US 5633439 A Résumé A gene promoter sequence has been isolated and characterised from the plant gene encoding the enzyme cinnamyl alcohol dehydrogenase (CAD), an enzyme which participates in the biosynthesis of lignins. The promoter may be used to control expression of exogenous genes placed under its control. Genes controlled by the CAD promoter is inducible by wounding. Revendications 1. A DNA construct for use in transforming plant cells which comprises an exogenous coding sequence under the control of upstream promoter and downstream terminator sequences, characterised in that the upstream promoter is a promoter of a cinnamyl alcohol dehydrogenase gene having a nucleotide sequence comprising the first 2765 nucleotides of SEQ ID NO:1. 2. An isolated cinnamyl alcohol dehydrogenase gene promoter, having the nucleotide sequence comprising the first 2765 nucleotides of SEQ ID NO:1. 3. The cinnamyl alcohol dehydrogenase gene promoter which is present in the clone designated gNtCAD9-6.3SH which has been deposited at the National Collections of Industrial and Marine Bacteria (NCIB), at 23 St. Machar Drive, Aberdeen AB2 1RY, Scotland, on 2nd Apr. 1992 under the reference NCIB Number 40499. 4. Plants and plant cells transformed with a construct claimed in claim 1. 5. A recombinant plant genome comprising a cinnamyl alcohol dehydrogenase gene promoter having a nucleotide sequence comprising the first 2765 nucleotides of SEQ ID NO:1, said promoter being located to drive expression of an exogenous gene. Description The invention will be further described with reference to the following drawings, in which: FIGS. 1A and 1B show a restriction map of gNtCAD9 and a diagram of the structure of the CAD gene; FIGS. 2A-2E, taken together, show the nucleotide sequence of the CAD promoter and the CAD structural gene, most of which is contained in the 6.4 kb SalI-HindIII fragment of gNTCAD9 (SEQ ID NO:1). FIG. 3 outlines a scheme for construction of the plant transformation vector pNtCAD9Prom-GUS1. 1.1 Isolation of CAD genes A tobacco genomic library (N.tabacum cv NK 326) was purchased from Clontech. This library contains MboI partially digested genomic DNA cloned into lambda EMBL3. The library was screened with the pTCAD14 cDNA insert and positive phages were purified by four successive cycles of plaque purification. Four positive clones were isolated. Restriction fragment mapping and DNA sequence analysis of these clones indicated that all 4 clones are overlapping clones of the CAD gene and are related. Only clones 2 and 9 contain promoter sequences and only clone 9 was characterised in detail. A restriction map of this clone is shown in FIG. 1. 1.2 Characterisation of the CAD gene promoter sequence A 6.4 kb SalI-HindIII fragment was isolated from gNTCAD9 and the nucleotide sequence covering 2765 bp of the 5'-flanking (promoter) sequences and most of the coding sequences has been determined (FIG. 2). Primer extension experiments place the transcription start point at nucleotide position 2766. Full sequence data of about 6.8 kb have been obtained of a tobacco CAD gene contained on clone gNtCAD9. The following are thereby confirmed: (A) Transcription start site mapped to position 2766 from the upstream Sal 1 border, now designated position +1, placing the ATG start codon at +110 (B) Position and exact size of the four introns: (1) at +198, size 149 bp; (11) at +312, size 1290 bp; (111) at +540, size 563 bp; (IV) at 980, size 632 bp. The intron position and sizes differ from the ones in ADH genes. (C) Three nucleotide mismatches to cDNA cNtCAD14, which are all silent with respect to the deduced protein. They can be ascribed to cultivar differences between cDNA and genomic library. 