US6096862A

US6096862A - Multimeric antiviral agent

Info

Publication number: US6096862A
Application number: US08/318,039
Authority: US
Inventors: Jeffrey M. Greve; Alan McClelland
Original assignee: Bayer Corp
Current assignee: Bayer Healthcare LLC
Priority date: 1990-07-20
Filing date: 1994-10-04
Publication date: 2000-08-01
Anticipated expiration: 2017-08-01
Also published as: EP0468257A1; ZA915678B; IE912552A1; EP0987329A2; DK0468257T3; EP0987329A3; KR100208847B1; EP0468257B1; JPH04297499A; FI913470A0; KR930002511A; GR3031768T3; DE69131564D1; AU652567B2; PT98394A; FI105687B; ES2134762T3; JP3091527B2; ATE184049T1; IL98866A0

Abstract

Multimeric antiviral agents comprising two or more monomers selected from the group consisting of monomers of transmembrane intracellular adhesion molecule-1 (tmICAM-1) and truncated intercellular adhesion molecule-1 (tICAMs), with the proviso that when said multimer is a dimer said monomers cannot both be tmICAM-1, wherein each of said monomers comprises the human rhinovirus (HRV) binding site and retains the ability to bind to HRV and reduce infectivity thereof, and wherein said multimeric antiviral agent mimics the multimeric configuration of tmICAM-1 and exhibits enhanced binding to said HRV relative to at least one of the constituent monomers.

Description

This application is a continuation of application U.S. Ser. No. 08/159,076 filed Nov. 29, 1993, now abandoned, which is a continuation of U.S. Ser. No. 07/977,589 filed Nov. 17, 1992, abandoned, which is a continuation of U.S. Ser. No. 07/556,238 filed Jul. 20, 1990, abandoned.

BACKGROUND OF THE INVENTION

The present invention relates to novel multimeric configurations and forms of intercellular adhesion molecule (ICAM), including both full length and truncated forms of these proteins, that effectively bind to human rhinovirus and can effectively reduce HRV infectivity.

Full length ICAM, also known as human rhinovirus receptor (HRR), is termed transmembrane ICAM (tmICAM-l); non-transmembrane ICAM forms, also known as truncated ICAM (tICAM), are less than full length. When in a multimeric configuration, preferably as dimers, these proteins display enhanced binding of human rhinovirus (HRV) and are able to reduce HRV infectivity. In addition, these multimerized proteins may also be used to reduce infectivity of other viruses that are known to bind to the `major` group human rhinovirus receptor (HRR), such as coxsackie A virus, and may also be used to block transmembrane intra-cellular adhesion molecule (tmICAM) interaction with lymphocyte function-associated antigen-1 (LFA-1) critical to many cell adhesion processes involved in the immunological response. Lastly, these multimerized proteins may be used to study the ICAM-1/HRV interaction especially with respect to designing other drugs directed at affecting this interaction.

Human rhinoviruses are the major causative agent of the common cold. They belong to the picornavirus family and can be classified based on the host cell receptor to which they bind. Tomassini, et al., J. Virol., 58: 290 (1986) reported the isolation of a receptor protein involved in the cell attachment of human rhinovirus. Approximately 90% of the more than 115 serotypes of rhinoviruses, as well as several types of coxsackie A virus, bind to a single common receptor termed the "major" human rhinovirus receptor (HRR); the remaining 10% bind to one or more other cell receptors.

Recently, Greve, J. et al., Cell, 56:839 (1989), co-authored by the co-inventors herein, identified the major HRR as a glycoprotein with an apparent molecular mass of 95,000 daltons and having an amino acid sequence essentially identical to that deduced from the nucleotide sequence of a previously described cell surface protein named intercellular adhesion molecule (ICAM-1). Simmons, D. et al., Nature, 331:624 (1988). Staunton, et al., Cell, 52:925-933 (1988). Subsequently, Staunton, D. E., et al., Cell, 56:849 (1989), confirmed that ICAM-1 is the major surface receptor for HRV. See also, Staunton, et al., Cell, 61:243-254 (1990).

ICAM-1 (number according to Staunton et al., 1988) is an integral membrane protein 505 amino acids long [SEQ ID NO: 1, encoded by nucleotides 138-1653 of SEQ ID NO:2] and has: i) five immunoglobulin-like extracellular domains at the amino-terminal end (amino acid residues 1-453), ii) a hydrophobic transmembrane domain (454-477), and iii) a short cytoplasmic domain at the carboxy-terminal end (478-505). ICAM-1 is a member of the immunoglobulin supergene family and functions as a ligand for the leukocyte molecule, lymphocyte function associated molecule-1 (LFA-1), a member of the integrin family. Heterotypic binding of LFA-1 to ICAM-1 mediates cellular adhesion of diverse cell types and is important in a broad range of immune interactions; induction of ICAM-1 expression by cytokines during the inflammatory response may regulate leukocyte localization to inflammatory sites. The primary structure of ICAM-1 has been found to be homologous to two cellular adhesion molecules, i.e., neural cell adhesion molecule (NCAM) and mylein-associated glycoprotein (MAG).

Several approaches to decreasing infectivity of viruses in general, and of rhinovirus in particular, have been pursued including: i) developing antibody to the cell surface receptor for use in blocking viral binding to the cell, ii) using interferon to promote an anti-viral state in host cells; iii) developing various agents to inhibit viral replication; iv) developing antibodies to viral capsid proteins/peptides; and v) blocking viral infection with isolated cell surface receptor protein, that specifically blocks the viral binding domain of the cell surface receptor.

Using this latter approach, Greve, et al., Cell, 56:879 (1989), supra, reported that purified tmICAM-1 could bind to rhinovirus HRV3 in vitro. Unpublished results with HRV2, HRV3, and HRV14 demonstrate a positive correlation between the ability to bind to rhinovirus and the ability to neutralize rhinovirus particularly if the binding studies are carried out under conditions where ICAM-1 is presented in a particular form and configuration as discussed further, infra. Results (unpublished) using HRV14 and HRV2 demonstrate a positive correlation between the receptor class of the virus and the ability to bind to tmICAM-1 in vitro. That is, ICAM-1, being the major receptor, can bind to HRV3, HRV4, and other "major" receptor serotypes and neutralize them, while it does not bind or neutralize HRV2, a "minor" receptor serotype. Further studies (unpublished), using purified tmICAM-1, demonstrate that it effectively inhibits rhinovirus infectivity in a plaque-reduction assay when the rhinovirus is pretreated with tmICAM-1 (50% reduction of titer at 10 nM receptor and one log reduction of titer at 100 nM receptor protein). These data were consistent with the affinity of rhinovirus for ICAM-1 of Hela cells, which had an apparent dissociation constant of 10 nM, and indicated a direct relationship between the ability of the receptor to bind to the virus and to neutralize the virus.

Because large-scale production of tmICAM-1 is not presently economically feasible, and because maintenance of tmICAM-1 in an active form requires the use of detergents, alternate means of producing a receptor protein for use as a rhinovirus inhibitor are desirable. Forms of the tmICAM-1 cDNA gene have been developed (as well as cell lines that produce the expression products; U.S. Ser. No. 390,662, now abandoned) that have been genetically altered to produce truncated ICAM-1 molecules. These truncated forms of ICAM-1 (tICAM(453) and tICAM(185)) lack the transmembrane region and are secreted into the cell culture medium. They bind to rhinovirus in the assay described in Greve, et al., Cell, 56:879 (1989), supra, although at substantially reduced levels relative to tmICAM-1. Thus, their effectiveness as inhibitors of rhinoviral infectivity appeared to be less than that of tmICAM-1. See generally co-pending applications, U.S. Ser. No. 130,378, now abandoned; U.S. Ser. No. 262,570; U.S. Ser. No. 262,428, now abandoned; U.S. Ser. No. 239,571, now abandoned; and U.S. Ser. No. 390,662, now abandoned.

U.S. Ser. No. 239,571 filed Sep. 1, 1988 and its CIP applications U.S. Ser. No. 262,428, now abandoned and U.S. Ser. No. 390,662, now abandoned are directed to the use of transmembrane rhinovirus receptor as an inhibitor of rhinovirus infectivity using non-ionic detergent to maintain the transmembrane protein in solution and directed to truncated intercellular adhesion molecules (tICAM) having extracellular domains 1, 2, 3, 4, and 5 of transmembrane intercellular adhesion molecules (tmICAM) and which truncated forms do not require the presence of non-ionic detergent for solubilization;

U.S. Ser. No. 130,378 filed Dec. 8, 1987 and its CIP application U.S. Ser. No. 262,570, now abandoned are directed to transfected cell lines which express the major rhinovirur receptor (HRR) and to the indentification of HRR as intercellular adhesion molecule; and

U.S. Ser. No. 301,192, now U.S. Pat. No. 5,235,049 filed Jan. 24, 1989 and its CIP application U.S. Ser. No. 449,356, abandoned are directed to a naturally occurring soluble ICAM (sICAM) related to but distinct from tmICAM in that this sICAM lacks the amino acids spanning the transmembrane region and the cytoplasmic region; in addition this sICAM has a novel sequence of 11 amino acids at the C-terminus.

Subsequently, Marlin, S.D., et al., Nature, 344:70 (1990), reported the construction and purification of a truncated soluble form of the normally membrane bound ICAM-1 molecule which they termed sICAM-1. It has both the transmembrane domain and the cytoplasmic domain of the protein deleted and differs from the wild-type amino acid sequence by a single conservative substitution at its carboxyl end. It is composed of residues 1-452 of ICAM-1 and of a novel phenylalanine residue at the C-terminus. These workers demonstrated that sICAM-1 was required at levels >50 μg/ml to prevent the binding of HRV14 virus to cells. However, they also found that sICAM-1 at 1 μg/ml (18 nM), when continually present in the culture medium, was able to inhibit by 50% the progression of an infection by HRV54. The inhibitory activity was correlated with the receptor class of the virus, in that coxsackie A13 but not poliovirus or HRV2 was inhibited; infectivity data for HRV14 was not reported, however. Thus, they did not demonstrate a direct correlation between binding and inhibition of infectivity. Further, as discussed in greater detail, infra, attempts to reproduce the results obtained by Marlin, et al. have not been successful and have suggested that a higher concentration of the truncated form of ICAM (10-fold higher than transmembrane ICAM) is required to produce a 50% reduction in viral titer.

To date, no one has been able to demonstrate an agent that binds to and effectively reduces infectivity of human rhinovirus (by blocking viral infection with isolated cell surface receptor protein) as effectively as tmICAM-1; accordingly there continues to exist a need in the art for a form of ICAM-1 that can effectively bind to human rhinovirus and can effectively reduce HRV infectivity.

BRIEF SUMMARY OF THE INVENTION

Provided by the invention are multimeric configurations of transmembrane ICAM (tmICAM-1) as well as multimeric configurations of non-transmembrane ICAM (tICAM). Non-transmembrane ICAM is also known as truncated ICAM, i.e, ICAM substantially without the carboxyl intracellular domain and without the hydrophobic membrane domain and includes but is not limited to the forms of tICAM(453) and tICAM(185). Non-transmembrane forms of ICAM can include functional derivatives of ICAM and mutein forms of tICAM to facilitate coupling. When the truncated ICAM forms are in a multimeric configuration, preferably as dimers, they display enhanced binding of human rhinovirus and are able to reduce viral infectivity. The different forms of ICAM, transmembrane and non-transmembrane, can be multimerized by adsorption to a support. This support can be made of materials such as nitrocellulose, PVDF, DEAE, lipid polymers, as well as amino dextran, or a variety of inert polymers that can adsorb or can be coupled to tICAM, either with or without a spacer or linker.

