WO1989005857A1 - A METHOD OF SIMULTANEOUSLY PRODUCING A LARGE NUMBER OF Leu17-VIP-ANALOGS AND NEW Leu17-VIP-ANALOGS - Google Patents

A METHOD OF SIMULTANEOUSLY PRODUCING A LARGE NUMBER OF Leu17-VIP-ANALOGS AND NEW Leu17-VIP-ANALOGS Download PDF

Info

Publication number
WO1989005857A1
WO1989005857A1 PCT/SE1988/000696 SE8800696W WO8905857A1 WO 1989005857 A1 WO1989005857 A1 WO 1989005857A1 SE 8800696 W SE8800696 W SE 8800696W WO 8905857 A1 WO8905857 A1 WO 8905857A1
Authority
WO
WIPO (PCT)
Prior art keywords
vip
thr
lys
gly
arg
Prior art date
Application number
PCT/SE1988/000696
Other languages
French (fr)
Inventor
Tamas Bartfai
Marie-Louise TJÖRNHAMMAR
András SIMONCSITS
Miklós KÁLMÁN
Imre CSERPÁN
Original Assignee
Trion Forskning- Och Utvecklings Aktiebolag
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Trion Forskning- Och Utvecklings Aktiebolag filed Critical Trion Forskning- Och Utvecklings Aktiebolag
Publication of WO1989005857A1 publication Critical patent/WO1989005857A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/575—Hormones
    • C07K14/57563—Vasoactive intestinal peptide [VIP]; Related peptides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/02—Stomatological preparations, e.g. drugs for caries, aphtae, periodontitis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00—Drugs for disorders of the respiratory system
    • A61P11/08—Bronchodilators
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00—Drugs for disorders of the urinary system
    • A61P13/02—Drugs for disorders of the urinary system of urine or of the urinary tract, e.g. urine acidifiers
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P15/00—Drugs for genital or sexual disorders; Contraceptives
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/18—Antipsychotics, i.e. neuroleptics; Drugs for mania or schizophrenia
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/24—Antidepressants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/26—Psychostimulants, e.g. nicotine, cocaine
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A61P9/08—Vasodilators for multiple indications
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide

Definitions

  • Leu 17 -VIP-analogs and new Leu 17 -VIP-analogs.
  • the present invention relates to a method of simultaneously producing a large number of peptide analogs and to new peptide analogs.
  • the invention relates specifically to a method of simultaneously producing a group of individual C-terminally extended analogs of Leu 17 -VIP (vasoactive intestinal polypeptide), to new C-terminally extended analogs of Leu 17 - -VIP and to plasmids containing genes having DNA sequences which code for said new Leu 17 -VIP analogs.
  • the present invention provides a method of simultaneously producing a large number of C-terminally extended analogs of Leu 17 -VIP, wherein all amino acid residues are of L-configuration.
  • Vasoactive intestinal polypeptide is a highly basic 28 amino acids long peptide with a C-terminal amide belonging to the glucagon-secretin family.
  • VIP was first isolated by S. Said and V. Mutt in 1970 (Said, S.I. and Mutt, V. (1970) Science 169, 1217-1218) from porcine upper intestinal tissue, but has later been found both in nervous tissue and in endocrine cells (Said, S.I. (1982) Vasoactive Intestinal Peptide (Raven Press, N.Y.) and (Said, S.I. (1984) Peptides 5, 143-150).
  • VIP The biological effects of VIP include vasodilation of cerebral blood vessels, stimulation of prolactin release, stimulation of pancreatic exocrine secretion, effect on penile erection (Said, S.I. (1982) Vasoactive Intestinal Peptide (Raven Press, N.Y.) and (Rostene, W.H. (1984) Progress in Neurobiology 22, 103-129) and Mutt, V. (1983) in Brain Peptides,eds. Krieger, D.T., et al), potentiation of cholinergically stimulated salivary flow (Lundberg, J.M., et al (1982) Acta Physiol. Scand. 114, 329-337) and acting as surfactant in the lung (Barnes, P.J. (1987) TIPS, 8, 24-27).
  • C-terminal Gly-Lys- Arg or Gly alone may act as substrate sites for C-terminal amidation by peptidylglycine ⁇ -amidating mono- oxygenase (PAMase) detected in various tissues (Bradbury, A.F., et al. (1982) Nature 298, 686-688) and (Eipper, B.A., et al (1983) Peptides 4, 921-928) and (Glembotski, C.C., et. al (1984) J. Biol. Chem. 259, 6385-6392) and (Gomez, S., et. al (1984) FEBS Lett.
  • PAMase peptidylglycine ⁇ -amidating mono- oxygenase
  • vasoactive intestinal polypeptide said group consisting of equally long peptides having the amino acid sequence
  • X represents Thr, Ser, Pro or Ala
  • Y represents Thr, Lys, lle or Ala
  • Z represents Thr, Lys, lle or Arg
  • W represents Gly or Gly-Lys-Arg
  • Said method comprises the steps of simultaneously synthesizing a first mixture of equally long oligonucleotides which during synthesis are made ambiguous at the triplets coding for the ammo acid residues at positions 7 and 14 of Leu 17 -VIP, and which have a few identical bases at the 3'-end, simultaneously synthesizing a second mixture of equally long oligonucleotides which during synthesis are made ambiguous at the triplet coding for the amino acid residue at position 20 of Leu 17 -VIP, and which have a few identical bases at the 3'-end, these being complementary to .the few bases at the 3'-end of the oligonucleotides in the first mixture, mixing said first mixture with said second mixture, whereby the few bases at the 3'-end of the oligonucleotides of the first mixture anneal to the few bases at the
  • the Leu 17- VIP-W 29 analogs which arise from mutations when carrying out the method are Phe 2 -Pro 7 -Thr 14 -Arg 20 -VIP-Gly 29 -Lys 30 -Arg 31 val 3 -Thr 7 -Lys 14 -Ile 20 -VIP-Gly 29 -Lys 30 -Arg 31 Pro 4 -Thr 7 -Thr 14 -Lys 20 -VIP-Gly 29 -Lys 30 -Arg 31 Phe 5 -Pro 7 -Thr 14 -Ile 20 -VIP-Gly 29 -Lys 30 -Arg 31 Thr 6 -Ala 7 -Thr 14 -Thr 20 -VIP-Gly 29 -Lys 30 -Arg 31 Thr 6 -Ala 7 -Thr 14 -Thr 20 -VIP-Gly 29 -Lys 30 -Arg 31 Thr 6 -Ala 7 -Thr 14 -Thr 20 -VIP-Gly 29 -L
  • hosts to be used in the above method are bacteria, e.g. of genus Bacillus or Escherichia coli, and yeasts, e.g. Saccharomyces cerevisiae.
  • vectors to be used in the above method are bacteriophages and plasmids.
  • the vectors are plasmids and the hosts are E. coli.
  • Leu 17 -VIP which is chosen from the group consisting of peptides having the amino acid sequence
  • X represents Thr, Ser, Pro or Ala
  • Y represents Thr, Lys, Ile or Ala
  • Z represents Thr, Lys, Ile or Arg
  • W represents Gly or Gly-Lys-Arg
  • All the C-terminally extended Leu 17 -VIP analogs of the invention have, besides similar properties to natural human VIP, some useful properties in common, namely, they are ligands at VIP receptors, they are resistant to oxidation and can be kept at acidic pH in solution (due to the replacement of methionine in position 17 of natural VIP by leucine), and, since they are C-terminally extended, they exhibit a prolonged effect both in vitro and in vivo, which is considered to be of advantage in view of the extremly short biological half-life of VIP.
  • the new pharmaceuticals are intended to be administered i) for the treatment of asthma and of constriction of the upper airways in general, specially for vasodilation in the lungs, 2) as pheripheric vasodilators to be locally applied for i.a. erection of penis, 3) for the treatment of VIPOMA (a VIP producing intestinal tumour which causes death of a human by loss of 5-15 liters of water per day),
  • composition of pharmaceuticals including the active ingredient will depend on the intended route of administration and the specific disorder to be treated.
  • a nasal or oral spray is suitable when asthma is to be treated.
  • Aqueous solutions or tablets for oral administration will be suitable for other indications.
  • the active ingredient is in admixture with pharmaceutically acceptable excipients and/or diluents normally used in the field of pharmacy.
  • a large number of artificial genes coding for C-termmally extended Leu 17 -VIP analogs were planned to be obtained directly as parts of an E. coli plasmid expression vector by performing only one cloning step.
  • the synthetic strategy utilized the principle of a method described originally [Simoncsits, A., Kalman, M., Cserpan, J. and Kari, C. (1984) Nucleic Acids Res. Symp. Ser. 14, 321] for obtaining a large number of artificial E. coli promoter derivatives. Briefly, two single-stranded oligodeoxyribonucleotides were chemically synthesized and were annealed [Itakura, K. (1982) TIBS, 7 , 442] through their 3' -terminal complementary sequences. The partial duplex obtained so covered the whole Leu 17 -VIP coding region and contained additional terminal sequences to be used for cloning.
  • the two oligodeoxyribonucleotides were obtained by ambiguous chemical synthesis so that the mixture of all four activated nucleotide monomers were used at certain predetermined positions (i.e. in triplets coding for the amino acid residues 7, 14 and 20 of
  • the annealed partial duplex was converted by a mutually primed synthesis effected by DNA polymerase (Klenow fragment) into double-stranded DNA mixture containing all possible homoduplexes. These were then cleaved with two different restriction endonucleases the cleavage sites of them being located upstream and downstream of the Leu 17 -VIP coding region and the cleaved mixture was ligated with the appropriately cleaved expression vector pPEX. The ligated mixture was transformed into competent E. coli cells and the recombinants containing Leu 17 -VIP related coding sequences were selected by colony hybridization.
  • the positive recombinants were further analyzed by nucleotide sequencing to identify the particular mutations obtained in the cloned Leu 17- VIP coding region.
  • synthetic oligodeoxyribonucleotides it was considered that they should code for a methionine preceding the Leu 17 -VIP coding region and for a Gly (VlPa analogs) or a Gly-Lys-Arg (VIPb-analogs) extension at the carboxy terminus.
  • Methionine was included to be able to release the
  • the VIPl oligonucleotide shown as the upper-strand of the partial, annealed duplex in Scheme 1 contains two mixed positions (N), while the lower strand VIP2 oligonucleotide contains only one.
  • the VIP2 oligonucleotide was prepared in two variations carrying information for C-terminal extensions as above (VIP2a and VIP2b oligonucleotides in Scheme 1). To obtain both VlPa and VIPb analogs, two separate experiments were carried out using VIPl + VIP2a or VIPl + VIP2b olignucleotides, respectively.
  • the double stranded DNA mixture obtained by Klenow polymerase reaction contained homoduplex molecules which were separated by cloning into an expression vector. In principle, all recombinants should contain only one type of mutant gene coding for a particular
  • pPEX vector pPEX is a highly efficient E. coli expression vector constructed from a rac fusion [Boros, J., Lukacsovich, T., Baliko, G. and Venetianer, P. (1986) Gene 42, 97] promoter vector L ⁇ int 23 named as pPEX by us.
  • the L ⁇ int 23 vector which expresses under rac promoter control a fusion protein composed of 280 amino acids of E.
  • coli ⁇ -galactosidase and part of the bacterial CAT was modified by eliminating its unique BamHI site and by replacing its CAT coding region located between Clal and EcoRI sites with a synthetic polycloning region.
  • the relevant region of the pPEX vector obtained so is shown in Scheme 2.
  • the vector contains unique BamHI, Kpnl, SacI, Apal and EcoRI sites in the polycloning region and ⁇ -galactosidase gene fusions can be performed using the BamHI and any of the other unique sites.
  • T4 DNA ligase was obtained from New England Biolabs.
  • T4 polynucleotide kinase and Klenow polymerase were from Boehringer, [ ⁇ - 32 P]ATP (>5000 Ci/mmol) and [ ⁇ - 32 P]dATP (800 Ci/mmol) were from Amersham, Rabbit antisera directed against BSA-VIP conjugates was provided by Dr. Per Askelof (SBL, Sweden).
  • Immunoblot assay kit containing antirabbit IgG-alkaline phosphatase conjugate and color development reagents BCIP/NBT was purchased from Bio-Rad.
  • T RNase was purchased from Calbiochem. Oligodeoxyribonucleotides
  • ACAGCCAGCTGT VIP2b oligonucleotide
  • oligonucleotides were prepared on an automatic DNA synthesizer by the phosphoramidite chemistry (Pharmacia Gene Assembler) and were purified by electrophoresis on polyacrylamide gels containing 8 M urea. Oligonucleotides were 5'-phosphorylated with [ ⁇ - 32 P]ATP by using
  • T4 polynucleotide kinase Maniates, T., Fritsch, E.F. and Sambrook, J. (1982) Molecular Cloning: A laboratory manual, Cold Spring Harbor Laboratory, Cold Spring Harbor N.Y] when they were to be used as either hybridization probe or sequencing primer.
  • the solution was made up to 100 ⁇ l containing 10 mM Tris-HCl, pH 8.2, 5 inM MgCl 2 , 50 ⁇ M each of dCTP, dGTP and TTP, 5 ⁇ l of [ ⁇ - 32 P]dATP (approx. 62.5 pmol) and 1 ⁇ l of 5U/ ⁇ l Klenow polymerase. After 15 min 10 ⁇ l of 1 mM dNTP mixture (containing all four deoxynucleoside 5' -triphosphates) was added and the solution was incubated at room temperature for 15 min.
  • the DNA was precipitated with the help of 1 ⁇ l of 10 ⁇ g/ ⁇ l yeast carrier tRNA (ctRNA) by ethanol precipitation and purified by 10% acrylamide-8 M urea gel electrophoresis at 400V for 2 hrs (gel thickness 0.4 mm).
  • the gel was radioautographed, the major radioactive band was cut out and soaked in 300 ⁇ l of 50 mM NaCl - 0.1% SDS solution at 37°C for 12 hrs.
  • the supernatant was phenol extracted and the precipitation was carried out by adding 1 ⁇ l of 10 ⁇ g/ ⁇ l ctRNA, 30 ⁇ l of 3 M NaOAc, pH 5.2 and 900 ⁇ l of ethanol in a liquid nitrogen bath.
  • the reaction mixture was heated to 60°C for 10 min, phenol extracted (two times), and the DNA was recovered from the waterphase by ethanol precipitation as above (two times) followed by ethanol washing, drying and redissolving in sterile water. Analysis of the mixture by 10% acrylamide-8 M urea electrophoresis showed that only approx. 50% of the duplex was cleaved and the fraction of the DNA which had been cleaved by both enzymes was only approx. 30%. Nevertheless, the mixture was used as it was for cloning into BamHI-EcoRI cleaved pPEX vector. Cleavage of pPEX vector with BamHI and EcoRI
  • Plasmid DNA was prepared by a rapid alkaline extraction procedure [Birnboim, H.C. and Doly, J. (1979) Nucleic Acids Res., 7 , 1513-1523].
  • the plasmid DNA was further treated with 5 units of T 1 RNase in 100 ⁇ l solution containing 10 mM Tris-HCl, pH 8.0, 1 mM EDTA at 37°C for 30 min followed by phenol extraction and ethanol precipitation. The pellet was taken up in 30 ⁇ l of sterile water. Dideoxynucleotide sequencing was performed on
  • E. coli JM101 cells transformed with pPEX Leu 17 -VIP analog plasmids were grown at 37°C, shaking 250 rpm, in 1 ml LB medium containing 0.1 mg/ml ampicillin.
  • the cells were collected by centrifugation at 12 000 rpm in an Eppendorf centrifuge for 1 minute, lysed at 100°C for 3 minutes in 300 ⁇ l of lysis buffer (0.125 M Tris-HCl pH 6.8, 30% glycerol, 2% SDS, 6 M urea and
  • the cells were harvested by centrifugation at 2000 x g, 4°C for 10 minutes, washed with 40 ml of TBS, pH 7.6, and resuspended in 30 ml TBS containing 10 ⁇ M PMSF and 0.5 mM EDTA.
  • the cell suspension was then freeze-thawed and sonicated (five 1 minute bursts) in a Branson sonifier, then centrifuged at 17000 x g, 4°C, for 30 minutes.
  • the pellet containing the fusion protein was homogenized in 50 ml 6 M guanidium chloride containing 1% 2-mercaptoethanol according to Goeddel, D.V. et. al.
  • the dissolved Leu 17 -VIP analog was desalted with a Sephadex G25 column (7 cm long, 2 cm diameter) and freeze-dried before dissolution in 1% TFA and purified on HPLC with a 20%-40% acetonitrile linear gradient in 1% TFA.
  • the Leu 17 -VIP analog was eluted at 33% acetonitrile.
  • the purified Leu 17 -VIP analog was then tested in biochemical and biological assay systems .
  • the fusion protein 3-galactosidase - VlPa was expressed in 1 liter LB medium containing 0.1 mg/ml ampicillin and purified as described above.
  • the fusion protein was cleaved with CNBr and VlPa so obtained was further purified as described above and tested in the following assay systems:
  • VlPa VlPa recombinant VlPa is recognized as VIP when measured according to the manufacturer's recommendation, based on the method of Fahrenkrug, J. and Schaffalitzky De Muckadell, 0. (1977) J. Lab. Clin. Med. 89 . , 1379-1388.
  • Radioreceptor assay was carried out on membranes from rat cerebral cortex using chloramin-T iodinated 125 I-VIP (Hallden, G. et. al. (1986) Reg. Pep. 16, 183-188) at 0.5 nM concentration, studying the displacement of the labeled VIP by purified VIP from porcine intestine and by recombinant VlPa from E. coli as described by Abens , J. et al. (1984) Peptides 5, 375-377.
  • the affinity of recombinant VlPa was within the experimental error identical to that of VIP purified from porcine intestine with a Kd value of 1.5-1.8 nM at equilibrium, proving that recombinant VlPa is a high affinity ligand at VIP receptors, binding in a manner indistinguishable from that of VIP obtained from other sources.
  • Rat cerebral cortical slices (0.4 mm x 0.4 mm) were preincubated in Krebs Ringers bicarbonate buffer, bubbled with O 2 /CO 2 (95%/5%) (V/V) for 60 minutes at 36°C in the presence of 10 mM theophylline (a phosphodiesterase inhibitor).
  • the tissue slices were then incubated in 600 ⁇ l total volume with porcine VIP at 10, 50, 100 nM, 1 and 10 ⁇ M concentration for 10 minutes and with recombinant VlPa at 10, 50, 100 and 300 nM concentration (estimated by 1)) for 10 minutes.
  • the incubations were terminated by addition of 150 ⁇ l EGTA (100 mM) solution followed by placing the test tubes into a boiling water bath for 3 minutes.
  • the cAMP content was measured according to Brown, B.L. et al. (1972) Adv. Cycl. Nucl. Res. 2 , 25-40. The results indicate that at 10 minutes incubation time recombinant VlPa produced an increase in cAMP levels and thus act as agonist at the VIP-receptor coupled adenylate cyclase, which is thought to mediate the physiological actions of VIP (cf. Rostene, W.H. (1984) Progr. Neurobiol. 22, 103-129).

Abstract

A method of simultaneously producing a large number of individual C-terminally extended analogs of Leu17-VIP is described. Said method comprises the steps of synthesizing two separate mixtures of equally long oligonucleotides coding for N-terminal and C-terminal portions of Leu17-VIP analogs, respectively, each having a few defined triplets which are made ambiguous and a few identical bases at the 3'-end, mixing said two mixtures to form a mixture of partially double stranded equally long DNA sequences, which are enzymatically converted into double stranded DNA sequences, subjecting the last mentioned mixture to cleavage, with two different enzymes to produce DNA sequences, which are inserted into similarly cleaved vectors by ligation, whereupon the vectors, are transformed into hosts, propagating said hosts to form colonies, which are analyzed one by one to establish the DNA sequences which code for a single protein, propagating separately under expression conditions those hosts which contain vectors having identified protein coding sequences, whereupon the separately expressed proteins are cleaved to release the C-terminally extended analogs of Leu17-VIP. Additionally there are disclosed new C-terminally extended analogs of Leu17-VIP and plasmids containing genes coding for the new analogs of Leu17-VIP.

