Recherche Images Maps Play YouTube Actualités Gmail Drive Plus »
Connexion
Les utilisateurs de lecteurs d'écran peuvent cliquer sur ce lien pour activer le mode d'accessibilité. Celui-ci propose les mêmes fonctionnalités principales, mais il est optimisé pour votre lecteur d'écran.

Brevets

  1. Recherche avancée dans les brevets
Numéro de publicationUS20070218489 A1
Type de publicationDemande
Numéro de demandeUS 11/685,603
Date de publication20 sept. 2007
Date de dépôt13 mars 2007
Date de priorité11 sept. 2003
Autre référence de publicationUS7956175, US8013142, US8242254, US8288523, US8394945, US20070224614, US20070238116, US20070243544, US20070248969, US20120122096, US20120122097, US20120122098, US20120122099, US20120122100, US20120122101, US20120122102, US20120122103
Numéro de publication11685603, 685603, US 2007/0218489 A1, US 2007/218489 A1, US 20070218489 A1, US 20070218489A1, US 2007218489 A1, US 2007218489A1, US-A1-20070218489, US-A1-2007218489, US2007/0218489A1, US2007/218489A1, US20070218489 A1, US20070218489A1, US2007218489 A1, US2007218489A1
InventeursRangarajan Sampath, Thomas Hall, David Ecker, Lawrence Blyn
Cessionnaire d'origineRangarajan Sampath, Hall Thomas A, Ecker David J, Lawrence Blyn
Exporter la citationBiBTeX, EndNote, RefMan
Liens externes: USPTO, Cession USPTO, Espacenet
Compositions for use in identification of bacteria
US 20070218489 A1
Résumé
The present invention provides compositions, kits and methods for rapid identification and quantification of bacteria by molecular mass and base composition analysis.
Images(7)
Previous page
Next page
Revendications(29)
1. An oligonucleotide primer pair comprising a forward primer and a reverse primer, each comprising between 13 and 35 linked nucleotides in length, configured to generate an amplicon that is between 45 and 200 linked nucleotides in length, said forward primer configured to hybridize with at least 70% complementarity to a first portion of a region of Genbank gi number: 57634611, and said reverse primer configured to hybridize with at least 70% complementarity to a second portion of said region of Genbank gi number: 57634611, wherein said region of Genbank gi number: 57634611 begins with the 5′ end of SEQ ID NO.: 174, and extends to the 5′ end of SEQ ID NO.: 899.
2. The oligonucleotide primer pair of claim 1, wherein said forward primer comprises at least 70% sequence identity with SEQ ID NO: 174.
3. The oligonucleotide primer pair of claim 2, wherein said forward primer comprises at least 80% sequence identity with SEQ ID NO: 174.
4. The oligonucleotide primer pair of claim 3, wherein said forward primer comprises at least 90% sequence identity with SEQ ID NO: 174.
5. The oligonucleotide primer pair of claim 1, wherein said forward primer is SEQ ID NO: 174.
6. The oligonucleotide primer pair of claim 1, wherein said reverse primer comprises at least 70% sequence identity with SEQ ID NO: 853.
7. The oligonucleotide primer pair of claim 6, wherein said reverse primer comprises at least 80% sequence identity with SEQ ID NO: 853.
8. The oligonucleotide primer pair of claim 7, wherein said reverse primer comprises at least 90% sequence identity with SEQ ID NO: 853.
9. The oligonucleotide primer pair of claim 1, wherein said reverse primer is SEQ ID NO: 853.
10. The oligonucleotide primer pair of claim 1, wherein at least one of said forward primer and said reverse primer comprises at least one modified nucleobase.
11. The oligonucleotide primer pair of claim 10, wherein at least one of said at least one modified nucleobase is a mass modified nucleobase.
12. The oligonucleotide primer pair of claim 11, wherein said mass modified nucleobase is 5-Iodo-C.
13. The composition of claim 11, wherein said mass modified nucleobase comprises a molecular mass modifying tag.
14. The oligonucleotide primer pair of claim 10, wherein at least one of said at least one modified nucleobase is a universal nucleobase.
15. The oligonucleotide primer pair of claim 14, wherein said universal nucleobase is inosine.
16. The oligonucleotide primer pair of claim 1, wherein at least one of said forward primer and said reverse primer comprises a non-templated T residue at its 5′ end.
17. A kit for identifying a Staphylococcus aureus bioagent comprising:
i) a first oligonucleotide primer pair comprising a forward primer and a reverse primer, each comprising between 13 and 35 linked nucleotides in length, configured to generate an amplicon that is between 45 and 200 linked nucleotides in length, said forward primer configured to hybridize with at least 70% complementarity to a first portion of a region of Genbank gi number: 57634611, and said reverse primer configured to hybridize with at least 70% complementarity to a second portion of said region of Genbank gi number: 57634611, wherein said region of Genbank gi number: 57634611 begins with the 5′ end of SEQ ID NO: 174 and extends to the 5′ end of SEQ ID NO: 899; and
ii) at least one additional primer pair, wherein the primers of each of said at least one additional primer pair are configured to hybridize to conserved sequence regions within a Staphylococcus aureus gene selected from the group consisting of: mecA, mecRI, ermA, ermC, pvluk, tufB and mupR.
18. The kit of claim 17, wherein each of said at least one additional primer pair comprises SEQ ID NO: 217:SEQ ID NO: 1167, SEQ ID NO: 399:SEQ ID NO:1041, SEQ ID NO: 456:SEQ ID NO: 1261, SEQ ID NO: 430:SEQ ID NO: 1321, SEQ ID NO: 288:SEQ ID NO:1269, SEQ ID NO: 698:SEQ ID NO: 1420, or SEQ ID NO: 205:SEQ ID NO: 876.
19. The kit of claim 17, wherein said first oligonucleotide primer pair and said at least one additional primer pair consists of eight oligonucleotide primer pairs having at least 70% sequence identity with the primer pairs: SEQ ID NO: 217:SEQ ID NO: 1167, SEQ ID NO: 399:SEQ ID NO:1041, SEQ ID NO: 456:SEQ ID NO: 1261, SEQ ID NO: 174:SEQ ID NO: 853, SEQ ID NO: 430:SEQ ID NO: 1321, SEQ ID NO: 288:SEQ ID NO:1269, SEQ ID NO: 698:SEQ ID NO: 1420, and SEQ ID NO: 205:SEQ ID NO: 876.
20. A method for identifying a Staphylococcus aureus bioagent in a sample comprising:
a) amplifying a nucleic acid from said sample using an oligonucleotide primer pair comprising a forward primer and a reverse primer, each comprising between 13 and 35 linked nucleotides in length, said forward primer configured to hybridize with at least 70% complementarity to a first portion of a region of Genbank gi number: 57634611, and said reverse primer configured to hybridize with at least 70% complementarity to a second portion of said region of Genbank gi number: 57634611, wherein said region of Genbank gi number: 57634611 begins with the 5′ end of SEQ ID NO.: 174, and extends to the 5′ end of SEQ ID NO.: 899; wherein said amplifying generates at least one amplification product that comprises between 45 and 200 linked nucleotides; and
b) determining the molecular mass of said at least one amplification product by mass spectrometry.
21. The method of claim 20 further comprising comparing said determined molecular mass to a database comprising a plurality of molecular masses of bioagent identifying amplicons, wherein a match between said determined molecular mass and a molecular mass comprised in said database identifies said Staphylococcus aureus bioagent in said sample.
22. The method of claim 20 further comprising calculating a base composition of said at least one amplification product using said molecular mass.
23. The method of claim 22 further comprising comparing said calculated base composition to a database comprising a plurality of base compositions of bioagent identifying amplicons, wherein a match between said calculated base composition and a base composition comprised in said database identifies said Staphylococcus aureus bioagent in said sample.
24. The method of claim 20, wherein said forward primer comprises at least 70% sequence identity with SEQ ID NO: 174.
25. The method of claim 20, wherein said reverse primer comprises at least 70% sequence identity with SEQ ID NO: 853.
26. The method of claim 20 further comprising repeating said amplifying and determining steps using at least one additional oligonucleotide primer pair wherein the primers of each of said at least one additional primer pair are designed to hybridize to conserved sequence regions within a Staphylococcus aureus gene selected from the group consisting of mecA, mecRI, ermA, ermC, pvluk, tufB, mupR, and nuc.
27. The method of claim 20, wherein said identifying comprises detecting the presence of said Staphylococcus aureus bioagent in said sample.
28. The method of claim 20, wherein said identifying comprises determining either the sensitivity or the resistance of said Staphylococcus aureus bioagent in said sample to one or more antibiotics.
29. The method of claim 20, wherein said identifying comprises identifying a sub-species characteristic, strain, or genotype of said Staphylococcus aureus bioagent in said sample.
Description
RELATED APPLICATIONS

This application is a continuation of U.S. application Ser. No. 11/409,535, filed Apr. 21, 2006, which is a continuation-in-part of U.S. application Ser. No. 11/060,135, filed Feb. 17, 2005 which claims the benefit of priority to U.S. Provisional Application Ser. No. 60/545,425 filed Feb. 18, 2004; U.S. Provisional Application Ser. No. 60/559,754, filed Apr. 5, 2004; U.S. Provisional Application Ser. No. 60/632,862, filed Dec. 3, 2004; U.S. Provisional Application Ser. No. 60/639,068, filed Dec. 22, 2004; and U.S. Provisional Application Ser. No. 60/648,188, filed Jan. 28, 2005. U.S. application Ser. No. 11/409,535 is a also continuation-in-part of U.S. application Ser. No. 10/728,486, filed Dec. 5, 2003 which claims the benefit of priority to U.S. Provisional Application Ser. No. 60/501,926, filed Sep. 11, 2003. U.S. application Ser. No. 11/409,535 also claims the benefit of priority to: U.S. Provisional Application Ser. No. 60/674,118, filed Apr. 21, 2005; U.S. Provisional Application Ser. No. 60/705,631, filed Aug. 3, 2005; U.S. Provisional Application Ser. No. 60/732,539, filed Nov. 1, 2005; and U.S. Provisional Application Ser. No. 60/773,124, filed Feb. 13, 2006. Each of the above-referenced U.S. Applications is incorporated herein by reference in its entirety. Methods disclosed in U.S. application Ser. Nos. 09/891,793, 10/156,608, 10/405,756, 10/418,514, 10/660,122, 10,660,996, 10/660,997, 10/660,998, 10/728,486, 11/060,135, and 11/073,362, are commonly owned and incorporated herein by reference in their entirety for any purpose.

STATEMENT OF GOVERNMENT SUPPORT

This invention was made with United States Government support under CDC contract RO1 CI000099-01. The United States Government has certain rights in the invention.

SEQUENCE LISTING

The present application is being filed along with a Sequence Listing in electronic format. The Sequence Listing is provided as a file entitled DIBIS0083USC12SEQ.txt, created on Mar. 13, 2007 which is 252 Kb in size. The information in the electronic format of the sequence listing is incorporated herein by reference in its entirety.

FIELD OF THE INVENTION

The present invention provides compositions, kits and methods for rapid identification and quantification of bacteria by molecular mass and base composition analysis.

BACKGROUND OF THE INVENTION

A problem in determining the cause of a natural infectious outbreak or a bioterrorist attack is the sheer variety of organisms that can cause human disease. There are over 1400 organisms infectious to humans; many of these have the potential to emerge suddenly in a natural epidemic or to be used in a malicious attack by bioterrorists (Taylor et al. Philos. Trans. R. Soc. London B. Biol. Sci., 2001, 356, 983-989). This number does not include numerous strain variants, bioengineered versions, or pathogens that infect plants or animals.

Much of the new technology being developed for detection of biological weapons incorporates a polymerase chain reaction (PCR) step based upon the use of highly specific primers and probes designed to selectively detect certain pathogenic organisms. Although this approach is appropriate for the most obvious bioterrorist organisms, like smallpox and anthrax, experience has shown that it is very difficult to predict which of hundreds of possible pathogenic organisms might be employed in a terrorist attack. Likewise, naturally emerging human disease that has caused devastating consequence in public health has come from unexpected families of bacteria, viruses, fungi, or protozoa. Plants and animals also have their natural burden of infectious disease agents and there are equally important biosafety and security concerns for agriculture.

A major conundrum in public health protection, biodefense, and agricultural safety and security is that these disciplines need to be able to rapidly identify and characterize infectious agents, while there is no existing technology with the breadth of function to meet this need. Currently used methods for identification of bacteria rely upon culturing the bacterium to effect isolation from other organisms and to obtain sufficient quantities of nucleic acid followed by sequencing of the nucleic acid, both processes which are time and labor intensive.

Mass spectrometry provides detailed information about the molecules being analyzed, including high mass accuracy. It is also a process that can be easily automated. DNA chips with specific probes can only determine the presence or absence of specifically anticipated organisms. Because there are hundreds of thousands of species of benign bacteria, some very similar in sequence to threat organisms, even arrays with 10,000 probes lack the breadth needed to identify a particular organism.

The present invention provides oligonucleotide primers and compositions and kits containing the oligonucleotide primers, which define bacterial bioagent identifying amplicons and, upon amplification, produce corresponding amplification products whose molecular masses provide the means to identify bacteria, for example, at and below the species taxonomic level.

SUMMARY OF THE INVENTION

The present invention provides compositions, kits and methods for rapid identification and quantification of bacteria by molecular mass and base composition analysis.

One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 456.

Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1261.

Another embodiment is an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 456 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1261.

One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 288.

Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1269.

Another embodiment is an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 288 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1269.

One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 698.

Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1420.

Another embodiment is an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 698 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1420.

One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 217.

Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1167

Another embodiment is an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 217 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1167.

One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 399.

Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1041.

Another embodiment is an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 399 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1041.

One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 430.

Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1321.

Another embodiment is an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 430 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1321.

One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 174.

Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 853.

Another embodiment is an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 174 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 853.

One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 172.

Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1360.

Another embodiment is an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 172 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1360.

Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 456 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1261.

Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 456 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1261 and further comprising one or more primer pairs wherein each member of said one or more primer pairs is of a length of 14 to 35 nucleobases and has 70% to 100% sequence identity with the corresponding member from the group of primer pairs represented by SEQ ID NOs: 288:1269, 698:1420, 217:1167, 399:1041, 430:1321, 174:853, and 172:1360.

One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 681.

Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1022.

Another embodiment is an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 681 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1022.

One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 315.

Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1379.

Another embodiment is an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 315 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1379.

One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 346.

Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 955.

Another embodiment is an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 346 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 955.

One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 504.

Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1409.

Another embodiment is an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 504 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1409.

One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 323.

Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1068.

Another embodiment is an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 323 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1068.

One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 479.

Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 938.

Another embodiment is an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 479 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 938.

Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 681 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1022.

Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 681 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1022 and further comprising one or more primer pairs wherein each member of said one or more primer pairs is of a length of 14 to 35 nucleobases and has 70% to 100% sequence identity with the corresponding member from the group of primer pairs represented by SEQ ID NOs: 315:1379, 346:955, 504:1409, 323:1068, 479:938.

One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 583.

Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 923.

Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 583 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 923.

One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 454.

Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1418.

Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 454 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1418.

One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 250.

Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 902.

Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 250 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 902.

One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 384.

Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 878.

Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 384 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 878.

One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 694.

Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1215.

Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 694 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1215.

One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 194.

Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1173.

Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 194 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1173.

One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 375.

Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 890.

Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 375 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 890.

One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 656.

Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1224.

Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 656 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1224.

One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 618.

Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1157.

Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 618 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1157.

One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 302.

Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 852.

Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 302 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 852.

One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 199.

Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 889.

Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 199 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 889.

One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 596.

Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1169.

Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 596 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1169.

One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 150.

Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1242.

Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 150 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1242.

One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 166.

Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1069.

Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 166 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1069.

One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 166.

Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1168.

Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 166 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1168.

Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 583 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 923 and further comprising one or more primer pairs wherein each member of said one or more primer pairs is of a length of 14 to 35 nucleobases and has 70% to 100% sequence identity with the corresponding member from the group of primer pairs represented by SEQ ID NOs: 454:1418, 250:902, 384:878, 694:1215, 194:1173, 375:890, 656:1224, 618:1157, 302:852, 199:889, 596:1169, 150:1242, 166:1069 and 166:1168.

One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 437.

Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1137.

Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 437 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1137.

One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 530.

Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 891.

Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 530 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 891.

One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 474.

Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 869.

Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 474 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 869.

One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 268.

Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1284.

Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 268 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1284.

One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 418.

Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1301.

Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 418 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1301.

One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 318.

Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1300.

Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 318 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1300.

One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 440.

Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1076.

Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 440 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1076.

One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 219.

Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1013.

Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 219 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1013.

Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 437 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1137 and further comprising one or more primer pairs wherein each member of said one or more primer pairs is of a length of 14 to 35 nucleobases and has 70% to 100% sequence identity with the corresponding member from the group of primer pairs represented by SEQ ID NOs: 530:891, 474:869, 268:1284, 418:1301, 318:1300, 440:1076 and 219:1013.

One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 325.

Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1163.

Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 325 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1163.

One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 278.

Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1039.

Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 278 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1039.

One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 465.

Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1037.

Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 465 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1037.

One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 148.

Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1172.

Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 148 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1172.

One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 190.

Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1254.

Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 190 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1254.

One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 266.

Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1094.

Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 266 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1094.

One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 508.

Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1297.

Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 508 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1297.

One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 259.

Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1060.

Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 259 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1060.

Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 325 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1163 and further comprising one or more primer pairs wherein each member of said one or more primer pairs is of a length of 14 to 35 nucleobases and has 70% to 100% sequence identity with the corresponding member from the group of primer pairs represented by SEQ ID NOs: 278:1039: 465:1037, 148:1172, 190:1254, 266:1094, 508:1297 and 259:1060.

One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 376.

Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1265.

Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 376 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1265.

One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 267.

Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1341.

Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 267 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1341.

One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 705.

Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1056.

Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 705 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1056.

One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 710.

Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1259.

Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 710 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1259.

One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 374.

Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1111.

Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 374 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1111.

One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 545.

Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 978.

Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 545 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 978.

One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 249.

Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1095.

Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 249 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1095.

One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 195.

Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1376.

Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 195 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1376.

One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 311.

Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1014.

Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 311 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1014.

One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 365.

Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1052.

Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 365 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1052.

One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 527.

Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1071.

Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 527 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1071.

One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 490.

Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1182.

Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 490 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1182.

Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 376 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1265 and further comprising one or more primer pairs wherein each member of said one or more primer pairs is of a length of 14 to 35 nucleobases and has 70% to 100% sequence identity with the corresponding member from the group of primer pairs represented by SEQ ID NOs: 267:1341, 705:1056, 710:1259, 374:1111, 545:978, 249:1095, 195:1376, 311:1014, 365:1052, 527:1071 and 490:1182.

In some embodiments, either or both of the primers of a primer pair composition contain at least one modified nucleobase such as 5-propynyluracil or 5-propynylcytosine for example.

In some embodiments, either or both of the primers of the primer pair comprises at least one universal nucleobase such as inosine for example.

In some embodiments, either or both of the primers of the primer pair comprises at least one non-templated T residue on the 5′-end.

In some embodiments, either or both of the primers of the primer pair comprises at least one non-template tag.

In some embodiments, either or both of the primers of the primer pair comprises at least one molecular mass modifying tag.

In some embodiments, the present invention provides primers and compositions comprising pairs of primers, and kits containing the same, and methods for use in identification of bacteria. The primers are designed to produce amplification products of DNA encoding genes that have conserved and variable regions across different subgroups and genotypes of bacteria.

Some embodiments are kits that contain one or more of the primer pair compositions. In some embodiments, each member of the one or more primer pairs of the kit is of a length of 14 to 35 nucleobases and has 70% to 100% sequence identity with the corresponding member from any of the primer pairs listed in Table 2.

Some embodiments of the kits contain at least one calibration polynucleotide for use in quantitiation of bacteria in a given sample, and also for use as a positive control for amplification.

Some embodiments of the kits contain at least one anion exchange functional group linked to a magnetic bead.

In some embodiments, the present invention also provides methods for identification of bacteria. Nucleic acid from the bacterium is amplified using the primers described above to obtain an amplification product. The molecular mass of the amplification product is measured. Optionally, the base composition of the amplification product is determined from the molecular mass. The molecular mass or base composition is compared with a plurality of molecular masses or base compositions of known analogous bacterial identifying amplicons, wherein a match between the molecular mass or base composition and a member of the plurality of molecular masses or base compositions identifies the bacterium. In some embodiments, the molecular mass is measured by mass spectrometry in a modality such as electrospray ionization (ESI) time of flight (TOF) mass spectrometry or ESI Fourier transform ion cyclotron resonance (FTICR) mass spectrometry, for example. Other mass spectrometry techniques can also be used to measure the molecular mass of bacterial bioagent identifying amplicons.

In some embodiments, the present invention is also directed to a method for determining the presence or absence of a bacterium in a sample. Nucleic acid from the sample is amplified using the composition described above to obtain an amplification product. The molecular mass of the amplification product is determined. Optionally, the base composition of the amplification product is determined from the molecular mass. The molecular mass or base composition of the amplification product is compared with the known molecular masses or base compositions of one or more known analogous bacterial bioagent identifying amplicons, wherein a match between the molecular mass or base composition of the amplification product and the molecular mass or base composition of one or more known bacterial bioagent identifying amplicons indicates the presence of the bacterium in the sample. In some embodiments, the molecular mass is measured by mass spectrometry.

In some embodiments, the present invention also provides methods for determination of the quantity of an unknown bacterium in a sample. The sample is contacted with the composition described above and a known quantity of a calibration polynucleotide comprising a calibration sequence. Nucleic acid from the unknown bacterium in the sample is concurrently amplified with the composition described above and nucleic acid from the calibration polynucleotide in the sample is concurrently amplified with the composition described above to obtain a first amplification product comprising a bacterial bioagent identifying amplicon and a second amplification product comprising a calibration amplicon. The molecular masses and abundances for the bacterial bioagent identifying amplicon and the calibration amplicon are determined. The bacterial bioagent identifying amplicon is distinguished from the calibration amplicon based on molecular mass and comparison of bacterial bioagent identifying amplicon abundance and calibration amplicon abundance indicates the quantity of bacterium in the sample. In some embodiments, the base composition of the bacterial bioagent identifying amplicon is determined.

In some embodiments, the present invention provides methods for detecting or quantifying bacteria by combining a nucleic acid amplification process with a mass determination process. In some embodiments, such methods identify or otherwise analyze the bacterium by comparing mass information from an amplification product with a calibration or control product. Such methods can be carried out in a highly multiplexed and/or parallel manner allowing for the analysis of as many as 300 samples per 24 hours on a single mass measurement platform. The accuracy of the mass determination methods in some embodiments of the present invention permits allows for the ability to discriminate between different bacteria such as, for example, various genotypes and drug resistant strains of Staphylococcus aureus.

BRIEF DESCRIPTION OF THE DRAWINGS

The foregoing summary of the invention, as well as the following detailed description of the invention, is better understood when read in conjunction with the accompanying drawings which are included by way of example and not by way of limitation.

FIG. 1: process diagram illustrating a representative primer pair selection process.

FIG. 2: process diagram illustrating an embodiment of the calibration method.

FIG. 3: common pathogenic bacteria and primer pair coverage. The primer pair number in the upper right hand corner of each polygon indicates that the primer pair can produce a bioagent identifying amplicon for all species within that polygon.

FIG. 4: a representative 3D diagram of base composition (axes A, G and C) of bioagent identifying amplicons obtained with primer pair number 14 (a precursor of primer pair number 348 which targets 16S rRNA). The diagram indicates that the experimentally determined base compositions of the clinical samples (labeled NHRC samples) closely match the base compositions expected for Streptococcus pyogenes and are distinct from the expected base compositions of other organisms.

FIG. 5: a representative mass spectrum of amplification products indicating the presence of bioagent identifying amplicons of Streptococcus pyogenes, Neisseria meningitidis, and Haemophilus influenzae obtained from amplification of nucleic acid from a clinical sample with primer pair number 349 which targets 23S rRNA. Experimentally determined molecular masses and base compositions for the sense strand of each amplification product are shown.

FIG. 6: a representative mass spectrum of amplification products representing a bioagent identifying amplicon of Streptococcus pyogenes, and a calibration amplicon obtained from amplification of nucleic acid from a clinical sample with primer pair number 356 which targets rplB. The experimentally determined molecular mass and base composition for the sense strand of the Streptococcus pyogenes amplification product is shown.

FIG. 7: a representative mass spectrum of an amplified nucleic acid mixture which contained the Ames strain of Bacillus anthracis, a known quantity of combination calibration polynucleotide (SEQ ID NO: 1464), and primer pair number 350 which targets the capC gene on the virulence plasmid pX02 of Bacillus anthracis. Calibration amplicons produced in the amplification reaction are visible in the mass spectrum as indicated and abundance data (peak height) are used to calculate the quantity of the Ames strain of Bacillus anthracis.

DEFINITIONS

As used herein, the term “abundance” refers to an amount. The amount may be described in terms of concentration which are common in molecular biology such as “copy number,” “pfu or plate-forming unit” which are well known to those with ordinary skill. Concentration may be relative to a known standard or may be absolute.

As used herein, the term “amplifiable nucleic acid” is used in reference to nucleic acids that may be amplified by any amplification method. It is contemplated that “amplifiable nucleic acid” also comprises “sample template.”

As used herein the term “amplification” refers to a special case of nucleic acid replication involving template specificity. It is to be contrasted with non-specific template replication (i.e., replication that is template-dependent but not dependent on a specific template). Template specificity is here distinguished from fidelity of replication (i.e., synthesis of the proper polynucleotide sequence) and nucleotide (ribo- or deoxyribo-) specificity. Template specificity is frequently described in terms of “target” specificity. Target sequences are “targets” in the sense that they are sought to be sorted out from other nucleic acid. Amplification techniques have been designed primarily for this sorting out. Template specificity is achieved in most amplification techniques by the choice of enzyme. Amplification enzymes are enzymes that, under conditions they are used, will process only specific sequences of nucleic acid in a heterogeneous mixture of nucleic acid. For example, in the case of Qβ replicase, MDV-1 RNA is the specific template for the replicase (D. L. Kacian et al., Proc. Natl. Acad. Sci. USA 69:3038 [1972]). Other nucleic acid will not be replicated by this amplification enzyme. Similarly, in the case of T7 RNA polymerase, this amplification enzyme has a stringent specificity for its own promoters (Chamberlin et al., Nature 228:227 [1970]). In the case of T4 DNA ligase, the enzyme will not ligate the two oligonucleotides or polynucleotides, where there is a mismatch between the oligonucleotide or polynucleotide substrate and the template at the ligation junction (D. Y. Wu and R. B. Wallace, Genomics 4:560 [1989]). Finally, Taq and Pfu polymerases, by virtue of their ability to function at high temperature, are found to display high specificity for the sequences bounded and thus defined by the primers; the high temperature results in thermodynamic conditions that favor primer hybridization with the target sequences and not hybridization with non-target sequences (H. A. Erlich (ed.), PCR Technology, Stockton Press [1989]).

As used herein, the term “amplification reagents” refers to those reagents (deoxyribonucleotide triphosphates, buffer, etc.), needed for amplification, excluding primers, nucleic acid template, and the amplification enzyme. Typically, amplification reagents along with other reaction components are placed and contained in a reaction vessel (test tube, microwell, etc.).

As used herein, the term “analogous” when used in context of comparison of bioagent identifying amplicons indicates that the bioagent identifying amplicons being compared are produced with the same pair of primers. For example, bioagent identifying amplicon “A” and bioagent identifying amplicon “B”, produced with the same pair of primers are analogous with respect to each other. Bioagent identifying amplicon “C”, produced with a different pair of primers is not analogous to either bioagent identifying amplicon “A” or bioagent identifying amplicon “B”.

As used herein, the term “anion exchange functional group” refers to a positively charged functional group capable of binding an anion through an electrostatic interaction. The most well known anion exchange functional groups are the amines, including primary, secondary, tertiary and quaternary amines.

The term “bacteria” or “bacterium” refers to any member of the groups of eubacteria and archaebacteria.

As used herein, a “base composition” is the exact number of each nucleobase (for example, A, T, C and G) in a segment of nucleic acid. For example, amplification of nucleic acid of Staphylococcus aureus strain carrying the lukS-PV gene with primer pair number 2095 (SEQ ID NOs: 456:1261) produces an amplification product 117 nucleobases in length from nucleic acid of the lukS-PV gene that has a base composition of A35 G17 C19 T46 (by convention—with reference to the sense strand of the amplification product). Because the molecular masses of each of the four natural nucleotides and chemical modifications thereof are known (if applicable), a measured molecular mass can be deconvoluted to a list of possible base compositions. Identification of a base composition of a sense strand which is complementary to the corresponding antisense strand in terms of base composition provides a confirmation of the true base composition of an unknown amplification product. For example, the base composition of the antisense strand of the 139 nucleobase amplification product described above is A46 G19 C17 T35.

As used herein, a “base composition probability cloud” is a representation of the diversity in base composition resulting from a variation in sequence that occurs among different isolates of a given species. The “base composition probability cloud” represents the base composition constraints for each species and is typically visualized using a pseudo four-dimensional plot.

In the context of this invention, a “bioagent” is any organism, cell, or virus, living or dead, or a nucleic acid derived from such an organism, cell or virus. Examples of bioagents include, but are not limited, to cells, (including but not limited to human clinical samples, bacterial cells and other pathogens), viruses, fungi, protists, parasites, and pathogenicity markers (including but not limited to: pathogenicity islands, antibiotic resistance genes, virulence factors, toxin genes and other bioregulating compounds). Samples may be alive or dead or in a vegetative state (for example, vegetative bacteria or spores) and may be encapsulated or bioengineered. In the context of this invention, a “pathogen” is a bioagent which causes a disease or disorder.

As used herein, a “bioagent division” is defined as group of bioagents above the species level and includes but is not limited to, orders, families, classes, clades, genera or other such groupings of bioagents above the species level.

As used herein, the term “bioagent identifying amplicon” refers to a polynucleotide that is amplified from a bioagent in an amplification reaction and which 1) provides sufficient variability to distinguish among bioagents from whose nucleic acid the bioagent identifying amplicon is produced and 2) whose molecular mass is amenable to a rapid and convenient molecular mass determination modality such as mass spectrometry, for example.

As used herein, the term “biological product” refers to any product originating from an organism. Biological products are often products of processes of biotechnology. Examples of biological products include, but are not limited to: cultured cell lines, cellular components, antibodies, proteins and other cell-derived biomolecules, growth media, growth harvest fluids, natural products and bio-pharmaceutical products.

The terms “biowarfare agent” and “bioweapon” are synonymous and refer to a bacterium, virus, fungus or protozoan that could be deployed as a weapon to cause bodily harm to individuals. Military or terrorist groups may be implicated in deployment of biowarfare agents.

In context of this invention, the term “broad range survey primer pair” refers to a primer pair designed to produce bioagent identifying amplicons across different broad groupings of bioagents. For example, the ribosomal RNA-targeted primer pairs are broad range survey primer pairs which have the capability of producing bacterial bioagent identifying amplicons for essentially all known bacteria. With respect to broad range primer pairs employed for identification of bacteria, a broad range survey primer pair for bacteria such as 16S rRNA primer pair number 346 (SEQ ID NOs: 202:1110) for example, will produce an bacterial bioagent identifying amplicon for essentially all known bacteria.

The term “calibration amplicon” refers to a nucleic acid segment representing an amplification product obtained by amplification of a calibration sequence with a pair of primers designed to produce a bioagent identifying amplicon.

The term “calibration sequence” refers to a polynucleotide sequence to which a given pair of primers hybridizes for the purpose of producing an internal (i.e: included in the reaction) calibration standard amplification product for use in determining the quantity of a bioagent in a sample. The calibration sequence may be expressly added to an amplification reaction, or may already be present in the sample prior to analysis.

The term “clade primer pair” refers to a primer pair designed to produce bioagent identifying amplicons for species belonging to a clade group. A clade primer pair may also be considered as a “speciating” primer pair which is useful for distinguishing among closely related species.

The term “codon” refers to a set of three adjoined nucleotides (triplet) that codes for an amino acid or a termination signal.

In context of this invention, the term “codon base composition analysis,” refers to determination of the base composition of an individual codon by obtaining a bioagent identifying amplicon that includes the codon. The bioagent identifying amplicon will at least include regions of the target nucleic acid sequence to which the primers hybridize for generation of the bioagent identifying amplicon as well as the codon being analyzed, located between the two primer hybridization regions.

As used herein, the terms “complementary” or “complementarity” are used in reference to polynucleotides (i.e., a sequence of nucleotides such as an oligonucleotide or a target nucleic acid) related by the base-pairing rules. For example, for the sequence “5′-A-G-T-3′,” is complementary to the sequence “3′-T-C-A-5′.” Complementarity may be “partial,” in which only some of the nucleic acids' bases are matched according to the base pairing rules. Or, there may be “complete” or “total” complementarity between the nucleic acids. The degree of complementarity between nucleic acid strands has significant effects on the efficiency and strength of hybridization between nucleic acid strands. This is of particular importance in amplification reactions, as well as detection methods that depend upon binding between nucleic acids. Either term may also be used in reference to individual nucleotides, especially within the context of polynucleotides. For example, a particular nucleotide within an oligonucleotide may be noted for its complementarity, or lack thereof, to a nucleotide within another nucleic acid strand, in contrast or comparison to the complementarity between the rest of the oligonucleotide and the nucleic acid strand.

The term “complement of a nucleic acid sequence” as used herein refers to an oligonucleotide which, when aligned with the nucleic acid sequence such that the 5′ end of one sequence is paired with the 3′ end of the other, is in “antiparallel association.” Certain bases not commonly found in natural nucleic acids may be included in the nucleic acids of the present invention and include, for example, inosine and 7-deazaguanine. Complementarity need not be perfect; stable duplexes may contain mismatched base pairs or unmatched bases. Those skilled in the art of nucleic acid technology can determine duplex stability empirically considering a number of variables including, for example, the length of the oligonucleotide, base composition and sequence of the oligonucleotide, ionic strength and incidence of mismatched base pairs. Where a first oligonucleotide is complementary to a region of a target nucleic acid and a second oligonucleotide has complementary to the same region (or a portion of this region) a “region of overlap” exists along the target nucleic acid. The degree of overlap will vary depending upon the extent of the complementarity.

In context of this invention, the term “division-wide primer pair” refers to a primer pair designed to produce bioagent identifying amplicons within sections of a broader spectrum of bioagents For example, primer pair number 352 (SEQ ID NOs: 687:1411), a division-wide primer pair, is designed to produce bacterial bioagent identifying amplicons for members of the Bacillus group of bacteria which comprises, for example, members of the genera Streptococci, Enterococci, and Staphylococci. Other division-wide primer pairs may be used to produce bacterial bioagent identifying amplicons for other groups of bacterial bioagents.

As used herein, the term “concurrently amplifying” used with respect to more than one amplification reaction refers to the act of simultaneously amplifying more than one nucleic acid in a single reaction mixture.

As used herein, the term “drill-down primer pair” refers to a primer pair designed to produce bioagent identifying amplicons for identification of sub-species characteristics or confirmation of a species assignment. For example, primer pair number 2146 (SEQ ID NOs: 437:1137), a drill-down Staphylococcus aureus genotyping primer pair, is designed to produce Staphylococcus aureus genotyping amplicons. Other drill-down primer pairs may be used to produce bioagent identifying amplicons for Staphylococcus aureus and other bacterial species.

The term “duplex” refers to the state of nucleic acids in which the base portions of the nucleotides on one strand are bound through hydrogen bonding the their complementary bases arrayed on a second strand. The condition of being in a duplex form reflects on the state of the bases of a nucleic acid. By virtue of base pairing, the strands of nucleic acid also generally assume the tertiary structure of a double helix, having a major and a minor groove. The assumption of the helical form is implicit in the act of becoming duplexed.

As used herein, the term “etiology” refers to the causes or origins, of diseases or abnormal physiological conditions.

The term “gene” refers to a DNA sequence that comprises control and coding sequences necessary for the production of an RNA having a non-coding function (e.g., a ribosomal or transfer RNA), a polypeptide or a precursor. The RNA or polypeptide can be encoded by a full length coding sequence or by any portion of the coding sequence so long as the desired activity or function is retained.

The terms “homology,” “homologous” and “sequence identity” refer to a degree of identity. There may be partial homology or complete homology. A partially homologous sequence is one that is less than 100% identical to another sequence. Determination of sequence identity is described in the following example: a primer 20 nucleobases in length which is otherwise identical to another 20 nucleobase primer but having two non-identical residues has 18 of 20 identical residues (18/20=0.9 or 90% sequence identity). In another example, a primer 15 nucleobases in length having all residues identical to a 15 nucleobase segment of a primer 20 nucleobases in length would have 15/20=0.75 or 75% sequence identity with the 20 nucleobase primer. In context of the present invention, sequence identity is meant to be properly determined when the query sequence and the subject sequence are both described and aligned in the 5′ to 3′ direction. Sequence alignment algorithms such as BLAST, will return results in two different alignment orientations. In the Plus/Plus orientation, both the query sequence and the subject sequence are aligned in the 5′ to 3′ direction. On the other hand, in the Plus/Minus orientation, the query sequence is in the 5′ to 3′ direction while the subject sequence is in the 3′ to 5′ direction. It should be understood that with respect to the primers of the present invention, sequence identity is properly determined when the alignment is designated as Plus/Plus. Sequence identity may also encompass alternate or modified nucleobases that perform in a functionally similar manner to the regular nucleobases adenine, thymine, guanine and cytosine with respect to hybridization and primer extension in amplification reactions. In a non-limiting example, if the 5-propynyl pyrimidines propyne C and/or propyne T replace one or more C or T residues in one primer which is otherwise identical to another primer in sequence and length, the two primers will have 100% sequence identity with each other. In another non-limiting example, Inosine (I) may be used as a replacement for G or T and effectively hybridize to C, A or U (uracil). Thus, if inosine replaces one or more C, A or U residues in one primer which is otherwise identical to another primer in sequence and length, the two primers will have 100% sequence identity with each other. Other such modified or universal bases may exist which would perform in a functionally similar manner for hybridization and amplification reactions and will be understood to fall within this definition of sequence identity.

As used herein, “housekeeping gene” refers to a gene encoding a protein or RNA involved in basic functions required for survival and reproduction of a bioagent. Housekeeping genes include, but are not limited to genes encoding RNA or proteins involved in translation, replication, recombination and repair, transcription, nucleotide metabolism, amino acid metabolism, lipid metabolism, energy generation, uptake, secretion and the like.

As used herein, the term “hybridization” is used in reference to the pairing of complementary nucleic acids. Hybridization and the strength of hybridization (i.e., the strength of the association between the nucleic acids) is influenced by such factors as the degree of complementary between the nucleic acids, stringency of the conditions involved, and the Tm of the formed hybrid. “Hybridization” methods involve the annealing of one nucleic acid to another, complementary nucleic acid, i.e., a nucleic acid having a complementary nucleotide sequence. The ability of two polymers of nucleic acid containing complementary sequences to find each other and anneal through base pairing interaction is a well-recognized phenomenon. The initial observations of the “hybridization” process by Marmur and Lane, Proc. Natl. Acad. Sci. USA 46:453 (1960) and Doty et al., Proc. Natl. Acad. Sci. USA 46:461 (1960) have been followed by the refinement of this process into an essential tool of modern biology.

The term “in silico” refers to processes taking place via computer calculations. For example, electronic PCR (ePCR) is a process analogous to ordinary PCR except that it is carried out using nucleic acid sequences and primer pair sequences stored on a computer formatted medium.

As used herein, “intelligent primers” are primers that are designed to bind to highly conserved sequence regions of a bioagent identifying amplicon that flank an intervening variable region and, upon amplification, yield amplification products which ideally provide enough variability to distinguish individual bioagents, and which are amenable to molecular mass analysis. By the term “highly conserved,” it is meant that the sequence regions exhibit between about 80-100%, or between about 90-100%, or between about 95-100% identity among all, or at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% of species or strains.

The “ligase chain reaction” (LCR; sometimes referred to as “Ligase Amplification Reaction” (LAR) described by Barany, Proc. Natl. Acad. Sci., 88:189 (1991); Barany, PCR Methods and Applic., 1:5 (1991); and Wu and Wallace, Genomics 4:560 (1989) has developed into a well-recognized alternative method for amplifying nucleic acids. In LCR, four oligonucleotides, two adjacent oligonucleotides which uniquely hybridize to one strand of target DNA, and a complementary set of adjacent oligonucleotides, that hybridize to the opposite strand are mixed and DNA ligase is added to the mixture. Provided that there is complete complementarity at the junction, ligase will covalently link each set of hybridized molecules. Importantly, in LCR, two probes are ligated together only when they base-pair with sequences in the target sample, without gaps or mismatches. Repeated cycles of denaturation, hybridization and ligation amplify a short segment of DNA. LCR has also been used in combination with PCR to achieve enhanced detection of single-base changes. However, because the four oligonucleotides used in this assay can pair to form two short ligatable fragments, there is the potential for the generation of target-independent background signal. The use of LCR for mutant screening is limited to the examination of specific nucleic acid positions.

The term “locked nucleic acid” or “LNA” refers to a nucleic acid analogue containing one or more 2′-O, 4′-C-methylene-o-D-ribofuranosyl nucleotide monomers in an RNA mimicking sugar conformation. LNA oligonucleotides display unprecedented hybridization affinity toward complementary single-stranded RNA and complementary single- or double-stranded DNA. LNA oligonucleotides induce A-type (RNA-like) duplex conformations. The primers of the present invention may contain LNA modifications.

As used herein, the term “mass-modifying tag” refers to any modification to a given nucleotide which results in an increase in mass relative to the analogous non-mass modified nucleotide. Mass-modifying tags can include heavy isotopes of one or more elements included in the nucleotide such as carbon-13 for example. Other possible modifications include addition of substituents such as iodine or bromine at the 5 position of the nucleobase for example.

The term “mass spectrometry” refers to measurement of the mass of atoms or molecules. The molecules are first converted to ions, which are separated using electric or magnetic fields according to the ratio of their mass to electric charge. The measured masses are used to identity the molecules.

The term “microorganism” as used herein means an organism too small to be observed with the unaided eye and includes, but is not limited to bacteria, virus, protozoans, fungi; and ciliates.

The term “multi-drug resistant” or multiple-drug resistant” refers to a microorganism which is resistant to more than one of the antibiotics or antimicrobial agents used in the treatment of said microorganism.

The term “multiplex PCR” refers to a PCR reaction where more than one primer set is included in the reaction pool allowing 2 or more different DNA targets to be amplified by PCR in a single reaction tube.

The term “non-template tag” refers to a stretch of at least three guanine or cytosine nucleobases of a primer used to produce a bioagent identifying amplicon which are not complementary to the template. A non-template tag is incorporated into a primer for the purpose of increasing the primer-duplex stability of later cycles of amplification by incorporation of extra G-C pairs which each have one additional hydrogen bond relative to an A-T pair.

The term “nucleic acid sequence” as used herein refers to the linear composition of the nucleic acid residues A, T, C or G or any modifications thereof, within an oligonucleotide, nucleotide or polynucleotide, and fragments or portions thereof, and to DNA or RNA of genomic or synthetic origin which may be single or double stranded, and represent the sense or antisense strand

As used herein, the term “nucleobase” is synonymous with other terms in use in the art including “nucleotide,” “deoxynucleotide,” “nucleotide residue,” “deoxynucleotide residue,” “nucleotide triphosphate (NTP),” or deoxynucleotide triphosphate (dNTP).

The term “nucleotide analog” as used herein refers to modified or non-naturally occurring nucleotides such as 5-propynyl pyrimidines (i.e., 5-propynyl-dTTP and 5-propynyl-dTCP), 7-deaza purines (i.e., 7-deaza-dATP and 7-deaza-dGTP). Nucleotide analogs include base analogs and comprise modified forms of deoxyribonucleotides as well as ribonucleotides.

The term “oligonucleotide” as used herein is defined as a molecule comprising two or more deoxyribonucleotides or ribonucleotides, preferably at least 5 nucleotides, more preferably at least about 13 to 35 nucleotides. The exact size will depend on many factors, which in turn depend on the ultimate function or use of the oligonucleotide. The oligonucleotide may be generated in any manner, including chemical synthesis, DNA replication, reverse transcription, PCR, or a combination thereof. Because mononucleotides are reacted to make oligonucleotides in a manner such that the 5′ phosphate of one mononucleotide pentose ring is attached to the 3′ oxygen of its neighbor in one direction via a phosphodiester linkage, an end of an oligonucleotide is referred to as the “5′-end” if its 5′ phosphate is not linked to the 3′ oxygen of a mononucleotide pentose ring and as the “3′-end” if its 3′ oxygen is not linked to a 5′ phosphate of a subsequent mononucleotide pentose ring. As used herein, a nucleic acid sequence, even if internal to a larger oligonucleotide, also may be said to have 5′ and 3′ ends. A first region along a nucleic acid strand is said to be upstream of another region if the 3′ end of the first region is before the 5′ end of the second region when moving along a strand of nucleic acid in a 5′ to 3′ direction. All oligonucleotide primers disclosed herein are understood to be presented in the 5′ to 3′ direction when reading left to right. When two different, non-overlapping oligonucleotides anneal to different regions of the same linear complementary nucleic acid sequence, and the 3′ end of one oligonucleotide points towards the 5′ end of the other, the former may be called the “upstream” oligonucleotide and the latter the “downstream” oligonucleotide. Similarly, when two overlapping oligonucleotides are hybridized to the same linear complementary nucleic acid sequence, with the first oligonucleotide positioned such that its 5′ end is upstream of the 5′ end of the second oligonucleotide, and the 3′ end of the first oligonucleotide is upstream of the 3′ end of the second oligonucleotide, the first oligonucleotide may be called the “upstream” oligonucleotide and the second oligonucleotide may be called the “downstream” oligonucleotide.