Multimeric ICAM can also be multimerized by coupling the ICAM to for example, an antibody, a protein carrier, or a cross-linking reagent. An example of an antibody includes anti-ICAM antibody, CL 203; suitable protein carriers include albumin and proteoglycans; and suitable cross-linking reagents include heterobifunctional and homobifunctional cross-linking reagents such as bifunctional N-hydroxysuccinimide esters, imidoesters, or bis-maleimidohexanes. To facilitate coupling, the ICAM can be modified at either the carboxyl end or the the amino end with a reactive amino acid residue such as lysine, cysteine, or other amino acid residue(s) that provide a site(s) to facilitate coupling. These types of modified ICAM are referred to as muteins. In addition, the ICAM can be modified at either termini to comprise a lipid capable of promoting formation of oligomer micelles. The ICAM comprising the multimeric ICAM can be either fully glycosylated, partially glycosylated, or non-glycosylated.

Also provided by the invention are methods for enhancing binding of ICAM and functional derivatives thereof to a ligand, i.e., human rhinovirus, and "major" group receptor viruses, lymphocyte function-associated antigen-1 (LFA-1), plasmodium falciparum (malaria) and the like, wherein the ICAM is presented in a form and a configuration to the ligand and wherein the binding of the ICAM to the ligand is enhanced. The ICAM form can either be transmembrane or non-transmembrane (truncated). Truncated ICAM is ICAM substantially without the carboxyl intracellular domain and without the hydrophobic membrane domain. Preferred truncated forms of ICAM include tICAM(453) and tICAM(185). The ICAM can be modified at either the carboxyl terminus or the amino terminus to enhance multimeric ICAM formation. These modifications can include the addition of reactive amino acid residues such as lysine, cysteine, or other amino acid residue(s) that provide a site(s) to facilitate coupling. The nucleotide sequence for the ICA14 of the method can be contained in a vector, such as a plasmid, and the vector can be introduced into a host cell, for example eukaryotic or prokaryotic cells. The preferred eukaryotic cell is a mammalian cell, i.e., Chinese Hamster Ovary cells; the preferred prokaryotic cell is E. coli.

The preferred configuration of the ICAM of the method is multimeric, dimeric being most preferred. The multimeric configuration can comprise a first ICAM cross-linked to a second ICAM or can comprise ICAM adsorbed to a support to thereby generate a multimeric configuration. The support can be high molecular weight and substantially inert polymers such as nitrocellulose, PVDF, DEAE, lipid polymers, and amino-dextran, or a variety of polymers that can adsorb and can be coupled to ICAM, either with or without a spacer or linker. The multimeric ICAM can be multimerized by coupling to for example, an antibody, a protein carrier, or a cross-linking reagent. Preferred cross-linking reagents include heterobifunctional and homobifunctional cross-linking reagents such as bifunctional N-hydroxysuccinimide esters, imidoesters, a bis-maleimidohexanes; preferred protein carriers include albumin and proteoglycans; an example of a preferred antibody includes CL 203 and any other antibodies that do not interfere with HRV binding.

Also provided by the invention are novel pharmaceutical compositions comprising a pharmaceutically acceptable solvent, diluent, adjuvant or carrier, and as the active ingredient, an effective amount of a polypeptide characterized by having human rhinovirus binding activity and reduction of virus infectivity.

Other aspects and advantages of the present invention will be apparent upon consideration of the following detailed description thereof which includes numerous illustrative examples of the practice of the invention.

DETAILED DESCRIPTION

As noted, supra, tmICAM-1 isolated from mammalian cells has the capacity to neutralize human rhinoviruses belonging to the major receptor group, but only if maintained in solution with detergent. Certain soluble fragments of ICAM-1 have been found to have a reduced capacity for binding virus and do not reduce infectivity as effectively as tmICAM-1. To date, no one has been able to ascertain the reason for this reduced capacity.

It has been proposed by others that the rhinovirus receptor exists on cells in a pentameric form. Tomassini, J., and Colonno, R., J. Virol., 58:290-295 (1986). However, quantitation (unpublished results of the co-inventors herein) of the rhinovirus and anti-ICAM-1 monoclonal antibody binding to Hela cells has revealed a maximum of 30,000 virions bound per cell (determined by the binding of ³⁵ S methionine-labeled HRV) and 50,000-60,000 ICAM-1 molecules per cell (determined by the binding of radio-labeled Mab to ICAM-1). These results prompted further studies to examine the possibility that rather than five, only between 1 and 2 ICAM-1 molecules on the surface of cells are bound per HRV particle bound to the cell.

Genetically engineered forms of truncated ICAM-1 that lack the C-terminal transmembrane domain and that are secreted into the culture medium of mammalian cells transfected with the recombinant gene. The purification of two of these secreted ICAM molecules, tICAM(453) and tICAM(185), from spent culture medium of cells stably transfected with the genes therefor, is described below. In a solution-HRV binding assay and in an HRV neutralization assay, it was found that tICAM(453) has substantially reduced (approximately 200fold) avidity for HRV relative to tmICAM-1. However, when either tmICAM-1 or tICAM(453) or tICAM(185) is first adsorbed to any one of a number of insoluble supports, such as nitrocellulose, PVDF (polyvinylidene difluoride), or DEAE (diethylaminoethyl) membranes, and then incubated with radioactive HRV, the virus-binding activity of tICAM(453) becomes comparable to that of tmICAM-1. This binding of multimeric tICAM(453) or of multimeric tICAM(185) to HRV has the same properties as the binding of HRV to ICAM-1 on Hela cells: it is inhibited by anti-ICAM-1 Mabs, it is specific for rhinoviruses of the major receptor group, and has the same temperature dependence as the binding of rhinovirus to cells (i.e., binds well at 37° C. and undetectably at 4° C.).

As used herein, the following abbreviations and terms include, but are not necessarily limited to, the following definitions.

______________________________________                                    
Abbreviation                                                              
          Definition                                                      
______________________________________                                    
ICAM      Intercellular adhesion molecule - may                           
   be used to denote both full length                                     
   (transmembrane) and truncated (non-                                    
   transmembrane) forms of the protein.                                   
  ICAM-1 Intercellular adhesion molecule-1, also                          
   known as ICAM, tmICAM-1; denoting the                                  
   full length transmembrane protein                                      
  tmICAM-1 Transmembrane intercellular adhesion                           
   molecule-1, also known as human rhino-                                 
   virus receptor (HRR)-requires e.g.,                                    
   detergent conditions to be solubilized                                 
  sICAM-1 A naturally occurring soluble ICAM-1                            
   having both the transmembrane and the                                  
   cytoplasmic domain of ICAM-1 deleted;                                  
   amino acids 1-442 plus 11 novel amino                                  
   acids; distinguishable from Staunton,                                  
   et al. tICAM453 which consists of amino                                
   acids 1-453 with the terminal tyrosine                                 
   replaced with phenylalanine.                                           
  tICAM Truncated intracellular adhesion                                  
   molecule, also known as non-transmembrane ICAM.                        
  tICAM(453) Truncated form of ICAM - extracellular                       
   amino terminal domain of ICAM; having                                  
   the transmembrane domain and                                           
   cytoplasmic domain of ICAM-1 deleted;                                  
   also referred to as sICAM-1 by Marlin, et al.                          
  tICAM(185) Truncated form of ICAM - extracellular                       
   amino terminal domain of ICAM having                                   
   the transmembrane domain and                                           
   cytoplasmic domain of ICAM-1 deleted.                                  
______________________________________

"Multimerization" and "multimeric" include, but are not limited to dimerization and dimeric, and include any multimeric configuration of the ICAM-1 molecule, or fragment thereof, that is effective in reducing viral binding and infectivity;

"transmembrane" generally means forms of the ICAM-1 protein molecule which possess a hydrophobic membrane-spanning sequence and which are membrane bound;

"non-transmembrane" generally means soluble forms of the ICAM-1 protein including so-called "truncated" forms of the protein that, rather than being membrane bound, are secreted into the cell culture medium as soluble proteins, as well as "transmembrane" forms that have been solubilized from cell membranes by lysing cells in non-ionic detergent;

"truncated" generally includes any protein form that is less than the full length transmembrane form of ICAM;

"form" is generally used herein to distinguish among full length and partial length ICAM forms; whereas "configuration" is generally used to distinguish among monomeric, dimeric, and multimeric configurations of possible ICAM forms;

all forms and configurations of the ICAM-1 molecule, whether full length or a fragment thereof, including muteins, whether monomeric or multimeric, may be fully or partially glycosylated, or completely unglycosylated, as long as the molecule remains effective in reducing viral binding and infectivity;

"ligand" is generally used herein to include anything capable of binding to at least one of any of the forms and configurations of ICAM and includes, but is not limited to, human rhinovirus, other viruses that bind to the "major" group human rhinovirus receptor, lymphocyte function-associated antigen-1, and plasmodium falciparum (malaria); and

"human rhinovirus" generally includes all human serotypes of human rhinovirus as catalogued in Hamparian, V., et al., Virol., 159:191-192 (1987).

The following examples illustrate practice of the invention.

Example 1 relates to growth, purification and assay of rhinoviruses;

Example 2 relates to production and isolation of monoclonal antibodies to ICAM-1;

Example 3 relates to construction of non-transmembrane truncated forms of ICAM cDNA from full length ICAM-1 cDNA;

Example 4 relates to transfection of mammalian-cells and expression of non-transmembrane truncated forms of ICAM cDNA;

Example 5 relates to isolation and purification of non-transmembrane truncated forms of ICAM-1;

Example 6 relates to radioactive labeling of tmICAM-1, tICAM(185), and tICAM(453) and demonstration of retained capacity for binding to monoclonal antibodies;

Example 7 relates to human rhinovirus binding assays of transmembrane and of transmembrane truncated forms of ICAM-1;

Example 8 relates to CL203 IgG antibody-mediated cross-linking of tICAM(453);

Example 9 relates to multimerization of transmembrane and of non-transmembrane truncated forms of ICAM-1;

Example 10 relates to infectivity-neutralization assay of multimeric transmembrane and of multimeric non-transmembrane truncated forms of ICAM-1; and

Example 11 relates to use of multimeric forms of transmembrane and truncated forms of ICAM-1, as effective inhibitors of ICAM/FLA-1 interaction.

EXAMPLE 1

Growth, Purification and Assay of Rhinoviruses

Rhinoviruses were grown, purified, and assayed essentially as described in Abraham, G., et al., J. Virol., 51:340 (1984) and Greve, et al., Cell, 56:839 (1989). The serotypes chosen for these studies include HRV14, the standard in the field, and HRV3, which has an approximately 10-fold higher affinity for ICAM than does HRV14. HRV2, which binds to the "minor" receptor rather than the "major" receptor, was used as a negative control.

Rhinoviruses HRV2, HRV3, and HRV14 were obtained from the American Type Culture Collection, plaque purified, and isolated from lysates of infected HeLa-S3 cells. Purified rhinovirus was prepared by polyethylene glycol precipitation and sucrose gradient sedimentation. Viral purity was assessed by SDS-PAGE analysis of capsid proteins and by electron microscopy. Infectivity was quantitated by a limiting dilution infectivity assay scoring for cytophathic effect, essentially as described by Minor, P. D., Growth, assay and purification of picornaviruses, In Virology: A Practical Approach, B. W. J. Mahy, ed (Oxford:IRL Press), pp. 25-41.

EXAMPLE 2

Production and Isolation of Monoclonal Antibodies to ICAM-1

BALB/cByJ female mice were immunized by intraperitoneal injection of 107 intact HeLa cells in 0.5 ml of phosphate-buffered saline (PBS) three times at 3 week intervals. Two weeks later the mice were bled and aliquots of serum were tested for protective effects against HRV14 infection of HeLa cells. Positive mice were boosted by a final injection of 10⁷ HeLa cells, and 3 days later spleen cells were fused to P3X63-Ag8.653 myeloma cells (Galfre, et al., Nature, 266:550-552 (1977)) to produce a total of approximately 700 hybridoma-containing wells. Each well was tested by incubating 3×10⁴ HeLa cells in 96-well plates with 100 μl of supernatant for 1 hr at 37° C.; the cells were then washed with PBS, and a sufficient amount of HRV14 was added to give complete cytopathic effect in 24-36 hr. Wells that were positive (protected from infection) were scored at 36 hr.

Cells were removed from wells which scored positive in the first screen and cloned by limiting dilution in 96-well microtiter plates. Supernatants from these wells were tested in the cell protection assay and positive wells were again identified. Further clonings were performed until all of the hybridoma containing wells were positive indicating a clonal population had been obtained. Four cloned cell lines, and their corresponding antibodies, were obtained and were designated c78.1A, c78.2A, c78.4A, c78.5A, c92.1A and c92.5A, respectively.

C92.1A was deposited on Nov. 19, 1987 with the American Type Culture Collection, 12301 Parklawn Drive, Rockville, Md. 20852 and was designated HB 9594.

EXAMPLE 3

Construction of Non-Transmembrane Truncated Forms of ICAM cDNA from Full Length ICAM-1 cDNA

A. Preparation of ICAM-1 cDNA

Randomly primed cDNA was synthesized from poly A+RNA from HE1 cells using an Amersham™ cDNA synthesis kit under conditions recommended by the supplier. PCR amplification was performed using 100 ng of cDNA for 25 cycles using primers PCR 5.1:

(ggaattcATGGCTCCCAGCAGCCCCCGGCCC)                          [SEQ ID NO:3] and

PCR 3.1: (ggaattcTCAGGGAGGCGTGGCTTGTGTGTT)                 [SEQ ID NO:6].

Amplification cycles consisted of 94° C. 1 min, 55° C. 2 min, and 72° C. 4 min. The product of the PCR reaction was digested with EcoR1 and cloned with EcoR1 digested phage vector λGT10 (Stratagene™). Recombinant phage clones were screened by plaque hybridization using ICAM-1 specific oligonucleotides:

GAGGTGTTCTCAAACAGCTCCAGCCCTTGGGGCCGCAGGTCCAGTTC (ICAM1)    [SEQ ID NO:5]

and

CGCTGGCAGGACAAAGGTCTGGAGCTGGTAGGGGGCCGAGGTGTTCT (ICAM3)    [SEQ ID NO:6].

A positive clone designated XHRR4 was selected and purified. The insert was removed by EcoR1 digestion and subcloned into the EcoR1 site of Bluescript KS+. This clone was designated pHRR2. The entire insert was sequenced and found to contain the entire ICAM-1 coding sequence beginning with the initiator ATG codon and ending with the TGA stop codon as specified by the PCR ICAM-1 sequence (Simmons, et al., Nature, 331:624 (1988); Staunton, et al., Cell, 52:925-933 (1988) [SEQ ID NO:2]) except for a single substitution of A 1462 for G. This same change was identified in several independent clones and thus represents a polymorphism of the ICAM-1 gene.

B. Construction of tICAM-1(453) and tICAM(185)

Modified forms of the ICAM-1 cDNA were created by PCR amplification reactions (Saiki, et al., Science, 230:1350-1354 (1985)) using the full length ICAM-1 cDNA clone pHRR-2 as template. The plasmid DNA was digested with EcoR1 to excise the ICAM-1 insert and treated with alkaline phosphatase to prevent re-circularization of the vector in subsequent ligation steps. Ten ng of template DNA was subjected to 10 cycles of PCR amplification using oligonucleotide primers PCR5.5 and PCR3.3 for tICAM-453 and PCR5.5 and 3.10 for tICAM-185 under the following conditions:

______________________________________                                    
Temperature (° C.)                                                 
                Time (mins)                                               
______________________________________                                    
94              1                                                         
  55 2                                                                    
  72 1.5                                                                  
  71 4 (final extension)                                                  
______________________________________

PCR5.5 has the sequence:

GGAATTCAAGCTTCTCAGCCTCGCTATGGCTCCCAGCAGCCCCCGGCCC          [SEQ ID NO:7]

which consists of EcoR1 and HindIII sites, 12bp ICAM-1 5' untranslated sequence, and the first 24 bp encoding the signal peptide.

PCR3.3 has the sequence:

GGAATTCCTGCAGTCACTCATACCGGGGGGAGAGCACATT                   [SEQ ID NO:8]

which consists of EcoR1 and Pst1 sites, a stop codon, and 24 bp complementary to the bases encoding the last 8 extracellular amino acids of ICAM-1 (residues 446-453).

PCR3.10 has the sequence:

TTCTAGAGGATCCTCAAAAGGTCTGGAGCTGGTAGGGGG                    [SEQ ID NO:9]

which consists of Xba1 and BamH1 sites, a stop codon, and 23 bp complementary to the bases encoding residues 178-185 of ICAM-1.

The PCR reaction products were digested with EcoR1 (tICAM(453)) or EcoR1 and BamH1 (tICAM(185)) and cloned into the polylinker site of Bluescript™ SK+ (Stratagene). Clones containing the desired inserts were verified by restriction analysis and DNA sequencing. The inserts were excised from Bluescript™ by digestion with HindIII and XbaI and inserted into the expression vector CDM8 (Seed, Nature, 239:840 (1987) at the HindIII and XbaI sites. A clone containing the tICAM(453) insert designated pHRR-8.2 and a clone containing the tICAM(185) insert designated pHRR23-13 were selected and subjected to extensive sequence analysis. This verified the existence of the desired stop codons, and the integrity of the selected regions of ICAM-1 coding sequence.

These plasmids were transfected into COS cells using the DEAE-dextran techniques and the cells were cultured 72 hr. before assay. Surface expression was monitored by FACS using indirect immunofluorescence and a monoclonal antibody specific for ICAM-1. Transient expression in COS cells and immunoprecipitation of metabolicaly labelled (³⁵ S cysteine) cell supernatants with c78.4A Mab (monoclonal antibody) demonstrated the production of soluble ICAM-1 fragments of 45 kd and 80 kd from pHRR23-13 and pHRR8.2, respectively. The preparation of stable Chinese Hamster Ovary cell transfectants is described below in Example 4.

C. Modified Non-glycosylated Transmembrane ICAM-1 Molecules

A modified full length ICAM-1 was made by simultaneous mutagenesis of N-103, N-118, N-156 and N-175 each to Q. This removes all four N-linked glycosylation sites from the extracellular D2 domain of the ICAM-1 molecule. The resultant molecule, referred to as non-glycosylated transmembrane ICAM, was expressed on the surface of COS cells and was able to bind radio-labeled HRV3 at levels comparable to unmodified ICAM-1. This result demonstrated that glycosylation of domain 2 (the first 184 amino acids) is not required for virus binding to ICAM-1.

It is expected that non-transmembrane ICAM can be similarly modified to yield modified non-glycosylated non-transmembrane ICAM-1 molecules.

D. Construction of Genetically Engineered Forms of Non-Transmembrane (Truncated) ICAM-1 Containing Reactive Residues Suitable for Cross-Linking to Form Multimers

A molecule consisting of the 453 amino acid extracellular domain of ICAM-1 with the addition of a novel lysine residue at the C-terminus was constructed by PCR modification of the pHRR-2 cDNA as described above. The primers used were PCR5.5 (described, supra) and PCR 3.19 which has the sequence:

TTCTAGAGGATCCTCACTTCTCATACCGGGGGGAGAGCACATT                [SEQ ID NO:10]

and consists of XbaI and BamHI sites, a stop codon, a Lys codon, and 24 bases complementary to the sequence encoding amino acid residues 446 to 453. Following cloning into the CDM8 vector, production of tICAM-453K was confirmed by transient expression in COS cells. Stable CHO cell lines were generated by co-transfection with pSV2-DHFR as described previously.

The same strategy was used to add a Lys residue to the C-terminus of tICAM(185) using PCR5.5 and PCR3.20 which has the sequence:

TTCTAGAGGATCCTCACTTAAAGGTCTGGAGCTGGTAGGGGGC                [SEQ ID NO:11]

and consists of XbaI and BamHI sites, a stop codon, a Lys codon, and 24 bases complementary to the sequence encoding residues 178 to 185. Transient COS cell expression confirmed the production of tICAM-185 and stable CHO cell lines were derived as described previously.

Three modified forms of tICAM(1-452) that each contain an additional Cys residue were constructed by site directed mutagenesis of the full length ICAM-1 cDNA. In each construct a stop codon was introduced by changing E-453 GAG to TAG. The C-terminus is thus Y-452. Residues N-338, T-360, and Q-387 were each separately mutated to Cys using a second site directed mutagenesis. The presence of the desired mutations were confirmed by DNA sequencing.

The residues selected for mutation to Cys were selected based on a computer generated plot of surface probability which predicts surface exposure of these regions. Also, T-360 is in close promimity to N-358 which is a site of potential N-linked glycosylation. Each of the three Cys modifications was expressed and secreted into the medium of transfected COS cells. Examination of the proteins under reducing and non-reducing conditions showed no indication of the presence of dimers. It is anticipated that cross-linking reagents reactive with sulfhydryl groups can be used to cross-link the Cys modified tICAM forms to obtain multimeric forms.

EXAMPLE 4

Transfection of Cells and Expression of Non-Transmembrane Truncated Forms of ICAM cDNA

A. Transfection of Eukaryotic Cells

Chinese Hamster Ovary (CHO) cells deficient in dihydrofolate reductase (DHFR) were obtained from Cutter Labs (Berkeley, Calif.). The cells were co-transfected with the plasmid pSV2 DHFR which contains the mouse dihydrofolate reductase (DHFR) gene under control of the SV40 promoter, and with tICAM-453, or tICAM-184 constructs in the CDM8 vector (Seed and Aruffo, PNAS, 84:3365-3369 (1987)).

Transfections were done using both electroporation and calcium phosphate methods. Bebbington, supra. Transfected DHFR-positive cells were selected by growth on nucleoside-free media, and pools of transfectants were cloned by limiting dilution.

