US20080262212A1 - Ribocloning: Recombinant DNA Construction using Primers with RIBO Bases - Google Patents

Ribocloning: Recombinant DNA Construction using Primers with RIBO Bases Download PDF

Info

Publication number
US20080262212A1
US20080262212A1 US12/101,433 US10143308A US2008262212A1 US 20080262212 A1 US20080262212 A1 US 20080262212A1 US 10143308 A US10143308 A US 10143308A US 2008262212 A1 US2008262212 A1 US 2008262212A1
Authority
US
United States
Prior art keywords
dna
pcr
primers
target
vector
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US12/101,433
Inventor
Wayne Morris Barnes
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Individual
Original Assignee
Individual
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Individual filed Critical Individual
Priority to US12/101,433 priority Critical patent/US20080262212A1/en
Publication of US20080262212A1 publication Critical patent/US20080262212A1/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/66—General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligation; Use of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease

Definitions

  • Sequence Listing which is a part of the present disclosure, includes a computer readable form and a written sequence listing comprising nucleotide and/or amino acid sequences of the present invention.
  • the sequence listing information recorded in computer readable form is identical to the written sequence listing.
  • the subject matter of the Sequence Listing is incorporated herein by reference in its entirety.
  • the present invention provides methods of linking nucleic acids without the use of restriction enzymes or any joining enzyme such as ligase. More specifically, the present invention provides methods for cloning or rearranging a double-stranded target DNA which is preferably a PCR product into a double-stranded vector DNA which is preferably a PCR product and methods for generating a hybrid double-stranded DNA comprising at least two target DNA sequences, all such DNA being amplified using primers that contain at least one ribonucleotide, preferably at or near the respective 3′ ends of the primers, such that RNA-specific cleavage, preferably by RNAse A, will allow release of the primers to create long matching 3′-sticky ends.
  • Recombinant DNA stems from the discovery of enzymes called restriction endonucleases or “restriction enzymes,” that are capable of cleaving double stranded DNA at specific recognition sites, thereby producing DNA fragments that can be ligated to one another by ligase enzyme to generate “recombinant” molecules (see, for example, Cohen et al, Proc. Natl. Acad. Sci. USA 70:1293, 1973; Cohen et al., Proc. Natl. Acad. Sci. USA 70:3274, 1972; see also U.S. Pat. Nos. 4,740,470; 4,468,464; 4,237,224). The study of molecular biology has benefited greatly from the ability of scientists to join DNA fragments together in manmade arrangements for the purpose of experimentation or industrial production.
  • PCR polymerase chain reaction
  • PCR products can be cloned using restriction enzymes, if the primers are made longer to incorporate the desired restriction site, if said site is not present in the PCR product or cutting at it can be suppressed, and if the vector has a similar matching restriction site. It is important to carry out a purification of the PCR product to at least remove mTPs and/or polymerase before digestion by restriction enzymes, especially for 5′-sticky ends, since they can be filled in by said left-over DNA polymerase.
  • TOP0 (TM Invitrogen)-cloning utilizes special vectors with adjacent sites for Vaccinia virus topoisomerase, and said vector is pre-activated with topoisomerase. If the PCR product has terminal extra As, and no 5′-phosphates, it can be cloned into this vector conveniently, at a site between the two topoisomerase recognition sequences.
  • the present invention has no requirement 20 for any specific vector or even the site of cloning within any vector, except that the vector must preferably be amplifiable by PCR using primers at the cloning site.
  • nonligase cloning method utilizes terminal homology similar to the present invention, although usually twice as long.
  • Special E. coli strains which highly express the recET system, or any yeast strain (if the vector is a yeast vector) can then be used to recombine target and vector.
  • This system is not very efficient, and is prone to recombination and rearrangements at other homologous or repeated sites on the vector and/or target molecules, rather than just at the desired and small terminal homologies.
  • restriction enzymes require that the segment of DNA being digested have the particular restriction site only at desired locations—that is to say, a particular DNA base sequence (restriction site) is necessary to enable the restriction enzyme to digest the particular piece of DNA, yet the restriction sites must be rare or preferably non-existent within the vector or target, lest they be cut up too much to put together in the desired arrangement.
  • a particular DNA base sequence restriction site
  • 2 vector or 2 target molecules will join, often in the wrong orientation, whereas the desired product is usually one vector and one target with one desired orientation.
  • the present invention provides methods for producing DNA target molecules that may be easily and directly inserted into vector molecules or attached to other DNA target molecules, all without the use of restriction enzymes, ligase, or topoisomerase, nor with any regard for restriction site sequences.
  • the inventive system provides techniques and reagents for generating target molecules with 3′-single-strand overhangs, and further provides the tools and methods for preparing vector or other target DNA molecules with matching complementary 3′-single-strand overhangs, allowing the efficient and specific linking of DNAs such as target(s) and vector to each other in desired orientation and location.
  • the length and sequence of the overhangs can be varied according to the desires of the practitioner, and do not need to be My complementary. Therefore, one aspect of the invention provides a method of cloning a double-stranded target DNA into a double stranded vector DNA, said method comprising:
  • RNA sequences which is to say at the desired site of recombination.
  • the resulting PCR product will have incorporated near each 5′-end a single (or more) ribonucleotide at a position preferably some 25 bases in from each 5′ end;
  • the PCR amplification reaction can be carried out in the presence of one or two bracketing “band-aid” oligomers (for example, 50 mers) which comprise one strand of the desired end-point recombined structure consisting of adjacent sequences complementary to the ends of said target (for example, 25 bases) and vector DNA (for example, 25 bases).
  • the band-aid primers are used at such low concentration that it is often helpful to employ unusually long PCR extension times, at annealing temperatures, in order to allow for slow kinetics of band-aid annealing.
  • successive PCR amplifications may be performed, in which the band-aid primers are oriented so that they can function at the first PCR amplification and are preferably at least 95% removed or diluted before the second PCR amplification which uses the riboprimers. If the template for the target already contains the sequences to match the riboprimers, the band-aid primers are of course unnecessary;
  • RNA-cleaving conditions that do not cleave DNA, preferably by the use of bovine pancreatic RNAse A enzyme, that result in the single-strand cleavage of said riboprimers at the point of the single (or more) ribonucleotide rC or rU, followed by heating at a temperature that melts the PCR primers from said target DNA, preferably followed by removal of the PCR primers and any uncleaved DNA, thereby generating target DNA with 3′-overhangs;
  • the amplification by PCR can be catalyzed by any one of a number of DNA polymerases and mixtures of DNA polymerases, including, but not limited to, Vent, peep Vent, Pfu, Pwo, Klentaq1, KlentaqLA, TaqLA, Taq, KOD, and further mixtures thereof.
  • Archeal DNA polymerases (such as Vent, Deep Vent, Pfu or Pwo) which cannot cross a ribonucleotide on the template must include a small admixture of a polymerase which can cross the ribonucleotide (such as Klentaq1 or Taq).
  • the vector DNA can be from any form of replication, including but not limited to, bacterial, viral, yeast, plant, or animal cell vectors.
  • the annealed molecules have discontinuities such as a nick, a nick with a slight overlap, or a gap on each strand, about 25 bases apart. These discontinuities are automatically and preferably repaired in vivo (intracellularly) after transformation, without special arrangement by the technician, and without the choice of any particular host cell recombination capacity or noncapacity, since the repair does not require recombination. Nevertheless it is possible to repair the discontinuities in vitro using methods well known in the art, such as nick-translation catalyzed by E. coli DNA polymerase I, followed by, or combined with, ligase treatment.
  • the structure of the recombined product is ideally suited for nick translation; the long 3′-sticky ends result in a structure that is made even more stable by the process of nick translation, which would move the nicks farther and farther apart on the DNA and leave them ever more suitable as substrates for any DNA ligase.
  • the cleaved target or vector DNA, incompletely cleaved or uncleaved target or vector DNA, and the primers are incubated with paramagnetic streptavidin beads, following which the completely cleaved target or vector DNA is separated from biotin-containing primers and biotin-containing uncleaved target or vector DNA which remain attached to the streptavidin beads.
  • the incubation with streptavidin beads may be performed prior to the cleavage step, thus allowing for the cleavage to occur on the beads, but this is not recommended due to poorer performance.
  • the one or more ribonucleotide within or preferably at the 3′ end of the primers can be selected from the group consisting of: riboC, riboU, riboT, riboA, riboG or ribol.
  • the RNA-cleavage conditions that result in the cleavage of riboprimers from desired DNA molecules can be performed using alkali, but this causes denaturation of the subject DNA, which must therefore be neutralized and reannealed to reconvert the DNA to the doublestranded form.
  • RNAse capable of cleaving a bond between a particular 3′-end ribonucleotide comprised near the 5′-end of the PCR product and the adjacent deoxynucleotide.
  • the RNAse comprises RNAse A, which can cleave at single bases of riboU and riboC within double-stranded PCR products, and the use of low salt is key. It is a surprising aspect of the invention that RNAse A can do this, since RNAse A is well known as a single-strand specific RNAse. It is important for the efficiency of the method that the RNAse not be contaminated with any other nucleases, such as DNAse II.
  • RNAse T 1 would be appropriate for riboG.
  • the vector, or portion of a vector can be any commercially available vector, or desired suitable portion of a vector, that can be amplified by PCR.
  • Band-aid primers may be on either strand. If on one strand (3′-ends pointing toward the target DNA, same as the PCR riboprimers) they will also serve to prime extension on the intended template, albeit, if included at the recommended very low (2-10 nanomolar) concentration, less efficiently than the PCR riboprimers. When band-aid primers are on this strand, the final PCR product will be contain them in some small proportion, and this proportion will not contain the ribonucleotide(s) supplied by the riboprimers.
  • the band-aid primers are on the other strand (3′-ends pointing away from the target DNA), they will at first and at early cycles of the PCR only serve as a short template, and the only template, for the PCR primers, which will be extended over the band-aid primers. Then the extended PCR primers will be able to initiate extension on the actual desired target at the second and later cycles of the PCR. Because all of the PCR product is expected to contain the ribonucleotide(s) from the riboprimers, this method (band-aid primers pointing away from the target) is preferred. It is of little consequence, and the method still works, if the band-aid primers are a mixture of the two types, i.e.
  • Band-aid primers may be of any length, and may be double-stranded, but preferably they have at least 20 bases of sequence overlap (preferably 24-26 bases) with the PCR product to be amplified at one of their ends, and a similar amount of sequence homology to the PCR riboprimers somewhere within them, distal to the amplified PCR span, such as at their other end.
  • band-aid primers at low (ca. 3-10 nanomolar) concentration may be extended by including during the PCR reaction several overlapping primers (such as 40-60 mers) at similarly low concentration, to build up significant lengths of novel sequence onto the vector or target.
  • This principal of low concentration (about 20 times lower than Stemmer et al.) and long annealing/extension time, preferably about 20 minutes (which is 20-40 times longer than Stemmer et al.) may be extended, by the use of dozens of overlapping primers, to constitute an improvement to the method of synthesis and assembly of entire genes.
  • the present method is used for one or more ribo bases throughout the primer.
  • An advantage to internal rib bases is that, upon cleavage at 2 locations, the fragments of primer remaining will not tend to compete with productive recombinant annealing. Primer left over from the PCR will be similarly degraded. Only one rib base per PCR primer is the most challenging special case of the method, yet it is the case demonstrated in the examples, for the possibly temporary reason of cost of manufacture of oligos with internal ribo bases.
  • ribobases per primer without 5′-biotin, could be used for the PCR and then the primers cleaved to 12-13 bases with RNAse A.
  • all-DNA primers could be synthesized and added, and annealed, for the purpose of streptavidin bead purification of sticky-ended targets or vectors. If this is done in series with each end at a time, each sticky end could be positively selected.
  • FIG. 1 Schematic of the ribocloning method.
  • Riboprimers are PCR primers with a 3′-riboC. DNA depictions, primers and resulting sticky ends are not to scale.
  • FIG. 2 Three example riboclonings analyzed by agarose gel. Three cloning experiments are shown. Experiment 1, 2, and 3 annealed DNAs are shown in lanes 1, 2, and 3. Lanes 1C, 2C and 3C, respectively, show the input DNAs migrating separately. To get this effect, vector primers V0lneg7T and V41 were included to poison (prevent by competition) the annealings. Experiment 1 vector was Ribovector 250, labeled “V250”. Experiment 1 and 2 target was ribotarget maize Ds-Red. Experiment 2 and 3 vector was Ribovector ASK75, labeled “V75”.
  • Experiment 3 target was the Taq DNA polymerase gene, which was inadvertently included at lower than recommended equimolar, at such a low level that it is not visible on this fuzzy gel.
  • the experiments in lanes 1 and 2 utilized a vector:target input ratio which was much closer to the ideal of equimolar.
  • All agarose gels ( FIGS. 2 , 4 and 5 ) contain a standard lane in which was loaded phage lambda DNA digested with restriction enzyme HindIII. The band sizes, in order from the top, are, if they are visible, are shown in Table 1.
  • FIG. 3 Transformant E. coli colonies arising from ribocloning a gene encoding Ds-Red protein. Clones arising from ribocloning the Ds-Red gene, from the cloning/annealing depicted in lane 1 of FIG. 2 . Bright red colonies are the desired clones, expressing Ds-Red as a pigment in this E. coli bacterial background after one week on the plate. Colorless colonies are the 10% typical misclones with this method. The cause and nature of the misclones is unknown at this time, but their number is too high to be PCR-induced mutations under the high-fidelity PCR conditions employed. Off-color clones (pink or orange) are presumably PCR-induced mutations. Some colonies have been smeared with a toothpick when picked for further analysis.
  • FIG. 4 Variations on ribocloning the Taq Pol I gene for Thermus aquaticus DNA polymerase, using bead-purifed DNA. Use of streptavidin bead-purified vector and target DNA. After the RNAse A treatment with USB RNAse (not of the preferred purity, which is Ambion 2270), proteinase K treatment was included as normal for the samples on the left, but omitted for the right side samples, before high-salt adsorption to and heat-elution from paramagnetic streptavidin beads. “LINE” marks a band which is believed to be a linear combination of one target and one vector molecule. This molecule it not the desired endpoint which is capable of efficient transformation of cells.
  • CIRCLE marks the position of a band that is believed to be the desired endpoint of the recombination. The number of transformant colonies from the method is greatest when this band is visible and prominent. All agarose gels ( FIGS. 2 , 4 and 5 ) contain a standard lane in which was loaded phage lambda DNA digested with restriction enzyme HindIII. The band sizes, in order from the top, are, if they are visible, are shown in Table 1.
  • FIG. 5 Cloning the Taq Pol I gene without using bead-purified DNA. Ribocloning without the purification on streptavidin beads. This is an example of the many preliminary experiments which were done without streptavidin beads, and which served to establish the salt, incubation, and temperatures which are recommended throughout the Examples. All agarose gels ( FIGS. 2 , 4 and 5 ) contain a standard lane in which was loaded phage lambda DNA digested with restriction enzyme HindIII. The band sizes, in order from the top, are, if they are visible, are shown in Table 1.
  • FIG. 6 Assay of clones of Taq Pol I gene to confirm successful cloning of active genes. Confirmation of successful cloning of the Taq Pol I gene depicted in FIGS. 4 and 5 . Transformant colonies were grown on nitrocellulose and assayed by the method of Sagner et al, [Sagner G, Ruger R, Kessler C. (1991) Rapid filter assay for the detection of DNA polymerase activity: direct identification of the gene for the DNA polymerase from Thermus aquaticus .Gene 97: 119-123] as modified and described by Barnes and Kermekchiev (U.S. Pat. No. 6,214,557).
