WO1990015814A1

WO1990015814A1 - Nuclease resistant, single-stranded, non-naturally occurring nucleic acid molecules

Info

Publication number: WO1990015814A1
Application number: PCT/US1990/003486
Authority: WO
Inventors: Peter Duck; Robert Bender
Original assignee: Meiogenics, Inc.
Priority date: 1989-06-20
Filing date: 1990-06-20
Publication date: 1990-12-27
Also published as: AU5931290A

Abstract

The present invention provides a nuclease resistant single-stranded non-naturally occurring nucleic acid molecule having a formula: [(D)xa(R)ya]a[(D)xb-y(R)yb-y]b-y [(D)xz(R)yz]z, wherein each D represents a deoxyribonucleotide which may be the same as, or different from, any other deoxyribonucleotide present in the molecule; wherein each R represents a ribonucleotide which may be the same as, or different from, any other ribonucleotide present in the molecule; wherein each of xa, ya xb-y, yb-y, xz and yz represents an integer which may independently vary from 0 to 10; and wherein each of a, b-y, and z represents an integer which may independently vary from 0 to 50.

Description

NUCLEASE RESISTANT, SINGLE-STRANDED, NON-NATURALLY OCCURRING NUCLEIC ACID MOLECULES

BACKGROUND OF THE INVENTION

Nucleic acid probes of DNA or RNA are known to be useful for detecting complementary sequences in the presence of a large amount of non-complementary DNA or RNA. However, one problem encountered in the use of such probes is their sensitivity to enzymatic, particularly, nuclease degradation.

Further, the use of antisense RNA as a therapeutic agent has been suggested. However, susceptibility to enzymatic, i.e. nuclease degradation, impedes such an approach.

European Patent Publication No. 067,597, published December 22, 1982, discloses oligonucleotides and a process for their preparation which comprises incorporating ribonucleotide units at specific locations in deoxyribonucleotide chains thus providing predetermined cleavage sites which allow ease of chain cleavage.

Coassigned U.S. Serial No. 805,279,filed December 5, 1985, now allowed discloses synthetic, non-naturally occurring molecules represented by the formula

wherein NA. and NA, are different noncomplementary nucleic acid sequences; wherein -—S—- is a scissile linkage which is capable of being cleaved or disrupted without cleaving or disrupting the nucleic acid sequences of NA. or NA. or of a target nucleic acid sequence capable of hybridizing to said composition, wherein if the scissile linkage is a nucleic acid sequence it is RNA when both NA. and NA- are DNA sequences, or the scissile linkage is DNA when both NA. and NA_ are RNA sequences; and wherein n is an integer from 1 to 4.

Coassigned U.S. Serial No. 187,814, filed April 29, 1988 as a continuation-in-part of U.S. Serial No. 805,279, discloses a method for detecting a target nucleic acid molecule using the molecules disclosed in U.S. Serial No. 187,814.

U.S. Patent No. 4,359,535, issued November 16, 1982 discloses autonomously replicating DNA containing inserted DNA sequences.

U.S. Patent No. 4,563,417, issued January 7, 1986 discloses nucleic acid hybridization assays employing antibodies to intercalation complexes.

Melton et al., Nucleic Acids Research, Vol. 12, No. 18 (1984) discloses in vitro synthesis of biologically active RNA and RNA hybridized probes.

The present invention relates to novel nucleic acid molecules which possess enhanced resistance to nuclease degradation and thus are particularly advantageous when used either as probes or in anti-sense or other therapeutic applications. SUMMARY OF THE INVENTION

The present invention provides a nuclease resistant single-stranded non-naturally occurring nucleic acid molecule having the formula:

C ^(D> ^R> a ^{[ (D}> ^xb-y <^R> yb-y3b-y ^^D> z <^R> V «

wherein each D represents a deoxyribonucleotide which may be the same as, or different from, any other deoxyribonucleotide present in the molecule; wherein each R represents a ribonucleotide which may be the same as, or different from, any other ribonucleotide present in the molecule; wherein each of x , y , x.__v, y_fa , x and y represents an integer which may independently vary from 0 to 10; and wherein each of a, b-y, and z represents an integer which may independently vary from 0 to 50.

The invention also concerns a method of inhibiting the proliferation of tumor cells which comprises contacting the tumor cells with a growth inhibiting amount of a nuclease resistant, single-stranded, non-naturally occurring, nucleic acid molecule having a nucleic acid sequence hybridizable with the mRNA transcript of a gene of the tumor cells essential for proliferation thereof having the formula:

[(D)x_a(R)y_a]_a[(D)x_b._y(R)y_b._y]_b__y [(D)x_z (R)y₂]_z

under suitable conditions so as to inhibit proliferation of tumor cells.