Cell lines that secrete tICAM were identified by testing culture supernatants with a two-site radioimmune assay (RIA) for ICAM using Mabs c78.4A and c78.5A as follows. A monoclonal antibody against one epitope on ICAM (for example, Mab c78.4A) was adsorbed to plastic 96-well plates (Immunlon plates, Dynatech Inc.), excess binding sites on the plates blocked with bovine serum albumin (BSA), and then culture supernatants incubated with the plates. The plates were then washed and incubated with ¹²⁵ I-Mab (directed against a second epitope on ICAM for example, c78.5A), and, after washing, the amount of bound ¹²⁵ IgG determined. The concentration of tICAM was determined by comparing RIA data from unknowns against a standard curve of tm-ICAM at known concentrations. Positive clones were expanded and expression of tICAM forms was confirmed by immunoprecipitation of metabolically labeled cell supernatants with Mab c78.4A.

Cell lines CT.2A (tICAM(453)) and CD12.1A (tICAM(185)) were selected for further study and were subjected to gene amplification in methotrexate containing media as described by Bebbington, et al., supra. A clone derived from CT.2A resistant to 100 nM methotrexate and a CD12.1A clone resistant to 1 μM methotrexate were used for purification of soluble truncated ICAM-1 proteins.

B. Transfection of Prokaryotic Cells

Because glycosylation of the viral binding domain of ICAM is not required to retain viral binding (as demonstrated in Example 3C), it is anticipated that prokaryotic cells, such as E. coli, can be successfully transfected to produce functional proteins.

EXAMPLE 5

Isolation and Purification of Non-Transmembrane Truncated Forms of ICAM-1

Monoclonal antibody affinity chromatography with c78.4A-Sepharose™ has been previously described in co-pending U.S. Ser. No. 130,378 and Greve, et al., Cell, 56:839-847 (1989). tICAM secreted into serum-containing media required additional purification steps due to the high level of contaminating protein in the serum. Before elution from the Mab-affinity column, the column was washed with 1 M NaCl to remove loosely-bound proteins. For tICAM(453), the partially purified tICAM(453) eluted from the c78.4-Sepharose™ column was dialysed into 10 mM Tris (pH 6.0), absorbed onto a mono-Q™ column (Pharmacia), and eluted with a 0-0.3 M NaCl gradient. tICAM184 was further purified by gel filtration on a Superose-12™ column.

It is also recognized that non-transmembrane truncated forms of ICAM-1 may be purified using standard ion exchange methodology without using monoclonal antibody affinity chromotography.

EXAMPLE 6

Radioactive Labeling of tmICAM-1, tICAM185, and tICAM453 and Demonstration of Retained Capacity for Binding to Monoclonal Antibodies

The epitopes reactive with monoclonal antibodies c78.4A and c78.5A are conformationally-dependent epitopes and thus can be used as analytical probes for confirming retention of the native ICAM structure. Known amounts of purified ICAM were incubated with c78.4A or c78.5A IgG-Sepharose™ and the fraction of the radioactivity bound determined. These experiments showed that the purified tmICAM-1, tICAM(185), and tICAM(453) completely retained the ability to bind to these monoclonal antibodies.

Transfectants were metabolically labeled with ³⁵ S cysteine, and cell lysates (for transmembrane ICAM) or culture supernatants (for truncated ICAM) were prepared and incubated with c78.4A IgG-Sepharose™ beads. The beads were washed and adsorbed proteins were eluted with SDS and analysed by SDS-PAGE; see Greve, et al., Cell, 56:839-847 (1989)). It was found that the isolated proteins were quantitatively bound to the c78.4A and c78.5A Mabs.

Accordingly, the tICAM(185) and tICAM(453) both have retained native ICAM structure.

EXAMPLE 7

Human Rhinovirus Binding Assays of Transmembrane and of Non-Transmembrane Truncated Forms of ICAM-1

Described below are three binding assays used to assess binding activity of the various forms of ICAM.

A. Pelleting Assay

[³⁵ S]cysteine-labeled tmICAM-1 or tICAM was mixed with HRV3 in 100 μl of 10 mM HEPES (pH 7.5), 150 mM NaCl, 1 mM MgCl₂, 1 mM CaCl₂, 0.1% Triton X-100. The mixture was incubated for 30 min. at 37° C., cooled on ice, layered on top of a cushion of 200 μl of 10% glycerol, 0.2 M triethanolamine (pH 7.5), and centrifuged in a Beckman air-driven centrifuge at 134,000×g for 30 min. at 4° C. The top 275 μl was removed, and the pellet was analyzed by SDS-PAGE and scintillation counting. Silver-staining of SDS gels of control experiments indicated that essentially all of the HRV3 is pelleted under these conditions and essentially all of the ICAM remains in the supernatant. The results are shown in Table 1.

              TABLE 1                                                     
______________________________________                                    
ICAM         % ICAM Pelleted*                                             
______________________________________                                    
tmICAM-1     11.6%                                                        
  tICAM(453) 1.0%                                                         
  tICAM(185) 4.3%                                                         
______________________________________                                    
 *average of 4 experiments; these numbers cannot be directly converted int
 relative affinities

These data show that both truncated forms of ICAM bind to rhinovirus, but at levels substantially reduced relative to that of tmICAM.

B. Solution Binding Assay

To obtain quantitative information on the relative affinity of tmICAM and tICAM fragments in solution, a solution competition assay was developed in which soluble tmICAM or soluble tICAM fragments were used to inhibit the binding of ³⁵ S HRV3 to previously immobilized ICAM-1; nonionic detergent (Triton X-100) was included in the buffers so that the different proteins could be compared under identical conditions. First, tmICAM-1 (isolated in the presence of 0.1% octylglucoside instead of Triton X-100) was diluted 10-fold into a Tris/NaCl buffer and allowed to adsorb to the walls of a microtiter plate (Immunlon-4, Dynatech) overnight. Nonspecific binding sites on the plate were then blocked with 10 mg/ml BSA and binding experiments performed in 0.1% Triton X-100/1 mg/ml BSA/Tris/NaCl. Approximately 20,000 cpm of ³⁵ S HRV3 were mixed with varying amounts of ICAM either tmICAM, tICAM(453) or tICAM(185), incubated for 1 hour at 37° C., and then added to wells of the microtiter plates and incubated for 3 hr at 37° C. The plates were washed and the bound radioactivity determined.

As shown in Table 2, tmICAM-1 inhibits virus binding half-maximally at low concentrations (.008 μM) while tICAM(453) and tICAM(185) inhibit at much higher concentrations (2.8 μM and 7.9 μM, respectively; or 350 to almost 1000 fold higher than tmICAM.

              TABLE 2                                                     
______________________________________                                    
ICAM         IC.sub.50 *                                                  
______________________________________                                    
tmICAM       8.0 ± 3.3 nM (N = 3)                                      
  tICAM(453) 2.8 ± 0.6 μM (N = 3)                                   
  tICAM(185) 7.9 ± 2.8 μM (N = 3)                                   
______________________________________                                    
 *IC.sub.50 is the concentration of soluble ICAM needed to inhibit HRV3   
 binding by 50%.

These data confirm and extend the earlier observations that tICAM(453) and tICAM(185) do bind to rhinovirus but with lower affinities than does tmICAM-l and provide evidence that the virus binding site is encompassed within the two N-terminal domain (185 residues) of ICAM-1.

C. Dot-Blot Assay

An alternative method of measuring binding activity was utilized in which tmICAM-1, tICAM(453), or tICAM(185) were adsorbed to nitrocellulose filters, the non-specific binding sites on the filters blocked with 10 mg/ml bovine serum albumin (BSA), and radioactive virus or ¹²⁵ I Mab to ICAM-1 incubated with the filter for 60 mins at 37° C. The filters were washed with buffer and the filters exposed to X-ray film.

The amount of radioactivity bound to the filters was determined by densitometry of the autoradiograms, and the data is expressed as HRV3 binding (in arbitrary units) normalized to the amount of ICAM bound to the blot by a parallel determination of the amount of ¹²⁵ Mab c78.4A or c78.5A bound to the ICAM (bound to the blot). The results are shown in Table 3.

              TABLE 3                                                     
______________________________________                                    
Binding of .sup.35 S HRV3 to Immobilized ICAM*                            
  ICAM          tICAM(453)                                                
                          ratio ICAM/tICAM453                             
______________________________________                                    
1.2 ± 1.1                                                              
            0.52 ± 0.45                                                
                      2.3                                                 
______________________________________                                    
 *Average of 5 experiments. Data is expressed in arbitrary densitometric  
 units of .sup.35 S HRV3 binding/.sup.125 I antiICAM Mab binding.

Additional studies with tICAM 185 have been initiated. Binding experiments have demonstrated equivocal results. It is anticipated that steric hinderance may play a role. The size of the virus is approximately 30 nanometers. The length of tICAM(185) is less than 10 nanometers. The use of a spacer or linker would provide better accessibility for binding.

The results from this experiment indicate that under these assay conditions tICAM(453) is capable of binding rhinovirus at levels comparable to those of tmICAM-1 when the amount of virus bound was normalized to the amount of ¹²⁵ I MAb bound. Further, these results indicate that the tICAM forms are capable of binding to rhinovirus, but that the binding avidity is dependent upon the configuration of the tICAM. tmICAM-1 may be a small multimer (probably a dimer) and presentation of tICAM in a multimeric form mimics this multimeric configuration.

Evidence supporting this hypothesis comes from quantitative binding studies (unpublished), in which the ratio of the maximum number of rhinovirus particles and the maximum number of antibody molecules that can be bound to cells is approximately 1.5, as discussed supra. This is in contrast to the earlier work of Tomassini, J., et al., J. Virol., 58:290 (1986), which suggested a complex of five molecules needed for binding. Their conclusion was based on an erroneous interperation of gel filtration data that failed to take into account bound detergent molecules.

EXAMPLE 8

CL203 IgG Antibody-Mediated Cross-Linking of tICAM(453)

To provide additional evidence that the higher relative binding activity of tmICAM-1 is due to a multimeric form of the protein, the tICAM(453) protein was pre-incubated with CL203, a monoclonal antibody to ICAM-1 that does not inhibit virus binding to ICAM-1 and binds to a site C-terminal to residue 184 Staunton, et al., Cell, 56:849 (1989) and Cell, 61:243 (1990). Thus, the antibody can effectively "cross-link" two molecules of tICAM(453), to create "dimers" of tICAM(453), yet without blocking the virus-binding site on each of the two molecules of tICAM(453). When a mixture of CL203 IgG and tICAM(453) at a 4:1 weight ratio was tested in the competition assay, it was found that the antibody cross-linked tICAM(453) inhibited HRV3 binding at a concentration 7.4-fold lower than tICAM(453) alone consistent with the idea that tmICAM-1 binds with higher affinity to rhinovirus because it is a dimer or a small multimer.

To create alternative multimeric forms of tICAM, several further modified truncated forms of ICAM were constructed as described, supra, in Example 3. These forms can then be multimerized as described in Example 9, below.