Description

A method of simultaneously producing a large number of
Leu 17-VIP-analogs and new Leu17-VIP-analogs.
The present invention relates to a method of simultaneously producing a large number of peptide analogs and to new peptide analogs. The invention relates specifically to a method of simultaneously producing a group of individual C-terminally extended analogs of Leu 17-VIP (vasoactive intestinal polypeptide), to new C-terminally extended analogs of Leu 17- -VIP and to plasmids containing genes having DNA sequences which code for said new Leu 17-VIP analogs. Background
The pharmaceutical industry, and independent research workers, are constantly searching for new compounds, which slightly differ from useful known compounds, with the aim of finding more potent, more specific etc derivatives. In case the known compound of interest is a peptide or polypeptide, one or several amino acid residues of the amino acid sequence thereof are substituted for other natural or unnatural amino acid residues. For screening purposes it would be desirable to be able to simultaneously produce a large number of analogs of a chosen peptide in order to save both time and money.
The present invention provides a method of simultaneously producing a large number of C-terminally extended analogs of Leu 17-VIP, wherein all amino acid residues are of L-configuration. Prior Art
Vasoactive intestinal polypeptide (VIP) is a highly basic 28 amino acids long peptide with a C-terminal amide belonging to the glucagon-secretin family. VIP was first isolated by S. Said and V. Mutt in 1970 (Said, S.I. and Mutt, V. (1970) Science 169, 1217-1218) from porcine upper intestinal tissue, but has later been found both in nervous tissue and in endocrine cells (Said, S.I. (1982) Vasoactive Intestinal Peptide (Raven Press, N.Y.) and (Said, S.I. (1984) Peptides 5, 143-150). The biological effects of VIP include vasodilation of cerebral blood vessels, stimulation of prolactin release, stimulation of pancreatic exocrine secretion, effect on penile erection (Said, S.I. (1982) Vasoactive Intestinal Peptide (Raven Press, N.Y.) and (Rostene, W.H. (1984) Progress in Neurobiology 22, 103-129) and Mutt, V. (1983) in Brain Peptides,eds. Krieger, D.T., et al), potentiation of cholinergically stimulated salivary flow (Lundberg, J.M., et al (1982) Acta Physiol. Scand. 114, 329-337) and acting as surfactant in the lung (Barnes, P.J. (1987) TIPS, 8, 24-27).
Recently the precursor gene coding for human VIP has been isolated and sequenced (Bodner, M., et al. (1985) Proc. Natl. Acad. Sci. USA, 8J2, 3548-3551) and (Linder, S., et al. (1987) Proc. Natl. Acad. Sci. USA, 84, 605-609). The sequence data show that at the 3'-end of the gene coding for VIP there are three additional triplets coding for the amino acid sequence Gly-Lys-Arg. It has been shown that C-terminal Gly-Lys- Arg or Gly alone may act as substrate sites for C-terminal amidation by peptidylglycine α-amidating mono- oxygenase (PAMase) detected in various tissues (Bradbury, A.F., et al. (1982) Nature 298, 686-688) and (Eipper, B.A., et al (1983) Peptides 4, 921-928) and (Glembotski, C.C., et. al (1984) J. Biol. Chem. 259, 6385-6392) and (Gomez, S., et. al (1984) FEBS Lett. 167, 160-164) and (Eipper, B.A., et. al. (1985) Endocrinology, 116, 2497-2504) and Ouafik, H., et. al. (1987) Proc. Natl. Acad. Sci. USA, 84, 261-264). It is obvious that large scale production by genetic engineering methods of VIP, a peptide hormone of broad biological activity, and analogs thereof, would be desirable. Although the human precursor gene for VIP has been isolated and characterized (Bodner, M., et. al. (1985) Proc. Natl. Acad. Sci. USA, 82, 3548-3551) and Linder, S., et. al. (1987) Proc. Natl. Acad. Sci. USA, 84, 605-609), its expression in another organism has not been reported yet. The C-terminally extended Leu 17-VIP analogs of the present invention have been produced in E. coli.
Description of the invention In one aspect of the invention there is provided a method of simultaneously producing a group of individual C-terminally extended analogs of Leu17-VIP
(vasoactive intestinal polypeptide), said group consisting of equally long peptides having the amino acid sequence
His-Ser-Asp-Ala-Val-Phe-X-Asp-Asn-Tyr-Thr-Arg-Leu-Y-
1 2 3 4 5 6 7 8 9 10 11 12 13 14
-Lys-Gln-Leu-Ala-Val-Z-Lys-Tyr-Leu-Asn-Ser-Ile-Leu- 15 16 17 18 19 20 21 22 23 24 25 26 27
-Asn-W 28 29
wherein X represents Thr, Ser, Pro or Ala, Y represents Thr, Lys, lle or Ala Z represents Thr, Lys, lle or Arg, and W represents Gly or Gly-Lys-Arg,
and of equally long peptides which are also Leu17-VIP- W29 analogs and which arise from mutations when carrying out the method. Said method comprises the steps of simultaneously synthesizing a first mixture of equally long oligonucleotides which during synthesis are made ambiguous at the triplets coding for the ammo acid residues at positions 7 and 14 of Leu 17-VIP, and which have a few identical bases at the 3'-end, simultaneously synthesizing a second mixture of equally long oligonucleotides which during synthesis are made ambiguous at the triplet coding for the amino acid residue at position 20 of Leu17-VIP, and which have a few identical bases at the 3'-end, these being complementary to .the few bases at the 3'-end of the oligonucleotides in the first mixture, mixing said first mixture with said second mixture, whereby the few bases at the 3'-end of the oligonucleotides of the first mixture anneal to the few bases at the 3' -end of the oligonucleotides of the second mixture, resulting in a mixture of partially double stranded equally long DNA sequences, which thereafter are enzymatically converted into fully double stranded DNA sequences, subjecting said mixture of double stranded DNA sequences, which include at the 3'-end a site for cleavage with a first enzyme and at the 5'-end a site for cleavage with a second enzyme, to cleavage, simultaneously or consecutively, with the first and the second enzyme to produce DNA sequences with 3'- and 5'-ends which are ligatable to the 5'- and 3'-ends of similarly cleaved vectors, inserting the thus cleaved DNA sequences into the thus cleaved vectors by ligation to produce a mixture of vectors, which are then transformed into hosts in per se known manner, propagating said hosts to form colonies, which are analyzed one by one to establish those DNA sequences which code for a single protein, propagating separately under expression conditions those hosts which contain vectors having identified protein coding sequences, the C-terminal portions of which correspond to an individual Leu 17-VIP-W29 analog, whereupon the separately expressed proteins are cleaved to release the C-terminal Leu 17-VIP-W29 analogs forming a group of said individual equally long peptides.
In one embodiment of this aspect of the invention, wherein W represents Gly, the Leu 17-VIP-W29 analogs which arise from mutations when carrying out the method are
Asp1-Ala7-Ile14-Thr20-VIP-Gly29
Tyr1-Pro7-Thr14-Lys20-VIP-Gly29 Tyr2-Thr7-Tyr8-Thr14-Thr20-VIP-Gly29 Gly3-Thr7-Thr14-Arg20-VIP-Gly29 Pro4-Thr7-Arg14-Thr20-VIP-Gly29
Phe5-Thr7-Thr14-Lys20-VIP-Gly29
Thr7-Asn8-Arg14-Arg20-VIP-Gly29 Pro7-Gly8-Thr14-Lys20-VIP-Gly29 Pro7-Gln8-Ile14-Phe19-Arg20-VIP-Gly29
Ser7-Pro8-Ile14-Arg20-VIP-Gly29
Ala7-Pro11-Lys14-Lys20-VIP-Gly29
Pro7-Pro12-Thr14-Thr20-VIP-Gly29 Thr7-Lys14-Asn15-Ile20-VIP-Gly29
Pro7-Ile14Arg15-Lys20-VIP-Gly29
Ala7-Lys14-Gln15-Arg20-VIP-Gly29
Ala7-Ile14-Thr15-Lys20-VIP-Gly29 Thr7-Lys14-His16-Lys20-VIP-Gly29 Pro7-Ile14-His16-Thr20-VIP-Gly29
Thr7-Ile14-Phe19-lle20-VIP-Gly29
Pro7-Thr14-Thr20-Lys24-VIP-Gly29
Ser7-Lys14-Thr20-Ile24-VIP-Gly29
Thr7-Thr14-Lys20-Asp28-VIP-Gly29 Gly7-Lys14-Lys20-VIP-Gly29, and Ala7-Asn14-Arg20-VIP-Gly29.
In another embodiment of this aspect of the invention, wherein W represents Gly-Lys-Arg, the Leu 17- VIP-W 29 analogs which arise from mutations when carrying out the method are Phe2-Pro7-Thr14-Arg20-VIP-Gly29-Lys30-Arg31 val3-Thr7-Lys14-Ile20-VIP-Gly29-Lys30-Arg31 Pro4-Thr7-Thr14-Lys20-VIP-Gly29-Lys30-Arg31 Phe5-Pro7-Thr14-Ile20-VIP-Gly29-Lys30-Arg31 Thr6-Ala7-Thr14-Thr20-VIP-Gly29-Lys30-Arg31
Thr7-Val8-Thr14-Thr20-VIP-Gly29-Lys30-Arg31 Pro7-Pro11-Thr14-Lys20-VIP-Gly29-Lys30-Arg31 Pro7-Pro11-Ile14-Arg20-VIP-Gly29-Lys30-Arg31 Thr7-Arg13-Lys14-Arg20-VIP-Gly29-Lys30-Arg31 Pro7-Gln13-Lys14-Lys20-VIP-Gly29-Lys30-Arg31
Pro7-Pro13-Thr14-Thr20-VIP-Gly29-Lys30-Arg31 Pro7-Pro13-Thr14-Arg20-VIP-Gly29-Lys30-Arg31 Ser7-Arg13-Thr14-Gln15-Thr20-VIP-Gly29-Lys30-Arg31Pro7-Lys14-Gln15-Arg20-VIP-Gly29-Lys30-Arg31 Ser7-Lys14-Asn15-Arg20-VIP-Gly29-Lys30-Arg31 Thr7-Lys14-Asp19-Lys20-VIP-Gly29-Lys30-Arg31 Thr7-Lys14-Gly19-Thr20-VIP-Gly29-Lys30-Arg31 Thr7-Thr14-Ile20-Asp24-VIP-Gly29-Lys30-Arg31 Ala7-Ile14-Arg20 Asp24-VIP-Gly29-Lys30-Arg31 Ser7-Ile14-Thr20-Lys24-VIP-Gly29-Lys30-Arg31 Pro7-Ile14-Thr20-Tyr25-VIP-Gly29-Lys30-Arg31 and, Ser7-Thr14-Ile20-Val26-VIP-GLy29-LYs30-Arg31 .
Examples of hosts to be used in the above method are bacteria, e.g. of genus Bacillus or Escherichia coli, and yeasts, e.g. Saccharomyces cerevisiae.
Examples of vectors to be used in the above method are bacteriophages and plasmids.
In a preferred embodiment of this aspect of the invention, the vectors are plasmids and the hosts are E. coli.
As a result of carrying out said preferred embodiment of the method of the invention there was produced a large number of C-terminally extended Leu 17-VIP analogs, which form an additional aspect of the invention. Thus, in an additional aspect of the invention there is provided a C-terminally extended analog of
