US6641999B1 - Probing method for identifying antibodies specific for selected antigens - Google Patents

Probing method for identifying antibodies specific for selected antigens Download PDF

Info

Publication number
US6641999B1
US6641999B1 US09/503,653 US50365300A US6641999B1 US 6641999 B1 US6641999 B1 US 6641999B1 US 50365300 A US50365300 A US 50365300A US 6641999 B1 US6641999 B1 US 6641999B1
Authority
US
United States
Prior art keywords
dna
seq
sequence
antibody
probe
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Lifetime
Application number
US09/503,653
Inventor
Peter S. Mezes
Brian Gourlie
Mark W. Rixon
W. H. Kerr Anderson
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
DEPARTMENT OF HEALTH AND HUMAN SERVICES GOVERNMENT OF United States, THE, Secretary of
US Department of Health and Human Services
Original Assignee
Dow Chemical Co
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from US08/040,687 external-priority patent/US6051225A/en
Priority to US09/503,653 priority Critical patent/US6641999B1/en
Application filed by Dow Chemical Co filed Critical Dow Chemical Co
Assigned to DOW CHEMICAL COMPANY, THE reassignment DOW CHEMICAL COMPANY, THE ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: GOURLIE, BRIAN
Assigned to DOW CHEMICAL COMPANY, THE reassignment DOW CHEMICAL COMPANY, THE ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: MEZES, PETER S.
Assigned to THE DOW CHEMICAL COMPANY reassignment THE DOW CHEMICAL COMPANY ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: ANDERSON, W. H. KERR
Assigned to DOW CHEMICAL COMPANY, THE reassignment DOW CHEMICAL COMPANY, THE ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: RIXON, MARK W.
Publication of US6641999B1 publication Critical patent/US6641999B1/en
Application granted granted Critical
Assigned to DEPARTMENT OF HEALTH AND HUMAN SERVICES, GOVERNMENT OF THE UNITED STATES OF AMERICA, AS REPRESENTED BY THE SECRETARY OF THE, THE reassignment DEPARTMENT OF HEALTH AND HUMAN SERVICES, GOVERNMENT OF THE UNITED STATES OF AMERICA, AS REPRESENTED BY THE SECRETARY OF THE, THE ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: SCHLOM, JEFFREY
Assigned to THE GOVERNMENT OF THE UNITED STATES OF AMERICA AS REPRESENTED BY THE SECRETARY OF THE DEPARTMENT OF HEALTH AND HUMAN SERVICES reassignment THE GOVERNMENT OF THE UNITED STATES OF AMERICA AS REPRESENTED BY THE SECRETARY OF THE DEPARTMENT OF HEALTH AND HUMAN SERVICES ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: THE DOW CHEMICAL COMPANY
Anticipated expiration legal-status Critical
Expired - Lifetime legal-status Critical Current

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/30Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/68Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
    • A61K47/6835Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site
    • A61K47/6875Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site the antibody being a hybrid immunoglobulin
    • A61K47/6877Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site the antibody being a hybrid immunoglobulin the antibody being an immunoglobulin containing regions, domains or residues from different species
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K51/00Preparations containing radioactive substances for use in therapy or testing in vivo
    • A61K51/02Preparations containing radioactive substances for use in therapy or testing in vivo characterised by the carrier, i.e. characterised by the agent or material covalently linked or complexing the radioactive nucleus
    • A61K51/04Organic compounds
    • A61K51/08Peptides, e.g. proteins, carriers being peptides, polyamino acids, proteins
    • A61K51/10Antibodies or immunoglobulins; Fragments thereof, the carrier being an antibody, an immunoglobulin or a fragment thereof, e.g. a camelised human single domain antibody or the Fc fragment of an antibody
    • A61K51/1084Antibodies or immunoglobulins; Fragments thereof, the carrier being an antibody, an immunoglobulin or a fragment thereof, e.g. a camelised human single domain antibody or the Fc fragment of an antibody the antibody being a hybrid immunoglobulin
    • A61K51/1087Antibodies or immunoglobulins; Fragments thereof, the carrier being an antibody, an immunoglobulin or a fragment thereof, e.g. a camelised human single domain antibody or the Fc fragment of an antibody the antibody being a hybrid immunoglobulin the immunoglobulin comprises domains from different animal species, e.g. chimeric immunoglobulins
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/46Hybrid immunoglobulins
    • C07K16/461Igs containing Ig-regions, -domains or -residues form different species
    • C07K16/462Igs containing a variable region (Fv) from one specie and a constant region (Fc) from another
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2123/00Preparations for testing in vivo
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/20Immunoglobulins specific features characterized by taxonomic origin
    • C07K2317/24Immunoglobulins specific features characterized by taxonomic origin containing regions, domains or residues from different species, e.g. chimeric, humanized or veneered
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide

Definitions

  • This invention relates to the field of immunoglobulin production and modifications to naturally occurring antibody amino acid sequences. Specifically, the invention relates to using recombinant DNA techniques to produce chimeric genes and to take advantage of these gene modification techniques to construct chimeric antibodies.
  • Antibodies are specific immunoglobulin (Ig) polypeptides produced by the vertebrate immune system in response to challenges by foreign proteins, glycoproteins, cells, or other antigenic foreign substances.
  • Ig immunoglobulin
  • the sequence of events which permits the organism to overcome invasion by foreign cells or to rid the system of foreign substances is at least partially understood.
  • An important part of this process is the manufacture of antibodies which bind specifically to a particular foreign substance.
  • the binding specificity of such polypeptides to a particular antigen is highly refined, and the multitude of specificities capable of being generated by the individual vertebrate is remarkable in its complexity and variability. Millions of antigens are capable of eliciting antibody responses, each antibody almost exclusively directed to the particular antigen which elicited it.
  • Two major sources of vertebrate antibodies are presently utilized—generation in situ by the mammalian B lymphocytes, and generation in cell culture by B-cell hybrids. Antibodies are generated in situ as a result of the differentiation of immature B lymphocytes into plasma cells, which occurs in response to stimulation by specific antigens. In the undifferentiated B cells, the portions of DNA coding for the various regions on the immunoglobulin chains are separated in the genomic DNA. The sequences are assembled sequentially prior to expression. A review of this process has been given by Gough, Trends in Biochem. Sci ., 6:203 (1981).
  • the resulting rearranged gene is capable of expression in the mature B lymphocyte to produce the desired antibody.
  • the in situ immune response to any particular antigen is defined by the mosaic of responses to the various determinants which are present on the antigen.
  • Each subset of homologous antibodies is contributed by a single population of B cells—hence in situ generation of antibodies is “polyclonal”.
  • the relatively short-lived, or mortal, splenocytes or lymphocytes from a mammal which has been injected with antigen are fused with an immortal tumor cell line, thus producing hybrid cells or “hybridomas” which are both immortal and capable of producing the genetically coded antibody of the B cell.
  • the hybrids thus formed are segregated into single genetic strains by selection, dilution, and regrowth, and each strain thus represents a single genetic line. They therefore, produce antibodies which are assured to be homogeneous against a desired antigen. These antibodies, referencing their pure genetic parentage, are called “monoclonal”.
  • Monoclonal antibodies with mono-specificity have greatly influenced immunology, and their usefulness has already been demonstrated in such sciences as biology, pharmacology, chemistry and others.
  • Such monoclonal antibodies have found widespread use not only as diagnostics reagents [see, for example, Immunology for the 80 's , Eds. Voller, et al., MTP Press, Lancaster, (1981), but also therapy (see, for example, Ritz and Schlossman, Blood , 59:1-11, (1982)].
  • Monoclonal antibodies produced by hybridomas while theoretically effective as discussed above and clearly preferable to polyclonal antibodies because of their specificity, suffer from an important disadvantage.
  • the use of monoclonal antibodies produced in non-human animals is severely restricted where the monoclonal antibodies are to be used in humans.
  • a “foreign” antibody in humans such as a mouse antibody, may lead to harmful hypersensitivity reactions.
  • Such a non-human derived monoclonal antibody when injected into humans, causes a anti-nonhuman antibody (ANHA) response.
  • ANHA anti-nonhuman antibody
  • HAMA human anti-mouse antibody
  • animal immunoglobulins having human constant regions will generate less of an ANHA response when injected into humans than animal immunoglobulins having nonhuman constant regions.
  • monoclonal antibodies having good binding affinities for selected antigens and having human constant regions are thought to possess great potential utility for immunological diagnosis and therapy of human patients with cancer.
  • human-derived monoclonal antibodies by using human hybridomas.
  • human-human hybridomas [Olsson et al., Proc. Natl. Acad. Sci . ( USA ), 77:5429 (1980)]; human-murine hybridomas [Schlom et al., Proc. Natl. Acad. Sci . ( USA ), 77:6841 (1980)] and several other xenogenic hybrid combinations have been prepared.
  • Human monoclonal antibodies have also been produced by transformation of lymphocytes using Epstein-Barr virus. However, such hybridomas may potentially harbor pathogenic human viruses.
  • primary, antibody producing B cells have been immortalized in vitro by transformation with viral DNA. Unfortunately, yields of monoclonal antibodies from human hybridoma cell lines are relatively low (1 ⁇ g/mL in human compared to 100 ⁇ g/mL in mouse hybridomas), and production costs are high.
  • a monoclonal antibody which reacts with high binding affinity to human tumor antigens, but which is not recognized as a foreign substance by humans is highly desirable.
  • a method to overcome this difficulty is to create artificially, an antibody which is very similar to a human antibody and is not recognized as a foreign substance within the human body, i.e., a chimeric, or “humanized” antibody.
  • variable region of both light and heavy chains mimics the variable regions of antibodies derived from one species of mammals, while the constant portions are homologous to the sequences in antibodies derived from humans.
  • variable regions can conveniently be derived from presently known sources using readily available hybridomas of B cells from non-human host organisms in combination with constant regions derived from, for example, human cell preparations. While the specificity of the variable region is not affected by its source, the constant region being human, is less likely to elicit an immune response from a human subject when the antibodies are injected than would the constant region from a non-human source.
  • TAG-72 tumor-associated glycoprotein
  • LS174T American Type Culture Collection, 10801 University Boulevard, Manassas, Va. 20110-2209 (herein ATCC) No. CL 188] is a variant of the LS180 (ATCC No. CL 187) colon adenocarcinoma line.
  • the karyotype of LS174T is similar to that of LS180 with a missing X chromosome in a majority of the cells. Data has been presented as described in Johnson, et al., Cancer Res ., 46:850-857 (1986), to characterize the TAG-72 molecule as a mucin.
  • TAG-72 has a high molecular weight (>1 ⁇ 10 6 ) as shown by its exclusion from a SEPHAROSE CL-4B column (modified polysaccharide gel filtration column from Pharmacia, Inc., Piscataway, N.J.); (b) the density of TAG-72 determined by equilibrium centrifugation in CsCl was 1.45 gm/mL, indicating a heavily glycosylated glycoprotein; (c) TAG-72 demonstrates a change in migration after neuraminidase digestion, indicating that it is a heavily sialylated molecule with an abundance of O-glycosidically linked oligosaccharides characteristic of mucins; (d) blood group antigens commonly found on mucins are found on affinity-purified TAG-72; and (e) Chondroitinase ABC digestion had no effect on TAG-72, thus demonstrating that the TAG-72 epitope is not expressed
  • B72.3 is a murine IgGl produced by hybridoma B72.3 (ATCC No. HB-8108).
  • B72.3 is a first generation monoclonal antibody developed using a human breast carcinoma extract as the immunogen (see Colcher et al., Proc. Natl. Acad. Sci . ( USA ), 78:3199-3203 (1981); and U.S. Pat. Nos. 4,522,918 and 4,612,282).
  • first generation monoclonal antibody means a monoclonal antibody produced using, as the immunogen, a crude cell extract.
  • CC monoclonal antibodies are a family of second generation murine monoclonal antibodies.
  • second generation monoclonal antibody means a monoclonal antibody produced using, as the immunogen, an antigen purified with a first generation monoclonal antibody.
  • CC monoclonal antibodies were prepared using TAG-72 purified with B72.3.
  • a discussion of the method for producing the CC antibodies is set forth in U.S. Pat. No. 7,073,685 (U.S. Pat. No. 7,073,685, abandoned, continued as U.S. Pat. No. 7,547,336, now U.S. Pat. No.
  • U.S. Pat. No. 7,073,685 teaches that the CC antibodies may be altered into their chimeric form by substituting, e.g., human constant regions (Fc) domains for mouse constant regions by recombinant DNA techniques known in the art. It is believed that the proposals set out in U.S. Pat. No. 7,073,685 did not lead to an actual attempt to express any chimeric Ig polypeptide chains, nor to produce Ig activity, nor to secrete and assemble Ig chains into the desired chimeric Igs.
  • Fc human constant regions
  • Idiotypes are antigenic determinants that involve variable regions of heavy and light chains of immunglobulin molecules. Isotypes and/or allotypes are antigenic determinants that are restricted to the constant regions of heavy chains. Attention is further directed to Morahan et al., Nature , 301:720-722 (1983), which teach:
  • the T15 idiotype defined by sera raised in A strain mice, or in rabbits, is considered identical to that expressed by the majority of BALB/c anti-PC antibodies.
  • monoclonal anti-T15 antibodies were used here to examine both serum and monoclonal anti-PC antibodies. The latter were found to differ from T15 with respect to the idiotope defined by the monoclonal anti-idiotope antibody, 21A5, in that the '21A5 idiotope' was absent from anti-PC sera; of the monoclonal anti-PC antibodies examined, only those which were both T15+ and of the IgA isotype seemed to express this idiotype fully. This result suggests that not only the V region, but also the constant region, of the immunoglobulin molecule can contribute to the formation of an idiotypic determinant. (emphasis added)
  • Morahan et al. (12) described an anti-T15 hybridoma antibody, 21A5, that identified an idiotypic determinant associated with T15 Id and the IgA CH region . . . we have shown that NL24 binding to C3 is inhibited by not only PC-binding IgA and T15 Id+MP, but also by numerous PC-binding hybridoma proteins (HP) and the IgA fraction of normal anti-PC antibodies of BALB/c mice and presumably other strains . . . .
  • the present invention is able to meet many of these above mentioned needs and provides a method for supplying the desired antibodies.
  • This invention concerns an antibody or antibody fragment comprising a variable region having a heavy chain (V H ), said V H being encoded by a DNA sequence effectively homologous to the V H ⁇ TAG germline gene (V H ⁇ TAG), wherein the variable region binds to TAG-72 at least 25 percent greater than the variable region of B72.3 binds to TAG-72, with the binding affinities of the antibody and B72.3 being measured by the same technique.
  • V H V H
  • V H ⁇ TAG V H ⁇ TAG
  • This invention also concerns a DNA sequence encoding at least a portion of an antibody heavy chain, said sequence comprising a DNA sequence segment being effectively homologous to the V H ⁇ TAG germline gene (V H ⁇ TAG), wherein the DNA sequence segment encodes at least a portion of a heavy chain variable region (V H ).
  • the invention includes the aforementioned antibody alone or conjugated to an imaging marker or therapeutic agent.
  • the invention also includes a composition comprising the aforementioned antibody in unconjugated or conjugated form in a pharmaceutically acceptable, non-toxic, sterile carrier.
  • the invention is directed to a method for in vivo diagnosis of cancer which comprises administering to an animal a pharmaceutically effective amount of the aforementioned composition for the in situ detection of carcinoma lesions.
  • the invention is also directed to a method for intraoperative therapy which comprises (a) administering to an animal a pharmaceutically effective amount of the aforementioned composition, whereby the tumors are localized, and (b) excision of the localized tumors.
  • the invention is directed to expression vectors or plasmids capable of effecting the production of such aforementioned antibodies in suitable host cells. It also includes the host cells and cell cultures which result from transformation with these vectors.
  • the invention is also directed to a method for finding (i.e. identifying) an unknown gene or genes encoding an unknown variable region(s), said unknown variable region having binding specificity for the same antigen as does a known variable region encoded by a known gene.
  • a detectably labeled, nucleic acid hybridization probe is prepared which comprises at least a portion, preferably about 15 nucleotides (or base pairs) or more, of the (+) and/or ( ⁇ ) strand of the 5′NTR of said known gene.
  • the probe is hybridized to nucleic acid(s) including unknown V-encoding nucleic acid(s), at least partly along their 5′NTR(s), to form probe-polynucleotide hybrid(s). Excess un-hybridized probe is washed away, and the remaining detectably-labeled probe-polynucleotide hybrid(s) are detected and may be isolated and/or further characterized.
  • FIG. 1 illustrates a basic immunoglobulin structure, with the enzymatic cleavage sites being indicated.
  • FIG. 2 i.e. FIGS. 2A-2G, illustrates the nucleotide sequences of V H ⁇ TAG V H (SEQ ID NO:1), CC46 V H (SEQ ID NO:7), CC49 V H (SEQ ID NO:3), CC83 V H (SEQ ID NO:5), and CC92 V H (SEQ ID NO:9).
  • FIG. 3 i.e. FIGS. 3A-3E, illustrates the amino acid sequences of V H ⁇ TAG V H (SEQ ID NO:2), CC46 V H (SEQ ID NO:8), CC49 V H (SEQ ID NO:4), CC83 V H (SEQ ID NO:6), and CC92 V H (SEQ ID NO:10).
  • FIG. 4A illustrates the nucleotide sequence (SEQ ID NO:11) and FIG. 4B illustrates the corresponding amino acid sequence (SEQ ID NO:12) of the CC49 V L .
  • FIG. 5A illustrates the nucleotide sequence (SEQ ID NO:13) and FIG. 5B illustrates the corresponding amino acid sequence (SEQ ID NO:14) of the CC83 V L .
  • FIG. 6A illustrates the nucleotide sequence (SEQ ID NO:27) and FIG. 6B illustrates the corresponding amino acid sequence (SEQ ID NO:28) of the CC92 V L .
  • FIG. 7 illustrates the nucleotide sequence of the Hind III-Pst I fragment (SEQ ID NO:15) isolated from the plasmid pGD1.
  • FIG. 8 illustrates the plasmid map of the pBLUESCRIPT SK( ⁇ ) (a nucleic acid vector from Stratagene, San Diego, Calif.).
  • FIG. 9 illustrates the plasmid map of the pRL101.
  • FIG. 10 illustrates a restriction enzyme map of the CC49 L chain genomic DNA insert in pRL101.
  • FIG. 11 illustrates the plasmid map of the pRL200.
  • FIG. 12 illustrates a restriction enzyme map of the CC83 L chain genomic DNA insert in pRL200.
  • FIG. 13 i.e. FIGS. 13A-13B, illustrates the nucleotide sequence of the Eco RI-Bam HI (SEQ ID NO:16) fragment isolated from the plasmid pNP9.
  • FIG. 14 illustrates the plasmid map of the pHH49.
  • FIG. 15 illustrates the plasmid map of the pHS83.
  • FIG. 16 shows the nucleotide sequence of CC49 V H (SEQ ID NO:25), with the underlined segments showing the sequences derived using oligonucleotide primers on mRNA.
  • FIG. 17 shows the nucleotide sequence of CC83 V H (SEQ ID NO:26), with the underlined segments showing the sequences derived using oligonucleotide primers on mRNA.
  • FIG. 18 shows the amino acid sequence of CC49 V H (SEQ ID NO:29), with the underlined segments showing the sequences determined by protein sequencing.
  • FIG. 19 shows the amino acid sequence of CC83 V H (SEQ ID NO:30), with the underlined segments showing the sequences determined by protein sequencing.
  • FIG. 20 shows the results of a SDS poly-acrylamide gel, with the results of PNGase F treatment of CC83 antibody.
  • FIG. 21, i.e. FIGS. 21A-21D illustrates the restriction enzyme maps of human gamma 1 (21A), gamma 2 (21B), gamma 3 (21C), and gamma 4 (21D).
  • FIG. 22 illustrates the plasmid map of pSV2gpt/R/B.
  • FIG. 23 illustrates the plasmid map of pSV2gpt- ⁇ 1-7.8.
  • FIG. 24 illustrates the plasmid map of pSV2gpt- ⁇ 1-2.3.
  • FIG. 25 illustrates the plasmid map of pSV2gpt- ⁇ 2.
  • FIG. 26 illustrates the plasmid map of pSV2gpt- ⁇ 3.
  • FIG. 27 illustrates the plasmid map of pSV2gpt- ⁇ 4.
  • FIG. 28 illustrates the plasmid map of p49 ⁇ 1-7.8.
  • FIG. 29 illustrates the plasmid map of p49 ⁇ 1-2.3.
  • FIG. 30 illustrates the plasmid map of p49- ⁇ 2.
  • FIG. 31 illustrates the plasmid map of p49- ⁇ 3.
  • FIG. 32 illustrates the plasmid map of p49- ⁇ 4.
  • FIG. 33 illustrates the plasmid map of p83 ⁇ 1-7.8.
  • FIG. 34 illustrates the plasmid map of p83 ⁇ 1-2.3.
  • FIG. 35 illustrates the plasmid map of p83- ⁇ 2.
  • FIG. 36 illustrates the plasmid map of p83- ⁇ 3.
  • FIG. 37 illustrates the plasmid map of p83- ⁇ 4.
  • FIG. 38 illustrates an SDS polyacrylamide gel showing the variation in size among the CH44-1 heavy (H) and light (L) chains compared to the corresponding chains of CC49.
  • FIG. 39 illustrates the overall reaction for the engineering of hybrid genes based on the method of Horton et al., Gene 77:61 (1989).
  • FIGS. 40A, 40 B, and 40 C show the biodistribution and whole body retention of CH44-1.
  • FIGS. 41A and 41B show the biodistribution and whole body retention of CH84-1.
  • FIG. 42 i.e. FIGS. 42A-42B, illustrates the partial nucleotide sequences of heavy chain variable regions of several antibodies derived from V H ⁇ TAG (SEQ ID NO:61): AHC46 (SEQ ID NO:62), AHC121 (SEQ ID NO:63), AHC139 (SEQ ID NO:64), AHC160 (SEQ ID NO:65).
  • FIG. 43 illustrates a technique for removing heavy chain constant region domains by use of splicing by overlap extension.
  • FIG. 44 illustrates the heavy chain constant region sequence of Ch44-CH3 ⁇ (SEQ ID NO:72): a constant region of the human ⁇ 1 heavy chain with removed CH3 domain.
  • FIG. 45 illustrates the heavy chain constant region sequence of Ch44-F(ab′) 2 (SEQ ID NO:73): a constant region of the human ⁇ 1 heavy chain with a removed CH2 and CH3 domains.
  • FIG. 46 illustrates the heavy chain constant region sequence of Ch44-Fab (SEQ ID NO:74): a constant region of the human ⁇ 3 heavy chains with a removed hinge region and CH2 and CH3 domains.
  • FIG. 47 illustrates the plasmid map of pRL103.
  • FIG. 48 illustrates the plasmid map of pRL104.
  • FIG. 49 illustrates the plasmid map of pGD1.
  • FIG. 50 illustrates the restriction map of the Bam HI fragment of phumC ⁇ .
  • FIG. 51 illustrates the plasmid map of pRL150.
  • FIG. 52 illustrates the plasmid map of pRL105.
  • FIG. 53 illustrates the plasmid map of pRL202.
  • FIG. 54 illustrates the plasmid map of pRL203.
  • FIG. 55 illustrates the plasmid map of pRL230.
  • the immunoglobulins of this invention have been developed to address the problems of murine monoclonal antibodies disclosed in the prior art. Each is characterized by having a chimeric structure composed of a heavy chain variable region encoded by DNA derived from the V H ⁇ TAG.
  • immunoglobulin refers to a tetramer or aggregate thereof whether or not specific immunoreactive activity is a property.
  • Antibodies refers to such assemblies which have significant known specific immunoreactive activity to an antigen, comprising light and heavy chains, with or without covalent linkage between them; “Non-specific immunoglobulin” (“NSI”) means those immunoglobulins which do not possess known specificity to an antigen.
  • the basic immunoglobulin structural unit in vertebrate systems is relatively well understood (Edelman, Ann. N.Y. Acad. Sci ., 190:5 (1971)). As seen in FIG. 1, the units are composed of two identical light polypeptide chains of molecular weight approximately 23,000 daltons, and two identical heavy chains of molecular weight 53,000-70,000. The four chains are joined by disulfide bonds in a “Y” configuration wherein the light chains bracket the heavy chains starting at the mouth of the “Y” and continuing through the diversity region.
  • Heavy chains are classified as gamma, mu, alpha, delta, or epsilon, with some subclasses among them. The nature of this chain, as it has a long constant region, determines the “class” of the antibody as IgA, IgD, IgE, IgG, or IgM.
  • Light chains are classified as either kappa ( ⁇ ) or lambda ( ⁇ ). Each heavy chain class may be bound with either a kappa or lambda light chain.
  • the light and heavy chains are covalently bonded to each other, and the “tail” portions of the two heavy chains are bonded to each other by covalent disulfide linkages when the immunoglobulins are generated either by hybridomas or by B cells.
  • the aggregate of non-disulfide-linked chains will still be capable of reaction with antigen.
  • the amino acid sequences run from an N-terminus at the forked edges of the Y to the C-terminus at the bottom of each chain. At the N-terminus is a variable region and at the C-terminus is a constant region.
  • variable and variable are used functionally.
  • the variable regions of both the light (V L ) and heavy (V H ) chains determine binding recognition and specificity to the antigen.
  • the constant region domains of light (C L ) and heavy (C H ) chains confer important biological properties such as antibody chain association, secretion, transplacental mobility, complement binding, and the like.
  • variable region is linked in each chain to the constant region by a linkage linking the V gene sequence and the C gene sequence.
  • the linkage occurs at the genomic level, combining nucleotide sequences via recombination sites.
  • the linking sequence is known as a “J” sequence in the light chain gene, which encodes about 12 amino acids, and as a combination of a “D” sequence and a “J” sequence in the heavy chain gene, which together encode approximately 25 amino acids.
  • Chimeric antibody for purposes of this invention refers to an antibody having in the heavy chain a variable region amino acid sequence encoded by a nucleotide sequence derived from a murine germline gene and a constant region amino acid sequence encoded by a nucleotide sequence derived from a human gene.
  • the present invention is not intended to be narrowly limited to merely substituting human C gene sequences encoding immunoglobulin constant regions for murine C gene sequences encoding immunoglobulin constant regions.
  • the present invention is not limited to whether or not the fusion point is at the variable/constant boundary.
  • “Composite” immunoglobulins comprise polypeptide variable regions not hitherto found associated with each other in nature. It is not critical whether any of the above are covalently or non-covalently aggregated, so long as the aggregation is capable of selectively reacting with a particular antigen or antigen family.
  • “Altered antibodies” means antibodies wherein the amino acid sequences, particularly in the variable region, has been varied. Because of the relevance of recombinant DNA techniques to this invention, one need not be confined to the amino acid sequences of antibodies selected from natural sources; amino acid sequences of the antibodies can be redesigned to obtain desired characteristics. The possible variations are many and range from the changing of just one or a few amino acids to the complete redesign of an antibody variable and/or constant region.
  • Changes in the variable region will be made in order to improve the antigen binding characteristics. Changes in the constant region will, in general, be made in order to improve the cellular process characteristics, such as complement fixation, interaction with membranes, and other effector functions. Alterations, can be made by standard recombinant techniques and also by oligonucleotide-directed mutagenesis techniques [Dalbadie-McFarland, et al. Proc. Natl. Acad. Sci . ( USA ) 79:6409 (1982)].
  • “Fragments” of immunoglobulins include segments of proteolytically-cleaved or recombinantly-prepared portions of an antibody molecule that are capable of selectively reacting with a particular antigen or antigen family.
  • Nonlimiting examples of such proteolytic and/or recombinant fragments include “Fab”, “F(ab′) 2 ”, and “Fab′”, with their proteolytic cleavage sites being shown in FIG. 1; as well as “Fv” fragment.
  • Recombinant techniques for producing Fv fragments are set forth in WO 88/01649, WO 88/06630, WO 88/07085, WO 88/07086, and WO 88/09344.
  • V H variable region
  • V L light chain variable region
  • mammals is meant to include primates, bovines, porcine, and rodents, etc.
  • “Expression vector” is given a functional definition, and any DNA sequence which is capable of effecting expression of a specified DNA code in a suitable host is included in this term. As at present, such vectors are frequently in the form of plasmids, thus “plasmid” and “expression vector” are often used interchangeably. However, the invention is intended to include such other forms of expression vectors which serve equivalent functions and which may, from time to time, become known in the art.
  • Transformation is meant the introduction of DNA into a recipient host cell that changes the genotype and consequently results in a change in the recipient cell.
  • “Host cells” refers to cells which have been recombinantly transformed with vectors constructed using recombinant DNA techniques. As defined herein, the antibody or modification thereof produced by a host cell is by virtue of this transformation.
  • the terms “cell” and “cell culture” are used interchangeably to denote the source of antibody unless it is clearly specified otherwise.
  • recovery of antibody from the “cells” may mean either from spun down whole cells, or from the cell culture containing both the medium and the suspended cells.
  • Nucleic acids, amino acids, peptides, protective groups, active groups and so on, when abbreviated, are abbreviated according to the IUPACIUB (Commission on Biological Nomenclature) or the practice in the fields concerned. The following are examples.
  • RNA Ribonucleic acid
  • DNA Deoxyribonucleic acid
  • DNA and RNA contain long chains of phosphoric acid, a sugar, and nitrogenous bases.
  • DNA is a double stranded helix, wherein the sugar is 2-deoxyribose
  • RNA is single stranded, wherein the sugar is D-ribose.
  • the four nitrogenous bases which characterize DNA nucleotides are linked in complementary pairs by hydrogen bonds to form the double helix of DNA: adenine is linked to thymine and guanine is linked to cytosine.
  • uracil is substituted for thymine in the listed DNA pairs.
  • Gly glycine Phe: phenylalanine Ala: alanine Tyr: tyrosine Val: valine Thr: threonine Leu: leucine Cys: cysteine Ile: isoleucine Met: methionine Ser: serine Glu: glutamic acid Asp: aspartic acid Trp: tryptophan Lys: lysine Pro: proline Arg: arginine Asn: asparagine His: histidine Gln: glutamine
  • the DNA encoding the heavy chain consists of a V H gene sequence, a D H gene sequence, and a J H gene sequence.
  • the DNA encoding the light chain consists of a V L gene sequence, and a J L gene sequence.
  • the present invention is directed to selected chimeric antibodies having the V H region encoded by a DNA sequence derived from a germline gene that is specifically reactive against TAG-72 (V H ⁇ TAG), the sequence of which is set forth in FIG. 2 (SEQ ID NO:1).
  • V H ⁇ TAG TAG-72
  • the chimeric antibodies are selected on the basis of their ability to bind TAG-72, namely wherein the variable region binds to TAG-72 at least 25 percent greater than the variable region of B72.3 binds to TAG-72.
  • the binding affinities of the chimeric antibody and B72.3 are measured by the same technique. Exemplary techniques for measuring antibody binding affinity are set forth in the following references: Scatchard, Annals of the N.Y. Acad.
  • the present invention is intended to include effectively homologous nucleotide sequences and corresponding amino acid sequences.
  • Effectively homologous refers to identity or near identify of nucleotide or amino acid sequences.
  • Homology is expressed as the fraction or percentage of matching bases (or amino acids) after two sequences (possibly of unequal length) have been aligned.
  • alignment is used in the sense defined by Sankoff and Kruskal in Chapter One of their book, The Time Warps, String Edits, and Macromolecules: The Theory and Practice of Sequence Comparison , Addison-Wesley, Reading, Mass., USA (1983). Roughly, two sequences are aligned by maximizing the number of matching bases (or amino acids) between the two sequences with the insertion of a minimal number of “blank” or “null” bases into either sequence to bring about the maximum overlap.
  • nucleotide mismatches can occur at the third or wobble base in the codon without causing amino acid substitutions in the final polypeptide sequence.
  • minor nucleotide modifications e.g., substitutions, insertions or deletions
  • substitutions, insertions or deletions in certain regions of the gene sequence can be tolerated and considered insignificant whenever such modifications result in changes in amino acid sequence that do not alter functionality of the final product. It has been shown that chemically synthesized copies of whole, or parts of, gene sequences can replace the corresponding regions in the natural gene without loss of gene function.
  • Homologs of specific DNA sequences may be identified by those skilled in the art using the test of cross-hybridization of nucleic acids under conditions of stringency as is well understood in the art [as described in Nucleic Acid Hybridization , Hames and Higgens (eds.), IRL Press, Oxford, UK (1985)]. Given two sequences, algorithms are available for computing their homology: e.g. Needleham and Wunsch, J. Mol. Biol ., 48:443-453 (1970); and Sankoff and Kruskal (1983), supra. Also, commercial services are available for performing such comparisons, e.g. Intelligenetics, Inc. (Palo Alto, Calif., USA).
  • the D H and J H gene segments exist in various types, although the type of D or J gene segment selected is not critical to the invention. That is the D H and J H may be derived from any animal. Preferred animals include mice and humans. Obviously, human D H and/or J H gene segments are particularly preferred, but the invention is not so limited if a D or J gene segment from another animal species provides an important property, i.e., increased binding to TAG-72.
  • Exemplary murine D H and J H sequences are set forth in Kurosawa and Tonegawa, J. Exp. Med ., 155:201 (1982); and Gough and Bernard, Proc. Natl. Acad. Sci . ( USA ), 78:509 (1981).
  • Exemplary human D H and J H sequences are set forth in Siebenlist et al. in Nature , 294:631 (1981); and exemplary human J H sequences are set forth in Ravetch et al., Cell , 27:583 (1981).
  • any V L and J L gene sequences may be employed that encodes a portion of a V L which is complementary to the V H encoded by a nucleotide sequence effectively homologous to V H ⁇ TAG.
  • complementary means a V L that binds to the V H and which yields an antibody variable region having a binding affinity of at least 25 percent more than B72.3, as measured by any standard technique for measuring binding affinity constants.
  • V L and J L gene segment selected is not critical to the invention. That is the V L and J L may be derived from any animal. Preferred animals include mice and humans. Obviously, human V L and/or J L gene segments are particularly preferred, but the invention is not so limited if a J L gene segment from another species provides an important property, i.e., increased binding to TAG-72.
  • Murine J L sequences are set forth in Max, et al., J. Biol. Chem ., 256:5116-5120 (1981). Human J L sequences are set forth in Heiter et al., The Journal of Biological Chemistry , 357(2):1516-1522 (1982).
  • variable regions within the scope of the present invention, i.e., having effectively homologous V H sequences to V H ⁇ TAG and binding to TAG-72 at least 25 percent greater than the variable region of B72.3 binds to TAG-72, with the binding affinities of the antibody and B72.3 being measured by the same technique.
  • variable region of antibodies produced by the B cells will be encoded by rearranged germline heavy and light chain DNA.
  • the rearranged germline heavy chain will include the V, D, and J gene segments including the leader sequence, as well as any introns which may be subsequently removed.
  • the light chain coding DNA will include the V and J gene segments including the leader sequence, as well as any introns which may be subsequently removed.
  • Variability may result from somatic mutations occurring in a B cell during productive rearrangement of the V H ⁇ TAG.
  • somatic mutations are nucleotide changes that may or may not result in an amino acid change that alters the activity toward TAG-72 of the productively rearranged V H .
  • Monoclonal or polyclonal antibodies may be screened to determine which of said antibodies selectively bind to TAG-72. Such screening may be accomplished by any of a number of well-known procedures, such as solid-phase radioimmunoassay, enzyme-linked immunosorbent assays, rosetting assays, blocking assays, and the like. The above-described procedures are well-known in the art.
  • FIGS. 2A-2G show the nucleotide sequences encoding the heavy chain variable regions of CC46, CC49, CC83 and CC92 antibodies, respectively (SEQ ID NO:7, SEQ ID NO:3, SEQ ID NO:5, and SEQ ID NO:9, respectively).
  • 3A-3E show the amino acid sequences of V H ⁇ TAG V H , CC46 V H , CC49 V H , CC83 V H , and CC92 V H , corresponding to the nucleotide sequences set forth in FIGS. 2A-2G.
  • the nucleotide sequences and corresponding amino acid sequences of CC49 V L are shown in FIGS. 4A and 4B, respectively (SEQ ID NO:11 and SEQ ID NO:12, respectively).
  • the nucleotide sequences and corresponding amino acid sequences of CC83 V L are shown in FIGS. 5A and 5B, respectively (SEQ ID NO:13 and SEQ ID NO:14, respectively).
  • the nucleotide sequences and corresponding amino acid sequences of CC92 V L are shown in FIGS. 6A and 6B, respectively.
  • V H ⁇ TAG antibodies encoded by DNA derived from V H ⁇ TAG may be derived by using V H ⁇ TAG as a hybridization probe.
  • a probe made from the DNA or RNA of the V H ⁇ TAG or rearranged genes containing the recombined V H ⁇ TAG could be used to find homologous genes in unknown hybridomas to those skilled in the art.
  • This essentially provides a prototype sequence for a starting point in discovering antibody variable region genes derived from the same germline gene, i.e., a “subset”.
  • Such homologous antibodies will have a DNA sequence whose mRNA hybridizes with the probe of all or a part of the V H ⁇ TAG germline gene and its flanking regions.
  • flanking regions is meant to include those DNA sequences from the 5′ end of the V H ⁇ TAG to the 3′ end of the upstream gene, and from 3′ end of the V H ⁇ TAG to the 5′ end of the downstream gene.
  • the subject method may be used for the detection of specific sequences of nucleic acids from a wide variety of sources.
  • the target sequence can be any whole or portion of genomic material, or nucleic acid gene product such as messenger RNA. Any source of nucleic acid, in purified or nonpurified form, can be utilized provided it contains or is suspected of containing the 5′ nontranslated region of interest.
  • the target nucleic acid can be single or double stranded.
  • the probes may comprise a probe region, that is a nucleotide sequence which is complementary to a target sequence; and a non-probe region, that is, a nucleotide sequence which is not complementary to the target sequence.
  • the probe need not be single continuous polynucleotide segment, but may be comprised of two or more individual segments. Moreover, a single probe sequence may be interrupted by noncomplementary sequences. It will be understood that the probe may refer to more than one polynucleotide, particularly in the case where there is some ambiguity in the information regarding the 5′ nontranslated region.
  • Probes may be single stranded or double stranded DNA or RNA, provided that, where both the target nucleic acid and the probe nucleotide sequence are single-stranded, one is a (+) strand and the other is a ( ⁇ ) strand.
  • a probe sequence can be selected. It is only necessary that a number of bases in the 5′ nontranslated region be known in sufficient detail that a probe can be produced so as to identify such a unique sequence, i.e., the effective sequence to distinguish subset members. The greater the knowledge of the bases of the 5′ nontranslated region of the sequence, the greater can be the specificity of the probe for the (5′NTR of the) target nucleic acid sequence, and thus the greater the efficiency of the process.
  • the target nucleic acid will likewise be a heavy chain variable region gene; or if light chain variable region gene 5′NTR for the probe, then light chain variable region gene for the target.
  • the probe sequences complementary to the target can be larger or small, so long as sufficiently stable double stranded hybrids form between the probe the target sequence.
  • the polynucleotide probe will have enough bases to provide specificity for the target sequence. Generally, the polynucleotide probe will have at least about 15 bases, more usually at least about 20 to about 50 bases, and may have up to about 10,000 bases or more.
  • the target sequence is likely to be found in the presence of a vast abundance of polynucleotides of different sequence. It is therefore necessary that its method of detection be highly specific. Further, since little DNA of the characteristic sequence may be available for analysis, a method of high sensitivity is also desirable. Consequently, the probe is preferably selected to be capable of hybridizing with as long a piece of the target sequence as possible. Moreover, the greater percentage of bases in the target sequence for which the probe is specific, the greater will be the specificity of the probe for members of a given subset.
  • the probe sequence need not reflect the exact sequence of the 5′ nontranslated region since hybridization may occur in the presence of mismatched pairs. In fact, there may be unhybridized regions of the target (without complementary regions present on the probe) extending from the hybrid or within the hybridized regions of the two molecules. Such unhybridized regions of DNA may affect (generally reduce) the efficiency of the process.
  • the complementary probe sequence can be composed of RNA or DNA regardless of whether the sample sequence of interest is composed of either DNA or RNA.
  • hybrids resulting from hybridization between the probe and the sample sequence may be DNA:RNA, DNA:DNA, or RNA:RNA duplexes.
  • the nucleic acids for use as a probe may be obtained from a variety of sources known to those of ordinary skill in the art.
  • Polynucleotides used in preparing the probe of the invention can be prepared by known techniques. These include biological and synthetic techniques.
  • the probe may be obtained from the “isolation” of a polynucleotide sequence from natural sources or from the chemical manufacture of a polynucleotide sequence.
  • probes it is necessary for the probes to be detectable after hybridization with the target sequence. This may be achieved by any known labeling technique. A skilled person will be aware of the techniques required for the introduction of these and other known labels and for the detection of such labels.
  • the specimens screened will be animal (e.g., human and mouse) tissues or body fluids. More preferably, the specimens will be tissue expected to have a relatively high concentration of lymphocytes sensitized to an antigen of interest (e.g., primary and secondary lymph organs, white blood cells in the peripheral blood, neoplastic tissue, and hybridomas).
  • an antigen of interest e.g., primary and secondary lymph organs, white blood cells in the peripheral blood, neoplastic tissue, and hybridomas.
  • the probe may be used to merely screen target sequences isolated from selected tissues.
  • a preferred tissue is hybridoma cells, because individual cells may be easily isolated by limiting dilution techniques. In some instances, it may however be possible to isolate and stimulate spleen or peripheral blood cells in vitro to generate an antibody (see, for example, U.S. Pat. No. 4,444,887).
  • the screening is accomplished by contacting the sample with an amount of a reagent sufficient to lyse the cells and to expose and separate the strands of the nucleic acid(s).
  • the probe is contacted with the lysed cells under suitable conditions to permit hybridization of only substantially complementary molecules to remain hybridized and causing imperfectly hybridized molecules to separate.
  • Conditions that influence the formation of polynucleotide hybrids are well known and described in detail in Sambrook et al. (1989), Molecular Cloning: A Laboratory Manual, (2nd ed.), supra; and Crosa et al., J. Bact , 115:904-911 (1973), the teachings of which are hereby incorporated by reference.
  • the probe itself can be detected by a variety of techniques including spectroscopic, photochemical, immunochemical, radiochemical, biochemical or chemical means. These protocols may include, for example, radioimmunoassay (RIA), immunoradiometric assay (IRMA), sandwich IRMA, fluoroimmunoassay (FIA), chemiluminescent assays, bioluminescent assays and enzyme linked immunosorbent assays (ELISA).
  • RIA radioimmunoassay
  • IRMA immunoradiometric assay
  • sandwich IRMA sandwich IRMA
  • fluoroimmunoassay chemiluminescent assays
  • bioluminescent assays bioluminescent assays
  • enzyme linked immunosorbent assays ELISA
  • PCR polymerase chain reaction
  • PCR primer PCR-priming oligonucleotide
  • V H and/or V L gene segments may be altered by mutagenesis.
  • Exemplary techniques include the addition, deletion, or nonconservative substitution of a limited number of various nucleotides or the conservative substitution of many nucleotides, provided that the proper reading frame is maintained.
  • Substitutions, deletions, insertions or any subcombination may be combined to arrive at a final construct. Since there are 64 possible codon sequences but only twenty known amino acids, the genetic code is degenerate in the sense that different codons may yield the same amino acid. However, the code is precise for each amino acid; thus there is at least one codon for each amino acid, i.e., each codon yields a single amino acid and no other. It will be apparent that during translation, the proper reading frame must be maintained in order to obtain the proper amino acid sequence in the polypeptide ultimately produced.
  • Techniques for additions at predetermined amino acid sites having a known sequence are well known. Exemplary techniques include oligonucleotide-mediated, site-directed mutagenesis and polymerase chain reaction.
  • Techniques for deletions at predetermined amino acid sites having a known sequence are well known. Exemplary techniques include oligonucleotide-mediated site-directed mutagenesis and the polymerase chain reaction.
  • Techniques for substitutions at predetermined amino acid sites having a known sequence are well known. Exemplary techniques include site-directed mutagenesis, and the polymerase chain reaction technique.
  • Oligonucleotide site-directed mutagenesis in essence involves hybridizing an oligonucleotide coding for a desired mutation with a single strand of DNA containing the region to be mutated and using the single strand as a template for extension of the oligonucleotide to produce a strand containing the mutation.
  • This technique in various forms, is described by Zoller and Smith, Nuc. Acids Res ., 10:6487-6500 (1982); Norris et al., Nuc. Acids Res ., 11:5103-5112 (1983); Zoller and Smith DNA , 3:479-488 (1984); Kramer et al., Nuc. Acids Res ., 10:6475-6485 (1982).
  • PCR may be employed to use sequence specified oligonucleotides to incorporate sequence alterations, if desired. Examples of mutagenesis using PCR are described in Higuchi et al., Nucl. Acids Res ., 16:7351-7367 (1988); Ho et al., Gene , 77:51-59 (1989), and Horton et al., Gene , 77:61 (1989).
  • the antibodies may be constructed by recombinant techniques.
  • the inventors have provided the nucleotide sequences of various V H - and V L -encoding regions, a skilled artisan could in vitro produce a complete gene coding for the heavy and light chain variable regions.
  • the constructed gene may be engineered in which selected D H and J H gene segments are in functional combination with a selected V H gene segment, i.e., the V H ⁇ TAG segment, or the V H gene segment of CC49 or CC83.
  • the constructed heavy chain coding DNA will include D H and J H gene sequences which are contiguous with the 3′ end of the germline V H ⁇ TAG gene segment, thereby completing the CDR3 and framework (FR4) of the V H domain.
  • a leader sequence may be present but may be subsequently removed.
  • Such a DNA gene will comprise a V L gene segment in functional combination, e.g., contiguous with a J L gene segment, including the leader sequence which may be subsequently removed.
  • the J L gene segment will vary depending upon whether the light chain is of the lambda or kappa system.
  • the J region sequence is contiguous with the end of the V L exon to complete FR 4 of the V L domain. Such a construction may be carried out by the techniques used to construct the V H gene.
  • the constructed gene may be engineered by conventional recombinant techniques, for example, to provide a gene insert in a plasmid capable of expression. Thereafter, the plasmids may be expressed in host cells. Exemplary recombinant biological techniques are set forth below.
  • the intron downstream from the J region may be primarily the intron sequence associated with (1) the constant region, (2) the J domain, or (3) portions of each. The last may be a matter of convenience where there is a convenient restriction site in the introns from the two sources. It may be necessary to provide adapters to join the intron to the constant region.
  • all or a portion of the intron may be modified by deletion, nucleotide substitution(s) or insertion, to enhance ease of manipulation, expression, or the like.
  • a sufficient amount of the intron should be present to contain an enhancer that is functionally active with the naturally-occurring promoter.
  • the fused gene free of the intron between the J gene and C gene.
  • the 3′ terminus of the J gene will be adjacent to the 5′ terminus of the C gene.
  • an artificial promoter which does not need to be functionally active with an enhancer, will generally be utilized
  • the genes encoding the V H and V L regions may be altered by replacing at least parts of the complementarity determining regions (CDRs) in the light or heavy chain variable domains of the antibody with analogous parts of CDRs from an antibody of different specificity.
  • CDRs complementarity determining regions
  • the inventors have disclosed the nucleotide sequences corresponding to the V H amino acid sequences of the V H ⁇ TAG, CC46, CC49, CC83 and CC92, as well as of the CC49, CC83 and CC92 V L gene segments. Consequently, it is envisaged that the CDRs from the antibodies of the present invention can be grafted onto the framework regions of a human antibody.
  • the CDR regions from a human V H or V L domain may be replaced by CDRs from the V H or V L regions of antibodies of the present invention.
  • exemplary human antibodies from which the framework portions may be used include human plasmacytoma NEWM, [Jones et al., Nature , 321:522-525 (1986)], publicly available from Dr. Greg Winter; and various other human V H and V L genes available from Dr. Terrence Rabbitts, both researchers being from the Medical Research Council, 20 Park Crescent, London, W1N 4AL.
  • the determination as to what constitutes a CDR and what constitutes a framework region may be made on the basis of the amino-acid sequences of a selected Ig as indicated in Kabat et al., Sequences of Proteins of Immunological Interest , Fourth Edition (1987), U.S. Dept. of Health and Human Services, NIH.
  • the four framework regions largely adopt a ⁇ -sheet conformation and the CDRs form loops connecting, and in some cases forming part of, the ⁇ -sheet structure. Moreover, not all of the amino-acid residues in the loop regions are solvent accessible and in one case, amino-acid residues in the framework regions are involved in antigen binding (see Amit et al., Science , 233:747-753, (1986)). It is also known that the variable regions of the two parts of an antigen binding site are held in the correct orientation by inter-chain, non-covalent interactions.
  • variable domains in both the heavy and light chains are altered by at least partial CDR replacement and, if necessary, by partial framework region replacement and sequence changing.
  • the CDRs may be derived from an antibody of the same class or even subclass as the antibody from which the framework regions are derived, it is envisaged that the CDRs will be derived from an antibody of different class and preferably from an antibody from a different species.
  • the V gene encoding the V L is the same V gene which encodes the V L naturally combined with the V H of choice.
  • the V gene which encodes the V L regions of CC49 and CC83 are beneficially used when employing the V gene which encodes the V H of CC49 and CC83, respectively.
  • V H regions of the antibodies of the present invention are encoded by V H genes derived from V H ⁇ TAG, composite antibodies may be beneficially formed.
  • the V H region of one antibody of the present invention may suitably be combined with the V L region of another antibody of the present invention.
  • the amino acid sequences of the CC49 and CC83 heavy chains are superficially close, it would be expected that a change of a few or even one amino acid may drastically affect the binding function of the antibody, i.e., the resultant antibodies are generally presumed to be a non-specific immunoglobulin (NSI), i.e.—lacking in antibody character, (see European Published Patent Application 0 125 023).
  • NSI non-specific immunoglobulin
  • an antibody having the requisite V H of this invention need not be recombined only with a V L from the same naturally occurring animal antibody.
  • a chimeric antibody having a heavy chain with a V H from CC83 and a light chain with a V L from CC49 wherein the composite antibody thus formed has a binding specificity 25 percent greater than the binding affinity of B72.3 to TAG-72.
  • the C H domains may be of various human isotypes, i.e., IgG (e.g., IgG 1 , IgG 2 , IgG 3 , and IgG 4 ), IgA, IgD, IgM, as well as the various subtypes of the individual groups.
  • IgG e.g., IgG 1 , IgG 2 , IgG 3 , and IgG 4
  • IgA, IgD, IgM as well as the various subtypes of the individual groups.
  • the C L domain may be human kappa ( ⁇ ) or human lambda ( ⁇ ).
  • the C H and/or C L gene segments may be “altered” by mutagenesis.
  • Exemplary techniques include the addition, deletion, or nonconservative substitution of a limited number of various nucleotides or the conservative substitution of many nucleotides, provided that the proper reading frame is maintained.
  • entire domains of the protein can be altered, for example, by substituting C H 2 for C H 3. This substitution is made at the DNA level by inserting, deleting or substituting entire exons of sequence.
  • the first technique for producing antibodies, whether monoclonal or polyclonal, having V H regions encoded by DNA derived from V H ⁇ TAG is to immunize a host animal with purified TAG-72.
  • Exemplary protocols for immunizing a host animal with TAG-72 are set forth in U.S. Pat. Nos. 4,522,918 and 4,612,282, using a human breast carcinoma extract as the immunogen; and U.S. Pat. No. 7,073,685 (abandoned, continued as U.S. Pat. No. 7,547,336, now U.S. Pat. No. 5,512,443, which is available to the public), using TAG-72 purified with B72.3 as the immunogen.
  • monoclonal or polyclonal antibodies produced from the immunization protocol are screened to determine which of said antibodies selectively bind to TAG-72.
  • screening may be accomplished by any of a number of well-known procedures, such as solid-phase radioimmunoassay, enzyme-linked immunosorbent assays, resetting assays, blocking assays, and the like. The above-described procedures are well known in the art.
  • Immunoglobulins of the present invention can be synthesized from their constituent amino acids. Suitable techniques are the Merrifield solid phase method, as described in J. Amer. Chem. Soc ., 85:2149-2154 (1963). This solid phase method for synthesizing sequences of amino acids is also described on pages 1-4 of a book by Stewart and Young, Solid Phase Peptide Synthesis (W. H. Freemen and Co., San Francisco, 1969).
  • the DNA encoding the antibody heavy and light chains may be obtained from a variety of sources known to those of ordinary skill in the art, for example, genomic DNA, cDNA, synthetic DNA, or a combination thereof.
  • Cells coding for the desired sequence may be isolated, and genomic DNA fragmented by one or more restriction enzymes.
  • the genomic DNA may or may not include naturally-occurring introns.
  • the resulting fragments may then be cloned and screened using a heavy chain J region (J H ) probe for the presence of the DNA sequence coding for the polypeptide sequence of interest.
  • J H heavy chain J region
  • the DNA may also be obtained from a cDNA library.
  • Messenger RNA coding for heavy or light chain is isolated from a suitable source, either mature B cells or a hybridoma culture, employing standard techniques of RNA isolation, and the use of oligo-dT cellulose chromatography to segregate the poly-A mRNA.
  • the poly-A mRNA may, further, be fractionated to obtain sequences of sufficient size to code for the amino acid sequences in the light or heavy chain of the desired antibody as necessary.
  • a cDNA library is then prepared from the mixture of mRNA using a suitable primer, preferably a nucleic acid sequence which is characteristic of the desired cDNA.
  • a suitable primer may be synthesized based on the amino acid sequence of the antibody.
  • cDNA from unfractionated poly-A mRNA from a cell line producing the desired antibody or poly-dT may also be used.
  • the resulting cDNA is optionally size fractionated on polyacrylamide gel and then extended with, for example, dC residues for annealing with pBR322 or other suitable cloning vector which has been cleaved by a suitable restriction enzyme, such as Pst I, and extended with dG residues.
  • a suitable host cell strain typically Escherichia coli ( E. coli )
  • E. coli is transformed with the annealed cloning vectors, and the successful transformants identified by means of, for example, ampicillin or tetracycline resistance or other phenotypic characteristics residing on the cloning vector plasmid.
  • Nitrocellulose filter imprints of these growing cultures are then probed with suitable nucleotide sequences containing bases known to be complementary to desired sequences in the cDNA.
  • suitable nucleotide sequences containing bases known to be complementary to desired sequences in the cDNA.
  • Several types of probe may be used, preferably synthetic single stranded DNA sequences labeled by kinasing with ⁇ - 32 P ATP.
  • the cells fixed to the nitrocellulose filter are lysed, the DNA denatured, and then fixed before reaction with kinased probe. Clones which successfully hybridize are detected by contact with a photoplate, then plasmids from the growing colonies isolated and sequenced by means known in the art to verify that the desired portions of the gene are present.
  • nucleotides are added to the 5′ end to include a start signal and a suitably positioned restriction endonuclease site.
  • the DNA also may be synthetically synthesized, for example, using an APPLIED BIOSYSTEMS Model 380A DNA Synthesizer (from Perkin-Elmer Corp., Foster City, Calif.), and constructed by standard techniques.
  • an APPLIED BIOSYSTEMS Model 380A DNA Synthesizer from Perkin-Elmer Corp., Foster City, Calif.
  • an exemplary technique for utilizing combination of the above techniques is by splicing with overlap extension using polymerase chain reaction technology, see Horton et al. (1989), supra.
  • a synthetically synthesized primer having a so-called “wagging tail”
  • a selected sequence for example genomic DNA.
  • the sequences are amplified and spliced together.
  • the DNA fragment encoding the amino acid sequence of the human constant region may be obtained by screening the chromosomal DNA of cells producing human immunoglobulin.
  • the desired DNA fragment may be positioned in a biologically functional expression vehicle which may contain appropriate control sequences not present in the selected DNA fragment.
  • biologically functional is meant that the expression vehicle provides for replication and/or expression in an appropriate host, either by maintenance as an extrachromosomal element or by integration into the host genome.
  • a large number of vectors are available or can be readily prepared, and are well known to skilled artisans.
  • the vectors and methods disclosed herein are suitable for use over a wide range of microorganisms, either prokaryotic and eukaryotic, which are susceptible to transformation.
  • the plasmid will be capable of replicating in the microorganism, particularly a bacterium.
  • plasmid vectors containing the appropriate promoters which can be used by the microbial organism for expression of its own protein, also contain control sequences, ribosome binding sites, and transcription termination sites.
  • control sequences ribosome binding sites, and transcription termination sites.
  • replicon and control sequences which are derived from species compatible with the host cell are used in connection with these hosts.
  • Smaller or larger SV40 fragments may also be used, provided there is included the approximately 250 base pair (bp) sequence extending from the Hind III site toward the Pvu II site located in the viral origin of replication. Further, it is also possible, and often desirable, to utilize promoter or control sequences normally associated with the desired gene sequence, provided such control sequences are compatible with the host cell systems.
  • the plasmid should desirably have a gene, a marker gene, that is capable of providing a phenotypical property which allows for selection of host cells containing the expression vector.
  • a gene that provides for survival selection is particularly useful. Survival selection can be achieved by providing resistance to a growth inhibiting substance or providing a growth factor capability to a bacterium deficient in such capability.
  • pBR322 a plasmid derived from an E. coli species [Bolivar et al., Gene , 2:95 (1977)] is particularly useful.
  • pBR322 contains genes for ampicillin and tetracycline resistance and thus provides an easy means for identifying transformed cells.
  • E. coli strains such as E. coli B, E. coli K12 strain 294 (ATCC No. 31446) and E. coli X1776 (ATCC No. 31537), E. coli W3110 (F ⁇ , ⁇ ⁇ , prototrophic, ATCC No. 27325), bacilli such as Bacillus subtilus , and other enterobacteriaceae such as Salmonella typhimurium or Serratia marcesans , and various Pseudomonas species may be used. These examples are intended to be illustrative only.
  • eukaryotic microbes may also be used. Saccharomyces cerevisiae , or common baker's yeast, is the most commonly used among eukaryotic microorganisms although a number of other strains are commonly available.
  • the plasmid YRp7 for example, (Stinchcomb et al., Nature , 282:39 (1979); Kingsman et al., Gene , 7:141 (1979); Tschemper et al., Gene , 10:157 (1980)) is commonly used.
  • This plasmid already contains the trpl gene which provides a selection marker for a mutant strain of yeast lacking the ability to grow in tryptophan, for example ATCC No. 44076 or PEP4-1 (Jones, Genetics , 85:12 (1977)).
  • the presence of the trpl lesion as a characteristic of the yeast host cell genome then provides an effective environment for detecting transformation by growth in the absence of tryptophan.
  • Any plasmid vector containing a yeast-compatible promoter, origin of replication and termination sequence is suitable for use in yeast.
  • Suitable promoting sequences in yeast vectors include the promoters for 3-phosphoglycerate kinase [Hitzeman et al., J. Biol. Chem . 255:2073 (1980)] or other glycolytic enzymes [Hess et al., J. Adv. Enzyme Reg ., 7:149 (1968); Holland et al., Biochemistry , 17:4900 (1978)].
  • control functions on the expression vectors are often provided by viral material.
  • promoters are derived from polyoma, Adenovirus 2, and most frequently Simian Virus 40 (SV40).
  • SV40 Simian Virus 40
  • the early and late promoters of SV40 virus are particularly useful because both are obtained easily from the virus as a fragment which also contains the SV40 viral origin of replication [see Fiers et al., Nature , 273:113 (1978)].
  • pSV2neo contains a gene for neomycin resistance which is under the control of an SV40 promoter.
  • pSV2neo provides easy means for identifying cells transformed with genes for both the animal variable region and human constant region.
  • the genes coding for the heavy chain or the light chain will be constructed by joining the 5′-end of a DNA fragment which encodes the constant region to the 3′ end of a DNA fragment which encodes the variable region.
  • the DNA sequence coding for the antibody amino acid sequence may be obtained in association with the promoter and replication site from genomic DNA. To the extent that the host cells recognize the transcriptional regulatory and translational initiation signals associated with the heterologous genes, then the region 5′ and 3′ of the variable region coding sequence may be retained with the variable region coding sequence and employed for transcriptional and translational initiation regulation.
  • the non-coding region 3′ to the constant region may be retained for its transcriptional termination regulatory sequences, such as termination and polyadenylation.
  • 5′ or 3′ for a double strand it is intended to mean the direction of transcription, with 5′ being upstream from 3′.
  • the intron sequence between the variable region for each respective chain may be joined to the corresponding human constant DNA fragment at any convenient restriction site.
  • it will usually be desirable to include a portion of the intron downstream from the J region. Where the intron is retained, it will be necessary that there be functional splice acceptor and donor sequences at the intron termini.
  • the contiguous non-coding region 5′ to the variable region will normally include those sequences involved with initiation of transcription and translation, such as the TATA box, capping sequence, CAAT sequence, and the like.
  • the 5′-non-coding sequence does not exceed about 1-2 kilo bases (kb).
  • An enhancer sequence should exist between the J region and the constant region.
  • the enhancer employed may be the enhancer of either (1) the animal V region or (2) the human constant region.
  • the transcriptional termination signals may be provided for the gene.
  • a 3′ region functional in the host cell may be substituted.
  • the non-coding 3′ region may be obtained from a non-coding contiguous 3′ region of a constant region from the expression host.
  • the 3′-non-coding region may be joined to the constant region by any of the means described previously for manipulation and ligation of DNA fragments. This region could then be used as a building block in preparing the gene.
  • Suitable expression vehicles containing the desired coding and control sequences may be produced as follows. The termini of the vectors and DNA fragments may then be religated to form the desired expression vehicles. The methods employed are not dependent on the DNA source, or intended host.
  • DNA fragments coding for the light chain and heavy chain may be inserted into separate expression vehicles, or into the same vector.
  • the fused genes encoding the light and heavy chimeric chains are assembled in two different expression vectors which can be used to cotransform a recipient cell, either concurrently or sequentially.
  • restriction endonucleases are hydrolytic enzymes capable of catalyzing site-specific cleavage of DNA molecules.
  • the locus of restriction endonuclease action is determined by the existence of a specific nucleotide sequence. Such a sequence is termed the recognition site for the restriction endonuclease.
  • Many restriction endonucleases from a variety of bacterial species have been isolated and characterized in terms of the nucleotide sequence of their recognition sites.
  • restriction endonucleases hydrolyze the phosphodiester bonds on both strands at the same point, producing blunt ends. Others catalyze hydrolysis of bonds separated by a few nucleotides from each other, producing free single stranded regions at each end of the cleaved molecule. Such single stranded ends are self-complementary, hence cohesive, and may be used to rejoin the hydrolyzed DNA.
  • Exemplary restriction enzymes include Aat II, Bam HI, Eco RI, Hind III, Nde I, Spe I, Xba I, Sac I, Bgl II, Pst I, Sal I and Pvu II.
  • the expression vector may have a polylinker inserted therein which has a plurality of unique restriction sites.
  • the polylinker will be cleaved so that at least one DNA fragment containing the gene can be inserted.
  • the polylinker allows for distinguishable termini, the DNA fragment can be inserted in a single orientation; were the termini are the same, insertion of the DNA fragment will result in plasmids having two different orientations.
  • Cleavage is performed by treating the plasmid with a restriction enzyme(s).
  • a restriction enzyme(s) In general, about 10 ⁇ g plasmid or DNA fragments is used with about 10 unit of enzyme in about 100 ⁇ l of buffer solution. Endonuclease digestion will normally be carried out at temperatures ranging from about 37° to 65° C., at a pH of about 7 to about 9. (Appropriate buffers and substrate amounts for particular restriction enzymes are specified by the manufacturers.) Time for the reaction will be from about 1 to about 18 hours.
  • alkaline phosphatase It may be useful to prevent religation of the cleaved vector by pretreatment with alkaline phosphatase. Specific conditions are prescribed by the manufacturer.
  • nucleic acid is recovered from the aqueous fraction (containing about 0.3 M sodium acetate) by precipitation with about 2.5 volumes of ethanol.
  • Size separation of the cleaved fragments by agarose gel electrophoresis is readily performed to follow the course of the reaction. Once the digestion has gone to the desired degree, the endonuclease may be inactivated by heating above 65° C. for about 10 minutes or organic extraction.
  • the desired fragment is then purified from the digest.
  • Suitable purification techniques include gel electrophoresis or sucrose gradient centrifugation.
  • the plasmid vehicle and foreign DNA fragments are then ligated with DNA ligase to recircularize. This process is referred to as annealing and DNA ligation.
  • An appropriately buffered medium containing the DNA fragments, DNA ligase, and appropriate cofactors is employed.
  • the temperature employed will be between about 25° to about 4° C. When DNA segments hydrogen bond, the DNA ligase will be able to introduce a covalent bond between the two segments.
  • the time employed for the annealing will vary with the temperature employed, the nature of the salt solution, as well as the nature of the sticky ends or cohesive termini. Generally, the time for ligation may be from 5 to 18 hours. See Maniatis T., Molecular Cloning , Cold Spring Harbor, supra.
  • Suitable host cells include cells derived from unicellular as well as multicellular organisms.
  • the chimeric immunoglobulin genes can be expressed in nonlymphoid cells such as bacteria or yeast.
  • bacteria Various unicellular microorganisms can be transformed, such as bacteria. That is, those unicellular organisms which are capable of being grown in cultures or fermentation. Since bacteria are generally the most convenient organisms to work with, bacteria will be hereinafter referred to as exemplary of the other unicellular organisms.
  • Bacteria, which are susceptible to transformation include members of the Enterobacteriaceae, such as strains of Escherichia coli ; Salmonella; Bacillaceae, such as Bacillus subtilis ; Pneumococcus; Streptococcus, and Haemophilus influenzae.
  • the immunoglobulin heavy chains and light chains become part of inclusion bodies. The chains then must be isolated, purified and then assembled into functional immunoglobulin molecules.
  • eukaryotic microbes such as yeast cultures may also be used. Saccharomyces cerevisiae , or common baker's yeast is the most commonly used among eukaryotic microorganisms, although a number of other strains are commonly available. The presence of the trpl lesion as a characteristic of the yeast host cell genome provides an effective environment for detecting transformation by growth in the absence of tryptophan.
  • cultures of cells derived from multicellular organisms may also be used as hosts.
  • any such cell culture is workable, whether from vertebrate or invertebrate culture, provided that the cell line is one that at least originally produced antibodies. Propagation of vertebrate cells in culture has become a routine procedure in recent years ( Tissue Culture , Academic Press, Kruse and Patterson, editors (1973)). Examples of such useful host cell lines are Sp2/0, VERO and HeLa cells, Chinese hamster ovary (CHO) cell lines, and W138, BHK, COS-7 and MDCK cell lines.
  • the preferred recipient cell line is a plasmacytoma cell such as B lymphocytes or hybridoma cells.
  • Plasmacytoma cells can synthesize, assemble and secrete immunoglobulins encoded by transformed immunoglobulin genes. Further, they possess the mechanism for glycosylation of the immunoglobulin.
  • Sp2/0 is a preferred recipient cell because it is an immunoglobulin-nonproducing plasmacytoma cell. The cell produces only immunoglobulin encoded by the transformed immunoglobulin genes.
  • Plasmacytoma cells can be grown in culture or in the peritoneum of mice where secreted immunoglobulin can be obtained from ascites fluid.
  • Transformation of host cells is accomplished as follows.
  • the expression vehicle is linearized and the DNA is inserted into host cells for production of the antibody.
  • Exemplary methods for inserting the DNA into host cells include electroportion, protoplast fusion, calcium phosphate-precipitation, or other conventional techniques, which use dextran sulfate, and PEG.
  • transformation may be carried out by the calcium phosphate precipitation method as described by Graham and Van der Eb, Virology , 52:546 (1978).
  • prokaryotic cells or cells which contain substantial cell wall constructions are used, the preferred method of transformation is calcium treatment using calcium chloride as described by Cohen et al., Proc. Natl. Acad. Sci . ( USA ), 69:2110 (1972).
  • the host cells may be transformed via either cotransformation or targeted transformation.
  • the genes coding for the light chain and heavy chain may be used to transform separate cell cultures, either of the same or of differing species; separate plasmids for light and heavy chain may be used to co-transform a single cell culture; or finally, a single expression plasmid containing both genes and capable of expressing the genes for both light and heavy chain may be transformed into a single cell culture.
  • the host cells are transformed with genes encoding for the light chain, and the cells containing the light chain marker are selected.
  • the light chain is found using cytostaining or possibly by detection of the light chain in the supernatant if it has been secreted.
  • Cells selected to have the light chain are transformed with the heavy chain construct, and resultant cells additionally containing the heavy chain marker selected.
  • the cells may be grown for about 48 hours to allow for expression of marker genes.
  • the cells are then placed in a selective medium, where untransformed cells are killed, leaving only cells transformed with the DNA constructions.
  • Heavy and light chains or portions thereof may be produced in isolation from each other and antibodies and fragments thereof may be obtained. Such preparations require the use of techniques to reassemble isolated chains.
  • the ability of the method of the invention to produce heavy and light chains or portions thereof, in isolation from each other offers the opportunity to obtain unique assemblies of immunoglobulins, Fab regions, and univalent antibodies. It is possible to recombine the heavy and light chains in vitro, disrupted by cleavage of only the interchain disulfides, and to regain antibody activity even without restoration of the inter-chain disulfides [see Edelman et al., Proc. Natl. Acad. Sci . ( USA ), 50:753 (1963)].
  • the transformed cells are grown under conditions appropriate to the production of the light chains and/or heavy chains, and assayed for heavy and/or light chain protein synthesis.
  • exemplary assay techniques include enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA), or fluorescence-activated cell sorter analysis (FACS from Becton, Dickinson & Co., Paramus, N.J.), immunohistochemistry and the like.
  • the binding affinity of monoclonal antibodies for TAG-72 is determined by means well known in the art (see Heyman et al., J. Immunol. Methods , 68:193-204 (1984) and as described in detail in the Examples provided hereinafter).
  • Selected positive cultures are subcloned in order to isolate pure transformed colonies.
  • a suitable technique for obtaining subclones is via the limited dilution method taught by McKeara in Monoclonal Antibodies , Plenum Press, N.Y. (1980).
  • Hybridomas that produce such chimeric antibodies may be grown using known procedures.
  • the transformed cells can secrete large quantities of the light chains and/or heavy chains by culture in vitro, such as by hollow fiber systems, spinner culture, static culture, or in vivo such as ascites production.
  • the chimeric antibodies may be produced in large quantities by injecting a hybridoma into the peritoneal cavity of pristane-primed mice, and after an appropriate time (about 1-2 weeks), harvesting ascites fluid from the mice, which yields a very high titer of homogeneous monoclonal antibody, and isolating the monoclonal antibodies therefrom by methods well known in the art (see Stramignoni et al., Intl. J. Cancer , 31:543-552 (1983)).