EXAMPLE 9

Multimerization of Transmembrane and Non-Transmembrane Truncated Forms of ICAM-1

There are several ways that tICAM can be converted to a multimeric form having enhanced viral binding and neutralization activity over the monomeric form. For example, tICAM(453) can be coupled to an inert polymer, such as amino dextran (MW 40,000) using homobifunctional (such as N-hydroxy succinimide (NHS) esters) or heterobifunctional (such as those containing NHS-ester and photoactivatable or sulfhydryl-reactive groups) cross-linking reagents utilizing the amino group on the amino dextran and an amino or other group on the tICAM. A number of examples of appropriate cross-linking reagents can be found in the Pierce Chemical Company catalog (Rockford, Ill.).

As tICAM is poorly reactive with NHS-ester-based compounds, a tICAM with a genetically engineered C-terminal lysine residue (see Example 3) would have improved coupling efficiency to supports with homobifunctional reagents whereas genetically engineered C-terminal cysteine residues would facilitate coupling by heterobifunctional reagents such as sulfo-maleimidobenzoyl-N-hydroxysuccinimide ester (MBS).

Alternatively, soluble tICAM multimers can be created by genetically engineering reactive residues into the C-terminal end of tICAM. For example, free cysteine residues can be created in relatively hydrophilic sequences in the C-terminal region of tICAM (which would have a greater tendency to be solvent-exposed). It is anticipated that this would allow for the creation of dimers in situ; alternatively, monomers could be purified and dimers created in vitro by disulfide exchange.

Another approach requires the placement of lysine residues at similar positions and cross-linking purified protein in vitro with homobifunctional NHS-esters. Examples of such lysine residues are residues 338, 360, 387.

Crosslinking cysteine residues to each other can be accomplished by reaction of tICAM with free cysteine groups with bis-maleimidohexane (Pierce Chemical Co.) or other bis-maleimido-analogs. Cross-linking free cysteine residues on tICAM to amino groups on carrier molecules can be accomplished by reaction with m-maleimidobenzoyl-N-hydroxysuccinimide ester. Crosslinking amino groups on tICAM molecules can be accomplished with homobifunctional N-hydroxysuccinimide esters (for examples, see Pierce Chemical Co. catalog). Alternatively, the carbohydrate groups on tICAM can be oxidized to aldehydes and coupled to hydrazine-activated amino groups on a carrier molecule.

EXAMPLE 10

Infectivity-Neutralization Assay of Transmembrane and Non-Transmembrane Truncated Forms of ICAM-1

Three different assays for virus infectivity have been used. These different assays take into account the differences in transmembrane ICAM and non-transmembrane solubilities.

A. Plaque-reduction Assay in the Presence of Detergent

The results of this assay indicate what the highest dilution of virus is that will still be effective in killing cells. Virus is pre-incubated with transmembrane ICAM protein in the presence of 0.1% TX100, serially diluted into culture medium, incubated for 30 min with HeLa cells at 106 cells/ml, diluted 10-fold, and plated out into multiple wells of a 96-well microtiter plate having varying dilutions of virus. 0.1% TX100 was used as positive control. After 5 days, the wells are scored as either being infected or not by the presence of cytopathic effect (CPE) and the titer expressed as plaque-forming units/ml (PFU/ml) of the original virus. This assay was described in U.S. Ser. No. 239,571 and was used to demonstrate the antiviral activity of tmICAM-1 (which required the presence of detergent to remain in solution). The concentration of ICAM protein used is the initial concentration in the pre-incubation mixture; however, the ICAM protein is not present continually during the infection in that the protein is serially diluted. While the presence of detergent is required to solubilize the tmICAM, the presence of the detergent does kill cells; thus, the need for the serial dilutions.

B. Plaque-Reduction Assay in the Absence of Detergent

In this plaque-reduction assay, a more traditional assay, HeLa cells are infected with serial dilution of rhinovirus as above, but detergent is not present; thus, this assay cannot be used to assay tmICAM. In this assay the tICAM is present continually in the culture medium at the indicated concentration. tmICAM-1 (which requires the presence of detergent) cannot be assayed in this system because the addition of the required detergent would kill the HeLa cells.

C. Plaque-reduction Assay In Continual Presence of Virus and ICAM

This assay is similar to that utilized by Marlin, et al. (Nature 1990) in which a culture of HeLa cells is infected with 100 PFU of virus in the presence or absence of ICAM protein and cultured approximately 4 days until cytopathic effect (CPE) is apparent. The cultures are then scored for CPE visually. The assay conditions were the same as Marlin, supra. Scoring was done visually rather than by a staining procedure using crystal violet.

In this assay, there is no detergent present, the ICAM is present continually, and this assay measures a reduction in virus replication/propagation at an arbitrary point in time.

The data from these three different assays for virus infectivity is summarized in Table 4.

              TABLE 4                                                     
______________________________________                                    
              IC50% (μM)*                                              
ICAM        Assay:  A          B    C                                     
______________________________________                                    
tmICAM-1            0.03       ND   ND                                    
  tICAM(453)  >20 0.2 0.2                                                 
  tICAM(185)  >20 ND ND                                                   
______________________________________                                    
 *IC50% is defined as the concentration of ICAM protein needed to inhibit 
 HRV3 infectivity by 50%.

These data indicate that tmICAM-1 is significantly more active in reducing viral infectivity than the truncated ICAM proteins, even when compared in different assay systems. The differences in neutralization activity of tICAM(453) in assay (A) and assay (B) indicate that the neutralization mediated by tICAM(453) requires the continual presence of tICAM(453) in the culture medium and is reversible. That the neutralization is reversible is indicated by the lack of neutralization observed in assay (A). In contrast, the neutralization activity of tmICAM-1 is >667-fold higher than tICAM(453) and than tICAM(185) in assay (A) and could be even greater in assay (B) if it were possible to have the tmICAM-1 present continually in the culture medium in the absence of detergent.

To compare these results with those of Marlin, et al., an attempt was made to reproduce their assay conditions. As shown in Table 4, there is a good correlation between the results in assay (B) and assay (C), although the IC50% for tICAM(453) is 10-fold greater than that seen by Marlin, et al. To determine if this is due to a difference in the serotype of rhinovirus used, the assay was repeated with HRV14 and HRV54 (the serotype used by Marlin, et al). The IC50% for both of these serotypes was 0.2 μM tICAM(453), indicating that there is no difference in serotype sensitivity between HRV14, HRV54, and HRV3.

To attempt to resolve this discrepancy, the same buffers that Marlin, et al. used were used to see if they affected the infectivity of rhinovirus in assay (C). Marlin, et al. prepared their sICAM-1 protein in a buffer containing 50 mM triethanolamine (TEA)/20 mM Tris. When this buffer alone was added to control infections (1/10th volume, final concentration 5 mM TEA/2 mM Tris) of HRV3 and HRV14, virtually complete inhibition of CPE was observed. Thus, it is possible that there could be buffer effects on virus replication unrelated to the presence of any form of ICAM.

EXAMPLE 11

Use of Multimeric Forms of Transmembrane and of Truncated Forms of ICAM-1, as Effective Inhibitors of ICAM/FLA-1 Interaction

The normal function of ICAM-1 is to serve as a ligand of the leukocyte integrin LFA-1; interaction between these two molecules leads to adhesion between leukocytes and a variety of other cells. The ability of tICAM(453) to inhibit adhesion between ICAM-1 and LFA-1 on cells was examined as follows. ICAM-1 was adsorbed to microtiter plates as described in Example 7C. JY cells, which express LFA-1, adhere to ICAM-expressing cells or to ICAM-1-coated culture dishes (Staunton, et al., JCB). JY cells were pre-incubated in the presence or absence of tICAM(453) for 30 min at 37° C., and then added to the ICAM-1-coated plates and incubated for 60 min at 37° C. The microtiter plates were then washed and the number of cells attached to the plates were counted.

              TABLE 5                                                     
______________________________________                                    
Inhibition of LFA-1/ICAM-1 interaction by soluble ICAM                    
      tICAM(453) (μg/ml)                                               
                   % control cell binding*                                
______________________________________                                    
--             100                                                        
  100 96                                                                  
  300 93                                                                  
  600 75                                                                  
______________________________________                                    
 *Binding to ICAM1-coated microtiter plates; 10 μg/ml antiLFA-1 or     
 antiICAM-1 MAb inhibited binding to >1%.

As can be seen in Table 5, even at high concentrations of tICAM(453) (0.6 mg/ml), minimal inhibition of JY cell binding was observed. This is probably due to the fact that the adhesion between cells is a highly cooperative process involving thousands of molecules and the affinity of tICAM(453) is low. Presentation of tICAM(453) or tICAM(185) in a multimeric configuration would increase the affinity of the tICAM for cells and could serve as an effective anti-adhesive agent in inflammatory or autoimmune diseases.

The foregoing examples describe the creation of soluble, multimeric forms of tICAM that substantially increase tICAM-1 binding and neutralizing activity.

While the present invention has been described in terms of specific methods and compositions, it is understood that variations and modifications will occur to those skilled in the art upon consideration of the present invention.

For example, it is anticipated that smaller protein fragments and peptides derived from ICAM-1 that still contain the virus-binding site would also be effective in a multimeric configuration. It is also anticipated that multimeric ICAM may be effective inhibitors of the ICAM-1/LFA-1 interaction, as the affinity between these two molecules is quite low and the cell-cell binding mediated by these two molecules is highly cooperative.

Although the preferred form and configuration is a non-transmembrane (truncated) ICAM in dimeric configuration, it is not intended to preclude other forms and configurations effective in binding virus and effective in neutralizing viral activity from being included in the scope of the present invention.

Further, it is anticipated that the general method of the invention of preparing soluble protein forms from insoluble, normally membrane bound receptor proteins can be used to prepare soluble multimeric forms of other receptor proteins useful for binding to and decreasing infectivity of viruses other than those that bind to the "major group" receptor. Such other viruses include polio, Herpes Simplex, and Epstein-Barr virus.

Numerous modifications and variations in the invention as described in the above illustrative examples are expected to occur to those skilled in the art and consequently only such limitations as appear in the appended claims should be placed thereon.

Accordingly it is intended in the appended claims to cover all such equivalent variations which come within the scope of the invention as claimed.

__________________________________________________________________________
#             SEQUENCE LISTING                                            
   - -  - - (1) GENERAL INFORMATION:                                      
   - -    (iii) NUMBER OF SEQUENCES: 11                                   
   - -  - - (2) INFORMATION FOR SEQ ID NO:1:                              
   - -      (i) SEQUENCE CHARACTERISTICS:                                 
            (A) LENGTH: 505                                               
            (B) TYPE: amino acids                                         
            (D) TOPOLOGY: linear                                          
   - -     (ii) MOLECULE TYPE: protein                                    
   - -    (iii) HYPOTHETICAL: no                                          
   - -     (ix) FEATURE:                                                  
            (A) NAME/KEY: ICAM-1 pr - #otein                              
   - -      (x) PUBLICATION INFORMATION:                                  
            (A) AUTHORS: Staunton, - #D.E., Marlin, S.D., Stratowa, C.,   
                Dustin, M - #.L., and Springer, T.A.                      
           (B) TITLE: Primary Stru - #cture of ICAM-1 Demonstrates        
                Interaction - #between Members of the Immunoglobulin and  
                Integrin - #Supergene Families                            
           (C) JOURNAL: Cell                                              
           (D) VOLUME: 52                                                 
           (F) PAGES: 925-933                                             
           (G) DATE: March 25, - #1988                                    
  - -      (xi) SEQUENCE DESCRIPTION: SEQ ID NO: - #1:                    
  - - Gln Thr Ser Val Ser Pro Ser Lys Val Ile Le - #u Pro Arg Gly Gly     
                 5  - #                 10 - #                 15         
  - - Ser Val Leu Val Thr Cys Ser Thr Ser Cys As - #p Gln Pro Lys Leu     
                 20  - #                25  - #                30         
  - - Leu Gly Ile Glu Thr Pro Leu Pro Lys Lys Gl - #u Leu Leu Leu Pro     
                 35  - #                40  - #                45         
  - - Gly Asn Asn Arg Lys Val Tyr Glu Leu Ser As - #n Val Gln Glu Asp     
                 50  - #                55  - #                60         
  - - Ser Gln Pro Met Cys Tyr Ser Asn Cys Pro As - #p Gly Gln Ser Thr     
                 65  - #                70  - #                75         
  - - Ala Lys Thr Phe Leu Thr Val Tyr Trp Thr Pr - #o Glu Arg Val Glu     
                 80  - #                85  - #                90         
  - - Leu Ala Pro Leu Pro Ser Trp Gln Pro Val Gl - #y Lys Asn Leu Thr     
                 95  - #                100 - #                105        
  - - Leu Arg Cys Gln Val Glu Gly Gly Ala Pro Ar - #g Ala Asn Leu Thr     
                 110  - #               115  - #               120        
  - - Val Val Leu Leu Arg Gly Glu Lys Glu Leu Ly - #s Arg Glu Pro Ala     
                 125  - #               130  - #               135        
  - - Val Gly Glu Pro Ala Glu Val Thr Thr Thr Va - #l Leu Val Arg Arg     
                 140  - #               145  - #               150        
  - - Asp His His Gly Ala Asn Phe Ser Cys Arg Th - #r Glu Leu Asp Leu     
                 155  - #               160  - #               165        
  - - Arg Pro Gln Gly Leu Glu Leu Phe Glu Asn Th - #r Ser Ala Pro Tyr     
                 170  - #               175  - #               180        
  - - Gln Leu Gln Thr Phe Val Leu Pro Ala Thr Pr - #o Pro Gln Leu Val     
                 185  - #               190  - #               195        
  - - Ser Pro Arg Val Leu Glu Val Asp Thr Gln Gl - #y Thr Val Val Cys     
                 200  - #               205  - #               210        
  - - Ser Leu Asp Gly Leu Phe Pro Val Ser Glu Al - #a Gln Val His Leu     
                 215  - #               220  - #               225        
  - - Ala Leu Gly Asp Gln Arg Leu Asn Pro Thr Va - #l Thr Tyr Gly Asn     
                 230  - #               235  - #               240        
  - - Asp Ser Phe Ser Ala Lys Ala Ser Val Ser Va - #l Thr Ala Glu Asp     
                 245  - #               250  - #               255        
  - - Glu Gly Thr Gln Arg Leu Thr Cys Ala Val Il - #e Leu Gly Asn Gln     
                 260  - #               265  - #               270        
  - - Ser Gln Glu Thr Leu Gln Thr Val Thr Ile Ty - #r Ser Phe Pro Ala     
                 275  - #               280  - #               285        
  - - Pro Asn Val Ile Leu Thr Lys Pro Glu Val Se - #r Glu Gly Thr Glu     
                 290  - #               295  - #               300        
  - - Val Thr Val Lys Cys Glu Ala His Pro Arg Al - #a Lys Val Thr Leu     
                 305  - #               310  - #               315        
  - - Asn Gly Val Pro Ala Gln Pro Leu Gly Pro Ar - #g Ala Gln Leu Leu     
                 320  - #               325  - #               330        
  - - Leu Lys Ala Thr Pro Glu Asp Asn Gly Arg Se - #r Phe Ser Cys Ser     
                 335  - #               340  - #               345        
  - - Ala Thr Leu Glu Val Ala Gly Gln Leu Ile Hi - #s Lys Asn Gln Thr     
                 350  - #               355  - #               360        
  - - Arg Glu Leu Arg Val Leu Tyr Gly Pro Arg Le - #u Asp Glu Arg Asp     
                 365  - #               370  - #               375        
  - - Cys Pro Gly Asn Trp Thr Trp Pro Glu Asn Se - #r Gln Gln Thr Pro     
                 380  - #               385  - #               390        
  - - Met Cys Gln Ala Trp Gly Asn Pro Leu Pro Gl - #u Leu Lys Cys Leu     
                 395  - #               400  - #               405        
  - - Lys Asp Gly Thr Phe Pro Leu Pro Ile Gly Gl - #u Ser Val Thr Val     
                 410  - #               415  - #               420        
  - - Thr Arg Asp Leu Glu Gly Thr Tyr Leu Cys Ar - #g Ala Arg Ser Thr     
                 425  - #               430  - #               435        
  - - Gln Gly Glu Val Thr Arg Glu Val Thr Val As - #n Val Leu Ser Pro     
                 440  - #               445  - #               450        
  - - Arg Tyr Glu Ile Val Ile Ile Thr Val Val Al - #a Ala Ala Val Ile     
                 455  - #               460  - #               465        
  - - Met Gly Thr Ala Gly Leu Ser Thr Tyr Leu Ty - #r Asn Arg Gln Arg     
                 470  - #               475  - #               480        
  - - Lys Ile Lys Lys Tyr Arg Leu Gln Gln Ala Gl - #n Lys Gly Thr Pro     
                 485  - #               490  - #               495        
  - - Met Lys Pro Asn Thr Gln Ala Thr Pro Pro                             
                 500  - #               505                               
  - -  - - (2) INFORMATION FOR SEQ ID NO:2:                               
  - -      (i) SEQUENCE CHARACTERISTICS:                                  
           (A) LENGTH: 1656                                               
           (B) TYPE: nucleic acid                                         
           (C) STRANDEDNESS: single                                       
           (D) TOPOLOGY: linear                                           
  - -     (ii) MOLECULE TYPE: other nucleic acid                          
  - -    (iii) HYPOTHETICAL: no                                           
  - -     (iv) ANTI-SENSE: no                                             
  - -     (ix) FEATURE:                                                   
           (A) NAME/KEY: ICAM-1 co - #ding sequence                       
  - -      (x) PUBLICATION INFORMATION:                                   
           (A) AUTHORS: Staunton, - #D.E., Marlin, S.D., Stratowa, C.,    
                Dustin, M - #.L., and Springer, T.A.                      
           (B) TITLE: Primary Stru - #cture of ICAM-1 Demonstrates        
                Interaction - #between Members of the Immunoglobulin and  
                Integrin - #Supergene Families                            
           (C) JOURNAL: Cell                                              
           (D) VOLUME: 52                                                 
           (F) PAGES: 925-933                                             
           (G) DATE: March 25, - #1988                                    
           (K) RELEVANT RESIDUES I - #N SEQ ID NO:2: From 58 to           
                1653                                                      
  - -     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:                         
  - - gcgccccagt cgacgctgag ctcctctgct actcagagtt gcaacctcag cc -         
#tcgctatg     60                                                          
   - - gctcccagca gcccccggcc cgcgctgccc gcactcctgg tcctgctggg gg -        
#ctctgtta    120                                                          
   - - ccaggacctg gcaatgcc cag aca tct gtg tcc ccc tca - #aaa gtc atc ctg 
     171                                                                  
                   - #  Gln Thr Ser Val Ser Pro Ser Lys Val - #Ile Leu    
                   - #   1               - #5                  - # 10     
  - - ccc cgg gga ggc tcc gtg ctg gtg aca tgc ag - #c acc tcc tgt gac cag 
     219                                                                  
 Pro Arg Gly Gly Ser Val Leu Val Thr Cys Se - #r Thr Ser Cys Asp Gln      
              15     - #             20     - #             25            
  - - ccc aag ttg ttg ggc ata gag acc ccg ttg cc - #t aaa aag gag ttg ctc 
     267                                                                  
 Pro Lys Leu Leu Gly Ile Glu Thr Pro Leu Pr - #o Lys Lys Glu Leu Leu      
          30         - #         35         - #         40                
  - - ctg cct ggg aac aac cgg aag gtg tat gaa ct - #g agc aat gtg caa gaa 
     315                                                                  
 Leu Pro Gly Asn Asn Arg Lys Val Tyr Glu Le - #u Ser Asn Val Gln Glu      
      45             - #     50             - #     55                    
  - - gat agc caa cca atg tgc tat tca aac tgc cc - #t gat ggg cag tca aca 
     363                                                                  
 Asp Ser Gln Pro Met Cys Tyr Ser Asn Cys Pr - #o Asp Gly Gln Ser Thr      
  60                 - # 65                 - # 70                 - # 75 
  - - gct aaa acc ttc ctc acc gtg tac tgg act cc - #a gaa cgg gtg gaa ctg 
     411                                                                  
 Ala Lys Thr Phe Leu Thr Val Tyr Trp Thr Pr - #o Glu Arg Val Glu Leu      
                  80 - #                 85 - #                 90        
  - - gca ccc ctc ccc tct tgg cag cca gtg ggc aa - #g aac ctt acc cta cgc 
     459                                                                  
 Ala Pro Leu Pro Ser Trp Gln Pro Val Gly Ly - #s Asn Leu Thr Leu Arg      
              95     - #            100     - #            105            
  - - tgc cag gtg gag ggt ggg gca ccc cgg gcc aa - #c ctc acc gtg gtg ctg 
     507                                                                  
 Cys Gln Val Glu Gly Gly Ala Pro Arg Ala As - #n Leu Thr Val Val Leu      
         110          - #       115          - #       120                
  - - ctc cgt ggg gag aag gag ctg aaa cgg gag cc - #a gct gtg ggg gag ccc 
     555                                                                  
 Leu Arg Gly Glu Lys Glu Leu Lys Arg Glu Pr - #o Ala Val Gly Glu Pro      
     125              - #   130              - #   135                    
  - - gct gag gtc acg acc acg gtg ctg gtg agg ag - #a gat cac cat gga gcc 
     603                                                                  
 Ala Glu Val Thr Thr Thr Val Leu Val Arg Ar - #g Asp His His Gly Ala      
 140                 1 - #45                 1 - #50                 1 -  
#55                                                                       
   - - aat ttc tcg tgc cgc act gaa ctg gac ctg cg - #g ccc caa ggg ctg    
gag      651                                                              
  Asn Phe Ser Cys Arg Thr Glu Leu Asp Leu Ar - #g Pro Gln Gly Leu Glu     
                 160  - #               165  - #               170        
  - - ctg ttt gag aac acc tcg gcg ccc tac cag ct - #c cag acc ttt gtc ctg 
     699                                                                  
 Leu Phe Glu Asn Thr Ser Ala Pro Tyr Gln Le - #u Gln Thr Phe Val Leu      
             175      - #           180      - #           185            
  - - cca gcg act ccc cca caa ctt gtc agc ccc cg - #g gtc cta gag gtg gac 
     747                                                                  
 Pro Ala Thr Pro Pro Gln Leu Val Ser Pro Ar - #g Val Leu Glu Val Asp      
         190          - #       195          - #       200                
  - - acg cag ggg acc gtg gtc tgt tcc ctg gac gg - #g ctg ttc cca gtc tcg 
     795                                                                  
 Thr Gln Gly Thr Val Val Cys Ser Leu Asp Gl - #y Leu Phe Pro Val Ser      
     205              - #   210              - #   215                    
  - - gag gcc cag gtc cac ctg gca ctg ggg gac ca - #g agg ttg aac ccc aca 
     843                                                                  
 Glu Ala Gln Val His Leu Ala Leu Gly Asp Gl - #n Arg Leu Asn Pro Thr      
 220                 2 - #25                 2 - #30                 2 -  
#35                                                                       
   - - gtc acc tat ggc aac gac tcc ttc tcg gcc aa - #g gcc tca gtc agt    
gtg      891                                                              
  Val Thr Tyr Gly Asn Asp Ser Phe Ser Ala Ly - #s Ala Ser Val Ser Val     
                 240  - #               245  - #               250        
  - - acc gca gag gac gag ggc acc cag cgg ctg ac - #g tgt gca gta ata ctg 
     939                                                                  
 Thr Ala Glu Asp Glu Gly Thr Gln Arg Leu Th - #r Cys Ala Val Ile Leu      
             255      - #           260      - #           265            
  - - ggg aac cag agc cag gag aca ctg cag aca gt - #g acc atc tac agc ttt 
     987                                                                  
 Gly Asn Gln Ser Gln Glu Thr Leu Gln Thr Va - #l Thr Ile Tyr Ser Phe      
         270          - #       275          - #       280                
  - - ccg gcg ccc aac gtg att ctg acg aag cca ga - #g gtc tca gaa ggg acc 
    1035                                                                  
 Pro Ala Pro Asn Val Ile Leu Thr Lys Pro Gl - #u Val Ser Glu Gly Thr      
     285              - #   290              - #   295                    
  - - gag gtg aca gtg aag tgt gag gcc cac cct ag - #a gcc aag gtg acg ctg 
    1083                                                                  
 Glu Val Thr Val Lys Cys Glu Ala His Pro Ar - #g Ala Lys Val Thr Leu      
 300                 3 - #05                 3 - #10                 3 -  
#15                                                                       
   - - aat ggg gtt cca gcc cag cca ctg ggc ccg ag - #g gcc cag ctc ctg    
ctg     1131                                                              
  Asn Gly Val Pro Ala Gln Pro Leu Gly Pro Ar - #g Ala Gln Leu Leu Leu     
                 320  - #               325  - #               330        
  - - aag gcc acc cca gag gac aac ggg cgc agc tt - #c tcc tgc tct gca acc 
    1179                                                                  
 Lys Ala Thr Pro Glu Asp Asn Gly Arg Ser Ph - #e Ser Cys Ser Ala Thr      
             335      - #           340      - #           345            
  - - ctg gag gtg gcc ggc cag ctt ata cac aag aa - #c cag acc cgg gag ctt 
    1227                                                                  
 Leu Glu Val Ala Gly Gln Leu Ile His Lys As - #n Gln Thr Arg Glu Leu      
         350          - #       355          - #       360                
  - - cgt gtc ctg tat ggc ccc cga ctg gac gag ag - #g gat tgt ccg gga aac 
    1275                                                                  
 Arg Val Leu Tyr Gly Pro Arg Leu Asp Glu Ar - #g Asp Cys Pro Gly Asn      
     365              - #   370              - #   375                    
  - - tgg acg tgg cca gaa aat tcc cag cag act cc - #a atg tgc cag gct tgg 
    1323                                                                  
 Trp Thr Trp Pro Glu Asn Ser Gln Gln Thr Pr - #o Met Cys Gln Ala Trp      
 380                 3 - #85                 3 - #90                 3 -  
#95                                                                       
   - - ggg aac cca ttg ccc gag ctc aag tgt cta aa - #g gat ggc act ttc    
cca     1371                                                              
  Gly Asn Pro Leu Pro Glu Leu Lys Cys Leu Ly - #s Asp Gly Thr Phe Pro     
                 400  - #               405  - #               410        
  - - ctg ccc atc ggg gaa tca gtg act gtc act cg - #a gat ctt gag ggc acc 
    1419                                                                  
 Leu Pro Ile Gly Glu Ser Val Thr Val Thr Ar - #g Asp Leu Glu Gly Thr      
             415      - #           420      - #           425            
  - - tac ctc tgt cgg gcc agg agc act caa ggg ga - #g gtc acc cgc gag gtg 
    1467                                                                  
 Tyr Leu Cys Arg Ala Arg Ser Thr Gln Gly Gl - #u Val Thr Arg Glu Val      
         430          - #       435          - #       440                
  - - acc gtg aat gtg ctc tcc ccc cgg tat gag at - #t gtc atc atc act gtg 
    1515                                                                  
 Thr Val Asn Val Leu Ser Pro Arg Tyr Glu Il - #e Val Ile Ile Thr Val      
     445              - #   450              - #   455                    
  - - gta gca gcc gca gtc ata atg ggc act gca gg - #c ctc agc acg tac ctc 
    1563                                                                  
 Val Ala Ala Ala Val Ile Met Gly Thr Ala Gl - #y Leu Ser Thr Tyr Leu      
 460                 4 - #65                 4 - #70                 4 -  
#75                                                                       
   - - tat aac cgc cag cgg aag atc aag aaa tac ag - #a cta caa cag gcc    
caa     1611                                                              
  Tyr Asn Arg Gln Arg Lys Ile Lys Lys Tyr Ar - #g Leu Gln Gln Ala Gln     
                 480  - #               485  - #               490        
  - - aaa ggg acc ccc atg aaa ccg aac aca caa gc - #c acg cct ccc         
    - #1653                                                               
 Lys Gly Thr Pro Met Lys Pro Asn Thr Gln Al - #a Thr Pro Pro              