1.3 Fusion of CAD promoter to the GUS reporter gene A XbaI site at position +84 was used to isolate the CAD promoter from gNtCAD9 and create a transcriptional fusion of 2849 bp of promoter and leader sequences to the GUS reporter gene in pBI 101.4. The promoter fragment was isolated after partial XbaI digest due to a second XbaI site in the promoter. Correct fusion and fusion borders were confirmed by restriction analysis and DNA sequencing. 1.4 Construction of plant transformation vector--pCAD-gus The plasmid subclone gNtCAD9-6.4SH containing the 6.4 kb SalI-HindIII fragment was digested with SalI and partially digested with XbaI to recover a 2853 bp SalI-XbaI fragment, which contains all of the available CAD promoter sequence and 87 bp of leader sequence. This promoter fragment was inserted into the appropriately cut polylinker of the promoterless GUS cassette of the binary plant transformation vector pBI101.4 in the 5'-3' orientation (FIG. 3). The correct insertion has been confirmed by DNA sequencing of the fusion borders. The vector pNtCAD9Prom-GUS1 (from Example 1.4) is transferred to Agrobacterium tumefaciens LBA4404 (a micro-organism widely available to plant biotechnologists) and was used to transform tobacco plants. The fusion construct was introduced into Agrobacterium tumefaciens LBA 4404. Tobacco cv. SR1 leaf discs were transformed via cocultivation with Agrobacteria harbouring the construct. Transgenic shoots were rooted and further propagated by standard procedures. Transformation of tobacco leaf disks follows established methods. Transformed plants were identified by their ability to grow on media containing the antibiotic kanamycin. Plants were regenerated and grown to maturity. The tissue-specific and developmental expression and expression in response to external stimuli of the β-glucuronidase (GUS) gene as determined by the CAD gene promoter is demonstrated by analysis of stems, roots, leaves, seeds, flowers, pollen and in response to wounding and ethylene treatment for GUS enzyme activity. From 20 transformants regenerated 11 have been analysed in some detail. Quantitatively (fluorometric analysis), GUS activity is highest in roots followed by stems and leaves. Histochemical staining by X-gluc indicates strong expression in the vascular system of stems and leaves preferentially in the developing xylem, where lignification is known to occur. No activity was detectable in pith or epidermal tissue. However, leaf and stem hairs ((trichomes)) exhibit considerable GUS expression in certain stages of their development. One example is the region around axillary buds, where strong staining of trichomes was observed. Upon wounding of stems a local induction of promoter activity was seen during the development of a wound plug but only 10-20 days after wounding.
__________________________________________________________________________SEQUENCE LISTING(1) GENERAL INFORMATION:(iii) NUMBER OF SEQUENCES: 1(2) INFORMATION FOR SEQ ID NO:1:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 6877 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA (genomic)(vi) ORIGINAL SOURCE:(A) ORGANISM: Nicotiana