  • the hybridomas are grown up in vivo, as tumors in animals, the serum or ascites fluid of which can provide up to about 50 mg/mL of monoclonal antibodies.
  • mice or rats usually, injection (preferably intraperitoneal) of about 10 6 to 10 7 histocompatible hybridoma cells into mice or rats will result in tumor formation after a few weeks.
  • the antibodies can then be collected and processed by well-known methods. See generally, Immunological Methods , Vols. I & II, Eds. Lefkovits and Pernis, (1979 & 1981) Academic Press, New York, N.Y.; and Handbook of Experimental Immunology , ed. Weir, (1978) Blackwell Scientific Publications, St. Louis, Mo., USA.
  • the antibodies can then be stored in various buffer solutions such as phosphate buffered saline (PBS), which gives a generally stable antibody solution for further use.
  • PBS phosphate buffered saline
  • the chimeric antibodies of the present invention may be fragmented using known protease enzymes, for example papain and pepsin, to obtain highly immunoreactive F(ab′)2, F(ab′) and Fab fragments.
  • active fragments of Ig formed by proteolysis (approximately 50,000 MW) can be split into their fully reduced heavy chain and light chain components and fairly efficiently reconstructed to give an active antibody [Haber, Proc. Natl. Acad. Sci . ( USA ), 52:1099 (1964); and Whitney et al., Proc. Natl. Acad. Sci . ( USA ), 53:524 (1965)].
  • the reactivity of the resulting F(ab′)2, F(ab′) and Fab fragments are determined by methods as described above for the complete monoclonal antibody molecule.
  • the antibodies of the present invention as well as immunoreactive fragments or recombinants thereof, provide unique benefits for use in a variety of cancer treatments.
  • the antibodies In addition to the ability to bind specifically to malignant cells and to localize tumors, the antibodies have constant variable regions which do not bind detectably to normal cells such as fibroblasts, endothelial cells, or epithelial cells in the major organs.
  • the antibodies, immunoreactive fragments or recombinants thereof are useful for, but not limited to, the following types of cancer treatment: (1) in vivo diagnostic assays conjugated to an imaging marker, for the in situ detection of carcinoma lesions, as further described below; (2) in vivo therapy, using the antibodies of the present invention alone or conjugated to a therapeutic agent such as a radionuclide, toxin, effector cells, other antibodies or via a complement mechanism, as described below; and (3) radioimmunoguided surgery, as described below.
  • a therapeutic agent such as a radionuclide, toxin, effector cells, other antibodies or via a complement mechanism, as described below
  • radioimmunoguided surgery as described below.
  • compositions comprising the antibodies of the present invention in a pharmaceutically acceptable, non-toxic, sterile carrier such as physiological saline, non-toxic buffers and the like, is also now possible.
  • compositions of the present invention may be either in suspension or solution form.
  • a pharmaceutically acceptable carrier comprise a suitable solvent, preservatives such as benzyl alcohol, if needed, and buffers.
  • suitable solvents include, for example, water, aqueous alcohols, glycols, and phosphonate or carbonate esters. Such aqueous solutions contain no more than 50 percent of the organic solvent by volume.
  • Injectable suspensions as compositions of the present invention require a liquid suspending medium, with or without adjuvants, as a carrier.
  • the suspending medium can be, for example, aqueous polyvinyl-pyrrolidone, inert oils such as vegetable oils or highly refined mineral oils, or aqueous carboxymethlycellulose.
  • Suitable physiologically acceptable adjuvants, if necessary to keep the complex in suspension may be chosen from among thickeners such as carboxymethyl cellulose, polyvinylpyrrolidone, gelatin, and the alginates.
  • surfactants are also useful as suspending agents, for example, lecithin, alkylphenol, polyethylene oxide adducts, naphthalenesulfonates, alkylbenzenesulfonates, and the polyoxyethylene sorbitan esters.
  • suspending agents for example, lecithin, alkylphenol, polyethylene oxide adducts, naphthalenesulfonates, alkylbenzenesulfonates, and the polyoxyethylene sorbitan esters.
  • Many substances which effect the hydrophibicity, density, and surface tension of the liquid suspension medium can assist in making injectable suspensions in individual cases.
  • silicone antifoams, sorbitol, and sugars are all useful suspending agents.
  • Cancer cells are heterogeneous and consequently, a single monospecific chimeric antibody may not be able to recognize all cells expressing different epitopes of a tumor.
  • chimeric antibodies of the present invention may be desirable to administer several different chimeric antibodies of the present invention.
  • the sequential use of these various antibodies should substantially reduce the anti-idiotypic responses in human patients when compared to repeated use of a single antibody.
  • CH92, CH88, and CH44 could be sequentially administered to a patient. Since these antibodies have different light chains and, in fact different CDR3 regions anti-idiotypic responses should be minimized.
  • immunoreactive fragments or recombinants thereof are conjugated to a marker, administered to a patient, and then the presence of the imaging marker in the patient is detected by exposing the patient to an appropriate detection means.
  • the dosage will vary depending upon the age and weight of the patient. Generally, the dosage should be effective to visualize or detect tumor sites, distinct from normal tissues. Preferably, a one-time dosage will be between about 0.1 to about 200 mg of an antibody-marker conjugate per patient.
  • imaging markers which can be conjugated to the antibody are well known to those skilled in the art and include substances which can be detected by diagnostic imaging using a gamma scanner or hand held gamma probe or positron emission tomography or the like, as described in the references cited above, and substances which can be detected by nuclear magnetic resonance imaging using a nuclear magnetic resonance spectrometer or the like, as described in the references cited above.
  • Suitable but not limiting examples of substances which can be detected using a gamma scanner or the like include 125 I, 131 I, 123 I, 111 In, 105 Rh, 153 Sm, 67 Cu, 67 Ga, 166 Ho, 177 Lu, 186 Re, 188 Re, and 99m Tc. 125 I, 123 I, 153 Sm, and 99m Tc are preferred due to their low energy and suitability for long range detection.
  • Gd gadolinium
  • the antibody-therapeutic agent conjugate can be delivered to the carcinoma site thereby directly exposing the carcinoma tissue to the therapeutic agent.
  • the antibodies of the present invention, immunoreactive fragments or recombinants thereof may be administered in a pharmaceutically effective amount for the in vivo treatment of human carcinomas or metastasis thereof.
  • a “pharmaceutically effective amount” of the antibody, immunoreactive fragment or recombinant thereof, conjugated or unconjugated to a therapeutic agent means the amount of said antibodies in the pharmaceutical composition should be Sufficient to achieve effective binding with the antigens against which said antibodies have specific affinity.
  • the pharmaceutical composition may be administered in a single or multiple dosage.
  • antibody-therapeutic agent conjugates which can be used in therapy include the following: (1) antibodies coupled to radionuclides, such as 125 I, 131 I, 123 I, 111 In, 105 Rh, 153 Sm, 67 Cu, 67 Ga, 166 Ho, 177 Lu, 186 Re, and 188 Re, and as described, for example, in Goldenberg et al., Cancer Res ., 41:4354-4360 (1981); Carrasquillo et al., Cancer Treat. Rep ., 68:317-328 (1984); Zalcberg et al., J. Natl. Cancer Inst ., 72:697-704 (1984); Jones et al., Int. J.
  • radionuclides such as 125 I, 131 I, 123 I, 111 In, 105 Rh, 153 Sm, 67 Cu, 67 Ga, 166 Ho, 177 Lu, 186 Re, and 188 Re, and as described, for example, in Goldenberg et al
  • heterofunctional antibodies for example, antibodies coupled or combined with another antibody so that the complex binds both to the carcinoma and effector cells, e.g., killer cells such as T cells, as described, for example, in Perez et al., J. Exper. Med ., 163:166-178 (1986); and Lau et al. Proc. Natl. Acad. Sci . ( USA ), 82:8648-8652 (1985); and (5) native, i.e., non-conjugated or non-complexed, antibodies, as described in, for example, Herlyn et al., Proc. Natl.
  • Antibodies, immunoreactive fragments or recombinants thereof, are important for radioimmunoguided surgery (RIGS).
  • RIGS radioimmunoguided surgery
  • an intraoperative therapy tumors are localized and excised.
  • An antibody labeled with an imaging marker is injected into the patient, and bound antibody localized by a hand-held gamma detecting probe (GDP) and excised.
  • GDP hand-held gamma detecting probe
  • An exemplary GDP is NEOPROBE gamma detecting probe, commercially available from Neoprobe Corporation, Columbus, Ohio, USA. See Martin et al., Amer. J. Surg ., 156:386-392 (1988); Martin et al., Hybridoma , 5:S97-S108 (1986).
  • the dosage will vary depending upon the age and weight of the patient, but generally a one time dosage of about 0.1 to 200 mg of antibody-marker conjugate per patient is sufficient.
  • CC antibodies were derived from mice, and are significantly less capable of carrying out the effector functions possessed by the human constant regions.
  • selected antibodies are “humanized” by genetically removing the constant regions of the heavy and light chains and replacing them with their human equivalents.
  • mice light chain constant region genes were replaced with the human kappa ( ⁇ ) gene, and the mouse heavy chain genes were replaced with each of the four human gamma isotypes ( ⁇ 1, ⁇ 2, ⁇ 3, and ⁇ 4).
  • Each of these four gamma isotypes possess unique biological properties.
  • CC49 hybridoma cells secrete an antibody having an IgG 1 isotype heavy chain and a kappa light chain.
  • the total extracted DNA from each cell line was subjected to the Southern hybridization technique, developed by E. M. Southern, (Southern, J. Mol. Biol ., 98:503-517 (1975)).
  • the DNA fragments were fractionated on the basis of their size by means of electrophoresis on a 0.8 percent agarose gel.
  • the double-stranded DNA fragments were modified into single-stranded DNA fragments in an alkali solution; and then a nitrocellulose filter was placed into close contact with the gel to transfer the modified DNA segments onto the filter in the presence of a high salt concentration solution.
  • Hybridization was carried out using, as the probe, a random primed ⁇ 32P>-labeled L chain.
  • the probe was a 1.71 kilo base pair (kbp) Hind III-Pst I fragment containing the coding exons for the murine J L regions (J1-J5) and was isolated from the plasmid pGD1.
  • a nucleotide sequence of the probe fragment is provided in FIG. 7 (SEQ ID NO:15).
  • This plasmid is described in Agostaro et al., Can. J. Biochem. Cell Biol ., 63: 969-976 (1985). The plasmid was provided by Nobumichi Hozumi and John Roder, Mt. Sinai Research Institute, Toronto, Ontario, Canada.
  • alpha ⁇ 32P> dCTP was obtained from Amersham, Arlington Heights, Ill., and the random priming kit was obtained from Pharmacia, Piscataway, N.J., USA.
  • LAMBDA-ZAP vector a lambda-based insertion cloning vector capable of self excision, was purchased from Stratagene Company, La Jolla, Calif., USA. LAMBDA-ZAP vector is described on pages 20-21 of the 1987 Stratagene catalog. The cohesive (cos) ends of LAMBDA-ZAP vector were ligated overnight by following the manufacturer's protocol.
  • One hundred sixty micrograms of total CC49 hybridoma DNA (containing the mouse light chain promoter and the L and VJ exons) were digested to completion with Hind III. Fragments between about 1 kb to about 20 kb were cut out of 0.8 percent agarose gels.
  • the DNA was purified using a GENECLEAN nucleic acid purification kit (containing a solution of NaI and NaC1 and an aqueous silica suspension), which is commercially available from BIO 101 (La Jolla, Calif., USA).
  • the total CC49 hybridoma DNA Hind III digested fragments were half-filled similarly to the Spe I fragments of the LAMBDA-ZAP vector with the exception that dATP and dGTP were employed.
  • the half-filled Hind III digested fragments produced 5′AGCTT/3′GAA sticky ends, which are compatible with the Spe I half-filled LAMBDA-ZAP vector fragment above.
  • the total CC49 hybridoma Hind III modified- and LAMBDA-ZAP vector Spe I modified-DNA fragments were ligated by means of T4 DNA ligase.
  • the ligation reaction was set using a 6.1 ⁇ L ligation mixture containing the following: about 0.2 ⁇ L of the total CC49 hybridoma Hind III modified DNA in a 3 ⁇ L solution, about 1 ⁇ L of LAMBDA-ZAP vector Spe I modified DNA in a 1 ⁇ L solution, 0.6 ⁇ L of Stratagene's 10 ⁇ ligase buffer, 0.5 ⁇ L 10 millimolar ATP, and 1 ⁇ L of Stratagene ligase. This was incubated overnight in a water bath and the temperature lowered incrementally from about 18° C. to about 4° C. This ligation eliminated both the Hind III and the Spe I sites.
  • a genomic library of ligated mix was made according to Stratagene's protocol. Briefly, 2 ⁇ L of the ligation mix produced above was used in Stratagene's GIGAPACK Gold packaging system, following the directions of the manufacturer. Fifteen 150 mm plates having a density of 50,000 plaques per plate were screened, as per manufacturer's directions, for positive clones by hybridization to nitrocellulose filters, obtained from Schleicher-Schuell, Keene, N.H., USA. The ⁇ 32P> random-labelled probe derived from pGD1, which was described above, was used for hybridization. Two positive clones were obtained.
  • Each clone was plaque purified and recombinant plasmids (phagemids) of LAMBDA-ZAP vector containing the CC49 L chain variable region were obtained by using Stratagene's automatic excision protocol.
  • the vector portion of the resulting recombined plasmid is called pBLUESCRIPT SK( ⁇ ) and consists of 2964 bp as described in the 1987 Stratagene catalog.
  • a plasmid map of pBLUESCRIPT SK( ⁇ ) is shown in FIG. 8 .
  • the DNA from the two positive clones was partially sequenced and both were identical.
  • One of the clones, which was named pRL101, was used for further studies.
  • pRL101 was 7.61 kb, and the size of the DNA insert was determined by restriction enzyme mapping to be 4.65 kb.
  • a plasmid map of pRL101 is shown in FIG. 9.
  • a restriction enzyme map of the CC49 L chain genomic DNA insert in pRL101 is shown in FIG. 10 .
  • a genomic library containing 7 ⁇ 10 5 plaques was screened using as the probe the ⁇ 32P> random-labeled 1.71 kb Hind III-Pst I fragment derived from pGD1, as described above. One positive clone was obtained. The positive clone was named pRL200.
  • pRL200 was 7.44 kb, and the size of the DNA insert was determined by restriction enzyme mapping to be 4.48 kb.
  • a plasmid map of pRL200 is shown in FIG. 11.
  • a restriction enzyme map of the CC83 L chain genomic DNA insert in pRL200 is shown in FIG. 12 .
  • the procedures used to isolate the CC49 heavy chain were essentially those used to isolate CC49 light chain, including the screening of the same CC49 Hind III modified DNA.
  • the hybridization probe used to screen the library was generated from pNP9, which contains a 1.98 kbp Eco RI-Bam HI fragment containing the coding exons for J H 3 and J H 4 of the CC49 immunoglobulin heavy chain.
  • the nucleotide sequence of the probe fragment is provided in FIGS. 13A-13B (SEQ ID NO:16).
  • a genomic library containing 9.5 ⁇ 10 5 plaques was screened, from which one positive clone was obtained.
  • the positive clone was named pHH49.
  • pHH49 was about 7.0 kb, and the size of the DNA insert was determined by restriction enzyme mapping to be about 4.0 kb.
  • a plasmid map of pHH49 is shown in FIG. 14 .
  • LAMBDA-ZAP vector DNA About 13 g of ligated LAMBDA-ZAP vector DNA were digested with 12 units of Spe I, purchased from New England Biolabs, Inc., in a total of 100 ⁇ L of an appropriate buffer.
  • the LAMBDA-ZAP vector was digested at 37° C. for one hour.
  • the reaction mixture was phenol extracted and ethanol precipitated as per Stratagene's protocol.
  • the Spe I-digested LAMBDA-ZAP vector was dephosphorylated according to procedures set forth in Maniatis except that 40 fold excess of calf intestinal alkaline phosphatase (Boehringer Mannheim, Indianapolis, Ind., USA) was used.
  • DNA from CC83 was digested to completion with Spe I. Fragments between about 3 kb to about 40 kb were isolated from a 0.8 percent agarose gel slice by electroelution as described by Maniatis, and ligated with the dephosphorylated Spe I-cut LAMBDA-ZAP vector.
  • a genomic library containing 5 ⁇ 10 5 plaques was screened using the probe generated from pNP9, the sequence of which is provided in FIG. 13 .
  • One positive clone was obtained.
  • the positive clone was named pHS83.
  • pHS83 was 7.95 kb, and the size of the DNA insert was determined by restriction enzyme mapping to be about 5 kb.
  • a plasmid map of pHS83 is shown in FIG. 15 .
  • RNA from about 1 ⁇ 10 7 CC49 cells frozen at ⁇ 70° C. was extracted essentially as reported by Maniatis, with the following exceptions. Four molar guanidinium isothiocyanate and 2.5 molar sodium citrate, pH 7.0, and a SW40Ti rotor centrifuged at 31,000 rpm were used.
  • RNA was isolated. After centrifugation, poly A+ mRNA was purified from about 1.68 mg of RNA by oligo(dT)-cellulose chromatography using Type 3 oligo(dT)-cellulose obtained from Collaborative Research, Inc., Bedford, Mass., USA. The procedure was as described by Aviv and Leder, Proc. Natl. Acad. Sci . ( USA ), 69:1408 (1972). A total of 50.24 ⁇ L of poly A+ mRNA was obtained from 1.68 milligrams of mRNA.
  • RNA was isolated from approximately 1 ⁇ 10 7 cells.
  • a total of 54.6 ⁇ L of poly A+ mRNA was isolated from 1.91 ⁇ g of total RNA.
  • a total of 0.814 mg of CC92 RNA was isolated from approximately 2.6 ⁇ 10 8 cells.
  • a total of 1.7 mg of CC46 RNA was isolated from approximately 2.89 ⁇ 10 8 cells.
  • a total of 68.88 ⁇ g of poly A+ RNA was isolated from 1.7 mg of total RNA.
  • Synthetic oligonucleotide primers were synthesized using an APPLIED BIOSYSTEMS (Applied Biosystems (ABI) of Perkin-Elmer Corp., Foster City, Calif.) Model 380A DNA synthesizer, by phosphoramadite-based chemistry as specified by ABI.
  • the oligonucleotides were purified, as specified by the manufacturer, after electrophoresis on a 20 percent polyacrylamide gel containing 7 M urea. Oligonucleotide concentrations were determined spectrophotometrically at an optical density of 260 nm, where 1 OD 260 nm unit is equal to 33 ⁇ g/mL of single-stranded DNA.
  • oligonucleotide primers were made for mRNA sequencing: (1) For the CC49, CC83 and CC92 light chains, K L ( ⁇ ), a 22-mer (SEQ ID NO:17):
  • 49FR1( ⁇ ), a 17-mer (SEQ ID NO:18):
  • J4( ⁇ ) a 24-mer (SEQ ID NO:19):
  • J5( ⁇ ) (SEQ ID NO:20):
  • the CH1( ⁇ ) 24-mer is used to determine the 3′-most mRNA sequence of heavy chain variable regions.
  • JH4( ⁇ )-20 mer (SEQ ID NO:22):
  • JH2( ⁇ )-16 mer (SEQ ID NO:23):
  • B72.3/CC92 HC-20 mer (SEQ ID NO:24):
  • the oligonucleotide primers were end-labeled as follows: 100 ng of oligonucleotide were combined in 50 mM Tris HCl (pH 8), 10 mM MgCl 2 , 5 mM dithiothreitol, and 1 mM spermidine, 100 ⁇ Ci ( ⁇ - 32 P) ATP (Amersham, 5000 Ci/mMole) and 7 units of T4 polynucleotide kinase in a volume of 13 ⁇ l. The reaction was allowed to proceed at 37° C. for 30 minutes, then heated for 5 minutes at 65° C. to inactivate the kinase, and then 7 ⁇ l of water was added to make the concentration 5 ng/ ⁇ l. The labeled primers were stored at ⁇ 20° C. until needed.
  • a 5 ng sample of end-labeled oligonucleotide primer was added to each mRNA sample, heated to 80° C. for 3 minutes, and annealed for 45 minutes at 61° C., for the K L ( ⁇ )oligonucleotides and 65° C. for the CH1( ⁇ ) oligonucleotides.
  • AMV reverse transcriptase (Boehringer Mannheim) was used at a level of 6 units for each mRNA sequencing reaction. The remainder of the sequencing was carried out as set forth in Gel Kunststoffter (1987), supra.
  • FIG. 16 shows the nucleotide sequence of CC49 V H , with the underlined segments showing the sequences derived using oligonucleotide primers on mRNA.
  • FIG. 17 shows the nucleotide sequence of CC83 V H , with the underlined segments showing the sequences derived using oligonucleotide primers on mRNA.
  • FIG. 4A shows the nucleotide sequence of CC49 V L , with the underlined segments showing the sequences derived using oligonucleotide primers on mRNA.
  • FIG. 5A shows the nucleotide sequence of CC83 V L , with the underlined segments showing the sequences derived using oligonucleotide primers on mRNA.
  • CC92 V L The entire nucleotide sequence of CC92 V L , shown in FIG. 6A (SEQ ID NO:27), was derived using oligonucleotide primers on mRNA.
  • the amino acid sequence of CC92 VL is given in SEQ ID NO:28.
  • FIG. 4B shows the amino acid sequence for CC49 V L , with the results of the amino acid sequence determination for the first 24 amino acids of the mature CC49 V L being underlined.
  • FIG. 5B shows the amino acid sequence for CC83 V L , with the results of the amino acid sequence determination for the first 51 amino acids of the mature CC83 V L being underlined.
  • ASN-20 could not be determined in the CC83 light chain, because of the presence of N-linked carbohydrate residues at this position, which is shown in the PNGase F experiment below.
  • the sequence Asn-Ile-Thr corresponds to the consensus sequence Asn-X-Thr/Ser for carbohydrate attachment to Asn.
  • the native glycopeptide was treated with cyanogen bromide (CNBr) to cleave at the methionine residues. The cleavage resulted in fragments, which were purified by reverse phase HPLC. N-terminal amino acid sequencing was performed on the CNBr fragments.
  • CNBr cyanogen bromide
  • FIG. 20 shows the results.
  • a new band (*) appears in the PNGase F treated CC83 sample but not in the untreated CC83 sample (lane 3).
  • the new band is approximately 2,000-3,000 molecular weight smaller than the native light chain band, which represents the removal of an N-linked carbohydrate moiety.
  • the only consensus glycosylation site for the CC83 light chain is at ASN 20, so by inference it is assumed that this is the actual site of glycosylation.
  • the CC49 light chain does not change mobility when treated with PNGase F (lane 6), but a new band is observed for the heavy chain fragment of CC11 F(ab′) 2 (lane 4*) which serves as a positive control.
  • mRNA sequence data of CC11 heavy chain indicates a consensus glycosylation site in the V domain (data not shown).
  • the standards (lane 1) are bovine serum albumin (BSA), MW 68,000 and soybean trypsin inhibitor (STI), MW 21,500.
  • Plasmid DNA was sequenced directly using the SEQUENASE DNA sequencing kit (containing modified T7 DNA polymerase and reagents), obtained from United States Biological (USB), Cleveland, Ohio, USA, now Amersham International PLC, Buckinghamshire, England. USB's protocol was followed to sequence double stranded DNA.
  • the DNA of each variable region was sequenced using the J H or J L oligo determined from the mRNA sequence information to be specific for each productively rearranged heavy chain or light chain gene, respectively.
  • the sequence was extended further by using additional primers.
  • the additional primers were synthesized using information gathered from the sequences previously generated.
  • DNA sequences of the entire heavy chain variable region exons and light chain variable region exons of CC49 and CC83 were obtained.
  • the DNA sequence was compiled and analyzed using a DNAsis DNA sequence analysis software program (Hitachi Software Engineering Co., Ltd., Yokohama, Japan).
  • CC49 FRI(+) (SEQ ID NO:32):
  • CC83 CDR2( ⁇ ) (SEQ ID NO:34):
  • J H 4( ⁇ )-20 mer (SEQ ID NO:37):
  • J H 2( ⁇ )-16 mer (SEQ ID NO:39):
  • FIGS. 2A-2G The complete nucleotide sequences for CC49 V H and CC83 V H are shown in FIGS. 2A-2G.
  • Hypervariable region 3 is quite different between the two due to the recombination of the V H region with different D and J H sequences, namely that the CC49 ⁇ 1 heavy chain used a J H 4 , and the CC83 gamma 1 used a J H 2.
  • the extensive DNA sequence homology 5′ to the coding regions in the CC49 and CC83 heavy chain variable region genes shows the two heavy chain variable region genes were derived from the same germline exons.
  • the procedures used to isolate the germline precursor gene to the heavy chain variable regions of CC46, CC49, CC83, and CC92 were essentially those used to isolate the CC49 heavy chain variable region except that the DNA used to generate the LAMBDA-ZAP vector library came from an irrelevant hybridoma cell line (i.e., a cell line which produces antibodies that do not appreciably bind to TAG-72).
  • a genomic library containing approximately 900,000 plaques was screened from which one positive clone was isolated. The positive clone was named pV H ⁇ TAG.
  • pV H ⁇ TAG was about 5.2 kb, and the size of the DNA insert was determined by restriction enzyme mapping to be about 2.2 kb.
  • V H ⁇ TAG IVS (+) (SEQ ID NO:47): 5′-CTAAAGTGGAGTCAGGGCCTG-3′;
  • V H ⁇ TAG IVS ( ⁇ ) (SEQ ID NO:48): 5′-CAGGCCCTGACTCCACTTTAG-3′;
  • V H ⁇ TAG CDR2 (+) (SEQ ID NO:49): 5′-GAATGGATTGGATATATTTCTC-3′.
  • V H ⁇ TAG The complete nucleotide sequence of V H ⁇ TAG is shown in FIGS. 2A-2G.
  • Plasmid constructs containing the various heavy chain human constant regions were provided by Dr. Ilan R. Kirsch of the National Cancer Institute, Bethesda, Md., USA.
  • the Hind III site of the CC49 light chain genomic DNA located in the murine intron region between J5 and C ⁇ was lost in the cloning procedure where half-filled in Hind III sites were ligated to half-filled in Spe I sites in the LAMBDA-ZAP vector.
  • the plasmid pRL101 (FIG. 9) carried this modification.
  • the intron Hind III site was regenerated as outlined in the steps below in order to enable a Hind III-Bam HI human germline kappa light chain DNA fragment (see Hieter et al., J. Biol. Chem ., 257:1516 (1982)) to be ligated to the murine variable region directly. All steps were performed using standard molecular biology techniques familiar to artisans and can be found in a manual such as Maniatis.
  • a 1.69 kb Bam HI-Pst I fragment was isolated from pRL101, described supra.
  • a 2.96 kb Bam HI-Pst I fragment was isolated from pBluescript SK( ⁇ ) (purchased from Stratagene), supra. The two fragments were then ligated and pRL103 (FIG. 47) was isolated.
  • Plasmid pGD1 (described supra), was digested with Pst I and Hind III restriction enzymes to yield the necessary 1.03 kb intron-containing fragment, and pRL103 was also digested with Pst I and Hind III restriction enzymes to remove the small fragment of DNA in the polylinker.
  • pGD1 and pRL104 Partial restriction maps of pGD1 and pRL104 are shown in FIGS. 49 and 48.
  • Plasmid phum C K was obtained from Dr. John Roder, Mt Sinai Research Institute, Toronto, Ontario, Canada.
  • the plasmid is derived from pBR322, with a 12 kb Bam HI fragment containing the human C K exon inserted therein.
  • pBR322 is described on page 171 of the 1987 Stratagene catalog.
  • the 12 kb Bam HI fragment restriction map is shown in FIG. 50 (from Heiter et al. J. Biol. Chem , 257:1516 (1982)).
  • the plasmid phum C ⁇ was digested with Hind III and Bam HI restriction enzymes to yield a 5.0 kb fragment, containing the human C ⁇ exon.
  • pRL104 was digested with Fsp I and Hind III restriction enzymes to yield a 4.2 kb fragment, containing the mouse light chain variable exons of CC49.
  • the chimeric Bam HI fragment containing both the murine light chain variable region exons (L and VJ) and the human constant region kappa ( ⁇ ) exon was ligated into the Bam HI site with the plasmid pSV2neo (5.6 kb), a pBR322-derived plasmid containing the selectable marker gene neo (obtained from ATCC).
  • the presence of the active neo gene renders a cell resistant to growth inhibition by GENETICIN aminoglycoside (from Gibco, now Life Technologies, Inc., Chagrin Falls, Ohio), a neomycin-like drug also called G418.
  • the chimeric Bam HI fragment was inserted into pSV2neo in both orientations as shown below. Both transcriptional orientations of the chimeric light chain gene, relative to the neo gene, were constructed. Plasmid pSV2neo was linearized at the Bam HI site, dephosphorylated (according to procedures set forth in Maniatis) using calf intestinal alkaline phosphatase (to prevent self-ligation) and ligated with chimeric CC49 L chain Bam HI fragments from above to form pRL150 (FIG. 51) and pRL105 (FIG. 52 ).
  • the transcriptional orientations of the neo gene and the CC49 chimeric light chain are indicated by arrows in pRL150 and pRL105.
  • the portions derived from pSV2neo are indicated.
  • These plasmids were purified on a large scale from preparative scale (1.0L) fermentation of E. coli clones replicating each of the plasmids.
  • the purified plasmids were used to introduce the chimeric CC49 light chain into SP2/0 plasmacytoma cells as discussed below.
  • the Hind III site in pRL200 which was lost in the cloning process of the CC83 light chain was regenerated for the same reason as for the CC49 light chain chimeric construction.
  • the regeneration was accomplished as follows.
  • the plasmid pRL200 was linearized at a unique Nhe I site, and both of its sticky ends were converted to blunt ends by filling in with dNTPs and DNA polymerase I.
  • a Bam HI phosphorylated linker purchased from New England Biolabs was ligated to the filled-in site.
  • the new plasmid is called pRL201.
  • the 2.5 kb Bam HI-Pst I fragment from pRL201 containing the CC83 light chain variable region genomic DNA was conveniently ligated to the 4 kb Bam HI-Pst I vector fragment from pRL104 which was described earlier in the CC49 light chain constructions and which already had the Hind III-bearing intron fragment.
  • the new plasmid is called pRL202 and is shown in FIG. 53 .
  • the approximately 5.05 kb Fsp I-Hind III fragment from pRL202 was isolated and ligated with the human C ⁇ -containing 5.0 kb Hind III-Bam HI fragment already described for the CC49 light chain chimeric construction.
  • the generation of the CC83 light chain vector was accomplished from this point in an identical fashion as carried out for the CC49 light chain.
  • the resulting 8.5 kb Bam HI CC83 light chain chimeric construct was also ligated to pSV2neo-Bam HI (phosphatased) and plasmids with both possible orientations of the insert were obtained as diagramed in FIGS. 54 (pRL203) and 55 (pRL230).
  • the transcriptional orientations of the neo gene and the CC83 chimeric light chain are indicated by arrows in pRL203 and pRL230.
  • These plasmids were purified on a large scale from a preparative scale of about 1 Liter (1.0L) fermentation in a commercial incubator of E. coli clones replicating each of the plasmids.
  • the purified plasmids were used to introduce the chimeric CC83 light chain into Sp2/0 plasmacytoma cells, as discussed below.
  • All four of the chimeric light chain plasmid constructs can be linearized by digesting with the restriction enzyme Aat II.
  • the Aat II site in the plasmids is in a region that is not essential for the expression of the chimeric light chain gene or the selectable marker gene, neo.
  • pSV2gpt The plasmid vector used to carry the chimeric heavy chain constructs is designated pSV2gpt, set forth in Mulligan and Berg, Proc. Natl. Acad. Sci ( USA ), 78(4):2072-2076 (1982).
  • pSV2gpt is a pBR322 derived plasmid containing the selectable marker gene, guanine phosphoribosyl transferase (gpt), which can be used for selective growth in media containing mycophenolic acid.
  • gpt guanine phosphoribosyl transferase
  • the digested DNA was fractionated on a 4 percent polyacrylamide gel and the 4.5 kb vector fragment was recovered from the gel by electroelution as described in Maniatis.
  • This linearized plasmid was designated pSV2gpt/R/B, a plasmid map is shown in FIG. 22 . It is able to accept Eco RI-Bam HI ended fragments.
  • the Eco RI site in vector, pBR322 was employed.
  • the fragment containing the human C ⁇ 1 exons was obtained by digesting and linearizing p ⁇ 1 with Hind III followed by filling in the Hind III sticky ends using all four dNTP's and the Klenow fragment of DNA Polymerase to make the Hind III ends blunt.
  • An Eco RI linker was ligated to the blunt ends to replace the Hind III site with an Eco RI site.
  • This construct was then digested with Eco RI and Bam HI to release a 7.8 kb fragment containing the C ⁇ 1 exons. This fragment was called C ⁇ 1-7.8 kb.
  • the fragments were each ligated into the Eco RI-Bam HI sites of pSV2-gpt/R/B.
  • This vector (pSV2-gpt- ⁇ 1-7.2) design allows us to insert any murine heavy chain variable region gene (with Eco RI ends) into the Eco RI site of the human IgG heavy chain vectors. More specifically, 125 ng of the human C ⁇ 1-7.8 kb fragment was ligated to 100 ng of the linearized pSV2gpt/R/B vector in a volume of 10 ⁇ l using 400 units of T4 DNA ligase (obtained from New England Biolabs). Frozen competent E.
  • coli DH1 cells from Invitrogen (San Diego, Calif.) were transformed with a ligation reaction according to the Invitrogen's protocol.
  • the resulting plasmid was designated pSV2gpt ⁇ 1-7.8.
  • a plasmid map of pSV2gpt ⁇ 1-7.8 is shown in FIG. 23 .
  • Size reduction was accomplished by converting a downstream Pvu II site to a Bam HI site by blunt-end addition of a Bam HI linker.
  • the Hind III site of p ⁇ -1. was converted to an Eco RI site by digestion of p ⁇ -1 with Hind III, filling in the 3′ end to create a blunt end, and addition of Eco RI linkers as above.
  • the Pvu II site 2.3 kb downstream was converted to a Bam HI site by subsequent digestion with Pvu II and ligation of Bam HI linkers directly to the blunt Pvu II ends. This construct was then digested with Eco RI and Bam HI to release a 2.3 kb fragment containing the C ⁇ 1 exons.
  • Approximately 200 ng of the human C ⁇ 1 2.3 kb fragment was ligated to 100 ng of the linearized plasmid pSV2gpt/R/B vector in a volume of 10 ⁇ l using 400 units of T4 DNA ligase (New England Biolabs). Frozen competent E. coli cells, obtained from Invitrogen, were transformed with the ligation reaction according to Invitrogen's protocol. The resulting plasmid was designated pSV2gpt ⁇ 1-2.3. A plasmid map of pSV2gpt ⁇ 1-2.3 is shown in FIG. 24 .
  • DNA fragments containing the other three human IgG constant region exons were also isolated.
  • the C ⁇ 2 exons were recovered from the plasmid p ⁇ 2 as a 4.0 kb Eco RI-Bam HI fragment.
  • the C ⁇ 3 exons were recovered from the plasmid p ⁇ 3 as an 8.0 kb Eco RI-Bam HI fragment.
  • the C ⁇ 4 exons were recovered from the plasmid p ⁇ 4 as a 7.6 kb Eco RI-Bam HI fragment.
  • the fragments were separately ligated into pSV2gpt/R/B as described for C ⁇ 1-7.8 and C ⁇ 1-2.3. Plasmid maps of the resultant plasmids are shown in FIG. 25, pSV2gpt- ⁇ 2; FIG. 26, pSV2gpt- ⁇ 3; and FIG. 27, pSV2gpt- ⁇ 4.
  • the complete heavy chain variable region human ⁇ 1 constant region chimeric constructs were generated by inserting a fragment containing the murine heavy chain variable region exons into the plasmids containing the human ⁇ 1 constant region exons described as follows.
  • a fragment containing the heavy chain variable region exons coding for the CC49 heavy chain variable region was prepared by digesting 14 ⁇ g of pHH49 with 50 units of Eco RI (obtained from BRL) at 37° C. for 2 hours. The digest was fractionated on a 4 percent polyacrylamide gel and the 1.9 kb Eco RI fragment containing the heavy chain variable region exons of CC49 was recovered by electroelution as described by Maniatis. This fragment was designated f49R.
  • a fragment containing the 7.8 kb sequence encoding for ⁇ 1 was prepared as follows:
  • pSV2gpt ⁇ 1-7.8 was digested with Eco RI.
  • the resultant fragment was dephosphorylated (to prevent self ligation) using calf intestinal alkaline phosphatase as described by Maniatis.
  • the fragment was purified from the 0.8 percent agarose gel by electroelution. This vector was designated pSV2gpt ⁇ 1-7.8/R.
  • the Eco RI site is located 245 bp upstream of the transcription initiation sites, and contains the promoter and the necessary tissue-specific sequences for efficient expression.
  • the intron regions 3′ of the variable region genes contain the murine heavy chain enhancer sequences which are absent on the human IgG heavy chain vectors. Therefore, the heavy chain chimeric vectors use both murine promoter and enhancer sequences.
  • FIG. 28 illustrates a plasmid map for p49 ⁇ 1-7.8.
  • pSV2gpt ⁇ 1-2.3 was digested as for pSV2gpt ⁇ 1-7.8 with Eco RI.
  • the resultant fragment was dephosphorylated using calf intestinal alkaline phosphatase as described by Maniatis.
  • the fragment was purified from an 0.8 percent agarose gel by electroelution. This linearized plasmid was designated pSV2gpt ⁇ 1-2.3/R.
  • FIG. 29 illustrates a plasmid map for p49 ⁇ 1-2.3.
  • Plasmids pSV2gpt- ⁇ 2, pSV2gpt- ⁇ 3 and pSV2gpt- ⁇ 4 were separately digested with Eco RI to produce the linear plasmid vectors pSV2gpt- ⁇ 2/R, pSV2gpt- ⁇ 3/R and pSV2gpt- ⁇ 4/R respectively. Each of these 3 linear plasmid vectors were separately ligated with f49R. Plasmid maps of the resulting plasmids are shown in FIG. 30, p49- ⁇ 2; FIG. 31, p49- ⁇ 3; and FIG. 32, p49- ⁇ 4.
  • Chimeric constructs containing the heavy chain variable region of CC83 were generated in a similar manner as the chimeric constructs of CC49.
  • a fragment containing the heavy chain variable region exons coding for the CC83 heavy chain region was prepared by digesting 19 ⁇ g of pHS83 with 50 units of Eco RI (obtained from BRL) at 37° C. for 2 hours. The digest was fractionated on a 4 percent polyacrylamide gel and the 2.9 kb Eco RI fragment containing the heavy chain variable region exons of CC83 were recovered by electroelution as described in Maniatis. This fragment was designated f83R.
  • FIG. 33 illustrates the plasmid map of p83 ⁇ 1-7.8.
  • FIG. 34 illustrates the plasmid map of p83 ⁇ 1-2.3.
  • Plasmids pSV2gpt- ⁇ 2, pSV2gpt- ⁇ 3 and pSV2gpt- ⁇ 4 were separately digested as above for pSV2gpt- ⁇ 2/R, pSV2gpt- ⁇ 3/R and pSV2gpt- ⁇ 4/R, respectively, with Eco RI to produce the linear plasmid vectors pSV2gpt- ⁇ 2/R, pSV2gpt- ⁇ 3/R and pSV2gpt- ⁇ 4/R respectively. Each of these 3 linear plasmid vectors were separately ligated with f83R. Plasmid maps for the resulting plasmids are shown in FIG. 35, p83- ⁇ 2; FIG. 36, p83- ⁇ 3; and FIG. 37, p83- ⁇ 4.
  • All ten of the circular plasmid constructs (p49 ⁇ 1-7.8; p49 ⁇ 1-2.3; p83 ⁇ 1-7.8; p83 ⁇ 1-2.3; p49- ⁇ 2; p83- ⁇ 2; p49- ⁇ 3; p83- ⁇ 3; p49- ⁇ 4; and p83- ⁇ 4) were then linearized for transformation by digesting with the restriction enzyme Nde I.
  • the Nde I site in the plasmids is in a region that is not essential for the expression of the chimeric immunoglobulin gene or the selectable marker gene, gpt.
  • the plasmids need to be in a linear form prior to transformation into a recipient cell to enhance selected integration of the DNA into the host cell genomic DNA.
  • H2L2 tetrameric immunoglobulins
  • Synthesis and secretion of these “chimeric” antibody proteins was accomplished by introducing the chimeric (mouse V:human C region) genes into mouse plasmacytoma cells (Sp2/0). Transformation was achieved by electroporation (Sahagan, et al., J. Immunology , 137:1066 (1986)).
  • chimeric (mouse V:human C region) genes in transformed (Sp2/0) is achieved using two different techniques. In one mode, different ratios of light chain genes to heavy chain genes can be introduced together. This is referred to as cotransformation. Alternatively, stable clones carrying the chimeric light chain gene can be obtained and subsequently used in a second mode referred to as targeted transformation. In each method, the goal is to obtain clones containing genes for both the H chain and L chain which produce intact H 2 L 2 immunoglobulin mentioned above.
  • Co-transformation involves the transformation of cells with both drug resistance markers at the same time and subsequent selection with one or both drugs.
  • Co-transformation of heavy chain and light chain vectors (at ratios of 1:1 and 1:10, respectively) was originally performed using only neo selection. Neo-resistant cell lines were obtained which expressed the first chimeric IgG1 antibodies with demonstrable TAG-72 binding activity.
  • Cotransformation was conducted pursuant to the protocols set forth in Gorman, “High Efficiency Gene Transfer into Mammalian Cells”, DNA Cloning , Vol II, D. M. Glover ed, IRL Press, Oxford, England (1985).
  • Constructs containing light and heavy chimeric immunoglobulin genes were sequentially transformed into Sp2/0 mouse plasmacytoma cells.
  • Targeted transformation involves transformation and selection with a vector containing a first drug-resistance gene (i.e., GENETICIN aminoglycoside for the chimeric light chain gene vector), followed by transformation and selection with a vector containing a second drug resistance gene (i.e., mycophenolic acid for the chimeric heavy chain gene vector).
  • a first drug-resistance gene i.e., GENETICIN aminoglycoside for the chimeric light chain gene vector
  • second drug resistance gene i.e., mycophenolic acid for the chimeric heavy chain gene vector
  • Sp2/0 mouse plasmacytoma cells were initially transformed with light chain-containing pSV2-neo vectors as follows. Cells were grown in RPMI 1640 medium with 5 percent fetal calf serum. Cells were washed in PBS and suspended to a concentration of 1 ⁇ 10 7 viable cells/mL PBS. 0.8 mL of cells were transferred to an electroporation curvette (on ice) containing 20 ⁇ g of light chain-containing pSV2neo vector (pRL105 and pRL150 for the CC49 chimeric L chain and pRL203 and pRL230 for the CC83 chimeric L chain) linearized with Aat II restriction endonuclease. Aat II was inactivated by heating the samples to 65° C.
  • cells were allowed to recover on ice for 15 minutes to allow relaxation of perturbed membranes. Afterwards, the cells were suspended in 24 mL of RPMI 1640 medium containing 5 percent fetal calf serum (RPMI+) and transferred to a 96 or 24 well plate. To decrease the probability of more than one drug resistant cell per well, the cells were also diluted 10-fold in medium (RPMI+) and plated into another 96-well (or 24-well) plate. The cell suspension was incubated at 37° C. and 5 percent CO 2 atmosphere.
  • the slides were mounted with FLUOROMOUNT-G, histologic mounting medium (obtained from Southern Biotechnology Associates, Inc., Birmingham, Ala.) under a coverslip.
  • the slides were observed with an OLYMPUS model BH-2 microscope (from Olympus Corp. of America, New Hyde Park, N.Y., now Olympus America, Inc., Lake Success, N.Y.) equipped with an epi-illumination U.V. attachment.
  • CC49 chimeric L chain For the CC49 chimeric L chain one cell line (49K-13-13) was obtained which expressed the chimeric light chain derived from CC49. This cell line was used for all subsequent targeted transformations with chimeric heavy chain vectors for constructs using the chimeric CC49 light chain.
  • CC83 chimeric L chain cell lines (83K-26-5, 83K-34-10, and 83K-42-2) were obtained which expressed the chimeric light chain derived from CC83.
  • One cell line (83K-26-5) stained more intensely than the others and had localized regions of cytoplasmic immunofluorescence. All three cell lines were compared for their relative ability to produce high levels of chimeric antibody after transformation with the chimeric CC83 g1 heavy chain vector. More clones expressing chimeric antibodies were derived from electroporation of the 83K-34-10 target than either of the other two chimeric light chain target cell lines. Therefore, the 83K-34-10 light chain cell line was used as a target for subsequent electroporations with chimeric heavy chain vectors for constructs containing the CC83 light chain variable region.
  • pSV2-gpt vectors Prior to transformation with pSV2-gpt vectors, which contain chimeric heavy chain constructions, drug selection for inhibition of growth of untransformed Sp2/0 plasmacytoma cells [obtained from the American Type Culture Collection (ATCC)] were established. Conditions for drug selection of cells transformed with pSV2-gpt vectors were more difficult to establish.
  • the E. coli gpt gene which codes for the enzyme guanosine phosphoribosyl transferase, confers the ability to utilize xanthine and hypoxanthine as substrates for the biosynthesis of guanine when the mammalian guanine metabolic pathway is inhibited by mycophenolic acid (MPA).
  • MPA mycophenolic acid
  • 49K-13-13 cells were used as a target for chimeric heavy chain constructs.
  • the cells were transformed with 20 pg chimeric heavy chain DNA vector (p49 ⁇ 1-7.8 or p49 ⁇ 1-2.3) linearized by Nde I digestion. Transformation by electroporation was performed as above for chimeric light chains.
  • Transformed cells grew to macroscopically visible colonies in 14 days. At that time, 50 ⁇ l of supernatant was removed and assayed by ELISA methods for binding to TAG and expression of human IgG constant region. Wells containing cells with positive TAG binding were expanded to 24-well plates with fresh drug selection medium and allowed to grow for 3-7 days.
  • Subcloning was performed as follows. Viable cell counts were determined and the cells were replated into two 96-well plates. One plate received 50 viable cells and the other received 250 viable cells. The unsubcloned cells were expanded to 6-well plates until the cell density was sufficient to allow for storage in liquid nitrogen in the event that re-subcloning would be necessary.
  • 83K-26-5, 83K-34-10, and 83K-42-2 cells demonstrating production of chimeric CC83 light chain were transformed as described in the transformation of CH44-1, with the exception that 20 ⁇ g of p83 ⁇ 1-7.8 or p83 ⁇ 1-2.3, the pSV2gpt vector which contains the chimeric CC83 heavy chain gene was used as the heavy chain vector.
  • chimeric antibodies were generated whose light and heavy chains were derived from different parents by mixed targeted transformations.
  • the chimeric heavy chain ⁇ 1 isotype vectors of CC49 and CC83 were electroporated into the chimeric light chain targets 83-K34-10 and 49K-13-13 respectively.
  • the resulting cell lines were designated CH48-1 and CH84-1, where the first numerical designation represents the heavy chain and light chain parents, respectively.
  • CH48-1 represents the ⁇ 1 isotype with the heavy chain derived from CC49 and the light chain derived from CC83.
  • the CH48-1 composite antibody did not bind to TAG-72. This was not due to the inability to make chimeric antibody, since most drug-resistant cell lines produced chimeric IgG (as determined by ELISA analysis using Goat Anti-Human Ig trap with Goat Anti-Human IgG-Alkaline Phosphatase as a probe). If any binding affinity were present, it was significantly less than that observed for the first generation antibody B72.3, which was approximately an order of magnitude less affinity for TAG-72 than either CC49 or CC83. Surprisingly, CH84-1 bound to TAG-72 with affinity similar to both parents.
  • 49K-13-13 cells demonstrating production of CH44 light chain by cytostaining were then transformed as described in the transformation of CH44-1, with the exception that 20 ⁇ g of p83 ⁇ 1-2.3, the pSV2gpt vector which contains the CH83 heavy chain gene was substituted for p49 ⁇ 1-2.3, the pSV2gpt vector which contains the CH44 heavy chain gene.
  • Chimeric antibodies were purified in two steps from culture supernatants.
  • a protein A affinity cartridge (Nygene Corporation, Yonkers, N.Y., USA) was utilized according to the manufacturer's specifications. Up to 1.0 L of culture supernatant was passed through a 1 mg capacity cartridge, at 5 mL/min. The cartridge was washed with phosphate buffered saline (PBS) to remove traces of albumin.
  • PBS phosphate buffered saline
  • the chimeric antibody was recovered by elution with 0.1 M sodium nitrate buffer, pH 3.0.
  • the pH of the fractions containing the chimeric antibody were immediately adjusted to neutrality with a 1M solution of TRIZMA base (Sigma Chemical Co., St. Louis, Mo.). Final purification was achieved from this solution, after concentration on an Amicon CENTRICON 30 unit, by gel filtration using a Pharmacia SUPEROSE 12 HR 16/50 column as specified by the manufacturer (Pharmacia, Piscataway, N.J., USA).
  • the first sample was 2 ⁇ g of a mixture of molecular weight standards consisting of bovine serum albumin (66.2 kilodaltons (Kd)) and soybean trypsin inhibitor (21.5 Kd), commercially available from Biorad.
  • the second sample consisted of 2 ⁇ g of purified CC49.
  • the third sample was 2 ⁇ g of purified CH-44-1.
  • the samples were loaded in 3 lanes of the gel, and electrophoresis was carried out at constant current (30 milliamperes (mA)) for a period of about 4 hours.
  • the gel was stained with Coomassie Brilliant Blue R-250 for about 1 hour and subsequently destained. Note the variation in size among the CH-44-1 heavy (H) and light (L) chains compared to the corresponding chains of CC49.
  • CH44-1 A cell line having CC49 V H , CC49 V L , and constant region of IgG 1 ;
  • CH44-2 A cell line having CC49 V H , CC49 V L , and constant region of IgG 2 ;
  • CH44-4 A cell line having CC49 V H , CC49 V L , and constant region of IgG 4 ;
  • CH88-1 A cell line having CC83 V H , CC83 V L , and constant region of IgG 1 ;
  • CH88-2 A cell line having CC83 V H , CC83 V L , and constant region of IgG 2 ;
  • CH88-3 A cell line having CC83 V H , CC83 V L , and constant region of Ig
  • chimeric anti-TAG-72 antibody was measured directly by reaction of an excess of goat anti-human IgG antibody labeled with an enzyme such as alkaline phosphatase, after allowing the chimeric anti-TAG-72 antibody to bind to microtiter wells coated with antigen (TAG-72).
  • Anti-TAG-72 activity was determined as a criterion for successful recombination.
  • Anti-TAG-72 activity was used as a criterion for successful recombination.
  • Wells of microtiter plates were coated with TAG by incubating 50 ⁇ l of a 1:75 dilution of purified TAG-72 (Muraro et al., Cancer Research , 48:4588-4596 (1988)) for 18 hours at room temperature.
  • the wells were then washed 4 times with phosphate buffered saline (PBS), and then blocked with BSA, by incubating 50 ⁇ l of 0.5 percent BSA in PBS for 2 hours at 37° C., followed by washing 4 times with PBS.
  • PBS phosphate buffered saline
  • BSA phosphate buffered saline
  • These plates are stable if kept moist at 4° C. 50 ⁇ l of a sample are then applied to each well.
  • a blank containing fresh medium is used as a control. All of the samples were incubated either in the plate for 90
  • the plates were then washed 4 times with PBS, and goat anti-human IgG-alkaline phosphatase (Southern Biotech Assoc.) was applied to each well by adding 50 ⁇ l of a 1:250 dilution. The solution was incubated at 37° C. for 90 minutes. Color development was monitored after washing the plates 4 times with PBS to remove the probe.
  • goat anti-human IgG-alkaline phosphatase Pacificn Biotech Assoc.
  • the substrate was incubated in 200 ⁇ l solution of substrate p-nitrophenyl phosphate (Kirkegaard & Perry) in ethanolamine buffered saline for 6 minutes at room temperature for color development.
  • the optical density at 405 nm of each well was read by a DYNATECH microplate reader (Dynatech Corp., Boston, Mass.).
  • the Sp2/0 colonies in wells with supernatants having TAG-72-binding chimeric antibody activity were subcloned by limited dilution. Individual subclones were chosen on the basis of relatively high production of chimeric antibody.
  • the procedures used to isolate the germline precursor gene to the heavy chain variable regions of CC46, CC49, CC83, and CC92 were essentially as outlined in Sambrook et al., supra.
  • the DNA used to generate the LAMBDA-ZAP genomic DNA library came from an irrelevant hybridoma cell line, i.e., a cell line which produces antibodies that do not appreciably bind to TAG-72.
  • the genomic DNA digests were subjected to the Southern hybridization technique, developed by Southern, J. Mol. Biol ., 98:503-517 (1975).
  • the DNA fragments were fractionated on the basis of their size by means of electrophoresis on a 0.8 percent agarose gel.
  • the double-stranded DNA fragments were modified into single-stranded DNA fragments in an alkali solution; a nitrocellulose filter was then placed into close contact with the gel to transfer the modified DNA segments onto the filter in the presence of a high salt concentration solution.
  • Hybridization was carried out using, as the probe a 250 base pair (bp) Eco RI-Nco I fragment containing 200 bp of 5′ flanking sequence and 50 bp of 5′ nontranslated sequence from the CC49 V H gene.
  • the probe was designated f49RN.
  • the probe was radiolabeled using 32 P ⁇ dCTP obtained from Amersham, Arlington Heights, Ill., USA, and the Oligolabeling kit obtained from Pharmacia, Piscataway, N.J., USA.
  • pV H ⁇ TAG-1 Approximately 900,000 plaques was screened from which one positive clone was isolated.
  • the positive clone was named pV H ⁇ TAG-1.
  • pV H ⁇ TAG-1 was about 5.2 kb, and the size of the DNA insert was determined by restriction enzyme mapping to be about 2.2 kb.
  • V H ⁇ TAG-1 IVS (+) (SEQ ID NO:47): 5′-CTAAAGTGGAGTCAGGGCCTG-3′;
  • V H ⁇ TAG-1 IVS ( ⁇ ) (SEQ ID NO:48): 5′-CAGGCCCTGACTCCACTTTAG-3′;
  • V H ⁇ TAG-1 CDR2 (+) (SEQ ID NO:49): 5′-GAATGGATTGGATATATTTCTC-3′.
  • FIGS. 2A-2G show where somatic mutations have been introduced into the productively rearranged subset members. The predicted amino acid substitutions ascribed to those somatic mutations are shown in FIGS. 3A-3E.
  • a mouse-human chimeric antibody molecule can be generated which contains the murine V H ⁇ TAG germline heavy chain variable region, a light chain variable region that is complementary to the V H ⁇ TAG V H , such as either the CC49 or CC83 murine light chain variable region, and human constant regions.
  • FIG. 39 shows the overall reaction for the engineering of hybrid genes based on the method of Horton et al., (1989), supra.
  • Four oligonucleotides (oligos) are designed to be used in enzymatic amplification and modification of the target DNA.
  • Oligo 1 anneals to the 5′ end of V H ⁇ TAG spanning the Eco RI site which is 249 bp 5′ to the ATG initiation codon.
  • Oligo 2 anneals to sequences complementary to the 3′ end of the V H ⁇ TAG exon and also contains sequences coding for a D segment. The D segment sequences in oligo 2 do not anneal with any V H ⁇ TAG sequences.
  • Oligo 3 contains sequences complementary to the 5′ end of the murine genomic J-C ⁇ region and incorporates sequences encoding the D segment (same as in oligo 2) and the J segment.
  • Oligo 4 anneals to the 3′ end of the J-C ⁇ region and contains sequences complementary to the EcoRI site located 1219 bp 3′ to J H 4. The sequence of these oligos follow:
  • Oligo 1 (SEQ ID NO:50) 5′ GTCTAG AATTCAT AAAAACTTTATG 5′ GTCTA GAATTC ATAAAAACTTTATG (25 mer)
  • Oligo 2 (SEQ ID NO:51) CAGTGTATTTCTGTAAAAGA TCTACTATGGTTACG (35 mer)
  • Oligo 3 (SEQ ID NO:52) 5′ TCTACTATGGTTACG TGGGGTCAAGGAACCTCAGTCACC GTCTCCTCAG GTAAGAATGGCCTCTCCAGGTCT 3′ (72 mer)
  • Oligo 4 (SEQ ID NO:53) 5′ ACTTCTAAAATGTATTTA GAATTC ATTTTC 3′
  • the D sequence is SP2.3 taken from the published sequence of Kurosawa and Tonegawa, J. Exp. Med ., 155:201 (1982).
  • the D sequence is shown in bold face type in oligos 2 and 3. Any other characterized murine or human D segment can be used by substituting their sequence in these positions of oligo 2 and 3.
  • the J segment in oligo 3 is underlined. It is the murine J H 4 taken from the published sequence of Gough and Bernard, Proc. Natl. Acad. Sci . ( USA ), 78:509 (1981). The inclusion of any other murine or human J segment can be made by substituting their sequences for the sequence of J H 4 in oligo 3.
  • DNA amplification reaction #1 copies the V H ⁇ TAG sequence and adds a D segment to its 3′ end.
  • DNA amplification reaction #2 copies the murine intron sequences containing the heavy chain enhancer sequences and adds the D and J segments encoded within oligo 3.
  • the amplified products from reaction 1 and 2 are gel purified, combined and oligos 1 and 4 are added to initiate reaction #3.
  • reaction 3 the products of reactions 1 and 2 anneal across their common D sequences.
  • Subsequent DNA amplification from oligos 1 and 4 yields the product shown at the bottom of FIG. 39 . This fragment is digested with Eco RI and gel purified.
  • the modified V H ⁇ TAG fragment is ligated into the Eco RI site of pSV2gpty1(2.3) as described in the example “Heavy Chain Chimeric Constructs”, above.
  • the entire V H ⁇ TAG-D-J-enhancer containing fragment is sequenced completely to ensure that no mutations have been introduced during the DNA amplification reactions.
  • the other three heavy chain ⁇ isotypes can be generated by ligating the same modified V H ⁇ TAG fragment into the other three ⁇ containing pSV2gpt vectors (pSV2gpt- ⁇ 2; pSV2gpt- ⁇ 3; pSV2gpt- ⁇ 4).
  • the modified V H ⁇ TAG gene containing plasmids can be linearized with NdeI and introduced via electroporation into the chimeric CC49 or CC83 light chain expressing cell lines (see example “C. Targeted Transformations”, above).
  • the transformed cells are selected for growth in the presence of GENETICIN aminolgycoside and mycophenolic acid as outlined above in “C. Targeted Transformations”.
  • the presence of expressed antibody is monitored by TAG-72 ELISA (see section in RESULTS, Enzyme-Linked Immunoassays (ELISA)).
  • the expressed antibody from these cells will contain human Ig ⁇ 1, ⁇ constant regions with the CC49 or CC83 light chain variable region and a heavy chain variable region from the modified V H ⁇ TAG germline V H exons.
  • V H ⁇ TAG heavy chain variable region constructs having a variety of D and J segments are shown below:
  • the sequence of the human D sequence D1 is obtained from Siebenlist et al., Nature , 294:631 (1981).
  • the sequence of the human J H 1 is obtained from Ravetch et al., Cell , 27:583 (1981).
  • V H ⁇ TAG #i The generation of V H ⁇ TAG #i is described with the above diagramed oligos 1 through 4. To generate V H ⁇ TAG #ii through #iv the corresponding D and J segments need to be changed in oligos 2 and 3. The following oligos delineate these changes. Substitution of these oligos in reaction #1 and reaction #2 will result in the generation of the V H ⁇ TAG #ii through #iv.
  • nucleic acid probe was designed to hybridize with the 5′ nontranslated region of all heavy chain variable region mRNAs derived from V H ⁇ TAG.
  • the hybridization probe was isolated from the heavy chain variable region gene of CC49 as an Eco RI-Nco I restriction enzyme digested fragment.
  • f49RN Fifty micrograms of a plasmid containing the gene encoding the heavy chain variable region of CC49 were digested with 40 units of Eco RI [Bethesda Research Laboratories, Gaithersburg, Md., USA, (BRL)] and 21 units of Nco I [BRL]. The digested DNA was fractionated on a 4 percent polyacrylamide gel and the 250 base pair fragment containing the 5′ nontranslated sequence was purified by electroelution [Sambrook et al., supra]. The 248 bp fragment was designated f49RN and it contained 52 base pairs of 5′ nontranslated sequence and 196 base pairs of 5′ gene flanking sequence. The sequence of f49RN (SEQ ID NO:58) follows:
  • f49RN was recloned into pBLUESCRIPT SK( ⁇ ) (Stratagene, La Jolla, Calif., USA).
  • the cloned insert was sequenced and shown to be a 496 base pair doublet of f49RN. This insert fragment was designated f49-5′.
  • Fragment f49-5′ was radiolabeled using a Pharmacia Oligolabelling Kit (Pharmacia LKB Biotechnology, Piscataway, N.J., USA).
  • a Pharmacia Oligolabelling Kit Pharmacia LKB Biotechnology, Piscataway, N.J., USA.
  • One hundred nanograms of DNA in 20 ⁇ l sterile deionized water (dH20) was denatured at 90° C. for 15 minutes, then incubated at 37° C. for 5 minutes before being placed on ice. Twelve microliters of the Pharmacia reagent mix, 2 ⁇ l BSA (3 mg/ml) about 70-80 ⁇ Ci 32 P ⁇ -dCTP and 2.5 ⁇ l of Klenow fragment were added and the reaction incubated for about 6 hours at room temperature. The reaction was terminated by addition of 20 ⁇ l Stop reagent.
  • the P 32 -labeled f49-5′ was seperated from free isotope on a G50 NICK column (Pharmacia LKB Biotechnology, now Pharmacia Biotechnology AB, Uppsala, Sweden) equilibrated in 10 mM Tris-HCl, 1 mM EDTA, pH 8.0 (TE buffer). Radiolabeled probe was used within 5 days of preparation.
  • a novel library of antibodies was prepared by immunizing mice against immunoaffinity purified TAG-72.
  • Members of this library designated as the AHC series, were examined for the presence of V H encoded by DNA derived from V H ⁇ TAG.
  • mice were sacrificed by cervical dislocation and the spleens or popliteal lymph nodes removed aseptically.
  • Single cell suspensions of the spleens or nodes were prepared by expelling the cell mass from the sac with syringe needles.
  • the lymphocytes were washed with sterile PBS twice.
  • the lymphocytes were mixed in a ratio of 4:1 (1:1 in the case of the lymph nodes) with plasmacytoma cells from the line P3X63-Ag8.653 (ATCC CRL158) in PBS and fused with 45 percent (v/v) polyethylene glycol (molecular weight 3700).
  • the cells were plated out at between 5 ⁇ 10 5 to 5 ⁇ 10 6 nucleated cells per ml in 96 well plates using RPMI-1640 medium containing L-glutamine (2 mM), sodium pyruvate (1 mM), penicillin (50 units/ml) and streptomycin (50 ⁇ g/ml).
  • the medium was supplemented with 8.8 percent (v/v) fetal bovine serum (Hyclone Laboratories, Logan, Utah, USA) and at least 1 ⁇ 10 4 murine peritoneal exudate cells/ml).
  • the medium was further supplemented with hypoxanthine-aminopterin-thymidine (Sigma Chemical Company) according to the manufacturer's instructions.
  • the cells were incubated at 37° C. in 7 percent CO 2 .
  • Cells at mid to high densities (at least 2 ⁇ 10 5 /ml) were suspended in 200 ⁇ l RPMI-1640 medium and plated in 96 well tissue culture plates. After settling, half the medium was removed and replaced with 100 ⁇ l of a lysis buffer containing 5.0 M KSCN and 50 percent v/v DMSO (both obtained from the Sigma Chemical Company).
  • RNA from the lysates was adsorbed onto OPTIBIND nitrocellulose paper (Schleicher and Schuell, Keene, N.H., USA) pre-wetted with 20 ⁇ SSC (20 ⁇ saline sodium citrate buffer containing 3M NaCl and 0.3M trisodium citrate, pH 7.0) (Sigma Chemical Co.) using a 96 well MINIFOLD dot blot apparatus (Schleicher and Schuell, Keene, N.H.). The MINIFOLD dot blot apparatus was rinsed with 200 ⁇ l of 20 ⁇ SSC and the membrane washed twice in the same buffer. The blot was dried under vacuum at 80° C. for about 2 hours. Blots could also be stored wet at ⁇ 20° C. or after drying at room temperature before probing.
  • Blots were prehybridized in buffer containing 5 ⁇ Denhardt's solution (0.1% BSA, 0.1% Ficoll, and 0.1% PVP), 5 ⁇ SSPE (5 ⁇ saline sodium phosphate EDTA buffer containing 0.745M NaCl, 0.05M NaH 2 PO 4 , and 0.005M disodium EDTA, pH 7.4), 100 ⁇ g/ml boiled salmon sperm (all Sigma Chemical, St. Louis, Mo., USA), 50 percent (v/v) deionized formamide (Bethesda Research Labs, Bethesda, Md., USA) and 20 percent (w/v) SDS at 42° C. for 60 minutes.
  • dextran sulfate (Oncor, Gaithersburg, Md., USA) was added to 5 percent (v/v) solution. Twenty microcuries of radiolabeled probe was boiled for 5 minutes to denature the probe and then added to 20 ml hybridization buffer. The probe was allowed to hybridize overnight at 42° C. Blots were washed in 2 ⁇ SSPE containing 0.1 percent SDS for 10 minutes at room temperature and 0.1 ⁇ SSPE containing 0.1 percent SDS for 10 minutes at room temperature and 0.1 ⁇ SSPE containing 0.1 percent SDS for 60 minutes at 42° C., wrapped in SARAN WRAP and exposed to X ray film with two enhanced screens overnight at ⁇ 70° C.
  • the cell lysates were plated out as described above and probed with f49-5′ for the presence of RNA containing sequences from the 5′ nontranslated region of the V H ⁇ TAG germline gene.
  • samples of an anti-TAG-72 antibody and P3X63-Ag8.653 were used as positive and negative controls, respectively.
  • P3X63-Ag8.653 were used as positive and negative controls, respectively.
  • 20 demonstrated binding with the f49-5′ probe.
  • Poly A + RNA was prepared from several of these lines and sequenced.
  • Poly A + RNA was prepared using the Invitrogen FASTTRACK RNA isolation kit (Invitrogen, San Diego, Calif., USA) according to the manufacturer's instructions. Alternatively, total RNA was prepared by guanidinium isothiocyanate lysis of a washed cell pellet followed by CsCl density gradient centrifugation. The Poly A + RNA was purified using an oligo dT cellulose column (Invitrogen, San Diego, Calif., USA).
  • Poly A + RNA was sequenced using AMV reverse transcriptase and dideoxy nucleotides in a protocol derived from Geleibter (1987), supra. Briefly, the priming oligonuceotides (see below) were end-labeled using T4 kinase (BRL) and 32 P ⁇ ATP. Between 7 and 11 ⁇ g poly A + RNA was precipitated with ethanol and rehydrated with 10 ⁇ l annealing buffer. Five ng labeled oligonucleotide (in 1 ⁇ l) were added to the RNA and incubated in 80° C. for about 3 minutes. The temperature was then ramped back to about 50° C. and held for 15 minutes.
  • RNA and oligonucleotides were added to enzyme and dideoxy and deoxynucleotides and incubated at 50° C. for about 50 minutes. The reaction was stopped with formamide and the samples analyzed on a 6 percent polyacrylamide/7M urea gel at 35 mAmps.
  • C ⁇ 1 is a 24 base oligonucleotide (SEQ ID NO:59) complementary to the CH1 domain of IgG1 heavy chain. Its sequence is shown below:
  • oligonucleotides were prepared on Model 380A DNA Synthesizer (Applied Biosystems Inc., Foster City, Calif., USA) and gel purified before use.
  • the partial sequences obtained from four AHC hybridomas which bound the probe are shown in FIGS. 42A-42B (SEQ ID NO:61 for V H ⁇ TAG; SEQ ID NO:62 for AHC46; SEQ ID NO:63 for AHC121; SEQ ID NO:64 for AHC139; and SEQ ID NO:65 for AHC160).
  • variable regions of subset members can be expressed with modified constant regions.
  • the smaller of these molecules resemble enzymatically derived Fab and F(ab′)2.
  • the larger molecule (CH3-minus) is intermediate in size between a F(ab′)2 and a full-sized antibody.
  • the respective molecular weight are 1 ⁇ 3, 2 ⁇ 3 and 5 ⁇ 6 of a full-sized antibody (150,000 daltons).
  • the heavy chains were modified by successively removing the CH3, CH2, and hinge domains of the human ⁇ 1 and ⁇ 3 constant region genes used in the expression of chimeric antibodies.
  • human ⁇ 1 and ⁇ 3 constant region genes used in the expression of chimeric antibodies.
  • human ⁇ 1 and ⁇ 3 constant region genes used in the expression of chimeric antibodies.
  • human ⁇ 3 see Ellison et al. (1982), supra; Takahashi et al. (1982), supra.
  • human ⁇ 3 see Krawinkel et al. (1982), supra, and Takahashi et al., supra. Because the sequence for ⁇ 1 and ⁇ 3 have been provided, it is possible to prepare oligonucleotides for PCR and obtain the genes from human DNA.
  • FIG. 43 illustrates the process: two DNA fragments designated y-b1 and a-x (which eliminate the desired exons between them) were generated seperately by PCR. This was accomplished by the use of short oligonucleotide primers, corresponding to each of the 5′ end (primers y and a) and 3′ end (primers b1 and x) of the fragments of interest.
  • the unique advantage of the SOE technique is accomplished by the inclusion of a “wagging tail” on at least one side of the intended junction.
  • This “wagging” region (designated “(a)” on each of primers b1, b2, and b3) must be complementary to the opposite strand of the intended junction.
  • the two PCR-derived DNA (y-b1 and a-x) were mixed, denatured and reannealed over the regions of overlap derived from the “wagging tail”.
  • the overlap is extended and amplified.
  • the 524 base pair DNA fragment, a-x starts with the Gly-Lys and termination codons, and includes the polyadenylation signal plus any other sequences from the 3′ end of the fragment which may be of importance.
  • This fragment was used as the 3′ joining fragment for all of the above constructs.
  • the DNA sequence of the approximately 300 bp at the 3′ end of the fragment is not known, the PCR was performed from a 3′ primer derived from the adjacent vector sequence and included the Bam HI restriction site of the fragment.
  • the human ⁇ 1 heavy chain is unique in that it is covalently attached to the light chain via a disulfide bond with Cys-H233, which is located in the hinge domain, rather than via Cys-H127, found in the CH1 domains of the other heavy chains, with the exception of ⁇ 1 (set forth in Kabat et al. (1987), supra).
  • the CH1 domain of the ⁇ 3 heavy chain was chosen for the Fab construct because it contains the appropriate Cys-H127 and only three other amino acid differences, two of which are conservative changes (Lys to Arg) for an overall amino acid similarity of 96 percent.
  • the initial PCR resulted in an a-x fragment of 524 bp, a y-b1 fragment of 544 bp, a y-b2 fragment of 977 bp, and a y-b3 fragment of 1425 bp.
  • the results from the SOE reaction using the 5′ and 3′ oligos (y and x, respectively) of y-b1 and a-x yields a fragment y-b1-x of 1068 bp.
  • the results from the SOE reaction using the 5′ and 3′ oligos (y and x, respectively) of y-b2 and a-x yields a fragment y-b2-x of 1501 bp.
  • oligonucleotide primers described above have the following sequences:
  • b1 (SEQ ID NO:69): 5′-CCGTCGCACTCATTTACCAACTCTCTTGTCCACCTT-3′;
  • b2 (SEQ ID NO:70): 5′-CCGTCGCACTCATTTACCTGGGCACGGTGGGCATGT-3′;
  • b3 (SEQ ID NO:71): 5′-CCGTCGCACTCATTTACCTTTGGCTTTGGAGATGGT-3′.
  • the fragments were digested with Eco RI and Bam HI and gel purified (Maniatis, et al. (1982), supra). Each fragment was ligated with the Eco RI/Bam HI fragment of the SV2-gpt vector. These vectors are able to accept any V H fragment with Eco RI ends.
  • the 1.9 kb Eco RI fragment containing the CC49 V H was ligated into the Eco RI site of each of the shortened heavy chain vectors and clones analyzed by Nco I digestion for correct orientation of the V H fragment.
  • Each of the chimeric CC49 shortened heavy chain vectors was linearized with Nde I and electroporated into target cells which express the chimeric CC49 light chain.
  • TAG-72 binding activity in the medium of mycophenolic acid (MPA)-resistant colonies was detected by ELISA with alkaline phosphatase-conjugated goat anti-human kappa antibody (Southern Biotechnology Associates, Inc., Birmingham, Ala., USA).
  • the vector containing the 49V H fragment alone (p 49 V H -gpt) was also electroporated into target cells (SP2/0) which do not express light chain or heavy chain (Shulman et al., Nature , 276:269-270 (1978)).
  • the possible TAG-72 binding activity produced by these MPA-resistant colonies was measured by competition ELISA. Colonies with positive TAG-72 ELISA activity were expanded to 24-well plates, subcloned, and selected.
  • Ch44-CH3 ⁇ a constant region of the human ⁇ 1 heavy chain with a removed CH3 domain (the sequence of which is set forth in FIG. 44 (SEQ ID NO:72)); Ch44-F(ab′) 2 : a constant region of the human ⁇ 1 heavy chain with removed CH2 and CH3 domains (the sequence of which is set forth in FIG. 45 (SEQ ID NO:73)) and Ch44-Fab: a constant region of the human ⁇ 3 heavy chain with a removed hinge region and CH2 and CH3 domains (the sequence of which is set forth in FIG. 46 (SEQ ID NO:74)).
  • chimeric monoclonal antibodies used in animal studies and shown in Tables 1-4 below were labeled with Na 125 I using IODO-GEN iodination reagent (Pierce Chemical, Rockford, Ill., USA). More specifically, from about 0.5-2 mg of purified chimeric monoclonal antibodies were adjusted to about 0.5 mL with 0.1 M sodium phosphate buffer (pH 7.2) and then added to a 12 cm ⁇ 75 cm glass tube coated with 50 ⁇ g of IODO-GEN iodination reagent followed by addition of from 0.1-0.5 mCi of Na 125 I (New England Nuclear, Boston, Mass., USA).
  • the protein was removed from the insoluble IODO-GEN iodination reagent, and the unincorporated 125 I was separated from the antibody by gel filtration through a 10 mL column SEPHADEX G-25 (from Pharmacia, Inc., Piscataway, N.J.) using PBS as the buffer.
  • the iodination protocol yielded labeled IgG chimeric antibody with a specific activity of 0.05 to 0.2 ⁇ Ci/ ⁇ g.
  • mice Female athymic mice (nu/nu) on a CD1 background were obtained from Charles River at approximately 4 weeks of age. Nine days later, mice were inoculated subcutaneously (0.1 mL/mouse) with LS174T cells (1 ⁇ 10 6 cells/animal).
  • Athymic mice bearing carcinomas 70 to 400 mg in weight, approximately 12 to 13 days after inoculation of the cells were given injections intravenously of from 0.5 to 2.0 ⁇ Ci (10-50 ⁇ g protein) in PBS of the chimeric monoclonal antibodies, which had been iodinated as described above.
  • Groups of five mice were sacrificed at varying times by exsanguination, the carcinoma and normal tissues were excised and weighed, and the cpm were measured in a gamma counter. The cpm/mg of each tissue was then determined and compared to that found in the carcinoma.
  • CH44-1 As shown in Table 1, at approximately 122 hours post-injection, the percent injected dose to tumor for CH44-1 was 44.16 percent. CH44-1 was, therefore, efficient in targeting the human tumor in situ. This demonstrates that the chimeric monoclonal antibodies of the present invention were efficient for in vivo carcinoma targeting and thus are useful for in vivo treatment of cancer.
  • CH44-1 As shown in Table 2, at 122 hours post-injection, the percent of injected dose to tumor for CH44-1 was 4.55 percent. CH44-1 was, therefore, efficient in targeting the human tumor in situ. This demonstrates that the chimeric monoclonal antibodies of the present invention were efficient for in vivo carcinoma targeting and thus were useful in in vivo treatment of cancer.
  • CH84-1 As shown in Table 3, at approximately 118 hours post-injection, the percent of injected dose to tumor for CH84-1 was 30.27 percent. CH84-1 was, therefore, efficient in targeting the human tumor in situ. This demonstrates that the chimeric monoclonal antibodies of the present invention were efficient for in vivo carcinoma targeting and thus were useful in in vivo treatment of cancer.
  • CH84-1 As shown in Table 4, at approximately 118 post-injection, the percent of injected dose to tumor for CH84-1 was 7.02 percent. CH84-1 was, therefore, efficient in targeting the human tumor in situ. This demonstrates that the chimeric monoclonal antibodies of the present invention were efficient for in vivo carcinoma targeting and thus were useful in in vivo treatment of cancer.

Abstract

This invention concerns a family of chimeric antibodies with high affinities to a high molecular weight, tumor-associated sialylated glycoprotein antigen (TAG-72) of human origin. These antibodies have (1) high affinity animal VH and VL sequences which mediate TAG-72 binding and (2) human CH and CL regions. They are thought to produce significantly fewer side-effects when administered to human patients by virtue of their human CH and CL antibody domains. The nucleotide and amino acid sequences of VHαTAG VH, CC46 VH, CC49VH, CC83 VH, and CC92 VH, and CC49VL, CC83 VL, and CC92 VL idiotype sequences are disclosed, as well as in vivo methods of treatment and diagnostic assay using these chimeric antibodies.

Description

CROSS REFERENCE TO RELATED APPLICATIONS
The present application is a continuation-in-part of application U.S. Ser. No. 08/823,105, filed Mar. 24, 1997, now abandoned, which is a divisional application from application U.S. Ser. No. 08/040,687, filed Mar. 31, 1993, now U.S. Pat. No. 6,051,225, which is a continuation-in-part of U.S. Ser. No. 07/424,362, filed Oct. 19, 1989, now abandoned, which is a continuation-in-part of U.S. Ser. No. 07/261,942, filed Oct. 24, 1988, now abandoned, which is a continuation of U.S. Ser. No. 07/259,943, filed Oct. 19, 1988, now abandoned, all of which are hereby incorporated by reference. The present application is also a continuation-in-part of application U.S. Ser. No. 08/040,687, filed Mar. 31, 1993, now U.S. Pat. No. 6,051,225.
FIELD OF THE INVENTION
This invention relates to the field of immunoglobulin production and modifications to naturally occurring antibody amino acid sequences. Specifically, the invention relates to using recombinant DNA techniques to produce chimeric genes and to take advantage of these gene modification techniques to construct chimeric antibodies.
BACKGROUND OF THE INVENTION
Antibodies are specific immunoglobulin (Ig) polypeptides produced by the vertebrate immune system in response to challenges by foreign proteins, glycoproteins, cells, or other antigenic foreign substances. The sequence of events which permits the organism to overcome invasion by foreign cells or to rid the system of foreign substances is at least partially understood. An important part of this process is the manufacture of antibodies which bind specifically to a particular foreign substance. The binding specificity of such polypeptides to a particular antigen is highly refined, and the multitude of specificities capable of being generated by the individual vertebrate is remarkable in its complexity and variability. Millions of antigens are capable of eliciting antibody responses, each antibody almost exclusively directed to the particular antigen which elicited it.
Two major sources of vertebrate antibodies are presently utilized—generation in situ by the mammalian B lymphocytes, and generation in cell culture by B-cell hybrids. Antibodies are generated in situ as a result of the differentiation of immature B lymphocytes into plasma cells, which occurs in response to stimulation by specific antigens. In the undifferentiated B cells, the portions of DNA coding for the various regions on the immunoglobulin chains are separated in the genomic DNA. The sequences are assembled sequentially prior to expression. A review of this process has been given by Gough, Trends in Biochem. Sci., 6:203 (1981).
The resulting rearranged gene is capable of expression in the mature B lymphocyte to produce the desired antibody. However, even when a particular mammal is exposed to only a single antigen a uniform population of antibodies does not result. The in situ immune response to any particular antigen is defined by the mosaic of responses to the various determinants which are present on the antigen. Each subset of homologous antibodies is contributed by a single population of B cells—hence in situ generation of antibodies is “polyclonal”.
This limited but inherent heterogeneity has been overcome in numerous particular cases by use of hybridoma technology to create “monoclonal” antibodies in cell cultures by B cell hybridomas [See Kohler and Milstein, Nature 256:495-497 (1975)].
In this process, the relatively short-lived, or mortal, splenocytes or lymphocytes from a mammal which has been injected with antigen are fused with an immortal tumor cell line, thus producing hybrid cells or “hybridomas” which are both immortal and capable of producing the genetically coded antibody of the B cell. The hybrids thus formed are segregated into single genetic strains by selection, dilution, and regrowth, and each strain thus represents a single genetic line. They therefore, produce antibodies which are assured to be homogeneous against a desired antigen. These antibodies, referencing their pure genetic parentage, are called “monoclonal”.
Monoclonal antibodies with mono-specificity have greatly influenced immunology, and their usefulness has already been demonstrated in such sciences as biology, pharmacology, chemistry and others. Such monoclonal antibodies have found widespread use not only as diagnostics reagents [see, for example, Immunology for the 80's, Eds. Voller, et al., MTP Press, Lancaster, (1981), but also therapy (see, for example, Ritz and Schlossman, Blood, 59:1-11, (1982)].
Monoclonal antibodies produced by hybridomas, while theoretically effective as discussed above and clearly preferable to polyclonal antibodies because of their specificity, suffer from an important disadvantage. In many applications, the use of monoclonal antibodies produced in non-human animals is severely restricted where the monoclonal antibodies are to be used in humans. Repeated injections of a “foreign” antibody in humans, such as a mouse antibody, may lead to harmful hypersensitivity reactions. Such a non-human derived monoclonal antibody, when injected into humans, causes a anti-nonhuman antibody (ANHA) response. For a discussion of a specific ANHA response caused by using murine-derived antibodies, human anti-mouse antibody (HAMA) response, see Shawler et al., Journal of Immunology, 135:1530-1535 (1985).
It is believed that animal immunoglobulins having human constant regions will generate less of an ANHA response when injected into humans than animal immunoglobulins having nonhuman constant regions. As such, monoclonal antibodies having good binding affinities for selected antigens and having human constant regions are thought to possess great potential utility for immunological diagnosis and therapy of human patients with cancer.
Various attempts have so far been made to manufacture human-derived monoclonal antibodies by using human hybridomas. For example, human-human hybridomas [Olsson et al., Proc. Natl. Acad. Sci. (USA), 77:5429 (1980)]; human-murine hybridomas [Schlom et al., Proc. Natl. Acad. Sci. (USA), 77:6841 (1980)] and several other xenogenic hybrid combinations have been prepared. Human monoclonal antibodies have also been produced by transformation of lymphocytes using Epstein-Barr virus. However, such hybridomas may potentially harbor pathogenic human viruses. Alternatively, primary, antibody producing B cells have been immortalized in vitro by transformation with viral DNA. Unfortunately, yields of monoclonal antibodies from human hybridoma cell lines are relatively low (1 μg/mL in human compared to 100 μg/mL in mouse hybridomas), and production costs are high.
While human immunoglobulins are highly desirable in immunological diagnosis and therapy of human cancer patients, human hybridoma techniques have not yet reached the stage where human monoclonal antibodies with required antigenic specificities can be easily obtained. In addition, for obvious ethical reasons, researchers can not immunize human subjects with selected toxic or otherwise deleterious antigens to generate antibodies against the specific antigen. This imposes great restrictions on immunological diagnosis and therapy of human patients.
No human antibody has been isolated which relatively strongly binds to TAG-72. Consequently, suitable antibodies must be engineered. The production of human-derived monoclonal antibodies is certainly possible, but is still inefficient in view of its low reproducibility and the other problems noted above. Consequently, most monoclonal antibodies are derived from non-human animals.
A monoclonal antibody which reacts with high binding affinity to human tumor antigens, but which is not recognized as a foreign substance by humans is highly desirable. A method to overcome this difficulty is to create artificially, an antibody which is very similar to a human antibody and is not recognized as a foreign substance within the human body, i.e., a chimeric, or “humanized” antibody.
Typically in chimeric antibodies, the variable region of both light and heavy chains mimics the variable regions of antibodies derived from one species of mammals, while the constant portions are homologous to the sequences in antibodies derived from humans. One clear advantage to such chimeric forms is that, for example, the variable regions can conveniently be derived from presently known sources using readily available hybridomas of B cells from non-human host organisms in combination with constant regions derived from, for example, human cell preparations. While the specificity of the variable region is not affected by its source, the constant region being human, is less likely to elicit an immune response from a human subject when the antibodies are injected than would the constant region from a non-human source.
One known human tumor antigen is tumor-associated glycoprotein (TAG-72). TAG-72 is associated with the surface of certain tumor cells of human origin, specifically the LS174T tumor cell line. LS174T [American Type Culture Collection, 10801 University Boulevard, Manassas, Va. 20110-2209 (herein ATCC) No. CL 188] is a variant of the LS180 (ATCC No. CL 187) colon adenocarcinoma line.
The karyotype of LS174T is similar to that of LS180 with a missing X chromosome in a majority of the cells. Data has been presented as described in Johnson, et al., Cancer Res., 46:850-857 (1986), to characterize the TAG-72 molecule as a mucin. This conclusion is based on the following observations: (a) TAG-72 has a high molecular weight (>1×106) as shown by its exclusion from a SEPHAROSE CL-4B column (modified polysaccharide gel filtration column from Pharmacia, Inc., Piscataway, N.J.); (b) the density of TAG-72 determined by equilibrium centrifugation in CsCl was 1.45 gm/mL, indicating a heavily glycosylated glycoprotein; (c) TAG-72 demonstrates a change in migration after neuraminidase digestion, indicating that it is a heavily sialylated molecule with an abundance of O-glycosidically linked oligosaccharides characteristic of mucins; (d) blood group antigens commonly found on mucins are found on affinity-purified TAG-72; and (e) Chondroitinase ABC digestion had no effect on TAG-72, thus demonstrating that the TAG-72 epitope is not expressed on a chondroitin sulfate proteoglycan.
Numerous murine monoclonal antibodies have been developed which have binding specificity for TAG-72. One of these monoclonal antibodies, designated B72.3, is a murine IgGl produced by hybridoma B72.3 (ATCC No. HB-8108). B72.3 is a first generation monoclonal antibody developed using a human breast carcinoma extract as the immunogen (see Colcher et al., Proc. Natl. Acad. Sci. (USA), 78:3199-3203 (1981); and U.S. Pat. Nos. 4,522,918 and 4,612,282). As used herein, the expression “first generation monoclonal antibody” means a monoclonal antibody produced using, as the immunogen, a crude cell extract.
Other monoclonal antibodies directed against TAG-72 are designated “CC” (colon cancer). CC monoclonal antibodies are a family of second generation murine monoclonal antibodies. As used herein, the expression “second generation monoclonal antibody” means a monoclonal antibody produced using, as the immunogen, an antigen purified with a first generation monoclonal antibody. CC monoclonal antibodies were prepared using TAG-72 purified with B72.3. A discussion of the method for producing the CC antibodies is set forth in U.S. Pat. No. 7,073,685 (U.S. Pat. No. 7,073,685, abandoned, continued as U.S. Pat. No. 7,547,336, now U.S. Pat. No. 5,512,443), the application was filed by Schlom et al. on Jul. 15, 1987 and is available to the public from the National Technical Information Service. Because of their relatively good binding affinities to TAG-72, the following CC antibodies have been deposited at the ATCC, with restricted access having been requested: CC49 (ATCC No. HB 9459); CC 83 (ATCC No. HB 9453); CC46 (ATCC No. HB 9458); CC92 (ATCC No. HB 9454); CC30 (ATCC No. HB 9457); CC11 (ATCC No. HB 9455); and CC15 (ATCC No. HB 9460).
U.S. Pat. No. 7,073,685 teaches that the CC antibodies may be altered into their chimeric form by substituting, e.g., human constant regions (Fc) domains for mouse constant regions by recombinant DNA techniques known in the art. It is believed that the proposals set out in U.S. Pat. No. 7,073,685 did not lead to an actual attempt to express any chimeric Ig polypeptide chains, nor to produce Ig activity, nor to secrete and assemble Ig chains into the desired chimeric Igs.
It is known that the function of an Ig molecule is dependent on its three dimensional structure, which in turn is dependent on its primary amino acid sequence. Thus, changing the amino acid sequence of an Ig may adversely affect its activity. Moreover, a change in the DNA sequence coding for the Ig may affect the ability of the cell containing the DNA sequence to express, secrete or assemble Ig.
Numerous articles confirm the fact that an antibody has a very complicated, a delicate three-dimensional structure. Dr. Kameyma Koh-Zoh commented, in an article in Saibo Kogaku, 4(12):1025-1035 (1985), in attempting to prepare a chimeric antibody to a melanoma antigen:
Using a chimeric antibody purified by means of HPLC, its bindability to a purified melanoma antigen was measured, but regretfully, for the time being there could not be obtained results showing its binding activity. As causes, first, there is a possibility that the C region affected the steric structure of the V region caused by the changing the mouse IgM antibody to human IgG antibody.
Idiotypes are antigenic determinants that involve variable regions of heavy and light chains of immunglobulin molecules. Isotypes and/or allotypes are antigenic determinants that are restricted to the constant regions of heavy chains. Attention is further directed to Morahan et al., Nature, 301:720-722 (1983), which teach:
The T15 idiotype, defined by sera raised in A strain mice, or in rabbits, is considered identical to that expressed by the majority of BALB/c anti-PC antibodies. To define the idiotypic determinants (idiotopes) of which the T15 idiotype is comprised, monoclonal anti-T15 antibodies were used here to examine both serum and monoclonal anti-PC antibodies. The latter were found to differ from T15 with respect to the idiotope defined by the monoclonal anti-idiotope antibody, 21A5, in that the '21A5 idiotope' was absent from anti-PC sera; of the monoclonal anti-PC antibodies examined, only those which were both T15+ and of the IgA isotype seemed to express this idiotype fully. This result suggests that not only the V region, but also the constant region, of the immunoglobulin molecule can contribute to the formation of an idiotypic determinant. (emphasis added)
Nishinarita et al., The Journal of Immunology, 134(4):2544-2549 (1985) teach:
Recently, Morahan et al. (12) described an anti-T15 hybridoma antibody, 21A5, that identified an idiotypic determinant associated with T15 Id and the IgA CH region . . . we have shown that NL24 binding to C3 is inhibited by not only PC-binding IgA and T15 Id+MP, but also by numerous PC-binding hybridoma proteins (HP) and the IgA fraction of normal anti-PC antibodies of BALB/c mice and presumably other strains . . . . The high frequency of C3-24 Id expression in IgA PC-binding MP and HP and in the IgA fraction if normal antibody of BALB/c mice suggest that isotype-restricted Id may not be an unusual occurrence. (emphasis added)
Clearly, based upon the teachings in the art, the influence of a homologous constant region to the three-dimensional conformation of a particular variable region is not predictable. In other words, the teachings of the prior art suggest that the binding ability of a particular antibody may be dependent upon the unique constant region associate therewith.
It is, therefore, not at all clear from the prior art that known recombinant DNA techniques will routinely produce a chimeric animal-human antibody from selected DNA sources that generate functional chimeric antibodies which bind specifically to selected human carcinomas and which reduce the initiation of ANHA side-effects when injected into humans.
Consequently, it is an object of the present invention to fuse genes coding for at least a part of an animal Ig which binds to human carcinomas expressing TAG-72 and genes coding for at least part of a human Ig. It is a further object of the invention to achieve expression of protein which can be secreted and assembled to give a functional chimeric antibody.
It is a still further object to provide an expression vector containing a DNA sequence which encodes antibodies and portions thereof which are directed against TAG-72.
It is also an object of the invention to provide cells transformed with expression vectors containing a DNA sequence which encodes antibodies and portions thereof which are directed against TAG-72.
Finally, it is an object of the present invention to provide novel antibodies for use in in vivo diagnostic assays; in vivo therapy; and radioimmunoguided surgery.
SUMMARY OF THE INVENTION
Surprisingly, the present invention is able to meet many of these above mentioned needs and provides a method for supplying the desired antibodies.
This invention concerns an antibody or antibody fragment comprising a variable region having a heavy chain (VH), said VH being encoded by a DNA sequence effectively homologous to the VHαTAG germline gene (VHαTAG), wherein the variable region binds to TAG-72 at least 25 percent greater than the variable region of B72.3 binds to TAG-72, with the binding affinities of the antibody and B72.3 being measured by the same technique.
This invention also concerns a DNA sequence encoding at least a portion of an antibody heavy chain, said sequence comprising a DNA sequence segment being effectively homologous to the VHαTAG germline gene (VHαTAG), wherein the DNA sequence segment encodes at least a portion of a heavy chain variable region (VH).
The invention includes the aforementioned antibody alone or conjugated to an imaging marker or therapeutic agent. The invention also includes a composition comprising the aforementioned antibody in unconjugated or conjugated form in a pharmaceutically acceptable, non-toxic, sterile carrier.
The invention is directed to a method for in vivo diagnosis of cancer which comprises administering to an animal a pharmaceutically effective amount of the aforementioned composition for the in situ detection of carcinoma lesions.
The invention is also directed to a method for intraoperative therapy which comprises (a) administering to an animal a pharmaceutically effective amount of the aforementioned composition, whereby the tumors are localized, and (b) excision of the localized tumors.
In other aspects, the invention is directed to expression vectors or plasmids capable of effecting the production of such aforementioned antibodies in suitable host cells. It also includes the host cells and cell cultures which result from transformation with these vectors.
The invention is also directed to a method for finding (i.e. identifying) an unknown gene or genes encoding an unknown variable region(s), said unknown variable region having binding specificity for the same antigen as does a known variable region encoded by a known gene. Generally, a detectably labeled, nucleic acid hybridization probe is prepared which comprises at least a portion, preferably about 15 nucleotides (or base pairs) or more, of the (+) and/or (−) strand of the 5′NTR of said known gene. The probe is hybridized to nucleic acid(s) including unknown V-encoding nucleic acid(s), at least partly along their 5′NTR(s), to form probe-polynucleotide hybrid(s). Excess un-hybridized probe is washed away, and the remaining detectably-labeled probe-polynucleotide hybrid(s) are detected and may be isolated and/or further characterized.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 illustrates a basic immunoglobulin structure, with the enzymatic cleavage sites being indicated.
FIG. 2, i.e. FIGS. 2A-2G, illustrates the nucleotide sequences of VHαTAG VH (SEQ ID NO:1), CC46 VH (SEQ ID NO:7), CC49 VH (SEQ ID NO:3), CC83 VH (SEQ ID NO:5), and CC92 VH (SEQ ID NO:9).
FIG. 3, i.e. FIGS. 3A-3E, illustrates the amino acid sequences of VHαTAG VH (SEQ ID NO:2), CC46 VH (SEQ ID NO:8), CC49 VH (SEQ ID NO:4), CC83 VH (SEQ ID NO:6), and CC92 VH (SEQ ID NO:10).
FIG. 4A illustrates the nucleotide sequence (SEQ ID NO:11) and FIG. 4B illustrates the corresponding amino acid sequence (SEQ ID NO:12) of the CC49 VL.
FIG. 5A illustrates the nucleotide sequence (SEQ ID NO:13) and FIG. 5B illustrates the corresponding amino acid sequence (SEQ ID NO:14) of the CC83 VL.
FIG. 6A illustrates the nucleotide sequence (SEQ ID NO:27) and FIG. 6B illustrates the corresponding amino acid sequence (SEQ ID NO:28) of the CC92 VL.
FIG. 7 illustrates the nucleotide sequence of the Hind III-Pst I fragment (SEQ ID NO:15) isolated from the plasmid pGD1.
FIG. 8 illustrates the plasmid map of the pBLUESCRIPT SK(−) (a nucleic acid vector from Stratagene, San Diego, Calif.).
FIG. 9 illustrates the plasmid map of the pRL101.
FIG. 10 illustrates a restriction enzyme map of the CC49 L chain genomic DNA insert in pRL101.
FIG. 11 illustrates the plasmid map of the pRL200.
FIG. 12 illustrates a restriction enzyme map of the CC83 L chain genomic DNA insert in pRL200.
FIG. 13, i.e. FIGS. 13A-13B, illustrates the nucleotide sequence of the Eco RI-Bam HI (SEQ ID NO:16) fragment isolated from the plasmid pNP9.
FIG. 14 illustrates the plasmid map of the pHH49.
FIG. 15 illustrates the plasmid map of the pHS83.
FIG. 16 shows the nucleotide sequence of CC49 VH (SEQ ID NO:25), with the underlined segments showing the sequences derived using oligonucleotide primers on mRNA.
FIG. 17 shows the nucleotide sequence of CC83 VH (SEQ ID NO:26), with the underlined segments showing the sequences derived using oligonucleotide primers on mRNA.
FIG. 18 shows the amino acid sequence of CC49 VH (SEQ ID NO:29), with the underlined segments showing the sequences determined by protein sequencing.
FIG. 19 shows the amino acid sequence of CC83 VH (SEQ ID NO:30), with the underlined segments showing the sequences determined by protein sequencing.
FIG. 20 shows the results of a SDS poly-acrylamide gel, with the results of PNGase F treatment of CC83 antibody.
FIG. 21, i.e. FIGS. 21A-21D, illustrates the restriction enzyme maps of human gamma 1 (21A), gamma 2 (21B), gamma 3 (21C), and gamma 4 (21D).
FIG. 22 illustrates the plasmid map of pSV2gpt/R/B.
FIG. 23 illustrates the plasmid map of pSV2gpt-γ1-7.8.
FIG. 24 illustrates the plasmid map of pSV2gpt-γ1-2.3.
FIG. 25 illustrates the plasmid map of pSV2gpt-γ2.
FIG. 26 illustrates the plasmid map of pSV2gpt-γ3.
FIG. 27 illustrates the plasmid map of pSV2gpt-γ4.
FIG. 28 illustrates the plasmid map of p49γ1-7.8.
FIG. 29 illustrates the plasmid map of p49γ1-2.3.
FIG. 30 illustrates the plasmid map of p49-γ2.
FIG. 31 illustrates the plasmid map of p49-γ3.
FIG. 32 illustrates the plasmid map of p49-γ4.
FIG. 33 illustrates the plasmid map of p83γ1-7.8.
FIG. 34 illustrates the plasmid map of p83γ1-2.3.
FIG. 35 illustrates the plasmid map of p83-γ2.
FIG. 36 illustrates the plasmid map of p83-γ3.
FIG. 37 illustrates the plasmid map of p83-γ4.
FIG. 38 illustrates an SDS polyacrylamide gel showing the variation in size among the CH44-1 heavy (H) and light (L) chains compared to the corresponding chains of CC49.
FIG. 39 illustrates the overall reaction for the engineering of hybrid genes based on the method of Horton et al., Gene 77:61 (1989).
FIGS. 40A, 40B, and 40C show the biodistribution and whole body retention of CH44-1.
FIGS. 41A and 41B show the biodistribution and whole body retention of CH84-1.
FIG. 42, i.e. FIGS. 42A-42B, illustrates the partial nucleotide sequences of heavy chain variable regions of several antibodies derived from VHαTAG (SEQ ID NO:61): AHC46 (SEQ ID NO:62), AHC121 (SEQ ID NO:63), AHC139 (SEQ ID NO:64), AHC160 (SEQ ID NO:65).
FIG. 43 illustrates a technique for removing heavy chain constant region domains by use of splicing by overlap extension.
FIG. 44 illustrates the heavy chain constant region sequence of Ch44-CH3 (SEQ ID NO:72): a constant region of the human γ1 heavy chain with removed CH3 domain.
FIG. 45 illustrates the heavy chain constant region sequence of Ch44-F(ab′)2 (SEQ ID NO:73): a constant region of the human γ1 heavy chain with a removed CH2 and CH3 domains.
FIG. 46 illustrates the heavy chain constant region sequence of Ch44-Fab (SEQ ID NO:74): a constant region of the human γ3 heavy chains with a removed hinge region and CH2 and CH3 domains.
FIG. 47 illustrates the plasmid map of pRL103.
FIG. 48 illustrates the plasmid map of pRL104.
FIG. 49 illustrates the plasmid map of pGD1.
FIG. 50 illustrates the restriction map of the Bam HI fragment of phumCκ.
FIG. 51 illustrates the plasmid map of pRL150.
FIG. 52 illustrates the plasmid map of pRL105.
FIG. 53 illustrates the plasmid map of pRL202.
FIG. 54 illustrates the plasmid map of pRL203.
FIG. 55 illustrates the plasmid map of pRL230.
DETAILED DESCRIPTION
The immunoglobulins of this invention have been developed to address the problems of murine monoclonal antibodies disclosed in the prior art. Each is characterized by having a chimeric structure composed of a heavy chain variable region encoded by DNA derived from the VHαTAG.
Definitions
As used herein, “immunoglobulin” refers to a tetramer or aggregate thereof whether or not specific immunoreactive activity is a property. “Antibodies” refers to such assemblies which have significant known specific immunoreactive activity to an antigen, comprising light and heavy chains, with or without covalent linkage between them; “Non-specific immunoglobulin” (“NSI”) means those immunoglobulins which do not possess known specificity to an antigen.
The basic immunoglobulin structural unit in vertebrate systems is relatively well understood (Edelman, Ann. N.Y. Acad. Sci., 190:5 (1971)). As seen in FIG. 1, the units are composed of two identical light polypeptide chains of molecular weight approximately 23,000 daltons, and two identical heavy chains of molecular weight 53,000-70,000. The four chains are joined by disulfide bonds in a “Y” configuration wherein the light chains bracket the heavy chains starting at the mouth of the “Y” and continuing through the diversity region.
Heavy chains are classified as gamma, mu, alpha, delta, or epsilon, with some subclasses among them. The nature of this chain, as it has a long constant region, determines the “class” of the antibody as IgA, IgD, IgE, IgG, or IgM.
Light chains are classified as either kappa (κ) or lambda (λ). Each heavy chain class may be bound with either a kappa or lambda light chain. In general, the light and heavy chains are covalently bonded to each other, and the “tail” portions of the two heavy chains are bonded to each other by covalent disulfide linkages when the immunoglobulins are generated either by hybridomas or by B cells. However, if non-covalent association of the chains can be effected in the correct geometry, the aggregate of non-disulfide-linked chains will still be capable of reaction with antigen.
The amino acid sequences run from an N-terminus at the forked edges of the Y to the C-terminus at the bottom of each chain. At the N-terminus is a variable region and at the C-terminus is a constant region.
The terms “constant” and “variable” are used functionally. The variable regions of both the light (VL) and heavy (VH) chains determine binding recognition and specificity to the antigen. The constant region domains of light (CL) and heavy (CH) chains confer important biological properties such as antibody chain association, secretion, transplacental mobility, complement binding, and the like.
The variable region is linked in each chain to the constant region by a linkage linking the V gene sequence and the C gene sequence. The linkage occurs at the genomic level, combining nucleotide sequences via recombination sites. The linking sequence is known as a “J” sequence in the light chain gene, which encodes about 12 amino acids, and as a combination of a “D” sequence and a “J” sequence in the heavy chain gene, which together encode approximately 25 amino acids.
“Chimeric antibody” for purposes of this invention refers to an antibody having in the heavy chain a variable region amino acid sequence encoded by a nucleotide sequence derived from a murine germline gene and a constant region amino acid sequence encoded by a nucleotide sequence derived from a human gene.
However, the present invention is not intended to be narrowly limited to merely substituting human C gene sequences encoding immunoglobulin constant regions for murine C gene sequences encoding immunoglobulin constant regions. Thus, the present invention is not limited to whether or not the fusion point is at the variable/constant boundary.
Through various techniques, it is now possible to produce altered chimeric antibodies, composite chimeric antibodies, and fragmented chimeric antibodies encoded by nucleotide sequences disclosed herein.
“Composite” immunoglobulins comprise polypeptide variable regions not hitherto found associated with each other in nature. It is not critical whether any of the above are covalently or non-covalently aggregated, so long as the aggregation is capable of selectively reacting with a particular antigen or antigen family.
“Altered antibodies” means antibodies wherein the amino acid sequences, particularly in the variable region, has been varied. Because of the relevance of recombinant DNA techniques to this invention, one need not be confined to the amino acid sequences of antibodies selected from natural sources; amino acid sequences of the antibodies can be redesigned to obtain desired characteristics. The possible variations are many and range from the changing of just one or a few amino acids to the complete redesign of an antibody variable and/or constant region.
Changes in the variable region will be made in order to improve the antigen binding characteristics. Changes in the constant region will, in general, be made in order to improve the cellular process characteristics, such as complement fixation, interaction with membranes, and other effector functions. Alterations, can be made by standard recombinant techniques and also by oligonucleotide-directed mutagenesis techniques [Dalbadie-McFarland, et al. Proc. Natl. Acad. Sci. (USA) 79:6409 (1982)].
“Fragments” of immunoglobulins include segments of proteolytically-cleaved or recombinantly-prepared portions of an antibody molecule that are capable of selectively reacting with a particular antigen or antigen family. Nonlimiting examples of such proteolytic and/or recombinant fragments include “Fab”, “F(ab′)2”, and “Fab′”, with their proteolytic cleavage sites being shown in FIG. 1; as well as “Fv” fragment. Recombinant techniques for producing Fv fragments are set forth in WO 88/01649, WO 88/06630, WO 88/07085, WO 88/07086, and WO 88/09344. By a “VH” fragment is meant that the variable region has at least a portion of a heavy chain variable region capable of being used as an antigen binding functionality. The preparation and use of a light chain variable region (VL) as an antigen binding functionality is set forth in an article entitled “Development of biologically active peptides based on antibody structure” by Williams et al. is set forth in Proc. Natl. Acad. Sci. (USA) 86:5537-5541 (1989).
In this invention, “animals” is meant to include primates, bovines, porcine, and rodents, etc.
“Expression vector” is given a functional definition, and any DNA sequence which is capable of effecting expression of a specified DNA code in a suitable host is included in this term. As at present, such vectors are frequently in the form of plasmids, thus “plasmid” and “expression vector” are often used interchangeably. However, the invention is intended to include such other forms of expression vectors which serve equivalent functions and which may, from time to time, become known in the art.
“Transformation” is meant the introduction of DNA into a recipient host cell that changes the genotype and consequently results in a change in the recipient cell.
“Host cells” refers to cells which have been recombinantly transformed with vectors constructed using recombinant DNA techniques. As defined herein, the antibody or modification thereof produced by a host cell is by virtue of this transformation.
In descriptions of processes for isolation of antibodies from recombinant hosts, the terms “cell” and “cell culture” are used interchangeably to denote the source of antibody unless it is clearly specified otherwise. In other words, recovery of antibody from the “cells” may mean either from spun down whole cells, or from the cell culture containing both the medium and the suspended cells.
Abbreviations
Nucleic acids, amino acids, peptides, protective groups, active groups and so on, when abbreviated, are abbreviated according to the IUPACIUB (Commission on Biological Nomenclature) or the practice in the fields concerned. The following are examples.
Reagents
EDTA: Ethylenediaminetetraacetic acid
SDS: Sodium dodecylsulfate
Nucleic Acids
RNA: Ribonucleic acid DNA: Deoxyribonucleic acid
Nitrogenous Bases
Purines Pyrimidines
A: Adenine T: Thymine
G: Guanine C: Cytosine
U: Uracil
Both DNA and RNA contain long chains of phosphoric acid, a sugar, and nitrogenous bases. DNA is a double stranded helix, wherein the sugar is 2-deoxyribose, whereas RNA is single stranded, wherein the sugar is D-ribose. The four nitrogenous bases which characterize DNA nucleotides are linked in complementary pairs by hydrogen bonds to form the double helix of DNA: adenine is linked to thymine and guanine is linked to cytosine. In RNA, uracil is substituted for thymine in the listed DNA pairs.
Amino Acids
Gly: glycine Phe: phenylalanine
Ala: alanine Tyr: tyrosine
Val: valine Thr: threonine
Leu: leucine Cys: cysteine
Ile: isoleucine Met: methionine
Ser: serine Glu: glutamic acid
Asp: aspartic acid Trp: tryptophan
Lys: lysine Pro: proline
Arg: arginine Asn: asparagine
His: histidine Gln: glutamine
Variable Region
The DNA encoding the heavy chain consists of a VH gene sequence, a DH gene sequence, and a JH gene sequence. The DNA encoding the light chain consists of a VL gene sequence, and a JL gene sequence.
VH Gene Sequence
The present invention is directed to selected chimeric antibodies having the VH region encoded by a DNA sequence derived from a germline gene that is specifically reactive against TAG-72 (VHαTAG), the sequence of which is set forth in FIG. 2 (SEQ ID NO:1). The chimeric antibodies are selected on the basis of their ability to bind TAG-72, namely wherein the variable region binds to TAG-72 at least 25 percent greater than the variable region of B72.3 binds to TAG-72. Generally, the binding affinities of the chimeric antibody and B72.3 are measured by the same technique. Exemplary techniques for measuring antibody binding affinity are set forth in the following references: Scatchard, Annals of the N.Y. Acad. of Sciences 51:660 (1949); Steward and Petty, Immunology, 23:881 (1972); Muraro et al., Cancer Research, 48:4588 (1988); and Heyman, J. of Immunol. Methods, 68:193-204 (1984).
A skilled artisan will appreciate that, as a result of the inventors' discovery, namely the nucleotide sequence of (and amino acid sequences encoded by) the VHαTAG, the present invention is intended to include effectively homologous nucleotide sequences and corresponding amino acid sequences. “Effectively homologous” refers to identity or near identify of nucleotide or amino acid sequences. Thus, in this disclosure it will be understood that minor sequence variation can exist within homologous sequences and that any sequences exhibiting at least 80 percent homology are deemed equivalent.
Homology is expressed as the fraction or percentage of matching bases (or amino acids) after two sequences (possibly of unequal length) have been aligned. The term alignment is used in the sense defined by Sankoff and Kruskal in Chapter One of their book, The Time Warps, String Edits, and Macromolecules: The Theory and Practice of Sequence Comparison, Addison-Wesley, Reading, Mass., USA (1983). Roughly, two sequences are aligned by maximizing the number of matching bases (or amino acids) between the two sequences with the insertion of a minimal number of “blank” or “null” bases into either sequence to bring about the maximum overlap.
As is understood in the art, nucleotide mismatches can occur at the third or wobble base in the codon without causing amino acid substitutions in the final polypeptide sequence. Also, minor nucleotide modifications (e.g., substitutions, insertions or deletions) in certain regions of the gene sequence can be tolerated and considered insignificant whenever such modifications result in changes in amino acid sequence that do not alter functionality of the final product. It has been shown that chemically synthesized copies of whole, or parts of, gene sequences can replace the corresponding regions in the natural gene without loss of gene function.
Homologs of specific DNA sequences may be identified by those skilled in the art using the test of cross-hybridization of nucleic acids under conditions of stringency as is well understood in the art [as described in Nucleic Acid Hybridization, Hames and Higgens (eds.), IRL Press, Oxford, UK (1985)]. Given two sequences, algorithms are available for computing their homology: e.g. Needleham and Wunsch, J. Mol. Biol., 48:443-453 (1970); and Sankoff and Kruskal (1983), supra. Also, commercial services are available for performing such comparisons, e.g. Intelligenetics, Inc. (Palo Alto, Calif., USA).
DH and JH Gene Sequences
The DH and JH gene segments exist in various types, although the type of D or J gene segment selected is not critical to the invention. That is the DH and JH may be derived from any animal. Preferred animals include mice and humans. Obviously, human DH and/or JH gene segments are particularly preferred, but the invention is not so limited if a D or J gene segment from another animal species provides an important property, i.e., increased binding to TAG-72.
Exemplary murine DH and JH sequences are set forth in Kurosawa and Tonegawa, J. Exp. Med., 155:201 (1982); and Gough and Bernard, Proc. Natl. Acad. Sci. (USA), 78:509 (1981).
Exemplary human DH and JH sequences are set forth in Siebenlist et al. in Nature, 294:631 (1981); and exemplary human JH sequences are set forth in Ravetch et al., Cell, 27:583 (1981).
VL and JL Gene Sequences
Generally, any VL and JL gene sequences may be employed that encodes a portion of a VL which is complementary to the VH encoded by a nucleotide sequence effectively homologous to VHαTAG. By “complementary” means a VL that binds to the VH and which yields an antibody variable region having a binding affinity of at least 25 percent more than B72.3, as measured by any standard technique for measuring binding affinity constants.
The type of VL and JL gene segment selected is not critical to the invention. That is the VL and JL may be derived from any animal. Preferred animals include mice and humans. Obviously, human VL and/or JL gene segments are particularly preferred, but the invention is not so limited if a JL gene segment from another species provides an important property, i.e., increased binding to TAG-72.
Murine JL sequences are set forth in Max, et al., J. Biol. Chem., 256:5116-5120 (1981). Human JL sequences are set forth in Heiter et al., The Journal of Biological Chemistry, 357(2):1516-1522 (1982).
Derivation of Variable Regions
Given the above teachings, it now becomes possible to derive numerous specific embodiments of antibody variable regions within the scope of the present invention, i.e., having effectively homologous VH sequences to VHαTAG and binding to TAG-72 at least 25 percent greater than the variable region of B72.3 binds to TAG-72, with the binding affinities of the antibody and B72.3 being measured by the same technique. Several nonlimiting techniques are set forth below.
Naturally-Produced Variable Regions
In response to an immunogen, TAG-72, an immunized animal will expand selected antibody producing B cells. The variable region of antibodies produced by the B cells will be encoded by rearranged germline heavy and light chain DNA. For example, the rearranged germline heavy chain will include the V, D, and J gene segments including the leader sequence, as well as any introns which may be subsequently removed. The light chain coding DNA will include the V and J gene segments including the leader sequence, as well as any introns which may be subsequently removed.
Variability may result from somatic mutations occurring in a B cell during productive rearrangement of the VHαTAG. These somatic mutations are nucleotide changes that may or may not result in an amino acid change that alters the activity toward TAG-72 of the productively rearranged VH.
Screening Techniques
Monoclonal or polyclonal antibodies may be screened to determine which of said antibodies selectively bind to TAG-72. Such screening may be accomplished by any of a number of well-known procedures, such as solid-phase radioimmunoassay, enzyme-linked immunosorbent assays, rosetting assays, blocking assays, and the like. The above-described procedures are well-known in the art.
The nucleotide sequences of encoding variable regions of antibodies produced from the productive rearrangement of the VHαTAG have now been obtained. In addition to the nucleotide sequence of VHαTAG, FIGS. 2A-2G also show the nucleotide sequences encoding the heavy chain variable regions of CC46, CC49, CC83 and CC92 antibodies, respectively (SEQ ID NO:7, SEQ ID NO:3, SEQ ID NO:5, and SEQ ID NO:9, respectively). FIGS. 3A-3E (SEQ ID NO:2, SEQ ID NO:8, SEQ ID NO:4, SEQ ID NO:6 and SEQ ID NO:10, respectively) show the amino acid sequences of VHαTAG VH, CC46 VH, CC49 VH, CC83 VH, and CC92 VH, corresponding to the nucleotide sequences set forth in FIGS. 2A-2G.
The relative similarity of the DNA encoding the CC46 VH, CC49 VH, CC83 VH, and CC92 VH regions, particularly in the 5′ flanking segment, proves that those DNA sequences are derived from VHαTAG. Somatic mutations occurring during productive rearrangement of the VH region gene to be expressed in a B cell give rise to some nucleotide changes that may or may not result in a homologous amino acid change between two productively rearranged VHαTAG producing hybridomas.
The nucleotide sequences and corresponding amino acid sequences of CC49 VL are shown in FIGS. 4A and 4B, respectively (SEQ ID NO:11 and SEQ ID NO:12, respectively). The nucleotide sequences and corresponding amino acid sequences of CC83 VL are shown in FIGS. 5A and 5B, respectively (SEQ ID NO:13 and SEQ ID NO:14, respectively). The nucleotide sequences and corresponding amino acid sequences of CC92 VL are shown in FIGS. 6A and 6B, respectively.
Probe Techniques
Other antibodies encoded by DNA derived from VHαTAG may be derived by using VHαTAG as a hybridization probe. Generally, a probe made from the DNA or RNA of the VHαTAG or rearranged genes containing the recombined VHαTAG could be used to find homologous genes in unknown hybridomas to those skilled in the art. This essentially provides a prototype sequence for a starting point in discovering antibody variable region genes derived from the same germline gene, i.e., a “subset”. Such homologous antibodies will have a DNA sequence whose mRNA hybridizes with the probe of all or a part of the VHαTAG germline gene and its flanking regions. By “flanking regions” is meant to include those DNA sequences from the 5′ end of the VHαTAG to the 3′ end of the upstream gene, and from 3′ end of the VHαTAG to the 5′ end of the downstream gene.
The subject method may be used for the detection of specific sequences of nucleic acids from a wide variety of sources. The target sequence can be any whole or portion of genomic material, or nucleic acid gene product such as messenger RNA. Any source of nucleic acid, in purified or nonpurified form, can be utilized provided it contains or is suspected of containing the 5′ nontranslated region of interest. The target nucleic acid can be single or double stranded.
The probes may comprise a probe region, that is a nucleotide sequence which is complementary to a target sequence; and a non-probe region, that is, a nucleotide sequence which is not complementary to the target sequence. The probe need not be single continuous polynucleotide segment, but may be comprised of two or more individual segments. Moreover, a single probe sequence may be interrupted by noncomplementary sequences. It will be understood that the probe may refer to more than one polynucleotide, particularly in the case where there is some ambiguity in the information regarding the 5′ nontranslated region. Probes may be single stranded or double stranded DNA or RNA, provided that, where both the target nucleic acid and the probe nucleotide sequence are single-stranded, one is a (+) strand and the other is a (−) strand.
There are a number of ways in which a probe sequence can be selected. It is only necessary that a number of bases in the 5′ nontranslated region be known in sufficient detail that a probe can be produced so as to identify such a unique sequence, i.e., the effective sequence to distinguish subset members. The greater the knowledge of the bases of the 5′ nontranslated region of the sequence, the greater can be the specificity of the probe for the (5′NTR of the) target nucleic acid sequence, and thus the greater the efficiency of the process. If the probe sequence is produced based on the nucleotide sequence of the 5′NTR of a heavy chain variable region gene, the target nucleic acid will likewise be a heavy chain variable region gene; or if light chain variable region gene 5′NTR for the probe, then light chain variable region gene for the target.
The probe sequences complementary to the target can be larger or small, so long as sufficiently stable double stranded hybrids form between the probe the target sequence. The polynucleotide probe will have enough bases to provide specificity for the target sequence. Generally, the polynucleotide probe will have at least about 15 bases, more usually at least about 20 to about 50 bases, and may have up to about 10,000 bases or more.
The target sequence is likely to be found in the presence of a vast abundance of polynucleotides of different sequence. It is therefore necessary that its method of detection be highly specific. Further, since little DNA of the characteristic sequence may be available for analysis, a method of high sensitivity is also desirable. Consequently, the probe is preferably selected to be capable of hybridizing with as long a piece of the target sequence as possible. Moreover, the greater percentage of bases in the target sequence for which the probe is specific, the greater will be the specificity of the probe for members of a given subset.
The probe sequence need not reflect the exact sequence of the 5′ nontranslated region since hybridization may occur in the presence of mismatched pairs. In fact, there may be unhybridized regions of the target (without complementary regions present on the probe) extending from the hybrid or within the hybridized regions of the two molecules. Such unhybridized regions of DNA may affect (generally reduce) the efficiency of the process.
The complementary probe sequence can be composed of RNA or DNA regardless of whether the sample sequence of interest is composed of either DNA or RNA. Thus, hybrids resulting from hybridization between the probe and the sample sequence may be DNA:RNA, DNA:DNA, or RNA:RNA duplexes.
The nucleic acids for use as a probe may be obtained from a variety of sources known to those of ordinary skill in the art. Polynucleotides used in preparing the probe of the invention can be prepared by known techniques. These include biological and synthetic techniques. The probe may be obtained from the “isolation” of a polynucleotide sequence from natural sources or from the chemical manufacture of a polynucleotide sequence.
It is necessary for the probes to be detectable after hybridization with the target sequence. This may be achieved by any known labeling technique. A skilled person will be aware of the techniques required for the introduction of these and other known labels and for the detection of such labels.
Generally, the specimens screened will be animal (e.g., human and mouse) tissues or body fluids. More preferably, the specimens will be tissue expected to have a relatively high concentration of lymphocytes sensitized to an antigen of interest (e.g., primary and secondary lymph organs, white blood cells in the peripheral blood, neoplastic tissue, and hybridomas).
In one aspect of this embodiment, the probe may be used to merely screen target sequences isolated from selected tissues. A preferred tissue is hybridoma cells, because individual cells may be easily isolated by limiting dilution techniques. In some instances, it may however be possible to isolate and stimulate spleen or peripheral blood cells in vitro to generate an antibody (see, for example, U.S. Pat. No. 4,444,887).
The screening is accomplished by contacting the sample with an amount of a reagent sufficient to lyse the cells and to expose and separate the strands of the nucleic acid(s). The probe is contacted with the lysed cells under suitable conditions to permit hybridization of only substantially complementary molecules to remain hybridized and causing imperfectly hybridized molecules to separate. Conditions that influence the formation of polynucleotide hybrids are well known and described in detail in Sambrook et al. (1989), Molecular Cloning: A Laboratory Manual, (2nd ed.), supra; and Crosa et al., J. Bact, 115:904-911 (1973), the teachings of which are hereby incorporated by reference.
The probe itself can be detected by a variety of techniques including spectroscopic, photochemical, immunochemical, radiochemical, biochemical or chemical means. These protocols may include, for example, radioimmunoassay (RIA), immunoradiometric assay (IRMA), sandwich IRMA, fluoroimmunoassay (FIA), chemiluminescent assays, bioluminescent assays and enzyme linked immunosorbent assays (ELISA).
In another embodiment, it may be possible to probe polynucleotides from a limited number of cells expressing a desired antibody following polymerase chain reaction (PCR) amplification of target sequences. PCR in essence involves exponentially amplifying DNA in vitro using sequence specified oligonulcleotides. As a consequence, the fusion step in B cell hybridoma production may be omitted entirely, since PCR will increase the target pool by alleviating the problem of low fusion frequencies often observed in hybridoma fusions. PCR for DNA or RNA (including mRNA) is described in Mullis and Faloona, Meth. Enz., 155:335-350 (1987); in U.S. Pat. No. 4,683,202 to Mullis (PCR for whole and partial nucleic acid amplification and for oligonucleotide-directed mutagenesis); and in U.S. Pat. No. 4,683,195 to Mullis et al. (PCR for nucleic acid detection, for overlap-extension, and for vector-insertion.
As is well-known by those skilled in the art, if the probe specifically hybridizes with the (−) or anti-sense strand of the target gene's 5′NTR, then only one additional PCR-priming oligonucleotide (“PCR primer”) need be added and this primer will be designed to specifically hybridize with the (+) or sense strand of the target gene and upon a region thereof that is located 3′ to said 5′NTR. If the probe specifically hybridizes only with the (+) or sense strand of the target gene's 5′NTR, then at least two PCR primers would need to be added, one as described above, and a further one binding upon the (−) or anti-sense strand of said 5′NTR.
Rationally Synthesized Variable Regions
Yet a further approach is the rational synthesis of altered variable regions of the antibodies disclosed herein, as well as antibodies discovered via probing. Such an approach has several potential advantages. Namely, a researcher would not have to screen immunized host animals attempting first to cull those antibodies which bind to TAG-72 and next to cull those antibodies which specifically have VH regions encoded by DNA derived from VHαTAG.
Mutagenic Techniques
The VH and/or VL gene segments may be altered by mutagenesis. Exemplary techniques include the addition, deletion, or nonconservative substitution of a limited number of various nucleotides or the conservative substitution of many nucleotides, provided that the proper reading frame is maintained.
Substitutions, deletions, insertions or any subcombination may be combined to arrive at a final construct. Since there are 64 possible codon sequences but only twenty known amino acids, the genetic code is degenerate in the sense that different codons may yield the same amino acid. However, the code is precise for each amino acid; thus there is at least one codon for each amino acid, i.e., each codon yields a single amino acid and no other. It will be apparent that during translation, the proper reading frame must be maintained in order to obtain the proper amino acid sequence in the polypeptide ultimately produced.
Techniques for additions at predetermined amino acid sites having a known sequence are well known. Exemplary techniques include oligonucleotide-mediated, site-directed mutagenesis and polymerase chain reaction.
Techniques for deletions at predetermined amino acid sites having a known sequence are well known. Exemplary techniques include oligonucleotide-mediated site-directed mutagenesis and the polymerase chain reaction.
Techniques for substitutions at predetermined amino acid sites having a known sequence are well known. Exemplary techniques include site-directed mutagenesis, and the polymerase chain reaction technique.
Oligonucleotide site-directed mutagenesis in essence involves hybridizing an oligonucleotide coding for a desired mutation with a single strand of DNA containing the region to be mutated and using the single strand as a template for extension of the oligonucleotide to produce a strand containing the mutation. This technique, in various forms, is described by Zoller and Smith, Nuc. Acids Res., 10:6487-6500 (1982); Norris et al., Nuc. Acids Res., 11:5103-5112 (1983); Zoller and Smith DNA, 3:479-488 (1984); Kramer et al., Nuc. Acids Res., 10:6475-6485 (1982).
PCR may be employed to use sequence specified oligonucleotides to incorporate sequence alterations, if desired. Examples of mutagenesis using PCR are described in Higuchi et al., Nucl. Acids Res., 16:7351-7367 (1988); Ho et al., Gene, 77:51-59 (1989), and Horton et al., Gene, 77:61 (1989).
Recombinant Techniques
The antibodies may be constructed by recombinant techniques. In other words, because the inventors have provided the nucleotide sequences of various VH- and VL-encoding regions, a skilled artisan could in vitro produce a complete gene coding for the heavy and light chain variable regions.
The constructed gene may be engineered in which selected DH and JH gene segments are in functional combination with a selected VH gene segment, i.e., the VHαTAG segment, or the VH gene segment of CC49 or CC83.
For example, the constructed heavy chain coding DNA will include DH and JH gene sequences which are contiguous with the 3′ end of the germline VHαTAG gene segment, thereby completing the CDR3 and framework (FR4) of the VH domain. A leader sequence may be present but may be subsequently removed.
Depending upon the light chain employed, it may also be necessary to provide a constructed light chain coding DNA. Such a DNA gene will comprise a VL gene segment in functional combination, e.g., contiguous with a JL gene segment, including the leader sequence which may be subsequently removed. The JL gene segment will vary depending upon whether the light chain is of the lambda or kappa system. The J region sequence is contiguous with the end of the VL exon to complete FR 4 of the VL domain. Such a construction may be carried out by the techniques used to construct the VH gene.
The constructed gene may be engineered by conventional recombinant techniques, for example, to provide a gene insert in a plasmid capable of expression. Thereafter, the plasmids may be expressed in host cells. Exemplary recombinant biological techniques are set forth below.
In providing a fragment encoding either the light chain or heavy chain variable region, it will usually be desirable to include all or a portion of the intron downstream from the J region, particularly where the variable region is derived from the host in which the fused gene is to be expressed. Where the intron is retained, it will be necessary that there be functional splice acceptor and donor sequences at the intron termini. The intron between the J and the constant region of the fused gene may be primarily the intron sequence associated with (1) the constant region, (2) the J domain, or (3) portions of each. The last may be a matter of convenience where there is a convenient restriction site in the introns from the two sources. It may be necessary to provide adapters to join the intron to the constant region. In some instances, all or a portion of the intron may be modified by deletion, nucleotide substitution(s) or insertion, to enhance ease of manipulation, expression, or the like. Preferably, a sufficient amount of the intron should be present to contain an enhancer that is functionally active with the naturally-occurring promoter.
Alternatively, it may be desirable to have the fused gene free of the intron between the J gene and C gene. Thus, the 3′ terminus of the J gene will be adjacent to the 5′ terminus of the C gene. One can use an exonuclease and, by employing varying periods of digestion, one can provide for varying 3′-termini, which can then be used for linking to the constant region and selection made for a functional product in a variety of ways; or by splicing with overlap extension using polymerase chain reaction technology, see Horton et al. (1989), supra. In this case, an artificial promoter, which does not need to be functionally active with an enhancer, will generally be utilized
In one preferred embodiment, the genes encoding the VH and VL regions may be altered by replacing at least parts of the complementarity determining regions (CDRs) in the light or heavy chain variable domains of the antibody with analogous parts of CDRs from an antibody of different specificity. An exemplary technique for replacing the CDRs is taught in European Published Patent Application 0 239 400, by Gregory Winter; and in PCT application WO 88/09344.
The inventors have disclosed the nucleotide sequences corresponding to the VH amino acid sequences of the VHαTAG, CC46, CC49, CC83 and CC92, as well as of the CC49, CC83 and CC92 VL gene segments. Consequently, it is envisaged that the CDRs from the antibodies of the present invention can be grafted onto the framework regions of a human antibody.
Generally, the CDR regions from a human VH or VL domain may be replaced by CDRs from the VH or VL regions of antibodies of the present invention. Exemplary human antibodies from which the framework portions may be used include human plasmacytoma NEWM, [Jones et al., Nature, 321:522-525 (1986)], publicly available from Dr. Greg Winter; and various other human VH and VL genes available from Dr. Terrence Rabbitts, both researchers being from the Medical Research Council, 20 Park Crescent, London, W1N 4AL.
The determination as to what constitutes a CDR and what constitutes a framework region may be made on the basis of the amino-acid sequences of a selected Ig as indicated in Kabat et al., Sequences of Proteins of Immunological Interest, Fourth Edition (1987), U.S. Dept. of Health and Human Services, NIH.
The four framework regions largely adopt a β-sheet conformation and the CDRs form loops connecting, and in some cases forming part of, the β-sheet structure. Moreover, not all of the amino-acid residues in the loop regions are solvent accessible and in one case, amino-acid residues in the framework regions are involved in antigen binding (see Amit et al., Science, 233:747-753, (1986)). It is also known that the variable regions of the two parts of an antigen binding site are held in the correct orientation by inter-chain, non-covalent interactions.
Thus, in order to transfer the antigen binding capacity of one variable domain to another, it may not be necessary to replace all of the CDRs with the complete CDRs from the donor variable region. It may be necessary only to transfer those residues which are necessary for the antigen binding site, and this may involve transferring framework region residues as well as CDR residues. Given the explanations set forth in European Published Patent Application 0 239 400, it will be well within the competence of those skilled in the art, either by carrying out routine experimentation or by trial and error testing to obtain a functional altered antibody.
Preferably, the variable domains in both the heavy and light chains are altered by at least partial CDR replacement and, if necessary, by partial framework region replacement and sequence changing. Although the CDRs may be derived from an antibody of the same class or even subclass as the antibody from which the framework regions are derived, it is envisaged that the CDRs will be derived from an antibody of different class and preferably from an antibody from a different species.
Composite Variable Regions
Generally, the V gene encoding the VL is the same V gene which encodes the VL naturally combined with the VH of choice. For example, the V gene which encodes the VL regions of CC49 and CC83 are beneficially used when employing the V gene which encodes the VH of CC49 and CC83, respectively.
Surprisingly, because the VH regions of the antibodies of the present invention are encoded by VH genes derived from VHαTAG, composite antibodies may be beneficially formed. In other words, the VH region of one antibody of the present invention may suitably be combined with the VL region of another antibody of the present invention. Although the amino acid sequences of the CC49 and CC83 heavy chains are superficially close, it would be expected that a change of a few or even one amino acid may drastically affect the binding function of the antibody, i.e., the resultant antibodies are generally presumed to be a non-specific immunoglobulin (NSI), i.e.—lacking in antibody character, (see European Published Patent Application 0 125 023).
Quite surprisingly, it has now been found that an antibody having the requisite VH of this invention, need not be recombined only with a VL from the same naturally occurring animal antibody. For instance, as set forth in the examples, it is possible to produce a chimeric antibody having a heavy chain with a VH from CC83 and a light chain with a VL from CC49, wherein the composite antibody thus formed has a binding specificity 25 percent greater than the binding affinity of B72.3 to TAG-72.
Constant Regions
Heavy Chain (CH) Domain
The CH domains may be of various human isotypes, i.e., IgG (e.g., IgG1, IgG2, IgG3, and IgG4), IgA, IgD, IgM, as well as the various subtypes of the individual groups.
For a discussion of the human γ1, see Ellison et al., Nucl. Acids Res., 10:4071-4079 (1982); Takahashi et al., Cell, 29:671-679 (1982). For a discussion of the human gamma 2 (γ2), see Krawinkel et al., EMBO J., 1:403-407 (1982); Ellison et al., Proc. Nat. Acad. Sci. (USA), 79:1984-1988 (1982); Takahashi et al. (1982), supra. For a discussion of human gamma 3 (γ3), see Krawinkel et al., (1982), supra, and Takahashi et al. (1982), supra. For a discussion of human gamma 4 (γ4), see Ellison et al. (1982), DNA, 1:11-18 (1982), Krawinkel et al. (1982), supra, and Takahashi et al. (1982), supra.
For a discussion of the human mu, see Rabbitts et al., Nucl. Acids Res. 9:4509-4524 (1981).
For a discussion of the human alpha, see Flanagan et al., Cell, 36:681-688 (1984).
For a discussion of the human delta, see White et al., Science, 228:733-737 (1985).
For a discussion of the human epsilon, see Max et al., Cell, 29:691-699 (1982).
Light Chain (CL) Domain
The CL domain may be human kappa (κ) or human lambda (λ).
For a discussion of the human κ, see Heiter et al., Cell, 22:197-207 (1980).
For a discussion of the human λ, see Hollis et al., Nature, 296:321-325 (1982).
The CH and/or CL gene segments may be “altered” by mutagenesis. Exemplary techniques include the addition, deletion, or nonconservative substitution of a limited number of various nucleotides or the conservative substitution of many nucleotides, provided that the proper reading frame is maintained. In addition, entire domains of the protein can be altered, for example, by substituting C H2 for C H3. This substitution is made at the DNA level by inserting, deleting or substituting entire exons of sequence.
Construction of Antibodies
Immunizations
The first technique for producing antibodies, whether monoclonal or polyclonal, having VH regions encoded by DNA derived from VHαTAG is to immunize a host animal with purified TAG-72. Exemplary protocols for immunizing a host animal with TAG-72 are set forth in U.S. Pat. Nos. 4,522,918 and 4,612,282, using a human breast carcinoma extract as the immunogen; and U.S. Pat. No. 7,073,685 (abandoned, continued as U.S. Pat. No. 7,547,336, now U.S. Pat. No. 5,512,443, which is available to the public), using TAG-72 purified with B72.3 as the immunogen.
Thereafter, monoclonal or polyclonal antibodies produced from the immunization protocol are screened to determine which of said antibodies selectively bind to TAG-72. Such screening may be accomplished by any of a number of well-known procedures, such as solid-phase radioimmunoassay, enzyme-linked immunosorbent assays, resetting assays, blocking assays, and the like. The above-described procedures are well known in the art.
Synthesis of Amino Acid Sequences
Immunoglobulins of the present invention can be synthesized from their constituent amino acids. Suitable techniques are the Merrifield solid phase method, as described in J. Amer. Chem. Soc., 85:2149-2154 (1963). This solid phase method for synthesizing sequences of amino acids is also described on pages 1-4 of a book by Stewart and Young, Solid Phase Peptide Synthesis (W. H. Freemen and Co., San Francisco, 1969).
Construction of DNA
DNA Encoding the VH and VL
The DNA encoding the antibody heavy and light chains may be obtained from a variety of sources known to those of ordinary skill in the art, for example, genomic DNA, cDNA, synthetic DNA, or a combination thereof.
Cells coding for the desired sequence may be isolated, and genomic DNA fragmented by one or more restriction enzymes. The genomic DNA may or may not include naturally-occurring introns. The resulting fragments may then be cloned and screened using a heavy chain J region (JH) probe for the presence of the DNA sequence coding for the polypeptide sequence of interest. DNA fragments isolated by preparative agarose gel electrophoresis are ligated. Recombinant plaques of the libraries are screened with a mouse JH probe.
The DNA may also be obtained from a cDNA library. Messenger RNA coding for heavy or light chain is isolated from a suitable source, either mature B cells or a hybridoma culture, employing standard techniques of RNA isolation, and the use of oligo-dT cellulose chromatography to segregate the poly-A mRNA. The poly-A mRNA may, further, be fractionated to obtain sequences of sufficient size to code for the amino acid sequences in the light or heavy chain of the desired antibody as necessary.
A cDNA library is then prepared from the mixture of mRNA using a suitable primer, preferably a nucleic acid sequence which is characteristic of the desired cDNA. Such a primer may be synthesized based on the amino acid sequence of the antibody. In the alternative cDNA from unfractionated poly-A mRNA from a cell line producing the desired antibody or poly-dT may also be used. The resulting cDNA is optionally size fractionated on polyacrylamide gel and then extended with, for example, dC residues for annealing with pBR322 or other suitable cloning vector which has been cleaved by a suitable restriction enzyme, such as Pst I, and extended with dG residues. Alternative means of forming cloning vectors containing the cDNA using other tails and other cloning vector remainder may, of course, also be used but the foregoing is a standard and preferable choice. A suitable host cell strain, typically Escherichia coli (E. coli), is transformed with the annealed cloning vectors, and the successful transformants identified by means of, for example, ampicillin or tetracycline resistance or other phenotypic characteristics residing on the cloning vector plasmid.
Successful transformants are picked and transferred to microtiter dishes or other support for further growth and preservation. Nitrocellulose filter imprints of these growing cultures are then probed with suitable nucleotide sequences containing bases known to be complementary to desired sequences in the cDNA. Several types of probe may be used, preferably synthetic single stranded DNA sequences labeled by kinasing with γ-32P ATP. The cells fixed to the nitrocellulose filter are lysed, the DNA denatured, and then fixed before reaction with kinased probe. Clones which successfully hybridize are detected by contact with a photoplate, then plasmids from the growing colonies isolated and sequenced by means known in the art to verify that the desired portions of the gene are present.
The desired gene fragments are excised and tailored to assure appropriate reading frame with the control segments when inserted into suitable expression vectors. Typically, nucleotides are added to the 5′ end to include a start signal and a suitably positioned restriction endonuclease site.
The DNA also may be synthetically synthesized, for example, using an APPLIED BIOSYSTEMS Model 380A DNA Synthesizer (from Perkin-Elmer Corp., Foster City, Calif.), and constructed by standard techniques.
Finally, an exemplary technique for utilizing combination of the above techniques is by splicing with overlap extension using polymerase chain reaction technology, see Horton et al. (1989), supra. Generally, a synthetically synthesized primer, having a so-called “wagging tail”, may be inserted with a selected sequence, for example genomic DNA. Thereafter, the sequences are amplified and spliced together.
DNA Encoding the CH and CL
The DNA fragment encoding the amino acid sequence of the human constant region may be obtained by screening the chromosomal DNA of cells producing human immunoglobulin.
Vectors
The desired DNA fragment may be positioned in a biologically functional expression vehicle which may contain appropriate control sequences not present in the selected DNA fragment. By “biologically functional” is meant that the expression vehicle provides for replication and/or expression in an appropriate host, either by maintenance as an extrachromosomal element or by integration into the host genome. A large number of vectors are available or can be readily prepared, and are well known to skilled artisans.
A number of plasmids, such as those described in European Published Patent Applications 0036776, 0048970 and 0051873, have been described which already contain a promoter in reading frame with the gene and compatible with the proposed host cell.
The vectors and methods disclosed herein are suitable for use over a wide range of microorganisms, either prokaryotic and eukaryotic, which are susceptible to transformation. The plasmid will be capable of replicating in the microorganism, particularly a bacterium.
In general, plasmid vectors containing the appropriate promoters, which can be used by the microbial organism for expression of its own protein, also contain control sequences, ribosome binding sites, and transcription termination sites. Generally, the replicon and control sequences which are derived from species compatible with the host cell are used in connection with these hosts.
Smaller or larger SV40 fragments may also be used, provided there is included the approximately 250 base pair (bp) sequence extending from the Hind III site toward the Pvu II site located in the viral origin of replication. Further, it is also possible, and often desirable, to utilize promoter or control sequences normally associated with the desired gene sequence, provided such control sequences are compatible with the host cell systems.
Finally, the plasmid should desirably have a gene, a marker gene, that is capable of providing a phenotypical property which allows for selection of host cells containing the expression vector. Particularly useful is a gene that provides for survival selection. Survival selection can be achieved by providing resistance to a growth inhibiting substance or providing a growth factor capability to a bacterium deficient in such capability.
In general, prokaryotes are preferred. For example, pBR322 a plasmid derived from an E. coli species [Bolivar et al., Gene, 2:95 (1977)] is particularly useful. pBR322 contains genes for ampicillin and tetracycline resistance and thus provides an easy means for identifying transformed cells.
While these prokaryotes are the most commonly used, other microbial strains which may be used include E. coli strains such as E. coli B, E. coli K12 strain 294 (ATCC No. 31446) and E. coli X1776 (ATCC No. 31537), E. coli W3110 (F, γ, prototrophic, ATCC No. 27325), bacilli such as Bacillus subtilus, and other enterobacteriaceae such as Salmonella typhimurium or Serratia marcesans, and various Pseudomonas species may be used. These examples are intended to be illustrative only.
In addition to prokaryates, eukaryotic microbes may also be used. Saccharomyces cerevisiae, or common baker's yeast, is the most commonly used among eukaryotic microorganisms although a number of other strains are commonly available.
For expression in Saccharomyces, the plasmid YRp7, for example, (Stinchcomb et al., Nature, 282:39 (1979); Kingsman et al., Gene, 7:141 (1979); Tschemper et al., Gene, 10:157 (1980)) is commonly used. This plasmid already contains the trpl gene which provides a selection marker for a mutant strain of yeast lacking the ability to grow in tryptophan, for example ATCC No. 44076 or PEP4-1 (Jones, Genetics, 85:12 (1977)). The presence of the trpl lesion as a characteristic of the yeast host cell genome then provides an effective environment for detecting transformation by growth in the absence of tryptophan.
Any plasmid vector containing a yeast-compatible promoter, origin of replication and termination sequence is suitable for use in yeast. Suitable promoting sequences in yeast vectors include the promoters for 3-phosphoglycerate kinase [Hitzeman et al., J. Biol. Chem. 255:2073 (1980)] or other glycolytic enzymes [Hess et al., J. Adv. Enzyme Reg., 7:149 (1968); Holland et al., Biochemistry, 17:4900 (1978)].
For use in mammalian cells, the control functions on the expression vectors are often provided by viral material. For example, commonly used promoters are derived from polyoma, Adenovirus 2, and most frequently Simian Virus 40 (SV40). The early and late promoters of SV40 virus are particularly useful because both are obtained easily from the virus as a fragment which also contains the SV40 viral origin of replication [see Fiers et al., Nature, 273:113 (1978)].
For example, pSV2neo contains a gene for neomycin resistance which is under the control of an SV40 promoter. Thus, pSV2neo provides easy means for identifying cells transformed with genes for both the animal variable region and human constant region.
Preparation of Chimeric DNA
The genes coding for the heavy chain or the light chain will be constructed by joining the 5′-end of a DNA fragment which encodes the constant region to the 3′ end of a DNA fragment which encodes the variable region. The DNA sequence coding for the antibody amino acid sequence may be obtained in association with the promoter and replication site from genomic DNA. To the extent that the host cells recognize the transcriptional regulatory and translational initiation signals associated with the heterologous genes, then the region 5′ and 3′ of the variable region coding sequence may be retained with the variable region coding sequence and employed for transcriptional and translational initiation regulation. The non-coding region 3′ to the constant region may be retained for its transcriptional termination regulatory sequences, such as termination and polyadenylation. In referring to 5′ or 3′ for a double strand, it is intended to mean the direction of transcription, with 5′ being upstream from 3′.
The intron sequence between the variable region for each respective chain may be joined to the corresponding human constant DNA fragment at any convenient restriction site. In providing a fragment encoding the variable region, it will usually be desirable to include a portion of the intron downstream from the J region. Where the intron is retained, it will be necessary that there be functional splice acceptor and donor sequences at the intron termini. The contiguous non-coding region 5′ to the variable region will normally include those sequences involved with initiation of transcription and translation, such as the TATA box, capping sequence, CAAT sequence, and the like. Usually, the 5′-non-coding sequence does not exceed about 1-2 kilo bases (kb).
An enhancer sequence should exist between the J region and the constant region. The enhancer employed may be the enhancer of either (1) the animal V region or (2) the human constant region.
By retaining the 3′-region naturally contiguous to the DNA sequence coding for the constant region, the transcriptional termination signals may be provided for the gene. Where the transcriptional termination signals are not satisfactorily functional in the expression host cell, then a 3′ region functional in the host cell may be substituted. Conveniently, the non-coding 3′ region may be obtained from a non-coding contiguous 3′ region of a constant region from the expression host. The 3′-non-coding region may be joined to the constant region by any of the means described previously for manipulation and ligation of DNA fragments. This region could then be used as a building block in preparing the gene.
Preparation of Expression Vehicles
Construction of suitable expression vehicles containing the desired coding and control sequences may be produced as follows. The termini of the vectors and DNA fragments may then be religated to form the desired expression vehicles. The methods employed are not dependent on the DNA source, or intended host.
DNA fragments coding for the light chain and heavy chain may be inserted into separate expression vehicles, or into the same vector. Preferably, the fused genes encoding the light and heavy chimeric chains are assembled in two different expression vectors which can be used to cotransform a recipient cell, either concurrently or sequentially.
The means for insertion of the DNA fragments containing the chimeric genes into expression vectors includes using restriction endonucleases. “Restriction endonucleases” (or “restriction enzymes”) are hydrolytic enzymes capable of catalyzing site-specific cleavage of DNA molecules. The locus of restriction endonuclease action is determined by the existence of a specific nucleotide sequence. Such a sequence is termed the recognition site for the restriction endonuclease. Many restriction endonucleases from a variety of bacterial species have been isolated and characterized in terms of the nucleotide sequence of their recognition sites. Some restriction endonucleases hydrolyze the phosphodiester bonds on both strands at the same point, producing blunt ends. Others catalyze hydrolysis of bonds separated by a few nucleotides from each other, producing free single stranded regions at each end of the cleaved molecule. Such single stranded ends are self-complementary, hence cohesive, and may be used to rejoin the hydrolyzed DNA. Exemplary restriction enzymes include Aat II, Bam HI, Eco RI, Hind III, Nde I, Spe I, Xba I, Sac I, Bgl II, Pst I, Sal I and Pvu II.
Additionally, the expression vector may have a polylinker inserted therein which has a plurality of unique restriction sites. By digestion of the expression vector with the appropriate restriction enzymes, the polylinker will be cleaved so that at least one DNA fragment containing the gene can be inserted. Where the polylinker allows for distinguishable termini, the DNA fragment can be inserted in a single orientation; were the termini are the same, insertion of the DNA fragment will result in plasmids having two different orientations.
Cleavage is performed by treating the plasmid with a restriction enzyme(s). In general, about 10 μg plasmid or DNA fragments is used with about 10 unit of enzyme in about 100 μl of buffer solution. Endonuclease digestion will normally be carried out at temperatures ranging from about 37° to 65° C., at a pH of about 7 to about 9. (Appropriate buffers and substrate amounts for particular restriction enzymes are specified by the manufacturers.) Time for the reaction will be from about 1 to about 18 hours.
It may be useful to prevent religation of the cleaved vector by pretreatment with alkaline phosphatase. Specific conditions are prescribed by the manufacturer.
After the restriction enzyme digest is complete, protein is removed by extraction with phenol and chloroform. The nucleic acid is recovered from the aqueous fraction (containing about 0.3 M sodium acetate) by precipitation with about 2.5 volumes of ethanol.
Descriptions of methods of cleavage with restriction enzymes may be found in the following articles: Greene et al., Methods in Molecular Biology, Vol. 9, ed. Wickner, R. B., Marcel Dekker, Inc., New York; Mertz and Davis, Proc. Nat. Acad. Sci. (USA), 69:3370 (1972).
Size separation of the cleaved fragments by agarose gel electrophoresis is readily performed to follow the course of the reaction. Once the digestion has gone to the desired degree, the endonuclease may be inactivated by heating above 65° C. for about 10 minutes or organic extraction.
The desired fragment is then purified from the digest. Suitable purification techniques include gel electrophoresis or sucrose gradient centrifugation.
The plasmid vehicle and foreign DNA fragments are then ligated with DNA ligase to recircularize. This process is referred to as annealing and DNA ligation.
An appropriately buffered medium containing the DNA fragments, DNA ligase, and appropriate cofactors is employed. The temperature employed will be between about 25° to about 4° C. When DNA segments hydrogen bond, the DNA ligase will be able to introduce a covalent bond between the two segments. The time employed for the annealing will vary with the temperature employed, the nature of the salt solution, as well as the nature of the sticky ends or cohesive termini. Generally, the time for ligation may be from 5 to 18 hours. See Maniatis T., Molecular Cloning, Cold Spring Harbor, supra.
Host Cells
Thereafter, the expression vehicle constructs may be used to transform an appropriate host cell. Suitable host cells include cells derived from unicellular as well as multicellular organisms.
The chimeric immunoglobulin genes can be expressed in nonlymphoid cells such as bacteria or yeast.
Various unicellular microorganisms can be transformed, such as bacteria. That is, those unicellular organisms which are capable of being grown in cultures or fermentation. Since bacteria are generally the most convenient organisms to work with, bacteria will be hereinafter referred to as exemplary of the other unicellular organisms. Bacteria, which are susceptible to transformation, include members of the Enterobacteriaceae, such as strains of Escherichia coli; Salmonella; Bacillaceae, such as Bacillus subtilis; Pneumococcus; Streptococcus, and Haemophilus influenzae.
When expressed in bacteria, the immunoglobulin heavy chains and light chains become part of inclusion bodies. The chains then must be isolated, purified and then assembled into functional immunoglobulin molecules.
In addition to prokaryates, eukaryotic microbes, such as yeast cultures may also be used. Saccharomyces cerevisiae, or common baker's yeast is the most commonly used among eukaryotic microorganisms, although a number of other strains are commonly available. The presence of the trpl lesion as a characteristic of the yeast host cell genome provides an effective environment for detecting transformation by growth in the absence of tryptophan.
In addition to microorganisms, cultures of cells derived from multicellular organisms may also be used as hosts. In principle, any such cell culture is workable, whether from vertebrate or invertebrate culture, provided that the cell line is one that at least originally produced antibodies. Propagation of vertebrate cells in culture has become a routine procedure in recent years (Tissue Culture, Academic Press, Kruse and Patterson, editors (1973)). Examples of such useful host cell lines are Sp2/0, VERO and HeLa cells, Chinese hamster ovary (CHO) cell lines, and W138, BHK, COS-7 and MDCK cell lines.
The preferred recipient cell line is a plasmacytoma cell such as B lymphocytes or hybridoma cells. Plasmacytoma cells can synthesize, assemble and secrete immunoglobulins encoded by transformed immunoglobulin genes. Further, they possess the mechanism for glycosylation of the immunoglobulin. Sp2/0 is a preferred recipient cell because it is an immunoglobulin-nonproducing plasmacytoma cell. The cell produces only immunoglobulin encoded by the transformed immunoglobulin genes. Plasmacytoma cells can be grown in culture or in the peritoneum of mice where secreted immunoglobulin can be obtained from ascites fluid.
Transformation of Host Cells
Transformation of host cells is accomplished as follows. The expression vehicle is linearized and the DNA is inserted into host cells for production of the antibody. Exemplary methods for inserting the DNA into host cells include electroportion, protoplast fusion, calcium phosphate-precipitation, or other conventional techniques, which use dextran sulfate, and PEG.
If cells without formidable cell wall barriers are used as host cells, transformation may be carried out by the calcium phosphate precipitation method as described by Graham and Van der Eb, Virology, 52:546 (1978).
If prokaryotic cells or cells which contain substantial cell wall constructions are used, the preferred method of transformation is calcium treatment using calcium chloride as described by Cohen et al., Proc. Natl. Acad. Sci. (USA), 69:2110 (1972).
The host cells may be transformed via either cotransformation or targeted transformation.
For cotransformation, the genes coding for the light chain and heavy chain may be used to transform separate cell cultures, either of the same or of differing species; separate plasmids for light and heavy chain may be used to co-transform a single cell culture; or finally, a single expression plasmid containing both genes and capable of expressing the genes for both light and heavy chain may be transformed into a single cell culture.
In the targeted transformation technique, the host cells are transformed with genes encoding for the light chain, and the cells containing the light chain marker are selected. The light chain is found using cytostaining or possibly by detection of the light chain in the supernatant if it has been secreted. Cells selected to have the light chain are transformed with the heavy chain construct, and resultant cells additionally containing the heavy chain marker selected.
It is known that some immortalized lymphoid cell lines, such as plasmacytoma cell lines, in their normal state secrete isolated Ig light or heavy chains. Consequently, if such a cell line is transformed with the vector containing the chimeric heavy or light chain of the present invention, it will not be necessary to transform the cell line or another cell line with the other Ig chain, provided that the normally secreted chain is complementary to the variable domain of the Ig chain encoded by the vector initially used to transform the cell line.
Selection and Expression of Transformed Host Cells
Generally, after transformation of the host cells, the cells may be grown for about 48 hours to allow for expression of marker genes. The cells are then placed in a selective medium, where untransformed cells are killed, leaving only cells transformed with the DNA constructions.
Heavy and light chains or portions thereof, may be produced in isolation from each other and antibodies and fragments thereof may be obtained. Such preparations require the use of techniques to reassemble isolated chains.
The ability of the method of the invention to produce heavy and light chains or portions thereof, in isolation from each other offers the opportunity to obtain unique assemblies of immunoglobulins, Fab regions, and univalent antibodies. It is possible to recombine the heavy and light chains in vitro, disrupted by cleavage of only the interchain disulfides, and to regain antibody activity even without restoration of the inter-chain disulfides [see Edelman et al., Proc. Natl. Acad. Sci. (USA), 50:753 (1963)].
The transformed cells are grown under conditions appropriate to the production of the light chains and/or heavy chains, and assayed for heavy and/or light chain protein synthesis. Exemplary assay techniques include enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA), or fluorescence-activated cell sorter analysis (FACS from Becton, Dickinson & Co., Paramus, N.J.), immunohistochemistry and the like.
The binding affinity of monoclonal antibodies for TAG-72 is determined by means well known in the art (see Heyman et al., J. Immunol. Methods, 68:193-204 (1984) and as described in detail in the Examples provided hereinafter).
Selected positive cultures are subcloned in order to isolate pure transformed colonies. A suitable technique for obtaining subclones is via the limited dilution method taught by McKeara in Monoclonal Antibodies, Plenum Press, N.Y. (1980).
Hybridomas that produce such chimeric antibodies may be grown using known procedures. The transformed cells can secrete large quantities of the light chains and/or heavy chains by culture in vitro, such as by hollow fiber systems, spinner culture, static culture, or in vivo such as ascites production.
The chimeric antibodies may be produced in large quantities by injecting a hybridoma into the peritoneal cavity of pristane-primed mice, and after an appropriate time (about 1-2 weeks), harvesting ascites fluid from the mice, which yields a very high titer of homogeneous monoclonal antibody, and isolating the monoclonal antibodies therefrom by methods well known in the art (see Stramignoni et al., Intl. J. Cancer, 31:543-552 (1983)). The hybridomas are grown up in vivo, as tumors in animals, the serum or ascites fluid of which can provide up to about 50 mg/mL of monoclonal antibodies. Usually, injection (preferably intraperitoneal) of about 106 to 107 histocompatible hybridoma cells into mice or rats will result in tumor formation after a few weeks. The antibodies can then be collected and processed by well-known methods. See generally, Immunological Methods, Vols. I & II, Eds. Lefkovits and Pernis, (1979 & 1981) Academic Press, New York, N.Y.; and Handbook of Experimental Immunology, ed. Weir, (1978) Blackwell Scientific Publications, St. Louis, Mo., USA.
The antibodies can then be stored in various buffer solutions such as phosphate buffered saline (PBS), which gives a generally stable antibody solution for further use.
The chimeric antibodies of the present invention may be fragmented using known protease enzymes, for example papain and pepsin, to obtain highly immunoreactive F(ab′)2, F(ab′) and Fab fragments. In addition, active fragments of Ig formed by proteolysis (approximately 50,000 MW) can be split into their fully reduced heavy chain and light chain components and fairly efficiently reconstructed to give an active antibody [Haber, Proc. Natl. Acad. Sci. (USA), 52:1099 (1964); and Whitney et al., Proc. Natl. Acad. Sci. (USA), 53:524 (1965)]. The reactivity of the resulting F(ab′)2, F(ab′) and Fab fragments are determined by methods as described above for the complete monoclonal antibody molecule.
Uses of the Antibodies
The antibodies of the present invention as well as immunoreactive fragments or recombinants thereof, provide unique benefits for use in a variety of cancer treatments. In addition to the ability to bind specifically to malignant cells and to localize tumors, the antibodies have constant variable regions which do not bind detectably to normal cells such as fibroblasts, endothelial cells, or epithelial cells in the major organs.
Specifically, the antibodies, immunoreactive fragments or recombinants thereof are useful for, but not limited to, the following types of cancer treatment: (1) in vivo diagnostic assays conjugated to an imaging marker, for the in situ detection of carcinoma lesions, as further described below; (2) in vivo therapy, using the antibodies of the present invention alone or conjugated to a therapeutic agent such as a radionuclide, toxin, effector cells, other antibodies or via a complement mechanism, as described below; and (3) radioimmunoguided surgery, as described below.
Moreover, a pharmaceutical composition comprising the antibodies of the present invention in a pharmaceutically acceptable, non-toxic, sterile carrier such as physiological saline, non-toxic buffers and the like, is also now possible.
Injectable compositions of the present invention may be either in suspension or solution form. In solution form the complex (or when desired the separate components) is dissolved in a pharmaceutically acceptable carrier. Such carriers comprise a suitable solvent, preservatives such as benzyl alcohol, if needed, and buffers. Useful solvents include, for example, water, aqueous alcohols, glycols, and phosphonate or carbonate esters. Such aqueous solutions contain no more than 50 percent of the organic solvent by volume.
Injectable suspensions as compositions of the present invention require a liquid suspending medium, with or without adjuvants, as a carrier. The suspending medium can be, for example, aqueous polyvinyl-pyrrolidone, inert oils such as vegetable oils or highly refined mineral oils, or aqueous carboxymethlycellulose. Suitable physiologically acceptable adjuvants, if necessary to keep the complex in suspension, may be chosen from among thickeners such as carboxymethyl cellulose, polyvinylpyrrolidone, gelatin, and the alginates. Many surfactants are also useful as suspending agents, for example, lecithin, alkylphenol, polyethylene oxide adducts, naphthalenesulfonates, alkylbenzenesulfonates, and the polyoxyethylene sorbitan esters. Many substances which effect the hydrophibicity, density, and surface tension of the liquid suspension medium can assist in making injectable suspensions in individual cases. For example, silicone antifoams, sorbitol, and sugars are all useful suspending agents.
Cancer cells are heterogeneous and consequently, a single monospecific chimeric antibody may not be able to recognize all cells expressing different epitopes of a tumor.
Thus, it may be desirable to administer several different chimeric antibodies of the present invention. The sequential use of these various antibodies should substantially reduce the anti-idiotypic responses in human patients when compared to repeated use of a single antibody. For example, CH92, CH88, and CH44 could be sequentially administered to a patient. Since these antibodies have different light chains and, in fact different CDR3 regions anti-idiotypic responses should be minimized.
In Vivo Diagnostic Assays
In vivo diagnostic assays of human tumors or metastasis thereof using the antibodies, immunoreactive fragments or recombinants thereof are conjugated to a marker, administered to a patient, and then the presence of the imaging marker in the patient is detected by exposing the patient to an appropriate detection means.
Administration and detection of the antibody-imaging marker conjugate as well as methods of conjugation of the antibody to the imaging marker are accomplished by methods readily known or readily determined, as described, for example, in Goldenberg et al., New England J. Med., 298:1384-1388 (1978); Goldenberg et al., J. Amer. Med. Assoc., 280:630-635 (1983); Goldenberg et al., Gastroenterol. 84:524-532 (1983); Siccardi et al., Cancer Res., 46:4817-4822 (1986); Epenetos et al., Cancer, 55:984-987 (1985); Philben, et al., Cancer, 57:571-576 (1986); Chiou et al., Cancer Inst. 76:849-855 (1986); Colcher et al., Cancer Res., 43:736-742 (1983); Colcher et al., Laboratory Research Methods in Biology and Medicine Immunodiagnostics, New York, Alan R. Liss, pp. 215-258 (1983); Keenan et al., J. Nucl. Med. 25:1197-1203 (1984); Colcher et al., Cancer Res., 47:1185-1189 (1987); Estaban et al., Intl. J. Cancer, 39:50-59 (1987); Martin et al., Curr. Surg., 41:193-194 (1984); Martin et al., Hybridoma, 5:S97-S108 (1986); Martin et al., Am. J. Surg., 150:672-675 (1985); Meares et al., Anal. Biochem. 142:68-78 (1984); and Krejcarek et al., Biochem. and Biophys. Res. Comm., 77:581-585 (1977).
The dosage will vary depending upon the age and weight of the patient. Generally, the dosage should be effective to visualize or detect tumor sites, distinct from normal tissues. Preferably, a one-time dosage will be between about 0.1 to about 200 mg of an antibody-marker conjugate per patient.
Examples of imaging markers which can be conjugated to the antibody are well known to those skilled in the art and include substances which can be detected by diagnostic imaging using a gamma scanner or hand held gamma probe or positron emission tomography or the like, as described in the references cited above, and substances which can be detected by nuclear magnetic resonance imaging using a nuclear magnetic resonance spectrometer or the like, as described in the references cited above.
Suitable but not limiting examples of substances which can be detected using a gamma scanner or the like include 125I, 131I, 123I, 111In, 105Rh, 153Sm, 67Cu, 67Ga, 166Ho, 177Lu, 186Re, 188Re, and 99mTc. 125I, 123I, 153Sm, and 99mTc are preferred due to their low energy and suitability for long range detection.
An example of a substance which can be detected using a nuclear magnetic resonance spectrometer or the like is gadolinium (Gd).
In Vivo Cancer Treatment
In this method, the antibody-therapeutic agent conjugate can be delivered to the carcinoma site thereby directly exposing the carcinoma tissue to the therapeutic agent.
The antibodies of the present invention, immunoreactive fragments or recombinants thereof may be administered in a pharmaceutically effective amount for the in vivo treatment of human carcinomas or metastasis thereof. A “pharmaceutically effective amount” of the antibody, immunoreactive fragment or recombinant thereof, conjugated or unconjugated to a therapeutic agent, means the amount of said antibodies in the pharmaceutical composition should be Sufficient to achieve effective binding with the antigens against which said antibodies have specific affinity. The pharmaceutical composition may be administered in a single or multiple dosage.
Methods of preparing and administering conjugates of the antibody, immunoreactive fragments or recombinants thereof, and a therapeutic agent are well known to or readily determined by those skilled in the art. Moreover, suitable dosages will depend on the age and weight of the patient and the therapeutic agent employed and are well known to or readily determined by those skilled in the art. Representative protocols are described in the references cited below.
Examples of the antibody-therapeutic agent conjugates which can be used in therapy include the following: (1) antibodies coupled to radionuclides, such as 125I, 131I, 123I, 111In, 105Rh, 153Sm, 67Cu, 67Ga, 166Ho, 177Lu, 186Re, and 188Re, and as described, for example, in Goldenberg et al., Cancer Res., 41:4354-4360 (1981); Carrasquillo et al., Cancer Treat. Rep., 68:317-328 (1984); Zalcberg et al., J. Natl. Cancer Inst., 72:697-704 (1984); Jones et al., Int. J. Cancer, 35:715-720 (1985); Lange et al., Surgery, 98:143-150 (1985); Kaltovich et al., J. Nucl. Med., 27:897 (1986); Order et al., Int. J. Radiother. Oncol. Biol. Phys., 8:259-261 (1982); Courtenay-Luck et al., Lancet, 1:1441-1443 (1984) and Ettinger et al., Cancer Treat. Rep., 66:289-297 (1982); (2) antibodies coupled to drugs or biological response modifiers such as methotrexate, adriamycin (formerly a generic name for doxorubicin hydrochloride, now ADRIAMYCIN from Farmitalia Carlo Erba, Milan, Italy), and lymphokines such as interferon as described, for example, in Chabner et al., Cancer, Principles and Practice of Oncology, Philadelphia, Pa., J.B. Lippincott Co. Vol. 1, pp. 290-328 (1985); Oldham et al., Cancer, Principles and Practice of Oncology, Philadelphia, Pa., J.B. Lippincott Co., Vol. 2, pp. 2223-2245 (1985); Deguchi et al., Cancer Res., 46:3751-3755 (1986); Deguchi et al., Fed. Proc., 44:1684 (1985); Embleton et al., Br. J. Cancer, 49:559-565 (1984) and Pimm et al., Cancer Immunol. Immunother., 12:125-134 (1982); (3) antibodies coupled to toxins, as described, for example, in Uhr et al., Monoclonal Antibodies and Cancer, Academic Press, Inc., pp. 85-98 (1983), Vitetta et al., Biotechnology and Bio. Frontiers, Ed. P. H. Abelson, pp. 73-85 (1984) and Vitetta et al., Sci., 219:644-650 (1983); (4) heterofunctional antibodies, for example, antibodies coupled or combined with another antibody so that the complex binds both to the carcinoma and effector cells, e.g., killer cells such as T cells, as described, for example, in Perez et al., J. Exper. Med., 163:166-178 (1986); and Lau et al. Proc. Natl. Acad. Sci. (USA), 82:8648-8652 (1985); and (5) native, i.e., non-conjugated or non-complexed, antibodies, as described in, for example, Herlyn et al., Proc. Natl. Acad. Sci. (USA), 79:4761-4765 (1982); Schulz et al., Proc. Natl. Acad. Sci. (USA), 80:5407-5411 (1983); Capone et al., Proc. Natl. Acad. Sci. (USA), 80:7328-7332 (1983); Sears et al., Cancer Res., 45:5910-5913 (1985); Nepom et al., Proc. Natl. Acad. Sci. (USA) 81:2864-2867 (1984); Koprowski et al., Proc. Natl. Acad. Sci. (USA), 81:216-219 (1984); and Houghton et al., Proc. Natl. Acad. Sci. (USA), 82:1242-1246 (1985).
The methods for combining the antibody or antibody fragment to a desired therapeutic agent as described above are conventional and well known in the art. For example, the methods given in the references above.
RadioImmunoguided Surgery
Antibodies, immunoreactive fragments or recombinants thereof, are important for radioimmunoguided surgery (RIGS). In RIGS, an intraoperative therapy, tumors are localized and excised. An antibody labeled with an imaging marker is injected into the patient, and bound antibody localized by a hand-held gamma detecting probe (GDP) and excised. An exemplary GDP is NEOPROBE gamma detecting probe, commercially available from Neoprobe Corporation, Columbus, Ohio, USA. See Martin et al., Amer. J. Surg., 156:386-392 (1988); Martin et al., Hybridoma, 5:S97-S108 (1986).
Administration and detection of the antibody-imaging marker conjugate as well as methods of conjugation of the antibody to the imaging marker are accomplished by methods readily known to or readily determined, as described, for example, above.
The dosage will vary depending upon the age and weight of the patient, but generally a one time dosage of about 0.1 to 200 mg of antibody-marker conjugate per patient is sufficient.
EXAMPLES
The following nonlimiting examples are merely for illustration of the construction and expression of chimeric DNA sequences encoding the antibodies of this invention. All temperatures not otherwise indicated are Centigrade. All percents not otherwise indicated are by weight.
Replacement of Mouse Constant Regions
CC antibodies were derived from mice, and are significantly less capable of carrying out the effector functions possessed by the human constant regions.
Consequently, in the following examples, selected antibodies are “humanized” by genetically removing the constant regions of the heavy and light chains and replacing them with their human equivalents.
The mouse light chain constant region genes were replaced with the human kappa (κ) gene, and the mouse heavy chain genes were replaced with each of the four human gamma isotypes (γ1, γ2, γ3, and γ4). Each of these four gamma isotypes possess unique biological properties. For a general review, see Hamilton, (1989) Doc. No. CB0051-289, Calbiochem Corporation.
Preparation of Heavy and Light Chain Variable Region
Isolation of CC49 Light Chain
CC49 hybridoma cells secrete an antibody having an IgG1 isotype heavy chain and a kappa light chain.
Total DNA from CC49 hybridoma cells, BALB/C mouse kidney cells and NSI plasmacytoma cells was isolated according to the procedures taught by Maki et al. and set forth in Cell, 24:353-356 (1981).
Generally, about 10-20 μg of the extracted DNA from each cell line was digested to completion with 80 units of Bam HI, Eco RI, Hind III, Spe I, Xba I, Sac I, Bgl II, and Pst I in 50-100 μL of a reaction mixture containing the appropriate reaction buffer at 37° C. overnight.
Next, the total extracted DNA from each cell line was subjected to the Southern hybridization technique, developed by E. M. Southern, (Southern, J. Mol. Biol., 98:503-517 (1975)). The DNA fragments were fractionated on the basis of their size by means of electrophoresis on a 0.8 percent agarose gel. The double-stranded DNA fragments were modified into single-stranded DNA fragments in an alkali solution; and then a nitrocellulose filter was placed into close contact with the gel to transfer the modified DNA segments onto the filter in the presence of a high salt concentration solution.
Hybridization was carried out using, as the probe, a random primed <32P>-labeled L chain.
More specifically, the probe was a 1.71 kilo base pair (kbp) Hind III-Pst I fragment containing the coding exons for the murine JL regions (J1-J5) and was isolated from the plasmid pGD1. A nucleotide sequence of the probe fragment is provided in FIG. 7 (SEQ ID NO:15). This plasmid is described in Agostaro et al., Can. J. Biochem. Cell Biol., 63: 969-976 (1985). The plasmid was provided by Nobumichi Hozumi and John Roder, Mt. Sinai Research Institute, Toronto, Ontario, Canada.
To radiolabel the probe, alpha<32P> dCTP was obtained from Amersham, Arlington Heights, Ill., and the random priming kit was obtained from Pharmacia, Piscataway, N.J., USA.
The signals in Southern transfers were visualized by autoradiography using KODAK X-OMAT AR film (X-ray photographic film from Eastman Kodak Co., Rochester, N.Y.). No obviously rearranged band was observed. Thus, relative to the standards, no unique band was detected on the autoradiogram for the CC49 DNA digested with Hind III. It could not be ruled out from the Southern data, however, that the rearranged band for the L chain was masked by a band migrating in the CC49 Hind III digested DNA parallel to the band resulting from a Hind III digest of mouse kidney cell DNA (representing the germline DNA). This actually turned out to be the case.
Preparation of Plasmid Containing Mouse VL Genes
LAMBDA-ZAP vector, a lambda-based insertion cloning vector capable of self excision, was purchased from Stratagene Company, La Jolla, Calif., USA. LAMBDA-ZAP vector is described on pages 20-21 of the 1987 Stratagene catalog. The cohesive (cos) ends of LAMBDA-ZAP vector were ligated overnight by following the manufacturer's protocol.
Twenty micrograms of the ligated LAMBDA-ZAP vector were digested with 5 μL (15 units) of Spe I, purchased from New England Biolabs, Inc. The total volume of the digest was 100 μL. After 55 minutes of digestion, another 6 units of Spe I were added. After 70 minutes, the reaction was stopped by phenol extraction and ethanol precipitation carried out as per Stratagene's protocol.
Digestion with Spe I restriction enzyme results in production of “sticky ends” at both termini. These sticky ends were modified with T4 DNA polymerase to create half filled-in Spe I sticky ends, e.g., 5′ACT/3′TCATG. To accomplish the half fill-in reaction, the DNA pellet obtained in the ethanol precipitation above was dissolved in 8 μL of water. To this was added 2 μL of 10 mM dTTP, 2 μL of 10 mM dCTP, 2 μL of Stratagene's 10×ligase buffer, 4 μL of deionized, distilled water, and 2 μL of a Klenow fragment from Bethesda Research Laboratories (BRL). The reaction was carried out at ambient temperatures for 30 minutes. The reaction was stopped by inactivating the DNA polymerase at 65° C. for 10 minutes.
One hundred sixty micrograms of total CC49 hybridoma DNA (containing the mouse light chain promoter and the L and VJ exons) were digested to completion with Hind III. Fragments between about 1 kb to about 20 kb were cut out of 0.8 percent agarose gels. The DNA was purified using a GENECLEAN nucleic acid purification kit (containing a solution of NaI and NaC1 and an aqueous silica suspension), which is commercially available from BIO 101 (La Jolla, Calif., USA).
The total CC49 hybridoma DNA Hind III digested fragments were half-filled similarly to the Spe I fragments of the LAMBDA-ZAP vector with the exception that dATP and dGTP were employed. The half-filled Hind III digested fragments produced 5′AGCTT/3′GAA sticky ends, which are compatible with the Spe I half-filled LAMBDA-ZAP vector fragment above.
After phenol extraction and ethanol precipitation, according to the teachings of Maniatis, the total CC49 hybridoma Hind III modified- and LAMBDA-ZAP vector Spe I modified-DNA fragments were ligated by means of T4 DNA ligase. The ligation reaction was set using a 6.1 μL ligation mixture containing the following: about 0.2 μL of the total CC49 hybridoma Hind III modified DNA in a 3 μL solution, about 1 μL of LAMBDA-ZAP vector Spe I modified DNA in a 1 μL solution, 0.6 μL of Stratagene's 10×ligase buffer, 0.5 μL 10 millimolar ATP, and 1 μL of Stratagene ligase. This was incubated overnight in a water bath and the temperature lowered incrementally from about 18° C. to about 4° C. This ligation eliminated both the Hind III and the Spe I sites.
A genomic library of ligated mix was made according to Stratagene's protocol. Briefly, 2 μL of the ligation mix produced above was used in Stratagene's GIGAPACK Gold packaging system, following the directions of the manufacturer. Fifteen 150 mm plates having a density of 50,000 plaques per plate were screened, as per manufacturer's directions, for positive clones by hybridization to nitrocellulose filters, obtained from Schleicher-Schuell, Keene, N.H., USA. The <32P> random-labelled probe derived from pGD1, which was described above, was used for hybridization. Two positive clones were obtained.
Each clone was plaque purified and recombinant plasmids (phagemids) of LAMBDA-ZAP vector containing the CC49 L chain variable region were obtained by using Stratagene's automatic excision protocol. The vector portion of the resulting recombined plasmid is called pBLUESCRIPT SK(−) and consists of 2964 bp as described in the 1987 Stratagene catalog. A plasmid map of pBLUESCRIPT SK(−) is shown in FIG. 8.
The DNA from the two positive clones was partially sequenced and both were identical. One of the clones, which was named pRL101, was used for further studies.
Restriction Mapping of CC49 Light Chain
pRL101 was 7.61 kb, and the size of the DNA insert was determined by restriction enzyme mapping to be 4.65 kb. A plasmid map of pRL101 is shown in FIG. 9. A restriction enzyme map of the CC49 L chain genomic DNA insert in pRL101 is shown in FIG. 10.
Isolation of CC83 Light Chain Variable Region
The procedures used to isolate the CC83 light chain were essentially those used to isolate the CC49 light chain, with the following exception.
A genomic library containing 7×105 plaques was screened using as the probe the <32P> random-labeled 1.71 kb Hind III-Pst I fragment derived from pGD1, as described above. One positive clone was obtained. The positive clone was named pRL200.
Restriction Mapping of CC83 Light Chain
pRL200 was 7.44 kb, and the size of the DNA insert was determined by restriction enzyme mapping to be 4.48 kb. A plasmid map of pRL200 is shown in FIG. 11. A restriction enzyme map of the CC83 L chain genomic DNA insert in pRL200 is shown in FIG. 12.
Isolation of CC49 Heavy Chain Variable Region
The procedures used to isolate the CC49 heavy chain were essentially those used to isolate CC49 light chain, including the screening of the same CC49 Hind III modified DNA.
The hybridization probe used to screen the library was generated from pNP9, which contains a 1.98 kbp Eco RI-Bam HI fragment containing the coding exons for J H3 and J H4 of the CC49 immunoglobulin heavy chain. The nucleotide sequence of the probe fragment is provided in FIGS. 13A-13B (SEQ ID NO:16).
A genomic library containing 9.5×105 plaques was screened, from which one positive clone was obtained. The positive clone was named pHH49.
Restriction Mapping of CC49 Heavy Chain
pHH49 was about 7.0 kb, and the size of the DNA insert was determined by restriction enzyme mapping to be about 4.0 kb. A plasmid map of pHH49 is shown in FIG. 14.
Isolation of CC83 Heavy Chain Variable Region
The procedures used to isolate the CC83 heavy chain were essentially those used to isolate the CC49 heavy chain, with the following exceptions.
About 13 g of ligated LAMBDA-ZAP vector DNA were digested with 12 units of Spe I, purchased from New England Biolabs, Inc., in a total of 100 μL of an appropriate buffer. The LAMBDA-ZAP vector was digested at 37° C. for one hour. The reaction mixture was phenol extracted and ethanol precipitated as per Stratagene's protocol. The Spe I-digested LAMBDA-ZAP vector was dephosphorylated according to procedures set forth in Maniatis except that 40 fold excess of calf intestinal alkaline phosphatase (Boehringer Mannheim, Indianapolis, Ind., USA) was used.
DNA from CC83 was digested to completion with Spe I. Fragments between about 3 kb to about 40 kb were isolated from a 0.8 percent agarose gel slice by electroelution as described by Maniatis, and ligated with the dephosphorylated Spe I-cut LAMBDA-ZAP vector.
A genomic library containing 5×105 plaques was screened using the probe generated from pNP9, the sequence of which is provided in FIG. 13. One positive clone was obtained. The positive clone was named pHS83.
Restriction Mapping of CC83 Heavy Chain
pHS83 was 7.95 kb, and the size of the DNA insert was determined by restriction enzyme mapping to be about 5 kb. A plasmid map of pHS83 is shown in FIG. 15.
Sequencing of CC46, CC49, CC83 and CC92 mRNA
Total RNA from about 1×107 CC49 cells frozen at −70° C. was extracted essentially as reported by Maniatis, with the following exceptions. Four molar guanidinium isothiocyanate and 2.5 molar sodium citrate, pH 7.0, and a SW40Ti rotor centrifuged at 31,000 rpm were used.
A total of 2.7 mg of CC49 RNA was isolated. After centrifugation, poly A+ mRNA was purified from about 1.68 mg of RNA by oligo(dT)-cellulose chromatography using Type 3 oligo(dT)-cellulose obtained from Collaborative Research, Inc., Bedford, Mass., USA. The procedure was as described by Aviv and Leder, Proc. Natl. Acad. Sci. (USA), 69:1408 (1972). A total of 50.24 μL of poly A+ mRNA was obtained from 1.68 milligrams of mRNA.
A total of 3.82 mg of CC83 RNA was isolated from approximately 1×107 cells. A total of 54.6 μL of poly A+ mRNA was isolated from 1.91 μg of total RNA.
A total of 0.814 mg of CC92 RNA was isolated from approximately 2.6×108 cells. A total of 41.88 μg of poly A+ RNA was isolated from 0.814 mg of total RNA.
A total of 1.7 mg of CC46 RNA was isolated from approximately 2.89×108 cells. A total of 68.88 μg of poly A+ RNA was isolated from 1.7 mg of total RNA.
Synthetic oligonucleotide primers were synthesized using an APPLIED BIOSYSTEMS (Applied Biosystems (ABI) of Perkin-Elmer Corp., Foster City, Calif.) Model 380A DNA synthesizer, by phosphoramadite-based chemistry as specified by ABI. The oligonucleotides were purified, as specified by the manufacturer, after electrophoresis on a 20 percent polyacrylamide gel containing 7 M urea. Oligonucleotide concentrations were determined spectrophotometrically at an optical density of 260 nm, where 1 OD 260 nm unit is equal to 33 μg/mL of single-stranded DNA.
The following oligonucleotide primers were made for mRNA sequencing: (1) For the CC49, CC83 and CC92 light chains, KL(−), a 22-mer (SEQ ID NO:17):
5′-GGAAGATGGATACAGTTGGTGC-3′
complementary to the coding sequence of the 5′ end of the constant region for mouse immunoglobulin kappa chains, is used to determine the 3′-most mRNA sequence of the light chain variable region.
Additionally, for CC49 light chain, 49FR1(−), a 17-mer (SEQ ID NO:18):
5′-GGAAGATGGATACAGTTGGTGC-3′
was used to determine the remaining sequence.
Additionally, for CC83 light chain, J4(−), a 24-mer (SEQ ID NO:19):
5′-CCAACTTTGTCCCCGAGCCGAACG-3′
and also 83L CDR2(−), a 17-mer: 5′-CAGGGACTCCAGTGTGC-3′ was used to determine the remaining sequence.
Additionally, for CC92 light chain, J5(−) (SEQ ID NO:20):
5′-CGTTTCAGCTCCAGCTTGGTCCC-3′
was used to determine the remaining sequence.
For the CC46, CC49, CC83, and CC92 γ1 heavy chains, CH1(−), a 24-mer (SEQ ID NO:21):
5′-ATGGAGTTAGTTTGGGCAGCAGAT-3′
complementary to the coding sequence of the 5′ end of the murine γ1 heavy chain constant region. The CH1(−) 24-mer is used to determine the 3′-most mRNA sequence of heavy chain variable regions.
Additionally, for the CC49 heavy chain, JH4(−)-20 mer (SEQ ID NO:22):
5′-GGTGACTGAGGTTCCTTGAC-3′
was used to determine the remaining sequence.
Additionally, for the CC83 heavy chain, JH2(−)-16 mer (SEQ ID NO:23):
5′-CTGAGGAGACTGTGAG-3′
was used to determine the remaining sequence.
Additionally, for the CC92 heavy chain and the B72.3 heavy chain, B72.3/CC92 HC-20 mer (SEQ ID NO:24):
5′-CCTTGAACTTCTCATTGTAC-3′
was used to determine the remaining sequence.
The following procedures were carried out as outlined in Gelliebter, BRL FOCUS, 9:1 (1987).
The oligonucleotide primers were end-labeled as follows: 100 ng of oligonucleotide were combined in 50 mM Tris HCl (pH 8), 10 mM MgCl2, 5 mM dithiothreitol, and 1 mM spermidine, 100 μCi (γ-32P) ATP (Amersham, 5000 Ci/mMole) and 7 units of T4 polynucleotide kinase in a volume of 13 μl. The reaction was allowed to proceed at 37° C. for 30 minutes, then heated for 5 minutes at 65° C. to inactivate the kinase, and then 7 μl of water was added to make the concentration 5 ng/μl. The labeled primers were stored at −20° C. until needed.
Separate samples, each containing about 13 μg of poly(A)+ mRNA of CC49, CC83, CC92, or CC46, respectively, were resuspended in 10 μl of annealing buffer [10 mM Tris HCl (pH 8.3), and 250 mM KCl].
A 5 ng sample of end-labeled oligonucleotide primer was added to each mRNA sample, heated to 80° C. for 3 minutes, and annealed for 45 minutes at 61° C., for the KL(−)oligonucleotides and 65° C. for the CH1(−) oligonucleotides. AMV reverse transcriptase (Boehringer Mannheim) was used at a level of 6 units for each mRNA sequencing reaction. The remainder of the sequencing was carried out as set forth in Gelliebter (1987), supra.
Initial sequence data showed that the heavy and light chains were rearranged as follows: CC49 kappa light chain used a J5, CC49 γ1 heavy chain used a J H4. The CC83 light chain used a J4; the CC83 gamma 1 used a J H2. The CC46 kappa light chain used a J2, and the CC46 heavy chain used a JH3. The CC92 light chain used a J5, and the CC92 gamma 1 used a J H2.
FIG. 16 (SEQ ID NO:25) shows the nucleotide sequence of CC49 VH, with the underlined segments showing the sequences derived using oligonucleotide primers on mRNA.
FIG. 17 (SEQ ID NO:26) shows the nucleotide sequence of CC83 VH, with the underlined segments showing the sequences derived using oligonucleotide primers on mRNA.
The entire nucleotide sequences of CC46 VH and CC92 VH, shown in FIGS. 2A-2G, were derived using oligonucleotide primers on mRNA.
FIG. 4A shows the nucleotide sequence of CC49 VL, with the underlined segments showing the sequences derived using oligonucleotide primers on mRNA.
FIG. 5A shows the nucleotide sequence of CC83 VL, with the underlined segments showing the sequences derived using oligonucleotide primers on mRNA.
The entire nucleotide sequence of CC92 VL, shown in FIG. 6A (SEQ ID NO:27), was derived using oligonucleotide primers on mRNA. The amino acid sequence of CC92 VL is given in SEQ ID NO:28.
Protein Sequence
Purified murine CC49 and CC83 immunoglobulin molecules analyzed for NH2-terminal amino acid sequence used the Edman degradation method, as modified by Tarr, (1986) in “Manual Edman Sequencing System”, Microcharacterization of Polypeptides: A Practical Manual (John E. Shively, ed., Humana Press, Inc., Clifton, N.J., pp 155-194). The immunoglobulin molecules were reduced and alkylated. The light and heavy chains of the immunoglobulin molecules were separated by reverse phase HPLC.
FIG. 4B shows the amino acid sequence for CC49 VL, with the results of the amino acid sequence determination for the first 24 amino acids of the mature CC49 VL being underlined. FIG. 5B shows the amino acid sequence for CC83 VL, with the results of the amino acid sequence determination for the first 51 amino acids of the mature CC83 VL being underlined. ASN-20 could not be determined in the CC83 light chain, because of the presence of N-linked carbohydrate residues at this position, which is shown in the PNGase F experiment below. The sequence Asn-Ile-Thr corresponds to the consensus sequence Asn-X-Thr/Ser for carbohydrate attachment to Asn.
Since the heavy chains of immunoglobulins CC49 and CC83 are blocked at the N-terminus and unavailable for amino acid sequence determination, the native glycopeptide was treated with cyanogen bromide (CNBr) to cleave at the methionine residues. The cleavage resulted in fragments, which were purified by reverse phase HPLC. N-terminal amino acid sequencing was performed on the CNBr fragments.
The results of the amino acid determination of one of the CC49 VH CNBr peptide fragments are indicated as underlined residues in FIG. 18 (SEQ ID NO:29). The results of the amino acid determination of one of the CC83 VH CNBr peptide fragments are indicated as underlined residues in FIG. 19 (SEQ ID NO:30). As with CC49, all other peptide sequences correspond to CNBr fragments derived from the constant region of mouse γ1.
Determination of N-Linked Carbohydrate on CC83 L Chain
This experiment was done to verify that there is an N-linked carbohydrate attached to the CC83 light chain, presumably at ASN-20 (see FIG. 5B). The enzyme glycopeptidase F (PNGase F), which is isolated from the culture filtrate of Flavobacterium meningosepticum (Tarentino et al., Biochemistry, 24:4665-4671 (1985)), will cleave high mannose and/or biantennary complex sugars N-linked to ASN to generate a free carbohydrate structure and an ASP residue from the ASN to which it was attached. The difference in molecular weight between the glycosylated and unglycosylated form of the same peptide can be determined by SDS-PAGE.
Twelve microgram reactions with and without PNGase F (Boehringer Mannheim, Indianapolis, Ind., USA) for the purified murine antibodies CC49, CC83 and CC11 F(ab′)2 (a positive control) were carried out in a final aqueous reaction volume of 40 μL. Four microliters of 10×buffer (1M potassium phosphate, 0.1M disodium EDTA pH 7.4) were added to each reaction mix. To those tubes designated “with PNGase F”, 7.5 μL of PNGase F were also added and all tubes were incubated at 37° C. for 1 hour. To the reaction tubes was added 40 μL of Laemmli 2×sample dilution buffer containing β-mercaptoethanol. A 10 percent SDS polyacrylamide gel was electrophoresed, the gel stained with Coomassie Brilliant Blue R-250 and destained. FIG. 20 shows the results. As shown in lane 2, a new band (*) appears in the PNGase F treated CC83 sample but not in the untreated CC83 sample (lane 3). The new band is approximately 2,000-3,000 molecular weight smaller than the native light chain band, which represents the removal of an N-linked carbohydrate moiety. The only consensus glycosylation site for the CC83 light chain is at ASN 20, so by inference it is assumed that this is the actual site of glycosylation. The CC49 light chain does not change mobility when treated with PNGase F (lane 6), but a new band is observed for the heavy chain fragment of CC11 F(ab′)2 (lane 4*) which serves as a positive control. mRNA sequence data of CC11 heavy chain indicates a consensus glycosylation site in the V domain (data not shown). The standards (lane 1) are bovine serum albumin (BSA), MW 68,000 and soybean trypsin inhibitor (STI), MW 21,500.
DNA Sequence
Plasmid DNA was sequenced directly using the SEQUENASE DNA sequencing kit (containing modified T7 DNA polymerase and reagents), obtained from United States Biological (USB), Cleveland, Ohio, USA, now Amersham International PLC, Buckinghamshire, England. USB's protocol was followed to sequence double stranded DNA. The DNA of each variable region was sequenced using the JH or JL oligo determined from the mRNA sequence information to be specific for each productively rearranged heavy chain or light chain gene, respectively.
After the initial sequences were determined, the sequence was extended further by using additional primers. The additional primers were synthesized using information gathered from the sequences previously generated.
Using the above technique, the DNA sequences of the entire heavy chain variable region exons and light chain variable region exons of CC49 and CC83 were obtained. The DNA sequence was compiled and analyzed using a DNAsis DNA sequence analysis software program (Hitachi Software Engineering Co., Ltd., Yokohama, Japan).
The following oligonucleotide primers were made for DNA sequencing:
(1) For both light chains, CK intron(−) (SEQ ID NO:31):
5′-GAAAACCTGTGTCTTACAC-3′.
(2) For the CC49 light chain, CC49 FRI(+) (SEQ ID NO:32):
5′-GTACCTGTGGGGACATTG-3′,
and JK5(−)-23 mer (SEQ ID NO:33):
5′-CGTTTCAGCTCCAGCTTGGTCCC-3′.
(3) For the CC83 light chain, CC83 CDR2(−) (SEQ ID NO:34):
5′-CAGGGACTCCAGTGTGC-3′,
CC83 L intron (−) (SEQ ID NO:35):
5′-GACTTCAAGATACAAATGTTAG-3′,
and JK4(−)-20 mer (SEQ ID NO:36):
5′-CCAACTTTGTCCCCGAGCCGAACG-3′.
The complete nucleotide sequences for CC49 VL and CC83 VL are shown in FIGS. 4A and 5A, respectively.
For the CC49 heavy chain, JH4(−)-20 mer (SEQ ID NO:37):
5′-GGTGACTGAGGTTCCTTGAC-3′ and J H4 Intron(−) (SEQ ID NO:38):
5′-GCAATGCTCAGAAAACTCC-3′.
For the CC83 heavy chain, JH2(−)-16 mer (SEQ ID NO:39):
5′-CTGAGGAGACTGTGAG-3′
and J H2 Intron(−) (SEQ ID NO:40):
5′-GCAGTAAAATCTATCTAAGCTG-3′.
Thereafter, the sequencing of each heavy chain was extended with the following sequences: CC49/83 HC/5′(+) (SEQ ID NO:41):
5′-GCACTGCTCATGATATGCAAATC-3′;
CC49/83 HC/5′(−) (SEQ ID NO:42):
5′-GATTTGCATATCATGAGCAGTGC-3′;
and CC49/83 H chain FRI(−) (SEQ ID NO:43):
5′-CTCAGCGTCAGACTGCTG-3′.
The complete nucleotide sequences for CC49 VH and CC83 VH are shown in FIGS. 2A-2G.
Comparisons were made between the characterized mRNA sequence and the characterized DNA sequence, and between the characterized amino acid sequence with the amino acid sequence predicted from the DNA sequence. Based on these comparisons, the plasmid clones were identified to contain the correct DNA sequence to code for the CC49 and CC83 heavy and light chain variable regions.
The predicted amino acid sequences from the nucleotide sequences of the heavy chain variable regions of CC49 and CC83, as shown in FIGS. 2A-2G, show extensive sequence similarity throughout the framework regions and hypervariable regions 1 and 2. Hypervariable region 3 is quite different between the two due to the recombination of the VH region with different D and JH sequences, namely that the CC49 γ1 heavy chain used a JH 4, and the CC83 gamma 1 used a J H2.
The extensive DNA sequence homology 5′ to the coding regions in the CC49 and CC83 heavy chain variable region genes shows the two heavy chain variable region genes were derived from the same germline exons.
Isolation of VHαTAG, Germline Precursor Gene to the Heavy Chain of CC46, CC49, CC83, and CC92
The procedures used to isolate the germline precursor gene to the heavy chain variable regions of CC46, CC49, CC83, and CC92 were essentially those used to isolate the CC49 heavy chain variable region except that the DNA used to generate the LAMBDA-ZAP vector library came from an irrelevant hybridoma cell line (i.e., a cell line which produces antibodies that do not appreciably bind to TAG-72). A genomic library containing approximately 900,000 plaques was screened from which one positive clone was isolated. The positive clone was named pVHαTAG. pVHαTAG was about 5.2 kb, and the size of the DNA insert was determined by restriction enzyme mapping to be about 2.2 kb.
DNA Sequence of VHαTAG
The following oligonucleotide primers were used for determining the DNA sequence of VHαTAG:
B72.3/CC92 HC-20 mer (SEQ ID NO:44):
5′-CCTTGAACTTCTCATTGTAC-3′;
CC49/CC83 HC 5′(+) (SEQ ID NO:45):
5′-GCACTGCTCATGATATGCAAATC-3′;
CC49/CC83 HC 5′(−) (SEQ ID NO:46):
5′-GATTTGCATATCATGAGCAGTGC-3′;
VHαTAG IVS (+) (SEQ ID NO:47): 5′-CTAAAGTGGAGTCAGGGCCTG-3′;
VHαTAG IVS (−) (SEQ ID NO:48): 5′-CAGGCCCTGACTCCACTTTAG-3′;
VHαTAG CDR2 (+) (SEQ ID NO:49): 5′-GAATGGATTGGATATATTTCTC-3′.
The complete nucleotide sequence of VHαTAG is shown in FIGS. 2A-2G.
Isolation of Human Heavy Constant Genes
Plasmid constructs containing the various heavy chain human constant regions (pγ1, pγ2, pγ3, and pγ4) were provided by Dr. Ilan R. Kirsch of the National Cancer Institute, Bethesda, Md., USA.
Restriction enzyme mapping was performed on these genes to confirm their identity. Restriction maps for the human constant regions are enclosed in FIGS. 21A-21D.
Chimeric Light Chain
Murine CC49 V Region
The Hind III site of the CC49 light chain genomic DNA located in the murine intron region between J5 and Cκ (see Max et al., J. Biol. Chem., 256:5116 (1981)) was lost in the cloning procedure where half-filled in Hind III sites were ligated to half-filled in Spe I sites in the LAMBDA-ZAP vector. The plasmid pRL101 (FIG. 9) carried this modification. The intron Hind III site was regenerated as outlined in the steps below in order to enable a Hind III-Bam HI human germline kappa light chain DNA fragment (see Hieter et al., J. Biol. Chem., 257:1516 (1982)) to be ligated to the murine variable region directly. All steps were performed using standard molecular biology techniques familiar to artisans and can be found in a manual such as Maniatis.
A 1.69 kb Bam HI-Pst I fragment was isolated from pRL101, described supra. A 2.96 kb Bam HI-Pst I fragment was isolated from pBluescript SK(−) (purchased from Stratagene), supra. The two fragments were then ligated and pRL103 (FIG. 47) was isolated.
Plasmid pGD1, (described supra), was digested with Pst I and Hind III restriction enzymes to yield the necessary 1.03 kb intron-containing fragment, and pRL103 was also digested with Pst I and Hind III restriction enzymes to remove the small fragment of DNA in the polylinker.
The resulting fragments were ligated with T4 DNA ligase to produce a 5.68 kb plasmid, called pRL104. Partial restriction maps of pGD1 and pRL104 are shown in FIGS. 49 and 48.
Human CK Region
Plasmid phum CK was obtained from Dr. John Roder, Mt Sinai Research Institute, Toronto, Ontario, Canada. The plasmid is derived from pBR322, with a 12 kb Bam HI fragment containing the human CK exon inserted therein. pBR322 is described on page 171 of the 1987 Stratagene catalog. The 12 kb Bam HI fragment restriction map is shown in FIG. 50 (from Heiter et al. J. Biol. Chem, 257:1516 (1982)).
The plasmid phum Cκ was digested with Hind III and Bam HI restriction enzymes to yield a 5.0 kb fragment, containing the human Cκ exon. pRL104 was digested with Fsp I and Hind III restriction enzymes to yield a 4.2 kb fragment, containing the mouse light chain variable exons of CC49.
The two resulting fragments were joined with T4 DNA ligase to produce a 9.2 kb fragment among the mixture of resulting fragments. This mixture was digested with Bam HI to yield a 7.7 kb Bam HI CC49 L chain chimeric construct with Bam HI sticky ends, which contains both the mouse variable region exons and the human constant region (kappa) exon. These constructions utilize the human enhancer sequences and the murine promoter sequences.
The chimeric Bam HI fragment containing both the murine light chain variable region exons (L and VJ) and the human constant region kappa (κ) exon was ligated into the Bam HI site with the plasmid pSV2neo (5.6 kb), a pBR322-derived plasmid containing the selectable marker gene neo (obtained from ATCC). The presence of the active neo gene renders a cell resistant to growth inhibition by GENETICIN aminoglycoside (from Gibco, now Life Technologies, Inc., Chagrin Falls, Ohio), a neomycin-like drug also called G418.
The chimeric Bam HI fragment was inserted into pSV2neo in both orientations as shown below. Both transcriptional orientations of the chimeric light chain gene, relative to the neo gene, were constructed. Plasmid pSV2neo was linearized at the Bam HI site, dephosphorylated (according to procedures set forth in Maniatis) using calf intestinal alkaline phosphatase (to prevent self-ligation) and ligated with chimeric CC49 L chain Bam HI fragments from above to form pRL150 (FIG. 51) and pRL105 (FIG. 52).
The transcriptional orientations of the neo gene and the CC49 chimeric light chain are indicated by arrows in pRL150 and pRL105. The portions derived from pSV2neo are indicated. These plasmids were purified on a large scale from preparative scale (1.0L) fermentation of E. coli clones replicating each of the plasmids. The purified plasmids were used to introduce the chimeric CC49 light chain into SP2/0 plasmacytoma cells as discussed below.
Murine CC83 VL Region and Human CK Region
The Hind III site in pRL200 which was lost in the cloning process of the CC83 light chain was regenerated for the same reason as for the CC49 light chain chimeric construction. The regeneration was accomplished as follows. The plasmid pRL200 was linearized at a unique Nhe I site, and both of its sticky ends were converted to blunt ends by filling in with dNTPs and DNA polymerase I. A Bam HI phosphorylated linker (purchased from New England Biolabs) was ligated to the filled-in site. The new plasmid is called pRL201.
The 2.5 kb Bam HI-Pst I fragment from pRL201 containing the CC83 light chain variable region genomic DNA was conveniently ligated to the 4 kb Bam HI-Pst I vector fragment from pRL104 which was described earlier in the CC49 light chain constructions and which already had the Hind III-bearing intron fragment. The new plasmid is called pRL202 and is shown in FIG. 53.
The approximately 5.05 kb Fsp I-Hind III fragment from pRL202 was isolated and ligated with the human Cκ-containing 5.0 kb Hind III-Bam HI fragment already described for the CC49 light chain chimeric construction. The generation of the CC83 light chain vector was accomplished from this point in an identical fashion as carried out for the CC49 light chain. The resulting 8.5 kb Bam HI CC83 light chain chimeric construct was also ligated to pSV2neo-Bam HI (phosphatased) and plasmids with both possible orientations of the insert were obtained as diagramed in FIGS. 54 (pRL203) and 55 (pRL230).
The transcriptional orientations of the neo gene and the CC83 chimeric light chain are indicated by arrows in pRL203 and pRL230. These plasmids were purified on a large scale from a preparative scale of about 1 Liter (1.0L) fermentation in a commercial incubator of E. coli clones replicating each of the plasmids. The purified plasmids were used to introduce the chimeric CC83 light chain into Sp2/0 plasmacytoma cells, as discussed below.
All four of the chimeric light chain plasmid constructs (pRL105, pRL150, pRL203 and pRL230) can be linearized by digesting with the restriction enzyme Aat II. The Aat II site in the plasmids is in a region that is not essential for the expression of the chimeric light chain gene or the selectable marker gene, neo.
Chimeric Heavy Chains
Human Gamma Constant Gene Exons
The plasmid vector used to carry the chimeric heavy chain constructs is designated pSV2gpt, set forth in Mulligan and Berg, Proc. Natl. Acad. Sci (USA), 78(4):2072-2076 (1982). pSV2gpt is a pBR322 derived plasmid containing the selectable marker gene, guanine phosphoribosyl transferase (gpt), which can be used for selective growth in media containing mycophenolic acid. To prepare pSV2gpt as a recipient for the human Cγ1, Cγ2, Cγ3, Cγ4 exons, it was digested with Eco RI and Bam HI. The digested DNA was fractionated on a 4 percent polyacrylamide gel and the 4.5 kb vector fragment was recovered from the gel by electroelution as described in Maniatis. This linearized plasmid was designated pSV2gpt/R/B, a plasmid map is shown in FIG. 22. It is able to accept Eco RI-Bam HI ended fragments.
The 5′ Hind III sites, present on the human IgG1 constant region fragments, were converted to Eco RI sites for directed cloning into the Eco RI site of pSV2-gpt. For γ1, γ2, γ3, and γ4, the Eco RI site in vector, pBR322 was employed.
Cγ1
The fragment containing the human Cγ1 exons was obtained by digesting and linearizing pγ1 with Hind III followed by filling in the Hind III sticky ends using all four dNTP's and the Klenow fragment of DNA Polymerase to make the Hind III ends blunt. An Eco RI linker was ligated to the blunt ends to replace the Hind III site with an Eco RI site. This construct was then digested with Eco RI and Bam HI to release a 7.8 kb fragment containing the Cγ1 exons. This fragment was called Cγ1-7.8 kb.
The fragments were each ligated into the Eco RI-Bam HI sites of pSV2-gpt/R/B. This vector (pSV2-gpt-γ1-7.2) design allows us to insert any murine heavy chain variable region gene (with Eco RI ends) into the Eco RI site of the human IgG heavy chain vectors. More specifically, 125 ng of the human Cγ1-7.8 kb fragment was ligated to 100 ng of the linearized pSV2gpt/R/B vector in a volume of 10 μl using 400 units of T4 DNA ligase (obtained from New England Biolabs). Frozen competent E. coli DH1 cells from Invitrogen (San Diego, Calif.) were transformed with a ligation reaction according to the Invitrogen's protocol. The resulting plasmid was designated pSV2gptγ1-7.8. A plasmid map of pSV2gptγ1-7.8 is shown in FIG. 23.
In addition, another shorter fragment containing the Cγ1 exons was generated. Concerns about the total size of the chimeric heavy chain vector, with a 7.8 kb Cγ1 fragment, a 4.5 kb pSV2-gpt/R/B vector, and a CC49 variable region of 1.9 kb (total=14.2 kb) prompted the need to reduce the large size of the 7.8 kb Cγ1 Eco RI-Bam HI fragment. The coding region of 7.8 kb Cγ1 occupies only the first ⅓ of the 5′ end of the fragment.
Size reduction was accomplished by converting a downstream Pvu II site to a Bam HI site by blunt-end addition of a Bam HI linker. The Hind III site of pγ-1. was converted to an Eco RI site by digestion of pγ-1 with Hind III, filling in the 3′ end to create a blunt end, and addition of Eco RI linkers as above. The Pvu II site 2.3 kb downstream was converted to a Bam HI site by subsequent digestion with Pvu II and ligation of Bam HI linkers directly to the blunt Pvu II ends. This construct was then digested with Eco RI and Bam HI to release a 2.3 kb fragment containing the Cγ1 exons. The shortened Eco RI-Bam HI fragment (2.3 kb) still contains the γ1 exons and the 3′ polyadenylation sequence. This reduces the total vector size by 5.5 kb, making the overall construct more manageable (total=8.7 kb).
Approximately 200 ng of the human Cγ1 2.3 kb fragment was ligated to 100 ng of the linearized plasmid pSV2gpt/R/B vector in a volume of 10 μl using 400 units of T4 DNA ligase (New England Biolabs). Frozen competent E. coli cells, obtained from Invitrogen, were transformed with the ligation reaction according to Invitrogen's protocol. The resulting plasmid was designated pSV2gptγ1-2.3. A plasmid map of pSV2gptγ1-2.3 is shown in FIG. 24.
DNA fragments containing the other three human IgG constant region exons were also isolated. The Cγ2 exons were recovered from the plasmid pγ2 as a 4.0 kb Eco RI-Bam HI fragment. The Cγ3 exons were recovered from the plasmid pγ3 as an 8.0 kb Eco RI-Bam HI fragment. The Cγ4 exons were recovered from the plasmid pγ4 as a 7.6 kb Eco RI-Bam HI fragment. The fragments were separately ligated into pSV2gpt/R/B as described for Cγ1-7.8 and Cγ1-2.3. Plasmid maps of the resultant plasmids are shown in FIG. 25, pSV2gpt-γ2; FIG. 26, pSV2gpt-γ3; and FIG. 27, pSV2gpt-γ4.
Heavy Chain Chimeric Constructs:
The complete heavy chain variable region human γ1 constant region chimeric constructs were generated by inserting a fragment containing the murine heavy chain variable region exons into the plasmids containing the human γ1 constant region exons described as follows.
Eco RI fragments containing the murine heavy chain variable region genes from CC49 and CC83 hybridoma cells were then ligated into each of the γ1-γ4-containing pSV2-gpt vectors (pSV2gpt-γ1; pSV2gpt-γ2; pSV2gpt-γ3; pSV2gpt-γ4) as follows:
CC49
A fragment containing the heavy chain variable region exons coding for the CC49 heavy chain variable region was prepared by digesting 14 μg of pHH49 with 50 units of Eco RI (obtained from BRL) at 37° C. for 2 hours. The digest was fractionated on a 4 percent polyacrylamide gel and the 1.9 kb Eco RI fragment containing the heavy chain variable region exons of CC49 was recovered by electroelution as described by Maniatis. This fragment was designated f49R.
A fragment containing the 7.8 kb sequence encoding for γ1 was prepared as follows:
Approximately 50 μg of the vector pSV2gptγ1-7.8 was digested with Eco RI. The resultant fragment was dephosphorylated (to prevent self ligation) using calf intestinal alkaline phosphatase as described by Maniatis. The fragment was purified from the 0.8 percent agarose gel by electroelution. This vector was designated pSV2gptγ1-7.8/R.
The Eco RI site is located 245 bp upstream of the transcription initiation sites, and contains the promoter and the necessary tissue-specific sequences for efficient expression. The intron regions 3′ of the variable region genes contain the murine heavy chain enhancer sequences which are absent on the human IgG heavy chain vectors. Therefore, the heavy chain chimeric vectors use both murine promoter and enhancer sequences.
Approximately 325 ng of linearized pSV2gptγ1-7.8/R was ligated with 188 ng of f49R in a volume of 10 μL with 1 unit of T4 DNA ligase (BRL). Frozen competent E. coli AG-1 cells from Stratagene were transformed with the ligation reaction according to their protocol. The resulting plasmid was designated p49γ1-7.8. FIG. 28 illustrates a plasmid map for p49γ1-7.8.
Approximately 50 μg of the vector pSV2gptγ1-2.3 was digested as for pSV2gptγ1-7.8 with Eco RI. The resultant fragment was dephosphorylated using calf intestinal alkaline phosphatase as described by Maniatis. The fragment was purified from an 0.8 percent agarose gel by electroelution. This linearized plasmid was designated pSV2gptγ1-2.3/R.
Approximately 300 ng of the linearized plasmid pSV2gpt γ1-2.3/R was ligated with 188 ng of f49R in a volume of 10 μl with 1 unit of T4 DNA ligase (BRL). Frozen competent E. coli AG-1 cells from Stratagene (La Jolla, Calif., USA) were transformed with the ligation reaction according to their protocol. The resulting plasmid was designated p49γ1-2.3. FIG. 29 illustrates a plasmid map for p49γ1-2.3.
Plasmids pSV2gpt-γ2, pSV2gpt-γ3 and pSV2gpt-γ4 were separately digested with Eco RI to produce the linear plasmid vectors pSV2gpt-γ2/R, pSV2gpt-γ3/R and pSV2gpt-γ4/R respectively. Each of these 3 linear plasmid vectors were separately ligated with f49R. Plasmid maps of the resulting plasmids are shown in FIG. 30, p49-γ2; FIG. 31, p49-γ3; and FIG. 32, p49-γ4.
CC83
Chimeric constructs containing the heavy chain variable region of CC83 were generated in a similar manner as the chimeric constructs of CC49. A fragment containing the heavy chain variable region exons coding for the CC83 heavy chain region was prepared by digesting 19 μg of pHS83 with 50 units of Eco RI (obtained from BRL) at 37° C. for 2 hours. The digest was fractionated on a 4 percent polyacrylamide gel and the 2.9 kb Eco RI fragment containing the heavy chain variable region exons of CC83 were recovered by electroelution as described in Maniatis. This fragment was designated f83R.
Approximately 300 ng of the linearized plasmid pSV2gptγ1-7.8/R, obtained as above, was ligated with 270 ng of f83R in a volume of 10 μl with 1 unit of T4 DNA ligase (obtained from BRL). Frozen competent E. coli AG-1 cells, obtained from Stratagene, were transformed with the ligation reaction according to Stratagene's protocol. The resulting plasmid was designated p83γ1-7.8. FIG. 33 illustrates the plasmid map of p83γ1-7.8.
Approximately 90 ng of linearized plasmid pSV2gpt γ1-2.3/R, obtained as above, was ligated with 270 ng of f83R in a volume of 10 μl with 1 unit of T4 DNA ligase (BRL). Frozen competent E. coli AG-1 cells from Stratagene were transformed with the ligation reaction according to their protocol. The resulting plasmid was designated p83γ1-2.3. FIG. 34 illustrates the plasmid map of p83γ1-2.3.
Plasmids pSV2gpt-γ2, pSV2gpt-γ3 and pSV2gpt-γ4 were separately digested as above for pSV2gpt-γ2/R, pSV2gpt-γ3/R and pSV2gpt-γ4/R, respectively, with Eco RI to produce the linear plasmid vectors pSV2gpt-γ2/R, pSV2gpt-γ3/R and pSV2gpt-γ4/R respectively. Each of these 3 linear plasmid vectors were separately ligated with f83R. Plasmid maps for the resulting plasmids are shown in FIG. 35, p83-γ2; FIG. 36, p83-γ3; and FIG. 37, p83-γ4.
All ten of the circular plasmid constructs (p49γ1-7.8; p49γ1-2.3; p83γ1-7.8; p83γ1-2.3; p49-γ2; p83-γ2; p49-γ3; p83-γ3; p49-γ4; and p83-γ4) were then linearized for transformation by digesting with the restriction enzyme Nde I. The Nde I site in the plasmids is in a region that is not essential for the expression of the chimeric immunoglobulin gene or the selectable marker gene, gpt. The plasmids need to be in a linear form prior to transformation into a recipient cell to enhance selected integration of the DNA into the host cell genomic DNA.
Verification of Construction
Since the Eco RI fragments can be ligated in either orientation, the correct orientation was determined by digestion with Nco I. In the constructions set forth above, correct ligations for plasmid construction are confirmed by performing restriction enzyme site mapping on the plasmid. The restriction enzyme map generated from restriction enzyme digestion and gel electrophoresis is compared to that which can be theoretically generated from the individual starting fragments. Because of the experience with the transcriptional orientation in the light chain vectors, the heavy chain vectors were constructed only in the opposite transcriptional orientation to the gpt gene.
Transformation of Plasmids into Mouse Plasmacytoma Cells
When both light chain and heavy chain chimeric genes were transformed into the same cell, tetrameric (H2L2) immunoglobulins are obtained. Synthesis and secretion of these “chimeric” antibody proteins was accomplished by introducing the chimeric (mouse V:human C region) genes into mouse plasmacytoma cells (Sp2/0). Transformation was achieved by electroporation (Sahagan, et al., J. Immunology, 137:1066 (1986)).
Expression of chimeric (mouse V:human C region) genes in transformed (Sp2/0) is achieved using two different techniques. In one mode, different ratios of light chain genes to heavy chain genes can be introduced together. This is referred to as cotransformation. Alternatively, stable clones carrying the chimeric light chain gene can be obtained and subsequently used in a second mode referred to as targeted transformation. In each method, the goal is to obtain clones containing genes for both the H chain and L chain which produce intact H2L2 immunoglobulin mentioned above.
A. Cotransformations
Co-transformation involves the transformation of cells with both drug resistance markers at the same time and subsequent selection with one or both drugs. Co-transformation of heavy chain and light chain vectors (at ratios of 1:1 and 1:10, respectively) was originally performed using only neo selection. Neo-resistant cell lines were obtained which expressed the first chimeric IgG1 antibodies with demonstrable TAG-72 binding activity. Cotransformation was conducted pursuant to the protocols set forth in Gorman, “High Efficiency Gene Transfer into Mammalian Cells”, DNA Cloning, Vol II, D. M. Glover ed, IRL Press, Oxford, England (1985).
B. Targeted Transformations
Constructs containing light and heavy chimeric immunoglobulin genes were sequentially transformed into Sp2/0 mouse plasmacytoma cells. Targeted transformation involves transformation and selection with a vector containing a first drug-resistance gene (i.e., GENETICIN aminoglycoside for the chimeric light chain gene vector), followed by transformation and selection with a vector containing a second drug resistance gene (i.e., mycophenolic acid for the chimeric heavy chain gene vector).
Neo Selection
Prior to transformation with pSV2-neo vectors, which contain chimeric light chain constructions, drug selection conditions for inhibition of growth of untransformed Sp2/0 plasmacytoma cells [obtained from the American Type Culture Collection (ATCC)] were established by titration of GENETICIN aminoglycoside (GIBCO). Published values for concentrations of GENETICIN aminoglycoside used for drug selection ranged from 100-1000 μg/mL. Concentrations above 400 μg/mL were found to prevent growth of Sp2/0 cells in our tissue culture environment.
Construction of Light Chain Containing Cells
Sp2/0 mouse plasmacytoma cells were initially transformed with light chain-containing pSV2-neo vectors as follows. Cells were grown in RPMI 1640 medium with 5 percent fetal calf serum. Cells were washed in PBS and suspended to a concentration of 1×107 viable cells/mL PBS. 0.8 mL of cells were transferred to an electroporation curvette (on ice) containing 20 μg of light chain-containing pSV2neo vector (pRL105 and pRL150 for the CC49 chimeric L chain and pRL203 and pRL230 for the CC83 chimeric L chain) linearized with Aat II restriction endonuclease. Aat II was inactivated by heating the samples to 65° C. for 10 minutes. The linearized DNA was ethanol precipitated and subsequently dissolved in 10-20 μL of PBS. After 15 minutes on ice, electroporation was performed using a GENE PULSER electroporation apparatus with added capacitance extender (Bio-Rad Laboratories, Inc., Richmond, Calif.) at 0.2 kvolts and 960 μF. The time constant (τ) was generally about 26 msec.
After transformation, cells were allowed to recover on ice for 15 minutes to allow relaxation of perturbed membranes. Afterwards, the cells were suspended in 24 mL of RPMI 1640 medium containing 5 percent fetal calf serum (RPMI+) and transferred to a 96 or 24 well plate. To decrease the probability of more than one drug resistant cell per well, the cells were also diluted 10-fold in medium (RPMI+) and plated into another 96-well (or 24-well) plate. The cell suspension was incubated at 37° C. and 5 percent CO2 atmosphere.
After 48 hours (to allow for expression of drug resistance), the medium was removed and replaced with medium containing 1 mg/mL GENETICIN aminoglycoside.
After 7-10 days, clones resistant to GENETICIN aminoglycoside were subcultured and the cells screened for chimeric light chains by cytostaining.
Cytostaining
Aliquots of cells were pelleted onto a glass slide using a CYTOSPIN-2 centrifuge (Shandon Southern Instruments, Ltd., Chesire, England, now Life Sciences International, Ltd., Cheshire, England). After air drying, the cells were fixed in acetic acid/ethanol (5 parts acetic acid/95 parts ethanol). After rinsing 3 times with PBS (without Ca+2 and Mg+2), the slides were placed in a humid chamber (100 percent RH), and stained for 20 minutes with 20 μl of goat anti-human Kappa-FITC, a fluorescent dye-conjugated antibody which is specific for human kappa light chains. The conjugated antibody was diluted 1:3 with 1 percent BSA in PBS. After washing overnight with PBS, the slides were mounted with FLUOROMOUNT-G, histologic mounting medium (obtained from Southern Biotechnology Associates, Inc., Birmingham, Ala.) under a coverslip. The slides were observed with an OLYMPUS model BH-2 microscope (from Olympus Corp. of America, New Hyde Park, N.Y., now Olympus America, Inc., Lake Success, N.Y.) equipped with an epi-illumination U.V. attachment.
Based on the intensity of fluorescence, the constructions with the orientation of the light chain in opposite transcriptional orientation relative to the direction of transcription of the neor gene in the vector, was found to give the highest L chain expression. Therefore, pRL105 was the preferred CC49 L chain construction and pRL230 was the favored CC83 L chain construction. As a result of these experiments the following chimeric light chain-containing cell lines (derived from Sp2/0) were used for the targeted transformations.
For the CC49 chimeric L chain one cell line (49K-13-13) was obtained which expressed the chimeric light chain derived from CC49. This cell line was used for all subsequent targeted transformations with chimeric heavy chain vectors for constructs using the chimeric CC49 light chain.
For the CC83 chimeric L chain three cell lines (83K-26-5, 83K-34-10, and 83K-42-2) were obtained which expressed the chimeric light chain derived from CC83. One cell line (83K-26-5) stained more intensely than the others and had localized regions of cytoplasmic immunofluorescence. All three cell lines were compared for their relative ability to produce high levels of chimeric antibody after transformation with the chimeric CC83 g1 heavy chain vector. More clones expressing chimeric antibodies were derived from electroporation of the 83K-34-10 target than either of the other two chimeric light chain target cell lines. Therefore, the 83K-34-10 light chain cell line was used as a target for subsequent electroporations with chimeric heavy chain vectors for constructs containing the CC83 light chain variable region.
Generation of gpt Resistant Clones Carrying CC49 and CC83 Chimeric H Chain Constructions
Prior to transformation with pSV2-gpt vectors, which contain chimeric heavy chain constructions, drug selection for inhibition of growth of untransformed Sp2/0 plasmacytoma cells [obtained from the American Type Culture Collection (ATCC)] were established. Conditions for drug selection of cells transformed with pSV2-gpt vectors were more difficult to establish. The E. coli gpt gene, which codes for the enzyme guanosine phosphoribosyl transferase, confers the ability to utilize xanthine and hypoxanthine as substrates for the biosynthesis of guanine when the mammalian guanine metabolic pathway is inhibited by mycophenolic acid (MPA).
Published values for the concentrations of MPA which allow for the growth of other lymphoid cell lines transformed with pSV2-gpt vectors were found to be almost two orders of magnitude too high to allow for the growth of Sp2/0 cells transformed with pSV2-gpt vectors in our tissue culture environment. Subsequently, a concentration of 0.1 μg/mL of MPA was found to be optimal for selection of gpt resistance. In addition, the use of aminopterin and thymidine (to further shut down the guanine pathway) was found to be unnecessary.
Generation of Clones Producing Chimeric 44 Antibody
CH44-1
49K-13-13 cells were used as a target for chimeric heavy chain constructs. The cells were transformed with 20 pg chimeric heavy chain DNA vector (p49γ1-7.8 or p49γ1-2.3) linearized by Nde I digestion. Transformation by electroporation was performed as above for chimeric light chains.
Selection after 48 hours, however, was performed by replacing the medium containing GENETICIN aminoglycoside with medium containing GENETICIN aminoglycoside and 0.3 μg/mL mycophenolic acid, 250 μg/mL xanthine, and 10 μg/mL hypoxanthine.
Transformed cells grew to macroscopically visible colonies in 14 days. At that time, 50 μl of supernatant was removed and assayed by ELISA methods for binding to TAG and expression of human IgG constant region. Wells containing cells with positive TAG binding were expanded to 24-well plates with fresh drug selection medium and allowed to grow for 3-7 days.
Subcloning was performed as follows. Viable cell counts were determined and the cells were replated into two 96-well plates. One plate received 50 viable cells and the other received 250 viable cells. The unsubcloned cells were expanded to 6-well plates until the cell density was sufficient to allow for storage in liquid nitrogen in the event that re-subcloning would be necessary.
After subcloning, those clones exhibiting the highest chimeric antibody production were selected for chimeric antibody production in bioreactors.
CH44-2
The procedures used to sequentially transform the Sp2/0 plasmacytoma cells in the construction of CH44-1 were repeated with the exception that 20 μg of p49-γ2, was used as the chimeric heavy chain vector.
CH44-3
The procedures used to sequentially transform the Sp2/0 plasmacytoma cells in the construction of CH44-1 were repeated with the exception that 20 μg of p49-γ3, was used as the heavy chain vector.
CH44-4
The procedures used to sequentially transform the Sp2/0 plasmacytoma cells in the construction of CH44-1 were repeated with the exception that 20 μg of p49-γ4, was used as the heavy chain vector.
Generation of Clones Producing Chimeric 88 Antibody
CH88-1
The procedures used to sequentially transform the Sp2/0 plasmacytoma cells in the construction of CH44-1 were repeated with the following exceptions:
83K-26-5, 83K-34-10, and 83K-42-2 cells demonstrating production of chimeric CC83 light chain were transformed as described in the transformation of CH44-1, with the exception that 20 μg of p83γ1-7.8 or p83γ1-2.3, the pSV2gpt vector which contains the chimeric CC83 heavy chain gene was used as the heavy chain vector.
CH88-2
The procedures used to sequentially transform the Sp2/0 plasmacytoma cells in the construction of CH88-1 were repeated with the exception that 20 μg of p83-γ2, was used as the heavy chain vector.
CH88-3
The procedures used to sequentially transform the Sp2/0 plasmacytoma cells in the construction of CH88-1 were repeated with the exception that 20 μg of p83-γ3, was used as the heavy chain vector.
CH88-4
The procedures used to sequentially transform the Sp2/0 plasmacytoma cells in the construction of CH88-1 were repeated with the exception that 20 μg of p83-γ4, was used as the heavy chain vector.
Generation of Clones Producing Chimeric 84 Antibody
Because of the high degree of sequence similarity between the heavy chain variable regions of CC49 and CC83, chimeric antibodies were generated whose light and heavy chains were derived from different parents by mixed targeted transformations. To generate both “mixed” combinations, the chimeric heavy chain γ1 isotype vectors of CC49 and CC83 were electroporated into the chimeric light chain targets 83-K34-10 and 49K-13-13 respectively. The resulting cell lines were designated CH48-1 and CH84-1, where the first numerical designation represents the heavy chain and light chain parents, respectively. For example, CH48-1 represents the γ1 isotype with the heavy chain derived from CC49 and the light chain derived from CC83.
The CH48-1 composite antibody did not bind to TAG-72. This was not due to the inability to make chimeric antibody, since most drug-resistant cell lines produced chimeric IgG (as determined by ELISA analysis using Goat Anti-Human Ig trap with Goat Anti-Human IgG-Alkaline Phosphatase as a probe). If any binding affinity were present, it was significantly less than that observed for the first generation antibody B72.3, which was approximately an order of magnitude less affinity for TAG-72 than either CC49 or CC83. Surprisingly, CH84-1 bound to TAG-72 with affinity similar to both parents.
Competition studies were undertaken to determine the specificity of this new mixed-antibody, CH84-1. It should be noted that both CC49 and CC83 exhibit some competitive recognition for the TAG-72 antigen. It was found that CH84-1 competed more with CC49 for binding to TAG-72 than it did with CC83. This would indicate that the specificity for binding to TAG-72 lies in the light chain.
Human γ2, -3, and -4 isotypes were also generated with this mixed-antibody, producing CH84-2, CH84-3, CH84-4 clones.
CH84-1
The procedure used to sequentially transform the Sp2/0 plasmacytoma cells in the construction of CH44-1 were repeated with the following exception:
49K-13-13 cells demonstrating production of CH44 light chain by cytostaining were then transformed as described in the transformation of CH44-1, with the exception that 20 μg of p83γ1-2.3, the pSV2gpt vector which contains the CH83 heavy chain gene was substituted for p49γ1-2.3, the pSV2gpt vector which contains the CH44 heavy chain gene.
CH84-2
The procedures used to sequentially transform the Sp2/0 plasmacytoma cells in the construction of CH84-1 were repeated with the exception that 20 μg of p83-γ2, was substituted for p83γ1-2.3.
CH84-3
The procedures used to sequentially transform the Sp2/0 plasmacytoma cells in the construction of CH84-1 were repeated with the exception that 20 μg of p83-γ3, was substituted for p83γ1-2.3.
CH84-4
The procedures used to sequentially transform the Sp2/0 plasmacytoma cells in the construction of CH84-1 were repeated with the exception that 20 μg of p83-γ4, was substituted for p83γ1-2.3.
Purification of Recombinant Antibodies
Cells expressing the chimeric antibodies were removed by centrifugation from the culture medium and the medium was filtered through a 0.2 μm filter. Chimeric antibodies were purified in two steps from culture supernatants. In the first step of the purification, a protein A affinity cartridge (Nygene Corporation, Yonkers, N.Y., USA) was utilized according to the manufacturer's specifications. Up to 1.0 L of culture supernatant was passed through a 1 mg capacity cartridge, at 5 mL/min. The cartridge was washed with phosphate buffered saline (PBS) to remove traces of albumin. The chimeric antibody was recovered by elution with 0.1 M sodium nitrate buffer, pH 3.0. The pH of the fractions containing the chimeric antibody were immediately adjusted to neutrality with a 1M solution of TRIZMA base (Sigma Chemical Co., St. Louis, Mo.). Final purification was achieved from this solution, after concentration on an Amicon CENTRICON 30 unit, by gel filtration using a Pharmacia SUPEROSE 12 HR 16/50 column as specified by the manufacturer (Pharmacia, Piscataway, N.J., USA).
As seen in FIG. 38, three samples were run on an SDS polyacrylamide gel. The first sample was 2 μg of a mixture of molecular weight standards consisting of bovine serum albumin (66.2 kilodaltons (Kd)) and soybean trypsin inhibitor (21.5 Kd), commercially available from Biorad. The second sample consisted of 2 μg of purified CC49. The third sample was 2 μg of purified CH-44-1. The samples were loaded in 3 lanes of the gel, and electrophoresis was carried out at constant current (30 milliamperes (mA)) for a period of about 4 hours. The gel was stained with Coomassie Brilliant Blue R-250 for about 1 hour and subsequently destained. Note the variation in size among the CH-44-1 heavy (H) and light (L) chains compared to the corresponding chains of CC49.
Chimeric Antibody—Producing Cell Lines
Simultaneous detection of heavy and light chains was accomplished using two probe antibodies:
1) Goat anti-human kappa labeled with the fluorescing dye FITC and;
2) Goat anti-human IgG labeled with the fluorescing dye TRITC.
Cell lines having positive responses for both heavy and light chains were tested further for associated chimeric immunoglobulin production and biological activity viz. binding to TAG-72.
Enzyme-linked Immunoassays (ELISA)
In order to select a transformed cell producing a chimeric monoclonal antibody, the ELISA technique was employed. Clones containing the heavy chain and light chain drug selection constructs were selected by their growth in selective culture medium. The following cell lines were tested (1) CH44-1: A cell line having CC49 VH, CC49 VL, and constant region of IgG1; (2) CH44-2: A cell line having CC49 VH, CC49 VL, and constant region of IgG2; (3) CH44-4: A cell line having CC49 VH, CC49 VL, and constant region of IgG4; (4) CH88-1: A cell line having CC83 VH, CC83 VL, and constant region of IgG1; (5) CH88-2: A cell line having CC83 VH, CC83 VL, and constant region of IgG2; (6) CH88-3: A cell line having CC83 VH, CC83 VL, and constant region of IgG3; (7) CH88-4: A cell line having CC83 VH, CC83 VL, and constant region of IgG4; (8) CH84-1: A cell line having CC83 VH, CC49 VL, and constant region of IgG1; (9) CH84-2: A cell line having CC83 VH, CC49 VL, and constant region of IgG2; (10) CH84-3: A cell line having CC83 VH, CC49 VL, and constant region of IgG3; and (11) CH84-4: A cell line having CC83 VH, CC49 VL, and constant region of IgG4.
Supernatants of these cultures were subjected to ELISA. The presence of chimeric anti-TAG-72 antibody was measured directly by reaction of an excess of goat anti-human IgG antibody labeled with an enzyme such as alkaline phosphatase, after allowing the chimeric anti-TAG-72 antibody to bind to microtiter wells coated with antigen (TAG-72). Anti-TAG-72 activity was determined as a criterion for successful recombination.
After growth for 14 days, 50 μl of supernatant was removed from the wells of the subcloned cells and re-assayed for TAG binding by ELISA. Samples of supernantants (50 μl) from drug resistant cell lines were applied to wells of IMMULON 96-well polystyrene NUNC plates (from Dynatech Laboratories, Inc., Alexandria, Va., now Dynex Technologies, Inc., Chantilly, Va.) which had previously been coated with TAG antigen (1/50 dilution). After washing to remove unbound material, the wells were incubated with Goat Anti-Human IgG antibodies conjugated with Alkaline Phosphatase (GAHIgG-AP) as a probe to detect the human constant regions of the chimeric antibodies which had bound to the TAG antigen immobilized on the plate. Another washing to remove unbound probe (GAHIgG-AP), followed by addition of a chromogenic alkaline phosphatase substrate, allowed color to develop in those wells which possessed TAG binding associated with human constant regions (i.e., chimeric anti-TAG-72 antibodies). Absorbance readings at 405 nm indicate the relative amount of chimeric antibody produced by the drug-resistant cell lines.
CH44-1
Anti-TAG-72 activity was used as a criterion for successful recombination. Wells of microtiter plates were coated with TAG by incubating 50 μl of a 1:75 dilution of purified TAG-72 (Muraro et al., Cancer Research, 48:4588-4596 (1988)) for 18 hours at room temperature. The wells were then washed 4 times with phosphate buffered saline (PBS), and then blocked with BSA, by incubating 50 μl of 0.5 percent BSA in PBS for 2 hours at 37° C., followed by washing 4 times with PBS. These plates are stable if kept moist at 4° C. 50 μl of a sample are then applied to each well. A blank containing fresh medium is used as a control. All of the samples were incubated either in the plate for 90 minutes at 37° C. or overnight at 40° C. in a closed container.
The plates were then washed 4 times with PBS, and goat anti-human IgG-alkaline phosphatase (Southern Biotech Assoc.) was applied to each well by adding 50 μl of a 1:250 dilution. The solution was incubated at 37° C. for 90 minutes. Color development was monitored after washing the plates 4 times with PBS to remove the probe.
The substrate was incubated in 200 μl solution of substrate p-nitrophenyl phosphate (Kirkegaard & Perry) in ethanolamine buffered saline for 6 minutes at room temperature for color development. The optical density at 405 nm of each well was read by a DYNATECH microplate reader (Dynatech Corp., Boston, Mass.).
The Sp2/0 colonies in wells with supernatants having TAG-72-binding chimeric antibody activity were subcloned by limited dilution. Individual subclones were chosen on the basis of relatively high production of chimeric antibody.
CH44-2
The TAG-ELISA procedure used with CH44-1 was repeated with the exception that the antibody was CH44-2.
CH44-3
The TAG-ELISA procedure used with CH44-1 was repeated with the exception that the antibody was CH44-3.
CH44-4
The TAG-ELISA procedure used with CH44-1 was repeated with the exception that the antibody was CH44-4.
CH88-1
The TAG-ELISA procedure used with CH44-1 was repeated with the exception that the antibody was CH88-1.
CH88-2
The TAG-ELISA procedure used with CH44-1 was repeated with the exception that the antibody was CH88-2.
CH88-3
The TAG-ELISA procedure used with CH44-1 was repeated with the exception that the antibody was CH88-3.
CH88-4
The TAG-ELISA procedure used with CH44-1 was repeated with the exception that the antibody was CH88-4.
CH84-1
The TAG-ELISA procedure used with CH44-1 was repeated with the exception that the antibody was CH84-1.
CH84-2
The TAG-ELISA procedure used with CH44-1 was repeated with the exception that the antibody was CH84-2.
CH84-3
The TAG-ELISA procedure used with CH44-1 was repeated with the exception that the antibody was CH84-3.
CH84-4
The TAG-ELISA procedure used with CH44-1 was repeated with the exception that the antibody was CH84-4.
CH48-1
The TAG-ELISA procedure used with CH44-1 was repeated with the exception that the antibody was CH48-1.
Generation of an Immunoglobulin Containing the Murine VHαTAG Germline Variable Region
The following examples are set forth to provide a skilled artisan with a reproducible technique for preparing an antibody having a VH region encoded by a DNA sequence derived from VHαTAG.
Isolation of VHαTAG, Germline Gene
The procedures used to isolate the germline precursor gene to the heavy chain variable regions of CC46, CC49, CC83, and CC92 were essentially as outlined in Sambrook et al., supra. The DNA used to generate the LAMBDA-ZAP genomic DNA library (Stratagene, La Jolla, Calif., USA) came from an irrelevant hybridoma cell line, i.e., a cell line which produces antibodies that do not appreciably bind to TAG-72.
Total hybridoma cell, BALB/c mouse kidney cells and NS-1 plasmacytoma cell genomic DNA was isolated according to the procedures set forth in Sambrook et al., supra.
Generally, about 10-20 μg of the extracted DNA from each cell line was digested to completion with 80 units of Bam HI, Eco RI, Hind III, Spe I, Xba I, Sac I, Bgl II, and Pst I in 50-100 μl of a reaction mixture containing the appropriate reaction buffer at 37° C. overnight.
The genomic DNA digests were subjected to the Southern hybridization technique, developed by Southern, J. Mol. Biol., 98:503-517 (1975). The DNA fragments were fractionated on the basis of their size by means of electrophoresis on a 0.8 percent agarose gel. The double-stranded DNA fragments were modified into single-stranded DNA fragments in an alkali solution; a nitrocellulose filter was then placed into close contact with the gel to transfer the modified DNA segments onto the filter in the presence of a high salt concentration solution.
Hybridization was carried out using, as the probe a 250 base pair (bp) Eco RI-Nco I fragment containing 200 bp of 5′ flanking sequence and 50 bp of 5′ nontranslated sequence from the CC49 VH gene. The probe was designated f49RN.
The probe was radiolabeled using 32P α dCTP obtained from Amersham, Arlington Heights, Ill., USA, and the Oligolabeling kit obtained from Pharmacia, Piscataway, N.J., USA.
The results of the Southern hybridization technique indicated that two Hind III fragments were common among all three cell lines. A Hind III genomic library was generated from the hybridoma cell line DNA.
Approximately 900,000 plaques was screened from which one positive clone was isolated. The positive clone was named pVHαTAG-1. pVHαTAG-1 was about 5.2 kb, and the size of the DNA insert was determined by restriction enzyme mapping to be about 2.2 kb.
DNA Sequence of VHαTAG
The following oligonucleotide primers were used for determining the DNA sequence of VHαTAG:
B72.3/CC92 HC-20 mer (SEQ ID NO:24):
5′-CCTTGAACTTCTCATTGTAC-3′;
CC49/CC83 HC 5′(+) (SEQ ID NO:41):
5′-GCACTGCTCATGATATGCAAATC-3′;
CC49/CC83 HC 5′(−) (SEQ ID NO:42):
5′-GATTTGCATATCATGAGCAGTGC-3′;
VHαTAG-1 IVS (+) (SEQ ID NO:47): 5′-CTAAAGTGGAGTCAGGGCCTG-3′;
VHαTAG-1 IVS (−) (SEQ ID NO:48): 5′-CAGGCCCTGACTCCACTTTAG-3′;
VHαTAG-1 CDR2 (+) (SEQ ID NO:49): 5′-GAATGGATTGGATATATTTCTC-3′.
The nucleotide sequences of VHαTAG and CC46 VH, CC49 VH, CC83 VH and CC92 VH are set forth in FIGS. 2A-2G. The extent of sequence identity in the 5′ nontranslated region proves that these CC antibodies are derived from a common germline gene. FIGS. 2A-2G show where somatic mutations have been introduced into the productively rearranged subset members. The predicted amino acid substitutions ascribed to those somatic mutations are shown in FIGS. 3A-3E.
Components for an Expressible VHαTAG Heavy Chain Gene
A mouse-human chimeric antibody molecule can be generated which contains the murine VHαTAG germline heavy chain variable region, a light chain variable region that is complementary to the VHαTAG VH, such as either the CC49 or CC83 murine light chain variable region, and human constant regions.
The 2.2 kb Hind III germline DNA fragment containing the VHαTAG VH exon sequence is used as a template to obtain a functionally rearranged VHαTAG variable region. The murine genomic J-Cμ intron region is used as a source for the murine heavy chain enhancer sequences. This latter region is obtained from the plasmid pNP9 (see example “Isolation of CC49 Heavy Chain Variable Region”, above). FIG. 39 shows the overall reaction for the engineering of hybrid genes based on the method of Horton et al., (1989), supra. Four oligonucleotides (oligos) are designed to be used in enzymatic amplification and modification of the target DNA. Oligo 1 anneals to the 5′ end of VHαTAG spanning the Eco RI site which is 249 bp 5′ to the ATG initiation codon. Oligo 2 anneals to sequences complementary to the 3′ end of the VHαTAG exon and also contains sequences coding for a D segment. The D segment sequences in oligo 2 do not anneal with any VHαTAG sequences. Oligo 3 contains sequences complementary to the 5′ end of the murine genomic J-Cμ region and incorporates sequences encoding the D segment (same as in oligo 2) and the J segment. Oligo 4 anneals to the 3′ end of the J-Cμ region and contains sequences complementary to the EcoRI site located 1219 bp 3′ to J H4. The sequence of these oligos follow:
Oligo 1 (SEQ ID NO:50) 5′ GTCTAGAATTCATAAAAACTTTATG
5′ GTCTAGAATTCATAAAAACTTTATG (25 mer)
Oligo 2 (SEQ ID NO:51)
CAGTGTATTTCTGTAAAAGATCTACTATGGTTACG (35 mer)
Oligo 3 (SEQ ID NO:52)
5′  TCTACTATGGTTACG TGGGGTCAAGGAACCTCAGTCACC
GTCTCCTCAGGTAAGAATGGCCTCTCCAGGTCT
3′ (72 mer)
Oligo 4 (SEQ ID NO:53) 5′ ACTTCTAAAATGTATTTAGAATTCATTTTC 3′
In this example, the D sequence is SP2.3 taken from the published sequence of Kurosawa and Tonegawa, J. Exp. Med., 155:201 (1982). The D sequence is shown in bold face type in oligos 2 and 3. Any other characterized murine or human D segment can be used by substituting their sequence in these positions of oligo 2 and 3.
The J segment in oligo 3 is underlined. It is the murine J H4 taken from the published sequence of Gough and Bernard, Proc. Natl. Acad. Sci. (USA), 78:509 (1981). The inclusion of any other murine or human J segment can be made by substituting their sequences for the sequence of J H4 in oligo 3.
In oligo 1 and 4 the Eco RI sites (GAATTC) are shown in italics.
Assembly of Intact VHαTAG Genes
Two separate DNA amplification reactions are performed using the components described above. DNA amplification reaction #1 copies the VHαTAG sequence and adds a D segment to its 3′ end. DNA amplification reaction #2 copies the murine intron sequences containing the heavy chain enhancer sequences and adds the D and J segments encoded within oligo 3. The amplified products from reaction 1 and 2 are gel purified, combined and oligos 1 and 4 are added to initiate reaction #3. In reaction 3, the products of reactions 1 and 2 anneal across their common D sequences. Subsequent DNA amplification from oligos 1 and 4 yields the product shown at the bottom of FIG. 39. This fragment is digested with Eco RI and gel purified. The modified VHαTAG fragment is ligated into the Eco RI site of pSV2gpty1(2.3) as described in the example “Heavy Chain Chimeric Constructs”, above. The entire VHαTAG-D-J-enhancer containing fragment is sequenced completely to ensure that no mutations have been introduced during the DNA amplification reactions. The other three heavy chain γ isotypes can be generated by ligating the same modified VHαTAG fragment into the other three γ containing pSV2gpt vectors (pSV2gpt-γ2; pSV2gpt-γ3; pSV2gpt-γ4).
Expression of the Modified VHαTAG Gene
The modified VHαTAG gene containing plasmids can be linearized with NdeI and introduced via electroporation into the chimeric CC49 or CC83 light chain expressing cell lines (see example “C. Targeted Transformations”, above). The transformed cells are selected for growth in the presence of GENETICIN aminolgycoside and mycophenolic acid as outlined above in “C. Targeted Transformations”. The presence of expressed antibody is monitored by TAG-72 ELISA (see section in RESULTS, Enzyme-Linked Immunoassays (ELISA)). The expressed antibody from these cells will contain human Ig γ1, κ constant regions with the CC49 or CC83 light chain variable region and a heavy chain variable region from the modified VHαTAG germline VH exons.
Four examples of modified VHαTAG heavy chain variable region constructs having a variety of D and J segments are shown below:
VH Segment D Segment J Segment
VHαTAG #i mouse D (SP2.3) mouse J
VHαTAG #ii human D (D1) mouse J
VHαTAG #iii mouse D (SP2.3) human J
VHαTAG #iv human D (D1) human J
The sequence of the human D sequence D1 is obtained from Siebenlist et al., Nature, 294:631 (1981). The sequence of the human J H1 is obtained from Ravetch et al., Cell, 27:583 (1981).
The generation of VHαTAG #i is described with the above diagramed oligos 1 through 4. To generate VHαTAG #ii through #iv the corresponding D and J segments need to be changed in oligos 2 and 3. The following oligos delineate these changes. Substitution of these oligos in reaction #1 and reaction #2 will result in the generation of the VHαTAG #ii through #iv.
VHαTAG #ii
Oligo 2 (SEQ ID NO:54)
5′ CAGTGTATTTCTGTAAAAGAGTACTGGTGGT (35
GTAT 3′ mer)
Oligo 3 (SEQ ID NO:55)
5′ GTACTGGTGGTGTAT TGGGGTCAAGGAACC (72
TCAGTCACCGTCTCCTCAGGTAAGAATGGCCT mer)
CTCCAGGTCT 3′
VHαTAG #iii
Oligo 2 (SEQ ID NO:51)
5′ CAGTGTATTTCTGTAAAAGATCTACTATGG (35
TTACG  3′ mer)
Oligo 3 (SEQ ID NO:56)
5′ TCTACTATGGTTACG TGGGGCCAGGGCAC (72
CCTGGTCACCGTCTCCTCAGGTAAGAATGGCC mer)
TCTCCAGGTCT 3′
VHαTAG #iv
Oligo 2 (SEQ ID NO:54)
5′ CAGTGTATTTCTGTAAAAGAGTACTGGTG (35
GTGTAT 3′ mer)
Oligo 3 (SEQ ID NO:57)
5′ GTACTGGTGGTGTAT TGGGGCCAGGGCAC (72
CCTGGTCACCGTCTCCTCAGGTAAGAATGGC mer)
CTCTCCAGGTCT 3′
Probing for Additional Subset Members of VHαTAG
Based on the sequence information deduced from FIG. 2, a nucleic acid probe was designed to hybridize with the 5′ nontranslated region of all heavy chain variable region mRNAs derived from VHαTAG. The hybridization probe was isolated from the heavy chain variable region gene of CC49 as an Eco RI-Nco I restriction enzyme digested fragment.
Fifty micrograms of a plasmid containing the gene encoding the heavy chain variable region of CC49 were digested with 40 units of Eco RI [Bethesda Research Laboratories, Gaithersburg, Md., USA, (BRL)] and 21 units of Nco I [BRL]. The digested DNA was fractionated on a 4 percent polyacrylamide gel and the 250 base pair fragment containing the 5′ nontranslated sequence was purified by electroelution [Sambrook et al., supra]. The 248 bp fragment was designated f49RN and it contained 52 base pairs of 5′ nontranslated sequence and 196 base pairs of 5′ gene flanking sequence. The sequence of f49RN (SEQ ID NO:58) follows:
5′-AATTCATAAAAACTTTATGGGATACATTTCCTCAGAGAGGAATAGGATTTGGA CCTGACGATCCTGCTGCCCGAGCCATGTGATGACAGTTCTTCTCCAGTTGAACTAG GTCCTTATCTAAGAAATGCACTGCTCATGAATATGCAAATCACCCGAGTCTATGGC AGTAAATACAGAGATGTTCATACCATAAAAACAATATGTGATCAGTGTCTTCTCCG CTATCCCTGGACACACTGACTCTAACC-3′
The underlined sequence corresponds to the 5′ nontranslated sequence. f49RN was recloned into pBLUESCRIPT SK(−) (Stratagene, La Jolla, Calif., USA). The cloned insert was sequenced and shown to be a 496 base pair doublet of f49RN. This insert fragment was designated f49-5′.
Fragment f49-5′ was radiolabeled using a Pharmacia Oligolabelling Kit (Pharmacia LKB Biotechnology, Piscataway, N.J., USA). One hundred nanograms of DNA in 20 μl sterile deionized water (dH20) was denatured at 90° C. for 15 minutes, then incubated at 37° C. for 5 minutes before being placed on ice. Twelve microliters of the Pharmacia reagent mix, 2 μl BSA (3 mg/ml) about 70-80 μCi 32P α-dCTP and 2.5 μl of Klenow fragment were added and the reaction incubated for about 6 hours at room temperature. The reaction was terminated by addition of 20 μl Stop reagent. The P32-labeled f49-5′ was seperated from free isotope on a G50 NICK column (Pharmacia LKB Biotechnology, now Pharmacia Biotechnology AB, Uppsala, Sweden) equilibrated in 10 mM Tris-HCl, 1 mM EDTA, pH 8.0 (TE buffer). Radiolabeled probe was used within 5 days of preparation.
Test Medium:
A novel library of antibodies was prepared by immunizing mice against immunoaffinity purified TAG-72. Members of this library, designated as the AHC series, were examined for the presence of VH encoded by DNA derived from VHαTAG.
Three to four week old BALB/c female mice were immunized with immunoaffinity purified TAG-72. Emulsions of Freund's complete or incomplete adjuvants (Sigma Chemical Company, St. Louis, Mo., USA) were prepared using equal volumes of the adjuvant and immunogen.
The mice were sacrificed by cervical dislocation and the spleens or popliteal lymph nodes removed aseptically. Single cell suspensions of the spleens or nodes were prepared by expelling the cell mass from the sac with syringe needles. The lymphocytes were washed with sterile PBS twice. The lymphocytes were mixed in a ratio of 4:1 (1:1 in the case of the lymph nodes) with plasmacytoma cells from the line P3X63-Ag8.653 (ATCC CRL158) in PBS and fused with 45 percent (v/v) polyethylene glycol (molecular weight 3700). After fusion the cells were plated out at between 5×105 to 5×106 nucleated cells per ml in 96 well plates using RPMI-1640 medium containing L-glutamine (2 mM), sodium pyruvate (1 mM), penicillin (50 units/ml) and streptomycin (50 μg/ml). The medium was supplemented with 8.8 percent (v/v) fetal bovine serum (Hyclone Laboratories, Logan, Utah, USA) and at least 1×104 murine peritoneal exudate cells/ml). For the selection of hybrids, the medium was further supplemented with hypoxanthine-aminopterin-thymidine (Sigma Chemical Company) according to the manufacturer's instructions. The cells were incubated at 37° C. in 7 percent CO2.
Cells at mid to high densities (at least 2×105/ml) were suspended in 200 μl RPMI-1640 medium and plated in 96 well tissue culture plates. After settling, half the medium was removed and replaced with 100 μl of a lysis buffer containing 5.0 M KSCN and 50 percent v/v DMSO (both obtained from the Sigma Chemical Company). RNA from the lysates was adsorbed onto OPTIBIND nitrocellulose paper (Schleicher and Schuell, Keene, N.H., USA) pre-wetted with 20×SSC (20× saline sodium citrate buffer containing 3M NaCl and 0.3M trisodium citrate, pH 7.0) (Sigma Chemical Co.) using a 96 well MINIFOLD dot blot apparatus (Schleicher and Schuell, Keene, N.H.). The MINIFOLD dot blot apparatus was rinsed with 200 μl of 20×SSC and the membrane washed twice in the same buffer. The blot was dried under vacuum at 80° C. for about 2 hours. Blots could also be stored wet at −20° C. or after drying at room temperature before probing.
Blots were prehybridized in buffer containing 5×Denhardt's solution (0.1% BSA, 0.1% Ficoll, and 0.1% PVP), 5×SSPE (5×saline sodium phosphate EDTA buffer containing 0.745M NaCl, 0.05M NaH2PO4, and 0.005M disodium EDTA, pH 7.4), 100 μg/ml boiled salmon sperm (all Sigma Chemical, St. Louis, Mo., USA), 50 percent (v/v) deionized formamide (Bethesda Research Labs, Bethesda, Md., USA) and 20 percent (w/v) SDS at 42° C. for 60 minutes. For hybridization, dextran sulfate (Oncor, Gaithersburg, Md., USA) was added to 5 percent (v/v) solution. Twenty microcuries of radiolabeled probe was boiled for 5 minutes to denature the probe and then added to 20 ml hybridization buffer. The probe was allowed to hybridize overnight at 42° C. Blots were washed in 2×SSPE containing 0.1 percent SDS for 10 minutes at room temperature and 0.1×SSPE containing 0.1 percent SDS for 10 minutes at room temperature and 0.1×SSPE containing 0.1 percent SDS for 60 minutes at 42° C., wrapped in SARAN WRAP and exposed to X ray film with two enhanced screens overnight at −70° C.
The cell lysates were plated out as described above and probed with f49-5′ for the presence of RNA containing sequences from the 5′ nontranslated region of the VHαTAG germline gene. In each case, samples of an anti-TAG-72 antibody and P3X63-Ag8.653 were used as positive and negative controls, respectively. Of the 94 TAG-72 specific hybridoma lines tested, 20 demonstrated binding with the f49-5′ probe.
In order to confirm the relationship of probe binding with the VH sequence of the antibodies, Poly A+ RNA was prepared from several of these lines and sequenced.
Poly A+ RNA was prepared using the Invitrogen FASTTRACK RNA isolation kit (Invitrogen, San Diego, Calif., USA) according to the manufacturer's instructions. Alternatively, total RNA was prepared by guanidinium isothiocyanate lysis of a washed cell pellet followed by CsCl density gradient centrifugation. The Poly A+ RNA was purified using an oligo dT cellulose column (Invitrogen, San Diego, Calif., USA).
Poly A+ RNA was sequenced using AMV reverse transcriptase and dideoxy nucleotides in a protocol derived from Geleibter (1987), supra. Briefly, the priming oligonuceotides (see below) were end-labeled using T4 kinase (BRL) and 32PγATP. Between 7 and 11 μg poly A+ RNA was precipitated with ethanol and rehydrated with 10 μl annealing buffer. Five ng labeled oligonucleotide (in 1 μl) were added to the RNA and incubated in 80° C. for about 3 minutes. The temperature was then ramped back to about 50° C. and held for 15 minutes. Annealed RNA and oligonucleotides were added to enzyme and dideoxy and deoxynucleotides and incubated at 50° C. for about 50 minutes. The reaction was stopped with formamide and the samples analyzed on a 6 percent polyacrylamide/7M urea gel at 35 mAmps.
Two oligonucleotides were used for priming of the sequencing. Cγ1 is a 24 base oligonucleotide (SEQ ID NO:59) complementary to the CH1 domain of IgG1 heavy chain. Its sequence is shown below:
5′-ATGGAGTTAGTTTGGGCAGCAGAT-3′
A second oligonucleotide, DC113 (SEQ ID NO:60), complementary to the Framework 2 region of the germline gene VHαTAG, was prepared and has the following sequence:
5′-TCCAATCCATTCCAGGCCCTGTTCAGG-3′
All oligonucleotides were prepared on Model 380A DNA Synthesizer (Applied Biosystems Inc., Foster City, Calif., USA) and gel purified before use. The partial sequences obtained from four AHC hybridomas which bound the probe are shown in FIGS. 42A-42B (SEQ ID NO:61 for VHαTAG; SEQ ID NO:62 for AHC46; SEQ ID NO:63 for AHC121; SEQ ID NO:64 for AHC139; and SEQ ID NO:65 for AHC160).
The procedures set forth above in screening the AHC library with a DNA probe are repeated with the exception that the probe is RNA generated by in vitro transcription of the mRNA in the f49-5′ insert. Screening of the AHC library confirms the results obtained above with screening the AHC library with a DNA probe.
Constant Region-modified Antibodies
The following examples are provided to show that the variable regions of subset members can be expressed with modified constant regions. The smaller of these molecules resemble enzymatically derived Fab and F(ab′)2. The larger molecule (CH3-minus) is intermediate in size between a F(ab′)2 and a full-sized antibody. The respective molecular weight are ⅓, ⅔ and ⅚ of a full-sized antibody (150,000 daltons).
The heavy chains were modified by successively removing the CH3, CH2, and hinge domains of the human γ1 and γ3 constant region genes used in the expression of chimeric antibodies. For a discussion of the human γ1, see Ellison et al. (1982), supra; Takahashi et al. (1982), supra. For a discussion of human γ3, see Krawinkel et al. (1982), supra, and Takahashi et al., supra. Because the sequence for γ1 and γ3 have been provided, it is possible to prepare oligonucleotides for PCR and obtain the genes from human DNA.
Each of the domains was removed by use of the techniques of PCR (Mullis et al. (1988), supra) and splicing by overlap extension (SOE) (Horton et al. (1989), supra). FIG. 43 illustrates the process: two DNA fragments designated y-b1 and a-x (which eliminate the desired exons between them) were generated seperately by PCR. This was accomplished by the use of short oligonucleotide primers, corresponding to each of the 5′ end (primers y and a) and 3′ end (primers b1 and x) of the fragments of interest. The unique advantage of the SOE technique is accomplished by the inclusion of a “wagging tail” on at least one side of the intended junction. This “wagging” region (designated “(a)” on each of primers b1, b2, and b3) must be complementary to the opposite strand of the intended junction. After purification, the two PCR-derived DNA (y-b1 and a-x) were mixed, denatured and reannealed over the regions of overlap derived from the “wagging tail”. By subjecting this reannealed mixture of fragments to PCR using the outermost oligonucleotide primers (primers y and x), the overlap is extended and amplified.
Each shortened construction was terminated by the last two amino acids of the C-terminus of the γ1 heavy chain. Thus, the 524 base pair DNA fragment, a-x, starts with the Gly-Lys and termination codons, and includes the polyadenylation signal plus any other sequences from the 3′ end of the fragment which may be of importance. This fragment was used as the 3′ joining fragment for all of the above constructs. Although the DNA sequence of the approximately 300 bp at the 3′ end of the fragment is not known, the PCR was performed from a 3′ primer derived from the adjacent vector sequence and included the Bam HI restriction site of the fragment.
The human γ1 heavy chain is unique in that it is covalently attached to the light chain via a disulfide bond with Cys-H233, which is located in the hinge domain, rather than via Cys-H127, found in the CH1 domains of the other heavy chains, with the exception of α1 (set forth in Kabat et al. (1987), supra). The CH1 domain of the γ3 heavy chain was chosen for the Fab construct because it contains the appropriate Cys-H127 and only three other amino acid differences, two of which are conservative changes (Lys to Arg) for an overall amino acid similarity of 96 percent.
The initial PCR resulted in an a-x fragment of 524 bp, a y-b1 fragment of 544 bp, a y-b2 fragment of 977 bp, and a y-b3 fragment of 1425 bp. The results from the SOE reaction using the 5′ and 3′ oligos (y and x, respectively) of y-b1 and a-x yields a fragment y-b1-x of 1068 bp. The results from the SOE reaction using the 5′ and 3′ oligos (y and x, respectively) of y-b2 and a-x yields a fragment y-b2-x of 1501 bp. The results from the SOE reaction using the 5′ and 3′ oligos (y and x, respectively) of y-b3 and a-x yields fragment y-b3-x of 1949 bp. Each final fragment was digested with Eco RI and Bam HI to generate compatible ends for subsequent ligation into the pSV2-gpt vector (see Gorman, DNA Cloning, Vol. II, Glover (ed.), (1985)).
The oligonucleotide primers described above have the following sequences:
x (SEQ ID NO:66): 5′-TATCTTATCATGTCTGGATCC-3′;
y (SEQ ID NO:67): 5′-GGCCCTTTCGTCTTCAAGAATTC-3′;
a (SEQ ID NO:68): 5′-GGTAAATGAGTGCGACGG-3′;
b1 (SEQ ID NO:69): 5′-CCGTCGCACTCATTTACCAACTCTCTTGTCCACCTT-3′;
b2 (SEQ ID NO:70): 5′-CCGTCGCACTCATTTACCTGGGCACGGTGGGCATGT-3′;
b3 (SEQ ID NO:71): 5′-CCGTCGCACTCATTTACCTTTGGCTTTGGAGATGGT-3′.
Thermal cycling was performed. Template and primer concentrations were 0.1-1.0 ng/ml and 1 nmole/ml, respectively, in 0.1 ml (Saiki et al., (1988), Science, 239:487-91). PCR and SOE conditions were: Denaturation-2 minutes at 92-96° C.; annealing-3 minutes at 37° C. to 50° C.; extension for 10 minutes at 71-74° C. (30 cycles).
After phenol/chloroform extraction and ethanol precipitation of the SOE reactions, the fragments were digested with Eco RI and Bam HI and gel purified (Maniatis, et al. (1982), supra). Each fragment was ligated with the Eco RI/Bam HI fragment of the SV2-gpt vector. These vectors are able to accept any VH fragment with Eco RI ends. The 1.9 kb Eco RI fragment containing the CC49 VH was ligated into the Eco RI site of each of the shortened heavy chain vectors and clones analyzed by Nco I digestion for correct orientation of the VH fragment.
Electroporation Selection and Expression
Each of the chimeric CC49 shortened heavy chain vectors was linearized with Nde I and electroporated into target cells which express the chimeric CC49 light chain. TAG-72 binding activity in the medium of mycophenolic acid (MPA)-resistant colonies was detected by ELISA with alkaline phosphatase-conjugated goat anti-human kappa antibody (Southern Biotechnology Associates, Inc., Birmingham, Ala., USA). The vector containing the 49VH fragment alone (p49VH-gpt) was also electroporated into target cells (SP2/0) which do not express light chain or heavy chain (Shulman et al., Nature, 276:269-270 (1978)). The possible TAG-72 binding activity produced by these MPA-resistant colonies was measured by competition ELISA. Colonies with positive TAG-72 ELISA activity were expanded to 24-well plates, subcloned, and selected.
Three of the cell lines were designated Ch44-CH3: a constant region of the human γ1 heavy chain with a removed CH3 domain (the sequence of which is set forth in FIG. 44 (SEQ ID NO:72)); Ch44-F(ab′)2: a constant region of the human γ1 heavy chain with removed CH2 and CH3 domains (the sequence of which is set forth in FIG. 45 (SEQ ID NO:73)) and Ch44-Fab: a constant region of the human γ3 heavy chain with a removed hinge region and CH2 and CH3 domains (the sequence of which is set forth in FIG. 46 (SEQ ID NO:74)).
Results
In Vivo Carcinoma Targeting
The chimeric monoclonal antibodies used in animal studies and shown in Tables 1-4 below were labeled with Na125I using IODO-GEN iodination reagent (Pierce Chemical, Rockford, Ill., USA). More specifically, from about 0.5-2 mg of purified chimeric monoclonal antibodies were adjusted to about 0.5 mL with 0.1 M sodium phosphate buffer (pH 7.2) and then added to a 12 cm×75 cm glass tube coated with 50 μg of IODO-GEN iodination reagent followed by addition of from 0.1-0.5 mCi of Na125I (New England Nuclear, Boston, Mass., USA). After a 2 minute incubation at room temperature, the protein was removed from the insoluble IODO-GEN iodination reagent, and the unincorporated 125I was separated from the antibody by gel filtration through a 10 mL column SEPHADEX G-25 (from Pharmacia, Inc., Piscataway, N.J.) using PBS as the buffer. The iodination protocol yielded labeled IgG chimeric antibody with a specific activity of 0.05 to 0.2 μCi/μg.
Female athymic mice (nu/nu) on a CD1 background were obtained from Charles River at approximately 4 weeks of age. Nine days later, mice were inoculated subcutaneously (0.1 mL/mouse) with LS174T cells (1×106 cells/animal).
Athymic mice bearing carcinomas 70 to 400 mg in weight, approximately 12 to 13 days after inoculation of the cells were given injections intravenously of from 0.5 to 2.0 μCi (10-50 μg protein) in PBS of the chimeric monoclonal antibodies, which had been iodinated as described above. Groups of five mice were sacrificed at varying times by exsanguination, the carcinoma and normal tissues were excised and weighed, and the cpm were measured in a gamma counter. The cpm/mg of each tissue was then determined and compared to that found in the carcinoma.
The results for CH44-1 are shown in Tables 1-2, and FIGS. 40A, 40B, and 40C. The results for CH84-1 are shown in Tables 3-4, and FIGS. 41A and 41B.
TABLE 1
Percent Injected Dose Per Gram
of 125I-Labeled Antibody
CH44-1
0.75 23.5 49.5 122
Tissue Hour Hours Hours Hours
blood, total 29.70 15.84 8.09 7.31
Liver 8.13 4.13 2.19 1.96
Spleen 6.19 3.39 2.12 1.36
Kidney 4.35 2.80 1.52 1.33
Tumor 3.31 25.95 28.83 44.16
Lung 7.34 5.39 2.90 2.36
Tumor, wt 0.18 0.12 0.09 0.11
As shown in Table 1, at approximately 122 hours post-injection, the percent injected dose to tumor for CH44-1 was 44.16 percent. CH44-1 was, therefore, efficient in targeting the human tumor in situ. This demonstrates that the chimeric monoclonal antibodies of the present invention were efficient for in vivo carcinoma targeting and thus are useful for in vivo treatment of cancer.
TABLE 2
Percent Injected Dose Per Organ
of 125I-Labeled Antibody
CH44-1
0.75 23.5 49.5 122
Tissue Hour Hours Hours Hours
blood, total 47.72 23.03 13.29 12.01
Liver 10.97 5.20 3.20 2.69
Spleen 1.09 0.48 0.25 0.22
Kidney 1.25 0.72 0.42 0.40
Tumor 0.57 3.08 2.82 4.55
Lung 1.20 0.87 0.57 0.37
GI tract 6.64 4.78 3.96 2.83
Carcass 43.17 49.68 35.35 29.95
Whole body 91.30 76.34 53.28 46.20
retention
As shown in Table 2, at 122 hours post-injection, the percent of injected dose to tumor for CH44-1 was 4.55 percent. CH44-1 was, therefore, efficient in targeting the human tumor in situ. This demonstrates that the chimeric monoclonal antibodies of the present invention were efficient for in vivo carcinoma targeting and thus were useful in in vivo treatment of cancer.
TABLE 3
Percent Injected Dose Per Gram
of 125I-Labeled Antibody
CH84-1
1 23 47 118-119
Tissue Hour Hours Hours Hours
blood 30.68 15.65 6.74 6.49
Liver 12.55 4.26 2.35 1.57
Spleen 10.93 3.35 2.56 1.70
Kidney 5.59 2.51 1.53 1.55
tumor 4.06 20.52 17.58 30.27
lung 10.77 4.80 2.58 2.24
Tumor, wt. 0.15 0.22 0.20 0.24
As shown in Table 3, at approximately 118 hours post-injection, the percent of injected dose to tumor for CH84-1 was 30.27 percent. CH84-1 was, therefore, efficient in targeting the human tumor in situ. This demonstrates that the chimeric monoclonal antibodies of the present invention were efficient for in vivo carcinoma targeting and thus were useful in in vivo treatment of cancer.
TABLE 4
Percent Injected Dose Per Organ
of 125I-Labeled Antibody
CH84-1
1 23 47 118-119
Tissue Hour Hours Hours Hours
Blood, total 45.98 22.11 10.08 9.37
Liver 13.64 5.34 3.13 1.94
Spleen 1.35 0.49 0.32 0.16
Kidney 1.39 0.62 0.38 0.38
tumor 0.59 4.33 3.63 7.02
lung 1.77 0.69 0.42 0.31
GI tract 7.38 4.92 3.41 2.32
carcass 44.83 52.19 30.32 24.06
Whole body 93.58 81.00 47.14 45.48
retention
As shown in Table 4, at approximately 118 post-injection, the percent of injected dose to tumor for CH84-1 was 7.02 percent. CH84-1 was, therefore, efficient in targeting the human tumor in situ. This demonstrates that the chimeric monoclonal antibodies of the present invention were efficient for in vivo carcinoma targeting and thus were useful in in vivo treatment of cancer.
Deposit of Cell Lines Producing Chimeric Antibodies
Eleven illustrative cell lines secreting chimeric antibodies, all having kappa light chains, made by the above examples were deposited at the American Type Culture Collection (ATCC) on Oct. 19, 1988. Specifically, the following cell lines have been deposited: (1) CH44-1 (ATCC No. HB 9884); (2) CH88-2 (ATCC No. HB 9880); (3) CH44-4 (ATCC No. 20 9877); (4) CH88-1 (ATCC No. 9882); (5) CH44-2 (ATCC No. 9881); (6) CH88-3 (ATCC No. 9876); (7) CH88-4 (ATCC No. 9874); (8) CH84-1 (ATCC No. 9883); (9) CH84-2 (ATCC No. 9879); (10) CH84-3 (ATCC No. 9878); (11) CH84-4 (ATCC No. 9875); (12) CH44-Fab (ATCC HB 10428); (13) Ch44-F(ab′)2 (ATCC No. 10429); and (14) Ch44-CH3 (ATCC No. 10430).
SEQUENCE LISTING
<160> NUMBER OF SEQ ID NOS: 74
<210> SEQ ID NO 1
<211> LENGTH: 982
<212> TYPE: DNA
<213> ORGANISM: Mus musculus
<220> FEATURE:
<221> NAME/KEY: CDS
<222> LOCATION: 384..429, 509..813
<221> NAME/KEY: sig_peptide
<222> LOCATION: 384..429, 509..519
<221> NAME/KEY: mat_peptide
<222> LOCATION: 520..813
<400> SEQUENCE: 1
ccttctcttc ctccaccacc aaatccacca tttgtaaatc aacatgttaa catatcacag 60
agtggagcaa cagaatcagg gcaaaaatat gctgagagat ttatccctgt cgttacaacc 120
aaagcatctg tctagaattc ataaaaactt tatgggatac atttcctcag agaggaatag 180
gatttggacc tgacgatcct gctgcccgag ccatgtgatg acagttcttc tccagttgaa 240
ctaggtcctt atctaagaaa tgcactgctc atgaatatgc aaatcacccg agtctatggc 300
agtaaataca gagatgttca taccataaaa acaatatatg atcagtgtct tctccgctat 360
ccctggacac actgactcta acc atg gaa tgg agc tgg gtc ttt ctc ttc 410
Met Glu Trp Ser Trp Val Phe Leu Phe
-19 -15
ttc ctg tca gta act aca g gtaaggggct caccatttcc aaatctaaag 459
Phe Leu Ser Val Thr Thr
-10 -5
tggagtcagg gcctgaggtg acaaagatat ccactttggc tttccacag gt gtc 513
Gly Val
-3
cac tcc cag gtt cag ctg cag cag tct gac gct gag ttg gtg aaa cct 561
His Ser Gln Val Gln Leu Gln Gln Ser Asp Ala Glu Leu Val Lys Pro
1 5 10
ggg gct tca gtg aag ata tcc tgc aag gct tct ggc tac acc ttc act 609
Gly Ala Ser Val Lys Ile Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr
15 20 25 30
gac cat gct att cac tgg gtg aag cag aag cct gaa cag ggc ctg gaa 657
Asp His Ala Ile His Trp Val Lys Gln Lys Pro Glu Gln Gly Leu Glu
35 40 45
tgg att gga tat att tct ccc gga aat ggt gat att aag tac aat gag 705
Trp Ile Gly Tyr Ile Ser Pro Gly Asn Gly Asp Ile Lys Tyr Asn Glu
50 55 60
aag ttc aag ggc aag gcc aca ctg act gca gac aaa tcc tcc agc act 753
Lys Phe Lys Gly Lys Ala Thr Leu Thr Ala Asp Lys Ser Ser Ser Thr
65 70 75
gcc tac atg cag ctc aac agc ctg aca tct gag gat tct gca gtg tat 801
Ala Tyr Met Gln Leu Asn Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr
80 85 90
ttc tgt aaa aga cacagtgttg taaccacatc ctgagtgtgt cagaaatcct 853
Phe Cys Lys Arg
95
gggggagcag aaagatacac tgggactgag aagacagaaa aattaatcct tagacttgct 913
cagaaatcgt aattttgaat gcctatttat ttcatcttgc tcacacacct atattgcttt 973
tgtaagctt 982
<210> SEQ ID NO 2
<211> LENGTH: 117
<212> TYPE: PRT
<213> ORGANISM: Mus musculus
<220> FEATURE:
<221> NAME/KEY: SIGNAL
<222> LOCATION: -19..-1
<221> NAME/KEY: CHAIN
<222> LOCATION: 1..98
<400> SEQUENCE: 2
Met Glu Trp Ser Trp Val Phe Leu Phe Phe Leu Ser Val Thr Thr Gly
-19 -15 -10 -5
Val His Ser Gln Val Gln Leu Gln Gln Ser Asp Ala Glu Leu Val Lys
1 5 10
Pro Gly Ala Ser Val Lys Ile Ser Cys Lys Ala Ser Gly Tyr Thr Phe
15 20 25
Thr Asp His Ala Ile His Trp Val Lys Gln Lys Pro Glu Gln Gly Leu
30 35 40 45
Glu Trp Ile Gly Tyr Ile Ser Pro Gly Asn Gly Asp Ile Lys Tyr Asn
50 55 60
Glu Lys Phe Lys Gly Lys Ala Thr Leu Thr Ala Asp Lys Ser Ser Ser
65 70 75
Thr Ala Tyr Met Gln Leu Asn Ser Leu Thr Ser Glu Asp Ser Ala Val
80 85 90
Tyr Phe Cys Lys Arg
95
<210> SEQ ID NO 3
<211> LENGTH: 865
<212> TYPE: DNA
<213> ORGANISM: Mus musculus
<220> FEATURE:
<221> NAME/KEY: CDS
<222> LOCATION: 384..429, 509..865
<221> NAME/KEY: sig_peptide
<222> LOCATION: 384..429, 509..519
<221> NAME/KEY: mat_peptide
<222> LOCATION: 520..865
<400> SEQUENCE: 3
ccttctcttc ctccaccacc aaatccacca tttgtaaatc aacatgttaa catatcacag 60
agtggagcaa cagaatcagg gcaaaaatat gctgagagat ttttccctgt cgttacaacc 120
aaagcatctg tctagaattc ataaaaactt tatgggatac atttcctcag agaggaatag 180
gatttggacc tgacgatcct gctgcccgag ccatgtgatg acagttcttc tccagttgaa 240
ctaggtcctt atctaagaaa tgcactgctc atgaatatgc aaatcacccg agtctatggc 300
agtaaataca gagatgttca taccataaaa acaatatgtg atcagtgtct tctccgctat 360
ccctggacac actgactcta acc atg gaa tgg agc tgg gtc ttt ctc ttc 410
Met Glu Trp Ser Trp Val Phe Leu Phe
-19 -15
ttc ctg tca gta act aca g gtaaggggct caccatttcc aaatctaaag 459
Phe Leu Ser Val Thr Thr
-10 -5
tggagtcagg gcctgaggtg acaaagatgt ccactttggc tgtccacag gt gtc 513
Gly Val
-3
cac tcc cag gtt cag ttg cag cag tct gac gct gag ttg gtg aaa cct 561
His Ser Gln Val Gln Leu Gln Gln Ser Asp Ala Glu Leu Val Lys Pro
1 5 10
ggg gct tca gtg aag att tcc tgc aag gct tct ggc tac acc ttc act 609
Gly Ala Ser Val Lys Ile Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr
15 20 25 30
gac cat gca att cac tgg gtg aaa cag aac cct gaa cag ggc ctg gaa 657
Asp His Ala Ile His Trp Val Lys Gln Asn Pro Glu Gln Gly Leu Glu
35 40 45
tgg att gga tat ttt tct ccc gga aat gat gat ttt aaa tac aat gag 705
Trp Ile Gly Tyr Phe Ser Pro Gly Asn Asp Asp Phe Lys Tyr Asn Glu
50 55 60
agg ttc aag ggc aag gcc aca ctg act gca gac aaa tcc tcc agc act 753
Arg Phe Lys Gly Lys Ala Thr Leu Thr Ala Asp Lys Ser Ser Ser Thr
65 70 75
gcc tac gtg cag ctc aac agc ctg aca tct gag gat tct gca gtg tat 801
Ala Tyr Val Gln Leu Asn Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr
80 85 90
ttc tgt aca aga tcc ctg aat atg gcc tac tgg ggt caa gga acc tca 849
Phe Cys Thr Arg Ser Leu Asn Met Ala Tyr Trp Gly Gln Gly Thr Ser
95 100 105 110
gtc acc gtc tcc tca g 865
Val Thr Val Ser Ser
115
<210> SEQ ID NO 4
<211> LENGTH: 134
<212> TYPE: PRT
<213> ORGANISM: Mus musculus
<220> FEATURE:
<221> NAME/KEY: SIGNAL
<222> LOCATION: -19..-1
<221> NAME/KEY: CHAIN
<222> LOCATION: 1..115
<400> SEQUENCE: 4
Met Glu Trp Ser Trp Val Phe Leu Phe Phe Leu Ser Val Thr Thr Gly
-19 -15 -10 -5
Val His Ser Gln Val Gln Leu Gln Gln Ser Asp Ala Glu Leu Val Lys
1 5 10
Pro Gly Ala Ser Val Lys Ile Ser Cys Lys Ala Ser Gly Tyr Thr Phe
15 20 25
Thr Asp His Ala Ile His Trp Val Lys Gln Asn Pro Glu Gln Gly Leu
30 35 40 45
Glu Trp Ile Gly Tyr Phe Ser Pro Gly Asn Asp Asp Phe Lys Tyr Asn
50 55 60
Glu Arg Phe Lys Gly Lys Ala Thr Leu Thr Ala Asp Lys Ser Ser Ser
65 70 75
Thr Ala Tyr Val Gln Leu Asn Ser Leu Thr Ser Glu Asp Ser Ala Val
80 85 90
Tyr Phe Cys Thr Arg Ser Leu Asn Met Ala Tyr Trp Gly Gln Gly Thr
95 100 105
Ser Val Thr Val Ser Ser
110 115
<210> SEQ ID NO 5
<211> LENGTH: 862
<212> TYPE: DNA
<213> ORGANISM: Mus musculus
<220> FEATURE:
<221> NAME/KEY: CDS
<222> LOCATION: 384..429, 509..862
<221> NAME/KEY: sig_peptide
<222> LOCATION: 384..429, 509..519
<221> NAME/KEY: mat_peptide
<222> LOCATION: 520..862
<400> SEQUENCE: 5
ccttctcttc ctccaccacc aaatccacca tttgtaaatc aacatgttaa catatcacag 60
agtggagcaa cagaatcagg gcaaaaatat gctgagagat ttatccctgt cgttacaacc 120
aaagcatctg tctagaattc ataaaaactt tatgggatac atttcctcag agaggaatag 180
gatttggacc tgacgatcct gctgcccgag ccatgtgatg acagttcttc tccagttgaa 240
ctaggtcctt atctaagaaa tgcactgctc atgaatatgc aaatcacccg agtctatggc 300
agtaaataca gagatgttca taccataaaa acaatatatg atcagtgtct tctccgctat 360
ccctggacac actgactcta acc atg gaa tgg agc tgg gtc ttt ctc ttc 410
Met Glu Trp Ser Trp Val Phe Leu Phe
-19 -15
ttc ctg tca gta act aca g gtaaggggct caccatttcc aaatctaaag 459
Phe Leu Ser Val Thr Thr
-10 -5
tggagtcagg gcctgaggtg acaaagatat ccactttggc tttccacag gt gtc 513
Gly Val
-3
cac tcc cag gtt cag ttg cag cag tct gac gct gag ttg gtg aaa cct 561
His Ser Gln Val Gln Leu Gln Gln Ser Asp Ala Glu Leu Val Lys Pro
1 5 10
ggg gct tca gtg aag att tcc tgc aag gct tct ggc tac acc ttc act 609
Gly Ala Ser Val Lys Ile Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr
15 20 25 30
gac cat gct att cac tgg gtg aag cag aag cct gaa cag ggc ctg gaa 657
Asp His Ala Ile His Trp Val Lys Gln Lys Pro Glu Gln Gly Leu Glu
35 40 45
tgg att gga tat att tct ccc gga aat gat gat att aag tac aat gag 705
Trp Ile Gly Tyr Ile Ser Pro Gly Asn Asp Asp Ile Lys Tyr Asn Glu
50 55 60
aag ttc aag ggc aag gcc aca ctg act gca gac aaa tcc tcc agt act 753
Lys Phe Lys Gly Lys Ala Thr Leu Thr Ala Asp Lys Ser Ser Ser Thr
65 70 75
gcc tac atg caa ctc aac agc ctg aca tct gag gat tct gca gtg tat 801
Ala Tyr Met Gln Leu Asn Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr
80 85 90
ttc tgt aga aga tcc ttc tac ggc aac tgg ggc caa ggc acc acc ctc 849
Phe Cys Arg Arg Ser Phe Tyr Gly Asn Trp Gly Gln Gly Thr Thr Leu
95 100 105 110
aca gtc tcc tca g 862
Thr Val Ser Ser
<210> SEQ ID NO 6
<211> LENGTH: 133
<212> TYPE: PRT
<213> ORGANISM: Mus musculus
<220> FEATURE:
<221> NAME/KEY: SIGNAL
<222> LOCATION: -19..-1
<221> NAME/KEY: CHAIN
<222> LOCATION: 1..114
<400> SEQUENCE: 6
Met Glu Trp Ser Trp Val Phe Leu Phe Phe Leu Ser Val Thr Thr Gly
-19 -15 -10 -5
Val His Ser Gln Val Gln Leu Gln Gln Ser Asp Ala Glu Leu Val Lys
1 5 10
Pro Gly Ala Ser Val Lys Ile Ser Cys Lys Ala Ser Gly Tyr Thr Phe
15 20 25
Thr Asp His Ala Ile His Trp Val Lys Gln Lys Pro Glu Gln Gly Leu
30 35 40 45
Glu Trp Ile Gly Tyr Ile Ser Pro Gly Asn Asp Asp Ile Lys Tyr Asn
50 55 60
Glu Lys Phe Lys Gly Lys Ala Thr Leu Thr Ala Asp Lys Ser Ser Ser
65 70 75
Thr Ala Tyr Met Gln Leu Asn Ser Leu Thr Ser Glu Asp Ser Ala Val
80 85 90
Tyr Phe Cys Arg Arg Ser Phe Tyr Gly Asn Trp Gly Gln Gly Thr Thr
95 100 105
Leu Thr Val Ser Ser
110
<210> SEQ ID NO 7
<211> LENGTH: 451
<212> TYPE: DNA
<213> ORGANISM: Mus musculus
<220> FEATURE:
<221> NAME/KEY: CDS
<222> LOCATION: 49..451
<223> OTHER INFORMATION: cDNA to mRNA
<221> NAME/KEY: sig_peptide
<222> LOCATION: 49..105
<221> NAME/KEY: mat_peptide
<222> LOCATION: 106..451
<400> SEQUENCE: 7
atatgatcag tgtcttctcc gctatccctg gacacactga ctctaacc atg gaa tgg 57
Met Glu Trp
-19
agc tgg gtc ttt ctc ttc ttc ctg tca gta act aca ggt gtc cac tcc 105
Ser Trp Val Phe Leu Phe Phe Leu Ser Val Thr Thr Gly Val His Ser
-15 -10 -5
caa ttt cag cta cag cag tct gac gct gag ttg gtg aga cct ggg gct 153
Gln Phe Gln Leu Gln Gln Ser Asp Ala Glu Leu Val Arg Pro Gly Ala
1 5 10 15
tca gtg aag att tcc tgc aag gct tct ggc tac acc ttc act gac cat 201
Ser Val Lys Ile Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asp His
20 25 30
gct att cac tgg gtg aag cag aag cct gaa cag ggc ctg gaa tgg att 249
Ala Ile His Trp Val Lys Gln Lys Pro Glu Gln Gly Leu Glu Trp Ile
35 40 45
gga tat ttt tct ccc gga aat ggt gat att aag tac aat gag aag ttc 297
Gly Tyr Phe Ser Pro Gly Asn Gly Asp Ile Lys Tyr Asn Glu Lys Phe
50 55 60
aag ggc aag gcc aca ctg act gca gac aaa tcc tcc agc act gcc tac 345
Lys Gly Lys Ala Thr Leu Thr Ala Asp Lys Ser Ser Ser Thr Ala Tyr
65 70 75 80
atg cag ttc aac agc ctg aca tct gag gac tct gca gtg tat ttc tgt 393
Met Gln Phe Asn Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Phe Cys
85 90 95
acg ggc ggc tac ggg ttt gct ttc tgg ggc caa ggg act ctg gtc act 441
Thr Gly Gly Tyr Gly Phe Ala Phe Trp Gly Gln Gly Thr Leu Val Thr
100 105 110
gtc tct gca g 451
Val Ser Ala
115
<210> SEQ ID NO 8
<211> LENGTH: 134
<212> TYPE: PRT
<213> ORGANISM: Mus musculus
<220> FEATURE:
<221> NAME/KEY: SIGNAL
<222> LOCATION: -19..-1
<221> NAME/KEY: CHAIN
<222> LOCATION: 1..115
<400> SEQUENCE: 8
Met Glu Trp Ser Trp Val Phe Leu Phe Phe Leu Ser Val Thr Thr Gly
-19 -15 -10 -5
Val His Ser Gln Phe Gln Leu Gln Gln Ser Asp Ala Glu Leu Val Arg
1 5 10
Pro Gly Ala Ser Val Lys Ile Ser Cys Lys Ala Ser Gly Tyr Thr Phe
15 20 25
Thr Asp His Ala Ile His Trp Val Lys Gln Lys Pro Glu Gln Gly Leu
30 35 40 45
Glu Trp Ile Gly Tyr Phe Ser Pro Gly Asn Gly Asp Ile Lys Tyr Asn
50 55 60
Glu Lys Phe Lys Gly Lys Ala Thr Leu Thr Ala Asp Lys Ser Ser Ser
65 70 75
Thr Ala Tyr Met Gln Phe Asn Ser Leu Thr Ser Glu Asp Ser Ala Val
80 85 90
Tyr Phe Cys Thr Gly Gly Tyr Gly Phe Ala Phe Trp Gly Gln Gly Thr
95 100 105
Leu Val Thr Val Ser Ala
110 115
<210> SEQ ID NO 9
<211> LENGTH: 430
<212> TYPE: DNA
<213> ORGANISM: Mus musculus
<220> FEATURE:
<221> NAME/KEY: CDS
<222> LOCATION: 28..430
<223> OTHER INFORMATION: cDNA to mRNA
<221> NAME/KEY: sig_peptide
<222> LOCATION: 28..84
<221> NAME/KEY: mat_peptide
<222> LOCATION: 85..430
<400> SEQUENCE: 9
ctatccctgg acacactgac tctaacc atg gaa tgg agc tgg gtc ttt ctc 51
Met Glu Trp Ser Trp Val Phe Leu
-19 -15
ttc ttc ctg tca gta act aca ggt gtc cac tcc cag gtt caa ctg cag 99
Phe Phe Leu Ser Val Thr Thr Gly Val His Ser Gln Val Gln Leu Gln
-10 -5 1 5
cag tct gac gct gag ttg gtg aaa cct ggg gct tca gtg aag ata tcc 147
Gln Ser Asp Ala Glu Leu Val Lys Pro Gly Ala Ser Val Lys Ile Ser
10 15 20
tgc aag gct tct ggc tac acc ttc act gac cat gct att cac tgg gtg 195
Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asp His Ala Ile His Trp Val
25 30 35
aag cag aaa cct gaa cag ggc ctg gaa tgg att gga tat att tct ccc 243
Lys Gln Lys Pro Glu Gln Gly Leu Glu Trp Ile Gly Tyr Ile Ser Pro
40 45 50
gga aat gat gat att aag tac aat gag aag ttc aag ggt aag gcc aca 291
Gly Asn Asp Asp Ile Lys Tyr Asn Glu Lys Phe Lys Gly Lys Ala Thr
55 60 65
ctg act gca gac aaa ccc tcc aac act gtc tac atg cag ctc aac agc 339
Leu Thr Ala Asp Lys Pro Ser Asn Thr Val Tyr Met Gln Leu Asn Ser
70 75 80 85
ctg acc tct gag gat tct gca gtg tat ttc tgt aca aga tct cta tcc 387
Leu Thr Ser Glu Asp Ser Ala Val Tyr Phe Cys Thr Arg Ser Leu Ser
90 95 100
ggg aac tcc tgg ggc cag ggc acc act ctc aca gtc tcc tca g 430
Gly Asn Ser Trp Gly Gln Gly Thr Thr Leu Thr Val Ser Ser
105 110 115
<210> SEQ ID NO 10
<211> LENGTH: 134
<212> TYPE: PRT
<213> ORGANISM: Mus musculus
<220> FEATURE:
<221> NAME/KEY: SIGNAL
<222> LOCATION: -19..-1
<221> NAME/KEY: CHAIN
<222> LOCATION: 1..115
<400> SEQUENCE: 10
Met Glu Trp Ser Trp Val Phe Leu Phe Phe Leu Ser Val Thr Thr Gly
-19 -15 -10 -5
Val His Ser Gln Val Gln Leu Gln Gln Ser Asp Ala Glu Leu Val Lys
1 5 10
Pro Gly Ala Ser Val Lys Ile Ser Cys Lys Ala Ser Gly Tyr Thr Phe
15 20 25
Thr Asp His Ala Ile His Trp Val Lys Gln Lys Pro Glu Gln Gly Leu
30 35 40 45
Glu Trp Ile Gly Tyr Ile Ser Pro Gly Asn Asp Asp Ile Lys Tyr Asn
50 55 60
Glu Lys Phe Lys Gly Lys Ala Thr Leu Thr Ala Asp Lys Pro Ser Asn
65 70 75
Thr Val Tyr Met Gln Leu Asn Ser Leu Thr Ser Glu Asp Ser Ala Val
80 85 90
Tyr Phe Cys Thr Arg Ser Leu Ser Gly Asn Ser Trp Gly Gln Gly Thr
95 100 105
Thr Leu Thr Val Ser Ser
110 115
<210> SEQ ID NO 11
<211> LENGTH: 795
<212> TYPE: DNA
<213> ORGANISM: Mus musculus
<220> FEATURE:
<221> NAME/KEY: CDS
<222> LOCATION: 144..192, 385..735
<221> NAME/KEY: sig_peptide
<222> LOCATION: 144..192, 385..395
<221> NAME/KEY: mat_peptide
<222> LOCATION: 396..735
<400> SEQUENCE: 11
ccatccactc tcacacacac tgcccaggca tttgcttttg tatttgctgg ctgctttgca 60
tagacccctc cagcctaacc cagctgctca gaatttataa accagtatga actgagcagc 120
atcagacagg caggggaagc aag atg gat tca cag gcc cag gtt ctt atg 170
Met Asp Ser Gln Ala Gln Val Leu Met
-20 -15
tta ctg ctg cta tgg gta tct g gtgagaaatt taaaagtatt atcatttcag 222
Leu Leu Leu Leu Trp Val Ser
-10 -5
agttacacct ttttatataa gaaatttata ctttgtgcaa gtgtgtaata ttacttccat 282
aataactctg acaatatgac attacaaaga cctttgacaa atttcaactg ttataataat 342
ctatttgtgt atgtattcat gttcactttc tacttatttc ag gt acc tgt ggg 395
Gly Thr Cys Gly
-3
gac att gtg atg tca cag tct cca tcc tcc cta cct gtg tca gtt ggc 443
Asp Ile Val Met Ser Gln Ser Pro Ser Ser Leu Pro Val Ser Val Gly
1 5 10 15
gag aag gtt act ttg agc tgc aag tcc agt cag agc ctt tta tat agt 491
Glu Lys Val Thr Leu Ser Cys Lys Ser Ser Gln Ser Leu Leu Tyr Ser
20 25 30
ggt aat caa aag aac tac ttg gcc tgg tac cag cag aaa cca ggg cag 539
Gly Asn Gln Lys Asn Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln
35 40 45
tct cct aaa ctg ctg att tac tgg gca tcc gct agg gaa tct ggg gtc 587
Ser Pro Lys Leu Leu Ile Tyr Trp Ala Ser Ala Arg Glu Ser Gly Val
50 55 60
cct gat cgc ttc aca ggc agt gga tct ggg aca gat ttc act ctc tcc 635
Pro Asp Arg Phe Thr Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Ser
65 70 75 80
atc agc agt gtg aag act gaa gac ctg gca gtt tat tac tgt cag cag 683
Ile Ser Ser Val Lys Thr Glu Asp Leu Ala Val Tyr Tyr Cys Gln Gln
85 90 95
tat tat agc tat ccc ctc acg ttc ggt gct ggg acc aag ctg gtg ctg 731
Tyr Tyr Ser Tyr Pro Leu Thr Phe Gly Ala Gly Thr Lys Leu Val Leu
100 105 110
aaacgtaagt acacttttct catctttttt tatgtgtaag acacaggttt tcatgttagg 791
Lys
agtt 795
<210> SEQ ID NO 12
<211> LENGTH: 133
<212> TYPE: PRT
<213> ORGANISM: Mus musculus
<220> FEATURE:
<221> NAME/KEY: SIGNAL
<222> LOCATION: -20..-1
<221> NAME/KEY: CHAIN
<222> LOCATION: 1..113
<400> SEQUENCE: 12
Met Asp Ser Gln Ala Gln Val Leu Met Leu Leu Leu Leu Trp Val Ser
-20 -15 -10 -5
Gly Thr Cys Gly Asp Ile Val Met Ser Gln Ser Pro Ser Ser Leu Pro
1 5 10
Val Ser Val Gly Glu Lys Val Thr Leu Ser Cys Lys Ser Ser Gln Ser
15 20 25
Leu Leu Tyr Ser Gly Asn Gln Lys Asn Tyr Leu Ala Trp Tyr Gln Gln
30 35 40
Lys Pro Gly Gln Ser Pro Lys Leu Leu Ile Tyr Trp Ala Ser Ala Arg
45 50 55 60
Glu Ser Gly Val Pro Asp Arg Phe Thr Gly Ser Gly Ser Gly Thr Asp
65 70 75
Phe Thr Leu Ser Ile Ser Ser Val Lys Thr Glu Asp Leu Ala Val Tyr
80 85 90
Tyr Cys Gln Gln Tyr Tyr Ser Tyr Pro Leu Thr Phe Gly Ala Gly Thr
95 100 105
Lys Leu Val Leu Lys
110
<210> SEQ ID NO 13
<211> LENGTH: 685
<212> TYPE: DNA
<213> ORGANISM: Mus musculus
<220> FEATURE:
<221> NAME/KEY: CDS
<222> LOCATION: 76..136, 315..647
<221> NAME/KEY: sig_peptide
<222> LOCATION: 76..136, 315..325
<221> NAME/KEY: mat_peptide
<222> LOCATION: 326..647
<400> SEQUENCE: 13
cctagaggcc agcacagctg cccatgattt ataaaccagg tctttgcagt gagatctcaa 60
atacatcaga ccagc atg ggc atc aag atg gag aca cat tct cag gtc ttt 111
Met Gly Ile Lys Met Glu Thr His Ser Gln Val Phe
-24 -20 -15
gta tac atg ttg ctg tgg ttg tct g gtgagacatt taaaagtatt 156
Val Tyr Met Leu Leu Trp Leu Ser
-10 -5
ataaaatctt aaaagtaatc tatttaaata gctttttcct ataggaagcc aatattaggc 216
agacaatgcc attagataag acattttgga ttctaacatt tgtatcttga agtctttata 276
tgtgtgagtt tatacacatt atctgtttct gtttgcag gt gtt gaa gga gac 328
Gly Val Glu Gly Asp
-3 1
att gtg atg acc cag tct cac aaa ttc atg tcc gca tca gtg gga gac 376
Ile Val Met Thr Gln Ser His Lys Phe Met Ser Ala Ser Val Gly Asp
5 10 15
agg gtc aac atc acc tgc aag gcc agt cag tat gtg gct act gct gta 424
Arg Val Asn Ile Thr Cys Lys Ala Ser Gln Tyr Val Ala Thr Ala Val
20 25 30
gcc tgg ttt cag cat aaa cca ggt cag tct cct aaa cta ctg att tac 472
Ala Trp Phe Gln His Lys Pro Gly Gln Ser Pro Lys Leu Leu Ile Tyr
35 40 45
ggg gca tcc acc cgg cac act gga gtc cct gat cgc ttc aca ggc agt 520
Gly Ala Ser Thr Arg His Thr Gly Val Pro Asp Arg Phe Thr Gly Ser
50 55 60 65
gga tct ggg aca gat ttc act ctc atc att agc aat gtg cag tct gag 568
Gly Ser Gly Thr Asp Phe Thr Leu Ile Ile Ser Asn Val Gln Ser Glu
70 75 80
gac ttg gca gat tat ttg tgt cag cat tat agc ggc tat cca ttc acc 616
Asp Leu Ala Asp Tyr Leu Cys Gln His Tyr Ser Gly Tyr Pro Phe Thr
85 90 95
ttc ggc tcg ggg aca aag ttg gaa ata aaacgtaagt agacttttgc 663
Phe Gly Ser Gly Thr Lys Leu Glu Ile Lys
100 105
tcatttactt gtgacgtttt gg 685
<210> SEQ ID NO 14
<211> LENGTH: 131
<212> TYPE: PRT
<213> ORGANISM: Mus musculus
<220> FEATURE:
<221> NAME/KEY: SIGNAL
<222> LOCATION: -24..-1
<221> NAME/KEY: CHAIN
<222> LOCATION: 1..107
<400> SEQUENCE: 14
Met Gly Ile Lys Met Glu Thr His Ser Gln Val Phe Val Tyr Met Leu
-24 -20 -15 -10
Leu Trp Leu Ser Gly Val Glu Gly Asp Ile Val Met Thr Gln Ser His
-5 1 5
Lys Phe Met Ser Ala Ser Val Gly Asp Arg Val Asn Ile Thr Cys Lys
10 15 20
Ala Ser Gln Tyr Val Ala Thr Ala Val Ala Trp Phe Gln His Lys Pro
25 30 35 40
Gly Gln Ser Pro Lys Leu Leu Ile Tyr Gly Ala Ser Thr Arg His Thr
45 50 55
Gly Val Pro Asp Arg Phe Thr Gly Ser Gly Ser Gly Thr Asp Phe Thr
60 65 70
Leu Ile Ile Ser Asn Val Gln Ser Glu Asp Leu Ala Asp Tyr Leu Cys
75 80 85
Gln His Tyr Ser Gly Tyr Pro Phe Thr Phe Gly Ser Gly Thr Lys Leu
90 95 100
Glu Ile Lys
105
<210> SEQ ID NO 15
<211> LENGTH: 1716
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<221> NAME/KEY: misc_feature
<222> LOCATION: 1..1716
<223> OTHER INFORMATION: Hind III-Pst I fragment from pGD1
<400> SEQUENCE: 15
aagctttcgc ctacccactg ctctgttcct cttcagtgag gagggttttt gtacagccag 60
acagtggagt actaccactg tggtggacgt tcggtggagg caccaagctg gaaatcaaac 120
gtaagtagaa tccaaagtct ctttcttccg ttgtctatgt ctgtggcttc tatgtctaaa 180
aatgatgtat aaaatcttac tctgaaacca gattctggca ctctccaagg caaagataca 240
gagtaactcc gtaagcaaag ctgggaatag gctagacatg ttctctggag aatgaatgcc 300
agtgtaataa ttaacacaag tgatagtttc agaaatgctc aaagaagcag ggtagcctgc 360
cctagacaaa cctttactcg gtgctcagac catgctcagt ttttgtatgg gggttgagtg 420
aagggacacc agtgtgtgta cacgttcgga ggggggacca agctggaaat aaaacgtaag 480
tagtcttctc aactcttgtt cactaagtct aaccttgtta agttgttctt tgttgtgtgt 540
ttttcttaag gagatttcag ggatttagca aattccattc tcagatcagg tgttaaggag 600
ggaaaactgt cccacaagag gttggaatga ttttcaggct aaattttagg ctttctaaac 660
caaagtaact aaactagggg aagagggata attgtctacc tagggagggt tttgtggagg 720
taaagttaaa ataaatcact gtaaatcaca ttcagtgatg ggaccagact ggaaataaaa 780
cctaagtaca tttttgctca actgcttgtg aagttttggt cccattgtgt cctttgtatg 840
agtttgtggt gtacattaga taaatgaact attccttgta acccaaaact taaatagaag 900
agaaccaaaa atctagctac tgtacaagct gagcaaacag actgacctca tgtcagattt 960
gtgggagaaa tgagaaagga acagtttttc tctgaactta gcctatctaa ctggatcgcc 1020
tcaggcaggt ttttgtaaag gggggcgcag tgatatgaat cactgtgatt cacgttcggc 1080
tcggggacaa agttggaaat aaaacgtaag tagacttttg ctcatttact tgtgacgttt 1140
tggttctgtt tgggtaactt gtgtgaattt gtgacatttt ggctaaatga gccattcctg 1200
gcaacctgtg catcaataga agatccccca gaaaagagtc agtgtgaaag ctgagcgaaa 1260
aactcgtctt aggcttctga gaccagtttt gtaaggggaa tgtagaagaa agagctgggc 1320
ttttcctctg aatttggccc atctagttgg actggcttca caggcaggtt tttgtagaga 1380
ggggcatgtc atagtcctca ctgtggctca cgttcggtgc tgggaccaag ctggagctga 1440
aacgtaagta cacttttctc atcttttttt atgtgtaaga cacaggtttt catgttagga 1500
gttaaagtca gttcagaaaa tcttgagaaa atggagaggg ctcattatca gttgacgtgg 1560
catacagtgt cagattttct gtttatcaag ctagtgagat taggggcaaa aagaggcttt 1620
agttgagagg aaagtaatta atactatggt caccatccaa gagattggat cggagaataa 1680
gcatgagtag ttattgagat ctgggtctga ctgcag 1716
<210> SEQ ID NO 16
<211> LENGTH: 1984
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<221> NAME/KEY: misc_feature
<222> LOCATION: 1..1984
<223> OTHER INFORMATION: Eco RI-Bam HI fragment from pNP9
<400> SEQUENCE: 16
ggatcctggc cagcattgcc gctaggtccc tctcttctat gctttctttg tccctcactg 60
gcctccatct gagataatcc tggagcccta gccaaggatc atttattgtc aggggtctaa 120
tcattgttgt cacaatgtgc ctggtttgct tactggggcc aagggactct ggtcactgtc 180
tctgcaggtg agtcctaact tctcccattc taaatgcatg ttggggggat tctgagcctt 240
caggaccaag attctctgca aacgggaatc aagattcaac ccctttgtcc caaagttgag 300
acatgggtct gggtcaggga ctctctgcct gctggtctgt ggtgacatta gaactgaagt 360
atgatgaagg atctgccaga actgaagctt gaagtctgag gcagaatctt gtccagggtc 420
tatcggactc ttgtgagaat taggggctga cagttgatgg tgacaatttc agggtcagtg 480
actgtcaggt ttctctgagg tgaggctgga atataggtca ccttgaagac taaagagggg 540
tccaggggct tttctgcaca ggcagggaac agaatgtgga acaatgactt gaatggttga 600
ttcttgtgtg acaccaagaa ttggcataat gtctgagttg cccaagggtg atcttagcta 660
gactctgggg tttttgtcgg gtacagagga aaaacccact attgtgatta ctatgctatg 720
gactactggg gtcaaggaac ctcagtcacc gtctcctcag gtaagaatgg cctctccagg 780
tctttatttt taacctttgt tatggagttt tctgagcatt gcagactaat cttggatatt 840
tgccctgagg gagccggctg agagaagttg ggaaataaat ctgtctaggg atctcagagc 900
ctttaggaca gattatctcc acatctttga aaaactaaga atctgtgtga tggtgttggt 960
ggagtccctg gatgatggga tagggacttt ggaggctcat ttgagggaga tgctaaaaca 1020
atcctatggc tggagggata gttggggctg tagttggaga ttttcagttt ttagaatgaa 1080
gtattagctg caatacttca aggaccacct ctgtgacaac cattttatac agtatccagg 1140
catagggaca aaaagtggag tggggcactt tctttagatt tgtgaggaat gttccacact 1200
acattgttta aaacttcatt tgttggaagg agctgtctta gtgattgagt caagggagaa 1260
aggcatctag cctcggtctc aaaagggtag ttgctgtcta gagaggtctg gtggagcctg 1320
caaaagtcca gctttcaaag gaacacagaa gtatgtgtat ggaatattag aagatgttgc 1380
ttttactctt aagttggttc ctaggaaaaa tagttaaata ctgtgacttt aaaatgtgag 1440
agggttttca agtactcatt tttttaaatg tccaaaattt ttgtcaatca atttgaggtc 1500
ttgtttgtgt agaactgaca ttacttaaag tttaaccgag gaatgggagt gaggctctct 1560
cataccctat tcagaactga cttttaacaa taataaatta agtttaaaat atttttaaat 1620
gaattgagca atgttgagtt gagtcaagat ggccgatcag aaccggaaca cctgcagcag 1680
ctggcaggaa gcaggtcatg tggcaaggct atttggggaa gggaaaataa aaccactagg 1740
taaacttgta gctgtggttt gaagaagtgg ttttgaaaca ctctgtccag ccccaccaaa 1800
ccgaaagtcc aggctgagca aaacaccacc tgggtaattt gcatttctaa aataagttga 1860
ggattcagcc gaaactggag aggtcctctt ttaacttatt gagttcaacc ttttaatttt 1920
agcttgagta gttctagttt ccccaaactt aagtttatcg acttctaaaa tgtatttaga 1980
attc 1984
<210> SEQ ID NO 17
<211> LENGTH: 22
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<221> NAME/KEY: misc_feature
<222> LOCATION: 1..22
<223> OTHER INFORMATION: Oligo KL(-)
<400> SEQUENCE: 17
ggaagatgga tacagttggt gc 22
<210> SEQ ID NO 18
<211> LENGTH: 22
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<221> NAME/KEY: misc_feature
<222> LOCATION: 1..22
<223> OTHER INFORMATION: Oligo 49FR1(-)
<400> SEQUENCE: 18
ggaagatgga tacagttggt gc 22
<210> SEQ ID NO 19
<211> LENGTH: 24
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<221> NAME/KEY: misc_feature
<222> LOCATION: 1..24
<223> OTHER INFORMATION: Oligo J4(-)
<400> SEQUENCE: 19
ccaactttgt ccccgagccg aacg 24
<210> SEQ ID NO 20
<211> LENGTH: 23
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<221> NAME/KEY: misc_feature
<222> LOCATION: 1..23
<223> OTHER INFORMATION: Oligo J5(-)
<400> SEQUENCE: 20
cgtttcagct ccagcttggt ccc 23
<210> SEQ ID NO 21
<211> LENGTH: 24
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<221> NAME/KEY: misc_feature
<222> LOCATION: 1..24
<223> OTHER INFORMATION: Oligo CH1(-)
<400> SEQUENCE: 21
atggagttag tttgggcagc agat 24
<210> SEQ ID NO 22
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<221> NAME/KEY: misc_feature
<222> LOCATION: 1..20
<223> OTHER INFORMATION: Oligo JH4(-)
<400> SEQUENCE: 22
ggtgactgag gttccttgac 20
<210> SEQ ID NO 23
<211> LENGTH: 16
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<221> NAME/KEY: misc_feature
<222> LOCATION: 1..16
<223> OTHER INFORMATION: Oligo JH2(-)
<400> SEQUENCE: 23
ctgaggagac tgtgag 16
<210> SEQ ID NO 24
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<221> NAME/KEY: misc_feature
<222> LOCATION: 1..20
<223> OTHER INFORMATION: Oligo B72.3/CC92 HC
<400> SEQUENCE: 24
ccttgaactt ctcattgtac 20
<210> SEQ ID NO 25
<211> LENGTH: 819
<212> TYPE: DNA
<213> ORGANISM: Mus musculus
<400> SEQUENCE: 25
ttaacatatc acagagtgga gcaacagaat cagggcaaaa atatgctgag agatttttcc 60
ctgtcgttac aaccaaagca tctgtctaga attcataaaa actttatggg atacatttcc 120
tcagagagga ataggatttg gacctgacga tcctgctgcc cgagccatgt gatgacagtt 180
cttctccagt tgaactaggt ccttatctaa gaaatgcact gctcatgaat atgcaaatca 240
cccgagtcta tggcagtaaa tacagagatg ttcataccat aaaaacaata tgtgatcagt 300
gtcttctccg ctatccctgg acacactgac tctaaccatg gaatggagct gggtctttct 360
cttcttcctg tcagtaacta caggtaaggg gctcaccatt tccaaatcta aagtggagtc 420
agggcctgag gtgacaaaga tgtccacttt ggctgtccac aggtgtccac tcccaggttc 480
agttgcagca gtctgacgct gagttggtga aacctggggc ttcagtgaag atttcctgca 540
aggcttctgg ctacaccttc actgaccatg caattcactg ggtgaaacag aaccctgaac 600
agggcctgga atggattgga tatttttctc ccggaaatga tgattttaaa tacaatgaga 660
ggttcaaggg caaggccaca ctgactgcag acaaatcctc cagcactgcc tacgtgcagc 720
tcaacagcct gacatctgag gattctgcag tgtatttctg tacaagatcc ctgaatatgg 780
cctactgggg tcaaggaacc tcagtcaccg tctcctcag 819
<210> SEQ ID NO 26
<211> LENGTH: 816
<212> TYPE: DNA
<213> ORGANISM: Mus musculus
<400> SEQUENCE: 26
ttaacatatc acagagtgga gcaacagaat cagggcaaaa atatgctgag agatttatcc 60
ctgtcgttac aaccaaagca tctgtctaga attcataaaa actttatggg atacatttcc 120
tcagagagga ataggatttg gacctgacga tcctgctgcc cgagccatgt gatgacagtt 180
cttctccagt tgaactaggt ccttatctaa gaaatgcact gctcatgaat atgcaaatca 240
cccgagtcta tggcagtaaa tacagagatg ttcataccat aaaaacaata tatgatcagt 300
gtcttctccg ctatccctgg acacactgac tctaaccatg gaatggagct gggtctttct 360
cttcttcctg tcagtaacta caggtaaggg gctcaccatt tccaaatcta aagtggagtc 420
agggcctgag gtgacaaaga tatccacttt ggctttccac aggtgtccac tcccaggttc 480
agttgcagca gtctgacgct gagttggtga aacctggggc ttcagtgaag atttcctgca 540
aggcttctgg ctacaccttc actgaccatg ctattcactg ggtgaagcag aagcctgaac 600
agggcctgga atggattgga tatatttctc ccggaaatga tgatattaag tacaatgaga 660
agttcaaggg caaggccaca ctgactgcag acaaatcctc cagtactgcc tacatgcaac 720
tcaacagcct gacatctgag gattctgcag tgtatttctg tagaagatcc ttctacggca 780
actggggcca aggcaccacc ctcacagtct cctcag 816
<210> SEQ ID NO 27
<211> LENGTH: 380
<212> TYPE: DNA
<213> ORGANISM: Mus musculus
<220> FEATURE:
<221> NAME/KEY: CDS
<222> LOCATION: 2..380
<223> OTHER INFORMATION: cDNA to mRNA
<221> NAME/KEY: sig_peptide
<222> LOCATION: 2..58
<223> OTHER INFORMATION: partial
<221> NAME/KEY: mat_peptide
<222> LOCATION: 59..380
<400> SEQUENCE: 27
g agt cac aga tcc agg tcc ttt gta ttc gtg ttt ctc tgg ttg tct 46
Ser His Arg Ser Arg Ser Phe Val Phe Val Phe Leu Trp Leu Ser
-19 -15 -10 -5
ggt gtt gac gga gac att gtg atg acc cag tct cac aaa ttc atg tcc 94
Gly Val Asp Gly Asp Ile Val Met Thr Gln Ser His Lys Phe Met Ser
1 5 10
aca tca gta gga gac agg gtc agc atc acc tgc aag gcc agt cag gat 142
Thr Ser Val Gly Asp Arg Val Ser Ile Thr Cys Lys Ala Ser Gln Asp
15 20 25
gtg agt agt gct gta ggg tgg ttt caa cag aaa cca gga caa tct cct 190
Val Ser Ser Ala Val Gly Trp Phe Gln Gln Lys Pro Gly Gln Ser Pro
30 35 40
aaa tta ctg att tat tcg gca tcc tac cgg tat act gga gtc cct gat 238
Lys Leu Leu Ile Tyr Ser Ala Ser Tyr Arg Tyr Thr Gly Val Pro Asp
45 50 55 60
cgc ttc act ggc agt gga tct cgg acg gat ttc act ttc acc atc acc 286
Arg Phe Thr Gly Ser Gly Ser Arg Thr Asp Phe Thr Phe Thr Ile Thr
65 70 75
agt gtg cag gct gaa gac ctg gca gtt tat tac tgt cag caa cat tat 334
Ser Val Gln Ala Glu Asp Leu Ala Val Tyr Tyr Cys Gln Gln His Tyr
80 85 90
agt agt ccg ctc acg ttc ggt gct ggg acc aag ctg gag ctg aaa c 380
Ser Ser Pro Leu Thr Phe Gly Ala Gly Thr Lys Leu Glu Leu Lys
95 100 105
<210> SEQ ID NO 28
<211> LENGTH: 126
<212> TYPE: PRT
<213> ORGANISM: Mus musculus
<220> FEATURE:
<221> NAME/KEY: SIGNAL
<222> LOCATION: -19..-1
<221> NAME/KEY: CHAIN
<222> LOCATION: 1..107
<400> SEQUENCE: 28
Ser His Arg Ser Arg Ser Phe Val Phe Val Phe Leu Trp Leu Ser Gly
-19 -15 -10 -5
Val Asp Gly Asp Ile Val Met Thr Gln Ser His Lys Phe Met Ser Thr
1 5 10
Ser Val Gly Asp Arg Val Ser Ile Thr Cys Lys Ala Ser Gln Asp Val
15 20 25
Ser Ser Ala Val Gly Trp Phe Gln Gln Lys Pro Gly Gln Ser Pro Lys
30 35 40 45
Leu Leu Ile Tyr Ser Ala Ser Tyr Arg Tyr Thr Gly Val Pro Asp Arg
50 55 60
Phe Thr Gly Ser Gly Ser Arg Thr Asp Phe Thr Phe Thr Ile Thr Ser
65 70 75
Val Gln Ala Glu Asp Leu Ala Val Tyr Tyr Cys Gln Gln His Tyr Ser
80 85 90
Ser Pro Leu Thr Phe Gly Ala Gly Thr Lys Leu Glu Leu Lys
95 100 105
<210> SEQ ID NO 29
<211> LENGTH: 134
<212> TYPE: PRT
<213> ORGANISM: Mus musculus
<400> SEQUENCE: 29
Met Glu Trp Ser Trp Val Phe Leu Phe Phe Leu Ser Val Thr Thr Gly
1 5 10 15
Val His Ser Gln Val Gln Leu Gln Gln Ser Asp Ala Glu Leu Val Lys
20 25 30
Pro Gly Ala Ser Val Lys Ile Ser Cys Lys Ala Ser Gly Tyr Thr Phe
35 40 45
Thr Asp His Ala Ile His Trp Val Lys Gln Asn Pro Glu Gln Gly Leu
50 55 60
Glu Trp Ile Gly Tyr Phe Ser Pro Gly Asn Asp Asp Phe Lys Tyr Asn
65 70 75 80
Glu Arg Phe Lys Gly Lys Ala Thr Leu Thr Ala Asp Lys Ser Ser Ser
85 90 95
Thr Ala Tyr Val Gln Leu Asn Ser Leu Thr Ser Glu Asp Ser Ala Val
100 105 110
Tyr Phe Cys Thr Arg Ser Leu Asn Met Ala Tyr Trp Gly Gln Gly Thr
115 120 125
Ser Val Thr Val Ser Ser
130
<210> SEQ ID NO 30
<211> LENGTH: 133
<212> TYPE: PRT
<213> ORGANISM: Mus musculus
<400> SEQUENCE: 30
Met Glu Trp Ser Trp Val Phe Leu Phe Phe Leu Ser Val Thr Thr Gly
1 5 10 15
Val His Ser Gln Val Gln Leu Gln Gln Ser Asp Ala Glu Leu Val Lys
20 25 30
Pro Gly Ala Ser Val Lys Ile Ser Cys Lys Ala Ser Gly Tyr Thr Phe
35 40 45
Thr Asp His Ala Ile His Trp Val Lys Gln Lys Pro Glu Gln Gly Leu
50 55 60
Glu Trp Ile Gly Tyr Ile Ser Pro Gly Asn Asp Asp Ile Lys Tyr Asn
65 70 75 80
Glu Lys Phe Lys Gly Lys Ala Thr Leu Thr Ala Asp Lys Ser Ser Ser
85 90 95
Thr Ala Tyr Met Gln Leu Asn Ser Leu Thr Ser Glu Asp Ser Ala Val
100 105 110
Tyr Phe Cys Arg Arg Ser Phe Tyr Gly Asn Trp Gly Gln Gly Thr Thr
115 120 125
Leu Thr Val Ser Ser
130
<210> SEQ ID NO 31
<211> LENGTH: 19
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<221> NAME/KEY: misc_feature
<222> LOCATION: 1..19
<223> OTHER INFORMATION: Oligo CK intron(-)
<400> SEQUENCE: 31
gaaaacctgt gtcttacac 19
<210> SEQ ID NO 32
<211> LENGTH: 18
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<221> NAME/KEY: misc_feature
<222> LOCATION: 1..18
<223> OTHER INFORMATION: Oligo CC49 FRI(+)
<400> SEQUENCE: 32
gtacctgtgg ggacattg 18
<210> SEQ ID NO 33
<211> LENGTH: 23
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<221> NAME/KEY: misc_feature
<222> LOCATION: 1..23
<223> OTHER INFORMATION: Oligo JK5(-)
<400> SEQUENCE: 33
cgtttcagct ccagcttggt ccc 23
<210> SEQ ID NO 34
<211> LENGTH: 17
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<221> NAME/KEY: misc_feature
<222> LOCATION: 1..17
<223> OTHER INFORMATION: Oligo CC83 CDR2(-)
<400> SEQUENCE: 34
cagggactcc agtgtgc 17
<210> SEQ ID NO 35
<211> LENGTH: 22
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<221> NAME/KEY: misc_feature
<222> LOCATION: 1..22
<223> OTHER INFORMATION: Oligo CC83 L intron(-)
<400> SEQUENCE: 35
gacttcaaga tacaaatgtt ag 22
<210> SEQ ID NO 36
<211> LENGTH: 24
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<221> NAME/KEY: misc_feature
<222> LOCATION: 1..24
<223> OTHER INFORMATION: Oligo JK4(-)
<400> SEQUENCE: 36
ccaactttgt ccccgagccg aacg 24
<210> SEQ ID NO 37
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<221> NAME/KEY: misc_feature
<222> LOCATION: 1..20
<223> OTHER INFORMATION: Oligo JH4(-)
<400> SEQUENCE: 37
ggtgactgag gttccttgac 20
<210> SEQ ID NO 38
<211> LENGTH: 19
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<221> NAME/KEY: misc_feature
<222> LOCATION: 1..19
<223> OTHER INFORMATION: Oligo JH4 Intron(-)
<400> SEQUENCE: 38
gcaatgctca gaaaactcc 19
<210> SEQ ID NO 39
<211> LENGTH: 16
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<221> NAME/KEY: misc_feature
<222> LOCATION: 1..16
<223> OTHER INFORMATION: Oligo JH2(-)
<400> SEQUENCE: 39
ctgaggagac tgtgag 16
<210> SEQ ID NO 40
<211> LENGTH: 22
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<221> NAME/KEY: misc_feature
<222> LOCATION: 1..22
<223> OTHER INFORMATION: Oligo JH2 Intron(-)
<400> SEQUENCE: 40
gcagtaaaat ctatctaagc tg 22
<210> SEQ ID NO 41
<211> LENGTH: 23
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<221> NAME/KEY: misc_feature
<222> LOCATION: 1..23
<223> OTHER INFORMATION: Oligo CC49/83 HC/5′(+)
<400> SEQUENCE: 41
gcactgctca tgatatgcaa atc 23
<210> SEQ ID NO 42
<211> LENGTH: 23
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<221> NAME/KEY: misc_feature
<222> LOCATION: 1..23
<223> OTHER INFORMATION: Oligo CC49/83 HC/5′(-)
<400> SEQUENCE: 42
gatttgcata tcatgagcag tgc 23
<210> SEQ ID NO 43
<211> LENGTH: 18
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<221> NAME/KEY: misc_feature
<222> LOCATION: 1..18
<223> OTHER INFORMATION: Oligo CC49/83 H chain FRI(-)
<400> SEQUENCE: 43
ctcagcgtca gactgctg 18
<210> SEQ ID NO 44
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<221> NAME/KEY: misc_feature
<222> LOCATION: 1..20
<223> OTHER INFORMATION: Oligo B72.3/CC92 HC
<400> SEQUENCE: 44
ccttgaactt ctcattgtac 20
<210> SEQ ID NO 45
<211> LENGTH: 23
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<221> NAME/KEY: misc_feature
<222> LOCATION: 1..23
<223> OTHER INFORMATION: Oligo CC49/CC83 HC 5′(+)
<400> SEQUENCE: 45
gcactgctca tgatatgcaa atc 23
<210> SEQ ID NO 46
<211> LENGTH: 23
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<221> NAME/KEY: misc_feature
<222> LOCATION: 1..23
<223> OTHER INFORMATION: Oligo CC49/CC83 HC 5′(-)
<400> SEQUENCE: 46
gatttgcata tcatgagcag tgc 23
<210> SEQ ID NO 47
<211> LENGTH: 21
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<221> NAME/KEY: misc_feature
<222> LOCATION: 1..21
<223> OTHER INFORMATION: Oligo VHaTAG IVS(+)
<400> SEQUENCE: 47
ctaaagtgga gtcagggcct g 21
<210> SEQ ID NO 48
<211> LENGTH: 21
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<221> NAME/KEY: misc_feature
<222> LOCATION: 1..21
<223> OTHER INFORMATION: Oligo VHaTAG IVS(-)
<400> SEQUENCE: 48
caggccctga ctccacttta g 21
<210> SEQ ID NO 49
<211> LENGTH: 22
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<221> NAME/KEY: misc_feature
<222> LOCATION: 1..22
<223> OTHER INFORMATION: Oligo VHaTAG CDR2(+)
<400> SEQUENCE: 49
gaatggattg gatatatttc tc 22
<210> SEQ ID NO 50
<211> LENGTH: 25
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<221> NAME/KEY: misc_feature
<222> LOCATION: 1..25
<223> OTHER INFORMATION: VHaTAG #i Oligo 1
<400> SEQUENCE: 50
gtctagaatt cataaaaact ttatg 25
<210> SEQ ID NO 51
<211> LENGTH: 35
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<221> NAME/KEY: misc_feature
<222> LOCATION: 1..35
<223> OTHER INFORMATION: VHaTAG #i Oligo 2
<400> SEQUENCE: 51
cagtgtattt ctgtaaaaga tctactatgg ttacg 35
<210> SEQ ID NO 52
<211> LENGTH: 72
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<221> NAME/KEY: misc_feature
<222> LOCATION: 1..72
<223> OTHER INFORMATION: VHaTAG #i Oligo 3
<400> SEQUENCE: 52
tctactatgg ttacgtgggg tcaaggaacc tcagtcaccg tctcctcagg taagaatggc 60
ctctccaggt ct 72
<210> SEQ ID NO 53
<211> LENGTH: 30
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<221> NAME/KEY: misc_feature
<222> LOCATION: 1..30
<223> OTHER INFORMATION: VHaTAG #i Oligo 4
<400> SEQUENCE: 53
acttctaaaa tgtatttaga attcattttc 30
<210> SEQ ID NO 54
<211> LENGTH: 35
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<221> NAME/KEY: misc_feature
<222> LOCATION: 1..35
<223> OTHER INFORMATION: VHaTAG #ii Oligo 2
<400> SEQUENCE: 54
cagtgtattt ctgtaaaaga gtactggtgg tgtat 35
<210> SEQ ID NO 55
<211> LENGTH: 72
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<221> NAME/KEY: misc_feature
<222> LOCATION: 1..72
<223> OTHER INFORMATION: VHaTAG #ii Oligo 3
<400> SEQUENCE: 55
gtactggtgg tgtattgggg tcaaggaacc tcagtcaccg tctcctcagg taagaatggc 60
ctctccagct ct 72
<210> SEQ ID NO 56
<211> LENGTH: 72
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<221> NAME/KEY: misc_feature
<222> LOCATION: 1..72
<223> OTHER INFORMATION: VHaTAG #iii Oligo 3
<400> SEQUENCE: 56
tctactatgg ttacgtgggg ccagggcacc ctggtcaccg tctcctcagg taagaatggc 60
ctctccaggt ct 72
<210> SEQ ID NO 57
<211> LENGTH: 72
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<221> NAME/KEY: misc_feature
<222> LOCATION: 1..72
<223> OTHER INFORMATION: VHaTAG #iv Oligo 3
<400> SEQUENCE: 57
gtactggtgg tgtattgggg ccagggcacc ctggtcaccg tctcctcagg taagaatggc 60
ctctccaggt ct 72
<210> SEQ ID NO 58
<211> LENGTH: 248
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<221> NAME/KEY: misc_feature
<222> LOCATION: 1..248
<223> OTHER INFORMATION: f49RN fragment
<400> SEQUENCE: 58
aattcataaa aactttatgg gatacatttc ctcagagagg aataggattt ggacctgacg 60
atcctgctgc ccgagccatg tgatgacagt tcttctccag ttgaactagg tccttatcta 120
agaaatgcac tgctcatgaa tatgcaaatc acccgagtct atggcagtaa atacagagat 180
gttcatacca taaaaacaat atgtgatcag tgtcttctcc gctatccctg gacacactga 240
ctctaacc 248
<210> SEQ ID NO 59
<211> LENGTH: 24
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<221> NAME/KEY: misc_feature
<222> LOCATION: 1..24
<223> OTHER INFORMATION: Oligo Cg1
<400> SEQUENCE: 59
atggagttag tttgggcagc agat 24
<210> SEQ ID NO 60
<211> LENGTH: 27
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<221> NAME/KEY: misc_feature
<222> LOCATION: 1..27
<223> OTHER INFORMATION: Oligo DC113
<400> SEQUENCE: 60
tccaatccat tccaggccct gttcagg 27
<210> SEQ ID NO 61
<211> LENGTH: 378
<212> TYPE: DNA
<213> ORGANISM: Mus musculus
<400> SEQUENCE: 61
ctatccctgg acacactgac tctaaccatg gaatggagct gggtctttct cttcttcctg 60
tcagtaacta caggtgtcca ctcccaggtt cagctgcagc agtctgacgc tgagttggtg 120
aaacctgggg cttcagtgaa gatatcctgc aaggcttctg gctacacctt cactgaccat 180
gctattcact gggtgaagca gaagcctgaa cagggcctgg aatggattgg atatatttct 240
cccggaaatg gtgatattaa gtacaatgag aagttcaagg gcaaggccac actgactgca 300
gacaaatcct ccagcactgc ctacatgcag ctcaacagcc tgacatctga ggattctgca 360
gtgtatttct gtaaaaga 378
<210> SEQ ID NO 62
<211> LENGTH: 423
<212> TYPE: DNA
<213> ORGANISM: Mus musculus
<220> FEATURE:
<221> NAME/KEY: V_segment
<222> LOCATION: 1..423
<223> OTHER INFORMATION: Partial sequence of cDNA to VHaTAG-analog mRNA
from hybridoma AHC46
<400> SEQUENCE: 62
gacacactga ctctaancat ggaatggagc tgggnntttc tcttcttcct gtaagtaact 60
anaggtgtcc actcccaggt tnagctgcag cagtctgacg ctgagttggt gaaacctggn 120
nnttcagtga agatatcctg caaggcttct ggctacacct tcactgacca tgctattnnn 180
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 240
nnnnnnnnnn nnnnnnnngt gaagttctag ggcnaggcca cactgactgc agacagatcc 300
tccagcactg cctncntgca gctcaacagc ctgacatctg aggattctgc agtgtatttc 360
tgtaaaagat cggtcaatgc ttttgactac tggggccaag gcaccnctct cnnngtctcc 420
tca 423
<210> SEQ ID NO 63
<211> LENGTH: 192
<212> TYPE: DNA
<213> ORGANISM: Mus musculus
<220> FEATURE:
<221> NAME/KEY: V_segment
<222> LOCATION: 1..192
<223> OTHER INFORMATION: Partial sequence of cDNA to VHaTAG-analog mRNA
from hybridoma AHC121
<400> SEQUENCE: 63
tggacacact gactctaacc atggaatgga gctgggtctt tctcttcttc ctgtcagtna 60
ctacaggtgt ccactcccag gnncagctgc ancagtctga ngctgagttg gtgaaacctg 120
gggcttcagn gaagatatcc tgnaaggctt cnggctacac cttcactgac catgctattc 180
actgggtgaa gc 192
<210> SEQ ID NO 64
<211> LENGTH: 422
<212> TYPE: DNA
<213> ORGANISM: Mus musculus
<220> FEATURE:
<221> NAME/KEY: V_segment
<222> LOCATION: 1..422
<223> OTHER INFORMATION: Partial sequence of cDNA to VHaTAG-analog mRNA
from hybridoma AHC139
<400> SEQUENCE: 64
acncactgac tctnaccntg gaatggagct gggnnnntct cttcttcctg tcngtaactn 60
nnggtgtccn ctcccaggtt nngctgcagc agtctgacgc tgagttggtg nnacctgggn 120
nttcagtgaa gatatcctgn aaggcttntg gctncacctt cnctgactat gctattcact 180
gggtgaagca gaagcctgaa cagggcctgg aatggattgg atatatttct cccggaaatg 240
gtgatattaa gtacaatgag aagttcaagg gcaaggccac actgactgca gacaaatcct 300
ccagcactgc ctacatgcag ctcaacagcc tgacatctga ggattctgca gtgtatttct 360
gtaaaagatc cctgggacgt tttgactact ggggccaagg caccactctc acagtctcct 420
ca 422
<210> SEQ ID NO 65
<211> LENGTH: 426
<212> TYPE: DNA
<213> ORGANISM: Mus musculus
<220> FEATURE:
<221> NAME/KEY: V_segment
<222> LOCATION: 1..426
<223> OTHER INFORMATION: Partial sequence of cDNA to VHaTAG-analog mRNA
from hybridoma AHC160
<400> SEQUENCE: 65
ctatccctgg acacactgac tctaaccatg gaatggagct gggtctttct cttcttcctg 60
tcagtaacta caggtgtcca ctcccaggtt cagctgcagc agtctgacgc tgagttggtg 120
aaacctgggg cttcagtgaa gatatcctgc aaggcttctg gctacacctt cactgaccat 180
gctattcact gggtgaagca gnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 240
nnnnnnnnnn nnnnnnnnnn nnnnaatgag aagttcaagg gcaaggccac actgactgca 300
gacaaatcct ccagcactgc ctatatgcaa ctcgacagcc tgacatctga ggattctgca 360
gtgtatttct gtaaagcctc ctactatggt aactggggcc aaggcacnac tctcacagtc 420
tcctca 426
<210> SEQ ID NO 66
<211> LENGTH: 21
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<221> NAME/KEY: misc_feature
<222> LOCATION: 1..21
<223> OTHER INFORMATION: Oligo x
<400> SEQUENCE: 66
tatcttatca tgtctggatc c 21
<210> SEQ ID NO 67
<211> LENGTH: 23
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<221> NAME/KEY: misc_feature
<222> LOCATION: 1..23
<223> OTHER INFORMATION: Oligo y
<400> SEQUENCE: 67
ggccctttcg tcttcaagaa ttc 23
<210> SEQ ID NO 68
<211> LENGTH: 18
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<221> NAME/KEY: misc_feature
<222> LOCATION: 1..18
<223> OTHER INFORMATION: Oligo a
<400> SEQUENCE: 68
ggtaaatgag tgcgacgg 18
<210> SEQ ID NO 69
<211> LENGTH: 36
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<221> NAME/KEY: misc_feature
<222> LOCATION: 1..36
<223> OTHER INFORMATION: Oligo b1
<400> SEQUENCE: 69
ccgtcgcact catttaccaa ctctcttgtc cacctt 36
<210> SEQ ID NO 70
<211> LENGTH: 36
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<221> NAME/KEY: misc_feature
<222> LOCATION: 1..36
<223> OTHER INFORMATION: Oligo b2
<400> SEQUENCE: 70
ccgtcgcact catttacctg ggcacggtgg gcatgt 36
<210> SEQ ID NO 71
<211> LENGTH: 36
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<221> NAME/KEY: misc_feature
<222> LOCATION: 1..36
<223> OTHER INFORMATION: Oligo b3
<400> SEQUENCE: 71
ccgtcgcact catttacctt tggctttgga gatggt 36
<210> SEQ ID NO 72
<211> LENGTH: 1383
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<221> NAME/KEY: misc_feature
<222> LOCATION: 1..1383
<223> OTHER INFORMATION: Ch44-CH3-
<400> SEQUENCE: 72
agctttctgg ggcaggccag gcctgacctt ggctttgggg cagggagggg gctaaggtga 60
ggcaggtggc gccagcaggt gcacacccaa tgcccatgag cccagacact ggacgctgaa 120
cctcgcggac agttaagaac ccaggggcct ctgcgcctgg gcccagctct gtcccacacc 180
gcggtcacat ggcaccacct ctcttgcagc ctccaccaag ggcccatcgg tcttccccct 240
ggcaccctcc tccaagagca cctctggggg cacagcggcc ctgggctgcc tggtcaagga 300
ctacttcccc gaaccggtga cggtgtcgtg gaactcaggc gccctgacca gcggcgtgca 360
caccttcccg gctgtcctac agtcctcagg actctactcc ctcagcagcg tggtgaccgt 420
gccctccagc agcttgggca cccagaccta catctgcaac gtgaatcaca agcccagcaa 480
caccaaggtg gacaagaaag ttggtgagag gccagcacag ggagggaggg tgtctgctgg 540
aagcaggctc agcgctcctg cctggacgca tcccggctat gcagccccag tccagggcag 600
caaggcaggc cccgtctgcc tcttcacccg gagcctctgc ccgccccact catgctcagg 660
gagagggtct tctggctttt tcccaggctc tgggcaggca caggctaggt gcccctaacc 720
caggccctgc acacaaaggg gcaggtgctg ggctcagacc tgccaagagc catatccggg 780
aggaccctgc ccctgaccta agcccacccc aaaggccaaa ctctccactc cctcagctcg 840
gacaccttct ctcctcccag attccagtaa ctcccaatct tctctctgca gagcccaaat 900
cttgtgacaa aactcacaca tgcccaccgt gcccaggtaa gccagcccag gcctcgccct 960
ccagctcaag gcgggacagg tgccctagag tagcctgcat ccagggacag gccccagccg 1020
ggtgctgaca cgtccacctc catctcttcc tcagcacctg aactcctggg gggaccgtca 1080
gtcttcctct tccccccaaa acccaaggac accctcatga tctcccggac ccctgaggtc 1140
acatgcgtgg tggtggacgt gagccacgaa gaccctgagg tcaagttcaa ctggtacgtg 1200
gacggcgtgg aggtgcataa tgccaagaca aagccgcggg aggagcagta caacagcacg 1260
taccgggtgg tcagcgtcct caccgtcctg caccaggact ggctgaatgg caaggagtac 1320
aagtgcaagg tctccaacaa agccctccca gcccccatcg agaaaaccat ctccaaagcc 1380
aaa 1383
<210> SEQ ID NO 73
<211> LENGTH: 935
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<221> NAME/KEY: misc_feature
<222> LOCATION: 1..935
<223> OTHER INFORMATION: Ch44-F(ab′)2
<400> SEQUENCE: 73
agctttctgg ggcaggccag gcctgacctt ggctttgggg cagggagggg gctaaggtga 60
ggcaggtggc gccagcaggt gcacacccaa tgcccatgag cccagacact ggacgctgaa 120
cctcgcggac agttaagaac ccaggggcct ctgcgcctgg gcccagctct gtcccacacc 180
gcggtcacat ggcaccacct ctcttgcagc ctccaccaag ggcccatcgg tcttccccct 240
ggcaccctcc tccaagagca cctctggggg cacagcggcc ctgggctgcc tggtcaagga 300
ctacttcccc gaaccggtga cggtgtcgtg gaactcaggc gccctgacca gcggcgtgca 360
caccttcccg gctgtcctac agtcctcagg actctactcc ctcagcagcg tggtgaccgt 420
gccctccagc agcttgggca cccagaccta catctgcaac gtgaatcaca agcccagcaa 480
caccaaggtg gacaagaaag ttggtgagag gccagcacag ggagggaggg tgtctgctgg 540
aagcaggctc agcgctcctg cctggacgca tcccggctat gcagccccag tccagggcag 600
caaggcaggc cccgtctgcc tcttcacccg gagcctctgc ccgccccact catgctcagg 660
gagagggtct tctggctttt tcccaggctc tgggcaggca caggctaggt gcccctaacc 720
caggccctgc acacaaaggg gcaggtgctg ggctcagacc tgccaagagc catatccggg 780
aggaccctgc ccctgaccta agcccacccc aaaggccaaa ctctccactc cctcagctcg 840
gacaccttct ctcctcccag attccagtaa ctcccaatct tctctctgca gagcccaaat 900
cttgtgacaa aactcacaca tgcccaccgt gccca 935
<210> SEQ ID NO 74
<211> LENGTH: 508
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<221> NAME/KEY: misc_feature
<222> LOCATION: 1..508
<223> OTHER INFORMATION: Ch44-Fab
<400> SEQUENCE: 74
agctttctgg ggcaggccag gcctgacttt ggctgggggc agggaggggg ctaaggtgac 60
gcaggtggcg ccagccaggc gcacacccaa tgcccgtgag cccagacact ggaccctgcc 120
tggaccctcg tggatagaca agaaccgagg ggcctctgcg ccctgggccc agctctgtcc 180
cacaccgcag tcacatggcg ccatctctct tgcagcttcc accaagggcc catcggtctt 240
ccccctggcg ccctgctcca ggagcacctc tgggggcaca gcggccctgg gctgcctggt 300
caaggactac ttccccgaac cggtgacggt gtcgtggaac tcaggcgccc tgaccagcgg 360
cgtgcacacc ttcccggctg tcctacagtc ctcaggactc tactccctca gcagcgtggt 420
gaccgtgccc tccagcagct tgggcaccca gacctacacc tgcaacgtga atcacaagcc 480
cagcaacacc aaggtggaca agagagtt 508

Claims (17)

What is claimed is:
1. A process for finding at least one murine VH-encoding polynucleotide encoding at least the heavy chain variable region (VH) of an antibody having binding specificity for TAG-72, the VH-encoding segment of said VH-encoding polynucleotide having a nucleotide sequence which is at least 80% homologous to the nucleotide sequence of the VHαTAG germline gene (SEQ ID NO:1), and said VH-encoding polynucleotide being a productively rearranged or mutated productively rearranged variant of the VHαTAG germline gene, said process comprising the steps of:
A. providing at least one test medium containing at least one murine anti-TAG-72 VH-encoding polynucleotide that is a productively rearranged or mutated productive rearranged variant of the VHαTAG germline gene (SEQ ID NO:1), said VH-encoding polynucleotide comprising at least one 5′-nontranslated region (5′-NTR) of a murine anti-TAG-72 VH-encoding gene that is a productively rearranged or mutated productively rearranged variant of the VHαTAG germline gene (SEQ ID NO:1);
B. providing at least one detectably labeled hybridization probe comprising a base sequence of, or fully complementary to, about 15 nucleotides or more of
(1) the 5′-NTR of mRNA transcribed from the DNA VHαTAG germline gene (SEQ ID NO:1), or of DNA corresponding thereto, or
(2) the 5′-NTR of mRNA transcribed from a productively rearranged or mutated productively rearranged variant of the DNA VHαTAG germline gene, or of DNA corresponding thereto;
C. contacting said VH-encoding polynucleotide(s) with said probe(s) under conditions in which said base sequence of the probe(s) binds specifically to said 5′-NTR(s) of said VH-encoding polynucleotide(s) in the test medium so as to form at least one detectably labeled probe-VH-encoding polynucleotide hybrid, wherein said hybrid contains a polyntcleotide that has a nucleotide sequence that is at least 80% homologous to the nucleotide sequence of the VHαTAG germline gene and that encodes a VH that is able to function as the VH of an antibody having binding specificity for TAG-72;
D. detecting said hybrid(s); and
E. optionally isolating said hybrid(s);
provided that, where both the VH-encoding polynucleotide and the probe are single stranded, one of these is a (+) strand and the other is a (−) strand.
2. The process according to claim 1 wherein the probe is DNA.
3. The process according to claim 1 wherein
at least one additional oligonucleotide is added to the test medium, said additional oligonucleotide being capable of specifically binding upon a section of said VH-encoding polynucleotide, which section is located 3′ to said VH-encoding polynucleotide's 5′-NTR, provided that, where the probe is a single stranded molecule capable of specifically binding to the sense strand of said 5′-NTR, at least one further oligonucleotide is also added, said further oligonucleotide being capable of specifically binding upon the anti-sense strand of said 5′-NTR; and
said process further comprises a step, performed after step C, of amplifying said polynucleotide by the polymerase chain reaction.
4. The process according to claim 1 wherein the probe is RNA.
5. The process according to claim 1 wherein, in step B, said probe contains the entire base sequence of the entire 5′-NTR.
6. The process according to claim 1 wherein the VH-encoding polynucleotide(s) of step A is RNA.
7. The process according to claim 6 wherein the VH-encoding polynucleotide(s) of step A is mRNA.
8. The process according to claim 1 wherein the VH-encoding polynucleotide (s) of step A is DNA.
9. The process according to claim 8 wherein said DNA is cDNA.
10. The process according to claim 1 wherein the VH-encoding polynucleotide(s) of step A is obtained from at least one hybridoma.
11. The process according to claim 1 wherein the probe contains, or is capable of specifically binding to, the base sequence of the following VH 5′-NTR nucleotide sequence:
nucleotides 332-383 of SEQ ID NO:1.
12. The process according to claim 1 wherein the probe contains, or is capable of specifically binding to, the base sequence of the following VH 5′-NTR nucleotide sequence:
nucleotides 332-383 of SEQ ID NO:3.
13. The process according to claim 1 wherein the anti-TAG-72 VH-encoding polynucleotide of step A is from an anti-TAG-72 VH-expressing hybridoma.
14. The process according to claim 1 wherein the productively rearranged or mutated productively rearranged variant of step B is a polynucleotide encoding the VH of CC46 (SEQ ID NO:7), CC49 (SEQ ID NO:3), CC83 (SEQ ID NO:5), or CC92 (SEQ ID NO:9).
15. The process according to claim 1 wherein said detectably labeled hybridization probe comprises a base sequence of, or complementary to, about 20 nucleotides or more of said 5′-NTR.
16. The process according to claim 1 wherein said detectably labeled hybridization probe comprises a base sequence of, or complementary to, about 15 to about 50 nucleotides of said 5′-NTR.
17. The process according to claim 15 wherein said detectably labeled hybridization probe comprises a base sequence of, or complementary to, about 20 to about 50 nucleotides of said 5′-NTR.
US09/503,653 1988-10-19 2000-02-14 Probing method for identifying antibodies specific for selected antigens Expired - Lifetime US6641999B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US09/503,653 US6641999B1 (en) 1988-10-19 2000-02-14 Probing method for identifying antibodies specific for selected antigens

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
US25994388A 1988-10-19 1988-10-19
US26194288A 1988-10-24 1988-10-24
US42436289A 1989-10-19 1989-10-19
US08/040,687 US6051225A (en) 1988-10-19 1993-03-31 Family of high affinity, modified antibodies for cancer treatment
US82310597A 1997-03-24 1997-03-24
US09/503,653 US6641999B1 (en) 1988-10-19 2000-02-14 Probing method for identifying antibodies specific for selected antigens

Related Parent Applications (2)

Application Number Title Priority Date Filing Date
US08/040,687 Continuation-In-Part US6051225A (en) 1988-10-19 1993-03-31 Family of high affinity, modified antibodies for cancer treatment
US82310597A Continuation-In-Part 1988-10-19 1997-03-24

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US26194288A Continuation 1988-10-19 1988-10-24

Publications (1)

Publication Number Publication Date
US6641999B1 true US6641999B1 (en) 2003-11-04

Family

ID=29273863

Family Applications (1)

Application Number Title Priority Date Filing Date
US09/503,653 Expired - Lifetime US6641999B1 (en) 1988-10-19 2000-02-14 Probing method for identifying antibodies specific for selected antigens

Country Status (1)

Country Link
US (1) US6641999B1 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20120315650A1 (en) * 2011-05-19 2012-12-13 Baxter International, Inc. Detection of circulating adamts13-antibody complexes
WO2013006544A1 (en) * 2011-07-06 2013-01-10 Medimmune, Llc Methods for making multimeric polypeptides

Citations (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4522918A (en) 1981-12-15 1985-06-11 Jeffery Schlom Process for producing monoclonal antibodies reactive with human breast cancer
US4612282A (en) 1981-12-15 1986-09-16 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Monoclonal antibodies reactive with human breast cancer
US4642334A (en) 1982-03-15 1987-02-10 Dnax Research Institute Of Molecular And Cellular Biology, Inc. Hybrid DNA prepared binding composition
US4656134A (en) 1982-01-11 1987-04-07 Board Of Trustees Of Leland Stanford Jr. University Gene amplification in eukaryotic cells
US4683195A (en) 1986-01-30 1987-07-28 Cetus Corporation Process for amplifying, detecting, and/or-cloning nucleic acid sequences
US4683202A (en) 1985-03-28 1987-07-28 Cetus Corporation Process for amplifying nucleic acid sequences
US4800159A (en) 1986-02-07 1989-01-24 Cetus Corporation Process for amplifying, detecting, and/or cloning nucleic acid sequences
WO1989000692A1 (en) 1987-07-15 1989-01-26 The United States Of America, As Represented By Th Second generation monoclonal antibodies having binding specificity to tag-72 and human carcinomas and methods for employing the same
WO1990014424A1 (en) 1989-05-16 1990-11-29 Scripps Clinic And Research Foundation Method for isolating receptors having a preselected specificity
US6204023B1 (en) * 1985-11-01 2001-03-20 Xoma Ltd. Modular assembly of antibody genes, antibodies prepared thereby and use

Patent Citations (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4612282A (en) 1981-12-15 1986-09-16 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Monoclonal antibodies reactive with human breast cancer
US4522918A (en) 1981-12-15 1985-06-11 Jeffery Schlom Process for producing monoclonal antibodies reactive with human breast cancer
US4656134A (en) 1982-01-11 1987-04-07 Board Of Trustees Of Leland Stanford Jr. University Gene amplification in eukaryotic cells
US4642334A (en) 1982-03-15 1987-02-10 Dnax Research Institute Of Molecular And Cellular Biology, Inc. Hybrid DNA prepared binding composition
US4683202B1 (en) 1985-03-28 1990-11-27 Cetus Corp
US4683202A (en) 1985-03-28 1987-07-28 Cetus Corporation Process for amplifying nucleic acid sequences
US6204023B1 (en) * 1985-11-01 2001-03-20 Xoma Ltd. Modular assembly of antibody genes, antibodies prepared thereby and use
US4683195B1 (en) 1986-01-30 1990-11-27 Cetus Corp
US4683195A (en) 1986-01-30 1987-07-28 Cetus Corporation Process for amplifying, detecting, and/or-cloning nucleic acid sequences
US4800159A (en) 1986-02-07 1989-01-24 Cetus Corporation Process for amplifying, detecting, and/or cloning nucleic acid sequences
WO1989000692A1 (en) 1987-07-15 1989-01-26 The United States Of America, As Represented By Th Second generation monoclonal antibodies having binding specificity to tag-72 and human carcinomas and methods for employing the same
US5512443A (en) 1987-07-15 1996-04-30 The United States Of America As Represented By The Department Of Health And Human Services Second generation monoclonal antibodies having binding specificity to TAG-72 and human carcinomas and methods for employing the same
WO1990014424A1 (en) 1989-05-16 1990-11-29 Scripps Clinic And Research Foundation Method for isolating receptors having a preselected specificity

Non-Patent Citations (23)

* Cited by examiner, † Cited by third party
Title
Boulianne et al. (1984), Nature, 312:643-64.
Brown et al. (1987), Cancer Research, 47:3577-3583.
Cabilly et al. (1984), Proc. Natl. Acad. Sci., USA, 81:2955-2959.
Jones et al. (1986), Nature, 312:522-525.
Kenten et al. (1984), Proc. Natl. Acad. Sci., USA, 81:2955-2959.
Kurosawa et al., J. Exp. Med. 155:201-218, 1982.* *
Liu et al. (1987), Proc. Natl. Acad. Sci., USA, 84:3439-3443.
Liu et al. (1987), The Journal of Immunology, 137(3):1066-1074.
Lui et al. (1984), Proc. Natl. Acad. Sci., USA, 81:5369-5373.
Manser et al. (1984), Proc. Natl. Acad. Sci., USA, 81:2470-2474.
Morrison et al. (1984), Proc. Natl. Acad. Sci., USA, 81:6851-6855.
Nueberger et al. (1984), Nature, 312:604-608.
Nueberger et al. (1984), Nature, 314:268-270.
Oi, et al. (1983), Proc. Natl. Acad. Sci., USA, 80:825-829.
Potter et al. (1984), Proc. Natl. Acad. Sci., USA, 81:7161-7165.
Rice, et al. (1982), Proc. Natl. Acad. Sci., USA, 79:7862-7865.
Sahagan et al. (1986), The Journal of Immunology, 137(3):1066-1074.
Shaw et al. (1987), The Journal of Immunology, 138(12):4534.
Short er al. (1988), Nucleic Acids Research, 16:7583-7600.
Siebenlist et al., Nature 294:631, 1981.* *
Sun et al. (1986), Hybridoma, 5(Suppl. 1):S17-S20.
Sun et al. (1987), Proc. Natl. Acad. Sci., USA, 84:214-218.
Whittle, et al. (1987), Protein Engineering, 1(6):499-505.

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20120315650A1 (en) * 2011-05-19 2012-12-13 Baxter International, Inc. Detection of circulating adamts13-antibody complexes
WO2013006544A1 (en) * 2011-07-06 2013-01-10 Medimmune, Llc Methods for making multimeric polypeptides

Similar Documents

Publication Publication Date Title
US5472693A (en) Family of anti-carcinoembryonic antigen chimeric antibodies
EP0365997B1 (en) A novel family of high affinity, modified antibodies for cancer treatment
US5874540A (en) CDR-grafted type III anti-CEA humanized mouse monoclonal antibodies
US5591593A (en) Minimum recognition unit of a PEM mucin tandem repeat specific monoclonal antibody and detection method using same
JP3492373B2 (en) Monoclonal antibody
AU653167B2 (en) Specific binding agents
US5993813A (en) Family of high affinity, modified antibodies for cancer treatment
US6207815B1 (en) Family of high affinity, modified antibodies for cancer treatment
US5645817A (en) Granulocyte-binding antibody constructs, their preparation and use
KR970007783B1 (en) Specific binding agents
US6641999B1 (en) Probing method for identifying antibodies specific for selected antigens
EP0618969B1 (en) Composite antibodies of human subgroup iv light chain capable of binding to tag-72
FI103477B (en) A method of producing a therapeutically useful antibody or antibody fragment
AU689331C (en) CDR-grafted type III anti-CEA humanized mouse monoclonal antibodies
JP3045313B2 (en) Complex antibody of human subgroup IV light chain capable of binding to TAG-72
NO316023B1 (en) Method for Preparation of a Therapeutically Active Antibody or Post-Therapeutically Active Fragment thereof selective for TAG-72

Legal Events

Date Code Title Description
AS Assignment

Owner name: DOW CHEMICAL COMPANY, THE, MICHIGAN

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:GOURLIE, BRIAN;REEL/FRAME:014365/0525

Effective date: 20000628

Owner name: DOW CHEMICAL COMPANY, THE, MICHIGAN

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:MEZES, PETER S.;REEL/FRAME:014365/0470

Effective date: 20000512

Owner name: DOW CHEMICAL COMPANY, THE, MICHIGAN

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:RIXON, MARK W.;REEL/FRAME:014365/0521

Effective date: 20000515

Owner name: THE DOW CHEMICAL COMPANY, MICHIGAN

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:ANDERSON, W. H. KERR;REEL/FRAME:014365/0481

Effective date: 20000518

STCF Information on status: patent grant

Free format text: PATENTED CASE

AS Assignment

Owner name: DEPARTMENT OF HEALTH AND HUMAN SERVICES, GOVERNMEN

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:SCHLOM, JEFFREY;REEL/FRAME:015509/0114

Effective date: 20041217

FEPP Fee payment procedure

Free format text: PAYOR NUMBER ASSIGNED (ORIGINAL EVENT CODE: ASPN); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY

AS Assignment

Owner name: THE GOVERNMENT OF THE UNITED STATES OF AMERICA AS

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:THE DOW CHEMICAL COMPANY;REEL/FRAME:018597/0844

Effective date: 20061011

FPAY Fee payment

Year of fee payment: 4

FPAY Fee payment

Year of fee payment: 8

FPAY Fee payment

Year of fee payment: 12