             495      - #           500      - #           505            
  - - tga                  - #                  - #                  - #  
         1656                                                             
  - -  - - (2) INFORMATION FOR SEQ ID NO:3:                               
  - -      (i) SEQUENCE CHARACTERISTICS:                                  
           (A) LENGTH: 31                                                 
           (B) TYPE: nucleic acid                                         
           (C) STRANDEDNESS: single                                       
           (D) TOPOLOGY: linear                                           
  - -     (ii) MOLECULE TYPE: other nucleic acid                          
  - -    (iii) HYPOTHETICAL: no                                           
  - -     (iv) ANTI-SENSE: no                                             
  - -     (ix) FEATURE:                                                   
           (A) NAME/KEY: PCR 5.1 - #(5' PCR primer)                       
           (B) LOCATION: 5' end - # of ICAM-1 coding sequence             
           (D) OTHER INFORMATION: - #bp 1 = G; bp 2-7 = EcoRI             
                site; bp - #8-31 = 24 bases coding for the                
                first eig - #ht amino acid residues of hICAM-1            
  - -      (x) PUBLICATION INFORMATION:                                   
           (A) AUTHORS: Greve, J.M - #., G. Davis, A.M. Meyer,            
                C.P. Fort - #e, S.C. Yost, C.W. Marlor, M.E.              
                Kamarck, - #and A. McClelland                             
           (B) TITLE: The Major - #Human Rhinovirus Receptor              
                is ICAM-1                                                 
           (C) JOURNAL: Cell                                              
           (D) VOLUME: 56                                                 
           (F) PAGES: 839-847                                             
           (G) DATE: March 10, - #1989                                    
           (K) RELEVANT RESIDUES I - #N SEQ ID NO:3: From 1 to            
                31                                                        
  - -     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:                         
  - - GGAATTC ATG GCT CCC AGC AGC CCC CGG CCC   - #                  - #  
        31                                                                
         Met Ala Pro Ser Ser Pro - #Arg Pro                               
                   - #        5                                           
  - -  - - (2) INFORMATION FOR SEQ ID NO:4:                               
  - -      (i) SEQUENCE CHARACTERISTICS:                                  
           (A) LENGTH: 31 bp                                              
           (B) TYPE: nucleic acid                                         
           (C) STRANDEDNESS: single                                       
           (D) TOPOLOGY: linear                                           
  - -     (ii) MOLECULE TYPE: other nucleic acid                          
  - -    (iii) HYPOTHETICAL: no                                           
  - -     (iv) ANTI-SENSE: yes                                            
  - -     (ix) FEATURE:                                                   
           (A) NAME/KEY: PCR 3.1 - #(3' PCR primer)                       
           (B) LOCATION: 3' end - # of ICAM-1 coding sequence             
           (D) OTHER INFORMATION: - #bp 1 = G; bp 2-7 = EcoRI             
                site; bp - #8-31 = 24 bases complementary to              
                nucleic a - #cid sequence coding for last 8               
                amino aci - #d residues of hICAM-1                        
  - -      (x) PUBLICATION INFORMATION:                                   
           (A) AUTHORS: Greve, J.M - #., G. Davis, A.M. Meyer,            
                C.P. Fort - #e, S.C. Yost, C.W. Marlor, M.E.              
                Kamarck, - #and A. McClelland                             
           (B) TITLE: The Major - #Human Rhinovirus Receptor              
                is ICAM-1                                                 
           (C) JOURNAL: Cell                                              
           (D) VOLUME: 56                                                 
           (F) PAGES: 839-847                                             
           (G) DATE: March 10, - #1989                                    
           (K) RELEVANT RESIDUES I - #N SEQ ID NO:4: From 1 to            
                31                                                        
  - -     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:                         
  - - GGAATTCTCA GGGAGGCGTG GCTTGTGTGT T        - #                  - #  
        31                                                                
  - -  - - (2) INFORMATION FOR SEQ ID NO:5:                               
  - -      (i) SEQUENCE CHARACTERISTICS:                                  
           (A) LENGTH: 47 bp                                              
           (B) TYPE: nucleic acid                                         
           (C) STRANDEDNESS: single                                       
           (D) TOPOLOGY: linear                                           
  - -     (ii) MOLECULE TYPE: other nucleic acid                          
  - -    (iii) HYPOTHETICAL: no                                           
  - -     (iv) ANTI-SENSE: yes                                            
  - -     (ix) FEATURE:                                                   
           (A) NAME/KEY: ICAM1 pro - #be                                  
           (D) OTHER INFORMATION: - #complementary to                     
                nucleotides - #565 to 611 of ICAM-1                       
  - -      (x) PUBLICATION INFORMATION:                                   
           (A) AUTHORS: Greve, J.M - #., G. Davis, A.M. Meyer,            
                C.P. Fort - #e, S.C. Yost, C.W. Marlor, M.E.              
                Kamarck, - #and A. McClelland                             
           (B) TITLE: The Major - #Human Rhinovirus Receptor              
                is ICAM-1                                                 
           (C) JOURNAL: Cell                                              
           (D) VOLUME: 56                                                 
           (F) PAGES: 839-847                                             
           (G) DATE: March 10, - #1989                                    
           (K) RELEVANT RESIDUES I - #N SEQ ID NO:5: From 1 to            
                47                                                        
  - -     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:                         
  - - GAGGTGTTCT CAAACAGCTC CAGCCCTTGG GGCCGCAGGT CCAGTTC   - #           
     47                                                                   
  - -  - - (2) INFORMATION FOR SEQ ID NO:6:                               
  - -      (i) SEQUENCE CHARACTERISTICS:                                  
           (A) LENGTH: 47 bp                                              
           (B) TYPE: nucleic acid                                         
           (C) STRANDEDNESS: single                                       
           (D) TOPOLOGY: linear                                           
  - -     (ii) MOLECULE TYPE: other nucleic acid                          
  - -    (iii) HYPOTHETICAL: no                                           
  - -     (iv) ANTI-SENSE: yes                                            
  - -     (ix) FEATURE:                                                   
           (A) NAME/KEY: ICAM3 pro - #be                                  
           (B) LOCATION: complementar - #y to nucleotides 659             
                to 705 - #of human ICAM-1                                 
  - -     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:                         
  - - CGCTGGCAGG ACAAAGGTCT GGAGCTGGTA GGGGGCCGAG GTGTTCT   - #           
     47                                                                   
  - -  - - (2) INFORMATION FOR SEQ ID NO:7:                               
  - -      (i) SEQUENCE CHARACTERISTICS:                                  
           (A) LENGTH: 49 bp                                              
           (B) TYPE: nucleic acid                                         
           (C) STRANDEDNESS: single                                       
           (D) TOPOLOGY: linear                                           
  - -     (ii) MOLECULE TYPE: other nucleic acid                          
  - -    (iii) HYPOTHETICAL: no                                           
  - -     (iv) ANTI-SENSE: no                                             
  - -     (ix) FEATURE:                                                   
           (A) NAME/KEY: PCR 5.5                                          
           (D) OTHER INFORMATION: - #bp 1 = G; bp 2-7 = EcoRI             
                site; bp - #8-13 = HindIII site; bp 14-25 =               
                hICAM-1 5 - #' untranslated region; bp 26-49 =            
                sequence - #coding for first 8 amino acid                 
                residues - #of hICAM-1                                    
  - -      (x) PUBLICATION INFORMATION:                                   
           (A) AUTHORS: Greve, J.M - #., C.P. Forte, C.W.                 
                Marlor, A - #.M. Meyer, H. Hoover-Litty, D.               
                Wunderlich, - #and A. McClelland                          
           (B) TITLE: "Mechanisms - #of Receptor-mediated                 
                Rhinovirus - #Neutralization Defined by Two               
                Soluble F - #orms of ICAM-1"                              
           (C) JOURNAL: Journal of - # Virology                           
           (D) VOLUME: 65                                                 
           (E) ISSUE: 11                                                  
           (F) PAGES: 6015-6023                                           
           (G) DATE: 1991                                                 
           (K) RELEVANT RESIDUES I - #N SEQ ID NO:7: From 1 to            
                49                                                        
  - -     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:                         
  - - GGAATTCAAG CTTCTCAGCC TCGCT ATG GCT CCC AGC AGC - #CCC CGG CCC      
     49                                                                   
                   - #          Met Ala Pro Ser Ser - # Pro Arg Pro       
                   - #                  - #          5                    
  - -  - - (2) INFORMATION FOR SEQ ID NO:8:                               
  - -      (i) SEQUENCE CHARACTERISTICS:                                  
           (A) LENGTH: 40 bp                                              
           (B) TYPE: nucleic acid                                         
           (C) STRANDEDNESS: single                                       
           (D) TOPOLOGY: linear                                           
  - -     (ii) MOLECULE TYPE: other nucleic acid                          
  - -    (iii) HYPOTHETICAL: no                                           
  - -     (iv) ANTI-SENSE: yes                                            
  - -     (ix) FEATURE:                                                   
           (A) NAME/KEY: PCR 3.3                                          
           (D) OTHER INFORMATION: - #bp 1 = G; bp 2-7 = EcoRI             
                site; bp - #8-13 = PstI site; bp 14-16 = stop             
                codon; bp - # 17-40 = complementary to                    
                nucleotide - #sequence coding for residues 453-446 of     
                hICAM-1                                                   
  - -      (x) PUBLICATION INFORMATION:                                   
           (A) AUTHORS: Greve, J.M - #., C.P. Forte, C.W.                 
                Marlor, A - #.M. Meyer, H. Hoover-Litty, D.               
                Wunderlich, - #and A. McClelland                          
           (B) TITLE: Mechanisms o - #f Receptor-mediated                 
                Rhinovirus - #Neutralization Defined by Two               
                Soluble F - #orms of ICAM-1                               
           (C) JOURNAL: Journal of - # Virology                           
           (D) VOLUME: 65                                                 
           (E) ISSUE: 11                                                  
           (F) PAGES: 6015-6023                                           
           (G) DATE: 1991                                                 
           (K) RELEVANT RESIDUES I - #N SEQ ID NO:8: From 1 to            
                40                                                        
  - -     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:                         
  - - GGAATTCCTG CAGTCACTCA TACCGGGGGG AGAGCACATT     - #                 
 - #    40                                                                
  - -  - - (2) INFORMATION FOR SEQ ID NO:9:                               
  - -      (i) SEQUENCE CHARACTERISTICS:                                  
           (A) LENGTH: 39 bp                                              
           (B) TYPE: nucleic acid                                         
           (C) STRANDEDNESS: single                                       
           (D) TOPOLOGY: linear                                           
  - -     (ii) MOLECULE TYPE: other nucleic acid                          
  - -    (iii) HYPOTHETICAL: no                                           
  - -     (iv) ANTI-SENSE: yes                                            
  - -     (ix) FEATURE:                                                   
           (A) NAME/KEY: PCR 3.10                                         
           (D) OTHER INFORMATION: - #bp 1 = T; bp 2-7 = Xba               
                site; bp - #8-13 = Bam site; bp 14-16 = stop              
                codon; bp - # 17-39 = sequence complementary to           
                nucleotides - #693-671 which code for amino               
                acid resi - #dues 185-178 of hICAM-1                      
  - -      (x) PUBLICATION INFORMATION:                                   
           (A) AUTHORS: Greve, J.M - #., C.P. Forte, C.W.                 
                Marlor, A - #.M. Meyer, H. Hoover-Litty, D.               
                Wunderlich, - #and A. McClelland                          
           (B) TITLE: Mechanisms o - #f Receptor-mediated                 
                Rhinovirus - #Neutralization Defined by Two               
                Soluble F - #orms of ICAM-1                               
           (C) JOURNAL: Journal of - # Virology                           
           (D) VOLUME: 65                                                 
           (E) ISSUE: 11                                                  
           (F) PAGES: 6015-6023                                           
           (G) DATE: 1991                                                 
           (K) RELEVANT RESIDUES I - #N SEQ ID NO:9: From 1 to            
                39                                                        
  - -     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:                         
  - - TTCTAGAGGA TCCTCAAAAG GTCTGGAGCT GGTAGGGGG      - #                 
 - #    39                                                                
  - -  - - (2) INFORMATION FOR SEQ ID NO:10:                              
  - -      (i) SEQUENCE CHARACTERISTICS:                                  
           (A) LENGTH: 43 bp                                              
           (B) TYPE: nucleic acid                                         
           (C) STRANDEDNESS: single                                       
           (D) TOPOLOGY: linear                                           
  - -     (ii) MOLECULE TYPE: other nucleic acid                          
  - -    (iii) HYPOTHETICAL: no                                           
  - -     (iv) ANTI-SENSE: yes                                            
  - -     (ix) FEATURE:                                                   
           (A) NAME/KEY: PCR 3.19                                         
           (D) OTHER INFORMATION: - #bp 1 = T; bp 2-7 = Xba               
                site; bp - #8-13 = Bam site; bp 14-16 = stop              
                codon; bp - # 17-19 = lysine codon; bp 20 - 43 =          
                sequence - #complementary to nucleotides coding           
                for amino - # acid residues 453-446 of hICAM-1            
  - -     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:10:                        
  - - TTCTAGAGGA TCCTCACTTC TCATACCGGG GGGAGAGCAC ATT    - #              
    - # 43                                                                
  - -  - - (2) INFORMATION FOR SEQ ID NO:11:                              
  - -      (i) SEQUENCE CHARACTERISTICS:                                  
           (A) LENGTH: 43 bp                                              
           (B) TYPE: nucleic acid                                         
           (C) STRANDEDNESS: single                                       
           (D) TOPOLOGY: linear                                           
  - -     (ii) MOLECULE TYPE: other nucleic acid                          
  - -    (iii) HYPOTHETICAL: no                                           
  - -     (iv) ANTI-SENSE: yes                                            
  - -     (ix) FEATURE:                                                   
           (A) NAME/KEY: PCR 3.20                                         
           (D) OTHER INFORMATION: - #bp 1 = T; bp 2-7 = Xba               
                site; bp - #8-13 = Bam site; bp 14-16 = stop              
                codon; bp - # 17-19 = lysine codon; bp 20 - 43 =          
                sequence - #complementary to nucleotides coding           
                for amino - # acid residues 185-178 of hICAM-1            
  - -     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:11:                        
  - - TTCTAGAGGA TCCTCACTTA AAGGTCTGGA GCTGGTAGGG GGC    - #              
    - # 43                                                                
__________________________________________________________________________

Claims

What is claimed is:

1. A multimeric antiviral agent comprising two or more monomers selected from the group consisting of monomeric transmembrane intercellular adhesion molecule-1(tmICAM-1) and monomeric fragments of tmICAM-1, with thc proviso that when said multimer is a dimer said monomers cannot both be tmICAM-1, wherein each of said monomers comprises the human rhinovirus (HRV) binding site and retains the ability to bind to HRV and reduce infectivity thereof, and wherein said multimeric antiviral agent mimics the multimeric configuration of tmICAM-1 and exhibits enhanced binding to said HRV relative to at least one of the constituent monomers.

2. A multimeric antiviral agent according to claim 1 wherein at least one of said monomers is selected from the group consisting of truncated intercelluar adhesion molecule-1 (tICAMs).

3. A multimeric antiviral agent according to claim 2 wherein said monomers are selected from the group consisting of tICAM(453) and tICAM(185).

4. A multimeric antiviral agent according to claim 1 wherein each of said monomers contains at least one reactive amino acid.

5. A multimeric antiviral agent according to claim 4, wherein each of said monomers contains at least one lysine residue, wherein each of said monomers is linked to at least one other such monomer via said lysine residues, and wherein said multimeric antiviral agent binds to HRV and reduces infectivity thereof.

6. A multimeric antiviral agent according to claim 4 wherein each of said monomers contains at least one cysteine residue, wherein each of said monomers is linked to at least one other such monomer via a cysteine disulfide linkage, and wherein said multimeric antiviral agent binds to HRV and reduces infectivity thereof.

7. A multimeric antiviral agent according to claim 1 wherein said multimer is a dimer.

8. A method for reducing infectivity of human rhinovirus (HRV), said method comprising contacting said HRV with a multimeric antiviral agent according to claim 1, 2, 3, 4, 5, 6, or 7.

9. A pharmaceutical composition comprising a pharmaceutically acceptable solvent, diluent, adjuvant, or carrier, and a multimeric antiviral agent according to claim 1, 2, 3, 4, 5, 6, or 7.

10. In a method for binding a truncated intercellular adhesion molecule-1 (tICAM) to human rhinovirus (HRV), the improvement comprising presenting said tICAM to said HRV in the form of a multimeric antiviral agent according to claim 1, 2, 3, 4, 5, 6, or 7.