In the context of this invention, a “pathogen” is a bioagent which causes a disease or disorder.

As used herein, the terms “PCR product,” “PCR fragment,” and “amplification product” refer to the resultant mixture of compounds after two or more cycles of the PCR steps of denaturation, annealing and extension are complete. These terms encompass the case where there has been amplification of one or more segments of one or more target sequences.

The term “peptide nucleic acid” (“PNA”) as used herein refers to a molecule comprising bases or base analogs such as would be found in natural nucleic acid, but attached to a peptide backbone rather than the sugar-phosphate backbone typical of nucleic acids. The attachment of the bases to the peptide is such as to allow the bases to base pair with complementary bases of nucleic acid in a manner similar to that of an oligonucleotide. These small molecules, also designated anti gene agents, stop transcript elongation by binding to their complementary strand of nucleic acid (Nielsen, et al. Anticancer Drug Des. 8:53 63). The primers of the present invention may comprise PNAs.

The term “polymerase” refers to an enzyme having the ability to synthesize a complementary strand of nucleic acid from a starting template nucleic acid strand and free dNTPs.

As used herein, the term “polymerase chain reaction” (“PCR”) refers to the method of K. B. Mullis U.S. Pat. Nos. 4,683,195, 4,683,202, and 4,965,188, hereby incorporated by reference, that describe a method for increasing the concentration of a segment of a target sequence in a mixture of genomic DNA without cloning or purification. This process for amplifying the target sequence consists of introducing a large excess of two oligonucleotide primers to the DNA mixture containing the desired target sequence, followed by a precise sequence of thermal cycling in the presence of a DNA polymerase. The two primers are complementary to their respective strands of the double stranded target sequence. To effect amplification, the mixture is denatured and the primers then annealed to their complementary sequences within the target molecule. Following annealing, the primers are extended with a polymerase so as to form a new pair of complementary strands. The steps of denaturation, primer annealing, and polymerase extension can be repeated many times (i.e., denaturation, annealing and extension constitute one “cycle”; there can be numerous “cycles”) to obtain a high concentration of an amplified segment of the desired target sequence. The length of the amplified segment of the desired target sequence is determined by the relative positions of the primers with respect to each other, and therefore, this length is a controllable parameter. By virtue of the repeating aspect of the process, the method is referred to as the “polymerase chain reaction” (hereinafter “PCR”). Because the desired amplified segments of the target sequence become the predominant sequences (in terms of concentration) in the mixture, they are said to be “PCR amplified.” With PCR, it is possible to amplify a single copy of a specific target sequence in genomic DNA to a level detectable by several different methodologies (e.g., hybridization with a labeled probe; incorporation of biotinylated primers followed by avidin-enzyme conjugate detection; incorporation of 32P-labeled deoxynucleotide triphosphates, such as dCTP or dATP, into the amplified segment). In addition to genomic DNA, any oligonucleotide or polynucleotide sequence can be amplified with the appropriate set of primer molecules. In particular, the amplified segments created by the PCR process itself are, themselves, efficient templates for subsequent PCR amplifications.

The term “polymerization means” or “polymerization agent” refers to any agent capable of facilitating the addition of nucleoside triphosphates to an oligonucleotide. Preferred polymerization means comprise DNA and RNA polymerases.

As used herein, the terms “pair of primers,” or “primer pair” are synonymous. A primer pair is used for amplification of a nucleic acid sequence. A pair of primers comprises a forward primer and a reverse primer. The forward primer hybridizes to a sense strand of a target gene sequence to be amplified and primes synthesis of an antisense strand (complementary to the sense strand) using the target sequence as a template. A reverse primer hybridizes to the antisense strand of a target gene sequence to be amplified and primes synthesis of a sense strand (complementary to the antisense strand) using the target sequence as a template.

The primers are designed to bind to highly conserved sequence regions of a bioagent identifying amplicon that flank an intervening variable region and yield amplification products which ideally provide enough variability to distinguish each individual bioagent, and which are amenable to molecular mass analysis. In some embodiments, the highly conserved sequence regions exhibit between about 80-100%, or between about 90-100%, or between about 95-100% identity, or between about 99-100% identity. The molecular mass of a given amplification product provides a means of identifying the bioagent from which it was obtained, due to the variability of the variable region. Thus design of the primers requires selection of a variable region with appropriate variability to resolve the identity of a given bioagent. Bioagent identifying amplicons are ideally specific to the identity of the bioagent.

Properties of the primers may include any number of properties related to structure including, but not limited to: nucleobase length which may be contiguous (linked together) or non-contiguous (for example, two or more contiguous segments which are joined by a linker or loop moiety), modified or universal nucleobases (used for specific purposes such as for example, increasing hybridization affinity, preventing non-templated adenylation and modifying molecular mass) percent complementarity to a given target sequences.

Properties of the primers also include functional features including, but not limited to, orientation of hybridization (forward or reverse) relative to a nucleic acid template. The coding or sense strand is the strand to which the forward priming primer hybridizes (forward priming orientation) while the reverse priming primer hybridizes to the non-coding or antisense strand (reverse priming orientation). The functional properties of a given primer pair also include the generic template nucleic acid to which the primer pair hybridizes. For example, identification of bioagents can be accomplished at different levels using primers suited to resolution of each individual level of identification. Broad range survey primers are designed with the objective of identifying a bioagent as a member of a particular division (e.g., an order, family, genus or other such grouping of bioagents above the species level of bioagents). In some embodiments, broad range survey intelligent primers are capable of identification of bioagents at the species or sub-species level. Other primers may have the functionality of producing bioagent identifying amplicons for members of a given taxonomic genus, clade, species, sub-species or genotype (including genetic variants which may include presence of virulence genes or antibiotic resistance genes or mutations). Additional functional properties of primer pairs include the functionality of performing amplification either singly (single primer pair per amplification reaction vessel) or in a multiplex fashion (multiple primer pairs and multiple amplification reactions within a single reaction vessel).

As used herein, the terms “purified” or “substantially purified” refer to molecules, either nucleic or amino acid sequences, that are removed from their natural environment, isolated or separated, and are at least 60% free, preferably 75% free, and most preferably 90% free from other components with which they are naturally associated. An “isolated polynucleotide” or “isolated oligonucleotide” is therefore a substantially purified polynucleotide.

The term “reverse transcriptase” refers to an enzyme having the ability to transcribe DNA from an RNA template. This enzymatic activity is known as reverse transcriptase activity. Reverse transcriptase activity is desirable in order to obtain DNA from RNA viruses which can then be amplified and analyzed by the methods of the present invention.

The term “ribosomal RNA” or “rRNA” refers to the primary ribonucleic acid constituent of ribosomes. Ribosomes are the protein-manufacturing organelles of cells and exist in the cytoplasm. Ribosomal RNAs are transcribed from the DNA genes encoding them.

The term “sample” in the present specification and claims is used in its broadest sense. On the one hand it is meant to include a specimen or culture (e.g., microbiological cultures). On the other hand, it is meant to include both biological and environmental samples. A sample may include a specimen of synthetic origin. Biological samples may be animal, including human, fluid, solid (e.g., stool) or tissue, as well as liquid and solid food and feed products and ingredients such as dairy items, vegetables, meat and meat by-products, and waste. Biological samples may be obtained from all of the various families of domestic animals, as well as feral or wild animals, including, but not limited to, such animals as ungulates, bear, fish, lagamorphs, rodents, etc. Environmental samples include environmental material such as surface matter, soil, water, air and industrial samples, as well as samples obtained from food and dairy processing instruments, apparatus, equipment, utensils, disposable and non-disposable items. These examples are not to be construed as limiting the sample types applicable to the present invention. The term “source of target nucleic acid” refers to any sample that contains nucleic acids (RNA or DNA). Particularly preferred sources of target nucleic acids are biological samples including, but not limited to blood, saliva, cerebral spinal fluid, pleural fluid, milk, lymph, sputum and semen.

As used herein, the term “sample template” refers to nucleic acid originating from a sample that is analyzed for the presence of “target” (defined below). In contrast, “background template” is used in reference to nucleic acid other than sample template that may or may not be present in a sample. Background template is often a contaminant. It may be the result of carryover, or it may be due to the presence of nucleic acid contaminants sought to be purified away from the sample. For example, nucleic acids from organisms other than those to be detected may be present as background in a test sample.

A “segment” is defined herein as a region of nucleic acid within a target sequence.

The “self-sustained sequence replication reaction” (3SR) (Guatelli et al., Proc. Natl. Acad. Sci., 87:1874-1878 [1990], with an erratum at Proc. Natl. Acad. Sci., 87:7797 [1990]) is a transcription-based in vitro amplification system (Kwok et al., Proc. Natl. Acad. Sci., 86:1173-1177 [1989]) that can exponentially amplify RNA sequences at a uniform temperature. The amplified RNA can then be utilized for mutation detection (Fahy et al., PCR Meth. Appl., 1:25-33 [1991]). In this method, an oligonucleotide primer is used to add a phage RNA polymerase promoter to the 5′ end of the sequence of interest. In a cocktail of enzymes and substrates that includes a second primer, reverse transcriptase, RNase H, RNA polymerase and ribo- and deoxyribonucleoside triphosphates, the target sequence undergoes repeated rounds of transcription, cDNA synthesis and second-strand synthesis to amplify the area of interest. The use of 3SR to detect mutations is kinetically limited to screening small segments of DNA (e.g., 200-300 base pairs).

As used herein, the term ““sequence alignment”” refers to a listing of multiple DNA or amino acid sequences and aligns them to highlight their similarities. The listings can be made using bioinformatics computer programs.

In context of this invention, the term “speciating primer pair” refers to a primer pair designed to produce a bioagent identifying amplicon with the diagnostic capability of identifying species members of a group of genera or a particular genus of bioagents. Primer pair number 2249 (SEQ ID NOs: 430:1321), for example, is a speciating primer pair used to distinguish Staphylococcus aureus from other species of the genus Staphylococcus.

As used herein, a “sub-species characteristic” is a genetic characteristic that provides the means to distinguish two members of the same bioagent species. For example, one viral strain could be distinguished from another viral strain of the same species by possessing a genetic change (e.g., for example, a nucleotide deletion, addition or substitution) in one of the viral genes, such as the RNA-dependent RNA polymerase. Sub-species characteristics such as virulence genes and drug—are responsible for the phenotypic differences among the different strains of bacteria.

As used herein, the term “target” is used in a broad sense to indicate the gene or genomic region being amplified by the primers. Because the present invention provides a plurality of amplification products from any given primer pair (depending on the bioagent being analyzed), multiple amplification products from different specific nucleic acid sequences may be obtained. Thus, the term “target” is not used to refer to a single specific nucleic acid sequence. The “target” is sought to be sorted out from other nucleic acid sequences and contains a sequence that has at least partial complementarity with an oligonucleotide primer. The target nucleic acid may comprise single- or double-stranded DNA or RNA. A “segment” is defined as a region of nucleic acid within the target sequence.

The term “template” refers to a strand of nucleic acid on which a complementary copy is built from nucleoside triphosphates through the activity of a template-dependent nucleic acid polymerase. Within a duplex the template strand is, by convention, depicted and described as the “bottom” strand. Similarly, the non-template strand is often depicted and described as the “top” strand.

As used herein, the term “Tm” is used in reference to the “melting temperature.” The melting temperature is the temperature at which a population of double-stranded nucleic acid molecules becomes half dissociated into single strands. Several equations for calculating the Tm of nucleic acids are well known in the art. As indicated by standard references, a simple estimate of the Tm value may be calculated by the equation: Tm=81.5+0.41(% G+C), when a nucleic acid is in aqueous solution at 1 M NaCl (see e.g., Anderson and Young, Quantitative Filter Hybridization, in Nucleic Acid Hybridization (1985). Other references (e.g., Allawi, H. T. & SantaLucia, J., Jr. Thermodynamics and NMR of internal G.T mismatches in DNA. Biochemistry 36, 10581-94 (1997) include more sophisticated computations which take structural and environmental, as well as sequence characteristics into account for the calculation of Tm.

The term “triangulation genotyping analysis” refers to a method of genotyping a bioagent by measurement of molecular masses or base compositions of amplification products, corresponding to bioagent identifying amplicons, obtained by amplification of regions of more than one gene. In this sense, the term “triangulation” refers to a method of establishing the accuracy of information by comparing three or more types of independent points of view bearing on the same findings. Triangulation genotyping analysis carried out with a plurality of triangulation genotyping analysis primers yields a plurality of base compositions that then provide a pattern or “barcode” from which a species type can be assigned. The species type may represent a previously known sub-species or strain, or may be a previously unknown strain having a specific and previously unobserved base composition barcode indicating the existence of a previously unknown genotype.

As used herein, the term “triangulation genotyping analysis primer pair” is a primer pair designed to produce bioagent identifying amplicons for determining species types in a triangulation genotyping analysis.

The employment of more than one bioagent identifying amplicon for identification of a bioagent is herein referred to as “triangulation identification.” Triangulation identification is pursued by analyzing a plurality of bioagent identifying amplicons produced with different primer pairs. This process is used to reduce false negative and false positive signals, and enable reconstruction of the origin of hybrid or otherwise engineered bioagents. For example, identification of the three part toxin genes typical of B. anthracis (Bowen et al., J. Appl. Microbiol., 1999, 87, 270-278) in the absence of the expected signatures from the B. anthracis genome would suggest a genetic engineering event.

In the context of this invention, the term “unknown bioagent” may mean either: (i) a bioagent whose existence is known (such as the well known bacterial species Staphylococcus aureus for example) but which is not known to be in a sample to be analyzed, or (ii) a bioagent whose existence is not known (for example, the SARS coronavirus was unknown prior to April 2003). For example, if the method for identification of coronaviruses disclosed in commonly owned U.S. patent Ser. No. 10/829,826 (incorporated herein by reference in its entirety) was to be employed prior to April 2003 to identify the SARS coronavirus in a clinical sample, both meanings of “unknown” bioagent are applicable since the SARS coronavirus was unknown to science prior to April, 2003 and since it was not known what bioagent (in this case a coronavirus) was present in the sample. On the other hand, if the method of U.S. patent Ser. No. 10/829,826 was to be employed subsequent to April 2003 to identify the SARS coronavirus in a clinical sample, only the first meaning (i) of “unknown” bioagent would apply since the SARS coronavirus became known to science subsequent to April 2003 and since it was not known what bioagent was present in the sample.

The term “variable sequence” as used herein refers to differences in nucleic acid sequence between two nucleic acids. For example, the genes of two different bacterial species may vary in sequence by the presence of single base substitutions and/or deletions or insertions of one or more nucleotides. These two forms of the structural gene are said to vary in sequence from one another. In the context of the present invention, “viral nucleic acid” includes, but is not limited to, DNA, RNA, or DNA that has been obtained from viral RNA, such as, for example, by performing a reverse transcription reaction. Viral RNA can either be single-stranded (of positive or negative polarity) or double-stranded.

The term “virus” refers to obligate, ultramicroscopic, parasites that are incapable of autonomous replication (i.e., replication requires the use of the host cell's machinery). Viruses can survive outside of a host cell but cannot replicate.

The term “wild-type” refers to a gene or a gene product that has the characteristics of that gene or gene product when isolated from a naturally occurring source. A wild-type gene is that which is most frequently observed in a population and is thus arbitrarily designated the “normal” or “wild-type” form of the gene. In contrast, the term “modified”, “mutant” or “polymorphic” refers to a gene or gene product that displays modifications in sequence and or functional properties (i.e., altered characteristics) when compared to the wild-type gene or gene product. It is noted that naturally-occurring mutants can be isolated; these are identified by the fact that they have altered characteristics when compared to the wild-type gene or gene product.

As used herein, a “wobble base” is a variation in a codon found at the third nucleotide position of a DNA triplet. Variations in conserved regions of sequence are often found at the third nucleotide position due to redundancy in the amino acid code.

DETAILED DESCRIPTION OF EMBODIMENTS

A. Bioagent Identifying Amplicons

The present invention provides methods for detection and identification of unknown bioagents using bioagent identifying amplicons. Primers are selected to hybridize to conserved sequence regions of nucleic acids derived from a bioagent, and which bracket variable sequence regions to yield a bioagent identifying amplicon, which can be amplified and which is amenable to molecular mass determination. The molecular mass then provides a means to uniquely identify the bioagent without a requirement for prior knowledge of the possible identity of the bioagent. The molecular mass or corresponding base composition signature of the amplification product is then matched against a database of molecular masses or base composition signatures. A match is obtained when an experimentally-determined molecular mass or base composition of an analyzed amplification product is compared with known molecular masses or base compositions of known bioagent identifying amplicons and the experimentally determined molecular mass or base composition is the same as the molecular mass or base composition of one of the known bioagent identifying amplicons. Alternatively, the experimentally-determined molecular mass or base composition may be within experimental error of the molecular mass or base composition of a known bioagent identifying amplicon and still be classified as a match. In some cases, the match may also be classified using a probability of match model such as the models described in U.S. Ser. No. 11/073,362, which is commonly owned and incorporated herein by reference in entirety. Furthermore, the method can be applied to rapid parallel multiplex analyses, the results of which can be employed in a triangulation identification strategy. The present method provides rapid throughput and does not require nucleic acid sequencing of the amplified target sequence for bioagent detection and identification.

Despite enormous biological diversity, all forms of life on earth share sets of essential, common features in their genomes. Since genetic data provide the underlying basis for identification of bioagents by the methods of the present invention, it is necessary to select segments of nucleic acids which ideally provide enough variability to distinguish each individual bioagent and whose molecular mass is amenable to molecular mass determination.

Unlike bacterial genomes, which exhibit conservation of numerous genes (i.e. housekeeping genes) across all organisms, viruses do not share a gene that is essential and conserved among all virus families. Therefore, viral identification is achieved within smaller groups of related viruses, such as members of a particular virus family or genus. For example, RNA-dependent RNA polymerase is present in all single-stranded RNA viruses and can be used for broad priming as well as resolution within the virus family.

In some embodiments of the present invention, at least one bacterial nucleic acid segment is amplified in the process of identifying the bacterial bioagent. Thus, the nucleic acid segments that can be amplified by the primers disclosed herein and that provide enough variability to distinguish each individual bioagent and whose molecular masses are amenable to molecular mass determination are herein described as bioagent identifying amplicons.

In some embodiments of the present invention, bioagent identifying amplicons comprise from about 45 to about 150 nucleobases (i.e. from about 45 to about 200 linked nucleosides), although both longer and short regions may be used. One of ordinary skill in the art will appreciate that the invention embodies compounds of 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, and 150 nucleobases in length, or any range therewithin.

It is the combination of the portions of the bioagent nucleic acid segment to which the primers hybridize (hybridization sites) and the variable region between the primer hybridization sites that comprises the bioagent identifying amplicon. Thus, it can be said that a given bioagent identifying amplicon is “defined by” a given pair of primers.

In some embodiments, bioagent identifying amplicons amenable to molecular mass determination which are produced by the primers described herein are either of a length, size or mass compatible with the particular mode of molecular mass determination or compatible with a means of providing a predictable fragmentation pattern in order to obtain predictable fragments of a length compatible with the particular mode of molecular mass determination. Such means of providing a predictable fragmentation pattern of an amplification product include, but are not limited to, cleavage with chemical reagents, restriction enzymes or cleavage primers, for example. Thus, in some embodiments, bioagent identifying amplicons are larger than 150 nucleobases and are amenable to molecular mass determination following restriction digestion. Methods of using restriction enzymes and cleavage primers are well known to those with ordinary skill in the art.

In some embodiments, amplification products corresponding to bioagent identifying amplicons are obtained using the polymerase chain reaction (PCR) that is a routine method to those with ordinary skill in the molecular biology arts. Other amplification methods may be used such as ligase chain reaction (LCR), low-stringency single primer PCR, and multiple strand displacement amplification (MDA). These methods are also known to those with ordinary skill.

B. Primers and Primer Pairs

In some embodiments, the primers are designed to bind to conserved sequence regions of a bioagent identifying amplicon that flank an intervening variable region and yield amplification products which provide variability sufficient to distinguish each individual bioagent, and which are amenable to molecular mass analysis. In some embodiments, the highly conserved sequence regions exhibit between about 80-100%, or between about 90-100%, or between about 95-100% identity, or between about 99-100% identity. The molecular mass of a given amplification product provides a means of identifying the bioagent from which it was obtained, due to the variability of the variable region. Thus, design of the primers involves selection of a variable region with sufficient variability to resolve the identity of a given bioagent. In some embodiments, bioagent identifying amplicons are specific to the identity of the bioagent.

In some embodiments, identification of bioagents is accomplished at different levels using primers suited to resolution of each individual level of identification. Broad range survey primers are designed with the objective of identifying a bioagent as a member of a particular division (e.g., an order, family, genus or other such grouping of bioagents above the species level of bioagents). In some embodiments, broad range survey intelligent primers are capable of identification of bioagents at the species or sub-species level. Examples of broad range survey primers include, but are not limited to: primer pair numbers: 346 (SEQ ID NOs: 202:1110), 347 (SEQ ID NOs: 560:1278), 348 SEQ ID NOs: 706:895), and 361 (SEQ ID NOs: 697:1398) which target DNA encoding 16S rRNA, and primer pair numbers 349 (SEQ ID NOs: 401:1156) and 360 (SEQ ID NOs: 409:1434) which target DNA encoding 23S rRNA.

In some embodiments, drill-down primers are designed with the objective of identifying a bioagent at the sub-species level (including strains, subtypes, variants and isolates) based on sub-species characteristics which may, for example, include single nucleotide polymorphisms (SNPs), variable number tandem repeats (VNTRs), deletions, drug resistance mutations or any other modification of a nucleic acid sequence of a bioagent relative to other members of a species having different sub-species characteristics. Drill-down intelligent primers are not always required for identification at the sub-species level because broad range survey intelligent primers may, in some cases provide sufficient identification resolution to accomplishing this identification objective. Examples of drill-down primers include, but are not limited to: confirmation primer pairs such as primer pair numbers 351 (SEQ ID NOs: 355:1423) and 353 (SEQ ID NOs: 220:1394), which target the pX01 virulence plasmid of Bacillus anthracis. Other examples of drill-down primer pairs are found in sets of triangulation genotyping primer pairs such as, for example, the primer pair number 2146 (SEQ ID NOs: 437:1137) which targets the arcC gene (encoding carmabate kinase) and is included in an 8 primer pair panel or kit for use in genotyping Staphylococcus aureus, or in other panels or kits of primer pairs used for determining drug-resistant bacterial strains, such as, for example, primer pair number 2095 (SEQ ID NOs: 456:1261) which targets the pv-luk gene (encoding Panton-Valentine leukocidin) and is included in an 8 primer pair panel or kit for use in identification of drug resistant strains of Staphylococcus aureus.

A representative process flow diagram used for primer selection and validation process is outlined in FIG. 1. For each group of organisms, candidate target sequences are identified (200) from which nucleotide alignments are created (210) and analyzed (220). Primers are then designed by selecting appropriate priming regions (230) to facilitate the selection of candidate primer pairs (240). The primer pairs are then subjected to in silico analysis by electronic PCR (ePCR) (300) wherein bioagent identifying amplicons are obtained from sequence databases such as GenBank or other sequence collections (310) and checked for specificity in silico (320). Bioagent identifying amplicons obtained from GenBank sequences (310) can also be analyzed by a probability model which predicts the capability of a given amplicon to identify unknown bioagents such that the base compositions of amplicons with favorable probability scores are then stored in a base composition database (325). Alternatively, base compositions of the bioagent identifying amplicons obtained from the primers and GenBank sequences can be directly entered into the base composition database (330). Candidate primer pairs (240) are validated by testing their ability to hybridize to target nucleic acid by an in vitro amplification by a method such as PCR analysis (400) of nucleic acid from a collection of organisms (410). Amplification products thus obtained are analyzed by gel electrophoresis or by mass spectrometry to confirm the sensitivity, specificity and reproducibility of the primers used to obtain the amplification products (420).

Many of the important pathogens, including the organisms of greatest concern as biowarfare agents, have been completely sequenced. This effort has greatly facilitated the design of primers for the detection of unknown bioagents. The combination of broad-range priming with division-wide and drill-down priming has been used very successfully in several applications of the technology, including environmental surveillance for biowarfare threat agents and clinical sample analysis for medically important pathogens.

Synthesis of primers is well known and routine in the art. The primers may be conveniently and routinely made through the well-known technique of solid phase synthesis. Equipment for such synthesis is sold by several vendors including, for example, Applied Biosystems (Foster City, Calif.). Any other means for such synthesis known in the art may additionally or alternatively be employed.

In some embodiments primers are employed as compositions for use in methods for identification of bacterial bioagents as follows: a primer pair composition is contacted with nucleic acid (such as, for example, bacterial DNA or DNA reverse transcribed from the rRNA) of an unknown bacterial bioagent. The nucleic acid is then amplified by a nucleic acid amplification technique, such as PCR for example, to obtain an amplification product that represents a bioagent identifying amplicon. The molecular mass of each strand of the double-stranded amplification product is determined by a molecular mass measurement technique such as mass spectrometry for example, wherein the two strands of the double-stranded amplification product are separated during the ionization process. In some embodiments, the mass spectrometry is electrospray Fourier transform ion cyclotron resonance mass spectrometry (ESI-FTICR-MS) or electrospray time of flight mass spectrometry (ESI-TOF-MS). A list of possible base compositions can be generated for the molecular mass value obtained for each strand and the choice of the correct base composition from the list is facilitated by matching the base composition of one strand with a complementary base composition of the other strand. The molecular mass or base composition thus determined is then compared with a database of molecular masses or base compositions of analogous bioagent identifying amplicons for known viral bioagents. A match between the molecular mass or base composition of the amplification product and the molecular mass or base composition of an analogous bioagent identifying amplicon for a known viral bioagent indicates the identity of the unknown bioagent. In some embodiments, the primer pair used is one of the primer pairs of Table 2. In some embodiments, the method is repeated using one or more different primer pairs to resolve possible ambiguities in the identification process or to improve the confidence level for the identification assignment.

In some embodiments, a bioagent identifying amplicon may be produced using only a single primer (either the forward or reverse primer of any given primer pair), provided an appropriate amplification method is chosen, such as, for example, low stringency single primer PCR (LSSP-PCR). Adaptation of this amplification method in order to produce bioagent identifying amplicons can be accomplished by one with ordinary skill in the art without undue experimentation.

In some embodiments, the oligonucleotide primers are broad range survey primers which hybridize to conserved regions of nucleic acid encoding the hexon gene of all (or between 80% and 100%, between 85% and 100%, between 90% and 100% or between 95% and 100%) known bacteria and produce bacterial bioagent identifying amplicons.

In some cases, the molecular mass or base composition of a bacterial bioagent identifying amplicon defined by a broad range survey primer pair does not provide enough resolution to unambiguously identify a bacterial bioagent at or below the species level. These cases benefit from further analysis of one or more bacterial bioagent identifying amplicons generated from at least one additional broad range survey primer pair or from at least one additional division-wide primer pair. The employment of more than one bioagent identifying amplicon for identification of a bioagent is herein referred to as triangulation identification.

In other embodiments, the oligonucleotide primers are division-wide primers which hybridize to nucleic acid encoding genes of species within a genus of bacteria. In other embodiments, the oligonucleotide primers are drill-down primers which enable the identification of sub-species characteristics. Drill down primers provide the functionality of producing bioagent identifying amplicons for drill-down analyses such as strain typing when contacted with nucleic acid under amplification conditions. Identification of such sub-species characteristics is often critical for determining proper clinical treatment of viral infections. In some embodiments, sub-species characteristics are identified using only broad range survey primers and division-wide and drill-down primers are not used.

In some embodiments, the primers used for amplification hybridize to and amplify genomic DNA, and DNA of bacterial plasmids.

In some embodiments, various computer software programs may be used to aid in design of primers for amplification reactions such as Primer Premier 5 (Premier Biosoft, Palo Alto, Calif.) or OLIGO Primer Analysis Software (Molecular Biology Insights, Cascade, Colo.). These programs allow the user to input desired hybridization conditions such as melting temperature of a primer-template duplex for example. In some embodiments, an in silico PCR search algorithm, such as (ePCR) is used to analyze primer specificity across a plurality of template sequences which can be readily obtained from public sequence databases such as GenBank for example. An existing RNA structure search algorithm (Macke et al., Nucl. Acids Res., 2001, 29, 4724-4735, which is incorporated herein by reference in its entirety) has been modified to include PCR parameters such as hybridization conditions, mismatches, and thermodynamic calculations (SantaLucia, Proc. Natl. Acad. Sci. U.S.A., 1998, 95, 1460-1465, which is incorporated herein by reference in its entirety). This also provides information on primer specificity of the selected primer pairs. In some embodiments, the hybridization conditions applied to the algorithm can limit the results of primer specificity obtained from the algorithm. In some embodiments, the melting temperature threshold for the primer template duplex is specified to be 35° C. or a higher temperature. In some embodiments the number of acceptable mismatches is specified to be seven mismatches or less. In some embodiments, the buffer components and concentrations and primer concentrations may be specified and incorporated into the algorithm, for example, an appropriate primer concentration is about 250 nM and appropriate buffer components are 50 mM sodium or potassium and 1.5 mM Mg2+.

One with ordinary skill in the art of design of amplification primers will recognize that a given primer need not hybridize with 100% complementarity in order to effectively prime the synthesis of a complementary nucleic acid strand in an amplification reaction. Moreover, a primer may hybridize over one or more segments such that intervening or adjacent segments are not involved in the hybridization event. (e.g., for example, a loop structure or a hairpin structure). The primers of the present invention may comprise at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or at least 99% sequence identity with any of the primers listed in Table 2. Thus, in some embodiments of the present invention, an extent of variation of 70% to 100%, or any range therewithin, of the sequence identity is possible relative to the specific primer sequences disclosed herein. Determination of sequence identity is described in the following example: a primer 20 nucleobases in length which is identical to another 20 nucleobase primer having two non-identical residues has 18 of 20 identical residues (18/20=0.9 or 90% sequence identity). In another example, a primer 15 nucleobases in length having all residues identical to a 15 nucleobase segment of primer 20 nucleobases in length would have 15/20=0.75 or 75% sequence identity with the 20 nucleobase primer.

Percent homology, sequence identity or complementarity, can be determined by, for example, the Gap program (Wisconsin Sequence Analysis Package, Version 8 for UNIX, Genetics Computer Group, University Research Park, Madison Wis.), using default settings, which uses the algorithm of Smith and Waterman (Adv. Appl. Math., 1981, 2, 482-489). In some embodiments, complementarity of primers with respect to the conserved priming regions of viral nucleic acid is between about 70% and about 75% 80%. In other embodiments, homology, sequence identity or complementarity, is between about 75% and about 80%. In yet other embodiments, homology, sequence identity or complementarity, is at least 85%, at least 90%, at least 92%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or is 100%.

In some embodiments, the primers described herein comprise at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 92%, at least 94%, at least 95%, at least 96%, at least 98%, or at least 99%, or 100% (or any range therewithin) sequence identity with the primer sequences specifically disclosed herein.

One with ordinary skill is able to calculate percent sequence identity or percent sequence homology and able to determine, without undue experimentation, the effects of variation of primer sequence identity on the function of the primer in its role in priming synthesis of a complementary strand of nucleic acid for production of an amplification product of a corresponding bioagent identifying amplicon.

In one embodiment, the primers are at least 13 nucleobases in length. In another embodiment, the primers are less than 36 nucleobases in length.

In some embodiments of the present invention, the oligonucleotide primers are 13 to 35 nucleobases in length (13 to 35 linked nucleotide residues). These embodiments comprise oligonucleotide primers 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34 or 35 nucleobases in length, or any range therewithin. The present invention contemplates using both longer and shorter primers. Furthermore, the primers may also be linked to one or more other desired moieties, including, but not limited to, affinity groups, ligands, regions of nucleic acid that are not complementary to the nucleic acid to be amplified, labels, etc. Primers may also form hairpin structures. For example, hairpin primers may be used to amplify short target nucleic acid molecules. The presence of the hairpin may stabilize the amplification complex (see e.g., TAQMAN MicroRNA Assays, Applied Biosystems, Foster City, Calif.).

In some embodiments, any oligonucleotide primer pair may have one or both primers with less then 70% sequence homology with a corresponding member of any of the primer pairs of Table 2 if the primer pair has the capability of producing an amplification product corresponding to a bioagent identifying amplicon. In other embodiments, any oligonucleotide primer pair may have one or both primers with a length greater than 35 nucleobases if the primer pair has the capability of producing an amplification product corresponding to a bioagent identifying amplicon.

In some embodiments, the function of a given primer may be substituted by a combination of two or more primers segments that hybridize adjacent to each other or that are linked by a nucleic acid loop structure or linker which allows a polymerase to extend the two or more primers in an amplification reaction.

In some embodiments, the primer pairs used for obtaining bioagent identifying amplicons are the primer pairs of Table 2. In other embodiments, other combinations of primer pairs are possible by combining certain members of the forward primers with certain members of the reverse primers. An example can be seen in Table 2 for two primer pair combinations of forward primer 16S_EC789810_F (SEQ ID NO:206), with the reverse primers 16S_EC880894_R (SEQ ID NO: 796), or 16S_EC882899_R or (SEQ ID NO: 818). Arriving at a favorable alternate combination of primers in a primer pair depends upon the properties of the primer pair, most notably the size of the bioagent identifying amplicon that would be produced by the primer pair, which preferably is between about 45 to about 150 nucleobases in length. Alternatively, a bioagent identifying amplicon longer than 150 nucleobases in length could be cleaved into smaller segments by cleavage reagents such as chemical reagents, or restriction enzymes, for example.

In some embodiments, the primers are configured to amplify nucleic acid of a bioagent to produce amplification products that can be measured by mass spectrometry and from whose molecular masses candidate base compositions can be readily calculated.

In some embodiments, any given primer comprises a modification comprising the addition of a non-templated T residue to the 5′ end of the primer (i.e., the added T residue does not necessarily hybridize to the nucleic acid being amplified). The addition of a non-templated T residue has an effect of minimizing the addition of non-templated adenosine residues as a result of the non-specific enzyme activity of Taq polymerase (Magnuson et al., Biotechniques, 1996, 21, 700-709), an occurrence which may lead to ambiguous results arising from molecular mass analysis.

In some embodiments of the present invention, primers may contain one or more universal bases. Because any variation (due to codon wobble in the 3rd position) in the conserved regions among species is likely to occur in the third position of a DNA (or RNA) triplet, oligonucleotide primers can be designed such that the nucleotide corresponding to this position is a base which can bind to more than one nucleotide, referred to herein as a “universal nucleobase.” For example, under this “wobble” pairing, inosine (I) binds to U, C or A; guanine (G) binds to U or C, and uridine (U) binds to U or C. Other examples of universal nucleobases include nitroindoles such as 5-nitroindole or 3-nitropyrrole (Loakes et al., Nucleosides and Nucleotides, 1995, 14, 1001-1003), the degenerate nucleotides dP or dK (Hill et al.), an acyclic nucleoside analog containing 5-nitroindazole (Van Aerschot et al., Nucleosides and Nucleotides, 1995, 14, 1053-1056) or the purine analog 1-(2-deoxy-β-D-ribofuranosyl)-imidazole-4-carboxamide (Sala et al., Nucl. Acids Res., 1996, 24, 3302-3306).

In some embodiments, to compensate for the somewhat weaker binding by the wobble base, the oligonucleotide primers are designed such that the first and second positions of each triplet are occupied by nucleotide analogs that bind with greater affinity than the unmodified nucleotide. Examples of these analogs include, but are not limited to, 2,6-diaminopurine which binds to thymine, 5-propynyluracil (also known as propynylated thymine) which binds to adenine and 5-propynylcytosine and phenoxazines, including G-clamp, which binds to G. Propynylated pyrimidines are described in U.S. Pat. Nos. 5,645,985, 5,830,653 and 5,484,908, each of which is commonly owned and incorporated herein by reference in its entirety. Propynylated primers are described in U.S Pre-Grant Publication No. 2003-0170682, which is also commonly owned and incorporated herein by reference in its entirety. Phenoxazines are described in U.S. Pat. Nos. 5,502,177, 5,763,588, and 6,005,096, each of which is incorporated herein by reference in its entirety. G-clamps are described in U.S. Pat. Nos. 6,007,992 and 6,028,183, each of which is incorporated herein by reference in its entirety.

In some embodiments, primer hybridization is enhanced using primers containing 5-propynyl deoxy-cytidine and deoxy-thymidine nucleotides. These modified primers offer increased affinity and base pairing selectivity.

In some embodiments, non-template primer tags are used to increase the melting temperature (Tm) of a primer-template duplex in order to improve amplification efficiency. A non-template tag is at least three consecutive A or T nucleotide residues on a primer which are not complementary to the template. In any given non-template tag, A can be replaced by C or G and T can also be replaced by C or G. Although Watson-Crick hybridization is not expected to occur for a non-template tag relative to the template, the extra hydrogen bond in a G-C pair relative to an A-T pair confers increased stability of the primer-template duplex and improves amplification efficiency for subsequent cycles of amplification when the primers hybridize to strands synthesized in previous cycles.

In other embodiments, propynylated tags may be used in a manner similar to that of the non-template tag, wherein two or more 5-propynylcytidine or 5-propynyluridine residues replace template matching residues on a primer. In other embodiments, a primer contains a modified internucleoside linkage such as a phosphorothioate linkage, for example.

In some embodiments, the primers contain mass-modifying tags. Reducing the total number of possible base compositions of a nucleic acid of specific molecular weight provides a means of avoiding a persistent source of ambiguity in determination of base composition of amplification products. Addition of mass-modifying tags to certain nucleobases of a given primer will result in simplification of de novo determination of base composition of a given bioagent identifying amplicon from its molecular mass.

In some embodiments of the present invention, the mass modified nucleobase comprises one or more of the following: for example, 7-deaza-2′-deoxyadenosine-5-triphosphate, 5-iodo-2′-deoxyuridine-5′-triphosphate, 5-bromo-2′-deoxyuridine-5′-triphosphate, 5-bromo-2′-deoxycytidine-5′-triphosphate, 5-iodo-2′-deoxycytidine-5′-triphosphate, 5-hydroxy-2′-deoxyuridine-5′-triphosphate, 4-thiothymidine-5′-triphosphate, 5-aza-2′-deoxyuridine-5′-triphosphate, 5-fluoro-2′-deoxyuridine-5′-triphosphate, O6-methyl-2′-deoxyguanosine-5′-triphosphate, N2-methyl-2′-deoxyguanosine-5′-triphosphate, 8-oxo-2′-deoxyguanosine-5′-triphosphate or thiothymidine-5′-triphosphate. In some embodiments, the mass-modified nucleobase comprises 15N or 13C or both 15N and 13C.

In some embodiments, multiplex amplification is performed where multiple bioagent identifying amplicons are amplified with a plurality of primer pairs. The advantages of multiplexing are that fewer reaction containers (for example, wells of a 96- or 384-well plate) are needed for each molecular mass measurement, providing time, resource and cost savings because additional bioagent identification data can be obtained within a single analysis. Multiplex amplification methods are well known to those with ordinary skill and can be developed without undue experimentation. However, in some embodiments, one useful and non-obvious step in selecting a plurality candidate bioagent identifying amplicons for multiplex amplification is to ensure that each strand of each amplification product will be sufficiently different in molecular mass that mass spectral signals will not overlap and lead to ambiguous analysis results. In some embodiments, a 10 Da difference in mass of two strands of one or more amplification products is sufficient to avoid overlap of mass spectral peaks.

In some embodiments, as an alternative to multiplex amplification, single amplification reactions can be pooled before analysis by mass spectrometry. In these embodiments, as for multiplex amplification embodiments, it is useful to select a plurality of candidate bioagent identifying amplicons to ensure that each strand of each amplification product will be sufficiently different in molecular mass that mass spectral signals will not overlap and lead to ambiguous analysis results.

C Determination of Molecular Mass of Bioagent Identifying Amplicons

In some embodiments, the molecular mass of a given bioagent identifying amplicon is determined by mass spectrometry. Mass spectrometry has several advantages, not the least of which is high bandwidth characterized by the ability to separate (and isolate) many molecular peaks across a broad range of mass to charge ratio (m/z). Thus mass spectrometry is intrinsically a parallel detection scheme without the need for radioactive or fluorescent labels, since every amplification product is identified by its molecular mass. The current state of the art in mass spectrometry is such that less than femtomole quantities of material can be readily analyzed to afford information about the molecular contents of the sample. An accurate assessment of the molecular mass of the material can be quickly obtained, irrespective of whether the molecular weight of the sample is several hundred, or in excess of one hundred thousand atomic mass units (amu) or Daltons.

In some embodiments, intact molecular ions are generated from amplification products using one of a variety of ionization techniques to convert the sample to gas phase. These ionization methods include, but are not limited to, electrospray ionization (ES), matrix-assisted laser desorption ionization (MALDI) and fast atom bombardment (FAB). Upon ionization, several peaks are observed from one sample due to the formation of ions with different charges. Averaging the multiple readings of molecular mass obtained from a single mass spectrum affords an estimate of molecular mass of the bioagent identifying amplicon. Electrospray ionization mass spectrometry (ESI-MS) is particularly useful for very high molecular weight polymers such as proteins and nucleic acids having molecular weights greater than 10 kDa, since it yields a distribution of multiply-charged molecules of the sample without causing a significant amount of fragmentation.

The mass detectors used in the methods of the present invention include, but are not limited to, Fourier transform ion cyclotron resonance mass spectrometry (FT-ICR-MS), time of flight (TOF), ion trap, quadrupole, magnetic sector, Q-TOF, and triple quadrupole.

D. Base Compositions of Bioagent Identifying Amplicons

Although the molecular mass of amplification products obtained using intelligent primers provides a means for identification of bioagents, conversion of molecular mass data to a base composition signature is useful for certain analyses. As used herein, “base composition” is the exact number of each nucleobase (A, T, C and G) determined from the molecular mass of a bioagent identifying amplicon. In some embodiments, a base composition provides an index of a specific organism. Base compositions can be calculated from known sequences of known bioagent identifying amplicons and can be experimentally determined by measuring the molecular mass of a given bioagent identifying amplicon, followed by determination of all possible base compositions which are consistent with the measured molecular mass within acceptable experimental error. The following example illustrates determination of base composition from an experimentally obtained molecular mass of a 46-mer amplification product originating at position 1337 of the 16S rRNA of Bacillus anthracis. The forward and reverse strands of the amplification product have measured molecular masses of 14208 and 14079 Da, respectively. The possible base compositions derived from the molecular masses of the forward and reverse strands for the B. anthracis products are listed in Table 1.

TABLE 1
Possible Base Compositions for B. anthracis 46mer Amplification Product
Calc. Mass Mass Error Base Calc. Mass Mass Error Base
Forward Forward Composition of Reverse Reverse Composition of
Strand Strand Forward Strand Strand Strand Reverse Strand
14208.2935 0.079520 A1 G17 C10 T18 14079.2624 0.080600 A0 G14 C13 T19
14208.3160 0.056980 A1 G20 C15 T10 14079.2849 0.058060 A0 G17 C18 T11
14208.3386 0.034440 A1 G23 C20 T2 14079.3075 0.035520 A0 G20 C23 T3
14208.3074 0.065560 A6 G11 C3 T26 14079.2538 0.089180 A5 G5 C1 T35
14208.3300 0.043020 A6 G14 C8 T18 14079.2764 0.066640 A5 G8 C6 T27
14208.3525 0.020480 A6 G17 C13 T10 14079.2989 0.044100 A5 G11 C11 T19
14208.3751 0.002060 A6 G20 C18 T2 14079.3214 0.021560 A5 G14 C16 T11
14208.3439 0.029060 A11 G8 C1 T26 14079.3440 0.000980 A5 G17 C21 T3
14208.3665 0.006520 A11 G11 C6 T18 14079.3129 0.030140 A10 G5 C4 T27
14208.3890 0.016020 A11 G14 C11 T10 14079.3354 0.007600 A10 G8 C9 T19
14208.4116 0.038560 A11 G17 C16 T2 14079.3579 0.014940 A10 G11 C14 T11
14208.4030 0.029980 A16 G8 C4 T18 14079.3805 0.037480 A10 G14 C19 T3
14208.4255 0.052520 A16 G11 C9 T10 14079.3494 0.006360 A15 G2 C2 T27
14208.4481 0.075060 A16 G14 C14 T2 14079.3719 0.028900 A15 G5 C7 T19
14208.4395 0.066480 A21 G5 C2 T18 14079.3944 0.051440 A15 G8 C12 T11
14208.4620 0.089020 A21 G8 C7 T10 14079.4170 0.073980 A15 G11 C17 T3
14079.4084 0.065400 A20 G2 C5 T19
14079.4309 0.087940 A20 G5 C10 T13

Among the 16 possible base compositions for the forward strand and the 18 possible base compositions for the reverse strand that were calculated, only one pair (shown in bold) are complementary base compositions, which indicates the true base composition of the amplification product. It should be recognized that this logic is applicable for determination of base compositions of any bioagent identifying amplicon, regardless of the class of bioagent from which the corresponding amplification product was obtained.

In some embodiments, assignment of previously unobserved base compositions (also known as “true unknown base compositions”) to a given phylogeny can be accomplished via the use of pattern classifier model algorithms. Base compositions, like sequences, vary slightly from strain to strain within species, for example. In some embodiments, the pattern classifier model is the mutational probability model. On other embodiments, the pattern classifier is the polytope model. The mutational probability model and polytope model are both commonly owned and described in U.S. patent application Ser. No. 11/073,362 which is incorporated herein by reference in entirety.

In one embodiment, it is possible to manage this diversity by building “base composition probability clouds” around the composition constraints for each species. This permits identification of organisms in a fashion similar to sequence analysis. A “pseudo four-dimensional plot” can be used to visualize the concept of base composition probability clouds. Optimal primer design requires optimal choice of bioagent identifying amplicons and maximizes the separation between the base composition signatures of individual bioagents. Areas where clouds overlap indicate regions that may result in a misclassification, a problem which is overcome by a triangulation identification process using bioagent identifying amplicons not affected by overlap of base composition probability clouds.

In some embodiments, base composition probability clouds provide the means for screening potential primer pairs in order to avoid potential misclassifications of base compositions. In other embodiments, base composition probability clouds provide the means for predicting the identity of a bioagent whose assigned base composition was not previously observed and/or indexed in a bioagent identifying amplicon base composition database due to evolutionary transitions in its nucleic acid sequence. Thus, in contrast to probe-based techniques, mass spectrometry determination of base composition does not require prior knowledge of the composition or sequence in order to make the measurement.

The present invention provides bioagent classifying information similar to DNA sequencing and phylogenetic analysis at a level sufficient to identify a given bioagent. Furthermore, the process of determination of a previously unknown base composition for a given bioagent (for example, in a case where sequence information is unavailable) has downstream utility by providing additional bioagent indexing information with which to populate base composition databases. The process of future bioagent identification is thus greatly improved as more BCS indexes become available in base composition databases.

E. Triangulation Identification

In some cases, a molecular mass of a single bioagent identifying amplicon alone does not provide enough resolution to unambiguously identify a given bioagent. The employment of more than one bioagent identifying amplicon for identification of a bioagent is herein referred to as “triangulation identification.” Triangulation identification is pursued by determining the molecular masses of a plurality of bioagent identifying amplicons selected within a plurality of housekeeping genes. This process is used to reduce false negative and false positive signals, and enable reconstruction of the origin of hybrid or otherwise engineered bioagents. For example, identification of the three part toxin genes typical of B. anthracis (Bowen et al., J. Appl. Microbiol., 1999, 87, 270-278) in the absence of the expected signatures from the B. anthracis genome would suggest a genetic engineering event.

In some embodiments, the triangulation identification process can be pursued by characterization of bioagent identifying amplicons in a massively parallel fashion using the polymerase chain reaction (PCR), such as multiplex PCR where multiple primers are employed in the same amplification reaction mixture, or PCR in multi-well plate format wherein a different and unique pair of primers is used in multiple wells containing otherwise identical reaction mixtures. Such multiplex and multi-well PCR methods are well known to those with ordinary skill in the arts of rapid throughput amplification of nucleic acids. In other related embodiments, one PCR reaction per well or container may be carried out, followed by an amplicon pooling step wherein the amplification products of different wells are combined in a single well or container which is then subjected to molecular mass analysis. The combination of pooled amplicons can be chosen such that the expected ranges of molecular masses of individual amplicons are not overlapping and thus will not complicate identification of signals.

F. Codon Base Composition Analysis

In some embodiments of the present invention, one or more nucleotide substitutions within a codon of a gene of an infectious organism confer drug resistance upon an organism which can be determined by codon base composition analysis. The organism can be a bacterium, virus, fungus or protozoan.

In some embodiments, the amplification product containing the codon being analyzed is of a length of about 35 to about 200 nucleobases. The primers employed in obtaining the amplification product can hybridize to upstream and downstream sequences directly adjacent to the codon, or can hybridize to upstream and downstream sequences one or more sequence positions away from the codon. The primers may have between about 70% to 100% sequence complementarity with the sequence of the gene containing the codon being analyzed.

In some embodiments, the codon base composition analysis is undertaken

In some embodiments, the codon analysis is undertaken for the purpose of investigating genetic disease in an individual. In other embodiments, the codon analysis is undertaken for the purpose of investigating a drug resistance mutation or any other deleterious mutation in an infectious organism such as a bacterium, virus, fungus or protozoan. In some embodiments, the bioagent is a bacterium identified in a biological product.

In some embodiments, the molecular mass of an amplification product containing the codon being analyzed is measured by mass spectrometry. The mass spectrometry can be either electrospray (ESI) mass spectrometry or matrix-assisted laser desorption ionization (MALDI) mass spectrometry. Time-of-flight (TOF) is an example of one mode of mass spectrometry compatible with the analyses of the present invention.

The methods of the present invention can also be employed to determine the relative abundance of drug resistant strains of the organism being analyzed. Relative abundances can be calculated from amplitudes of mass spectral signals with relation to internal calibrants. In some embodiments, known quantities of internal amplification calibrants can be included in the amplification reactions and abundances of analyte amplification product estimated in relation to the known quantities of the calibrants.

In some embodiments, upon identification of one or more drug-resistant strains of an infectious organism infecting an individual, one or more alternative treatments can be devised to treat the individual.

G. Determination of the Quantity of a Bioagent

In some embodiments, the identity and quantity of an unknown bioagent can be determined using the process illustrated in FIG. 2. Primers (500) and a known quantity of a calibration polynucleotide (505) are added to a sample containing nucleic acid of an unknown bioagent. The total nucleic acid in the sample is then subjected to an amplification reaction (510) to obtain amplification products. The molecular masses of amplification products are determined (515) from which are obtained molecular mass and abundance data. The molecular mass of the bioagent identifying amplicon (520) provides the means for its identification (525) and the molecular mass of the calibration amplicon obtained from the calibration polynucleotide (530) provides the means for its identification (535). The abundance data of the bioagent identifying amplicon is recorded (540) and the abundance data for the calibration data is recorded (545), both of which are used in a calculation (550) which determines the quantity of unknown bioagent in the sample.

A sample comprising an unknown bioagent is contacted with a pair of primers that provide the means for amplification of nucleic acid from the bioagent, and a known quantity of a polynucleotide that comprises a calibration sequence. The nucleic acids of the bioagent and of the calibration sequence are amplified and the rate of amplification is reasonably assumed to be similar for the nucleic acid of the bioagent and of the calibration sequence. The amplification reaction then produces two amplification products: a bioagent identifying amplicon and a calibration amplicon. The bioagent identifying amplicon and the calibration amplicon should be distinguishable by molecular mass while being amplified at essentially the same rate. Effecting differential molecular masses can be accomplished by choosing as a calibration sequence, a representative bioagent identifying amplicon (from a specific species of bioagent) and performing, for example, a 2-8 nucleobase deletion or insertion within the variable region between the two priming sites. The amplified sample containing the bioagent identifying amplicon and the calibration amplicon is then subjected to molecular mass analysis by mass spectrometry, for example. The resulting molecular mass analysis of the nucleic acid of the bioagent and of the calibration sequence provides molecular mass data and abundance data for the nucleic acid of the bioagent and of the calibration sequence. The molecular mass data obtained for the nucleic acid of the bioagent enables identification of the unknown bioagent and the abundance data enables calculation of the quantity of the bioagent, based on the knowledge of the quantity of calibration polynucleotide contacted with the sample.

In some embodiments, construction of a standard curve where the amount of calibration polynucleotide spiked into the sample is varied provides additional resolution and improved confidence for the determination of the quantity of bioagent in the sample. The use of standard curves for analytical determination of molecular quantities is well known to one with ordinary skill and can be performed without undue experimentation.

In some embodiments, multiplex amplification is performed where multiple bioagent identifying amplicons are amplified with multiple primer pairs which also amplify the corresponding standard calibration sequences. In this or other embodiments, the standard calibration sequences are optionally included within a single vector which functions as the calibration polynucleotide. Multiplex amplification methods are well known to those with ordinary skill and can be performed without undue experimentation.

In some embodiments, the calibrant polynucleotide is used as an internal positive control to confirm that amplification conditions and subsequent analysis steps are successful in producing a measurable amplicon. Even in the absence of copies of the genome of a bioagent, the calibration polynucleotide should give rise to a calibration amplicon. Failure to produce a measurable calibration amplicon indicates a failure of amplification or subsequent analysis step such as amplicon purification or molecular mass determination. Reaching a conclusion that such failures have occurred is in itself, a useful event.

In some embodiments, the calibration sequence is comprised of DNA. In some embodiments, the calibration sequence is comprised of RNA.

In some embodiments, the calibration sequence is inserted into a vector that itself functions as the calibration polynucleotide. In some embodiments, more than one calibration sequence is inserted into the vector that functions as the calibration polynucleotide. Such a calibration polynucleotide is herein termed a “combination calibration polynucleotide.” The process of inserting polynucleotides into vectors is routine to those skilled in the art and can be accomplished without undue experimentation. Thus, it should be recognized that the calibration method should not be limited to the embodiments described herein. The calibration method can be applied for determination of the quantity of any bioagent identifying amplicon when an appropriate standard calibrant polynucleotide sequence is designed and used. The process of choosing an appropriate vector for insertion of a calibrant is also a routine operation that can be accomplished by one with ordinary skill without undue experimentation.

H. Identification of Bacteria

In other embodiments of the present invention, the primer pairs produce bioagent identifying amplicons within stable and highly conserved regions of bacteria. The advantage to characterization of an amplicon defined by priming regions that fall within a highly conserved region is that there is a low probability that the region will evolve past the point of primer recognition, in which case, the primer hybridization of the amplification step would fail. Such a primer set is thus useful as a broad range survey-type primer. In another embodiment of the present invention, the intelligent primers produce bioagent identifying amplicons including a region which evolves more quickly than the stable region described above. The advantage of characterization bioagent identifying amplicon corresponding to an evolving genomic region is that it is useful for distinguishing emerging strain variants or the presence of virulence genes, drug resistance genes, or codon mutations that induce drug resistance.

The present invention also has significant advantages as a platform for identification of diseases caused by emerging bacterial strains such as, for example, drug-resistant strains of Staphylococcus aureus. The present invention eliminates the need for prior knowledge of bioagent sequence to generate hybridization probes. This is possible because the methods are not confounded by naturally occurring evolutionary variations occurring in the sequence acting as the template for production of the bioagent identifying amplicon. Measurement of molecular mass and determination of base composition is accomplished in an unbiased manner without sequence prejudice.

Another embodiment of the present invention also provides a means of tracking the spread of a bacterium, such as a particular drug-resistant strain when a plurality of samples obtained from different locations are analyzed by the methods described above in an epidemiological setting. In one embodiment, a plurality of samples from a plurality of different locations is analyzed with primer pairs which produce bioagent identifying amplicons, a subset of which contains a specific drug-resistant bacterial strain. The corresponding locations of the members of the drug-resistant strain subset indicate the spread of the specific drug-resistant strain to the corresponding locations.

I. Kits

The present invention also provides kits for carrying out the methods described herein. In some embodiments, the kit may comprise a sufficient quantity of one or more primer pairs to perform an amplification reaction on a target polynucleotide from a bioagent to form a bioagent identifying amplicon. In some embodiments, the kit may comprise from one to fifty primer pairs, from one to twenty primer pairs, from one to ten primer pairs, or from two to five primer pairs. In some embodiments, the kit may comprise one or more primer pairs recited in Table 2.

In some embodiments, the kit comprises one or more broad range survey primer(s), division wide primer(s), or drill-down primer(s), or any combination thereof. If a given problem involves identification of a specific bioagent, the solution to the problem may require the selection of a particular combination of primers to provide the solution to the problem. A kit may be designed so as to comprise particular primer pairs for identification of a particular bioagent. A drill-down kit may be used, for example, to distinguish different genotypes or strains, drug-resistant, or otherwise. In some embodiments, the primer pair components of any of these kits may be additionally combined to comprise additional combinations of broad range survey primers and division-wide primers so as to be able to identify a bacterium.

In some embodiments, the kit contains standardized calibration polynucleotides for use as internal amplification calibrants. Internal calibrants are described in commonly owned U.S. Patent Application Ser. No. 60/545,425 which is incorporated herein by reference in its entirety.

In some embodiments, the kit comprises a sufficient quantity of reverse transcriptase (if RNA is to be analyzed for example), a DNA polymerase, suitable nucleoside triphosphates (including alternative dNTPs such as inosine or modified dNTPs such as the 5-propynyl pyrimidines or any dNTP containing molecular mass-modifying tags such as those described above), a DNA ligase, and/or reaction buffer, or any combination thereof, for the amplification processes described above. A kit may further include instructions pertinent for the particular embodiment of the kit, such instructions describing the primer pairs and amplification conditions for operation of the method. A kit may also comprise amplification reaction containers such as microcentrifuge tubes and the like. A kit may also comprise reagents or other materials for isolating bioagent nucleic acid or bioagent identifying amplicons from amplification, including, for example, detergents, solvents, or ion exchange resins which may be linked to magnetic beads. A kit may also comprise a table of measured or calculated molecular masses and/or base compositions of bioagents using the primer pairs of the kit.

Some embodiments are kits that contain one or more survey bacterial primer pairs represented by primer pair compositions wherein each member of each pair of primers has 70% to 100% sequence identity with the corresponding member from the group of primer pairs represented by any of the primer pairs of Table 5. The survey primer pairs may include broad range primer pairs which hybridize to ribosomal RNA, and may also include division-wide primer pairs which hybridize to housekeeping genes such as rplB, tufB, rpoB, rpoC, valS, and infB, for example.

In some embodiments, a kit may contain one or more survey bacterial primer pairs and one or more triangulation genotyping analysis primer pairs such as the primer pairs of Tables 8, 12, 14, 19, 21, 23, or 24. In some embodiments, the kit may represent a less expansive genotyping analysis but include triangulation genotyping analysis primer pairs for more than one genus or species of bacteria. For example, a kit for surveying nosocomial infections at a health care facility may include, for example, one or more broad range survey primer pairs, one or more division wide primer pairs, one or more Acinetobacter baumannii triangulation genotyping analysis primer pairs and one or more Staphylococcus aureus triangulation genotyping analysis primer pairs. One with ordinary skill will be capable of analyzing in silico amplification data to determine which primer pairs will be able to provide optimal identification resolution for the bacterial bioagents of interest.

In some embodiments, a kit may be assembled for identification of strains of bacteria involved in contamination of food. An example of such a kit embodiment is a kit comprising one or more bacterial survey primer pairs of Table 5 with one or more triangulation genotyping analysis primer pairs of Table 12 which provide strain resolving capabilities for identification of specific strains of Campylobacter jejuni.

Some embodiments of the kits are 96-well or 384-well plates with a plurality of wells containing any or all of the following components: dNTPs, buffer salts, Mg2+, betaine, and primer pairs. In some embodiments, a polymerase is also included in the plurality of wells of the 96-well or 384-well plates.

Some embodiments of the kit contain instructions for PCR and mass spectrometry analysis of amplification products obtained using the primer pairs of the kits.

Some embodiments of the kit include a barcode which uniquely identifies the kit and the components contained therein according to production lots and may also include any other information relative to the components such as concentrations, storage temperatures, etc. The barcode may also include analysis information to be read by optical barcode readers and sent to a computer controlling amplification, purification and mass spectrometric measurements. In some embodiments, the barcode provides access to a subset of base compositions in a base composition database which is in digital communication with base composition analysis software such that a base composition measured with primer pairs from a given kit can be compared with known base compositions of bioagent identifying amplicons defined by the primer pairs of that kit.

In some embodiments, the kit contains a database of base compositions of bioagent identifying amplicons defined by the primer pairs of the kit. The database is stored on a convenient computer readable medium such as a compact disk or USB drive, for example.

In some embodiments, the kit includes a computer program stored on a computer formatted medium (such as a compact disk or portable USB disk drive, for example) comprising instructions which direct a processor to analyze data obtained from the use of the primer pairs of the present invention. The instructions of the software transform data related to amplification products into a molecular mass or base composition which is a useful concrete and tangible result used in identification and/or classification of bioagents. In some embodiments, the kits of the present invention contain all of the reagents sufficient to carry out one or more of the methods described herein.

While the present invention has been described with specificity in accordance with certain of its embodiments, the following examples serve only to illustrate the invention and are not intended to limit the same. In order that the invention disclosed herein may be more efficiently understood, examples are provided below. It should be understood that these examples are for illustrative purposes only and are not to be construed as limiting the invention in any manner.

EXAMPLES Example 1 Design and Validation of Primers that Define Bioagent Identifying Amplicons for Identification of Bacteria

For design of primers that define bacterial bioagent identifying amplicons, a series of bacterial genome segment sequences were obtained, aligned and scanned for regions where pairs of PCR primers would amplify products of about 45 to about 150 nucleotides in length and distinguish subgroups and/or individual strains from each other by their molecular masses or base compositions. A typical process shown in FIG. 1 is employed for this type of analysis.

A database of expected base compositions for each primer region was generated using an in silico PCR search algorithm, such as (ePCR). An existing RNA structure search algorithm (Macke et al., Nucl. Acids Res., 2001, 29, 4724-4735, which is incorporated herein by reference in its entirety) has been modified to include PCR parameters such as hybridization conditions, mismatches, and thermodynamic calculations (SantaLucia, Proc. Natl. Acad. Sci. U.S.A., 1998, 95, 1460-1465, which is incorporated herein by reference in its entirety). This also provides information on primer specificity of the selected primer pairs.

Table 2 represents a collection of primers (sorted by primer pair number) designed to identify bacteria using the methods described herein. The primer pair number is an in-house database index number. Primer sites were identified on segments of genes, such as, for example, the 16S rRNA gene. The forward or reverse primer name shown in Table 2 indicates the gene region of the bacterial genome to which the primer hybridizes relative to a reference sequence. In Table 2, for example, the forward primer name 16S_EC10771106_F indicates that the forward primer (_F) hybridizes to residues 1077-1106 of the reference sequence represented by a sequence extraction of coordinates 4033120 . . . 4034661 from GenBank gi number 16127994 (as indicated in Table 3). As an additional example: the forward primer name BONTA_X52066450473 indicates that the primer hybridizes to residues 450-437 of the gene encoding Clostridium botulinum neurotoxin type A (BoNT/A) represented by GenBank Accession No. X52066 (primer pair name codes appearing in Table 2 are defined in Table 3. One with ordinary skill knows how to obtain individual gene sequences or portions thereof from genomic sequences present in GenBank. In Table 2, Tp=5-propynyluracil; Cp=5-propynylcytosine; *=phosphorothioate linkage; I=inosine. T. GenBank Accession Numbers for reference sequences of bacteria are shown in Table 3 (below). In some cases, the reference sequences are extractions from bacterial genomic sequences or complements thereof.

TABLE 2
Primer Pairs for Identification of Bacteria
Primer Forward Forward Reverse Reverse
Pair Primer Forward SEQ ID Primer Reverse SEQ ID
Number Name Sequence NO: Name Sequence NO:
1 16S_EC_1077_1106_F GTGAGATGTTGGGTTAA 134 16S_EC_1175_1195_R GACGTCATCCCCACCTT 809
GTCCCGTAACGAG CCTC
2 16S_EC_1082_1106_F ATGTTGGGTTAAGTCCC 38 16S_EC_1175_1197_R TTGACGTCATCCCCACC 1398
GCAACGAG TTCCTC
3 16S_EC_1090_1111_F TTAAGTCCCGCAACGAT 651 16S_EC_1175_1196_R TGACGTCATCCCCACCT 1159
CGCAA TCCTC
4 16S_EC_1222_1241_F GCTACACACGTGCTACA 114 16S_EC_1303_1323_R CGAGTTGCAGACTGCGA 787
ATG TCCG
5 16S_EC_1332_1353_F AAGTCGGAATCGCTAGT 10 16S_EC_1389_1407_R GACGGGCGGTGTGTACA 806
AATCG AG
6 16S_EC_30_54_F TGAACGCTGGTGGCATG 429 16S_EC_105_126_R TACGCATTACTCACCCG 897
CTTAACAC TCCGC
7 16S_EC_38_64_F GTGGCATGCCTAATACA 136 16S_EC_101_120_R TTACTCACCCGTCCGCC 1365
TGCAAGTCG GCT
8 16S_EC_49_68_F TAACACATGCAAGTCGA 152 16S_EC_104_120_R TTACTCACCCGTCCGCC 1364
ACG
9 16S_EC_683_700_F GTGTAGCGGTGAAATGC 137 16S_EC_774_795_R GTATCTAATCCTGTTTG 839
G CTCCC
10 16S_EC_713_732_F AGAACACCGATGGCGAA 21 16S_EC_789_809_R CGTGGACTACCAGGGTA 798
GGC TCTA
11 16S_EC_785_806_F GGATTAGAGACCCTGGT 118 16S_EC_880_897_R GGCCGTACTCCCCAGGC 830
AGTCC G
12 16S_EC_785_810_F GGATTAGATACCCTGGT 119 16S_EC_880_897_2_R GGCCGTACTCCCCAGGC 830
AGTCCACGC G
13 16S_EC_789_810_F TAGATACCCTGGTAGTC 206 16S_EC_880_894_R CGTACTCCCCAGGCG 796
CACGC
14 16S_EC_960_981_F TTCGATGCAACGCGAAG 672 16S_EC_1054_1073_R ACGAGCTGACGACAGCC 735
AACCT ATG
15 16S_EC_969_985_F ACGCGAAGAACCTTACC 19 16S_EC_1061_1078_R ACGACACGAGCTGACGA 734
C
16 23S_EC_1826_1843_F CTGACACCTGCCCGGTG 80 23S_EC_1906_1924_R GACCGTTATAGTTACGG 805
C CC
17 23S_EC_2645_2669_F TCTGTCCCTAGTACGAG 408 23S_EC_2744_2761_R TGCTTAGATGCTTTCAG 1252
AGGACCGG C
18 23S_EC_2645_2669_ CTGTCCCTAGTACGAGA 83 23S_EC_2751_2767_R GTTTCATGCTTAGATGC 846
2_F GGACCGG TTTCAGC
19 23S_EC_493_518_F GGGGAGTGAAAGAGATC 125 23S_EC_551_571_R ACAAAAGGTACGCCGTC 717
CTGAAACCG ACCC
20 23S_EC_493_518_2_F GGGGAGTGAAAGAGATC 125 23S_EC_551_571_2_R ACAAAAGGCACGCCATC 716
CTGAAACCG ACCC
21 23S_EC_971_992_F CGAGAGGGAAACAACCC 66 23S_EC_1059_1077_R TGGCTGCTTCTAAGCCA 1282
AGACC AC
22 CAPC_BA_104_131_F GTTATTTAGCACTCGTT 139 CAPC_BA_180_205_R TGAATCTTGAAACACCA 1150
TTTAATCAGCC TACGTAACG
23 CAPC_BA_114_133_F ACTCGTTTTTAATCAGC 20 CAPC_BA_185_205_R TGAATCTTGAAACACCA 1149
CCG TACG
24 CAPC_BA_274_303_F GATTATTGTTATCCTGT 109 CAPC_BA_349_376_R GTAACCCTTGTCTTTGA 837
TATGCCATTTGAG ATTGTATTTGC
25 CAPC_BA_276_296_F TTATTGTTATCCTGTTA 663 CAPC_BA_358_377_R GGTAACCCTTGTCTTTG 834
TGCC AAT
26 CAPC_BA_281_301_F GTTATCCTGTTATGCCA 138 CAPC_BA_361_378_R TGGTAACCCTTGTCTTT 1298
TTTG G
27 CAPC_BA_315_334_F CCGTGGTATTGGAGTTA 59 CAPC_BA_361_378_R TGGTAACCCTTGTCTTT 1298
TTG G
28 CYA_BA_1055_1072_F GAAAGAGTTCGGATTGG 92 CYA_BA_1112_1130_R TGTTGACCATGCTTCTT 1352
G AG
29 CYA_BA_1349_1370_F ACAACGAAGTACAATAC 12 CYA_BA_1447_1426_R CTTCTACATTTTTAGCC 800
AAGAC ATCAC
30 CYA_BA_1353_1379_F CGAAGTACAATACAAGA 64 CYA_BA_1448_1467_R TGTTAACGGCTTCAAGA 1342
CAAAAGAAGG CCC
31 CYA_BA_1359_1379_F ACAATACAAGACAAAAG 13 CYA_BA_1447_1461_R CGGCTTCAAGACCCC 794
AAGG
32 CYA_BA_914_937_F CAGGTTTAGTACCAGAA 53 CYA_BA_999_1026_R ACCACTTTTAATAAGGT 728
CATGCAG TTGTAGCTAAC
33 CYA_BA_916_935_F GGTTTAGTACCAGAACA 131 CYA_BA_1003_1025_R CCACTTTTAATAAGGTT 768
TGC TGTAGC
34 INFB_EC_1365_1393_ TGCTCGTGGTGCACAAG 524 INFB_EC_1439_1467_R TGCTGCTTTCGCATGGT 1248
F TAACGGATATTA TAATTGCTTCAA
35 LEF_BA_1033_1052_F TCAAGAAGAAAAAGAGC 254 LEF_BA_1119_1135_R GAATATCAATTTGTAGC 803
36 LEF_BA_1036_1066_F CAAGAAGAAAAAGAGCT 44 LEF_BA_1119_1149_R AGATAAAGAATCACGAA 745
TCTAAAAAGAATAC TATCAATTTGTAGC
37 LEF_BA_756_781_F AGCTTTTGCATATTATA 26 LEF_BA_843_872_R TCTTCCAAGGATAGATT 1135
TCGAGCCAC TATTTCTTGTTCG
38 LEF_BA_758_778_F CTTTTGCATATTATATC 90 LEF_BA_843_865_R AGGATAGATTTATTTCT 748
GAGC TGTTCG
39 LEF_BA_795_813_F TTTACAGCTTTATGCAC 700 LEF_BA_883_900_R TCTTGACAGCATCCGTT 1140
CG G
40 LEF_BA_883_899_F CAACGGATGCTGGCAAG 43 LEF_BA_939_958_R CAGATAAAGAATCGCTC 762
CAG
41 PAG_BA_122_142_F CAGAATCAAGTTCCCAG 49 PAG_BA_190_209_R CCTGTAGTAGAAGAGGT 781
GGG AAC
42 PAG_BA_123_145_F AGAATCAAGTTCCCAGG 22 PAG_BA_187_210_R CCCTGTAGTAGAAGAGG 774
GGTTAC TAACCAC
43 PAG_BA_269_287_F AATCTGCTATTTGGTCA 11 PAG_BA_326_344_R TGATTATCAGCGGAAGT 1186
GG AG
44 PAG_BA_655_675_F GAAGGATATACGGTTGA 93 PAG_BA_755_772_R CCGTGCTCCATTTTTCA 778
TGTC G
45 PAG_BA_753_772_F TCCTGAAAAATGGAGCA 341 PAG_BA_849_868_R TCGGATAAGCTGCCACA 1089
CGG AGG
46 PAG_BA_763_781_F TGGAGCACGGCTTCTGA 552 PAG_BA_849_868_R TCGGATAAGCTGCCACA 1089
TC AGG
47 RPOC_EC_1018_1045_ CAAAACTTATTAGGTAA 39 RPOC_EC_1095_1124_R TCAAGCGCCATTTCTTT 959
F GCGTGTTGACT TGGTAAACCACAT
48 RPOC_EC_1018_1045_ CAAAACTTATTAGGTAA 39 RPOC_EC_1095_1124_2_R TCAAGCGCCATCTCTTT 958
F GCGTGTTGACT CGGTAATCCACAT
49 RPOC_EC_114_140_F TAAGAAGCCGGAAACCA 158 RPOC_EC_213_232_R GGCGCTTGTACTTACCG 831
TCAACTACCG CAC
50 RPOC_EC_2178_2196_ TGATTCTGGTGCCCGTG 478 RPOC_EC_2225_2246_R TTGGCCATCAGGCCACG 1414
F GT CATAC
51 RPOC_EC_2178_2196_ TGATTCCGGTGCCCGTG 477 RPOC_EC_2225_2246_2_R TTGGCCATCAGACCACG 1413
2_F GT CATAC
52 RPOC_EC_2218_2241_ CTGGCAGGTATGCGTGG 81 RPOC_EC_2313_2337_R CGCACCGTGGGTTGAGA 790
F TCTGATG TGAAGTAC
53 RPOC_EC_2218_2241_ CTTGCTGGTATGCGTGG 86 RPOC_EC_2313_2337_2_R CGCACCATGCGTAGAGA 789
2_F TCTGATG TGAAGTAC
54 RPOC_EC_808_833_F CGTCGGGTGATTAACCG 75 RPOC_EC_865_889_R GTTTTTCGTTGCGTACG 847
TAACAACCG ATGATGTC
55 RPOC_EC_808_833_2_ CGTCGTGTAATTAACCG 76 RPOC_EC_865_891_R ACGTTTTTCGTTTTGAA 741
F TAACAACCG CGATAATGCT
56 RPOC_EC_993_1019_F CAAAGGTAAGCAAGGTC 41 RPOC_EC_1036_1059_R CGAACGGCCTGAGTAGT 785
GTTTCCGTCA CAACACG
57 RPOC_EC_993_1019_ CAAAGGTAAGCAAGGAC 40 RPOC_EC_1036_1059_2_R CGAACGGCCAGAGTAGT 784
2_F GTTTCCGTCA CAACACG
58 SSPE_BA_115_137_F CAAGCAAACGCACAATC 45 SSPE_BA_197_222_R TGCACGTCTGTTTCAGT 1201
AGAAGC TGCAAATTC
59 TUFB_EC_239_259_F TAGACTGCCCAGGACAC 204 TUFB_EC_283_303_R GCCGTCCATCTGAGCAG 815
GCTG CACC
60 TUFB_EC_239_259_2_ TTGACTGCCCAGGTCAC 678 TUFB_EC_283_303_2_R GCCGTCCATTTGAGCAG 816
F GCTG CACC
61 TUFB_EC_976_1000_F AACTACCGTCCGCAGTT 4 TUFB_EC_1045_1068_R GTTGTCGCCAGGCATAA 845
CTACTTCC CCATTTC
62 TUFB_EC_976_1000_ AACTACCGTCCTCAGTT 5 TUFB_EC_1045_1068_2_R GTTGTCACCAGGCATTA 844
2_F CTACTTCC CCATTTC
63 TUFB_EC_985_1012_F CCACAGTTCTACTTCCG 56 TUFB_EC_1033_1062_R TCCAGGCATTACCATTT 1006
TACTACTGACG CTACTCCTTCTGG
66 RPLB_EC_650_679_F GACCTACAGTAAGAGGT 98 RPLB_EC_739_762_R TCCAAGTGCTGGTTTAC 999
TCTGTAATGAACC CCCATGG
67 RPLB_EC_688_710_F CATCCACACGGTGGTGG 54 RPLB_EC_736_757_R GTGCTGGTTTACCCCAT 842
TGAAGG GGAGT
68 RPOC_EC_1036_1060_ CGTGTTGACTATTCGGG 78 RPOC_EC_1097_1126_R ATTCAAGAGCCATTTCT 754
F GCGTTCAG TTTGGTAAACCAC
69 RPOB_EC_3762_3790_ TCAACAACCTCTTGGAG 248 RPOB_EC_3836_3865_R TTTCTTGAAGAGTATGA 1435
F GTAAAGCTCAGT GCTGCTCCGTAAG
70 RPLB_EC_688_710_F CATCCACACGGTGGTGG 54 RPLB_EC_743_771_R TGTTTTGTATCCAAGTG 1356
TGAAGG CTGGTTTACCCC
71 VALS_EC_1105_1124_ CGTGGCGGCGTGGTTAT 77 VALS_EC_1195_1218_R CGGTACGAACTGGATGT 795
F CGA CGCCGTT
72 RPOB_EC_1845_1866_ TATCGCTCAGGCGAACT 233 RPOB_EC_1909_1929_R GCTGGATTCGCCTTTGC 825
F CCAAC TACG
73 RPLB_EC_669_698_F TGTAATGAACCCTAATG 623 RPLB_EC_735_761_R CCAAGTGCTGGTTTACC 767
ACCATCCACACGG CCATGGAGTA
74 RPLB_EC_671_700_F TAATGAACCCTAATGAC 169 RPLB_EC_737_762_R TCCAAGTGCTGGTTTAC 1000
CATCCACACGGTG CCCATGGAG
75 SP101_SPET11_1_29_ AACCTTAATTGGAAAGA 2 SP101_SPET11_92_116_R CCTACCCAACGTTCACC 779
F AACCCAAGAAGT AAGGGCAG
76 SP101_SPET11_118_ GCTGGTGAAAATAACCC 115 SP101_SPET11_213_238_R TGTGGCCGATTTCACCA 1340
147_F AGATGTCGTCTTC CCTGCTCCT
77 SP101_SPET11_216_ AGCAGGTGGTGAAATCG 24 SP101_SPET11_308_333_R TGCCACTTTGACAACTC 1209
243_F GCCACATGATT CTGTTGCTG
78 SP101_SPET11_266_ CTTGTACTTGTGGCTCA 89 SP101_SPET11_355_380_R GCTGCTTTGATGGCTGA 824
295_F CACGGCTGTTTGG ATCCCCTTC
79 SP101_SPET11_322_ GTCAAAGTGGCACGTTT 132 SP101_SPET11_423_441_R ATCCCCTGCTTCTGCTG 753
344_F ACTGGC CC
80 SP101_SPET11_358_ GGGGATTCAGCCATCAA 126 SP101_SPET11_448_473_R CCAACCTTTTCCACAAC 766
387_F AGCAGCTATTGAC AGAATCAGC
81 SP101_SPET11_600_ CCTTACTTCGAACTATG 62 SP101_SPET11_686_714_R CCCATTTTTTCACGCAT 772
629_F AATCTTTTGGAAG GCTGAAAATATC
82 SP101_SPET11_658_ GGGGATTGATATCACCG 127 SP101_SPET11_756_784_R GATTGGCGATAAAGTGA 813
684_F ATAAGAAGAA TATTTTCTAAAA
83 SP101_SPET11_776_ TCGCCAATCAAAACTAA 364 SP101_SPET11_871_896_R GCCCACCAGAAAGACTA 814
801_F GGGAATGGC GCAGGATAA
84 SP101_SPET11_893_ GGGCAACAGCAGCGGAT 123 SP101_SPET11_988_1012_R CATGACAGCCAAGACCT 763
921_F TGCGATTGCGCG CACCCACC
85 SP101_SPET11_1154_ CAATACCGCAACAGCGG 47 SP101_SPET11_1251_1277_R GACCCCAACCTGGCCTT 804
1179_F TGGCTTGGG TTGTCGTTGA
86 SP101_SPET11_1314_ CGCAAAAAAATCCAGCT 68 SP101_SPET11_1403_1431_R AAACTATTTTTTTAGCT 711
1336_F ATTAGC ATACTCGAACAC
87 SP101_SPET11_1408_ CGAGTATAGCTAAAAAA 67 SP101_SPET11_1486_1515_R GGATAATTGGTCGTAAC 828
1437_F ATAGTTTATGACA AAGGGATAGTGAG
88 SP101_SPET11_1688_ CCTATATTAATCGTTTA 60 SP101_SPET11_1783_1808_R ATATGATTATCATTGAA 752
1716_F CAGAAACTGGCT CTGCGGCCG
89 SP101_SPET11_1711_ CTGGCTAAAACTTTGGC 82 SP101_SPET11_1808_1835_R GCGTGACGACCTTCTTG 821
1733_F AACGGT AATTGTAATCA
90 SP101_SPET11_1807_ ATGATTACAATTCAAGA 33 SP101_SPET11_1901_1927_R TTGGACCTGTAATCAGC 1412
1835_F AGGTCGTCACGC TGAATACTGG
91 SP101_SPET11_1967_ TAACGGTTATCATGGCC 155 SP101_SPET11_2062_2083_R ATTGCCCAGAAATCAAA 755
1991_F CAGATGGG TCATC
92 SP101_SPET11_2260_ CAGAGACCGTTTTATCC 50 SP101_SPET11_2375_2397_R TCTGGGTGACCTGGTGT 1131
2283_F TATCAGC TTTAGA
93 SP101_SPET11_2375_ TCTAAAACACCAGGTCA 390 SP101_SPET11_2470_2497_R AGCTGCTAGATGAGCTT 747
2399_F CCCAGAAG CTGCCATGGCC
94 SP101_SPET11_2468_ ATGGCCATGGCAGAAGC 35 SP101_SPET11_2543_2570_R CCATAAGGTCACCGTCA 770
2487_F TCA CCATTCAAAGC
95 SP101_SPET11_2961_ ACCATGACAGAAGGCAT 15 SP101_SPET11_3023_3045_R GGAATTTACCAGCGATA 827
2984_F TTTGACA GACACC
96 SP101_SPET11_3075_ GATGACTTTTTAGCTAA 108 SP101_SPET11_3168_3196_R AATCGACGACCATCTTG 715
3103_F TGGTCAGGCAGC GAAAGATTTCTC
97 SP101_SPET11_3386_ AGCGTAAAGGTGAACCT 25 SP101_SPET11_3480_3506_R CCAGCAGTTACTGTCCC 769
3403_F T CTCATCTTTG
98 SP101_SPET11_3511_ GCTTCAGGAATCAATGA 116 SP101_SPET11_3605_3629_R GGGTCTACACCTGCACT 832
3535_F TGGAGCAG TGCATAAC
111 RPOB_EC_3775_3803_ CTTGGAGGTAAGTCTCA 87 RPOB_EC_3829_3858_R CGTATAAGCTGCACCAT 797
F TTTTGGTGGGCA AAGCTTGTAATGC
112 VALS_EC_1833_1850_ CGACGCGCTGCGCTTCA 65 VALS_EC_1920_1943_R GCGTTCCACAGCTTGTT 822
F C GCAGAAG
113 RPOB_EC_1336_1353_ GACCACCTCGGCAACCG 97 RPOB_EC_1438_1455_R TTCGCTCTCGGCCTGGC 1386
F T C
114 TUFB_EC_225_251_F GCACTATGCACACGTAG 111 TUFB_EC_284_309_R TATAGCACCATCCATCT 930
ATTGTCCTGG GAGCGGCAC
115 DNAK_EC_428_449_F CGGCGTACTTCAACGAC 72 DNAK_EC_503_522_R CGCGGTCGGCTCGTTGA 792
AGCCA TGA
116 VALS_EC_1920_1943_ CTTCTGCAACAAGCTGT 85 VALS_EC_1948_1970_R TCGCAGTTCATCAGCAC 1075
F GGAACGC GAAGCG
117 TUFB_EC_757_774_F AAGACGACCTGCACGGG 6 TUFB_EC_849_867_R GCGCTCCACGTCTTCAC 819
C GC
118 23S_EC_2646_2667_ CTGTTCTTAGTACGAGA 84 23S_EC_2745_2765_R TTCGTGCTTAGATGCTT 1389
F GGACC TCAG
119 16S_EC_969_985_1P_ ACGCGAAGAACCTTACp 19 16S_EC_1061_1078_2P_R ACGACACGAGCpTpGAC 733
F C GAC
120 16S_EC_972_985_2P_ CGAAGAACpCpTTACC 63 16S_EC_1064_1075_2P_R ACACGAGCpTpGAC 727
F
121 16S_EC_972_985_F CGAAGAACCTTACC 63 16S_EC_1064_1075_R ACACGAGCTGAC 727
122 TRNA_ILE- CCTGATAAGGGTGAGGT 61 23S_EC_40_59_R ACGTCCTTCATCGCCTC 740
RRNH_EC_32_50.2_F CG TGA
123 23S_EC_-7_15_F GTTGTGAGGTTAAGCGA 140 23S_EC_430_450_R CTATCGGTCAGTCAGGA 799
CTAAG GTAT
124 23S_EC_-7_15_F GTTGTGAGGTTAAGCGA 141 23S_EC_891_910_R TTGCATCGGGTTGGTAA 1403
CTAAG GTC
125 23S_EC_430_450_F ATACTCCTGACTGACCG 30 23S_EC_1424_1442_R AACATAGCCTTCTCCGT 712
ATAG CC
126 23S_EC_891_910_F GACTTACCAACCCGATG 100 23S_EC_1908_1931_R TACCTTAGGACCGTTAT 893
CAA AGTTACG
127 23S_EC_1424_1442_F GGACGGAGAAGGCTATG 117 23S_EC_2475_2494_R CCAAACACCGCCGTCGA 765
TT TAT
128 23S_EC_1908_1931_F CGTAACTATAACGGTCC 73 23S_EC_2833_2852_R GCTTACACACCCGGCCT 826
TAAGGTA ATC
129 23S_EC_2475_2494_F ATATCGACGGCGGTGTT 31 TRNA_ASP- GCGTGACAGGCAGGTAT 820
TGG RRNH_EC_23_41.2_R TC
131 16S_EC_−60_−39_F AGTCTCAAGAGTGAACA 28 16S_EC_508_525_R GCTGCTGGCACGGAGTT 823
CGTAA A
132 16S_EC_326_345_F GACACGGTCCAGACTCC 95 16S_EC_1041_1058_R CCATGCAGCACCTGTCT 771
TAC C
133 16S_EC_705_724_F GATCTGGAGGAATACCG 107 16S_EC_1493_1512_R ACGGTTACCTTGTTACG 739
GTG ACT
134 16S_EC_1268_1287_F GAGAGCAAGCGGACCTC 101 TRNA_ALA- CCTCCTGCGTGCAAAGC 780
ATA RRNH_EC_30_46.2_R
135 16S_EC_969_985_F ACGCGAAGAACCTTACC 19 16S_EC_1061_1078.2_R ACAACACGAGCTGACGA 719
C
137 16S_EC_969_985_F ACGCGAAGAACCTTACC 19 16S_EC_1061_1078.2_I14_R ACAACACGAGCTGICGA 721
C
138 16S_EC_969_985_F ACGCGAAGAACCTTACC 19 16S_EC_1061_1078.2_I12_R ACAACACGAGCIGACGA 718
C
139 16S_EC_969_985_F ACGCGAAGAACCTTACC 19 16S_EC_1061_1078.2_I11_R ACAACACGAGITGACGA 722
C
140 16S_EC_969_985_F ACGCGAAGAACCTTACC 19 16S_EC_1061_1078.2_I16_R ACAACACGAGCTGACIA 720
C
141 16S_EC_969_985_F ACGCGAAGAACCTTACC 19 16S_EC_1061_1078.2_2I_R ACAACACGAICTIACGA 723
C
142 16S_EC_969_985_F ACGCGAAGAACCTTACC 19 16S_EC_1061_1078.2_3I_R ACAACACIAICTIACGA 724
C
143 16S_EC_969_985_F ACGCGAAGAACCTTACC 19 16S_EC_1061_1078.2_4I_R ACAACACIAICTIACIA 725
C
147 23S_EC_2652_2669_ CTAGTACGAGAGGACCG 79 23S_EC_2741_2760_R ACTTAGATGCTTTCAGC 743
F G GGT
158 16S_EC_683_700_F GTGTAGCGGTGAAATGC 137 16S_EC_880_894_R CGTACTCCCCAGGCG 796
G
159 16S_EC_1100_1116_F CAACGAGCGCAACCCTT 42 16S_EC_1174_1188_R TCCCCACCTTCCTCC 1019
215 SSPE_BA_121_137_F AACGCACAATCAGAAGC 3 SSPE_BA_197_216_R TCTGTTTCAGTTGCAAA 1132
TTC
220 GROL_EC_941_959_F TGGAAGATCTGGGTCAG 544 GROL_EC_1039_1060_R CAATCTGCTGACGGATC 759
GC TGAGC
221 INFB_EC_1103_1124_ GTCGTGAAAACGAGCTG 133 INFB_EC_1174_1191_R CATGATGGTCACAACCG 764
F GAAGA G
222 HFLB_EC_1082_1102_ TGGCGAACCTGGTGAAC 569 HFLB_EC_1144_1168_R CTTTCGCTTTCTCGAAC 802
F GAAGC TCAACCAT
223 INFB_EC_1969_1994_ CGTCAGGGTAAATTCCG 74 INFB_EC_2038_2058_R AACTTCGCCTTCGGTCA 713
F TGAAGTTAA TGTT
224 GROL_EC_219_242_F GGTGAAAGAAGTTGCCT 128 GROL_EC_328_350_R TTCAGGTCCATCGGGTT 1377
CTAAAGC CATGCC
225 VALS_EC_1105_1124_ CGTGGCGGCGTGGTTAT 77 VALS_EC_1195_1214_R ACGAACTGGATGTCGCC 732
F CGA GTT
226 16S_EC_556_575_F CGGAATTACTGGGCGTA 70 16S_EC_683_700_R CGCATTTCACCGCTACA 791
AAG C
227 RPOC_EC_1256_1277_ ACCCAGTGCTGCTGAAC 16 RPOC_EC_1295_1315_R GTTCAAATGCCTGGATA 843
F CGTGC CCCA
228 16S_EC_774_795_F GGGAGCAAACAGGATTA 122 16S_EC_880_894_R CGTACTCCCCAGGCG 796
GATAC
229 RPOC_EC_1584_1604_ TGGCCCGAAAGAAGCTG 567 RPOC_EC_1623_1643_R ACGCGGGCATGCAGAGA 737
F AGCG TGCC
230 16S_EC_1082_1100_F ATGTTGGGTTAAGTCCC 37 16S_EC_1177_1196_R TGACGTCATCCCCACCT 1158
GC TCC
231 16S_EC_1389_1407_F CTTGTACACACCGCCCG 88 16S_EC_1525_1541_R AAGGAGGTGATCCAGCC 714
TC
232 16S_EC_1303_1323_F CGGATTGGAGTCTGCAA 71 16S_EC_1389_1407_R GACGGGCGGTGTGTACA 808
CTCG AG
233 23S_EC_23_37_F GGTGGATGCCTTGGC 129 23S_EC_115_130_R GGGTTTCCCCATTCGG 833
234 23S_EC_187_207_F GGGAACTGAAACATCTA 121 23S_EC_242_256_R TTCGCTCGCCGCTAC 1385
AGTA
235 23S_EC_1602_1620_F TACCCCAAACCGACACA 184 23S_EC_1686_1703_R CCTTCTCCCGAAGTTACG 782
GG
236 23S_EC_1685_1703_F CCGTAACTTCGGGAGAA 58 23S_EC_1828_1842_R CACCGGGCAGGCGTC 760
GG
237 23S_EC_1827_1843_F GACGCCTGCCCGGTGC 99 23S_EC_1929_1949_R CCGACAAGGAATTTCGC 775
TACC
238 23S_EC_2434_2456_F AAGGTACTCCGGGGATA 9 23S_EC_2490_2511_R AGCCGACATCGAGGTGC 746
ACAGGC CAAAC
239 23S_EC_2599_2616_F GACAGTTCGGTCCCTAT 96 23S_EC_2653_2669_R CCGGTCCTCTCGTACTA 777
C
240 23S_EC_2653_2669_F TAGTACGAGAGGACCGG 227 23S_EC_2737_2758_R TTAGATGCTTTCAGCAC 1369
TTATC
241 23S_BS_-68_-44_F AAACTAGATAACAGTAG 1 23S_BS_5_21_R GTGCGCCCTTTCTAACT 841
ACATCAC T
242 16S_EC_8_27_F AGAGTTTGATCATGGCT 23 16S_EC_342_358_R ACTGCTGCCTCCCGTAG 742
CAG
243 16S_EC_314_332_F CACTGGAACTGAGACAC 48 16S_EC_556_575_R CTTTACGCCCAGTAATT 801
GG CCG
244 16S_EC_518_536_F CCAGCAGCCGCGGTAAT 57 16S_EC_774_795_R GTATCTAATCCTGTTTG 839
AC CTCCC
245 16S_EC_683_700_F GTGTAGCGGTGAAATGC 137 16S_EC_967_985_R GGTAAGGTTCTTCGCGT 835
G TG
246 16S_EC_937_954_F AAGCGGTGGAGCATGTG 7 16S_EC_1220_1240_R ATTGTAGCACGTGTGTA 757
G GCCC
247 16S_EC_1195_1213_F CAAGTCATCATGGCCCT 46 16S_EC_1525_1541_R AAGGAGGTGATCCAGCC 714
TA
248 16S_EC_8_27_F AGAGTTTGATCATGGCT 23 16S_EC_1525_1541_R AAGGAGGTGATCCAGCC 714
CAG
249 23S_EC_1831_1849_F ACCTGCCCAGTGCTGGA 18 23S_EC_1919_1936_R TCGCTACCTTAGGACCG 1080
AG T
250 16S_EC_1387_1407_F GCCTTGTACACACCTCC 112 16S_EC_1494_1513_R CACGGCTACCTTGTTAC 761
CGTC GAC
251 16S_EC_1390_1411_F TTGTACACACCGCCCGT 693 16S_EC_1486_1505_R CCTTGTTACGACTTCAC 783
CATAC CCC
252 16S_EC_1367_1387_F TACGGTGAATACGTTCC 191 16S_EC_1485_1506_R ACCTTGTTACGACTTCA 731
CGGG CCCCA
253 16S_EC_804_822_F ACCACGCCGTAAACGAT 14 16S_EC_909_929_R CCCCCGTCAATTCCTTT 773
GA GAGT
254 16S_EC_791_812_F GATACCCTGGTAGTCCA 106 16S_EC_886_904_R GCCTTGCGACCGTACTC 817
CACCG CC
255 16S_EC_789_810_F TAGATACCCTGGTAGTC 206 16S_EC_882_899_R GCGACCGTACTCCCCAG 818
CACGC G
256 16S_EC_1092_1109_F TAGTCCCGCAACGAGCG 228 168_EC_1174_1195_R GACGTCATCCCCACCTT 810
C CCTCC
257 23S_EC_2586_2607_F TAGAACGTCGCGAGACA 203 23S_EC_2658_2677_R AGTCCATCCCGGTCCTC 749
GTTCG TCG
258 RNASEP_SA_31_49_F GAGGAAAGTCCATGCTC 103 RNASEP_SA_358_379_R ATAAGCCATGTTCTGTT 750
AC CCATC
258 RNASEP_SA_31_49_F GAGGAAAGTCCATGCTC 103 RNASEP_EC_345_362_R ATAAGCCGGGTTCTGTC 751
AC G
258 RNASEP_SA_31_49_F GAGGAAAGTCCATGCTC 103 RNASEP_BS_363_384_R GTAAGCCATGTTTTGTT 838
AC CCATC
258 RNASEP_BS_43_61_F GAGGAAAGTCCATGCTC 104 RNASEP_SA_358_379_R ATAAGCCATGTTCTGTT 750
GC CCATC
258 RNASEP_BS_43_61_F GAGGAAAGTCCATGCTC 104 RNASEP_EC_345_362_R ATAAGCCGGGTTCTGTC 751
GC G
258 RNASEP_BS_43_61_F GAGGAAAGTCCATGCTC 104 RNASEP_BS_363_384_R GTAAGCCATGTTTTGTT 838
GC CCATC
258 RNASEP_EC_61_77_F GAGGAAAGTCCGGGCTC 105 RNASEP_SA_358_379_R ATAAGCCATGTTCTGTT 750
CCATC
258 RNASEP_EC_61_77_F GAGGAAAGTCCGGGCTC 105 RNASEP_EC_345_362_R ATAAGCCGGGTTCTGTC 751
G
258 RNASEP_EC_61_77_F GAGGAAAGTCCGGGCTC 105 RNASEP_BS_363_384_R GTAAGCCATGTTTTGTT 838
CCATC
259 RNASEP_BS_43_61_F GAGGAAAGTCCATGCTC 104 RNASEP_BS_363_384_R GTAAGCCATGTTTTGTT 838
GC CCATC
260 RNASEP_EC_61_77_F GAGGAAAGTCCGGGCTC 105 RNASEP_EC_345_362_R ATAAGCCGGGTTCTGTC 751
G
262 RNASEP_SA_31_49_F GAGGAAAGTCCATGCTC 103 RNASEP_SA_358_379_R ATAAGCCATGTTCTGTT 750
AC CCATC
263 16S_EC_1082_1100_F ATGTTGGGTTAAGTCCC 37 16S_EC_1525_1541_R AAGGAGGTGATCCAGCC 714
GC
264 16S_EC_556_575_F CGGAATTACTGGGCGTA 70 16S_EC_774_795_R GTATCTAATCCTGTTTG 839
AAG CTCCC
265 16S_EC_1082_1100_F ATGTTGGGTTAAGTCCC 37 16S_EC_1177_1196_10G_R TGACGTCATGCCCACCT 1160
GC TCC
266 16S_EC_1082_1100_F ATGTTGGGTTAAGTCCC 37 16S_EC_1177_1196_10G_ TGACGTCATGGCCACCT 1161
GC 11G_R TCC
268 YAED_EC_513_532_F_ GGTGTTAAATAGCCTGG 130 TRNA_ALA- AGACCTCCTGCGTGCAA 744
MOD CAG RRNH_EC_30_49_F_MOD AGC
269 16S_EC_1082_1100_ ATGTTGGGTTAAGTCCC 37 16S_EC_1177_1196_R_MOD TGACGTCATCCCCACCT 1158
F_MOD GC TCC
270 23S_EC_2586_2607_ TAGAACGTCGCGAGACA 203 23S_EC_2658_2677_R_MOD AGTCCATCCCGGTCCTC 749
F_MOD GTTCG TCG
272 16S_EC_969_985_F ACGCGAAGAACCTTACC 19 16S_EC_1389_1407_R GACGGGCGGTGTGTACA 807
AG
273 16S_EC_683_700_F GTGTAGCGGTGAAATGC 137 16S_EC_1303_1323_R CGAGTTGCAGACTGCGA 788
G TCCG
274 16S_EC_49_68_F TAACACATGCAAGTCGA 152 16S_EC_880_894_R CGTACTCCCCAGGCG 796
ACG
275 16S_EC_49_68_F TAACACATGCAAGTCGA 152 16S_EC_1061_1078_R ACGACACGAGCTGACGA 734
ACG C
277 CYA_BA_1349_1370_F ACAACGAAGTACAATAC 12 CYA_BA_1426_1447_R CTTCTACATTTTTAGCC 800
AAGAC ATCAC
278 16S_EC_1090_1111_ TTAAGTCCCGCAACGAG 650 16S_EC_1175_1196_R TGACGTCATCCCCACCT 1159
2_F CGCAA TCCTC
279 16S_EC_405_432_F TGAGTGATGAAGGCCTT 464 16S_EC_507_527_R CGGCTGCTGGCACGAAG 793
AGGGTTGTAAA TTAG
280 GROL_EC_496_518_F ATGGACAAGGTTGGCAA 34 GROL_EC_577_596_R TAGCCGCGGTCGAATTG 914
GGAAGG CAT
281 GROL_EC_511_536_F AAGGAAGGCGTGATCAC 8 GROL_EC_571_593_R CCGCGGTCGAATTGCAT 776
CGTTGAAGA GCCTTC
288 RPOB_EC_3802_3821_ CAGCGTTTCGGCGAAAT 51 RPOB_EC_3862_3885_R CGACTTGACGGTTAACA 786
F GGA TTTCCTG
289 RPOB_EC_3799_3821_ GGGCAGCGTTTCGGCGA 124 RPOB_EC_3862_3888_R GTCCGACTTGACGGTCA 840
F AATGGA ACATTTCCTG
290 RPOC_EC_2146_2174_ CAGGAGTCGTTCAACTC 52 RPOC_EC_2227_2245_R ACGCCATCAGGCCACGC 736
F GATCTACATGAT AT
291 ASPS_EC_405_422_F GCACAACCTGCGGCTGC 110 ASPS_EC_521_538_R ACGGCACGAGGTAGTCG 738
G C
292 RPOC_EC_1374_1393_ CGCCGACTTCGACGGTG 69 RPOC_EC_1437_1455_R GAGCATCAGCGTGCGTG 811
F ACC CT
293 TUFB_EC_957_979_F CCACACGCCGTTCTTCA 55 TUFB_EC_1034_1058_R GGCATCACCATTTCCTT 829
ACAACT GTCCTTCG
294 16S_EC_7_33_F GAGAGTTTGATCCTGGC 102 16S_EC_101_122_R TGTTACTCACCCGTCTG 1345
TCAGAACGAA CCACT
295 VALS_EC_610_649_F ACCGAGCAAGGAGACCA 17 VALS_EC_705_727_R TATAACGCACATCGTCA 929
GC GGGTGA
344 16S_EC_971_990_F GCGAAGAACCTTACCAG 113 16S_EC_1043_1062_R ACAACCATGCACCACCT 726
GTC GTC
346 16S_EC_713_732_ TAGAACACCGATGGCGA 202 16S_EC_789_809_TMOD_R TCGTGGACTACCAGGGT 1110
TMOD_F AGGC ATCTA
347 16S_EC_785_806_ TGGATTAGAGACCCTGG 560 16S_EC_880_897_TMOD_R TGGCCGTACTCCCCAGG 1278
TMOD_F TAGTCC CG
348 16S_EC_960_981_ TTTCGATGCAACGCGAA 706 16S_EC_1054_1073_TMOD_R TACGAGCTGACGACAGC 895
TMOD_F GAACCT CATG
349 23S_EC_1826_1843_ TCTGACACCTGCCCGGT 401 23S_EC_1906_1924_TMOD_R TGACCGTTATAGTTACG 1156
TMOD_F GC GCC
350 CAPC_BA_274_303_ TGATTATTGTTATCCTG 476 CAPC_BA_349_376_TMOD_R TGTAACCCTTGTCTTTG 1314
TMOD_F TTATGCCATTTGAG AATTGTATTTGC
351 CYA_BA_1353_1379_ TCGAAGTACAATACAAG 355 CYA_BA_1448_1467_TMOD_R TTGTTAACGGCTTCAAG 1423
TMOD_F ACAAAAGAAGG ACCC
352 INFB_EC_1365_1393_ TTGCTCGTGGTGCACAA 687 INFB_EC_1439_1467_TMOD_R TTGCTGCTTTCGCATGG 1411
TMOD_F GTAACGGATATTA TTAATTGCTTCAA
353 LEF_BA_756_781_ TAGCTTTTGCATATTAT 220 LEF_BA_843_872_TMOD_R TTCTTCCAAGGATAGAT 1394
TMOD_F ATCGAGCCAC TTATTTCTTGTTCG
354 RPOC_EC_2218_2241_ TCTGGCAGGTATGCGTG 405 RPOC_EC_2313_2337_TMOD_R TCGCACCGTGGGTTGAG 1072
TMOD_F GTCTGATG ATGAAGTAC
355 SSPE_BA_115_137_ TCAAGCAAACGCACAAT 255 SSPE_BA_197_222_TMOD_R TTGCACGTCTGTTTCAG 1402
TMOD_F CAGAAGC TTGCAAATTC
356 RPLB_EC_650_679_ TGACCTACAGTAAGAGG 448 RPLB_EC_739_762_TMOD_R TTCCAAGTGCTGGTTTA 1380
TMOD_F TTCTGTAATGAACC CCCCATGG
357 RPLB_EC_688_710_ TCATCCACACGGTGGTG 296 RPLB_EC_736_757_TMOD_R TGTGCTGGTTTACCCCA 1337
TMOD_F GTGAAGG TGGAGT
358 VALS_EC_1105_1124_ TCGTGGCGGCGTGGTTA 385 VALS_EC_1195_1218_TMOD_R TCGGTACGAACTGGATG 1093
TMOD_F TCGA TCGCCGTT
359 RPOB_EC_1845_1866_ TTATCGCTCAGGCGAAC 659 RPOB_EC_1909_1929_TMOD_R TGCTGGATTCGCCTTTG 1250
TMOD_F TCCAAC CTACG
360 23S_EC_2646_2667_ TCTGTTCTTAGTACGAG 409 23S_EC_2745_2765_TMOD_R TTTCGTGCTTAGATGCT 1434
TMOD_F AGGACC TTCAG
361 16S_EC_1090_1111_ TTTAAGTCCCGCAACGA 697 16S_EC_1175_1196_TMOD_R TTGACGTCATCCCCACC 1398
2_TMOD_F GCGCAA TTCCTC
362 RPOB_EC_3799_3821_ TGGGCAGCGTTTCGGCG 581 RPOB_EC_3862_3888_TMOD_R TGTCCGACTTGACGGTC 1325
TMOD_F AAATGGA AACATTTCCTG
363 RPOC_EC_2146_2174_ TCAGGAGTCGTTCAACT 284 RPOC_EC_2227_2245_TMOD_R TACGCCATCAGGCCACG 898
TMOD_F CGATCTACATGAT CAT
364 RPOC_EC_1374_1393_ TCGCCGACTTCGACGGT 367 RPOC_EC_1437_1455_TMOD_R TGAGCATCAGCGTGCGT 1166
TMOD_F GACC GCT
367 TUFB_EC_957_979_ TCCACACGCCGTTCTTC 308 TUFB_EC_1034_1058_TMOD_R TGGCATCACCATTTCCT 1276
TMOD_F AACAACT TGTCCTTCG
423 SP101_SPET11_893_ TGGGCAACAGCAGCGGA 580 SP101_SPET11_988_1012_ TCATGACAGCCAAGACC 990
921_TMOD_F TTGCGATTGCGCG TMOD_R TCACCCACC
424 SP101_SPET11_1154_ TCAATACCGCAACAGCG 258 SP101_SPET11_1251_1277_ TGACCCCAACCTGGCCT 1155
1179_TMOD_F GTGGCTTGGG TMOD_R TTTGTCGTTGA
425 SP101_SPET11_118_ TGCTGGTGAAAATAACC 528 SP101_SPET11_213_238_ TTGTGGCCGATTTCACC 1422
147_TMOD_F CAGATGTCGTCTTC TMOD_R ACCTGCTCCT
426 SP101_SPET11_1314_ TCGCAAAAAAATCCAGC 363 SP101_SPET11_1403_1431_ TAAACTATTTTTTTAGC 849
1336_TMOD_F TATTAGC TMOD_R TATACTCGAACAC
427 SP101_SPET11_1408_ TCGAGTATAGCTAAAAA 359 SP101_SPET11_1486_1515_ TGGATAATTGGTCGTAA 1268
1437_TMOD_F AATAGTTTATGACA TMOD_R CAAGGGATAGTGAG
428 SP101_SPET11_1688_ TCCTATATTAATCGTTT 334 SP101_SPET11_1783_1808_ TATATGATTATCATTGA 932
1716_TMOD_F ACAGAAACTGGCT TMOD_R ACTGCGGCCG
429 SP101_SPET11_1711_ TCTGGCTAAAACTTTGG 406 SP101_SPET11_1808_1835_ TGCGTGACGACCTTCTT 1239
1733_TMOD_F CAACGGT TMOD_R GAATTGTAATCA
430 SP101_SPET11_1807_ TATGATTACAATTCAAG 235 SP101_SPET11_1901_1927_ TTTGGACCTGTAATCAG 1439
1835_TMOD_F AAGGTCGTCACGC TMOD_R CTGAATACTGG
431 SP101_SPET11_1967_ TTAACGGTTATCATGGC 649 SP101_SPET11_2062_2083_ TATTGCCCAGAAATCAA 940
1991_TMOD_F CCAGATGGG TMOD_R ATCATC
432 SP101_SPET11_216_ TAGCAGGTGGTGAAATC 210 SP101_SPET11_308_333_ TTGCCACTTTGACAACT 1404
243_TMOD_F GGCCACATGATT TMOD_R CCTGTTGCTG
433 SP101_SPET11_2260_ TCAGAGACCGTTTTATC 272 SP101_SPET11_2375_2397_ TTCTGGGTGACCTGGTG 1393
2283_TMOD_F CTATCAGC TMOD_R TTTTAGA
434 SP101_SPET11_2375_ TTCTAAAACACCAGGTC 675 SP101_SPET11_2470_2497_ TAGCTGCTAGATGAGCT 918
2399_TMOD_F ACCCAGAAG TMOD_R TCTGCCATGGCC
435 SP101_SPET11_2468_ TATGGCCATGGCAGAAG 238 SP101_SPET11_2543_2570_ TCCATAAGGTCACCGTC 1007
2487_TMOD_F CTCA TMOD_R ACCATTCAAAGC
436 SP101_SPET11_266_ TCTTGTACTTGTGGCTC 417 SP101_SPET11_355_380_ TGCTGCTTTGATGGCTG 1249
295_TMOD_F ACACGGCTGTTTGG TMOD_R AATCCCCTTC
437 SP101_SPET11_2961_ TACCATGACAGAAGGCA 183 SP101_SPET11_3023_3045_ TGGAATTTACCAGCGAT 1264
2984_TMOD_F TTTTGACA TMOD_R AGACACC
438 SP101_SPET11_3075_ TGATCACTTTTTAGCTA 473 SP101_SPET11_3168_3196_ TAATCGACGACCATCTT 875
3103_TMOD_F ATGGTCAGGCAGC TMOD_R GGAAAGATTTCTC
439 SP101_SPET11_322_ TGTCAAAGTGGCACGTT 631 SP101_SPET11_423_441_ TATCCCCTGCTTCTGCT 934
344_TMOD_F TACTGGC TMOD_R GCC
440 SP101_SPET11_3386_ TAGCGTAAAGGTGAACC 215 SP101_SPET11_3480_3506_ TCCAGCAGTTACTGTCC 1005
3403_TMOD_F TT TMOD_R CCTCATCTTTG
441 SP101_SPET11_3511_ TGCTTCAGGAATCAATG 531 SP101_SPET11_3605_3629_ TGGGTCTACACCTGCAC 1294
3535_TMOD_F ATGGAGCAG TMOD_R TTGCATAAC
442 SP101_SPET11_358_ TGGGGATTCAGCCATCA 588 SP101_SPET11_448_473_ TCCAACCTTTTCCACAA 998
387_TMOD_F AAGCAGCTATTGAC TMOD_R CAGAATCAGC
443 SP101_SPET11_600_ TCCTTACTTCGAACTAT 348 SP101_SPET11_686_714_ TCCCATTTTTTCACGCA 1018
629_TMOD_F GAATCTTTTGGAAG TMOD_R TGCTGAAAATATC
444 SP101_SPET11_658_ TGGGGATTGATATCACC 589 SP101_SPET11_756_784_ TGATTGGCGATAAAGTG 1189
684_TMOD_F GATAAGAAGAA TMOD_R ATATTTTCTAAAA
445 SP101_SPET11_776_ TTCGCCAATCAAAACTA 673 SP101_SPET11_871_896_ TGCCCACCAGAAAGACT 1217
801_TMOD_F AGGGAATGGC TMOD_R AGCAGGATAA
446 SP101_SPET11_1_29_ TAACCTTAATTGGAAAG 154 SP101_SPET11_92_116_ TCCTACCCAACGTTCAC 1044
TMOD_F AAACCCAAGAAGT TMOD_R CAAGGGCAG
447 SP101_SPET11_364_ TCAGCCATCAAAGCAGC 276 SP101_SPET11_448_471_R TACCTTTTCCACAACAG 894
385_F TATTG AATCAGC
448 SP101_SPET11_3085_ TAGCTAATGGTCAGGCA 216 SP101_SPET11_3170_3194_R TCGACGACCATCTTGGA 1066
3104_F GCC AAGATTTC
449 RPLB_EC_690_710_F TCCACACGGTGGTGGTG 309 RPLB_EC_737_758_R TGTGCTGGTTTACCCCA 1336
AAGG TGGAG
481 BONTA_X52066_538_ TATGGCTCTACTCAA 239 BONTA_X52066_647_660_R TGTTACTGCTGGAT 1346
552_F
482 BONTA_X52066_538_ TA*TpGGC*Tp*Cp*Tp 143 BONTA_X52066_647_660P_R TG*Tp*TpA*Cp*TpG* 1146
552P_F A*Cp*Tp*CpAA Cp*TpGGAT
483 BONTA_X52066_701_ GAATAGCAATTAATCCA 94 BONTA_X52066_759_775_R TTACTTCTAACCCACTC 1367
720_F AAT
484 BONTA_X52066_701_ GAA*TpAG*CpAA*Tp* 91 BONTA_X52066_759_775P_R TTA*Cp*Tp*Tp*Cp*T 1359
720P_F TpAA*Tp*Cp*CpAAAT pAA*Cp*Cp*CpA*Cp*TpC
485 BONTA_X52066_450_ TCTAGTAATAATAGGAC 393 BONTA_X52066_517_539_R TAACCATTTCGCGTAAG 859
473_F CCTCAGC ATTCAA
486 BONTA_X52066_450_ T*Cp*TpAGTAATAATA 142 BONTA_X52066_517_539P_R TAACCA*Tp*Tp*Tp* 857
473P_F GGA*Cp*Cp*Cp*Tp* CpGCGTAAGA*Tp*Tp*
CpAGC CpAA
487 BONTA_X52066_591_ TGAGTCACTTGAAGTTG 463 BONTA_X52066_644_671_R TCATGTGCTAATGTTAC 992
620_F ATACAAATCCTCT TGCTGGATCTG
608 SSPE_BA_156_168P_F TGGTpGCpTpAGCpATT 616 SSPE_BA_243_255P_R TGCpAGCpTGATpTpGT 1241
609 SSPE_BA_75_89P_F TACpAGAGTpTpTpGCp 192 SSPE_BA_163_177P_R TGTGCTpTpTpGAATpG 1338
GAC CpT
610 SSPE_BA_150_168P_F TGCTTCTGGTpGCpTpA 533 SSPE_BA_243_264P_R TGATTGTTTTGCpAGCp 1191
GCpATT TGATpTpGT
611 SSPE_BA_72_89P_F TGGTACpAGAGTpTpTp 602 SSPE_BA_163_182P_R TCATTTGTGCTpTpTpG 995
GCpGAC AATpGCpT
612 SSPE_BA_114_137P_F TCAAGCAAACGCACAAT 255 SSPE_BA_196_222P_R TTGCACGTCpTpGTTTC 1401
pCpAGAAGC AGTTGCAAATTC
699 SSPE_BA_123_153_F TGCACAATCAGAAGCTA 488 SSPE_BA_202_231_R TTTCACAGCATGCACGT 1431
AGAAAGCGCAAGCT CTGTTTCAGTTGC
700 SSPE_BA_156_168_F TGGTGCTAGCATT 612 SSPE_BA_243_255_R TGCAGCTCATTGT 1202
701 SSPE_BA_75_89_F TACAGAGTTTGCGAC 179 SSPE_BA_163_177_R TGTGCTTTGAATGCT 1338
702 SSPE_BA_150_168_F TGCTTCTGGTGCTAGCA 533 SSPE_BA_243_264_R TGATTGTTTTGCAGCTG 1190
TT ATTGT
703 SSPE_BA_72_89_F TGGTACAGAGTTTGCGA 600 SSPE_BA_163_182_R TCATTTGTGCTTTGAAT 995
C GCT
704 SSPE_BA_146_168_F TGCAAGCTTCTGGTGCT 484 SSPE_BA_242_267_R TTGTGATTGTTTTGCAG 1421
AGCATT CTGATTGTG
705 SSPE_BA_63_89_F TGCTAGTTATGGTACAG 518 SSPE_BA_163_191_R TCATAACTAGCATTTGT 986
AGTTTGCGAC GCTTTGAATGCT
706 SSPE_BA_114_137_F TCAAGCAAACGCACAAT 255 SSPE_BA_196_222_R TTGCACGTCTGTTTCAG 1402
CAGAAGC TTGCAAATTC
770 PLA_AF053945_7377_ TGACATCCGGCTCACGT 442 PLA_AF053945_7434_7462_R TGTAAATTCCGCAAAGA 1313
7402_F TATTATGGT CTTTGGCATTAG
771 PLA_AF053945_7382_ TCCGGCTCACGTTATTA 327 PLA_AF053945_7482_7502_R TGGTCTGAGTACCTCCT 1304
7404_F TGGTAC TTGC
772 PLA_AF053945_7481_ TGCAAAGGAGGTACTCA 481 PLA_AF053945_7539_7562_R TATTGGAAATACCGGCA 943
7503_F GACCAT GCATCTC
773 PLA_AF053945_7186_ TTATACCGGAAACTTCC 657 PLA_AF053945_7257_7280_R TAATGCGATACTGGCCT 879
7211_F CGAAAGGAG GCAAGTC
774 CAF1_AF053947_ TCAGTTCCGTTATCGCC 292 CAF1_AF053947_33494_ TGCGGGCTGGTTCAACA 1235
33407_33430_F ATTGCAT 33514_R AGAG
775 CAF1_AF053947_ TCACTCTTACATATAAG 270 CAF1_AF053947_33595_ TCCTGTTTTATAGCCGC 1053
33515_33541_F GAAGGCGCTC 33621_R CAAGAGTAAG
776 CAF1_AF053947_ TGGAACTATTGCAACTG 542 CAF1_AF053947_33499_ TGATGCGGGCTGGTTCA 1183
33435_33457_F CTAATG 33517_R AC
777 CAF1_AF053947_ TCAGGATGGAAATAACC 286 CAF1_AF053947_33755_ TCAAGGTTCTCACCGTT 962
33687_33716_F ACCAATTCACTAC 33782_R TACCTTAGGAG
778 INV_U22457_515_ TGGCTCCTTGGTATGAC 573 INV_U22457_571_598_R TGTTAAGTGTGTTGCGG 1343
539_F TCTGCTTC CTGTCTTTATT
779 INV_U22457_699_ TGCTGAGGCCTGGACCG 525 INV_U22457_753_776_R TCACGCGACGAGTGCCA 976
724_F ATTATTTAC TCCATTG
780 INV_U22457_834_ TTATTTACCTGCACTCC 664 INV_U22457_942_966_R TGACCCAAAGCTGAAAG 1154
858_F CACAACTG CTTTACTG
781 INV_U22457_1558_ TGGTAACAGAGCCTTAT 597 INV_U22457_1619_1643_R TTGCGTTGCAGATTATC 1408
1581_F AGGCGCA TTTACCAA
782 LL_NC003143_ TGTAGCCGCTAAGCACT 627 LL_NC003143_2367073_ TCTCATCCCGATATTAC 1123
2366996_2367019_F ACCATCC 2367097_R CGCCATGA
783 LL_NC003143_ TGGACGGCATCACGATT 550 LL_NC003143_2367249_ TGGCAACAGCTCAACAC 1272
2367172_2367194_F CTCTAC 2367271_R CTTTGG
874 RPLB_EC_649_679_F TGICCIACIGTIIGIGG 620 RPLB_EC_739_762_TMOD_R TTCCAAGTGCTGGTTTA 1380
TTCTGTAATGAACC CCCCATGG
875 RPLB_EC_642_679P_F TpCpCpTpTpGITpGIC 646 RPLB_EC_739_762_TMOD_R TTCCAAGTGCTGGTTTA 1380
CIACIGTIIGIGGTTCT CCCCATGG
GTAATGAACC
876 MECIA_Y14051_3315_ TTACACATATCGTGAGC 653 MECIA_Y14051_3367_3393_R TGTGATATGGAGGTGTA 1333
3341_F AATGAACTGA GAAGGTGTTA
877 MECA_Y14051_3774_ TAAAACAAACTACGGTA 144 MECA_Y14051_3828_3854_R TCCCAATCTAACTTCCA 1015
3802_F ACATTGATCGCA CATACCATCT
878 MECA_Y14051_3645_ TGAAGTAGAAATGACTG 434 MECA_Y14051_3690_3719_R TGATCCTGAATGTTTAT 1181
3670_F AACGTCCGA ATCTTTAACGCCT
879 MECA_Y14051_4507_ TCAGGTACTGCTATCCA 288 MECA_Y14051_4555_4581_R TGGATAGACGTCATATG 1269
4530_F CCCTCAA AAGGTGTGCT
880 MECA_Y14051_4510_ TGTACTGCTATCCACCC 626 MECA_Y14051_4586_4610_R TATTCTTCGTTACTCAT 939
4530_F TCAA GCCATACA
881 MECA_Y14051_4669_ TCACCAGGTTCAACTCA 262 MECA_Y14051_4765_4793_R TAACCACCCCAAGATTT 858
4698_F AAAAATATTAACA ATCTTTTTGCCA
882 MECA_Y14051_4520_ TCpCpACpCpCpTpCpA 389 MECA_Y14051_4590_4600P_R TpACpTpCpATpGCpCp 1357
4530P_F A A
883 MECA_Y14051_4520_ TCpCpACpCpCpTpCpA 389 MECA_Y14051_4600_4610P_R TpATpTpCpTpTpCpGT 1358
4530P_F A pT
902 TRPE_AY094355_ ATGTCGATTGCAATCCG 36 TRPE_AY094355_1569_ TGCGCGAGCTTTTATTT 1231
1467_1491_F TACTTGTG 1592_R GGGTTTC
903 TRPE_AY094355_ TGGATGGCATGGTGAAA 557 TRPE_AY094355_1551_ TATTTGGGTTTCATTCC 944
1445_1471_F TGGATATGTC 1580_R ACTCAGATTCTGG
904 TRPE_AY094355_ TCAAATGTACAAGGTGA 247 TRPE_AY094355_1392_ TCCTCTTTTCACAGGCT 1048
1278_1303_F AGTGCGTGA 1418_R CTACTTCATC
905 TRPE_AY094355_ TCGACCTTTGGCAGGAA 357 TRPE_AY094355_1171_ TACATCGTTTCGCCCAA 885
1064_1086_F CTAGAC 1196_R GATCAATCA
906 TRPE_AY094355_666_ GTGCATGCGGATACAGA 135 TRPE_AY094355_769_791_R TTCAAAATGCGGAGGCG 1372
688_F GCAGAG TATGTG
907 TRPE_AY094355_757_ TGCAAGCGCGACCACAT 483 TRPE_AY094355_864_883_R TGCCCAGGTACAACCTG 1218
776_F ACG CAT
908 RECA_AF251469_43_ TGGTACATGTGCCTTCA 601 RECA_AF251469_140_163_R TTCAAGTGCTTGCTCAC 1375
68_F TTGATGCTG CATTGTC
909 RECA_AF251469_169_ TGACATGCTTGTCCGTT 446 RECA_AF251469_277_300_R TGGCTCATAAGACGCGC 1280
190_F CAGGC TTGTAGA
910 PARC_X95819_87_ TGGTGACTCGGCATGTT 609 PARC_X95819_201_222_R TTCGGTATAACGCATCG 1387
110_F ATGAAGC CAGCA
911 PARC_X95819_87_ TGGTGACTCGGCATGTT 609 PARC_X95819_192_219_R GGTATAACGCATCGCAG 836
110_F ATGAAGC CAAAAGATTTA
912 PARC_X95819_123_ GGCTCAGCCATTTAGTT 120 PARC_X95819_232_260_R TCGCTCAGCAATAATTC 1081
147_F ACCGCTAT ACTATAAGCCGA
913 PARC_X95819_43_ TCAGCGCGTACAGTGGG 277 PARC_X95819_143_170_R TTCCCCTGACCTTCGAT 1383
63_F TGAT TAAAGGATAGC
914 OMPA_AY485227_272_ TTACTCCATTATTGCTT 655 OMPA_AY485227_364_388_R GAGCTGCGCCAACGAAT 812
301_F GGTTACACTTTCC AAATCGTC
915 OMPA_AY485227_379_ TGCGCAGCTCTTGGTAT 509 OMPA_AY485227_492_519_R TGCCGTAACATAGAAGT 1223
401_F CGAGTT TACCGTTGATT
916 OMPA_AY485227_311_ TACACAACAATGGCGGT 178 OMPA_AY485227_424_453_R TACGTCGCCTTTAACTT 901
335_F AAAGATGG GGTTATATTCAGC
917 OMPA_AY485227_415_ TGCCTCGAAGCTGAATA 506 OMPA_AY485227_514_546_R TCGGGCGTAGTTTTTAG 1092
441_F TAACCAAGTT TAATTAAATCAGAAGT
918 OMPA_AY485227_494_ TCAACGGTAACTTCTAT 252 OMPA_AY485227_569_596_R TCGTCGTATTTATAGTG 1108
520_F GTTACTTCTG ACCAGCACCTA
919 OMPA_AY485227_551_ TCAAGCCGTACGTATTA 257 OMPA_AY485227_658_680_R TTTAAGCGCCAGAAAGC 1425
577_F TTAGGTGCTG ACCAAC
920 OMPA_AY485227_555_ TCCGTACGTATTATTAG 328 OMPA_AY485227_635_662_R TCAACACCAGCGTTACC 954
581_F GTGCTGGTCA TAAAGTACCTT
921 OMPA_AY485227_556_ TCGTACGTATTATTAGG 379 OMPA_AY485227_659_683_R TCGTTTAAGCGCCAGAA 1114
583_F TGCTGGTCACT AGCACCAA
922 OMPA_AY485227_657_ TGTTGGTGCTTTCTGGC 645 OMPA_AY485227_739_765_R TAAGCCAGCAAGAGCTG 871
679_F GCTTAA TATAGTTCCA
923 OMPA_AY485227_660_ TGGTGCTTTCTGGCGCT 613 OMPA_AY485227_786_807_R TACAGGAGCAGCAGGCT 884
683_F TAAACGA TCAAG
924 GYRA_AF100557_4_ TCTGCCCGTGTCGTTGG 402 GYRA_AF100557_119_142_R TCGAACCGAAGTTACCC 1063
23_F TGA TGACCAT
925 GYRA_AF100557_70_ TCCATTGTTCGTATGGC 316 GYRA_AF100557_178_201_R TGCCAGCTTAGTCATAC 1211
94_F TCAAGACT GGACTTC
926 GYRB_AB008700_19_ TCAGGTGGCTTACACGG 289 GYRB_AB008700_111_140_R TATTGCGGATCACCATG 941
40_F CGTAG ATGATATTCTTGC
927 GYRB_AB008700_265_ TCTTTCTTGAATGCTGG 420 GYRB_AB008700_369_395_R TCGTTGAGATGGTTTTT 1113
292_F TGTACGTATCG ACCTTCGTTG
928 GYRB_AB008700_368_ TCAACGAAGGTAAAAAC 251 GYRB_AB008700_466_494_R TTTGTGAAACAGCGAAC 1440
394_F CATCTCAACG ATTTTCTTGGTA
929 GYRB_AB008700_477_ TGTTCGCTGTTTCACAA 641 GYRB_AB008700_611_632_R TCACGCGCATCATCACC 977
504_F ACAACATTCCA AGTCA
930 GYRB_AB008700_760_ TACTTACTTGAGAATCC 198 GYRB_AB008700_862_888_R ACCTGCAATATCTAATG 729
787_F ACAAGCTGCAA CACTCTTACG
931 WAAA_Z96925_2_29_F TCTTGCTCTTTCGTGAG 416 WAAA_Z96925_115_138_R CAAGCGGTTTGCCTCAA 758
TTCAGTAAATG ATAGTCA
932 WAAA_Z96925_286_ TCGATCTGGTTTCATGC 360 WAAA_Z96925_394_412_R TGGCACGAGCCTGACCT 1274
311_F TGTTTCAGT GT
939 RPOB_EC_3798_3821_ TGGGCAGCGTTTCGGCG 581 RPOB_EC_3862_3889_R TGTCCGACTTGACGGTC 1326
F AAATGGA AGCATTTCCTG
940 RPOB_EC_3798_3821_ TGGGCAGCGTTTCGGCG 581 RPOB_EC_3862_3889_2_R TGTCCGACTTGACGGTT 1327
F AAATGGA AGCATTTCCTG
941 TUFB_EC_275_299_F TGATCACTGGTGCTGCT 468 TUFB_EC_337_362_R TGGATGTGCTCACGAGT 1271
CAGATGGA CTGTGGCAT
942 TUFB_EC_251_278_F TGCACGCCGACTATGTT 493 TUFB_EC_337_360_R TATGTGCTCACGAGTTT 937
AAGAACATGAT GCGGCAT
949 GYRB_AB008700_760_ TACTTACTTGAGAATCC 198 GYRB_AB008700_862_888_ TCCTGCAATATCTAATG 1050
787_F ACAAGCTGCAA 2_R CACTCTTACG
958 RPOC_EC_2223_2243_ TGGTATGCGTGGTCTGA 605 RPOC_EC_2329_2352_R TGCTAGACCTTTACGTG 1243
F TGGC CACCGTG
959 RPOC_EC_918_938_F TCTGGATAACGGTCGTC 404 RPOC_EC_1009_1031_R TCCAGCAGGTTCTGACG 1004
GCGG GAAACG
960 RPOC_EC_2334_2357_ TGCTCGTAAGGGTCTGG 523 RPOC_EC_2380_2403_R TACTAGACGACGGGTCA 905
F CGGATAC GGTAACC
961 RPOC_EC_917_938_F TATTGGACAACGGTCGT 242 RPOC_EC_1009_1034_R TTACCGAGCAGGTTCTG 1362
CGCGG ACGGAAACG
962 RPOB_EC_2005_2027_ TCGTTCCTGGAACACGA 387 RPOB_EC_2041_2064_R TTGACGTTGCATGTTCG 1399
F TGACGC AGCCCAT
963 RPOB_EC_1527_1549_ TCAGCTGTCGCAGTTCA 282 RPOB_EC_1630_1649_R TCGTCGCGGACTTCGAA 1104
F TGGACC GCC
964 INFB_EC_1347_1367_ TGCGTTTACCGCAATGC 515 INFB_EC_1414_1432_R TCGGCATCACGCCGTCG 1090
F GTGC TC
965 VALS_EC_1128_1151_ TATGCTGACCGACCAGT 237 VALS_EC_1231_1257_R TTCGCGCATCCAGGAGA 1384
F GGTACGT AGTACATGTT
978 RPOC_EC_2145_2175_ TCAGGAGTCGTTCAACT 285 RPOC_EC_2228_2247_R TTACGCCATCAGGCCAC 1363
F CGATCTACATGATG GCA
1045 CJST_CJ_1668_ TGCTCGAGTGATTGACT 522 CJST_CJ_1774_1799_R TGAGCGTGTGGAAAAGG 1170
1700_F TTGCTAAATTTAGAGA ACTTGGATG
1046 CJST_CJ_2171_ TCGTTTGGTGGTGGTAG 388 CJST_CJ_2283_2313_R TCTCTTTCAAAGCACCA 1126
2197_F ATGAAAAAGG TTGCTCATTATAGT
1047 CJST_CJ_584_616_F TCCAGGACAAATGTATG 315 CJST_CJ_663_692_R TTCATTTTCTGGTCCAA 1379
AAAAATGTCCAAGAAC AGTAAGCAGTATC
1048 CJST_CJ_360_394_F TCCTGTTATCCCTGAAG 346 CJST_CJ_442_476_R TCAACTGGTTCAAAAAC 955
TAGTTAATCAAGTTTGT ATTAAGTTGTAATTGTC
T C
1049 CJST_CJ_2636_ TGCCTAGAAGATCTTAA 504 CJST_CJ_2753_2777_R TTGCTGCCATAGCAAAG 1409
2668_F AAATTTCCGCCAACTT CCTACAGC
1050 CJST_CJ_1290_ TGGCTTATCCAAATTTA 575 CJST_CJ_1406_1433_R TTTGCTCATGATCTGCA 1437
1320_F GATCGTGGTTTTAC TGAAGCATAAA
1051 CJST_CJ_3267_ TTTGATTTTACGCCGTC 707 CJST_CJ_3356_3385_R TCAAAGAACCCGCACCT 951
3293_F CTCCAGGTCG AATTCATCATTTA
1052 CJST_CJ_5_39_F TAGGCGAAGATATACAA 222 CJST_CJ_104_137_R TCCCTTATTTTTCTTTC 1029
AGAGTATTAGAAGCTAG TACTACCTTCGGATAAT
A
1053 CJST_CJ_1080_ TTGAGGGTATGCACCGT 681 CJST_CJ_1166_1198_R TCCCCTCATGTTTAAAT 1022
1110_F CTTTTTGATTCTTT GATCAGGATAAAAAGC
1054 CJST_CJ_2060_ TCCCGGACTTAATATCA 323 CJST_CJ_2148_2174_R TCGATCCGCATCACCAT 1068
2090_F ATGAAAATTGTGGA CAAAAGCAAA
1055 CJST_CJ_2869_ TGAAGCTTGTTCTTTAG 432 CJST_CJ_2979_3007_R TCCTCCTTGTGCCTCAA 1045
2895_F CAGGACTTCA AACGCATTTTTA
1056 CJST_CJ_1880_ TCCCAATTAATTCTGCC 317 CJST_CJ_1981_2011_R TGGTTCTTACTTGCTTT 1309
1910_F ATTTTTCCAGGTAT GCATAAACTTTCCA
1057 CJST_CJ_2185_ TAGATGAAAAGGGCGAA 208 CJST_CJ_2283_2316_R TGAATTCTTTCAAAGCA 1152
2212_F GTGGCTAATGG CCATTGCTCATTATAGT
1058 CJST_CJ_1643_ TTATCGTTTGTGGAGCT 660 CJST_CJ_1724_1752_R TGCAATGTGTGCTATGT 1198
1670_F AGTGCTTATGC CAGCAAAAAGAT
1059 CJST_CJ_2165_ TGCGGATCGTTTGGTGG 511 CJST_CJ_2247_2278_R TCCACACTGGATTGTAA 1002
2194_F TTGTAGATGAAAA TTTACCTTGTTCTTT
1060 CJST_CJ_599_632_F TGAAAAATGTCCAAGAA 424 CJST_CJ_711_743_R TCCCGAACAATGAGTTG 1024
GCATAGCAAAAAAAGCA TATCAACTATTTTTAC
1061 CJST_CJ_360_393_F TCCTGTTATCCCTGAAG 345 CJST_CJ_443_477_R TACAACTGGTTCAAAAA 882
TAGTTAATCAAGTTTGT CATTAAGCTGTAATTGT
C
1062 CJST_CJ_2678_ TCCCCAGGACACCCTGA 321 CJST_CJ_2760_2787_R TGTGCTTTTTTTGCTGC 1339
2703_F AATTTCAAC CATAGCAAAGC
1063 CJST_CJ_1268_ AGTTATAAACACGGCTT 29 CJST_CJ_1349_1379_R TCGGTTTAAGCTCTACA 1096
1299_F TCCTATGGCTTATCC TGATCGTAAGGATA
1064 CJST_CJ_1680_ TGATTTTGCTAAATTTA 479 CJST_CJ_1795_1822_R TATGTGTAGTTGAGCTT 938
1713_F GAGAAATTGCGGATGAA ACTACATGAGC
1065 CJST_CJ_2857_ TGGCATTTCTTATGAAG 565 CJST_CJ_2965_2998_R TGCTTCAAAACGCATTT 1253
2887_F CTTGTTCTTTAGCA TTACATTTTCGTTAAAG
1070 RNASEP_BKM_580_ TGCGGGTAGGGAGCTTG 512 RNASEP_BKM_665_686_R TCCGATAAGCCGGATTC 1034
599_F AGC TGTGC
1071 RNASEP_BKM_616_ TCCTAGAGGAATGGCTG 333 RNASEP_BKM_665_687_R TGCCGATAAGCCGGATT 1222
637_F CCACG CTGTGC
1072 RNASEP_BDP_574_ TGGCACGGCCATCTCCG 561 RNASEP_BDP_616_635_R TCGTTTCACCCTGTCAT 1115
592_F TG GCCG
1073 23S_BRM_1110_1129_ TGCGCGGAAGATGTAAC 510 23S_BRM_1176_1201_R TCGCAGGCTTACAGAAC 1074
F GGG GCTCTCCTA
1074 23S_BRM_515_536_F TGCATACAAACAGTCGG 496 23S_BRM_616_635_R TCGGACTCGCTTTCGCT 1088
AGCCT ACG
1075 RNASEP_CLB_459_ TAAGGATAGTGCAACAG 162 RNASEP_CLB_498_526_R TGCTCTTACCTCACCGT 1247
487_F AGATATACCGCC TCCACCCTTACC
1076 RNASEP_CLB_459_ TAAGGATAGTGCAACAG 162 RNASEP_CLB_498_522_R TTTACCTCGCCTTTCCA 1426
487_F AGATATACCGCC CCCTTACC
1077 ICD_CXB_93_120_F TCCTGACCGACCCATTA 343 ICD_CXB_172_194_R TAGGATTTTTCCACGGC 921
TTCCCTTTATC GGCATC
1078 ICD_CXB_92_120_F TTCCTGACCGACCCATT 671 ICD_CXB_172_194_R TAGGATTTTTCCACGGC 921
ATTCCCTTTATC GGCATC
1079 ICD_CXB_176_198_F TCGCCGTGGAAAAATCC 369 ICD_CXB_224_247_R TAGCCTTTTCTCCGGCG 916
TACGCT TAGATCT
1080 IS1111A_NC002971_ TCAGTATGTATCCACCG 290 IS1111A_NC002971_6928_ TAAACGTCCGATACCAA 848
6866_6891_F TAGCCAGTC 6954_R TGGTTCGCTC
1081 IS1111A_NC002971_ TGGGTGACATTCATCAA 594 IS1111A_NC002971_7529_ TCAACAACACCTCCTTA 952
7456_7483_F TTTCATCGTTC 7554_R TTCCCACTC
1082 RNASEP_RKP_419_ TGGTAAGAGCGCACCGG 599 RNASEP_RKP_542_565_R TCAAGCGATCTACCCGC 957
448_F TAAGTTGGTAACA ATTACAA
1083 RNASEP_RKP_422_ TAAGAGCGCACCGGTAA 159 RNASEP_RKP_542_565_R TCAAGCGATCTACCCGC 957
443_F GTTGG ATTACAA
1084 RNASEP_RKP_466_ TCCACCAAGAGCAAGAT 310 RNASEP_RKP_542_565_R TCAAGCGATCTACCCGC 957
491_F CAAATAGGC ATTACAA
1085 RNASEP_RKP_264_ TCTAAATGGTCGTGCAG 391 RNASEP_RKP_295_321_R TCTATAGAGTCCGGACT 1119
287_F TTGCGTG TTCCTCGTGA
1086 RNASEP_RKP_426_ TGCATACCGGTAAGTTG 497 RNASEP_RKP_542_565_R TCAAGCGATCTACCCGC 957
448_F GCAACA ATTACAA
1087 OMPB_RKP_860_890_F TTACAGGAAGTTTAGGT 654 OMPB_RKP_972_996_R TCCTGCAGCTCTACCTG 1051
GGTAATCTAAAAGG CTCCATTA
1088 OMPB_RKP_1192_ TCTACTGATTTTGGTAA 392 OMPB_RKP_1288_1315_R TAGCAgCAAAAGTTATC 910
1221_F TCTTGCAGCACAG ACACCTGCAGT
1089 OMPB_RKP_3417_ TGCAAGTGGTACTTCAA 485 OMPB_RKP_3520_3550_R TGGTTGTAGTTCCTGTA 1310
3440_F CATGGGG GTTGTTGCATTAAC
1090 GLTA_RKP_1043_ TGGGACTTGAAGCTATC 576 GLTA_RKP_1138_1162_R TGAACATTTGCGACGGT 1147
1072_F GCTCTTAAAGATG ATACCCAT
1091 GLTA_RKP_400_428_F TCTTCTCATCCTATGGC 413 GLTA_RKP_499_529_R TGGTGGGTATCTTAGCA 1305
TATTATGCTTGC ATCATTCTAATAGC
1092 GLTA_RKP_1023_ TCCGTTCTTACAAATAG 330 GLTA_RKP_1129_1156_R TTGGCGACGGTATACCC 1415
1055_F CAATAGAACTTGAAGC ATAGCTTTATA
1093 GLTA_RKP_1043_ TGGAGCTTGAAGCTATC 553 GLTA_RKP_1138_1162_R TGAACATTTGCGACGGT 1147
1072_2_F GCTCTTAAAGATG ATACCCAT
1094 GLTA_RKP_1043_ TGGAACTTGAAGCTCTC 543 GLTA_RKP_1138_1164 R TGTGAACATTTGCGACG 1330
1072_3_F GCTCTTAAAGATG GTATACCCAT
1095 GLTA_RKP_400_428_F TCTTCTCATCCTATGGC 413 GLTA_RKP_505_534_R TGCGATGGTAGGTATCT 1230
TATTATGCTTGC TAGCAATCATTCT
1096 CTXA_VBC_117_142_F TCTTATGCCAAGAGGAC 410 CTXA_VBC_194_218_R TGCCTAACAAATCCCGT 1226
AGAGTGAGT CTGAGTTC
1097 CTXA_VBC_351_377_F TGTATTAGGGGCATACA 630 CTXA_VBC_441_466_R TGTCATCAAGCACCCCA 1324
GTCCTCATCC AAATGAACT
1098 RNASEP_VBC_331_ TCCGCGGAGTTGACTGG 325 RNASEP_VBC_388_414_R TGACTTTCCTCCCCCTT 1163
349_F GT ATCAGTCTCC
1099 TOXR_VBC_135_158_F TCGATTAGGCAGCAACG 362 TOXR_VBC_221_246_R TTCAAAACCTTGCTCTC 1370
AAAGCCG GCCAAACAA
1100 ASD_FRT_1_29_F TTGCTTAAAGTTGGTTT 690 ASD_FRT_86_116_R TGAGATGTCGAAAAAAA 1164
TATTGGTTGGCG CGTTGGCAAAATAC
1101 ASD_FRT_43_76_F TCAGTTTTAATGTCTCG 295 ASD_FRT_129_156_R TCCATATTGTTGCATAA 1009
TATGATCGAATCAAAAG AACCTGTTGGC
1102 GALE_FRT_168_199_F TTATCAGCTAGACCTTT 658 GALE_FRT_241_269_R TCACCTACAGCTTTAAA 973
TAGGTAAAGCTAAGC GCCAGCAAAATG
1103 GALE_FRT_834_865_F TCAAAAAGCCCTAGGTA 245 GALE_FRT_901_925_R TAGCCTTGGCAACATCA 915
AAGAGATTCCATATC GCAAAACT
1104 GALE_FRT_308_339_F TCCAAGGTACACTAAAC 306 GALE_FRT_390_422_R TCTTCTGTAAAGGGTGG 1136
TTACTTGAGCTAATG TTTATTATTCATCCCA
1105 IPAH_SGF_258_277_F TGAGGACCGTGTCGCGC 458 IPAH_SGF_301_327_R TCCTTCTGATGCCTGAT 1055
TCA GGACCAGGAG
1106 IPAH_SGF_113_134_F TCCTTGACCGCCTTTCC 350 IPAH_SGF_172_191_R TTTTCCAGCCATGCAGC 1441
GATAC GAC
1107 IPAH_SGF_462_486_F TCAGACCATGCTCGCAG 271 IPAH_SGF_522_540_R TGTCACTCCCGACACGC 1322
AGAAACTT CA
1111 RNASEP_BRM_461_ TAAACCCCATCGGGAGC 147 RNASEP_BRM_542_561_R TGCCTCGCGCAACCTAC 1227
488_F AAGACCGAATA CCG
1112 RNASEP_BRM_325_ TACCCCAGGGAAAGTGC 185 RNASEP_BRM_402_428_R TCTCTTACCCCACCCTT 1125
347_F CACAGA TCACCCTTAC
1128 HUPB_CJ_113_134_F TAGTTGCTCAAACAGCT 230 HUPB_CJ_157_188_R TCCCTAATAGTAGAAAT 1028
GGGCT AACTGCATCAGTAGC
1129 HUPB_CJ_76_102_F TCCCGGAGCTTTTATGA 324 HUPB_CJ_157_188_R TCCCTAATAGTAGAAAT 1028
CTAAAGCAGAT AACTGCATCAGTAGC
1130 HUPB_CJ_76_102_F TCCCGGAGCTTTTATGA 324 HUPB_CJ_114_135_R TAGCCCAGCTGTTTGAG 913
CTAAAGCAGAT CAACT
1151 AS_MLST-11- TGAGATTGCTGAACATT 454 AB_MLST-11- TTGTACATTTGAAACAA 1418
OIF007_62_91_F TAATGCTGATTGA OIF007_169_203_R TATGCATGACATGTGAA
T
1152 AB_MLST-11- TATTGTTTCAAATGTAC 243 AB_MLST-11- TCACAGGTTCTACTTCA 969
OIF007_185_214_F AAGGTGAAGTGCG OIF007_291_324_R TCAATAATTTCCATTGC
1153 AB_MLST-11- TGGAACGTTATCAGGTG 541 AB_MLST-11- TTGCAATCGACATATCC 1400
OIF007_260_289_F CCCCAAAAATTCG OIF007_364_393_R ATTTCACCATGCC
1154 AB_MLST-11- TGAAGTGCGTGATGATA 436 AB_MLST-11- TCCGCCAAAAACTCCCC 1036
OIF007_206_239_F TCGATGCACTTGATGTA OIF007_318_344_R TTTTCACAGG
1155 AB_MLST-11- TCGGTTTAGTAAAAGAA 378 AB_MLST-11- TTCTGCTTGAGGAATAG 1392
OIF007_522_552_F CGTATTGCTCAACC OIF007_587_610_R TGCGTGG
1156 AB_MLST-11- TCAACCTGACTGCGTGA 250 AB_MLST-11- TACGTTCTACGATTTCT 902
OIF007_547_571_F ATGGTTGT OIF007_656_686_R TCATCAGGTACATC
1157 AB_MLST-11- TCAAGCAGAAGCTTTGG 256 AB_MLST-11- TACAACGTGATAAACAC 881
OIF007_601_627_F AAGAAGAAGG OIF007_710_736_R GACCAGAAGC
1158 AB_MLST-11- TCGTGCCCGCAATTTGC 384 AB_MLST-11- TAATGCCGGGTAGTGCA 878
OIF007_1202_1225_F ATAAAGC OIF007_1266_1296_R ATCCATTCTTCTAG
1159 AB_MLST-11- TCGTGCCCGCAATTTGC 384 AB_MLST-11- TGCACCTGCGGTCGAGC 1199
OIF007_1202_1225_F ATAAAGC OIF007_1299_1316_R G
1160 AB_MLST-11- TTGTAGCACAGCAAGGC 694 AB_MLST-11- TGCCATCCATAATCACG 1215
OIF007_1234_1264_F AAATTTCCTGAAAC OIF007_1335_1362_R CCATACTGACG
1161 AB_MLST-11- TAGGTTTACGTCAGTAT 225 AB_MLST-11- TGCCAGTTTCCACATTT 1212
OIF007_1327_1356_F GGCGTGATTATGG OIF007_1422_1448_R CACGTTCGTG
1162 AB_MLST-11- TCGTGATTATGGATGGC 383 AB_MLST-11- TCGCTTGAGTGTAGTCA 1083
OIF007_1345_1369_F AACGTGAA OIF007_1470_1494_R TGATTGCG
1163 AB_MLST-11- TTATGGATGGCAACGTG 662 AB_MLST-11- TCGCTTGAGTGTAGTCA 1083
OIF007_1351_1375_F AAACGCGT OIF007_1470_1494_R TGATTGCG
1164 AB_MLST-11- TCTTTGCCATTGAAGAT 422 AB_MLST-11- TCGCTTGAGTGTAGTCA 1083
OIF007_1387_1412_F GACTTAAGC OIF007_1470_1494_R TGATTGCG
1165 AB_MLST-11- TACTAGCGGTAAGCTTA 194 AB_MLST-11- TGAGTCGGGTTCACTTT 1173
OIF007_1542_1569_F AACAAGATTGC OIF007_1656_1680_R ACCTGGCA
1166 AB_MLST-11- TTGCCAATGATATTCGT 684 AB_MLST-11- TGAGTCGGGTTCACTTT 1173
OIF007_1566_1593_F TGGTTAGCAAG OIF007_1656_1680_R ACCTGGCA
1167 AB_MLST-11- TCGGCGAAATCCGTATT 375 AB_MLST-11- TACCGGAAGCACCAGCG 890
OIF007_1611_1638_F CCTGAAAATGA OIF007_1731_1757_R ACATTAATAG
1168 AB_MLST-11- TACCACTATTAATGTCG 182 AB_MLST-11- TGCAACTGAATAGATTG 1195
OIF007_1726_1752_F CTGGTGCTTC OIF007_1790_1821_R CAGTAAGTTATAAGC
1169 AB_MLST-11- TTATAACTTACTGCAAT 656 AB_MLST-11- TGAATTATGCAAGAAGT 1151
OIF007_1792_1826_F CTATTCAGTTGCTTGGT OIF007_1876_1909_R GATCAATTTTCTCACGA
G
1170 AB_MLST-11- TTATAACTTACTGCAAT 656 AB_MLST-11- TGCCGTAACTAACATAA 1224
OIF007_1792_1826_F CTATTCAGTTGCTTGGT OIF007_1895_1927_R GAGAATTATGCAAGAA
G
1171 AB_MLST-11- TGGTTATGTACCAAATA 618 AB_MLST-11- TGACGGCATCGATACCA 1157
OIF007_1970_2002_F CTTTGTCTGAAGATGG OIF007_2097_2118_R CCGTC
1172 RNASEP_BRM_461_ TAAACCCCATCGGGAGC 147 RNASEP_BRM_542_561_2_R TGCCTCGTGCAACCCAC 1228
488_F AAGACCGAATA CCG
2000 CTXB_NC002505_46_ TCAGCGTATGCACATGG 278 CTXB_NC002505_132_162_R TCCGGCTAGAGATTCTG 1039
70_F AACTCCTC TATACGACAATATC
2001 FUR_NC002505_87_ TGAGTGCCAACATATCA 465 FUR_NC002505_205_228_R TCCGCCTTCAAAATGGT 1037
113_F GTGCTGAAGA GGCGAGT
2002 FUR_NC002505_87_ TGAGTGCCAACATATCA 465 FUR_NC002505_178_205_R TCACGATACCTGCATCA 974
113_F GTGCTGAAGA TCAAATTGGTT
2003 GAPA_NC002505_533_ TCGACAACACCATTATC 356 GAPA_NC002505_646_671_R TCAGAATCGATGCCAAA 980
560_F TATGGTGTGAA TGCGTCATC
2004 GAPA_NC002505_694_ TCAATGAACGACCAACA 259 GAPA_NC002505_769_798_R TCCTCTATGCAACTTAG 1046
721_F AGTGATTGATG TATCAACAGGAAT
2005 GAPA_NC002505_753_ TGCTAGTCAATCTATCA 517 GAPA_NC0002505_856_881_R TCCATCGCAGTCACGTT 1011
782_F TTCCGGTTGATAC TACTGTTGG
2006 GYRB_NC002505_2_ TGCCGGACAATTACGAT 501 GYRB_NC002505_109_134_R TCCACCACCTCAAAGAC 1003
32_F TCATCGAGTATTAA CATGTGGTG
2007 GYRB_NC002505_123_ TGAGGTGGTGGATAACT 460 GYRB_NC002505_199_225_R TCCGTCATCGCTGACAG 1042
152_F CAATTGATGAAGC AAACTGAGTT
2008 GYRB_NC002505_768_ TATGCAGTGGAACGATG 236 GYRB_NC002505_832_860_R TGGAAACCGGCTAAGTG 1262
794_F GTTTCCAAGA AGTACCACCATC
2009 GYRB_NC002505_837_ TGGTACTCACTTAGCGG 603 GYRB_NC002505_937_957_R TCCTTCACGCGCATCAT 1054
860_F GTTTCCG CACC
2010 GYRB_NC002505_934_ TCGGGTGATGATGCGCG 377 GYRB_NC002505_982_1007_R TGGCTTGAGAATTTAGG 1283
956_F TGAAGG ATCCGGCAC
2011 GYRB_NC002505_ TAAAGCCCGTGAAATGA 148 GYRB_NC002505_1255_ TGAGTCACCCTCCACAA 1172
1161_1190_F CTCGTCGTAAAGG 1284_R TGTATAGTTCAGA
2012 OMPU_NC002505_85_ TACGCTGACGGAATCAA 190 OMPU_NC002505_154_180_R TGCTTCAGCACGGCCAC 1254
110_F CCAAAGCGG CAACTTCTAG
2013 OMPU_NC002505_258_ TGACGGCCTATACGGTG 451 OMPU_NC002505_346_369_R TCCGAGACCAGCGTAGG 1033
283_F TTGGTTTCT TGTAACG
2014 OMPU_NC002505_431_ TCACCGATATCATGGCT 266 OMPU_NC002505_544_567_R TCGGTCAGCAAAACGGT 1094
455_F TACCACGG AGCTTGC
2015 OMPU_NC002505_ TAGGCGTGAAAGCAAGC 223 OMPU_NC002505_625_651_R TAGAGAGTAGCCATCTT 908
533_557_F TACCGTTT CACCGTTGTC
2016 OMPU_NC002505_689_ TAGGTGCTGGTTACGCA 224 OMPU_NC002505_725_751_R TGGGGTAAGACGCGGCT 1291
713_F GATCAAGA AGCATGTATT
2017 OMPU_NC002505_727_ TACATGCTAGCCGCGTC 181 OMPU_NC002505_811_835_R TAGCAGCTAGCTCGTAA 911
747_F TTAC CCAGTGTA
2018 OMPU_NC002505_931_ TACTACTTCAAGCCGAA 193 OMPU_NC002505_1033_ TTAGAAGTCGTAACGTG 1368
953_F CTTCCG 1053_R GACC
2019 OMPU_NC002505_927_ TACTTACTACTTCAAGC 197 OMPU_NC002505_1033_ TGGTTAGAAGTCGTAAC 1307
953_F CGAACTTCCG 1054_R GTGGACC
2020 TCPA_NC002505_48_ TCACGATAAGAAAACCG 269 TCPA_NC002505_148_170_R TTCTGCGAATCAATCGC 1391
73_F GTCAAGAGG ACGCTG
2021 TDH_NC004605_265_ TGGCTGACATCCTACAT 574 TDH_NC004605_357_386_R TGTTGAAGCTGTACTTG 1351
289_F GACTGTGA ACCTGATTTTACG
2022 VVHA_NC004460_772_ TCTTATTCCAACTTCAA 412 VVHA_NC004460_862_886_R TACCAAAGCGTGCACGA 887
802_F ACCGAACTATGACG TAGTTGAG
2023 23S_EC_2643_2667_F TGCCTGTTCTTAGTACG 508 23S_EC_2746_2770_R TGGGTTTCGCGCTTAGA 1297
AGAGGACC TGCTTTCA
2024 16S_EC_713_732_ TAGAACACCGATGGCGA 202 16S_EC_789_811_R TGCGTGGACTACCAGGG 1240
TMOD_F AGGC TATCTA
2025 16S_EC_784_806_F TGGATTAGAGACCCTGG 560 16S_EC_880_897_TMOD_R TGGCCGTACTCCCCAGG 1278
TAGTCC CG
2026 16S_EC_959_981_F TGTCGATGCAACGCGAA 634 16S_EC_1052_1074_R TACGAGCTGACGACAGC 896
GAACCT CATGCA
2027 TUFB_EC_956_979_F TGCACACGCCGTTCTTC 489 TUFB_EC_1034_1058_2_R TGCATCACCATTTCCTT 1204
AACAACT GTCCTTCG
2028 RPOC_EC_2146_2174_ TCAGGAGTCGTTCAACT 284 RPOC_EC_2227_2249_R TGCTAGGCCATCAGGCC 1244
TMOD_F CGATCTACATGAT ACGCAT
2029 RPOB_EC_1841_1866_ TGGTTATCGCTCAGGCG 617 RPOB_EC_1909_1929_TMOD_R TGCTGGATTCGCCTTTG 1250
F AACTCCAAC CTACG
2030 RPLB_EC_650_679_ TGACCTACAGTAAGAGG 449 RPLB_EC_739_763_R TGCCAAGTGCTGGTTTA 1208
TMOD_F TTCTGTAATGAACC CCCCATGG
2031 RPLB_EC_690_710_F TCCACACGGTGGTGGTG 309 RPLB_EC_737_760_R TGGGTGCTGGTTTACCC 1295
AAGG CATGGAG
2032 INFB_EC_1366_1393_ TCTCGTGGTGCACAAGT 397 INFB_EC_1439_1469_R TGTGCTGCTTTCGCATG 1335
F AACGGATATTA GTTAATTGCTTCAA
2033 VALS_EC_1105_1124_ TCGTGGCGGCGTGGTTA 385 VALS_EC_1195_1219_R TGGGTACGAACTGGATG 1292
TMOD_F TCGA TCGCCGTT
2034 SSPE_BA_113_137_F TGCAAGCAAACGCACAA 482 SSPE_BA_197_222_TMOD_R TTGCACGTCTGTTTCAG 1402
TCAGAAGC TTGCAAATTC
2035 RPOC_EC_2218_2241_ TCTGGCAGGTATGCGTG 405 RPOC_EC_2313_2338_R TGGCACCGTGGGTTGAG 1273
TMOD_F GTCTGATG ATGAAGTAC
2056 MECI-R_NC003923- TTTACACATATCGTGAG 698 MECI-R_NC003923-41798- TTGTGATATGGAGGTGT 1420
41798-41609_33_60_ CAATGAACTGA 41609_86_113_R AGAAGGTGTTA
F
2057 AGR-III_NC003923- TCACCAGTTTGCCACGT 263 AGR-III_NC003923- ACCTGCATCCCTAAACG 730
2108074- ATCTTCAA 2108074-2109507_56_79_R TACTTGC
2109507_1_23_F
2058 AGR-III_NC003923- TGAGCTTTTAGTTGACT 457 AGR-III_NC003923- TACTTCAGCTTCGTCCA 906
2108074- TTTTCAACAGC 2108074-2109507_622_ ATAAAAAATCACAAT
2109507_569_596_F 653_R
2059 AGR-III_NC003923- TTTCACACAGCGTGTTT 701 AGR-III_NC003923- TGTAGGCAAGTGCATAA 1319
2108074-2109507_ ATAGTTCTACCA 2108074-2109507_1070_ GAAATTGATACA
1024_1052_F 1098_R
2060 AGR-I_AJ617706_ TGGTGACTTCATAATGG 610 AGR-I_AJ617706_694_726_R TCCCCATTTAATAATTC 1021
622_651_F ATGAAGTTGAAGT CACCTACTATCACACT
2061 AGR-I_AJ617706_ TGGCATTTTAAAAAACA 579 AGR-I_AJ617706_626_655_R TGGTACTTCAACTTCAT 1302
580_611_F TTGGTAACATCGCAC CCATTATGAAGTC
2062 AGR-II_NC002745- TCTTGCAGCAGTTTATT 415 AGR-II_NC002745-2079448- TTGTTTATTGTTTCCAT 1424
2079448-2080879_ TGATGAACCTAAAGT 2080879_700_731_R ATGCTACACACTTTC
620_651_F
2063 AGR-II_NC002745- TGTACCCGCTGAATTAA 624 AGR-II_NC002745-2079448- TCGCCATAGCTAAGTTG 1077
2079448-2080879_ CGAATTTATACGAC 2080879_715_745_R TTTATTGTTTCCAT
649_679_F
2064 AGR-IV_AJ617711_ TGGTATTCTATTTTGCT 606 AGR-IV_AJ617711_1004_ TGCGCTATCAACGATTT 1233
931_961_F GATAATGACCTCGC 1035_R TGACAATATATGTGA
2065 AGR-IV_AJ617711_ TGGCACTCTTGCCTTTA 562 AGR-IV_AJ617711_309_ TCCCATACCTATGGCGA 1017
250_283_F ATATTAGTAAACTATCA 335_R TAACTGTCAT
2066 BLAZ_NC002952 TCCACTTATCGCAAATG 312 BLAZ_NC002952 TGGCCACTTTTATCAGC 1277
(1913827 . . . GAAAATTAAGCAA (1913827 . . . 1914672)_ AACCTTACAGTC
1914672)_68_68_F 68_68_R
2067 BLAZ_NC002952 TGCACTTATCGCAAATG 494 BLAZ_NC002952 TAGTCTTTTGGAACACC 926
(1913827 . . . GAAAATTAAGCAA (1913827 . . . 1914672)_ GTCTTTAATTAAAGT
1914672)_68_68_2_F 68_68_2_R
2068 BLAZ_NC002952 TGATACTTCAACGCCTG 467 BLAZ_NC002952 TGGAACACCGTCTTTAA 1263
(1913827 . . . CTGCTTTC (1913827 . . . 1914672)_ TTAAAGTATCTCC
1914672)_68_68_3_F 68_68_3_R
2069 BLAZ_NC002952 TATACTTCAACGCCTGC 232 BLAZ_NC002952 TCTTTTCTTTGCTTAAT 1145
(1913827 . . . TGCTTTC (1913827 . . . 1914672)_ TTTCCATTTGCGAT
1914672)_68_68_4_F 68_68_4_R
2070 BLAZ_NC002952 TGCAATTGCTTTAGTTT 487 BLAZ_NC0002952 TTACTTCCTTACCACTT 1366
(1913827 . . . TAAGTGCATGTAATTC (1913827 . . . 1914672)_ TTAGTATCTAAAGCATA
1914672)_1_33_F 34_67_R
2071 BLAZ_NC002952 TCCTTGCTTTAGTTTTA 351 BLAZ_NC0002952 TGGGGACTTCCTTACCA 1289
(1913827 . . . AGTGCATGTAATTCAA (1913827 . . . 1914672)_ CTTTTAGTATCTAA
1914672)_3_34_F 40_68_R
2072 BSA-A_NC003923- TAGCGAATGTGGCTTTA 214 BSA-A_NC003923-1304065- TGCAAGGGAAACCTAGA 1197
1304065- CTTCACAATT 1303589_165_193_R ATTACAAACCCT
1303589_99_125_F
2073 BSA-A_NC003923- ATCAATTTGGTGGCCAA 32 BSA-A_NC003923-1304065- TGCATAGGGAAGGTAAC 1203
1304065- GAACCTGG 1303589_253_278_R ACCATAGTT
1303589_194_218_F
2074 BSA-A_NC003923- TTGACTGCGGCACAACA 679 BSA-A_NC003923-1304065- TAACAACGTTACCTTCG 856
1304065- CGGAT 1303589_388_415_R CGATCCACTAA
1303589_328_349_F
2075 BSA-A_NC003923- TGCTATGGTGTTACCTT 519 BSA-A_NC003923-1304065- TGTTGTGCCGCAGTCAA 1353
1304065- CCCTATGCA 1303589_317_344_R ATATCTAAATA
1303589_253_278_F
2076 BSA-B_NC003923- TAGCAACAAATATATCT 209 BSA-B_NC003923-1917149- TGTGAAGAACTTTCAAA 1331
1917149- GAAGCAGCGTACT 1914156_1011_1039_R TCTGTGAATCCA
1914156_953_982_F
2077 BSA-B_NC003923- TGAAAAGTATGGATTTG 426 BSA-B_NC003923-1917149- TCTTCTTGAAAAATTGT 1138
1917149- AACAACTCGTGAATA 1914156_1109_1136_R TGTCCCGAAAC
1914156_1050_1081_
F
2078 BSA-B_NC003923- TCATTATCATGCGCCAA 300 BSA-B_NC003923-1917149- TGGACTAATAACAATGA 1267
1917149- TGAGTGCAGA 1914156_1323_1353_R GCTCATTGTACTGA
1914156_1260_1286_
F
2079 BSA-B_NC003923- TTTCATCTTATCGAGGA 703 BSA-B_NC003923-1917149- TGAATATGTAATGCAAA 1148
1917149- CCCGAAATCGA 1914156_2186_2216_R CCAGTCTTTGTCAT
1914156_2126_2153_
F
2080 ERMA_NC002952- TCGCTATCTTATCGTTG 372 ERMA_NC002952-55890- TGAGTCTACACTTGGCT 1174
55890- AGAAGGGATT 56621_487_513_R TAGGATGAAA
56621_366_392_F
2081 ERMA_NC002952- TAGCTATCTTATCGTTG 217 ERMA_NC002952-55890- TGAGCATTTTTATATCC 1167
55890- AGAAGGGATTTGC 56621_438_465_R ATCTCCACCAT
56621_366_395_F
2082 ERMA_NC002952- TGATCGTTGAGAAGGGA 470 ERMA_NC002952-55890- TCTTGGCTTAGGATGAA 1143
55890- TTTGCGAAAAGA 56621_473_504_R AATATAGTGGTGGTA
56621_374_402_F
2083 ERMA_NC002952- TGCAAAATCTGCAACGA 480 ERMA_NC002952-55890- TCAATACAGAGTCTACA 964
55890- GCTTTGG 56621_491_520_R CTTGGCTTAGGAT
56621_404_427_F
2084 ERMA_NC002952- TCATCCTAAGCCAAGTG 297 ERMA_NC002952-55890- TGGACGATATTCACGGT 1266
55890- TAGACTCTGTA 56621_586_615_R TTACCCACTTATA
56621_489_516_F
2085 ERMA_NC002952- TATAAGTGGGTAAACCG 231 ERMA_NC002952-55890- TTGACATTTGCATGCTT 1397
55890- TGAATATCGTGT 56621_640_665_R CAAAGCCTG
56621_586_614_F
2086 ERMC_NC005908- TCTGAACATGATAATAT 399 ERMC_NC005908-2004- TCCGTAGTTTTGCATAA 1041
2004-2738_85_116_F CTTTGAAATCGGCTC 2738_173_206_R TTTATGGTCTATTTCAA
2087 ERMC_NC005908- TCATGATAATATCTTTG 298 ERMC_NC005908-2004- TTTATGGTCTATTTCAA 1429
2004-2738_90_120_F AAATCGGCTCAGGA 2738_160_189_R TGGCAGTTACGAA
2088 ERMC_NC005908- TCAGGAAAAGGGCATTT 283 ERMC_NC005908-2004- TATGGTCTATTTCAATG 936
2004-2738_115_139_ TACCCTTG 2738_161_187_R GCAGTTACGA
F
2089 ERMC_NC005908- TAATCGTGGAATACGGG 168 ERMC_NC005908-2004- TCAACTTCTGCCATTAA 956
2004-2738_374_397_ TTTGCTA 2738_425_452_R AAGTAATGCCA
F
2090 ERMC_NC005908- TCTTTGAAATCGGCTCA 421 ERMC_NC005908-2004- TGATGGTCTATTTCAAT 1185
2004-2738_101_125_ GGAAAAGG 2738_159_188_R GGCAGTTACGAAA
F
2091 ERMB_Y13600-625- TGTTGGGAGTATTCCTT 644 ERMB_Y13600-625- TCAACAATCAGATAGAT 953
1362_291_321_F ACCATTTAAGCACA 1362_352_380_R GTCAGACGCATG
2092 ERMB_Y13600-625- TGGAAAGCCATGCGTCT 536 ERMB_Y13600-625- TGCAAGAGCAACCCTAG 1196
1362_344_367_F GACATCT 1362_415_437_R TGTTCG
2093 ERMB_Y13600-625- TGGATATTCACCGAACA 556 ERMB_Y13600-625- TAGGATGAAAGCATTCC 919
1362_404_429_F CTAGGGTTG 1362_471_493_R GCTGGC
2094 ERMB_Y13600-625- TAAGCTGCCAGCGGAAT 161 ERMB_Y13600-625- TCATCTGTGGTATGGCG 989
1362_465_487_F GCTTTC 1362_521_545_R GGTAAGTT
2095 PVLUK_NC003923- TGAGCTGCATCAACTGT 456 PVLUK_NC003923-1529595- TGGAAAACTCATGAAAT 1261
1529595- ATTGGATAG 1531285_775_804_R TAAAGTGAAAGGA
1531285_688_713_F
2096 PVLUK_NC003923- TGGAACAAAATAGTCTC 539 PVLUK_NC003923-1529595- TCATTAGGTAAAATGTC 993
1529595- TCGGATTTTGACT 1531285_1095_1125_R TGGACATGATCCAA
1531285_1039_1068_
F
2097 PVLUK_NC003923- TGAGTAACATCCATATT 461 PVLUK_NC003923-1529595- TCTCATGAAAAAGGCTC 1124
1529595- TCTGCCATACGT 1531285_950_978_R AGGAGATACAAG
1531285_908_936_F
2098 PVLUK_NC003923- TCGGAATCTGATGTTGC 373 PVLUK_NC003923-1529595- TCACACCTGTAAGTGAG 968
1529595- AGTTGTT 1531285_654_682_R AAAAAGGTTGAT
1531285_610_633_F
2099 SA442_NC003923- TGTCGGTACACGATATT 635 SA442_NC003923-2538576- TTTCCGATGCAACGTAA 1433
2538576- CTTCACGA 2538831_98_124_R TGAGATTTCA
2538831_11_35_F
2100 SA442_NC003923- TGAAATCTCATTACGTT 427 SA442_NC003923-2538576- TCGTATGACCAGCTTCG 1098
2538576- GCATCGGAAA 2538831_163_188_R GTACTACTA
2538831_98_124_F
2101 SA442_NC003923- TCTCATTACGTTGCATC 395 SA442_NC003923-2538576- TTTATGACCAGCTTCGG 1428
2538576- GGAAACA 2538831_161_187_R TACTACTAAA
2538831_103_126_F
2102 SA442_NC003923- TAGTACCGAAGCTGGTC 226 SA442_NC003923-2538576- TGATAATGAAGGGAAAC 1179
2538576- ATACGA 2538831_231_257_R CTTTTTCACG
2538831_166_188_F
2103 SEA_NC003923- TGCAGGGAACAGCTTTA 495 SEA_NC003923-2052219- TCGATCGTGACTCTCTT 1070
2052219- GGCA 2051456_173_200_R TATTTTCAGTT
2051456_115_135_F
2104 SEA_NC003923- TAACTCTGATGTTTTTG 156 SEA_NC003923-2052219- TGTAATTAACCGAAGGT 1315
2052219- ATGGGAAGGT 2051456_621_651_R TCTGTAGAAGTATG
2051456_572_598_F
2105 SEA_NC003923- TGTATGGTGGTGTAACG 629 SEA_NC003923-2052219- TAACCGTTTCCAAAGGT 861
2052219- TTACATGATAATAATC 2051456_464_492_R ACTGTATTTTGT
2051456_382_414_F
2106 SEA_NC003923- TTGTATGTATGGTGGTG 695 SEA_NC003923-2052219- TAACCGTTTCCAAAGGT 862
2052219- TAACGTTACATGA 2051456_459_492_R ACTGTATTTTGTTTACC
2051456_377_406_F
2107 SEB_NC002758- TTTCACATGTAATTTTG 702 SEB_NC002758-2135540- TCATCTGGTTTAGGATC 988
2135540- ATATTCGCACTGA 2135140_273_298_R TGGTTGACT
2135140_208_237_F
2108 SEB_NC002758- TATTTCACATGTAATTT 244 SEB_NC002758-2135540- TGCAACTCATCTGGTTT 1194
2135540- TGATATTCGCACT 2135140_281_304_R AGGATCT
2135140_206_235_F
2109 SEB_NC002758- TAACAACTCGCCTTATG 151 SEB_NC002758-2135540- TGTGCAGGCATCATGTC 1334
2135540- AAACGGGATATA 2135140_402_402_R ATACCAA
2135140_402_402_F
2110 SEB_NC002758- TTGTATGTATGGTGGTG 696 SEB_NC002758-2135540- TTACCATCTTCAAATAC 1361
2135540- TAACTGAGCA 2135140_402_402_2_R CCGAACAGTAA
2135140_402_402_2_F
2111 SEC_NC003923- TTAACATGAAGGAAACC 648 SEC_NC003923-651678- TGAGTTTGCACTTCAAA 1177
851678- ACTTTGATAATGG 852768_620_647_R AGAAATTGTGT
852768_546_575_F
2112 SEC_NC003923- TGGAATAACAAAACATG 546 SEC_NC003923-851678- TCAGTTTGCACTTCAAA 985
851678- AAGGAAACCACTT 852768_619_647_R AGAAATTGTGTT
852768_537_566_F
2113 SEC_NC003923- TGAGTTTAACAGTTCAC 466 SEC_NC003923-851678- TCGCCTGGTGCAGGCAT 1078
851678- CATATGAAACAGG 852768_794_815_R CATAT
852768_720_749_F
2114 SEC_NC003923- TGGTATGATATGATGCC 604 SEC_NC003923-851678- TCTTCACACTTTTAGAA 1133
851678- TGCACCA 852768_853_886_R TCAACCGTTTTATTGTC
852768_787_810_F
2115 SED_M28521_657_ TGGTGGTGAAATAGATA 615 SED_M28521_741_770_R TGTACACCATTTATCCA 1318
682_F GGACTGCTT CAAATTGATTGGT
2116 SED_M28521_690_ TGGAGGTGTCACTCCAC 554 SED_M28521_739_770_R TGGGCACCATTTATCCA 1288
711_F ACGAA CAAATTGATTGGTAT
2117 SED_M28521_833_ TTGCACAAGCAAGGCGC 683 SED_M28521_888_911_R TCGCGCTGTATTTTTCC 1079
854_F TATTT TCCGAGA
2118 SED_M28521_962_ TGGATGTTAAGGGTGAT 559 SED_M28521_1022_1048_R TGTCAATATGAAGGTGC 1320
987_F TTTCCCGAA TCTGTGGATA
2119 SEA-SEE_NC002952- TTTACACTACTTTTATT 699 SEA-SEE_NC002952- TCATTTATTTCTTCGCT 994
2131289- CATTGCCCTAACG 2131289-2130703_71_98_R TTTCTCGCTAC
2130703_16_45_F
2120 SEA-SEE_NC002952- TGATCATCCGTGGTATA 469 SEA-SEE_NC002952- TAAGCACCATATAAGTC 870
2131289- ACGATTTATTAGT 2131289-2130703_314_ TACTTTTTTCCCTT
2130703_249_278_F 344_R
2121 SEE_NC002952- TGACATGATAATAACCG 445 SEE_NC002952-2131289- TCTATAGGTACTGTAGT 1120
2131289- ATTGACCGAAGA 2130703_465_494_R TTGTTTTCCGTCT
2130703_409_437_F
2122 SEE_NC002952- TGTTCAAGAGCTAGATC 640 SEE_NC002952-2131289- TTTGCACCTTACCGCCA 1436
2131289- TTCAGGCAA 2130703_586_586_R AAGCT
2130703_525_550_F
2123 SEE_NC002952- TGTTCAAGAGCTAGATC 639 SEE_NC002952-2131289- TACCTTACCGCCAAAGC 892
2131289- TTCAGGCA 2130703_586_586_2_R TGTCT
2130703_525_549_F
2124 SEE_NC002952- TCTGGAGGCACACCAAA 403 SEE_NC002952-2131289- TCCGTCTATCCACAAGT 1043
2131289- TAAAACA 2130703_444_471_R TAATTGGTACT
2130703_361_384_F
2125 SEG_NC002758- TGCTCAACCCGATCCTA 520 SEG_NC002758-1955100- TAACTCCTCTTCCTTCA 863
1955100- AATTAGACGA 1954171_321_346_R ACAGGTGGA
1954171_225_251_F
2126 SEG_NC002758- TGGACAATAGACAATCA 548 SEG_NC002758-1955100- TGCTTTGTAATCTAGTT 1260
1955100- CTTGGATTTACA 1954171_671_702_R CCTGAATAGTAACCA
1954171_623_651_F
2127 SEG_NC002758- TGGAGGTTGTTGTATGT 555 SEG_NC002758-1955100- TGTCTATTGTCGATTGT 1329
1955100- ATGGTGGT 1954171_607_635_R TACCTGTACAGT
1954171_540_564_F
2128 SEG_NC002758- TACAAAGCAAGACACTG 173 SEG_NC002758-1955100- TGATTCAAATGCAGAAC 1187
1955100- GCTCACTA 1954171_735_762_R CATCAAACTCG
1954171_694_718_F
2129 SEH_NC002953- TTGCAACTGCTGATTTA 682 SEH_NC002953-60024- TAGTGTTGTACCTCCAT 927
60024- GCTCAGA 60977_547_576_R ATAGACATTCAGA
60977_449_472_F
2130 SEH_NC002953- TAGAAATCAAGGTGATA 201 SEH_NC002953-60024- TTCTGAGCTAAATCAGC 1390
60024- GTGGCAATGA 60977_450_473_R AGTTGCA
60977_408_434_F
2131 SEH_NC002953- TCTGAATGTCTATATGG 400 SEH_NC002953-60024- TACCATCTACCCAAACA 888
60024- AGGTACAACACTA 60977_608_634_R TTAGCACCAA
60977_547_576_F
2132 SEH_NC002953- TTCTGAATGTCTATATG 677 SEH_NC002953-60024- TAGCACCAATCACCCTT 909
60024- GAGGTACAACACT 60977_594_616_R TCCTGT
60977_546_575_F
2133 SEI_NC002758- TCAACTCGAATTTTCAA 253 SEI_NC002758-1957830- TCACAAGGACCATTATA 966
1957830- CAGGTACCA 1956949_419_446_R ATCAATGCCAA
1956949_324_349_F
2134 SEI_NC002758- TTCAACAGGTACCAATG 666 SEI_NC002758-1957830- TGTACAAGGACCATTAT 1316
1957830- ATTTGATCTCA 1956949_420_447_R AATCAATGCCA
1956949_336_363_F
2135 SEI_NC002758- TGATCTCAGAATCTAAT 471 SEI_NC002758-1957830- TCTGGCCCCTCCATACA 1129
1957830- AATTGGGACGAA 1956949_449_474_R TGTATTTAG
1956949_356_384_F
2136 SEI_NC002758- TCTCAAGGTGATATTGG 394 SEI_NC002758-1957830- TGGGTAGGTTTTTATCT 1293
1957830- TGTAGGTAACTTAA 1956949_290_316_R GTGACGCCTT
1956949_223_253_F
2137 SEJ_AF053140_1307_ TGTGGAGTAACACTGCA 637 SEJ_AF053140_1381_1404_R TCTAGCGGAACAACAGT 1118
1332_F TGAAAACAA TCTGATG
2138 SEJ_AF053140_1378_ TAGCATCAGAACTGTTG 211 SEJ_AF053140_1429_1458_R TCCTGAAGATCTAGTTC 1049
1403_F TTCCGCTAG TTGAATGGTTACT
2139 SEJ_AF053140_1431_ TAACCATTCAAGAACTA 153 SEJ_AF053140_1500_1531_R TAGTCCTTTCTGAATTT 925
1459_F GATCTTCAGGCA TACCATCAAAGGTAC
2140 SEJ_AF053140_1434_ TCATTCAAGAACTAGAT 301 SEJ_AF053140_1521_1549_R TCAGGTATGAAACACGA 984
1461_F CTTCAGGCAAG TTAGTCCTTTCT
2141 TSST_NC002758- TGGTTTAGATAATTCCT 619 TSST_NC002758-2137564- TGTAAAAGCAGGGCTAT 1312
2137564- TAGGATCTATGCGT 2138293_278_305_R AATAAGGACTC
2138293_206_236_F
2142 TSST_NC002758- TGCGTATAAAAAACACA 514 TSST_NC002758-2137564- TGCCCTTTTGTAAAAGC 1221
2137564- GATGGCAGCA 2138293_289_313_R AGGGCTAT
2138293_232_258_F
2143 TSST_NC002758- TCCAAATAAGTGGCGTT 304 TSST_NC002758-2137564- TACTTTAAGGGGCTATC 907
2137564- ACAAATACTGAA 2138293_448_478_R TTTACCATGAACCT
2138293_382_410_F
2144 TSST_NC002758- TCTTTTACAAAAGGGGA 423 TSST_NC002758-2137564- TAAGTTCCTTCGCTAGT 874
2137564- AAAAGTTGACTT 2138293_347_373_R ATGTTGGCTT
2138293_297_325_F
2145 ARCC_NC003923- TCGCCGGCAATGCCATT 368 ARCC_NC003923-2725050- TGAGTTAAAATGCGATT 1175
2725050- GGATA 2724595_97_128_R GATTTCAGTTTCCAA
2724595_37_58_F
2146 ARCC_NC003923- TGAATAGTGATAGAACT 437 ARCC_NC003923-2725050- TCTTCTTCTTTCGTATA 1137
2725050- GTAGGCACAATCGT 2724595_214_245_R AAAAGGACCAATTGG
2724595_131_161_F
2147 ARCC_NC003923- TTGGTCCTTTTTATACG 691 ARCC_NC003923-2725050- TGGTGTTCTAGTATAGA 1306
2725050- AAAGAAGAAGTTGAA 2724595_322_353_R TTGAGGTAGTGGTGA
2724595_218_249_F
2148 AROE_NC003923- TTGCGAATAGAACGATG 686 AROE_NC003923-1674726- TCGAATTCAGCTAAATA 1064
1674726- GCTCGT 1674277_435_464_R CTTTTCAGCATCT
1674277_371_393_F
2149 AROE_NC003923- TGGGGCTTTAAATATTC 590 AROE_NC003923-1674726- TACCTGCATTAATCGCT 891
1674726- CAATTGAAGATTTTCA 1674277_155_181_R TGTTCATCAA
1674277_30_62_F
2150 AROE_NC003923- TGATGGCAAGTGGATAG 474 AR0E_NC003923-1674726- TAAGCAATACCTTTACT 869
1674726- GGTATAATACAG 1674277_308_335_R TGCACCACCTG
1674277_204_232_F
2151 GLPF_NC003923- TGCACCGGCTATTAAGA 491 GLPF_NC003923-1296927- TGCAACAATTAATGCTC 1193
1296927- ATTACTTTGCCAACT 1297391_382_414_R CGACAATTAAAGGATT
1297391_270_301_F
2152 GLPF_NC003923- TGGATGGGGATTAGCGG 558 GLPF_NC003923-1296927- TAAAGACACCGCTGGGT 850
1296927- TTACAATG 1297391_81_108_R TTAAATGTGCA
1297391_27_51_F
2153 GLPF_NC003923- TAGCTGGCGCGAAATTA 218 GLPF_NC003923-1296927- TCACCGATAAATAAAAT 972
1296927- GGTGT 1297391_323_359_R ACCTAAAGTTAATGCCA
1297391_239_260_F TTG
2154 GMK_NC003923- TACTTTTTTAAAACTAG 200 GMK_NC003923-1190906- TGATATTGAACTGGTGT 1180
1190906- GGATGCGTTTGAAGC 1191334_166_197_R ACCATAATAGTTGCC
1191334_91_122_F
2155 GMK_NC003923- TGAAGTAGAAGGTGCAA 435 GMK_NC003923-1190906- TCGCTCTCTCAAGTGAT 1082
1190906- AGCAAGTTAGA 1191334_305_333_R CTAAACTTGGAG
1191334_240_267_F
2156 GMK_NC003923- TCACCTCCAAGTTTAGA 268 GMK_NC003923-1190906- TGGGACGTAATCGTATA 1284
1190906- TCACTTGAGAGA 1191334_403_432_R AATTCATCATTTC
1191334_301_329_F
2157 PTA_NC003923- TCTTGTTTATGCTGGTA 418 PTA_NC003923-628885- TGGTACACCTGGTTTCG 1301
628885- AAGCAGATGG 629355_314_345_R TTTTGATGATTTGTA
629355_237_263_F
2158 PTA_NC003923- TGAATTAGTTCAATCAT 439 PTA_NC003923-628885- TGCATTGTACCGAAGTA 1207
628885- TTGTTGAACGACGT 629355_211_239_R GTTCACATTGTT
629355_141_171_F
2159 PTA_NC003923- TCCAAACCAGGTGTATC 303 PTA_NC003923-628885- TGTTCTGGATTGATTGC 1349
628885- AAGAACATCAGG 629355_393_422_R ACAATCACCAAAG
629355_328_356_F
2160 TPI_NC003923- TGCAAGTTAAGAAAGCT 486 TPI_NC003923-830671- TGAGATGTTGATGATTT 1165
830671- GTTGCAGGTTTAT 831072_209_239_R ACCAGTTCCGATTG
831072_131_160_F
2161 TPI_NC003923- TCCCACGAAACAGATGA 318 TPI_NC003923-830671- TGGTACAACATCGTTAG 1300
830671- AGAAATTAACAAAAAAG 831072_97_129_R CTTTACCACTTTCACG
831072_1_34_F
2162 TPI_NC003923- TCAAACTGGGCAATCGG 246 TPI_NC003923-830671- TGGCAGCAATAGTTTGA 1275
830671- AACTGGTAAATC 831072_253_286_R CGTACAAATGCACACAT
831072_199_227_F
2163 YQI_NC003923- TGAATTGCTGCTATGAA 440 YQI_NC003923-378916- TCGCCAGCTAGCACGAT 1076
378916- AGGTGGCTT 379431_259_284_R GTCATTTTC
379431_142_167_F
2164 YQI_NC003923- TACAACATATTATTAAA 175 YQI_NC003923-378916- TTCGTGCTGGATTTTGT 1388
378916- GAGACGGGTTTGAATCC 379431_120_145_R CCTTGTCCT
379431_44_77_F
2165 YQI_NC003923- TCCAGCACGAATTGCTG 314 YQI_NC003923-378916- TCCAACCCAGAACCACA 997
378916- CTATGAAAG 379431_193_221_R TACTTTATTCAC
379431_135_160_F
2166 YQI_NC003923- TAGCTGGCGGTATGGAG 219 YQI_NC003923-378916- TCCATCTGTTAAACCAT 1013
378916- AATATGTCT 379431_364_396_R CATATACCATGCTATC
379431_275_300_F
2167 BLAZ_ TCCACTTATCGCAAATG 312 BLAZ_ TGGCCACTTTTATCAGC 1277
(1913827 . . . GAAAATTAAGCAA (1913827 . . . 1914672)_ AACCTTACAGTC
1914672)_546_575_F 655_683_R
2168 BLAZ_ TGCACTTATCGCAAATG 494 BLAZ_ TAGTCTTTTGGAACACC 926
(1913827 . . . GAAAATTAAGCAA (1913827 . . . 1914672)_ GTCTTTAATTAAAGT
1914672)_546_575 628_659_R
2_F
2169 BLAZ_ TGATACTTCAACGCCTG 467 BLAZ_ TGGAACACCGTCTTTAA 1263
(1913827 . . . CTGCTTTC (1913827 . . . 1914672)_ TTAAAGTATCTCC
1914672)_507_531_F 622_651_R
2170 BLAZ_ TATACTTCAACGCCTGC 232 BLAZ_ TCTTTTCTTTGCTTAAT 1145
(1913827 . . . TGCTTTC (1913827 . . . 1914672)_ TTTCCATTTGCGAT
1914672)_508_531_F 553_583_R
2171 BLAZ_ TGCAATTGCTTTAGTTT 487 BLAZ_ TTACTTCCTTACCACTT 1366
(1913827 . . . TAAGTGCATGTAATTC (1913827 . . . 1914672)_ TTAGTATCTAAAGCATA
1914672)_24_56_F 121_154_R
2172 BLAZ_ TCCTTGCTTTAGTTTTA 351 BLAZ_ TGGGGACTTCCTTACCA 1289
(1913827 . . . AGTGCATGTAATTCAA (1913827 . . . 1914672)_ CTTTTAGTATCTAA
1914672)_26_58_F 127_157_R
2173 BLAZ_NC002952- TCCACTTATCGCAAATG 312 BLAZ_NC002952-1913827- TGGCCACTTTTATCAGC 1277
1913827- GAAAATTAAGCAA 1914672_655_683_R AACCTTACAGTC
1914672_546_575_F
2174 BLAZ_NC002952- TGCACTTATCGCAAATG 494 BLAZ_NC002952-1913827- TAGTCTTTTGGAACACC 926
1913827- GAAAATTAAGCAA 1914672_628_659_R GTCTTTAATTAAAGT
1914672_546_575_
2_F
2175 BLAZ_NC002952- TGATACTTCAACGCCTG 467 BLAZ_NC002952-1913827- TGGAACACCGTCTTTAA 1263
1913827- CTGCTTTC 1914672_622_651_R TTAAAGTATCTCC
1914672_507_531_F
2176 BLAZ_NC002952- TATACTTCAACGCCTGC 232 BLAZ_NC002952-1913827- TCTTTTCTTTGCTTAAT 1145
1913827- TGCTTTC 1914672_553_583_R TTTCCATTTGCGAT
1914672_508_531_F
2177 BLAZ_NC002952- TGCAATTGCTTTAGTTT 487 BLAZ_NC002952-1913827- TTACTTCCTTACCACTT 1366
1913827- TAAGTGCATGTAATTC 1914672_121_154_R TTAGTATCTAAAGCATA
1914672_24_56_F
2178 BLAZ_NC002952- TCCTTGCTTTAGTTTTA 351 BLAZ_NC002952-1913827- TGGGGACTTCCTTACCA 1289
1913827- AGTGCATGTAATTCAA 1914672_127_157_R CTTTTAGTATCTAA
1914672_26_58_F
2247 TUFB_NC002758- TGTTGAACGTGGTCAAA 643 TUFB_NC002758-615038- TGTCACCAGCTTCAGCG 1321
615038- TCAAAGTTGGTG 616222_793_820_R TAGTCTAATAA
616222_693_721_F
2248 TUFB_NC002758- TCGTGTTGAACGTGGTC 386 TUFB_NC002758-615038- TGTCACCAGCTTCAGCG 1321
615038- AAATCAAAGT 616222_793_820_R TAGTCTAATAA
616222_690_716_F
2249 TUFB_NC002758- TGAACGTGGTCAAATCA 430 TUFB_NC002758-615038- TGTCACCAGCTTCAGCG 1321
615038- AAGTTGGTGAAGA 616222_793_820_R TAGTCTAATAA
616222_696_725_F
2250 TUFB_NC002758- TCCCAGGTGACGATGTA 320 TUFB_NC002758-615038- TGGTTTGTCAGAATCAC 1311
615038- CCTGTAATC 616222_601_630_R GTTCTGGAGTTGG
616222_488_513_F
2251 TUFB_NC002758- TGAAGGTGGACGTCACA 433 TUFB_NC002758-615038- TAGGCATAACCATTTCA 922
615038- CTCCATTCTTC 616222_1030_1060_R GTACCTTCTGGTAA
616222_945_972_F
2252 TUFB_NC002758- TCCAATGCCACAAACTC 307 TUFB_NC002758-615038- TTCCATTTCAACTAATT 1382
615038- GTGAACA 616222_424_459_R CTAATAATTCTTCATCG
616222_333_356_F TC
2253 NUC_NC002758- TCCTGAAGCAAGTGCAT 342 NUC_NC002758-894288- TACGCTAAGCCACGTCC 899
894288- TTACGA 894974_483_509_R ATATTTATCA
894974_402_424_F
2254 NUC_NC002758- TCCTTATAGGGATGGCT 349 NUC_NC002758-894288- TGTTTGTGATGCATTTG 1354
894288- ATCAGTAATGTT 894974_165_189_R CTGAGCTA
894974_53_81_F
2255 NUC_NC002758- TCAGCAAATGCATCACA 273 NUC_NC002758-894288- TAGTTGAAGTTGCACTA 928
894288- AACAGATAA 894974_222_250_R TATACTGTTGGA
894974_169_194_F
2256 NUC_NC002758- TACAAAGGTCAACCAAT 174 NUC_NC002758-894288- TAAATGCACTTGCTTCA 853
894288- GACATTCAGACTA 894974_396_421_R GGGCCATAT
894974_316_345_F
2270 RPOB_EC_3798_3821_ TGGCCAGCGCTTCGGTG 566 RPOB_EC_3868_3895_R TCACGTCGTCCGACTTC 979
1_F AAATGGA ACGGTCAGCAT
2271 RPOB_EC_3789_3812_ TCAGTTCGGCGGTCAGC 294 RPOB_EC_3860_3890_R TCGTCGGACTTAACGGT 1107
F GCTTCGG CAGCATTTCCTGCA
2272 RPOB_EC_3789_3812_ TCAGTTCGGCGGTCAGC 294 RPOB_EC_3860_3890_2_R TCGTCCGACTTAACGGT 1102
F GCTTCGG CAGCATTTCCTGCA
2273 RPOB_EC_3789_3812_ TCAGTTCGGCGGTCAGC 294 RPOB_EC_3862_3890_R TCGTCGGACTTAACGGT 1106
F GCTTCGG CAGCATTTCCTG
2274 RPOB_EC_3789_3812_ TCAGTTCGGCGGTCAGC 294 RPOB_EC_3862_3890_2_R TCGTCCGACTTAACGGT 1101
F GCTTCGG CAGCATTTCCTG
2275 RPOB_EC_3793_3812_ TTCGGCGGTCAGCGCTT 674 RPOB_EC_3865_3890_R TCGTCGGACTTAACGGT 1105
F CGG CAGCATTTC
2276 RPOB_EC_3793_3812_ TTCGGCGGTCAGCGCTT 674 RPOB_EC_3865_3890_2_R TCGTCCGACTTAACGGT 1100
F CGG CAGCATTTC
2309 MUPR_X75439_1658_ TCCTTTGATATATTATG 352 MUPR_X75439_1744_1773_R TCCCTTCCTTAATATGA 1030
1689_F CGATGGAAGGTTGGT GAAGGAAACCACT
2310 MUPR_X75439_1330_ TTCCTCCTTTTGAAAGC 669 MUPR_X75439_1413_1441_R TGAGCTGGTGCTATATG 1171
1353_F GACGGTT AACAATACCAGT
2312 MUPR_X75439_1314_ TTTCCTCCTTTTGAAAG 704 MUPR_X75439_1381_1409_R TATATGAACAATACCAG 931
1338_F CGACGGTT TTCCTTCTGAGT
2313 MUPR_X75439_2486_ TAATTGGGCTCTTTCTC 172 MUPR_X75439_2548_2574_R TTAATCTGGCTGCGGAA 1360
2516_F GCTTAAACACCTTA GTGAAATCGT
2314 MUPR_X75439_2547_ TACGATTTCACTTCCGC 188 MUPR_X75439_2605_2630_R TCGTCCTCTCGAATCTC 1103
2572_F AGCCAGATT CGATATACC
2315 MUPR_X75439_2666_ TGCGTACAATACGCTTT 513 MUPR_X75439_2711_2740_R TCAGATATAAATGGAAC 981
2696_F ATGAAATTTTAACA AAATGGAGCCACT
2316 MUPR_X75439_2813_ TAATCAAGCATTGGAAG 165 MUPR_X75439_2867_2890_R TCTGCATTTTTGCGAGC 1127
2843_F ATGAAATGCATACC CTGTCTA
2317 MUPR_X75439_884_ TGACATGGACTCCCCCT 447 MUPR_X75439_977_1007_R TGTACAATAAGGAGTCA 1317
914_F ATATAACTCTTGAG CCTTATGTCCCTTA
2318 CTXA_NC002505- TGGTCTTATGCCAAGAG 608 CTXA_NC002505-1568114- TCGTGCCTAACAAATCC 1109
1568114- GACAGAGTGAGT 1567341_194_221_R CGTCTGAGTTC
1567341_114_142_F
2319 CTXA_NC002505- TCTTATGCCAAGAGGAC 411 CTXA_NC002505-1568114- TCGTGCCTAACAAATCC 1109
1568114- AGAGTGAGTACT 1567341_194_221_R CGTCTGAGTTC
1567341_117_145_F
2320 CTXA_NC002505- TGGTCTTATGCCAAGAG 608 CTXA_NC002505-1568114- TAACAAATCCCGTCTGA 855
1568114- GACAGAGTGAGT 1567341_186_214_R GTTCCTCTTGCA
1567341_114_142_F
2321 CTXA_NC002505- TCTTATGCCAAGAGGAC 411 CTXA_NC002505-1568114- TAACAAATCCCGTCTGA 855
1568114- AGAGTGAGTACT 1567341_186_214_R GTTCCTCTTGCA
1567341_117_145_F
2322 CTXA_NC002505- AGGACAGAGTGAGTACT 27 CTXA_NC002505-1568114- TCCCGTCTGAGTTCCTC 1027
1568114- TTGACCGAGGT 1567341_180_207_R TTGCATGATCA
1567341_129_156_F
2323 CTXA_NC002505- TGCCAAGAGGACAGAGT 500 CTXA_NC002505-1568114- TAACAAATCCCGTCTGA 855
1568114- GAGTACTTTGA 1567341_186_214_R GTTCCTCTTGCA
1567341_122_149_F
2324 INV_U22457-74- TGCTTATTTACCTGCAC 530 INV_U22457-74- TGACCCAAAGCTGAAAG 1154
3772_831_858_F TCCCACAACTG 3772_942_966_R CTTTACTG
2325 INV_U22457-74- TGAATGCTTATTTACCT 438 INV_U22457-74- TAACTGACCCAAAGCTG 864
3772_827_857_F GCACTCCCACAACT 3772_942_970_R AAAGCTTTACTG
2326 INV_U22457-74- TGCTGGTAACAGAGCCT 526 INV_U22457-74- TGGGTTGCGTTGCAGAT 1296
3772_1555_1581_F TATAGGCGCA 3772_1619_1647_R TATCTTTACCAA
2327 INV_U22457-74- TGGTAACAGAGCCTTAT 598 INV_U22457-74- TCATAAGGGTTGCGTTG 987
3772_1558_1585_F AGGCGCATATG 3772_1622_1652_R CAGATTATCTTTAC
2328 ASD_NC006570- TGAGGGTTTTATGCTTA 459 ASD_NC006570-439714- TGATTCGATCATACGAG 1188
439714- AAGTTGGTTTTATTGGT 438608_54_84_R ACATTAAAACTGAG
438608_3_37_F T
2329 ASD_NC006570- TAAAGTTGGTTTTATTG 149 ASD_NC006570-439714- TCAAAATCTTTTGATTC 948
439714- GTTGGCGCGGA 438608_66_95_R GATCATACGAGAC
438608_18_45_F
2330 ASD_NC006570- TTAAAGTTGGTTTTATT 647 ASD_NC006570-439714- TCCCAATCTTTTGATTC 1016
439714- GGTTGGCGCGGA 438608_67_95_R GATCATACGAGA
438608_17_45_F
2331 ASD_NC006570- TTTTATGCTTAAAGTTG 709 ASD_NC006570-439714- TCTGCCTGAGATGTCGA 1128
439714- GTTTTATTGGTTGGC 438608_107_134_R AAAAAACGTTG
438608_9_40_F
2332 GALE_AF513299_171_ TCAGCTAGACCTTTTAG 280 GALE_AF513299_241_271_R TCTCACCTACAGCTTTA 1122
200_F GTAAAGCTAAGCT AAGCCAGCAAAATG
2333 GALE_AF513299_168_ TTATCAGCTAGACCTTT 658 GALE_AF513299_245_271_R TCTCACCTACAGCTTTA 1121
199_F TAGGTAAAGCTAAGC AAGCCAGCAA
2334 GALE_AF513299_168_ TTATCAGCTAGACCTTT 658 GALE_AF513299_233_264_R TACAGCTTTAAAGCCAG 883
199_F TAGGTAAAGCTAAGC CAAAATGAATTACAG
2335 GALE_AF513299_169_ TCCCAGCTAGACCTTTT 319 GALE_AF513299_252_279_R TTCAACACTCTCACCTA 1374
198_F AGGTAAAGCTAAG CAGCTTTAAAG
2336 PLA_AF053945_7371_ TTGAGAAGACATCCGGC 680 PLA_AF053945_7434_7468_R TACGTATGTAAATTCC 900
7403_F TCACGTTATTATGGTA GCAAAGACTTTGGCAT
TAG
2337 PLA_AF053945_7377_ TGACATCCGGCTCACGT 443 PLA_AF053945_7428_7455_R TCCGCAAAGACTTTGGC 1035
7403_F TATTATGGTA ATTAGGTGTGA
2338 PLA_AF053945_7377_ TGACATCCGGCTCACGT 444 PLA_AF053945_7430_7460_R TAAATTCCGCAAAGACT 854
7404_F TATTATGGTAC TTGGCATTAGGTGT
2339 CAF_AF053947_ TCCGTTATCGCCATTGC 329 CAF_AF053947_33498_ TAAGAGTGATGCGGGCT 866
33412_33441_F ATTATTTGGAACT 33523_R GGTTCAACA
2340 CAF_AF053947_ TGCATTATTTGGAACTA 499 CAF_AF053947_33483_ TGGTTCAACAAGAGTTG 1308
33426_33458_F TTGCAACTGCTAATGC 33507_R CCGTTGCA
2341 CAF_AF053947_ TCAGTTCCGTTATCGCC 291 CAF_AF053947_33483_ TTCAACAAGAGTTGCCG 1373
33407_33429_F ATTGCA 33504_R TTGCA
2342 CAF_AF053947_ TCAGTTCCGTTATCGCC 293 CAF_AF053947_33494_ TGATGCGGGCTGGTTCA 1184
33407_33431_F ATTGCATT 33517_R ACAAGAG
2344 GAPA_NC_002505_1_ TCAATGAACGATCAACA 260 GAPA_NC_002505_29_58_R_1 TCCTTTATGCAACTTGG 1060
28_F_1 AGTGATTGATG TATCAACAGGAAT
2472 OMPA_NC000117_68_ TGCCTGTAGGGAATCCT 507 OMPA_NC000117_145_167_R TCACACCAAGTAGTGCA 967
89_F GCTGA AGGATC
2473 OMPA_NC000117_798_ TGATTACCATGAGTGGC 475 OMPA_NC000117_865_893_R TCAAAACTTGCTCTAGA 947
821_F AAGCAAG CCATTTAACTCC
2474 OMPA_NC000117_645_ TGCTCAATCTAAACCTA 521 OMPA_NC000117_757_777_R TGTCGCAGCATCTGTTC 1328
671_F AAGTCGAAGA CTGC
2475 OMPA_NC000117_947_ TAACTGCATGGAACCCT 157 OMPA_NC000117_1011_ TGACAGGACACAATCTG 1153
973_F TCTTTACTAG 1040_R CATGAAGTCTGAG
2476 OMPA_NC000117_774_ TACTGGAACAAAGTCTG 196 OMPA_NC000117_871_894_R TTCAAAAGTTGCTCGAG 1371
795_F CGACC ACCATTG
2477 OMPA_NC000117_457_ TTCTATCTCGTTGGTTT 676 OMPA_NC000117_511_534_R TAAAGAGACGTTTGGTA 851
483_R ATTCGGAGTT GTTCATTTGC
2478 OMPA_NC000117_687_ TAGCCCAGCACAATTTG 212 OMPA_NC000117_787_816_R TTGCCATTCATGGTATT 1406
710_F TGATTCA TAAGTGTAGCAGA
2479 OMPA_NC000117_540_ TGGCGTAGTAGAGCTAT 571 OMPA_NC000117_649_672_R TTCTTGAACGCGAGGTT 1395
566_F TTACAGACAC TCGATTG
2480 OMPA_NC000117_338_ TGCACGATGCGGAATGG 492 OMPA_NC000117_417_444_R TCCTTTAAAATAACCGC 1058
360_F TTCACA TAGTAGCTCCT
2481 OMP2_NC000117_18_ TATGACCAAACTCATCA 234 OMP2_NC000117_71_91_R TCCCGCTGGCAAATAAA 1025
40_F GACGAG CTCG
2482 OMP2_NC000117_354_ TGCTACGGTAGGATCTC 516 OMP2_NC000117_445_471_R TGGATCACTGCTTACGA 1270
382_F CTTATCCTATTG ACTCAGCTTC
2483 OMP2_NC000117_ TGGAAAGGTGTTGCAGC 537 OMP2_NC000117_1396_ TACGTTTGTATCTTCTG 903
1297_1319_F TACTCA 1419_R CAGAACC
2484 OMP2_NC000117_ TCTGGTCCAACAAAAGG 407 OMP2_NC000117_1541_ TCCTTTCAATGTTACAG 1062
1465_1493_F AACGATTACAGG 1569_R AAAACTCTACAG
2485 OMP2_NC000117_44_ TGACGATCTTCGCGGTG 450 OMP2_NC000117_120_148_R TGTCAGCTAAGCTAATA 1323
66_F ACTAGT ACGTTTGTAGAG
2486 OMP2_NC000117_166_ TGACAGCGAAGAAGGTT 441 OMP2_NC000117_240_261_R TTGACATCGTCCCTCTT 1396
190_F AGACTTGTCC CACAG
2487 GYRA_NC000117_514_ TCAGGCATTGCGGTTGG 287 GYRA_NC000117_640_660_R TGCTGTAGGGAAATCAG 1251
536_F GATGGC GGCC
2488 GYRA_NC000117_801_ TGTGAATAAATCACGAT 636 GYRA_NC000117_871_893_R TTGTCAGACTCATCGCG 1419
827_F TGATTGAGCA AACATC
2489 GYRA_NC002952_219_ TGTCATGGGTAAATATC 632 GYRA_NC002952_319_345_R TCCATCCATAGAACCAA 1010
242_F ACCCTCA AGTTACCTTG
2490 GYRA_NC002952_964_ TACAAGCACTCCCAGCT 176 GYRA_NC002952_1024_ TCGCAGCGTGCGTGGCA 1073
983_F GCA 1041_R C
2491 GYRA_NC002952_ TCGCCCGCGAGGACGT 366 GYRA_NC002952_1546_ TTGGTGCGCTTGGCGTA 1416
1505_1520_F 1562_R
2492 GYRA_NC002952_59_ TCAGCTACATCGACTAT 279 GYRA_NC002952_124_143_R TGGCGATGCACTGGCTT 1279
81_F GCGATG GAG
2493 GYRA_NC002952_216_ TGACGTCATCGGTAAGT 452 GYRA_NC002952_313_333_R TCCGAAGTTGCCCTGGC 1032
239_F ACCACCC CGTC
2494 GYRA_NC002952_219_ TGTACTCGGTAAGTATC 625 GYRA_NC002952_308_330_R TAAGTTACCTTGCCCGT 873
242_2_F ACCCGCA CAACCA
2495 GYRA_NC002952_115_ TGAGATGGATTTAAACC 453 GYRA_NC002952_220_242_R TGCGGGTGATACTTACC 1236
141_F TGTTCACCGC GAGTAC
2496 GYRA_NC002952_517_ TCAGGCATTGCGGTTGG 287 GYRA_NC002952_643_663_R TGCTGTAGGGAAATCAG 1251
539_F GATGGC GGCC
2497 GYRA_NC002952_273_ TCGTATGGCTCAATGGT 380 GYRA_NC002952_338_360_R TGCGGCAGCACTATCAC 1234
293_F GGAG CATCCA
2498 GYRA_NC000912_257_ TGAGTAAGTTCCACCCG 462 GYRA_NC000912_346_370_R TCGAGCCGAAGTTACCC 1067
278_F CACGG TGTCCGTC
2504 ARCC_NC003923- TAGTpGATpAGAACpTp 229 ARCC_NC003923-2725050- TCpTpTpTpCpGTATAA 1116
2725050- GTAGGCpACpAATpCpG 2724595_214_239P_R AAAGGACpCpAATpTpG
2724595_135_161P_F T G
2505 PTA_NC003923- TCTTGTpTpTpATGCpT 417 PTA_NC003923-628885- TACpACpCpTGGTpTpT 904
628885- pGGTAAAGCAGATGG 629355_314_342P_R pCpGTpTpTpTpGATGA
629355_237_263P_F TpTpTpGTA
2517 CJMLST_ST1_1852_ TTTGCGGATGAAGTAGG 708 CJMLST_ST1_1945_1977_R TGTTTTATGTGTAGTTG 1355
1883_F TGCCTATCTTTTTGC AGCTTACTACATGAGC
2518 CJMLST_ST1_2963_ TGAAATTGCTACAGGCC 428 CJMLST_ST1_3073_3097_R TCCCCATCTCCGCAAAG 1020
2992_F CTTTAGGACAAGG ACAATAAA
2519 CJMLST_ST1_2350_ TGCTTTTGATGGTGATG 535 CJMLST_ST1_2447_2481_R TCTACAACACTTGATTG 1117
2378_F CAGATCGTTTGG TAATTTGCCTTGTTCTT
T
2520 CJMLST_ST1_654_ TATGTCCAAGAAGCATA 240 CJMLST_ST1_725_756_R TCGGAAACAAAGAATTC 1084
684_F GCAAAAAAAGCAAT ATTTTCTGGTCCAAA
2521 CJMLST_ST1_360_ TCCTGTTATTCCTGAAG 347 CJMLST_ST1_454_487_R TGCTATATGCTACAACT 1245
395_F TAGTTAATCAAGTTTGT GGTTCAAAAACATTAAG
TA
2522 CJMLST_ST1_1231_ TGGCAGTTTTACAAGGT 564 CJMLST_ST1_1312_1340_R TTTAGCTACTATTCTAG 1427
1258_F GCTGTTTCATC CTGCCATTTCCA
2523 CJMLST_ST1_3543_ TGCTGTAGCTTATCGCG 529 CJMLST_ST1_3656_3685_R TCAAAGAACCAGCACCT 950
3574_F AAATGTCTTTGATTT AATTCATCATTTA
2524 CJMLST_ST1_1_17_F TAAAACTTTTGCCGTAA 145 CJMLST_ST1_55_84_R TGTTCCAATAGCAGTTC 1348
TGATGGGTGAAGATAT CGCCCAAATTGAT
2525 CJMLST_ST1_1312_ TGGAAATGGCAGCTAGA 538 CJMLST_ST1_1383_1417_R TTTCCCCGATCTAAATT 1432
1342_F ATAGTAGCTAAAAT TGGATAAGCCATAGGAA
A
2526 CJMLST_ST1_2254_ TGGGCCTAATGGGCTTA 582 CJMLST_ST1_2352_2379_R TCCAAACGATCTGCATC 996
2286_F ATATCAATGAAAATTG ACCATCAAAAG
2527 CJMLST_ST1_1380_ TGCTTTCCTATGGCTTA 534 CJMLST_ST1_1486_1520_R TGCATGAAGCATAAAAA 1205
1411_F TCCAAATTTAGATCG CTGTATCAAGTGCTTTT
A
2528 CJMLST_ST1_3413_ TTGTAAATGCCGGTGCT 692 CJMLST_ST1_3511_3542_R TGCTTGCTCAAATCATC 1257
3437_F TCAGATCC ATAAACAATTAAAGC
2529 CJMLST_ST1_1130_ TACGCGTCTTGAAGCGT 189 CJMLST_ST1_1203_1230_R TAGGATGAGCATTATCA 920
1156_F TTCGTTATGA GGGAAAGAATC
2530 CJMLST_ST1_2840_ TGGGGCTTTGCTTTATA 591 CJMLST_ST1_2940_2973_R TAGCGATTTCTACTCCT 917
2872_F GTTTTTTACATTTAAG AGAGTTGAAATTTCAGG
2531 CJMLST_ST1_2058_ TATTCAAGGTGGTCCTT 241 CJMLST_ST1_2131_2162_R TTGGTTCTTACTTGTTT 1417
2084_F TGATGCATGT TGCATAAACTTTCCA
2532 CJMLST_ST1_553_ TCCTGATGCTCAAAGTG 344 CJMLST_ST1_655_685_R TATTGCTTTTTTTGCTA 942
585_F CTTTTTTAGATCCTTT TGCTTCTTGGACAT
2564 GLTA_NC002163- TCATGTTGAGCTTAAAC 299 GLTA_NC002163-1604930- TTTTGCTCATGATCTGC 1443
1604930- CTATAGAAGTAAAAGC 1604529_352_380_R ATGAAGCATAAA
1604529_306_338_F
2565 UNCA_NC002163- TCCCCCACGCTTTAATT 322 UNCA_NC002163-112166- TCGACCTGGAGGACGAC 1065
112166- GTTTATGATGATTTGAG 112647_146_171_R GTAAAATCA
112647_80_113_F
2566 UNCA_NC002163- TAATGATGAATTAGGTG 170 UNCA_NC002163-112166- TGGGATAACATTGGTTG 1285
112166- CGGGTTCTTT 112647_294_329_R GAATATAAGCAGAAACA
112647_233_259_F TC
2567 PGM_NC002163- TCTTGATACTTGTAATG 414 PGM_NC002163-327773- TCCATCGCCAGTTTTTG 1012
327773- TGGGCGATAAATATGT 328270_365_396_R CATAATCGCTAAAAA
328270_273_305_F
2568 TKT_NC002163- TTATGAAGCGTGTTCTT 661 TKT_NC002163-1569415- TCAAAACGCATTTTTAC 946
1569415- TAGCAGGACTTCA 1569873_350_383_R ATCTTCGTTAAAGGCTA
1569873_255_284_F
2570 GLTA_NC002163- TCGTCTTTTTGATTCTT 381 GLTA_NC002163-1604930- TGTTCATGTTTAAATGA 1347
1604930- TCCCTGATAATGC 1604529_109_142_R TCAGGATAAAAAGCACT
1604529_39_68_F
2571 TKT_NC002163- TGATCTTAAAAATTTCC 472 TKT_NC002163-1569415- TGCCATAGCAAAGCCTA 1214
1569415- GCCAACTTCATTC 1569903_139_162_R CAGCATT
1569903_33_62_F
2572 TKT_NC002163- TAAGGTTTATTGTCTTT 164 TKT_NC002163-1569415- TACATCTCCTTCGATAG 886
1569415- GTGGAGATGGGGATTT 1569903_313_345_R AAATTTCATTGCTATC
1569903_207_239_F
2573 TKT_NC002163- TAGCCTTTAACGAAAAT 213 TKT_NC002163-1569415- TAAGACAAGGTTTTGTG 865
1569415- GTAAAAATGCGTTTTGA 1569903_449_481_R GATTTTTTAGCTTGTT
1569903_350_383_F
2574 TKT_NC002163- TTCAAAAACTCCAGGCC 665 TKT_NC002163-1569415- TTGCCATAGCAAAGCCT 1405
1569415- ATCCTGAAATTTCAAC 1569903_139_163_R ACAGCATT
1569903_60_92_F
2575 GLTA_NC002163- TCGTCTTTTTGATTCTT 382 GLTA_NC002163-1604930- TGCCATTTCCATGTACT 1216
1604930- TCCCTGATAATGCTC 1604529_139_168_R CTTCTCTAACATT
1604529_39_70_F
2576 GLYA_NC002163- TCAGCTATTTTTCCAGG 281 GLYA_NC002163-367572- ATTGCTTCTTACTTGCT 756
367572- TATCCAAGGTGG 368079_476_508_R TAGCATAAATTTTCCA
368079_386_414_F
2577 GLYA_NC002163- TGGTGCGAGTGCTTATG 611 GLYA_NC002163-367572- TGCTCACCTGCTACAAC 1246
367572- CTCGTATTAT 368079_242_270_R AAGTCCAGCAAT
368079_148_174_F
2578 GLYA_NC002163- TGTAAGCTCTACAACCC 622 GLYA_NC002163-367572- TTCCACCTTGGATACCT 1381
367572- ACAAAACCTTACG 368079_384_416_R GGAAAAATAGCTGAAT
368079_298_327_F
2579 GLYA_NC002163- TGGTGGACATTTAACAC 614 GLYA_NC002163-367572- TCAAGCTCTACACCATA 961
367572- ATGGTGCAAA 368079_52_81_R AAAAAAGCTCTCA
368079_1_27_F
2580 PGM_NC002163- TGAGCAATGGGGCTTTG 455 PGM_NC002163-327746- TTTGCTCTCCGCCAAAG 1438
327746- AAAGAATTTTTAAAT 328270_356_379_R TTTCCAC
328270_254_285_F
2581 PGM_NC002163- TGAAAAGGGTGAAGTAG 425 PGM_NC002163-327746- TGCCCCATTGCTCATGA 1219
327746- CAAATGGAGATAG 328270_241_267_R TAGTAGCTAC
328270_153_182_F
2582 PGM_NC002163- TGGCCTAATGGGCTTAA 568 PGM_NC002163-327746- TGCACGCAAACGCTTTA 1200
327746- TATCAATGAAAATTG 328270_79_102_R CTTCAGC
328270_19_50_F
2583 UNCA_NC002163- TAAGCATGCTGTGGCTT 160 UNCA_NC002163-112166- TGCCCTTTCTAAAAGTC 1220
112166- ATCGTGAAATG 112647_196_225_R TTGAGTGAAGATA
112647_114_141_F
2584 UNCA_NC002163- TGCTTCGGATCCAGCAG 532 UNCA_NC002163-112166- TGCATGCTTACTCAAAT 1206
112166- CACTTCAATA 112647_88_123_R CATCATAAACAATTAAA
112647_3_29_F GC
2585 ASPA_NC002163- TTAATTTGCCAAAAATG 652 ASPA_NC002163-96692- TGCAAAAGTAACGGTTA 1192
96692- CAACCAGGTAG 97166_403_432_R CATCTGCTCCAAT
97166_308_335_F
2586 ASPA_NC002163- TCGCGTTGCAACAAAAC 370 ASPA_NC002163-96692- TCATGATAGAACTACCT 991
96692- TTTCTAAAGTATGT 97166_316_346_R GGTTGCATTTTTGG
97166_228_258_F
2587 GLNA_NC002163- TGGAATGATGATAAAGA 547 GLNA_NC002163-658085- TGAGTTTGAACCATTTC 1176
658085- TTTCGCAGATAGCTA 657609_340_371_R AGAGCGAATATCTAC
657609_244_275_F
2588 TKT_NC002163- TCGCTACAGGCCCTTTA 371 TKT_NC002163-1569415- TCCCCATCTCCGCAAAG 1020
1569415- GGACAAG 1569903_212_236_R ACAATAAA
1569903_107_130_F
2589 TKT_NC002163- TGTTCTTTAGCAGGACT 642 TKT_NC002163-1569415- TCCTTGTGCTTCAAAAC 1057
1569415- TCACAAACTTGATAA 1569903_361_393_R GCATTTTTACATTTTC
1569903_265_296_F
2590 GLYA_NC002163- TGCCTATCTTTTTGCTG 505 GLYA_NC002163-367572- TCCTCTTGGGCCACGCA 1047
367572- ATATAGCACATATTGC 368095_317_340_R AAGTTTT
368095_214_246_F
2591 GLYA_NC002163- TCCTTTGATGCATGTAA 353 GLYA_NC002163-367572- TCTTGAGCATTGGTTCT 1141
367572- TTGCTGCAAAAGC 368095_485_516_R TACTTGTTTTGCATA
368095_415_444_F
2592 PGM_NC002163_21_ TCCTAATGGACTTAATA 332 PGM_NC002163_116_142_R TCAAACGATCCGCATCA 949
54_F TCAATGAAAATTGTGGA CCATCAAAAG
2593 PGM_NC002163_149_ TAGATGAAAAAGGCGAA 207 PGM_NC002163_247_277_R TCCCCTTTAAAGCACCA 1023
176_F GTGGCTAATGG TTACTCATTATAGT
2594 GLNA_NC002163- TGTCCAAGAAGCATAGC 633 GLNA_NC002163-658085- TCAAAAACAAAGAATTC 945
658085- AAAAAAAGCAA 657609_148_179_R ATTTTCTGGTCCAAA
657609_79_106_F
2595 ASPA_NC002163- TCCTGTTATTCCTGAAG 347 ASPA_NC002163-96685- TCAAGCTATATGCTACA 960
96685- TAGTTAATCAAGTTTGT 97196_467_497_R ACTGGTTCAAAAAC
97196_367_402_F TA
2596 ASPA_NC002163- TGCCGTAATGATAGGTG 502 ASPA_NC002163-96685- TACAACCTTCGGATAAT 880
96685-97196_1_33_F AAGATATACAAAGAGT 97196_95_127_R CAGGATGAGAATTAAT
2597 ASPA_NC002163- TGGAACAGGAATTAATT 540 ASPA_NC002163-96685- TAAGCTCCCGTATCTTG 872
96685- CTCATCCTGATTATCC 97196_185_210_R AGTCGCCTC
97196_85_117_F
2598 PGM_NC002163- TGGCAGCTAGAATAGTA 563 PGM_NC002163-327746- TCACGATCTAAATTTGC 975
327746- GCTAAAATCCCTAC 328270_230_261_R ATAAGCCATAGGAAA
328270_165_195_F
2599 PGM_NC002163- TGGGTCGTGGTTTTACA 593 PGM_NC002163-327746- TTTTGCTCATGATCTGC 1443
327746- GAAAATTTCTTATATAT 328270_353_381_R ATGAAGCATAAA
328270_252_286_F G
2600 PGM_NC002163- TGGGATGAAAAAGCGTT 577 PGM_NC002163-327746- TGATAAAAAGCACTAAG 1178
327746- CTTTTATCCATGA 328270_95_123_R CGATGAAACAGC
328270_1_30_F
2601 PGM_NC002163- TAAACACGGCTTTCCTA 146 PGM_NC002163-327746- TCAAGTGCTTTTACTTC 963
327746- TGGCTTATCCAAAT 328270_314_345_R TATAGGTTTAAGCTC
328270_220_250_F
2602 UNCA_NC002163- TGTAGCTTATCGCGAAA 628 UNCA_NC002163-112166- TGCTTGCTCTTTCAAGC 1258
112166- TGTCTTTGATTTT 112647_199_229_R AGTCTTGAATGAAG
112647_123_152_F
2603 UNCA_NC002163- TCCAGATGGACAAATTT 313 UNCA_NC002163-112166- TCCGAAACTTGTTTTGT 1031
112166- TCTTAGAAACTGATTT 112647_430_461_R AGCTTTAATTTGAGC
112647_333_365_F
2734 GYRA_AY291534_237_ TCACCCTCATGGTGATT 265 GYRA_AY291534_268_288_R TTGCGCCATACGTACCA 1407
264_F CAGCTGTTTAT TCGT
2735 GYRA_AY291534_224_ TAATCGGTAAGTATCAC 167 GYRA_AY291534_256_285_R TGCCATACGTACCATCG 1213
252_F CCTCATGGTGAT TTTCATAAACAGC
2736 GYRA_AY291534_170_ TAGGAATTACGGCTGAT 221 GYRA_AY291534_268_288_R TTGCGCCATACGTACCA 1407
198_F AAAGCGTATAAA TCGT
2737 GYRA_AY291534_224_ TAATCGGTAAGTATCAC 167 GYRA_AY291534_319_346_R TATCGACAGATCCAAAG 935
252_F CCTCATGGTGAT TTACCATGCCC
2738 GYRA_NC002953- TAAGGTATGACACCGGA 163 GYRA_NC002953-7005- TCTTGAGCCATACGTAC 1142
7005-9668_166_195_ TAAATCATATAAA 9668_265_287_R CATTGC
F
2739 GYRA_NC002953- TAATGGGTAAATATCAC 171 GYRA_NC002953-7005- TATCCATTGAACCAAAG 933
7005-9668_221_249_ CCTCATGGTGAC 9668_316_343_R TTACCTTGGCC
F
2740 GYRA_NC002953- TAATGGGTAAATATCAC 171 GYRA_NC002953-7005- TAGCCATACGTACCATT 912
7005-9668_221_249_ CCTCATGGTGAC 9668_253_283_R GCTTCATAAATAGA
F
2741 GYRA_NC002953- TCACCCTCATGGTGACT 264 GYRA_NC002953-7005- TCTTGAGCCATACGTAC 1142
7005-9668_234_261_ CATCTATTTAT 9668_265_287_R CATTGC
F
2842 CAPC_AF188935- TGGGATTATTGTTATCC 578 CAPC_AF188935-56074- TGGTAACCCTTGTCTTT 1299
56074- TGTTATGCCATTTGAGA 55628_348_378_R GAATTGTATTTGCA
55628_271_304_F
2843 CAPC_AF188935- TGATTATTGTTATCCTG 476 CAPC_AF188935-56074- TGTAACCCTTGTCTTTG 1314
56074- TTATGCpCpATpTpTpG 55628_349_377P_R AATpTpGTATpTpTpGC
55628_273_303P_F AG
2844 CAPC_AF188935- TCCGTTGATTATTGTTA 331 CAPC_AF188935-56074- TGTTAATGGTAACCCTT 1344
56074- TCCTGTTATGCCATTTG 55628_349_384_R GTCTTTGAATTGTATTT
55628_268_303_F AG GC
2845 CAPC_AF188935- TCCGTTGATTATTGTTA 331 CAPC_AF188935-56074- TAACCCTTGTCTTTGAA 860
56074- TCCTGTTATGCCATTTG 55628_337_375_R TTGTATTTGCAATTAAT
55628_268_303_F AG CCTGG
2846 PARC_X95819_33_58_ TCCAAAAAAATCAGCGC 302 PARC_X95819_121_153_R TAAAGGATAGCGGTAAC 852
F GTACAGTGG TAAATGGCTGAGCCAT
2847 PARC_X95819_65_92_ TACTTGGTAAATACCAC 199 PARC_X95819_157_178_R TACCCCAGTTCCCCTGA 889
F CCACATGGTGA CCTTC
2848 PARC_X95819_69_93_ TGGTAAATACCACCCAC 596 PARC_X95819_97_128_R TGAGCCATGAGTACCAT 1169
F ATGGTGAC GGCTTCATAACATGC
2849 PARC_NC003997- TTCCGTAAGTCGGCTAA 668 PARC_NC003997-3362578- TCCAAGTTTGACTTAAA 1001
3362578- AACAGTCG 3365001_256_283_R CGTACCATCGC
3365001_181_205_F
2850 PARC_NC003997- TGTAACTATCACCCGCA 621 PARC_NC003997-3362578- TCGTCAACACTACCATT 1099
3362578- CGGTGAT 3365001_304_335_R ATTACCATGCATCTC
3365001_217_240_F
2851 PARC_NC003997- TGTAACTATCACCCGCA 621 PARC_NC003997-3362578- TGACTTAAACGTACCAT 1162
3362578- CGGTGAT 3365001_244_275_R CGCTTCATATACAGA
3365001_217_240_F
2852 GYRA_AY642140_-1_ TAAATCTGCCCGTGTCG 150 GYRA_AY642140_71_100_R TGCTAAAGTCTTGAGCC 1242
24_F TTGGTGAC ATACGAACAATGG
2853 GYRA_AY642140_26_ TAATCGGTAAATATCAC 166 GYRA_AY642140_121_146_R TCGATCGAACCGAAGTT 1069
54_F CCGCATGGTGAC ACCCTGACC
2854 GYRA_AY642140_26_ TAATCGGTAAATATCAC 166 GYRA_AY642140_58_89_R TGAGCCATACGAACAAT 1168
54_F CCGCATGGTGAC GGTTTCATAAACAGC
2860 CYA_AF065404_1348_ TCCAACGAAGTACAATA 305 CYA_AF065404_1448_1472_R TCAGCTGTTAACGGCTT 983
1379_F CAAGACAAAAGAAGG CAAGACCC
2861 LEF_BA_AF065404_ TCGAAAGCTTTTGCATA 354 LEF_BA_AF065404_843_ TCTTTAAGTTCTTCCAA 1144
751_781_F TTATATCGAGCCAC 881_R GGATAGATTTATTTCTT
GTTCG
2862 LEF_BA_AF065404_ TGCATATTATATCGAGC 498 LEF_BA_AF065404_843_ TCTTTAAGTTCTTCCAA 1144
762_788_F CACAGCATCG 881_R GGATAGATTTATTTCTT
GTTCG
2917 MUTS_AY698802_106_ TCCGCTGAATCTGTCGC 326 MUTS_AY698802_172_193_R TGCGGTCTGGCGCATAT 1237
125_F CGC AGGTA
2918 MUTS_AY698802_172_ TACCTATATGCGCCAGA 187 MUTS_AY698802_228_252_R TCAATCTCGACTTTTTG 965
192_F CCGC TGCCGGTA
2919 MUTS_AY698802_228_ TACCGGCGCAAAAAGTC 186 MUTS_AY698802_314_342_R TCGGTTTCAGTCATCTC 1097
252_F GAGATTGG CACCATAAAGGT
2920 MUTS_AY698802_315_ TCTTTATGGTGGAGATG 419 MUTS_AY698802_413_433_R TGCCAGCGACAGACCAT 1210
342_F ACTGAAACCGA CGTA
2921 MUTS_AY698802_394_ TGGGCGTGGAACGTCCA 585 MUTS_AY698802_497_519_R TCCGGTAACTGGGTCAG 1040
411_F C CTCGAA
2922 AB_MLST-11-OIF007_ TGGGcGATGCTGCgAAA 583 AB_MLST-11-OIF007_1110_ TAGTATCACCACGTACA 923
991_1018_F TGGTTAAAAGA 1137_R CCCGGATCAGT
2927 GAPA_NC002505_694_ TCAATGAACGACCAACA 259 GAPA_NC_002505_29_58_R_1 TCCTTTATGCAACTTGG 1060
721_F AGTGATTGATG TATCAACAGGAAT
2928 GAPA_NC002505_694_ TCGATGAACGACCAACA 361 GAPA_NC002505_769_798_ TCCTTTATGCAACTTGG 1061
721_2_F AGTGATTGATG 2_R TATCAACCGGAAT
2929 GAPA_NC002505_694_ TCGATGAACGACCAACA 361 GAPA_NC002505_769_798_ TCCTTTATGCAACTTAG 1059
721_2_F AGTGATTGATG 3_R TATCAACCGGAAT
2932 INFB_EC_1364_1394_ TTGCTCGTGGTGCACAA 688 INFB_EC_1439_1468_R TTGCTGCTTTCGCATGG 1410
F GTAACGGATATTAC TTAATCGCTTCAA
2933 INFB_EC_1364_1394_ TTGCTCGTGGTGCAIAA 689 INFB_EC_1439_1468_R TTGCTGCTTTCGCATGG 1410
2_F GTAACGGATATIAC TTAATCGCTTCAA
2934 INFB_EC_80_110_F TTGCCCGCGGTGCGGAA 685 INFB_EC_1439_1468_R TTGCTGCTTTCGCATGG 1410
GTAACCGATATTAC TTAATCGCTTCAA
2949 ACS_NC002516- TCGGCGCCTGCCTGATG 376 ACS_NC002516-970624- TGGACCACGCCGAAGAA 1265
970624- A 971013_364_383_R CGG
971013_299_316_F
2950 ARO_NC002516- TCACCGTGCCGTTCAAG 267 ARO_NC002516-26883- TGTGTTGTCGCCGCGCA 1341
26883-27380_4_26_F GAAGAG 27380_111_128_R G
2951 ARO_NC002516-26883- TTTCGAAGGGCCTTTCG 705 ARO_NC002516-26883- TCCTTGGCATACATCAT 1056
27380_356_377_F ACCTG 27380_459_484_R GTCGTAGCA
2952 GUA_NC002516- TGGACTCCTCGGTGGTC 551 GUA_NC002516-4226546- TCGGCGAACATGGCCAT 1091
4226546- GC 4226174_127_146_R CAC
4226174_23_41_F
2953 GUA_NC002516- TGACCAGGTGATGGCCA 448 GUA_NC002516-4226546- TGCTTCTCTTCCGGGTC 1256
4226546- TGTTCG 4226174_214_233_R GGC
4226174_120_142_F
2954 GUA_NC002516- TTTTGAAGGTGATCCGT 710 GUA_NC002516-4226546- TGCTTGGTGGCTTCTTC 1259
4226546- GCCAACG 4226174_265_287_R GTCGAA
4226174_155_178_F
2955 GUA_NC002516- TTCCTCGGCCGCCTGGC 670 GUA_NC002516-4226546- TGCGAGGAACTTCACGT 1229
4226546- 4226174_288_309_R CCTGC
4226174_190_206_F
2956 GUA_NC002516- TCGGCCGCACCTTCATC 374 GUA_NC002516-4226546- TCGTGGGCCTTGCCGGT 1111
4226546- GAAGT 4226174_355_371_R
4226174_242_263_F
2957 MUT_NC002516- TGGAAGTCATCAAGCGC 545 MUT_NC002516-5551158- TCACGGGCCAGCTCGTC 978
5551158- CTGGC 5550717_99_116_R T
5550717_5_26_F
2958 MUT_NC002516- TCGAGCAGGCGCTGCCG 358 MUT_NC002516-5551158- TCACCATGCGCCCGTTC 971
5551158- 5550717_256_277_R ACATA
5550717_152_168_F
2959 NUO_NC002516- TCAACCTCGGCCCGAAC 249 NUO_NC002516-2984589- TCGGTGGTGGTAGCCGA 1095
2984589- CA 2984954_97_117_R TCTC
2984954_8_26_F
2960 NUO_NC002516- TACTCTCGGTGGAGAAG 195 NUC_NC002516-2984589- TTCAGGTACAGCAGGTG 1376
2984589- CTCGC 2984954_301_326_R GTTCAGGAT
2984954_218_239_F
2961 PPS_NC002516- TCCACGGTCATGGAGCG 311 PPS_NC002516-1915014- TCCATTTCCGACACGTC 1014
1915014- CTA 1915383_140_165_R GTTGATCAC
1915383_44_63_F
2962 PPS_NC002516- TCGCCATCGTCACCAAC 365 PPS_NC002516-1915014- TCCTGGCCATCCTGCAG 1052
1915014- CG 1915383_341_360_R GAT
1915383_240_258_F
2963 TRP_NC002516- TGCTGGTACGGGTCGAG 527 TRP_NC002516-671831- TCGATCTCCTTGGCGTC 1071
671831- GA 672273_131_150_R CGA
672273_24_42_F
2964 TRP_NC002516- TGCACATCGTGTCCAAC 490 TRP_NC002516-671831- TGATCTCCATGGCGCGG 1182
671831- GTCAC 672273_362_383_R ATCTT
672273_261_282_F
2972 AB_MLST-11- TGGGIGATGCTGCIAAA 592 AB_MLST-11- TAGTATCACCACGTACI 924
OIF007_1007_1034_F TGGTTAAAAGA OIF007_1126_1153_R CCIGGATCAGT
2993 OMPU_NC002505- TTCCCACCGATATCATG 667 OMPU_NC002505_544_567_R TCGGTCAGCAAAACGGT 1094
674828- GCTTACCACGG AGCTTGC
675880_428_455_F
2994 GAPA_NC002505- TCCTCAATGAACGAICA 335 GAPA_NC002505-506780- TTTTCCCTTTATGCAAC 1442
506780- ACAAGTGATTGATG 507937_769_802_R TTAGTATCAACIGGAAT
507937_691_721_F
2995 GAPA_NC002505- TCCTCIATGAACGAICA 339 GAPA_NC002505-506780- TCCATACCTTTATGCAA 1008
506780- ACAAGTGATTGATG 507937_769_803_R CTTIGTATCAACIGGAA
507937_691_721_2_F T
2996 GAPA_NC002505- TCTCGATGAACGACCAA 396 GAPA_NC002505-506780- TCGGAAATATTCTTTCA 1085
506780- CAAGTGATTGATG 507937_785_817_R ATACCTTTATGCAACT
507937_692_721_F
2997 GAPA_NC002505- TCCTCGATGAACGAICA 337 GAPA_NC002505-506780- TCGGAAATATTCTTTCA 1085
506780- ACAAGTIATTGATG 507937_785_817_R ATACCTTTATGCAACT
507937_691_721_3_F
2998 GAPA_NC002505- TCCTCAATGAATGATCA 336 GAPA_NC002505-506780- TCGGAAATATTCTTTCA 1087
506780- ACAAGTGATTGATG 507937_784_817_R ATICCTTTITGCAACTT
507937_691_721_4_F
2999 GAPA_NC002505- TCCTCIATGAAIGAICA 340 GAPA_NC002505-506780- TCGGAAATATTCTTTCA 1086
506780- ACAAGTIATTGATG 507937_784_817_2_R ATACCTTTATGCAACTT
507937_691_721_5_F
3000 GAPA_NC002505- TCCTCGATGAATGAICA 338 GAPA_NC002505-506780- TTTCAATACCTTTATGC 1430
506780- ACAAGTIATTGATG 507937_769_805_R AACTTIGTATCAACIGG
507937_691_721_6_F AAT
3001 CTXB_NC002505- TCAGCATATGCACATGG 275 CTXB_NC002505-1566967- TCCCGGCTAGAGATTCT 1026
1566967- AACACCTCA 1567341_139_163_R GTATACGA
1567341_46_71_F
3002 CTXB_NC002505- TCAGCATATGCACATGG 274 CTXB_NC002505-1566967- TCCGGCTAGAGATTCTG 1038
1566967- AACACCTC 1567341_132_162_R TATACGAAAATATC
1567341_46_70_F
3003 CTXB_NC002505- TCAGCATATGCACATGG 274 CTXB_NC002505-1566967- TGCCGTATACGAAAATA 1225
1566967- AACACCTC 1567341_118_150_R TCTTATCATTTAGCGT
1567341_46_70_F
3004 TUFB_NC002758- TACAGGCCGTGTTGAAC 180 TUFB_NC002758-615038- TCAGCGTAGTCTAATAA 982
615038- GTGG 616222_778_809_R TTTACGGAACATTTC
616222_684_704_F
3005 TUFB_NC002758- TGCCGTGTTGAACGTGG 503 TUFB_NC002758-615038- TGCTTCAGCGTAGTCTA 1255
615038- TCAAAT 616222_783_813_R ATAATTTACGGAAC
616222_688_710_F
3006 TUFB_NC002758- TGTGGTCAAATCAAAGT 638 TUFB_NC002758-615038- TGCGTAGTCTAATAATT 1238
615038- TGGTGAAGAA 616222_778_807_R TACGGAACATTTC
616222_700_726_F
3007 TUFB_NC002758- TGGTCAAATCAAAGTTG 607 TUFB_NC002758-615038- TGCGTAGTCTAATAATT 1238
615038- GTGAAGAA 616222_778_807_R TACGGAACATTTC
616222_702_726_F
3008 TUFB_NC002758- TGAACGTGGTCAAATCA 431 TUFB_NC002758-615038- TCACCAGCTTCAGCGTA 970
615038- AAGTTGGTGAAGAA 616222_785_818_R GTCTAATAATTTACGGA
616222_696_726_F
3009 TUFB_NC002758- TCGTGTTGAACGTGGTC 386 TUFB_NC002758-615038- TCTTCAGCGTAGTCTAA 1134
615038- AAATCAAAGT 616222_778_812_R TAATTTACGGAACATTT
616222_690_716_F C
3010 MECI-R_NC003923- TCACATATCGTGAGCAA 261 MECI-R_NC003923-41798- TGTGATATGGAGGTGTA 1332
41798-41609_36_59_ TGAACTG 41609_89_112_R GAAGGTG
F
3011 MECI-R_NC003923- TGGGCGTGAGCAATGAA 584 MECI-R_NC003923-41798- TGGGATGGAGGTGTAGA 1287
41798-41609_40_66_ CTGATTATAC 41609_81_110_R AGGTGTTATCATC
F
3012 MECI-R_NC003923- TGGACACATATCGTGAG 549 MECI-R_NC003923-41798- TGGGATGGAGGTGTAGA 1286
41798- CAATGAACTGA 41609_81_110_R AGGTGTTATCATC
41609_33_60_2_F
3013 MECI-R_NC003923- TGGGTTTACACATATCG 595 MECI-R_NC003923-41798- TGGGGATATGGAGGTGT 1290
41798-41609_29_60_ TGAGCAATGAACTGA 41609_81_113_R AGAAGGTGTTATCATC
F
3014 MUPR_X75439_2490_ TGGGCTCTTTCTCGCTT 587 MUPR_X75439_2548_2570_R TCTGGCTGCGGAAGTGA 1130
2514_F AAACACCT AATCGT
3015 MUPR_X75439_2490_ TGGGCTCTTTCTCGCTT 586 MUPR_X75439_2547_2568_R TGGCTGCGGAAGTGAAA 1281
2513_F AAACACC TCGTA
3016 MUPR_X75439_2482_ TAGATAATTGGGCTCTT 205 MUPR_X75439_2551_2573_R TAATCTGGCTGCGGAAG 876
2510_F TCTCGCTTAAAC TGAAAT
3017 MUPR_X75439_2490_ TGGGCTCTTTCTCGCTT 587 MUPR_X75439_2549_2573_R TAATCTGGCTGCGGAAG 877
2514_F AAACACCT TGAAATCG
3018 MUPR_X75439_2482_ TAGATAATTGGGCTCTT 205 MUPR_X75439_2559_2589_R TGGTATATTCGTTAATT 1303
2510_F TCTCGCTTAAAC AATCTGGCTGCGGA
3019 MUPR_X75439_2490_ TGGGCTCTTTCTCGCTT 587 MUPR_X75439_2554_2581_R TCGTTAATTAATCTGGC 1112
2514_F AAACACCT TGCGGAAGTGA
3020 AROE_NC003923- TGATGGCAAGTGGATAG 474 AROE_NC003923-1674726- TAAGCAATACCTTTACT 868
1674726- GGTATAATACAG 1674277_309_335_R TGCACCACCT
1674277_204_232_F
3021 AROE_NC003923- TGGCGAGTGGATAGGGT 570 AROE_NC003923-1674726- TTCATAAGCAATACCTT 1378
1674726- ATAATACAG 1674277_311_339_R TACTTGCACCAC
1674277_207_232_F
3022 AROE_NC003923- TGGCpAAGTpGGATpAG 572 AROE_NC003923-1674726- TAAGCAATACCpTpTpT 867
1674726- GGTpATpAATpACpAG 1674277_311_335P_R pACTpTpGCpACpCpAC
1674277_207_232P_F
3023 ARCC_NC003923- TCTGAAATGAATAGTGA 398 ARCC_NC003923-2725050- TCTTCTTCTTTCGTATA 1137
2725050- TAGAACTGTAGGCAC 2724595_214_245_R AAAAGGACCAATTGG
2724595_124_155_F
3024 ARCC_NC003923- TGAATAGTGATAGAACT 437 ARCC_NC003923-2725050- TCTTCTTTCGTATAAAA 1139
2725050- GTAGGCACAATCGT 2724595_212_242_R AGGACCAATTGGTT
2724595_131_161_F
3025 ARCC_NC003923- TGAATAGTGATAGAACT 437 ARCC_NC003923-2725050- TGCGCTAATTCTTCAAC 1232
2725050- GTAGGCACAATCGT 2724595_232_260_R TTCTTCTTTCGT
2724595_131_161_F
3026 PTA_NC003923- TACAATGCTTGTTTATG 177 PTA_NC003923-628885- TGTTCTTGATACACCTG 1350
628885- CTGGTAAAGCAG 629355_322_351_R GTTTCGTTTTGAT
629355_231_259_F
3027 PTA_NC003923- TACAATGCTTGTTTATG 177 PTA_NC003923-628885- TGGTACACCTGGTTTCG 1301
628885- CTGGTAAAGCAG 629355_314_345_R TTTTGATGATTTGTA
629355_231_259_F
3028 PTA_NC003923- TCTTGTTTATGCTGGTA 418 PTA_NC003923-628885- TGTTCTTGATACACCTG 1350
628885- AAGCAGATGG 629355_322_351_R GTTTCGTTTTGAT
629355_237_263_F

Primer pair name codes and reference sequences are shown in Table 3. The primer name code typically represents the gene to which the given primer pair is targeted. The primer pair name may include specific coordinates with respect to a reference sequence defined by an extraction of a section of sequence or defined by a GenBank gi number, or the corresponding complementary sequence of the extraction, or the entire GenBank gi number as indicated by the label “no extraction.” Where “no extraction” is indicated for a reference sequence, the coordinates of a primer pair named to the reference sequence are with respect to the GenBank gi listing. Gene abbreviations are shown in bold type in the “Gene Name” column.

To determine the exact primer hybridization coordinates of a given pair of primers on a given bioagent nucleic acid sequence and to determine the sequences, molecular masses and base compositions of an amplification product to be obtained upon amplification of nucleic acid of a known bioagent with known sequence information in the region of interest with a given pair of primers, one with ordinary skill in bioinformatics is capable of obtaining alignments of the primers of the present invention with the GenBank gi number of the relevant nucleic acid sequence of the known bioagent. For example, the reference sequence GenBank gi numbers (Table 3) provide the identities of the sequences which can be obtained from GenBank. Alignments can be done using a bioinformatics tool such as BLASTn provided to the public by NCBI (Bethesda, Md.). Alternatively, a relevant GenBank sequence may be downloaded and imported into custom programmed or commercially available bioinformatics programs wherein the alignment can be carried out to determine the primer hybridization coordinates and the sequences, molecular masses and base compositions of the amplification product. For example, to obtain the hybridization coordinates of primer pair number 2095 (SEQ ID NOs: 456:1261), First the forward primer (SEQ ID NO: 456) is subjected to a BLASTn search on the publicly available NCBI BLAST website. “RefSeq_Genomic” is chosen as the BLAST database since the gi numbers refer to genomic sequences. The BLAST query is then performed. Among the top results returned is a match to GenBank gi number 21281729 (Accession Number NC003923). The result shown below, indicates that the forward primer hybridizes to positions 1530282 . . . 1530307 of the genomic sequence of Staphylococcus aureus subsp. aureus MW2 (represented by gi number 21281729).

Staphylococcus aureus subsp. aureus MW2, complete genome Length=2820462

Features in this part of subject sequence:

Panton-Valentine leukocidin chain F precursor

Score=52.0 bits (26), Expect=2e-05

Identities=26/26 (100%), Gaps=0/26 (0%)

Strand=Plus/Plus

Query 1 TGAGCTGCATCAACTGTATTGGATAG 26
||||||||||||||||||||||||||
Sbjct 1530282 TGAGCTGCATCAACTGTATTGGATAG 1530307

The hybridization coordinates of the reverse primer (SEQ ID NO: 1261) can be determined in a similar manner and thus, the bioagent identifying amplicon can be defined in terms of genomic coordinates. The query/subject arrangement of the result would be presented in Strand=Plus/Minus format because the reverse strand hybridizes to the reverse complement of the genomic sequence. The preceding sequence analyses are well known to one with ordinary skill in bioinformatics and thus, Table 3 contains sufficient information to determine the primer hybridization coordinates of any of the primers of Table 2 to the applicable reference sequences described therein.

TABLE 3
Primer Name Codes and Reference Sequence
Reference
GenBank gi
Primer name code Gene Name Organism number
16S_EC 16S rRNA (16S ribosomal RNA gene) Escherichia coli 16127994
23S_EC 23S rRNA (23S ribosomal RNA gene) Escherichia coli 16127994
CAPC_BA capC (capsule biosynthesis gene) Bacillus anthracis 6470151
CYA_BA cya (cyclic AMP gene) Bacillus anthracis 4894216
DNAK_EC dnaK (chaperone dnaK gene) Escherichia coli 16127994
GROL_EC groL (chaperonin groL) Escherichia coli 16127994
HFLB_EC hflb (cell division protein peptidase Escherichia coli 16127994
ftsH)
INFB_EC infB (protein chain initiation factor Escherichia coli 16127994
infB gene)
LEF_BA lef (lethal factor) Bacillus anthracis 21392688
PAG_BA pag (protective antigen) Bacillus anthracis 21392688
RPLB_EC rplB (50S ribosomal protein L2) Escherichia coli 16127994
RPOB_EC rpoB (DNA-directed RNA polymerase beta Escherichia coli 6127994
chain)
RPOC_EC rpoC (DNA-directed RNA polymerase Escherichia coli 16127994
beta′ chain)
SP101ET_SPET_11 Artificial Sequence Concatenation Artificial 15674250
comprising: Sequence* -
gki (glucose kinase) partial gene
gtr (glutamine transporter protein) sequences of
murI (glutamate racemase) Streptococcus
mutS (DNA mismatch repair protein) pyogenes
xpt (xanthine phosphoribosyl
transferase)
yqiL (acetyl-CoA-acetyl transferase)
tkt (transketolase)
SSPE_BA sspE (small acid-soluble spore Bacillus anthracis 30253828
protein)
TUFB_EC tufB (Elongation factor Tu) Escherichia coli 16127994
VALS_EC valS (Valyl-tRNA synthetase) Escherichia coli 16127994
ASPS_EC aspS (Aspartyl-tRNA synthetase) Escherichia coli 16127994
CAF1_AF053947 caf1 (capsular protein caf1) Yersinia pestis 2996286
INV_U22457 inv (invasin) Yersinia pestis 1256565
LL_NC003143 Y. pestis specific chromosomal genes - Yersinia pestis 16120353
difference region
BONTA_X52066 BoNT/A (neurotoxin type A) Clostridium 40381
botulinum
MECA_Y14051 mecA methicillin resistance gene Staphylococcus 2791983
aureus
TRPE_AY094355 trpE (anthranilate synthase (large Acinetobacter 20853695
component)) baumanii
RECA_AF251469 recA (recombinase A) Acinetobacter 9965210
baumanii
GYRA_AF100557 gyrA (DNA gyrase subunit A) Acinetobacter 4240540
baumanii
GYRB_AB008700 gyrB (DNA gyrase subunit B) Acinetobacter 4514436
baumanii
WAAA_Z96925 waaA (3-deoxy-D-manno-octulosonic-acid Acinetobacter 2765828
transferase) baumanii
CJST_CJ Artificial Sequence Concatenation Artificial 15791399
comprising: Sequence* -
tkt (transketolase) partial gene
glyA (serine hydroxymethyltransferase) sequences of
gltA (citrate synthase) Campylobacter
aspA (aspartate ammonia lyase) jejuni
glnA (glutamine synthase)
pgm (phosphoglycerate mutase)
uncA (ATP synthetase alpha chain)
RNASEP_BDP RNase P (ribonuclease P) Bordetella 33591275
pertussis
RNASEP_BKM RNase P (ribonuclease P) Burkholderia 53723370
mallei
RNASEP_BS RNase P (ribonuclease P) Bacillus subtilis 16077068
RNASEP_CLB RNase P (ribonuclease P) Clostridium 18308982
perfringens
RNASEP_EC RNase P (ribonuclease P) Escherichia coli 16127994
RNASEP_RKP RNase P (ribonuclease P) Rickettsia 15603881
prowazekii
RNASEP_SA RNase P (ribonuclease P) Staphylococcus 15922990
aureus
RNASEP_VBC RNase P (ribonuclease P) Vibrio cholerae 15640032
ICD_CXB icd (isocitrate dehydrogenase) Coxiella burnetii 29732244
IS1111A multi-locus IS1111A insertion element Acinetobacter 29732244
baumannii
OMPA_AY485227 ompA (outer membrane protein A) Rickettsia 40287451
prowazekii
OMPB_RKP ompB (outer membrane protein B) Rickettsia 15603881
prowazekii
GLTA_RKP gltA (citrate synthase) Vibrio cholerae 15603881
TOXR_VBC toxR (transcription regulator toxR) Francisella 15640032
tularensis
ASD_FRT asd (Aspartate semialdehyde Francisella 56707187
dehydrogenase) tularensis
GALE_FRT galE (UDP-glucose 4-epimerase) Shigella flexneri 56707187
IPAH_SGF ipaH (invasion plasmid antigen) Campylobacter 30061571
jejuni
HUPB_CJ hupB (DNA-binding protein Hu-beta) Coxiella burnetii 15791399
AB_MLST Artificial Sequence Concatenation Artificial Sequenced
comprising: Sequence* - in-house
trpE (anthranilate synthase component partial gene (SEQ ID
I)) sequences of NO: 1444)
adk (adenylate kinase) Acinetobacter
mutY (adenine glycosylase) baumannii
fumC (fumarate hydratase)
efp (elongation factor p)
ppa (pyrophosphate phospho-
hydratase
MUPR_X75439 mupR (mupriocin resistance gene) Staphylococcus 438226
aureus
PARC_X95819 parC (topoisomerase IV) Acinetobacter 1212748
baumannii
SED_M28521 sed (enterotoxin D) Staphylococcus 1492109
aureus
PLA_AF053945 pla (plasminogen activator) Yersinia pestis 2996216
SEJ_AF053140 sej (enterotoxin J) Staphylococcus 3372540
aureus
GYRA_NC000912 gyrA (DNA gyrase subunit A) Mycoplasma 13507739
pneumoniae
ACS_NC002516 acsA (Acetyl CoA Synthase) Pseudomonas 15595198
aeruginosa
ARO_NC002516 aroE (shikimate 5-dehydrogenase Pseudomonas 15595198
aeruginosa
GUA_NC002516 guaA (GMP synthase) Pseudomonas 15595198
aeruginosa
MUT_NC002516 mutL (DNA mismatch repair protein) Pseudomonas 15595198
aeruginosa
NUO_NC002516 nuoD (NADH dehydrogenase I chain C, D) Pseudomonas 15595198
aeruginosa
PPS_NC002516 ppsA (Phosphoenolpyruvate synthase) Pseudomonas 15595198
aeruginosa
TRP_NC002516 trpE (Anthranilate synthetase Pseudomonas 15595198
component I) aeruginosa
OMP2_NC000117 ompB (outer membrane protein B) Chlamydia 15604717
trachomatis
OMPA_NC000117 ompA (outer membrane protein B) Chlamydia 15604717
trachomatis
GYRA_NC000117 gyrA (DNA gyrase subunit A) Chlamydia 15604717
trachomatis
CTXA_NC002505 ctxA (Cholera toxin A subunit) Vibrio cholerae 15640032
CTXB_NC002505 ctxB (Cholera toxin B subunit) Vibrio cholerae 15640032
FUR_NC002505 fur (ferric uptake regulator protein) Vibrio cholerae 15640032
GAPA_NC_002505 gapA (glyceraldehyde-3-phosphate Vibrio cholerae 15640032
dehydrogenase)
GYRB_NC002505 gyrB (DNA gyrase subunit B) Vibrio cholerae 15640032
OMPU_NC002505 ompU (outer membrane protein) Vibrio cholerae 15640032
TCPA_NC002505 tcpA (toxin-coregulated pilus) Vibrio cholerae 15640032
ASPA_NC002163 aspA (aspartate ammonia lyase) Campylobacter 15791399
jejuni
GLNA_NC002163 glnA (glutamine synthetase) Campylobacter 15791399
jejuni
GLTA_NC002163 gltA (glutamate synthase) Campylobacter 15791399
jejuni
GLYA_NC002163 glyA (serine hydroxymethyltransferase) Campylobacter 15791399
jejuni
PGM_NC002163 pgm (phosphoglyceromutase) Campylobacter 15791399
jejuni
TKT_NC002163 tkt (transketolase) Campylobacter 15791399
jejuni
UNCA_NC002163 uncA (ATP synthetase alpha chain) Campylobacter 15791399
jejuni
AGR-III_NC003923 agr-III (accessory gene regulator-III) Staphylococcus 21281729
aureus
ARCC_NC003923 arcC (carbamate kinase) Staphylococcus 21281729
aureus
AROE_NC003923 aroE (shikimate 5-dehydrogenase Staphylococcus 21281729
aureus
BSA-A_NC003923 bsa-a (glutathione peroxidase) Staphylococcus 21281729
aureus
BSA-B_NC003923 bsa-b (epidermin biosynthesis protein Staphylococcus 21281729
EpiB) aureus
GLPF_NC003923 glpF (glycerol transporter) Staphylococcus 21281729
aureus
GMK_NC003923 gmk (guanylate kinase) Staphylococcus 21281729
aureus
MECI-R_NC003923 mecR1 (truncated methicillin Staphylococcus 21281729
resistance protein) aureus
PTA_NC003923 pta (phosphate acetyltransferase) Staphylococcus 21281729
aureus
PVLUK_NC003923 pvluk (Panton-Valentine leukocidin Staphylococcus 21281729
chain F precursor) aureus
SA442_NC003923 sa442 gene Staphylococcus 21281729
aureus
SEA_NC003923 sea (staphylococcal enterotoxin A Staphylococcus 21281729
precursor) aureus
SEC_NC003923 sec4 (enterotoxin type C precursor) Staphylococcus 21281729
aureus
TPI_NC003923 tpi (triosephosphate isomerase) Staphylococcus 21281729
aureus
YQI_NC003923 yqi (acetyl-CoA C-acetyltransferase Staphylococcus 21281729
homologue) aureus
GALE_AF513299 galE (galactose epimerase) Francisella 23506418
tularensis
VVHA_NC004460 vVhA (cytotoxin, cytolysin precursor) Vibrio vulnificus 27366463
TDH_NC004605 tdh (thermostable direct hemolysin A) Vibrio 28899855
parahaemolyticus
AGR-II_NC002745 agr-II (accessory gene regulator-II) Staphylococcus 29165615
aureus
PARC_NC003997 parC (topoisomerase IV) Bacillus anthracis 30260195
GYRA_AY291534 gyrA (DNA gyrase subunit A) Bacillus anthracis 31323274
AGR-I_AJ617706 agr-I (accessory gene regulator-I) Staphylococcus 46019543
aureus
AGR-IV_AJ617711 agr-IV (accessory gene regulator-III) Staphylococcus 46019563
aureus
BLAZ_NC002952 blaZ (beta lactamase III) Staphylococcus 49482253
aureus
ERMA_NC002952 ermA (rRNA methyltransferase A) Staphylococcus 49482253
aureus
ERMB_Y13600 ermB (rRNA methyltransferase B) Staphylococcus 49482253
aureus
SEA-SEE_NC002952 sea (staphylococcal enterotoxin A Staphylococcus 49482253
precursor) aureus
SEA-SEE_NC002952 sea (staphylococcal enterotoxin A Staphylococcus 49482253
precursor) aureus
SEE_NC002952 sea (staphylococcal enterotoxin A Staphylococcus 49482253
precursor) aureus
SEH_NC002953 seh (staphylococcal enterotoxin H) Staphylococcus 49484912
aureus
ERMC_NC005908 ermC (rRNA methyltransferase C) Staphylococcus 49489772
aureus
MUTS_AY698802 mutS (DNA mismatch repair protein) Shigella boydii 52698233
NUC_NC002758 nuc (staphylococcal nuclease) Staphylococcus 57634611
aureus
SEB_NC002758 seb (enterotoxin type B precursor) Staphylococcus 57634611
aureus
SEG_NC002758 seg (staphylococcal enterotoxin G) Staphylococcus 57634611
aureus
SEI_NC002758 sei (staphylococcal enterotoxin I) Staphylococcus 57634611
aureus
TSST_NC002758 tsst (toxic shock syndrome toxin-1) Staphylococcus 57634611
aureus
TUFB_NC002758 tufB (Elongation factor Tu) Staphylococcus 57634611
aureus

Note:

artificial reference sequences represent concatenations of partial gene extractions from the indicated reference gi number. Partial sequences were used to create the concatenated sequence because complete gene sequences were not necessary for primer design.

Example 2 Sample Preparation and PCR

Genomic DNA was prepared from samples using the DNeasy Tissue Kit (Qiagen, Valencia, Calif.) according to the manufacturer's protocols.

All PCR reactions were assembled in 50 μL reaction volumes in a 96-well microtiter plate format using a Packard MPII liquid handling robotic platform and M. J. Dyad thermocyclers (MJ research, Waltham, Mass.) or Eppendorf Mastercycler thermocyclers (Eppendorf, Westbury, N.Y.). The PCR reaction mixture consisted of 4 units of Amplitaq Gold, 1× buffer II (Applied Biosystems, Foster City, Calif.), 1.5 mM MgCl2, 0.4 M betaine, 800 μM dNTP mixture and 250 nM of each primer. The following typical PCR conditions were used: 95° C. for 10 min followed by 8 cycles of 95° C. for 30 seconds, 48° C. for 30 seconds, and 72° C. 30 seconds with the 48° C. annealing temperature increasing 0.9° C. with each of the eight cycles. The PCR was then continued for 37 additional cycles of 95° C. for 15 seconds, 56° C. for 20 seconds, and 72° C. 20 seconds.

Example 3 Purification of PCR Products for Mass Spectrometry with Ion Exchange Resin-Magnetic Beads

For solution capture of nucleic acids with ion exchange resin linked to magnetic beads, 25 μl of a 2.5 mg/mL suspension of BioClone amine terminated superparamagnetic beads were added to 25 to 50 μl of a PCR (or RT-PCR) reaction containing approximately 10 μM of a typical PCR amplification product. The above suspension was mixed for approximately 5 minutes by vortexing or pipetting, after which the liquid was removed after using a magnetic separator. The beads containing bound PCR amplification product were then washed three times with 50 mM ammonium bicarbonate/50% MeOH or 100 mM ammonium bicarbonate/50% MeOH, followed by three more washes with 50% MeOH. The bound PCR amplicon was eluted with a solution of 25 mM piperidine, 25 mM imidazole, 35% MeOH which included peptide calibration standards.

Example 4 Mass Spectrometry and Base Composition Analysis

The ESI-FTICR mass spectrometer is based on a Bruker Daltonics (Billerica, Mass.) Apex II 70e electrospray ionization Fourier transform ion cyclotron resonance mass spectrometer that employs an actively shielded 7 Tesla superconducting magnet. The active shielding constrains the majority of the fringing magnetic field from the superconducting magnet to a relatively small volume. Thus, components that might be adversely affected by stray magnetic fields, such as CRT monitors, robotic components, and other electronics, can operate in close proximity to the FTICR spectrometer. All aspects of pulse sequence control and data acquisition were performed on a 600 MHz Pentium II data station running Bruker's Xmass software under Windows NT 4.0 operating system. Sample aliquots, typically 15 μl, were extracted directly from 96-well microtiter plates using a CTC HTS PAL autosampler (LEAP Technologies, Carrboro, N.C.) triggered by the FTICR data station. Samples were injected directly into a 10 μl sample loop integrated with a fluidics handling system that supplies the 100 μl/hr flow rate to the ESI source. Ions were formed via electrospray ionization in a modified Analytica (Branford, Conn.) source employing an off axis, grounded electrospray probe positioned approximately 1.5 cm from the metalized terminus of a glass desolvation capillary. The atmospheric pressure end of the glass capillary was biased at 6000 V relative to the ESI needle during data acquisition. A counter-current flow of dry N2 was employed to assist in the desolvation process. Ions were accumulated in an external ion reservoir comprised of an rf-only hexapole, a skimmer cone, and an auxiliary gate electrode, prior to injection into the trapped ion cell where they were mass analyzed. Ionization duty cycles greater than 99% were achieved by simultaneously accumulating ions in the external ion reservoir during ion detection. Each detection event consisted of 1M data points digitized over 2.3 s. To improve the signal-to-noise ratio (S/N), 32 scans were co-added for a total data acquisition time of 74 s.

The ESI-TOF mass spectrometer is based on a Bruker Daltonics MicroTOF™. Ions from the ESI source undergo orthogonal ion extraction and are focused in a reflectron prior to detection. The TOF and FTICR are equipped with the same automated sample handling and fluidics described above. Ions are formed in the standard MicroTOF™ ESI source that is equipped with the same off-axis sprayer and glass capillary as the FTICR ESI source. Consequently, source conditions were the same as those described above. External ion accumulation was also employed to improve ionization duty cycle during data acquisition. Each detection event on the TOF was comprised of 75,000 data points digitized over 75 μs.

The sample delivery scheme allows sample aliquots to be rapidly injected into the electrospray source at high flow rate and subsequently be electrosprayed at a much lower flow rate for improved ESI sensitivity. Prior to injecting a sample, a bolus of buffer was injected at a high flow rate to rinse the transfer line and spray needle to avoid sample contamination/carryover. Following the rinse step, the autosampler injected the next sample and the flow rate was switched to low flow. Following a brief equilibration delay, data acquisition commenced. As spectra were co-added, the autosampler continued rinsing the syringe and picking up buffer to rinse the injector and sample transfer line. In general, two syringe rinses and one injector rinse were required to minimize sample carryover. During a routine screening protocol a new sample mixture was injected every 106 seconds. More recently a fast wash station for the syringe needle has been implemented which, when combined with shorter acquisition times, facilitates the acquisition of mass spectra at a rate of just under one spectrum/minute.

Raw mass spectra were post-calibrated with an internal mass standard and deconvoluted to monoisotopic molecular masses. Unambiguous base compositions were derived from the exact mass measurements of the complementary single-stranded oligonucleotides. Quantitative results are obtained by comparing the peak heights with an internal PCR calibration standard present in every PCR well at 500 molecules per well. Calibration methods are commonly owned and disclosed in U.S. Provisional Patent Application Ser. No. 60/545,425 which is incorporated herein by reference in entirety.

Example 5 De Novo Determination of Base Composition of Amplification Products Using Molecular Mass Modified Deoxynucleotide Triphosphates

Because the molecular masses of the four natural nucleobases have a relatively narrow molecular mass range (A=313.058, G=329.052, C=289.046, T=304.046—See Table 4), a persistent source of ambiguity in assignment of base composition can occur as follows: two nucleic acid strands having different base composition may have a difference of about 1 Da when the base composition difference between the two strands is G

A (−15.994) combined with CT (+15.000). For example, one 99-mer nucleic acid strand having a base composition of A27G30C21T2, has a theoretical molecular mass of 30779.058 while another 99-mer nucleic acid strand having a base composition of A26G31C22T20 has a theoretical molecular mass of 30780.052. A 1 Da difference in molecular mass may be within the experimental error of a molecular mass measurement and thus, the relatively narrow molecular mass range of the four natural nucleobases imposes an uncertainty factor.

The present invention provides for a means for removing this theoretical 1 Da uncertainty factor through amplification of a nucleic acid with one mass-tagged nucleobase and three natural nucleobases. The term “nucleobase” as used herein is synonymous with other terms in use in the art including “nucleotide,” “deoxynucleotide,” “nucleotide residue,” “deoxynucleotide residue,” “nucleotide triphosphate (NTP),” or deoxynucleotide triphosphate (dNTP).

Addition of significant mass to one of the 4 nucleobases (dNTPs) in an amplification reaction, or in the primers themselves, will result in a significant difference in mass of the resulting amplification product (significantly greater than 1 Da) arising from ambiguities arising from the G A combined with C

T event (Table 4). Thus, the same the G A (−15.994) event combined with 5-Iodo-CT (−110.900) event would result in a molecular mass difference of 126.894. If the molecular mass of the base composition A27G30 5-Iodo-C21T21 (33422.958) is compared with A26G315-Iodo-C22T20, (33549.852) the theoretical molecular mass difference is +126.894. The experimental error of a molecular mass measurement is not significant with regard to this molecular mass difference. Furthermore, the only base composition consistent with a measured molecular mass of the 99-mer nucleic acid is A27G305-Iodo-C21T21. In contrast, the analogous amplification without the mass tag has 18 possible base compositions.
TABLE 4
Molecular Masses of Natural Nucleobases and the
Mass-Modified Nucleobase 5-Iodo-C and
Mass Differences Resulting from Transitions
Nucleobase Molecular Mass Transition Molecular Mass
A 313.058 A-->T −9.012
A 313.058 A-->C −24.012
A 313.058 A-->5-Iodo-C 101.888
A 313.058 A-->G 15.994
T 304.046 T-->A 9.012
T 304.046 T-->C −15.000
T 304.046 T-->5-Iodo-C 110.900
T 304.046 T-->G 25.006
C 289.046 C-->A 24.012
C 289.046 C-->T 15.000
C 289.046 C-->G 40.006
5-Iodo-C 414.946 5-Iodo-C-->A −101.888
5-Iodo-C 414.946 5-Iodo-C-->T −110.900
5-Iodo-C 414.946 5-Iodo-C-->G −85.894
G 329.052 G-->A −15.994
G 329.052 G-->T −25.006
G 329.052 G-->C −40.006
G 329.052 G-->5-Iodo-C 85.894

Mass spectra of bioagent-identifying amplicons were analyzed independently using a maximum-likelihood processor, such as is widely used in radar signal processing. This processor, referred to as GenX, first makes maximum likelihood estimates of the input to the mass spectrometer for each primer by running matched filters for each base composition aggregate on the input data. This includes the GenX response to a calibrant for each primer.

The algorithm emphasizes performance predictions culminating in probability-of-detection versus probability-of-false-alarm plots for conditions involving complex backgrounds of naturally occurring organisms and environmental contaminants. Matched filters consist of a priori expectations of signal values given the set of primers used for each of the bioagents. A genomic sequence database is used to define the mass base count matched filters. The database contains the sequences of known bacterial bioagents and includes threat organisms as well as benign background organisms. The latter is used to estimate and subtract the spectral signature produced by the background organisms. A maximum likelihood detection of known background organisms is implemented using matched filters and a running-sum estimate of the noise covariance. Background signal strengths are estimated and used along with the matched filters to form signatures which are then subtracted. The maximum likelihood process is applied to this “cleaned up” data in a similar manner employing matched filters for the organisms and a running-sum estimate of the noise-covariance for the cleaned up data.

The amplitudes of all base compositions of bioagent-identifying amplicons for each primer are calibrated and a final maximum likelihood amplitude estimate per organism is made based upon the multiple single primer estimates. Models of all system noise are factored into this two-stage maximum likelihood calculation. The processor reports the number of molecules of each base composition contained in the spectra. The quantity of amplification product corresponding to the appropriate primer set is reported as well as the quantities of primers remaining upon completion of the amplification reaction.

Base count blurring can be carried out as follows. “Electronic PCR” can be conducted on nucleotide sequences of the desired bioagents to obtain the different expected base counts that could be obtained for each primer pair. See for example, ncbi.nlm.nih.gov/sutils/e-pcr/; Schuler, Genome Res. 7:541-50, 1997. In one illustrative embodiment, one or more spreadsheets, such as Microsoft Excel workbooks contain a plurality of worksheets. First in this example, there is a worksheet with a name similar to the workbook name; this worksheet contains the raw electronic PCR data. Second, there is a worksheet named “filtered bioagents base count” that contains bioagent name and base count; there is a separate record for each strain after removing sequences that are not identified with a genus and species and removing all sequences for bioagents with less than 10 strains. Third, there is a worksheet, “Sheet1” that contains the frequency of substitutions, insertions, or deletions for this primer pair. This data is generated by first creating a pivot table from the data in the “filtered bioagents base count” worksheet and then executing an Excel VBA macro. The macro creates a table of differences in base counts for bioagents of the same species, but different strains. One of ordinary skill in the art may understand additional pathways for obtaining similar table differences without undo experimentation.

Application of an exemplary script, involves the user defining a threshold that specifies the fraction of the strains that are represented by the reference set of base counts for each bioagent. The reference set of base counts for each bioagent may contain as many different base counts as are needed to meet or exceed the threshold. The set of reference base counts is defined by taking the most abundant strain's base type composition and adding it to the reference set and then the next most abundant strain's base type composition is added until the threshold is met or exceeded. The current set of data was obtained using a threshold of 55%, which was obtained empirically.

For each base count not included in the reference base count set for that bioagent, the script then proceeds to determine the manner in which the current base count differs from each of the base counts in the reference set. This difference may be represented as a combination of substitutions, Si=Xi, and insertions, Ii=Yi, or deletions, Di=Zi. If there is more than one reference base count, then the reported difference is chosen using rules that aim to minimize the number of changes and, in instances with the same number of changes, minimize the number of insertions or deletions. Therefore, the primary rule is to identify the difference with the minimum sum (Xi+Yi) or (Xi+Zi), e.g., one insertion rather than two substitutions. If there are two or more differences with the minimum sum, then the one that will be reported is the one that contains the most substitutions.

Differences between a base count and a reference composition are categorized as one, two, or more substitutions, one, two, or more insertions, one, two, or more deletions, and combinations of substitutions and insertions or deletions. The different classes of nucleobase changes and their probabilities of occurrence have been delineated in U.S. Patent Application Publication No. 2004209260 (U.S. application Ser. No. 10/418,514) which is incorporated herein by reference in entirety.

Example 6 Use of Broad Range Survey and Division Wide Primer Pairs for Identification of Bacteria in an Epidemic Surveillance Investigation

This investigation employed a set of 16 primer pairs which is herein designated the “surveillance primer set” and comprises broad range survey primer pairs, division wide primer pairs and a single Bacillus clade primer pair. The surveillance primer set is shown in Table 5 and consists of primer pairs originally listed in Table 2. This surveillance set comprises primers with T modifications (note TMOD designation in primer names) which constitutes a functional improvement with regard to prevention of non-templated adenylation (vide supra) relative to originally selected primers which are displayed below in the same row. Primer pair 449 (non-T modified) has been modified twice. Its predecessors are primer pairs 70 and 357, displayed below in the same row. Primer pair 360 has also been modified twice and its predecessors are primer pairs 17 and 118.

TABLE 5
Bacterial Primer Pairs of the Surveillance Primer Set
Forward Reverse
Primer Primer Primer
Pair (SEQ ID (SEQ ID
No. Forward Primer Name NO:) Reverse Primer Name NO:) Target Gene
346 16S_EC_713_732_TMOD_F 202 16S_EC_789_809_TMOD_R 1110 16S rRNA
10 16S_EC_713_732_F 21 16S_EC_789_809 798 16S rRNA
347 16S_EC_785_806_TMOD_F 560 16S_EC_880_897_TMOD_R 1278 16S rRNA
11 16S_EC_785_806_F 118 16S_EC_880_897_R 830 16S rRNA
348 16S_EC_960_981_TMOD_F 706 16S_EC_1054_1073_TMOD_R 895 16S rRNA
14 16S_EC_960_981_F 672 16S_EC_1054_1073_R 735 16S rRNA
349 23S_EC_1826_1843_TMOD_F 401 23S_EC_1906_1924_TMOD_R 1156 23S rRNA
16 23S_EC_1826_1843_F 80 23S_EC_1906_1924_R 805 23S rRNA
352 INFB_EC_1365_1393_TMOD_F 687 INFB_EC_1439_1467_TMOD_R 1411 infB
34 INFB_EC_1365_1393_F 524 INFB_EC_1439_1467_R 1248 infB
354 RPOC_EC_2218_2241_TMOD_F 405 RPOC_EC_2313_2337_TMOD_R 1072 rpoC
52 RPOC_EC_2218_2241_F 81 RPOC_EC_2313_2337_R 790 rpoC
355 SSPE_BA_115_137_TMOD_F 255 SSPE_BA_197_222_TMOD_R 1402 sspE
58 SSPE_BA_115_137_F 45 SSPE_BA_197_222_R 1201 sspE
356 RPLB_EC_650_679_TMOD_F 232 RPLB_EC_739_762_TMOD_R 592 rplB
66 RPLB_EC_650_679_F 98 RPLB_EC_739_762_R 999 rplB
358 VALS_EC_1105_1124_TMOD_F 385 VALS_EC_1195_1218_TMOD_R 1093 valS
71 VALS_EC_1105_1124_F 77 VALS_EC_1195_1218_R 795 valS
359 RPOB_EC_1845_1866_TMOD_F 659 RPOB_EC_1909_1929_TMOD_R 1250 rpoB
72 RPOB_EC_1845_1866_F 233 RPOB_EC_1909_1929_R 825 rpoB
360 23S_EC_2646_2667_TMOD_F 409 23S_EC_2745_2765_TMOD_R 1434 23S rRNA
118 23S_EC_2646_2667_F 84 23S_EC_2745_2765_R 1389 23S rRNA
17 23S_EC_2645_2669_F 408 23S_EC_2744_2761_R 1252 23S rRNA
361 16S_EC_1090_1111_2_TMOD_F 697 16S_EC_1175_1196_TMOD_R 1398 16S rRNA
3 16S_EC_1090_1111_2_F 651 16S_EC_1175_1196_R 1159 16S rRNA
362 RPOB_EC_3799_3821_TMOD_F 581 RPOB_EC_3862_3888_TMOD_R 1325 rpoB
289 RPOB_EC_3799_3821_F 124 RPOB_EC_3862_3888_R 840 rpoB
363 RPOC_EC_2146_2174_TMOD_F 284 RPOC_EC_2227_2245_TMOD_R 898 rpoC
290 RPOC_EC_2146_2174_F 52 RPOC_EC_2227_2245_R 736 rpoC
367 TUFB_EC_957_979_TMOD_F 308 TUFB_EC_1034_1058_TMOD_R 1276 tufB
293 TUFB_EC_957_979_F 55 TUFB_EC_1034_1058_R 829 tufB
449 RPLB_EC_690_710_F 309 RPLB_EC_737_758_R 1336 rplB
357 RPLB_EC_688_710_TMOD_F 296 RPLB_EC_736_757_TMOD_R 1337 rplB
67 RPLB_EC_688_710_F 54 RPLB_EC_736_757_R 842 rplB

The 16 primer pairs of the surveillance set are used to produce bioagent identifying amplicons whose base compositions are sufficiently different amongst all known bacteria at the species level to identify, at a reasonable confidence level, any given bacterium at the species level. As shown in Tables 6A-E, common respiratory bacterial pathogens can be distinguished by the base compositions of bioagent identifying amplicons obtained using the 16 primer pairs of the surveillance set. In some cases, triangulation identification improves the confidence level for species assignment. For example, nucleic acid from Streptococcus pyogenes can be amplified by nine of the sixteen surveillance primer pairs and Streptococcus pneumoniae can be amplified by ten of the sixteen surveillance primer pairs. The base compositions of the biogent identifying amplicons are identical for only one of the analogous bioagent identifying amplicons and differ in all of the remaining analogous bioagent identifying amplicons by up to four bases per bioagent identifying amplicon. The resolving power of the surveillance set was confirmed by determination of base compositions for 120 isolates of respiratory pathogens representing 70 different bacterial species and the results indicated that natural variations (usually only one or two base substitutions per bioagent identifying amplicon) amongst multiple isolates of the same species did not prevent correct identification of major pathogenic organisms at the species level.

Bacillus anthracis is a well known biological warfare agent which has emerged in domestic terrorism in recent years. Since it was envisioned to produce bioagent identifying amplicons for identification of Bacillus anthracis, additional drill-down analysis primers were designed to target genes present on virulence plasmids of Bacillus anthracis so that additional confidence could be reached in positive identification of this pathogenic organism. Three drill-down analysis primers were designed and are listed in Tables 2 and 6. In Table 6, the drill-down set comprises primers with T modifications (note TMOD designation in primer names) which constitutes a functional improvement with regard to prevention of non-templated adenylation (vide supra) relative to originally selected primers which are displayed below in the same row.

TABLE 6
Drill-Down Primer Pairs for Confirmation of Identification of Bacillus anthracis
Forward Reverse
Primer Primer Primer
Pair (SEQ ID (SEQ ID
No. Forward Primer Name NO:) Reverse Primer Name NO:) Target Gene
350 CAPC_BA_274_303_TMOD_F 476 CAPC_BA_349_376_TMOD_R 1314 capC
24 CAPC_BA_274_303_F 109 CAPC_BA_349_376_R 837 capC
351 CYA_BA_1353_1379_TMOD_F 355 CYA_BA_1448_1467_TMOD_R 1423 cyA
30 CYA_BA_1353_1379_F 64 CYA_BA_1448_1467_R 1342 cyA
353 LEF_BA_756_781_TMOD_F 220 LEF_BA_843_872_TMOD_R 1394 lef
37 LEF_BA_756_781_F 26 LEF_BA_843_872_R 1135 lef

Phylogenetic coverage of bacterial space of the sixteen surveillance primers of Table 5 and the three Bacillus anthracis drill-down primers of Table 6 is shown in FIG. 3 which lists common pathogenic bacteria. FIG. 3 is not meant to be comprehensive in illustrating all species identified by the primers. Only pathogenic bacteria are listed as representative examples of the bacterial species that can be identified by the primers and methods of the present invention. Nucleic acid of groups of bacteria enclosed within the polygons of FIG. 3 can be amplified to obtain bioagent identifying amplicons using the primer pair numbers listed in the upper right hand corner of each polygon. Primer coverage for polygons within polygons is additive. As an illustrative example, bioagent identifying amplicons can be obtained for Chlamydia trachomatis by amplification with, for example, primer pairs 346-349, 360 and 361, but not with any of the remaining primers of the surveillance primer set. On the other hand, bioagent identifying amplicons can be obtained from nucleic acid originating from Bacillus anthracis (located within 5 successive polygons) using, for example, any of the following primer pairs: 346-349, 360, 361 (base polygon), 356, 449 (second polygon), 352 (third polygon), 355 (fourth polygon), 350, 351 and 353 (fifth polygon). Multiple coverage of a given organism with multiple primers provides for increased confidence level in identification of the organism as a result of enabling broad triangulation identification.

In Tables 7A-E, base compositions of respiratory pathogens for primer target regions are shown. Two entries in a cell, represent variation in ribosomal DNA operons. The most predominant base composition is shown first and the minor (frequently a single operon) is indicated by an asterisk (*). Entries with NO DATA mean that the primer would not be expected to prime this species due to mismatches between the primer and target region, as determined by theoretical PCR.

TABLE 7A
Base Compositions of Common Respiratory Pathogens
for Bioagent Identifying Amplicons Corresponding to
Primer Pair Nos: 346, 347 and 348
Primer 346 Primer 347 Primer 348
Organism Strain [A G C T] [A G C T] [A G C T]
Klebsiella MGH78578 [29 32 25 13] [23 38 28 26] [26 32 28 30]
pneumoniae [29 31 25 13]* [23 37 28 26]* [26 31 28 30]*
Yersinia pestis CO-92 Biovar [29 32 25 13] [22 39 28 26] [29 30 28 29]
Orientalis [30 30 27 29]*
Yersinia pestis KIM5 P12 (Biovar [29 32 25 13] [22 39 28 26] [29 30 28 29]
Mediaevalis)
Yersinia pestis 91001 [29 32 25 13] [22 39 28 26] [29 30 28 29]
[30 30 27 29]*
Haemophilus KW20 [28 31 23 17] [24 37 25 27] [29 30 28 29]
influenzae
Pseudomonas PAO1 [30 31 23 15] [26 36 29 24] [26 32 29 29]
aeruginosa [27 36 29 23]*
Pseudomonas Pf0-1 [30 31 23 15] [26 35 29 25] [28 31 28 29]
fluorescens
Pseudomonas KT2440 [30 31 23 15] [28 33 27 27] [27 32 29 28]
putida
Legionella Philadelphia-1 [30 30 24 15] [33 33 23 27] [29 28 28 31]
pneumophila
Francisella schu 4 [32 29 22 16] [28 38 26 26] [25 32 28 31]
tularensis
Bordetella Tohama I [30 29 24 16] [23 37 30 24] [30 32 30 26]
pertussis
Burkholderia J2315 [29 29 27 14] [27 32 26 29] [27 36 31 24]
cepacia [20 42 35 19]*
Burkholderia K96243 [29 29 27 14] [27 32 26 29] [27 36 31 24]
pseudomallei
Neisseria FA 1090, ATCC [29 28 24 18] [27 34 26 28] [24 36 29 27]
gonorrhoeae 700825
Neisseria MC58 (serogroup B) [29 28 26 16] [27 34 27 27] [25 35 30 26]
meningitidis
Neisseria serogroup C, FAM18 [29 28 26 16] [27 34 27 27] [25 35 30 26]
meningitidis
Neisseria Z2491 (serogroup A) [29 28 26 16] [27 34 27 27] [25 35 30 26]
meningitidis
Chlamydophila TW-183 [31 27 22 19] NO DATA [32 27 27 29]
pneumoniae
Chlamydophila AR39 [31 27 22 19] NO DATA [32 27 27 29]
pneumoniae
Chlamydophila CWL029 [31 27 22 19] NO DATA [32 27 27 29]
pneumoniae
Chlamydophila J138 [31 27 22 19] NO DATA [32 27 27 29]
pneumoniae
Corynebacterium NCTC13129 [29 34 21 15] [22 38 31 25] [22 33 25 34]
diphtheriae
Mycobacterium k10 [27 36 21 15] [22 37 30 28] [21 36 27 30]
avium
Mycobacterium 104 [27 36 21 15] [22 37 30 28] [21 36 27 30]
avium
Mycobacterium CSU#93 [27 36 21 15] [22 37 30 28] [21 36 27 30]
tuberculosis
Mycobacterium CDC 1551 [27 36 21 15] [22 37 30 28] [21 36 27 30]
tuberculosis
Mycobacterium H37Rv (lab strain) [27 36 21 15] [22 37 30 28] [21 36 27 30]
tuberculosis
Mycoplasma M129 [31 29 19 20] NO DATA NO DATA
pneumoniae
Staphylococcus MRSA252 [27 30 21 21] [25 35 30 26] [30 29 30 29]
aureus [29 31 30 29]*
Staphylococcus MSSA476 [27 30 21 21] [25 35 30 26] [30 29 30 29]
aureus [30 29 29 30]*
Staphylococcus COL [27 30 21 21] [25 35 30 26] [30 29 30 29]
aureus [30 29 29 30]*
Staphylococcus Mu50 [27 30 21 21] [25 35 30 26] [30 29 30 29]
aureus [30 29 29 30]*
Staphylococcus MW2 [27 30 21 21] [25 35 30 26] [30 29 30 29]
aureus [30 29 29 30]*
Staphylococcus N315 [27 30 21 21] [25 35 30 26] [30 29 30 29]
aureus [30 29 29 30]*
Staphylococcus NCTC 8325 [27 30 21 21] [25 35 30 26] [30 29 30 29]
aureus [25 35 31 26]* [30 29 29 30]
Streptococcus NEM316 [26 32 23 18] [24 36 31 25] [25 32 29 30]
agalactiae [24 36 30 26]*
Streptococcus NC_002955 [26 32 23 18] [23 37 31 25] [29 30 25 32]
equi
Streptococcus MGAS8232 [26 32 23 18] [24 37 30 25] [25 31 29 31]
pyogenes
Streptococcus MGAS315 [26 32 23 18] [24 37 30 25] [25 31 29 31]
pyogenes
Streptococcus SSI-1 [26 32 23 18] [24 37 30 25] [25 31 29 31]
pyogenes
Streptococcus MGAS10394 [26 32 23 18] [24 37 30 25] [25 31 29 31]
pyogenes
Streptococcus Manfredo (M5) [26 32 23 18] [24 37 30 25] [25 31 29 31]
pyogenes
Streptococcus SF370 (M1) [26 32 23 18] [24 37 30 25] [25 31 29 31]
pyogenes
Streptococcus 670 [26 32 23 18] [25 35 28 28] [25 32 29 30]
pneumoniae
Streptococcus R6 [26 32 23 18] [25 35 28 28] [25 32 29 30]
pneumoniae
Streptococcus TIGR4 [26 32 23 18] [25 35 28 28] [25 32 30 29]
pneumoniae
Streptococcus NCTC7868 [25 33 23 18] [24 36 31 25] [25 31 29 31]
gordonii
Streptococcus NCTC 12261 [26 32 23 18] [25 35 30 26] [25 32 29 30]
mitis [24 31 35 29]*
Streptococcus UA159 [24 32 24 19] [25 37 30 24] [28 31 26 31]
mutans

TABLE 7B
Base Compositions of Common Respiratory Pathogens for Bioagent Identifying
Amplicons Corresponding to Primer Pair Nos: 349, 360, and 356
Primer 349 Primer 360 Primer 356
Organism Strain [A G C T] [A G C T] [A G C T]
Klebsiella MGH78578 [25 31 25 22] [33 37 25 27] NO DATA
pneumoniae
Yersinia pestis CO-92 Biovar [25 31 27 20] [34 35 25 28] NO DATA
Orientalis [25 32 26 20]*
Yersinia pestis KIM5 P12 (Biovar [25 31 27 20] [34 35 25 28] NO DATA
Mediaevalis) [25 32 26 20]*
Yersinia pestis 91001 [25 31 27 20] [34 35 25 28] NO DATA
Haemophilus KW20 [28 28 25 20] [32 38 25 27] NO DATA
influenzae
Pseudomonas PAO1 [24 31 26 20] [31 36 27 27] NO DATA
aeruginosa [31 36 27 28]*
Pseudomonas Pf0-1 NO DATA [30 37 27 28] NO DATA
fluorescens [30 37 27 28]
Pseudomonas KT2440 [24 31 26 20] [30 37 27 28] NO DATA
putida
Legionella Philadelphia-1 [23 30 25 23] [30 39 29 24] NO DATA
pneumophila
Francisella schu 4 [26 31 25 19] [32 36 27 27] NO DATA
tularensis
Bordetella Tohama I [21 29 24 18] [33 36 26 27] NO DATA
pertussis
Burkholderia J2315 [23 27 22 20] [31 37 28 26] NO DATA
cepacia
Burkholderia K96243 [23 27 22 20] [31 37 28 26] NO DATA
pseudomallei
Neisseria FA 1090, ATCC 700825 [24 27 24 17] [34 37 25 26] NO DATA
gonorrhoeae
Neisseria MC58 (serogroup B) [25 27 22 18] [34 37 25 26] NO DATA
meningitidis
Neisseria serogroup C, FAM18 [25 26 23 18] [34 37 25 26] NO DATA
meningitidis
Neisseria Z2491 (serogroup A) [25 26 23 18] [34 37 25 26] NO DATA
meningitidis
Chlamydophila TW-183 [30 28 27 18] NO DATA NO DATA
pneumoniae
Chlamydophila AR39 [30 28 27 18] NO DATA NO DATA
pneumoniae
Chlamydophila CWL029 [30 28 27 18] NO DATA NO DATA
pneumoniae
Chlamydophila J138 [30 28 27 18] NO DATA NO DATA
pneumoniae
Corynebacterium NCTC13129 NO DATA [29 40 28 25] NO DATA
diphtheriae
Mycobacterium k10 NO DATA [33 35 32 22] NO DATA
avium
Mycobacterium 104 NO DATA [33 35 32 22] NO DATA
avium
Mycobacterium CSU#93 NO DATA [30 36 34 22] NO DATA
tuberculosis
Mycobacterium CDC 1551 NO DATA [30 36 34 22] NO DATA
tuberculosis
Mycobacterium H37Rv (lab strain) NO DATA [30 36 34 22] NO DATA
tuberculosis
Mycoplasma M129 [28 30 24 19] [34 31 29 28] NO DATA
pneumoniae
Staphylococcus MRSA252 [26 30 25 20] [31 38 24 29] [33 30 31 27]
aureus
Staphylococcus MSSA476 [26 30 25 20] [31 38 24 29] [33 30 31 27]
aureus
Staphylococcus COL [26 30 25 20] [31 38 24 29] [33 30 31 27]
aureus
Staphylococcus Mu50 [26 30 25 20] [31 38 24 29] [33 30 31 27]
aureus
Staphylococcus MW2 [26 30 25 20] [31 38 24 29] [33 30 31 27]
aureus
Staphylococcus N315 [26 30 25 20] [31 38 24 29] [33 30 31 27]
aureus
Staphylococcus NCTC 8325 [26 30 25 20] [31 38 24 29] [33 30 31 27]
aureus
Streptococcus NEM316 [28 31 22 20] [33 37 24 28] [37 30 28 26]
agalactiae
Streptococcus NC_002955 [28 31 23 19] [33 38 24 27] [37 31 28 25]
equi
Streptococcus MGAS8232 [28 31 23 19] [33 37 24 28] [38 31 29 23]
pyogenes
Streptococcus MGAS315 [28 31 23 19] [33 37 24 28] [38 31 29 23]
pyogenes
Streptococcus SSI-1 [28 31 23 19] [33 37 24 28] [38 31 29 23]
pyogenes
Streptococcus MGAS10394 [28 31 23 19] [33 37 24 28] [38 31 29 23]
pyogenes
Streptococcus Manfredo (M5) [28 31 23 19] [33 37 24 28] [38 31 29 23]
pyogenes
Streptococcus SF370 (M1) [28 31 23 19] [33 37 24 28] [38 31 29 23]
pyogenes [28 31 22 20]*
Streptococcus 670 [28 31 22 20] [34 36 24 28] [37 30 29 25]
pneumoniae
Streptococcus R6 [28 31 22 20] [34 36 24 28] [37 30 29 25]
pneumoniae
Streptococcus TIGR4 [28 31 22 20] [34 36 24 28] [37 30 29 25]
pneumoniae
Streptococcus NCTC7868 [28 32 23 20] [34 36 24 28] [36 31 29 25]
gordonii
Streptococcus NCTC 12261 [28 31 22 20] [34 36 24 28] [37 30 29 25]
mitis [29 30 22 20]*
Streptococcus UA159 [26 32 23 22] [34 37 24 27] NO DATA
mutans

TABLE 7C
Base Compositions of Common Respiratory Pathogens for Bioagent Identifying
Amplicons Corresponding to Primer Pair Nos: 449, 354, and 352
Primer 449 Primer 354 Primer 352
Organism Strain [A G C T] [A G C T] [A G C T]
Klebsiella MGH78578 NO DATA [27 33 36 26] NO DATA
pneumoniae
Yersinia pestis CO-92 Biovar NO DATA [29 31 33 29] [32 28 20 25]
Orientalis
Yersinia pestis KIM5 P12 (Biovar NO DATA [29 31 33 29] [32 28 20 25]
Mediaevalis)
Yersinia pestis 91001 NO DATA [29 31 33 29] NO DATA
Haemophilus KW20 NO DATA [30 29 31 32] NO DATA
influenzae
Pseudomonas PAO1 NO DATA [26 33 39 24] NO DATA
aeruginosa
Pseudomonas Pf0-1 NO DATA [26 33 34 29] NO DATA
fluorescens
Pseudomonas KT2440 NO DATA [25 34 36 27] NO DATA
putida
Legionella Philadelphia-1 NO DATA NO DATA NO DATA
pneumophila
Francisella schu 4 NO DATA [33 32 25 32] NO DATA
tularensis
Bordetella Tohama I NO DATA [26 33 39 24] NO DATA
pertussis
Burkholderia J2315 NO DATA [25 37 33 27] NO DATA
cepacia
Burkholderia K96243 NO DATA [25 37 34 26] NO DATA
pseudomallei
Neisseria FA 1090, ATCC 700825 [17 23 22 10] [29 31 32 30] NO DATA
gonorrhoeae
Neisseria MC58 (serogroup B) NO DATA [29 30 32 31] NO DATA
meningitidis
Neisseria serogroup C, FAM18 NO DATA [29 30 32 31] NO DATA
meningitidis
Neisseria Z2491 (serogroup A) NO DATA [29 30 32 31] NO DATA
meningitidis
Chlamydophila TW-183 NO DATA NO DATA NO DATA
pneumoniae
Chlamydophila AR39 NO DATA NO DATA NO DATA
pneumoniae
Chlamydophila CWL029 NO DATA NO DATA NO DATA
pneumoniae
Chlamydophila J138 NO DATA NO DATA NO DATA
pneumoniae
Corynebacterium NCTC13129 NO DATA NO DATA NO DATA
diphtheriae
Mycobacterium k10 NO DATA NO DATA NO DATA
avium
Mycobacterium 104 NO DATA NO DATA NO DATA
avium
Mycobacterium CSU#93 NO DATA NO DATA NO DATA
tuberculosis
Mycobacterium CDC 1551 NO DATA NO DATA NO DATA
tuberculosis
Mycobacterium H37Rv (lab strain) NO DATA NO DATA NO DATA
tuberculosis
Mycoplasma M129 NO DATA NO DATA NO DATA
pneumoniae
Staphylococcus MRSA252 [17 20 21 17] [30 27 30 35] [36 24 19 26]
aureus
Staphylococcus MSSA476 [17 20 21 17] [30 27 30 35] [36 24 19 26]
aureus
Staphylococcus COL [17 20 21 17] [30 27 30 35] [35 24 19 27]
aureus
Staphylococcus Mu50 [17 20 21 17] [30 27 30 35] [36 24 19 26]
aureus
Staphylococcus MW2 [17 20 21 17] [30 27 30 35] [36 24 19 26]
aureus
Staphylococcus N315 [17 20 21 17] [30 27 30 35] [36 24 19 26]
aureus
Staphylococcus NCTC 8325 [17 20 21 17] [30 27 30 35] [35 24 19 27]
aureus
Streptococcus NEM316 [22 20 19 14] [26 31 27 38] [29 26 22 28]
agalactiae
Streptococcus NC_002955 [22 21 19 13] NO DATA NO DATA
equi
Streptococcus MGAS8232 [23 21 19 12] [24 32 30 36] NO DATA
pyogenes
Streptococcus MGAS315 [23 21 19 12] [24 32 30 36] NO DATA
pyogenes
Streptococcus SSI-1 [23 21 19 12] [24 32 30 36] NO DATA
pyogenes
Streptococcus MGAS10394 [23 21 19 12] [24 32 30 36] NO DATA
pyogenes
Streptococcus Manfredo (M5) [23 21 19 12] [24 32 30 36] NO DATA
pyogenes
Streptococcus SF370 (M1) [23 21 19 12] [24 32 30 36] NO DATA
pyogenes
Streptococcus 670 [22 20 19 14] [25 33 29 35] [30 29 21 25]
pneumoniae
Streptococcus R6 [22 20 19 14] [25 33 29 35] [30 29 21 25]
pneumoniae
Streptococcus TIGR4 [22 20 19 14] [25 33 29 35] [30 29 21 25]
pneumoniae
Streptococcus NCTC7868 [21 21 19 14] NO DATA [29 26 22 28]
gordonii
Streptococcus NCTC 12261 [22 20 19 14] [26 30 32 34] NO DATA
mitis
Streptococcus UA159 NO DATA NO DATA NO DATA
mutans

TABLE 7D
Base Compositions of Common Respiratory Pathogens for Bioagent Identifying
Amplicons Corresponding to Primer Pair Nos: 355, 358, and 359
Primer 355 Primer 358 Primer 359
Organism Strain [A G C T] [A G C T] [A G C T]
Klebsiella MGH78578 NO DATA [24 39 33 20] [25 21 24 17]
pneumoniae
Yersinia pestis CO-92 Biovar NO DATA [26 34 35 21] [23 23 19 22]
Orientalis
Yersinia pestis KIM5 P12 (Biovar NO DATA [26 34 35 21] [23 23 19 22]
Mediaevalis)
Yersinia pestis 91001 NO DATA [26 34 35 21] [23 23 19 22]
Haemophilus KW20 NO DATA NO DATA NO DATA
influenzae
Pseudomonas PAO1 NO DATA NO DATA NO DATA
aeruginosa
Pseudomonas Pf0-1 NO DATA NO DATA NO DATA
fluorescens
Pseudomonas KT2440 NO DATA [21 37 37 21] NO DATA
putida
Legionella Philadelphia-1 NO DATA NO DATA NO DATA
pneumophila
Francisella schu 4 NO DATA NO DATA NO DATA
tularensis
Bordetella Tohama I NO DATA NO DATA NO DATA
pertussis
Burkholderia J2315 NO DATA NO DATA NO DATA
cepacia
Burkholderia K96243 NO DATA NO DATA NO DATA
pseudomallei
Neisseria FA 1090, ATCC 700825 NO DATA NO DATA NO DATA
gonorrhoeae
Neisseria MC58 (serogroup B) NO DATA NO DATA NO DATA
meningitidis
Neisseria serogroup C, FAM18 NO DATA NO DATA NO DATA
meningitidis
Neisseria Z2491 (serogroup A) NO DATA NO DATA NO DATA
meningitidis
Chlamydophila TW-183 NO DATA NO DATA NO DATA
pneumoniae
Chlamydophila AR39 NO DATA NO DATA NO DATA
pneumoniae
Chlamydophila CWL029 NO DATA NO DATA NO DATA
pneumoniae
Chlamydophila J138 NO DATA NO DATA NO DATA
pneumoniae
Corynebacterium NCTC13129 NO DATA NO DATA NO DATA
diphtheriae
Mycobacterium k10 NO DATA NO DATA NO DATA
avium
Mycobacterium 104 NO DATA NO DATA NO DATA
avium
Mycobacterium CSU#93 NO DATA NO DATA NO DATA
tuberculosis
Mycobacterium CDC 1551 NO DATA NO DATA NO DATA
tuberculosis
Mycobacterium H37Rv (lab strain) NO DATA NO DATA NO DATA
tuberculosis
Mycoplasma M129 NO DATA NO DATA NO DATA
pneumoniae
Staphylococcus MRSA252 NO DATA NO DATA NO DATA
aureus
Staphylococcus MSSA476 NO DATA NO DATA NO DATA
aureus
Staphylococcus COL NO DATA NO DATA NO DATA
aureus
Staphylococcus Mu50 NO DATA NO DATA NO DATA
aureus
Staphylococcus MW2 NO DATA NO DATA NO DATA
aureus
Staphylococcus N315 NO DATA NO DATA NO DATA
aureus
Staphylococcus NCTC 8325 NO DATA NO DATA NO DATA
aureus
Streptococcus NEM316 NO DATA NO DATA NO DATA
agalactiae
Streptococcus NC_002955 NO DATA NO DATA NO DATA
equi
Streptococcus MGAS8232 NO DATA NO DATA NO DATA
pyogenes
Streptococcus MGAS315 NO DATA NO DATA NO DATA
pyogenes
Streptococcus SSI-1 NO DATA NO DATA NO DATA
pyogenes
Streptococcus MGAS10394 NO DATA NO DATA NO DATA
pyogenes
Streptococcus Manfredo (M5) NO DATA NO DATA NO DATA
pyogenes
Streptococcus SF370 (M1) NO DATA NO DATA NO DATA
pyogenes
Streptococcus 670 NO DATA NO DATA NO DATA
pneumoniae
Streptococcus R6 NO DATA NO DATA NO DATA
pneumoniae
Streptococcus TIGR4 NO DATA NO DATA NO DATA
pneumoniae
Streptococcus NCTC7868 NO DATA NO DATA NO DATA
gordonii
Streptococcus NCTC 12261 NO DATA NO DATA NO DATA
mitis
Streptococcus UA159 NO DATA NO DATA NO DATA
mutans

TABLE 7E
Base Compositions of Common Respiratory Pathogens for Bioagent Identifying
Amplicons Corresponding to Primer Pair Nos: 362, 363, and 367
Primer 362 Primer 363 Primer 367
Organism Strain [A G C T] [A G C T] [A G C T]
Klebsiella MGH78578 [21 33 22 16] [16 34 26 26] NO DATA
pneumoniae
Yersinia pestis CO-92 Biovar [20 34 18 20] NO DATA NO DATA
Orientalis
Yersinia pestis KIM5 P12 (Biovar [20 34 18 20] NO DATA NO DATA
Mediaevalis)
Yersinia pestis 91001 [20 34 18 20] NO DATA NO DATA
Haemophilus KW20 NO DATA NO DATA NO DATA
influenzae
Pseudomonas PAO1 [19 35 21 17] [16 36 28 22] NO DATA
aeruginosa
Pseudomonas Pf0-1 NO DATA [18 35 26 23] NO DATA
fluorescens
Pseudomonas KT2440 NO DATA [16 35 28 23] NO DATA
putida
Legionella Philadelphia-1 NO DATA NO DATA NO DATA
pneumophila
Francisella schu 4 NO DATA NO DATA NO DATA
tularensis
Bordetella Tohama I [20 31 24 17] [15 34 32 21] [26 25 34 19]
pertussis
Burkholderia J2315 [20 33 21 18] [15 36 26 25] [25 27 32 20]
cepacia
Burkholderia K96243 [19 34 19 20] [15 37 28 22] [25 27 32 20]
pseudomallei
Neisseria FA 1090, ATCC 700825 NO DATA NO DATA NO DATA
gonorrhoeae
Neisseria MC58 (serogroup B) NO DATA NO DATA NO DATA
meningitidis
Neisseria serogroup C, FAM18 NO DATA NO DATA NO DATA
meningitidis
Neisseria Z2491 (serogroup A) NO DATA NO DATA NO DATA
meningitidis
Chlamydophila TW-183 NO DATA NO DATA NO DATA
pneumoniae
Chlamydophila AR39 NO DATA NO DATA NO DATA
pneumoniae
Chlamydophila CWL029 NO DATA NO DATA NO DATA
pneumoniae
Chlamydophila J138 NO DATA NO DATA NO DATA
pneumoniae
Corynebacterium NCTC13129 NO DATA NO DATA NO DATA
diphtheriae
Mycobacterium k10 [19 34 23 16] NO DATA [24 26 35 19]
avium
Mycobacterium 104 [19 34 23 16] NO DATA [24 26 35 19]
avium
Mycobacterium CSU#93 [19 31 25 17] NO DATA [25 25 34 20]
tuberculosis
Mycobacterium CDC 1551 [19 31 24 18] NO DATA [25 25 34 20]
tuberculosis
Mycobacterium H37Rv (lab strain) [19 31 24 18] NO DATA [25 25 34 20]
tuberculosis
Mycoplasma M129 NO DATA NO DATA NO DATA
pneumoniae
Staphylococcus MRSA252 NO DATA NO DATA NO DATA
aureus
Staphylococcus MSSA476 NO DATA NO DATA NO DATA
aureus
Staphylococcus COL NO DATA NO DATA NO DATA
aureus
Staphylococcus Mu50 NO DATA NO DATA NO DATA
aureus
Staphylococcus MW2 NO DATA NO DATA NO DATA
aureus
Staphylococcus N315 NO DATA NO DATA NO DATA
aureus
Staphylococcus NCTC 8325 NO DATA NO DATA NO DATA
aureus
Streptococcus NEM316 NO DATA NO DATA NO DATA
agalactiae
Streptococcus NC_002955 NO DATA NO DATA NO DATA
equi
Streptococcus MGAS8232 NO DATA NO DATA NO DATA
pyogenes
Streptococcus MGAS315 NO DATA NO DATA NO DATA
pyogenes
Streptococcus SSI-1 NO DATA NO DATA NO DATA
pyogenes
Streptococcus MGAS10394 NO DATA NO DATA NO DATA
pyogenes
Streptococcus Manfredo (M5) NO DATA NO DATA NO DATA
pyogenes
Streptococcus SF370 (M1) NO DATA NO DATA NO DATA
pyogenes
Streptococcus 670 NO DATA NO DATA NO DATA
pneumoniae
Streptococcus R6 [20 30 19 23] NO DATA NO DATA
pneumoniae
Streptococcus TIGR4 [20 30 19 23] NO DATA NO DATA
pneumoniae
Streptococcus NCTC7868 NO DATA NO DATA NO DATA
gordonii
Streptococcus NCTC 12261 NO DATA NO DATA NO DATA
mitis
Streptococcus UA159 NO DATA NO DATA NO DATA
mutans

Four sets of throat samples from military recruits at different military facilities taken at different time points were analyzed using the primers of the present invention. The first set was collected at a military training center from Nov. 1 to Dec. 20, 2002 during one of the most severe outbreaks of pneumonia associated with group A Streptococcus in the United States since 1968. During this outbreak, fifty-one throat swabs were taken from both healthy and hospitalized recruits and plated on blood agar for selection of putative group A Streptococcus colonies. A second set of 15 original patient specimens was taken during the height of this group A Streptococcus-associated respiratory disease outbreak. The third set were historical samples, including twenty-seven isolates of group A Streptococcus, from disease outbreaks at this and other military training facilities during previous years. The fourth set of samples was collected from five geographically separated military facilities in the continental U.S. in the winter immediately following the severe November/December 2002 outbreak.

Pure colonies isolated from group A Streptococcus-selective media from all four collection periods were analyzed with the surveillance primer set. All samples showed base compositions that precisely matched the four completely sequenced strains of Streptococcus pyogenes. Shown in FIG. 4 is a 3D diagram of base composition (axes A, G and C) of bioagent identifying amplicons obtained with primer pair number 14 (a precursor of primer pair number 348 which targets 16S rRNA). The diagram indicates that the experimentally determined base compositions of the clinical samples closely match the base compositions expected for Streptococcus pyogenes and are distinct from the expected base compositions of other organisms.

In addition to the identification of Streptococcus pyogenes, other potentially pathogenic organisms were identified concurrently. Mass spectral analysis of a sample whose nucleic acid was amplified by primer pair number 349 (SEQ ID NOs: 401:1156) exhibited signals of bioagent identifying amplicons with molecular masses that were found to correspond to analogous base compositions of bioagent identifying amplicons of Streptococcus pyogenes (A27 G32 C24 T18), Neisseria meningitidis (A25 G27 C22 T18), and Haemophilus influenzae (A28 G28 C25 T20) (see FIG. 5 and Table 7B). These organisms were present in a ratio of 4:5:20 as determined by comparison of peak heights with peak height of an internal PCR calibration standard as described in commonly owned U.S. Patent Application Ser. No. 60/545,425 which is incorporated herein by reference in its entirety.

Since certain division-wide primers that target housekeeping genes are designed to provide coverage of specific divisions of bacteria to increase the confidence level for identification of bacterial species, they are not expected to yield bioagent identifying amplicons for organisms outside of the specific divisions. For example, primer pair number 356 (SEQ ID NOs: 449:1380) primarily amplifies the nucleic acid of members of the classes Bacilli and Clostridia and is not expected to amplify proteobacteria such as Neisseria meningitidis and Haemophilus influenzae. As expected, analysis of the mass spectrum of amplification products obtained with primer pair number 356 does not indicate the presence of Neisseria meningitidis and Haemophilus influenzae but does indicate the presence of Streptococcus pyogenes (FIGS. 3 and 6, Table 7B). Thus, these primers or types of primers can confirm the absence of particular bioagents from a sample.

The 15 throat swabs from military recruits were found to contain a relatively small set of microbes in high abundance. The most common were Haemophilus influenza, Neisseria meningitides, and Streptococcus pyogenes. Staphylococcus epidermidis, Moraxella cattarhalis, Corynebacterium pseudodiphtheriticum, and Staphylococcus aureus were present in fewer samples. An equal number of samples from healthy volunteers from three different geographic locations, were identically analyzed. Results indicated that the healthy volunteers have bacterial flora dominated by multiple, commensal non-beta-hemolytic Streptococcal species, including the viridans group streptococci (S. parasangunis, S. vestibularis, S. mitis, S. oralis and S. pneumoniae; data not shown), and none of the organisms found in the military recruits were found in the healthy controls at concentrations detectable by mass spectrometry. Thus, the military recruits in the midst of a respiratory disease outbreak had a dramatically different microbial population than that experienced by the general population in the absence of epidemic disease.

Example 7 Triangulation Genotyping Analysis for Determination of emm-Type of Streptococcus pyogenes in Epidemic Surveillance

As a continuation of the epidemic surveillance investigation of Example 6, determination of sub-species characteristics (genotyping) of Streptococcus pyogenes, was carried out based on a strategy that generates strain-specific signatures according to the rationale of Multi-Locus Sequence Typing (MLST). In classic MLST analysis, internal fragments of several housekeeping genes are amplified and sequenced (Enright et al. Infection and Immunity, 2001, 69, 2416-2427). In classic MLST analysis, internal fragments of several housekeeping genes are amplified and sequenced. In the present investigation, bioagent identifying amplicons from housekeeping genes were produced using drill-down primers and analyzed by mass spectrometry. Since mass spectral analysis results in molecular mass, from which base composition can be determined, the challenge was to determine whether resolution of emm classification of strains of Streptococcus pyogenes could be determined.

For the purpose of development of a triangulation genotyping assay, an alignment was constructed of concatenated alleles of seven MLST housekeeping genes (glucose kinase (gki), glutamine transporter protein (gtr), glutamate racemase (murI), DNA mismatch repair protein (mutS), xanthine phosphoribosyl transferase (xpt), and acetyl-CoA acetyl transferase (yqiL)) from each of the 212 previously emm-typed strains of Streptococcus pyogenes. From this alignment, the number and location of primer pairs that would maximize strain identification via base composition was determined. As a result, 6 primer pairs were chosen as standard drill-down primers for determination of emm-type of Streptococcus pyogenes. These six primer pairs are displayed in Table 8. This drill-down set comprises primers with T modifications (note TMOD designation in primer names) which constitutes a functional improvement with regard to prevention of non-templated adenylation (vide supra) relative to originally selected primers which are displayed below in the same row.

TABLE 8
Triangulation Genotyping Analysis Primer Pairs for Group A Streptococcus Drill-Down
Forward
Primer
Primer (SEQ ID Reverse Primer Target
Pair No. Forward Primer Name NO:) Reverse Primer Name (SEQ ID NO:) Gene
442 SP101_SPET11_358_387_TMOD_F 588 SP101_SPET11_448_473_TMOD_R 998 gki
80 SP101_SPET11_358_387_F 126 SP101_SPET11_448_473_TMOD_R 766 gki
443 SP101_SPET11_600_629_TMOD_F 348 SP101_SPET11_686_714_TMOD_R 1018 gtr
81 SP101_SPET11_600_629_F 62 SP101_SPET11_686_714_R 772 gtr
426 SP101_SPET11_1314_1336_TMOD_F 363 SP101_SPET11_1403_1431_TMOD_R 849 murI
86 SP101_SPET11_1314_1336_F 68 SP101_SPET11_1403_1431_R 711 murI
430 SP101_SPET11_1807_1835_TMOD_F 235 SP101_SPET11_1901_1927_TMOD_R 1439 mutS
90 SP101_SPET11_1807_1835_F 33 SP101_SPET11_1901_1927_R 1412 mutS
438 SP101_SPET11_3075_3103_TMOD_F 473 SP101_SPET11_3168_3196_TMOD_R 875 xpt
96 SP101_SPET11_3075_3103_F 108 SP101_SPET11_3168_3196_R 715 xpt
441 SP101_SPET11_3511_3535_TMOD_F 531 SP101_SPET11_3605_3629_TMOD_R 1294 yqiL
98 SP101_SPET11_3511_3535_F 116 SP101_SPET11_3605_3629_R 832 yqiL

The primers of Table 8 were used to produce bioagent identifying amplicons from nucleic acid present in the clinical samples. The bioagent identifying amplicons which were subsequently analyzed by mass spectrometry and base compositions corresponding to the molecular masses were calculated.

Of the 51 samples taken during the peak of the November/December 2002 epidemic (Table 9A-C rows 1-3), all except three samples were found to represent emm3, a Group A Streptococcus genotype previously associated with high respiratory virulence. The three outliers were from samples obtained from healthy individuals and probably represent non-epidemic strains. Archived samples (Tables 9A-C rows 5-13) from historical collections showed a greater heterogeneity of base compositions and emm types as would be expected from different epidemics occurring at different places and dates. The results of the mass spectrometry analysis and emm gene sequencing were found to be concordant for the epidemic and historical samples.