tabacum(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:GTCGACCTGCAGGTCAACGGATCATATATTATGTGTCTTTACCTATACTATTATCACTAA60ATCAATAAATGTCTAACTGCAATGATCGTGTTAAATTGTGTATCAGAGAATTGAGTGACT120GATATATAGTAGGCATTTGAAAGTTGAAAGATGAATTTCACACTAAACTCAGATAAGATG180ATTTTGTGGGGTAGGCATTTGATTAAATGCAAAACCTACTCTCATGAATGTCAGTTTAAC240AACACAATCAACCAAATGAATTCTAAAAACAAGAATTTTACTGGGGAAAAAAACGTTTCG300AATAAATAAGAATATCGTAAAATTAATATTAACCAACAAATTTGCATTGGTTATAACTTA360TAATCACGTGAAATGATTTGTACCAATACCTTATTTGGATCCAAAGCCTGGCTAATTTGT420TTCTTACCTTCTTTTGCACAAGCAACCTCTTTTTAGCTTCTTCTACCTATATTACCTACT480AACTTTTAAGAGTCCAAAACCTAAAATAAATCAAAAGTTTTTTTTAAAAAAAAAAAAAAA540AAAAAAAAAACCTTACCTAAAACATGACGATCTAGTGACGCATACTTCCACCTAACCCCG600GGGGACCCAAACTGCTTGTCCAGAACAATTAATGCTTTCTTTTAGGAAGTTATCATTCAC660ATAATTCATCTAGGCCTGTGATAAAGATAATTGGTCATTATTGGAAAAGTCGTCTCACGT720AGGAAGAGATTGCTAAACTAGAATTTGAAATTTGAGTCCTCTGAATTTGACGTCGAATTC780ACTGCATATTTTAATTACTGAGTTCATAATTATATATTAGTATAAATTTAATTGATTCTC840TCGTATAAATATAGACTTTATGCAAAAGCTACGAGTTCGATCAAACCCGTAAATAATATG900TTACCTCCGTTTCCTAGTAGGAAGACAGAAACAAATATCAAAAAGAAAGGAAAAAAACAT960TTCACACTCTACGTACCTTTCTATAATTTCAAAATAAAAGTTGGTGAAAGGGAAAAATGG1020TTAGAGGAAAAATAAGATAGGAGAGAACAGAAACTATGTATTCGTAAGGAATTTAAAATT1080AAAATATATTAATTTTGTTTTACAAGTTATTTAAGAACTTTAGAAGACGAATAACAACAA1140TGTTTTTTTTCTGTTTTAGTAATTTTCATAACATATGAACTAAATGCTCTTTTAAAAAGT1200TTTTAGGGAAAAGAAAAACGAAAAATTAAAGTGGTTGTATCAAGAAAGCAAAACATATGA1260TCAGATTTTCCGGCATATTTATAGGATTATTAACGATGGTTTACTCAGTTACAAGGTTCC1320CGAGAAATTAATTTTGAAAATATTAACAGAAAAAAGCCCAAATAAACACTTTTTTCTTTA1380AGATTTATTTATTTAGGCCTCGTTAGTTTGCATGGAGGTTTGAATCTTAATCATTCAGAT1440CTCAGATATTGACTGCGTTTCTTTTTAAGTATAAATCTTAATTATTCAGATCTTAATCAT1500TAAATTTTTTTAAACCACTGAATGAGTCTGAAATCTGAATAGGTCTTATTGATTACGATT1560TATAACAGAGACTTAATTTTATTAAGATGTTATCATCCATATTCACTACTAACCACCGCC1620ATTATCACCTACCACCATGCACCATCCAACCAATACCAAACTCAACCACCACCAAATTCA1680AACACCATCACTAACCACCACTATCTCACTGCTATCATTATCGACTACCATCACCTCCAA1740CCCCACCATTATCGATTACCATCACCCACCACCCCATAATTATCAACTAATACCACTACC1800ATCAATCACAAACATCTATCCACTCACCTCAACTACTACCATCAACCCCCCCACCACCAT1860AATCAACCATAGCTACCATTGTCCTCCACGCCACCATCACCTTCCTCGACCATAACTACT1920ACTACCCAATCACCACTAGTTATTACTTGGAACCATCACCAACCGCCGCCTCCAGTCGGA1980TCCATAAGCCTCACCGTCAACCATCACTACACCAACTATCATATTATTTTTCAAAAATAT2040ATTTATTATTAATAGAATATTAAATTAATTAATATTTTATTTGAATTTTTTATTTATTAT2100TTTTAGATAATGATAAATTTTATACATTCAGATGTTGAAAATCAAACAGTCTTAATCATT2160TAGTATTCATATATTAATATATATCTTAAATAATCAGATGTCTATTCTGATTCAAACGTT2220TTAATCTTAATACACATCTTAATATTTACATGTCTCTTTATCTTTAAATAAACAAATGAG2280GCCTTAGCTGTCTTCACATAATTCTTTATTGCTGTGCTATTAATGAGTACGAATTAGTAA2340TTCTCTTAACGAACAGTGAGTAGTTTGCTAACTTTATATTCGTTTATTGTACGTATATTG2400TGTATTATAAGAATAAAAAAATATTTAGCACTTATTTGGTTAGTATTAATTTCCACGGAC2460ATTTTTAAAGCATATTTTCCAAGCTGTATCTATTTTTTTTTCCTTCCTCTCATCTCAAGA2520TGCAAGTGTCATTTAATTTGTACAACATGTCGATTAATATAGTGATTACAATTATTACCT2580TACTGTTCACGTATAGGTTGGAAATATAATATAAGCATCTACTCAATCCAATTATAAAAC2640TTGATGTCTATATCTTAGCTACTGAGCAAAAAATCAACTTTTGTAAATTCTAGAAGAAAC2700GCCACCCAACCTCTGTCTTCCCCTTCTTTAAACTATATATATGTGGTGTTATTAACCAAA2760CTGTACTAAAATAGCTCACCACTATTCCTTTCTCTTTCCCTTGAACTGTGTTTTCGTTTT2820TTCTGCTCTAAAACAATAGTGTGTTCCTTCTAGATTTTAAGTTTAAAGAACATCATGGGT2880GGCTTGGAAGTTGAGAAAACAACTATTGGTTGGGCTGCTAGAGACCCTTCTGGTGTACTT2940TCACCTTATACCTATACTCTCAGGTACATTACATTACTACTTATGTTCTTTCTATAATCG3000TAATATCCGAATCAGCTTATGCTTACCTCGACTACTTATTTTTATCTTATAATAACTATT3060CTACCAATTTTAAGATGAGTTATGAACTTTGTTTTTTGTTTTTCATGTCCAGAAACACAG3120GACCTGAAGATGTGGAAGTCAAAGTTTTGTATTGTGGGCTCTGCCACACTGATCTTCACC3180AAGTTAAAAATGATCTTGGCATGTCCAACTACCCTCTGGTTCCTGGGTATTTGCTCTTCC3240CTCTCTATTTTCCCTGTTTTTTCTCTCTCTCTATATATATATATAAAACATAATTTGAGA3300GTTCAAGTTTTGTGGACAAAATGAGGATCACTATTGATCCCCTAAGGATGGAGGAAAATT3360GATTAATTAGAAGAGAAACAAGAGTTTGACAGTAATTTTTTCAAGGATAATTTAACTTGT3420TTTAGCATAGGTTGTTGCAGTATTCTTGAGATTACGAATTTCATTTATGATAAATACTTG3480TAAGTATATTTTAAGTGATCTGATAGCTAGAAATTCTTTACACGCTTTTAAATATATGAA3540TGTTAAAATTCTCCTACAATGGTACCCTTTGAATCTTTGTTTGATGTCAATTTCAGTTTT3600TTCCTTAGCCACTGAATAAATCAAGAGAAATGTAGTGGTCCTTGTGCCTTTTAGTACCAA3660TCCACCATCCTCGGTGACTTAATAAATTTGCAACTGTTAGTTGTTAGGATTTGATTTATT3720ATTCCAAATGTCTTTTTTTCCTTCCTTTATTAAACGAATGATGAGTACTATTGAATTGTT3780TAATTAGGAGTTGTGGCAGACCACGTATTTTCGTGGCCTAAATGCCAAAGCAAACATATA3840ATAACGTACGACTAAGTTCACTTCTTTCATTGGATTTGTAAAAGTTGTTGGTGACACTTA3900CGTTTTGTTCGAATCCAATGCTATTATTGTTAGATAAATTTTTACTTTTAGTCCCTAAAA3960TTATTGATAAGTTATAATTTTAATCCTTGTACTATTTGGCGAAGTACATTTAGTCTTCAA4020TTTAATTAAAATTAGACATTTGATCCTGCTTCTGCTTGTGAATCTTCACAAAGTTAATCA4080ATTATGAATTCATGAATTATGTTAAATTTGTGTTGTTACTCCCTATCTAAGGATACTAGA4140GTTCTAATTCATAAGTAGCGGTGGTAAAATAGATAAAAATAATAATTATCCATTCATTTT4200ATCCACTAAAAAATAAATAACCAATGAATTTAACTTTTATATTTACAAACCCTTAATTGA4260AGGGTTTCTCAAGTTTGAGATACTAAGAATTCTCTCAAAAGTAATCATATTGAAGAAGTT4320ATGAATCATATGTATATCCATATTATCTGTCAATTAACTATTTTTTATCCATATTAAATA4380TAGATAAGGTTGAATATTATATTTATTAGACGCCCATTTGTCACCCCTATAATCACAATT4440GCAATATCCCTTTTGTTTTTTACTATGTGTTGATCCTTATCCCTTTGTAACTTCATATTT4500GTGGTGAATGATGTAGACATGAAGTGGTGGGAGAAGTGGTGGAGGTAGGACCAGATGTGT4560CAAAATTCAAAGTGGGGGACACAGTTGGAGTTGGATTACTCGTTGGAAGTTGCAGGAACT4620GTGGCCCTTGCAAGAGAGATATAGAGCAATATTGCAACAAGAAGATTTGGAACTGCAATG4680ATGTCTACACTGATGGCAAACCCACCCAAGGTGGTTTTGCTAAATCCATGGTTGTTGATC4740AAAAGTAAGTCTTTTACCCTTCCATATATATAGAGAAGTACCTTTCTTTAATATTAACTT4800ATAGCAAGTGACATTGTATATAAGTTACACCCTGTAAATTAAAGAAACTATCAGTATAAC4860TTACCTGTCGTAATAGGTTGGTTGCCTTATTTTGAGGTAATTAGTTTTACTTATTGTGGA4920CAGAGCTACAACTATTTAGATAATAGGATGGTATAAAACAATTTCTACACTATCATTGTG4980TTTGTTCAACTCTTTTTTAAATCCATTGGGTATCGAATCATGACAAATGTTACTAGGACG5040ATCAAGAAATCATGTAGGGCAGCCCTGTACACTAAGCTCGCGCTATGCGGTCCGGGGAAA5100GTCGGACCACAAAGGTATATTGTATGTAGTCTAACCCTGCATTTCTGCAGAGGTGCTCGA5160ACCCGTATCCTCTTTGGTCACATGGTAATAACTTAACCAGTTACGCCAAGGTTCCCCTTC5220AAGAAACCATATAATTAAAGTGGTTAATTCACATTTCTTGAATTAAAAGATCACAATGGA5280CTGAATGTTATTTTGCCTTGTATATAGGTTTGTGGTGAAAATTCCAGAGGGTATGGCACC5340AGAACAAGCAGCACCTCTATTATGTGCTGGTATAACAGTATACAGTCCATTGAACCATTT5400TGGTTTCAAACAGAGTGGATTAAGAGGAGGAATTTTGGGATTAGGAGGAGTGGGACACAT5460GGGAGTGAAAATAGCAAAGGCAATGGGACATCATGTTACTGTCATTAGTTCTTCAAATAA5520GAAGAGACAAGAGGCATTGGAACATCTTGGTGCAGATGATTATCTTGTCAGTTCAGACAC5580TGATAAAATGCAAGAGGCTTCTGATTCACTTGACTATATTATTGATACTGTCCCTGTTGG5640CCATCCTCTTGAACCTTATCTTTCTTTGCTTAAAATTGATGGCAAACTTATCTTGATGGG5700AGTTATCAACACCCCCTTGCAATTTATCTCCCCCATGGTTATGCTCGGTAAGTCATTTAA5760CTTATTTACGCTGACAGTGTAACACGTTCGGACGAAATGCATTATTACAACAAGTTAAAA5820TTGGTTTCTAACAATATATCGTGTTAGTACTTGCTCTAAAAAGTCGATTGAAAATTTAAA5880CGTTGAATTTGTCTATATATGAAAAAAGATAGAACAAAAGGATTGGAAGAGTGGTCATTT5940TAGTCAATGAAAGCCATGATTTGTTGAAATATGCAGGTGCCATTGGTCTATTTTTGCGGC6000ATAATAATGTTATGAGCAGAATTAATATATAGACAAATTCTAGGCTTGTAGGGTTGTGTT6060ATTTAAGGAACCATGTCTGCAATAATGGACTGCAATAACAACAGAGACCATACACGTATT6120AAAGCCAATGTATTTGATTAACATTTGTTTAATGCAACCTCTTATTACTATTATGTTTTA6180AGATTTTTTAAGCACAGACAGTGTGTAAGTTTTTTTATACCATCAAGCAAAGTTGATATA6240TTCCGAAAAGAAAAGTTGATGTACAATAATAGATAACATTTCATTAGTGTGGTATGGTAA6300TTTGAAAGTAGTACTCGGTATAATTTTTCATTTTACATTGTCGGCGTATATAACTTTTAG6360ACTTTATTATTATGATCAGGGAGAAAGAGCATCACAGGAAGCTTTATTGGTAGCATGAAG6420GAAACAGAGGAAATGCTAGATTTCTGCAAAGAGAAAGGTGTGACTTCACAGATTGAGATA6480GTGAAAATGGATTATATCAACACTGCAATGGAGAGGTTGGAGAAAAATGATGTGAGGTAC6540AGATTTGTGGTTGATGTTATTGGAAGCAAGCTTGACCAGTAATTATATTACACAAGAAAA6600ACAACATGGAATGGTTCACTATTATACAAGGCTGTGAGAATACTAAACTTTGATGTCGTC6660TTTTGTATCCTTTTGTTTTATTTGCCACCTGTATTTTCTTATTTGGTGATCGAGAGTGAC6720GTTTATGTATTATTTTCTTTCTTCAAAACAATTTAATGTATGAATTTGGATGTTGGTGAC6780GATTTTGAAATATACCAACCAAAACTTTGTTTGGTACGTGAAGCTATCTCCACTTCTCGT6840GACTAGGGTGTCGATCCATCTTTAAATCGATTAACCG6877__________________________________________________________________________ The present invention relates to the regulation of gene expression in transgenic plants. In particular it is concerned with the isolation and use of DNA sequences which control the expression of genes in lignifying tissues and in response to pathogen attack. The ability to isolate and manipulate plant genes has opened the way to gain understanding about the mechanisms involved in the regulation of plant gene expression. This knowledge is important for the exploitation of genetic engineering techniques to practical problems such as the expression of genes in genetically manipulated crop plants exhibiting improved quality and production characteristics. Many examples have been reported in the literature of plant DNA sequences which have been used to drive the expression of foreign genes in plants. In most instances the regions immediately 5' to the coding regions of genes have been used in gene constructs. These regions are referred to as promoter sequences. They may be derived from plant DNA; or from other sources, e.g., viruses. It has been demonstrated that sequences up to 500-1000 bases in most instances are sufficient to allow for the regulated expression of foreign genes. The provide a promoter sequence suitable for the control of foreign gene expression in plants. According to the present invention there is provided a DNA construct for use in transforming plant cells which comprises an exogenous coding sequence under the control of upstream promoter and downstream terminator sequences, characterised in that the upstream promoter is or has functional homology to a promoter of a gene of the lignin biosynthesis pathway. Thus, the present invention comprises the use of the promoter(s) of the cinnamyl alcohol dehydrogenase or other genes involved in the lignin biosynthesis pathway to control the expression of novel and exogenous proteins and genes in these tissues. Preferably, the promoter is the CAD promoter. The clone gNtCAD9-6.3SH contains the promoter fragment of this gene. This clone has been deposited at the National Collections of Industrial and Marine Bacteria (NCIB), at 23 St. Machar Drive, Aberdeen AB2 1RY, Scotland, on 2nd Apr. 1992 under the reference NCIB Number 40499. We further provide novel plant cells, and plants transformed with constructs according to the present invention. We illustrate the invention hereinafter using tobacco as a model plant species. The constructs can be used in the expression of exogenous genes and proteins in vascular tissues, particularly but not exclusively, such as poplar, eucalyptus, pine, and other woody plants as well as forages such as festuca, alfalfa, maize, sorghum, penesitum, amongst others. Not only will this promoter be expressed in types of regulation exemplified include tissue-specificity, regulation by external factors such as light, heat treatment, chemicals, hormones, and developmental regulation. However, it has also been shown that sequences much longer than 1 kb may have useful features which permit high levels of gene expression in transgenic plants. These experiments have largely been carried out using gene fusions between the promoter sequences and foreign structural genes such as bacterial genes, etc. This has led to the identification of useful promoter sequences. In the work leading to the present invention we have identified a gene which expresses an enzyme involved in biosynthesis of lignin in vascular plants. We have shown that this gene encodes cimmamyl alcohol dehydrogenase (CAD) which is one of the enzymes specific to the lignin branch pathway of phenylpropanoid metabolism. The gene in question is encoded by the cDNA clone pTCAD19 among others which are the subject of our published copending International Patent Application Number WO 93/05159. The enzyme encoded by the CAD gene catalyses the oxidation of cinnamyl aldehydes to cinnamyl alcohols which are the direct precursors of the lignin polymer. We have isolated the gene encoding this enzyme from tobacco. We have shown that CAD mRNA is expressed throughout plant development with the highest levels found in lignifying tissues. In these tissues the CAD enzyme can be found in high concentration in the xylem of plants. An object of the present invention is to modified plants in a given tissue but it will also be induced in response to environmental and endogenous signals such as wounding, infection, ethylene production and others. Promoters for use in the invention may be derived from genes such as methyl transferase, and cinnamyl CoA reductase. Such promoters may be isolated from genomic libraries by the use of cDNA probes, as has been done in the case of CAD. We particularly prefer to use the promoter of the CAD gene. The downstream (3') terminator sequences may also be derived from the CAD gene or they may be derived from other genes. Many possibilities are available from the literature: the selection of the terminator being of rather lesser importance. By the term `exogenous coding sequence` we mean a sequence of DNA, other than that which follows the promoter region in the natural CAD gene, that is adapted to be transcribed into functional RNA under the action of plant cell enzymes such as RNA polymerase. Functional RNA is RNA which affects the biochemistry of the cell: it may for example be mRNA which is translated into protein by ribosomes; or antisense RNA which inhibits the translation of mRNA complementary (or otherwise related) to it into protein. In principle any exogenous coding sequence may be used in the present invention. Where the exogenous coding sequence codes for mRNA for a protein, this protein may be of bacterial origin (such as enzymes involved in cell wall modification and cell wall metabolism), of eukaryotic origin (such as pharmaceutically active polypeptides) or of plant origin (such as enzymes involved in the synthesis of phenolic compounds, ethylene synthesis, sugar metabolism, cell wall metabolism,), or genes or parts thereof in sense and antisense orientation. A wide variety of exogenous coding sequences is known from the literature, and the present invention is applicable to these as well as many others yet to be reported. As well as functional mRNA, the exogenous gene may code for RNA that interferes with the function of any kind of mRNA produced by the plant cell: for example, antisense RNA complementary to mRNA for genes such as stilbene synthesis, phytoalexin synthesis and flavour and pigment synthesis. Of particular interest is the ability of the CAD gene promoter to respond to exogenous stimuli. The construction of vectors and constructs of the present invention will be described in more detail in the Examples below. For convenience it will be generally found suitable to use promoter sequences (upstream--i.e. 5'--of the coding sequence of the gene) of between 100 and 2000 bases in length. A particularly preferred embodiment of the invention