US20060210967A1 - Re-sequencing pathogen microarray - Google Patents

Re-sequencing pathogen microarray Download PDF

Info

Publication number
US20060210967A1
US20060210967A1 US11/177,646 US17764605A US2006210967A1 US 20060210967 A1 US20060210967 A1 US 20060210967A1 US 17764605 A US17764605 A US 17764605A US 2006210967 A1 US2006210967 A1 US 2006210967A1
Authority
US
United States
Prior art keywords
sample
sequence
resequencing
pathogen
dna microarray
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US11/177,646
Inventor
Brian Agan
Eric Hanson
Russell Kruzelock
Baochuan Lin
Robb Rowley
Donald Seto
David Stenger
Jennifer Johnson
Clark Tibbetts
Dzung Thach
Gary Vora
Elizabeth Walter
Zheng Wang
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
US Air Force
US Department of Navy
Original Assignee
US Air Force
US Department of Navy
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by US Air Force, US Department of Navy filed Critical US Air Force
Priority to US11/177,646 priority Critical patent/US20060210967A1/en
Assigned to U.S.A. AS REPRESENTED BY THE SECRETARY OF THE NAVY, THE reassignment U.S.A. AS REPRESENTED BY THE SECRETARY OF THE NAVY, THE ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: THACH, DZUNG, STENGER, DAVID, WANG, ZHENG, VORA, GARY, LIN, BAOCHUAN, THORNTON, JENNIFER
Priority to US11/422,431 priority patent/US7623997B2/en
Priority to US11/422,425 priority patent/US7695941B2/en
Priority to CA002612360A priority patent/CA2612360A1/en
Priority to AU2006259665A priority patent/AU2006259665A1/en
Priority to AU2006259666A priority patent/AU2006259666B2/en
Priority to NZ585369A priority patent/NZ585369A/en
Priority to KR1020117007313A priority patent/KR20110039587A/en
Priority to EP13002755.0A priority patent/EP2648124A3/en
Priority to KR1020087001245A priority patent/KR101058820B1/en
Priority to NZ564992A priority patent/NZ564992A/en
Priority to PCT/US2006/022622 priority patent/WO2006138182A2/en
Priority to KR1020127014945A priority patent/KR20120083521A/en
Priority to CA2612412A priority patent/CA2612412C/en
Priority to NZ564991A priority patent/NZ564991A/en
Priority to JP2008516960A priority patent/JP2009509499A/en
Priority to EP06772796A priority patent/EP1910568A4/en
Priority to JP2008516959A priority patent/JP4910104B2/en
Priority to KR1020087001309A priority patent/KR101023163B1/en
Priority to KR1020107023975A priority patent/KR20100122124A/en
Priority to EP06772795A priority patent/EP1910577A4/en
Priority to PCT/US2006/022623 priority patent/WO2006138183A2/en
Priority to KR1020107004052A priority patent/KR101182505B1/en
Publication of US20060210967A1 publication Critical patent/US20060210967A1/en
Priority to US11/559,513 priority patent/US8965710B2/en
Assigned to THE GOVERNMENT OF THE UNITED STATES OF AMERICA AS REPRESENTED BY THE SECRETARY OF THE AIR FORCE reassignment THE GOVERNMENT OF THE UNITED STATES OF AMERICA AS REPRESENTED BY THE SECRETARY OF THE AIR FORCE ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: KRUZELOCK, RUSSELL P, TIBBETTS, CLARK J, AGAN, BRIAN K, WALKER, ELIZABETH A, ROWLEY, ROBB K, HANSON, ERIC H, SETO, DONALD
Priority to US11/843,126 priority patent/US7668664B2/en
Priority to US12/100,519 priority patent/US9430610B2/en
Priority to US12/617,025 priority patent/US7979446B2/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6893—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for protozoa
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
    • C12Q1/701—Specific hybridization probes
    • G—PHYSICS
    • G16—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
    • G16B—BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
    • G16B30/00—ICT specially adapted for sequence analysis involving nucleotides or amino acids
    • G—PHYSICS
    • G16—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
    • G16B—BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
    • G16B30/00—ICT specially adapted for sequence analysis involving nucleotides or amino acids
    • G16B30/10—Sequence alignment; Homology search
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6869—Methods for sequencing
    • C12Q1/6874—Methods for sequencing involving nucleic acid arrays, e.g. sequencing by hybridisation

Definitions

  • the United States Government owns rights in the present invention pursuant to funding from the Defense Threat Reduction Agency (DTRA; Interagency Cost Reimbursement Order (IACRO #02-4118), MIPR numbers 01-2817, 02-2292, 02-2219, and 02-2887), the Office of the U.S. Air Force Surgeon General (HQ USAF SGR; MIPR Numbers NMIPR035203650, NMIPRONMIEPRO35203881, NMIPRONMIPRO35203881), the U.S. Army Medical Research Acquisition Activity (Contract # DAMD17-03-2-0089), the Defense Advance Research Projects Agency (DARPA; MIPR Number M189/02), and the Office of Naval Research (NRL Work Unit 6456).
  • DTRA Defense Threat Reduction Agency
  • IACRO #02-4118 Interagency Cost Reimbursement Order
  • MIPR numbers 01-2817, 02-2292, 02-2219, and 02-2887 the Office of the U.S. Air Force Surgeon General
  • HQ USAF SGR MIPR
  • the present application includes a sequence listing on an accompanying compact disk containing a single file named 272918US59SDSt2-5.txt, created on Jul. 1, 2005, 639 KB in size, and additionally labeled:
  • the present invention provides pathogen detection by use of DNA resequencing microarrays.
  • the present invention provides for simultaneous detection of multiple pathogens.
  • the present invention also provides resequencing microarrays and microarray chips for differential diagnosis and fine-scale discrimination between closely related pathogens present in a biological sample.
  • the present invention further provides methods of detecting the presence and identity of pathogens present in a biological sample.
  • the invention enables diagnosis and surveillance of known pathogen sequences and pathogens that may be identified due to unanticipated sequence variations, as well as mixtures of such pathogens. Resequencing, combined with several amplification strategies, allows simultaneous clinical diagnosis and performance of traditional surveillance assays for serotyping, antibiotic resistance profiling, genetic drift/shift analysis, forensics, and rapid detection of biological terrorism events.
  • approaches generally rely on the ability of immobilized “probe” DNA sequences on the surfaces of microarrays to hybridize with complementary genomic “target” that is uniquely identifying of a particular category or specific strain of microbial pathogen.
  • Various microarray technologies have been developed for this purpose, varying in the density of probes and the time ranges required for assay completion.
  • microarrays which enable the simultaneous interrogation of thousands of genetic elements, address this crucial need.
  • microarray refers to any type of planar substrate or solid beads presenting a high multiplicity (10 2 to 10 6 ) of individual sites, each presenting nucleic acid probes designed to selectively capture complementary strands of target (i.e. pathogen or host) nucleic acid.
  • the majority of pathogen identification microarrays described in the literature is prepared using oligonucleotides that are robotically spotted onto derivatized glass surfaces (typically 3 ⁇ 1 inch microscope slides). This approach allows the most flexibility with regards to the size of the oligonucleotides that are deposited, ranging from 20-mers to cDNA PCR products of several thousand base pairs (bp). With few exceptions, the detection event is an increased level of fluorescence originating from a spot following hybridization of a fluorophore-labeled target nucleic acid.
  • MARSH Microarrays for Resequencing and Sequence Heterogeneity
  • MAVR Microarray Analysis of Viral Recombination
  • MAVR uses organism-specific oligonucleotide probes that cover the entire genome at ⁇ 150 nt spacings and is used to detect large scale genetic recombinations.
  • the DeRisi group at UCSF pioneered the use of long (70-mer) oligonucleotide probe microarrays for broad-spectrum pathogen identification (Wang et al., 2002; Wang et al., 2003).
  • the use of long (70 nt) oligonucleotides bears implicit advantages and disadvantages.
  • One advantage is that higher degrees of sensitivity can usually be achieved with 70-mer probes compared to shorter ones (e.g. 20-25 mers).
  • specificity is reduced because 70-mer target/probe hybridizations are generally insensitive to significant numbers (e.g., 7-10) of single base mismatches, whereas shorter probes provide much greater sequence specificity.
  • DeRisi's group described the use of spotted microarrays having 1,600 different 70-mer oligonucleotide probes to identify a variety of viruses responsible for common respiratory infections (Wang et al., 2002).
  • the probes were selected for each pathogen using an algorithm that located discriminatory sequences from a list of known viral genomes.
  • a serial combination of a previously described (Bohlander et al., 1992) method and subsequent PCR/Klenow fragment-based amplification was used to achieve non-biased amplification of both viral RNA and DNA, allowing generation of sufficient amounts of target amplicons for successful microarray hybridization and detection via fluorescent label. (N.B.
  • Affymetrix, Inc. (Santa Clara, Calif.) uses high-density probe fabrication technology to construct “tiled” microarrays using 4 probes each in both the sense and anti-sense directions for each nucleotide base to be resequenced.
  • single base substitutions are directly detected by the hybridization pattern (for additional information see Affymetrix CustomSeq design manual).
  • tiled microarrays for pathogen genotyping.
  • PCR primers were used to amplify DNA targets prior to microarray hybridizations, through the use of conserved primer sites, or in the work of Andersen et al. (Wilson et al., 2002a; Wilson et al., 2002b), by carrying out up to ⁇ 150 different PCR reactions in multi-well format and pooling the amplicons.
  • U.S. Pat. No. 6,228,575 B1 describes the same data as described by Gingeras (Gingeras et al., 1998) and Troesch (Troesch et al., 1999).
  • target pathogen sequences are tiled onto arrays. Because several types of variations (esp. insertion/deletion or frequent multiple substitutions) in pathogen sequence can perturb hybridization patterns, Gingeras et al. used differential measures of specific pathogen hybridization patterns to identify individual mycobacterial variants. That is, identifications required a priori knowledge of a differential hybridization pattern that was empirically determined in ground truth experiments.
  • FIG. 1 shows a graphical description of the Version 1 Respiratory Pathogen Microarray (RPMV1).
  • RPMV1 Respiratory Pathogen Microarray
  • the geometrical distribution of all tile regions dedicated to each pathogen is represented by assigned colors (right).
  • the Affymetrix spike-in controls are at the top of the microarray (white). Black regions interspersed between tiled regions did not contain probes.
  • FIG. 2 shows purified adenovirus 4 prototype (accession number AY594253) DNA hybridization to RPMV1 following nucleic acid isolation and amplification using either (A) degenerate primer PCR (Lin et al., 2004) or (B) GenomiPhi total amplification of target DNA, as described in Example 1.
  • Degenerate primer PCR (A) resulted in hybridization of targets within those tiled regions covered by conserved primer sites.
  • Total amplification (B) resulted in target hybridization across the entire Ad4 tile regions. Neither method resulted in significant cross-hybridization across the microarray.
  • REPI identified the correct strain of adenovirus 4 (AY594253) as having achieved the highest BLAST (“Basic Local Alignment Search Tool”) bit score across all Ad4 tile regions where amplicons hybridized, except in one case (described in Example 1).
  • FIG. 3 shows purified adenovirus 5 field strain (Ad5FS, accession number AY601635) (A, B) and adenovirus 7 prototype (accession number AY594255) (C, D) DNA hybridizations to RPMV1 following nucleic acid isolation and amplification using either (A, C) degenerate primer PCR (Lin et al., 2004) or (B, D) GenomiPhi total amplification of target DNA as described in Example 3. Degenerate primer PCR (A, C) resulted in hybridization of targets within those tiled regions having conserved primer sites for both the Ad5FS and the Ad7 prototype.
  • Total amplification (B, D) resulted in target hybridization across the entire AdS and Ad7 tile regions. Neither method resulted in significant cross-hybridization across the microarray.
  • REPI identified the correct strain of adenovirus 5 (Ad5FS, accession number AY601635) or adenovirus 7 (accession number AY594255) as having achieved the highest BLAST bit score across all respective tile regions where amplicons hybridized.
  • Ad7 Ad7 prototype on the Ad7 vaccine tile region, distinguishing it correctly from Ad7 vaccine strain (AY594256) from which the tile region was derived.
  • FIG. 4 shows the results of the adenovirus 4,5 breakthrough strain as described in Example 4.
  • An aliquot of purified nucleic acid from culture of throat swab of a patient with febrile respiratory illness (who was previously vaccinated against adenovirus) was amplified using conserved/degenerate primers as described (Lin et al., 2004) and otherwise processed according to the standard Affymetrix CustomSeq protocol.
  • the patient was diagnosed as Ad4 positive via serotypic antibody neutralization, and diagnosed as Ad5 positive via a hexon sequence.
  • the present inventors obtained multiple target hybridizations, resulting in base calls on all the adenovirus 5 and adenovirus 7 prototype tile regions.
  • Ad5FS accession number AY601635
  • Ad7 prototype regions gave evidence of a B subgroup species other than Ad7, namely Ad21.
  • the degenerate primer solution, used for amplification of all adenoviruses herein was unintentionally contaminated with small amounts of Ad4 and Ad7 prototypes, as in the case shown in FIG. 3 . The contaminants did not result in easily discernible hybridizations in the Ad4 tiles (as shown in FIG.
  • Ad 7 tiles were not Ad7 prototype (despite low-level contamination) but adenovirus type 21 (Ad 21; AY601633), another member of the B subgroup of adenoviruses represented by the Ad7 prototype (AY594255).
  • Ad 21 Ad 21; AY601633
  • Ad 7 prototype AY594255
  • the observation of a mixture of Ad5 and Ad21 in this sample was confirmed using conventional DNA sequencing for Ad5, amplicon sequencing for Ad21, and spotted microarray results (Lin et al., 2004).
  • Ad7 prototype the low-level contaminant of Ad7 prototype was still detected and distinguished by high bit scores in a single tile region subsequence.
  • an unanticipated mixed adenovirus sample comprised of AdS and Ad2l, inadvertently contaminated with small amounts of Ad4 and Ad7 prototype (not found in field samples), was completely resolved. Resolution of this fine detail would be impossible using other types of microarrays (i.e. spotted) without anticipation of such types of events and extensive probe design effort.
  • FIG. 5 shows the results of influenza A strain identification as described in Example 5.
  • Aliquots of a nasal wash from an Influenza A (+) febrile patient (confirmed by standard viral cell culturing techniques) who was previously immunized (using A/Moscow/10/99(H3N2))—based vaccine) during the 2003-2004 flu season were amplified using (A) universal (Hoffmann et al., 2001) or (B) multiplex (Offringa et al., 2000) RT/PCR primers, and processed according to the standard Affymetrix CustomSeq protocol. Because both strategies produce amplicons of the entire HA, NA, and M genes, the respective tile regions on the microarrays were almost completely hybridized in both cases.
  • FIG. 6 shows the results of the reduced hybridization time assay as described in Example 6.
  • a nasal wash that was confirmed negative for all targets probed by the microarray except the erythromycin resistance markers SPYERMB, SPYERMTR, and SPYMEFAE was subjected to specific multiplex PCR for each of these three markers.
  • the amplicons were then hybridized to separate microarrays for either 16 hours (A) or 15 minutes (B), otherwise being processed in accordance with the Affymetrix CustomSeq protocol.
  • the signal intensities for the 15-minute hybridization microarray (B) were lower than those on the control 16-hour microarray (A) (note incomplete hybridization to the Affymetrix control probes at the top of the microarray in (B)).
  • FIG. 7 shows the effects of subtractive hybridization approaches as described in Example 7.
  • A Shows the hybridization pattern obtained following total amplification of the isolated nucleic acids from an aliquot of nasal wash from a patient with febrile respiratory illness at Lackland AFB. This sample was positive for Ad4 at an estimated titer of 10 4 genomic copies per microliter. The high background hybridization across the microarray prevents GDAS from making base calls even though the adenovirus type 4 region showed a discernibly higher signal than that of the overall background. Co-hybridizing the same set of total amplicons obtained in (A) with COT-1 fraction human genomic DNA (B) did little to improve this as again no base calls were made by GDAS.
  • base calling was extended into the Ad4FIBER tile region in addition to Ad4HEXON-1, allowing unambiguous high bit-score ranking for an Ad4 field strain in the Ad4HEXON-1 tiles and in several Ad4FIBER subsequences.
  • FIG. 8 shows hybridization of Influenza A targets (Fujian 411/2002), spiked into normal nasal wash, following amplification using a recently-described modification (Kessler et al., 2004) of a previous (Wang et al., 2003) protocol for non-biased amplification of viral RNA genomic targets.
  • FIG. 8 (A-C) show hybridization patterns for 10 5 , 10 3 , and 10 1 plaque-forming unit (pfu) spike-in amounts, respectively (see Example 9).
  • FIG. 9 shows a flowchart representation of an embodiment of the present invention in which the RNA and DNA pathways are converged.
  • DNA microarrays might be used to analyze the sequence of target nucleic acids from pathogens for diagnostic or surveillance purposes.
  • the effects of oligonucleotide probe sequence selection, length, positioning on surfaces, the physical chemistry of binding, and labeling techniques, have been the topics of vigorous research in the past ten years.
  • the approaches taken have almost exclusively involved the use of single oligonucleotide probes (13-70 mers) that are specifically designed to hybridize to-a single recognized pathogen target sequence with high specificity (13-25 mers) or to a longer stretch of pathogen target with a lesser degree of specificity (70 mers).
  • microarrays are commonly known as spotted microarrays, but the same content of a spotted microarray can also be embodied in other forms besides two-dimensional planar surfaces, one example being “bead arrays” (Ferguson, Steemers & Walt, 2000).
  • oligonucleotide probes are incapable of resolving subtle sequence variations for more than 10-1000 base pairs of total target sequence, even if the array were designed with a tiling strategy.
  • spotted oligonucleotide microarrays that facilitate identification of a broad spectrum of pathogens at an individual strain or SNP level (Cherkasova et al., 2003; Wang et al., 2002; Wang et al., 2003) require that the pathogen target sequence be determined using conventional DNA sequencing technology, requiring specialized equipment, personnel, and time periods of several days.
  • the present invention generally relates to the detection and identification of bacterial, viral and protozoan pathogens and virulence markers using DNA microarray technology.
  • the present invention also relates to the design, test, and analysis of resequencing microarrays having defined regions that can be used to assign numeric detection probabilities for a large number of specific pathogen genotypes and mixtures of pathogens.
  • it relates to methods required for the processing of both simple and complex (e.g. clinical and environmental) samples for said microarrays.
  • the present invention relates to the use of high plurality resequencing microarrays as a novel class of devices for purposes that would include diagnosis of infectious disease agents and pathogen surveillance.
  • it pertains to DNA microarrays that employ a large number (hundreds to thousands) of selected “prototype” nucleic acid sequence regions (typically 250-2000 base pairs each) from target genomic sequences to detect and identify a logarithmically larger number (thousands to tens of thousands) of both unrelated and closely related (strain level) microbial pathogens.
  • the invention relates to the design of microarrays fabricated to allow a resequencing of the target nucleic acids using a “tiled” probe approach.
  • the invention concerns the design of Affymetrix resequencing microarrays using tiled probes that will allow for analysis of up to 10 5 to 10 6 base pairs of target sequence.
  • the present invention provides a method for simultaneously assaying for a large number of pathogens by detecting their nucleic acid sequences and subjecting the detected sequences to an automated similarity search against public domain and private databases.
  • This object is accomplished by a non-obvious adaptation of a commercial technology (Affymetrix CustomSeqTM).
  • CustomSeqTM was designed for detection of Single Nucleotide Polymorphisms (SNPs) by resequencing target DNA.
  • This so-called SNP-detection calls for: (1) an error rate in base calling that is much lower than the naturally occurring frequency of mutation (in humans approximately (1 per 10 8 base pairs), (2) amplification of the purified starting material, at a concentration of 10 6 genomic copies/microliter, prior to microarray hybridization using specific PCR primers, and (3) combination and processing multiple chips for replicate samples by an algorithm that restricts base calls to those having a degree of confidence at which the presence of low frequency SNPs can be deduced.
  • the present inventors demonstrate that Affymetrix resequencing technology can be adapted for insertion into an integrated system for high multiplicity infectious disease diagnostics and pathogen surveillance in a time scale and level of sample preparation complexity that are enabling for point-of-care diagnostics applications. This system is substantively different from the intended use of the Affymetrix technology, and is not obvious to the typical skilled practitioner of microarray technology.
  • the method proffered by the present inventors does not share the same limitations as those disclosed in the prior art using resequencing microarrays.
  • technology enablements for at least one intended use namely the simultaneous detection of a large number of diverse pathogen species, have only recently occurred with the introduction of Affymetrix microarrays (18 ⁇ 18 micron features) for CustomSeqTM RPMV1 chip and higher density (8 ⁇ 8 micron features) for Respiratory Microarray Version 2 (RPMV2), allowing 29.7 kb and 300 kb, respectively, to be tiled for resequencing.
  • BLASTN sequence length-independent similarity searches
  • sequences selected for tiling are “prototypes” in the sense that a single gene or subsequence may represent a much broader class of organism species and subspecies (alternatively types, strains, variants, or mutants).
  • the resulting method is robust with respect to minor variations in the genotypes of individual pathogens and strains, and enables detection and probable identification among a plurality of candidate pathogens that may not be explicitly represented in the design of the experimental chip layout, including the tiled regions.
  • the chip layout also takes advantage of partially redundant tile sets (these were discouraged by the manufacturer's design guidelines and by the manufacturer during design), both intragenic and intergenic variation within a single pathogen strain, and between multiple similar or diverse pathogen types.
  • partially redundant tile sets these were discouraged by the manufacturer's design guidelines and by the manufacturer during design
  • intragenic and intergenic variation within a single pathogen strain and between multiple similar or diverse pathogen types.
  • the present inventors have determined that the redundancy is important to elevate confidence in results and to minimize likelihood of false positive and false negative results.
  • Advantages of this design/analysis approach will permit incorporation of both conserved and hyper-variable regions of genomes, facilitating group, type, and strain level identification.
  • the present invention generally advances the art of generic amplification for pathogen detection by microarrays in several ways: (1) it details specific methods for total amplification of purified or highly enriched pathogen nucleic acids for presentation to a high density short (25 mer) Affymetrix resequencing array, which is neither previously described nor obvious, since the methods are a large departure from the prescribed Affymetrix protocols, and (2) it describes novel alternative approaches to the use of enzymatic processes, competitive hybridizations, and magnetic bead-based subtractive and enrichment steps to reduce background and subsequent non-biased (i.e. total) amplification and microarray hybridization.
  • the present invention is embodied by a specific set of design and processing methods that enable broad-scale pathogen identification and characterization by utilizing resequencing microarrays. Specifically, the present invention allows for the precise, sensitive, and high confidence identification of a large multiplicity (thousands) of pathogens in a single assay.
  • a tile comprising at least four sets of primers arranged in a parallel fashion on the chip: 1) a first set that is exactly complementary to the reference sequence; and 2) three additional sets of primers, each of which is identical to the first set of primers but for the nucleotide at a central position, which is different in each of the three sets such that all four conventional nucleotide bases are present on said array.
  • the present invention further provides methods for processing complex clinical samples (e.g. nasal wash) requiring minimal nucleic acid isolation/amplification step(s).
  • the present invention is distinct from the overwhelming majority of microarray-based pathogen detection schemes because it uses high-density “tiled” microarrays to determine the actual sequences of pathogen genetic targets. It is further unique from other resequencing pathogen identification strategies in a number of important areas, including incorporation of: (1) a high multiplicity of disparate pathogen “prototype” target regions that exhibit little or no discernible cross-hybridization or interference with one another, (2) a high sequence redundancy within closely related pathogens that allows higher confidence identification of specific strain (e.g.
  • adenoviruses or influenza viruses (3) “prototype” regions of large tiled segments representative of a class of pathogens allowing for the precise identification of specific pathogen strains and the use of specially-designed software to parse and arrange sequence fragments for presentation to similarity search (e.g. BLAST) algorithms, allowing discrimination of pathogen mixtures and recombination events between pathogens, instead of the more restrictive tile selections and differential algorithm described in the most closely-related prior art (U.S. Pat. No.
  • the combination of these methods allows the simultaneous detection and identification of a high multiplicity of pathogen(s) from a clinical sample by a single qualified technician within a period of 24 hours, but preferably within 4 hours, more preferably with 2 hours, most preferably within 30 minutes.
  • the present invention supports: (a) routine diagnosis of infection in a clinical setting within several hours of sample collection, (b) simultaneous interrogation of the sample for indications of a rare infectious event (e.g. unanticipated pathogen, antibiotic resistance pattern or biological warfare agent), (c) routine molecular pathogen surveillance, (d) vaccine quality control and (e) monitoring of genetic changes of a pathogen as a result of natural genetic variations, drug treatment, intentional manipulation, or other events.
  • a rare infectious event e.g. unanticipated pathogen, antibiotic resistance pattern or biological warfare agent
  • High-density microarrays are fabricated by light-directed combinatorial synthesis of DNA oligomers (Kozal et al., 1996). The DNA oligomers synthesized on these sites typically have lengths of 20-30 bases.
  • Affymetrix has demonstrated fabrication of HDMs having individual features with resolutions approaching 1 ⁇ m 2 , enabling probe feature densities of 10-100 times greater than that demonstrated in the RPMV1.
  • HDM designs relevant to pathogen identification have been based on a “tiling” strategy.
  • the base calls of the unknown target are interrogated at each of one of four possible base positions (one of every four possible base pairings varied at the number 13 position in the tiled 25 mer probes), allowing a direct read of the target sequence from the corresponding positions across the array.
  • the GCOS (Version 1.1) software is used to reduce the raw image (.DAT) file to a simplified file format (.CEL file) with intensities assigned to each of the corresponding probe positions.
  • the GDAS (Version 2.0) software is used to apply an embedded version of the ABACUS (Cutler et al., 2001) algorithm to produce an estimate of the correct base calls, comparing the respective intensities for the sense and antisense probe sets.
  • One of the available export file types from GDAS is the FASTA-formatted base calls made for each tiled region of the resequencing array.
  • HDMs of the type described above have been used to identify pathogen species and detect drug resistance-conferring mutations in a series of in vitro experiments using cultured microorganisms, including HIV (Kozal et al., 1996).
  • Troesch et al. (Troesch et al., 1999) designed HDMs to discriminate between 54 different to detect Mycobacterium species and Mycobacterium tuberculosis rifampin resistance.
  • a tiled array of 65,000 oligomer probes was used to accurately resequence 70 clinical isolates of 27 mycobacterial species and 15 rifampin-resistant M. tuberculosis strains. More recently, sequence-specific identification of F. tularensis and Y.
  • the present invention is developed using Affymetrix CustomSeq resequencing microarrays.
  • resequencing microarrays For a discussion of resequencing microarrays, the artisan is directed to U.S. Pat. No. 6,228,575, which is incorporated herein by reference in its entirety.
  • the present invention is not conceptually limited to microarrays produced using that specific fabrication strategy.
  • resequencing can be performed on the scale described with any technology that is capable of producing microarrays with sufficient feature density to allow this approach. Theoretically this can be accomplished using an oligonucleotide printing technology, but it is more likely accomplished using a photolithographic approach.
  • Affymetrix resequencing chips are based on sequential lithographic steps using a separate mask that corresponds to each step
  • an alternative approach could use maskless lithography (Albert et al., 2003; Nuwaysir et al., 2002) or by nanolithographic methods (Ginger, Zhang & Mirkin, 2004). More generally, any method of producing a plurality of oligonucleotide probes for the purpose of determining target sequence would be applicable, even bead “arrays” that are not in a 2-dimensional format (Ferguson et al., 2000).
  • the probes themselves could be comprised of variants of DNA, namely RNA or oligomeric peptide-nucleic acids (PNA).
  • the probes can be made sensitive to enzyme digestion, then subject to subsequent handling.
  • the probes will incorporate dUTP instead of dTTP, making them sensitive to uracil-DNA-glycosylase. This will make them amenable to selective degradation following the capture of target.
  • immobilize RNA and obtain complementary sequence recognition thereof Immobilization of RNA would require chemical stabilization of the RNA.
  • the probes can be made from chemically modified nucleic acids that would make them more or less susceptible to subsequent chemical processing steps.
  • This present invention using the RPMV1 microarray, illustrates the ability of tiled prototype sequences to identify a wide variety of specific pathogen strains without assuming that specific hybridization patterns are required for specific pathogen identification.
  • the prototypes for tiled regions particularly those for adenoviruses 4, 5, and 7, were empirically chosen to be representative of adenovirus subgroups E, C, and B, respectively.
  • a more preferred and systematic approach to the design would involve the use of multiple sequence alignments to produce consensus sequences, where consensus sequences are defined as those representing the most frequent bases at the alignment position.
  • the alignment algorithm will produce a hierarchical phylogenetic tree for target gene sequences from individual pathogen strains or for a group or family of pathogens.
  • a consensus sequence will first be formed for members of each node or group of nodes on the tree, whose distance measures fall within a threshold, using an appropriate algorithm (Lee, 2003). The actual target sequences would then be compared individually to the consensus sequence, and the effects of hybridization to a tiled microarray region defined by the consensus sequence would be simulated.
  • the resequencing array would be designed in combination with another less complex solid phase capture device (array, gel, or otherwise) that that would be used initially to queue the resequencing array.
  • another less complex solid phase capture device array, gel, or otherwise
  • an array comprised of a multiplicity of long oligonucleotide probes would be used initially for the detection of pathogen by recognizing conserved sequences within a family of pathogens.
  • the resequencing array could then be used to interrogate variable regions associated with the conserved probes on the initial array, providing detailed sequence information on the pathogen.
  • the sample preparation would be common for both the solid phase capture device and the resequencing microarray.
  • the initial array would be used to capture target that would be isolated and then amplified using non-biased amplification techniques for presentation to the resequencing array.
  • This invention leverages pathogen genome information from various public and/or private sources to, design, fabricate, evaluate, validate and integrate an advanced diagnostics platform as part of an effective biodefense surveillance and operational medicine system. It is an integral facet of the Epidemic Outbreak Surveillance (EOS) program biodefense model that the system would most effectively be enabled through the adoption of a widely distributed device that would find utility in routine diagnostics of infectious diseases, most particularly in diagnosis of infectious respiratory disease (see the Defense Sciences Board Summer 2000 Study Report and the Health Sciences Biodefense System (HSBS) final briefing). It is important that the device (e.g. microarray) will provide a cost-effective alternative to conventional approaches to the diagnosis, management, and surveillance of infectious diseases, most particularly respiratory infections.
  • EOS Epidemic Outbreak Surveillance
  • HSBS Health Sciences Biodefense System
  • the device e.g. microarray
  • the device be a key component of an integrated system comprised of a local point-of-care diagnostic device that provides automated, two-way data sharing between health care providers, public health officials, and decision makers (this a maybe a cross-reference to the business model patent that is in the queue).
  • the invention described herein might fulfill this role in at least two ways: (1) through reduction in array size (i.e.
  • the invention could become the object of the point-of-care device itself, and (2) in the event of lower-cost or easily automated microarray alternatives, the resequencing array can be a higher echelon component in a diagnostics/surveillance pipeline. In the latter case, the lower-cost alternative device will provide for initial sample processing, pathogen target enrichment, amplification, decision information at the point-of-care, while the resequencing capability provides for a sequential testing capability by facilitating a more detailed interrogation of the sample when desired.
  • the process of designing resequencing microarray chips is carried out by selecting pathogen genomic sequences having sequence properties that make them unique to a small number (ideally one) of pathogens, or are highly conserved, allowing them to detect many types of microbial species at the family or genus level, or are moderately conserved and selected as “prototype” regions.
  • Prototype. regions will have an intermediate level of sequence homology across a group of microbial species and allow for both efficient hybridization and unique identification of most or all of a subtype of pathogenic species.
  • the design strategy for layout of resequencing tiles includes leveraging from alignment of similar sequences and application of a consensus probe sequence for tiling to the chip.
  • the consensus sequence might not be identical to any of selected pathogens, but will interact with a plurality of similar pathogen genomes.
  • the patterns of perfect and imperfect matching of real pathogen genome sequences with the consensus sequence will provide diagnostic discrimination power.
  • a sample e.g., a partially purified sample, a purified sample, an enriched sample, a biological sample, etc.
  • a sample e.g., a partially purified sample, a purified sample, an enriched sample, a biological sample, etc.
  • the various aspects of this design and validation protocol are embodied in the following 6 “phases.”
  • Pathogen list e.g. Adenovirus; Influenza; Streptococcus pyogenes —provided by pathogen experts or public domain
  • Genus/species new pathogen i.e. Severe acute respiratory syndrome (SARS) variant of corona virus
  • Plasmid DNA sequence (Bluescript, PUC etc.)
  • Biothreat agents (identified by Centers for Disease Control)
  • Table 1 represents a preferred (but not limiting) set of pathogens (both viral and bacterial) that may be used within the context of the present invention as designed for the detection and diagnosis of common respiratory pathogens: TABLE 1 Microarray Pathogens Viral Pathogens Bacterial Pathogens Adenovirus (Serotypes/Genus level) Streptococcus pyogenes (emm types/resistance) Influenza A and B (strains) Mycoplasma pneumoniae Coronavirus/SARS Bordetella pertussis Parainfluenza 1,2,3,4 Chlamydia pneumoniae Respiratory Syncitial Virus Streptococcus pneumoniae Metapneumovirus Legionella (genus level) Rhinoviruses Moraxella catarrhalis Coxsackie virus Haemophilus influenza Echoviruses Neisseria meningitidis West Nile Virus Mycobacterium tuberculosis Varicella (HHV-3) Staphylococc
  • the list of pathogens chosen for inclusion onto the chip would also include those selected from the U.S. Centers for Disease Control (CDC) Category A, B, and C bioterrorism agents. These are most notably, but not limited to, include:
  • Bacillus anthracis targets: lethal factor, protective antigen
  • Viral encephalitis (alphaviruses [e.g., Venezuelan equine encephalitis, eastern equine encephalitis, western equine encephalitis])
  • RPMV1 and RPMV2 resequencing microarray chips
  • RPMV1 was made using a high-density Affymetrix microarray fabrication process having an individual probe feature size of 18 ⁇ 18 microns. At this density, 29.7 kb of total pathogen target sequence was tiled for resequencing. The fabrication was performed as part of a pre-production beta-test of an Affymetrix commercial product (CustomSeq) that was intended for SNP detection in an arbitrary collection of sequences.
  • CustomerSeq Affymetrix commercial product
  • the Affymetrix CustomSeq design protocol was followed. While there were a variety of ongoing efforts within the project consortium to non-specifically amplify targets for microarray analysis, the present inventors made every effort to tile sequences on the array that could interrogate conventional (specific primer pair) PCR amplicons. Whenever possible, primer pairs were developed or adapted for conserved sequences that flanked the variable regions to be interrogated with tiled microarray probe sets. This allowed for the ability to: (1) directly amplify with an existing hardware platform (e.g. RAPID Light Cycler, Idaho Technologies), (2) provide control measurements for comparison with generic or total amplification strategies that are on the immediate horizon. In general, our strategy was to match the hybridization patterns with specific strains of organisms and to detect subtle variations in sequence that corresponds to pathogenicity and drug resistance.
  • an existing hardware platform e.g. RAPID Light Cycler, Idaho Technologies
  • Adenovirus (double-stranded DNA virus) types 4, 5, and 7 were designated as “prototypes” for the E, C and B subgroups, respectively.
  • prototypes for the E, C and B subgroups, respectively.
  • the present inventors postulated that resequencing on the prototype-tiled regions would allow detection and identification of subtle sequence variations between the subgroup members.
  • Three target gene regions were selected, specifically from E1A, hexon, and fiber genes. However, it was not postulated nor anticipated which regions or which sections of any of the tiles would allow unique identification.
  • Sub-Group B 3, 7, 11, 14, 21, 34,-35 and 50
  • Sub-Group C 1, 2, 5, and 6
  • the present inventors made the hypothesis that if they tiled three genes (E1A, Fiber and Hexon) on the array for prototype sub-group representatives, types 7, 5, and 4 (for subgroups B, C, and E, respectively), they would be able to identify any of the fully-sequenced types (listed above) by variations in the hybridization patterns that map to their sequence differences.
  • Influenza A and B viruses which are negative-polarity single stranded RNA viruses (ssRNA), were represented with prototype regions for hemagglutinin (HA) neuraminidase (NA) and matrix (M). These genes were represented for three types of Influenza A (H1N1, H3N2 and H5N1) and Influenza B. Influenza is one of the best examples of a prototype model system, as hundreds, if not thousands of influenza strains have been at least partially sequenced, and most have been sequenced for the hemagglutinin and neuraminidase segments.
  • ssRNA negative-polarity single stranded RNA viruses
  • Prototype Influenza HA, NA and M genes were chosen from strains that were either identical of closely related to the three vaccine strains recommended for the Northern hemisphere by the World Health Organization;
  • sequences were publicly available from the Los Alamos National Laboratory influenza Internet database.
  • the present inventors postulated that the sequence calls made for unknown Influenza A or B on the prototype tile regions would allow the identification of that target if it was sufficiently similar to allow similarity search-based querying.
  • RPMV1 The remainder of RPMV1 was populated with tiles for a variety of common respiratory pathogens, the first set being viruses:
  • the present inventors selected targets from the open literature (e.g., NCBI GenBank) for genes containing diagnostic (via PCR) regions and tiled that diagnostic region or a larger coding region containing that region.
  • the full listing of all target genes, PCR primer sites, and primers for the RPMV1 are shown in Table 8 (infra) and the attached Sequence Listing.
  • the sequences submitted for tiling and chip fabrication are summarized in Table 7 (infra) and the attached Sequence Listing.
  • the present invention is not limited to the specific sequences and/or microorganisms (bacteria or virus) listed above. It is well within the purview of the skilled artisan to tailor the “pathogen chip” to meet the particular requirements of the intended field test. Such tailoring may be on a gene-level or on a microorganism level. Clearly, the artisan would be greatly assisted in the efforts by the general protocol above.
  • RPMV2 is built on a high-density Affymetrix microarray having an intended feature size of 8 ⁇ 8 microns. At this density, approximately 300 kb of target sequence information may be tiled for resequencing.
  • the general layout strategy described in Tables 2-4 (infra).
  • the RPM V2 design allowed for roughly 10 times the sequence content of the RPMV1, and thus allowed inclusion of a large number of pathogens, which included expanded representations of all the pathogens present on the RPMV1, numerous other respiratory pathogens, and virtually the entire set of CDC Category A, B, and C bioterrorism agents.
  • the full listing of the RPMV2 content is provided in Example 8.
  • the RPMV2 design expanded molecular epidemiology capability by enabling inclusion of probes, such as the emm types for Streptococcus pyogenes .
  • This feature will provide the epidemiologist/public health professional an ability to determine a likely index disease case and to study transmission of the typed pathogen in enclosed populations (ails, dormitories, nursing homes, military barracks, etc.). These probes may also predict pathogen virulence and clinical presentation of disease in the population.
  • the number of pathogens represented can also be expanded with increasing probes per unit area of microarray.
  • the chips of the present invention take advantage of high feature density to simultaneously probe and discriminate among a large number of candidate pathogens that may be present in a single clinical specimen.
  • gene expression markers can conceptually be tiled onto the array in the same manner as genomic markers.
  • sequences representing pathogen transcripts RNA templates coding for protein synthesis
  • RNA templates coding for protein synthesis can be simultaneously positioned on arrays with those allowing resequencing of genomic markers. This would enable the microarray to detect not only the presence of a pathogen, but would also allow determination of viability, since transcriptional markers would only be present in intact pathogens.
  • coli 0157 H7 660 948 960 812 Ricinus communis 1133 Salmonella Salmonella enterica 904 812 Salmonella typhimurium 904 Shigella Shigella dysenteriae 907 Shigella flexneri 898 812 Vibrio cholerae 942 984 887 Nipah virus 858 1359 Hantavirus Sin Nombre 639 1293 Leglonella pneumophilla 1157 236 Histoplasma capsulatum 919 1082 Blastomyces dermatiditis 942 912 Coccidioides Immitis 965 1234 Varicella Varicella HHV-6 890 1236 Varicella HHV-3 822 781 Epstein-Barr Virus 971 1317 Corynebacterium Corynebacterium 913 818 diphtheriae Enterovirus (genus) 1758 Coxsackie (subgroup) 920 Echo (subgroup) 1277 Polio (subgroup) 1226 Paramyxoviridae Paramyxoviridae 1854
  • the target nucleic acids may be contained within a biological sample.
  • biological sample refers to a sample obtained from an organism or from components (e.g., cells) of an organism.
  • the sample may be of any biological tissue or fluid.
  • the sample may be one taken from the environment (air, soil or water). Frequently the sample will be a “clinical sample” which is a sample derived from a patient.
  • Such samples include, but are not limited to, sputum, nasal wash, nasal aspirate, throat swab, blood, blood cells (e.g., white cells), tissue or fine needle biopsy samples, urine, peritoneal fluid, visceral fluid, and pleural fluid, or cells therefrom.
  • the clinical sample be a nasal wash, nasal aspiration or a throat swab.
  • the clinical sample is a nasal wash.
  • Biological samples may also include sections of tissues such as frozen sections taken for histological purposes, or from non-human animal sources, plants, or environmental sources such as water, air, or soil.
  • the target nucleic acids may require some degree of processing. For the intended purposes, this will involve one or more of the following target processing steps: (1) isolation, (2) enrichment for target sequences of interest, (3) amplification, (4) labeling, and (5) hybridization.
  • Preferred embodiments corresponding to each of these processing strategies are described below; however, the present invention is not intended to be limited thereto.
  • the skilled artisan would readily appreciate alternative methods corresponding to the aforementioned processing strategies both based on those commonly in use and as described in U.S. Pat. No. 6,638,717, U.S. Pat. No. 6,376,191, U.S. Pat. No. 5,759,778, U.S. Pat. No. 6,268,133, and U.S. Pat. No. 6,613,516 (each of which are incorporated herein by reference in its entirety).
  • the target nucleic acids (RNA and/or DNA) to be assayed are isolated prior to amplification of the same.
  • Methods of isolating nucleic acids are well known to the skilled artisan.
  • the target nucleic acid isolation may be performed using a MasterPureTM DNA Purification Kit (Epicentre Technologies, Madison, Wis.) ethanol purification method (per manufacturer's instructions).
  • the target nucleic acids will be isolated using a rapid microcentrifuge technique, as in the use of Xtra Amp Kit (XTRANA, Inc. Broomfield, Colo.).
  • the nucleic acids will be isolated using an automated device for said purpose, such as a GeneXpert (Cepheid, Sunnyvale, Calif.) or using a robot for magnetic bead-based isolation (e.g. Qiagen or Beckman).
  • the QIAamp DNA Mini Kit simplifies isolation of DNA from human tissue samples with fast spin-column or vacuum procedures. DNA binds specifically to the QIAamp silica-gel membrane while contaminants pass through. PCR inhibitors such as divalent cations and proteins are completely removed in two efficient wash steps, leaving pure DNA to be eluted in either water or a buffer provided with the kit. QIAamp DNA technology yields genomic, mitochondrial, bacterial, parasite, or viral DNA from human tissue samples ready to use in PCR and blotting procedures.
  • the RNeasy Mini Kit allows efficient purification of total RNA from very small amounts of tissue or cells. Total RNA is easily purified from animal cells or tissues, Gram-positive or Gram-negative bacteria, or yeast. RNeasy technology simplifies total RNA isolation by combining the stringency of guanidine-isothiocyanate lysis with the speed and purity of silica gel-membrane purification.
  • Fresh or frozen tissue samples are homogenized using bead-beating technology to lyse the cells. Lysates are loaded onto a silica spin filter. During a brief spin, the DNA selectively binds to the silica membrane while contaminants pass through. Remaining contaminants and enzyme inhibitors are removed by a wash step. Pure DNA is then eluted into certified, DNA-free Tris buffer.
  • RNA is captured on a silica membrane spin filter while contaminants are passed through the filter by centrifugation. The filter is washed to remove any remaining contaminants and salts. The RNA is then eluted into certified RNase-free water (provided). RNA is of high quality and is ready for any downstream applications.
  • the Wizard® Genomic DNA Purification Kit is designed for isolation of DNA from white blood cells, tissue culture cells and animal tissue, plant tissue, yeast, Gram-positive and Gram-negative bacteria.
  • the Wizard® Genomic DNA Purification Kit is based on a four-step process. The first step in the purification procedure lyses the cells and the nuclei. For isolation of DNA from white blood cells, this step involves lysis of the red blood cells in the Cell Lysis Solution, followed by lysis of the white blood cells and their nuclei in the Nuclei Lysis Solution. An RNase digestion step may be included at this time; it is optional for some applications.
  • the cellular proteins are then removed by a salt precipitation step, which precipitates the proteins but leaves the high molecular weight genomic DNA in solution. Finally, the genomic DNA is concentrated and desalted by isopropanol precipitation.
  • the SV Total RNA Isolation System provides a fast and simple technique for the preparation of purified and intact total RNA from tissues, cultured cells and white blood cells using this membrane-based purification system.
  • the system incorporates a DNase treatment step directly on the membrane of the minicolumn. Purification is achieved without the use of phenol:chloroform extractions or ethanol precipitations, and there is no DNase carryover in the final RNA preparation.
  • RNAqueous kits can be used to purify total RNA from many different tissues and cells.
  • Cells or tissue are disrupted in a guanidinium thiocyanate solution; this chaotropic agent effectively lyses cells and inactivates endogenous ribonucleases.
  • the lysate is then diluted with an ethanol solution and applied to an RNA-binding glass fiber filter. Proteins, DNA and other contaminants are removed in three rapid washing steps, and the bound RNA is then eluted in concentrated form.
  • conserved (degenerate) multiplex PCR serves to reduce the systemic bias introduced with specific PCR protocols by designing a series of primers selected to target the conserved regions flanking species-specific variable regions of a gene(s) to be probed.
  • the strategy for E1A, fiber, and hexon genes has been illustrated; however, the skilled artisan may expand this strategy to target any gene that is conserved across a broad spectrum of species, but still has species-specific variable regions.
  • candidate genes and the specific regions can be readily identified by global or local homology searches (i.e., sequence alignment).
  • primer refers to an oligonucleotide that is capable of acting as a point of initiation of polynucleotide synthesis along a complementary strand when placed under conditions in which synthesis of a primer extension product that is complementary to a polynucleotide is catalyzed.
  • Typical polynucleotide synthesis conditions include the presence of four different nucleotide triphosphates or nucleoside analogs and one or more enzyme to catalyze polymerization (e.g., a DNA polymerase and/or reverse transcriptase) in an appropriate buffer (“buffer” includes substituents which are cofactors, or which affect pH, ionic strength, etc.), and at a suitable temperature.
  • buffer includes substituents which are cofactors, or which affect pH, ionic strength, etc.
  • amplification primers typically range from 13 to 35 nucleotides, preferably from 20 to 25 nucleotides.
  • the nucleotide sequence of the primer must have sufficient sequence complementarity to the target sequence in order to facilitate hybridization.
  • the degree of complementarity will depend in large part on the length of the primer, the degree of complementarity generally is at least 80%, preferably at least 90%, more preferably at least 95%.
  • the preferred primer length is from 6 to 10 nucleotides.
  • the sequence would ideally include all permutations of a hexameric (2 permutations) to a decameric (2 10 permutations).
  • the preferred scenario would be to have conserved primers that flank variable regions of target genes.
  • HA hemagglutinin
  • NA neuraminidase
  • M matrix
  • targets are not selected as “prototypes”, the amount of real estate on the chip can be greatly reduced compared to prototype regions.
  • the objective in these cases is not necessarily to identify a particular strain or sub-variant of the species, but rather to allow for enough base calls to be made for an unambiguous statistical estimate demonstrating that the sequence corresponds to the pathogen of interest and not to a closely related species or non-virulent strain.
  • this chip design of multiple, small targets it is not feasible to design and optimize conditions for the large number of specific PCR reactions that would be needed and total amplification becomes the optimal amplification strategy.
  • sequence similarity or sequence identity of nucleotide or amino acid sequences may be determined conventionally by using known software or computer programs such as the BestFit or Gap pairwise comparison programs (GCG Wisconsin Package, Genetics Computer Group, 575 Science Drive, Madison, Wis. 53711). BestFit uses the local homology algorithm of Smith and Waterman, Advances in Applied Mathematics 2: 482-489 (1981), to find the best segment of identity or similarity between two sequences. Gap performs global alignments: all of one sequence with all of another similar sequence using the previously described methods (Needleman & Wunsch, 1970).
  • the default setting When using a sequence alignment program such as BestFit, to determine the degree of sequence homology, similarity or identity, the default setting may be used, or an appropriate scoring matrix may be selected to optimize identity, similarity or homology scores. Similarly, when using a program such as BestFit to determine sequence identity, similarity or homology between two different amino acid sequences, the default settings may be used, or an appropriate scoring matrix, such as blosum45 or blosum80, may be selected to optimize identity, similarity or homology scores.
  • a sequence alignment program such as BestFit
  • Targets may also be amplified using a combination of specific PCR reactants in what is referred to as “multiplexed PCR”.
  • multiplexed PCR PCR primer pairs for all target regions on the RPM are combined into one reaction miture. This is a preferred method in cases where one or more of the pathogens is present in too low a concentration to be detected using random amplification strategies alone (described below).
  • microarray-based detection is that it can combine unbiased (e.g. random) nucleic acid amplification strategies with the subsequent discriminatory capability of microarrays, resulting in high sensitivity, specificity and throughput capacity.
  • the inventors have addressed the aforementioned issues through the use of alternative approaches and have investigated four front-end amplification strategies: random primed, isothermal Klenow polymerase-based, 029 DNA polymerase-based and multiplex PCR (Vora et al., 2004).
  • Klenow-based amplification The Klenow fragment of DNA polymerase I can be used for isothermal, random amplification of target DNA of unknown sequence with random octamers oligonucleotide primers. For the present invention, this can be performed using the BioPrime® DNA Labeling System (Invitrogen). Biotinylated amplicons are generated (following the manufacturer's recommended labeling protocol with minor modifications). This process is typically performed at 37° C. for 4 hours. Klenow amplification results in some high molecular weight amplification products, but the vast majority of amplicons are 50-450 basepairs (bp) in length. As such, these amplicons are suitable for direct hybridization to DNA microarrays.
  • bp basepairs
  • Random PCR amplification Random PCR amplification—Random PCR (rPCR) amplicons can be generated using the 2.5 ⁇ Random Primers Solution and 10 ⁇ DNTP mix from the Invitrogen BioPrime DNA Labeling System.
  • the reaction components typically include: 1 ⁇ PCR buffer (Qiagen), 2.5 mM MgCl 2 , 1 ⁇ DNTP Mix (containing biotin-14-dCTP), 5 ⁇ l of 2.5 ⁇ random octamers and 5 U Taq DNA polymerase (Qiagen).
  • the amplification reactions are performed using the following conditions for 35 cycles: 94° C. for 30 sec, 26° C. for 2 min, and 72° C. for 1 min.
  • ⁇ 29-based amplification Isothermal ⁇ 29 DNA polymerase-based amplification with random hexamers can be performed using the TempliPhiTM 100 Amplification Kit (Amersham Biosciences Corp., Piscataway, N.J.). Biotinylated amplicons are generated following the manufacturer's recommended protocol with minor modifications (14.4 ⁇ l amplification reactions contained 0.4 ⁇ l enzyme mix and 3 ⁇ l of 350 ⁇ M biotin-14-dCTP and are incubated at 30° C. for 16 h).
  • rPCR and ⁇ 29 DNA polymerase amplification products are too large to migrate into electophoretic gels (>1500 bp). Large amplification products hybridize poorly to immobilized probes on two-dimensional surfaces due to spatial and steric constraints (Vora et al., 2004). Thus, the rPCR and ⁇ 29 polymerase amplification products are digested with a DNase I fragmentation buffer to achieve amplicon sizes that are comparable to the Klenow and multiplex amplicons prior to hybridization.
  • Tandem [Klenow+Klenow] and [ ⁇ 29+Klendow] tandem random amplification strategies can provide better sensitivity to enriched pathogen targets than multiplex PCR.
  • the same random amplification strategies are also able to detect diagnostic genomic targets in spiked environmental water samples containing a 63-fold excess of contaminating DNA (Vora et al., 2004). The results presented underscore the feasibility of using random amplification approaches and begin to systematically address the versatility of these approaches for unbiased pathogen detection from environmental sources.
  • Random amplification methods result in amplification of non-target DNA as well as target DNA.
  • the inventors describe herein a variety of methods for enrichment of pathogen diagnostic target sequences in advance of random amplification steps. This is especially important to improve sensitivity and/or specificity of detection of analytes in complex matrices such as clinical (e.g. nasal wash or throat swab) or environmental (e.g. water, soil, air collector) samples.
  • Non-specific background Complex samples (clinical and environmental) contain significant, and sometimes overwhelming amounts of unknown genomes and genomes not of interest (non-specific background).
  • One approach to reduce the non-specific background is to expose the nucleic acids to enzymatic processes that selectively digest the background genomic sequences. This process is described below within the examples.
  • Another strategy for reducing non-pathogen genomic content is to use background genomic sequences from a comparable complex sample known to be negative for the organism(s) of interest and use it to directly remove background genomic sequences.
  • Such “subtractive” methods can include: (1) immobilization of the background genomes on solid phase surfaces such as gels or beads, followed by hybridization with the test sample to absorb background genomes from the samples.
  • One possibility for direct selection (also known as positive selection) from samples is to use immobilized probes on a solid phase support (magnetic beads or gel matrices) to selectively enrich for genomic targets of interest.
  • the probes on the solid support should not be detectable on the array, as they would result in false signals in the event that the enrichment molecules are carried over or inadvertently amplified.
  • the probes on the beads should select for target genomes via an adjacent region or slightly overlapping with the region of the analytes' genomes to be queried on the microarray.
  • this queried region should be masked out during in silico analysis.
  • those probes should be comprised so as to not undergo subsequent amplification, or be made susceptible to selective enzymatic digestion prior to amplification.
  • Immunoprecipitation is another way to enrich the pathogens' nucleic acids.
  • Antibodies for pathogens of interest could be mixed with clinical samples, then precipitated with anti-IgG to pull down pathogens, thereby removing background genomic DNA. This will be of particular importance when it is desirable to correlate specific genomic traits with a single pathogen, such as antibiotic resistance markers or indicators of intentional genetic manipulation.
  • Size exclusion is another method by which to subtract or enrich pathogen DNA.
  • Exemplary size exclusion methods include: gradient centrifugation, column, or centrifugal filter units. Gradient centrifugation or column separation methods are time-consuming and require special set-up in the laboratory. The use of “centrifugal filter units” for separation of high- from low-molecular-weight species suffers from inconsistent and, often, low recovery rates. Each of these methods requires a large volume of starting material.
  • Other size exclusion methods include: flow cytometry or electrophoresis methods, such as fluorescence-activated cell sorting (FACS) or with a special electrophoretic chip used in an Agilent bioanalyzer.
  • FACS fluorescence-activated cell sorting
  • the present inventors have described methods for subtraction of “normal” human and microbial nucleic acids from nasal wash specimens. This same principle can also be applied to samples of any origin (clinical or environmental) where a representative “normal” mixture of nucleic acids can be collected, pooled, and prepared as a subtractive reagent.
  • a variety of approaches can also be applied to enrich for the pathogens or specific targets that are tiled on the array prior to performing a total amplification strategy.
  • One such approach would use immobilized variants of the sequences that are tiled on the array. These variants would be bound to a solid phase component used for separation (beads, matrices, etc.) and serve to enrich for targets that will be amplified without being amplified themselves. Making the enrichment probes susceptible to enzymatic degradation can do this or they might be comprised of modified nucleic acids that would not be amplifiable.
  • a more preferred embodiment would utilize probes that recognize sequences that are adjacent to target gene sequences and not represented on the tiled regions of the chip. In this manner, their amplification in a non-biased amplification strategy would not result in artifacts.
  • the method of the present invention preferably does not make use of specific sequences for amplification (PCR).
  • PCR amplification
  • the invention illustrates that there are alternate methods for enrichment of pathogen nucleic acids, for example: using solid phase support separations, prior to applying reduced bias, and isothermal (e.g. random-primed Klenow or strand displacement) amplification.
  • isothermal e.g. random-primed Klenow or strand displacement
  • a skilled technician in a conventional laboratory setting would be capable of performing time- and cost-effective sample preparation using a minimal set of automated steps to perform microarray experiments.
  • a minimally skilled technician in a field environment (medical level 1) would be capable of performing manual separation/enrichment of pathogen target nucleic acids using a handheld instrument and perform isothermal amplification of pathogen targets with few reagents and technical steps.
  • first strand cDNA from RNA viruses (pathogens) may be employed.
  • a subtractive hybridization protocol could be employed after first strand cDNA synthesis is complete to reduce the amount of background DNA in clinical samples before subjecting complex (i.e. clinical or environmental) samples to one or more DNA amplification step(s).
  • One method is direct subtraction of the background genomic DNA from amplified products (first strand cDNA synthesis, then total amplification) in hybridization solution with COT-1 human DNA (which consists largely of rapidly annealing repetitive elements).
  • Another method is bead-based subtraction of background genomic DNA from clinical sample after first strand cDNA synthesis and prior to the DNA amplification step.
  • the third method is the combination of the above methods.
  • the human genomic background DNA from complex samples would be subtracted using bead-based subtraction after first strand cDNA synthesis and prior to the DNA amplification step(s).
  • the background DNA could be further subtracted from complex sample in hybridization solution with sequences designed to selectively capture human DNA and RNA.
  • the DNA amplification step itself could be aimed at amplifying the cDNA products formed in the random RT step specifically, non-specifically, or through a combination of methods to amplify both the specific primer site-labeled RT-PCR products as well as pathogen genomic DNA targets and other non-cDNA targets that did not arise from the random RT-PCR step.
  • One approach for doing so would be to ligate a specific primer sequence to the pathogen DNA genomic targets (this could be the same primer as used attached to cDNA products or a separate one), allowing a single PCR step to amplify all RNA and DNA pathogen targets.
  • RNA processing pathway spiked and clinical (nasal wash and throat swab) Influenza A positive specimens were processed using different methods (random, universal, and multiplexed PCR). However, to achieve acceptable levels of sensitivity with random amplification approaches, human messenger and ribosomal RNA should be subtracted using the MICROBEnrichTM kit (Ambion, Inc., Austin, Tex.) in accordance with the manufacturer's instructions. A preferred random amplification strategy may be empolyed adapted from a previously-described method (Wang et al., 2002).
  • the flu sensitivity is about 0.25 pfu/ ⁇ l (1 ng/ ⁇ l) in spiking nasal wash.
  • the sensitivty without subtraction is estimated to be about 1-10 pfu/ ⁇ l.
  • Random amplification for DNA samples may be performed with either bacteriophage ⁇ 29 DNA polymerase or modified random amplification protocol from previously published paper (Wang et al. 2002; Wang et al.2003). Briefly, DNA amplification utilizing bacteriophage ⁇ 29 DNA polymerase with random hexamers can be conducted according to the instruction of GenomiPhiTM DNA Amplification Kit (Amersham Biosciences Corp., Sunnyvale, Calif.). The amplified products are then ethanol precipitated according to manufacture recommended protocol.
  • DNA amplification utilizing modified random amplification may be performed with initial round of DNA synthesis with SequenaseTM version 2.0 DNA polymerase (United States Biochemical, Cleveland, Ohio) using primer D, followed by PCR amplification with primer E.
  • RNA amplification viral samples are then amplified by a modified version of a random PCR protocol (Wang et al. 2002; Wang et al. 2003; Kessler et al. 2004). Briefly, 10 ⁇ l of total RNA can be reverse transcribed by using primer D and superscript III reverse transcriptase (Invitrogen Corp. Carlsbad, Calif.), and was then amplified by PCR with primer E.
  • RNA and DNA pathways are described in FIG. 9 .
  • the pathways for RNA and DNA are merged.
  • This protocol is adapted from the lab of Joseph DeRisi at University of California San Francisco (http://derisilab.ucsf.edu/pdfs/Round_A_B_C.pdf) and randomly incorporates a single, fixed-sequence PCR primer binding site into all pathogen DNA or cDNA molecules, allowing them to all be amplified in a subsequent step using a conventional PCR thermal cycling protocol.
  • a “microarray” is a linear or two-dimensional array of preferably discrete regions, each having a defined area, formed on the surface of a solid support.
  • the density of the discrete regions on a microarray is determined by the total numbers of different target polynucleotides to be detected on the surface of a single solid phase support, preferably at least about 10 2 /cm 2 , more preferably at least about 10 4 /cm 2 , even more preferably at least about 10 6 /cm 2 , and still more preferably at least about 10 8 /cm 2 .
  • a DNA microarray is an array of oligonucleotide primers placed on a chip or other surfaces used to detect and/or isolate target polynucleotides. Since the position of each particular group of primers in the array is known, the identities of the target polynucleotides can be determined based on their binding to a particular position in the microarray.
  • One embodiment of the invention utilized standard Affymetrix hardware (Agilent GeneChip Scanner (phased out) and the Affymetrix Scanner 3000 workstation and Fluidics Station 450.
  • the described invention does not require this equipment.
  • the existing apparatuses are not optimized for the dynamic range of signal intensities or background interferences inherent to the present invention.
  • a preferred embodiment incorporates the use-of image acquisition methods, including the use of spatial frequency filtering and image enhancement, taking advantage of the inherent regularity of the feature dimensions to impose a filtering algorithm (e.g. edge enhancement, convolution, etc.) that allows better contrast of noisy images.
  • sample processing is accomplished by employing the standard Affymetrix CustomSeqTM protocol.
  • this method entails: (a) amplification of DNA probe-containing materials, (b) pooling and quantitation of amplified product, (c) fragmentation and labeling of the amplified product, (d) target hybridization, and (e) washing, staining, and scanning of the hybridized target.
  • a detailed description of the Affymetrix CustomSeqTM protocol can be found in the product manual and protocol guide, which are available from the manufacturer and are incorporated herein by reference.
  • step (a) entails either long-range PCR or short-range PCR, with long-range PCR being the preferred amplification strategy.
  • the manufacturer recommended PCR DNA polymerases are Taq variants, AmpliTaq Gold DNA polymerase (short-range PCR) and LA Taq DNA polymerase (long-range PCR).
  • any DNA polymerase may be employed for step (a) so long as the DNA polymerase used is a high fidelity DNA polymerase.
  • step (a) of the Affymetrix CustomSeqTM protocol is replaced with an alternate amplification strategy, such as multiplex PCR, total amplification (GenomiPhiTM), or random RT/PCR.
  • an alternate amplification strategy such as multiplex PCR, total amplification (GenomiPhiTM), or random RT/PCR.
  • step (b) of the Affymetrix CustomSeqTM protocol entails pooling PCR reactions and spectrophotometrically quantifying the same to ensure equimolar application of sample to the microarray.
  • the present invention poses several advantages over the SNP detection tailored protocols of the Affymetrix CustomSeqTM method.
  • the use of the increased density chips with sequence length-independent similarity searches (BLASTN) in the present invention affords that fewer assumptions must be made in advance of selecting sequences for tiling.
  • the use of length-independent similarity searches (BLASTN) removes the constraint that a particular known subsequence be successfully resequenced, making the approach more resistant to variations in target concentration and contributions from nonspecific binding leading to lost base calls.
  • step (b) of the Affymetrix CustomSeqTM protocol is optional and may be omitted.
  • step (c) of the Affymetrix CustomSeqTM protocol involves fragmentation and subsequent labeling of the fragments with a fluorescent substrate.
  • the method and reagents for fragmentation and labeling are not particularly limiting; however the label must be compatible with the detection apparatus for the resequencing microarray. To this end, the manufacturer recommended reagents and conditions may be employed.
  • Fluorescent labels that may serve to be advantageous for the methods described herein, as these are routinely used with automated instrumentation for simultaneous high throughput analysis of multiple samples, include the Cy fluorophores, the rhodamine based fluorophores: TARAM, ROX, JOE, and FAM; the BigDyeTM fluorophores (Applied Biosystems, Inc.), the dansyl group, fluorescein and substituted fluorescein derivatives, acridine derivatives, coumarin derivatives, pthalocyanines, tetramethylrhodamine, Texas RedTM, 9-(carboxyethyl)-3-hydroxy-6-oxo-6H-xanthenes, DABCYLTM, BODIPYTM, and ALEXATM fluorophores (Molecular Probes, Eugene, Oreg.)
  • RLS resonance light scattering
  • Quantum Dot Corp. Quantum Dot Corp.
  • the target hybridization may be performed as described in the Affymetrix CustomSeqTM protocol.
  • the highlight of this step is that the sample containing the fragmented and labeled DNA is denatured by a high temperature (e.g., 85-100° C., preferably 95° C.) incubation followed by a hybridization temperature (e.g., 45° C.) equilibration.
  • a high temperature e.g. 85-100° C., preferably 95° C.
  • a hybridization temperature e.g. 45° C.
  • the target hybridization incubation time may range from a short time of 15 minutes to a long of 24 hours. Clearly, it is contemplated that this range of times embodies each of the intermediate times as if they were explicitly stated. Preferable times worth noting are 15 minutes, 30 minutes, 1 hour, 2 hours, 4 hours, 12, hours, and 16 hours.
  • the last step of the Affymetrix CustomSeqTM protocol entails washing the hybridized array using the Affymetrix Fluidics Station and scanned using the Agilent GeneArrayTM Scanner.
  • This instrument simply automates what would otherwise be manually performable labeling and rinse steps.
  • any instrument that would be capable of delivering and withdrawing milliliter quantities of labeling and rinse media on a timed basis would be a suitable alternative.
  • the invention described herein will be amenable to any subsequent hardware variations offered by Affymetrix.
  • data acquisition from the types of resequencing microarrays described herein may be obtained from any manufacturer of equipment for microarray processing.
  • Bioinformatic tools are indispensable for the efficient design and selection of specific complementary nucleic acid probe sequences for microarray development.
  • target pathogen genomic nucleic acid sequences are often amplified prior to microarray analysis and bioinformatics clearly has a role in the design of primers (assessing T m /T a , secondary structure, self-complementarity, and specificity issues) for assaying genes considered specific to an organism and strain (Kampke, Kieninger & Mecklenburg, 2001). These same assessments must also be made for microarray probe design.
  • primers and probes to genetic signatures associated with a target pathogen are specific to that pathogen or family of pathogens. It would follow that the generation of an amplicon or positive hybridization reaction using specifically designed primers or probe, respectively, would indicate the detection of the designated molecular trait from the target pathogen; however, this is not necessarily true.
  • Bacterial and viral ‘genetic promiscuity’ the propensity of microorganisms to exchange genetic material, creates difficulties in developing single species or strain specific probes (Ochman, Lawrence & Groisman, 2000).
  • preferred primer and probe design methodologies require the use of bioinformatic tools to: (a) perform multiple sequence alignments between different organisms or strains and design appropriate primers with the appropriate biochemical properties, (b) compare these sequences with those deposited in sequence databases to determine the present uniqueness of particular sequences and the potential for cross-reactivity, and (c) infer the probability of target specificity based on the level of genetic conservation and evolutionary relatedness with other pathogenic and non-pathogenic species whose primary genetic sequence has not yet been elucidated.
  • a very important bioinformatics aspect of the disclosed invention involves the assembly, annotation and selection of pathogen diagnostic targets into database(s) for incorporation into microarray design, as well as the concomitant task of relating detection events on the microarray to such database(s).
  • An advantage of the present invention is that the information contained in the publicly available databases is ever increasing, thus further adding to the robust nature of the present invention.
  • the present invention describes a process of manually selecting pathogen target sequences from the published literature (e.g. GenBank) and/or ascertaining an empirically determined diagnostic target sequence from published literature.
  • the described approach has the advantage that a consortium of scientists, each possessing sufficient “domain expertise” for each of a large number of disparate pathogen species, can provide relevant, pathogen diagnostic sequence information that can be incorporated into an automated array design process without specific regard to specific probe, reagent, amplification, and sample preparation methods.
  • the requisite domain expertise for each of a large number of unrelated pathogens will be maintained in an up-to-date fashion through a web-portal enabled database.
  • an extended consortium comprised of individual researchers of specific pathogens, would be able to provide the latest annotated target sequence information via a “pathogen page” formatted web portal, analogous to the “molecular page” model adopted by the Alliance for Cellular Signaling (AfCS).
  • the AfCS database then maintains an otherwise incomprehensible amount of specific information on thousands of molecules involved in intracellular signaling cascades. In this format, individual researchers without specific knowledge about individual signaling molecules can access detailed parameters that can be used in numerical simulations of signaling events.
  • the annotated target sequence data for individual pathogens is organized into an automated data pipeline in which will impose user-defined design constraints (e.g. number of probe features, number of pathogen targets, the levels of sensitivity and specificity required for array performance, etc.) upon the total information content of a pathogen database, allowing automated, optimal target selection and submission of those targets to a vendor in a format necessary for microarray fabrication.
  • user-defined design constraints e.g. number of probe features, number of pathogen targets, the levels of sensitivity and specificity required for array performance, etc.
  • the selected target sequences determined by the previous process will be correlated with the data that is collected in actual use of the microarray, such that metrics for probability and quality can readily used for decision-making.
  • VIBE Visual Integrated Bioinformatics Environment
  • iNquiry BioTeam, Boston, Mass.
  • Raw sequence data from the resequencing microarray chips is provided by the Genetic Data Analysis Software version 2.0 (GDAS) packaged with the microarray reader from Affymetrix.
  • GDAS Genetic Data Analysis Software version 2.0
  • the Affymetrix resequencing array contains a defined number of probe cells or features. During scanning, the software divides each feature into subunit squares or pixels (3 ⁇ 3 ⁇ m). Each feature contains many copies of a unique 25-base oligonucleotide probe of defined sequence, while a series of eight features query a specific site in a known reference sequence. Four features interrogate the sense strand and contain probes that are identical except for the central base which is A, C, G, or T and four features interrogate the anti-sense strand and contain probes that are identical except for the central base which is A, C, G, or T.
  • GDAS uses the cell intensity data to make base calls for every base position represented on the resequencing array.
  • the algorithm uses the intensity data from multiple samples to improve its calling accuracy and assigns a quality score for each call.
  • GDAS base calling is based on a previously described base-calling algorithm, ABACUS, detailed in (Cutler et al., 2001)).
  • the model assumes that the pixel intensities of a feature are independently and normally distributed.
  • the algorithm computes the estimated mean background and variance for the sense and anti-sense strand features.
  • the base-calling algorithm also specifies models for the presence or absence of various genotypes in the sample (haploid or diploid).
  • a variety of base calling algorithm parameters can be defined by the user (GDAS operator's manual/user's guide, Affymetrix) to obtain a trade-off between base calling percentage and accuracy.
  • GDAS user manual which is incorporated herein by reference in its entirety.
  • a description of the parameters is found in the GDAS version 2.0 manual on pages 207-217.
  • the recommended (default) settings for GDAS are “conservative” settings that focus on the highest level of accuracy.
  • the objective of the present invention is to increase the percentage of base calls. To achieve this objective, the present inventors adjusted the parameters to allow highly permissive base calls (increased percentage) as listed below:
  • the base call algorithm is set up by default to sacrifice the number of base calls made in order to make the most accurate calls (i.e., for SNP detection).
  • the technique is less concerned about achieving the same degree of accuracy as required for SNP detection but instead expanding the number of calls made so that the longest possible stretches of contiguous sequence are produced by GDAS while maintaining necessary specificity.
  • the above-listed permissive settings can be altered individually or in toto as desired by the practitioner to obtain an optimal sensitivity/specificity agreement.
  • the settings above are exemplary and that each setting may be altered by 10% or more (parameter dependent) without altering the desired result of the present invention.
  • sequence information derived from a base-calling algorithm, as applied to the microarray hybridization pattern that is used to identify individual pathogens.
  • sequence of target sequences determined by the resequencing probes is used to query a database using a similarity search algorithm.
  • the algorithm uses commonly used local alignment (e.g. Smith-Waterman, BLASTN) sequence alignment algorithms to statistically determine the probability that a given target sequence corresponds to a specific sequence in a database record (Korf, Yandell & Bedell, 2003).
  • a custom algorithm that determines subsequences that are most suitable for producing meaningful similarity searches against database records determines the set(s) of sequences that are submitted for similarity search automatically.
  • the automated subsequence-parsing algorithm is the Resequencing Pathogen Identifier (REPI) algorithm described in this invention and the sequence database records will be in both the public (e.g. GenBank) and private domain.
  • REPI Resequencing Pathogen Identifier
  • Variants of nucleic acid sequence similarity search algorithms that are suitable for use in the intended invention include, but are not limited to: Washington University BLAST (WU-BLAST), NCBI-BLAST, FastA, MPsrch, Scanps, and BestFit (Korf et al., 2003).
  • REPI Resequencing Pathogen Identifier
  • the low-level functionality provided by REPI will be central to a number of higher bioinformatics tasks that will utilize discontinuous segments of nucleic acid, or even amino acid sequence.
  • the present inventors provide data showing that sequence fragments can be linked automatically to individual pathogens.
  • this approach can be refined to better discriminate between mixtures of pathogens and genetic recombination between pathogens.
  • the analysis software would allow for automatic detection of overlapping or homologous sequence fragments on different tiled regions of the array, allowing inference of a mixture of pathogens.
  • the analysis software would determine that the sequence outputs from different tiled regions are not overlapping but correspond to contiguous sequence that may be used to infer a genetic recombination event.
  • a co-infection of two strains of a virus may produce a recombinant with a gene that is homologous with one virus strain except for the 5′ end, which has been substituted with the corresponding section of gene for the other virus strain.
  • this new recombinant virus genome is hybridized on a resequencing microarray, it produces signal from the corresponding pieces of both regions.
  • the degree of overlap could be affected by low concentrations of target with correspondingly smaller amounts of the tiles being filled in.
  • This same principle can be applied even more readily, and with greater impact, on viruses where the recombination is a steady and recurring event, as in the case of influenza, where recombinations between viral segments result regularly in the formation of new viral strains.
  • this described functionality in REPI will be essential for the distinction of pathogen mixtures versus recombination.
  • REPI algorithms will allow for the analysis of transcriptional markers (e.g. RNA) that have been resequenced using the presently described type of microarray (via hybridization of RNA or complementary cDNA).
  • transcriptional sequences may also be assembled to determine pathogen viability and transcriptional editing events that can serve as markers for infection.
  • the first is the absolute intensity of the hybridization signals on the chip.
  • a non-linear relationship exists between the amount of target in solution and the amount that actually hybridizes and the resulting signal.
  • an estimate of the amount of target nucleic acid in the sample could be made by comparison with a standard curve prepared under control conditions.
  • the signal intensity data is readily available from the .CEL file in the Affymetrix data hierarchy, and although the content of the .CEL files were not used in this disclosure, the output of REPI could easily be modified to include the intensity values of the .CEL files.
  • the percentage of base calls both as a percentage of the total tile region size and as a percentage of base calls within a selected subsequence satisfying the sliding window algorithm, could be used as a measure of concentration. Our results show that both of these percentage metrics decrease with decreasing target concentration, although the correct pathogen can still be identified.
  • the invention described herein will be used for the routine diagnosis and surveillance of common respiratory pathogens in a clinical setting (at or near point-of-care).
  • Readily obtainable samples e.g. nasal wash, nasal swab, throat swab, sputum, or blood
  • Base calls will be made using the custom algorithms or using the steps specified by the vendor.
  • REPI or some variant thereof, will be used to automatically parse the base calls made by the microarray, and provide the end-user (e.g., physician, health care provider, public health officer, or other decision-makers) with decision-quality information for management (e.g., diagnostic, treatment, prognostic and outbreak control/containment measures) of the infectious pathogen(s) that are causative of the disease symptoms and complications.
  • This analysis would occur locally through the use of an embedded sequence database that would be queried by REPI (e.g.
  • the microarray will also carry markers for highly improbable (i.e. bioterrorism) pathogens that would be cause for involvement of others, namely public health officials.
  • bioterrorism highly improbable pathogens that would be cause for involvement of others, namely public health officials.
  • a nasal wash or throat swab may not be the optimal sample type for diagnosis of bioterrorism agents and that a separate sample type may be needed.
  • Pathogens which can be identified by this route include the commonly occurring pathogens including those listed in Table 1.
  • the presence of fever has been found to be an important criteria for isolating respiratory pathogens by culture and literature demonstrates that pathogens are typically present at peak titer during febrile periods.
  • HCP Health Care Practitioner
  • Common organisms causing lower respiratory tract infection include, but are not limited to: Mycoplasma pneumoniae, S. pneumoniae, C. pneumoniae, L. pneumophila, S. pyogenes , Influenza A/B, RSV, Parainfluenza, S. aureus , SARS.
  • BT/BW agents of concern an abnormal chest x-ray can be found with B.
  • nasal wash/throat swab can still be appropriate sample techniques, although some practitioners will choose to send a sputum samples.
  • sputum and blood can be appropriate sample techniques.
  • the microarray can continue to be useful for detecting cases of other common pathogens, but may also be used to screen for known BT/BW agent using any type of appropriate specimen. Other assays may prove less expensive, but the microarray can provide forensic information and antibiotic resistance data at the time of pathogen identification.
  • the resequencing DNA microarray and associated devices will be but one class of elements of an integrated pathogen diagnostic/surveillance system.
  • This system will be comprised of diagnostic, informatic, and epidemiologic components.
  • the RPM and ancillary devices
  • the RPM will provide a rapid and cost-effective methodology for providing a diagnosis, patient-specific treatment information, and prognostic information (based on virulence and resistance markers) of infectious respiratory disease.
  • the single highly multiplexed DNA arrays will additionally provide diagnostic information on which group of pathogens to treat (e.g., bacteria, viruses, parasitic, and fungal pathogens) producing substantial return on investment by reducing the number of prescriptions based on suspicion of causal agents (e.g., prescribing antibiotics for a viral respiratory infection will have no effect).
  • group of pathogens to treat e.g., bacteria, viruses, parasitic, and fungal pathogens
  • Additional diagnostic applications can be created to cover all pathogens effecting an organ or organ systems (e.g., respiratory, genitourinary, central nervous system, etc.), syndromes (e.g., fever of unknown origin evaluated in the hospital for two weeks without identifying the cause to rule out all potential infectious disease causes), symptoms (e.g., all pathogens causing a urticaria or rash that itches, or cough, etc.), around collections of pathogens or threats present in geographic locations, or functional categories (e.g., groupings based on all the organisms known to have antimicrobial resistance in hospital or other confined settings like prisons or nursing homes).
  • organ or organ systems e.g., respiratory, genitourinary, central nervous system, etc.
  • syndromes e.g., fever of unknown origin evaluated in the hospital for two weeks without identifying the cause to rule out all potential infectious disease causes
  • symptoms e.g., all pathogens causing a urticaria or rash that itches, or cough, etc.
  • This highly multiplexed differential diagnostic testing will be done by determining the causative agent(s) of infection, antimicrobial susceptibility of the agent(s), and genomic sequence-specific clues as to the nature of the agent such that the maximum number of opportunities is identified to increase the efficacy and efficiency of clinical management.
  • diagnostic microarrays In the specific embodiment described here, it will be highly advantageous to have diagnostic microarrays, the fabrication of which will not rely on the availability of a large number of target sequences and a means to fabricate arrays using them. More importantly, it will be critical not to be restricted to the assumption that the target sequences are invariant. Diagnostic DNA microarrays will identify specific but unanticipated genomic variants of a model pathogen, without requiring re-design of specific oligonucleotide probes and array re-fabrication. This will be critical to the ability to characterize the cause(s) of infectious disease outbreaks in a time-effective manner. For example, such microarrays could be used to rapidly detect new variations of influenza or SARS virus without requiring that the pathogens be isolated, cultured, and sequenced using conventional approaches; a process that would require weeks to months if the pathogen were readily cultivable.
  • the present invention also embraces applications for detecting a mixture of pathogens, especially when there is no preliminary evidence to suggest that the mixture might be interrogated by specific reagents (e.g. PCR primers).
  • specific reagents e.g. PCR primers.
  • the present invention provides a means to impact the ability to determine the complementary roles of interacting pathogens in disease etiology.
  • applications such as viral or bacterial stock quality control and assessment of viral vaccine production, which involves the intentional mixture of field strain and cultivable viruses to produce recombinants that culture well.
  • the present invention enables the presentation of the correct the appropriate epitope(s) for vaccine efficacy.
  • the informatics component of the system will provide the necessary components to allow local (point-of-care), automatic microarray data analysis as well as coordinate multi-directional information transfer.
  • “Upward” flow of information will entail the transfer of specific sequence base calls from the resequencing chip, preferably in FASTA format, and all associated local processing results, to local, regional, national and international levels.
  • “Lateral” flow of information will involve the exchange of specific sequence base calls and associated local processing results to other local point-of-care medical facilities.
  • Downward flow of information is defined as a provision of national level data integration to regional and local health officials.
  • environmental samples may contain small amounts of target nucleic acids in a high genomic background of unknown origin. But unlike clinical samples of a given type, the background found in an environmental sample (e.g. soil, water, or collected from an aerosol particle collector) might show a more heterogeneous composition depending on the geographical location, season, and environmental conditions. Accordingly, the aforementioned amplification, enrichment and/or subtraction strategies may be employed to obtain reliable base calling.
  • an environmental sample e.g. soil, water, or collected from an aerosol particle collector
  • the amount of detailed sequence information provided by the RPM will be enabling for various applications other than medical diagnosis and surveillance.
  • the capability of the apparatus extends to forensic fingerprinting of specific pathogen strains.
  • the capability enables preemptive diagnosis of etiologies of infectious disease, as alternative to conventional practice of corroborative diagnostic analysis.
  • the resequencing pathogen detection microarray would allow for detailed strain identification that could be used to determine the possible originator of the event and to allow for rapid mitigation of the event (e.g. determination of infectious capacity, antimicrobial resistance, or engineered modifications to an organism) by implementing targeted public health containment measures directed by having the pathogen identified to the strain as the completed first step in the outbreak investigation process.
  • the present invention further suggests methods and processes to automate and optimize the iterative and adaptive design, fabrication and validation of arrays, including derivative sub-arrays.
  • an enterprise level a consortium of experts on individual pathogens would maintain a web portal-enabled database. The consortium would maintain pathogen target sequences for identification and virulence.
  • the invention further provides a specific implementation that validates its capabilities in a real world operational setting.
  • This implementation relates to epidemic outbreaks of acute respiratory disease involving common and less common etiologies, while simultaneously evaluating the possible presentation of hostile pathogenic agents (rare if ever) in individual encounters.
  • the invention provides a means to perform near real time surveillance of a plurality of infectious pathogens involved in an infectious outbreak. Such surveillance may be validated and eventually become operational in a “real world testbed”.
  • the real world testbed is a human population that regularly encounters a variety of respiratory pathogens.
  • the population is comprised of military personnel at an installation or base.
  • the population is comprised of active duty military personnel.
  • microarray design and assay will require only that sequences be provided to a microarray manufacturer and not involve the design of ancillary reagents (e.g. for specific PCR).
  • ancillary reagents e.g. for specific PCR.
  • an end user who has no detailed knowledge of genomics or would be capable of defining qualitative attributes of a microarray-based assay, and an automated bioinformatics pipeline would be used to select suitable target gene subsequences for submission to a resequencing microarray manufacturer. This would allow rapid deployment of a new micorarray design for a specific geographic location, theater of operations.
  • the integrated design/analysis capability that is enabled by the present invention will generalize to other envisioned applications besides those listed herein.
  • genomic sequences of thirteen adenovirus strains which were not known as of the date of the present invention.
  • the thirteen adenovirus strains are: Ad3, Ad3FS_navy, Ad4, Ad4vaccine, Ad4FS_navy, Ad4FS_AF, Ad5FS, Ad7, Ad7FS_navy, Ad7 vaccine, Ad16, Ad1, and Ad21.
  • These genomic sequences have been assigned the GenBank accession numbers shown in Table 6 appearing in the Examples. The full GenBank records, including partial annotation, for each of these sequences are found in the Sequence Listing attached herewith.
  • polypeptide as used herein is understood to mean a sequence of several amino acid residues linked by peptide bonds. Such amino acids are known in the art and encompass the unmodified and modified amino acids. In addition, one or more modifications known in the art such as glycosylation, phosphorylation, etc may modify the polypeptide.
  • isolated means separated from its natural environment. This term is intended to also embrace the terms “purified” (100% pure) and “substantially purified” (at least 90% pure).
  • polynucleotide refers in general to polyribonucleotides and polydeoxyribonucleotides, and can denote an unmodified RNA or DNA or a modified RNA or DNA.
  • homologous as used herein is understood to mean sequence similarity between two or more polynucleotides or proteins from the same species or from a different species.
  • said two or more polynucleotides (or proteins) are homologous when at least 70%, preferably at least 80%, most preferably at least 90% of the nucleotide base (amino acid) composition of a candidate sequence corresponds to the sequence according to the invention.
  • a “homologous protein” is to be understood to retain at least 50%, preferably at least 75%, more preferably at least 85%, most preferably at least 95%, of the activity of the activity of the sequence of the present invention.
  • corresponding amino acids are either identical or are mutually homologous amino acids.
  • homologous amino acids denotes those that have corresponding properties, particularly with regard to their charge, hydrophobic character, steric properties, etc.
  • the same terminology can be used to describe DNA or RNA sequence homology for gene sequences that encode the corresponding proteins.
  • homologous fragment as used herein is understood to mean two or more polynucleotides or proteins from the same species or from a different species.
  • a fragment is homologous when it shares at least 40% identity to a fragment having at least 50 amino acids.
  • homologous fragments share at least 50% identity to a fragment having at least 50 amino acids.
  • homologous fragments share at least 60% identity, at least 70% identity, at least 80% identity, at least 90% identity, or at least 95% identity to a fragment having at least 50 amino acids. Accordingly, homologous fragments are included within the scope of the present invention.
  • homologous polynucleotides it is understood that that the same homology ranges are envisioned in the present inventions but over a range of up to 1000 nucleotides, inclusive of all integers (i.e., 150, 250, 300, 500, 750, etc.).
  • sequence similarity or sequence identity of nucleotide or amino acid sequences may be determined conventionally by using known software or computer programs such as the BestFit or Gap pairwise comparison programs (GCG Wisconsin Package, Genetics Computer Group, 575 Science Drive, Madison, Wis. 53711). BestFit uses the local homology algorithm of Smith and Waterman, Advances in Applied Mathematics 2: 482-489 (1981), to find the best segment of identity or similarity between two sequences. Gap performs global alignments: all of one sequence with all of another similar sequence using the method of Needleman and Wunsch, J. Mol. Biol. 48:443453 (1970).
  • the default setting When using a sequence alignment program such as BestFit, to determine the degree of sequence homology, similarity or identity, the default setting may be used, or an appropriate scoring matrix may be selected to optimize identity, similarity or homology scores. Similarly, when using a program such as BestFit to determine sequence identity, similarity or homology between two different amino acid sequences, the default settings may be used, or an appropriate scoring matrix, such as blosum45 or blosum80, may be selected to optimize identity, similarity or homology scores.
  • a sequence alignment program such as BestFit
  • the present invention also relates to polynucleotides that contain complete genes that are identified by open reading frames.
  • Examples of the preferred genes embraced by the present invention include E1A, hexon, and fiber.
  • the sequences of E1A, hexon, and fiber, as well as other preferred polynucleotide sequences within the scope of the present invention are found in the attached Sequence Listing.
  • the present invention also embraces fragments of said genes and polynucleotides and fragments thereof that can be obtained by screening by means of the hybridization of a corresponding gene bank with a probe which contains the sequence of said polynucleotide or a fragment thereof, and isolation of said DNA sequence.
  • the present invention also relates to coding DNA sequences that result from degeneration of the genetic code.
  • conservative amino acid replacements such as the replacement of glycine by alanine or of aspartic acid by glutamic acid in proteins as “sense mutations” that do not result in any fundamental change in the activity of the protein, i.e. which are functionally neutral. It is also known that changes at the N- and/or C-terminus of a protein do not substantially impair the function thereof, and may even stabilize said function.
  • Polynucleotide sequences according to the invention are suitable as hybridization probes for RNA, cDNA and DNA, in order to isolate those cDNAs or genes, which exhibit a high degree of similarity to the probe sequence.
  • Polynucleotide sequences according to the invention are also suitable as primers for polymerase chain reaction (PCR) for the production of DNA that encodes an active enzyme.
  • PCR polymerase chain reaction
  • Oligonucleotides such as these which serve as probes or primers, can contain more than 30, preferably up to 30, more preferably up to 20, even more preferably at least 15, and most preferably at least 13 successive nucleotides. Oligonucleotides with a length of at least 40 or 50 nucleotides are also suitable.
  • Hybridization protocols are known in the art and are disclosed, for example, in Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, N.Y. (1989).
  • stringent hybridization conditions are those conditions which allow hybridization between polynucleotides that are 75%, 80%, 85%, 90%, 95%, or 98% homologous as determined using conventional homology programs, an example of which is UWGCG sequence analysis program available from the University of Wisconsin (Devereux, Haeberli & Smithies, 1984).
  • stringent conditions will be those in which the salt concentration is less than about 1.5 M Na ion, typically about 0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30° C. for short probes (e.g., 10 to 50 nucleotides) and at least about 60° C. for long probes (e.g., greater than 50 nucleotides).
  • Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide.
  • Exemplary moderate stringency conditions include hybridization in 40 to 45% formamide, 1 M NaCl, 1% SDS at 37° C., and a wash in 0.5 ⁇ to 1 ⁇ SSC at 55 to 60° C.
  • Exemplary high stringency conditions include hybridization in 50% formamide, 1 M NaCl, 1% SDS at 37° C., and a wash in 0.1 ⁇ SSC at 60 to 65° C.
  • the Tm is the temperature (under defined ionic strength and pH) at which 50% of a complementary target sequence hybridizes to a perfectly matched probe. Tm is reduced by about 1° C. for each 1% of mismatching; thus, Tm, hybridization and/or wash conditions can be adjusted to hybridize to sequences of the desired identity. For example, if sequences with approximately 90% identity are sought, the Tm can be decreased 10° C. Generally, stringent conditions are selected to be about 5° C. lower than the thermal melting point (Tm) for the specific sequence and its complement at a defined ionic strength and pH. However, severely stringent conditions can utilize a hybridization and/or wash at 1, 2, 3, or 4° C.
  • primer or “probe” means a polynucleotide, especially an oligonucleotide, that is produced synthetically or biologically and includes a specific nucleotide sequence and permits hybridization to a section containing the target nucleotide sequence.
  • primers or probes may be produced by any of several well-known methods, including automated solid-phase chemical synthesis using cyanoethyl-phosphoramidite precursors. Other well-known methods for construction of synthetic primers/oligonucleotides may, of course, be employed. J. Sambrook, E. F. Fritsch and T. Maniatis, Molecular Cloning 11 (2d ed. 1989).
  • the primers used to amplify the sample nucleic acids may be coupled to a detectable moiety.
  • a preferred example of such a detectable moiety is fluorescein, which is a standard label used in nucleic acid sequencing systems using laser light as a detection system.
  • Other detectable labels can also be employed, however, including other fluorophores, radio labels, chemical couplers such as biotin which can be detected with streptavidin-linked enzymes, and epitope tags such as digoxigenin detected using antibodies.
  • the primers may be modified whereby another nucleotide is added to, removed from, or substituted for at least one nucleotide in the oligonucleotide. Introduction of known labels such as radioactive substances, enzymes, fluorescence substances, etc. after synthesis of oligonucleotide is also included therein.
  • the probes/oligonucleotides used to hybridize with the polynucleotides coding for the polypeptides of the invention may be coupled to a detectable moiety.
  • the term “enhancement” means increasing the intracellular activity of one or more enzymes in a plant cell and/or plant that are encoded by the corresponding DNA. Enhancement can be achieved with the aid of various manipulations of the bacterial cell. In order to achieve enhancement, particularly over-expression, the number of copies of the corresponding gene can be increased, a strong promoter can be used, or the promoter- and regulation region or the ribosome binding site which is situated upstream of the structural gene can be mutated. Expression cassettes that are incorporated upstream of the structural gene act in the same manner. In addition, it is possible to increase expression by employing inducible promoters. A gene can also be used which encodes a corresponding enzyme with a high activity. Expression can also be improved by measures for extending the life of the mRNA. Furthermore, preventing the degradation of the enzyme increases enzyme activity as a whole. Moreover, these measures can optionally be combined in any desired manner.
  • a gene can also be used that encodes a corresponding or variant enzyme with a high activity.
  • the corresponding enzyme has a greater activity than the native form of the enzyme, more preferably at least in the range of 5, 10, 25% or 50% more activity, most preferably more than twice the activity of the native enzyme.
  • the phrases “selected from the group consisting of,” “chosen from,” and the like include mixtures of the specified materials.
  • GenBank accession numbers refer to the genomic sequence numbers assigned to each strain. These sequences were not available to the public at the time of invention and form an embodiment of the present invention, as well as fragments of the same.
  • TABLE 6 Accession Genome GenBank name no. size Origin Ad3 AY599834 35,345 ATCC#VR-3, strain GB Ad3FS_navy AY599836 35,265 Ad3FS NHRC#1276 from NTC Great Lakes, IL Nov. 07, 1997 Ad4 AY594253 35,990 ATCC#VR-4, strain RI-67 Ad4vaccine AY594254 35,994 Calif.
  • Ad4FS_navy AY599835 35,965 Ad4FS NHRC#42606 from Ft Jackson, SC Apr. 02, 2003
  • Ad4FS_AF AY599837 35,964 Linda Canas, Brooks AFB, Lackland AFB AF#3 2002
  • Ad5FS AY601635 35,931
  • the prototype influenza types represented by tiles on RPMV1 are:
  • Influenza A virus (A/New Caledonia/20/99) H1 HA gene for hemagglutinin 1
  • FluAHA5 Influenza A virus (A/HongKong/156/97/H5N1), hemagglutinin 5
  • DNA sequences were provided to Affymetrix for creation of the resequencing microarray chip (RPM Version 1 chip) utilized in the following examples.
  • RPM Version 1 chip resequencing microarray chip
  • submission of the DNA sequence and instruction files to Affymetrix were in accordance with the manufacturer instructions CustomSeqTM Array Protocol and product literature.
  • Probe lengths were nominally 25-nucleotides long and contained a variable (interrogation point) central nucleotide for each of four possible variants (A, C, T or G) in both the sense and antisense directions.
  • the target genes selected for the RPMV1 pathogens listed above are described in the version 1 layout shown in Table 8 and the Sequence Listing along with the respective PCR primers used for amplification of the same.
  • the sequences submitted for tiling and chip fabrication were based on the Affymetrix instruction file summarized in Table 7, which corresponds to the sequences appearing as SEQ ID NOs: 1-58.
  • the corresponding “instruction file” lists the alias designator (e.g. FluAHA5) for each tile region and provides a “FASTA” formatted target gene sequence (this can be all or part of the complete target gene).
  • the instruction file references the same alias designators, but further specifies the actual subsequences that are actually to be tiled onto the array. In most cases, this represents the entire sequence from the sequence file but in others (e.g. FluBMATRIX) only nucleotides 1-362 of the total sequence were used for tiling. Table 9 provides the information presented in the instructions file.
  • Table 9 Instruction file (specific file) of the RPM V1 design specification.
  • the alias designator is a name assigned to each discrete “tile” region (e.g. a geometric region of the microarray containing all probe combinations required for resequencing of a stretch of pathogen genome sequence). The pathogen, sequence accession number, and tile size for each tile region are shown.
  • the instructions which were processed in Affymetrix submission format, appear in Table 7.
  • the instruction file references complete or partial sequence of the complete target genes that are found in SEQ ID NOs: 1-58 appearing in the attached Sequence Listing.
  • FIG. 1 shows an overview of the chip layout as a function of where the gene sequences for any given pathogen are clustered on the resequencing microarray chip (RPM Version 1 chip) utilized in the following examples.
  • RPM Version 1 chip resequencing microarray chip
  • the tiling strategy dictates that the first 12 and last 12 sequences from each discrete tile region that are not queried by the tiling strategy of the resequencing microassay, since they are used as components of the first and last 25-mer probes that are varied at the number 13 positions.
  • sequences used for the adenovirus regions (Ad4, Ad5, Ad7 and Ad7 vaccine) of the chip were all derived from early drafts of genomes sequenced by the present inventors.
  • GenBank submission files that correspond to the genomes used for tiled regions are listed in Table 6. Because the sequences submitted to Affymetrix for the prototypes were based on early drafts of the genomes, there were discrepancies observed between those early sequences and the final sequences submitted to GenBank.
  • the objective of primer selection to support conserved (degenerate) multiplex PCR is to design primers that target the conserved regions flanking species-specific variable regions of E1A, fiber, and hexon genes.
  • this method may be applied to any organism, as conserved sequences within a species are a ubiquitous in nature. These target genes were selected based on their function and location within the linear adenoviral genome.
  • E1A is located at the 5′ end of the adenoviruses genome and encodes a trans-acting transcriptional regulatory factor that is necessary for transcriptional activation of early genes.
  • the hexon and fiber genes which are located in the middle and 3′ end of the adenovirus genome, encode antigenic determinants ⁇ and ⁇ respectively, which determine the viral serotype.
  • detection and serotyping of ARD-causing adenoviruses can be effectuated by targeting the nucleic acid determinants that give rise to the serotype.
  • the primers provided specific amplification within the adenovirus while the variable regions supplied serotype-specific characters for proper species identification.
  • the primers used for conserved (degenerate) multiplex PCR in the following examples are based on a global alignment of E1A, fiber, and hexon gene sequences, respectively, available from GenBank (GenBank accession numbers are given in parentheses): E1A-AdB (NC — 004001), AdC (NC — 001405), Ad3 (AF492352), Ad4 (M14918), Ad7 (X03000);fiber-Ad2 (AJ278921), AdS (M18369), Ad3 (X01998), Ad4 (X76547), Ad7 (M23696), Ad16 (U06106), Ad2l (U06107); hexon-Ad3 (X76549), Ad4 (X84646), Ad6 (AF161560, X67710, Y17245), Ad7 (AF053087, X76551), Ad16 (X74662), Ad21 (AB053166).
  • the global sequence alignment for primer design of the E1A gene used the E1A gene sequences from Ad3, Ad4, Ad7, Ad21, AdB, and AdC serotypes.
  • the global sequence alignment for primer design of the fiber gene used fiber gene sequences from Ad2, Ad3, Ad4, AdS, Ad7, Ad16, and Ad21 serotypes.
  • the global sequence alignment for primer design of the hexon gene used the hexon gene sequences from Ad3, Ad4, Ad6, Ad7, Ad16, and Ad21 serotypes.
  • primer pairs were selected based on their ability to amplify E1A, fiber, and hexon genes of serotype 3, 4, 6, 7, 16 and 21 (data not shown). Table 11 shows the primer pairs employed in the following Examples.
  • AdE1A-F E1A CGC TGC ACG ATC TGT ATG AT (SEQ ID NO: 421)
  • AdE1A-R E1A TCT CAT ATA GCA AAG CGC ACA (SEQ ID NO: 409-446 422)
  • AdB1* Fiber TST ACC CYT ATG AAG ATG AAA GC (SEQ ID NO: 423)
  • AdB2* Fiber GGA TAA GCT GTA GTR CTK GGC AT (SEQ ID 670-772 NO: 424)
  • AdFib-F3 Fiber ACT GTA KCW GYT TTG GYT GT (SEQ ID NO: 425)
  • AdFib-R3 Fiber TTA TTS YTG GGC WAT GTA KGA (SEQ ID NO: 430-437 426)
  • AdHex-F7 Hexon CAC GAY GTG ACC ACM GAC CG (SEQ ID NO: 427)
  • AdHex-R5 Hexon TTK AdHex-R5 Hex
  • the primers pairs (Lin et al., 2004) were evaluated in various multiplex combinations to obtain amplification of adenovirus serotype 3, 4, 6, 7, 16, and 21.
  • PCR was performed in 50 ⁇ l volumes containing 20 mM Tris-HCl (pH 8.4), 50 mM KCl, 200 ⁇ M each of dNTPs, 200 nM AdB1, AdB2 primers; 300 nM AdE1A-F, AdE1A-R primers; 400 nM Adfib-F3, Adfib-R3 primers; 500 nM Adhex-F7, Adhex-R5 primers, 2 U of Platinum Taq DNA polymerase (Invitrogen), and 10 6 copies of DNA templates.
  • the amplification reaction was performed using a Peltier Thermal Cycler-PTC225 (MJ Research) with preliminary denaturation at 94° C. for 3 minutes, then followed-by 40 cycles of denaturation at 94° C. for 30 seconds, annealing at 50° C. for 30 seconds, the extension at 72° C. for 40 seconds, and a final extension at 72° C. for 10 minutes.
  • the generic multiplex PCR assay could amplify all three genes of all six ARD causing adenoviruses even though the hexon gene of Ad4 showed very weak band on agarose gel.
  • GenomiPhi total amplification was conducted using the commercially available GenomiPhiTM DNA Amplification Kit (Amersham Biosciences) to representatively amplify linear genomic DNA (hereinafter referred to as “GenomiPhi total amplification”).
  • the amplification method employed in the GenomiPhi total amplification method utilizes bacteriophage Phi29 DNA polymerase enzyme to exponentially amplify single- or double-stranded linear DNA templates by strand displacement amplification. The starting sample was not quantified, but rather was used directly.
  • Raw sequence data from the resequencing microarray chips is provided by the Genetic Data Analysis Software version 2.0 (GDAS) packaged with the microarray reader from Affymetrix.
  • GDAS base calling is based on a previously described base-calling algorithm (Cutler et al., 2001).
  • Each of the FASTA output files containing the base calls obtained from the GDAS software was analyzed using specialized software (REPI) that the present inventors developed.
  • the sequence output of GDAS is most often a scattered mixture of contiguous sequence calls (A, T, C or G) that are interspersed with varying amounts of no-calls (n's) where the GDAS software does not make a base call due to lack of amplification, weak hybridization signal on the chip and/or high background hybridization caused by non-specific binding (Cutler et al., 2001).
  • Similarity search algorithms such as BLAST (Korf et al., 2003) allow the use of n's (analogously to a wildcard) but the inclusion of too many n's results in an unacceptable degree of ambiguity. In that case, no meaningful BLAST results will be returned.
  • the REPI software was designed to parse the output of the FASTA file selecting and editing to mold sequence data into a format suitable for sequence similarity searches using the NCBI BLASTN algorithm. To accomplish this objective, REPI functions through a series of filters modifying the data as little as possible while extracting usable, “BLASTable” data from the FASTA files. Due to the nature of the resequencing microarray the sequences often contain large amounts of non-base calls (n's). BLAST is unable to return significant similarity for sequences with a large amount of non-base calls. Therefore the original sequences must be filtered to extract those portions that are most likely to return a significant similarity.
  • the first filter that a prospective sequence encounters is a control check.
  • the control sequence incorporated into the microarray is specifically designed to be a nonsense sequence; therefore, it will never return a significant similarity.
  • the sequence is evaluated for “BLASTable” data.
  • a sliding window algorithm is used, the window-size parameter is entered by the user and represents the number of base calls the algorithm will evaluate at one time.
  • the sequence is evaluated starting from the first base-call the window slides along the sequence searching for the first area containing relevant data, this is evaluated using a scoring method where all valid bases are given a score of one and all n's are given a score of zero if the score is greater than or equal to a predetermined threshold (here 25% is used) the program marks the start of this window as the beginning of usable data. Once the start of usable data is determined the program reverses its parameters and begins searching for the end of the useable data, the score must now be less than or equal to the threshold. For each sequence REPI searches for the largest continuous string(s) of usable data, which will represent that sequence's initial subsequence.
  • This subsequence is then trimmed for beginning and trailing n's. Trimming is necessary because the previous filter uses the starting position of the starting window as the beginning of the subsequence and the last position of the ending window as the end of the subsequence, therefore all though that window's score was acceptable there may be n's leading or trailing the subsequence.
  • the next filter the subsequence goes through is a length evaluation. Subsequences longer than 50 nucleotides are allowed to continue, subsequences shorter than 20 nucleotides are discarded, and subsequences between 20 and 50 nucleotides are re-evaluated as follows.
  • REPI computes a number of statistics on the subsequence including the subsequence percentage of the target sequence, the subsequence length, the number of subsequence base calls, and the percentage of subsequence base calls.
  • the subsequence percentage of the target sequence and the subsequence length shows what portion of the target pathogen gene was identified.
  • the subsequence length and percentage of subsequence base calls allow us to monitor the filtering algorithm filters as well as the GDAS threshold parameters.
  • REPI saves all statistical results returned from the BLASTN algorithm allowing the user to manipulate which results are displayed in the graphical user interface.
  • REPI was interfaced to a local BLAST (NCBI GenBank) database (contained on an Apple G5 single processor (1.8 Ghz) computer with 4.5 GB of random access memory) via a CGI (Perl) interface.
  • the E-value represents the number of alignments expected at random given the size of the search space, the scoring matrix, and the gap penalties; the lower the E-value the less likely the database sequence similarity matches was in fact a random identification.
  • e 2.71828182845904523536028747135.
  • the REPI output is comprised of the (BLASTable) subsequence names, lengths, E-values, and bits scores are displayed for each subsequence in descending order of bit scores.
  • the name is reported as the GenBank record's FASTA definition line and includes the sequence length.
  • the score is the normalized score computed from the scoring matrix and gap penalties, the higher the score the greater the similarity.
  • REPI output of the example listed above is shown below.
  • REPI returns (in descending order of bit score ranking) all GenBank data records having expect values of ⁇ 1.0 e-9.
  • the highest bit score is achieved for the adenovirus 4 prototype (AY594253), which is genetically indistinguishable from the Ad4 vaccine strain (AY594254) across this stretch, while lower bit scores suitably distinguish field strains from Air Force and Navy training sites (SEQ ID NO: 430).
  • Raw sequence data from the resequencing microarray chips is provided by the Genetic Data Analysis Software version 2.0 (GDAS) packaged with the microarray reader from Affymetrix.
  • GDAS base calling is based on a previously described base-calling algorithm, ABACUS, detailed previously (Cutler et al., 2001).
  • ABACUS base-calling algorithm
  • a variety of base-calling algorithm parameters can be defined by the user (GDAS operators manual) to obtain a trade-off between base calling percentage and accuracy.
  • the recommended (default) settings for GDAS are “conservative” settings that focus on the highest level of accuracy.
  • the objective of the present invention is to increase the percentage of base calls. To achieve this objective, the present inventors adjusted the parameters to allow highly permissive base calls (increased percentage) as listed below:
  • the base call algorithm is set up by default to sacrifice the number of base calls made in order to make the most accurate calls (i.e., for SNP detection).
  • the technique is less concerned about achieving the same degree of accuracy as required for SNP detection but instead expanding the number of calls made so that the longest possible stretches of contiguous sequence are produced by GDAS, while maintaining specificity.
  • a starting concentration of 10 6 genomic copies of Adenovirus 4 prototype (AY594253) per microliter were amplified using either degenerate adenovirus PCR primers (Lin et al., 2004) or GenomiPhi isothermal methods.
  • DNA was isolated from cultured adenoviruses and aliquoted at concentrations of 10 6 copies per microliter. DNA was amplified using a total amplification strategy (GenomiPhi, Amersham), then processed in accordance with the standard Affymetrix CustomSeqTM protocol (available from manufacturer).
  • GenomiPhi total amplification allowed the entire tiled region (increased sensitivity) to be resequenced compared to the more limited region resulting from conserved (degenerate) multiplex PCR. This result arises due to the fact that GenomiPhi total amplification does not rely on specific primer sequences within the tiled fragment. However, it is also important to note that irrespective of which amplification strategy was employed, i.e., conserved (degenerate) multiplex PCR or GenomiPhi total amplification, the proper Ad4 calls were made. The consistency between these methods is important as the conserved primers may have a more direct application to serotyping members of the same family of pathogens from complex samples without the need for selective enrichment.
  • REPI identified the following list of top-ranked returns for the conserved PCR amplification strategy for the E1A, Fiber, and Hexon-1 tile regions of the V1 RPM microarray (note: omitted from this list are several adenovirus type 4 GenBank records having nearly identical sequences as the Ad4 prototype and Ad4 vaccine strain).
  • Ad4E1A CustemSeq-Adenovirus 4 Accession # Name E value: Bit Score: AY594254 Human Adenovirus 1.04808E ⁇ 107 396.964 serotype 4, vaccine strain AY594253 Human Adenovirus 1.04808E ⁇ 107 396.964 Serotype 4 AY599837 Human Adenovirus 8.34268E ⁇ 53 214.587 serotype 4, USAF Field Strain AY599835 Human Adenovirus 8.34268E ⁇ 53 214.587 serotype 4, US Navy Field Strain
  • Ad4FIBER CustemSeq-Adenovirus 4 Accession # Name E value: Bit Score: AY594254 Human Adenovirus 0.0 751.806 serotype 4, vaccine strain AY594253 Human Adenovirus 0.0 751.806 Serotype 4 AY599837 Human Adenovirus 0.0 704.23 serotype 4, USAF Field Strain AY599835 Human Adenovirus 0.0 696.3 serotype 4, US Navy Field Strain
  • Ad4HEXON-1 CustemSeq-Adenovirus 4 Accession # Name E value: Bit Score: AY594254 Human Adenovirus 0.0 751.806 serotype 4, vaccine strain AY594253 Human Adenovirus 0.0 751.806 Serotype 4 AY599835 Human Adenovirus 1.73046E ⁇ 169 603.13 serotype 4, US Navy Field Strain AY599837 Human Adenovirus 4.2185E ⁇ 167 595.2 serotype 4, USAF Field Strain
  • the adenovirus type 4 prototype (AY594253) and vaccine strain (AY594254) returned the highest expect values and bit scores for hybridization of the adenovirus type 4 prototype amplicons obtained by conserved PCR amplification. This is expected because the prototype strain was used for vaccine production and the sequences were determined to be identical. In each case, the returns were distinguished in order of similarity from the closely related Air Force (AY599837) and Navy (AY599835) adenovirus 4 field strains.
  • Ad4E1A Adenovirus 4 GenomiPhi3 Accession # Name E value: Bit Score: AY594253 Human Adenovirus 0.0 868.765 Serotype 4 AY594254 Human Adenovirus 0.0 868.765 serotype 4, vaccine strain gi
  • Ad4FIBER Adenovirus 4 GenomiPhi3 Accession # Name E value: Bit Score: gi
  • Ad4HEXON-1 Adenovirus 4 GenomiPhi3 Accession # Name E value: Bit Score: AY594254 Human Adenovirus 0.0 1065.02 serotype 4, vaccine strain AY594253 Human Adenovirus 0.0 1065.02 Serotype 4 gi
  • GenomiPhi total amplification allowed the entire tiled region (increased sensitivity) to be resequenced compared to the more limited region resulting from conserved (degenerate) multiplex PCR. This result arises due to the fact that GenomiPhi total amplification does not rely on primer sequences within the tiled fragment.
  • REPI listed the appropriate adenovirus type (AY594254 or AY594253) as the 10 highest scoring return for each tile region with the exception of Ad4FIBER.
  • hybridization and base calling was assayed as a function of the initial concentration of the target subsequent to conserved (degenerate) multiplex PCR.
  • this example also compares two different base-calling strategies within the GDAS software: (a) “permissive” (described in Specification) and (b) “conservative” (default) settings.
  • the biological sample utilized in this example was the adenovirus 4 prototype.
  • Hybridization and base calling were assayed as a function of the initial concentration of the target subsequent to conserved (degenerate) multiplex PCR.
  • a dilution series of the adenovirus 4 prototype (ATCC) was prepared having 10 5 , 10 3 , and 10 1 genomic copies per microliter.
  • Affymetrix CustomSeq protocol was followed, except that samples aliquoted from the aforementioned dilutions were amplified using the conserved (degenerate) multiplex adenovirus primer strategy for E1A, fiber, and hexon genes.
  • Tables 18-20 demonstrate the ability of the RPMV 1 chip with REPI analysis to detect the appropriate Adenovirus type 4 target (not specific to strain) depending on whether “Conservative” (default GDAS) or “Permissive” (from Example 1) base call settings were used. A positive detection was counted when REPI returned one or more GenBank (or local) database record(s) for an Adenovirus type 4 target as the highest BLAST bit score value(s). In each case, “length” corresponds to the number of base pairs in the subsequence selected by REPI as having satisfied the conditions of the sliding window algorithm. TABLE 18 Ad4 Fiber Conservative Permissive Dilutions Expt. Score Eval name length Expt.
  • Ad4 E1A Conservative Permissive Dilutions Expt. Score E-val name length Expt. Score Eval name length 10 5 1 448.5 E ⁇ 123 Ad4 E1A region 553 1 775.595 E ⁇ 0.0 Ad4 E1A region 556 1-2 420.8 E ⁇ 115 Ad4 E1A region 422 1-2 691.471 E ⁇ 0.0 Ad4 E1A region 444 1-3 n/d — — 1-3 561.5 E ⁇ 157 Ad4 E1A region 413 1-4 353.4 E ⁇ 94 Ad4 E1A region 424 1-4 589.253 165 Ad4 E1A region 424 10 3 2 341.5 E ⁇ 91 Ad4 E1A region 399 2 607.1 E ⁇ 171 Ad4 E1A region 412 2-2* n/d — — 2-2 n/d — — 2-3 194.8 E ⁇ 47 Ad4 E1A region 404 2-3 470.774 E ⁇ 130 Ad4 E1A region 421 2-4 n/d — — 2-4 n/d —
  • the “Permissive” base call settings produced GDAS outputs that were used by REPI to consistently yield higher subsequence lengths and bit scores than those outputs using the default GDAS base call settings, for SNP detection.
  • the “Permissive” base call settings resulted in a sufficient number of base calls for REPI to detect the target whereas the default settings did not. This example demonstrates that by lowering the restrictions on base calling by GDAS and coupling the output to the REPI algorithm, higher sensitivity and discriminatory power (strain identification) among pathogens is achieved.
  • Example 2 This example is the same as Example 1, except the resequencing microarray chip (RPMV1) described above in Preparation Example 1 was probed with adenovirus type 5 field strain (Ad5FS; AY601635) or adenovirus type 7 prototype (AY594255) using either (a) conserved (degenerate) multiplex PCR or (b) GenomiPhi total amplification ( FIG. 3 ). Based on the GDAS outputs (using “permissive” settings), REPI identified the following 3 top “hits” for the conserved PCR and total amplification strategies with each of the Ad5 prototype and the Ad7 prototype.
  • RPMV1 resequencing microarray chip
  • each subsequence called by the adenovirus type 5 tile regions listed the top “hit” (highest BLAST bit score) as the correct prototype strain for adenovirus type 5 (Ad5FS; Accession number AY601635) using either conserved PCR amplification or total (GenomiPhi) amplification.
  • each subsequence for the adenovirus type 7 tile regions (Ad7E1A, Ad7FIBER, Ad5HEXON-1 and AdSHEXON-2) listed the top “hit” (highest BLAST bit score) as the correct prototype strain for adenovirus type 7 (Ad7; Accession number AY594255) when using either conserved PCR or total (GenomiPhi) amplification.
  • GenomiPhi amplification led to base calls from both the Ad4E1A regions and the Ad7vaccine regions, both resulting in top bit scores assigned to the correct Ad7 prototype strain.
  • results obtained for the adenovirus type 5 and adenovirus type 7 prototypes confirmed those for adenovirus type 4.
  • the results shown in FIGS. 3 A-D show that GenomiPhi total amplification allowed the entire tiled region (increased sensitivity) to be resequenced compared to the more limited region resulting from conserved (degenerate) multiplex PCR. More importantly, these results confirm that irrespective of which amplification strategy was employed, i.e., conserved (degenerate) multiplex PCR or GenomiPhi total amplification, the proper Ad5 or Ad7 calls were made.
  • Ad4-5 Breakthrough Strain as a Model of Mixed Infection Detectable by Resequencing Microarray Assay
  • the sample for this example was provided by the Naval Health Research Center (San Diego).
  • the archived sample was a nasal wash from a basic trainee who had previously been immunized for adenovirus (using the Ad4/Ad7 vaccine) and who subsequently was diagnosed with adenovirus infection and febrile respiratory illness. Strains associated with infection in spite of previous vaccination are broadly referred to as “breakthrough strains”. In this case, the presumption was that a single variant form of adenovirus was the causative agent.
  • Ad4-5 Breakthrough because of inconclusive culture and serological assays that indicated properties of both adenovirus types 4, while sequencing of the hexon gene (one of antigenic determinants of adenovirus serotype) indicated properties of adenovirus type 5.
  • the sample was processed according to the multiplex degenerate primer PCR protocol described in Preparation Example 1. This approach was demonstrated to (Lin et al 2004) successfully amplify hypervariable regions on hexon and fiber genes (as well as a relatively variable E1A region) for all adenoviruses associated with febrile respiratory infection. Otherwise, the standard Affymetrix CustomSeq protocol was used.
  • Ad5HEXON-1 Ad 4-5 Breakthrough Strain Accession # Name E value: Bit Score: lcl
  • Ad7E1A Ad 4-5 Breakthrough Strain Accession # Name E value: Bit Score: gi
  • Ad7HEXON-1 Ad 4-5 Breakthrough Strain Accession # Name E value: Bit Score: lcl
  • Influenza A positive clinical samples of unknown serotype were collected during the 2002-2003 and 2003-2004 flu seasons and provided to Dr. Zheng Wang as frozen nasal washes by Dr. Elizabeth Walter.
  • EPICENTRE MasterPureTM DNA Purification Kits (Madison, Wis.) were used to extract total nucleic acids from 50 Ill of nasal wash (sample NW20031114-05-02) without RNase treatment. Sample NW20031114-05-02 was collected on Nov. 14, 2003 at Lackland Air Force Base (San Antonio, Tex.). The patient was vaccinated on Nov. 10, 2003. The total nucleic acids were suspended in 20 ⁇ l nuclease free H 2 O. Two-step RT-PCR was employed to amplify each of the viral gene segments.
  • RNA in 4 ⁇ l total nucleic acids was transcribed into cDNA by using SuperScriptTM III Reverse Transcriptase (Invitrogen, Carlsbad, Calif.) according to the protocol provided by the manufacturer and 100 pmol Uni3 primer in 20 ⁇ l.
  • the RT (reverse transcription) reaction was performed at 42° C. for 1 hr and then was inactivated at 70° C. for 15 min. 2 ⁇ l of the RT-reaction was used for cDNA amplification.
  • the cDNA was amplified by using TaqPlus Long System (Stratagene, La Jolla, Calif.) according to protocol provided. Two different PCR conditions were used for amplification.
  • PCR For universal PCR, universal primers uni3 and uni5 were used to amplify all eight segments of hemagglutinin (HA), neuraminidase (NA) and matrix (M) (see Hoffman et al, 2001).
  • segments were amplified by mixing three segment specific primer pairs (Bm-HA-1/Bm-NS-890R, BA-Na-1/Ba-Na-1413R and Bm-M-1/Bm-M-1027R). The final concentration of Mg 2+ -ions was 2 mM and final primer concentration was 1 ⁇ M.
  • PCR condition for universal amplification was: 94° C. for 2 min followed by 29 cycles of 94° C. for 1 min, 40° C. for 2 min.
  • the multiplex PCR condition was basically same except that the annealing temperature was raised to 58° C.
  • PCR products were purified by Qiagen PCR Purification kit. 500 ng of universally amplified PCR products and 1000 ng of multiplex PCR products were applied to two V1 Pathogen chips for hybridization according to Affymetrix protocol, respectively.
  • the chip scan results are shown for each of the two amplification protocols: (a) universal primer PCR and (b) multiplex PCR ( FIG. 5 ). Based on the GDAS outputs (using “permissive” settings), REPI identified the following 3 top “hits” for the universal primer (Hoffman et al., 2001) amplification method and total amplification strategies with each of the Ad5 prototype and specific multiplex PCR method (See Table 25).
  • the present inventors obtained sequence for the HA gene of the Flu strain that evaded the 2003-2004 vaccine and caused widespread illness, namely Fujian/411/2002 (note: only the HA sequence was available for Fujian/411/2002) and incorporated that into the database searched by REPI.
  • Fujian/411/2002 note: only the HA sequence was available for Fujian/411/2002
  • Each of the two amplification methods produced effectively the same results, although bit scores varied slightly.
  • Fujian 411/2002 returned the highest bit score for FluAHA3 in the REPI output files. Moscow 10/99, the strain used for vaccination in 2003, did not return a REPI output for FluAHA3.
  • the Affymetrix CustomSeq protocol specifies that the hybridization step be at least 16 hours to facilitate maximum hybridization. For the intended purpose of a diagnostic capability, this could be prohibitively long. Therefore, the applicability and efficiency of the present methodologies to short hybridization times was assessed.
  • hybridization and base calling were performed, using samples that were amplified by specific PCR reagents and then hybridized for periods of either 1 hour, 30 minutes, or 15 minutes on the resequencing microarray chip (RPMV1) described above in Preparation Example 1.
  • RPMV1 resequencing microarray chip
  • the Affymetrix CustomSeq protocol was followed with the exception of varying hybridization time.
  • a nasal wash that was negative for all targets probed by the microarray except the erythromycin resistance markers SPYERMB, SPYERMTR, and SPYMEFAE was subjected to specific PCR for each of those markers.
  • the amplicons were then hybridized to separate microarrays for either 16 hours or 15 minutes, and then processed otherwise as prescribed by the Affymetrix protocol.
  • the SPYERMB tile region produced a subsequence length of 219 bp (98% of tile region, 95% base calls made within the subsequence) for a 16 hour hybridization, while discontinuities in the hybridization pattern from a 15 minute hybridization resulted in fragmentation of the tile into two subsequences of lengths 100 bp (45% of tile region, 99% base calls made within subsequence) and 87 bp (39% of tile region, 99% base calls made in subsequence).
  • a variety of methods might be employed to reduce the amount of background human DNA in clinical samples when using total amplification.
  • One method is direct subtraction of the background genomic DNA from amplified products in hybridization solution with COT-1 fraction human genomic DNA that consists largely of rapidly annealing repetitive elements.
  • Another method is bead-based subtraction of background genomic DNA from clinical sample prior to total amplification.
  • a third method is the combination of the above methods, the genomic background DNA from clinical sample were subtracted using bead-based subtraction prior to total amplification, subsequently, the background DNA might be further subtracted from the clinical sample in hybridization solution with COT-1 human DNA.
  • a nasal wash was collected from one clinical sample and the total nucleic acid was isolated using MasterPureTM DNA purification kit (Epicentre).
  • the nucleic acid was predigested with McrBc (an endonuclease that cleaves DNA containing methylcytosine on one or both strands) at 37° C. for one hour, and then heated to 65° C. to denature the enzyme. Subsequently, the sample was split to two aliquots and amplified with GenomiPhi DNA amplification kit (Amersham Biosciences). The amplified products were fragmented and labeled according to Affymetrix CustomSeq protocol.
  • RPMV1 resequencing microarray chips
  • the present example describes bead-base subtraction and the combination of bead-base subtraction with subtractive hybridization methods for increasing the pathogen specific signal-to-noise ratio when using total amplification.
  • COT-1 human DNA consisting largely of rapidly annealing repetitive elements, was biotinylated at 3′-end using terminal transferase (Tdt) (NEB) to generate Biotinylated Subtraction Probes (BSPs).
  • Tdt terminal transferase
  • NEB terminal transferase
  • BSPs Biotinylated Subtraction Probes
  • An aliquot of ⁇ 400 ng of BSPs was incubated at 95° C. for 10 minutes in 4 ⁇ SSC and 0.2% SDS with nucleic acid extract of clinical nasal wash (diagnosed as Ad4 positive clinical sample) predigested with McrBC at 37° C. for one hour, then slowly cooled to 65° C. to allow co-hybridization with the HMB for one hour.
  • the BSP-HMB complexes were incubated at room temperature for 30 minutes at 1 ⁇ PBS, 0.1% BSA with BcMag.Streptavidin Magnetic Beads (SMBs, Bioclone). The beads were separated from supernatant using a magnetic separator. The supernatant was then transferred to a new tube and the magnetic beads were washed once with 1 33 PBS, 0.1% BSA. The supernatants were combined and precipitated with ethanol. The DNA pellet was resuspended with nuclease free water (Ambion) then split to two aliquots and amplified with GenomiPhi DNA amplification kit (Amersham Biosciences) according to the manufacture recommended protocol.
  • SMBs BcMag.Streptavidin Magnetic Beads
  • DNA template was denatured with 9 ⁇ l of sample buffer at 95° C. for 3 minutes, the cooled down to 4° C.
  • 1 ⁇ l of enzyme was mixed with 9 ⁇ l of reaction buffer, and then the mixture was added to the denatured DNA template.
  • the reaction was then performed at 30° C. for 18 hours at Thermal Cycler-PTC225 (MJ Research Inc., Reno, Nev.).
  • the amplified products were hybridized to the resequencing microarray chips (RPMV1) either with standard hybridization solution according to Affymetrix CustomSeq protocol ( FIG. 7C ) or with hybridization mixture containing 12 ⁇ g Herring Sperm DNA and 10 ⁇ g COT-1 human DNA instead of 22 ⁇ g Herring sperm DNA as Affymetrix recommended ( FIG. 7D ).
  • RPMV1 resequencing microarray chips
  • FIG. 7 The results of the subtractive hybridization approaches are shown in FIG. 7 .
  • FIG. 7A total amplification of the isolated nucleic acids resulted in significant background hybridization to the RPMV1 microarray.
  • the adenovirus type 4 region showed a discernibly higher signal than that of the overall background, GDAS was unable to make enough base calls to satisfy the sliding window condition in REPI, so no attempts to BLAST the data were made.
  • Co-hybridizing the same set of total amplicons with COT-1 human genomic DNA did little to improve this ( FIG. 7B ) and no base calls were made.
  • FIG. 7C shows that the use of a magnetic bead-based subtraction alone, prior to total amplification, again did not result in a sufficient number of base calls to allow similarity searching.
  • Ad4HEXON-1 BL_818141_030503_NW_4 Accession # Name E value: Bit Score: lcl
  • base calling was extended into the Ad4FIBER tile region (see Table 33) in addition to Ad4HEXON-1 (see Table 34), allowing unambiguous high bit-score ranking for Ad4 Field Strain (though not distinguishing between Air Force and Navy field strains) versus prototype (AY594253) or vaccine strain (AY594254) in several Ad4FIBER subsequences.
  • Ad4 Air Force Field Strain Accession No. AY599837
  • Ad4HEXON-1 BL_818141_030503_NW_9b Accession # Name E value: Bit Score: lcl
  • RD1-A 32469331 c985-455 531 339 tularensis strain
  • RD1-B 32469331 c1338-1054 285 340 tularensis strain
  • FTUTUL4 Francisella tularensis TUL4 M32059 834 341
  • FTUFOPA Francisella tularensis outer membrane protein FopA 111 344 OTSGROEL Orientia tsutsugamushi GroEL AY191589 546 345 OTSSTA56 Orientia tsutsugamushi sta56 AY283180 1059 346 RPRGYRA Rickettsia prowazekii Gyr
  • This example is to present application of newly modified random RT-PCR protocol on isolated Influenza A (Fujan/411/2002 strain) nucleic acids spiked into normal nasal wash samples.
  • a random RT-PCR protocol has been applied by DeRisi's lab to amplify viral pathogens for microarray interrogation (Wang et al., 2003). Modification to this protocol was recently reported for amplifying cultured influenza viruses (Kessler et al., 2004). However, the modified protocol was not reported to amplify viral targets in clinical samples.
  • the Influenza A virus cultures (H1N1 & H3N2) were provided by the Air Force Institute for Operational Health (AFIOH) and sent to Virapure, LLC for amplification and quantification prior to the study. According to the Certificate of Analysis, the virus was amplified for two rounds on early passage MDCK cells purchased from ATCC exclusively for this project, followed by virus amplification in the presence of 1 ⁇ g/ml TPCK treated trypsin. At 48 hours after infection, the virus supernatants were collected and adjusted to contain 3% sucrose, 20 mM Tris pH 7.1 and pH stabilizer. Prior to delivery, Corning screw top cryovials were filled with 200-300 ⁇ l aliquots of supernatant.
  • a nasal wash (0.9% Normal Saline) was obtained from an asymptomatic member of the Clinical Division of the Advanced Diagnostic Laboratory at Lackland AFB. From each Virapure pre-quantified titer, a 10-fold/6-series dilution of Influenza-spiked nasal aspirate was generated beginning with and including the Virapure stock of each strain. A total of 100 ⁇ l of each influenza-spiked nasal wash were processed from the dilution using the MasterPure Total Nucleic Acid Extraction distributed by EPICENTRE.
  • the mixture was centrifuged at 4° C. for 10 minutes and the isopropanol decanted without dislodging pellet. Following, the pellet was rinsed twice with 75% ethanol and dried at room temperature. Once dried, the nucleic acid pellet was resuspended in 35 ⁇ l of TE Buffer. Each sample was properly labeled and placed in dry ice prior to shipment to the Naval Research Laboratory.
  • 2 ⁇ l of total nucleic acid was reverse transcribed by using 1 ⁇ l primer D (40 pmol/ ⁇ l; 5′-GTT TCC CAG TCA CGA TCN NNN NNN NN; SEQ ID NO: 573) and 1 ⁇ l SuperScriptTM III Reverse Transcriptase (50 units/ ⁇ l; Invitrogen, Carlsbad, Calif.) in 20 ⁇ l.
  • the RT (reverse transcription) reaction was performed at 42° C. for 1 hr and then was inactivated at 70° C. for 15 min.
  • PCR was conducted with 35 cycles of 94° C. for 30 s, 40° C. for 30 s, 50° C. for 30 s, and 72° C. for 160 s, followed by an additional 7 minutes at 72° C.
  • PCR products from 10 5 , 10 3 and 10 1 pfu flu spiking samples were applied to three different V1RPM pathogen microarrays for hybridization according to Affymetrix Customseq protocol.
  • gene “E1A” “mRNAII product, homologue of gi
  • 209784” polyA_site 1494 . . . 1499 “polyA site for E1A gene. GenScan Prediction” promoter 1549 . . . 1554 “TATA box for E1B” CDS 1603 . . . 2139 gene “E1B” “19 kD small T antigen, homologous to the unnamed protein product in Ad7, gi
  • 58518” CDS 1908 . . . 3386 gene “E1B” “55 kD protein, homologous to gi
  • gene “E2B” “hypothetical 12.6 kD early protein, gi
  • 139931 in Ad7” CDS complement (8424 . . . 10346) gene “E2B” “terminal protein precursor, homologue in Ad7 is gi
  • 10034 gene “L1” “9.7 kD hypothetical protein, homologue in Ad7 is gi
  • CDS join gene “L4” “33 KD protein” (25686 . . . 26034, 26204 . . . 26559)
  • CDS 26719 . . . 27312 gene “L4” “pVIII protein” Promoter 26994 . . . 26999 “putative TATA box for the E3 gene”
  • CDS 27312 . . . 27632 gene “E3A” “12.1 KD glycoprotein” polyA_signal 27391 . . . 27396 “possible polyA signal for L4” CDS 27586 . . .
  • CDS complement 5049 . . . 8417

Abstract

The present invention relates to pathogen detection and identification by use of DNA resequencing microarrays. The present invention also provides resequencing microarray chips for differential diagnosis and serotyping of pathogens present in a biological sample. The present invention further provides methods of detecting the presence and identity of pathogens present in a biological sample.

Description

    CROSS-REFERENCE TO RELATED APPLICATIONS
  • The present application claims priority to U.S. provisional Application Ser. No. 60/590,931, filed on Jul. 2, 2004, U.S. provisional Application Ser. No. 60/609,918 filed on Sep. 15, 2004, U.S. provisional Application Ser. No. 60/631,437 filed on Nov. 29, 2004, U.S. provisional Application Ser. No. 60/631,460 filed on Nov. 29, 2004 and U.S. provisional Application Ser. No. 60/691,768 filed on Jun. 16, 2005. This application is also related to U.S. non-provisional application Ser. No. ______, titled “Computer-Implemented Biological Sequence Identifier System and Method,” filed along with this application on Jul. 2, 2005. The entire contents of these applications are incorporated herein by reference.
    • STATEMENT REGARDING FEDERALLY FUNDED PROJECT
  • The United States Government owns rights in the present invention pursuant to funding from the Defense Threat Reduction Agency (DTRA; Interagency Cost Reimbursement Order (IACRO #02-4118), MIPR numbers 01-2817, 02-2292, 02-2219, and 02-2887), the Office of the U.S. Air Force Surgeon General (HQ USAF SGR; MIPR Numbers NMIPR035203650, NMIPRONMIEPRO35203881, NMIPRONMIPRO35203881), the U.S. Army Medical Research Acquisition Activity (Contract # DAMD17-03-2-0089), the Defense Advance Research Projects Agency (DARPA; MIPR Number M189/02), and the Office of Naval Research (NRL Work Unit 6456).
    • REFERENCE TO SEQUENCE LISTING
  • The present application includes a sequence listing on an accompanying compact disk containing a single file named 272918US59SDSt2-5.txt, created on Jul. 1, 2005, 639 KB in size, and additionally labeled:
  • “Inventors: Brian K. Agan, Eric H. Hanson, Russell P. Kruzelock, Baochuan Lin et al.
  • Invention: “Re-Sequencing Pathogen Microarray”
  • The entire contents of that accompanying compact disk are incorporated by reference into this application.
    • BACKGROUND OF THE INVENTION
  • 1. Field of the Invention
  • The present invention provides pathogen detection by use of DNA resequencing microarrays. Preferably, the present invention provides for simultaneous detection of multiple pathogens. The present invention also provides resequencing microarrays and microarray chips for differential diagnosis and fine-scale discrimination between closely related pathogens present in a biological sample. The present invention further provides methods of detecting the presence and identity of pathogens present in a biological sample. The invention enables diagnosis and surveillance of known pathogen sequences and pathogens that may be identified due to unanticipated sequence variations, as well as mixtures of such pathogens. Resequencing, combined with several amplification strategies, allows simultaneous clinical diagnosis and performance of traditional surveillance assays for serotyping, antibiotic resistance profiling, genetic drift/shift analysis, forensics, and rapid detection of biological terrorism events.
  • 2. Discussion of the Background
  • As we move through the biotechnology age fostered by the human genome project a premium has been placed on the development of high throughput methodologies to obtain and analyze sequence information. To meet this demand, the multifunctional DNA microarray platform has gained notoriety leading to an explosive growth in application methods using the same.
  • More importantly, the evolution of world events and the emergence of bioterrorism in mainstream society have led to a growing sentiment amongst the scientific community and lay people alike that new, rapid, and accurate techniques for biological threat identification and eradication must be developed. The concept of a microarray used for broad-spectrum pathogen identification has considerable and obvious appeal to both medical practice and national defense. It is within this framework that the present inventors have endeavored.
  • Heretofore, for the purpose of pathogen identification, approaches generally rely on the ability of immobilized “probe” DNA sequences on the surfaces of microarrays to hybridize with complementary genomic “target” that is uniquely identifying of a particular category or specific strain of microbial pathogen. Various microarray technologies have been developed for this purpose, varying in the density of probes and the time ranges required for assay completion.
  • One technical challenge for pathogen detection with microarrays arises due to the difficulty in obtaining samples with a sufficient quantity of pathogen nucleic acid. Thus, for a majority of sample types, some sort of target amplification will likely be required to provide sufficient copies of pathogen gene markers for detection by microarray hybridization. Unfortunately, conventional methods for this amplification do not scale well in comparison to the number of probes that can be placed on a microarray chip. However, the most commonly employed means of providing sufficient quantities of genomic target to detect hybridization relies upon genotypic identification methods that utilize molecular biology-based techniques, such as the polymerase chain reaction (PCR). These techniques offer several potential advantages over conventional microbiological approaches. Nucleic acid amplification strategies base pathogen identification on the detection of genetic information contained within the organism, such that culturing the organism is not required.
  • Although PCR-based assays are sensitive, accurate, and rapid, these methods also introduce a new set of problems. As successful identification depends almost entirely on appropriately chosen primer sets, as PCR-based testing requires assumptions about the exact sequences pertaining to the identity of the target organism(s). Consequently, there is a critical need for advanced diagnostic systems that can detect both assumed and unanticipated pathogen sequences. DNA microarrays, which enable the simultaneous interrogation of thousands of genetic elements, address this crucial need. Here, the term “microarray” refers to any type of planar substrate or solid beads presenting a high multiplicity (102 to 106) of individual sites, each presenting nucleic acid probes designed to selectively capture complementary strands of target (i.e. pathogen or host) nucleic acid.
  • However, the majority of pathogen identification microarrays described in the literature is prepared using oligonucleotides that are robotically spotted onto derivatized glass surfaces (typically 3×1 inch microscope slides). This approach allows the most flexibility with regards to the size of the oligonucleotides that are deposited, ranging from 20-mers to cDNA PCR products of several thousand base pairs (bp). With few exceptions, the detection event is an increased level of fluorescence originating from a spot following hybridization of a fluorophore-labeled target nucleic acid.
  • Short (14-25 mer) oligonucleotides, immobilized inside acrylamide pads, have been applied extensively to pathogen identification (Strizhkov et al., 2000; Vasiliskov et al., 1999) in a collaborative effort between Argonne National Lab (DOE, USA) and the Engelhard Institute of Molecular Biology (Moscow, RU) under the leadership of Andrei Mirzabekov. In addition, low-density microarrays (several hundred features per 3×1 inch microscope slide) have been used for determination of drug resistance determinants (Volokhov et al., 2003). One distinguishing aspect of this body of work is the use of three-dimensional polymer matrices for probe immobilization instead of two-dimensional planar surfaces.
  • More recently, Cherkasova et al have described the use of glass-immobilized short oligonucleotide spotted microarrays to map poliovirus mutations using overlapping 14-25 mer probes (Cherkasova et al., 2003). Two variations of this approach have been used: (1) Microarrays for Resequencing and Sequence Heterogeneity (MARSH) assay, and (2) Microarray Analysis of Viral Recombination (MAVR) assay. MARSH uses a set of overlapping (at half length) nucleotide probes for individual gene sequences. Hybridizations patterns allow the detection of single point mutations or substitution/deletion events to a resolution of half probe lengths (e.g. 7-10 bp) but does not allow for exact determination of position(s) or the nature of the mutation. Accordingly, conventional DNA sequencing technologies must be employed subsequently to determine these changes. MAVR uses organism-specific oligonucleotide probes that cover the entire genome at ˜150 nt spacings and is used to detect large scale genetic recombinations.
  • The DeRisi group at UCSF pioneered the use of long (70-mer) oligonucleotide probe microarrays for broad-spectrum pathogen identification (Wang et al., 2002; Wang et al., 2003). The use of long (70 nt) oligonucleotides bears implicit advantages and disadvantages. One advantage is that higher degrees of sensitivity can usually be achieved with 70-mer probes compared to shorter ones (e.g. 20-25 mers). However, specificity is reduced because 70-mer target/probe hybridizations are generally insensitive to significant numbers (e.g., 7-10) of single base mismatches, whereas shorter probes provide much greater sequence specificity.
  • DeRisi's group described the use of spotted microarrays having 1,600 different 70-mer oligonucleotide probes to identify a variety of viruses responsible for common respiratory infections (Wang et al., 2002). The probes were selected for each pathogen using an algorithm that located discriminatory sequences from a list of known viral genomes. A serial combination of a previously described (Bohlander et al., 1992) method and subsequent PCR/Klenow fragment-based amplification was used to achieve non-biased amplification of both viral RNA and DNA, allowing generation of sufficient amounts of target amplicons for successful microarray hybridization and detection via fluorescent label. (N.B. This protocol was placed into the public domain via the DeRisi lab website.(http://derisilab.ucsf.edu)). The time required from sample preparation to obtained result was approximately 24 hours. Because exact sequence information was not attainable from such arrays, pathogen identifications were made on the basis of a hybridization pattern that could be empirically determined for each pathogen or strain. In a related report from the same group (Wang et al., 2003) similar microarrays were prepared using highly conserved sequences in an effort to capture as many microbial species as possible from a sample. Following physical removal of the pathogen sequences from the microarray, the sequences are cloned and sequenced using conventional DNA sequencing technologies. No measure of analytical/clinical sensitivity or specificity for pathogen detection in clinical specimens was provided in the work from the DeRisi group.
  • In contrast to the above-mentioned approaches using spotted microarrays, Affymetrix, Inc. (Santa Clara, Calif.) uses high-density probe fabrication technology to construct “tiled” microarrays using 4 probes each in both the sense and anti-sense directions for each nucleotide base to be resequenced. Thus, single base substitutions are directly detected by the hybridization pattern (for additional information see Affymetrix CustomSeq design manual). Several groups described the use of tiled microarrays for pathogen genotyping. (Kozal et al., 1996) utilized this type of microarray to measure mutational drift in HIV while Gingeras et al (Gingeras et al., 1998; Troesch et al., 1999) used a tiled array of 65,000 oligomer probes to resequence and accurately identify 70 clinical isolates of 27 mycobacterial species and 15 rifampin-resistant M. tuberculosis strains. More recently, Andersen et al. (Wilson et al., 2002b) described the use of tiled Affymetrix microarrays for the identification of biological warfare agents. Their approach relied entirely on the use of specific PCR reactions performed in parallel to generate sufficient pathogen target DNA for microarray hybridization. In all cases listed above, specific PCR primers were used to amplify DNA targets prior to microarray hybridizations, through the use of conserved primer sites, or in the work of Andersen et al. (Wilson et al., 2002a; Wilson et al., 2002b), by carrying out up to ˜150 different PCR reactions in multi-well format and pooling the amplicons.
  • U.S. Pat. No. 6,228,575 B1 describes the same data as described by Gingeras (Gingeras et al., 1998) and Troesch (Troesch et al., 1999). In this patent, which is incorporated herein by reference in its entirety, target pathogen sequences are tiled onto arrays. Because several types of variations (esp. insertion/deletion or frequent multiple substitutions) in pathogen sequence can perturb hybridization patterns, Gingeras et al. used differential measures of specific pathogen hybridization patterns to identify individual mycobacterial variants. That is, identifications required a priori knowledge of a differential hybridization pattern that was empirically determined in ground truth experiments.
  • As stated above, there is a critical need for advanced diagnostic systems that can detect known and pathogen genomic sequences as well as variations of those sequences. More particularly, there remains a critical demand for DNA microarray techniques that are fast and reliable, but are free from the systemic bias flowing from the specific PCR based methods that have heretofore been employed.
    • SUMMARY OF THE INVENTION
  • It is an object of the present invention to provide the following preferred embodiments:
      • A. In an embodiment of the present invention is a resequencing DNA microarray chip of multiple groups of oligonucleotide primers of a length ranging from 13 to 70 nucleotides immobilized to a solid phase support, wherein each group of oligonucleotide primers is selected to span a particular region of the reference sequence, occupying a discrete area of the array (e.g. a tile), and comprising at least four sets of primers arranged in a parallel fashion on the chip: 1) a first set that is exactly complementary to the reference sequence; and 2) three additional sets of primers, each of which is identical to the first set of primers but for the nucleotide at a central position, which is different in each of the three sets such that all four conventional nucleotide bases are present on said array.
        • a. In a preferred aspect of this embodiment, the length of the oligonucleotide primers is 25 nucleotides.
        • b. In a preferred aspect of this embodiment, the region of the reference sequence that is spanned by the oligonucleotide primer moves by (n+1) nucleotides across the reference sequence for each adjacent tiled region across the microarray surface.
        • c. In a preferred aspect of this embodiment, the resequencing DNA microarray contains 18×18 micron features.
        • d. In a preferred aspect of this embodiment, the resequencing DNA microarray contains 8×8 micron features.
        • e. In a preferred aspect of this embodiment, the sequences selected for tiling are a single gene or subsequence that may represent a much broader class of organism genus, species and subspecies.
        • f. In a preferred aspect of this embodiment, the sequences selected for tiling are “prototypes” representing genotypes of pathogen families.
        • g. In a preferred aspect of this embodiment, the sequences selected for tiling are “prototypes” representing a family or group of adenoviruses.
        • h. In a preferred aspect of this embodiment, the sequences selected for tiling are “prototypes” representing a family or group of influenza viruses.
        • i. In a preferred aspect of this embodiment, the sequences selected for tiling are a single gene or subsequence unique to an individual pathogenic strain.
        • j. In a preferred aspect of this embodiment, the sequences selected for tiling encode a drug-resistance marker.
        • k. In a preferred aspect of this embodiment, the resequencing DNA microarray is a Version 1 Respiratory Pathogen Microarray (RPMV1).
        • l. In a preferred aspect of this embodiment, the resequencing DNA microarray is a Version 2 Respiratory Pathogen Microarray (RPMV2).
        • m. In a preferred aspect of this embodiment, at least one common pathogen and at least one biological terrorism agent is represented on the same chip.
        • n. In a preferred aspect of this embodiment, the resequencing DNA microarray embraces any combination of the aforementioned aspects.
      • B. In an embodiment of the present invention is a kit containing (a) the aforementioned resequencing DNA microarray, and (b) reagents suitable for specific hybridization of target sequences to the probe sequences present on said resequencing DNA microarray. C. In an embodiment of the present invention is a method of detecting the presence of a drug-resistance marker in a microorganism or a microorganism belonging to a particular class of organism species or subspecies, wherein the method comprises: (1) providing a resequencing DNA microarray as described above; (2) contacting to said resequencing DNA microarray a unknown sample; (3) hybridizing the contents of said unknown sample to the probe sequences immobilized on said resequencing DNA microarray under suitable conditions and for a suitable time; (4) detecting the presence and/or identity of a drug-resistance marker in a microorganism or a microorganism belonging to a particular class of organism species or subspecies in said unknown sample, and (5) detecting a sufficient amount of pathogen sequence in order to allow a forensic assessment of the possible source(s) of pathogens.
        • a. In a preferred aspect of this embodiment, the method is for detecting the presence of a particular pathogenic species.
        • b. In a preferred aspect of this embodiment, the method is for detecting the presence of a drug-resistance marker.
        • c. In a preferred aspect of this embodiment, the hybridization time ranges from 15 minutes to 24 hours.
        • d. In a preferred aspect of this embodiment, the unknown sample is a biological sample, including a nasal wash specimen, a throat swab, a blood sample, and a sputum sample, or an environmental sample, including a soil sample, an air sample, and a water sample.
        • e. In a preferred aspect of this embodiment, prior to hybridizing the unknown sample is subjected to one or more of the following steps: (1) isolation, (2) enrichment for target sequences of interest, (3) amplification, (4) labeling, and (5) hybridization (e.g., subtractive).
        • f. In a preferred aspect of this embodiment, prior to hybridizing the target nucleic acids of interest in the unknown sample is amplified by specific reverse transcription (RT), PCR, multiplex PCR, and/or random PCR.
        • g. In a preferred aspect of this embodiment, prior to hybridizing the target nucleic acids of interest, the unknown sample is subjected to a random amplification strategy (e.g., random primed, isothermal Klenow polymerase-based, φ29DNA polymerase-based, tandem amplification, multiplex PCR, and total amplification).
        • h. In a preferred aspect of this embodiment, the DNA present in said unknown sample has been enriched.
        • i. In a preferred aspect of this embodiment, the target nucleic acids of interest present in said unknown sample are enriched by subtraction of the background nucleic acids from said sample.
        • j. In a preferred aspect of this embodiment, the target nucleic acids of interest present in said unknown sample are enriched by selective removal of said target nucleic acids from a mixture of nucleic acids presenting said unknown sample.
        • k. In a preferred aspect of this embodiment, the target nucleic acids of interest present in said unknown sample are enriched by selective capture using probes having complete or partial sequence homnology, followed by amplification and hybridization to the microarray.
        • l. In a preferred aspect of this embodiment, said detecting the presence and/or identity is by (a) making base calls based on the hybridization response between the nucleic acids of interest in said unknown sample and the probe DNA on the resequencing DNA microarray and (b) determining the sequence of the corresponding full-length gene or genomic fragment by comparing the sequence of the hybridized region to sequences present in a sequence database.
          • i. In a particularly preferred aspect, the base calls are made by the Affymetrix GDAS software under “permissive” settings.
          • ii. In a particularly preferred aspect, sequence determination is by Resequencing Pathogen Identifier (REPI) software (see U.S. provisional Application Ser. No. 60/609,918 filed on Sep. 15, 2004, and U.S. provisional Application Ser. No. 60/631,460, filed on Nov. 29, 2004, which are incorporated herein by reference in their entirety).
          • iii. In a particularly preferred aspect, the sequence database is GenBank.
      • D. In an embodiment of the present invention is a method of routine diagnosis of common respiratory pathogens and/or biological terrorism agents by using the method of C above.
      • E. In an embodiment of the present invention is the genomic sequences of thirteen adenovirus strains, which were not known as of the date of the present invention, including: Ad3, Ad3FS_navy, Ad4, Ad4vaccine, Ad4FS_navy, Ad4FS_AF, Ad5FS, Ad7, Ad7FS_navy, Ad7 vaccine, Ad16, Ad1, and Ad21, and fragments thereof.
      • F. In an embodiment of the present invention-is a method of surveillance of common respiratory pathogens and/or biological terrorism agents by using the method of C above.
      • G. In an embodiment of the present invention is a method of estimating the relative amount of a pathogen in a biological sample containing the same comprising providing a resequencing DNA microarray as described above; (2) contacting to said resequencing DNA microarray said biological sample; (3) hybridizing the contents of said unknown sample to the probe sequences immobilized on said resequencing DNA microarray under suitable conditions and for a suitable time; and (4) quantifying the presence and/or identity of a drug-resistance marker in a microorganism or a microorganism belonging to a particular class of organism species or subspecies in said unknown sample.
        • a. In a preferred aspect of this embodiment, said quantifying is by determining the absolute intensity of the hybridization signals on the chip.
        • b. In a preferred aspect of this embodiment, said quantifying is by determining the percentage of base calls, both as a percentage of the total tile region size and as a percentage of base calls within a selected subsequence satisfying the sliding window algorithm (i.e., REPI).
  • The above objects highlight certain aspects of the invention. Additional objects, aspects and embodiments of the invention are found in the following detailed description of the invention.
    • BRIEF DESCRIPTION OF THE FIGURES
  • A more complete appreciation of the invention and many of the attendant advantages thereof will be readily obtained as the same becomes better understood by reference to the following Figures in conjunction with the detailed description below.
  • FIG. 1 shows a graphical description of the Version 1 Respiratory Pathogen Microarray (RPMV1). The geometrical distribution of all tile regions dedicated to each pathogen is represented by assigned colors (right). The Affymetrix spike-in controls are at the top of the microarray (white). Black regions interspersed between tiled regions did not contain probes.
  • FIG. 2 shows purified adenovirus 4 prototype (accession number AY594253) DNA hybridization to RPMV1 following nucleic acid isolation and amplification using either (A) degenerate primer PCR (Lin et al., 2004) or (B) GenomiPhi total amplification of target DNA, as described in Example 1. Degenerate primer PCR (A) resulted in hybridization of targets within those tiled regions covered by conserved primer sites. Total amplification (B) resulted in target hybridization across the entire Ad4 tile regions. Neither method resulted in significant cross-hybridization across the microarray. In each case, REPI identified the correct strain of adenovirus 4 (AY594253) as having achieved the highest BLAST (“Basic Local Alignment Search Tool”) bit score across all Ad4 tile regions where amplicons hybridized, except in one case (described in Example 1).
  • FIG. 3 shows purified adenovirus 5 field strain (Ad5FS, accession number AY601635) (A, B) and adenovirus 7 prototype (accession number AY594255) (C, D) DNA hybridizations to RPMV1 following nucleic acid isolation and amplification using either (A, C) degenerate primer PCR (Lin et al., 2004) or (B, D) GenomiPhi total amplification of target DNA as described in Example 3. Degenerate primer PCR (A, C) resulted in hybridization of targets within those tiled regions having conserved primer sites for both the Ad5FS and the Ad7 prototype. Total amplification (B, D) resulted in target hybridization across the entire AdS and Ad7 tile regions. Neither method resulted in significant cross-hybridization across the microarray. In each case, REPI identified the correct strain of adenovirus 5 (Ad5FS, accession number AY601635) or adenovirus 7 (accession number AY594255) as having achieved the highest BLAST bit score across all respective tile regions where amplicons hybridized. For adenovirus 7, the correct assignment was also made for the Ad7 prototype on the Ad7 vaccine tile region, distinguishing it correctly from Ad7 vaccine strain (AY594256) from which the tile region was derived. Also, it is noteworthy to mention that the degenerate primer solution used for amplification of all adenoviruses herein was unintentionally contaminated with small amounts of Ad4 and Ad7 prototypes (not considered positive for contamination by real-time PCR). The contaminants did not result in easily discernible hybridizations (as shown in FIG. 3) but base calls were made by Genetic Data Analysis Software (GDAS) (packaged with the microarray reader form Affymetrix, Santa Clara, Calif.) and Resequencing Pathogen Identifier (REPI) assigned all unintentional base calls to the correct contaminant. The GenomiPhi solution did not become contaminated, and no base calls were made on adenovirus tile regions outside of the Ad5 and Ad7 tile regions in respective experiments.
  • FIG. 4 shows the results of the adenovirus 4,5 breakthrough strain as described in Example 4. An aliquot of purified nucleic acid from culture of throat swab of a patient with febrile respiratory illness (who was previously vaccinated against adenovirus) was amplified using conserved/degenerate primers as described (Lin et al., 2004) and otherwise processed according to the standard Affymetrix CustomSeq protocol. The patient was diagnosed as Ad4 positive via serotypic antibody neutralization, and diagnosed as Ad5 positive via a hexon sequence. The present inventors obtained multiple target hybridizations, resulting in base calls on all the adenovirus 5 and adenovirus 7 prototype tile regions. REPI analysis revealed that the adenovirus was identified with high confidence as Ad5 (Ad5FS, accession number AY601635), while multiple Ad7 prototype regions gave evidence of a B subgroup species other than Ad7, namely Ad21. It is noteworthy again to note that the degenerate primer solution, used for amplification of all adenoviruses herein was unintentionally contaminated with small amounts of Ad4 and Ad7 prototypes, as in the case shown in FIG. 3. The contaminants did not result in easily discernible hybridizations in the Ad4 tiles (as shown in FIG. 4) but base calls were made by GDAS and REPI assigned all unintentional base calls to the correct contaminant (adenovirus 4 prototype; accession number AY594253), not a field strain that circulates in basic military training venues. Moreover, the highest bit score achieved in the Ad7 tiles was not Ad7 prototype (despite low-level contamination) but adenovirus type 21 (Ad 21; AY601633), another member of the B subgroup of adenoviruses represented by the Ad7 prototype (AY594255). The observation of a mixture of Ad5 and Ad21 in this sample was confirmed using conventional DNA sequencing for Ad5, amplicon sequencing for Ad21, and spotted microarray results (Lin et al., 2004). Yet, the low-level contaminant of Ad7 prototype was still detected and distinguished by high bit scores in a single tile region subsequence. Thus, in this example, an unanticipated mixed adenovirus sample comprised of AdS and Ad2l, inadvertently contaminated with small amounts of Ad4 and Ad7 prototype (not found in field samples), was completely resolved. Resolution of this fine detail would be impossible using other types of microarrays (i.e. spotted) without anticipation of such types of events and extensive probe design effort.
  • FIG. 5 shows the results of influenza A strain identification as described in Example 5. Aliquots of a nasal wash from an Influenza A (+) febrile patient (confirmed by standard viral cell culturing techniques) who was previously immunized (using A/Moscow/10/99(H3N2))—based vaccine) during the 2003-2004 flu season were amplified using (A) universal (Hoffmann et al., 2001) or (B) multiplex (Offringa et al., 2000) RT/PCR primers, and processed according to the standard Affymetrix CustomSeq protocol. Because both strategies produce amplicons of the entire HA, NA, and M genes, the respective tile regions on the microarrays were almost completely hybridized in both cases. REPI output for both cases showed that the highest bit score for HA3 was obtained for the Fujian/411/2002 influenza strain (ISDN38157_InfluenzaA/Fujian/411/2002_Hemagglutinin—1042) that evaded vaccine protection during the 2003-2004 flu season. The prototype influenza A HA sequence used to define the HA3 tile region, (A/Panama/2007/99/H3N2), was not present in the REPI output for the base calls on the HA tile. Thus, a prototype region for an expected strain of influenza A allowed identification of an unexpected strain.
  • FIG. 6 shows the results of the reduced hybridization time assay as described in Example 6. In this example, a nasal wash that was confirmed negative for all targets probed by the microarray except the erythromycin resistance markers SPYERMB, SPYERMTR, and SPYMEFAE was subjected to specific multiplex PCR for each of these three markers. The amplicons were then hybridized to separate microarrays for either 16 hours (A) or 15 minutes (B), otherwise being processed in accordance with the Affymetrix CustomSeq protocol. In comparison, the signal intensities for the 15-minute hybridization microarray (B) were lower than those on the control 16-hour microarray (A) (note incomplete hybridization to the Affymetrix control probes at the top of the microarray in (B)). However, the REPI output for each of the three tile regions showed that the highest bit scores in each region were the same for both (A) and (B), although both the bit scores and expect values were lower in the cases of reduced hybridization times. Similar results were obtained for 30 minute and 1 hour hybridizations, with an increase in the number of base calls made with increasing hybridization times. However, this example clearly illustrates the robustness of the method to make fine scale discrimination between targets with a range of different hybridization patterns.
  • FIG. 7 shows the effects of subtractive hybridization approaches as described in Example 7. (A) Shows the hybridization pattern obtained following total amplification of the isolated nucleic acids from an aliquot of nasal wash from a patient with febrile respiratory illness at Lackland AFB. This sample was positive for Ad4 at an estimated titer of 104 genomic copies per microliter. The high background hybridization across the microarray prevents GDAS from making base calls even though the adenovirus type 4 region showed a discernibly higher signal than that of the overall background. Co-hybridizing the same set of total amplicons obtained in (A) with COT-1 fraction human genomic DNA (B) did little to improve this as again no base calls were made by GDAS. (C) Shows that the use of a magnetic bead-based subtraction alone, prior to total amplification, did not result in a sufficient number of base calls to allow similarity searching. However, through the combined use of a bead-based subtraction (Streptavidin-coated beads conjugated with biotinylated COT-1 human DNA) prior to amplification and co-hybridization with solution phase COT-1 human DNA (D), enough base calls could be made to unambiguously rank the adenovirus 4 Air Force field strain (accession number AY599837) highest in each of three subsequences identified in the Ad4HEXON-1 tile region (D). Moreover, by performing the same set of combined steps using 2 microliters of starting sample material instead of 1 microliter (E), base calling was extended into the Ad4FIBER tile region in addition to Ad4HEXON-1, allowing unambiguous high bit-score ranking for an Ad4 field strain in the Ad4HEXON-1 tiles and in several Ad4FIBER subsequences.
  • FIG. 8 shows hybridization of Influenza A targets (Fujian 411/2002), spiked into normal nasal wash, following amplification using a recently-described modification (Kessler et al., 2004) of a previous (Wang et al., 2003) protocol for non-biased amplification of viral RNA genomic targets. FIG. 8(A-C) show hybridization patterns for 105, 103, and 101 plaque-forming unit (pfu) spike-in amounts, respectively (see Example 9). These results demonstrate that the efficacy of the present approach can be retained even when a non-biased amplification scheme is used. This should allow extension of the overall approach to preparation of a multiplicity of unknown RNA targets and for incorporation of this particular protocol into a combined method for universal amplification of both RNA and DNA pathogen targets for the resequencing microarray.
  • FIG. 9 shows a flowchart representation of an embodiment of the present invention in which the RNA and DNA pathways are converged.
    • DETAILED DESCRIPTION OF THE INVENTION
  • Unless specifically defined, all technical and scientific terms used herein have the same meaning as commonly understood by a skilled artisan in enzymology, biochemistry, cellular biology, molecular biology, bioinformatics, and the medical sciences.
  • All methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, with suitable methods and materials being described herein. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. Further, the materials, methods, and examples are illustrative only and are not intended to be limiting, unless otherwise specified.
  • It is well known that DNA microarrays might be used to analyze the sequence of target nucleic acids from pathogens for diagnostic or surveillance purposes. The effects of oligonucleotide probe sequence selection, length, positioning on surfaces, the physical chemistry of binding, and labeling techniques, have been the topics of vigorous research in the past ten years. However, heretofore, the approaches taken have almost exclusively involved the use of single oligonucleotide probes (13-70 mers) that are specifically designed to hybridize to-a single recognized pathogen target sequence with high specificity (13-25 mers) or to a longer stretch of pathogen target with a lesser degree of specificity (70 mers). These microarrays are commonly known as spotted microarrays, but the same content of a spotted microarray can also be embodied in other forms besides two-dimensional planar surfaces, one example being “bead arrays” (Ferguson, Steemers & Walt, 2000).
  • There have been many fewer descriptions of pathogen identification and characterization using Affymetrix resequencing microarrays. Kozal (Kozal et al., 1996) measured mutational drift in HIV and Gingeras (Gingeras et al., 1998; Gingeras et al., 2001), and Troesch (Troesch et al., 1999) identified mycobacterial species and Single Nucleotide Polymorphisms (SNPs) relating to antibiotic resistance using resequencing arrays. Wilson et al. (Wilson et al., 2002a) used the same types of arrays for bacterial identification using ribosomal RNA and for detection of multiple biowarfare agents (Wilson et al., 2002b).
  • The use of resequencing microarrays for simultaneous pathogen identification and surveillance has fundamental advantages over single oligonucleotide approaches because detailed target sequence information becomes directly available as part of the raw microarray data. By definition, spotted microarrays having 102 to 104 oligonucleotide probes are incapable of resolving subtle sequence variations for more than 10-1000 base pairs of total target sequence, even if the array were designed with a tiling strategy. Thus, spotted oligonucleotide microarrays that facilitate identification of a broad spectrum of pathogens at an individual strain or SNP level (Cherkasova et al., 2003; Wang et al., 2002; Wang et al., 2003) require that the pathogen target sequence be determined using conventional DNA sequencing technology, requiring specialized equipment, personnel, and time periods of several days.
  • Accordingly, the present invention generally relates to the detection and identification of bacterial, viral and protozoan pathogens and virulence markers using DNA microarray technology. The present invention also relates to the design, test, and analysis of resequencing microarrays having defined regions that can be used to assign numeric detection probabilities for a large number of specific pathogen genotypes and mixtures of pathogens. Furthermore, it relates to methods required for the processing of both simple and complex (e.g. clinical and environmental) samples for said microarrays.
  • More specifically, the present invention relates to the use of high plurality resequencing microarrays as a novel class of devices for purposes that would include diagnosis of infectious disease agents and pathogen surveillance. In particular, it pertains to DNA microarrays that employ a large number (hundreds to thousands) of selected “prototype” nucleic acid sequence regions (typically 250-2000 base pairs each) from target genomic sequences to detect and identify a logarithmically larger number (thousands to tens of thousands) of both unrelated and closely related (strain level) microbial pathogens. More-particularly, the invention relates to the design of microarrays fabricated to allow a resequencing of the target nucleic acids using a “tiled” probe approach. Yet even more particularly, the invention concerns the design of Affymetrix resequencing microarrays using tiled probes that will allow for analysis of up to 105 to 106 base pairs of target sequence.
  • In a particular embodiment, the present invention provides a method for simultaneously assaying for a large number of pathogens by detecting their nucleic acid sequences and subjecting the detected sequences to an automated similarity search against public domain and private databases. This object is accomplished by a non-obvious adaptation of a commercial technology (Affymetrix CustomSeq™). The program employed, CustomSeq™, was designed for detection of Single Nucleotide Polymorphisms (SNPs) by resequencing target DNA. This so-called SNP-detection calls for: (1) an error rate in base calling that is much lower than the naturally occurring frequency of mutation (in humans approximately (1 per 108 base pairs), (2) amplification of the purified starting material, at a concentration of 106 genomic copies/microliter, prior to microarray hybridization using specific PCR primers, and (3) combination and processing multiple chips for replicate samples by an algorithm that restricts base calls to those having a degree of confidence at which the presence of low frequency SNPs can be deduced. The present inventors demonstrate that Affymetrix resequencing technology can be adapted for insertion into an integrated system for high multiplicity infectious disease diagnostics and pathogen surveillance in a time scale and level of sample preparation complexity that are enabling for point-of-care diagnostics applications. This system is substantively different from the intended use of the Affymetrix technology, and is not obvious to the typical skilled practitioner of microarray technology.
  • At present, there have been few, but relevant literature descriptions of application of Affymetrix resequencing technology to pathogen identification. From the design, experimental, and analysis standpoints, the present invention has substantive advantages over the prior art in pathogen characterization using resequencing. Kozal (Kozal et al., 1996) measured mutational drift in HIV and Gingeras (Gingeras et al., 1998; Gingeras et al., 2001), and Troesch (Troesch et al., 1999) identified mycobacterial species and SNPs relating to antibiotic resistance using resequencing arrays. In each of these cases, optimized sequences were selected for tiling, based on alignments of the possible target sequences. Specific PCR primers were designed to amplify targets for hybridization. Unknown clinical isolate identifications were made using pattern recognition algorithms based on empirically determined differential hybridization patterns to the arrays. As such, this approach would depend on the amplification and hybridization of the full length of the target sequences, and would not be amenable to: (1) contributions of confounding non-specific binding resulting in lost base calls, (2) incomplete hybridization across the length of the target due to low target concentration or gaps caused by low homology, and (3) compromised hybridization integrity caused by non-biased (total) amplification of unknown target sequences from a clinical or environmental sample.
  • The method proffered by the present inventors does not share the same limitations as those disclosed in the prior art using resequencing microarrays. Moreover, technology enablements for at least one intended use, namely the simultaneous detection of a large number of diverse pathogen species, have only recently occurred with the introduction of Affymetrix microarrays (18×18 micron features) for CustomSeq™ RPMV1 chip and higher density (8×8 micron features) for Respiratory Microarray Version 2 (RPMV2), allowing 29.7 kb and 300 kb, respectively, to be tiled for resequencing. However, the most significant improvement offered by the present invention is the use of the increased density chips with sequence length-independent similarity searches (BLASTN), which affords that many fewer assumptions must be made in advance of selecting sequences for tiling. Furthermore, the use of length-independent similarity searches (BLASTN) removes the constraint that a particular known subsequence be fully resequenced, making the approach more resistant to variations in target concentration and contributions from nonspecific binding leading to lost base calls.
  • Thus, in the present invention, sequences selected for tiling are “prototypes” in the sense that a single gene or subsequence may represent a much broader class of organism species and subspecies (alternatively types, strains, variants, or mutants). The resulting method is robust with respect to minor variations in the genotypes of individual pathogens and strains, and enables detection and probable identification among a plurality of candidate pathogens that may not be explicitly represented in the design of the experimental chip layout, including the tiled regions.
  • The chip layout also takes advantage of partially redundant tile sets (these were discouraged by the manufacturer's design guidelines and by the manufacturer during design), both intragenic and intergenic variation within a single pathogen strain, and between multiple similar or diverse pathogen types. However, the present inventors have determined that the redundancy is important to elevate confidence in results and to minimize likelihood of false positive and false negative results. Advantages of this design/analysis approach will permit incorporation of both conserved and hyper-variable regions of genomes, facilitating group, type, and strain level identification.
  • There are only a few literature reports describing generic amplification strategies for microarray analysis of microbial pathogens. Wang et al. (Wang et al., 2002) described a multi-step process for amplification of RNA pathogen targets followed by sequential PCR and Klenow fragment-based amplifications, prior to hybridization on 70 mer oligonucleotide arrays. The time and/or number of technical steps required for this amplification were not specified but a subsequent paper from the same group (Wang et al., 2003) reported it to be approximately 24 hours. It was also not specified which of the amplification steps resulted in enhanced detection efficiency. A recent report from our group (Vora et al., 2004) describes a variety of nonspecific nucleic acid amplification techniques, individually and in combination, for hybridization to 70 mer oligonucleotide arrays. There are no known reports of prior art in the area of nonspecific amplification of DNA targets, either purified or in a complex mixture (e.g. clinical sample), for hybridization to a resequencing microarray.
  • The present invention generally advances the art of generic amplification for pathogen detection by microarrays in several ways: (1) it details specific methods for total amplification of purified or highly enriched pathogen nucleic acids for presentation to a high density short (25 mer) Affymetrix resequencing array, which is neither previously described nor obvious, since the methods are a large departure from the prescribed Affymetrix protocols, and (2) it describes novel alternative approaches to the use of enzymatic processes, competitive hybridizations, and magnetic bead-based subtractive and enrichment steps to reduce background and subsequent non-biased (i.e. total) amplification and microarray hybridization.
  • The present invention is embodied by a specific set of design and processing methods that enable broad-scale pathogen identification and characterization by utilizing resequencing microarrays. Specifically, the present invention allows for the precise, sensitive, and high confidence identification of a large multiplicity (thousands) of pathogens in a single assay.
  • In an embodiment of the present invention is a resequencing DNA microarray chip of multiple groups of oligonucleotide primers of a length ranging from 13 to 70 nucleotides (preferably 25 nucleotides, although it is possible and is within the scope of the present invention to use primer lengths corresponding to each integer value within this recited range) immobilized to a solid phase support, wherein each group of oligonucleotide primers is selected to span a particular region of the reference sequence, occupying a discrete area of the array (e.g. a tile), and comprising at least four sets of primers arranged in a parallel fashion on the chip: 1) a first set that is exactly complementary to the reference sequence; and 2) three additional sets of primers, each of which is identical to the first set of primers but for the nucleotide at a central position, which is different in each of the three sets such that all four conventional nucleotide bases are present on said array.
  • The present invention further provides methods for processing complex clinical samples (e.g. nasal wash) requiring minimal nucleic acid isolation/amplification step(s).
  • The present invention is distinct from the overwhelming majority of microarray-based pathogen detection schemes because it uses high-density “tiled” microarrays to determine the actual sequences of pathogen genetic targets. It is further unique from other resequencing pathogen identification strategies in a number of important areas, including incorporation of: (1) a high multiplicity of disparate pathogen “prototype” target regions that exhibit little or no discernible cross-hybridization or interference with one another, (2) a high sequence redundancy within closely related pathogens that allows higher confidence identification of specific strain (e.g. adenoviruses or influenza viruses), (3) “prototype” regions of large tiled segments representative of a class of pathogens allowing for the precise identification of specific pathogen strains and the use of specially-designed software to parse and arrange sequence fragments for presentation to similarity search (e.g. BLAST) algorithms, allowing discrimination of pathogen mixtures and recombination events between pathogens, instead of the more restrictive tile selections and differential algorithm described in the most closely-related prior art (U.S. Pat. No. 6,228,575), (4) minimally-biased nucleic acid amplification strategies that allow precise, high-confidence pathogen target resequencing without significant interference or cross-hybridization, and (5) sample processing methodologies that allow the resequencing array to be used in conjunction with minimally-biased nucleic acid amplification strategies on complex clinical samples.
  • The combination of these methods allows the simultaneous detection and identification of a high multiplicity of pathogen(s) from a clinical sample by a single qualified technician within a period of 24 hours, but preferably within 4 hours, more preferably with 2 hours, most preferably within 30 minutes.
  • Accordingly, owing to its embodiments, the present invention supports: (a) routine diagnosis of infection in a clinical setting within several hours of sample collection, (b) simultaneous interrogation of the sample for indications of a rare infectious event (e.g. unanticipated pathogen, antibiotic resistance pattern or biological warfare agent), (c) routine molecular pathogen surveillance, (d) vaccine quality control and (e) monitoring of genetic changes of a pathogen as a result of natural genetic variations, drug treatment, intentional manipulation, or other events.
  • High-Density Resequencing Microarrays
  • High-density microarrays (HDMs) are fabricated by light-directed combinatorial synthesis of DNA oligomers (Kozal et al., 1996). The DNA oligomers synthesized on these sites typically have lengths of 20-30 bases. Through subsequent improvements to the method using high-resolution semiconductor photoresists, Affymetrix has demonstrated fabrication of HDMs having individual features with resolutions approaching 1 μm2, enabling probe feature densities of 10-100 times greater than that demonstrated in the RPMV1. To date, HDM designs relevant to pathogen identification have been based on a “tiling” strategy. Accordingly, four probes of equal length are synthesized for each base in both the sense and antisense directions, requiring that a total of eight 25-mer probes are used for each base pair in a given reference sequence. One probe in each direction (sense and antisense) exactly complements the reference sequence while three others have a single base mismatch at the position of the interrogated base. Thus, a tiled HDM can effectively allow the target nucleic acid to be “resequenced”.
  • In this manner, the base calls of the unknown target are interrogated at each of one of four possible base positions (one of every four possible base pairings varied at the number 13 position in the tiled 25 mer probes), allowing a direct read of the target sequence from the corresponding positions across the array. In the case of CustomSeq arrays, the GCOS (Version 1.1) software is used to reduce the raw image (.DAT) file to a simplified file format (.CEL file) with intensities assigned to each of the corresponding probe positions. Finally, the GDAS (Version 2.0) software is used to apply an embedded version of the ABACUS (Cutler et al., 2001) algorithm to produce an estimate of the correct base calls, comparing the respective intensities for the sense and antisense probe sets. One of the available export file types from GDAS is the FASTA-formatted base calls made for each tiled region of the resequencing array.
  • HDMs of the type described above have been used to identify pathogen species and detect drug resistance-conferring mutations in a series of in vitro experiments using cultured microorganisms, including HIV (Kozal et al., 1996). Troesch et al. (Troesch et al., 1999) designed HDMs to discriminate between 54 different to detect Mycobacterium species and Mycobacterium tuberculosis rifampin resistance. A tiled array of 65,000 oligomer probes was used to accurately resequence 70 clinical isolates of 27 mycobacterial species and 15 rifampin-resistant M. tuberculosis strains. More recently, sequence-specific identification of F. tularensis and Y. pestis was demonstrated in environmental samples using tiled HDMs (Wilson et al., 2002b). Both of these general approaches rely on specific hybridization patterns based on ground-truth (control) measurements. Moreover, the authors have provided no direction on how a quantitative comparison might be made against closely-related or unanticipated organisms for starting concentrations that may vary by six orders of magnitude.
  • Array Types
  • The present invention is developed using Affymetrix CustomSeq resequencing microarrays. For a discussion of resequencing microarrays, the artisan is directed to U.S. Pat. No. 6,228,575, which is incorporated herein by reference in its entirety. However, the present invention is not conceptually limited to microarrays produced using that specific fabrication strategy. In principle, resequencing can be performed on the scale described with any technology that is capable of producing microarrays with sufficient feature density to allow this approach. Theoretically this can be accomplished using an oligonucleotide printing technology, but it is more likely accomplished using a photolithographic approach. Whereas the Affymetrix resequencing chips are based on sequential lithographic steps using a separate mask that corresponds to each step, an alternative approach could use maskless lithography (Albert et al., 2003; Nuwaysir et al., 2002) or by nanolithographic methods (Ginger, Zhang & Mirkin, 2004). More generally, any method of producing a plurality of oligonucleotide probes for the purpose of determining target sequence would be applicable, even bead “arrays” that are not in a 2-dimensional format (Ferguson et al., 2000).
  • The probes themselves could be comprised of variants of DNA, namely RNA or oligomeric peptide-nucleic acids (PNA). The probes can be made sensitive to enzyme digestion, then subject to subsequent handling. In a preferred embodiment, the probes will incorporate dUTP instead of dTTP, making them sensitive to uracil-DNA-glycosylase. This will make them amenable to selective degradation following the capture of target. Moreover, within the scope of the present invention it is also possible to immobilize RNA and obtain complementary sequence recognition thereof. Immobilization of RNA would require chemical stabilization of the RNA. In a more general sense, the probes can be made from chemically modified nucleic acids that would make them more or less susceptible to subsequent chemical processing steps.
  • Array Design
  • This present invention, using the RPMV1 microarray, illustrates the ability of tiled prototype sequences to identify a wide variety of specific pathogen strains without assuming that specific hybridization patterns are required for specific pathogen identification. In the current apparatus, the prototypes for tiled regions, particularly those for adenoviruses 4, 5, and 7, were empirically chosen to be representative of adenovirus subgroups E, C, and B, respectively.
  • A more preferred and systematic approach to the design would involve the use of multiple sequence alignments to produce consensus sequences, where consensus sequences are defined as those representing the most frequent bases at the alignment position. In a preferred embodiment, the alignment algorithm will produce a hierarchical phylogenetic tree for target gene sequences from individual pathogen strains or for a group or family of pathogens. A consensus sequence will first be formed for members of each node or group of nodes on the tree, whose distance measures fall within a threshold, using an appropriate algorithm (Lee, 2003). The actual target sequences would then be compared individually to the consensus sequence, and the effects of hybridization to a tiled microarray region defined by the consensus sequence would be simulated. Known effects such as insertion or deletion of bases, as well as the effects of multiple base substitutions within an oligonucleotide probe region would define rules for the simulated hybridization. Subsequent analysis of the resultant hybridization and base call pattern would then indicate the suitability of a proposed tile for acting as a prototype for a given range of pathogens. This process would be reiterated until the most suitable set of prototype regions were defined for coverage of a given set of pathogens. In one very preferred embodiment, this process would be used to maximize the efficiency of space usage on a chip, resulting in the greatest reduction in the overall physical dimensions of a resequencing microarray, and thus, the greatest reduction in manufacture cost per microarray.
  • In one preferred embodiment, the resequencing array would be designed in combination with another less complex solid phase capture device (array, gel, or otherwise) that that would be used initially to queue the resequencing array. For example, an array comprised of a multiplicity of long oligonucleotide probes would be used initially for the detection of pathogen by recognizing conserved sequences within a family of pathogens. The resequencing array could then be used to interrogate variable regions associated with the conserved probes on the initial array, providing detailed sequence information on the pathogen. In a very preferred embodiment, the sample preparation would be common for both the solid phase capture device and the resequencing microarray. In yet another very preferred embodiment, the initial array would be used to capture target that would be isolated and then amplified using non-biased amplification techniques for presentation to the resequencing array.
  • Overall Design Philosophy for the Intended Use
  • This invention leverages pathogen genome information from various public and/or private sources to, design, fabricate, evaluate, validate and integrate an advanced diagnostics platform as part of an effective biodefense surveillance and operational medicine system. It is an integral facet of the Epidemic Outbreak Surveillance (EOS) program biodefense model that the system would most effectively be enabled through the adoption of a widely distributed device that would find utility in routine diagnostics of infectious diseases, most particularly in diagnosis of infectious respiratory disease (see the Defense Sciences Board Summer 2000 Study Report and the Health Sciences Biodefense System (HSBS) final briefing). It is important that the device (e.g. microarray) will provide a cost-effective alternative to conventional approaches to the diagnosis, management, and surveillance of infectious diseases, most particularly respiratory infections. It is equally important that the device is supported with design and analysis informatics, and to ensure that decision quality information from that device will be transmissible and interpretable by a variety of care providers, public health officials, and decision makers. Thus, it is a critical objective of this invention that the device (e.g. microarray) be a key component of an integrated system comprised of a local point-of-care diagnostic device that provides automated, two-way data sharing between health care providers, public health officials, and decision makers (this a maybe a cross-reference to the business model patent that is in the queue). The invention described herein might fulfill this role in at least two ways: (1) through reduction in array size (i.e. lower cost), process automation, and the availability of portable hardware for processing resequencing arrays, the invention could become the object of the point-of-care device itself, and (2) in the event of lower-cost or easily automated microarray alternatives, the resequencing array can be a higher echelon component in a diagnostics/surveillance pipeline. In the latter case, the lower-cost alternative device will provide for initial sample processing, pathogen target enrichment, amplification, decision information at the point-of-care, while the resequencing capability provides for a sequential testing capability by facilitating a more detailed interrogation of the sample when desired.
  • General Strategy for Resequencing Microarray Chip Design
  • According to the present invention, the process of designing resequencing microarray chips is carried out by selecting pathogen genomic sequences having sequence properties that make them unique to a small number (ideally one) of pathogens, or are highly conserved, allowing them to detect many types of microbial species at the family or genus level, or are moderately conserved and selected as “prototype” regions. Prototype. regions will have an intermediate level of sequence homology across a group of microbial species and allow for both efficient hybridization and unique identification of most or all of a subtype of pathogenic species. The design strategy for layout of resequencing tiles includes leveraging from alignment of similar sequences and application of a consensus probe sequence for tiling to the chip. The consensus sequence might not be identical to any of selected pathogens, but will interact with a plurality of similar pathogen genomes. The patterns of perfect and imperfect matching of real pathogen genome sequences with the consensus sequence will provide diagnostic discrimination power.
  • In a particular embodiment of the present invention is a general protocol for designing resequencing microarray chips that permit the identification and designation of pathogens present in a sample (e.g., a partially purified sample, a purified sample, an enriched sample, a biological sample, etc.). The various aspects of this design and validation protocol are embodied in the following 6 “phases.”
  • Phase 1: Pathogen Identification:
  • a. Pathogen list (e.g. Adenovirus; Influenza; Streptococcus pyogenes)—provided by pathogen experts or public domain
  • b. Genus/species (new pathogen i.e. Severe acute respiratory syndrome (SARS) variant of corona virus)
  • c. Species/subspecies (Epidemiologic tracking; forensics)
  • d. Pathogen unique segments (cross hybridization issues)
  • e. Issues of genetic shift/drift (e.g. Influenza, HIV)
  • f. Drug resistance markers
  • g. Pathogenicity-related genes or virulence markers (useful for diagnostic and prognostic purposes)
  • h. Markers for genetically engineered traits
  • i. Plasmid DNA sequence (Bluescript, PUC etc.)
      • i. Multiple cloning sites
      • ii. Drug resistance markers (ampicillin, kanamycin, penicillin etc.) (or could list as: Amp, Kan, PBP, etc.)
      • iii. Toxins (botulinum; ricin etc)
        Phase 2: Pathogen identification in relation to sample sources:
  • a. Common respiratory pathogens (and close relatives)
  • b. Biothreat agents: (identified by Centers for Disease Control)
  • c. Consideration of background or commensal organisms in:
      • i. Clinical samples (nasal wash, swab, stool, etc.)
      • ii. Vectors (e.g. mosquito)
      • iii. Environment (water, food, soil)
        Phase 3: Gene Identification: (Most complicated issue associated with pathogen design)
  • a. Sequence Homology (relative to pathogen identity)
      • a. Highly conserved (Genus/Species identification) Identification of novel or unanticipated)
        • i. Identify new/unanticipated organisms
          • 1. chimeras (bacterial genetic exchange)
          • 2. genetic shift/drift variants (i.e. Influenza)
          • 3. man-made
        • ii. Distinguish complicated pathogen families
          • 1. Rhinovirus (many disparate variants)
      • b. Less conserved to hypervariable (Species/subspecies)
      • c. Pathogen-unique sequence segments (cross hybridization)
        • i. Potentially important for a total amplification approach
  • b. Functional Sequences (relative to pathogenicity and patient management)
      • a. Drug Resistance genes in commensal microbes
      • b. Pathogenicity related genes
        • i. Toxin genes
        • ii. Transmission (Infectivity) related genes
        • iii. Pathogenicity islands
        • iv. Virulence factors
      • c. Other Host-pathogen interacting genes
        • i. Immune response
        • ii. Tumorogenesis
        • iii. DNA repair
          Phase 4: Gene Selection (What sequences should actually be placed on the chip)
  • a. Identify Gene Accession Number(s)
      • a. Complete gene
      • b. Pathogen genome for flanking sequences (Controls)
      • c. Most recent/prevalent variants available
        • i. Especially important for rapidly evolving pathogens (Influenza)
  • b. BLAST search: (Inclusion/Exclusion criteria)
      • a. Human sequence homology (exclusion criteria)
      • b. Related pathogen sequences
        • i. Possible exclusion/annotation criteria
        • ii. If >90% homology, sequence needs only to be deposited once
          • 1. Use consensus sequence for identity and annotate as such
        • iii. Identify pathogen specific genes/sequences
  • c. Pragmatic Issues
      • a. Horizontal gene transfer issues in bacteria
      • b. Number of copies of gene in pathogen
      • c. Sequence homology with human sequence (cross hybridization)
      • d. Sequence homology with less pathogenic species (i.e. Bacillus; variola [pox])
        Phase 5: RPM chip prioritization
  • a. Define chip “real estate” (total sequences represented)
      • a. Target gene tile sizes
        • i. Associate accession numbers with tiles
        • ii. Associate accession numbers with consensus sequences
  • b. Refer to primary objectives for prioritization criteria. Key issue include:
      • a. Prevalence of pathogen depending on targeted population, geographic location, season, and other disease transmission factors
      • b. Clinical, operational, and public health relevance
      • c. Chip functionality issues:
        • i. Mixed pathogens
        • ii. Data annotation and presentation to end-user
          Phase 6. Microarray Validation:
  • a. Design controls
      • a. Nested primers sets:
        • i. Outer primer set: Develop controls
        • ii. Inner primer set. Assay positive control
        • iii. Control and RPM sequence should be 100% sequence match
      • b. Control clones developed
      • c. Control clones sequence validated for match.
  • b. Develop pathogen chip annotation schema:
      • a. Sites of poor hybridization
        • i. Poor signal
        • ii. Incorrect signal
      • b. Sites of cross hybridization
        • i. Human cross hybridization
        • ii. Other pathogens (especially bioterrorism agents and toxins)
      • c. Level of specificity of sequence
        • i. Markers that can identify subspecies/variants
          • 1. Forms the basis of a forensics database
        • ii. Markers that can identify genus or species only
        • iii. Identification of new variant markers as discovered
  • c. Chip Validation Experimental Framework:
      • a. Human hybridization to detect cross hybridization regions
      • b. Plasmid-based validation schema:
        • i. Titrate plasmid for PCR sensitivity
        • ii. Titrate for RPM detection sensitivity
        • iii. Estimate base-calling accuracy with varied concentrations
          • 1. Annotate any errors
      • c. Culture-based validation schema
        • i. Titration of virus
          • 1. Efficiency of nucleic acid isolation
          • 2. Chip hybridization sensitivity/specificity
            • a. Total amplification sensitivity/specificity
            • b. PCR comparison
          • 3. Chip hybridization sensitivity from titrated culture
          • 4. Sequence validation of culture sequence
      • d. Spiked pathogens into complex media
        • i. Titration of virus into solution
        • ii. Hybridization to chip (background interference)
        • iii. Sequence validation of virus if different than culture pathogen
      • e. Estimation of target concentration from complex matrices.
        • i. Nasal wash
        • ii. Cotton swab
          • 1. Nasal swab
          • 2. Throat swab
        • iii. Stabilization of virus in solution
          • 1. Nasal wash
          • 2. Swabs
        • iv. Freeze/thaw effects of virus solution
        • v. Sequence validation of target pathogen
  • The following table (Table 1) represents a preferred (but not limiting) set of pathogens (both viral and bacterial) that may be used within the context of the present invention as designed for the detection and diagnosis of common respiratory pathogens:
    TABLE 1
    Microarray Pathogens
    Viral Pathogens Bacterial Pathogens
    Adenovirus (Serotypes/Genus level) Streptococcus pyogenes (emm
    types/resistance)
    Influenza A and B (strains) Mycoplasma pneumoniae
    Coronavirus/SARS Bordetella pertussis
    Parainfluenza
    1,2,3,4 Chlamydia pneumoniae
    Respiratory Syncitial Virus Streptococcus pneumoniae
    Metapneumovirus Legionella (genus level)
    Rhinoviruses Moraxella catarrhalis
    Coxsackie virus Haemophilus influenza
    Echoviruses Neisseria meningitidis
    West Nile Virus Mycobacterium tuberculosis
    Varicella (HHV-3) Staphylococcus aureus
    Hantaviruses Arcanobacterium hemolyticum
    Rubella, Rubeola Chlamydia psittaci
    Herpes simplex types 1 and 2
    Enteroviruses (mumps, polio)
    Parvovirus
  • For the intended use of a broadly distributed respiratory diagnostic device with built-in surveillance capability for agents of bioterrorism, the list of pathogens chosen for inclusion onto the chip would also include those selected from the U.S. Centers for Disease Control (CDC) Category A, B, and C bioterrorism agents. These are most notably, but not limited to, include:
        • CDC Category A
  • Bacillus anthracis (targets: lethal factor, protective antigen)
  • Yersinia pestis
  • Smallpox (variola major)
  • Francisella tularensis
  • Viral hemorrhagic fevers (filoviruses [e.g. Ebola, Marburg] and arenaviruses [e.g. Lassa, Machupo]
  • CDC Category B
  • Brucella abortus (2308 B37), Brucella melitensis (F6145), Brucella suis (A44)
  • Burkholderia mallei (Glanders)
  • Burkholderia pseudomallei (Meliodosis)
  • Psittacosis (Chlamydia psittaci)
  • Typhus fever (Rickeusia prowazekii)
  • Viral encephalitis (alphaviruses [e.g., Venezuelan equine encephalitis, eastern equine encephalitis, western equine encephalitis])
  • CDC Category C
  • Emerging infectious diseases such as Nipah virus and hantavirus
  • A complete and updated listing of these agents may be found on the CDC website (http://www.cdc.gov/).
  • For purposes of illustration of the present invention, two resequencing microarray chips (RPMV1 and RPMV2) will be described herein below:
  • Resequencing Respiratory Pathogen Microarray Version 1 (RPMV1 Chip)
  • RPMV1 was made using a high-density Affymetrix microarray fabrication process having an individual probe feature size of 18×18 microns. At this density, 29.7 kb of total pathogen target sequence was tiled for resequencing. The fabrication was performed as part of a pre-production beta-test of an Affymetrix commercial product (CustomSeq) that was intended for SNP detection in an arbitrary collection of sequences.
  • The following overall design strategy was used for the RPMV1:
  • The Affymetrix CustomSeq design protocol was followed. While there were a variety of ongoing efforts within the project consortium to non-specifically amplify targets for microarray analysis, the present inventors made every effort to tile sequences on the array that could interrogate conventional (specific primer pair) PCR amplicons. Whenever possible, primer pairs were developed or adapted for conserved sequences that flanked the variable regions to be interrogated with tiled microarray probe sets. This allowed for the ability to: (1) directly amplify with an existing hardware platform (e.g. RAPID Light Cycler, Idaho Technologies), (2) provide control measurements for comparison with generic or total amplification strategies that are on the immediate horizon. In general, our strategy was to match the hybridization patterns with specific strains of organisms and to detect subtle variations in sequence that corresponds to pathogenicity and drug resistance.
  • Adenovirus (double-stranded DNA virus) types 4, 5, and 7 were designated as “prototypes” for the E, C and B subgroups, respectively. Specifically, the present inventors postulated that resequencing on the prototype-tiled regions would allow detection and identification of subtle sequence variations between the subgroup members. Three target gene regions were selected, specifically from E1A, hexon, and fiber genes. However, it was not postulated nor anticipated which regions or which sections of any of the tiles would allow unique identification.
  • Thirteen adenovirus genomes were completely sequenced as part of the Epidemic Outbreak Surveillance program. The names, accession numbers, and sources for these are listed in Table 6 of the Examples section. Multiple sequence alignments were performed to determine variable regions of the E1A, hexon, and fiber genes that were flanked by conserved regions that could be used to amplify multiple adenoviruses with a single set of degenerate primers (Lin et al., 2004). These common regions for E1A, hexon, and fiber genes were obtained for each of the 3 prototype adenoviruses that are associated with respiratory illness: 7 (subgroup B), 5 (subgroup C), and 4 (subgroup E) were submitted to Affymetrix as part of the 29.7 kb total pathogen target sequence for tiling on the RPMV1 microarray.
  • Adenovirus Taxonomy:
  • Sub-Group B: 3, 7, 11, 14, 21, 34,-35 and 50
  • Sub-Group C: 1, 2, 5, and 6
  • Sub-Group E: 4
  • The present inventors made the hypothesis that if they tiled three genes (E1A, Fiber and Hexon) on the array for prototype sub-group representatives, types 7, 5, and 4 (for subgroups B, C, and E, respectively), they would be able to identify any of the fully-sequenced types (listed above) by variations in the hybridization patterns that map to their sequence differences.
  • Influenza A and B viruses, which are negative-polarity single stranded RNA viruses (ssRNA), were represented with prototype regions for hemagglutinin (HA) neuraminidase (NA) and matrix (M). These genes were represented for three types of Influenza A (H1N1, H3N2 and H5N1) and Influenza B. Influenza is one of the best examples of a prototype model system, as hundreds, if not thousands of influenza strains have been at least partially sequenced, and most have been sequenced for the hemagglutinin and neuraminidase segments.
  • Prototype Influenza HA, NA and M genes were chosen from strains that were either identical of closely related to the three vaccine strains recommended for the Northern hemisphere by the World Health Organization;
      • A/New Caledonia/20/99/(H1N1)
      • A/Moscow/10/99/(H3N2)
      • B/Hong Kong/330/2001
  • These sequences were publicly available from the Los Alamos National Laboratory influenza Internet database. The present inventors postulated that the sequence calls made for unknown Influenza A or B on the prototype tile regions would allow the identification of that target if it was sufficiently similar to allow similarity search-based querying.
  • The remainder of RPMV1 was populated with tiles for a variety of common respiratory pathogens, the first set being viruses:
      • Rhinovirus A (pos)SSRNA
      • Rhinovirus B (pos)SSRNA
      • Coronavirus (pos)SSRNA; no DNA stage
      • Parainfluenza (neg)SSRNA
      • RSV (neg)SSRNA
  • These viral pathogens had relatively little sequence available compared to adenovirus and influenza, complicating efforts to perform analogous tests for use of prototype sequences to identify a large number of related strains.
  • Common bacterial pathogens were also chosen:
      • Streptococcus pyogenes
      • Mycoplasma pneumoniae
      • Bordetella pertussis
      • Chlamydia pneumoniae
      • Streptococcus pneumoniae
      • Neisseria meningitidis
  • In addition, the following plasmid-conferred antibiotic resistance genes were represented on the RPMV1 chip:
      • ermA
      • ermB
      • ermTR
      • macrolide-efflux determinant (mef)A
  • The following biological threat agents were also included on the RPMV1 chip:
      • Bacillus anthracis (targets: lethal factor, protective antigen)
      • Yersinia pestis
      • Smallpox (variola major)
      • Francisella tularensis
      • Viral hemorrhagic fevers (filoviruses [e.g. Ebola, Marburg] and arenaviruses [e.g.
  • Lassa, Machupo])
  • In addition to the hybridization controls prescribed by Affymetrix (see CustomSeq protocol), it was considered necessary to include internal process controls to verify target isolation, reverse transcription (RT) and cDNA/DNA amplification. Thus, we included a specialized vector containing gene inserts from the plant Arabidopsis thaliana (Yang et al., 2002) and provided tile regions on the array for several genes inserts from that vector.
  • For all targets other than adenovirus and influenza, the present inventors selected targets from the open literature (e.g., NCBI GenBank) for genes containing diagnostic (via PCR) regions and tiled that diagnostic region or a larger coding region containing that region. The full listing of all target genes, PCR primer sites, and primers for the RPMV1 are shown in Table 8 (infra) and the attached Sequence Listing. The sequences submitted for tiling and chip fabrication are summarized in Table 7 (infra) and the attached Sequence Listing.
  • However, the present invention is not limited to the specific sequences and/or microorganisms (bacteria or virus) listed above. It is well within the purview of the skilled artisan to tailor the “pathogen chip” to meet the particular requirements of the intended field test. Such tailoring may be on a gene-level or on a microorganism level. Clearly, the artisan would be greatly assisted in the efforts by the general protocol above.
  • Resequencing Microarray Chip Version 2 (RPMV2 Chip)
  • RPMV2 is built on a high-density Affymetrix microarray having an intended feature size of 8×8 microns. At this density, approximately 300 kb of target sequence information may be tiled for resequencing.
  • The general layout strategy described in Tables 2-4 (infra). The RPM V2 design allowed for roughly 10 times the sequence content of the RPMV1, and thus allowed inclusion of a large number of pathogens, which included expanded representations of all the pathogens present on the RPMV1, numerous other respiratory pathogens, and virtually the entire set of CDC Category A, B, and C bioterrorism agents. The full listing of the RPMV2 content is provided in Example 8. The RPMV2 design expanded molecular epidemiology capability by enabling inclusion of probes, such as the emm types for Streptococcus pyogenes. This feature will provide the epidemiologist/public health professional an ability to determine a likely index disease case and to study transmission of the typed pathogen in enclosed populations (ails, dormitories, nursing homes, military barracks, etc.). These probes may also predict pathogen virulence and clinical presentation of disease in the population.
  • The number of pathogens represented can also be expanded with increasing probes per unit area of microarray. The chips of the present invention take advantage of high feature density to simultaneously probe and discriminate among a large number of candidate pathogens that may be present in a single clinical specimen.
  • It is also important to note that gene expression markers can conceptually be tiled onto the array in the same manner as genomic markers. Thus, sequences representing pathogen transcripts (RNA templates coding for protein synthesis) can be simultaneously positioned on arrays with those allowing resequencing of genomic markers. This would enable the microarray to detect not only the presence of a pathogen, but would also allow determination of viability, since transcriptional markers would only be present in intact pathogens.
    TABLE 2
    RPMV2 layout (Name)
    Respiratory
    Pathogen
    Name
    BT Agent Name Species/Sub- Species/Sub- Genus/
    (CDC A; B; C) species species Species/Sub-species Species Rx Res
    Adenovirus
    Subgroup A Hexon Fiber E1A
    Subgroup B1
    Adenovirus 3 Hexon Fiber E1A
    Adenovirus 7 Hexon Fiber E1A
    Adenovirus 16 Hexon Fiber E1A
    Adenovirus 21 Hexon Fiber E1A
    Subgroup B2
    Adenovirus 11 Hexon Fiber E1A
    Adenovirus 35 Hexon Fiber E1A
    Subgroup C
    Adenovirus 1 Hexon Fiber E1A
    Adenovirus 2 Hexon Fiber E1A
    Adenovirus 5 Hexon Fiber E1A
    Adenovirus 6 Hexon Fiber E1A
    Subgroup D
    Subgroup E
    Adenovirus 4 Hexon Fiber E1A
    Subgroup F Hexon Fiber E1A
    Influenza
    Influenza A Hemagglutinin 1 Neuraminidase 1 Neuraminidase 1 Matrix
    (Full) (Full) (H5N1)
    Hemagglutinin 2 Neuraminidase 2
    (Full)
    Hemagglutinin 3 Neuraminidase 3
    (Full)
    Hemagglutinin 4 Neuraminidase 4
    Hemagglutinin 5 Neuraminidase 5
    Hemagglutinin 6 Neuraminidase 6
    Hemagglutinin 7 Neuraminidase 7
    Hemagglutinin 8 Neuraminidase 8
    Hemagglutinin 9 Neuraminidase 9
    Hemagglutinin 10
    Hemagglutinin 11
    Hemagglutinin 12
    Hemagglutinin 13
    Hemagglutinin 14
    Hemagglutinin 15
    Influenza B Hemagglutinin B Neuraminidase B Matrix
    Influenza C Hemagglutinin- Matrix
    esterase
    Parainfluenza
    Parainfluenza 1 Hemagglutinin- Matrix
    neuraminidase
    Parainfluenza 2 Hemagglutinin- Matrix
    neuraminidase
    Parainfluenza 3 Hemagglutinin- Matrix
    neuraminidase
    Parainfluenza 4A Hemagglutinin- Matrix
    neuraminidase
    Rhinovirus 5′ NCR HRV 5′ NCR HRV21 5′ NCR HRV29 5′ NCR 5′ NCR
    9501468 HRV HRV62
    9501821
    5′ NCR HRV1A 5′ NCR HRV58 5′ NCR HRV14 5′ NCR
    HRV87
    Coronavirus
    SARS Membrane Nucleocapsid Spike Matrix
    Glycoprotein
    O43 Hemagglutinin- Nucleocapsid Spike
    esterase
    229E Surface Nucleocapsid Spike
    Glycoprotein
    Respiratory
    Syncitial
    Virus
    Type 1 (RSV A) Nucleocapsid Matrix
    Type 2 (RSV B) Nucleocapsid Matrix
    Streptococcus
    Streptococcus emm
    1 ST2035 ST4529L ST4532 ST4264 ST4547 GyrA Erm(A); Erm
    pyogenes (B);
    Erm(TR);
    MefA;
    MefE;
    prtF1; put.
    Rx resist
    prot.; tet(O)
    emm 75 emm13L ST3018 U92492 STI4973 STCMUK16
    ST2267 U50338 ST2980 ST230-2 ST436
    ST448L ST3365 ST1135 ST1161 ST1432
    ST6949 ST1160
    emm1 emm2 emm3 emm4 emm5
    emm6 emm7 emm8 emm9 emm10
    emm11 emm12 emm13 emm14 emm15
    emm16 emm17 emm18 emm19 emm20
    emm21 emm22 emm23 emm24 emm25
    emm26 emm27 emm28 emm29 emm30
    emm31 emm32 emm33 emm34 emm35
    emm36 emm37 emm38 emm39 emm40
    emm41 emm42 emm43 emm44 emm45
    emm46 emm47 emm48 emm49 emm50
    emm51 emm52 emm53 emm54 emm55
    emm56 emm57 emm58 emm59 emm60
    emm61 emm62 emm63 emm64 emm65
    emm66 emm67 emm68 emm69 emm70
    emm71 emm72 emm73 emm74 emm75
    emm76 emm77 emm78 emm79 emm80
    emm81 emm82 emm83 emm84 emm85
    emm86 emm87 emm88 emm89 emm90
    emm91 emm92 emm93 emm94 emm95
    emm96 emm97 emm98 emm99 emm100
    emm101 emm102 emm103 emm104 emm105
    emm106 emm107 emm108 emm109 emm110
    U74320
    Csr R & Csr S sic SpeB
    Streptococcus ponA (Pbp1A) GyrA GyrB; ParC
    pneumoniae
    Staphylococcus entQ entK tst seb GyrA MSR(A);
    aureus mecR1;
    VanA;
    BlaZ; dfrA;
    qacC
    Mycoplasma P1 gene GyrA
    pneumoniae
    Bordetella pertussis Pertussis toxin PrnA
    Chlamydia
    Chlamydia OmpB DNA
    peumoniae Gyrase
    Chlamydia psittaci OmpA SigA
    Neisseria MviN GyrA
    menIngitidis
    Bacillus
    Bacillus anthracis protective antigen rpoB lethal factor adema GyrA
    factor
    (Cya)
    Bacillus cereus rpoB
    Bacillus cry rpoB
    thuringensis
    Bacillus subtillus rpoB
    rpoB
    Yersinia pestis OmpA cve2155 sequence GyrA
    Smallpox (variola Hemagglutinin SOD Chemo-
    major) kine
    binding
    protein
    Monkeypox Hemagglutinin IA
    Varicella Hemagglutinin
    Francisella TUL4 Region of mdh
    tularensis Difference (RD1)
    Filoviridae
    Ebola L gene NP Protein
    Marburg L gene NP Protein
    Arenaviridae
    Lassa L protein NP Protein
    Machupo L protein NP Protein
    Burkholderia
    Burkholderia mallei PenA WaaF
    (Glanders)
    Burkholderia PenA WaaF
    pseudomallei
    (Meliodosis)
    Burkholderia recA
    cepacia
    Typhus fever Omp1 GyrA ermB
    (Rickettsia
    prowazekii)
    Alphaviruses
    Venezuelan equine nonstructural nucleocapsid
    encephalitis polyprotein proteins
    Eastern equine nonstructural nucleocapsid
    encephalitis polyprotein proteins
    Western equine nonstructural nucleocapsid
    encephalitis polyprotein proteins
    Brucella Omp25 Omp2 RB51_WBOA_IS711J
    INSERT
    Brucella abortus (2308
    B37)
    Brucella melitensis
    (F6145)
    Brucella suis (A44) GyrA
    Brucella canis
    Brucella ovis
    Brucella neotoma
    Arcanobacterium 16S rRNA pld
    hemolyticum
    Haemophilus OmpP5 (OmpA- GyrA
    Influenzae family)
    Moraxella hemagglutinin GyrA
    catarrhalis
    Mycobacterium Omp A GyrA
    tuberculosis
    Clostridium
    Clostridium Ntnh Bont
    botulinum
    Clostridium TmpC Epsilon Toxin GyrA
    perfringens
    Clostridium tetani L & H chain
    Coxiella burnetii TolC GyrA
    Cryptosporidium Sod CP2
    parvum
    E. coli 0157:H7 Omp A Shiga Toxin I Shiga Toxin II GyrA
    Ricinus communis Ricinus communis
    toxin
    Salmonella
    Salmonella enterica OmpA GyrA
    Salmonella OmpA precursor
    typhimurium
    Shigella
    Shigella dysenteriae OmpA
    Shigella flexneri OmpA GyrA
    Vibrio cholerae OmpA CtxA & CtxB GyrA
    Nipah virus Nucleocapsid Matrix
    Hantavirus
    Sin Nombre Nucleocapsid Glycoprotein
    Legionella MompS GyrA
    pneumophilia
    Histoplasma M antigen H antigen
    capsulatum
    Blastomyces WI-1 bys1
    dermatiditis
    Coccidioides bg12 Ag2
    immitis
    Varicella
    Varicella HHV-6 major capsid Major antigenic
    protein structural protein
    Varicella HHV-3 major capsid immediate early
    protein transactivator
    Epstein-Barr Virus major capsid immediate early
    protein transactivator
    Corynebacterium
    Corynebacterium Dtx gene GyrA
    diphtheriae
    Enterovirus (genus) Enterovirus
    Coxsackie Coxsackie
    (subgroup)
    Echo (subgroup) Echovirus
    Polio (subgroup) Poliovirus
    Paramyxoviridae
    Paramyxoviridae Hemagglutinin Matrix
    morbillivirus
    (Rubeola)
    Newcastle Hemagglutinin- Matrix
    Neuraminidase
    West Nile Virus Envelope Nonstructural
    protein 5
    Yellow Fever Envelope Nonstructural
    protein 5
    Metapneumovirus Nucleocapsid Matrix
    Norwalk Virus RNA-dependent Nucleocapsid
    RNA polymerase
    Dengue Virus capsid protein © pre-M protein
    Foot & Mouth VPI gene 3D gene
    St. Louis polyprotein NS5
    Encephalitis
    Rift Valley Fever nucleoprotein nonstructural
    protein
    Usutu polyprotein
    tsutsugamushi fever GroEL tsa
    Chandipura G Glycoprotein Matrix
    Man-made Insertion Bluescript II (KS+) pUC pGEM
    Sequences
    Multiple Cloning
    Sites
    Rx Resistance
    Markers
  • TABLE 3
    RPMV2 layout (Accession Number)
    Respiratory Pathogen Species/Sub- Species/Sub- Species/Sub- Species/Sub- Species/Sub-
    Name species species species species species Genus/Species Rx Res
    BT Agent Name (CDC
    A; B; C)
    Adenovirus
    Subgroup A NC_001460 NC_001460 NC_001460
    Subgroup B1
    Adenovirus 3 AF542129 AY224415 AF492352
    Adenovirus 7 X76551 Z48954 AY495969
    Adenovirus 16 X74662 U06106
    Adenovirus 21 AB053166 U06107 AF492353
    Subgroup B2
    Adenovirus 11 AF532578 L08232 BK001453
    Adenovirus 35 AB052912 AB098563 AY128640
    Subgroup C
    Adenovirus
    1 AF534906 AB108423 AF534906
    Adenovirus 2 AY224391 AY224410 BK000407
    Adenovirus 5 AF542130 AY224411 AY147066
    Adenovirus 6 X67710 AB108424 E1A
    Subgroup D NC_002067 NC_002067 NC_002067
    Subgroup E
    Adenovirus
    4 X84646 X76547 E1A
    Subgroup F NC_001454 NC_001454 NC_001454
    Influenza Crieria: Human;
    Swine; Avian (Newest 1st)
    Influenza A AJ344014 AJ518092 AY526746 AJ458301
    (vaccine)
    L11125 U42776
    ISDN38157 AY300947
    (vaccine)
    ISDN13277 K01030
    (vaccine)
    AF285885
    AY526745 M24740
    AJ507203 AF285887
    AY338459 AY340079
    AF310988 AY300948
    AY294658 AY180830
    AF311750
    AF310986
    AF310990
    M26089
    M35997
    L43916
    Influenza B AB126838 AY139074 AB036877
    Influenza C AB093473 AB086809
    Parainfluenza
    Parainfluenza
    1 NC_003461 NC_003461
    Parainfluenza 2 NC_003443 NC_003443
    Parainfluenza 3 AY283063 NC_001796
    Parainfluenza 4A E02727 E03809
    Rhinovirus AF108164 AF108180 AF542420 AF542420 AF108184
    AF108179 AF108183 AF108186 AF108187
    Coronavirus
    SARS AY323974 AY365036 AY429079 AY390556
    OC43 M76373 NC_005147 L14643
    229E NC_002645 X51325 X16816
    Respiratory Syncitial
    Virus
    Type 1 (RSV A) AF035006 AF035006
    Type 2 (RSV B) AF013254 AF013254
    Streptococcus emm source
    Streptococcus pyogenes ST2035 ST4529L ST4532 ST4264 ST4547 AE006557 Erm(A);
    AY357120;
    Erm(TR);
    U70055; MefE;
    prtF1;
    AE006513
    emm13L ST3018 U92492 STI4973 STCMUK16
    ST2267 U50338 ST2980 ST230-2 ST436
    ST448L ST3365 ST1135 ST1161 ST1432
    ST6949 ST1160
    emm1 emm2 emm3 emm4 emm5
    emm6 emm7 emm8 emm9 emm10
    emm11 emm12 emm13 emm14 emm15
    emm16 emm17 emm18 emm19 emm20
    emm21 emm22 emm23 emm24 emm25
    emm26 emm27 emm28 emm29 emm30
    emm31 emm32 emm33 emm34 emm35
    emm36 emm37 emm38 emm39 emm40
    emm41 emm42 emm43 emm44 emm45
    emm46 emm47 emm48 emm49 emm50
    emm51 emm52 emm53 emm54 emm55
    emm56 emm57 emm58 emm59 emm60
    emm61 emm62 emm63 emm64 emm65
    emm66 emm67 emm68 emm69 emm70
    emm71 emm72 emm73 emm74 emm75
    emm76 emm77 emm78 emm79 emm80
    emm81 emm82 emm83 emm84 emm85
    emm86 emm87 emm88 emm89 emm90
    emm91 emm92 emm93 emm94 emm95
    emm96 emm97 emm98 emm99 emm100
    emm101 emm102 emm103 emm104 emm105
    emm106 emm107 emm108 emm109 emm110
    U74320
    U11966 AF095713 AY229859 AB051298
    Streptococcus X67867 AY157689 GyrB; ParC
    pneumoniae
    Staphylococcus aureus U93688 U93688 U93688 M11118 D10489 AF467080;
    AF142100;
    AE017171
    Mycoplasma AF290002 X53555
    pneumoniae
    Bordetella pertussis M13223 AJ507642 BX640413 (codon
    286253)
    Chlamydia
    Chlamydia pneumoniae X53511 AB103388
    Chlamydia psittaci AF269281 U04442
    Neisseria meningitidis AE002384 AE002487
    Bacillus
    Bacillus anthracis AF306783 AF205335 M29081 M24074 AY291534
    Bacillus cereus AF205342
    Bacillus thuringensis AF278797 AF205349
    Bacillus subtillus AF205356 X02369 (orf 821)
    Yerslnia pestis NC_003143 AF350077 AE013898
    Smallpox (variola major) L22579 L22579 L22579
    Monkeypox
    Varicella
    Francisella tularensis M32059 AF469619 AF513319
    Filoviridae
    Ebola NC_004161 NC_004161
    Marburg NC_001608 NC_001608
    Arenaviridae
    Lassa NC_004297 NC_004296
    Machupo NC_005079 NC_005078
    Burkholderia
    Burkholderia mallei AY032868 AY124769
    (Glanders)
    Burkholderia AY032869 AF097748
    pseudomallei (Meliodosis)
    Burkholderia cepacia U70431
    Typhus fever (Rickettsia AJ235270 AJ235270 (codon AJ235270
    prowazekii) 250672)
    Alphaviruses
    Venezuelan equine L04653 L04653
    encephalitis
    Eastern equine NC003899 NC003899
    encephalitis
    Western equine NC003908 NC003908
    encephalitis
    Brucella Consensus Consensus Consensus
    Brucella abortus (2308
    B37)
    Brucella melitensis
    (F6145)
    Brucella suis (A44) AE014411
    Brucella canis
    Brucella ovis
    Brucella neotoma
    Arcanobacterium X73952 L16583
    hemolyticum
    Haemophilus influenzae L20309 U32806
    Moraxella catarrhalls AY077637 AF056196
    Mycobacterium BX842574 AE006915
    tuberculosis
    Clostridium
    Clostridium botulinum Y13630 X62683
    Clostridium perfringens AP003191 X60694 AP003185
    Clostridium tetani X04436
    Coxiella burnetil AE016960 AE016960
    Cryptosporidium AF529280 AY471868
    parvum
    E. coli 0157:H7 AE005582 AB083044 AB048837 NC_002655
    Ricinus communis X52908
    Salmonella
    Salmonella enterica AL627269 AE016836 (codon
    70224)
    Salmonella typhimurium AE008746
    Shigella
    Shigella dysenteriae V01344
    Shigella flexneri AE015125 AE016986
    Vibrio cholerae AF030977 Gary Custom NC_002505
    Nipah virus NC_002728 NC_002728
    Hantavirus
    Sin Nombre NC_005216 L33474
    Legionella AF078136 AY091594
    pneumophilia
    Histoplasma AF026268 U20346
    capsulatum
    Blastomyces S63772 AF277079
    dermatiditis
    Coccidioides immitis AF022893 U32518
    Varicella
    Varicella HHV-6 NC_001664 NC_001664
    Varicella HHV-3 NC_001348 NC_001348
    Epstein-Barr Virus NC_001345 NC_001345
    Corynebacterium
    Corynebacterium A04646 BX248354
    diphtheriae
    Enterovirus (genus) NC_001612
    Coxsackie (subgroup) AF499635
    Echo (subgroup) NC_003986
    Polio (subgroup) NC_002058
    Paramyxoviridae
    Paramyxoviridae AY523581 NC_001498
    morbillivirus (Rubeola)
    Newcastle AY510092 NC_002617
    West Nile Virus AF346319 AF208017
    Yellow Fever AY359908 AF013417
    Metapneumovirus AY145272 AY145271
    Norwalk Virus NC_001959 NC_001959
    Dengue Virus NC_001474 NC_001474
    Foot & Mouth NC_004004 NC_004004
    St. Louis Encephalitis AY289618 AF013416
    Rift Valley Fever X53771 X53771
    Usutu AF452643
    tsutsugamushi fever AY191589 AY283180
    Chandipura J04350 AF128868
    Man-made Insertion Stratagene X06404 X65312
    Sequences Provided
    Multiple Cloning Sites
    Rx Resistance Markers
  • TABLE 4
    RPMV2 layout (Size)
    Respiratory Pathogen
    Name
    BT Agent Name Species/Sub- Species/Sub-
    (CDC A; B; C) species species Species/Sub-species Genus/Species Rx Res
    Adenovirus
    Subgroup A 836 860 597
    Subgroup B1
    Adenovirus 3 685 829 880
    Adenovirus 7 605 829 880
    Adenovirus 16 673 906
    Adenovirus 21 759 637 819
    Subgroup B2
    Adenovirus 11 629 1025 789
    Adenovirus 35 641 711 789
    Subgroup C
    Adenovirus 1 667 802 870
    Adenovirus 2 789 698 870
    Adenovirus 5 684 826 1055
    Adenovirus 6 785 578
    Subgroup D 644 783 579
    Subgroup E
    Adenovirus 4 2811 1375 616
    Subgroup F 828 659 909
    Influenza
    Influenza A
    1692 1459 575 734
    757 1410
    1042 804
    1323 257
    303 865
    839 691
    770 946
    849 795
    553 444
    727
    680
    690
    813
    715
    745
    Influenza B 737 761 715
    Influenza C 401 862
    Parainfluenza
    Parainfluenza 1 1649 910
    Parainfluenza 2 1646 693
    Parainfluenza 3 1581 498
    Parainfluenza 4A 638 807
    Rhinovirus 508 499 338 503 501
    511 504 520 506
    Coronavirus
    SARS 666 1269 3768 666
    OC43 828 557 1042
    229E 753 789 1393
    Respiratory Syncitial
    Virus
    Type 1 (RSV A) 907 958
    Type 2 (RSV B) 554 826
    Streptococcus
    Streptococcus pyogenes 675 425 713 661 340 815 Erm(A);
    763; 732;
    563;
    MefE;
    prtF1
    200 316 371 415 680
    413 384 401 688 350
    355 554 619 475 664
    650 635
    325 360 391 337 490
    437 emm7 emm8 509 emm10
    500 364 emm13 439 652
    emm16 187 emm18 381 emm20
    emm21 620 258 421 561
    936 317 333 328 265
    339 299 328 340 emm35
    410 270 481 369 340
    488 408 306 391 emm45
    315 331 489 485 287
    423 499 414 293 405
    389 338 391 433 452
    325 334 429 538 640
    528 335 526 566 440
    300 256 328 306 451
    353 450 415 322 354
    432 497 421 324 448
    404 420 346 379 483
    393 363 403 516 408
    358 357 351 372 340
    350 354 emm103 emm104 emm105
    emm106 emm107 emm108 emm109 emm110
    533
    292 904 1008 681
    Streptococcus pneumoniae 1237 815 GyrB;
    ParC
    Staphylococcus aureus 771 729 705 713 821 400; 652;
    1032;
    846; ##;
    ##
    Mycoplasma pneumoniae 2526 809
    Bordetella pertussis 824 730 815
    Chlamydia
    Chlamydia pneumoniae 982 824
    Chlamydia psittaci 991 835
    Neisseria meningitidis 856 941
    Bacillus
    Bacillus anthracis 551 777 638 985 732
    Bacillus cereus 777
    Bacillus thuringensis 805 777
    Bacillus subtillus 780 812
    Bacillus globigii
    Yersinia pestis 913 517 812
    Smallpox (variola major) 942 378 762
    Monkeypox 764
    Varicella
    Francisella tularensis 786 3322 960
    Filoviridae
    Ebola 752 758
    Marburg 1170 799
    Arenaviridae
    Lassa 973 703
    Machupo 1540 715
    Burkholderia
    Burkholderia mallei 1117
    (Glanders)
    Burkholderia pseudomallei 1117 1100
    (Meliodosis)
    Burkholderia cepacia 563
    Typhus fever (Rickettsia 985 968 1560
    prowazekii)
    Alphaviruses
    Venezuelan equine 923 1512
    encephalitis
    Eastern equine 1312 975
    encephalitis
    Western equine 878 902
    encephalitis
    Brucella 582 2428 1291
    Brucella abortus (2308
    B37)
    Brucella melitensis (F6145) 995
    Brucella suis (A44)
    Brucella canis
    Brucella ovis
    Brucella neotoma
    Arcanobacterium 1489 1111
    hemolyticum
    Haemophilus influenzae 937 896
    Moraxella catarrhalis 653 321
    Mycobacterium 932 818
    tuberculosis
    Clostridium
    Clostridium botulinum 499 1000
    Clostridium perfringens 1113 572 810
    Clostridium tetani 1138
    Coxiella burnetii 1851 812
    Cryptosporidium parvum 375 2304
    E. coli 0157: H7 660 948 960 812
    Ricinus communis 1133
    Salmonella
    Salmonella enterica 904 812
    Salmonella typhimurium 904
    Shigella
    Shigella dysenteriae 907
    Shigella flexneri 898 812
    Vibrio cholerae 942 984 887
    Nipah virus 858 1359
    Hantavirus
    Sin Nombre 639 1293
    Leglonella pneumophilla 1157 236
    Histoplasma capsulatum 919 1082
    Blastomyces dermatiditis 942 912
    Coccidioides Immitis 965 1234
    Varicella
    Varicella HHV-6 890 1236
    Varicella HHV-3 822 781
    Epstein-Barr Virus 971 1317
    Corynebacterium
    Corynebacterium 913 818
    diphtheriae
    Enterovirus (genus) 1758
    Coxsackie (subgroup) 920
    Echo (subgroup) 1277
    Polio (subgroup) 1226
    Paramyxoviridae
    Paramyxoviridae 1854 1008
    morbillivirus (Rubeola)
    Newcastle 1734 1232
    West Nile Virus 1504 917
    Yellow Fever 1547 1035
    Metapneumovirus 1185 765
    Norwalk Virus 961 712
    Dengue Virus 300 498
    Foot & Mouth 633 799
    St. Louis Encephalitis 679 1035
    Rift Valley Fever 738 798
    Usutu 1035
    tsutsugamushi fever 546 1011
    Chandipura 704 755
    Man-made Insertion 2961 3914 2912
    Sequences
    Multiple Cloning Sites
    Rx Resistance Markers