  • Each of 96 clones is assayed as a trio of inoculated spots of bacteria.
  • a trio of visible spots indicates TCA-insoluble material incorporated by a positive clone at 65° C.
  • Rows 4 and 8 are each assays of 12 clones that are invisible, because they are negative controls that are not expected to have any Taq DNA.
  • Rows 1 and 5 each assay 12 colonies from the cloning depicted in FIG. 5 .
  • Rows 2 and 6 assays 12 colonies from FIG. 4 right, and Rows 3 and 7 each assay 12 colonies from FIG. 4 left.
  • some 10% of the Taq clones are in fact negative in this assay, such as the ones in row 1, column 2, and row 2, column 7; the nature of these apparent misclones has not yet been determined.
  • bp is the abbreviation for base pairs.
  • kb is the abbreviation for kilobase (1000 base pairs).
  • nt is the abbreviation for nucleotides.
  • overlap means DNA sequence homology or complementarity, as appropriate.
  • Taq is the abbreviation for Thermus aquaticus.
  • Pfu is the abbreviation for Purococcus furiosus.
  • Vent is the abbreviation for Thermococcus litoralis DNA polymerase.
  • KOD is the abbreviation for hyperthermophiiic archaeon Pyrococcus Kodakaraensis KOD 1 (Kod DNA Polymerase) Deep Vent DNA polymerase is purified from an archael, thermophilic bacterium by New England Biolabs, Inc.
  • Klentaq1 is a trademark for Klentaq-278 which is a DNA polymerase having substantially the same amino acid sequence as Thermus aquaticus DNA polymerase, but excluding the N-terminal 278 amino acids, ⁇ one residue as claimed in U.S. Pat. No. 5,616,494, incorporated herein by reference.
  • LA PCR is Long and Accurate PCR, which is PCR using an unbalanced mixture of two DNA polymerases, as claimed in U.S. Pat. No. 5,436,149.
  • KlentaqLA is an unbalanced mixture of two DNA polymerases, wherein the major component is the thermostable DNA polymerase known as Klentaq1 or Klentaq278 and lacking 3′-exonuclease and the minor component is at least one DNA polymerase exhibiting 3′-exonuclease activity, as claimed in U.S. Pat. No. 5,436,149.
  • KlentaqLA is commercially available from Clontech (Cat. No. 8421-1) and from Sigma (Cat. No. D6290).
  • the minor component is “Deep Vent” DNA polymerase.
  • TaqLA is an unbalanced mixture of two DNA polymerases, wherein the major component is full-length Taq DNA polymerase as the thermostable DNA polymerase lacking 3′-exonuclease activity and the minor component is at least one DNA polymerase exhibiting 3′-exonuclease activity, as claimed in U.S. Pat. No. 5,436,149, incorporated herein by reference.
  • the minor component is “Deep Vent” DNA polymerase.
  • “Thermostable” is defined herein as having the ability to withstand temperatures up to at least 95° C. for many minutes without becoming irreversibly denatured and the ability to polymerize DNA at optimum temperatures of 55° C. to 75° C.
  • PCR primers are usually present at 20 pmoles per 100 ⁇ l (0.2 micromolar), and serve to direct in vitro amplification to the DNA sequence specifically between them on a template.
  • “Band-aid” primers usually contain adjacent sequence of circa 25 nt each, from the ends of the target and the vector. They are used to bridge the PCR primers onto the target to be amplified.
  • PCR is the polymerase chain reaction which is a process in which replicate copies are made of a target polynucleotide using one or more primers, and a catalyst of polymerization, such as a DNA polymerase, and particularly a thermally stable polymerase.
  • PCR involves repeatedly performing a “cycle” of two or three temperature steps: “melting”, in which the temperature is adjusted such that the DNA dissociates to single strands, “annealing”, in which the temperature is adjusted such that oligonucleotide primers are permitted to match their complementary base sequence using base pair recognition to form a duplex at one end of the span of polynucleotide to be amplified; and “extension” or “synthesis”, which may occur at the same temperature as annealing, or in which the temperature is adjusted to a slightly higher and more optimum temperature. Oligonucleotides that have formed a duplex (which have primed onto a template strand) are elongated with the provided DNA polymerase. This cycle is then repeated until the desired amount of amplified polynucleotide is obtained.
  • Methods for PCR amplification are taught in U.S. Pat. Nos. 4,683,195 and 4,683,202.
  • RNA may be replicated, for example, by a RNA directed RNA polymerase, or by reverse transcribing the RNA using a reverse transcriptase or a DNA polymerase exhibiting reverse transcriptase activity and then performing a PCR amplification.
  • the amplified copy of the RNA is a DNA (known as “copy DNA:, “complementary DNA”, “cDNA” or RT-PCR product) of the correlating or homologous sequence.
  • “Amplimer” is a term for the span of DNA that is amplified by the PCR process, a.k.a. a “PCR product”.
  • “Riboprimer” is a form of PCR primer that contains at least one ribonucleotide instead of DNA, most conveniently at the very 3′-end.
  • “Ribocloning” refers to the use of riboprimers to specify amplimers which can be recombined by the present method.
  • “Specificity” in PCR amplification refers to the generation of a single, “specific,” PCR product with the size and sequence predicted from the sequences of the primers and the genomic or transcribed region of nucleic acid to which the primers were designed to anneal in a base-complementary manner. “Nonspecific” PCR product has a size or sequence different from such prediction.
  • a “target nucleic acid” is that genomic or transcribed region of nucleic acid sought to be replicated, generally the ends of which are base-complementary (with proper orientation) to primers included in a complete set of PCR reagents.
  • a primer refers to a nucleic acid sequence, which is complementary to a known portion of a target nucleic acid sequence and which is necessary to initiate synthesis by DNA polymerase.
  • a primer as used herein includes riboprimers unless the context precludes it. “Proper orientation” is a term used to indicate that the two primers anneal to opposite strands of double-stranded target nucleic acid with their 3′ ends pointing toward one another on the sequence. Such primers are said to target the genomic or transcribed sequence to the ends of which they are base-complementary.
  • Thermus aquaticus DNA polymerase and “Taq DNA polymerase” are used interchangeably to refer to heat stable DNA polymerases from the bacterium Thermus aquaticus and include all Taq mutants, natural and synthesized.
  • complementarity refers to the pairing of bases (purines and pyrimidines) that associate through hydrogen bonding base-pair recognition in double stranded nucleic acid.
  • bases purines and pyrimidines
  • the following base pairs are complementary: guanine pairs with cytosine; adenine with thymine; and adenine with uracil.
  • complementarity and complementary include complete and partial complementarity.
  • sequence means the linear order in which monomers occur in a polymer, for example, the order of amino acids in a polypeptide or the order of nucleotides in a polynucleotide.
  • riboprimer refers to a primer that comprises at least one ribonucleotide, usually at the 3′ end, but also usefully at one or more positions from 5 to 26, preferably at one or more positions from 13 to 26, with usefulness but steadily decreasing preference with each base faster than 26 from the 5′ end.
  • target DNA refers to a [double-stranded] DNA sequence that is to be cloned into a [double-stranded] vector (so-called because it comprises a replicon) or that may be joined with additional [double-stranded] DNA sequences. Accordingly, the present invention provides novel methods for joining at least two DNA sequences. Such methods are useful for cloning a target DNA molecule into a vector or for recombining two or more target DNA sequences.
  • the methods disclosed herein care little about the location of insertion within the vector, and avoid the use of restriction enzymes, ligase or topoisomerase, thereby contributing to the generality, accuracy and efficiency of nucleic acid cloning and rearrangement.
  • vector refers do a [double-stranded] DNA sequence that carries a replicon and a suitable selective marker that will allow selection of transformants in the form of life that that the replicon and marker are expressed in. More generally, the term “vector” refers to a DNA sequence that will allow the replication or expression of an attached target DNA, whether in vivo or in vitro. As used herein, the term “vector” may only include sequences, such as extensive homology or restriction sites, suitable for a separate step of recombination that would eventually lead to the desired DNA structure.
  • the present invention provides methods of cloning a double-stranded target DNA into or onto a double-stranded vector, wherein said methods comprise:
  • one of the target riboprimers and one of the vector riboprimers are completely and exactly complementary to one another, or they share enough complementary homology, generally known to be about 12 bases, to anneal together stably in solution without the need of catalysis by any enzymes.
  • a similar homology is designed to exist for the second target riboprimer and the second vector riboprimer.
  • Riboprimers are PCR primers that contain at least one ribonucleotide, usually at their respective 3′ ends; b) exposing the target and/or vector DNA to conditions that specifically cleave RNA and result in the cleavage of said riboprimers at the position of their one or more ribonucleotides even though surrounded by DNA, usually double-stranded DNA, thereby generating cleaved target DNA with a nick about 25 bases (preferred range 12-26 bases) from each 5′ end; e) melting off the 12-1 5 base fragments under conditions that do not melt the bulk double stranded PCR product DNA, thus leaving a 12-26 base 3′-single strand at each end;
  • bracketing oligonucleotides that contain overlap between the target and the vector.
  • These bracketing oligonucleotides are generally only employed in initial cycles of PCR to create target DNA sequences with ends complementary to the ends of the vector, and thus are used in smaller quantities than riboprimers.
  • amplification is performed using about 20 pmoles of each riboprimer and 1 ⁇ 2 to 1 pmole of each bandaid primer per each 100-150 ⁇ l of reaction volume.
  • bandaid primers are about 50 nucleotides long, comprising about 25 nucleotides from the target ends and about 25 nucleotides from the vector ends; however, a skilled artisan can select other lengths as well that would also allow successful priming of DNA synthesis.
  • any DNA polymerase known in the art that is capable of extending from a riboprimer can be used, which is all of them, as far as we know, since extension from an RNA primer is a natural part of the initiation of DNA syntheses in cells.
  • some DNA polymerases, particularly those from the Archea cannot cross the ribonucleotides as template when they come back the other way on the next PCR cycle.
  • the riboprimers that are used to amplify the target DNA sequence contain at least one ribonucleotide at or near their respective 3′ ends.
  • Ribonucleotides can be selected from the group consisting of riboC, ribo U, ribo T, riboA, riboG, and ribo 1. The particular ribonucleotide is chosen based on optimal efficiency of commercially available ribonucleases. Pancreatic RNAse A, catalog numbers 2270 and 2272 from Ambion is particularly effective, but can only cleave at rU, rT, and rC.
  • the riboprimers are preferably about 24-26 nucleotides in length, however their precise length is optional and can be chosen by a practitioner. Generally, the riboprimer length is from about 20 nucleotides to about 30 nucleotides.
  • the nucleotide sequence of each of the riboprimers is selected by the practitioner and need not be My complementary to the sequence of the target DNA. As is known in the art, perfect complementarity is not required for successful extension of primers and resulting DNA synthesis, nor for successful annealing.
  • the 5′ end of the primer does not need to be paired at all to the DNA being amplified; thus adding nucleotides to the 5′ end of the primer may be used in generating target DNAs that contain additional sequences.
  • the bandaid primers that are used herein comprise sequences complementary to the target DNA at 3′ ends and sequences complementary to the vector DNA at 5′ ends, thus allowing for addition of vector end sequences on both ends of the target DNA.
  • Riboprimers that contain at least one ribonucleotide, preferably at their 3′ ends may be prepared by any technique available in the art. For example, such riboprimers may be chemically synthesized. Such riboprimers are commercially available from companies such as, e-g., DNAgency and Integrated DNA Technologies (IDT), which will synthesize primers according to a practitioner's request.
  • IDT Integrated DNA Technologies
  • riboprimers may be generated by ligating at least one ribonucleotide to the 3′-end of a DNA sequence that is to be used as a primer (see, for example, Moore et al., Science 256:992, 1992; Smith (ed), RNA: Protein Interactions, A Practical Approach , Oxford University Press, 1998, which are incorporated herein by reference).
  • Riboprimers that are preferably used comprise only one ribonucleotide at their 3′ ends. While the presence of only one ribonucleotide in each riboprimer does not decrease the efficacy of priming and/or cleaving of said riboprimers from the target DNAs, synthesis of riboprimers with only one ribonucleotide is more cost-effective than synthesis of primers with more than one ribonucleotide.
  • a ribonucleotide used for the methods of the present selection may be selected from riboG, riboA, riboU, riboT, and riboI. In a preferred embodiment, the ribonucleotide comprises riboC or riboU.
  • the solution comprising the target DNA may be precipitated with PEG in order to remove the unincorporated primers, followed by resuspension of the target DNA in a low salt solution (such as 5 mM Tris, 5 mM EDTA) prior to exposing it to conditions that result in the cleavage of said riboprimers from said target DNA.
  • a low salt solution such as 5 mM Tris, 5 mM EDTA
  • the cleavage of the primers from a target DNA is achieved by incubating the target DNA with an RNAse that is capable of cleaving a bond between a deoxynucleotide and a particular ribonucleotide that was used in the primers.
  • an RNAse that is capable of cleaving a bond between a deoxynucleotide and a particular ribonucleotide that was used in the primers.
  • a riboprimer comprises a riboC
  • any RNAse capable of cleaving a bond between a deoxynucleotide and a riboC may be used.
  • bovine pancreatic RNAseA is used to cleave the bonds between a deoxynucleotide and riboC, riboU, or riboT
  • RNAseT1 is used to cleave the bonds between a deoxynucleotide and a riboG.
  • the amount of RNAse depends on multiple factors, such as, e.g., the amount of the target DNA, and can easily be determined by one of ordinary skill in the art.
  • RNAse RNAse
  • a protease such as proteinase K is added to inactivate the RNAse and any other nucleases that may contaminate it.
  • the incubation with protease is followed by heating the solution comprising the target DNA and RNAse, thereby releasing the riboprimers from the double-stranded DNA molecules.
  • the riboprimers are specified and manufactured to contain a biotin moiety at their 5′-ends. In this case it improves the overall procedure to bind the PCR product to streptavidin beads at this time, which binding requires high salt, such as 0.25 M NaCl. Whether or not streptavidin beads are used, high salt such as 0.25 M NaCl is preferable at this time in order to control and achieve the melting of the primer portion of the molecule without melting the entire molecules.
  • the temperature that results in melting off the riboprimers needs to be selected so that it does not have any negative effects on target DNA molecules, such as, e-g., denaturation. For instance, heating the solution to 750 to 85° C.
  • target DNA will contain 3′-overhangs, thereby creating a target DNA molecule with “sticky ends”.
  • a generation of a target DNA molecule containing 3′-overhangs is depicted in FIG. 2 .
  • RNAse may be degraded by adding a proteinase to a solution comprising the target DNA and RNAse.
  • the RNAse is removed by the proteinase K. While removal of RNAse is not essential for the linking of nucleic acids as described herein, introduction of linked nucleic acids that also contain RNAse into cells chosen for transformation may be lethal to the cells under many circumstances. Therefore, it is preferable for transformation of cells with at least two DNA molecules that were annealed as described herein to remove or inactivate RNAse.
  • Additional methods of cleaving DNA/RNA bonds such as exposure to elevated pH (e.g. treatment with a base such as sodium hydroxide) could also be employed to create target DNA sequences with 3′-overhangs.
  • elevated pH e.g. treatment with a base such as sodium hydroxide
  • this base treatment will completely denature the vector and target DNAs. It is possible to reanneal to recover double-stranded target and vector DNA in this situation, and we have successfully created desired recombinant molecules this way. We find it much less efficient and productive, however.
  • the length of a 3′-overhang corresponds with the length of the riboprimer if a single ribonucleotide at the 3′ end of the primer is used, or with the position of the most 3′-ribobase, if more than one ribobase is used.
  • a preferred length of resulting sticky end is about 25 nucleotides; however other lengths can also be used.
  • the 3′-overhangs at the two ends of the target DNA need not have the exact complete same sequence or length. It is often desirable to generate a target DNA that can be annealed to a second DNA molecule in only one orientation or that can be annealed to two different DNA molecules in a particular arrangement.
  • any two DNA molecules that are to be joined possess 3′-overhangs that are at least complementary in part.
  • one or more gaps or non-homologous overlaps may be present in the joint sequence.
  • the presence of one or more gaps did not negatively affect the efficiency of cell transfection with such annealed sequences (data not shown). While not being bound to a particular theory, it is believed that annealed sequences containing gap(s) are corrected after being introduced into the cells through actions of cellular enzymes involved in correcting DNA damage.
  • vectors may be selected from the group consisting of bacterial, yeast, viral, plant, and mammalian vectors. Both cloning and expression vectors may be used due to the fact that they contain nucleotide sequences that allow the vectors to replicate in one or more suitable host cells. In cloning vectors, this sequence is generally one that enables the vector to replicate independently of the host cell chromosomes, and also includes either origins of replication or autonomously replicating sequences.
  • bacterial and viral origins of replication are well known to those skilled in the art and include, but are not limited to, the colE1 plasmid origin, the 2 ⁇ plasmid origin, and the SV40, polyoma, adenovirus, VSV and BPV viral origins.
  • Common promoters used in expression vectors include, but are not limited to, CMV promoter, LTR or SV40 promoter, the E. coli lac or trp promoters, and the phage lambda PL promoter.
  • Other promoters known to control the expression of genes in prokaryotic or eukaryotic cells can be used and are known to those skilled in the art.
  • Expression vectors may also contain a ribosome binding site for translation initiation and a transcription terminator. The vector may also contain sequences useful for the amplification of gene expression.
  • Expression and cloning vectors can and usually do contain a selection gene or selection marker. Typically, this gene encodes a protein necessary for the survival or growth of the host cell transformed with the vector. Examples of suitable markers include neomycin or hygromycin B resistance for eukaryotic cells and tetracycline, ampicillin, or kanarnycin resistance for E. coli.
  • the target DNA and vector DNA with single-stranded complementary 3′ overhangs are then incubated together under conditions that result in annealing of their complementary overhangs.
  • Exemplary conditions include incubation of the target and vector at 78° C. for 2 minutes, followed by an incubation at 52° C. for 30 minutes.
  • the incubations can be the following: incubation for 2 minutes at 78° C. followed by 10 minutes at 65° C., followed by slow cooling e.g., over a period of 30 minutes to 52° C. and then chilling.
  • One of ordinary skill in the art can determine other incubation conditions without undue experimentation. In fact, mere incubation at room temperature works pretty well.
  • annealing is performed at equi-molar concentrations of the DNAs to be recombined, such as the target and vector DNAs.
  • two or more double-stranded molecules may be linked, thereby generating a hybrid DNA molecule, when neither molecule is a vector per se.
  • different 3′-overhangs are generated when linking more than two DNA sequences. This allows for joining of DNA molecules in only one orientation, minimizing the screening process for a properly linked hybrid DNA, unless a random mixture of orientations and/or map arrangements is one of the desired outcomes. Furthermore, in such complex linking reactions, different 3′-overhangs help to minimize the possibility of self-annealing by individual sequences.
  • the linking reaction can include the use of biotin and streptavidin. Both the linking of a vector and a target DNA or linking of more than two DNA sequences may be performed using this method. Briefly, the generation of desired DNA molecules with complementary 3′-overhangs is performed as described herein by exposing said DNAs to conditions that result in cleavage of primers from the DNA molecules.
  • the primers in addition to containing at least one ribonucleotide at or near the 3′ end also contain a biotin moiety at the 5′ end. Primers modified in such manner may be obtained commercially (e.g. IDT) or riboprimers may be coupled to biotin.
  • hapten binding ligand such as biotin
  • the support such as streptavidin beads
  • biotin hapten binding ligand
  • a paramagnetic streptavidin conjugated bead obtained from Genovision, Inc. (West Chester, Pa.) or Life Technologies, Inc. (Gaithersburg, Md.) or the Dynabead Streptavidin M-280 bead obtained from Dynal (Great Neck, N.Y.) can be used as the support.
  • Other hapten-support systems may also be used.
  • the cleavage of the primers from the desired DNA molecules may not be 100% efficient. Accordingly, there likely will be DNA molecules that have not been cleaved and do not possess 3′-overhangs in the solution comprising target DNAs and primers. Such molecules cannot be linked by annealing to desired cleaved DNAs. In addition, cleaved primers and possibly primers left over from the PCR will also be present in the solution to compete for the desired annealing at the 3′-sticky ends. Despite best efforts to use a pure RNAse, in the absence of free magnesium, some of the 3′-sticky ends may be subject to damage or removal by unwanted nuclease activities, leading to another source of unsuitable ends. To increase the efficiency of linking two or more DNA sequences, it is generally desirable that only the sticky-ended vector and target(s) sequences be present in the annealing reaction.
  • the cleaved target DNA with biotin primers still on it, possible uncleaved target DNA, the possible loose primers, and proteinase K used to inactivate the RNAse may be incubated in the high-salt annealing buffer with magnetic streptavidin beads. Proteinase K does not seem to hurt the beads, since streptavidin is resistant to protease, particularly in the high-salt buffer necessary to get the beads to bind the biotin-PCR product. This incubation at i.e.
  • the beads are heated to around 75-85° C. to melt off desired DNA away from the primers and uncleaved DNA which remain stuck to the beads at their biotin moeities, and a after a few minutes a magnet is applied near to the solution containing the cleaved DNA, biotin-labeled DNAs, and streptavidin beads, thereby separating the cleaved target DNA molecules from the uncleaved, biotin-labeled ones and from unwanted contaminating primer.
  • each DNA target or vector is separately treated with streptavidin beads.
  • the target and vector DNA sequences are then storable in the freezer, and may be, when desired, mixed together at preferably equimolar amounts and incubated under conditions that result in annealing of the complementary ends thereof.
  • the DNAs are allowed to affix to the streptavidin beads before the scission at the ribonucleotides and the proteinase K treatment. Proteinase K does not seem to hurt the beads, since streptavidin is resistant to protease.
  • the DNAs and the primers can be incubated with streptavidin beads.
  • the solution comprising said beads, DNAs and the primers is exposed to conditions that result in the cleavage of said primers from the DNAs, leading to the generation of cleaved DNAs that are free in solution, while uncleaved DNA molecules and the primers stay attached to the beads.
  • the magnet is then applied to the solution in order to separate the beads with attached biotin-containing molecules from the solution.
  • the desired DNA molecules are combined at preferably equimolar ratios and incubated under conditions that result in annealing of their complementary ends.
  • Any two or more linked DNA sequences can then be propagated in cells, subject to the normal requirements of replication (including recombinational insertion into a genome) and marker selection.
  • Introduction of such sequences, i.e. transformation into cells can be achieved by any of the methods available in the art. Such methods include, but are not limited to, calcium phosphate transfection, DEAE-dextran mediated transfection, Polybrene mediated transfection, protoplast fusion, liposome mediated transfection, direct microinjection into the nuclei, biolistic (gene gun) devices, scrape loading, electroporation, and calcium and lithium treated bacterial cells.
  • E. coli X7029 is F- and wild-type except for a lac-pro deletion.
  • E. coli WB451 (IDE3) is a deletion of lacZ codons, constructed by the method of Datsenko and Wanner. (Datsenko, K. A., and Wanner, B. L. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. USA 97:6640-6645, 2000.) and it is lysogenic for lambda DE3 transducing phage. There is nothing about the E. coli cells used here that is particular or necessary to the method, as far as is known or expected.
  • Bacteria are made electrocompetent and transformed by electroporation as described by Dower, W. J., Miller, J F. and Ragsdale, C. W. (1988) High efficiency transformation of E. coli by high—voltage electroporation, Nucleic Acids Research 16:6127-6145 and Mattanovich, D., et al, (1989) Efficient transformation of Agrobacterium spp. by electroporation, Nucleic Acids Research 17:6747. When DpnI treatment was employed, background transformation with vector alone or target alone was always less than 1%, usually less than 0.1%, of the recombinant clones. 10 ⁇ ATEN buffer is (0.5 M Tris pH 7.9, 2.5 M NaCl, 0.25 M Na 4 EDTA pH 7.9). Add 1/9 volume to make 1 ⁇ .
  • T005,E005 is 5 mM Tris pH 7.9, 5 mM Na4EDTA pH 7.9.
  • TEN is 10 mM Tris pH 7.9, D.1 mM EDTA, 10 mM NaCl.
  • 10 ⁇ KLA pH9.2 is 500 mM Tris base, 160 mM ammonium sulfate, 25 mM MgCl2, 1% Tween 20.
  • 10 ⁇ KLA pH7.9 is the same as 10 ⁇ KLA pH9.2 except that HCl has been added to lower the pH.
  • Dpn I selection If the template for the vector or the target came from dam+ E. coli , and could contribute to an unwanted background later at the cloning step, degrade the background template at methylated GATC sites: To each 100 ⁇ l of PCR reaction, add 1 ⁇ l (10 units) of Dpd, and incubate 37 degrees for 1-2 hours. 2. PEG-precipitate the DNA. This is to lose the primers and the salt. The desired DNA will be in the pellet. Transfer to thick-walled (regular-walled) tubes, either 0.5 ml or 1.7 ml, for this. Thin-walled PCR tubes cannot reliably withstand the centrifuge step.
  • RNAse K Stock be stored at ⁇ 20 degrees in 100 mM beta-mercaptoethanol, 20 mM Tris pH 7.9, 1 mM CaCl2, 50% (v/v) glycerol. Add 5 ⁇ g proteinase K or about equal the weight of RNAse used above. Mix thoroughly and spin briefly. Incubate 30 min. 65 degrees, chill. [If using biotin primers, go now to bead purification steps in EXAMPLE 2 below, then come back here.]
  • Double-check target and vector DNA concentrations by loading 2 and 8 ⁇ l samples of each vector or target onto agarose gel alongside a concentration standard. The exact concentration is not as important as getting the ratios to be equimolar for the cloning.
  • Another good control is to include only one poison primer—this control will show you what lousy annealing looks like, although sometimes when it looks like this there are still hundreds of good clones that arise from an invisible circular product band. 7. Annealing may not be necessary for bead-purified DNA, but for non-biotin primers, this heat step helps a lot. Incubate 2 min 78°; C., 30 min. 52°; C. Alternatively, 2 min. 78°; C, 10 min 650; C, then cool slowly over 30 minutes to 520; C. or lower. Chill. Pull aliquot (20 ⁇ l) for after-annealling gel sample. These gel samples are for monitoring and improving the recombination.
  • the proteinase K if left over, does not hurt the streptavidin beads. 2a.
  • To each amount of DNA that originates from 130 ⁇ l of PEG-precipitated PCR reaction add 60 ⁇ l of Genovision beads previously pretreated and resuspended in 1 ⁇ ATEN buffer as above. Incubate 30 min. 25 deg. with occasional shaking. Magnetize, and save the bead supernatant “B.S.” 2b. If significant amounts of DNA do not stick to beads in 1 ⁇ ATEN (i.e. are in the B.S.), try adding 1 pmole of one biotin primer to the (bead-free) DNA, and anneal at 52 degrees for 30 min Then add more beads as for 2a. 3.
  • Ribprimers used in the examples are listed here, in standard 5′-3′ sequence. The last and lower case letter represents the 3′-ribo base. These primers names are used in the Sequence Listing, also.
  • T7gen10rC GTTTAACTTT AAGAAGGAGA TATAc
  • T7gen10atrC GTTTAACTTT AAGAAGGAGA TATATc
  • T41 GTG GCG AGA AAG GAA GGG AAG AAA
  • Gc VO1neg7T GTATATCTCCTTCTTAAAGTTAAAc
  • V41 GCTTTCTTCCCTTCCTTTCTCGCCAc
  • T7gen10rU GTTTAACTTTAAGAAGGAGATATAU
  • 5′-biotin modification was sometimes specified at the 5′-end when ordering from IDT (Integrated DNA Technologies, Coralville, Iowa), with or without TEG linker.
  • Primerfinder http://eatworms.swmed.edu/ ⁇ tim/prim&der was used to design primers T4 1 and V41, which are in the phage fl DNA portion of the plasmid vector.
  • Ribovector 250 4.8 kb: Template for PCR was pWJB250 digested with HindIII and NcoI. The same ribovector 250 DNA would have arisen if the template were pWB254b (ATCC #69244) linearized by digestion with NcoI. When amplified using PCR tiboprimers VO lneg7TrC and V41, the product is equivalent to the backbone of pWB254 described in U.S. Pat. No.
  • Ribovector ASK75 PCR, 2.9 kb Template was pASK75 [Skerra, A. Use of the tetracycline promoter for the tightly regulated production of a murine antibody fiagment in Escherichia coli. Gene 151 (1994) 13 1-135.] digested with EcoRI and HindIII.
  • Target PCR Two targets are shown being cloned in FIG. 2 .
  • Ribotarget maize Ds-Red PCR, 1 kb Template was pWS397, which is a clone of an artificial gene assembled from 40-mers by the method described in this patent. It was cloned into the ribovector form of pWJB250 using a riboprimer somewhat differently located than T41.
  • the riboprimers T7gen10rC (2194-221 8 of pWB397) and T41 (3174-3149 of pWB397) give rise to a 1 kb product (981 bp) which comprises a 678 bp ORF of a artificial codons which code for Ds-Red.
  • the product comprises a riboC at a position 26 bases from each 5′-end.
  • Ribotarget Taq DNA Polymerase gene 2.5 kb.
  • Template was genomic DNA from Thermus aquaticus i.e. ATCC # 25105.
  • Primers were T7gen10atrC, and T41. Included in the PCR at 10 nM were 2 band-aid oligomers to adapt the PCR primers to prime the target. These band-aids were
  • T7SD-Q5 band-aid GTTTAACTTT AAGAAGGAGA TATATCCATG AGaGGGATGC TGCCCCTCTT TGA (contains a change to 2d codon (for ARG) to break up a run of G5) and “T4 1-Q3 bandaid” GTG GCG AGA AAG GAA GGG AAG AAA GCT CAC TCC TTG GCG GAG AGC CAG TCC T PCR conditions were as described in Example 1 and 2, with the following details. Reaction volume was 150 ⁇ l. Melt time per cycle was 70 seconds at 93 degrees C. One other temperature was used per cycle: 62 degrees to anneal/extend.
  • the time of extension was 20 minutes if one or more band-aids were included; otherwise the 62-degree time was 10 minutes.
  • the vector and target products were amplified, worked up to the 3′-sticky-ended forms, mixed and annealed by the methods of Example 1 and 2.
  • This example demonstrates ribocloning the Taq gene without or with bead purification, and using beads but comparing with or without proteinase K treatment, using a ribovector with an assembled portion.
  • the vector was ribovector 419.
  • a cluster of four 42-mers was included in the PCR reaction at 10 nanomolar to assemble a 80 bp span of DNA, containing a T7 promoter and ribosome binding site region, onto the plasmid where it did not exist before.
  • Our normal vector ribprimer V0lneg7TrC could then, present at the normal level for PCR (200 nM) prime onto the end of this assembled region.
  • our vector riboprimer V41 required the presence of a 50-mer bandaid to adapt priming. Despite this seeming complexity, this is a very reliable PCR amplification that we have carried out several times, including with templates pKD46 and pKD911.
  • the four 42-mers that assembled 104 bp for the new phage T7 control region are listed below.
  • the first 25 bp of the resulting assembly are homologous to bp 1210-1234 of pKD46 (Datsenko & Wanner, 2000) in order to overlap for the PCR amplification; thereafter the sequences is from phage T7 right before gene 10.
  • exoCt′-T41 GGA TGC GTC ATC GCC ATT GCT CCC CGT GGC GAG PLAA GGA AGG GAA G M AGC Adjacent to complementarity for V41/T41, this band-aid incorporates complementarity to 3111-3135 of pKD46 and pKD119.
  • the vector PCR reaction included, per 100 ⁇ l, 1 pmole of the above 5 oligomers, 20 pmoles of 5′-biotin V41, and 20 pmoles of 5′-biotin V0lneg7T.
  • the template was 10 ng of pKD119 pre-digested with Pst I.
  • the target DNA was ribotarget Taq gene (2.5 kb) prepared as described in Example 3.
  • FIG. 5 shows the results when target and vector were prepared and mixed together for cloning according to Example 1, with no bead purification having been used. It can be seen that heating is required to obtain fused target and vector since without it (lane 1) target and vector migrate separately. After heating and annealing, a new upper band appears. This is not actually the desired circular fusion of target and vector. The yield of said desired product, the circular fusion, is so poor that it does not appear visible on this gel (it would migrate between bands 1 and 2 of the standard lane, as can be seen from the more successful experiment shown in FIG. 4 ). Another suboptimal feature of this ribocloning, i.e.
  • FIG. 4 shows a more advanced and successful cloning.
  • the same target (Taq gene) and vector (V4 1 9, a.k.a. pWB4 1 9, amplified from pKD 119 template) preparations were used, but subjected, before cloning, to the streptavidin bead purification described in Example 2.
  • the necessity of the proteinase K step was tested by leaving it out of the target and vector DNA preparations loaded onto the right half of FIG. 4 .
  • lane 3 combined target and vector were allowed to sit at room temperature for one hour, without a heating and annealing treatment.
  • Lanes 4, 5, and 6 (labeled PI, p2 and CL) were subjected to the heating and annealing treatment.
  • one poison primer was included in the annealing loaded in lane 4 (PI).
  • two poison primers were included in the annealing loaded in lane 5 (P2), as recommended in Example 1. and as indicated on the FIG. 4 .
  • the material analyzed in the lanes marked CL was transformed into E. coli , and the quality of the clones was confirmed in the assay shown in FIG. 6 .

Abstract

The present invention provides methods of linking nucleic acids without the use of restriction enzymes or any joining enzyme such as ligase. More specifically, the present invention provides methods for cloning or rearranging a double-stranded target DNA which is a PCR product into a double-stranded vector DNA which is a PCR product, said DNAs being amplified using primers that contain at least one ribonucleotide, preferably at or near the respective 3′ ends of the primers, such that RNA-specific cleavage, preferably by RNAse A, will allow release of the primers to create long matching 3′-sticky ends.

Description

    CROSS-REFERENCE TO RELATED APPLICATIONS
  • The present application is a Divisional application of U.S. application Ser. No. 10/147,430, filed on May 16, 2002, which is incorporated herein by reference in its entirety to the extent permitted by law.
    • INCORPORATION-BY-REFERENCE OF SEQUENCE LISTING
  • The Sequence Listing, which is a part of the present disclosure, includes a computer readable form and a written sequence listing comprising nucleotide and/or amino acid sequences of the present invention. The sequence listing information recorded in computer readable form is identical to the written sequence listing. The subject matter of the Sequence Listing is incorporated herein by reference in its entirety.
    • FIELD OF THE INVENTION
  • The present invention provides methods of linking nucleic acids without the use of restriction enzymes or any joining enzyme such as ligase. More specifically, the present invention provides methods for cloning or rearranging a double-stranded target DNA which is preferably a PCR product into a double-stranded vector DNA which is preferably a PCR product and methods for generating a hybrid double-stranded DNA comprising at least two target DNA sequences, all such DNA being amplified using primers that contain at least one ribonucleotide, preferably at or near the respective 3′ ends of the primers, such that RNA-specific cleavage, preferably by RNAse A, will allow release of the primers to create long matching 3′-sticky ends.
    • BACKGROUND OF THE INVENTION
  • Recombinant DNA stems from the discovery of enzymes called restriction endonucleases or “restriction enzymes,” that are capable of cleaving double stranded DNA at specific recognition sites, thereby producing DNA fragments that can be ligated to one another by ligase enzyme to generate “recombinant” molecules (see, for example, Cohen et al, Proc. Natl. Acad. Sci. USA 70:1293, 1973; Cohen et al., Proc. Natl. Acad. Sci. USA 70:3274, 1972; see also U.S. Pat. Nos. 4,740,470; 4,468,464; 4,237,224). The study of molecular biology has benefited greatly from the ability of scientists to join DNA fragments together in manmade arrangements for the purpose of experimentation or industrial production.
  • Molecular biology was further facilitated by the invention of the polymerase chain reaction (PCR), which allowed rapid in vitro amplification of selected DNA segments. This allowed for production of large amounts of replicated material that could subsequently be cleaved by restriction enzymes and ligated to other DNA molecules (see, for example, U.S. Pat. Nos. 4,638,195; 4,683,202; 5,333,675). Further advances of the PCR technique included the creation of a DNA polymerase having enhanced thermostability and polymerase mixtures having enhanced fidelity and length of product (U.S. Pat. No. 5,436,149). PCR products can be cloned using restriction enzymes, if the primers are made longer to incorporate the desired restriction site, if said site is not present in the PCR product or cutting at it can be suppressed, and if the vector has a similar matching restriction site. It is important to carry out a purification of the PCR product to at least remove mTPs and/or polymerase before digestion by restriction enzymes, especially for 5′-sticky ends, since they can be filled in by said left-over DNA polymerase.
  • A way to clone PCR products without restriction enzymes, and also using RNA/DNA primers, has been recently described [Chert G J., Qiu N. & Page MGP (2002) Universal restriction site-free cloning method using chimeric primers, Biotechniques 325 1 8-5241. This method still uses ligase, and the r i b base cleavage is not enzymatic, but rather by the use of rare-earth metal ions, which are not as efficient, convenient, or specific as RNAse enzyme.
  • Ways to clone the PCR products without the use of ligase have been developed. Forinstance, TOP0 (TM Invitrogen)-cloning utilizes special vectors with adjacent sites for Vaccinia virus topoisomerase, and said vector is pre-activated with topoisomerase. If the PCR product has terminal extra As, and no 5′-phosphates, it can be cloned into this vector conveniently, at a site between the two topoisomerase recognition sequences. The present invention has no requirement 20 for any specific vector or even the site of cloning within any vector, except that the vector must preferably be amplifiable by PCR using primers at the cloning site. Another example of a nonligase cloning method utilizes terminal homology similar to the present invention, although usually twice as long. Special E. coli strains which highly express the recET system, or any yeast strain (if the vector is a yeast vector) can then be used to recombine target and vector. This system is not very efficient, and is prone to recombination and rearrangements at other homologous or repeated sites on the vector and/or target molecules, rather than just at the desired and small terminal homologies.
  • Thus despite these advances, there is substantial room for improvement. The use of restriction enzymes requires that the segment of DNA being digested have the particular restriction site only at desired locations—that is to say, a particular DNA base sequence (restriction site) is necessary to enable the restriction enzyme to digest the particular piece of DNA, yet the restriction sites must be rare or preferably non-existent within the vector or target, lest they be cut up too much to put together in the desired arrangement. Often, 2 vector or 2 target molecules will join, often in the wrong orientation, whereas the desired product is usually one vector and one target with one desired orientation.
  • Therefore, molecular biology could benefit from the development of improved systems of cloning and joining of DNA molecules. Of particular interest would be a system that would allow DNA joining without the use of, or indeed any regard for, restriction enzymes or restriction sites, provide for efficient joining, provide an increase in yield and specificity of the desired product, decrease the cost of molecular biological experiments, and be generally useful for the joining of DNA sequences having a wide variety of sequences. Optimal systems would even provide for directional joining (i.e., joining in which the DNA molecules to be linked together will only link to one another in a single orientation).
    • SUMMARY OF THE INVENTION
  • Among the objects of the present invention are methods for linking nucleic acids together. In particular, the present invention provides methods for producing DNA target molecules that may be easily and directly inserted into vector molecules or attached to other DNA target molecules, all without the use of restriction enzymes, ligase, or topoisomerase, nor with any regard for restriction site sequences.
  • The inventive system provides techniques and reagents for generating target molecules with 3′-single-strand overhangs, and further provides the tools and methods for preparing vector or other target DNA molecules with matching complementary 3′-single-strand overhangs, allowing the efficient and specific linking of DNAs such as target(s) and vector to each other in desired orientation and location. The length and sequence of the overhangs can be varied according to the desires of the practitioner, and do not need to be My complementary. Therefore, one aspect of the invention provides a method of cloning a double-stranded target DNA into a double stranded vector DNA, said method comprising:
  • a) generating by PCR a double-stranded target DNA molecule using hybrid “riboprimers” as the two PCR primers, which riboprimers are not all DNA, but rather include at least one ribonucleotide, most conveniently at their respective 3′ ends, and preferably rC or rU, and which PCR primers comprise sequences complementary to the ends of vector DNA sequences, which is to say at the desired site of recombination. The resulting PCR product will have incorporated near each 5′-end a single (or more) ribonucleotide at a position preferably some 25 bases in from each 5′ end;
  • b) if the target does not already have homology to the PCR riboprimers, i.e. complementarity to the vector cloning site, then the PCR amplification reaction can be carried out in the presence of one or two bracketing “band-aid” oligomers (for example, 50 mers) which comprise one strand of the desired end-point recombined structure consisting of adjacent sequences complementary to the ends of said target (for example, 25 bases) and vector DNA (for example, 25 bases). The band-aid primers are used at such low concentration that it is often helpful to employ unusually long PCR extension times, at annealing temperatures, in order to allow for slow kinetics of band-aid annealing. Alternatively, but less conveniently, successive PCR amplifications may be performed, in which the band-aid primers are oriented so that they can function at the first PCR amplification and are preferably at least 95% removed or diluted before the second PCR amplification which uses the riboprimers. If the template for the target already contains the sequences to match the riboprimers, the band-aid primers are of course unnecessary;
  • c) exposing the target DNA to RNA-cleaving conditions that do not cleave DNA, preferably by the use of bovine pancreatic RNAse A enzyme, that result in the single-strand cleavage of said riboprimers at the point of the single (or more) ribonucleotide rC or rU, followed by heating at a temperature that melts the PCR primers from said target DNA, preferably followed by removal of the PCR primers and any uncleaved DNA, thereby generating target DNA with 3′-overhangs;
  • d) similarly providing a vector DNA with circa 25-base 3′-overhangs, including amplification specified by PCR riboprimers that are completely or mostly complementary to the PCR riboprimers used for the target, and, if the riboprimers do not already match the template, including the similar use of band-aid primers; and
  • e) incubating said target DNA and said vector DNA under conditions that result in annealing of the complementary ends thereof. The joined ends are so stable that they are ready for transformation into the host cells without further enzymatic processing in vitro.
  • Furthermore, the amplification by PCR can be catalyzed by any one of a number of DNA polymerases and mixtures of DNA polymerases, including, but not limited to, Vent, peep Vent, Pfu, Pwo, Klentaq1, KlentaqLA, TaqLA, Taq, KOD, and further mixtures thereof. Archeal DNA polymerases (such as Vent, Deep Vent, Pfu or Pwo) which cannot cross a ribonucleotide on the template must include a small admixture of a polymerase which can cross the ribonucleotide (such as Klentaq1 or Taq). Additionally, the vector DNA can be from any form of replication, including but not limited to, bacterial, viral, yeast, plant, or animal cell vectors.
  • The annealed molecules have discontinuities such as a nick, a nick with a slight overlap, or a gap on each strand, about 25 bases apart. These discontinuities are automatically and preferably repaired in vivo (intracellularly) after transformation, without special arrangement by the technician, and without the choice of any particular host cell recombination capacity or noncapacity, since the repair does not require recombination. Nevertheless it is possible to repair the discontinuities in vitro using methods well known in the art, such as nick-translation catalyzed by E. coli DNA polymerase I, followed by, or combined with, ligase treatment. The structure of the recombined product is ideally suited for nick translation; the long 3′-sticky ends result in a structure that is made even more stable by the process of nick translation, which would move the nicks farther and farther apart on the DNA and leave them ever more suitable as substrates for any DNA ligase.
  • It is another object of the present invention to provide methods of cloning a doublestranded target DNA into a double stranded vector DNA and methods of generating hybrid DNA molecules using the methods described herein, wherein the ribprimers additionally comprise biotin molecules at their respective 5′ ends. In one embodiment, following the step of cleavage at the one or more ribo base comprised by the riboprimers, the cleaved target or vector DNA, incompletely cleaved or uncleaved target or vector DNA, and the primers are incubated with paramagnetic streptavidin beads, following which the completely cleaved target or vector DNA is separated from biotin-containing primers and biotin-containing uncleaved target or vector DNA which remain attached to the streptavidin beads. Alternatively, the incubation with streptavidin beads may be performed prior to the cleavage step, thus allowing for the cleavage to occur on the beads, but this is not recommended due to poorer performance.
  • In the methods described herein the one or more ribonucleotide within or preferably at the 3′ end of the primers can be selected from the group consisting of: riboC, riboU, riboT, riboA, riboG or ribol. The RNA-cleavage conditions that result in the cleavage of riboprimers from desired DNA molecules can be performed using alkali, but this causes denaturation of the subject DNA, which must therefore be neutralized and reannealed to reconvert the DNA to the doublestranded form.
  • It is preferable to use an RNAse capable of cleaving a bond between a particular 3′-end ribonucleotide comprised near the 5′-end of the PCR product and the adjacent deoxynucleotide. In one embodiment, the RNAse comprises RNAse A, which can cleave at single bases of riboU and riboC within double-stranded PCR products, and the use of low salt is key. It is a surprising aspect of the invention that RNAse A can do this, since RNAse A is well known as a single-strand specific RNAse. It is important for the efficiency of the method that the RNAse not be contaminated with any other nucleases, such as DNAse II.
  • RNAse T1, would be appropriate for riboG.
  • After the RNAse cleavage, mild heating releases said primers from the DNA molecules without denaturing the double-stranded PCR products. Furthermore, the vector, or portion of a vector, can be any commercially available vector, or desired suitable portion of a vector, that can be amplified by PCR.
  • Band-aid primers may be on either strand. If on one strand (3′-ends pointing toward the target DNA, same as the PCR riboprimers) they will also serve to prime extension on the intended template, albeit, if included at the recommended very low (2-10 nanomolar) concentration, less efficiently than the PCR riboprimers. When band-aid primers are on this strand, the final PCR product will be contain them in some small proportion, and this proportion will not contain the ribonucleotide(s) supplied by the riboprimers. If the band-aid primers are on the other strand (3′-ends pointing away from the target DNA), they will at first and at early cycles of the PCR only serve as a short template, and the only template, for the PCR primers, which will be extended over the band-aid primers. Then the extended PCR primers will be able to initiate extension on the actual desired target at the second and later cycles of the PCR. Because all of the PCR product is expected to contain the ribonucleotide(s) from the riboprimers, this method (band-aid primers pointing away from the target) is preferred. It is of little consequence, and the method still works, if the band-aid primers are a mixture of the two types, i.e. mutually on the very same strand. Band-aid primers may be of any length, and may be double-stranded, but preferably they have at least 20 bases of sequence overlap (preferably 24-26 bases) with the PCR product to be amplified at one of their ends, and a similar amount of sequence homology to the PCR riboprimers somewhere within them, distal to the amplified PCR span, such as at their other end.
  • Furthermore, the use of band-aid primers at low (ca. 3-10 nanomolar) concentration may be extended by including during the PCR reaction several overlapping primers (such as 40-60 mers) at similarly low concentration, to build up significant lengths of novel sequence onto the vector or target. This principal of low concentration (about 20 times lower than Stemmer et al.) and long annealing/extension time, preferably about 20 minutes (which is 20-40 times longer than Stemmer et al.), may be extended, by the use of dozens of overlapping primers, to constitute an improvement to the method of synthesis and assembly of entire genes. [Stemmer, W. P. C., Crameri, A., Ha, K. D., Brennan, T. M., & Heyneker, H. L. (1995) Single-step assembly of a gene and entire plasmid from large numbers of oligodeoxyribonucleotides. Gene 164:49-53. See also Chen, G.-Q., Choi, I., Rarnachandran, B. & Gouaux, J. E. (1994) Total gene synthesis: Novel single-step and convergent strategies applied to the construction of a 779 base pair bacteriorhodopsin gene. JACS 116:8799-8800. See also Dillon, P. J., & Rosen, C. A. (1990). A rapid method for the construction of synthetic genes using polymerase chain reaction. Biotechniques 9:298-299.]
  • The present method is used for one or more ribo bases throughout the primer. An advantage to internal rib bases is that, upon cleavage at 2 locations, the fragments of primer remaining will not tend to compete with productive recombinant annealing. Primer left over from the PCR will be similarly degraded. Only one rib base per PCR primer is the most challenging special case of the method, yet it is the case demonstrated in the examples, for the possibly temporary reason of cost of manufacture of oligos with internal ribo bases. Taking for example a case of 2 ribonucleotides, with one at the 3′-end, and another in abut the middle of a primer, the cost is currently six times higher than with a single 3′-riboC, due in part to the need to use RNAse-free conditions during manufacture. Addition of a 5′-bio tin is currently expensive also, but it merely triples the cost (3.3×). Besides being less expensive, the use of 5′-biotin ends has the advantage of positive purification of sticky-ended products, as described here with the use of streptavidin beads. If expense is not a consideration, one could combine these approaches. Two ribobases per primer, without 5′-biotin, could be used for the PCR and then the primers cleaved to 12-13 bases with RNAse A. Separately, 5′-biotin, all-DNA primers could be synthesized and added, and annealed, for the purpose of streptavidin bead purification of sticky-ended targets or vectors. If this is done in series with each end at a time, each sticky end could be positively selected.
  • Other objects and features will be in part apparent and in part pointed out hereinafter.
    • BRIEF DESCRIPTION OF THE DRAWINGS
  • Those of skill in the art will understand that the drawings, described below, are for illustrative purposes only. The drawings are not intended to limit the scope of the present teachings in any way.
  • FIG. 1. Schematic of the ribocloning method. Schematic of the ribcloning method. Riboprimers are PCR primers with a 3′-riboC. DNA depictions, primers and resulting sticky ends are not to scale.
  • FIG. 2. Three example riboclonings analyzed by agarose gel. Three cloning experiments are shown. Experiment 1, 2, and 3 annealed DNAs are shown in lanes 1, 2, and 3. Lanes 1C, 2C and 3C, respectively, show the input DNAs migrating separately. To get this effect, vector primers V0lneg7T and V41 were included to poison (prevent by competition) the annealings. Experiment 1 vector was Ribovector 250, labeled “V250”. Experiment 1 and 2 target was ribotarget maize Ds-Red. Experiment 2 and 3 vector was Ribovector ASK75, labeled “V75”. Experiment 3 target was the Taq DNA polymerase gene, which was inadvertently included at lower than recommended equimolar, at such a low level that it is not visible on this fuzzy gel. The experiments in lanes 1 and 2 utilized a vector:target input ratio which was much closer to the ideal of equimolar. All agarose gels (FIGS. 2, 4 and 5) contain a standard lane in which was loaded phage lambda DNA digested with restriction enzyme HindIII. The band sizes, in order from the top, are, if they are visible, are shown in Table 1.
  • FIG. 3. Transformant E. coli colonies arising from ribocloning a gene encoding Ds-Red protein. Clones arising from ribocloning the Ds-Red gene, from the cloning/annealing depicted in lane 1 of FIG. 2. Bright red colonies are the desired clones, expressing Ds-Red as a pigment in this E. coli bacterial background after one week on the plate. Colorless colonies are the 10% typical misclones with this method. The cause and nature of the misclones is unknown at this time, but their number is too high to be PCR-induced mutations under the high-fidelity PCR conditions employed. Off-color clones (pink or orange) are presumably PCR-induced mutations. Some colonies have been smeared with a toothpick when picked for further analysis.
  • FIG. 4. Variations on ribocloning the Taq Pol I gene for Thermus aquaticus DNA polymerase, using bead-purifed DNA. Use of streptavidin bead-purified vector and target DNA. After the RNAse A treatment with USB RNAse (not of the preferred purity, which is Ambion 2270), proteinase K treatment was included as normal for the samples on the left, but omitted for the right side samples, before high-salt adsorption to and heat-elution from paramagnetic streptavidin beads. “LINE” marks a band which is believed to be a linear combination of one target and one vector molecule. This molecule it not the desired endpoint which is capable of efficient transformation of cells. “CIRCLE” marks the position of a band that is believed to be the desired endpoint of the recombination. The number of transformant colonies from the method is greatest when this band is visible and prominent. All agarose gels (FIGS. 2, 4 and 5) contain a standard lane in which was loaded phage lambda DNA digested with restriction enzyme HindIII. The band sizes, in order from the top, are, if they are visible, are shown in Table 1.
  • FIG. 5. Cloning the Taq Pol I gene without using bead-purified DNA. Ribocloning without the purification on streptavidin beads. This is an example of the many preliminary experiments which were done without streptavidin beads, and which served to establish the salt, incubation, and temperatures which are recommended throughout the Examples. All agarose gels (FIGS. 2, 4 and 5) contain a standard lane in which was loaded phage lambda DNA digested with restriction enzyme HindIII. The band sizes, in order from the top, are, if they are visible, are shown in Table 1.
  • FIG. 6. Assay of clones of Taq Pol I gene to confirm successful cloning of active genes. Confirmation of successful cloning of the Taq Pol I gene depicted in FIGS. 4 and 5. Transformant colonies were grown on nitrocellulose and assayed by the method of Sagner et al, [Sagner G, Ruger R, Kessler C. (1991) Rapid filter assay for the detection of DNA polymerase activity: direct identification of the gene for the DNA polymerase from Thermus aquaticus.Gene 97: 119-123] as modified and described by Barnes and Kermekchiev (U.S. Pat. No. 6,214,557). Each of 96 clones is assayed as a trio of inoculated spots of bacteria. A trio of visible spots indicates TCA-insoluble material incorporated by a positive clone at 65° C. Rows 4 and 8 are each assays of 12 clones that are invisible, because they are negative controls that are not expected to have any Taq DNA. Rows 1 and 5 each assay 12 colonies from the cloning depicted in FIG. 5. Rows 2 and 6 assays 12 colonies from FIG. 4 right, and Rows 3 and 7 each assay 12 colonies from FIG. 4 left. As is typical for the method at this stage of development, some 10% of the Taq clones are in fact negative in this assay, such as the ones in row 1, column 2, and row 2, column 7; the nature of these apparent misclones has not yet been determined.
    •  DETAILED DESCRIPTION OF THE INVENTION
  • The following description is provided to aid those skilled in the art in practicing the present invention. Even so, this detailed description should not be construed to unduly limit the present invention as modifications and variations in the embodiments discussed herein can be made by those of ordinary skill in the art without departing from the spirit or scope of the present inventive discovery.
  • All publications, patents, patent applications and other references cited in this application are herein incorporated by reference in their entirety as if each individual publication, patent, patent application or other reference were specifically and individually indicated to be incorporated by reference.
  • The following definitions and methods are provided to better define the present invention and to guide those of ordinary skill in the art in the practice of the present invention. Unless otherwise noted, terms are to be understood according to conventional usage by those of ordinary skill in the relevant art. The listed abbreviations and terms, as used herein, are as follows:
  • bp is the abbreviation for base pairs.
    kb is the abbreviation for kilobase (1000 base pairs).
    nt is the abbreviation for nucleotides.
  • “overlap” means DNA sequence homology or complementarity, as appropriate.
  • 10 nM means 10 nanomolar
    Taq is the abbreviation for Thermus aquaticus.
    Pfu is the abbreviation for Purococcus furiosus.
    Vent is the abbreviation for Thermococcus litoralis DNA polymerase.
    KOD is the abbreviation for hyperthermophiiic archaeon Pyrococcus Kodakaraensis KOD 1 (Kod DNA Polymerase)
    Deep Vent DNA polymerase is purified from an archael, thermophilic bacterium by New England Biolabs, Inc.
    “Klentaq1” is a trademark for Klentaq-278 which is a DNA polymerase having substantially the same amino acid sequence as Thermus aquaticus DNA polymerase, but excluding the N-terminal 278 amino acids, ±one residue as claimed in U.S. Pat. No. 5,616,494, incorporated herein by reference.
    “LA PCR” is Long and Accurate PCR, which is PCR using an unbalanced mixture of two DNA polymerases, as claimed in U.S. Pat. No. 5,436,149.
    “KlentaqLA” is an unbalanced mixture of two DNA polymerases, wherein the major component is the thermostable DNA polymerase known as Klentaq1 or Klentaq278 and lacking 3′-exonuclease and the minor component is at least one DNA polymerase exhibiting 3′-exonuclease activity, as claimed in U.S. Pat. No. 5,436,149. KlentaqLA is commercially available from Clontech (Cat. No. 8421-1) and from Sigma (Cat. No. D6290). In the examples shown, the minor component is “Deep Vent” DNA polymerase.
    “TaqLA” is an unbalanced mixture of two DNA polymerases, wherein the major component is full-length Taq DNA polymerase as the thermostable DNA polymerase lacking 3′-exonuclease activity and the minor component is at least one DNA polymerase exhibiting 3′-exonuclease activity, as claimed in U.S. Pat. No. 5,436,149, incorporated herein by reference. In the examples shown, the minor component is “Deep Vent” DNA polymerase.
    “Thermostable” is defined herein as having the ability to withstand temperatures up to at least 95° C. for many minutes without becoming irreversibly denatured and the ability to polymerize DNA at optimum temperatures of 55° C. to 75° C.
    PCR primers are usually present at 20 pmoles per 100 μl (0.2 micromolar), and serve to direct in vitro amplification to the DNA sequence specifically between them on a template.
  • “Band-aid” primers usually contain adjacent sequence of circa 25 nt each, from the ends of the target and the vector. They are used to bridge the PCR primers onto the target to be amplified.
  • “PCR” is the polymerase chain reaction which is a process in which replicate copies are made of a target polynucleotide using one or more primers, and a catalyst of polymerization, such as a DNA polymerase, and particularly a thermally stable polymerase. Generally, PCR involves repeatedly performing a “cycle” of two or three temperature steps: “melting”, in which the temperature is adjusted such that the DNA dissociates to single strands, “annealing”, in which the temperature is adjusted such that oligonucleotide primers are permitted to match their complementary base sequence using base pair recognition to form a duplex at one end of the span of polynucleotide to be amplified; and “extension” or “synthesis”, which may occur at the same temperature as annealing, or in which the temperature is adjusted to a slightly higher and more optimum temperature. Oligonucleotides that have formed a duplex (which have primed onto a template strand) are elongated with the provided DNA polymerase. This cycle is then repeated until the desired amount of amplified polynucleotide is obtained. Methods for PCR amplification are taught in U.S. Pat. Nos. 4,683,195 and 4,683,202.
  • In vitro processes of producing replicate copies of the same polynucleotide, such as PCR, are collectively referred to herein as “amplification” or “replication.” For example, single or double stranded DNA may be replicated to form another DNA with the same sequence. RNA may be replicated, for example, by a RNA directed RNA polymerase, or by reverse transcribing the RNA using a reverse transcriptase or a DNA polymerase exhibiting reverse transcriptase activity and then performing a PCR amplification. In the latter case, the amplified copy of the RNA is a DNA (known as “copy DNA:, “complementary DNA”, “cDNA” or RT-PCR product) of the correlating or homologous sequence.
  • “Amplimer” is a term for the span of DNA that is amplified by the PCR process, a.k.a. a “PCR product”.
  • “Riboprimer” is a form of PCR primer that contains at least one ribonucleotide instead of DNA, most conveniently at the very 3′-end.
  • “Ribocloning” refers to the use of riboprimers to specify amplimers which can be recombined by the present method.
  • “Specificity” in PCR amplification refers to the generation of a single, “specific,” PCR product with the size and sequence predicted from the sequences of the primers and the genomic or transcribed region of nucleic acid to which the primers were designed to anneal in a base-complementary manner. “Nonspecific” PCR product has a size or sequence different from such prediction. A “target nucleic acid” is that genomic or transcribed region of nucleic acid sought to be replicated, generally the ends of which are base-complementary (with proper orientation) to primers included in a complete set of PCR reagents. A primer refers to a nucleic acid sequence, which is complementary to a known portion of a target nucleic acid sequence and which is necessary to initiate synthesis by DNA polymerase. A primer, as used herein includes riboprimers unless the context precludes it. “Proper orientation” is a term used to indicate that the two primers anneal to opposite strands of double-stranded target nucleic acid with their 3′ ends pointing toward one another on the sequence. Such primers are said to target the genomic or transcribed sequence to the ends of which they are base-complementary. An “appropriate temperature,” as referred to in the claims in regard to the PCR amplifications, indicates the temperature at which specific annealing between primers and a target nucleic acid sequence occurs.
  • “Thermus aquaticus DNA polymerase” and “Taq DNA polymerase” are used interchangeably to refer to heat stable DNA polymerases from the bacterium Thermus aquaticus and include all Taq mutants, natural and synthesized.
  • The procedures for the use of PCR to replicate nucleic acid sequences disclosed herein are known to those skilled in the art. See generally Fredrick M. Ausubel et al. (1995), “Short Protocols in Molecular Biology,” John Wiley and Sons, and Joseph Sambrook et al. (1989), “Molecular Cloning, A Laboratory Manual,” second ed., Cold Spring Harbor Laboratory Press, which are both incorporated by reference.
  • As used herein, the terms “complementary” or “complementarity” refer to the pairing of bases (purines and pyrimidines) that associate through hydrogen bonding base-pair recognition in double stranded nucleic acid. The following base pairs are complementary: guanine pairs with cytosine; adenine with thymine; and adenine with uracil. As used herein complementarity and complementary include complete and partial complementarity.
  • As used herein, “sequence” means the linear order in which monomers occur in a polymer, for example, the order of amino acids in a polypeptide or the order of nucleotides in a polynucleotide.
  • As used herein, “riboprimer” refers to a primer that comprises at least one ribonucleotide, usually at the 3′ end, but also usefully at one or more positions from 5 to 26, preferably at one or more positions from 13 to 26, with usefulness but steadily decreasing preference with each base faster than 26 from the 5′ end.
  • The terms “recombine”, “anneal”, and “link” are used interchangeably herein to refer to a process of joining two or more nucleic acids at their ends, which are in this invention arranged and adjusted to be complementary (and in this invention unusually long) sticky ends, without the use of accessory enzymes to catalyze the joining. It is understood that transformed cells are able to complete the joining by the use of various DNA repair enzymes intracellularly.
  • The term “target DNA” as used herein, refers to a [double-stranded] DNA sequence that is to be cloned into a [double-stranded] vector (so-called because it comprises a replicon) or that may be joined with additional [double-stranded] DNA sequences. Accordingly, the present invention provides novel methods for joining at least two DNA sequences. Such methods are useful for cloning a target DNA molecule into a vector or for recombining two or more target DNA sequences. In addition, the methods disclosed herein care little about the location of insertion within the vector, and avoid the use of restriction enzymes, ligase or topoisomerase, thereby contributing to the generality, accuracy and efficiency of nucleic acid cloning and rearrangement.
  • The term “vector” refers do a [double-stranded] DNA sequence that carries a replicon and a suitable selective marker that will allow selection of transformants in the form of life that that the replicon and marker are expressed in. More generally, the term “vector” refers to a DNA sequence that will allow the replication or expression of an attached target DNA, whether in vivo or in vitro. As used herein, the term “vector” may only include sequences, such as extensive homology or restriction sites, suitable for a separate step of recombination that would eventually lead to the desired DNA structure.
  • In one embodiment, the present invention provides methods of cloning a double-stranded target DNA into or onto a double-stranded vector, wherein said methods comprise:
  • a) generating a double stranded target DNA molecule by extension of primers, usually a matching pair of primers, from opposite strands, which bracket the target on the DNA sequence, wherein said primers are riboprimers and comprise sequences complementary to said target DNA and are present in the target DNA amplification reaction; and separately and similarly generating a vector DNA molecule using similar primers having sequences which define the ends of and direct the specific formation of the vector DNA, and are present in the vector DNA amplification reaction. To allow for eventual annealing of the ends of the target and vector DNA, one of the target riboprimers and one of the vector riboprimers are completely and exactly complementary to one another, or they share enough complementary homology, generally known to be about 12 bases, to anneal together stably in solution without the need of catalysis by any enzymes. A similar homology is designed to exist for the second target riboprimer and the second vector riboprimer. Riboprimers are PCR primers that contain at least one ribonucleotide, usually at their respective 3′ ends;
    b) exposing the target and/or vector DNA to conditions that specifically cleave RNA and result in the cleavage of said riboprimers at the position of their one or more ribonucleotides even though surrounded by DNA, usually double-stranded DNA, thereby generating cleaved target DNA with a nick about 25 bases (preferred range 12-26 bases) from each 5′ end;
    e) melting off the 12-1 5 base fragments under conditions that do not melt the bulk double stranded PCR product DNA, thus leaving a 12-26 base 3′-single strand at each end;
  • d) combining the target DNA and vector DNA, or two or more target DNAs, at near equimolar amounts; and
  • e) incubating said cleaved target DNA and said vector DNA and/or other target DNAs under conditions that result in annealing of the complementary ends thereof.
  • Complementarity between target and vector is often achieved through the use of bracketing oligonucleotides that contain overlap between the target and the vector. These bracketing oligonucleotides (referred to herein as “bandaid” primers) are generally only employed in initial cycles of PCR to create target DNA sequences with ends complementary to the ends of the vector, and thus are used in smaller quantities than riboprimers. Preferably, amplification is performed using about 20 pmoles of each riboprimer and ½ to 1 pmole of each bandaid primer per each 100-150 μl of reaction volume. In one embodiment, bandaid primers are about 50 nucleotides long, comprising about 25 nucleotides from the target ends and about 25 nucleotides from the vector ends; however, a skilled artisan can select other lengths as well that would also allow successful priming of DNA synthesis. For the synthesis of DNA/RNA hybrids as described herein, any DNA polymerase known in the art that is capable of extending from a riboprimer can be used, which is all of them, as far as we know, since extension from an RNA primer is a natural part of the initiation of DNA syntheses in cells. However, some DNA polymerases, particularly those from the Archea, cannot cross the ribonucleotides as template when they come back the other way on the next PCR cycle. Complete crossing of the ribonucleotides as template is a necessary part of this method, so it is recommended to include at least some Taq or Klentaq in what would therefore be a mixture of DNA polymerases, to ensure crossing at these positions to complete each strand during a PCR cycle.
  • The riboprimers that are used to amplify the target DNA sequence contain at least one ribonucleotide at or near their respective 3′ ends. Ribonucleotides can be selected from the group consisting of riboC, ribo U, ribo T, riboA, riboG, and ribo 1. The particular ribonucleotide is chosen based on optimal efficiency of commercially available ribonucleases. Pancreatic RNAse A, catalog numbers 2270 and 2272 from Ambion is particularly effective, but can only cleave at rU, rT, and rC. The riboprimers are preferably about 24-26 nucleotides in length, however their precise length is optional and can be chosen by a practitioner. Generally, the riboprimer length is from about 20 nucleotides to about 30 nucleotides. In addition, the nucleotide sequence of each of the riboprimers is selected by the practitioner and need not be My complementary to the sequence of the target DNA. As is known in the art, perfect complementarity is not required for successful extension of primers and resulting DNA synthesis, nor for successful annealing.
  • During PCR, the 5′ end of the primer does not need to be paired at all to the DNA being amplified; thus adding nucleotides to the 5′ end of the primer may be used in generating target DNAs that contain additional sequences. For instance, the bandaid primers that are used herein comprise sequences complementary to the target DNA at 3′ ends and sequences complementary to the vector DNA at 5′ ends, thus allowing for addition of vector end sequences on both ends of the target DNA. Other considerations of primer design are well known in the art (see, for example, Newton et al., (des), PCR: Essential Data Series, John Wiley and Sons, New York, N.Y., 1995; Dieffenbach (ed), PCR Primer: a Laboratory Manual, Cold Springs Harbor Laboratory Press, Cold Springs Harbor, N.Y. 1995; White et al. (eds), PCR Protocols: Current Methods and Applications; Methods in Molecular Biology, The Humana Press, Totowa, N.J., 1993; Innis et al., PCR Protocols: A Guide to Methods and Applications, Academic Press, San Diego, Calif., 1990; GrBk et al. (eds.), PCR Technology, Current Innovations, CRC Press, Boca Raton, Fla., 1994, each of which is herein incorporated by reference). For instance, it is often desirable for approximately 50% (range 45-55%) of the hybridizing residues to be Gs or Cs.
  • Riboprimers that contain at least one ribonucleotide, preferably at their 3′ ends, may be prepared by any technique available in the art. For example, such riboprimers may be chemically synthesized. Such riboprimers are commercially available from companies such as, e-g., DNAgency and Integrated DNA Technologies (IDT), which will synthesize primers according to a practitioner's request. Alternatively, riboprimers may be generated by ligating at least one ribonucleotide to the 3′-end of a DNA sequence that is to be used as a primer (see, for example, Moore et al., Science 256:992, 1992; Smith (ed), RNA: Protein Interactions, A Practical Approach, Oxford University Press, 1998, which are incorporated herein by reference).
  • Riboprimers that are preferably used comprise only one ribonucleotide at their 3′ ends. While the presence of only one ribonucleotide in each riboprimer does not decrease the efficacy of priming and/or cleaving of said riboprimers from the target DNAs, synthesis of riboprimers with only one ribonucleotide is more cost-effective than synthesis of primers with more than one ribonucleotide. In one embodiment of the present invention, a ribonucleotide used for the methods of the present selection may be selected from riboG, riboA, riboU, riboT, and riboI. In a preferred embodiment, the ribonucleotide comprises riboC or riboU.
  • Following the generation of a double-stranded target DNA that contains at least one ribonucleotide on each strand, the solution comprising the target DNA may be precipitated with PEG in order to remove the unincorporated primers, followed by resuspension of the target DNA in a low salt solution (such as 5 mM Tris, 5 mM EDTA) prior to exposing it to conditions that result in the cleavage of said riboprimers from said target DNA. A range of cleavage conditions capable of cleaving a bond between a deoxynucleotide and a ribonucleotide, thereby leading to the separation of riboprimers from both strands of a target DNA molecule, may be selected. In a preferred embodiment, the cleavage of the primers from a target DNA is achieved by incubating the target DNA with an RNAse that is capable of cleaving a bond between a deoxynucleotide and a particular ribonucleotide that was used in the primers. For instance, when a riboprimer comprises a riboC, any RNAse capable of cleaving a bond between a deoxynucleotide and a riboC may be used. Preferably, bovine pancreatic RNAseA is used to cleave the bonds between a deoxynucleotide and riboC, riboU, or riboT, and RNAseT1 is used to cleave the bonds between a deoxynucleotide and a riboG. The amount of RNAse depends on multiple factors, such as, e.g., the amount of the target DNA, and can easily be determined by one of ordinary skill in the art. If the continued presence of the RNAse is detrimental to the eventual transformation of living cells or other immediate manipulation of the target DNA, a protease such as proteinase K is added to inactivate the RNAse and any other nucleases that may contaminate it. The incubation with protease is followed by heating the solution comprising the target DNA and RNAse, thereby releasing the riboprimers from the double-stranded DNA molecules.
  • In one embodiment, the riboprimers are specified and manufactured to contain a biotin moiety at their 5′-ends. In this case it improves the overall procedure to bind the PCR product to streptavidin beads at this time, which binding requires high salt, such as 0.25 M NaCl. Whether or not streptavidin beads are used, high salt such as 0.25 M NaCl is preferable at this time in order to control and achieve the melting of the primer portion of the molecule without melting the entire molecules. The temperature that results in melting off the riboprimers needs to be selected so that it does not have any negative effects on target DNA molecules, such as, e-g., denaturation. For instance, heating the solution to 750 to 85° C. will result in release of the riboprimers without denaturation of target DNA sequences. Other temperatures might be suitable, and can be determined by a skilled artisan. As a result of such cleavage and heating, the target DNA will contain 3′-overhangs, thereby creating a target DNA molecule with “sticky ends”. A generation of a target DNA molecule containing 3′-overhangs is depicted in FIG. 2.
  • RNAse may be degraded by adding a proteinase to a solution comprising the target DNA and RNAse. Preferably, the RNAse is removed by the proteinase K. While removal of RNAse is not essential for the linking of nucleic acids as described herein, introduction of linked nucleic acids that also contain RNAse into cells chosen for transformation may be lethal to the cells under many circumstances. Therefore, it is preferable for transformation of cells with at least two DNA molecules that were annealed as described herein to remove or inactivate RNAse.
  • Additional methods of cleaving DNA/RNA bonds, such as exposure to elevated pH (e.g. treatment with a base such as sodium hydroxide) could also be employed to create target DNA sequences with 3′-overhangs. Unfortunately this base treatment will completely denature the vector and target DNAs. It is possible to reanneal to recover double-stranded target and vector DNA in this situation, and we have successfully created desired recombinant molecules this way. We find it much less efficient and productive, however.
  • It should be noted that the length of a 3′-overhang corresponds with the length of the riboprimer if a single ribonucleotide at the 3′ end of the primer is used, or with the position of the most 3′-ribobase, if more than one ribobase is used. As mentioned previously, a preferred length of resulting sticky end is about 25 nucleotides; however other lengths can also be used. Moreover, the 3′-overhangs at the two ends of the target DNA need not have the exact complete same sequence or length. It is often desirable to generate a target DNA that can be annealed to a second DNA molecule in only one orientation or that can be annealed to two different DNA molecules in a particular arrangement. It is essential, however, that any two DNA molecules that are to be joined possess 3′-overhangs that are at least complementary in part. In cases of partial complementarity, it will be appreciated that following annealing, one or more gaps or non-homologous overlaps may be present in the joint sequence. As applicant has determined, the presence of one or more gaps did not negatively affect the efficiency of cell transfection with such annealed sequences (data not shown). While not being bound to a particular theory, it is believed that annealed sequences containing gap(s) are corrected after being introduced into the cells through actions of cellular enzymes involved in correcting DNA damage.
  • Any vectors available in the art may be used, subject only to their successful amplification by long and accurate PCR (LA PCR, U.S. Pat. No. 5,436,149), which can amplify up to at least 35 kb. Accordingly, depending on the organism in which they will be replicated, vectors may be selected from the group consisting of bacterial, yeast, viral, plant, and mammalian vectors. Both cloning and expression vectors may be used due to the fact that they contain nucleotide sequences that allow the vectors to replicate in one or more suitable host cells. In cloning vectors, this sequence is generally one that enables the vector to replicate independently of the host cell chromosomes, and also includes either origins of replication or autonomously replicating sequences. Various bacterial and viral origins of replication are well known to those skilled in the art and include, but are not limited to, the colE1 plasmid origin, the 2μ plasmid origin, and the SV40, polyoma, adenovirus, VSV and BPV viral origins. Common promoters used in expression vectors include, but are not limited to, CMV promoter, LTR or SV40 promoter, the E. coli lac or trp promoters, and the phage lambda PL promoter. Other promoters known to control the expression of genes in prokaryotic or eukaryotic cells can be used and are known to those skilled in the art. Expression vectors may also contain a ribosome binding site for translation initiation and a transcription terminator. The vector may also contain sequences useful for the amplification of gene expression.
  • Expression and cloning vectors can and usually do contain a selection gene or selection marker. Typically, this gene encodes a protein necessary for the survival or growth of the host cell transformed with the vector. Examples of suitable markers include neomycin or hygromycin B resistance for eukaryotic cells and tetracycline, ampicillin, or kanarnycin resistance for E. coli.
  • The target DNA and vector DNA with single-stranded complementary 3′ overhangs are then incubated together under conditions that result in annealing of their complementary overhangs. Exemplary conditions include incubation of the target and vector at 78° C. for 2 minutes, followed by an incubation at 52° C. for 30 minutes. Alternatively, the incubations can be the following: incubation for 2 minutes at 78° C. followed by 10 minutes at 65° C., followed by slow cooling e.g., over a period of 30 minutes to 52° C. and then chilling. One of ordinary skill in the art can determine other incubation conditions without undue experimentation. In fact, mere incubation at room temperature works pretty well. Additional modifications for optimizing the annealing rates between the vector and the target DNA may also be employed. Adjusting the salt concentration and temperature play a role in the annealing process, and thus might require optimization for different DNA sequences. Such modifications are well known in the art. It is preferred that annealing is performed at equi-molar concentrations of the DNAs to be recombined, such as the target and vector DNAs.
  • In a further embodiment of the present invention, two or more double-stranded molecules may be linked, thereby generating a hybrid DNA molecule, when neither molecule is a vector per se.
  • It is preferred that different 3′-overhangs are generated when linking more than two DNA sequences. This allows for joining of DNA molecules in only one orientation, minimizing the screening process for a properly linked hybrid DNA, unless a random mixture of orientations and/or map arrangements is one of the desired outcomes. Furthermore, in such complex linking reactions, different 3′-overhangs help to minimize the possibility of self-annealing by individual sequences.
  • In yet another embodiment of the present invention, the linking reaction can include the use of biotin and streptavidin. Both the linking of a vector and a target DNA or linking of more than two DNA sequences may be performed using this method. Briefly, the generation of desired DNA molecules with complementary 3′-overhangs is performed as described herein by exposing said DNAs to conditions that result in cleavage of primers from the DNA molecules. The primers, in addition to containing at least one ribonucleotide at or near the 3′ end also contain a biotin moiety at the 5′ end. Primers modified in such manner may be obtained commercially (e.g. IDT) or riboprimers may be coupled to biotin. Methods for effecting the attachment of the hapten binding ligand (such as biotin) to the support (such as streptavidin beads) are described by Hevey et al. (U.S. Pat. No. 4,228,237) and by Kourilsky et al. (U.S. Pat. No. 4,581,333). When biotin is employed, a paramagnetic streptavidin conjugated bead, obtained from Genovision, Inc. (West Chester, Pa.) or Life Technologies, Inc. (Gaithersburg, Md.) or the Dynabead Streptavidin M-280 bead obtained from Dynal (Great Neck, N.Y.) can be used as the support. Other hapten-support systems may also be used.
  • The cleavage of the primers from the desired DNA molecules may not be 100% efficient. Accordingly, there likely will be DNA molecules that have not been cleaved and do not possess 3′-overhangs in the solution comprising target DNAs and primers. Such molecules cannot be linked by annealing to desired cleaved DNAs. In addition, cleaved primers and possibly primers left over from the PCR will also be present in the solution to compete for the desired annealing at the 3′-sticky ends. Despite best efforts to use a pure RNAse, in the absence of free magnesium, some of the 3′-sticky ends may be subject to damage or removal by unwanted nuclease activities, leading to another source of unsuitable ends. To increase the efficiency of linking two or more DNA sequences, it is generally desirable that only the sticky-ended vector and target(s) sequences be present in the annealing reaction.
  • To maximize the purity of cleaved DNAs before using them in the annealing process, the cleaved target DNA with biotin primers still on it, possible uncleaved target DNA, the possible loose primers, and proteinase K used to inactivate the RNAse, may be incubated in the high-salt annealing buffer with magnetic streptavidin beads. Proteinase K does not seem to hurt the beads, since streptavidin is resistant to protease, particularly in the high-salt buffer necessary to get the beads to bind the biotin-PCR product. This incubation at i.e. room temperature results in binding of the biotin-containing molecules to said magnetic beads, then unbound material is washed away, then more annealing buffer is added. In the next step, the beads are heated to around 75-85° C. to melt off desired DNA away from the primers and uncleaved DNA which remain stuck to the beads at their biotin moeities, and a after a few minutes a magnet is applied near to the solution containing the cleaved DNA, biotin-labeled DNAs, and streptavidin beads, thereby separating the cleaved target DNA molecules from the uncleaved, biotin-labeled ones and from unwanted contaminating primer. The use of the magnet allows for the beads to be immobilized while the solution containing the desired pure DNA is withdrawn. It should be noted that normally each DNA target or vector is separately treated with streptavidin beads. The target and vector DNA sequences are then storable in the freezer, and may be, when desired, mixed together at preferably equimolar amounts and incubated under conditions that result in annealing of the complementary ends thereof.
  • Alternatively, but not preferably, the DNAs are allowed to affix to the streptavidin beads before the scission at the ribonucleotides and the proteinase K treatment. Proteinase K does not seem to hurt the beads, since streptavidin is resistant to protease. Following the amplification of desired DNA molecules using primers comprising at least one ribonucleotide at their respective 3′ ends and a biotin at their respective 5′ ends, the DNAs and the primers can be incubated with streptavidin beads. Following such incubation, the solution comprising said beads, DNAs and the primers is exposed to conditions that result in the cleavage of said primers from the DNAs, leading to the generation of cleaved DNAs that are free in solution, while uncleaved DNA molecules and the primers stay attached to the beads. The magnet is then applied to the solution in order to separate the beads with attached biotin-containing molecules from the solution. Following separation of the beads, the desired DNA molecules are combined at preferably equimolar ratios and incubated under conditions that result in annealing of their complementary ends.
  • Any two or more linked DNA sequences can then be propagated in cells, subject to the normal requirements of replication (including recombinational insertion into a genome) and marker selection. Introduction of such sequences, i.e. transformation into cells, can be achieved by any of the methods available in the art. Such methods include, but are not limited to, calcium phosphate transfection, DEAE-dextran mediated transfection, Polybrene mediated transfection, protoplast fusion, liposome mediated transfection, direct microinjection into the nuclei, biolistic (gene gun) devices, scrape loading, electroporation, and calcium and lithium treated bacterial cells.
  • Having described the invention in detail, it will be apparent that modifications, variations, and equivalent embodiments are possible without departing the scope of the invention defined in the appended claims. Furthermore, it should be appreciated that all examples in the present disclosure are provided as non-limiting examples.
    • EXAMPLES
  • The following non-limiting examples are provided to further illustrate the present invention. It should be appreciated by those of skill in the art that the techniques disclosed in the examples that follow represent approaches the inventors have found function well in the practice of the invention, and thus can be considered to constitute examples of modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments that are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention.
    • Example 1
  • Most of these incubations are programmed into a PCR i.e. thermocycler machine, with “chill” being hold on cold block for 5 min. to overnight.
  • E. coli X7029 is F- and wild-type except for a lac-pro deletion.
    E. coli WB451 (IDE3) is a deletion of lacZ codons, constructed by the method of Datsenko and Wanner. (Datsenko, K. A., and Wanner, B. L. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. USA 97:6640-6645, 2000.) and it is lysogenic for lambda DE3 transducing phage. There is nothing about the E. coli cells used here that is particular or necessary to the method, as far as is known or expected.
    Bacteria are made electrocompetent and transformed by electroporation as described by Dower, W. J., Miller, J F. and Ragsdale, C. W. (1988) High efficiency transformation of E. coli by high—voltage electroporation, Nucleic Acids Research 16:6127-6145 and Mattanovich, D., et al, (1989) Efficient transformation of Agrobacterium spp. by electroporation, Nucleic Acids Research 17:6747.
    When DpnI treatment was employed, background transformation with vector alone or target alone was always less than 1%, usually less than 0.1%, of the recombinant clones.
    10×ATEN buffer is (0.5 M Tris pH 7.9, 2.5 M NaCl, 0.25 M Na4EDTA pH 7.9). Add 1/9 volume to make 1×.
    • T005,E005 is 5 mM Tris pH 7.9, 5 mM Na4EDTA pH 7.9. TEN is 10 mM Tris pH 7.9, D.1 mM EDTA, 10 mM NaCl.
  • 10×KLA pH9.2 is 500 mM Tris base, 160 mM ammonium sulfate, 25 mM MgCl2, 1% Tween 20.
    10×KLA pH7.9 is the same as 10×KLA pH9.2 except that HCl has been added to lower the pH.
  • 1. Amplify target and vector using KlentaqLA DNA polymerase mixture and ribo-U or ribo-C at the 3′-ends of the primers. Four PCR conditions should be evaluated: KLA buffer pH 7.9 or pH 9.2, and betaine at 1.3 or 1.9 M. For best cloning efficiency, additionally specify 5′-Biotin or 5′-Biotin-TEG modification for the primers, and use streptavidin beads as described below in Example 2. Additional PCR details are 100 mM each dNTP, and 0.1 μl KlentaqLA per kb of amplimer size, up to 10 kb (Barnes, 1994).
  • Dpn I selection. If the template for the vector or the target came from dam+E. coli, and could contribute to an unwanted background later at the cloning step, degrade the background template at methylated GATC sites: To each 100 μl of PCR reaction, add 1 μl (10 units) of Dpd, and incubate 37 degrees for 1-2 hours.
    2. PEG-precipitate the DNA. This is to lose the primers and the salt. The desired DNA will be in the pellet.
    Transfer to thick-walled (regular-walled) tubes, either 0.5 ml or 1.7 ml, for this. Thin-walled PCR tubes cannot reliably withstand the centrifuge step.
    Add 5 μl 1 mg/ml blue dextran and ½ volume 30% PEG 3350, 1.5 M NaCl (to make final 10% PEG, 0.5 M NaCl).
    Wait 30 min. at R.T. or 90 min. to overnight at 4 degrees. Centrifuge 15 min. Watch blue pellet whilst removing supernatant, so as not to accidentally discard the pellet. Rinse pellet with 75% ethanol (centrifuge 8 minutes).
    Dry pellet for 10-20 minutes in air. Resuspend in 100 μl T005,E005 for at least 10 minutes on ice, with vortexing occasionally.
    3. Pancreatic RNase A: Dilute some Ambion 2270 or 2272 RNAse A to a concentration of 200 μg/ml in T005,E005 buffer. May be stored frozen.
    Add 6 μg (30 μl) RNAse to the DNA on ice. Vortex and centrifuge briefly, then incubate PCR products with RNAse for 30 min. at 55 degrees. Chill.
    4. Proteinase K: Stock be stored at −20 degrees in 100 mM beta-mercaptoethanol, 20 mM Tris pH 7.9, 1 mM CaCl2, 50% (v/v) glycerol.
    Add 5 μg proteinase K or about equal the weight of RNAse used above. Mix thoroughly and spin briefly.
    Incubate 30 min. 65 degrees, chill.
    [If using biotin primers, go now to bead purification steps in EXAMPLE 2 below, then come back here.]
    • 5. Cloning Step
  • Double-check target and vector DNA concentrations by loading 2 and 8 μl samples of each vector or target onto agarose gel alongside a concentration standard. The exact concentration is not as important as getting the ratios to be equimolar for the cloning.
  • 01 to 10 μl vector=30 ng 0.02 pmole
  • 01 to 10 μl target=5 ng (Equimolar is best for target::vector.)
  • 10×ATEN to make 1×, if necessary
  • 1×ATEN to 40 μl.
  • 6. Use 20 μl aliquots of cloning mix for various controls, such as before heating, no heating, gel samples, etc. So make up more of the cloning mix as necessary, in proportion. Minimum is 40 μl: 20 μl for gel, 20 μl for transformation of cells.
    The best control is a 20 μl aliquot with the 2 vector primers (or the 2 target primers) added in the amount of ½ to 5 pmole of each. This will poison the ends and make the annealing impossible—this gel (and/or transformation) sample will show you what the input DNA looks like with no annealing. This is analogous to a no-ligase control for prior art methods using restriction sites.
    Another good control is to include only one poison primer—this control will show you what lousy annealing looks like, although sometimes when it looks like this there are still hundreds of good clones that arise from an invisible circular product band.
    7. Annealing may not be necessary for bead-purified DNA, but for non-biotin primers, this heat step helps a lot.
    Incubate 2 min 78°; C., 30 min. 52°; C. Alternatively, 2 min. 78°; C, 10 min 650; C, then cool slowly over 30 minutes to 520; C. or lower. Chill.
    Pull aliquot (20 μl) for after-annealling gel sample.
    These gel samples are for monitoring and improving the recombination. These gel samples may be skipped for routine cloning, but, as for any DNA cloning experiment, if something goes wrong, you won't know what it was without the gel analysis. If you didn't run the gel samples, don't ask someone else what went wrong; they won't know either. If you did run the gel samples, you will probably be the expert.
    8. Add 1/9 or ⅙ volume 3 M sodium acetate, pH 5.6, and 2 mg blue dextran. Add 2-3 volumes ethanol to precipitate, chill to −20 degrees for 30 min, and centrifuge 10-15 min.
    Rinse the (hopefully visibly blue) pellet with 75% ethanol: 25% TEN buffer—centrufuge 8 min.
    9. Resuspend dry pellets in 22 μl water on ice. Water should turn slightly blue from the blue dextran carrier. Save 7 μl for a gel sample or a backup transformation.
    10. Electroporate 70 μl competent bacteria with 15 μl DNA. Plate a suitable portion on Ticarcillin 100 after 10 minutes or on Kan25 after 5-16 hours or on Tet 12 after 2 hours. The above is just one way to work up the PCR products with RNAse treatment. There are alternate ways to purify PCR products free of primers, treat them with enzyme(s), and remove the enzyme(s).
    • Example 2 Paramagnetic Streptavidin Bead Way
  • 1. Amplify target with 5′-Bio-TEG and 3′-riboC primers.
    DpnI, PEG-precipitate, RNAse and proteinase K in T005,E005 as in Example 2. above.
    Add 1/9 volume of 10×ATEN buffer to make samples 1×ATEN.
    Pre-preparation of beads: Withdraw a volume of resuspended beads from their storage tube, magnetize, and discard the storage buffer.
    Wash twice (including once at 80 deg with 5-10 minute soak) with the same volume of 1×ATEN buffer. Resuspend in 1×ATEN buffer for use, and store at 4 deg. for up to at least 2 weeks. This washing is to remove loose streptavidin. The proteinase K, if left over, does not hurt the streptavidin beads.
    2a. To each amount of DNA that originates from 130 μl of PEG-precipitated PCR reaction add 60 μl of Genovision beads previously pretreated and resuspended in 1×ATEN buffer as above.
    Incubate 30 min. 25 deg. with occasional shaking.
    Magnetize, and save the bead supernatant “B.S.”
    2b. If significant amounts of DNA do not stick to beads in 1×ATEN (i.e. are in the B.S.), try adding 1 pmole of one biotin primer to the (bead-free) DNA, and anneal at 52 degrees for 30 min Then add more beads as for 2a.
    3. Wash DNA-containing beads once or twice quickly with 200-500 μl 1×ATEN. This is to remove more initial PCR template and RNAse.
    4. Heat-elute at 80 degrees 2 or 3 times with 100 μl 1×ATEN as follows:
    Heat at 80 deg. for 3-5 min. Move tubes to 80 deg. hot block holes with a magnet in them for another few minutes.
    One at a time, hold warm tubes next to magnet in hand and withdraw supernatant. This is the ribocloning DNA.
    Pool the 2 or 3 elutant volumes, and magnetize or centrifuge it one more time to remove all traces of beads.
    5. DNA is now ready for cloning. The DNA is now in 1×ATEN, so make sure final ATEN is 1× during the recombination annealing described in step 5 of Example 1.
    Equimolarity is very important to a good yield of recombinants, so remeasure the quantities of DNA: Load 2 or 8 μl onto a gel next to 2 or 8 μl of lambda+H3 digest to quantitate vector and target DNA. Recombine as described in step 5 of Example 1. above.
    Yield: With E. coli X7029, which is not particularly electrocompetent (10**8 per μg plasmid), we get 1,000-3,000 clones per μl (10 ng) of original target PCR reaction. X7029 has wild-type recombination. With JC8679, which is more electrocompetent and has high RecET activity, there are 10× more colonies, but an unacceptable portion of these are unwanted recombinants or rearrangements between repeated spans of our vector and/or target.
    • Example 3 Ribocloning an Artificial Ds-Red Gene and the Gene for Taq DNA Polymerase
  • The specific vectors and targets are presented as arbitrary examples, only. The method is highly general and does not depend on any specific target or vector. Undue experimentation is not required to adapt the method to nearly any vector, and to nearly any site within any vector, that may be chosen by a practitioner of the art, nor to nearly any target. The only requirement is that the PCR amplification work well. Usually, the exact desired and chosen site within a desired vector, and the exact span of desired target, may be recombined using the method.
  • Ribprimers used in the examples are listed here, in standard 5′-3′ sequence. The last and lower case letter represents the 3′-ribo base. These primers names are used in the Sequence Listing, also.
  • T7gen10rC = GTTTAACTTT AAGAAGGAGA TATAc
    T7gen10atrC = GTTTAACTTT AAGAAGGAGA TATATc
    T41 = GTG GCG AGA AAG GAA GGG AAG AAA Gc
    VO1neg7T = GTATATCTCCTTCTTAAAGTTAAAc
    V41 = GCTTTCTTCCCTTCCTTTCTCGCCAc
    T7gen10rU = GTTTAACTTTAAGAAGGAGATATAU
  • 5′-biotin modification was sometimes specified at the 5′-end when ordering from IDT (Integrated DNA Technologies, Coralville, Iowa), with or without TEG linker. Primerfinder (http://eatworms.swmed.edu/˜tim/prim&der) was used to design primers T4 1 and V41, which are in the phage fl DNA portion of the plasmid vector.
  • Vector PCR Two vectors are shown in FIG. 2.
  • Ribovector 250, 4.8 kb: Template for PCR was pWJB250 digested with HindIII and NcoI. The same ribovector 250 DNA would have arisen if the template were pWB254b (ATCC #69244) linearized by digestion with NcoI. When amplified using PCR tiboprimers VO lneg7TrC and V41, the product is equivalent to the backbone of pWB254 described in U.S. Pat. No. 5,436,149, with base pairs 2217 to 4138 missing, nucleotide 2218 (the first one of V0lneg7TrC) changed from an A to a G, and a single ribonucleotide rC at 25 or 26 bases from each 5′ end, at positions 2194 and 4164.
    Ribovector ASK75 PCR, 2.9 kb: Template was pASK75 [Skerra, A. Use of the tetracycline promoter for the tightly regulated production of a murine antibody fiagment in Escherichia coli. Gene 151 (1994) 13 1-135.] digested with EcoRI and HindIII. The same PCR riboprimers were used as above for ribovector 250, with the addition of one band-aid primer to adapt the V0lneg7TrC to prime, and change the Shine-Dalgamo site to that of gene 10 from phage T7. That band-aid sequence, included at only 10 nM for the PCR, was ASK-T7SD,
  • A CTCCCTATCA GTGATAGAGA AAAGT TTAACTTTAAGAAGGAGATATAC.
  • Target PCR. Two targets are shown being cloned in FIG. 2.
  • Ribotarget maize Ds-Red PCR, 1 kb: Template was pWS397, which is a clone of an artificial gene assembled from 40-mers by the method described in this patent. It was cloned into the ribovector form of pWJB250 using a riboprimer somewhat differently located than T41. The riboprimers T7gen10rC (2194-221 8 of pWB397) and T41 (3174-3149 of pWB397) give rise to a 1 kb product (981 bp) which comprises a 678 bp ORF of a artificial codons which code for Ds-Red. The product comprises a riboC at a position 26 bases from each 5′-end.
    Ribotarget Taq DNA Polymerase gene, 2.5 kb. Template was genomic DNA from Thermus aquaticus i.e. ATCC # 25105. Primers were T7gen10atrC, and T41. Included in the PCR at 10 nM were 2 band-aid oligomers to adapt the PCR primers to prime the target. These band-aids were
  • “T7SD-Q5 band-aid”
    GTTTAACTTT AAGAAGGAGA TATATCCATG AGaGGGATGC
    TGCCCCTCTT TGA
    (contains a change to 2d codon (for ARG) to break
    up a run of G5)
    and
    “T4 1-Q3 bandaid”
    GTG GCG AGA AAG GAA GGG AAG AAA GCT CAC TCC TTG
    GCG GAG AGC CAG TCC T

    PCR conditions were as described in Example 1 and 2, with the following details.
    Reaction volume was 150 μl. Melt time per cycle was 70 seconds at 93 degrees C. One other temperature was used per cycle: 62 degrees to anneal/extend. The time of extension was 20 minutes if one or more band-aids were included; otherwise the 62-degree time was 10 minutes. The vector and target products were amplified, worked up to the 3′-sticky-ended forms, mixed and annealed by the methods of Example 1 and 2.
    • Example 4
  • This example demonstrates ribocloning the Taq gene without or with bead purification, and using beads but comparing with or without proteinase K treatment, using a ribovector with an assembled portion.
  • In this example, the vector was ribovector 419. To prepare this ribovector by PCR, a cluster of four 42-mers was included in the PCR reaction at 10 nanomolar to assemble a 80 bp span of DNA, containing a T7 promoter and ribosome binding site region, onto the plasmid where it did not exist before. Our normal vector ribprimer V0lneg7TrC could then, present at the normal level for PCR (200 nM) prime onto the end of this assembled region. At the other end of the ribovector PCR amplifier, our vector riboprimer V41 required the presence of a 50-mer bandaid to adapt priming. Despite this seeming complexity, this is a very reliable PCR amplification that we have carried out several times, including with templates pKD46 and pKD911.
  • The four 42-mers that assembled 104 bp for the new phage T7 control region are listed below. The first 25 bp of the resulting assembly are homologous to bp 1210-1234 of pKD46 (Datsenko & Wanner, 2000) in order to overlap for the PCR amplification; thereafter the sequences is from phage T7 right before gene 10.
  • ;pKD46-T7 42 mer
    TTTGGGMTTCGAGCTCTAAGGAGGTTAATACGACTCACTAT
    ;T71ea 42 mer
    AGGGAGACCACAACGGTTTCCCTCTAGAAATAATTTTGTTTA
    ;VO1 neg7Tbot 42 mer
    GTATATCTCCTTCTTAAAGTTAAACAAAATTATTTCTAGAGG
    ;T71eabot 42 mer
    GAAACCGTTGTGGTCTCCCTATAGTGAGTCGTATTAACCTCC

    The bandaid to allow riboprimer V41 to prime onto pKD46, or pKD119 (analogous to pKD46 but having tetracycline resistance in the place of, and in the opposite orientation to, ampicillin resistance; B. Wanner, personal communication), is
  • “exoCt′-T41”
    GGA TGC GTC ATC GCC ATT GCT CCC CGT GGC GAG PLAA
    GGA AGG GAA G M AGC

    Adjacent to complementarity for V41/T41, this band-aid incorporates complementarity to 3111-3135 of pKD46 and pKD119.
  • Thus, the vector PCR reaction included, per 100 μl, 1 pmole of the above 5 oligomers, 20 pmoles of 5′-biotin V41, and 20 pmoles of 5′-biotin V0lneg7T. The template was 10 ng of pKD119 pre-digested with Pst I.
  • The target DNA was ribotarget Taq gene (2.5 kb) prepared as described in Example 3.
  • FIG. 5 shows the results when target and vector were prepared and mixed together for cloning according to Example 1, with no bead purification having been used. It can be seen that heating is required to obtain fused target and vector since without it (lane 1) target and vector migrate separately. After heating and annealing, a new upper band appears. This is not actually the desired circular fusion of target and vector. The yield of said desired product, the circular fusion, is so poor that it does not appear visible on this gel (it would migrate between bands 1 and 2 of the standard lane, as can be seen from the more successful experiment shown in FIG. 4). Another suboptimal feature of this ribocloning, i.e. a slight error, is that the ratio of vector to target is quite far from equimolar—there is too much target. Nevertheless, although the desired product band was too low in yield to be visible, valid recombinant clones were obtained. As enumerated in Table 2, about 14 colonies were obtained per ng of vector DNA, and as assayed in FIG. 6, rows 1 and 5, 19 of 24 clones exhibited the desired activity of thermostable DNA polymerase.
  • FIG. 4 shows a more advanced and successful cloning. The same target (Taq gene) and vector (V4 1 9, a.k.a. pWB4 1 9, amplified from pKD 119 template) preparations were used, but subjected, before cloning, to the streptavidin bead purification described in Example 2. Also, the necessity of the proteinase K step was tested by leaving it out of the target and vector DNA preparations loaded onto the right half of FIG. 4. In lane 3, combined target and vector were allowed to sit at room temperature for one hour, without a heating and annealing treatment. Lanes 4, 5, and 6 (labeled PI, p2 and CL) were subjected to the heating and annealing treatment. To illustrate poor cloning efficiency (such as that for FIG. 5), one poison primer was included in the annealing loaded in lane 4 (PI). To illustrate no annealing at all, and so that the input DNA could be separately visualized and confirmed in the production annealing mixture, two poison primers were included in the annealing loaded in lane 5 (P2), as recommended in Example 1. and as indicated on the FIG. 4. The material analyzed in the lanes marked CL was transformed into E. coli, and the quality of the clones was confirmed in the assay shown in FIG. 6. Again, at least 80% of the clones exhibited the desired thermostable DNA polymerase activity, Many more clones were obtained with this bead-purified DNA, as enumerated in Table 2. About twice as many clones were obtained when proteinase K treatment was not omitted from the recommended procedure. In early experiments with target and vector that were not purified with streptavidin beads, and using less pure RNAse A, the importance of proteinase K was much higher: proteinase K treatment improved transformation by 100-fold (data not shown.)
  • TABLE 1
    Sizes of DNA loaded onto the agarose gels, in base pairs (bp).
    23130 Standard band 1 of lambda +
    HindIII digest.
    9416 Standard band 2
    6557 Standard band 3
    4361 Standard band 4
    2322 Standard band 5
    2027 Standard band 6
    564 Standard band 7 not always visible
    4798 Vector 250 amplifiable from pWB254 or
    pWB250
    4997 Vector 419 amplifiable from pKD119
    2913 Vector 75 amplifiable from pASK75
    2552 Target Taq Pol I gene amplifiable from genomic
    Taq DNA
    981 Target Ds-Red gene, artificial amplifiable from pWB397
    codons
  • TABLE 2
    Yield of clones.
    50 ul Transformants
    Workup actual Total projected per
    after colony colony yield if ng vector
    RNAse count all plated. DNA
    P-k, no beads 27 850 14
    (gel FIG. 5)
    Beads & 550 17,000 283
    P-k (Left of
    FIG. 4. gel)
    Beads, no P-k 281 8700 144
    (Right FIG. 4.
    gel)
    Super-coiled 30,000
    plasmid

Claims (3)

1. A method of gene assembly, wherein disconnected, but adjacent on the designed sequence, 40-60 mers of DNA that overlap with staggered complementary oligomers of the same size to form a gene, are provided at a concentration of 1 to 10 nanomolar, and cycled with a themostable DNA polymerase under PCR conditions which comprise annealing/extension steps of 15 to 30 minutes.
2. A method of claim 1 wherein at one or each end of a PCR amplimer, only two to four 40-60 mers, such as 42 mers, overlap each other and a target DNA to be amplified and a PCR primer at that end or each end of the amplimer.
3. A method of claim 2 wherein at one or each end of a PCR amplimer, only one 40-60 mer, such as a 50 mer, overlaps both a target DNA to be amplified and a PCR primer at that end or at each of the amplimer.
US12/101,433 2002-05-16 2008-04-11 Ribocloning: Recombinant DNA Construction using Primers with RIBO Bases Abandoned US20080262212A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US12/101,433 US20080262212A1 (en) 2002-05-16 2008-04-11 Ribocloning: Recombinant DNA Construction using Primers with RIBO Bases

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US10/147,430 US7393635B2 (en) 2002-05-16 2002-05-16 Ribocloning: recombinant DNA construction using primers with ribo bases
US12/101,433 US20080262212A1 (en) 2002-05-16 2008-04-11 Ribocloning: Recombinant DNA Construction using Primers with RIBO Bases

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
US10/147,430 Division US7393635B2 (en) 2002-05-16 2002-05-16 Ribocloning: recombinant DNA construction using primers with ribo bases

Publications (1)

Publication Number Publication Date
US20080262212A1 true US20080262212A1 (en) 2008-10-23

Family

ID=29419017

Family Applications (2)

Application Number Title Priority Date Filing Date
US10/147,430 Expired - Fee Related US7393635B2 (en) 2002-05-16 2002-05-16 Ribocloning: recombinant DNA construction using primers with ribo bases
US12/101,433 Abandoned US20080262212A1 (en) 2002-05-16 2008-04-11 Ribocloning: Recombinant DNA Construction using Primers with RIBO Bases

Family Applications Before (1)

Application Number Title Priority Date Filing Date
US10/147,430 Expired - Fee Related US7393635B2 (en) 2002-05-16 2002-05-16 Ribocloning: recombinant DNA construction using primers with ribo bases

Country Status (1)

Country Link
US (2) US7393635B2 (en)

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10683537B2 (en) 2012-10-16 2020-06-16 Dna Polymerase Technology, Inc. Inhibition-resistant polymerases
JP6475171B2 (en) * 2013-02-05 2019-02-27 バイオナノ ジェノミクス、 インコーポレイテッド Single molecule analysis method
WO2016183294A1 (en) 2015-05-12 2016-11-17 Dna Polymerase Technology, Inc. Mutant polymerases and uses thereof

Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US40715A (en) * 1863-11-24 Improvement in locomotive-tenders
US5658731A (en) * 1990-04-09 1997-08-19 Europaisches Laboratorium Fur Molekularbiologie 2'-O-alkylnucleotides as well as polymers which contain such nucleotides
US5766849A (en) * 1989-07-11 1998-06-16 Gen-Probe Incorporated Methods of amplifying nucleic acids using promoter-containing primer sequence
US5824517A (en) * 1995-07-24 1998-10-20 Bio Merieux Method for amplifying nucleic acid sequences by strand displacement using DNA/RNA chimeric primers
US6251590B1 (en) * 1998-03-11 2001-06-26 Exonhit Therapeutics S.A. Differential Qualitative screening
US6358712B1 (en) * 1999-01-05 2002-03-19 Trustee Of Boston University Ordered gene assembly
US20050014169A1 (en) * 1999-09-24 2005-01-20 Ambion, Inc. Nuclease inhibitor cocktail

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5916777A (en) * 1995-06-07 1999-06-29 Gen-Probe Incorporated Enzymatic synthesis of oligonucleotides using 3'-ribonucleotide primers
US6380377B1 (en) * 2000-07-14 2002-04-30 Applied Gene Technologies, Inc. Nucleic acid hairpin probes and uses thereof

Patent Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US40715A (en) * 1863-11-24 Improvement in locomotive-tenders
US5766849A (en) * 1989-07-11 1998-06-16 Gen-Probe Incorporated Methods of amplifying nucleic acids using promoter-containing primer sequence
US5658731A (en) * 1990-04-09 1997-08-19 Europaisches Laboratorium Fur Molekularbiologie 2'-O-alkylnucleotides as well as polymers which contain such nucleotides
US5824517A (en) * 1995-07-24 1998-10-20 Bio Merieux Method for amplifying nucleic acid sequences by strand displacement using DNA/RNA chimeric primers
US6251590B1 (en) * 1998-03-11 2001-06-26 Exonhit Therapeutics S.A. Differential Qualitative screening
US6358712B1 (en) * 1999-01-05 2002-03-19 Trustee Of Boston University Ordered gene assembly
US20050014169A1 (en) * 1999-09-24 2005-01-20 Ambion, Inc. Nuclease inhibitor cocktail

Also Published As

Publication number Publication date
US20030215924A1 (en) 2003-11-20
US7393635B2 (en) 2008-07-01

Similar Documents

Publication Publication Date Title
EP3169781B1 (en) Compositions and methods for nucleic acid assembly
US9834774B2 (en) Methods and compositions for rapid seamless DNA assembly
AU724922B2 (en) Recombinational cloning using engineered recombination sites
US6143557A (en) Recombination cloning using engineered recombination sites
US7223576B2 (en) Recombinational cloning using engineered recombination sites
US5514568A (en) Enzymatic inverse polymerase chain reaction
US7435572B2 (en) Methods and compositions for DNA manipulation
US20010049125A1 (en) End-complementary polymerase reaction
CA3068615C (en) Dna production method and dna fragment-joining kit
US20100267147A1 (en) Site-directed mutagenesis in circular methylated dna
WO2017139412A1 (en) Improved cloning and expression vectors and systems
US20080262212A1 (en) Ribocloning: Recombinant DNA Construction using Primers with RIBO Bases
Walker et al. A method for generating sticky-end PCR products which facilitates unidirectional cloning and the one-step assembly of complex DNA constructs
EP3759243B1 (en) Methods and compositions for enriching nucleic acids
JP4854160B2 (en) DNA ligation method
US20040248131A1 (en) Methods for dna mutagenesis and dna cloning
US20050153338A1 (en) Method for obtaining circular mutated or chimeric polynucleotides
Glass et al. 6 Site-Directed Mutagenesis
AU2007202518A1 (en) Methods and compositions utilizing nucleic acids
AU2004201501A1 (en) Recombinational cloning using engineered recombination sites
JP2003038177A (en) Method for preparing library of dna having modified target base sequence

Legal Events

Date Code Title Description
STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION