specific hybridization is detected, or even quantified, by means of the label.
  • BMP-2A SEQ ID NO:1
  • BMP4 SEQ ID NO:3
  • BMP-5 SEQ ID NO:5
  • BMP7 SEQ ID NO:7
  • BMP-RIA SEQ ID NO:37
  • BMP-RIB SEQ ID NO:39
  • BMP-RII SEQ ID NO:41
  • chordin SEQ ID NO:43
  • gremlin SEQ ID NO:45
  • follistatin SEQ ID NO:47
  • bambi SEQ ID NO:53
  • Recombinant vectors and isolated DNA segments may therefore variously include the BMP coding regions themselves, upstream or downstream regions of the genes, coding regions bearing selected alterations or modifications in the basic coding region, or they may encode larger polypeptides that nevertheless include BMP coding regions or may encode biologically functional equivalent proteins or polypeptides that have variant amino acid sequences.
  • the DNA segments of the present invention encompass biologically fimctional equivalent BMP proteins and polypeptides. Such sequences may arise as a consequence of codon redundancy and functional equivalency that are known to occur naturally within nucleic acid sequences and the proteins thus encoded.
  • functionally equivalent proteins or polypeptides may be created via the application of recombinant DNA technology, in which changes in the protein structure may be engineered, based on considerations of the properties of the amino acids being exchanged. Changes designed by man may be introduced through the application of site-directed mutagenesis techniques, e.g., to introduce improvements to the antigenicity of the protein or to test BMP mutants in order to examine binding activity at the molecular level.
  • the therapeutic agent for the treatment of glaucoma can be: a peptide or protein, a peptide mimetic, an oligonucleotide or derivatized oligonucleotide, or small drug-like molecule, all which affect one or more aspects of the ocular BMP pathways.
  • Preferred therapeutic agents are those that are: (1) BMP2, BMP4, BMP5, or BMP7 agonists; (2) chordin, gremlin, follistatin, or bambi antagonists; and/or (3) Smad1, Smad5 and/or Smad4 agonists.
  • the agent may be delivered directly to the eye (for example: topical ocular drops or ointments; slow release devices in the cul-de-sac or implanted adjacent to the sclera or within the eye; periocular, conjunctival, sub-Tenons, intracameral or intravitreal injections) or parenterally (for example: orally; intravenous, subcutaneous or intramuscular injections; dermal delivery; etc.) using techniques well known by those skilled in the art.
  • parenterally for example: orally; intravenous, subcutaneous or intramuscular injections; dermal delivery; etc.
  • Topical ocular formulation Agent that increases ocular BMP-4 expression 0.01-2 HPMC 0.5 Sodium chloride 0.8 BAC 0.01% EDTA 0.01 NaOH/HCl qs pH 7.4 Purified water qs 100 mL
  • Topical ocular formulation Gremlin antagonist 0.01-2 HPMC 0.5 Sodium chloride 0.8 BAC 0.01 EDTA 0.01 NaOH/HCl qs pH 7.4 Purified water qs 100 mL
  • Topical ocular formulation Smad 1 ⁇ 5 agonist 0.01-2 HPMC 0.5 Sodium chloride 0.8 BAC 0.01 EDTA 0.01 NaOH/HCl qs pH 7.2 Purified water qs 100 mL
  • the compounds of the invention could be formulated in intraocular insert devices.
  • This invention is also useful for the discovery of new anti-glaucoma therapeutic agents that are involved in the BMP signaling pathway (see FIG. 5 ).
  • Selective BMP ligands bind to BMP type I and type II serine/threonine kinase receptors (BMP-RI and BMP-RII) and transduce signal via Smad proteins.
  • the BMP signal is propagated by Smads through protein-protein and protein-DNA interactions (Attisano and Tuen Lee-Hoeflich 2001).
  • Regulatory Smad 1 and Smad 5 are activated (via phosphorylation) by ligand bound BMP receptors (von Bubnoff and Cho 2001). These regulatory Smads then interact with Smad 4 to form a heteromeric complex that translocates to the nucleus. This complex is able to activate or repress the transcription of selective genes that recognize this transcriptional complex, depending on which nuclear co-factors are present.
  • the BMP/Smad signaling pathway is negatively regulated by several mechanisms.
  • Certain BMP-binding proteins such as gremlin, BAMBI, or follistatin
  • gremlin bind BMPs and inhibit their interaction with BMP receptors.
  • inhibitory Smad proteins e.g. Smad 6 and Smad 7
  • Smad 6 and Smad 7 which bind and inactivate BMP receptors.
  • peptide or peptide mimetic agents that act as agonists or inhibitors of BMPs can be discovered through molecular modeling of BMP/BMP receptor structures (Nickel et al. 2001).
  • BMP signal transduction involves select sets of Smad proteins (Kawabata et al. 1998; Itoh et al. 2000; Attiseno et al. 2000).
  • Select BMP agonists and Smad agonists can be discovered using cell based assays. The test cell should express the appropriate BMP receptor(s) and possess the appropriate BMP signaling pathway.
  • BMP agonists and Smad agonists can be discovered by screening for BMP-induced genes.
  • the induction of BMP regulated genes also may be assayed by quantitating levels of mRNA using quantitative RT-PCR (Wang et al. 2001), DNA microarrays, or reporter gene constructs.
  • BMP binding proteins also known as BMP-associated proteins
  • Antagonists of the protein inhibitors can be discovered using ligand binding assays.
  • test agents can be added to recombinant purified gremlin, and those agents that bind to gremlin are identified using a variety of techniques known to those skilled in the art. To determine whether these agents are gremlin antagonists, a cell based assay similar to that described above is used.
  • any known in vitro and in vivo screening models may be used in conjunction with the present invention to identify new glaucoma therapies directed to the BMP family of genes. Such models are well known to those skilled in the art and their practice has become routine.
  • Small peptides or peptide mimetics can be designed based on structure/function knowledge of the BMP, BMPR, and/or BMP binding protein gene products.
  • Ligand binding assays can be used to detect small molecules that bind to BMPs, BMPRs, or BMP binding proteins. Cell based assays can look at the effects of various agents on BMP signaling pathways.
  • Knock-in cell lines containing BMP family gene promoters coupled to a reporter gene can be generated to look for agents that alter BMP family member gene expression. These assays can be used to identify both agonist and antagonist molecules. Ex vivo assays, such as perfusion cultured anterior segments from human eyes (Clark et al. 1995a; Pang et al. 2000), can be used to examine the effects of agents on IOP and on BMP signaling in TM tissue. Rodent models of glaucoma can be generated using well-known techniques to create stable BMP family member transgenic, knockout, or knock-in strains of mice and rats. These rodent models can be used to screen for agents that alter the glaucoma-like phenotype(s) (e.g. tonometry to evaluate effects on IOP, histology to evaluate effects on glaucomatous optic neurology).
  • Ex vivo assays such as perfusion cultured anterior segments from human eyes (Clark et al. 1995a; Pang e
  • kits for the early detection of glaucoma.
  • the kits can contain a nucleic acid segment encoding a BMP polypeptide or protein.
  • the kit can further contain reagents for detecting an interaction between a sample and a nucleic acid or peptide of the present invention.
  • the provided reagent can be radio-, fluorescently- or enzymatically-labeled.
  • the kit can contain a known radiolabeled agent capable of binding or interacting with a nucleic acid or peptide or protein of the present invention.
  • the reagent of the kit can be provided as a liquid solution, attached to a solid support or as a dried powder.
  • the liquid solution is an aqueous solution.
  • the solid support can be chromatography media, a test plate having a plurality of wells, or a microscope slide.
  • the reagent provided is a dry powder, the powder can be reconstituted by the addition of a suitable solvent, that may be provided.
  • the present invention concerns diagnostic methods and associated kits for the diagnosis of glaucoma. It is proposed that the BMP associated peptides and nucleic acids of the invention may be employed to detect polymorphisms or mutations in the BMP nucleic acids from patient samples. In general, these methods will include first obtaining a sample suspected of containing such a polymorphism or mutation, contacting the sample with a peptide or nucleic acid of the present invention, as the case may be, under conditions effective to allow the formation of a complex, and then detecting the presence of the complex.
  • complex formation is quite well known in the art and may be achieved through the application of numerous approaches.
  • the present invention contemplates the application of ELISA, RIA, indirect fluorescence techniques and the like.
  • complex formation will be detected through the use of a label, such as a radiolabel or an enzyme tag (such as alkaline phosphatase, horseradish peroxidase, or the like).
  • a label such as a radiolabel or an enzyme tag (such as alkaline phosphatase, horseradish peroxidase, or the like).
  • an enzyme tag such as alkaline phosphatase, horseradish peroxidase, or the like.
  • TM cells were grown from TM explants of donors ranging in age from 6 days to 90 years.
  • Human optic nerve head astrocytes and lamina cribrosa (LC) cells were generated from carefully dissected optic nerve heads (donors aged 2 days to 90 years) and characterized according to previous reports (Lambert et al. 2001; Clark et al. 1995a).
  • the cells were grown to confluency in the following media: Ham's F10 media (JRH Biosciences, Lenexa, Kans.) containing 10% fetal bovine serum (HyClone, Logan, Utah) and antibiotics (Gibco BRL-Life Technologies, Grand Island, N.Y.) for TM cells; Dulbecco's modified Eagle's media (DMEM, HyClone) containing 10% FBS for LC cells; and astrocyte growth medium (AGM, Clonetics, San Diego, Calif.) containing 5% FBS for ONH astrocytes.
  • Ham's F10 media JRH Biosciences, Lenexa, Kans.
  • DMEM Dulbecco's modified Eagle's media
  • AGM astrocyte growth medium
  • RT-PCR Human TM and ONH tissues also were dissected from donor eyes (Wordinger et al. 1998; Wang et al. 2001). Total RNA was extracted from the TM and ONH cells and tissues using TRIzol extraction (Gibco BRL-Life Technologies), and cDNA prepared by reverse transcription using standard procedures (Wordinger et al. 1998; Wordinger et al. 1999; Wordinger et al. 2000; Wordinger et al. 2002). PCR primers were designed using the Oligos 4.0 software program (see primer pairs in Table 1).
  • ⁇ -actin PCR primers AGGCCAACCGCGAGAAGATGACC (upstream) and GAAGTCCAGGGCGACGTAGCAC (downstream) with an annealing temperature of 55° C. yielded a PCR product of 350 bp.
  • PCR reactions were run as described (Wordinger et al. 1998; Wordinger et al. 1999; Wordinger et al. 2000; Lambert et al. 2001; Wordinger et al. 2002) using Taq Start Antibody Hot Start with the following cycle conditions: 2 minutes at 94° C., 2 minutes at 92° C., and 40 cycles of 30 seconds at the optimal annealing temperature, extension for 90 seconds at 72° C. and denaturation for 45 seconds at 92° C.
  • the amplified PCR products were examined by horizontal electrophoresis in 1.5% agarose gels. To ensure specificity of the RT-PCR products, Southern blot analysis was performed with probes designed using Oligo 4.0 that hybridized to a region within the amplified PCR product.
  • PCR products were sequenced to verify the specificity of the PCR reactions.
  • Table 2 lists the members of the BMP family that are expressed in the human TM and ONH. TABLE 1 PCR Primer Pairs, Annealing Temperature and Amplimer Size of BMPs Ampl.
  • the membranes were washed, incubated with secondary antibodies (goat anti-mouse IgG-horseradish peroxidase for BMPs, Santa Cruz; donkey anti-goat-horseradish peroxidase for BMP receptors, Jackson Immuno Research), and developed using the WesternBeeze chemiluminescence immunodetection system (Invitrogen, Carlsbad, Calif.).
  • BMPs, BMPRs mRNA in human TM cells and tissues Amplification products of expected for BMP-2, BMP-4, BMP-5 and BMP-7 primer pairs in human TM cells and tissues are shown in FIG. 6 . Southern blots using specific probes verified that these were the expected PCR products. All human TM cell lines and tissues expressed message for BMP-2, BMP-4, and BMP-7. However, message for BMP-5 was low to undetectable in human TM tissue samples ( FIG. 6 , lanes 6 and 7). Control reactions without cDNA did not result in amplification products indicating that reagents and primers were free of DNA or RNA contamination ( FIG. 6 , lane C).
  • FIG. 7 shows the amplification products of expected size for BMP-RIA, BMP-RIB, and BMP-RII primer pairs in human TM cells and tissues. All human TM cells and tissues expressed message for the BMP receptor complexes. Southern blots using specific probes verified that these were the expected PCR products. An alternate amplification product (350 bp) was detected in the BMP-RII PCR reaction. The alternate amplification product was present in all human TM cells and tissues. This alternate band is currently being identified to determine if it is an alternate spliced form of the receptor. Control reactions without cDNA did not result in amplification products ( FIG. 7 , lane C) indicating that reagents and primers were free of DNA or RNA contamination.
  • BMP and BMP receptor mRNA in human ONH cells and tissues Amplification products of expected size for BMP-2, BMP-4, BMP-5 and BMP-7 primer pairs in human ONH astrocytes and ONH tissues are shown in FIG. 8 . All ONH astrocytes and ONH tissue expressed message for the respective BMP. Human brain astrocytes were used as a positive control cell line. Southern blots using specific probes verified that these were the expected PCR products. With the exception of BMP-2, all other BMP were expressed by human brain astrocytes ( FIG. 8 , lane 7). Control reactions without cDNA did not result in amplification products ( FIG. 8 , lane C) indicating that reagents and primers were free of DNA or RNA contamination.
  • FIG. 9 shows the amplification products of expected sizes for BMP-2, BMP-4, BMP-5 and BMP-7 primer pairs in cultured human LC cells. All LC cell lines expressed message for each BMP. Southern blots using specific probes verified that these were the expected PCR products. Control reactions without cDNA did not result in amplification products ( FIG. 9 , lane C) indicating that reagents and primers were free of DNA or RNA contamination.
  • FIG. 10 Amplification products of expected size for BMP-RIA, BMP-RIB, and BMP-RII primer pairs in human ONH astrocytes and ONH tissues are shown in FIG. 10 .
  • BMP-RII was expressed by all ONH astrocyte cell lines.
  • Message for all BMP receptors FIG. 10 , lane 7 was expressed by a human brain astrocyte cell line that served as a positive control.
  • the reduced expression in ONH tissue may reflect a low level of expression. Control reactions without cDNA did not result in amplification products ( FIG. 5 , lane C) indicating that reagents and primers were free of DNA or RNA contamination.
  • FIG. 11 shows the amplification products of expected size for BMP-RLA, BMP-RIB, and BMP-RII primer pairs in cultured human LC cells. All LC cell lines expressed message for each BMP receptor. Southern blots using specific probes verified that these were the expected PCR products. Control reactions without cDNA did not result in amplification products ( FIG. 11 , lane C) indicating that reagents and primers were free of DNA or RNA contamination.
  • FIG. 12 represents chemiluminescent immunoblot detection of BMP-2, BMP-4, BMP-5, BMP-7, BMP-RIA, BMP-RIB, and BMP-RII proteins in human TM and ONH cells and tissues. All cell lines studied expressed the respective BMP proteins. The BMP proteins were detected in cell lines the following molecular weights: 54-56 kDa for BMP-2, 25-27 kDa for BMP-4, 55-57 kDa for BMP-5, and 77 kDa for BMP-7.
  • BMP-2 and BMP-4 Multiple bands were detected for BMP-2 and BMP-4, which most likely represent glycosylated, and partially glycosylated forms of these BMPs as seen in other studies. However, we did not do glycosylation studies as they were beyond the scope of this study.
  • the BMP receptor proteins were detected in cell lines at molecular weights: 38 kDa for BMP-RIA, 64 kDa for BMP-RIB, and 57 kDa for BMP-RII. Multiple bands were detected for BMP-RIB and BMP-RII in the TM cells, which most likely represent glycosylated, and partially glycosylated forms as seen in other studies.
  • the expression levels of proteins for the BMP receptors appeared to be lower in the TM cells compared to ONH cells. For example BMP-RII was not detected in TM cells and BMP-RIB was greatly reduced.
  • BMP associated protein mRNAs in cultured human TM cells and in human ONH cells Amplification products of expected size for BMP associated protein primer pairs in human TM cell lines are shown in FIG. 13 .
  • Human TM cell lines expressed message for DRM (gremlin), chordin, follistatin, and NMA (AMBI). Southern blots using specific probes verified that these were the expected PCR products. There was no apparent difference in message expression between cell lines. All human TM cells examined failed to express mRNA for the BMP associated proteins noggin and Cer-1. Control reactions without cDNA did not result in amplification products indicating that reagents and primers were free of DNA or RNA contamination.
  • Amplification products of expected size for BMP associated protein primer pairs in ONH astrocytes and LC cell lines are shown in FIG. 14 .
  • All ONH astrocytes and LC cell lines expressed message for DRM (gremlin), follistatin and NMA (BAMBI). Southern blots using specific probes verified that these were the expected PCR products.
  • the majority of LC cells and ONH astrocytes expressed message for chordin.
  • All human ONH astrocytes and LC cells examined failed to express mRNA for the BMP associated proteins noggin and Cer-1. Control reactions without cDNA did not result in amplification products indicating that reagents and primers were free of DNA and RNA contamination.
  • FIG. 15 shows increased expression of the BMP antagonist gremlin (CKTSF1B1) in glaucomatous TM cells. Gene expression was assessed using Affymetrix gene arrays (Affymetrix gene chip U133A).
  • compositions and/or methods disclosed and claimed herein can be made and executed without undue experimentation in light of the present disclosure. While the compositions and methods of this invention have been described in terms of preferred embodiments, it will be apparent to those of skill in the art that variations may be applied to the compositions and/or methods and in the steps or in the sequence of steps of the method described herein without departing from the concept, spirit and scope of the invention. More specifically, it will be apparent that certain agents which are both chemically and structurally related may be substituted for the agents described herein to achieve similar results. All such substitutions and modifications apparent to those skilled in the art are deemed to be within the spirit, scope and concept of the invention as defined by the appended claims.

Abstract

The present invention provides methods and kits for diagnosing and treating glaucoma.

Description

    1. FIELD OF THE INVENTION
  • The present invention discloses methods and reagents for diagnosing and treating glaucoma and related disorders.
  • 2. DESCRIPTION OF THE RELATED ART
  • “Glaucomas” are a group of debilitating eye diseases that are the leading cause of irreversible blindness in the United States and other developed nations. Primary Open Angle Glaucoma (“POAG”), the most common form of glaucoma, is characterized by the degeneration of the trabecular meshwork, leading to obstruction of the normal ability of aqueous humor to leave the eye without closure of the space (e.g., the “angle”) between the iris and cornea (Vaughan, D. et al., (1992)). A characteristic of such obstruction in this disease is an increased intraocular pressure (“IOP”), resulting in progressive visual loss and blindness if not treated appropriately and in a timely fashion. The disease is estimated to affect between 0.4% and 3.3% of all adults over 40 years old (Leske, M. C. et al. (1986); Bengtsson, B. (1989); Strong, N. P. (1992)). Moreover, the prevalence of the disease rises with age to over 6% of those 75 years or older (Strong, N. P., (1992)).
  • Because increased IOP is a readily measurable characteristic of glaucoma, the diagnosis of the disease is largely screened for by measuring intraocular pressure (tonometry) (Strong, N. P. (1992); Greve, M. et al. (1993)). Unfortunately, because glaucomatous and normal pressure ranges overlap, such methods are of limited value unless multiple readings are obtained (Hitchings, R. A., (1993); Tuck, M. W. et al. (1993); Vaughan, D. et al., (1992); Vernon, S. A., (1993)). For this reason, additional methods, such as direct examination of the optic disk and determination of the extent of a patient's visual field loss are often conducted to improve the accuracy of diagnosis (Greve, M. et al., (1993)).
  • Glaucoma affects three separate tissues in the eye. The elevated IOP associated with POAG is due to morphological and biochemical changes in the trabecular meshwork (TM), a tissue located at the angle between the cornea and iris. Most of the nutritive aqueous humor exits the anterior segment of the eye through the TM. The progressive loss of TM cells and the build-up of extracellular debris in the TM of glaucomatous eyes leads to increased resistance to aqueous outflow (Lutjen-Drecoll and Rohen 1996; Rohen 1983; Rohen et al. 1993; Grierson and Calthorpe 1988), thereby raising IOP. Elevated IOP, as well as other factors such as ischemia, cause degenerative changes in the optic nerve head (ONH) leading to progressive “cupping” of the ONH (Varma and Minckler 1996; Hernandez and Gong 1996; Hernandez et al. 1990; Hernandez and Pena 1997; Morrison et al. 1990) and loss of retinal ganglion cells (Quigley et al. 2000; Quigley 1999; Quigley et al. 1995; Kerrigan et al. 1997) and axons. The detailed molecular mechanisms responsible for glaucomatous damage to the TM, ONH, and the retinal ganglion cells are unknown.
  • Current glaucoma therapy is directed to lowering IOP, a major risk factor for the development and progression of glaucoma. These therapies lower IOP, but they do not directly address the pathogenic mechanisms, and the disease continues to progress. At least half of patients with glaucoma are undiagnosed, and by the time patients are diagnosed with glaucoma, they have already lost approximately 40% of their retinal ganglion cells. Therefore, methods for earlier detection and diagnosis of glaucoma are needed.
  • In view of the importance of glaucoma, and the at least partial inadequacies of prior methods of diagnosis, it would be desirable to have an improved, more accurate method for diagnosing glaucoma in its early stages. In addition, it would be desirable to have new therapeutic agents that address glaucomatous pathogenic mechanisms.
  • SUMMARY OF THE INVENTION
  • The present invention overcomes these and other drawbacks of the prior art by providing methods and kits for the early diagnosis of glaucoma, for treating glaucoma, and for the identification of compounds useful in the treatment of glaucoma.
  • In certain specific embodiments, the invention provides a method for diagnosing glaucoma in a sample obtained from a cell or bodily fluid by detecting altered expression of a bone morphogenic protein family member gene. The method generally includes the steps of:
      • a) obtaining a tissue or fluid sample from a patient suspected of having glaucoma;
      • b) extracting DNA from said sample;
      • c) obtaining a plurality of PCR primers, wherein said primers each comprise a sequence consisting of from 18 to 1547 contiguous nucleotides from SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO: 37, SEQ ID NO:39, SEQ ID NO:41, SEQ ID NO:43, SEQ ID NO:45, SEQ ID NO:47, or SEQ ID NO:53;
      • d) amplifying regions of the extracted DNA using said primers to obtain a PCR product;
      • e) resolving the PCR product; and
      • f) identifying differences between the sequence of the PCR product and the normal gene sequence;
      • where a difference between the amplified sequence and the normal gene sequence is diagnostic of glaucoma.
  • In general, the methods of the invention may include obtaining a sample from an individual and extracting DNA from said sample. Select PCR primers for specific members of the BMP gene family are then used to amplify relevant regions of the extracted gene to obtain a PCR product. The PCR product is resolved by a technique that effectively identifies DNA sequence differences between the normal and mutated form of the specific BMP family gene being evaluated (the extracted DNA). Identified differences between the sequences are indicative of glaucoma.
  • The tissue or fluid sample for use in the methods of the invention may be blood or buccal cells.
  • Typically, the primer sequences will have a length of between about 10, 15 or 18 nucleotides to about 20, or to about 30 nucleotides. Longer sequences, e.g., 40, 50, 80, 90, 95, 100, even up to full length, are even more preferred for certain embodiments. Lengths of oligonucleotides of at least about 18 to 20 nucleotides are well accepted by those of skill in the art as sufficient to allow sufficiently specific hybridization so as to be useful as a molecular probe, as described by Lathe (1985), which reference is specifically incorporated herein by reference for this purpose. Preferably, the nucleotide sequence will consist of from 20 to 100 contiguous nucleotides of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:37, SEQ ID NO:39, SEQ ID NO:41, SEQ ID NO:43, SEQ ID NO:45, SEQ ID NO:47, or SEQ ID NO:53. It is also contemplated that the primer sequences may consist of sequences of at least 10, 15 or 18 contiguous nucleotides from the sequences of BMP receptor genes and from BMP-associated proteins, the sequences of which are known.
  • Nucleic acid molecules having stretches of 10, 18, 20, 30, 50, 60, 65 or even up to and including 100 nucleotides or so, complementary to any one of SEQ ID NO: 1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:37, SEQ ID NO:39, SEQ ID NO:41,
  • SEQ ID NO:43, SEQ ID NO:45, SEQ ID NO:47, or SEQ ID NO:53, have utility as hybridization probes. Primers or probes having a nucleotide length of about 18 nucleotides are recognized by those of skill in the art to provide highly specific hybridization to a target sequence. The total size of the fragment, as well as the size of the complementary stretches, will ultimately depend on the intended use of application of the particular nucleic acid segment. Smaller fragments will generally find use in hybridization embodiments, wherein the length of the complementary region may be varied, such as between about 10, 18, 20 or 30 and about 50, 60, 70, 80, 80 or 100 nucleotides, or even is full length according to the complementary sequences one wishes to detect.
  • In specifically preferred embodiments, the primers will consist of contiguous sequences from SEQ ID NO: 1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:37, SEQ ID NO:39, SEQ ID NO:41, SEQ ID NO:43, SEQ ID NO:45, SEQ ID NO:47, or SEQ ID NO:53. In other preferred embodiments, the primers will consist of contiguous sequences from BMP receptor genes (disclosed in ten Dijke et al. 1993; Astrom et al. 1999; Nohno et al. 1995, all incorporated herein by reference) or from BMP-associated genes, such as chordin (NCBI NM029130), gremlin (Murphy et al. 1999; McMahon et al. 2000), follistatin (NCBI NM003892) or bambi (NCBI NM005791). Most preferably, the primers will consist of contiguous sequence from SEQ ID NO:3. In certain aspects, at least some of the primers may further include a detectable label.
  • In other embodiments, the invention provides a method for treating glaucoma by administering to a patient in need thereof a composition comprising a sequence consisting of at least one compound selected from the group consisting of a BMP2 agonist, a BMP4 agonist, a BMP5 agonist, a BMP7 agonist, a Smad ⅕ agonist, a chordin antagonist, a gremlin antagonist and a follistatin antagonist.
  • In additional aspects, the present invention provides a method for identifying a therapeutic agent for the treatment of glaucoma. Therapeutic agents may be identified, for example, by:
      • a) obtaining a first composition comprising a population of recombinant cells expressing BMP-2A, BMP4, BMP-5, or BMP7;
      • b) obtaining a candidate substance;
      • c) incubating said composition and said candidate substance;
        testing said composition for its ability to turn on BMP-induced Smad signaling pathways and/or BMP-regulated gene expression; and identifying a candidate substance that inhibits, or stimulates, these downstream effects of BMP.
  • Another aspect of the invention are diagnostic kits containing sequences of the present invention and suitable reagents such as a detectable label linked to a protein, peptide or the antibody itself. Alternatively, the detectable label may be linked to a second sequence which selectively hybridizes to a sequence of the invention.
  • Related embodiments include therapeutic kits which include pharmaceutically-acceptable formulations of either the nucleic acid sequences or peptide or protein sequences disclosed herein. Such kits are useflul in the detection of altered expression of the BMP genes and proteins in clinical samples for the diagnosis of glaucoma.
  • BRIEF DESCRIPTION OF THE DRAWINGS
  • The drawings form part of the present specification and are included to further demonstrate certain aspects of the present invention. The invention may be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein.
  • FIG. 1. Nucleotide and amino acid sequence of BMP2A.
  • FIG. 2. Nucleotide and amino acid sequence of BMP4.
  • FIG. 3. Nucleotide and amino acid sequence of BMP5.
  • FIG. 4. Nucleotide and amino acid sequence of BMP7.
  • FIG. 5. Bone morphogenic protein signaling pathway. Bone Morphogenic Protein (BMP) dimers bind to a membrane complex composed of BMP receptors 1 and 2, which are serin/threonine kinases. The regulatory Smads (Smad1/Smad5) become phosphorylated and associate with a co-Smad (Smad 4). This resulting Smad complex enters the nucleus where it associates with transcription factors (TF) and regulates gene expression. BMP associated proteins act as BMP antagonists by binding BMPs and preventing BMP interaction with BMP receptors.
  • FIG. 6. BMP expression in human TM cells and tissues. Ethidium bromide-stained agarose gel of BMP PCR products from cDNA samples generated from RT-PCR analysis of BMP expression in human TM cells (lanes 1-5) and tissues (lanes 6-7). L=base pair markers. C=PCR negative control lane. β-actin was used as a positive RT-PCR internal control.
  • FIG. 7. BMP receptor expression in human TM cells and tissues. Ethidium bromide-stained agarose gel of PCR products from cDNA samples generated from RT-PCR analysis of BMP receptor expression in human TM cells (lanes 1-5) and tissues (lanes 6-7). L=base pair markers. C=PCR negative control lane. β-actin was used as a positive RT-PCR internal control.
  • FIG. 8. BMP expression in human ONH astrocytes, ONH tissues, and human brain astrocytes. Ethidium bromide-stained agarose gel of PCR products from cDNA samples generated from RT-PCR analysis of BMP expression in human ONH astrocyte (lanes 1-5), ONH tissue (lane 6), and human brain astrocytes (lane 7). L=base pair markers. C=PCR negative control lane. β-actin was used as a positive RT-PCR internal control.
  • FIG. 9. BMP expression in human lamina cribrosa cell lines. Ethidium bromide-stained agarose gel of PCR products from cDNA samples generated from RT-PCR analysis of human lamina cribrosa cells (lanes 1-9). L=base pair markers. C=PCR negative control lane. β-actin was used as a positive RT-PCR internal control.
  • FIG. 10. BMP receptor expression in human ONH astrocytes, ONH tissues, and human brain astrocytes. Ethidium bromide-stained agarose gel of PCR products from cDNA samples generated from RT-PCR analysis of BMP receptor expression in human optic nerve head astrocytes (ONA) (lanes 1-5), ONH tissue (lane 6), and human brain astrocytes (lane 7). L=base pair markers. C=PCR negative control lane. β-actin was used as a positive RT-PCR control.
  • FIG. 11. BMP receptor expression in human lamina cribrosa cell lines. Ethidium bromide-stained agarose gel of PCR products from cDNA samples generated from RT-PCR analysis of human lamina cribrosa cells (lanes 1-9). L=base pair markers. C=PCR negative control lane. β-actin was used as a positive RT-PCR control.
  • FIG. 12. Western immunoblot of BMP and BMP receptor expression in cultured human TM cells, optic nerve head astrocytes (ONA), and lamina cribrosa cells. Chemiluminescent detection of BMP proteins and BMP receptors in human trabecular meshwork cells (lanes 1-2), ONH astrocytes (lanes 3-4), and lamina cribrosa cells (lanes 5-6). Protein size indicated in kDa.
  • FIG. 13. BMP associated protein mRNA expression in human TM cells. Ethidium bromide-stained agarose gel of PCR products from cDNA samples generated from RT-PCR analysis of human TM cells (lanes 1-5). L=base pair markers. C=PCR negative control lane. β-actin was used as a positive RT-PCR internal control.
  • FIG. 14. BMP associated protein mRNA expression in human lamina cribrosa cells and ONH astrocytes. Ethidium bromide-stained agarose gel of PCR products from cDNA samples generated from RT-PCR analysis of lamina cribrosa (LC) cells (lanes 1-7) and ONH astrocytes (ONA) (lanes 8-11). L=base pair markers. C=PCR negative control lane. β-actin was used as a positive RT-PCR internal control.
  • FIG. 15. Illustrates increased expression of the BMP antagonist gremlin (CKTSF1B1) in glaucomatous TM cells. Gene expression was assessed using Affymetrix gene arrays (Affymetrix gene chip U133A).
  • DETAILED DESCRIPTION PREFERRED EMBODIMENTS
  • The trabecular meshwork has been proposed to play an important role in the normal flow of the aqueous humor, and has been presumed to be the major site of outflow resistance in glaucomatous eyes. Human trabecular meshwork (HTM) cells are specialized cells which line the outflow channels by which aqueous humor exits the eye. Altered synthetic function of the cells may be involved in the pathogenesis of POAG, steroid glaucoma, and other types of glaucoma.
  • Despite years of intensive research, the precise molecular mechanisms responsible for glaucomatous damage to the eye are not known. Recent research has suggested that growth factors may be important in maintaining normal homeostasis in the ocular tissues associated with glaucoma, and alterations in growth factor/growth factor receptors may play a role in glaucoma pathogenesis. Growth factors area very large family of polypeptides that control cell growth and differentiation. These molecules have a variety of cell-specific effects on gene expression, extracellular matrix composition and deposition, cytoskeletal organization, and regulation of cellular functions. The TM expresses a wide variety of growth factors, growth factor receptors (Tripathi et al. 1993a; Tripathi et al. 1993b; Tripathi et al. 1994a; Tripathi et al. 1994b; Wordinger et al. 1998; Wordinger et al. 1999) as well as neurotrophin/neurotrophic factors and their receptors (Liu et al. 2001; Wordinger et al. 2000). ONH astrocytes and lamina cribrosa cells, two cell types of the optic nerve head, express growth factors, neurotrophins and their receptors (Lambert et al. 2001; Pena et al. 1999). The aqueous humor also contains a variety of growth factors including FGF2, EGF, TGFβ, HGF (Tripathi et al. 1996; Tripathi et al. 1991; Tripathi et al. 1992; Hu and Ritch 2001) as well as neurotrophins (Chundru et al. 2000). Elevated levels of aqueous humor TGFβ-2 and HGF have been reported in POAG patients (Tripathi et al. 1994c; Inatani et al. 2001; Picht et al. 2001). Growth factors may be involved in glaucoma by altering the normal development and/or flnction of the TM and ONH.
  • The present invention stems in part from the recognition that bone morphogenic proteins (BMPs) not only induce bone and cartilage formation but are multifunctional cytokines having a wide range of effects on numerous cell types (Hogan 1996; Reddi 1997) and are expressed by both human trabecular meshwork (HTM) and optic nerve head (ONH) cells (Wordinger et al. 2002). BMPs are members of the TGFP superfamily, and there are approximately 15-20 BMPs genes in man, 3 BMP receptors, and a number of BMP associated proteins that function as BMP antagonists (Yamashita et al. 1996). BMPs signal via a receptor complex consisting of BMPR-I and BMPR-II. It has been reported that superfamily members TGFP and TGFPR (Agarwal et al. 1997; Lambert et al. 1997) and GDNF and GDNFR (Wordinger et al. 1999; Liu et al. 1999) are expressed by both HTM and ONH cells.
  • BMPs and BMP receptors are expressed in ocular tissues (Obata et al. 1999; You et al. 1999), but previous reports have focused on ocular development. The function of BMPs is important in ocular development since targeted disruption of genes encoding BMPs in mice leads to severe developmental defects in the retina and the lens (Jena et al. 1997; Luo et al. 1995; Dudley et al. 1995). BMP-2, BMP-4 and BMP-7 are involved in the development of the lens and retina (Jena et al. 1997; Furuta and Hogan 1998; Reddi 2000; Trousse et al. 2001). BMP-6 and BMP-7 also appear to play a role in protecting neurons from hypoglycemic or ischemic damage (Nonner et al. 2001; Liu et al. 2001), and BMP2 has been shown to enhance ganglion cell neurotrophin expression (Zhang et al. 1998). Heterozygous knock-out mice haploinsufficient for Bmp4 have ocular phenotypes including anterior segment dysgenesis, elevated IOP, and optic nerve abnormalities (Chang et al. 2001). There has been very limited information published concerning the role of BMPs in the human postnatal eye.
  • Mohan and colleagues (1998) reported that BMP-2 and BMP-4 and BMP receptors were expressed in cells of the adult cornea and suggested that BMP function might include corneal keratocyte proliferation and apoptosis. You and colleagues (1999) verified this study and also reported the expression of BMP-3, BMP-5, and BMP-7 in ex vivo and cultured corneal epithelium and stromal cells. They reported that the level of BMP transcription was higher in the stroma while the level for receptors was higher in cultured corneal epithelial cells.
  • Using RT-PCR, the present inventors discovered mRNAs for BMPs, BMP receptors BMPR-IA, BMPR-IB and BMPR-II, as well as BMP binding proteins gremlin, chordin, follistatin, and banbi, in HTM, lamina cribosa (LC) and ONH astrocyte cell lines and tissues (Wordinger et al. 2002). The present inventors further discovered that HTM and ONH cells express proteins BMP-2, BMP-4, BMP-5 and BMP-7.
  • Glaucoma will be diagnosed by characterization of genetic changes in genes of members of the BMP signaling family. As used herein, the phrases “bone morphogenic protein family member gene” and “BMP signaling family” refer to all BMPs, BMP receptors and associated proteins. The term “genetic changes” is well known by those skilled in the art. There are numerous examples of diseases associated with genetic changes in specific genes (for examples see Cummings 1997; Strachan, et al. 1996; Jorde, et al. 1999). Genetic changes in a specific gene (e.g. BMP) can be determined using a variety of techniques well known by those skilled in the art, such as: SSCP, DGGE, ASO, RFLP, heteroduplex analysis, CCM, PTT, and RNase cleavage (see Birren, et al. 1998).
  • Glaucoma may be caused by altered expression of one or more BMP family genes in the eye, which leads to elevated IOP and/or glaucomatous optic neuropathy. “Altered BMP gene expression” means expression of this gene product that is different from normal. The term may also refer to alterations in the sequence of the gene or protein. The normal BMP gene has been well characterized (see above), and the expression of BMP has been reported in a variety of tissues including the TM and ONH. Genetic changes in the coding region of BMP family genes may alter the function of these proteins. Genetic changes outside the coding region may also lead to glaucoma.
  • It is well known by those skilled in the art that “changes outside” of the coding region of a specific gene are important in the regulation of gene expression. For example, the region upstream (5′) of the coding region of most genes is known as the promoter region which “promotes” and regulates the expression of that gene. The promoter region contains numerous nucleotide sequences recognized by various transcription factors and DNA binding proteins that are responsible for activation or repression of gene expression. Regions downstream (3′) of the gene can determine poly-adenylation of the gene product, thereby regulating RNA processing and translation of the gene product.
  • The altered expression of BMP genes or mutations in the sequence of the genes that is indicative of glaucoma may be detected using techniques well known to those of skill in the art. For example, it is contemplated that a nucleic acid fragment of almost any length may be employed, with the total length preferably being limited by the ease of preparation and use in the intended protocol. The nucleic acid sequences disclosed herein may also have utility as probes or primers in nucleic acid hybridization embodiments. As such, it is contemplated that nucleic acid segments that comprise a sequence region that consists of at least a 14 nucleotide long contiguous sequence that has the same sequence as, or is complementary to, a 14 nucleotide long contiguous sequence of BMP-2A (SEQ ID NO:1), BMP-4 (SEQ ID NO:3), BMP-5 (SEQ ID NO:5), BMP-7 (SEQ ID NO:7), BMP-RIA (SEQ ID NO:37), BMP-RIB (SEQ ID NO:39), BMP-RH (SEQ ID NO:41), chordin (SEQ ID NO:43), gremlin (SEQ ID NO:45), follistatin (SEQ ID NO:47), or bambi (SEQ ID NO:53) will find particular utility. Longer contiguous identical or complementary sequences, e.g., those of about 20, 30, 40, 50, 100, 200, 500, 1000 nucleotides (including all intermediate lengths), and even up to full length sequences of about 1547 nucleotides (for BMP-2A), 1946 nucleotides (for BMP-4), 2153 nucleotides (for BMP-5) and 1878 nucleotides (for BMP-7), 2932 nucleotides (for BMP-RIA), 2032 nucleotides (for BMP-RIB), 3611 nucleotides (for BMP-RII), 3561 nucleotides (for chordin), 4049 nucleotides (for gremlin), 1386 nucleotides (for follistatin), and 1523 nucleotides (for bambi) will also be of use in certain embodiments.
  • It will be readily understood that “intermediate lengths”, in this context, means any length between the quoted ranges, such as 14, 15, 16, 17, 18, 19, 20, etc.; 21, 22, 23, etc.; 30, 31, 32, etc.; 50, 51, 52, 53, etc.; 100, 101, 102, 103, etc.; 150, 151, 152, 153, etc.; including all integers through the 200-500; 500-1,000; 1,000-2,000 ranges, up to and including sequences of 2,001, 2002, 2050, 2051, and the like.
  • The ability of such nucleic acid probes and primers to specifically hybridize to BMP coding sequences and primers to specifically amplify BMP sequences will enable them to be of use in detecting the presence of complementary sequences in a given sample. However, other uses are envisioned, including the use of the sequence information for the preparation of mutant species primers, or primers for use in preparing other genetic constructions.
  • Nucleic acid molecules having sequence regions consisting of contiguous nucleotide stretches of 10, 20, 30, 50, or even of 100-200 nucleotides or so, identical or complementary to BMP-2A (SEQ ID NO:1), BMP4 (SEQ ID NO:3), BMP-5 (SEQ ID NO:5), BMP7 (SEQ ID NO:7), BMP-RIA (SEQ ID NO:37), BMP-RIB (SEQ ID NO:39), BMP-RII (SEQ ID NO:41), chordin (SEQ ID NO:43), gremlin (SEQ ID NO:45), follistatin (SEQ ID NO:47), or bambi (SEQ ID NO:53) are particularly contemplated as hybridization probes for use in, e.g., SNP evaluation and solid phase hybridization assays, in addition to Southern and northern blotting. This would allow BMP structural or regulatory genes to be analyzed, both in tissues and cells. The total size of fragment, as well as the size of the complementary stretch(es), will ultimately depend on the intended use of application of the particular nucleic acid segment. Smaller fragments will generally find use in hybridization embodiments, wherein the length of the contiguous complementary region may be varied, such as between about 10 and about 100 nucleotides, but larger contiguous complementary stretches of up to about 1547 nucleotides (for BMP-2A), 1946 nucleotides (for BMP-4), 2153 nucleotides (for BMP-5) and 1878 nucleotides (for BMP-7), 2932 nucleotides (for BMP-RIA), 2032 nucleotides (for BMP-RIB), 3611 nucleotides (for BMP-RII), 3561 nucleotides (for chordin), 4049 nucleotides (for gremlin), 1386 nucleotides (for follistatin), and 1523 nucleotides (for bambi) may be used, according to the length complementary sequences one wishes to detect.
  • The use of a hybridization probe of about 10-14 nucleotides in length allows the formation of a duplex molecule that is both stable and selective. Molecules having contiguous complementary sequences over stretches greater than 10 bases in length are generally preferred, though, in order to increase stability and selectivity of the hybrid, and thereby improve the quality and degree of specific hybrid molecules obtained, one will generally prefer to design nucleic acid molecules having gene-complementary stretches of 15 to 20 contiguous nucleotides, or even longer where desired.
  • Hybridization probes may be selected from any portion of any of the sequences disclosed herein. All that is required is to review the sequence set forth in SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:37, SEQ ID NO:39, SEQ ID NO:41, SEQ ID NO:43, SEQ ID NO:45, SEQ ID NO:47 or SEQ ID NO:53 and to select any continuous portion of the sequence, from about 10 nucleotides in length up to and including the full length sequence, that one wishes to utilize as a probe or primer. The choice of probe and primer sequences may be governed by various factors, such as, by way of example only, one may wish to employ primers from towards the termini of the total sequence, or from the ends of the functional domain-encoding sequences, in order to amplify further DNA.
  • The process of selecting, and preparing a nucleic acid segment that includes a contiguous sequence from within BMP-2A (SEQ ID NO:1), BMP4 (SEQ ID NO:3), BMP-5 (SEQ ID NO:5), BMP7 (SEQ ID NO:7), BMP-RIA (SEQ ID NO:37), BMP-RIB (SEQ ID NO:39), BMP-RII (SEQ ID NO:41), chordin (SEQ ID NO:43), gremlin (SEQ ID NO:45), follistatin (SEQ ID NO:47), or bambi (SEQ ID NO:53) may alternatively be described as preparing a nucleic acid fragment. Of course, fragments may also be obtained by other techniques such as, e.g., by mechanical shearing or by restriction enzyme digestion. Small nucleic acid segments or fragments may be readily prepared by, for example, directly synthesizing the fragment by chemical means, as is commonly practiced using an automated oligonucleotide synthesizer. Also, fragments may be obtained by application of nucleic acid reproduction technology, such as the PCR™ technology of U.S. Pat. No. 4,683,202 and U.S. Pat. No. 4,682,195 (each incorporated herein by reference), by introducing selected sequences into recombinant vectors for recombinant production, and by other recombinant DNA techniques generally known to those of skill in the art of molecular biology.
  • Accordingly, the nucleotide sequences of the invention may be used for their ability to selectively form duplex molecules with complementary stretches of BMP genes or cDNAs. Depending on the application envisioned, one will desire to employ varying degrees of selectivity of hybridization to achieve varying degrees of selectivity of probe towards target sequence. For applications requiring high selectivity, one will typically desire to employ relatively stringent conditions to form the hybrids, e.g., one will select relatively low salt and/or high temperature conditions, such as provided by 0.02M-0.15M NaCl at temperatures of 50° C. to 70° C. Such selective conditions tolerate little, if any, mismatch between the probe and the template or target strand, and would be particularly suitable for examining BMP genes.
  • Of course, for some applications, for example, where one desires to prepare or identify mutants employing a mutant primer strand hybridized to an underlying template or where one seeks to isolate BMP encoding sequences from related species, functional equivalents, or the like, less stringent hybridization conditions will typically be needed in order to allow formation of the heteroduplex. In these circumstances, one may desire to employ conditions such a 0.15M-1.0M salt, at temperatures ranging from 20° C. to 55° C. Cross-hybridizing species can thereby be readily identified as positively hybridizing signals with respect to control hycbridizations. In any case, it is generally appreciated that conditions can be rendered more stringent by decreasing NaCl concentrations or by the addition of increasing amounts of formamide, which serves to destabilize the hybrid duplex in the same manner as increased temperature. Thus, hybridization conditions can be readily manipulated, and thus will generally be a method of choice depending on the desired results.
  • In certain embodiments, it will be advantageous to employ nucleic acid sequences of the present invention in combination with an appropriate means, such as a label, for determining hybridization. A wide variety of appropriate indicator means are known in the art, including fluorescent, radioactive, enzymatic or other ligands, such as avidin/biotin, which are capable of giving a detectable signal. In preferred embodiments, one will likely desire to employ a fluorescent label or an enzyme tag, such as urease, alkaline phosphatase or peroxidase, instead of radioactive or other environmental undesirable reagents. In the case of enzyme tags, colorimetric indicator substrates are known that can be employed to provide a means visible to the human eye or spectrophotometrically, to identify specific hybridization with complementary nucleic acid-containing samples.
  • In general, it is envisioned that the hybridization probes described herein will be useful both as reagents in solution hybridization as well as in embodiments employing a solid phase. In embodiments involving a solid phase, the test DNA (or RNA) is adsorbed or otherwise affixed to a selected matrix or surface. This fixed, single-stranded nucleic acid is then subjected to specific hybridization with selected probes under desired conditions. The selected conditions will depend on the particular circumstances based on the particular criteria required (depending, for example, on the G+C contents, type of target nucleic acid, source of nucleic acid, size of hybridization probe, etc.). Following washing of the hybridized surface so as to remove nonspecifically bound probe molecules, specific hybridization is detected, or even quantified, by means of the label.
  • It will also be understood that this invention is not limited to the particular nucleic acid and amino acid sequences of BMP-2A (SEQ ID NO:1), BMP4 (SEQ ID NO:3), BMP-5 (SEQ ID NO:5), BMP7 (SEQ ID NO:7), BMP-RIA (SEQ ID NO:37), BMP-RIB (SEQ ID NO:39), BMP-RII (SEQ ID NO:41), chordin (SEQ ID NO:43), gremlin (SEQ ID NO:45), follistatin (SEQ ID NO:47), or bambi (SEQ ID NO:53). Recombinant vectors and isolated DNA segments may therefore variously include the BMP coding regions themselves, upstream or downstream regions of the genes, coding regions bearing selected alterations or modifications in the basic coding region, or they may encode larger polypeptides that nevertheless include BMP coding regions or may encode biologically functional equivalent proteins or polypeptides that have variant amino acid sequences.
  • The DNA segments of the present invention encompass biologically fimctional equivalent BMP proteins and polypeptides. Such sequences may arise as a consequence of codon redundancy and functional equivalency that are known to occur naturally within nucleic acid sequences and the proteins thus encoded. Alternatively, functionally equivalent proteins or polypeptides may be created via the application of recombinant DNA technology, in which changes in the protein structure may be engineered, based on considerations of the properties of the amino acids being exchanged. Changes designed by man may be introduced through the application of site-directed mutagenesis techniques, e.g., to introduce improvements to the antigenicity of the protein or to test BMP mutants in order to examine binding activity at the molecular level.
  • The therapeutic agent for the treatment of glaucoma can be: a peptide or protein, a peptide mimetic, an oligonucleotide or derivatized oligonucleotide, or small drug-like molecule, all which affect one or more aspects of the ocular BMP pathways. Preferred therapeutic agents are those that are: (1) BMP2, BMP4, BMP5, or BMP7 agonists; (2) chordin, gremlin, follistatin, or bambi antagonists; and/or (3) Smad1, Smad5 and/or Smad4 agonists.
  • The agent may be delivered directly to the eye (for example: topical ocular drops or ointments; slow release devices in the cul-de-sac or implanted adjacent to the sclera or within the eye; periocular, conjunctival, sub-Tenons, intracameral or intravitreal injections) or parenterally (for example: orally; intravenous, subcutaneous or intramuscular injections; dermal delivery; etc.) using techniques well known by those skilled in the art. The following are examples of possible formulations embodied by this invention.
    wt. %
    (a) Topical ocular formulation
    Agent that increases ocular BMP-4 expression 0.01-2
    HPMC 0.5
    Sodium chloride 0.8
    BAC 0.01%
    EDTA 0.01
    NaOH/HCl qs pH 7.4
    Purified water qs 100 mL
    (b) Topical ocular formulation
    Gremlin antagonist 0.01-2
    HPMC 0.5
    Sodium chloride 0.8
    BAC 0.01
    EDTA 0.01
    NaOH/HCl qs pH 7.4
    Purified water qs 100 mL
    (c) Topical ocular formulation
    Smad ⅕ agonist 0.01-2
    HPMC 0.5
    Sodium chloride 0.8
    BAC 0.01
    EDTA 0.01
    NaOH/HCl qs pH 7.2
    Purified water qs 100 mL
  • It is further contemplated that the compounds of the invention could be formulated in intraocular insert devices.
  • A. Assay for Therapeutic Agents
  • This invention is also useful for the discovery of new anti-glaucoma therapeutic agents that are involved in the BMP signaling pathway (see FIG. 5). Selective BMP ligands bind to BMP type I and type II serine/threonine kinase receptors (BMP-RI and BMP-RII) and transduce signal via Smad proteins. The BMP signal is propagated by Smads through protein-protein and protein-DNA interactions (Attisano and Tuen Lee-Hoeflich 2001). Regulatory Smad 1 and Smad 5 are activated (via phosphorylation) by ligand bound BMP receptors (von Bubnoff and Cho 2001). These regulatory Smads then interact with Smad 4 to form a heteromeric complex that translocates to the nucleus. This complex is able to activate or repress the transcription of selective genes that recognize this transcriptional complex, depending on which nuclear co-factors are present.
  • The BMP/Smad signaling pathway is negatively regulated by several mechanisms. Certain BMP-binding proteins (such as gremlin, BAMBI, or follistatin) bind BMPs and inhibit their interaction with BMP receptors. In addition, there are inhibitory Smad proteins (e.g. Smad 6 and Smad 7), which bind and inactivate BMP receptors. (Kowabata et al. 1998; Itoh et al. 2000; Miyazono 2000). The present inventors have discovered that human TM cells, ONH astrocytes and lamina cribrosa cells express message and protein for the BMP receptor complex. Thus, these cells could respond to endogenous BMP ligands.
  • Various methods may be used to discover new anti-glaucoma therapeutic agents, and these techniques are well known to those skilled in the art. For example, peptide or peptide mimetic agents that act as agonists or inhibitors of BMPs can be discovered through molecular modeling of BMP/BMP receptor structures (Nickel et al. 2001). BMP signal transduction involves select sets of Smad proteins (Kawabata et al. 1998; Itoh et al. 2000; Attiseno et al. 2000). Select BMP agonists and Smad agonists can be discovered using cell based assays. The test cell should express the appropriate BMP receptor(s) and possess the appropriate BMP signaling pathway. Because one of the major effects of BMP signaling is the alteration of gene expression, BMP agonists and Smad agonists can be discovered by screening for BMP-induced genes. The induction of BMP regulated genes also may be assayed by quantitating levels of mRNA using quantitative RT-PCR (Wang et al. 2001), DNA microarrays, or reporter gene constructs. There are natural inhibitors of BMP signaling, the BMP binding proteins (also known as BMP-associated proteins), such as chordin, gremlin, and follistatin. Antagonists of the protein inhibitors can be discovered using ligand binding assays. For example, test agents can be added to recombinant purified gremlin, and those agents that bind to gremlin are identified using a variety of techniques known to those skilled in the art. To determine whether these agents are gremlin antagonists, a cell based assay similar to that described above is used.
  • It is contemplated that any known in vitro and in vivo screening models may be used in conjunction with the present invention to identify new glaucoma therapies directed to the BMP family of genes. Such models are well known to those skilled in the art and their practice has become routine. Small peptides or peptide mimetics can be designed based on structure/function knowledge of the BMP, BMPR, and/or BMP binding protein gene products. Ligand binding assays can be used to detect small molecules that bind to BMPs, BMPRs, or BMP binding proteins. Cell based assays can look at the effects of various agents on BMP signaling pathways. Knock-in cell lines containing BMP family gene promoters coupled to a reporter gene can be generated to look for agents that alter BMP family member gene expression. These assays can be used to identify both agonist and antagonist molecules. Ex vivo assays, such as perfusion cultured anterior segments from human eyes (Clark et al. 1995a; Pang et al. 2000), can be used to examine the effects of agents on IOP and on BMP signaling in TM tissue. Rodent models of glaucoma can be generated using well-known techniques to create stable BMP family member transgenic, knockout, or knock-in strains of mice and rats. These rodent models can be used to screen for agents that alter the glaucoma-like phenotype(s) (e.g. tonometry to evaluate effects on IOP, histology to evaluate effects on glaucomatous optic neurology).
  • B. Kits
  • The present invention provides methods, compositions and kits for the early detection of glaucoma. The kits can contain a nucleic acid segment encoding a BMP polypeptide or protein. The kit can further contain reagents for detecting an interaction between a sample and a nucleic acid or peptide of the present invention. The provided reagent can be radio-, fluorescently- or enzymatically-labeled. The kit can contain a known radiolabeled agent capable of binding or interacting with a nucleic acid or peptide or protein of the present invention.
  • The reagent of the kit can be provided as a liquid solution, attached to a solid support or as a dried powder. Preferably, when the reagent is provided in a liquid solution, the liquid solution is an aqueous solution. Preferably, when the reagent provided is attached to a solid support, the solid support can be chromatography media, a test plate having a plurality of wells, or a microscope slide. When the reagent provided is a dry powder, the powder can be reconstituted by the addition of a suitable solvent, that may be provided.
  • In still further embodiments, the present invention concerns diagnostic methods and associated kits for the diagnosis of glaucoma. It is proposed that the BMP associated peptides and nucleic acids of the invention may be employed to detect polymorphisms or mutations in the BMP nucleic acids from patient samples. In general, these methods will include first obtaining a sample suspected of containing such a polymorphism or mutation, contacting the sample with a peptide or nucleic acid of the present invention, as the case may be, under conditions effective to allow the formation of a complex, and then detecting the presence of the complex.
  • In general, the detection of complex formation is quite well known in the art and may be achieved through the application of numerous approaches. For example, the present invention contemplates the application of ELISA, RIA, indirect fluorescence techniques and the like. Generally, complex formation will be detected through the use of a label, such as a radiolabel or an enzyme tag (such as alkaline phosphatase, horseradish peroxidase, or the like). Of course, one may find additional advantages through the use of a secondary binding ligand.
  • The following examples are representative of the techniques employed by the inventors in carrying out aspects of the present invention. It should be appreciated that while these techniques are exemplary of preferred embodiments for the practice of the invention, those of skill in the art, in light of the present disclosure, will recognize that numerous modifications can be made without departing from the spirit and intended scope of the invention.
  • EXAMPLE 1
  • Cell culture: Human TM cells and ONH cells were generated from donor eyes as described (Steely et al. 1992; Steely et al. 2000; Wilson et aL 1993; Clark et al. 1994; Clark et al. 1995b; Clark et al. 1995c; Clark et al. 1996; Clark et al. 2001a; Clark et al. 2001b; Dickerson et al. 1998; Wordinger et al. 1998; Wordinger et al. 1999; Wordinger et al. 2000; Wordinger et al. 2002; Lambert et al. 2001; Agarwal et al. 1999; Liu et al. 2001). TM cells were grown from TM explants of donors ranging in age from 6 days to 90 years. Human optic nerve head astrocytes and lamina cribrosa (LC) cells were generated from carefully dissected optic nerve heads (donors aged 2 days to 90 years) and characterized according to previous reports (Lambert et al. 2001; Clark et al. 1995a). The cells wers grown to confluency in the following media: Ham's F10 media (JRH Biosciences, Lenexa, Kans.) containing 10% fetal bovine serum (HyClone, Logan, Utah) and antibiotics (Gibco BRL-Life Technologies, Grand Island, N.Y.) for TM cells; Dulbecco's modified Eagle's media (DMEM, HyClone) containing 10% FBS for LC cells; and astrocyte growth medium (AGM, Clonetics, San Diego, Calif.) containing 5% FBS for ONH astrocytes.
  • RT-PCR: Human TM and ONH tissues also were dissected from donor eyes (Wordinger et al. 1998; Wang et al. 2001). Total RNA was extracted from the TM and ONH cells and tissues using TRIzol extraction (Gibco BRL-Life Technologies), and cDNA prepared by reverse transcription using standard procedures (Wordinger et al. 1998; Wordinger et al. 1999; Wordinger et al. 2000; Wordinger et al. 2002). PCR primers were designed using the Oligos 4.0 software program (see primer pairs in Table 1). All primer pairs were designed so that amplification of potentially contaminated genomic DNA sequences would produce mRNA PCR products that would be substantially larger than expected, because intron sequences that were excised during RNA processing would be included in genomic DNA. The β-actin PCR primers, AGGCCAACCGCGAGAAGATGACC (upstream) and GAAGTCCAGGGCGACGTAGCAC (downstream) with an annealing temperature of 55° C. yielded a PCR product of 350 bp.
  • PCR reactions were run as described (Wordinger et al. 1998; Wordinger et al. 1999; Wordinger et al. 2000; Lambert et al. 2001; Wordinger et al. 2002) using Taq Start Antibody Hot Start with the following cycle conditions: 2 minutes at 94° C., 2 minutes at 92° C., and 40 cycles of 30 seconds at the optimal annealing temperature, extension for 90 seconds at 72° C. and denaturation for 45 seconds at 92° C. The amplified PCR products were examined by horizontal electrophoresis in 1.5% agarose gels. To ensure specificity of the RT-PCR products, Southern blot analysis was performed with probes designed using Oligo 4.0 that hybridized to a region within the amplified PCR product. PCR products were sequenced to verify the specificity of the PCR reactions. Table 2 lists the members of the BMP family that are expressed in the human TM and ONH.
    TABLE 1
    PCR Primer Pairs, Annealing Temperature and Amplimer Size of BMPs
    Ampl.
    Assession Size
    Name Number Upstream PCR Primer Downstream PCR Primer (bp)
    BMP-2A NM_001200 ACTGCGGTCTCCTAAAGGTCGA GCTGACCTGAGTGCCTGCGAT 657
    (SEQ ID NO:9) (SEQ ID NO:10)
    BMP-4 NM_001202 GAATGCTGATGGTCGTTTTTATTATG AGACTGAAGGCGGTAAAGAT 348
    (SEQ ID NO:11) (SEQ ID NO:12)
    BMP-5 NM_021073 AAGAGGACAAGAAGGACTAAAAATAT GTAGAGATCCAGCATAAAGAGAGGT 303
    (SEQ ID NO:13) (SEQ ID NO:14)
    BMP-7 NM_001719 AGCCCGGGTAGCGCGTAGAG GCGCCGGTGGATGAAGCTCGA 202
    (SEQ ID NO:15) (SEQ ID NO:16)
    BMPR-1A NM_004329 TAAAGGTGACAGTACACAGGAACA TCTATGATGGCAAAGCAATGTCC 298
    (SEQ ID NO:17) (SEQ ID NO:18)
    BMPR-1B NM_001203 TACAAGCCTGCCATAAGTGAAGAAGC ATCATCGTGAAACAATATCCGTCTG 211
    (SEQ ID NO:19) (SEQ ID NO:20)
    BMPR-II NM_001204 TCCTCTCATCAGCCATTTGTCCTTTC AGTTACTACACATTCTTCATAG 457
    (SEQ ID NO:21) (SEQ ID NO:22)
    Chordin AF209930 CTCTGCTCACTCTGCACCTG CCGGTCACCATCAAAATAGC 198
    (CHRD) (SEQ ID NO:23) (SEQ ID NO:24)
    Gremlin NM_013372 ATCAACCGCTTCTGTTACGG ATGCAACGACACTGCTTCAC 197
    (CKTSF1B1) (SEQ ID NO:25) (SEQ ID NO:26)
    Follistatin NM_006350 TGCCACCTGAGAAAGGCTAC ACAGACAGGCTCATCCGACT 201
    (FST) (SEQ ID NO:27) (SEQ ID NO:28)
    Noggin NM_005450 GACTACGACCCAGGCTTCAT CTCCGCAGCTTCTTGCTTAG 212
    (NOG) (SEQ ID NO:29) (SEQ ID NO:30)
    CER-1 NM_005454 ATAGTGAGCCCTTCCCACCT AATGAACAGACCCGCATTTC 294
    (SEQ ID NO:33) (SEQ ID NO:34)
    NMA NM_005791 GATCGCCACTCCAGCTACATC GGGCACGGCAATGACC 471
    (BAMB1) (SEQ ID NO:35) (SEQ ID NO:36)
  • TABLE 2
    BMP Family Members Expressed in Human TM and ONH
    Optic
    BMP Trabecular Nerve
    Family Member Meshwork Head
    BMP-2 + +
    BMP-4 + +
    BMP-5 + +
    BMP-7 + +
    BMPR-IA + +
    BMPR-IB + +
    BMPR-II + +
    Chordin + +
    Gremlin + +
    Follistatin + +
    Bambi + +
    Noggin
    CER-1
  • Western immunoblotting: Protein was extracted from cultured cells using lysis buffer, and proteins were separated by denaturing polyacrylamide gel electrophoresis prior to electrophoretic transfer to nitrocellulose membranes (Lambert et al. 2001). The membranes were blocked with 5% milk (for BMPs) or 3% gelatin (for BMPRs) and incubated with the following primary antibodies: BMP2, BMP4, BMP5, BMP7 (all from Santa Cruz, Santa Cruz, Calif.), or BMP-RIA, BMP-RIB, BMP-RII (from Jackson Immuno Research, West Grove, Pa.). The membranes were washed, incubated with secondary antibodies (goat anti-mouse IgG-horseradish peroxidase for BMPs, Santa Cruz; donkey anti-goat-horseradish peroxidase for BMP receptors, Jackson Immuno Research), and developed using the WesternBeeze chemiluminescence immunodetection system (Invitrogen, Carlsbad, Calif.).
  • Expression of BMPs, BMPRs mRNA in human TM cells and tissues: Amplification products of expected for BMP-2, BMP-4, BMP-5 and BMP-7 primer pairs in human TM cells and tissues are shown in FIG. 6. Southern blots using specific probes verified that these were the expected PCR products. All human TM cell lines and tissues expressed message for BMP-2, BMP-4, and BMP-7. However, message for BMP-5 was low to undetectable in human TM tissue samples (FIG. 6, lanes 6 and 7). Control reactions without cDNA did not result in amplification products indicating that reagents and primers were free of DNA or RNA contamination (FIG. 6, lane C).
  • FIG. 7 shows the amplification products of expected size for BMP-RIA, BMP-RIB, and BMP-RII primer pairs in human TM cells and tissues. All human TM cells and tissues expressed message for the BMP receptor complexes. Southern blots using specific probes verified that these were the expected PCR products. An alternate amplification product (350 bp) was detected in the BMP-RII PCR reaction. The alternate amplification product was present in all human TM cells and tissues. This alternate band is currently being identified to determine if it is an alternate spliced form of the receptor. Control reactions without cDNA did not result in amplification products (FIG. 7, lane C) indicating that reagents and primers were free of DNA or RNA contamination.
  • Expression of BMP and BMP receptor mRNA in human ONH cells and tissues: Amplification products of expected size for BMP-2, BMP-4, BMP-5 and BMP-7 primer pairs in human ONH astrocytes and ONH tissues are shown in FIG. 8. All ONH astrocytes and ONH tissue expressed message for the respective BMP. Human brain astrocytes were used as a positive control cell line. Southern blots using specific probes verified that these were the expected PCR products. With the exception of BMP-2, all other BMP were expressed by human brain astrocytes (FIG. 8, lane 7). Control reactions without cDNA did not result in amplification products (FIG. 8, lane C) indicating that reagents and primers were free of DNA or RNA contamination.
  • FIG. 9 shows the amplification products of expected sizes for BMP-2, BMP-4, BMP-5 and BMP-7 primer pairs in cultured human LC cells. All LC cell lines expressed message for each BMP. Southern blots using specific probes verified that these were the expected PCR products. Control reactions without cDNA did not result in amplification products (FIG. 9, lane C) indicating that reagents and primers were free of DNA or RNA contamination.
  • Amplification products of expected size for BMP-RIA, BMP-RIB, and BMP-RII primer pairs in human ONH astrocytes and ONH tissues are shown in FIG. 10. All ONH astrocyte cell lines and tissues expressed message for BMP-RIA and BMP-RIB. Southern blots using specific probes verified that these were the expected PCR products. With the exception of ONH tissue (FIG. 10, lane 6), BMP-RII was expressed by all ONH astrocyte cell lines. Message for all BMP receptors (FIG. 10, lane 7) was expressed by a human brain astrocyte cell line that served as a positive control. There appears to be a discrepancy in the expression of BMP-RII in ONH tissue and ONH cell lines. The reduced expression in ONH tissue may reflect a low level of expression. Control reactions without cDNA did not result in amplification products (FIG. 5, lane C) indicating that reagents and primers were free of DNA or RNA contamination.
  • FIG. 11 shows the amplification products of expected size for BMP-RLA, BMP-RIB, and BMP-RII primer pairs in cultured human LC cells. All LC cell lines expressed message for each BMP receptor. Southern blots using specific probes verified that these were the expected PCR products. Control reactions without cDNA did not result in amplification products (FIG. 11, lane C) indicating that reagents and primers were free of DNA or RNA contamination.
  • Expression of BMP proteins and BMP receptor proteins in human TM and ONH cells and tissues: FIG. 12 represents chemiluminescent immunoblot detection of BMP-2, BMP-4, BMP-5, BMP-7, BMP-RIA, BMP-RIB, and BMP-RII proteins in human TM and ONH cells and tissues. All cell lines studied expressed the respective BMP proteins. The BMP proteins were detected in cell lines the following molecular weights: 54-56 kDa for BMP-2, 25-27 kDa for BMP-4, 55-57 kDa for BMP-5, and 77 kDa for BMP-7. Multiple bands were detected for BMP-2 and BMP-4, which most likely represent glycosylated, and partially glycosylated forms of these BMPs as seen in other studies. However, we did not do glycosylation studies as they were beyond the scope of this study. The BMP receptor proteins were detected in cell lines at molecular weights: 38 kDa for BMP-RIA, 64 kDa for BMP-RIB, and 57 kDa for BMP-RII. Multiple bands were detected for BMP-RIB and BMP-RII in the TM cells, which most likely represent glycosylated, and partially glycosylated forms as seen in other studies. The expression levels of proteins for the BMP receptors appeared to be lower in the TM cells compared to ONH cells. For example BMP-RII was not detected in TM cells and BMP-RIB was greatly reduced.
  • Expression of BMP associated protein mRNAs in cultured human TM cells and in human ONH cells: Amplification products of expected size for BMP associated protein primer pairs in human TM cell lines are shown in FIG. 13. Human TM cell lines expressed message for DRM (gremlin), chordin, follistatin, and NMA (AMBI). Southern blots using specific probes verified that these were the expected PCR products. There was no apparent difference in message expression between cell lines. All human TM cells examined failed to express mRNA for the BMP associated proteins noggin and Cer-1. Control reactions without cDNA did not result in amplification products indicating that reagents and primers were free of DNA or RNA contamination.
  • Amplification products of expected size for BMP associated protein primer pairs in ONH astrocytes and LC cell lines are shown in FIG. 14. All ONH astrocytes and LC cell lines expressed message for DRM (gremlin), follistatin and NMA (BAMBI). Southern blots using specific probes verified that these were the expected PCR products. The majority of LC cells and ONH astrocytes expressed message for chordin. All human ONH astrocytes and LC cells examined failed to express mRNA for the BMP associated proteins noggin and Cer-1. Control reactions without cDNA did not result in amplification products indicating that reagents and primers were free of DNA and RNA contamination.
  • FIG. 15 shows increased expression of the BMP antagonist gremlin (CKTSF1B1) in glaucomatous TM cells. Gene expression was assessed using Affymetrix gene arrays (Affymetrix gene chip U133A).
  • All of the compositions and/or methods disclosed and claimed herein can be made and executed without undue experimentation in light of the present disclosure. While the compositions and methods of this invention have been described in terms of preferred embodiments, it will be apparent to those of skill in the art that variations may be applied to the compositions and/or methods and in the steps or in the sequence of steps of the method described herein without departing from the concept, spirit and scope of the invention. More specifically, it will be apparent that certain agents which are both chemically and structurally related may be substituted for the agents described herein to achieve similar results. All such substitutions and modifications apparent to those skilled in the art are deemed to be within the spirit, scope and concept of the invention as defined by the appended claims.
  • References
  • The following references, to the extent that they provide exemplary procedural or other details supplementary to those set forth herein, are specifically incorporated herein by reference.
  • Books
      • Birren, et al., GENOME ANALYSIS, Vol. 2, (1998).
      • Clark A F, Browder S, Steely H T, Wilson K, Cantu-Crouch D, McCartney M D, “Cell biology of the human lamina cribrosa,” In Drance S M (ed). OPTIC NERVE IN GLAUCOMA. Kugler Publications, New York: pp. 79-105 (1995b).
      • Cummings, Michael R., HUMAN HEREDITY, Fourth Edition, (1997).
      • Grierson I, Calthorpe C M, “Characteristics of meshwork cells and age changes in the outflow system of the eye: their relevance to primary open angle glaucoma.” In Mills K B (ed). GLAUCOMA. PROCEEDINGS OF THE FOURTH INTERNATIONAL SYMPOSIUM OF THE NORTHERN EYE INSTITUTE, Manchester, UK, New York, Pergamon: pp. 12-31 (1988).
      • Hernandez M, Gong H, “Extracellular matrix of the trabecular meshwork and optic nerve head.” in Ritch R., Shields, M. B., Krupin, T. (eds). THE GLAUCOMAS, 2nd ed. St Louis: Mosby-Year; pp. 213-249 (1996).
      • Jorde, et al., MEDICAL GENETICS, Second Edition, (1999).
      • Lutjen-Drecoll E., Rohen J. W., “Morphology of aqueous outflow pathways in normal and glaucomatous eyes,” in Ritch R., Shields, M. B., Krupin, T. (eds). THE GLAUCOMAS, 2nd ed. St Louis: Mosby-Year; pp. 89-123 (1996).
      • Strachan, et al., HUMAN MOLECULAR GENETICS, (1996).
      • Tripathi R C, Borisuth N S, Li, J, Tripathi B J, “Clinical implications of aqueous humor growth factors in glaucoma,” in Ritch R., Shields, M. B., Krupin, T. (eds). THE GLAUCOMAS, 2nd ed. St Louis: Mosby-Year; pp. 71-87 (1996).
      • Varma R, Minckler D, “Anatomy and pathophysiology of the retina and optic nerve.” in Ritch R., Shields, M. B., Krupin, T. (eds). THE GLAUCOMAS, 2nd ed. St Louis: Mosby-Year; pp. 139-175 (1996).
      • Vaughan, D. et al., In: GENERAL OPHTHALMOLOGY, Appleton & Lange, Norwalk, Conn., pp.213-230 (1992).
  • Other Publications
      • Agarwal et al., IOVS 38(4):S563 (1997)
      • Agarwal R, Talati M, Lambert W, Clark A F, Wilson S E, Agarwal N, Wordinger R J, “FAS-activated apoptosis and other apoptosis mediators in human trabecular meshwork cells,” Exp. Eye Res. 68:583-590 (1999).
      • Astrom, A. K., Jin, D., Imanura, T., Roijer, E., Rosenzweig, B., Miyazono, K., ten Dijke, P., Stenman, G., Mamm. Genome 10(3):299-302 (1999).
      • Attisano L, Tuen Lee-Hoeflich S, “The Smads,” Genome Biol. 2:REVIEWS3010 (2001).
      • Bengtsson, B., Br. J. Ophthalmol. 73:483-487 (1989).
      • Chang B, Smith R S, Peters M, Savinova D V, Hawes N L, Zabalata A, Nusinowitz S, Martin J E, Davisson M L, Sepko C L, Hogan B M L, John S W M, “Haploinsufficient Bmp4 ocular phenotypes include anterior segment dysgenesis with elevated intraocular pressure,” BMC Genetics 2:18 (2001).
      • Chundru R K, Agarwal R, Wordinger R J, Whitson J T, “Detection of neurotrophins in human aqueous humor,” Invest. Ophthalmol. Vis. Sci. 41 :S236 (2000).
      • Clark A F, Kawase K, English-Wright S, Lane D, Steely H T, Yamamoto T, Kitazawa Y, Kwon Y H, Fingert J H, Swiderski R E, Mullins R F, Hageman G S, Alward W L M, Sheffield V C, Stone E M, “Expression of the glaucoma gene myocilin (MYOC) in the human optic nerve head,” FASEB J. 15:1251-1253 (2001).
      • Clark A F, Lane D, Wilson K, Miggans S T, McCartney M D, “Inhibition ofdexamethasone-induced cytoskeletal changes in cultured human trabecular meshwork cells by tetrahydrocortisol,” Invest. Ophthalmol. Vis. Sci. 35:805-813 (1996).
      • Clark A F, Miggans S T, Wilson K, Browder S, McCartney M D, “Cytoskeletal changes in cultured human glaucoma trabecular meshwork cells,” J. Glaucoma 4:183-188 (1995c).
      • Clark A F, Steely H T, Dickerson J E, English-Wright S, Stropki K, McCartney M D, Jacobson N, Shepard A R, Clark J I, Matsushima H, Peskind E R, Leverenz J B, Wilkinson C W, Swiderski R E, Fingert J H, Sheffield V C, Stone E M, “Glucocorticoid induction of the glaucoma gene MYOC in human and monkey trabecular meshwork cells and tissues,” Invest. Ophthalmol. Vis. Sci. 42:1769-1780 (2001b).
      • Clark A F, Wilson K, de Kater A W, Allingham R R, McCartney M D, “Dexamethasone-induced ocular hypertension in perfusion-cultured human eyes,” Invest. Ophthalmol. Vis. Sci. 36:478-489 (1995a).
      • Clark A F, Wilson K, McCartney M D, Miggans S T, Kunkle M, Howe W, “Glucocorticoid-induced formation of cross-linked actin networks in cultured human trabecular meshwork cells,” Invest. Ophthalmol. Vis. Sci. 35:281-294 (1994).
      • Dickerson J E, Steely H T, English-Wright S L, Clark A F, “The effect of dexamethasone on integrin and laminin expression in cultured human trabecular meshwork cells,” Exp. Eye Res. 66:731-738 (1998).
      • Dudley A T, Lyons K M, Robertson E J, “A requirement for bone morphogenicprotein-7 during development of the mammalian kidney and eye,” Genes Dev. 9:2795-2807 (1995).
      • Furuta Y, Hogan B L, “BMP4 is essential for lens induction in the mouse embryo,” Genes Dev. 12:3764-3775 (1998).
      • Greve, M. et al., Can. J. Ophthamol. 28:201-206 (1993).
      • Giguere et al., Cell 46:645-652 (1986).
      • Hernandez M R, Andrzejewska W M, Neufeld A H, “Changes in the extracellular matrix of the human optic nerve head in primary open-angle glaucoma,” Am. J. Ophthalmol. 109:180-188 (1990).
      • Hernandez M R, Pena J D, “The optic nerve head in glaucomatous optic neuropathy,” Arch Ophthalmol. 115:389-395 (1997).
      • Hitchings, R. A., Br. J. Ophthamol. 77:326 (1993).
      • Hogan B L, “Bone morphogenic proteins: multifunctional regulators of vertebrate development,” Genes Dev. 10:1580-1594 (1996).
      • Hu D N, Ritch R, “Hepatocyte growth factor is increased in the aqueous humor of glaucomatous eyes,” J. Glaucoma 10:152-157 (2001).
      • Inatani M, Tanihara H, Katsuta H, Honjo M, Kido N, Honda Y, “Transforming growth factor beta 2 levels in aqueous humor of glaucomatous eyes,” Graefes Arch. Clin. Exp. Ophthalmol. 239:109-113 (2001).
      • Itoh et al., Eur. J. Biochem. 267:6954-6967 (2000).
      • Jena N, Martin-Seisdedos C, McCue P, Croce C M, “BMP7 null mutation in mice: developmental defects in skeleton, kidney, and eye,” Exp. Cell Res. 230:28-37 (1997).
      • Kawabata et al., Cytokine & Growth Factor Review, 9:49-61 (1998).
      • Kerrigan L A, Zack D J, Quigley H A, Smith S D, Pease M E, “TUNEL-positive ganglion cells in human primary open-angle glaucoma,” Arch. Ophthalmol. 115:1031-1035 (1997).
      • Lambert et al., IOVS 38(4):S162 (1997).
      • Lambert W, Agarwal R, Howe W, Clark A F, Wordinger R J, “Neurotrophin and neurotrophin receptor expression by cells of the human lamina cribrosa,” Invest. Ophthalmol. Vis. Sci., 42:2315-2323 (2001).
      • Leske, M. C. et al., Amer. J. Epidemiol. 113:1843-1846 (1986).
      • Liu et al., IOVS 40(4):S673 (1999).
      • Liu Y, Belayev L, Zhao W, Busto R, Saul I, Alonso O, Ginsberg M D, “The effect of bone morphogenic protein-7 (BMP-7) on functional recovery, local cerebral glucose utilization and blood flow after transient focal cerebral ischemia in rats,” Brain Res. 905:81-90 (2001).
      • Liu X, Lambert W, Agarwal R, Talati M, Cross W, Clark A F, Wordinger R J, “Human trabecular meshwork cells express the ciliary neurotrophic factor (CNTF) tripartate receptor complex,” Exp. Eye Res. 72:711-717 (2001).
      • Luo G, Gofinann C, Bronckers A L, Sohocki M, Bradley A, Karsenty G, “BMP-7 is an inducer of nephrogenesis, and is also required for eye development and skeletal patterning,” Genes Dev. 9:2808-2820 (1995).
      • McMahon, R., Murphy, M., Clarkson, M., Taal, M., Mackenzie, H. S., Godson, C., Martin, F., Brady, H. R., J. Biol. Chem. 275(14):9901-9904 (2000).
      • Miyazono, J. Cell Science, 113:1101-1109 (2000).
      • Mohan R R, Kim W J, Mohan R R, Chen L, Wilson S E, “ Bone morphogenic proteins 2 and 4 and their receptors in the adults human cornea,” Invest. Ophthalmol. Vis. Sci. 39:2626-2636 (1998).
      • Morrison J C, Dorman-Pease M E, Dunkelberger G R, Quigley H A, “Optic nerve head extracellular matrix in primary optic atrophy and experimental glaucoma,” Arch. Ophthalmol. 108:1020-1024 (1990).
      • Murphy, M., Godson, C., Cannon, S., Kato, S., Mackenzie, H. S., Martin, F., Brady, H. R., J. Biol. Chem. 274(9):5830-5834 (1999).
      • Nickel J, Dreyer M K, Kirsch T, Sebold W, “The crystal structure of BMP-2:BMPR-1A complex and the generation of BMP-2 antagonists,” J. Bone & Joint Surgery 83-A(suppl 1):S1-S7 (2001).
      • Nohno, T., Ishikawa, T., Saito, T., Hosokawa, K., Noji, S., Wolsing, D. H., Rosenbaum, J. S., J. Biol. Chem. 270(38):22522-22526 (1995).
      • Nonner D, Barrett E F, Kaplan P, Barrett J N, “Bone morphogenic proteins (BMP6 and BMP7) enhance the protective effect of neurotrophins on cultured septal cholinergic neurons during hypoglycemia,” J. Neurochem. 77:691-699 (2001).
      • Obata H, Kaji Y, Yamada H, Kato M, Tsuru T, Yamashita H, “Expression of tranfsorming growth factor-beta superfamily receptors in rat eyes,” Acta. Ophthalmol. Scand. 77:151-156 (1999).
      • Pang I -H, McCartney M D, Steely H T, Clark A F, “Human ocular perfusion organ culture: a versatile ex vivo modelfor glaucoma research,” J. Glaucoma 9:468-479 (2000).
      • Pena J D, Taylor A W, Ricard C S, Vidal I, Hernandez M R, “Transforming growth factor beta isoforms in human optic nerve heads,” Br. J. Ophthalmol. 83:209-218 (1999).
      • Picht G, Welge-Luessen U, Grehn F, Lutjen-Drecoll E, “Transforming growth factor beta 2 levels in the aqueous humor in different types of glaucoma and the relation to filtering bleb development,” Graefes Arch. Clin. Exp. Ophthalmol. 239:199-207 (2001).
      • Quigley H A, McKinnon S J, Zack D J, Pease M E<Kerrigan-Baunrind L A, Kerrigan D F, Mitchell R S, “Retrograde axonal transport of BDNF in retinal ganglion cells is blocked by acute IOP elevation in rats,” Invest. Ophthalmol. Vis. Sci. 41:3460-3466 (2000).
      • Quigley H A, “Neuronal death in glaucoma,” Prog. Retin. Eye Res. 18:39-57 (1999).
      • Quigley H A, Nickells R W, Kerrigan L A, Pease M E, Thibault D J, Zack D J, “Retinal ganglion cell death in experimental glaucoma and after axotomy occurs by apoptosis,” Invest. Ophthalmol. Vis. Sci. 36:774-786 (1995).
      • Reddi A H, “Bone morphonegetic proteins: an unconventional approach to isolation of first mammalian morphogens,” Cytokine Growth Factor Rev. 8:11-20 (1997).
      • Reddi A H, “Bone morphogenic proteins and skeletal development: the kidney-bone connection,” Pediatr. Nephrol. 14:598-601 (2000).
      • Rohen J W, “Why is intraocular pressure elevated in chronic simple glaucoma? Anatomical considerations.” Ophthalmology 90:758-765 (1983).
      • Steely H T, Browder S L, Julian M B, Miggans S T, Wilson K L, Clark A F, “The effects of dexamethasone on fibronectin expression in cultured human trabecular meshwork cells,” Invest. Ophthalmol. Vis. Sci. 33: 2242-2250 (1992).
      • Steely H T, English-Wright S L, Clark A F, “Similarity of protein expression in trabecular meshwork and lamina cribrosa: implications for glaucoma,” Exp. Eye Res. 70:17-30 (2000).
      • Strong, N. P., Ophthal. Physiol. Opt. 12:3-7 (1992).
      • ten Dijke, P. P., Ichijo, H., Franzen, P., Schulz, P., Saras, J., Toyoshima, H., Heldin, C. H., Miyazono, K., Oncogene 8(10):2879-2887 (1993).
      • Tripathi R C, Borisuth N S, Kolli S P, Tripathi B J, “Trabecular cells express receptors that bind TGF-beta 1 and TGF-beta 2: a qualitative and quantitative characterization,” Invest. Ophthalmol. Vis. Sci. 34:260-263 (1993b).
      • Tripathi R C, Borisuth N S, Tripathi B J, “Detection, quantification, and significance of basic fibroblast growth factor in the aqueous humor of man, cat, dog and pig,” Exp. Eye Res. 54:447-454 (1992).
      • Tripathi R C, Borisuth N S, Tripathi B J, Fang V S, “Analysis of human aqueous humor for epidermal growth factor,” Exp. Eye Res. 53:407-409 (1991).
      • Tripathi R C, Chan W F, Li J, Tripathi B J, “Trabecular cells express the TFG-beta 2 gene and secrete the cytokine,” Exp. Eye Res. 58:523-528 (1994a).
      • Tripathi R C, Li J, Borisuth N S, Tripathi B J, “Trabecular cells of the eye express messenger RNA for transforming growth factor-beta 1 and secrete this cytokine,” Invest. Ophthalmol. Vis. Sci. 34:2562-2569 (1993a).
      • Tripathi R C, Li J, Chan W F, Tripathi B J, “Aqueous humor in glaucomatous eyes contains an increased level of TFG-beta 2,” Exp. Eye Res. 59:723-727 (1994c).
      • Tripathi R C, Li J, Tripathi B J, “Immunolocalization of bFGF in the trabecular meshwork and detection of its mRNA in trabecular cells,” Exp. Eye Res. 58:503-507 (1994b).
      • Trousse F, Esteve P, Bovolenta P, “BMP4 mediates apoptotic cell death in the developing chick eye,” J. Neurosci. 21:1292-1301 (2001).
      • Tuck, M. W. et al., Ophthal. Physiol. Opt. 13:227-232 (1993).
      • Vernon, S. A., Eye 7:134-137 (1993).
      • Von Bubnoff A, Cho K W, “Intracellular BMP signaling regulation in vertebrates: pathway or network?” Dev. Biol. 239:1-14 (2001).
      • Wang W -H, McNatt L G, Shepard A R, Jacobson N, Nishimura D Y, Stone E M, Sheffield V C, Clark A F, “Optimal procedure for extracting RNA from human ocular tissues and expression profiling of the congenital glaucoma gene FOXC1 using quantitative RT-PCR,” Molecular Vision 7:89-94 (2001).
      • Wilson K, McCartney M D, Miggans S T, Clark A F, “Dexamethasone induced ultrastructural changes in cultured human trabecular meshwork cells,” Current Eye Research 12:783-793 (1993).
      • Wordinger et al., IOVS 40(4):S504 (1999a).
      • Wordinger R J, Agarwal R, Talati M, Fuller J, Lambert W, Calrk A F, “Expression of bone morphogenic proteins (BMP), BMP receptors, and BMP associated proteins in human trabecular meshwork and optic nerve head cells and tissues,” Molec. Vision 8:241-256 (2002).
      • Wordinger R J, Clark A F, Agarwal R, Lambert W, McNatt L, Wilson S E, Qu E, Fung B K -K, “Cultured human trabecular meshwork cells express functional growth factor receptors,” Invest. Ophthalmol. Vis. Sci. 39: 1575-1589 (1998).
      • Wordinger R J, Clark A F, Agarwal R, Lambert W, Wilson S E, “Expression of alternatively spliced growth factor receptor isoforms in the human trabecular meshwork,” Invest. Ophthalmol. Vis. Sci. 40:242-247 (1999b).
      • Wordinger R J, Lambert W, Agarwal R, Talati M, Clark A F, “Human trabecular meshwork cells secrete neurotrophins and express neurotrophin receptors (Trk),” Invest. Ophthalmol. Vis. Sci. 41:3833-3841 (2000).
      • Yamashita H, Ten Dijke P, Heldin C H, Miyazono K, “Bone morphogenic protein receptors,” Bone 19:569-574 (1996).
      • You L, Kruse F E, Pohl J, Volcker H E, “Bone morphogenic proteins and growth and differentiation factors in the human cornea,” Invest. Ophthalmol. Vis. Sci. 40:296-311 (1999).
      • Zhang D, Mehler M F, Song Q, Kessler J A, “Development of bone morphogenic protein receptors in the nervous system and possible roles in regulating trkC expression,” J. Neurosci. 18:3314-3326 (1998).

Claims (7)

1. A method for diagnosing glaucoma in a sample obtained from a cell or bodily fluid by detecting altered expression of a bone morphogenic family member gene, said method comprising the steps of:
g) obtaining a tissue or fluid sample from a patient suspected of having glaucoma;
h) extracting DNA from said sample;
i) obtaining a plurality of PCR primers, wherein said primers each comprise a sequence consisting of from 18 to 1547 contiguous nucleotides from SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:37, SEQ ID NO:39, SEQ ID NO:41, SEQ ID NO:43, SEQ ID NO:45, SEQ ID NO:47, or SEQ ID NO:53;
j) amplifying regions of the extracted DNA using said primers to obtain a PCR product;
k) resolving the PCR product; and
l) identifying differences between the sequence of the amplified extracted DNA and the sequence of the primer;
where a difference between the amplified sequence and the primer is diagnostic of glaucoma.
2. The method of claim 1, wherein said tissue or fluid sample is blood or buccal cells.
3. The method of claim 1, wherein the primers comprise sequences consisting of from 20 to 100 contiguous nucleotides of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:37, SEQ ID NO:39, SEQ ID NO:41, SEQ ID NO:43, SEQ ID NO:45, SEQ ID NO:47, or SEQ ID NO:53.
4. The method of claim 1, wherein the primers comprise sequences consisting of from 20 to 50 contiguous nucleotides of SEQ ID NO:3.
5. The method of claim 1, wherein the PCR product is resolved by SSCP, DGGE, ASO or RFLP.
6. A method for treating glaucoma comprising administering to a patient in need thereof a composition comprising a sequence consisting of at least one compound selected from the group consisting of a BMP2 agonist, a BMP4 agonist, a BMP5 agonist, a BMP7 agonist, a Smad ⅕ agonist, a chordin antagonist, a gremlin antagonist and a follistatin antagonist.
7. A method for identifying a therapeutic agent for the treatment of glaucoma, said method comprising:
d) obtaining a first composition comprising a population of recombinant cells expressing BMP-2A, BMP4, BMP-5, or BMP7;
e) obtaining a candidate substance;
f) incubating said composition and said candidate substance;
g) testing said composition for its ability to turn on BMP-induced Smad signaling pathways or BMP-regulated gene expression; and
h) identifying a candidate substance that inhibits, or stimulates, BMP-induced Smad signaling pathways or BMP-regulated gene expression.
US10/492,380 2001-10-31 2002-10-31 Bone morphogenic proteins (bmp),bmp receptors and bmp binding proteins and their use in the diagnosis and treatment of glaucoma Abandoned US20050118585A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US10/492,380 US20050118585A1 (en) 2001-10-31 2002-10-31 Bone morphogenic proteins (bmp),bmp receptors and bmp binding proteins and their use in the diagnosis and treatment of glaucoma

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US33485201P 2001-10-31 2001-10-31
PCT/US2002/035251 WO2003055443A2 (en) 2001-10-31 2002-10-31 Bone morphogenic proteins (bmp), bmp receptors and bmp binding proteins and their use in the diagnosis and treatment of glaucoma
US10/492,380 US20050118585A1 (en) 2001-10-31 2002-10-31 Bone morphogenic proteins (bmp),bmp receptors and bmp binding proteins and their use in the diagnosis and treatment of glaucoma

Publications (1)

Publication Number Publication Date
US20050118585A1 true US20050118585A1 (en) 2005-06-02

Family

ID=23309139

Family Applications (5)

Application Number Title Priority Date Filing Date
US10/492,380 Abandoned US20050118585A1 (en) 2001-10-31 2002-10-31 Bone morphogenic proteins (bmp),bmp receptors and bmp binding proteins and their use in the diagnosis and treatment of glaucoma
US10/286,152 Expired - Fee Related US7405192B2 (en) 2001-10-31 2002-10-31 Bone morphogenic proteins (BMP), BMP receptors and BMP binding proteins and their use in the diagnosis and treatment of glaucoma
US12/106,653 Expired - Fee Related US7744873B2 (en) 2001-10-31 2008-04-21 Method for treating glaucoma comprising administering to a patient in need thereof a composition comprising an antibody against gremlin
US12/766,056 Expired - Fee Related US8063013B2 (en) 2001-10-31 2010-04-23 Method of treating glaucoma comprising administering a composition comprising human BMP7
US13/281,816 Expired - Fee Related US8389496B2 (en) 2001-10-31 2011-10-26 Bone morphogenic proteins (BMP), BMP receptors and BMP binding proteins and their use in the diagnosis and treatment of glaucoma

Family Applications After (4)

Application Number Title Priority Date Filing Date
US10/286,152 Expired - Fee Related US7405192B2 (en) 2001-10-31 2002-10-31 Bone morphogenic proteins (BMP), BMP receptors and BMP binding proteins and their use in the diagnosis and treatment of glaucoma
US12/106,653 Expired - Fee Related US7744873B2 (en) 2001-10-31 2008-04-21 Method for treating glaucoma comprising administering to a patient in need thereof a composition comprising an antibody against gremlin
US12/766,056 Expired - Fee Related US8063013B2 (en) 2001-10-31 2010-04-23 Method of treating glaucoma comprising administering a composition comprising human BMP7
US13/281,816 Expired - Fee Related US8389496B2 (en) 2001-10-31 2011-10-26 Bone morphogenic proteins (BMP), BMP receptors and BMP binding proteins and their use in the diagnosis and treatment of glaucoma

Country Status (16)

Country Link
US (5) US20050118585A1 (en)
EP (2) EP2053135A1 (en)
JP (2) JP4255382B2 (en)
KR (4) KR101072867B1 (en)
CN (2) CN1685055A (en)
AT (1) ATE349554T1 (en)
BR (1) BR0213738A (en)
CA (1) CA2463143A1 (en)
DE (1) DE60217152T2 (en)
ES (1) ES2278079T3 (en)
HK (1) HK1069851A1 (en)
MX (1) MXPA04003697A (en)
PL (2) PL214839B1 (en)
RU (3) RU2336902C2 (en)
WO (1) WO2003055443A2 (en)
ZA (1) ZA200402662B (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20080051361A1 (en) * 2006-08-24 2008-02-28 Alcon Manufacturing, Ltd. Rnai-mediated inhibition of gremlin for treatment of iop-related conditions

Families Citing this family (93)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1685055A (en) 2001-10-31 2005-10-19 爱尔康公司 Bone morphogenic proteins (BMP), BMP receptors and BMP binding proteins and their use in the diagnosis and treatment of glaucoma
US7193069B2 (en) 2002-03-22 2007-03-20 Research Association For Biotechnology Full-length cDNA
EP1627916B1 (en) * 2003-05-28 2009-11-25 Takeda Pharmaceutical Company Limited Anti-BAMBI antibodies or RNA for diagnosis and therapy of colon or liver cancer
CA2475769C (en) * 2003-08-28 2018-12-11 Veridex, Llc Colorectal cancer prognostics
BR122018071808B8 (en) 2003-11-06 2020-06-30 Seattle Genetics Inc conjugate
CA2567810A1 (en) 2004-05-27 2005-12-08 Acceleron Pharma Inc. Cerberus/coco derivatives and uses thereof
US9045553B2 (en) 2004-05-27 2015-06-02 Acceleron Pharma, Inc. Cerberus/Coco derivatives and uses thereof
BRPI0510883B8 (en) 2004-06-01 2021-05-25 Genentech Inc drug-antibody conjugate compound, pharmaceutical composition, method of manufacturing a drug-antibody conjugate compound, and uses of a formulation, a drug-antibody conjugate and a chemotherapeutic agent, and a combination
US20100111856A1 (en) 2004-09-23 2010-05-06 Herman Gill Zirconium-radiolabeled, cysteine engineered antibody conjugates
RU2412947C2 (en) 2004-09-23 2011-02-27 Дженентек, Инк. Antibodies, constructed on cysteine basis and their conjugates
EP1817059A2 (en) 2004-12-01 2007-08-15 Genentech, Inc. Conjugates of 1,8-bis-naphthalimides with an antibody
WO2007028212A1 (en) * 2005-09-08 2007-03-15 Apollo Life Sciences Limited Noggin and chimeric molecules thereof
US10059756B2 (en) 2006-11-02 2018-08-28 Acceleron Pharma Inc. Compositions comprising ALK1-ECD protein
US8642031B2 (en) 2006-11-02 2014-02-04 Acceleron Pharma, Inc. Antagonists of BMP9, BMP10, ALK1 and other ALK1 ligands, and uses thereof
MX2009004718A (en) 2006-11-02 2009-06-19 Acceleron Pharma Inc Alk1 receptor and ligand antagonists and uses thereof.
EP2099471A2 (en) 2006-12-08 2009-09-16 Acceleron Pharma, Inc. Uses of cerberus, coco and derivatives thereof
KR20190128254A (en) 2008-05-02 2019-11-15 악셀레론 파마 인코포레이티드 Methods and compositions based on alk1 antagonists for modulating angiogenesis and pericyte coverage
US8900589B2 (en) 2008-07-15 2014-12-02 Genetech, Inc. Anthracycline derivative conjugates, process for their preparation and their use as antitumor compounds
IN2012DN03025A (en) 2009-09-09 2015-07-31 Ct Se Llc
BR112012008848A2 (en) 2009-10-16 2019-09-24 Scripps Research Inst in vitro or ex vivo method for inducing non-pluripotent mammalian cells into induced pluripotent stem cells
US20130089560A1 (en) * 2010-03-17 2013-04-11 Oncomed Pharmaceuticals Inc Bone morphogenetic protein receptor binding agents and methods of their use
TWI540136B (en) 2010-04-15 2016-07-01 梅迪繆思有限公司 Pyrrolobenzodiazepines and conjugates thereof
SG185428A1 (en) 2010-06-08 2012-12-28 Genentech Inc Cysteine engineered antibodies and conjugates
JP5889912B2 (en) 2010-11-17 2016-03-22 ジェネンテック, インコーポレイテッド Alaninyl maytansinol antibody conjugate
JP5987053B2 (en) 2011-05-12 2016-09-06 ジェネンテック, インコーポレイテッド Multiple reaction monitoring LC-MS / MS method for detecting therapeutic antibodies in animal samples using framework signature peptides
CN103987407B (en) 2011-10-14 2016-08-24 麦迪穆有限责任公司 Pyrrolobenzodiazepines Zhuo and conjugate thereof
WO2013130093A1 (en) 2012-03-02 2013-09-06 Genentech, Inc. Biomarkers for treatment with anti-tubulin chemotherapeutic compounds
WO2013137686A1 (en) * 2012-03-15 2013-09-19 서울대학교 산학협력단 Gremlin-1 antibody
ES2680153T3 (en) 2012-10-12 2018-09-04 Adc Therapeutics Sa Anti-PSMA-pyrrolobenzodiazepine antibody conjugates
RS58921B1 (en) 2012-10-12 2019-08-30 Medimmune Ltd Pyrrolobenzodiazepines and conjugates thereof
AU2013328628B2 (en) 2012-10-12 2016-12-15 Adc Therapeutics Sa Pyrrolobenzodiazepine-anti-CD22 antibody conjugates
DK2906296T3 (en) 2012-10-12 2018-05-22 Adc Therapeutics Sa Pyrrolobenzodiazepine-antibody conjugates
US9931414B2 (en) 2012-10-12 2018-04-03 Medimmune Limited Pyrrolobenzodiazepine-antibody conjugates
US10695433B2 (en) 2012-10-12 2020-06-30 Medimmune Limited Pyrrolobenzodiazepine-antibody conjugates
SI2906253T1 (en) 2012-10-12 2018-11-30 Adc Therapeutics Sa Pyrrolobenzodiazepine - anti-psma antibody conjugates
US9562049B2 (en) 2012-12-21 2017-02-07 Medimmune Limited Pyrrolobenzodiazepines and conjugates thereof
EP2935273A1 (en) 2012-12-21 2015-10-28 MedImmune Limited Unsymmetrical pyrrolobenzodiazepines-dimers for use in the treatment of proliferative and autoimmune diseases
KR102066318B1 (en) 2013-03-13 2020-01-14 메디뮨 리미티드 Pyrrolobenzodiazepines and conjugates thereof
EA027910B1 (en) 2013-03-13 2017-09-29 Медимьюн Лимитед Pyrrolobenzodiazepines and conjugates thereof
MX362970B (en) 2013-03-13 2019-02-28 Medimmune Ltd Pyrrolobenzodiazepines and conjugates thereof.
EP2970448B1 (en) 2013-03-14 2021-11-03 Regeneron Pharmaceuticals, Inc. Human antibodies to grem 1
WO2015023355A1 (en) 2013-08-12 2015-02-19 Genentech, Inc. 1-(chloromethyl)-2,3-dihydro-1h-benzo[e]indole dimer antibody-drug conjugate compounds, and methods of use and treatment
GB201317982D0 (en) 2013-10-11 2013-11-27 Spirogen Sarl Pyrrolobenzodiazepines and conjugates thereof
US9956299B2 (en) 2013-10-11 2018-05-01 Medimmune Limited Pyrrolobenzodiazepine—antibody conjugates
EP3054985B1 (en) 2013-10-11 2018-12-26 Medimmune Limited Pyrrolobenzodiazepine-antibody conjugates
US10010624B2 (en) 2013-10-11 2018-07-03 Medimmune Limited Pyrrolobenzodiazepine-antibody conjugates
CA2929565A1 (en) 2013-12-16 2015-06-25 Genentech, Inc. 1-(chloromethyl)-2,3-dihydro-1h-benzo[e]indole dimer antibody-drug conjugate compounds, and methods of use and treatment
WO2015095223A2 (en) 2013-12-16 2015-06-25 Genentech, Inc. Peptidomimetic compounds and antibody-drug conjugates thereof
CR20160271A (en) 2013-12-16 2016-12-02 Genentech Inc PEPTIDOMETIC COMPOUNDS AND THEIR ANTIBODY-DRUG CONJUGATES
EP3166624B1 (en) 2014-07-09 2020-06-03 Mayo Foundation for Medical Education and Research Treating rotator cuff conditions
WO2016037644A1 (en) 2014-09-10 2016-03-17 Medimmune Limited Pyrrolobenzodiazepines and conjugates thereof
SG11201701128YA (en) 2014-09-12 2017-03-30 Genentech Inc Cysteine engineered antibodies and conjugates
GB201416112D0 (en) 2014-09-12 2014-10-29 Medimmune Ltd Pyrrolobenzodiazepines and conjugates thereof
CN106714844B (en) 2014-09-12 2022-08-05 基因泰克公司 Anthracycline disulfide intermediates, antibody-drug conjugates and methods
JP2017533887A (en) 2014-09-17 2017-11-16 ジェネンテック, インコーポレイテッド Pyrrolobenzodiazepines and their antibody disulfide conjugates
BR112017011111A2 (en) 2014-11-25 2017-12-26 Adc Therapeutics Sa pyrrolobenzodiazepine-antibody conjugates
EP3226909A1 (en) 2014-12-03 2017-10-11 Genentech, Inc. Quaternary amine compounds and antibody-drug conjugates thereof
GB201506411D0 (en) 2015-04-15 2015-05-27 Bergenbio As Humanized anti-axl antibodies
GB201506402D0 (en) 2015-04-15 2015-05-27 Berkel Patricius H C Van And Howard Philip W Site-specific antibody-drug conjugates
US10596192B2 (en) 2015-07-16 2020-03-24 Mayo Foundation For Medical Education And Research Treating rotator cuff conditions
MA43345A (en) 2015-10-02 2018-08-08 Hoffmann La Roche PYRROLOBENZODIAZEPINE ANTIBODY-DRUG CONJUGATES AND METHODS OF USE
KR101921784B1 (en) * 2015-10-13 2018-11-23 사회복지법인 삼성생명공익재단 Composition for Preventing or Treating Eye Diseases Comprising Nucleotides Encoding Gremlin-1 or Gremlin-1
MA43354A (en) 2015-10-16 2018-08-22 Genentech Inc CONJUGATE DRUG CONJUGATES WITH CLOUDY DISULPHIDE
MA45326A (en) 2015-10-20 2018-08-29 Genentech Inc CALICHEAMICIN-ANTIBODY-DRUG CONJUGATES AND METHODS OF USE
GB201601431D0 (en) 2016-01-26 2016-03-09 Medimmune Ltd Pyrrolobenzodiazepines
GB201602356D0 (en) 2016-02-10 2016-03-23 Medimmune Ltd Pyrrolobenzodiazepine Conjugates
GB201602359D0 (en) 2016-02-10 2016-03-23 Medimmune Ltd Pyrrolobenzodiazepine Conjugates
CN105807065B (en) * 2016-03-16 2018-10-02 沈慧勇 The application in preparing ankylosing spondylitis diagnostic kit is used in combination in BMP2 and Noggin
CN108700598A (en) 2016-03-25 2018-10-23 豪夫迈·罗氏有限公司 The drug of the total antibody of multichannel and antibody conjugate quantifies measuring method
GB201607478D0 (en) 2016-04-29 2016-06-15 Medimmune Ltd Pyrrolobenzodiazepine Conjugates
JP2019522633A (en) 2016-05-20 2019-08-15 ジェネンテック, インコーポレイテッド PROTAC antibody conjugates and methods of use
WO2017205741A1 (en) 2016-05-27 2017-11-30 Genentech, Inc. Bioanalytical method for the characterization of site-specific antibody-drug conjugates
EP3464280B1 (en) 2016-06-06 2021-10-06 F. Hoffmann-La Roche AG Silvestrol antibody-drug conjugates and methods of use
WO2018031662A1 (en) 2016-08-11 2018-02-15 Genentech, Inc. Pyrrolobenzodiazepine prodrugs and antibody conjugates thereof
CN106086229B (en) * 2016-08-26 2019-08-16 广东省农业科学院动物科学研究所 The relevant molecular labeling of chicken growth traits and its discrimination method and application
JP7050770B2 (en) 2016-10-05 2022-04-08 エフ・ホフマン-ラ・ロシュ・アクチェンゲゼルシャフト Method for preparing antibody drug conjugate
GB201617466D0 (en) 2016-10-14 2016-11-30 Medimmune Ltd Pyrrolobenzodiazepine conjugates
GB201702031D0 (en) 2017-02-08 2017-03-22 Medlmmune Ltd Pyrrolobenzodiazepine-antibody conjugates
US11160872B2 (en) 2017-02-08 2021-11-02 Adc Therapeutics Sa Pyrrolobenzodiazepine-antibody conjugates
JP2020517609A (en) 2017-04-18 2020-06-18 メディミューン リミテッド Pyrrolobenzodiazepine complex
KR20190141666A (en) 2017-04-20 2019-12-24 에이디씨 테라퓨틱스 에스에이 Combination Therapy with Anti-AXL Antibody-Drug Conjugates
MX2019015042A (en) 2017-06-14 2020-08-06 Adc Therapeutics Sa Dosage regimes for the administration of an anti-cd19 adc.
CN111065638B (en) 2017-08-18 2021-04-09 麦迪穆有限责任公司 Pyrrolobenzodiazepine conjugates
BR112020004307A2 (en) 2017-09-20 2020-11-10 Ph Pharma Co., Ltd. tailanestatin analogues
CN108531608B (en) * 2018-01-24 2020-06-30 华南农业大学 BMP6 gene as molecular marker for black goat lambing number character
GB201803342D0 (en) 2018-03-01 2018-04-18 Medimmune Ltd Methods
GB201806022D0 (en) 2018-04-12 2018-05-30 Medimmune Ltd Pyrrolobenzodiazepines and conjugates thereof
GB201814281D0 (en) 2018-09-03 2018-10-17 Femtogenix Ltd Cytotoxic agents
CN113056287A (en) 2018-10-24 2021-06-29 豪夫迈·罗氏有限公司 Conjugated chemical degradation inducers and methods of use
WO2020123275A1 (en) 2018-12-10 2020-06-18 Genentech, Inc. Photocrosslinking peptides for site specific conjugation to fc-containing proteins
GB201901197D0 (en) 2019-01-29 2019-03-20 Femtogenix Ltd G-A Crosslinking cytotoxic agents
WO2020229628A1 (en) * 2019-05-15 2020-11-19 Novo Nordisk A/S Methods for obtaining eye field progenitor cells from human pluripotent stem cells
GB2597532A (en) 2020-07-28 2022-02-02 Femtogenix Ltd Cytotoxic compounds

Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5856094A (en) * 1995-05-12 1999-01-05 The Johns Hopkins University School Of Medicine Method of detection of neoplastic cells
US5989885A (en) * 1997-01-10 1999-11-23 Myriad Genetics, Inc. Specific mutations of map kinase 4 (MKK4) in human tumor cell lines identify it as a tumor suppressor in various types of cancer
US6207450B1 (en) * 1998-04-15 2001-03-27 University Of Iowa Research Foundation Glaucoma therapeutics and diagnostics based on a novel human transcription factor
US6248867B1 (en) * 1994-11-03 2001-06-19 Univ California Trabecular meshwork induced glucocorticoid response (TIGR) fusion protein
US6248571B1 (en) * 1995-08-31 2001-06-19 Lonza Ag Method of producing dihydroxypyrimidine derivatives
US20030092019A1 (en) * 2001-01-09 2003-05-15 Millennium Pharmaceuticals, Inc. Methods and compositions for diagnosing and treating neuropsychiatric disorders such as schizophrenia
US6613563B1 (en) * 1997-03-14 2003-09-02 Selective Gentics, Inc. Viral vectors with modified tropism

Family Cites Families (18)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5041538A (en) * 1987-08-28 1991-08-20 The Salk Institute For Biological Studies Mammalian follistatin
IT1224795B (en) * 1988-12-01 1990-10-24 Sigma Tau Ind Farmaceuti USE OF ACETYL D-CARNITINE IN THE THERAPEUTIC TREATMENT OF GLAUCOMA AND PHARMACEUTICAL COMPOSITIONS USEFUL IN SUCH TREATMENT
SK136693A3 (en) * 1991-06-05 1994-10-05 Procter & Gamble Therapeutic compositions for osteoinduction
US5364884A (en) * 1993-01-21 1994-11-15 Baylor College Of Medicine Arginine compounds as ocular hypotensive agents
US5863738A (en) * 1994-04-29 1999-01-26 Creative Biomolecules, Inc. Methods of antagonizing OP-1 binding to a cell surface receptor utilizing ALK polypeptides
US5846770A (en) * 1994-11-22 1998-12-08 Genetics Institute, Inc. DNA molecules encoding human chordin
US6040431A (en) * 1995-06-07 2000-03-21 Stryker Corporation Single chain analogs of the TGF-β superfamily (morphons)
WO1998020131A1 (en) * 1996-11-08 1998-05-14 University Of Iowa Research Foundation Glaucoma-associated protein and corresponding nucleic acid and their therapeutic and diagnostic uses
AU5244998A (en) * 1996-11-15 1998-06-03 Creative Biomolecules, Inc. Morphogen-induced regeneration of sense perceptory tissues
CA2274244C (en) * 1996-12-05 2008-11-04 Abbot F. Clark Methods for diagnosing glaucoma and discovering anti-glaucoma drugs
AU2936400A (en) * 1999-02-26 2000-09-14 Hibergen Limited Identification of genes having a role in the presentation of diabetic nephropathy
CA2365917A1 (en) * 1999-04-09 2000-10-19 Human Genome Sciences, Inc. Bone morphogenic proteins
JP2002543777A (en) * 1999-05-07 2002-12-24 ヒューマン ジノーム サイエンシーズ, インコーポレイテッド Serine protease
AU5457000A (en) * 1999-06-11 2001-01-02 Human Genome Sciences, Inc. 48 human secreted proteins
WO2002077006A1 (en) * 2001-03-23 2002-10-03 Human Genome Sciences, Inc. Bone morphogenic protein polynucleotides, polypeptides, and antibodies
EP1383771A1 (en) 2001-04-20 2004-01-28 Vertex Pharmaceuticals Incorporated 9-deazaguanine derivatives as inhibitors of gsk-3
CN1685055A (en) 2001-10-31 2005-10-19 爱尔康公司 Bone morphogenic proteins (BMP), BMP receptors and BMP binding proteins and their use in the diagnosis and treatment of glaucoma
US7249992B2 (en) 2004-07-02 2007-07-31 Strasbaugh Method, apparatus and system for use in processing wafers

Patent Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6248867B1 (en) * 1994-11-03 2001-06-19 Univ California Trabecular meshwork induced glucocorticoid response (TIGR) fusion protein
US5856094A (en) * 1995-05-12 1999-01-05 The Johns Hopkins University School Of Medicine Method of detection of neoplastic cells
US6248571B1 (en) * 1995-08-31 2001-06-19 Lonza Ag Method of producing dihydroxypyrimidine derivatives
US5989885A (en) * 1997-01-10 1999-11-23 Myriad Genetics, Inc. Specific mutations of map kinase 4 (MKK4) in human tumor cell lines identify it as a tumor suppressor in various types of cancer
US6613563B1 (en) * 1997-03-14 2003-09-02 Selective Gentics, Inc. Viral vectors with modified tropism
US6207450B1 (en) * 1998-04-15 2001-03-27 University Of Iowa Research Foundation Glaucoma therapeutics and diagnostics based on a novel human transcription factor
US20030092019A1 (en) * 2001-01-09 2003-05-15 Millennium Pharmaceuticals, Inc. Methods and compositions for diagnosing and treating neuropsychiatric disorders such as schizophrenia

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20080051361A1 (en) * 2006-08-24 2008-02-28 Alcon Manufacturing, Ltd. Rnai-mediated inhibition of gremlin for treatment of iop-related conditions
US20100305193A1 (en) * 2006-08-24 2010-12-02 Alcon Research, Ltd. Rnai-mediated inhibition of gremlin for treatment of iop-related conditions

Also Published As

Publication number Publication date
KR20040054726A (en) 2004-06-25
ES2278079T3 (en) 2007-08-01
US20100204086A1 (en) 2010-08-12
KR20110032003A (en) 2011-03-29
PL214839B1 (en) 2013-09-30
AU2002364946A1 (en) 2003-07-15
DE60217152D1 (en) 2007-02-08
WO2003055443A3 (en) 2004-03-25
US20120059049A1 (en) 2012-03-08
RU2336902C2 (en) 2008-10-27
KR100996226B1 (en) 2010-11-24
KR20100013352A (en) 2010-02-09
CN1685055A (en) 2005-10-19
DE60217152T2 (en) 2007-10-31
JP2005518788A (en) 2005-06-30
RU2012120343A (en) 2013-11-27
EP2053135A1 (en) 2009-04-29
ZA200402662B (en) 2006-07-26
US8063013B2 (en) 2011-11-22
JP2008301834A (en) 2008-12-18
US8389496B2 (en) 2013-03-05
HK1069851A1 (en) 2005-06-03
CA2463143A1 (en) 2003-07-10
US7744873B2 (en) 2010-06-29
CN1966725A (en) 2007-05-23
BR0213738A (en) 2006-11-21
EP1440159A4 (en) 2005-04-13
RU2004116308A (en) 2005-03-27
US7405192B2 (en) 2008-07-29
EP1440159B1 (en) 2006-12-27
ATE349554T1 (en) 2007-01-15
MXPA04003697A (en) 2005-04-08
EP1440159A2 (en) 2004-07-28
KR101072867B1 (en) 2011-10-17
KR20100127891A (en) 2010-12-06
JP4255382B2 (en) 2009-04-15
US20030134308A1 (en) 2003-07-17
RU2008122296A (en) 2009-12-10
PL396553A1 (en) 2012-01-30
PL373863A1 (en) 2005-09-19
US20080194515A1 (en) 2008-08-14
WO2003055443A2 (en) 2003-07-10

Similar Documents

Publication Publication Date Title
US7405192B2 (en) Bone morphogenic proteins (BMP), BMP receptors and BMP binding proteins and their use in the diagnosis and treatment of glaucoma
JP2012025763A (en) Diagnostics and therapeutics for glaucoma
Padhy et al. De novo variants in an extracellular matrix protein coding gene, fibulin-5 (FBLN5) are associated with pseudoexfoliation
CA2545777A1 (en) Use of serum amyloid a gene in diagnosis and treatment of glaucoma and identification of anti-glaucoma agents
Yosypiv et al. Downregulation of Spry-1, an inhibitor of GDNF/Ret, causes angiotensin II-induced ureteric bud branching
AU2014329606A1 (en) Methods for the identification, assessment, prevention, and treatment of neurological disorders and diseases using Fndc5
CA2759457C (en) Association of htra1 mutations and familial ischemic cerebral small-vessel disease
AU2002364946B2 (en) Bone morphogenic proteins (BMP), BMP receptors and BMP binding proteins and their use in the diagnosis and treatment of glaucoma
EP1777519A1 (en) Bone morphogenic proteins (BMP), BMP receptors and BMP binding proteins and their use in the diagnosis and treatment of glaucoma
Ramos-Nino et al. Gene profiling and kinase screening in asbestos-exposed epithelial cells and lungs
Desgrosellier The role of type I TGFβ receptors in epithelial-mesenchymal transformation in the atrioventricular cushion
JP2006504395A (en) Method for examining cellular response to VEGF and use thereof

Legal Events

Date Code Title Description
AS Assignment

Owner name: UNIVERSITY OF NORTH TEXAS HEALTH SCIENCE CENTER, T

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:WORDINGER, ROBERT J.;REEL/FRAME:014208/0160

Effective date: 20030612

Owner name: ALCON, INC., SWITZERLAND

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:CLARK, ABBOT F.;REEL/FRAME:014208/0151

Effective date: 20030610

AS Assignment

Owner name: ALCON, INC., SWITZERLAND

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:CLARK, ABBOT F.;REEL/FRAME:015431/0625

Effective date: 20040330

Owner name: UNIVERSITY OF NORTH TEXAS HEALTH SCIENCE CENTER, T

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:WORDINGER, ROBERT J.;REEL/FRAME:015431/0753

Effective date: 20040402

STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION