WO1993008829A1 - Compositions that mediate killing of hiv-infected cells - Google Patents

Compositions that mediate killing of hiv-infected cells Download PDF

Info

Publication number
WO1993008829A1
WO1993008829A1 PCT/US1992/009550 US9209550W WO9308829A1 WO 1993008829 A1 WO1993008829 A1 WO 1993008829A1 US 9209550 W US9209550 W US 9209550W WO 9308829 A1 WO9308829 A1 WO 9308829A1
Authority
WO
WIPO (PCT)
Prior art keywords
domains
binding domain
binding
antibody
cells
Prior art date
Application number
PCT/US1992/009550
Other languages
French (fr)
Inventor
Matthias Wabl
Jorg Berg
Erika Lotscher
Original Assignee
The Regents Of The University Of California
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by The Regents Of The University Of California filed Critical The Regents Of The University Of California
Publication of WO1993008829A1 publication Critical patent/WO1993008829A1/en

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2803Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
    • C07K16/2809Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily against the T-cell receptor (TcR)-CD3 complex
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70503Immunoglobulin superfamily
    • C07K14/70514CD4
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/46Hybrid immunoglobulins
    • C07K16/468Immunoglobulins having two or more different antigen binding sites, e.g. multifunctional antibodies
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/30Non-immunoglobulin-derived peptide or protein having an immunoglobulin constant or Fc region, or a fragment thereof, attached thereto
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/32Fusion polypeptide fusions with soluble part of a cell surface receptor, "decoy receptors"

Definitions

  • This application relates to pharmaceutical compositions useful in the treatment of human immunodeficiency virus (HIV) infections and particularly those useful for stimulating killing of HIV-infected cells by cytotoxic T
  • HIV human immunodeficiency virus
  • lymphocytes are lymphocytes.
  • CD4 is a non-polymorphic glycoprotein with homology to the immunoglobulin gene superfamily (P. Maddon et al., Cell 42:93 [1985]).
  • CD4 defines two distinct subsets of mature peripheral T cells (E. Reinherz et al., Cell 19:821 [1980]), which are distinguished by their ability to interact with nominal antigen targets in the context of class I and class II major histocompatibility complex (MHC) antigens, respectively (S. Swain, Proc. Natl. Acad. Sci. 78:7101 [1981]; E. Engleman et al., J. Immunol. 127:2124 [1981]; H. Spitz et al., J. Immunol. 129:1563 [1982]; W. Biddison et al., J. Exp. Med. 156: 1065 [1982]; and D. Wilde et al., J.
  • CD4 T cells display the helper/inducer T cell phenotype (E. Reinherz, supra), although CD4 T cells characterized as cytotoxic/suppressor T cells have also been identified (Y. Thomas et al., J. Exp. Med. 154:459 [1981]; S. Mauer et al., Proc. Natl. Acad. Sci. USA 79:4395 [1982]; and A. Krensky et al., Proc. Natl. Acad. Sci. USA 79:2365
  • CD4 helper/inducer T cell function probably underlies the profound defects in cellular and humoral immunity leading to the opportunistic infections and malignancies characteristic of the acquired immunodeficiency syndrome (AIDS) (H. Lane supra).
  • CD4 T cells Studies of HIV-I infection of fractionated CD4 and CD8 T cells from normal donors and AIDS patients have revealed that depletion of CD4 T cells results from the ability of HIV-I to selectively infect, replicate in, and ultimately destroy this T lymphocyte subset (D. Klatzmann et al., Science 225:59 [1984]).
  • CD4 itself is an essential component of the cellular receptor for HIV-I was first indicated by the observation that monoclonal antibodies directed against CD4 block HIV-I infection and syncytia induction (A.
  • CD4 Antibody against CD4 was found to inhibit the fusion of uninfected CD4 T cells with HIV-I infected cells in vitro: moreover, the giant multinucleated cells produced by this event die shortly after being formed resulting in the depletion of the population of CD4 cells (J. Lifson et al., Science 232:1123 [1986]).
  • syncytia also requires gp120 expression, and can be elicited by coculturing CD4-positive cell lines with cell lines expressing the HTV-I any. gene in the absence of other viral structural or regulatory proteins (J. Sodroski et al., Nature 322:470 [1986]; J. Lifson et al., Nature 323:725 [1986]).
  • the interaction between gp120 and CD4 constitutes one of several critical entry points in the viral life cycle amenable to therapeutic intervention (H. Mitauya et al., Nature 325:773 [1987]).
  • the known sequence of the CD4 precursor predicts a hydrophobic signal peptide, an extracellular region of approximately 370 amino acids, a highly hydrophobic stretch with significant identity to the membrane-spanning domain of the class ⁇ MHC beta chain, and a highly charged intracellular sequence of 40 residues (P. Madden, Cell 42:93 [1985]).
  • the extracellular domain of CD4 consists of four contiguous regions each having amino acid and structural similarity to the variable and joining (V-J) domains of immunoglobulin light chains as well as related regions in other members of the immunoglobulin gene superfamily. These structurally similar regions of CD4 are termed the V 1 , V 2 , V 3 and V 4 domains (denominated 1-4 in Figure 1).
  • One specific binding region of the molecule generally referred to herein as a binding domain, consists of a portion (or all) of a CD4 variable region that is capable of binding to HIV gp120 while the other binding region (binding domain) exhibits specific binding affinity for a cytotoxic T cell, typically via an anti-CD3 binding region of an antibody.
  • the bispecific molecules used in compositions of the invention referred to herein as "bispecs," are able to mediate the killing of cells infected with HIV virus of any strain by cytotoxic T cells of any specificity. It is no longer necessary to direct an antibody specifically to the HIV virus or to any particular class of T lymphocytes.
  • Bispecs include single polypeptide chains with a CD4 region at one end and an anti-CD3 region at the other end, typically prepared by splicing CD4 variable region domains of a CD4 molecule onto anti-CD3 variable region domains of an anti-CD3 antibody, using techniques of genetic engineering.
  • modified antibody molecules can be prepared, in which one arm of the antibody is derived from an anti-CD3 antibody and the other arm is derived from a CD4 molecule.
  • These antibody molecules are preferably designed to be specifically useful in clinical situations by incorporating deletions of non-specific binding regions in, for example, the Fc region of the antibody chain, so that undesired binding, and thus indiscriminate cell killing, does not occur.
  • Bispecs of the invention as described in detail below, have been demonstrated to mediate killing of HIV infected cells in the presence of completely unrelated cytotoxic T lymphocytes.
  • Figure 1 is a schematic representation of the structure of a CD4 molecule and of a typical immunoglobulin chain exemplified by the ⁇ 1 antibody chain.
  • CD4 and ⁇ 1 are shown in the first two lines of the Figure 1.
  • the third line of Figure 1 shows the four immunoglobulin-like domains of CD4 as a separate soluble entity, as they can be prepared by techniques of recombinant engineering (soluble rCD4).
  • the last two lines of Figure 1 show two fusion proteins formed by linking various CD4 domains to the constant region of the ⁇ 1 immunoglobulin chain.
  • the first of these two representations, indicated by CD4 2 ⁇ 1 consists of the first two domains of CD4 linked to the constant region of ⁇ 1.
  • the last line of the Figure, identified as CD4 2 ⁇ 1 shows a construct in which the first four domains of have been attached to the constant region of ⁇ 1.
  • FIG. 2 is a schematic representation of a bispecific antibody.
  • the left arm of the molecule consists of the fusion protein CD4 ⁇ 1 linked to ⁇ light chain by a disulfide bridge; the right arm consists of a ⁇ 1, ⁇ pair.
  • the left arm binds to HIV gp120 of any strain.
  • the right arm of the bispecific antibody binds to CD3, a component of the T cell receptor, and, thereby, activates the cytotoxic T cell.
  • CD4.1, CD4.2, CD4.3, and CD4.4 are immunoglobulin-like domains of CD4; CH1, CH2, and CH3 are constant region domains of ⁇ 1 chains; VH is the variable region of ⁇ 1 heavy chain; VL is the variable region of ⁇ .
  • Figure 3 is a series of schematic representations of autoradiographs.
  • Positions 1, 2, and 3 indicate M-T301 immunoglobulin, bispecific antibody, and CD4 ⁇ 1, ⁇ tetramers, respectively.
  • Lane 4 of Figure 3(c) was cut out and rerun under reducing conditions,
  • (e) Transfectoma supernatant purified over an anti-CD4 column, electrophoresed non-reduced or after reduction,
  • (f) Non-reduced material electrophoresed as in Figure 3(e) rerun under reducing conditions.
  • Positions 1 and 2 indicate bispecific antibody and CD4 ⁇ 1, ⁇ dimers, respectively. Staining in 2(e) and 2(f) was with Commassie blue.
  • bispecific molecules usually a modified form of antibodies, that direct cytotoxic T lymphocytes of any specificity to cells that express gp120.
  • These bispecific molecules comprise an anti-T-cell- specific-antigen binding region and a CD4 region; e.g., one heavy/light chain pair from an antibody to a CD3 antigen linked to a heavy chain whose variable region has been replaced with sequences from CD4 plus a second light chain.
  • CD3 is part of the antigen receptor on T cells and is responsible for signal transduction and is used throughout this specification as the exemplary (and preferred) cytotoxic-T-cell-specific antigen.
  • T cells of irrelevant specificity effectively lyse HIV-infected cells, as shown by the examples below in which this cytotoxicity has been demonstrated.
  • CD4 the anti-gp120 monoclonal antibody, which was strain-specific and, therefore, of limited therapeutic potential
  • a CD4 derivative such as a CD4 ⁇ 1 chain
  • the heavy antibody chain consists of the first four immunoglobulin-like domains of CD4 fused to the whole constant region of mouse ⁇ 1 chain. HIV cannot mutate out of the binding capability of CD4 without losing its ability to infect cells via their membrane CD4 molecule, so that this and other bispecs will be effective against any HIV strain.
  • domain is used in this specification in the same manner as it is used in biochemistry to describe regions of molecules, usually proteins, that interact with other molecules or have other properties restricted to one (or more) region of the total molecule.
  • a domain is simply a region of a molecule that is associated with a particular physical or chemical property, such as binding to another molecule. This region is generally but not always comprised of a single continuous segment of the amino acid sequence that makes up the total protein.
  • a domain preferably refers to such a continuous segment.
  • domain has come to have a more specialized meaning, namely one of the roughly spherical regions of an antibody chain that are linked to each other to form an immunoglobulin chain (or a similar region of another member of the immunoglobulin superfamily of molecules, such as CD4).
  • the particular meaning of domain as used herein will be clear from the context, but generally domain is used in the broader sense defined above unless it is used to refer to one of the immunoglobulin (or immunoglobulin-like) regions of an antibody chain or CD4 molecule that is specifically referred to as a domain in the scientific literature.
  • domain For exemplification of the meaning of domain as it is used in context of immunoglobulin and CD4 segments in the scientific literature, see the publications discussed in the
  • the invention can be practiced with other molecules that are bispecific in the same manner as the antibodies described above.
  • the immunoglobulin-like domains of a CD4 molecule can be linked to a molecule retaining its specificity for CD3 in any fashion, including using linkers (usually short polypeptide chains), to provide a bispec of the invention.
  • a particularly preferred bispec is prepared as a fusion protein in which one end of the molecule is a CD4 domain or domains and the other end of the molecule is a binding region for CD3.
  • Such molecules can readily be prepared as fused proteins by genetic engineering by linking coding regions together, such as the coding region for one or more domains of CD4 and the coding region for at least the binding region of one strand, preferably the heavy chain variable region, of an anti-CD3 antibody. Recent work has shown that single-stranded antibody chains retain specificity for their specific antigen
  • a single-chain polypeptide of the invention can be prepared by linking together the coding regions for at least one CD4 variable region domain, for V H and V L , and for C ⁇ .
  • the resuling single polypeptide will thus contain both V L and V H .
  • Examples of molecules prepared in this manner are given below.
  • a particularly preferred example, D-V H -V L -C ⁇ has been shown to be effective by colleagues of the present inventors.
  • V H and V L are linked via a short peptide linker in order to provide sufficient flexibility for the antibody binding site to form.
  • the CD4 domain can be attached directly to the N terminus of the V H domain.
  • the CD4 domain has its leader sequence for secretion from mammalian cells, but the leader sequences of the V H and V L are not present.
  • the C ⁇ region is retained in order to assist in folding and stability of the antibody part of the molecule, even if other deletions occur, as discussed in more detail below.
  • Constructs that comprise entire antibody and CD4 domains are also preferred for ease of folding, expression, and genetic
  • detectably labeled gp120 molecules can be used in a variety of well-known techniques to determine the ability of the CD4 portion of the molecule to bind gp120.
  • detectably labeled CD3 antigen can be used to determine whether the anti-CD3 portion of the molecule retains its binding ability. If desired for higher binding affinity or greater specificity, a genetic construct can be prepared that encodes two proteins, one being the fused
  • CD4/antibody chain e.g., with an antibody heavy chain
  • the other being the remaining anti-CD3 antibody chain (e.g., the light chain).
  • Expression of the two proteins concurrently will result in assembly of the light and heavy chains to form one light/heavy chain pair (i.e., one arm of an antibody against CD3) with the CD4 domain being attached to one of the antibody chains.
  • the antibody binding domain When assembled in this fashion, it is preferred to have the antibody binding domain at the N terminus of the fused molecule and (in some embodiments) to include at least part of the constant region of the two antibody chains for ease of post-expression assembly.
  • other embodiments eliminate all or part of one or more constant region domains, as discussed in more detail below, in order to eliminate undesired binding of the antibody Fc region to other cells and/or molecules.
  • the CD4 region is normally attached in such constructs at the C terminus, although the alternative order can occur as well.
  • Such genetic constructs are prepared in the same manner as is described in detail below for the production of bispecific antibodies of the invention except for the order and/or selection of the segments that are spliced together.
  • Another preferred embodiment uses the concept described by Ward et al., Nature, 341:544 (1989), in which single antibody chains are prepared that retain binding specificity, where the first or the first two domains of the heavy chain are linked by a peptide bridge to the first domain of or the complete light chain.
  • the resulting single antibody chain can be readily fused to a CD4 domain or domains as described herein, using, in preferred embodiments, the same linking groups to attach the two antibody variable regions.
  • the resulting single-chain protein which is readily produced by genetic engineering and expression, has a structure such as D-V L -V H -C ⁇ , D-V H -V L -C ⁇ , D-V H -V L -C ⁇ , V H -V L -C ⁇ -D, V L -V H -C ⁇ -D, V H -V L -C ⁇ -D, and other similar combinations in which a portion (D) of CD4 that retains its binding affinity for gp120 is fused to variable (V; heavy and light chains) and constant (C) domains of an anti-CD3 antibody.
  • Preferred fusions have a CD4 domain or domains at one terminus of the polypeptide chain and the antibody domains at the other terminus. Additional amino acids can be present in central portions of the polypeptide (i.e., between CD4 and antibody domains) without adversely affecting binding affinities.
  • Bispecs of the invention can readily be prepared using existing sources of genetic material encoding the indicated specific molecules. However, the invention also encompasses variations derived from the original material that has been modified by techniques of genetic and protein engineering to provide additional desirable properties in the resulting bispecs. Those bispecs that have the same amino acid sequence (in their relevant portions) as can be found in naturally occurring CD4 and anti-CD3 molecules are referred to herein as
  • Naturally-sequence bispecs This invention, however, is also concerned with amino acid sequence variants of natural-sequence bispecs.
  • Amino acid sequence variants of bispecs are prepared with various objectives in mind, including increasing the affinity of the bispec for its binding partner, facilitating the stability, purification and preparation of the bispec, increasing its plasma half life, improving therapeutic efficacy as described above in the background, introducing additional functionalities and lessening the severity or occurrence of side effects during therapeutic use of the bispec.
  • Amino acid sequence variants of bispecs fall into one or a combination of insertional, substitutional, and deletional variants, as will be discussed in detail below.
  • CD4 immunoglobulin-like domains which may be homologous either to the constant or to the variable region domains, or any other fragment of CD4 (as long as the CD4 sequence retains its ability to bind gp120) is conjugated with an immunoglobulin constant region sequence.
  • Immunoglobulins and certain variants thereof are known and many have been prepared in recombinant cell culture. For example, see U.S. Patent 4,745,055; EP 256,654; Faulkner et al., Nature 298:286 (1982); EP 120,694; EP 125,023; Morrison, J. Immun. 123:793 (1979); Kohler et al., P.N.A.S.
  • the domains of CD4 that are homologous to immunoglobulins and extracellular in their native environment are fused C-terminally to the N-terminus of the constant region of immunoglobulins in place of the variable region(s) thereof, retaining at least functionally active hinge, CH2 and CH3 domains of the constant region of an immunoglobulin heavy chain.
  • This ordinarily is accomplished by constructing the appropriate DNA sequence and expressing it in recombinant cell culture.
  • Immunoglobulins and other polypeptides having enhanced plasma half life are fused to the extracellular or ligand binding domains of other CD4 variants in the same fashion.
  • the boundary domains for the CD4 V-like regions are, respectively, about 100-109, about 175-184, about 289-298, and about 360-369 (based on the precursor CD4 amino acid sequence in which the initiating met is -25).
  • the CD4 sequence which is well known to those familiar with HIV infections and the CD4 molecule, see Figures 1 and 2 of PCT application US 88/03414 published under the International Publication No. WO
  • CD4 sequences containing any of the CD4 domains involved in binding to gp120 are fused to the immunoglobulin sequence. It is preferable that V1V2 or V1V2V3V4 be fused at its C-terminus to the immunoglobulin constant region.
  • the precise site at which the fusion is made is not critical; the boundary domains noted herein are for guidance only and other sites neighboring or within the V regions may be selected in order to optimize the secretion or binding characteristics of the CD4. The optimal site will be determined by routine experimentation.
  • the fusions are generally expressed intracellularly, but a great deal of variation is encountered in the degree of secretion of the fusions from recombinant hosts.
  • Table 1 shows various CD4 immunoglobulin fusions that were obtained in PCT/US88/03414. These immunoglobulin chains were referred as "immuno- adhesons," and this terminology is retained here to refer to single antibody chains consisting of one or more CD4 domains linked to the constant region of an immunoglobulin chain. In all of these examples of CD4 immunoadhesons, the CD4 signal was used to direct secretion from 293 cells.
  • CD4 immunoadhesons typically contained either the first N-terminal 366 residues of CD4 (CD4 4 ) or the first 180 N-terminal residues of CD4 (CD4 2 ) linked at their C-terminus to the ⁇ (light) chain or IgG1 heavy chain constant region ( ⁇ 1).
  • CD4/human-heavy-chain immunoadheson was secreted as a dimer whereas the analogous murine construction was not detected (this does not exclude the intracellular accumulation of the protein, however).
  • CD4-IgG immunoadheson chimeras are readily secreted wherein the CD4 epitope is present fused to one or more light or heavy chains, including heterotetramers wherein up to and including all four variable region analogues are derived from CD4.
  • a heterofunctional antibody thus is provided.
  • the heterofunctional antibody is a bispec when the separate heavy-light chain is obtained from an anti-CD3 antibody.
  • Such antibodies are available commercially, as are hybridomas that contain genetic information encoding anti-CD3 antibodies. Additionally, production of new anti-CD3-producing cell lines can readily be accomplished by routine immunological techniques.
  • exemplary hetero- and chimeric bispecific antibodies produced in accordance with this invention are schematically diagrammed below.
  • “D” means at least a portion of the extracellular domain of CD4 containing its ligand binding site;
  • V L , V H , C L and C H represent light or heavy chain variable or constant domains of an immunoglobulin;
  • n is an integer; and
  • Y designates a covalent cross-linking moiety.
  • the structures in this list of formulas show only key features; e.g., they do not show joining (J) or other domains of the immunoglobulins, nor are disulfide bonds shown. These are omitted in the interests of brevity. However, where such domains are required for binding activity they shall be construed as being present in the ordinary locations which they occupy in the CD4, bispec, or immunoglobulin molecules as the case may be. These examples are representative of divalent antibodies; more complex structures would result by employing immunoglobulin heavy chain sequences from other classes, e.g., IgM.
  • the immunoglobulin V L V H antibody combining site also designated as the companion immunoglobulin, preferably is capable of binding to a predetermined antigen. Suitable companion immunoglobulin combining sites and fusion partners are obtained from IgG-1, -2, -3, or -4 subtypes, IgA, IgE, IgD or IgM.
  • a preferred embodiment of a fused CD4/immunoglobulin chain for use in preparing a bispec of the invention is a fusion of an N-terminal portion of CD4, which contains the binding site for the gp120 envelope protein of HIV, to the C-terminal F c portion of an antibody, containing the effector functions of immunoglobulin G 1 .
  • those variants in which one or more immunoglobulin-like domains of CD4 are substituted for the variable region of an immunoglobulin chain are useful in preparing bispecs of the invention.
  • These chimeras are constructed in a fashion similar to chimeric antibodies in which a variable domain from an antibody of one species is substituted for the variable domain of another species. See, for example, EP 0 125 023; Munro, Nature 312:
  • the DNA encoding the CD4 immunoglobulin-like domain(s) is cleaved by a restriction enzyme at or proximal to the 3' end of the DNA encoding the immunoglobulin-like domain(s) and at a point at or near the DNA encoding the N-terminal end of the mature CD4 polypeptide (where use of a different leader is contemplated) or at or proximal to the N-terminal coding region for CD4 (where the native CD4 signal is employed).
  • This DNA fragment then is readily inserted into DNA encoding an
  • immunoglobulin light or heavy chain constant region and, if necessary, tailored by deletional mutagenesis.
  • this is a human immunoglobulin when the variant is intended for in vivo therapy for humans.
  • immunoglobulin light or heavy chain constant regions is known or readily available from cDNA libraries or is synthesized. See for example, Adams et al.,
  • DNA encoding the immunoglobulin or immunoadheson chimeric chain(s) is transfected into a host cell for expression. If the host cell is producing an immunoglobulin prior to transfection, then one need only transfect with the CD4 domains fused to light or to heavy chain to produce a heteroantibody.
  • the aforementioned immunoglublins having one or more arms bearing the CD4 domain and one or more arms bearing companion variable regions specific for CD3 result in dual specificity for gp120 of any source and for a CD3 antigen.
  • F(ab') 2 fragments of the adheson fusion and an immunoglobulin are prepared, the F(ab') 2 fragments converted to Fab' fragments by reduction under mild reducing conditions, and then reoxidized in each other's presence under acidic conditions in accord with methods known per se. See also
  • heteroantibodies from immunoglobulins having different specificities can be adopted for the in vitro production of bispecs by simply substituting the CD4-containing chains for one of the previously employed immunoglobulins.
  • host cells producing a CD4-immunoglobulin fusion e.g., transfected myelomas
  • B cells or hybridomas which secrete antibody having the desired companion specificity for CD3 antigen also are fused with B cells or hybridomas which secrete antibody having the desired companion specificity for CD3 antigen.
  • Heterobifunctional antibody is recovered from the culture medium of such hybridomas, and thus can be produced somewhat more conveniently than by conventional in vitro resorting methods (EP 68,763).
  • the present invention contemplates not only natural-sequence bispecs, but variants in which there have been single, multiple, or combinations of insertions, deletions, and/or substitutions of amino acids in the naturally derived sequences.
  • Insertional amino acid sequence variants are those in which one or more amino acid residues extraneous to the bispec are introduced into a predetermined site in the bispec including the C or N terminus of any polypeptide chain.
  • Such variants, particularly when the insertions are lengthy, are referred to as fusions of the bispec and a different polypeptide.
  • Such fusions contain sequences other than those which are normally found in the bispec at the inserted position.
  • Another class of bispec variants comprises deletional variants.
  • Deletions are characterized by the removal of one or more amino acid residues from a given sequence.
  • CD4 are deleted. When such deletions are desired in the case of CD4, at least residues 368 to 395 (the transmembrane region), and ordinarily 396-433 as well (the cytoplasmic domain), will be deleted.
  • Another preferred deletion is one which reduces or eliminates the ability of CD4 to bind to MHC class ⁇ antigens.
  • the amino acid residues associated with binding are numbers 19, 89, and 165 of the CD4 molecule.
  • CD4 deletions affecting MHC class II antigen binding with a CD4 molecule is described in Fleury et al., Cell 66: 1037.
  • a preferred class of compounds encompasses bispecs derived from antibodies in which the binding region for Fc receptor is deleted or modified to reduce undesired binding.
  • Such deletions can be of one or more entire domains of the Fc region or can a deletion or mutation of part of a domain or even a single amino acid.
  • a preferred mutation would be to change residue 235 of IgG from leu to glu, as demonstrated and described in Alegre et al., J. Immunol. 148:3461.
  • the CH2 domain which is the domain that interacts the Fc receptor, should be deleted. Whether or not any given deletion results in a bispec with the desired binding properties can readily be tested using the procedures described in the following examples to determine whether the resulting molecule is capable of directing cytotoxic T cells to HIV-infected cells.
  • Substitutional variants are those in which at least one residue in a sequence has been removed and a different residue inserted in its place.
  • the native N-terminal residue for mature CD4 is now known to be lysine.
  • the normal sequence shown in Figure 1 of PCT/US88/03414, with an N-terminal asparagine is an amino acid sequence variant of native mature CD4.
  • Table 2 below describes substitutions which in general will result in fine modulation of the characteristics of the CD4 antigen or anti-CD3 binding region.
  • substitutions that are less conservative than those in Table 2, i.e., selecting residues that differ more significantly in their effect on maintaining (a) the structure of the polypeptide backbone in the area of the substitution, for example as a sheet or helical conformation, (b) the charge or hydrophobicity of the molecule at the target site or (c) the bulk of the side chain.
  • the substitutions which in general are expected to produce the greatest changes in adheson properties will be those in which (a) a hydrophilic residue, e.g., seryl or threonly, is substituted for (or by) a hydrophobic residue, e.g., leucyl, isoleucyl,
  • a cysteinyl or prolyl is substituted for (or by) any other residue
  • a residue having an electropositive side chain e.g., lysyl, arginyl, or histidyl
  • an electronegative residue e.g., glutamyl or aspartyl
  • a residue having a bulky side chain e.g.,
  • phenylalanyl is substituted for (or by) one not having a side chain, e.g., glycyl.
  • variants ordinarily are prepared by site specific mutagenesis of nucleotides in the DNA encoding the CD4 or anti-CD3 molecules, thereby producing DNA encoding the variant, and thereafter expressing the DNA in recombinant cell culture.
  • variant bispecs also are prepared by in vitro synthesis. Obviously, variations made in the DNA encoding the variant bispecs must not place the sequence out of reading from and preferably will not create complementary regions that could produce secondary mRNA structure deleterious to expression (EP 75 444 A).
  • the CD4-derived region or regions of the variants typically exhibit the same gp120 binding activity as does the naturally occurring prototype, although variants also are selected in order to modify the characteristics of the CD4 adheson as indicated above.
  • the regions of the CD4 molecule that are responsible for binding to class II major histocompatibility antigen (MHC) can be deleted in order to eliminate binding to undesired locations in vivo. Similar considerations exist for the anti-CD3 region or regions.
  • the mutation per se need not be predetermined. For example, in order to optimize the performance of a mutation at a given site, random
  • mutagenesis may be conducted at the target codon or region and the expressed adheson variants screened for the optimal combination of desired activities.
  • substitution mutations are predetermined sites in DNA having a known sequence are well known, for example M13 primer mutagenesis.
  • CD4 The DNA encoding CD4 is obtained by known procedures. See Williams, Immunol. Today 8:298-303 (1987) and citations therein. In general, prokaryotes are used for cloning of CD4 variant DNA sequences.
  • E. coli strain SR101 for propagating ml3 phage, a ⁇ -resistant strain of JM 101; Messing et al., Nucl. Acids. Res. 9(2):309-321 [1981]
  • E. coli K12 strain 294 ATCC No. 31446) are particularly useful.
  • Other microbial strains which may be used include E. coli B, UM101 and E. coli ⁇ 1776 (ATCC No. 31537). These examples are illustrative rather than limiting.
  • DNA encoding the various constructs used in preparing polypeptides of the invention is inserted for expression into vectors containing promoters and control sequences which are derived from species compatible with the intended host cell.
  • the vector will ordinarily, but need not, carry a replication site as well as one or more marker sequences which are capable of providing phenotypic selection in transformed cells.
  • E. coli is typically transformed using a derivative of pBR322 which is a plasmid derived from an E. coli species
  • pBR322 contains genes for ampicillin and tetracycline resistance and thus provides easy means for identifying transformed cells.
  • the pBR322 plasmid, or other microbial plasmid must also contain or be modified to contain promoters and other control elements commonly used in recombinant DNA constructions.
  • Promoters suitable for use with prokaryotic hosts illustratively include the ⁇ -lactamase and lactose promoter systems (Chang et al., Nature
  • eukaryotic microbes such as yeast cultures also are useful as cloning or expression hosts.
  • Saccharomyces cerevisiae. or common baker's yeast is the most commonly used eukaryotic microorganism, although a number of other strains are commonly available.
  • the plasmid YRp7 for example, (Stinchcomb et al., Nature
  • This plasmid already contains the trp1 gene which provides a selection marker for a mutant strain of yeast lacking the ability to grow in tryptophan, for example ATCC No. 44076 or PEP4-1 (Jones, Genetics
  • Suitable promoting sequences for use with yeast hosts include the promoters for 3-phosphoglycerate kinase (Hitzeman et al., J. Biol. Chem.
  • glycolytic enzymes Hess et al., J. Adv. Enzyme Reg. 7:149 [1968]; and Holland, Biochemistry 17:4900 [1978]
  • enolase glyceraldehyde-3-phosphate dehydrogenase, hexokinase, pyruvate decarboxylase, phosphofructokinase, glucose-6-phosphate isomerase, 3-phosphoglycerate mutase, pyruvate kinase, triosephosphate isomerase, phosphoglucose isomerase, and glucokinase.
  • yeast promoters which are inducible promoters having the additional advantage of transcription controlled by growth conditions, are the promoter regions for alcohol dehydrogenase 2, isocytochrome C, acid
  • yeast promoters for use in yeast expression are further described in R. Hitzeman et al. , European Patent Publication No. 73,657A. Yeast enhancers also are advantageously used with yeast promoters.
  • Promoters for controlling transcription from vectors in mammalian host cells may be obtained from various sources, for example, the genomes of viruses such as: polyoma, Simian Virus 40 (SV40), adenovirus, retroviruses, hepatitis-B virus and most preferably cytomegalovirus, or from heterologous mammalian promoters of the S V40 virus are conveniently obtained as an S V40 restriction fragment which also contains the SV40 viral origin of replication. Fiers et al., Nature 273:113 (1978). The immediate early promoter of the human cytomegalovirus is conveniently obtained as a HindIII E restriction fragment. Greenaway, P.J. et al., Gene 18:355-360 (1982). Of course, promoters from the host cell or related species also are useful herein.
  • viruses such as: polyoma, Simian Virus 40 (SV40), adenovirus, retroviruses, hepatitis-B virus and most preferably cytomegalovirus,
  • Enhancers are cis acting elements of DNA, usually from about 10 to 300bp, that act to increase the transcription initiation capability of a promoter. Enhancers are relatively orientation ad position independent having been found 5' (Laurrins, L. et al., Proc. Natl. Acid. Sci. 78:993 [1981]) and 3' (Lusky, MX., et al., Mol. Cell Bio.
  • enhancer sequences are now known from mammalian genes (globin, elastase, albumin, ⁇ -fetoprotein and insulin). Typically, however, one will use an enhancer from a eukaryotic cell virus. Examples include the SV40 enhancer on the late side of the replication origin (bp 100-270), the
  • cytomegalovirus early promoter enhancer the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers.
  • Expression vectors used in eukaryotic host cells may also contain sequences necessary for the termination of transcription which may affect mRNA expression.
  • Selection gene also termed a selectable marker.
  • suitable selectable markers for mammalian cells are dihydrofolate reductase (DHFR), thymidine kinase or neomycin. When such selectable markers are successfully transferred into a mammalian host cell, the transformed mammalian host cell can survive if placed under selective pressure.
  • DHFR dihydrofolate reductase
  • thymidine kinase thymidine kinase
  • neomycin thymidine kinase
  • CHO DHFR cells and mouse LTK cells. These cells lack the ability to grow without the addition of such nutrients as thymidine or hypoxanthine. Because these cells lack certain genes necessary for a complete nucleotide synthesis pathway, they cannot survive unless the missing nucleotides are provided in a supplemented medium.
  • supplementing the medium is to introduce an intact DHFR or TK gene into cells lacking the respective genes, thus altering their growth requirements. Individual cells which were not transformed with the DHFR or TK gene will not be capable of survival in non supplemented media.
  • the second category is dominant selection which refers to a selection scheme used in any cell type and does not require the use of a mutant cell line. These schemes typically use a drug to arrest growth of a host cell.
  • Those cells which have a novel gene would express a protein conveying drug resistance and would survive the selection.
  • Examples of such dominant selection use the drugs neomycin, Southern P. and Berg, P., J. Molec. Appl. Genet. 1:327 (1982), mycophenolic acid, Mulligan, R.C. and Berg, P., Science 209:1422 (1980) or hygromycin, Sugden, B. et al., Mol. Cell, Bio. 5:410-413 (1985).
  • the three examples given above employ bacterial genes under eukaryotic control to convey resistance to the appropriate drug G418 or neomycin (geneticin), xgpt (mycophenolic acid) or hygromycin, respectively.
  • Amplification refers to the increase or replication of an isolated region within a cell's chromosomal DNA. Amplification is achieved using a selection agent e.g, methotrexate (MTX) which inactivates DHFR. Amplications for the making of successive copies of the DHFR gene results in greater amounts of DHFR being produced in the face of greater amounts of MTX. Amplification pressure is applied notwithstanding the presence of endogenous DHFR, by adding ever greater amounts of MTX to the media. Amplification of desired gene can be achieved by cotransfecting a mammalian host cell with a plasmid having a DNA encoding a desired protein and the DHFR or amplification gene permitting cointegration.
  • MTX methotrexate
  • the result is that increased copies of the gene, i.e., an amplified gene, encoding the desired heterologous protein express more of the desired heterologous protein.
  • Preferred host cells for expressing the CD antigen variants of this invention are mammalian cell lines, examples including: monkey kidney CF1 line transformed by SV40 (COS-7, ATCC CRL 1651); human embryonic M ney line (293, Graham, F.L. et al., J. Gen. Virol. 16:59 [1977] and 2938 cells [293 subclones selected for better suspension growth]); baby hamster kidney cells (BHK, ATCC CCL 10); Chinese hamster ovary-cells-DHFR (CHO, Urlaub and Chas ⁇ n, Proc. Natl. Acad. Sci. USA 17:4216, [1980]); mouse sertoli cells (TM4,
  • human cervical carcinoma cells HELA, ATCC CCL2
  • canine ki ney cells MM K, ATCC CCL 34
  • buffalo rat liver cells BRL 3A, ATCC CRL 1442
  • human lung cells W138, ATCC CCL 75
  • human liver cells Hep G2, HB 8065
  • mouse mammary tumor MMT 060562, ATCC CCL51 cells
  • TRI cells TRI cells
  • Transformation means introducing DNA into an organism so that the DNA is replicable, either as an extrachromosomal element or by chromosomal integration.
  • One suitable for transformation of the host cells is the method of
  • Plasmids containing the desired coding and control sequences employ standard and manipulative ligation techniques. Isolated plasmids or DNA fragments are cleaved, tailored, and relegated in the form desired to form the plasmids required. Suitable procedures are well known for the construction described herein. See, for example, (Maniatis, T. et al., Molecular Cloning, 133-134 Cold Spring Harbor, [1982]; "Current Protocols in Molecular Biology,” edited by Ausubel et al., [1987], publ. by Greene Publishing Associates & Wiley-Interscience).
  • Host cells are transformed with the expression vectors of this invention. Thereafter they are cultured in appropriate culture media, e.g., containing substances for inducing promoters, selecting transformants or amplifying genes.
  • appropriate culture media e.g., containing substances for inducing promoters, selecting transformants or amplifying genes.
  • the culture conditions such as temperature, pH and the like, are those previously used with the host cell selected for expression, and will be apparent to the ordinarily skilled artisan.
  • the secreted polypeptides are recovered and purified from the culture supernatants or lysates of recombinant hosts.
  • the supernatants are concentrated by ultrafiltration, contacted with a ligand affinity or immunoaffinity matrix so as to adsorb the adheson variant, and eluted from the matrix.
  • the bispec or adheson is purified by ion exchange chromatography.
  • the purified bispec is formulated into conventional
  • pharmacologically acceptable excipients It is admimstered to patients having HIV infection at a dosage capable of maintaining a concentration of greater than about 100 ng of soluble bispec/ml plasma.
  • soluble bispec/ml plasma For variants having different molecular weights, about 2 picomoles of soluble receptor per ml of plasma will be initially evaluated clinically in order to establish a stoichiometric equivalence with native (membrane bound) and soluble receptor.
  • the ordinary initial dosage of a bispec is 100 ⁇ g/kg of patient weight/day. This initial dosage can be adjusted either upward or downward depending on the effects of the initial dosage.
  • a composition of the invention for use in vivo generally will contain a pharmaceutically acceptable carrier.
  • a pharmaceutically acceptable carrier By this is intended either solid or liquid material, which may inorganic or organic and of synthetic or natural origin, with which the active component of the composition is mixed or formulated to facilitate administration to a subject.
  • Inert materials in pharmaceutical compositions are also called excipients. Any other materials customarily employed in formulating pharmaceutical are suitable.
  • Solid carriers include natural and synthetic cloisonne silicates, for example natural silicates such as diatomaceous earths; magnesium silicates, for example, talcs; magnesium aluminum silicates, for example attapulgites and vermiculites; aluminum silicates, for example kaolinites, montinorillonites, and micas; calcium carbonates; calcium sulfate; synthetic hydrated silicone oxides and synthetic calcium or aluminum silicates; elements such as carbon or sulfur; natural and synthetic resin such as polyvinyl alcohol; and waxes such as parafan and beeswax.
  • suitable liquid carriers include water and aqueous solutions containing oxygenated organic compounds such as ethanol.
  • the therapeutic bispec can be employed by itself or with other therapies and agents for the treatment of AIDS, including AZT, neutralizing antibodies, immunocytotoxins, and vaccines.
  • Plasmids are designated by a lower case p preceded and/or followed by capital letters and/or numbers.
  • the starting plasmids herein are either commercially available, publicly available, publicly available on a restricted basis, or can be constructed from available plasmids in accord with published
  • “Digestion” of DNA refers to catalytic cleavage of the DNA with a restriction enzyme that acts only at certain sequences in the DNA.
  • the various restriction enzymes used herein are commercially available and their reaction conditions, cofactors and other requirements were used as would be known to the ordinarily skilled artisan.
  • For analytical purposes typically 1 ⁇ g of plasmid or DNA fragment is used with about 2 units of enzyme in about 20 ⁇ l of buffer solution.
  • For the purpose of isolating DNA fragments for plasmid construction typically 5 to 50 ⁇ g of DNA are digested with 20 to 250 units of enzyme in a larger volume. Appropriate buffers and substrate amounts for particular restriction enzymes are specified by the manufacturer. Incubation times of about 1 hour at 37°C are ordinarily used, but may vary in accordance with the supplier's instructions. After digestion the reaction is electrophoresed directly on a polyacrylamide gel to isolate the desired fragment.
  • Recovery or “isolation” of a given fragment of DNA form a restriction digest means separation of the digest on polyacrylamide or agarose gel by electrophoresis, identification of the fragment of interest by comparison of its mobility versus that of marker DNA fragments of known molecular weight, removal of the gel section containing the desired fragment, and separation of the gel from DNA.
  • This procedure is known generally (Lawn, R. et al., Nucelic Acids Res. 9:6103-6114 [1981], and Goeddel, D. et al., Nucleic Acids Res.
  • Dephosphorylation refers to the removal of the terminal 5' phosphates by treatment with bacterial alkaline phosphatase (BAP). This procedure prevents the two restriction cleaved ends of a DNA fragment from "circularizing” or forming a closed loop that would impede insertion of another DNA fragment at the restriction site. Procedures and reagents for
  • Reactions using BAP are carried out in 50mM Tris at 68°C to suppress the activity of any exonuclease which may be present in the enzyme preparations. Reactions were run for 1 hours. Following the reaction the DNA fragment is gel purified.
  • “Ligation” refers to the process of forming phosphodiester bonds between two double stranded nucleic acid fragments (maniatis, T. et al., Id. at
  • ligation may be accomplished using known buffers and conditions with 10 units of T4 DNA ligase ("ligase”) per 0.5 ⁇ g of approximately equimolar amounts of the DNA fragments to be ligated.
  • ligase T4 DNA ligase
  • “Filling” or “blunting” refers to the procedures by which the single stranded end in the cohesive terminus of a restriction enzyme-cleaved nucleic acid is converted to a double strand. This eliminates the cohesive terminus and forms a blunt end. This process is a versatile tool for converting a restriction cut end that may be cohesive with the ends created by only one or a few other restriction enzymes into a terminus compatible with any blunt-cutting restriction endonuclease or other filled cohesive terminus.
  • blunting is accomplished by incubating 2-15 ⁇ g of the target DNA in 10mM MgCl 2 , 1mM dithiothreitol, 50mM NaCl, 10mM Tris (pH 7.5) buffer at about 37°C in the presence of 8 units of the Klenow fragment of DNA polymerase I and 250 ⁇ M of each of the four deoxynucleoside triphosphates.
  • the incubation generally is terminated after 30 min. phenol and chloroform extraction and ethanol precipitation.
  • Examples 1-4 are prior examples published in PCT/US88/03414 which show preparation of antibody/CD4 fusions that can be used to prepare bispecs of the invention, such as those described in Example 5.
  • Example 1 is prior examples published in PCT/US88/03414 which show preparation of antibody/CD4 fusions that can be used to prepare bispecs of the invention, such as those described in Example 5.
  • Example 1 is prior examples published in PCT/US88/03414 which show preparation of antibody/CD4 fusions that can be used to prepare bispecs of the invention, such as those described in Example 5.
  • the plasmid used for recombinant synthesis of human CD4 was pSVeCD4DHFR.
  • the plasmid was constructed as follows:
  • XCD4P1 containing most of the coding sequence of human CD4 was digested with
  • pUC18 was digested with EcoRI and the single fragment recovered by polyacrylamide gel electrophoresis (Fragment 2). Fragment 1 was ligated to fragment 2 and the ligation mixture transformed into E. coli strain 294. The transformed culture was plated on ampicillin media plates and resistant colonies selected. Plasmid DNA was prepared from transformants and checked by restriction analysis for the presence of the correct DNA fragments. This plasmid is referred to as pUCD4.
  • pSVeE'DHFR (Muesing et al., Cell 48:691-701 [1987]) was digested with KpnI and BamHI and blunted with E. coli DNA polymerase I
  • Fragment 3 containing the pML-Amp r region, SV40 early promoter, the HIV LTR, and the mouse DHFR gene was recovered by gel electrophoresis, ligated and the ligation mixture transformed into E. coli strain 294. The transformed culture was plated on ampicillin media plates and resistant colonies selected. Plasmid DNA was prepared from transformants and checked by restriction analysis for the presence of the BamHI restriction site and the absence of the KpnI restriction site. This plasmid is referred to as pSVe ⁇ BKDHFR and allows EcoRI-BamHI fragments to be inserted after the SV40 early promoter and transcribed under its control, following transfection into an appropriate cell line.
  • Synthetic oligonucleotides (adaptors 1-8, below) were made to extend from 76 bp 5' of the initiation codon of CD4 translation to the RaaI restriction site at 121 bp 3' of the initiator, with the sequence AATT at the 5' end of the sense strand t generate an end which could ligate to an EcoRI restriction fragment. These oligonucleotides were ligated and the 204 bp fragment containing the entire sequence recovered by gel electrophoresis (Fragment 4).
  • CD4 adaptor 1 AATTCAAGCCCAGAGCCCTGCCATTTCTGTGGGCTC
  • AGGTCCCT CD4 adaptor 2 pACTGCTCAGCCCCTTCCTCCCTCGGCAAGGCCACA
  • CD4 adaptor 3 pCCTTTTAGGCACTTGCTTCTGGTGCTGCAACTGGCG
  • CTCCTCCCAGC CD4 adaptor 4 pAGCCACTCAGGGAAACAAAGTGGTGCTGGGCAAAA
  • AGGGGATACAGTGGAAGTGACCTGT CD4 adaptor 5 pACAGGTCAGTTCCACTGTATCCCCTTTTTTGCCCAG
  • CACCACTTTGTTTCC CD4 adaptor 6 pCTGAGTGGCTGCTGGGAGGAGCGCCAGTTGCAGCA
  • CCAGAAGCAAGT CD4 adaptor 7 pGCCTAAAAGGGACTCCCCGGTTCATTGTGGCCTTG
  • CGAGGGAGGAAGGG CD4 adaptor 8 GCTGAGCAGTAGGGACCTGAGCCCACAGAAATGGCAGG
  • pUCCD4 was digested with RsaI and SstI and the 401 bp fragment containing part of the CD4 coding sequence recovered by gel electrophoresis (Fragment 5).
  • pUC18 was digested with EcoRI and SstI and the fragment comprising the bulk of the plasmid recovered by gel electrophoresis (Fragment 6).
  • Fragments 4 and 5 were ligated to Fragment 6 and the ligation mixture
  • E. coli strain 294. The transformed culture was plated on ampicillin media plates and resistant colonies selected. Plasmid DNA was prepared from transformants and checked by restriction analysis for the presence of the correct fragment. The sequence of the inserted synthetic DNA was checked by excising the 605 bp EcoRI-SstI fragments from several transformants and ligating them to M13mp19 which had been digested with the same enzymes. After transformation into E. coli strain JM101, single-stranded DNA was prepared and sequenced. One plasmid which contained the correct sequence was selected, and is referred to as pCD4int.
  • pCD4int was digested with EcoRI and SstI and fragment 7 containing the 5' end of the CD4 coding region was recovered by gel
  • pUCCD4 was digested with SstI and BamHI and the 1139 bp fragment containing the remainder of the CD4 coding region (fragment 8)
  • pSVe ⁇ BKDHFR was digested with EcoRI and BamHI and fragment 9 comprising the bulk of the plasmid was isolated. Fragments 7, 8, and 9 were ligated and the ligation mixture transformed into E. coli strain 294. The
  • Plasmid DNA was prepared from transformants and checked by restriction analysis for the presence of the correct fragment. This plasmid is referred to as pSVeCD4DHFR, and was used to direct synthesis of recombinant intact CD4.
  • Synthetic DNA is made to code for the C region of human ⁇ chain (residues 109-214) based on the sequence published by Morin et al., Proc. Natl.
  • pRKCD4 is digested with EcoRI and BspMI and the 478bp fragment containing the region coding for the putative V-like domain of CD4 is recovered (fragment 34). Fragments 33 and 34 are ligated together with fragment 16 (from the expression vector pRK5). The ligation mixture is transformed into E. coli strain 294, the transformed culture plated on ampicillin media plates and resistant colonies selected. Plasmid DNA is prepared from transformants and checked by restriction analysis for the presence of the correct fragment. The resulting plasmid is referred to as pRKCD4Ck.
  • a plasmid encoding a fusion of the CD4 V-like domain to the human immunoglobulin C ⁇ 2 region is constructed in a similar fashion, and is referred to as pRKCD4C ⁇ 2. Both of these plasmids are transfected into 293 cells, myeloma cells or other competent cells in order to obtain cell lines expressing variant CD4 molecules as described above.
  • Plasmids were constructed to direct the expression of proteins containing differing lengths of the ammo-terminal, extracellular domain of CD4 fused to the constant region of human immunoglobulin ⁇ 1. These plasmids are referred to as pRKCD4 2 ⁇ 1 , pRKCD4 e4 ⁇ 1 , pRKCD4 2 ⁇ 1 , PRKCD4 1 , and pRKCD4 el ⁇ 1 .
  • Plasmid pRKCD4 4 ⁇ 1 contains the portion of the CD4 gene from the initiation codon to the fusion site after the codon for serine reside 366 of the mature CD4 polypeptide, immediately followed by the sequence coding for the constant region of human immunoglobulin ⁇ 1, starting at the codon for serine residue 114 of mature human immunoglobulin ⁇ 1 (Kabat et al.).
  • Plasmid pRKCD4 e4 ⁇ 1 contains the portion of the CD4 gene from the initiation codon to the fusion site after the codon for lysine residue 360 of the mature CD4 polypeptide, immediately followed by the sequence coding for the constant region of human immunoglobulin ⁇ 1, starting at the codon for serine residue 114 of mature human immunoglobulin ⁇ 1 (Kabat et al.).
  • Plasmid pRKCD4 2 ⁇ 1 contains the portion of the CD4 gene from the initiation codon to the fusion site after the codon for glutamine residue 180 of the mature CD4 polypeptide, immediately followed by the sequence coding for the constant region of human immunoglobulin ⁇ 1, starting at the codon for serine residue 114 of mature human immunoglobulin ⁇ 1 (Kabat et al.).
  • Plasmid pRKCD4 e2 ⁇ 1 contains the portion of the CD4 gene from the initiation codon to the fusion site after the codon for leucine residue 117 of the mature CD4 polypeptide, immediately followed by the sequence coding for the constant region of human immunoglobulin ⁇ 1, starting at the codon for serine residue 114 of mature human immunoglobulin ⁇ 1 (Kabat et al.).
  • Plasmid pRKCD4 1 ⁇ 1 contains the portion of the CD4 gene from the initiation codon to the fusion site after the codon for aspartic acid residue 105 of the mature CD4 polypeptide, immediately followed by the sequence coding for the constant region of human immunoglobulin ⁇ 1, starting at the codon for serine residue 114 of mature human immunoglobulin ⁇ 1 (Kabat et al.).
  • Plasmid pRKCD4 e1 ⁇ 1 contains the portion of the CD4 gene from the initiation codon to the fusion site after the codon for leucine residue 100 of the mature CD4 polypeptide, immediately followed by the sequence coding for the constant region of human immunoglobulin ⁇ 1, starting at the codon for serine residue 114 of mature human immunoglobulin ⁇ 1 (Kabat et al.).
  • a cDNA clone coding for human immunoglobulin ⁇ 1 was obtained from a human spleen cDNA library (Clontech Laboratories, Ine.) using oligonucleotides based on the published sequence (Ellison et al., Nucl. Acids Res. 10:4071-4079 [1982]), and an EcoRI-EagI fragment (the EcpRI site was contributed by a linker; see Figure 4a and b of PCT/US88/03414) containing part of the variable and all of the constant region was obtained. This fragment was blunted with Klenow fragment, and recovered by gel electrophoresis (Fragment al).
  • Plasmid pRKCD4TP-kk encoding a substitutional variant of soluble CD4 (residues 1-368) containing a lysine residue instead of asparagine at position
  • Plasmid pRKCD4TP was transformed into E. coli strain SR101 and the transformed colonies plated on ampicillin media plates. Resistant colonies were selected and grown in the presence of m13K07 helper bacteriophage to yield secreted, encapsidated single-stranded templates of pRKCD4TP. The single-stranded plasmid DNA was isolated and used as the template for mutagenesis reactions with the synthetic oligonucleotides described above as primers. The mutagenesis reaction was transformed E. coli SR101 and the transformed culture plated on ampicillin media plates. Transformants were screened by colony hybridization (ref . Grunstein-Hogness) for the presence of the appropriate sequence, using the following 16 mer as the probe.
  • hybridization conditions chosen were sufficiently stringent that the probe only detects the correctly fused product. Colonies identified as positive were selected and plasmid DNA was isolated and transformed into E. coli strain SR101. The transformed cultures were plated on ampicillin media plates, and resistant colonies were selected and grown in the presence of m13K07 bacteriophage. Templates were prepared as above and screened by sequencing.
  • Plasmid pRKCD4TP-kk was digested with Xbal and treated with
  • Klenow Enzyme, and Fragment a2 containing the linearized plasmid was recovered by gel electrophoresis, and ligated with fragment al.
  • the ligation mixture as transformed into E. coli strain 294, the transformed culture plated on ampicillin media plates and resistant colonies selected. Plasmid DNA was prepared from the transformants and checked by restriction analysis for the presence of the correct fragment in the correct orientation (i.e., the
  • This plasmid is referred to as pRKCD4TP/ ⁇ 1.
  • Synthetic oligonucleotides were made as primers for deletional mutagenesis reactions to fuse the appropriate coding sequence of IgG1 and CD4 as described above. These were synthesized as 48-mers comprising 24 nucleotides on each side of the desired fusion site (i.e., corresponding to the COOH-terminal 8 residues of the desired immunoglobulin moiety). Plasmid pRKCD4TP/ ⁇ 1 was transformed into E. coli strain SR101 and the transformed cultures plated on ampicillin media plates. Resistant colonies were selected and grown in the presence of ml3K07 helper bacteriophage to yield secreted, encapsidated single-stranded templates of pRKCD4TP/ ⁇ 1.
  • the single-stranded plasmid DNA was isolated and used as the template for mutagenesis reactions with the synthetic oligonucleotides described above as primers.
  • the mutagenesis reactions were transformed E. coli SR101 and the transformed culture plated on ampicillin media plates. Transformants were screened by colony hybridization (ref. Grunstein- Hogness) for the presence of the appropriate fusion site, using l ⁇ mers as probes. These l ⁇ mers comprise 8 bases on either side of the fusion site, and the hybridization conditions chosen were sufficiently stringent that the probes only detect the correctly fused product. Colonies identified as positive were selected and plasmid DNA was isolated and transformed into E. coli strain SR101. The transformed cultures were plated on ampicillin media plates, and resistant colonies were selected and grown in the presence of m13K07 bacteriophage. Templates were prepared as above and screened by sequencing.
  • the plasmids were transfected into 293 cells using standard procedures and assayed for expression and production as described above.
  • PRKCD4 4 ⁇ 1 + + Plasmids also were constructed to direct the expression of fusion proteins containing differing lengths of the ammo-terminal, extracellular domain of CD4 fused to the truncated portion of the constant region of human
  • immunoglobulin ⁇ 1 comprising only the hind region and constant domains CH 2 and CH 3 .
  • Synthetic oligonucleotides were made as primers for mutagenesis reactions to delete the immunoglobulin sequence from Ser114 to Cys215 inclusive (Kabat et al.). These were synthesized as 48-mers comprising 24 nucleotides on each side of the desired fusion site (i.e., corresponding to the COOH-terminal 8 residues of the desired CD4 moiety, and the NH 2 -terminal 8 residues of the desired immunoglobulin moiety). Plasmids pRKCD4 4 ⁇ 1 , pRKCD4 2 ⁇ and the transformed culture plated on ampicillin media plates.
  • Resistant colonies were selected and grown in the presence of m13K07 helper bacteriophage to yieldd secreted, encapsidated single-stranded templates of these plasmids.
  • the single- stranded plasmid DNA was isolated and used as the template for mutagenesis reactions with the synthetic oligonucleotides described above as primers.
  • the mutagenesis reactions were transformed E. coli SR101 and the transformed culture plated on ampicillin media plates.
  • Transformants were screened by colony hybridization (Grunstein-Hogness) for the presence of the appropriate fusion sites, using 16mers as probes. These 16mers comprise 8 bases on either side of the fusion site, and the hybridization conditions chosen were sufficiently stringent that the probes only detect the correctly fused product. Colonies identified as positive were selected and plasmid DNA was isolated and transformed into E. coli strain
  • Templates were prepared as above and screened by sequencing.
  • pRKCD4 rFc1 The plasmid derived from plasmid pRKCD4 4 ⁇ 1 is referred to as pRKCD4 rFc1 , that derived from plasmid pRKCD4 2 ⁇ 1 is referred to as
  • pRKCD4 2Fcl and that derived from plasmid pRKCD4 1 ⁇ 1 is referred to as pRKCD4 1Fc1 .
  • pRKCD4 2Fc1 , pRKCD4 1Fc1 and PRKCD4 4Fc1 are cultured in the same fashion as described above and CHI-deleted CD4 immunoadhesons recovered as described elsewhere herein.
  • Plasmids were constructed to direct the expression of proteins containing differing lengths of the amino terminal, extracellular domain of CD4 fused to the constant region of human immunoglobulin JC. These plasmids are referred to as pRKCD4 4 ⁇ , and pRKCD4 e4 ⁇ .
  • Plasmid pRKCD4 4 contains the portion of the CD4 gene from the initiation codon to the fusion site after the codon for serine residue 366 of the mature CD4 polypeptide, immediately followed by the sequence for the constant region of human immunoglobulin ⁇ , starting at the codon for threonine residue 109 of the mature human immunoglobulin ⁇ .
  • Plasmid pRKCD4 e4 ⁇ contains the portion of the CD4 gene from the initiation codon to the fusion site after the codon for lysine residue 360 of the mature CD4 polypeptide, immediately followed by the sequence for the constant region of human immunoglobulin JC, starting at the codon for threonine residue 109 of the mature human immunoglobulin JC. (Kabat et al.)
  • plasmids were constructed in a manner analogous to plasmids pRKCD4 4 ⁇ 1 and pRKCD4 e4 ⁇ 1 described above, with the following exception:
  • PCT/US88/034144 was obtained from a human spleen cDNA library (Clontech Laboratories, Inc.) using oligonucleotides based on the published sequence (Hieter,
  • Plasmids were or are constructed to direct the expression of the immunoadhesons described above in CHO cells. These are referred to as pSVeCD4 4 ⁇ SVDHFR, pSVeCD4 2 ⁇ 1 SVDHFR, pSVeCD4 1 ⁇ SVDHFR,
  • Fragment 31 was prepared as described above.
  • Fragment 32a was prepared by digesting plasmid pE348HBV.E400 D22 with BamHI, blunting with
  • pRKCD4 1 ⁇ 1 , pRKCD4 e4 ⁇ 1 , pRKCD4 e2 ⁇ 1 , pRKCD4 e1 ⁇ 1 , pRKCD4 4Fc1 , pRKCD4 2FC1 , pRKCD4 4 ⁇ and pRKCD4 2 ⁇ were separately digested with HindIII, blunted with Klenow fragment and the four dNTPs, then digested with EcoRI and the fragments encoding the CD4-Ig fusion protein were isolated. The resulting DNA fragments were ligated together with fragments 31 and 32a and transformed into E. coli strain 294. Colonies were selected and checked for the presence of the correct plasmid as above, then transferred into CHO cells and amplified by methotrexate selection using conventional procedures.
  • Plasmids encoding soluble CD4 immunoadhesons were calcium phosphate transfected into CHO-DP7 (a proinsulin-transformed autocrine host cell derived from CHO; U.S.S.N. 97,472) and the transformants grown in selective medium (1:1 HAM F12/DMEM GHT containing 1-10% diafiltered or dialyzed bovine serum).
  • CHO-DP7 a proinsulin-transformed autocrine host cell derived from CHO; U.S.S.N. 97,472
  • Other suitable host cells are CHO cells or 293S human embryonic kidney cells. The transformants were amplified by methotrexate.
  • the plasmid that was integrated in the genome of the transfectoma was generated by cutting out an EcoRI - SfiI fragment from the CD4 ⁇ 1 plasmid, filling the ends, and blunt end-ligating the fragment into the XbaI site of the pcDEB vector, which contains the hygromycin resistance gene.
  • CD4TP soluble CD4 variant consisting essentially of the first four domains (expressed in soluble form) known as CD4TP.
  • Culture fluid from CD4 transformants was concentrated and diafiltered to lower the ionic strength.
  • the concentrate was passed through a large volume of Q-Sepharose anion exchange resin (previously equilibrated with 25 mM NaCl, pH 8.5) in order to adsorb contaminants from the culture fluid.
  • the unadsorbed culture fluid from the anion exchange resin step was then passed through a cation exchange resin (previously equilibrated with 25 mM NaCl at pH 8.5) whereby the CD4 variant was adsorbed to the resin.
  • the protein was eluted with a NaCl gradient at pH 8.5.
  • Ammonium sulfate was added to the eluate to a concentration of 1.7M and the solution passed through a column of hydrophobic interaction chromatography resin (phenyl or butyl Sepharose). The protein was eluted from the hydrophobic interaction column with a gradient of ammonium sulfate.
  • the eluate was concentrated and buffer exchanged on a G-25 column using phosphate buffered saline containing .02% (w/v) Tween 20 or Tween 80.
  • Other polymeric nonionic surfactants are suitably used with the CD4 formulations, including Pluronic block copolymers or polyethylene glycol.
  • CD4 V1-V4 optionally are further purified by the procedure described above for unfused CD4 variants (i.e., the general procedure of this Example).
  • CD4 immunoglobulin fusions with CD4 V1-V2 also may be purified by the procedure above, except that it is not expected that the isoelectric point of this class of molecules will be as alkaline as that of species ⁇ ntajhing all four V regions of CD4.
  • FIG. 3a shows an autoradiograph of biosynthetically labeled intracellular proteins obtained from the hybridoma of this invention precipitated with antibody to mouse ⁇ 1 chain (lanes 2 and 3).
  • a 92 kd polypeptide representing CD4 ⁇ 1 is precipitated from the transfected (lane 3), but not from the untransfected cell line (lane 2).
  • Some of the CD4 ⁇ 1 is secreted (Figure 3b) in association with the ⁇ chain of M-T301, this dimer being linked to the heavy(H) X light(L) chain pair of M-T301.
  • the rather large CD4 ⁇ 1 is not sterically hindered from being linked to the ⁇ 1 chain, probably because of the flexibility of the hinge region, which allows the amino ends of the polypeptides to move apart.
  • the ⁇ chain is also not hindered from forming a disulfide bridge with the CD4 ⁇ 1 chain.
  • target cells were incubated with antibodies at one or more concentrations (or with no antibody), washed, and cells of the cytotoxic T cell line MX66 (effector cells) (obtained from H. Spits, DNAX, Palo Alto) were added at a ratio of 0.5:1 or
  • Targets were one of the following: HeLa cells expressing CD4 and infected with HIV- LAV I (HeLa LAV I); or not infected (HeLa); or allogeneic cell line HUT 78.
  • Antibodies were one of the following: anti-CD3 monoclonal antibody M-T301; bispecific antibodies (bispecs) with one arm specific for CD3 (derived from M- T301) and the other arm specific for gp120 (derived from CD4g1); a 1:1 mixture of M-T301 and CD4g1 (antibody mixture).
  • %lysis (cpm experimental release - cpm spontaneous release) : (cpm maximal release - cpm spontaneous release) ⁇ 100. Spontaneous release was always less than 15% of maximal release. Maximum release was determined after lysis with 1N HCl.
  • M-T301 antibody was purified from M-T301 hybridoma supernatant, and thus must have been free of such contamination.
  • Table 3 shows that bispecs are effective in killing HW-infected cells in vitro.
  • HeLa.T4 cells whether HIV-infected or not, were not killed by effector cells alone.
  • our bispecs at a concentration of 1.6 ⁇ g/ml, 26.8% of infected cells were killed at an effector:target ratio of 0.5:1, while the uninfected cells were not killed.
  • a mixture of equal parts of bivalent CD4 ⁇ 1, ⁇ tetramers and M-T301 antibodies did not cause killing (below 0.7%).
  • the bispec preparation contained an equal amount of monospecific bivalent CD4 ⁇ 1, ⁇ tetramers, which do not help the killing, but which, due to their superior avidity (two binding sites vs. one), may rather prevent bispecs from binding to the target cells. Further purification of the bispecs should yield preparations that are somewhat more efficient. To alleviate the necessity for a tedious purification, mutations in the ⁇ chains that allow only heterologous pairing, i.e. V H ⁇ 1 with CD4 ⁇ 1, can be selected.

Abstract

A method for directing a cytotoxic T cell to an HIV-I-infected cell, which comprises contacting the infected cell with a bispecific proteinaceous molecule comprising two binding domains, wherein the first binding domain comprises a CD4 domain or domains and the second binding domain comprises an anti-CD3 binding region.

Description

COMPOSITIONS THAT MEDIATE KILLING
OF HIV-INFECTED CELLS
INTRODUCTION
Technical Field
This application relates to pharmaceutical compositions useful in the treatment of human immunodeficiency virus (HIV) infections and particularly those useful for stimulating killing of HIV-infected cells by cytotoxic T
lymphocytes.
Background
The primary immunologic abnormality resulting from infection by HIV is the progressive depletion and functional impairment of T lymphocytes expressing the CD4 cell surface glycoprotein (H. Lane et al., Ann. Rev. Immunol. 3:477 [1985]). CD4 is a non-polymorphic glycoprotein with homology to the immunoglobulin gene superfamily (P. Maddon et al., Cell 42:93 [1985]).
Together with the CD8 surface antigen, CD4 defines two distinct subsets of mature peripheral T cells (E. Reinherz et al., Cell 19:821 [1980]), which are distinguished by their ability to interact with nominal antigen targets in the context of class I and class II major histocompatibility complex (MHC) antigens, respectively (S. Swain, Proc. Natl. Acad. Sci. 78:7101 [1981]; E. Engleman et al., J. Immunol. 127:2124 [1981]; H. Spitz et al., J. Immunol. 129:1563 [1982]; W. Biddison et al., J. Exp. Med. 156: 1065 [1982]; and D. Wilde et al., J.
Immunol. 131:2178 [1983]). For the most part, CD4 T cells display the helper/inducer T cell phenotype (E. Reinherz, supra), although CD4 T cells characterized as cytotoxic/suppressor T cells have also been identified (Y. Thomas et al., J. Exp. Med. 154:459 [1981]; S. Mauer et al., Proc. Natl. Acad. Sci. USA 79:4395 [1982]; and A. Krensky et al., Proc. Natl. Acad. Sci. USA 79:2365
[1982]). The loss of CD4 helper/inducer T cell function probably underlies the profound defects in cellular and humoral immunity leading to the opportunistic infections and malignancies characteristic of the acquired immunodeficiency syndrome (AIDS) (H. Lane supra).
Studies of HIV-I infection of fractionated CD4 and CD8 T cells from normal donors and AIDS patients have revealed that depletion of CD4 T cells results from the ability of HIV-I to selectively infect, replicate in, and ultimately destroy this T lymphocyte subset (D. Klatzmann et al., Science 225:59 [1984]). The possibility that CD4 itself is an essential component of the cellular receptor for HIV-I was first indicated by the observation that monoclonal antibodies directed against CD4 block HIV-I infection and syncytia induction (A.
Dalgleish et al., Nature [London] 312:767 [1984]; J. McDougal et al., Science 231:382 [1986]; and the finding that HIV-I tropism can be conferred upon ordinarily non-permissive human cells following the stable expression of CD4 cDNA (P. Maddon et al., Cell 47:333[1986]). Furthermore, the neurotropic properties of HIV-I, reflected by a high incidence of central nervous system dysfunction in HIV-I infected individuals (W. Snider et al., Ann. Neurol. 14:403 [1983]), and the ability to detect HIV-I in the brain tissue and cerebrospinal fluid of AIDS patients (G. Shaw et al., Science 227:177 [1985]; L. Epstein, AIDS Res. 1:447 [1985]; S. Koenig, Science 233:1089 [1986]; D. Ho et al., N. Engl. J. Med. 313: 1498 [1985]; J. Levy et al., Lancet II:586 [1985]), appears to have its explanation in the expression of CD4 in cells of neuronal, glial and
monocyte/macrophage origin (P. Maddon, Cell 47:444 [1986]; I. Funke et al., J. Exp. Med. 165:1230 [1986]; B. Tourvielle et al., Science 234:610 [1986]).
In addition to determining the susceptibility to HIV-I infection, the manifestation of cytopathic effects in the infected host cell appears to involve
CD4. Antibody against CD4 was found to inhibit the fusion of uninfected CD4 T cells with HIV-I infected cells in vitro: moreover, the giant multinucleated cells produced by this event die shortly after being formed resulting in the depletion of the population of CD4 cells (J. Lifson et al., Science 232:1123 [1986]).
Formation of syncytia also requires gp120 expression, and can be elicited by coculturing CD4-positive cell lines with cell lines expressing the HTV-I any. gene in the absence of other viral structural or regulatory proteins (J. Sodroski et al., Nature 322:470 [1986]; J. Lifson et al., Nature 323:725 [1986]). Thus, in mediating both the initial infection by HTB-I as well as eventual cell death, the interaction between gp120 and CD4 constitutes one of several critical entry points in the viral life cycle amenable to therapeutic intervention (H. Mitauya et al., Nature 325:773 [1987]).
The known sequence of the CD4 precursor predicts a hydrophobic signal peptide, an extracellular region of approximately 370 amino acids, a highly hydrophobic stretch with significant identity to the membrane-spanning domain of the class π MHC beta chain, and a highly charged intracellular sequence of 40 residues (P. Madden, Cell 42:93 [1985]). The extracellular domain of CD4 consists of four contiguous regions each having amino acid and structural similarity to the variable and joining (V-J) domains of immunoglobulin light chains as well as related regions in other members of the immunoglobulin gene superfamily. These structurally similar regions of CD4 are termed the V1, V2, V3 and V4 domains (denominated 1-4 in Figure 1).
Some work preliminary to the present invention was described in a publication from the laboratory of the present inventors, namely J. Berg et al., Proc. Natl. Acad. Sci. USA, 88:4723-4727. However, this publication describes only bispecific antibodies with complete Fc and CD4 domains and not other bispecific molecules. As noted in the publication, only clinical testing can determine whether such compounds that contain both CD4 and anti-CD3 regions along with other binding regions, such as those for the Fc receptor and MHC class II antigens, will be of clinical value.
Accordingly, it is an object of this invention to produce pharmaceutical compositions containing CD4 derivatives useful in the treatment of
AIDS and related conditions, in a manner essentially unaffected by the extreme degree of genetic variation observed among various HIV-I isolates and their respective env polypeptides (J. Coffin, Cell 46:1 [1986]). In particular, it is an objective to prepare compositions containing molecules for directing cytotoxic T cells to cells exhibiting HIV antigens, e.g. HIV gp120, on their surfaces so that the infected cells can be destroyed using molecules that are particularly designed for clinical use. SUMMARY OF THE INVENTION
The objects of this invention have been accomplished by providing pharmaceutical compositions containing a pharmaceutically acceptable carrier and an effective amount of a molecule that is bispecific and that can easily be produced by techniques of genetic engineering from readily available genetic sources. One specific binding region of the molecule, generally referred to herein as a binding domain, consists of a portion (or all) of a CD4 variable region that is capable of binding to HIV gp120 while the other binding region (binding domain) exhibits specific binding affinity for a cytotoxic T cell, typically via an anti-CD3 binding region of an antibody. The bispecific molecules used in compositions of the invention, referred to herein as "bispecs," are able to mediate the killing of cells infected with HIV virus of any strain by cytotoxic T cells of any specificity. It is no longer necessary to direct an antibody specifically to the HIV virus or to any particular class of T lymphocytes.
Several types of Bispecs are particularly preferred. These include single polypeptide chains with a CD4 region at one end and an anti-CD3 region at the other end, typically prepared by splicing CD4 variable region domains of a CD4 molecule onto anti-CD3 variable region domains of an anti-CD3 antibody, using techniques of genetic engineering. Alternatively, modified antibody molecules can be prepared, in which one arm of the antibody is derived from an anti-CD3 antibody and the other arm is derived from a CD4 molecule. These antibody molecules are preferably designed to be specifically useful in clinical situations by incorporating deletions of non-specific binding regions in, for example, the Fc region of the antibody chain, so that undesired binding, and thus indiscriminate cell killing, does not occur. Bispecs of the invention, as described in detail below, have been demonstrated to mediate killing of HIV infected cells in the presence of completely unrelated cytotoxic T lymphocytes.
BRIEF DFSCRIPTION OF THE DRAWINGS
Figure 1 is a schematic representation of the structure of a CD4 molecule and of a typical immunoglobulin chain exemplified by the γ1 antibody chain. CD4 and γ1 are shown in the first two lines of the Figure 1. The third line of Figure 1 shows the four immunoglobulin-like domains of CD4 as a separate soluble entity, as they can be prepared by techniques of recombinant engineering (soluble rCD4). The last two lines of Figure 1 show two fusion proteins formed by linking various CD4 domains to the constant region of the γ1 immunoglobulin chain. The first of these two representations, indicated by CD42γ1, consists of the first two domains of CD4 linked to the constant region of γ1. The last line of the Figure, identified as CD42γ1, shows a construct in which the first four domains of have been attached to the constant region of γ1.
Figure 2 is a schematic representation of a bispecific antibody. The left arm of the molecule consists of the fusion protein CD4γ1 linked to κ light chain by a disulfide bridge; the right arm consists of a γ1,κ pair. The left arm binds to HIV gp120 of any strain. The right arm of the bispecific antibody binds to CD3, a component of the T cell receptor, and, thereby, activates the cytotoxic T cell. CD4.1, CD4.2, CD4.3, and CD4.4 are immunoglobulin-like domains of CD4; CH1, CH2, and CH3 are constant region domains of γ1 chains; VH is the variable region of γ1 heavy chain; VL is the variable region of κ.
Figure 3 is a series of schematic representations of autoradiographs.
(a) Autoradiograph obtained after SDS-polyacrylamide gel electrophoresis of
[35S]methionine-labeled immunoglobulin chains produced by hybridoma M-T301 (lane 2) and the transfectoma (lane 3). Lane 1: molecular weight standards.
Cells were incubated for 20 min in RPMI containing [35S]methionine. Proteins were immunoprecipitated from lysed cells using goat antibody to mouse
immunoglobulin followed by S. aureus. The precipitate was reduced and analyzed on a 10% gel. The band at a mol. weight of circa 40,000 presumably represents a truncated immunoglobulin chain encoded by a silent allele; it is not secreted [see
(b)]. (b) Fluorograph obtained after SDS-polyacrylamide gel electrophoresis of [35S]methionine-labeled immunoglobulin from the supernatants of hybridoma M- T301 (lane 1) and the transfectoma (lane 2). Material in lanes 1 and 2 was reduced before being loaded onto the gel. Far left lane: molecular weight standards, (c) Non-reduced precipitates from M-T301 (Lane 3) and the transfectoma (lane 4). Positions 1, 2, and 3 indicate M-T301 immunoglobulin, bispecific antibody, and CD4γ1,κ tetramers, respectively, (d) Lane 4 of Figure 3(c) was cut out and rerun under reducing conditions, (e) Transfectoma supernatant purified over an anti-CD4 column, electrophoresed non-reduced or after reduction, (f) Non-reduced material electrophoresed as in Figure 3(e) rerun under reducing conditions. Positions 1 and 2 indicate bispecific antibody and CD4γ1,κ dimers, respectively. Staining in 2(e) and 2(f) was with Commassie blue.
DESCRIPTION OF SPECIFIC EMBODIMENTS
Although AIDS patients lose HIV-specific cytotoxic T cells, their remaining CD8-positive T lymphocytes maintain cytotoxic function. To exploit this fact, we have constructed bispecific molecules, usually a modified form of antibodies, that direct cytotoxic T lymphocytes of any specificity to cells that express gp120. These bispecific molecules ("bispecs") comprise an anti-T-cell- specific-antigen binding region and a CD4 region; e.g., one heavy/light chain pair from an antibody to a CD3 antigen linked to a heavy chain whose variable region has been replaced with sequences from CD4 plus a second light chain. CD3 is part of the antigen receptor on T cells and is responsible for signal transduction and is used throughout this specification as the exemplary (and preferred) cytotoxic-T-cell-specific antigen. In the presence of bispecific molecules of these specificities, T cells of irrelevant specificity effectively lyse HIV-infected cells, as shown by the examples below in which this cytotoxicity has been demonstrated.
It was previously known that human peripheral blood lymphocytes can kill HIV-infected cells in vitro in the presence of monoclonal anti-gp120 antibodies chemically cross-linked to monoclonal antibodies to CD3. We have improved upon this scheme in two ways. First, we have replaced the chemical linkage with a biochemical one. By transfection we produced a cell line expressing molecules of both specificities. This line secretes, among other products, the desired bispecific molecules. Second, we have replaced the anti-gp120 monoclonal antibody, which was strain-specific and, therefore, of limited therapeutic potential, by a CD4 derivative, such as a CD4γ1 chain; in this example the heavy antibody chain consists of the first four immunoglobulin-like domains of CD4 fused to the whole constant region of mouse γ1 chain. HIV cannot mutate out of the binding capability of CD4 without losing its ability to infect cells via their membrane CD4 molecule, so that this and other bispecs will be effective against any HIV strain.
The word "domain" is used in this specification in the same manner as it is used in biochemistry to describe regions of molecules, usually proteins, that interact with other molecules or have other properties restricted to one (or more) region of the total molecule. In its broadest sense, a domain is simply a region of a molecule that is associated with a particular physical or chemical property, such as binding to another molecule. This region is generally but not always comprised of a single continuous segment of the amino acid sequence that makes up the total protein. As used herein, a "domain" preferably refers to such a continuous segment. In the field of immunology, "domain" has come to have a more specialized meaning, namely one of the roughly spherical regions of an antibody chain that are linked to each other to form an immunoglobulin chain (or a similar region of another member of the immunoglobulin superfamily of molecules, such as CD4). The particular meaning of domain as used herein will be clear from the context, but generally domain is used in the broader sense defined above unless it is used to refer to one of the immunoglobulin (or immunoglobulin-like) regions of an antibody chain or CD4 molecule that is specifically referred to as a domain in the scientific literature. For exemplification of the meaning of domain as it is used in context of immunoglobulin and CD4 segments in the scientific literature, see the publications discussed in the
Background section of this specification.
In addition to bispecific antibodies, the invention can be practiced with other molecules that are bispecific in the same manner as the antibodies described above. For example, the immunoglobulin-like domains of a CD4 molecule can be linked to a molecule retaining its specificity for CD3 in any fashion, including using linkers (usually short polypeptide chains), to provide a bispec of the invention. A particularly preferred bispec is prepared as a fusion protein in which one end of the molecule is a CD4 domain or domains and the other end of the molecule is a binding region for CD3. Such molecules can readily be prepared as fused proteins by genetic engineering by linking coding regions together, such as the coding region for one or more domains of CD4 and the coding region for at least the binding region of one strand, preferably the heavy chain variable region, of an anti-CD3 antibody. Recent work has shown that single-stranded antibody chains retain specificity for their specific antigen
(discussed below in more detail). See, for example, the techniques described in Ward et al., Nature, 341:544 (1989). Expression of the resulting polynucleotide results in production of a fused protein containing two regions with the desired primary amino acid structures.
For example, a single-chain polypeptide of the invention can be prepared by linking together the coding regions for at least one CD4 variable region domain, for VH and VL, and for Cκ. The resuling single polypeptide will thus contain both VL and VH. This is readily achieved by inserting a polypeptide linker between VH and VL. Examples of molecules prepared in this manner are given below. A particularly preferred example, D-VH-VL-Cκ, has been shown to be effective by colleagues of the present inventors. In these molecules, VH and VL are linked via a short peptide linker in order to provide sufficient flexibility for the antibody binding site to form. However, the CD4 domain can be attached directly to the N terminus of the VH domain. In the molecule that has been expressed, the CD4 domain has its leader sequence for secretion from mammalian cells, but the leader sequences of the VH and VL are not present. In preferred embodiments, the Cκ region is retained in order to assist in folding and stability of the antibody part of the molecule, even if other deletions occur, as discussed in more detail below. Constructs that comprise entire antibody and CD4 domains (rather than parts of domains) are also preferred for ease of folding, expression, and genetic
manipulation.
Whether any particular construct retains its ability after folding to carry out the desired binding functions can readily be determined by simple binding experiments. For example, detectably labeled gp120 molecules can be used in a variety of well-known techniques to determine the ability of the CD4 portion of the molecule to bind gp120. Similarly, detectably labeled CD3 antigen can be used to determine whether the anti-CD3 portion of the molecule retains its binding ability. If desired for higher binding affinity or greater specificity, a genetic construct can be prepared that encodes two proteins, one being the fused
CD4/antibody chain (e.g., with an antibody heavy chain) and the other being the remaining anti-CD3 antibody chain (e.g., the light chain). Expression of the two proteins concurrently will result in assembly of the light and heavy chains to form one light/heavy chain pair (i.e., one arm of an antibody against CD3) with the CD4 domain being attached to one of the antibody chains.
When assembled in this fashion, it is preferred to have the antibody binding domain at the N terminus of the fused molecule and (in some embodiments) to include at least part of the constant region of the two antibody chains for ease of post-expression assembly. However, other embodiments eliminate all or part of one or more constant region domains, as discussed in more detail below, in order to eliminate undesired binding of the antibody Fc region to other cells and/or molecules. The CD4 region is normally attached in such constructs at the C terminus, although the alternative order can occur as well. Such genetic constructs are prepared in the same manner as is described in detail below for the production of bispecific antibodies of the invention except for the order and/or selection of the segments that are spliced together.
Another preferred embodiment uses the concept described by Ward et al., Nature, 341:544 (1989), in which single antibody chains are prepared that retain binding specificity, where the first or the first two domains of the heavy chain are linked by a peptide bridge to the first domain of or the complete light chain. The resulting single antibody chain can be readily fused to a CD4 domain or domains as described herein, using, in preferred embodiments, the same linking groups to attach the two antibody variable regions. The resulting single-chain protein, which is readily produced by genetic engineering and expression, has a structure such as D-VL-VH-Cκ, D-VH-VL-Cκ, D-VH-VL-Cλ, VH-VL-Cκ-D, VL-VH-Cκ-D, VH-VL-Cλ-D, and other similar combinations in which a portion (D) of CD4 that retains its binding affinity for gp120 is fused to variable (V; heavy and light chains) and constant (C) domains of an anti-CD3 antibody. Preferred fusions have a CD4 domain or domains at one terminus of the polypeptide chain and the antibody domains at the other terminus. Additional amino acids can be present in central portions of the polypeptide (i.e., between CD4 and antibody domains) without adversely affecting binding affinities.
Bispecs of the invention can readily be prepared using existing sources of genetic material encoding the indicated specific molecules. However, the invention also encompasses variations derived from the original material that has been modified by techniques of genetic and protein engineering to provide additional desirable properties in the resulting bispecs. Those bispecs that have the same amino acid sequence (in their relevant portions) as can be found in naturally occurring CD4 and anti-CD3 molecules are referred to herein as
"natural-sequence bispecs." This invention, however, is also concerned with amino acid sequence variants of natural-sequence bispecs. Amino acid sequence variants of bispecs are prepared with various objectives in mind, including increasing the affinity of the bispec for its binding partner, facilitating the stability, purification and preparation of the bispec, increasing its plasma half life, improving therapeutic efficacy as described above in the background, introducing additional functionalities and lessening the severity or occurrence of side effects during therapeutic use of the bispec. Amino acid sequence variants of bispecs fall into one or a combination of insertional, substitutional, and deletional variants, as will be discussed in detail below.
In a specific embodiment of a bispec of the invention, one or more
CD4 immunoglobulin-like domains, which may be homologous either to the constant or to the variable region domains, or any other fragment of CD4 (as long as the CD4 sequence retains its ability to bind gp120) is conjugated with an immunoglobulin constant region sequence. Immunoglobulins and certain variants thereof are known and many have been prepared in recombinant cell culture. For example, see U.S. Patent 4,745,055; EP 256,654; Faulkner et al., Nature 298:286 (1982); EP 120,694; EP 125,023; Morrison, J. Immun. 123:793 (1979); Kohler et al., P.N.A.S. USA 77:2197 (1980); Raso et al., Cancer Res. 41:2073 (1981); Morrison et al., Ann. Rev. Immunol. 2:239 91984); Morrison, Science 229:1202 (1985); Morrison et al., P.N.A.S. USA 81:6851 91984); EP 255,694; EP
266,663; and WO 88/03559. Reassorted immunoglobulin chains also are known. See for example U.S. Patent 4,444,878; WO 88/03565; and EP 68,763 and references cited therein. For production of single antibody chains that retain binding specificity, where the first or the first two domains of the heavy chain are linked by a peptide bridge to the first domain of or the complete light chain, see Ward et al., Nature, 341:544 (1989). All of these patents and other publications are herein incorporated by reference.
Ordinarily, the domains of CD4 that are homologous to immunoglobulins and extracellular in their native environment are fused C-terminally to the N-terminus of the constant region of immunoglobulins in place of the variable region(s) thereof, retaining at least functionally active hinge, CH2 and CH3 domains of the constant region of an immunoglobulin heavy chain. This ordinarily is accomplished by constructing the appropriate DNA sequence and expressing it in recombinant cell culture. Immunoglobulins and other polypeptides having enhanced plasma half life are fused to the extracellular or ligand binding domains of other CD4 variants in the same fashion.
The boundary domains for the CD4 V-like regions (V1-V4) are, respectively, about 100-109, about 175-184, about 289-298, and about 360-369 (based on the precursor CD4 amino acid sequence in which the initiating met is -25). For a full disclosure of the CD4 sequence, which is well known to those familiar with HIV infections and the CD4 molecule, see Figures 1 and 2 of PCT application US 88/03414 published under the International Publication No. WO
89/02922 on 6 April 1989. This PCT publication, which is herein incorporated by reference, describes the preparation of immunoglobulin chains containing various CD4 domains and the constant region of an antibody, but is not directed to combinations specifically involving anti-CD3 binding regions or to the targeting of cytotoxic T cells to HIV-infected cells.
CD4 sequences containing any of the CD4 domains involved in binding to gp120 are fused to the immunoglobulin sequence. It is preferable that V1V2 or V1V2V3V4 be fused at its C-terminus to the immunoglobulin constant region. The precise site at which the fusion is made is not critical; the boundary domains noted herein are for guidance only and other sites neighboring or within the V regions may be selected in order to optimize the secretion or binding characteristics of the CD4. The optimal site will be determined by routine experimentation. Unless the first constant region domain of the immunoglobulin heavy chain is deleted, or a light chain is provided, the fusions are generally expressed intracellularly, but a great deal of variation is encountered in the degree of secretion of the fusions from recombinant hosts. For instance, the following table (Table 1) shows various CD4 immunoglobulin fusions that were obtained in PCT/US88/03414. These immunoglobulin chains were referred as "immuno- adhesons," and this terminology is retained here to refer to single antibody chains consisting of one or more CD4 domains linked to the constant region of an immunoglobulin chain. In all of these examples of CD4 immunoadhesons, the CD4 signal was used to direct secretion from 293 cells. Lower case m represent murine origin, while the lower case a designates human origin. V and C are abbreviations for immunoglobulin variable and constant domains respectively. The numerical subscripts indicate the number of parenthetical units found in the designated multimer. It will be understood that the chains of the multimers are believed to be disulfide bonded in the same fashion as native immunoglobulins. The CD4 immunoadhesons typically contained either the first N-terminal 366 residues of CD4 (CD44) or the first 180 N-terminal residues of CD4 (CD42) linked at their C-terminus to the κ (light) chain or IgG1 heavy chain constant region (γ1).
Figure imgf000014_0001
Figure imgf000015_0001
It can be seen that the CD4/human-heavy-chain immunoadheson was secreted as a dimer whereas the analogous murine construction was not detected (this does not exclude the intracellular accumulation of the protein, however). These CD4-IgG immunoadheson chimeras are readily secreted wherein the CD4 epitope is present fused to one or more light or heavy chains, including heterotetramers wherein up to and including all four variable region analogues are derived from CD4. Where a separate light-heavy chain non-CD4 variable domain is also present, a heterofunctional antibody thus is provided. In the present invention, the heterofunctional antibody is a bispec when the separate heavy-light chain is obtained from an anti-CD3 antibody. Such antibodies are available commercially, as are hybridomas that contain genetic information encoding anti-CD3 antibodies. Additionally, production of new anti-CD3-producing cell lines can readily be accomplished by routine immunological techniques.
Various exemplary hetero- and chimeric bispecific antibodies produced in accordance with this invention (as well as single polypeptide chains used to prepare bispecs) are schematically diagrammed below. "D" means at least a portion of the extracellular domain of CD4 containing its ligand binding site; VL, VH, CL and CH represent light or heavy chain variable or constant domains of an immunoglobulin; n is an integer; and Y designates a covalent cross-linking moiety. (a) DCL;
(b) DCL-DCL;
(c) DCH-[CDH, DCL-DCH, DCL-VHCH, VLCL-DCH, or VLCL- VHCH];
(d) DCL-DCH-[DCH, DCL-DCH, DCL-VHCH, VLCL-DCH, or VLCL- VHCH];
(e) DCL-VHCH-[CDH, DCL-DCH, DCL-VHCH, VLCL-DCH, or VLCL- VHCH];
(f) VLCL-DCH-[CDH, DCL-DCH, DCL-VHCH, VLCL-DCH, OR VLCL- VHCH];
or
(g) [D-Y]n-[VLCL-VHCH]2..
The structures in this list of formulas show only key features; e.g., they do not show joining (J) or other domains of the immunoglobulins, nor are disulfide bonds shown. These are omitted in the interests of brevity. However, where such domains are required for binding activity they shall be construed as being present in the ordinary locations which they occupy in the CD4, bispec, or immunoglobulin molecules as the case may be. These examples are representative of divalent antibodies; more complex structures would result by employing immunoglobulin heavy chain sequences from other classes, e.g., IgM. The immunoglobulin VLVH antibody combining site, also designated as the companion immunoglobulin, preferably is capable of binding to a predetermined antigen. Suitable companion immunoglobulin combining sites and fusion partners are obtained from IgG-1, -2, -3, or -4 subtypes, IgA, IgE, IgD or IgM.
A preferred embodiment of a fused CD4/immunoglobulin chain for use in preparing a bispec of the invention is a fusion of an N-terminal portion of CD4, which contains the binding site for the gp120 envelope protein of HIV, to the C-terminal Fc portion of an antibody, containing the effector functions of immunoglobulin G1. There are two preferred embodiments of this sort with respect to the portion of the antibody chain that is used; in one, the entire heavy chain constant region is fused to a portion of CD4; in another, a sequence beginning in the hinge region just upstream of the papain cleavage site which defines IgG F chemically (residue 216, taking the first residue of heavy chain constant region to be 114 [Kabat et al., "Sequences of Proteins of Immunological Interest" 4th Ed., 1987], or analogous sites of other immunoglobulins) is fused to a portion of CD4. These embodiments are described in the examples.
More particularly, those variants in which one or more immunoglobulin-like domains of CD4 are substituted for the variable region of an immunoglobulin chain are useful in preparing bispecs of the invention. These chimeras are constructed in a fashion similar to chimeric antibodies in which a variable domain from an antibody of one species is substituted for the variable domain of another species. See, for example, EP 0 125 023; Munro, Nature 312:
(13 December 1984); Neuberger et al., Nature 312: (13 December 1984); Sharon et al., Nature 309: (24 May 1984); Morrison et al., Proc. Natl. Acad. Sci. USA 81:6851-6855 91984); Morrison et al., Science 229:1202-1207 (1985); and Boulianne et al., Nature 312:643-646 (13 December 1984). The DNA encoding the CD4 immunoglobulin-like domain(s) is cleaved by a restriction enzyme at or proximal to the 3' end of the DNA encoding the immunoglobulin-like domain(s) and at a point at or near the DNA encoding the N-terminal end of the mature CD4 polypeptide (where use of a different leader is contemplated) or at or proximal to the N-terminal coding region for CD4 (where the native CD4 signal is employed). This DNA fragment then is readily inserted into DNA encoding an
immunoglobulin light or heavy chain constant region and, if necessary, tailored by deletional mutagenesis. Preferably, this is a human immunoglobulin when the variant is intended for in vivo therapy for humans. DNA encoding
immunoglobulin light or heavy chain constant regions is known or readily available from cDNA libraries or is synthesized. See for example, Adams et al.,
Biochemistry 19:2711-2719 91980); Gough et al., Biochemistry 19:2702-2710 (1980); Dolby et al., P.N.A.S. USA 77:6027-6031 (1980); Rice et al., P.N.A.S. USA 79:7862-7865 (1982); Falkner et al., Nature 298:286-288 (1982); and Morrison et al., Ann. Rev. Immunol. 2:239-256 (1984). All publications cited in this paragraph are herein incorporated by reference.
DNA encoding the immunoglobulin or immunoadheson chimeric chain(s) is transfected into a host cell for expression. If the host cell is producing an immunoglobulin prior to transfection, then one need only transfect with the CD4 domains fused to light or to heavy chain to produce a heteroantibody. The aforementioned immunoglublins having one or more arms bearing the CD4 domain and one or more arms bearing companion variable regions specific for CD3 result in dual specificity for gp120 of any source and for a CD3 antigen. These are produced by the above-described recombinant methods or by in vitro procedures. In the latter case, for example, F(ab')2 fragments of the adheson fusion and an immunoglobulin are prepared, the F(ab')2 fragments converted to Fab' fragments by reduction under mild reducing conditions, and then reoxidized in each other's presence under acidic conditions in accord with methods known per se. See also
U.S. Patent 4,444,878, which is incorporated herein by reference.
Additionally, procedures are known for producing intact
heteroantibodies from immunoglobulins having different specificities. These procedures can be adopted for the in vitro production of bispecs by simply substituting the CD4-containing chains for one of the previously employed immunoglobulins.
In an alternative method for producing a heterofunctional antibody, host cells producing a CD4-immunoglobulin fusion, e.g., transfected myelomas, also are fused with B cells or hybridomas which secrete antibody having the desired companion specificity for CD3 antigen. Heterobifunctional antibody is recovered from the culture medium of such hybridomas, and thus can be produced somewhat more conveniently than by conventional in vitro resorting methods (EP 68,763).
As was previously mentioned, the present invention contemplates not only natural-sequence bispecs, but variants in which there have been single, multiple, or combinations of insertions, deletions, and/or substitutions of amino acids in the naturally derived sequences. Insertional amino acid sequence variants are those in which one or more amino acid residues extraneous to the bispec are introduced into a predetermined site in the bispec including the C or N terminus of any polypeptide chain. Such variants, particularly when the insertions are lengthy, are referred to as fusions of the bispec and a different polypeptide. Such fusions contain sequences other than those which are normally found in the bispec at the inserted position.
Another class of bispec variants comprises deletional variants.
Deletions are characterized by the removal of one or more amino acid residues from a given sequence. Typically, the transmembrane and cytoplasmic domains of
CD4 are deleted. When such deletions are desired in the case of CD4, at least residues 368 to 395 (the transmembrane region), and ordinarily 396-433 as well (the cytoplasmic domain), will be deleted.
Another preferred deletion is one which reduces or eliminates the ability of CD4 to bind to MHC class π antigens. The amino acid residues associated with binding are numbers 19, 89, and 165 of the CD4 molecule.
Mutations of these residues abrogate MHC binding. CD4 deletions affecting MHC class II antigen binding with a CD4 molecule is described in Fleury et al., Cell 66: 1037.
Other deletions can be used with the present invention as long as the binding specificity or other desired properties, such as effector functions, are retained. A preferred class of compounds encompasses bispecs derived from antibodies in which the binding region for Fc receptor is deleted or modified to reduce undesired binding. Such deletions can be of one or more entire domains of the Fc region or can a deletion or mutation of part of a domain or even a single amino acid. For example, a preferred mutation would be to change residue 235 of IgG from leu to glu, as demonstrated and described in Alegre et al., J. Immunol. 148:3461. When an entire domain is to be deleted, the CH2 domain, which is the domain that interacts the Fc receptor, should be deleted. Whether or not any given deletion results in a bispec with the desired binding properties can readily be tested using the procedures described in the following examples to determine whether the resulting molecule is capable of directing cytotoxic T cells to HIV-infected cells.
Substitutional variants are those in which at least one residue in a sequence has been removed and a different residue inserted in its place. For example, the native N-terminal residue for mature CD4 is now known to be lysine. Thus, the normal sequence shown in Figure 1 of PCT/US88/03414, with an N-terminal asparagine, is an amino acid sequence variant of native mature CD4. Table 2 below describes substitutions which in general will result in fine modulation of the characteristics of the CD4 antigen or anti-CD3 binding region.
Figure imgf000020_0001
Substantial changes in function or immunological identity are made by selecting substitutions that are less conservative than those in Table 2, i.e., selecting residues that differ more significantly in their effect on maintaining (a) the structure of the polypeptide backbone in the area of the substitution, for example as a sheet or helical conformation, (b) the charge or hydrophobicity of the molecule at the target site or (c) the bulk of the side chain. The substitutions which in general are expected to produce the greatest changes in adheson properties will be those in which (a) a hydrophilic residue, e.g., seryl or threonly, is substituted for (or by) a hydrophobic residue, e.g., leucyl, isoleucyl,
pheylalanyl, valyl or alanyl; (b) a cysteinyl or prolyl is substituted for (or by) any other residue; (c) a residue having an electropositive side chain, e.g., lysyl, arginyl, or histidyl, is substituted for (or by) an electronegative residue, e.g., glutamyl or aspartyl; or (d) a residue having a bulky side chain, e.g.,
phenylalanyl, is substituted for (or by) one not having a side chain, e.g., glycyl.
It will be amply apparent from the foregoing discussion that substitutions, deletions, insertions or any combination thereof are easily introduced to arrive at a final construct. These variants ordinarily are prepared by site specific mutagenesis of nucleotides in the DNA encoding the CD4 or anti-CD3 molecules, thereby producing DNA encoding the variant, and thereafter expressing the DNA in recombinant cell culture. However, variant bispecs also are prepared by in vitro synthesis. Obviously, variations made in the DNA encoding the variant bispecs must not place the sequence out of reading from and preferably will not create complementary regions that could produce secondary mRNA structure deleterious to expression (EP 75 444 A). The CD4-derived region or regions of the variants typically exhibit the same gp120 binding activity as does the naturally occurring prototype, although variants also are selected in order to modify the characteristics of the CD4 adheson as indicated above. For example, the regions of the CD4 molecule that are responsible for binding to class II major histocompatibility antigen (MHC) can be deleted in order to eliminate binding to undesired locations in vivo. Similar considerations exist for the anti-CD3 region or regions.
While the site for introducing an amino acid sequence variation is predetermined, the mutation per se need not be predetermined. For example, in order to optimize the performance of a mutation at a given site, random
mutagenesis may be conducted at the target codon or region and the expressed adheson variants screened for the optimal combination of desired activities.
Techniques for making substitution mutations are predetermined sites in DNA having a known sequence are well known, for example M13 primer mutagenesis.
The DNA encoding CD4 is obtained by known procedures. See Williams, Immunol. Today 8:298-303 (1987) and citations therein. In general, prokaryotes are used for cloning of CD4 variant DNA sequences. For example, E. coli strain SR101 (for propagating ml3 phage, a λ-resistant strain of JM 101; Messing et al., Nucl. Acids. Res. 9(2):309-321 [1981]); and E. coli K12 strain 294 (ATCC No. 31446) are particularly useful. Other microbial strains which may be used include E. coli B, UM101 and E. coli χ1776 (ATCC No. 31537). These examples are illustrative rather than limiting.
DNA encoding the various constructs used in preparing polypeptides of the invention is inserted for expression into vectors containing promoters and control sequences which are derived from species compatible with the intended host cell. The vector will ordinarily, but need not, carry a replication site as well as one or more marker sequences which are capable of providing phenotypic selection in transformed cells. For example, E. coli is typically transformed using a derivative of pBR322 which is a plasmid derived from an E. coli species
(Bolivar et al., Gene 2:95 [1977]). pBR322 contains genes for ampicillin and tetracycline resistance and thus provides easy means for identifying transformed cells. The pBR322 plasmid, or other microbial plasmid must also contain or be modified to contain promoters and other control elements commonly used in recombinant DNA constructions.
Promoters suitable for use with prokaryotic hosts illustratively include the β-lactamase and lactose promoter systems (Chang et al., Nature
275:615 [1978]; and Goeddel et al., Nature 281:544 [1979]), alkaline phosphatase, the tryptophan (trp) promoter systems (Goeddel, Nucleic Acids Res. 8:4057 [1980] and EPO Appln. Publ. No. 36,776) and hybrid promoters such as the tac promoter (H. de Boer et al., Proc. Natl. Acad. Sci. USA 80:21-25 [1983]). However, other functional bacterial promoters are suitable. Their nucleotide sequences are generally known, thereby enabling a skilled worker operably to ligate them to DNA encoding the adheson variant using linkers or adaptors to supply any required restriction sites (Siebenlist et al., Cell 20:269 [1980]). Promoters for use in bacterial systems also will contain a Shine-Dalgarno (S.D.) sequence operably linked to the DNA encoding the antigen.
In addition to prokaryotes, eukaryotic microbes such as yeast cultures also are useful as cloning or expression hosts. Saccharomyces cerevisiae. or common baker's yeast is the most commonly used eukaryotic microorganism, although a number of other strains are commonly available. For expression in Saccharomyces, the plasmid YRp7, for example, (Stinchcomb et al., Nature
282:39 [1979]; Kingsman et al., Gene 7:141 [1979]; Tschemper et al., Gene
10:157 [1980]) s commonly used. This plasmid already contains the trp1 gene which provides a selection marker for a mutant strain of yeast lacking the ability to grow in tryptophan, for example ATCC No. 44076 or PEP4-1 (Jones, Genetics
85:12 [1977]). The presence of the trp1 lesion as a characteristic of the yeast host cell genome then provides an effective means of selection by growth in the absence of tryptophan.
Suitable promoting sequences for use with yeast hosts include the promoters for 3-phosphoglycerate kinase (Hitzeman et al., J. Biol. Chem.
255:2073 [1980]) or other glycolytic enzymes (Hess et al., J. Adv. Enzyme Reg. 7:149 [1968]; and Holland, Biochemistry 17:4900 [1978]), such as enolase, glyceraldehyde-3-phosphate dehydrogenase, hexokinase, pyruvate decarboxylase, phosphofructokinase, glucose-6-phosphate isomerase, 3-phosphoglycerate mutase, pyruvate kinase, triosephosphate isomerase, phosphoglucose isomerase, and glucokinase.
Other yeast promoters, which are inducible promoters having the additional advantage of transcription controlled by growth conditions, are the promoter regions for alcohol dehydrogenase 2, isocytochrome C, acid
phosphatase, degradative enzymes associated with nitrogen metabolism,
metallothionein, glyceraldehyde-3-phosphate dehydrogenase, and enzymes responsible for maltose and galactose utilization. Suitable vectors and promoters for use in yeast expression are further described in R. Hitzeman et al. , European Patent Publication No. 73,657A. Yeast enhancers also are advantageously used with yeast promoters.
Promoters for controlling transcription from vectors in mammalian host cells may be obtained from various sources, for example, the genomes of viruses such as: polyoma, Simian Virus 40 (SV40), adenovirus, retroviruses, hepatitis-B virus and most preferably cytomegalovirus, or from heterologous mammalian promoters of the S V40 virus are conveniently obtained as an S V40 restriction fragment which also contains the SV40 viral origin of replication. Fiers et al., Nature 273:113 (1978). The immediate early promoter of the human cytomegalovirus is conveniently obtained as a HindIII E restriction fragment. Greenaway, P.J. et al., Gene 18:355-360 (1982). Of course, promoters from the host cell or related species also are useful herein.
DNA transcription in higher eukaryotes is increased by inserting an enhancer sequence into the vector. Enhancers are cis acting elements of DNA, usually from about 10 to 300bp, that act to increase the transcription initiation capability of a promoter. Enhancers are relatively orientation ad position independent having been found 5' (Laurrins, L. et al., Proc. Natl. Acid. Sci. 78:993 [1981]) and 3' (Lusky, MX., et al., Mol. Cell Bio. 3:1108 [1983]) to the transcription unit, within an intron (Banerji, J.L., et al., Cell 33:729 [1983]) as well as within the coding sequence itself (Osborne, T.F., et al. , Mol. Cell Bio. 4:1293 [1984]). Many enhancer sequences are now known from mammalian genes (globin, elastase, albumin, α-fetoprotein and insulin). Typically, however, one will use an enhancer from a eukaryotic cell virus. Examples include the SV40 enhancer on the late side of the replication origin (bp 100-270), the
cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers.
Expression vectors used in eukaryotic host cells (yeast, fungi, insect, plant, animal, human or nucleated cells) may also contain sequences necessary for the termination of transcription which may affect mRNA expression.
These regions are transcribed as polyadenylated segments in the untranslated portion of the mRNA encoding the adheson.
Expression vector systems generally will contain a selection gene, also termed a selectable marker. Examples of suitable selectable markers for mammalian cells are dihydrofolate reductase (DHFR), thymidine kinase or neomycin. When such selectable markers are successfully transferred into a mammalian host cell, the transformed mammalian host cell can survive if placed under selective pressure. There are two widely used distinct categories of selective regimes. The first category is based on a cell's metabolism and the use of a mutant cell line which lacks the ability to grow independent of a
supplemented medium. Two examples are: CHO DHFR cells and mouse LTK cells. These cells lack the ability to grow without the addition of such nutrients as thymidine or hypoxanthine. Because these cells lack certain genes necessary for a complete nucleotide synthesis pathway, they cannot survive unless the missing nucleotides are provided in a supplemented medium. An alternative to
supplementing the medium is to introduce an intact DHFR or TK gene into cells lacking the respective genes, thus altering their growth requirements. Individual cells which were not transformed with the DHFR or TK gene will not be capable of survival in non supplemented media.
The second category is dominant selection which refers to a selection scheme used in any cell type and does not require the use of a mutant cell line. These schemes typically use a drug to arrest growth of a host cell.
Those cells which have a novel gene would express a protein conveying drug resistance and would survive the selection. Examples of such dominant selection use the drugs neomycin, Southern P. and Berg, P., J. Molec. Appl. Genet. 1:327 (1982), mycophenolic acid, Mulligan, R.C. and Berg, P., Science 209:1422 (1980) or hygromycin, Sugden, B. et al., Mol. Cell, Bio. 5:410-413 (1985). The three examples given above employ bacterial genes under eukaryotic control to convey resistance to the appropriate drug G418 or neomycin (geneticin), xgpt (mycophenolic acid) or hygromycin, respectively.
"Amplification" refers to the increase or replication of an isolated region within a cell's chromosomal DNA. Amplification is achieved using a selection agent e.g, methotrexate (MTX) which inactivates DHFR. Amplications for the making of successive copies of the DHFR gene results in greater amounts of DHFR being produced in the face of greater amounts of MTX. Amplification pressure is applied notwithstanding the presence of endogenous DHFR, by adding ever greater amounts of MTX to the media. Amplification of desired gene can be achieved by cotransfecting a mammalian host cell with a plasmid having a DNA encoding a desired protein and the DHFR or amplification gene permitting cointegration. One ensures that the cell requires more DHFR, which requirement is met by replication of the selection gene, by selecting only for cells that can grow in the presence of ever-greater MTX concentration, so long as the gene encoding a desired heterologous protein has cointegrated with the selection gene replication of this gene give rise to replication of the gene encoding the desired protein. The result is that increased copies of the gene, i.e., an amplified gene, encoding the desired heterologous protein express more of the desired heterologous protein.
Preferred host cells for expressing the CD antigen variants of this invention are mammalian cell lines, examples including: monkey kidney CF1 line transformed by SV40 (COS-7, ATCC CRL 1651); human embryonic M ney line (293, Graham, F.L. et al., J. Gen. Virol. 16:59 [1977] and 2938 cells [293 subclones selected for better suspension growth]); baby hamster kidney cells (BHK, ATCC CCL 10); Chinese hamster ovary-cells-DHFR (CHO, Urlaub and Chasϊn, Proc. Natl. Acad. Sci. USA 17:4216, [1980]); mouse sertoli cells (TM4,
MM her, J.P., Biol. Reprod. 23:243-251 [1980]); monkey kidney cells (CF1 ATCC CCL 70); african green monkey kidney cells (VERO-76, ATCC CRL-1587);
human cervical carcinoma cells (HELA, ATCC CCL2); canine ki ney cells (MM K, ATCC CCL 34); buffalo rat liver cells (BRL 3A, ATCC CRL 1442); human lung cells (W138, ATCC CCL 75); human liver cells (Hep G2, HB 8065); mouse mammary tumor (MMT 060562, ATCC CCL51 cells); and TRI cells (Mather, J.P., et al., Annals N.Y. Acad. Sci. 383:44-68 [1982]).
"Transformation" means introducing DNA into an organism so that the DNA is replicable, either as an extrachromosomal element or by chromosomal integration. One suitable for transformation of the host cells is the method of
Graham, F. and van der Eb, A., Virology 52:456-457 (1973). However, other methods for introducing DNA into cells such as by nuclear injection or by protoplast fusion may also be used. If prokaryotic cells or cells which contain substantial cell walls are used as hosts, the preferred method of transfection is calcium treatment using calcium chloride as described by Cohen, F.N. et al.,
Proc. Natl. Acad. Sci. USA 69:2110 (1972).
Construction of suitable vectors containing the desired coding and control sequences employ standard and manipulative ligation techniques. Isolated plasmids or DNA fragments are cleaved, tailored, and relegated in the form desired to form the plasmids required. Suitable procedures are well known for the construction described herein. See, for example, (Maniatis, T. et al., Molecular Cloning, 133-134 Cold Spring Harbor, [1982]; "Current Protocols in Molecular Biology," edited by Ausubel et al., [1987], publ. by Greene Publishing Associates & Wiley-Interscience).
Correct plasmid sequences are confirmed by transforming E. coli K12 strains 294 (ATCC 31446) with ligation mixtures, successful transformants selected by ampicillin or tetracycline resistance where appropriate, plasmids from the transformants prepared, and then analyzed by restriction enzyme digestion and/or sequenced by the method of Messing et al., Nucleic Acids Res. 9:309 (1981) or by the method of Maxam et al., Methods in Enzymology 65:499 (1980).
Host cells are transformed with the expression vectors of this invention. Thereafter they are cultured in appropriate culture media, e.g., containing substances for inducing promoters, selecting transformants or amplifying genes. The culture conditions, such as temperature, pH and the like, are those previously used with the host cell selected for expression, and will be apparent to the ordinarily skilled artisan.
The secreted polypeptides (including bispecific antibodies) are recovered and purified from the culture supernatants or lysates of recombinant hosts. Typically, the supernatants are concentrated by ultrafiltration, contacted with a ligand affinity or immunoaffinity matrix so as to adsorb the adheson variant, and eluted from the matrix. Optionally, the bispec or adheson is purified by ion exchange chromatography.
The purified bispec is formulated into conventional
pharmacologically acceptable excipients. It is admimstered to patients having HIV infection at a dosage capable of maintaining a concentration of greater than about 100 ng of soluble bispec/ml plasma. For variants having different molecular weights, about 2 picomoles of soluble receptor per ml of plasma will be initially evaluated clinically in order to establish a stoichiometric equivalence with native (membrane bound) and soluble receptor. The ordinary initial dosage of a bispec is 100 μg/kg of patient weight/day. This initial dosage can be adjusted either upward or downward depending on the effects of the initial dosage.
A composition of the invention for use in vivo generally will contain a pharmaceutically acceptable carrier. By this is intended either solid or liquid material, which may inorganic or organic and of synthetic or natural origin, with which the active component of the composition is mixed or formulated to facilitate administration to a subject. Inert materials in pharmaceutical compositions are also called excipients. Any other materials customarily employed in formulating pharmaceutical are suitable. Solid carriers include natural and synthetic cloisonne silicates, for example natural silicates such as diatomaceous earths; magnesium silicates, for example, talcs; magnesium aluminum silicates, for example attapulgites and vermiculites; aluminum silicates, for example kaolinites, montinorillonites, and micas; calcium carbonates; calcium sulfate; synthetic hydrated silicone oxides and synthetic calcium or aluminum silicates; elements such as carbon or sulfur; natural and synthetic resin such as polyvinyl alcohol; and waxes such as parafan and beeswax. Examples of suitable liquid carriers include water and aqueous solutions containing oxygenated organic compounds such as ethanol.
The therapeutic bispec can be employed by itself or with other therapies and agents for the treatment of AIDS, including AZT, neutralizing antibodies, immunocytotoxins, and vaccines.
In order to facilitate understanding of the following examples, certain frequently occurring methods and/or terms will be described.
"Plasmids" are designated by a lower case p preceded and/or followed by capital letters and/or numbers. The starting plasmids herein are either commercially available, publicly available, publicly available on a restricted basis, or can be constructed from available plasmids in accord with published
procedures. In addition, equivalent plasmids to those described are known in the art and will be apparent to the ordinarily skilled artisan.
"Digestion" of DNA refers to catalytic cleavage of the DNA with a restriction enzyme that acts only at certain sequences in the DNA. The various restriction enzymes used herein are commercially available and their reaction conditions, cofactors and other requirements were used as would be known to the ordinarily skilled artisan. For analytical purposes, typically 1 μg of plasmid or DNA fragment is used with about 2 units of enzyme in about 20 μl of buffer solution. For the purpose of isolating DNA fragments for plasmid construction, typically 5 to 50 μg of DNA are digested with 20 to 250 units of enzyme in a larger volume. Appropriate buffers and substrate amounts for particular restriction enzymes are specified by the manufacturer. Incubation times of about 1 hour at 37°C are ordinarily used, but may vary in accordance with the supplier's instructions. After digestion the reaction is electrophoresed directly on a polyacrylamide gel to isolate the desired fragment.
"Recovery" or "isolation" of a given fragment of DNA form a restriction digest means separation of the digest on polyacrylamide or agarose gel by electrophoresis, identification of the fragment of interest by comparison of its mobility versus that of marker DNA fragments of known molecular weight, removal of the gel section containing the desired fragment, and separation of the gel from DNA. This procedure is known generally (Lawn, R. et al., Nucelic Acids Res. 9:6103-6114 [1981], and Goeddel, D. et al., Nucleic Acids Res.
8:4057 [1980]).
"Dephosphorylation" refers to the removal of the terminal 5' phosphates by treatment with bacterial alkaline phosphatase (BAP). This procedure prevents the two restriction cleaved ends of a DNA fragment from "circularizing" or forming a closed loop that would impede insertion of another DNA fragment at the restriction site. Procedures and reagents for
dephosphorylation and other recombinant manipulations are conventional.
Reactions using BAP are carried out in 50mM Tris at 68°C to suppress the activity of any exonuclease which may be present in the enzyme preparations. Reactions were run for 1 hours. Following the reaction the DNA fragment is gel purified.
"Ligation" refers to the process of forming phosphodiester bonds between two double stranded nucleic acid fragments (maniatis, T. et al., Id. at
146). Unless otherwise provided, ligation may be accomplished using known buffers and conditions with 10 units of T4 DNA ligase ("ligase") per 0.5 μg of approximately equimolar amounts of the DNA fragments to be ligated.
"Filling" or "blunting" refers to the procedures by which the single stranded end in the cohesive terminus of a restriction enzyme-cleaved nucleic acid is converted to a double strand. This eliminates the cohesive terminus and forms a blunt end. This process is a versatile tool for converting a restriction cut end that may be cohesive with the ends created by only one or a few other restriction enzymes into a terminus compatible with any blunt-cutting restriction endonuclease or other filled cohesive terminus. Typically, blunting is accomplished by incubating 2-15 μg of the target DNA in 10mM MgCl2, 1mM dithiothreitol, 50mM NaCl, 10mM Tris (pH 7.5) buffer at about 37°C in the presence of 8 units of the Klenow fragment of DNA polymerase I and 250 μM of each of the four deoxynucleoside triphosphates. The incubation generally is terminated after 30 min. phenol and chloroform extraction and ethanol precipitation.
The following examples merely illustrate the best mode now contemplated for practicing the invention, but should not be construed to limit the invention. Examples 1-4 are prior examples published in PCT/US88/03414 which show preparation of antibody/CD4 fusions that can be used to prepare bispecs of the invention, such as those described in Example 5. Example 1
Construction of Vectors for the Expression of Native CD4 and Secreted
Derivatives Section 1
The plasmid used for recombinant synthesis of human CD4 was pSVeCD4DHFR. The plasmid was constructed as follows:
XCD4P1 containing most of the coding sequence of human CD4 (obtained from a human placental cDNA library using oligonucleotide probes based on the published CD4 sequence [Maddon et al. 1985]) was digested with
EcoRI to produce cDNA insert. This fragment was recovered by polyacrylamide gel electrophoresis (Fragment 1).
pUC18 was digested with EcoRI and the single fragment recovered by polyacrylamide gel electrophoresis (Fragment 2). Fragment 1 was ligated to fragment 2 and the ligation mixture transformed into E. coli strain 294. The transformed culture was plated on ampicillin media plates and resistant colonies selected. Plasmid DNA was prepared from transformants and checked by restriction analysis for the presence of the correct DNA fragments. This plasmid is referred to as pUCD4.
pSVeE'DHFR (Muesing et al., Cell 48:691-701 [1987]) was digested with KpnI and BamHI and blunted with E. coli DNA polymerase I
(Klenow fragment) and the four dNTPs. Fragment 3 containing the pML-Ampr region, SV40 early promoter, the HIV LTR, and the mouse DHFR gene was recovered by gel electrophoresis, ligated and the ligation mixture transformed into E. coli strain 294. The transformed culture was plated on ampicillin media plates and resistant colonies selected. Plasmid DNA was prepared from transformants and checked by restriction analysis for the presence of the BamHI restriction site and the absence of the KpnI restriction site. This plasmid is referred to as pSVeΔBKDHFR and allows EcoRI-BamHI fragments to be inserted after the SV40 early promoter and transcribed under its control, following transfection into an appropriate cell line.
Synthetic oligonucleotides (adaptors 1-8, below) were made to extend from 76 bp 5' of the initiation codon of CD4 translation to the RaaI restriction site at 121 bp 3' of the initiator, with the sequence AATT at the 5' end of the sense strand t generate an end which could ligate to an EcoRI restriction fragment. These oligonucleotides were ligated and the 204 bp fragment containing the entire sequence recovered by gel electrophoresis (Fragment 4).
CD4 adaptor 1: AATTCAAGCCCAGAGCCCTGCCATTTCTGTGGGCTC
AGGTCCCT CD4 adaptor 2: pACTGCTCAGCCCCTTCCTCCCTCGGCAAGGCCACA
ATGAACCGGGGAGTC
CD4 adaptor 3: pCCTTTTAGGCACTTGCTTCTGGTGCTGCAACTGGCG
CTCCTCCCAGC CD4 adaptor 4: pAGCCACTCAGGGAAACAAAGTGGTGCTGGGCAAAA
AGGGGATACAGTGGAAGTGACCTGT CD4 adaptor 5: pACAGGTCAGTTCCACTGTATCCCCTTTTTTGCCCAG
CACCACTTTGTTTCC CD4 adaptor 6: pCTGAGTGGCTGCTGGGAGGAGCGCCAGTTGCAGCA
CCAGAAGCAAGT CD4 adaptor 7: pGCCTAAAAGGGACTCCCCGGTTCATTGTGGCCTTG
CGAGGGAGGAAGGG CD4 adaptor 8: GCTGAGCAGTAGGGACCTGAGCCCACAGAAATGGCAGG
GCTCTGGGCTTG
pUCCD4 was digested with RsaI and SstI and the 401 bp fragment containing part of the CD4 coding sequence recovered by gel electrophoresis (Fragment 5). pUC18 was digested with EcoRI and SstI and the fragment comprising the bulk of the plasmid recovered by gel electrophoresis (Fragment 6).
Fragments 4 and 5 were ligated to Fragment 6 and the ligation mixture
transformed into E. coli strain 294. The transformed culture was plated on ampicillin media plates and resistant colonies selected. Plasmid DNA was prepared from transformants and checked by restriction analysis for the presence of the correct fragment. The sequence of the inserted synthetic DNA was checked by excising the 605 bp EcoRI-SstI fragments from several transformants and ligating them to M13mp19 which had been digested with the same enzymes. After transformation into E. coli strain JM101, single-stranded DNA was prepared and sequenced. One plasmid which contained the correct sequence was selected, and is referred to as pCD4int.
pCD4int was digested with EcoRI and SstI and fragment 7 containing the 5' end of the CD4 coding region was recovered by gel
electrophoresis. pUCCD4 was digested with SstI and BamHI and the 1139 bp fragment containing the remainder of the CD4 coding region (fragment 8)
recovered by gel electrophoresis.
pSVeΔBKDHFR was digested with EcoRI and BamHI and fragment 9 comprising the bulk of the plasmid was isolated. Fragments 7, 8, and 9 were ligated and the ligation mixture transformed into E. coli strain 294. The
transformed culture was plated on ampicillin media plates and the resistant colonies selected. Plasmid DNA was prepared from transformants and checked by restriction analysis for the presence of the correct fragment. This plasmid is referred to as pSVeCD4DHFR, and was used to direct synthesis of recombinant intact CD4.
Example 2
Fusions of the V region of the CD4 gene, which is homologous to the variable region of immunoglobulin genes (ref. Maddon et al. 1985), to the constant (C) region of human immunoglobulin κ and γ2 chains are constructed as follows:
Synthetic DNA is made to code for the C region of human κ chain (residues 109-214) based on the sequence published by Morin et al., Proc. Natl.
Acad. Sci. 82:7025-7029, with the addition at the 5' end of the coding strand of the sequence GGGG, which allows this fragment to be ligated to the BspMI site at the end of the putative V-like region of CD4. At the 3' end of the coding region, a translatipnal stop codon is added as well as a sequence which allows this end to be ligated to BamHI restriction fragments. The synthetic DNA is made in 8 fragments, 4 for each strand, 70-90 bases long. These are then allowed to anneal and ligated prior to isolation on a polyacrylamide gel (fragment 33).
pRKCD4 is digested with EcoRI and BspMI and the 478bp fragment containing the region coding for the putative V-like domain of CD4 is recovered (fragment 34). Fragments 33 and 34 are ligated together with fragment 16 (from the expression vector pRK5). The ligation mixture is transformed into E. coli strain 294, the transformed culture plated on ampicillin media plates and resistant colonies selected. Plasmid DNA is prepared from transformants and checked by restriction analysis for the presence of the correct fragment. The resulting plasmid is referred to as pRKCD4Ck.
A plasmid encoding a fusion of the CD4 V-like domain to the human immunoglobulin Cγ2 region is constructed in a similar fashion, and is referred to as pRKCD4Cγ2. Both of these plasmids are transfected into 293 cells, myeloma cells or other competent cells in order to obtain cell lines expressing variant CD4 molecules as described above.
Example 3 Plasmids were constructed to direct the expression of proteins containing differing lengths of the ammo-terminal, extracellular domain of CD4 fused to the constant region of human immunoglobulin γ1. These plasmids are referred to as pRKCD42γ1, pRKCD4e4γ1, pRKCD42γ1, PRKCD41, and pRKCD4elγ1.
Plasmid pRKCD44γ1 contains the portion of the CD4 gene from the initiation codon to the fusion site after the codon for serine reside 366 of the mature CD4 polypeptide, immediately followed by the sequence coding for the constant region of human immunoglobulin γ1, starting at the codon for serine residue 114 of mature human immunoglobulin γ1 (Kabat et al.).
Plasmid pRKCD4e4γ1 contains the portion of the CD4 gene from the initiation codon to the fusion site after the codon for lysine residue 360 of the mature CD4 polypeptide, immediately followed by the sequence coding for the constant region of human immunoglobulin γ1, starting at the codon for serine residue 114 of mature human immunoglobulin γ1 (Kabat et al.).
Plasmid pRKCD42γ1 contains the portion of the CD4 gene from the initiation codon to the fusion site after the codon for glutamine residue 180 of the mature CD4 polypeptide, immediately followed by the sequence coding for the constant region of human immunoglobulin γ1, starting at the codon for serine residue 114 of mature human immunoglobulin γ1 (Kabat et al.).
Plasmid pRKCD4e2γ1 contains the portion of the CD4 gene from the initiation codon to the fusion site after the codon for leucine residue 117 of the mature CD4 polypeptide, immediately followed by the sequence coding for the constant region of human immunoglobulin γ1, starting at the codon for serine residue 114 of mature human immunoglobulin γ1 (Kabat et al.).
Plasmid pRKCD41γ1 contains the portion of the CD4 gene from the initiation codon to the fusion site after the codon for aspartic acid residue 105 of the mature CD4 polypeptide, immediately followed by the sequence coding for the constant region of human immunoglobulin γ1, starting at the codon for serine residue 114 of mature human immunoglobulin γ1 (Kabat et al.).
Plasmid pRKCD4e1γ1 contains the portion of the CD4 gene from the initiation codon to the fusion site after the codon for leucine residue 100 of the mature CD4 polypeptide, immediately followed by the sequence coding for the constant region of human immunoglobulin γ1, starting at the codon for serine residue 114 of mature human immunoglobulin γ1 (Kabat et al.).
Construction of these plasmids required the prior construction of plasmid pRKCD4TP/γ1. It was constructed as follows:
A cDNA clone coding for human immunoglobulin γ1 was obtained from a human spleen cDNA library (Clontech Laboratories, Ine.) using oligonucleotides based on the published sequence (Ellison et al., Nucl. Acids Res. 10:4071-4079 [1982]), and an EcoRI-EagI fragment (the EcpRI site was contributed by a linker; see Figure 4a and b of PCT/US88/03414) containing part of the variable and all of the constant region was obtained. This fragment was blunted with Klenow fragment, and recovered by gel electrophoresis (Fragment al).
Plasmid pRKCD4TP-kk, encoding a substitutional variant of soluble CD4 (residues 1-368) containing a lysine residue instead of asparagine at position
1 of the mature polypeptide, was constructed from plasmid pRKCD4TP by sitedirected mutagenesis. A synthetic oligonucleotide was made as a primer for a mutagenesis reaction to obtain the desired coding sequence. This was synthesized as a 51-mer which contained two silent mutations from the natural sequence in addition to the substitution mutation, and 21 bases on each side of the mutated codons:
5' - CCC TTT TTT GCC CAG GAC CAC CTT CTT GCC CTG¬
AGT GGC TGC TGG GAG GAG -3'
Plasmid pRKCD4TP was transformed into E. coli strain SR101 and the transformed colonies plated on ampicillin media plates. Resistant colonies were selected and grown in the presence of m13K07 helper bacteriophage to yield secreted, encapsidated single-stranded templates of pRKCD4TP. The single-stranded plasmid DNA was isolated and used as the template for mutagenesis reactions with the synthetic oligonucleotides described above as primers. The mutagenesis reaction was transformed E. coli SR101 and the transformed culture plated on ampicillin media plates. Transformants were screened by colony hybridization (ref . Grunstein-Hogness) for the presence of the appropriate sequence, using the following 16 mer as the probe.
5' - C CAC CTT CTT GCC CTG -3'
The hybridization conditions chosen were sufficiently stringent that the probe only detects the correctly fused product. Colonies identified as positive were selected and plasmid DNA was isolated and transformed into E. coli strain SR101. The transformed cultures were plated on ampicillin media plates, and resistant colonies were selected and grown in the presence of m13K07 bacteriophage. Templates were prepared as above and screened by sequencing.
Plasmid pRKCD4TP-kk was digested with Xbal and treated with
Klenow Enzyme, and Fragment a2, containing the linearized plasmid was recovered by gel electrophoresis, and ligated with fragment al. The ligation mixture as transformed into E. coli strain 294, the transformed culture plated on ampicillin media plates and resistant colonies selected. Plasmid DNA was prepared from the transformants and checked by restriction analysis for the presence of the correct fragment in the correct orientation (i.e., the
immunoglobulin coding region in the same orientation as the CD4 coding region, and at the 3' end of the CD4 coding region). This plasmid is referred to as pRKCD4TP/γ1.
Synthetic oligonucleotides were made as primers for deletional mutagenesis reactions to fuse the appropriate coding sequence of IgG1 and CD4 as described above. These were synthesized as 48-mers comprising 24 nucleotides on each side of the desired fusion site (i.e., corresponding to the COOH-terminal 8 residues of the desired immunoglobulin moiety). Plasmid pRKCD4TP/γ1 was transformed into E. coli strain SR101 and the transformed cultures plated on ampicillin media plates. Resistant colonies were selected and grown in the presence of ml3K07 helper bacteriophage to yield secreted, encapsidated single-stranded templates of pRKCD4TP/γ1. The single-stranded plasmid DNA was isolated and used as the template for mutagenesis reactions with the synthetic oligonucleotides described above as primers. The mutagenesis reactions were transformed E. coli SR101 and the transformed culture plated on ampicillin media plates. Transformants were screened by colony hybridization (ref. Grunstein- Hogness) for the presence of the appropriate fusion site, using lόmers as probes. These lόmers comprise 8 bases on either side of the fusion site, and the hybridization conditions chosen were sufficiently stringent that the probes only detect the correctly fused product. Colonies identified as positive were selected and plasmid DNA was isolated and transformed into E. coli strain SR101. The transformed cultures were plated on ampicillin media plates, and resistant colonies were selected and grown in the presence of m13K07 bacteriophage. Templates were prepared as above and screened by sequencing.
The plasmids were transfected into 293 cells using standard procedures and assayed for expression and production as described above.
Expressed Secreted pRKCD41γ1 + - pRKCD4e2γ1 + +
pRKCD42γ1 + +
pRKCD4e4γ1 + +
PRKCD44γ1 + + Plasmids also were constructed to direct the expression of fusion proteins containing differing lengths of the ammo-terminal, extracellular domain of CD4 fused to the truncated portion of the constant region of human
immunoglobulin γ1, comprising only the hind region and constant domains CH2 and CH3.
Synthetic oligonucleotides were made as primers for mutagenesis reactions to delete the immunoglobulin sequence from Ser114 to Cys215 inclusive (Kabat et al.). These were synthesized as 48-mers comprising 24 nucleotides on each side of the desired fusion site (i.e., corresponding to the COOH-terminal 8 residues of the desired CD4 moiety, and the NH2-terminal 8 residues of the desired immunoglobulin moiety). Plasmids pRKCD44γ1, pRKCD42 γ and the transformed culture plated on ampicillin media plates. Resistant colonies were selected and grown in the presence of m13K07 helper bacteriophage to yieldd secreted, encapsidated single-stranded templates of these plasmids. The single- stranded plasmid DNA was isolated and used as the template for mutagenesis reactions with the synthetic oligonucleotides described above as primers. The mutagenesis reactions were transformed E. coli SR101 and the transformed culture plated on ampicillin media plates. Transformants were screened by colony hybridization (Grunstein-Hogness) for the presence of the appropriate fusion sites, using 16mers as probes. These 16mers comprise 8 bases on either side of the fusion site, and the hybridization conditions chosen were sufficiently stringent that the probes only detect the correctly fused product. Colonies identified as positive were selected and plasmid DNA was isolated and transformed into E. coli strain
SR101. The transformed cultures were plated on ampicillin media plates, and resistant colonies were selected and grown in the presence of m13K07
bacteriophage. Templates were prepared as above and screened by sequencing.
The plasmid derived from plasmid pRKCD44γ1 is referred to as pRKCD4rFc1, that derived from plasmid pRKCD42γ1 is referred to as
pRKCD42Fcl and that derived from plasmid pRKCD41γ1 is referred to as pRKCD41Fc1.
pRKCD42Fc1, pRKCD41Fc1 and PRKCD44Fc1 are cultured in the same fashion as described above and CHI-deleted CD4 immunoadhesons recovered as described elsewhere herein.
Light Chain Fusions
Plasmids were constructed to direct the expression of proteins containing differing lengths of the amino terminal, extracellular domain of CD4 fused to the constant region of human immunoglobulin JC. These plasmids are referred to as pRKCD4, and pRKCD4e4κ.
Plasmid pRKCD44 contains the portion of the CD4 gene from the initiation codon to the fusion site after the codon for serine residue 366 of the mature CD4 polypeptide, immediately followed by the sequence for the constant region of human immunoglobulin κ, starting at the codon for threonine residue 109 of the mature human immunoglobulin κ. (Kabat et al.) Plasmid pRKCD4e4κ contains the portion of the CD4 gene from the initiation codon to the fusion site after the codon for lysine residue 360 of the mature CD4 polypeptide, immediately followed by the sequence for the constant region of human immunoglobulin JC, starting at the codon for threonine residue 109 of the mature human immunoglobulin JC. (Kabat et al.)
These plasmids were constructed in a manner analogous to plasmids pRKCD44 γ1 and pRKCD4e4γ1 described above, with the following exception:
The human immunoglobulin κ coding sequence (Figure 5 of
PCT/US88/03414) was obtained from a human spleen cDNA library (Clontech Laboratories, Inc.) using oligonucleotides based on the published sequence (Hieter,
P. A. et al., Cell 22:197-207 [1980]), and an EcoRI-BspMI fragment containing part of the variable region and the entire constant region was obtained (see Figure 5 of PCT/US88/03414). This fragment was blunted with Klenow fragment and the four dNTPs. This fragment was used instead of fragment al, and was used to construct plasmid pRKCD4TP/hjc.
Expression in CHO Cells
Plasmids were or are constructed to direct the expression of the immunoadhesons described above in CHO cells. These are referred to as pSVeCD4SVDHFR, pSVeCD42γ1SVDHFR, pSVeCD4SVDHFR,
pSVeCD434γ1SVDHFR, pSVeCD4e2γ1SVDHFR, pSV3CD4e1γ1SVDHFR, pSVeCD44Fc1SVDHFR, pSVeCD42Fc1SVDHFR, pSVeCD41Fc1SFCHFR, pSVeCD4SVDHFR and pSV3CD4SVDHFR.
Fragment 31 was prepared as described above. Fragment 32a was prepared by digesting plasmid pE348HBV.E400 D22 with BamHI, blunting with
Klenow fragment and the four dNTPs, then digesting with PyuI and isolating the large fragment containing the balance of the β-lactamase gene and the SV40 early promoter and the DHFR gene. Plasmids pRKCD44γ1, pRKCD42 γ1,
pRKCD41γ1, pRKCD4e4γ1, pRKCD4e2γ1, pRKCD4e1γ1, pRKCD44Fc1, pRKCD42FC1, pRKCD4 and pRKCD4 were separately digested with HindIII, blunted with Klenow fragment and the four dNTPs, then digested with EcoRI and the fragments encoding the CD4-Ig fusion protein were isolated. The resulting DNA fragments were ligated together with fragments 31 and 32a and transformed into E. coli strain 294. Colonies were selected and checked for the presence of the correct plasmid as above, then transferred into CHO cells and amplified by methotrexate selection using conventional procedures.
Example 4
Culture, Purification and formulation of CD4 variants
Plasmids encoding soluble CD4 immunoadhesons were calcium phosphate transfected into CHO-DP7 (a proinsulin-transformed autocrine host cell derived from CHO; U.S.S.N. 97,472) and the transformants grown in selective medium (1:1 HAM F12/DMEM GHT containing 1-10% diafiltered or dialyzed bovine serum). Other suitable host cells are CHO cells or 293S human embryonic kidney cells. The transformants were amplified by methotrexate. The plasmid that was integrated in the genome of the transfectoma was generated by cutting out an EcoRI - SfiI fragment from the CD4γ1 plasmid, filling the ends, and blunt end-ligating the fragment into the XbaI site of the pcDEB vector, which contains the hygromycin resistance gene.
The general procedure for purifying a variety of CD4 proteins was as follows. Specific parameter values (e.g., pH) in this paragraph are for a soluble CD4 variant consisting essentially of the first four domains (expressed in soluble form) known as CD4TP. Culture fluid from CD4 transformants was concentrated and diafiltered to lower the ionic strength. The concentrate was passed through a large volume of Q-Sepharose anion exchange resin (previously equilibrated with 25 mM NaCl, pH 8.5) in order to adsorb contaminants from the culture fluid. The unadsorbed culture fluid from the anion exchange resin step was then passed through a cation exchange resin (previously equilibrated with 25 mM NaCl at pH 8.5) whereby the CD4 variant was adsorbed to the resin. The protein was eluted with a NaCl gradient at pH 8.5. Ammonium sulfate was added to the eluate to a concentration of 1.7M and the solution passed through a column of hydrophobic interaction chromatography resin (phenyl or butyl Sepharose). The protein was eluted from the hydrophobic interaction column with a gradient of ammonium sulfate. The eluate was concentrated and buffer exchanged on a G-25 column using phosphate buffered saline containing .02% (w/v) Tween 20 or Tween 80. Other polymeric nonionic surfactants are suitably used with the CD4 formulations, including Pluronic block copolymers or polyethylene glycol.
It is also possible to employ immunoaffinity purification of soluble CD4 variants wherein the CD4 is adsorbed onto an immobilized antibody against CD4. This method suffers from the disadvantage that elution of the soluble CD4 under acidic conditions leads to protein aggregation that is only thoroughly ameliorated at relatively higher levels of surfactant. The foregoing procedure permits the use of much lower quantities of surfactant, about from 0.01 to 0.10% (w/v) surfactant.
The procedure followed for the purification of CD4 fusions with immunoglobulin heavy chain was to concentrate recombinant supernatants by ultrafiltration and thereafter adsorb the fusion onto resin-immobilized
Staphylococcal protein A. The fusion was eluted with 0.1M citrate buffer pH 3 with no salt or detergent. This preparation is buffered into Tris buffer at pH 7.5. The immunoglobulin fusions with CD4 V1-V4 optionally are further purified by the procedure described above for unfused CD4 variants (i.e., the general procedure of this Example). CD4 immunoglobulin fusions with CD4 V1-V2 also may be purified by the procedure above, except that it is not expected that the isoelectric point of this class of molecules will be as alkaline as that of species ∞ntajhing all four V regions of CD4.
Example 5
We cloned the gene encoding the fusion polypeptide CD4γ1 (CD4 V1-V4 fused to γ1) described above into a vector that allows expression in mouse cells and transfected it into hybridoma M-T301, which secretes a γ1,κ anti-human CD3 antibody. This antibody can activate T cells when added in polymerized form. This particular hybridoma and anti-human CD3 antibody were selected for convenience only. The same transfection process can be carried out with other hybridomas that produce anti-CD3 antibodies in order to produce bispecific antibodies of the invention.
The bispecific antibody produced in this example is shown schematically in Figure 2. Figure 3a shows an autoradiograph of biosynthetically labeled intracellular proteins obtained from the hybridoma of this invention precipitated with antibody to mouse γ1 chain (lanes 2 and 3). A 92 kd polypeptide representing CD4γ1 is precipitated from the transfected (lane 3), but not from the untransfected cell line (lane 2). Some of the CD4γ1 is secreted (Figure 3b) in association with the κ chain of M-T301, this dimer being linked to the heavy(H) X light(L) chain pair of M-T301. In addition, there are other combinations of the three polypeptide chains present in the transfectoma; this can be deduced from the molecular weights of the unreduced molecules (Figure 3c, lane 4). Furthermore, we have rerun lane 4 of Figure 3c under reducing conditions, confirming that some of the molecules contain CD4γ1, H and L chain (Figure 3d).
From the supernatant of the transfectoma, we then purified bispecs by binding them to and later eluting them from an affinity column consisting of monoclonal antibody to CD4, which separated them from bivalent anti-CD3 antibodies, which passed through the column. Electrophoresis of this material on a polyacrylamide gel revealed equal proportions of two kinds of molecules: a bivalent monospecific tetramer consisting of CD4γ1 and κ, and the desired bispec with the composition κ, CD4γ1, γ, κ (Figure 3e). Thus the CD4γ1 chain is linked to κ and pairs with the H x L chain half of IgG1 molecule of M-T301 (Figure 3f). The rather large CD4γ1 is not sterically hindered from being linked to the γ1 chain, probably because of the flexibility of the hinge region, which allows the amino ends of the polypeptides to move apart. The κ chain is also not hindered from forming a disulfide bridge with the CD4γ1 chain.
The ability of the bispecs to mediate killing of HIV-infected cells by nonspecific cytotoxic T cells was tested with a chromium release assay that we developed. As target cells, we used CD4-expressing HeLa cells, which we had infected with HIV. The percentage of infected cells was assessed by
immunofluorescence using a monoclonal antibody to viral p24 in the cytoplasm and the monospecific CD4g1, κ antibody for testing expression of membrane gp120. From the bulk culture we subcloned lines in which greater than 90% of the cells stably expressed these proteins. As effector cells we used clones of the human cytotoxic T cell line MX66, which is specific for influenza virus matrix protein when presented on human cells expressing the histocompatibility antigen
A2. At an effector:target ratio of 1:1 the MX66 cells did not show significant killing of the CD3-positive HUT 78 cell line; however, when M-T301 antibody, which is specific to CD3, was added, good killing was seen. (Table 3). This confirms that M-T301 antibody is able to mediate the killing of non-cognate target cells, by activating the MX66 cells and linking them to these targets.
Thus, this is a suitable system for testing the bispecs.
In the experimental work that provided the data set out in Table 3, target cells were incubated with antibodies at one or more concentrations (or with no antibody), washed, and cells of the cytotoxic T cell line MX66 (effector cells) (obtained from H. Spits, DNAX, Palo Alto) were added at a ratio of 0.5:1 or
1:1, or as a control, medium with no effector cells was added (no E). Targets were one of the following: HeLa cells expressing CD4 and infected with HIV- LAV I (HeLa LAV I); or not infected (HeLa); or allogeneic cell line HUT 78. Antibodies were one of the following: anti-CD3 monoclonal antibody M-T301; bispecific antibodies (bispecs) with one arm specific for CD3 (derived from M- T301) and the other arm specific for gp120 (derived from CD4g1); a 1:1 mixture of M-T301 and CD4g1 (antibody mixture). The values in the body of the table are the percentages of cells killed (resulting 51Cr release) as calculated from the formula: %lysis = (cpm experimental release - cpm spontaneous release) : (cpm maximal release - cpm spontaneous release) × 100. Spontaneous release was always less than 15% of maximal release. Maximum release was determined after lysis with 1N HCl.
In Experiment II the background killing, i.e., chromium release in the presence of effector cells but in the absence of antibodies, is higher than in Experiment I. This commonly observed non-specific killing by T cell clones is thought to depend on culture conditions. Furthermore, in Exp. II the mixture of monospecific antibodies also resulted in some killing of the infected, but not the uninfected, cells. In Exp. II the M-T301 antibody was purified from
transfectoma supernatant and presumably contained small amounts of bispecs. In Exp. I, the M-T301 antibody was purified from M-T301 hybridoma supernatant, and thus must have been free of such contamination.
In summary, Table 3 shows that bispecs are effective in killing HW-infected cells in vitro. In Experiment I HeLa.T4 cells, whether HIV-infected or not, were not killed by effector cells alone. However, when we added our bispecs at a concentration of 1.6 μg/ml, 26.8% of infected cells were killed at an effector:target ratio of 0.5:1, while the uninfected cells were not killed. At an effector:target ratio of 1:1, 40% of the infected, but only 2% of uninfected cells were killed. A mixture of equal parts of bivalent CD4γ1, κ tetramers and M-T301 antibodies did not cause killing (below 0.7%). The effect of the bispecs diminished at a lower concentration and was absent at 16 ng/ml. However, in Experiment II this concentration was still effective (in another experiment not shown, 1.6 ng/ml showed some effect). As mentioned above, the bispec preparation contained an equal amount of monospecific bivalent CD4γ1, κ tetramers, which do not help the killing, but which, due to their superior avidity (two binding sites vs. one), may rather prevent bispecs from binding to the target cells. Further purification of the bispecs should yield preparations that are somewhat more efficient. To alleviate the necessity for a tedious purification, mutations in the γ chains that allow only heterologous pairing, i.e. VHγ1 with CD4γ1, can be selected.
All publications and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference.
The invention now being fully described, it will be apparent to one of ordinary skill in the art that many changes and modifications can be made thereto without departing from the spirit or scope of the appended claims.
Table 3 ( page 1 )
% specific 51Cr release from target cells
HUT 78 HeLa.LAV I HeLa
Antibody conc, Effector:Target Effector:Target Effector:Target
μg/ml 0.5: 1 1: 1 0.5:1 1:1 no E 0.5: 1 1 :1 no E no antibody ╌ 0 0,4±0.2 0 0.7±1,2 ╌ 1.6±1.7 1.7±0.8 ╌
M-T301 ~2 34.2±2.3 48.3±1 ,9 ╌ ╌ ╌ ╌ ╌ ╌ bispec 1.6 ╌ ╌ 26.8±3.0 40.3±3.3 0 0.3±0.6 2.2±0.4 0
0.16 ╌ ╌ 9.8±1.7 14.6±2.1 0.9±1.2 0.8±0.8 0.5±0.6 0
0.016 ╌ ╌ 0,9±1.6 3.2±1.5 0 0.4±0.1 1.7±1.8 0
0.0016 ╌ ╌ 2.3±0.9 0.9±1.2 0 0 0 0
0.00016 ╌ ╌ 0.9±0.6 2.0±2.2 0 0.2±0.3 0.9±1.4 0 antibody 1.6 ╌ ╌ 0 0 0 0.2±0.9 0.7±0.8 0 mixture
0.16 ╌ ╌ 0 0.2±1.8 0 0 0.3±0.9 0
Table 3 ( page 2)
% specific 51Cr release from target cells
HUT 78 HeLa LAV 1 HeLa
Antibody conc. Effector:Target Effector:Target Effector:Target
μg/ml 0.5: 1 1:1 0.5: 1 1 : 1 no E 0.5: 1 1: 1 no E no antibody ╌ 0.3±0.8 1.5±0.5 3.5±1.6 8.2±1.9 ╌ 0 0 ╌
M-T301 ~2 53.3±1.2 64.6±4.0 ╌ ╌ ╌ ╌ ╌ ╌ bispec 1.6 ╌ ╌ 49.0±5.4 67.2±3.2 0.8±0.7 4.3±1.9 6.0±1.5 0
0.16 ╌ ╌ 31.6±3.5 44.6±2.8 1.0±0.8 0 1.1±2.1 0
0.016 ╌ ╌ 10.7±0.4 16.0±2.5 0.4±1.3 0 0.8±2.0 0
0.0016 ╌ ╌ 3.1±2.0 5.7±0.2 0 0 2.7±1.3 0
0.00016 ╌ ╌ 1.9± 1.7 7.0±1.0 0 0 0 0 antibody 1.6 ╌ ╌ 1 1.1±0.5 17.5±1.2 0 0 0 0 mixture
0.16 ╌ ╌ 6.6±0.5 1 1.3±1.1 0.1±0.7 0 0 0

Claims

WHAT IS CLAIMED IS
1. A method for directing a cytotoxic T cell to an HIV-infected cell, which comprises:
contacting said infected cell with a bispecific proteinaceous molecule comprising two binding domains, wherein said first binding domain comprises a CD4 region that binds to HTV gp120 and said second binding domain comprises an anti-CD3 binding region, wherein said molecule is other than a molecule consisting essentially of a CD4 variable region domain or domains that bind to both HTV gp120 and class II MHC antigen fused to a complete antibody constant region as one half of a bispecific antibody in which the second half of said bispecific antibody is a complete light/heavy antibody chain pair specific for CD3.
2. The method of Claim 1, wherein said bispecific molecule is a bispecific antibody with a deletion of a binding region specific for Fc receptor or a deletion of a CD4 binding region for class II MHC antigen.
3. The method of Claim 2, wherein said first binding domain comprises a CD4 domain or domains that is fused to an antibody constant region to form a chimeric antibody chain.
4. The method of Claim 3, wherein said second binding domain comprises a variable region domain of an anti-CD3 antibody chain.
5. The method of Claim 1, wherein said first binding domain and said second binding domain are different regions of a single polypeptide chain.
6. The method of Claim 5, wherein said polypeptide chain comprises an N- terminus and a C-terminus and each of said first and second binding domains is located at one or the other of said termini.
7. The method of Claim 6, wherein said first binding domain is located at said N-terminus and said second binding domain is located at said C-terminus.
8. The method of Claim 7, wherein said first binding domain contains V1V2 domains of CD4.
9. The method of Claim 7, wherein said first binding domain contains V1V2V3V4 domains of CD4.
10. The method of Claim 1, wherein said bispecific molecule is present at a concentration of from at least 16 ng/ml in contact with said infected cell.
11. The method of Claim 1, wherein said cytotoxic T cell is a member of a collection of cytotoxic T cells and said cytotoxic T cells are present at a ratio of from 0.1:1 to 10:1, relative to infected cells, while in contact with said bispecific molecule and HIV-infected cells.
12. The method of Claim 1, wherein said infected cells are located in vivo.
13. A pharmaceutical composition for directing a cytotoxic T cell to an HIV-infected cell in vivo, which comprises:
a bispecific proteinaceous molecule comprising two binding domains, wherein said first binding domain comprises a CD4 region that binds to HIV gp120 and said second binding domain comprises an anti-CD3 binding region and a pharmaceutically acceptable carrier.
14. The composition of Claim 13, wherein said bispecific molecule is a bispecific antibody.
15. The composition of Claim 13, wherein said first binding domain consists essentially of a CD4 variable region domain or domains and said second binding domain consists essentially of an anti-CD3 antibody variable region domain or domains.
16. The composition of Claim 13, wherein said first binding domain comprises a CD4 variable region domain or domains that is fused to an antibody constant region to form a chimeric antibody chain.
17. The composition of Claim 16, wherein said second binding domain comprises a variable region of an anti-CD3 antibody chain.
18. The composition of Claim 13, wherein said first binding domain and said second binding domain are different regions of a single polypeptide chain.
19. The composition of Claim 18, wherein said polypeptide chain comprises an N-terminus and a C-terminus and each of said first and second binding domains is located at one or the other of said termini.
20. The composition of Claim 19, wherein said first binding domain is located at said N-terminus and said second binding domain is located at said C-terminus.
21. The composition of Claim 13, wherein said first binding domain contains V1V2 domains of CD4.
22. The composition of Claim 13, wherein said first binding domain contains V1V2V3V4 domains of CD4.
23. The composition of Claim 13, wherein said composition further comprises a second active component suitable for treating HIV-I infection.
PCT/US1992/009550 1991-11-04 1992-11-04 Compositions that mediate killing of hiv-infected cells WO1993008829A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US78737891A 1991-11-04 1991-11-04
US787,378 1991-11-04

Publications (1)

Publication Number Publication Date
WO1993008829A1 true WO1993008829A1 (en) 1993-05-13

Family

ID=25141289

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1992/009550 WO1993008829A1 (en) 1991-11-04 1992-11-04 Compositions that mediate killing of hiv-infected cells

Country Status (1)

Country Link
WO (1) WO1993008829A1 (en)

Cited By (1141)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0871726A1 (en) * 1995-02-06 1998-10-21 Cell Genesys, Inc. Multispecific chimeric receptors
US5851984A (en) * 1996-08-16 1998-12-22 Genentech, Inc. Method of enhancing proliferation or differentiation of hematopoietic stem cells using Wnt polypeptides
US5990281A (en) * 1996-09-30 1999-11-23 Genentech, Inc. Vertebrate smoothened proteins
US6030945A (en) * 1996-01-09 2000-02-29 Genentech, Inc. Apo-2 ligand
WO2000018806A1 (en) * 1998-09-25 2000-04-06 Horst Lindhofer Bispecific and trispecific antibodies which specifically react with inducible surface antigens as operational target structures
US6121428A (en) * 1997-06-13 2000-09-19 Genentech, Inc. Protein recovery
US6136958A (en) * 1996-09-30 2000-10-24 Genentech, Inc. Antibodies to vertebrate smoothened proteins
US6159462A (en) * 1996-08-16 2000-12-12 Genentech, Inc. Uses of Wnt polypeptides
WO2001029070A2 (en) 1999-10-20 2001-04-26 Genentech, Inc. Modulation of t cell differentiation for the treatment of t helper cell mediated diseases
US6270987B1 (en) 1997-01-31 2001-08-07 Genentech, Inc. O-fucosyltransferase
US6291643B1 (en) 1997-06-05 2001-09-18 Board Of Reports, The University Of Texas System Apaf-1 an activator of caspase-3
US6342369B1 (en) 1997-05-15 2002-01-29 Genentech, Inc. Apo-2-receptor
WO2002016625A2 (en) 2000-08-25 2002-02-28 Basf Plant Science Gmbh Plant polynucleotides encoding prenyl proteases
WO2002030463A2 (en) 2000-10-12 2002-04-18 Genentech, Inc. Reduced-viscosity concentrated protein formulations
WO2002060485A2 (en) 2001-01-31 2002-08-08 Idec Pharmaceuticals Corporation Use of immunoregulatory antibodies in the treatment of neoplastic disorders
US6462176B1 (en) 1996-09-23 2002-10-08 Genentech, Inc. Apo-3 polypeptide
US6469144B1 (en) 1996-04-01 2002-10-22 Genentech, Inc. Apo-2LI and Apo-3 polypeptides
WO2004010957A2 (en) 2002-07-31 2004-02-05 Seattle Genetics, Inc. Drug conjugates and their use for treating cancer, an autoimmune disease or an infectious disease
US6723840B1 (en) 1998-01-23 2004-04-20 The Regents Of The University Of California Identification and expression of a novel kinesin motor protein
US6727079B1 (en) 1998-02-25 2004-04-27 The United States Of America As Represented By The Department Of Health And Human Services cDNA encoding a gene BOG (B5T Over-expressed Gene) and its protein product
US6740739B1 (en) 1998-01-15 2004-05-25 Genentech, Inc. Substitutional variants of APO-2 ligand
US6746668B2 (en) 1996-01-09 2004-06-08 Genentech, Inc. Apo-2 ligand
US6764679B2 (en) 1997-09-18 2004-07-20 Genentech, Inc. Antibodies to DcR3 Polypeptide, a TNFR Homolog
WO2004112572A2 (en) 2003-06-13 2004-12-29 University Of Pittsburgh Monitoring immunologic, hematologic and inflammatory diseases
WO2005062972A2 (en) 2003-12-23 2005-07-14 Tanox, Inc. Treatment of cancer with novel anti-il 13 monoclonal antibodies
WO2005070963A1 (en) 2004-01-12 2005-08-04 Applied Molecular Evolution, Inc Fc region variants
WO2005084390A2 (en) 2004-03-02 2005-09-15 Seattle Genetics, Inc. Partially loaded antibodies and methods of their conjugation
WO2006003407A2 (en) 2004-07-01 2006-01-12 Glaxo Group Limited Chimeric and humanised monoclonal antibodies against inteleukin- 13
WO2006024354A1 (en) * 2004-08-30 2006-03-09 Schering Aktiengesellschaft Treatment of hiv infection by t-cell modulation
WO2006074418A2 (en) 2005-01-07 2006-07-13 Diadexus, Inc. Ovr110 antibody compositions and methods of use
WO2006108273A1 (en) 2005-04-11 2006-10-19 National Research Council Of Canada Identification of a beta-1,3-n-acetylgalactosaminyltransferase (cgte) from campylobacter jejuni lio87
WO2006113402A1 (en) 2005-04-14 2006-10-26 Genentech, Inc. Methods and compositions for modulating and detecting wisp activity
WO2006132670A2 (en) 2004-11-12 2006-12-14 Seattle Genetics, Inc. Auristatins having an aminobenzoic acid unit at the n terminus
WO2007011968A2 (en) 2005-07-18 2007-01-25 Seattle Genetics, Inc. Beta-glucuronide-linker drug conjugates
WO2007048849A1 (en) * 2005-10-28 2007-05-03 Novo Nordisk A/S Fusion proteins that bind effector lymphocytes and target cells
WO2007068803A1 (en) 2005-12-14 2007-06-21 Licentia Ltd Novel neurotrophic factor protein and uses thereof
WO2007068750A2 (en) 2005-12-16 2007-06-21 Glaxo Group Limited Immunoglobulins directed against nogo
US7235633B2 (en) 2000-03-21 2007-06-26 Genentech, Inc. Cytokine receptors and nucleic acids encoding the same
US7256257B2 (en) 2001-04-30 2007-08-14 Seattle Genetics, Inc. Pentapeptide compounds and uses related thereto
EP1820859A2 (en) 1998-12-22 2007-08-22 Genentech, Inc. Methods and compositions for inhibiting neoplastic cell growth
EP1865061A2 (en) 1998-05-15 2007-12-12 Genentech, Inc. IL-17 homologous polypeptides and therapeutic uses thereof
WO2007141280A2 (en) 2006-06-06 2007-12-13 Oxford Genome Sciences (Uk) Ltd Proteins
US7314623B2 (en) 2002-07-15 2008-01-01 Wyeth Methods and compositions for modulating T helper (Th) cell development and function
WO2008011081A2 (en) 2006-07-19 2008-01-24 The Trustees Of The University Of Pennsylvania Wsx-1/p28 as a target for anti-inflammatory responses
EP1887014A1 (en) 1997-10-17 2008-02-13 Genentech, Inc. Human toll homologues
WO2008021290A2 (en) 2006-08-09 2008-02-21 Homestead Clinical Corporation Organ-specific proteins and methods of their use
WO2008036135A2 (en) 2006-06-01 2008-03-27 Genentech, Inc. Crystal structure of crig and c3b: crig complex
WO2008052187A2 (en) 2006-10-27 2008-05-02 Genentech. Inc. Antibodies and immunoconjugates and uses therefor
WO2008060776A2 (en) 2006-10-03 2008-05-22 University Of Medicine And Dentistry Of New Jersey Atap peptides, nucleic acids encoding the same and associated methods of use
EP1933150A1 (en) 2002-05-07 2008-06-18 Institut Pasteur Methods of screening of PP1-interacting polypeptides or proteins, peptides inhibiting PP1c binding to Bcl-2 proteins, BCL-XL and BCL-W, and uses thereof
EP1941905A1 (en) 1998-03-27 2008-07-09 Genentech, Inc. APO-2 Ligand-anti-her-2 antibody synergism
EP1944317A2 (en) 2000-09-01 2008-07-16 Genentech, Inc. Secreted and transmembrane polypeptides and nucleic acids encoding the same
EP1947119A2 (en) 1997-12-12 2008-07-23 Genentech, Inc. Treatment of cancer with anti-erb2 antibodies in combination with a chemotherapeutic agent
EP1950300A2 (en) 1998-11-18 2008-07-30 Genentech, Inc. Antibody variants with higher binding affinity compared to parent antibodies
EP1953173A1 (en) 1999-06-15 2008-08-06 Genentech, Inc. Secreted and transmembrane polypeptides and nucleic acids endoding the same
EP1961428A1 (en) 2002-04-02 2008-08-27 Ucb S.A. SC6 antibody for treatment of cancer
WO2008103962A2 (en) 2007-02-22 2008-08-28 Genentech, Inc. Methods for detecting inflammatory bowel disease
EP1967587A1 (en) 1997-10-10 2008-09-10 Genentech, Inc. APO-3 Ligand
WO2008118324A2 (en) 2007-03-26 2008-10-02 Macrogenics, Inc. Composition and method of treating cancer with an anti-uroplakin ib antibody
EP1983000A2 (en) 2003-11-21 2008-10-22 UCB Pharma, S.A. Method for the treatment of multiple sclerosis by inhibiting IL-17 activity
EP1992643A2 (en) 2001-06-20 2008-11-19 Genentech, Inc. Compositions and methods for the diagnosis and treatment of tumor
EP1995321A2 (en) 2005-08-15 2008-11-26 Genentech, Inc. Gene disruptions, compositions and methods relating thereto
WO2008150525A1 (en) 2007-06-04 2008-12-11 Genentech, Inc. Anti-notch1 nrr antibodies and methods using same
EP2002714A1 (en) 2005-11-21 2008-12-17 Genentech, Inc. Novel gene disruptions, compositions and methods relating thereto
EP2011886A2 (en) 2002-04-16 2009-01-07 Genentech, Inc. Compositions and methods for the diagnosis and treatment of tumor
EP2011873A2 (en) 1994-05-27 2009-01-07 Genentech, Inc. Tumor necrosis factor receptor-associated factors
EP2014770A2 (en) 1997-10-29 2009-01-14 Genentech, Inc. WNT-1 Iinduced secreted polypeptide WISP-2
EP2014675A1 (en) 2003-08-11 2009-01-14 Genentech, Inc. Compositions and methods for the treatment of immune related diseases
EP2014677A1 (en) 1997-11-21 2009-01-14 Genentech, Inc. A-33 related antigens and their pharmacological uses
EP2014303A2 (en) 2000-07-27 2009-01-14 Genentech, Inc. APO-2L receptor agonist and CPT-11 synergism
EP2014298A2 (en) 2000-08-24 2009-01-14 Genentech, Inc. Interleukin-22 polypeptides, nucleic acids encoding the same and methods for the treatment of pancreatic disorders
EP2016951A1 (en) 1998-03-17 2009-01-21 Genentech, Inc. Polypeptides homologous to VEGF and BMP1
EP2033970A2 (en) 1997-10-29 2009-03-11 Genentech, Inc. WNT-1 inducible genes
WO2009035791A1 (en) 2007-08-02 2009-03-19 Arresto Biosciences Lox and l0xl2 inhibitors and uses thereof
EP2042597A1 (en) 2000-06-23 2009-04-01 Genentech, Inc. Compositions and methods for the diagnosis and treatment of disorders involving angiogenesis
WO2009044208A1 (en) 2007-10-03 2009-04-09 Oxford Genome Sciences (Uk) Limited Protein
EP2048154A1 (en) 2002-02-05 2009-04-15 Genentech, Inc. Protein purification
EP2050762A2 (en) 1998-03-10 2009-04-22 Genentech, Inc. Novel polypeptides and nucleic acids encoding the same
EP2050335A1 (en) 2006-02-17 2009-04-22 Genentech, Inc. Gene disruptions, compositions and methods relating thereto
WO2009052431A2 (en) 2007-10-19 2009-04-23 Seattle Genetics, Inc. Cd19 binding agents and uses thereof
WO2009052081A2 (en) 2007-10-15 2009-04-23 Sanofi-Aventis Antibodies that bind il-4 and/or il-13 and their uses
EP2052742A1 (en) 2000-06-20 2009-04-29 Biogen Idec Inc. Treatment of B-cell associated diseases such as malignancies and autoimmune diseases using a cold anti-CD20 antibody/radiolabeled anti-CD22 antibody combination
WO2009054873A2 (en) 2007-08-02 2009-04-30 Novimmune S.A. Anti-rantes antibodies and methods of use thereof
EP2058334A2 (en) 1998-06-12 2009-05-13 Genentech, Inc. Monoclonal antibodies, cross-reactive antibodies and method for producing the same
EP2062916A2 (en) 2003-04-09 2009-05-27 Genentech, Inc. Therapy of autoimmune disease in a patient with an inadequate response to a TNF-Alpha inhibitor
EP2065467A2 (en) 2001-02-22 2009-06-03 Genentech, Inc. Anti-interferon-alpha antibodies
WO2009068649A2 (en) 2007-11-30 2009-06-04 Glaxo Group Limited Antigen-binding constructs
EP2067472A1 (en) 2002-01-02 2009-06-10 Genentech, Inc. Compositions and methods for the diagnosis and treatment of tumor
EP2075334A1 (en) 2000-06-23 2009-07-01 Genentech, Inc. EG-VEGF nucleic acids and polypeptides and methods of use
EP2075253A1 (en) 2000-06-23 2009-07-01 Genentech, Inc. Compositions and methds for the diagnosis and treatment of disorders involving angiogensis
WO2009086539A2 (en) 2007-12-28 2009-07-09 Elan Pharmaceuticals, Inc. Treatment and prophylaxis of amyloidosis
EP2082645A1 (en) 2006-04-19 2009-07-29 Genentech, Inc. Novel gene disruptions, compositions and methods relating thereto
EP2083018A2 (en) 2003-04-16 2009-07-29 Genentech, Inc. Compositions and methods relating to STOP-1
EP2083079A1 (en) 1997-06-18 2009-07-29 Genentech, Inc. Apo-2DcR
EP2085096A2 (en) 2002-09-11 2009-08-05 Genentech, Inc. Novel composition and methods for the treatment of immune related diseases
EP2090657A2 (en) 2000-08-07 2009-08-19 Centocor Ortho Biotech Inc. Anti-IL-12 antibodies, compositions, methods and uses
EP2093570A1 (en) 2003-06-06 2009-08-26 Genentech, Inc. Modulating the interaction between HGF beta chain and c-met
WO2009123894A2 (en) 2008-04-02 2009-10-08 Macrogenics, Inc. Her2/neu-specific antibodies and methods of using same
EP2110138A1 (en) 1999-08-27 2009-10-21 Genentech, Inc. Dosages for treatment of anti-erbB2 antibodies
EP2112167A2 (en) 1999-06-25 2009-10-28 Genentech, Inc. Humanized ANTI-ERBB2 antibodies and treatment with ANTI-ERBB2 antibodies
EP2116551A1 (en) 2002-09-11 2009-11-11 Genentech, Inc. Compositions and methods for the treatment of immune related diseases
WO2009151717A2 (en) 2008-04-02 2009-12-17 Macrogenics, Inc. Bcr-complex-specific antibodies and methods of using same
EP2143438A1 (en) 2001-09-18 2010-01-13 Genentech, Inc. Compositions and methods for the diagnosis and treatment of tumor
EP2159230A1 (en) 2000-08-07 2010-03-03 Centocor Ortho Biotech Inc. Anti-TNF antibodies, compositions, methods and uses
EP2161283A1 (en) 2003-11-17 2010-03-10 Genentech, Inc. Compositions comprising antibodies against CD79b conjugated to a growth inhibitory agent or cytotoxic agent and methods for the treatment of tumor of hematopoietic origin
WO2010027364A1 (en) 2008-09-07 2010-03-11 Glyconex Inc. Anti-extended type i glycosphingolipid antibody, derivatives thereof and use
WO2010030813A2 (en) 2008-09-10 2010-03-18 Genentech, Inc. Methods for inhibiting ocular angiogenesis
WO2010033279A2 (en) 2008-06-04 2010-03-25 Macrogenics, Inc. Antibodies with altered binding to fcrn and methods of using same
WO2010042562A2 (en) 2008-10-06 2010-04-15 Minerva Biotechnologies Corporation Muc1* antibodies
WO2010048446A2 (en) 2008-10-22 2010-04-29 Genentech, Inc. Modulation of axon degeneration
EP2186402A1 (en) 2005-06-06 2010-05-19 Genentech, Inc. Knock-out animal models for novel genes and methods of use
US7727525B2 (en) 2006-05-11 2010-06-01 City Of Hope Engineered anti-CD20 antibody fragments for in vivo targeting and therapeutics
US7736635B2 (en) 2003-12-23 2010-06-15 Ucb Pharma S.A. Branched molecular scaffolds for linking polymer residues to biologically active moieties
WO2010070094A1 (en) 2008-12-19 2010-06-24 Glaxo Group Limited Myostatin binding proteins
WO2010075548A2 (en) 2008-12-23 2010-07-01 Genentech, Inc. Immunoglobulin variants with altered binding to protein a
WO2010075249A2 (en) 2008-12-22 2010-07-01 Genentech, Inc. A method for treating rheumatoid arthritis with b-cell antagonists
WO2010074702A1 (en) 2008-12-16 2010-07-01 Millipore Corporation Purification of proteins
WO2010077634A1 (en) 2008-12-09 2010-07-08 Genentech, Inc. Anti-pd-l1 antibodies and their use to enhance t-cell function
WO2010080528A1 (en) 2008-12-17 2010-07-15 Genentech, Inc. Hepatitis c virus combination therapy
WO2010084408A2 (en) 2009-01-21 2010-07-29 Oxford Biotherapeutics Ltd. Pta089 protein
EP2214014A1 (en) 2004-05-11 2010-08-04 The University of Pittsburgh Monitoring immunologic, hematologic and inflammatory diseases
EP2216650A1 (en) 2004-04-09 2010-08-11 University of Pittsburgh Real time method of detecting acute inflammatory conditions
WO2010097386A1 (en) 2009-02-24 2010-09-02 Glaxo Group Limited Antigen-binding constructs
WO2010097394A1 (en) 2009-02-24 2010-09-02 Glaxo Group Limited Multivalent and/or multispecific rankl-binding constructs
WO2010097385A1 (en) 2009-02-24 2010-09-02 Glaxo Group Limited Antigen-binding constructs
EP2228446A1 (en) 1999-12-01 2010-09-15 Genentech, Inc. Secreted and transmembrane polypeptieds and nucleic acids encoding the same
US7803561B2 (en) 2006-02-06 2010-09-28 Rhode Island Hospital GPR30 estrogen receptor in breast cancers
EP2233149A1 (en) 2007-10-16 2010-09-29 ZymoGenetics, Inc. Combination of BLYS inhibition and anti-CD20 agents for treatment of autoimmune disease
WO2010111254A1 (en) 2009-03-25 2010-09-30 Genentech, Inc. Novel anti-alpha5beta1 antibodies and uses thereof
WO2010111367A1 (en) 2009-03-25 2010-09-30 Genentech, Inc. Anti-fgfr3 antibodies and methods using same
WO2010114859A1 (en) 2009-04-01 2010-10-07 Genentech, Inc. Treatment of insulin-resistant disorders
WO2010118243A2 (en) 2009-04-08 2010-10-14 Genentech, Inc. Use of il-27 antagonists to treat lupus
EP2241622A2 (en) 1994-03-18 2010-10-20 Genentech, Inc. Human trk receptors and their derivatives
WO2010120561A1 (en) 2009-04-01 2010-10-21 Genentech, Inc. Anti-fcrh5 antibodies and immunoconjugates and methods of use
US7820799B2 (en) 2005-06-17 2010-10-26 Janssen Alzheimer Immunotherapy Methods of purifying Fc region containing proteins
EP2248829A1 (en) 2003-05-30 2010-11-10 Genentech, Inc. Treatment with anti-VEGF antibodies
WO2010128407A2 (en) 2009-05-05 2010-11-11 Novimmune S.A. Anti-il-17f antibodies and methods of use thereof
EP2253646A1 (en) 2000-08-07 2010-11-24 Centocor Ortho Biotech Inc. Anti-dual integrin antibody and compositions and conjugates comprising said antibody
EP2258848A1 (en) 1999-12-23 2010-12-08 Genentech, Inc. Il-17 homologous polypeptide and therapeutic uses thereof
EP2261367A2 (en) 2007-11-29 2010-12-15 Genentech, Inc. Gene expression markers for inflammatory bowel disease
EP2260858A2 (en) 2003-11-06 2010-12-15 Seattle Genetics, Inc. Monomethylvaline compounds capable of conjugation to ligands
EP2263691A1 (en) 2002-07-15 2010-12-22 Genentech, Inc. Treatment of cancer with the recombinant humanized monoclonal anti-erbb2 antibody 2C4 (rhuMAb 2C4)
EP2266594A1 (en) 2001-09-19 2010-12-29 Neuronova AB VEGF for use in the treatment of central nervous system disorders
EP2267450A2 (en) 2005-04-29 2010-12-29 The Regents of the University of California Antibodies against histone modifications for clinical diagnosis and prognosis of cancer
US7868133B2 (en) 2002-09-09 2011-01-11 Dana Farber Cancer Institute, Inc. BH3 peptides and method of use thereof
EP2272868A2 (en) 2003-06-05 2011-01-12 Genentech, Inc. Combination therapy for B cell disorders
WO2011005715A1 (en) 2009-07-07 2011-01-13 Genentech, Inc. Diagnosis and treatment of autoimmune demyelinating diseases
EP2275119A1 (en) 1995-07-27 2011-01-19 Genentech, Inc. Stable isotonic lyophilized protein formulation
WO2011008990A1 (en) 2009-07-15 2011-01-20 Prometheus Laboratories Inc. Drug selection for gastric cancer therapy using antibody-based arrays
EP2277908A2 (en) 2003-07-08 2011-01-26 Genentech, Inc. IL-17A/F heterologous polypeptides, antibodies and therapeutic uses thereof
WO2011011339A1 (en) 2009-07-20 2011-01-27 Genentech, Inc. Gene expression markers for crohn's disease
WO2011014457A1 (en) 2009-07-27 2011-02-03 Genentech, Inc. Combination treatments
WO2011014750A1 (en) 2009-07-31 2011-02-03 Genentech, Inc. Inhibition of tumor metastasis using bv8- or g-csf-antagonists
EP2283866A2 (en) 1999-06-25 2011-02-16 Genentech, Inc. Methods of treatment using anti-ERBB antibody-maytansinoid conjugates
WO2011019619A1 (en) 2009-08-11 2011-02-17 Genentech, Inc. Production of proteins in glutamine-free cell culture media
WO2011019620A1 (en) 2009-08-10 2011-02-17 Genentech, Inc. Antibodies with enhanced adcc function
WO2011019679A1 (en) 2009-08-11 2011-02-17 Allergan, Inc. Ccr2 inhibitors for treating conditions of the eye
WO2011019622A1 (en) 2009-08-14 2011-02-17 Genentech, Inc. Cell culture methods to make antibodies with enhanced adcc function
EP2286844A2 (en) 2004-06-01 2011-02-23 Genentech, Inc. Antibody-drug conjugates and methods
EP2289942A2 (en) 2002-04-10 2011-03-02 Genentech, Inc. Anti-HER2 antibody variants
WO2011028753A1 (en) 2009-09-01 2011-03-10 Genentech, Inc. Enhanced protein purification through a modified protein a elution
WO2011028950A1 (en) 2009-09-02 2011-03-10 Genentech, Inc. Mutant smoothened and methods of using the same
WO2011031397A1 (en) 2009-08-06 2011-03-17 Genentech, Inc. Method to improve virus removal in protein purification
EP2308968A1 (en) 2002-11-26 2011-04-13 Genentech, Inc. Compositions and methods for the treatment of immune related diseases
EP2308888A1 (en) 2001-11-14 2011-04-13 Centocor Ortho Biotech Inc. Anti-IL-6 antibodies, compositions, methods and uses
WO2011044368A1 (en) 2009-10-07 2011-04-14 Macrogenics, Inc. Fc region-containing polypeptides that exhibit improved effector function due to alterations of the extent of fucosylation, and methods for their use
EP2311960A2 (en) 2001-08-29 2011-04-20 Genentech, Inc. Bv8 nucleic acids and polypeptides with mitogenic activity
EP2314318A1 (en) 2001-01-31 2011-04-27 Biogen Idec Inc. CD80 antibody for use in combination with chemotherapeutics to treat B cell malignancies
WO2011050194A1 (en) 2009-10-22 2011-04-28 Genentech, Inc. Methods and compositions for modulating hepsin activation of macrophage-stimulating protein
WO2011050188A1 (en) 2009-10-22 2011-04-28 Genentech, Inc. Anti-hepsin antibodies and methods using same
WO2011050069A1 (en) 2009-10-20 2011-04-28 Prometheus Laboratories Inc. Proximity-mediated assays for detecting oncogenic fusion proteins
WO2011054007A1 (en) 2009-11-02 2011-05-05 Oxford Biotherapeutics Ltd. Ror1 as therapeutic and diagnostic target
EP2319929A1 (en) 1998-12-23 2011-05-11 Genentech, Inc. IL-1 related polypeptides
WO2011056497A1 (en) 2009-10-26 2011-05-12 Genentech, Inc. Activin receptor type iib compositions and methods of use
WO2011054820A1 (en) 2009-11-03 2011-05-12 Universidad Del País Vasco Methods and compositions for the treatment of white matter ischemia
WO2011056502A1 (en) 2009-10-26 2011-05-12 Genentech, Inc. Bone morphogenetic protein receptor type ii compositions and methods of use
WO2011056494A1 (en) 2009-10-26 2011-05-12 Genentech, Inc. Activin receptor-like kinase-1 antagonist and vegfr3 antagonist combinations
WO2011057120A1 (en) 2009-11-05 2011-05-12 Genentech, Inc. Methods and composition for secretion of heterologous polypeptides
EP2322202A2 (en) 2002-10-29 2011-05-18 Genentech, Inc. Compositions and methods for the treatment of immune diseases
WO2011060246A2 (en) 2009-11-12 2011-05-19 Genentech, Inc. A method of promoting dendritic spine density
EP2325208A1 (en) 2005-12-15 2011-05-25 Genentech, Inc. Polyubiquitin antibodies
WO2011066503A2 (en) 2009-11-30 2011-06-03 Genentech, Inc. Compositions and methods for the diagnosis and treatment of tumor
EP2332996A1 (en) 2002-09-11 2011-06-15 Genentech, Inc. Protein Purification
EP2332956A1 (en) 2002-07-08 2011-06-15 Genentech, Inc. Antibody binding to PRO71238
EP2333069A2 (en) 1998-05-15 2011-06-15 Genentech, Inc. Therapeutic uses of IL-17 homologous polypeptides
WO2011071577A1 (en) 2009-12-11 2011-06-16 Genentech, Inc. Anti-vegf-c antibodies and methods using same
EP2335725A1 (en) 2003-04-04 2011-06-22 Genentech, Inc. High concentration antibody and protein formulations
EP2336178A1 (en) 2003-12-11 2011-06-22 Genentech, Inc. Methods and compositions for inhibiting C-Met dimerization and activation
EP2338492A1 (en) 2009-12-24 2011-06-29 Universidad del Pais Vasco Methods and compositions for the treatment of alzheimer
WO2011079185A1 (en) 2009-12-23 2011-06-30 Genentech, Inc. Anti-bv8 antibodies and uses thereof
WO2011080050A2 (en) 2009-12-11 2011-07-07 Novartis Ag Binding molecules
WO2011082187A1 (en) 2009-12-30 2011-07-07 Genentech, Inc. Methods for modulating a pdgf-aa mediated biological response
WO2011084750A1 (en) 2009-12-21 2011-07-14 Genentech, Inc. Antibody formulation
US7982012B2 (en) 2008-03-10 2011-07-19 Theraclone Sciences, Inc. Compositions and methods for the therapy and diagnosis of cytomegalovirus
US7981418B2 (en) 2007-03-02 2011-07-19 Genentech, Inc. Predicting response to a HER inhibitor
WO2011094759A2 (en) 2010-02-01 2011-08-04 The Regents Of The University Of California Novel diagnostic and therapeutic targets associated with or regulated by n-cadherin expression and/or epithelial to mesenchymal transition (emt) in prostate cancer and other malignancies
WO2011094259A2 (en) 2010-01-28 2011-08-04 Glaxo Group Limited Cd127 binding proteins
WO2011095506A1 (en) 2010-02-03 2011-08-11 Ucb Pharma, S.A. Process for obtaining antibodies
WO2011100403A1 (en) 2010-02-10 2011-08-18 Immunogen, Inc Cd20 antibodies and uses thereof
WO2011103242A1 (en) 2010-02-18 2011-08-25 Genentech, Inc. Neuregulin antagonists and use thereof in treating cancer
EP2361931A1 (en) 2004-07-20 2011-08-31 Genentech, Inc. Inhibitors of angiopoietin-like 4 protein, combinations, and their use
WO2011106297A2 (en) 2010-02-23 2011-09-01 Genentech, Inc. Compositions and methods for the diagnosis and treatment of tumor
WO2011107480A1 (en) 2010-03-03 2011-09-09 Glaxo Group Limited Antigen binding proteins specific for serum amyloid p component
EP2364997A2 (en) 1999-01-15 2011-09-14 Genentech, Inc. Polypeptide variants with altered effector function
EP2364716A2 (en) 2002-11-08 2011-09-14 Genentech, Inc. Compositions and methods for the treatment of natural killer cell related diseases
EP2366716A2 (en) 2006-03-21 2011-09-21 Genentech, Inc. Combinatorial therapy involving alpha5beta1 antagonists
WO2011119661A1 (en) 2010-03-24 2011-09-29 Genentech, Inc. Anti-lrp6 antibodies
WO2011119888A2 (en) 2010-03-24 2011-09-29 The Regents Of The University Of California N-cadherin: target for cancer diagnosis and therapy
US8030023B2 (en) 2005-02-02 2011-10-04 Genentech, Inc. Nucleic acid encoding DR5 antibodies and uses thereof
EP2371388A2 (en) 2004-10-20 2011-10-05 Genentech, Inc. Antibody formulations
WO2011123507A1 (en) 2010-03-30 2011-10-06 Centocor Ortho Biotech Inc. Humanized il-25 antibodies
EP2377527A1 (en) 2007-01-22 2011-10-19 Genentech, Inc. Polyelectrolyte precipitation and purification of antibodies
WO2011133931A1 (en) 2010-04-22 2011-10-27 Genentech, Inc. Use of il-27 antagonists for treating inflammatory bowel disease
WO2011136911A2 (en) 2010-04-09 2011-11-03 Aveo Pharmaceuticals, Inc. Anti-erbb3 antibodies
WO2011139718A1 (en) 2010-05-03 2011-11-10 Genentech, Inc. Compositions and methods useful for reducing the viscosity of protein-containing formulations
WO2011139985A1 (en) 2010-05-03 2011-11-10 Genentech, Inc. Compositions and methods for the diagnosis and treatment of tumor
US8057796B2 (en) 2007-11-12 2011-11-15 Theraclone Sciences, Inc. Compositions and methods for the therapy and diagnosis of influenza
EP2388265A1 (en) 2002-02-22 2011-11-23 Genentech, Inc. Compositions and methods for the treatment of immune related diseases
WO2011146568A1 (en) 2010-05-19 2011-11-24 Genentech, Inc. Predicting response to a her inhibitor
EP2390666A1 (en) 2006-03-21 2011-11-30 The Regents of The University of California N-Cadherin as target for cancer diagnosis and therapy
EP2389948A1 (en) 2006-03-23 2011-11-30 Novartis AG Anti-tumor cell antigen antibody therapeutics
WO2011150241A2 (en) 2010-05-28 2011-12-01 Genentech, Inc. Decreasing lactate level and increasing polypeptide production by downregulating the expression of lactate dehydrogenase and pyruvate dehydrogenase kinase
WO2011147834A1 (en) 2010-05-26 2011-12-01 Roche Glycart Ag Antibodies against cd19 and uses thereof
WO2011150110A1 (en) 2010-05-25 2011-12-01 Genentech, Inc. Methods of purifying polypeptides
EP2392353A1 (en) 2005-01-28 2011-12-07 Janssen Alzheimer Immunotherapy Anti A beta antibody formulation
WO2011153346A1 (en) 2010-06-03 2011-12-08 Genentech, Inc. Immuno-pet imaging of antibodies and immunoconjugates and uses therefor
WO2011151432A1 (en) 2010-06-03 2011-12-08 Glaxo Group Limited Humanised antigen binding proteins to myostatin6
WO2011159655A2 (en) 2010-06-16 2011-12-22 Allergan, Inc. IL23p19 ANTIBODY INHIBITOR FOR TREATING OCULAR AND OTHER CONDITIONS
EP2399605A1 (en) 2005-02-23 2011-12-28 Genentech, Inc. Extending time to disease progression or survival in cancer patients
WO2011161119A1 (en) 2010-06-22 2011-12-29 F. Hoffmann-La Roche Ag Antibodies against insulin-like growth factor i receptor and uses thereof
WO2011161189A1 (en) 2010-06-24 2011-12-29 F. Hoffmann-La Roche Ag Anti-hepsin antibodies and methods of use
EP2402373A2 (en) 2006-01-05 2012-01-04 Genentech, Inc. Anti-EphB4 Antibodies and Methods Using Same
EP2404935A1 (en) 2004-03-30 2012-01-11 Glaxo Group Limited Immunoglobulin binding HOSM
WO2012006503A1 (en) 2010-07-09 2012-01-12 Genentech, Inc. Anti-neuropilin antibodies and methods of use
WO2012010551A1 (en) 2010-07-19 2012-01-26 F. Hoffmann-La Roche Ag Method to identify a patient with an increased likelihood of responding to an anti-cancer therapy
WO2012010549A1 (en) 2010-07-19 2012-01-26 F. Hoffmann-La Roche Ag Method to identify a patient with an increased likelihood of responding to an anti-cancer therapy
WO2012010582A1 (en) 2010-07-21 2012-01-26 Roche Glycart Ag Anti-cxcr5 antibodies and methods of use
US8108030B2 (en) 2006-10-20 2012-01-31 Board Of Regents, The University Of Texas System Method and apparatus to identify vulnerable plaques with thermal wave imaging of heated nanoparticles
WO2012013930A2 (en) 2010-07-27 2012-02-02 Ucb Pharma S.A. Process for purifying proteins
WO2012018771A1 (en) 2010-08-03 2012-02-09 Genentech, Inc. Chronic lymphocytic leukemia (cll) biomarkers
WO2012017003A1 (en) 2010-08-05 2012-02-09 F. Hoffmann-La Roche Ag Anti-mhc antibody anti-viral cytokine fusion protein
WO2012020038A1 (en) 2010-08-13 2012-02-16 Roche Glycart Ag Anti-tenascin-c a2 antibodies and methods of use
WO2012020006A2 (en) 2010-08-13 2012-02-16 Roche Glycart Ag Anti-fap antibodies and methods of use
WO2012020072A1 (en) 2010-08-12 2012-02-16 Westfälische Wilhelms-Universität Muenster Anti-syndecan-4 antibodies
WO2012021773A1 (en) 2010-08-13 2012-02-16 Genentech, Inc. Antibodies to il-1beta and il-18, for treatment of disease
WO2012022734A2 (en) 2010-08-16 2012-02-23 Medimmune Limited Anti-icam-1 antibodies and methods of use
EP2423333A1 (en) 2006-08-25 2012-02-29 Oncotherapy Science, Inc. Prognostic markers and therapeutic targets for lung cancer
WO2012025536A1 (en) 2010-08-25 2012-03-01 F. Hoffmann-La Roche Ag Antibodies against il-18r1 and uses thereof
WO2012031027A1 (en) 2010-08-31 2012-03-08 Genentech, Inc. Biomarkers and methods of treatment
EP2434022A2 (en) 2002-10-03 2012-03-28 Genentech, Inc. Use of A33 antigens and JAM-IT
WO2012047968A2 (en) 2010-10-05 2012-04-12 Genentech, Inc. Mutant smoothened and methods of using the same
EP2441775A1 (en) 2007-02-26 2012-04-18 Oxford Biotherapeutics Ltd. Protein
EP2444409A2 (en) 2002-09-16 2012-04-25 Genentech, Inc. Compositions and methods for the treatment of immune related diseases
EP2447719A1 (en) 2007-02-26 2012-05-02 Oxford Biotherapeutics Ltd. Proteins
EP2446904A2 (en) 2006-05-30 2012-05-02 Genentech, Inc. Anti-CD22 antibodies, their immunoconjugates and uses thereof
EP2450050A1 (en) 2006-11-29 2012-05-09 Genentech, Inc. IL-17A/F heterodimeric polypeptides and therapeutic uses thereof
WO2012058768A1 (en) 2010-11-05 2012-05-10 Zymeworks Inc. Stable heterodimeric antibody design with mutations in the fc domain
WO2012058726A1 (en) 2010-11-05 2012-05-10 Transbio Ltd Markers of endothelial progenitor cells and uses thereof
WO2012061129A1 (en) 2010-10-25 2012-05-10 Genentech, Inc Treatment of gastrointestinal inflammation and psoriasis a
EP2452694A1 (en) 2005-06-30 2012-05-16 Janssen Biotech, Inc. Anti-IL-23 antibodies, compositions, methods and uses
WO2012064836A1 (en) 2010-11-10 2012-05-18 Genentech, Inc. Methods and compositions for neural disease immunotherapy
EP2455404A2 (en) 2006-08-22 2012-05-23 G2 Inflammation Pty Ltd Anti-C5AR antibodies with improved properties
WO2012069557A1 (en) 2010-11-24 2012-05-31 Glaxo Group Limited Multispecific antigen binding proteins targeting hgf
WO2012071436A1 (en) 2010-11-24 2012-05-31 Genentech, Inc. Method of treating autoimmune inflammatory disorders using il-23r loss-of-function mutants
WO2012075037A1 (en) 2010-11-30 2012-06-07 Genentech, Inc. Low affinity blood brain barrier receptor antibodies and uses therefor
EP2468772A2 (en) 2006-03-16 2012-06-27 Genentech, Inc. Antibodies to EGFL7 and methods for their use
WO2012087962A2 (en) 2010-12-20 2012-06-28 Genentech, Inc. Anti-mesothelin antibodies and immunoconjugates
WO2012088337A1 (en) 2010-12-23 2012-06-28 Prometheus Laboratories Inc. Drug selection for malignant cancer therapy using antibody-based arrays
WO2012088313A1 (en) 2010-12-22 2012-06-28 Genentech, Inc. Anti-pcsk9 antibodies and methods of use
US8211434B2 (en) 2008-11-26 2012-07-03 Allergan, Inc. KLK-13 antibody inhibitor for treating dry eye
EP2471809A1 (en) 2006-07-11 2012-07-04 University Of Medicine And Dentistry Of New Jersey Proteins, nucleic acids encoding the same and associated methods of use
WO2012092539A2 (en) 2010-12-31 2012-07-05 Takeda Pharmaceutical Company Limited Antibodies to dll4 and uses thereof
EP2474557A2 (en) 2007-07-16 2012-07-11 Genentech, Inc. Anti-CD79b antibodies and immunoconjugates and methods of use
WO2012093254A1 (en) 2011-01-07 2012-07-12 Ucb Pharma S.A. Lipocalin 2 as a biomarker for il-17 inhibitor therapy efficacy
WO2012095662A1 (en) 2011-01-14 2012-07-19 Ucb Pharma S.A. Antibody molecules which bind il-17a and il-17f
WO2012099566A1 (en) 2010-11-17 2012-07-26 Sea Lane Biotechnologies, Llc Influenza virus neutralizing agents that mimic the binding site of an influenza neutralizing antibody
WO2012100835A1 (en) 2011-01-28 2012-08-02 Laboratorios Del Dr. Esteve, S.A. Methods and compositions for the treatment of aids
WO2012119989A2 (en) 2011-03-04 2012-09-13 Oryzon Genomics, S.A. Methods and antibodies for the diagnosis and treatment of cancer
EP2500030A2 (en) 2005-11-04 2012-09-19 Genentech, Inc. Use of complement pathway inhibitors to treat ocular diseases
EP2500438A2 (en) 2002-09-25 2012-09-19 Genentech, Inc. Novel compositions and methods for the treatment of psoriasis
WO2012125614A1 (en) 2011-03-15 2012-09-20 Theraclone Sciences, Inc. Compositions and methods for the therapy and diagnosis of influenza
EP2503341A2 (en) 2006-11-14 2012-09-26 Genentech, Inc. Modulators of Neuronal Regeneration
WO2012130831A1 (en) 2011-03-29 2012-10-04 Roche Glycart Ag Antibody fc variants
WO2012138997A1 (en) 2011-04-07 2012-10-11 Amgen Inc. Novel egfr binding proteins
WO2012138975A1 (en) 2011-04-07 2012-10-11 Genentech, Inc. Anti-fgfr4 antibodies and methods of use
EP2511299A1 (en) 2005-04-19 2012-10-17 Seattle Genetics, Inc. Humanized anti-CD70 binding agents and uses thereof
EP2514764A2 (en) 2006-10-18 2012-10-24 UCB Pharma, S.A. Antibody molecules which bind IL-17A and IL-17F
WO2012143379A1 (en) 2011-04-20 2012-10-26 Roche Glycart Ag Method and constructs for the ph dependent passage of the blood-brain-barrier
WO2012155019A1 (en) 2011-05-12 2012-11-15 Genentech, Inc. Multiple reaction monitoring lc-ms/ms method to detect therapeutic antibodies in animal samples using framework signature pepides
WO2012158704A1 (en) 2011-05-16 2012-11-22 Genentech, Inc. Fgfr1 agonists and methods of use
WO2012158948A1 (en) 2011-05-17 2012-11-22 The Rockefeller University Human immunodeficiency virus neutralizing antibodies adn methods of use thereof
US8318905B2 (en) 2004-04-23 2012-11-27 Richard Kroczek Antibodies for depletion of ICOS-positive cells in vivo
EP2526960A1 (en) 2003-03-12 2012-11-28 Genentech, Inc. Use of BV8 and/or EG-VEGF to promote hematopoiesis
US8329178B2 (en) 2005-02-18 2012-12-11 Dana-Farber Cancer Institute, Inc. Antibodies against CXCR4 and methods of use thereof
EP2535355A2 (en) 2005-03-23 2012-12-19 Genmab A/S Antibodies against CD38 for treatment of multiple myeloma
WO2012171996A1 (en) 2011-06-15 2012-12-20 F. Hoffmann-La Roche Ag Anti-human epo receptor antibodies and methods of use
WO2013003680A1 (en) 2011-06-30 2013-01-03 Genentech, Inc. Anti-c-met antibody formulations
WO2013001369A2 (en) 2011-06-28 2013-01-03 Oxford Biotherapeutics Ltd. Therapeutic and diagnostic target
US8355776B2 (en) 2005-05-27 2013-01-15 Board Of Regents, The University Of Texas System Hemoglobin contrast in magneto-motive optical doppler tomography, optical coherence tomography, and ultrasound imaging methods and apparatus
EP2548577A1 (en) 2005-12-29 2013-01-23 Janssen Biotech, Inc. Human anti-il-23 antibodies, compositions, methods and uses
WO2013012855A1 (en) 2011-07-18 2013-01-24 Amgen Inc. Apelin antigen-binding proteins and uses thereof
EP2551672A1 (en) 2006-09-21 2013-01-30 Nestec S.A. Antibody-based arrays for detecting multiple signal transducers in rare circulating cells
WO2013025944A1 (en) 2011-08-17 2013-02-21 Genentech, Inc. Inhibition of angiogenesis in refractory tumors
WO2013025853A1 (en) 2011-08-17 2013-02-21 Genentech, Inc. Neuregulin antibodies and uses thereof
WO2013026832A1 (en) 2011-08-23 2013-02-28 Roche Glycart Ag Anti-mcsp antibodies
WO2013033623A1 (en) 2011-09-02 2013-03-07 Nestec S.A. Profiling of signal pathway proteins to determine therapeutic efficacy
WO2013033069A1 (en) 2011-08-30 2013-03-07 Theraclone Sciences, Inc. Human rhinovirus (hrv) antibodies
EP2567975A2 (en) 2006-11-21 2013-03-13 The Regents of The University of California Modulation of RHAMM (CD168) for selective adipose tissue development
WO2013040433A1 (en) 2011-09-15 2013-03-21 Genentech, Inc. Methods of promoting differentiation
EP2573114A1 (en) 2005-08-10 2013-03-27 MacroGenics, Inc. Identification and engineering of antibodies with variant Fc regions and methods of using same
EP2573563A1 (en) 2007-12-20 2013-03-27 Heptares Therapeutics Limited Screening
WO2013043715A1 (en) 2011-09-19 2013-03-28 Genentech, Inc. Combination treatments comprising c-met antagonists and b-raf antagonists
WO2013052155A1 (en) 2011-10-05 2013-04-11 Genentech, Inc. Methods of treating liver conditions using notch2 antagonists
WO2013055998A1 (en) 2011-10-14 2013-04-18 Genentech, Inc. ANTI-HtrA1 ANTIBODIES AND METHODS OF USE
WO2013056148A2 (en) 2011-10-15 2013-04-18 Genentech, Inc. Methods of using scd1 antagonists
WO2013059531A1 (en) 2011-10-20 2013-04-25 Genentech, Inc. Anti-gcgr antibodies and uses thereof
EP2586788A1 (en) 2007-07-09 2013-05-01 Genentech, Inc. Prevention of disulfide bond reduction during recombinant production of polypeptides
WO2013063001A1 (en) 2011-10-28 2013-05-02 Genentech, Inc. Therapeutic combinations and methods of treating melanoma
WO2013067301A1 (en) 2011-11-02 2013-05-10 Genentech, Inc. Overload and elute chromatography
EP2592156A2 (en) 2007-06-08 2013-05-15 Genentech, Inc. Gene expression markers of tumor resistance to HER2 inhibitor treatment
WO2013078170A1 (en) 2011-11-21 2013-05-30 Genentech, Inc. Purification of anti-c-met antibodies
US8454511B2 (en) 2005-05-27 2013-06-04 Board Of Regents, The University Of Texas System Magneto-motive ultrasound detection of magnetic nanoparticles
EP2602623A2 (en) 2008-02-25 2013-06-12 Nestec S.A. Mehtod for the detection of intracellular truncated receptors
WO2013083497A1 (en) 2011-12-06 2013-06-13 F. Hoffmann-La Roche Ag Antibody formulation
WO2013092743A2 (en) 2011-12-22 2013-06-27 F. Hoffmann-La Roche Ag Expression vector element combinations, novel production cell generation methods and their use for the recombinant production of polypeptides
WO2013092720A1 (en) 2011-12-22 2013-06-27 F. Hoffmann-La Roche Ag Full length antibody display system for eukaryotic cells and its use
WO2013096791A1 (en) 2011-12-23 2013-06-27 Genentech, Inc. Process for making high concentration protein formulations
WO2013096812A1 (en) 2011-12-23 2013-06-27 Genentech, Inc. Articles of manufacture and methods for co-administration of antibodies
WO2013092723A1 (en) 2011-12-22 2013-06-27 F. Hoffmann-La Roche Ag Expression vector organization, novel production cell generation methods and their use for the recombinant production of polypeptides
EP2610267A1 (en) 2006-12-18 2013-07-03 Genentech, Inc. Antagonist anti-Notch3 antibodies and their use in the prevention and treatment of Notch3-related diseases
EP2609932A2 (en) 2006-12-01 2013-07-03 Seattle Genetics, Inc. Variant target binding agents and uses thereof
WO2013101771A2 (en) 2011-12-30 2013-07-04 Genentech, Inc. Compositions and method for treating autoimmune diseases
EP2614839A2 (en) 2006-04-05 2013-07-17 Genentech, Inc. Method for using BOC/CDO to modulate hedgehog signaling
WO2013106485A2 (en) 2012-01-09 2013-07-18 The Scripps Research Institute Ultralong complementarity determining regions and uses thereof
WO2013106489A1 (en) 2012-01-09 2013-07-18 The Scripps Research Institute Humanized antibodies with ultralong cdr3s
WO2013109819A1 (en) 2012-01-18 2013-07-25 Genentech, Inc. Anti-lrp5 antibodies and methods of use
WO2013109856A2 (en) 2012-01-18 2013-07-25 Genentech, Inc. Methods of using fgf19 modulators
WO2013110945A1 (en) 2012-01-26 2013-08-01 Imperial Innovations Ltd Methods of treating pain by inhibition of vgf activity
US8501178B2 (en) 2008-11-25 2013-08-06 Biogen Idec Ma Inc. Use of DR6 and p75 antagonists to promote survival of cells of the nervous system
EP2623516A2 (en) 2005-12-02 2013-08-07 Genentech, Inc. Compositions and methods for the treatment of diseases and disorders associated with cytokine signaling involving antibodies that bind to IL-22 and IL-22R
WO2013116287A1 (en) 2012-01-31 2013-08-08 Genentech, Inc. Anti-ig-e m1' antibodies and methods using same
WO2013120056A1 (en) 2012-02-11 2013-08-15 Genentech, Inc. R-spondin translocations and methods using the same
WO2013120929A1 (en) 2012-02-15 2013-08-22 F. Hoffmann-La Roche Ag Fc-receptor based affinity chromatography
US8535912B2 (en) 2009-10-15 2013-09-17 Genentech, Inc. Chimeric fibroblast growth factors with altered receptor specificity
EP2639301A2 (en) 2006-06-30 2013-09-18 Bristol-Myers Squibb Company Polynucleotides encoding novel PCSK9 variants
EP2641618A2 (en) 2007-07-16 2013-09-25 Genentech, Inc. Humanized anti-CD79B antibodies and immunoconjugates and methods of use
EP2644205A1 (en) 2007-04-12 2013-10-02 The Brigham and Women's Hospital, Inc. Targeting ABCB5 for cancer therapy
WO2013148315A1 (en) 2012-03-27 2013-10-03 Genentech, Inc. Diagnosis and treatments relating to her3 inhibitors
WO2013149159A1 (en) 2012-03-30 2013-10-03 Genentech, Inc. Anti-lgr5 antibodies and immunoconjugates
WO2013149111A2 (en) 2012-03-29 2013-10-03 Novimmune S.A. Anti-tlr4 antibodies and uses thereof
WO2013148249A1 (en) 2012-03-27 2013-10-03 Genentech, Inc. Improved harvest operations for recombinant proteins
EP2657253A2 (en) 2008-01-31 2013-10-30 Genentech, Inc. Anti-CD79b antibodies and immunoconjugates and methods of use
WO2013165940A1 (en) 2012-05-01 2013-11-07 Genentech, Inc. Anti-pmel17 antibodies and immunoconjugates
WO2013170191A1 (en) 2012-05-11 2013-11-14 Genentech, Inc. Methods of using antagonists of nad biosynthesis from nicotinamide
WO2013177062A2 (en) 2012-05-21 2013-11-28 Genentech, Inc. Methods for improving safety of blood-brain barrier transport
WO2013177470A1 (en) 2012-05-23 2013-11-28 Genentech, Inc. Selection method for therapeutic agents
US8609101B2 (en) 2009-04-23 2013-12-17 Theraclone Sciences, Inc. Granulocyte-macrophage colony-stimulating factor (GM-CSF) neutralizing antibodies
WO2013188448A2 (en) 2012-06-11 2013-12-19 Amgen Inc. Dual receptor antagonistic antigen-binding proteins and uses thereof
WO2014006124A1 (en) 2012-07-04 2014-01-09 F. Hoffmann-La Roche Ag Covalently linked antigen-antibody conjugates
WO2014006118A1 (en) 2012-07-04 2014-01-09 F. Hoffmann-La Roche Ag Anti-theophylline antibodies and methods of use
WO2014006123A1 (en) 2012-07-04 2014-01-09 F. Hoffmann-La Roche Ag Anti-biotin antibodies and methods of use
WO2014008391A1 (en) 2012-07-05 2014-01-09 Genentech, Inc. Expression and secretion system
WO2014011521A1 (en) 2012-07-09 2014-01-16 Genentech, Inc. Immunoconjugates comprising anti - cd79b antibodies
WO2014011519A1 (en) 2012-07-09 2014-01-16 Genentech, Inc. Immunoconjugates comprising anti-cd79b antibodies
WO2014011518A1 (en) 2012-07-09 2014-01-16 Genentech, Inc. Immunoconjugates comprising anti-cd22 antibodies
WO2014011520A1 (en) 2012-07-09 2014-01-16 Genentech, Inc. Immunoconjugates comprising anti-cd22 antibodies
WO2014018554A1 (en) 2012-07-23 2014-01-30 La Jolla Institute For Allergy And Immunology Ptprs and proteoglycans in autoimmune disease
WO2014020331A1 (en) 2012-08-01 2014-02-06 Oxford Biotherapeutics Ltd. Therapeutic and diagnostic target
US8647622B2 (en) 2007-08-29 2014-02-11 Sanofi Humanized anti-CXCR5 antibodies, derivatives thereof and their use
WO2014037899A2 (en) 2012-09-07 2014-03-13 Novartis Ag Il-18 binding molecules
WO2014047311A1 (en) 2012-09-19 2014-03-27 Genentech, Inc. Methods and compositions for preventing norleucine misincorporation into proteins
WO2014049003A1 (en) 2012-09-25 2014-04-03 Glenmark Pharmaceuticals S.A. Purification of hetero-dimeric immunoglobulins
US8691918B2 (en) 2010-05-17 2014-04-08 Emd Millipore Corporation Stimulus responsive polymers for the purification of biomolecules
EP2722051A1 (en) 2005-07-07 2014-04-23 Seattle Genetics, Inc. Monomethylvaline compounds having phenylalanine side-chain modifications at the C-terminus
WO2014069647A1 (en) 2012-11-05 2014-05-08 全薬工業株式会社 Antibody and antibody composition production method
WO2014072306A1 (en) 2012-11-08 2014-05-15 F. Hoffmann-La Roche Ag Her3 antigen binding proteins binding to the beta-hairpin of her3
WO2014078268A2 (en) 2012-11-13 2014-05-22 Genentech, Inc. Anti-hemagglutinin antibodies and methods of use
WO2014087248A2 (en) 2012-12-03 2014-06-12 Novimmune S.A. Anti-cd47 antibodies and methods of use thereof
WO2014116749A1 (en) 2013-01-23 2014-07-31 Genentech, Inc. Anti-hcv antibodies and methods of using thereof
WO2014123580A1 (en) 2013-02-06 2014-08-14 Inhibrx Llc Non-platelet depleting and non-red blood cell depleting cd47 antibodies and methods of use thereof
WO2014128235A1 (en) 2013-02-22 2014-08-28 F. Hoffmann-La Roche Ag Methods of treating cancer and preventing drug resistance
WO2014130064A1 (en) 2013-02-22 2014-08-28 Abbvie Inc. Ultrafiltration and diafiltration formulation methods for protein processing
WO2014131715A1 (en) 2013-02-26 2014-09-04 Roche Glycart Ag Anti-mcsp antibodies
WO2014138364A2 (en) 2013-03-06 2014-09-12 Genentech, Inc. Methods of treating and preventing cancer drug resistance
WO2014144871A1 (en) 2013-03-15 2014-09-18 The Centre For Drug Research And Development Cytotoxic and anti-mitotic compounds, and methods of using the same
WO2014144865A2 (en) 2013-03-15 2014-09-18 Genentech, Inc. Anti-crth2 antibodies and methods of use
WO2014144763A2 (en) 2013-03-15 2014-09-18 Memorial Sloan Kettering Cancer Center High affinity anti-gd2 antibodies
WO2014144850A1 (en) 2013-03-15 2014-09-18 Genentech, Inc. Methods of treating cancer and preventing cancer drug resistance
WO2014145098A1 (en) 2013-03-15 2014-09-18 Genentech, Inc. Cell culture compositions with antioxidants and methods for polypeptide production
WO2014153030A2 (en) 2013-03-14 2014-09-25 Genentech, Inc. Methods of treating cancer and preventing cancer drug resistance
WO2014151866A1 (en) 2013-03-15 2014-09-25 Genentech, Inc. Compositions and methods for diagnosis and treatment of hepatic cancers
WO2014152358A2 (en) 2013-03-14 2014-09-25 Genentech, Inc. Combinations of a mek inhibitor compound with an her3/egfr inhibitor compound and methods of use
WO2014150877A2 (en) 2013-03-15 2014-09-25 Ac Immune S.A. Anti-tau antibodies and methods of use
WO2014151006A2 (en) 2013-03-15 2014-09-25 Genentech, Inc. Biomarkers and methods of treating pd-1 and pd-l1 related conditions
WO2014160490A1 (en) 2013-03-13 2014-10-02 Genetech, Inc. Antibody formulations
WO2014160497A1 (en) 2013-03-13 2014-10-02 Genentech, Inc. Formulations with reduced oxidation
WO2014159835A1 (en) 2013-03-14 2014-10-02 Genentech, Inc. Anti-b7-h4 antibodies and immunoconjugates
WO2014159940A1 (en) 2013-03-14 2014-10-02 Macrogenics, Inc. Bispecific molecules that are immunoreactive with immune effector cells that express an activating receptor
WO2014160495A1 (en) 2013-03-13 2014-10-02 Genentech, Inc. Formulations with reduced oxidation
US8853369B2 (en) 2010-06-18 2014-10-07 Genentech, Inc. Anti-Axl antibodies and methods of use
WO2014161845A1 (en) 2013-04-03 2014-10-09 Roche Glycart Ag Bispecific antibodies specific for fap and dr5, antibodies specific for dr5 and methods of use
US8858948B2 (en) 2009-05-20 2014-10-14 Theraclone Sciences, Inc. Compositions and methods for the therapy and diagnosis of influenza
WO2014169076A1 (en) 2013-04-09 2014-10-16 Annexon,,Inc. Methods of treatment for neuromyelitis optica
WO2014172661A1 (en) 2013-04-19 2014-10-23 The Regent Of The University Of California Lone star virus
WO2014177460A1 (en) 2013-04-29 2014-11-06 F. Hoffmann-La Roche Ag Human fcrn-binding modified antibodies and methods of use
WO2014177461A1 (en) 2013-04-29 2014-11-06 F. Hoffmann-La Roche Ag Fcrn-binding abolished anti-igf-1r antibodies and their use in the treatment of vascular eye diseases
WO2014188377A2 (en) 2013-05-24 2014-11-27 Nestec S.A. Pathway specific assays for predicting irritable bowel syndrome diagnosis
US8900590B2 (en) 2010-08-12 2014-12-02 Theraclone Sciences, Inc. Anti-hemagglutinin antibody compositions and methods of use thereof
US8916160B2 (en) 2011-02-14 2014-12-23 Theraclone Sciences, Inc. Compositions and methods for the therapy and diagnosis of influenza
WO2015006504A1 (en) 2013-07-09 2015-01-15 Annexon, Inc. Anti-complement factor c1q antibodies and uses thereof
WO2015010100A2 (en) 2013-07-18 2015-01-22 Fabrus, Inc. Humanized antibodies with ultralong complementarity determining regions
WO2015017146A2 (en) 2013-07-18 2015-02-05 Fabrus, Inc. Antibodies with ultralong complementarity determining regions
WO2015023596A1 (en) 2013-08-12 2015-02-19 Genentech, Inc. Compositions and method for treating complement-associated conditions
EP2842968A1 (en) 2005-04-29 2015-03-04 Janssen Biotech, Inc. Anti-IL-6 antibodies, compositions, methods and uses
WO2015031837A1 (en) 2013-08-29 2015-03-05 City Of Hope Cell penetrating conjugates and methods of use thereof
EP2851372A1 (en) 2007-11-30 2015-03-25 Genentech, Inc. Anti-VEGF antibodies
WO2015042108A1 (en) 2013-09-17 2015-03-26 Genentech, Inc. Methods of using anti-lgr5 antibodies
WO2015048520A1 (en) 2013-09-27 2015-04-02 Genentech, Inc. Anti-pdl1 antibody formulations
US8999702B2 (en) 2008-06-11 2015-04-07 Emd Millipore Corporation Stirred tank bioreactor
US9000132B2 (en) 2013-03-15 2015-04-07 Diadexus, Inc. Lipoprotein-associated phospholipase A2 antibody compositions and methods of use
WO2015050959A1 (en) 2013-10-01 2015-04-09 Yale University Anti-kit antibodies and methods of use thereof
WO2015054670A1 (en) 2013-10-11 2015-04-16 Genentech, Inc. Nsp4 inhibitors and methods of use
WO2015058132A2 (en) 2013-10-18 2015-04-23 Genentech, Inc. Anti-rspo antibodies and methods of use
WO2015061441A1 (en) 2013-10-23 2015-04-30 Genentech, Inc. Methods of diagnosing and treating eosinophilic disorders
WO2015069459A1 (en) 2013-11-05 2015-05-14 Novartis Ag Organic compounds
WO2015075011A1 (en) 2013-11-21 2015-05-28 F. Hoffmann-La Roche Ag ANTI-alpha-SYNUCLEIN ANTIBODIES AND METHODS OF USE
US9045541B2 (en) 2012-02-06 2015-06-02 Inhibrx Llc CD47 antibodies and methods of use thereof
WO2015084625A1 (en) 2013-12-02 2015-06-11 Baylor College Of Medicine Identification of a new polypeptide hormone for maintenance of optimal body weight and blood glucose
WO2015089117A1 (en) 2013-12-09 2015-06-18 Allakos Inc. Anti-siglec-8 antibodies and methods of use thereof
WO2015089344A1 (en) 2013-12-13 2015-06-18 Genentech, Inc. Anti-cd33 antibodies and immunoconjugates
WO2015091656A1 (en) 2013-12-20 2015-06-25 F. Hoffmann-La Roche Ag HUMANIZED ANTI-Tau(pS422) ANTIBODIES AND METHODS OF USE
WO2015095423A2 (en) 2013-12-17 2015-06-25 Genentech, Inc. Combination therapy comprising ox40 binding agonists and pd-1 axis binding antagonists
WO2015095410A1 (en) 2013-12-17 2015-06-25 Genentech, Inc. Methods of treating cancer using pd-1 axis binding antagonists and an anti-cd20 antibody
WO2015095418A1 (en) 2013-12-17 2015-06-25 Genentech, Inc. Methods of treating her2-positive cancers using pd-1 axis binding antagonists and anti-her2 antibodies
WO2015095953A1 (en) 2013-12-27 2015-07-02 The Centre For Drug Research And Development Sulfonamide-containing linkage systems for drug conjugates
WO2015097536A2 (en) 2013-12-24 2015-07-02 Janssen Pharmaceutical Nv Anti-vista antibodies and fragments
US9073984B2 (en) 2007-12-27 2015-07-07 Abbott Laboratories Anti-T. cruzi antibodies and methods of use
WO2015101586A1 (en) 2014-01-03 2015-07-09 F. Hoffmann-La Roche Ag Bispecific anti-hapten/anti-blood brain barrier receptor antibodies, complexes thereof and their use as blood brain barrier shuttles
WO2015101587A1 (en) 2014-01-03 2015-07-09 F. Hoffmann-La Roche Ag Covalently linked helicar-anti-helicar antibody conjugates and uses thereof
WO2015101588A1 (en) 2014-01-06 2015-07-09 F. Hoffmann-La Roche Ag Monovalent blood brain barrier shuttle modules
WO2015101589A1 (en) 2014-01-03 2015-07-09 F. Hoffmann-La Roche Ag Covalently linked polypeptide toxin-antibody conjugates
WO2015109180A2 (en) 2014-01-16 2015-07-23 Academia Sinica Compositions and methods for treatment and detection of cancers
WO2015107026A1 (en) 2014-01-15 2015-07-23 F. Hoffmann-La Roche Ag Fc-region variants with modified fcrn- and maintained protein a-binding properties
US9090930B2 (en) 2006-06-27 2015-07-28 Emd Millipore Corporation Method and unit for preparing a sample for the microbiological analysis of a liquid
WO2015112909A1 (en) 2014-01-24 2015-07-30 Genentech, Inc. Methods of using anti-steap1 antibodies and immunoconjugates
WO2015120233A1 (en) 2014-02-08 2015-08-13 Genentech, Inc. Methods of treating alzheimer's disease
WO2015120280A1 (en) 2014-02-08 2015-08-13 Genentech, Inc. Methods of treating alzheimer's disease
WO2015120075A2 (en) 2014-02-04 2015-08-13 Genentech, Inc. Mutant smoothened and methods of using the same
WO2015127405A2 (en) 2014-02-21 2015-08-27 Genentech, Inc. Anti-il-13/il-17 bispecific antibodies and uses thereof
WO2015124588A1 (en) 2014-02-18 2015-08-27 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and pharmaceutical compositions for the treatment of diseases mediated by the nrp-1/obr complex signaling pathway
WO2015131155A1 (en) 2014-02-28 2015-09-03 Allakos Inc. Methods and compositions for treating siglec-8 associated diseases
US9133524B2 (en) 2010-07-01 2015-09-15 The Regents Of The University Of California Protein kinase ck2 gene mutations, amplifications and polymorphisms in human cancers and methods of use
WO2015139046A1 (en) 2014-03-14 2015-09-17 Genentech, Inc. Methods and compositions for secretion of heterologous polypeptides
WO2015140591A1 (en) 2014-03-21 2015-09-24 Nordlandssykehuset Hf Anti-cd14 antibodies and uses thereof
WO2015148984A2 (en) 2014-03-27 2015-10-01 Ruiyi Inc. Antibodies that bind human cannabinoid 1 (cb1) receptor
WO2015147915A1 (en) 2013-03-24 2015-10-01 Development Center For Biotechnology Methods for suppressing cancer by inhibition of tmcc3
WO2015148809A1 (en) 2014-03-27 2015-10-01 Genentech, Inc. Methods for diagnosing and treating inflammatory bowel disease
WO2015148531A1 (en) 2014-03-24 2015-10-01 Genentech, Inc. Cancer treatment with c-met antagonists and correlation of the latter with hgf expression
EP2926830A2 (en) 2010-08-31 2015-10-07 Theraclone Sciences, Inc. Human immunodeficiency virus (HIV)-neutralizing antibodies
WO2015150446A1 (en) 2014-04-02 2015-10-08 F. Hoffmann-La Roche Ag Method for detecting multispecific antibody light chain mispairing
WO2015153513A1 (en) 2014-03-31 2015-10-08 Genentech, Inc. Anti-ox40 antibodies and methods of use
WO2015153514A1 (en) 2014-03-31 2015-10-08 Genentech, Inc. Combination therapy comprising anti-angiogenesis agents and ox40 binding agonists
WO2015161267A2 (en) 2014-04-18 2015-10-22 The Board Of Trustees Of The Leland Stanford Junior University Humanized and chimeric monoclonal antibodies to cd99
WO2015164615A1 (en) 2014-04-24 2015-10-29 University Of Oslo Anti-gluten antibodies and uses thereof
WO2015175375A1 (en) 2014-05-13 2015-11-19 Short Jay M Conditionally active biological proteins
WO2015179835A2 (en) 2014-05-23 2015-11-26 Genentech, Inc. Mit biomarkers and methods using the same
WO2015179658A2 (en) 2014-05-22 2015-11-26 Genentech, Inc. Anti-gpc3 antibodies and immunoconjugates
WO2015191715A1 (en) 2014-06-11 2015-12-17 Genentech, Inc. Anti-lgr5 antibodies and uses thereof
WO2015191986A1 (en) 2014-06-13 2015-12-17 Genentech, Inc. Methods of treating and preventing cancer drug resistance
WO2015195835A2 (en) 2014-06-17 2015-12-23 The Regents Of The University Of California Improved alpha-v beta-8 antibodies
WO2015195917A1 (en) 2014-06-18 2015-12-23 Mersana Therapeutics, Inc. Monoclonal antibodies against her2 epitope and methods of use thereof
EP2962697A1 (en) 2006-11-27 2016-01-06 diaDexus, Inc. Ovr110 antibody compositions and methods of use
WO2016001140A1 (en) 2014-06-30 2016-01-07 Affiris Ag Vaccines and monoclonal antibodies targeting truncated variants of osteopontin and uses thereof
WO2016007775A1 (en) 2014-07-11 2016-01-14 Genentech, Inc. Notch pathway inhibition
WO2016007235A1 (en) 2014-07-11 2016-01-14 Genentech, Inc. Anti-pd-l1 antibodies and diagnostic uses thereof
EP2975048A2 (en) 2008-04-23 2016-01-20 UCB Biopharma SPRL Epitopes of il-17a and il-17f and antibodies specific thereto
EP2980100A1 (en) 2007-06-08 2016-02-03 Australian Poultry CRC Pty Ltd Clostridial toxin netb
US9266961B2 (en) 2012-06-15 2016-02-23 Genentech, Inc. Anti-PCSK9 antibodies, formulations, dosing, and methods of use
US9267112B2 (en) 2011-05-10 2016-02-23 The Regents Of The University Of California Adenovirus isolated from Titi Monkeys
WO2016029079A2 (en) 2014-08-21 2016-02-25 Walter Reed Army Institute Of Research Department Of The Army Monoclonal antibodies for treatment of microbial infections
WO2016033331A1 (en) 2014-08-28 2016-03-03 Bioatla, Llc Conditionally active chimeric antigen receptors for modified t-cells
US9278131B2 (en) 2012-08-10 2016-03-08 Adocia Process for lowering the viscosity of highly concentrated protein solutions
US9286673B2 (en) 2012-10-05 2016-03-15 Volcano Corporation Systems for correcting distortions in a medical image and methods of use thereof
WO2016040868A1 (en) 2014-09-12 2016-03-17 Genentech, Inc. Anti-cll-1 antibodies and immunoconjugates
WO2016040856A2 (en) 2014-09-12 2016-03-17 Genentech, Inc. Cysteine engineered antibodies and conjugates
US9292918B2 (en) 2012-10-05 2016-03-22 Volcano Corporation Methods and systems for transforming luminal images
WO2016044396A1 (en) 2014-09-17 2016-03-24 Genentech, Inc. Immunoconjugates comprising anti-her2 antibodies and pyrrolobenzodiazepines
WO2016041082A1 (en) 2014-09-17 2016-03-24 CDRD Ventures, Inc. Cytotoxic and anti-mitotic compounds, and methods of using the same
US9301687B2 (en) 2013-03-13 2016-04-05 Volcano Corporation System and method for OCT depth calibration
US9307926B2 (en) 2012-10-05 2016-04-12 Volcano Corporation Automatic stent detection
WO2016059602A2 (en) 2014-10-16 2016-04-21 Glaxo Group Limited Methods of treating cancer and related compositions
WO2016061389A2 (en) 2014-10-16 2016-04-21 Genentech, Inc. Anti-alpha-synuclein antibodies and methods of use
US9324141B2 (en) 2012-10-05 2016-04-26 Volcano Corporation Removal of A-scan streaking artifact
EP3011970A2 (en) 2009-10-22 2016-04-27 F. Hoffmann-La Roche AG Modulation of axon degeneration
WO2016073157A1 (en) 2014-11-06 2016-05-12 Genentech, Inc. Anti-ang2 antibodies and methods of use thereof
WO2016073791A1 (en) 2014-11-05 2016-05-12 Genentech, Inc. Methods of producing two chain proteins in bacteria
WO2016073685A1 (en) 2014-11-05 2016-05-12 Annexon, Inc. Humanized anti-complement factor c1q antibodies and uses thereof
WO2016073794A1 (en) 2014-11-05 2016-05-12 Genentech, Inc. Methods of producing two chain proteins in bacteria
WO2016073378A1 (en) 2014-11-03 2016-05-12 Genentech, Inc. Assays for detecting t cell immune subsets and methods of use thereof
WO2016077369A1 (en) 2014-11-10 2016-05-19 Genentech, Inc. Animal model for nephropathy and agents for treating the same
WO2016077381A1 (en) 2014-11-10 2016-05-19 Genentech, Inc. Anti-interleukin-33 antibodies and uses thereof
WO2016081643A1 (en) 2014-11-19 2016-05-26 Genentech, Inc. Anti-transferrin receptor antibodies and methods of use
WO2016081639A1 (en) 2014-11-19 2016-05-26 Genentech, Inc. Antibodies against bace1 and use thereof for neural disease immunotherapy
WO2016079708A1 (en) 2014-11-19 2016-05-26 Nestec S.A. Antibodies against serotonin, tryptophan and kynurenine metabolites and uses thereof
WO2016081640A1 (en) 2014-11-19 2016-05-26 Genentech, Inc. Anti-transferrin receptor / anti-bace1 multispecific antibodies and methods of use
WO2016081384A1 (en) 2014-11-17 2016-05-26 Genentech, Inc. Combination therapy comprising ox40 binding agonists and pd-1 axis binding antagonists
US9360630B2 (en) 2011-08-31 2016-06-07 Volcano Corporation Optical-electrical rotary joint and methods of use
WO2016090210A1 (en) 2014-12-05 2016-06-09 Genentech, Inc. ANTI-CD79b ANTIBODIES AND METHODS OF USE
WO2016087514A1 (en) 2014-12-02 2016-06-09 Cemm - Forschungszentrum Für Molekulare Medizin Gmbh Anti-mutant calreticulin antibodies and their use in the diagnosis and therapy of myeloid malignancies
US9367965B2 (en) 2012-10-05 2016-06-14 Volcano Corporation Systems and methods for generating images of tissue
WO2016094566A2 (en) 2014-12-10 2016-06-16 Genentech, Inc. Blood brain barrier receptor antibodies and methods of use
WO2016098356A1 (en) 2014-12-19 2016-06-23 Chugai Seiyaku Kabushiki Kaisha Anti-c5 antibodies and methods of use
US9376464B2 (en) 2006-12-21 2016-06-28 Emd Millipore Corporation Purification of proteins
US9383263B2 (en) 2012-12-21 2016-07-05 Volcano Corporation Systems and methods for narrowing a wavelength emission of light
EP3043181A1 (en) 2008-01-15 2016-07-13 The Board of Trustees of The Leland Stanford Junior University Markers of acute myeloid leukemia stem cells
WO2016115275A1 (en) 2015-01-13 2016-07-21 City Of Hope Ctla4-binding protein peptide-linker masks
WO2016114819A1 (en) 2015-01-16 2016-07-21 Academia Sinica Compositions and methods for treatment and detection of cancers
WO2016118961A1 (en) 2015-01-24 2016-07-28 Academia Sinica Cancer markers and methods of use thereof
WO2016117346A1 (en) 2015-01-22 2016-07-28 Chugai Seiyaku Kabushiki Kaisha A combination of two or more anti-c5 antibodies and methods of use
US9403855B2 (en) 2010-05-10 2016-08-02 Academia Sinica Zanamivir phosphonate congeners with anti-influenza activity and determining oseltamivir susceptibility of influenza viruses
WO2016123593A1 (en) 2015-01-30 2016-08-04 Academia Sinica Compositions and methods relating to universal glycoforms for enhanced antibody efficacy
WO2016123329A2 (en) 2015-01-28 2016-08-04 Genentech, Inc. Gene expression markers and treatment of multiple sclerosis
WO2016126972A1 (en) 2015-02-04 2016-08-11 Genentech, Inc. Mutant smoothened and methods of using the same
WO2016125495A1 (en) 2015-02-05 2016-08-11 Chugai Seiyaku Kabushiki Kaisha Antibodies comprising an ion concentration dependent antigen-binding domain, fc region variants, il-8-binding antibodies, and uses therof
WO2016138207A1 (en) 2015-02-26 2016-09-01 Genentech, Inc. Integrin beta7 antagonists and methods of treating crohn's disease
US9441035B2 (en) 2013-03-15 2016-09-13 Genentech, Inc. Cell culture media and methods of antibody production
WO2016144824A1 (en) 2015-03-06 2016-09-15 Genentech, Inc. Ultrapurified dsba and dsbc and methods of making and using the same
WO2016149276A1 (en) 2015-03-16 2016-09-22 Genentech, Inc. Methods of detecting and quantifying il-13 and uses in diagnosing and treating th2-associated diseases
WO2016146833A1 (en) 2015-03-19 2016-09-22 F. Hoffmann-La Roche Ag Biomarkers for nad(+)-diphthamide adp ribosyltransferase resistance
KR20160116056A (en) 2008-08-14 2016-10-06 테바 파마슈티컬즈 오스트레일리아 피티와이 엘티디 Anti-il-12/il-23 antibodies
US9465029B2 (en) 2004-04-16 2016-10-11 Glaxo Group Limited Methods for detecting LP-PLA2 activity and inhibition of LP-PLA2 activity
WO2016164480A1 (en) 2015-04-07 2016-10-13 Genentech, Inc. Antigen binding complex having agonistic activity and methods of use
WO2016164497A1 (en) 2015-04-06 2016-10-13 Acceleron Pharma Inc. Alk4:actriib heteromultimers and uses thereof
WO2016164503A1 (en) 2015-04-06 2016-10-13 Acceleron Pharma Inc. Alk7:actriib heteromultimers and uses thereof
WO2016166348A1 (en) 2015-04-17 2016-10-20 Elsalys Biotech Anti-tyro3 antibodies and uses thereof
US9478940B2 (en) 2012-10-05 2016-10-25 Volcano Corporation Systems and methods for amplifying light
WO2016172551A2 (en) 2015-04-24 2016-10-27 Genentech, Inc. Methods of identifying bacteria comprising binding polypeptides
US9486143B2 (en) 2012-12-21 2016-11-08 Volcano Corporation Intravascular forward imaging device
US9499634B2 (en) 2012-06-25 2016-11-22 Zymeworks Inc. Process and methods for efficient manufacturing of highly pure asymmetric antibodies in mammalian cells
EP3095463A2 (en) 2008-09-16 2016-11-23 F. Hoffmann-La Roche AG Methods for treating progressive multiple sclerosis
EP3095793A1 (en) 2003-07-28 2016-11-23 Genentech, Inc. Reducing protein a leaching during protein a affinity chromatography
WO2016187158A1 (en) 2015-05-15 2016-11-24 City Of Hope Chimeric antigen receptor compositions
WO2016191750A1 (en) 2015-05-28 2016-12-01 Genentech, Inc. Cell-based assay for detecting anti-cd3 homodimers
WO2016189091A1 (en) 2015-05-26 2016-12-01 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and pharmaceutical compositions (ntsr1 inhibitors) for the treatment of hepatocellular carcinomas
WO2016189045A1 (en) 2015-05-27 2016-12-01 Ucb Biopharma Sprl Method for the treatment of neurological disease
WO2016189118A1 (en) 2015-05-28 2016-12-01 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods of prognosis and treatment of patients suffering from acute myeloid leukemia
WO2016196298A1 (en) 2015-05-29 2016-12-08 Genentech, Inc. Therapeutic and diagnolstic methods for cancer
WO2016196381A1 (en) 2015-05-29 2016-12-08 Genentech, Inc. Pd-l1 promoter methylation in cancer
WO2016196343A1 (en) 2015-05-29 2016-12-08 Genentech, Inc. Humanized anti-ebola virus glycoprotein antibodies and methods of use
WO2016196679A1 (en) 2015-06-02 2016-12-08 Genentech, Inc. Compositions and methods for using anti-il-34 antibodies to treat neurological diseases
WO2016196726A1 (en) 2015-06-05 2016-12-08 Genentech, Inc. Anti-tau antibodies and methods of use
WO2016200836A1 (en) 2015-06-08 2016-12-15 Genentech, Inc. Methods of treating cancer using anti-ox40 antibodies
WO2016201389A2 (en) 2015-06-12 2016-12-15 Alector Llc Anti-cd33 antibodies and methods of use thereof
WO2016200835A1 (en) 2015-06-08 2016-12-15 Genentech, Inc. Methods of treating cancer using anti-ox40 antibodies and pd-1 axis binding antagonists
WO2016201388A2 (en) 2015-06-12 2016-12-15 Alector Llc Anti-cd33 antibodies and methods of use thereof
WO2016205531A2 (en) 2015-06-17 2016-12-22 Genentech, Inc. Anti-her2 antibodies and methods of use
WO2016205320A1 (en) 2015-06-17 2016-12-22 Genentech, Inc. Methods of treating locally advanced or metastatic breast cancers using pd-1 axis binding antagonists and taxanes
WO2016204966A1 (en) 2015-06-16 2016-12-22 Genentech, Inc. Anti-cd3 antibodies and methods of use
WO2016205176A1 (en) 2015-06-15 2016-12-22 Genentech, Inc. Antibodies and immunoconjugates
WO2016205520A1 (en) 2015-06-16 2016-12-22 Genentech, Inc. Humanized and affinity matured antibodies to fcrh5 and methods of use
WO2016205200A1 (en) 2015-06-16 2016-12-22 Genentech, Inc. Anti-cll-1 antibodies and methods of use
WO2016207124A1 (en) 2015-06-25 2016-12-29 F. Hoffmann-La Roche Ag Cell based assay for determining antibody or ligand binding and function
WO2016207717A1 (en) 2015-06-24 2016-12-29 Janssen Pharmaceutica Nv Anti-vista antibodies and fragments
EP3112468A1 (en) 1998-05-15 2017-01-04 Genentech, Inc. Il-17 homologous polypeptides and therapeutic uses thereof
WO2017004091A1 (en) 2015-06-29 2017-01-05 Genentech, Inc. Type ii anti-cd20 antibody for use in organ transplantation
US9540674B2 (en) 2006-03-31 2017-01-10 Dana-Farber Cancer Institute, Inc. Methods of determining cellular chemosensitivity
US9547009B2 (en) 2012-08-21 2017-01-17 Academia Sinica Benzocyclooctyne compounds and uses thereof
US9562099B2 (en) 2013-03-14 2017-02-07 Genentech, Inc. Anti-B7-H4 antibodies and immunoconjugates
US9562097B2 (en) 2011-07-01 2017-02-07 Genentech, Inc. Use of anti-CD83 agonist antibodies for treating autoimmune diseases
WO2017024238A1 (en) 2015-08-06 2017-02-09 City Of Hope Cell penetrating protein-antibody conjugates and methods of use
EP3130349A1 (en) 2004-06-04 2017-02-15 Genentech, Inc. Method for treating multiple sclerosis
US9574010B2 (en) 2011-11-04 2017-02-21 Zymeworks Inc. Stable heterodimeric antibody design with mutations in the Fc domain
WO2017041004A1 (en) 2015-09-02 2017-03-09 The Regents Of The University Of Colorado, A Body Corporate Compositions and methods for modulating t-cell mediated immune response
WO2017040195A1 (en) 2015-08-28 2017-03-09 The Trustees Of The University Of Pennsylvania Methods and compositions for cells expressing a chimeric intracellular signaling molecule
WO2017040301A1 (en) 2015-08-28 2017-03-09 Alector Llc Anti-siglec-7 antibodies and methods of use thereof
US9592289B2 (en) 2012-03-26 2017-03-14 Sanofi Stable IgG4 based binding agent formulations
US9596993B2 (en) 2007-07-12 2017-03-21 Volcano Corporation Automatic calibration systems and methods of use
WO2017046994A1 (en) 2015-09-18 2017-03-23 Chugai Seiyaku Kabushiki Kaisha Il-8-binding antibodies and uses thereof
WO2017053906A1 (en) 2015-09-24 2017-03-30 Abvitro Llc Hiv antibody compositions and methods of use
WO2017050729A1 (en) 2015-09-22 2017-03-30 Spring Bioscience Corporation Anti-ox40 antibodies and diagnostic uses thereof
WO2017053807A2 (en) 2015-09-23 2017-03-30 Genentech, Inc. Optimized variants of anti-vegf antibodies
US9612105B2 (en) 2012-12-21 2017-04-04 Volcano Corporation Polarization sensitive optical coherence tomography system
WO2017059289A1 (en) 2015-10-02 2017-04-06 Genentech, Inc. Pyrrolobenzodiazepine antibody drug conjugates and methods of use
WO2017055443A1 (en) 2015-10-02 2017-04-06 F. Hoffmann-La Roche Ag Anti-pd1 antibodies and methods of use
WO2017055399A1 (en) 2015-10-02 2017-04-06 F. Hoffmann-La Roche Ag Cellular based fret assay for the determination of simultaneous binding
WO2017058771A1 (en) 2015-09-30 2017-04-06 Bird Rock Bio, Inc. Antibodies that bind human cannabinoid 1 (cb1) recetor
WO2017062672A2 (en) 2015-10-06 2017-04-13 Alector Llc Anti-trem2 antibodies and methods of use thereof
WO2017062682A2 (en) 2015-10-06 2017-04-13 Genentech, Inc. Method for treating multiple sclerosis
US9622706B2 (en) 2007-07-12 2017-04-18 Volcano Corporation Catheter for in vivo imaging
WO2017064034A1 (en) 2015-10-12 2017-04-20 INSERM (Institut National de la Santé et de la Recherche Médicale) An agent capable of depleting cd8 t cells for the treatment of myocardial infarction or acute myocardial infarction
WO2017064675A1 (en) 2015-10-16 2017-04-20 Genentech, Inc. Hindered disulfide drug conjugates
WO2017068511A1 (en) 2015-10-20 2017-04-27 Genentech, Inc. Calicheamicin-antibody-drug conjugates and methods of use
WO2017072210A1 (en) 2015-10-29 2017-05-04 F. Hoffmann-La Roche Ag Anti-variant fc-region antibodies and methods of use
WO2017075173A2 (en) 2015-10-30 2017-05-04 Genentech, Inc. Anti-factor d antibodies and conjugates
WO2017075432A2 (en) 2015-10-29 2017-05-04 Alector Llc Anti-siglec-9 antibodies and methods of use thereof
EP3165532A2 (en) 2015-11-03 2017-05-10 Industrial Technology Research Institute Auristatin derivatives, linker-drugs and ligand-drug conjugates
WO2017079768A1 (en) 2015-11-08 2017-05-11 Genentech, Inc. Methods of screening for multispecific antibodies
WO2017088734A1 (en) 2015-11-23 2017-06-01 四川科伦博泰生物医药股份有限公司 Anti-erbb2 antibody-drug conjugate and composition thereof, preparation method therefor, and application thereof
EP3176185A1 (en) 2013-11-04 2017-06-07 Glenmark Pharmaceuticals S.A. Production of t cell retargeting hetero-dimeric immunoglobulins
EP3178848A1 (en) 2015-12-09 2017-06-14 F. Hoffmann-La Roche AG Type ii anti-cd20 antibody for reducing formation of anti-drug antibodies
WO2017100714A1 (en) 2015-12-10 2017-06-15 City Of Hope Cell penetrating cyanine-coupled antibodies
US9684000B2 (en) 2010-12-16 2017-06-20 Genentech, Inc. Diagnosis and treatments relating to TH2 inhibition
WO2017104779A1 (en) 2015-12-18 2017-06-22 Chugai Seiyaku Kabushiki Kaisha Anti-c5 antibodies and methods of use
EP3184547A1 (en) 2015-10-29 2017-06-28 F. Hoffmann-La Roche AG Anti-tpbg antibodies and methods of use
WO2017112917A1 (en) 2015-12-24 2017-06-29 Corvus Pharmaceuticals, Inc. Methods of treating cancer
US9695233B2 (en) 2012-07-13 2017-07-04 Roche Glycart Ag Bispecific anti-VEGF/anti-ANG-2 antibodies and their use in the treatment of ocular vascular diseases
WO2017117311A1 (en) 2015-12-30 2017-07-06 Genentech, Inc. Formulations with reduced degradation of polysorbate
WO2017117304A1 (en) 2015-12-30 2017-07-06 Genentech, Inc. Use of tryptophan derivatives for protein formulations
EP3189831A1 (en) 2007-11-30 2017-07-12 AbbVie Biotechnology Ltd Protein formulations and methods of making same
US9708410B2 (en) 2003-05-30 2017-07-18 Janssen Biotech, Inc. Anti-tissue factor antibodies and compositions
US9709379B2 (en) 2012-12-20 2017-07-18 Volcano Corporation Optical coherence tomography system that is reconfigurable between different imaging modes
WO2017122098A2 (en) 2016-01-10 2017-07-20 Neotx Therapeutics Ltd. Methods and compositions for enhancing the potency of superantigen mediated cancer immunotherapy.
WO2017127764A1 (en) 2016-01-20 2017-07-27 Genentech, Inc. High dose treatments for alzheimer's disease
WO2017132279A1 (en) 2016-01-25 2017-08-03 Genentech, Inc. Methods for assaying t-cell dependent bispecific antibodies
WO2017136558A1 (en) 2016-02-04 2017-08-10 Curis, Inc. Mutant smoothened and methods of using the same
US9730613B2 (en) 2012-12-20 2017-08-15 Volcano Corporation Locating intravascular images
WO2017137830A1 (en) 2016-02-12 2017-08-17 Janssen Pharmaceutica Nv Anti-vista (b7h5) antibodies
EP3208612A1 (en) 2008-04-09 2017-08-23 Genentech, Inc. Compositions and methods for the treatment of immune related diseases
EP3211008A1 (en) 2008-08-29 2017-08-30 F. Hoffmann-La Roche AG Cross-reactive and bispecific anti-il-17a/f antibodies
WO2017152102A2 (en) 2016-03-04 2017-09-08 Alector Llc Anti-trem1 antibodies and methods of use thereof
WO2017151502A1 (en) 2016-02-29 2017-09-08 Genentech, Inc. Therapeutic and diagnostic methods for cancer
US9759726B2 (en) 2014-03-27 2017-09-12 Academia Sinica Reactive labelling compounds and uses thereof
US9765156B2 (en) 2012-07-13 2017-09-19 The Trustees Of The University Of Pennsylvania Enhancing activity of CAR T cells by co-introducing a bispecific antibody
US9770172B2 (en) 2013-03-07 2017-09-26 Volcano Corporation Multimodal segmentation in intravascular images
WO2017165683A1 (en) 2016-03-23 2017-09-28 Novartis Ag Cell secreted minibodies and uses thereof
WO2017165734A1 (en) 2016-03-25 2017-09-28 Genentech, Inc. Multiplexed total antibody and antibody-conjugated drug quantification assay
WO2017172771A2 (en) 2016-03-29 2017-10-05 Janssen Biotech, Inc. Method of treating psoriasis with increased interval dosing of anti-il12/23 antibody
WO2017173302A2 (en) 2016-04-01 2017-10-05 The Regents Of The University Of California Inhibitors of integrin alpha 5 beta 1 and methods of use
US9782476B2 (en) 2013-09-06 2017-10-10 Academia Sinica Human iNKT cell activation using glycolipids with altered glycosyl groups
WO2017175058A1 (en) 2016-04-07 2017-10-12 Janssen Pharmaceutica Nv Anti-vista antibodies and fragments, uses thereof, and methods of identifying same
WO2017181111A2 (en) 2016-04-15 2017-10-19 Genentech, Inc. Methods for monitoring and treating cancer
WO2017181079A2 (en) 2016-04-15 2017-10-19 Genentech, Inc. Methods for monitoring and treating cancer
WO2017180864A1 (en) 2016-04-14 2017-10-19 Genentech, Inc. Anti-rspo3 antibodies and methods of use
US9803165B2 (en) 2008-12-16 2017-10-31 Emd Millipore Corporation Stirred tank reactor and method
US9810670B2 (en) 2012-11-15 2017-11-07 Genentech, Inc. Ionic strength-mediated pH gradient ion exchange chromatography
WO2017191101A1 (en) 2016-05-02 2017-11-09 F. Hoffmann-La Roche Ag The contorsbody - a single chain target binder
US9816981B2 (en) 2007-03-23 2017-11-14 Academia Sinica Alkynyl sugar analogs for labeling and visualization of glycoconjugates in cells
WO2017197234A1 (en) 2016-05-13 2017-11-16 Bioatla, Llc Anti-ror2 antibodies, antibody fragments, their immunoconjugates and uses thereof
WO2017194441A1 (en) 2016-05-11 2017-11-16 F. Hoffmann-La Roche Ag Modified anti-tenascin antibodies and methods of use
WO2017201036A1 (en) 2016-05-17 2017-11-23 Genentech, Inc. Stromal gene signatures for diagnosis and use in immunotherapy
WO2017201449A1 (en) 2016-05-20 2017-11-23 Genentech, Inc. Protac antibody conjugates and methods of use
WO2017205741A1 (en) 2016-05-27 2017-11-30 Genentech, Inc. Bioanalytical method for the characterization of site-specific antibody-drug conjugates
EP3252078A1 (en) 2016-06-02 2017-12-06 F. Hoffmann-La Roche AG Type ii anti-cd20 antibody and anti-cd20/cd3 bispecific antibody for treatment of cancer
WO2017214024A1 (en) 2016-06-06 2017-12-14 Genentech, Inc. Silvestrol antibody-drug conjugates and methods of use
WO2017218977A2 (en) 2016-06-17 2017-12-21 Genentech, Inc. Purification of multispecific antibodies
EP3260136A1 (en) 2009-03-17 2017-12-27 Theraclone Sciences, Inc. Human immunodeficiency virus (hiv) -neutralizing antibodies
WO2017223405A1 (en) 2016-06-24 2017-12-28 Genentech, Inc. Anti-polyubiquitin multispecific antibodies
US9858668B2 (en) 2012-10-05 2018-01-02 Volcano Corporation Guidewire artifact removal in images
EP3263581A1 (en) 2005-05-17 2018-01-03 University of Connecticut Compositions and methods for immunomodulation in an organism
US9867530B2 (en) 2006-08-14 2018-01-16 Volcano Corporation Telescopic side port catheter device with imaging system and method for accessing side branch occlusions
WO2018011691A1 (en) 2016-07-12 2018-01-18 Nestec S.A. Competitive immunoassay methods
WO2018013936A1 (en) 2016-07-15 2018-01-18 Acceleron Pharma Inc. Compositions and methods for treating pulmonary hypertension
US9873742B2 (en) 2012-10-05 2018-01-23 Genentech, Inc. Methods for diagnosing and treating inflammatory bowel disease
US9873748B2 (en) 2013-12-23 2018-01-23 Genentech, Inc. Bispecific antibodies binding to beta-klotho and fibroblast growth factor receptor 1
US9879042B2 (en) 2014-09-08 2018-01-30 Academia Sinica Human iNKT cell activation using glycolipids
WO2018022762A1 (en) 2016-07-27 2018-02-01 Acceleron Pharma Inc. Methods and compositions for treating myelofibrosis
WO2018021450A1 (en) 2016-07-29 2018-02-01 中外製薬株式会社 Bispecific antibody exhibiting increased alternative fviii-cofactor-function activity
WO2018027204A1 (en) 2016-08-05 2018-02-08 Genentech, Inc. Multivalent and multiepitopic anitibodies having agonistic activity and methods of use
WO2018029124A1 (en) 2016-08-08 2018-02-15 F. Hoffmann-La Roche Ag Therapeutic and diagnostic methods for cancer
WO2018031662A1 (en) 2016-08-11 2018-02-15 Genentech, Inc. Pyrrolobenzodiazepine prodrugs and antibody conjugates thereof
WO2018035025A1 (en) 2016-08-15 2018-02-22 Genentech, Inc. Chromatography method for quantifying a non-ionic surfactant in a composition comprising the non-ionic surfactant and a polypeptide
WO2018038046A1 (en) 2016-08-22 2018-03-01 中外製薬株式会社 Gene-modified non-human animal expressing human gpc3 polypeptide
WO2018045379A1 (en) 2016-09-02 2018-03-08 Dana-Farber Cancer Institute, Inc. Composition and methods of treating b cell disorders
US9914956B2 (en) 2012-08-18 2018-03-13 Academia Sinica Cell-permeable probes for identification and imaging of sialidases
US9914785B2 (en) 2012-11-28 2018-03-13 Zymeworks Inc. Engineered immunoglobulin heavy chain-light chain pairs and uses thereof
WO2018049261A1 (en) 2016-09-09 2018-03-15 Icellhealth Consulting Llc Oncolytic virus expressing immune checkpoint modulators
WO2018050878A1 (en) 2016-09-19 2018-03-22 F. Hoffmann-La Roche Ag Complement factor based affinity chromatography
WO2018057849A1 (en) 2016-09-23 2018-03-29 Genentech, Inc. Uses of il-13 antagonists for treating atopic dermatitis
WO2018060035A1 (en) 2016-09-30 2018-04-05 F. Hoffmann-La Roche Ag Spr-based dual-binding assay for the functional analysis of multispecific molecules
WO2018064478A1 (en) 2016-09-29 2018-04-05 The Regents Of The University Of California NEUTRALIZING ANTIBODIES TO THE αVβ8 INTEGRIN COMPLEX FOR IMMUNOTHERAPY
WO2018060462A1 (en) 2016-09-29 2018-04-05 Nascient Ltd Tenascin epitope and antibodies thereto
WO2018064436A1 (en) 2016-09-30 2018-04-05 Janssen Biotech, Inc. Safe and effective method of treating psoriasis with anti-il23 specific antibody
WO2018068028A1 (en) 2016-10-06 2018-04-12 Genentech, Inc. Therapeutic and diagnostic methods for cancer
WO2018065501A1 (en) 2016-10-05 2018-04-12 F. Hoffmann-La Roche Ag Methods for preparing antibody drug conjugates
WO2018081648A2 (en) 2016-10-29 2018-05-03 Genentech, Inc. Anti-mic antibidies and methods of use
WO2018081649A1 (en) 2016-10-28 2018-05-03 Banyan Biomarkers, Inc. Antibodies to ubiquitin c-terminal hydrolase l1 (uch-l1) and glial fibrillary acidic protein (gfap) and related methods
WO2018083535A1 (en) 2016-11-04 2018-05-11 Novimmune Sa Anti-cd19 antibodies and methods of use thereof
WO2018089967A1 (en) 2016-11-14 2018-05-17 Virginia Commonwealth University Inhibitors of cancer invasion, attachment, and/or metastasis
US9975965B2 (en) 2015-01-16 2018-05-22 Academia Sinica Compositions and methods for treatment and detection of cancers
EP3323830A1 (en) 2010-06-19 2018-05-23 Memorial Sloan-Kettering Cancer Center Anti-gd2 antibodies
WO2018093841A1 (en) 2016-11-16 2018-05-24 Janssen Biotech, Inc. Method of treating psoriasis with anti-il-23 specific antibody
WO2018093821A1 (en) 2016-11-15 2018-05-24 Genentech, Inc. Dosing for treatment with anti-cd20/anti-cd3 bispecific antibodies
WO2018094300A1 (en) 2016-11-19 2018-05-24 Potenza Therapeutics, Inc. Anti-gitr antigen-binding proteins and methods of use thereof
WO2018091580A1 (en) 2016-11-18 2018-05-24 F. Hoffmann-La Roche Ag Anti-hla-g antibodies and use thereof
US9981030B2 (en) 2013-06-27 2018-05-29 Academia Sinica Glycan conjugates and use thereof
WO2018098363A2 (en) 2016-11-23 2018-05-31 Bioverativ Therapeutics Inc. Bispecific antibodies binding to coagulation factor ix and coagulation factor x
US9995746B2 (en) 2014-04-02 2018-06-12 The United States Of America, As Represented By The Secretary Of The Army Rapid dual direct fluorescent antibody assay for the identification of Bacillus antrhacis
WO2018106776A2 (en) 2016-12-07 2018-06-14 Genentech, Inc. Anti-tau antibodies and methods of use
WO2018106781A1 (en) 2016-12-07 2018-06-14 Genentech, Inc Anti-tau antibodies and methods of use
WO2018108759A1 (en) 2016-12-13 2018-06-21 F. Hoffmann-La Roche Ag Method to determine the presence of a target antigen in a tumor sample
US10005847B2 (en) 2014-05-27 2018-06-26 Academia Sinica Anti-HER2 glycoantibodies and uses thereof
WO2018114772A1 (en) 2016-12-21 2018-06-28 F. Hoffmann-La Roche Ag Assay for determining antibody or ligand binding and function
WO2018114878A1 (en) 2016-12-21 2018-06-28 F. Hoffmann-La Roche Ag Re-use of enzymes in in vitro glycoengineering of antibodies
WO2018114754A1 (en) 2016-12-19 2018-06-28 F. Hoffmann-La Roche Ag Combination therapy with targeted 4-1bb (cd137) agonists
WO2018114748A1 (en) 2016-12-20 2018-06-28 F. Hoffmann-La Roche Ag Combination therapy of anti-cd20/anti-cd3 bispecific antibodies and 4-1bb (cd137) agonists
WO2018115231A2 (en) 2016-12-22 2018-06-28 Boehringer Ingelheim International Gmbh Binding molecules for the treatment of cancer
WO2018114877A1 (en) 2016-12-21 2018-06-28 F. Hoffmann-La Roche Ag In vitro glycoengineering of antibodies
WO2018114879A1 (en) 2016-12-21 2018-06-28 F. Hoffmann-La Roche Ag Method for in vitro glycoengineering of antibodies
US10011658B2 (en) 2015-04-03 2018-07-03 Eureka Therapeutics, Inc. Constructs targeting AFP peptide/MHC complexes and uses thereof
WO2018129029A1 (en) 2017-01-04 2018-07-12 Immunogen, Inc. Met antibodies and immunoconjugates and uses thereof
US10023892B2 (en) 2014-05-27 2018-07-17 Academia Sinica Compositions and methods relating to universal glycoforms for enhanced antibody efficacy
EP3348277A1 (en) 2009-11-20 2018-07-18 The Regents of The University of California Epithelial membrane protein-2 (emp2) and proliferative vitreoretinopathy (pvr)
EP3360567A1 (en) 2007-11-07 2018-08-15 Genentech, Inc. Amp for use in treating microbial disorders
WO2018148585A1 (en) 2017-02-10 2018-08-16 Genentech, Inc. Anti-tryptase antibodies, compositions thereof, and uses thereof
WO2018152496A1 (en) 2017-02-17 2018-08-23 The Usa, As Represented By The Secretary, Dept. Of Health And Human Services Compositions and methods for the diagnosis and treatment of zika virus infection
US10058284B2 (en) 2012-12-21 2018-08-28 Volcano Corporation Simultaneous imaging, monitoring, and therapy
US10059768B2 (en) 2014-09-12 2018-08-28 Genentech, Inc. Anti-B7-H4 antibodies and immunoconjugates
WO2018160841A1 (en) 2017-03-01 2018-09-07 Genentech, Inc. Diagnostic and therapeutic methods for cancer
US10070827B2 (en) 2012-10-05 2018-09-11 Volcano Corporation Automatic image playback
US10077304B2 (en) 2013-08-14 2018-09-18 The Governing Council Of The University Of Toronto Antibodies against frizzled receptor
WO2018175788A1 (en) 2017-03-22 2018-09-27 Genentech, Inc. Hydrogel cross-linked hyaluronic acid prodrug compositions and methods
WO2018175752A1 (en) 2017-03-22 2018-09-27 Genentech, Inc. Optimized antibody compositions for treatment of ocular disorders
US10087236B2 (en) 2009-12-02 2018-10-02 Academia Sinica Methods for modifying human antibodies by glycan engineering
US10086054B2 (en) 2013-06-26 2018-10-02 Academia Sinica RM2 antigens and use thereof
US10087255B2 (en) 2015-04-07 2018-10-02 Alector Llc Anti-sortilin antibodies and methods of use thereof
WO2018183175A1 (en) 2017-03-28 2018-10-04 Genentech, Inc. Methods of treating neurodegenerative diseases
WO2018194496A2 (en) 2017-04-17 2018-10-25 Закрытое Акционерное Общество "Биокад" Monoclonal antibody to pd-l1
WO2018195472A1 (en) 2017-04-21 2018-10-25 Genentech, Inc. Use of klk5 antagonists for treatment of a disease
WO2018200742A1 (en) 2017-04-25 2018-11-01 The Usa, As Represented By The Secretary, Dept. Of Health And Human Services Antibodies and methods for the diagnosis and treatment of epstein barr virus infection
US10118969B2 (en) 2014-05-27 2018-11-06 Academia Sinica Compositions and methods relating to universal glycoforms for enhanced antibody efficacy
EP3401335A1 (en) 2008-01-30 2018-11-14 Genentech, Inc. Composition comprising antibody that binds to domain ii of her2 and acidic variants thereof
US10130714B2 (en) 2012-04-14 2018-11-20 Academia Sinica Enhanced anti-influenza agents conjugated with anti-inflammatory activity
US10131658B2 (en) 2013-09-30 2018-11-20 The Regents Of The University Of California Anti-alphavbeta1 integrin compounds and methods
US10132797B2 (en) 2016-12-19 2018-11-20 Tolero Pharmaceuticals, Inc. Profiling peptides and methods for sensitivity profiling
WO2018213316A1 (en) 2017-05-16 2018-11-22 Alector Llc Anti-siglec-5 antibodies and methods of use thereof
WO2018215835A1 (en) 2017-05-26 2018-11-29 Novimmune Sa Anti-cd47 x anti-mesothelin antibodies and methods of use thereof
WO2018215535A1 (en) 2017-05-23 2018-11-29 Helmholtz Zentrum München - Deutsches Forschungszentrum für Gesundheit und Umwelt (GmbH) Novel cd73 antibody, preparation and uses thereof
WO2018220099A1 (en) 2017-06-02 2018-12-06 F. Hoffmann-La Roche Ag Type ii anti-cd20 antibody and anti-cd20/cd3 bispecific antibody for treatment of cancer
US10150818B2 (en) 2014-01-16 2018-12-11 Academia Sinica Compositions and methods for treatment and detection of cancers
EP3412309A1 (en) 2011-03-31 2018-12-12 F. Hoffmann-La Roche AG Methods of administering beta7 integrin antagonists
US10166003B2 (en) 2012-12-21 2019-01-01 Volcano Corporation Ultrasound imaging with variable line density
EP3428190A1 (en) 2014-02-12 2019-01-16 F. Hoffmann-La Roche AG Anti-jagged1 antibodies and methods of use
WO2019018629A1 (en) 2017-07-19 2019-01-24 The Usa, As Represented By The Secretary, Dept. Of Health And Human Services Antibodies and methods for the diagnosis and treatment of hepatitis b virus infection
WO2019018757A1 (en) 2017-07-21 2019-01-24 Genentech, Inc. Therapeutic and diagnostic methods for cancer
US10191220B2 (en) 2012-12-21 2019-01-29 Volcano Corporation Power-efficient optical circuit
WO2019023347A1 (en) 2017-07-26 2019-01-31 Forty Seven, Inc. Anti-sirp-alpha antibodies and related methods
WO2019028283A1 (en) 2017-08-03 2019-02-07 Alector Llc Anti-cd33 antibodies and methods of use thereof
WO2019028292A1 (en) 2017-08-03 2019-02-07 Alector Llc Anti-trem2 antibodies and methods of use thereof
US10208349B2 (en) 2011-01-07 2019-02-19 Ucb Biopharma Sprl Lipocalin 2 as a biomarker for IL-17 inhibitor therapy efficacy
US10208120B2 (en) 2014-11-05 2019-02-19 Genentech, Inc. Anti-FGFR2/3 antibodies and methods using same
US10214522B2 (en) 2015-03-10 2019-02-26 The Regents Of The University Of California Anti-alphavbeta1 integrin inhibitors and methods of use
EP3447075A2 (en) 2015-05-15 2019-02-27 The General Hospital Corporation Antagonistic anti-tumor necrosis factor receptor superfamily antibodies
US10219780B2 (en) 2007-07-12 2019-03-05 Volcano Corporation OCT-IVUS catheter for concurrent luminal imaging
US10219887B2 (en) 2013-03-14 2019-03-05 Volcano Corporation Filters with echogenic characteristics
US10221218B2 (en) 2011-05-10 2019-03-05 The Regents Of The University Of California Adenovirus isolated from titi monkeys
EP3450459A2 (en) 2009-12-28 2019-03-06 OncoTherapy Science, Inc. Anti-cdh3 antibodies and uses thereof
US10226597B2 (en) 2013-03-07 2019-03-12 Volcano Corporation Guidewire with centering mechanism
US10233211B2 (en) 2006-12-21 2019-03-19 Emd Millipore Corporation Purification of proteins
US10238367B2 (en) 2012-12-13 2019-03-26 Volcano Corporation Devices, systems, and methods for targeted cannulation
WO2019065795A1 (en) 2017-09-29 2019-04-04 中外製薬株式会社 Multispecific antigen-binding molecule having blood coagulation factor viii (fviii) cofactor function-substituting activity, and pharmaceutical formulation containing said molecule as active ingredient
WO2019067015A1 (en) 2017-09-29 2019-04-04 City Of Hope Chimeric antigen receptors and bispecific antibodies for treatment of mantle cell lymphoma
US10251952B2 (en) 2014-06-26 2019-04-09 Hoffmann-La Roche Inc. Humanized anti-tau(pS422) antibody brain shuttles and use thereof
WO2019070164A1 (en) 2017-10-03 2019-04-11 Закрытое Акционерное Общество "Биокад" MONOCLONAL ANTIBODY TO IL-5Rα
US10259835B2 (en) 2015-05-18 2019-04-16 Tolero Pharmaceuticals, Inc. Alvocidib prodrugs having increased bioavailability
US10274466B2 (en) 2013-07-12 2019-04-30 Genentech, Inc. Elucidation of ion exchange chromatography input optimization
US10274488B2 (en) 2008-07-15 2019-04-30 Academia Sinica Glycan arrays on PTFE-like aluminum coated glass slides and related methods
WO2019086395A1 (en) 2017-11-01 2019-05-09 F. Hoffmann-La Roche Ag Trifab-contorsbody
WO2019086497A2 (en) 2017-11-01 2019-05-09 F. Hoffmann-La Roche Ag Combination therapy with targeted ox40 agonists
WO2019090263A1 (en) 2017-11-06 2019-05-09 Genentech, Inc. Diagnostic and therapeutic methods for cancer
WO2019086331A2 (en) 2017-11-02 2019-05-09 Bayer Aktiengesellschaft Bispecific antibodies binding alk-1 and bmpr-2
US10292677B2 (en) 2013-03-14 2019-05-21 Volcano Corporation Endoluminal filter having enhanced echogenic properties
EP3495814A2 (en) 2013-03-27 2019-06-12 F. Hoffmann-La Roche AG Use of biomarkers for assessing treatment of gastrointestinal inflammatory disorders with beta7 integrin antagonists
US10332228B2 (en) 2012-12-21 2019-06-25 Volcano Corporation System and method for graphical processing of medical data
WO2019122054A1 (en) 2017-12-22 2019-06-27 F. Hoffmann-La Roche Ag Depletion of light chain mispaired antibody variants by hydrophobic interaction chromatography
WO2019125846A1 (en) 2017-12-19 2019-06-27 The Rockefeller University HUMAN IgG Fc DOMAIN VARIANTS WITH IMPROVED EFFECTOR FUNCTION
WO2019126472A1 (en) 2017-12-22 2019-06-27 Genentech, Inc. Use of pilra binding agents for treatment of a disease
US10336784B2 (en) 2016-03-08 2019-07-02 Academia Sinica Methods for modular synthesis of N-glycans and arrays thereof
US10338069B2 (en) 2010-04-12 2019-07-02 Academia Sinica Glycan arrays for high throughput screening of viruses
WO2019133512A1 (en) 2017-12-29 2019-07-04 Alector Llc Anti-tmem106b antibodies and methods of use thereof
WO2019129211A1 (en) 2017-12-28 2019-07-04 Nanjing Legend Biotech Co., Ltd. Antibodies and variants thereof against pd-l1
US10342858B2 (en) 2015-01-24 2019-07-09 Academia Sinica Glycan conjugates and methods of use thereof
EP3511344A1 (en) 2004-12-10 2019-07-17 NovImmune S.A. Neutralizing antibodies and methods of use thereof
US10357488B2 (en) 2015-04-20 2019-07-23 Tolero Pharmaceuticals, Inc. Predicting response to alvocidib by mitochondrial profiling
EP3514174A1 (en) 2015-06-29 2019-07-24 Ventana Medical Systems, Inc. Materials and methods for performing histochemical assays for human pro-epiregulin and amphiregulin
WO2019143636A1 (en) 2018-01-16 2019-07-25 Lakepharma, Inc. Bispecific antibody that binds cd3 and another target
WO2019145475A2 (en) 2018-01-25 2019-08-01 Acm Biolabs Pte Ltd Polymersomes comprising a soluble encapsulated antigen as well as methods of making and uses thereof
US10370455B2 (en) 2014-12-05 2019-08-06 Immunext, Inc. Identification of VSIG8 as the putative VISTA receptor (V-R) and use thereof to produce VISTA/VSIG8 agonists and antagonists
WO2019152715A1 (en) 2018-01-31 2019-08-08 Alector Llc Anti-ms4a4a antibodies and methods of use thereof
EP3524620A1 (en) 2008-10-14 2019-08-14 Genentech, Inc. Immunoglobulin variants and uses thereof
WO2019157358A1 (en) 2018-02-09 2019-08-15 Genentech, Inc. Therapeutic and diagnostic methods for mast cell-mediated inflammatory diseases
US10393733B2 (en) 2012-09-19 2019-08-27 Dana-Farber Cancer Institute, Inc. Dynamic BH3 profiling
US10406197B2 (en) 2014-07-10 2019-09-10 Affiris Ag Substances and methods for the use in prevention and/or treatment in Huntington's disease
WO2019171252A1 (en) 2018-03-05 2019-09-12 Janssen Biotech, Inc. Methods of treating crohn's disease with anti-il23 specific antibody
US10413317B2 (en) 2012-12-21 2019-09-17 Volcano Corporation System and method for catheter steering and operation
US10414814B2 (en) 2014-07-03 2019-09-17 City Of Hope Tumor-selective CTLA-4 antagonists
WO2019178316A1 (en) 2018-03-14 2019-09-19 Genentech, Inc. Anti-klk5 antibodies and methods of use
WO2019175125A1 (en) 2018-03-13 2019-09-19 F. Hoffmann-La Roche Ag Combination therapy with targeted 4-1bb (cd137) agonists
WO2019175071A1 (en) 2018-03-13 2019-09-19 F. Hoffmann-La Roche Ag Therapeutic combination of 4-1 bb agonists with anti-cd20 antibodies
WO2019175658A1 (en) 2018-03-14 2019-09-19 Novimmune Sa Anti-cd3 epsilon antibodies and methods of use thereof
US10420530B2 (en) 2012-12-21 2019-09-24 Volcano Corporation System and method for multipath processing of image signals
US10426590B2 (en) 2013-03-14 2019-10-01 Volcano Corporation Filters with echogenic characteristics
WO2019192432A1 (en) 2018-04-02 2019-10-10 上海博威生物医药有限公司 Lymphocyte activation gene-3 (lag-3) binding antibody and use thereof
WO2019195514A1 (en) 2018-04-04 2019-10-10 Genentech, Inc. Methods for detecting and quantifying fgf21
US10450379B2 (en) 2005-11-15 2019-10-22 Genetech, Inc. Method for treating joint damage
WO2019202040A1 (en) 2018-04-18 2019-10-24 F. Hoffmann-La Roche Ag Anti-hla-g antibodies and use thereof
WO2019213416A1 (en) 2018-05-02 2019-11-07 The Usa, As Represented By The Secretary, Dept. Of Health And Human Services Antibodies and methods for the diagnosis, prevention, and treatment of epstein barr virus infection
WO2019215701A1 (en) 2018-05-11 2019-11-14 Janssen Biotech, Inc. Methods of treating depression using il-23 antibodies
WO2019226973A1 (en) 2018-05-25 2019-11-28 Alector Llc Anti-sirpa antibodies and methods of use thereof
WO2019224385A2 (en) 2018-05-24 2019-11-28 Glenmark Pharmaceuticals S.A. Combined bispecific antibody and immuno-oncology therapies
US10495645B2 (en) 2015-01-16 2019-12-03 Academia Sinica Cancer markers and methods of use thereof
WO2019236965A1 (en) 2018-06-08 2019-12-12 Alector Llc Anti-siglec-7 antibodies and methods of use thereof
WO2019234220A1 (en) 2018-06-09 2019-12-12 Boehringer Ingelheim International Gmbh Dll3-cd3 bispecific antibodies
US10513699B2 (en) 2014-09-03 2019-12-24 Bioatla, Llc Discovering and producing conditionally active biologic proteins in the same eukaryotic cell production hosts
WO2019246557A1 (en) 2018-06-23 2019-12-26 Genentech, Inc. Methods of treating lung cancer with a pd-1 axis binding antagonist, a platinum agent, and a topoisomerase ii inhibitor
WO2020006568A1 (en) 2018-06-29 2020-01-02 City Of Hope Cd6 targeted chimeric antigen receptors for treatent of certain autoimmune disorders
WO2020006374A2 (en) 2018-06-29 2020-01-02 Alector Llc Anti-sirp-beta1 antibodies and methods of use thereof
EP3594240A1 (en) 2013-05-20 2020-01-15 F. Hoffmann-La Roche AG Anti-transferrin receptor antibodies and methods of use
WO2020014306A1 (en) 2018-07-10 2020-01-16 Immunogen, Inc. Met antibodies and immunoconjugates and uses thereof
WO2020014617A1 (en) 2018-07-13 2020-01-16 Alector Llc Anti-sortilin antibodies and methods of use thereof
US10538592B2 (en) 2016-08-22 2020-01-21 Cho Pharma, Inc. Antibodies, binding fragments, and methods of use
WO2020016838A2 (en) 2018-07-18 2020-01-23 Janssen Biotech, Inc. Sustained response predictors after treatment with anti-il23 specific antibody
WO2020018789A1 (en) 2018-07-18 2020-01-23 Genentech, Inc. Methods of treating lung cancer with a pd-1 axis binding antagonist, an antimetabolite, and a platinum agent
WO2020023920A1 (en) 2018-07-27 2020-01-30 Alector Llc Anti-siglec-5 antibodies and methods of use thereof
WO2020027330A1 (en) 2018-08-03 2020-02-06 中外製薬株式会社 Antigen-binding molecule containing two antigen-binding domains that are linked to each other
EP3608674A1 (en) 2018-08-09 2020-02-12 Regeneron Pharmaceuticals, Inc. Methods for assessing binding affinity of an antibody variant to the neonatal fc receptor
WO2020033485A1 (en) 2018-08-08 2020-02-13 Genentech, Inc. Use of tryptophan derivatives and l-methionine for protein formulation
WO2020032230A1 (en) 2018-08-10 2020-02-13 中外製薬株式会社 Anti-cd137 antigen-binding molecule and utilization thereof
EP3611188A1 (en) 2014-11-06 2020-02-19 F. Hoffmann-La Roche AG Fc-region variants with modified fcrn-binding and methods of use
WO2020035577A1 (en) 2018-08-16 2020-02-20 Cantargia Ab Anti-il1rap antibody compositions
WO2020037154A1 (en) 2018-08-17 2020-02-20 23Andme, Inc. Anti-il1rap antibodies and methods of use thereof
US10568586B2 (en) 2012-10-05 2020-02-25 Volcano Corporation Systems for indicating parameters in an imaging data set and methods of use
US10568887B2 (en) 2015-08-03 2020-02-25 Tolero Pharmaceuticals, Inc. Combination therapies for treatment of cancer
EP3613433A1 (en) 2014-05-30 2020-02-26 Henlix Biotech Co., Ltd. Anti-epidermal growth factor receptor (egfr) antibodies
WO2020041541A2 (en) 2018-08-23 2020-02-27 Seattle Genetics, Inc. Anti-tigit antibodies
WO2020041758A1 (en) 2018-08-24 2020-02-27 City Of Hope Masked cytokine conjugates
WO2020047374A1 (en) 2018-08-31 2020-03-05 Alector Llc Anti-cd33 antibodies and methods of use thereof
WO2020049286A1 (en) 2018-09-03 2020-03-12 Femtogenix Limited Polycyclic amides as cytotoxic agents
WO2020053325A1 (en) 2018-09-12 2020-03-19 Acm Biolabs Pte Ltd Polymersomes comprising a covalently bound antigen as well as methods of making and uses thereof
US10595820B2 (en) 2012-12-20 2020-03-24 Philips Image Guided Therapy Corporation Smooth transition catheters
WO2020061381A1 (en) 2018-09-19 2020-03-26 La Jolla Institute For Immunology Ptprs and proteoglycans in rheumatoid arthritis
WO2020061060A1 (en) 2018-09-19 2020-03-26 Genentech, Inc. Therapeutic and diagnostic methods for bladder cancer
WO2020061349A1 (en) 2018-09-21 2020-03-26 Genentech, Inc. Diagnostic methods for triple-negative breast cancer
US10604577B2 (en) 2015-10-22 2020-03-31 Allakos Inc. Methods and compositions for treating systemic mastocytosis
US10604561B2 (en) 2016-09-16 2020-03-31 Chugai Seiyaku Kabushiki Kaisha Anti-dengue virus antibodies, polypeptides containing variant Fc regions, and methods of use
EP3633371A1 (en) 2014-12-18 2020-04-08 F. Hoffmann-La Roche AG Assay and method for determining cdc eliciting antibodies
WO2020081767A1 (en) 2018-10-18 2020-04-23 Genentech, Inc. Diagnostic and therapeutic methods for sarcomatoid kidney cancer
WO2020086858A1 (en) 2018-10-24 2020-04-30 Genentech, Inc. Conjugated chemical inducers of degradation and methods of use
US10638939B2 (en) 2013-03-12 2020-05-05 Philips Image Guided Therapy Corporation Systems and methods for diagnosing coronary microvascular disease
US10640508B2 (en) 2017-10-13 2020-05-05 Massachusetts Institute Of Technology Diazene directed modular synthesis of compounds with quaternary carbon centers
WO2020092455A2 (en) 2018-10-29 2020-05-07 The Broad Institute, Inc. Car t cell transcriptional atlas
WO2020096959A1 (en) 2018-11-05 2020-05-14 Genentech, Inc. Methods of producing two chain proteins in prokaryotic host cells
US10653779B2 (en) 2013-03-13 2020-05-19 Genentech, Inc. Formulations with reduced oxidation
EP3653641A1 (en) 2004-02-19 2020-05-20 Genentech, Inc. Cdr-repaired antibodies
WO2020104943A2 (en) 2018-11-20 2020-05-28 Janssen Biotech, Inc. Safe and effective method of treating psoriasis with anti-il-23 specific antibody
WO2020104496A1 (en) 2018-11-20 2020-05-28 INSERM (Institut National de la Santé et de la Recherche Médicale) Bispecific antibody targeting transferrin receptor 1 and soluble antigen
WO2020117257A1 (en) 2018-12-06 2020-06-11 Genentech, Inc. Combination therapy of diffuse large b-cell lymphoma comprising an anti-cd79b immunoconjugates, an alkylating agent and an anti-cd20 antibody
WO2020123275A1 (en) 2018-12-10 2020-06-18 Genentech, Inc. Photocrosslinking peptides for site specific conjugation to fc-containing proteins
WO2020132220A1 (en) 2018-12-21 2020-06-25 23Andme, Inc. Anti-il-36 antibodies and methods of use thereof
WO2020132230A2 (en) 2018-12-20 2020-06-25 Genentech, Inc. Modified antibody fcs and methods of use
WO2020132034A1 (en) 2018-12-20 2020-06-25 23Andme, Inc. Anti-cd96 antibodies and methods of use thereof
WO2020132231A1 (en) 2018-12-21 2020-06-25 Genentech, Inc. Methods of producing polypeptides using a cell line resistant to apoptosis
WO2020139920A2 (en) 2018-12-26 2020-07-02 City Of Hope Activatable masked anti-ctla4 binding proteins
WO2020141117A1 (en) 2018-12-30 2020-07-09 F. Hoffmann-La Roche Ag Ph-gradient spr-based binding assay
US10717778B2 (en) 2014-09-29 2020-07-21 Duke University Bispecific molecules comprising an HIV-1 envelope targeting arm
US10724082B2 (en) 2012-10-22 2020-07-28 Bio-Rad Laboratories, Inc. Methods for analyzing DNA
WO2020153467A1 (en) 2019-01-24 2020-07-30 中外製薬株式会社 Novel cancer antigens and antibodies of said antigens
WO2020154410A1 (en) 2019-01-23 2020-07-30 Genentech, Inc. Methods of producing multimeric proteins in eukaryotic host cells
EP3689910A2 (en) 2014-09-23 2020-08-05 F. Hoffmann-La Roche AG Method of using anti-cd79b immunoconjugates
WO2020157491A1 (en) 2019-01-29 2020-08-06 Femtogenix Limited G-a crosslinking cytotoxic agents
US10739333B2 (en) 2013-09-19 2020-08-11 Dana-Farber Cancer Institute, Inc. Methods of BH3 profiling
US10745467B2 (en) 2010-03-26 2020-08-18 The Trustees Of Dartmouth College VISTA-Ig for treatment of autoimmune, allergic and inflammatory disorders
EP3698807A1 (en) 2005-01-21 2020-08-26 Genentech, Inc. Fixed dosing of her antibodies
US10761086B2 (en) 2015-04-27 2020-09-01 Dana-Farber Cancer Institute, Inc. High throughput BH3 profiling: a rapid and scalable technology to BH3 profile on low numbers of cells
US10758207B2 (en) 2013-03-13 2020-09-01 Philips Image Guided Therapy Corporation Systems and methods for producing an image from a rotational intravascular ultrasound device
US10767232B2 (en) 2014-11-03 2020-09-08 Genentech, Inc. Methods and biomarkers for predicting efficacy and evaluation of an OX40 agonist treatment
US10774145B2 (en) 2015-06-17 2020-09-15 Allakos Inc. Methods and compositions for treating fibrotic diseases
WO2020185535A1 (en) 2019-03-08 2020-09-17 Genentech, Inc. Methods for detecting and quantifying membrane-associated proteins on extracellular vesicles
WO2020186176A1 (en) 2019-03-14 2020-09-17 Genentech, Inc. Treatment of cancer with her2xcd3 bispecific antibodies in combination with anti-her2 mab
US10781254B2 (en) 2010-03-26 2020-09-22 The Trustees Of Dartmouth College VISTA regulatory T cell mediator protein, VISTA binding agents and use thereof
US10793593B2 (en) 2006-12-21 2020-10-06 Emd Millipore Corporation Purification of proteins
WO2020200944A1 (en) 2019-03-29 2020-10-08 F. Hoffmann-La Roche Ag Method for generating avid-binding multispecific antibodies
WO2020200941A1 (en) 2019-03-29 2020-10-08 F. Hoffmann-La Roche Ag Spr-based binding assay for the functional analysis of multivalent molecules
WO2020213724A1 (en) 2019-04-19 2020-10-22 中外製薬株式会社 Chimeric receptor recognizing modification site of antibody
WO2020214995A1 (en) 2019-04-19 2020-10-22 Genentech, Inc. Anti-mertk antibodies and their methods of use
WO2020214963A1 (en) 2019-04-18 2020-10-22 Genentech, Inc. Antibody potency assay
US10822402B2 (en) 2015-06-24 2020-11-03 Hoffmann-La Roche Inc. Humanized anti-tau(pS422) antibodies and methods of use
US10828353B2 (en) 2015-01-31 2020-11-10 The Trustees Of The University Of Pennsylvania Compositions and methods for T cell delivery of therapeutic molecules
EP3736293A1 (en) 2013-02-12 2020-11-11 Boehringer Ingelheim International Gmbh Therapeutic and diagnostic target for cancer comprising dll3 binding reagents
WO2020232262A1 (en) 2019-05-16 2020-11-19 Procisedx Inc. Assay detection methods for vcam-1 and calprotectin
WO2020229378A1 (en) 2019-05-13 2020-11-19 F. Hoffmann-La Roche Ag Interference-suppressed pharmacokinetic immunoassay
WO2020232169A1 (en) 2019-05-14 2020-11-19 Genentech, Inc. Methods of using anti-cd79b immunoconjugates to treat follicular lymphoma
WO2020230142A1 (en) 2019-05-15 2020-11-19 Neotx Therapeutics Ltd. Cancer treatment
WO2020232295A1 (en) 2019-05-16 2020-11-19 Procisedx Inc. An assay method for the detection of vcam-1 and alpha-2-macroglobulin in blood
WO2020229982A1 (en) 2019-05-10 2020-11-19 Takeda Pharmaceutical Company Limited Antibody drug conjugates
WO2020236528A1 (en) 2019-05-23 2020-11-26 Procisedx Inc. Assay methods for the detection of human serum albumin, vitamin d, c-reactive protein, and anti-transglutaminase autoantibody
WO2020247159A1 (en) 2019-06-06 2020-12-10 Procisedx Inc. DETECTION OF HEMOGLOBIN A1C (HbA1c) IN BLOOD
WO2020247634A1 (en) 2019-06-05 2020-12-10 Genentech, Inc. A method for regeneration of an overload chromatography column
WO2020245677A1 (en) 2019-06-03 2020-12-10 Janssen Biotech, Inc. Anti-tnf antibodies, compositions, and methods for the treatment of active ankylosing spondylitis
WO2020252066A1 (en) 2019-06-11 2020-12-17 Alector Llc Anti-sortilin antibodies for use in therapy
WO2020250915A1 (en) 2019-06-10 2020-12-17 中外製薬株式会社 Anti-t cell antigen-binding molecule to be used in combination with cytokine inhibitor
US10870701B2 (en) 2016-03-15 2020-12-22 Generon (Shanghai) Corporation Ltd. Multispecific fab fusion proteins and use thereof
WO2020254357A1 (en) 2019-06-19 2020-12-24 F. Hoffmann-La Roche Ag Method for the generation of a protein expressing cell by targeted integration using cre mrna
WO2020254351A1 (en) 2019-06-19 2020-12-24 F. Hoffmann-La Roche Ag Method for the generation of a multivalent, multispecific antibody expressing cell by targeted integration of multiple expression cassettes in a defined organization
WO2020254356A1 (en) 2019-06-19 2020-12-24 F. Hoffmann-La Roche Ag Method for the generation of a multivalent, bispecific antibody expressing cell by targeted integration of multiple expression cassettes in a defined organization
WO2020254352A1 (en) 2019-06-19 2020-12-24 F. Hoffmann-La Roche Ag Method for the generation of a trivalent antibody expressing cell by targeted integration of multiple expression cassettes in a defined organization
WO2020254355A1 (en) 2019-06-19 2020-12-24 F. Hoffmann-La Roche Ag Method for the generation of a bivalent, bispecific antibody expressing cell by targeted integration of multiple expression cassettes in a defined organization
WO2020263450A1 (en) 2019-06-25 2020-12-30 Procisedx Inc. Detection of anti-tnf alpha drug biologics and anti-drug antibodies
WO2020264300A1 (en) 2019-06-28 2020-12-30 Genentech, Inc. Composition and methods for stabilizing liquid protein formulations
WO2020260327A1 (en) 2019-06-26 2020-12-30 F. Hoffmann-La Roche Ag Mammalian cell lines with sirt-1 gene knockout
WO2021011673A2 (en) 2019-07-16 2021-01-21 Ming Jin Neutralizing anti-amyloid beta antibodies for the treatment of alzheimer's disease
WO2021010326A1 (en) 2019-07-12 2021-01-21 中外製薬株式会社 Anti-mutation type fgfr3 antibody and use therefor
WO2021021605A1 (en) 2019-07-26 2021-02-04 Vanderbilt University Human monoclonal antibodies to enterovirus d68
WO2021017892A1 (en) 2019-07-26 2021-02-04 上海复宏汉霖生物技术股份有限公司 Method and composition for anti-cd73 antibodies and variants
WO2021022083A2 (en) 2019-07-31 2021-02-04 Alector Llc Anti-ms4a4a antibodies and methods of use thereof
WO2021024209A1 (en) 2019-08-06 2021-02-11 Aprinoia Therapeutics Inc. Antibodies that bind to pathological tau species and uses thereof
US10918627B2 (en) 2016-05-11 2021-02-16 Massachusetts Institute Of Technology Convergent and enantioselective total synthesis of Communesin analogs
US10918735B2 (en) 2012-12-04 2021-02-16 Massachusetts Institute Of Technology Substituted pyrazino[1′,2′:1,5]pyrrolo[2,3-b]indole-1,4-diones for cancer treatment
WO2021030251A1 (en) 2019-08-12 2021-02-18 Purinomia Biotech, Inc. Methods and compositions for promoting and potentiating t-cell mediated immune responses through adcc targeting of cd39 expressing cells
WO2021028752A1 (en) 2019-08-15 2021-02-18 Janssen Biotech, Inc. Anti-tfn antibodies for treating type i diabetes
US10927342B2 (en) 2015-08-04 2021-02-23 Regeneran Pharmaceuticals, Inc. Taurine supplemented cell culture medium and methods of use
EP3782654A1 (en) 2014-09-12 2021-02-24 Genentech, Inc. Anti-her2 antibodies and immunoconjugates
EP3783018A1 (en) 2012-10-18 2021-02-24 The Rockefeller University Broadly-neutralizing anti-hiv antibodies
EP3783029A1 (en) 2015-05-12 2021-02-24 F. Hoffmann-La Roche AG Therapeutic and diagnostic methods for cancer
US10935544B2 (en) 2015-09-04 2021-03-02 Obi Pharma, Inc. Glycan arrays and method of use
US10933115B2 (en) 2012-06-22 2021-03-02 The Trustees Of Dartmouth College VISTA antagonist and methods of use
US10942022B2 (en) 2012-12-20 2021-03-09 Philips Image Guided Therapy Corporation Manual calibration of imaging system
US10940401B2 (en) 2013-09-05 2021-03-09 Genentech, Inc. Method for chromatography reuse
US10939826B2 (en) 2012-12-20 2021-03-09 Philips Image Guided Therapy Corporation Aspirating and removing biological material
EP3789402A1 (en) 2014-11-20 2021-03-10 F. Hoffmann-La Roche AG Combination therapy of t cell activating bispecific antigen binding molecules and pd-1 axis binding antagonists
EP3789036A1 (en) 2013-07-16 2021-03-10 F. Hoffmann-La Roche AG Methods of treating cancer using pd-1 axis binding antagonists and tigit inhibitors
WO2021050645A1 (en) 2019-09-12 2021-03-18 Genentech, Inc. Compositions and methods of treating lupus nephritis
EP3795168A1 (en) 2015-01-16 2021-03-24 City of Hope Cell penetrating antibodies
WO2021055694A1 (en) 2019-09-20 2021-03-25 Genentech, Inc. Dosing for anti-tryptase antibodies
WO2021057978A1 (en) 2019-09-27 2021-04-01 南京金斯瑞生物科技有限公司 Anti-vhh domain antibodies and use thereof
WO2021064137A2 (en) 2019-10-02 2021-04-08 Boehringer Ingelheim International Gmbh Multi-specific binding proteins for cancer treatment
US10980894B2 (en) 2016-03-29 2021-04-20 Obi Pharma, Inc. Antibodies, pharmaceutical compositions and methods
WO2021076196A1 (en) 2019-10-18 2021-04-22 Genentech, Inc. Methods of using anti-cd79b immunoconjugates to treat diffuse large b-cell lymphoma
US10993694B2 (en) 2012-12-21 2021-05-04 Philips Image Guided Therapy Corporation Rotational ultrasound imaging catheter with extended catheter body telescope
US11000601B2 (en) 2016-11-21 2021-05-11 Obi Pharma, Inc. Conjugated biological molecules, pharmaceutical compositions and methods
US11008389B2 (en) 2011-03-16 2021-05-18 Sanofi Uses of a dual V region antibody-like protein
US11013800B2 (en) 2011-05-16 2021-05-25 Evive Biotech Ltd. Multi-specific Fab fusion proteins comprising a CD3-binding Fab fragment with N-terminal fusion to binding domains and methods of use
US11014982B2 (en) 2017-02-07 2021-05-25 Janssen Biotech, Inc. Anti-TNF antibodies, compositions, and methods for the treatment of active ankylosing spondylitis
US11014987B2 (en) 2013-12-24 2021-05-25 Janssen Pharmaceutics Nv Anti-vista antibodies and fragments, uses thereof, and methods of identifying same
US11026591B2 (en) 2013-03-13 2021-06-08 Philips Image Guided Therapy Corporation Intravascular pressure sensor calibration
US11034770B2 (en) 2019-07-19 2021-06-15 Oncoresponse, Inc. Immunomodulatory antibodies and methods of use thereof
US11034710B2 (en) 2018-12-04 2021-06-15 Sumitomo Dainippon Pharma Oncology, Inc. CDK9 inhibitors and polymorphs thereof for use as agents for treatment of cancer
WO2021119505A1 (en) 2019-12-13 2021-06-17 Genentech, Inc. Anti-ly6g6d antibodies and methods of use
WO2021119400A1 (en) 2019-12-12 2021-06-17 Alector Llc Methods of use of anti-cd33 antibodies
US11041020B2 (en) 2017-01-30 2021-06-22 Janssen Biotech, Inc. Methods for the treatment of active Psoriatic Arthritis
US11041017B2 (en) 2016-03-29 2021-06-22 Obi Pharma, Inc. Antibodies, pharmaceutical compositions and methods
US11040140B2 (en) 2010-12-31 2021-06-22 Philips Image Guided Therapy Corporation Deep vein thrombosis therapeutic methods
EP3842453A1 (en) 2014-11-06 2021-06-30 F. Hoffmann-La Roche AG Fc-region variants with modified fcrn- and protein a-binding properties
WO2021131021A1 (en) 2019-12-27 2021-07-01 中外製薬株式会社 Anti-ctla-4 antibody and use thereof
US11053308B2 (en) 2016-08-05 2021-07-06 Chugai Seiyaku Kabushiki Kaisha Method for treating IL-8-related diseases
US11053294B2 (en) 2018-09-27 2021-07-06 Xilio Development, Inc. Masked cytokine polypeptides
WO2021138454A1 (en) 2019-12-30 2021-07-08 City Of Hope Methods of making and using regulatory t cells and effector t cells having chimeric antigen receptors targeted to cd6, cd19, and/or an il-13r for treatment of autoimmune disorders and cancers
WO2021138264A1 (en) 2019-12-30 2021-07-08 Seagen Inc. Methods of treating cancer with nonfucosylated anti-cd70 antibodies
WO2021136772A1 (en) 2020-01-02 2021-07-08 F. Hoffmann-La Roche Ag Method for determining the amount of a therapeutic antibody in the brain
WO2021139777A1 (en) 2020-01-10 2021-07-15 上海复宏汉霖生物技术股份有限公司 Anti-tigit antibodies and usage method
WO2021152186A2 (en) 2020-06-26 2021-08-05 Bayer Aktiengesellschaft Ccr8 antibodies for therapeutic applications
US11084875B2 (en) 2014-08-08 2021-08-10 Alector Llc Anti-TREM2 antibodies and methods of use thereof
EP3862365A1 (en) 2016-01-08 2021-08-11 F. Hoffmann-La Roche AG Methods of treating cea-positive cancers using pd-1 axis binding antagonists and anti-cea/anti-cd3 bispecific antibodies
WO2021160155A1 (en) 2020-02-10 2021-08-19 上海诗健生物科技有限公司 Claudin 18.2 antibody and use thereof
WO2021162020A1 (en) 2020-02-12 2021-08-19 中外製薬株式会社 Anti-cd137 antigen-binding molecule for use in cancer treatment
WO2021160154A1 (en) 2020-02-10 2021-08-19 上海诗健生物科技有限公司 Cldn18.2 antibody and use thereof
WO2021163265A1 (en) 2020-02-11 2021-08-19 Vanderbilt University Human monoclonal antibodies to severe acute respiratory syndrome coronavirus 2 (sars-cov- 2)
WO2021170082A1 (en) 2020-02-28 2021-09-02 南京圣和药业股份有限公司 Anti-cd47/anti-pd-l1 antibody and applications thereof
US11111288B2 (en) 2014-08-28 2021-09-07 Bioatla, Inc. Conditionally active chimeric antigen receptors for modified t-cells
EP3878866A1 (en) 2013-04-29 2021-09-15 F. Hoffmann-La Roche AG Fc-receptor binding modified asymmetric antibodies and methods of use
WO2021183849A1 (en) 2020-03-13 2021-09-16 Genentech, Inc. Anti-interleukin-33 antibodies and uses thereof
US11123426B2 (en) 2014-06-11 2021-09-21 The Trustees Of Dartmouth College Use of vista agonists and antagonists to suppress or enhance humoral immunity
WO2021188749A1 (en) 2020-03-19 2021-09-23 Genentech, Inc. Isoform-selective anti-tgf-beta antibodies and methods of use
WO2021194913A1 (en) 2020-03-24 2021-09-30 Genentech, Inc. Tie2-binding agents and methods of use
WO2021195418A1 (en) 2020-03-26 2021-09-30 Vanderbilt University Human monoclonal antibodies to severe acute respiratory syndrome coronavirus 2 (sars-cov-2)
WO2021195385A1 (en) 2020-03-26 2021-09-30 Vanderbilt University HUMAN MONOCLONAL ANTIBODIES TO SEVERE ACUTE RESPIRATORY SYNDROME CORONAVIRUS 2 (SARS-GoV-2)
WO2021201202A1 (en) 2020-04-02 2021-10-07 中外製薬株式会社 Analysis method for impurity molecules in composition containing multi-specific antigen-binding molecules
WO2021202959A1 (en) 2020-04-03 2021-10-07 Genentech, Inc. Therapeutic and diagnostic methods for cancer
US11141063B2 (en) 2010-12-23 2021-10-12 Philips Image Guided Therapy Corporation Integrated system architectures and methods of use
US11149088B2 (en) 2016-04-15 2021-10-19 Bioatla, Inc. Anti-Axl antibodies, antibody fragments and their immunoconjugates and uses thereof
EP3896091A1 (en) 2015-08-11 2021-10-20 Legend Biotech Ireland Limited Chimeric antigen receptors targeting bcma and methods of use thereof
US11154313B2 (en) 2013-03-12 2021-10-26 The Volcano Corporation Vibrating guidewire torquer and methods of use
WO2021217051A1 (en) 2020-04-24 2021-10-28 Genentech, Inc. Methods of using anti-cd79b immunoconjugates
WO2021222167A1 (en) 2020-04-28 2021-11-04 Genentech, Inc. Methods and compositions for non-small cell lung cancer immunotherapy
WO2021222533A1 (en) 2020-04-30 2021-11-04 Procisedx Inc. Methods of detecting antibodies to sars-cov-2
WO2021225892A1 (en) 2020-05-03 2021-11-11 Levena (Suzhou) Biopharma Co., Ltd. Antibody-drug conjugates (adcs) comprising an anti-trop-2 antibody, compositions comprising such adcs, as well as methods of making and using the same
US11180557B2 (en) 2012-06-22 2021-11-23 King's College London Vista modulators for diagnosis and treatment of cancer
WO2021236658A1 (en) 2020-05-19 2021-11-25 Boehringer Ingelheim International Gmbh Binding molecules for the treatment of cancer
WO2021243204A1 (en) 2020-05-29 2021-12-02 23Andme, Inc. Anti-cd200r1 antibodies and methods of use thereof
EP3922649A1 (en) 2015-10-30 2021-12-15 F. Hoffmann-La Roche AG Anti-htra1 antibodies and methods of use thereof
WO2021252977A1 (en) 2020-06-12 2021-12-16 Genentech, Inc. Methods and compositions for cancer immunotherapy
US11203645B2 (en) 2018-06-27 2021-12-21 Obi Pharma, Inc. Glycosynthase variants for glycoprotein engineering and methods of use
US11203638B2 (en) 2017-05-05 2021-12-21 Allakos Inc. Methods and compositions for treating perennial allergic conjunctivitis and keratoconjunctivitis
WO2021257503A1 (en) 2020-06-16 2021-12-23 Genentech, Inc. Methods and compositions for treating triple-negative breast cancer
WO2021256555A1 (en) 2020-06-19 2021-12-23 中外製薬株式会社 Anti-t cell antigen-binding molecule for use in combination with angiogenesis inhibitor
WO2021259880A1 (en) 2020-06-22 2021-12-30 Almirall, S.A. Anti-il-36 antibodies and methods of use thereof
US11214619B2 (en) 2018-07-20 2022-01-04 Surface Oncology, Inc. Anti-CD112R compositions and methods
EP3936524A2 (en) 2015-05-11 2022-01-12 F. Hoffmann-La Roche AG Compositions and methods of treating lupus nephritis
WO2022016119A1 (en) 2020-07-17 2022-01-20 Simurx, Inc. Chimeric myd88 receptors for redirecting immunosuppressive signaling and related compositions and methods
WO2022020288A1 (en) 2020-07-21 2022-01-27 Genentech, Inc. Antibody-conjugated chemical inducers of degradation of brm and methods thereof
WO2022025220A1 (en) 2020-07-31 2022-02-03 中外製薬株式会社 Pharmaceutical composition including cell expressing chimeric receptor
WO2022023735A1 (en) 2020-07-28 2022-02-03 Femtogenix Limited Cytotoxic agents
US11241417B2 (en) 2018-06-21 2022-02-08 Yumanity Therapeutics, Inc. Compositions and methods for the treatment and prevention of neurological disorders
US11272845B2 (en) 2012-10-05 2022-03-15 Philips Image Guided Therapy Corporation System and method for instant and automatic border detection
US11274157B2 (en) 2017-01-12 2022-03-15 Eureka Therapeutics, Inc. Constructs targeting histone H3 peptide/MHC complexes and uses thereof
US11279694B2 (en) 2016-11-18 2022-03-22 Sumitomo Dainippon Pharma Oncology, Inc. Alvocidib prodrugs and their use as protein kinase inhibitors
WO2022057651A1 (en) 2020-09-16 2022-03-24 四川科伦博泰生物医药股份有限公司 Anti-nectin-4 antibody, conjugate including same, and application thereof
WO2022061214A1 (en) 2020-09-21 2022-03-24 Genentech, Inc. Purification of multispecific antibodies
US11286300B2 (en) 2015-10-01 2022-03-29 Hoffmann-La Roche Inc. Humanized anti-human CD19 antibodies and methods of use
WO2022063100A1 (en) 2020-09-22 2022-03-31 南京圣和药业股份有限公司 Anti-tigit antibody and double antibody and their application
WO2022063877A1 (en) 2020-09-24 2022-03-31 F. Hoffmann-La Roche Ag Mammalian cell lines with gene knockout
DE102020125465A1 (en) 2020-09-29 2022-03-31 Immatics Biotechnologies Gmbh Amidated peptides and their deamidated counterparts presented by non-HLA-A*02 molecules for use in immunotherapy against various types of cancer
DE102020125457A1 (en) 2020-09-29 2022-03-31 Immatics Biotechnologies Gmbh Amidated peptides and their deamidated counterparts presented by HLA-A*02 molecules for use in immunotherapy against various types of cancer
WO2022069579A2 (en) 2020-09-29 2022-04-07 Immatics Biotechnologies Gmbh Amidated peptides and their deamidated counterparts displayed by non-hla-a*02 for use in immunotherapy against different types of cancers
WO2022076462A1 (en) 2020-10-05 2022-04-14 Genentech, Inc. Dosing for treatment with anti-fcrh5/anti-cd3 bispecific antibodies
WO2022084355A2 (en) 2020-10-21 2022-04-28 Boehringer Ingelheim International Gmbh Agonistic trkb binding molecules for the treatment of eye diseases
WO2022084210A1 (en) 2020-10-20 2022-04-28 F. Hoffmann-La Roche Ag Combination therapy of pd-1 axis binding antagonists and lrrk2 inhitibors
US11319526B2 (en) 2008-05-02 2022-05-03 Seagen Inc. Methods and compositions for making antibodies and antibody derivatives with reduced core fucosylation
WO2022097117A1 (en) 2020-11-09 2022-05-12 Takeda Pharmaceutical Company Ltd. Antibody drug conjugates
WO2022098972A1 (en) 2020-11-08 2022-05-12 Seagen Inc. Combination-therapy antibody drug conjugate with immune cell inhibitor
US11332523B2 (en) 2014-05-28 2022-05-17 Academia Sinica Anti-TNF-alpha glycoantibodies and uses thereof
US11332533B2 (en) 2007-09-26 2022-05-17 Chugai Seiyaku Kabushiki Kaisha Modified antibody constant region
WO2022100613A1 (en) 2020-11-10 2022-05-19 上海齐鲁制药研究中心有限公司 Bispecific antibody for claudin 18a2 and cd3 and application of bispecific antibody
WO2022101458A1 (en) 2020-11-16 2022-05-19 F. Hoffmann-La Roche Ag Combination therapy with fap-targeted cd40 agonists
US11352403B2 (en) 2018-05-14 2022-06-07 Werewolf Therapeutics, Inc. Activatable interleukin-2 polypeptides and methods of use thereof
WO2022120352A1 (en) 2020-12-02 2022-06-09 Alector Llc Methods of use of anti-sortilin antibodies
US11370833B2 (en) 2014-09-15 2022-06-28 Genentech, Inc. Antibody formulations
WO2022136140A1 (en) 2020-12-22 2022-06-30 F. Hoffmann-La Roche Ag Oligonucleotides targeting xbp1
US11377485B2 (en) 2009-12-02 2022-07-05 Academia Sinica Methods for modifying human antibodies by glycan engineering
EP4026848A1 (en) 2015-12-09 2022-07-13 F. Hoffmann-La Roche AG Type ii anti-cd20 antibody for reducing the cytokine release syndrome
EP4026556A1 (en) 2016-10-05 2022-07-13 Acceleron Pharma Inc. Compositions and method for treating kidney disease
US11390685B2 (en) 2017-01-06 2022-07-19 Biosion, Inc. ErbB2 antibodies and uses therefore
WO2022152880A1 (en) 2021-01-15 2022-07-21 Immatics Biotechnologies Gmbh Peptides displayed by hla for use in immunotherapy against different types of cancers
WO2022159349A1 (en) 2021-01-20 2022-07-28 Oncoresponse, Inc. Immunomodulatory antibodies and uses thereof
WO2022157094A2 (en) 2021-01-22 2022-07-28 Bayer Aktiengesellschaft Lrrc15 antibodies and conjugates thereof
US11406498B2 (en) 2012-12-20 2022-08-09 Philips Image Guided Therapy Corporation Implant delivery system and implants
WO2022169825A1 (en) 2021-02-03 2022-08-11 Mozart Therapeutics, Inc. Binding agents and methods of using the same
WO2022177392A1 (en) 2021-02-19 2022-08-25 (주)샤페론 Single domain antibody against cd47 and use thereof
WO2022177393A1 (en) 2021-02-19 2022-08-25 (주)샤페론 Single domain antibody against pd-l1 and use thereof
WO2022175217A1 (en) 2021-02-18 2022-08-25 F. Hoffmann-La Roche Ag Method for resolving complex, multistep antibody interactions
WO2022184082A1 (en) 2021-03-03 2022-09-09 Sorrento Therapeutics, Inc. Antibody-drug conjugates comprising an anti-bcma antibody
WO2022187272A1 (en) 2021-03-01 2022-09-09 Xilio Development, Inc. Combination of masked ctla4 and pd1/pdl1 antibodies for treating cancer
WO2022187270A1 (en) 2021-03-01 2022-09-09 Xilio Development, Inc. Combination of ctla4 and pd1/pdl1 antibodies for treating cancer
WO2022190033A1 (en) 2021-03-12 2022-09-15 Janssen Biotech, Inc. Safe and effective method of treating psoriatic arthritis with anti-il23 specific antibody
WO2022190034A1 (en) 2021-03-12 2022-09-15 Janssen Biotech, Inc. Method of treating psoriatic arthritis patients with inadequate response to tnf therapy with anti-il23 specific antibody
US11447573B2 (en) 2016-07-20 2022-09-20 Nanjing Legend Biotech Co., Ltd. Multispecific antigen binding proteins and methods of use thereof
US11447564B2 (en) 2017-04-26 2022-09-20 Eureka Therapeutics, Inc. Constructs specifically recognizing glypican 3 and uses thereof
WO2022197947A1 (en) 2021-03-18 2022-09-22 Alector Llc Anti-tmem106b antibodies and methods of use thereof
WO2022198192A1 (en) 2021-03-15 2022-09-22 Genentech, Inc. Compositions and methods of treating lupus nephritis
WO2022197877A1 (en) 2021-03-19 2022-09-22 Genentech, Inc. Methods and compositions for time delayed bio-orthogonal release of cytotoxic agents
US11453710B2 (en) 2018-05-14 2022-09-27 Werewolf Therapeutics, Inc. Activatable interleukin 12 polypeptides and methods of use thereof
WO2022201122A1 (en) 2021-03-26 2022-09-29 Janssen Biotech, Inc. Humanized antibodies against paired helical filament tau and uses thereof
WO2022200389A1 (en) 2021-03-22 2022-09-29 Novimmune S.A. Bispecific antibodies targeting cd47 and pd-l1 and methods of use thereof
WO2022200387A1 (en) 2021-03-22 2022-09-29 Novimmune S.A. Bispecific antibodies targeting cd47 and pd-l1 and methods of use thereof
WO2022204274A1 (en) 2021-03-23 2022-09-29 Alector Llc Anti-tmem106b antibodies for treating and preventing coronavirus infections
WO2022214565A1 (en) 2021-04-09 2022-10-13 F. Hoffmann-La Roche Ag Process for selecting cell clones expressing a heterologous polypeptide
WO2022217026A1 (en) 2021-04-09 2022-10-13 Seagen Inc. Methods of treating cancer with anti-tigit antibodies
WO2022217022A1 (en) 2021-04-10 2022-10-13 Profoundbio Us Co. Folr1 binding agents, conjugates thereof and methods of using the same
US11472881B2 (en) 2016-10-11 2022-10-18 Nanjing Legend Biotech Co., Ltd. Single-domain antibodies and variants thereof against CTLA-4
WO2022218957A1 (en) 2021-04-12 2022-10-20 Acm Biolabs Pte Ltd Polymersomes comprising a soluble encapsulated polynucleotide and an ionizable lipid as well as methods of making and uses thereof
WO2022220275A1 (en) 2021-04-15 2022-10-20 中外製薬株式会社 ANTI-C1s ANTIBODY
WO2022226317A1 (en) 2021-04-23 2022-10-27 Profoundbio Us Co. Anti-cd70 antibodies, conjugates thereof and methods of using the same
WO2022228706A1 (en) 2021-04-30 2022-11-03 F. Hoffmann-La Roche Ag Dosing for treatment with anti-cd20/anti-cd3 bispecific antibody
WO2022228705A1 (en) 2021-04-30 2022-11-03 F. Hoffmann-La Roche Ag Dosing for combination treatment with anti-cd20/anti-cd3 bispecific antibody and anti-cd79b antibody drug conjugate
US11492396B2 (en) 2015-10-27 2022-11-08 UCB Biopharma SRL Methods of treatment using anti-IL-17A/F antibodies
US11497756B2 (en) 2017-09-12 2022-11-15 Sumitomo Pharma Oncology, Inc. Treatment regimen for cancers that are insensitive to BCL-2 inhibitors using the MCL-1 inhibitor alvocidib
WO2022241446A1 (en) 2021-05-12 2022-11-17 Genentech, Inc. Methods of using anti-cd79b immunoconjugates to treat diffuse large b-cell lymphoma
WO2022238481A1 (en) 2021-05-11 2022-11-17 Modiquest B.V. Antibodies
WO2022241082A1 (en) 2021-05-14 2022-11-17 Genentech, Inc. Agonists of trem2
WO2022247030A1 (en) 2021-05-27 2022-12-01 江苏荃信生物医药股份有限公司 ANTI-HUMAN INTERFERON α RECEPTOR 1 MONOCLONAL ANTIBODY AND APPLICATION THEREOF
US11525000B2 (en) 2016-04-15 2022-12-13 Immunext, Inc. Anti-human VISTA antibodies and use thereof
WO2022258600A1 (en) 2021-06-09 2022-12-15 F. Hoffmann-La Roche Ag Combination of a particular braf inhibitor (paradox breaker) and a pd-1 axis binding antagonist for use in the treatment of cancer
US11529416B2 (en) 2012-09-07 2022-12-20 Kings College London Vista modulators for diagnosis and treatment of cancer
WO2022263507A1 (en) 2021-06-17 2022-12-22 Boehringer Ingelheim International Gmbh Novel tri-specific binding molecules
WO2022270612A1 (en) 2021-06-25 2022-12-29 中外製薬株式会社 Use of anti-ctla-4 antibody
WO2022270611A1 (en) 2021-06-25 2022-12-29 中外製薬株式会社 Anti–ctla-4 antibody
WO2023278377A1 (en) 2021-06-29 2023-01-05 Seagen Inc. Methods of treating cancer with a combination of a nonfucosylated anti-cd70 antibody and a cd47 antagonist
WO2023280227A2 (en) 2021-07-06 2023-01-12 Profoundbio Us Co. Linkers, drug linkers and conjugates thereof and methods of using the same
WO2023004386A1 (en) 2021-07-22 2023-01-26 Genentech, Inc. Brain targeting compositions and methods of use thereof
US11578372B2 (en) 2012-11-05 2023-02-14 Foundation Medicine, Inc. NTRK1 fusion molecules and uses thereof
US11578426B2 (en) 2017-08-21 2023-02-14 Adagene Inc. Dynamic human heavy chain antibody libraries
WO2023019239A1 (en) 2021-08-13 2023-02-16 Genentech, Inc. Dosing for anti-tryptase antibodies
US11585014B2 (en) 2017-08-21 2023-02-21 Adagene Inc. Dynamic human antibody light chain libraries
US11583577B2 (en) 2016-04-22 2023-02-21 Obi Pharma, Inc. Cancer immunotherapy by immune activation or immune modulation via Globo series antigens
WO2023028591A1 (en) 2021-08-27 2023-03-02 Genentech, Inc. Methods of treating tau pathologies
US11597774B2 (en) 2017-05-04 2023-03-07 City Of Hope Antibody variable domains and antibody constructs
US11597727B2 (en) 2018-03-13 2023-03-07 The Regents Of The University Of California Inhibitors of integrin alpha 2 beta 1 and methods of use
US11596620B2 (en) 2013-03-13 2023-03-07 F. Hoffmann-La Roche Ag Formulations with reduced oxidation
WO2023034750A1 (en) 2021-08-30 2023-03-09 Genentech, Inc. Anti-polyubiquitin multispecific antibodies
WO2023029280A1 (en) 2021-09-03 2023-03-09 江苏荃信生物医药股份有限公司 Anti-human interleukin-33 monoclonal antibody and use thereof
WO2023029281A1 (en) 2021-09-03 2023-03-09 江苏荃信生物医药股份有限公司 Anti-human tslp monoclonal antibody and use thereof
EP4155321A1 (en) 2021-06-04 2023-03-29 Chugai Seiyaku Kabushiki Kaisha Anti-ddr2 antibodies and uses thereof
WO2023058723A1 (en) 2021-10-08 2023-04-13 中外製薬株式会社 Method for preparing prefilled syringe formulation
WO2023064947A1 (en) 2021-10-15 2023-04-20 Regenxbio Inc. Antibodies and methods of using thereof
WO2023073615A1 (en) 2021-10-29 2023-05-04 Janssen Biotech, Inc. Methods of treating crohn's disease with anti-il23 specific antibody
WO2023076876A1 (en) 2021-10-26 2023-05-04 Mozart Therapeutics, Inc. Modulation of immune responses to viral vectors
US11643456B2 (en) 2016-07-29 2023-05-09 Obi Pharma, Inc. Human antibodies, pharmaceutical compositions and methods
US11642400B2 (en) 2016-07-27 2023-05-09 Obi Pharma, Inc. Immunogenic/therapeutic glycan compositions and uses thereof
US11643388B2 (en) 2020-05-01 2023-05-09 The Regents Of The University Of California Inhibitors of alpha 2 beta 1 integrin and methods of use thereof
WO2023081898A1 (en) 2021-11-08 2023-05-11 Alector Llc Soluble cd33 as a biomarker for anti-cd33 efficacy
WO2023086807A1 (en) 2021-11-10 2023-05-19 Genentech, Inc. Anti-interleukin-33 antibodies and uses thereof
WO2023084488A1 (en) 2021-11-15 2023-05-19 Janssen Biotech, Inc. Methods of treating crohn's disease with anti-il23 specific antibody
WO2023095000A1 (en) 2021-11-23 2023-06-01 Janssen Biotech, Inc. Method of treating ulcerative colitis with anti-il23 specific antibody
WO2023094282A1 (en) 2021-11-25 2023-06-01 F. Hoffmann-La Roche Ag Quantification of low amounts of antibody sideproducts
US11673968B2 (en) 2014-06-26 2023-06-13 Hoffmann-La Roche Inc. Anti-BRDU antibodies and methods of use
WO2023117325A1 (en) 2021-12-21 2023-06-29 F. Hoffmann-La Roche Ag Method for the determination of hydrolytic activity
US11713353B2 (en) 2018-01-15 2023-08-01 Nanjing Legend Biotech Co., Ltd. Single-domain antibodies and variants thereof against PD-1
EP4219560A2 (en) 2010-02-18 2023-08-02 The Regents of The University of California Integrin alpha v beta 8 neutralizing antibody
WO2023147328A1 (en) 2022-01-26 2023-08-03 Genentech, Inc. Antibody-conjugated chemical inducers of degradation with hydolysable maleimide linkers and methods thereof
WO2023147329A1 (en) 2022-01-26 2023-08-03 Genentech, Inc. Antibody-conjugated chemical inducers of degradation and methods thereof
US11730822B2 (en) 2017-03-24 2023-08-22 Seagen Inc. Process for the preparation of glucuronide drug-linkers and intermediates thereof
US11739132B2 (en) 2019-05-14 2023-08-29 Werewolf Therapeutics, Inc. Separation moieties and methods of use thereof
WO2023170295A1 (en) 2022-03-11 2023-09-14 Janssen Pharmaceutica Nv Multispecific antibodies and uses thereof
WO2023170290A1 (en) 2022-03-11 2023-09-14 Janssen Pharmaceutica Nv Multispecific antibodies and uses thereof
WO2023170291A1 (en) 2022-03-11 2023-09-14 Janssen Pharmaceutica Nv Multispecific antibodies and uses thereof
WO2023173026A1 (en) 2022-03-10 2023-09-14 Sorrento Therapeutics, Inc. Antibody-drug conjugates and uses thereof
WO2023178357A1 (en) 2022-03-18 2023-09-21 Evolveimmune Therapeutics, Inc. Bispecific antibody fusion molecules and methods of use thereof
WO2023180353A1 (en) 2022-03-23 2023-09-28 F. Hoffmann-La Roche Ag Combination treatment of an anti-cd20/anti-cd3 bispecific antibody and chemotherapy
US11771698B2 (en) 2013-01-18 2023-10-03 Foundation Medicine, Inc. Methods of treating cholangiocarcinoma
WO2023187407A1 (en) 2022-04-01 2023-10-05 Bradcode Limited Human monoclonal antibodies binding to sars-cov-2 and methods of use thereof
WO2023192622A1 (en) 2022-04-01 2023-10-05 Genentech, Inc. Hydroxypropyl methyl cellulose derivatives to stabilize polypeptides
WO2023187707A1 (en) 2022-03-30 2023-10-05 Janssen Biotech, Inc. Method of treating mild to moderate psoriasis with il-23 specific antibody
WO2023191816A1 (en) 2022-04-01 2023-10-05 Genentech, Inc. Dosing for treatment with anti-fcrh5/anti-cd3 bispecific antibodies
US11780911B2 (en) 2019-05-23 2023-10-10 Janssen Biotech, Inc. Method of treating inflammatory bowel disease with a combination therapy of antibodies to IL-23 and TNF alpha
WO2023198727A1 (en) 2022-04-13 2023-10-19 F. Hoffmann-La Roche Ag Pharmaceutical compositions of anti-cd20/anti-cd3 bispecific antibodies and methods of use
WO2023201299A1 (en) 2022-04-13 2023-10-19 Genentech, Inc. Pharmaceutical compositions of therapeutic proteins and methods of use
US11793802B2 (en) 2019-03-20 2023-10-24 Sumitomo Pharma Oncology, Inc. Treatment of acute myeloid leukemia (AML) with venetoclax failure
WO2023202967A1 (en) 2022-04-19 2023-10-26 F. Hoffmann-La Roche Ag Improved production cells
EP4268831A2 (en) 2018-09-12 2023-11-01 Fred Hutchinson Cancer Center Reducing cd33 expression to selectively protect therapeutic cells
WO2023215737A1 (en) 2022-05-03 2023-11-09 Genentech, Inc. Anti-ly6e antibodies, immunoconjugates, and uses thereof
WO2023215498A2 (en) 2022-05-05 2023-11-09 Modernatx, Inc. Compositions and methods for cd28 antagonism
WO2023219613A1 (en) 2022-05-11 2023-11-16 Genentech, Inc. Dosing for treatment with anti-fcrh5/anti-cd3 bispecific antibodies
WO2023223265A1 (en) 2022-05-18 2023-11-23 Janssen Biotech, Inc. Method for evaluating and treating psoriatic arthritis with il23 antibody
WO2023232961A1 (en) 2022-06-03 2023-12-07 F. Hoffmann-La Roche Ag Improved production cells
US11840567B2 (en) 2017-10-03 2023-12-12 Joint Stock Company “Biocad” Bispecific antibodies with specific binding to CD47 and PD-L1
US11844839B2 (en) 2016-03-25 2023-12-19 Seagen Inc. Process for the preparation of pegylated drug-linkers and intermediates thereof
WO2023245105A1 (en) 2022-06-17 2023-12-21 Genentech, Inc. Use of kosmotropes to enhance yield of an affinity chromatography purification step
WO2024015897A1 (en) 2022-07-13 2024-01-18 Genentech, Inc. Dosing for treatment with anti-fcrh5/anti-cd3 bispecific antibodies
WO2024013315A1 (en) 2022-07-15 2024-01-18 Boehringer Ingelheim International Gmbh Binding molecules for the treatment of cancer
WO2024020432A1 (en) 2022-07-19 2024-01-25 Genentech, Inc. Dosing for treatment with anti-fcrh5/anti-cd3 bispecific antibodies
WO2024020579A1 (en) 2022-07-22 2024-01-25 Bristol-Myers Squibb Company Antibodies binding to human pad4 and uses thereof
US11884739B2 (en) 2014-05-27 2024-01-30 Academia Sinica Anti-CD20 glycoantibodies and uses thereof
US11890301B2 (en) 2015-08-28 2024-02-06 The Trustees Of The University Of Pennsylvania Methods and compositions for cells expressing a chimeric intracellular signaling molecule
US11891432B2 (en) 2018-03-15 2024-02-06 Chugai Seiyaku Kabushiki Kaisha Anti-dengue virus antibodies having cross-reactivity to Zika virus and methods of use
WO2024030956A2 (en) 2022-08-03 2024-02-08 Mozart Therapeutics, Inc. Cd39-specific binding agents and methods of using the same
US11897952B2 (en) 2015-03-30 2024-02-13 City Of Hope Mechanically interlocking complexes
US11905327B2 (en) 2017-12-28 2024-02-20 Nanjing Legend Biotech Co., Ltd. Single-domain antibodies and variants thereof against TIGIT
US11912754B2 (en) 2017-10-12 2024-02-27 Immunowake Inc. VEGFR-antibody light chain fusion protein
WO2024049949A1 (en) 2022-09-01 2024-03-07 Genentech, Inc. Therapeutic and diagnostic methods for bladder cancer
EP4339615A2 (en) 2016-09-16 2024-03-20 Shanghai Henlius Biotech, Inc. Anti-pd-1 antibodies
US11958903B2 (en) 2018-03-30 2024-04-16 Nanjing Legend Biotech Co., Ltd. Single-domain antibodies against LAG-3 and uses thereof
US11965023B2 (en) 2022-05-09 2024-04-23 Alector Llc Anti-Siglec-5 antibodies and methods of use thereof

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
CLIN. EXP. IMMUNOLOL., Volume 79, issued 1990, S. SONGSIVILAI et al., "Bispecific Antibody: A Tool for Diagnosis and Treatment of Disease", pages 315-321. *
INT. J. CANCER, Volume 43, issued 1989, J. VAN DUK et al., "Induction of Tumor-Cell Lysis by Bi-Specific Monoclonal Antibodies Recognizing Renal-Cell Carcinoma and CD3 Antigen", pages 344-349. *
NATURE, 337, issued 09 February 1989, (London, GB), D.J. CAPON et al., "Designing CD4 Immunoadhesins for AIDS Therapy", pages 525-530. *

Cited By (1681)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2241622A2 (en) 1994-03-18 2010-10-20 Genentech, Inc. Human trk receptors and their derivatives
EP2011873A2 (en) 1994-05-27 2009-01-07 Genentech, Inc. Tumor necrosis factor receptor-associated factors
EP0871726A4 (en) * 1995-02-06 2000-10-04 Cell Genesys Inc Multispecific chimeric receptors
EP0871726A1 (en) * 1995-02-06 1998-10-21 Cell Genesys, Inc. Multispecific chimeric receptors
EP2275119A1 (en) 1995-07-27 2011-01-19 Genentech, Inc. Stable isotonic lyophilized protein formulation
US6030945A (en) * 1996-01-09 2000-02-29 Genentech, Inc. Apo-2 ligand
US6746668B2 (en) 1996-01-09 2004-06-08 Genentech, Inc. Apo-2 ligand
US7285533B2 (en) 1996-01-09 2007-10-23 Genentech, Inc. Apo-2 ligand
US6998116B1 (en) 1996-01-09 2006-02-14 Genentech, Inc. Apo-2 ligand
US6469144B1 (en) 1996-04-01 2002-10-22 Genentech, Inc. Apo-2LI and Apo-3 polypeptides
US6159462A (en) * 1996-08-16 2000-12-12 Genentech, Inc. Uses of Wnt polypeptides
US5851984A (en) * 1996-08-16 1998-12-22 Genentech, Inc. Method of enhancing proliferation or differentiation of hematopoietic stem cells using Wnt polypeptides
US6462176B1 (en) 1996-09-23 2002-10-08 Genentech, Inc. Apo-3 polypeptide
US6407216B1 (en) 1996-09-30 2002-06-18 Genentech, Inc. Vertebrate smoothened antibodies
US6492139B1 (en) 1996-09-30 2002-12-10 Genentech, Inc. Vertebrate smoothened proteins
US6136958A (en) * 1996-09-30 2000-10-24 Genentech, Inc. Antibodies to vertebrate smoothened proteins
US5990281A (en) * 1996-09-30 1999-11-23 Genentech, Inc. Vertebrate smoothened proteins
US6270987B1 (en) 1997-01-31 2001-08-07 Genentech, Inc. O-fucosyltransferase
US6342369B1 (en) 1997-05-15 2002-01-29 Genentech, Inc. Apo-2-receptor
US7749755B2 (en) 1997-05-15 2010-07-06 Genentech, Inc. Apo-2 receptor polynucleotides
US7750118B2 (en) 1997-05-15 2010-07-06 Genentech, Inc. Apo-2 receptor polypeptides
US7595046B2 (en) 1997-05-15 2009-09-29 Genentech, Inc. Treatment of cancer using anti-Apo-2 antibodies
US7314619B2 (en) 1997-05-15 2008-01-01 Genentech, Inc. Inducing apoptosis using anti-Apo-2 antibodies
US6291643B1 (en) 1997-06-05 2001-09-18 Board Of Reports, The University Of Texas System Apaf-1 an activator of caspase-3
US6716598B2 (en) 1997-06-13 2004-04-06 Genentech, Inc. Protein recovery
US6121428A (en) * 1997-06-13 2000-09-19 Genentech, Inc. Protein recovery
US6322997B1 (en) 1997-06-13 2001-11-27 Genentech, Inc. Protein recovery
EP2083079A1 (en) 1997-06-18 2009-07-29 Genentech, Inc. Apo-2DcR
US6764679B2 (en) 1997-09-18 2004-07-20 Genentech, Inc. Antibodies to DcR3 Polypeptide, a TNFR Homolog
EP1967587A1 (en) 1997-10-10 2008-09-10 Genentech, Inc. APO-3 Ligand
EP1887014A1 (en) 1997-10-17 2008-02-13 Genentech, Inc. Human toll homologues
EP2033970A2 (en) 1997-10-29 2009-03-11 Genentech, Inc. WNT-1 inducible genes
EP2014770A2 (en) 1997-10-29 2009-01-14 Genentech, Inc. WNT-1 Iinduced secreted polypeptide WISP-2
EP2014677A1 (en) 1997-11-21 2009-01-14 Genentech, Inc. A-33 related antigens and their pharmacological uses
EP1947119A2 (en) 1997-12-12 2008-07-23 Genentech, Inc. Treatment of cancer with anti-erb2 antibodies in combination with a chemotherapeutic agent
US6740739B1 (en) 1998-01-15 2004-05-25 Genentech, Inc. Substitutional variants of APO-2 ligand
EP2017341A2 (en) 1998-01-15 2009-01-21 Genentech, Inc. Apo-2 ligand
US6723840B1 (en) 1998-01-23 2004-04-20 The Regents Of The University Of California Identification and expression of a novel kinesin motor protein
US6764830B1 (en) 1998-01-23 2004-07-20 The Regents Of The University Of California Thermomyces lanuginosus kinesin motor protein and methods of screening for modulators of kinesin proteins
US6815169B1 (en) 1998-01-23 2004-11-09 The Regents Of The University Of California Identification and expression of a novel kinesin motor protein
US6727079B1 (en) 1998-02-25 2004-04-27 The United States Of America As Represented By The Department Of Health And Human Services cDNA encoding a gene BOG (B5T Over-expressed Gene) and its protein product
US7342099B2 (en) 1998-02-25 2008-03-11 The United States Of America As Represented By The Secretary, Department Of Health And Human Services cDNA encoding a gene BOG (B5T over-expressed gene) and its protein product
EP2050762A2 (en) 1998-03-10 2009-04-22 Genentech, Inc. Novel polypeptides and nucleic acids encoding the same
EP2016951A1 (en) 1998-03-17 2009-01-21 Genentech, Inc. Polypeptides homologous to VEGF and BMP1
EP1941905A1 (en) 1998-03-27 2008-07-09 Genentech, Inc. APO-2 Ligand-anti-her-2 antibody synergism
EP3112468A1 (en) 1998-05-15 2017-01-04 Genentech, Inc. Il-17 homologous polypeptides and therapeutic uses thereof
EP1865061A2 (en) 1998-05-15 2007-12-12 Genentech, Inc. IL-17 homologous polypeptides and therapeutic uses thereof
EP2333069A2 (en) 1998-05-15 2011-06-15 Genentech, Inc. Therapeutic uses of IL-17 homologous polypeptides
EP2058334A2 (en) 1998-06-12 2009-05-13 Genentech, Inc. Monoclonal antibodies, cross-reactive antibodies and method for producing the same
WO2000018806A1 (en) * 1998-09-25 2000-04-06 Horst Lindhofer Bispecific and trispecific antibodies which specifically react with inducible surface antigens as operational target structures
EP1950300A2 (en) 1998-11-18 2008-07-30 Genentech, Inc. Antibody variants with higher binding affinity compared to parent antibodies
EP2075335A2 (en) 1998-12-22 2009-07-01 Genentech, Inc. Methods and compositions for inhibiting neoplastic cell growth
EP1820859A2 (en) 1998-12-22 2007-08-22 Genentech, Inc. Methods and compositions for inhibiting neoplastic cell growth
EP2319929A1 (en) 1998-12-23 2011-05-11 Genentech, Inc. IL-1 related polypeptides
EP2330198A1 (en) 1998-12-23 2011-06-08 Genentech, Inc. IL-1 related polypeptides
EP2386574A2 (en) 1999-01-15 2011-11-16 Genentech, Inc. Polypeptide variants with altered effector function
EP2364997A2 (en) 1999-01-15 2011-09-14 Genentech, Inc. Polypeptide variants with altered effector function
EP2366713A2 (en) 1999-01-15 2011-09-21 Genentech, Inc. Polypeptide variants with altered effector function
EP1953173A1 (en) 1999-06-15 2008-08-06 Genentech, Inc. Secreted and transmembrane polypeptides and nucleic acids endoding the same
EP1956030A1 (en) 1999-06-15 2008-08-13 Genentech, Inc. Secreted and transmembrane polypeptides and nucleic acids endoding the same
EP2283866A2 (en) 1999-06-25 2011-02-16 Genentech, Inc. Methods of treatment using anti-ERBB antibody-maytansinoid conjugates
EP2283867A2 (en) 1999-06-25 2011-02-16 Genentech, Inc. Methods of treatment using anti-ERBB antibody-maytansinoid conjugates
EP2803367A1 (en) 1999-06-25 2014-11-19 ImmunoGen, Inc. Methods of treatment using anti-ERBB antibody-maytansinoid conjugates
EP2112167A2 (en) 1999-06-25 2009-10-28 Genentech, Inc. Humanized ANTI-ERBB2 antibodies and treatment with ANTI-ERBB2 antibodies
EP2977063A1 (en) 1999-06-25 2016-01-27 Genentech, Inc. Methods of treatment using anti-ErbB antibody-maytansinoid conjugates
EP2110138A1 (en) 1999-08-27 2009-10-21 Genentech, Inc. Dosages for treatment of anti-erbB2 antibodies
EP2111870A1 (en) 1999-08-27 2009-10-28 Genentech, Inc. Dosages for treatment of anti-erbB2 antibodies
WO2001029070A2 (en) 1999-10-20 2001-04-26 Genentech, Inc. Modulation of t cell differentiation for the treatment of t helper cell mediated diseases
EP2228446A1 (en) 1999-12-01 2010-09-15 Genentech, Inc. Secreted and transmembrane polypeptieds and nucleic acids encoding the same
EP2290081A2 (en) 1999-12-23 2011-03-02 Genentech, Inc. IL-17 homologous polypeptide and therapeutic uses thereof
EP2258848A1 (en) 1999-12-23 2010-12-08 Genentech, Inc. Il-17 homologous polypeptide and therapeutic uses thereof
US7235633B2 (en) 2000-03-21 2007-06-26 Genentech, Inc. Cytokine receptors and nucleic acids encoding the same
EP2052742A1 (en) 2000-06-20 2009-04-29 Biogen Idec Inc. Treatment of B-cell associated diseases such as malignancies and autoimmune diseases using a cold anti-CD20 antibody/radiolabeled anti-CD22 antibody combination
EP2075253A1 (en) 2000-06-23 2009-07-01 Genentech, Inc. Compositions and methds for the diagnosis and treatment of disorders involving angiogensis
EP2168980A1 (en) 2000-06-23 2010-03-31 Genentech, Inc. Compositions and methods for the diagnosis and treatment of disorders involving angiogensis
EP2275549A1 (en) 2000-06-23 2011-01-19 Genentech, Inc. Compositions and methods for the diagnosis and treatment of disorders involving angiogenesis
EP2792747A1 (en) 2000-06-23 2014-10-22 Genentech, Inc. Compositions and methods for the diagnosis and treatment of disorders involving angiogenesis
EP2075334A1 (en) 2000-06-23 2009-07-01 Genentech, Inc. EG-VEGF nucleic acids and polypeptides and methods of use
EP2042597A1 (en) 2000-06-23 2009-04-01 Genentech, Inc. Compositions and methods for the diagnosis and treatment of disorders involving angiogenesis
EP2077276A1 (en) 2000-06-23 2009-07-08 Genentech, Inc. Compositions and methods for the diagnosis and treatment of disorders involving angiogensis
EP2014303A2 (en) 2000-07-27 2009-01-14 Genentech, Inc. APO-2L receptor agonist and CPT-11 synergism
EP2330129A2 (en) 2000-08-07 2011-06-08 Centocor Ortho Biotech Inc. Anti-TNF antibodies, compositions, methods and uses
EP2090657A2 (en) 2000-08-07 2009-08-19 Centocor Ortho Biotech Inc. Anti-IL-12 antibodies, compositions, methods and uses
EP2305817A2 (en) 2000-08-07 2011-04-06 Centocor Ortho Biotech Inc. Anti-IL-12 antibodies, compositions, methods and uses
EP3597752A1 (en) 2000-08-07 2020-01-22 Janssen Biotech, Inc. Anti-il-12 antibodies, compositions, methods and uses
EP2253646A1 (en) 2000-08-07 2010-11-24 Centocor Ortho Biotech Inc. Anti-dual integrin antibody and compositions and conjugates comprising said antibody
EP3118318A1 (en) 2000-08-07 2017-01-18 Janssen Biotech, Inc. Anti-tnf antibodies, compositions, methods and uses
EP2159230A1 (en) 2000-08-07 2010-03-03 Centocor Ortho Biotech Inc. Anti-TNF antibodies, compositions, methods and uses
EP2014298A2 (en) 2000-08-24 2009-01-14 Genentech, Inc. Interleukin-22 polypeptides, nucleic acids encoding the same and methods for the treatment of pancreatic disorders
WO2002016625A2 (en) 2000-08-25 2002-02-28 Basf Plant Science Gmbh Plant polynucleotides encoding prenyl proteases
EP1944317A2 (en) 2000-09-01 2008-07-16 Genentech, Inc. Secreted and transmembrane polypeptides and nucleic acids encoding the same
WO2002030463A2 (en) 2000-10-12 2002-04-18 Genentech, Inc. Reduced-viscosity concentrated protein formulations
EP2314318A1 (en) 2001-01-31 2011-04-27 Biogen Idec Inc. CD80 antibody for use in combination with chemotherapeutics to treat B cell malignancies
WO2002060485A2 (en) 2001-01-31 2002-08-08 Idec Pharmaceuticals Corporation Use of immunoregulatory antibodies in the treatment of neoplastic disorders
EP2292301A2 (en) 2001-02-22 2011-03-09 Genentech, Inc. Anti-interferon-alpha antibodies
EP2065467A2 (en) 2001-02-22 2009-06-03 Genentech, Inc. Anti-interferon-alpha antibodies
US7256257B2 (en) 2001-04-30 2007-08-14 Seattle Genetics, Inc. Pentapeptide compounds and uses related thereto
US7423116B2 (en) 2001-04-30 2008-09-09 Seattle Genetics Inc. Pentapeptide compounds and uses related thereto
EP2000545A1 (en) 2001-06-20 2008-12-10 Genentech, Inc. Compositions and methods for the diagnosis and treatment of tumor
EP1992643A2 (en) 2001-06-20 2008-11-19 Genentech, Inc. Compositions and methods for the diagnosis and treatment of tumor
EP2000148A1 (en) 2001-06-20 2008-12-10 Genentech, Inc. Compositions and methods for the diagnosis and treatment of prostate cancer
EP2000482A1 (en) 2001-06-20 2008-12-10 Genentech, Inc. Compositions and methods for the diagnosis and treatment of tumor
EP2311960A2 (en) 2001-08-29 2011-04-20 Genentech, Inc. Bv8 nucleic acids and polypeptides with mitogenic activity
EP2143438A1 (en) 2001-09-18 2010-01-13 Genentech, Inc. Compositions and methods for the diagnosis and treatment of tumor
EP2151244A1 (en) 2001-09-18 2010-02-10 Genentech, Inc. Compositions and methods for the diagnosis and treatment of tumor
EP2153843A1 (en) 2001-09-18 2010-02-17 Genentech, Inc. Compositions and methods for the diagnosis and treatment of tumor
EP2266594A1 (en) 2001-09-19 2010-12-29 Neuronova AB VEGF for use in the treatment of central nervous system disorders
EP2289537A1 (en) 2001-09-19 2011-03-02 Neuronova AB PDGF for use in the treatment of central nervous system disorders
EP2308888A1 (en) 2001-11-14 2011-04-13 Centocor Ortho Biotech Inc. Anti-IL-6 antibodies, compositions, methods and uses
EP2067472A1 (en) 2002-01-02 2009-06-10 Genentech, Inc. Compositions and methods for the diagnosis and treatment of tumor
EP2048154A1 (en) 2002-02-05 2009-04-15 Genentech, Inc. Protein purification
EP2388265A1 (en) 2002-02-22 2011-11-23 Genentech, Inc. Compositions and methods for the treatment of immune related diseases
EP1961428A1 (en) 2002-04-02 2008-08-27 Ucb S.A. SC6 antibody for treatment of cancer
EP2289942A2 (en) 2002-04-10 2011-03-02 Genentech, Inc. Anti-HER2 antibody variants
EP2011886A2 (en) 2002-04-16 2009-01-07 Genentech, Inc. Compositions and methods for the diagnosis and treatment of tumor
EP1933150A1 (en) 2002-05-07 2008-06-18 Institut Pasteur Methods of screening of PP1-interacting polypeptides or proteins, peptides inhibiting PP1c binding to Bcl-2 proteins, BCL-XL and BCL-W, and uses thereof
EP2332956A1 (en) 2002-07-08 2011-06-15 Genentech, Inc. Antibody binding to PRO71238
US7314623B2 (en) 2002-07-15 2008-01-01 Wyeth Methods and compositions for modulating T helper (Th) cell development and function
US7731946B2 (en) 2002-07-15 2010-06-08 Wyeth Llc Methods and compositions for modulating T helper (TH) cell development and function
EP2263691A1 (en) 2002-07-15 2010-12-22 Genentech, Inc. Treatment of cancer with the recombinant humanized monoclonal anti-erbb2 antibody 2C4 (rhuMAb 2C4)
EP2353611A2 (en) 2002-07-31 2011-08-10 Seattle Genetics, Inc. Drug conjugates and their use for treating cancer, an autoimmune disease or an infectious disease
EP2357006A2 (en) 2002-07-31 2011-08-17 Seattle Genetics, Inc. Drug conjugates and their use for treating cancer, an autoimmune disease or an infectious disease
WO2004010957A2 (en) 2002-07-31 2004-02-05 Seattle Genetics, Inc. Drug conjugates and their use for treating cancer, an autoimmune disease or an infectious disease
US9856303B2 (en) 2002-09-09 2018-01-02 Dana-Farber Cancer Institute, Inc. BH3 peptides and method of use thereof
US11225511B2 (en) 2002-09-09 2022-01-18 Howard Hughes Medical Institute BH3 peptides and methods of use thereof
US9902759B2 (en) 2002-09-09 2018-02-27 Dana-Farber Cancer Institute, Inc. BH3 peptides and methods of use thereof
US7868133B2 (en) 2002-09-09 2011-01-11 Dana Farber Cancer Institute, Inc. BH3 peptides and method of use thereof
EP2085096A2 (en) 2002-09-11 2009-08-05 Genentech, Inc. Novel composition and methods for the treatment of immune related diseases
EP2332996A1 (en) 2002-09-11 2011-06-15 Genentech, Inc. Protein Purification
EP2116551A1 (en) 2002-09-11 2009-11-11 Genentech, Inc. Compositions and methods for the treatment of immune related diseases
EP3388452A2 (en) 2002-09-11 2018-10-17 Genentech, Inc. Protein purification
EP2444409A2 (en) 2002-09-16 2012-04-25 Genentech, Inc. Compositions and methods for the treatment of immune related diseases
EP2500438A2 (en) 2002-09-25 2012-09-19 Genentech, Inc. Novel compositions and methods for the treatment of psoriasis
EP2434022A2 (en) 2002-10-03 2012-03-28 Genentech, Inc. Use of A33 antigens and JAM-IT
EP2322202A2 (en) 2002-10-29 2011-05-18 Genentech, Inc. Compositions and methods for the treatment of immune diseases
EP2322201A2 (en) 2002-10-29 2011-05-18 Genentech, Inc. Compositions and methods for the treatment of immune related diseases
EP2322200A2 (en) 2002-10-29 2011-05-18 Genentech, Inc. Compositions and methods for the treatment of immune related diseases
EP2322203A2 (en) 2002-10-29 2011-05-18 Genentech, Inc. Compositions and methods for the treatment of immune related diseases
EP2364716A2 (en) 2002-11-08 2011-09-14 Genentech, Inc. Compositions and methods for the treatment of natural killer cell related diseases
EP2311870A1 (en) 2002-11-26 2011-04-20 Genentech, Inc. Compositions and methods for the treatment of immune related diseases
EP2308968A1 (en) 2002-11-26 2011-04-13 Genentech, Inc. Compositions and methods for the treatment of immune related diseases
EP2311868A1 (en) 2002-11-26 2011-04-20 Genentech, Inc. Compositions and methods for the treatment of immune related diseases
EP2314676A1 (en) 2002-11-26 2011-04-27 Genentech, Inc. Compositions and methods for the treatment of immune related diseases
EP2526960A1 (en) 2003-03-12 2012-11-28 Genentech, Inc. Use of BV8 and/or EG-VEGF to promote hematopoiesis
EP2335725A1 (en) 2003-04-04 2011-06-22 Genentech, Inc. High concentration antibody and protein formulations
EP3178492A1 (en) 2003-04-04 2017-06-14 Genentech, Inc. High concentration antibody and protein formulations
EP2062916A2 (en) 2003-04-09 2009-05-27 Genentech, Inc. Therapy of autoimmune disease in a patient with an inadequate response to a TNF-Alpha inhibitor
EP2083018A2 (en) 2003-04-16 2009-07-29 Genentech, Inc. Compositions and methods relating to STOP-1
EP2251355A1 (en) 2003-05-30 2010-11-17 Genentech, Inc. Treatment with anti-VEGF antibodies
EP2311875A1 (en) 2003-05-30 2011-04-20 Genentech, Inc. Treatment with anti-VEGF antibodies
US9708410B2 (en) 2003-05-30 2017-07-18 Janssen Biotech, Inc. Anti-tissue factor antibodies and compositions
EP2248829A1 (en) 2003-05-30 2010-11-10 Genentech, Inc. Treatment with anti-VEGF antibodies
EP2272868A2 (en) 2003-06-05 2011-01-12 Genentech, Inc. Combination therapy for B cell disorders
EP2093570A1 (en) 2003-06-06 2009-08-26 Genentech, Inc. Modulating the interaction between HGF beta chain and c-met
WO2004112572A2 (en) 2003-06-13 2004-12-29 University Of Pittsburgh Monitoring immunologic, hematologic and inflammatory diseases
EP3594228A1 (en) 2003-07-08 2020-01-15 Genentech, Inc. Il-17a/f heterologous polypedtides and therapeutic uses thereof
EP2784084A1 (en) 2003-07-08 2014-10-01 Genentech, Inc. IL-17 A/F heterologous polypeptides and therapeutics uses thereof
EP2277908A2 (en) 2003-07-08 2011-01-26 Genentech, Inc. IL-17A/F heterologous polypeptides, antibodies and therapeutic uses thereof
EP3722309A1 (en) 2003-07-28 2020-10-14 Genentech, Inc. Reducing protein a leaching during protein a affinity chromatography
EP3095793A1 (en) 2003-07-28 2016-11-23 Genentech, Inc. Reducing protein a leaching during protein a affinity chromatography
EP2014675A1 (en) 2003-08-11 2009-01-14 Genentech, Inc. Compositions and methods for the treatment of immune related diseases
EP2478912A1 (en) 2003-11-06 2012-07-25 Seattle Genetics, Inc. Auristatin conjugates with anti-HER2 or anti-CD22 antibodies and their use in therapy
EP2260858A2 (en) 2003-11-06 2010-12-15 Seattle Genetics, Inc. Monomethylvaline compounds capable of conjugation to ligands
EP3858387A1 (en) 2003-11-06 2021-08-04 Seagen Inc. Monomethylvaline compounds capable of conjugation to ligands
EP2489364A1 (en) 2003-11-06 2012-08-22 Seattle Genetics, Inc. Monomethylvaline compounds onjugated to antibodies
EP2486933A1 (en) 2003-11-06 2012-08-15 Seattle Genetics, Inc. Monomethylvaline compounds conjugated with antibodies
EP3434275A1 (en) 2003-11-06 2019-01-30 Seattle Genetics, Inc. Assay for cancer cells based on the use of auristatin conjugates with antibodies
EP3120861A1 (en) 2003-11-06 2017-01-25 Seattle Genetics, Inc. Intermediate for conjugate preparation comprising auristatin derivatives and a linker
EP2295073A1 (en) 2003-11-17 2011-03-16 Genentech, Inc. Antibody against CD22 for the treatment of tumour of hematopoietic origin
EP2161283A1 (en) 2003-11-17 2010-03-10 Genentech, Inc. Compositions comprising antibodies against CD79b conjugated to a growth inhibitory agent or cytotoxic agent and methods for the treatment of tumor of hematopoietic origin
EP2301568A1 (en) 2003-11-17 2011-03-30 Genentech, Inc. Antibody against IRTA2 for the treatment of tumour of hematopoietic origin
EP1983000A2 (en) 2003-11-21 2008-10-22 UCB Pharma, S.A. Method for the treatment of multiple sclerosis by inhibiting IL-17 activity
US7931900B2 (en) 2003-11-21 2011-04-26 Ucb Pharma S.A. Method for the treatment of multiple sclerosis by inhibiting IL-17 activity
EP2974742A1 (en) 2003-11-21 2016-01-20 UCB Biopharma SPRL Method for the treatment of multiple sclerosis by inhibiting il-17 activity
EP2336178A1 (en) 2003-12-11 2011-06-22 Genentech, Inc. Methods and compositions for inhibiting C-Met dimerization and activation
EP3718564A1 (en) 2003-12-23 2020-10-07 Genentech, Inc. Novel anti-il 13 antibodies and uses thereof
EP2805728A1 (en) 2003-12-23 2014-11-26 Genentech, Inc. Novel anti-IL 13 antibodies and uses thereof
WO2005062972A2 (en) 2003-12-23 2005-07-14 Tanox, Inc. Treatment of cancer with novel anti-il 13 monoclonal antibodies
EP2332575A1 (en) 2003-12-23 2011-06-15 Genentech, Inc. Treatment of cancer with novel anti-IL 13 monoclonal antibodies
EP2351584A1 (en) 2003-12-23 2011-08-03 Genentech, Inc. Novel anti-IL 13 antibodies and uses thereof
US7736635B2 (en) 2003-12-23 2010-06-15 Ucb Pharma S.A. Branched molecular scaffolds for linking polymer residues to biologically active moieties
WO2005070963A1 (en) 2004-01-12 2005-08-04 Applied Molecular Evolution, Inc Fc region variants
EP3653641A1 (en) 2004-02-19 2020-05-20 Genentech, Inc. Cdr-repaired antibodies
WO2005084390A2 (en) 2004-03-02 2005-09-15 Seattle Genetics, Inc. Partially loaded antibodies and methods of their conjugation
EP2404935A1 (en) 2004-03-30 2012-01-11 Glaxo Group Limited Immunoglobulin binding HOSM
EP2216650A1 (en) 2004-04-09 2010-08-11 University of Pittsburgh Real time method of detecting acute inflammatory conditions
US9465029B2 (en) 2004-04-16 2016-10-11 Glaxo Group Limited Methods for detecting LP-PLA2 activity and inhibition of LP-PLA2 activity
US8318905B2 (en) 2004-04-23 2012-11-27 Richard Kroczek Antibodies for depletion of ICOS-positive cells in vivo
US8916155B2 (en) 2004-04-23 2014-12-23 Bundesrepublik Deutschland letztvertreten durch das Robert-Koch-Institut vertreten durch seinen Präsidenten Method for the treatment of T cell mediated conditions by depletion of ICOS-positive cells in vivo
EP2214014A1 (en) 2004-05-11 2010-08-04 The University of Pittsburgh Monitoring immunologic, hematologic and inflammatory diseases
EP2286844A2 (en) 2004-06-01 2011-02-23 Genentech, Inc. Antibody-drug conjugates and methods
EP3130349A1 (en) 2004-06-04 2017-02-15 Genentech, Inc. Method for treating multiple sclerosis
WO2006003407A2 (en) 2004-07-01 2006-01-12 Glaxo Group Limited Chimeric and humanised monoclonal antibodies against inteleukin- 13
EP2436697A1 (en) 2004-07-01 2012-04-04 Glaxo Group Limited Chimeric and humanised monoclonal antibodies against interleukin-13
EP2361931A1 (en) 2004-07-20 2011-08-31 Genentech, Inc. Inhibitors of angiopoietin-like 4 protein, combinations, and their use
WO2006024354A1 (en) * 2004-08-30 2006-03-09 Schering Aktiengesellschaft Treatment of hiv infection by t-cell modulation
EP3498294A1 (en) 2004-10-20 2019-06-19 Genentech, Inc. Antibody formulations
EP2371388A2 (en) 2004-10-20 2011-10-05 Genentech, Inc. Antibody formulations
WO2006132670A2 (en) 2004-11-12 2006-12-14 Seattle Genetics, Inc. Auristatins having an aminobenzoic acid unit at the n terminus
EP3505191A1 (en) 2004-11-12 2019-07-03 Seattle Genetics, Inc. Auristatins having an aminobenzoic acid unit at the n terminus
EP3511344A1 (en) 2004-12-10 2019-07-17 NovImmune S.A. Neutralizing antibodies and methods of use thereof
EP2230517A1 (en) 2005-01-07 2010-09-22 Diadexus, Inc. OVR110 antibody compositions and methods of use
WO2006074418A2 (en) 2005-01-07 2006-07-13 Diadexus, Inc. Ovr110 antibody compositions and methods of use
EP3698807A1 (en) 2005-01-21 2020-08-26 Genentech, Inc. Fixed dosing of her antibodies
EP2392353A1 (en) 2005-01-28 2011-12-07 Janssen Alzheimer Immunotherapy Anti A beta antibody formulation
US8029783B2 (en) 2005-02-02 2011-10-04 Genentech, Inc. DR5 antibodies and articles of manufacture containing same
US8030023B2 (en) 2005-02-02 2011-10-04 Genentech, Inc. Nucleic acid encoding DR5 antibodies and uses thereof
US8409570B2 (en) 2005-02-02 2013-04-02 Genentech, Inc. Method of inducing apoptosis using anti-DR5 antibodies
US8329178B2 (en) 2005-02-18 2012-12-11 Dana-Farber Cancer Institute, Inc. Antibodies against CXCR4 and methods of use thereof
EP2399605A1 (en) 2005-02-23 2011-12-28 Genentech, Inc. Extending time to disease progression or survival in cancer patients
EP3312196A1 (en) 2005-03-23 2018-04-25 Genmab A/S Antibodies against cd38 for treatment of multiple myeloma
EP3153525A1 (en) 2005-03-23 2017-04-12 Genmab A/S Antibodies against cd38 for treatment of multiple myeloma
EP2567976A2 (en) 2005-03-23 2013-03-13 Genmab A/S Antibodies against CD38 for treatment of multiple myeloma
EP2551282A2 (en) 2005-03-23 2013-01-30 Genmab A/S Antibodies against CD38 for treatment of multiple myeloma
EP2535355A2 (en) 2005-03-23 2012-12-19 Genmab A/S Antibodies against CD38 for treatment of multiple myeloma
WO2006108273A1 (en) 2005-04-11 2006-10-19 National Research Council Of Canada Identification of a beta-1,3-n-acetylgalactosaminyltransferase (cgte) from campylobacter jejuni lio87
WO2006113402A1 (en) 2005-04-14 2006-10-26 Genentech, Inc. Methods and compositions for modulating and detecting wisp activity
EP2511299A1 (en) 2005-04-19 2012-10-17 Seattle Genetics, Inc. Humanized anti-CD70 binding agents and uses thereof
EP2267450A2 (en) 2005-04-29 2010-12-29 The Regents of the University of California Antibodies against histone modifications for clinical diagnosis and prognosis of cancer
EP2842968A1 (en) 2005-04-29 2015-03-04 Janssen Biotech, Inc. Anti-IL-6 antibodies, compositions, methods and uses
EP3263581A1 (en) 2005-05-17 2018-01-03 University of Connecticut Compositions and methods for immunomodulation in an organism
EP3805245A1 (en) 2005-05-17 2021-04-14 University of Connecticut Compositions and methods for immunomodulation in an organism
US8454511B2 (en) 2005-05-27 2013-06-04 Board Of Regents, The University Of Texas System Magneto-motive ultrasound detection of magnetic nanoparticles
US8355776B2 (en) 2005-05-27 2013-01-15 Board Of Regents, The University Of Texas System Hemoglobin contrast in magneto-motive optical doppler tomography, optical coherence tomography, and ultrasound imaging methods and apparatus
US9198596B2 (en) 2005-05-27 2015-12-01 Board Of Regents, The University Of Texas System Hemoglobin contrast in magneto-motive optical doppler tomography, optical coherence tomography, and ultrasound imaging methods and apparatus
US9687153B2 (en) 2005-05-27 2017-06-27 Board Of Regents, The University Of Texas System Hemoglobin contrast in magneto-motive optical doppler tomography, optical coherence tomography, and ultrasound imaging methods and apparatus
EP2186402A1 (en) 2005-06-06 2010-05-19 Genentech, Inc. Knock-out animal models for novel genes and methods of use
US7820799B2 (en) 2005-06-17 2010-10-26 Janssen Alzheimer Immunotherapy Methods of purifying Fc region containing proteins
US8440799B2 (en) 2005-06-17 2013-05-14 Janssen Alzheimer Immunotherapy Methods of purifying anti A β antibodies
US7825223B2 (en) 2005-06-17 2010-11-02 Janssen Alzheimer Immunotherapy Methods of purifying anti A β antibodies
EP2388274A1 (en) 2005-06-17 2011-11-23 Janssen Alzheimer Immunotherapy Methods of purifying anti A Beta antibodies
EP3501537A1 (en) 2005-06-30 2019-06-26 Janssen Biotech, Inc. Anti-il23 antibodies, compositions, methods and uses
EP2452694A1 (en) 2005-06-30 2012-05-16 Janssen Biotech, Inc. Anti-IL-23 antibodies, compositions, methods and uses
EP2722051A1 (en) 2005-07-07 2014-04-23 Seattle Genetics, Inc. Monomethylvaline compounds having phenylalanine side-chain modifications at the C-terminus
EP3498289A1 (en) 2005-07-07 2019-06-19 Seattle Genetics, Inc. Monomethylvaline compounds having phenylalanine side-chain modifications at the c-terminus
EP4026840A1 (en) 2005-07-18 2022-07-13 Seagen Inc. Beta-glucuronide-linker drug conjugates
WO2007011968A2 (en) 2005-07-18 2007-01-25 Seattle Genetics, Inc. Beta-glucuronide-linker drug conjugates
EP3248613A1 (en) 2005-07-18 2017-11-29 Seattle Genetics, Inc. Beta-glucuronide drug linker conjugates
EP2573114A1 (en) 2005-08-10 2013-03-27 MacroGenics, Inc. Identification and engineering of antibodies with variant Fc regions and methods of using same
EP1995321A2 (en) 2005-08-15 2008-11-26 Genentech, Inc. Gene disruptions, compositions and methods relating thereto
WO2007048849A1 (en) * 2005-10-28 2007-05-03 Novo Nordisk A/S Fusion proteins that bind effector lymphocytes and target cells
EP2998318A1 (en) 2005-11-04 2016-03-23 Genentech, Inc. Use of complement pathway inhibitors to treat ocular diseases
EP2500030A2 (en) 2005-11-04 2012-09-19 Genentech, Inc. Use of complement pathway inhibitors to treat ocular diseases
EP3299027A1 (en) 2005-11-04 2018-03-28 Genentech, Inc. Use of complement pathway inhibitors to treat ocular diseases
US10450379B2 (en) 2005-11-15 2019-10-22 Genetech, Inc. Method for treating joint damage
US10654940B2 (en) 2005-11-15 2020-05-19 Genentech, Inc. Method for treating joint damage
EP2002714A1 (en) 2005-11-21 2008-12-17 Genentech, Inc. Novel gene disruptions, compositions and methods relating thereto
EP2623516A2 (en) 2005-12-02 2013-08-07 Genentech, Inc. Compositions and methods for the treatment of diseases and disorders associated with cytokine signaling involving antibodies that bind to IL-22 and IL-22R
EP3006466A2 (en) 2005-12-02 2016-04-13 Genentech, Inc. Compositions and methods for the treatment of diseases and disorders associated with cytokine signaling involving antibodies that bind to il-22 and il-22r
WO2007068803A1 (en) 2005-12-14 2007-06-21 Licentia Ltd Novel neurotrophic factor protein and uses thereof
WO2007068784A1 (en) 2005-12-14 2007-06-21 Licentia Ltd Novel neurotrophic factor protein and uses thereof
EP2325208A1 (en) 2005-12-15 2011-05-25 Genentech, Inc. Polyubiquitin antibodies
EP3309170A1 (en) 2005-12-15 2018-04-18 Genentech, Inc. Polyubiquitin antibodies
WO2007068750A2 (en) 2005-12-16 2007-06-21 Glaxo Group Limited Immunoglobulins directed against nogo
EP2228391A2 (en) 2005-12-16 2010-09-15 Glaxo Group Limited Immunoglobulins directed against Nogo
EP3760230A1 (en) 2005-12-29 2021-01-06 Janssen Biotech, Inc. Human anti-il-23 antibodies, compositions, methods and uses
EP3219328A1 (en) 2005-12-29 2017-09-20 Janssen Biotech, Inc. Human anti-il-23 antibodies, compositions, method and uses
EP2548577A1 (en) 2005-12-29 2013-01-23 Janssen Biotech, Inc. Human anti-il-23 antibodies, compositions, methods and uses
EP3156418A1 (en) 2006-01-05 2017-04-19 Genentech, Inc. Anti-ephb4 antibodies and methods using same
EP2402373A2 (en) 2006-01-05 2012-01-04 Genentech, Inc. Anti-EphB4 Antibodies and Methods Using Same
US7803561B2 (en) 2006-02-06 2010-09-28 Rhode Island Hospital GPR30 estrogen receptor in breast cancers
EP2050335A1 (en) 2006-02-17 2009-04-22 Genentech, Inc. Gene disruptions, compositions and methods relating thereto
EP2468772A2 (en) 2006-03-16 2012-06-27 Genentech, Inc. Antibodies to EGFL7 and methods for their use
EP2390666A1 (en) 2006-03-21 2011-11-30 The Regents of The University of California N-Cadherin as target for cancer diagnosis and therapy
EP2366716A2 (en) 2006-03-21 2011-09-21 Genentech, Inc. Combinatorial therapy involving alpha5beta1 antagonists
EP2389947A1 (en) 2006-03-23 2011-11-30 Novartis AG Anti-tumor cell antigen antibody therapeutics
EP2389946A1 (en) 2006-03-23 2011-11-30 Novartis AG Anti-tumor cell antigen antibody therapeutics
EP2389948A1 (en) 2006-03-23 2011-11-30 Novartis AG Anti-tumor cell antigen antibody therapeutics
EP2389951A1 (en) 2006-03-23 2011-11-30 Novartis AG Anti-tumor cell antigen antibody therapeutics
EP2389949A1 (en) 2006-03-23 2011-11-30 Novartis AG Anti-tumor cell antigen antibody therapeutics
EP2389950A1 (en) 2006-03-23 2011-11-30 Novartis AG Anti-tumor cell antigen antibody therapeutics
US9540674B2 (en) 2006-03-31 2017-01-10 Dana-Farber Cancer Institute, Inc. Methods of determining cellular chemosensitivity
US11215608B2 (en) 2006-03-31 2022-01-04 Dana-Farber Cancer Institute, Inc. Methods of determining cellular chemosensitivity
EP2614839A2 (en) 2006-04-05 2013-07-17 Genentech, Inc. Method for using BOC/CDO to modulate hedgehog signaling
EP2082645A1 (en) 2006-04-19 2009-07-29 Genentech, Inc. Novel gene disruptions, compositions and methods relating thereto
US7727525B2 (en) 2006-05-11 2010-06-01 City Of Hope Engineered anti-CD20 antibody fragments for in vivo targeting and therapeutics
EP2446904A2 (en) 2006-05-30 2012-05-02 Genentech, Inc. Anti-CD22 antibodies, their immunoconjugates and uses thereof
EP2447282A2 (en) 2006-05-30 2012-05-02 Genentech, Inc. Anti-CD22 Antibodies, their Immunoconjugates and uses thereof
WO2008036135A2 (en) 2006-06-01 2008-03-27 Genentech, Inc. Crystal structure of crig and c3b: crig complex
WO2007141280A2 (en) 2006-06-06 2007-12-13 Oxford Genome Sciences (Uk) Ltd Proteins
EP2375255A1 (en) 2006-06-06 2011-10-12 Oxford Biotherapeutics Ltd. Proteins
US9090930B2 (en) 2006-06-27 2015-07-28 Emd Millipore Corporation Method and unit for preparing a sample for the microbiological analysis of a liquid
US9410181B2 (en) 2006-06-27 2016-08-09 Emd Millipore Corporation Method and unit for preparing a sample for the microbiological analysis of a liquid
EP2639301A2 (en) 2006-06-30 2013-09-18 Bristol-Myers Squibb Company Polynucleotides encoding novel PCSK9 variants
EP2671946A1 (en) 2006-06-30 2013-12-11 Bristol-Myers Squibb Company Polynucleotides encoding novel PCSK9 variants
EP2471815A1 (en) 2006-07-11 2012-07-04 University Of Medicine And Dentistry Of New Jersey Proteins, nucleic acids encoding the same and associated methods of use
EP2471809A1 (en) 2006-07-11 2012-07-04 University Of Medicine And Dentistry Of New Jersey Proteins, nucleic acids encoding the same and associated methods of use
WO2008011081A2 (en) 2006-07-19 2008-01-24 The Trustees Of The University Of Pennsylvania Wsx-1/p28 as a target for anti-inflammatory responses
EP2520935A2 (en) 2006-08-09 2012-11-07 Homestead Clinical Corporation Organ-specific proteins and methods of their use
WO2008021290A2 (en) 2006-08-09 2008-02-21 Homestead Clinical Corporation Organ-specific proteins and methods of their use
US9867530B2 (en) 2006-08-14 2018-01-16 Volcano Corporation Telescopic side port catheter device with imaging system and method for accessing side branch occlusions
EP2455404A2 (en) 2006-08-22 2012-05-23 G2 Inflammation Pty Ltd Anti-C5AR antibodies with improved properties
EP2423333A1 (en) 2006-08-25 2012-02-29 Oncotherapy Science, Inc. Prognostic markers and therapeutic targets for lung cancer
EP2423332A1 (en) 2006-08-25 2012-02-29 Oncotherapy Science, Inc. Prognostic markers and therapeutic targets for lung cancer
EP2551672A1 (en) 2006-09-21 2013-01-30 Nestec S.A. Antibody-based arrays for detecting multiple signal transducers in rare circulating cells
EP3023789A1 (en) 2006-09-21 2016-05-25 Nestec S.A. Antibody-based arrays for detecting multiple signal transducers in rare circulating cells
WO2008060776A2 (en) 2006-10-03 2008-05-22 University Of Medicine And Dentistry Of New Jersey Atap peptides, nucleic acids encoding the same and associated methods of use
EP3524623A1 (en) 2006-10-18 2019-08-14 UCB Biopharma SPRL Antibody molecules which bind il-17a and il-17f
EP2514764A2 (en) 2006-10-18 2012-10-24 UCB Pharma, S.A. Antibody molecules which bind IL-17A and IL-17F
US8108030B2 (en) 2006-10-20 2012-01-31 Board Of Regents, The University Of Texas System Method and apparatus to identify vulnerable plaques with thermal wave imaging of heated nanoparticles
US9289131B2 (en) 2006-10-20 2016-03-22 Board Of Regents, The University Of Texas System Method and apparatus to identify vulnerable plaques with thermal wave imaging of heated nanoparticles
EP2845866A1 (en) 2006-10-27 2015-03-11 Genentech, Inc. Antibodies and immunoconjugates and uses therefor
WO2008052187A2 (en) 2006-10-27 2008-05-02 Genentech. Inc. Antibodies and immunoconjugates and uses therefor
EP2503341A2 (en) 2006-11-14 2012-09-26 Genentech, Inc. Modulators of Neuronal Regeneration
EP2567975A2 (en) 2006-11-21 2013-03-13 The Regents of The University of California Modulation of RHAMM (CD168) for selective adipose tissue development
EP2962697A1 (en) 2006-11-27 2016-01-06 diaDexus, Inc. Ovr110 antibody compositions and methods of use
EP3181147A1 (en) 2006-11-29 2017-06-21 Genentech, Inc. Il-17a/f heterodimeric polypeptides and therapeutic thereof
EP2450050A1 (en) 2006-11-29 2012-05-09 Genentech, Inc. IL-17A/F heterodimeric polypeptides and therapeutic uses thereof
EP2609932A2 (en) 2006-12-01 2013-07-03 Seattle Genetics, Inc. Variant target binding agents and uses thereof
EP2610267A1 (en) 2006-12-18 2013-07-03 Genentech, Inc. Antagonist anti-Notch3 antibodies and their use in the prevention and treatment of Notch3-related diseases
US10233211B2 (en) 2006-12-21 2019-03-19 Emd Millipore Corporation Purification of proteins
US10793593B2 (en) 2006-12-21 2020-10-06 Emd Millipore Corporation Purification of proteins
US9376464B2 (en) 2006-12-21 2016-06-28 Emd Millipore Corporation Purification of proteins
EP2377527A1 (en) 2007-01-22 2011-10-19 Genentech, Inc. Polyelectrolyte precipitation and purification of antibodies
WO2008103962A2 (en) 2007-02-22 2008-08-28 Genentech, Inc. Methods for detecting inflammatory bowel disease
EP2436781A1 (en) 2007-02-22 2012-04-04 Genentech, Inc. Methods for detecting inflammatory bowel disease
EP3118221A1 (en) 2007-02-26 2017-01-18 Oxford BioTherapeutics Ltd Proteins
EP3118220A1 (en) 2007-02-26 2017-01-18 Oxford BioTherapeutics Ltd Protein
EP2441775A1 (en) 2007-02-26 2012-04-18 Oxford Biotherapeutics Ltd. Protein
EP2447719A1 (en) 2007-02-26 2012-05-02 Oxford Biotherapeutics Ltd. Proteins
EP2899541A1 (en) 2007-03-02 2015-07-29 Genentech, Inc. Predicting response to a HER dimerisation inhbitor based on low HER3 expression
US8940302B2 (en) 2007-03-02 2015-01-27 Genentech, Inc. Predicting response to a HER inhibitor
US7981418B2 (en) 2007-03-02 2011-07-19 Genentech, Inc. Predicting response to a HER inhibitor
US9816981B2 (en) 2007-03-23 2017-11-14 Academia Sinica Alkynyl sugar analogs for labeling and visualization of glycoconjugates in cells
US10317393B2 (en) 2007-03-23 2019-06-11 Academia Sinica Alkynyl sugar analogs for labeling and visualization of glycoconjugates in cells
WO2008118324A2 (en) 2007-03-26 2008-10-02 Macrogenics, Inc. Composition and method of treating cancer with an anti-uroplakin ib antibody
EP3431103A1 (en) 2007-04-12 2019-01-23 The Brigham and Women's Hospital, Inc. Targeting abcb5 for cancer therapy
EP2644205A1 (en) 2007-04-12 2013-10-02 The Brigham and Women's Hospital, Inc. Targeting ABCB5 for cancer therapy
WO2008150525A1 (en) 2007-06-04 2008-12-11 Genentech, Inc. Anti-notch1 nrr antibodies and methods using same
EP2592156A2 (en) 2007-06-08 2013-05-15 Genentech, Inc. Gene expression markers of tumor resistance to HER2 inhibitor treatment
EP2980100A1 (en) 2007-06-08 2016-02-03 Australian Poultry CRC Pty Ltd Clostridial toxin netb
EP2586788A1 (en) 2007-07-09 2013-05-01 Genentech, Inc. Prevention of disulfide bond reduction during recombinant production of polypeptides
EP4219522A2 (en) 2007-07-09 2023-08-02 Genentech, Inc. Prevention of disulfide bond reduction during recombinant production of polypeptides
EP4335863A2 (en) 2007-07-09 2024-03-13 Genentech, Inc. Prevention of disulfide bond reduction during recombinant production of polypeptides
EP4245766A2 (en) 2007-07-09 2023-09-20 Genentech, Inc. Prevention of disulfide bond reduction during recombinant production of polypeptides
EP3327026A1 (en) 2007-07-09 2018-05-30 Genentech, Inc. Prevention of disulfide bond reduction during recombinant production of polypeptides
US11350906B2 (en) 2007-07-12 2022-06-07 Philips Image Guided Therapy Corporation OCT-IVUS catheter for concurrent luminal imaging
US10219780B2 (en) 2007-07-12 2019-03-05 Volcano Corporation OCT-IVUS catheter for concurrent luminal imaging
US9622706B2 (en) 2007-07-12 2017-04-18 Volcano Corporation Catheter for in vivo imaging
US9596993B2 (en) 2007-07-12 2017-03-21 Volcano Corporation Automatic calibration systems and methods of use
EP2474557A2 (en) 2007-07-16 2012-07-11 Genentech, Inc. Anti-CD79b antibodies and immunoconjugates and methods of use
EP2502937A2 (en) 2007-07-16 2012-09-26 Genentech, Inc. Anti-CD 79b Antibodies And Immunoconjugates And Methods Of Use
EP2641618A2 (en) 2007-07-16 2013-09-25 Genentech, Inc. Humanized anti-CD79B antibodies and immunoconjugates and methods of use
EP2537529A1 (en) 2007-08-02 2012-12-26 Gilead Biologics, Inc. Lox and loxl2 inhibitors antibodies and uses thereof
WO2009054873A2 (en) 2007-08-02 2009-04-30 Novimmune S.A. Anti-rantes antibodies and methods of use thereof
WO2009035791A1 (en) 2007-08-02 2009-03-19 Arresto Biosciences Lox and l0xl2 inhibitors and uses thereof
US9228019B2 (en) 2007-08-29 2016-01-05 Sanofi Humanized anti-CXCR5 antibodies, derivatives thereof and their use
US8647622B2 (en) 2007-08-29 2014-02-11 Sanofi Humanized anti-CXCR5 antibodies, derivatives thereof and their use
US9175087B2 (en) 2007-08-29 2015-11-03 Sanofi Humanized anti-CXCR5 antibodies, derivatives thereof and their use
US9243067B2 (en) 2007-08-29 2016-01-26 Sanofi Humanized anti-CXCR5 antibodies, derivatives thereof and their use
US8980262B2 (en) 2007-08-29 2015-03-17 Sanofi Humanized anti-CXCR5 antibodies, derivatives thereof and their use
US9815902B2 (en) 2007-08-29 2017-11-14 Sanofi Humanized anti-CXCR5 antibodies, derivatives thereof and their uses
US11332533B2 (en) 2007-09-26 2022-05-17 Chugai Seiyaku Kabushiki Kaisha Modified antibody constant region
WO2009044208A1 (en) 2007-10-03 2009-04-09 Oxford Genome Sciences (Uk) Limited Protein
US9738728B2 (en) 2007-10-15 2017-08-22 Sanofi Antibodies that bind IL-4 and/or IL-13 and their uses
EP2573119A1 (en) 2007-10-15 2013-03-27 Sanofi Antibodies that bind IL-4 and/or IL-13 and their uses
EP3686220A1 (en) 2007-10-15 2020-07-29 Sanofi Antibodies that bind il-4 and/or il-13 and their uses
EP2573121A1 (en) 2007-10-15 2013-03-27 Sanofi Antibodies that bind il-4 and/or il-13 and their uses
EP2573117A1 (en) 2007-10-15 2013-03-27 Sanofi Antibodies that bind IL-4 and/or IL-13 and their uses
US11453727B2 (en) 2007-10-15 2022-09-27 Sanofi Antibodies that bind IL-4 and/or IL-13 and their uses
EP2573118A1 (en) 2007-10-15 2013-03-27 Sanofi Antibodies that bind IL-4 and/or IL-13 and their uses
WO2009052081A2 (en) 2007-10-15 2009-04-23 Sanofi-Aventis Antibodies that bind il-4 and/or il-13 and their uses
EP2573115A1 (en) 2007-10-15 2013-03-27 Sanofi Antibodies that bind IL-4 and/or IL-13 and their uses
EP2573116A1 (en) 2007-10-15 2013-03-27 Sanofi Antibodies that bind IL-4 and/or IL-13 and their uses
EP2574629A1 (en) 2007-10-15 2013-04-03 Sanofi Antibodies that bind il-4 and/or il-13 and their uses
EP2574630A1 (en) 2007-10-15 2013-04-03 Sanofi Antibodies that bind il-4 and/or il-13 and their uses
US9732162B2 (en) 2007-10-15 2017-08-15 Sanofi Antibodies that bind IL-4 and/or IL-13 and their uses
EP2574626A1 (en) 2007-10-15 2013-04-03 Sanofi Antibodies that bind IL-4 and/or IL-13 and their uses
US8388965B2 (en) 2007-10-15 2013-03-05 Sanofi Antibodies that bind IL-4 and/or IL-13 and their uses
US10759871B2 (en) 2007-10-15 2020-09-01 Sanofi Antibodies that bind IL-4 and/or IL-13 and their uses
EP2233149A1 (en) 2007-10-16 2010-09-29 ZymoGenetics, Inc. Combination of BLYS inhibition and anti-CD20 agents for treatment of autoimmune disease
WO2009052431A2 (en) 2007-10-19 2009-04-23 Seattle Genetics, Inc. Cd19 binding agents and uses thereof
EP3360567A1 (en) 2007-11-07 2018-08-15 Genentech, Inc. Amp for use in treating microbial disorders
US8057796B2 (en) 2007-11-12 2011-11-15 Theraclone Sciences, Inc. Compositions and methods for the therapy and diagnosis of influenza
US8460671B2 (en) 2007-11-12 2013-06-11 Theraclone Sciences, Inc. Compositions and methods for the therapy and diagnosis of influenza
US8114402B2 (en) 2007-11-12 2012-02-14 Theraclone Sciences, Inc. Compositions and methods for the therapy and diagnosis of influenza
EP2261367A2 (en) 2007-11-29 2010-12-15 Genentech, Inc. Gene expression markers for inflammatory bowel disease
EP3173425A1 (en) 2007-11-30 2017-05-31 Genentech, Inc. Anti-vegf antibodies
EP2615115A2 (en) 2007-11-30 2013-07-17 Glaxo Group Limited Antigen-binding constructs
EP2851372A1 (en) 2007-11-30 2015-03-25 Genentech, Inc. Anti-VEGF antibodies
DE112008003232T5 (en) 2007-11-30 2011-02-24 Glaxo Group Limited, Greenford Antigen-binding constructs
EP2641919A2 (en) 2007-11-30 2013-09-25 Glaxo Group Limited Antigen-binding constructs
EP3189831A1 (en) 2007-11-30 2017-07-12 AbbVie Biotechnology Ltd Protein formulations and methods of making same
WO2009068649A2 (en) 2007-11-30 2009-06-04 Glaxo Group Limited Antigen-binding constructs
EP2573563A1 (en) 2007-12-20 2013-03-27 Heptares Therapeutics Limited Screening
US10215754B2 (en) 2007-12-27 2019-02-26 Abbott Laboratories Anti-T. cruzi antibodies and methods of use
US9482667B2 (en) 2007-12-27 2016-11-01 Abbott Laboratories Anti-T. cruzi antibodies and methods of use
US9073984B2 (en) 2007-12-27 2015-07-07 Abbott Laboratories Anti-T. cruzi antibodies and methods of use
EP2730659A2 (en) 2007-12-28 2014-05-14 Elan Pharmaceuticals Inc. Treatment and Prophylaxis of Amyloidosis
WO2009086539A2 (en) 2007-12-28 2009-07-09 Elan Pharmaceuticals, Inc. Treatment and prophylaxis of amyloidosis
EP3693470A1 (en) 2007-12-28 2020-08-12 Prothena Therapeutics Limited Treatment and prophylaxis of amyloidosis
EP4160212A1 (en) 2008-01-15 2023-04-05 The Board of Trustees of the Leland Stanford Junior University Markers of acute myeloid leukemia stem cells
EP3043181A1 (en) 2008-01-15 2016-07-13 The Board of Trustees of The Leland Stanford Junior University Markers of acute myeloid leukemia stem cells
EP3722317A1 (en) 2008-01-15 2020-10-14 The Board of Trustees of the Leland Stanford Junior University Markers of acute myeloid leukemia stem cells
EP4119583A1 (en) 2008-01-30 2023-01-18 Genentech, Inc. Composition comprising antibody that binds to domain ii of her2 and acidic variants thereof
EP3401335A1 (en) 2008-01-30 2018-11-14 Genentech, Inc. Composition comprising antibody that binds to domain ii of her2 and acidic variants thereof
EP2657253A2 (en) 2008-01-31 2013-10-30 Genentech, Inc. Anti-CD79b antibodies and immunoconjugates and methods of use
EP2602623A2 (en) 2008-02-25 2013-06-12 Nestec S.A. Mehtod for the detection of intracellular truncated receptors
EP2618146A2 (en) 2008-02-25 2013-07-24 Nestec S.A. Drug selection for breast cancer therapy using antibody-based arrays
US7982012B2 (en) 2008-03-10 2011-07-19 Theraclone Sciences, Inc. Compositions and methods for the therapy and diagnosis of cytomegalovirus
US8268309B2 (en) 2008-03-10 2012-09-18 Theraclone Sciences, Inc. Compositions and methods for the therapy and diagnosis of cytomegalovirus
US8852594B2 (en) 2008-03-10 2014-10-07 Theraclone Sciences, Inc. Compositions and methods for the therapy and diagnosis of cytomegalovirus infections
EP3045475A1 (en) 2008-04-02 2016-07-20 MacroGenics, Inc. Bcr-complex-specific antibodies and methods of using same
WO2009123894A2 (en) 2008-04-02 2009-10-08 Macrogenics, Inc. Her2/neu-specific antibodies and methods of using same
WO2009151717A2 (en) 2008-04-02 2009-12-17 Macrogenics, Inc. Bcr-complex-specific antibodies and methods of using same
EP3067063A1 (en) 2008-04-02 2016-09-14 MacroGenics, Inc. Her2/neu-specific antibodies and methods of using same
EP3208612A1 (en) 2008-04-09 2017-08-23 Genentech, Inc. Compositions and methods for the treatment of immune related diseases
EP3605088A1 (en) 2008-04-09 2020-02-05 Genentech, Inc. Compositions and methods for the treatment of immune related diseases
EP2975048A2 (en) 2008-04-23 2016-01-20 UCB Biopharma SPRL Epitopes of il-17a and il-17f and antibodies specific thereto
US11319526B2 (en) 2008-05-02 2022-05-03 Seagen Inc. Methods and compositions for making antibodies and antibody derivatives with reduced core fucosylation
WO2010033279A2 (en) 2008-06-04 2010-03-25 Macrogenics, Inc. Antibodies with altered binding to fcrn and methods of using same
US8999702B2 (en) 2008-06-11 2015-04-07 Emd Millipore Corporation Stirred tank bioreactor
US10274488B2 (en) 2008-07-15 2019-04-30 Academia Sinica Glycan arrays on PTFE-like aluminum coated glass slides and related methods
KR20160116056A (en) 2008-08-14 2016-10-06 테바 파마슈티컬즈 오스트레일리아 피티와이 엘티디 Anti-il-12/il-23 antibodies
EP3211008A1 (en) 2008-08-29 2017-08-30 F. Hoffmann-La Roche AG Cross-reactive and bispecific anti-il-17a/f antibodies
WO2010027364A1 (en) 2008-09-07 2010-03-11 Glyconex Inc. Anti-extended type i glycosphingolipid antibody, derivatives thereof and use
WO2010030813A2 (en) 2008-09-10 2010-03-18 Genentech, Inc. Methods for inhibiting ocular angiogenesis
EP3747464A1 (en) 2008-09-16 2020-12-09 F. Hoffmann-La Roche AG Methods for treating progessive multiple sclerosis using an anti-cd20 antibody
EP3095463A2 (en) 2008-09-16 2016-11-23 F. Hoffmann-La Roche AG Methods for treating progressive multiple sclerosis
US11560435B2 (en) 2008-10-06 2023-01-24 Minerva Biotechnologies Corporation MUC1* antibodies
EP4083072A1 (en) 2008-10-06 2022-11-02 Minerva Biotechnologies Corporation Muc1* antibodies
EP3130607A2 (en) 2008-10-06 2017-02-15 Minerva Biotechnologies Corporation Muc1* antibodies
WO2010042562A2 (en) 2008-10-06 2010-04-15 Minerva Biotechnologies Corporation Muc1* antibodies
EP3524620A1 (en) 2008-10-14 2019-08-14 Genentech, Inc. Immunoglobulin variants and uses thereof
WO2010048446A2 (en) 2008-10-22 2010-04-29 Genentech, Inc. Modulation of axon degeneration
US8501178B2 (en) 2008-11-25 2013-08-06 Biogen Idec Ma Inc. Use of DR6 and p75 antagonists to promote survival of cells of the nervous system
US8894999B2 (en) 2008-11-25 2014-11-25 Biogen Idec Ma Inc. Use of DR6 and p75 antagonists to promote survival of cells of the nervous system
US8491905B2 (en) 2008-11-26 2013-07-23 Allergan, Inc. KLK-13 antibody inhibitor for treating dry eye
US8821874B2 (en) 2008-11-26 2014-09-02 Allergan, Inc. KLK-13 antibody inhibitor for treating dry eye
US8211434B2 (en) 2008-11-26 2012-07-03 Allergan, Inc. KLK-13 antibody inhibitor for treating dry eye
WO2010077634A1 (en) 2008-12-09 2010-07-08 Genentech, Inc. Anti-pd-l1 antibodies and their use to enhance t-cell function
EP3929216A1 (en) 2008-12-09 2021-12-29 F. Hoffmann-La Roche AG Anti-pd-l1 antibodies and their use to enhance t-cell function
EP4331604A2 (en) 2008-12-09 2024-03-06 F. Hoffmann-La Roche AG Anti-pd-l1 antibodies and their use to enhance t-cell function
EP4209510A1 (en) 2008-12-09 2023-07-12 F. Hoffmann-La Roche AG Anti-pd-l1 antibodies and their use to enhance t-cell function
EP4169951A1 (en) 2008-12-09 2023-04-26 F. Hoffmann-La Roche AG Anti-pd-l1 antibodies and their use to enhance t-cell function
EP3255060A1 (en) 2008-12-09 2017-12-13 F. Hoffmann-La Roche AG Anti-pd-l1 antibodies and their use to enhance t-cell function
EP3447073A1 (en) 2008-12-09 2019-02-27 F. Hoffmann-La Roche AG Anti-pd-l1 antibodies and their use to enhance t-cell function
US9803165B2 (en) 2008-12-16 2017-10-31 Emd Millipore Corporation Stirred tank reactor and method
WO2010074702A1 (en) 2008-12-16 2010-07-01 Millipore Corporation Purification of proteins
WO2010080528A1 (en) 2008-12-17 2010-07-15 Genentech, Inc. Hepatitis c virus combination therapy
WO2010070094A1 (en) 2008-12-19 2010-06-24 Glaxo Group Limited Myostatin binding proteins
WO2010075249A2 (en) 2008-12-22 2010-07-01 Genentech, Inc. A method for treating rheumatoid arthritis with b-cell antagonists
EP3318573A1 (en) 2008-12-23 2018-05-09 F. Hoffmann-La Roche AG Mmunoglobulin variants with altered binding to protein a
WO2010075548A2 (en) 2008-12-23 2010-07-01 Genentech, Inc. Immunoglobulin variants with altered binding to protein a
WO2010084408A2 (en) 2009-01-21 2010-07-29 Oxford Biotherapeutics Ltd. Pta089 protein
WO2010097386A1 (en) 2009-02-24 2010-09-02 Glaxo Group Limited Antigen-binding constructs
WO2010097394A1 (en) 2009-02-24 2010-09-02 Glaxo Group Limited Multivalent and/or multispecific rankl-binding constructs
WO2010097385A1 (en) 2009-02-24 2010-09-02 Glaxo Group Limited Antigen-binding constructs
EP3260136A1 (en) 2009-03-17 2017-12-27 Theraclone Sciences, Inc. Human immunodeficiency virus (hiv) -neutralizing antibodies
EP3323427A1 (en) 2009-03-17 2018-05-23 Theraclone Sciences, Inc. Human immunodeficiency virus (hiv)-neutralizing antibodies
EP4085925A1 (en) 2009-03-17 2022-11-09 International AIDS Vaccine Initiative Human immunodeficiency virus (hiv)-neutralizing antibodies
US10000571B2 (en) 2009-03-25 2018-06-19 Genentech, Inc. Anti-FGFR3 antibodies and methods using same
US9161977B2 (en) 2009-03-25 2015-10-20 F. Hoffmann-La Roche Ag Anti-FGFR3 antibodies and methods using same
WO2010111254A1 (en) 2009-03-25 2010-09-30 Genentech, Inc. Novel anti-alpha5beta1 antibodies and uses thereof
EP2679600A1 (en) 2009-03-25 2014-01-01 Genentech, Inc. Anti-FGFR3 antibodies and methods using same
US10287356B2 (en) 2009-03-25 2019-05-14 Genentech, Inc. Anti-FGFR3 antibodies and methods using same
US8410250B2 (en) 2009-03-25 2013-04-02 Genentech, Inc. Anti-FGFR3 antibodies and methods using same
US9499623B2 (en) 2009-03-25 2016-11-22 Genentech, Inc. Anti-FGFR3 antibodies and methods using same
WO2010111367A1 (en) 2009-03-25 2010-09-30 Genentech, Inc. Anti-fgfr3 antibodies and methods using same
US11401333B2 (en) 2009-03-25 2022-08-02 Genentech, Inc. Anti-FGFR3 antibodies and methods using same
US8710189B2 (en) 2009-03-25 2014-04-29 Genentech, Inc. Anti-FGFR3 antibodies and methods using same
WO2010114859A1 (en) 2009-04-01 2010-10-07 Genentech, Inc. Treatment of insulin-resistant disorders
WO2010120561A1 (en) 2009-04-01 2010-10-21 Genentech, Inc. Anti-fcrh5 antibodies and immunoconjugates and methods of use
WO2010118243A2 (en) 2009-04-08 2010-10-14 Genentech, Inc. Use of il-27 antagonists to treat lupus
US8609101B2 (en) 2009-04-23 2013-12-17 Theraclone Sciences, Inc. Granulocyte-macrophage colony-stimulating factor (GM-CSF) neutralizing antibodies
WO2010128407A2 (en) 2009-05-05 2010-11-11 Novimmune S.A. Anti-il-17f antibodies and methods of use thereof
US8858948B2 (en) 2009-05-20 2014-10-14 Theraclone Sciences, Inc. Compositions and methods for the therapy and diagnosis of influenza
WO2011005715A1 (en) 2009-07-07 2011-01-13 Genentech, Inc. Diagnosis and treatment of autoimmune demyelinating diseases
WO2011008990A1 (en) 2009-07-15 2011-01-20 Prometheus Laboratories Inc. Drug selection for gastric cancer therapy using antibody-based arrays
EP2757160A2 (en) 2009-07-20 2014-07-23 Genentech, Inc. Gene expression markers for Crohn's disease
WO2011011339A1 (en) 2009-07-20 2011-01-27 Genentech, Inc. Gene expression markers for crohn's disease
EP2584049A2 (en) 2009-07-20 2013-04-24 Genentech, Inc. Gene expression markers for Crohn's disease
WO2011014457A1 (en) 2009-07-27 2011-02-03 Genentech, Inc. Combination treatments
WO2011014750A1 (en) 2009-07-31 2011-02-03 Genentech, Inc. Inhibition of tumor metastasis using bv8- or g-csf-antagonists
US10662237B2 (en) 2009-08-06 2020-05-26 Genentech, Inc. Method to improve virus filtration capacity
EP3309168A1 (en) 2009-08-06 2018-04-18 F. Hoffmann-La Roche AG Method to improve virus removal in protein purification
US11225513B2 (en) 2009-08-06 2022-01-18 Genentech, Inc. Method to improve virus filtration capacity
WO2011031397A1 (en) 2009-08-06 2011-03-17 Genentech, Inc. Method to improve virus removal in protein purification
WO2011019620A1 (en) 2009-08-10 2011-02-17 Genentech, Inc. Antibodies with enhanced adcc function
EP3760712A1 (en) 2009-08-11 2021-01-06 F. Hoffmann-La Roche AG Production of proteins in glutamine-free cell culture media
WO2011019619A1 (en) 2009-08-11 2011-02-17 Genentech, Inc. Production of proteins in glutamine-free cell culture media
WO2011019679A1 (en) 2009-08-11 2011-02-17 Allergan, Inc. Ccr2 inhibitors for treating conditions of the eye
WO2011019622A1 (en) 2009-08-14 2011-02-17 Genentech, Inc. Cell culture methods to make antibodies with enhanced adcc function
US9428548B2 (en) 2009-09-01 2016-08-30 Genentech, Inc. Enhanced protein purification through a modified protein A elution
WO2011028753A1 (en) 2009-09-01 2011-03-10 Genentech, Inc. Enhanced protein purification through a modified protein a elution
EP3736338A1 (en) 2009-09-01 2020-11-11 F. Hoffmann-La Roche AG Enhanced protein purification through a modified protein a elution
WO2011028950A1 (en) 2009-09-02 2011-03-10 Genentech, Inc. Mutant smoothened and methods of using the same
US9096877B2 (en) 2009-10-07 2015-08-04 Macrogenics, Inc. Fc region-containing polypeptides that exhibit improved effector function due to alterations of the extent of fucosylation, and methods for their use
WO2011044368A1 (en) 2009-10-07 2011-04-14 Macrogenics, Inc. Fc region-containing polypeptides that exhibit improved effector function due to alterations of the extent of fucosylation, and methods for their use
US8535912B2 (en) 2009-10-15 2013-09-17 Genentech, Inc. Chimeric fibroblast growth factors with altered receptor specificity
WO2011050069A1 (en) 2009-10-20 2011-04-28 Prometheus Laboratories Inc. Proximity-mediated assays for detecting oncogenic fusion proteins
WO2011050194A1 (en) 2009-10-22 2011-04-28 Genentech, Inc. Methods and compositions for modulating hepsin activation of macrophage-stimulating protein
EP3011970A2 (en) 2009-10-22 2016-04-27 F. Hoffmann-La Roche AG Modulation of axon degeneration
WO2011050188A1 (en) 2009-10-22 2011-04-28 Genentech, Inc. Anti-hepsin antibodies and methods using same
US8697386B2 (en) 2009-10-22 2014-04-15 Genentech, Inc. Methods and compositions for modulating hepsin activation of macrophage-stimulating protein
WO2011056497A1 (en) 2009-10-26 2011-05-12 Genentech, Inc. Activin receptor type iib compositions and methods of use
WO2011056494A1 (en) 2009-10-26 2011-05-12 Genentech, Inc. Activin receptor-like kinase-1 antagonist and vegfr3 antagonist combinations
WO2011056502A1 (en) 2009-10-26 2011-05-12 Genentech, Inc. Bone morphogenetic protein receptor type ii compositions and methods of use
WO2011054007A1 (en) 2009-11-02 2011-05-05 Oxford Biotherapeutics Ltd. Ror1 as therapeutic and diagnostic target
EP2322149A1 (en) 2009-11-03 2011-05-18 Universidad del Pais Vasco Methods and compositions for the treatment of ischemia
WO2011054820A1 (en) 2009-11-03 2011-05-12 Universidad Del País Vasco Methods and compositions for the treatment of white matter ischemia
WO2011057120A1 (en) 2009-11-05 2011-05-12 Genentech, Inc. Methods and composition for secretion of heterologous polypeptides
WO2011060246A2 (en) 2009-11-12 2011-05-19 Genentech, Inc. A method of promoting dendritic spine density
EP3348277A1 (en) 2009-11-20 2018-07-18 The Regents of The University of California Epithelial membrane protein-2 (emp2) and proliferative vitreoretinopathy (pvr)
EP3002297A2 (en) 2009-11-30 2016-04-06 F. Hoffmann-La Roche AG Antibodies for treating and diagnosing tumors expressing slc34a2 (tat211)
WO2011066503A2 (en) 2009-11-30 2011-06-03 Genentech, Inc. Compositions and methods for the diagnosis and treatment of tumor
US11377485B2 (en) 2009-12-02 2022-07-05 Academia Sinica Methods for modifying human antibodies by glycan engineering
US10087236B2 (en) 2009-12-02 2018-10-02 Academia Sinica Methods for modifying human antibodies by glycan engineering
US11267870B2 (en) 2009-12-02 2022-03-08 Academia Sinica Methods for modifying human antibodies by glycan engineering
WO2011080050A2 (en) 2009-12-11 2011-07-07 Novartis Ag Binding molecules
WO2011071577A1 (en) 2009-12-11 2011-06-16 Genentech, Inc. Anti-vegf-c antibodies and methods using same
WO2011084750A1 (en) 2009-12-21 2011-07-14 Genentech, Inc. Antibody formulation
EP3616719A1 (en) 2009-12-21 2020-03-04 F. Hoffmann-La Roche AG Antibody formulation
WO2011079185A1 (en) 2009-12-23 2011-06-30 Genentech, Inc. Anti-bv8 antibodies and uses thereof
US9266948B2 (en) 2009-12-23 2016-02-23 Genentech, Inc. Anti-Bv8 antibodies and uses thereof
EP2338492A1 (en) 2009-12-24 2011-06-29 Universidad del Pais Vasco Methods and compositions for the treatment of alzheimer
WO2011076946A2 (en) 2009-12-24 2011-06-30 Universidad Del País Vasco Methods and compositions for the treatment of alzheimer
EP3450459A2 (en) 2009-12-28 2019-03-06 OncoTherapy Science, Inc. Anti-cdh3 antibodies and uses thereof
WO2011082187A1 (en) 2009-12-30 2011-07-07 Genentech, Inc. Methods for modulating a pdgf-aa mediated biological response
WO2011094259A2 (en) 2010-01-28 2011-08-04 Glaxo Group Limited Cd127 binding proteins
WO2011094759A2 (en) 2010-02-01 2011-08-04 The Regents Of The University Of California Novel diagnostic and therapeutic targets associated with or regulated by n-cadherin expression and/or epithelial to mesenchymal transition (emt) in prostate cancer and other malignancies
WO2011095506A1 (en) 2010-02-03 2011-08-11 Ucb Pharma, S.A. Process for obtaining antibodies
WO2011100403A1 (en) 2010-02-10 2011-08-18 Immunogen, Inc Cd20 antibodies and uses thereof
EP4219560A2 (en) 2010-02-18 2023-08-02 The Regents of The University of California Integrin alpha v beta 8 neutralizing antibody
WO2011103242A1 (en) 2010-02-18 2011-08-25 Genentech, Inc. Neuregulin antagonists and use thereof in treating cancer
WO2011106297A2 (en) 2010-02-23 2011-09-01 Genentech, Inc. Compositions and methods for the diagnosis and treatment of tumor
WO2011107480A1 (en) 2010-03-03 2011-09-09 Glaxo Group Limited Antigen binding proteins specific for serum amyloid p component
EP3025729A1 (en) 2010-03-03 2016-06-01 Glaxo Group Limited Antigen binding proteins specific for serum amyloid p component
WO2011119888A2 (en) 2010-03-24 2011-09-29 The Regents Of The University Of California N-cadherin: target for cancer diagnosis and therapy
WO2011119661A1 (en) 2010-03-24 2011-09-29 Genentech, Inc. Anti-lrp6 antibodies
US10781254B2 (en) 2010-03-26 2020-09-22 The Trustees Of Dartmouth College VISTA regulatory T cell mediator protein, VISTA binding agents and use thereof
US10745467B2 (en) 2010-03-26 2020-08-18 The Trustees Of Dartmouth College VISTA-Ig for treatment of autoimmune, allergic and inflammatory disorders
WO2011123507A1 (en) 2010-03-30 2011-10-06 Centocor Ortho Biotech Inc. Humanized il-25 antibodies
WO2011136911A2 (en) 2010-04-09 2011-11-03 Aveo Pharmaceuticals, Inc. Anti-erbb3 antibodies
US10338069B2 (en) 2010-04-12 2019-07-02 Academia Sinica Glycan arrays for high throughput screening of viruses
WO2011133931A1 (en) 2010-04-22 2011-10-27 Genentech, Inc. Use of il-27 antagonists for treating inflammatory bowel disease
WO2011139718A1 (en) 2010-05-03 2011-11-10 Genentech, Inc. Compositions and methods useful for reducing the viscosity of protein-containing formulations
WO2011139985A1 (en) 2010-05-03 2011-11-10 Genentech, Inc. Compositions and methods for the diagnosis and treatment of tumor
US9403855B2 (en) 2010-05-10 2016-08-02 Academia Sinica Zanamivir phosphonate congeners with anti-influenza activity and determining oseltamivir susceptibility of influenza viruses
US9874562B2 (en) 2010-05-10 2018-01-23 Academia Sinica Zanamivir phosphonate congeners with anti-influenza activity and determining oseltamivir susceptibility of influenza viruses
US9217048B2 (en) 2010-05-17 2015-12-22 Emd Millipore Corporation Stimulus responsive polymers for the purification of biomolecules
US8691918B2 (en) 2010-05-17 2014-04-08 Emd Millipore Corporation Stimulus responsive polymers for the purification of biomolecules
US9731288B2 (en) 2010-05-17 2017-08-15 Emd Millipore Corporation Stimulus responsive polymers for the purification of biomolecules
WO2011146568A1 (en) 2010-05-19 2011-11-24 Genentech, Inc. Predicting response to a her inhibitor
EP3299380A1 (en) 2010-05-25 2018-03-28 F. Hoffmann-La Roche AG Methods of purifying polypeptides
WO2011150110A1 (en) 2010-05-25 2011-12-01 Genentech, Inc. Methods of purifying polypeptides
WO2011147834A1 (en) 2010-05-26 2011-12-01 Roche Glycart Ag Antibodies against cd19 and uses thereof
US11046987B2 (en) 2010-05-28 2021-06-29 Genentech, Inc. Decreasing lactate level and increasing polypeptide production by downregulating the expression of lactate dehydrogenase and pyruvate dehydrogenase kinase
US9487809B2 (en) 2010-05-28 2016-11-08 Genentech, Inc. Decreasing lactate level and increasing polypeptide production by downregulating the expression of lactate dehydrogenase and pyruvate dehydrogenase kinase
US10011856B2 (en) 2010-05-28 2018-07-03 Genentech, Inc. Decreasing lactate level and increasing polypeptide production by downregulating the expression of lactate dehydrogenase and pyruvate dehydrogenase kinase
WO2011150241A2 (en) 2010-05-28 2011-12-01 Genentech, Inc. Decreasing lactate level and increasing polypeptide production by downregulating the expression of lactate dehydrogenase and pyruvate dehydrogenase kinase
US10704071B2 (en) 2010-05-28 2020-07-07 Genentech, Inc. Decreasing lactate level and increasing polypeptide production by down regulating the expression of lactate dehydrogenase and pyruvate dehydrogenase kinase
WO2011151432A1 (en) 2010-06-03 2011-12-08 Glaxo Group Limited Humanised antigen binding proteins to myostatin6
WO2011153346A1 (en) 2010-06-03 2011-12-08 Genentech, Inc. Immuno-pet imaging of antibodies and immunoconjugates and uses therefor
US8771966B2 (en) 2010-06-03 2014-07-08 Genentech, Inc. Immuno-PET imaging of antibodies and immunoconjugates and uses therefor
WO2011159655A2 (en) 2010-06-16 2011-12-22 Allergan, Inc. IL23p19 ANTIBODY INHIBITOR FOR TREATING OCULAR AND OTHER CONDITIONS
US8853369B2 (en) 2010-06-18 2014-10-07 Genentech, Inc. Anti-Axl antibodies and methods of use
USRE47761E1 (en) 2010-06-18 2019-12-10 Genentech, Inc. Anti-axl antibodies and methods of use
EP3098240A2 (en) 2010-06-18 2016-11-30 F. Hoffmann-La Roche AG Anti-axl antibodies and methods of use
EP3323830A1 (en) 2010-06-19 2018-05-23 Memorial Sloan-Kettering Cancer Center Anti-gd2 antibodies
EP4269563A2 (en) 2010-06-19 2023-11-01 Memorial Sloan-Kettering Cancer Center Anti-gd2 antibodies
WO2011161119A1 (en) 2010-06-22 2011-12-29 F. Hoffmann-La Roche Ag Antibodies against insulin-like growth factor i receptor and uses thereof
WO2011161189A1 (en) 2010-06-24 2011-12-29 F. Hoffmann-La Roche Ag Anti-hepsin antibodies and methods of use
US9133524B2 (en) 2010-07-01 2015-09-15 The Regents Of The University Of California Protein kinase ck2 gene mutations, amplifications and polymorphisms in human cancers and methods of use
WO2012006503A1 (en) 2010-07-09 2012-01-12 Genentech, Inc. Anti-neuropilin antibodies and methods of use
WO2012010551A1 (en) 2010-07-19 2012-01-26 F. Hoffmann-La Roche Ag Method to identify a patient with an increased likelihood of responding to an anti-cancer therapy
EP2848939A1 (en) 2010-07-19 2015-03-18 F. Hoffmann-La Roche AG Method to identify a patient with an increased likelihood of responding to an anti-cancer therapy
WO2012010550A1 (en) 2010-07-19 2012-01-26 F. Hoffmann-La Roche Ag Method to identify a patient with an increased likelihood of responding to an anti-cancer therapy
EP2848940A1 (en) 2010-07-19 2015-03-18 F. Hoffmann-La Roche AG Method to identify a patient with an increased likelihood of responding to an anti-cancer therapy
WO2012010547A1 (en) 2010-07-19 2012-01-26 F. Hoffmann-La Roche Ag Method to identify a patient with an increased likelihood of responding to an anti-cancer therapy
EP2824457A1 (en) 2010-07-19 2015-01-14 F. Hoffmann-La Roche AG Method to identify a patient with an increased likelihood of responding to an anti-cancer therapy
WO2012010548A1 (en) 2010-07-19 2012-01-26 F. Hoffmann-La Roche Ag Method to identify a patient with an increased likelihood of responding to an anti-cancer therapy
WO2012010549A1 (en) 2010-07-19 2012-01-26 F. Hoffmann-La Roche Ag Method to identify a patient with an increased likelihood of responding to an anti-cancer therapy
EP2866032A1 (en) 2010-07-19 2015-04-29 F. Hoffmann-La Roche AG Method to identify a patient with an increased likelihood of responding to an anti-cancer therapy
EP2801826A1 (en) 2010-07-19 2014-11-12 F. Hoffmann-La Roche AG Method to identify a patient with an increased likelihood of responding to an anti-cancer therapy
WO2012010582A1 (en) 2010-07-21 2012-01-26 Roche Glycart Ag Anti-cxcr5 antibodies and methods of use
WO2012013930A2 (en) 2010-07-27 2012-02-02 Ucb Pharma S.A. Process for purifying proteins
WO2012018771A1 (en) 2010-08-03 2012-02-09 Genentech, Inc. Chronic lymphocytic leukemia (cll) biomarkers
WO2012017003A1 (en) 2010-08-05 2012-02-09 F. Hoffmann-La Roche Ag Anti-mhc antibody anti-viral cytokine fusion protein
US8900590B2 (en) 2010-08-12 2014-12-02 Theraclone Sciences, Inc. Anti-hemagglutinin antibody compositions and methods of use thereof
WO2012020072A1 (en) 2010-08-12 2012-02-16 Westfälische Wilhelms-Universität Muenster Anti-syndecan-4 antibodies
WO2012020038A1 (en) 2010-08-13 2012-02-16 Roche Glycart Ag Anti-tenascin-c a2 antibodies and methods of use
EP2420250A1 (en) 2010-08-13 2012-02-22 Universitätsklinikum Münster Anti-Syndecan-4 antibodies
WO2012020006A2 (en) 2010-08-13 2012-02-16 Roche Glycart Ag Anti-fap antibodies and methods of use
EP3333194A1 (en) 2010-08-13 2018-06-13 Roche Glycart AG Anti-fap antibodies and methods of use
WO2012021773A1 (en) 2010-08-13 2012-02-16 Genentech, Inc. Antibodies to il-1beta and il-18, for treatment of disease
WO2012022734A2 (en) 2010-08-16 2012-02-23 Medimmune Limited Anti-icam-1 antibodies and methods of use
WO2012025536A1 (en) 2010-08-25 2012-03-01 F. Hoffmann-La Roche Ag Antibodies against il-18r1 and uses thereof
US8883975B2 (en) 2010-08-25 2014-11-11 Hoffmann-La Roche, Inc. Antibodies against IL-18R1 and uses thereof
EP4226935A2 (en) 2010-08-31 2023-08-16 Theraclone Sciences, Inc. Human immunodeficiency virus (hiv)-neutralizing antibodies
EP3264089A1 (en) 2010-08-31 2018-01-03 Genentech, Inc. Biomarkers and methods of treatment
WO2012031027A1 (en) 2010-08-31 2012-03-08 Genentech, Inc. Biomarkers and methods of treatment
EP2926830A2 (en) 2010-08-31 2015-10-07 Theraclone Sciences, Inc. Human immunodeficiency virus (HIV)-neutralizing antibodies
EP3556396A1 (en) 2010-08-31 2019-10-23 Theraclone Science, Int. Human immunodeficiency virus (hiv)-neutralizing antibodies
EP4085924A1 (en) 2010-08-31 2022-11-09 Theraclone Sciences, Inc. Human immunodeficiency virus (hiv)-neutralizing antibodies
WO2012047968A2 (en) 2010-10-05 2012-04-12 Genentech, Inc. Mutant smoothened and methods of using the same
WO2012061129A1 (en) 2010-10-25 2012-05-10 Genentech, Inc Treatment of gastrointestinal inflammation and psoriasis a
EP3214442A1 (en) 2010-10-25 2017-09-06 F. Hoffmann-La Roche AG Treatment of gastrointestinal inflammation and psoriasis and asthmainflammation and psoriasis a
US9562109B2 (en) 2010-11-05 2017-02-07 Zymeworks Inc. Stable heterodimeric antibody design with mutations in the Fc domain
WO2012058768A1 (en) 2010-11-05 2012-05-10 Zymeworks Inc. Stable heterodimeric antibody design with mutations in the fc domain
WO2012058726A1 (en) 2010-11-05 2012-05-10 Transbio Ltd Markers of endothelial progenitor cells and uses thereof
US10875931B2 (en) 2010-11-05 2020-12-29 Zymeworks, Inc. Stable heterodimeric antibody design with mutations in the Fc domain
WO2012064836A1 (en) 2010-11-10 2012-05-18 Genentech, Inc. Methods and compositions for neural disease immunotherapy
EP3176184A1 (en) 2010-11-10 2017-06-07 F. Hoffmann-La Roche AG Methods and compositions for neural disease immunotherapy
WO2012099566A1 (en) 2010-11-17 2012-07-26 Sea Lane Biotechnologies, Llc Influenza virus neutralizing agents that mimic the binding site of an influenza neutralizing antibody
EP2853542A1 (en) 2010-11-24 2015-04-01 Glaxo Group Limited Multispecific antigen binding proteins targeting HGF
WO2012069557A1 (en) 2010-11-24 2012-05-31 Glaxo Group Limited Multispecific antigen binding proteins targeting hgf
WO2012071436A1 (en) 2010-11-24 2012-05-31 Genentech, Inc. Method of treating autoimmune inflammatory disorders using il-23r loss-of-function mutants
EP3208282A1 (en) 2010-11-30 2017-08-23 F. Hoffmann-La Roche AG Low affinity anti transferrin receptor and their use to transfer therapeutic scfv across the blood brain barrier
WO2012075037A1 (en) 2010-11-30 2012-06-07 Genentech, Inc. Low affinity blood brain barrier receptor antibodies and uses therefor
US9995755B2 (en) 2010-12-16 2018-06-12 Genentech, Inc. Diagnosis and treatments relating to TH2 inhibition
US11226341B2 (en) 2010-12-16 2022-01-18 Genentech, Inc. Method of treating asthma using an IL-13 antibody
US9684000B2 (en) 2010-12-16 2017-06-20 Genentech, Inc. Diagnosis and treatments relating to TH2 inhibition
EP3447491A2 (en) 2010-12-16 2019-02-27 F. Hoffmann-La Roche AG Diagnosis and treatments relating to th2 inhibition
EP3296321A1 (en) 2010-12-20 2018-03-21 F. Hoffmann-La Roche AG Anti-mesothelin antibodies and immunoconjugates
WO2012087962A2 (en) 2010-12-20 2012-06-28 Genentech, Inc. Anti-mesothelin antibodies and immunoconjugates
WO2012088313A1 (en) 2010-12-22 2012-06-28 Genentech, Inc. Anti-pcsk9 antibodies and methods of use
US11141063B2 (en) 2010-12-23 2021-10-12 Philips Image Guided Therapy Corporation Integrated system architectures and methods of use
WO2012088337A1 (en) 2010-12-23 2012-06-28 Prometheus Laboratories Inc. Drug selection for malignant cancer therapy using antibody-based arrays
US11040140B2 (en) 2010-12-31 2021-06-22 Philips Image Guided Therapy Corporation Deep vein thrombosis therapeutic methods
WO2012092539A2 (en) 2010-12-31 2012-07-05 Takeda Pharmaceutical Company Limited Antibodies to dll4 and uses thereof
WO2012093254A1 (en) 2011-01-07 2012-07-12 Ucb Pharma S.A. Lipocalin 2 as a biomarker for il-17 inhibitor therapy efficacy
US10208349B2 (en) 2011-01-07 2019-02-19 Ucb Biopharma Sprl Lipocalin 2 as a biomarker for IL-17 inhibitor therapy efficacy
EP3534159A1 (en) 2011-01-07 2019-09-04 UCB Biopharma SPRL Lipocalin 2 as a biomarker for il-17 inhibitor therapy efficacy
US11466324B2 (en) 2011-01-07 2022-10-11 UCB Biopharma SRL Lipocalin 2 as a biomarker for IL-17 inhibitor therapy efficacy
US9034600B2 (en) 2011-01-14 2015-05-19 Ucb Biopharma Sprl DNA encoding antibody molecules which bind IL-17A and IL-17F
WO2012095662A1 (en) 2011-01-14 2012-07-19 Ucb Pharma S.A. Antibody molecules which bind il-17a and il-17f
US11919950B2 (en) 2011-01-14 2024-03-05 UCB Biopharma SRL Expression vector encoding antibody molecule which binds IL-17A and IL-17F
US8580265B2 (en) 2011-01-14 2013-11-12 Ucb Pharma S.A. Antibody molecules which bind IL-17A and IL-17F
US9988446B2 (en) 2011-01-14 2018-06-05 Ucb Biopharma Sprl Methods of treatment using antibodies which bind IL-17A and IL-17F
EP3219728A1 (en) 2011-01-14 2017-09-20 UCB Biopharma SPRL Antibody molecules which bind il-17a and il-17f
WO2012100835A1 (en) 2011-01-28 2012-08-02 Laboratorios Del Dr. Esteve, S.A. Methods and compositions for the treatment of aids
US8916160B2 (en) 2011-02-14 2014-12-23 Theraclone Sciences, Inc. Compositions and methods for the therapy and diagnosis of influenza
WO2012119989A2 (en) 2011-03-04 2012-09-13 Oryzon Genomics, S.A. Methods and antibodies for the diagnosis and treatment of cancer
WO2012125614A1 (en) 2011-03-15 2012-09-20 Theraclone Sciences, Inc. Compositions and methods for the therapy and diagnosis of influenza
US11008389B2 (en) 2011-03-16 2021-05-18 Sanofi Uses of a dual V region antibody-like protein
EP3590965A1 (en) 2011-03-29 2020-01-08 Roche Glycart AG Antibody fc variants
WO2012130831A1 (en) 2011-03-29 2012-10-04 Roche Glycart Ag Antibody fc variants
EP3412309A1 (en) 2011-03-31 2018-12-12 F. Hoffmann-La Roche AG Methods of administering beta7 integrin antagonists
WO2012138997A1 (en) 2011-04-07 2012-10-11 Amgen Inc. Novel egfr binding proteins
WO2012138975A1 (en) 2011-04-07 2012-10-11 Genentech, Inc. Anti-fgfr4 antibodies and methods of use
WO2012143379A1 (en) 2011-04-20 2012-10-26 Roche Glycart Ag Method and constructs for the ph dependent passage of the blood-brain-barrier
US10221218B2 (en) 2011-05-10 2019-03-05 The Regents Of The University Of California Adenovirus isolated from titi monkeys
US9267112B2 (en) 2011-05-10 2016-02-23 The Regents Of The University Of California Adenovirus isolated from Titi Monkeys
WO2012155019A1 (en) 2011-05-12 2012-11-15 Genentech, Inc. Multiple reaction monitoring lc-ms/ms method to detect therapeutic antibodies in animal samples using framework signature pepides
WO2012158704A1 (en) 2011-05-16 2012-11-22 Genentech, Inc. Fgfr1 agonists and methods of use
US11013800B2 (en) 2011-05-16 2021-05-25 Evive Biotech Ltd. Multi-specific Fab fusion proteins comprising a CD3-binding Fab fragment with N-terminal fusion to binding domains and methods of use
EP3219730A1 (en) 2011-05-16 2017-09-20 F. Hoffmann-La Roche AG Fgfr1 agonists and methods of use
WO2012158948A1 (en) 2011-05-17 2012-11-22 The Rockefeller University Human immunodeficiency virus neutralizing antibodies adn methods of use thereof
EP3865507A1 (en) 2011-05-17 2021-08-18 The Rockefeller University Human immunodeficiency virus neutralizing antibodies and methods of use thereof
WO2012171996A1 (en) 2011-06-15 2012-12-20 F. Hoffmann-La Roche Ag Anti-human epo receptor antibodies and methods of use
WO2013001369A2 (en) 2011-06-28 2013-01-03 Oxford Biotherapeutics Ltd. Therapeutic and diagnostic target
WO2013003680A1 (en) 2011-06-30 2013-01-03 Genentech, Inc. Anti-c-met antibody formulations
US9562097B2 (en) 2011-07-01 2017-02-07 Genentech, Inc. Use of anti-CD83 agonist antibodies for treating autoimmune diseases
WO2013012855A1 (en) 2011-07-18 2013-01-24 Amgen Inc. Apelin antigen-binding proteins and uses thereof
WO2013025944A1 (en) 2011-08-17 2013-02-21 Genentech, Inc. Inhibition of angiogenesis in refractory tumors
WO2013025853A1 (en) 2011-08-17 2013-02-21 Genentech, Inc. Neuregulin antibodies and uses thereof
WO2013026832A1 (en) 2011-08-23 2013-02-28 Roche Glycart Ag Anti-mcsp antibodies
US8822651B2 (en) 2011-08-30 2014-09-02 Theraclone Sciences, Inc. Human rhinovirus (HRV) antibodies
WO2013033069A1 (en) 2011-08-30 2013-03-07 Theraclone Sciences, Inc. Human rhinovirus (hrv) antibodies
US9360630B2 (en) 2011-08-31 2016-06-07 Volcano Corporation Optical-electrical rotary joint and methods of use
WO2013033623A1 (en) 2011-09-02 2013-03-07 Nestec S.A. Profiling of signal pathway proteins to determine therapeutic efficacy
WO2013040433A1 (en) 2011-09-15 2013-03-21 Genentech, Inc. Methods of promoting differentiation
WO2013043715A1 (en) 2011-09-19 2013-03-28 Genentech, Inc. Combination treatments comprising c-met antagonists and b-raf antagonists
WO2013052155A1 (en) 2011-10-05 2013-04-11 Genentech, Inc. Methods of treating liver conditions using notch2 antagonists
WO2013055998A1 (en) 2011-10-14 2013-04-18 Genentech, Inc. ANTI-HtrA1 ANTIBODIES AND METHODS OF USE
EP3461839A1 (en) 2011-10-14 2019-04-03 F. Hoffmann-La Roche AG Anti-htra1 antibodies and methods of use
WO2013056148A2 (en) 2011-10-15 2013-04-18 Genentech, Inc. Methods of using scd1 antagonists
WO2013059531A1 (en) 2011-10-20 2013-04-25 Genentech, Inc. Anti-gcgr antibodies and uses thereof
WO2013063001A1 (en) 2011-10-28 2013-05-02 Genentech, Inc. Therapeutic combinations and methods of treating melanoma
WO2013067301A1 (en) 2011-11-02 2013-05-10 Genentech, Inc. Overload and elute chromatography
EP3257564A1 (en) 2011-11-02 2017-12-20 F. Hoffmann-La Roche AG Overload and elute chromatography
EP3527274A1 (en) 2011-11-02 2019-08-21 F. Hoffmann-La Roche AG Overload and elute chromatography
US9988460B2 (en) 2011-11-04 2018-06-05 Zymeworks Inc. Crystal structures of heterodimeric Fc domains
US9732155B2 (en) 2011-11-04 2017-08-15 Zymeworks Inc. Crystal structures of heterodimeric Fc domains
US10457742B2 (en) 2011-11-04 2019-10-29 Zymeworks Inc. Stable heterodimeric antibody design with mutations in the Fc domain
US9574010B2 (en) 2011-11-04 2017-02-21 Zymeworks Inc. Stable heterodimeric antibody design with mutations in the Fc domain
WO2013078170A1 (en) 2011-11-21 2013-05-30 Genentech, Inc. Purification of anti-c-met antibodies
WO2013083497A1 (en) 2011-12-06 2013-06-13 F. Hoffmann-La Roche Ag Antibody formulation
WO2013092723A1 (en) 2011-12-22 2013-06-27 F. Hoffmann-La Roche Ag Expression vector organization, novel production cell generation methods and their use for the recombinant production of polypeptides
WO2013092720A1 (en) 2011-12-22 2013-06-27 F. Hoffmann-La Roche Ag Full length antibody display system for eukaryotic cells and its use
US10882910B2 (en) 2011-12-22 2021-01-05 Hoffmann-La Roche Inc. Expression vector organization, novel production cell generation methods and their use for the recombinant production of polypeptides
WO2013092743A2 (en) 2011-12-22 2013-06-27 F. Hoffmann-La Roche Ag Expression vector element combinations, novel production cell generation methods and their use for the recombinant production of polypeptides
WO2013096812A1 (en) 2011-12-23 2013-06-27 Genentech, Inc. Articles of manufacture and methods for co-administration of antibodies
WO2013096791A1 (en) 2011-12-23 2013-06-27 Genentech, Inc. Process for making high concentration protein formulations
WO2013101771A2 (en) 2011-12-30 2013-07-04 Genentech, Inc. Compositions and method for treating autoimmune diseases
WO2013106485A2 (en) 2012-01-09 2013-07-18 The Scripps Research Institute Ultralong complementarity determining regions and uses thereof
EP3663314A1 (en) 2012-01-09 2020-06-10 The Scripps Research Institute Humanized antibodies with ultralong cdr3s
WO2013106489A1 (en) 2012-01-09 2013-07-18 The Scripps Research Institute Humanized antibodies with ultralong cdr3s
WO2013109819A1 (en) 2012-01-18 2013-07-25 Genentech, Inc. Anti-lrp5 antibodies and methods of use
WO2013109856A2 (en) 2012-01-18 2013-07-25 Genentech, Inc. Methods of using fgf19 modulators
US9718879B2 (en) 2012-01-26 2017-08-01 Imperial Innovations Ltd. Methods of treating pain by inhibition of VGF activity
WO2013110945A1 (en) 2012-01-26 2013-08-01 Imperial Innovations Ltd Methods of treating pain by inhibition of vgf activity
WO2013116287A1 (en) 2012-01-31 2013-08-08 Genentech, Inc. Anti-ig-e m1' antibodies and methods using same
US9663575B2 (en) 2012-02-06 2017-05-30 Inhibrx, Lp CD47 antibodies and methods of use thereof
US9045541B2 (en) 2012-02-06 2015-06-02 Inhibrx Llc CD47 antibodies and methods of use thereof
EP3578569A1 (en) 2012-02-06 2019-12-11 Inhibrx, Inc. Cd47 antibodies and methods of use thereof
WO2013120056A1 (en) 2012-02-11 2013-08-15 Genentech, Inc. R-spondin translocations and methods using the same
US11814409B2 (en) 2012-02-15 2023-11-14 Hoffmann-La Roche Inc. Fc-receptor based affinity chromatography
WO2013120929A1 (en) 2012-02-15 2013-08-22 F. Hoffmann-La Roche Ag Fc-receptor based affinity chromatography
US10525130B2 (en) 2012-03-26 2020-01-07 Sanofi Stable IGG4 based binding agent formulations
US9592289B2 (en) 2012-03-26 2017-03-14 Sanofi Stable IgG4 based binding agent formulations
WO2013148315A1 (en) 2012-03-27 2013-10-03 Genentech, Inc. Diagnosis and treatments relating to her3 inhibitors
WO2013148249A1 (en) 2012-03-27 2013-10-03 Genentech, Inc. Improved harvest operations for recombinant proteins
WO2013149111A2 (en) 2012-03-29 2013-10-03 Novimmune S.A. Anti-tlr4 antibodies and uses thereof
US9175089B2 (en) 2012-03-30 2015-11-03 Genentech, Inc. Anti-LGR5 antibodies and immunoconjugates
WO2013149159A1 (en) 2012-03-30 2013-10-03 Genentech, Inc. Anti-lgr5 antibodies and immunoconjugates
US10130714B2 (en) 2012-04-14 2018-11-20 Academia Sinica Enhanced anti-influenza agents conjugated with anti-inflammatory activity
US10196454B2 (en) 2012-05-01 2019-02-05 Genentech, Inc. Anti-PMEL17 antibodies and immunoconjugates
US9056910B2 (en) 2012-05-01 2015-06-16 Genentech, Inc. Anti-PMEL17 antibodies and immunoconjugates
US9597411B2 (en) 2012-05-01 2017-03-21 Genentech, Inc. Anti-PMEL17 antibodies and immunoconjugates
WO2013165940A1 (en) 2012-05-01 2013-11-07 Genentech, Inc. Anti-pmel17 antibodies and immunoconjugates
WO2013170191A1 (en) 2012-05-11 2013-11-14 Genentech, Inc. Methods of using antagonists of nad biosynthesis from nicotinamide
EP3594239A1 (en) 2012-05-21 2020-01-15 F. Hoffmann-La Roche AG Methods for improving safety of blood-brain barrier transport
WO2013177062A2 (en) 2012-05-21 2013-11-28 Genentech, Inc. Methods for improving safety of blood-brain barrier transport
EP3605090A1 (en) 2012-05-23 2020-02-05 F. Hoffmann-La Roche AG Selection method for therapeutic agents
WO2013177470A1 (en) 2012-05-23 2013-11-28 Genentech, Inc. Selection method for therapeutic agents
EP3498857A1 (en) 2012-06-11 2019-06-19 Amgen, Inc. Dual receptor antagonistic antigen-binding proteins and uses thereof
WO2013188448A2 (en) 2012-06-11 2013-12-19 Amgen Inc. Dual receptor antagonistic antigen-binding proteins and uses thereof
EP3540070A1 (en) 2012-06-11 2019-09-18 Amgen Inc. Dual receptor antagonistic antigen-binding proteins and uses thereof
US9266961B2 (en) 2012-06-15 2016-02-23 Genentech, Inc. Anti-PCSK9 antibodies, formulations, dosing, and methods of use
US11180557B2 (en) 2012-06-22 2021-11-23 King's College London Vista modulators for diagnosis and treatment of cancer
US11752189B2 (en) 2012-06-22 2023-09-12 The Trustees Of Dartmouth College Vista antagonist and methods of use
US10933115B2 (en) 2012-06-22 2021-03-02 The Trustees Of Dartmouth College VISTA antagonist and methods of use
US10508154B2 (en) 2012-06-25 2019-12-17 Zymeworks Inc. Process and methods for efficient manufacturing of highly pure asymmetric antibodies in mammalian cells
US9499634B2 (en) 2012-06-25 2016-11-22 Zymeworks Inc. Process and methods for efficient manufacturing of highly pure asymmetric antibodies in mammalian cells
US10517945B2 (en) 2012-07-04 2019-12-31 Hoffman-La Roche Inc. Covalently linked antigen-antibody conjugates
WO2014006124A1 (en) 2012-07-04 2014-01-09 F. Hoffmann-La Roche Ag Covalently linked antigen-antibody conjugates
US9925272B2 (en) 2012-07-04 2018-03-27 Hoffmann-La Roche Inc. Anti-theophylline antibodies and methods of use
WO2014006118A1 (en) 2012-07-04 2014-01-09 F. Hoffmann-La Roche Ag Anti-theophylline antibodies and methods of use
US9765153B2 (en) 2012-07-04 2017-09-19 Hoffmann-La Roche Inc. Anti-biotin antibodies and methods of use
WO2014006123A1 (en) 2012-07-04 2014-01-09 F. Hoffmann-La Roche Ag Anti-biotin antibodies and methods of use
EP3578660A1 (en) 2012-07-05 2019-12-11 F. Hoffmann-La Roche AG Expression and secretion system
WO2014008391A1 (en) 2012-07-05 2014-01-09 Genentech, Inc. Expression and secretion system
WO2014011520A1 (en) 2012-07-09 2014-01-16 Genentech, Inc. Immunoconjugates comprising anti-cd22 antibodies
WO2014011521A1 (en) 2012-07-09 2014-01-16 Genentech, Inc. Immunoconjugates comprising anti - cd79b antibodies
WO2014011519A1 (en) 2012-07-09 2014-01-16 Genentech, Inc. Immunoconjugates comprising anti-cd79b antibodies
WO2014011518A1 (en) 2012-07-09 2014-01-16 Genentech, Inc. Immunoconjugates comprising anti-cd22 antibodies
US11795240B2 (en) 2012-07-13 2023-10-24 The Trustees Of The University Of Pennsylvania Enhancing activity of CAR T cells by co-introducing a bispecific antibody
US9765156B2 (en) 2012-07-13 2017-09-19 The Trustees Of The University Of Pennsylvania Enhancing activity of CAR T cells by co-introducing a bispecific antibody
US10683345B2 (en) 2012-07-13 2020-06-16 Roche Glycart Ag Bispecific anti-VEGF/anti-ANG-2 antibodies and their use in the treatment of ocular vascular diseases
EP3730512A1 (en) 2012-07-13 2020-10-28 The Trustees of the University of Pennsylvania Enhancing activity of car t cells by co-introducing a bispecific antibody
US9695233B2 (en) 2012-07-13 2017-07-04 Roche Glycart Ag Bispecific anti-VEGF/anti-ANG-2 antibodies and their use in the treatment of ocular vascular diseases
US10696749B2 (en) 2012-07-13 2020-06-30 The Trustees Of The University Of Pennsylvania Enhancing activity of CAR T cells by co-introducing a bispecific antibody
WO2014018554A1 (en) 2012-07-23 2014-01-30 La Jolla Institute For Allergy And Immunology Ptprs and proteoglycans in autoimmune disease
WO2014020331A1 (en) 2012-08-01 2014-02-06 Oxford Biotherapeutics Ltd. Therapeutic and diagnostic target
US9278131B2 (en) 2012-08-10 2016-03-08 Adocia Process for lowering the viscosity of highly concentrated protein solutions
US10214765B2 (en) 2012-08-18 2019-02-26 Academia Sinica Cell-permeable probes for identification and imaging of sialidases
US9914956B2 (en) 2012-08-18 2018-03-13 Academia Sinica Cell-permeable probes for identification and imaging of sialidases
US9547009B2 (en) 2012-08-21 2017-01-17 Academia Sinica Benzocyclooctyne compounds and uses thereof
EP3725805A1 (en) 2012-09-07 2020-10-21 Novartis AG Il-18 binding molecules
WO2014037899A2 (en) 2012-09-07 2014-03-13 Novartis Ag Il-18 binding molecules
US11529416B2 (en) 2012-09-07 2022-12-20 Kings College London Vista modulators for diagnosis and treatment of cancer
US11815508B2 (en) 2012-09-19 2023-11-14 Dana-Farber Cancer Institute, Inc. Dynamic BH3 profiling
US10393733B2 (en) 2012-09-19 2019-08-27 Dana-Farber Cancer Institute, Inc. Dynamic BH3 profiling
WO2014047311A1 (en) 2012-09-19 2014-03-27 Genentech, Inc. Methods and compositions for preventing norleucine misincorporation into proteins
EP3502267A1 (en) 2012-09-19 2019-06-26 F. Hoffmann-La Roche AG Methods and compositions for preventing norleucine misincorporation into proteins
WO2014049003A1 (en) 2012-09-25 2014-04-03 Glenmark Pharmaceuticals S.A. Purification of hetero-dimeric immunoglobulins
EP3401337A1 (en) 2012-09-25 2018-11-14 Glenmark Pharmaceuticals S.A. Purification of hetero-dimeric immunoglobulins
US10568586B2 (en) 2012-10-05 2020-02-25 Volcano Corporation Systems for indicating parameters in an imaging data set and methods of use
US9873742B2 (en) 2012-10-05 2018-01-23 Genentech, Inc. Methods for diagnosing and treating inflammatory bowel disease
US9478940B2 (en) 2012-10-05 2016-10-25 Volcano Corporation Systems and methods for amplifying light
US10070827B2 (en) 2012-10-05 2018-09-11 Volcano Corporation Automatic image playback
US9307926B2 (en) 2012-10-05 2016-04-12 Volcano Corporation Automatic stent detection
US11864870B2 (en) 2012-10-05 2024-01-09 Philips Image Guided Therapy Corporation System and method for instant and automatic border detection
US9324141B2 (en) 2012-10-05 2016-04-26 Volcano Corporation Removal of A-scan streaking artifact
US11272845B2 (en) 2012-10-05 2022-03-15 Philips Image Guided Therapy Corporation System and method for instant and automatic border detection
US11890117B2 (en) 2012-10-05 2024-02-06 Philips Image Guided Therapy Corporation Systems for indicating parameters in an imaging data set and methods of use
US9858668B2 (en) 2012-10-05 2018-01-02 Volcano Corporation Guidewire artifact removal in images
US11510632B2 (en) 2012-10-05 2022-11-29 Philips Image Guided Therapy Corporation Systems for indicating parameters in an imaging data set and methods of use
US11091551B2 (en) 2012-10-05 2021-08-17 Genentech, Inc. Methods for diagnosing and treating inflammatory bowel disease
US9292918B2 (en) 2012-10-05 2016-03-22 Volcano Corporation Methods and systems for transforming luminal images
US9367965B2 (en) 2012-10-05 2016-06-14 Volcano Corporation Systems and methods for generating images of tissue
US9286673B2 (en) 2012-10-05 2016-03-15 Volcano Corporation Systems for correcting distortions in a medical image and methods of use thereof
EP3783018A1 (en) 2012-10-18 2021-02-24 The Rockefeller University Broadly-neutralizing anti-hiv antibodies
US10724082B2 (en) 2012-10-22 2020-07-28 Bio-Rad Laboratories, Inc. Methods for analyzing DNA
US11578372B2 (en) 2012-11-05 2023-02-14 Foundation Medicine, Inc. NTRK1 fusion molecules and uses thereof
WO2014069647A1 (en) 2012-11-05 2014-05-08 全薬工業株式会社 Antibody and antibody composition production method
WO2014072306A1 (en) 2012-11-08 2014-05-15 F. Hoffmann-La Roche Ag Her3 antigen binding proteins binding to the beta-hairpin of her3
EP3461501A1 (en) 2012-11-13 2019-04-03 F. Hoffmann-La Roche AG Anti-hemagglutinin antibodies and methods of use
WO2014078268A2 (en) 2012-11-13 2014-05-22 Genentech, Inc. Anti-hemagglutinin antibodies and methods of use
US10712322B2 (en) 2012-11-15 2020-07-14 Genentech, Inc. Ionic strength-mediated pH gradient ion exchange chromatography
US9810670B2 (en) 2012-11-15 2017-11-07 Genentech, Inc. Ionic strength-mediated pH gradient ion exchange chromatography
US11078296B2 (en) 2012-11-28 2021-08-03 Zymeworks Inc. Engineered immunoglobulin heavy chain-light chain pairs and uses thereof
US9914785B2 (en) 2012-11-28 2018-03-13 Zymeworks Inc. Engineered immunoglobulin heavy chain-light chain pairs and uses thereof
WO2014087248A2 (en) 2012-12-03 2014-06-12 Novimmune S.A. Anti-cd47 antibodies and methods of use thereof
US11059910B2 (en) 2012-12-03 2021-07-13 Novimmune Sa Anti-CD47 antibodies and methods of use thereof
US11840553B2 (en) 2012-12-03 2023-12-12 Novimmune Sa Anti-CD47 antibodies and methods of use thereof
EP3725807A1 (en) 2012-12-03 2020-10-21 NovImmune SA Anti-cd47 antibodies and methods of use thereof
US10918735B2 (en) 2012-12-04 2021-02-16 Massachusetts Institute Of Technology Substituted pyrazino[1′,2′:1,5]pyrrolo[2,3-b]indole-1,4-diones for cancer treatment
US10238367B2 (en) 2012-12-13 2019-03-26 Volcano Corporation Devices, systems, and methods for targeted cannulation
US9709379B2 (en) 2012-12-20 2017-07-18 Volcano Corporation Optical coherence tomography system that is reconfigurable between different imaging modes
US10939826B2 (en) 2012-12-20 2021-03-09 Philips Image Guided Therapy Corporation Aspirating and removing biological material
US10942022B2 (en) 2012-12-20 2021-03-09 Philips Image Guided Therapy Corporation Manual calibration of imaging system
US11892289B2 (en) 2012-12-20 2024-02-06 Philips Image Guided Therapy Corporation Manual calibration of imaging system
US9730613B2 (en) 2012-12-20 2017-08-15 Volcano Corporation Locating intravascular images
US10595820B2 (en) 2012-12-20 2020-03-24 Philips Image Guided Therapy Corporation Smooth transition catheters
US11406498B2 (en) 2012-12-20 2022-08-09 Philips Image Guided Therapy Corporation Implant delivery system and implants
US11141131B2 (en) 2012-12-20 2021-10-12 Philips Image Guided Therapy Corporation Smooth transition catheters
US11253225B2 (en) 2012-12-21 2022-02-22 Philips Image Guided Therapy Corporation System and method for multipath processing of image signals
US10332228B2 (en) 2012-12-21 2019-06-25 Volcano Corporation System and method for graphical processing of medical data
US10058284B2 (en) 2012-12-21 2018-08-28 Volcano Corporation Simultaneous imaging, monitoring, and therapy
US9486143B2 (en) 2012-12-21 2016-11-08 Volcano Corporation Intravascular forward imaging device
US11786213B2 (en) 2012-12-21 2023-10-17 Philips Image Guided Therapy Corporation System and method for multipath processing of image signals
US10420530B2 (en) 2012-12-21 2019-09-24 Volcano Corporation System and method for multipath processing of image signals
US10166003B2 (en) 2012-12-21 2019-01-01 Volcano Corporation Ultrasound imaging with variable line density
US10993694B2 (en) 2012-12-21 2021-05-04 Philips Image Guided Therapy Corporation Rotational ultrasound imaging catheter with extended catheter body telescope
US10191220B2 (en) 2012-12-21 2019-01-29 Volcano Corporation Power-efficient optical circuit
US9383263B2 (en) 2012-12-21 2016-07-05 Volcano Corporation Systems and methods for narrowing a wavelength emission of light
US9612105B2 (en) 2012-12-21 2017-04-04 Volcano Corporation Polarization sensitive optical coherence tomography system
US10413317B2 (en) 2012-12-21 2019-09-17 Volcano Corporation System and method for catheter steering and operation
US11771698B2 (en) 2013-01-18 2023-10-03 Foundation Medicine, Inc. Methods of treating cholangiocarcinoma
WO2014116749A1 (en) 2013-01-23 2014-07-31 Genentech, Inc. Anti-hcv antibodies and methods of using thereof
WO2014123580A1 (en) 2013-02-06 2014-08-14 Inhibrx Llc Non-platelet depleting and non-red blood cell depleting cd47 antibodies and methods of use thereof
EP4137518A1 (en) 2013-02-06 2023-02-22 Inhibrx, Inc. Non-platelet depleting and non-red blood cell depleting cd47 antibodies and methods of use thereof
EP3736293A1 (en) 2013-02-12 2020-11-11 Boehringer Ingelheim International Gmbh Therapeutic and diagnostic target for cancer comprising dll3 binding reagents
WO2014128235A1 (en) 2013-02-22 2014-08-28 F. Hoffmann-La Roche Ag Methods of treating cancer and preventing drug resistance
WO2014130064A1 (en) 2013-02-22 2014-08-28 Abbvie Inc. Ultrafiltration and diafiltration formulation methods for protein processing
WO2014131715A1 (en) 2013-02-26 2014-09-04 Roche Glycart Ag Anti-mcsp antibodies
WO2014138364A2 (en) 2013-03-06 2014-09-12 Genentech, Inc. Methods of treating and preventing cancer drug resistance
US9770172B2 (en) 2013-03-07 2017-09-26 Volcano Corporation Multimodal segmentation in intravascular images
US10226597B2 (en) 2013-03-07 2019-03-12 Volcano Corporation Guidewire with centering mechanism
US10638939B2 (en) 2013-03-12 2020-05-05 Philips Image Guided Therapy Corporation Systems and methods for diagnosing coronary microvascular disease
US11154313B2 (en) 2013-03-12 2021-10-26 The Volcano Corporation Vibrating guidewire torquer and methods of use
US10653779B2 (en) 2013-03-13 2020-05-19 Genentech, Inc. Formulations with reduced oxidation
EP3744345A1 (en) 2013-03-13 2020-12-02 F. Hoffmann-La Roche AG Antibody formulations
US10010611B2 (en) 2013-03-13 2018-07-03 Genentech, Inc. Antibody formulations
WO2014160497A1 (en) 2013-03-13 2014-10-02 Genentech, Inc. Formulations with reduced oxidation
US10758207B2 (en) 2013-03-13 2020-09-01 Philips Image Guided Therapy Corporation Systems and methods for producing an image from a rotational intravascular ultrasound device
US9301687B2 (en) 2013-03-13 2016-04-05 Volcano Corporation System and method for OCT depth calibration
US11596620B2 (en) 2013-03-13 2023-03-07 F. Hoffmann-La Roche Ag Formulations with reduced oxidation
WO2014160490A1 (en) 2013-03-13 2014-10-02 Genetech, Inc. Antibody formulations
US11026591B2 (en) 2013-03-13 2021-06-08 Philips Image Guided Therapy Corporation Intravascular pressure sensor calibration
WO2014160495A1 (en) 2013-03-13 2014-10-02 Genentech, Inc. Formulations with reduced oxidation
US10925966B2 (en) 2013-03-13 2021-02-23 Genentech, Inc. Antibody formulations
WO2014152358A2 (en) 2013-03-14 2014-09-25 Genentech, Inc. Combinations of a mek inhibitor compound with an her3/egfr inhibitor compound and methods of use
US10292677B2 (en) 2013-03-14 2019-05-21 Volcano Corporation Endoluminal filter having enhanced echogenic properties
WO2014159940A1 (en) 2013-03-14 2014-10-02 Macrogenics, Inc. Bispecific molecules that are immunoreactive with immune effector cells that express an activating receptor
WO2014159835A1 (en) 2013-03-14 2014-10-02 Genentech, Inc. Anti-b7-h4 antibodies and immunoconjugates
US11421031B2 (en) 2013-03-14 2022-08-23 Macrogenics, Inc. Bispecific molecules that are immunoreactive with immune effector cells that express an activating receptor and an antigen expressed by a cell infected by a virus and uses thereof
EP3299391A1 (en) 2013-03-14 2018-03-28 Genentech, Inc. Anti-b7-h4 antibodies and immunoconjugates
US10219887B2 (en) 2013-03-14 2019-03-05 Volcano Corporation Filters with echogenic characteristics
US10426590B2 (en) 2013-03-14 2019-10-01 Volcano Corporation Filters with echogenic characteristics
US9908938B2 (en) 2013-03-14 2018-03-06 Macrogenics, Inc. Bispecific molecules that are immunoreactive with immune effector cells that express an activating receptor and an antigen expressed by a cell infected by a virus and uses thereof
US11230600B2 (en) 2013-03-14 2022-01-25 Genentech, Inc. Anti-B7-H4 antibodies and immunoconjugates
US10150813B2 (en) 2013-03-14 2018-12-11 Genentech, Inc. Anti-B7-H4 antibodies and immunoconjugates
US10730947B2 (en) 2013-03-14 2020-08-04 Macrogenics, Inc. Bispecific molecules that are immunoreactive with immune effector cells that express an activating receptor and an antigen expressed by a cell infected by a virus and uses thereof
US9562099B2 (en) 2013-03-14 2017-02-07 Genentech, Inc. Anti-B7-H4 antibodies and immunoconjugates
WO2014153030A2 (en) 2013-03-14 2014-09-25 Genentech, Inc. Methods of treating cancer and preventing cancer drug resistance
AU2014244286B2 (en) * 2013-03-14 2018-11-08 Duke University Bispecific molecules that are immunoreactive with immune effector cells that express an activating receptor
US10676710B2 (en) 2013-03-15 2020-06-09 Genentech, Inc. Cell culture compositions with antioxidants and methods for polypeptide production
WO2014145098A1 (en) 2013-03-15 2014-09-18 Genentech, Inc. Cell culture compositions with antioxidants and methods for polypeptide production
EP3712252A1 (en) 2013-03-15 2020-09-23 F. Hoffmann-La Roche AG Cell culture compositions with antioxidants and methods for polypeptide production
US9000132B2 (en) 2013-03-15 2015-04-07 Diadexus, Inc. Lipoprotein-associated phospholipase A2 antibody compositions and methods of use
WO2014144763A2 (en) 2013-03-15 2014-09-18 Memorial Sloan Kettering Cancer Center High affinity anti-gd2 antibodies
US10131873B2 (en) 2013-03-15 2018-11-20 Genentech, Inc. Cell culture compositions with antioxidants and methods for polypeptide production
US9441035B2 (en) 2013-03-15 2016-09-13 Genentech, Inc. Cell culture media and methods of antibody production
WO2014144865A2 (en) 2013-03-15 2014-09-18 Genentech, Inc. Anti-crth2 antibodies and methods of use
US10829732B2 (en) 2013-03-15 2020-11-10 Genentech, Inc. Cell culture compositions with antioxidants and methods for polypeptide production
WO2014151006A2 (en) 2013-03-15 2014-09-25 Genentech, Inc. Biomarkers and methods of treating pd-1 and pd-l1 related conditions
WO2014144850A1 (en) 2013-03-15 2014-09-18 Genentech, Inc. Methods of treating cancer and preventing cancer drug resistance
EP3590922A1 (en) 2013-03-15 2020-01-08 Zymeworks Inc. Cytotoxic and anti-mitotic compounds, and methods of using the same
WO2014150877A2 (en) 2013-03-15 2014-09-25 Ac Immune S.A. Anti-tau antibodies and methods of use
WO2014151866A1 (en) 2013-03-15 2014-09-25 Genentech, Inc. Compositions and methods for diagnosis and treatment of hepatic cancers
US10017732B2 (en) 2013-03-15 2018-07-10 Genentech, Inc. Cell culture compositions with antioxidants and methods for polypeptide production
WO2014144871A1 (en) 2013-03-15 2014-09-18 The Centre For Drug Research And Development Cytotoxic and anti-mitotic compounds, and methods of using the same
EP3633377A1 (en) 2013-03-15 2020-04-08 F. Hoffmann-La Roche AG Biomarkers and methods of treating pd-1 and pd-l1 related conditions
WO2015147915A1 (en) 2013-03-24 2015-10-01 Development Center For Biotechnology Methods for suppressing cancer by inhibition of tmcc3
EP3495814A2 (en) 2013-03-27 2019-06-12 F. Hoffmann-La Roche AG Use of biomarkers for assessing treatment of gastrointestinal inflammatory disorders with beta7 integrin antagonists
EP3933401A2 (en) 2013-03-27 2022-01-05 F. Hoffmann-La Roche AG Use of biomarkers for assessing treatment of gastrointestinal inflammatory disorders with beta7 integrin antagonists
WO2014161845A1 (en) 2013-04-03 2014-10-09 Roche Glycart Ag Bispecific antibodies specific for fap and dr5, antibodies specific for dr5 and methods of use
WO2014169076A1 (en) 2013-04-09 2014-10-16 Annexon,,Inc. Methods of treatment for neuromyelitis optica
WO2014172661A1 (en) 2013-04-19 2014-10-23 The Regent Of The University Of California Lone star virus
EP3878866A1 (en) 2013-04-29 2021-09-15 F. Hoffmann-La Roche AG Fc-receptor binding modified asymmetric antibodies and methods of use
WO2014177461A1 (en) 2013-04-29 2014-11-06 F. Hoffmann-La Roche Ag Fcrn-binding abolished anti-igf-1r antibodies and their use in the treatment of vascular eye diseases
WO2014177460A1 (en) 2013-04-29 2014-11-06 F. Hoffmann-La Roche Ag Human fcrn-binding modified antibodies and methods of use
EP3628685A1 (en) 2013-04-29 2020-04-01 F. Hoffmann-La Roche AG Human fcrn-binding modified antibodies and methods of use
EP3594240A1 (en) 2013-05-20 2020-01-15 F. Hoffmann-La Roche AG Anti-transferrin receptor antibodies and methods of use
EP4324480A2 (en) 2013-05-20 2024-02-21 F. Hoffmann-La Roche AG Anti-transferrin receptor antibodies and methods of use
WO2014188377A2 (en) 2013-05-24 2014-11-27 Nestec S.A. Pathway specific assays for predicting irritable bowel syndrome diagnosis
US10086054B2 (en) 2013-06-26 2018-10-02 Academia Sinica RM2 antigens and use thereof
US9981030B2 (en) 2013-06-27 2018-05-29 Academia Sinica Glycan conjugates and use thereof
WO2015006504A1 (en) 2013-07-09 2015-01-15 Annexon, Inc. Anti-complement factor c1q antibodies and uses thereof
EP4252769A2 (en) 2013-07-09 2023-10-04 Annexon, Inc. Anti-complement factor c1q antibodies and uses thereof
US10274466B2 (en) 2013-07-12 2019-04-30 Genentech, Inc. Elucidation of ion exchange chromatography input optimization
EP3536699A1 (en) 2013-07-12 2019-09-11 F. Hoffmann-La Roche AG Elucidation of ion exchange chromatography input optimization
US10921297B2 (en) 2013-07-12 2021-02-16 Genentech, Inc. Elucidation of ion exchange chromatography input optimization
EP3789036A1 (en) 2013-07-16 2021-03-10 F. Hoffmann-La Roche AG Methods of treating cancer using pd-1 axis binding antagonists and tigit inhibitors
WO2015017146A2 (en) 2013-07-18 2015-02-05 Fabrus, Inc. Antibodies with ultralong complementarity determining regions
WO2015010100A2 (en) 2013-07-18 2015-01-22 Fabrus, Inc. Humanized antibodies with ultralong complementarity determining regions
WO2015023596A1 (en) 2013-08-12 2015-02-19 Genentech, Inc. Compositions and method for treating complement-associated conditions
US10689442B2 (en) 2013-08-14 2020-06-23 Sachdev Sidhu Antibodies against Frizzled receptor
US10077304B2 (en) 2013-08-14 2018-09-18 The Governing Council Of The University Of Toronto Antibodies against frizzled receptor
EP3705494A2 (en) 2013-08-14 2020-09-09 Sachdev Sidhu Antibodies against frizzled proteins and methods of use thereof
WO2015031837A1 (en) 2013-08-29 2015-03-05 City Of Hope Cell penetrating conjugates and methods of use thereof
US10940401B2 (en) 2013-09-05 2021-03-09 Genentech, Inc. Method for chromatography reuse
US9782476B2 (en) 2013-09-06 2017-10-10 Academia Sinica Human iNKT cell activation using glycolipids with altered glycosyl groups
US10918714B2 (en) 2013-09-06 2021-02-16 Academia Sinica Human iNKT cell activation using glycolipids with altered glycosyl groups
US10111951B2 (en) 2013-09-06 2018-10-30 Academia Sinica Human iNKT cell activation using glycolipids with altered glycosyl groups
US10246515B2 (en) 2013-09-17 2019-04-02 Genentech, Inc. Methods of treating hedgehog-related diseases with an anti-LGR5 antibody
WO2015042108A1 (en) 2013-09-17 2015-03-26 Genentech, Inc. Methods of using anti-lgr5 antibodies
US11867687B2 (en) 2013-09-19 2024-01-09 Dana-Farber Cancer Institute, Inc. Methods of BH3 profiling
US10739333B2 (en) 2013-09-19 2020-08-11 Dana-Farber Cancer Institute, Inc. Methods of BH3 profiling
WO2015048520A1 (en) 2013-09-27 2015-04-02 Genentech, Inc. Anti-pdl1 antibody formulations
EP3626742A1 (en) 2013-09-27 2020-03-25 F. Hoffmann-La Roche AG Anti-pdl1 antibody formulations
US10131658B2 (en) 2013-09-30 2018-11-20 The Regents Of The University Of California Anti-alphavbeta1 integrin compounds and methods
WO2015050959A1 (en) 2013-10-01 2015-04-09 Yale University Anti-kit antibodies and methods of use thereof
US9975963B2 (en) 2013-10-11 2018-05-22 Genentech, Inc. NSP4 inhibitors and methods of use
US10246519B2 (en) 2013-10-11 2019-04-02 Genentech, Inc. NSP4 inhibitors and methods of use
WO2015054670A1 (en) 2013-10-11 2015-04-16 Genentech, Inc. Nsp4 inhibitors and methods of use
WO2015058132A2 (en) 2013-10-18 2015-04-23 Genentech, Inc. Anti-rspo antibodies and methods of use
WO2015061441A1 (en) 2013-10-23 2015-04-30 Genentech, Inc. Methods of diagnosing and treating eosinophilic disorders
EP3176185A1 (en) 2013-11-04 2017-06-07 Glenmark Pharmaceuticals S.A. Production of t cell retargeting hetero-dimeric immunoglobulins
WO2015069459A1 (en) 2013-11-05 2015-05-14 Novartis Ag Organic compounds
WO2015075011A1 (en) 2013-11-21 2015-05-28 F. Hoffmann-La Roche Ag ANTI-alpha-SYNUCLEIN ANTIBODIES AND METHODS OF USE
WO2015084625A1 (en) 2013-12-02 2015-06-11 Baylor College Of Medicine Identification of a new polypeptide hormone for maintenance of optimal body weight and blood glucose
EP3611191A1 (en) 2013-12-09 2020-02-19 Allakos Inc. Anti-siglec-8 antibodies and methods of use thereof
US9546215B2 (en) 2013-12-09 2017-01-17 Allakos Inc. Anti-Siglec-8 antibodies and methods of use thereof
WO2015089117A1 (en) 2013-12-09 2015-06-18 Allakos Inc. Anti-siglec-8 antibodies and methods of use thereof
WO2015089344A1 (en) 2013-12-13 2015-06-18 Genentech, Inc. Anti-cd33 antibodies and immunoconjugates
EP3461845A1 (en) 2013-12-13 2019-04-03 Genentech, Inc. Anti-cd33 antibodies and immunoconjugates
EP3527587A1 (en) 2013-12-17 2019-08-21 F. Hoffmann-La Roche AG Combination therapy comprising ox40 binding agonists and pd-l1 binding antagonists
WO2015095418A1 (en) 2013-12-17 2015-06-25 Genentech, Inc. Methods of treating her2-positive cancers using pd-1 axis binding antagonists and anti-her2 antibodies
EP3680254A1 (en) 2013-12-17 2020-07-15 F. Hoffmann-La Roche AG Methods of treating her2-positive cancers using pd-1 axis binding antagonists and anti-her2 antibodies
WO2015095410A1 (en) 2013-12-17 2015-06-25 Genentech, Inc. Methods of treating cancer using pd-1 axis binding antagonists and an anti-cd20 antibody
EP3647324A1 (en) 2013-12-17 2020-05-06 F. Hoffmann-La Roche AG Methods of treating cancers using pd-1 axis binding antagonists and taxanes
WO2015095423A2 (en) 2013-12-17 2015-06-25 Genentech, Inc. Combination therapy comprising ox40 binding agonists and pd-1 axis binding antagonists
US10465000B2 (en) 2013-12-20 2019-11-05 Hoffmann-La Roche Inc. Humanized anti-Tau(pS422) antibodies and methods of use
WO2015091656A1 (en) 2013-12-20 2015-06-25 F. Hoffmann-La Roche Ag HUMANIZED ANTI-Tau(pS422) ANTIBODIES AND METHODS OF USE
US10246518B2 (en) 2013-12-23 2019-04-02 Genentech, Inc. Nucleic acids encoding bispecific antibodies binding to beta-Klotho and fibroblast growth factor receptor 1
EP4219555A1 (en) 2013-12-23 2023-08-02 F. Hoffmann-La Roche AG Antibodies and methods of use
US10882921B2 (en) 2013-12-23 2021-01-05 Genentech, Inc. Host cell comprising nucleic acids encoding bispecific antibodies binding to beta-klotho and fibroblast growth factor receptor 1 and antibody production
US9884919B2 (en) 2013-12-23 2018-02-06 Genentech, Inc. Methods of treatment with bispecific antibodies binding to beta-klotho and fibroblast growth factor receptor 1
US9873748B2 (en) 2013-12-23 2018-01-23 Genentech, Inc. Bispecific antibodies binding to beta-klotho and fibroblast growth factor receptor 1
US11014987B2 (en) 2013-12-24 2021-05-25 Janssen Pharmaceutics Nv Anti-vista antibodies and fragments, uses thereof, and methods of identifying same
US11242392B2 (en) 2013-12-24 2022-02-08 Janssen Pharmaceutica Nv Anti-vista antibodies and fragments
WO2015097536A2 (en) 2013-12-24 2015-07-02 Janssen Pharmaceutical Nv Anti-vista antibodies and fragments
EP4043493A1 (en) 2013-12-24 2022-08-17 Janssen Pharmaceutica NV Anti-vista antibodies and fragments
EP3712174A1 (en) 2013-12-24 2020-09-23 Janssen Pharmaceutica NV Anti-vista antibodies and fragments
WO2015095953A1 (en) 2013-12-27 2015-07-02 The Centre For Drug Research And Development Sulfonamide-containing linkage systems for drug conjugates
US10519249B2 (en) 2014-01-03 2019-12-31 Hoffmann-La Roche Inc. Covalently linked polypeptide toxin-antibody conjugates
US10561737B2 (en) 2014-01-03 2020-02-18 Hoffmann-La Roche Inc. Bispecific anti-hapten/anti-blood brain barrier receptor antibodies, complexes thereof and their use as blood brain barrier shuttles
WO2015101586A1 (en) 2014-01-03 2015-07-09 F. Hoffmann-La Roche Ag Bispecific anti-hapten/anti-blood brain barrier receptor antibodies, complexes thereof and their use as blood brain barrier shuttles
WO2015101587A1 (en) 2014-01-03 2015-07-09 F. Hoffmann-La Roche Ag Covalently linked helicar-anti-helicar antibody conjugates and uses thereof
WO2015101589A1 (en) 2014-01-03 2015-07-09 F. Hoffmann-La Roche Ag Covalently linked polypeptide toxin-antibody conjugates
US10407511B2 (en) 2014-01-03 2019-09-10 Hoffmann-La Roche Inc. Covalently linked helicar-anti-helicar antibody conjugates and uses thereof
WO2015101588A1 (en) 2014-01-06 2015-07-09 F. Hoffmann-La Roche Ag Monovalent blood brain barrier shuttle modules
WO2015107026A1 (en) 2014-01-15 2015-07-23 F. Hoffmann-La Roche Ag Fc-region variants with modified fcrn- and maintained protein a-binding properties
EP3835318A1 (en) 2014-01-15 2021-06-16 F. Hoffmann-La Roche AG Fc-region variants with modified fcrn- and maintained protein a-binding properties
US10150818B2 (en) 2014-01-16 2018-12-11 Academia Sinica Compositions and methods for treatment and detection of cancers
WO2015109180A2 (en) 2014-01-16 2015-07-23 Academia Sinica Compositions and methods for treatment and detection of cancers
US9982041B2 (en) 2014-01-16 2018-05-29 Academia Sinica Compositions and methods for treatment and detection of cancers
WO2015112909A1 (en) 2014-01-24 2015-07-30 Genentech, Inc. Methods of using anti-steap1 antibodies and immunoconjugates
WO2015120075A2 (en) 2014-02-04 2015-08-13 Genentech, Inc. Mutant smoothened and methods of using the same
EP3900738A1 (en) 2014-02-08 2021-10-27 F. Hoffmann-La Roche AG Methods of treating alzheimer's disease
WO2015120233A1 (en) 2014-02-08 2015-08-13 Genentech, Inc. Methods of treating alzheimer's disease
WO2015120280A1 (en) 2014-02-08 2015-08-13 Genentech, Inc. Methods of treating alzheimer's disease
EP3718563A1 (en) 2014-02-08 2020-10-07 F. Hoffmann-La Roche AG Methods of treating alzheimer's disease
EP3825332A1 (en) 2014-02-12 2021-05-26 F. Hoffmann-La Roche AG Anti-jagged1 antibodies and methods of use
EP3428190A1 (en) 2014-02-12 2019-01-16 F. Hoffmann-La Roche AG Anti-jagged1 antibodies and methods of use
WO2015124588A1 (en) 2014-02-18 2015-08-27 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and pharmaceutical compositions for the treatment of diseases mediated by the nrp-1/obr complex signaling pathway
WO2015127405A2 (en) 2014-02-21 2015-08-27 Genentech, Inc. Anti-il-13/il-17 bispecific antibodies and uses thereof
EP4014995A1 (en) 2014-02-28 2022-06-22 Allakos Inc. Methods and compositions for treating siglec-8 associated diseases
WO2015131155A1 (en) 2014-02-28 2015-09-03 Allakos Inc. Methods and compositions for treating siglec-8 associated diseases
US10183996B2 (en) 2014-02-28 2019-01-22 Allakos Inc. Methods and compositions for treating Siglec-8 associated diseases
WO2015139046A1 (en) 2014-03-14 2015-09-17 Genentech, Inc. Methods and compositions for secretion of heterologous polypeptides
WO2015140591A1 (en) 2014-03-21 2015-09-24 Nordlandssykehuset Hf Anti-cd14 antibodies and uses thereof
WO2015148531A1 (en) 2014-03-24 2015-10-01 Genentech, Inc. Cancer treatment with c-met antagonists and correlation of the latter with hgf expression
US10240207B2 (en) 2014-03-24 2019-03-26 Genentech, Inc. Cancer treatment with c-met antagonists and correlation of the latter with HGF expression
US11566069B2 (en) 2014-03-27 2023-01-31 Bird Rock Bio, Inc. Treatment of disease responsive to modulation of cannabanoid 1(CB1) receptor signaling
US10119972B2 (en) 2014-03-27 2018-11-06 Academia Sinica Reactive labelling compounds and uses thereof
US10308712B2 (en) 2014-03-27 2019-06-04 Bird Rock Bio, Inc. Antibodies that bind human cannabinoid 1 (CB1) receptor
EP4159761A1 (en) 2014-03-27 2023-04-05 Bird Rock Bio, Inc. Antibodies that bind human cannabinoid 1 (cb1) receptor
WO2015148809A1 (en) 2014-03-27 2015-10-01 Genentech, Inc. Methods for diagnosing and treating inflammatory bowel disease
US9759726B2 (en) 2014-03-27 2017-09-12 Academia Sinica Reactive labelling compounds and uses thereof
WO2015148984A2 (en) 2014-03-27 2015-10-01 Ruiyi Inc. Antibodies that bind human cannabinoid 1 (cb1) receptor
EP3632934A1 (en) 2014-03-31 2020-04-08 F. Hoffmann-La Roche AG Anti-ox40 antibodies and methods of use
US9975957B2 (en) 2014-03-31 2018-05-22 Genentech, Inc. Anti-OX40 antibodies and methods of use
WO2015153514A1 (en) 2014-03-31 2015-10-08 Genentech, Inc. Combination therapy comprising anti-angiogenesis agents and ox40 binding agonists
US10730951B2 (en) 2014-03-31 2020-08-04 Genentech, Inc. Anti-OX40 antibodies and methods of use
WO2015153513A1 (en) 2014-03-31 2015-10-08 Genentech, Inc. Anti-ox40 antibodies and methods of use
WO2015150446A1 (en) 2014-04-02 2015-10-08 F. Hoffmann-La Roche Ag Method for detecting multispecific antibody light chain mispairing
US10330679B2 (en) 2014-04-02 2019-06-25 The United States Of America, As Represented By The Secretary Of The Army Rapid dual direct fluorescent antibody assay for the identification of Bacillus anthracis
US9995746B2 (en) 2014-04-02 2018-06-12 The United States Of America, As Represented By The Secretary Of The Army Rapid dual direct fluorescent antibody assay for the identification of Bacillus antrhacis
WO2015161267A2 (en) 2014-04-18 2015-10-22 The Board Of Trustees Of The Leland Stanford Junior University Humanized and chimeric monoclonal antibodies to cd99
WO2015164615A1 (en) 2014-04-24 2015-10-29 University Of Oslo Anti-gluten antibodies and uses thereof
US10329556B2 (en) 2014-05-13 2019-06-25 Bioatla, Llc Conditionally active biological proteins
WO2015175375A1 (en) 2014-05-13 2015-11-19 Short Jay M Conditionally active biological proteins
WO2015179658A2 (en) 2014-05-22 2015-11-26 Genentech, Inc. Anti-gpc3 antibodies and immunoconjugates
WO2015179835A2 (en) 2014-05-23 2015-11-26 Genentech, Inc. Mit biomarkers and methods using the same
US11884739B2 (en) 2014-05-27 2024-01-30 Academia Sinica Anti-CD20 glycoantibodies and uses thereof
US10005847B2 (en) 2014-05-27 2018-06-26 Academia Sinica Anti-HER2 glycoantibodies and uses thereof
US10618973B2 (en) 2014-05-27 2020-04-14 Academia Sinica Anti-HER2 glycoantibodies and uses thereof
US10118969B2 (en) 2014-05-27 2018-11-06 Academia Sinica Compositions and methods relating to universal glycoforms for enhanced antibody efficacy
US10023892B2 (en) 2014-05-27 2018-07-17 Academia Sinica Compositions and methods relating to universal glycoforms for enhanced antibody efficacy
US11319567B2 (en) 2014-05-27 2022-05-03 Academia Sinica Fucosidase from bacteroides and methods using the same
US11332523B2 (en) 2014-05-28 2022-05-17 Academia Sinica Anti-TNF-alpha glycoantibodies and uses thereof
EP3613433A1 (en) 2014-05-30 2020-02-26 Henlix Biotech Co., Ltd. Anti-epidermal growth factor receptor (egfr) antibodies
US11261255B2 (en) 2014-05-30 2022-03-01 Shanghai Henlius Biotech, Inc. Anti-epidermal growth factor receptor (EGFR) antibodies
US10584171B2 (en) 2014-05-30 2020-03-10 Henlix Biotech Co., Ltd. Anti-epidermal growth factor receptor (EGFR) antibodies
WO2015191715A1 (en) 2014-06-11 2015-12-17 Genentech, Inc. Anti-lgr5 antibodies and uses thereof
US11123426B2 (en) 2014-06-11 2021-09-21 The Trustees Of Dartmouth College Use of vista agonists and antagonists to suppress or enhance humoral immunity
WO2015191986A1 (en) 2014-06-13 2015-12-17 Genentech, Inc. Methods of treating and preventing cancer drug resistance
WO2015195835A2 (en) 2014-06-17 2015-12-23 The Regents Of The University Of California Improved alpha-v beta-8 antibodies
WO2015195917A1 (en) 2014-06-18 2015-12-23 Mersana Therapeutics, Inc. Monoclonal antibodies against her2 epitope and methods of use thereof
EP4285917A2 (en) 2014-06-18 2023-12-06 Mersana Therapeutics, Inc. Monoclonal antibodies against her2 epitope and methods of use thereof
US10251952B2 (en) 2014-06-26 2019-04-09 Hoffmann-La Roche Inc. Humanized anti-tau(pS422) antibody brain shuttles and use thereof
US11673968B2 (en) 2014-06-26 2023-06-13 Hoffmann-La Roche Inc. Anti-BRDU antibodies and methods of use
WO2016001140A1 (en) 2014-06-30 2016-01-07 Affiris Ag Vaccines and monoclonal antibodies targeting truncated variants of osteopontin and uses thereof
US10414814B2 (en) 2014-07-03 2019-09-17 City Of Hope Tumor-selective CTLA-4 antagonists
US11279752B2 (en) 2014-07-03 2022-03-22 City Of Hope Tumor-selective CTLA-4 antagonists
US10406197B2 (en) 2014-07-10 2019-09-10 Affiris Ag Substances and methods for the use in prevention and/or treatment in Huntington's disease
WO2016007235A1 (en) 2014-07-11 2016-01-14 Genentech, Inc. Anti-pd-l1 antibodies and diagnostic uses thereof
EP3309174A1 (en) 2014-07-11 2018-04-18 Genentech, Inc. Anti-pd-l1 antibodies and diagnostic uses thereof
WO2016007775A1 (en) 2014-07-11 2016-01-14 Genentech, Inc. Notch pathway inhibition
EP4066859A1 (en) 2014-08-08 2022-10-05 Alector LLC Anti-trem2 antibodies and methods of use thereof
US11084875B2 (en) 2014-08-08 2021-08-10 Alector Llc Anti-TREM2 antibodies and methods of use thereof
WO2016029079A2 (en) 2014-08-21 2016-02-25 Walter Reed Army Institute Of Research Department Of The Army Monoclonal antibodies for treatment of microbial infections
US11584927B2 (en) 2014-08-28 2023-02-21 Bioatla, Inc. Conditionally active chimeric antigen receptors for modified T-cells
US11111288B2 (en) 2014-08-28 2021-09-07 Bioatla, Inc. Conditionally active chimeric antigen receptors for modified t-cells
EP4074735A1 (en) 2014-08-28 2022-10-19 BioAtla, Inc. Conditionally active chimeric antigen receptors for modified t-cells
WO2016033331A1 (en) 2014-08-28 2016-03-03 Bioatla, Llc Conditionally active chimeric antigen receptors for modified t-cells
US10513699B2 (en) 2014-09-03 2019-12-24 Bioatla, Llc Discovering and producing conditionally active biologic proteins in the same eukaryotic cell production hosts
US10533034B2 (en) 2014-09-08 2020-01-14 Academia Sinica Human iNKT cell activation using glycolipids
US9879042B2 (en) 2014-09-08 2018-01-30 Academia Sinica Human iNKT cell activation using glycolipids
WO2016040868A1 (en) 2014-09-12 2016-03-17 Genentech, Inc. Anti-cll-1 antibodies and immunoconjugates
US11286302B2 (en) 2014-09-12 2022-03-29 Genentech, Inc. Anti-B7-H4 antibodies and immunoconjugates
US10059768B2 (en) 2014-09-12 2018-08-28 Genentech, Inc. Anti-B7-H4 antibodies and immunoconjugates
EP3782654A1 (en) 2014-09-12 2021-02-24 Genentech, Inc. Anti-her2 antibodies and immunoconjugates
WO2016040856A2 (en) 2014-09-12 2016-03-17 Genentech, Inc. Cysteine engineered antibodies and conjugates
EP3693391A1 (en) 2014-09-12 2020-08-12 Genentech, Inc. Anti-cll-1 antibodies and immunoconjugates
US11370833B2 (en) 2014-09-15 2022-06-28 Genentech, Inc. Antibody formulations
EP4029873A1 (en) 2014-09-17 2022-07-20 Zymeworks Inc. Cytotoxic and anti-mitotic compounds, and methods of using the same
WO2016041082A1 (en) 2014-09-17 2016-03-24 CDRD Ventures, Inc. Cytotoxic and anti-mitotic compounds, and methods of using the same
WO2016044396A1 (en) 2014-09-17 2016-03-24 Genentech, Inc. Immunoconjugates comprising anti-her2 antibodies and pyrrolobenzodiazepines
EP3689910A2 (en) 2014-09-23 2020-08-05 F. Hoffmann-La Roche AG Method of using anti-cd79b immunoconjugates
US10717778B2 (en) 2014-09-29 2020-07-21 Duke University Bispecific molecules comprising an HIV-1 envelope targeting arm
WO2016059602A2 (en) 2014-10-16 2016-04-21 Glaxo Group Limited Methods of treating cancer and related compositions
WO2016061389A2 (en) 2014-10-16 2016-04-21 Genentech, Inc. Anti-alpha-synuclein antibodies and methods of use
US10845364B2 (en) 2014-11-03 2020-11-24 Genentech, Inc. Assays for detecting T cell immune subsets and methods of use thereof
US10767232B2 (en) 2014-11-03 2020-09-08 Genentech, Inc. Methods and biomarkers for predicting efficacy and evaluation of an OX40 agonist treatment
WO2016073378A1 (en) 2014-11-03 2016-05-12 Genentech, Inc. Assays for detecting t cell immune subsets and methods of use thereof
EP4295911A2 (en) 2014-11-05 2023-12-27 Annexon, Inc. Humanized anti-complement factor c1q antibodies and uses thereof
WO2016073685A1 (en) 2014-11-05 2016-05-12 Annexon, Inc. Humanized anti-complement factor c1q antibodies and uses thereof
WO2016073794A1 (en) 2014-11-05 2016-05-12 Genentech, Inc. Methods of producing two chain proteins in bacteria
US10066002B2 (en) 2014-11-05 2018-09-04 Genentech, Inc. Methods of producing two chain proteins in bacteria
EP3753948A1 (en) 2014-11-05 2020-12-23 Genentech, Inc. Methods of producing two chain proteins in bacteria
US10112994B2 (en) 2014-11-05 2018-10-30 Genentech, Inc. Methods of producing two chain proteins in bacteria
US10208120B2 (en) 2014-11-05 2019-02-19 Genentech, Inc. Anti-FGFR2/3 antibodies and methods using same
WO2016073791A1 (en) 2014-11-05 2016-05-12 Genentech, Inc. Methods of producing two chain proteins in bacteria
US11299539B2 (en) 2014-11-05 2022-04-12 Genentech, Inc. Methods of producing two chain proteins in bacteria
US11091530B2 (en) 2014-11-05 2021-08-17 Genentech, Inc. Methods of producing two chain proteins in bacteria
EP3842453A1 (en) 2014-11-06 2021-06-30 F. Hoffmann-La Roche AG Fc-region variants with modified fcrn- and protein a-binding properties
WO2016073157A1 (en) 2014-11-06 2016-05-12 Genentech, Inc. Anti-ang2 antibodies and methods of use thereof
EP3611188A1 (en) 2014-11-06 2020-02-19 F. Hoffmann-La Roche AG Fc-region variants with modified fcrn-binding and methods of use
EP3552488A1 (en) 2014-11-10 2019-10-16 F. Hoffmann-La Roche AG Animal model for nephropathy and agents for treating the same
WO2016077381A1 (en) 2014-11-10 2016-05-19 Genentech, Inc. Anti-interleukin-33 antibodies and uses thereof
WO2016077369A1 (en) 2014-11-10 2016-05-19 Genentech, Inc. Animal model for nephropathy and agents for treating the same
EP3783023A1 (en) 2014-11-10 2021-02-24 H. Hoffnabb-La Roche Ag Anti-interleukin-33 antibodies and uses thereof
WO2016081384A1 (en) 2014-11-17 2016-05-26 Genentech, Inc. Combination therapy comprising ox40 binding agonists and pd-1 axis binding antagonists
WO2016079708A1 (en) 2014-11-19 2016-05-26 Nestec S.A. Antibodies against serotonin, tryptophan and kynurenine metabolites and uses thereof
WO2016081640A1 (en) 2014-11-19 2016-05-26 Genentech, Inc. Anti-transferrin receptor / anti-bace1 multispecific antibodies and methods of use
WO2016081643A1 (en) 2014-11-19 2016-05-26 Genentech, Inc. Anti-transferrin receptor antibodies and methods of use
WO2016081639A1 (en) 2014-11-19 2016-05-26 Genentech, Inc. Antibodies against bace1 and use thereof for neural disease immunotherapy
EP3845565A2 (en) 2014-11-19 2021-07-07 Genentech, Inc. Antibodies against bace1 and use thereof for neural disease immunotherapy
EP4141032A1 (en) 2014-11-20 2023-03-01 F. Hoffmann-La Roche AG Combination therapy of t cell activating bispecific antigen binding molecules and pd-1 axis binding antagonists
EP3789402A1 (en) 2014-11-20 2021-03-10 F. Hoffmann-La Roche AG Combination therapy of t cell activating bispecific antigen binding molecules and pd-1 axis binding antagonists
WO2016087514A1 (en) 2014-12-02 2016-06-09 Cemm - Forschungszentrum Für Molekulare Medizin Gmbh Anti-mutant calreticulin antibodies and their use in the diagnosis and therapy of myeloid malignancies
WO2016090210A1 (en) 2014-12-05 2016-06-09 Genentech, Inc. ANTI-CD79b ANTIBODIES AND METHODS OF USE
US10370455B2 (en) 2014-12-05 2019-08-06 Immunext, Inc. Identification of VSIG8 as the putative VISTA receptor (V-R) and use thereof to produce VISTA/VSIG8 agonists and antagonists
WO2016094566A2 (en) 2014-12-10 2016-06-16 Genentech, Inc. Blood brain barrier receptor antibodies and methods of use
EP3633371A1 (en) 2014-12-18 2020-04-08 F. Hoffmann-La Roche AG Assay and method for determining cdc eliciting antibodies
WO2016098356A1 (en) 2014-12-19 2016-06-23 Chugai Seiyaku Kabushiki Kaisha Anti-c5 antibodies and methods of use
EP3981794A1 (en) 2014-12-19 2022-04-13 Chugai Seiyaku Kabushiki Kaisha Anti-c5 antibodies and methods of use
US11926652B2 (en) 2015-01-13 2024-03-12 City Of Hope CTLA4-binding protein peptide-linker masks
US10689423B2 (en) 2015-01-13 2020-06-23 City Of Hope CTLA4-binding protein peptide-linker masks
WO2016115275A1 (en) 2015-01-13 2016-07-21 City Of Hope Ctla4-binding protein peptide-linker masks
EP3733696A1 (en) 2015-01-13 2020-11-04 City of Hope Ctla4-binding protein peptide-linker masks
WO2016114819A1 (en) 2015-01-16 2016-07-21 Academia Sinica Compositions and methods for treatment and detection of cancers
EP3795168A1 (en) 2015-01-16 2021-03-24 City of Hope Cell penetrating antibodies
US9975965B2 (en) 2015-01-16 2018-05-22 Academia Sinica Compositions and methods for treatment and detection of cancers
US10495645B2 (en) 2015-01-16 2019-12-03 Academia Sinica Cancer markers and methods of use thereof
WO2016117346A1 (en) 2015-01-22 2016-07-28 Chugai Seiyaku Kabushiki Kaisha A combination of two or more anti-c5 antibodies and methods of use
US10342858B2 (en) 2015-01-24 2019-07-09 Academia Sinica Glycan conjugates and methods of use thereof
WO2016118961A1 (en) 2015-01-24 2016-07-28 Academia Sinica Cancer markers and methods of use thereof
US11236391B2 (en) 2015-01-28 2022-02-01 Genentech, Inc. Gene expression markers and treatment of multiple sclerosis
WO2016123329A2 (en) 2015-01-28 2016-08-04 Genentech, Inc. Gene expression markers and treatment of multiple sclerosis
WO2016123593A1 (en) 2015-01-30 2016-08-04 Academia Sinica Compositions and methods relating to universal glycoforms for enhanced antibody efficacy
US10828353B2 (en) 2015-01-31 2020-11-10 The Trustees Of The University Of Pennsylvania Compositions and methods for T cell delivery of therapeutic molecules
EP4223873A2 (en) 2015-01-31 2023-08-09 The Trustees of the University of Pennsylvania Compositions and methods for t cell delivery of therapeutic molecules
WO2016126972A1 (en) 2015-02-04 2016-08-11 Genentech, Inc. Mutant smoothened and methods of using the same
US11180548B2 (en) 2015-02-05 2021-11-23 Chugai Seiyaku Kabushiki Kaisha Methods of neutralizing IL-8 biological activity
EP3816179A2 (en) 2015-02-05 2021-05-05 Chugai Seiyaku Kabushiki Kaisha Fc region variant comprising a modified fcrn-binding domain
WO2016125495A1 (en) 2015-02-05 2016-08-11 Chugai Seiyaku Kabushiki Kaisha Antibodies comprising an ion concentration dependent antigen-binding domain, fc region variants, il-8-binding antibodies, and uses therof
EP3978530A1 (en) 2015-02-26 2022-04-06 F. Hoffmann-La Roche AG Integrin beta7 antagonists and methods of treating crohn's disease
WO2016138207A1 (en) 2015-02-26 2016-09-01 Genentech, Inc. Integrin beta7 antagonists and methods of treating crohn's disease
US10690671B2 (en) 2015-03-06 2020-06-23 Genentech, Inc. Ultrapurified DsbA and DsbC and methods of making and using the same
US10073098B2 (en) 2015-03-06 2018-09-11 Genentech, Inc. Ultrapurified DsbA and DsbC and methods of making and using the same
EP3636749A1 (en) 2015-03-06 2020-04-15 F. Hoffmann-La Roche AG Ultrapurified dsba and dsbc and methods of making and using the same
WO2016144824A1 (en) 2015-03-06 2016-09-15 Genentech, Inc. Ultrapurified dsba and dsbc and methods of making and using the same
US10214522B2 (en) 2015-03-10 2019-02-26 The Regents Of The University Of California Anti-alphavbeta1 integrin inhibitors and methods of use
WO2016149276A1 (en) 2015-03-16 2016-09-22 Genentech, Inc. Methods of detecting and quantifying il-13 and uses in diagnosing and treating th2-associated diseases
WO2016146833A1 (en) 2015-03-19 2016-09-22 F. Hoffmann-La Roche Ag Biomarkers for nad(+)-diphthamide adp ribosyltransferase resistance
US11897952B2 (en) 2015-03-30 2024-02-13 City Of Hope Mechanically interlocking complexes
US10011658B2 (en) 2015-04-03 2018-07-03 Eureka Therapeutics, Inc. Constructs targeting AFP peptide/MHC complexes and uses thereof
WO2016164503A1 (en) 2015-04-06 2016-10-13 Acceleron Pharma Inc. Alk7:actriib heteromultimers and uses thereof
WO2016164497A1 (en) 2015-04-06 2016-10-13 Acceleron Pharma Inc. Alk4:actriib heteromultimers and uses thereof
EP3929211A1 (en) 2015-04-06 2021-12-29 Acceleron Pharma Inc. Alk4:actriib heteromultimers and uses thereof
EP3828199A1 (en) 2015-04-06 2021-06-02 Acceleron Pharma Inc. Alk7: actriib heteromultimers and uses thereof
US10428150B2 (en) 2015-04-07 2019-10-01 Alector Llc Anti-sortilin antibodies and methods of use thereof
US10087255B2 (en) 2015-04-07 2018-10-02 Alector Llc Anti-sortilin antibodies and methods of use thereof
EP3991748A2 (en) 2015-04-07 2022-05-04 Alector LLC Anti-sortilin antibodies and methods of use thereof
US11339223B2 (en) 2015-04-07 2022-05-24 Alector Llc Methods of use of anti-Sortilin antibodies for treating a disease, disorder, or injury
US11208488B2 (en) 2015-04-07 2021-12-28 Alector Llc Methods of increasing progranulin levels using anti-Sortilin antibodies
US10308718B2 (en) 2015-04-07 2019-06-04 Alector Llc Anti-sortilin antibodies and methods of use thereof
US10865248B2 (en) 2015-04-07 2020-12-15 Genentech, Inc. Antigen binding complex having agonistic activity and methods of use
WO2016164480A1 (en) 2015-04-07 2016-10-13 Genentech, Inc. Antigen binding complex having agonistic activity and methods of use
US11186645B2 (en) 2015-04-07 2021-11-30 Alector Llc Isolated nucleic acids encoding anti-sortilin antibodies
WO2016166348A1 (en) 2015-04-17 2016-10-20 Elsalys Biotech Anti-tyro3 antibodies and uses thereof
US10357488B2 (en) 2015-04-20 2019-07-23 Tolero Pharmaceuticals, Inc. Predicting response to alvocidib by mitochondrial profiling
US10624880B2 (en) 2015-04-20 2020-04-21 Tolero Pharmaceuticals, Inc. Predicting response to alvocidib by mitochondrial profiling
EP3913052A1 (en) 2015-04-24 2021-11-24 F. Hoffmann-La Roche AG Methods of identifying bacteria comprising binding polypeptides
WO2016172551A2 (en) 2015-04-24 2016-10-27 Genentech, Inc. Methods of identifying bacteria comprising binding polypeptides
US10761086B2 (en) 2015-04-27 2020-09-01 Dana-Farber Cancer Institute, Inc. High throughput BH3 profiling: a rapid and scalable technology to BH3 profile on low numbers of cells
US11867688B2 (en) 2015-04-27 2024-01-09 Dana-Farber Cancer Institute, Inc. High throughput BH3 profiling: a rapid and scalable technology to BH3 profile on low numbers of cells
EP4238994A2 (en) 2015-05-11 2023-09-06 F. Hoffmann-La Roche AG Compositions and methods of treating lupus nephritis
EP3936524A2 (en) 2015-05-11 2022-01-12 F. Hoffmann-La Roche AG Compositions and methods of treating lupus nephritis
EP3783029A1 (en) 2015-05-12 2021-02-24 F. Hoffmann-La Roche AG Therapeutic and diagnostic methods for cancer
EP3447075A2 (en) 2015-05-15 2019-02-27 The General Hospital Corporation Antagonistic anti-tumor necrosis factor receptor superfamily antibodies
EP3842448A1 (en) 2015-05-15 2021-06-30 City of Hope Chimeric antigen receptor compositions
EP4292664A2 (en) 2015-05-15 2023-12-20 The General Hospital Corporation Antagonistic anti-tumor necrosis factor receptor superfamily antibodies
WO2016187158A1 (en) 2015-05-15 2016-11-24 City Of Hope Chimeric antigen receptor compositions
US10562925B2 (en) 2015-05-18 2020-02-18 Tolero Pharmaceuticals, Inc. Alvocidib prodrugs having increased bioavailability
US10259835B2 (en) 2015-05-18 2019-04-16 Tolero Pharmaceuticals, Inc. Alvocidib prodrugs having increased bioavailability
WO2016189091A1 (en) 2015-05-26 2016-12-01 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and pharmaceutical compositions (ntsr1 inhibitors) for the treatment of hepatocellular carcinomas
WO2016189045A1 (en) 2015-05-27 2016-12-01 Ucb Biopharma Sprl Method for the treatment of neurological disease
US10690678B2 (en) 2015-05-28 2020-06-23 Genentech, Inc. Cell-based assay for detecting anti-CD3 homodimers
EP3795679A1 (en) 2015-05-28 2021-03-24 Genentech, Inc. Cell-based assay for detecting anti-cd3 homodimers
WO2016191750A1 (en) 2015-05-28 2016-12-01 Genentech, Inc. Cell-based assay for detecting anti-cd3 homodimers
WO2016189118A1 (en) 2015-05-28 2016-12-01 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods of prognosis and treatment of patients suffering from acute myeloid leukemia
EP3763827A1 (en) 2015-05-29 2021-01-13 F. Hoffmann-La Roche AG Pd-l1 promoter methylation in cancer
US11254987B2 (en) 2015-05-29 2022-02-22 Genentech, Inc. PD-L1 promoter methylation in cancer
WO2016196381A1 (en) 2015-05-29 2016-12-08 Genentech, Inc. Pd-l1 promoter methylation in cancer
EP4335931A2 (en) 2015-05-29 2024-03-13 F. Hoffmann-La Roche AG Therapeutic and diagnostic methods for cancer
WO2016196343A1 (en) 2015-05-29 2016-12-08 Genentech, Inc. Humanized anti-ebola virus glycoprotein antibodies and methods of use
WO2016196298A1 (en) 2015-05-29 2016-12-08 Genentech, Inc. Therapeutic and diagnolstic methods for cancer
EP3708681A1 (en) 2015-05-29 2020-09-16 F. Hoffmann-La Roche AG Therapeutic and diagnostic methods for cancer
WO2016196679A1 (en) 2015-06-02 2016-12-08 Genentech, Inc. Compositions and methods for using anti-il-34 antibodies to treat neurological diseases
WO2016196726A1 (en) 2015-06-05 2016-12-08 Genentech, Inc. Anti-tau antibodies and methods of use
WO2016200835A1 (en) 2015-06-08 2016-12-15 Genentech, Inc. Methods of treating cancer using anti-ox40 antibodies and pd-1 axis binding antagonists
WO2016200836A1 (en) 2015-06-08 2016-12-15 Genentech, Inc. Methods of treating cancer using anti-ox40 antibodies
US11136390B2 (en) 2015-06-12 2021-10-05 Alector Llc Anti-CD33 antibodies and methods of use thereof
WO2016201389A2 (en) 2015-06-12 2016-12-15 Alector Llc Anti-cd33 antibodies and methods of use thereof
WO2016201388A2 (en) 2015-06-12 2016-12-15 Alector Llc Anti-cd33 antibodies and methods of use thereof
US11174313B2 (en) 2015-06-12 2021-11-16 Alector Llc Anti-CD33 antibodies and methods of use thereof
WO2016205176A1 (en) 2015-06-15 2016-12-22 Genentech, Inc. Antibodies and immunoconjugates
WO2016205520A1 (en) 2015-06-16 2016-12-22 Genentech, Inc. Humanized and affinity matured antibodies to fcrh5 and methods of use
EP4299073A2 (en) 2015-06-16 2024-01-03 F. Hoffmann-La Roche AG Humanized and affinity matured antibodies to fcrh5 and methods of use
WO2016204966A1 (en) 2015-06-16 2016-12-22 Genentech, Inc. Anti-cd3 antibodies and methods of use
EP3916018A1 (en) 2015-06-16 2021-12-01 Genentech, Inc. Anti-cd3 antibodies and methods of use
WO2016205200A1 (en) 2015-06-16 2016-12-22 Genentech, Inc. Anti-cll-1 antibodies and methods of use
WO2016205320A1 (en) 2015-06-17 2016-12-22 Genentech, Inc. Methods of treating locally advanced or metastatic breast cancers using pd-1 axis binding antagonists and taxanes
WO2016205531A2 (en) 2015-06-17 2016-12-22 Genentech, Inc. Anti-her2 antibodies and methods of use
US10774145B2 (en) 2015-06-17 2020-09-15 Allakos Inc. Methods and compositions for treating fibrotic diseases
EP3722314A1 (en) 2015-06-24 2020-10-14 Janssen Pharmaceutica NV Anti-vista antibodies and fragments
US11009509B2 (en) 2015-06-24 2021-05-18 Janssen Pharmaceutica Nv Anti-VISTA antibodies and fragments
US10822402B2 (en) 2015-06-24 2020-11-03 Hoffmann-La Roche Inc. Humanized anti-tau(pS422) antibodies and methods of use
WO2016207717A1 (en) 2015-06-24 2016-12-29 Janssen Pharmaceutica Nv Anti-vista antibodies and fragments
WO2016207124A1 (en) 2015-06-25 2016-12-29 F. Hoffmann-La Roche Ag Cell based assay for determining antibody or ligand binding and function
EP3514174A1 (en) 2015-06-29 2019-07-24 Ventana Medical Systems, Inc. Materials and methods for performing histochemical assays for human pro-epiregulin and amphiregulin
WO2017004091A1 (en) 2015-06-29 2017-01-05 Genentech, Inc. Type ii anti-cd20 antibody for use in organ transplantation
EP3978525A1 (en) 2015-06-29 2022-04-06 Ventana Medical Systems, Inc. Materials and methods for performing histochemical assays for human pro-epiregulin and amphiregulin
US10835537B2 (en) 2015-08-03 2020-11-17 Sumitomo Dainippon Pharma Oncology, Inc. Combination therapies for treatment of cancer
US10568887B2 (en) 2015-08-03 2020-02-25 Tolero Pharmaceuticals, Inc. Combination therapies for treatment of cancer
US10682356B2 (en) 2015-08-03 2020-06-16 Tolero Pharmaceuticals, Inc. Combination therapies for treatment of cancer
US11312936B2 (en) 2015-08-04 2022-04-26 Regeneron Pharmaceuticals, Inc. Taurine supplemented cell culture medium and methods of use
US10927342B2 (en) 2015-08-04 2021-02-23 Regeneran Pharmaceuticals, Inc. Taurine supplemented cell culture medium and methods of use
US11661463B2 (en) 2015-08-06 2023-05-30 City Of Hope Cell penetrating protein-antibody conjugates and methods of use
WO2017024238A1 (en) 2015-08-06 2017-02-09 City Of Hope Cell penetrating protein-antibody conjugates and methods of use
EP4063397A1 (en) 2015-08-11 2022-09-28 Legend Biotech Ireland Limited Chimeric antigen receptors based on single-domain antibodies and methods of use thereof
EP4282878A2 (en) 2015-08-11 2023-11-29 Legend Biotech Ireland Limited Chimeric antigen receptors targeting bcma and methods of use thereof
EP4282877A2 (en) 2015-08-11 2023-11-29 Legend Biotech Ireland Limited Chimeric antigen receptors targeting bcma and methods of use thereof
EP3896091A1 (en) 2015-08-11 2021-10-20 Legend Biotech Ireland Limited Chimeric antigen receptors targeting bcma and methods of use thereof
US10590198B2 (en) 2015-08-28 2020-03-17 Alector Llc Anti-siglec-7 antibodies and methods of use thereof
US11890301B2 (en) 2015-08-28 2024-02-06 The Trustees Of The University Of Pennsylvania Methods and compositions for cells expressing a chimeric intracellular signaling molecule
US11390680B2 (en) 2015-08-28 2022-07-19 Alector Llc Anti-Siglec-7 antibodies and methods of use thereof
WO2017040301A1 (en) 2015-08-28 2017-03-09 Alector Llc Anti-siglec-7 antibodies and methods of use thereof
WO2017040195A1 (en) 2015-08-28 2017-03-09 The Trustees Of The University Of Pennsylvania Methods and compositions for cells expressing a chimeric intracellular signaling molecule
US11649435B2 (en) 2015-08-28 2023-05-16 The Trustees Of The University Of Pennsylvania Methods and compositions for cells expressing a chimeric intracellular signaling molecule
EP4223784A2 (en) 2015-09-02 2023-08-09 The Regents of the University of Colorado, a body corporate Compositions and methods for modulating t-cell mediated immune response
WO2017041004A1 (en) 2015-09-02 2017-03-09 The Regents Of The University Of Colorado, A Body Corporate Compositions and methods for modulating t-cell mediated immune response
US10935544B2 (en) 2015-09-04 2021-03-02 Obi Pharma, Inc. Glycan arrays and method of use
WO2017046994A1 (en) 2015-09-18 2017-03-23 Chugai Seiyaku Kabushiki Kaisha Il-8-binding antibodies and uses thereof
WO2017050729A1 (en) 2015-09-22 2017-03-30 Spring Bioscience Corporation Anti-ox40 antibodies and diagnostic uses thereof
WO2017053807A2 (en) 2015-09-23 2017-03-30 Genentech, Inc. Optimized variants of anti-vegf antibodies
EP3662930A1 (en) 2015-09-24 2020-06-10 AbVitro LLC Hiv antibody compositions and methods of use
WO2017053906A1 (en) 2015-09-24 2017-03-30 Abvitro Llc Hiv antibody compositions and methods of use
US11421026B2 (en) 2015-09-30 2022-08-23 Bird Rock Bio, Inc. Antibodies that bind human cannabinoid 1 (CB1) receptor
WO2017058771A1 (en) 2015-09-30 2017-04-06 Bird Rock Bio, Inc. Antibodies that bind human cannabinoid 1 (cb1) recetor
US11286300B2 (en) 2015-10-01 2022-03-29 Hoffmann-La Roche Inc. Humanized anti-human CD19 antibodies and methods of use
WO2017055399A1 (en) 2015-10-02 2017-04-06 F. Hoffmann-La Roche Ag Cellular based fret assay for the determination of simultaneous binding
WO2017055443A1 (en) 2015-10-02 2017-04-06 F. Hoffmann-La Roche Ag Anti-pd1 antibodies and methods of use
WO2017059289A1 (en) 2015-10-02 2017-04-06 Genentech, Inc. Pyrrolobenzodiazepine antibody drug conjugates and methods of use
WO2017062672A2 (en) 2015-10-06 2017-04-13 Alector Llc Anti-trem2 antibodies and methods of use thereof
WO2017062682A2 (en) 2015-10-06 2017-04-13 Genentech, Inc. Method for treating multiple sclerosis
WO2017064034A1 (en) 2015-10-12 2017-04-20 INSERM (Institut National de la Santé et de la Recherche Médicale) An agent capable of depleting cd8 t cells for the treatment of myocardial infarction or acute myocardial infarction
WO2017064675A1 (en) 2015-10-16 2017-04-20 Genentech, Inc. Hindered disulfide drug conjugates
WO2017068511A1 (en) 2015-10-20 2017-04-27 Genentech, Inc. Calicheamicin-antibody-drug conjugates and methods of use
US10604577B2 (en) 2015-10-22 2020-03-31 Allakos Inc. Methods and compositions for treating systemic mastocytosis
US11492396B2 (en) 2015-10-27 2022-11-08 UCB Biopharma SRL Methods of treatment using anti-IL-17A/F antibodies
WO2017075432A2 (en) 2015-10-29 2017-05-04 Alector Llc Anti-siglec-9 antibodies and methods of use thereof
US10800844B2 (en) 2015-10-29 2020-10-13 Alector Llc Anti-Siglec-9 antibodies and methods of use thereof
EP3184547A1 (en) 2015-10-29 2017-06-28 F. Hoffmann-La Roche AG Anti-tpbg antibodies and methods of use
WO2017072210A1 (en) 2015-10-29 2017-05-04 F. Hoffmann-La Roche Ag Anti-variant fc-region antibodies and methods of use
US11667710B2 (en) 2015-10-29 2023-06-06 Alector Llc Anti-Siglec-9 antibodies and methods of use thereof
EP3922649A1 (en) 2015-10-30 2021-12-15 F. Hoffmann-La Roche AG Anti-htra1 antibodies and methods of use thereof
WO2017075173A2 (en) 2015-10-30 2017-05-04 Genentech, Inc. Anti-factor d antibodies and conjugates
EP3165532A2 (en) 2015-11-03 2017-05-10 Industrial Technology Research Institute Auristatin derivatives, linker-drugs and ligand-drug conjugates
EP3165237A1 (en) 2015-11-03 2017-05-10 Industrial Technology Research Institute Antibody-drug conjugate (adc) and method for forming the same
WO2017079768A1 (en) 2015-11-08 2017-05-11 Genentech, Inc. Methods of screening for multispecific antibodies
WO2017088734A1 (en) 2015-11-23 2017-06-01 四川科伦博泰生物医药股份有限公司 Anti-erbb2 antibody-drug conjugate and composition thereof, preparation method therefor, and application thereof
EP3178848A1 (en) 2015-12-09 2017-06-14 F. Hoffmann-La Roche AG Type ii anti-cd20 antibody for reducing formation of anti-drug antibodies
EP4026848A1 (en) 2015-12-09 2022-07-13 F. Hoffmann-La Roche AG Type ii anti-cd20 antibody for reducing the cytokine release syndrome
WO2017100714A1 (en) 2015-12-10 2017-06-15 City Of Hope Cell penetrating cyanine-coupled antibodies
WO2017104779A1 (en) 2015-12-18 2017-06-22 Chugai Seiyaku Kabushiki Kaisha Anti-c5 antibodies and methods of use
EP4342529A2 (en) 2015-12-18 2024-03-27 Chugai Seiyaku Kabushiki Kaisha Anti-c5 antibodies and methods of use
WO2017112917A1 (en) 2015-12-24 2017-06-29 Corvus Pharmaceuticals, Inc. Methods of treating cancer
WO2017117304A1 (en) 2015-12-30 2017-07-06 Genentech, Inc. Use of tryptophan derivatives for protein formulations
US10933141B2 (en) 2015-12-30 2021-03-02 Genentech, Inc. Formulations with reduced degradation of polysorbate
US10525137B2 (en) 2015-12-30 2020-01-07 Genentech, Inc. Formulations with reduced degradation of polysorbate
WO2017117311A1 (en) 2015-12-30 2017-07-06 Genentech, Inc. Formulations with reduced degradation of polysorbate
EP3862365A1 (en) 2016-01-08 2021-08-11 F. Hoffmann-La Roche AG Methods of treating cea-positive cancers using pd-1 axis binding antagonists and anti-cea/anti-cd3 bispecific antibodies
WO2017122098A2 (en) 2016-01-10 2017-07-20 Neotx Therapeutics Ltd. Methods and compositions for enhancing the potency of superantigen mediated cancer immunotherapy.
WO2017127764A1 (en) 2016-01-20 2017-07-27 Genentech, Inc. High dose treatments for alzheimer's disease
US11513127B2 (en) 2016-01-25 2022-11-29 Genentech, Inc. Methods for assaying T-cell dependent bispecific antibodies
WO2017132279A1 (en) 2016-01-25 2017-08-03 Genentech, Inc. Methods for assaying t-cell dependent bispecific antibodies
WO2017136558A1 (en) 2016-02-04 2017-08-10 Curis, Inc. Mutant smoothened and methods of using the same
US10899836B2 (en) 2016-02-12 2021-01-26 Janssen Pharmaceutica Nv Method of identifying anti-VISTA antibodies
WO2017137830A1 (en) 2016-02-12 2017-08-17 Janssen Pharmaceutica Nv Anti-vista (b7h5) antibodies
WO2017151502A1 (en) 2016-02-29 2017-09-08 Genentech, Inc. Therapeutic and diagnostic methods for cancer
EP4155415A1 (en) 2016-02-29 2023-03-29 Genentech, Inc. Therapeutic and diagnostic methods for cancer
WO2017152102A2 (en) 2016-03-04 2017-09-08 Alector Llc Anti-trem1 antibodies and methods of use thereof
US10336784B2 (en) 2016-03-08 2019-07-02 Academia Sinica Methods for modular synthesis of N-glycans and arrays thereof
US10870701B2 (en) 2016-03-15 2020-12-22 Generon (Shanghai) Corporation Ltd. Multispecific fab fusion proteins and use thereof
WO2017165683A1 (en) 2016-03-23 2017-09-28 Novartis Ag Cell secreted minibodies and uses thereof
WO2017165734A1 (en) 2016-03-25 2017-09-28 Genentech, Inc. Multiplexed total antibody and antibody-conjugated drug quantification assay
EP4273551A2 (en) 2016-03-25 2023-11-08 F. Hoffmann-La Roche AG Multiplexed total antibody and antibody-conjugated drug quantification assay
US11844839B2 (en) 2016-03-25 2023-12-19 Seagen Inc. Process for the preparation of pegylated drug-linkers and intermediates thereof
US11041017B2 (en) 2016-03-29 2021-06-22 Obi Pharma, Inc. Antibodies, pharmaceutical compositions and methods
US11833223B2 (en) 2016-03-29 2023-12-05 Obi Pharma, Inc. Antibodies, pharmaceutical compositions and methods
US10980894B2 (en) 2016-03-29 2021-04-20 Obi Pharma, Inc. Antibodies, pharmaceutical compositions and methods
WO2017172771A2 (en) 2016-03-29 2017-10-05 Janssen Biotech, Inc. Method of treating psoriasis with increased interval dosing of anti-il12/23 antibody
WO2017173302A2 (en) 2016-04-01 2017-10-05 The Regents Of The University Of California Inhibitors of integrin alpha 5 beta 1 and methods of use
WO2017175058A1 (en) 2016-04-07 2017-10-12 Janssen Pharmaceutica Nv Anti-vista antibodies and fragments, uses thereof, and methods of identifying same
WO2017180864A1 (en) 2016-04-14 2017-10-19 Genentech, Inc. Anti-rspo3 antibodies and methods of use
EP3865511A1 (en) 2016-04-14 2021-08-18 F. Hoffmann-La Roche AG Anti-rspo3 antibodies and methods of use
US11603403B2 (en) 2016-04-15 2023-03-14 Immunext, Inc. Anti-human vista antibodies and use thereof
US11525000B2 (en) 2016-04-15 2022-12-13 Immunext, Inc. Anti-human VISTA antibodies and use thereof
US11649283B2 (en) 2016-04-15 2023-05-16 Immunext, Inc. Anti-human vista antibodies and use thereof
WO2017181111A2 (en) 2016-04-15 2017-10-19 Genentech, Inc. Methods for monitoring and treating cancer
US11149088B2 (en) 2016-04-15 2021-10-19 Bioatla, Inc. Anti-Axl antibodies, antibody fragments and their immunoconjugates and uses thereof
WO2017181079A2 (en) 2016-04-15 2017-10-19 Genentech, Inc. Methods for monitoring and treating cancer
US11897959B2 (en) 2016-04-15 2024-02-13 Bioatla, Inc. Anti-AXL antibodies, antibody fragments and their immunoconjugates and uses thereof
US11603402B2 (en) 2016-04-15 2023-03-14 Immunext, Inc. Anti-human vista antibodies and use thereof
US11583577B2 (en) 2016-04-22 2023-02-21 Obi Pharma, Inc. Cancer immunotherapy by immune activation or immune modulation via Globo series antigens
EP3889175A1 (en) 2016-05-02 2021-10-06 F. Hoffmann-La Roche AG The contorsbody - a single chain target binder
WO2017191101A1 (en) 2016-05-02 2017-11-09 F. Hoffmann-La Roche Ag The contorsbody - a single chain target binder
WO2017194441A1 (en) 2016-05-11 2017-11-16 F. Hoffmann-La Roche Ag Modified anti-tenascin antibodies and methods of use
US10918627B2 (en) 2016-05-11 2021-02-16 Massachusetts Institute Of Technology Convergent and enantioselective total synthesis of Communesin analogs
US11879011B2 (en) 2016-05-13 2024-01-23 Bioatla, Inc. Anti-ROR2 antibodies, antibody fragments, their immunoconjucates and uses thereof
US11254742B2 (en) 2016-05-13 2022-02-22 Bioatla, Inc. Anti-Ror2 antibodies, antibody fragments, their immunoconjugates and uses thereof
WO2017197234A1 (en) 2016-05-13 2017-11-16 Bioatla, Llc Anti-ror2 antibodies, antibody fragments, their immunoconjugates and uses thereof
EP4122958A1 (en) 2016-05-13 2023-01-25 BioAtla, Inc. Anti-ror2 antibodies, antibody fragments, their immunoconjugates and uses thereof
WO2017201036A1 (en) 2016-05-17 2017-11-23 Genentech, Inc. Stromal gene signatures for diagnosis and use in immunotherapy
WO2017201449A1 (en) 2016-05-20 2017-11-23 Genentech, Inc. Protac antibody conjugates and methods of use
WO2017205741A1 (en) 2016-05-27 2017-11-30 Genentech, Inc. Bioanalytical method for the characterization of site-specific antibody-drug conjugates
EP3252078A1 (en) 2016-06-02 2017-12-06 F. Hoffmann-La Roche AG Type ii anti-cd20 antibody and anti-cd20/cd3 bispecific antibody for treatment of cancer
WO2017214024A1 (en) 2016-06-06 2017-12-14 Genentech, Inc. Silvestrol antibody-drug conjugates and methods of use
WO2017218977A2 (en) 2016-06-17 2017-12-21 Genentech, Inc. Purification of multispecific antibodies
WO2017223405A1 (en) 2016-06-24 2017-12-28 Genentech, Inc. Anti-polyubiquitin multispecific antibodies
WO2018011691A1 (en) 2016-07-12 2018-01-18 Nestec S.A. Competitive immunoassay methods
EP3928784A1 (en) 2016-07-15 2021-12-29 Acceleron Pharma Inc. Compositions comprising actriia polypeptides for use in treating pulmonary hypertension
WO2018013936A1 (en) 2016-07-15 2018-01-18 Acceleron Pharma Inc. Compositions and methods for treating pulmonary hypertension
US11447573B2 (en) 2016-07-20 2022-09-20 Nanjing Legend Biotech Co., Ltd. Multispecific antigen binding proteins and methods of use thereof
US11642400B2 (en) 2016-07-27 2023-05-09 Obi Pharma, Inc. Immunogenic/therapeutic glycan compositions and uses thereof
WO2018022762A1 (en) 2016-07-27 2018-02-01 Acceleron Pharma Inc. Methods and compositions for treating myelofibrosis
WO2018021450A1 (en) 2016-07-29 2018-02-01 中外製薬株式会社 Bispecific antibody exhibiting increased alternative fviii-cofactor-function activity
US11643456B2 (en) 2016-07-29 2023-05-09 Obi Pharma, Inc. Human antibodies, pharmaceutical compositions and methods
WO2018027204A1 (en) 2016-08-05 2018-02-08 Genentech, Inc. Multivalent and multiepitopic anitibodies having agonistic activity and methods of use
US11780912B2 (en) 2016-08-05 2023-10-10 Chugai Seiyaku Kabushiki Kaisha Composition for prophylaxis or treatment of IL-8 related diseases
US11053308B2 (en) 2016-08-05 2021-07-06 Chugai Seiyaku Kabushiki Kaisha Method for treating IL-8-related diseases
US11046776B2 (en) 2016-08-05 2021-06-29 Genentech, Inc. Multivalent and multiepitopic antibodies having agonistic activity and methods of use
WO2018029124A1 (en) 2016-08-08 2018-02-15 F. Hoffmann-La Roche Ag Therapeutic and diagnostic methods for cancer
WO2018031662A1 (en) 2016-08-11 2018-02-15 Genentech, Inc. Pyrrolobenzodiazepine prodrugs and antibody conjugates thereof
US11333644B2 (en) 2016-08-15 2022-05-17 Genentech, Inc. Chromatography method for quantifying a nonionic surfactant in a composition comprising the non-ionic surfactant and a polypeptide
US11680931B2 (en) 2016-08-15 2023-06-20 Genentech, Inc. Chromatography method for quantifying a non-ionic surfactant in a composition comprising the non-ionic surfactant and a polypeptide
WO2018035025A1 (en) 2016-08-15 2018-02-22 Genentech, Inc. Chromatography method for quantifying a non-ionic surfactant in a composition comprising the non-ionic surfactant and a polypeptide
WO2018038046A1 (en) 2016-08-22 2018-03-01 中外製薬株式会社 Gene-modified non-human animal expressing human gpc3 polypeptide
US10538592B2 (en) 2016-08-22 2020-01-21 Cho Pharma, Inc. Antibodies, binding fragments, and methods of use
US10870694B2 (en) 2016-09-02 2020-12-22 Dana Farber Cancer Institute, Inc. Composition and methods of treating B cell disorders
WO2018045379A1 (en) 2016-09-02 2018-03-08 Dana-Farber Cancer Institute, Inc. Composition and methods of treating b cell disorders
WO2018049248A1 (en) 2016-09-09 2018-03-15 Icellhealth Consulting Llc Oncolytic virus equipped with bispecific engager molecules
WO2018049261A1 (en) 2016-09-09 2018-03-15 Icellhealth Consulting Llc Oncolytic virus expressing immune checkpoint modulators
US10604561B2 (en) 2016-09-16 2020-03-31 Chugai Seiyaku Kabushiki Kaisha Anti-dengue virus antibodies, polypeptides containing variant Fc regions, and methods of use
EP4339615A2 (en) 2016-09-16 2024-03-20 Shanghai Henlius Biotech, Inc. Anti-pd-1 antibodies
US11780908B2 (en) 2016-09-16 2023-10-10 Chugai Seiyaku Kabushiki Kaisha Anti-dengue virus antibodies, polypeptides containing variant FC regions, and methods of use
US10844113B2 (en) 2016-09-16 2020-11-24 Chugai Seiyaku Kabushiki Kaisha Anti-dengue virus antibodies, polypeptides containing variant Fc regions, and methods of use
WO2018050878A1 (en) 2016-09-19 2018-03-22 F. Hoffmann-La Roche Ag Complement factor based affinity chromatography
US11440942B2 (en) 2016-09-19 2022-09-13 Hoffmann-La Roche Inc. Complement factor based affinity chromatography
WO2018057849A1 (en) 2016-09-23 2018-03-29 Genentech, Inc. Uses of il-13 antagonists for treating atopic dermatitis
EP4268845A2 (en) 2016-09-23 2023-11-01 F. Hoffmann-La Roche AG Uses of il-13 antagonists for treating atopic dermatitis
WO2018060462A1 (en) 2016-09-29 2018-04-05 Nascient Ltd Tenascin epitope and antibodies thereto
WO2018064478A1 (en) 2016-09-29 2018-04-05 The Regents Of The University Of California NEUTRALIZING ANTIBODIES TO THE αVβ8 INTEGRIN COMPLEX FOR IMMUNOTHERAPY
WO2018064436A1 (en) 2016-09-30 2018-04-05 Janssen Biotech, Inc. Safe and effective method of treating psoriasis with anti-il23 specific antibody
WO2018060035A1 (en) 2016-09-30 2018-04-05 F. Hoffmann-La Roche Ag Spr-based dual-binding assay for the functional analysis of multispecific molecules
WO2018065501A1 (en) 2016-10-05 2018-04-12 F. Hoffmann-La Roche Ag Methods for preparing antibody drug conjugates
EP4026556A1 (en) 2016-10-05 2022-07-13 Acceleron Pharma Inc. Compositions and method for treating kidney disease
WO2018068028A1 (en) 2016-10-06 2018-04-12 Genentech, Inc. Therapeutic and diagnostic methods for cancer
US11472881B2 (en) 2016-10-11 2022-10-18 Nanjing Legend Biotech Co., Ltd. Single-domain antibodies and variants thereof against CTLA-4
WO2018081649A1 (en) 2016-10-28 2018-05-03 Banyan Biomarkers, Inc. Antibodies to ubiquitin c-terminal hydrolase l1 (uch-l1) and glial fibrillary acidic protein (gfap) and related methods
US11078298B2 (en) 2016-10-28 2021-08-03 Banyan Biomarkers, Inc. Antibodies to ubiquitin C-terminal hydrolase L1 (UCH-L1) and glial fibrillary acidic protein (GFAP) and related methods
WO2018081648A2 (en) 2016-10-29 2018-05-03 Genentech, Inc. Anti-mic antibidies and methods of use
WO2018083535A1 (en) 2016-11-04 2018-05-11 Novimmune Sa Anti-cd19 antibodies and methods of use thereof
WO2018089967A1 (en) 2016-11-14 2018-05-17 Virginia Commonwealth University Inhibitors of cancer invasion, attachment, and/or metastasis
WO2018093821A1 (en) 2016-11-15 2018-05-24 Genentech, Inc. Dosing for treatment with anti-cd20/anti-cd3 bispecific antibodies
US11208474B2 (en) 2016-11-16 2021-12-28 Janssen Biotech, Inc. Method of treating psoriasis with anti-IL23 specific antibody
WO2018093841A1 (en) 2016-11-16 2018-05-24 Janssen Biotech, Inc. Method of treating psoriasis with anti-il-23 specific antibody
WO2018091580A1 (en) 2016-11-18 2018-05-24 F. Hoffmann-La Roche Ag Anti-hla-g antibodies and use thereof
EP4335874A2 (en) 2016-11-18 2024-03-13 F. Hoffmann-La Roche AG Anti-hla-g antibodies and use thereof
US11279694B2 (en) 2016-11-18 2022-03-22 Sumitomo Dainippon Pharma Oncology, Inc. Alvocidib prodrugs and their use as protein kinase inhibitors
WO2018094300A1 (en) 2016-11-19 2018-05-24 Potenza Therapeutics, Inc. Anti-gitr antigen-binding proteins and methods of use thereof
US11000601B2 (en) 2016-11-21 2021-05-11 Obi Pharma, Inc. Conjugated biological molecules, pharmaceutical compositions and methods
WO2018098363A2 (en) 2016-11-23 2018-05-31 Bioverativ Therapeutics Inc. Bispecific antibodies binding to coagulation factor ix and coagulation factor x
WO2018106776A2 (en) 2016-12-07 2018-06-14 Genentech, Inc. Anti-tau antibodies and methods of use
WO2018106781A1 (en) 2016-12-07 2018-06-14 Genentech, Inc Anti-tau antibodies and methods of use
WO2018108759A1 (en) 2016-12-13 2018-06-21 F. Hoffmann-La Roche Ag Method to determine the presence of a target antigen in a tumor sample
WO2018114754A1 (en) 2016-12-19 2018-06-28 F. Hoffmann-La Roche Ag Combination therapy with targeted 4-1bb (cd137) agonists
US10422788B2 (en) 2016-12-19 2019-09-24 Tolero Pharmaceuticals, Inc. Profiling peptides and methods for sensitivity profiling
US10132797B2 (en) 2016-12-19 2018-11-20 Tolero Pharmaceuticals, Inc. Profiling peptides and methods for sensitivity profiling
US10267787B2 (en) 2016-12-19 2019-04-23 Tolero Pharmaceuticals, Inc. Profiling peptides and methods for sensitivity profiling
WO2018114748A1 (en) 2016-12-20 2018-06-28 F. Hoffmann-La Roche Ag Combination therapy of anti-cd20/anti-cd3 bispecific antibodies and 4-1bb (cd137) agonists
US11821897B2 (en) 2016-12-21 2023-11-21 Hoffmann-La Roche Inc. Assay for determining antibody or ligand binding and function
US11767342B2 (en) 2016-12-21 2023-09-26 Hoffmann-La Roche Inc. Method for in vitro glycoengineering of antibodies
WO2018114878A1 (en) 2016-12-21 2018-06-28 F. Hoffmann-La Roche Ag Re-use of enzymes in in vitro glycoengineering of antibodies
WO2018114772A1 (en) 2016-12-21 2018-06-28 F. Hoffmann-La Roche Ag Assay for determining antibody or ligand binding and function
WO2018114877A1 (en) 2016-12-21 2018-06-28 F. Hoffmann-La Roche Ag In vitro glycoengineering of antibodies
WO2018114879A1 (en) 2016-12-21 2018-06-28 F. Hoffmann-La Roche Ag Method for in vitro glycoengineering of antibodies
WO2018115231A2 (en) 2016-12-22 2018-06-28 Boehringer Ingelheim International Gmbh Binding molecules for the treatment of cancer
US10858438B2 (en) 2016-12-22 2020-12-08 Boehringer Ingelheim International Gmbh TRAILR2 CDH17 binding molecules for the treatment of cancer
US11851495B2 (en) 2016-12-22 2023-12-26 Boehringer Ingelheim International Gmbh TRAILR2 CDH17 binding molecules for the treatment of cancer
WO2018129029A1 (en) 2017-01-04 2018-07-12 Immunogen, Inc. Met antibodies and immunoconjugates and uses thereof
US11390685B2 (en) 2017-01-06 2022-07-19 Biosion, Inc. ErbB2 antibodies and uses therefore
US11274157B2 (en) 2017-01-12 2022-03-15 Eureka Therapeutics, Inc. Constructs targeting histone H3 peptide/MHC complexes and uses thereof
US11041020B2 (en) 2017-01-30 2021-06-22 Janssen Biotech, Inc. Methods for the treatment of active Psoriatic Arthritis
US11014982B2 (en) 2017-02-07 2021-05-25 Janssen Biotech, Inc. Anti-TNF antibodies, compositions, and methods for the treatment of active ankylosing spondylitis
WO2018148585A1 (en) 2017-02-10 2018-08-16 Genentech, Inc. Anti-tryptase antibodies, compositions thereof, and uses thereof
EP3360898A1 (en) 2017-02-14 2018-08-15 Boehringer Ingelheim International GmbH Bispecific anti-tnf-related apoptosis-inducing ligand receptor 2 and anti-cadherin 17 binding molecules for the treatment of cancer
WO2018152496A1 (en) 2017-02-17 2018-08-23 The Usa, As Represented By The Secretary, Dept. Of Health And Human Services Compositions and methods for the diagnosis and treatment of zika virus infection
WO2018160841A1 (en) 2017-03-01 2018-09-07 Genentech, Inc. Diagnostic and therapeutic methods for cancer
WO2018175752A1 (en) 2017-03-22 2018-09-27 Genentech, Inc. Optimized antibody compositions for treatment of ocular disorders
WO2018175788A1 (en) 2017-03-22 2018-09-27 Genentech, Inc. Hydrogel cross-linked hyaluronic acid prodrug compositions and methods
US11642415B2 (en) 2017-03-22 2023-05-09 Ascendis Pharma A/S Hydrogel cross-linked hyaluronic acid prodrug compositions and methods
US11730822B2 (en) 2017-03-24 2023-08-22 Seagen Inc. Process for the preparation of glucuronide drug-linkers and intermediates thereof
WO2018183175A1 (en) 2017-03-28 2018-10-04 Genentech, Inc. Methods of treating neurodegenerative diseases
WO2018194496A2 (en) 2017-04-17 2018-10-25 Закрытое Акционерное Общество "Биокад" Monoclonal antibody to pd-l1
US11236167B2 (en) 2017-04-17 2022-02-01 Joint Stock Company “Biocad” Monoclonal antibody to PD-L1
WO2018195472A1 (en) 2017-04-21 2018-10-25 Genentech, Inc. Use of klk5 antagonists for treatment of a disease
EP4230649A2 (en) 2017-04-25 2023-08-23 The U.S.A. As Represented By The Secretary, Department Of Health And Human Services Antibodies and methods for the diagnosis and treatment of epstein barr virus infection
WO2018200742A1 (en) 2017-04-25 2018-11-01 The Usa, As Represented By The Secretary, Dept. Of Health And Human Services Antibodies and methods for the diagnosis and treatment of epstein barr virus infection
US11447564B2 (en) 2017-04-26 2022-09-20 Eureka Therapeutics, Inc. Constructs specifically recognizing glypican 3 and uses thereof
US11597774B2 (en) 2017-05-04 2023-03-07 City Of Hope Antibody variable domains and antibody constructs
US11203638B2 (en) 2017-05-05 2021-12-21 Allakos Inc. Methods and compositions for treating perennial allergic conjunctivitis and keratoconjunctivitis
WO2018213316A1 (en) 2017-05-16 2018-11-22 Alector Llc Anti-siglec-5 antibodies and methods of use thereof
US11359014B2 (en) 2017-05-16 2022-06-14 Alector Llc Anti-siglec-5 antibodies and methods of use thereof
WO2018215535A1 (en) 2017-05-23 2018-11-29 Helmholtz Zentrum München - Deutsches Forschungszentrum für Gesundheit und Umwelt (GmbH) Novel cd73 antibody, preparation and uses thereof
US11260117B2 (en) 2017-05-26 2022-03-01 Novimmune Sa Anti-CD47 x anti-mesothelin antibodies and methods of use thereof
WO2018215835A1 (en) 2017-05-26 2018-11-29 Novimmune Sa Anti-cd47 x anti-mesothelin antibodies and methods of use thereof
WO2018220099A1 (en) 2017-06-02 2018-12-06 F. Hoffmann-La Roche Ag Type ii anti-cd20 antibody and anti-cd20/cd3 bispecific antibody for treatment of cancer
WO2019018629A1 (en) 2017-07-19 2019-01-24 The Usa, As Represented By The Secretary, Dept. Of Health And Human Services Antibodies and methods for the diagnosis and treatment of hepatitis b virus infection
WO2019018757A1 (en) 2017-07-21 2019-01-24 Genentech, Inc. Therapeutic and diagnostic methods for cancer
WO2019023347A1 (en) 2017-07-26 2019-01-31 Forty Seven, Inc. Anti-sirp-alpha antibodies and related methods
WO2019028292A1 (en) 2017-08-03 2019-02-07 Alector Llc Anti-trem2 antibodies and methods of use thereof
WO2019028283A1 (en) 2017-08-03 2019-02-07 Alector Llc Anti-cd33 antibodies and methods of use thereof
US10676525B2 (en) 2017-08-03 2020-06-09 Alector Llc Anti-TREM2 antibodies and methods of use thereof
EP4248996A2 (en) 2017-08-03 2023-09-27 Alector LLC Anti-trem2 antibodies and methods of use thereof
US11254743B2 (en) 2017-08-03 2022-02-22 Alector Llc Anti-CD33 antibodies and methods of use thereof
US10711062B2 (en) 2017-08-03 2020-07-14 Alector Llc Anti-CD33 antibodies and methods of use thereof
US11634489B2 (en) 2017-08-03 2023-04-25 Alector Llc Anti-TREM2 antibodies and methods of use thereof
US11578426B2 (en) 2017-08-21 2023-02-14 Adagene Inc. Dynamic human heavy chain antibody libraries
US11585014B2 (en) 2017-08-21 2023-02-21 Adagene Inc. Dynamic human antibody light chain libraries
US11497756B2 (en) 2017-09-12 2022-11-15 Sumitomo Pharma Oncology, Inc. Treatment regimen for cancers that are insensitive to BCL-2 inhibitors using the MCL-1 inhibitor alvocidib
WO2019065795A1 (en) 2017-09-29 2019-04-04 中外製薬株式会社 Multispecific antigen-binding molecule having blood coagulation factor viii (fviii) cofactor function-substituting activity, and pharmaceutical formulation containing said molecule as active ingredient
WO2019067015A1 (en) 2017-09-29 2019-04-04 City Of Hope Chimeric antigen receptors and bispecific antibodies for treatment of mantle cell lymphoma
US11840567B2 (en) 2017-10-03 2023-12-12 Joint Stock Company “Biocad” Bispecific antibodies with specific binding to CD47 and PD-L1
WO2019070164A1 (en) 2017-10-03 2019-04-11 Закрытое Акционерное Общество "Биокад" MONOCLONAL ANTIBODY TO IL-5Rα
US11912754B2 (en) 2017-10-12 2024-02-27 Immunowake Inc. VEGFR-antibody light chain fusion protein
US10640508B2 (en) 2017-10-13 2020-05-05 Massachusetts Institute Of Technology Diazene directed modular synthesis of compounds with quaternary carbon centers
WO2019086497A2 (en) 2017-11-01 2019-05-09 F. Hoffmann-La Roche Ag Combination therapy with targeted ox40 agonists
WO2019086395A1 (en) 2017-11-01 2019-05-09 F. Hoffmann-La Roche Ag Trifab-contorsbody
WO2019086331A2 (en) 2017-11-02 2019-05-09 Bayer Aktiengesellschaft Bispecific antibodies binding alk-1 and bmpr-2
US11292846B2 (en) 2017-11-02 2022-04-05 Bayer Aktiengesellschaft Bispecific antibodies binding ALK-1 and BMPR-2
WO2019090263A1 (en) 2017-11-06 2019-05-09 Genentech, Inc. Diagnostic and therapeutic methods for cancer
WO2019125846A1 (en) 2017-12-19 2019-06-27 The Rockefeller University HUMAN IgG Fc DOMAIN VARIANTS WITH IMPROVED EFFECTOR FUNCTION
WO2019126472A1 (en) 2017-12-22 2019-06-27 Genentech, Inc. Use of pilra binding agents for treatment of a disease
WO2019122054A1 (en) 2017-12-22 2019-06-27 F. Hoffmann-La Roche Ag Depletion of light chain mispaired antibody variants by hydrophobic interaction chromatography
WO2019129211A1 (en) 2017-12-28 2019-07-04 Nanjing Legend Biotech Co., Ltd. Antibodies and variants thereof against pd-l1
US11905327B2 (en) 2017-12-28 2024-02-20 Nanjing Legend Biotech Co., Ltd. Single-domain antibodies and variants thereof against TIGIT
WO2019133512A1 (en) 2017-12-29 2019-07-04 Alector Llc Anti-tmem106b antibodies and methods of use thereof
US11713353B2 (en) 2018-01-15 2023-08-01 Nanjing Legend Biotech Co., Ltd. Single-domain antibodies and variants thereof against PD-1
WO2019143636A1 (en) 2018-01-16 2019-07-25 Lakepharma, Inc. Bispecific antibody that binds cd3 and another target
WO2019145475A2 (en) 2018-01-25 2019-08-01 Acm Biolabs Pte Ltd Polymersomes comprising a soluble encapsulated antigen as well as methods of making and uses thereof
WO2019152715A1 (en) 2018-01-31 2019-08-08 Alector Llc Anti-ms4a4a antibodies and methods of use thereof
WO2019157358A1 (en) 2018-02-09 2019-08-15 Genentech, Inc. Therapeutic and diagnostic methods for mast cell-mediated inflammatory diseases
WO2019171252A1 (en) 2018-03-05 2019-09-12 Janssen Biotech, Inc. Methods of treating crohn's disease with anti-il23 specific antibody
WO2019175125A1 (en) 2018-03-13 2019-09-19 F. Hoffmann-La Roche Ag Combination therapy with targeted 4-1bb (cd137) agonists
WO2019175071A1 (en) 2018-03-13 2019-09-19 F. Hoffmann-La Roche Ag Therapeutic combination of 4-1 bb agonists with anti-cd20 antibodies
US11597727B2 (en) 2018-03-13 2023-03-07 The Regents Of The University Of California Inhibitors of integrin alpha 2 beta 1 and methods of use
WO2019178316A1 (en) 2018-03-14 2019-09-19 Genentech, Inc. Anti-klk5 antibodies and methods of use
WO2019175658A1 (en) 2018-03-14 2019-09-19 Novimmune Sa Anti-cd3 epsilon antibodies and methods of use thereof
US11203646B2 (en) 2018-03-14 2021-12-21 Novimmune Sa Anti-CD3 epsilon antibodies and methods of use thereof
US11891432B2 (en) 2018-03-15 2024-02-06 Chugai Seiyaku Kabushiki Kaisha Anti-dengue virus antibodies having cross-reactivity to Zika virus and methods of use
US11958903B2 (en) 2018-03-30 2024-04-16 Nanjing Legend Biotech Co., Ltd. Single-domain antibodies against LAG-3 and uses thereof
WO2019192432A1 (en) 2018-04-02 2019-10-10 上海博威生物医药有限公司 Lymphocyte activation gene-3 (lag-3) binding antibody and use thereof
WO2019195514A1 (en) 2018-04-04 2019-10-10 Genentech, Inc. Methods for detecting and quantifying fgf21
WO2019202040A1 (en) 2018-04-18 2019-10-24 F. Hoffmann-La Roche Ag Anti-hla-g antibodies and use thereof
WO2019213416A1 (en) 2018-05-02 2019-11-07 The Usa, As Represented By The Secretary, Dept. Of Health And Human Services Antibodies and methods for the diagnosis, prevention, and treatment of epstein barr virus infection
WO2019215701A1 (en) 2018-05-11 2019-11-14 Janssen Biotech, Inc. Methods of treating depression using il-23 antibodies
US11535658B2 (en) 2018-05-14 2022-12-27 Werewolf Therapeutics, Inc. Activatable interleukin-2 polypeptides and methods of use thereof
US11453710B2 (en) 2018-05-14 2022-09-27 Werewolf Therapeutics, Inc. Activatable interleukin 12 polypeptides and methods of use thereof
US11352403B2 (en) 2018-05-14 2022-06-07 Werewolf Therapeutics, Inc. Activatable interleukin-2 polypeptides and methods of use thereof
WO2019224385A2 (en) 2018-05-24 2019-11-28 Glenmark Pharmaceuticals S.A. Combined bispecific antibody and immuno-oncology therapies
WO2019226973A1 (en) 2018-05-25 2019-11-28 Alector Llc Anti-sirpa antibodies and methods of use thereof
WO2019236965A1 (en) 2018-06-08 2019-12-12 Alector Llc Anti-siglec-7 antibodies and methods of use thereof
US11332541B2 (en) 2018-06-09 2022-05-17 Boehringer Ingelheim International Gmbh Multi-specific binding proteins for cancer treatment
WO2019234220A1 (en) 2018-06-09 2019-12-12 Boehringer Ingelheim International Gmbh Dll3-cd3 bispecific antibodies
US11241417B2 (en) 2018-06-21 2022-02-08 Yumanity Therapeutics, Inc. Compositions and methods for the treatment and prevention of neurological disorders
WO2019246557A1 (en) 2018-06-23 2019-12-26 Genentech, Inc. Methods of treating lung cancer with a pd-1 axis binding antagonist, a platinum agent, and a topoisomerase ii inhibitor
US11203645B2 (en) 2018-06-27 2021-12-21 Obi Pharma, Inc. Glycosynthase variants for glycoprotein engineering and methods of use
WO2020006568A1 (en) 2018-06-29 2020-01-02 City Of Hope Cd6 targeted chimeric antigen receptors for treatent of certain autoimmune disorders
WO2020006374A2 (en) 2018-06-29 2020-01-02 Alector Llc Anti-sirp-beta1 antibodies and methods of use thereof
WO2020014306A1 (en) 2018-07-10 2020-01-16 Immunogen, Inc. Met antibodies and immunoconjugates and uses thereof
WO2020014617A1 (en) 2018-07-13 2020-01-16 Alector Llc Anti-sortilin antibodies and methods of use thereof
US11396546B2 (en) 2018-07-13 2022-07-26 Alector Llc Anti-Sortilin antibodies and methods of use thereof
EP4212210A1 (en) 2018-07-13 2023-07-19 Alector LLC Anti-sortilin antibodies and methods of use thereof
WO2020016838A2 (en) 2018-07-18 2020-01-23 Janssen Biotech, Inc. Sustained response predictors after treatment with anti-il23 specific antibody
WO2020018789A1 (en) 2018-07-18 2020-01-23 Genentech, Inc. Methods of treating lung cancer with a pd-1 axis binding antagonist, an antimetabolite, and a platinum agent
US11279758B2 (en) 2018-07-20 2022-03-22 Surface Oncology, Inc. Anti-CD112R compositions and methods
US11214619B2 (en) 2018-07-20 2022-01-04 Surface Oncology, Inc. Anti-CD112R compositions and methods
WO2020023920A1 (en) 2018-07-27 2020-01-30 Alector Llc Anti-siglec-5 antibodies and methods of use thereof
WO2020027330A1 (en) 2018-08-03 2020-02-06 中外製薬株式会社 Antigen-binding molecule containing two antigen-binding domains that are linked to each other
WO2020033485A1 (en) 2018-08-08 2020-02-13 Genentech, Inc. Use of tryptophan derivatives and l-methionine for protein formulation
EP3608674A1 (en) 2018-08-09 2020-02-12 Regeneron Pharmaceuticals, Inc. Methods for assessing binding affinity of an antibody variant to the neonatal fc receptor
WO2020032230A1 (en) 2018-08-10 2020-02-13 中外製薬株式会社 Anti-cd137 antigen-binding molecule and utilization thereof
WO2020035577A1 (en) 2018-08-16 2020-02-20 Cantargia Ab Anti-il1rap antibody compositions
WO2020037154A1 (en) 2018-08-17 2020-02-20 23Andme, Inc. Anti-il1rap antibodies and methods of use thereof
WO2020041541A2 (en) 2018-08-23 2020-02-27 Seattle Genetics, Inc. Anti-tigit antibodies
WO2020041758A1 (en) 2018-08-24 2020-02-27 City Of Hope Masked cytokine conjugates
WO2020047374A1 (en) 2018-08-31 2020-03-05 Alector Llc Anti-cd33 antibodies and methods of use thereof
WO2020049286A1 (en) 2018-09-03 2020-03-12 Femtogenix Limited Polycyclic amides as cytotoxic agents
EP4268831A2 (en) 2018-09-12 2023-11-01 Fred Hutchinson Cancer Center Reducing cd33 expression to selectively protect therapeutic cells
WO2020053325A1 (en) 2018-09-12 2020-03-19 Acm Biolabs Pte Ltd Polymersomes comprising a covalently bound antigen as well as methods of making and uses thereof
WO2020061060A1 (en) 2018-09-19 2020-03-26 Genentech, Inc. Therapeutic and diagnostic methods for bladder cancer
WO2020061381A1 (en) 2018-09-19 2020-03-26 La Jolla Institute For Immunology Ptprs and proteoglycans in rheumatoid arthritis
EP4249917A2 (en) 2018-09-21 2023-09-27 F. Hoffmann-La Roche AG Diagnostic methods for triple-negative breast cancer
WO2020061349A1 (en) 2018-09-21 2020-03-26 Genentech, Inc. Diagnostic methods for triple-negative breast cancer
EP4321530A2 (en) 2018-09-27 2024-02-14 Xilio Development, Inc. Masked cytokine polypeptides
US11866476B2 (en) 2018-09-27 2024-01-09 Xilio Development, Inc. Masked IL-2-Fc fusion polypeptides
US11827685B2 (en) 2018-09-27 2023-11-28 Xilio Development, Inc. Masked cytokine polypeptides
US11718655B2 (en) 2018-09-27 2023-08-08 Xilio Development, Inc. Masked interleukin-12 polypeptides
US11053294B2 (en) 2018-09-27 2021-07-06 Xilio Development, Inc. Masked cytokine polypeptides
US11827686B2 (en) 2018-09-27 2023-11-28 Xilio Development, Inc. Masked cytokine polypeptides
WO2020081767A1 (en) 2018-10-18 2020-04-23 Genentech, Inc. Diagnostic and therapeutic methods for sarcomatoid kidney cancer
WO2020086858A1 (en) 2018-10-24 2020-04-30 Genentech, Inc. Conjugated chemical inducers of degradation and methods of use
WO2020092455A2 (en) 2018-10-29 2020-05-07 The Broad Institute, Inc. Car t cell transcriptional atlas
WO2020096959A1 (en) 2018-11-05 2020-05-14 Genentech, Inc. Methods of producing two chain proteins in prokaryotic host cells
WO2020104496A1 (en) 2018-11-20 2020-05-28 INSERM (Institut National de la Santé et de la Recherche Médicale) Bispecific antibody targeting transferrin receptor 1 and soluble antigen
WO2020104943A2 (en) 2018-11-20 2020-05-28 Janssen Biotech, Inc. Safe and effective method of treating psoriasis with anti-il-23 specific antibody
US11548941B2 (en) 2018-11-20 2023-01-10 Janssen Biotech, Inc. Safe and effective method of treating psoriasis with anti-IL-23 specific antibody
US11530231B2 (en) 2018-12-04 2022-12-20 Sumitomo Pharma Oncology, Inc. CDK9 inhibitors and polymorphs thereof for use as agents for treatment of cancer
US11034710B2 (en) 2018-12-04 2021-06-15 Sumitomo Dainippon Pharma Oncology, Inc. CDK9 inhibitors and polymorphs thereof for use as agents for treatment of cancer
WO2020117257A1 (en) 2018-12-06 2020-06-11 Genentech, Inc. Combination therapy of diffuse large b-cell lymphoma comprising an anti-cd79b immunoconjugates, an alkylating agent and an anti-cd20 antibody
WO2020123275A1 (en) 2018-12-10 2020-06-18 Genentech, Inc. Photocrosslinking peptides for site specific conjugation to fc-containing proteins
WO2020132034A1 (en) 2018-12-20 2020-06-25 23Andme, Inc. Anti-cd96 antibodies and methods of use thereof
WO2020132230A2 (en) 2018-12-20 2020-06-25 Genentech, Inc. Modified antibody fcs and methods of use
WO2020132220A1 (en) 2018-12-21 2020-06-25 23Andme, Inc. Anti-il-36 antibodies and methods of use thereof
WO2020132231A1 (en) 2018-12-21 2020-06-25 Genentech, Inc. Methods of producing polypeptides using a cell line resistant to apoptosis
WO2020139920A2 (en) 2018-12-26 2020-07-02 City Of Hope Activatable masked anti-ctla4 binding proteins
WO2020139926A2 (en) 2018-12-26 2020-07-02 Akrevia Therapeutics Inc. Anti-ctla4 antibodies and methods of use thereof
WO2020141117A1 (en) 2018-12-30 2020-07-09 F. Hoffmann-La Roche Ag Ph-gradient spr-based binding assay
WO2020154410A1 (en) 2019-01-23 2020-07-30 Genentech, Inc. Methods of producing multimeric proteins in eukaryotic host cells
WO2020153467A1 (en) 2019-01-24 2020-07-30 中外製薬株式会社 Novel cancer antigens and antibodies of said antigens
WO2020157491A1 (en) 2019-01-29 2020-08-06 Femtogenix Limited G-a crosslinking cytotoxic agents
WO2020185535A1 (en) 2019-03-08 2020-09-17 Genentech, Inc. Methods for detecting and quantifying membrane-associated proteins on extracellular vesicles
WO2020186176A1 (en) 2019-03-14 2020-09-17 Genentech, Inc. Treatment of cancer with her2xcd3 bispecific antibodies in combination with anti-her2 mab
US11793802B2 (en) 2019-03-20 2023-10-24 Sumitomo Pharma Oncology, Inc. Treatment of acute myeloid leukemia (AML) with venetoclax failure
WO2020200941A1 (en) 2019-03-29 2020-10-08 F. Hoffmann-La Roche Ag Spr-based binding assay for the functional analysis of multivalent molecules
WO2020200944A1 (en) 2019-03-29 2020-10-08 F. Hoffmann-La Roche Ag Method for generating avid-binding multispecific antibodies
WO2020214963A1 (en) 2019-04-18 2020-10-22 Genentech, Inc. Antibody potency assay
WO2020213724A1 (en) 2019-04-19 2020-10-22 中外製薬株式会社 Chimeric receptor recognizing modification site of antibody
WO2020214995A1 (en) 2019-04-19 2020-10-22 Genentech, Inc. Anti-mertk antibodies and their methods of use
WO2020229982A1 (en) 2019-05-10 2020-11-19 Takeda Pharmaceutical Company Limited Antibody drug conjugates
WO2020229378A1 (en) 2019-05-13 2020-11-19 F. Hoffmann-La Roche Ag Interference-suppressed pharmacokinetic immunoassay
WO2020232169A1 (en) 2019-05-14 2020-11-19 Genentech, Inc. Methods of using anti-cd79b immunoconjugates to treat follicular lymphoma
US11739132B2 (en) 2019-05-14 2023-08-29 Werewolf Therapeutics, Inc. Separation moieties and methods of use thereof
WO2020230142A1 (en) 2019-05-15 2020-11-19 Neotx Therapeutics Ltd. Cancer treatment
WO2020232295A1 (en) 2019-05-16 2020-11-19 Procisedx Inc. An assay method for the detection of vcam-1 and alpha-2-macroglobulin in blood
WO2020232262A1 (en) 2019-05-16 2020-11-19 Procisedx Inc. Assay detection methods for vcam-1 and calprotectin
US11780911B2 (en) 2019-05-23 2023-10-10 Janssen Biotech, Inc. Method of treating inflammatory bowel disease with a combination therapy of antibodies to IL-23 and TNF alpha
WO2020236528A1 (en) 2019-05-23 2020-11-26 Procisedx Inc. Assay methods for the detection of human serum albumin, vitamin d, c-reactive protein, and anti-transglutaminase autoantibody
WO2020245677A1 (en) 2019-06-03 2020-12-10 Janssen Biotech, Inc. Anti-tnf antibodies, compositions, and methods for the treatment of active ankylosing spondylitis
WO2020247634A1 (en) 2019-06-05 2020-12-10 Genentech, Inc. A method for regeneration of an overload chromatography column
WO2020247159A1 (en) 2019-06-06 2020-12-10 Procisedx Inc. DETECTION OF HEMOGLOBIN A1C (HbA1c) IN BLOOD
WO2020250915A1 (en) 2019-06-10 2020-12-17 中外製薬株式会社 Anti-t cell antigen-binding molecule to be used in combination with cytokine inhibitor
WO2020252066A1 (en) 2019-06-11 2020-12-17 Alector Llc Anti-sortilin antibodies for use in therapy
WO2020254352A1 (en) 2019-06-19 2020-12-24 F. Hoffmann-La Roche Ag Method for the generation of a trivalent antibody expressing cell by targeted integration of multiple expression cassettes in a defined organization
WO2020254355A1 (en) 2019-06-19 2020-12-24 F. Hoffmann-La Roche Ag Method for the generation of a bivalent, bispecific antibody expressing cell by targeted integration of multiple expression cassettes in a defined organization
WO2020254357A1 (en) 2019-06-19 2020-12-24 F. Hoffmann-La Roche Ag Method for the generation of a protein expressing cell by targeted integration using cre mrna
WO2020254351A1 (en) 2019-06-19 2020-12-24 F. Hoffmann-La Roche Ag Method for the generation of a multivalent, multispecific antibody expressing cell by targeted integration of multiple expression cassettes in a defined organization
WO2020254356A1 (en) 2019-06-19 2020-12-24 F. Hoffmann-La Roche Ag Method for the generation of a multivalent, bispecific antibody expressing cell by targeted integration of multiple expression cassettes in a defined organization
WO2020263450A1 (en) 2019-06-25 2020-12-30 Procisedx Inc. Detection of anti-tnf alpha drug biologics and anti-drug antibodies
WO2020260327A1 (en) 2019-06-26 2020-12-30 F. Hoffmann-La Roche Ag Mammalian cell lines with sirt-1 gene knockout
US11865177B2 (en) 2019-06-28 2024-01-09 Genentech, Inc. Composition and methods for stabilizing liquid protein formulations
WO2020264300A1 (en) 2019-06-28 2020-12-30 Genentech, Inc. Composition and methods for stabilizing liquid protein formulations
WO2021010326A1 (en) 2019-07-12 2021-01-21 中外製薬株式会社 Anti-mutation type fgfr3 antibody and use therefor
WO2021011673A2 (en) 2019-07-16 2021-01-21 Ming Jin Neutralizing anti-amyloid beta antibodies for the treatment of alzheimer's disease
US11034770B2 (en) 2019-07-19 2021-06-15 Oncoresponse, Inc. Immunomodulatory antibodies and methods of use thereof
US11827715B2 (en) 2019-07-19 2023-11-28 Oncoresponse, Inc. Human CD163 antibodies and uses thereof
US11634501B2 (en) 2019-07-19 2023-04-25 Oncoresponse, Inc. Immunomodulatory antibodies and methods of use thereof
WO2021021605A1 (en) 2019-07-26 2021-02-04 Vanderbilt University Human monoclonal antibodies to enterovirus d68
WO2021017892A1 (en) 2019-07-26 2021-02-04 上海复宏汉霖生物技术股份有限公司 Method and composition for anti-cd73 antibodies and variants
WO2021022083A2 (en) 2019-07-31 2021-02-04 Alector Llc Anti-ms4a4a antibodies and methods of use thereof
WO2021024209A1 (en) 2019-08-06 2021-02-11 Aprinoia Therapeutics Inc. Antibodies that bind to pathological tau species and uses thereof
WO2021030251A1 (en) 2019-08-12 2021-02-18 Purinomia Biotech, Inc. Methods and compositions for promoting and potentiating t-cell mediated immune responses through adcc targeting of cd39 expressing cells
WO2021028752A1 (en) 2019-08-15 2021-02-18 Janssen Biotech, Inc. Anti-tfn antibodies for treating type i diabetes
WO2021050645A1 (en) 2019-09-12 2021-03-18 Genentech, Inc. Compositions and methods of treating lupus nephritis
WO2021055694A1 (en) 2019-09-20 2021-03-25 Genentech, Inc. Dosing for anti-tryptase antibodies
WO2021057978A1 (en) 2019-09-27 2021-04-01 南京金斯瑞生物科技有限公司 Anti-vhh domain antibodies and use thereof
US11732045B2 (en) 2019-10-02 2023-08-22 Boehringer Ingelheim International Gmbh Multi-specific binding proteins for cancer treatment
WO2021064137A2 (en) 2019-10-02 2021-04-08 Boehringer Ingelheim International Gmbh Multi-specific binding proteins for cancer treatment
WO2021076196A1 (en) 2019-10-18 2021-04-22 Genentech, Inc. Methods of using anti-cd79b immunoconjugates to treat diffuse large b-cell lymphoma
WO2021119400A1 (en) 2019-12-12 2021-06-17 Alector Llc Methods of use of anti-cd33 antibodies
WO2021119505A1 (en) 2019-12-13 2021-06-17 Genentech, Inc. Anti-ly6g6d antibodies and methods of use
WO2021131021A1 (en) 2019-12-27 2021-07-01 中外製薬株式会社 Anti-ctla-4 antibody and use thereof
US11820827B2 (en) 2019-12-30 2023-11-21 Seagen Inc. Methods of treating myelodysplastic syndrome and acute myeloid leukemia with nonfucosylated anti-CD70 antibodies
WO2021138454A1 (en) 2019-12-30 2021-07-08 City Of Hope Methods of making and using regulatory t cells and effector t cells having chimeric antigen receptors targeted to cd6, cd19, and/or an il-13r for treatment of autoimmune disorders and cancers
WO2021138264A1 (en) 2019-12-30 2021-07-08 Seagen Inc. Methods of treating cancer with nonfucosylated anti-cd70 antibodies
WO2021136772A1 (en) 2020-01-02 2021-07-08 F. Hoffmann-La Roche Ag Method for determining the amount of a therapeutic antibody in the brain
WO2021139777A1 (en) 2020-01-10 2021-07-15 上海复宏汉霖生物技术股份有限公司 Anti-tigit antibodies and usage method
WO2021160154A1 (en) 2020-02-10 2021-08-19 上海诗健生物科技有限公司 Cldn18.2 antibody and use thereof
WO2021160155A1 (en) 2020-02-10 2021-08-19 上海诗健生物科技有限公司 Claudin 18.2 antibody and use thereof
WO2021163265A1 (en) 2020-02-11 2021-08-19 Vanderbilt University Human monoclonal antibodies to severe acute respiratory syndrome coronavirus 2 (sars-cov- 2)
WO2021162020A1 (en) 2020-02-12 2021-08-19 中外製薬株式会社 Anti-cd137 antigen-binding molecule for use in cancer treatment
WO2021170082A1 (en) 2020-02-28 2021-09-02 南京圣和药业股份有限公司 Anti-cd47/anti-pd-l1 antibody and applications thereof
WO2021183849A1 (en) 2020-03-13 2021-09-16 Genentech, Inc. Anti-interleukin-33 antibodies and uses thereof
WO2021188749A1 (en) 2020-03-19 2021-09-23 Genentech, Inc. Isoform-selective anti-tgf-beta antibodies and methods of use
WO2021194913A1 (en) 2020-03-24 2021-09-30 Genentech, Inc. Tie2-binding agents and methods of use
WO2021195418A1 (en) 2020-03-26 2021-09-30 Vanderbilt University Human monoclonal antibodies to severe acute respiratory syndrome coronavirus 2 (sars-cov-2)
WO2021195385A1 (en) 2020-03-26 2021-09-30 Vanderbilt University HUMAN MONOCLONAL ANTIBODIES TO SEVERE ACUTE RESPIRATORY SYNDROME CORONAVIRUS 2 (SARS-GoV-2)
WO2021201202A1 (en) 2020-04-02 2021-10-07 中外製薬株式会社 Analysis method for impurity molecules in composition containing multi-specific antigen-binding molecules
WO2021202959A1 (en) 2020-04-03 2021-10-07 Genentech, Inc. Therapeutic and diagnostic methods for cancer
WO2021217051A1 (en) 2020-04-24 2021-10-28 Genentech, Inc. Methods of using anti-cd79b immunoconjugates
WO2021222167A1 (en) 2020-04-28 2021-11-04 Genentech, Inc. Methods and compositions for non-small cell lung cancer immunotherapy
WO2021222533A1 (en) 2020-04-30 2021-11-04 Procisedx Inc. Methods of detecting antibodies to sars-cov-2
US11643388B2 (en) 2020-05-01 2023-05-09 The Regents Of The University Of California Inhibitors of alpha 2 beta 1 integrin and methods of use thereof
WO2021225892A1 (en) 2020-05-03 2021-11-11 Levena (Suzhou) Biopharma Co., Ltd. Antibody-drug conjugates (adcs) comprising an anti-trop-2 antibody, compositions comprising such adcs, as well as methods of making and using the same
WO2021236658A1 (en) 2020-05-19 2021-11-25 Boehringer Ingelheim International Gmbh Binding molecules for the treatment of cancer
WO2021243204A1 (en) 2020-05-29 2021-12-02 23Andme, Inc. Anti-cd200r1 antibodies and methods of use thereof
WO2021252977A1 (en) 2020-06-12 2021-12-16 Genentech, Inc. Methods and compositions for cancer immunotherapy
WO2021257503A1 (en) 2020-06-16 2021-12-23 Genentech, Inc. Methods and compositions for treating triple-negative breast cancer
WO2021256555A1 (en) 2020-06-19 2021-12-23 中外製薬株式会社 Anti-t cell antigen-binding molecule for use in combination with angiogenesis inhibitor
WO2021259880A1 (en) 2020-06-22 2021-12-30 Almirall, S.A. Anti-il-36 antibodies and methods of use thereof
WO2021152186A2 (en) 2020-06-26 2021-08-05 Bayer Aktiengesellschaft Ccr8 antibodies for therapeutic applications
WO2021260208A2 (en) 2020-06-26 2021-12-30 Bayer Aktiengesellschaft Sulfated peptides for chemokine receptor antibody generation
WO2021260206A2 (en) 2020-06-26 2021-12-30 Bayer Aktiengesellschaft Chemokine receptor antibodies binding sulfated trd motifs
WO2021260209A2 (en) 2020-06-26 2021-12-30 Bayer Aktiengesellschaft Ccr8 antibodies and uses thereof
US11427640B1 (en) 2020-06-26 2022-08-30 Bayer Aktiengesellschaft CCR8 antibodies for therapeutic applications
WO2021260210A2 (en) 2020-06-26 2021-12-30 Bayer Aktiengesellschaft Anti ccr8 antibody therapy: biomarkers & combination therapies
WO2022016119A1 (en) 2020-07-17 2022-01-20 Simurx, Inc. Chimeric myd88 receptors for redirecting immunosuppressive signaling and related compositions and methods
WO2022020288A1 (en) 2020-07-21 2022-01-27 Genentech, Inc. Antibody-conjugated chemical inducers of degradation of brm and methods thereof
WO2022023735A1 (en) 2020-07-28 2022-02-03 Femtogenix Limited Cytotoxic agents
WO2022025220A1 (en) 2020-07-31 2022-02-03 中外製薬株式会社 Pharmaceutical composition including cell expressing chimeric receptor
WO2022057651A1 (en) 2020-09-16 2022-03-24 四川科伦博泰生物医药股份有限公司 Anti-nectin-4 antibody, conjugate including same, and application thereof
WO2022061214A1 (en) 2020-09-21 2022-03-24 Genentech, Inc. Purification of multispecific antibodies
WO2022063100A1 (en) 2020-09-22 2022-03-31 南京圣和药业股份有限公司 Anti-tigit antibody and double antibody and their application
WO2022063877A1 (en) 2020-09-24 2022-03-31 F. Hoffmann-La Roche Ag Mammalian cell lines with gene knockout
WO2022069557A2 (en) 2020-09-29 2022-04-07 Immatics Biotechnologies Gmbh Amidated peptides and their deamidated counterparts displayed by hla-a*02 for use in immunotherapy against different types of cancers
WO2022069579A2 (en) 2020-09-29 2022-04-07 Immatics Biotechnologies Gmbh Amidated peptides and their deamidated counterparts displayed by non-hla-a*02 for use in immunotherapy against different types of cancers
DE102020125457A1 (en) 2020-09-29 2022-03-31 Immatics Biotechnologies Gmbh Amidated peptides and their deamidated counterparts presented by HLA-A*02 molecules for use in immunotherapy against various types of cancer
DE102020125465A1 (en) 2020-09-29 2022-03-31 Immatics Biotechnologies Gmbh Amidated peptides and their deamidated counterparts presented by non-HLA-A*02 molecules for use in immunotherapy against various types of cancer
WO2022076462A1 (en) 2020-10-05 2022-04-14 Genentech, Inc. Dosing for treatment with anti-fcrh5/anti-cd3 bispecific antibodies
WO2022084210A1 (en) 2020-10-20 2022-04-28 F. Hoffmann-La Roche Ag Combination therapy of pd-1 axis binding antagonists and lrrk2 inhitibors
WO2022084355A2 (en) 2020-10-21 2022-04-28 Boehringer Ingelheim International Gmbh Agonistic trkb binding molecules for the treatment of eye diseases
WO2022084354A1 (en) 2020-10-21 2022-04-28 Boehringer Ingelheim International Gmbh Bispecific anti-vegf and anti-trkb binding molecules for the treatment of eye diseases
WO2022098972A1 (en) 2020-11-08 2022-05-12 Seagen Inc. Combination-therapy antibody drug conjugate with immune cell inhibitor
WO2022097117A1 (en) 2020-11-09 2022-05-12 Takeda Pharmaceutical Company Ltd. Antibody drug conjugates
WO2022100613A1 (en) 2020-11-10 2022-05-19 上海齐鲁制药研究中心有限公司 Bispecific antibody for claudin 18a2 and cd3 and application of bispecific antibody
WO2022101458A1 (en) 2020-11-16 2022-05-19 F. Hoffmann-La Roche Ag Combination therapy with fap-targeted cd40 agonists
WO2022120352A1 (en) 2020-12-02 2022-06-09 Alector Llc Methods of use of anti-sortilin antibodies
WO2022136140A1 (en) 2020-12-22 2022-06-30 F. Hoffmann-La Roche Ag Oligonucleotides targeting xbp1
WO2022152880A1 (en) 2021-01-15 2022-07-21 Immatics Biotechnologies Gmbh Peptides displayed by hla for use in immunotherapy against different types of cancers
WO2022159349A1 (en) 2021-01-20 2022-07-28 Oncoresponse, Inc. Immunomodulatory antibodies and uses thereof
WO2022157094A2 (en) 2021-01-22 2022-07-28 Bayer Aktiengesellschaft Lrrc15 antibodies and conjugates thereof
WO2022169825A1 (en) 2021-02-03 2022-08-11 Mozart Therapeutics, Inc. Binding agents and methods of using the same
WO2022175217A1 (en) 2021-02-18 2022-08-25 F. Hoffmann-La Roche Ag Method for resolving complex, multistep antibody interactions
WO2022177393A1 (en) 2021-02-19 2022-08-25 (주)샤페론 Single domain antibody against pd-l1 and use thereof
WO2022177392A1 (en) 2021-02-19 2022-08-25 (주)샤페론 Single domain antibody against cd47 and use thereof
WO2022187272A1 (en) 2021-03-01 2022-09-09 Xilio Development, Inc. Combination of masked ctla4 and pd1/pdl1 antibodies for treating cancer
WO2022187270A1 (en) 2021-03-01 2022-09-09 Xilio Development, Inc. Combination of ctla4 and pd1/pdl1 antibodies for treating cancer
WO2022184082A1 (en) 2021-03-03 2022-09-09 Sorrento Therapeutics, Inc. Antibody-drug conjugates comprising an anti-bcma antibody
WO2022190033A1 (en) 2021-03-12 2022-09-15 Janssen Biotech, Inc. Safe and effective method of treating psoriatic arthritis with anti-il23 specific antibody
WO2022190034A1 (en) 2021-03-12 2022-09-15 Janssen Biotech, Inc. Method of treating psoriatic arthritis patients with inadequate response to tnf therapy with anti-il23 specific antibody
WO2022198192A1 (en) 2021-03-15 2022-09-22 Genentech, Inc. Compositions and methods of treating lupus nephritis
WO2022197947A1 (en) 2021-03-18 2022-09-22 Alector Llc Anti-tmem106b antibodies and methods of use thereof
WO2022197877A1 (en) 2021-03-19 2022-09-22 Genentech, Inc. Methods and compositions for time delayed bio-orthogonal release of cytotoxic agents
WO2022200389A1 (en) 2021-03-22 2022-09-29 Novimmune S.A. Bispecific antibodies targeting cd47 and pd-l1 and methods of use thereof
WO2022200387A1 (en) 2021-03-22 2022-09-29 Novimmune S.A. Bispecific antibodies targeting cd47 and pd-l1 and methods of use thereof
WO2022204274A1 (en) 2021-03-23 2022-09-29 Alector Llc Anti-tmem106b antibodies for treating and preventing coronavirus infections
WO2022201122A1 (en) 2021-03-26 2022-09-29 Janssen Biotech, Inc. Humanized antibodies against paired helical filament tau and uses thereof
WO2022214565A1 (en) 2021-04-09 2022-10-13 F. Hoffmann-La Roche Ag Process for selecting cell clones expressing a heterologous polypeptide
WO2022217026A1 (en) 2021-04-09 2022-10-13 Seagen Inc. Methods of treating cancer with anti-tigit antibodies
WO2022217022A1 (en) 2021-04-10 2022-10-13 Profoundbio Us Co. Folr1 binding agents, conjugates thereof and methods of using the same
WO2022218957A1 (en) 2021-04-12 2022-10-20 Acm Biolabs Pte Ltd Polymersomes comprising a soluble encapsulated polynucleotide and an ionizable lipid as well as methods of making and uses thereof
WO2022220275A1 (en) 2021-04-15 2022-10-20 中外製薬株式会社 ANTI-C1s ANTIBODY
WO2022226317A1 (en) 2021-04-23 2022-10-27 Profoundbio Us Co. Anti-cd70 antibodies, conjugates thereof and methods of using the same
WO2022228705A1 (en) 2021-04-30 2022-11-03 F. Hoffmann-La Roche Ag Dosing for combination treatment with anti-cd20/anti-cd3 bispecific antibody and anti-cd79b antibody drug conjugate
WO2022228706A1 (en) 2021-04-30 2022-11-03 F. Hoffmann-La Roche Ag Dosing for treatment with anti-cd20/anti-cd3 bispecific antibody
WO2022238481A1 (en) 2021-05-11 2022-11-17 Modiquest B.V. Antibodies
WO2022241446A1 (en) 2021-05-12 2022-11-17 Genentech, Inc. Methods of using anti-cd79b immunoconjugates to treat diffuse large b-cell lymphoma
WO2022241082A1 (en) 2021-05-14 2022-11-17 Genentech, Inc. Agonists of trem2
WO2022247030A1 (en) 2021-05-27 2022-12-01 江苏荃信生物医药股份有限公司 ANTI-HUMAN INTERFERON α RECEPTOR 1 MONOCLONAL ANTIBODY AND APPLICATION THEREOF
EP4155321A1 (en) 2021-06-04 2023-03-29 Chugai Seiyaku Kabushiki Kaisha Anti-ddr2 antibodies and uses thereof
WO2022258600A1 (en) 2021-06-09 2022-12-15 F. Hoffmann-La Roche Ag Combination of a particular braf inhibitor (paradox breaker) and a pd-1 axis binding antagonist for use in the treatment of cancer
WO2022263507A1 (en) 2021-06-17 2022-12-22 Boehringer Ingelheim International Gmbh Novel tri-specific binding molecules
WO2022270612A1 (en) 2021-06-25 2022-12-29 中外製薬株式会社 Use of anti-ctla-4 antibody
WO2022270611A1 (en) 2021-06-25 2022-12-29 中外製薬株式会社 Anti–ctla-4 antibody
WO2023278377A1 (en) 2021-06-29 2023-01-05 Seagen Inc. Methods of treating cancer with a combination of a nonfucosylated anti-cd70 antibody and a cd47 antagonist
WO2023280227A2 (en) 2021-07-06 2023-01-12 Profoundbio Us Co. Linkers, drug linkers and conjugates thereof and methods of using the same
WO2023004386A1 (en) 2021-07-22 2023-01-26 Genentech, Inc. Brain targeting compositions and methods of use thereof
WO2023019239A1 (en) 2021-08-13 2023-02-16 Genentech, Inc. Dosing for anti-tryptase antibodies
WO2023028591A1 (en) 2021-08-27 2023-03-02 Genentech, Inc. Methods of treating tau pathologies
WO2023034750A1 (en) 2021-08-30 2023-03-09 Genentech, Inc. Anti-polyubiquitin multispecific antibodies
WO2023029280A1 (en) 2021-09-03 2023-03-09 江苏荃信生物医药股份有限公司 Anti-human interleukin-33 monoclonal antibody and use thereof
WO2023029281A1 (en) 2021-09-03 2023-03-09 江苏荃信生物医药股份有限公司 Anti-human tslp monoclonal antibody and use thereof
WO2023058723A1 (en) 2021-10-08 2023-04-13 中外製薬株式会社 Method for preparing prefilled syringe formulation
WO2023064947A1 (en) 2021-10-15 2023-04-20 Regenxbio Inc. Antibodies and methods of using thereof
WO2023076876A1 (en) 2021-10-26 2023-05-04 Mozart Therapeutics, Inc. Modulation of immune responses to viral vectors
WO2023073615A1 (en) 2021-10-29 2023-05-04 Janssen Biotech, Inc. Methods of treating crohn's disease with anti-il23 specific antibody
WO2023081898A1 (en) 2021-11-08 2023-05-11 Alector Llc Soluble cd33 as a biomarker for anti-cd33 efficacy
WO2023086807A1 (en) 2021-11-10 2023-05-19 Genentech, Inc. Anti-interleukin-33 antibodies and uses thereof
WO2023084488A1 (en) 2021-11-15 2023-05-19 Janssen Biotech, Inc. Methods of treating crohn's disease with anti-il23 specific antibody
WO2023095000A1 (en) 2021-11-23 2023-06-01 Janssen Biotech, Inc. Method of treating ulcerative colitis with anti-il23 specific antibody
WO2023094282A1 (en) 2021-11-25 2023-06-01 F. Hoffmann-La Roche Ag Quantification of low amounts of antibody sideproducts
WO2023117325A1 (en) 2021-12-21 2023-06-29 F. Hoffmann-La Roche Ag Method for the determination of hydrolytic activity
WO2023147329A1 (en) 2022-01-26 2023-08-03 Genentech, Inc. Antibody-conjugated chemical inducers of degradation and methods thereof
WO2023147328A1 (en) 2022-01-26 2023-08-03 Genentech, Inc. Antibody-conjugated chemical inducers of degradation with hydolysable maleimide linkers and methods thereof
WO2023173026A1 (en) 2022-03-10 2023-09-14 Sorrento Therapeutics, Inc. Antibody-drug conjugates and uses thereof
WO2023170295A1 (en) 2022-03-11 2023-09-14 Janssen Pharmaceutica Nv Multispecific antibodies and uses thereof
WO2023170290A1 (en) 2022-03-11 2023-09-14 Janssen Pharmaceutica Nv Multispecific antibodies and uses thereof
WO2023170291A1 (en) 2022-03-11 2023-09-14 Janssen Pharmaceutica Nv Multispecific antibodies and uses thereof
WO2023178357A1 (en) 2022-03-18 2023-09-21 Evolveimmune Therapeutics, Inc. Bispecific antibody fusion molecules and methods of use thereof
WO2023180353A1 (en) 2022-03-23 2023-09-28 F. Hoffmann-La Roche Ag Combination treatment of an anti-cd20/anti-cd3 bispecific antibody and chemotherapy
WO2023187707A1 (en) 2022-03-30 2023-10-05 Janssen Biotech, Inc. Method of treating mild to moderate psoriasis with il-23 specific antibody
WO2023191816A1 (en) 2022-04-01 2023-10-05 Genentech, Inc. Dosing for treatment with anti-fcrh5/anti-cd3 bispecific antibodies
WO2023187407A1 (en) 2022-04-01 2023-10-05 Bradcode Limited Human monoclonal antibodies binding to sars-cov-2 and methods of use thereof
WO2023192622A1 (en) 2022-04-01 2023-10-05 Genentech, Inc. Hydroxypropyl methyl cellulose derivatives to stabilize polypeptides
WO2023201299A1 (en) 2022-04-13 2023-10-19 Genentech, Inc. Pharmaceutical compositions of therapeutic proteins and methods of use
WO2023198727A1 (en) 2022-04-13 2023-10-19 F. Hoffmann-La Roche Ag Pharmaceutical compositions of anti-cd20/anti-cd3 bispecific antibodies and methods of use
WO2023202967A1 (en) 2022-04-19 2023-10-26 F. Hoffmann-La Roche Ag Improved production cells
WO2023215737A1 (en) 2022-05-03 2023-11-09 Genentech, Inc. Anti-ly6e antibodies, immunoconjugates, and uses thereof
WO2023215498A2 (en) 2022-05-05 2023-11-09 Modernatx, Inc. Compositions and methods for cd28 antagonism
US11965023B2 (en) 2022-05-09 2024-04-23 Alector Llc Anti-Siglec-5 antibodies and methods of use thereof
WO2023219613A1 (en) 2022-05-11 2023-11-16 Genentech, Inc. Dosing for treatment with anti-fcrh5/anti-cd3 bispecific antibodies
WO2023223265A1 (en) 2022-05-18 2023-11-23 Janssen Biotech, Inc. Method for evaluating and treating psoriatic arthritis with il23 antibody
WO2023232961A1 (en) 2022-06-03 2023-12-07 F. Hoffmann-La Roche Ag Improved production cells
WO2023245105A1 (en) 2022-06-17 2023-12-21 Genentech, Inc. Use of kosmotropes to enhance yield of an affinity chromatography purification step
WO2024015897A1 (en) 2022-07-13 2024-01-18 Genentech, Inc. Dosing for treatment with anti-fcrh5/anti-cd3 bispecific antibodies
WO2024013315A1 (en) 2022-07-15 2024-01-18 Boehringer Ingelheim International Gmbh Binding molecules for the treatment of cancer
WO2024020432A1 (en) 2022-07-19 2024-01-25 Genentech, Inc. Dosing for treatment with anti-fcrh5/anti-cd3 bispecific antibodies
WO2024020579A1 (en) 2022-07-22 2024-01-25 Bristol-Myers Squibb Company Antibodies binding to human pad4 and uses thereof
WO2024030956A2 (en) 2022-08-03 2024-02-08 Mozart Therapeutics, Inc. Cd39-specific binding agents and methods of using the same
WO2024049949A1 (en) 2022-09-01 2024-03-07 Genentech, Inc. Therapeutic and diagnostic methods for bladder cancer

Similar Documents

Publication Publication Date Title
WO1993008829A1 (en) Compositions that mediate killing of hiv-infected cells
EP0383799B2 (en) Adheson variants
US5565335A (en) Adhesion variants
Zettlmeissl et al. Expression and characterization of human CD4: immunoglobulin fusion proteins
AU668423B2 (en) Bispecific immunoadhesins
JP3808553B2 (en) CTLA4 mutant molecules and uses thereof
CN105017429B (en) Multimeric IL-15 soluble fusion molecules and methods of making and using the same
US5605689A (en) Treatment of HIV-associated immune thrombocytopenic purpura
CA2156421A1 (en) Synergistic composition of cd4-based protein and anti-hiv-1 antibody, and methods of using same
CA2080226C (en) Cd4-gamma2 and cd4-igg2 chimeras
US20030104535A1 (en) Adheson variants
AU765218B2 (en) A novel chimeric protein for prevention and treatment of HIV infection
EP0832971B1 (en) Adheson variants
IL91070A (en) Cytotoxic agent against specific virus infection
AU618969B2 (en) Adheson variants
CHAMOW et al. A humanized, bispecific immunoadhesin-antibody that retargets CD3+ effectors to kill HIV-1-infected cells
AU623924B2 (en) Cytotoxic agent against specific virus infection
US20030211470A1 (en) CD4-IgG2-based salvage therapy of HIV-1 infection

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): JP US

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LU MC NL SE

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
ENP Entry into the national phase

Ref country code: US

Ref document number: 1994 240676

Date of ref document: 19940504

Kind code of ref document: A

Format of ref document f/p: F

122 Ep: pct application non-entry in european phase