Finally, a method of inhibiting the replication of a virus is provided. The method which comprises contacting the virus with a replication inhibiting amount of a nuclease resistant single-stranded non- naturally occurring molecule having a nucleic acid sequence complementary to the nucleic acid sequence of the virus and comprising the structure:

[(D)x_a(R)y_a]_aC(D)x_b._y(R)y_b__y]_b__y [(D)x_z (R)y_z]_z

under suitable conditions so as to inhibit replication of the virus.

BRIEF DESCRIPTION OF FIGURES

Figure 1 depicts polymer-supported DNA synthesis on silica gel or CPG supports.

Figure 2 depicts polymer-supported RNA synthesis on silica gel or CPG supports.

Figure 3 depicts the synthesis of DRDR sequences first attaching a nucleoside onto an insoluble support and then placing the support in a small column and attaching the column to an automated DNA/RNA synthesizer.

Figure 4 Blots of DRDR Sequences Showing Increased Nuclease Resistance With 2' Protection

Figure 5 Blots of DRDR Sequences Showing Increased Nuclease Resistance With 2' Protection

Figure 6 Blots of DRDR Sequences Showing Increased Nuclease Resistance With 2' Protection

DETAILED DESCRIPTION OF THE INVENTION

The present invention provides a nuclease resistant, single-stranded, non-naturally occurring nucleic acid molecule having the formula:

[(D)x_a(R)y_a]_aC(D)x_b._y(R)y_b._y]_b._y [(D)x_z (R)y_z]_z

wherein each D represents a deoxyribonucleotide which may be the same as, or different from, any other deoxyribonucleotide present in the molecule; wherein each R represents a ribonucleotide which may be the same as, or different from, any other ribonucleotide present in the molecule; wherein each of x , y , x_b__v# y_b , and y represents an integer which may independently vary from 0 to 10; and wherein each of a, b-y, and z represent an integer which may independently vary from 0 to 50.

In a presently preferred embodiment, each of x . y_, ^xb-v' ^b-v' ^xz ^and ^z i^ndeP^endentlY varies and is less than or equal to 5. Additionally, each of a, b-y, and z independently varies and is less than or equal to 25.

Further, each D is selected from the group consisting of deoxyadenylate, deoxyguanylate, deoxythymidylate, deoxycytidylate and analogs or derivatives thereof. Moreover, each R is selected from the group consisting of adenylate, guanylate, uridylate, cytidylate and analogs or derivatives thereof.

It will be clear to one skilled in the art that the deoxyribonucleotides and ribonucleotides useful in this invention encompass all deoxyribonucleotides and ribonucleotides useful in the practice of this invention disclosed herein.

In one embodiment, the nucleic acid molecules of the invention have at least one R to the 2 ' position of which a protecting group, e.g. a silyl or a lower alkyl (C^Cg) group, which enhances the resistance of the molecule to digestion by a nuclease, is attached.

Additionally or alternatively', the nuclease resistant, single-stranded, non-naturally occurring nucleic acid molecules of this invention has at least one D or R which comprises a hydrogen atom in place of a hydroxyl group on the phosphorus atom.

The invention also provides the nuclease resistant, single-stranded, non-naturally occurring nucleic acid molecules hybridizable with a messenger RNA transcript of a viral gene, e.g. an HIV gene which encodes a gene product essential for viral, e.g. HIV replication.

Alternatively, the nuclease resistant, single- stranded, non-naturally occurring nucleic acid molecule are hybridizable with a regulatory sequence of a viral, e.g. an HIV gene essential for viral replication.

The invention also provides nuclease resistant, single- stranded, non-naturally occurring nucleic acid molecules hybridizable with a messenger RNA transcript of a Coxsackie B-3 gene which encodes a gene product essential for Coxsackie B-3 replication.

Alternatively, the nuclease resistant, single- stranded, non-naturally occurring nucleic acid molecules are hybridizable with a regulatory sequence of a Coxsackie B-3 gene essential for Coxsackie B-3 replication.

This invention also provides a method of inhibiting the replication of the HIV virus which comprises contacting the a regulatory sequence of an HIV gene essential for replication with a nucleic acid molecule of this invention so as to form a complex therewith and thereby inhibit the replication of the HIV virus.

The invention further provides a method of inhibiting the replication of the HIV virus which comprises contacting a messenger RNA transcript of an HIV gene essential for replication with a nucleic acid molecule of this invention so as to form a complex therewith and thereby inhibiting the proliferation of the HIV virus.

Additionally, the invention provides a method of inhibiting the replication of the Coxsackie B-3 virus which comprises contacting a messenger RNA transcript of a Coxsackie gene essential for its replicationn with a nucleic acid molecule of this invention so as to form a complex therewith and thereby inhibit replication of the Coxsackie B-3 virus.

Still further, the invention provides a method of inhibiting the proliferation of the Coxsackie B-3 virus which comprises contacting the molecule with a regulatory sequence of a Coxsackie B-3 gene essential for its replication with a nucleic acid molecule of this invention so as to form a complex therewith and thereby inhibit replication of the Coxsackie B-3 virus.

The invention also concerns a method of inhibiting the proliferation of tumor cells which comprises contacting the tumor cells with a proliferation inhibiting amount of a nuclease resistant, single-stranded non-naturally occurring, nucleic acid molecule having a nucleic acid sequence hybridizable with an mRNA transcript of a gene of the tumor cells essential for proliferation thereof, the molecule having the formula:

[(D)x_a(R)y_a3_a[(D)x_b._y(R)y_b__y]_b._y [(D)x_z (R)y_z]_z

under suitable conditions so as to inhibit the proliferation of the tumor cells.

Additionally, the invention concerns a method of inhibiting the replication of a virus which comprises contacting the virus with a replication inhibiting amount of a nuclease resistant single-stranded non- naturally occurring molecule having a nucleic acid sequence hybridizable to the nucleic acid sequence of the virus and having the formula:

C(D)x_a(R)y_a]_a[(D)x_b._y(R)y_b__y]_b._y [(D)x_z (R)y_z]_z

and under suitable conditions so as to inhibit the replication of the virus.

This invention still further provides a method of treating a subject afflicted with a disorder which comprises administering, e.g. by intravenous administration or by time release implant, to the subject an effective amount of a nuclease resistant, single-stranded non-naturally occurring molecule of this invention alone or in and a pharmaceutically acceptable carrier, the moelcule being characterized by its ability to interfere at the nucleic acid level with the progression of, or symptoms associated with, the disorder. This invention is illustrated in the Experimental Details section which follows. This section is set forth to aid in an understanding of the invention but is not intended to, and should not be construed to, limit in any way the invention as set forth in the claims which follow.

EXPERIMENTAL DETAILS

MATERIALS AND METHODS

POLYMER-SUPPORTED DNA-RNA SYNTHESIS

Synthesis of DNA (Figure 1) . Table I shows the protocol for synthesis of DNA on silica gel or CPG supports. The synthesis was completed on Vydak Silica gel or CPG LCAA using 2-5 micromoles of nucleoside on the support. The synthesis was accomplished using an automated synthesizer (1) with a continuous flow manner (3.0-3.5 ml/min) , and the reactions were carried out in a column. Condensations were completed under dry nitrogen, and phosphoramidites of the four bases were kept under nitrogen. At the completion of the synthesis, oligonucleotide cleavage and deprotection were effected by treatment with: 1) Dioxane: Triethylamine: thiophenol (2:1:1 by volume) at room temperature for 1 hour (only for OMe derivatives) ; and 2) concentrated ammonia at 55*C for 24 hours. The oligonucleotides were purified from the resulting mixture by thin layer chromatography (TLC) on silica gel (Kieselgel 60 plates, Merck) with a mixture of n- propanol: ammonia: water (55:35:10) as the running solvent. The purity and size of the final products were confirmed by electrophoretic analysis on polyacrylamide gels.

Synthesis of RNA (Figure 2) . Table II shows the protocol for synthesis of RNA on silica gel or CPG supports. The synthesis was completed on fractosil, Vydak, or CPG, using 2-5 micromoles of nucleoside on the support. Reactions were carried out in a column using an automated synthesizer with a continuous flow manner (3.0-3.5 ml/min) (G. Alvarado-Urbina et al. (1986) Biochem. Cell Biol. 64_:548-555) . At the completion of synthesis, oligonucleotide cleavage and deprotection were effected by treatment with: 1) Dioxanne: triethylamine: thiophenol (2:1:1 by volume) at room temperature for 1 hour; and 2) concentrated ammonia: ethanol (3:1) for 24 hours at room temperature and 16 hours at 50*C. The crude material was then treated with TBAF ([CH.(CH,).] .NF-tetrabutylammonium fluoride, 1.0 M) (1 ml) for 6 hours at room temperature (E.J. Corey and Barry B. Snider (1972) J. Am. Chem.

Soc. 94_:2549). Excess TBAF was converted to NaF with Na ion exchange resin and the nucleotide desalted (Sephadex 50) . The completely deprotected material was obtained by purification on TLC (silica gel) or by polyacrylamide gel electrophoresis.

Table I

Protocol for synthesis of DNA on silica gel or CPG supports (2-5 micromole scale)

Step Reagent or Solvent Mixture Time Vol (min:sec) (ml)

1 Dichloroethane 1: 30 5. 0

2 3% DCA in dichloroethane 1: 30 5. 0

3 Dichloroethane 1: 00 3.5

4 Acetonitrile 2 : 00 5.0

5 Condensation-Phosphoramidite 11::0000 3.5 In line mixing - 20 micromoles of phosphoramidite/CH.CN and

3% Tetrazol in CH.CN Recycling 1:00 —

6 Oxidation - 0.01 M Iodine in 0:20 1.0 a mixture of CH.CN:H,0:2- lutidine ^J * Capping (in line mixing) 1:00 3.5 xxxx a) 20% (AcO). in CH.CN: 2-Glutidine (80:20) b) 3% DMAP in CH₃CN

Recycling 1:00 — x

Total Time 10:20

10

15

20

25

30

35 Table II

Protocol for Synthesis of RNA on Silica or CPG Supports (2-5 micromoles of nucleoside)

Step Reagent or solvent mixture Time

(min:sec)

1 Dichloroethane 1:30 2 3% DCA in Dichloroethane 1:30 3 Dichloroethane 1:00 4 Acetonitrile 2:00 5 Condensation 50:50 1:00

In line mixing -50 micromoles of the phosph- oramidite and 3% Tetrazole in acetonitrile Recycling 5:00

6 Acetonitrile 0:30

7 0.01M I. in CH.CN:H,0:2-lutidine 0:20 (120:120:24) ^{J Λ}

8 In line mixing DMAP-CH.CN (3%) 1:00 and 10% (AcO)_ in CH,CN:2 lutidine (80:20) * ^J

Recycling 1:00

Go to step #1

PREPARATION OF DRDR... SEQUENCES USING THE POLYMER SUPPORTED APPROACH

Sequences. Examples of the sequences involved (5'-3') are shown below.

1) CaAcCcAcAgGcTgTuTuAa.,

2) CgCaCcGaAuGcGgAgTuTu.,

The Reaction. The preparation of DRDR... sequences is shown in Figure 3. For the preparation of mixed sequences DNA-RNA-DNA-RNA... , applicants' general strategy was to attach the 3'-terminal nucleoside of an intended sequence onto the insoluble support. Once the first nucleoside has been attached, the support is used as substrate for chain extension reactions. Applicants used mainly Vydak silica gel with an amount of loading equal to 65-80 micromoles/gram, or long chain alkyl amine controlled pore glass (LCAA CPG) with a loading of 25-30 micromoles/gram. The polymer support with the first nucleoside attached to it was placed in a small - column and attached to an automated DNA/RNA synthesizer.

The synthesis cycle employed was described above for

DNA and RNA separately. For the preparation of DRDR... sequences, the synthesis cycles are combined into four basic steps: 1) acidic treatment to remove 5'- dimethoxytrilyl protecting groups; 2) condensation of the polymer bound nucleoside with a nucleoside-3'- diisopropylphosphoramidite for DNA and RNA; 3) oxidation, using iodine and water in acetonitrile, to convert the phosphite linkage into phosphate linkage; and 4) capping with acetic anhydride and DMAP to block off unreacted sites and to remove residual moisture. The most difficult step is the chain extension reaction. Unlike 2 -deoxyribonucleosides, protected ribonucleosides are much more hindered about the 3' position. This is due to the bulky t-butyl dimethylsilyl or triisopropylsilyl protecting groups which applicants use on the 2' position. Consequently, applicants have found it necessary to use higher concentrations (50 micromoles vs 20 micromoles) and longer coupling times (6 minutes vs 2 minutes) relative to phosphoramidite-OMe of oligodeoxyribonucleotide synthesis in order to obtain reasonable coupling yields.

Deprotection and Purification of the Final Product. After assembly of the desired sequence by the automated synthesizer, the final product - a mixed sequence DNA- RNA-DNA... - must be cleaved from the polymer, deprotected and isolated. This procedure is more difficult in the case of RNA sequences than for DNA sequences for two reasons. First, the 2'-protecting group requires the inclusion of an extra deprotection step. Second, the deprotected oligoribonucleotides are much more sensitive toward chemical hydrolysis.

The deprotection began by treatment of the polymer support with thiophenoxide-Dioxane: TEA:Ph5H (2:1:1 fc. volume) at room temperature for 1 hour. This is to remove the methyl protecting groups. Acyl linkages were then hydrolyzed by treatment with ethanolic ammonium hydroxide (NH.OH:EtOH, 3:1) at room temperature for 72 hours. The crude material was finally desilylated with a TBAF solution, desalted and purified on TLC or polyacrylamide gel electrophoresis. All of the above mixed sequences were characterized by kinasing samples and sizing them.

EXAMPLES EXAMPLE 1

Applicants have created many nuclease resistant, single stranded, non-naturally occurring nucleic acid molecules by the polymer supported approach discussed in Materials and Methods. Table III illustrates the increased nuclease resistance of 5 of these sequences. RNase cleaves single-stranded RNA, DNase cleaves single stranded DNA and SI breaks down both DNA and RNA. Table III also illustrates the effect of 2' protection of the ribonucleotide by a silyl group.

Although the Materials are more resistant to some nucleases than DNA or RNA alone, the addition of a 2 ' protecting group, in some instances, confers even greater nuclease resistance.

Table III Nuclease Resistant Constructions

No. 136 DRDRDRDRDRDRD 13-mer

No. 148 DDDDRDDDDRDDDDRDDDD 19-mer

No. 149 DDDRDDDRDDDRDDDRDDD 19-mer

No. 150 DDRDDRDDRDDRDDRDD 17-mer

No. 137 RRRRRRRRRRRR 12-mer

Si+ Si-

RNase SI RNase SI

No. 137(R) + - - -

No. 136(DR) +++ ++ - -

No. 150| [DDR) +++ ++ + (^■ +)

NO. 149 (DDDR) +++ ++ + -

No. 148( 'DDDDR) ++⁽+> ++ + -

+++ Very resistant ++ Moderately resistant + Slightly resistant - Not resistant

No. 082 GTTGTGTAGACTCACTCGTGAACCTAGATT3^,

No. 136 TuTuCcCaGuCaC3'

No. 137 auucacacaacc3' No. 148 GGTTuTCCCaGTCAcGACG3'

No. 149 TTTucCCaGTCaCGAcGTT3' o. 150 TTcCCaGTcACgACgTT3' EXAMPLE 2

The nucleic acid molecule of the present invention are useful as nucleic acid probes because of their resistance to nuclease degradation. Preferably, the 2' position of one or more ribonucleotides in the molecule may be substituted with a protecting group which enhances the nuclease resistance of the resulting molecule.

EXAMPLE 3

The nucleic acid molecules of the present invention may be used to deliver therapeutic agents into contact with DNA or RNA targets and are particularly advantageous for this purpose because of their resistance to nuclease degradation. Preferably, the 2 ' position of one or more ribonucleotides within the molecule may be substituted with a protecting group which enhances the nuclease resistance of the resulting copolymer. More than one such protecting group may be present in the molecule, each such group being the same as, or different from one or more other such groups. Further, the therapeutic agent may be attached to the molecule through any available reactive site on the molecule, one such site being a 2' position on a ribonucleotide which has not had a protective group placed thereon.

EXAMPLE 4

The constructions of nuclease resistant single-stranded nucleic acid molecules, because of their enzymatic resistance, can also be of use for antisense blocking or otherwise modifying the transcription and/or translation of nucleic acid strings by way of competitive inhibition.

Applicants have been able to show that nuclease resistant single-stranded nucleic acid molecules are effective in inhibiting the replication of Coxsackie B- 3 virus. The experimental data for this is the reduction of the number of viral plaques in an activity assay in which a known titer of virus is exposed to a cell culture. The control develops plaques indicating viral titer. The experimental treatment shows both a reduction in the number and the size of the viral plaques. Compared to DNA sequences, the DRDR type compounds are more stable and provide longer lasting inhibition.

EXAMPLE 5

Applicants have also shown that the molecules can be used to inhibit HIV (AIDS virus) replication. The molecule is complementary to an HIV gene which encodes a gene product essential for HIV replication. The molecule may also be complementary to an HIV gene which encodes the HIV T helper cell receptor.

Claims

What is claimed is:

1. A nuclease resistant, single-stranded, non- naturally occurring nucleic acid molecule having the formula:

C(D)x_a(R)y_a]_a[CD)x_b__y(R)y_b__y]_b_y [(D)x_z

(^R)y₂]_z

wherein each D represents a deoxyribonucleotide which may be the same as, or different from, any other deoxyribonucleotide present in the molecule;

wherein each R represents a ribonucleotide which may be the same as, or different from, any other ribonucleotide present in the molecule;

wherein each of x_a, y_a, x_b__y, y_b__y, -<_z and yz_ represents an integer which may independently vary from 0 to 10;

Wherein each of a, b-y, and z represent an integer which may independently vary from 0 to 50.

2. A molecule of claim l, wherein each of x 3.. y3. x_fa_ , Yfc-v' ^x ₂ ^and Y_z independently varies and is less than or equal to 5.

3. A molecule of claim 1, wherein each of a, b-y, and z independently varies and is less than or equal to 25.

4. A molecule of claim 1, wherein each D is selected from the group consisting of deoxyadenylate, deoxyguanylate, deoxythymidylate, deoxycytidylate and analogs or derivatives thereof.

5. A molecule of claim 1, wherein each R is selected from the group consisting of adenylate, guanylate, uridylate, cytidylate and analogs or derivatives thereof.

6. A molecule of claim 5 wherein at least one R has attached to its 2 ' position a protecting group which enhances the resistance of the molecule to digestion by a nuclease.

7. A molecule of claim 6, wherein the protecting group is a silyl group.

8. A molecule of claim 6, wherein the protecting group is a lower alkyl group.

9. A molecule of claim 1, wherein at least one D or R comprises a hydrogen atom in place of a hydroxyl group on the phosphorus atom.

10. A molecule of claim 1, hybridizable with a messenger RNA transcript of an HIV gene which encodes a gene product essential for HIV replication.

11. A molecule of claim 1, hybridizable with a regulatory sequence of an HIV gene essential for HIV replication.

12. A molecule of claim 1, hybridizable with a messenger RNA transcript of a Coxsackie gene which encodes a gene product essential for

Coxsackie B-3 replication.

13. A molecule of claim 1, hybridizable with a regulatory sequence of a Coxsackie B-3 gene essential for Coxsackie B-3 replication.

14. A method of inhibiting the proliferation of the HIV virus which comprises contacting the molecule of claim 1 with a messenger RNA transcript of an HIV gene so as to form a complex thereby inhibiting the proliferation of the HIV virus.

15. A method of inhibiting the proliferation of the HIV virus which comprises contacting the molecule of claim 1 with a messenger RNA transcript of an HIV gene so as to form a complex thereby inhibiting the proliferation of the HIV virus.

16. A method of inhibiting the proliferation of the Coxsackie B-3 virus which comprises contacting the molecule of claim 1 with a messenger RNA transcript of a Coxsackie gene so as to form a complex thereby inhibiting the proliferation of the Coxsackie B-3 virus.

17. A method of inhibiting the proliferation of the Coxsackie B-3 virus which comprises contacting the molecule of claim 1 with a regulatory sequence of a Coxsackie B-3 gene so as to form a complex thereby inhibiting the proliferation of the Coxsackie B-3 virus.

18. A method of inhibiting the proliferation of tumor cells which comprises contacting the tumor cells with a growth inhibiting amount of a nuclease resistant, single-stranded non- naturally occurring, nucleic acid molecule having a nucleic acid sequence hybridizable with the mRNA transcript of a gene of the tumor cells essential for growth thereof having the formula:

[(D)x_a(R)y_a[(D)x_b._y(R)y_b._y]_b._y [(D)x_z (R)y_z]_z

19. A method of inhibiting the replication of a virus which comprises contacting the virus with a replication inhibiting amount of a nuclease resistant single-stranded non-naturally occurring molecule having a nucleic acid sequence complementary to the nucleic acid sequence of the virus and comprising the formula:

[(D)x_a(R)y_a[(D)x_b._y(R)y_b._y]_b__y [(D)x_z (R)y_β]_∑

under suitable conditions so as to inhibit the replication of the virus.

20. A method of treating a subject with a disease which comprises administering to the subject an effective amount of the molecule of claim 1 and a pharmaceutically acceptable carrier.

21. A method of claim 20, wherein administration comprises intravenous administration.

22. A method of claim 20, wherein administration comprises a time release implant.