Leu 17-VIP which is chosen from the group consisting of peptides having the amino acid sequence
His-Ser-Asp-Ala-Val-Phe-X-Asp-Asn-Tyr-Thr-Arg-Leu-Y- 1 2 3 4 5 6 7 8 9 10 11 12 13 14
-Lys-Gln-Leu-Ala-Val-Z-Lys-Tyr-Leu-Asn-Ser-Ile-Leu- 15 16 17 18 19 20 21 22 23 24 25 26 27
-Asn-W 28 29
wherein X represents Thr, Ser, Pro or Ala,
Y represents Thr, Lys, Ile or Ala
Z represents Thr, Lys, Ile or Arg, and
W represents Gly or Gly-Lys-Arg,
(which resulted from the method and which were originally planned to be produced) and analogs of Leu 17-VIP having the same amino acid sequence wherein W represents Gly, except for His in position 1 which is sμbstituted by Asp when X = Ala, Y = Ile and Z = Thr, except for His in position 1 which is substituted by Tyr when X = Pro, Y = Thr and Z = Lys, except for Ser in position 2 which is substituted by Tyr and Asp in position 8 which is substituted by Tyr when X = Thr, Y = Thr and Z = Thr, except for Asp in position 3 which is substituted by Gly when X = Thr, Y = Thr and Z = Arg, except for Ala in position 4 which is substituted by Pro when X = Thr, Y = Arg and Z = Thr, except for Val in position 5 which is substituted by Phe when X = Thr, Y = Thr and Z = Lys, except for Asp in position 8 which is substituted by Asn when X = Thr, Y = Arg and Z = Arg, except for Asp in position 8 which is substituted by Gly when X = Pro, Y = Thr and X = Lys, except for Asp in position 8 which is substituted by Gln and Val in position 19 which is substituted by Phe when X = Pro, Y = Ile and Z = Arg, except for Asp in position 8 which is substituted by Pro when X = Ser, Y = Ile and Z = Arg, except for Thr in position 11 which is substituted by Pro when X = Ala, Y = Lys and Z = Lys, except for Arg in position 12 which is substituted by Pro when X = Pro, Y = Thr and Z = Thr, except for Lys in position 15 which is substituted by Asn when X = Thr, Y = Lys and Z = Ile, except for Lys in position 15 which is substituted by Arg when X = Pro, Y = Ile and Z = Lys, except for Lys in position 15 which is substituted by Gln when X = Ala, Y = Lys and Z = Arg, except for Lys in position 15 which is substituted by Thr when X = Ala, Y = Ile and Z = Lys, except for Gln in position 16 which is substituted by His when X = Thr, Y = Lys and Z = Lys, except for Gln in position 16 which is substituted by His when X = Pro, Y = Ile and Z = Thr, except for Val in position 19 which is substituted by Phe when X = Thr, Y = Ile and Z = Ile, except for Asn in position 24 which is substituted by Lys when X = Pro, Y = Thr and Z = Thr, except for Asn in position 24 which is substituted by Ile when X = Ser, Y = Lys and Z = Thr, except for Asn in position 28 which is substituted by Asp when X = Thr, Y = Arg and Z = Lys, and X = Gly when Y = Lys and Z = Lys, and X = Ala when Y = Asn and Z = Arg,
[these analogs can be named with regard to VIP as follows: Asp1-Ala7-Ile14-Thr20-VIP-Gly29
Tyr1-Pro7-Thr14-Lys20-VIP-Gly29
Tyr2-Thr7-Tyr8-Thr14-Thr20-VIP-Gly29 Gly3-Thr7-Thr14-Arg20-VIP-Gly29 Pro4-Thr7-Arg14-Thr20-VIP-Gly29 Phe5-Thr7-Thr14-Lys20-VIP-Gly29
Thr7-Asn8-Arg14-Arg20-VIP-Gly29
Pro7-Gly8-Thr14-Lys20-VIP-Gly29 Pro7-Gln8-Ile14-Phe19-Arg20-VIP-Gly29 Ser7-Pro8-Ile14-Arg20-VIP-Gly29
Ala7-Pro11-Lys14-Lys20-VIP-Gly29
Pro7-Pro12-Thr14-Thr20-VIP-Gly29
Thr7-Lys14-Asn15-Ile20-VIP-Gly29 Pro7-Ile14Arg15-Lys20-VIP-Gly29 Ala7-Lys14-Gln15-Arg20-VIP-Gly29
Ala7-Ile14-Thr15-Lys20-VIP-Gly29 Thr7-Lys14-His1 6-Lys20-VIP-Gly29 Pro7-Ile14-His16-Thr20-VIP-Gly29
Thr7-lle14-Phe19-Ile20-VIP-Gly29 Pro7-Thr14-Thr20-Lys24-VIP-Gly29
Ser7-Lys14-Thr20-lie24-VIP-Gly29
Thr7-Thr14-Lys20-Asp28-VIP-Gly29
Gly7-Lys14-Lys20-VIP-Gly29 and
Ala7-Asn14-Arg20-VIP-Gly29] (which arose as mutations when carrying out one run of the preferred embodiment of the method of the invention)
and analogs of Leu17-VIP having the same amino acid sequence wherein W represents -Gly-Lys-Arg except for Ser in position 2 which is substituted by Phe when X = Pro, Y = Thr and X = Arg, except for Asp in position 3 which is substituted by Val when X = Thr, Y = Lys and Z = Ile, except for Ala in position 4 which is substituted by Pro when X = Thr, Y = Thr and Z = Lys, except for Val in position 5 which is substituted by Phe when X = Pro, Y = Thr and Z = Ile, except for Phe in position 6 which is substituted by Thr when X = Ala, Y = Thr and Z = Thr, except for Asp in position 8 which is substituted by Val when X = Thr, Y = Thr and Z = Thr, except for Thr in position 11 which is substituted by Pro when X = Pro, Y = Thr and Z = Lys, except for Thr in position 11 which is substituted by Pro when X = Pro, Y = Ile and Z = Arg, except for Leu in position 13 which is substituted by Arg when X = Thr, Y = Lys and Z = Arg, except for Leu in position 13 which is substituted by Gln when X = Pro, Y = Lys and Z = Lys, except for Leu in position 13 which is substituted by Pro when X = Pro, Y = Thr and Z = Thr, except for Leu in position 13 which is substituted by Pro when X = Pro, Y = Thr and Z = Arg, except for Leu in position 13 which is substituted by Arg and Lys in position 15 which is substituted by Gln when X = Ser, Y = Thr and Z = Thr, except for Lys in position 15 which is substituted by Gln when X = Pro, Y = Lys and Z = Arg, except for Lys in position 15 which is substituted by Asn when X = Ser, Y = Lys and Z = Arg, except for Val in position 19 which is substituted by Asp when X = Thr, Y = Lys and Z = Lys, except for Val in position 19 which is substituted by Gly when X = Thr, Y = Lys and Z = Thr, except for Asn in position 24 which is substituted by Asp when X = Thr, Y = Thr and Z = Ile, except for Asn in position 24 which is substituted by Asp when X = Ala, Y = Ile and Z = Arg, except for Asn in position 24 which is substituted by Lys when X = Ser, Y = Ile and Z = Thr, except for Ser in position 25 which is substituted by Tyr when X = Pro, Y = Ile and Z = Thr, and except for Ile in position 26 which is substituted by Val when X = Ser, Y = Thr and Z = Ile, [these analogs can be named with regard to VIP as follows:
Phe2-Pro7-Thr14-Arg20-VIP-Gly29-Lys30-Arg31 Val3-Thr7-Lys14-Ile20-VIP-Gly29-Lys30-Arg31
Pro4-Thr7-Thr14-Lys20-VIP-Gly29-Lys30-Arg31 Phe5-Pro7-Thr14-Ile20-VIP-Gly29-Lys30-Arg31 Thr6-Ala7-Thr14-Thr20-VIP-Gly29-Lys30-Arg31
Thr7-Val8-Thr14-Thr20-VIP-Gly29-Lys30-Arg31
Pro7-Pro11-Thr14-Lys20-VIP-Gly29-Lys30-Arg31
Pro7-Pro11-Ile14-Arg20-VIP-Gly29-Lys30-Arg31 Thr7-Arg1 3-Lys14-Arg20-VIP-Gly29-Lys30-Arg31 Pro7-Gln13-Lys14-Lys20-VIP-Gly29-Lys30-Arg31 Pro7-Pro13-Thr14-Thr20-VIP-Gly29-Lys30-Arg31 Pro7-Pro13-Thr14-Arg20-VIP-Gly29-Lys30-Arg31 Ser7-Arg13-Thr14-Gin15-Thr20-VIP-Gly29-Lys30-Arg31 Pro7-Lys14-Gln15-Arg20-VIP-Gly29-Lys30-Arg31 Ser7-Lys14-Asn15-Arg20-VIP-Gly29-Lys30-Arg31
Thr7-Lys14-Asp19-Lys20-VIP-Gly29-Lys30-Arg31
Thr7-Lys14-Gly19-Thr20-VIP-Gly29-Lys30-Arg31 Thr7-Thr14-Ile20-Asp24-VIP-Gly29-Lys30-Arg31 Ala7-Ile14-Arg20-Asp24-VIP-Gly29-Lys30-Arg31 Ser7-Ile14-Thr20-Lys24-VIP-Gly29-Lys30-Arg31 Pro7-Ile14-Thr20-Tyr25-VIP-Gly29-Lys30-Arg31 and, Ser7-Thr14-Ile20-Val26-VIP-Gly29-Lys30-Arg31]
(which arose as mutations when carrying out a second run of the preferred embodiment of the method of the invention).
All the amino acid residues in the C-terminally extended Leu17-VIP analogs of the invention are of
L-configuration. In a further aspect of the invention there is provided a plasmid containing a gene having a DNA sequence which codes for a C-terminally extended Leu17- VIP analog of the invention.
All the C-terminally extended Leu 17-VIP analogs of the invention have, besides similar properties to natural human VIP, some useful properties in common, namely, they are ligands at VIP receptors, they are resistant to oxidation and can be kept at acidic pH in solution (due to the replacement of methionine in position 17 of natural VIP by leucine), and, since they are C-terminally extended, they exhibit a prolonged effect both in vitro and in vivo, which is considered to be of advantage in view of the extremly short biological half-life of VIP.
Thus the C-terminally extended Leu 17-VIP analogs of the invention are useful as potential active ingredients in new pharmaceuticals, as well as in cosmetics (for hydration of the skin).
The new pharmaceuticals are intended to be administered i) for the treatment of asthma and of constriction of the upper airways in general, specially for vasodilation in the lungs, 2) as pheripheric vasodilators to be locally applied for i.a. erection of penis, 3) for the treatment of VIPOMA (a VIP producing intestinal tumour which causes death of a human by loss of 5-15 liters of water per day),
4) for the treatment of disorders of blood flow, blood-pressure, intestinal motility and urinary bladder,
5) for potentiation of salivation e.g. for the treatment of blocked or reduced salivation (e.g. due to administration of antipsychotic drugs or anti- depressants), and 6) for the stimulation of pancreatic juice secretion. The composition of pharmaceuticals including the active ingredient will depend on the intended route of administration and the specific disorder to be treated. A nasal or oral spray is suitable when asthma is to be treated. Aqueous solutions or tablets for oral administration will be suitable for other indications. In all types of pharmaceuticals the active ingredient is in admixture with pharmaceutically acceptable excipients and/or diluents normally used in the field of pharmacy. General strategy to obtain Leu 17-VIP analog-coding DNA sequences cloned in an E. coli expression vector
A large number of artificial genes coding for C-termmally extended Leu 17-VIP analogs were planned to be obtained directly as parts of an E. coli plasmid expression vector by performing only one cloning step. The synthetic strategy utilized the principle of a method described originally [Simoncsits, A., Kalman, M., Cserpan, J. and Kari, C. (1984) Nucleic Acids Res. Symp. Ser. 14, 321] for obtaining a large number of artificial E. coli promoter derivatives. Briefly, two single-stranded oligodeoxyribonucleotides were chemically synthesized and were annealed [Itakura, K. (1982) TIBS, 7 , 442] through their 3' -terminal complementary sequences. The partial duplex obtained so covered the whole Leu 17-VIP coding region and contained additional terminal sequences to be used for cloning.
The two oligodeoxyribonucleotides were obtained by ambiguous chemical synthesis so that the mixture of all four activated nucleotide monomers were used at certain predetermined positions (i.e. in triplets coding for the amino acid residues 7, 14 and 20 of
Leu 17-VIP) which were outside of the annealing region.
The annealed partial duplex was converted by a mutually primed synthesis effected by DNA polymerase (Klenow fragment) into double-stranded DNA mixture containing all possible homoduplexes. These were then cleaved with two different restriction endonucleases the cleavage sites of them being located upstream and downstream of the Leu17-VIP coding region and the cleaved mixture was ligated with the appropriately cleaved expression vector pPEX. The ligated mixture was transformed into competent E. coli cells and the recombinants containing Leu 17-VIP related coding sequences were selected by colony hybridization. The positive recombinants were further analyzed by nucleotide sequencing to identify the particular mutations obtained in the cloned Leu 17- VIP coding region. During the design of the synthetic oligodeoxyribonucleotides, it was considered that they should code for a methionine preceding the Leu17-VIP coding region and for a Gly (VlPa analogs) or a Gly-Lys-Arg (VIPb-analogs) extension at the carboxy terminus. Methionine was included to be able to release the
Leu 17-VIP analogs from the fusion protein by CNBr cleavage, while the carboxy terminal extensions could serve as substrate sites for amidation catalysed by peptidylglycine α-amidating monooxygenase (PAMase) [Bradburg, A.F., Finnie, M.D.A. and Smyth, D.G. (1982) Nature 298, 686]. The positions of the mixed chemical couplings whithin the nucleotide sequences were chosen to be located in the predetermined X, Y and Z codons so that after performing the steps shown in Scheme 1, the maximum number of amino acid variations be obtained for X, Y and Z. By choosing the first (for codon X) or the second (for codons Y and Z) base of the target codons as mixed positions, four amino acids could be obtained of each three codon variations, yielding altogether 64 possible Leu17-VIP analogs after expression.
The VIPl oligonucleotide, shown as the upper-strand of the partial, annealed duplex in Scheme 1 contains two mixed positions (N), while the lower strand VIP2 oligonucleotide contains only one. The VIP2 oligonucleotide was prepared in two variations carrying information for C-terminal extensions as above (VIP2a and VIP2b oligonucleotides in Scheme 1). To obtain both VlPa and VIPb analogs, two separate experiments were carried out using VIPl + VIP2a or VIPl + VIP2b olignucleotides, respectively.
The double stranded DNA mixture obtained by Klenow polymerase reaction contained homoduplex molecules which were separated by cloning into an expression vector. In principle, all recombinants should contain only one type of mutant gene coding for a particular
Leu 17-VIP analog. pPEX vector pPEX is a highly efficient E. coli expression vector constructed from a rac fusion [Boros, J., Lukacsovich, T., Baliko, G. and Venetianer, P. (1986) Gene 42, 97] promoter vector Lα int 23 named as pPEX by us. The Lα int 23 vector, which expresses under rac promoter control a fusion protein composed of 280 amino acids of E. coli β-galactosidase and part of the bacterial CAT ( chloramphenicol acetyl transferase) was modified by eliminating its unique BamHI site and by replacing its CAT coding region located between Clal and EcoRI sites with a synthetic polycloning region. The relevant region of the pPEX vector obtained so is shown in Scheme 2. The vector contains unique BamHI, Kpnl, SacI, Apal and EcoRI sites in the polycloning region and β-galactosidase gene fusions can be performed using the BamHI and any of the other unique sites. When the Leu 17-VIP coding genes are cloned into the BamHI and EcoRI sites of the pPEX vector, the resulting gene fusions code for 314 and 316 amino acids long β-galactosidase-VIPa and β-galactosidase-VIPb fusion proteins, respectively, of which proteins 284 amino acids are derived from the fusion partner (Scheme 1). EXAMPLE Preparation of the mixture of DNA regions coding for Leu17-VIP analogs
MATERIALS Restriction enzymes and T4 DNA ligase were obtained from New England Biolabs. T4 polynucleotide kinase and Klenow polymerase were from Boehringer, [γ-32P]ATP (>5000 Ci/mmol) and [α-32P]dATP (800 Ci/mmol) were from Amersham, Rabbit antisera directed against BSA-VIP conjugates was provided by Dr. Per Askelof (SBL, Stockholm, Sweden). Immunoblot assay kit containing antirabbit IgG-alkaline phosphatase conjugate and color development reagents BCIP/NBT was purchased from Bio-Rad. T, RNase was purchased from Calbiochem. Oligodeoxyribonucleotides
CCGGATCCATATGCACTCTGACGCTGTTTTCNCTGACAACTACACT¬
CGTCTGANAAAACAGCTGGCT (VIPl oligonucleotide),
AAGAATTCAGCCGTTCAGGATAGAGTTCAGGTACTTTNTAACAGCC¬
AGCTGT (VIP2a oligonucleotide), AAGAATTCAACGTTTGCCGTTCAGGATAGAGTTCAGGTACTTTNTA¬
ACAGCCAGCTGT (VIP2b oligonucleotide) and
CAGGGTGAAACGCAGGTCGCCAGCGGC (lac Z 27-mer primer) oligonucleotides were prepared on an automatic DNA synthesizer by the phosphoramidite chemistry (Pharmacia Gene Assembler) and were purified by electrophoresis on polyacrylamide gels containing 8 M urea. Oligonucleotides were 5'-phosphorylated with [γ- 32P]ATP by using
T4 polynucleotide kinase [Maniates, T., Fritsch, E.F. and Sambrook, J. (1982) Molecular Cloning: A laboratory manual, Cold Spring Harbor Laboratory, Cold Spring Harbor N.Y] when they were to be used as either hybridization probe or sequencing primer.
100 pmol of VIPl oligonucleotide was mixed with 100 pmole of either VIP2a or VIP2b oligonucleotide in 50 μl of water, the mixture was kept at 90°C for
3 min and was let to cool to room temperature in approx. 1 hr period. The solution was made up to 100 μl containing 10 mM Tris-HCl, pH 8.2, 5 inM MgCl2, 50 μM each of dCTP, dGTP and TTP, 5 μl of [α-32P]dATP (approx. 62.5 pmol) and 1 μl of 5U/μl Klenow polymerase. After 15 min 10 μl of 1 mM dNTP mixture (containing all four deoxynucleoside 5' -triphosphates) was added and the solution was incubated at room temperature for 15 min. The DNA was precipitated with the help of 1 μl of 10 μg/μl yeast carrier tRNA (ctRNA) by ethanol precipitation and purified by 10% acrylamide-8 M urea gel electrophoresis at 400V for 2 hrs (gel thickness 0.4 mm). The gel was radioautographed, the major radioactive band was cut out and soaked in 300 μl of 50 mM NaCl - 0.1% SDS solution at 37°C for 12 hrs. The supernatant was phenol extracted and the precipitation was carried out by adding 1 μl of 10 μg/μl ctRNA, 30 μl of 3 M NaOAc, pH 5.2 and 900 μl of ethanol in a liquid nitrogen bath. Centrifugation (14 000 rpm, 3 min) resulted in a radioactive pellet which was washed with ethanol, dried and dissolved in sterile water. 20 pmol of the radioactive Leu 17-VIP-DNA obtained as above was treated with 200 units of BamHI and EcoRI each in 200 μl of 100 mM NaCl, 50 mM Tris HCl, pH 7.5, 10 mM MgCl2, 1 mM DTT (high-salt buffer) at 37°C for 20 hrs. The reaction mixture was heated to 60°C for 10 min, phenol extracted (two times), and the DNA was recovered from the waterphase by ethanol precipitation as above (two times) followed by ethanol washing, drying and redissolving in sterile water. Analysis of the mixture by 10% acrylamide-8 M urea electrophoresis showed that only approx. 50% of the duplex was cleaved and the fraction of the DNA which had been cleaved by both enzymes was only approx. 30%. Nevertheless, the mixture was used as it was for cloning into BamHI-EcoRI cleaved pPEX vector. Cleavage of pPEX vector with BamHI and EcoRI
2 μg of pPEX 13 was treated with 10-10 units of BamHI and EcoRI in 20 μl of high salt buffer at 37°C for 4 hrs. The reaction mixture was applied onto an agarose gel (0.5%) and the electrophoresis was performed in TAE buffer (40 mM Tris-acetate, 2 mM EDTA pH 7.5) at 60V for 1 hr in the presence of ethidium bromide. The linear vector band was cut out, electroeluted, phenol extracted twice, ethanol precipitated, washed with ethanol and dried. The pellet was dissolved in sterile water. Cloning of Leu17 VIP-DNA into pPEX vector
0.2 μg BamHI-EcoRI cleaved pPEX vector and approx. 5 pmol BamHI-EcoRI Leu17-VIP-DNA obtained as above were reacted in 20 μl reaction mixture containing
50 mM Tris-HCl pH 7.5, 10 mM MgCl2, 10 mM DTT, 1 mM ATP and 80 units of T4 DNA ligase at 15°C for 12 hrs. The reaction mixture was transformed into JM101 E. coli cells [genotype (supE, thi, Δ ( lac-proAB), [F', traD36, proAB, ladqZΔM15), Messing, J., Crea, R. and Seeburg, P.H. (1981) Nucleic Acids Res. 9, 309-321] using a frozen stock [Hanahan, D. in DNA cloning, Vol I., edited by Glover, D.M. IRC Press Limited (1985), pp 109-135, protocol 3]. Ampicillin resistant colonies were picked for colony hybridization [Grunstein, M. and Hogness, D.S. (1975) Proc. Natl. Acad. Sci. USA 72, 3961-3965] with 32P-labeled VIPl oligonucleotide probe. Approx. 80-90% of the colonies were positive in this test for both VlPa and VIPb mutants. 120 colonies of both series were taken for plasmid preparation and sequencing. Plasmid greparation and seguencing
A single colony was inoculated into 3 ml of LB- medium containing 100 μg/ml ampicillin and the culture was shaken for 12-16 hrs at 37°C. Plasmid DNA was prepared by a rapid alkaline extraction procedure [Birnboim, H.C. and Doly, J. (1979) Nucleic Acids Res., 7 , 1513-1523]. The plasmid DNA was further treated with 5 units of T1 RNase in 100 μl solution containing 10 mM Tris-HCl, pH 8.0, 1 mM EDTA at 37°C for 30 min followed by phenol extraction and ethanol precipitation. The pellet was taken up in 30 μl of sterile water. Dideoxynucleotide sequencing was performed on
Hindlll linearized plasmid template (0.2-0.4 μg) using
5'- 32P-phosphorylated lac Z 27-mer sequencing primer
(0.25 pmol) and heat denaturation as described [Hong, G.F., (1982) Bioscience Reports 2 , 907].
Sequencing reactions for 24 clones were performed at the same time. Expression of Leu 17-VIP analogs
E. coli JM101 cells transformed with pPEX Leu17-VIP analog plasmids were grown at 37°C, shaking 250 rpm, in 1 ml LB medium containing 0.1 mg/ml ampicillin. When the cell density reached 0.5 at A=600 nm the cells were induced either by addition of IPTG (final concentration 2.5 mM ) and shaken at 250 rpm for 4 hours at 37°C or by addition of lactose (final concentration 1%) and shaken at 250 rpm for 20 hours. After induction the cells were collected by centrifugation at 12 000 rpm in an Eppendorf centrifuge for 1 minute, lysed at 100°C for 3 minutes in 300 μl of lysis buffer (0.125 M Tris-HCl pH 6.8, 30% glycerol, 2% SDS, 6 M urea and
1 M 2-mercaptoethanol) and 30 μl of non-induced extracts and 30 μl of induced extracts were run on SDS-10% polyacrylamide gels according to Laemmli, U.K. (1970) Nature, 227, 680-685 to monitor the degree of protein expression as shown by coomassie brilliant blue staining of the gels. As estimated from the gels the amount of expressed fusion protein was more than 60% of total cell proteins.
Immunological recogfnitiion/detection of β-galactosidase- Leu17-VIP analogs
6 μl aliqout of non-induced and 6 μl of 50x diluted induced samples were run on SDS-10% polyacrylamide gels in parallel and half of the gels were stained with coomassie brilliant blue and the other half of the gels were electroblotted onto nitrocellulose papers. The blotted nitrocellulose papers were incubated with a polyclonal rabbit serum containing antibodies directed against BSA-VIP, and the immunoblot was developed by treatments with goat anti rabbit IgG conjugated alkaline phosphatase and BCIP/NBT color development solution (Bio-Rad immuno assay kit) according to the manufacturer's instructions. A very strong immunostaining was obtained with the fusion proteins containing Leu17-VIP analogs.
1 liter scale purification of expressed β-galactosidase Leu17-VIP analog fusion proteins E. coli JM101 cells carrying the pPEX-Leu 17-VIP analog plasmids were shaken (250 rpm) in 1 liter LB medium containing 0.1 mg/ml ampicillin at 37°C. When the absorbance at 600 nm reached 0.5 the cells were induced with lactose (1% final concentration) and shaken at 250 rpm at 37°C for 20 hours. After induction the cells were harvested by centrifugation at 2000 x g, 4°C for 10 minutes, washed with 40 ml of TBS, pH 7.6, and resuspended in 30 ml TBS containing 10 μM PMSF and 0.5 mM EDTA. The cell suspension was then freeze-thawed and sonicated (five 1 minute bursts) in a Branson sonifier, then centrifuged at 17000 x g, 4°C, for 30 minutes. The pellet containing the fusion protein was homogenized in 50 ml 6 M guanidium chloride containing 1% 2-mercaptoethanol according to Goeddel, D.V. et. al. (1979) PNAS (USA), 76, 106-110 and centrifuged at 60 000 x g for 60 minutes. The clear, amber supernatant containing the fusion protein was diluted to 100 ml with 6 M guanidium chloride - 1% 2-mercaptoethanol and 172 ml TBS was added dropwise with vigorous stirring which rendered most of the fusion protein to precipitate while most of the host proteins remained in solution. The slurry was stirred at room temperatur for 30 minutes before centrifugation at 10 000 x g for 30 minutes at 10°C. The pellet so obtained contains most of the 3-galactosidase-Leu17-VIP analog fusion protein. CNBr cleavage of fusion protein The partially purified β-galactosidase - Leu17-VIP analog fusion protein was dissolved by homogenization in 25 ml 70% HCOOH and 1.5 g CNBr was added per gram precipitate. The solution was stirred at room temperature for 70 hours and then evaporated at room temperature under reduced pressure using a Rotavapor. 20 ml 50 mM HCl in methanol was added per gram fusion protein to the residue and stirred at room temperature over night. Then the slurry was centrifuged at 2000 x g, 4°C, for 10 minutes and the supernatant collected. Purification of Leu17-VIP analogs The supernatant containing the Leu17-VIP analog was either 1 ) freeze-dried and the Leu17-VIP analog-containing residue was dissolved in 1% TFA and purified on HPLC ( C18-Bondapack, reverse phase) or 2) subjected to further purification as follows before the HPLC step. To the acidic methanol phase containing the Leu17- VIP analog solid NaCl (0.2 g/ml ) and 4 volumes of ice cold diethylether were added. The precipitate (containing Leu 17-VIP analog) was collected on a sintered glass funnel (pore size no 3 ) and dissolved by washing with 5 ml 1 M acetic acid. The dissolved Leu17-VIP analog was desalted with a Sephadex G25 column (7 cm long, 2 cm diameter) and freeze-dried before dissolution in 1% TFA and purified on HPLC with a 20%-40% acetonitrile linear gradient in 1% TFA. The Leu17-VIP analog was eluted at 33% acetonitrile. The purified Leu17-VIP analog was then tested in biochemical and biological assay systems . EXAMPLE : VlPa (X=Thr, Y=Arg , Z=Lys, W=Gly)
The fusion protein 3-galactosidase - VlPa was expressed in 1 liter LB medium containing 0.1 mg/ml ampicillin and purified as described above. The fusion protein was cleaved with CNBr and VlPa so obtained was further purified as described above and tested in the following assay systems:
1) Radioimmunoassay (RIA) 2) Radioreceptor assay
3) Stimulation of 3', 5'-cyclic AMP production
4 ) Bicarbonate secretion in cat in vivo
1) Radioimmuoassay (RIA) In the VIP - RIA kit purchased from Penninsula
Laboratories (USA) recombinant VlPa is recognized as VIP when measured according to the manufacturer's recommendation, based on the method of Fahrenkrug, J. and Schaffalitzky De Muckadell, 0. (1977) J. Lab. Clin. Med. 89., 1379-1388.
2) Radioreceptor assay
Radioreceptor assay was carried out on membranes from rat cerebral cortex using chloramin-T iodinated 125I-VIP (Hallden, G. et. al. (1986) Reg. Pep. 16, 183-188) at 0.5 nM concentration, studying the displacement of the labeled VIP by purified VIP from porcine intestine and by recombinant VlPa from E. coli as described by Abens , J. et al. (1984) Peptides 5, 375-377. The affinity of recombinant VlPa was within the experimental error identical to that of VIP purified from porcine intestine with a Kd value of 1.5-1.8 nM at equilibrium, proving that recombinant VlPa is a high affinity ligand at VIP receptors, binding in a manner indistinguishable from that of VIP obtained from other sources. 3 ) Stimulation of 3',5'-cγclic AMP synthesis Stimulation of 3',5'-cyclic AMP ( cAMP ) synthesis in tissue slices from rat cerebral cortex by VIP purified from porcine and recombinant VlPa was studied to establish whether or not recombinant VlPa, a ligand of the VIP receptor according to the result in 2), behaves as an agonist or an antagonist. The experiments were carried out as follows:
Rat cerebral cortical slices (0.4 mm x 0.4 mm) were preincubated in Krebs Ringers bicarbonate buffer, bubbled with O2/CO2 (95%/5%) (V/V) for 60 minutes at 36°C in the presence of 10 mM theophylline (a phosphodiesterase inhibitor). The tissue slices were then incubated in 600 μl total volume with porcine VIP at 10, 50, 100 nM, 1 and 10 μM concentration for 10 minutes and with recombinant VlPa at 10, 50, 100 and 300 nM concentration (estimated by 1)) for 10 minutes. The incubations were terminated by addition of 150 μl EGTA (100 mM) solution followed by placing the test tubes into a boiling water bath for 3 minutes. The cAMP content was measured according to Brown, B.L. et al. (1972) Adv. Cycl. Nucl. Res. 2 , 25-40. The results indicate that at 10 minutes incubation time recombinant VlPa produced an increase in cAMP levels and thus act as agonist at the VIP-receptor coupled adenylate cyclase, which is thought to mediate the physiological actions of VIP (cf. Rostene, W.H. (1984) Progr. Neurobiol. 22, 103-129). 4 ) Biological activitγ of VIPa The biological activity of recombinant VlPa was also examined in the in vivo assay on stimulation of bicarbonate secretion from cat pancreas according to Mutt, V. and Sδderberg, U. (1959) Arkiv Kern. 15, 63-68. Recombinant VlPa (16 μg injected) was in this assay approximately 70% as efficient as porcine VIP. Recombinant VIPb was, when tested at the same concentration in this assay, at least as efficient as porcine VIP.
Figure imgf000027_0001
Figure imgf000028_0001
Figure imgf000029_0001

Claims

1. A method of simultaneously producing a group of individual C-terminally extended analogs of Leu17-VIP (vasoactive intestinal polypeptide), said group consisting of equally long peptides having the amino acid sequence
His-Ser-Asp-Ala-Val-Phe-X-Asp-Asn-Tyr-Thr-Arg-Leu-Y- 1 2 3 4 5 6 7 8 9 10 11 12 13 14
-Lys-Gln-Leu-Ala-Val-Z-Lys-Tyr-Leu-Asn-Ser-Ile-Leu- 15 16 17 18 19 20 21 22 23 24 25 26 27
-Asn-W 28 29
wherein X represents Thr, Ser, Pro or Ala, Y represents Thr, Lys, Ile or Ala Z represents Thr, Lys, Ile or Arg, and W represents Gly or Gly-Lys-Arg,
and of equally long peptides which are also Leu17-VIP- W 29 analogs and which arise from mutations when carrying out the method, c h a r a c t e r i s e d by the steps of simultaneously synthesizing a first mixture of equally long oligonucleotides which during synthesis are made ambiguous at the triplets coding for the ammo acid residues at positions 7 and 14 of Leu 17-VIP, and which have a few identical bases at the 3'-end, simultaneously synthesizing a second mixture of equally long oligonucleotides which during synthesis are made ambiguous at the triplet coding for the amino acid residue at position 20 of Leu17-VIP, and which have a few identical bases at the 3'-end, these being complementary to the few bases at the 3'-end of the oligonucleotides in the first mixture, mixing said first mixture with said second mixture, whereby the few bases at the 3'-end of the oligonucleotides of the first mixture anneal to the few bases at the 3'-end of the oligonucleotides of the second mixture, resulting in a mixture of partially double stranded equally long DNA sequences, which thereafter are enzymatically converted into fully double stranded DNA sequences, subjecting said mixture of double stranded DNA sequences, which include at the 3'-end a site for cleavage with a first enzyme and at the 5'-end a site for cleavage with a second enzyme, to cleavage, simultaneously or consecutively, with the first and the second enzyme to produce DNA sequences with 3'- and 5'-ends which are ligatable to the 5'- and 3'-ends of similarly cleaved vectors, inserting the thus cleaved DNA sequences into the thus cleaved vectors by ligation to produce a mixture of vectors, which are then transformed into hosts in per se known manner, propagating said hosts to form colonies, which are analyzed one by one to establish those DNA sequences which code for a single protein, propagating separately under expression conditions those hosts which contain vectors having identified protein coding sequences, the C-terminal portions of which correspond to an individual Leu 17-VIP-W29 analog, whereupon the separately expressed proteins are cleaved to release the C-terminal Leu 17-VIP-W29 analogs forming a group of said individual equally long peptides.
2. A method according to claim 1, wherein W represents Gly and the Leu 17-VIP-W29 analogs which arise from mutations when carrying out the method are Asp1-Ala7-Ile14-Thr20-VIP-Gly29 Tyr1-Pro7-Thr14-Lys20-VIP-Gly29 Tyr2-Thr7-Tyr8-Thr14-Thr20-VIP-Gly29 Gly3-Thr7-Thr14-Arg20-VIP-Gly29 Pro4-Thr7-Arg14-Thr20-VIP-Gly29 Phe5-Thr7-Thr14-Lys20-VIP-Gly29
Thr7-Asn8-Arg14-Arg20-VIP-Gly29 Pro7-Gly8-Thr14-Lys20-VIP-Gly29 Pro7-Gln8-lle14-Phe19-Arg20-VIP-Gly29 Ser7-Pro8-Ile14-Arg20-VIP-Gly29 Ala7-Pro11-Lys14-Lys20-VIP-Gly29
Pro7-Pro12-Thr14-Thr20-VIP-Gly29 Thr7-Lys14-Asn15-lle20-VIP-Gly29 Pro7-Ile14Arg15-Lys20-VIP-Gly29 Ala7-Lys14-Gln15-Arg20-VIP-Gly29
Ala7-Ile14-Thr15-Lys20-VIP-Gly29
Thr7-Lys14-His16-Lys20-VIP-Gly29
Pro7-Ile14-His16-Thr20-VIP-Gly29 Thr7-Ile14-Phe19-Ile20-VIP-Gly29 Pro7-Thr14-Thr20-Lys24-VIP-Gly29
Ser7-Lys14-Thr20-Ile24-VIP-Gly29
Thr7-Thr14-Lys20-Asp28-VIP-Gly29 Gly7-Lys14-Lys20-VIP-Gly29, and Ala7-Asn14-Arg20-VIP-Gly29.
3. A method according to claim 1, wherein W represents Gly-Lys-Arg and the Leu 17-VIP-W29 analogs which arise from mutations when carrying out the method are
Phe2-Pro7-Thr14-Arg20-VIP-Gly29-Lys30-Arg31
Val3-Thr7-Lys14-Ile20-VIP-Gly29-Lys30-Arg31
Pro4-Thr7-Thr14-Lys20-VIP-Gly29-Lys30-Arg31
Phe5-Pro7-Thr14-Ile20-VIP-Gly29-Lys30-Arg31 Thr6-Ala7-Thr14-Thr20-VIP-Gly29-Lys30-Arg31
Thr7-Val8-Thr14-Thr20-VIP-Gly29-Lys30-Arg31
Pro7-Pro11-Thr14-Lys20-VIP-Gly29-Lys30-Arg31
Pro7-Pro11-lle14-Arg20-VIP-Gly29-Lys30-Arg31
Thr7-Arg13-Lys14-Arg20-VIP-Gly29-Lys30-Arg31 Pro7-Gln13-Lys14-Lys20 VIP-Gly29-Lys30-Arg31
Pro7-Pro13-Thr14-Thr20-VIP-Gly29-Lys30-Arg31
Pro7-Pro13--Thr14-Thr20-VIP-Gly29-Lys30-Arg31
Ser7-Arg13-Thr14-Gln15-Thr20-VIP-Gly29-Lys30-Arg31
Pro7-Lys14-Gln15-Arg20-VIP-Gly29-Lys30-Arg31 Ser7-Lys14-Asn15-Arg20-VIP-Gly29-Lys30-Arg31
Thr7-Lys14-Asp19-Lys20-VIP-Gly29-Lys30-Arg31
Thr7-Lys14-Gly19-Thr20-VIP-Gly29-Lys30-Arg31 Thr7-Thr14-lle20-Asp24-VIP-Gly29-Lys30-Arg31 Ala7-lle14-Arg20-Asp24-VIP-Gly29-Lys30-Arg31
Ser7-lle14-Thr20-Lys24-VIP-Gly29-Lys30-Arg31
Pro7-lle14-Thr20-Tyr25-VIP-Gly29-Lys30-Arg31 and Ser7-Thr14-Ile20-Val26-VIP-Gly2 9 Lys30-Arg31.
4. A method according to any one of claims 1-3, c h a r a c t e r i s e d in that the vectors are plasmids and the hosts are E. coli.
5. A C-termmally extended analog of Leu 17-VIP c h a r a c t e r i s e d in that it is chosen from the group consisting of peptides having the amino acid sequence
His-Ser-Asp-Ala-Val-Phe-X-Asp-Asn-Tyr-Thr-Arg-Leu-Y- 1 2 3 4 5 6 7 8 9 10 11 12 13 14
-Lys-Gln-Leu-Ala-Val-Z-Lys-Tyr-Leu-Asn-Ser-Ile-Leu- 15 16 17 18 19 20 21 22 23 24 25 26 27
-Asn-W 28 29 wherein X represents Thr, Ser, Pro or Ala,
Y represents Thr, Lys, Ile or Ala
Z represents Thr, Lys, Ile or Arg, and
W represents Gly or Gly-Lys-Arg, and
Asp1-Ala7-Ile14-Thr20-VIP-Gly29
Tyr1-Pro7-Thr14-Lys20-VIP-Gly29
Tyr2-Thr7-Tyr8-Thr14-Thr20-VIP-Gly29 Gly3-Thr7-Thr14-Arg20-VIP-Gly29
Pro4-Thr7-Arg14-Thr20-VIP-Gly29
Phe5-Thr7-Thr14-Lys20-VIP-Gly29
Thr7-Asn8-Arg14-Arg20-VIP-Gly29
Pro7-Gly8-Thr14-Lys20-VIP-Gly29
Pro7- Gln8-Ile14-Phe19-Arg20-VIP-Gly29 Ser7-Pro8-Ile14-Arg20-VIP-Gly29
Ala7-Pro11-Lys14-Lys20-VIP-Gly29
Pro7-Pro12-Thr14-Thr20-VIP-Gly29 Thr 7-Lys14-Asn15-Ile20-VIP-Gly29
Pro7-Ile14Arg15-Lys20-VIP-Gly29
Ala7-Lys14-Gln15-Arg20-VIP-Gly29
Ala7-Ile14-Thr15-Lys20-VIP-Gly29 Thr 7-Lys14-His16-Lys20-VIP-Gly29
Pro7-Ile14-His16-Thr20-VIP-Gly29 Thr 7-Ile14-Phe19-IIe20-VIP-Gly29 Pro7-Thr14-Thr20-Lys24-VIP-Gly29
Ser -Lys 14-Thr20-Ile24-VIP-Gly29
Thr7-Thr14-Lys20-Asp28-VIP-Gly29
Gly7-Lys14-Lys20-VIP-Gly29
Ala7 Asn14-Arg20-VIP-Gly29 and
Phe2- Pro7-Thr14-Arg20-VIP-Gly29-Lys30-Arg31
Val3- Thr7-Lys14-Ile20-VIP-Gly29-Lys30-Arg31 Pro4- Thr7-Thr14-Lys20-VIP-Gly29-Lys30-Arg31
Phe5- Pro7-Thr14-Ile20-VIP-Gly29-Lys30-Arg31
Thr6- Ala7-Thr14-Thr20-VIP-Gly29-Lys30-Arg31 Thr7-Val8-Thr14-Thr20-VIP-Gly29-Lys30-Arg31 Pro7-Pro11-Thr14-Lys20-VIP-Gly29-Lys30-Arg31 Pro7-Pro11-Ile14-Arg20-VIP-Gly29-Lys30-Arg31 Thr7-Arg13-Lys14-Arg20-VIP-Gly29-Lys30-Arg31 Pro7-Gln13-Lys14-Lys20-VIP-Gly29-Lys30-Arg31 Pro7-Pro13-Thr14-Thr20-VIP-Gly29-Lys30-Arg31 Pro7-Pro13-Thr14-Arg20-VIP-Gly29-Lys30-Arg31
Ser7-Arg13-Thr14-Gln15-Thr20-VIP-Gly29-Lys30-Arg31
Pro7-Lys14-Gln15-Arg20-VIP-Gly29-Lys30-Arg31
Ser7-Lys14-Asn15-Arg20-VIP-Gly29-Lys30-Arg31
Thr7- Lys14-Asp19-Lys20-VIP-Gly29-Lys30-Arg31
Thr7- Lys14-Gly19-Thr20-VIP-Gly29-Lys30-Arg31
Thr7- Thr14-Ile20-Asp24-VIP-Gly29-Lys30-Arg31
Ala7- Ile14-Arg20-Asp24-VIP-Gly29-Lys30-Arg31 Ser7- Ile14-Thr20-Lys24-VIP-Gly29-Lys30-Arg31
Pro7- Ile14-Thr20 Tyr25-VIP-Gly29-Lys30-Arg31 and
Ser7-Thr14-Ile20-Val26-VIP-Gly29-Lys30-Arg31
wherein all the amino acid residues are of L-confi- guration.
6. A plasmid containing a gene coding for a C-terminallly extended analog of Leu17-VIP, c h a r a c ¬t e r i s e d by a DNA sequence which codes for a
C-terminally extended analog of Leu 17-VIP as defined in claim 5
PCT/SE1988/000696 1987-12-23 1988-12-21 A METHOD OF SIMULTANEOUSLY PRODUCING A LARGE NUMBER OF Leu17-VIP-ANALOGS AND NEW Leu17-VIP-ANALOGS WO1989005857A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
SE8705139A SE8705139D0 (en) 1987-12-23 1987-12-23 PROCEDURE FOR MANUFACTURING A LARGE NUMBER OF PEPTID ANALOGS AND NEW PEPTID ANALOGS
SE8705139-7 1987-12-23

Publications (1)

Publication Number Publication Date
WO1989005857A1 true WO1989005857A1 (en) 1989-06-29

Family

ID=20370695

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/SE1988/000696 WO1989005857A1 (en) 1987-12-23 1988-12-21 A METHOD OF SIMULTANEOUSLY PRODUCING A LARGE NUMBER OF Leu17-VIP-ANALOGS AND NEW Leu17-VIP-ANALOGS

Country Status (6)

Country Link
EP (1) EP0391957A1 (en)
JP (1) JPH03502880A (en)
DD (1) DD294500A5 (en)
HU (1) HUT50494A (en)
SE (1) SE8705139D0 (en)
WO (1) WO1989005857A1 (en)

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0405242A2 (en) * 1989-06-30 1991-01-02 F. Hoffmann-La Roche Ag VIP-Analogs II
JPH06507415A (en) * 1991-04-25 1994-08-25 コーマン，ルイス・ワイ Use of vasoactive intestinal peptide (VIP) to induce temporary paralysis of the gastrointestinal tract
EP0622459A1 (en) * 1993-04-26 1994-11-02 Sanwa Kagaku Kenkyusho Co., Ltd. Fused proteins for preparing vasoactive intestinal polypeptide analogs, method of preparing same and recombinant plasmids and transformant microorganisms
EP0796867A1 (en) * 1995-06-09 1997-09-24 Itoham Foods Inc. Peptide, bronchodilator and blood flow ameliorant
GB2313376A (en) * 1996-05-22 1997-11-26 Diapharm Limited Polypeptide immunologically cross-reactive with NTM peptide and with vasoactive intestinal peptide (VIP)
US5733549A (en) * 1992-08-14 1998-03-31 Shino-Test Corporation Peptides including amino acid sequences selected from lipoprotein (a) and apolipoprotein (a), antibodies recognizing these amino acid sequences, and methods of determination using these antibodies
EP1571155A1 (en) * 2002-11-27 2005-09-07 Itoham Foods Inc. Peptides and medicinal compositions containing the same
US7951778B2 (en) 2002-06-10 2011-05-31 Mondobiotech Ag Use of compounds having the biological activity of vasoactive intestinal peptide for the treatment of sarcoidosis
US8153599B1 (en) 2000-11-28 2012-04-10 Mondobiotech Ag Compounds with the biological activity of vasoactive intestinal peptide for the treatment of pulmonary and arteriolar hypertension

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1985002198A1 (en) * 1983-11-01 1985-05-23 Amgen Microbial expression of type i transforming growth factor, polypeptide analogs thereof and hybrid egf/tgf polypeptides
EP0184309A2 (en) * 1984-11-01 1986-06-11 Beecham Group Plc Peptides selected from amino-acid residues 11 to 23 of VIP
US4605641A (en) * 1984-10-09 1986-08-12 Hoffmann-La Roche Inc. Synthetic vasoactive intestinal peptide analogs
EP0194006A1 (en) * 1985-02-01 1986-09-10 Imperial Chemical Industries Plc Analogous interferon polypeptides, process for their preparation and pharmaceutical compositions containing them
EP0225020A2 (en) * 1985-10-19 1987-06-10 Beecham Group Plc Peptides comprising, in sequence, units selected from the amino-acid residues 17 to 24 of ViP

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1985002198A1 (en) * 1983-11-01 1985-05-23 Amgen Microbial expression of type i transforming growth factor, polypeptide analogs thereof and hybrid egf/tgf polypeptides
US4605641A (en) * 1984-10-09 1986-08-12 Hoffmann-La Roche Inc. Synthetic vasoactive intestinal peptide analogs
EP0184309A2 (en) * 1984-11-01 1986-06-11 Beecham Group Plc Peptides selected from amino-acid residues 11 to 23 of VIP
EP0194006A1 (en) * 1985-02-01 1986-09-10 Imperial Chemical Industries Plc Analogous interferon polypeptides, process for their preparation and pharmaceutical compositions containing them
EP0225020A2 (en) * 1985-10-19 1987-06-10 Beecham Group Plc Peptides comprising, in sequence, units selected from the amino-acid residues 17 to 24 of ViP

Cited By (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0405242A3 (en) * 1989-06-30 1992-05-27 F. Hoffmann-La Roche Ag Vip-analogs ii
US5141924A (en) * 1989-06-30 1992-08-25 Hoffmann-La Roche, Inc. Synthetic vasoactive intestinal peptide analogs
EP0405242A2 (en) * 1989-06-30 1991-01-02 F. Hoffmann-La Roche Ag VIP-Analogs II
JPH06507415A (en) * 1991-04-25 1994-08-25 コーマン，ルイス・ワイ Use of vasoactive intestinal peptide (VIP) to induce temporary paralysis of the gastrointestinal tract
US5733549A (en) * 1992-08-14 1998-03-31 Shino-Test Corporation Peptides including amino acid sequences selected from lipoprotein (a) and apolipoprotein (a), antibodies recognizing these amino acid sequences, and methods of determination using these antibodies
EP0622459A1 (en) * 1993-04-26 1994-11-02 Sanwa Kagaku Kenkyusho Co., Ltd. Fused proteins for preparing vasoactive intestinal polypeptide analogs, method of preparing same and recombinant plasmids and transformant microorganisms
EP0796867A4 (en) * 1995-06-09 1999-10-20 Itoham Foods Inc Peptide, bronchodilator and blood flow ameliorant
EP0796867A1 (en) * 1995-06-09 1997-09-24 Itoham Foods Inc. Peptide, bronchodilator and blood flow ameliorant
GB2313376A (en) * 1996-05-22 1997-11-26 Diapharm Limited Polypeptide immunologically cross-reactive with NTM peptide and with vasoactive intestinal peptide (VIP)
US8153599B1 (en) 2000-11-28 2012-04-10 Mondobiotech Ag Compounds with the biological activity of vasoactive intestinal peptide for the treatment of pulmonary and arteriolar hypertension
US7951778B2 (en) 2002-06-10 2011-05-31 Mondobiotech Ag Use of compounds having the biological activity of vasoactive intestinal peptide for the treatment of sarcoidosis
EP1571155A1 (en) * 2002-11-27 2005-09-07 Itoham Foods Inc. Peptides and medicinal compositions containing the same
EP1571155A4 (en) * 2002-11-27 2005-12-28 Itoham Foods Inc Peptides and medicinal compositions containing the same
US7332473B2 (en) 2002-11-27 2008-02-19 Itoham Foods Inc. Peptides and medicinal compositions containing the same
AU2003284428B2 (en) * 2002-11-27 2010-08-26 Ils Inc. Peptides and medicinal compositions containing the same

Also Published As

Publication number Publication date
DD294500A5 (en) 1991-10-02
JPH03502880A (en) 1991-07-04
HUT50494A (en) 1990-02-28
EP0391957A1 (en) 1990-10-17
SE8705139D0 (en) 1987-12-23

Similar Documents

Publication Publication Date Title
FI100972B (en) DNA sequence encoding colony-stimulating factor-1 (CSF-1) and the method of producing a CSF-1 protein
EP0518587B1 (en) A-C-B proinsulin, method of manufacturing and using same, and intermediates in insulin production
US4847201A (en) DNA encoding for CSF-1 and accompanying recombinant systems
US6365725B1 (en) DNA coding for a human vasoconstrictive peptide and use thereof
Sauer et al. Primary structure of the phage P22 repressor and its gene c2
US4549986A (en) Human CGRP
HU215241B (en) Process for producing new forms of colony stimulating factor-1 and expression cassette, vector and recombinant host cells used in the process
IE62422B1 (en) Expression of humanproapolipoprotein a-i
JP2565666B2 (en) Recombinant human acidic fibroblast growth factor produced using a plasmid containing the artificial DNA encoding the human acidic fibroblast growth factor and a host thereof
WO1989005857A1 (en) A METHOD OF SIMULTANEOUSLY PRODUCING A LARGE NUMBER OF Leu17-VIP-ANALOGS AND NEW Leu17-VIP-ANALOGS
Van Poelje et al. Cloning, sequencing, expression, and site-directed mutagenesis of the gene from Clostridium perfringens encoding pyruvoyl-dependent histidine decarboxylase
WO1992015015A1 (en) Methods for detecting galanin antagonists
NO172547B (en) PROCEDURE FOR THE PREPARATION OF NALFA-ACETYL-EGLIN B AND -C
US4736023A (en) DNA encoding human CGRP
US5910480A (en) Protein called epil/placentin, process for the preparation of this protein and pharmaceutical composition containing such, DNA coding for said Protein
JPH07316197A (en) Preparation of growth hormone release factor
Lopez de Haro et al. Nucleotide and derived amino acid sequences of a cDNA coding for pre-uteroglobin from the lung of the hare (Lepus capensis)
US6703201B1 (en) Human PEC-60-like protein and DNA encoding this protein
EP0857732A1 (en) Human pec-60-like protein and dna encoding the same
Kan et al. Expression of Human C5a in E. Coli
JPH05207883A (en) New growth hormonal polypeptide of fishes
JPH0691833B2 (en) Method for producing polypeptide having diuretic effect
JPH05268969A (en) New growth hormone polypeptide of fishes
JPH051800B2 (en)
JPH03123487A (en) Production of new polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): DK FI JP NO US

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH DE FR GB IT LU NL SE

WWE Wipo information: entry into national phase

Ref document number: 1989900676

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 1989900676

Country of ref document: EP

WWW Wipo information: withdrawn in national office

Ref document number: 1989900676

Country of ref document: EP