is a promoter for use in the expression of exogenous genes in plants, comprising the promoter of cinnamyl alcohol dehydrogenase. More particularly the promoter of the invention comprises the nucleotide sequence shown in FIGS. 2A-2E, taken together (SEQ ID NO:1). The invention includes modifications or the use of only parts of the said sequence which, while retaining sufficient homology to the said sequence in order to maintain functionality, enhance or alter its tissue-specificity or response to external stimuli. The invention further provides a recombinant gene construct comprising, in sequence, a promoter according to this invention, a coding region and a gene terminator. The invention further comprises a recombinant plant genome containing the said construct. Plant cells may be transformed with constructs of the invention according to a variety of known methods (Agrobacterium Ti plasmids, electroporation, microinjection, microprojectile bombardment, etc). The transformed cells may then be regenerated into whole plants in which the new nuclear material is stably incorporated into the genome. Both transformed monocot and dicot plants may be obtained in this way. The transformation and regeneration methods employed are not particularly germane to this invention and may simply be selected from those available from the literature. Examples of genetically modified plants according to the present invention include tomatoes, fruits such as mangoes, peaches, apples, pears, strawberries, bananas and melons; and field crops such as maize (corn), sunflowers, sugarbeet, canola, and small grained cereals such as wheat, barley and rice, ornamental plants such carnations, petunias, roses, chrysanthemums etc. Plants produced by the process of the invention may contain more than one recombinant construct. As well as one or more constructs containing the cinnamyl alcohol dehydrogenase promoter, they may contain a wide variety of other recombinant constructs, for example constructs having different effects on plant development, structure and defense. In particular, constructs which affect lignin structure, composition and quality and quantity, cellulose and hemicellulose structure and amount, and plant defense genes are included in this invention. Of particular interest is the ability of the CAD gene promoter to respond to exogenous stimuli. Thus, a further aspect of the present invention is a process of activating exogenous coding sequences in plants under the control of the CAD promoter which comprises the application of exogenous stimuli such as viruses, fungi and bacteria, as well as ethylene and other chemicals. This may find particular use when the expression of novel characters in the plant may need to be controlled exogenously. We now describe the isolation of genomic clones from a tobacco genomic library encoding the cinnamyl alcohol dehydrogenase gene and related sequences. Genomic clones representing one of the closely related CAD genes found in tobacco have been isolated and characterised by DNA sequence analysis. The clone gTCAD9 represents the whole of the gene with exon sequence identical to the clone pTCAD14 with only two mismatches. The genomic clones described in the Examples cover all of the coding region and the complete transcriptional initiation region of the CAD gene. The subclone gNTCAD9-6.3SH contains approximately 2800 bp of the promoter fragment of this gene. Citations de brevets
Citations hors brevets
Référencé par
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||