    Chip Size 293826
  • The sequences submitted for RPMV2 tiling and chip fabrication were based on the Affymetrix instruction file summarized in Table 5, which corresponds to the sequences appearing as SEQ ID NOs: 59-421.
    TABLE 5
    RPMV2 Affymetrix instructions file for tiling and chip
    fabrication
    SEQ
    ID
    Name Alias Start End NO: StartSeq EndSeq
    ATTIM1 ATTIM1 1 523 59 ACATCGAC GAGCTTGC
    Ad3E1A Ad3E1A 1 879 60 TGAGACAC GGCAATGA
    Ad3HEXON Ad3HEXON 1 595 61 CCAGCACA CATGTGGT
    Ad3FIBER Ad3FIBER 1 746 62 AAGCGGCT AACCCTCA
    Ad7E1A Ad7E1A 1 868 63 TGAGACAC AAACTGCC
    Ad7HEXON Ad7HEXON 1 513 64 CCAGCACA TGCTGACG
    Ad7FIBER Ad7FIBER 1 977 65 TGACCAAG ACGACTGA
    Ad7NAVYE1A Ad7NAVYE1A 1 879 66 ATGAGACA AGGCAATA
    Ad7NAVYHEXON Ad7NAVYHEXON 1 504 67 CCAGCACA TGCTGACG
    Ad7NAVYFIBER Ad7NAVYFIBER 1 975 68 TGGCTTTA CCCCACGC
    Ad16E1A Ad16E1A 1 878 69 TGAGACAC GGCAATGA
    Ad16HEXON Ad16HEXON 1 667 70 CGTTGACC AGGACACC
    Ad16FIBER Ad16FIBER 1 652 71 GGGAGATG AGGAAGCC
    Ad21EIA Ad21E1A 1 878 72 TGAGACAC GACAATGA
    Ad21HEXON Ad21HEXON 1 807 73 CGCCACAG GTGTACAA
    Ad21FIBER Ad21FIBER 1 685 74 GCTCAGTG CCTTTATG
    Ad11E1A Ad11E1A 1 872 75 TGAGAGAT GACAATAA
    Ad11HEXON Ad11HEXON 1 677 76 CGCCACAG TCAGAAAG
    Ad11FIBER Ad11FIBER 1 977 77 TGACCAAG ACGACTGA
    Ad35E1A Ad35E1A 1 872 78 TGAGAGAT GACAATAA
    Ad35HEXON Ad35HEXON 1 689 79 CGCCACAG TGAAAAAA
    Ad35FIBER Ad35FIBER 1 971 80 TGACCAAG ACAACTAA
    Ad1E1A Ad1E1A 1 986 81 TGAGACAT GGCCATAA
    Ad1HEXON Ad1HEXON 1 715 82 AGTGGTCT TGCTACGG
    Ad1FIBER Ad1FIBER 1 750 83 GATGCTGT AAGAATAA
    Ad2E1A Ad2E1A 1 983 84 TGAGACAT GGCCATAA
    Ad2HEXON Ad2HEXON 1 837 85 AGTGGTCT CGACCGGC
    Ad2FIBER Ad2FIBER 1 750 86 ATAGCTAT AGGAATAA
    Ad5E1A Ad5E1A 1 985 87 TGAGACAT GGCCATAA
    Ad5HEXON Ad5HEXON 1 732 88 AGTGGTCT TGTAAAGC
    Ad5FIBER Ad5FIBER 1 747 89 ACAGCCAT AAGAATAA
    Ad6E1A Ad6E1A 1 985 90 TGAGACAT GGCCATAA
    Ad6HEXON Ad6HEXON 1 833 91 GAATGAAG AATTGGGA
    Ad6FIBER Ad6FIBER 1 750 92 TCCTCAAA CAGAAAAT
    Ad4E1A Ad4E1A 1 865 93 TGAGGCAC GGCATTAA
    Ad4HEXON Ad4HEXON 1 2810 94 TGGCCACC CCACATAA
    Ad4FIBER Ad4FIBER 1 1277 95 TGTCCAAA AACAATAA
    Ad4AFE1A Ad4AFE1A 1 832 96 TGAGGCAC GACATTAA
    Ad4AFHEXON Ad4AFHEXON 1 2810 97 TGGCCACC CCACATAA
    Ad4AFFIBER Ad4AFFIBER 1 1277 98 TGTCCAAA AAGAATAA
    Ad12E1A Ad12E1A 1 597 99 ATGAGAAC GGAGGTGA
    Ad12HEXON Ad12HEXON 1 884 100 CCTACTTC TGCAAGAC
    Ad12FIBER Ad12FIBER 1 908 101 CAGCAGAA CGTTGCCG
    Ad17E1A Ad17E1A 1 579 102 ATGAGACA GAGGCTGA
    Ad17HEXON Ad17HEXON 1 692 103 CTTCAGCC GAAGAATA
    Ad17FIBER Ad17FIBER 1 829 104 TCCTGTCA TATCAGCC
    Ad40E1A Ad40E1A 1 824 105 CTTGAGTG ATAGAAGA
    Ad40HEXON Ad40HEXON 1 876 106 CGCAATGG TAATTACA
    Ad40FIBER Ad40FIBER 1 707 107 CACTGACA TCAGTGTC
    FluAHA1 FluAHA1 1 1692 108 ATGAAAGC GAATATGC
    FluAHA2 FluAHA2 1 805 109 AAGGTCGA TTTGGGAG
    FluAHA3 FluAHA3 1 1042 110 CAAAAACT AATGGTGG
    FluAHA4 FluAHA4 1 1371 111 AGGAAATC GACAAAGG
    FluAHA5 FluAHA5 1 303 112 ATGCCCCA TTTAACAA
    FluAHA6 FluAHA6 1 887 113 CCGTCACA GACTAAGA
    FluAHA7 FluAHA7 1 818 114 AAATCCTG TGGGAATT
    FluAHA8 FluAHA8 1 897 115 CTCTTGGC GCAAACCC
    FluAHA9 FluAHA9 1 601 116 ACTCCACA CCAAGGCC
    FIuAHA10 FluAHA10 1 775 117 CCTGGAGC GTATGGTT
    FluAHA11 FluAHA11 1 728 118 CTGCATTC AGAGGCAA
    FluAHA12 FluAHA12 1 738 119 CACTGTTC GGCCAAAC
    FluAHA13 FluAHA13 1 1765 120 AGCAAAAG TTTCTACT
    FluAHA14 FluAHA14 1 763 121 CACAAATG CAAGAGGC
    FLuAHA15 FluAHA15 1 793 122 ACGGAGAC CCCTTTGC
    FIuANA1-1 FluANA1-1 1 1459 123 CAAAAGCA TTTCTACT
    FluANA1-2 FluANA1-2 1 575 124 TGCCATGA ATGATTTG
    FluANA2 FluANA2 1 1062 125 TCATGCGA TTTTAGAA
    FluANA3 FluANA3 1 852 126 GCCCTTTC TGAAGTCA
    FluANA4 FluANA4 1 257 127 AGCAAAAG CAGCCCCC
    FluANA5 FluANA5 1 913 128 CGGTGAGA GCGGGAAG
    FluANA6 FluANA6 1 739 129 AGAGGATG TTGCATTC
    FluANA7 FluANA7 1 994 130 AGGAGGGT ACACCAGC
    FluANA8 FluANA8 1 843 131 CAATACAG ATTAGCAG
    FluANA9 FluANA9 1 444 132 AACCTGAA GTCAATAT
    FluAH1N1MATRIX FluAH1N1MATRIX 1 734 133 ATGGAATG TAAACACG
    FluAH5N1MATRIX FluAH5N1MATRIX 1 657 134 AGACCAAT TTGCACTT
    FluBHA FluBHA 1 785 135 GGGAAGTC AGGTAATA
    FluBNA FluBNA 1 809 136 GCCCTCAT CTCGAACG
    FluBMATRIX FIuBMATRIX 1 763 137 GGAGAAGG ATGGCTTG
    FIuCHA FluCHA 1 401 138 CTTCTTGC ATGATCAT
    FluGMATRIX FluCMATRIX 1 862 139 ATGTCCGA TTATATAA
    PIV1HN PIV1HN 1 1728 140 ATGGCTGA CATCTTGA
    PIV1MATRIX PIV1MATRIX 1 958 141 CCGGAGAA CAGTAGAA
    PIV1NC PIV1NC 1 1682 142 AGGGTTAA AAGAAAAA
    PIV2HN PIV2HN 1 1716 143 ATGGAAGA TACCTTAA
    PIV2MATRIX PIV2MATRIX 1 741 144 CTTGCCTC CAGGTCGG
    PIV2NC PIV2NC 1 1849 145 AGATTCGG AGAAAAAA
    PIV3HN PIV3HN 1 1725 146 ATGGAATA AATCATAA
    PIV3MATRIX PIV3MATRIX 1 544 147 CCAACAAA CCTGGCGA
    PIV3NC PIV3NC 1 1548 148 ATGTTGAG GCAACTAA
    PIV4HN PIV4HN 1 686 149 GACGGGAG AAAGATTG
    PIV4MATRIX PIV4MATRIX 1 855 150 GGAACGGT TTGGCTCA
    HRV14NCR HRV14NCR 1 520 151 TGATGTAC GTTTCTCA
    HRV1ANCR HRV1ANCR 1 511 152 TTCCGGTA GTTTCACT
    HRV21NCR HRV21NCR 1 499 153 TTCCGGTA GTTTCACT
    HRV29NCR HRV29NCR 1 676 154 CGAAAACA TTGGGTGT
    HRV58NCR HRV58NCR 1 504 155 TCACGGTA GTTTCCTG
    HRV62NCR HRV62NCR 1 501 156 TTCCGGTA GTTTCACT
    HRV87NCR HRV87NCR 1 506 157 TCTTGGTA GTTTCACT
    HRV95NCR HRV95NCR 1 508 158 TTCCGGTA GTTTCTTG
    RSVABL RSVABL 1 379 159 AAGTGCTC AAGCAAAC
    RSVAMATRIX RSVAMATRIX 1 958 160 GGGGCAAA ATAAAAAA
    RSVANC RSVANC 1 955 161 TCCAACGG CCGAGGAA
    RSVBMATRIX RSVBMATRIX 1 770 162 ATGGAAAC GAGGATTA
    RSVBNC RSVBNC 1 602 163 GATGGGAG TACGCCAA
    HCV229ESPIKE HCV229ESPIKE 1 1534 164 GTTGATTG GCCGTGGT
    HCV229EMEM HCV229EMEM 1 678 165 ATGTCAAA TTTTCTAA
    HCV229ENC HCV229ENC 1 924 166 ATGGCTAC GTCACATT
    HCVOC43SPIKE HCVOC43SPIKE 1 1456 167 ATTGATTG GCCTTGGT
    HCVOC43MEM HCVOC43MEM 1 693 168 ATGAGTAG ATATCTAA
    HCVOC43NC HCVOC43NC 1 966 169 AGAGCTCA GTACACTT
    SARSSPIKE SARSSPIKE 1 1438 170 GTAGATTG GCCTTGGT
    SARSMEM SARSMEM 1 666 171 ATGGCAGA TACAGTAA
    SARSNC SARSNC 1 932 172 ATGGGGCA ACAAAGAT
    HCVNL63SPIKE HCVNL63SPIKE 1 1534 173 GTTGATTG GCCTTGGT
    HCVNL63ORF3 HCVNL63ORF3 1 678 174 ATGCCTTT TTAATTGA
    HCVNL63MEM HCVNL63MEM 1 681 175 ATGTCTAA TAATCTAA
    HCVNL63NC HCVNL63NC 1 879 176 ATGGCTAG GTGAGGTT
    MPVMATRIX MPVMATRIX 1 765 177 ATGGAGTC CCAGATAA
    MPVNC MPVNC 1 1185 178 ATGTCTCT ATGAGTAA
    HHV1L HHV1L 1 1061 179 TACCAGGG AAGCGCCT
    HHV1CAPSID HHV1CAPSID 1 993 180 CGGGCGCC GTGGGCGT
    HHV3L HHV3L 1 1061 181 TATAAAGG CGTCGCTT
    HHV3CAPSID HHV3CAPSID 1 993 182 CGGGAGCC ATGGGCAT
    HHV4L HHV4L 1 1067 183 TACCAGGG ACCCAGAT
    HHV4CAPSID HHV4CAPSID 1 992 184 CGCCGACA CTGGGCAT
    HHV5L HHV5L 1 1136 185 TACCAGGG TCTAACCT
    HHV5CAPSID HHV5CAPSID 1 998 186 CGCGCAGC CTGGGCCT
    HHV6L HHV6L 1 1058 187 TACAAAGG CCGAATCT
    HLHV6CAPSID HHV6CAPSID 1 1001 188 CGCGCAGC TTGGGCAT
    ENTEROVIRUS ENTEROVIRUS 1 1758 189 CACCAATG GATAGATA
    COXSACKIEVIRUS COXSACKIEVIRUS 1 920 190 CAATGCAA TCTTGAGG
    ECHO ECHO 1 1277 191 CACTTGCC ACAAAGAG
    POLIO POLIO 1 1226 192 TGGATAGT ACTTATGT
    POLIO1NCR POLIO1NCR 1 436 193 CAAGCACT TGACAATC
    POLIO2NCR POLIO2NCR 1 437 194 CAAGCACT TGACAATC
    POLIO3NCR POLIO3NCR 1 437 195 CAAGCACT TGACAATC
    MEASLESHA MEASLESHA 1 1854 196 ATGTCACC GCGGATAG
    MEASLESMATRIX MEASLESMATRIX 1 1008 197 ATGACAGA TTCTGTAG
    NEWCASTLEHN NEWCASTLEHN 1 1734 198 ATGGACCG CTGGCTAG
    NEWCASTLEMATRIX NEWCASTLEMATRIX 1 1232 199 ACGGGTAG CATCAAGT
    WNE WNE 1 1504 200 TTCAACTG GCACGCTG
    WNNS WNNS 1 917 201 GGCTGCTG GGGAAGGA
    WNCM WNCM 1 432 202 GGCCAATA TGATCCAG
    YFE YFE 1 1547 203 CTGCATTG TAGAGACT
    YFNS YFNS 1 1035 204 AAGCTGTC AGGGAGAG
    VMVG3R VMVG3R 1 762 205 ATGAAACA GTGTCTGA
    VMVHA VMVHA 1 942 206 ATGACACG AAGTCTAG
    VMVSOD VMVSOD 1 378 207 ATGGCTGT GCGTTTGA
    VMVCRMB VMVCRMB 1 291 208 TCGGGAAC CGTCTGTT
    MONKEYPOX MONKEYPOX 1 812 209 GTGAATGC TTTCGACG
    EBOLAL EBOLAL 1 800 210 AGTTGGAC GAAACACG
    EBOLANP EBOLANP 1 806 211 AGGAGTAA CGACAATC
    EBOLAMATRIX EBOLAMATRIX 1 1498 212 GATGAAGA AAGAAAAA
    MARBURGL MARBURGL 1 1218 213 GCGGCACT CAATTGAC
    MARBURGNP MARBURGNP 1 847 214 TCACAGAA GTCATTTG
    LASSAL LASSAL 1 1021 215 GCATCTGG ACTACCTC
    LASSANP LASSANP 1 751 216 ATGGAGTG AGTTCAGG
    LASSAGP LASSAGP 1 1476 217 ATGGGACA AGAGATGA
    MACHUPOL MACHUPOL 1 1588 218 GTGGCTGA GAGGCTAA
    MACHUPONP MACHUPONP 1 763 219 TTGAAGAC GGCACTAT
    MACHUPOG MACHUPOG 1 1491 220 ATGGGGCA GACATTAA
    VEEVNS VEEVNS 1 923 221 GACAGCCC AAAGTGAC
    VEEVNC VEEVNC 1 1512 222 GGCCACCT AGCATATC
    EEEVNS EEEVNS 1 1312 223 GAGATAGA ATTGCGTC
    EEEVNC EEEVNC 1 975 224 CCTGACTT TCAGCTAT
    WEEVNS WEEVNS 1 878 225 CGTATGTC CCACAATG
    WEEVNC WEEVNC 1 902 226 TGTTCTAG TGGCGACT
    NIPAHMATRIX NIPAHMATRIX 1 1359 227 AGGAGACA ACAAAAAA
    NILPAHN NIPAHN 1 858 228 AGGAATCT CAATCAGC
    SINNOMBREOP SINNOMBREGP 1 1293 229 ATAGCTGG GGATGGAT
    SINNOMBRENG SINNOMBRENG 1 639 230 TCACTCTC TGTGATTG
    NORWALKL NORWALKL 1 739 231 TTCTCCAT ATTCGTAA
    NORWALKCAPSID NORWALKCAPSID 1 760 232 TGGTACCG CTGGATGG
    DENGUECAPSID DENGUECAPSID 1 300 233 ATGAATGA GACGTAGA
    DENGUEM DENGUEM 1 498 234 TTTCATCT CAATGACA
    DENGUE1NCR DENGUE1NCR 1 157 235 GGTTAGAG GCTGTCTC
    DENGUE2NCR DENGUE2NCR 1 159 236 GGTTAGAG GCTGTCTC
    DENGUE3NCR DENGUE3NCR 1 156 237 GGTTAGAG GCTGTCTC
    DENGUE5NCR DENGUE5NCR 1 162 238 GGTTAGAG GCTGTCTC
    FMDVVP1 FMDVVP1 1 633 239 ACCACCTC CAAAACAG
    FMDV3D FMDV3D 1 846 240 GTTGATCG ACGGAGCA
    SLEVNS5 SLEVNS5 1 1035 241 AAGACTGG AGGGTGAG
    SLEVPP SLEVPP 1 727 242 CTCGGTAG GTTTCACG
    RVFVN RVFVN 1 738 243 ATGGACAA CAGCCTAA
    RVFVNS RVFVNS 1 798 244 ATGGATTA TTGATTAG
    USUTUPP USUTUPP 1 1035 245 AAGCTCGG CAGGTGAG
    JEVPP JEVPP 1 1035 246 AAGCCTGG AAGGAGAG
    CHANDIPURAMATRIX CHANDIPURAMATRIX 1 755 247 AACAGAAA GAAAAAAA
    CHANDIPURAGP CHANDIPURAGP 1 752 248 ATCACTCT GTAGTTGT
    ATTIM2 ATTIM2 1 523 249 ACATCGAC GAGCTTGC
    ATTIM3 ATTIM3 1 523 250 ACATCGAC GAGCTTGC
    SPYEMM1 SPYEMM1 1 398 251 GCTTCAGT CAGGCAAG
    SPYEMM2 SPYEMM2 1 360 252 GCATCCGT GAGAAGTC
    SPYEMM3 SPYEMM3 1 391 253 ACGGCTTC GGAATATC
    SPYEMM4 SPYEMM4 1 337 254 AGCATCAG GTCAATAT
    SPYEMM5 SPYEMM5 1 490 255 ACTGCATC AAAAGATA
    SPYEMM6 SPYEMM6 1 437 256 TACTGCAT CTTAAAAA
    SPYEMM9 SPYEMM9 1 509 257 CAGGTACA CTGCTCTT
    SPYEMM11 SPYEMM11 1 500 258 GCATCCGT AATCACCA
    SPYEMM12 SPYEMM12 1 364 259 GCTTCAGT AAATGATG
    SPYEMM13L SPYEMM13L 1 325 260 CAGCATCC AAAAATCA
    SPYEMM18 SPYEMM18 1 524 261 ACTGCTTC GAAGAACA
    SPYEMM22 SPYEMM22 1 620 262 GCATCAGT GACGCAAG
    SPYEMM28 SPYEMM28 1 333 263 CAGCATCC AGAACGTC
    SPYEMM29 SPYEMM29 1 328 264 TGCATCAG AAGAACAG
    SPYEMM44 SPYEMM44 1 391 265 CAGCATCA CAAGAACA
    SPYEMM61 SPYEMM61 1 325 266 GCATCAGT AGAACGTC
    SPYEMM75 SPYEMM75 1 451 267 TCCGTAGC AAGCCGTG
    SPYEMM77 SPYEMM77 1 450 268 GCTCAGTA AGCTGAGC
    SPYEMM89 SPYEMM89 1 378 269 CATCAGTA AGAAAAGC
    SPYEMM94 SPYEMM94 1 516 270 GCATCAGT CAGACGCA
    SPYCSR SPYCSR 1 952 271 TGGTCCTA CCCAGGCT
    SPYSFB1 SPYSFB1 1 615 272 AGAACCTG GGCATGAG
    SPYSPEB SPYSPEB 1 729 273 ACTCTACC TATCGATG
    SPNGYRA SPNGYRA 1 815 274 GAGGATTT ACTGATAC
    SPNLYTA SPNLYTA 1 125 275 TATCGAAC CTCAGACC
    SPNPLY SPNPLY 1 99 276 GGTTTGGC ATCAAGAT
    SAUGYRA SAUGYRA 1 821 277 GAAGACTT ACTAATGC
    SAUTST SAUTST 1 705 278 ATGAATAA TTAATTAA
    SAUENTK SAUENTK 1 729 279 ATGAAAAA CGATATAA
    SAUENTQ SAUENTQ 1 771 280 ATGCCTAT CTGAATAA
    CPNGYRA CPNGYRA 1 824 281 GAAGACAT TCGAGTCA
    CPNOMPB CPNOMPB 1 1030 282 GCGAAGCT TCAGGTCC
    CPNMOMPVD4 CPNMOMPVD4 1 150 283 ATGCTGAT TCAGATCA
    CPNMOMPVD2 CPNMOMPVD2 1 133 284 AGCGTTCA TAGGCGCT
    CPNRPOB CPNRPOB 1 346 285 AAGGACTT CTGCAGGC
    CPSOMPA CPSOMPA 1 991 286 GGAACCCA TCGATTCA
    CPSSIGA CPSSIGA 1 883 287 CGCAAGCT GGTTCAGC
    CDIDTX CDIDTX 1 913 288 GACGTGGT TTCTCCGG
    CDIGYRA CDIGYRA 1 818 289 GAAGACCT ACCTCCGC
    CDIDTXR CDIDTXR 1 1124 290 AATGAGTG GCGCCTGT
    HINGYRA HINGYRA 1 896 291 GAAGATTT ACTGATGC
    HINOMPA HINOMPA 1 937 292 GCGTTAAA CCAGACCG
    LPNGYRA LPNGYRA 1 236 293 GATGTCGG GACCGTCG
    LPNMOMPS LPNMOMPS 1 1157 294 GTCCTTAC TCATTAGA
    MCAGYRA MCAGYRA 1 321 295 AACTGGAA AGATTCCC
    MCAHA MCAHA 1 653 296 GATCAATC AATGGTCA
    MTUGYRA MTUGYRA 1 818 297 GAGGATTT ACTTCCGG
    MTUOMPA MTUOMPA 1 932 298 GACGAACT TCAACTAA
    MTURPOB MTURPOB 1 411 299 TACGGTCG ACGCCGTA
    MPNGYRA MPNGYRA 1 809 300 GAGGACTT TCTTCAGC
    MPNP1 MPNP1 1 2570 301 CAGTTGCA ACGCGAGC
    NMEGYRA NMEGYRA 1 941 302 GAAGACCT ACCAGCGG
    NMEMVIN NMEMVIN 1 904 303 GATGAATA ATACGGAA
    NMECTRA NMECTRA 1 135 304 TTGGATGC TTTTGCTG
    NMECRGA NMECRGA 1 254 305 GGTGCTGC TGCCGGTC
    AHE16S AHE16S 1 1489 306 CGAACGCT CCGGAAGG
    AHEPLD AHEPLD 1 1111 307 GCAAAGTG CTCCTTTT
    BANGYRA BANGYRA 1 732 308 GAAGACTT AGACTTGT
    BANLEF BANLEF 1 685 309 ATATCGAG CTAGGTGC
    BANPAG BANPAG 1 599 310 CAGAAGTG GGATAGCG
    BANRPOB BANRPOB 1 777 311 TAGTTCGC AGGGGATA
    BANCYA BANCYA 1 545 312 GCGATGAT CTGTCGAG
    BANCAPB BANCAPB 1 246 313 TTACACGT ACCTATTA
    BCERPOB BCERPOB 1 777 314 TAGTTCGC AGGGGATA
    BSUGYRA BSUGYRA 1 812 315 GAAGATCT ACAGCTAG
    BSURPOB BSURPOB 1 780 316 TTGTTCGG AGGCGACA
    BTHCRY BTHCRY 1 853 317 AGAACACA ATCGCATC
    BTHRPOB BTHRPOB 1 777 318 TAGTTCGC AGGGGATA
    BPEGYRA BPEGYRA 1 815 319 GAAGACCT ACCACCGG
    BPEPRNA BPEPRNA 1 777 320 GGTTCAAG CGCCGACA
    BMEGYRA BMEGYRA 1 995 321 GAAGACCT TCGGATGG
    BABRB51 BABRB51 1 1339 322 ATCCCATA AGCTAGTA
    BABOMP25 BABOMP25 1 630 323 AAGTCTCT AGTTCTAA
    BABOMP2 BABOMP2 1 1434 324 TGTTCTTC GAGAGCAG
    BCAOMP2 BCAOMP2 1 1434 325 TGTTCTTC GAGAGCAG
    BMEOMP2 BMEOMP2 1 1434 326 TGTTCTTC GAGAGCAG
    BNEOMP2 BNEOMP2 1 1434 327 TGTTCTTC GAGAGCAG
    BOVOMP2 BOVOMP2 1 1449 328 TGTTCTTC GAGAGCAG
    BSUIOMP2 BSUIOMP2 1 1434 329 TGTTCTTC GAGAGCAG
    BMAPENA BMAPENA 1 1117 330 GAGAGCTG AAGGTTCA
    BMAWAAF BMAWAAF 1 1015 331 CGTTGGTT GGGATGCT
    BPSPENA BPSPENA 1 1117 332 GAGAGCTG AAGGTTCA
    BPSWAAF BPSWAAF 1 1100 333 AGCGCGGC GTCCGCGG
    BCEPRECA BCEPRECA 1 611 334 CATGGAAG CAACCAGA
    CPEGYRA CPEGYRA 1 810 335 GAAGACTT ATAAATAG
    CPETMPC CPETMPC 1 1113 336 ATGAAAAA TAAATTAA
    CBUGYRA CBUGYRA 1 812 337 GAAGATTT AGTGATAA
    CBUTOLC CBUTOLC 1 745 338 ATTTAGAC CTAGGAAA
    FTURD1A FTURD1A 1 531 339 ATGAAAAA CAATTTAG
    FTURD1B FTURD1B 1 285 340 ATGGCTTT TAGACTAG
    FTUTUL4 FTUTUL4 1 834 341 GGCGAGTG CCAACCAC
    FTUMDH FTUMDH 1 960 342 ATGGCTAG CAAAATAA
    FTU13KD FTU13KD 1 431 343 ATCGTAAT TAAGTATG
    FTUFOPA FTUFOPA 1 111 344 CAGATATA GATACTAC
    OTSGROEL OTSGROEL 1 546 345 GTTGAAGT AAGAAAAA
    OTSSTA56 OTSSTA56 1 1059 346 CTAGTGCA AGCAGTAG
    RPRGYRA RPRGYRA 1 968 347 GAAGATTT ACAAATAG
    RPROMP1 RPROMP1 1 985 348 TATATAAA ACAAGCTA
    YPEGYRA YPEGYRA 1 812 349 GAAGACCT ACTGATGC
    YPEOMPA YPEOMPA 1 913 350 GTGGTAAA CCAGATCG
    YPECVE YPECVE 1 517 351 GTACAGAT TGAGGTAC
    YPECAF1 YPECAF1 1 525 352 TATGAAAA ATATAGAT
    ACAHAG ACAHAG 1 1082 353 GGTTGCGC TGCTCTCG
    ACAMAG ACAMAG 1 919 354 CCGTCTGT GTCATGTA
    ACAGH17 ACAGH17 1 810 355 ACACAGCA AAAAAAAA
    BDEWI-1 BDEWI-1 1 942 356 GGATCCAT TTTTTGTG
    BDEBYS1 BDEBYS1 1 912 357 ATGCATCT ATGATAAC
    CIMAG2 CIMAG2 1 1234 358 CTCTCCCT TTTTGTTA
    CIMBG12 CIMBG12 1 965 359 ATAGAGGG GAAACGAT
    CPACP2 CPACP2 1 735 360 CTGAGGAA TTCAAAAA
    CPASOD CPASOD 1 375 361 TTGAATTC GTGATGTA
    ECOGYRA ECOGYRA 1 812 362 GAAGATCT ACCGATGC
    ECOOMPA ECOOMPA 1 660 363 ATGAAGAA CGCTGTAA
    SENGYRA SENGYRA 1 812 364 GAAGATCT ACGGATGC
    SENOMPA SENOMPA 1 904 365 GTGCTAAA CCGGATCG
    SDYOMPA SDYOMPA 1 907 366 GTGCTAAA CCGGATCG
    SFLGYRA SFLGYRA 1 812 367 GAAGATCT ACCGATGC
    SFLOMPA SFLOMPA 1 898 368 GTGCTAAA CCGGATCG
    VCHGYRA VCHGYRA 1 887 369 GAAGAGCT ACCAATGC
    VCHOMPA VCHOMPA 1 942 370 ATGAAAAA TCCCTGAA
    MSRA MSRA 1 400 371 GCAAATGG ATCACATG
    MECR1 MECR1 1 652 372 ATGGAGGT GAATCGAT
    MEFA MEFA 1 611 373 AATATGGG ACTACGGC
    ERMTR ERMTR 1 732 374 ATGAAACA TTCAATAA
    ERMB ERMB 1 763 375 GATGTATC GGAAATAA
    EMRB EMRB 1 1560 376 ATGCCAAA TTCACTAA
    GYRB GYRB 1 1947 377 ATGACAGA ATGTCTAA
    PARC PARC 1 2637 378 GAGTTTGC AATATAAG
    PARE PARE 1 2008 379 AAAATTTT TGTTTTAA
    PBP1 PBP1 1 1282 380 TTCGACCA ACGAGCTA
    PBP5 PBP5 1 668 381 TGACGATC AACGAGCA
    MECA MECA 1 729 382 ATCGATGG ATGAATAA
    BLAZ BLAZ 1 846 383 TTGAAAAA AATTTTAA
    DFRA DFRA 1 486 384 ATGACATT GGAAATAG
    VANA VANA 1 1032 385 ATGAATAG AGGGGTGA
    QACC QACC 1 324 386 ATGCCTTA CGCATTAA
    RMTB RMTB 1 756 387 ATGAACAT ATGGATAA
    STRA STRA 1 804 388 TTGAATCG GGGGTTGA
    STRB STRB 1 837 389 ATGTTCAT CATACTAG
    AADA1 AADA1 1 792 390 ATGAGGGA GCAAATAA
    SULII SULII 1 816 391 ATGAATAA TTCGTTAA
    CTXM CTXM 1 436 392 CAAGAAGA ATGGCACC
    KPC2 KPC2 1 918 393 CGTTGATG CCACCACC
    AMPC AMPC 1 1140 394 ATGAAAAA TGGAATAA
    BLACMY2 BLACMY2 1 1146 395 ATGATGAA TGCAATAA
    AMPR AMPR 1 876 396 ATGGTCAG CGGCGTAA
    SULI SULI 1 840 397 ATGGTGAC ATGCCTAG
    AACAAPHD AACAAPHD 1 1440 398 ATGAATAT AAGATTGA
    FLOR FLOR 1 1215 399 ATGACCAC TCGTCTAA
    TETM TETM 1 536 400 CACGCCAG CGGAAATG
    TETC TETC 1 502 401 TATCGTCC CAGTCAGC
    TETS TETS 1 555 402 GCTACATT GGCATTCA
    TETA TETA 1 494 403 TGGCATTC GCTATACG
    TETG TETG 1 550 404 CTCGGTGG GGCTTTGC
    TETL TETL 1 548 405 CTGGGTGA ATTCCTGA
    TETB TETB 1 571 406 AGTGCTGT TCCAAGCC
    PTX PTX 1 872 407 ATCACTAC CAGGAGCT
    BONT BONT 1 792 408 TGATGGAA TTCTACGG
    NTNH NTNH 1 496 409 AATATTTG AATATGGT
    BOTE BOTE 1 1000 410 GATAAAAT TAACTATG
    EPSILON EPSILON 1 620 411 ATGCGAAA GGAGGAGC
    TETANUS TETANUS 1 1185 412 CCTGATAA CTAACGGA
    STX1A STX1A 1 948 413 ATGAAAAT GCAGTTGA
    STX2A STX2A 1 960 414 ATGAAGTG GTAAATAA
    RICINUSTOXIN RICINUSTOXIN 1 1133 415 ATGGTCCA CATCGGAT
    CTXAB CTXAB 1 984 416 CGGGCAGA CCTGAGGA
    PBLUEVEC PBLUEVEC 1 236 417 CTGCAGGA TGCGTTGC
    PGEMVEC PGEMVEC 1 226 418 GAATATGC TGCGTTGC
    PUCVEC PUCVEC 1 252 419 AGACAGTT TGCGTTGC
    ATTIM4 ATTIM4 1 523 420 ACATCGAC GAGCTTGC

    Sample Preparation
  • In any embodiment of the present invention, the target nucleic acids (DNA and/or RNA) may be contained within a biological sample. The term “biological sample”, as used herein, refers to a sample obtained from an organism or from components (e.g., cells) of an organism. The sample may be of any biological tissue or fluid. Alternatively, the sample may be one taken from the environment (air, soil or water). Frequently the sample will be a “clinical sample” which is a sample derived from a patient. Such samples include, but are not limited to, sputum, nasal wash, nasal aspirate, throat swab, blood, blood cells (e.g., white cells), tissue or fine needle biopsy samples, urine, peritoneal fluid, visceral fluid, and pleural fluid, or cells therefrom. Within the context of the present invention it is preferred that the clinical sample be a nasal wash, nasal aspiration or a throat swab. In a particularly preferred embodiment the clinical sample is a nasal wash. Biological samples may also include sections of tissues such as frozen sections taken for histological purposes, or from non-human animal sources, plants, or environmental sources such as water, air, or soil.
  • In order to be detected using microarrays, the target nucleic acids may require some degree of processing. For the intended purposes, this will involve one or more of the following target processing steps: (1) isolation, (2) enrichment for target sequences of interest, (3) amplification, (4) labeling, and (5) hybridization. Preferred embodiments corresponding to each of these processing strategies are described below; however, the present invention is not intended to be limited thereto. To this end, the skilled artisan would readily appreciate alternative methods corresponding to the aforementioned processing strategies both based on those commonly in use and as described in U.S. Pat. No. 6,638,717, U.S. Pat. No. 6,376,191, U.S. Pat. No. 5,759,778, U.S. Pat. No. 6,268,133, and U.S. Pat. No. 6,613,516 (each of which are incorporated herein by reference in its entirety).
  • Target Nucleic Acid Isolation
  • In an embodiment of the present invention, the target nucleic acids (RNA and/or DNA) to be assayed are isolated prior to amplification of the same. Methods of isolating nucleic acids are well known to the skilled artisan.
  • In a preferred embodiment, the target nucleic acid isolation may be performed using a MasterPure™ DNA Purification Kit (Epicentre Technologies, Madison, Wis.) ethanol purification method (per manufacturer's instructions). In another preferred embodiment, the target nucleic acids will be isolated using a rapid microcentrifuge technique, as in the use of Xtra Amp Kit (XTRANA, Inc. Broomfield, Colo.). In yet another preferred embodiment, the nucleic acids will be isolated using an automated device for said purpose, such as a GeneXpert (Cepheid, Sunnyvale, Calif.) or using a robot for magnetic bead-based isolation (e.g. Qiagen or Beckman).
  • A variety of other commercial products are available that are geared towards purification and concentration of nucleic acids from complex matrices. In addition to the methods described above and in the invention, alternatives include:
  • QIAamp DNA Mini Kit (Qiagen)
  • (For Purification of Genomic, Mitochondrial, Bacterial, Parasite, or Viral DNA)
  • The QIAamp DNA Mini Kit simplifies isolation of DNA from human tissue samples with fast spin-column or vacuum procedures. DNA binds specifically to the QIAamp silica-gel membrane while contaminants pass through. PCR inhibitors such as divalent cations and proteins are completely removed in two efficient wash steps, leaving pure DNA to be eluted in either water or a buffer provided with the kit. QIAamp DNA technology yields genomic, mitochondrial, bacterial, parasite, or viral DNA from human tissue samples ready to use in PCR and blotting procedures.
  • RNeasy Mini Kit (Ambion)
  • The RNeasy Mini Kit allows efficient purification of total RNA from very small amounts of tissue or cells. Total RNA is easily purified from animal cells or tissues, Gram-positive or Gram-negative bacteria, or yeast. RNeasy technology simplifies total RNA isolation by combining the stringency of guanidine-isothiocyanate lysis with the speed and purity of silica gel-membrane purification.
  • UltraClean™ Tissue DNA Kit (Mo Bio Laboratories, Inc.)
  • Fresh or frozen tissue samples are homogenized using bead-beating technology to lyse the cells. Lysates are loaded onto a silica spin filter. During a brief spin, the DNA selectively binds to the silica membrane while contaminants pass through. Remaining contaminants and enzyme inhibitors are removed by a wash step. Pure DNA is then eluted into certified, DNA-free Tris buffer.
  • UltraClean™ Tissue RNA Kit (Mo Bio Laboratories, Inc.)
  • Prepared fresh or frozen tissues are homogenized using a tissue homogenizer or mortar and pestle in the presence of lysis solutions. The RNA is captured on a silica membrane spin filter while contaminants are passed through the filter by centrifugation. The filter is washed to remove any remaining contaminants and salts. The RNA is then eluted into certified RNase-free water (provided). RNA is of high quality and is ready for any downstream applications.
  • Wizard® Genomic DNA Purification Kit (Promega)
  • The Wizard® Genomic DNA Purification Kit is designed for isolation of DNA from white blood cells, tissue culture cells and animal tissue, plant tissue, yeast, Gram-positive and Gram-negative bacteria. The Wizard® Genomic DNA Purification Kit is based on a four-step process. The first step in the purification procedure lyses the cells and the nuclei. For isolation of DNA from white blood cells, this step involves lysis of the red blood cells in the Cell Lysis Solution, followed by lysis of the white blood cells and their nuclei in the Nuclei Lysis Solution. An RNase digestion step may be included at this time; it is optional for some applications. The cellular proteins are then removed by a salt precipitation step, which precipitates the proteins but leaves the high molecular weight genomic DNA in solution. Finally, the genomic DNA is concentrated and desalted by isopropanol precipitation.
  • SV Total RNA Isolation System (Promega)
  • The SV Total RNA Isolation System provides a fast and simple technique for the preparation of purified and intact total RNA from tissues, cultured cells and white blood cells using this membrane-based purification system. The system incorporates a DNase treatment step directly on the membrane of the minicolumn. Purification is achieved without the use of phenol:chloroform extractions or ethanol precipitations, and there is no DNase carryover in the final RNA preparation.
  • RNAqueous Technology (Ambion, Inc.)
  • RNAqueous kits can be used to purify total RNA from many different tissues and cells. Cells or tissue are disrupted in a guanidinium thiocyanate solution; this chaotropic agent effectively lyses cells and inactivates endogenous ribonucleases. The lysate is then diluted with an ethanol solution and applied to an RNA-binding glass fiber filter. Proteins, DNA and other contaminants are removed in three rapid washing steps, and the bound RNA is then eluted in concentrated form.
  • Nucleic Acid Isolation Robotics
  • In addition to those methods described above, several vendors (e.g. PSS BIO Instruments, Roche Diagnsotics, Qiagen, Caliper) manufacture both small (benchtop) and/or high-throughput liquid handling robots and associated reagents that can be used instead of the manual methods described above. In a preferred embodiment, one or more such robots and their associated reagensts will be used to automatically isolate nucleic acids for the subsequent processing (background removal and amplification).
  • Target Amplification
  • One set of technical challenges for pathogen detection with microarrays arises because of the difficulty in obtaining samples with a sufficient quantity of pathogen nucleic acids. Thus, for a majority of sample types, some sort of amplification will likely be required to provide sufficient copies of pathogen gene markers for detection by microarray hybridization. Multiplex PCR as a microarray preparative step is practically limited to tens of different primer pairs, not thousands, and increasing numbers of primer pairs give rise to varying numbers of spurious amplicons. However, discrimination occurs when the labeled amplicons are required to hybridize to specific probes on the array surface and, fortuitously, spurious amplicons may not detected by the microarray assay (Chizhikov et al., 2001).
  • Multiplex PCR
  • Conserved (degenerate) multiplex PCR serves to reduce the systemic bias introduced with specific PCR protocols by designing a series of primers selected to target the conserved regions flanking species-specific variable regions of a gene(s) to be probed. In the examples of the present application, the strategy for E1A, fiber, and hexon genes has been illustrated; however, the skilled artisan may expand this strategy to target any gene that is conserved across a broad spectrum of species, but still has species-specific variable regions. To this end, candidate genes and the specific regions (conserved and variable) can be readily identified by global or local homology searches (i.e., sequence alignment).
  • Applicants describe below a general strategy for the selection of targets and primer design:
  • As used herein the term “primer” (and generally appreciated in the art) refers to an oligonucleotide that is capable of acting as a point of initiation of polynucleotide synthesis along a complementary strand when placed under conditions in which synthesis of a primer extension product that is complementary to a polynucleotide is catalyzed. Typical polynucleotide synthesis conditions include the presence of four different nucleotide triphosphates or nucleoside analogs and one or more enzyme to catalyze polymerization (e.g., a DNA polymerase and/or reverse transcriptase) in an appropriate buffer (“buffer” includes substituents which are cofactors, or which affect pH, ionic strength, etc.), and at a suitable temperature.
  • To facilitate specific PCR, amplification primers typically range from 13 to 35 nucleotides, preferably from 20 to 25 nucleotides. The nucleotide sequence of the primer must have sufficient sequence complementarity to the target sequence in order to facilitate hybridization. Although the degree of complementarity will depend in large part on the length of the primer, the degree of complementarity generally is at least 80%, preferably at least 90%, more preferably at least 95%.
  • For random PCR protocols, the preferred primer length is from 6 to 10 nucleotides. The sequence would ideally include all permutations of a hexameric (2 permutations) to a decameric (210 permutations).
  • For the case of “prototype” region design, the preferred scenario would be to have conserved primers that flank variable regions of target genes. This was the case in RPMV1 for adenovirus and has been adopted by present inventors for Influenza A (using conserved 3′ and 5′ ends of Influenza A segments for hemagglutinin (HA) neuraminidase (NA) and matrix (M). This concept can be extended to any of a large number of pathogen types because highly conserved regions are ubiquitous in nature and degenerate primers can be designed for those sequences.
  • When targets are not selected as “prototypes”, the amount of real estate on the chip can be greatly reduced compared to prototype regions. The objective in these cases is not necessarily to identify a particular strain or sub-variant of the species, but rather to allow for enough base calls to be made for an unambiguous statistical estimate demonstrating that the sequence corresponds to the pathogen of interest and not to a closely related species or non-virulent strain. With this chip design of multiple, small targets, it is not feasible to design and optimize conditions for the large number of specific PCR reactions that would be needed and total amplification becomes the optimal amplification strategy.
  • Homology, sequence similarity or sequence identity of nucleotide or amino acid sequences may be determined conventionally by using known software or computer programs such as the BestFit or Gap pairwise comparison programs (GCG Wisconsin Package, Genetics Computer Group, 575 Science Drive, Madison, Wis. 53711). BestFit uses the local homology algorithm of Smith and Waterman, Advances in Applied Mathematics 2: 482-489 (1981), to find the best segment of identity or similarity between two sequences. Gap performs global alignments: all of one sequence with all of another similar sequence using the previously described methods (Needleman & Wunsch, 1970). When using a sequence alignment program such as BestFit, to determine the degree of sequence homology, similarity or identity, the default setting may be used, or an appropriate scoring matrix may be selected to optimize identity, similarity or homology scores. Similarly, when using a program such as BestFit to determine sequence identity, similarity or homology between two different amino acid sequences, the default settings may be used, or an appropriate scoring matrix, such as blosum45 or blosum80, may be selected to optimize identity, similarity or homology scores.
  • Targets may also be amplified using a combination of specific PCR reactants in what is referred to as “multiplexed PCR”. In this strategy, PCR primer pairs for all target regions on the RPM are combined into one reaction miture. This is a preferred method in cases where one or more of the pathogens is present in too low a concentration to be detected using random amplification strategies alone (described below).
  • Random Amplification Strategies
  • Despite the sensitivity and specificity associated with PCR amplification, the inherent bias and limited throughput of this approach limits the principal benefits of downstream microarray-based applications. As successful identification depends almost entirely on appropriately chosen primer sets, all PCR-based testing requires a priori knowledge pertaining to the identity of the contaminating organism. As such, there remains a critical need for advanced diagnostic systems that can rapidly screen clinical and environmental samples without bias for specifically anticipated sequences. The advantage of microarray-based detection is that it can combine unbiased (e.g. random) nucleic acid amplification strategies with the subsequent discriminatory capability of microarrays, resulting in high sensitivity, specificity and throughput capacity.
  • The inventors have addressed the aforementioned issues through the use of alternative approaches and have investigated four front-end amplification strategies: random primed, isothermal Klenow polymerase-based, 029 DNA polymerase-based and multiplex PCR (Vora et al., 2004).
  • Klenow-based amplification—The Klenow fragment of DNA polymerase I can be used for isothermal, random amplification of target DNA of unknown sequence with random octamers oligonucleotide primers. For the present invention, this can be performed using the BioPrime® DNA Labeling System (Invitrogen). Biotinylated amplicons are generated (following the manufacturer's recommended labeling protocol with minor modifications). This process is typically performed at 37° C. for 4 hours. Klenow amplification results in some high molecular weight amplification products, but the vast majority of amplicons are 50-450 basepairs (bp) in length. As such, these amplicons are suitable for direct hybridization to DNA microarrays.
  • Random PCR amplification—Random PCR (rPCR) amplicons can be generated using the 2.5× Random Primers Solution and 10× DNTP mix from the Invitrogen BioPrime DNA Labeling System. The reaction components typically include: 1× PCR buffer (Qiagen), 2.5 mM MgCl2, 1× DNTP Mix (containing biotin-14-dCTP), 5 μl of 2.5× random octamers and 5 U Taq DNA polymerase (Qiagen). The amplification reactions are performed using the following conditions for 35 cycles: 94° C. for 30 sec, 26° C. for 2 min, and 72° C. for 1 min.
  • φ29-based amplification—Isothermal φ29 DNA polymerase-based amplification with random hexamers can be performed using the TempliPhi™ 100 Amplification Kit (Amersham Biosciences Corp., Piscataway, N.J.). Biotinylated amplicons are generated following the manufacturer's recommended protocol with minor modifications (14.4 μl amplification reactions contained 0.4 μl enzyme mix and 3 μl of 350 μM biotin-14-dCTP and are incubated at 30° C. for 16 h).
  • The majority of both the rPCR and φ29 DNA polymerase amplification products are too large to migrate into electophoretic gels (>1500 bp). Large amplification products hybridize poorly to immobilized probes on two-dimensional surfaces due to spatial and steric constraints (Vora et al., 2004). Thus, the rPCR and φ29 polymerase amplification products are digested with a DNase I fragmentation buffer to achieve amplicon sizes that are comparable to the Klenow and multiplex amplicons prior to hybridization.
  • Tandem Amplification
  • Increased sensitivity to pathogen targets can be achieved using a combination of the random amplifications strategies described above. Tandem [Klenow+Klenow] and [φ29+Klendow] tandem random amplification strategies can provide better sensitivity to enriched pathogen targets than multiplex PCR. The same random amplification strategies are also able to detect diagnostic genomic targets in spiked environmental water samples containing a 63-fold excess of contaminating DNA (Vora et al., 2004). The results presented underscore the feasibility of using random amplification approaches and begin to systematically address the versatility of these approaches for unbiased pathogen detection from environmental sources.
  • Combination of Target Enrichment and Random Amplification
  • Random amplification methods result in amplification of non-target DNA as well as target DNA. Thus, the inventors describe herein a variety of methods for enrichment of pathogen diagnostic target sequences in advance of random amplification steps. This is especially important to improve sensitivity and/or specificity of detection of analytes in complex matrices such as clinical (e.g. nasal wash or throat swab) or environmental (e.g. water, soil, air collector) samples.
  • Complex samples (clinical and environmental) contain significant, and sometimes overwhelming amounts of unknown genomes and genomes not of interest (non-specific background). One approach to reduce the non-specific background is to expose the nucleic acids to enzymatic processes that selectively digest the background genomic sequences. This process is described below within the examples.
  • Another strategy for reducing non-pathogen genomic content is to use background genomic sequences from a comparable complex sample known to be negative for the organism(s) of interest and use it to directly remove background genomic sequences. Such “subtractive” methods can include: (1) immobilization of the background genomes on solid phase surfaces such as gels or beads, followed by hybridization with the test sample to absorb background genomes from the samples. One can also use unlabeled background genomes during hybridization of targets on microarray to block the effects of non-specific binding due to the labeled background genomes. This blocking approach has the advantage in that it does not require additional steps during assaying. Both such strategies are also described in the Examples section.
  • Alternatively or concurrently, one can also use strategies to selectively enrich for the pathogen target nucleic acids prior to random amplification. One possibility for direct selection (also known as positive selection) from samples is to use immobilized probes on a solid phase support (magnetic beads or gel matrices) to selectively enrich for genomic targets of interest. Ideally, the probes on the solid support should not be detectable on the array, as they would result in false signals in the event that the enrichment molecules are carried over or inadvertently amplified. As such, the probes on the beads should select for target genomes via an adjacent region or slightly overlapping with the region of the analytes' genomes to be queried on the microarray. If there is a slight overlap between the probe sequences and the analytes' sequences that is detectable on the array, then this queried region should be masked out during in silico analysis. In the event that it is desirable that the enrichment probes have homologous sequence to that on the microarray, then those probes should be comprised so as to not undergo subsequent amplification, or be made susceptible to selective enzymatic digestion prior to amplification. One can use combinations of the above and other strategies if necessary according to the specifics of the sample and applications of interest.
  • Alternative Subtraction or Enrichment Methods
  • Immunoprecipitation is another way to enrich the pathogens' nucleic acids. Antibodies for pathogens of interest could be mixed with clinical samples, then precipitated with anti-IgG to pull down pathogens, thereby removing background genomic DNA. This will be of particular importance when it is desirable to correlate specific genomic traits with a single pathogen, such as antibiotic resistance markers or indicators of intentional genetic manipulation.
  • Size exclusion is another method by which to subtract or enrich pathogen DNA. Exemplary size exclusion methods include: gradient centrifugation, column, or centrifugal filter units. Gradient centrifugation or column separation methods are time-consuming and require special set-up in the laboratory. The use of “centrifugal filter units” for separation of high- from low-molecular-weight species suffers from inconsistent and, often, low recovery rates. Each of these methods requires a large volume of starting material. Other size exclusion methods include: flow cytometry or electrophoresis methods, such as fluorescence-activated cell sorting (FACS) or with a special electrophoretic chip used in an Agilent bioanalyzer.
  • General Target Enrichment and Amplification Strategies
  • The present inventors have described methods for subtraction of “normal” human and microbial nucleic acids from nasal wash specimens. This same principle can also be applied to samples of any origin (clinical or environmental) where a representative “normal” mixture of nucleic acids can be collected, pooled, and prepared as a subtractive reagent.
  • A variety of approaches can also be applied to enrich for the pathogens or specific targets that are tiled on the array prior to performing a total amplification strategy. One such approach would use immobilized variants of the sequences that are tiled on the array. These variants would be bound to a solid phase component used for separation (beads, matrices, etc.) and serve to enrich for targets that will be amplified without being amplified themselves. Making the enrichment probes susceptible to enzymatic degradation can do this or they might be comprised of modified nucleic acids that would not be amplifiable.
  • A more preferred embodiment would utilize probes that recognize sequences that are adjacent to target gene sequences and not represented on the tiled regions of the chip. In this manner, their amplification in a non-biased amplification strategy would not result in artifacts.
  • As conventional DNA sequencing technologies can be considered as part of an overall information collecting process in basic research, so can the described resequencing approach be considered a component of an overall pathogen detection/characterization scheme. Wang et al. (Wang et al., 2003) describe a method for using a spotted DNA microarray comprised of long oligonucleotides (70-mers) that recognized conserved sequences, which are within a family of pathogens. Target sequences bound to these locations were isolated and used in a conventional DNA sequencing approach to allow further characterization. In an analogous manner, a very preferred embodiment would involve the use of the resequencing array to replace the steps related to alternative forms of DNA sequencing, thus providing specific pathogen characterization within hours instead of days and enablement of an effective biodefense system.
  • The method of the present invention preferably does not make use of specific sequences for amplification (PCR). The invention illustrates that there are alternate methods for enrichment of pathogen nucleic acids, for example: using solid phase support separations, prior to applying reduced bias, and isothermal (e.g. random-primed Klenow or strand displacement) amplification. In a preferable embodiment, a skilled technician in a conventional laboratory setting would be capable of performing time- and cost-effective sample preparation using a minimal set of automated steps to perform microarray experiments. In a highly preferred embodiment, a minimally skilled technician (medical technologist or medic) in a field environment (medical level 1) would be capable of performing manual separation/enrichment of pathogen target nucleic acids using a handheld instrument and perform isothermal amplification of pathogen targets with few reagents and technical steps.
  • Ampification and Hybridization Following Background Subtraction
  • In addition to random RT-PCR using primer D: GTITCCCAGTCACGATCNNNNNNNNN (SEQ ID NO: 573), and Primer E: GTTTCCCAGTCACGATC (SEQ ID NO: 574) (Kessler et al., 2004), analogous, previously described primer sets (Wang et al., 2002), variants of those primer sets, and/or random (6-9 mers) to synthesize first strand cDNA from RNA viruses (pathogens) may be employed. A subtractive hybridization protocol could be employed after first strand cDNA synthesis is complete to reduce the amount of background DNA in clinical samples before subjecting complex (i.e. clinical or environmental) samples to one or more DNA amplification step(s).
  • One method is direct subtraction of the background genomic DNA from amplified products (first strand cDNA synthesis, then total amplification) in hybridization solution with COT-1 human DNA (which consists largely of rapidly annealing repetitive elements). Another method is bead-based subtraction of background genomic DNA from clinical sample after first strand cDNA synthesis and prior to the DNA amplification step.
  • The third method is the combination of the above methods. In this case, the human genomic background DNA from complex samples would be subtracted using bead-based subtraction after first strand cDNA synthesis and prior to the DNA amplification step(s). Subsequently, the background DNA could be further subtracted from complex sample in hybridization solution with sequences designed to selectively capture human DNA and RNA. The DNA amplification step itself could be aimed at amplifying the cDNA products formed in the random RT step specifically, non-specifically, or through a combination of methods to amplify both the specific primer site-labeled RT-PCR products as well as pathogen genomic DNA targets and other non-cDNA targets that did not arise from the random RT-PCR step. One approach for doing so would be to ligate a specific primer sequence to the pathogen DNA genomic targets (this could be the same primer as used attached to cDNA products or a separate one), allowing a single PCR step to amplify all RNA and DNA pathogen targets.
  • RNA Substraction
  • Where separate processing pathways exist for detection of RNA and DNA pathogens the following may be used. For development of the RNA processing pathway, spiked and clinical (nasal wash and throat swab) Influenza A positive specimens were processed using different methods (random, universal, and multiplexed PCR). However, to achieve acceptable levels of sensitivity with random amplification approaches, human messenger and ribosomal RNA should be subtracted using the MICROBEnrich™ kit (Ambion, Inc., Austin, Tex.) in accordance with the manufacturer's instructions. A preferred random amplification strategy may be empolyed adapted from a previously-described method (Wang et al., 2002).
  • It was found by the present inventors that by employing this method positive detection of H3N2 and H1N1 Flu A detection in 16/19 different culture-positive Flu A nasal wash and throat swab specimens at concentrations as low as 0.45-3.75 pfu/150 μL sample aliquot may be achieved. It was further determined it was possible to detect Flu A in 6/8 specimens in the low concentration range following subtraction of human RNA.
  • Using random amplification approach, without background subtraction, the flu sensitivity is about 0.25 pfu/μl (1 ng/μl) in spiking nasal wash. In clinical samples, the sensitivty without subtraction is estimated to be about 1-10 pfu/μl.
  • DNA Substraction
  • Random amplification for DNA samples may be performed with either bacteriophage φ29 DNA polymerase or modified random amplification protocol from previously published paper (Wang et al. 2002; Wang et al.2003). Briefly, DNA amplification utilizing bacteriophage φ29 DNA polymerase with random hexamers can be conducted according to the instruction of GenomiPhi™ DNA Amplification Kit (Amersham Biosciences Corp., Sunnyvale, Calif.). The amplified products are then ethanol precipitated according to manufacture recommended protocol. DNA amplification utilizing modified random amplification may be performed with initial round of DNA synthesis with Sequenase™ version 2.0 DNA polymerase (United States Biochemical, Cleveland, Ohio) using primer D, followed by PCR amplification with primer E. For RNA amplification, viral samples are then amplified by a modified version of a random PCR protocol (Wang et al. 2002; Wang et al. 2003; Kessler et al. 2004). Briefly, 10 μl of total RNA can be reverse transcribed by using primer D and superscript III reverse transcriptase (Invitrogen Corp. Carlsbad, Calif.), and was then amplified by PCR with primer E.
  • Convergence of RNA and DNA Pathways
  • The combination of the RNA and DNA pathways is described in FIG. 9. In an embodiment of the present invention, the pathways for RNA and DNA are merged. This protocol is adapted from the lab of Joseph DeRisi at University of California San Francisco (http://derisilab.ucsf.edu/pdfs/Round_A_B_C.pdf) and randomly incorporates a single, fixed-sequence PCR primer binding site into all pathogen DNA or cDNA molecules, allowing them to all be amplified in a subsequent step using a conventional PCR thermal cycling protocol.
  • Data Acquisition and Processing
  • Affymetrix/Microarray Apparatus
  • In general, a “microarray” is a linear or two-dimensional array of preferably discrete regions, each having a defined area, formed on the surface of a solid support. The density of the discrete regions on a microarray is determined by the total numbers of different target polynucleotides to be detected on the surface of a single solid phase support, preferably at least about 102/cm2, more preferably at least about 104/cm2, even more preferably at least about 106/cm2, and still more preferably at least about 108/cm2. As used herein, a DNA microarray is an array of oligonucleotide primers placed on a chip or other surfaces used to detect and/or isolate target polynucleotides. Since the position of each particular group of primers in the array is known, the identities of the target polynucleotides can be determined based on their binding to a particular position in the microarray.
  • One embodiment of the invention utilized standard Affymetrix hardware (Agilent GeneChip Scanner (phased out) and the Affymetrix Scanner 3000 workstation and Fluidics Station 450. In principle, the described invention does not require this equipment. Given the manufacturer's intended uses of the GeneChip system for quantitative gene expression profiling and high confidence SNP detection, the existing apparatuses are not optimized for the dynamic range of signal intensities or background interferences inherent to the present invention. Thus, a preferred embodiment incorporates the use-of image acquisition methods, including the use of spatial frequency filtering and image enhancement, taking advantage of the inherent regularity of the feature dimensions to impose a filtering algorithm (e.g. edge enhancement, convolution, etc.) that allows better contrast of noisy images.
  • Affymetrix CustomSeq Protocol
  • In an embodiment of the present invention, sample processing is accomplished by employing the standard Affymetrix CustomSeq™ protocol. Generally, this method entails: (a) amplification of DNA probe-containing materials, (b) pooling and quantitation of amplified product, (c) fragmentation and labeling of the amplified product, (d) target hybridization, and (e) washing, staining, and scanning of the hybridized target. A detailed description of the Affymetrix CustomSeq™ protocol can be found in the product manual and protocol guide, which are available from the manufacturer and are incorporated herein by reference.
  • In the standard Affymetrix CustomSeq™ protocol, step (a) entails either long-range PCR or short-range PCR, with long-range PCR being the preferred amplification strategy. For each of these amplification strategies, the manufacturer recommended PCR DNA polymerases are Taq variants, AmpliTaq Gold DNA polymerase (short-range PCR) and LA Taq DNA polymerase (long-range PCR). Although not specifically recommended by the manufacturer, any DNA polymerase may be employed for step (a) so long as the DNA polymerase used is a high fidelity DNA polymerase.
  • To facilitate DNA amplification step (a), the standard Affymetrix CustomSeq™ protocol employs specific PCR primers. However, the use of specific PCR primers significantly limits the broad application of the inventive technique due to the introduction of systemic bias flowing from the specific PCR based methods that have heretofore been employed. Accordingly, in a preferred embodiment of the present invention step (a) of the Affymetrix CustomSeq™ protocol is replaced with an alternate amplification strategy, such as multiplex PCR, total amplification (GenomiPhi™), or random RT/PCR. These alternate strategies are discussed hereinabove. Conditions for optimal PCR amplification for each of the manufacturer recommended PCR strategies, as well as the preferred strategies of the present invention, can be determined by routine experimentation by the skilled artisan.
  • Since variability exists between PCR reactions, the Affymetrix CustomSeq™ protocol states that assay performance may be compromised if amplicon concentration in the hybridization varies by more than two fold. Therefore, step (b) of the Affymetrix CustomSeq™ protocol entails pooling PCR reactions and spectrophotometrically quantifying the same to ensure equimolar application of sample to the microarray.
  • However, the present invention poses several advantages over the SNP detection tailored protocols of the Affymetrix CustomSeq™ method. In particular, the use of the increased density chips with sequence length-independent similarity searches (BLASTN) in the present invention affords that fewer assumptions must be made in advance of selecting sequences for tiling. Furthermore, the use of length-independent similarity searches (BLASTN) removes the constraint that a particular known subsequence be successfully resequenced, making the approach more resistant to variations in target concentration and contributions from nonspecific binding leading to lost base calls. Accordingly, within the present invention step (b) of the Affymetrix CustomSeq™ protocol is optional and may be omitted.
  • Following DNA amplification, the DNA molecules obtained thereby are too long to hybridize with the short probes on the array surface. Accordingly, step (c) of the Affymetrix CustomSeq™ protocol involves fragmentation and subsequent labeling of the fragments with a fluorescent substrate. The method and reagents for fragmentation and labeling are not particularly limiting; however the label must be compatible with the detection apparatus for the resequencing microarray. To this end, the manufacturer recommended reagents and conditions may be employed.
  • Alternative Variations of the Affymetrix Protocols
  • Fluorescent labels that may serve to be advantageous for the methods described herein, as these are routinely used with automated instrumentation for simultaneous high throughput analysis of multiple samples, include the Cy fluorophores, the rhodamine based fluorophores: TARAM, ROX, JOE, and FAM; the BigDye™ fluorophores (Applied Biosystems, Inc.), the dansyl group, fluorescein and substituted fluorescein derivatives, acridine derivatives, coumarin derivatives, pthalocyanines, tetramethylrhodamine, Texas Red™, 9-(carboxyethyl)-3-hydroxy-6-oxo-6H-xanthenes, DABCYL™, BODIPY™, and ALEXA™ fluorophores (Molecular Probes, Eugene, Oreg.)
  • Additionally, there are a variety of labels other than fluorophores that will be suitable and perhaps preferable for a variety of situations. These labels include, but are not limited to: resonance light scattering (RLS) particles (In Vitrogen, Carlsbad, Calif.), quantum dots (Quantum Dot Corp.) and other nanoscale particles having desirable optical qualities.
  • The target hybridization (step (d)) may be performed as described in the Affymetrix CustomSeq™ protocol. The highlight of this step is that the sample containing the fragmented and labeled DNA is denatured by a high temperature (e.g., 85-100° C., preferably 95° C.) incubation followed by a hybridization temperature (e.g., 45° C.) equilibration. Once the DNA-containing sample has equilibrated the sample is applied to the resequencing array. The manufacturer recommends conducting the hybridization reaction for 16 hours; however, as stated above, the method of the present invention does not have its hands tied to enhance sensitivity to make the appropriate base calls. Therefore, shorter incubation times are appropriate for target hybridization. Within the context of the present invention, the target hybridization incubation time may range from a short time of 15 minutes to a long of 24 hours. Clearly, it is contemplated that this range of times embodies each of the intermediate times as if they were explicitly stated. Preferable times worth noting are 15 minutes, 30 minutes, 1 hour, 2 hours, 4 hours, 12, hours, and 16 hours.
  • The last step of the Affymetrix CustomSeq™ protocol entails washing the hybridized array using the Affymetrix Fluidics Station and scanned using the Agilent GeneArray™ Scanner. This instrument simply automates what would otherwise be manually performable labeling and rinse steps. Thus, any instrument that would be capable of delivering and withdrawing milliliter quantities of labeling and rinse media on a timed basis would be a suitable alternative. The invention described herein will be amenable to any subsequent hardware variations offered by Affymetrix. In addition, data acquisition from the types of resequencing microarrays described herein may be obtained from any manufacturer of equipment for microarray processing.
  • Bioinformatics Issues Concerning Pathogen Detection
  • Depending on the endpoints used for microarray-based detection of pathogens, the emphasis of bioinformatics issues is very different. Bioinformatic tools are indispensable for the efficient design and selection of specific complementary nucleic acid probe sequences for microarray development. For example, target pathogen genomic nucleic acid sequences are often amplified prior to microarray analysis and bioinformatics clearly has a role in the design of primers (assessing Tm/Ta, secondary structure, self-complementarity, and specificity issues) for assaying genes considered specific to an organism and strain (Kampke, Kieninger & Mecklenburg, 2001). These same assessments must also be made for microarray probe design.
  • During the initial stages of experimental design, it is assumed that primers and probes to genetic signatures associated with a target pathogen are specific to that pathogen or family of pathogens. It would follow that the generation of an amplicon or positive hybridization reaction using specifically designed primers or probe, respectively, would indicate the detection of the designated molecular trait from the target pathogen; however, this is not necessarily true. Bacterial and viral ‘genetic promiscuity’, the propensity of microorganisms to exchange genetic material, creates difficulties in developing single species or strain specific probes (Ochman, Lawrence & Groisman, 2000). Thus, preferred primer and probe design methodologies require the use of bioinformatic tools to: (a) perform multiple sequence alignments between different organisms or strains and design appropriate primers with the appropriate biochemical properties, (b) compare these sequences with those deposited in sequence databases to determine the present uniqueness of particular sequences and the potential for cross-reactivity, and (c) infer the probability of target specificity based on the level of genetic conservation and evolutionary relatedness with other pathogenic and non-pathogenic species whose primary genetic sequence has not yet been elucidated.
  • A very important bioinformatics aspect of the disclosed invention involves the assembly, annotation and selection of pathogen diagnostic targets into database(s) for incorporation into microarray design, as well as the concomitant task of relating detection events on the microarray to such database(s). An advantage of the present invention is that the information contained in the publicly available databases is ever increasing, thus further adding to the robust nature of the present invention. The present invention describes a process of manually selecting pathogen target sequences from the published literature (e.g. GenBank) and/or ascertaining an empirically determined diagnostic target sequence from published literature. The described approach has the advantage that a consortium of scientists, each possessing sufficient “domain expertise” for each of a large number of disparate pathogen species, can provide relevant, pathogen diagnostic sequence information that can be incorporated into an automated array design process without specific regard to specific probe, reagent, amplification, and sample preparation methods.
  • In one very preferred embodiment, the requisite domain expertise for each of a large number of unrelated pathogens will be maintained in an up-to-date fashion through a web-portal enabled database. Thus, an extended consortium, comprised of individual researchers of specific pathogens, would be able to provide the latest annotated target sequence information via a “pathogen page” formatted web portal, analogous to the “molecular page” model adopted by the Alliance for Cellular Signaling (AfCS). The AfCS database then maintains an otherwise incomprehensible amount of specific information on thousands of molecules involved in intracellular signaling cascades. In this format, individual researchers without specific knowledge about individual signaling molecules can access detailed parameters that can be used in numerical simulations of signaling events. Thus, in another very preferable embodiment, the annotated target sequence data for individual pathogens is organized into an automated data pipeline in which will impose user-defined design constraints (e.g. number of probe features, number of pathogen targets, the levels of sensitivity and specificity required for array performance, etc.) upon the total information content of a pathogen database, allowing automated, optimal target selection and submission of those targets to a vendor in a format necessary for microarray fabrication.
  • In yet another very preferred embodiment, the selected target sequences determined by the previous process will be correlated with the data that is collected in actual use of the microarray, such that metrics for probability and quality can readily used for decision-making. Two preferable approaches for performing such automated pipelining of data and algorithms are VIBE (Visual Integrated Bioinformatics Environment) software (Incogen, Inc., Williamsburg, Va.) and iNquiry (BioTeam, Boston, Mass.) which are representative of a class of integrated bioinformatics environments that could be used to equal effect for the intended purpose.
  • Data Acquisition
  • Raw sequence data from the resequencing microarray chips is provided by the Genetic Data Analysis Software version 2.0 (GDAS) packaged with the microarray reader from Affymetrix.
  • The Affymetrix resequencing array contains a defined number of probe cells or features. During scanning, the software divides each feature into subunit squares or pixels (3×3 μm). Each feature contains many copies of a unique 25-base oligonucleotide probe of defined sequence, while a series of eight features query a specific site in a known reference sequence. Four features interrogate the sense strand and contain probes that are identical except for the central base which is A, C, G, or T and four features interrogate the anti-sense strand and contain probes that are identical except for the central base which is A, C, G, or T.
  • GDAS uses the cell intensity data to make base calls for every base position represented on the resequencing array. Under the manufacturer setting for GDAS, the algorithm uses the intensity data from multiple samples to improve its calling accuracy and assigns a quality score for each call.
  • GDAS base calling is based on a previously described base-calling algorithm, ABACUS, detailed in (Cutler et al., 2001)). The model assumes that the pixel intensities of a feature are independently and normally distributed. The algorithm computes the estimated mean background and variance for the sense and anti-sense strand features. The base-calling algorithm also specifies models for the presence or absence of various genotypes in the sample (haploid or diploid). A variety of base calling algorithm parameters can be defined by the user (GDAS operator's manual/user's guide, Affymetrix) to obtain a trade-off between base calling percentage and accuracy.
  • Additional information regarding the GDAS algorithm and the parameters that can be modified is available in the GDAS user manual, which is incorporated herein by reference in its entirety. A description of the parameters is found in the GDAS version 2.0 manual on pages 207-217. The recommended (default) settings for GDAS are “conservative” settings that focus on the highest level of accuracy. In contrast, the objective of the present invention is to increase the percentage of base calls. To achieve this objective, the present inventors adjusted the parameters to allow highly permissive base calls (increased percentage) as listed below:
  • “Permissive” Base Calling Algorithm Settings”
  • Filter Conditions
      • No Signal threshold=0.500 (default=1.000000)
      • Weak Signal Fold threshold=20000.000 (default=20.000000)
      • Large SNR threshold=20.000000 (default=20.000000)
  • Algorithm Parameters
      • Strand Quality Threshold=0.000 (default=0.000000)
      • Total Quality Threshold=25.0000 (default=75.000000)
      • Maximum Fraction of Heterozygote Calls=0.99000 (default=0.900000)
      • Model Type (0=Heterozygote, 1=Homozygote)=0
      • Perfect Call Quality Threshold=0.500 (default=2.000000)
  • Final Reliability Rules
      • Min Fraction of Calls in Neighboring Probes=1.0000 (disables filter)
      • Min Fraction of Calls of Samples=1.0000 (disables filter)
  • The settings above are significant in the present application because the base call algorithm is set up by default to sacrifice the number of base calls made in order to make the most accurate calls (i.e., for SNP detection). In the present application, the technique is less concerned about achieving the same degree of accuracy as required for SNP detection but instead expanding the number of calls made so that the longest possible stretches of contiguous sequence are produced by GDAS while maintaining necessary specificity.
  • It is to be understood that within the scope of the present invention, the above-listed permissive settings can be altered individually or in toto as desired by the practitioner to obtain an optimal sensitivity/specificity agreement. In addition, it is to be understood that the settings above are exemplary and that each setting may be altered by 10% or more (parameter dependent) without altering the desired result of the present invention.
  • Resequencing Pathogen Identifier (REPI) and Alternatives, Modifications, Developments
  • Also according to the invention, it is the sequence information derived from a base-calling algorithm, as applied to the microarray hybridization pattern that is used to identify individual pathogens. Preferably, the sequence of target sequences determined by the resequencing probes is used to query a database using a similarity search algorithm. More preferably, the algorithm uses commonly used local alignment (e.g. Smith-Waterman, BLASTN) sequence alignment algorithms to statistically determine the probability that a given target sequence corresponds to a specific sequence in a database record (Korf, Yandell & Bedell, 2003). Even more preferably, a custom algorithm that determines subsequences that are most suitable for producing meaningful similarity searches against database records determines the set(s) of sequences that are submitted for similarity search automatically. Yet even more preferably, the automated subsequence-parsing algorithm is the Resequencing Pathogen Identifier (REPI) algorithm described in this invention and the sequence database records will be in both the public (e.g. GenBank) and private domain. Variants of nucleic acid sequence similarity search algorithms that are suitable for use in the intended invention include, but are not limited to: Washington University BLAST (WU-BLAST), NCBI-BLAST, FastA, MPsrch, Scanps, and BestFit (Korf et al., 2003).
  • REPI Alternatives and Variants
  • In the described invention, REPI (Resequencing Pathogen Identifier) software (see U.S. Application Ser. No. 60/609,918 filed on Sep. 15, 2004, and U.S. Application Ser. No. 60/631,460, filed on Nov. 29, 2004, which are incorporated herein by reference in their entirety) was used to ascertain which base call subsequences from the CustomSeq/GCOS/GDAS process would likely return significant BLAST results through the use of a customized sliding window algorithm. Subsequently, REPI automatically returns BLAST outputs to the end user that allow probabilistic assignments to the likelihood that a given set of base calls correspond to a particular microbial sequence. This low-level software functionality is analogous to the “kernel” of UNIX or UNIX-derived computer operating system, in that all higher-level functions and user interfaces must pass though it for resequencing chip analysis.
  • The low-level functionality provided by REPI will be central to a number of higher bioinformatics tasks that will utilize discontinuous segments of nucleic acid, or even amino acid sequence. In the following examples, the present inventors provide data showing that sequence fragments can be linked automatically to individual pathogens. In several more preferred embodiments, this approach can be refined to better discriminate between mixtures of pathogens and genetic recombination between pathogens. In one very preferred embodiment, the analysis software would allow for automatic detection of overlapping or homologous sequence fragments on different tiled regions of the array, allowing inference of a mixture of pathogens. In an even more refined embodiment, the analysis software would determine that the sequence outputs from different tiled regions are not overlapping but correspond to contiguous sequence that may be used to infer a genetic recombination event.
  • For example, a co-infection of two strains of a virus may produce a recombinant with a gene that is homologous with one virus strain except for the 5′ end, which has been substituted with the corresponding section of gene for the other virus strain. When this new recombinant virus genome is hybridized on a resequencing microarray, it produces signal from the corresponding pieces of both regions. One would need to have an assembly algorithm to construct a “model” of the pathogen showing which parts might fit together to form an entire target. If the two have significant overlap, one might conclude that there is probably a mixture. But if there were no overlap, there would remain a possibility that there is a recombinant. The degree of overlap (or lack of) could be affected by low concentrations of target with correspondingly smaller amounts of the tiles being filled in. This same principle can be applied even more readily, and with greater impact, on viruses where the recombination is a steady and recurring event, as in the case of influenza, where recombinations between viral segments result regularly in the formation of new viral strains. In fact, this described functionality in REPI will be essential for the distinction of pathogen mixtures versus recombination.
  • In another very preferred embodiment, REPI algorithms will allow for the analysis of transcriptional markers (e.g. RNA) that have been resequenced using the presently described type of microarray (via hybridization of RNA or complementary cDNA). In a method analogous to that described above for inference of genomic recombination events, transcriptional sequences may also be assembled to determine pathogen viability and transcriptional editing events that can serve as markers for infection.
  • Another REPI Alternative (Estimating the Amount of Pathogen Target in a Sample)
  • Not only is the present inventive approach able to distinguish between mixtures of pathogens and recombination events within a given pathogen (described elsewhere herein) it would also be of great value to provide the end user with an estimate (quantitation) of the relative amount of pathogen that was detected in the resequencing microarray assay. In particular, this would be of great utility when the clinician (technician) attempts to assign cause and effect when multiple pathogen genomic signatures are detected.
  • Two types of data may be used for this purpose. The first is the absolute intensity of the hybridization signals on the chip. A non-linear relationship exists between the amount of target in solution and the amount that actually hybridizes and the resulting signal. However, an estimate of the amount of target nucleic acid in the sample could be made by comparison with a standard curve prepared under control conditions. The signal intensity data is readily available from the .CEL file in the Affymetrix data hierarchy, and although the content of the .CEL files were not used in this disclosure, the output of REPI could easily be modified to include the intensity values of the .CEL files. Secondly, the percentage of base calls, both as a percentage of the total tile region size and as a percentage of base calls within a selected subsequence satisfying the sliding window algorithm, could be used as a measure of concentration. Our results show that both of these percentage metrics decrease with decreasing target concentration, although the correct pathogen can still be identified.
  • General Utility for Pathogen Detection
  • In a preferred embodiment, the invention described herein will be used for the routine diagnosis and surveillance of common respiratory pathogens in a clinical setting (at or near point-of-care). Readily obtainable samples (e.g. nasal wash, nasal swab, throat swab, sputum, or blood) will be processed in a simple manner to produce nucleic acid isolates that are obtained using an adsorptive process, enriched for pathogen-specific targets, amplified using a non-biased (e.g. total) amplification method or multiplexed PCR method, and hybridized on the resequencing microarray for a minimal amount of time prior to washing and imaging. The overall process will be sufficiently simple such that a skilled technician (medical technologist level) will be able to perform the assay without a significant interruption in their routine work pattern. Base calls will be made using the custom algorithms or using the steps specified by the vendor. REPI, or some variant thereof, will be used to automatically parse the base calls made by the microarray, and provide the end-user (e.g., physician, health care provider, public health officer, or other decision-makers) with decision-quality information for management (e.g., diagnostic, treatment, prognostic and outbreak control/containment measures) of the infectious pathogen(s) that are causative of the disease symptoms and complications. This analysis would occur locally through the use of an embedded sequence database that would be queried by REPI (e.g. local dedicated BLAST server). In addition to providing a routine diagnostic functionality, the microarray will also carry markers for highly improbable (i.e. bioterrorism) pathogens that would be cause for involvement of others, namely public health officials. However, it is understood that a nasal wash or throat swab may not be the optimal sample type for diagnosis of bioterrorism agents and that a separate sample type may be needed.
  • Also within the scope of the present invention, which further demonstrate the utility of the microarrays and methods of the present invention, include:
  • Scenario 1:
  • Patient arrives to medical facility with T>100.5 and respiratory symptoms. Nasal wash and/or throat swab are taken. Pathogens which can be identified by this route include the commonly occurring pathogens including those listed in Table 1. The presence of fever has been found to be an important criteria for isolating respiratory pathogens by culture and literature demonstrates that pathogens are typically present at peak titer during febrile periods.
  • For the bioterrorism agents, little information is available in the literature on infectious titers in respiratory secretions after intentional release of a biological agent. It is suspected that an aerosol release of an agent of bioterrorism would lead to detectable titers of organism in the first 24 hours post-exposure. In individuals presenting after the first 24 hours post-exposure, the microarray would serve the purpose of identifying common pathogens that might be otherwise erroneously suspected of being cases from the BT/BW agent. A proportion of individuals exposed to a significant aerosol release will develop symptoms rapidly and will retain the BT/BW agent in the nares for detection. For a disease, such as smallpox, the incubation period for onset of symptoms is much longer, but the virus can be isolated from throat culture for days.
  • Scenario 2:
  • The individual has been ill for days and did not initially present to a medical clinic, but chose to self-medicate. Patient may not have initially noted fever, but now has fever and respiratory symptoms and is concerned about lack of resolution. Health Care Practitioner (HCP) sees patient and determines appropriate clinical sample. If patient appears more ill, then chest X-ray may be acquired. Common organisms causing lower respiratory tract infection include, but are not limited to: Mycoplasma pneumoniae, S. pneumoniae, C. pneumoniae, L. pneumophila, S. pyogenes, Influenza A/B, RSV, Parainfluenza, S. aureus, SARS. Amongst the BT/BW agents of concern, an abnormal chest x-ray can be found with B. anthracis, Smallpox, Y. pestis, F. tularensis. For the common respiratory organisms, nasal wash/throat swab can still be appropriate sample techniques, although some practitioners will choose to send a sputum samples. For the BT/BW agents, sputum and blood can be appropriate sample techniques.
  • Scenario 3:
  • Ongoing outbreak of a known agent. The microarray can continue to be useful for detecting cases of other common pathogens, but may also be used to screen for known BT/BW agent using any type of appropriate specimen. Other assays may prove less expensive, but the microarray can provide forensic information and antibiotic resistance data at the time of pathogen identification.
  • Overall Business Model
  • The resequencing DNA microarray and associated devices (to include other types of lower content microarrays or alternative sequence detectors) will be but one class of elements of an integrated pathogen diagnostic/surveillance system. This system will be comprised of diagnostic, informatic, and epidemiologic components. At the diagnostic level, the RPM (and ancillary devices) will provide a rapid and cost-effective methodology for providing a diagnosis, patient-specific treatment information, and prognostic information (based on virulence and resistance markers) of infectious respiratory disease. This will represent a shift in diagnostic emphasis for the provider from clinical suspicion of one or a few pathogens (e.g., Mycoplasma pneumoniae and other pathogens with a presentation of “walking pneumonia” would be tested by obtaining bacterial cultures, presence of antibodies to that pathogen, etc.) to symptom-based and broad differential testing by multiplexed DNA microarrays based on the symptom(s) and the organ system or systems effected. The single highly multiplexed DNA arrays will additionally provide diagnostic information on which group of pathogens to treat (e.g., bacteria, viruses, parasitic, and fungal pathogens) producing substantial return on investment by reducing the number of prescriptions based on suspicion of causal agents (e.g., prescribing antibiotics for a viral respiratory infection will have no effect). Additional diagnostic applications can be created to cover all pathogens effecting an organ or organ systems (e.g., respiratory, genitourinary, central nervous system, etc.), syndromes (e.g., fever of unknown origin evaluated in the hospital for two weeks without identifying the cause to rule out all potential infectious disease causes), symptoms (e.g., all pathogens causing a urticaria or rash that itches, or cough, etc.), around collections of pathogens or threats present in geographic locations, or functional categories (e.g., groupings based on all the organisms known to have antimicrobial resistance in hospital or other confined settings like prisons or nursing homes). This highly multiplexed differential diagnostic testing will be done by determining the causative agent(s) of infection, antimicrobial susceptibility of the agent(s), and genomic sequence-specific clues as to the nature of the agent such that the maximum number of opportunities is identified to increase the efficacy and efficiency of clinical management.
  • However, because of the high number of specific molecular queries that are being made, a large number of pathogens can be detected, each at previously unattainable levels of detail. As such, a large number of assays (culture, serotyping, and PCR confirmation) that are subsequently and infrequently performed as part of “surveillance” activities are now being performed simultaneously with diagnosis, obviating the need for burdensome and expensive tasks currently required at the clinical level for surveillance support. This would have great relevance to diagnosis and surveillance of variants of RNA viruses (e.g. Influenza and SARS) in a manner that would be prohibitively complicated when relying on specific oligonucleotide probe sets.
  • In the specific embodiment described here, it will be highly advantageous to have diagnostic microarrays, the fabrication of which will not rely on the availability of a large number of target sequences and a means to fabricate arrays using them. More importantly, it will be critical not to be restricted to the assumption that the target sequences are invariant. Diagnostic DNA microarrays will identify specific but unanticipated genomic variants of a model pathogen, without requiring re-design of specific oligonucleotide probes and array re-fabrication. This will be critical to the ability to characterize the cause(s) of infectious disease outbreaks in a time-effective manner. For example, such microarrays could be used to rapidly detect new variations of influenza or SARS virus without requiring that the pathogens be isolated, cultured, and sequenced using conventional approaches; a process that would require weeks to months if the pathogen were readily cultivable.
  • The present invention also embraces applications for detecting a mixture of pathogens, especially when there is no preliminary evidence to suggest that the mixture might be interrogated by specific reagents (e.g. PCR primers). Thus, the present invention provides a means to impact the ability to determine the complementary roles of interacting pathogens in disease etiology. However, in applications such as viral or bacterial stock quality control and assessment of viral vaccine production, which involves the intentional mixture of field strain and cultivable viruses to produce recombinants that culture well. Thereby, the present invention enables the presentation of the correct the appropriate epitope(s) for vaccine efficacy.
  • The informatics component of the system will provide the necessary components to allow local (point-of-care), automatic microarray data analysis as well as coordinate multi-directional information transfer. “Upward” flow of information will entail the transfer of specific sequence base calls from the resequencing chip, preferably in FASTA format, and all associated local processing results, to local, regional, national and international levels. “Lateral” flow of information will involve the exchange of specific sequence base calls and associated local processing results to other local point-of-care medical facilities. “Downward” flow of information is defined as a provision of national level data integration to regional and local health officials.
  • Like clinical samples, environmental samples may contain small amounts of target nucleic acids in a high genomic background of unknown origin. But unlike clinical samples of a given type, the background found in an environmental sample (e.g. soil, water, or collected from an aerosol particle collector) might show a more heterogeneous composition depending on the geographical location, season, and environmental conditions. Accordingly, the aforementioned amplification, enrichment and/or subtraction strategies may be employed to obtain reliable base calling.
  • Forensic and Environmental Applications
  • The amount of detailed sequence information provided by the RPM will be enabling for various applications other than medical diagnosis and surveillance. Thus, the capability of the apparatus extends to forensic fingerprinting of specific pathogen strains. The capability enables preemptive diagnosis of etiologies of infectious disease, as alternative to conventional practice of corroborative diagnostic analysis. In the case of an intentional infection, poisoning, or bioterrorism event, the resequencing pathogen detection microarray would allow for detailed strain identification that could be used to determine the possible originator of the event and to allow for rapid mitigation of the event (e.g. determination of infectious capacity, antimicrobial resistance, or engineered modifications to an organism) by implementing targeted public health containment measures directed by having the pathogen identified to the strain as the completed first step in the outbreak investigation process.
  • The present invention further suggests methods and processes to automate and optimize the iterative and adaptive design, fabrication and validation of arrays, including derivative sub-arrays. In a very preferable embodiment, an enterprise level, a consortium of experts on individual pathogens would maintain a web portal-enabled database. The consortium would maintain pathogen target sequences for identification and virulence.
  • The same technology described in the present invention can be used for non-clinical samples, including those collected from air, water, soil or surface swabs. The only modifications necessary to those described in the present invention will be those necessary for nucleic acid extraction and background nucleic acid removal, if a subtractive approach followed by generic amplification is a desired approach.
  • Multiple Pathogen Surveillance in a Population
  • The invention further provides a specific implementation that validates its capabilities in a real world operational setting. This implementation relates to epidemic outbreaks of acute respiratory disease involving common and less common etiologies, while simultaneously evaluating the possible presentation of hostile pathogenic agents (rare if ever) in individual encounters. Thus, the invention provides a means to perform near real time surveillance of a plurality of infectious pathogens involved in an infectious outbreak. Such surveillance may be validated and eventually become operational in a “real world testbed”. In a preferred embodiment, the real world testbed is a human population that regularly encounters a variety of respiratory pathogens. In a preferred embodiment, the population is comprised of military personnel at an installation or base. In a very preferred embodiment, the population is comprised of active duty military personnel.
  • End User-Specified Applications
  • The integrated process of microarray design and assay will require only that sequences be provided to a microarray manufacturer and not involve the design of ancillary reagents (e.g. for specific PCR). Thus, an end user who has no detailed knowledge of genomics or would be capable of defining qualitative attributes of a microarray-based assay, and an automated bioinformatics pipeline would be used to select suitable target gene subsequences for submission to a resequencing microarray manufacturer. This would allow rapid deployment of a new micorarray design for a specific geographic location, theater of operations. Thus, the integrated design/analysis capability that is enabled by the present invention will generalize to other envisioned applications besides those listed herein.
  • Adenovirus Sequences
  • In an additional embodiment of the present invention are the genomic sequences of thirteen adenovirus strains, which were not known as of the date of the present invention. The thirteen adenovirus strains are: Ad3, Ad3FS_navy, Ad4, Ad4vaccine, Ad4FS_navy, Ad4FS_AF, Ad5FS, Ad7, Ad7FS_navy, Ad7 vaccine, Ad16, Ad1, and Ad21. These genomic sequences have been assigned the GenBank accession numbers shown in Table 6 appearing in the Examples. The full GenBank records, including partial annotation, for each of these sequences are found in the Sequence Listing attached herewith.
  • A “polypeptide” as used herein is understood to mean a sequence of several amino acid residues linked by peptide bonds. Such amino acids are known in the art and encompass the unmodified and modified amino acids. In addition, one or more modifications known in the art such as glycosylation, phosphorylation, etc may modify the polypeptide.
  • The term “isolated” means separated from its natural environment. This term is intended to also embrace the terms “purified” (100% pure) and “substantially purified” (at least 90% pure).
  • The term “polynucleotide” refers in general to polyribonucleotides and polydeoxyribonucleotides, and can denote an unmodified RNA or DNA or a modified RNA or DNA.
  • The term “homologous” as used herein is understood to mean sequence similarity between two or more polynucleotides or proteins from the same species or from a different species. Within the meaning of this term, said two or more polynucleotides (or proteins) are homologous when at least 70%, preferably at least 80%, most preferably at least 90% of the nucleotide base (amino acid) composition of a candidate sequence corresponds to the sequence according to the invention. According to the invention, a “homologous protein” is to be understood to retain at least 50%, preferably at least 75%, more preferably at least 85%, most preferably at least 95%, of the activity of the activity of the sequence of the present invention. As used herein “corresponds” is to be understood to mean that the corresponding amino acids are either identical or are mutually homologous amino acids. The expression “homologous amino acids” denotes those that have corresponding properties, particularly with regard to their charge, hydrophobic character, steric properties, etc. The same terminology can be used to describe DNA or RNA sequence homology for gene sequences that encode the corresponding proteins.
  • The term “homologous fragment” as used herein is understood to mean two or more polynucleotides or proteins from the same species or from a different species. In this context, it is contemplated that a fragment is homologous when it shares at least 40% identity to a fragment having at least 50 amino acids. Preferably, homologous fragments share at least 50% identity to a fragment having at least 50 amino acids. More preferably, homologous fragments share at least 60% identity, at least 70% identity, at least 80% identity, at least 90% identity, or at least 95% identity to a fragment having at least 50 amino acids. Accordingly, homologous fragments are included within the scope of the present invention. For homologous polynucleotides, it is understood that that the same homology ranges are envisioned in the present inventions but over a range of up to 1000 nucleotides, inclusive of all integers (i.e., 150, 250, 300, 500, 750, etc.).
  • Homology, sequence similarity or sequence identity of nucleotide or amino acid sequences may be determined conventionally by using known software or computer programs such as the BestFit or Gap pairwise comparison programs (GCG Wisconsin Package, Genetics Computer Group, 575 Science Drive, Madison, Wis. 53711). BestFit uses the local homology algorithm of Smith and Waterman, Advances in Applied Mathematics 2: 482-489 (1981), to find the best segment of identity or similarity between two sequences. Gap performs global alignments: all of one sequence with all of another similar sequence using the method of Needleman and Wunsch, J. Mol. Biol. 48:443453 (1970). When using a sequence alignment program such as BestFit, to determine the degree of sequence homology, similarity or identity, the default setting may be used, or an appropriate scoring matrix may be selected to optimize identity, similarity or homology scores. Similarly, when using a program such as BestFit to determine sequence identity, similarity or homology between two different amino acid sequences, the default settings may be used, or an appropriate scoring matrix, such as blosum45 or blosum80, may be selected to optimize identity, similarity or homology scores.
  • The present invention also relates to polynucleotides that contain complete genes that are identified by open reading frames. Examples of the preferred genes embraced by the present invention include E1A, hexon, and fiber. The sequences of E1A, hexon, and fiber, as well as other preferred polynucleotide sequences within the scope of the present invention are found in the attached Sequence Listing. The present invention also embraces fragments of said genes and polynucleotides and fragments thereof that can be obtained by screening by means of the hybridization of a corresponding gene bank with a probe which contains the sequence of said polynucleotide or a fragment thereof, and isolation of said DNA sequence.
  • The present invention also relates to coding DNA sequences that result from degeneration of the genetic code. Moreover, one skilled in the art is also aware of conservative amino acid replacements such as the replacement of glycine by alanine or of aspartic acid by glutamic acid in proteins as “sense mutations” that do not result in any fundamental change in the activity of the protein, i.e. which are functionally neutral. It is also known that changes at the N- and/or C-terminus of a protein do not substantially impair the function thereof, and may even stabilize said function.
  • Polynucleotide sequences according to the invention are suitable as hybridization probes for RNA, cDNA and DNA, in order to isolate those cDNAs or genes, which exhibit a high degree of similarity to the probe sequence.
  • Polynucleotide sequences according to the invention are also suitable as primers for polymerase chain reaction (PCR) for the production of DNA that encodes an active enzyme.
  • Oligonucleotides such as these, which serve as probes or primers, can contain more than 30, preferably up to 30, more preferably up to 20, even more preferably at least 15, and most preferably at least 13 successive nucleotides. Oligonucleotides with a length of at least 40 or 50 nucleotides are also suitable.
  • Hybridization protocols are known in the art and are disclosed, for example, in Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, N.Y. (1989). However, as used herein, stringent hybridization conditions are those conditions which allow hybridization between polynucleotides that are 75%, 80%, 85%, 90%, 95%, or 98% homologous as determined using conventional homology programs, an example of which is UWGCG sequence analysis program available from the University of Wisconsin (Devereux, Haeberli & Smithies, 1984). Typically, stringent conditions will be those in which the salt concentration is less than about 1.5 M Na ion, typically about 0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30° C. for short probes (e.g., 10 to 50 nucleotides) and at least about 60° C. for long probes (e.g., greater than 50 nucleotides). Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide. Exemplary low stringency conditions include hybridization with a buffer solution of 30 to 35% formamide, 1 M NaCl, 1% SDS (sodium dodecyl sulphate) at 37° C., and a wash in 1× to 2×SSC (20×SSC=3.0 M NaCl/0.3 M trisodium citrate) at 50 to 55° C. Exemplary moderate stringency conditions include hybridization in 40 to 45% formamide, 1 M NaCl, 1% SDS at 37° C., and a wash in 0.5× to 1×SSC at 55 to 60° C. Exemplary high stringency conditions include hybridization in 50% formamide, 1 M NaCl, 1% SDS at 37° C., and a wash in 0.1×SSC at 60 to 65° C.
  • Specificity is typically the function of post-hybridization washes, the critical factors being the ionic strength and temperature of the final wash solution. For DNA—DNA hybrids, the Tm can be approximated from the equation of Meinkoth and Wahl, (Meinkoth & Wahl, 1984): Tm=81.5° C.+16.6 (log M)+0.41 (% GC)−0.61 (% form)−500/L; where M is the molarity of monovalent cations, % GC is the percentage of guanosine and cytosine nucleotides in the DNA, % form is the percentage of formamide in the hybridization solution, and L is the length of the hybrid in base pairs. The Tm is the temperature (under defined ionic strength and pH) at which 50% of a complementary target sequence hybridizes to a perfectly matched probe. Tm is reduced by about 1° C. for each 1% of mismatching; thus, Tm, hybridization and/or wash conditions can be adjusted to hybridize to sequences of the desired identity. For example, if sequences with approximately 90% identity are sought, the Tm can be decreased 10° C. Generally, stringent conditions are selected to be about 5° C. lower than the thermal melting point (Tm) for the specific sequence and its complement at a defined ionic strength and pH. However, severely stringent conditions can utilize a hybridization and/or wash at 1, 2, 3, or 4° C. lower than the thermal melting point (Tm); moderately stringent conditions can utilize a hybridization and/or wash at 6, 7, 8, 9, or 10° C. lower than the thermal melting point (Tm); low stringency conditions can utilize a hybridization and/or wash at 11, 12, 13, 14, 15, or 20° C. lower than the thermal melting point (Tm). Using the equation, hybridization and wash compositions, and desired Tm, those of ordinary skill will understand that variations in the stringency of hybridization and/or wash solutions are inherently described. If the desired degree of mismatching results in a Tm of less than 45° C. (aqueous solution) or 32° C. (formamide solution) it is preferred to increase the SSC concentration so that a higher temperature can be used. An extensive guide to the hybridization of nucleic acids is found in Current Protocols in Molecular Biology, Chapter 2, Ausubel, et al., Eds., Greene Publishing and Wiley-Interscience, New York (2000).
  • In this invention “primer” or “probe” means a polynucleotide, especially an oligonucleotide, that is produced synthetically or biologically and includes a specific nucleotide sequence and permits hybridization to a section containing the target nucleotide sequence.
  • Defined primers or probes, as well as all other oligonucleotides and polynucleotide of the present invention, may be produced by any of several well-known methods, including automated solid-phase chemical synthesis using cyanoethyl-phosphoramidite precursors. Other well-known methods for construction of synthetic primers/oligonucleotides may, of course, be employed. J. Sambrook, E. F. Fritsch and T. Maniatis, Molecular Cloning 11 (2d ed. 1989).
  • The primers used to amplify the sample nucleic acids may be coupled to a detectable moiety. A preferred example of such a detectable moiety is fluorescein, which is a standard label used in nucleic acid sequencing systems using laser light as a detection system. Other detectable labels can also be employed, however, including other fluorophores, radio labels, chemical couplers such as biotin which can be detected with streptavidin-linked enzymes, and epitope tags such as digoxigenin detected using antibodies. The primers may be modified whereby another nucleotide is added to, removed from, or substituted for at least one nucleotide in the oligonucleotide. Introduction of known labels such as radioactive substances, enzymes, fluorescence substances, etc. after synthesis of oligonucleotide is also included therein.
  • Similarly, the probes/oligonucleotides used to hybridize with the polynucleotides coding for the polypeptides of the invention, for example for the purpose of detection of such a polynucleotide, may be coupled to a detectable moiety.
  • As used herein, the term “enhancement” means increasing the intracellular activity of one or more enzymes in a plant cell and/or plant that are encoded by the corresponding DNA. Enhancement can be achieved with the aid of various manipulations of the bacterial cell. In order to achieve enhancement, particularly over-expression, the number of copies of the corresponding gene can be increased, a strong promoter can be used, or the promoter- and regulation region or the ribosome binding site which is situated upstream of the structural gene can be mutated. Expression cassettes that are incorporated upstream of the structural gene act in the same manner. In addition, it is possible to increase expression by employing inducible promoters. A gene can also be used which encodes a corresponding enzyme with a high activity. Expression can also be improved by measures for extending the life of the mRNA. Furthermore, preventing the degradation of the enzyme increases enzyme activity as a whole. Moreover, these measures can optionally be combined in any desired manner.
  • A gene can also be used that encodes a corresponding or variant enzyme with a high activity. Preferably the corresponding enzyme has a greater activity than the native form of the enzyme, more preferably at least in the range of 5, 10, 25% or 50% more activity, most preferably more than twice the activity of the native enzyme.
  • The above written description of the invention provides a manner and process of making and using it such that any person skilled in this art is enabled to make and use the same, this enablement being provided in particular for the subject matter of the appended claims, which make up a part of the original description.
  • As used herein, the phrases “selected from the group consisting of,” “chosen from,” and the like include mixtures of the specified materials.
  • Where a numerical limit or range is stated herein, the endpoints are included. Also, all values and sub-ranges within a numerical limit or range are specifically included as if explicitly written out.
  • The above description is presented to enable a person skilled in the art to make and use the invention, and is provided in the context of a particular application and its requirements. Various modifications to the preferred embodiments will be readily apparent to those skilled in the art, and the generic principles defined herein may be applied to other embodiments and applications without departing from the spirit and scope of the invention. Thus, this invention is not intended to be limited to the embodiments shown, but is to be accorded the widest scope consistent with the principles and features disclosed herein.
  • Having generally described this invention, a further understanding can be obtained by reference to certain specific examples, which are provided herein for purposes of illustration only, and are not intended to be limiting unless otherwise specified.
    • EXAMPLES
  • Materials and Methods
  • Table 6 (below) lists the adenovirus strains cited in the following examples. GenBank accession numbers refer to the genomic sequence numbers assigned to each strain. These sequences were not available to the public at the time of invention and form an embodiment of the present invention, as well as fragments of the same.
    TABLE 6
    Accession Genome
    GenBank name no. size Origin
    Ad3 AY599834 35,345 ATCC#VR-3, strain GB
    Ad3FS_navy AY599836 35,265 Ad3FS NHRC#1276 from NTC
    Great Lakes, IL Nov. 07, 1997
    Ad4 AY594253 35,990 ATCC#VR-4, strain RI-67
    Ad4vaccine AY594254 35,994 Calif. Public Health (via Kevin
    Russell/NHRC)
    Ad4FS_navy AY599835 35,965 Ad4FS NHRC#42606 from Ft
    Jackson, SC Apr. 02, 2003
    Ad4FS_AF AY599837 35,964 Linda Canas, Brooks AFB,
    Lackland AFB AF#3 2002
    Ad5FS AY601635 35,931 Ad5FS NHRC#7151 from Ft
    Jackson, SC Jan. 06, 1998
    Ad7 AY594255 35,305 ATCC#AV-HAD7_AFIP, strain
    Gomen
    Ad7FS_navy AY601634 35,198 Ad7FS NHRC#1315 from NTC
    Great Lakes, IL Nov. 19, 1997
    Ad7vaccine AY594256 35,236 NHRC vaccine tablet (Margaret
    Ryan, Kevin Russell/NHRC)
    Ad16 AY601636 35,522 ATCC#VR-17, strain ch.79
    Ad1 AF534906 36,001 ATCC#VR-1, strain Adenoid 71
    1953
    Ad21 AY601633 35,382 ATCC#NIAID V-221-002-014,
    NIH Research Reagent,
    prepared in November 1963

    ATCC = American Type Culture Collection (Manassas, VA)

    NHRC = Naval Health Research Center (San Diego, CA)

    NIH = National Institutes of Health (Bethesda, MD)

    The full GenBank records, including partial annotation, for each of these are found in the Sequence Listing attached herewith.
    Influenza Content
  • The prototype influenza types represented by tiles on RPMV1 are:
  • Influenza A virus (A/New Caledonia/20/99) H1 HA gene for hemagglutinin 1
  • FluAHA3 Influenza A virus (A/Fujian/411/02) H3N2 gene for hemagglutinin 3
  • FluAHA5 Influenza A virus (A/HongKong/156/97/H5N1), hemagglutinin 5
  • FluANA1 Influenza (A/Chile/1/83), neuraminidase 1
  • FluANA2 Influenza A virus (A/Panama/2007/99/H3N2) NA gene for neurarninidase 2
  • FluAMATRIX Influenza virus A/NWS/33/H1N1 matrix protein (M)
  • FluBNA Influenza B virus (BlYamagata/16/88), neuraminidase glycoprotein genes
  • FluBHA Influenza B virus (B/Yamanashi/166/98) hemagglutinin 1 subunit (HA)
  • FluBMATRIX Influenza B virus (BlYamagata/16/88) M1 matrix protein (M)
  • The Accession numbers for each of the foregoing sequences, as well as the remaining pathogen target sequences, obtained from the public domain and personal communications, are listed in Table 9.
    • Preparation Example 1 RPM Version 1 Chip Design
  • DNA sequences were provided to Affymetrix for creation of the resequencing microarray chip (RPM Version 1 chip) utilized in the following examples. Submission of the DNA sequence and instruction files to Affymetrix were in accordance with the manufacturer instructions CustomSeq™ Array Protocol and product literature. Probe lengths were nominally 25-nucleotides long and contained a variable (interrogation point) central nucleotide for each of four possible variants (A, C, T or G) in both the sense and antisense directions.
  • The target genes selected for the RPMV1 pathogens listed above are described in the version 1 layout shown in Table 8 and the Sequence Listing along with the respective PCR primers used for amplification of the same. The sequences submitted for tiling and chip fabrication were based on the Affymetrix instruction file summarized in Table 7, which corresponds to the sequences appearing as SEQ ID NOs: 1-58. The corresponding “instruction file” lists the alias designator (e.g. FluAHA5) for each tile region and provides a “FASTA” formatted target gene sequence (this can be all or part of the complete target gene).
    TABLE 7
    RPMV1 Affymetrix instructions file for tiling and chip
    fabrication
    SEQ
    Name Alias Start End ID NO: StartSeq EndSeq Design
    FluAHA1 FluAHA1 1 699 1 TTGAGAAG ATGGTATG 1
    FluAHA3 FluAHA3 1 794 2 GATAGTGA AAGCATTC 1
    FluAHA5 FluAHA5 1 524 3 AATCCACT GCTCCAAT 1
    FluANA1 FluANA1 1 1360 4 AAAAGCAG TTTTGTGG 1
    FluANA2 FluANA2 1 1449 5 GCAAAAGC TAGAAAAA 1
    FluAMATRIX FluAMATRIX 1 923 6 AGCAAAAG TGCCAGAG 1
    FluBHA FluBHA 1 684 7 TTACATCC AGCCATAG 1
    FluBNA FluBNA 1 896 8 ATGAACAA CAGTTACA 1
    FluBMATRIX FluBMATRIX 1 362 9 ATGTCGCT CATGAAAG 1
    Ad4HEXON Ad4HEXON-1 1 1096 10 GTGGCGCC TAAAGTTA 1
    Ad4HEXON Ad4HEXON-2 2226 2504 10 CGAGGTTA GCCCACGC 1
    Ad4FIBER Ad4FLBER 1 1258 11 CGACCCCG ACCCTGCA 1
    Ad4E1A Ad4E1A 1 1326 12 GCGGGGCA CCCAGGCA 1
    Ad5HEXON Ad5HEXON-1 1 843 13 GTGGCGCC ATTGCTTT 1
    Ad5HEXON Ad5HEXON-2 1655 1846 13 GACCTAAG CCAACGTG 1
    Ad5FIBER Ad5FIBER 1 2012 14 TTCTGTCC AGATCACC 1
    Ad5E1A Ad5E1A 1 616 15 AGCCGGAG CTGTGGAA 1
    Ad7HEXON Ad7HEXON-1 1 807 16 GTGGCGCC ATTGGCTT 1
    Ad7HEXON Ad7HEXON-2 1652 2245 16 TCTGTATG AATTACAC 1
    Ad7FIBER Ad7FIBER 1 712 17 CCTTCAAC AATGTTAA 1
    Ad7E1A Ad7E1A 1 615 18 AAGAGTTT ACTGCCAC 1
    PIVIHN PIVIHN 1 204 19 TAGACCCA TATAGGGA 1
    PIVIIIHN PIVIIIHN 1 213 20 CAAATCTA TGAAAGAT 1
    PIVIIINCFP PIVIII5NCFP 1 230 21 ACTTAGGA GTACAACC 1
    HRV5NT HRV5NT 1 412 22 GTCAAAGG TCGTGTTT 1
    RSVABL RSVABL 1 379 23 AAGTGCTC AAGCAAAC 1
    RSVAN RSVAN 1 106 24 AATACAAA AGATAGTA 1
    RSVBN RSVBN 1 128 25 GGCAAATA CAATTATG 1
    WNVCPRM WNVCPRM 1 432 26 GGCCAATA TGATCCAG 1
    WNVE WNVE 1 94 27 ATTTGGCT TTTGTGTG 1
    WNVNS1 WNVNS1 1 153 28 GAAGGTTG GGGTACAA 1
    HCV229EMG HCV229EMG 1 598 29 TAGAACAG TAACCTAC 1
    HCVOC43MG HCVOC43MG 1 358 30 TGATTATT TATATGAC 1
    SPNLYTA SPNLYTA 1 125 31 TATCGAAC CTCAGACC 1
    SPNPLY SPNPLY 1 99 32 GGTTTGGC ATCAAGAT 1
    SPYSPEB SPYSPEB 1 281 33 AATCTTTT TAGACATG 1
    SPYMEFAE SPYMEFAE 1 370 34 GGCAGGGC TTACGAAA 1
    SPYERMB SPYERMB 1 248 35 AACTGATT TAGAATCC 1
    SPYERMTR SPYERMTR 1 176 36 CAACGGGT GATATTGT 1
    MPP1 MPP1 1 369 37 AGGGGGTT ACTATGTT 1
    NMCTRA NMCTRA 1 135 38 TTGGATGC TTTTGCTG 1
    NMCRGA NMCRGA 1 254 39 GGTGCTGC TGCCGGTC 1
    BPPTXP BPPTXP 1 305 40 GAAGTAGC CAAACCGC 1
    BPPTXS1 BPPTXS1 1 222 41 CGGCGCAT AGGCCGAA 1
    CPMOMPVD4 CPMOMPVD4 1 150 42 ATGCTGAT TCAGATCA 1
    CPMOMPVD2 CPMOMPVD2 1 133 43 AGCGTTCA TAGGCGCT 1
    CPRPOB CPRPOB 1 346 44 AAGGACTT CTGCAGGC 1
    BARPOB BARPOB 1 199 45 CGTCCTGG GGCAGAAG 1
    BAPAGA BAPAG 1 354 46 TAGCGGCG TAATTCGT 1
    BACAPB BACAPB 1 246 47 TTACACGT ACCTATTA 1
    VMVHA VMVHA 1 510 48 AACTATTA TCACCAAC 1
    VMVCRMB VMVCRMB 1 291 49 TCGGGAAC CGTCTGTT 1
    ZEVL ZEVL 1 443 50 TACTACCA TCACACTG 1
    LVGPC LVGPC 1 351 51 GCGCACCG GTGGGCAA 1
    FTLP FTLP 1 431 52 ATCGTAAT TAAGTATG 1
    FTFOPA FTFOPA 1 111 53 CAGATATA GATACTAC 1
    YPCVE YPCVE 1 265 54 ATAAAGGG AGGCGGGG 1
    YPCAF1 YPCAF1 1 525 55 TATGAAAA ATATAGAT 1
    ATTIM ATTIM 1 523 56 ACATCGAC GAGCTTGC 1
    ATNAC1 ATNAC1 1 543 57 TATATGTA ATTGTACA 1
    Ad7HEXVAC Ad7HEXVAC 168 383 58 GGTGCTTG AAGCCCAT 1
  • TABLE 8
    RPMV1 layout, along with the respective PCR primers used for amplification of the same
    Gene Forward
    found in Primer
    SEQ ID (SEQ ID
    Organism Gene Name Amplicon Probe NO: NO:) Size % GC
    Influenza A Hemaglutinin 1 675 699 1 439 23 47.8
    Influenza A Hemaglutinin 3 770 794 2 440 24 33.3
    Influenza A Hemaglutinin 5 500 524 3 441 26 42.3
    Influenza A Hemaglutinin 5 219 442 26 30.8
    Influenza A Neuraminidase 1 1336 1360 4 443 22 22.7
    Influenza A Neuraminidase 2 1434 1449 5 444 22 45.5
    Influenza A Matrix Gene 911 923 6 445 20 40
    Influenza B Hemaglutinin 660 684 7 446 22 45.5
    Influenza B Neuraminidase 881 896 8 447 25 32
    Influenza B Matrix Gene 338 362 9 448 24 45.8
    Adenovirus 5 Hexon 819 843 13 449
    Adenovirus 5 Hexon 168 192 13 450 24 45.8
    Adenovirus 5 Fiber 1988 2012 14 451 22 45.5
    Adenovirus 5 E1A 171 452 24 54.2
    Adenovirus 5 E1A 431 616 15 453 23 56.5
    Adenovirus 4 Hexon 764 1096 10 454
    Adenovirus 4 Hexon 255 279 10 455 18 61.1
    Adenovirus 4 Hexon 511 456 19 57.1
    Adenovirus 4 Fiber 967 457 20 55
    Adenovirus 4 Fiber 435 1258 11 458
    Adenovirus 4 E1A 844 459 22 45.5
    Adenovirus 4 E1A 878 460 23 56.5
    Adenovirus 4 E1A 409 1326 12 461
    Adenovirus 7 Hexon 774 798 16 462
    Adenovirus 7 Hexon 570 594 16 463 24 61.6
    Adenovirus 7 Fiber 688 712 17 464 23 41.3
    Adenovirus 7 E1A 205 465 20 65
    Adenovirus 7 E1A 428 615 18 466
    Adenovirus 7 Hexvac
    Parainfluenza Virus I HN 180 204 19 467 27 48.1
    Parainfluenza Virus HN 189 213 20 468 21 47.6
    III
    Parainfluenza Virus 5′ noncoding 206 230 21 469 21 38.1
    III region of fusion
    protein
    Human rhinovirus 5′ noncoding 388 412 22 470 16 56.2
    region
    RSV (A, B) L-polymerase 355 379 23 471 19 36.8
    major
    RSV (A) nucleocapsid, N 82 106 24 472 26 38.5
    major
    RSV (B) nucleocapsid, N 104 128 25 473 26 38.5
    West Nile virus C and prM 408 432 26 474 25 48
    West Nile virus E 70 94 27 475 21 52.4
    West Nile virus NS1 129 153 28 476 21 52.4
    Human coronavirus membrane 574 598 29 477 20 40
    (229E) glycoprotein
    Human coronavirus membrane 334 358 30 20 55
    (OC43) glycoprotein
    Streptococcus Autolysin, lytA 101 125 31 478 21 47.6
    pneumoniae
    Streptococcus pneumolysin, ply 75 99 32 479 22 50
    pneumoniae
    Mycoplasma Cytadhesin P1 345 369 37 480 24 58.3
    pneumoniae protein
    Neisseria capsular transport 111 135 38 481 19 57.9
    meningitidis protein (ctrA)
    gene
    Neisseria regularoty protein, 230 254 39 482 25 60
    meningitidis crgA
    Bordetella pertussis Pertussis toxin 281 305 40 483 22 72.7
    promoter region
    Bordetella pertussis Pertussis toxin S1 198 222 41 484 18 61.1
    subunit ptxS1
    Chlamydia major outer 126 150 42 485 16 62.5
    pneumoniae membrane protein
    (MOMP) VD4
    Chlamydia DNA directed 322 346 44 486 21 42.9
    pneumoniae RNA polymerase
    (rpoB)
    Chlamydia major outer 109 133 43 487 20 40
    pneumoniae membrane protein
    (MOMP) VD2
    Streptococcus pyrogenic 257 281 33 488 20 50
    pyogenes exotoxin B (speB)
    Streptococcus macrolide-efflux 346 370 34 489 21 33.3
    pyogenes determinant
    (mefA, mefE)
    Streptococcus erythromycin 224 248 35 490 23 39.1
    pyogenes resistance
    methylase (ermB)
    Streptococcus erm(TR) 152 176 36 491 20 40
    pyogenes
    Bacillus anthracis RNA polymerase 175 199 45 492 21 47.6
    beta-subunit
    (rpoB)
    Bacillus anthracis protective antigen 330 354 46 493 25 40
    (pag)
    Bacillus anthracis Poly(D-glutamic 222 246 47 494 19 52.6
    acid) capsule
    (capB)
    Variola Major Virus hemagglutinin 486 510 48 495 18 27.8
    (HA)
    Variola Major Virus cytokine response 267 291 49 496 28 39.3
    modifier B (crmB)
    Ebola Virus L Gene 419 443 50 497 22 27.3
    Lassa Virus GPC Gene 335 351 51 498 20 55
    Francisella 13-kDa lipoprotein 407 431 52 499 27 55
    tularensis
    Francisella FopA 87 111 53 500 27 37
    tularensis
    Yersinia pestis cve2155 sequence 242 265 54 501 22 54.5
    Yersinia pestis Caf1 501 525 55 502 21 52.4
    Arabisopsis thaliana TIM 499 523 56 503 20 45
    Arabisopsis thaliana NAC1 519 543 57 504 20 45
    29344
    Reverse Taqman
    Primer Probe
    (SEQ ID (SEQ ID
    Organism Tm NO:) Size % GC Tm NO:) Size % GC Tm
    Influenza A 54.8 505 24 33.3 55.6
    Influenza A 57.6 506 22 36.4 55.9
    Influenza A 59.8 507 26 42.3 58.7
    Influenza A 58.9 508 24 45.8 58.5
    Influenza A 54.2 509 18 55.6 53.5
    Influenza A 57.9 510 23 39.1 57.8
    Influenza A 55 511 571 20 55 62
    Influenza B 55.5 512 24 47.9 57.5
    Influenza B 56.3 513 22 45.5 56
    Influenza B 59.9 514 25 36 59.6 572 22 54.5 63.4
    Adenovirus 5 515
    Adenovirus 5 57.6 516 24 54.2 58.5
    Adenovirus 5 55.9 517 20 60 61
    Adenovirus 5 61.5 518 21 66.7 61.3
    Adenovirus 5 59.7 519 21 57.1 57.3
    Adenovirus 4 520
    Adenovirus 4 63 521 18 66.7 62
    Adenovirus 4 66 522 18 50 64
    Adenovirus 4 57.8 523 21 47.6 54.9
    Adenovirus 4 524
    Adenovirus 4 57.1 525 19 59.9 59.6
    Adenovirus 4 61.2 526 25 48 60.6
    Adenovirus 4
    Adenovirus 7 527
    Adenovirus 7 60.5 528 24 50 60.3
    Adenovirus 7 54.7 529 23 47.8 58.2
    Adenovirus 7 62 530 23 60.9 61.3
    Adenovirus 7 531
    Adenovirus 7
    Parainfluenza Virus I 62.8 532 28 35.7 58.2
    Parainfluenza Virus 48.5 533 21 42.9 49.5
    III
    Parainfluenza Virus 46.3 534 20 40 48
    III
    Human rhinovirus 44.9 535 16 56.2 43.8
    RSV (A, B) 43.9 536 19 36.8 42.9
    RSV (A) 57.3 537 21 47.6 54.3
    RSV (B) 58 538 30 33.3 59.1
    West Nile virus 62.6 539 25 56 64.9
    West Nile virus 53.8 540 21 52.4 53.8
    West Nile virus 53.2 541 21 47.6 54.3
    Human coronavirus 53.7 542 20 50 51.9
    (229E)
    Human coronavirus 55 543 20 45 53.7
    (OC43)
    Streptococcus 52.7 544 21 42.9 53.2
    pneumoniae
    Streptococcus 56.3 545 23 43.5 58
    pneumoniae
    Mycoplasma 63.8 546 25 52 60.8
    pneumoniae
    Neisseria 53.2 547 20 45 54.4
    meningitidis
    Neisseria 73.6 548 24 62.5 69.4
    meningitidis
    Bordetella pertussis 69.6 549 20 55 59.1
    Bordetella pertussis 56.2 550 19 63.2 58.6
    Chlamydia 50.3 551 25 32 55.5
    pneumoniae
    Chlamydia 52 552 20 50 49.2
    pneumoniae
    Chlamydia 50.6 553 21 47.6 48.7
    pneumoniae
    Streptococcus 48.1 554 20 40 48.7
    pyogenes
    Streptococcus 43 555 21 38.1 47.2
    pyogenes
    Streptococcus 50.7 556 20 50 51.7
    pyogenes
    Streptococcus 45.2 557 23 30.4 48.7
    pyogenes
    Bacillus anthracis 52.5 558 23 34.8 53.2
    Bacillus anthracis 54.9 559 27 44.4 57.1
    Bacillus anthracis 49 560 19 42.1 51.7
    Variola Major Virus 48 561 23 34.8 48.3
    Variola Major Virus 59.1 562 24 50 59.8
    Ebola Virus 50.1 563 30 33.3 60.1
    Lassa Virus 59.5 564 29 31 57.6
    Francisella 59.5 565 24 31 57.6
    tularensis
    Francisella 59.9 566 23 43.5 56
    tularensis
    Yersinia pestis 60.1 567 20 65 61.8
    Yersinia pestis 57.4 568 23 39.1 53.6
    Arabisopsis thaliana 47.7 569 20 50 49.9
    Arabisopsis thaliana 51.1 570 20 50 53.3
  • The instruction file references the same alias designators, but further specifies the actual subsequences that are actually to be tiled onto the array. In most cases, this represents the entire sequence from the sequence file but in others (e.g. FluBMATRIX) only nucleotides 1-362 of the total sequence were used for tiling. Table 9 provides the information presented in the instructions file.
  • Table 9 (below): Instruction file (specific file) of the RPM V1 design specification. The alias designator is a name assigned to each discrete “tile” region (e.g. a geometric region of the microarray containing all probe combinations required for resequencing of a stretch of pathogen genome sequence). The pathogen, sequence accession number, and tile size for each tile region are shown. The instructions, which were processed in Affymetrix submission format, appear in Table 7. The instruction file references complete or partial sequence of the complete target genes that are found in SEQ ID NOs: 1-58 appearing in the attached Sequence Listing.
    TABLE 9
    RPMV1 Chip Table
    ALIAS NAME GENE_NAME ACCESSION_NO LENGTH
    ATNAC1 Arabidopsis thaliana NAC1 543
    ATTIM Arabidopsis thaliana TIM 523
    Ad4E1A Adenovirus 4 E1A AF594253(draft) 1326
    Ad4FIBER Adenovirus 4 Fiber AF594253(draft) 1258
    Ad4HEXON-1 Adenovirus 4 Hexon AF594253(draft) 1096
    Ad4HEXON-2 Adenovirus 4 Hexon AF594253(draft) 279
    Ad5E1A Adenovirus 5 E1A AY147066 616
    Ad5FIBER Adenovirus 5 Fiber M18369 2012
    Ad5HEXON-1 Adenovirus 5 Hexon AF542130 843
    Ad5HEXON-2 Adenovirus 5 Hexon AF542130 192
    Ad7E1A Adenovirus 7 E1A AY594255(draft) 615
    Ad7FIBER Adenovirus 7 Fiber AY594255(draft) 712
    Ad7HEXON-1 Adenovirus 7 Hexon AY594255(draft) 807
    Ad7HEXON-2 Adenovirus 7 Hexon AY594255(draft) 594
    Ad7HEXVAC Adenovirus 7 Hexon AY594256(draft) 216
    BACAPB Bacillus anthracis Poly(D-glutamic acid) capsule (capB) M24150 246
    BAPAG Bacillus anthracis protective antigen (pag) M22589 354
    BARPOB Bacillus anthracis RNA polymerase beta-subunit (rpoB) AF205323 199
    BPPTXP Bordetella pertussis Pertussis toxin promoter region M13223 305
    BPPTXS1 Bordetella pertussis Pertussis toxin S1 subunit ptxS1 M13223.1 222
    CPMOMPVD2 Chlamydia pneumoniae major outer membrane protein (MOMP) CP0694 133
    VD2
    CPMOMPVD4 Chlamydia pneumoniae major outer membrane protein (MOMP) M69230 150
    VD4
    CPRPOB Chlamydia pneumoniae DNA directed RNA polymerase (rpoB) NT01CP0714 346
    FluAHA1 Influenza A Hemaglutinin 1 AJ344014 699
    FluAHA3 Influenza A Hemaglutinin 3 private 794
    communication
    FluAHA5 Influenza A Hemaglutinin 5 AF028709 524
    FluAMATRIX Influenza A Matrix Gene L25814 923
    FluANA1 Influenza A Neuraminidase 1 M24783 1360
    FluANA2 Influenza A Neuraminidase 2 AJ457937 1449
    FluBHA Influenza B Hemaglutinin AF100355 684
    FluBMATRIX Influenza B Matrix Gene AF100378 362
    FluBNA Influenza B Neuraminidase AY139081 896
    FTFOPA Francisella tularensis FopA AF097542 111
    FTLP Francisella tularensis 13-kDa lipoprotein M32059 431
    HCV229EMG Human coronavirus (229E) membrane glycoprotein AF304460 598
    HCVOC43MG Human coronavirus (OC43) membrane glycoprotein M93390 358
    HRV5NT Human rhinovirus 5′ noncoding region NC_001617 412
    LVGPC Lassa Virus GPC Gene M15076 351
    MPP1 Mycoplasma pneumoniae Cytadhesin P1 protei M18639 369
    NMCRGA Neisseria meningitidis regularoty protein, crgA AF190471 254
    NMCTRA Neisseria meningitidis capsular transport potein (ctrA) NMB0071 135
    PIVIHN Parainfluenza Virus I HN U70948 204
    PIVIII5NCFP Parainfluenza Virus III 5′ noncoding region Z11575 213
    PIVIIIHN Parainfluenza Virus III HN M18764 230
    RSVABL RSV L-polymerase AF254574 379
    RSVAN RSV A major nucleocapsid, M11486 106
    RSVBN RSV B major nucleocapsid, D00736 128
    SPNLYTA Streptococcus pneumoniae Autolysin, lytA SP1937 125
    SPNPLY Streptococcus pneumoniae pneumolysin, ply SP1923 99
    SPYERMB Streptococcus pyogenes erythromycin resistance methylase (ermB) X52632 248
    SPYERMTR Streptococcus pyogenes erm(TR) AF002716 176
    SPYMEFAE Streptococcus pyogenes macrolide-efflux determinant (mefA, metE) U70055 370
    SPYSPEB Streptococcus pyogenes pyrogenic exotoxin B (speB) NT01SP1804 281
    VMVCRMB Variola Major Virus cytokine response mo U88145 291
    VMVHA Variola Major Virus hemagglutinin (HA) X65516 510
    WNVCPRM West Nile virus C and prM AF196835 432
    WNVE West Nile virus E AF196835 94
    WNVNS1 West Nile virus NS1 AF196835 153
    YPCAF1 Yersinia pestis Caf1 X61996 525
    YPCVE Yersinia pestis cve2155 sequence AF350077 265
    ZEVL Ebola Virus L Gene AF086833 443
    29569
  • The chip design team at Affymetrix used the combination of the information above and the corresponding sequence file information to generate the layout of the chip. FIG. 1 shows an overview of the chip layout as a function of where the gene sequences for any given pathogen are clustered on the resequencing microarray chip (RPM Version 1 chip) utilized in the following examples. This figure and chip layout is only for illustration of the “real estate” allocation to various pathogens for the RPMV1 and is not intended to be limiting in any way. The skilled artisan would readily appreciate that the relative order and amounts of sequence dedicated to each of the pathogen clusters on this chip can be altered without intrinsic deleterious effects on the utility of the chip.
  • It is important to note that the tiling strategy dictates that the first 12 and last 12 sequences from each discrete tile region that are not queried by the tiling strategy of the resequencing microassay, since they are used as components of the first and last 25-mer probes that are varied at the number 13 positions.
  • The sequences used for the adenovirus regions (Ad4, Ad5, Ad7 and Ad7 vaccine) of the chip were all derived from early drafts of genomes sequenced by the present inventors. The GenBank submission files that correspond to the genomes used for tiled regions are listed in Table 6. Because the sequences submitted to Affymetrix for the prototypes were based on early drafts of the genomes, there were discrepancies observed between those early sequences and the final sequences submitted to GenBank. A list of those discrepancies is given in the Table 10:
    TABLE 10
    Discrepancies observed between the RPMV1 tiled sequences and the
    final sequences submitted to Genbank appearing in Table 6
    Length
    of target Sequence Base # Target Sequence
    Contig for Ad4
    E1A 2004 554 missing A
    658 C T
    697 G A
    698 A G
    851 C T
    1460 C T
    1675 C T
    1777 A G
    2002 missing T
    Hexon 2813 18319 C G
    18330 missing T
    18331 missing G
    18332 missing G
    18385 A G
    18451 C T
    18523 T C
    18547 T C
    18571 C T
    18586 T C
    18617 T C
    18640 T C
    18659 G T
    18662 A G
    18687 T C
    18700 A C
    18843 A G
    18889 T A
    18901 C T
    18940 G T
    18965 A C
    18997 T C
    19013 G A
    19020 A C
    19113 A C
    19237 A G
    19325 T C
    19327 A G
    19330 C T
    19447 A G
    19542 C A
    19714 T C
    19732 A C
    19759 C T
    19762 A G
    19765 A G
    19795 C A
    19796 T A
    19798 C T
    19816 T C
    19819 C T
    19881 A missing
    19897 C T
    19906 C T
    19911 A G
    19915 T C
    19916 T C
    19936 T C
    19976 T C
    20038 C T
    20050 C T
    20128 C C
    20149 A C
    20158 A C
    20176 T C
    20206 C G
    20210 G A
    20239 missing C
    20245 C missing
    20246 T A
    20285 T C
    20297 T C
    20336 T C
    20363 T C
    20366 A C
    20429 T C
    20435 T C
    20447 G C
    20459 G A
    20499 T C
    20511 T C
    20519 T C
    20528 T C
    20570 T C
    20579 T C
    20658 C G
    20660 T C
    20663 T C
    20666 G A
    20684 T C
    20687 C T
    20690 T A
    20713 G A
    20753 T C
    20759 A G
    20768 C T
    20819 T C
    20864 T C
    20939 T C
    21008 C T
    21038 G A
    Fiber 1386 31602 missing C
    31611 missing C
    31616 missing C
    31652 missing A
    31672 G missing
    31714 missing C
    31746 T missing
    31790 missing C
    31798 C missing
    31799 C missing
    31816 missing C
    31923 T missing
    31943 C missing
    32003 G missing
    32047 T missing
    32051 missing T
    32260 T missing
    32262 G T
    32266 missing G
    32473 A T
    32475 T A
    32618 T C
    32619 C T
    32934 missing C
    Contig for Ad5_canji
    E1A 60 none
    Hexon 60 19020 G missing
    19023 A missing
    19024 C missing
    19025 A missing
    Fiber 60 none
    Contig for Ad7
    E1A 60 none
    Hexon 60 none
    Fiber 60 none
    Contig for Ad7_Navy
    E1A 60 590 C T
    Hexon 60 18109 A G
    Fiber 60 none
    Contig for
    Ad7_Vaccine
    E1A 60 559 C G
    586 C T
    Hexon 60 18142 A G
    Fiber 60 none
  • This relatively small number of discordances did not interfere with the ability of the chip to make base calls that could be associated with the correct organism, except in one specific case of adenovirus type 4, described in the Examples. Overall, the resequencing microarray technique of the present invention corroborated the accurate (refined) final sequence of the tiled genes with respect to base substitutions, validating the unanticipated robustness of our method.
    • Preparation Example 2 PCR Primer Design and Amplification Protocols
  • Degenerate PCR Primers Design
  • The objective of primer selection to support conserved (degenerate) multiplex PCR is to design primers that target the conserved regions flanking species-specific variable regions of E1A, fiber, and hexon genes. In general, this method may be applied to any organism, as conserved sequences within a species are a ubiquitous in nature. These target genes were selected based on their function and location within the linear adenoviral genome. E1A is located at the 5′ end of the adenoviruses genome and encodes a trans-acting transcriptional regulatory factor that is necessary for transcriptional activation of early genes. The hexon and fiber genes, which are located in the middle and 3′ end of the adenovirus genome, encode antigenic determinants ε and γ respectively, which determine the viral serotype. Thus, detection and serotyping of ARD-causing adenoviruses can be effectuated by targeting the nucleic acid determinants that give rise to the serotype. Thereby, the primers provided specific amplification within the adenovirus while the variable regions supplied serotype-specific characters for proper species identification.
  • The primers used for conserved (degenerate) multiplex PCR in the following examples are based on a global alignment of E1A, fiber, and hexon gene sequences, respectively, available from GenBank (GenBank accession numbers are given in parentheses): E1A-AdB (NC—004001), AdC (NC—001405), Ad3 (AF492352), Ad4 (M14918), Ad7 (X03000);fiber-Ad2 (AJ278921), AdS (M18369), Ad3 (X01998), Ad4 (X76547), Ad7 (M23696), Ad16 (U06106), Ad2l (U06107); hexon-Ad3 (X76549), Ad4 (X84646), Ad6 (AF161560, X67710, Y17245), Ad7 (AF053087, X76551), Ad16 (X74662), Ad21 (AB053166). The global sequence alignment for primer design of the E1A gene used the E1A gene sequences from Ad3, Ad4, Ad7, Ad21, AdB, and AdC serotypes. The global sequence alignment for primer design of the fiber gene used fiber gene sequences from Ad2, Ad3, Ad4, AdS, Ad7, Ad16, and Ad21 serotypes. The global sequence alignment for primer design of the hexon gene used the hexon gene sequences from Ad3, Ad4, Ad6, Ad7, Ad16, and Ad21 serotypes.
  • Subsequent to the global sequence alignment, primer pairs were selected based on their ability to amplify E1A, fiber, and hexon genes of serotype 3, 4, 6, 7, 16 and 21 (data not shown). Table 11 shows the primer pairs employed in the following Examples.
    TABLE 11
    Amplicon
    Primer Gene Sequence (5′ → 3′) size (bp)
    AdE1A-F E1A CGC TGC ACG ATC TGT ATG AT (SEQ ID NO:
    421)
    AdE1A-R E1A TCT CAT ATA GCA AAG CGC ACA (SEQ ID NO: 409-446
    422)
    AdB1* Fiber TST ACC CYT ATG AAG ATG AAA GC (SEQ ID
    NO: 423)
    AdB2* Fiber GGA TAA GCT GTA GTR CTK GGC AT (SEQ ID 670-772
    NO: 424)
    AdFib-F3 Fiber ACT GTA KCW GYT TTG GYT GT (SEQ ID NO:
    425)
    AdFib-R3 Fiber TTA TTS YTG GGC WAT GTA KGA (SEQ ID NO: 430-437
    426)
    AdHex-F7 Hexon CAC GAY GTG ACC ACM GAC CG (SEQ ID NO:
    427)
    AdHex-R5 Hexon TTK GGT CTG TTW GGC ATK GCY TG (SEQ ID 770-815
    NO: 428)

    Multiplex Degenerate Primer PCR Protocol
  • The primers pairs (Lin et al., 2004) were evaluated in various multiplex combinations to obtain amplification of adenovirus serotype 3, 4, 6, 7, 16, and 21. PCR was performed in 50 μl volumes containing 20 mM Tris-HCl (pH 8.4), 50 mM KCl, 200 μM each of dNTPs, 200 nM AdB1, AdB2 primers; 300 nM AdE1A-F, AdE1A-R primers; 400 nM Adfib-F3, Adfib-R3 primers; 500 nM Adhex-F7, Adhex-R5 primers, 2 U of Platinum Taq DNA polymerase (Invitrogen), and 106 copies of DNA templates. The amplification reaction was performed using a Peltier Thermal Cycler-PTC225 (MJ Research) with preliminary denaturation at 94° C. for 3 minutes, then followed-by 40 cycles of denaturation at 94° C. for 30 seconds, annealing at 50° C. for 30 seconds, the extension at 72° C. for 40 seconds, and a final extension at 72° C. for 10 minutes. The generic multiplex PCR assay could amplify all three genes of all six ARD causing adenoviruses even though the hexon gene of Ad4 showed very weak band on agarose gel.
  • Total Amplification Protocol
  • Total amplification was conducted using the commercially available GenomiPhi™ DNA Amplification Kit (Amersham Biosciences) to representatively amplify linear genomic DNA (hereinafter referred to as “GenomiPhi total amplification”). The amplification method employed in the GenomiPhi total amplification method utilizes bacteriophage Phi29 DNA polymerase enzyme to exponentially amplify single- or double-stranded linear DNA templates by strand displacement amplification. The starting sample was not quantified, but rather was used directly.
    • Preparation Example 3 REPI Software
  • Raw sequence data from the resequencing microarray chips is provided by the Genetic Data Analysis Software version 2.0 (GDAS) packaged with the microarray reader from Affymetrix. GDAS base calling is based on a previously described base-calling algorithm (Cutler et al., 2001). Each of the FASTA output files containing the base calls obtained from the GDAS software was analyzed using specialized software (REPI) that the present inventors developed.
  • In the case of the present invention, the sequence output of GDAS is most often a scattered mixture of contiguous sequence calls (A, T, C or G) that are interspersed with varying amounts of no-calls (n's) where the GDAS software does not make a base call due to lack of amplification, weak hybridization signal on the chip and/or high background hybridization caused by non-specific binding (Cutler et al., 2001). An example output of the GDAS output for the Adenovirus 4 prototype sample for the Ad4FIBER tile region is shown below (SEQ ID NO: 429):
    >Ad4FIBER:CustemSeq-Adenovirus 4 Start = 12 End = 1245
    nnnnnnnnnnnnnnncnnncncngaccgngnnnttcannaacnctcccntcgnnctcttcag
    atgnattnnaagaaaagcccctgggggtgttgtccnnannnnnnngccgaccctgtcncnnn
    aagaatgnnnaaattannnnnaagctgngngagggggtnnnncttgacgactcgggaaaact
    cnttgcaancacagtaaacaaggccattgcnnctctcagnttttnccaacaacaccatttnn
    nnttaacatggatacccctttatacaccaaagntggaaaactanccttacaagtttctncca
    ccattaagtatattaaaatcaacaattttgaatacnnnnnnnnnagcttttggntcaggttt
    nggactcagtnnnngcgcccnngcagtananttagnctcnccacttacatttgntgataaag
    ggaatanaaagattacccnaaanagnnimttgcatgttanaacaggagntgcaattgaaagc
    aacatcagttgggctaaaggtntaaaattngaagatggtgccatagctacaaacattggtaa
    nnnnnnnnnnntnnnaaccagnngtncagaannannagnnannaangcttatccaatccaan
    nnnnnnntgncnctggtctcagctttgacagcacaggagccataatgnctggcaataaagnc
    tatgataaattaactttgtggacaacgcctgacccatcaccaaactgncaaatncttgcaga
    aaatgntgcaaaactaacactttgnnnnnnnnanngnnacagncaaatactggccactgtan
    cngntttggntgttagaagnggaaacttaaacccaattactggcacagtaagcagtgctcaa
    gnttttcnncgntttgatgcaaatggtgnncntntnacagaacactctanncnnaaaaaatn
    ntggggcnanaagcaangagatagnatagatggcactccatacaccaatgctgttggtttta
    tgccaaattcaacagcttntnnaaagacncaaagttctnctnctaaaaataatntagtgggt
    caagtatacatgantnnagntgtttnanannncatgnttcttnctataactcttaatggtnc
    tgatgacaccaccngtgcatnctcaatgncattttcatacacctggactaacggaagctata
    tcggagcaacatttggagctaactcatacaccttctcntacatngcccannannnn
  • Similarity search algorithms such as BLAST (Korf et al., 2003) allow the use of n's (analogously to a wildcard) but the inclusion of too many n's results in an unacceptable degree of ambiguity. In that case, no meaningful BLAST results will be returned.
  • The REPI software was designed to parse the output of the FASTA file selecting and editing to mold sequence data into a format suitable for sequence similarity searches using the NCBI BLASTN algorithm. To accomplish this objective, REPI functions through a series of filters modifying the data as little as possible while extracting usable, “BLASTable” data from the FASTA files. Due to the nature of the resequencing microarray the sequences often contain large amounts of non-base calls (n's). BLAST is unable to return significant similarity for sequences with a large amount of non-base calls. Therefore the original sequences must be filtered to extract those portions that are most likely to return a significant similarity.
  • The first filter that a prospective sequence encounters is a control check. The control sequence incorporated into the microarray is specifically designed to be a nonsense sequence; therefore, it will never return a significant similarity. Next the sequence is evaluated for “BLASTable” data. Here a sliding window algorithm is used, the window-size parameter is entered by the user and represents the number of base calls the algorithm will evaluate at one time. The sequence is evaluated starting from the first base-call the window slides along the sequence searching for the first area containing relevant data, this is evaluated using a scoring method where all valid bases are given a score of one and all n's are given a score of zero if the score is greater than or equal to a predetermined threshold (here 25% is used) the program marks the start of this window as the beginning of usable data. Once the start of usable data is determined the program reverses its parameters and begins searching for the end of the useable data, the score must now be less than or equal to the threshold. For each sequence REPI searches for the largest continuous string(s) of usable data, which will represent that sequence's initial subsequence.
  • This subsequence is then trimmed for beginning and trailing n's. Trimming is necessary because the previous filter uses the starting position of the starting window as the beginning of the subsequence and the last position of the ending window as the end of the subsequence, therefore all though that window's score was acceptable there may be n's leading or trailing the subsequence. The next filter the subsequence goes through is a length evaluation. Subsequences longer than 50 nucleotides are allowed to continue, subsequences shorter than 20 nucleotides are discarded, and subsequences between 20 and 50 nucleotides are re-evaluated as follows. Due to the length of these subsequences they are rescored using the same scoring system described earlier. Subsequences with greater than 60% non-base calls are discarded; all others are allowed to continue to be searched with the BLAST algorithm against GenBank, or one's own modified database.
  • Once the similarity search is complete REPI computes a number of statistics on the subsequence including the subsequence percentage of the target sequence, the subsequence length, the number of subsequence base calls, and the percentage of subsequence base calls. The subsequence percentage of the target sequence and the subsequence length shows what portion of the target pathogen gene was identified. The subsequence length and percentage of subsequence base calls allow us to monitor the filtering algorithm filters as well as the GDAS threshold parameters. REPI saves all statistical results returned from the BLASTN algorithm allowing the user to manipulate which results are displayed in the graphical user interface.
  • In the examples provided, REPI was interfaced to a local BLAST (NCBI GenBank) database (contained on an Apple G5 single processor (1.8 Ghz) computer with 4.5 GB of random access memory) via a CGI (Perl) interface. Displayed results included all database sequences within an expect value (E-value) threshold of 1.0e-9. The E-value represents the number of alignments expected at random given the size of the search space, the scoring matrix, and the gap penalties; the lower the E-value the less likely the database sequence similarity matches was in fact a random identification. By definition e=2.71828182845904523536028747135.
  • The REPI output is comprised of the (BLASTable) subsequence names, lengths, E-values, and bits scores are displayed for each subsequence in descending order of bit scores. The name is reported as the GenBank record's FASTA definition line and includes the sequence length. The score is the normalized score computed from the scoring matrix and gap penalties, the higher the score the greater the similarity.
  • The REPI output of the example listed above is shown below. For each “BLASTable” subsequence, REPI returns (in descending order of bit score ranking) all GenBank data records having expect values of <1.0 e-9. The highest bit score is achieved for the adenovirus 4 prototype (AY594253), which is genetically indistinguishable from the Ad4 vaccine strain (AY594254) across this stretch, while lower bit scores suitably distinguish field strains from Air Force and Navy training sites (SEQ ID NO: 430).
    >Ad4FIBER:CustemSeq-Adenovirus 4 Start = 12 End = 1245
    Subsequence:
    cnnncncngaccgngnnnttcannaacnctcccntcgnnctcttcagatgnattnnaagaaaag
    cccctgggggtgttgtccnnannnnnnngccgaccctgtcncnnnaagaatgaanaaattannn
    nnaagctgngngagggggtnnnncttgacgactcgggaaaactcnttgcaancacagtaaacaa
    ggccattgcnnctctcagnttttnccaacaacaccatttnnnnttaacatggatacccctttat
    acaccaaagntggaaaactanccttacaagtttctnccaccattaagtatattaaaatcaacaa
    ttttgaatacnnnnnnnnnagcttttggntcaggtttnggactcagtnnnngcgcccnngcagt
    ananttagnctcnccacttacatttgntgataaagggaatanaaagattacccnaaanagnnnn
    ttgcatgttanaacaggagntgcaattgaaagcaacatcagttgggctaaaggtntaaaattng
    aagatggtgccatagctacaaacattggtaannnnnnnnnnntnnnaaccagnngtncagaann
    annagnnannaangcttatccaatccaannnnnnnntgncnctggtctcagctttgacagcaca
    ggagccataatgnctggcaataaagnctatgataaattaactttgtggacaacgcctgacccat
    caccaaactgncaaatncttgcagaaaatgntgcaaaactaacactttgnnnnnnnnanngnna
    cagncaaatactggccactgtancngntttggntgttagaagnggaaacttaaacccaattact
    ggcacagtaagcagtgctcaagnttttcnncgntttgatgcaaatggtgnncntntnacagaac
    actctanncnnaaaaaatnntggggcnanaagcaangagatagnatagatggcactccatacac
    caatgctgttggttttatgccaaattcaacagcttntrmaaagacncaaagttctnctnctaaa
    aataatntagtgggtcaagtatacatgantnnagntgtttnanannncatgnttcttnctataa
    ctcttaatggtnctgatgacaccaccngtgcatnctcaatgncattttcatacacctggactaa
    cggaagctatatcggagcaacatttggagctaactcatacaccttctcntacatngcccanna
  • Subsequence Percentage of Target: 98%
  • Subsequence Length: 1215
  • Number of Subsequence Base Calls: 1020
  • Percentage of Subsequence Base Calls: 84%
      • lcl|AY594254|Human Adenovirus serotype 4, vaccine strain#|35,994 bp; Length=35994
        • evalue: 0.0, score: 751.806 for Ad4FIBER
      • lcl|AY594253|Human Adenovirus Serotype 4|35,990 bp; Length=35990
        • evalue: 0.0, score: 751.806 for Ad4FIBER
      • gi|303967|gb|L19194.1|ADRFIBERX Mastadenovirus h4 fiber protein, complete cds; Length=1346
        • evalue: 0.0, score: 743.877 for Ad4FIBER
      • gi|22796371|emb|AJ315930.1|HAD315930 Human adenovirus type 4 DNA; Length=12718
        • evalue: 0.0, score: 735.947 for Ad4FIBER
      • lcl|AY599837|Human Adenovirus serotype 4, USAF Field Strain|35,964 bp; Length=35964
        • evalue: 0.0, score: 704.23 for Ad4FIBER
      • lcl|AY599835|Human Adenovirus serotype 4, US Navy Field Strain|35,965 bp; Length=35965
        • evalue: 0.0, score: 696.3 for Ad4FIBER
      • gi|434913|emb|X76547.1|AV4FIB1 Adenovirus type 4 gene for fiber protein; Length=1375
        • evalue: 2.32306E-154, score: 553.571 for Ad4FIBER
      • gi|17105037|gb|AF394196.1|AF394196 Simian adenovirus 25, complete genome; Length=36521
        • evalue: 6.5072E-53, score: 216.57 for Ad4FIBER
      • gi|33694802|tpg|BKO00413.1|TPA: Simian adenovirus 25, complete genome; Length=36519
        • evalue: 6.5072E-53, score: 216.57 for Ad4FIBER
  • The application Java Archive (.jar) files for the REPI program are generated and processed in accordance with the description provided in U.S. Application Ser. No. 60/609,918 filed on Sep. 15, 2004, and U.S. Application Ser. No. 60/631,460, filed on Nov. 29, 2004, which are incorporated herein by reference in their entirety.
    • EXAMPLE 1 Base Calling Algorithm Settings and BLAST Analysis of Base Calls for Adenovirus 4 Using Conserved (Degenerate) PCR Primers and GenomiPhi Total Amplification
  • Raw sequence data from the resequencing microarray chips is provided by the Genetic Data Analysis Software version 2.0 (GDAS) packaged with the microarray reader from Affymetrix. GDAS base calling is based on a previously described base-calling algorithm, ABACUS, detailed previously (Cutler et al., 2001). A variety of base-calling algorithm parameters can be defined by the user (GDAS operators manual) to obtain a trade-off between base calling percentage and accuracy.
  • A description of the parameters is found in the GDAS manual on pages 207-217. The recommended (default) settings for GDAS are “conservative” settings that focus on the highest level of accuracy. In contrast, the objective of the present invention is to increase the percentage of base calls. To achieve this objective, the present inventors adjusted the parameters to allow highly permissive base calls (increased percentage) as listed below:
  • “Permissive” Base Calling Algorithm Settings
  • Filter Conditions
      • No Signal threshold=0.500 (default=1.000000)
      • Weak Signal Fold threshold=20000.000 (default=20.000000)
      • Large SNR threshold=20.000000 (default=20.000000)
  • Algorithm Parameters
      • Strand Quality Threshold=0.000 (default=0.000000)
      • Total Quality Threshold=25.0000 (default=75.000000)
      • Maximum Fraction of Heterozygote Calls=0.99000 (default=0.900000)
      • Model Type (0=Heterozygote, 1=Homozygote)=0
      • Perfect Call Quality Threshold=0.500 (default=2.000000)
  • Final Reliability Rules
      • Min Fraction of Calls in Neighboring Probes=1.0000 (disables filter)
      • Min Fraction of Calls of Samples=1.0000 (disables filter)
  • The settings above are significant in the present application because the base call algorithm is set up by default to sacrifice the number of base calls made in order to make the most accurate calls (i.e., for SNP detection). In the present application, the technique is less concerned about achieving the same degree of accuracy as required for SNP detection but instead expanding the number of calls made so that the longest possible stretches of contiguous sequence are produced by GDAS, while maintaining specificity.
  • In a comparative approach to sample preparation for analysis by the RPM V1 microarray, a starting concentration of 106 genomic copies of Adenovirus 4 prototype (AY594253) per microliter were amplified using either degenerate adenovirus PCR primers (Lin et al., 2004) or GenomiPhi isothermal methods. For the total amplification experiments, DNA was isolated from cultured adenoviruses and aliquoted at concentrations of 106 copies per microliter. DNA was amplified using a total amplification strategy (GenomiPhi, Amersham), then processed in accordance with the standard Affymetrix CustomSeq™ protocol (available from manufacturer).
  • Images of the hybridized microarrays are shown in FIG. 2. GenomiPhi total amplification allowed the entire tiled region (increased sensitivity) to be resequenced compared to the more limited region resulting from conserved (degenerate) multiplex PCR. This result arises due to the fact that GenomiPhi total amplification does not rely on specific primer sequences within the tiled fragment. However, it is also important to note that irrespective of which amplification strategy was employed, i.e., conserved (degenerate) multiplex PCR or GenomiPhi total amplification, the proper Ad4 calls were made. The consistency between these methods is important as the conserved primers may have a more direct application to serotyping members of the same family of pathogens from complex samples without the need for selective enrichment.
  • Based on the corresponding GDAS outputs (using “permissive” settings), REPI identified the following list of top-ranked returns for the conserved PCR amplification strategy for the E1A, Fiber, and Hexon-1 tile regions of the V1 RPM microarray (note: omitted from this list are several adenovirus type 4 GenBank records having nearly identical sequences as the Ad4 prototype and Ad4 vaccine strain).
    TABLE 12
    Ad4E1A: CustemSeq-Adenovirus 4
    Accession # Name E value: Bit Score:
    AY594254 Human Adenovirus 1.04808E−107 396.964
    serotype 4, vaccine
    strain
    AY594253 Human Adenovirus 1.04808E−107 396.964
    Serotype 4
    AY599837 Human Adenovirus 8.34268E−53 214.587
    serotype 4, USAF
    Field Strain
    AY599835 Human Adenovirus 8.34268E−53 214.587
    serotype 4, US Navy
    Field Strain
  • TABLE 13
    Ad4FIBER: CustemSeq-Adenovirus 4
    Accession # Name E value: Bit Score:
    AY594254 Human Adenovirus 0.0 751.806
    serotype 4, vaccine
    strain
    AY594253 Human Adenovirus 0.0 751.806
    Serotype 4
    AY599837 Human Adenovirus 0.0 704.23
    serotype 4, USAF
    Field Strain
    AY599835 Human Adenovirus 0.0 696.3
    serotype 4, US Navy
    Field Strain
  • TABLE 14
    Ad4HEXON-1: CustemSeq-Adenovirus 4
    Accession # Name E value: Bit Score:
    AY594254 Human Adenovirus 0.0 751.806
    serotype 4, vaccine
    strain
    AY594253 Human Adenovirus 0.0 751.806
    Serotype 4
    AY599835 Human Adenovirus 1.73046E−169 603.13
    serotype 4, US Navy
    Field Strain
    AY599837 Human Adenovirus  4.2185E−167 595.2
    serotype 4, USAF
    Field Strain
  • In each case shown above, the adenovirus type 4 prototype (AY594253) and vaccine strain (AY594254) returned the highest expect values and bit scores for hybridization of the adenovirus type 4 prototype amplicons obtained by conserved PCR amplification. This is expected because the prototype strain was used for vaccine production and the sequences were determined to be identical. In each case, the returns were distinguished in order of similarity from the closely related Air Force (AY599837) and Navy (AY599835) adenovirus 4 field strains.
  • Listed below are the corresponding outputs following GenomiPhi amplification of the adenovirus type 4 prototype instead of conserved PCR (note: not shown are several closely-related adenoviruses with bit scores higher than the Air Force and navy field strains):
    TABLE 15
    Ad4E1A: Adenovirus 4 GenomiPhi3
    Accession # Name E value: Bit Score:
    AY594253 Human Adenovirus 0.0 868.765
    Serotype 4
    AY594254 Human Adenovirus 0.0 868.765
    serotype 4, vaccine
    strain
    gi|209874|gb|M14918.1 ADRDE1AA 0.0 860.836
    Adenovirus type 4
    E1A region
  • TABLE 16
    Ad4FIBER: Adenovirus 4 GenomiPhi3
    Accession # Name E value: Bit Score:
    gi|434913|emb|X76547.1 AV4FIB1 0.0 1031.32
    Adenovirus type 4
    gene for fiber
    protein
    AY594254 Human Adenovirus 0.0 926.254
    serotype 4, vaccine
    strain
    AY594253 Human Adenovirus 0.0 926.254
    Serotype 4
    AY599837 Human Adenovirus 0.0 743.877
    serotype 4, USAF
    Field Strain
  • TABLE 17
    Ad4HEXON-1: Adenovirus 4 GenomiPhi3
    Accession # Name E value: Bit Score:
    AY594254 Human Adenovirus 0.0 1065.02
    serotype 4, vaccine
    strain
    AY594253 Human Adenovirus 0.0 1065.02
    Serotype 4
    gi|11693508|gb| Human adenovirus 0.0 1065.02
    AF065062.2| type 4 strain RI-67
    AF065062 pVI core protein
    AY599835 Human Adenovirus 2.96209E−147 529.782
    serotype 4, US
    Navy Field Strain
  • Based on the results evidenced by FIG. 2, GenomiPhi total amplification allowed the entire tiled region (increased sensitivity) to be resequenced compared to the more limited region resulting from conserved (degenerate) multiplex PCR. This result arises due to the fact that GenomiPhi total amplification does not rely on primer sequences within the tiled fragment. REPI listed the appropriate adenovirus type (AY594254 or AY594253) as the 10 highest scoring return for each tile region with the exception of Ad4FIBER. This discrepancy was later resolved by observing that the early draft sequence of the adenovirus type 4 prototype (AY594253) contained errors that gave rise to a slightly higher homology between the sequence used to define Ad4FIBER and a GenBank record for a different adenovirus type 4 strain (gi|11693508|gb|AF065062.2|AF065062).
  • With this one exception, it is also important to note that irrespective of which amplification strategy was employed, i.e., conserved (degenerate) multiplex PCR or GenomiPhi total amplification, the proper Ad4 calls were made (except in case of Ad4FIBER with GenomiPhi due to tile sequence errors). The consistency between these methods is important as the conserved primers may have a more direct application to serotyping members of the same family of pathogens from complex samples without the need for selective enrichment.
    • EXAMPLE 2 Ad4 Dilution Series
  • In the present example, hybridization and base calling was assayed as a function of the initial concentration of the target subsequent to conserved (degenerate) multiplex PCR. In addition, this example also compares two different base-calling strategies within the GDAS software: (a) “permissive” (described in Specification) and (b) “conservative” (default) settings. The biological sample utilized in this example was the adenovirus 4 prototype.
  • Hybridization and base calling were assayed as a function of the initial concentration of the target subsequent to conserved (degenerate) multiplex PCR. A dilution series of the adenovirus 4 prototype (ATCC) was prepared having 105, 103, and 101 genomic copies per microliter. To this end, the Affymetrix CustomSeq protocol was followed, except that samples aliquoted from the aforementioned dilutions were amplified using the conserved (degenerate) multiplex adenovirus primer strategy for E1A, fiber, and hexon genes.
  • Tables 18-20 demonstrate the ability of the RPMV 1 chip with REPI analysis to detect the appropriate Adenovirus type 4 target (not specific to strain) depending on whether “Conservative” (default GDAS) or “Permissive” (from Example 1) base call settings were used. A positive detection was counted when REPI returned one or more GenBank (or local) database record(s) for an Adenovirus type 4 target as the highest BLAST bit score value(s). In each case, “length” corresponds to the number of base pairs in the subsequence selected by REPI as having satisfied the conditions of the sliding window algorithm.
    TABLE 18
    Ad4 Fiber
    Conservative Permissive
    Dilutions Expt. Score Eval name length Expt. Score Eval name length
    105 1 835.065 E−0.0 Ad4 Fiber 1227  1 1623.97 0.0 Ad4 Fiber 1227 
    Protein Protein
    1-2 1015.46 E−0.0 Ad4 Fiber 990 1-2 1447.89 0.0 Ad 4 Fiber 997
    Protein Protein
    1-3 297.846 E−78 Ad4 Fiber 451 1-3 703.626 0.0 Ad4 Fiber 512
    Protein Protein
    1-4 839.03 0.0 Ad4 Fiber 1059  1-4 1605.08 0.0 Ad4 Fiber 1215 
    Protein Protein
    103 2 488.153 E−134 Ad4 Fiber 1208  2 1559.2 0.0 Ad4 Fiber 1220 
    Protein Protein
     2-2* n/d — — 2-2 n/d — —
    2-3 232.429 E−58 Ad4 Fiber 421 2-3 405.389 E−110 Ad4 Fiber 444
    Protein Protein
    2-4 n/d — — 2-4 n/d — —
    101 3 172.958 E−40 Ad4 Fiber 294 3 301.101 E−79 Ad4 Fiber 442
    Protein Protein
     3-2* n/d — — 3-2 n/d — —
    3-3 n/d — — 3-3 118.758 E−24 Ad4 Fiber 279
    Protein
    3-4 99.61 E−19 Ad4 Fiber  93 3-4 116.39 E−24 Ad4 Fiber  95
    Protein Protein

    *indicates degraded template; n/d indicates “not determined” due to insufficient base calls
  • TABLE 19
    Ad4 E1A
    Conservative Permissive
    Dilutions Expt. Score E-val name length Expt. Score Eval name length
    105 1 448.5 E−123 Ad4 E1A region 553 1 775.595 E−0.0 Ad4 E1A region 556
    1-2 420.8 E−115 Ad4 E1A region 422 1-2 691.471 E−0.0 Ad4 E1A region 444
    1-3 n/d — — 1-3 561.5 E−157 Ad4 E1A region 413
    1-4 353.4 E−94 Ad4 E1A region 424 1-4 589.253 165 Ad4 E1A region 424
    103 2 341.5 E−91 Ad4 E1A region 399 2 607.1 E−171 Ad4 E1A region 412
     2-2* n/d — — 2-2 n/d — —
    2-3 194.8 E−47 Ad4 E1A region 404 2-3 470.774 E−130 Ad4 E1A region 421
    2-4 n/d — — 2-4 n/d — —
    101 3 n/d — — 3 385.836 E−104 Ad4 E1A region 405
     3-2* n/d — — 3-2 n/d — —
    3-3 n/d — — 3-3 199.58 E−48 Ad4 E1A region 403
    3-4 412.8 E−112 Ad4 E1A region 397 3-4 640.794 E−0.0 Ad4 E1A region 398
  • TABLE 20
    Ad4 Hexon
    Conservative Permissive
    Dilutions Expt. Score Eval name length Expt. Score Eval name length
    105 1 377.1 E−101 Ad4 Hexon gene 760 1 893.45 0.0 Ad4 Hexon gene 769
    1-2 603.13 E−0.0 Ad4 Hexon gene 760 1-2 941.874 E−0.0 Ad4 Hexon gene 768
    1-3 107.5 E−21 Ad4 Hexon gene 262 1-3 246.762 E−62 Ad4 Hexon gene 497
    1-4 498.1 E−138 Ad4 Hexon gene 760 1-4 920.916 E−0.0 Ad4 Hexon gene 762
    103 2 383.1 E−103 Ad4 Hexon gene 759 2 826.865 E−0.0 Ad4 Hexon gene 759
     2-2* n/d — — 2-2 n/d — —
    2-3 n/d — — 2-3 n/d — —
    2-4 n/d — — 2-4 n/d — —
    101 3 n/d — — 3 78.8677 E−12 Ad4 Hexon gene 143
     3-2* 71.86 E−11 Ad4 Hexon gene  65 3-2 107.54 E−21 Ad4 Hexon gene  72
    3-3 n/d — — 3-3 n/d — —
    3-4 n/d — — 3-4 149.17 E−33 Ad4 Hexon gene 209

    *indicates degraded template;

    n/d indicates “not determined” due to insufficient base calls
  • Across the range of dilutions, the “Permissive” base call settings produced GDAS outputs that were used by REPI to consistently yield higher subsequence lengths and bit scores than those outputs using the default GDAS base call settings, for SNP detection. In several cases, the “Permissive” base call settings resulted in a sufficient number of base calls for REPI to detect the target whereas the default settings did not. This example demonstrates that by lowering the restrictions on base calling by GDAS and coupling the output to the REPI algorithm, higher sensitivity and discriminatory power (strain identification) among pathogens is achieved.
  • Of particular note here is that in some cases, there was evidence contained in the image, GDAS output, and REPI analyses, of unintentional contamination of the degenerate primer cocktail with trace amounts of Adenovirus 7 and Adenovirus 5 (confirmed by specific real-time PCR). Because there was no significant cross-hybridization between the tile regions for the prototype adenoviruses, this contamination did not result in a perturbation of the base calling or results in the Adenovirus 4 tile regions. This demonstrates the robustness of the methods described herein to perform quantitative separation of mixtures of closely related pathogens.
  • It is noteworthy that the Andersen group at Lawrence Livermore National Laboratory (Wilson et al., 2002b) described the use of an Affymetrix resequencing chip that could detect a low concentration (˜101 copies) following specific PCR amplification. However, it was not disclosed or suggested how this sensitivity was defined or to what extent those results were influenced by hybridization of closely related microbial species. Rather, the emphasis in that paper was the percentage of probe pairs that could be used, not the actual sequences as they were called by the chip. Therefore, the artisan would not have any expectation resulting from the disclosure. Nor would the skilled artisan have inferred this possibility from the previous patent (U.S. Pat. No. 6,228,575) or related publication (Gingeras et al., 1998) since these references fail to disclose or suggest robustness of the prescribed methods of pattern recognition to concentration differences, errors in the definition of tile region sequences, or other forms of interference.
    • EXAMPLE 3 Base Calling Algorithm Settings and BLAST Analysis of Base Calls for Adenovirus Field Strain (Ad5FS: AY601635) and Adenovirus 7 Prototype (Ad7; AY594255) Using Conserved (Degenerate) PCR Primers and GenomiPhi Total Amplification
  • This example is the same as Example 1, except the resequencing microarray chip (RPMV1) described above in Preparation Example 1 was probed with adenovirus type 5 field strain (Ad5FS; AY601635) or adenovirus type 7 prototype (AY594255) using either (a) conserved (degenerate) multiplex PCR or (b) GenomiPhi total amplification (FIG. 3). Based on the GDAS outputs (using “permissive” settings), REPI identified the following 3 top “hits” for the conserved PCR and total amplification strategies with each of the Ad5 prototype and the Ad7 prototype. Without exception, each subsequence called by the adenovirus type 5 tile regions (Ad5E1A, Ad5FIBER, Ad5FIBER, Ad5HEXON-1 and Ad5HEXON-2) listed the top “hit” (highest BLAST bit score) as the correct prototype strain for adenovirus type 5 (Ad5FS; Accession number AY601635) using either conserved PCR amplification or total (GenomiPhi) amplification.
  • Also, without exception, each subsequence for the adenovirus type 7 tile regions (Ad7E1A, Ad7FIBER, Ad5HEXON-1 and AdSHEXON-2) listed the top “hit” (highest BLAST bit score) as the correct prototype strain for adenovirus type 7 (Ad7; Accession number AY594255) when using either conserved PCR or total (GenomiPhi) amplification. In addition, GenomiPhi amplification led to base calls from both the Ad4E1A regions and the Ad7vaccine regions, both resulting in top bit scores assigned to the correct Ad7 prototype strain.
  • The results obtained for the adenovirus type 5 and adenovirus type 7 prototypes confirmed those for adenovirus type 4. Specifically, the results shown in FIGS. 3A-D show that GenomiPhi total amplification allowed the entire tiled region (increased sensitivity) to be resequenced compared to the more limited region resulting from conserved (degenerate) multiplex PCR. More importantly, these results confirm that irrespective of which amplification strategy was employed, i.e., conserved (degenerate) multiplex PCR or GenomiPhi total amplification, the proper Ad5 or Ad7 calls were made.
    • EXAMPLE 4 Ad4-5 Breakthrough Strain as a Model of Mixed Infection Detectable by Resequencing Microarray Assay
  • The sample for this example was provided by the Naval Health Research Center (San Diego). The archived sample was a nasal wash from a basic trainee who had previously been immunized for adenovirus (using the Ad4/Ad7 vaccine) and who subsequently was diagnosed with adenovirus infection and febrile respiratory illness. Strains associated with infection in spite of previous vaccination are broadly referred to as “breakthrough strains”. In this case, the presumption was that a single variant form of adenovirus was the causative agent. The sample described here is referred to as Ad4-5 Breakthrough because of inconclusive culture and serological assays that indicated properties of both adenovirus types 4, while sequencing of the hexon gene (one of antigenic determinants of adenovirus serotype) indicated properties of adenovirus type 5.
  • The sample was processed according to the multiplex degenerate primer PCR protocol described in Preparation Example 1. This approach was demonstrated to (Lin et al 2004) successfully amplify hypervariable regions on hexon and fiber genes (as well as a relatively variable E1A region) for all adenoviruses associated with febrile respiratory infection. Otherwise, the standard Affymetrix CustomSeq protocol was used.
  • The resultant hybridization pattern is shown is FIG. 4. Based on the GDAS outputs (using “permissive” settings), REPI identified the following 3 top “hits” for total amplification strategies by multiplex PCR (See Tables 21-24).
    TABLE 21
    Ad5FIBER: Ad 4-5 Breakthrough Strain
    Accession # Name E value: Bit Score:
    lcl|AY601635 Human 5.01036E−76 291.899
    Adenovirus
    Serotype 5,
    Field Strain
    gi|33694637| TPA: Human 5.01036E−76 291.899
    tpg|BK000408.1 adenovirus type 5
    gi|32127287| Human 5.01036E−76 291.899
    gb|AY224398.1 adenovirus type
    5 strain KNIH
    99/5 fiber gene
  • TABLE 22
    Ad5HEXON-1: Ad 4-5 Breakthrough Strain
    Accession # Name E value: Bit Score:
    lcl|AY601635 Human 0.0 644.759
    Adenovirus
    Serotype 5,
    Field Strain
    gi|33694637| TPA: Human 1.81596E−172 613.041
    tpg|BK000408.1 adenovirus type 5
    gi|32127287| Human 2.63084E−165 589.253
    gb|AY224398.1 adenovirus type
    5 strain KNIH
    99/5 fiber gene
  • TABLE 23
    Ad7E1A: Ad 4-5 Breakthrough Strain
    Accession # Name E value: Bit Score:
    gi|4127293|emb| Adenovirus 3.18875E−83 315.688
    AJ005536.1|ACA005536 clinical isolate,
    clone B44
    from genomic
    DNA
    lcl|AY601633 Human 4.97873E−82 311.723
    Adenovirus
    Serotype 21
    gi|21311720| Human 1.21371E−79 303.794
    gb|AF492353.1 adenovirus
    type 21 E1A
    13S protein
    gene
    lcl|AY601634 Human 2.95877E−77 295.864
    Adenovirus
    Serotype 7, US
    Navy Field
    Strain
  • TABLE 24
    Ad7HEXON-1: Ad 4-5 Breakthrough Strain
    Accession # Name E value: Bit Score:
    lcl|AY601633 Human Adenovirus 6.98074E−24 117.452
    Serotype 21
    gi|13919592| Human adenovirus type 6.98074E−24 117.452
    gb|AY008279.1 21 hexon protein gene
    gi|21311720| Human adenovirus 6.98074E−24 117.452
    gb|AF492353.1 type 50
    lcl|AY594255 Human Adenovirus  6.0101E−12 77.8048
    Serotype 7
    lcl|AY601634 Human Adenovirus  6.0101E−12 77.8048
    Serotype 7, US Navy
    Field Strain
  • Selected REPI return values for Adenovirus 4,5 Breakthrough Strain on RPMV1. This “strain” was determined by several independent means to be a mixture of adenovirus type 5 and a B subgroup member, most likely being adenovirus type 21. This was borne out in the combined hybridization results and REPI analysis, with adenovirus type 5 being confirmed on all adenovirus 5 tiles, while the B subgroup prototype (adenovirus 7; AY594255) tiles returned the highest bit scores for a adenovirus type 21, a different member of the B subgroup.
  • Conventional DNA sequencing revealed that the complete adenovirus 5 genome was recovered and that other sequences were present that could not be assembled because an Adenovirus 5 model assumption was required. However, a significant amount of corroborating evidence was amassed to support the conclusion of an Ad5/Ad 21 co-infection, including similar results obtained in parallel experiments with 70-mer oligonucleotide arrays (Lin et al 2004) showing evidence of an Ad 5/Ad 21 mixture or co-infection, and sequencing of amplicons using conventional approaches that supported the presence of both Ad5 and Ad 21. An extended study conducted subsequently of adenovirus breakthrough strains (in collaboration with NHRC San Diego) showed that a variety of such strains were actually comprised of mixtures of lesser adenoviruses (manuscript in preparation).
  • There are several significant aspects and advantages implicit in this discovery:
      • 1. demonstration that a prototype region (Ad 7 for B subgroup) could be used to successfully identify a different B subgroup member (Ad 21) without specific a priori design or anticipation of discovering Ad 21 in a sample.
      • 2. demonstration of a microarray to distinguish mixed pathogens due to spatial resolution. This mixture confounded a conventional DNA sequencing approach that relied on assembly of contiguous fragments based on assumption of a single organism.
    EXAMPLE 5 Influenza A Strain Identification Using Prototype Regions
  • Influenza A positive clinical samples of unknown serotype were collected during the 2002-2003 and 2003-2004 flu seasons and provided to Dr. Zheng Wang as frozen nasal washes by Dr. Elizabeth Walter.
  • Samples were processed for pathogen chip analysis as follows:
  • EPICENTRE MasterPure™ DNA Purification Kits (Madison, Wis.) were used to extract total nucleic acids from 50 Ill of nasal wash (sample NW20031114-05-02) without RNase treatment. Sample NW20031114-05-02 was collected on Nov. 14, 2003 at Lackland Air Force Base (San Antonio, Tex.). The patient was vaccinated on Nov. 10, 2003. The total nucleic acids were suspended in 20 μl nuclease free H2O. Two-step RT-PCR was employed to amplify each of the viral gene segments.
  • Briefly, the RNA in 4 μl total nucleic acids was transcribed into cDNA by using SuperScript™ III Reverse Transcriptase (Invitrogen, Carlsbad, Calif.) according to the protocol provided by the manufacturer and 100 pmol Uni3 primer in 20 μl. The RT (reverse transcription) reaction was performed at 42° C. for 1 hr and then was inactivated at 70° C. for 15 min. 2 μl of the RT-reaction was used for cDNA amplification. The cDNA was amplified by using TaqPlus Long System (Stratagene, La Jolla, Calif.) according to protocol provided. Two different PCR conditions were used for amplification. For universal PCR, universal primers uni3 and uni5 were used to amplify all eight segments of hemagglutinin (HA), neuraminidase (NA) and matrix (M) (see Hoffman et al, 2001). For multiplex PCR, segments were amplified by mixing three segment specific primer pairs (Bm-HA-1/Bm-NS-890R, BA-Na-1/Ba-Na-1413R and Bm-M-1/Bm-M-1027R). The final concentration of Mg2+-ions was 2 mM and final primer concentration was 1 μM. PCR condition for universal amplification was: 94° C. for 2 min followed by 29 cycles of 94° C. for 1 min, 40° C. for 2 min. 72° C. for 3 min, and final extension at 72° C. for 10 min. The multiplex PCR condition was basically same except that the annealing temperature was raised to 58° C. PCR products were purified by Qiagen PCR Purification kit. 500 ng of universally amplified PCR products and 1000 ng of multiplex PCR products were applied to two V1 Pathogen chips for hybridization according to Affymetrix protocol, respectively.
  • Primer Sequences (from Hoffman et al, 2001)
    Uni3: AGCAAAAAGCAGG (SEQ ID NO:431)
    Uni5: AGTAGAAACAAG (SEQ ID NO:432)
    Bm-HA-1: TATTCGTCTCAGGGAGCAAAAGCAGGGG (SEQ ID NO:433)
    Bm-NS-890R: ATATCGTCTCGTATTAGTAGAAACAAGGGTGTTTT (SEQ ID NO:434)
    Ba-Na-1: TATTGGTCTCAGGGAGCAAAAGCAGGAGT (SEQ ID NO:435)
    Ba-Na-1413R: ATATGGTCTCGTATTAGTAGAAACAAGGAGTTTTTT (SEQ ID NO:436)
    Bm-M-1: TATTCGTCTCAGGGAGCAAAAGCAGGTAG (SEQ ID NO:437)
    Bm-M-1027R: ATATCGTCTCGTATTAGTAGAAACAAGGTAGTTTTT (SEQ ID NO:438)
  • The chip scan results are shown for each of the two amplification protocols: (a) universal primer PCR and (b) multiplex PCR (FIG. 5). Based on the GDAS outputs (using “permissive” settings), REPI identified the following 3 top “hits” for the universal primer (Hoffman et al., 2001) amplification method and total amplification strategies with each of the Ad5 prototype and specific multiplex PCR method (See Table 25).
  • For this experiment, the present inventors obtained sequence for the HA gene of the Flu strain that evaded the 2003-2004 vaccine and caused widespread illness, namely Fujian/411/2002 (note: only the HA sequence was available for Fujian/411/2002) and incorporated that into the database searched by REPI. Each of the two amplification methods produced effectively the same results, although bit scores varied slightly. Specifically, Fujian 411/2002 returned the highest bit score for FluAHA3 in the REPI output files. Moscow 10/99, the strain used for vaccination in 2003, did not return a REPI output for FluAHA3.
    TABLE 25
    FluAHA3: NW20031114-05-02 ACID04-B2
    Accession # Name E value: Bit Score:
    lcl|ISDN38157 InfluenzaA/Fujian/411/ 0.0 1431.75
    2002_Hemagglutinin_104
    gi|37530025| Influenza A virus 0.0 1431.75
    gb|AY389356.1 (A/Middleburg/41/03(H3N2))
    hemagglutinin (HA) gene
    gi|37530033| Influenza A virus 0.0 1423.83
    gb|AY389360.1 (A/Pretoria/17/03(H3N2))
    hemagglutinin (HA) gene
    gi|37530031| Influenza A virus 0.0 1423.83
    gb|AY389359.1 (A/Pretoria/16/03(H3N2))
    hemagglutinin (HA) gene
  • The highest BLAST bit score for HA3 was achieved for (InfluenzaA/Fujian/411/2002_Hemagglutinin—104), the H3N2 etiologic agent of the 2003-2004 Influenza outbreak in the United States that evaded protection by vaccination. An indistinguishable viral sequence for HA3 also achieved the same bit score. Over 500 GenBank records were returned for HA3, all having expect values of 0.0 and bit scores ranging from those shown above to 995.636. The vaccine strain, (A/Panama/2007/99(H3N2)), was not in the list of returned Influenza A strains in the HA3 region. Note: sequence for InfluenzaA/Fujian/411/2002_Hemagglutinin—104 was only available for HA, so other regions are not compared here.
  • Although not shown, the present inventors have been able to identify the H1N1 outbreak strain from the 2002-2003 flu season.
    • EXAMPLE 6 Reduced Hybridization Times
  • The Affymetrix CustomSeq protocol specifies that the hybridization step be at least 16 hours to facilitate maximum hybridization. For the intended purpose of a diagnostic capability, this could be prohibitively long. Therefore, the applicability and efficiency of the present methodologies to short hybridization times was assessed.
  • In the present example hybridization and base calling were performed, using samples that were amplified by specific PCR reagents and then hybridized for periods of either 1 hour, 30 minutes, or 15 minutes on the resequencing microarray chip (RPMV1) described above in Preparation Example 1. For this comparative study the Affymetrix CustomSeq protocol was followed with the exception of varying hybridization time. In the example data shown (FIG. 6), a nasal wash that was negative for all targets probed by the microarray except the erythromycin resistance markers SPYERMB, SPYERMTR, and SPYMEFAE was subjected to specific PCR for each of those markers. The amplicons were then hybridized to separate microarrays for either 16 hours or 15 minutes, and then processed otherwise as prescribed by the Affymetrix protocol.
  • The results appear in FIG. 6A [16 hours; ex-6a]) and FIG. 6B [2 hours; ex-6b]. Based on the GDAS outputs (using “permissive” settings), REPI identified the following 3 top “hits” for the 16 hour hybridization and the 15 minute hybridization, respectively.
  • The corresponding GDAS and REPI analyses show that the number of base calls resulting is fewer in the case of the 15 minute hybridization compared to that for the 16 hour hybridization (See Tables 26-31). For example, the SPYERMB tile region produced a subsequence length of 219 bp (98% of tile region, 95% base calls made within the subsequence) for a 16 hour hybridization, while discontinuities in the hybridization pattern from a 15 minute hybridization resulted in fragmentation of the tile into two subsequences of lengths 100 bp (45% of tile region, 99% base calls made within subsequence) and 87 bp (39% of tile region, 99% base calls made in subsequence).
    TABLE 26
    SPYERMB: BL_JMS_020604_TW_3c (16 hour hybridization)
    Accession # Name E value: Bit Score:
    gi|21886737| Enterococcus faecium 1.90377E−98 365.247
    gb|AF516335.1 plasmid pUW786 multiple
    antibiotic resistance gene
    cluster
  • TABLE 27
    SPYERMB: BL_JMS_020604_TW_3b (15 minute hybridization)
    Accession # Name E value: Bit Score:
    gi|21886737| Enterococcus faecium 1.6409E−47 194.764
    gb|AF516335.1 plasmid pUW786 multiple
    antibiotic resistance gene
    cluster
  • TABLE 28
    SPYERMTR: BL_JMS_020604_TW_3c (16 hour hybridization)
    Bit
    Accession # Name E value: Score:
    gi|2190969|gb| Streptococcus pyogenes 3.18989E−13 79.787
    AF002716.1| leader peptides 1 (lpg1)
    AF002716 and 2 (lpg2), and
    erythromycin resistance
    methylase (ermTR) gene
  • TABLE 29
    SPYERMTR: BL_JMS_020604_TW_3b (15 minute hybridization)
    Accession # Name E value: Bit Score:
    No calls N/A N/A N/A
  • TABLE 30
    SPYMEFAE: BL_JMS_020604_TW_3c (16 hour hybridization)
    Accession # Name E value: Bit Score:
    gi|22121182|gb|AY071836.1 Strepto- 1.01677E−60 240.358
    coccus
    sp. 6
    macrolide-
    efflux
    protein
    (mefA) gene
  • TABLE 31
    SPYMEFAE: BL_JMS_020604_TW_3b (15 minute hybridization)
    Accession # Name E value: Bit Score:
    gi|22121182|gb|AY071836.1 Streptococcus 3.331E−36 159.081
    sp. 6
    macrolide-
    efflux
    protein
    (mefA) gene
  • The tables above show the comparative top rankings for the three different antibiotic resistance markers described in Example 6 for 16 hour versus 15 minute hybridization times. Although the SPYERMTR tile region did not produce a sufficient number of base calls to allow identification following a 15-minute hybridization, both the SPYERMB and SPYMEFAE returned high bit scores for the same variants of the antibiotic resistance markers comprising the tile regions (identified in Table 9).
  • However, the REPI output for each of the three tile regions showed that the highest bit scores in each region were the same (except for SPYERMTR which lacked sufficient base calls for the 15 minute hybridization), although both the bit scores and expect values were different in each case. Similar results were obtained for 30 minute and 1 hour hybridizations, with an increase in the number of base calls made with increasing hybridization times. Further, this example clearly illustrates the robustness of the method to make fine scale discrimination between targets with a range of different hybridization patterns.
    • EXAMPLE 7 Subtractive Hybridization
  • A variety of methods might be employed to reduce the amount of background human DNA in clinical samples when using total amplification. One method is direct subtraction of the background genomic DNA from amplified products in hybridization solution with COT-1 fraction human genomic DNA that consists largely of rapidly annealing repetitive elements. Another method is bead-based subtraction of background genomic DNA from clinical sample prior to total amplification. A third method is the combination of the above methods, the genomic background DNA from clinical sample were subtracted using bead-based subtraction prior to total amplification, subsequently, the background DNA might be further subtracted from the clinical sample in hybridization solution with COT-1 human DNA.
  • Methods for FIGS. 7A and 7B
  • A nasal wash was collected from one clinical sample and the total nucleic acid was isolated using MasterPure™ DNA purification kit (Epicentre). The nucleic acid was predigested with McrBc (an endonuclease that cleaves DNA containing methylcytosine on one or both strands) at 37° C. for one hour, and then heated to 65° C. to denature the enzyme. Subsequently, the sample was split to two aliquots and amplified with GenomiPhi DNA amplification kit (Amersham Biosciences). The amplified products were fragmented and labeled according to Affymetrix CustomSeq protocol.
  • For this comparative study the Affymetrix CustomSeq protocol was followed except for the following changes. The clinical sample was hybridized to the resequencing microarray chips (RPMV1) either with standard hybridization solution according to Affymetrix CustomSeq protocol (FIG. 7A) or with hybridization mixture containing 12 μg Herring Sperm DNA and 10 μg COT-1 human DNA (Roche, Indianapolis, Ind.) instead of 22 μg Herring sperm DNA as Affymetrix recommended (FIG. 7B).
  • Methods for FIGS. 7C and 7D
  • The present example describes bead-base subtraction and the combination of bead-base subtraction with subtractive hybridization methods for increasing the pathogen specific signal-to-noise ratio when using total amplification.
  • COT-1 human DNA, consisting largely of rapidly annealing repetitive elements, was biotinylated at 3′-end using terminal transferase (Tdt) (NEB) to generate Biotinylated Subtraction Probes (BSPs). An aliquot of ˜400 ng of BSPs was incubated at 95° C. for 10 minutes in 4×SSC and 0.2% SDS with nucleic acid extract of clinical nasal wash (diagnosed as Ad4 positive clinical sample) predigested with McrBC at 37° C. for one hour, then slowly cooled to 65° C. to allow co-hybridization with the HMB for one hour. After hybridization, the BSP-HMB complexes were incubated at room temperature for 30 minutes at 1×PBS, 0.1% BSA with BcMag.Streptavidin Magnetic Beads (SMBs, Bioclone). The beads were separated from supernatant using a magnetic separator. The supernatant was then transferred to a new tube and the magnetic beads were washed once with 133 PBS, 0.1% BSA. The supernatants were combined and precipitated with ethanol. The DNA pellet was resuspended with nuclease free water (Ambion) then split to two aliquots and amplified with GenomiPhi DNA amplification kit (Amersham Biosciences) according to the manufacture recommended protocol. Briefly, 1 ml DNA template was denatured with 9 μl of sample buffer at 95° C. for 3 minutes, the cooled down to 4° C. In a separate tube, 1 μl of enzyme was mixed with 9 μl of reaction buffer, and then the mixture was added to the denatured DNA template. The reaction was then performed at 30° C. for 18 hours at Thermal Cycler-PTC225 (MJ Research Inc., Reno, Nev.).
  • For this comparative study, the amplified products were hybridized to the resequencing microarray chips (RPMV1) either with standard hybridization solution according to Affymetrix CustomSeq protocol (FIG. 7C) or with hybridization mixture containing 12 μg Herring Sperm DNA and 10 μg COT-1 human DNA instead of 22 μg Herring sperm DNA as Affymetrix recommended (FIG. 7D).
  • Methods for FIG. 7E
  • The combination of bead-base subtraction and subtractive hybridization procedure was repeated with double amount of initial material and the result appearing in FIG. 7E evidenced that the present inventors were able to subtract human background from clinical sample for the resequencing microarray chip (RPM Version 1 chip) described above in Preparation Example 1 to resolve the presence and identification of Ad4 hexon and fiber genes in the clinical sample.
  • Subtractive Hybridization Results
  • The results of the subtractive hybridization approaches are shown in FIG. 7. As shown in FIG. 7A, total amplification of the isolated nucleic acids resulted in significant background hybridization to the RPMV1 microarray. Although the adenovirus type 4 region showed a discernibly higher signal than that of the overall background, GDAS was unable to make enough base calls to satisfy the sliding window condition in REPI, so no attempts to BLAST the data were made. Co-hybridizing the same set of total amplicons with COT-1 human genomic DNA did little to improve this (FIG. 7B) and no base calls were made. FIG. 7C shows that the use of a magnetic bead-based subtraction alone, prior to total amplification, again did not result in a sufficient number of base calls to allow similarity searching.
  • However, through the combined use of a bead-based subtraction prior to amplification and co-hybridization with COT-1 human DNA, enough base calls could be made to identify and rank the adenovirus 4 field strains (Navy and Air Force without discrimination) higher than those of the vaccine and prototype adenovirus 4 strains in each of three subsequences identified in the Ad4HEXON-1 tile region (FIG. 7D and Table 32).
    TABLE 32
    Ad4HEXON-1: BL_818141_030503_NW_4
    Accession # Name E value: Bit Score:
    lcl|AY599837 Human Adenovirus 6.14232E−37 161.064
    serotype 4, USAF
    Field Strain
    lcl|AY599835 Human Adenovirus 6.14232E−37 161.064
    serotype 4, US Navy
    Field Strain
    lcl|AY594254 Human Adenovirus 1.49737E−34 153.134
    serotype 4, vaccine
    strain
    lcl|AY594253 Human Adenovirus 1.49737E−34 153.134
    Serotype 4
  • Moreover, by performing the same set of combined steps using 2 microliters of starting sample material instead of 1 microliter (FIG. 7E), base calling was extended into the Ad4FIBER tile region (see Table 33) in addition to Ad4HEXON-1 (see Table 34), allowing unambiguous high bit-score ranking for Ad4 Field Strain (though not distinguishing between Air Force and Navy field strains) versus prototype (AY594253) or vaccine strain (AY594254) in several Ad4FIBER subsequences. However, the Ad4 Air Force Field Strain (Accession No. AY599837) was distinguishable from the Navy field strain (AY599835) in the Ad4HEXON-1 tile because an increased number of base calls allowed for a more complete sequence comparison and increased bit score resolution.
    TABLE 33
    Ad4FIBER: BL_818141_030503_NW_9b
    Accession # Name E value: Bit Score:
    lcl|AY599837 Human Adenovirus 3.51948E−22 111.505
    serotype 4, USAF
    Field Strain
    lcl|AY599835 Human Adenovirus 3.51948E−22 111.505
    serotype 4, US Navy
    Field Strain
    lcl|AY594254 Human Adenovirus 8.57976E−20 103.575
    serotype 4, vaccine
    strain
    lcl|AY594253 Human Adenovirus 8.57976E−20 103.575
    Serotype 4
  • TABLE 34
    Ad4HEXON-1: BL_818141_030503_NW_9b
    Accession # Name E value: Bit Score:
    lcl|AY599837 Human Adenovirus 1.59752E−70 274.058
    serotype 4, USAF
    Field Strain
    lcl|AY599835 Human Adenovirus 9.49375E−66 258.199
    serotype 4, US Navy
    Field Strain
    lcl|AY594254 Human Adenovirus 5.64196E−61 242.34
    serotype 4, vaccine
    strain
    lcl|AY594253 Human Adenovirus 5.64196E−61 242.34
    Serotype 4
    • EXAMPLE 8 RPMV2 Chip and Design thereof
  • A listing of the sequence tiles for the RPM V2 chip is listed below in (Table 35). This represented an approximate 10-fold increase in the content of the RPM V1 chip.
    TABLE 35
    RPMV2 Chip Table
    SEQ
    Accession Number: ID
    Alias Organism Gene Name Seq Num Length NO:
    ATTIM1 Arabidopsis thaliana(1) triosephosphate isomerase (TIM) 523 59
    Ad3E1A Adenovirus 3 E1A AY599834: 576-1455 879 60
    Ad3HEXON Adenovirus 3 Hexon AY599834: 18420-21254 595 61
    Ad3FIBER Adenovirus 3 Fiber AY599834: 31370-32329 746 62
    Ad7E1A Adenovirus 7 E1A AY594255: 577-1445 868 63
    Ad7HEXON Adenovirus 7 Hexon AY594255: 18419-21232 513 64
    Ad7FIBER Adenovirus 7 Fiber AY594255: 31320-32297 977 65
    Ad7NAVYE1A Adenovirus 7 FS Navy E1A AY601634: 575-1454 879 66
    Ad7NAVYHEXON Adenovirus 7 FS Navy Hexon AY601634: 18408-21210 504 67
    Ad7NAVYFIBER Adenovirus 7 FS Navy Fiber AY601634: 31320-32295 975 68
    Ad16E1A Adenovirus 16 E1A AY601636: 574-1452 878 69
    Ad16HEXON Adenovirus 16 Hexon AY601636: 18450-21272 667 70
    Ad16FIBER Adenovirus 16 Fiber AY601636: 31448-32509 652 71
    Ad21E1A Adenovirus 21 E1A AY601633: 574-1452 878 72
    Ad21HEXON Adenovirus 21 Hexon AY601633: 18454-21303 807 73
    Ad21FIBER Adenovirus 21 Fiber AY601633: 31406-32377 685 74
    Ad11E1A Adenovirus 11 E1A AY163756: 568-1440 872 75
    Ad11HEXON Adenovirus 11 Hexon AY163756: 18254-21100 677 76
    Ad11FIBER Adenovirus 11 Fiber AY163756: 30811-31788 977 77
    Ad35E1A Adenovirus 35 E1A AY271307: 569-1441 872 78
    Ad35HEXON Adenovirus 35 Hexon AY271307: 18257-21115 689 79
    Ad35FIBER Adenovirus 35 Fiber AY271307: 30827-31798 971 80
    Ad1E1A Adenovirus 1 E1A 33330439: 560-1546 986 81
    Ad1HEXON Adenovirus 1 Hexon 33330439: 18861-21755 715 82
    Ad1FIBER Adenovinis 1 Fiber 33330439: 31101-32849 750 83
    Ad2E1A Adenovirus 2 E1A 33694600: 559-1542 983 84
    Ad2HEXON Adenovirus 2 Hexon 33694600: 18838-21744 837 85
    Ad2FIBER Adenovirus 2 Fiber 33694600: 31030-32778 750 86
    Ad5E1A Adenovirus 5 E1A 33465830: 560-1545 985 87
    Ad5HEXON Adenovirus 5 Hexon 33465830: 18842-21700 732 88
    Ad5FIBER Adenovirus 5 Fiber 33465830: 31037-32782 747 89
    Ad6E1A Adenovirus 6 E1A CBI 985 90
    Ad6HEXON Adenovirus 6 Hexon X67710 833 91
    Ad6FIBER Adenovirus 6 Fiber AB108424 750 92
    Ad4E1A Adenovirus 4 E1A AY594253: 576-1441 865 93
    Ad4HEXON Adenovirus 4 Hexon AY594253: 18248-21058 2810 94
    Ad4FIBER Adenovirus 4 Fiber AY594253: 31645-32922 1277 95
    Ad4AFE1A Adenovirus 4 FS AF E1A AY599837: 575-1407 832 96
    Ad4AFHEXON Adenovirus 4 FS AF Hexon AY599837: 18179-20989 2810 97
    Ad4AFFIBER Adenovirus 4 FS AF Fiber AY599837: 31463-32740 1277 98
    Ad12E1A Adenovirus 12 E1A 9626621: 503-1099 597 99
    Ad12HEXON Adenovirus 12 Hexon 9626621: 17740-20499 884 100
    Ad12FIBER Adenovirus 12 Fiber 9626621: 29368-31131 908 101
    Ad17E1A Adenovirus 17 E1A 9632407: 560-1138 579 102
    Ad17HEXON Adenovirus 17 Hexon 9632407: 17754-20617 692 103
    Ad17FIBER Adenovirus 17 Fiber 9632407: 30935-32035 829 104
    Ad40E1A Adenovirus 40 E1A 9626553: 418-1326 824 105
    Ad40HEXON Adenovirus 40 Hexon 9626553: 17643-20414 876 106
    Ad40FIBER Adenovirus 40 Fiber 9626553: 28751-29914 707 107
    FluAHA1 Influenza A H1N1 (New Caledonia Like) Hemagglutinin 1 AJ344014 1692 108
    FluAHA2 Influenza A H2N2 (berkley) Hemagglutinin 2 L11125 805 109
    FluAHA3 Influenza A H3N2 (Fujian) Hemagglutinin 3 ISDN38157 1042 110
    FluAHA4 Influenza A H4N6 (Swine: Ontario) Hemagglutinin 4 AF285885 1371 111
    FluAHA5 Influenza A H5N1 (Vietnam) Hemagglutinin 5 AY526745 303 112
    FluAHA6 Influenza A H6N2 (Turkey; Germany) Hemagglutinin 6 AJ507203 887 113
    FluAHA7 Influenza A H7N7 (Netherlands) Hemagglutinin 7 AY338459 818 114
    FluAHA8 Influenza A H8N4 (Duck; Alberta) Hemagglutinin 8 AF310988 897 115
    FluAHA9 Influenza A H9N2 (Swine: China) Hemagglutinin 9 AY294658 601 116
    FluAHA10 Influenza A H10 (Shorebird) Hemagglutinin 10 AF311750 775 117
    FluAHA11 Influenza A H11 (Duck; Taiwan) Hemagglutinin 11 AF310986 728 118
    FluAHA12 Influenza A H12N4 (Ruddy Tumstone; Hemagglutinin 12 AF310990 738 119
    Delaware)
    FluAHA13 Influenza A H13N6 (Gull; Astrakan) Hemagglutinin 13 M26089 1765 120
    FluAHA14 Influenza A H14 (mallard; Gurjev) Hemagglutinin 14 M35997 763 121
    FluAHA15 Influenza A H15N8 (Duck; Australia) Hemagglutinin 15 L43916 793 122
    FluANA1-1 Influenza A H1N1 (New Caledonia Like) Neuraminidase 1 AJ518092 1459 123
    FluANA1-2 Influenza A H5N1 (Vietnam) Neuraminidase 1 AY526746 575 124
    FluANA2 Influenza A H3N2 (Ireland) Neuraminidase 2 AJ457947 1062 125
    FluANA3 Influenza A H5N3 (chicken: TX) Neuraminidase 3 AY300947 852 126
    FluANA4 Influenza A H8N4 (Duck: Alberta) Neuraminidase 4 K01030 257 127
    FluANA5 Influenza A H6N5 (Shearwater) Neuraminidase 5 M24740 913 128
    FluANA6 Influenza A H4N6 (Swine: Ontario) Neuraminidase 6 AF285887 739 129
    FluANA7 Influenza A H7N7 (Netherlands) Neuraminidase 7 AY340079 994 130
    FluANA8 Influenza A H5N8 (Duck: NY) Neuraminidase 8 AY300948 843 131
    FluANA9 Influenza A H2N9 (Duck: Nanchang) Neuraminidase 9 AY180830 444 132
    FluAH1N1MATRIX Influenza A H1N1 (New Caledonia Like) Matrix AJ458301 734 133
    FluAH5N1MATRIX Influenza A H5N1 (Vietnam) Matrix AY526748 657 134
    FluBHA Influenza B Hemagglutinin B AB126838 785 135
    FluBNA Influenza B Neuraminidase B AY139074 809 136
    FluBMATRIX Influenza B Matrix AB036877 763 137
    FluCHA Influenza C Hemagglutinin-esterase AB093473 401 138
    FluCMATRIX Influenza C Matrix AB086809 862 139
    PIV1HN Parainfluenza 1 Hemagglutinin-neuraminidase 19718363: 6903-8630 1728 140
    PIV1MATRIX Parainfluenza 1 Matrix 19718363: 3637-4809 958 141
    PIV1NC Parainfluenza 1 Nucleocapsid 19718363: 56-1737 1682 142
    PIV2HN Parainfluenza 2 Hemagglutinin-neuraminidasegi 19525721: 6817-8532 1716 143
    PIV2MATRIX Parainfluenza 2 Matrix 19525721: 3411-4742 741 144
    PIV2NC Parainfluenza 2 Nucleocapsid 19525721: 71-1919 1849 145
    PIV3HN Parainfluenza 3 Hemagglutinin-neuraminidase 10937870: 6806-8530 1725 146
    PIV3MATRIX Parainfluenza 3 Matrix 10937870: 3753-4814 544 147
    PIV3NC Parainfluenza 3 Nucleocapsid 10937870: 111-1658 1548 148
    PIV4HN Parainfluenza 4 Hemagglutinin-neuraminidase E02727 686 149
    PIV4MATRIX Parainfluenza 4 Matrix E03809 855 150
    HRV14NCR Rhinovirus 14 5′ NCR AF108186 520 151
    HRV1ANCR Rhinovirus 1A 5′ NCR AF108179 511 152
    HRV21NCR Rhinovirus 21 5′ NCR AF108180 499 153
    HRV29NCR Rhinovirus 29 5′ NCR AF542420 676 154
    HRV58NCR Rhinovirus 58 5′ NCR AF108183 504 155
    HRV62NCR Rhinovirus 62 5′ NCR AF108184 501 156
    HRV87NCR Rhinovirus 87 5′ NCR AF108187 506 157
    HRV95NCR Rhinovirus 95-01468 5′ NCR AF108164 508 158
    RSVABL RSV A&B polymerase L AF254574 379 159
    RSVAMATRIX RSV A Matrix 3089371: 3253-4210 958 160
    RSVANC RSV A Nucleocapsid 3089371: 1126-2398 955 161
    RSVBMATRIX RSV B Matrix 2582022: 3263-4033 770 162
    RSVBNC RSV B Nucleocapsid 2582022: 1140-2315 602 163
    HCV229ESPIKE Coronavirus 229E Spike 12175745: 20570-24091 1534 164
    HCV229EMEM Coronavirus 229E Membrane protein 12175745: 24995-25672 678 165
    HCV229ENC Coronavirus 229E Nucleocapsid 12175745: 25686-26855 924 166
    HCVOC43SPIKE Coronavirus OC43 Spike 38018022: 23644-27729 1456 167
    HCVOC43MEM Coronavirus OC43 Membrane protein 38018022: 28402-29094 693 168
    HCVOC43NC Coronavirus OC43 Nucleocapsid 38018022: 29104-30450 966 169
    SARSSPIKE Coronavirus SARS(Urbani) Spike 30027617: 21492-25259 1438 170
    SARSMEM Coronavirus SARS(Urbani) Membrane Glycoprotein 30027617: 26398-27063 666 171
    SARSNC Coronavirus SARS(Urbani) Nucleocapsid 30027617: 28120-29388 932 172
    HCVNL63SPIKE Coronavirus NL63 Spike AY567487: 20472-24542 1534 173
    HCVNL63ORF3 Coronavirus NL63 ORF3 AY567487: 24542-25219 678 174
    HCVNL63MEM Coronavirus NL63 Membrane protein AY567487: 25442-26122 681 175
    HCVNL63NC Coronavirus NL63 Nucleocapsid AY567487: 26133-27266 879 176
    MPVMATRIX Metapneumovirus Matrix AY145271 765 177
    MPVNC Metapneumovirus Nucleocapsid AY145272 1185 178
    HHV1L Human herpesvirus 1 (Simplex) DNA polymerase 9629378: 62807-66514 1061 179
    HHV1CAPSID Human herpesvirus 1 (Simplex) major capsid protein 9629378: c40528-36404 993 180
    HHV3L Human herpesvirus 3 (VZV) DNA polymerase 9625875: c50636-47052 1061 181
    HHV3CAPSID Human herpesvirus 3 (VZV) major capsid protein 9625875: 71540-75730 993 182
    HHV4L Human herpesvirus 4 (EBV) DNA polymerase 9625578: c156746-153699 1067 183
    HHV4CAPSID Human herpesvirus 4 (EBV) major capsid protein 9625578: c137466-133321 992 184
    HHV5L Human herpesvirus 5 (CMV) DNA polymerase 9628290: c59588-56550 1136 185
    HHV5CAPSID Human herpesvirus 5 (CMV) major capsid protein 9628290: c129226-125114 998 186
    HHV6L Human herpesvirus 6 (Roleola) DNA polymerase 9628290: c59588-56550 1058 187
    HHV6CAPSID Human herpesvirus 6 (Roleola) major capsid protein 9628290: c93912-89875 1001 188
    ENTEROVIRUS Enterovirus (genus) Enterovirus NC_001612 1758 189
    COXSACKIEVIRUS Human coxsackievirus unknown AF499635 920 190
    ECHO Echo (subgroup) Echovirus NC_003986 1277 191
    POLIO Polio (subgroup) Poliovirus NC_002058 1226 192
    POLIO1NCR Polio type 1 Sabin 5′NCR AY184219: 162-597 436 193
    POLIO2NCR Polio type 2 Sabin 5′NCR AY184220: 162-598 437 194
    POLIO3NCR Polio type 3 Sabin 5′NCR AY184221: 164-600 437 195
    MEASLESHA Paramyxoviridae morbillivirus (Rubeola) Hemagglutinin AY523581 1854 196
    MEASLESMATRIX Paramyxoviridae morbillivirus (Rubeola) Matrix 9626945: 3438-4445 1008 197
    NEWCASTLEHN Newcastle Hemagglutinin-Neuraminidase AY510092 1734 198
    NEWCASTLEMATRIX Newcastle disease Matrix 11545722: 3256-4487 1232 199
    WNE West Nile Virus Envelope AF346319 1504 200
    WNNS West Nile Virus Nonstructural protein 5 AF208017 917 201
    WNCM West Nile virus C and prM 432 202
    YFE Yellow Fever Envelope AY359908 1547 203
    YFNS Yellow Fever Nonstructural protein 5 AF013417 1035 204
    VMVG3R Variola major virus G3R 623595: 183809-184570 762 205
    VMVHA Variola major virus hemagglutinin 623595: 151032-151973 942 206
    VMVSOD Variola major virus SOD 623595: 144137-144514 378 207
    VMVCRMB Variola major virus CrmB 291 208
    MONKEYPOX Monkeypox virus inclusion body protein U84503 812 209
    EBOLAL Reston Ebola L 22789222: 11464-18866 800 210
    EBOLANP Reston Ebola NP 22789222: 56-3013 806 211
    EBOLAMATRIX Reston Ebola Matrix 22789222: 4396-5893 1498 212
    MARBURGL Marburg virus L protein 13489275: 11479-18474 1218 213
    MARBURGNP Marburg virus NP 13489275: 103-2190 847 214
    LASSAL Lassa virus L 23343512: c7122-466 1021 215
    LASSANP Lassa virus Nucleoprotein 23343509: 101-1810 751 216
    LASSAGP Lassa virus Glycoprotein 23343509: c3347-1872 1476 217
    MACHUPOL Machupo virus L polymerase 34365535: c7094-465 1588 218
    MACHUPONP Machupo virus Nucleoprotein 34365532: c3364-1670 763 219
    MACHUPOG Machupo virus Glycoprotein 34365532: 89-1579 1491 220
    VEEVNS Venezuelan equine encephalitis virus NS 9626526: 1-7526 923 221
    VEEVNC Venezuelan equine encephalitis virus Structrual protein 9626526: 7532-11444 1512 222
    EEEVNS Eastern equine encephalitis virus NS 21218484: 47-5683 1312 223
    EEEVNC Eastern equine encephalitis virus Nucleocapsid 21218484: 7592-11317 975 224
    WEEVNS Western equine encephalitis virus NS 21238454: 25-7428 878 225
    WEEVNC Western equine encephalitis virus Structrual protein 21238454: 7473-11183 902 226
    NIPAHMATRIX Nipah virus Matrix 13559808: 5008-6366 1359 227
    NIPAHN Nipah virus N 13559808: 56-2297 858 228
    SINNOMBREGP Sin Nombre Glycoprotein 558060: 52-3474 1293 229
    SINNOMBRENC Sin Nombre Nucleocapsid 38371725: 43-1329 639 230
    NORWALKL Norwalk virus RNA-dependent RNA 9630803: 3848-5371 739 231
    polymerase
    NORWALKCAPSID Norwalk virus capsid protein 9630803: 5358-6950 760 232
    DENGUECAPSID Dengue virus capsid protein 9626681: 97-396 300 233
    DENGUEM Dengue virus pre-M protein 9626681: 439-936 498 234
    DENGUE1NCR Dengue type 1 3′NCR AF309641: 10501-10657 157 235
    DENGUE2NCR Dengue type 2 3′NCR AF359579: 10501-10659 159 236
    DENGUE3NCR Dengue type 3 3′NCR AF317645: 10477-10632 156 237
    DENGUE5NCR Dengue type 4 3′NCR AF326573: 10424-10585 162 238
    FMDVVP1 Foot and mouth disease virus VP1 21426907: 3231-3863 633 239
    FMDV3D Foot and mouth disease virus 3D 21426907: 6615-8024 846 240
    SLEVNS5 Saint Louis encephalitis virus NS5 AF013416 1035 241
    SLEVPP Saint Louis encephalitis virus polyprotein precursor AY289618 727 242
    RVFVN Rift Valley fever virus N 61928: c1652-915 738 243
    RVFVNS Rift Valley fever virus NS 61928: 35-832 798 244
    USUTUPP Usutu virus polyprotein AF452643 1035 245
    JEVPP Japanese encephalitis virus polyprotein M18370: 9062-10097 1035 246
    CHANDIPURAMATRIX Chandipura virus Matrix 4583436: 97-851 755 247
    CHANDIPURAGP Chandipura virus glycoprotein J04350 752 248
    ATTIM2 Arabidopsis thaliana(2) triosephosphate isomerase (TIM) 523 249
    ATTIM3 Arabidopsis thaliana(3) triosephosphate isomerase (TIM) 523 250
    SPYEMM1 Streptococcus pyogenes emm1 CDC 398 251
    SPYEMM2 Streptococcus pyogenes emm2 CDC 360 252
    SPYEMM3 Streptococcus pyogenes emm3 CDC 391 253
    SPYEMM4 Streptococcus pyogenes emm4 CDC 337 254
    SPYEMM5 Streptococcus pyogenes emm5 CDC 490 255
    SPYEMM6 Streptococcus pyogenes emm6 CDC 437 256
    SPYEMM9 Streptococcus pyogenes emm9 CDC 509 257
    SPYEMM11 Streptococcus pyogenes emm11 CDC 500 258
    SPYEMM12 Streptococcus pyogenes emm12 CDC 364 259
    SPYEMM13L Streptococcus pyogenes emm13L CDC 325 260
    SPYEMM18 Streptococcus pyogenes emm18 CDC 524 261
    SPYEMM22 Streptococcus pyogenes emm22 CDC 620 262
    SPYEMM28 Streptococcus pyogenes emm28 CDC 333 263
    SPYEMM29 Streptococcus pyogenes emm29 CDC 328 264
    SPYEMM44 Streptococcus pyogenes emm44 CDC 391 265
    SPYEMM61 Streptococcus pyogenes emm61 CDC 325 266
    SPYEMM75 Streptococcus pyogenes emm75 CDC 451 267
    SPYEMM77 Streptococcus pyogenes emm77 CDC 450 268
    SPYEMM89 Streptococcus pyogenes emm89 CDC 378 269
    SPYEMM94 Streptococcus pyogenes emm94 CDC 516 270
    SPYCSR Streptococcus pyogenes Csr R & Csr S AF095713 952 271
    SPYSFB1 Streptococcus pyogenes sfb1 AJ347842 615 272
    SPYSPEB Streptococcus pyogenes SpeB AB051298 729 273
    SPNGYRA Streptococcus pneumoniae GyrA AY157689 815 274
    SPNLYTA Streptococcus pneumoniae Autolysin lytA 125 275
    SPNPLY Streptococcus pneumoniae pneumolysin ply 99 276
    SAUGYRA Staphylococcus aureus GyrA D10489 821 277
    SAUTST Staphylococcus aureus tst 18266750: 2118-2822 705 278
    SAUENTK Staphylococcus aureus EntK 18266750: 13059-13787 729 279
    SAUENTQ Staphylococcus aureus EntQ 18266750: 12265-13035 771 280
    CPNGYRA Chlamydia pneumoniae GyrA 28415636: 2451-4955 824 281
    CPNOMPB Chlamydia pneumoniae OmpB X53511 1030 282
    CPNMOMPVD4 Chlamydia pneumoniae MOMP VD4 M69230 150 283
    CPNMOMPVD2 Chlamydia pneumoniae major outer membrane protein 133 284
    (MOMP)VD2
    CPNRPOB Chlamydia pneumoniae Pstl fragment (rpoB) NT01CP0714 346 285
    CPSOMPA Chlamydia psittaci OmpA AF269281 991 286
    CPSSIGA Chlamydia psittaci SigA U04442 883 287
    CDIDTX Corynebacterium diphtheriae Dtx gene A04646 913 288
    CDIGYRA Corynebacterium diphtheriae GyrA 38198900: 8792-11362 818 289
    CDIDTXR Corynebacterium diphtheriae dtxR gene M80336 1124 290
    HINGYRA Haemophilus influenzae GyrA 1574717: c7221-4579 896 291
    HINOMPA Haemophilus influenzae OmpP5 (OmpA-family) L20309 937 292
    LPNGYRA Legionella pneumophilia GyrA AY091594 236 293
    LPNMOMPS Legionella pneumophilia MompS AF078136 1157 294
    MCAGYRA Moraxella catarrhalis GyrA AF056196 321 295
    MCAHA Moraxella catarrhalis hemagglutinin AY077637 653 296
    MTUGYRA Mycobacterium tuberculosis GyrA 13879041: 7302-9818 818 297
    MTUOMPA Mycobacterium tuberculosis OmpA 38490207: 318539-319519 932 298
    MTURPOB Mycobacterium tuberculosis RpoB 468333: 1065-4598 411 299
    MPNGYRA Mycoplasma pneumoniae GyrA 11379479: 4821-7340 809 300
    MPNP1 Mycoplasma pneumoniae P1 gene AF290002 2570 301
    NMEGYRA Neisseria meningitidis GyrA 7413466: 89-2839 941 302
    NMEMVIN Neisseria meningitidis MviN 7225498: c5929-4388 904 303
    NMECTRA Neisseria meningitides capsular transport protein (ctrA) 135 304
    NMECRGA Neisseria meningitidis CrgA AF190471 254 305
    AHE16S Arcanobacterium hemolyticum 16S rRNA X73952 1489 306
    AHEPLD Arcanobacterium hemolyticum pld L16583 1111 307
    BANGYRA Bacillus anthracis GyrA AY291534 732 308
    BANLEF Bacillus anthracis lethal factor M29081 685 309
    BANPAG Bacillus anthracis protective antigen AF306783 599 310
    BANRPOB Bacillus anthracis rpoB AF205335 777 311
    BANCYA Bacillus anthracis Cya 142812: 544-2946 545 312
    BANCAPB Bacillus anthracis encapsulation protein 246 313
    gene B(capB)
    BCERPOB Bacillus cereus rpoB AF205342 777 314
    BSUGYRA Bacillus subtillus GyrA 40012: 7769-10234 812 315
    BSURPOB Bacillus subtillus rpoB AF205356 780 316
    BTHCRY Bacillus thuringensis cry AF278797 853 317
    BTHRPOB Bacillus thuringensis rpoB AF205349 777 318
    BPEGYRA Bordetella pertussis GyrA 33571514: 286253-288934 815 319
    BPEPRNA Bordetella pertussis PmA AJ507642 777 320
    BMEGYRA Brucella melitensis (F6145) GyrA AE009529: 4650-7358 995 321
    BABRB51 Brucella abortus (RB51) WboA with insert AF107768 1339 322
    Consensus Sequence
    BABOMP25 Brucella abortus (2308 B37) Omp25 X79284 630 323
    BABOMP2 Brucella abortus (2308 B37) Omp2 U26438 1434 324
    BCAOMP2 Brucella canis Omp2 U26439 1434 325
    BMEOMP2 Brucella melitensis (F6145) Omp2 U26440 1434 326
    BNEOMP2 Brucella neotoma Omp2 U26441 1434 327
    BOVOMP2 Brucella ovis Omp2 U26442 1449 328
    BSUIOMP2 Brucella suis (A44) Omp2 U26443 1434 329
    BMAPENA Burkholderia mallei (Glanders) PenA AY032868 1117 330
    BMAWAAF Burkholderia mallei (Glanders) WaaF AY124769 1015 331
    BPSPENA Burkholderia pseudomallei (Meliodosis) PenA AY032869 1117 332
    BPSWAAF Burkholderia pseudomallei (Meliodosis) WaaF AF097748 1100 333
    BCEPRECA Burkholderia cepacia RecA U70431 611 334
    CPEGYRA Clostridium perfringens GyrA 18143657: 7100-9391 810 335
    CPETMPC Clostridium perfringens TmpC 18146729: c45993-44881 1113 336
    CBUGYRA Coxiella burnetii GyrA 29540947: 165494-168040 812 337
    CBUTOLC Coxiella burnetii TolC 29540626: 51830-53680 745 338
    FTURD1A Francisella tularensis subsp. RD1-A 32469331: c985-455 531 339
    tularensis strain
    FTURD1B Francisella tularensis subsp. RD1-B 32469331: c1338-1054 285 340
    tularensis strain
    FTUTUL4 Francisella tularensis TUL4 M32059 834 341
    FTUMDH Francisella tularensis mdh AF513319 960 342
    FTU13KD Francisella tularensis 13-kDa protein M32059 431 343
    FTUFOPA Francisella tularensis outer membrane protein FopA 111 344
    OTSGROEL Orientia tsutsugamushi GroEL AY191589 546 345
    OTSSTA56 Orientia tsutsugamushi sta56 AY283180 1059 346
    RPRGYRA Rickettsia prowazekii GyrA 3860572: 250672-253389 968 347
    RPROMP1 Rickettsia prowazekii Omp1 3860572: c191770-189464 985 348
    YPEGYRA Yersinia pestis GyrA 21959874: c10908-8233 812 349
    YPEOMPA Yersinia pestis OmpA 16120353: 913 350
    c1628253-1627192
    YPECVE Yersinia pestis cve2155 sequence AF350077 517 351
    YPECAF1 Yersinia pestis caf1 X61996 525 352
    ACAHAG Ajellomyces capsulatus H antigen U20346 1082 353
    ACAMAG Ajellomyces capsulatus M antigen AF026268 919 354
    ACAGH17 Ajellomyces capsulatus GH17 U27588 810 355
    BDEWI-1 Blastomyces dermatiditis WI-1 S63772 942 356
    BDEBYS1 Blastomyces dermatiditis bys1 AF277079 912 357
    CIMAG2 Coccidioides immitis Ag2 U32518 1234 358
    CIMBG12 Coccidioides immitis bg12 AF022893 965 359
    CPACP2 Cryptosporidium parvum CP2 AY471868 735 360
    CPASOD Cryptosporidium parvum Sod AF529280 375 361
    ECOGYRA E. coli 0157:H7 GyrA 16445223: 812 362
    c3136459-3133832
    ECOOMPA E. coli 0157:H7 OmpA 12518283: 3562-4221 660 363
    SENGYRA Salmonella enterica GyrA 29136667: 70224-72860 812 364
    SENOMPA Salmonella enterica OmpA 16502231: c18055-17003 904 365
    SDYOMPA Shigella dysenteriae OmpA 46943: 568-1623 907 366
    SFLGYRA Shigella flexneri GyrA 30041918: c2708-81 812 367
    SFLOMPA Shigella flexneri OmpA 24051234: c4458-3340 898 368
    VCHGYRA Vibrio cholerae GyrA 15640032: 887 369
    1330207-1332891
    VCHOMPA Vibrio cholerae OmpA 6031221: 1022-1987 942 370
    MSRA Staphylococcus aureus MSR(A) AF467080 400 371
    MECR1 Staphylococcus aureus mecR1 AF142100 652 372
    MEFA Streptococcus pyogenes MefA U70055 611 373
    ERMTR Streptococcus pyogenes Erm(TR) 2190969: 211-942 732 374
    ERMB Streptococcus pyogenes ErmB 38707181: 8545-9307 763 375
    EMRB Rickettsia prowazekii EmrB 3860572: c187837-186278 1560 376
    GYRB Streptococcus pneumoniae GyrB X83917 1947 377
    PARC Streptococcus pneumoniae ParC AF503577 2637 378
    PARE Streptococcus pneumoniae parE 6851036: 1255-3198 2008 379
    PBP1 Streptococcus pneumoniae ponA (Pbp1A) AF446215 1282 380
    PBP5 Enterococcus faecium pbp5 AF375986 668 381
    MECA Staphylococcus aureus pUB110 mecA 9181834: <1-729 729 382
    BLAZ Staphylococcus aureus plasmid pLW043 blaz 33390917: c41981-41136 846 383
    DFRA Staphylococcus aureus plasmid PLW043 dfrA 33390917: c2802-2317 486 384
    VANA Staphylococcus aureus plasmid pLW043 vanA 33390917: 34299-35330 1032 385
    QACC Staphylococcus aureus plasmid pLW043 qacC 33390917: c21313-20990 324 386
    RMTB Escherichia coli rmtB AB117036 756 387
    STRA Escherichia coli pMBSF1 plasmid strA 25815144: 723-1526 804 388
    STRB Escherichia coli pMBSF1 plasmid strB 25815144: 1526-2362 837 389
    AADA1 Escherichia coli plasmid p541 aadA1 40287459: 10986-11777 792 390
    SULII Escherichia coli plasmid pSTOJO1 sulii 17129524: 449-1264 816 391
    CTXM Escherichia coli strain EU2657 ctx-M AY517475 436 392
    KPC2 Klebsiella pneumoniae carbapenemase (KPC-2) AY034847 918 393
    AMPC Klebsiella pneumoniae plasmid AmpC 40548851: 1310-2449 1140 394
    BLACMY2 Klebsiella pneumoniae plasmid bla CMY-2 1212997: 1924-3069 1146 395
    AMPR Klebsiella pneumoniae plasmid pKP3 AmpR 40548851: c1199-324 876 396
    SULI Plasmid R388 suli 45795: 880-1719 840 397
    AACAAPHD Staphylococcus aureus plasmid pLW043 aacA-aphD 33390917: 23440-24879 1440 398
    FLOR Vibrio cholerae floR 32469306: 11605-12819 1215 399
    TETM Enterococcus faecalis tet(M) M85225 536 400
    TETC Escherichia coli partial plasmid (tetC) Y19114 502 401
    TETS Listeria monocytogenes tet(S) L09756 555 402
    TETA Pseudomonas aeruginosa plasmid RP4 tet(A) X75761 494 403
    TETG Pseudomonas sp. plasmid pPSTG2 tet(G) AF133140 550 404
    TETL Staphylococcus hyicus (plasmid pSTE1) tet(L) X60828 548 405
    TETB Transposon Tn10 tet(B) V00611 571 406
    PTX Bordetella pertussis Pertussis toxin M13223 872 407
    BONT Clostridium botulinum bonT 3805779: 7268-11143 792 408
    NTNH Clostridium botulinum ntnh 3805779: 3649-7242 496 409
    BOTE Clostridium botulinum botE X62683 1000 410
    EPSILON Clostridium perfringens plasmid epsilon-toxin X60694 620 411
    TETANUS Clostridium tetani tetanus toxin 40769: 281-4228 1185 412
    STX1A E. coli 0157:H7 stx1A 32400301: 1-948 948 413
    STX2A E. coli 0157:H7 stx2A 13359151: 1-960 960 414
    RICINUSTOXIN Ricinus communis Ricinus communis toxin X52908 1133 415
    CTXAB Vibrio cholerae ctxA + ctxB Gary 984 416
    PBLUEVEC pBluescript II KS(+) 236 417
    PGEMVEC pGEM-9Zf(−) X65312 226 418
    PUCVEC pUC4KAN X06404 252 419
    ATTIM4 Arabidopsis thaliana(4) triosephosphate isomerase (TIM) 523 420
    308034
    • EXAMPLE 9 Influenza A Strain Identification with Random RT-PCR Approach
  • This example is to present application of newly modified random RT-PCR protocol on isolated Influenza A (Fujan/411/2002 strain) nucleic acids spiked into normal nasal wash samples. A random RT-PCR protocol has been applied by DeRisi's lab to amplify viral pathogens for microarray interrogation (Wang et al., 2003). Modification to this protocol was recently reported for amplifying cultured influenza viruses (Kessler et al., 2004). However, the modified protocol was not reported to amplify viral targets in clinical samples.
  • The Influenza A virus cultures (H1N1 & H3N2) were provided by the Air Force Institute for Operational Health (AFIOH) and sent to Virapure, LLC for amplification and quantification prior to the study. According to the Certificate of Analysis, the virus was amplified for two rounds on early passage MDCK cells purchased from ATCC exclusively for this project, followed by virus amplification in the presence of 1 μg/ml TPCK treated trypsin. At 48 hours after infection, the virus supernatants were collected and adjusted to contain 3% sucrose, 20 mM Tris pH 7.1 and pH stabilizer. Prior to delivery, Corning screw top cryovials were filled with 200-300 μl aliquots of supernatant. The titration of each sample vial was performed according to procedure AM110, Plaque Forming Assay of Influenza Virus. A titer of 1.2×107 PFU/ml was obtained for Influenza A H3N2, K0717 SV5/SV40 RMK and 5×106 PFU/ml for Influenza A/California/2935/03/H1N1.
  • To generate a clinical collection control, a nasal wash (0.9% Normal Saline) was obtained from an asymptomatic member of the Clinical Division of the Advanced Diagnostic Laboratory at Lackland AFB. From each Virapure pre-quantified titer, a 10-fold/6-series dilution of Influenza-spiked nasal aspirate was generated beginning with and including the Virapure stock of each strain. A total of 100 μl of each influenza-spiked nasal wash were processed from the dilution using the MasterPure Total Nucleic Acid Extraction distributed by EPICENTRE. During the protocol, 150 μl of 2× T and C Lysis Solution containing Proteinase K was added to each 100 μl dilution of the spiked nasal wash, vortex thoroughly and incubated at 65° C. for 15 minutes. Next, the samples were placed on ice for 5 minutes followed by the addition of 150 μl of MPC Protein Precipitation Reagent. The samples were vortex mixed vigorously for 10 seconds. The mixture was then precipitated by centrifugation at 10,000×g for 10 minutes and the supernatant transferred to a microcentrifuge tube. To the recovered supernatant, 500 μl of isopropanol wer added and the tube inverted (30-40) times.
  • The mixture was centrifuged at 4° C. for 10 minutes and the isopropanol decanted without dislodging pellet. Following, the pellet was rinsed twice with 75% ethanol and dried at room temperature. Once dried, the nucleic acid pellet was resuspended in 35 μl of TE Buffer. Each sample was properly labeled and placed in dry ice prior to shipment to the Naval Research Laboratory.
  • Each of three 100 μl normal nasal wash aliquots was spiked with a serial of dilution (ranging from 105 pfu to 101) of influenza A H3N2 viral cultures. Total nucleic acids were extracted with EPICENTRE MasterPure™ DNA Purification Kits (Madison, Wis.), as in Example 5, and suspended in 40 μl H2O. Random RT-PCR was applied as follows, according to that described (Kessler et al., 2004):
  • 2 μl of total nucleic acid was reverse transcribed by using 1 μl primer D (40 pmol/μl; 5′-GTT TCC CAG TCA CGA TCN NNN NNN NN; SEQ ID NO: 573) and 1 μl SuperScript™ III Reverse Transcriptase (50 units/μl; Invitrogen, Carlsbad, Calif.) in 20 μl. The RT (reverse transcription) reaction was performed at 42° C. for 1 hr and then was inactivated at 70° C. for 15 min. Then 10 μl RT products were amplified with 1 μl primer E (100 pmol/μl; 5′-GTT TCC CAG TCA CGA TC; SEQ ID NO: 574) and 2.5 units TaqPlus Long polymerase (5 units/μl, Stratagene, La Jolla, Calif.) in 50 μl. PCR was conducted with 35 cycles of 94° C. for 30 s, 40° C. for 30 s, 50° C. for 30 s, and 72° C. for 160 s, followed by an additional 7 minutes at 72° C. PCR products from 105, 103 and 101 pfu flu spiking samples were applied to three different V1RPM pathogen microarrays for hybridization according to Affymetrix Customseq protocol.
  • The V1RPM chip scans for the three spike-in samples, 105, 103, and 101 pfu, amplified by this random RT-PCR method, are shown in FIG. 8 A-C, respectively. All samples resulted in clear sequence calls in at least some of the Influenza A tile regions, indicating that the random RT-PCR protocol successfully amplified flu genomes in the spiking samples even without interference of human genomic DNA. Based on the GDAS outputs (using “permissive” settings), REPI identified the following 4 top “hits” from each sample (Tables 36-38). The top four hits for 105 (Table 36) and 103 pfu (Table 37) samples corresponded to the top ranking being assigned to the correct Fujian/411/2002 strain and were exactly same as those obtained for the Fujian/411/2002 (+) clinical sample NW20031114-05-02 ACID04 -B2, amplified by influenza universal primers (shown in Table 25). This result indicates that random RT-PCR has similar amplification power to the Influenza A-specific PCR with relatively high titer of viruses in the sample. With low titer of flu viruses (101 pfu), the percentage of tile region that hybridized and the percentage of base calls decreased. This resulted in a slight skewing of the rankings, making Fujian 411/2002 tied for the second highest-ranking strain. However, the V1RPM was still able to read the spiked virus as H3N2 Pretoria strain, which originally derived from and is almost identical to Fujian/411/2002 strain.
  • Because of success of random RT-PCR in this experiment, it is believed that this protocol will work in flu clinical samples and other pathogenic viruses.
    TABLE 36
    FluAHA3: Influenza A H3N2 spiked samples (105 pfu)
    Accession # Name E value: Bit Score:
    lcl|ISDN38157 InfluenzaA/Fujian/411/ 0.0 1400.04
    2002_Hemagglutinin_104
    gi|37530025| Influenza A virus 0.0 1400.04
    gb|AY389356.1 (A/Middleburg/41/03(H3N2))
    hemagglutinin (HA) gene
    gi|37530033| Influenza A virus 0.0 1392.11
    gb|AY389360.1 (A/Pretoria/17/03(H3N2))
    hemagglutinin (HA) gene
    gi|37530031|gb| Influenza A virus 0.0 1392.11
    AY389359.1 (A/Pretoria/16/03(H3N2))
    hemagglutinin (HA) gene
  • TABLE 37
    FluAHA: Influenza A H3N2 spiked samples (103 pfu)
    Accession # Name E value: Bit Score:
    lcl|ISDN38157 InfluenzaA/Fujian/411/ 0.0 1471.4
    2002_Hemagglutinin_104
    gi|37530025| Influenza A virus 0.0 1471.4
    gb|AY389356.1 (A/Middleburg/41/03(H3N2))
    hemagglutinin (HA) gene
    gi|37530033| Influenza A virus 0.0 1463.47
    gb|AY389360.1 (A/Pretoria/17/03(H3N2))
    hemagglutinin (HA) gene
    gi|37530031|gb| Influenza A virus 0.0 1463.47
    AY389359.1 (A/Pretoria/16/03(H3N2))
    hemagglutinin (HA) gene
  • TABLE 38
    FluAHA3: Influenza A H3N2 spiked samples (101 pfu)
    Accession # Name E value: Bit Score:
    gi|37530033|gb| Influenza A virus 0.0 686.389
    AY389360.1 (A/Pretoria/17/03(H3N2))
    hemagglutinin (HA) gene
    gi|37530031| Influenza A virus 0.0 686.389
    gb|AY389359.1 (A/Pretoria/16/03(H3N2))
    hemagglutinin (HA) gene
    gi|37530029| Influenza A virus 0.0 686.389
    gb|AY389358.1| (A/Pretoria/2/03(H3N2))
    hemagglutinin (HA) gene
    gi|37530025|gb| Influenza A virus 0.0 686.389
    AY389356.1| (A/Middleburg/41/03(H3N2))
    hemagglutinin (HA) gene
    lcl|ISDN38157 InfluenzaA/Fujian/411/ 0.0 678.459
    2002_Hemagglutinin_104
  • This example is significant because it shows that a completely non-biased amplification method, derived from a June 2001 public domain protocol may be used as a preparative step for resequencing microarrays, resulting in PCR-level sensitivity (101 target copies). Although this amplification protocol has been used for several published examples of long oligomer (70-mer) microarray-based assays, it is not obvious that it would suffice for resequencing microarray approaches. Numerous modifications and variations on the present invention are possible in light of the above teachings. It is, therefore, to be understood that within the scope of the accompanying claims, the invention may be practiced otherwise than as specifically described herein.
    • EXAMPLE 10 Other Pathogen Tests
  • In summary, the following pathogens were detected/discriminated from laboratory and/or clinical samples on RPMV1, (in aggregate representing >180 chips tested) with 100% concordance of identification and input identity, and with no type cross-hybridizations, except to parts of sequence tiles representing homologous sequences between type variant strains, in:
    Human adenoviruses group C Ad5 prototype Ad5 USA field strain
    Human adenoviruses group E Ad4 prototype Ad4 AF field strain
    Ad4 vaccine Ad4 USN field strain
    Human adenoviruses group B Ad3 prototype Ad3 USN field strain
    Ad7 prototype Ad7 USN field strain
    Ad7 vaccine
    Ad16 prototype
    Ad21 prototype Ad21 field strain
    Influenza A H1N1 H3N2
    Variola Major (smallpox)
    Lassa Virus
    Ebola Virus
    Streptococcus pneumonia
    Streptococcus pyogenes
    Chlamydia pneumonia
    Mycoplasma pneumonia
    Neisseria meningitides
    Bacillus anthracis
    Yersinia pestis
    Francisella tularensis
  • Selected examples of RPMV1 microrarray results for prepared non-infectious laboratory samples of Variola Major (smallpox), Ebola Virus, B. anthracis, Y. pestis, and F. tularensis have been performed, but not shown here. Variola Major (smallpox), Ebola Virus, and F. tularensis samples were prepared using specific PCR primers. B. anthracis and Y. pestis samples were amplified using GenomiPhi reagents (as described in Example 3).
    • EXAMPLE 11 Features of Sequences Adenoviruses
  • The following tables present the sequence features and putatitve gene products for the sequenced adenoviruses appearing in Table 6 and SEQ ID NOs: 575-587.
    TABLE 39
    Ad3 (Accession No. AY599834; SEQ ID NO: 575) Sequence Features and
    putative gene products
    Feature Type Location Comment or Gene Locus Product
    repeat_region 1 . . . 134
    promoter 480 . . . 485 “TATA box for the E1A
    genes”
    CDS Join (576 . . . 662, 1250 . . . 1351) gene = “E1A” “6 KD protein”
    CDS Join (576 . . . 1155, 1250 . . . 1455) gene = “E1A” “29.1 kD protein”
    CDS Join (576 . . . 1062, 1250 . . . 1455) gene = “E1A” “25K protein”
    polyA_site 1494 . . . 1499 “polyA site for E1A”
    promoter 1549 . . . 1554 “TATA box for the E1B
    genes”
    CDS 1603 . . . 2139 gene = “E1B” “19 kD small T
    antigen”
    CDS 1908 . . . 3386 gene = “E1B” 55K protein
    Promoter 3384 . . . 3389 “TATA box for pIX”
    polyA_site 3450 . . . 3455 “polyA site for E1B”
    CDS 3480 . . . 3896 gene = “protein IX” “protein IX”
    polyA_site 3913 . . . 3918 “polyA site for pIX”
    polyA_site Complement (3925 . . . 3930) “polyA site for E2B”
    CDS Complement (join gene = “E2B” “IVA2 maturation
    (3948 . . . 5281, 5560 . . . 5572)) protein”
    CDS Complement (5051 . . . 8419) gene = “E2B” “DNA polymerase”
    CDS 5123 . . . 5692 gene = “hypothetical” “hypothetical 20.6 KD
    early protein”
    Promoter 5872 . . . 5877 “TATA box for the Major
    Late Promoter”
    CDS Complement (6868 . . . 7389) gene “hypothetical” = “hypothetical
    19 kD
    protein”
    CDS 7829 . . . 8425 gene = “L1” “probable DNA
    binding agnoprotein”
    CDS Complement (join gene = “pTP” “DNA terminal protein
    (8422 . . . 10389, 13848 . . . 13856)) precursor”
    CDS 9757 . . . 10032 gene = “hypothetical” “hypothetical 9.7 kD
    protein”
    misc_RNA 10422 . . . 10595 “virus-associated RNA I”
    CDS 10890 . . . 12026 gene = “L1” “55 KD protein”
    CDS 12051 . . . 13817 gene = “L1” “pIIIa protein”
    polyA_site 13830 . . . 13835 “polyA site for L1”
    CDS 13905 . . . 15539 gene = “L2” “penton base protein”
    CDS 15553 . . . 16131 gene = “L2” “pVII”
    CDS 16174 . . . 17223 gene = “L2” “protein V”
    polyA_site 17498 . . . 17503 “polyA site for L2”
    CDS 17555 . . . 18001 gene = “L3” “protein VI”
    CDS 18420 . . . 21254 gene = “L3” “hexon protein”
    CDS 21291 . . . 21920 gene = “L3” “‘23K proteinase’”
    polyA_site 21940 . . . 21945 “polyA site for L3”
    polyA_site Complement (21952 . . . 21957) “polyA site for E2A”
    CDS Complement (22006 . . . 23559) gene = “E2A” “DNA binding
    protein”
    CDS 23590 . . . 26076 gene = “L4” “hexon assembly-
    associated 100 KD
    protein”
    CDS 25778 . . . 26375 gene = “L4” “22K protein”
    CDS Join (25778 . . . 26159, gene = “L4” “33 KD protein”
    26296 . . . 26651)
    CDS 26722 . . . 27405 gene = “L4” “proteinVIII”
    Promoter 27087 . . . 27092 “TATA box for the E3
    genes”
    CDS 27405 . . . 27725 gene = “E3” “12.5 KD protein”
    CDS 27679 . . . 28002 gene = “E3” “16 KD glycoprotein”
    CDS 28104 . . . 28622 gene = “E3” “18.5 protein”
    CDS 28652 . . . 29191 gene = “E3” “20.1 KD protein”
    CDS 29204 . . . 29773 gene = “E3” “20.1 KD protein,
    duplicate copy”
    CDS 29788 . . . 30021 gene = “E3” ” “9K glycoprotein
    CDS 30063 . . . 30338 gene = “E3” “10.3 KD protein”
    CDS 30310 . . . 30747 gene = “E3” “14.9 KD protein”
    CDS 30740 . . . 31150 gene = “E3” “14 KD protein”
    polyA_site 31183 . . . 31188 “polyA site for E3”
    CDS Complement (31194 . . . 31355) gene = “U” “U protein”
    CDS 31370 . . . 32329 gene = “L5” “fiber protein”
    polyA_site Complement (32354 . . . 32359) “polyA signal for E4”
    CDS Complement (32370 . . . 32621) gene = “E4” “ORF6/7”
    CDS Complement (32618 . . . 33517) gene = “E4” “33.2 KD protein”
    CDS Complement (33420 . . . 33788) gene = “E4” “13.6 KD protein”
    CDS 33643 . . . 34152 gene = “L5” ” “agnoprotein
    CDS Complement (33797 . . . 34150) gene = “E4” “11 KD protein”
    CDS Complement (34147 . . . 34536) gene = “E4” “14.3 KD protein”
    polyA_site 34561 . . . 34566 “polyA signal for L5”
    CDS Complement (34578 . . . 34955) gene = “E4” “13.9 KD protein”
    Promoter Complement (35037 . . . 35042) “TATA box for the E4
    promoter”
    repeat_region Complement (35212 . . . 35345) “the inverted terminal
    repeat”
  • TABLE 40
    Ad3FS_navy (Accession No. AY599836; SEQ ID NO: 576) Sequence Features
    and putative gene products
    Feature Type Location Comment or Gene Locus Product
    repeat_region 1 . . . 111 “the inverted terminal
    repeat”
    promoter 480 . . . 485 “TATA box for E1A”
    CDS join (576 . . . 647, 1248 . . . 1349) gene = “E1A” “6.9k protein”
    CDS join (576 . . . 1062, 1248 . . . 1453) gene = “E1A” “25K protein”
    CDS join (576 . . . 1155, 1248 . . . 1453) gene = “E1A” “29K protein”
    polyA_site 1492 . . . 1497 “polyA site for E1A”
    promoter 1547 . . . 1552 “TATA box for E1B”
    CDS 1601 . . . 2137 gene = “E1B” “19K small T-antigen
    protein”
    CDS 1906 . . . 3384 gene = “E1B” “55K large T-antigen
    protein”
    Promoter 3428 . . . 3433 “TATA box for pIX”
    polyA_site 3448 . . . 3453 “polyA signal for E1B”
    CDS 3478 . . . 3894 gene = “pIX” “proteinIX”
    polyA_site 3907 . . . 3912 “polyA signal for pIX”
    polyA_site complement (3923 . . . 3928) “polyA signal for E2B”
    CDS complement (join gene = “E2B” “proteinIVa2”
    (3946 . . . 5279, 5558 . . . 5570))
    CDS complement(5049 . . . 8417) gene = “E2B” “DNA polymerase”
    Promoter 5870 . . . 5875 “TATA box for the Major
    Late Promoter”
    CDS 6142 . . . 6462 gene = “hypothetical” “hypothetical 11.5K
    early protein”
    CDS 7131 . . . 7418 gene = “hypothetical” “hypothetical 10.4K
    early protein”
    CDS 7827 . . . 8423 gene = “L1” “probable DNA
    binding agnoprotein”
    CDS complement (8227 . . . 8562) gene = “E2B” “hypothetical 12.6K
    early protein”
    CDS complement (join gene = “E2B” “Terminal protein
    (8420 . . . 10378, 13840 . . . 13848)) precursor, aka Bellet's
    protein”
    CDS complement (9532 . . . 9846) gene = “hypothetical” “11.3K early protein”
    CDS 9746 . . . 10021 gene = “hypothetical” “9.7K early protein”
    misc_RNA 10411 . . . 10584 “VA RNA I”
    misc_RNA 10662 . . . 10838 “VA RNA II”
    CDS 10861 . . . 12018 gene = “L1” “55K protein”
    CDS 12043 . . . 13809 gene = “L1” “hexon associated
    proteinIIIa precursor”
    polyA_site 13822 . . . 13827 “polyA signal for L1”
    CDS 13897 . . . 15531 gene = “L2” “penton base protein”
    CDS 15545 . . . 16123 gene = “L2” “pVII 21K protein”
    CDS 16166 . . . 17218 gene = “L2” “pV from L2”
    polyA_site 17493 . . . 17498 “polyA signal for L2”
    CDS 17550 . . . 18302 gene = “L3” “pVI”
    CDS 18415 . . . 21243 gene = “L3” “hexon protein”
    CDS 21286 . . . 21915 gene = “L3” “23K proteinase”
    polyA_site 21935 . . . 21940 “polyA signal for L3”
    CDS complement (21947 . . . 21952)
    CDS complement (22002 . . . 23552) “E2A” “DNA binding
    protein”
    CDS 23583 . . . 26057 gene = “L4” “100K protein”
    CDS 25759 . . . 26358 gene = “L4” “22K protein”
    CDS join gene = “L4” “33K protein”
    (25759 . . . 26107, 26289 . . . 26632)
    CDS 26702 . . . 27385 gene = “L4” “pVIII, hexon
    associated protein
    precursor”
    Promoter 27067 . . . 27072 “TATA box for the E3 gene”
    CDS 27385 . . . 27705 gene = “E3” “12.2K glycoprotein”
    CDS 27659 . . . 28099 gene = “E3” “16K glycoprotein”
    CDS 28084 . . . 28602 gene = “E3” “18.5K glycoprotein”
    CDS 28632 . . . 29171 gene = “E4” “20.1K glycoprotein”
    CDS 29184 . . . 29753 gene = “E3” “20.1K glycoprotein”
    CDS 29985 . . . 30260 gene = “E3” “10.3K glycoprotein”
    CDS 30232 . . . 30669 gene = “E3” “14.9K glycoprotein”
    CDS 30662 . . . 31072 gene = “E3” “15.3K protein”
    polyA_site 31105 . . . 31110 “polyA signal for E3”
    CDS complement (31116 . . . 31277) gene = “U exon” “U exon protein”
    CDS 31292 . . . 32251 gene = “L5” “fiber protein”
    polyA_site complement (32276 . . . 32281) “polyA signal for E4”
    CDS complement (32292 . . . 32543) gene = “E4” “ORF6/7”
    CDS complement (32540 . . . 33439) gene = “E4” “34K protein”
    CDS complement (33342 . . . 33710) gene = “E4” “13.6K protein”
    CDS 33565 . . . 34074 gene = “L5” “DNA binding
    agnoprotein”
    CDS complement (33719 . . . 34072) gene = “E4” “ORF3”
    CDS complement (34069 . . . 34458) gene = “E4” “14.3K protein”
    polyA_site 34483 . . . 34488 “polyA signal for L5”
    CDS complement (34500 . . . 34877) gene = “E4” “13.9K protein”
    Promoter complement (34959 . . . 34964) “TATA box for the E4 gene” Promoter
    repeat_region complement (35155 . . . 35265) “the inverted terminal repeat_region
    repeat”
  • TABLE 41
    Ad4 (Accession No. AY594253; SEQ ID NO: 577) Sequence Features and
    putative gene products
    Feature Type Location Comment or Gene Locus Product
    repeat_unit 1 . . . 116 “ITR”
    promoter 472 . . . 511 “E1A”
    CDS 576 . . . 1154 gene = “E1A” “ORF1: putative”
    CDS join (576 . . . 650, 1236 . . . 1340) gene = “E1A” “early E1A 6.8 KD
    protein” similarity to
    Simian Adenovirus 25
    11 kDa, GI: 17227344
    CDS join (576 . . . 1142, 1235 . . . 1441) gene = “E1A” “EARLY E1A 28 KD
    PROTEIN” similarity
    to Simian Adenovirus
    25 28.2 kDa,
    GI: 17227342
    CDS join (576 . . . 1049, 1235 . . . 1441) gene = “E1A” “early E1A 24.6 KD
    protein” similarity to
    Simian Adenovirus 25
    24.8 kDa,
    GI: 17227343
    polyA_signal 1499 . . . 1504 “E1A”
    promoter 1553 . . . 1592 “E1B”
    CDS join (1600 . . . 2001, 2003 . . . 2029) gene = “E1B” “small T-antigen (E1B
    19K)”
    CDS 1600 . . . 2115 gene = “E1B” “early E1B 20 KD
    protein” similarity to
    Simian Adenovirus 25
    20.5 kDa,
    GI: 17227345
    CDS join (1905 . . . 2123, 3259 . . . 3276) gene = “E1B” “early E1B 8.2 KD
    protein” similarity to
    Simian Adenovirus 25
    10.1 kDa,
    GI: 17227348
    CDS 1905 . . . 3356 gene = “E1B” “large T antigen”
    similarity to Simian
    Adenovirus 25 54.7 kDa,
    GI: 17227347
    CDS join (1905 . . . 2153, 3141 . . . 3356) gene = “E1B” “early E1B 16.8 KD
    protein” similarity to
    Simian Adenovirus 25
    18.5 kDa,
    GI: 17227346
    CDS 3441 . . . 3869 gene = “IX” “protein IX (hexon-
    associated protein)”
    similarity to Simian
    Adenovirus 25 pIX,
    GI: 17227349
    polyA_signal 3880 . . . 3885 “E1B and IX”
    polyA_signal complement (3902 . . . 3907) “E2B and IVa2”
    CDS complement (join (3930 . . . 5263, gene = “IVa2” “IVa2 protein
    5542 . . . 5554)) (maturation protein)”
    similarity to Simian
    Adenovirus 25 pIVa2,
    GI: 17227350
    CDS complement (join (5033 . . . 8605, gene = “E2B(POL)” “DNA polymerase”
    12212 . . . 12220)) similarity to Simian
    Adenovirus 25 TPA:
    pol, GI: 33694808
    CDS 5105 . . . 5674 gene = “E2B” “19.4 KD early
    protein” similarity to
    Human Adenovirus 7
    hypothetical 20.6 kD
    early protein,
    GI: 58522
    CDS 6126 . . . 6446 gene = “E2B” “11.5 KD early
    protein” similarity to
    Human Adenovirus 7
    hypothtical 11.5 kD
    early protein,
    GI: 58524
    CDS 7814 . . . 8407 gene = “L1” “DNA-binding protein
    (agnoprotein)”
    similarity to Simian
    Adenovirus 25 21.9 kDa,
    GI: 17227351
    CDS join (7814 . . . 7819, 8536 . . . 8928) gene = “E2B” “14.1 KD early
    protein” similarity to
    Human Adenovirus 7
    hypothetical 14.5 kD
    early protein,
    GI: 58528
    CDS complement (join gene = “E2B(pTP)” “precursor terminal
    (8404 . . . 10323, 12212 . . . 12220)) protein” similarity to
    Simian Adenovirus 25
    TPA: pTP,
    GI: 33694809
    misc_RNA 10356 . . . 10514 “virus-associated RNA I” “VA RNA-I, 159 nt”
    promoter complement (10457 . . . 10496) “E2B”
    promoter 10541 . . . 10580 “L1”
    misc_RNA 10575 . . . 10743 “virus-associated RNA II” “VA RNA-II, 169 nt”
    CDS 10765 . . . 11937 gene = “L1(52K)” “52K protein”
    similarity to Simian
    Adenovirus 25 42.9 kDa
    (52K),
    GI: 17227352
    polyA_signal 11942 . . . 11947 “L1(52K)”
    CDS 11961 . . . 13736 gene = “L1(IIIa)” “protein IIIa”
    similarity to Simian
    Adenovirus 25 TPA:
    pIIIa, GI: 33694811
    polyA_signal 13749 . . . 13754 “L1(IIIa)”
    promoter 13758 . . . 13797 “L2”
    CDS 13815 . . . 15422 gene = “L2(penton)” “penton
    protein(protein III)”
    similarity to Simian
    Adenovirus 25 pIII,
    GI: 17227353
    polyA_signal 15425 . . . 15430 “L2(penton)”
    CDS 15426 . . . 16007 gene = “L2(pVII)” “major core protein
    (protein VII)”
    similarity to Simian
    Adenovirus 25 pVII,
    GI: 17227354
    CDS 16055 . . . 17080 gene = “L2(pV)” “minor core protein
    (protein V)” similarity
    to Simian Adenovirus
    25 TPA: pV,
    GI: 33694814
    CDS 17103 . . . 17336 gene = “L2(pX)” “protein X (protein
    mu)” similarity to
    Simian Adenovirus 25
    TPA: pX,
    GI: 33694815
    polyA_signal 17357 . . . 17362 “L2(pX)”
    CDS 17368 . . . 18141 gene = “L3(pVI)” “protein VI (hexon-
    associated protein)”
    similarity to Simian
    Adenovirus 25 pVI,
    GI: 17227356
    CDS 18248 . . . 21058 gene = “L3(hexon)” “hexon protein
    (protein II)” similarity
    to Simian Adenovirus
    25 pII (hexon),
    GI: 17227357
    CDS 21082 . . . 21702 gene = “L3(23K)” “late L3 23K
    proteinase (Adenain)”
    similarity to Simian
    Adenovirus 25
    protease, GI: 33694818
    polyA_signal 21725 . . . 21730 “L3”
    polyA_signal complement (21767 . . . 21772) “E2A”
    CDS complement (21774 . . . 23312) gene = “E2A(DBP)” “early E2A DNA-
    binding protein”
    similarity to Simian
    Adenovirus 25 DNA-
    binding protein,
    GI: 17227358
    CDS 23341 . . . 25716 gene = “L4(100K)” “100K protein”
    similarity to Simian
    Adenovirus 25 TPA:
    100K, GI: 33694820
    Promoter complement (23345 . . . 23384) “E2A”
    CDS 25439 . . . 25978 gene = “L4(22K)” “22K protein”
    similarity to Simian
    Adenovirus 25 TPA:
    22K, GI: 33694822
    CDS join(25439 . . . 25756, 25926 . . . 26249) gene = “L4(33K)” “33K protein”
    similarity to Simian
    Adenovirus 25 TPA:
    33K (24.3 kDa),
    GI: 17227359
    CDS 26318 . . . 27001 gene = “L4(pVIII)” “L4 protein VIII”
    similarity to Simian
    Adenovirus 25 pVIII,
    GI: 17227360
    CDS 27002 . . . 27322 gene = “E3” “E3 12.1 kDa protein”
    similarity to Simian
    Adenovirus 25 11.6 kDa,
    GI: 17227361
    CDS 27276 . . . 27908 gene = “E3” “E3 23.3 kDa protein”
    similarity to Simian
    Adenovirus 25 TPA:
    E3 CR1-alpha1,
    GI: 33694825
    CDS 27890 . . . 28414 gene = “E3” “E3 19 kDa protein”
    similarity to Simian
    Adenovirus 25 TPA:
    E3 gp19K (19.3 kDa),
    GI: 33694826
    CDS 28445 . . . 29107 gene = “E3” “E3 24.8 kDa protein”
    similarity to Simian
    Adenovirus 25 22.3 kDa,
    TPA: E3 CR1-
    gamma1,
    GI: 17227364
    CDS 29275 . . . 29439 gene = “E3” “E3 6.3 kDa protein”
    CDS 29436 . . . 30260 gene = “E3” “E3 29.7 kDa protein”
    similarity to Simian
    Adenovirus 25 TPA:
    E3 CR1-delta1,
    GI: 33694829
    CDS 30269 . . . 30544 gene = “E3” “E3 10.4 kDa protein”
    similarity to Simian
    Adenovirus 25 9.9 kDa,
    GI: 17227365
    CDS 30550 . . . 30990 gene = “E3” “E3 14.5 kDa protein”
    similarity to Simian
    Adenovirus 25 15.6 kDa,
    GI: 17227366
    CDS 30983 . . . 31384 gene = “E3” “E3 14.7 kDa protein”
    similarity to Simian
    Adenovirus 25 14.7 kDa,
    GI: 17227367
    polyA_signal 31424 . . . 31429 “E3”
    promoter 31473 . . . 31512 “L5”
    CDS 31645 . . . 32922 gene = “L5(fiber)” “fiber protein”
    similarity to Simian
    Adenovirus 25
    pIV(TPA: fiber),
    GI: 17227368
    polyA_signal 32982 . . . 32987 “L5”
    polyA_signal complement (32998 . . . 33003) “E4”
    CDS complement (33018 . . . 33212) gene = “E4” “E4 7.4 KD protein”
    similarity to Simian
    Adenovirus 25 Ad9
    ORF7-like protein,
    GI: 17227369
    CDS complement (join gene = “E4” “E4 15.9 KD protein”
    (33018 . . . 33266, 33992 . . . 34165)) similarity to Simian
    Adenovirus 25 TPA:
    E4 ORF6/7,
    GI: 33694835
    CDS complement (33266 . . . 34165) gene = “E4” “E4 34.6 KD protein”
    similarity to Simian
    Adenovirus 25 33 kDa,
    GI: 17227370
    CDS complement (34068 . . . 34436) gene = “E4” “E4 14.1 KD protein”
    similarity to Simian
    Adenovirus 25 13.2 kDa,
    GI: 17227371
    polyA_signal complement (34388 . . . 34393) “E4”
    CDS complement (34445 . . . 34798) gene = “E4” “E4 13.7 KD protein”
    similarity to Simian
    Adenovirus 25 12.8 kDa,
    GI: 17227372
    CDS complement (34795 . . . 35184) gene = “E4” “E4 14.6 KD protein”
    similarity to Simian
    Adenovirus 25 14.2 kD,
    GI: 17227373
    CDS complement (35232 . . . 35606) gene = “E4” “E4 13.5 KD protein”
    similarity to Simian
    Adenovirus 25 TPA:
    E4 ORF1,
    GI: 33694840
    repeat_unit complement (35875 . . . 35990) “ITR”
  • TABLE 42
    Ad4vaccine (Accession No. AY594254; SEQ ID NO: 578) Sequence Features and
    putative gene products
    Feature Type Location Comment or Gene Locus Product
    repeat_unit 1 . . . 116 “ITR”
    promoter 472 . . . 511 “E1A”
    CDS 576 . . . 1154 gene = “E1A” “ORF1: putative”
    CDS join (576 . . . 650, 1236 . . . 1340) gene = “E1A” “early E1A 6.8 KD
    protein” similarity to
    Simian Adenovirus 25
    11 kDa, GI: 17227344
    CDS join (576 . . . 1142, 1235 . . . 1441) gene = “E1A” “early E1A 28 KD
    protein” similarity to
    Simian Adenovirus 25
    28.2 kDa,
    GI: 17227342
    CDS join (576 . . . 1049, 1235 . . . 1441) gene = “E1A” “early E1A 24.6 KD
    protein” similarity to
    Simian Adenovirus 25
    24.8 kDa,
    GI: 17227343
    polyA_signal 1499 . . . 1504 “E1A”
    promoter 1553 . . . 1592 “E1B”
    CDS Join (1600 . . . 2001, 2003 . . . 2029) gene = “E1B” “small T-antigen (E1B
    19K)”
    CDS 1600 . . . 2115 gene = “E1B” “early E1B 20 KD
    protein” similarity to
    Simian Adenovirus 25
    20.5 kDa,
    GI: 17227345
    CDS join (1905 . . . 2123, 3259 . . . 3276) gene = “E1B” “early E1B 8.2 KD
    protein” similarity to
    Simian Adenovirus 25
    10.1 kDa,
    GI: 17227348
    CDS 1905 . . . 3356 gene = “E1B” “large T antigen”
    similarity to Simian
    Adenovirus 25 54.7 kDa,
    GI: 17227347
    CDS join (1905 . . . 2153, 3141 . . . 3356) gene = “E1B” “early E1B 16.8 KD
    protein” similarity to
    Simian Adenovirus 25
    18.5 kDa,
    GI: 17227346
    CDS 3441 . . . 3869 gene = “IX” “protein IX (hexon-
    associated protein)”
    similarity to Simian
    Adenovirus 25 pIX,
    GI: 17227349
    polyA_signal 3880 . . . 3885 “E1B and IX”
    polyA_signal complement (3902 . . . 3907) “E2B and IVa2”
    CDS complement (join (3930 . . . 5263, gene = “IVa2” “IVa2 protein
    5542 . . . 5554)) (maturation protein)”
    similarity to Simian
    Adenovirus 25 pIVa2,
    GI: 17227350
    CDS complement (join (5033 . . . 8605, gene = “E2B(POL)” “DNA polymerase”
    12212 . . . 12220)) similarity to Simian
    Adenovirus 25 TPA:
    pol, GI: 33694808
    CDS 5105 . . . 5674 gene = “E2B” “19.4 KD early
    protein” similarity to
    similar to Human
    Adenovirus 7
    hypothetical 20.6 kD
    early protein,
    GI: 58522
    CDS 6126 . . . 6446 gene = “E2B” “11.5 KD early
    protein” similarity to
    similar to Human
    Adenovirus 7
    hypothtical 11.5 kD
    early protein,
    GI: 58524
    CDS 7814 . . . 8407 gene = “L1” “DNA-binding protein
    (agnoprotein)”
    similarity to Simian
    Adenovirus 25 21.9 kDa,
    GI: 17227351
    CDS join (7814 . . . 7819, 8536 . . . 8928) gene = “E2B” “14.1 KD early
    protein” similarity to
    similar to Human
    Adenovirus 7
    hypothetical 14.5 kD
    early protein,
    GI: 58528
    CDS complement (join gene = “E2B(pTP)” “precursor terminal
    (8404 . . . 10323, 12212 . . . 12220)) protein” similarity to
    Simian Adenovirus 25
    TPA: pTP,
    GI: 33694809
    misc_RNA 10356 . . . 10514 “virus-associated RNA I” “VA RNA-I, 159 nt”
    promoter complement (10457 . . . 10496) “E2B”
    promoter 10541 . . . 10580 “L1”
    misc_RNA 10575 . . . 10743 “virus-associated RNA II” “VA RNA-II, 169 nt”
    CDS 10765 . . . 11937 gene = “L1(52K)” “52K protein”
    similarity to Simian
    Adenovirus 25 42.9 kDa
    (52K),
    GI: 17227352
    polyA_signal 11942 . . . 11947 “L1(52K)”
    CDS 11961 . . . 13736 gene = “L1(IIIa)” “protein IIIa”
    similarity to Simian
    Adenovirus 25 TPA:
    pIIIa, GI: 33694811
    polyA_signal 13749 . . . 13754 “L1(IIIa)”
    promoter 13758 . . . 13797 “L2”
    CDS 13815 . . . 15422 gene = “L2(penton)” “penton
    protein(protein III)”
    similarity to Simian
    Adenovirus 25 pIII,
    GI: 17227353
    polyA_signal 15425 . . . 15430 “L2(penton)”
    CDS 15426 . . . 16007 gene = “L2(pVII)” “major core protein
    (protein VII)”
    similarity to Simian
    Adenovirus 25 pVII,
    GI: 17227354
    CDS 16055 . . . 17080 gene = “L2(pV)” “minor core protein
    (protein V)” similarity
    to Simian Adenovirus
    25 TPA: pV,
    GI: 33694814
    CDS 17103 . . . 17336 gene = “L2(pX)” “protein X (protein
    mu)” similarity to
    Simian Adenovirus 25
    TPA: pX,
    GI: 33694815
    polyA_signal 17357 . . . 17362 “L2(pX)”
    CDS 17368 . . . 18141 gene = “L3(pVI)” “protein VI (hexon-
    associated protein)”
    similarity to Simian
    Adenovirus 25 pVI,
    GI: 17227356
    CDS 18248 . . . 21058 gene = “L3(hexon)” “hexon protein
    (protein II)” similarity
    to Simian Adenovirus
    25 pII (hexon),
    GI: 17227357
    CDS 21082 . . . 21702 gene = “L3(23K)” “late L3 23K
    proteinase (Adenain)”
    similarity to Simian
    Adenovirus 25
    protease, GI: 33694818
    polyA_signal 21725 . . . 21730 “L3”
    polyA_signal complement (21767 . . . 21772) “E2A”
    CDS complement (21774 . . . 23312) gene = “E2A(DBP)” “early E2A DNA-
    binding protein”
    similarity to Simian
    Adenovirus 25 DNA-
    binding protein,
    GI: 17227358
    CDS 23341 . . . 25716 gene = “L4(100K)” “100K protein”
    similarity to Simian
    Adenovirus 25 TPA:
    100K, GI: 33694820
    promoter complement (23345 . . . 23384) “E2A”
    CDS 25439 . . . 25978 gene = “L4(22K)” “22K protein”
    similarity to Simian
    Adenovirus 25 TPA:
    22K, GI: 33694822
    CDS join (25439 . . . 25756, gene = “L4(33K)” “33K protein”
    25926 . . . 26252) similarity to Simian
    Adenovirus 25 TPA:
    33K (24.3 kDa),
    GI: 17227359
    CDS 26321 . . . 27004 gene = “L4(pVIII)” “L4 protein VIII”
    similarity to Simian
    Adenovirus 25 pVIII,
    GI: 17227360
    CDS 27005 . . . 27325 gene = “E3” “E3 12.1 kDa protein”
    similarity to Simian
    Adenovirus 25 11.6 kDa,
    GI: 17227361
    CDS 27279 . . . 27911 gene = “E3” “E3 23.3 kDa protein”
    similarity to Simian
    Adenovirus 25 TPA:
    E3 CR1-alpha1,
    GI: 33694825
    CDS 27893 . . . 28417 gene = “E3” “E3 19 kDa protein”
    similarity to Simian
    Adenovirus 25 TPA:
    E3 gp19K (19.3 kDa),
    GI: 33694826
    CDS 28449 . . . 29111 gene = “E3” “E3 24.8 kDa protein”
    similarity to Simian
    Adenovirus 25 22.3 kDa,
    TPA: E3 CR1-
    gamma1,
    GI: 17227364
    CDS 29279 . . . 29443 gene = “E3” “E3 6.3 kDa protein”
    CDS 29440 . . . 30264 gene = “E3” “E3 29.7 kDa protein”
    similarity to Simian
    Adenovirus 25 TPA:
    E3 CR1-delta1,
    GI: 33694829
    CDS 30273 . . . 30548 gene = “E3” “E3 10.4 kDa protein”
    similarity to Simian
    Adenovirus 25 9.9 kDa,
    GI: 17227365
    CDS 30554 . . . 30994 gene = “E3” “E3 14.5 kDa protein”
    similarity to Simian
    Adenovirus 25 15.6 kDa,
    GI: 17227366
    CDS 30987 . . . 31388 gene = “E3” “E3 14.7 kDa protein”
    similarity to Simian
    Adenovirus 25 14.7 kDa,
    GI: 17227367
    polyA_signal 31428 . . . 31433 “E3”
    promoter 31477 . . . 31516 “L5”
    CDS 31649 . . . 32926 gene = “L5(fiber)” “fiber protein”
    similarity to Simian
    Adenovirus 25
    pIV(TPA: fiber),
    GI: 17227368
    polyA_signal 32986 . . . 32991 “L5”
    polyA_signal complement (33002 . . . 33007) “E4”
    CDS complement (33022 . . . 33216) gene = “E4” “E4 7.4 KD protein”
    similarity to Simian
    Adenovirus 25 Ad9
    ORF7-like protein,
    GI: 17227369
    CDS complement (join gene = “E4” “E4 15.9 KD protein”
    (33022 . . . 33270, 33996 . . . 34169)) similarity to Simian
    Adenovirus 25 TPA:
    E4 ORF6/7,
    GI: 33694835
    CDS complement (33270 . . . 34169) gene = “E4” “E4 34.6 KD protein”
    similarity to Simian
    Adenovirus 25 33 kDa,
    GI: 17227370
    CDS complement (34072 . . . 34440) gene = “E4” “E4 14.1 KD protein”
    similarity to Simian
    Adenovirus 25 13.2 kDa,
    GI: 17227371
    polyA_signal complement (34392 . . . 34397) “E4”
    CDS complement (34449 . . . 34802) gene = “E4” “E4 13.7 KD protein”
    similarity to Simian
    Adenovirus 25 12.8 kDa,
    GI: 17227372
    CDS complement (34799 . . . 35188) gene = “E4” “E4 14.6 KD protein”
    similarity to Simian
    Adenovirus 25 14.2 kD,
    GI: 17227373
    CDS complement (35236 . . . 35610) gene = “E4” “E4 13.5 KD protein”
    similarity to Simian
    Adenovirus 25 TPA:
    E4 ORF1,
    GI: 33694840
    repeat_unit complement (35879 . . . 35994) “ITR”
  • TABLE 43
    Ad4FS_navy (Accession No. AY599835; SEQ ID NO: 579) Sequence Features
    and putative gene products
    Feature Type Location Comment or Gene Locus Product
    repeat_region 1 . . . 208 “ITR”
    CDS 576 . . . 1121 gene = “E1A” “ORF1: putative”
    CDS Join (576 . . . 650, 1203 . . . 1307) gene = “E1A” “early E1A 6.8 KD
    protein” similarity to
    similar to Simian
    Adenovirus 25 11 kDa,
    GI: 17227344
    CDS join (576 . . . 1109, 202 . . . 1408) gene = “E1A” “early E1A 27 KD
    protein” similarity to
    Simian Adenovirus 25
    28.2 kDa,
    GI: 17227342
    CDS join (576 . . . 1016, 202 . . . 1408) gene = “E1A” “early E1A 23.5 KD
    protein” similarity to
    Simian Adenovirus 25
    24.8 kDa,
    GI: 17227343
    polyA_signal 1464 . . . 1469 “E1A”
    promoter 1518 . . . 1557 “E1B”
    CDS Join (1565 . . . 1966, 1968 . . . 1994) gene = “E1B” “small T antigen”
    CDS 1565 . . . 2119 gene = “E1B” “early E1B 21.5 KD
    protein”
    standard_name -
    Simian Adenovirus 25
    20.5 kDa,
    GI: 17227345
    CDS join (1870 . . . 2127, 3263 . . . 3280) gene = “E1B” “early E1B 9 KD
    protein” similarity to
    Simian Adenovirus 25
    10.1 kDa,
    GI: 17227348
    CDS 1870 . . . 3360 gene = “E1B” “large T antigen (55 KD)”
    similarity to
    Simian Adenovirus 25
    54.7 kDa, GI:
    17227347
    CDS join (1870 . . . 2157, 3145 . . . 3360) gene = “E1B” “early E1B 17.9 KD
    protein” similarity to
    Simian Adenovirus 25
    18.5 kDa,
    GI: 17227346
    CDS 3444 . . . 3872 gene = “IX” “protein IX (hexon-
    associated protein)”
    polyA_signal 3882 . . . 3887 “E1B and IX”
    polyA_signal Complement (3904 . . . 3909) “E2B and IVa2”
    CDS Complement (join gene = “IVa2” “IVa2 protein
    (3935 . . . 5268, 5547 . . . 5559)) (maturation protein)”
    CDS complement (join (5038 . . . 8610, gene = “E2B(POL)” “DNA polymerase”
    12152 . . . 12160))
    CDS 5110 . . . 5679 gene = “E2B” “19.4 KD early
    protein” similarity to
    similar to Human
    Adenovirus 7
    htpothetical 20.6 kD
    early protein,
    GI: 58522
    CDS 6131 . . . 6451 gene = “E2B” “11.5 KD early
    protein” similarity to
    similar to Human
    Adenovirus 7
    hypothetical 11.5 kD
    early protein,
    GI: 58524
    CDS 7819 . . . 8412 gene = “L1” “DNA-binding protein
    (agnoprotein)”
    similarity to Simian
    Adenovirus 25 21.9 kDa,
    GI: 17227251
    CDS join (7819 . . . 7824, 8541 . . . 8933) gene = “E2B” “14.1 KD early
    protein” similarity to
    similar to Human
    Adenovirus 7
    hypothetical 14.5 KD
    early protein,
    GI: 58528
    CDS complement (join gene = “E2B(pTP)” “precursor terminal
    (8409 . . . 10328, 12152 . . . 12160)) protein”
    misc_RNA 10361 . . . 10519 “virus-associated RNA I” “VA RNA-I, 159 nt”
    promoter complement(10462 . . . 10501) “E2B”
    promoter 10542 . . . 10581 “L1”
    misc_RNA 10584 . . . 10684 “virus-associated RNA II” “VA RNA-II, 101 nt”
    CDS 10705 . . . 11877 gene = “L1(52K)” “52K protein”
    polyA_signal 11882 . . . 11887 “L1(52K)”
    CDS 11901 . . . 13682 gene = “L1(IIIa)” “protein IIIa”
    polyA_signal 13696 . . . 13701 “L1(IIIa)”
    promoter 13755 . . . 13794 “L2”
    CDS 13762 . . . 15369 gene = “L2(penton)” “penton
    protein(protein III)”
    polyA_signal 15372 . . . 15377 “L2(penton)”
    CDS 15373 . . . 15954 gene = “L2(pVII)” “major core protein
    (protein VII)”
    CDS 16002 . . . 17027 gene = “L2(pV)” “minor core protein
    (protein V)”
    CDS 17050 . . . 17283 gene = “L2(pX)” “protein X (protein
    mu)”
    CDS 17343 . . . 18074 gene = “L3(pVI)” “protein VI (hexon-
    associated protein)”
    CDS 18181 . . . 20991 gene = “L3(hexon)” “hexon protein
    (protein II)”
    CDS 21015 . . . 21635 gene = “L3(23K)” “23K protease”
    polyA_signal 21661 . . . 21666 “L3”
    polyA_signal complement (21703 . . . 21708) “E2A”
    CDS complement (21710 . . . 23242) gene = “E2A(DBP)” “early E2A DNA-
    binding protein”
    promoter complement (23170 . . . 23209) “E2A”
    promoter 23211 . . . 23250 “L4”
    CDS 23271 . . . 25634 gene = “L4(100K)” “100K protein”
    CDS 25369 . . . 25884 gene = “L4(22K)” “22K protein”
    CDS join (25369 . . . 25674, gene = “L4(33K)” “33K protein”
    25844 . . . 26158)
    CDS 26226 . . . 26909 gene = “L4(pVIII)” “L4 protein VIII”
    CDS 26910 . . . 27230 gene = “E3” “E3 12.1 kDa protein”
    CDS 27184 . . . 27816 gene = “E3” “E3 23.3 kDa protein”
    CDS 27798 . . . 28322 gene = “E3” “E3 19 kDa protein”
    CDS 28352 . . . 28987 gene = “E3” “E3 24.8 kDa protein”
    CDS 29296 . . . 30105 gene = “E3” “E3 29.7 kDa protein”
    CDS 30114 . . . 30389 gene = “E3” “E3 10.4 kDa protein”
    CDS 30395 . . . 30835 gene = “E3” “E3 14.5 kDa protein”
    CDS 30828 . . . 31229 gene = “E3” “E3 14.7 kDa protein”
    polyA_signal 31279 . . . 31284 “E3”
    promoter 31292 . . . 31331 “L5”
    CDS 31464 . . . 32741 gene = “L5(fiber)” “fiber protein”
    polyA_signal 32801 . . . 32806 “L5”
    polyA_signal complement (32817 . . . 32822) “E4”
    CDS complement (32837 . . . 33031) gene = “E4” “E4 7.4 KD protein”
    CDS complement (join gene = “E4” “E4 15.9 KD protein”
    (32837 . . . 33085, 33811 . . . 33984))
    CDS complement (33085 . . . 33984) gene = “E4” “E4 34.6 KD protein”
    CDS complement (33887 . . . 34255) gene = “E4” “E4 14.1 KD protein”
    polyA_signal complement (34207 . . . 34212) “E4”
    CDS complement (34264 . . . 34617) gene = “E4” “E4 13.7 KD protein”
    CDS complement (34614 . . . 35003) gene = “E4” “E4 14.6 KD protein”
    CDS complement (35051 . . . 35425) gene = “E4” “E4 13.5 KD protein”
    repeat_region complement(35758 . . . 35965) “ITR”
  • TABLE 44
    Ad4FS_AF (Accession No. AY599837; SEQ ID NO: 580) Sequence Features and
    putative gene products
    Feature Type Location Comment or Gene Locus Product
    repeat_region 1 . . . 208 “ITR”
    CDS 575 . . . 1120 gene = “E1A” “ORF1; putative”
    CDS Join (575 . . . 649, 1202 . . . 1306) gene = “E1A” “early E1A 6.8 KD
    protein” similarity to
    Simian Adenovirus 25
    11 kDa, GI: 17227344
    CDS Join (575 . . . 1108, 1201 . . . 1407) gene = “E1A” “early E1A 27 KD
    protein” similarity to
    Simian Adenovirus 25
    28.2 kDa,
    GI: 17227342
    CDS Join (575 . . . 1015, 1201 . . . 1407) gene = “E1A” “early E1A 23.5 KD
    protein” similarity to
    Simian Adenovirus 25
    24.8 kDa,
    GI: 17227343
    polyA_signal 1463 . . . 1468 “E1A”
    promoter 1517 . . . 1556 “E1B”
    CDS join (1564 . . . 1965, 1976 . . . 1993) gene = “E1B” “small T antigen (16.5 KD)”
    CDS 1564 . . . 2115 gene = “E1B” “early E1B 21.5 KD
    protein” similarity to
    Simian Adenovirus 25
    20.5 kDa,
    GI: 17227345
    CDS join (1869 . . . 2123, 3258 . . . 3269) gene = “E1B” “early E1B 9 KD
    protein” similarity to
    Simian Adenovirus 25
    10.1 kDa,
    GI: 17227348
    CDS join (1869 . . . 2615, 2618 . . . 3355) gene = “E1B” “large T antigen (55 KD)”
    similarity to
    Simian Adenovirus 25
    54.7 kDa,
    GI: 17227347
    CDS join (1869 . . . 2153, 3140 . . . 3355) gene = “E1B” “early E1B 17.9 KD
    protein” similarity to
    Simian Adenovirus 25
    18.5 kDa,
    GI: 17227346”
    CDS 3439 . . . 3867 gene = “IX” “protein IX (hexon-
    associated protein)”
    polyA_signal 3877 . . . 3882 “E1B and IX”
    polyA_signal complement (3899 . . . 3904) “E2B and IVa2”
    CDS complement (join (3931 . . . 5264, gene = “IVa2” “IVa2 protein
    5543 . . . 5555)) (maturation protein)”
    CDS complement (join (5034 . . . 8606, gene = “E2B(POL)” “DNA polymerase”
    12151 . . . 12159))
    CDS 5106 . . . 5675 gene = “E2B” “19.4 KD early
    protein.” similarity to
    similar to Human
    Adenovirus 7
    hypothetical 20.6 kD
    early protein,
    GI: 58522
    CDS 6127 . . . 6447 gene = “E2B” “11.5 KD early
    protein” similarity to
    similar to Human
    Adenovirus 7
    hypothtical 11.5 kD
    early protein,
    GI: 58524
    CDS 7815 . . . 8408 gene = “L1” “DNA-binding protein
    (agnoprotein)”
    similarity to Simian
    Adenovirus 25 21.9 kDa,
    GI: 17227351
    CDS join (7815 . . . 7820, 8537 . . . 8929) gene = “E2B” “14.1 KD early
    protein” similarity to
    similar to Human
    Adenovirus 7
    hypothetical 14.5 KD
    early protein,
    GI: 58528
    CDS complement (join gene = “E2B” “precursor terminal
    (8405 . . . 10324, 12151 . . . 12159)) protein”
    misc_RNA 10357 . . . 10515 “virus-associated RNA I” “VA RNA-I, 159 nt”
    promoter complement (10458 . . . 10497) “E2B”
    promoter 10541 . . . 10580 “L1”
    misc_RNA 10583 . . . 10683 “virus-associated RNA II” “VA RNA-II, 101 nt”
    CDS 10704 . . . 11876 gene = “L1(52K)” “52K protein”
    polyA_signal 11881 . . . 11886 “L1(52K)”
    CDS 11900 . . . 13681 gene = “L1(IIIa)” “protein IIIa”
    polyA_signal 13695 . . . 13700 “L1(IIIa)”
    promoter 13754 . . . 13793 “L2”
    CDS 13761 . . . 15368 gene = “L2(penton)” “penton
    protein(protein III)”
    polyA_signal 15371 . . . 15376 “L2(penton)”
    CDS 15372 . . . 15953 gene = “L2(pVII)” “major core protein
    (protein VII)”
    CDS 16001 . . . 17026 gene = “L2(pV)” “minor core protein
    (protein V)”
    CDS 17049 . . . 17282 gene = “L2(pX)” “protein X (protein
    mu)”
    CDS 17314 . . . 18072 gene = “L3(pVI)” “protein VI (hexon-
    associated protein)”
    CDS 18179 . . . 20989 gene = “L3(hexon)” “hexon protein
    (protein II)”
    CDS 21013 . . . 21633 gene = “L3(23K)” “L3 23K
    proteinase(Adenain)”
    polyA_signal 21659 . . . 21664 “L3”
    polyA_signal complement (21701 . . . 21706) “E2A”
    CDS complement (21708 . . . 23240) gene = “E2A(DBP)” “early E2A DNA-
    binding protein”
    promoter complement (23168 . . . 23207) “E2A”
    promoter 23209 . . . 23248 “L4”
    CDS 23269 . . . 25632 gene = “L4(100K)” “100K protein”
    CDS 25367 . . . 25882 gene = “L4(22K)” “22K protein”
    CDS join (25367 . . . 25672, gene = “L4(33K)” “33K protein”
    25842 . . . 26156)
    CDS 26224 . . . 26907 gene = “L4(pVIII)” “L4 protein VIII”
    CDS 26908 . . . 27228 gene = “E3” “E3 12.1 kDa protein”
    CDS 27182 . . . 27814 gene = “E3” “E3 23.3 kDa protein”
    CDS 27796 . . . 28320 gene = “E3” “E3 19 kDa protein”
    CDS 28350 . . . 28985 gene = “E3” “E3 24.8 kDa protein”
    CDS 29295 . . . 30104 gene = “E3” “E3 29.7 kDa protein”
    CDS 30113 . . . 30388 gene = “E3” “E3 10.4 kDa protein”
    CDS 30394 . . . 30834 gene = “E3” “E3 14.5 kDa protein”
    CDS 30827 . . . 31228 gene = “E3” “E3 14.7 kDa protein”
    polyA_signal 31278 . . . 31283 “E3”
    promoter 31291 . . . 31330 “L5”
    CDS 31463 . . . 32740 gene = “L5(fiber)” “fiber protein”
    polyA_signal 32800 . . . 32805 “L5”
    polyA_signal complement (32816 . . . 32821) “E4”
    CDS complement (32836 . . . 33030) gene = “E4” “E4 7.4 KD protein”
    CDS complement (join gene = “E4” “E4 15.9 KD protein”
    (32836 . . . 33084, 33810 . . . 33983))
    CDS complement (33084 . . . 33983) gene = “E4” “E4 34.6 KD protein”
    CDS complement (33886 . . . 34254) gene = “E4” “E4 14.1 KD protein”
    polyA_signal complement (34206 . . . 34211) “E4”
    CDS complement (34263 . . . 34616) gene = “E4” “E4 13.7 KD protein”
    CDS complement (34613 . . . 35002) gene = “E4” “E4 14.6 KD protein”
    CDS complement (35050 . . . 35424) gene = “E4” “E4 13.5 KD protein”
    repeat_region complement (35757 . . . 35964) “ITR”
  • TABLE 45
    Ad5FS (Accession No. AY601635; SEQ ID NO: 581) Sequence Features and
    putative gene products
    Feature Type Location Comment or Gene Locus Product
    CDS 11565 . . . 12297 “52/55K protein gene” protein_id = “AAA96406.1”
    CDS 12318 . . . 14075 product = “protein IIIa” protein_id = “AAA96407.1”
    CDS 16286 . . . 16474 product = “protein pVII” protein_id = “AAA96408.1”
    CDS 16544 . . . 17650 product = “protein V” protein_id = “AAA96409.1”
    CDS 17774 . . . 17920 product = “protein 5 protein_id = “AAA96410.1”
    precursor”
    CDS 18003 . . . 18755 product = “protein pVI” protein_id = “AAA96411.1”
    CDS 25819 . . . 26484 “100K protein” protein_id = “AAA96412.1”
    Exon 26485 . . . 26514 “of a 33K protein”
    Exon 26713 . . . 27083 “of a 33K protein”
    CDS 27174 . . . 27857 product = “protein pVIII” protein_id = “AAA96413.1”
  • TABLE 46
    Ad7 (Accession No. AY594255; SEQ ID NO: 582) Sequence Features and
    putative gene products
    Feature Type Location Comment or Gene Locus Product
    repeat_region 1 . . . 108 “the inverted terminal
    repeat”
    promoter 481 . . . 486 “TATA box for E1A”
    CDS Join (577 . . . 648, 1250 . . . 1351) gene = “E1A” “6 kD protein”
    CDS Join (577 . . . 1156, 1250 . . . 1455) gene = “E1A” “E1A 28 kD protein”
    CDS Join (577 . . . 1063, 1250 . . . 1455) gene = “E1A” “mRNAII product,
    homologue of
    gi|209784”
    polyA_site 1494 . . . 1499 “polyA site for E1A gene.
    GenScan Prediction”
    promoter 1549 . . . 1554 “TATA box for E1B”
    CDS 1603 . . . 2139 gene = “E1B” “19 kD small T
    antigen, homologous
    to the unnamed
    protein product in
    Ad7, gi|58518”
    CDS 1908 . . . 3386 gene = “E1B” “55 kD protein,
    homologous to
    gi|58519 in Ad7”
    CDS 3144 . . . 3386 gene = “E1B” “hypothetical protein
    derived from 1.2 kB
    mRNA”
    Promoter 3384 . . . 3389 “TATA box for proteinIX”
    polyA_site 3405 . . . 3410 “possible polyA site for the
    E1b genes”
    CDS 3481 . . . 3897 gene = “proteinIX” “hexon associated
    protein IX,
    homologous to the
    unnamed protein
    gi|58521, in Ad7”
    polyA_site 3910 . . . 3915 “Genscan predicted polyA
    site for the proteinIX gene”
    polyA_site complement (3928 . . . 3933) “Genscan predicted polyA
    site for E2B genes”
    CDS complement (join (3950 . . . 5283, gene = “IVa2” “maturation protein
    5562 . . . 5574)) IVA2”
    CDS Complement (5053 . . . 8421) gene = “E2B” “DNA polymerase”
    Promoter 5874 . . . 5879 “TATA box for the major
    late promoter”
    CDS 7987 . . . 8427 gene = “L1” “DNA binding
    protein, homologous to
    protein gi|17227351 in
    Adenovirus type E”
    CDS complement (8231 . . . 8575) gene = “E2B” “hypothetical 12.6 kD
    early protein,
    gi|139931 in Ad7”
    CDS complement (8424 . . . 10346) gene = “E2B” “terminal protein
    precursor, homologue
    in Ad7 is gi|74214”
    CDS 8550 . . . 8951 gene = “L1” “hypothetical 14.5 kD
    protein”
    CDS complement (9545 . . . 9859) gene = “E2B” “11.3 kD early protein,
    homologue in Ad7 is
    gi|139914”
    CDS 9759 . . . 10034 gene = “L1” “9.7 kD hypothetical
    protein, homologue in
    Ad7 is gi|140138”
    misc_RNA 10423 . . . 10592 “VA RNA I”
    misc_RNA 10668 . . . 10838 “VA RNA II”
    CDS 10890 . . . 12026 gene = “L1” “55 kD protein”
    CDS 12051 . . . 13817 gene = “L1” “peripentonal hexon
    associated protein
    IIIa”
    polyA_site 13830 . . . 13835 “Genscan predicted polyA
    site for L1”
    CDS 13905 . . . 15539 gene = “L2” “penton base protein
    (III)”
    polyA_site 15545 . . . 15550 “Genscsan predicted polyA
    site for L2”
    CDS 15550 . . . 16128 gene = “L2” “protein VII
    precursor”
    CDS 16171 . . . 17000 gene = “L2” “minor core protein,
    protein V”
    polyA_site 17497 . . . 17502 “Genscan predicted polyA
    site for L2”
    CDS 17554 . . . 18306 gene = “L3” “protein VI precursor”
    CDS 18419 . . . 21232 gene = “L3” “hexon protein”
    CDS 21269 . . . 21898 gene = “L3” “23K protease”
    polyA_site 21918 . . . 21923 “Genscan predicted polyA
    site for L3”
    polyA_site complement (21930 . . . 21935) “Genscan predicted polyA
    site for E2A”
    CDS complement (21985 . . . 23538) gene = “E2A” “DNA binding
    protein”
    CDS 23569 . . . 26055 gene = “L4” “100k hexon-
    assembly associated
    protein”
    CDS complement (24924 . . . 25133) gene = “hypothetical” “hypothetical protein”
    CDS 25757 . . . 26356 gene = “L4” “22K protein”
    CDS join (25850 . . . 26225, gene = “L4” “33 kD protein”
    26275 . . . 26630)
    polyA_site 26662 . . . 26667 “possible polyA site for the
    L4 gene”
    CDS 26700 . . . 27383 gene = “L4” “protein VIII, hexon-
    associated protein
    precursor”
    Promoter 27065 . . . 27070 “TATA box for E3”
    CDS 27383 . . . 27703 gene = “E3” “12.1 kD glycoprotein”
    CDS 27657 . . . 28097 gene = “E3” “16.1 kD protein”
    CDS 28082 . . . 28600 gene = “E3” “19.3 kD MHC classI
    antigen-binding
    glycoprotein
    precursor”
    CDS 28630 . . . 29169 gene = “E3” “hypothetical 20.6 kD
    protein”
    CDS 29182 . . . 29751 gene = “E3” “20.6 kD protein”
    CDS 29766 . . . 29966 gene = “E3” “7.7 kD protein”
    CDS 30083 . . . 30313 gene = “E3” “10.3 kD protein”
    CDS 30285 . . . 30722 gene = “E3” “14.9 kD protien”
    CDS 30715 . . . 31122 gene = “E3” “14.7 kD protein”
    polyA_site 31128 . . . 31133 “Genscan predicted polyA
    site for E3”
    CDS complement (31141 . . . 31305) gene = “” “U protein”
    CDS 31320 . . . 32297 gene = “L5” “fiber protein”
    polyA_site complement (32317 . . . 32322) “Genscan prediction for
    polyA site of E4”
    CDS complement (32333 . . . 32584) gene = “E4” “orf 6/7 protein”
    CDS complement (32581 . . . 33480) gene = “E4” “33.2 kD protein”
    CDS complement (33383 . . . 33751) gene = “E4” “13.6 kD protein”
    CDS 33606 . . . 34115 gene = “L5” “agnoprotein”
    CDS complement (33760 . . . 34113) gene = “E4” “34 kD protein”
    CDS complement (34110 . . . 34499) gene = “E4” “130aa protein”
    polyA_site 34122 . . . 34127 “possible polyA site for the
    L5 gene”
    CDS complement (34541 . . . 34918) gene = “E4” “13.9 kD protein”
    Promoter complement (35000 . . . 35005) “TATA box for E4”
    repeat_region complement (35199 . . . 35306) “the inverted terminal
    repeat”
  • TABLE 47
    Ad7FS_navy (Accession No. AY601634; SEQ ID NO: 583) Sequence Features
    and putative gene products
    Feature Type Location Comment or Gene Locus Product
    repeat_region 0 . . . 135 “the inverted terminal
    repeat”
    promoter 479 . . . 484 “TATA box for E1A”
    CDS 575 . . . 1168 gene = “E1A” “hypothetical E1A
    protein”
    CDS join (575 . . . 646, 1249 . . . 1350) gene = “E1A” “6 KD protein”
    CDS join (575 . . . 1154, 1249 . . . 1454) gene = “E1A” “mRNAI, 28 KD E1A
    protein”
    CDS join (575 . . . 1061, 1249 . . . 1454) gene = “E1A” “mRNAII protein”
    polyA_signal 1493 . . . 1498 “polyA signal for E1A gene”
    promoter 1548 . . . 1553 “TATA box for E1B”
    CDS 1602 . . . 2138 gene = “E1B” “20 KD small T
    antigen”
    CDS 1907 . . . 3385 gene = “E1B” “transformation
    associated 55 KD
    protein”
    Promoter 3383 . . . 3388 “TATA box for proteinIX”
    polyA_signal 3401 . . . 3406 “possible polyA signal for
    E1B gene”
    CDS 3479 . . . 3895 gene = “pIX” “proteinIX”
    polyA_signal 3908 . . . 3913 “polyA signal for the
    proteinIX gene”
    polyA_signal complement (3926 . . . 3931) “possible polyA signal for
    E2B genes”
    CDS complement (join (5560 . . . 5572, gene = “E2B” “maturation protein
    3948 . . . 5281) IVa2”
    CDS complement (5051 . . . 8419) gene = “E2B” “DNA polymerase”
    Promoter 5872 . . . 5877 “TATA box for the major
    late promoter”
    CDS 6144 . . . 6464 gene = “hypothetical” “hypothetical protein
    A-106”
    CDS complement (6868 . . . 7389) gene = “E2B” “hypothetical 19 KD
    protein”
    CDS 7133 . . . 7420 gene = “L1” “hypothetical 10.4 KD
    protein”
    CDS 7829 . . . 8425 gene = “L1” “15.3 KD agnoprotein”
    CDS complement (8328 . . . 8573) gene = “E2B” “hypothetical 12.6 kD
    early protein”
    CDS complement (8422 . . . 10344) gene = “E2B” “preterminal DNA-
    binding protein”
    CDS 8548 . . . 8949 gene = “hypothetical” “hypothetical 14.5 KD
    early protein”
    CDS 9757 . . . 10032 gene = “hypothetical” “hypothetical 9.7 KD
    protein”
    Misc_RNA 10424 . . . 10584 “VA RNA I”,
    Misc_RNA 10655 . . . 10829 “VA RNA II”
    CDS 10806 . . . 11975 gene = L1” “55 KD protein”
    CDS 12000 . . . 13766 gene = “L1” “peripentonal hexon
    associated protein
    IIIA”
    polyA_signal 13779 . . . 13784 “polyA signal for L1”
    CDS 13854 . . . 15488 gene = “L2” “penton base protein”
    CDS 15500 . . . 16078 gene = “L2” “major core protein
    precursor pVII”
    CDS 16121 . . . 17173 gene = “L2” “minor core protein
    precursor pV”
    polyA_signal 17448 . . . 17453 “possible polyA signal for
    L2”
    CDS 17505 . . . 18239 gene = “L3” “pVI precursor”
    CDS 18352 . . . 21156 gene = “L3” “the hexon protein”
    CDS 21193 . . . 21822 gene = “L3” “23 KD proteinase”
    polyA_signal 21842 . . . 21847 “possible polyA signal for
    L3”
    polyA_signal complement (21854 . . . 21859) “possible polyA signal for
    E2A”
    CDS complement (21911 . . . 23464) gene = “E2A” “DNA binding
    protein”
    CDS 23495 . . . 25984 gene = “L4” “100 KD protein”
    CDS 25686 . . . 26285 gene = “L4” “22 KD protein”
    CDS join gene = “L4” “33 KD protein”
    (25686 . . . 26034, 26204 . . . 26559)
    CDS 26719 . . . 27312 gene = “L4” “pVIII protein”
    Promoter 26994 . . . 26999 “putative TATA box for the
    E3 gene”
    CDS 27312 . . . 27632 gene = “E3A” “12.1 KD
    glycoprotein”
    polyA_signal 27391 . . . 27396 “possible polyA signal for
    L4”
    CDS 27586 . . . 28026 gene = “E3A” “16.1 KD protein”
    CDS 28011 . . . 28529 gene = “E3A” “19 KD MHC classI
    antigen-binding
    glycoprotein”
    CDS 28559 . . . 29083 gene = “E3A” “20.3 KD
    glycoprotein”
    CDS 29110 . . . 29679 gene = “E3A” “20.3 KD protein”
    CDS 29694 . . . 29819 gene = “E3A” “7.7 KD protein”
    CDS 29931 . . . 30206 gene = “E3B” “10.3 KD protein”
    CDS 30178 . . . 30615 gene = “E3B” “14.9 KD protein”
    CDS 30608 . . . 31015 gene = “E3B” “15.3 KD protein”
    polyA_signal 31021 . . . 31026 “putative polyA signal for
    E3”
    CDS 31213 . . . 32190 gene = “L5” “fiber protein”
    polyA_signal} complement (32209 . . . 32214) “polyA signal for the E4
    gene”
    CDS complement (32225 . . . 32476) gene = “E4” “ORF6/7”
    CDS complement (32473 . . . 33372) gene = “E4” “32 KD protein”
    CDS complement (33275 . . . 33643) gene = “E4” “13.6 KD protein”
    CDS 33498 . . . 34007 gene = “L5” “agnoprotein”
    CDS complement (33652 . . . 34005) gene = “E4” “13 KD protein”
    CDS complement (34002 . . . 34391) gene = “E4” “130aa protein
    CDS complement (34433 . . . 34810) gene = “E4” “13.9 KD protein”
    Promoter complement (34891 . . . 24896) “possible TATA box for the
    E4 gene”
    repeat_region complement (35062 . . . 35197) “the inverted terminal
    repeat”
  • TABLE 48
    Ad7vaccine (Accession No. AY594256; SEQ ID NO: 584) Sequence Features and
    putative gene products
    Feature Type Location Comment or Gene Locus Product
    misc_feature 1 . . . 136 “the inverted terminal
    repeat”
    promoter 476 . . . 481 “TATA box for the E1A
    genes”
    CDS join (572 . . . 647, 1247 . . . 1348) gene = “E1A” “E1A 6 kD protein”
    CDS join (572 . . . 1157, 1246 . . . 1452) gene = “E1A” “E1A mRNA I
    protein, homologous
    to the 29.1 kD protein
    in Ad11”
    CDS join (572 . . . 1067, 1246 . . . 1452) gene = “E1A” “E1A mRNA II
    protein, homologous
    to the 25.7 kD E1A
    protein in Ad 11”
    polyA_site 1490 . . . 1495
    promoter 1545 . . . 1550 “TATA box for E1B”
    CDS 1599 . . . 2136 gene = “E1B” “20 kd protein, small
    T antigen”
    CDS 1904 . . . 3382 gene = “E1B” “55 kD protein”
    promoter 3380 . . . 3385 “TATA box for pIX”
    CDS 3476 . . . 3892 gene = “pIX” “protein IX”
    polyA_site 3905 . . . 3910
    polyA_site complement (3923 . . . 3928)
    CDS complement (join (3945 . . . 5278, gene = “E2B” “pIVA2”
    5557 . . . 5569))
    CDS complement (5048 . . . 8416) gene = “E2B” “DNA polymerase”
    promoter 5869 . . . 5874 “TATA box for the major
    late promoter”
    CDS 6141 . . . 6461 gene = “hypothetical” “A-106 hypothetical
    protein”
    CDS 7826 . . . 8422 gene = “agnoprotein gene” “13.6 kD agnoprotein”
    CDS complement (8419 . . . 10341) gene = “E2B” “DNA terminal
    protein”
    CDS complement (9540 . . . 9854) gene = “hypothetical” “11.3 kD hypothetical
    protein”
    CDS 9754 . . . 10029 gene = “hypothetical” “protein = 9.7 kD
    hypothetical protein”
    misc_RNA 10403 . . . 10821 “VA RNA, SHORTENED “VA RNA”
    DUE TO A 25bp
    DELETION”
    CDS 10828 . . . 11997 gene = “L1” “55 kD protein”
    CDS 12022 . . . 13788 gene = “L1” “pIIIA precursor”
    CDS 13876 . . . 15510 “L2” “penton protein III
    precursor”
    polyA_site 15512 . . . 15517
    CDS 15520 . . . 16098 gene = “L2” “protein VII
    precursor”
    CDS 16141 . . . 17193 gene = “L2” “protein V”
    polyA_site 17467 . . . 17472
    CDS 17523 . . . 18275 gene = “L3” “protein VI precursor”
    CDS 18388 . . . 21192 gene = “L3” “hexon”
    CDS 21229 . . . 21858 gene = “L3” “23K protease”
    polyA_site 21878 . . . 21883
    polyA_site complement (21890 . . . 21895)
    CDS complement (21947 . . . 23500) gene = “E2A” “DNA binding
    protein”
    CDS 23531 . . . 26020 gene = “L4” “hexon protein”
    CDS 25722 . . . 26321 gene = “L4” “33 KD protein”
    CDS join (25722 . . . 26070, gene = “L4” “33 kD protein”
    26252 . . . 26595)
    CDS 26665 . . . 27348 gene = “L4” “pIII protein”
    promoter 27030 . . . 27035 “TATA box for E3”
    CDS 27348 . . . 27668 gene = “E3” “12.1 kD glycoprotein”
    CDS 27622 . . . 28062 gene = “E3” “16.1 kD protein”
    CDS 28047 . . . 28565 gene = “E3” “18.3 kD glycoprotein
    precursor”
    CDS 28595 . . . 29134 gene = “E3” “E3 20.1 kD protein”
    CDS 29147 . . . 29716 gene = “E3” “E3 20.6 kD protein
    duplication”
    CDS 29731 . . . 29856 gene = “E3” “E3 7.7 kD protein”
    CDS 29969 . . . 30244 gene = “E3” “E3 10.3 kD protein”
    CDS 30249 . . . 30653 gene = “E3B” “E3B 14.9 kD protein
    precursor”
    CDS 30646 . . . 31053 gene = “E3B” “E3B 14.7 kD protein”
    polyA_site 31059 . . . 31064
    CDS 31251 . . . 32228 gene = “L5” “L5 fiber protein”
    polyA_site complement (32247 . . . 32252)
    CDS complement (32263 . . . 32514) gene = “E4” “E4 orf6/7”
    polyA_site 32764 . . . 32769
    CDS complement (33313 . . . 33681) gene = “E4” “E4 13.6 kD protein”
    CDS 33536 . . . 34045 gene = “probable agnoprotein “probable
    gene” agnoprotein”
    CDS complement (33690 . . . 34043) gene = “E4” “E4 13 kD protein”
    CDS complement (34040 . . . 34429) gene = “E4” “13.9 kD protein”
    CDS complement (34471 . . . 34848) gene = “E4” “hypothetical protein”
  • TABLE 49
    Ad16 (Accession No. AY594256; SEQ ID NO: 585) Sequence Features and
    putative gene products
    Feature Type Location Comment or Gene Locus Product
    repeat_region 1 . . . 114 “the inverted terminal
    repeat”
    promoter 478 . . . 483 “TATA box of the E1
    promoter”
    CDS join (574 . . . 645, 1247 . . . 1348) gene = “E1A” “6.3 kDa protein”
    CDS join (574 . . . 1060, 1247 . . . 1452) gene = “E1A” “25.7 kDa protein”
    CDS join (574 . . . 1153, 1247 . . . 1452) gene = “E1A” “28 kDa protein”
    polyA_signal 1489 . . . 1494 “polyA signal for E1A”
    promoter 1544 . . . 1549 “TATA box for the E1B
    gene”
    CDS 1598 . . . 2134 gene = “E1B” “19K small T-antigen
    protein”
    CDS 1903 . . . 3381 gene = “E1B” “55K large T antigen
    protein”
    promoter 3444 . . . 3449 “TATA box for pIX”
    CDS 3476 . . . 3892 gene = “pIX” “proteinIX”
    polyA_signal 3905 . . . 3910 “polyA signal for pIX”
    polyA_signal complement (3923 . . . 3928) “polyA signal for E2B”
    CDS complement (join (3945 . . . 5278, gene = “E2B” “maturation protein
    5557 . . . 5569)) pIVa2”
    CDS complement (5048 . . . 8416) gene = “E2B” “DNA polymerase”
    promoter 5869 . . . 5874 “TATA box for the Major
    Late Promoter”
    CDS 7130 . . . 7417 gene = “hypothetical” “hypothetical 10.4K
    early protein”
    CDS 7826 . . . 8422 gene = “hypothetical” “probable DNA
    binding agnoprotein”
    CDS complement (8226 . . . 8570) gene = “E2B” “hypothetical 12.6K
    early protein”
    CDS complement (join (8419 . . . 10386, gene = “E2B” “Terminal protein
    13843 . . . 13851)) precursor”
    CDS 10851 . . . 12020 gene = “L1” “55K protein”
    CDS 12045 . . . 13811 gene = “L1” “protein IIIa
    precursor”
    polyA_signal 13825 . . . 13830 “polyA signal for L1”
    CDS 13902 . . . 15569 gene = “L2” “penton base protein”
    CDS 15582 . . . 16160 gene = “L2” “protein VII
    precursor”
    CDS 16203 . . . 17255 gene = “L2” “32K proteinV”
    CDS 17284 . . . 17511 gene = “L2” “proteinX”
    polyA_signal 17529 . . . 17534 “polyA signal for L2”
    CDS 17586 . . . 18284 gene = “L3” “protein VI precursor”
    CDS 18450 . . . 21272 gene = “L3” “the hexon protein”
    CDS 21309 . . . 21938 gene = “L3” “23K protease”
    polyA_signal 21958 . . . 21963 “polyA signal for L3”
    polyA_signal complement (21970 . . . 21975) “polyA signal for E2A”
    CDS complement (22027 . . . 23580) gene = “E2A” “early DNA binding
    protein”
    CDS 23611 . . . 26097 gene = “L4” “100k protein”
    CDS 25799 . . . 26398 gene = “L4” “22K protein”
    CDS join (25799 . . . 26147, “33K protein” gene = “L4”
    26317 . . . 26672)
    CDS 26742 . . . 27425 gene = “L4” “protein VIII
    precursor”
    promoter 27107 . . . 27112 “TATA box for E3”
    CDS 27425 . . . 27745 gene = “E3A” “12.2K glycoprotein”
    CDS 27699 . . . 28139 gene = “E3A” “16.1K membrane
    protein”
    polyA_signal 27734 . . . 27739 “possible polyA signal for
    L4”
    CDS 28124 . . . 28642 gene = “E3” “18.5K glycoprotein
    precursor”
    CDS 28672 . . . 29211 gene = “E3” “20.1K protein”
    CDS 29224 . . . 29793 gene = “E3” “20.5K glycoprotein”
    CDS 29808 . . . 30023 gene = “E3” “7.7K protein”
    CDS 30133 . . . 30408 gene = “E3” “10.3K protein”
    CDS 30380 . . . 30817 gene = “E3” “14.9K protein”
    CDS 30810 . . . 31217 gene = “E3” “14.7K protein”
    polyA_signal 31258 . . . 31263 “polyA signal for E3”
    CDS complement (31269 . . . 31433) gene = “U” “U exon protein”
    CDS 31448 . . . 32509 gene = “L5” “the fiber protein”
    polyA_signal complement (31735 . . . 31740) “polyA signal for E4”
    polyA_signal 32520 . . . 32525 “possible polyA signal for
    L5”
    CDS complement (32552 . . . 32803) gene = “E4” “ORF6/7”
    CDS complement (32800 . . . 33696) gene = “E4” “34K protein”
    CDS complement (33599 . . . 33967) gene = “E4” “13.6K protein”
    CDS 33822 . . . 34331 gene = “L5” “DNA binding
    agnoprotein”
    CDS complement (33976 . . . 34329) gene = “E4” “13K protein”
    CDS complement (34326 . . . 34715) gene = “E4” “14.3K protein”
    CDS complement (34757 . . . 35134) gene = “E4” “13.9K protein”
    promoter complement (35216 . . . 35221) “TATA box for E4”
    repeat_region complement (35409 . . . 35522) “the inverted terminal
    repeat”
  • TABLE 50
    Ad1 (Accession No. AF534906; SEQ ID NO: 586) Sequence Features and putative
    gene products
    Feature Type Location Comment or Gene Locus Product
    CDS join (560 . . . 1112, 1230 . . . 1546) gene = “E1a” “32 kDa protein”
    CDS join (560 . . . 976, 1232 . . . 1546) gene = “E1a” “26 kDa protein”
    CDS join (560 . . . 643, 1236 . . . 1319) gene = “E1a” “6 kDa protein”
    CDS 1717 . . . 2259 gene = “E1a” “21 kDa protein”
    CDS 2022 . . . 3524 gene = “E1b” “transformation-
    associated protein 55 kDa”
    CDS join (2022 . . . 2270, 3291 . . . 3524) gene = “E1b” “E1b”
    CDS join (2022 . . . 2270, 3233 . . . 3277) gene = “E1b” “E1b”
    CDS 3621 . . . 4043 gene = “IX” “hexon-associated
    protein 14.5 kDa”
    CDS complement (4102 . . . 5460) gene = “IVa2” “virion
    morphogenesis-
    associated protein 51 kDa”
    CDS complement (5208 . . . 8378) gene = “IVa2” “DNA polymerase 120 kDa”
    CDS 7989 . . . 8438 gene = “L1” “16.7 kDa protein”
    CDS complement (8594 . . . 10552) gene = “E2b” “terminal protein 75 kDa”
    CDS complement (10598 . . . 10996) “unknown”
    CDS 11059 . . . 12306 gene = “L1” “47 kDa protein”
    CDS 12327 . . . 14084 gene = “IIIa” “peripentonal hexon-
    associated protein 65 kDa”
    CDS 14166 . . . 15890 gene = “L3_1” “penton protein 64 kDa”
    CDS 15897 . . . 16493 gene = “pro-VII” “major core protein 22 kDa
    precursor”
    CDS 16563 . . . 17669 gene = “pV” “minor core protein 42 kDa”
    CDS 17793 . . . 17939 gene = “L2” “pmu 8.8 kDa”
    CDS 18022 . . . 18774 gene = “pVI” “hexon-associated
    protein 27 kDa
    precursor”
    CDS 18861 . . . 21755 gene = “L4” “hexon protein 109 kDa”
    CDS 21788 . . . 22402 gene = “L3_1” “endopeptidase 23 kDa”
    CDS complement (22500 . . . 24089) gene = “E2a_1” “DNA-binding protein
    59 kDa”
    CDS 24118 . . . 26541 gene = “L5” “hexon assembly-
    associated protein 90 kDa”
    CDS join (26252 . . . 26566, 26769 . . . 27137) gene = “E2a_2” “virion
    morphogenesis-
    associated protein 25 kDa”
    CDS 27225 . . . 27908 gene = “pVIII” “hexon-associated
    protein 25 kDa”
    CDS 27909 . . . 28232 gene = “E3A” “12 kDa protein”
    CDS 28775 . . . 29257 gene = “E3” “glycosylated
    membrane protein
    18.6 kDa”
    CDS 29532 . . . 29816 gene = “E3” “10.7 kDa protein”
    CDS 30106 . . . 30507 gene = “E3” “14.9 kDa protein”
    CDS 31101 . . . 32849 gene = “L5” “fiber protein 62 kDa”
    CDS complement (join gene = “E4” “20 kDa protein”
    (33976 . . . 34063, 34768 . . . 34865,
    35232 . . . 35594))
    CDS complement (join gene = “E4” “27 kDa protein”
    (33976 . . . 34063, 34768 . . . 35054,
    35232 . . . 35594))
    CDS complement (join gene = “E4” “32 kDa protein”
    (33976 . . . 34063, 34768 . . . 35168,
    35232 . . . 35594))
    CDS complement (join gene = “E4” “17 kDa protein”
    (34764 . . . 34865, 35232 . . . 35594))
    CDS complement (join gene = “E4” “24 kDa protein”
    (34764 . . . 35054, 35232 . . . 35594))
    CDS complement (join gene = “E4” “28.6 kDa protein”
    (34764 . . . 35168, 35232 . . . 35594))
  • TABLE 51
    Ad21 (Accession No. AY601633; SEQ ID NO: 587) Sequence Features and
    putative gene products
    Feature Type Location Comment or Gene Locus Product
    repeat_unit 1 . . . 114 “ITR”
    CDS join (574 . . . 645, 1247 . . . 1348) gene = “E1A” “E1A 6.8 KD protein”
    CDS join (574 . . . 1155, 1249 . . . 1452) gene = “E1A” “E1A 28.4 KD
    protein”
    CDS join (574 . . . 1062, 1249 . . . 1452) gene = “E1A” “E1A 24.6 KD
    protein”
    polyA_signal 1491 . . . 1496 “E1A”
    promoter 1541 . . . 1580 “E1B and IX”
    CDS 1905 . . . 3383 gene = “E1B” “E1B large T antigen”
    CDS 3477 . . . 3893 gene = “IX” “protein IX (hexon-
    associated protein)”
    polyA_signal 3906 . . . 3911 “E1B and IX”
    polyA_signal complement (3924 . . . 3929) “E2B and IVa2”
    CDS complement (join (3946 . . . 5279, gene = “IVa2” “IVa2 protein
    5558 . . . 5570)) (maturation protein)”
    CDS complement (5049 . . . 8417) gene = “E2B(POL)” “DNA polymerase”
    CDS 6142 . . . 6462 gene = “unassigned” “hypothetical 11.5 KD
    protein”
    CDS complement (6866 . . . 7387) gene = “unassigned” “hypothetical 19 KD
    protein”
    CDS 7131 . . . 7418 gene = “unassigned” “hypothetical 10.4 KD
    protein”
    CDS join (7827 . . . 8228, 9478 . . . 9495) gene = “unassigned” “DNA binding
    protein”
    CDS complement (8227 . . . 8571) gene = “unassigned” “hypothetical 12.6 KD
    protein”
    CDS complement (8420 . . . 10342) gene = “E2B(pTP)” “DNA terminal
    protein”
    CDS 8546 . . . 8947 gene = “unassigned” “hypothetical 14.5 KD
    protein”
    CDS complement (9541 . . . 9855) gene = “unassigned” “hypothetical 11.5 KD
    protein”
    CDS 9755 . . . 10030 gene = “unassigned” “hypothetical 9.7 KD
    protein”
    promoter complement (10521 . . . 10560) “E2B and IVa2”
    promoter 10576 . . . 10615 “L1”
    CDS 10857 . . . 12026 gene = “L1(52K)” “L1 52K protein”
    CDS 12054 . . . 13805 gene = “L1(IIIa)” “protein IIIa”
    CDS 13878 . . . 15563 gene = “L2(penton)” “penton
    protein(protein III)”
    polyA_signal 15565 . . . 15570 “L2 (penton)”
    CDS 15572 . . . 16150 gene = “L2(pVII)” “major core protein
    (protein VII)”
    CDS 16190 . . . 17251 gene = “L2(pV)” “minor core protein
    (protein V)”
    CDS 17280 . . . 17510 gene = “L2(pX)” “protein X (protein
    mu)”
    polyA_signal 17528 . . . 17533 “L2 (X)”
    promoter 17542 . . . 17581 “L3”
    CDS 17583 . . . 18332 gene = “L3(pVI)” “protein VI (hexon-
    associated protein)”
    CDS 18454 . . . 21303 gene = “L3(hexon)” “hexon protein
    (protein II)”
    CDS 21340 . . . 21969 gene = “L3(23K)” “23K proteinase
    (Adenain)”
    polyA_signal 21989 . . . 21994 “L3”
    polyA_signal complement (22001 . . . 22006) “E2A”
    CDS complement (22058 . . . 23611) gene = “E2A(DBP)” “early E2A DNA-
    binding protein”
    promoter complement (23560 . . . 23599) “E2A”
    promoter 23601 . . . 23641 “L4”
    CDS 23642 . . . 26113 gene = “L4(100K)” “100K protein”
    CDS 25815 . . . 26414 gene = “L4(22K)” “22K protein”
    CDS join (25815 . . . 26163, gene = “L4(33K)” “33K protein”
    26354 . . . 26688)
    polyA_signal 26559 . . . 26564 “LA (100K and 22K)”
    CDS 26758 . . . 27441 gene = “L4(pVIII)” “LA protein VIII”
    CDS 27441 . . . 27761 gene = “E3” “E3 12.1 KD protein”
    CDS 27715 . . . 28155 gene = “E3” “E3 16 KD protein”
    polyA_signal 27750 . . . 27755 “E3”
    CDS 28140 . . . 28658 gene = “E3” “E3 19.2 KD protein”
    CDS 28688 . . . 29227 gene = “E3” “E3 20 KD protein”
    CDS 29240 . . . 29827 gene = “E3” “E3 21.2 KD protein”
    CDS 29857 . . . 30084 gene = “E3” “E3 8.8 KD protein”
    CDS 30124 . . . 30399 gene = “E3” “E3 10.3 KD protein”
    CDS 30371 . . . 30808 gene = “E3” “E3 16.6 KD protein”
    CDS 30801 . . . 31208 gene = “E3” “E3 15.3 KD protein”
    CDS 31406 . . . 32377 gene = “L5(fiber)” “fiber protein”
    polyA_signal 32380 . . . 32385 “L5”
    polyA_signal complement (32397 . . . 32402) “E4”
    CDS complement (join gene = “E4” “E4 16 KD protein”
    (32409 . . . 32660, 33383 . . . 33556))
    CDS complement (32657 . . . 33556) gene = “E4” “E4 34.7 KD protein”
    CDS complement (33459 . . . 33827) gene = “E4” “E4 14.3 KD protein”
    CDS 33682 . . . 34191 gene = “unassigned” “agonoprotein”
    similarity to Human
    Adenovirus B
    agonoprotein, GI:
    32967054
    CDS complement (33836 . . . 34189) gene = “E4” “E4 13.6 KD protein”
    CDS complement (34186 . . . 34575) gene = “E4” “E4 14.4 KD protein”
    CDS complement (34617 . . . 34994) gene = “E4” “E4 14.2 KD protein”
    repeat_unit complement (35269 . . . 35382) “ITR”
  • For the products designated above in Tables 39-51, the present inventors note that it is routine in the art by referring to the universal genetic code to translate the nucleic acid sequence identified in the “location” column to the corresponding amino acid sequence. As such, the amino acid sequences designated in the “product” column have not been explicitly listed.
    • REFERENCES
    • Albert, T. J., Norton, J., Ott, M., Richmond, T., Nuwaysir, K., Nuwaysir, E. F., Stengele, K. P., Green, R. D. 2003. Light-directed 5′→3′ synthesis of complex oligonucleotide microarrays. Nucleic Acids Res 31:e35
    • Bohlander, S. K., Espinosa, R., 3rd, Le Beau, M. M., Rowley, J. D., Diaz, M. O. 1992. A method for the rapid sequence-independent amplification of microdissected chromosomal material. Genomics 13:1322-4
    • Cherkasova, E., Laassri, M., Chizhikov, V., Korotkova, E., Dragunsky, E., Agol, V. I., Chumakov, K. 2003. Microarray analysis of evolution of RNA viruses: evidence of circulation of virulent highly divergent vaccine-derived polioviruses. Proc Natl Acad Sci U S A 100:9398-403
    • Chizhikov, V., Rasooly, A., Chumakov, K., Levy, D. D. 2001. Microarray analysis of microbial virulence factors. Appl Environ Microbiol 67:3258-63
    • Cutler, D. J., Zwick, M. E., Carrasquillo, M. M., Yohn, C. T., Tobin, K. P., Kashuk, C., Mathews, D. J., Shah, N. A., Eichler, E. E., Warrington, J. A., Chakravarti, A. 2001. High-throughput variation detection and genotyping using microarrays. Genome Res 11:1913-25
    • Devereux, J., Haeberli, P., Smithies, O. 1984. A comprehensive set of sequence analysis programs for the VAX. Nucleic Acids Res 12:387-95
    • Ferguson, J. A., Steemers, F. J., Walt, D. R. 2000. High-density fiber-optic DNA random microsphere array. Anal Chem 72:5618-24
    • Ginger, D. S., Zhang, H., Mirkin, C. A. 2004. The evolution of dip-pen nanolithography. Angew Chem Int Ed Engl 43:30-45
    • Gingeras, T. R., Ghandour, G., Wang, E., Berno, A., Small, P. M., Drobniewski, F., Alland, D., Desmond, E., Holodniy, M., Drenkow, J. 1998. Simultaneous genotyping and species identification using hybridization pattern recognition analysis of generic Mycobacterium DNA arrays. Genome Res 8:435-48
    • Gingeras, T. R., Mack, D., Chee, M. S., Bemo, A. J., Small, P. M., Drobniewski, F., Alland, D., Desmond, E., Holodniy, M., Drenkow, J. 2001. Chip-Based Species Identification and Phenotype Characterization of Microorganisms. Affymetrix, Inc., US
    • Hoffmann, E., Stech, J., Guan, Y., Webster, R. G., Perez, D. R. 2001. Universal primer set for the full-length amplification of all influenza A viruses. Arch Virol 146:2275-89
    • Kampke, T., Kieninger, M., Mecklenburg, M. 2001. Efficient primer design algorithms. Bioinformatics 17:214-25
    • Kessler, N., Ferraris, O., Palmer, K., Marsh, W., Steel, A. 2004. Use of the DNA Flow-Thru Chip, a Three-Dimensional Biochip, for Typing and Subtyping of Influenza Viruses. J Clin Microbiol 42:2173-2185
    • Korf, I., Yandell, M., Bedell, J. 2003. BLAST. O'Reilly and Associates, Sebastopol, Calif. Kozal, M. J., Shah, N., Shen, N., Yang, R., Fucini, R., Merigan, T. C., Richman, D. D., Morris, D., Hubbell, E., Chee, M., Gingeras, T. R. 1996. Extensive polymorphisms observed in HIV-1 clade B protease gene using high-density oligonucleotide arrays. Nat Med 2:753-9
    • Lee, C. 2003. Generating consensus sequences from partial order multiple sequence alignment graphs. Bioinformatics 19:999-1008
    • Lin, B., Vora, G. J., Thach, D., Walter, E., Metzgar, D., Tibbetts, C., Stenger, D. A. 2004. Rapid detection and serotyping of acute respiratory disease-associated adenoviruses with oligonucleotide microarrays. Journal of Clinical Microbiology in press
    • Meinkoth, J., Wahl, G. 1984. Hybridization of nucleic acids immobilized on solid supports. Anal Biochem 138:267-84
    • Needleman, S. B., Wunsch, C. D. 1970. A general method applicable to the search for similarities in the amino acid sequence of two proteins. J Mol Biol 48:443-53
    • Nuwaysir, E. F., Huang, W., Albert, T. J., Singh, J., Nuwaysir, K., Pitas, A., Richmond, T., Gorski, T., Berg, J. P., Ballin, J., McCormick, M., Norton, J., Pollock, T., Sumwalt, T., Butcher, L., Porter, D., Molla, M., Hall, C., Blattner, F., Sussman, M. R., Wallace, R. L., Cerrina, F., Green, R. D. 2002. Gene expression analysis using oligonucleotide arrays produced by maskless photolithography. Genome Res 12:1749-55
    • Ochman, H., Lawrence, J. G., Groisman, E. A. 2000. Lateral gene transfer and the nature of bacterial innovation. Nature 405:299-304
    • Offringa, D. P., Tyson-Medlock, V., Ye, Z., Levandowski, R. A. 2000. A comprehensive systematic approach to identification of influenza A virus genotype using RT-PCR and RFLP. J Virol Methods 88:15-24
    • Strizhkov, B. N., Drobyshev, A. L., Mikhailovich, V. M., Mirzabekov, A. D. 2000. PCR amplification on a microarray of gel-immobilized oligonucleotides: detection of bacterial toxin- and drug-resistant genes and their mutations. Biotechniques 29:844-8, 850-2, 854 passim
    • Troesch, A., Nguyen, H., Miyada, C. G., Desvarenne, S., Gingeras, T. R., Kaplan, P. M., Cros, P., Mabilat, C. 1999. Mycobacterium species identification and rifampin resistance testing with high-density DNA probe arrays. J Clin Microbiol 37:49-55
    • Vasiliskov, A. V., Timofeev, E. N., Surzhikov, S. A., Drobyshev, A. L., Shick, V. V., Mirzabekov, A. D. 1999. Fabrication of mnicroarray of gel-immobilized compounds on a chip by copolymerization. Biotechniques 27:592-4, 596-8, 600 passim
    • Volokhov, D., Chizhikov, V., Chumakov, K., Rasooly, A. 2003. Microarray analysis of erythromycin resistance determinants. J Appl Microbiol 95:787-98
    • Vora, G. J., Meador, C. E., Stenger, D. A., Andreadis, J. D. 2004. Nucleic Acid amplification strategies for DNA microarray-based pathogen detection. Appl Environ Microbiol 70:3047-54
    • Wang, D., Coscoy, L., Zylberberg, M., Avila, P. C., Boushey, H. A., Ganem, D., DeRisi, J. L. 2002. Microarray-based detection and genotyping of viral pathogens. Proc Natl Acad Sci U S A 99:15687-92
    • Wang, D., Urisman, A., Liu, Y. T., Springer, M., Ksiazek, T. G., Erdman, D. D., Mardis, E. R., Hickenbotham, M., Magrini, V., Eldred, J., Latreille, J. P., Wilson, R .K., Ganem, D., DeRisi, J. L. 2003. Viral discovery and sequence recovery using DNA microarrays. PLoS Biol 1:E2
    • Wilson, K. H., Wilson, W. J., Radosevich, J. L., DeSantis, T. Z., Viswanathan, V. S., Kuczmarski, T. A., Andersen, G. L. 2002a. High-density microarray of small-subunit ribosomal DNA probes. Appl Environ Microbiol 68:2535-41
    • Wilson, W. J., Strout, C. L., DeSantis, T. Z., Stilwell, J. L., Carrano, A. V., Andersen, G. L. 2002b. Sequence-specific identification of 18 pathogenic microorganisms using microarray technology. Mol Cell Probes 16:119-27
    • Yang, I. V., Chen, E., Hasseman, J. P., Liang, W., Frank, B. C., Wang, S., Sharov, V., Saeed, A. I., White, J., Li, J., Lee, N. H., Yeatman, T. J., Quackenbush, J. 2002. Within the fold: assessing differential expression measures and reproducibility in microarray assays. Genome Biol 3:research0062

Claims (67)

1. A resequencing DNA microarray comprising multiple groups of oligonucleotide primers of a length ranging from 13 to 70 nucleotides immobilized to a solid phase support, wherein each group of oligonucleotide primers is:
(a) selected to span a particular region of a distinct reference sequence,
(b) occupies a discrete area of the array termed a tiled region, and
(c) comprises at least four sets of primers arranged in a parallel fashion within said discrete area of the array, wherein said four sets of primers are selected as follows:
i) a first primer that is exactly complementary to the reference sequence; and
ii) three additional primers, each of which is identical to the first primer but for the nucleotide at a central position, which is different in each of the three sets such that all four conventional nucleotide bases are present on said array.
2. The resequencing DNA microarray according to claim 1, wherein the length of the oligonucleotide primers is 25 nucleotides.
3. The resequencing DNA microarray according to claim 1, wherein the region of the reference sequence that is spanned by the oligonucleotide primer moves by (n+1) nucleotides across the reference sequence for each adjacent tiled region across the microarray surface.
4. The resequencing DNA microarray according to claim 1, wherein the resequencing DNA microarray contains 18×18 micron features.
5. The resequencing DNA microarray according to claim 1, wherein the resequencing DNA microarray contains 8×8 micron features.
6. The resequencing DNA microarray according to claim 1, wherein the sequences selected for tiling are a single gene or subsequence that may represent a much broader class of organism genus, species and subspecies.
7. The resequencing DNA microarray according to claim 1, wherein the sequences selected for tiling are “prototypes” representing genotypes of pathogen families.
8. The resequencing DNA microarray according to claim 1, wherein the sequences selected for tiling are “prototypes” representing a family or group of adenoviruses.
9. The resequencing DNA microarray according to claim 1, wherein the sequences selected for tiling are “prototypes” representing a family or group of influenza viruses.
10. The resequencing DNA microarray according to claim 1, wherein the sequences selected for tiling are a single gene or subsequence unique to an individual pathogenic strain.
11. The resequencing DNA microarray according to claim 1, wherein the sequences selected for tiling encode a drug-resistance marker.
12. The resequencing DNA microarray according to claim 1, wherein the resequencing DNA microarray is RPMV1.
13. The resequencing DNA microarray according to claim 1, wherein the resequencing DNA microarray is RPMV2.
14. The resequencing DNA microarray according to claim 1, wherein said resequencing DNA microarray contains at least one reference sequence for a common pathogen and at least one biological terrorism agent.
15. A kit comprising:
(a) the resequencing DNA microarray according to claim 1, and
(b) reagents suitable for specific hybridization of target sequences to the probe sequences present on said resequencing DNA microarray.
16. A method of detecting the presence of a drug-resistance marker in a microorganism, wherein the method comprises:
(a) providing the resequencing DNA microarray according to claim 1;
(b) contacting an unknown sample comprising genetic material to said resequencing DNA microarray;
(c) hybridizing the contents of said unknown sample to the probe sequences immobilized on said resequencing DNA microarray under suitable conditions and for a suitable time; and
(d) detecting the presence of a drug-resistance marker in a microorganism in said unknown sample.
17. The method according to claim 16, wherein said method further comprises determining the identity of the drug-resistance marker by sequence comparison between the DNA sequence of the drug-resistance marker identified by said method and known resistance markers.
18. The method according to claim 16, wherein said hybridizing is for a time ranging from 15 minutes to 24 hours.
19. The method according to claim 16, wherein the unknown sample is a biological sample.
20. The method according to claim 19, wherein said biological sample is selected from the group consisting of a nasal wash specimen, a nasal aspirate, a throat swab, a blood sample, a sputum sample, blood cells, a tissue sample, a fine needle biopsy sample, a urine specimen, a peritoneal fluid sample, a visceral fluid sample, and a pleural fluid sample, or cells therefrom.
21. The method according to claim 16, wherein said unknown sample is an environmental sample selected from the group consisting of a soil sample, an air sample and a water sample.
22. The method according to claim 16, wherein prior to said hybridizing, the unknown sample is subjected to at least one of process selected from the group consisting of:
(i) isolation of the genetic material within said sample,
(ii) enrichment for target sequences of interest within said sample,
(iii) amplification of the genetic material contained within said sample,
(iv) labeling the genetic material within said sample, and
(v) subtractive hybridization.
23. The method according to claim 16, wherein prior to said hybridizing one or more target nucleic acids of interest in the unknown sample is amplified by at least one method selected from the group consisting of specific reverse transcription, PCR, multiplex PCR and random PCR.
24. The method according to claim 16, wherein prior to said hybridizing one or more target nucleic acids of interest in the unknown sample, the unknown sample is subjected to at least one random amplification strategy selected from the group consisting of random primed, isothermal Klenow polymerase-based, Φ29DNA polymerase-based, tandem amplification, multiplex PCR, and total amplification.
25. The method according to claim 16, wherein the genetic material present in said unknown sample has been enriched.
26. The method according to claim 16, wherein one or more target nucleic acids of interest present in said unknown sample are enriched by subtraction of the background nucleic acids from said sample.
27. The method according to claim 16, wherein one or more target nucleic acids of interest present in said unknown sample are enriched by reverse-transcriptase subtractive hybridization.
28. The method according to claim 16, wherein one or more target nucleic acids of interest present in said unknown sample are enriched by selective removal of said target nucleic acids from a mixture of nucleic acids presenting said unknown sample.
29. The method according to claim 16, wherein said detecting is by:
(i) making base calls based on the hybridization response between nucleic acids of interest in said unknown sample and the probe DNA on the resequencing DNA microarray, and
(ii) determining the sequence of the corresponding full-length gene or genomic fragment by comparing the sequence of the hybridized region to sequences present in a sequence database.
30. The method according to claim 29, wherein the base calls are made by Affymetrix GDAS software under “permissive” settings.
31. The method according to claim 29, wherein sequence determination is by Resequencing Pathogen Identifier (REPI) software.
32. The method according to claim 29, wherein the sequence database is GenBank.
33. A method of routine diagnosis of common respiratory pathogens by performing the method according to claim 16, wherein said unknown sample is obtained from a subject in need of routine diagnosis of common respiratory pathogens.
34. The method according to claim 33, wherein said unknown sample is obtained during a physical examination.
35. A method of surveillance of common respiratory pathogens by performing the method according to claim 16, wherein said unknown sample is obtained from a subject in need of surveillance of common respiratory pathogens.
36. The method according to claim 35, wherein said subject in need of surveillance of common respiratory pathogens has a history of respiratory pathogen infection.
37. A method of surveillance of one or more biological terrorism agents by performing the method according to claim 16, wherein said unknown sample is obtained from a subject in need of surveillance of said biological terrorism agents.
38. The method according to claim 37, wherein said subject in need of surveillance of biological terrorism agents is suspected of being exposed to said biological terrorism agents.
39. A method of detecting the presence of a microorganism belonging to a particular class of organism species or subspecies in an unknown sample, wherein the method comprises:
(a) providing a resequencing DNA microarray according to claim 1;
(b) contacting the unknown sample comprising genetic material to said resequencing DNA microarray;
(c) hybridizing the contents of said unknown sample to the probe sequences immobilized on said resequencing DNA microarray under suitable conditions and for a suitable time; and
(d) detecting the presence of a microorganism belonging to a particular class of organism species or subspecies in said unknown sample.
40. The method according to claim 39, wherein said method further comprises determining the identity of the particular class of organism species or subspecies by sequence comparison between the DNA sequence identified by said method and known sequences present in a genomic database.
41. The method according to claim 40, wherein said determining comprises detecting a sufficient amount of pathogen sequence in order to allow a forensic assessment of the possible source of pathogens.
42. The method according to claim 39, wherein said hybridizing is for a time ranging from 15 minutes to 24 hours.
43. The method according to claim 39, wherein the unknown sample is a biological sample.
44. The method according to claim 43, wherein said biological sample is selected from the group consisting of a nasal wash specimen, a nasal aspirate, a throat swab, a blood sample, a sputum sample, blood cells, a tissue sample, a fine needle biopsy sample, a urine specimen, a peritoneal fluid sample, a visceral fluid sample, and a pleural fluid sample, or cells therefrom.
45. The method according to claim 39, wherein said unknown sample is an environmental sample selected from the group consisting of a soil sample, an air sample, and a water sample.
46. The method according to claim 39, wherein prior to said hybridizing the unknown sample is subjected to at least one of process selected from the group consisting of:
(i) isolation of the genetic material within said sample,
(ii) enrichment for target sequences of interest within said sample,
(iii) amplification of the genetic material contained within said sample,
(iv) labeling the genetic material within said sample, and
(v) subtractive hybridization.
47. The method according to claim 39, wherein prior to said hybridizing one or more target nucleic acids of interest in the unknown sample is amplified by at least one method selected from the group consisting of specific reverse transcription, PCR, multiplex PCR, and random PCR.
48. The method according to claim 39, wherein prior to said hybridizing one or more target nucleic acids of interest in the unknown sample, the unknown sample is subjected to at least one random amplification strategy selected from the group consisting of random primed, isothermal Klenow polymerase-based, Φ29DNA polymerase-based, tandem amplification, multiplex PCR, and total amplification.
49. The method according to claim 39, wherein the genetic material present in said unknown sample has been enriched.
50. The method according to claim 39, wherein one or more target nucleic acids of interest present in said unknown sample are enriched by subtraction of the background nucleic acids from said sample.
51. The method according to claim 39, wherein one or more target nucleic acids of interest present in said unknown sample are enriched by reverse-transcriptase subtractive hybridization.
52. The method according to claim 39, wherein one or more target nucleic acids of interest present in said unknown sample are enriched by selective removal of said target nucleic acids from a mixture of nucleic acids presenting said unknown sample.
53. The method according to claim 39, wherein said detecting is by:
(i) making base calls based on the hybridization response between nucleic acids of interest in said unknown sample and the probe DNA on the resequencing DNA microarray, and
(ii) determining the sequence of the corresponding full-length gene or genomic fragment by comparing the sequence of the hybridized region to sequences present in a sequence database.
54. The method according to claim 53, wherein the base calls are made by the Affymetrix GDAS software under “permissive” settings.
55. The method according to claim 53, wherein sequence determination is by Resequencing Pathogen Identifier (REPI) software.
56. The method according to claim 53, wherein the sequence database is GenBank.
57. A method of routine diagnosis of common respiratory pathogens by performing the method according to claim 39, wherein said unknown sample is obtained from a subject in need of routine diagnosis of common respiratory pathogens.
58. The method according to claim 57, wherein said unknown sample is obtained during a physical examination.
59. A method of surveillance of common respiratory pathogens by performing the method according to claim 39, wherein said unknown sample is obtained from a subject in need of surveillance of common respiratory pathogens.
60. The method according to claim 59, wherein said subject in need of surveillance of common respiratory pathogens has a history of respiratory pathogen infection.
61. A method of surveillance of one or more biological terrorism agents by performing the method according to claim 39, wherein said unknown sample is obtained from a subject in need of surveillance of said biological terrorism agents.
62. The method according to claim 61, wherein said subject in need of surveillance of biological terrorism agents is suspected of being exposed to said biological terrorism agents.
63. A method of estimating the relative amount of a pathogen in a biological sample containing the same comprising:
(a) providing a resequencing DNA microarray according to claim 1;
(b) contacting said biological sample to said resequencing DNA microarray;
(c) hybridizing the contents of said unknown sample to the probe sequences immobilized on said resequencing DNA microarray under suitable conditions and for a suitable time; and
(d) quantifying the presence and/or identity of a drug-resistance marker in a microorganism or a microorganism belonging to a particular class of organism species or subspecies in said unknown sample.
64. The method according to claim 63, wherein said quantifying is by determining the absolute intensity of the hybridization signals on said resequencing DNA microarray.
65. The method according to claim 63, wherein said quantifying is by determining the percentage of base calls, both as a percentage of the total tile region size and as a percentage of base calls within a selected subsequence satisfying a sliding window algorithm.
66. The method according to claim 65, wherein said quantifying is by Resequencing Pathogen Identifier (REPI) software.
67. A genomic sequence of an adenovirus strain selected from the group consisting of Ad3, Ad3FS_navy, Ad4, Ad4vaccine, Ad4FS_navy, Ad4FS_AF, Ad5FS, Ad7, Ad7FS_navy, Ad7 vaccine, Ad16, Ad1, and Ad21, and fragments thereof.
US11/177,646 2004-07-02 2005-07-02 Re-sequencing pathogen microarray Abandoned US20060210967A1 (en)

Priority Applications (27)

Application Number Priority Date Filing Date Title
US11/177,646 US20060210967A1 (en) 2004-07-02 2005-07-02 Re-sequencing pathogen microarray
US11/422,431 US7623997B2 (en) 2004-07-02 2006-06-06 Computer-implemented biological sequence identifier system and method
US11/422,425 US7695941B2 (en) 2005-06-16 2006-06-06 Multiplexed polymerase chain reaction for genetic sequence analysis
KR1020107004052A KR101182505B1 (en) 2005-06-16 2006-06-09 Computer-implemented biological sequence identifier system and method
NZ564991A NZ564991A (en) 2005-06-16 2006-06-09 Multiplexed polymerase chain reaction for genetic sequence analysis
EP06772796A EP1910568A4 (en) 2005-06-16 2006-06-09 Multiplexed polymerase chain reaction for genetic sequence analysis
AU2006259666A AU2006259666B2 (en) 2005-06-16 2006-06-09 Multiplexed polymerase chain reaction for genetic sequence analysis
NZ585369A NZ585369A (en) 2005-06-16 2006-06-09 Computer-implemented biological sequence identifier system and method
KR1020117007313A KR20110039587A (en) 2005-06-16 2006-06-09 Multiplexed polymerase chain reaction for genetic sequence analysis
EP13002755.0A EP2648124A3 (en) 2005-06-16 2006-06-09 Computer-implemented biological sequence identifier system and method
KR1020087001245A KR101058820B1 (en) 2005-06-16 2006-06-09 Multiple Polymerase Chain Reaction for Gene Sequencing
NZ564992A NZ564992A (en) 2005-06-16 2006-06-09 Computer-implemented biological sequence identifier system and method
PCT/US2006/022622 WO2006138182A2 (en) 2005-06-16 2006-06-09 Computer-implemented biological sequence identifier system and method
KR1020127014945A KR20120083521A (en) 2005-06-16 2006-06-09 Computer-implemented biological sequence identifier system and method
CA2612412A CA2612412C (en) 2005-06-16 2006-06-09 Multiplexed polymerase chain reaction for genetic sequence analysis
CA002612360A CA2612360A1 (en) 2005-06-16 2006-06-09 Computer-implemented biological sequence identifier system and method
JP2008516960A JP2009509499A (en) 2005-06-16 2006-06-09 Multiple polymerase chain reaction for gene sequence analysis
AU2006259665A AU2006259665A1 (en) 2005-06-16 2006-06-09 Computer-implemented biological sequence identifier system and method
JP2008516959A JP4910104B2 (en) 2005-06-16 2006-06-09 Computer-implemented biological sequence identifier system and method
KR1020087001309A KR101023163B1 (en) 2005-06-16 2006-06-09 Computer-implemented biological sequence identifier system and method
KR1020107023975A KR20100122124A (en) 2005-06-16 2006-06-09 Computer-implemented biological sequence identifier system and method
EP06772795A EP1910577A4 (en) 2005-06-16 2006-06-09 Computer-implemented biological sequence identifier system and method
PCT/US2006/022623 WO2006138183A2 (en) 2005-06-16 2006-06-09 Multiplexed polymerase chain reaction for genetic sequence analysis
US11/559,513 US8965710B2 (en) 2004-07-02 2006-11-14 Automated sample-to-microarray apparatus and method
US11/843,126 US7668664B2 (en) 2004-07-02 2007-08-22 Design and selection of genetic targets for sequence resolved organism detection and identification
US12/100,519 US9430610B2 (en) 2004-07-02 2008-04-10 Re-sequencing pathogen microarray
US12/617,025 US7979446B2 (en) 2004-07-02 2009-11-12 Computer-implemented biological sequence identifier system and method

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
US59093104P 2004-07-02 2004-07-02
US60991804P 2004-09-15 2004-09-15
US63146004P 2004-11-29 2004-11-29
US63143704P 2004-11-29 2004-11-29
US69176805P 2005-06-16 2005-06-16
US11/177,646 US20060210967A1 (en) 2004-07-02 2005-07-02 Re-sequencing pathogen microarray

Related Parent Applications (3)

Application Number Title Priority Date Filing Date
US11/177,647 Continuation-In-Part US8032310B2 (en) 2004-07-02 2005-07-02 Computer-implemented method, computer readable storage medium, and apparatus for identification of a biological sequence
US11/268,373 Continuation-In-Part US20080020379A1 (en) 2004-07-02 2005-11-07 Diagnosis and prognosis of infectious diseases clinical phenotypes and other physiologic states using host gene expression biomarkers in blood
US11/559,513 Continuation-In-Part US8965710B2 (en) 2004-07-02 2006-11-14 Automated sample-to-microarray apparatus and method

Related Child Applications (6)

Application Number Title Priority Date Filing Date
US11/177,647 Continuation-In-Part US8032310B2 (en) 2004-07-02 2005-07-02 Computer-implemented method, computer readable storage medium, and apparatus for identification of a biological sequence
US11/422,431 Continuation-In-Part US7623997B2 (en) 2004-07-02 2006-06-06 Computer-implemented biological sequence identifier system and method
US11/422,425 Continuation-In-Part US7695941B2 (en) 2004-07-02 2006-06-06 Multiplexed polymerase chain reaction for genetic sequence analysis
US11/559,513 Continuation-In-Part US8965710B2 (en) 2004-07-02 2006-11-14 Automated sample-to-microarray apparatus and method
US11/843,126 Continuation-In-Part US7668664B2 (en) 2004-07-02 2007-08-22 Design and selection of genetic targets for sequence resolved organism detection and identification
US12/100,519 Continuation US9430610B2 (en) 2004-07-02 2008-04-10 Re-sequencing pathogen microarray

Publications (1)

Publication Number Publication Date
US20060210967A1 true US20060210967A1 (en) 2006-09-21

Family

ID=36916882

Family Applications (4)

Application Number Title Priority Date Filing Date
US11/177,646 Abandoned US20060210967A1 (en) 2004-07-02 2005-07-02 Re-sequencing pathogen microarray
US11/177,647 Expired - Fee Related US8032310B2 (en) 2004-07-02 2005-07-02 Computer-implemented method, computer readable storage medium, and apparatus for identification of a biological sequence
US12/100,519 Active 2026-09-18 US9430610B2 (en) 2004-07-02 2008-04-10 Re-sequencing pathogen microarray
US13/211,382 Abandoned US20120035857A1 (en) 2004-07-02 2011-08-17 Computer-implemented biological sequence identifier system and method

Family Applications After (3)

Application Number Title Priority Date Filing Date
US11/177,647 Expired - Fee Related US8032310B2 (en) 2004-07-02 2005-07-02 Computer-implemented method, computer readable storage medium, and apparatus for identification of a biological sequence
US12/100,519 Active 2026-09-18 US9430610B2 (en) 2004-07-02 2008-04-10 Re-sequencing pathogen microarray
US13/211,382 Abandoned US20120035857A1 (en) 2004-07-02 2011-08-17 Computer-implemented biological sequence identifier system and method

Country Status (11)

Country Link
US (4) US20060210967A1 (en)
EP (3) EP2385477A1 (en)
JP (3) JP2008504844A (en)
CN (2) CN103224942A (en)
AU (1) AU2005327520B2 (en)
CA (2) CA2823727A1 (en)
HK (1) HK1118081A1 (en)
NO (1) NO20070611L (en)
NZ (2) NZ552432A (en)
SG (1) SG156616A1 (en)
WO (1) WO2006088493A2 (en)

Cited By (18)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030104405A1 (en) * 2001-02-09 2003-06-05 Sapporo Breweries Limited Method of differentiating beer yeast
US20060190184A1 (en) * 2005-02-23 2006-08-24 Incogen, Inc. System and method using a visual or audio-visual programming environment to enable and optimize systems-level research in life sciences
WO2008066493A1 (en) * 2006-11-27 2008-06-05 Agency For Science, Technology And Research Influenza b virus detection method and kit therefor
WO2008140494A2 (en) * 2006-11-22 2008-11-20 The Board Of Trustees Of Michigan State University High throughput screening using microarrays
US20090092969A1 (en) * 2007-10-09 2009-04-09 Michael Aye Detection of atypical pneumonia
US20090124512A1 (en) * 2006-01-18 2009-05-14 Regents Of The University Of Colorado Dna array analysis as a diagnostic for current and emerging strains of influenza
WO2009085733A1 (en) * 2007-12-21 2009-07-09 Quest Diagnostics Investments Incorporated Multiplex detection assay for influenza and rsv viruses
WO2009102369A2 (en) * 2007-11-20 2009-08-20 Autogenomics, Inc. Multiplex assay for respiratory viruses
US20100048423A1 (en) * 2008-08-19 2010-02-25 Animal Health Research Institute, Council Of Agriculture, Executive Yuan Simultaneous detection, differentiation and typing system of newcastle disease and avian influenza viruses
WO2010051367A1 (en) * 2008-10-31 2010-05-06 The Trustees Of The University Of Pennsylvania Simian adenoviruses sadv-43, -45,-48,-49, and -50 and uses thereof
WO2010147989A1 (en) * 2009-06-15 2010-12-23 Ibis Biosciences, Inc. Compositions and methods for the isolation of nucleic acid
US20110097704A1 (en) * 2008-01-29 2011-04-28 Ibis Biosciences, Inc. Compositions for use in identification of picornaviruses
WO2011106556A2 (en) * 2010-02-24 2011-09-01 Life Technologies Corporation Systems and methods for adaptive recursive sequencing
US20130130235A1 (en) * 2010-07-29 2013-05-23 Bigtec Private Limited Probes and primers for detection of dengue
US20130260368A1 (en) * 2010-09-16 2013-10-03 Gen-Probe Incorporated Capture Probes Immobilizable Via L-Nucleotide Tail
WO2016028384A1 (en) 2014-06-30 2016-02-25 Dow Global Technologies Llc Method and reagents for detecting water contamination
US10515715B1 (en) 2019-06-25 2019-12-24 Colgate-Palmolive Company Systems and methods for evaluating compositions
WO2023173114A3 (en) * 2022-03-10 2024-01-25 Technovax, Inc. Recombinant virus-like particle capsid vaccines against adenoviruses and compositions, methods, and use thereof

Families Citing this family (40)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20090305248A1 (en) * 2005-12-15 2009-12-10 Lander Eric G Methods for increasing accuracy of nucleic acid sequencing
US8080971B2 (en) * 2008-06-12 2011-12-20 Northern Illinois University Active electrical power flow control system for optimization of power delivery in electric hybrid vehicles
US20110246084A1 (en) * 2008-11-26 2011-10-06 Mostafa Ronaghi Methods and systems for analysis of sequencing data
US8926904B2 (en) 2009-05-12 2015-01-06 Daniel Wai-Cheong So Method and apparatus for the analysis and identification of molecules
WO2011040886A1 (en) * 2009-09-29 2011-04-07 Agency For Science, Technology And Research Methods and arrays for dna sequencing
WO2013109700A1 (en) * 2012-01-18 2013-07-25 Dow Agrosciences Llc Stable pair-wise e-value
WO2013144663A2 (en) * 2012-03-27 2013-10-03 Rudjer Boskovic Institute Method of determination of neutral dna sequences in the genome, system for targeting sequences obtained thereby and methods for use thereof
US9201916B2 (en) * 2012-06-13 2015-12-01 Infosys Limited Method, system, and computer-readable medium for providing a scalable bio-informatics sequence search on cloud
WO2014028061A1 (en) * 2012-08-16 2014-02-20 NVS Technologies, Inc. Assay methods and systems
US9111095B2 (en) 2012-08-29 2015-08-18 The Johns Hopkins University Apparatus and method for identifying similarity via dynamic decimation of token sequence n-grams
US9003529B2 (en) 2012-08-29 2015-04-07 The Johns Hopkins University Apparatus and method for identifying related code variants in binaries
US20140089328A1 (en) * 2012-09-27 2014-03-27 International Business Machines Corporation Association of data to a biological sequence
US9146248B2 (en) 2013-03-14 2015-09-29 Intelligent Bio-Systems, Inc. Apparatus and methods for purging flow cells in nucleic acid sequencing instruments
WO2014140381A1 (en) * 2013-03-15 2014-09-18 Nexidia Methods for immunocapture and concentration of bacteria in a sample
US9591268B2 (en) 2013-03-15 2017-03-07 Qiagen Waltham, Inc. Flow cell alignment methods and systems
US20160162635A1 (en) * 2013-07-17 2016-06-09 Siemens Aktiengesellschaft Method and system for determining a bacterial resistance to an antibiotic drug
AU2014348566B2 (en) * 2013-11-13 2019-02-28 Five3 Genomics, Llc Systems and methods for transmission and pre-processing of sequencing data
WO2015085105A1 (en) * 2013-12-04 2015-06-11 University Of Alaska Fairbanks Methods and compositions for enriching non-host sequences in host samples
US10342861B2 (en) 2014-05-27 2019-07-09 University Of Rochester Arenavirus vaccine
CN105631239B (en) * 2014-10-30 2018-08-17 国际商业机器公司 Method and apparatus for managing gene order
US9805099B2 (en) * 2014-10-30 2017-10-31 The Johns Hopkins University Apparatus and method for efficient identification of code similarity
KR20180008374A (en) * 2014-11-21 2018-01-24 난토믹스, 엘엘씨 Systems and methods for identification and differentiation of viral infection
US20160178905A1 (en) * 2014-12-19 2016-06-23 Intel Corporation Facilitating improved viewing capabitlies for glass displays
CN107111693A (en) * 2014-12-29 2017-08-29 考希尔股份有限公司 Method for determining the genotype in high homology region
WO2017004448A1 (en) * 2015-07-02 2017-01-05 Indevr, Inc. Methods of processing and classifying microarray data for the detection and characterization of pathogens
CN108348166B (en) * 2015-09-09 2022-06-03 普梭梅根公司 Microbiota-derived diagnostic and therapeutic methods and systems for infectious diseases and other health conditions associated with antibiotic use
WO2017145739A1 (en) * 2016-02-24 2017-08-31 富士フイルム株式会社 Chromosome number quantification method
US10629291B2 (en) * 2016-03-10 2020-04-21 Koninklijke Philips N.V. Antibiotic resistance causation identification
WO2018067457A1 (en) 2016-10-03 2018-04-12 So Daniel Wai Cheong Method and apparatus for the analysis and identification of molecules
EP3339446A1 (en) 2016-12-21 2018-06-27 Siemens Healthcare GmbH Amplification-integrated genetic material depletion of non-target organisms using differentially abundant k-mers
US20190057134A1 (en) * 2017-08-21 2019-02-21 Eitan Moshe Akirav System and method for automated microarray information citation analysis
CN108342509B (en) * 2018-02-08 2021-07-09 北京宏微特斯生物科技有限公司 Method for enriching vertebrate viral nucleic acids
EP3891280A4 (en) * 2018-12-06 2022-08-10 Battelle Memorial Institute Technologies for nucleotide sequence screening
RU2712418C1 (en) * 2019-11-08 2020-01-28 Илья Юрьевич Емельянов Computing device
US20220364157A1 (en) * 2020-03-27 2022-11-17 Pathogendx, Inc. Methods for Detecting Low Levels of Covid-19 Virus
CN113470742A (en) * 2020-03-31 2021-10-01 阿里巴巴集团控股有限公司 Data processing method, data processing device, storage medium and computer equipment
WO2022020259A1 (en) * 2020-07-19 2022-01-27 Centrillion Technologies, Inc. Methods and devices for detecting and sequencing sars-cov-2
CN113284560B (en) * 2021-04-28 2022-05-17 广州微远基因科技有限公司 Pathogenic detection background microorganism judgment method and application
CN115547414B (en) * 2022-10-25 2023-04-14 黑龙江金域医学检验实验室有限公司 Determination method and device of potential virulence factor, computer equipment and storage medium
CN115992265B (en) * 2023-03-22 2023-07-14 中山大学 Grouper whole genome liquid phase chip and application thereof

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6228575B1 (en) * 1996-02-08 2001-05-08 Affymetrix, Inc. Chip-based species identification and phenotypic characterization of microorganisms

Family Cites Families (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5932220A (en) * 1995-05-08 1999-08-03 Board Of Regents University Of Texas System Diagnostic tests for a new spirochete, Borrelia lonestari sp. nov.
US5701256A (en) * 1995-05-31 1997-12-23 Cold Spring Harbor Laboratory Method and apparatus for biological sequence comparison
EP0880598A4 (en) * 1996-01-23 2005-02-23 Affymetrix Inc Nucleic acid analysis techniques
US6519583B1 (en) * 1997-05-15 2003-02-11 Incyte Pharmaceuticals, Inc. Graphical viewer for biomolecular sequence data
US7024312B1 (en) * 1999-01-19 2006-04-04 Maxygen, Inc. Methods for making character strings, polynucleotides and polypeptides having desired characteristics
EP1103911A1 (en) * 1999-11-25 2001-05-30 Applied Research Systems ARS Holding N.V. Automated method for identifying related biomolecular sequences
US6996477B2 (en) * 2001-04-19 2006-02-07 Dana Farber Cancer Institute, Inc. Computational subtraction method
CA2446262A1 (en) * 2001-05-04 2002-11-14 Paracel, Inc. Method and apparatus for high-speed approximate sub-string searches
JP3871301B2 (en) * 2001-05-15 2007-01-24 インターナショナル・ビジネス・マシーンズ・コーポレーション Database search apparatus and program
US6881835B2 (en) * 2002-01-04 2005-04-19 Dr. Chip Biotechnology Inc. Detection of respiratory viruses
EP1339006A1 (en) * 2002-02-14 2003-08-27 AgeLab Pharma GmbH Method for the detection of a functional protein sequence and an apparatus therefor
EP2270197A3 (en) * 2002-03-26 2011-02-16 Massachusetts Institute of Technology Targets, methods, and reagents for diagnosis and treatment of schizophrenia
US7695941B2 (en) * 2005-06-16 2010-04-13 The United States Of America As Represented By The Secretary Of The Navy Multiplexed polymerase chain reaction for genetic sequence analysis

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6228575B1 (en) * 1996-02-08 2001-05-08 Affymetrix, Inc. Chip-based species identification and phenotypic characterization of microorganisms

Cited By (43)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7504239B2 (en) * 2001-02-09 2009-03-17 Sapporo Breweries Limited Method of differentiating beer yeast
US20030104405A1 (en) * 2001-02-09 2003-06-05 Sapporo Breweries Limited Method of differentiating beer yeast
US20060190184A1 (en) * 2005-02-23 2006-08-24 Incogen, Inc. System and method using a visual or audio-visual programming environment to enable and optimize systems-level research in life sciences
US20090124512A1 (en) * 2006-01-18 2009-05-14 Regents Of The University Of Colorado Dna array analysis as a diagnostic for current and emerging strains of influenza
WO2008140494A2 (en) * 2006-11-22 2008-11-20 The Board Of Trustees Of Michigan State University High throughput screening using microarrays
WO2008140494A3 (en) * 2006-11-22 2009-03-12 Univ Michigan State High throughput screening using microarrays
US20110039715A1 (en) * 2006-11-27 2011-02-17 Agency For Science, Technology And Research Influenza b virus detection method and kit therefor
WO2008066493A1 (en) * 2006-11-27 2008-06-05 Agency For Science, Technology And Research Influenza b virus detection method and kit therefor
US20090092969A1 (en) * 2007-10-09 2009-04-09 Michael Aye Detection of atypical pneumonia
WO2009048873A2 (en) 2007-10-09 2009-04-16 Quest Diagnostics Investments Incorporated Detection of atypical pneumonia
WO2009048873A3 (en) * 2007-10-09 2009-08-27 Quest Diagnostics Investments Incorporated Detection of atypical pneumonia
US20110046001A1 (en) * 2007-11-20 2011-02-24 Autogenomics, Inc. Multiplex Assay for Respiratory Viruses
WO2009102369A2 (en) * 2007-11-20 2009-08-20 Autogenomics, Inc. Multiplex assay for respiratory viruses
WO2009102369A3 (en) * 2007-11-20 2009-12-30 Autogenomics, Inc. Multiplex assay for respiratory viruses
US10260113B2 (en) * 2007-12-21 2019-04-16 Quest Diagnostics Investments Incorporated Multiplex detection assay for influenza and RSV viruses
WO2009085733A1 (en) * 2007-12-21 2009-07-09 Quest Diagnostics Investments Incorporated Multiplex detection assay for influenza and rsv viruses
US8354230B2 (en) 2007-12-21 2013-01-15 Quest Diagnostics Investments Inc. Multiplex detection assay for influenza and RSV viruses
US20090181360A1 (en) * 2007-12-21 2009-07-16 Jules Chen Multiplex detection assay for influenza and rsv viruses
US20110097704A1 (en) * 2008-01-29 2011-04-28 Ibis Biosciences, Inc. Compositions for use in identification of picornaviruses
US20100048423A1 (en) * 2008-08-19 2010-02-25 Animal Health Research Institute, Council Of Agriculture, Executive Yuan Simultaneous detection, differentiation and typing system of newcastle disease and avian influenza viruses
US20110223135A1 (en) * 2008-10-31 2011-09-15 The Trustees Of The University Of Pennsylvania SIMIAN ADENOVIRUSES SAdV-43, -45, -46, -47, -48, -49, AND -50 AND USES THEREOF
US11807866B2 (en) 2008-10-31 2023-11-07 The Trustees Of The University Of Pennsylvania Simian adenoviruses SAdV-43, -45, -46, -47, -48, -49, and -50, and uses thereof
US8940290B2 (en) 2008-10-31 2015-01-27 The Trustees Of The University Of Pennsylvania Simian adenoviruses SAdV-43, -45, -46, -47, -48, -49, and -50 and uses thereof
US10501757B2 (en) 2008-10-31 2019-12-10 The Trustees Of The University Of Pennsylvania Simian adenoviruses SAdV-43, -45, -46, -47, -48, -49, and -50, and uses thereof
US9593346B2 (en) 2008-10-31 2017-03-14 The Trustees Of The University Of Pennsylvania Simian adenoviruses SAdV-43, -45, -46, -47, -48, -49, and -50, and uses thereof
WO2010051367A1 (en) * 2008-10-31 2010-05-06 The Trustees Of The University Of Pennsylvania Simian adenoviruses sadv-43, -45,-48,-49, and -50 and uses thereof
WO2010147989A1 (en) * 2009-06-15 2010-12-23 Ibis Biosciences, Inc. Compositions and methods for the isolation of nucleic acid
WO2011106556A2 (en) * 2010-02-24 2011-09-01 Life Technologies Corporation Systems and methods for adaptive recursive sequencing
WO2011106556A3 (en) * 2010-02-24 2012-01-19 Life Technologies Corporation Systems and methods for adaptive recursive sequencing
US20130130235A1 (en) * 2010-07-29 2013-05-23 Bigtec Private Limited Probes and primers for detection of dengue
US9938590B2 (en) * 2010-09-16 2018-04-10 Gen-Probe Incorporated Capture probes immobilizable via L-nucleotide tail
US11035012B2 (en) 2010-09-16 2021-06-15 Gen-Probe Incorporated Capture probes immobilizable via L-nucleotide tail
US20130260368A1 (en) * 2010-09-16 2013-10-03 Gen-Probe Incorporated Capture Probes Immobilizable Via L-Nucleotide Tail
US10392671B2 (en) 2014-06-30 2019-08-27 Dow Global Technologies Llc Method and reagents for detecting water contamination
WO2016028384A1 (en) 2014-06-30 2016-02-25 Dow Global Technologies Llc Method and reagents for detecting water contamination
US10515715B1 (en) 2019-06-25 2019-12-24 Colgate-Palmolive Company Systems and methods for evaluating compositions
US10839942B1 (en) 2019-06-25 2020-11-17 Colgate-Palmolive Company Systems and methods for preparing a product
US10839941B1 (en) 2019-06-25 2020-11-17 Colgate-Palmolive Company Systems and methods for evaluating compositions
US10861588B1 (en) 2019-06-25 2020-12-08 Colgate-Palmolive Company Systems and methods for preparing compositions
US11315663B2 (en) 2019-06-25 2022-04-26 Colgate-Palmolive Company Systems and methods for producing personal care products
US11342049B2 (en) 2019-06-25 2022-05-24 Colgate-Palmolive Company Systems and methods for preparing a product
US11728012B2 (en) 2019-06-25 2023-08-15 Colgate-Palmolive Company Systems and methods for preparing a product
WO2023173114A3 (en) * 2022-03-10 2024-01-25 Technovax, Inc. Recombinant virus-like particle capsid vaccines against adenoviruses and compositions, methods, and use thereof

Also Published As

Publication number Publication date
JP2011204261A (en) 2011-10-13
CA2572617C (en) 2013-10-29
WO2006088493A2 (en) 2006-08-24
US8032310B2 (en) 2011-10-04
CN101133164A (en) 2008-02-27
US20090170717A1 (en) 2009-07-02
CN101133164B (en) 2014-01-22
AU2005327520B2 (en) 2011-04-28
EP2385477A1 (en) 2011-11-09
JP5455977B2 (en) 2014-03-26
WO2006088493A3 (en) 2007-05-31
US9430610B2 (en) 2016-08-30
CA2572617A1 (en) 2006-08-24
EP2383670A1 (en) 2011-11-02
HK1118081A1 (en) 2009-01-30
JP2011200250A (en) 2011-10-13
EP1778881A4 (en) 2008-12-10
EP1778881A2 (en) 2007-05-02
US20070065832A1 (en) 2007-03-22
CN103224942A (en) 2013-07-31
AU2005327520A1 (en) 2006-08-24
SG156616A1 (en) 2009-11-26
JP2008504844A (en) 2008-02-21
US20120035857A1 (en) 2012-02-09
NZ552432A (en) 2009-11-27
NZ579206A (en) 2011-04-29
NO20070611L (en) 2007-03-29
JP5517996B2 (en) 2014-06-11
CA2823727A1 (en) 2006-08-24
WO2006088493A8 (en) 2007-08-09

Similar Documents

Publication Publication Date Title
US9430610B2 (en) Re-sequencing pathogen microarray
Fischer et al. Evaluation of unbiased next-generation sequencing of RNA (RNA-seq) as a diagnostic method in influenza virus-positive respiratory samples
Lin et al. Broad-spectrum respiratory tract pathogen identification using resequencing DNA microarrays
Miller et al. Basic concepts of microarrays and potential applications in clinical microbiology
Lin et al. Using a resequencing microarray as a multiple respiratory pathogen detection assay
Wang et al. Identifying influenza viruses with resequencing microarrays
AU2006280489B2 (en) Method and/or apparatus of oligonucleotide design and/or nucleic acid detection
US7695941B2 (en) Multiplexed polymerase chain reaction for genetic sequence analysis
AU2007314214A1 (en) DNA array analysis as a diagnostic for current and emerging strains of influenza
Meinel et al. Whole genome sequencing identifies influenza A H3N2 transmission and offers superior resolution to classical typing methods
US20110152109A1 (en) Biological sample target classification, detection and selection methods, and related arrays and oligonucleotide probes
Wang et al. Resequencing microarray probe design for typing genetically diverse viruses: human rhinoviruses and enteroviruses
CN101273143A (en) Multiplexed polymerase chain reaction for genetic sequence analysis
Leski et al. Application of resequencing microarrays in microbial detection and characterization
AU2011203297B2 (en) Computer-Implemented Biological Sequence Identifier System and Method
Shallom et al. A species independent universal bio-detection microarray for pathogen forensics and phylogenetic classification of unknown microorganisms
Leclercq et al. Use of consensus sequences for the design of high density resequencing microarrays: the influenza virus paradigm
Zhu et al. Evaluation of Metagenomics Next-Generation Sequencing as a Diagnostic Tool for Influenza Virus-Positive Respiratory Samples in Retired Fitness Players
JP2009509499A (en) Multiple polymerase chain reaction for gene sequence analysis
JP2009131242A (en) Virus database method

Legal Events

Date Code Title Description
AS Assignment

Owner name: U.S.A. AS REPRESENTED BY THE SECRETARY OF THE NAVY

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:STENGER, DAVID;LIN, BAOCHUAN;THACH, DZUNG;AND OTHERS;REEL/FRAME:016852/0282;SIGNING DATES FROM 20050628 TO 20050708

AS Assignment

Owner name: THE GOVERNMENT OF THE UNITED STATES OF AMERICA AS

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:AGAN, BRIAN K;WALKER, ELIZABETH A;ROWLEY, ROBB K;AND OTHERS;REEL/FRAME:019378/0432;SIGNING DATES FROM 20040916 TO 20070530

STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION