WO1994029351A2 - Antibodies - Google Patents
Antibodies Download PDFInfo
- Publication number
- WO1994029351A2 WO1994029351A2 PCT/GB1994/001290 GB9401290W WO9429351A2 WO 1994029351 A2 WO1994029351 A2 WO 1994029351A2 GB 9401290 W GB9401290 W GB 9401290W WO 9429351 A2 WO9429351 A2 WO 9429351A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- antibody
- altered
- human
- complement
- antibodies
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/2803—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
- C07K16/2833—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily against MHC-molecules, e.g. HLA-molecules
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
- C07K2317/73—Inducing cell death, e.g. apoptosis, necrosis or inhibition of cell proliferation
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
- C07K2317/73—Inducing cell death, e.g. apoptosis, necrosis or inhibition of cell proliferation
- C07K2317/732—Antibody-dependent cellular cytotoxicity [ADCC]
Definitions
- This invention relates to altered antibodies, to pharmaceutical, therapeutic and diagnostic compositions containing said antibodies; to processes for preparing said compositions; to methods of therapy and diagnosis using said antibodies, to a method of modulating the function of cell surface associated antigens using said antibodies; to DNA sequences coding for said antibodies; to cloning and expression vectors containing DNA sequences coding for said antibodies; to host cells transformed with said vectors and to processes for preparing said antibodies.
- Complement consists of a complex series of proteins.
- the proteins of the complement system form two interrelated enzyme cascades, termed the classical and alternative pathways, providing two routes to the cleavage of C3, the central event in the complement system.
- the sequence of events comprising the classical complement pathway is recognition, enzymatic activation, and membrane attack leading to cell death.
- the recognition unit of the complement system is the C1 complex.
- the C1 complement protein complex is a unique feature of the classical complement cascade leading to C3 conversion.
- Complement fixation occurs when the C1q subcomponent binds directly to immunoglobulin antigen immune complex. Whether or not complement fixation occurs depends on a number of constraints. For example, only certain subclasses of immunoglobulin can fix complement even under optimal conditions. These are lgG1, lgG3 and IgM in man and lgG2a, lgG2b and IgM in mice.
- the C1q molecule is potentially multivalent for attachment to the complement fixation sites of immunoglobulin.
- the C H 2 domain of IgG and probably the C H 4 domain of IgM contain binding sites for C1q.
- Fc bearing cells also play a role in enhancing the effect of the immune response by binding to and opsonising, phagocytosing or killing target cells coated with antibody of the relevant class.
- Three IgG binding receptors Fc ⁇ R have been described for murine and human leukocytes.
- Fc ⁇ RI has high binding affinity for monomeric IgG
- Fc ⁇ RII and Fc ⁇ RIII have low affinity for mono IgG and interact mainly with antigen complexed IgG.
- the presence of Fc receptors confers on these immune cells the ability to mediate a number of effector mechanisms important in the effector phase of the humoral response.
- the gamma 1 isotype of human IgG like lgG3, binds to FcRI and, when complexed with its cognate antigen, activates complement and binds to FcRII and FcRIII.
- human lgG2 and lgG4 are relatively inactive isotypes; both fail to activate the classical complement pathway and lgG4 binds weakly to FcRI [Burton, D R and Woof, J M (1992) Adv. Immunol. 51, 1. Lucisano Valim, Y M and Lachmann, P J. (1991) Clin. exp. Immunol, 84, 1].
- Complement fixation could be restored to human lgG4 with just the carboxyi terminal of C H 2 from residue 292 of lgG1 and not the N- terminal half or any other domain.
- Duncan & Winter (1988) [Nature, 332, 21] identified a motif in C H 2 of Glu 318, Lys 320 and Lys 322 of the mouse lgG2b isotype. Changing any of these residues abolished C1q binding, as did the use of competitive peptides of sequences in this region.
- the C1q motif residues are also found in antibodies that do not fix complement suggesting that these residues may well be necessary but not sufficient for complement activation.
- Residues Glu 318, Lys 320 and Lys 322 are conserved in all the human IgGs, rat lgG2b and lgG2c, mouse lgG2a, lgG2b and lgG3, guinea pig lgG1 and rabbit IgG. Further experiments showed that the affinity of human C1q for mutant mouse lgG2b antibodies in which residue 235 was mutated was unaffected i.e. it was in the same range of values as that obtained with the wild type.
- the invention provides a method of treating diseases in which antibody therapy leads to undesirable toxicity due to antibody mediated complement fixation comprising administering an altered antibody wherein one or more amino acid residues in the N-terminal region of the C H 2 domain of said antibody are altered characterised in that the ability of said antibody to fix complement is altered as compared to unaltered antibody.
- the altered antibody binds to one or more cellular Fc receptors especially FcRIII and excluding FcRI i.e. the antibody does not bind significantly to FcRI, and more preferably binding to FcRI is abolished.
- the invention provides an altered antibody wherein one or more amino acid residues in the N-terminal region of the C H 2 domain of said antibody are altered characterised in that the ability of said antibody to fix complement is altered, as compared to unaltered antibody.
- the invention therefore provides an altered antibody wherein one or more amino acid residues in the N-terminal region of the C H 2 domain of said antibody are altered characterised in that the ability of said antibody to fix complement is altered as compared to unaltered antibody and said altered antibody binds to one or more cellular Fc receptors especially FcRIII and does not bind significantly to FcRI.
- the constant region of the antibodies to be altered according to the invention may be of animal origin and is preferably of human origin. It may also be of any isotype but is preferably human IgG and most preferably human lgG1.
- amino acid residue(s) which is altered lies within amino acid positions 231 to 239, preferably within 234 to 239. In a particularly preferred embodiment of the invention the amino acid residue(s) which is altered lies within the motif Leu 234 Leu 235 Gly 236 Gly 237 Pro 238 Ser 239.
- amino acid residue(s) which is altered is either Leu 235 and/or Gly 237.
- the term 'altered' when used in conjunction with the ability of an antibody to fix complement most usually indicates a decrease in the ability of antibody to fix complement compared to the starting antibody.
- complement fixation denotes that human complement fixation is preferably ⁇ 30%, more preferably ⁇ 20% and most preferably ⁇ 10% of the level seen with the starting wild type unaltered antibody.
- the term 'significantly' as used with respect to FcRI binding denotes that the binding of antibody to FcRI is typically ⁇ 20%, and is most preferably ⁇ 10% of that seen with unaltered antibody.
- the altered antibodies of the invention preferably bind to FcRIII as measured by their ability to mediate antibody dependent cellular cytotoxicity (ADCC) at a concentration no greater than ten times that of the wild type unaltered antibody.
- ADCC antibody dependent cellular cytotoxicity
- the proteins encoded in the Major Histocompatibility Complex region of the genome are involved in many aspects of immunological recognition. It is known that all mammals and probably all vertebrates possess basically equivalent MHC systems and that immune response genes are linked to the MHC.
- the HLA gene cluster on chromosome 6 In man the major histocompatibility complex is the HLA gene cluster on chromosome 6. The main regions are D, B, C and A. The D region contains genes for class II proteins which are involved in cooperation and interaction between cells of the immune system. Many diseases have been found to be associated with the D region of the HLA gene cluster. Studies to date have shown associations with an enormous variety of diseases, including most autoimmune diseases (see for example, European Patent No. 68790). European Patent No. 68790 suggests controlling diseases associated with a particular allele of certain regions of the MHC such as the HLA-D region in humans by selectively suppressing the immune response(s) controlled by a monoclonal antibody specific for an MHC-class II antigen.
- the invention provides an MHC specific antibody wherein one or more amino acid residues in the N-terminal region of the C H 2 domain of said antibody are altered characterised in that the ability of said antibody to fix complement is altered as compared to unaltered antibody.
- the invention provides an MHC specific monoclonal antibody characterised in that said antibody has been altered at position 235 of the N-terminal region of the C H 2 domain.
- the alteration in the N-terminal region of the C H 2 domain of the antibody while altering the ability to fix complement additionally inhibits the binding to FcRI receptors.
- the antibodies are preferably specific for MHC-class II antigens and due to the alteration of one or more amino acid residues in the N-terminal region of the C H 2 domain will not bind significantly to FcRI.
- the altered antibodies of the invention or for use according to the invention are directed against an MHC class II antigen characterised in that said antibody has been altered at position 235 of the N-terminal region of the C H 2 domain.
- the altered antibodies of the invention or for use according to the invention are directed against an MHC class II antigen characterised in that said antibody has been altered at position 235 of the N-terminal region of the C H 2 domain and the ability of said antibody to fix complement is altered as compared to unaltered antibody and said altered antibody binds to one or more cellular Fc receptors especially FcRIII and does not bind significantly to FcRI.
- the invention provides a method for producing an altered antibody with altered ability to fix complement comprising altering one or more amino acids in the N-terminal region of the C H 2 domain of said antibody, altering the ability of said antibody to fix complement as compared with unaltered antibody.
- the term 'altered antibody' is used to denote an antibody which differs from the wild type unaltered antibody at one or more amino acid residues in the N-terminal region of the C H 2 domain of the Fc region of the antibody.
- the alteration may for example comprise the substitution or replacement of the starting wild type antibody amino acid by another amino acid, or the deletion of an amino acid residue.
- the naturally occurring amino acid at position 235 of the N-terminal region of the C H 2 domain is a leucine residue.
- the alterations at position 235 of replacing leucine by glutamic acid or alanine have been found particularly effective at producing a potent immuno-suppressive antibody with minimal toxicity in vitro and which is tolerated in vivo.
- the alteration at position 237 of replacing glycine by alanine has been found to produce an antibody with an intermediate ability to fix human complement, i.e. the complement fixation level is approximately 15-80%, preferably 20-60%, most preferably 20-40% of that seen with the starting wild type unaltered antibody.
- residue(s) could similarly be replaced using an analogous process to that described herein, by any other amino acid residue or amino acid derivative, having for example an inappropriate functionality on its side chain. This may be achieved by for example changing the charge and/or polarity of the side chain.
- the altered antibodies of the invention may also be produced for example, by deleting residues such as 235, or by, for example, inserting a glycosylation site at a suitable position in the molecule.
- Such techniques are well known in the art, see for example the teaching of published European patent application EP-307434.
- the altered antibodies of the invention may also be produced by exchanging lower hinge regions of antibodies of different isotypes.
- a G1/G2 lower hinge exchange abolished complement fixation and is a further preferred embodiment of the invention. This is described in more detail in the accompanying examples.
- the G1/G2 lower hinge exchange results in an antibody with altered residues in the 231 to 238 region of the N-terminal region of the C H 2 domain wherein one or more residues may be altered and/or deleted.
- the antibody is a human lgG1 antibody directed against an MHC class II antigen.
- the invention provides a method of modulating the function of cell surface associated antigens avoiding complement mediated toxicity comprising administering an altered antibody wherein one or more amino acid residues in the N-terminal region of the C H 2 domain of said antibody are altered characterised in that the ability of said antibody to fix complement is altered as compared to unaltered antibody.
- said altered antibody is able to bind to one or more cellular Fc receptors especially FcRIII while binding to FcRI is significantly reduced.
- cell surface antigens include for example adhesion molecules, T-cell receptor, CD4, CD8, CD3, CD28, CD69, MHC Class I, MHC Class II and CD25.
- the invention also includes therapeutic, pharmaceutical and diagnostic compositions comprising the altered antibodies according to the invention and the uses of these products and the compositions in therapy and diagnosis.
- the invention provides a therapeutic, pharmaceutical or diagnostic composition
- a therapeutic, pharmaceutical or diagnostic composition comprising an altered antibody according to the invention, in combination with a pharmaceutically acceptable excipient, diluent or carrier.
- the invention also provides a process for the preparation of a therapeutic, pharmaceutical or diagnostic composition comprising admixing an altered antibody according to the invention together with a pharmaceutically acceptable excipient, diluent or carrier.
- the antibodies and compositions may be for administration in any appropriate form and amount according to the therapy in which they are employed.
- the altered antibodies for use in the therapeutic, diagnostic, or pharmaceutical compositions, pr for use in the method of treatment of diseases in which antibody therapy leads to undesirable toxicity due to antibody mediated complement fixation are preferably MHC specific antibodies most preferably specific for MHC Class II antigens, and most preferably have specificity for antigen ic determinants dependent on the
- the therapeutic, pharmaceutical or diagnostic composition may take any suitable form for administration, and, preferably is in a form suitable for parenteral administration e.g. by injection or infusion, for example by bolus injection or continuous infusion.
- parenteral administration e.g. by injection or infusion, for example by bolus injection or continuous infusion.
- the product may take the form of a suspension, solution or emulsion in an oily or aqueous vehicle and it may contain formulatory agents such as suspending, preservative, stabilising and/or dispersing agents.
- the antibody or composition may be in dry form, for reconstitution before use with an appropriate sterile liquid.
- the formulation may contain, in addition to the active ingredient, additives such as: starch - e.g. potato, maize or wheat starch or cellulose - or starch derivatives such as microcrystalline cellulose; silica; various sugars such as lactose; magnesium carbonate and/or calcium phosphate. It is desirable that, if the formulation is for parental administration it will be well tolerated by the patient's digestive system. To this end, it may be desirable to include in the formulation mucus formers and resins. It may also be desirable to improve tolerance by formulating the antibody or compositions in a capsule which is insoluble in the gastric juices. It may also be preferable to include the antibody or composition in a controlled release formulation.
- additives such as: starch - e.g. potato, maize or wheat starch or cellulose - or starch derivatives such as microcrystalline cellulose; silica; various sugars such as lactose; magnesium carbonate and/or calcium phosphate.
- mucus formers and resins it may also
- the formulation may contain a binding and/or lubricating agent, for example polymeric glycols, gelatins, cocoa-butter or other vegetable waxes or fats.
- a binding and/or lubricating agent for example polymeric glycols, gelatins, cocoa-butter or other vegetable waxes or fats.
- the invention also provides methods of therapy and diagnosis comprising administering an effective amount of an altered antibody according to the invention to a human or animal subject.
- the antibodies and compositions may be for administration in any appropriate form and amount according to the therapy in which they are employed.
- the dose at which the antibody is administered depends on the nature of the condition to be treated and on whether the antibody is being. used prophylactically or to treat an existing condition.
- the dose will also be selected according to the age and conditions of the patient.
- a therapeutic dose of the antibodies according to the invention may be, for example, preferably between 0.1-25mg/kg body weight per single therapeutic dose and most preferably between 0.1-10mg/kg body weight per single therapeutic dose.
- immunological diseases which may be treated with the antibodies of the invention include for example joint disease such as ankylosing spondylitis, juvenile rheumatoid arthritis, rheumatoid arthritis; neurological disease such as multiple sclerosis; pancreatic disease such as diabetes, juvenile onset diabetes; gastrointestinal tract disease such as chronic active hepatitis, celiac disease, ulcerative colitis, Crohns disease, pernicious anaemia; skin diseases such as psoriasis; allergic diseases such as asthma and in transplantation related conditions such as graft versus host disease, and allograft rejection.
- Other diseases include those described in European Patent No. 68790.
- the altered antibodies of the invention may also be useful in the treatment of infectious diseases e.g. viral or bacterial infections and in cancer immunotherapy.
- the term 'antibody' is used to cover natural antibodies, chimeric antibodies and CDR-grafted or humanised antibodies.
- Chimeric antibodies are antibodies in which an antigen binding site comprising the complete variable domains of one antibody is linked to constant domains derived from another antibody. Methods for carrying out such chimerisation procedures are described in EP 120694 (Celltech Limited), EP 125023 (Genentech Inc and City of Hope), EP 171496 (Res. Dev. Corp. Japan), EP 173494 (Stanford University) and WO 86/01533 (Celltech Ltd).
- CDR grafted or humanised antibodies are antibody molecules having an antigen binding site derived from an immunoglobulin from a non-human species and remaining immunoglobulin-derived parts of the molecule being derived from a human immunoglobulin. Procedures for generating CDR-grafted or humanised antibodies are described in WO 91/09967 (Celltech Ltd), WO 90/07861 (Protein Design Labs. Inc) and WO 92/11383 (Celltech Ltd).
- the invention also includes DNA sequences coding for the altered antibodies according to the invention; cloning and expression vectors containing the DNA sequences, host cells transformed with the DNA sequences and processes for producing the altered antibodies according to the invention comprising expressing the DNA sequences in the transformed host cells.
- a process for producing an altered antibody of the invention comprises: a. producing in an expression vector an operon having a DNA sequence which encodes an antibody heavy or light chain.
- alteration in the N-terminal region of the C H 2 domain may be made using techniques such as site directed mutagenesis after the whole altered antibody has been expressed.
- site directed mutagenesis after the whole altered antibody has been expressed.
- DNA sequences should be expressed following the teaching described above for altered antibody.
- the DNA sequences preferably encode a humanised antibody; a CDR-grafted heavy and/or light chain or a chimeric antibody.
- the cell line may be transfected with two vectors, the first vector containing the operon encoding the light chain-derived polypeptide and the second vector containing the operon encoding the heavy chain derived polypeptide.
- the vectors are identical except in so far as the coding sequences and selectable markers are concerned so as to ensure as far as possible that each polypeptide chain is equally expressed.
- a single vector may be used, the vector including a selectable marker and the operons encoding both light chain- and heavy chain-derived polypeptides.
- the altered antibody according to the invention is preferably derived from the anti-MHC antibody L243, which has been deposited at the American
- Type Culture Collection Rockville, Maryland USA under Accession number ATCC HB55, and is most preferably a chimeric or a CDR-grafted derivative thereof.
- L243 was previously described by Lampson and Levy [J. Immunol. (1980) 125, 293].
- DNA sequences coding for the altered antibodies according to the invention may be synthed completely or in part using oligonucleotide synthesis techniques. Site-directed mutagenesis and polymerase chain reaction (PCR) techniques may be used as appropriate. See for example "PCR Technology Principles and Applications for DNA Amplification” (1989), Ed. H. A. Eriich, Stockton Press, N.Y. London.
- PCR polymerase chain reaction
- oligonucleotide directed synthesis as described by Jones et al [Nature, 321 , 522 (1986)] may be used.
- oligonucleotide directed mutagenesis may be used as described by Kramer et al [Nucleic Acid Res. 12 9441 (1984)].
- Any suitable host cell/vector system may be used for the expression of the DNA sequences coding for the altered antibody.
- Bacterial e.g. E.coli and other microbial systems may be used.
- Eucaryotic e.g. mammalian host cell expression systems may also be used such as for example COS cells and CHO cells [Bebbington, C R (1991) Methods 2, 136-145], and myeloma or hybridoma cell lines [Bebbington, C R et al (1992) Bio/Technology 10, 169-175].
- altered antibody is derived from L243 CHO based expression systems are preferably used.
- Immune function/immunosuppression by antibodies may be assayed using techniques well known in the art including for example: Mixed Lymphocyte Responses and T-cell antigen recall responses to Tetanus Toxoid. These assays are described in detail in the following examples. The invention is illustrated in the following non-limiting examples and with reference to the following figures in which:
- Figure 1 shows: a map of plasmid pMR15.1
- Figure 2 shows: a map of plasmid pMR14
- Figure 3 shows: the nucieotide sequence and predicted amino acid sequence of L243 heavy chain
- Figure 4 shows: the nucieotide and amino acid sequences of
- Figure 5 shows: the nucieotide sequence and predicted amino acid sequence of L243 light chain
- Figure 6 shows: a map of plasmid pGamma 1
- Figure 7 shows: a map of plasmid pGamma 2
- Figure 8 shows: the nucieotide sequence of hinge and C H 2 region of human C-gamma 1
- FIG. 9 shows: Antigen binding potency of L243 human isotype series
- FIG. 10 shows: FcRI binding of L243 isotype series
- Figure 11 shows: human complement fixation by L243 isotype series e
- Figure 12 shows: binding of human Clq to L243 human isotype series
- Figure 13 shows: human complement fixation by L243 isotype
- Figure 14 shows: guinea pig complement fixation by L243 isotype
- Figure 15 shows: rabbit complement fixation by L243 isotype
- FIG. 16 shows: FcRIII binding of L243 isotype series by ADCC
- Figure 17 shows: L243 Isotype Series Inhibition of TT recall response
- Figure 18 shows: L243 Isotype Series Inhibition of TT recall response
- FIG. 19 shows: L243 Isotype Series Inhibition of Mixed Lymphocyte
- Figure 20 shows: L243 Isotype Series Inhibition of TT response
- FIG. 21 shows: L243 Isotype Series Inhibition of Mixed Lymphocyte
- Figure 22 shows: the nucieotide and amino acid sequence of VI region in
- Figure 23 shows: shows the nucieotide and amino acid sequence of VI region of
- Figure 24 shows: the nucieotide and amino acid sequence of Vh region of L243-gH
- Figure 25 shows: a graph of the results of a competition assay for L243 grafts vs FITC-chimeric L243
- Figure 26 shows: a graph of a Scatchard analysis for L243 gamma 4
- Figure 27 shows: a graph of FcRIII binding of chimeric, grafted
- Figure 28 shows: a graph of immunosuppressive activity of CDR grafted
- Figure 29 shows: a graph of CDR grafted L243 and grafted [L235E]
- Figure 30 shows: a graph of complement mediated cytotoxic potency of
- RNA was prepared from 3 ⁇ 10exp7 L243 hybridoma cells as described below. Cells were washed in physiological saline and dissolved in RNAzol (0.2ml per 10exp6 cells). Chloroform (0.2ml per 2ml homogenate) was added, the mixture shaken vigorously for 15 seconds and then left on ice for 15 minutes. The resulting aqueous and organic phases were separated by centrifugation for 15 minutes in an Eppendorf centrifuge and RNA precipitated from the aqueous phase by the addition of an equal volume of isopropanol. After 15 minutes on ice, the RNA was pelleted by centrifugation, washed with 70% ethanol, dried and dissolved in sterile, RNAase free water. The yield of RNA was 350 ⁇ g.
- the sequence of the first nine amino acids of the mature L243 light chain was determined to be NH2-DIQMTQSPAS.
- cDNA genes for the variable regions of L243 heavy and light chains were synthesised using reverse transcriptase to produce single stranded cDNA copies of the mRNA present in the total RNA, followed by Polymerase Chain Reaction (PCR) on the cDNAs with specific oligonucleotide primers.
- PCR Polymerase Chain Reaction
- cDNA was synthesised in a 20 ⁇ l reaction containing the following reagents: 50mM Tris-HCI PH8.3, 75mM KCI, 10mM dithiothreitol, 3mM MgC.2, 0.5mM each deoxyribonucleoside triphosphates, 20 units RNAsin, 75ng random hexanucleotide primer, 2 ⁇ g L243 RNA and 200 units Moloney Murine Leukemia Virus reverse transcriptase. After incubation at 42°C for 60 min the reaction was terminated by heating at 95°C for 5 minutes. b) PCR
- the 3' primers are shown in Table 3.
- the light chain primer spans the V - C junction of the antibody and contains a restriction site for the enzyme Spl1 to facilitate cloning of the VI PCR fragment.
- the heavy chain 3' primers are a mixture designed to span the J - C junction of the antibody.
- the first 23 nucleotides are identical to those found at the start of human C - gamma 1 , 2, 3 and 4 genes and include the Apa1 restriction site common to these human isotypes.
- the 3' region of the primers contain a mixed sequence based on those found in known mouse antibodies [Kabat E A, Wu, T.T.; Perry H M, Gottesman K S, and Foeller L; In: Sequences of
- Incubations (20 ⁇ l) for the PCR were set up as follows. Each reaction contained 10 mM Tris-HCI pH 8.3, 1.5 mM MgCt ⁇ , 50 mM KCI, 0.01% w/v gelatin, 0.25 mM each deoxyribonucleoside triphosphate, 1 - 6 pmoles 5' primer mix (Table 4), 6 pmoles 3' primer, 1 ⁇ l cDNA and 0.25 units Taq polymerase. Reactions were incubated at 95°C for 5 minutes and then cycled through 94°C for 1 minute, 55°C for 1 minute and 72°C for 1 minute. After 30 cycles, aliquots of each reaction were analysed by electrophoresis on an agarose gel.
- DNA fragments produced in reactions B2, B3 and B5 were digested with the enzymes BstB1 and Spl1, concentrated by ethanol precipitation, electrophoresed on a 1.4 % agarose gel and DNA bands in the range of 400 base pairs recovered. These were cloned by ligation into the vector pMR15.1 ( Figure 1) that had been restricted with BstB1 and Spl1 . After ligation, mixtures were transformed into E. coli LM1035 and plasmids from the resulting bacterial colonies screened for inserts by digestion with BstB1 and Spl1. Representatives with inserts from each ligation were analysed further by nucieotide sequencing.
- Plasmid DNA (pE1701 and pE1702) from two isolates containing Vh inserts from reaction B9 was sequenced using the primers R1053 (which primes in the 3' region of the HCMV promoter in pMR14) and R720 (which primes in the 5' region of human C - gamma 4 and allows sequencing through the DNA insert on pMR14).
- the determined nucieotide sequence and predicted amino acid sequence of L243 Vh in pE1702 is given in Figure 3.
- the nucieotide sequence for the Vh insert in pE1701 was found to be identical to that in pE1702 except at nucieotide 20 (A in pE1701) and nucieotide 426 (A in pE1701). These two differences are in the signal peptide and J regions of Vh respectively and indicate that the two clones examined are independent isolates arising from the use of different primers from the mixture of oligonucleotides during the PCR stage.
- clones 182 and 183 contain a VI gene that codes for a signal peptide of 20 amino acids, while the VI gene in clones 43 and 45 results from priming with a different set of oligonucleotides and has a leader sequence of only 15 amino acids.
- Clone 192 does not code for L243 VI. Instead, examination of the database of antibody sequences [Kabat, 1991] indicates that clone 192 contains the VI gene for MOPC21, a light chain synthesised by the NS1 myeloma fusion partner used in the production of the L243 hybridoma.
- Clones 182 and 183 are identical except at nucleotide 26 (T in clone 182, C in clone 183). This difference can be accounted for by the use of different primers in the PCR and indicates that clones 182 and 183 are independent isolates of the same gene.
- the L243 Vh gene was subcloned on a HindIII - Apal fragment into pGamma 1 and pGamma 2, vectors containing the human C - gamma 1 and C - gamma 2 genes respectively ( Figures 6 and 7).
- Human Isotype mutants were subcloned on a HindIII - Apal fragment into pGamma 1 and pGamma 2, vectors containing the human C - gamma 1 and C - gamma 2 genes respectively ( Figures 6 and 7).
- PCR mutagenesis was used to change residue 235 in human C - gammal contained in the vector pGamma 1 from leucine to either glutamic acid or to alanine and to change residue 237 from glycine to alanine.
- the lower hinge region of human C-gamma 1 was also replaced by the corresponding region of human C-gamma 2.
- the following oligonucleotides were used to effect these changes: i) L235E change
- oligonucleotides used in the PCR mutagenesis are:
- R4732 and R4912 prime between nucleotides 834 and 858 and between nucleotides 1156 and 1137 respectively in human C - gamma 1 ( Figure 8).
- reactions (20 ⁇ l) were prepared containing the following reagents : 10 mM Tris - HCl pH 8.3, 1.5 mM MgCI2, 50 mM KCl, 0.01% gelatin, 0.25 mM each deoxyribonucleoside triphosphate, 50 ng pGamma 1 DNA, 0.4 unit Taq polymerase and 6 pmoles of each of the primer.
- the following combinations of primers were used:
- Second round PCR was in a 100 ⁇ l reaction containing 10 mM Tris - HCl pH 8.3, 1.5 mM MgCI2, 50 mM KCI, 0.01 % gelatin, 0.25 mM each deoxyribonucleoside triphosphate, 2 units Taq polymerase, 1/20 of each pair of DNA fragments from the first round reaction and 30 pmoles of each of R4732 and R4912.
- the reactions were extracted with phenol / chloroform (1/1) and precipitated with ethanol. Fragments were digested with Bgl11 and Sty1 , electrophoresed on a 1.4 % agarose gel and DNA bands of 250 base-pairs recovered from gel slices as previously described.
- Bgl II - Sty1 fragments were ligated in a 3 - way ligation to the 830 base-pair Sty1 - EcoRI fragment, containing the C - terminal part of the C H 2 domain and the entire CH3 domain of human C - gamma 1, and the BgIII - EcoR1 vector fragment from pGammal (see Figure 6).
- plasmid minipreps from resulting colonies were screened for the presence of the Bgl II - Sty1 fragment and representatives of each taken for nucieotide sequence analysis. From this, plasmids containing the desired sequence were identified and, for future reference, named as follows : pGammal [L235E] containing glutamic acid at residue 235,
- Antibody for biological evaluation was produced by transient expression of the appropriate heavy and light chain pairs after co-transfection into Chinese Hamster Ovary (CHO) cells using calcium phosphate precipitation.
- the calcium phosphate precipitate was prepared by mixing 1.25 ml of 0.25M CaCI2 containing 50 ⁇ g of each of heavy and light chain expression vectors with 1.25 ml of 2 ⁇ HBS (16.36 gm NaCI, 11.9 gm HEPES and 0.4 gm Na2HPO4 in 1 litre water with the pH adjusted to 7.1 with NaOH) and adding immediately into the medium on the cells.
- the samples were titrated in the microtitre wells in 2-fold dilutions to give a final volume of 0.1 ml in each well and the plates incubated at room temperature for 1 hr with shaking. After the first incubation step the plates were washed 10 times with distilled water and then incubated for 1 hr as before with 0.1 ml of a mouse monoclonal anti-human kappa (clone GD12) peroxidase conjugated antibody (The Binding Site, code MP135) at a dilution of 1 in 700 in conjugate buffer. The plate was washed again and substrate solution (0.1 ml) added to each well.
- clone GD12 mouse monoclonal anti-human kappa peroxidase conjugated antibody
- Substrate solution contained 150 ⁇ l N,N,N,N-tetramethylbe ⁇ zidine (10 mg/ml in DMSO), 150 ⁇ l hydrogen peroxide (30% solution) in 10 ml 0.1 M sodium acetate/sodium citrate, pH6.0. The plate was developed for 5 -10 minutes until the absorbance at 630nm was approximately 1.0 for the top standard. Absorbance at 630nm was measured using a plate reader and the concentration of the sample determined by comparing the titration curves with those of the standard. TABLE 1
- CH1 5'ATGAAATGCAGCTGGGTCAT(G,C)TTCTT3'
- CH2 5'ATGGGATGGAGCT(A,G)TATCAT(C,G)(C, T)TCTT3'
- CH6 5'ATGGCTGTC(C,T)T(G,A)G(G,C)GCT(G,A)CTCTTCTG3' CH7 : 5'ATGG(G,A)ATGGAGC(G,T) GG(G,A)TCTTT(A,C)TCTT3 ,
- CL1 5 ⁇ TGAAGTTGCCTGTTAGGCTGTTGGTGCT3'
- CL2 5'ATGGAG(T,A)CAGACACACTCCTG(T,C)TATGGGT3'
- CL9 5 , ATGGT(G,A)TCC(T,A)CA(G,C)CTCAGTTCCTT3
- CL10 5'ATGTATATATGTTTGTTGTCTATTTC3'
- CL11 5'ATGGAAGCCCCAGCTCAGCTTCTCTT3'
- Murine L243 (lgG2a) was labelled with fluorescein (FITC) using standard, techniques. All dilutions, manipulations and incubations were done in
- the ability of the engineered variants of L243 to bind to FcgRI was measured.
- the principle of this experiment is that antibodies will bind to cells through Fc receptors and the affinity of this interaction is determined by the subclass and hence the structure of the Fc of the antibody.
- the assay is based on the ability of the engineered antibodies to compete for binding with FITC labelled murine lgG2a to I FN ⁇ stimulated U937 cells.
- U937 myelomonocytic cells, when incubated with 500 ⁇ /ml IFN ⁇ (Genzyme UK) for 24 hours, expresses high levels of FcgRI, as assessed by CD64 binding and monomeric lgG2a binding, low levels of Fc ⁇ RII and no Fc ⁇ RIII.
- U937 cells are washed extensively in DMEM containing 25mM HEPES (Gibco UK), incubated for 2 hours at 37°C in RPMI 1640 (Gibco UK) and then washed again in DMEM containing 25mM HEPES (Gibco UK) to remove bovine IgG bound to Fc receptors.
- Serial dilutions of engineered antibodies were prepared in 50 ⁇ l in Phosphate Buffered Saline (Gibco UK) containing 0.1% sodium azide in V-bottom 96 well microtitre plates' (ICN/Flow UK) and were incubated with 5x10 4 U937 cells in 50 ⁇ l for 30min at 4°C. 50 ⁇ l of FITC labelled lgG2a antibody was then added to all wells, at a previously determined optimal concentration, for a further 90min at
- the principle of the experiment is that antibodies will mediate complement lysis of target cells bearing their cognate antigen if the Fc of the antibody is able to interact with the components of the (usually classical) complement cascade.
- the critical interaction is with the C1q molecule.
- the source of complement in these experiments is human venous blood freshly drawn into endotoxin free glass bottles which is then allowed to clot at 37°C for 1 hour. The clot is detached from the glass and then incubated at 4°C for 2 hours to allow it to retract. The clot is then removed and the serum separated from the remaining red cells by centrifugation at 1000g. Once prepared, the serum can be stored for up to one month at -20°C without noticeable deterioration of potency but is best used fresh.
- Target cells JY B lymphoblastoid cell line bearing high levels of HLA-DR
- Serial antibody dilutions are prepared in duplicate in V-bottom 96 well microtitre plates (ICN/Flow UK) in 25 ⁇ l.
- Control wells containing medium only are also prepared to establish the spontaneous release of label giving the assay background.
- Target 51 Cr labelled JY cells are added to all wells in 10 ⁇ l.
- the same number of JY cells are also added to wells containing 2% Triton ⁇ 100 in water to establish the 100% release value.
- Target cells and antibody are incubated together and, after 1 hour at room temperature, 25 ⁇ l serum as a source of complement is added to all wells (except the 100%) for a further 1 hour at room temperature.
- 100 ⁇ l of EDTA saline at 4°C is then added to stop any further cell killing, the microtitre plates are centrifuged at 200g to pellet the intact cells and 100 ⁇ l supernatant is removed and counted in a gamma counter.
- Percent cell lysis is calculated by subtracting the background from all values and then expressing them as a percentage of the adjusted maximum release. Replicates vary by less than 5%. Percent cell lysis is then plotted against antibody dilution.
- 5 ⁇ 10 4 indicator cells JY B lymphoblastoid cell line bearing high levels of HLA-DR were coated with the different engineered antibodies by incubating at saturating concentrations for 1 hour at 4°C in RB polystyrene tubes (2052 12x75mm Falcon UK). After washing, serial dilutions of FITC labelled C1q in 100 ⁇ l were added and were incubated together for a further 30 min at 4°C. After washing, binding of C1q was revealed using a Fluorescence Activated Cell Scanner (FACS Becton Dickinson). After appropriate analysis, median fluorescence intensity is plotted against C1q concentration.
- FACS Becton Dickinson Fluorescence Activated Cell Scanner
- the G1[L235E] and G1[L235A] modifications behaved differently when rabbit or guinea pig serum was used as a source of complement instead of human.
- rabbit C they caused the same level of lysis as the wild type G1.
- guinea pig they caused 40% and 49% plateau level killing, respectively, compared with 80% killing by the lgG1 wild type.
- the 235 change only affects human complement binding indicating that rabbit and guinea pig complement interact differently with human lgG1 (see Figures 13-15).
- ADCC antibody dependent cell mediated cytotoxicity
- PBMC Peripheral blood mononuclear cells
- the cells are then washed three times, to remove free radiolabel, and resuspended at 2 ⁇ 10 6 /ml.
- Serial antibody dilutions are prepared in duplicate in sterile U-bottom 96 well microtitre plates (Falcon UK) in 25 ⁇ l. Control wells containing medium only are also prepared to establish the spontaneous release of label giving the assay background.
- Target 51 Cr labelled JY cells are added to all wells in 10 ⁇ l. The same number of JY cells are also added to wells containing 2% Triton x100 in water to establish the 100% release value.
- Target cells and antibody are incubated together and, after 30min at room temperature, 25 ⁇ l effector cells are added to all wells (except the 100%) for a further 4 hours at 37°C.
- microtitre plates 100 ⁇ l of EDTA saline at 4°C is then added to stop any further cell killing, the microtitre plates are centrifuged at 200g to pellet the intact cells and 100 ⁇ l supernatant is removed and counted in a gamma counter.
- Percent cell lysis is calculated by subtracting the background from all values and then expressing them as a percentage of the adjusted maximum release. Replicates vary by less than 5%. Percent cell lysis is then plotted against antibody dilution. Results
- L243 lgG2 was unable to mediate peripheral blood mononuclear cell cytotoxicity (ADCC) of HLA-DR positive JY lymphoblastoid cells at concentrations up to 100 ⁇ /ml.
- lgG4 caused a low level of ADCC (20% maximum killing at 1 ⁇ /ml) which could be abrogated by the Leu 235 to Glu change.
- Wild type lgG1 was a potent mediator of cell killing giving 50% cell death at 5ng/ml antibody.
- Gly to Ala at 237 reduced the igG1 wild type killing to the level seen with lgG4.
- Exchanging the whole lower hinge region with the sequence found in human lgG2 gave intermediate levels of killing with 500ng/ml needed for 50% cell death.
- changes at 235 in lgG1 had minimal effect on ADCC.
- Changing the Leu 235 to Ala gave levels of killing comparable with the G1 wild type (9ng/ml for 50% cell death)) and changing the Leu 235 to Glu reduced ADCC a little (40ng/ml for 50% cell death).
- a change in the previously described C1q binding motif, from Lys to Ala at 320 had no effect on the ability of lgG1 to mediate ADCC.
- the immunosuppressive potency of engineered variants of L243 was assessed using a mixed lymphocyte reaction.
- the principle of the experiment is that when leucocytes from one individual are mixed with those of another which express different HLA alleles, they will recognise each other as foreign and will become activated. This activation is dependent, primarily, on interactions between the CD3/TcR complex on T cells and the MHC-II molecule on antigen presenting cells. Antibodies that bind to MHC-II are known to inhibit this reaction.
- PBMC Peripheral blood mononuclear cells
- Serial antibody dilutions are prepared in triplicate in sterile U-bottom 96 well microtitre plates (Falcon UK) in 100 ⁇ l. Control wells containing medium only and optimal Cyclosporin (Sandimmun®, Sandoz) levels (100nM) are also prepared to establish the maximum response and maximum inhibition, respectively. Equal numbers of irradiated stimulators and responders are mixed together and 100 ⁇ l are added to each well. Wells of stimulator alone and responders alone are also set up as controls. The experiment is incubated at 37°C in 100% humidity and 5%CO 2 for 5 days. Response is measured by assessing proliferation during the last 18 hours of culture by incubation with 1 ⁇ Ci/well 3 H-Thymidine (Amersham UK), harvesting on to glass filter mattes and counting using a beta counter.
- T lymphocytes from an individual previously immunised with Tetanus Toxoid will respond to TT when re-exposed ex vivo. This activation is dependent on the interaction between the CD3/TcR complex on T ceils and the MHC-II molecule on cells which process and present the antigen. Antibodies that bind to MHC-II are known to inhibit this reaction. Lymphocytes are prepared fresh for each experiment. Human venous blood is drawn into endotoxin free tubes containing heparin. Peripheral blood mononuclear cells (PBMC) are prepared by density gradient centrifugation according to the manufacturers instructions (Pharmacia).
- PBMC Peripheral blood mononuclear cells
- PBMC peripheral blood mononuclear cells
- PBMC peripheral blood mononuclear cells
- RPMI 1640 medium Gibco UK
- 2mM Glutamine Gibco UK
- 100 ⁇ /ml/100 ⁇ g/ml Penicillin/ Streptomycin Gibco
- 10% foetal calf serum Sigma UK
- Serial antibody dilutions are prepared in triplicate in sterile U-bottom 96' well microtitre plates (Falcon UK) in 100 ⁇ l. 50 ⁇ l containing an optimal concentration of TT, previously determined by experimentation, is added to all wells. Control wells containing medium only or Cyclosporin
- Results are plotted as CPM against antibody concentration. Replicates vary by less than 10%.
- G1/G2 L hinge exchange mutant was intermediate in immuno-suppresser potency, there was no correlation between complement fixation or FcRI binding and immuno-suppression, G1 binding well to FcRI and fixing complement and G1[L235E] doing neither, but both giving good immunosuppression. But, there was good correlation with FcRIII binding. Human G1 and G1[L235E] interact with FcRIII and give good immunosuppression. The G1/G2 L hinge is intermediate in FcRIII binding and immuno-suppression. In contrast, the G237A mutation in human G1, in agreement with published observations, reduces FcRIII binding. This antibody gave poor immunosuppression. (Table 5). Table 6 shows a number of L243 isotype mutants.
- G1/G2Lh 10 500 >20/0
- L243 is a mouse monoclonal antibody raised against human MHC Class II.
- the nucieotide and amino acid sequences of L243 VI and Vh are shown in Figures 5 and 3 respectively.
- the following examples describe the humanisation of the L243 antibody (CDR grafting).
- L243-gL1 The construction of L243-gL1 is given below in detail.
- the following oligonucleotides were used in the Polymerase Chain Reactions (PCR) to introduce changes into the framework regions of the chimeric light chain: R5043 : 5 'GTAGGAGACCGGGTCACCATCACATGTCGAGCAAA3 '
- R5CH4 5 'CTGAGGAGCTTTTCCTGGTTTCTGCTGATACCATGCTAAA3 '
- R5045 5 'AAACCAGGAAAAGCTCCTCAGCTCCTGATCTTTGCTGCATC3 '
- R5046 5 'CTTCTGGCTGCAGGCTGGAGATAGTTAGGGTATACTGTGTGCC3 '
- R5047 5 'CTTCAGCCTGCAGCCAGAAGATTTTGCTACTTATTACTGTCAA3 '
- R5048 5 'GGGCCGCTACCGTACGTTTTAGTTCCACTTTGGTGCCTTGACCGAA3 '
- the reaction 100 ⁇ l, contained 10 mM Tris-HCI pH 8.3, 1.5 mM MgCI2, 50 mM KCI, 0.01% w/v gelatin, 1/10 of each of the three PCR fragments from the first set of reactions, 30 pmoles of R5043 and R5048 and 2.5 units Taq polymerase. Reaction temperatures were as above.
- the mixture was extracted with phenol / chloroform and then with chloroform and precipitated with ethanol. The ethanol precipitate was recovered by centrifugation, dissolved in the appropriate buffer and restricted with the enzymes BstEII and Spll.
- the resulting product was finally electrophoresed on an agarose gel and the 270 base pair DNA fragment recovered from a gel slice and ligated into the vector pMR15.1 ( Figure 1) that had previously been digested with the same enzymes.
- the ligation mixture was used to transform E. coli LM1035 and resulting colonies analysed by PCR, restriction enzyme digests and nucieotide sequencing.
- the nucieotide and amino acid sequence of the VI region of L243-gL1 is shown in Figure 22.
- L243-gL2 was constructed from L243-gL1 using PCR.
- the following oligonucleotides were used to introduce the amino acid changes : R1053 : 5 'GCTGACAGACTAACAGACTGTTCC3 '
- the reaction 100 ⁇ l, contained 10 mM Tris-HCI pH 8.3, 1.5 mM MgCI2, 50 mM KCI, 0.01% w/v gelatin, 1/5 of each of the PCR fragments from the first set of reactions, 30 pmoles of R1053 and R684 and 2.5 units Taq polymerase. Reaction temperatures were as above.
- the mixture was extracted with phenol / chloroform and then with chloroform and precipitated with ethanol.
- the ethanol precipitate was recovered by centrifugation, dissolved in the appropriate buffer and restricted with the enzymes BstEII and Spll.
- the resulting product was finally electrophoresed on an agarose gel and the 270 base pair DNA fragment recovered from a gel slice and ligated into the vector pMR15.1 ( Figure 1) that had previously been digested with the same enzymes.
- the ligation mixture was used to transform E. coli LM1035 and resulting colonies analysed by PCR, restriction enzyme digests and nucieotide sequencing.
- the nucleotide and amino acid sequence of the VI region of L243-gL2 is shown in Figure 23.
- L243 heavy chain was found to be most homologous to human heavy chains belonging to subgroup 1 and therefore the consensus sequence of the human subgroup 1 frameworks was chosen to accept the L243 heavy chain CDRs.
- L243 differs from the human consensus at 28 positions (underlined). After analysis of the contribution that any of these might make to antigen binding, only residues 27,67,69,71,72 and 75 were retained in the CDR grafted heavy chain, L243-gH.
- L243gH was assembled by subjecting overlapping oligonucleotides to PCR in the presence of the appropriate primers.
- the following oligonucleotides. were used in the PCR: R3004 : 5 'GGGGGGAAGCTTGCCGCCACCATGG3 ' R3005 : 5 'CCCCCCGGGCCCTTTGTAGAAGCAG3 ' R4902 : 5 'GACAACAGGAGTGCACTCTCAGGTGCAGCTGGTGCAGTCTGGAGC
- CAGGGACTCGAGTGGA3 ' R4904 5 ' CCTACGTACGCAGACGACTTCAAGGGAAGATTCACATTCACACTG
- TCCCATCCACTCGAGTCCCTGTCCAG3 ' R4900 5 'TTGCACAGTAGTACACTGCTGTGTCCTCAGATCTCAGAGAAGACA GCTCCATGTATGCTGTAGATGCAGAT3 ' R4901 : 5 'CCCCCCGGGCCCTTTGTAGAAGCAGAAGACACTGTCACCAGTGTT
- the assembly reaction 50 ⁇ l, contained 10 mM Tris-HCI pH 8.3, 1.5 mM MgCI2, 50 mM KCI, 0.01% w/v gelatin, 0.25 mM each deoxyribonucleoside triphosphate, 1 pmole of each Of R4897 - R4905, 10 pmoles of each of R3004 and R3005 and 2.5 units Taq polymerase. Reactions were cycled through 94 C for 1 minute, 55 C for 1 minute and 72 C for 1 minute. After 30 cycles, the reaction was extracted with phenol/chloroform (1/1), then with chloroform and precipitated with ethanol. After centrifugation, the DNA was dissolved in the appropriate restriction buffer and digested with HindIII and ApaI.
- pMR14 contains the human gamma 4 heavy chain constant region and so the heavy chain expressed from this vector will be a gamma 4 isotype.
- the ligation mixture was used to transform E. coli LM1035 and resulting bacterial colonies screened by restriction digest and nucieotide sequence analysis. In this way, a plasmid containing the correct sequence for L243gH was identified ( Figure 24). Construction of Gamma 1 versions of chimeric and CDR grafted L243 heavy chain
- Human Gamma 1 versions of L243 heavy chains were constructed by transferring the variable regions of both the murine and the CDR grafted heavy chains as HindIII to Apal fragments into the vector pGammal ( Figure 6). This vector contains the human Gamma 1 heavy chain constant region.
- Chimeric and CDR grafted L243 was produced for biological evaluation by transient expression of heavy and light chain pairs after co-transfection into Chinese Hamster Ovary (CHO) cells using calcium phosphate precipitation as described above for production of chimeric L243.
- Antibody concentration was determined using a human Ig ELISA (see below). b) ELISA
- the samples were titrated in the microtitre wells in 2-fold dilutions to give a final volume of 0.1 ml in each well and the plates incubated at room temperature for 1 hr with shaking. After the first incubation step the plates were washed 10 times with distilled water and then incubated for 1 hr as before with 0.1 ml of a mouse monoclonal anti-human kappa (clone GD12) peroxidase conjugated antibody (The Binding Site, code MP135) at a dilution of 1 in 700 in conjugate buffer. The plate was washed again and substrate solution (0.1 ml) added to each well.
- clone GD12 mouse monoclonal anti-human kappa peroxidase conjugated antibody
- Substrate solution contained 150 ⁇ l N,N,N,N-tetramethylbenzidine (10 mg/ml in DMSO), 150 ⁇ l hydrogen peroxide (30% solution) in 10 ml 0.1 M sodium acetate/sodium citrate, pH6.0. The plate was developed for 5 -10 minutes until the absorbance at 630nm was approximately 1.0 for the top standard. Absorbance at 630nm was measured using a plate reader and the concentration of the sample determined by comparing the titration curves with those of the standard. c) Competition Assay
- the principle of this assay is that if the antigen binding region has been correctly transferred from the murine to human frameworks, then the CDR grafted antibody will compete equally well with a labelled chimeric antibody for binding to human MHC Class II. Any changes in the antigen binding potency will be revealed in this system.
- Chimeric L243 was labelled with fluorescein (FITC) using the method of Wood et al [Wood.T., Thompson, S and Goldstein, G 1965, J. Immunol 95, 225-229 and used in the competition assay described above.
- FITC fluorescein
- Figure 25 compares the ability of combinations of L243 heavy and light chains to compete with FITC-labelled chimeric L243 for binding to JY cells. All combinations were effective competitors although none of those containing CDR grafted heavy or light chains were as effective as the chimeric antibody itself. Thus, the combinations cH/gL1 , gH/cL and gH/gL1 were 89%, 78% and 64% respectively, as effective as chimeric L243 in this assay. d) Determination of Affinity constants by Scatchard Analysis
- L243 antibodies were titrated from 10 ⁇ g/ml in PBS, 5% fetal calf serum, 0.1% sodium azide in 1.5-fold dilutions (150 ⁇ l each) before incubation with 5 ⁇ 10 4 JY cells per titration point for 1 hour on ice. The cells were previously counted, washed and resuspended in the same medium as the samples. After incubation, the cells were washed with 5ml of the above medium, spun down and the supernatant discarded. Bound antibody was revealed by addition of 100 ⁇ l of a 1/100 dilution of FITC conjugated antihuman Fc monoclonal (The Binding Site; code MF001).
- the cells were then incubated for 1 hour on ice and then the excess FITC conjugate removed by washing as before.
- Cells were dispersed in 250 ⁇ l of the same buffer and the median fluorescence intensity per cell was determined in a FACScan (Becton Dickinson) and calibrated using standard beads (Flow Cytometry standards Corporation). The number of molecules of antibody bound per cell at each antibody concentration was thus established and used to generate Scatchard plots. For the purpose of calculation, it was assumed that the valency of binding of the FITC conjugate to L243 was 1:1 and that the F/P ratio was 3.36 (as given by the manufacturer).
- the principle of the experiment is that when leucocytes from one individual are mixed with those of another individual which express different HLA alleles, they will recognise each other as foreign and the lymphocytes will become activated. This activation is dependent primarily on interactions between the CD3/TcR complex on T cells and the MHC Class II molecule on antigen presenting cells. L243 is known to inhibit this reaction.
Abstract
Description
Claims
Priority Applications (3)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
JP7501518A JPH08511420A (en) | 1993-06-16 | 1994-06-15 | Body |
EP94917750A EP0714409A1 (en) | 1993-06-16 | 1994-06-15 | Antibodies |
AU69341/94A AU691811B2 (en) | 1993-06-16 | 1994-06-15 | Antibodies |
Applications Claiming Priority (8)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
GB9312415.4 | 1993-06-16 | ||
GB939312415A GB9312415D0 (en) | 1993-06-16 | 1993-06-16 | Altered antibodies |
GB9401597.1 | 1994-01-27 | ||
GB9401597A GB9401597D0 (en) | 1994-01-27 | 1994-01-27 | Altered antibodies |
GB9402499A GB9402499D0 (en) | 1994-02-09 | 1994-02-09 | Altered abtibodies |
GB9402499.9 | 1994-02-09 | ||
GB9406244A GB9406244D0 (en) | 1994-03-29 | 1994-03-29 | Altered antibodies |
GB9406244.5 | 1994-03-29 |
Publications (2)
Publication Number | Publication Date |
---|---|
WO1994029351A3 WO1994029351A3 (en) | 1994-12-22 |
WO1994029351A2 true WO1994029351A2 (en) | 1994-12-22 |
Family
ID=27451034
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/GB1994/001290 WO1994029351A2 (en) | 1993-06-16 | 1994-06-15 | Antibodies |
Country Status (5)
Country | Link |
---|---|
EP (1) | EP0714409A1 (en) |
JP (1) | JPH08511420A (en) |
AU (1) | AU691811B2 (en) |
CA (1) | CA2163345A1 (en) |
WO (1) | WO1994029351A2 (en) |
Cited By (1114)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1996008512A1 (en) * | 1994-09-16 | 1996-03-21 | Austin Research Institute Cancer And Anti-Inflammatory Syndicate No. 1 | POLYPEPTIDES WITH Fc BINDING ABILITY |
WO1999032659A1 (en) * | 1997-12-22 | 1999-07-01 | Stiftelsen Universitetsforskning Bergen (Unifob) | METHOD FOR DISEASE PROGNOSIS BASED ON Fc RECEPTOR GENOTYPING |
WO1999051642A1 (en) * | 1998-04-02 | 1999-10-14 | Genentech, Inc. | Antibody variants and fragments thereof |
US6194551B1 (en) | 1998-04-02 | 2001-02-27 | Genentech, Inc. | Polypeptide variants |
US6204007B1 (en) | 1994-03-29 | 2001-03-20 | Celltech Therapeutics Limited | Antibodies against E-selectin |
US6242195B1 (en) | 1998-04-02 | 2001-06-05 | Genentech, Inc. | Methods for determining binding of an analyte to a receptor |
WO2001077342A1 (en) | 2000-04-11 | 2001-10-18 | Genentech, Inc. | Multivalent antibodies and uses therefor |
US6528624B1 (en) | 1998-04-02 | 2003-03-04 | Genentech, Inc. | Polypeptide variants |
US6737056B1 (en) | 1999-01-15 | 2004-05-18 | Genentech, Inc. | Polypeptide variants with altered effector function |
WO2004074430A2 (en) * | 2002-12-06 | 2004-09-02 | Diadexus, Inc. | Compositions, splice variants and methods relating to lung specific genes and proteins |
WO2005070963A1 (en) * | 2004-01-12 | 2005-08-04 | Applied Molecular Evolution, Inc | Fc region variants |
EP1620467A2 (en) * | 2003-05-02 | 2006-02-01 | Xencor, Inc. | Optimized fc variants and methods for their generation |
US7053202B2 (en) | 2001-10-19 | 2006-05-30 | Millennium Pharmaceuticals, Inc. | Immunoglobulin DNA cassette molecules, monobody constructs, methods of production, and methods of use therefor |
US7083784B2 (en) | 2000-12-12 | 2006-08-01 | Medimmune, Inc. | Molecules with extended half-lives, compositions and uses thereof |
WO2006089133A2 (en) | 2005-02-15 | 2006-08-24 | Duke University | Anti-cd19 antibodies and uses in oncology |
US7147851B1 (en) | 1996-08-15 | 2006-12-12 | Millennium Pharmaceuticals, Inc. | Humanized immunoglobulin reactive with α4β7 integrin |
US7183387B1 (en) | 1999-01-15 | 2007-02-27 | Genentech, Inc. | Polypeptide variants with altered effector function |
WO2007067992A2 (en) | 2005-12-08 | 2007-06-14 | Medarex, Inc. | Human monoclonal antibodies to fucosyl-gm1 and methods for using anti-fucosyl-gm1 |
US7247302B1 (en) | 1996-08-02 | 2007-07-24 | Bristol-Myers Squibb Company | Method for inhibiting immunoglobulin-induced toxicity resulting from the use of immunoglobulins in therapy and in vivo diagnosis |
US7262278B2 (en) | 2001-10-15 | 2007-08-28 | Kirin Beer Kabushiki Kaisha | Anti-HLA-DR antibody |
WO2007127506A2 (en) | 2006-01-20 | 2007-11-08 | Genentech, Inc. | Anti-ephrinb2 antibodies and methods using same |
WO2008031056A2 (en) | 2006-09-08 | 2008-03-13 | Medimmune, Llc | Humanized anti-cd19 antibodies and their use in treatment of oncology, transplantation and autoimmune disease |
WO2008030611A2 (en) | 2006-09-05 | 2008-03-13 | Medarex, Inc. | Antibodies to bone morphogenic proteins and receptors therefor and methods for their use |
US7355008B2 (en) | 2003-01-09 | 2008-04-08 | Macrogenics, Inc. | Identification and engineering of antibodies with variant Fc regions and methods of using same |
WO2008052187A2 (en) | 2006-10-27 | 2008-05-02 | Genentech. Inc. | Antibodies and immunoconjugates and uses therefor |
US7371826B2 (en) | 1999-01-15 | 2008-05-13 | Genentech, Inc. | Polypeptide variants with altered effector function |
WO2008070569A2 (en) | 2006-12-01 | 2008-06-12 | Medarex, Inc. | Human antibodies that bind cd22 and uses thereof |
WO2008074004A2 (en) | 2006-12-14 | 2008-06-19 | Medarex, Inc. | Human antibodies that bind cd70 and uses thereof |
WO2008076560A2 (en) | 2006-11-15 | 2008-06-26 | Medarex, Inc. | Human monoclonal antibodies to btla and methods of use |
US7416726B2 (en) | 2000-04-13 | 2008-08-26 | The Rockefeller University | Enhancement of antibody-mediated immune responses |
WO2008150525A1 (en) | 2007-06-04 | 2008-12-11 | Genentech, Inc. | Anti-notch1 nrr antibodies and methods using same |
US7476724B2 (en) | 2004-08-05 | 2009-01-13 | Genentech, Inc. | Humanized anti-cmet antibodies |
US7495085B2 (en) | 2003-03-14 | 2009-02-24 | Wyeth | Antibodies against human or mouse IL-21 receptor |
WO2009032845A2 (en) | 2007-09-04 | 2009-03-12 | Compugen, Ltd. | Polypeptides and polynucleotides, and uses thereof as a drug target for producing drugs and biologics |
WO2009054863A2 (en) | 2006-12-13 | 2009-04-30 | Medarex, Inc. | Human antibodies that bind cd19 and uses thereof |
US7528236B2 (en) | 2004-09-03 | 2009-05-05 | Genentech, Inc. | Humanized anti-beta7 antagonists and uses therefor |
US7531175B2 (en) | 1999-02-12 | 2009-05-12 | Genetics Institute Llc | Methods for modulation of immune responses using humanized immunoglobulins reactive with B7-1 molecules |
WO2009081201A2 (en) | 2007-12-21 | 2009-07-02 | Medimmune Limited | BINDING MEMBERS FOR INTERLEUKIN-4 RECEPTOR ALPHA (IL-4Rα) - 173 |
US7563441B2 (en) * | 2004-04-13 | 2009-07-21 | Hoffman-La Roche Inc. | Anti-P-selectin antibodies |
WO2009100309A2 (en) | 2008-02-08 | 2009-08-13 | Medimmune, Llc | Anti-ifnar1 antibodies with reduced fc ligand affinity |
US7597889B1 (en) * | 1998-05-08 | 2009-10-06 | Cambridge Enterprise Limited | Binding molecules derived from immunoglobulins which do not trigger complement mediated lysis |
WO2009131256A1 (en) | 2008-04-24 | 2009-10-29 | Gene Techno Science Co., Ltd. | Humanized antibodies specific for amino acid sequence rgd of an extracellular matrix protein and the uses thereof |
US7632497B2 (en) | 2004-11-10 | 2009-12-15 | Macrogenics, Inc. | Engineering Fc Antibody regions to confer effector function |
EP2135619A1 (en) | 2003-12-10 | 2009-12-23 | Millennium Pharmaceuticals, Inc. | Humanized anti-CCR2 antibodies and methods of use therefor |
US7658921B2 (en) | 2000-12-12 | 2010-02-09 | Medimmune, Llc | Molecules with extended half-lives, compositions and uses thereof |
US7659374B2 (en) | 2004-08-16 | 2010-02-09 | Medimmune, Llc | Eph receptor Fc variants with enhanced antibody dependent cell-mediated cytotoxicity activity |
WO2010015608A1 (en) | 2008-08-05 | 2010-02-11 | Novartis Ag | Compositions and methods for antibodies targeting complement protein c5 |
US7662925B2 (en) | 2002-03-01 | 2010-02-16 | Xencor, Inc. | Optimized Fc variants and methods for their generation |
US7666421B2 (en) | 1999-02-12 | 2010-02-23 | Genetics Institute, Llc | Methods of treatment of autoimmune diseases using humanized immunoglobulin reactive with B7-2 |
EP2161336A1 (en) | 2005-05-09 | 2010-03-10 | ONO Pharmaceutical Co., Ltd. | Human monoclonal antibodies to programmed death 1(PD-1) and methods for treating cancer using anti-PD-1 antibodies alone or in combination with other immunotherapeutics |
US7700097B2 (en) | 2003-06-27 | 2010-04-20 | Biogen Idec Ma Inc. | Purification and preferential synthesis of binding molecules |
US7700099B2 (en) | 2005-02-14 | 2010-04-20 | Merck & Co., Inc. | Non-immunostimulatory antibody and compositions containing the same |
US7704505B2 (en) | 1994-08-15 | 2010-04-27 | Medimmune, Llc | Human-murine chimeric antibodies against respiratory syncytial virus |
WO2010056804A1 (en) | 2008-11-12 | 2010-05-20 | Medimmune, Llc | Antibody formulation |
WO2010067308A2 (en) | 2008-12-08 | 2010-06-17 | Compugen Ltd. | Polypeptides and polynucleotides, and uses thereof as a drug target for producing drugs and biologics |
US7740847B2 (en) | 2004-08-04 | 2010-06-22 | Applied Molecular Evolution, Inc. | Variant Fc regions |
WO2010070346A2 (en) | 2008-12-18 | 2010-06-24 | Medimmune Limited | BINDING MEMBERS FOR INTERLEUKIN-4 RECEPTOR ALPHA (IL-4Ra) - 836 |
WO2010072740A2 (en) | 2008-12-23 | 2010-07-01 | Astrazeneca Ab | TARGETED BINDING AGENTS DIRECTED TO α5β1 AND USES THEREOF |
EP2221316A1 (en) | 2005-05-05 | 2010-08-25 | Duke University | Anti-CD19 antibody therapy for autoimmune disease |
WO2010094720A2 (en) | 2009-02-19 | 2010-08-26 | Glaxo Group Limited | Improved anti-tnfr1 polypeptides, antibody variable domains & antagonists |
US7786270B2 (en) | 2006-05-26 | 2010-08-31 | Macrogenics, Inc. | Humanized FcγRIIB-specific antibodies and methods of use thereof |
WO2010102175A1 (en) | 2009-03-05 | 2010-09-10 | Medarex, Inc. | Fully human antibodies specific to cadm1 |
WO2010108127A1 (en) | 2009-03-20 | 2010-09-23 | Genentech, Inc. | Bispecific anti-her antibodies |
US7803904B2 (en) | 1995-09-01 | 2010-09-28 | Millennium Pharmaceuticals, Inc. | Mucosal vascular addressing and uses thereof |
US7803377B2 (en) | 2006-06-06 | 2010-09-28 | Genentech, Inc. | Anti-DLL4 antibodies and methods using same |
WO2010111367A1 (en) | 2009-03-25 | 2010-09-30 | Genentech, Inc. | Anti-fgfr3 antibodies and methods using same |
WO2010111254A1 (en) | 2009-03-25 | 2010-09-30 | Genentech, Inc. | Novel anti-alpha5beta1 antibodies and uses thereof |
WO2010112458A1 (en) | 2009-03-31 | 2010-10-07 | Novartis Ag | Composition and methods of use for therapeutic antibodies specific for the il-12 receptore betal subunit |
WO2010125003A1 (en) | 2009-04-27 | 2010-11-04 | Novartis Ag | Compositions and methods for increasing muscle growth |
EP2251026A1 (en) | 2000-06-08 | 2010-11-17 | Immune Disease Institute, Inc. | Methods and compositions for inhibiting immunoglobulin-mediated reperfusion injury |
WO2010146550A1 (en) | 2009-06-18 | 2010-12-23 | Pfizer Inc. | Anti notch-1 antibodies |
US7863419B2 (en) | 2003-08-22 | 2011-01-04 | Biogen Idec Ma Inc. | Antibodies having altered effector function and methods for making the same |
EP2275448A2 (en) | 2003-12-19 | 2011-01-19 | Genentech, Inc. | Monovalent antibody fragments useful as therapeutics |
WO2011006914A2 (en) | 2009-07-16 | 2011-01-20 | Glaxo Group Limited | Antagonists, uses & methods for partially inhibiting tnfr1 |
WO2011014438A1 (en) | 2009-07-31 | 2011-02-03 | N.V. Organon | Fully human antibodies to btla |
WO2011014457A1 (en) | 2009-07-27 | 2011-02-03 | Genentech, Inc. | Combination treatments |
WO2011021146A1 (en) | 2009-08-20 | 2011-02-24 | Pfizer Inc. | Osteopontin antibodies |
EP2290077A2 (en) | 2004-03-01 | 2011-03-02 | Immune Disease Institute, Inc. | Natural IGM antibodies and inhibitors thereof |
WO2011029823A1 (en) | 2009-09-09 | 2011-03-17 | Novartis Ag | Monoclonal antibody reactive with cd63 when expressed at the surface of degranulated mast cells |
EP2298348A1 (en) | 2000-04-14 | 2011-03-23 | Millennium Pharmaceuticals, Inc. | Antibody binding alpha4Beta7 integrin and its use to treat inflammatory bowel disease |
US7923221B1 (en) * | 1983-04-08 | 2011-04-12 | Genentech, Inc | Methods of making antibody heavy and light chains having specificity for a desired antigen |
WO2011047083A1 (en) | 2009-10-13 | 2011-04-21 | Oxford Biotherapeutics Ltd. | Antibodies against epha10 |
WO2011050188A1 (en) | 2009-10-22 | 2011-04-28 | Genentech, Inc. | Anti-hepsin antibodies and methods using same |
WO2011049868A1 (en) | 2009-10-19 | 2011-04-28 | Genentech, Inc. | Modulators of hepatocyte growth factor activator |
WO2011051217A1 (en) | 2009-10-27 | 2011-05-05 | Glaxo Group Limited | Stable anti-tnfr1 polypeptides, antibody variable domains & antagonists |
WO2011056772A1 (en) | 2009-11-04 | 2011-05-12 | Schering Corporation | Engineered anti-tslp antibody |
WO2011056502A1 (en) | 2009-10-26 | 2011-05-12 | Genentech, Inc. | Bone morphogenetic protein receptor type ii compositions and methods of use |
WO2011057120A1 (en) | 2009-11-05 | 2011-05-12 | Genentech, Inc. | Methods and composition for secretion of heterologous polypeptides |
WO2011056497A1 (en) | 2009-10-26 | 2011-05-12 | Genentech, Inc. | Activin receptor type iib compositions and methods of use |
WO2011056494A1 (en) | 2009-10-26 | 2011-05-12 | Genentech, Inc. | Activin receptor-like kinase-1 antagonist and vegfr3 antagonist combinations |
EP2325208A1 (en) | 2005-12-15 | 2011-05-25 | Genentech, Inc. | Polyubiquitin antibodies |
EP2327423A2 (en) | 2006-02-21 | 2011-06-01 | Wyeth LLC | Human antibodies against human interleukin-22 (IL-22) |
WO2011068993A1 (en) | 2009-12-02 | 2011-06-09 | Acceleron Pharma Inc. | Compositions and methods for increasing serum half-life of fc fusion proteins. |
WO2011067711A2 (en) | 2009-12-01 | 2011-06-09 | Compugen Ltd | Novel heparanase splice variant |
WO2011071577A1 (en) | 2009-12-11 | 2011-06-16 | Genentech, Inc. | Anti-vegf-c antibodies and methods using same |
WO2011079185A1 (en) | 2009-12-23 | 2011-06-30 | Genentech, Inc. | Anti-bv8 antibodies and uses thereof |
WO2011076781A1 (en) | 2009-12-22 | 2011-06-30 | Novartis Ag | Tetravalent cd47-antibody constant region fusion protein for use in therapy |
US7973136B2 (en) | 2005-10-06 | 2011-07-05 | Xencor, Inc. | Optimized anti-CD30 antibodies |
EP2343551A1 (en) | 2006-04-10 | 2011-07-13 | Genentech, Inc. | Disheveled PDZ modulators |
WO2011085343A1 (en) | 2010-01-11 | 2011-07-14 | Alexion Pharmaceuticals, Inc | Biomarkers of immunomodulatory effects in humans treated with anti-cd200 antibodies |
US7985833B2 (en) | 2000-04-21 | 2011-07-26 | Fuso Pharmaceutical Industries, Ltd. | Collectin |
WO2011100403A1 (en) | 2010-02-10 | 2011-08-18 | Immunogen, Inc | Cd20 antibodies and uses thereof |
WO2011098449A1 (en) | 2010-02-10 | 2011-08-18 | Novartis Ag | Methods and compounds for muscle growth |
WO2011103242A1 (en) | 2010-02-18 | 2011-08-25 | Genentech, Inc. | Neuregulin antagonists and use thereof in treating cancer |
WO2011101328A2 (en) | 2010-02-18 | 2011-08-25 | Roche Glycart Ag | Treatment with a humanized igg class anti egfr antibody and an antibody against insulin like growth factor 1 receptor |
US8008443B2 (en) | 2005-04-26 | 2011-08-30 | Medimmune, Llc | Modulation of antibody effector function by hinge domain engineering |
WO2011106528A1 (en) * | 2010-02-24 | 2011-09-01 | Immunogen, Inc. | Folate receptor 1 antibodies and immunoconjugates and uses thereof |
WO2011119661A1 (en) | 2010-03-24 | 2011-09-29 | Genentech, Inc. | Anti-lrp6 antibodies |
EP2383295A1 (en) | 2003-12-10 | 2011-11-02 | Medarex, Inc. | IP-10 antibodies and their uses |
WO2011137395A1 (en) | 2010-04-30 | 2011-11-03 | Rother Russell P | Anti-c5a antibodies and methods for using the antibodies |
WO2011138391A1 (en) | 2010-05-06 | 2011-11-10 | Novartis Ag | Compositions and methods of use for therapeutic low density lipoprotein - related protein 6 (lrp6) multivalent antibodies |
WO2011138392A1 (en) | 2010-05-06 | 2011-11-10 | Novartis Ag | Compositions and methods of use for therapeutic low density lipoprotein -related protein 6 (lrp6) antibodies |
EP2388323A2 (en) | 2008-01-11 | 2011-11-23 | Gene Techno Science Co., Ltd. | Humanized anti-9 integrin antibodies and the uses thereof |
WO2011147834A1 (en) | 2010-05-26 | 2011-12-01 | Roche Glycart Ag | Antibodies against cd19 and uses thereof |
WO2011153346A1 (en) | 2010-06-03 | 2011-12-08 | Genentech, Inc. | Immuno-pet imaging of antibodies and immunoconjugates and uses therefor |
US8084582B2 (en) | 2003-03-03 | 2011-12-27 | Xencor, Inc. | Optimized anti-CD20 monoclonal antibodies having Fc variants |
WO2011161119A1 (en) | 2010-06-22 | 2011-12-29 | F. Hoffmann-La Roche Ag | Antibodies against insulin-like growth factor i receptor and uses thereof |
WO2011161189A1 (en) | 2010-06-24 | 2011-12-29 | F. Hoffmann-La Roche Ag | Anti-hepsin antibodies and methods of use |
EP2402373A2 (en) | 2006-01-05 | 2012-01-04 | Genentech, Inc. | Anti-EphB4 Antibodies and Methods Using Same |
WO2012006503A1 (en) | 2010-07-09 | 2012-01-12 | Genentech, Inc. | Anti-neuropilin antibodies and methods of use |
AU2008229860B2 (en) * | 2003-05-02 | 2012-01-12 | Xencor, Inc | Optimized Fc variants and methods for their generation |
US8101720B2 (en) | 2004-10-21 | 2012-01-24 | Xencor, Inc. | Immunoglobulin insertions, deletions and substitutions |
WO2012010582A1 (en) | 2010-07-21 | 2012-01-26 | Roche Glycart Ag | Anti-cxcr5 antibodies and methods of use |
WO2012018771A1 (en) | 2010-08-03 | 2012-02-09 | Genentech, Inc. | Chronic lymphocytic leukemia (cll) biomarkers |
WO2012017003A1 (en) | 2010-08-05 | 2012-02-09 | F. Hoffmann-La Roche Ag | Anti-mhc antibody anti-viral cytokine fusion protein |
EP2418220A2 (en) | 2003-12-10 | 2012-02-15 | Medarex, Inc. | Interferon alpha antibodies and their uses |
WO2012020096A1 (en) | 2010-08-13 | 2012-02-16 | Medimmune Limited | Monomeric polypeptides comprising variant fc regions and methods of use |
WO2012020006A2 (en) | 2010-08-13 | 2012-02-16 | Roche Glycart Ag | Anti-fap antibodies and methods of use |
WO2012020038A1 (en) | 2010-08-13 | 2012-02-16 | Roche Glycart Ag | Anti-tenascin-c a2 antibodies and methods of use |
WO2012022734A2 (en) | 2010-08-16 | 2012-02-23 | Medimmune Limited | Anti-icam-1 antibodies and methods of use |
WO2012022814A1 (en) | 2010-08-20 | 2012-02-23 | Novartis Ag | Antibodies for epidermal growth factor receptor 3 (her3) |
US8124731B2 (en) | 2002-03-01 | 2012-02-28 | Xencor, Inc. | Optimized Fc variants and methods for their generation |
WO2012025536A1 (en) | 2010-08-25 | 2012-03-01 | F. Hoffmann-La Roche Ag | Antibodies against il-18r1 and uses thereof |
WO2012031027A1 (en) | 2010-08-31 | 2012-03-08 | Genentech, Inc. | Biomarkers and methods of treatment |
US8133982B2 (en) | 2004-05-10 | 2012-03-13 | Macrogenics, Inc. | FcγRIIB specific antibodies and methods of use thereof |
EP2431392A1 (en) | 2006-02-21 | 2012-03-21 | Wyeth LLC | Antibodies against human IL-22 and uses therefor |
WO2012035518A1 (en) | 2010-09-17 | 2012-03-22 | Compugen Ltd. | Compositions and methods for treatment of drug resistant multiple myeloma |
WO2012045703A1 (en) | 2010-10-05 | 2012-04-12 | Novartis Ag | Anti-il12rbeta1 antibodies and their use in treating autoimmune and inflammatory disorders |
WO2012047968A2 (en) | 2010-10-05 | 2012-04-12 | Genentech, Inc. | Mutant smoothened and methods of using the same |
EP2446904A2 (en) | 2006-05-30 | 2012-05-02 | Genentech, Inc. | Anti-CD22 antibodies, their immunoconjugates and uses thereof |
WO2012064836A1 (en) | 2010-11-10 | 2012-05-18 | Genentech, Inc. | Methods and compositions for neural disease immunotherapy |
US8187593B2 (en) | 2002-08-14 | 2012-05-29 | Macrogenics, Inc. | FcγRIIB specific antibodies and methods of use thereof |
US8188231B2 (en) | 2002-09-27 | 2012-05-29 | Xencor, Inc. | Optimized FC variants |
EP2463305A1 (en) | 2006-01-12 | 2012-06-13 | Alexion Pharmaceuticals, Inc. | Antibodies to OX-2/CD200 and uses thereof |
EP2465870A1 (en) | 2005-11-07 | 2012-06-20 | Genentech, Inc. | Binding polypeptides with diversified and consensus VH/VL hypervariable sequences |
EP2468772A2 (en) | 2006-03-16 | 2012-06-27 | Genentech, Inc. | Antibodies to EGFL7 and methods for their use |
EP2468776A2 (en) | 2007-02-09 | 2012-06-27 | Genentech, Inc. | Anti-Robo4 antibodies and uses therefor |
WO2012088313A1 (en) | 2010-12-22 | 2012-06-28 | Genentech, Inc. | Anti-pcsk9 antibodies and methods of use |
WO2012087962A2 (en) | 2010-12-20 | 2012-06-28 | Genentech, Inc. | Anti-mesothelin antibodies and immunoconjugates |
WO2012092539A2 (en) | 2010-12-31 | 2012-07-05 | Takeda Pharmaceutical Company Limited | Antibodies to dll4 and uses thereof |
EP2476705A1 (en) | 2004-12-28 | 2012-07-18 | Innate Pharma | Monoclonal antibodies against NKG2A |
WO2012100346A1 (en) | 2011-01-24 | 2012-08-02 | Ym Biosciences Inc. | Antibodies selective for cells presenting egfr at high density |
WO2012106634A1 (en) | 2011-02-03 | 2012-08-09 | Alexion Pharmaceuticals, Inc. | Use of an anti-cd200 antibody for prolonging the survival of allografts |
EP2486941A1 (en) | 2006-10-02 | 2012-08-15 | Medarex, Inc. | Human antibodies that bind CXCR4 and uses thereof |
WO2012138975A1 (en) | 2011-04-07 | 2012-10-11 | Genentech, Inc. | Anti-fgfr4 antibodies and methods of use |
WO2012140627A1 (en) | 2011-04-15 | 2012-10-18 | Compugen Ltd. | Polypeptides and polynucleotides, and uses thereof for treatment of immune related disorders and cancer |
WO2012142515A2 (en) | 2011-04-13 | 2012-10-18 | Bristol-Myers Squibb Company | Fc fusion proteins comprising novel linkers or arrangements |
WO2012145539A1 (en) | 2011-04-20 | 2012-10-26 | Acceleron Pharma, Inc. | Endoglin polypeptides and uses thereof |
US8298533B2 (en) | 2008-11-07 | 2012-10-30 | Medimmune Limited | Antibodies to IL-1R1 |
WO2012146630A1 (en) | 2011-04-29 | 2012-11-01 | F. Hoffmann-La Roche Ag | N-terminal acylated polypeptides, methods for their production and uses thereof |
WO2012151248A2 (en) | 2011-05-02 | 2012-11-08 | Millennium Pharmaceuticals, Inc. | FORMULATION FOR ANTI-α4β7 ANTIBODY |
WO2012151247A2 (en) | 2011-05-02 | 2012-11-08 | Millennium Pharmaceuticals, Inc. | FORMULATION FOR ANTI-α4β7 ANTIBODY |
US8309690B2 (en) | 2005-07-01 | 2012-11-13 | Medimmune, Llc | Integrated approach for generating multidomain protein therapeutics |
WO2012155019A1 (en) | 2011-05-12 | 2012-11-15 | Genentech, Inc. | Multiple reaction monitoring lc-ms/ms method to detect therapeutic antibodies in animal samples using framework signature pepides |
WO2012156309A1 (en) | 2011-05-13 | 2012-11-22 | Millegen | Antibodies against her3 |
WO2012158704A1 (en) | 2011-05-16 | 2012-11-22 | Genentech, Inc. | Fgfr1 agonists and methods of use |
US8318907B2 (en) | 2004-11-12 | 2012-11-27 | Xencor, Inc. | Fc variants with altered binding to FcRn |
WO2012162561A2 (en) | 2011-05-24 | 2012-11-29 | Zyngenia, Inc. | Multivalent and monovalent multispecific complexes and their uses |
EP2530090A2 (en) | 2006-10-19 | 2012-12-05 | CSL Limited | Anti-IL-13R alpha 1 antibodies and their uses thereof |
EP2532677A1 (en) | 2005-10-21 | 2012-12-12 | Novartis AG | Human antibodies against il13 and therapeutic uses |
EP2535355A2 (en) | 2005-03-23 | 2012-12-19 | Genmab A/S | Antibodies against CD38 for treatment of multiple myeloma |
WO2012172495A1 (en) | 2011-06-14 | 2012-12-20 | Novartis Ag | Compositions and methods for antibodies targeting tem8 |
WO2012171996A1 (en) | 2011-06-15 | 2012-12-20 | F. Hoffmann-La Roche Ag | Anti-human epo receptor antibodies and methods of use |
WO2012172521A1 (en) | 2011-06-16 | 2012-12-20 | Novartis Ag | Soluble proteins for use as therapeutics |
WO2012175508A1 (en) | 2011-06-22 | 2012-12-27 | F. Hoffmann-La Roche Ag | Removal of target cells by circulating virus-specific cytotoxic t-cells using mhc class i comprising complexes |
WO2012175692A1 (en) | 2011-06-22 | 2012-12-27 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Anti-axl antibodies and uses thereof |
WO2012175691A1 (en) | 2011-06-22 | 2012-12-27 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Anti-axl antibodies and uses thereof |
EP2540741A1 (en) | 2006-03-06 | 2013-01-02 | Aeres Biomedical Limited | Humanized anti-CD22 antibodies and their use in treatment of oncology, transplantation and autoimmune disease |
WO2013003625A2 (en) | 2011-06-28 | 2013-01-03 | Oxford Biotherapeutics Ltd. | Antibodies |
WO2013003680A1 (en) | 2011-06-30 | 2013-01-03 | Genentech, Inc. | Anti-c-met antibody formulations |
WO2013006437A1 (en) | 2011-07-01 | 2013-01-10 | Novartis Ag | Method for treating metabolic disorders |
WO2013008171A1 (en) | 2011-07-11 | 2013-01-17 | Glenmark Pharmaceuticals S.A. | Antibodies that bind to ox40 and their uses |
WO2013010955A1 (en) | 2011-07-15 | 2013-01-24 | Morphosys Ag | Antibodies that are cross-reactive for macrophage migration inhibitory factor (mif) and d-dopachrome tautomerase (d-dt) |
WO2013025853A1 (en) | 2011-08-17 | 2013-02-21 | Genentech, Inc. | Neuregulin antibodies and uses thereof |
WO2013026832A1 (en) | 2011-08-23 | 2013-02-28 | Roche Glycart Ag | Anti-mcsp antibodies |
US8388955B2 (en) | 2003-03-03 | 2013-03-05 | Xencor, Inc. | Fc variants |
US8394374B2 (en) | 2006-09-18 | 2013-03-12 | Xencor, Inc. | Optimized antibodies that target HM1.24 |
EP2567709A2 (en) | 2007-11-02 | 2013-03-13 | Novartis AG | Molecules and methods for modulating low-density-lipoprotein receptor-related protein 6 (LRP6) |
WO2013040433A1 (en) | 2011-09-15 | 2013-03-21 | Genentech, Inc. | Methods of promoting differentiation |
WO2013043715A1 (en) | 2011-09-19 | 2013-03-28 | Genentech, Inc. | Combination treatments comprising c-met antagonists and b-raf antagonists |
US8409568B2 (en) | 2005-10-14 | 2013-04-02 | Medimmune, Llc | Mutant antibody Fc domains and fusion proteins thereof |
WO2013052155A1 (en) | 2011-10-05 | 2013-04-11 | Genentech, Inc. | Methods of treating liver conditions using notch2 antagonists |
WO2013055998A1 (en) | 2011-10-14 | 2013-04-18 | Genentech, Inc. | ANTI-HtrA1 ANTIBODIES AND METHODS OF USE |
WO2013056008A1 (en) | 2011-10-14 | 2013-04-18 | Genentech, Inc. | Zymogen activators |
WO2013054307A2 (en) | 2011-10-14 | 2013-04-18 | Novartis Ag | Antibodies and methods for wnt pathway-related diseases |
WO2013056148A2 (en) | 2011-10-15 | 2013-04-18 | Genentech, Inc. | Methods of using scd1 antagonists |
WO2013059531A1 (en) | 2011-10-20 | 2013-04-25 | Genentech, Inc. | Anti-gcgr antibodies and uses thereof |
EP2586796A1 (en) | 2007-10-12 | 2013-05-01 | Novartis AG | Compositions and methods for use for antibodies against sclerostin |
WO2013063001A1 (en) | 2011-10-28 | 2013-05-02 | Genentech, Inc. | Therapeutic combinations and methods of treating melanoma |
WO2013070565A1 (en) | 2011-11-07 | 2013-05-16 | Medimmune, Llc | Multispecific and multivalent binding proteins and uses thereof |
WO2013078170A1 (en) | 2011-11-21 | 2013-05-30 | Genentech, Inc. | Purification of anti-c-met antibodies |
WO2013083497A1 (en) | 2011-12-06 | 2013-06-13 | F. Hoffmann-La Roche Ag | Antibody formulation |
WO2013084148A2 (en) | 2011-12-05 | 2013-06-13 | Novartis Ag | Antibodies for epidermal growth factor receptor 3 (her3) directed to domain ii of her3 |
WO2013084147A2 (en) | 2011-12-05 | 2013-06-13 | Novartis Ag | Antibodies for epidermal growth factor receptor 3 (her3) |
WO2013096791A1 (en) | 2011-12-23 | 2013-06-27 | Genentech, Inc. | Process for making high concentration protein formulations |
WO2013093762A1 (en) | 2011-12-21 | 2013-06-27 | Novartis Ag | Compositions and methods for antibodies targeting factor p |
WO2013106485A2 (en) | 2012-01-09 | 2013-07-18 | The Scripps Research Institute | Ultralong complementarity determining regions and uses thereof |
WO2013106489A1 (en) | 2012-01-09 | 2013-07-18 | The Scripps Research Institute | Humanized antibodies with ultralong cdr3s |
WO2013109856A2 (en) | 2012-01-18 | 2013-07-25 | Genentech, Inc. | Methods of using fgf19 modulators |
WO2013109819A1 (en) | 2012-01-18 | 2013-07-25 | Genentech, Inc. | Anti-lrp5 antibodies and methods of use |
EP2623516A2 (en) | 2005-12-02 | 2013-08-07 | Genentech, Inc. | Compositions and methods for the treatment of diseases and disorders associated with cytokine signaling involving antibodies that bind to IL-22 and IL-22R |
EP2626371A1 (en) | 2007-07-31 | 2013-08-14 | MedImmune, LLC | Multispecific epitope binding proteins and uses thereof |
WO2013120056A1 (en) | 2012-02-11 | 2013-08-15 | Genentech, Inc. | R-spondin translocations and methods using the same |
WO2013120929A1 (en) | 2012-02-15 | 2013-08-22 | F. Hoffmann-La Roche Ag | Fc-receptor based affinity chromatography |
US8524867B2 (en) | 2006-08-14 | 2013-09-03 | Xencor, Inc. | Optimized antibodies that target CD19 |
US8530627B2 (en) | 2002-08-14 | 2013-09-10 | Macrogenics, Inc. | FcγRIIB specific antibodies and methods of use thereof |
WO2013137920A1 (en) | 2012-03-16 | 2013-09-19 | Genentech, Inc. | Engineered conformationally-stabilized proteins |
EP2641612A1 (en) | 2008-02-05 | 2013-09-25 | Bristol-Myers Squibb Company | Alpha 5 - beta 1 antibodies and their uses |
US8546543B2 (en) | 2004-11-12 | 2013-10-01 | Xencor, Inc. | Fc variants that extend antibody half-life |
EP2644205A1 (en) | 2007-04-12 | 2013-10-02 | The Brigham and Women's Hospital, Inc. | Targeting ABCB5 for cancer therapy |
WO2013148315A1 (en) | 2012-03-27 | 2013-10-03 | Genentech, Inc. | Diagnosis and treatments relating to her3 inhibitors |
WO2013149159A1 (en) | 2012-03-30 | 2013-10-03 | Genentech, Inc. | Anti-lgr5 antibodies and immunoconjugates |
WO2013151762A1 (en) | 2012-04-05 | 2013-10-10 | Ac Immune S.A. | Humanized tau antibody |
WO2013162654A1 (en) | 2012-04-25 | 2013-10-31 | Biodesy, Llc | Methods for detecting allosteric modulators of proteins |
WO2013165940A1 (en) | 2012-05-01 | 2013-11-07 | Genentech, Inc. | Anti-pmel17 antibodies and immunoconjugates |
EP2662390A1 (en) | 2004-06-21 | 2013-11-13 | Medarex, L.L.C. | Interferon alpha receptor 1 antibodies and their uses |
WO2013170191A1 (en) | 2012-05-11 | 2013-11-14 | Genentech, Inc. | Methods of using antagonists of nad biosynthesis from nicotinamide |
WO2013177470A1 (en) | 2012-05-23 | 2013-11-28 | Genentech, Inc. | Selection method for therapeutic agents |
WO2013184514A1 (en) | 2012-06-04 | 2013-12-12 | Irm Llc | Site-specific labeling methods and molecules produced thereby |
WO2013183032A2 (en) | 2012-06-08 | 2013-12-12 | Glenmark Pharmaceuticals S.A. | Anti-trka antibodies with enhanced inhibitory properties and derivatives thereof |
US8617554B2 (en) | 2009-05-13 | 2013-12-31 | Genzyme Corporation | Anti-human CD52 immunoglobulins |
US8618248B2 (en) | 2006-10-31 | 2013-12-31 | President And Fellows Of Harvard College | Phosphopeptide compositions and anti-phosphopeptide antibody compositions and methods of detecting phosphorylated peptides |
WO2014008391A1 (en) | 2012-07-05 | 2014-01-09 | Genentech, Inc. | Expression and secretion system |
WO2014006124A1 (en) | 2012-07-04 | 2014-01-09 | F. Hoffmann-La Roche Ag | Covalently linked antigen-antibody conjugates |
WO2014006118A1 (en) | 2012-07-04 | 2014-01-09 | F. Hoffmann-La Roche Ag | Anti-theophylline antibodies and methods of use |
WO2014008218A1 (en) | 2012-07-02 | 2014-01-09 | Bristol-Myers Squibb Company | Optimization of antibodies that bind lymphocyte activation gene-3 (lag-3), and uses thereof |
WO2014006123A1 (en) | 2012-07-04 | 2014-01-09 | F. Hoffmann-La Roche Ag | Anti-biotin antibodies and methods of use |
WO2014011521A1 (en) | 2012-07-09 | 2014-01-16 | Genentech, Inc. | Immunoconjugates comprising anti - cd79b antibodies |
WO2014011519A1 (en) | 2012-07-09 | 2014-01-16 | Genentech, Inc. | Immunoconjugates comprising anti-cd79b antibodies |
WO2014011520A1 (en) | 2012-07-09 | 2014-01-16 | Genentech, Inc. | Immunoconjugates comprising anti-cd22 antibodies |
WO2014011518A1 (en) | 2012-07-09 | 2014-01-16 | Genentech, Inc. | Immunoconjugates comprising anti-cd22 antibodies |
WO2014018625A1 (en) | 2012-07-25 | 2014-01-30 | Kolltan Pharmaceuticals, Inc. | Anti-kit antibodies and uses thereof |
WO2014020056A1 (en) | 2012-08-02 | 2014-02-06 | F. Hoffmann-La Roche Ag | METHOD FOR PRODUCING SOLUBLE FcR AS Fc-FUSION WITH INERT IMMUNOGLOBULIN Fc-REGION AND USES THEREOF |
US8647625B2 (en) | 2004-07-26 | 2014-02-11 | Biogen Idec Ma Inc. | Anti-CD154 antibodies |
EP2703011A2 (en) | 2007-05-07 | 2014-03-05 | MedImmune, LLC | Anti-icos antibodies and their use in treatment of oncology, transplantation and autoimmune disease |
WO2014037899A2 (en) | 2012-09-07 | 2014-03-13 | Novartis Ag | Il-18 binding molecules |
US8679492B2 (en) | 2009-02-23 | 2014-03-25 | Glenmark Pharmaceuticals S.A. | Humanized antibodies that bind to CD19 and their uses |
US8697071B2 (en) | 2005-08-10 | 2014-04-15 | Macrogenics, Inc. | Identification and engineering of antibodies with variant Fc regions and methods of using same |
US8709432B2 (en) | 2011-04-01 | 2014-04-29 | Immunogen, Inc. | Methods for increasing efficacy of FOLR1 cancer therapy |
WO2014072306A1 (en) | 2012-11-08 | 2014-05-15 | F. Hoffmann-La Roche Ag | Her3 antigen binding proteins binding to the beta-hairpin of her3 |
EP2733153A1 (en) | 2012-11-15 | 2014-05-21 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Methods for the preparation of immunoconjugates and uses thereof |
WO2014078268A2 (en) | 2012-11-13 | 2014-05-22 | Genentech, Inc. | Anti-hemagglutinin antibodies and methods of use |
WO2014084859A1 (en) | 2012-11-30 | 2014-06-05 | Novartis Ag | Molecules and methods for modulating tmem16a activities |
WO2014089111A1 (en) | 2012-12-05 | 2014-06-12 | Novartis Ag | Compositions and methods for antibodies targeting epo |
WO2014093396A1 (en) | 2012-12-10 | 2014-06-19 | Biogen Idec Ma Inc. | Anti-blood dendritic cell antigen 2 antibodies and uses thereof |
EP2746290A2 (en) | 2007-06-06 | 2014-06-25 | Domantis Limited | Polypeptides, antibody variable domains and antagonists |
US8775090B2 (en) | 2008-12-12 | 2014-07-08 | Medimmune, Llc | Crystals and structure of a human IgG Fc variant with enhanced FcRn binding |
WO2014107739A1 (en) | 2013-01-07 | 2014-07-10 | Eleven Biotherapeutics, Inc. | Antibodies against pcsk9 |
WO2014106602A1 (en) | 2013-01-02 | 2014-07-10 | Glenmark Pharmaceuticals S.A. | Antibodies that bind to tl1a and their uses |
WO2014116749A1 (en) | 2013-01-23 | 2014-07-31 | Genentech, Inc. | Anti-hcv antibodies and methods of using thereof |
US8795667B2 (en) | 2007-12-19 | 2014-08-05 | Macrogenics, Inc. | Compositions for the prevention and treatment of smallpox |
US8802820B2 (en) | 2004-11-12 | 2014-08-12 | Xencor, Inc. | Fc variants with altered binding to FcRn |
WO2014124258A2 (en) | 2013-02-08 | 2014-08-14 | Irm Llc | Specific sites for modifying antibodies to make immunoconjugates |
WO2014122613A1 (en) | 2013-02-08 | 2014-08-14 | Novartis Ag | Anti-il-17a antibodies and their use in treating autoimmune and inflammatory disorders |
WO2014124316A2 (en) | 2013-02-08 | 2014-08-14 | Irm Llc | Specific sites for modifying antibodies to make immunoconjugates |
WO2014126871A1 (en) | 2013-02-12 | 2014-08-21 | Bristol-Myers Squibb Company | Tangential flow filtration based protein refolding methods |
WO2014126884A1 (en) | 2013-02-12 | 2014-08-21 | Bristol-Myers Squibb Company | High ph protein refolding methods |
EP2769993A1 (en) | 2007-12-14 | 2014-08-27 | Novo Nordisk A/S | Antibodies against human NKG2D and uses thereof |
WO2014128235A1 (en) | 2013-02-22 | 2014-08-28 | F. Hoffmann-La Roche Ag | Methods of treating cancer and preventing drug resistance |
WO2014131715A1 (en) | 2013-02-26 | 2014-09-04 | Roche Glycart Ag | Anti-mcsp antibodies |
WO2014138364A2 (en) | 2013-03-06 | 2014-09-12 | Genentech, Inc. | Methods of treating and preventing cancer drug resistance |
WO2014144850A1 (en) | 2013-03-15 | 2014-09-18 | Genentech, Inc. | Methods of treating cancer and preventing cancer drug resistance |
WO2014144791A2 (en) | 2013-03-15 | 2014-09-18 | Dana-Farber Cancer Institute, Inc. | Therapeutic peptides |
WO2014143739A2 (en) | 2013-03-15 | 2014-09-18 | Biogen Idec Ma Inc. | Anti-alpha v beta 6 antibodies and uses thereof |
WO2014145016A2 (en) | 2013-03-15 | 2014-09-18 | Genentech, Inc. | Il-22 polypeptides and il-22 fc fusion proteins and methods of use |
WO2014144865A2 (en) | 2013-03-15 | 2014-09-18 | Genentech, Inc. | Anti-crth2 antibodies and methods of use |
WO2014144466A1 (en) | 2013-03-15 | 2014-09-18 | Biogen Idec Ma Inc. | Anti-alpha v beta 6 antibodies and uses thereof |
WO2014151866A1 (en) | 2013-03-15 | 2014-09-25 | Genentech, Inc. | Compositions and methods for diagnosis and treatment of hepatic cancers |
WO2014153030A2 (en) | 2013-03-14 | 2014-09-25 | Genentech, Inc. | Methods of treating cancer and preventing cancer drug resistance |
WO2014152358A2 (en) | 2013-03-14 | 2014-09-25 | Genentech, Inc. | Combinations of a mek inhibitor compound with an her3/egfr inhibitor compound and methods of use |
WO2014151680A1 (en) | 2013-03-15 | 2014-09-25 | Biogen Idec Ma Inc. | Treatment and prevention of acute kidney injury using anti-alpha v beta 5 antibodies |
WO2014151006A2 (en) | 2013-03-15 | 2014-09-25 | Genentech, Inc. | Biomarkers and methods of treating pd-1 and pd-l1 related conditions |
WO2014150877A2 (en) | 2013-03-15 | 2014-09-25 | Ac Immune S.A. | Anti-tau antibodies and methods of use |
WO2014160160A2 (en) | 2013-03-13 | 2014-10-02 | Novartis Ag | Antibody drug conjugates |
WO2014159835A1 (en) | 2013-03-14 | 2014-10-02 | Genentech, Inc. | Anti-b7-h4 antibodies and immunoconjugates |
WO2014159239A2 (en) | 2013-03-14 | 2014-10-02 | Novartis Ag | Antibodies against notch 3 |
US8853369B2 (en) | 2010-06-18 | 2014-10-07 | Genentech, Inc. | Anti-Axl antibodies and methods of use |
WO2014177460A1 (en) | 2013-04-29 | 2014-11-06 | F. Hoffmann-La Roche Ag | Human fcrn-binding modified antibodies and methods of use |
WO2014177461A1 (en) | 2013-04-29 | 2014-11-06 | F. Hoffmann-La Roche Ag | Fcrn-binding abolished anti-igf-1r antibodies and their use in the treatment of vascular eye diseases |
WO2014205300A2 (en) | 2013-06-21 | 2014-12-24 | Novartis Ag | Lectin-like oxidized ldl receptor1 antibodies and methods of use |
WO2014205302A2 (en) | 2013-06-21 | 2014-12-24 | Novartis Ag | Lectin-like oxidized ldl receptor1 antibodies and methods of use |
WO2015010100A2 (en) | 2013-07-18 | 2015-01-22 | Fabrus, Inc. | Humanized antibodies with ultralong complementarity determining regions |
EP2829551A1 (en) | 2006-10-19 | 2015-01-28 | CSL Limited | High affinity antibody antagonists of interleukin-13 receptor alpha 1 |
WO2015017146A2 (en) | 2013-07-18 | 2015-02-05 | Fabrus, Inc. | Antibodies with ultralong complementarity determining regions |
WO2015022658A2 (en) | 2013-08-14 | 2015-02-19 | Novartis Ag | Methods of treating sporadic inclusion body myositis |
US8969526B2 (en) | 2011-03-29 | 2015-03-03 | Roche Glycart Ag | Antibody Fc variants |
US8975377B2 (en) | 2007-08-13 | 2015-03-10 | Vasgene Therapeutics, Inc | Cancer treatment using humanized antibodies that bind to EphB4 |
EP2851372A1 (en) | 2007-11-30 | 2015-03-25 | Genentech, Inc. | Anti-VEGF antibodies |
WO2015042108A1 (en) | 2013-09-17 | 2015-03-26 | Genentech, Inc. | Methods of using anti-lgr5 antibodies |
WO2015046467A1 (en) | 2013-09-27 | 2015-04-02 | 中外製薬株式会社 | Method for producing polypeptide heteromultimer |
WO2015052230A1 (en) | 2013-10-11 | 2015-04-16 | F. Hoffmann-La Roche Ag | Multispecific domain exchanged common variable light chain antibodies |
WO2015054670A1 (en) | 2013-10-11 | 2015-04-16 | Genentech, Inc. | Nsp4 inhibitors and methods of use |
WO2015057939A1 (en) | 2013-10-18 | 2015-04-23 | Biogen Idec Ma Inc. | Anti-s1p4 antibodies and uses thereof |
WO2015058132A2 (en) | 2013-10-18 | 2015-04-23 | Genentech, Inc. | Anti-rspo antibodies and methods of use |
WO2015061441A1 (en) | 2013-10-23 | 2015-04-30 | Genentech, Inc. | Methods of diagnosing and treating eosinophilic disorders |
WO2015067986A1 (en) | 2013-11-07 | 2015-05-14 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Neuregulin allosteric anti-her3 antibody |
US9040041B2 (en) | 2005-10-03 | 2015-05-26 | Xencor, Inc. | Modified FC molecules |
WO2015075011A1 (en) | 2013-11-21 | 2015-05-28 | F. Hoffmann-La Roche Ag | ANTI-alpha-SYNUCLEIN ANTIBODIES AND METHODS OF USE |
US9051373B2 (en) | 2003-05-02 | 2015-06-09 | Xencor, Inc. | Optimized Fc variants |
WO2015085210A1 (en) | 2013-12-06 | 2015-06-11 | Dana-Farber Cancer Institute, Inc. | Therapeutic peptides |
WO2015089344A1 (en) | 2013-12-13 | 2015-06-18 | Genentech, Inc. | Anti-cd33 antibodies and immunoconjugates |
WO2015089117A1 (en) | 2013-12-09 | 2015-06-18 | Allakos Inc. | Anti-siglec-8 antibodies and methods of use thereof |
US9062116B2 (en) | 2009-04-23 | 2015-06-23 | Infinity Pharmaceuticals, Inc. | Anti-fatty acid amide hydrolase-2 antibodies and uses thereof |
WO2015091656A1 (en) | 2013-12-20 | 2015-06-25 | F. Hoffmann-La Roche Ag | HUMANIZED ANTI-Tau(pS422) ANTIBODIES AND METHODS OF USE |
WO2015095410A1 (en) | 2013-12-17 | 2015-06-25 | Genentech, Inc. | Methods of treating cancer using pd-1 axis binding antagonists and an anti-cd20 antibody |
WO2015095418A1 (en) | 2013-12-17 | 2015-06-25 | Genentech, Inc. | Methods of treating her2-positive cancers using pd-1 axis binding antagonists and anti-her2 antibodies |
WO2015095423A2 (en) | 2013-12-17 | 2015-06-25 | Genentech, Inc. | Combination therapy comprising ox40 binding agonists and pd-1 axis binding antagonists |
WO2015100299A1 (en) | 2013-12-24 | 2015-07-02 | Argen-X N.V. | Fcrn antagonists and methods of use |
WO2015101586A1 (en) | 2014-01-03 | 2015-07-09 | F. Hoffmann-La Roche Ag | Bispecific anti-hapten/anti-blood brain barrier receptor antibodies, complexes thereof and their use as blood brain barrier shuttles |
WO2015101588A1 (en) | 2014-01-06 | 2015-07-09 | F. Hoffmann-La Roche Ag | Monovalent blood brain barrier shuttle modules |
WO2015101589A1 (en) | 2014-01-03 | 2015-07-09 | F. Hoffmann-La Roche Ag | Covalently linked polypeptide toxin-antibody conjugates |
WO2015101587A1 (en) | 2014-01-03 | 2015-07-09 | F. Hoffmann-La Roche Ag | Covalently linked helicar-anti-helicar antibody conjugates and uses thereof |
WO2015107026A1 (en) | 2014-01-15 | 2015-07-23 | F. Hoffmann-La Roche Ag | Fc-region variants with modified fcrn- and maintained protein a-binding properties |
WO2015112909A1 (en) | 2014-01-24 | 2015-07-30 | Genentech, Inc. | Methods of using anti-steap1 antibodies and immunoconjugates |
EP2905030A1 (en) | 2008-08-11 | 2015-08-12 | E. R. Squibb & Sons, L.L.C. | Human antibodies that bind lymphocyte activation gene-3 (LAG-3) and uses thereof |
WO2015120233A1 (en) | 2014-02-08 | 2015-08-13 | Genentech, Inc. | Methods of treating alzheimer's disease |
WO2015120075A2 (en) | 2014-02-04 | 2015-08-13 | Genentech, Inc. | Mutant smoothened and methods of using the same |
WO2015120280A1 (en) | 2014-02-08 | 2015-08-13 | Genentech, Inc. | Methods of treating alzheimer's disease |
WO2015127405A2 (en) | 2014-02-21 | 2015-08-27 | Genentech, Inc. | Anti-il-13/il-17 bispecific antibodies and uses thereof |
WO2015131155A1 (en) | 2014-02-28 | 2015-09-03 | Allakos Inc. | Methods and compositions for treating siglec-8 associated diseases |
US9127060B2 (en) | 2010-12-15 | 2015-09-08 | Wyeth Llc | Anti-Notch1 antibodies |
WO2015134894A1 (en) | 2014-03-07 | 2015-09-11 | Alexion Pharmaceuticals, Inc. | Anti-c5 antibodies having improved pharmacokinetics |
WO2015138615A2 (en) | 2014-03-12 | 2015-09-17 | Irm Llc | Specific sites for modifying antibodies to make immunoconjugates |
WO2015139046A1 (en) | 2014-03-14 | 2015-09-17 | Genentech, Inc. | Methods and compositions for secretion of heterologous polypeptides |
US9139863B2 (en) | 2012-03-16 | 2015-09-22 | Genentech, Inc. | Engineered conformationally-stabilized proteins |
WO2015140591A1 (en) | 2014-03-21 | 2015-09-24 | Nordlandssykehuset Hf | Anti-cd14 antibodies and uses thereof |
WO2015148531A1 (en) | 2014-03-24 | 2015-10-01 | Genentech, Inc. | Cancer treatment with c-met antagonists and correlation of the latter with hgf expression |
EP2927244A1 (en) | 2008-09-19 | 2015-10-07 | MedImmune, LLC | Antibodies directed to DLL4 and uses thereof |
WO2015153514A1 (en) | 2014-03-31 | 2015-10-08 | Genentech, Inc. | Combination therapy comprising anti-angiogenesis agents and ox40 binding agonists |
WO2015153513A1 (en) | 2014-03-31 | 2015-10-08 | Genentech, Inc. | Anti-ox40 antibodies and methods of use |
US9156915B2 (en) | 2012-04-26 | 2015-10-13 | Thomas Jefferson University | Anti-GCC antibody molecules |
WO2015162590A1 (en) | 2014-04-24 | 2015-10-29 | Novartis Ag | Methods of improving or accelerating physical recovery after surgery for hip fracture |
WO2015164615A1 (en) | 2014-04-24 | 2015-10-29 | University Of Oslo | Anti-gluten antibodies and uses thereof |
WO2015164330A1 (en) | 2014-04-21 | 2015-10-29 | Millennium Pharmaceuticals, Inc. | Anti-psyk antibody molecules and use of same for syk-targeted therapy |
US9182406B2 (en) | 2008-08-04 | 2015-11-10 | Biodesy, Inc. | Nonlinear optical detection of molecules comprising an unnatural amino acid possessing a hyperpolarizability |
WO2015171523A1 (en) | 2014-05-05 | 2015-11-12 | Regeneron Pharmaceuticals, Inc. | Humanized c5 and c3 animals |
WO2015179658A2 (en) | 2014-05-22 | 2015-11-26 | Genentech, Inc. | Anti-gpc3 antibodies and immunoconjugates |
WO2015179835A2 (en) | 2014-05-23 | 2015-11-26 | Genentech, Inc. | Mit biomarkers and methods using the same |
US9200079B2 (en) | 2004-11-12 | 2015-12-01 | Xencor, Inc. | Fc variants with altered binding to FcRn |
US9200073B2 (en) | 2012-08-31 | 2015-12-01 | Immunogen, Inc. | Diagnostic assays and kits for detection of folate receptor 1 |
WO2015184099A1 (en) | 2014-05-28 | 2015-12-03 | 4-Antibody Ag | Anti-gitr antibodies and methods of use thereof |
WO2015187835A2 (en) | 2014-06-06 | 2015-12-10 | Bristol-Myers Squibb Company | Antibodies against glucocorticoid-induced tumor necrosis factor receptor (gitr) and uses thereof |
WO2015191986A1 (en) | 2014-06-13 | 2015-12-17 | Genentech, Inc. | Methods of treating and preventing cancer drug resistance |
WO2015191715A1 (en) | 2014-06-11 | 2015-12-17 | Genentech, Inc. | Anti-lgr5 antibodies and uses thereof |
US9217018B2 (en) | 2011-12-15 | 2015-12-22 | Sergei B Onikienko | HSP70 fusion protein conjugates and uses thereof |
WO2015198217A2 (en) | 2013-02-08 | 2015-12-30 | Novartis Ag | Compositions and methods for long-acting antibodies targeting il-17 |
WO2016007775A1 (en) | 2014-07-11 | 2016-01-14 | Genentech, Inc. | Notch pathway inhibition |
WO2016007235A1 (en) | 2014-07-11 | 2016-01-14 | Genentech, Inc. | Anti-pd-l1 antibodies and diagnostic uses thereof |
EP2982379A1 (en) | 2005-07-01 | 2016-02-10 | E. R. Squibb & Sons, L.L.C. | Human monoclonal antibodies to programmed death ligand 1 (pd-l1) |
WO2016020880A2 (en) | 2014-08-07 | 2016-02-11 | Novartis Ag | Angiopoietin-like 4 antibodies and methods of use |
WO2016020882A2 (en) | 2014-08-07 | 2016-02-11 | Novartis Ag | Angiopoetin-like 4 (angptl4) antibodies and methods of use |
WO2016020791A1 (en) | 2014-08-05 | 2016-02-11 | Novartis Ag | Ckit antibody drug conjugates |
WO2016024195A1 (en) | 2014-08-12 | 2016-02-18 | Novartis Ag | Anti-cdh6 antibody drug conjugates |
US9266961B2 (en) | 2012-06-15 | 2016-02-23 | Genentech, Inc. | Anti-PCSK9 antibodies, formulations, dosing, and methods of use |
WO2016028672A1 (en) | 2014-08-19 | 2016-02-25 | Merck Sharp & Dohme Corp. | Anti-lag3 antibodies and antigen-binding fragments |
WO2016028656A1 (en) | 2014-08-19 | 2016-02-25 | Merck Sharp & Dohme Corp. | Anti-tigit antibodies |
US9284375B2 (en) | 2005-04-15 | 2016-03-15 | Macrogenics, Inc. | Covalent diabodies and uses thereof |
EP2995315A1 (en) | 2009-05-15 | 2016-03-16 | University Health Network | Compositions and methods for treating hematologic cancers targeting the sirp alpha- cd47 interaction |
WO2016040868A1 (en) | 2014-09-12 | 2016-03-17 | Genentech, Inc. | Anti-cll-1 antibodies and immunoconjugates |
WO2016040856A2 (en) | 2014-09-12 | 2016-03-17 | Genentech, Inc. | Cysteine engineered antibodies and conjugates |
WO2016044396A1 (en) | 2014-09-17 | 2016-03-24 | Genentech, Inc. | Immunoconjugates comprising anti-her2 antibodies and pyrrolobenzodiazepines |
US9296816B2 (en) | 2005-04-15 | 2016-03-29 | Macrogenics, Inc. | Covalent diabodies and uses thereof |
WO2016057846A1 (en) | 2014-10-08 | 2016-04-14 | Novartis Ag | Compositions and methods of use for augmented immune response and cancer therapy |
EP3009454A2 (en) | 2009-04-20 | 2016-04-20 | Oxford Bio Therapeutics Limited | Antibodies specific to cadherin-17 |
WO2016061389A2 (en) | 2014-10-16 | 2016-04-21 | Genentech, Inc. | Anti-alpha-synuclein antibodies and methods of use |
US9321831B2 (en) | 2007-06-01 | 2016-04-26 | Medimmune Limited | RSV-specific binding molecules and means for producing them |
WO2016073794A1 (en) | 2014-11-05 | 2016-05-12 | Genentech, Inc. | Methods of producing two chain proteins in bacteria |
WO2016073378A1 (en) | 2014-11-03 | 2016-05-12 | Genentech, Inc. | Assays for detecting t cell immune subsets and methods of use thereof |
WO2016073791A1 (en) | 2014-11-05 | 2016-05-12 | Genentech, Inc. | Methods of producing two chain proteins in bacteria |
WO2016073157A1 (en) | 2014-11-06 | 2016-05-12 | Genentech, Inc. | Anti-ang2 antibodies and methods of use thereof |
WO2016073282A1 (en) | 2014-11-06 | 2016-05-12 | Genentech, Inc. | Combination therapy comprising ox40 binding agonists and tigit inhibitors |
WO2016075670A1 (en) | 2014-11-14 | 2016-05-19 | Novartis Ag | Antibody drug conjugates |
WO2016077369A1 (en) | 2014-11-10 | 2016-05-19 | Genentech, Inc. | Animal model for nephropathy and agents for treating the same |
WO2016077381A1 (en) | 2014-11-10 | 2016-05-19 | Genentech, Inc. | Anti-interleukin-33 antibodies and uses thereof |
WO2016081639A1 (en) | 2014-11-19 | 2016-05-26 | Genentech, Inc. | Antibodies against bace1 and use thereof for neural disease immunotherapy |
WO2016081748A2 (en) | 2014-11-21 | 2016-05-26 | Bristol-Myers Squibb Company | Antibodies against cd73 and uses thereof |
WO2016081384A1 (en) | 2014-11-17 | 2016-05-26 | Genentech, Inc. | Combination therapy comprising ox40 binding agonists and pd-1 axis binding antagonists |
WO2016081640A1 (en) | 2014-11-19 | 2016-05-26 | Genentech, Inc. | Anti-transferrin receptor / anti-bace1 multispecific antibodies and methods of use |
WO2016081643A1 (en) | 2014-11-19 | 2016-05-26 | Genentech, Inc. | Anti-transferrin receptor antibodies and methods of use |
WO2016086147A1 (en) | 2014-11-26 | 2016-06-02 | Millennium Pharmaceuticals, Inc. | Vedolizumab for the treatment of fistulizing crohn's disease |
WO2016090210A1 (en) | 2014-12-05 | 2016-06-09 | Genentech, Inc. | ANTI-CD79b ANTIBODIES AND METHODS OF USE |
WO2016094566A2 (en) | 2014-12-10 | 2016-06-16 | Genentech, Inc. | Blood brain barrier receptor antibodies and methods of use |
WO2016091891A1 (en) | 2014-12-09 | 2016-06-16 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Human monoclonal antibodies against axl |
WO2016098079A2 (en) | 2014-12-19 | 2016-06-23 | Novartis Ag | Compositions and methods for antibodies targeting bmp6 |
WO2016098356A1 (en) | 2014-12-19 | 2016-06-23 | Chugai Seiyaku Kabushiki Kaisha | Anti-c5 antibodies and methods of use |
WO2016097865A1 (en) | 2014-12-19 | 2016-06-23 | Regenesance B.V. | Antibodies that bind human c6 and uses thereof |
US9376495B2 (en) | 2011-05-21 | 2016-06-28 | Macrogenics, Inc. | Deimmunized serum-binding domains and their use in extending serum half-life |
WO2016115345A1 (en) | 2015-01-14 | 2016-07-21 | The Brigham And Women's Hospital, | Treatment of cancer with anti-lap monoclonal antibodies |
WO2016117346A1 (en) | 2015-01-22 | 2016-07-28 | Chugai Seiyaku Kabushiki Kaisha | A combination of two or more anti-c5 antibodies and methods of use |
WO2016118961A1 (en) | 2015-01-24 | 2016-07-28 | Academia Sinica | Cancer markers and methods of use thereof |
WO2016125495A1 (en) | 2015-02-05 | 2016-08-11 | Chugai Seiyaku Kabushiki Kaisha | Antibodies comprising an ion concentration dependent antigen-binding domain, fc region variants, il-8-binding antibodies, and uses therof |
WO2016134335A2 (en) | 2015-02-19 | 2016-08-25 | Compugen Ltd. | Pvrig polypeptides and methods of treatment |
WO2016134333A1 (en) | 2015-02-19 | 2016-08-25 | Compugen Ltd. | Anti-pvrig antibodies and methods of use |
US9428789B2 (en) | 2011-03-21 | 2016-08-30 | Biodesy, Inc. | Classification of kinase inhibitors using nonlinear optical techniques |
WO2016135066A1 (en) | 2015-02-26 | 2016-09-01 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Fusion proteins and antibodies comprising thereof for promoting apoptosis |
WO2016142782A1 (en) | 2015-03-09 | 2016-09-15 | Argen-X N.V. | Methods of reducing serum levels of fc-containing agents using fcrn antagonsits |
WO2016149276A1 (en) | 2015-03-16 | 2016-09-22 | Genentech, Inc. | Methods of detecting and quantifying il-13 and uses in diagnosing and treating th2-associated diseases |
WO2016146833A1 (en) | 2015-03-19 | 2016-09-22 | F. Hoffmann-La Roche Ag | Biomarkers for nad(+)-diphthamide adp ribosyltransferase resistance |
WO2016168771A2 (en) | 2015-04-17 | 2016-10-20 | Alpine Immune Sciences, Inc. | Immunomodulatory proteins with tunable affinities |
WO2016172551A2 (en) | 2015-04-24 | 2016-10-27 | Genentech, Inc. | Methods of identifying bacteria comprising binding polypeptides |
WO2016179517A1 (en) | 2015-05-07 | 2016-11-10 | Agenus Inc. | Anti-ox40 antibodies and methods of use thereof |
WO2016179003A1 (en) | 2015-05-01 | 2016-11-10 | Genentech, Inc. | Masked anti-cd3 antibodies and methods of use |
WO2016188911A1 (en) | 2015-05-22 | 2016-12-01 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Human monoclonal antibodies fragments inhibiting both the cath-d catalytic activity and its binding to the lrp1 receptor |
WO2016196726A1 (en) | 2015-06-05 | 2016-12-08 | Genentech, Inc. | Anti-tau antibodies and methods of use |
WO2016196679A1 (en) | 2015-06-02 | 2016-12-08 | Genentech, Inc. | Compositions and methods for using anti-il-34 antibodies to treat neurological diseases |
WO2016193872A2 (en) | 2015-06-05 | 2016-12-08 | Novartis Ag | Antibodies targeting bone morphogenetic protein 9 (bmp9) and methods therefor |
WO2016196228A1 (en) | 2015-05-29 | 2016-12-08 | Bristol-Myers Squibb Company | Antibodies against ox40 and uses thereof |
WO2016196343A1 (en) | 2015-05-29 | 2016-12-08 | Genentech, Inc. | Humanized anti-ebola virus glycoprotein antibodies and methods of use |
WO2016196298A1 (en) | 2015-05-29 | 2016-12-08 | Genentech, Inc. | Therapeutic and diagnolstic methods for cancer |
WO2016200836A1 (en) | 2015-06-08 | 2016-12-15 | Genentech, Inc. | Methods of treating cancer using anti-ox40 antibodies |
WO2016200835A1 (en) | 2015-06-08 | 2016-12-15 | Genentech, Inc. | Methods of treating cancer using anti-ox40 antibodies and pd-1 axis binding antagonists |
WO2016204966A1 (en) | 2015-06-16 | 2016-12-22 | Genentech, Inc. | Anti-cd3 antibodies and methods of use |
WO2016205176A1 (en) | 2015-06-15 | 2016-12-22 | Genentech, Inc. | Antibodies and immunoconjugates |
WO2016203432A1 (en) | 2015-06-17 | 2016-12-22 | Novartis Ag | Antibody drug conjugates |
WO2016205320A1 (en) | 2015-06-17 | 2016-12-22 | Genentech, Inc. | Methods of treating locally advanced or metastatic breast cancers using pd-1 axis binding antagonists and taxanes |
WO2016205520A1 (en) | 2015-06-16 | 2016-12-22 | Genentech, Inc. | Humanized and affinity matured antibodies to fcrh5 and methods of use |
WO2016205531A2 (en) | 2015-06-17 | 2016-12-22 | Genentech, Inc. | Anti-her2 antibodies and methods of use |
WO2016205200A1 (en) | 2015-06-16 | 2016-12-22 | Genentech, Inc. | Anti-cll-1 antibodies and methods of use |
WO2016207858A1 (en) | 2015-06-26 | 2016-12-29 | Novartis Ag | Factor xi antibodies and methods of use |
WO2017004091A1 (en) | 2015-06-29 | 2017-01-05 | Genentech, Inc. | Type ii anti-cd20 antibody for use in organ transplantation |
WO2017009712A1 (en) | 2015-07-13 | 2017-01-19 | Compugen Ltd. | Hide1 compositions and methods |
US9562099B2 (en) | 2013-03-14 | 2017-02-07 | Genentech, Inc. | Anti-B7-H4 antibodies and immunoconjugates |
WO2017024171A1 (en) | 2015-08-04 | 2017-02-09 | Acceleron Pharma Inc. | Methods for treating myeloproliferative disorders |
WO2017021893A1 (en) | 2015-08-03 | 2017-02-09 | Novartis Ag | Methods of treating fgf21-associated disorders |
US9580506B2 (en) | 2005-07-21 | 2017-02-28 | Genmab A/S | Potency assays for antibody drug substance binding to an Fc receptor |
WO2017040342A1 (en) | 2015-08-28 | 2017-03-09 | Genentech, Inc. | Anti-hypusine antibodies and uses thereof |
WO2017040790A1 (en) | 2015-09-01 | 2017-03-09 | Agenus Inc. | Anti-pd-1 antibodies and methods of use thereof |
WO2017042701A1 (en) | 2015-09-09 | 2017-03-16 | Novartis Ag | Thymic stromal lymphopoietin (tslp)-binding antibodies and methods of using the antibodies |
WO2017046994A1 (en) | 2015-09-18 | 2017-03-23 | Chugai Seiyaku Kabushiki Kaisha | Il-8-binding antibodies and uses thereof |
WO2017046676A1 (en) | 2015-09-16 | 2017-03-23 | Novartis Ag | Polyomavirus neutralizing antibodies |
WO2017053807A2 (en) | 2015-09-23 | 2017-03-30 | Genentech, Inc. | Optimized variants of anti-vegf antibodies |
WO2017050729A1 (en) | 2015-09-22 | 2017-03-30 | Spring Bioscience Corporation | Anti-ox40 antibodies and diagnostic uses thereof |
EP3150636A1 (en) | 2015-10-02 | 2017-04-05 | F. Hoffmann-La Roche AG | Tetravalent multispecific antibodies |
WO2017055443A1 (en) | 2015-10-02 | 2017-04-06 | F. Hoffmann-La Roche Ag | Anti-pd1 antibodies and methods of use |
WO2017055404A1 (en) | 2015-10-02 | 2017-04-06 | F. Hoffmann-La Roche Ag | Bispecific antibodies specific for pd1 and tim3 |
WO2017059289A1 (en) | 2015-10-02 | 2017-04-06 | Genentech, Inc. | Pyrrolobenzodiazepine antibody drug conjugates and methods of use |
WO2017055540A1 (en) | 2015-10-02 | 2017-04-06 | F. Hoffmann-La Roche Ag | Bispecific anti-human a-beta/human transferrin receptor antibodies and methods of use |
WO2017055398A2 (en) | 2015-10-02 | 2017-04-06 | F. Hoffmann-La Roche Ag | Bispecific antibodies specific for a costimulatory tnf receptor |
WO2017055542A1 (en) | 2015-10-02 | 2017-04-06 | F. Hoffmann-La Roche Ag | Bispecific anti-human cd20/human transferrin receptor antibodies and methods of use |
US9617336B2 (en) | 2012-02-01 | 2017-04-11 | Compugen Ltd | C10RF32 antibodies, and uses thereof for treatment of cancer |
WO2017060144A1 (en) | 2015-10-07 | 2017-04-13 | F. Hoffmann-La Roche Ag | Bispecific antibodies with tetravalency for a costimulatory tnf receptor |
WO2017064675A1 (en) | 2015-10-16 | 2017-04-20 | Genentech, Inc. | Hindered disulfide drug conjugates |
WO2017066714A1 (en) | 2015-10-16 | 2017-04-20 | Compugen Ltd. | Anti-vsig1 antibodies and drug conjugates |
WO2017068511A1 (en) | 2015-10-20 | 2017-04-27 | Genentech, Inc. | Calicheamicin-antibody-drug conjugates and methods of use |
US9637547B2 (en) | 2013-08-30 | 2017-05-02 | Immunogen, Inc. | Monoclonal antibodies for detection of folate receptor 1 |
WO2017075124A1 (en) | 2015-10-29 | 2017-05-04 | Merck Sharp & Dohme Corp. | Antibody neutralizing human respiratory syncytial virus |
WO2017072662A1 (en) | 2015-10-29 | 2017-05-04 | Novartis Ag | Antibody conjugates comprising toll-like receptor agonist |
WO2017075173A2 (en) | 2015-10-30 | 2017-05-04 | Genentech, Inc. | Anti-factor d antibodies and conjugates |
WO2017072210A1 (en) | 2015-10-29 | 2017-05-04 | F. Hoffmann-La Roche Ag | Anti-variant fc-region antibodies and methods of use |
WO2017079768A1 (en) | 2015-11-08 | 2017-05-11 | Genentech, Inc. | Methods of screening for multispecific antibodies |
US9657106B2 (en) | 2003-03-03 | 2017-05-23 | Xencor, Inc. | Optimized Fc variants |
WO2017087678A2 (en) | 2015-11-19 | 2017-05-26 | Bristol-Myers Squibb Company | Antibodies against glucocorticoid-induced tumor necrosis factor receptor (gitr) and uses thereof |
WO2017095875A1 (en) | 2015-11-30 | 2017-06-08 | Bristol-Myers Squibb Company | Anti human ip-10 antibodies and their uses |
WO2017093947A1 (en) | 2015-12-04 | 2017-06-08 | Novartis Ag | Antibody cytokine engrafted compositions and methods of use for immunoregulation |
US9684000B2 (en) | 2010-12-16 | 2017-06-20 | Genentech, Inc. | Diagnosis and treatments relating to TH2 inhibition |
EP3181580A1 (en) | 2006-11-02 | 2017-06-21 | Acceleron Pharma Inc. | Alk1 receptor and ligand antagonists and uses thereof |
WO2017106129A1 (en) | 2015-12-16 | 2017-06-22 | Merck Sharp & Dohme Corp. | Anti-lag3 antibodies and antigen-binding fragments |
WO2017103895A1 (en) | 2015-12-18 | 2017-06-22 | Novartis Ag | Antibodies targeting cd32b and methods of use thereof |
WO2017104779A1 (en) | 2015-12-18 | 2017-06-22 | Chugai Seiyaku Kabushiki Kaisha | Anti-c5 antibodies and methods of use |
US9688775B2 (en) | 2001-08-27 | 2017-06-27 | Genentech, Inc. | System for antibody expression and assembly |
EP3184547A1 (en) | 2015-10-29 | 2017-06-28 | F. Hoffmann-La Roche AG | Anti-tpbg antibodies and methods of use |
WO2017112956A1 (en) | 2015-12-23 | 2017-06-29 | Moonshot Pharma Llc | Methods for inducing an immune response |
US9695236B2 (en) | 2008-04-02 | 2017-07-04 | Macrogenics, Inc. | BCR-complex-specific antibodies and methods of using same |
US9695233B2 (en) | 2012-07-13 | 2017-07-04 | Roche Glycart Ag | Bispecific anti-VEGF/anti-ANG-2 antibodies and their use in the treatment of ocular vascular diseases |
US9708407B2 (en) | 2013-03-15 | 2017-07-18 | Genzyme Corporation | Anti-CD52 antibodies |
US9708408B2 (en) | 2006-12-08 | 2017-07-18 | Macrogenics, Inc. | Methods for the treatment of disease using immunoglobulins having Fc Regions with altered affinities for FcγRactivating and FcγRinhibiting |
US9714295B2 (en) | 2010-03-04 | 2017-07-25 | Macrogenics, Inc. | Antibodies reactive with B7-H3, immunologically active fragments thereof and uses thereof |
US9714282B2 (en) | 2003-09-26 | 2017-07-25 | Xencor, Inc. | Optimized Fc variants and methods for their generation |
WO2017127764A1 (en) | 2016-01-20 | 2017-07-27 | Genentech, Inc. | High dose treatments for alzheimer's disease |
WO2017136558A1 (en) | 2016-02-04 | 2017-08-10 | Curis, Inc. | Mutant smoothened and methods of using the same |
US9737599B2 (en) | 2006-06-26 | 2017-08-22 | Macrogenics, Inc. | Combination of FcγRIIB-specific antibodies and CD20-specific antibodies and methods of use thereof |
WO2017152085A1 (en) | 2016-03-04 | 2017-09-08 | Bristol-Myers Squibb Company | Combination therapy with anti-cd73 antibodies |
WO2017151502A1 (en) | 2016-02-29 | 2017-09-08 | Genentech, Inc. | Therapeutic and diagnostic methods for cancer |
WO2017160699A2 (en) | 2016-03-14 | 2017-09-21 | Millennium Pharmaceuticals, Inc. | Method of preventing graft versus host disease |
WO2017160700A1 (en) | 2016-03-14 | 2017-09-21 | Millennium Pharmaceuticals, Inc. | Methods of treating or preventing graft versus host disease |
WO2017159699A1 (en) | 2016-03-15 | 2017-09-21 | Chugai Seiyaku Kabushiki Kaisha | Methods of treating cancers using pd-1 axis binding antagonists and anti-gpc3 antibodies |
WO2017161173A1 (en) | 2016-03-16 | 2017-09-21 | Merrimack Pharmaceuticals, Inc. | Engineered trail for cancer therapy |
WO2017165778A1 (en) | 2016-03-24 | 2017-09-28 | Millennium Pharmaceuticals, Inc. | Methods of treating gastrointestinal immune-related adverse events in immune oncology treatments |
WO2017165734A1 (en) | 2016-03-25 | 2017-09-28 | Genentech, Inc. | Multiplexed total antibody and antibody-conjugated drug quantification assay |
WO2017162678A1 (en) | 2016-03-22 | 2017-09-28 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Humanized anti-claudin-1 antibodies and uses thereof |
WO2017165742A1 (en) | 2016-03-24 | 2017-09-28 | Millennium Pharmaceuticals, Inc. | Methods of treating gastrointestinal immune-related adverse events in anti-ctla4 anti-pd-1 combination treatments |
WO2017181111A2 (en) | 2016-04-15 | 2017-10-19 | Genentech, Inc. | Methods for monitoring and treating cancer |
WO2017180864A1 (en) | 2016-04-14 | 2017-10-19 | Genentech, Inc. | Anti-rspo3 antibodies and methods of use |
WO2017181079A2 (en) | 2016-04-15 | 2017-10-19 | Genentech, Inc. | Methods for monitoring and treating cancer |
WO2017181152A2 (en) | 2016-04-15 | 2017-10-19 | Alpine Immune Sciences, Inc. | Cd80 variant immunomodulatory proteins and uses thereof |
WO2017181148A2 (en) | 2016-04-15 | 2017-10-19 | Alpine Immune Sciences, Inc. | Icos ligand variant immunomodulatory proteins and uses thereof |
WO2017189724A1 (en) | 2016-04-27 | 2017-11-02 | Novartis Ag | Antibodies against growth differentiation factor 15 and uses thereof |
US9809647B2 (en) | 2010-11-19 | 2017-11-07 | Eisai R&D Management Co., Ltd. | Neutralizing anti-CCL20 antibodies |
WO2017191101A1 (en) | 2016-05-02 | 2017-11-09 | F. Hoffmann-La Roche Ag | The contorsbody - a single chain target binder |
US9815890B2 (en) | 2010-06-22 | 2017-11-14 | The Regents Of The University Of Colorado, A Body Corporate | Antibodies to the C3d fragment of complement component 3 |
WO2017196663A1 (en) | 2016-05-09 | 2017-11-16 | Bristol-Myers Squibb Company | Tl1a antibodies and uses thereof |
WO2017197234A1 (en) | 2016-05-13 | 2017-11-16 | Bioatla, Llc | Anti-ror2 antibodies, antibody fragments, their immunoconjugates and uses thereof |
WO2017194441A1 (en) | 2016-05-11 | 2017-11-16 | F. Hoffmann-La Roche Ag | Modified anti-tenascin antibodies and methods of use |
US9822181B2 (en) | 2013-08-23 | 2017-11-21 | Macrogenics, Inc. | Bi-specific monovalent diabodies that are capable of binding CD123 and CD3, and uses thereof |
WO2017201449A1 (en) | 2016-05-20 | 2017-11-23 | Genentech, Inc. | Protac antibody conjugates and methods of use |
WO2017205721A1 (en) | 2016-05-27 | 2017-11-30 | Agenus Inc. | Anti-tim-3 antibodies and methods of use thereof |
WO2017203450A1 (en) | 2016-05-25 | 2017-11-30 | Novartis Ag | Reversal binding agents for anti-factor xi/xia antibodies and uses thereof |
WO2017205741A1 (en) | 2016-05-27 | 2017-11-30 | Genentech, Inc. | Bioanalytical method for the characterization of site-specific antibody-drug conjugates |
US9834606B2 (en) | 2013-09-13 | 2017-12-05 | Beigene, Ltd | Anti-PD1 antibodies and their use as therapeutics and diagnostics |
WO2017214024A1 (en) | 2016-06-06 | 2017-12-14 | Genentech, Inc. | Silvestrol antibody-drug conjugates and methods of use |
WO2017218434A1 (en) | 2016-06-12 | 2017-12-21 | Millennium Pharmaceuticals, Inc. | Method of treating inflammatory bowel disease |
WO2017216724A1 (en) | 2016-06-15 | 2017-12-21 | Novartis Ag | Methods for treating disease using inhibitors of bone morphogenetic protein 6 (bmp6) |
WO2017223405A1 (en) | 2016-06-24 | 2017-12-28 | Genentech, Inc. | Anti-polyubiquitin multispecific antibodies |
WO2018007314A1 (en) | 2016-07-04 | 2018-01-11 | F. Hoffmann-La Roche Ag | Novel antibody format |
WO2018013818A2 (en) | 2016-07-14 | 2018-01-18 | Bristol-Myers Squibb Company | Antibodies against tim3 and uses thereof |
US9879042B2 (en) | 2014-09-08 | 2018-01-30 | Academia Sinica | Human iNKT cell activation using glycolipids |
WO2018020476A1 (en) | 2016-07-29 | 2018-02-01 | Aduro Biotech Holdings, Europe B.V. | Anti-pd-1 antibodies |
WO2018022945A1 (en) | 2016-07-28 | 2018-02-01 | Alpine Immune Sciences, Inc. | Cd112 variant immunomodulatory proteins and uses thereof |
WO2018022946A1 (en) | 2016-07-28 | 2018-02-01 | Alpine Immune Sciences, Inc. | Cd155 variant immunomodulatory proteins and uses thereof |
WO2018021450A1 (en) | 2016-07-29 | 2018-02-01 | 中外製薬株式会社 | Bispecific antibody exhibiting increased alternative fviii-cofactor-function activity |
WO2018022479A1 (en) | 2016-07-25 | 2018-02-01 | Biogen Ma Inc. | Anti-hspa5 (grp78) antibodies and uses thereof |
EP3279215A1 (en) | 2009-11-24 | 2018-02-07 | MedImmune Limited | Targeted binding agents against b7-h1 |
WO2018027203A1 (en) | 2016-08-05 | 2018-02-08 | Allakos, Inc. | Anti-siglec-7 antibodies for the treatment of cancer |
WO2018025178A1 (en) | 2016-08-02 | 2018-02-08 | Aduro Biotech Holdings, Europe B.V. | Antibodies against human ctla-4 |
US9889197B2 (en) | 2005-04-15 | 2018-02-13 | Macrogenics, Inc. | Covalently-associated diabody complexes that possess charged coil domains and that are capable of enhanced binding to serum albumin |
WO2018029124A1 (en) | 2016-08-08 | 2018-02-15 | F. Hoffmann-La Roche Ag | Therapeutic and diagnostic methods for cancer |
WO2018031662A1 (en) | 2016-08-11 | 2018-02-15 | Genentech, Inc. | Pyrrolobenzodiazepine prodrugs and antibody conjugates thereof |
US9896508B2 (en) | 2010-03-04 | 2018-02-20 | Macrogenics, Inc. | Antibodies reactive with B7-H3 and uses thereof |
US9908938B2 (en) | 2013-03-14 | 2018-03-06 | Macrogenics, Inc. | Bispecific molecules that are immunoreactive with immune effector cells that express an activating receptor and an antigen expressed by a cell infected by a virus and uses thereof |
WO2018044970A1 (en) | 2016-08-31 | 2018-03-08 | University Of Rochester | Human monoclonal antibodies to human endogenous retrovirus k envelope (herv-k) and uses thereof |
WO2018050878A1 (en) | 2016-09-19 | 2018-03-22 | F. Hoffmann-La Roche Ag | Complement factor based affinity chromatography |
WO2018058022A1 (en) | 2016-09-26 | 2018-03-29 | Merck Sharp & Dohme Corp. | Anti-cd27 antibodies |
WO2018057849A1 (en) | 2016-09-23 | 2018-03-29 | Genentech, Inc. | Uses of il-13 antagonists for treating atopic dermatitis |
US9932400B2 (en) | 2013-08-23 | 2018-04-03 | Macrogenics, Inc. | Bi-specific monovalent diabodies that are capable of binding to gpA33 and CD3, and uses thereof |
WO2018065501A1 (en) | 2016-10-05 | 2018-04-12 | F. Hoffmann-La Roche Ag | Methods for preparing antibody drug conjugates |
WO2018068028A1 (en) | 2016-10-06 | 2018-04-12 | Genentech, Inc. | Therapeutic and diagnostic methods for cancer |
WO2018071500A1 (en) | 2016-10-11 | 2018-04-19 | Agenus Inc. | Anti-lag-3 antibodies and methods of use thereof |
WO2018081648A2 (en) | 2016-10-29 | 2018-05-03 | Genentech, Inc. | Anti-mic antibidies and methods of use |
US9963510B2 (en) | 2005-04-15 | 2018-05-08 | Macrogenics, Inc. | Covalent diabodies and uses thereof |
US9969789B2 (en) | 2012-12-17 | 2018-05-15 | Trillium Therapeutics Inc. | Treatment of CD47+ disease cells with SIRP alpha-Fc fusions |
WO2018087720A1 (en) | 2016-11-14 | 2018-05-17 | Novartis Ag | Compositions, methods, and therapeutic uses related to fusogenic protein minion |
US9975965B2 (en) | 2015-01-16 | 2018-05-22 | Academia Sinica | Compositions and methods for treatment and detection of cancers |
WO2018091580A1 (en) | 2016-11-18 | 2018-05-24 | F. Hoffmann-La Roche Ag | Anti-hla-g antibodies and use thereof |
WO2018093821A1 (en) | 2016-11-15 | 2018-05-24 | Genentech, Inc. | Dosing for treatment with anti-cd20/anti-cd3 bispecific antibodies |
WO2018091724A1 (en) | 2016-11-21 | 2018-05-24 | Cureab Gmbh | Anti-gp73 antibodies and immunoconjugates |
WO2018094300A1 (en) | 2016-11-19 | 2018-05-24 | Potenza Therapeutics, Inc. | Anti-gitr antigen-binding proteins and methods of use thereof |
US9982041B2 (en) | 2014-01-16 | 2018-05-29 | Academia Sinica | Compositions and methods for treatment and detection of cancers |
US9981030B2 (en) | 2013-06-27 | 2018-05-29 | Academia Sinica | Glycan conjugates and use thereof |
WO2018098363A2 (en) | 2016-11-23 | 2018-05-31 | Bioverativ Therapeutics Inc. | Bispecific antibodies binding to coagulation factor ix and coagulation factor x |
WO2018106776A2 (en) | 2016-12-07 | 2018-06-14 | Genentech, Inc. | Anti-tau antibodies and methods of use |
WO2018106864A1 (en) | 2016-12-07 | 2018-06-14 | Agenus Inc. | Antibodies and methods of use thereof |
WO2018106862A1 (en) | 2016-12-07 | 2018-06-14 | Agenus Inc. | Anti-ctla-4 antibodies and methods of use thereof |
WO2018106781A1 (en) | 2016-12-07 | 2018-06-14 | Genentech, Inc | Anti-tau antibodies and methods of use |
WO2018111890A1 (en) | 2016-12-12 | 2018-06-21 | Genentech, Inc. | Methods of treating cancer using anti-pd-l1 antibodies and antiandrogens |
US10005847B2 (en) | 2014-05-27 | 2018-06-26 | Academia Sinica | Anti-HER2 glycoantibodies and uses thereof |
WO2018114748A1 (en) | 2016-12-20 | 2018-06-28 | F. Hoffmann-La Roche Ag | Combination therapy of anti-cd20/anti-cd3 bispecific antibodies and 4-1bb (cd137) agonists |
WO2018116255A1 (en) | 2016-12-23 | 2018-06-28 | Novartis Ag | Factor xi antibodies and methods of use |
WO2018115960A1 (en) | 2016-12-19 | 2018-06-28 | Mosaic Biomedicals, S.L. | Antibodies against lif and uses thereof |
WO2018119171A1 (en) | 2016-12-23 | 2018-06-28 | Potenza Therapeutics, Inc. | Anti-neuropilin antigen-binding proteins and methods of use thereof |
US10011658B2 (en) | 2015-04-03 | 2018-07-03 | Eureka Therapeutics, Inc. | Constructs targeting AFP peptide/MHC complexes and uses thereof |
WO2018129029A1 (en) | 2017-01-04 | 2018-07-12 | Immunogen, Inc. | Met antibodies and immunoconjugates and uses thereof |
WO2018129451A2 (en) | 2017-01-09 | 2018-07-12 | Merrimack Pharmaceuticals, Inc. | Anti-fgfr antibodies and methods of use |
WO2018127473A1 (en) | 2017-01-03 | 2018-07-12 | F. Hoffmann-La Roche Ag | Bispecific antigen binding molecules comprising anti-4-1bb clone 20h4.9 |
US10023892B2 (en) | 2014-05-27 | 2018-07-17 | Academia Sinica | Compositions and methods relating to universal glycoforms for enhanced antibody efficacy |
US10035843B2 (en) | 2009-10-06 | 2018-07-31 | Medimmune Limited | RSV-specific binding molecule |
WO2018143266A1 (en) | 2017-01-31 | 2018-08-09 | Chugai Seiyaku Kabushiki Kaisha | A pharmaceutical composition for use in the treatment or prevention of a c5-related disease and a method for treating or preventing a c5-related disease |
WO2018142322A1 (en) | 2017-02-03 | 2018-08-09 | Novartis Ag | Anti-ccr7 antibody drug conjugates |
EP3360567A1 (en) | 2007-11-07 | 2018-08-15 | Genentech, Inc. | Amp for use in treating microbial disorders |
WO2018148585A1 (en) | 2017-02-10 | 2018-08-16 | Genentech, Inc. | Anti-tryptase antibodies, compositions thereof, and uses thereof |
WO2018146594A1 (en) | 2017-02-08 | 2018-08-16 | Novartis Ag | Fgf21 mimetic antibodies and uses thereof |
US10053510B2 (en) | 2013-05-24 | 2018-08-21 | Promis Neurosciences Inc. | FasR antibodies and methods of use |
WO2018151821A1 (en) | 2017-02-17 | 2018-08-23 | Bristol-Myers Squibb Company | Antibodies to alpha-synuclein and uses thereof |
US10059768B2 (en) | 2014-09-12 | 2018-08-28 | Genentech, Inc. | Anti-B7-H4 antibodies and immunoconjugates |
WO2018157027A1 (en) | 2017-02-27 | 2018-08-30 | Regeneron Pharmaceuticals, Inc. | Humanized model of kidney and liver disorders |
WO2018160841A1 (en) | 2017-03-01 | 2018-09-07 | Genentech, Inc. | Diagnostic and therapeutic methods for cancer |
WO2018158398A1 (en) | 2017-03-02 | 2018-09-07 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Antibodies having specificity to nectin-4 and uses thereof |
WO2018170026A2 (en) | 2017-03-16 | 2018-09-20 | Alpine Immune Sciences, Inc. | Cd80 variant immunomodulatory proteins and uses thereof |
WO2018170021A1 (en) | 2017-03-16 | 2018-09-20 | Alpine Immune Sciences, Inc. | Pd-l1 variant immunomodulatory proteins and uses thereof |
WO2018170023A1 (en) | 2017-03-16 | 2018-09-20 | Alpine Immune Sciences, Inc. | Pd-l2 variant immunomodulatory proteins and uses thereof |
WO2018175752A1 (en) | 2017-03-22 | 2018-09-27 | Genentech, Inc. | Optimized antibody compositions for treatment of ocular disorders |
WO2018175460A1 (en) | 2017-03-24 | 2018-09-27 | Novartis Ag | Methods for preventing and treating heart disease |
US10086054B2 (en) | 2013-06-26 | 2018-10-02 | Academia Sinica | RM2 antigens and use thereof |
US10087236B2 (en) | 2009-12-02 | 2018-10-02 | Academia Sinica | Methods for modifying human antibodies by glycan engineering |
WO2018178076A1 (en) | 2017-03-29 | 2018-10-04 | F. Hoffmann-La Roche Ag | Bispecific antigen binding molecule for a costimulatory tnf receptor |
WO2018178055A1 (en) | 2017-03-29 | 2018-10-04 | F. Hoffmann-La Roche Ag | Bispecific antigen binding molecule for a costimulatory tnf receptor |
WO2018183175A1 (en) | 2017-03-28 | 2018-10-04 | Genentech, Inc. | Methods of treating neurodegenerative diseases |
WO2018183889A1 (en) | 2017-03-30 | 2018-10-04 | Potenza Therapeutics, Inc. | Anti-tigit antigen-binding proteins and methods of use thereof |
WO2018185045A1 (en) | 2017-04-04 | 2018-10-11 | F. Hoffmann-La Roche Ag | Novel bispecific antigen binding molecules capable of specific binding to cd40 and to fap |
WO2018187518A1 (en) | 2017-04-07 | 2018-10-11 | Merck Sharp & Dohme Corp. | Anti-ilt4 antibodies and antigen-binding fragments |
WO2018185043A1 (en) | 2017-04-05 | 2018-10-11 | F. Hoffmann-La Roche Ag | Bispecific antibodies specifically binding to pd1 and lag3 |
WO2018185618A1 (en) | 2017-04-03 | 2018-10-11 | Novartis Ag | Anti-cdh6 antibody drug conjugates and anti-gitr antibody combinations and methods of treatment |
WO2018185046A1 (en) | 2017-04-05 | 2018-10-11 | F. Hoffmann-La Roche Ag | Anti-lag3 antibodies |
US10100116B2 (en) | 2006-06-26 | 2018-10-16 | Macrogenics, Inc. | FcγRIIB-specific antibodies and methods of use thereof |
WO2018190719A2 (en) | 2017-04-13 | 2018-10-18 | Aduro Biotech Holdings, Europe B.V. | Anti-sirp alpha antibodies |
WO2018191502A2 (en) | 2017-04-13 | 2018-10-18 | Agenus Inc. | Anti-cd137 antibodies and methods of use thereof |
WO2018191660A1 (en) | 2017-04-14 | 2018-10-18 | Genentech, Inc. | Diagnostic and therapeutic methods for cancer |
WO2018195472A1 (en) | 2017-04-21 | 2018-10-25 | Genentech, Inc. | Use of klk5 antagonists for treatment of a disease |
US10111951B2 (en) | 2013-09-06 | 2018-10-30 | Academia Sinica | Human iNKT cell activation using glycolipids with altered glycosyl groups |
WO2018198091A1 (en) | 2017-04-28 | 2018-11-01 | Novartis Ag | Antibody conjugates comprising toll-like receptor agonist and combination therapies |
WO2018201096A1 (en) | 2017-04-27 | 2018-11-01 | Tesaro, Inc. | Antibody agents directed against lymphocyte activation gene-3 (lag-3) and uses thereof |
WO2018200818A2 (en) | 2017-04-28 | 2018-11-01 | Millennium Pharmaceuticals, Inc. | Method of treating pediatric disorders |
US10118969B2 (en) | 2014-05-27 | 2018-11-06 | Academia Sinica | Compositions and methods relating to universal glycoforms for enhanced antibody efficacy |
US10119972B2 (en) | 2014-03-27 | 2018-11-06 | Academia Sinica | Reactive labelling compounds and uses thereof |
EP3398966A1 (en) | 2008-05-02 | 2018-11-07 | Acceleron Pharma, Inc. | Methods and compositions for modulating angiogenesis and pericyte composition |
WO2018204594A1 (en) | 2017-05-04 | 2018-11-08 | Acceleron Pharma Inc. | Tgf-beta receptor type ii fusion proteins and uses thereof |
WO2018204363A1 (en) | 2017-05-01 | 2018-11-08 | Agenus Inc. | Anti-tigit antibodies and methods of use thereof |
US10131713B2 (en) | 2008-04-02 | 2018-11-20 | Macrogenics, Inc. | HER2/neu-specific antibodies and methods of using same |
US10130714B2 (en) | 2012-04-14 | 2018-11-20 | Academia Sinica | Enhanced anti-influenza agents conjugated with anti-inflammatory activity |
WO2018213097A1 (en) | 2017-05-15 | 2018-11-22 | University Of Rochester | Broadly neutralizing anti-influenza monoclonal antibody and uses thereof |
WO2018215937A1 (en) | 2017-05-24 | 2018-11-29 | Novartis Ag | Interleukin-7 antibody cytokine engrafted proteins and methods of use in the treatment of cancer |
WO2018215936A1 (en) | 2017-05-24 | 2018-11-29 | Novartis Ag | Antibody-cytokine engrafted proteins and methods of use in the treatment of cancer |
WO2018215938A1 (en) | 2017-05-24 | 2018-11-29 | Novartis Ag | Antibody-cytokine engrafted proteins and methods of use |
WO2018218056A1 (en) | 2017-05-25 | 2018-11-29 | Birstol-Myers Squibb Company | Antibodies comprising modified heavy constant regions |
WO2018215935A1 (en) | 2017-05-24 | 2018-11-29 | Novartis Ag | Antibody-cytokine engrafted proteins and methods of use for immune related disorders |
WO2018220446A1 (en) | 2017-06-01 | 2018-12-06 | Compugen Ltd. | Triple combination antibody therapies |
US10150818B2 (en) | 2014-01-16 | 2018-12-11 | Academia Sinica | Compositions and methods for treatment and detection of cancers |
WO2018229706A1 (en) | 2017-06-16 | 2018-12-20 | Novartis Ag | Combination therapy for the treatment of cancer |
WO2018229715A1 (en) | 2017-06-16 | 2018-12-20 | Novartis Ag | Compositions comprising anti-cd32b antibodies and methods of use thereof |
WO2018229612A1 (en) | 2017-06-12 | 2018-12-20 | Novartis Ag | Method of manufacturing bispecific antibodies, bispecific antibodies and therapeutic use of such antibodies |
WO2018237097A1 (en) | 2017-06-20 | 2018-12-27 | Amgen Inc. | Method of treating or ameliorating metabolic disorders using binding proteins for gastric inhibitory peptide receptor (gipr) in combination with glp-1 agonists |
WO2018236904A1 (en) | 2017-06-19 | 2018-12-27 | Surface Oncology, Inc. | Combination of anti-cd47 antibodies and cell death-inducing agents, and uses thereof |
WO2018237335A1 (en) | 2017-06-23 | 2018-12-27 | VelosBio Inc. | Ror1 antibody immunoconjugates |
WO2019003104A1 (en) | 2017-06-28 | 2019-01-03 | Novartis Ag | Methods for preventing and treating urinary incontinence |
US10174124B2 (en) | 2013-12-17 | 2019-01-08 | Genentech, Inc. | Anti-CD3 antibodies and methods of use |
US10172875B2 (en) | 2015-09-17 | 2019-01-08 | Immunogen, Inc. | Therapeutic combinations comprising anti-FOLR1 immunoconjugates |
EP3424530A1 (en) | 2013-03-15 | 2019-01-09 | Zyngenia, Inc. | Multivalent and monovalent multispecific complexes and their uses |
EP3428190A1 (en) | 2014-02-12 | 2019-01-16 | F. Hoffmann-La Roche AG | Anti-jagged1 antibodies and methods of use |
WO2019018757A1 (en) | 2017-07-21 | 2019-01-24 | Genentech, Inc. | Therapeutic and diagnostic methods for cancer |
WO2019022187A1 (en) | 2017-07-27 | 2019-01-31 | 第一三共株式会社 | Anti-cd147 antibody |
WO2019023347A1 (en) | 2017-07-26 | 2019-01-31 | Forty Seven, Inc. | Anti-sirp-alpha antibodies and related methods |
WO2019033043A2 (en) | 2017-08-11 | 2019-02-14 | Genentech, Inc. | Anti-cd8 antibodies and uses thereof |
US10208129B2 (en) | 2010-12-06 | 2019-02-19 | National Research Council Of Canada | Antibodies selective for cells presenting ErbB2 at high density |
US10208120B2 (en) | 2014-11-05 | 2019-02-19 | Genentech, Inc. | Anti-FGFR2/3 antibodies and methods using same |
WO2019036605A2 (en) | 2017-08-17 | 2019-02-21 | Massachusetts Institute Of Technology | Multiple specificity binders of cxc chemokines and uses thereof |
US10214765B2 (en) | 2012-08-18 | 2019-02-26 | Academia Sinica | Cell-permeable probes for identification and imaging of sialidases |
WO2019040780A1 (en) | 2017-08-25 | 2019-02-28 | Five Prime Therapeutics Inc. | B7-h4 antibodies and methods of use thereof |
WO2019059411A1 (en) | 2017-09-20 | 2019-03-28 | Chugai Seiyaku Kabushiki Kaisha | Dosage regimen for combination therapy using pd-1 axis binding antagonists and gpc3 targeting agent |
WO2019065795A1 (en) | 2017-09-29 | 2019-04-04 | 中外製薬株式会社 | Multispecific antigen-binding molecule having blood coagulation factor viii (fviii) cofactor function-substituting activity, and pharmaceutical formulation containing said molecule as active ingredient |
WO2019065964A1 (en) | 2017-09-29 | 2019-04-04 | 第一三共株式会社 | Antibody-pyrrolobenzodiazepine derivative conjugate |
US10251952B2 (en) | 2014-06-26 | 2019-04-09 | Hoffmann-La Roche Inc. | Humanized anti-tau(pS422) antibody brain shuttles and use thereof |
WO2019075090A1 (en) | 2017-10-10 | 2019-04-18 | Tilos Therapeutics, Inc. | Anti-lap antibodies and uses thereof |
WO2019074983A1 (en) | 2017-10-10 | 2019-04-18 | Alpine Immune Sciences, Inc. | Ctla-4 variant immunomodulatory proteins and uses thereof |
WO2019077092A1 (en) | 2017-10-20 | 2019-04-25 | F. Hoffmann-La Roche Ag | Method for generating multispecific antibodies from monospecific antibodies |
WO2019079520A2 (en) | 2017-10-18 | 2019-04-25 | Alpine Immune Sciences, Inc. | Variant icos ligand immunomodulatory proteins and related compositions and methods |
US10274488B2 (en) | 2008-07-15 | 2019-04-30 | Academia Sinica | Glycan arrays on PTFE-like aluminum coated glass slides and related methods |
WO2019081983A1 (en) | 2017-10-25 | 2019-05-02 | Novartis Ag | Antibodies targeting cd32b and methods of use thereof |
US10279021B2 (en) | 2014-03-14 | 2019-05-07 | Dana-Faber Cancer Institute, Inc. | Vaccine compositions and methods for restoring NKG2D pathway function against cancers |
WO2019089753A2 (en) | 2017-10-31 | 2019-05-09 | Compass Therapeutics Llc | Cd137 antibodies and pd-1 antagonists and uses thereof |
WO2019090263A1 (en) | 2017-11-06 | 2019-05-09 | Genentech, Inc. | Diagnostic and therapeutic methods for cancer |
WO2019086362A1 (en) | 2017-10-30 | 2019-05-09 | F. Hoffmann-La Roche Ag | Method for in vivo generation of multispecific antibodies from monospecific antibodies |
WO2019100052A2 (en) | 2017-11-20 | 2019-05-23 | Compass Therapeutics Llc | Cd137 antibodies and tumor antigen-targeting antibodies and uses thereof |
US10302655B2 (en) | 2008-12-05 | 2019-05-28 | Glaxo Group Limited | Methods for selecting protease resistant polypeptides |
WO2019102353A1 (en) | 2017-11-22 | 2019-05-31 | Novartis Ag | Reversal binding agents for anti-factor xi/xia antibodies and uses thereof |
WO2019106578A2 (en) | 2017-12-01 | 2019-06-06 | Novartis Ag | Polyomavirus neutralizing antibodies |
US10317393B2 (en) | 2007-03-23 | 2019-06-11 | Academia Sinica | Alkynyl sugar analogs for labeling and visualization of glycoconjugates in cells |
WO2019110823A1 (en) | 2017-12-08 | 2019-06-13 | Argenx Bvba | Use of fcrn antagonists for treatment of generalized myasthenia gravis |
EP3502140A1 (en) | 2017-12-21 | 2019-06-26 | F. Hoffmann-La Roche AG | Combination therapy of tumor targeted icos agonists with t-cell bispecific molecules |
WO2019126133A1 (en) | 2017-12-20 | 2019-06-27 | Alexion Pharmaceuticals, Inc. | Liquid formulations of anti-cd200 antibodies |
WO2019126536A1 (en) | 2017-12-20 | 2019-06-27 | Alexion Pharmaceuticals Inc. | Humanized anti-cd200 antibodies and uses thereof |
WO2019126472A1 (en) | 2017-12-22 | 2019-06-27 | Genentech, Inc. | Use of pilra binding agents for treatment of a disease |
US10336784B2 (en) | 2016-03-08 | 2019-07-02 | Academia Sinica | Methods for modular synthesis of N-glycans and arrays thereof |
US10338069B2 (en) | 2010-04-12 | 2019-07-02 | Academia Sinica | Glycan arrays for high throughput screening of viruses |
WO2019129677A1 (en) | 2017-12-29 | 2019-07-04 | F. Hoffmann-La Roche Ag | Anti-vegf antibodies and methods of use |
WO2019129211A1 (en) | 2017-12-28 | 2019-07-04 | Nanjing Legend Biotech Co., Ltd. | Antibodies and variants thereof against pd-l1 |
US10344092B2 (en) | 2013-08-09 | 2019-07-09 | Macrogenics, Inc. | Bi-specific monovalent Fc diabodies that are capable of binding CD32B and CD79b and uses thereof |
US10342858B2 (en) | 2015-01-24 | 2019-07-09 | Academia Sinica | Glycan conjugates and methods of use thereof |
WO2019136179A1 (en) | 2018-01-03 | 2019-07-11 | Alpine Immune Sciences, Inc. | Multi-domain immunomodulatory proteins and methods of use thereof |
WO2019134981A1 (en) | 2018-01-05 | 2019-07-11 | Ac Immune Sa | Misfolded tdp-43 binding molecules |
WO2019140229A1 (en) | 2018-01-12 | 2019-07-18 | Bristol-Myers Squibb Company | Antibodies against tim3 and uses thereof |
EP3514174A1 (en) | 2015-06-29 | 2019-07-24 | Ventana Medical Systems, Inc. | Materials and methods for performing histochemical assays for human pro-epiregulin and amphiregulin |
EP3514178A1 (en) | 2013-03-15 | 2019-07-24 | Novartis AG | Antibody drug conjugates |
WO2019143636A1 (en) | 2018-01-16 | 2019-07-25 | Lakepharma, Inc. | Bispecific antibody that binds cd3 and another target |
WO2019148020A1 (en) | 2018-01-26 | 2019-08-01 | Genentech, Inc. | Compositions and methods of use |
WO2019148026A1 (en) | 2018-01-26 | 2019-08-01 | Genentech, Inc. | Il-22 fc fusion proteins and methods of use |
US10370455B2 (en) | 2014-12-05 | 2019-08-06 | Immunext, Inc. | Identification of VSIG8 as the putative VISTA receptor (V-R) and use thereof to produce VISTA/VSIG8 agonists and antagonists |
EP3520816A2 (en) | 2009-10-23 | 2019-08-07 | Millennium Pharmaceuticals, Inc. | Anti-gcc antibody molecules and related compositions and methods |
WO2019152642A1 (en) | 2018-02-01 | 2019-08-08 | Merck Sharp & Dohme Corp. | Anti-pd-1/lag3 bispecific antibodies |
EP3524626A1 (en) | 2007-03-22 | 2019-08-14 | Biogen MA Inc. | Binding proteins, including antibodies, antibody derivatives and antibody fragments, that specifically bind cd154 and uses thereof |
WO2019157308A1 (en) | 2018-02-08 | 2019-08-15 | Genentech, Inc. | Bispecific antigen-binding molecules and methods of use |
WO2019157358A1 (en) | 2018-02-09 | 2019-08-15 | Genentech, Inc. | Therapeutic and diagnostic methods for mast cell-mediated inflammatory diseases |
WO2019158645A1 (en) | 2018-02-14 | 2019-08-22 | Abba Therapeutics Ag | Anti-human pd-l2 antibodies |
WO2019165434A1 (en) | 2018-02-26 | 2019-08-29 | Genentech, Inc. | Dosing for treatment with anti-tigit and anti-pd-l1 antagonist antibodies |
WO2019165140A1 (en) | 2018-02-21 | 2019-08-29 | Genentech, Inc. | DOSING FOR TREATMENT WITH IL-22 Fc FUSION PROTEINS |
WO2019168403A2 (en) | 2018-03-02 | 2019-09-06 | Labo Bio-Medical Investments B.V. | Multispecific binding molecules for the prevention, treatment and diagnosis of neurodegenerative disorders |
WO2019172165A1 (en) | 2018-03-05 | 2019-09-12 | 学校法人埼玉医科大学 | Pharmaceutical composition for treating or preventing heterotopic ossification |
WO2019178269A2 (en) | 2018-03-14 | 2019-09-19 | Surface Oncology, Inc. | Antibodies that bind cd39 and uses thereof |
WO2019175071A1 (en) | 2018-03-13 | 2019-09-19 | F. Hoffmann-La Roche Ag | Therapeutic combination of 4-1 bb agonists with anti-cd20 antibodies |
WO2019178316A1 (en) | 2018-03-14 | 2019-09-19 | Genentech, Inc. | Anti-klk5 antibodies and methods of use |
WO2019183040A1 (en) | 2018-03-21 | 2019-09-26 | Five Prime Therapeutics, Inc. | ANTIBODIES BINDING TO VISTA AT ACIDIC pH |
US10428146B2 (en) | 2014-07-22 | 2019-10-01 | Cb Therapeutics, Inc. | Anti PD-1 antibodies |
WO2019191552A1 (en) | 2018-03-29 | 2019-10-03 | Genentech, Inc. | Modulating lactogenic activity in mammalian cells |
US10435470B2 (en) | 2014-08-05 | 2019-10-08 | Cb Therapeutics, Inc. | Anti-PD-L1 antibodies |
WO2019195514A1 (en) | 2018-04-04 | 2019-10-10 | Genentech, Inc. | Methods for detecting and quantifying fgf21 |
WO2019195126A1 (en) | 2018-04-02 | 2019-10-10 | Bristol-Myers Squibb Company | Anti-trem-1 antibodies and uses thereof |
EP3552631A1 (en) | 2018-04-10 | 2019-10-16 | Inatherys | Antibody-drug conjugates and their uses for the treatment of cancer |
WO2019200357A1 (en) | 2018-04-12 | 2019-10-17 | Surface Oncology, Inc. | Biomarker for cd47 targeting therapeutics and uses therefor |
WO2019197903A1 (en) | 2018-04-12 | 2019-10-17 | Mosaic Biomedicals Slu | Combination of lif inhibitors and pd-1 axis inhibitors for use in treating cancer |
WO2019202041A1 (en) | 2018-04-18 | 2019-10-24 | F. Hoffmann-La Roche Ag | Multispecific antibodies and use thereof |
WO2019202040A1 (en) | 2018-04-18 | 2019-10-24 | F. Hoffmann-La Roche Ag | Anti-hla-g antibodies and use thereof |
WO2019213384A1 (en) | 2018-05-03 | 2019-11-07 | University Of Rochester | Anti-influenza neuraminidase monoclonal antibodies and uses thereof |
WO2019214707A1 (en) | 2018-05-11 | 2019-11-14 | 信达生物制药(苏州)有限公司 | Preparations comprising anti-pcsk9 antibodies and use thereof |
WO2019220204A2 (en) | 2018-05-14 | 2019-11-21 | Mosaic Biomedicals Slu | Antibodies against lif and dosage forms thereof |
US10495645B2 (en) | 2015-01-16 | 2019-12-03 | Academia Sinica | Cancer markers and methods of use thereof |
WO2019229699A1 (en) | 2018-05-31 | 2019-12-05 | Novartis Ag | Hepatitis b antibodies |
WO2019229701A2 (en) | 2018-06-01 | 2019-12-05 | Novartis Ag | Binding molecules against bcma and uses thereof |
WO2019229658A1 (en) | 2018-05-30 | 2019-12-05 | Novartis Ag | Entpd2 antibodies, combination therapies, and methods of using the antibodies and combination therapies |
US10501521B2 (en) | 2012-12-21 | 2019-12-10 | Hoffmann-La Roche Inc. | Disulfide-linked multivalent MHC class I comprising multi-function proteins |
WO2019235426A1 (en) | 2018-06-04 | 2019-12-12 | 中外製薬株式会社 | Antigen-binding molecule showing changed half-life in cytoplasm |
WO2019241758A1 (en) | 2018-06-15 | 2019-12-19 | Alpine Immune Sciences, Inc. | Pd-1 variant immunomodulatory proteins and uses thereof |
WO2019246557A1 (en) | 2018-06-23 | 2019-12-26 | Genentech, Inc. | Methods of treating lung cancer with a pd-1 axis binding antagonist, a platinum agent, and a topoisomerase ii inhibitor |
WO2019243900A2 (en) | 2018-06-18 | 2019-12-26 | Mosaic Biomedicals Slu | Combination of lif inhibitors and platinum-based antineoplastic agents for use in treating cancer |
WO2020007817A1 (en) | 2018-07-04 | 2020-01-09 | F. Hoffmann-La Roche Ag | Novel bispecific agonistic 4-1bb antigen binding molecules |
EP3594240A1 (en) | 2013-05-20 | 2020-01-15 | F. Hoffmann-La Roche AG | Anti-transferrin receptor antibodies and methods of use |
WO2020014132A2 (en) | 2018-07-09 | 2020-01-16 | Five Prime Therapeutics, Inc. | Antibodies binding to ilt4 |
WO2020014327A2 (en) | 2018-07-11 | 2020-01-16 | Five Prime Therapeutics, Inc. | Antibodies binding to vista at acidic ph |
WO2020014306A1 (en) | 2018-07-10 | 2020-01-16 | Immunogen, Inc. | Met antibodies and immunoconjugates and uses thereof |
WO2020013170A1 (en) | 2018-07-10 | 2020-01-16 | 国立大学法人神戸大学 | ANTI-SIRPα ANTIBODY |
US10538592B2 (en) | 2016-08-22 | 2020-01-21 | Cho Pharma, Inc. | Antibodies, binding fragments, and methods of use |
WO2020018789A1 (en) | 2018-07-18 | 2020-01-23 | Genentech, Inc. | Methods of treating lung cancer with a pd-1 axis binding antagonist, an antimetabolite, and a platinum agent |
US10544225B2 (en) | 2014-07-03 | 2020-01-28 | Beigene, Ltd. | Anti-PD-L1 antibodies and their use as therapeutics and diagnostics |
WO2020027279A1 (en) | 2018-08-01 | 2020-02-06 | Chugai Seiyaku Kabushiki Kaisha | A pharmaceutical composition for use in the treatment or prevention of a c5-related disease and a method for treating or preventing a c5-related disease |
WO2020025703A1 (en) | 2018-08-01 | 2020-02-06 | Imcheck Therapeutics Sas | Anti-btn3a antibodies and their use in treating cancer or infectious disorders |
WO2020027330A1 (en) | 2018-08-03 | 2020-02-06 | 中外製薬株式会社 | Antigen-binding molecule containing two antigen-binding domains that are linked to each other |
EP3608674A1 (en) | 2018-08-09 | 2020-02-12 | Regeneron Pharmaceuticals, Inc. | Methods for assessing binding affinity of an antibody variant to the neonatal fc receptor |
WO2020033925A2 (en) | 2018-08-09 | 2020-02-13 | Compass Therapeutics Llc | Antibodies that bind cd277 and uses thereof |
WO2020033926A2 (en) | 2018-08-09 | 2020-02-13 | Compass Therapeutics Llc | Antibodies that bind cd277 and uses thereof |
WO2020033923A1 (en) | 2018-08-09 | 2020-02-13 | Compass Therapeutics Llc | Antigen binding agents that bind cd277 and uses thereof |
WO2020032230A1 (en) | 2018-08-10 | 2020-02-13 | 中外製薬株式会社 | Anti-cd137 antigen-binding molecule and utilization thereof |
EP3611188A1 (en) | 2014-11-06 | 2020-02-19 | F. Hoffmann-La Roche AG | Fc-region variants with modified fcrn-binding and methods of use |
WO2020037154A1 (en) | 2018-08-17 | 2020-02-20 | 23Andme, Inc. | Anti-il1rap antibodies and methods of use thereof |
WO2020050406A1 (en) | 2018-09-06 | 2020-03-12 | 第一三共株式会社 | Novel cyclic dinucleotide derivative and antibody-drug conjugate thereof |
WO2020049286A1 (en) | 2018-09-03 | 2020-03-12 | Femtogenix Limited | Polycyclic amides as cytotoxic agents |
WO2020056077A1 (en) | 2018-09-13 | 2020-03-19 | The Board Of Regents Of The University Of Texas System | Novel lilrb4 antibodies and uses thereof |
WO2020053742A2 (en) | 2018-09-10 | 2020-03-19 | Novartis Ag | Anti-hla-hbv peptide antibodies |
WO2020061349A1 (en) | 2018-09-21 | 2020-03-26 | Genentech, Inc. | Diagnostic methods for triple-negative breast cancer |
WO2020061060A1 (en) | 2018-09-19 | 2020-03-26 | Genentech, Inc. | Therapeutic and diagnostic methods for bladder cancer |
WO2020061376A2 (en) | 2018-09-19 | 2020-03-26 | Alpine Immune Sciences, Inc. | Methods and uses of variant cd80 fusion proteins and related constructs |
US10604577B2 (en) | 2015-10-22 | 2020-03-31 | Allakos Inc. | Methods and compositions for treating systemic mastocytosis |
US10604561B2 (en) | 2016-09-16 | 2020-03-31 | Chugai Seiyaku Kabushiki Kaisha | Anti-dengue virus antibodies, polypeptides containing variant Fc regions, and methods of use |
US10611825B2 (en) | 2011-02-28 | 2020-04-07 | Hoffmann La-Roche Inc. | Monovalent antigen binding proteins |
WO2020070035A1 (en) | 2018-10-01 | 2020-04-09 | F. Hoffmann-La Roche Ag | Bispecific antigen binding molecules with trivalent binding to cd40 |
WO2020070041A1 (en) | 2018-10-01 | 2020-04-09 | F. Hoffmann-La Roche Ag | Bispecific antigen binding molecules comprising anti-fap clone 212 |
WO2020076969A2 (en) | 2018-10-10 | 2020-04-16 | Tilos Therapeutics, Inc. | Anti-lap antibody variants and uses thereof |
WO2020081493A1 (en) | 2018-10-16 | 2020-04-23 | Molecular Templates, Inc. | Pd-l1 binding proteins |
WO2020079580A1 (en) | 2018-10-15 | 2020-04-23 | Novartis Ag | Trem2 stabilizing antibodies |
WO2020081767A1 (en) | 2018-10-18 | 2020-04-23 | Genentech, Inc. | Diagnostic and therapeutic methods for sarcomatoid kidney cancer |
US10633457B2 (en) | 2014-12-03 | 2020-04-28 | Hoffmann-La Roche Inc. | Multispecific antibodies |
US10640564B2 (en) | 2014-10-17 | 2020-05-05 | Ichnos Sciences SA | Antibodies that bind to CCR6 and their uses |
US10640555B2 (en) | 2009-06-16 | 2020-05-05 | Hoffmann-La Roche Inc. | Bispecific antigen binding proteins |
WO2020089811A1 (en) | 2018-10-31 | 2020-05-07 | Novartis Ag | Dc-sign antibody drug conjugates |
WO2020095922A1 (en) | 2018-11-07 | 2020-05-14 | 第一三共株式会社 | Method of improving blood kinetics of peptide |
WO2020096959A1 (en) | 2018-11-05 | 2020-05-14 | Genentech, Inc. | Methods of producing two chain proteins in prokaryotic host cells |
WO2020102555A1 (en) | 2018-11-16 | 2020-05-22 | Memorial Sloan Kettering Cancer Center | Antibodies to mucin-16 and methods of use thereof |
WO2020108530A1 (en) | 2018-11-27 | 2020-06-04 | 信达生物制药(苏州)有限公司 | Anti-il-23p19 antibody and uses thereof |
WO2020113141A2 (en) | 2018-11-30 | 2020-06-04 | Alpine Immune Sciences, Inc. | Cd86 variant immunomodulatory proteins and uses thereof |
WO2020112781A1 (en) | 2018-11-28 | 2020-06-04 | Bristol-Myers Squibb Company | Antibodies comprising modified heavy constant regions |
EP3662930A1 (en) | 2015-09-24 | 2020-06-10 | AbVitro LLC | Hiv antibody compositions and methods of use |
WO2020117257A1 (en) | 2018-12-06 | 2020-06-11 | Genentech, Inc. | Combination therapy of diffuse large b-cell lymphoma comprising an anti-cd79b immunoconjugates, an alkylating agent and an anti-cd20 antibody |
WO2020117952A2 (en) | 2018-12-05 | 2020-06-11 | Genentech, Inc. | Diagnostic methods and compositions for cancer immunotherapy |
WO2020118011A1 (en) | 2018-12-06 | 2020-06-11 | Alexion Pharmaceuticals, Inc. | Anti-alk2 antibodies and uses thereof |
WO2020123275A1 (en) | 2018-12-10 | 2020-06-18 | Genentech, Inc. | Photocrosslinking peptides for site specific conjugation to fc-containing proteins |
WO2020121059A1 (en) | 2018-12-14 | 2020-06-18 | Northern Biologics Inc. | Anti-periostin antibodies and uses thereof |
WO2020132231A1 (en) | 2018-12-21 | 2020-06-25 | Genentech, Inc. | Methods of producing polypeptides using a cell line resistant to apoptosis |
WO2020128612A2 (en) | 2018-12-21 | 2020-06-25 | Novartis Ag | Antibodies to pmel17 and conjugates thereof |
WO2020127873A1 (en) | 2018-12-21 | 2020-06-25 | F. Hoffmann-La Roche Ag | Antibody that binds to vegf and il-1beta and methods of use |
WO2020132220A1 (en) | 2018-12-21 | 2020-06-25 | 23Andme, Inc. | Anti-il-36 antibodies and methods of use thereof |
WO2020128863A1 (en) | 2018-12-19 | 2020-06-25 | Novartis Ag | Anti-tnf-alpha antibodies |
WO2020132230A2 (en) | 2018-12-20 | 2020-06-25 | Genentech, Inc. | Modified antibody fcs and methods of use |
WO2020132034A1 (en) | 2018-12-20 | 2020-06-25 | 23Andme, Inc. | Anti-cd96 antibodies and methods of use thereof |
WO2020139920A2 (en) | 2018-12-26 | 2020-07-02 | City Of Hope | Activatable masked anti-ctla4 binding proteins |
WO2020141145A1 (en) | 2018-12-30 | 2020-07-09 | F. Hoffmann-La Roche Ag | Anti-rabbit cd19 antibodies and methods of use |
US10717778B2 (en) | 2014-09-29 | 2020-07-21 | Duke University | Bispecific molecules comprising an HIV-1 envelope targeting arm |
WO2020150496A1 (en) | 2019-01-16 | 2020-07-23 | Compass Therapeutics Llc | Formulations of antibodies that bind human cd137 and uses thereof |
WO2020148207A1 (en) | 2019-01-14 | 2020-07-23 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Human monoclonal antibodies binding to hla-a2 |
WO2020150152A1 (en) | 2019-01-14 | 2020-07-23 | Genentech, Inc. | Methods of treating cancer with a pd-1 axis binding antagonist and an rna vaccine |
WO2020153467A1 (en) | 2019-01-24 | 2020-07-30 | 中外製薬株式会社 | Novel cancer antigens and antibodies of said antigens |
WO2020154293A1 (en) | 2019-01-22 | 2020-07-30 | Bristol-Myers Squibb Company | Antibodies against il-7r alpha subunit and uses thereof |
WO2020154405A2 (en) | 2019-01-22 | 2020-07-30 | Genentech, Inc. | Immunoglobulin a antibodies and methods of production and use |
WO2020154410A1 (en) | 2019-01-23 | 2020-07-30 | Genentech, Inc. | Methods of producing multimeric proteins in eukaryotic host cells |
EP3689910A2 (en) | 2014-09-23 | 2020-08-05 | F. Hoffmann-La Roche AG | Method of using anti-cd79b immunoconjugates |
WO2020157491A1 (en) | 2019-01-29 | 2020-08-06 | Femtogenix Limited | G-a crosslinking cytotoxic agents |
US10745467B2 (en) | 2010-03-26 | 2020-08-18 | The Trustees Of Dartmouth College | VISTA-Ig for treatment of autoimmune, allergic and inflammatory disorders |
WO2020176748A1 (en) | 2019-02-27 | 2020-09-03 | Genentech, Inc. | Dosing for treatment with anti-tigit and anti-cd20 or anti-cd38 antibodies |
US10768174B2 (en) | 2014-12-23 | 2020-09-08 | Bluelight Therapeutics, Inc. | Attachment of proteins to interfaces for use in nonlinear optical detection |
US10767232B2 (en) | 2014-11-03 | 2020-09-08 | Genentech, Inc. | Methods and biomarkers for predicting efficacy and evaluation of an OX40 agonist treatment |
EP3705498A1 (en) | 2013-08-22 | 2020-09-09 | Acceleron Pharma Inc. | Tgf-beta receptor type ii variants and uses thereof |
US10774145B2 (en) | 2015-06-17 | 2020-09-15 | Allakos Inc. | Methods and compositions for treating fibrotic diseases |
WO2020185535A1 (en) | 2019-03-08 | 2020-09-17 | Genentech, Inc. | Methods for detecting and quantifying membrane-associated proteins on extracellular vesicles |
WO2020186176A1 (en) | 2019-03-14 | 2020-09-17 | Genentech, Inc. | Treatment of cancer with her2xcd3 bispecific antibodies in combination with anti-her2 mab |
US10781254B2 (en) | 2010-03-26 | 2020-09-22 | The Trustees Of Dartmouth College | VISTA regulatory T cell mediator protein, VISTA binding agents and use thereof |
WO2020196474A1 (en) | 2019-03-25 | 2020-10-01 | 第一三共株式会社 | Antibody-pyrrolobenzodiazepine derivative conjugate |
WO2020196712A1 (en) | 2019-03-27 | 2020-10-01 | 第一三共株式会社 | Combination of antibody-pyrrolobenzodiazepine derivative conjugate and parp inhibitor |
US10793633B2 (en) | 2011-09-30 | 2020-10-06 | Dana-Farber Cancer Institute, Inc. | Therapeutic peptides |
US10793621B2 (en) | 2011-02-28 | 2020-10-06 | Hoffmann-La Roche Inc. | Nucleic acid encoding dual Fc antigen binding proteins |
WO2020208177A1 (en) | 2019-04-11 | 2020-10-15 | Argenx Bvba | ANTI-IgE ANTIBODIES |
WO2020210358A1 (en) | 2019-04-08 | 2020-10-15 | Biogen Ma Inc. | Anti-integrin antibodies and uses thereof |
WO2020213724A1 (en) | 2019-04-19 | 2020-10-22 | 中外製薬株式会社 | Chimeric receptor recognizing modification site of antibody |
WO2020214867A1 (en) | 2019-04-17 | 2020-10-22 | Alpine Immune Sciences, Inc. | Methods and uses of variant icos ligand (icosl) fusion proteins |
WO2020214995A1 (en) | 2019-04-19 | 2020-10-22 | Genentech, Inc. | Anti-mertk antibodies and their methods of use |
US10822402B2 (en) | 2015-06-24 | 2020-11-03 | Hoffmann-La Roche Inc. | Humanized anti-tau(pS422) antibodies and methods of use |
EP3733244A1 (en) | 2013-10-02 | 2020-11-04 | Medlmmune, LLC | Neutralizing anti-influenza a antibodies and uses thereof |
WO2020226986A2 (en) | 2019-05-03 | 2020-11-12 | Genentech, Inc. | Methods of treating cancer with an anti-pd-l1 antibody |
US10836830B2 (en) | 2015-12-02 | 2020-11-17 | Agenus Inc. | Antibodies and methods of use thereof |
WO2020232169A1 (en) | 2019-05-14 | 2020-11-19 | Genentech, Inc. | Methods of using anti-cd79b immunoconjugates to treat follicular lymphoma |
WO2020236841A2 (en) | 2019-05-20 | 2020-11-26 | Novartis Ag | Antibody drug conjugates having linkers comprising hydrophilic groups |
WO2020236817A2 (en) | 2019-05-20 | 2020-11-26 | Novartis Ag | Mcl-1 inhibitor antibody-drug conjugates and methods of use |
WO2020236792A1 (en) | 2019-05-21 | 2020-11-26 | Novartis Ag | Cd19 binding molecules and uses thereof |
WO2020236797A1 (en) | 2019-05-21 | 2020-11-26 | Novartis Ag | Variant cd58 domains and uses thereof |
WO2020234473A1 (en) | 2019-05-23 | 2020-11-26 | Ac Immune Sa | Anti-tdp-43 binding molecules and uses thereof |
WO2020236795A2 (en) | 2019-05-21 | 2020-11-26 | Novartis Ag | Trispecific binding molecules against bcma and uses thereof |
US10864203B2 (en) | 2016-07-05 | 2020-12-15 | Beigene, Ltd. | Combination of a PD-1 antagonist and a RAF inhibitor for treating cancer |
WO2020250159A1 (en) | 2019-06-12 | 2020-12-17 | Novartis Ag | Natriuretic peptide receptor 1 antibodies and methods of use |
WO2020260326A1 (en) | 2019-06-27 | 2020-12-30 | F. Hoffmann-La Roche Ag | Novel icos antibodies and tumor-targeted antigen binding molecules comprising them |
WO2020263830A1 (en) | 2019-06-25 | 2020-12-30 | Gilead Sciences, Inc. | Flt3l-fc fusion proteins and methods of use |
WO2021009047A1 (en) | 2019-07-12 | 2021-01-21 | F. Hoffmann-La Roche Ag | Antibodies which bind to cancer cells and target radionuclides to said cells |
WO2021009263A1 (en) | 2019-07-16 | 2021-01-21 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Antibodies having specificity for cd38 and uses thereof |
WO2021011678A1 (en) | 2019-07-15 | 2021-01-21 | Bristol-Myers Squibb Company | Anti-trem-1 antibodies and uses thereof |
WO2021011681A1 (en) | 2019-07-15 | 2021-01-21 | Bristol-Myers Squibb Company | Antibodies against human trem-1 and uses thereof |
WO2021010326A1 (en) | 2019-07-12 | 2021-01-21 | 中外製薬株式会社 | Anti-mutation type fgfr3 antibody and use therefor |
US10899836B2 (en) | 2016-02-12 | 2021-01-26 | Janssen Pharmaceutica Nv | Method of identifying anti-VISTA antibodies |
WO2021014389A1 (en) | 2019-07-24 | 2021-01-28 | H. Lundbeck A/S | Anti-mglur5 antibodies and uses thereof |
WO2021019036A1 (en) | 2019-07-31 | 2021-02-04 | F. Hoffmann-La Roche Ag | Dosage and administration regimen for the treatment or prevention of c5-related diseases by the use of the anti-c5 antibody crovalimab |
WO2021020282A1 (en) | 2019-07-26 | 2021-02-04 | 学校法人埼玉医科大学 | Antibody recognizing extracellular region of alk2/acvr1 |
WO2021021837A2 (en) | 2019-07-29 | 2021-02-04 | Compugen Ltd. | Anti-pvrig antibodies formulations and uses thereof |
WO2021019033A1 (en) | 2019-07-31 | 2021-02-04 | F. Hoffmann-La Roche Ag | Dosage and administration regimen for the treatment or prevention of c5-related diseases by the use of the anti-c5 antibody crovalimab |
WO2021024209A1 (en) | 2019-08-06 | 2021-02-11 | Aprinoia Therapeutics Inc. | Antibodies that bind to pathological tau species and uses thereof |
WO2021030488A1 (en) | 2019-08-12 | 2021-02-18 | Bienvenue David Leonard | 4-1bb and ox40 binding proteins and related compositions and methods, antibodies against 4-1bb, antibodies against ox40 |
EP3783029A1 (en) | 2015-05-12 | 2021-02-24 | F. Hoffmann-La Roche AG | Therapeutic and diagnostic methods for cancer |
EP3782654A1 (en) | 2014-09-12 | 2021-02-24 | Genentech, Inc. | Anti-her2 antibodies and immunoconjugates |
US10933115B2 (en) | 2012-06-22 | 2021-03-02 | The Trustees Of Dartmouth College | VISTA antagonist and methods of use |
WO2021042019A1 (en) | 2019-08-30 | 2021-03-04 | Agenus Inc. | Anti-cd96 antibodies and methods of use thereof |
EP3789399A1 (en) | 2014-11-21 | 2021-03-10 | Bristol-Myers Squibb Company | Antibodies comprising modified heavy constant regions |
WO2021050645A1 (en) | 2019-09-12 | 2021-03-18 | Genentech, Inc. | Compositions and methods of treating lupus nephritis |
WO2021053560A1 (en) | 2019-09-18 | 2021-03-25 | Novartis Ag | Combination therapy with entpd2 and cd73 antibodies |
WO2021053559A1 (en) | 2019-09-18 | 2021-03-25 | Novartis Ag | Entpd2 antibodies, combination therapies, and methods of using the antibodies and combination therapies |
WO2021055698A1 (en) | 2019-09-19 | 2021-03-25 | Bristol-Myers Squibb Company | Antibodies binding to vista at acidic ph |
WO2021055577A2 (en) | 2019-09-18 | 2021-03-25 | Genentech, Inc. | Anti-klk7 antibodies, anti-klk5 antibodies, multispecific anti-klk5/klk7 antibodies, and methods of use |
WO2021055694A1 (en) | 2019-09-20 | 2021-03-25 | Genentech, Inc. | Dosing for anti-tryptase antibodies |
US10961311B2 (en) | 2016-04-15 | 2021-03-30 | Macrogenics, Inc. | B7-H3 binding molecules, antibody drug conjugates thereof and methods of use thereof |
WO2021062085A1 (en) | 2019-09-27 | 2021-04-01 | Genentech, Inc. | Dosing for treatment with anti-tigit and anti-pd-l1 antagonist antibodies |
WO2021062244A1 (en) | 2019-09-25 | 2021-04-01 | Surface Oncology, Inc. | Anti-il-27 antibodies and uses thereof |
US10968273B2 (en) | 2010-04-05 | 2021-04-06 | Fundacio Privada Institut D'investigacio Oncologica Vall D'hebron (Vhio) | Antibody recognizing human leukemia inhibitory factor (LIF) and use of anti-LIF antibodies in the treatment of diseases associated with unwanted cell proliferation |
WO2021070181A1 (en) | 2019-10-08 | 2021-04-15 | Nectin Therapeutics Ltd. | Antibodies against the poliovirus receptor (pvr) and uses thereof |
WO2021076196A1 (en) | 2019-10-18 | 2021-04-22 | Genentech, Inc. | Methods of using anti-cd79b immunoconjugates to treat diffuse large b-cell lymphoma |
WO2021080682A1 (en) | 2019-10-24 | 2021-04-29 | Massachusetts Institute Of Technology | Monoclonal antibodies that bind human cd161 and uses thereof |
WO2021091605A1 (en) | 2019-11-04 | 2021-05-14 | Compugen Ltd. | Combination therapy with anti-pvrig antibodies formulations and anti-pd-1 antibodies |
WO2021092171A1 (en) | 2019-11-06 | 2021-05-14 | Genentech, Inc. | Diagnostic and therapeutic methods for treatment of hematologic cancers |
US11009509B2 (en) | 2015-06-24 | 2021-05-18 | Janssen Pharmaceutica Nv | Anti-VISTA antibodies and fragments |
US11014987B2 (en) | 2013-12-24 | 2021-05-25 | Janssen Pharmaceutics Nv | Anti-vista antibodies and fragments, uses thereof, and methods of identifying same |
WO2021110873A1 (en) | 2019-12-04 | 2021-06-10 | Medimmune Limited | Antibodies against lif and uses thereof |
WO2021116119A1 (en) | 2019-12-09 | 2021-06-17 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Antibodies having specificity to her4 and uses thereof |
WO2021119505A1 (en) | 2019-12-13 | 2021-06-17 | Genentech, Inc. | Anti-ly6g6d antibodies and methods of use |
EP3842457A1 (en) | 2015-09-09 | 2021-06-30 | Novartis AG | Thymic stromal lymphopoietin (tslp)-binding molecules and methods of using the molecules |
EP3842453A1 (en) | 2014-11-06 | 2021-06-30 | F. Hoffmann-La Roche AG | Fc-region variants with modified fcrn- and protein a-binding properties |
WO2021131021A1 (en) | 2019-12-27 | 2021-07-01 | 中外製薬株式会社 | Anti-ctla-4 antibody and use thereof |
WO2021129872A1 (en) | 2019-12-27 | 2021-07-01 | 高诚生物医药(香港)有限公司 | Anti-ox40 antibody and use thereof |
US11053294B2 (en) | 2018-09-27 | 2021-07-06 | Xilio Development, Inc. | Masked cytokine polypeptides |
US11053308B2 (en) | 2016-08-05 | 2021-07-06 | Chugai Seiyaku Kabushiki Kaisha | Method for treating IL-8-related diseases |
WO2021142002A1 (en) | 2020-01-06 | 2021-07-15 | Vaccinex, Inc. | Anti-ccr8 antibodies and uses thereof |
WO2021140202A1 (en) | 2020-01-08 | 2021-07-15 | argenx BV | Methods for treating pemphigus disorders |
WO2021139777A1 (en) | 2020-01-10 | 2021-07-15 | 上海复宏汉霖生物技术股份有限公司 | Anti-tigit antibodies and usage method |
EP3851118A1 (en) | 2013-10-25 | 2021-07-21 | Acceleron Pharma Inc. | Endoglin peptides to treat fibrotic diseases |
WO2021155149A1 (en) | 2020-01-31 | 2021-08-05 | Genentech, Inc. | Methods of inducing neoepitope-specific t cells with a pd-1 axis binding antagonist and an rna vaccine |
EP3862365A1 (en) | 2016-01-08 | 2021-08-11 | F. Hoffmann-La Roche AG | Methods of treating cea-positive cancers using pd-1 axis binding antagonists and anti-cea/anti-cd3 bispecific antibodies |
WO2021162020A1 (en) | 2020-02-12 | 2021-08-19 | 中外製薬株式会社 | Anti-cd137 antigen-binding molecule for use in cancer treatment |
WO2021173844A1 (en) | 2020-02-26 | 2021-09-02 | Biograph 55, Inc. | C19 c38 bispecific antibodies |
WO2021170071A1 (en) | 2020-02-28 | 2021-09-02 | Shanghai Henlius Biotech, Inc. | Anti-cd137 constructs, multispecific antibody and uses thereof |
WO2021170067A1 (en) | 2020-02-28 | 2021-09-02 | 上海复宏汉霖生物技术股份有限公司 | Anti-cd137 construct and use thereof |
WO2021176424A1 (en) | 2020-03-06 | 2021-09-10 | Ona Therapeutics, S.L. | Anti-cd36 antibodies and their use to treat cancer |
WO2021175954A1 (en) | 2020-03-04 | 2021-09-10 | Imcheck Therapeutics Sas | Antibodies having specificity for btnl8 and uses thereof |
WO2021177438A1 (en) | 2020-03-06 | 2021-09-10 | 第一三共株式会社 | Antibody-drug conjugate including novel cyclic dinucleotide derivative |
EP3878866A1 (en) | 2013-04-29 | 2021-09-15 | F. Hoffmann-La Roche AG | Fc-receptor binding modified asymmetric antibodies and methods of use |
WO2021183207A1 (en) | 2020-03-10 | 2021-09-16 | Massachusetts Institute Of Technology | COMPOSITIONS AND METHODS FOR IMMUNOTHERAPY OF NPM1c-POSITIVE CANCER |
WO2021180205A1 (en) | 2020-03-13 | 2021-09-16 | 江苏恒瑞医药股份有限公司 | Pvrig binding protein and its medical uses |
WO2021183849A1 (en) | 2020-03-13 | 2021-09-16 | Genentech, Inc. | Anti-interleukin-33 antibodies and uses thereof |
US11123426B2 (en) | 2014-06-11 | 2021-09-21 | The Trustees Of Dartmouth College | Use of vista agonists and antagonists to suppress or enhance humoral immunity |
WO2021188749A1 (en) | 2020-03-19 | 2021-09-23 | Genentech, Inc. | Isoform-selective anti-tgf-beta antibodies and methods of use |
WO2021195464A2 (en) | 2020-03-26 | 2021-09-30 | Genentech, Inc. | Modified mammalian cells |
WO2021194481A1 (en) | 2020-03-24 | 2021-09-30 | Genentech, Inc. | Dosing for treatment with anti-tigit and anti-pd-l1 antagonist antibodies |
WO2021195513A1 (en) | 2020-03-27 | 2021-09-30 | Novartis Ag | Bispecific combination therapy for treating proliferative diseases and autoimmune disorders |
WO2021194913A1 (en) | 2020-03-24 | 2021-09-30 | Genentech, Inc. | Tie2-binding agents and methods of use |
WO2021202235A1 (en) | 2020-04-01 | 2021-10-07 | University Of Rochester | Monoclonal antibodies against the hemagglutinin (ha) and neuraminidase (na) of influenza h3n2 viruses |
WO2021198034A1 (en) | 2020-03-30 | 2021-10-07 | F. Hoffmann-La Roche Ag | Antibody that binds to vegf and pdgf-b and methods of use |
WO2021198335A1 (en) | 2020-04-01 | 2021-10-07 | F. Hoffmann-La Roche Ag | Bispecific antibodies comprising a modified c-terminal crossfab fragment |
WO2021202959A1 (en) | 2020-04-03 | 2021-10-07 | Genentech, Inc. | Therapeutic and diagnostic methods for cancer |
WO2021207662A1 (en) | 2020-04-10 | 2021-10-14 | Genentech, Inc. | Use of il-22fc for the treatment or prevention of pneumonia, acute respiratory distress syndrome, or cytokine release syndrome |
WO2021207449A1 (en) | 2020-04-09 | 2021-10-14 | Merck Sharp & Dohme Corp. | Affinity matured anti-lap antibodies and uses thereof |
US11149088B2 (en) | 2016-04-15 | 2021-10-19 | Bioatla, Inc. | Anti-Axl antibodies, antibody fragments and their immunoconjugates and uses thereof |
EP3896091A1 (en) | 2015-08-11 | 2021-10-20 | Legend Biotech Ireland Limited | Chimeric antigen receptors targeting bcma and methods of use thereof |
WO2021217051A1 (en) | 2020-04-24 | 2021-10-28 | Genentech, Inc. | Methods of using anti-cd79b immunoconjugates |
WO2021214277A1 (en) | 2020-04-24 | 2021-10-28 | F. Hoffmann-La Roche Ag | Enzyme and pathway modulation with sulfhydryl compounds and their derivatives |
WO2021222935A2 (en) | 2020-04-28 | 2021-11-04 | The Rockefeller University | Neutralizing anti-sars-cov-2 antibodies and methods of use thereof |
WO2021220199A1 (en) | 2020-04-30 | 2021-11-04 | Novartis Ag | Ccr7 antibody drug conjugates for treating cancer |
WO2021219871A2 (en) | 2020-04-30 | 2021-11-04 | Aduro Biotech Holdings, Europe B.V. | Anti-cd103 antibodies |
WO2021222167A1 (en) | 2020-04-28 | 2021-11-04 | Genentech, Inc. | Methods and compositions for non-small cell lung cancer immunotherapy |
WO2021226551A1 (en) | 2020-05-08 | 2021-11-11 | Alpine Immune Sciences, Inc. | April and baff inhibitory immunomodulatory proteins and methods of use thereof |
WO2021225892A1 (en) | 2020-05-03 | 2021-11-11 | Levena (Suzhou) Biopharma Co., Ltd. | Antibody-drug conjugates (adcs) comprising an anti-trop-2 antibody, compositions comprising such adcs, as well as methods of making and using the same |
WO2021228956A1 (en) | 2020-05-12 | 2021-11-18 | INSERM (Institut National de la Santé et de la Recherche Médicale) | New method to treat cutaneous t-cell lymphomas and tfh derived lymphomas |
US11180557B2 (en) | 2012-06-22 | 2021-11-23 | King's College London | Vista modulators for diagnosis and treatment of cancer |
WO2021233834A1 (en) | 2020-05-17 | 2021-11-25 | Astrazeneca Uk Limited | Sars-cov-2 antibodies and methods of selecting and using the same |
WO2021234160A2 (en) | 2020-05-22 | 2021-11-25 | Formycon Ag | Ace2 fusion proteins and uses thereof |
WO2021238886A1 (en) | 2020-05-27 | 2021-12-02 | Staidson (Beijing) Biopharmaceuticals Co., Ltd. | Antibodies specifically recognizing nerve growth factor and uses thereof |
WO2021243204A1 (en) | 2020-05-29 | 2021-12-02 | 23Andme, Inc. | Anti-cd200r1 antibodies and methods of use thereof |
WO2021247769A1 (en) | 2020-06-02 | 2021-12-09 | Dynamicure Biotechnology Llc | Anti-cd93 constructs and uses thereof |
EP3922649A1 (en) | 2015-10-30 | 2021-12-15 | F. Hoffmann-La Roche AG | Anti-htra1 antibodies and methods of use thereof |
WO2021249990A2 (en) | 2020-06-08 | 2021-12-16 | Hoffmann-La Roche Inc. | Anti-hbv antibodies and methods of use |
WO2021252977A1 (en) | 2020-06-12 | 2021-12-16 | Genentech, Inc. | Methods and compositions for cancer immunotherapy |
US11203638B2 (en) | 2017-05-05 | 2021-12-21 | Allakos Inc. | Methods and compositions for treating perennial allergic conjunctivitis and keratoconjunctivitis |
WO2021257503A1 (en) | 2020-06-16 | 2021-12-23 | Genentech, Inc. | Methods and compositions for treating triple-negative breast cancer |
WO2021257124A1 (en) | 2020-06-18 | 2021-12-23 | Genentech, Inc. | Treatment with anti-tigit antibodies and pd-1 axis binding antagonists |
WO2021259199A1 (en) | 2020-06-22 | 2021-12-30 | 信达生物制药(苏州)有限公司 | Anti-cd73 antibody and use thereof |
WO2021259880A1 (en) | 2020-06-22 | 2021-12-30 | Almirall, S.A. | Anti-il-36 antibodies and methods of use thereof |
WO2021262791A1 (en) | 2020-06-25 | 2021-12-30 | Merck Sharp & Dohme Corp. | High affinity antibodies targeting tau phosphorylated at serine 413 |
WO2021262783A1 (en) | 2020-06-24 | 2021-12-30 | Genentech, Inc. | Apoptosis resistant cell lines |
US11214619B2 (en) | 2018-07-20 | 2022-01-04 | Surface Oncology, Inc. | Anti-CD112R compositions and methods |
EP3936524A2 (en) | 2015-05-11 | 2022-01-12 | F. Hoffmann-La Roche AG | Compositions and methods of treating lupus nephritis |
WO2022008688A1 (en) | 2020-07-10 | 2022-01-13 | F. Hoffmann-La Roche Ag | Antibodies which bind to cancer cells and target radionuclides to said cells |
WO2022016037A1 (en) | 2020-07-17 | 2022-01-20 | Genentech, Inc. | Anti-notch2 antibodies and methods of use |
WO2022026763A1 (en) | 2020-07-29 | 2022-02-03 | Dynamicure Biotechnology Llc | Anti-cd93 constructs and uses thereof |
WO2022023735A1 (en) | 2020-07-28 | 2022-02-03 | Femtogenix Limited | Cytotoxic agents |
US11242392B2 (en) | 2013-12-24 | 2022-02-08 | Janssen Pharmaceutica Nv | Anti-vista antibodies and fragments |
US11242393B2 (en) | 2018-03-23 | 2022-02-08 | Bristol-Myers Squibb Company | Antibodies against MICA and/or MICB and uses thereof |
WO2022031749A1 (en) | 2020-08-03 | 2022-02-10 | Genentech, Inc. | Diagnostic and therapeutic methods for lymphoma |
WO2022031978A1 (en) | 2020-08-06 | 2022-02-10 | Bioverativ Usa Inc. | Inflammatory cytokines and fatigue in subject with a complement mediated disease |
WO2022034044A1 (en) | 2020-08-10 | 2022-02-17 | Astrazeneca Uk Limited | Sars-cov-2 antibodies for treatment and prevention of covid-19 |
US11254748B2 (en) | 2005-04-15 | 2022-02-22 | Macrogenics, Inc. | Covalent diabodies and uses thereof |
WO2022043517A2 (en) | 2020-08-27 | 2022-03-03 | Cureab Gmbh | Anti-golph2 antibodies for macrophage and dendritic cell differentiation |
WO2022046644A1 (en) | 2020-08-25 | 2022-03-03 | Gilead Sciences, Inc. | Multi-specific antigen binding molecules targeting hiv and methods of use |
WO2022047222A2 (en) | 2020-08-28 | 2022-03-03 | Genentech, Inc. | Crispr/cas9 multiplex knockout of host cell proteins |
WO2022049165A1 (en) | 2020-09-04 | 2022-03-10 | F. Hoffmann-La Roche Ag | Antibody that binds to vegf-a and ang2 and methods of use |
WO2022050954A1 (en) | 2020-09-04 | 2022-03-10 | Genentech, Inc. | Dosing for treatment with anti-tigit and anti-pd-l1 antagonist antibodies |
US11274157B2 (en) | 2017-01-12 | 2022-03-15 | Eureka Therapeutics, Inc. | Constructs targeting histone H3 peptide/MHC complexes and uses thereof |
WO2022053715A1 (en) | 2020-09-14 | 2022-03-17 | Ichnos Sciences SA | Antibodies that bind to il1rap and uses thereof |
US11286300B2 (en) | 2015-10-01 | 2022-03-29 | Hoffmann-La Roche Inc. | Humanized anti-human CD19 antibodies and methods of use |
WO2022067262A1 (en) | 2020-09-28 | 2022-03-31 | Dynamicure Biotechnology Llc | Anti-cd93 constructs and uses thereof |
WO2022076462A1 (en) | 2020-10-05 | 2022-04-14 | Genentech, Inc. | Dosing for treatment with anti-fcrh5/anti-cd3 bispecific antibodies |
WO2022086957A1 (en) | 2020-10-20 | 2022-04-28 | Genentech, Inc. | Peg-conjugated anti-mertk antibodies and methods of use |
WO2022087149A2 (en) | 2020-10-22 | 2022-04-28 | Gilead Sciences, Inc. | Interleukin-2-fc fusion proteins and methods of use |
WO2022093981A1 (en) | 2020-10-28 | 2022-05-05 | Genentech, Inc. | Combination therapy comprising ptpn22 inhibitors and pd-l1 binding antagonists |
WO2022090801A2 (en) | 2020-10-26 | 2022-05-05 | Compugen Ltd. | Pvrl2 and/or pvrig as biomarkers for treatment |
WO2022090469A2 (en) | 2020-10-29 | 2022-05-05 | Formycon Ag | Ace2 fusion proteins and uses thereof |
WO2022098628A2 (en) | 2020-11-04 | 2022-05-12 | Genentech, Inc. | Subcutaneous dosing of anti-cd20/anti-cd3 bispecific antibodies |
WO2022097060A1 (en) | 2020-11-06 | 2022-05-12 | Novartis Ag | Cd19 binding molecules and uses thereof |
WO2022098870A1 (en) | 2020-11-04 | 2022-05-12 | The Rockefeller University | Neutralizing anti-sars-cov-2 antibodies |
WO2022097065A2 (en) | 2020-11-06 | 2022-05-12 | Novartis Ag | ANTIBODY Fc VARIANTS |
WO2022097061A1 (en) | 2020-11-06 | 2022-05-12 | Novartis Ag | Anti-cd19 agent and b cell targeting agent combination therapy for treating b cell malignancies |
WO2022098638A2 (en) | 2020-11-04 | 2022-05-12 | Genentech, Inc. | Dosing for treatment with anti-cd20/anti-cd3 bispecific antibodies |
WO2022098648A2 (en) | 2020-11-04 | 2022-05-12 | Genentech, Inc. | Dosing for treatment with anti-cd20/anti-cd3 bispecific antibodies and anti-cd79b antibody drug conjugates |
US11332524B2 (en) | 2018-03-22 | 2022-05-17 | Surface Oncology, Inc. | Anti-IL-27 antibodies and uses thereof |
US11332523B2 (en) | 2014-05-28 | 2022-05-17 | Academia Sinica | Anti-TNF-alpha glycoantibodies and uses thereof |
US11332533B2 (en) | 2007-09-26 | 2022-05-17 | Chugai Seiyaku Kabushiki Kaisha | Modified antibody constant region |
WO2022102634A1 (en) | 2020-11-11 | 2022-05-19 | 第一三共株式会社 | COMBINATION OF ANTIBODY-DRUG CONJUGATE WITH ANTI-SIRPα ANTIBODY |
WO2022115451A1 (en) | 2020-11-24 | 2022-06-02 | Novartis Ag | Mcl-1 inhibitor antibody-drug conjugates and methods of use |
WO2022112942A2 (en) | 2020-11-24 | 2022-06-02 | Novartis Ag | Anti-cd48 antibodies, antibody drug conjugates, and uses thereof |
US11352403B2 (en) | 2018-05-14 | 2022-06-07 | Werewolf Therapeutics, Inc. | Activatable interleukin-2 polypeptides and methods of use thereof |
WO2022119976A1 (en) | 2020-12-01 | 2022-06-09 | Aptevo Research And Development Llc | Heterodimeric psma and cd3-binding bispecific antibodies |
US11359028B2 (en) | 2016-11-09 | 2022-06-14 | Agenus Inc. | Anti-OX40 antibodies and anti-GITR antibodies |
US11365239B2 (en) | 2020-03-20 | 2022-06-21 | Tsb Therapeutics (Beijing) Co., Ltd. | Anti-SARS-COV-2 antibodies and uses thereof |
WO2022130182A1 (en) | 2020-12-14 | 2022-06-23 | Novartis Ag | Reversal binding agents for anti-natriuretic peptide receptor 1 (npr1) antibodies and uses thereof |
WO2022129120A1 (en) | 2020-12-17 | 2022-06-23 | F. Hoffmann-La Roche Ag | Anti-hla-g antibodies and use thereof |
WO2022127793A1 (en) | 2020-12-18 | 2022-06-23 | 珠海泰诺麦博生物技术有限公司 | Respiratory syncytial virus-specific binding molecule |
WO2022135467A1 (en) | 2020-12-23 | 2022-06-30 | 信达生物制药(苏州)有限公司 | Anti-b7-h3 antibody and uses thereof |
WO2022140797A1 (en) | 2020-12-23 | 2022-06-30 | Immunowake Inc. | Immunocytokines and uses thereof |
US11377485B2 (en) | 2009-12-02 | 2022-07-05 | Academia Sinica | Methods for modifying human antibodies by glycan engineering |
US11384149B2 (en) | 2013-08-09 | 2022-07-12 | Macrogenics, Inc. | Bi-specific monovalent Fc diabodies that are capable of binding CD32B and CD79b and uses thereof |
WO2022148732A1 (en) | 2021-01-06 | 2022-07-14 | F. Hoffmann-La Roche Ag | Combination therapy employing a pd1-lag3 bispecific antibody and a cd20 t cell bispecific antibody |
US11390670B2 (en) | 2016-12-19 | 2022-07-19 | Medimmune Limited | Antibodies against LIF and uses thereof |
WO2022155324A1 (en) | 2021-01-15 | 2022-07-21 | The Rockefeller University | Neutralizing anti-sars-cov-2 antibodies |
WO2022152656A1 (en) | 2021-01-12 | 2022-07-21 | F. Hoffmann-La Roche Ag | Split antibodies which bind to cancer cells and target radionuclides to said cells |
WO2022152701A1 (en) | 2021-01-13 | 2022-07-21 | F. Hoffmann-La Roche Ag | Combination therapy |
US11401348B2 (en) | 2009-09-02 | 2022-08-02 | Xencor, Inc. | Heterodimeric Fc variants |
WO2022165275A2 (en) | 2021-01-28 | 2022-08-04 | Compugen Ltd. | Combination therapy with anti-pvrig antibodies formulations and anti-pd-1-antibodies |
WO2022165266A1 (en) | 2021-01-28 | 2022-08-04 | Compugen Ltd. | Anti-pvrig antibodies formulations and uses thereof |
WO2022163846A1 (en) | 2021-02-01 | 2022-08-04 | 第一三共株式会社 | Novel method for producing antibody-immunostimulator conjugate |
WO2022169872A1 (en) | 2021-02-03 | 2022-08-11 | Genentech, Inc. | Multispecific binding protein degrader platform and methods of use |
WO2022187863A1 (en) | 2021-03-05 | 2022-09-09 | Dynamicure Biotechnology Llc | Anti-vista constructs and uses thereof |
WO2022187270A1 (en) | 2021-03-01 | 2022-09-09 | Xilio Development, Inc. | Combination of ctla4 and pd1/pdl1 antibodies for treating cancer |
WO2022187272A1 (en) | 2021-03-01 | 2022-09-09 | Xilio Development, Inc. | Combination of masked ctla4 and pd1/pdl1 antibodies for treating cancer |
WO2022184082A1 (en) | 2021-03-03 | 2022-09-09 | Sorrento Therapeutics, Inc. | Antibody-drug conjugates comprising an anti-bcma antibody |
WO2022184854A2 (en) | 2021-03-03 | 2022-09-09 | Formycon Ag | Formulations of ace2 fc fusion proteins |
WO2022192898A2 (en) | 2021-03-10 | 2022-09-15 | Immunowake Inc. | Immunomodulatory molecules and uses thereof |
WO2022192647A1 (en) | 2021-03-12 | 2022-09-15 | Genentech, Inc. | Anti-klk7 antibodies, anti-klk5 antibodies, multispecific anti-klk5/klk7 antibodies, and methods of use |
US11447573B2 (en) | 2016-07-20 | 2022-09-20 | Nanjing Legend Biotech Co., Ltd. | Multispecific antigen binding proteins and methods of use thereof |
US11447564B2 (en) | 2017-04-26 | 2022-09-20 | Eureka Therapeutics, Inc. | Constructs specifically recognizing glypican 3 and uses thereof |
WO2022197877A1 (en) | 2021-03-19 | 2022-09-22 | Genentech, Inc. | Methods and compositions for time delayed bio-orthogonal release of cytotoxic agents |
WO2022198192A1 (en) | 2021-03-15 | 2022-09-22 | Genentech, Inc. | Compositions and methods of treating lupus nephritis |
US11453710B2 (en) | 2018-05-14 | 2022-09-27 | Werewolf Therapeutics, Inc. | Activatable interleukin 12 polypeptides and methods of use thereof |
WO2022204724A1 (en) | 2021-03-25 | 2022-09-29 | Dynamicure Biotechnology Llc | Anti-igfbp7 constructs and uses thereof |
WO2022212645A1 (en) | 2021-03-31 | 2022-10-06 | Bioverativ Usa Inc. | Reducing surgery-associated hemolysis in cold agglutinin disease patients |
WO2022212876A1 (en) | 2021-04-02 | 2022-10-06 | The Regents Of The University Of California | Antibodies against cleaved cdcp1 and uses thereof |
US11471488B2 (en) | 2016-07-28 | 2022-10-18 | Alpine Immune Sciences, Inc. | CD155 variant immunomodulatory proteins and uses thereof |
US11472881B2 (en) | 2016-10-11 | 2022-10-18 | Nanjing Legend Biotech Co., Ltd. | Single-domain antibodies and variants thereof against CTLA-4 |
WO2022221720A1 (en) | 2021-04-16 | 2022-10-20 | Novartis Ag | Antibody drug conjugates and methods for making thereof |
WO2022225880A1 (en) | 2021-04-19 | 2022-10-27 | Genentech, Inc. | Modified mammalian cells |
WO2022235867A2 (en) | 2021-05-06 | 2022-11-10 | The Rockefeller University | Neutralizing anti-sars- cov-2 antibodies and methods of use thereof |
WO2022236134A1 (en) | 2021-05-07 | 2022-11-10 | Surface Oncology, Inc. | Anti-il-27 antibodies and uses thereof |
WO2022236335A1 (en) | 2021-05-07 | 2022-11-10 | Alpine Immune Sciences, Inc. | Methods of dosing and treatment with a taci-fc fusion immunomodulatory protein |
WO2022241082A1 (en) | 2021-05-14 | 2022-11-17 | Genentech, Inc. | Agonists of trem2 |
WO2022241446A1 (en) | 2021-05-12 | 2022-11-17 | Genentech, Inc. | Methods of using anti-cd79b immunoconjugates to treat diffuse large b-cell lymphoma |
WO2022246259A1 (en) | 2021-05-21 | 2022-11-24 | Genentech, Inc. | Modified cells for the production of a recombinant product of interest |
WO2022243261A1 (en) | 2021-05-19 | 2022-11-24 | F. Hoffmann-La Roche Ag | Agonistic cd40 antigen binding molecules targeting cea |
WO2022245671A1 (en) | 2021-05-18 | 2022-11-24 | Gilead Sciences, Inc. | Methods of using flt3l-fc fusion proteins |
US11510966B2 (en) | 2016-04-15 | 2022-11-29 | Evive Biotechnology (Shanghai) Ltd | Use of IL-22 in treating necrotizing enterocolitis |
US11525000B2 (en) | 2016-04-15 | 2022-12-13 | Immunext, Inc. | Anti-human VISTA antibodies and use thereof |
US11529416B2 (en) | 2012-09-07 | 2022-12-20 | Kings College London | Vista modulators for diagnosis and treatment of cancer |
WO2022263357A1 (en) | 2021-06-14 | 2022-12-22 | Argenx Iip Bv | Anti-il-9 antibodies and methods of use thereof |
WO2022266660A1 (en) | 2021-06-17 | 2022-12-22 | Amberstone Biosciences, Inc. | Anti-cd3 constructs and uses thereof |
WO2022270612A1 (en) | 2021-06-25 | 2022-12-29 | 中外製薬株式会社 | Use of anti-ctla-4 antibody |
WO2022269451A1 (en) | 2021-06-22 | 2022-12-29 | Novartis Ag | Bispecific antibodies for use in treatment of hidradenitis suppurativa |
WO2022270611A1 (en) | 2021-06-25 | 2022-12-29 | 中外製薬株式会社 | Anti–ctla-4 antibody |
WO2023279092A2 (en) | 2021-07-02 | 2023-01-05 | Genentech, Inc. | Methods and compositions for treating cancer |
WO2023275621A1 (en) | 2021-07-01 | 2023-01-05 | Compugen Ltd. | Anti-tigit and anti-pvrig in monotherapy and combination treatments |
WO2023283611A1 (en) | 2021-07-08 | 2023-01-12 | Staidson Biopharma Inc. | Antibodies specifically recognizing tnfr2 and uses thereof |
US11555038B2 (en) | 2017-01-25 | 2023-01-17 | Beigene, Ltd. | Crystalline forms of (S)-7-(1-(but-2-ynoyl)piperidin-4-yl)-2-(4-phenoxyphenyl)-4,5,6,7-tetrahydropyrazolo[1,5-a]pyrimidine-3-carboxamide, preparation, and uses thereof |
WO2023288241A1 (en) | 2021-07-14 | 2023-01-19 | Genentech, Inc. | Anti-c-c motif chemokine receptor 8 (ccr8) antibodies and methods of use |
WO2023288182A1 (en) | 2021-07-12 | 2023-01-19 | Genentech, Inc. | Structures for reducing antibody-lipase binding |
WO2023284714A1 (en) | 2021-07-14 | 2023-01-19 | 舒泰神(北京)生物制药股份有限公司 | Antibody that specifically recognizes cd40 and application thereof |
WO2023004386A1 (en) | 2021-07-22 | 2023-01-26 | Genentech, Inc. | Brain targeting compositions and methods of use thereof |
WO2023001884A1 (en) | 2021-07-22 | 2023-01-26 | F. Hoffmann-La Roche Ag | Heterodimeric fc domain antibodies |
WO2023010095A1 (en) | 2021-07-28 | 2023-02-02 | F. Hoffmann-La Roche Ag | Methods and compositions for treating cancer |
WO2023007472A1 (en) | 2021-07-30 | 2023-02-02 | ONA Therapeutics S.L. | Anti-cd36 antibodies and their use to treat cancer |
WO2023011338A1 (en) | 2021-08-02 | 2023-02-09 | 信达生物制药(苏州)有限公司 | Anti-cd79b×cd3 bispecific antibody and use thereof |
WO2023012147A1 (en) | 2021-08-03 | 2023-02-09 | F. Hoffmann-La Roche Ag | Bispecific antibodies and methods of use |
US11578372B2 (en) | 2012-11-05 | 2023-02-14 | Foundation Medicine, Inc. | NTRK1 fusion molecules and uses thereof |
WO2023019092A1 (en) | 2021-08-07 | 2023-02-16 | Genentech, Inc. | Methods of using anti-cd79b immunoconjugates to treat diffuse large b-cell lymphoma |
WO2023019239A1 (en) | 2021-08-13 | 2023-02-16 | Genentech, Inc. | Dosing for anti-tryptase antibodies |
US11584927B2 (en) | 2014-08-28 | 2023-02-21 | Bioatla, Inc. | Conditionally active chimeric antigen receptors for modified T-cells |
US11584793B2 (en) | 2015-06-24 | 2023-02-21 | Hoffmann-La Roche Inc. | Anti-transferrin receptor antibodies with tailored affinity |
WO2023021055A1 (en) | 2021-08-19 | 2023-02-23 | F. Hoffmann-La Roche Ag | Multivalent anti-variant fc-region antibodies and methods of use |
US11591388B2 (en) | 2019-06-07 | 2023-02-28 | argenx BV | Pharmaceutical formulations of FcRn inhibitors suitable for subcutaneous administration |
WO2023028591A1 (en) | 2021-08-27 | 2023-03-02 | Genentech, Inc. | Methods of treating tau pathologies |
US11597768B2 (en) | 2017-06-26 | 2023-03-07 | Beigene, Ltd. | Immunotherapy for hepatocellular carcinoma |
WO2023034750A1 (en) | 2021-08-30 | 2023-03-09 | Genentech, Inc. | Anti-polyubiquitin multispecific antibodies |
EP4155321A1 (en) | 2021-06-04 | 2023-03-29 | Chugai Seiyaku Kabushiki Kaisha | Anti-ddr2 antibodies and uses thereof |
WO2023052541A1 (en) | 2021-09-30 | 2023-04-06 | Imcheck Therapeutics | Combination of an anti-btn3a activating antibody and an il-2 agonist for use in therapy |
WO2023056403A1 (en) | 2021-09-30 | 2023-04-06 | Genentech, Inc. | Methods for treatment of hematologic cancers using anti-tigit antibodies, anti-cd38 antibodies, and pd-1 axis binding antagonists |
WO2023056362A1 (en) | 2021-09-30 | 2023-04-06 | Seagen Inc. | B7-h4 antibody-drug conjugates for the treatment of cancer |
WO2023056069A1 (en) | 2021-09-30 | 2023-04-06 | Angiex, Inc. | Degrader-antibody conjugates and methods of using same |
WO2023064958A1 (en) | 2021-10-15 | 2023-04-20 | Compugen Ltd. | Combination therapy with anti-pvrig antibodies formulations, anti-tigit antibodies, and anti-pd-1 antibodies |
WO2023079086A1 (en) | 2021-11-05 | 2023-05-11 | Astrazeneca Uk Limited | Composition for treatment and prevention of covid-19 |
WO2023086807A1 (en) | 2021-11-10 | 2023-05-19 | Genentech, Inc. | Anti-interleukin-33 antibodies and uses thereof |
US11654135B2 (en) | 2017-06-22 | 2023-05-23 | Moonshot Pharma Llc | Methods for treating colon cancer with compositions comprising amlexanox and immune checkpoint inhibitors |
US11655303B2 (en) | 2019-09-16 | 2023-05-23 | Surface Oncology, Inc. | Anti-CD39 antibody compositions and methods |
US11654104B2 (en) | 2013-11-07 | 2023-05-23 | Evive Biotechnology (Shanghai) Ltd | Use of IL-22 dimer in manufacture of a medicament for intravenous administration |
WO2023091968A1 (en) | 2021-11-17 | 2023-05-25 | Disc Medicine, Inc. | Methods for treating anemia of kidney disease |
WO2023091887A1 (en) | 2021-11-16 | 2023-05-25 | Genentech, Inc. | Methods and compositions for treating systemic lupus erythematosus (sle) with mosunetuzumab |
WO2023088959A1 (en) | 2021-11-16 | 2023-05-25 | Ac Immune Sa | Novel molecules for therapy and diagnosis |
US11661452B2 (en) | 2018-03-20 | 2023-05-30 | WuXi Biologics Ireland Limited | Anti-lag-3 antibody polypeptide |
WO2023094571A1 (en) | 2021-11-25 | 2023-06-01 | Formycon Ag | Stabilization of ace2 fusion proteins |
WO2023094507A1 (en) | 2021-11-24 | 2023-06-01 | Formycon Ag | Improved ace2 fusion proteins |
US11673968B2 (en) | 2014-06-26 | 2023-06-13 | Hoffmann-La Roche Inc. | Anti-BRDU antibodies and methods of use |
WO2023114829A1 (en) | 2021-12-15 | 2023-06-22 | Genentech, Inc. | Stabilized il-18 polypeptides and uses thereof |
WO2023117834A1 (en) | 2021-12-20 | 2023-06-29 | F. Hoffmann-La Roche Ag | Agonistic ltbr antibodies and bispecific antibodies comprising them |
WO2023131901A1 (en) | 2022-01-07 | 2023-07-13 | Johnson & Johnson Enterprise Innovation Inc. | Materials and methods of il-1beta binding proteins |
US11701357B2 (en) | 2016-08-19 | 2023-07-18 | Beigene Switzerland Gmbh | Treatment of B cell cancers using a combination comprising Btk inhibitors |
WO2023139107A1 (en) | 2022-01-18 | 2023-07-27 | argenx BV | Galectin-10 antibodies |
WO2023141445A1 (en) | 2022-01-19 | 2023-07-27 | Genentech, Inc. | Anti-notch2 antibodies and conjugates and methods of use |
US11713353B2 (en) | 2018-01-15 | 2023-08-01 | Nanjing Legend Biotech Co., Ltd. | Single-domain antibodies and variants thereof against PD-1 |
EP4219555A1 (en) | 2013-12-23 | 2023-08-02 | F. Hoffmann-La Roche AG | Antibodies and methods of use |
WO2023147399A1 (en) | 2022-01-27 | 2023-08-03 | The Rockefeller University | Broadly neutralizing anti-sars-cov-2 antibodies targeting the n-terminal domain of the spike protein and methods of use thereof |
US11739132B2 (en) | 2019-05-14 | 2023-08-29 | Werewolf Therapeutics, Inc. | Separation moieties and methods of use thereof |
WO2023168352A1 (en) | 2022-03-03 | 2023-09-07 | Yale University | Humanized 3e10 antibodies, variants, and antigen binding fragments thereof |
US11752207B2 (en) | 2017-07-11 | 2023-09-12 | Compass Therapeutics Llc | Agonist antibodies that bind human CD137 and uses thereof |
WO2023172883A1 (en) | 2022-03-07 | 2023-09-14 | Alpine Immune Sciences, Inc. | Immunomodulatory proteins of variant cd80 polypeptides, cell therapies thereof and related methods and uses |
WO2023173026A1 (en) | 2022-03-10 | 2023-09-14 | Sorrento Therapeutics, Inc. | Antibody-drug conjugates and uses thereof |
EP4245374A2 (en) | 2022-03-18 | 2023-09-20 | Compugen Ltd. | Pvrl2 and/or pvrig as biomarkers for treatment |
WO2023178357A1 (en) | 2022-03-18 | 2023-09-21 | Evolveimmune Therapeutics, Inc. | Bispecific antibody fusion molecules and methods of use thereof |
WO2023178192A1 (en) | 2022-03-15 | 2023-09-21 | Compugen Ltd. | Il-18bp antagonist antibodies and their use in monotherapy and combination therapy in the treatment of cancer |
EP4249066A2 (en) | 2014-12-23 | 2023-09-27 | Bristol-Myers Squibb Company | Antibodies to tigit |
US11771698B2 (en) | 2013-01-18 | 2023-10-03 | Foundation Medicine, Inc. | Methods of treating cholangiocarcinoma |
US11774452B2 (en) | 2021-11-05 | 2023-10-03 | American Diagnostics & Therapy, LLC | Antibodies against carcinoembryonic antigens |
WO2023186756A1 (en) | 2022-03-28 | 2023-10-05 | F. Hoffmann-La Roche Ag | Interferon gamma variants and antigen binding molecules comprising these |
WO2023191816A1 (en) | 2022-04-01 | 2023-10-05 | Genentech, Inc. | Dosing for treatment with anti-fcrh5/anti-cd3 bispecific antibodies |
WO2023187657A1 (en) | 2022-03-30 | 2023-10-05 | Novartis Ag | Methods of treating disorders using anti-natriuretic peptide receptor 1 (npr1) antibodies |
EP4257200A2 (en) | 2015-03-06 | 2023-10-11 | Takeda Pharmaceutical Company Limited | Method of treating primary sclerosing cholangitis |
US11786529B2 (en) | 2017-11-29 | 2023-10-17 | Beigene Switzerland Gmbh | Treatment of indolent or aggressive B-cell lymphomas using a combination comprising BTK inhibitors |
WO2023201299A1 (en) | 2022-04-13 | 2023-10-19 | Genentech, Inc. | Pharmaceutical compositions of therapeutic proteins and methods of use |
WO2023209177A1 (en) | 2022-04-29 | 2023-11-02 | Astrazeneca Uk Limited | Sars-cov-2 antibodies and methods of using the same |
WO2023215737A1 (en) | 2022-05-03 | 2023-11-09 | Genentech, Inc. | Anti-ly6e antibodies, immunoconjugates, and uses thereof |
WO2023217743A1 (en) | 2022-05-10 | 2023-11-16 | Imcheck Therapeutics | Anti-btn3a antibodies for use in methods of treating gastro-intestinal inflammatory disorders |
WO2023219613A1 (en) | 2022-05-11 | 2023-11-16 | Genentech, Inc. | Dosing for treatment with anti-fcrh5/anti-cd3 bispecific antibodies |
WO2023217933A1 (en) | 2022-05-11 | 2023-11-16 | F. Hoffmann-La Roche Ag | Antibody that binds to vegf-a and il6 and methods of use |
US11820830B2 (en) | 2004-07-20 | 2023-11-21 | Xencor, Inc. | Optimized Fc variants |
WO2023237928A2 (en) | 2022-06-10 | 2023-12-14 | Horizon Therapeutics Ireland Dac | Igf1r antibodies |
WO2023239803A1 (en) | 2022-06-08 | 2023-12-14 | Angiex, Inc. | Anti-tm4sf1 antibody-drug conjugates comprising cleavable linkers and methods of using same |
WO2023240058A2 (en) | 2022-06-07 | 2023-12-14 | Genentech, Inc. | Prognostic and therapeutic methods for cancer |
WO2023242372A1 (en) | 2022-06-15 | 2023-12-21 | argenx BV | Fcrn/hsa binding molecules and methods of use |
WO2023245048A1 (en) | 2022-06-15 | 2023-12-21 | Bioverativ Usa Inc. | Anti-complement c1s antibody formulation |
WO2023250507A1 (en) | 2022-06-24 | 2023-12-28 | Bioverativ Usa Inc. | Methods for treating complement-mediated diseases |
US11866505B2 (en) | 2021-02-17 | 2024-01-09 | Prometheus Biosciences, Inc. | Anti-CD30L antibodies and uses thereof |
WO2024015897A1 (en) | 2022-07-13 | 2024-01-18 | Genentech, Inc. | Dosing for treatment with anti-fcrh5/anti-cd3 bispecific antibodies |
WO2024020579A1 (en) | 2022-07-22 | 2024-01-25 | Bristol-Myers Squibb Company | Antibodies binding to human pad4 and uses thereof |
WO2024020564A1 (en) | 2022-07-22 | 2024-01-25 | Genentech, Inc. | Anti-steap1 antigen-binding molecules and uses thereof |
WO2024020432A1 (en) | 2022-07-19 | 2024-01-25 | Genentech, Inc. | Dosing for treatment with anti-fcrh5/anti-cd3 bispecific antibodies |
WO2024020407A1 (en) | 2022-07-19 | 2024-01-25 | Staidson Biopharma Inc. | Antibodies specifically recognizing b- and t-lymphocyte attenuator (btla) and uses thereof |
US11884739B2 (en) | 2014-05-27 | 2024-01-30 | Academia Sinica | Anti-CD20 glycoantibodies and uses thereof |
WO2024026496A1 (en) | 2022-07-28 | 2024-02-01 | Compugen Ltd. | Combination therapy with anti-pvrig antibodies formulations and anti-pd-1 antibodies |
US11891432B2 (en) | 2018-03-15 | 2024-02-06 | Chugai Seiyaku Kabushiki Kaisha | Anti-dengue virus antibodies having cross-reactivity to Zika virus and methods of use |
WO2024028731A1 (en) | 2022-08-05 | 2024-02-08 | Janssen Biotech, Inc. | Transferrin receptor binding proteins for treating brain tumors |
WO2024028732A1 (en) | 2022-08-05 | 2024-02-08 | Janssen Biotech, Inc. | Cd98 binding constructs for treating brain tumors |
US11905327B2 (en) | 2017-12-28 | 2024-02-20 | Nanjing Legend Biotech Co., Ltd. | Single-domain antibodies and variants thereof against TIGIT |
WO2024037633A2 (en) | 2022-08-19 | 2024-02-22 | Evive Biotechnology (Shanghai) Ltd | Formulations comprising g-csf and uses thereof |
US11912754B2 (en) | 2017-10-12 | 2024-02-27 | Immunowake Inc. | VEGFR-antibody light chain fusion protein |
WO2024044675A1 (en) | 2022-08-25 | 2024-02-29 | Beigene, Ltd. | Methods of cancer treatment using anti-pd1 antibodies in combination with anti-tim3 antibodies |
WO2024049949A1 (en) | 2022-09-01 | 2024-03-07 | Genentech, Inc. | Therapeutic and diagnostic methods for bladder cancer |
WO2024052503A1 (en) | 2022-09-08 | 2024-03-14 | Institut National de la Santé et de la Recherche Médicale | Antibodies having specificity to ltbp2 and uses thereof |
WO2024054929A1 (en) | 2022-09-07 | 2024-03-14 | Dynamicure Biotechnology Llc | Anti-vista constructs and uses thereof |
US11932685B2 (en) | 2007-10-31 | 2024-03-19 | Xencor, Inc. | Fc variants with altered binding to FcRn |
US11939383B2 (en) | 2018-03-02 | 2024-03-26 | Five Prime Therapeutics, Inc. | B7-H4 antibodies and methods and use thereof |
WO2024077239A1 (en) | 2022-10-07 | 2024-04-11 | Genentech, Inc. | Methods of treating cancer with anti-c-c motif chemokine receptor 8 (ccr8) antibodies |
WO2024074498A1 (en) | 2022-10-04 | 2024-04-11 | Imcheck Therapeutics | Combination of a btn3a activating antibody, a bcl2 inhibitor and hypomethylating agent for use in treating cancer |
WO2024077018A2 (en) | 2022-10-04 | 2024-04-11 | Alpine Immune Sciences, Inc. | Methods and uses of taci-fc fusion immunomodulatory protein |
US11958903B2 (en) | 2018-03-30 | 2024-04-16 | Nanjing Legend Biotech Co., Ltd. | Single-domain antibodies against LAG-3 and uses thereof |
US11970539B2 (en) | 2020-09-14 | 2024-04-30 | Ichnos Sciences SA | Antibodies that bind to IL1RAP and uses thereof |
Families Citing this family (14)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US7179892B2 (en) | 2000-12-06 | 2007-02-20 | Neuralab Limited | Humanized antibodies that recognize beta amyloid peptide |
US7132100B2 (en) | 2002-06-14 | 2006-11-07 | Medimmune, Inc. | Stabilized liquid anti-RSV antibody formulations |
US8946387B2 (en) | 2002-08-14 | 2015-02-03 | Macrogenics, Inc. | FcγRIIB specific antibodies and methods of use thereof |
US8968730B2 (en) | 2002-08-14 | 2015-03-03 | Macrogenics Inc. | FcγRIIB specific antibodies and methods of use thereof |
US7960512B2 (en) | 2003-01-09 | 2011-06-14 | Macrogenics, Inc. | Identification and engineering of antibodies with variant Fc regions and methods of using same |
WO2007094842A2 (en) | 2005-12-02 | 2007-08-23 | Genentech, Inc. | Binding polypeptides and uses thereof |
JP5898082B2 (en) | 2009-10-07 | 2016-04-06 | マクロジェニクス,インコーポレーテッド | Fc region-containing polypeptide exhibiting improved effector function by changing the degree of fucosylation and use thereof |
JO3437B1 (en) * | 2009-10-30 | 2019-10-20 | Esai R & D Man Co Ltd | Improved anti human Fraktalkine antibodies and uses thereof |
HUE028629T2 (en) * | 2009-12-23 | 2016-12-28 | Synimmune Gmbh | Anti-flt3 antibodies and methods of using the same |
US8362210B2 (en) | 2010-01-19 | 2013-01-29 | Xencor, Inc. | Antibody variants with enhanced complement activity |
AU2012277376B2 (en) | 2011-06-30 | 2016-11-24 | Compugen Ltd. | Polypeptides and uses thereof for treatment of autoimmune disorders and infection |
US9487587B2 (en) | 2013-03-05 | 2016-11-08 | Macrogenics, Inc. | Bispecific molecules that are immunoreactive with immune effector cells of a companion animal that express an activating receptor and cells that express B7-H3 and uses thereof |
US8986691B1 (en) | 2014-07-15 | 2015-03-24 | Kymab Limited | Method of treating atopic dermatitis or asthma using antibody to IL4RA |
US8980273B1 (en) | 2014-07-15 | 2015-03-17 | Kymab Limited | Method of treating atopic dermatitis or asthma using antibody to IL4RA |
-
1994
- 1994-06-15 CA CA 2163345 patent/CA2163345A1/en not_active Abandoned
- 1994-06-15 JP JP7501518A patent/JPH08511420A/en active Pending
- 1994-06-15 EP EP94917750A patent/EP0714409A1/en not_active Withdrawn
- 1994-06-15 AU AU69341/94A patent/AU691811B2/en not_active Ceased
- 1994-06-15 WO PCT/GB1994/001290 patent/WO1994029351A2/en not_active Application Discontinuation
Non-Patent Citations (8)
Title |
---|
EUROPEAN JOURNAL OF IMMUNOLOGY, vol.23, 1993 pages 1098 - 1104 GREENWOOD J. ET AL. 'Structural motifs involved in human IgG antibody effector functions' cited in the application * |
INTERNATIONAL REVIEWS OF IMMUNOLOGY, vol.10, June 1993, LONDON GB pages 241 - 250 JOLIFFE L. K. 'Humanized antibodies: enhancing therapeutic utility through antibody engineering' * |
JOURNAL OF IMMUNOLOGY, vol.125, 1980, BALTIMORE US pages 293 - 299 LAMPSON L. A. ET AL. 'Two populationS of Ia-like molecules on a human B cell line' cited in the application * |
JOURNAL OF IMMUNOLOGY, vol.148, June 1992, BALTIMORE US pages 3461 - 3468 ALEGRE M.-L. ET AL. 'Effect of a single amino acid mutation on the activating and immunosuppressive properties of a "humanized" OKT3 monoclonal antibody' cited in the application * |
NATURE, vol.332, 1988, LONDON GB pages 738 - 740 DUNCAN A.R. ET AL. 'The binding site for C1q on IgG' cited in the application * |
PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF USA, vol.80, 1983, WASHINGTON US pages 6632 - 6636 NOSE M. ET AL. 'Biological significance of carbohydrate chains on monoclonal antibodies' * |
PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF USA, vol.88, October 1991, WASHINGTON US pages 9036 - 9040 CHAPPEL M. S. ET AL. 'Identification of the Fcgamma receptor class I binding site in human IgG through the use of recombinant IgG1/IgG2 hybrid and point-mutated antibodies' cited in the application * |
THE JOURNAL OF EXPERIMENTAL MEDICINE, vol.173, no.4, April 1991 pages 1025 - 1028 TAO M.-H. ET AL. 'The differential ability of human IgG1 and IgG4 to activate complement is determined by the COOH-terminal seqence of the Ch2 domain' cited in the application * |
Cited By (1613)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US7923221B1 (en) * | 1983-04-08 | 2011-04-12 | Genentech, Inc | Methods of making antibody heavy and light chains having specificity for a desired antigen |
US6204007B1 (en) | 1994-03-29 | 2001-03-20 | Celltech Therapeutics Limited | Antibodies against E-selectin |
US6407214B1 (en) | 1994-03-29 | 2002-06-18 | Celltech Therapeutics Limited | Antibodies against E-selectin |
US8562994B2 (en) | 1994-08-15 | 2013-10-22 | Medimmune, Llc | Human-murine chimeric antibodies against respiratory syncytial virus |
US7704505B2 (en) | 1994-08-15 | 2010-04-27 | Medimmune, Llc | Human-murine chimeric antibodies against respiratory syncytial virus |
WO1996008512A1 (en) * | 1994-09-16 | 1996-03-21 | Austin Research Institute Cancer And Anti-Inflammatory Syndicate No. 1 | POLYPEPTIDES WITH Fc BINDING ABILITY |
US7803904B2 (en) | 1995-09-01 | 2010-09-28 | Millennium Pharmaceuticals, Inc. | Mucosal vascular addressing and uses thereof |
US8277808B2 (en) | 1995-09-01 | 2012-10-02 | Millennium Pharmaceuticals, Inc. | Mucosal vascular addressins and uses thereof |
US7247302B1 (en) | 1996-08-02 | 2007-07-24 | Bristol-Myers Squibb Company | Method for inhibiting immunoglobulin-induced toxicity resulting from the use of immunoglobulins in therapy and in vivo diagnosis |
US7147851B1 (en) | 1996-08-15 | 2006-12-12 | Millennium Pharmaceuticals, Inc. | Humanized immunoglobulin reactive with α4β7 integrin |
US7402410B2 (en) | 1996-08-15 | 2008-07-22 | Millennium Pharmaceuticals, Inc. | Humanized immunoglobulin reactive with α4β7 integrin |
WO1999032659A1 (en) * | 1997-12-22 | 1999-07-01 | Stiftelsen Universitetsforskning Bergen (Unifob) | METHOD FOR DISEASE PROGNOSIS BASED ON Fc RECEPTOR GENOTYPING |
US6194551B1 (en) | 1998-04-02 | 2001-02-27 | Genentech, Inc. | Polypeptide variants |
US7297775B2 (en) | 1998-04-02 | 2007-11-20 | Genentech, Inc. | Polypeptide variants |
US6528624B1 (en) | 1998-04-02 | 2003-03-04 | Genentech, Inc. | Polypeptide variants |
US6538124B1 (en) | 1998-04-02 | 2003-03-25 | Genentech, Inc. | Polypeptide variants |
US7364731B2 (en) | 1998-04-02 | 2008-04-29 | Genentech, Inc. | Polypeptide variants |
US6242195B1 (en) | 1998-04-02 | 2001-06-05 | Genentech, Inc. | Methods for determining binding of an analyte to a receptor |
US7741072B2 (en) | 1998-04-02 | 2010-06-22 | Genentech, Inc. | Polypeptide variants |
WO1999051642A1 (en) * | 1998-04-02 | 1999-10-14 | Genentech, Inc. | Antibody variants and fragments thereof |
US7597889B1 (en) * | 1998-05-08 | 2009-10-06 | Cambridge Enterprise Limited | Binding molecules derived from immunoglobulins which do not trigger complement mediated lysis |
US7183387B1 (en) | 1999-01-15 | 2007-02-27 | Genentech, Inc. | Polypeptide variants with altered effector function |
EP2386574A2 (en) | 1999-01-15 | 2011-11-16 | Genentech, Inc. | Polypeptide variants with altered effector function |
US7332581B2 (en) | 1999-01-15 | 2008-02-19 | Genentech, Inc. | Polypeptide variants with altered effector function |
US7335742B2 (en) | 1999-01-15 | 2008-02-26 | Genentech, Inc. | Polypeptide variants with altered effector function |
US7416727B2 (en) | 1999-01-15 | 2008-08-26 | Genentech, Inc. | Polypeptide variants with altered effector function |
US6737056B1 (en) | 1999-01-15 | 2004-05-18 | Genentech, Inc. | Polypeptide variants with altered effector function |
EP2366713A2 (en) | 1999-01-15 | 2011-09-21 | Genentech, Inc. | Polypeptide variants with altered effector function |
US7122637B2 (en) | 1999-01-15 | 2006-10-17 | Genentech, Inc. | Polypeptide variants with altered effector function |
US7371826B2 (en) | 1999-01-15 | 2008-05-13 | Genentech, Inc. | Polypeptide variants with altered effector function |
US8163882B2 (en) | 1999-01-15 | 2012-04-24 | Genentech, Inc. | Polypeptide variants with altered effector function |
EP2364997A2 (en) | 1999-01-15 | 2011-09-14 | Genentech, Inc. | Polypeptide variants with altered effector function |
US7785791B2 (en) | 1999-01-15 | 2010-08-31 | Genentech, Inc. | Polypeptide variants with altered effector function |
US7790858B2 (en) | 1999-01-15 | 2010-09-07 | Genentech, Inc. | Polypeptide variants with altered effector function |
US7666421B2 (en) | 1999-02-12 | 2010-02-23 | Genetics Institute, Llc | Methods of treatment of autoimmune diseases using humanized immunoglobulin reactive with B7-2 |
US7531175B2 (en) | 1999-02-12 | 2009-05-12 | Genetics Institute Llc | Methods for modulation of immune responses using humanized immunoglobulins reactive with B7-1 molecules |
EP2857516A1 (en) | 2000-04-11 | 2015-04-08 | Genentech, Inc. | Multivalent antibodies and uses therefor |
WO2001077342A1 (en) | 2000-04-11 | 2001-10-18 | Genentech, Inc. | Multivalent antibodies and uses therefor |
US7416726B2 (en) | 2000-04-13 | 2008-08-26 | The Rockefeller University | Enhancement of antibody-mediated immune responses |
EP2298348A1 (en) | 2000-04-14 | 2011-03-23 | Millennium Pharmaceuticals, Inc. | Antibody binding alpha4Beta7 integrin and its use to treat inflammatory bowel disease |
EP3167902A1 (en) | 2000-04-14 | 2017-05-17 | Millennium Pharmaceuticals, Inc. | Antibody binding alpha4beta7 integrin and its use to treat inflammatory bowel disease |
US8604162B2 (en) | 2000-04-21 | 2013-12-10 | Fuso Pharmaceutical Industries, Ltd. | Collectin |
US7985833B2 (en) | 2000-04-21 | 2011-07-26 | Fuso Pharmaceutical Industries, Ltd. | Collectin |
EP2251026A1 (en) | 2000-06-08 | 2010-11-17 | Immune Disease Institute, Inc. | Methods and compositions for inhibiting immunoglobulin-mediated reperfusion injury |
US8012476B2 (en) | 2000-12-12 | 2011-09-06 | Medimmune, Llc | Molecules with extended half-lives, compositions and uses thereof |
US8475792B2 (en) | 2000-12-12 | 2013-07-02 | Medimmune, Llc | Molecules with extended half-lives, compositions and uses thereof |
US8795661B2 (en) | 2000-12-12 | 2014-08-05 | Medimmune, Llc | Molecules with extended half-lives, compositions and uses thereof |
US7670600B2 (en) | 2000-12-12 | 2010-03-02 | MedImmine, LLC | Molecules with extended half-lives, compositions and uses thereof |
US7704497B2 (en) | 2000-12-12 | 2010-04-27 | Medimmune, Llc | Molecules with extended half-lives, compositions and uses thereof |
US7083784B2 (en) | 2000-12-12 | 2006-08-01 | Medimmune, Inc. | Molecules with extended half-lives, compositions and uses thereof |
US7658921B2 (en) | 2000-12-12 | 2010-02-09 | Medimmune, Llc | Molecules with extended half-lives, compositions and uses thereof |
US8323962B2 (en) | 2000-12-12 | 2012-12-04 | Medimmune, Llc | Molecules with extended half-lives, compositions and uses thereof |
US9562100B2 (en) | 2000-12-12 | 2017-02-07 | Medimmune Llc | Molecules with extended half-lives, compositions and uses thereof |
US9688775B2 (en) | 2001-08-27 | 2017-06-27 | Genentech, Inc. | System for antibody expression and assembly |
US7262278B2 (en) | 2001-10-15 | 2007-08-28 | Kirin Beer Kabushiki Kaisha | Anti-HLA-DR antibody |
US7053202B2 (en) | 2001-10-19 | 2006-05-30 | Millennium Pharmaceuticals, Inc. | Immunoglobulin DNA cassette molecules, monobody constructs, methods of production, and methods of use therefor |
US8093357B2 (en) | 2002-03-01 | 2012-01-10 | Xencor, Inc. | Optimized Fc variants and methods for their generation |
US8124731B2 (en) | 2002-03-01 | 2012-02-28 | Xencor, Inc. | Optimized Fc variants and methods for their generation |
US7662925B2 (en) | 2002-03-01 | 2010-02-16 | Xencor, Inc. | Optimized Fc variants and methods for their generation |
US8734791B2 (en) | 2002-03-01 | 2014-05-27 | Xencor, Inc. | Optimized fc variants and methods for their generation |
US8187593B2 (en) | 2002-08-14 | 2012-05-29 | Macrogenics, Inc. | FcγRIIB specific antibodies and methods of use thereof |
US8530627B2 (en) | 2002-08-14 | 2013-09-10 | Macrogenics, Inc. | FcγRIIB specific antibodies and methods of use thereof |
US8039592B2 (en) | 2002-09-27 | 2011-10-18 | Xencor, Inc. | Optimized Fc variants and methods for their generation |
US8093359B2 (en) | 2002-09-27 | 2012-01-10 | Xencor, Inc. | Optimized Fc variants and methods for their generation |
US10183999B2 (en) | 2002-09-27 | 2019-01-22 | Xencor, Inc. | Optimized Fc variants and methods for their generation |
US9193798B2 (en) | 2002-09-27 | 2015-11-24 | Xencor, Inc. | Optimized Fc variants and methods for their generation |
US10184000B2 (en) | 2002-09-27 | 2019-01-22 | Xencor, Inc. | Optimized Fc variants and methods for their generation |
US9353187B2 (en) | 2002-09-27 | 2016-05-31 | Xencor, Inc. | Optimized FC variants and methods for their generation |
US8188231B2 (en) | 2002-09-27 | 2012-05-29 | Xencor, Inc. | Optimized FC variants |
US8809503B2 (en) | 2002-09-27 | 2014-08-19 | Xencor, Inc. | Optimized Fc variants and methods for their generation |
US8383109B2 (en) | 2002-09-27 | 2013-02-26 | Xencor, Inc. | Optimized Fc variants and methods for their generation |
US8858937B2 (en) | 2002-09-27 | 2014-10-14 | Xencor, Inc. | Optimized Fc variants and methods for their generation |
WO2004074430A2 (en) * | 2002-12-06 | 2004-09-02 | Diadexus, Inc. | Compositions, splice variants and methods relating to lung specific genes and proteins |
WO2004074430A3 (en) * | 2002-12-06 | 2004-12-16 | Diadexus Inc | Compositions, splice variants and methods relating to lung specific genes and proteins |
US9028815B2 (en) | 2003-01-09 | 2015-05-12 | Macrogenics, Inc. | Identification and engineering of antibodies with variant FC regions and methods of using same |
US7355008B2 (en) | 2003-01-09 | 2008-04-08 | Macrogenics, Inc. | Identification and engineering of antibodies with variant Fc regions and methods of using same |
US10584176B2 (en) | 2003-03-03 | 2020-03-10 | Xencor, Inc. | Fc variants with increased affinity for FcγRIIc |
US8084582B2 (en) | 2003-03-03 | 2011-12-27 | Xencor, Inc. | Optimized anti-CD20 monoclonal antibodies having Fc variants |
US8735545B2 (en) | 2003-03-03 | 2014-05-27 | Xencor, Inc. | Fc variants having increased affinity for fcyrllc |
US9657106B2 (en) | 2003-03-03 | 2017-05-23 | Xencor, Inc. | Optimized Fc variants |
US10113001B2 (en) | 2003-03-03 | 2018-10-30 | Xencor, Inc. | Fc variants with increased affinity for FcyRIIc |
US9663582B2 (en) | 2003-03-03 | 2017-05-30 | Xencor, Inc. | Optimized Fc variants |
US8388955B2 (en) | 2003-03-03 | 2013-03-05 | Xencor, Inc. | Fc variants |
US7495085B2 (en) | 2003-03-14 | 2009-02-24 | Wyeth | Antibodies against human or mouse IL-21 receptor |
US8143385B2 (en) | 2003-03-14 | 2012-03-27 | Wyeth Llc | Nucleic acids coding for antibodies against human IL-21 receptor and uses therefor |
EP2184298A1 (en) | 2003-03-14 | 2010-05-12 | Wyeth a Corporation of the State of Delaware | Antibodies against human IL-21 receptor and uses therefor |
US9051373B2 (en) | 2003-05-02 | 2015-06-09 | Xencor, Inc. | Optimized Fc variants |
EP1620467A2 (en) * | 2003-05-02 | 2006-02-01 | Xencor, Inc. | Optimized fc variants and methods for their generation |
AU2008229860B2 (en) * | 2003-05-02 | 2012-01-12 | Xencor, Inc | Optimized Fc variants and methods for their generation |
US8603473B2 (en) | 2003-06-27 | 2013-12-10 | Biogen Idec Ma Inc. | Modified binding molecules comprising connecting peptides |
US7700097B2 (en) | 2003-06-27 | 2010-04-20 | Biogen Idec Ma Inc. | Purification and preferential synthesis of binding molecules |
US8318917B2 (en) | 2003-08-22 | 2012-11-27 | Biogen Idec Ma Inc. | Nucleic acids encoding antibodies having altered effector function and methods for making the same |
US7863419B2 (en) | 2003-08-22 | 2011-01-04 | Biogen Idec Ma Inc. | Antibodies having altered effector function and methods for making the same |
US9714282B2 (en) | 2003-09-26 | 2017-07-25 | Xencor, Inc. | Optimized Fc variants and methods for their generation |
EP2383295A1 (en) | 2003-12-10 | 2011-11-02 | Medarex, Inc. | IP-10 antibodies and their uses |
EP2418220A2 (en) | 2003-12-10 | 2012-02-15 | Medarex, Inc. | Interferon alpha antibodies and their uses |
EP2135619A1 (en) | 2003-12-10 | 2009-12-23 | Millennium Pharmaceuticals, Inc. | Humanized anti-CCR2 antibodies and methods of use therefor |
EP2865687A1 (en) | 2003-12-10 | 2015-04-29 | E. R. Squibb & Sons, L.L.C. | IP-10 antibodies and their uses |
EP2275448A2 (en) | 2003-12-19 | 2011-01-19 | Genentech, Inc. | Monovalent antibody fragments useful as therapeutics |
WO2005070963A1 (en) * | 2004-01-12 | 2005-08-04 | Applied Molecular Evolution, Inc | Fc region variants |
EA009746B1 (en) * | 2004-01-12 | 2008-04-28 | Эпплайд Молекьюлар Эволюшн, Инк. | Fc region variants |
EP2290077A2 (en) | 2004-03-01 | 2011-03-02 | Immune Disease Institute, Inc. | Natural IGM antibodies and inhibitors thereof |
US7824684B2 (en) | 2004-04-13 | 2010-11-02 | Hoffmann-La Roche Inc. | Methods of inhibiting the binding of P-selectin to PSGL-1 with anti-P-selectin antibodies |
USRE44389E1 (en) | 2004-04-13 | 2013-07-23 | Hoffman-La Roche Inc. | Methods of inhibiting the binding of P-selectin to PSGL-1 with anti-P-selectin antibodies |
USRE44359E1 (en) | 2004-04-13 | 2013-07-09 | Hoffmann-La Roche Inc | Nucleic acid molecules encoding anti-P-selectin antibodies |
US7754867B2 (en) | 2004-04-13 | 2010-07-13 | Hoffmann-La Roche Inc. | Nucleic acid molecules encoding anti-P-selectin antibodies |
US7563441B2 (en) * | 2004-04-13 | 2009-07-21 | Hoffman-La Roche Inc. | Anti-P-selectin antibodies |
USRE43568E1 (en) | 2004-04-13 | 2012-08-07 | Hoffmann-La Roche Inc. | Anti-P-selectin antibodies |
US8133982B2 (en) | 2004-05-10 | 2012-03-13 | Macrogenics, Inc. | FcγRIIB specific antibodies and methods of use thereof |
EP2662390A1 (en) | 2004-06-21 | 2013-11-13 | Medarex, L.L.C. | Interferon alpha receptor 1 antibodies and their uses |
US11820830B2 (en) | 2004-07-20 | 2023-11-21 | Xencor, Inc. | Optimized Fc variants |
US8647625B2 (en) | 2004-07-26 | 2014-02-11 | Biogen Idec Ma Inc. | Anti-CD154 antibodies |
US8961976B2 (en) | 2004-07-26 | 2015-02-24 | Biogen Idec Ma Inc. | Anti-CD154 antibodies |
US7740847B2 (en) | 2004-08-04 | 2010-06-22 | Applied Molecular Evolution, Inc. | Variant Fc regions |
US7476724B2 (en) | 2004-08-05 | 2009-01-13 | Genentech, Inc. | Humanized anti-cmet antibodies |
US7659374B2 (en) | 2004-08-16 | 2010-02-09 | Medimmune, Llc | Eph receptor Fc variants with enhanced antibody dependent cell-mediated cytotoxicity activity |
EP2322556A1 (en) | 2004-09-03 | 2011-05-18 | Genentech, Inc. | Humanized anti-beta7 antagonists and uses therefor |
US7528236B2 (en) | 2004-09-03 | 2009-05-05 | Genentech, Inc. | Humanized anti-beta7 antagonists and uses therefor |
US8835133B2 (en) | 2004-09-03 | 2014-09-16 | Genentech, Inc. | Humanized anti-beta7 antagonists and uses therefor |
US8124082B2 (en) | 2004-09-03 | 2012-02-28 | Genentech, Inc. | Humanized anti-beta7 antagonists and uses therefor |
US7687605B2 (en) | 2004-09-03 | 2010-03-30 | Genentech, Inc. | Humanized anti-beta7 antagonists and uses therefor |
US8779100B2 (en) | 2004-09-03 | 2014-07-15 | Genentech, Inc. | Humanized anti-beta7 antagonists and uses therefor |
US8101720B2 (en) | 2004-10-21 | 2012-01-24 | Xencor, Inc. | Immunoglobulin insertions, deletions and substitutions |
US7632497B2 (en) | 2004-11-10 | 2009-12-15 | Macrogenics, Inc. | Engineering Fc Antibody regions to confer effector function |
US8802820B2 (en) | 2004-11-12 | 2014-08-12 | Xencor, Inc. | Fc variants with altered binding to FcRn |
US9200079B2 (en) | 2004-11-12 | 2015-12-01 | Xencor, Inc. | Fc variants with altered binding to FcRn |
US9803023B2 (en) | 2004-11-12 | 2017-10-31 | Xencor, Inc. | Fc variants with altered binding to FcRn |
US8546543B2 (en) | 2004-11-12 | 2013-10-01 | Xencor, Inc. | Fc variants that extend antibody half-life |
US8852586B2 (en) | 2004-11-12 | 2014-10-07 | Xencor, Inc. | Fc variants with altered binding to FcRn |
US8367805B2 (en) | 2004-11-12 | 2013-02-05 | Xencor, Inc. | Fc variants with altered binding to FcRn |
US8883973B2 (en) | 2004-11-12 | 2014-11-11 | Xencor, Inc. | Fc variants with altered binding to FcRn |
US11198739B2 (en) | 2004-11-12 | 2021-12-14 | Xencor, Inc. | Fc variants with altered binding to FcRn |
US8324351B2 (en) | 2004-11-12 | 2012-12-04 | Xencor, Inc. | Fc variants with altered binding to FcRn |
US8338574B2 (en) | 2004-11-12 | 2012-12-25 | Xencor, Inc. | FC variants with altered binding to FCRN |
US8318907B2 (en) | 2004-11-12 | 2012-11-27 | Xencor, Inc. | Fc variants with altered binding to FcRn |
US10336818B2 (en) | 2004-11-12 | 2019-07-02 | Xencor, Inc. | Fc variants with altered binding to FcRn |
EP2476705A1 (en) | 2004-12-28 | 2012-07-18 | Innate Pharma | Monoclonal antibodies against NKG2A |
EP3026063A1 (en) | 2004-12-28 | 2016-06-01 | Innate Pharma S.A. | Monoclonal antibodies against nkg2a |
US7700099B2 (en) | 2005-02-14 | 2010-04-20 | Merck & Co., Inc. | Non-immunostimulatory antibody and compositions containing the same |
WO2006089133A2 (en) | 2005-02-15 | 2006-08-24 | Duke University | Anti-cd19 antibodies and uses in oncology |
EP2548575A1 (en) | 2005-02-15 | 2013-01-23 | Duke University | Anti-CD19 antibodies that mediate ADCC for use in treating autoimmune diseases |
EP2535355A2 (en) | 2005-03-23 | 2012-12-19 | Genmab A/S | Antibodies against CD38 for treatment of multiple myeloma |
EP2567976A2 (en) | 2005-03-23 | 2013-03-13 | Genmab A/S | Antibodies against CD38 for treatment of multiple myeloma |
EP3312196A1 (en) | 2005-03-23 | 2018-04-25 | Genmab A/S | Antibodies against cd38 for treatment of multiple myeloma |
EP3153525A1 (en) | 2005-03-23 | 2017-04-12 | Genmab A/S | Antibodies against cd38 for treatment of multiple myeloma |
EP2551282A2 (en) | 2005-03-23 | 2013-01-30 | Genmab A/S | Antibodies against CD38 for treatment of multiple myeloma |
US9284375B2 (en) | 2005-04-15 | 2016-03-15 | Macrogenics, Inc. | Covalent diabodies and uses thereof |
US11254748B2 (en) | 2005-04-15 | 2022-02-22 | Macrogenics, Inc. | Covalent diabodies and uses thereof |
US10093739B2 (en) | 2005-04-15 | 2018-10-09 | Macrogenics, Inc. | Covalent diabodies and uses thereof |
US11254747B2 (en) | 2005-04-15 | 2022-02-22 | Macrogenics, Inc. | Covalent diabodies and uses thereof |
US9296816B2 (en) | 2005-04-15 | 2016-03-29 | Macrogenics, Inc. | Covalent diabodies and uses thereof |
US10093738B2 (en) | 2005-04-15 | 2018-10-09 | Macrogenics, Inc. | Covalent diabodies and uses thereof |
US9889197B2 (en) | 2005-04-15 | 2018-02-13 | Macrogenics, Inc. | Covalently-associated diabody complexes that possess charged coil domains and that are capable of enhanced binding to serum albumin |
US9963510B2 (en) | 2005-04-15 | 2018-05-08 | Macrogenics, Inc. | Covalent diabodies and uses thereof |
US8697396B2 (en) | 2005-04-26 | 2014-04-15 | Medimmune, Llc | Modulation of antibody effector function by hinge domain engineering |
US8008443B2 (en) | 2005-04-26 | 2011-08-30 | Medimmune, Llc | Modulation of antibody effector function by hinge domain engineering |
EP2221316A1 (en) | 2005-05-05 | 2010-08-25 | Duke University | Anti-CD19 antibody therapy for autoimmune disease |
EP3530736A2 (en) | 2005-05-09 | 2019-08-28 | ONO Pharmaceutical Co., Ltd. | Human monoclonal antibodies to programmed death 1 (pd-1) and methods for treating cancer using anti-pd-1 antibodies alone or in combination with other immunotherapeutics |
EP2418278A2 (en) | 2005-05-09 | 2012-02-15 | Ono Pharmaceutical Co., Ltd. | Human monoclonal antibodies to programmed death 1(PD-1) and methods for treating cancer using anti-PD-1 antibodies alone or in combination with other immunotherapeutics |
EP2161336A1 (en) | 2005-05-09 | 2010-03-10 | ONO Pharmaceutical Co., Ltd. | Human monoclonal antibodies to programmed death 1(PD-1) and methods for treating cancer using anti-PD-1 antibodies alone or in combination with other immunotherapeutics |
EP2439272A2 (en) | 2005-05-09 | 2012-04-11 | Ono Pharmaceutical Co., Ltd. | Human monoclonal antibodies to programmed death 1(PD-1) and methods for treating cancer using anti-PD-1 antibodies alone or in combination with other immunotherapeutics |
EP2439273A2 (en) | 2005-05-09 | 2012-04-11 | Ono Pharmaceutical Co., Ltd. | Human monoclonal antibodies to programmed death 1(PD-1) and methods for treating cancer using anti-PD-1 antibodies alone or in combination with other immunotherapeutics |
EP2982379A1 (en) | 2005-07-01 | 2016-02-10 | E. R. Squibb & Sons, L.L.C. | Human monoclonal antibodies to programmed death ligand 1 (pd-l1) |
US8309690B2 (en) | 2005-07-01 | 2012-11-13 | Medimmune, Llc | Integrated approach for generating multidomain protein therapeutics |
US9580506B2 (en) | 2005-07-21 | 2017-02-28 | Genmab A/S | Potency assays for antibody drug substance binding to an Fc receptor |
US8697071B2 (en) | 2005-08-10 | 2014-04-15 | Macrogenics, Inc. | Identification and engineering of antibodies with variant Fc regions and methods of using same |
US9040041B2 (en) | 2005-10-03 | 2015-05-26 | Xencor, Inc. | Modified FC molecules |
US7973136B2 (en) | 2005-10-06 | 2011-07-05 | Xencor, Inc. | Optimized anti-CD30 antibodies |
US9574006B2 (en) | 2005-10-06 | 2017-02-21 | Xencor, Inc. | Optimized anti-CD30 antibodies |
US8409568B2 (en) | 2005-10-14 | 2013-04-02 | Medimmune, Llc | Mutant antibody Fc domains and fusion proteins thereof |
US9567389B2 (en) | 2005-10-14 | 2017-02-14 | Medimmune, Llc | Cell display of antibody libraries |
EP2532679A1 (en) | 2005-10-21 | 2012-12-12 | Novartis AG | Human antibodies against il13 and therapeutic uses |
EP2532677A1 (en) | 2005-10-21 | 2012-12-12 | Novartis AG | Human antibodies against il13 and therapeutic uses |
EP2465870A1 (en) | 2005-11-07 | 2012-06-20 | Genentech, Inc. | Binding polypeptides with diversified and consensus VH/VL hypervariable sequences |
EP2623516A2 (en) | 2005-12-02 | 2013-08-07 | Genentech, Inc. | Compositions and methods for the treatment of diseases and disorders associated with cytokine signaling involving antibodies that bind to IL-22 and IL-22R |
EP3006466A2 (en) | 2005-12-02 | 2016-04-13 | Genentech, Inc. | Compositions and methods for the treatment of diseases and disorders associated with cytokine signaling involving antibodies that bind to il-22 and il-22r |
WO2007067992A2 (en) | 2005-12-08 | 2007-06-14 | Medarex, Inc. | Human monoclonal antibodies to fucosyl-gm1 and methods for using anti-fucosyl-gm1 |
EP3309170A1 (en) | 2005-12-15 | 2018-04-18 | Genentech, Inc. | Polyubiquitin antibodies |
EP2325208A1 (en) | 2005-12-15 | 2011-05-25 | Genentech, Inc. | Polyubiquitin antibodies |
EP2402373A2 (en) | 2006-01-05 | 2012-01-04 | Genentech, Inc. | Anti-EphB4 Antibodies and Methods Using Same |
EP3156418A1 (en) | 2006-01-05 | 2017-04-19 | Genentech, Inc. | Anti-ephb4 antibodies and methods using same |
EP3101033A1 (en) | 2006-01-12 | 2016-12-07 | Alexion Pharmaceuticals, Inc. | Antibodies to ox-2/cd200 and uses thereof |
EP2463305A1 (en) | 2006-01-12 | 2012-06-13 | Alexion Pharmaceuticals, Inc. | Antibodies to OX-2/CD200 and uses thereof |
WO2007127506A2 (en) | 2006-01-20 | 2007-11-08 | Genentech, Inc. | Anti-ephrinb2 antibodies and methods using same |
EP2327423A2 (en) | 2006-02-21 | 2011-06-01 | Wyeth LLC | Human antibodies against human interleukin-22 (IL-22) |
EP3020729A1 (en) | 2006-02-21 | 2016-05-18 | Wyeth LLC | Antibodies against human il-22 and uses therefor |
EP2431392A1 (en) | 2006-02-21 | 2012-03-21 | Wyeth LLC | Antibodies against human IL-22 and uses therefor |
EP2540741A1 (en) | 2006-03-06 | 2013-01-02 | Aeres Biomedical Limited | Humanized anti-CD22 antibodies and their use in treatment of oncology, transplantation and autoimmune disease |
EP2468772A2 (en) | 2006-03-16 | 2012-06-27 | Genentech, Inc. | Antibodies to EGFL7 and methods for their use |
EP2343551A1 (en) | 2006-04-10 | 2011-07-13 | Genentech, Inc. | Disheveled PDZ modulators |
US7786270B2 (en) | 2006-05-26 | 2010-08-31 | Macrogenics, Inc. | Humanized FcγRIIB-specific antibodies and methods of use thereof |
EP2447282A2 (en) | 2006-05-30 | 2012-05-02 | Genentech, Inc. | Anti-CD22 Antibodies, their Immunoconjugates and uses thereof |
EP2446904A2 (en) | 2006-05-30 | 2012-05-02 | Genentech, Inc. | Anti-CD22 antibodies, their immunoconjugates and uses thereof |
US7803377B2 (en) | 2006-06-06 | 2010-09-28 | Genentech, Inc. | Anti-DLL4 antibodies and methods using same |
US9737599B2 (en) | 2006-06-26 | 2017-08-22 | Macrogenics, Inc. | Combination of FcγRIIB-specific antibodies and CD20-specific antibodies and methods of use thereof |
US10100116B2 (en) | 2006-06-26 | 2018-10-16 | Macrogenics, Inc. | FcγRIIB-specific antibodies and methods of use thereof |
US11098125B2 (en) | 2006-06-26 | 2021-08-24 | Macrogenics, Inc. | FcγRIIB-specific antibodies and methods of use thereof |
US8524867B2 (en) | 2006-08-14 | 2013-09-03 | Xencor, Inc. | Optimized antibodies that target CD19 |
US11618788B2 (en) | 2006-08-14 | 2023-04-04 | Xencor, Inc. | Optimized antibodies that target CD19 |
US9803020B2 (en) | 2006-08-14 | 2017-10-31 | Xencor, Inc. | Optimized antibodies that target CD19 |
US10626182B2 (en) | 2006-08-14 | 2020-04-21 | Xencor, Inc. | Optimized antibodies that target CD19 |
WO2008030611A2 (en) | 2006-09-05 | 2008-03-13 | Medarex, Inc. | Antibodies to bone morphogenic proteins and receptors therefor and methods for their use |
WO2008031056A2 (en) | 2006-09-08 | 2008-03-13 | Medimmune, Llc | Humanized anti-cd19 antibodies and their use in treatment of oncology, transplantation and autoimmune disease |
US8394374B2 (en) | 2006-09-18 | 2013-03-12 | Xencor, Inc. | Optimized antibodies that target HM1.24 |
US9040042B2 (en) | 2006-09-18 | 2015-05-26 | Xencor, Inc. | Optimized antibodies that target HM1.24 |
EP2486941A1 (en) | 2006-10-02 | 2012-08-15 | Medarex, Inc. | Human antibodies that bind CXCR4 and uses thereof |
EP2829551A1 (en) | 2006-10-19 | 2015-01-28 | CSL Limited | High affinity antibody antagonists of interleukin-13 receptor alpha 1 |
EP2530090A2 (en) | 2006-10-19 | 2012-12-05 | CSL Limited | Anti-IL-13R alpha 1 antibodies and their uses thereof |
EP2845866A1 (en) | 2006-10-27 | 2015-03-11 | Genentech, Inc. | Antibodies and immunoconjugates and uses therefor |
WO2008052187A2 (en) | 2006-10-27 | 2008-05-02 | Genentech. Inc. | Antibodies and immunoconjugates and uses therefor |
US8618248B2 (en) | 2006-10-31 | 2013-12-31 | President And Fellows Of Harvard College | Phosphopeptide compositions and anti-phosphopeptide antibody compositions and methods of detecting phosphorylated peptides |
EP3181580A1 (en) | 2006-11-02 | 2017-06-21 | Acceleron Pharma Inc. | Alk1 receptor and ligand antagonists and uses thereof |
WO2008076560A2 (en) | 2006-11-15 | 2008-06-26 | Medarex, Inc. | Human monoclonal antibodies to btla and methods of use |
WO2008070569A2 (en) | 2006-12-01 | 2008-06-12 | Medarex, Inc. | Human antibodies that bind cd22 and uses thereof |
US9708408B2 (en) | 2006-12-08 | 2017-07-18 | Macrogenics, Inc. | Methods for the treatment of disease using immunoglobulins having Fc Regions with altered affinities for FcγRactivating and FcγRinhibiting |
US10711069B2 (en) | 2006-12-08 | 2020-07-14 | Macrogenics, Inc. | Methods for the treatment of disease using immunoglobulins having Fc regions with altered affinities for FcγRactivating and FcγRinhibiting |
US11787871B2 (en) | 2006-12-08 | 2023-10-17 | Macrogenics, Inc. | Methods for the treatment of disease using immunoglobulins having fc regions with altered affinities for FcgammaRactivating and FegammaRinhibiting |
WO2009054863A2 (en) | 2006-12-13 | 2009-04-30 | Medarex, Inc. | Human antibodies that bind cd19 and uses thereof |
WO2008074004A2 (en) | 2006-12-14 | 2008-06-19 | Medarex, Inc. | Human antibodies that bind cd70 and uses thereof |
EP2468776A2 (en) | 2007-02-09 | 2012-06-27 | Genentech, Inc. | Anti-Robo4 antibodies and uses therefor |
EP3524626A1 (en) | 2007-03-22 | 2019-08-14 | Biogen MA Inc. | Binding proteins, including antibodies, antibody derivatives and antibody fragments, that specifically bind cd154 and uses thereof |
US10317393B2 (en) | 2007-03-23 | 2019-06-11 | Academia Sinica | Alkynyl sugar analogs for labeling and visualization of glycoconjugates in cells |
EP3431103A1 (en) | 2007-04-12 | 2019-01-23 | The Brigham and Women's Hospital, Inc. | Targeting abcb5 for cancer therapy |
EP2644205A1 (en) | 2007-04-12 | 2013-10-02 | The Brigham and Women's Hospital, Inc. | Targeting ABCB5 for cancer therapy |
EP2703011A2 (en) | 2007-05-07 | 2014-03-05 | MedImmune, LLC | Anti-icos antibodies and their use in treatment of oncology, transplantation and autoimmune disease |
EP2737907A2 (en) | 2007-05-07 | 2014-06-04 | MedImmune, LLC | Anti-icos antibodies and their use in treatment of oncology, transplantation and autoimmune disease |
US9321831B2 (en) | 2007-06-01 | 2016-04-26 | Medimmune Limited | RSV-specific binding molecules and means for producing them |
US10730931B2 (en) | 2007-06-01 | 2020-08-04 | Medimmune Limited | RSV-specific binding molecules and means for producing them |
US10059757B2 (en) | 2007-06-01 | 2018-08-28 | Medimmune Limited | RSV-specific binding molecules and means for producing them |
WO2008150525A1 (en) | 2007-06-04 | 2008-12-11 | Genentech, Inc. | Anti-notch1 nrr antibodies and methods using same |
EP2746290A2 (en) | 2007-06-06 | 2014-06-25 | Domantis Limited | Polypeptides, antibody variable domains and antagonists |
EP2746291A2 (en) | 2007-06-06 | 2014-06-25 | Domantis Limited | Pulmonary formulation comprising an immunoglobulin single variable domain which binds to TNFR1 |
EP2626371A1 (en) | 2007-07-31 | 2013-08-14 | MedImmune, LLC | Multispecific epitope binding proteins and uses thereof |
US8975377B2 (en) | 2007-08-13 | 2015-03-10 | Vasgene Therapeutics, Inc | Cancer treatment using humanized antibodies that bind to EphB4 |
EP2769729A1 (en) | 2007-09-04 | 2014-08-27 | Compugen Ltd. | Polypeptides and polynucleotides, and uses thereof as a drug target for producing drugs and biologics |
WO2009032845A2 (en) | 2007-09-04 | 2009-03-12 | Compugen, Ltd. | Polypeptides and polynucleotides, and uses thereof as a drug target for producing drugs and biologics |
US10098934B2 (en) | 2007-09-04 | 2018-10-16 | Compugen Ltd | Polypeptides and polynucleotides, and uses thereof as a drug target for producing drugs and biologics |
EP2769728A1 (en) | 2007-09-04 | 2014-08-27 | Compugen Ltd. | Polypeptides and polynucleotides, and uses thereof as a drug target for producing drugs and biologics |
US11332533B2 (en) | 2007-09-26 | 2022-05-17 | Chugai Seiyaku Kabushiki Kaisha | Modified antibody constant region |
EP2586796A1 (en) | 2007-10-12 | 2013-05-01 | Novartis AG | Compositions and methods for use for antibodies against sclerostin |
US11932685B2 (en) | 2007-10-31 | 2024-03-19 | Xencor, Inc. | Fc variants with altered binding to FcRn |
EP2567709A2 (en) | 2007-11-02 | 2013-03-13 | Novartis AG | Molecules and methods for modulating low-density-lipoprotein receptor-related protein 6 (LRP6) |
EP3305324A1 (en) | 2007-11-02 | 2018-04-11 | Novartis AG | Molecules and methods for modulating low-density-lipoprotein receptor-related protein 6 (lrp6) |
EP3360567A1 (en) | 2007-11-07 | 2018-08-15 | Genentech, Inc. | Amp for use in treating microbial disorders |
EP3173425A1 (en) | 2007-11-30 | 2017-05-31 | Genentech, Inc. | Anti-vegf antibodies |
EP2851372A1 (en) | 2007-11-30 | 2015-03-25 | Genentech, Inc. | Anti-VEGF antibodies |
EP2769993A1 (en) | 2007-12-14 | 2014-08-27 | Novo Nordisk A/S | Antibodies against human NKG2D and uses thereof |
US8795667B2 (en) | 2007-12-19 | 2014-08-05 | Macrogenics, Inc. | Compositions for the prevention and treatment of smallpox |
EP3211010A1 (en) | 2007-12-21 | 2017-08-30 | Medimmune Limited | Binding members for interleukin-4 receptor alpha (il-4r) - 173 |
EP2604628A2 (en) | 2007-12-21 | 2013-06-19 | Medimmune Limited | Binding members for interleukin-4 receptor alpha (IL-4R) - 173 |
WO2009081201A2 (en) | 2007-12-21 | 2009-07-02 | Medimmune Limited | BINDING MEMBERS FOR INTERLEUKIN-4 RECEPTOR ALPHA (IL-4Rα) - 173 |
EP2388323A2 (en) | 2008-01-11 | 2011-11-23 | Gene Techno Science Co., Ltd. | Humanized anti-9 integrin antibodies and the uses thereof |
EP2650017A2 (en) | 2008-02-05 | 2013-10-16 | Bristol-Myers Squibb Company | Alpha 5 - beta 1 antibodies and their uses |
EP2641612A1 (en) | 2008-02-05 | 2013-09-25 | Bristol-Myers Squibb Company | Alpha 5 - beta 1 antibodies and their uses |
EP2250279A2 (en) * | 2008-02-08 | 2010-11-17 | MedImmune, LLC | Anti-ifnar1 antibodies with reduced fc ligand affinity |
US10301390B2 (en) | 2008-02-08 | 2019-05-28 | Astrazeneca Ab | Anti-IFNAR1 antibodies with reduced Fc ligand affinity |
US9988459B2 (en) | 2008-02-08 | 2018-06-05 | Astrazeneca Ab | Anti-IFNAR1 antibodies with reduced Fc ligand affinity |
EP2250279A4 (en) * | 2008-02-08 | 2011-03-30 | Medimmune Llc | Anti-ifnar1 antibodies with reduced fc ligand affinity |
WO2009100309A2 (en) | 2008-02-08 | 2009-08-13 | Medimmune, Llc | Anti-ifnar1 antibodies with reduced fc ligand affinity |
US10131713B2 (en) | 2008-04-02 | 2018-11-20 | Macrogenics, Inc. | HER2/neu-specific antibodies and methods of using same |
US11028183B2 (en) | 2008-04-02 | 2021-06-08 | Macrogenics, Inc. | HER2/neu-specific antibodies and methods of using same |
US9695236B2 (en) | 2008-04-02 | 2017-07-04 | Macrogenics, Inc. | BCR-complex-specific antibodies and methods of using same |
US10479831B2 (en) | 2008-04-02 | 2019-11-19 | Macrogenics, Inc | BCR-complex-specific antibodies and methods of using same |
WO2009131256A1 (en) | 2008-04-24 | 2009-10-29 | Gene Techno Science Co., Ltd. | Humanized antibodies specific for amino acid sequence rgd of an extracellular matrix protein and the uses thereof |
EP3398966A1 (en) | 2008-05-02 | 2018-11-07 | Acceleron Pharma, Inc. | Methods and compositions for modulating angiogenesis and pericyte composition |
US10274488B2 (en) | 2008-07-15 | 2019-04-30 | Academia Sinica | Glycan arrays on PTFE-like aluminum coated glass slides and related methods |
US9880172B2 (en) | 2008-08-04 | 2018-01-30 | Biodesy, Inc. | Nonlinear optical detection of molecules comprising an unnatural amino acid possessing a hyperpolarizability |
US9182406B2 (en) | 2008-08-04 | 2015-11-10 | Biodesy, Inc. | Nonlinear optical detection of molecules comprising an unnatural amino acid possessing a hyperpolarizability |
EP2837388A1 (en) | 2008-08-05 | 2015-02-18 | Novartis AG | Compositions and methods for antibodies targeting complement protein C5 |
EP2815766A1 (en) | 2008-08-05 | 2014-12-24 | Novartis AG | Compositions and methods for antibodies targeting complement protein C5 |
WO2010015608A1 (en) | 2008-08-05 | 2010-02-11 | Novartis Ag | Compositions and methods for antibodies targeting complement protein c5 |
EP3597216A1 (en) | 2008-08-11 | 2020-01-22 | E. R. Squibb & Sons, L.L.C. | Human antibodies that bind lymphocyte activation gene-3 (lag-3) and uses thereof |
EP2905030A1 (en) | 2008-08-11 | 2015-08-12 | E. R. Squibb & Sons, L.L.C. | Human antibodies that bind lymphocyte activation gene-3 (LAG-3) and uses thereof |
EP4147714A1 (en) | 2008-08-11 | 2023-03-15 | E. R. Squibb & Sons, L.L.C. | Human antibodies that bind lymphocyte activation gene-3 (lag-3) and uses thereof |
EP2927244A1 (en) | 2008-09-19 | 2015-10-07 | MedImmune, LLC | Antibodies directed to DLL4 and uses thereof |
US8741604B2 (en) | 2008-11-07 | 2014-06-03 | Medimmune Limited | Nucleic acid molecule encoding a specific IL-1R1 antibody |
US9200074B2 (en) | 2008-11-07 | 2015-12-01 | Medimmune Limited | Antibodies to IL-1 R1 and methods of making them |
US8298533B2 (en) | 2008-11-07 | 2012-10-30 | Medimmune Limited | Antibodies to IL-1R1 |
WO2010056804A1 (en) | 2008-11-12 | 2010-05-20 | Medimmune, Llc | Antibody formulation |
US10302655B2 (en) | 2008-12-05 | 2019-05-28 | Glaxo Group Limited | Methods for selecting protease resistant polypeptides |
US10466252B2 (en) | 2008-12-05 | 2019-11-05 | Glaxo Group Limited | Methods for selecting protease resistant polypeptides |
EP2865689A1 (en) | 2008-12-08 | 2015-04-29 | Compugen Ltd. | FAM26F polypeptides and polynucleotides, and uses thereof as a drug target for producing drugs and biologics |
WO2010067308A2 (en) | 2008-12-08 | 2010-06-17 | Compugen Ltd. | Polypeptides and polynucleotides, and uses thereof as a drug target for producing drugs and biologics |
US8775090B2 (en) | 2008-12-12 | 2014-07-08 | Medimmune, Llc | Crystals and structure of a human IgG Fc variant with enhanced FcRn binding |
WO2010070346A2 (en) | 2008-12-18 | 2010-06-24 | Medimmune Limited | BINDING MEMBERS FOR INTERLEUKIN-4 RECEPTOR ALPHA (IL-4Ra) - 836 |
WO2010072740A2 (en) | 2008-12-23 | 2010-07-01 | Astrazeneca Ab | TARGETED BINDING AGENTS DIRECTED TO α5β1 AND USES THEREOF |
WO2010094720A2 (en) | 2009-02-19 | 2010-08-26 | Glaxo Group Limited | Improved anti-tnfr1 polypeptides, antibody variable domains & antagonists |
US8679492B2 (en) | 2009-02-23 | 2014-03-25 | Glenmark Pharmaceuticals S.A. | Humanized antibodies that bind to CD19 and their uses |
WO2010102175A1 (en) | 2009-03-05 | 2010-09-10 | Medarex, Inc. | Fully human antibodies specific to cadm1 |
WO2010108127A1 (en) | 2009-03-20 | 2010-09-23 | Genentech, Inc. | Bispecific anti-her antibodies |
EP3088420A1 (en) | 2009-03-20 | 2016-11-02 | F. Hoffmann-La Roche AG | Bispecific anti-her antibodies |
EP2679600A1 (en) | 2009-03-25 | 2014-01-01 | Genentech, Inc. | Anti-FGFR3 antibodies and methods using same |
US11401333B2 (en) | 2009-03-25 | 2022-08-02 | Genentech, Inc. | Anti-FGFR3 antibodies and methods using same |
US8410250B2 (en) | 2009-03-25 | 2013-04-02 | Genentech, Inc. | Anti-FGFR3 antibodies and methods using same |
WO2010111367A1 (en) | 2009-03-25 | 2010-09-30 | Genentech, Inc. | Anti-fgfr3 antibodies and methods using same |
US9499623B2 (en) | 2009-03-25 | 2016-11-22 | Genentech, Inc. | Anti-FGFR3 antibodies and methods using same |
WO2010111254A1 (en) | 2009-03-25 | 2010-09-30 | Genentech, Inc. | Novel anti-alpha5beta1 antibodies and uses thereof |
US9161977B2 (en) | 2009-03-25 | 2015-10-20 | F. Hoffmann-La Roche Ag | Anti-FGFR3 antibodies and methods using same |
US8710189B2 (en) | 2009-03-25 | 2014-04-29 | Genentech, Inc. | Anti-FGFR3 antibodies and methods using same |
US10000571B2 (en) | 2009-03-25 | 2018-06-19 | Genentech, Inc. | Anti-FGFR3 antibodies and methods using same |
US10287356B2 (en) | 2009-03-25 | 2019-05-14 | Genentech, Inc. | Anti-FGFR3 antibodies and methods using same |
EP3702371A1 (en) | 2009-03-25 | 2020-09-02 | Genentech, Inc. | Anti-fgfr3 antibodies and methods using same |
WO2010112458A1 (en) | 2009-03-31 | 2010-10-07 | Novartis Ag | Composition and methods of use for therapeutic antibodies specific for the il-12 receptore betal subunit |
EP3009454A2 (en) | 2009-04-20 | 2016-04-20 | Oxford Bio Therapeutics Limited | Antibodies specific to cadherin-17 |
US9062116B2 (en) | 2009-04-23 | 2015-06-23 | Infinity Pharmaceuticals, Inc. | Anti-fatty acid amide hydrolase-2 antibodies and uses thereof |
WO2010125003A1 (en) | 2009-04-27 | 2010-11-04 | Novartis Ag | Compositions and methods for increasing muscle growth |
EP3275900A1 (en) | 2009-04-27 | 2018-01-31 | Novartis AG | Compositions and methods for increasing muscle growth |
EP2998405A1 (en) | 2009-05-13 | 2016-03-23 | Genzyme Corporation | Anti-human cd52 immunoglobulins |
EP3683317A2 (en) | 2009-05-13 | 2020-07-22 | Genzyme Corporation | Anti-human cd52 immunoglobulins |
US11945874B2 (en) | 2009-05-13 | 2024-04-02 | Genzyme Corporation | Anti-human CD52 immunoglobulins |
US8617554B2 (en) | 2009-05-13 | 2013-12-31 | Genzyme Corporation | Anti-human CD52 immunoglobulins |
EP4311863A2 (en) | 2009-05-15 | 2024-01-31 | University Health Network | Compositions and methods for treating hematologic cancers targeting the sirp alpha- cd47 interaction |
EP2995315A1 (en) | 2009-05-15 | 2016-03-16 | University Health Network | Compositions and methods for treating hematologic cancers targeting the sirp alpha- cd47 interaction |
US10907209B2 (en) | 2009-05-15 | 2021-02-02 | University Health Network | Compositions and methods for treating hematological cancers targeting the SIRPα CD47 interaction |
US10640555B2 (en) | 2009-06-16 | 2020-05-05 | Hoffmann-La Roche Inc. | Bispecific antigen binding proteins |
US11673945B2 (en) | 2009-06-16 | 2023-06-13 | Hoffmann-La Roche Inc. | Bispecific antigen binding proteins |
EP3431501A1 (en) | 2009-06-18 | 2019-01-23 | Pfizer Inc | Anti notch-1 antibodies |
US9090690B2 (en) | 2009-06-18 | 2015-07-28 | Pfizer Inc. | Anti Notch-1 antibodies |
WO2010146550A1 (en) | 2009-06-18 | 2010-12-23 | Pfizer Inc. | Anti notch-1 antibodies |
WO2011006914A2 (en) | 2009-07-16 | 2011-01-20 | Glaxo Group Limited | Antagonists, uses & methods for partially inhibiting tnfr1 |
WO2011014457A1 (en) | 2009-07-27 | 2011-02-03 | Genentech, Inc. | Combination treatments |
EP3199551A2 (en) | 2009-07-31 | 2017-08-02 | E. R. Squibb & Sons, L.L.C. | Fully human antibodies to btla |
WO2011014438A1 (en) | 2009-07-31 | 2011-02-03 | N.V. Organon | Fully human antibodies to btla |
WO2011021146A1 (en) | 2009-08-20 | 2011-02-24 | Pfizer Inc. | Osteopontin antibodies |
US11401348B2 (en) | 2009-09-02 | 2022-08-02 | Xencor, Inc. | Heterodimeric Fc variants |
WO2011029823A1 (en) | 2009-09-09 | 2011-03-17 | Novartis Ag | Monoclonal antibody reactive with cd63 when expressed at the surface of degranulated mast cells |
US10035843B2 (en) | 2009-10-06 | 2018-07-31 | Medimmune Limited | RSV-specific binding molecule |
US10723786B2 (en) | 2009-10-06 | 2020-07-28 | Medimmune, Limited | RSV-specific binding molecule |
WO2011047083A1 (en) | 2009-10-13 | 2011-04-21 | Oxford Biotherapeutics Ltd. | Antibodies against epha10 |
US8759491B2 (en) | 2009-10-19 | 2014-06-24 | Genentech, Inc. | Modulators of hepatocyte growth factor activator |
WO2011049868A1 (en) | 2009-10-19 | 2011-04-28 | Genentech, Inc. | Modulators of hepatocyte growth factor activator |
WO2011050188A1 (en) | 2009-10-22 | 2011-04-28 | Genentech, Inc. | Anti-hepsin antibodies and methods using same |
EP3520816A2 (en) | 2009-10-23 | 2019-08-07 | Millennium Pharmaceuticals, Inc. | Anti-gcc antibody molecules and related compositions and methods |
WO2011056502A1 (en) | 2009-10-26 | 2011-05-12 | Genentech, Inc. | Bone morphogenetic protein receptor type ii compositions and methods of use |
WO2011056494A1 (en) | 2009-10-26 | 2011-05-12 | Genentech, Inc. | Activin receptor-like kinase-1 antagonist and vegfr3 antagonist combinations |
WO2011056497A1 (en) | 2009-10-26 | 2011-05-12 | Genentech, Inc. | Activin receptor type iib compositions and methods of use |
WO2011051217A1 (en) | 2009-10-27 | 2011-05-05 | Glaxo Group Limited | Stable anti-tnfr1 polypeptides, antibody variable domains & antagonists |
WO2011056772A1 (en) | 2009-11-04 | 2011-05-12 | Schering Corporation | Engineered anti-tslp antibody |
EP3594356A1 (en) | 2009-11-04 | 2020-01-15 | Merck Sharp & Dohme Corp. | Engineered anti-tslp antibody |
WO2011057120A1 (en) | 2009-11-05 | 2011-05-12 | Genentech, Inc. | Methods and composition for secretion of heterologous polypeptides |
EP3279215A1 (en) | 2009-11-24 | 2018-02-07 | MedImmune Limited | Targeted binding agents against b7-h1 |
WO2011067711A2 (en) | 2009-12-01 | 2011-06-09 | Compugen Ltd | Novel heparanase splice variant |
US10087236B2 (en) | 2009-12-02 | 2018-10-02 | Academia Sinica | Methods for modifying human antibodies by glycan engineering |
WO2011068993A1 (en) | 2009-12-02 | 2011-06-09 | Acceleron Pharma Inc. | Compositions and methods for increasing serum half-life of fc fusion proteins. |
US11377485B2 (en) | 2009-12-02 | 2022-07-05 | Academia Sinica | Methods for modifying human antibodies by glycan engineering |
US11267870B2 (en) | 2009-12-02 | 2022-03-08 | Academia Sinica | Methods for modifying human antibodies by glycan engineering |
WO2011071577A1 (en) | 2009-12-11 | 2011-06-16 | Genentech, Inc. | Anti-vegf-c antibodies and methods using same |
WO2011076781A1 (en) | 2009-12-22 | 2011-06-30 | Novartis Ag | Tetravalent cd47-antibody constant region fusion protein for use in therapy |
WO2011079185A1 (en) | 2009-12-23 | 2011-06-30 | Genentech, Inc. | Anti-bv8 antibodies and uses thereof |
WO2011085343A1 (en) | 2010-01-11 | 2011-07-14 | Alexion Pharmaceuticals, Inc | Biomarkers of immunomodulatory effects in humans treated with anti-cd200 antibodies |
WO2011100403A1 (en) | 2010-02-10 | 2011-08-18 | Immunogen, Inc | Cd20 antibodies and uses thereof |
WO2011098449A1 (en) | 2010-02-10 | 2011-08-18 | Novartis Ag | Methods and compounds for muscle growth |
WO2011103242A1 (en) | 2010-02-18 | 2011-08-25 | Genentech, Inc. | Neuregulin antagonists and use thereof in treating cancer |
WO2011101328A2 (en) | 2010-02-18 | 2011-08-25 | Roche Glycart Ag | Treatment with a humanized igg class anti egfr antibody and an antibody against insulin like growth factor 1 receptor |
US8557966B2 (en) | 2010-02-24 | 2013-10-15 | Immunogen, Inc. | Folate receptor 1 antibodies and immunoconjugates and uses thereof |
US9598490B2 (en) | 2010-02-24 | 2017-03-21 | Immunogen, Inc. | Folate receptor 1 antibodies and immunoconjugates and uses thereof |
US9670278B2 (en) | 2010-02-24 | 2017-06-06 | Immunogen, Inc. | Folate receptor 1 antibodies and immunoconjugates and uses thereof |
US9133275B2 (en) | 2010-02-24 | 2015-09-15 | Immunogen, Inc. | Folate receptor 1 antibodies and immunoconjugates and uses thereof |
US9670280B2 (en) | 2010-02-24 | 2017-06-06 | Immunogen, Inc. | Folate receptor 1 antibodies and immunoconjugates and uses thereof |
US9657100B2 (en) | 2010-02-24 | 2017-05-23 | Immunogen, Inc. | Folate receptor 1 antibodies and immunoconjugates and uses thereof |
WO2011106528A1 (en) * | 2010-02-24 | 2011-09-01 | Immunogen, Inc. | Folate receptor 1 antibodies and immunoconjugates and uses thereof |
US10301385B2 (en) | 2010-02-24 | 2019-05-28 | Immunogen, Inc. | Folate receptor 1 antibodies and immunoconjugates and uses thereof |
US9670279B2 (en) | 2010-02-24 | 2017-06-06 | Immunogen, Inc. | Folate receptor 1 antibodies and immunoconjugates and uses thereof |
US10752683B2 (en) | 2010-02-24 | 2020-08-25 | Immunogen, Inc. | Folate receptor 1 antibodies and immunoconjugates and uses thereof |
US9714295B2 (en) | 2010-03-04 | 2017-07-25 | Macrogenics, Inc. | Antibodies reactive with B7-H3, immunologically active fragments thereof and uses thereof |
US9896508B2 (en) | 2010-03-04 | 2018-02-20 | Macrogenics, Inc. | Antibodies reactive with B7-H3 and uses thereof |
US9714296B2 (en) | 2010-03-04 | 2017-07-25 | Macrogenics, Inc. | Antibodies reactive with B7-H3, immunologically active fragments thereof and uses thereof |
US10730945B2 (en) | 2010-03-04 | 2020-08-04 | Macrogenics, Inc. | Antibodies reactive with B7-H3 and users thereof |
US10683364B2 (en) | 2010-03-04 | 2020-06-16 | Macrogenics, Inc. | Antibodies reactive with B7-H3, immunologically active fragments thereof and uses thereof |
WO2011119661A1 (en) | 2010-03-24 | 2011-09-29 | Genentech, Inc. | Anti-lrp6 antibodies |
US10745467B2 (en) | 2010-03-26 | 2020-08-18 | The Trustees Of Dartmouth College | VISTA-Ig for treatment of autoimmune, allergic and inflammatory disorders |
US10781254B2 (en) | 2010-03-26 | 2020-09-22 | The Trustees Of Dartmouth College | VISTA regulatory T cell mediator protein, VISTA binding agents and use thereof |
US10968273B2 (en) | 2010-04-05 | 2021-04-06 | Fundacio Privada Institut D'investigacio Oncologica Vall D'hebron (Vhio) | Antibody recognizing human leukemia inhibitory factor (LIF) and use of anti-LIF antibodies in the treatment of diseases associated with unwanted cell proliferation |
US10338069B2 (en) | 2010-04-12 | 2019-07-02 | Academia Sinica | Glycan arrays for high throughput screening of viruses |
US9221901B2 (en) | 2010-04-30 | 2015-12-29 | Alexion Pharmaceuticals, Inc. | Methods of treating complement-associated disorders with anti-C5a antibodies |
WO2011137395A1 (en) | 2010-04-30 | 2011-11-03 | Rother Russell P | Anti-c5a antibodies and methods for using the antibodies |
US9371378B1 (en) | 2010-04-30 | 2016-06-21 | Alexion Pharmaceuticals, Inc. | Anti-C5a antibodies |
US11407821B2 (en) | 2010-04-30 | 2022-08-09 | Alexion Pharmaceuticals, Inc. | Anti-C5A antibodies |
US9469690B2 (en) | 2010-04-30 | 2016-10-18 | Alexion Pharmaceuticals, Inc. | Methods of treating complement-associated disorders with anti-C5a antibodies |
US10450370B2 (en) | 2010-04-30 | 2019-10-22 | Alexion Pharmaceuticals, Inc. | Anti-C5a antibodies |
US9963503B2 (en) | 2010-04-30 | 2018-05-08 | Alexion Pharmaceuticals, Inc. | Methods of producing anti-C5a antibodies |
EP2824111A2 (en) | 2010-04-30 | 2015-01-14 | Alexion Pharmaceuticals, Inc. | Anti-C5A Antibodies and Methods for Using the Antibodies |
US9434784B1 (en) | 2010-04-30 | 2016-09-06 | Alexion Pharmaceuticals, Inc. | Nucleic acids encodng anti-C5A antibodies |
US9309310B2 (en) | 2010-04-30 | 2016-04-12 | Alexion Pharmaceuticals, Inc. | Nucleic acids encoding anti-C5a antibodies |
WO2011138392A1 (en) | 2010-05-06 | 2011-11-10 | Novartis Ag | Compositions and methods of use for therapeutic low density lipoprotein -related protein 6 (lrp6) antibodies |
EP3345926A1 (en) | 2010-05-06 | 2018-07-11 | Novartis AG | Compositions and methods of use for therapeutic low density lipoprotein-related protein 6 (lrp6) antibodies |
WO2011138391A1 (en) | 2010-05-06 | 2011-11-10 | Novartis Ag | Compositions and methods of use for therapeutic low density lipoprotein - related protein 6 (lrp6) multivalent antibodies |
EP4234698A2 (en) | 2010-05-06 | 2023-08-30 | Novartis AG | Compositions and methods of use for therapeutic low density lipoprotein-related protein 6 (lrp6) antibodies |
WO2011147834A1 (en) | 2010-05-26 | 2011-12-01 | Roche Glycart Ag | Antibodies against cd19 and uses thereof |
US8771966B2 (en) | 2010-06-03 | 2014-07-08 | Genentech, Inc. | Immuno-PET imaging of antibodies and immunoconjugates and uses therefor |
WO2011153346A1 (en) | 2010-06-03 | 2011-12-08 | Genentech, Inc. | Immuno-pet imaging of antibodies and immunoconjugates and uses therefor |
US8853369B2 (en) | 2010-06-18 | 2014-10-07 | Genentech, Inc. | Anti-Axl antibodies and methods of use |
EP3098240A2 (en) | 2010-06-18 | 2016-11-30 | F. Hoffmann-La Roche AG | Anti-axl antibodies and methods of use |
USRE47761E1 (en) | 2010-06-18 | 2019-12-10 | Genentech, Inc. | Anti-axl antibodies and methods of use |
WO2011161119A1 (en) | 2010-06-22 | 2011-12-29 | F. Hoffmann-La Roche Ag | Antibodies against insulin-like growth factor i receptor and uses thereof |
US9815890B2 (en) | 2010-06-22 | 2017-11-14 | The Regents Of The University Of Colorado, A Body Corporate | Antibodies to the C3d fragment of complement component 3 |
USRE49339E1 (en) | 2010-06-22 | 2022-12-20 | The Regents Of The University Of Colorado, A Body Corporate | Antibodies to the C3D fragment of complement component 3 |
WO2011161189A1 (en) | 2010-06-24 | 2011-12-29 | F. Hoffmann-La Roche Ag | Anti-hepsin antibodies and methods of use |
WO2012006503A1 (en) | 2010-07-09 | 2012-01-12 | Genentech, Inc. | Anti-neuropilin antibodies and methods of use |
WO2012010582A1 (en) | 2010-07-21 | 2012-01-26 | Roche Glycart Ag | Anti-cxcr5 antibodies and methods of use |
WO2012018771A1 (en) | 2010-08-03 | 2012-02-09 | Genentech, Inc. | Chronic lymphocytic leukemia (cll) biomarkers |
WO2012017003A1 (en) | 2010-08-05 | 2012-02-09 | F. Hoffmann-La Roche Ag | Anti-mhc antibody anti-viral cytokine fusion protein |
WO2012020038A1 (en) | 2010-08-13 | 2012-02-16 | Roche Glycart Ag | Anti-tenascin-c a2 antibodies and methods of use |
WO2012020006A2 (en) | 2010-08-13 | 2012-02-16 | Roche Glycart Ag | Anti-fap antibodies and methods of use |
WO2012020096A1 (en) | 2010-08-13 | 2012-02-16 | Medimmune Limited | Monomeric polypeptides comprising variant fc regions and methods of use |
EP3333194A1 (en) | 2010-08-13 | 2018-06-13 | Roche Glycart AG | Anti-fap antibodies and methods of use |
WO2012022734A2 (en) | 2010-08-16 | 2012-02-23 | Medimmune Limited | Anti-icam-1 antibodies and methods of use |
WO2012022814A1 (en) | 2010-08-20 | 2012-02-23 | Novartis Ag | Antibodies for epidermal growth factor receptor 3 (her3) |
US8883975B2 (en) | 2010-08-25 | 2014-11-11 | Hoffmann-La Roche, Inc. | Antibodies against IL-18R1 and uses thereof |
WO2012025536A1 (en) | 2010-08-25 | 2012-03-01 | F. Hoffmann-La Roche Ag | Antibodies against il-18r1 and uses thereof |
WO2012031027A1 (en) | 2010-08-31 | 2012-03-08 | Genentech, Inc. | Biomarkers and methods of treatment |
EP3264089A1 (en) | 2010-08-31 | 2018-01-03 | Genentech, Inc. | Biomarkers and methods of treatment |
WO2012035518A1 (en) | 2010-09-17 | 2012-03-22 | Compugen Ltd. | Compositions and methods for treatment of drug resistant multiple myeloma |
WO2012047968A2 (en) | 2010-10-05 | 2012-04-12 | Genentech, Inc. | Mutant smoothened and methods of using the same |
WO2012045703A1 (en) | 2010-10-05 | 2012-04-12 | Novartis Ag | Anti-il12rbeta1 antibodies and their use in treating autoimmune and inflammatory disorders |
WO2012064836A1 (en) | 2010-11-10 | 2012-05-18 | Genentech, Inc. | Methods and compositions for neural disease immunotherapy |
EP3176184A1 (en) | 2010-11-10 | 2017-06-07 | F. Hoffmann-La Roche AG | Methods and compositions for neural disease immunotherapy |
US9809647B2 (en) | 2010-11-19 | 2017-11-07 | Eisai R&D Management Co., Ltd. | Neutralizing anti-CCL20 antibodies |
US10208129B2 (en) | 2010-12-06 | 2019-02-19 | National Research Council Of Canada | Antibodies selective for cells presenting ErbB2 at high density |
US9127060B2 (en) | 2010-12-15 | 2015-09-08 | Wyeth Llc | Anti-Notch1 antibodies |
US9995755B2 (en) | 2010-12-16 | 2018-06-12 | Genentech, Inc. | Diagnosis and treatments relating to TH2 inhibition |
US11226341B2 (en) | 2010-12-16 | 2022-01-18 | Genentech, Inc. | Method of treating asthma using an IL-13 antibody |
US9684000B2 (en) | 2010-12-16 | 2017-06-20 | Genentech, Inc. | Diagnosis and treatments relating to TH2 inhibition |
EP3447491A2 (en) | 2010-12-16 | 2019-02-27 | F. Hoffmann-La Roche AG | Diagnosis and treatments relating to th2 inhibition |
EP3296321A1 (en) | 2010-12-20 | 2018-03-21 | F. Hoffmann-La Roche AG | Anti-mesothelin antibodies and immunoconjugates |
WO2012087962A2 (en) | 2010-12-20 | 2012-06-28 | Genentech, Inc. | Anti-mesothelin antibodies and immunoconjugates |
WO2012088313A1 (en) | 2010-12-22 | 2012-06-28 | Genentech, Inc. | Anti-pcsk9 antibodies and methods of use |
WO2012092539A2 (en) | 2010-12-31 | 2012-07-05 | Takeda Pharmaceutical Company Limited | Antibodies to dll4 and uses thereof |
WO2012100346A1 (en) | 2011-01-24 | 2012-08-02 | Ym Biosciences Inc. | Antibodies selective for cells presenting egfr at high density |
US10570211B2 (en) | 2011-01-24 | 2020-02-25 | Gilead Sciences, Inc. | Antibodies selective for cells presenting EGFR at high density |
WO2012106634A1 (en) | 2011-02-03 | 2012-08-09 | Alexion Pharmaceuticals, Inc. | Use of an anti-cd200 antibody for prolonging the survival of allografts |
US10611825B2 (en) | 2011-02-28 | 2020-04-07 | Hoffmann La-Roche Inc. | Monovalent antigen binding proteins |
US10793621B2 (en) | 2011-02-28 | 2020-10-06 | Hoffmann-La Roche Inc. | Nucleic acid encoding dual Fc antigen binding proteins |
US9428789B2 (en) | 2011-03-21 | 2016-08-30 | Biodesy, Inc. | Classification of kinase inhibitors using nonlinear optical techniques |
US8969526B2 (en) | 2011-03-29 | 2015-03-03 | Roche Glycart Ag | Antibody Fc variants |
US11135305B2 (en) | 2011-04-01 | 2021-10-05 | Immunogen, Inc. | Methods for increasing efficacy of FOLR1 cancer therapy |
US8709432B2 (en) | 2011-04-01 | 2014-04-29 | Immunogen, Inc. | Methods for increasing efficacy of FOLR1 cancer therapy |
WO2012138975A1 (en) | 2011-04-07 | 2012-10-11 | Genentech, Inc. | Anti-fgfr4 antibodies and methods of use |
US10214579B2 (en) | 2011-04-13 | 2019-02-26 | Bristol-Myers Squibb Company | Fc fusion proteins comprising novel linkers or arrangements |
WO2012142515A2 (en) | 2011-04-13 | 2012-10-18 | Bristol-Myers Squibb Company | Fc fusion proteins comprising novel linkers or arrangements |
EP3896083A1 (en) | 2011-04-13 | 2021-10-20 | Bristol-Myers Squibb Company | Fc fusion proteins comprising novel linkers or arrangements |
EP3144320A1 (en) | 2011-04-13 | 2017-03-22 | Bristol-Myers Squibb Company | Fc fusion proteins comprising novel linkers or arrangements |
EP3415528A2 (en) | 2011-04-13 | 2018-12-19 | Bristol-Myers Squibb Company | Fc fusion proteins comprising novel linkers or arrangements |
US9469676B2 (en) | 2011-04-13 | 2016-10-18 | Bristol-Myers Squibb Company | Fc fusion proteins comprising novel linkers or arrangements |
WO2012140627A1 (en) | 2011-04-15 | 2012-10-18 | Compugen Ltd. | Polypeptides and polynucleotides, and uses thereof for treatment of immune related disorders and cancer |
EP3549952A1 (en) | 2011-04-20 | 2019-10-09 | Acceleron Pharma Inc. | Endoglin polypeptides and uses thereof |
WO2012145539A1 (en) | 2011-04-20 | 2012-10-26 | Acceleron Pharma, Inc. | Endoglin polypeptides and uses thereof |
WO2012146630A1 (en) | 2011-04-29 | 2012-11-01 | F. Hoffmann-La Roche Ag | N-terminal acylated polypeptides, methods for their production and uses thereof |
WO2012151248A2 (en) | 2011-05-02 | 2012-11-08 | Millennium Pharmaceuticals, Inc. | FORMULATION FOR ANTI-α4β7 ANTIBODY |
EP3311834A1 (en) | 2011-05-02 | 2018-04-25 | Millennium Pharmaceuticals, Inc. | Formulation for anti-alpha4beta7 antibody |
US9663579B2 (en) | 2011-05-02 | 2017-05-30 | Millennium Pharmaceuticals, Inc. | Formulation for anti-α4β7 antibody |
US10143752B2 (en) | 2011-05-02 | 2018-12-04 | Millennium Pharmaceuticals, Inc. | Methods of treating ulcerative colitis |
US11560434B2 (en) | 2011-05-02 | 2023-01-24 | Millennium Pharmaceuticals, Inc. | Formulation for anti-α4β7 antibody |
US10040855B2 (en) | 2011-05-02 | 2018-08-07 | Millennium Pharmaceuticals, Inc. | Formulation for anti-α4β7 antibody |
US10004808B2 (en) | 2011-05-02 | 2018-06-26 | Millennium Pharmaceuticals, Inc. | Methods of treating ulcerative colitis |
WO2012151247A2 (en) | 2011-05-02 | 2012-11-08 | Millennium Pharmaceuticals, Inc. | FORMULATION FOR ANTI-α4β7 ANTIBODY |
EP3263178A1 (en) | 2011-05-02 | 2018-01-03 | Millennium Pharmaceuticals, Inc. | Formulation for anti-alpha4beta7 antibody |
EP3329965A1 (en) | 2011-05-02 | 2018-06-06 | Millennium Pharmaceuticals, Inc. | Dosing regimen of anti-alpha4beta7-antibodies |
US9764033B2 (en) | 2011-05-02 | 2017-09-19 | Millennium Pharmaceuticals, Inc. | Formulation for anti-α4β7 antibody |
WO2012155019A1 (en) | 2011-05-12 | 2012-11-15 | Genentech, Inc. | Multiple reaction monitoring lc-ms/ms method to detect therapeutic antibodies in animal samples using framework signature pepides |
WO2012156309A1 (en) | 2011-05-13 | 2012-11-22 | Millegen | Antibodies against her3 |
WO2012158704A1 (en) | 2011-05-16 | 2012-11-22 | Genentech, Inc. | Fgfr1 agonists and methods of use |
EP3219730A1 (en) | 2011-05-16 | 2017-09-20 | F. Hoffmann-La Roche AG | Fgfr1 agonists and methods of use |
US9376495B2 (en) | 2011-05-21 | 2016-06-28 | Macrogenics, Inc. | Deimmunized serum-binding domains and their use in extending serum half-life |
WO2012162561A2 (en) | 2011-05-24 | 2012-11-29 | Zyngenia, Inc. | Multivalent and monovalent multispecific complexes and their uses |
WO2012172495A1 (en) | 2011-06-14 | 2012-12-20 | Novartis Ag | Compositions and methods for antibodies targeting tem8 |
WO2012171996A1 (en) | 2011-06-15 | 2012-12-20 | F. Hoffmann-La Roche Ag | Anti-human epo receptor antibodies and methods of use |
WO2012172521A1 (en) | 2011-06-16 | 2012-12-20 | Novartis Ag | Soluble proteins for use as therapeutics |
WO2012175508A1 (en) | 2011-06-22 | 2012-12-27 | F. Hoffmann-La Roche Ag | Removal of target cells by circulating virus-specific cytotoxic t-cells using mhc class i comprising complexes |
WO2012175692A1 (en) | 2011-06-22 | 2012-12-27 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Anti-axl antibodies and uses thereof |
WO2012175691A1 (en) | 2011-06-22 | 2012-12-27 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Anti-axl antibodies and uses thereof |
WO2013003625A2 (en) | 2011-06-28 | 2013-01-03 | Oxford Biotherapeutics Ltd. | Antibodies |
US9487589B2 (en) | 2011-06-30 | 2016-11-08 | Genentech, Inc. | Anti-c-met-antibody formulations |
WO2013003680A1 (en) | 2011-06-30 | 2013-01-03 | Genentech, Inc. | Anti-c-met antibody formulations |
WO2013006437A1 (en) | 2011-07-01 | 2013-01-10 | Novartis Ag | Method for treating metabolic disorders |
WO2013008171A1 (en) | 2011-07-11 | 2013-01-17 | Glenmark Pharmaceuticals S.A. | Antibodies that bind to ox40 and their uses |
WO2013010955A1 (en) | 2011-07-15 | 2013-01-24 | Morphosys Ag | Antibodies that are cross-reactive for macrophage migration inhibitory factor (mif) and d-dopachrome tautomerase (d-dt) |
WO2013025853A1 (en) | 2011-08-17 | 2013-02-21 | Genentech, Inc. | Neuregulin antibodies and uses thereof |
WO2013026832A1 (en) | 2011-08-23 | 2013-02-28 | Roche Glycart Ag | Anti-mcsp antibodies |
WO2013040433A1 (en) | 2011-09-15 | 2013-03-21 | Genentech, Inc. | Methods of promoting differentiation |
WO2013043715A1 (en) | 2011-09-19 | 2013-03-28 | Genentech, Inc. | Combination treatments comprising c-met antagonists and b-raf antagonists |
US10793633B2 (en) | 2011-09-30 | 2020-10-06 | Dana-Farber Cancer Institute, Inc. | Therapeutic peptides |
WO2013052155A1 (en) | 2011-10-05 | 2013-04-11 | Genentech, Inc. | Methods of treating liver conditions using notch2 antagonists |
EP3461839A1 (en) | 2011-10-14 | 2019-04-03 | F. Hoffmann-La Roche AG | Anti-htra1 antibodies and methods of use |
US8623821B2 (en) | 2011-10-14 | 2014-01-07 | Genentech, Inc. | Zymogen activators |
EP3653222A1 (en) | 2011-10-14 | 2020-05-20 | Novartis AG | Antibodies and methods for wnt pathway-related diseases |
WO2013054307A2 (en) | 2011-10-14 | 2013-04-18 | Novartis Ag | Antibodies and methods for wnt pathway-related diseases |
WO2013055998A1 (en) | 2011-10-14 | 2013-04-18 | Genentech, Inc. | ANTI-HtrA1 ANTIBODIES AND METHODS OF USE |
WO2013056008A1 (en) | 2011-10-14 | 2013-04-18 | Genentech, Inc. | Zymogen activators |
WO2013056148A2 (en) | 2011-10-15 | 2013-04-18 | Genentech, Inc. | Methods of using scd1 antagonists |
WO2013059531A1 (en) | 2011-10-20 | 2013-04-25 | Genentech, Inc. | Anti-gcgr antibodies and uses thereof |
WO2013063001A1 (en) | 2011-10-28 | 2013-05-02 | Genentech, Inc. | Therapeutic combinations and methods of treating melanoma |
US9580509B2 (en) | 2011-11-07 | 2017-02-28 | Medimmune, Llc | Multispecific and multivalent binding proteins and uses thereof |
WO2013070565A1 (en) | 2011-11-07 | 2013-05-16 | Medimmune, Llc | Multispecific and multivalent binding proteins and uses thereof |
WO2013078170A1 (en) | 2011-11-21 | 2013-05-30 | Genentech, Inc. | Purification of anti-c-met antibodies |
EP3590538A1 (en) | 2011-12-05 | 2020-01-08 | Novartis AG | Antibodies for epidermal growth factor receptor 3 (her3) |
WO2013084148A2 (en) | 2011-12-05 | 2013-06-13 | Novartis Ag | Antibodies for epidermal growth factor receptor 3 (her3) directed to domain ii of her3 |
WO2013084147A2 (en) | 2011-12-05 | 2013-06-13 | Novartis Ag | Antibodies for epidermal growth factor receptor 3 (her3) |
WO2013083497A1 (en) | 2011-12-06 | 2013-06-13 | F. Hoffmann-La Roche Ag | Antibody formulation |
US9217018B2 (en) | 2011-12-15 | 2015-12-22 | Sergei B Onikienko | HSP70 fusion protein conjugates and uses thereof |
EP3330288A1 (en) | 2011-12-21 | 2018-06-06 | Novartis AG | Compositions and methods for antibodies targeting factor p |
WO2013093762A1 (en) | 2011-12-21 | 2013-06-27 | Novartis Ag | Compositions and methods for antibodies targeting factor p |
WO2013096791A1 (en) | 2011-12-23 | 2013-06-27 | Genentech, Inc. | Process for making high concentration protein formulations |
WO2013106485A2 (en) | 2012-01-09 | 2013-07-18 | The Scripps Research Institute | Ultralong complementarity determining regions and uses thereof |
WO2013106489A1 (en) | 2012-01-09 | 2013-07-18 | The Scripps Research Institute | Humanized antibodies with ultralong cdr3s |
EP3663314A1 (en) | 2012-01-09 | 2020-06-10 | The Scripps Research Institute | Humanized antibodies with ultralong cdr3s |
WO2013109819A1 (en) | 2012-01-18 | 2013-07-25 | Genentech, Inc. | Anti-lrp5 antibodies and methods of use |
WO2013109856A2 (en) | 2012-01-18 | 2013-07-25 | Genentech, Inc. | Methods of using fgf19 modulators |
US9617336B2 (en) | 2012-02-01 | 2017-04-11 | Compugen Ltd | C10RF32 antibodies, and uses thereof for treatment of cancer |
WO2013120056A1 (en) | 2012-02-11 | 2013-08-15 | Genentech, Inc. | R-spondin translocations and methods using the same |
WO2013120929A1 (en) | 2012-02-15 | 2013-08-22 | F. Hoffmann-La Roche Ag | Fc-receptor based affinity chromatography |
US11814409B2 (en) | 2012-02-15 | 2023-11-14 | Hoffmann-La Roche Inc. | Fc-receptor based affinity chromatography |
US9139863B2 (en) | 2012-03-16 | 2015-09-22 | Genentech, Inc. | Engineered conformationally-stabilized proteins |
WO2013137920A1 (en) | 2012-03-16 | 2013-09-19 | Genentech, Inc. | Engineered conformationally-stabilized proteins |
WO2013148315A1 (en) | 2012-03-27 | 2013-10-03 | Genentech, Inc. | Diagnosis and treatments relating to her3 inhibitors |
WO2013149159A1 (en) | 2012-03-30 | 2013-10-03 | Genentech, Inc. | Anti-lgr5 antibodies and immunoconjugates |
US9175089B2 (en) | 2012-03-30 | 2015-11-03 | Genentech, Inc. | Anti-LGR5 antibodies and immunoconjugates |
WO2013151762A1 (en) | 2012-04-05 | 2013-10-10 | Ac Immune S.A. | Humanized tau antibody |
US10130714B2 (en) | 2012-04-14 | 2018-11-20 | Academia Sinica | Enhanced anti-influenza agents conjugated with anti-inflammatory activity |
WO2013162654A1 (en) | 2012-04-25 | 2013-10-31 | Biodesy, Llc | Methods for detecting allosteric modulators of proteins |
US9662405B2 (en) | 2012-04-26 | 2017-05-30 | Thomas Jefferson University | Method of treating cancer by administering chimeric antigen receptor comprising anti-GCC antibody |
US9156915B2 (en) | 2012-04-26 | 2015-10-13 | Thomas Jefferson University | Anti-GCC antibody molecules |
US9056910B2 (en) | 2012-05-01 | 2015-06-16 | Genentech, Inc. | Anti-PMEL17 antibodies and immunoconjugates |
US10196454B2 (en) | 2012-05-01 | 2019-02-05 | Genentech, Inc. | Anti-PMEL17 antibodies and immunoconjugates |
US9597411B2 (en) | 2012-05-01 | 2017-03-21 | Genentech, Inc. | Anti-PMEL17 antibodies and immunoconjugates |
WO2013165940A1 (en) | 2012-05-01 | 2013-11-07 | Genentech, Inc. | Anti-pmel17 antibodies and immunoconjugates |
WO2013170191A1 (en) | 2012-05-11 | 2013-11-14 | Genentech, Inc. | Methods of using antagonists of nad biosynthesis from nicotinamide |
EP3605090A1 (en) | 2012-05-23 | 2020-02-05 | F. Hoffmann-La Roche AG | Selection method for therapeutic agents |
WO2013177470A1 (en) | 2012-05-23 | 2013-11-28 | Genentech, Inc. | Selection method for therapeutic agents |
WO2013184514A1 (en) | 2012-06-04 | 2013-12-12 | Irm Llc | Site-specific labeling methods and molecules produced thereby |
WO2013183032A2 (en) | 2012-06-08 | 2013-12-12 | Glenmark Pharmaceuticals S.A. | Anti-trka antibodies with enhanced inhibitory properties and derivatives thereof |
US9266961B2 (en) | 2012-06-15 | 2016-02-23 | Genentech, Inc. | Anti-PCSK9 antibodies, formulations, dosing, and methods of use |
US11180557B2 (en) | 2012-06-22 | 2021-11-23 | King's College London | Vista modulators for diagnosis and treatment of cancer |
US10933115B2 (en) | 2012-06-22 | 2021-03-02 | The Trustees Of Dartmouth College | VISTA antagonist and methods of use |
US11752189B2 (en) | 2012-06-22 | 2023-09-12 | The Trustees Of Dartmouth College | Vista antagonist and methods of use |
WO2014008218A1 (en) | 2012-07-02 | 2014-01-09 | Bristol-Myers Squibb Company | Optimization of antibodies that bind lymphocyte activation gene-3 (lag-3), and uses thereof |
EP3275899A1 (en) | 2012-07-02 | 2018-01-31 | Bristol-Myers Squibb Company | Optimization of antibodies that bind lymphocyte activation gene-3 (lag-3), and uses thereof |
EP3795592A1 (en) | 2012-07-02 | 2021-03-24 | Bristol-Myers Squibb Company | Optimization of antibodies that bind lymphocyte activation gene-3 (lag-3), and uses thereof |
US9765153B2 (en) | 2012-07-04 | 2017-09-19 | Hoffmann-La Roche Inc. | Anti-biotin antibodies and methods of use |
US10517945B2 (en) | 2012-07-04 | 2019-12-31 | Hoffman-La Roche Inc. | Covalently linked antigen-antibody conjugates |
WO2014006123A1 (en) | 2012-07-04 | 2014-01-09 | F. Hoffmann-La Roche Ag | Anti-biotin antibodies and methods of use |
WO2014006118A1 (en) | 2012-07-04 | 2014-01-09 | F. Hoffmann-La Roche Ag | Anti-theophylline antibodies and methods of use |
WO2014006124A1 (en) | 2012-07-04 | 2014-01-09 | F. Hoffmann-La Roche Ag | Covalently linked antigen-antibody conjugates |
US9925272B2 (en) | 2012-07-04 | 2018-03-27 | Hoffmann-La Roche Inc. | Anti-theophylline antibodies and methods of use |
EP3578660A1 (en) | 2012-07-05 | 2019-12-11 | F. Hoffmann-La Roche AG | Expression and secretion system |
WO2014008391A1 (en) | 2012-07-05 | 2014-01-09 | Genentech, Inc. | Expression and secretion system |
WO2014011521A1 (en) | 2012-07-09 | 2014-01-16 | Genentech, Inc. | Immunoconjugates comprising anti - cd79b antibodies |
WO2014011519A1 (en) | 2012-07-09 | 2014-01-16 | Genentech, Inc. | Immunoconjugates comprising anti-cd79b antibodies |
WO2014011520A1 (en) | 2012-07-09 | 2014-01-16 | Genentech, Inc. | Immunoconjugates comprising anti-cd22 antibodies |
WO2014011518A1 (en) | 2012-07-09 | 2014-01-16 | Genentech, Inc. | Immunoconjugates comprising anti-cd22 antibodies |
US10683345B2 (en) | 2012-07-13 | 2020-06-16 | Roche Glycart Ag | Bispecific anti-VEGF/anti-ANG-2 antibodies and their use in the treatment of ocular vascular diseases |
US9695233B2 (en) | 2012-07-13 | 2017-07-04 | Roche Glycart Ag | Bispecific anti-VEGF/anti-ANG-2 antibodies and their use in the treatment of ocular vascular diseases |
EP4063391A1 (en) | 2012-07-25 | 2022-09-28 | Celldex Therapeutics, Inc. | Anti-kit antibodies and uses thereof |
EP3381943A1 (en) | 2012-07-25 | 2018-10-03 | Celldex Therapeutics, Inc. | Anti-kit antibodies and uses thereof |
WO2014018625A1 (en) | 2012-07-25 | 2014-01-30 | Kolltan Pharmaceuticals, Inc. | Anti-kit antibodies and uses thereof |
WO2014020056A1 (en) | 2012-08-02 | 2014-02-06 | F. Hoffmann-La Roche Ag | METHOD FOR PRODUCING SOLUBLE FcR AS Fc-FUSION WITH INERT IMMUNOGLOBULIN Fc-REGION AND USES THEREOF |
US10214765B2 (en) | 2012-08-18 | 2019-02-26 | Academia Sinica | Cell-permeable probes for identification and imaging of sialidases |
US9200073B2 (en) | 2012-08-31 | 2015-12-01 | Immunogen, Inc. | Diagnostic assays and kits for detection of folate receptor 1 |
US10613093B2 (en) | 2012-08-31 | 2020-04-07 | Immunogen, Inc. | Diagnostic assays and kits for detection of folate receptor 1 |
US9702881B2 (en) | 2012-08-31 | 2017-07-11 | Immunogen, Inc. | Diagnostic assays and kits for detection of folate receptor 1 |
US10180432B2 (en) | 2012-08-31 | 2019-01-15 | Immunogen, Inc. | Diagnostic assays and kits for detection of folate receptor 1 |
WO2014037899A2 (en) | 2012-09-07 | 2014-03-13 | Novartis Ag | Il-18 binding molecules |
EP3725805A1 (en) | 2012-09-07 | 2020-10-21 | Novartis AG | Il-18 binding molecules |
US11529416B2 (en) | 2012-09-07 | 2022-12-20 | Kings College London | Vista modulators for diagnosis and treatment of cancer |
US11578372B2 (en) | 2012-11-05 | 2023-02-14 | Foundation Medicine, Inc. | NTRK1 fusion molecules and uses thereof |
WO2014072306A1 (en) | 2012-11-08 | 2014-05-15 | F. Hoffmann-La Roche Ag | Her3 antigen binding proteins binding to the beta-hairpin of her3 |
EP3461501A1 (en) | 2012-11-13 | 2019-04-03 | F. Hoffmann-La Roche AG | Anti-hemagglutinin antibodies and methods of use |
WO2014078268A2 (en) | 2012-11-13 | 2014-05-22 | Genentech, Inc. | Anti-hemagglutinin antibodies and methods of use |
EP2733153A1 (en) | 2012-11-15 | 2014-05-21 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Methods for the preparation of immunoconjugates and uses thereof |
WO2014084859A1 (en) | 2012-11-30 | 2014-06-05 | Novartis Ag | Molecules and methods for modulating tmem16a activities |
EP3851454A1 (en) | 2012-12-05 | 2021-07-21 | Novartis AG | Compositions and methods for antibodies targeting epo |
WO2014089111A1 (en) | 2012-12-05 | 2014-06-12 | Novartis Ag | Compositions and methods for antibodies targeting epo |
WO2014093396A1 (en) | 2012-12-10 | 2014-06-19 | Biogen Idec Ma Inc. | Anti-blood dendritic cell antigen 2 antibodies and uses thereof |
EP3686218A1 (en) | 2012-12-10 | 2020-07-29 | Biogen MA Inc. | Anti-blood dendritic cell antigen 2 antibodies and uses thereof |
US9969789B2 (en) | 2012-12-17 | 2018-05-15 | Trillium Therapeutics Inc. | Treatment of CD47+ disease cells with SIRP alpha-Fc fusions |
US10906954B2 (en) | 2012-12-17 | 2021-02-02 | Trillium Therapeutics Inc. | Treatment of CD47+ disease cells with SIRPα-Fc fusions |
US10501521B2 (en) | 2012-12-21 | 2019-12-10 | Hoffmann-La Roche Inc. | Disulfide-linked multivalent MHC class I comprising multi-function proteins |
US9290576B2 (en) | 2013-01-02 | 2016-03-22 | Glenmark Pharmaceuticals S.A. | Antibodies that bind to TL1A and their uses |
WO2014106602A1 (en) | 2013-01-02 | 2014-07-10 | Glenmark Pharmaceuticals S.A. | Antibodies that bind to tl1a and their uses |
WO2014107739A1 (en) | 2013-01-07 | 2014-07-10 | Eleven Biotherapeutics, Inc. | Antibodies against pcsk9 |
US11771698B2 (en) | 2013-01-18 | 2023-10-03 | Foundation Medicine, Inc. | Methods of treating cholangiocarcinoma |
WO2014116749A1 (en) | 2013-01-23 | 2014-07-31 | Genentech, Inc. | Anti-hcv antibodies and methods of using thereof |
WO2014124316A2 (en) | 2013-02-08 | 2014-08-14 | Irm Llc | Specific sites for modifying antibodies to make immunoconjugates |
WO2015198217A2 (en) | 2013-02-08 | 2015-12-30 | Novartis Ag | Compositions and methods for long-acting antibodies targeting il-17 |
EP3929217A2 (en) | 2013-02-08 | 2021-12-29 | Novartis AG | Specific sites for modifying antibodies to make immunoconjugates |
EP3656786A1 (en) | 2013-02-08 | 2020-05-27 | Novartis AG | Anti-il-17a antibodies and their use in treating autoimmune and inflammatory disorders |
WO2014124258A2 (en) | 2013-02-08 | 2014-08-14 | Irm Llc | Specific sites for modifying antibodies to make immunoconjugates |
WO2014122613A1 (en) | 2013-02-08 | 2014-08-14 | Novartis Ag | Anti-il-17a antibodies and their use in treating autoimmune and inflammatory disorders |
WO2014126884A1 (en) | 2013-02-12 | 2014-08-21 | Bristol-Myers Squibb Company | High ph protein refolding methods |
WO2014126871A1 (en) | 2013-02-12 | 2014-08-21 | Bristol-Myers Squibb Company | Tangential flow filtration based protein refolding methods |
EP3617220A1 (en) | 2013-02-12 | 2020-03-04 | Bristol-Myers Squibb Company | High ph protein refolding methods |
EP3744728A1 (en) | 2013-02-12 | 2020-12-02 | Bristol-Myers Squibb Company | Tangential flow filtration based protein refolding methods |
EP3299378A1 (en) | 2013-02-12 | 2018-03-28 | Bristol-Myers Squibb Company | High ph protein refolding methods |
WO2014128235A1 (en) | 2013-02-22 | 2014-08-28 | F. Hoffmann-La Roche Ag | Methods of treating cancer and preventing drug resistance |
WO2014131715A1 (en) | 2013-02-26 | 2014-09-04 | Roche Glycart Ag | Anti-mcsp antibodies |
WO2014138364A2 (en) | 2013-03-06 | 2014-09-12 | Genentech, Inc. | Methods of treating and preventing cancer drug resistance |
WO2014160160A2 (en) | 2013-03-13 | 2014-10-02 | Novartis Ag | Antibody drug conjugates |
US9908938B2 (en) | 2013-03-14 | 2018-03-06 | Macrogenics, Inc. | Bispecific molecules that are immunoreactive with immune effector cells that express an activating receptor and an antigen expressed by a cell infected by a virus and uses thereof |
US10150813B2 (en) | 2013-03-14 | 2018-12-11 | Genentech, Inc. | Anti-B7-H4 antibodies and immunoconjugates |
US9562099B2 (en) | 2013-03-14 | 2017-02-07 | Genentech, Inc. | Anti-B7-H4 antibodies and immunoconjugates |
US10730947B2 (en) | 2013-03-14 | 2020-08-04 | Macrogenics, Inc. | Bispecific molecules that are immunoreactive with immune effector cells that express an activating receptor and an antigen expressed by a cell infected by a virus and uses thereof |
WO2014153030A2 (en) | 2013-03-14 | 2014-09-25 | Genentech, Inc. | Methods of treating cancer and preventing cancer drug resistance |
EP3611189A1 (en) | 2013-03-14 | 2020-02-19 | Novartis AG | Antibodies against notch 3 |
WO2014152358A2 (en) | 2013-03-14 | 2014-09-25 | Genentech, Inc. | Combinations of a mek inhibitor compound with an her3/egfr inhibitor compound and methods of use |
WO2014159835A1 (en) | 2013-03-14 | 2014-10-02 | Genentech, Inc. | Anti-b7-h4 antibodies and immunoconjugates |
WO2014159239A2 (en) | 2013-03-14 | 2014-10-02 | Novartis Ag | Antibodies against notch 3 |
US11421031B2 (en) | 2013-03-14 | 2022-08-23 | Macrogenics, Inc. | Bispecific molecules that are immunoreactive with immune effector cells that express an activating receptor and an antigen expressed by a cell infected by a virus and uses thereof |
US11230600B2 (en) | 2013-03-14 | 2022-01-25 | Genentech, Inc. | Anti-B7-H4 antibodies and immunoconjugates |
EP3299391A1 (en) | 2013-03-14 | 2018-03-28 | Genentech, Inc. | Anti-b7-h4 antibodies and immunoconjugates |
US11130791B2 (en) | 2013-03-15 | 2021-09-28 | Genentech, Inc. | Methods for treating metabolic syndrome using IL-22 Fc fusion proteins |
WO2014143739A2 (en) | 2013-03-15 | 2014-09-18 | Biogen Idec Ma Inc. | Anti-alpha v beta 6 antibodies and uses thereof |
WO2014144791A2 (en) | 2013-03-15 | 2014-09-18 | Dana-Farber Cancer Institute, Inc. | Therapeutic peptides |
US9708407B2 (en) | 2013-03-15 | 2017-07-18 | Genzyme Corporation | Anti-CD52 antibodies |
US11155591B2 (en) | 2013-03-15 | 2021-10-26 | Genentech, Inc. | Methods of treating acute pancreatitis using IL-22 fc fusion proteins |
US11136365B2 (en) | 2013-03-15 | 2021-10-05 | Genentech, Inc. | Methods for preventing or treating cardiovascular conditions using il-22 fc fusion proteins |
US11332507B2 (en) | 2013-03-15 | 2022-05-17 | Genentech, Inc. | IL-22 Fc fusion proteins |
WO2014145016A2 (en) | 2013-03-15 | 2014-09-18 | Genentech, Inc. | Il-22 polypeptides and il-22 fc fusion proteins and methods of use |
EP3424530A1 (en) | 2013-03-15 | 2019-01-09 | Zyngenia, Inc. | Multivalent and monovalent multispecific complexes and their uses |
EP3385277A1 (en) | 2013-03-15 | 2018-10-10 | F. Hoffmann-La Roche AG | Il-22 polypeptides and il-22 fc fusion proteins and methods of use |
US10160793B2 (en) | 2013-03-15 | 2018-12-25 | Genentech, Inc. | Methods of treating inflammatory bowel disease using IL-22 Fc fusion proteins |
WO2014144865A2 (en) | 2013-03-15 | 2014-09-18 | Genentech, Inc. | Anti-crth2 antibodies and methods of use |
WO2014144466A1 (en) | 2013-03-15 | 2014-09-18 | Biogen Idec Ma Inc. | Anti-alpha v beta 6 antibodies and uses thereof |
WO2014144850A1 (en) | 2013-03-15 | 2014-09-18 | Genentech, Inc. | Methods of treating cancer and preventing cancer drug resistance |
US10745483B2 (en) | 2013-03-15 | 2020-08-18 | Dana-Farber Cancer Institute, Inc. | Therapeutic peptides |
WO2014151866A1 (en) | 2013-03-15 | 2014-09-25 | Genentech, Inc. | Compositions and methods for diagnosis and treatment of hepatic cancers |
EP3666886A1 (en) | 2013-03-15 | 2020-06-17 | Dana-Farber Cancer Institute, Inc. | Therapeutic peptides |
EP4356960A2 (en) | 2013-03-15 | 2024-04-24 | F. Hoffmann-La Roche AG | Biomarkers and methods of treating pd-1 and pd-l1 related conditions |
EP3633377A1 (en) | 2013-03-15 | 2020-04-08 | F. Hoffmann-La Roche AG | Biomarkers and methods of treating pd-1 and pd-l1 related conditions |
WO2014151680A1 (en) | 2013-03-15 | 2014-09-25 | Biogen Idec Ma Inc. | Treatment and prevention of acute kidney injury using anti-alpha v beta 5 antibodies |
WO2014151006A2 (en) | 2013-03-15 | 2014-09-25 | Genentech, Inc. | Biomarkers and methods of treating pd-1 and pd-l1 related conditions |
WO2014150877A2 (en) | 2013-03-15 | 2014-09-25 | Ac Immune S.A. | Anti-tau antibodies and methods of use |
US10584155B2 (en) | 2013-03-15 | 2020-03-10 | Genentech, Inc. | Pharmaceutical compositions of IL-22 Fc fusion proteins |
US10544198B2 (en) | 2013-03-15 | 2020-01-28 | Genentech, Inc. | Methods of accelerating or improving wound healing using IL-22 FC fusion proteins |
EP3514178A1 (en) | 2013-03-15 | 2019-07-24 | Novartis AG | Antibody drug conjugates |
US9815880B2 (en) | 2013-03-15 | 2017-11-14 | Genentech, Inc. | IL-22 Fc fusion proteins |
US10087227B2 (en) | 2013-03-15 | 2018-10-02 | Genentech, Inc. | Nucleic acids encoding IL-22 Fc fusion proteins |
EP3878866A1 (en) | 2013-04-29 | 2021-09-15 | F. Hoffmann-La Roche AG | Fc-receptor binding modified asymmetric antibodies and methods of use |
WO2014177460A1 (en) | 2013-04-29 | 2014-11-06 | F. Hoffmann-La Roche Ag | Human fcrn-binding modified antibodies and methods of use |
WO2014177461A1 (en) | 2013-04-29 | 2014-11-06 | F. Hoffmann-La Roche Ag | Fcrn-binding abolished anti-igf-1r antibodies and their use in the treatment of vascular eye diseases |
EP3628685A1 (en) | 2013-04-29 | 2020-04-01 | F. Hoffmann-La Roche AG | Human fcrn-binding modified antibodies and methods of use |
EP4324480A2 (en) | 2013-05-20 | 2024-02-21 | F. Hoffmann-La Roche AG | Anti-transferrin receptor antibodies and methods of use |
EP3594240A1 (en) | 2013-05-20 | 2020-01-15 | F. Hoffmann-La Roche AG | Anti-transferrin receptor antibodies and methods of use |
US10053510B2 (en) | 2013-05-24 | 2018-08-21 | Promis Neurosciences Inc. | FasR antibodies and methods of use |
WO2014205300A2 (en) | 2013-06-21 | 2014-12-24 | Novartis Ag | Lectin-like oxidized ldl receptor1 antibodies and methods of use |
WO2014205302A2 (en) | 2013-06-21 | 2014-12-24 | Novartis Ag | Lectin-like oxidized ldl receptor1 antibodies and methods of use |
US10086054B2 (en) | 2013-06-26 | 2018-10-02 | Academia Sinica | RM2 antigens and use thereof |
US9981030B2 (en) | 2013-06-27 | 2018-05-29 | Academia Sinica | Glycan conjugates and use thereof |
WO2015010100A2 (en) | 2013-07-18 | 2015-01-22 | Fabrus, Inc. | Humanized antibodies with ultralong complementarity determining regions |
WO2015017146A2 (en) | 2013-07-18 | 2015-02-05 | Fabrus, Inc. | Antibodies with ultralong complementarity determining regions |
US10344092B2 (en) | 2013-08-09 | 2019-07-09 | Macrogenics, Inc. | Bi-specific monovalent Fc diabodies that are capable of binding CD32B and CD79b and uses thereof |
US11384149B2 (en) | 2013-08-09 | 2022-07-12 | Macrogenics, Inc. | Bi-specific monovalent Fc diabodies that are capable of binding CD32B and CD79b and uses thereof |
WO2015022658A2 (en) | 2013-08-14 | 2015-02-19 | Novartis Ag | Methods of treating sporadic inclusion body myositis |
EP3705498A1 (en) | 2013-08-22 | 2020-09-09 | Acceleron Pharma Inc. | Tgf-beta receptor type ii variants and uses thereof |
US9932400B2 (en) | 2013-08-23 | 2018-04-03 | Macrogenics, Inc. | Bi-specific monovalent diabodies that are capable of binding to gpA33 and CD3, and uses thereof |
US9822181B2 (en) | 2013-08-23 | 2017-11-21 | Macrogenics, Inc. | Bi-specific monovalent diabodies that are capable of binding CD123 and CD3, and uses thereof |
US10787521B2 (en) | 2013-08-23 | 2020-09-29 | Macrogenics, Inc. | Bi-specific monovalent diabodies that are capable of binding CD123 and CD3, and uses thereof |
US10858430B2 (en) | 2013-08-23 | 2020-12-08 | Macrogenics, Inc. | Bi-specific monovalent diabodies that are capable of binding to gpA33 and CD3, and uses thereof |
US11932701B2 (en) | 2013-08-30 | 2024-03-19 | Immunogen, Inc. | Method for increasing the efficacy of cancer therapy by administering an anti-FOLR1 immunoconjugate |
US11198736B2 (en) | 2013-08-30 | 2021-12-14 | Immunogen, Inc. | Method for identifying an ovarian cancer in a subject likely to respond to anti-folate receptor 1 (FOLR1) antibody |
US9637547B2 (en) | 2013-08-30 | 2017-05-02 | Immunogen, Inc. | Monoclonal antibodies for detection of folate receptor 1 |
US10544230B2 (en) | 2013-08-30 | 2020-01-28 | Immunogen, Inc. | Methods of using antibodies to detect folate receptor 1 (FOLR1) |
US10017578B2 (en) | 2013-08-30 | 2018-07-10 | Immunogen, Inc. | Methods of treating cancer in a patient by administering anti-folate-receptor-1 (FOLR1) antibodies |
US10111951B2 (en) | 2013-09-06 | 2018-10-30 | Academia Sinica | Human iNKT cell activation using glycolipids with altered glycosyl groups |
US10918714B2 (en) | 2013-09-06 | 2021-02-16 | Academia Sinica | Human iNKT cell activation using glycolipids with altered glycosyl groups |
US9834606B2 (en) | 2013-09-13 | 2017-12-05 | Beigene, Ltd | Anti-PD1 antibodies and their use as therapeutics and diagnostics |
US10519235B2 (en) | 2013-09-13 | 2019-12-31 | Beigene Switzerland Gmbh | Anti-PD1 antibodies and their use as therapeutics and diagnostics |
US11186637B2 (en) | 2013-09-13 | 2021-11-30 | Beigene Switzerland Gmbh | Anti-PD1 antibodies and their use as therapeutics and diagnostics |
US9988450B2 (en) | 2013-09-13 | 2018-06-05 | Beigene Switzerland Gmbh | Anti-PD1 antibodies and their use as therapeutics and diagnostics |
US11673951B2 (en) | 2013-09-13 | 2023-06-13 | Beigene Switzerland Gmbh | Anti-PD1 antibodies and their use as therapeutics and diagnostics |
WO2015042108A1 (en) | 2013-09-17 | 2015-03-26 | Genentech, Inc. | Methods of using anti-lgr5 antibodies |
US10246515B2 (en) | 2013-09-17 | 2019-04-02 | Genentech, Inc. | Methods of treating hedgehog-related diseases with an anti-LGR5 antibody |
WO2015046467A1 (en) | 2013-09-27 | 2015-04-02 | 中外製薬株式会社 | Method for producing polypeptide heteromultimer |
EP3733244A1 (en) | 2013-10-02 | 2020-11-04 | Medlmmune, LLC | Neutralizing anti-influenza a antibodies and uses thereof |
US9975963B2 (en) | 2013-10-11 | 2018-05-22 | Genentech, Inc. | NSP4 inhibitors and methods of use |
WO2015052230A1 (en) | 2013-10-11 | 2015-04-16 | F. Hoffmann-La Roche Ag | Multispecific domain exchanged common variable light chain antibodies |
WO2015054670A1 (en) | 2013-10-11 | 2015-04-16 | Genentech, Inc. | Nsp4 inhibitors and methods of use |
US10323099B2 (en) | 2013-10-11 | 2019-06-18 | Hoffmann-La Roche Inc. | Multispecific domain exchanged common variable light chain antibodies |
US10246519B2 (en) | 2013-10-11 | 2019-04-02 | Genentech, Inc. | NSP4 inhibitors and methods of use |
WO2015057939A1 (en) | 2013-10-18 | 2015-04-23 | Biogen Idec Ma Inc. | Anti-s1p4 antibodies and uses thereof |
WO2015058132A2 (en) | 2013-10-18 | 2015-04-23 | Genentech, Inc. | Anti-rspo antibodies and methods of use |
WO2015061441A1 (en) | 2013-10-23 | 2015-04-30 | Genentech, Inc. | Methods of diagnosing and treating eosinophilic disorders |
EP3851118A1 (en) | 2013-10-25 | 2021-07-21 | Acceleron Pharma Inc. | Endoglin peptides to treat fibrotic diseases |
WO2015067986A1 (en) | 2013-11-07 | 2015-05-14 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Neuregulin allosteric anti-her3 antibody |
US11654104B2 (en) | 2013-11-07 | 2023-05-23 | Evive Biotechnology (Shanghai) Ltd | Use of IL-22 dimer in manufacture of a medicament for intravenous administration |
WO2015075011A1 (en) | 2013-11-21 | 2015-05-28 | F. Hoffmann-La Roche Ag | ANTI-alpha-SYNUCLEIN ANTIBODIES AND METHODS OF USE |
US10106611B2 (en) | 2013-12-06 | 2018-10-23 | Dana-Farber Cancer Institute, Inc. | Antibodies that bind to MHC class I polypeptide-related sequence A |
WO2015085210A1 (en) | 2013-12-06 | 2015-06-11 | Dana-Farber Cancer Institute, Inc. | Therapeutic peptides |
WO2015089117A1 (en) | 2013-12-09 | 2015-06-18 | Allakos Inc. | Anti-siglec-8 antibodies and methods of use thereof |
EP3611191A1 (en) | 2013-12-09 | 2020-02-19 | Allakos Inc. | Anti-siglec-8 antibodies and methods of use thereof |
US9546215B2 (en) | 2013-12-09 | 2017-01-17 | Allakos Inc. | Anti-Siglec-8 antibodies and methods of use thereof |
WO2015089344A1 (en) | 2013-12-13 | 2015-06-18 | Genentech, Inc. | Anti-cd33 antibodies and immunoconjugates |
EP3461845A1 (en) | 2013-12-13 | 2019-04-03 | Genentech, Inc. | Anti-cd33 antibodies and immunoconjugates |
WO2015095423A2 (en) | 2013-12-17 | 2015-06-25 | Genentech, Inc. | Combination therapy comprising ox40 binding agonists and pd-1 axis binding antagonists |
WO2015095410A1 (en) | 2013-12-17 | 2015-06-25 | Genentech, Inc. | Methods of treating cancer using pd-1 axis binding antagonists and an anti-cd20 antibody |
US11186650B2 (en) | 2013-12-17 | 2021-11-30 | Genentech, Inc. | Anti-CD3 antibodies and methods of use |
US11530275B2 (en) | 2013-12-17 | 2022-12-20 | Genentech, Inc. | Anti-CD3 antibodies and methods of use |
US11732054B2 (en) | 2013-12-17 | 2023-08-22 | Genentech, Inc. | Anti-CD3 antibodies and methods of use |
US10174124B2 (en) | 2013-12-17 | 2019-01-08 | Genentech, Inc. | Anti-CD3 antibodies and methods of use |
EP3680254A1 (en) | 2013-12-17 | 2020-07-15 | F. Hoffmann-La Roche AG | Methods of treating her2-positive cancers using pd-1 axis binding antagonists and anti-her2 antibodies |
WO2015095418A1 (en) | 2013-12-17 | 2015-06-25 | Genentech, Inc. | Methods of treating her2-positive cancers using pd-1 axis binding antagonists and anti-her2 antibodies |
EP3527587A1 (en) | 2013-12-17 | 2019-08-21 | F. Hoffmann-La Roche AG | Combination therapy comprising ox40 binding agonists and pd-l1 binding antagonists |
US10640572B2 (en) | 2013-12-17 | 2020-05-05 | Genentech, Inc. | Anti-CD3 antibodies and methods of use |
US10865251B2 (en) | 2013-12-17 | 2020-12-15 | Genentech, Inc. | Anti-CD3 antibodies and methods of use |
EP3647324A1 (en) | 2013-12-17 | 2020-05-06 | F. Hoffmann-La Roche AG | Methods of treating cancers using pd-1 axis binding antagonists and taxanes |
WO2015091656A1 (en) | 2013-12-20 | 2015-06-25 | F. Hoffmann-La Roche Ag | HUMANIZED ANTI-Tau(pS422) ANTIBODIES AND METHODS OF USE |
US10465000B2 (en) | 2013-12-20 | 2019-11-05 | Hoffmann-La Roche Inc. | Humanized anti-Tau(pS422) antibodies and methods of use |
EP4219555A1 (en) | 2013-12-23 | 2023-08-02 | F. Hoffmann-La Roche AG | Antibodies and methods of use |
EP3626738A1 (en) | 2013-12-24 | 2020-03-25 | Argenx BVBA | Fcrn antagonists and methods of use |
WO2015100299A1 (en) | 2013-12-24 | 2015-07-02 | Argen-X N.V. | Fcrn antagonists and methods of use |
US11242392B2 (en) | 2013-12-24 | 2022-02-08 | Janssen Pharmaceutica Nv | Anti-vista antibodies and fragments |
US11014987B2 (en) | 2013-12-24 | 2021-05-25 | Janssen Pharmaceutics Nv | Anti-vista antibodies and fragments, uses thereof, and methods of identifying same |
US11505585B2 (en) | 2013-12-24 | 2022-11-22 | argenx BV | FcRn antagonists and methods of use |
WO2015101587A1 (en) | 2014-01-03 | 2015-07-09 | F. Hoffmann-La Roche Ag | Covalently linked helicar-anti-helicar antibody conjugates and uses thereof |
WO2015101589A1 (en) | 2014-01-03 | 2015-07-09 | F. Hoffmann-La Roche Ag | Covalently linked polypeptide toxin-antibody conjugates |
US10561737B2 (en) | 2014-01-03 | 2020-02-18 | Hoffmann-La Roche Inc. | Bispecific anti-hapten/anti-blood brain barrier receptor antibodies, complexes thereof and their use as blood brain barrier shuttles |
US10519249B2 (en) | 2014-01-03 | 2019-12-31 | Hoffmann-La Roche Inc. | Covalently linked polypeptide toxin-antibody conjugates |
US10407511B2 (en) | 2014-01-03 | 2019-09-10 | Hoffmann-La Roche Inc. | Covalently linked helicar-anti-helicar antibody conjugates and uses thereof |
WO2015101586A1 (en) | 2014-01-03 | 2015-07-09 | F. Hoffmann-La Roche Ag | Bispecific anti-hapten/anti-blood brain barrier receptor antibodies, complexes thereof and their use as blood brain barrier shuttles |
WO2015101588A1 (en) | 2014-01-06 | 2015-07-09 | F. Hoffmann-La Roche Ag | Monovalent blood brain barrier shuttle modules |
WO2015107026A1 (en) | 2014-01-15 | 2015-07-23 | F. Hoffmann-La Roche Ag | Fc-region variants with modified fcrn- and maintained protein a-binding properties |
EP3835318A1 (en) | 2014-01-15 | 2021-06-16 | F. Hoffmann-La Roche AG | Fc-region variants with modified fcrn- and maintained protein a-binding properties |
US10150818B2 (en) | 2014-01-16 | 2018-12-11 | Academia Sinica | Compositions and methods for treatment and detection of cancers |
US9982041B2 (en) | 2014-01-16 | 2018-05-29 | Academia Sinica | Compositions and methods for treatment and detection of cancers |
WO2015112909A1 (en) | 2014-01-24 | 2015-07-30 | Genentech, Inc. | Methods of using anti-steap1 antibodies and immunoconjugates |
WO2015120075A2 (en) | 2014-02-04 | 2015-08-13 | Genentech, Inc. | Mutant smoothened and methods of using the same |
EP3718563A1 (en) | 2014-02-08 | 2020-10-07 | F. Hoffmann-La Roche AG | Methods of treating alzheimer's disease |
WO2015120280A1 (en) | 2014-02-08 | 2015-08-13 | Genentech, Inc. | Methods of treating alzheimer's disease |
EP3900738A1 (en) | 2014-02-08 | 2021-10-27 | F. Hoffmann-La Roche AG | Methods of treating alzheimer's disease |
WO2015120233A1 (en) | 2014-02-08 | 2015-08-13 | Genentech, Inc. | Methods of treating alzheimer's disease |
EP3428190A1 (en) | 2014-02-12 | 2019-01-16 | F. Hoffmann-La Roche AG | Anti-jagged1 antibodies and methods of use |
EP3825332A1 (en) | 2014-02-12 | 2021-05-26 | F. Hoffmann-La Roche AG | Anti-jagged1 antibodies and methods of use |
WO2015127405A2 (en) | 2014-02-21 | 2015-08-27 | Genentech, Inc. | Anti-il-13/il-17 bispecific antibodies and uses thereof |
EP4014995A1 (en) | 2014-02-28 | 2022-06-22 | Allakos Inc. | Methods and compositions for treating siglec-8 associated diseases |
US10183996B2 (en) | 2014-02-28 | 2019-01-22 | Allakos Inc. | Methods and compositions for treating Siglec-8 associated diseases |
WO2015131155A1 (en) | 2014-02-28 | 2015-09-03 | Allakos Inc. | Methods and compositions for treating siglec-8 associated diseases |
WO2015134894A1 (en) | 2014-03-07 | 2015-09-11 | Alexion Pharmaceuticals, Inc. | Anti-c5 antibodies having improved pharmacokinetics |
EP3594235A1 (en) | 2014-03-07 | 2020-01-15 | Alexion Pharmaceuticals, Inc. | Anti-c5 antibodies having improved pharmacokinetics |
EP3095795A1 (en) | 2014-03-07 | 2016-11-23 | Alexion Pharmaceuticals, Inc. | Anti-c5 antibodies having improved pharmacokinetics |
WO2015138615A2 (en) | 2014-03-12 | 2015-09-17 | Irm Llc | Specific sites for modifying antibodies to make immunoconjugates |
EP3960767A2 (en) | 2014-03-12 | 2022-03-02 | Novartis AG | Specific sites for modifying antibodies to make immunoconjugates |
US10279021B2 (en) | 2014-03-14 | 2019-05-07 | Dana-Faber Cancer Institute, Inc. | Vaccine compositions and methods for restoring NKG2D pathway function against cancers |
WO2015139046A1 (en) | 2014-03-14 | 2015-09-17 | Genentech, Inc. | Methods and compositions for secretion of heterologous polypeptides |
WO2015140591A1 (en) | 2014-03-21 | 2015-09-24 | Nordlandssykehuset Hf | Anti-cd14 antibodies and uses thereof |
WO2015148531A1 (en) | 2014-03-24 | 2015-10-01 | Genentech, Inc. | Cancer treatment with c-met antagonists and correlation of the latter with hgf expression |
US10240207B2 (en) | 2014-03-24 | 2019-03-26 | Genentech, Inc. | Cancer treatment with c-met antagonists and correlation of the latter with HGF expression |
US10119972B2 (en) | 2014-03-27 | 2018-11-06 | Academia Sinica | Reactive labelling compounds and uses thereof |
WO2015153513A1 (en) | 2014-03-31 | 2015-10-08 | Genentech, Inc. | Anti-ox40 antibodies and methods of use |
US9975957B2 (en) | 2014-03-31 | 2018-05-22 | Genentech, Inc. | Anti-OX40 antibodies and methods of use |
WO2015153514A1 (en) | 2014-03-31 | 2015-10-08 | Genentech, Inc. | Combination therapy comprising anti-angiogenesis agents and ox40 binding agonists |
EP3632934A1 (en) | 2014-03-31 | 2020-04-08 | F. Hoffmann-La Roche AG | Anti-ox40 antibodies and methods of use |
US10730951B2 (en) | 2014-03-31 | 2020-08-04 | Genentech, Inc. | Anti-OX40 antibodies and methods of use |
WO2015164330A1 (en) | 2014-04-21 | 2015-10-29 | Millennium Pharmaceuticals, Inc. | Anti-psyk antibody molecules and use of same for syk-targeted therapy |
WO2015164615A1 (en) | 2014-04-24 | 2015-10-29 | University Of Oslo | Anti-gluten antibodies and uses thereof |
WO2015162590A1 (en) | 2014-04-24 | 2015-10-29 | Novartis Ag | Methods of improving or accelerating physical recovery after surgery for hip fracture |
EP3461495A1 (en) | 2014-04-24 | 2019-04-03 | Novartis AG | Methods of improving or accelerating physical recovery after surgery for hip fracture |
US11178860B2 (en) | 2014-05-05 | 2021-11-23 | Regeneron Pharmaceuticals, Inc. | Humanized C5 animals |
US10492477B2 (en) | 2014-05-05 | 2019-12-03 | Regeneron Pharmaceuticals, Inc. | Humanized C5 animals |
US10524458B2 (en) | 2014-05-05 | 2020-01-07 | Regeneron Pharmaceuticals, Inc. | Humanized C3 animals |
WO2015171523A1 (en) | 2014-05-05 | 2015-11-12 | Regeneron Pharmaceuticals, Inc. | Humanized c5 and c3 animals |
US9795121B2 (en) | 2014-05-05 | 2017-10-24 | Regeneron Pharmaceuticals, Inc. | Humanized C3 animals |
WO2015179658A2 (en) | 2014-05-22 | 2015-11-26 | Genentech, Inc. | Anti-gpc3 antibodies and immunoconjugates |
WO2015179835A2 (en) | 2014-05-23 | 2015-11-26 | Genentech, Inc. | Mit biomarkers and methods using the same |
US10118969B2 (en) | 2014-05-27 | 2018-11-06 | Academia Sinica | Compositions and methods relating to universal glycoforms for enhanced antibody efficacy |
US10618973B2 (en) | 2014-05-27 | 2020-04-14 | Academia Sinica | Anti-HER2 glycoantibodies and uses thereof |
US11884739B2 (en) | 2014-05-27 | 2024-01-30 | Academia Sinica | Anti-CD20 glycoantibodies and uses thereof |
US11319567B2 (en) | 2014-05-27 | 2022-05-03 | Academia Sinica | Fucosidase from bacteroides and methods using the same |
US10023892B2 (en) | 2014-05-27 | 2018-07-17 | Academia Sinica | Compositions and methods relating to universal glycoforms for enhanced antibody efficacy |
US10005847B2 (en) | 2014-05-27 | 2018-06-26 | Academia Sinica | Anti-HER2 glycoantibodies and uses thereof |
US10800849B2 (en) | 2014-05-28 | 2020-10-13 | Agenus Inc. | Anti-GITR antibodies and methods of use thereof |
WO2015184099A1 (en) | 2014-05-28 | 2015-12-03 | 4-Antibody Ag | Anti-gitr antibodies and methods of use thereof |
US11401335B2 (en) | 2014-05-28 | 2022-08-02 | Agenus Inc. | Anti-GITR antibodies and methods of use thereof |
US10829559B2 (en) | 2014-05-28 | 2020-11-10 | Agenus Inc. | Anti-GITR antibodies and methods of use thereof |
EP3498295A1 (en) | 2014-05-28 | 2019-06-19 | Agenus Inc. | Anti-gitr antibodies and methods of use thereof |
US10577426B2 (en) | 2014-05-28 | 2020-03-03 | Agenus Inc. | Anti-GITR antibodies and methods of use thereof |
US10280226B2 (en) | 2014-05-28 | 2019-05-07 | Agenus Inc. | Anti-GITR antibodies and methods of use thereof |
US11332523B2 (en) | 2014-05-28 | 2022-05-17 | Academia Sinica | Anti-TNF-alpha glycoantibodies and uses thereof |
US10155818B2 (en) | 2014-05-28 | 2018-12-18 | Agenus Inc. | Anti-GITR antibodies and methods of use thereof |
US11897962B2 (en) | 2014-05-28 | 2024-02-13 | Agenus Inc. | Anti-GITR antibodies and methods of use thereof |
WO2015187835A2 (en) | 2014-06-06 | 2015-12-10 | Bristol-Myers Squibb Company | Antibodies against glucocorticoid-induced tumor necrosis factor receptor (gitr) and uses thereof |
EP3998079A1 (en) | 2014-06-06 | 2022-05-18 | Bristol-Myers Squibb Company | Antibodies against glucocorticoid-induced tumor necrosis factor receptor (gitr) and uses thereof |
EP3610924A1 (en) | 2014-06-06 | 2020-02-19 | Bristol-Myers Squibb Company | Antibodies against glucocorticoid-induced tumor necrosis factor receptor (gitr) and uses thereof |
WO2015191715A1 (en) | 2014-06-11 | 2015-12-17 | Genentech, Inc. | Anti-lgr5 antibodies and uses thereof |
US11123426B2 (en) | 2014-06-11 | 2021-09-21 | The Trustees Of Dartmouth College | Use of vista agonists and antagonists to suppress or enhance humoral immunity |
WO2015191986A1 (en) | 2014-06-13 | 2015-12-17 | Genentech, Inc. | Methods of treating and preventing cancer drug resistance |
US11673968B2 (en) | 2014-06-26 | 2023-06-13 | Hoffmann-La Roche Inc. | Anti-BRDU antibodies and methods of use |
US10251952B2 (en) | 2014-06-26 | 2019-04-09 | Hoffmann-La Roche Inc. | Humanized anti-tau(pS422) antibody brain shuttles and use thereof |
US10544225B2 (en) | 2014-07-03 | 2020-01-28 | Beigene, Ltd. | Anti-PD-L1 antibodies and their use as therapeutics and diagnostics |
US11512132B2 (en) | 2014-07-03 | 2022-11-29 | Beigene, Ltd. | Anti-PD-L1 antibodies and their use as therapeutics and diagnostics |
WO2016007775A1 (en) | 2014-07-11 | 2016-01-14 | Genentech, Inc. | Notch pathway inhibition |
WO2016007235A1 (en) | 2014-07-11 | 2016-01-14 | Genentech, Inc. | Anti-pd-l1 antibodies and diagnostic uses thereof |
EP3309174A1 (en) | 2014-07-11 | 2018-04-18 | Genentech, Inc. | Anti-pd-l1 antibodies and diagnostic uses thereof |
US10981994B2 (en) | 2014-07-22 | 2021-04-20 | Apollomics Inc. | Anti PD-1 antibodies |
US10428146B2 (en) | 2014-07-22 | 2019-10-01 | Cb Therapeutics, Inc. | Anti PD-1 antibodies |
US11560429B2 (en) | 2014-07-22 | 2023-01-24 | Apollomics Inc. | Anti PD-1 antibodies |
US11111300B2 (en) | 2014-08-05 | 2021-09-07 | Apollomics Inc. | Anti PD-L1 antibodies |
US10435470B2 (en) | 2014-08-05 | 2019-10-08 | Cb Therapeutics, Inc. | Anti-PD-L1 antibodies |
WO2016020791A1 (en) | 2014-08-05 | 2016-02-11 | Novartis Ag | Ckit antibody drug conjugates |
US11827707B2 (en) | 2014-08-05 | 2023-11-28 | Apollomics Inc. | Anti PD-L1 antibodies |
WO2016020882A2 (en) | 2014-08-07 | 2016-02-11 | Novartis Ag | Angiopoetin-like 4 (angptl4) antibodies and methods of use |
WO2016020880A2 (en) | 2014-08-07 | 2016-02-11 | Novartis Ag | Angiopoietin-like 4 antibodies and methods of use |
EP4122957A1 (en) | 2014-08-07 | 2023-01-25 | Novartis AG | Angiopoietin-like 4 antibodies and methods of use |
WO2016024195A1 (en) | 2014-08-12 | 2016-02-18 | Novartis Ag | Anti-cdh6 antibody drug conjugates |
WO2016028672A1 (en) | 2014-08-19 | 2016-02-25 | Merck Sharp & Dohme Corp. | Anti-lag3 antibodies and antigen-binding fragments |
EP3834842A1 (en) | 2014-08-19 | 2021-06-16 | Merck Sharp & Dohme Corp. | Anti-lag3 antibodies and antigen-binding fragments |
WO2016028656A1 (en) | 2014-08-19 | 2016-02-25 | Merck Sharp & Dohme Corp. | Anti-tigit antibodies |
US11584927B2 (en) | 2014-08-28 | 2023-02-21 | Bioatla, Inc. | Conditionally active chimeric antigen receptors for modified T-cells |
US10533034B2 (en) | 2014-09-08 | 2020-01-14 | Academia Sinica | Human iNKT cell activation using glycolipids |
US9879042B2 (en) | 2014-09-08 | 2018-01-30 | Academia Sinica | Human iNKT cell activation using glycolipids |
EP3782654A1 (en) | 2014-09-12 | 2021-02-24 | Genentech, Inc. | Anti-her2 antibodies and immunoconjugates |
WO2016040868A1 (en) | 2014-09-12 | 2016-03-17 | Genentech, Inc. | Anti-cll-1 antibodies and immunoconjugates |
US10059768B2 (en) | 2014-09-12 | 2018-08-28 | Genentech, Inc. | Anti-B7-H4 antibodies and immunoconjugates |
US11084877B2 (en) | 2014-09-12 | 2021-08-10 | Genentech, Inc. | Anti-CLL-1 antibodies and immunoconjugates |
EP3693391A1 (en) | 2014-09-12 | 2020-08-12 | Genentech, Inc. | Anti-cll-1 antibodies and immunoconjugates |
WO2016040856A2 (en) | 2014-09-12 | 2016-03-17 | Genentech, Inc. | Cysteine engineered antibodies and conjugates |
US11286302B2 (en) | 2014-09-12 | 2022-03-29 | Genentech, Inc. | Anti-B7-H4 antibodies and immunoconjugates |
WO2016044396A1 (en) | 2014-09-17 | 2016-03-24 | Genentech, Inc. | Immunoconjugates comprising anti-her2 antibodies and pyrrolobenzodiazepines |
EP3689910A2 (en) | 2014-09-23 | 2020-08-05 | F. Hoffmann-La Roche AG | Method of using anti-cd79b immunoconjugates |
US10717778B2 (en) | 2014-09-29 | 2020-07-21 | Duke University | Bispecific molecules comprising an HIV-1 envelope targeting arm |
WO2016057846A1 (en) | 2014-10-08 | 2016-04-14 | Novartis Ag | Compositions and methods of use for augmented immune response and cancer therapy |
WO2016057841A1 (en) | 2014-10-08 | 2016-04-14 | Novartis Ag | Compositions and methods of use for augmented immune response and cancer therapy |
WO2016061389A2 (en) | 2014-10-16 | 2016-04-21 | Genentech, Inc. | Anti-alpha-synuclein antibodies and methods of use |
US10640564B2 (en) | 2014-10-17 | 2020-05-05 | Ichnos Sciences SA | Antibodies that bind to CCR6 and their uses |
WO2016073378A1 (en) | 2014-11-03 | 2016-05-12 | Genentech, Inc. | Assays for detecting t cell immune subsets and methods of use thereof |
US10767232B2 (en) | 2014-11-03 | 2020-09-08 | Genentech, Inc. | Methods and biomarkers for predicting efficacy and evaluation of an OX40 agonist treatment |
US10845364B2 (en) | 2014-11-03 | 2020-11-24 | Genentech, Inc. | Assays for detecting T cell immune subsets and methods of use thereof |
WO2016073791A1 (en) | 2014-11-05 | 2016-05-12 | Genentech, Inc. | Methods of producing two chain proteins in bacteria |
EP3753948A1 (en) | 2014-11-05 | 2020-12-23 | Genentech, Inc. | Methods of producing two chain proteins in bacteria |
WO2016073794A1 (en) | 2014-11-05 | 2016-05-12 | Genentech, Inc. | Methods of producing two chain proteins in bacteria |
US10066002B2 (en) | 2014-11-05 | 2018-09-04 | Genentech, Inc. | Methods of producing two chain proteins in bacteria |
US11091530B2 (en) | 2014-11-05 | 2021-08-17 | Genentech, Inc. | Methods of producing two chain proteins in bacteria |
US10112994B2 (en) | 2014-11-05 | 2018-10-30 | Genentech, Inc. | Methods of producing two chain proteins in bacteria |
US11299539B2 (en) | 2014-11-05 | 2022-04-12 | Genentech, Inc. | Methods of producing two chain proteins in bacteria |
US10208120B2 (en) | 2014-11-05 | 2019-02-19 | Genentech, Inc. | Anti-FGFR2/3 antibodies and methods using same |
WO2016073157A1 (en) | 2014-11-06 | 2016-05-12 | Genentech, Inc. | Anti-ang2 antibodies and methods of use thereof |
EP3611188A1 (en) | 2014-11-06 | 2020-02-19 | F. Hoffmann-La Roche AG | Fc-region variants with modified fcrn-binding and methods of use |
WO2016073282A1 (en) | 2014-11-06 | 2016-05-12 | Genentech, Inc. | Combination therapy comprising ox40 binding agonists and tigit inhibitors |
EP3842453A1 (en) | 2014-11-06 | 2021-06-30 | F. Hoffmann-La Roche AG | Fc-region variants with modified fcrn- and protein a-binding properties |
WO2016077369A1 (en) | 2014-11-10 | 2016-05-19 | Genentech, Inc. | Animal model for nephropathy and agents for treating the same |
EP3552488A1 (en) | 2014-11-10 | 2019-10-16 | F. Hoffmann-La Roche AG | Animal model for nephropathy and agents for treating the same |
EP3783023A1 (en) | 2014-11-10 | 2021-02-24 | H. Hoffnabb-La Roche Ag | Anti-interleukin-33 antibodies and uses thereof |
WO2016077381A1 (en) | 2014-11-10 | 2016-05-19 | Genentech, Inc. | Anti-interleukin-33 antibodies and uses thereof |
WO2016075670A1 (en) | 2014-11-14 | 2016-05-19 | Novartis Ag | Antibody drug conjugates |
WO2016081384A1 (en) | 2014-11-17 | 2016-05-26 | Genentech, Inc. | Combination therapy comprising ox40 binding agonists and pd-1 axis binding antagonists |
WO2016081640A1 (en) | 2014-11-19 | 2016-05-26 | Genentech, Inc. | Anti-transferrin receptor / anti-bace1 multispecific antibodies and methods of use |
WO2016081639A1 (en) | 2014-11-19 | 2016-05-26 | Genentech, Inc. | Antibodies against bace1 and use thereof for neural disease immunotherapy |
WO2016081643A1 (en) | 2014-11-19 | 2016-05-26 | Genentech, Inc. | Anti-transferrin receptor antibodies and methods of use |
EP3845565A2 (en) | 2014-11-19 | 2021-07-07 | Genentech, Inc. | Antibodies against bace1 and use thereof for neural disease immunotherapy |
WO2016081748A2 (en) | 2014-11-21 | 2016-05-26 | Bristol-Myers Squibb Company | Antibodies against cd73 and uses thereof |
EP3789399A1 (en) | 2014-11-21 | 2021-03-10 | Bristol-Myers Squibb Company | Antibodies comprising modified heavy constant regions |
EP3725808A1 (en) | 2014-11-21 | 2020-10-21 | Bristol-Myers Squibb Company | Antibodies against cd73 and uses thereof |
EP3581585A1 (en) | 2014-11-26 | 2019-12-18 | Millennium Pharmaceuticals, Inc. | Vedolizumab for the treatment of fistulizing crohn's disease |
WO2016086147A1 (en) | 2014-11-26 | 2016-06-02 | Millennium Pharmaceuticals, Inc. | Vedolizumab for the treatment of fistulizing crohn's disease |
US10633457B2 (en) | 2014-12-03 | 2020-04-28 | Hoffmann-La Roche Inc. | Multispecific antibodies |
US10370455B2 (en) | 2014-12-05 | 2019-08-06 | Immunext, Inc. | Identification of VSIG8 as the putative VISTA receptor (V-R) and use thereof to produce VISTA/VSIG8 agonists and antagonists |
WO2016090210A1 (en) | 2014-12-05 | 2016-06-09 | Genentech, Inc. | ANTI-CD79b ANTIBODIES AND METHODS OF USE |
WO2016091891A1 (en) | 2014-12-09 | 2016-06-16 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Human monoclonal antibodies against axl |
WO2016094566A2 (en) | 2014-12-10 | 2016-06-16 | Genentech, Inc. | Blood brain barrier receptor antibodies and methods of use |
WO2016098356A1 (en) | 2014-12-19 | 2016-06-23 | Chugai Seiyaku Kabushiki Kaisha | Anti-c5 antibodies and methods of use |
WO2016098079A2 (en) | 2014-12-19 | 2016-06-23 | Novartis Ag | Compositions and methods for antibodies targeting bmp6 |
EP3981794A1 (en) | 2014-12-19 | 2022-04-13 | Chugai Seiyaku Kabushiki Kaisha | Anti-c5 antibodies and methods of use |
EP3945096A1 (en) | 2014-12-19 | 2022-02-02 | Regenesance B.V. | Antibodies that bind human c6 and uses thereof |
WO2016097865A1 (en) | 2014-12-19 | 2016-06-23 | Regenesance B.V. | Antibodies that bind human c6 and uses thereof |
US10768174B2 (en) | 2014-12-23 | 2020-09-08 | Bluelight Therapeutics, Inc. | Attachment of proteins to interfaces for use in nonlinear optical detection |
EP4249066A2 (en) | 2014-12-23 | 2023-09-27 | Bristol-Myers Squibb Company | Antibodies to tigit |
WO2016115345A1 (en) | 2015-01-14 | 2016-07-21 | The Brigham And Women's Hospital, | Treatment of cancer with anti-lap monoclonal antibodies |
US9975965B2 (en) | 2015-01-16 | 2018-05-22 | Academia Sinica | Compositions and methods for treatment and detection of cancers |
US10495645B2 (en) | 2015-01-16 | 2019-12-03 | Academia Sinica | Cancer markers and methods of use thereof |
WO2016117346A1 (en) | 2015-01-22 | 2016-07-28 | Chugai Seiyaku Kabushiki Kaisha | A combination of two or more anti-c5 antibodies and methods of use |
US10342858B2 (en) | 2015-01-24 | 2019-07-09 | Academia Sinica | Glycan conjugates and methods of use thereof |
WO2016118961A1 (en) | 2015-01-24 | 2016-07-28 | Academia Sinica | Cancer markers and methods of use thereof |
US11180548B2 (en) | 2015-02-05 | 2021-11-23 | Chugai Seiyaku Kabushiki Kaisha | Methods of neutralizing IL-8 biological activity |
WO2016125495A1 (en) | 2015-02-05 | 2016-08-11 | Chugai Seiyaku Kabushiki Kaisha | Antibodies comprising an ion concentration dependent antigen-binding domain, fc region variants, il-8-binding antibodies, and uses therof |
EP3816179A2 (en) | 2015-02-05 | 2021-05-05 | Chugai Seiyaku Kabushiki Kaisha | Fc region variant comprising a modified fcrn-binding domain |
EP4129320A1 (en) | 2015-02-19 | 2023-02-08 | Compugen Ltd. | Anti-pvrig antibodies and methods of use |
EP3978929A1 (en) | 2015-02-19 | 2022-04-06 | Compugen Ltd. | Pvrig polypeptides and methods of treatment |
EP3653221A1 (en) | 2015-02-19 | 2020-05-20 | Compugen Ltd. | Anti-pvrig antibodies and methods of use |
EP3295951A1 (en) | 2015-02-19 | 2018-03-21 | Compugen Ltd. | Anti-pvrig antibodies and methods of use |
WO2016134335A2 (en) | 2015-02-19 | 2016-08-25 | Compugen Ltd. | Pvrig polypeptides and methods of treatment |
WO2016134333A1 (en) | 2015-02-19 | 2016-08-25 | Compugen Ltd. | Anti-pvrig antibodies and methods of use |
WO2016135066A1 (en) | 2015-02-26 | 2016-09-01 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Fusion proteins and antibodies comprising thereof for promoting apoptosis |
EP4257200A2 (en) | 2015-03-06 | 2023-10-11 | Takeda Pharmaceutical Company Limited | Method of treating primary sclerosing cholangitis |
EP4006051A1 (en) | 2015-03-09 | 2022-06-01 | Argenx BVBA | Methods of reducing serum levels of fc-containing agents using fcrn antagonists |
WO2016142782A1 (en) | 2015-03-09 | 2016-09-15 | Argen-X N.V. | Methods of reducing serum levels of fc-containing agents using fcrn antagonsits |
WO2016149276A1 (en) | 2015-03-16 | 2016-09-22 | Genentech, Inc. | Methods of detecting and quantifying il-13 and uses in diagnosing and treating th2-associated diseases |
WO2016146833A1 (en) | 2015-03-19 | 2016-09-22 | F. Hoffmann-La Roche Ag | Biomarkers for nad(+)-diphthamide adp ribosyltransferase resistance |
US10011658B2 (en) | 2015-04-03 | 2018-07-03 | Eureka Therapeutics, Inc. | Constructs targeting AFP peptide/MHC complexes and uses thereof |
EP3875477A1 (en) | 2015-04-17 | 2021-09-08 | Alpine Immune Sciences, Inc. | Immunomodulatory proteins with tunable affinities |
WO2016168771A2 (en) | 2015-04-17 | 2016-10-20 | Alpine Immune Sciences, Inc. | Immunomodulatory proteins with tunable affinities |
US11319359B2 (en) | 2015-04-17 | 2022-05-03 | Alpine Immune Sciences, Inc. | Immunomodulatory proteins with tunable affinities |
EP3913052A1 (en) | 2015-04-24 | 2021-11-24 | F. Hoffmann-La Roche AG | Methods of identifying bacteria comprising binding polypeptides |
WO2016172551A2 (en) | 2015-04-24 | 2016-10-27 | Genentech, Inc. | Methods of identifying bacteria comprising binding polypeptides |
EP3778640A1 (en) | 2015-05-01 | 2021-02-17 | Genentech, Inc. | Masked anti-cd3 antibodies and methods of use |
WO2016179003A1 (en) | 2015-05-01 | 2016-11-10 | Genentech, Inc. | Masked anti-cd3 antibodies and methods of use |
WO2016179517A1 (en) | 2015-05-07 | 2016-11-10 | Agenus Inc. | Anti-ox40 antibodies and methods of use thereof |
EP3936524A2 (en) | 2015-05-11 | 2022-01-12 | F. Hoffmann-La Roche AG | Compositions and methods of treating lupus nephritis |
EP4238994A2 (en) | 2015-05-11 | 2023-09-06 | F. Hoffmann-La Roche AG | Compositions and methods of treating lupus nephritis |
EP3783029A1 (en) | 2015-05-12 | 2021-02-24 | F. Hoffmann-La Roche AG | Therapeutic and diagnostic methods for cancer |
WO2016188911A1 (en) | 2015-05-22 | 2016-12-01 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Human monoclonal antibodies fragments inhibiting both the cath-d catalytic activity and its binding to the lrp1 receptor |
WO2016196298A1 (en) | 2015-05-29 | 2016-12-08 | Genentech, Inc. | Therapeutic and diagnolstic methods for cancer |
WO2016196343A1 (en) | 2015-05-29 | 2016-12-08 | Genentech, Inc. | Humanized anti-ebola virus glycoprotein antibodies and methods of use |
EP4335931A2 (en) | 2015-05-29 | 2024-03-13 | F. Hoffmann-La Roche AG | Therapeutic and diagnostic methods for cancer |
EP3708681A1 (en) | 2015-05-29 | 2020-09-16 | F. Hoffmann-La Roche AG | Therapeutic and diagnostic methods for cancer |
WO2016196228A1 (en) | 2015-05-29 | 2016-12-08 | Bristol-Myers Squibb Company | Antibodies against ox40 and uses thereof |
WO2016196679A1 (en) | 2015-06-02 | 2016-12-08 | Genentech, Inc. | Compositions and methods for using anti-il-34 antibodies to treat neurological diseases |
WO2016196726A1 (en) | 2015-06-05 | 2016-12-08 | Genentech, Inc. | Anti-tau antibodies and methods of use |
WO2016193872A2 (en) | 2015-06-05 | 2016-12-08 | Novartis Ag | Antibodies targeting bone morphogenetic protein 9 (bmp9) and methods therefor |
WO2016200835A1 (en) | 2015-06-08 | 2016-12-15 | Genentech, Inc. | Methods of treating cancer using anti-ox40 antibodies and pd-1 axis binding antagonists |
WO2016200836A1 (en) | 2015-06-08 | 2016-12-15 | Genentech, Inc. | Methods of treating cancer using anti-ox40 antibodies |
WO2016205176A1 (en) | 2015-06-15 | 2016-12-22 | Genentech, Inc. | Antibodies and immunoconjugates |
US11192950B2 (en) | 2015-06-16 | 2021-12-07 | Genentech, Inc. | Humanized and affinity matured antibodies to FcRH5 and methods of use |
US10323094B2 (en) | 2015-06-16 | 2019-06-18 | Genentech, Inc. | Humanized and affinity matured antibodies to FcRH5 and methods of use |
US10501545B2 (en) | 2015-06-16 | 2019-12-10 | Genentech, Inc. | Anti-CLL-1 antibodies and methods of use |
WO2016205520A1 (en) | 2015-06-16 | 2016-12-22 | Genentech, Inc. | Humanized and affinity matured antibodies to fcrh5 and methods of use |
US11466087B2 (en) | 2015-06-16 | 2022-10-11 | Genentech, Inc. | Anti-CLL-1 antibodies and methods of use |
EP3916018A1 (en) | 2015-06-16 | 2021-12-01 | Genentech, Inc. | Anti-cd3 antibodies and methods of use |
WO2016204966A1 (en) | 2015-06-16 | 2016-12-22 | Genentech, Inc. | Anti-cd3 antibodies and methods of use |
WO2016205200A1 (en) | 2015-06-16 | 2016-12-22 | Genentech, Inc. | Anti-cll-1 antibodies and methods of use |
EP4299073A2 (en) | 2015-06-16 | 2024-01-03 | F. Hoffmann-La Roche AG | Humanized and affinity matured antibodies to fcrh5 and methods of use |
US10774145B2 (en) | 2015-06-17 | 2020-09-15 | Allakos Inc. | Methods and compositions for treating fibrotic diseases |
WO2016205320A1 (en) | 2015-06-17 | 2016-12-22 | Genentech, Inc. | Methods of treating locally advanced or metastatic breast cancers using pd-1 axis binding antagonists and taxanes |
WO2016203432A1 (en) | 2015-06-17 | 2016-12-22 | Novartis Ag | Antibody drug conjugates |
WO2016205531A2 (en) | 2015-06-17 | 2016-12-22 | Genentech, Inc. | Anti-her2 antibodies and methods of use |
US11584793B2 (en) | 2015-06-24 | 2023-02-21 | Hoffmann-La Roche Inc. | Anti-transferrin receptor antibodies with tailored affinity |
US10822402B2 (en) | 2015-06-24 | 2020-11-03 | Hoffmann-La Roche Inc. | Humanized anti-tau(pS422) antibodies and methods of use |
US11009509B2 (en) | 2015-06-24 | 2021-05-18 | Janssen Pharmaceutica Nv | Anti-VISTA antibodies and fragments |
WO2016207858A1 (en) | 2015-06-26 | 2016-12-29 | Novartis Ag | Factor xi antibodies and methods of use |
US10465011B2 (en) | 2015-06-26 | 2019-11-05 | Novartis Ag | Factor XI antibodies and methods of use |
WO2017004091A1 (en) | 2015-06-29 | 2017-01-05 | Genentech, Inc. | Type ii anti-cd20 antibody for use in organ transplantation |
EP3514174A1 (en) | 2015-06-29 | 2019-07-24 | Ventana Medical Systems, Inc. | Materials and methods for performing histochemical assays for human pro-epiregulin and amphiregulin |
EP3978525A1 (en) | 2015-06-29 | 2022-04-06 | Ventana Medical Systems, Inc. | Materials and methods for performing histochemical assays for human pro-epiregulin and amphiregulin |
EP3971211A1 (en) | 2015-07-13 | 2022-03-23 | Compugen Ltd. | Hide1 compositions and methods |
WO2017009712A1 (en) | 2015-07-13 | 2017-01-19 | Compugen Ltd. | Hide1 compositions and methods |
WO2017021893A1 (en) | 2015-08-03 | 2017-02-09 | Novartis Ag | Methods of treating fgf21-associated disorders |
EP4218792A1 (en) | 2015-08-04 | 2023-08-02 | Acceleron Pharma Inc. | Composition for treating myeloproliferative disorders |
WO2017024171A1 (en) | 2015-08-04 | 2017-02-09 | Acceleron Pharma Inc. | Methods for treating myeloproliferative disorders |
EP4282877A2 (en) | 2015-08-11 | 2023-11-29 | Legend Biotech Ireland Limited | Chimeric antigen receptors targeting bcma and methods of use thereof |
EP3896091A1 (en) | 2015-08-11 | 2021-10-20 | Legend Biotech Ireland Limited | Chimeric antigen receptors targeting bcma and methods of use thereof |
EP4282878A2 (en) | 2015-08-11 | 2023-11-29 | Legend Biotech Ireland Limited | Chimeric antigen receptors targeting bcma and methods of use thereof |
EP4063397A1 (en) | 2015-08-11 | 2022-09-28 | Legend Biotech Ireland Limited | Chimeric antigen receptors based on single-domain antibodies and methods of use thereof |
WO2017040342A1 (en) | 2015-08-28 | 2017-03-09 | Genentech, Inc. | Anti-hypusine antibodies and uses thereof |
EP3932953A1 (en) | 2015-08-28 | 2022-01-05 | F. Hoffmann-La Roche AG | Anti-hypusine antibodies and uses thereof |
WO2017040790A1 (en) | 2015-09-01 | 2017-03-09 | Agenus Inc. | Anti-pd-1 antibodies and methods of use thereof |
EP3842457A1 (en) | 2015-09-09 | 2021-06-30 | Novartis AG | Thymic stromal lymphopoietin (tslp)-binding molecules and methods of using the molecules |
WO2017042701A1 (en) | 2015-09-09 | 2017-03-16 | Novartis Ag | Thymic stromal lymphopoietin (tslp)-binding antibodies and methods of using the antibodies |
WO2017046676A1 (en) | 2015-09-16 | 2017-03-23 | Novartis Ag | Polyomavirus neutralizing antibodies |
US10172875B2 (en) | 2015-09-17 | 2019-01-08 | Immunogen, Inc. | Therapeutic combinations comprising anti-FOLR1 immunoconjugates |
US11033564B2 (en) | 2015-09-17 | 2021-06-15 | Immunogen, Inc. | Therapeutic combinations comprising anti-FOLR1 immunoconjugates |
WO2017046994A1 (en) | 2015-09-18 | 2017-03-23 | Chugai Seiyaku Kabushiki Kaisha | Il-8-binding antibodies and uses thereof |
WO2017050729A1 (en) | 2015-09-22 | 2017-03-30 | Spring Bioscience Corporation | Anti-ox40 antibodies and diagnostic uses thereof |
WO2017053807A2 (en) | 2015-09-23 | 2017-03-30 | Genentech, Inc. | Optimized variants of anti-vegf antibodies |
EP3662930A1 (en) | 2015-09-24 | 2020-06-10 | AbVitro LLC | Hiv antibody compositions and methods of use |
US11286300B2 (en) | 2015-10-01 | 2022-03-29 | Hoffmann-La Roche Inc. | Humanized anti-human CD19 antibodies and methods of use |
WO2017055540A1 (en) | 2015-10-02 | 2017-04-06 | F. Hoffmann-La Roche Ag | Bispecific anti-human a-beta/human transferrin receptor antibodies and methods of use |
WO2017055404A1 (en) | 2015-10-02 | 2017-04-06 | F. Hoffmann-La Roche Ag | Bispecific antibodies specific for pd1 and tim3 |
WO2017055443A1 (en) | 2015-10-02 | 2017-04-06 | F. Hoffmann-La Roche Ag | Anti-pd1 antibodies and methods of use |
WO2017059289A1 (en) | 2015-10-02 | 2017-04-06 | Genentech, Inc. | Pyrrolobenzodiazepine antibody drug conjugates and methods of use |
US10941205B2 (en) | 2015-10-02 | 2021-03-09 | Hoffmann-La Roche Inc. | Bispecific anti-human A-beta/human transferrin receptor antibodies and methods of use |
US11603411B2 (en) | 2015-10-02 | 2023-03-14 | Hoffmann-La Roche Inc. | Bispecific anti-human CD20/human transferrin receptor antibodies and methods of use |
WO2017055398A2 (en) | 2015-10-02 | 2017-04-06 | F. Hoffmann-La Roche Ag | Bispecific antibodies specific for a costimulatory tnf receptor |
EP3150636A1 (en) | 2015-10-02 | 2017-04-05 | F. Hoffmann-La Roche AG | Tetravalent multispecific antibodies |
WO2017055542A1 (en) | 2015-10-02 | 2017-04-06 | F. Hoffmann-La Roche Ag | Bispecific anti-human cd20/human transferrin receptor antibodies and methods of use |
WO2017060144A1 (en) | 2015-10-07 | 2017-04-13 | F. Hoffmann-La Roche Ag | Bispecific antibodies with tetravalency for a costimulatory tnf receptor |
WO2017064675A1 (en) | 2015-10-16 | 2017-04-20 | Genentech, Inc. | Hindered disulfide drug conjugates |
WO2017066714A1 (en) | 2015-10-16 | 2017-04-20 | Compugen Ltd. | Anti-vsig1 antibodies and drug conjugates |
WO2017068511A1 (en) | 2015-10-20 | 2017-04-27 | Genentech, Inc. | Calicheamicin-antibody-drug conjugates and methods of use |
US10604577B2 (en) | 2015-10-22 | 2020-03-31 | Allakos Inc. | Methods and compositions for treating systemic mastocytosis |
WO2017072662A1 (en) | 2015-10-29 | 2017-05-04 | Novartis Ag | Antibody conjugates comprising toll-like receptor agonist |
WO2017072210A1 (en) | 2015-10-29 | 2017-05-04 | F. Hoffmann-La Roche Ag | Anti-variant fc-region antibodies and methods of use |
US10358480B2 (en) | 2015-10-29 | 2019-07-23 | Merck Sharp & Dohme Corp. | Antibody neutralizing human respiratory syncytial virus |
US11566065B2 (en) | 2015-10-29 | 2023-01-31 | Merck Sharp & Dohme Llc | Antibody neutralizing human respiratory syncytial virus |
EP3797797A1 (en) | 2015-10-29 | 2021-03-31 | Novartis AG | Antibody conjugates comprising toll-like receptor agonist |
US10072072B2 (en) | 2015-10-29 | 2018-09-11 | Merck Sharp & Dohme Corp. | Antibody neutralizing human respiratory syncytial virus |
US10323079B2 (en) | 2015-10-29 | 2019-06-18 | Merck Sharp & Dohme Corp. | Antibody neutralizing human respiratory syncytial virus |
US9963500B2 (en) | 2015-10-29 | 2018-05-08 | Merck Sharp & Dohme Corp. | Antibody neutralizing human respiratory syncytial virus |
EP3184547A1 (en) | 2015-10-29 | 2017-06-28 | F. Hoffmann-La Roche AG | Anti-tpbg antibodies and methods of use |
WO2017075124A1 (en) | 2015-10-29 | 2017-05-04 | Merck Sharp & Dohme Corp. | Antibody neutralizing human respiratory syncytial virus |
US11008380B2 (en) | 2015-10-29 | 2021-05-18 | Merck Sharp & Dohme Corp. | Antibody neutralizing human respiratory syncytial virus |
WO2017075173A2 (en) | 2015-10-30 | 2017-05-04 | Genentech, Inc. | Anti-factor d antibodies and conjugates |
EP3922649A1 (en) | 2015-10-30 | 2021-12-15 | F. Hoffmann-La Roche AG | Anti-htra1 antibodies and methods of use thereof |
WO2017079768A1 (en) | 2015-11-08 | 2017-05-11 | Genentech, Inc. | Methods of screening for multispecific antibodies |
WO2017087678A2 (en) | 2015-11-19 | 2017-05-26 | Bristol-Myers Squibb Company | Antibodies against glucocorticoid-induced tumor necrosis factor receptor (gitr) and uses thereof |
WO2017095875A1 (en) | 2015-11-30 | 2017-06-08 | Bristol-Myers Squibb Company | Anti human ip-10 antibodies and their uses |
US10836830B2 (en) | 2015-12-02 | 2020-11-17 | Agenus Inc. | Antibodies and methods of use thereof |
US11447557B2 (en) | 2015-12-02 | 2022-09-20 | Agenus Inc. | Antibodies and methods of use thereof |
WO2017093947A1 (en) | 2015-12-04 | 2017-06-08 | Novartis Ag | Antibody cytokine engrafted compositions and methods of use for immunoregulation |
WO2017106129A1 (en) | 2015-12-16 | 2017-06-22 | Merck Sharp & Dohme Corp. | Anti-lag3 antibodies and antigen-binding fragments |
WO2017104779A1 (en) | 2015-12-18 | 2017-06-22 | Chugai Seiyaku Kabushiki Kaisha | Anti-c5 antibodies and methods of use |
WO2017103895A1 (en) | 2015-12-18 | 2017-06-22 | Novartis Ag | Antibodies targeting cd32b and methods of use thereof |
WO2017112956A1 (en) | 2015-12-23 | 2017-06-29 | Moonshot Pharma Llc | Methods for inducing an immune response |
US10898483B2 (en) | 2015-12-23 | 2021-01-26 | Moonshot Pharma Llc | Methods for inducing an immune response by promoting premature termination codon read-through |
US11135221B2 (en) | 2015-12-23 | 2021-10-05 | Moonshot Pharma Llc | Methods for inducing an immune response |
US10966976B2 (en) | 2015-12-23 | 2021-04-06 | Moonshot Pharma Llc | Methods for inducing an immune response by inhibition of nonsense mediated decay |
WO2017112955A1 (en) | 2015-12-23 | 2017-06-29 | Pharma Llc Moonshot | Methods for inducing an immune response by inhibition of nonsense mediated decay |
US11957678B2 (en) | 2015-12-23 | 2024-04-16 | Moonshot Pharma Llc | Methods for inducing an immune response |
EP3862365A1 (en) | 2016-01-08 | 2021-08-11 | F. Hoffmann-La Roche AG | Methods of treating cea-positive cancers using pd-1 axis binding antagonists and anti-cea/anti-cd3 bispecific antibodies |
WO2017127764A1 (en) | 2016-01-20 | 2017-07-27 | Genentech, Inc. | High dose treatments for alzheimer's disease |
WO2017136558A1 (en) | 2016-02-04 | 2017-08-10 | Curis, Inc. | Mutant smoothened and methods of using the same |
US10899836B2 (en) | 2016-02-12 | 2021-01-26 | Janssen Pharmaceutica Nv | Method of identifying anti-VISTA antibodies |
EP4155415A1 (en) | 2016-02-29 | 2023-03-29 | Genentech, Inc. | Therapeutic and diagnostic methods for cancer |
WO2017151502A1 (en) | 2016-02-29 | 2017-09-08 | Genentech, Inc. | Therapeutic and diagnostic methods for cancer |
WO2017152085A1 (en) | 2016-03-04 | 2017-09-08 | Bristol-Myers Squibb Company | Combination therapy with anti-cd73 antibodies |
US10336784B2 (en) | 2016-03-08 | 2019-07-02 | Academia Sinica | Methods for modular synthesis of N-glycans and arrays thereof |
WO2017160700A1 (en) | 2016-03-14 | 2017-09-21 | Millennium Pharmaceuticals, Inc. | Methods of treating or preventing graft versus host disease |
WO2017160699A2 (en) | 2016-03-14 | 2017-09-21 | Millennium Pharmaceuticals, Inc. | Method of preventing graft versus host disease |
EP4112641A1 (en) | 2016-03-15 | 2023-01-04 | Chugai Seiyaku Kabushiki Kaisha | Methods of treating cancers using pd-1 axis binding antagonists and anti-gpc3 antibodies |
WO2017159699A1 (en) | 2016-03-15 | 2017-09-21 | Chugai Seiyaku Kabushiki Kaisha | Methods of treating cancers using pd-1 axis binding antagonists and anti-gpc3 antibodies |
WO2017161173A1 (en) | 2016-03-16 | 2017-09-21 | Merrimack Pharmaceuticals, Inc. | Engineered trail for cancer therapy |
WO2017162678A1 (en) | 2016-03-22 | 2017-09-28 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Humanized anti-claudin-1 antibodies and uses thereof |
WO2017165742A1 (en) | 2016-03-24 | 2017-09-28 | Millennium Pharmaceuticals, Inc. | Methods of treating gastrointestinal immune-related adverse events in anti-ctla4 anti-pd-1 combination treatments |
WO2017165778A1 (en) | 2016-03-24 | 2017-09-28 | Millennium Pharmaceuticals, Inc. | Methods of treating gastrointestinal immune-related adverse events in immune oncology treatments |
EP4273551A2 (en) | 2016-03-25 | 2023-11-08 | F. Hoffmann-La Roche AG | Multiplexed total antibody and antibody-conjugated drug quantification assay |
WO2017165734A1 (en) | 2016-03-25 | 2017-09-28 | Genentech, Inc. | Multiplexed total antibody and antibody-conjugated drug quantification assay |
WO2017180864A1 (en) | 2016-04-14 | 2017-10-19 | Genentech, Inc. | Anti-rspo3 antibodies and methods of use |
EP3865511A1 (en) | 2016-04-14 | 2021-08-18 | F. Hoffmann-La Roche AG | Anti-rspo3 antibodies and methods of use |
US11078282B2 (en) | 2016-04-15 | 2021-08-03 | Alpine Immune Sciences, Inc. | CD80 variant immunomodulatory proteins and uses thereof |
US10961311B2 (en) | 2016-04-15 | 2021-03-30 | Macrogenics, Inc. | B7-H3 binding molecules, antibody drug conjugates thereof and methods of use thereof |
WO2017181079A2 (en) | 2016-04-15 | 2017-10-19 | Genentech, Inc. | Methods for monitoring and treating cancer |
WO2017181152A2 (en) | 2016-04-15 | 2017-10-19 | Alpine Immune Sciences, Inc. | Cd80 variant immunomodulatory proteins and uses thereof |
US11525000B2 (en) | 2016-04-15 | 2022-12-13 | Immunext, Inc. | Anti-human VISTA antibodies and use thereof |
US11479609B2 (en) | 2016-04-15 | 2022-10-25 | Alpine Immune Sciences, Inc. | CD80 variant immunomodulatory proteins and uses thereof |
US11591400B2 (en) | 2016-04-15 | 2023-02-28 | Macrogenics, Inc. | B7-H3 directed antibody drug conjugates |
US11603403B2 (en) | 2016-04-15 | 2023-03-14 | Immunext, Inc. | Anti-human vista antibodies and use thereof |
US11603402B2 (en) | 2016-04-15 | 2023-03-14 | Immunext, Inc. | Anti-human vista antibodies and use thereof |
US10882914B2 (en) | 2016-04-15 | 2021-01-05 | Alpine Immune Sciences, Inc. | ICOS ligand variant immunomodulatory proteins and uses thereof |
US11498967B2 (en) | 2016-04-15 | 2022-11-15 | Alpine Immune Sciences, Inc. | CD80 variant immunomodulatory proteins and uses thereof |
WO2017181148A2 (en) | 2016-04-15 | 2017-10-19 | Alpine Immune Sciences, Inc. | Icos ligand variant immunomodulatory proteins and uses thereof |
US11897959B2 (en) | 2016-04-15 | 2024-02-13 | Bioatla, Inc. | Anti-AXL antibodies, antibody fragments and their immunoconjugates and uses thereof |
US11510966B2 (en) | 2016-04-15 | 2022-11-29 | Evive Biotechnology (Shanghai) Ltd | Use of IL-22 in treating necrotizing enterocolitis |
US11649283B2 (en) | 2016-04-15 | 2023-05-16 | Immunext, Inc. | Anti-human vista antibodies and use thereof |
US11149088B2 (en) | 2016-04-15 | 2021-10-19 | Bioatla, Inc. | Anti-Axl antibodies, antibody fragments and their immunoconjugates and uses thereof |
US11359022B2 (en) | 2016-04-15 | 2022-06-14 | Alpine Immune Sciences, Inc. | CD80 variant immunomodulatory proteins and uses thereof |
WO2017181111A2 (en) | 2016-04-15 | 2017-10-19 | Genentech, Inc. | Methods for monitoring and treating cancer |
WO2017189724A1 (en) | 2016-04-27 | 2017-11-02 | Novartis Ag | Antibodies against growth differentiation factor 15 and uses thereof |
EP3889175A1 (en) | 2016-05-02 | 2021-10-06 | F. Hoffmann-La Roche AG | The contorsbody - a single chain target binder |
WO2017191101A1 (en) | 2016-05-02 | 2017-11-09 | F. Hoffmann-La Roche Ag | The contorsbody - a single chain target binder |
US10968279B2 (en) | 2016-05-09 | 2021-04-06 | Bristol-Myers Squibb Company | TL1A antibodies and uses thereof |
US11767364B2 (en) | 2016-05-09 | 2023-09-26 | Bristol-Myers Squibb Company | TL1A antibodies and methods of treatment |
WO2017196663A1 (en) | 2016-05-09 | 2017-11-16 | Bristol-Myers Squibb Company | Tl1a antibodies and uses thereof |
WO2017194441A1 (en) | 2016-05-11 | 2017-11-16 | F. Hoffmann-La Roche Ag | Modified anti-tenascin antibodies and methods of use |
US11879011B2 (en) | 2016-05-13 | 2024-01-23 | Bioatla, Inc. | Anti-ROR2 antibodies, antibody fragments, their immunoconjucates and uses thereof |
EP4122958A1 (en) | 2016-05-13 | 2023-01-25 | BioAtla, Inc. | Anti-ror2 antibodies, antibody fragments, their immunoconjugates and uses thereof |
WO2017197234A1 (en) | 2016-05-13 | 2017-11-16 | Bioatla, Llc | Anti-ror2 antibodies, antibody fragments, their immunoconjugates and uses thereof |
US11254742B2 (en) | 2016-05-13 | 2022-02-22 | Bioatla, Inc. | Anti-Ror2 antibodies, antibody fragments, their immunoconjugates and uses thereof |
WO2017201449A1 (en) | 2016-05-20 | 2017-11-23 | Genentech, Inc. | Protac antibody conjugates and methods of use |
US10647780B2 (en) | 2016-05-25 | 2020-05-12 | Novartis Ag | Reversal binding agents for anti-factor XI/XIa antibodies and uses thereof |
WO2017203450A1 (en) | 2016-05-25 | 2017-11-30 | Novartis Ag | Reversal binding agents for anti-factor xi/xia antibodies and uses thereof |
WO2017205721A1 (en) | 2016-05-27 | 2017-11-30 | Agenus Inc. | Anti-tim-3 antibodies and methods of use thereof |
WO2017205741A1 (en) | 2016-05-27 | 2017-11-30 | Genentech, Inc. | Bioanalytical method for the characterization of site-specific antibody-drug conjugates |
WO2017214024A1 (en) | 2016-06-06 | 2017-12-14 | Genentech, Inc. | Silvestrol antibody-drug conjugates and methods of use |
WO2017218434A1 (en) | 2016-06-12 | 2017-12-21 | Millennium Pharmaceuticals, Inc. | Method of treating inflammatory bowel disease |
WO2017216724A1 (en) | 2016-06-15 | 2017-12-21 | Novartis Ag | Methods for treating disease using inhibitors of bone morphogenetic protein 6 (bmp6) |
WO2017223405A1 (en) | 2016-06-24 | 2017-12-28 | Genentech, Inc. | Anti-polyubiquitin multispecific antibodies |
WO2018007314A1 (en) | 2016-07-04 | 2018-01-11 | F. Hoffmann-La Roche Ag | Novel antibody format |
US10864203B2 (en) | 2016-07-05 | 2020-12-15 | Beigene, Ltd. | Combination of a PD-1 antagonist and a RAF inhibitor for treating cancer |
US11534431B2 (en) | 2016-07-05 | 2022-12-27 | Beigene Switzerland Gmbh | Combination of a PD-1 antagonist and a RAF inhibitor for treating cancer |
US11591392B2 (en) | 2016-07-14 | 2023-02-28 | Bristol-Myers Squibb Company | Antibodies against TIM3 and uses thereof |
WO2018013818A2 (en) | 2016-07-14 | 2018-01-18 | Bristol-Myers Squibb Company | Antibodies against tim3 and uses thereof |
US10533052B2 (en) | 2016-07-14 | 2020-01-14 | Bristol-Myers Squibb Company | Antibodies against TIM3 and uses thereof |
US10077306B2 (en) | 2016-07-14 | 2018-09-18 | Bristol-Myers Squibb Company | Antibodies against TIM3 and uses thereof |
US11447573B2 (en) | 2016-07-20 | 2022-09-20 | Nanjing Legend Biotech Co., Ltd. | Multispecific antigen binding proteins and methods of use thereof |
WO2018022479A1 (en) | 2016-07-25 | 2018-02-01 | Biogen Ma Inc. | Anti-hspa5 (grp78) antibodies and uses thereof |
WO2018022945A1 (en) | 2016-07-28 | 2018-02-01 | Alpine Immune Sciences, Inc. | Cd112 variant immunomodulatory proteins and uses thereof |
US11471488B2 (en) | 2016-07-28 | 2022-10-18 | Alpine Immune Sciences, Inc. | CD155 variant immunomodulatory proteins and uses thereof |
WO2018022946A1 (en) | 2016-07-28 | 2018-02-01 | Alpine Immune Sciences, Inc. | Cd155 variant immunomodulatory proteins and uses thereof |
US11834490B2 (en) | 2016-07-28 | 2023-12-05 | Alpine Immune Sciences, Inc. | CD112 variant immunomodulatory proteins and uses thereof |
WO2018021450A1 (en) | 2016-07-29 | 2018-02-01 | 中外製薬株式会社 | Bispecific antibody exhibiting increased alternative fviii-cofactor-function activity |
US10494436B2 (en) | 2016-07-29 | 2019-12-03 | Aduro Biotech Holdings, Europe B.V. | Anti-PD-1 antibodies |
WO2018020476A1 (en) | 2016-07-29 | 2018-02-01 | Aduro Biotech Holdings, Europe B.V. | Anti-pd-1 antibodies |
WO2018025178A1 (en) | 2016-08-02 | 2018-02-08 | Aduro Biotech Holdings, Europe B.V. | Antibodies against human ctla-4 |
US10808030B2 (en) | 2016-08-02 | 2020-10-20 | Aduro Biotech Holdings, Europe B.V. | Anti-HCTLA-4 antibodies |
US11053308B2 (en) | 2016-08-05 | 2021-07-06 | Chugai Seiyaku Kabushiki Kaisha | Method for treating IL-8-related diseases |
WO2018027203A1 (en) | 2016-08-05 | 2018-02-08 | Allakos, Inc. | Anti-siglec-7 antibodies for the treatment of cancer |
US11780912B2 (en) | 2016-08-05 | 2023-10-10 | Chugai Seiyaku Kabushiki Kaisha | Composition for prophylaxis or treatment of IL-8 related diseases |
WO2018029124A1 (en) | 2016-08-08 | 2018-02-15 | F. Hoffmann-La Roche Ag | Therapeutic and diagnostic methods for cancer |
WO2018031662A1 (en) | 2016-08-11 | 2018-02-15 | Genentech, Inc. | Pyrrolobenzodiazepine prodrugs and antibody conjugates thereof |
US11701357B2 (en) | 2016-08-19 | 2023-07-18 | Beigene Switzerland Gmbh | Treatment of B cell cancers using a combination comprising Btk inhibitors |
US10538592B2 (en) | 2016-08-22 | 2020-01-21 | Cho Pharma, Inc. | Antibodies, binding fragments, and methods of use |
WO2018044970A1 (en) | 2016-08-31 | 2018-03-08 | University Of Rochester | Human monoclonal antibodies to human endogenous retrovirus k envelope (herv-k) and uses thereof |
US10844113B2 (en) | 2016-09-16 | 2020-11-24 | Chugai Seiyaku Kabushiki Kaisha | Anti-dengue virus antibodies, polypeptides containing variant Fc regions, and methods of use |
US11780908B2 (en) | 2016-09-16 | 2023-10-10 | Chugai Seiyaku Kabushiki Kaisha | Anti-dengue virus antibodies, polypeptides containing variant FC regions, and methods of use |
US10604561B2 (en) | 2016-09-16 | 2020-03-31 | Chugai Seiyaku Kabushiki Kaisha | Anti-dengue virus antibodies, polypeptides containing variant Fc regions, and methods of use |
US11440942B2 (en) | 2016-09-19 | 2022-09-13 | Hoffmann-La Roche Inc. | Complement factor based affinity chromatography |
WO2018050878A1 (en) | 2016-09-19 | 2018-03-22 | F. Hoffmann-La Roche Ag | Complement factor based affinity chromatography |
EP4268845A2 (en) | 2016-09-23 | 2023-11-01 | F. Hoffmann-La Roche AG | Uses of il-13 antagonists for treating atopic dermatitis |
WO2018057849A1 (en) | 2016-09-23 | 2018-03-29 | Genentech, Inc. | Uses of il-13 antagonists for treating atopic dermatitis |
WO2018058022A1 (en) | 2016-09-26 | 2018-03-29 | Merck Sharp & Dohme Corp. | Anti-cd27 antibodies |
WO2018065501A1 (en) | 2016-10-05 | 2018-04-12 | F. Hoffmann-La Roche Ag | Methods for preparing antibody drug conjugates |
WO2018068028A1 (en) | 2016-10-06 | 2018-04-12 | Genentech, Inc. | Therapeutic and diagnostic methods for cancer |
US11472881B2 (en) | 2016-10-11 | 2022-10-18 | Nanjing Legend Biotech Co., Ltd. | Single-domain antibodies and variants thereof against CTLA-4 |
WO2018071500A1 (en) | 2016-10-11 | 2018-04-19 | Agenus Inc. | Anti-lag-3 antibodies and methods of use thereof |
US10844119B2 (en) | 2016-10-11 | 2020-11-24 | Agenus Inc. | Anti-LAG-3 antibodies and methods of use thereof |
US10882908B2 (en) | 2016-10-11 | 2021-01-05 | Agenus Inc. | Anti-LAG-3 antibodies and methods of use thereof |
WO2018081648A2 (en) | 2016-10-29 | 2018-05-03 | Genentech, Inc. | Anti-mic antibidies and methods of use |
US11359028B2 (en) | 2016-11-09 | 2022-06-14 | Agenus Inc. | Anti-OX40 antibodies and anti-GITR antibodies |
WO2018087720A1 (en) | 2016-11-14 | 2018-05-17 | Novartis Ag | Compositions, methods, and therapeutic uses related to fusogenic protein minion |
US11466094B2 (en) | 2016-11-15 | 2022-10-11 | Genentech, Inc. | Dosing for treatment with anti-CD20/anti-CD3 bispecific antibodies |
WO2018093821A1 (en) | 2016-11-15 | 2018-05-24 | Genentech, Inc. | Dosing for treatment with anti-cd20/anti-cd3 bispecific antibodies |
WO2018091580A1 (en) | 2016-11-18 | 2018-05-24 | F. Hoffmann-La Roche Ag | Anti-hla-g antibodies and use thereof |
EP4335874A2 (en) | 2016-11-18 | 2024-03-13 | F. Hoffmann-La Roche AG | Anti-hla-g antibodies and use thereof |
WO2018094300A1 (en) | 2016-11-19 | 2018-05-24 | Potenza Therapeutics, Inc. | Anti-gitr antigen-binding proteins and methods of use thereof |
EP4015532A1 (en) | 2016-11-21 | 2022-06-22 | cureab GmbH | Anti-gp73 antibodies and immunoconjugates |
WO2018091724A1 (en) | 2016-11-21 | 2018-05-24 | Cureab Gmbh | Anti-gp73 antibodies and immunoconjugates |
WO2018098363A2 (en) | 2016-11-23 | 2018-05-31 | Bioverativ Therapeutics Inc. | Bispecific antibodies binding to coagulation factor ix and coagulation factor x |
WO2018106862A1 (en) | 2016-12-07 | 2018-06-14 | Agenus Inc. | Anti-ctla-4 antibodies and methods of use thereof |
WO2018106776A2 (en) | 2016-12-07 | 2018-06-14 | Genentech, Inc. | Anti-tau antibodies and methods of use |
WO2018106781A1 (en) | 2016-12-07 | 2018-06-14 | Genentech, Inc | Anti-tau antibodies and methods of use |
WO2018106864A1 (en) | 2016-12-07 | 2018-06-14 | Agenus Inc. | Antibodies and methods of use thereof |
EP4289484A2 (en) | 2016-12-07 | 2023-12-13 | Agenus Inc. | Anti-ctla-4 antibodies and methods of use thereof |
WO2018111890A1 (en) | 2016-12-12 | 2018-06-21 | Genentech, Inc. | Methods of treating cancer using anti-pd-l1 antibodies and antiandrogens |
US10206999B2 (en) | 2016-12-19 | 2019-02-19 | Mosaic Biomedicals, S.L. | Antibodies against LIF and uses thereof |
US11390670B2 (en) | 2016-12-19 | 2022-07-19 | Medimmune Limited | Antibodies against LIF and uses thereof |
EP4321219A2 (en) | 2016-12-19 | 2024-02-14 | Medimmune Limited | Antibodies against lif and uses thereof |
US10583191B2 (en) | 2016-12-19 | 2020-03-10 | Mosaic Biomedicals Slu | Antibodies against LIF and uses thereof |
WO2018115960A1 (en) | 2016-12-19 | 2018-06-28 | Mosaic Biomedicals, S.L. | Antibodies against lif and uses thereof |
WO2018114748A1 (en) | 2016-12-20 | 2018-06-28 | F. Hoffmann-La Roche Ag | Combination therapy of anti-cd20/anti-cd3 bispecific antibodies and 4-1bb (cd137) agonists |
WO2018116255A1 (en) | 2016-12-23 | 2018-06-28 | Novartis Ag | Factor xi antibodies and methods of use |
WO2018119171A1 (en) | 2016-12-23 | 2018-06-28 | Potenza Therapeutics, Inc. | Anti-neuropilin antigen-binding proteins and methods of use thereof |
US11168147B2 (en) | 2016-12-23 | 2021-11-09 | Novartis Ag | Factor XI antibodies and methods of use |
WO2018127473A1 (en) | 2017-01-03 | 2018-07-12 | F. Hoffmann-La Roche Ag | Bispecific antigen binding molecules comprising anti-4-1bb clone 20h4.9 |
WO2018129029A1 (en) | 2017-01-04 | 2018-07-12 | Immunogen, Inc. | Met antibodies and immunoconjugates and uses thereof |
WO2018129451A2 (en) | 2017-01-09 | 2018-07-12 | Merrimack Pharmaceuticals, Inc. | Anti-fgfr antibodies and methods of use |
US11274157B2 (en) | 2017-01-12 | 2022-03-15 | Eureka Therapeutics, Inc. | Constructs targeting histone H3 peptide/MHC complexes and uses thereof |
US11555038B2 (en) | 2017-01-25 | 2023-01-17 | Beigene, Ltd. | Crystalline forms of (S)-7-(1-(but-2-ynoyl)piperidin-4-yl)-2-(4-phenoxyphenyl)-4,5,6,7-tetrahydropyrazolo[1,5-a]pyrimidine-3-carboxamide, preparation, and uses thereof |
WO2018143266A1 (en) | 2017-01-31 | 2018-08-09 | Chugai Seiyaku Kabushiki Kaisha | A pharmaceutical composition for use in the treatment or prevention of a c5-related disease and a method for treating or preventing a c5-related disease |
EP4223774A2 (en) | 2017-01-31 | 2023-08-09 | Chugai Seiyaku Kabushiki Kaisha | A pharmaceutical composition for use in the treatment or prevention of a c5-related disease and a method for treating or preventing a c5-related disease |
WO2018142322A1 (en) | 2017-02-03 | 2018-08-09 | Novartis Ag | Anti-ccr7 antibody drug conjugates |
WO2018146594A1 (en) | 2017-02-08 | 2018-08-16 | Novartis Ag | Fgf21 mimetic antibodies and uses thereof |
WO2018148585A1 (en) | 2017-02-10 | 2018-08-16 | Genentech, Inc. | Anti-tryptase antibodies, compositions thereof, and uses thereof |
US11827695B2 (en) | 2017-02-17 | 2023-11-28 | Bristol-Myers Squibb Company | Antibodies to alpha-synuclein and uses thereof |
WO2018151821A1 (en) | 2017-02-17 | 2018-08-23 | Bristol-Myers Squibb Company | Antibodies to alpha-synuclein and uses thereof |
US11142570B2 (en) | 2017-02-17 | 2021-10-12 | Bristol-Myers Squibb Company | Antibodies to alpha-synuclein and uses thereof |
WO2018157027A1 (en) | 2017-02-27 | 2018-08-30 | Regeneron Pharmaceuticals, Inc. | Humanized model of kidney and liver disorders |
WO2018160841A1 (en) | 2017-03-01 | 2018-09-07 | Genentech, Inc. | Diagnostic and therapeutic methods for cancer |
WO2018158398A1 (en) | 2017-03-02 | 2018-09-07 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Antibodies having specificity to nectin-4 and uses thereof |
US11230588B2 (en) | 2017-03-16 | 2022-01-25 | Alpine Immune Sciences, Inc. | CD80 variant immunomodulatory proteins and uses thereof |
WO2018170023A1 (en) | 2017-03-16 | 2018-09-20 | Alpine Immune Sciences, Inc. | Pd-l2 variant immunomodulatory proteins and uses thereof |
WO2018170026A2 (en) | 2017-03-16 | 2018-09-20 | Alpine Immune Sciences, Inc. | Cd80 variant immunomodulatory proteins and uses thereof |
US11117948B2 (en) | 2017-03-16 | 2021-09-14 | Alpine Immune Sciences, Inc. | CD80 variant immunomodulatory proteins and uses thereof |
EP4306537A2 (en) | 2017-03-16 | 2024-01-17 | Alpine Immune Sciences, Inc. | Pd-l1 variant immunomodulatory proteins and uses thereof |
WO2018170021A1 (en) | 2017-03-16 | 2018-09-20 | Alpine Immune Sciences, Inc. | Pd-l1 variant immunomodulatory proteins and uses thereof |
US11117950B2 (en) | 2017-03-16 | 2021-09-14 | Alpine Immune Sciences, Inc. | CD80 variant immunomodulatory proteins and uses thereof |
US11732022B2 (en) | 2017-03-16 | 2023-08-22 | Alpine Immune Sciences, Inc. | PD-L2 variant immunomodulatory proteins and uses thereof |
US11117949B2 (en) | 2017-03-16 | 2021-09-14 | Alpine Immune Sciences, Inc. | CD80 variant immunomodulatory proteins and uses thereof |
US11639375B2 (en) | 2017-03-16 | 2023-05-02 | Alpine Immune Sciences, Inc. | CD80 variant immunomodulatory proteins and uses thereof |
US11096988B2 (en) | 2017-03-16 | 2021-08-24 | Alpine Immune Sciences, Inc. | CD80 variant immunomodulatory proteins and uses thereof |
WO2018175752A1 (en) | 2017-03-22 | 2018-09-27 | Genentech, Inc. | Optimized antibody compositions for treatment of ocular disorders |
WO2018175460A1 (en) | 2017-03-24 | 2018-09-27 | Novartis Ag | Methods for preventing and treating heart disease |
WO2018183175A1 (en) | 2017-03-28 | 2018-10-04 | Genentech, Inc. | Methods of treating neurodegenerative diseases |
WO2018178055A1 (en) | 2017-03-29 | 2018-10-04 | F. Hoffmann-La Roche Ag | Bispecific antigen binding molecule for a costimulatory tnf receptor |
WO2018178076A1 (en) | 2017-03-29 | 2018-10-04 | F. Hoffmann-La Roche Ag | Bispecific antigen binding molecule for a costimulatory tnf receptor |
WO2018183889A1 (en) | 2017-03-30 | 2018-10-04 | Potenza Therapeutics, Inc. | Anti-tigit antigen-binding proteins and methods of use thereof |
WO2018185618A1 (en) | 2017-04-03 | 2018-10-11 | Novartis Ag | Anti-cdh6 antibody drug conjugates and anti-gitr antibody combinations and methods of treatment |
WO2018185045A1 (en) | 2017-04-04 | 2018-10-11 | F. Hoffmann-La Roche Ag | Novel bispecific antigen binding molecules capable of specific binding to cd40 and to fap |
WO2018185046A1 (en) | 2017-04-05 | 2018-10-11 | F. Hoffmann-La Roche Ag | Anti-lag3 antibodies |
WO2018185043A1 (en) | 2017-04-05 | 2018-10-11 | F. Hoffmann-La Roche Ag | Bispecific antibodies specifically binding to pd1 and lag3 |
US11053315B2 (en) | 2017-04-07 | 2021-07-06 | Merck Sharp & Dohme Corp. | Anti-ILT4 antibodies and antigen-binding fragments |
WO2018187518A1 (en) | 2017-04-07 | 2018-10-11 | Merck Sharp & Dohme Corp. | Anti-ilt4 antibodies and antigen-binding fragments |
US11897956B2 (en) | 2017-04-07 | 2024-02-13 | Merck Sharp & Dohme Llc | Anti-ILT4 antibodies and antigen-binding fragments |
US11897957B2 (en) | 2017-04-07 | 2024-02-13 | Merck Sharp & Dohme Llc | Anti-ILT4 antibodies and antigen-binding fragments |
WO2018190719A2 (en) | 2017-04-13 | 2018-10-18 | Aduro Biotech Holdings, Europe B.V. | Anti-sirp alpha antibodies |
WO2018191502A2 (en) | 2017-04-13 | 2018-10-18 | Agenus Inc. | Anti-cd137 antibodies and methods of use thereof |
US10851164B2 (en) | 2017-04-13 | 2020-12-01 | Aduro Biotech Holdings, Europe B.V. | Anti-SIRPα antibodies |
WO2018191660A1 (en) | 2017-04-14 | 2018-10-18 | Genentech, Inc. | Diagnostic and therapeutic methods for cancer |
WO2018195472A1 (en) | 2017-04-21 | 2018-10-25 | Genentech, Inc. | Use of klk5 antagonists for treatment of a disease |
US11447564B2 (en) | 2017-04-26 | 2022-09-20 | Eureka Therapeutics, Inc. | Constructs specifically recognizing glypican 3 and uses thereof |
WO2018201096A1 (en) | 2017-04-27 | 2018-11-01 | Tesaro, Inc. | Antibody agents directed against lymphocyte activation gene-3 (lag-3) and uses thereof |
WO2018198091A1 (en) | 2017-04-28 | 2018-11-01 | Novartis Ag | Antibody conjugates comprising toll-like receptor agonist and combination therapies |
WO2018200818A2 (en) | 2017-04-28 | 2018-11-01 | Millennium Pharmaceuticals, Inc. | Method of treating pediatric disorders |
WO2018204363A1 (en) | 2017-05-01 | 2018-11-08 | Agenus Inc. | Anti-tigit antibodies and methods of use thereof |
EP4275698A2 (en) | 2017-05-01 | 2023-11-15 | Agenus Inc. | Anti-tigit antibodies and methods of use thereof |
EP4241848A2 (en) | 2017-05-04 | 2023-09-13 | Acceleron Pharma Inc. | Tgf-beta receptor type ii fusion proteins and uses thereof |
WO2018204594A1 (en) | 2017-05-04 | 2018-11-08 | Acceleron Pharma Inc. | Tgf-beta receptor type ii fusion proteins and uses thereof |
US11203638B2 (en) | 2017-05-05 | 2021-12-21 | Allakos Inc. | Methods and compositions for treating perennial allergic conjunctivitis and keratoconjunctivitis |
WO2018213097A1 (en) | 2017-05-15 | 2018-11-22 | University Of Rochester | Broadly neutralizing anti-influenza monoclonal antibody and uses thereof |
WO2018215938A1 (en) | 2017-05-24 | 2018-11-29 | Novartis Ag | Antibody-cytokine engrafted proteins and methods of use |
WO2018215935A1 (en) | 2017-05-24 | 2018-11-29 | Novartis Ag | Antibody-cytokine engrafted proteins and methods of use for immune related disorders |
WO2018215937A1 (en) | 2017-05-24 | 2018-11-29 | Novartis Ag | Interleukin-7 antibody cytokine engrafted proteins and methods of use in the treatment of cancer |
WO2018215936A1 (en) | 2017-05-24 | 2018-11-29 | Novartis Ag | Antibody-cytokine engrafted proteins and methods of use in the treatment of cancer |
WO2018218056A1 (en) | 2017-05-25 | 2018-11-29 | Birstol-Myers Squibb Company | Antibodies comprising modified heavy constant regions |
EP4098662A1 (en) | 2017-05-25 | 2022-12-07 | Bristol-Myers Squibb Company | Antibodies comprising modified heavy constant regions |
WO2018220446A1 (en) | 2017-06-01 | 2018-12-06 | Compugen Ltd. | Triple combination antibody therapies |
WO2018229612A1 (en) | 2017-06-12 | 2018-12-20 | Novartis Ag | Method of manufacturing bispecific antibodies, bispecific antibodies and therapeutic use of such antibodies |
WO2018229715A1 (en) | 2017-06-16 | 2018-12-20 | Novartis Ag | Compositions comprising anti-cd32b antibodies and methods of use thereof |
WO2018229706A1 (en) | 2017-06-16 | 2018-12-20 | Novartis Ag | Combination therapy for the treatment of cancer |
WO2018236904A1 (en) | 2017-06-19 | 2018-12-27 | Surface Oncology, Inc. | Combination of anti-cd47 antibodies and cell death-inducing agents, and uses thereof |
WO2018237097A1 (en) | 2017-06-20 | 2018-12-27 | Amgen Inc. | Method of treating or ameliorating metabolic disorders using binding proteins for gastric inhibitory peptide receptor (gipr) in combination with glp-1 agonists |
US11654135B2 (en) | 2017-06-22 | 2023-05-23 | Moonshot Pharma Llc | Methods for treating colon cancer with compositions comprising amlexanox and immune checkpoint inhibitors |
WO2018237335A1 (en) | 2017-06-23 | 2018-12-27 | VelosBio Inc. | Ror1 antibody immunoconjugates |
US11597768B2 (en) | 2017-06-26 | 2023-03-07 | Beigene, Ltd. | Immunotherapy for hepatocellular carcinoma |
WO2019003104A1 (en) | 2017-06-28 | 2019-01-03 | Novartis Ag | Methods for preventing and treating urinary incontinence |
US11752207B2 (en) | 2017-07-11 | 2023-09-12 | Compass Therapeutics Llc | Agonist antibodies that bind human CD137 and uses thereof |
WO2019018757A1 (en) | 2017-07-21 | 2019-01-24 | Genentech, Inc. | Therapeutic and diagnostic methods for cancer |
WO2019023347A1 (en) | 2017-07-26 | 2019-01-31 | Forty Seven, Inc. | Anti-sirp-alpha antibodies and related methods |
WO2019022187A1 (en) | 2017-07-27 | 2019-01-31 | 第一三共株式会社 | Anti-cd147 antibody |
US11739150B2 (en) | 2017-08-11 | 2023-08-29 | Genentech, Inc. | Anti-CD8 antibodies and uses thereof |
WO2019033043A2 (en) | 2017-08-11 | 2019-02-14 | Genentech, Inc. | Anti-cd8 antibodies and uses thereof |
WO2019036605A2 (en) | 2017-08-17 | 2019-02-21 | Massachusetts Institute Of Technology | Multiple specificity binders of cxc chemokines and uses thereof |
US11814431B2 (en) | 2017-08-25 | 2023-11-14 | Five Prime Therapeutics, Inc. | B7-H4 antibodies and methods of use thereof |
US11306144B2 (en) | 2017-08-25 | 2022-04-19 | Five Prime Therapeutics, Inc. | B7-H4 antibodies and methods of use thereof |
WO2019040780A1 (en) | 2017-08-25 | 2019-02-28 | Five Prime Therapeutics Inc. | B7-h4 antibodies and methods of use thereof |
WO2019059411A1 (en) | 2017-09-20 | 2019-03-28 | Chugai Seiyaku Kabushiki Kaisha | Dosage regimen for combination therapy using pd-1 axis binding antagonists and gpc3 targeting agent |
WO2019065964A1 (en) | 2017-09-29 | 2019-04-04 | 第一三共株式会社 | Antibody-pyrrolobenzodiazepine derivative conjugate |
WO2019065795A1 (en) | 2017-09-29 | 2019-04-04 | 中外製薬株式会社 | Multispecific antigen-binding molecule having blood coagulation factor viii (fviii) cofactor function-substituting activity, and pharmaceutical formulation containing said molecule as active ingredient |
US11230601B2 (en) | 2017-10-10 | 2022-01-25 | Tilos Therapeutics, Inc. | Methods of using anti-lap antibodies |
EP4219540A2 (en) | 2017-10-10 | 2023-08-02 | Alpine Immune Sciences, Inc. | Ctla-4 variant immunomodulatory proteins and uses thereof |
WO2019074983A1 (en) | 2017-10-10 | 2019-04-18 | Alpine Immune Sciences, Inc. | Ctla-4 variant immunomodulatory proteins and uses thereof |
US11753458B2 (en) | 2017-10-10 | 2023-09-12 | Alpine Immune Sciences, Inc. | CTLA-4 variant immunomodulatory proteins and uses thereof |
WO2019075090A1 (en) | 2017-10-10 | 2019-04-18 | Tilos Therapeutics, Inc. | Anti-lap antibodies and uses thereof |
US11912754B2 (en) | 2017-10-12 | 2024-02-27 | Immunowake Inc. | VEGFR-antibody light chain fusion protein |
US11613566B2 (en) | 2017-10-18 | 2023-03-28 | Alpine Immune Sciences, Inc. | Variant ICOS ligand immunomodulatory proteins and related compositions and methods |
WO2019079520A2 (en) | 2017-10-18 | 2019-04-25 | Alpine Immune Sciences, Inc. | Variant icos ligand immunomodulatory proteins and related compositions and methods |
WO2019077092A1 (en) | 2017-10-20 | 2019-04-25 | F. Hoffmann-La Roche Ag | Method for generating multispecific antibodies from monospecific antibodies |
WO2019081983A1 (en) | 2017-10-25 | 2019-05-02 | Novartis Ag | Antibodies targeting cd32b and methods of use thereof |
WO2019086362A1 (en) | 2017-10-30 | 2019-05-09 | F. Hoffmann-La Roche Ag | Method for in vivo generation of multispecific antibodies from monospecific antibodies |
US11718679B2 (en) | 2017-10-31 | 2023-08-08 | Compass Therapeutics Llc | CD137 antibodies and PD-1 antagonists and uses thereof |
WO2019089753A2 (en) | 2017-10-31 | 2019-05-09 | Compass Therapeutics Llc | Cd137 antibodies and pd-1 antagonists and uses thereof |
WO2019090263A1 (en) | 2017-11-06 | 2019-05-09 | Genentech, Inc. | Diagnostic and therapeutic methods for cancer |
WO2019100052A2 (en) | 2017-11-20 | 2019-05-23 | Compass Therapeutics Llc | Cd137 antibodies and tumor antigen-targeting antibodies and uses thereof |
WO2019102353A1 (en) | 2017-11-22 | 2019-05-31 | Novartis Ag | Reversal binding agents for anti-factor xi/xia antibodies and uses thereof |
US11786529B2 (en) | 2017-11-29 | 2023-10-17 | Beigene Switzerland Gmbh | Treatment of indolent or aggressive B-cell lymphomas using a combination comprising BTK inhibitors |
WO2019106578A2 (en) | 2017-12-01 | 2019-06-06 | Novartis Ag | Polyomavirus neutralizing antibodies |
WO2019110823A1 (en) | 2017-12-08 | 2019-06-13 | Argenx Bvba | Use of fcrn antagonists for treatment of generalized myasthenia gravis |
WO2019126536A1 (en) | 2017-12-20 | 2019-06-27 | Alexion Pharmaceuticals Inc. | Humanized anti-cd200 antibodies and uses thereof |
WO2019126133A1 (en) | 2017-12-20 | 2019-06-27 | Alexion Pharmaceuticals, Inc. | Liquid formulations of anti-cd200 antibodies |
WO2019122049A1 (en) | 2017-12-21 | 2019-06-27 | F. Hoffmann-La Roche Ag | Combination therapy of tumor targeted icos agonists with t-cell bispecific molecules |
EP3502140A1 (en) | 2017-12-21 | 2019-06-26 | F. Hoffmann-La Roche AG | Combination therapy of tumor targeted icos agonists with t-cell bispecific molecules |
WO2019126472A1 (en) | 2017-12-22 | 2019-06-27 | Genentech, Inc. | Use of pilra binding agents for treatment of a disease |
WO2019129211A1 (en) | 2017-12-28 | 2019-07-04 | Nanjing Legend Biotech Co., Ltd. | Antibodies and variants thereof against pd-l1 |
US11905327B2 (en) | 2017-12-28 | 2024-02-20 | Nanjing Legend Biotech Co., Ltd. | Single-domain antibodies and variants thereof against TIGIT |
WO2019129677A1 (en) | 2017-12-29 | 2019-07-04 | F. Hoffmann-La Roche Ag | Anti-vegf antibodies and methods of use |
WO2019136179A1 (en) | 2018-01-03 | 2019-07-11 | Alpine Immune Sciences, Inc. | Multi-domain immunomodulatory proteins and methods of use thereof |
WO2019134981A1 (en) | 2018-01-05 | 2019-07-11 | Ac Immune Sa | Misfolded tdp-43 binding molecules |
WO2019140229A1 (en) | 2018-01-12 | 2019-07-18 | Bristol-Myers Squibb Company | Antibodies against tim3 and uses thereof |
US11713353B2 (en) | 2018-01-15 | 2023-08-01 | Nanjing Legend Biotech Co., Ltd. | Single-domain antibodies and variants thereof against PD-1 |
WO2019143636A1 (en) | 2018-01-16 | 2019-07-25 | Lakepharma, Inc. | Bispecific antibody that binds cd3 and another target |
WO2019148020A1 (en) | 2018-01-26 | 2019-08-01 | Genentech, Inc. | Compositions and methods of use |
WO2019148026A1 (en) | 2018-01-26 | 2019-08-01 | Genentech, Inc. | Il-22 fc fusion proteins and methods of use |
US11072658B2 (en) | 2018-02-01 | 2021-07-27 | Merck Sharp & Dohme Corp. | Anti-PD-1/LAG3 bispecific antibodies |
WO2019152642A1 (en) | 2018-02-01 | 2019-08-08 | Merck Sharp & Dohme Corp. | Anti-pd-1/lag3 bispecific antibodies |
WO2019157308A1 (en) | 2018-02-08 | 2019-08-15 | Genentech, Inc. | Bispecific antigen-binding molecules and methods of use |
US11866498B2 (en) | 2018-02-08 | 2024-01-09 | Genentech, Inc. | Bispecific antigen-binding molecules and methods of use |
WO2019157358A1 (en) | 2018-02-09 | 2019-08-15 | Genentech, Inc. | Therapeutic and diagnostic methods for mast cell-mediated inflammatory diseases |
WO2019158645A1 (en) | 2018-02-14 | 2019-08-22 | Abba Therapeutics Ag | Anti-human pd-l2 antibodies |
WO2019165140A1 (en) | 2018-02-21 | 2019-08-29 | Genentech, Inc. | DOSING FOR TREATMENT WITH IL-22 Fc FUSION PROTEINS |
WO2019165434A1 (en) | 2018-02-26 | 2019-08-29 | Genentech, Inc. | Dosing for treatment with anti-tigit and anti-pd-l1 antagonist antibodies |
US11939383B2 (en) | 2018-03-02 | 2024-03-26 | Five Prime Therapeutics, Inc. | B7-H4 antibodies and methods and use thereof |
WO2019168403A2 (en) | 2018-03-02 | 2019-09-06 | Labo Bio-Medical Investments B.V. | Multispecific binding molecules for the prevention, treatment and diagnosis of neurodegenerative disorders |
WO2019172165A1 (en) | 2018-03-05 | 2019-09-12 | 学校法人埼玉医科大学 | Pharmaceutical composition for treating or preventing heterotopic ossification |
WO2019175071A1 (en) | 2018-03-13 | 2019-09-19 | F. Hoffmann-La Roche Ag | Therapeutic combination of 4-1 bb agonists with anti-cd20 antibodies |
WO2019178316A1 (en) | 2018-03-14 | 2019-09-19 | Genentech, Inc. | Anti-klk5 antibodies and methods of use |
US10793637B2 (en) | 2018-03-14 | 2020-10-06 | Surface Oncology, Inc. | Antibodies that bind CD39 and uses thereof |
EP4043496A1 (en) | 2018-03-14 | 2022-08-17 | Surface Oncology, Inc. | Antibodies that bind cd39 and uses thereof |
WO2019178269A2 (en) | 2018-03-14 | 2019-09-19 | Surface Oncology, Inc. | Antibodies that bind cd39 and uses thereof |
US10738128B2 (en) | 2018-03-14 | 2020-08-11 | Surface Oncology, Inc. | Antibodies that bind CD39 and uses thereof |
US11891432B2 (en) | 2018-03-15 | 2024-02-06 | Chugai Seiyaku Kabushiki Kaisha | Anti-dengue virus antibodies having cross-reactivity to Zika virus and methods of use |
US11661452B2 (en) | 2018-03-20 | 2023-05-30 | WuXi Biologics Ireland Limited | Anti-lag-3 antibody polypeptide |
WO2019183040A1 (en) | 2018-03-21 | 2019-09-26 | Five Prime Therapeutics, Inc. | ANTIBODIES BINDING TO VISTA AT ACIDIC pH |
US11332524B2 (en) | 2018-03-22 | 2022-05-17 | Surface Oncology, Inc. | Anti-IL-27 antibodies and uses thereof |
US11242393B2 (en) | 2018-03-23 | 2022-02-08 | Bristol-Myers Squibb Company | Antibodies against MICA and/or MICB and uses thereof |
WO2019191552A1 (en) | 2018-03-29 | 2019-10-03 | Genentech, Inc. | Modulating lactogenic activity in mammalian cells |
US11958903B2 (en) | 2018-03-30 | 2024-04-16 | Nanjing Legend Biotech Co., Ltd. | Single-domain antibodies against LAG-3 and uses thereof |
WO2019195126A1 (en) | 2018-04-02 | 2019-10-10 | Bristol-Myers Squibb Company | Anti-trem-1 antibodies and uses thereof |
US11155618B2 (en) | 2018-04-02 | 2021-10-26 | Bristol-Myers Squibb Company | Anti-TREM-1 antibodies and uses thereof |
WO2019195514A1 (en) | 2018-04-04 | 2019-10-10 | Genentech, Inc. | Methods for detecting and quantifying fgf21 |
WO2019197428A1 (en) | 2018-04-10 | 2019-10-17 | Inatherys | Antibody-drug conjugates and their uses for the treatment of cancer |
EP3552631A1 (en) | 2018-04-10 | 2019-10-16 | Inatherys | Antibody-drug conjugates and their uses for the treatment of cancer |
WO2019200357A1 (en) | 2018-04-12 | 2019-10-17 | Surface Oncology, Inc. | Biomarker for cd47 targeting therapeutics and uses therefor |
WO2019197903A1 (en) | 2018-04-12 | 2019-10-17 | Mosaic Biomedicals Slu | Combination of lif inhibitors and pd-1 axis inhibitors for use in treating cancer |
WO2019202041A1 (en) | 2018-04-18 | 2019-10-24 | F. Hoffmann-La Roche Ag | Multispecific antibodies and use thereof |
WO2019202040A1 (en) | 2018-04-18 | 2019-10-24 | F. Hoffmann-La Roche Ag | Anti-hla-g antibodies and use thereof |
WO2019213384A1 (en) | 2018-05-03 | 2019-11-07 | University Of Rochester | Anti-influenza neuraminidase monoclonal antibodies and uses thereof |
WO2019214707A1 (en) | 2018-05-11 | 2019-11-14 | 信达生物制药(苏州)有限公司 | Preparations comprising anti-pcsk9 antibodies and use thereof |
US11352403B2 (en) | 2018-05-14 | 2022-06-07 | Werewolf Therapeutics, Inc. | Activatable interleukin-2 polypeptides and methods of use thereof |
WO2019220204A2 (en) | 2018-05-14 | 2019-11-21 | Mosaic Biomedicals Slu | Antibodies against lif and dosage forms thereof |
US11453710B2 (en) | 2018-05-14 | 2022-09-27 | Werewolf Therapeutics, Inc. | Activatable interleukin 12 polypeptides and methods of use thereof |
US11535658B2 (en) | 2018-05-14 | 2022-12-27 | Werewolf Therapeutics, Inc. | Activatable interleukin-2 polypeptides and methods of use thereof |
WO2019229658A1 (en) | 2018-05-30 | 2019-12-05 | Novartis Ag | Entpd2 antibodies, combination therapies, and methods of using the antibodies and combination therapies |
WO2019229699A1 (en) | 2018-05-31 | 2019-12-05 | Novartis Ag | Hepatitis b antibodies |
US11932681B2 (en) | 2018-05-31 | 2024-03-19 | Novartis Ag | Hepatitis B antibodies |
WO2019229701A2 (en) | 2018-06-01 | 2019-12-05 | Novartis Ag | Binding molecules against bcma and uses thereof |
WO2019235426A1 (en) | 2018-06-04 | 2019-12-12 | 中外製薬株式会社 | Antigen-binding molecule showing changed half-life in cytoplasm |
WO2019241758A1 (en) | 2018-06-15 | 2019-12-19 | Alpine Immune Sciences, Inc. | Pd-1 variant immunomodulatory proteins and uses thereof |
WO2019243900A2 (en) | 2018-06-18 | 2019-12-26 | Mosaic Biomedicals Slu | Combination of lif inhibitors and platinum-based antineoplastic agents for use in treating cancer |
WO2019246557A1 (en) | 2018-06-23 | 2019-12-26 | Genentech, Inc. | Methods of treating lung cancer with a pd-1 axis binding antagonist, a platinum agent, and a topoisomerase ii inhibitor |
WO2020007817A1 (en) | 2018-07-04 | 2020-01-09 | F. Hoffmann-La Roche Ag | Novel bispecific agonistic 4-1bb antigen binding molecules |
WO2020014132A2 (en) | 2018-07-09 | 2020-01-16 | Five Prime Therapeutics, Inc. | Antibodies binding to ilt4 |
WO2020013170A1 (en) | 2018-07-10 | 2020-01-16 | 国立大学法人神戸大学 | ANTI-SIRPα ANTIBODY |
WO2020014306A1 (en) | 2018-07-10 | 2020-01-16 | Immunogen, Inc. | Met antibodies and immunoconjugates and uses thereof |
WO2020014327A2 (en) | 2018-07-11 | 2020-01-16 | Five Prime Therapeutics, Inc. | Antibodies binding to vista at acidic ph |
WO2020018789A1 (en) | 2018-07-18 | 2020-01-23 | Genentech, Inc. | Methods of treating lung cancer with a pd-1 axis binding antagonist, an antimetabolite, and a platinum agent |
US11214619B2 (en) | 2018-07-20 | 2022-01-04 | Surface Oncology, Inc. | Anti-CD112R compositions and methods |
US11279758B2 (en) | 2018-07-20 | 2022-03-22 | Surface Oncology, Inc. | Anti-CD112R compositions and methods |
WO2020027279A1 (en) | 2018-08-01 | 2020-02-06 | Chugai Seiyaku Kabushiki Kaisha | A pharmaceutical composition for use in the treatment or prevention of a c5-related disease and a method for treating or preventing a c5-related disease |
WO2020025703A1 (en) | 2018-08-01 | 2020-02-06 | Imcheck Therapeutics Sas | Anti-btn3a antibodies and their use in treating cancer or infectious disorders |
WO2020027330A1 (en) | 2018-08-03 | 2020-02-06 | 中外製薬株式会社 | Antigen-binding molecule containing two antigen-binding domains that are linked to each other |
EP3608674A1 (en) | 2018-08-09 | 2020-02-12 | Regeneron Pharmaceuticals, Inc. | Methods for assessing binding affinity of an antibody variant to the neonatal fc receptor |
WO2020033923A1 (en) | 2018-08-09 | 2020-02-13 | Compass Therapeutics Llc | Antigen binding agents that bind cd277 and uses thereof |
WO2020033926A2 (en) | 2018-08-09 | 2020-02-13 | Compass Therapeutics Llc | Antibodies that bind cd277 and uses thereof |
WO2020033925A2 (en) | 2018-08-09 | 2020-02-13 | Compass Therapeutics Llc | Antibodies that bind cd277 and uses thereof |
WO2020032230A1 (en) | 2018-08-10 | 2020-02-13 | 中外製薬株式会社 | Anti-cd137 antigen-binding molecule and utilization thereof |
WO2020037154A1 (en) | 2018-08-17 | 2020-02-20 | 23Andme, Inc. | Anti-il1rap antibodies and methods of use thereof |
WO2020049286A1 (en) | 2018-09-03 | 2020-03-12 | Femtogenix Limited | Polycyclic amides as cytotoxic agents |
WO2020050406A1 (en) | 2018-09-06 | 2020-03-12 | 第一三共株式会社 | Novel cyclic dinucleotide derivative and antibody-drug conjugate thereof |
WO2020053742A2 (en) | 2018-09-10 | 2020-03-19 | Novartis Ag | Anti-hla-hbv peptide antibodies |
WO2020056077A1 (en) | 2018-09-13 | 2020-03-19 | The Board Of Regents Of The University Of Texas System | Novel lilrb4 antibodies and uses thereof |
WO2020061060A1 (en) | 2018-09-19 | 2020-03-26 | Genentech, Inc. | Therapeutic and diagnostic methods for bladder cancer |
WO2020061376A2 (en) | 2018-09-19 | 2020-03-26 | Alpine Immune Sciences, Inc. | Methods and uses of variant cd80 fusion proteins and related constructs |
EP4249917A2 (en) | 2018-09-21 | 2023-09-27 | F. Hoffmann-La Roche AG | Diagnostic methods for triple-negative breast cancer |
WO2020061349A1 (en) | 2018-09-21 | 2020-03-26 | Genentech, Inc. | Diagnostic methods for triple-negative breast cancer |
EP4321530A2 (en) | 2018-09-27 | 2024-02-14 | Xilio Development, Inc. | Masked cytokine polypeptides |
US11827685B2 (en) | 2018-09-27 | 2023-11-28 | Xilio Development, Inc. | Masked cytokine polypeptides |
US11053294B2 (en) | 2018-09-27 | 2021-07-06 | Xilio Development, Inc. | Masked cytokine polypeptides |
US11866476B2 (en) | 2018-09-27 | 2024-01-09 | Xilio Development, Inc. | Masked IL-2-Fc fusion polypeptides |
US11718655B2 (en) | 2018-09-27 | 2023-08-08 | Xilio Development, Inc. | Masked interleukin-12 polypeptides |
US11827686B2 (en) | 2018-09-27 | 2023-11-28 | Xilio Development, Inc. | Masked cytokine polypeptides |
WO2020070041A1 (en) | 2018-10-01 | 2020-04-09 | F. Hoffmann-La Roche Ag | Bispecific antigen binding molecules comprising anti-fap clone 212 |
WO2020070035A1 (en) | 2018-10-01 | 2020-04-09 | F. Hoffmann-La Roche Ag | Bispecific antigen binding molecules with trivalent binding to cd40 |
US11130802B2 (en) | 2018-10-10 | 2021-09-28 | Tilos Therapeutics, Inc. | Anti-lap antibody variants |
WO2020076969A2 (en) | 2018-10-10 | 2020-04-16 | Tilos Therapeutics, Inc. | Anti-lap antibody variants and uses thereof |
WO2020079580A1 (en) | 2018-10-15 | 2020-04-23 | Novartis Ag | Trem2 stabilizing antibodies |
WO2020081493A1 (en) | 2018-10-16 | 2020-04-23 | Molecular Templates, Inc. | Pd-l1 binding proteins |
WO2020081767A1 (en) | 2018-10-18 | 2020-04-23 | Genentech, Inc. | Diagnostic and therapeutic methods for sarcomatoid kidney cancer |
WO2020089811A1 (en) | 2018-10-31 | 2020-05-07 | Novartis Ag | Dc-sign antibody drug conjugates |
WO2020096959A1 (en) | 2018-11-05 | 2020-05-14 | Genentech, Inc. | Methods of producing two chain proteins in prokaryotic host cells |
WO2020095922A1 (en) | 2018-11-07 | 2020-05-14 | 第一三共株式会社 | Method of improving blood kinetics of peptide |
WO2020102555A1 (en) | 2018-11-16 | 2020-05-22 | Memorial Sloan Kettering Cancer Center | Antibodies to mucin-16 and methods of use thereof |
WO2020108530A1 (en) | 2018-11-27 | 2020-06-04 | 信达生物制药(苏州)有限公司 | Anti-il-23p19 antibody and uses thereof |
WO2020112781A1 (en) | 2018-11-28 | 2020-06-04 | Bristol-Myers Squibb Company | Antibodies comprising modified heavy constant regions |
WO2020113141A2 (en) | 2018-11-30 | 2020-06-04 | Alpine Immune Sciences, Inc. | Cd86 variant immunomodulatory proteins and uses thereof |
WO2020117952A2 (en) | 2018-12-05 | 2020-06-11 | Genentech, Inc. | Diagnostic methods and compositions for cancer immunotherapy |
EP4198057A1 (en) | 2018-12-05 | 2023-06-21 | F. Hoffmann-La Roche AG | Diagnostic methods and compositions for cancer immunotherapy |
WO2020117257A1 (en) | 2018-12-06 | 2020-06-11 | Genentech, Inc. | Combination therapy of diffuse large b-cell lymphoma comprising an anti-cd79b immunoconjugates, an alkylating agent and an anti-cd20 antibody |
WO2020118011A1 (en) | 2018-12-06 | 2020-06-11 | Alexion Pharmaceuticals, Inc. | Anti-alk2 antibodies and uses thereof |
WO2020123275A1 (en) | 2018-12-10 | 2020-06-18 | Genentech, Inc. | Photocrosslinking peptides for site specific conjugation to fc-containing proteins |
WO2020121059A1 (en) | 2018-12-14 | 2020-06-18 | Northern Biologics Inc. | Anti-periostin antibodies and uses thereof |
WO2020128863A1 (en) | 2018-12-19 | 2020-06-25 | Novartis Ag | Anti-tnf-alpha antibodies |
WO2020132034A1 (en) | 2018-12-20 | 2020-06-25 | 23Andme, Inc. | Anti-cd96 antibodies and methods of use thereof |
WO2020132230A2 (en) | 2018-12-20 | 2020-06-25 | Genentech, Inc. | Modified antibody fcs and methods of use |
WO2020128612A2 (en) | 2018-12-21 | 2020-06-25 | Novartis Ag | Antibodies to pmel17 and conjugates thereof |
WO2020127873A1 (en) | 2018-12-21 | 2020-06-25 | F. Hoffmann-La Roche Ag | Antibody that binds to vegf and il-1beta and methods of use |
WO2020132220A1 (en) | 2018-12-21 | 2020-06-25 | 23Andme, Inc. | Anti-il-36 antibodies and methods of use thereof |
WO2020132231A1 (en) | 2018-12-21 | 2020-06-25 | Genentech, Inc. | Methods of producing polypeptides using a cell line resistant to apoptosis |
WO2020139926A2 (en) | 2018-12-26 | 2020-07-02 | Akrevia Therapeutics Inc. | Anti-ctla4 antibodies and methods of use thereof |
WO2020139920A2 (en) | 2018-12-26 | 2020-07-02 | City Of Hope | Activatable masked anti-ctla4 binding proteins |
WO2020141145A1 (en) | 2018-12-30 | 2020-07-09 | F. Hoffmann-La Roche Ag | Anti-rabbit cd19 antibodies and methods of use |
WO2020148207A1 (en) | 2019-01-14 | 2020-07-23 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Human monoclonal antibodies binding to hla-a2 |
WO2020150152A1 (en) | 2019-01-14 | 2020-07-23 | Genentech, Inc. | Methods of treating cancer with a pd-1 axis binding antagonist and an rna vaccine |
WO2020150496A1 (en) | 2019-01-16 | 2020-07-23 | Compass Therapeutics Llc | Formulations of antibodies that bind human cd137 and uses thereof |
US11919962B2 (en) | 2019-01-22 | 2024-03-05 | Bristol Myers-Squibb Company | Antibodies against IL-7R alpha subunit and uses thereof |
WO2020154405A2 (en) | 2019-01-22 | 2020-07-30 | Genentech, Inc. | Immunoglobulin a antibodies and methods of production and use |
WO2020154293A1 (en) | 2019-01-22 | 2020-07-30 | Bristol-Myers Squibb Company | Antibodies against il-7r alpha subunit and uses thereof |
US11008395B2 (en) | 2019-01-22 | 2021-05-18 | Bristol Myers-Squibb Company | Antibodies against IL-7R alpha subunit and uses thereof |
WO2020154410A1 (en) | 2019-01-23 | 2020-07-30 | Genentech, Inc. | Methods of producing multimeric proteins in eukaryotic host cells |
WO2020153467A1 (en) | 2019-01-24 | 2020-07-30 | 中外製薬株式会社 | Novel cancer antigens and antibodies of said antigens |
WO2020157491A1 (en) | 2019-01-29 | 2020-08-06 | Femtogenix Limited | G-a crosslinking cytotoxic agents |
WO2020176748A1 (en) | 2019-02-27 | 2020-09-03 | Genentech, Inc. | Dosing for treatment with anti-tigit and anti-cd20 or anti-cd38 antibodies |
WO2020185535A1 (en) | 2019-03-08 | 2020-09-17 | Genentech, Inc. | Methods for detecting and quantifying membrane-associated proteins on extracellular vesicles |
WO2020186176A1 (en) | 2019-03-14 | 2020-09-17 | Genentech, Inc. | Treatment of cancer with her2xcd3 bispecific antibodies in combination with anti-her2 mab |
WO2020196474A1 (en) | 2019-03-25 | 2020-10-01 | 第一三共株式会社 | Antibody-pyrrolobenzodiazepine derivative conjugate |
WO2020196712A1 (en) | 2019-03-27 | 2020-10-01 | 第一三共株式会社 | Combination of antibody-pyrrolobenzodiazepine derivative conjugate and parp inhibitor |
WO2020210358A1 (en) | 2019-04-08 | 2020-10-15 | Biogen Ma Inc. | Anti-integrin antibodies and uses thereof |
WO2020208177A1 (en) | 2019-04-11 | 2020-10-15 | Argenx Bvba | ANTI-IgE ANTIBODIES |
WO2020214867A1 (en) | 2019-04-17 | 2020-10-22 | Alpine Immune Sciences, Inc. | Methods and uses of variant icos ligand (icosl) fusion proteins |
WO2020213724A1 (en) | 2019-04-19 | 2020-10-22 | 中外製薬株式会社 | Chimeric receptor recognizing modification site of antibody |
WO2020214995A1 (en) | 2019-04-19 | 2020-10-22 | Genentech, Inc. | Anti-mertk antibodies and their methods of use |
WO2020226986A2 (en) | 2019-05-03 | 2020-11-12 | Genentech, Inc. | Methods of treating cancer with an anti-pd-l1 antibody |
US11739132B2 (en) | 2019-05-14 | 2023-08-29 | Werewolf Therapeutics, Inc. | Separation moieties and methods of use thereof |
WO2020232169A1 (en) | 2019-05-14 | 2020-11-19 | Genentech, Inc. | Methods of using anti-cd79b immunoconjugates to treat follicular lymphoma |
WO2020236817A2 (en) | 2019-05-20 | 2020-11-26 | Novartis Ag | Mcl-1 inhibitor antibody-drug conjugates and methods of use |
WO2020236841A2 (en) | 2019-05-20 | 2020-11-26 | Novartis Ag | Antibody drug conjugates having linkers comprising hydrophilic groups |
WO2020236795A2 (en) | 2019-05-21 | 2020-11-26 | Novartis Ag | Trispecific binding molecules against bcma and uses thereof |
WO2020236797A1 (en) | 2019-05-21 | 2020-11-26 | Novartis Ag | Variant cd58 domains and uses thereof |
WO2020236792A1 (en) | 2019-05-21 | 2020-11-26 | Novartis Ag | Cd19 binding molecules and uses thereof |
WO2020234473A1 (en) | 2019-05-23 | 2020-11-26 | Ac Immune Sa | Anti-tdp-43 binding molecules and uses thereof |
US11591388B2 (en) | 2019-06-07 | 2023-02-28 | argenx BV | Pharmaceutical formulations of FcRn inhibitors suitable for subcutaneous administration |
WO2020250159A1 (en) | 2019-06-12 | 2020-12-17 | Novartis Ag | Natriuretic peptide receptor 1 antibodies and methods of use |
WO2020263830A1 (en) | 2019-06-25 | 2020-12-30 | Gilead Sciences, Inc. | Flt3l-fc fusion proteins and methods of use |
WO2020260326A1 (en) | 2019-06-27 | 2020-12-30 | F. Hoffmann-La Roche Ag | Novel icos antibodies and tumor-targeted antigen binding molecules comprising them |
WO2021010326A1 (en) | 2019-07-12 | 2021-01-21 | 中外製薬株式会社 | Anti-mutation type fgfr3 antibody and use therefor |
WO2021009047A1 (en) | 2019-07-12 | 2021-01-21 | F. Hoffmann-La Roche Ag | Antibodies which bind to cancer cells and target radionuclides to said cells |
WO2021011678A1 (en) | 2019-07-15 | 2021-01-21 | Bristol-Myers Squibb Company | Anti-trem-1 antibodies and uses thereof |
WO2021011681A1 (en) | 2019-07-15 | 2021-01-21 | Bristol-Myers Squibb Company | Antibodies against human trem-1 and uses thereof |
WO2021009263A1 (en) | 2019-07-16 | 2021-01-21 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Antibodies having specificity for cd38 and uses thereof |
WO2021014389A1 (en) | 2019-07-24 | 2021-01-28 | H. Lundbeck A/S | Anti-mglur5 antibodies and uses thereof |
WO2021020282A1 (en) | 2019-07-26 | 2021-02-04 | 学校法人埼玉医科大学 | Antibody recognizing extracellular region of alk2/acvr1 |
WO2021021837A2 (en) | 2019-07-29 | 2021-02-04 | Compugen Ltd. | Anti-pvrig antibodies formulations and uses thereof |
WO2021019036A1 (en) | 2019-07-31 | 2021-02-04 | F. Hoffmann-La Roche Ag | Dosage and administration regimen for the treatment or prevention of c5-related diseases by the use of the anti-c5 antibody crovalimab |
WO2021019033A1 (en) | 2019-07-31 | 2021-02-04 | F. Hoffmann-La Roche Ag | Dosage and administration regimen for the treatment or prevention of c5-related diseases by the use of the anti-c5 antibody crovalimab |
WO2021024209A1 (en) | 2019-08-06 | 2021-02-11 | Aprinoia Therapeutics Inc. | Antibodies that bind to pathological tau species and uses thereof |
WO2021030488A1 (en) | 2019-08-12 | 2021-02-18 | Bienvenue David Leonard | 4-1bb and ox40 binding proteins and related compositions and methods, antibodies against 4-1bb, antibodies against ox40 |
WO2021042019A1 (en) | 2019-08-30 | 2021-03-04 | Agenus Inc. | Anti-cd96 antibodies and methods of use thereof |
WO2021050645A1 (en) | 2019-09-12 | 2021-03-18 | Genentech, Inc. | Compositions and methods of treating lupus nephritis |
US11655303B2 (en) | 2019-09-16 | 2023-05-23 | Surface Oncology, Inc. | Anti-CD39 antibody compositions and methods |
WO2021055577A2 (en) | 2019-09-18 | 2021-03-25 | Genentech, Inc. | Anti-klk7 antibodies, anti-klk5 antibodies, multispecific anti-klk5/klk7 antibodies, and methods of use |
WO2021053560A1 (en) | 2019-09-18 | 2021-03-25 | Novartis Ag | Combination therapy with entpd2 and cd73 antibodies |
WO2021053559A1 (en) | 2019-09-18 | 2021-03-25 | Novartis Ag | Entpd2 antibodies, combination therapies, and methods of using the antibodies and combination therapies |
WO2021055698A1 (en) | 2019-09-19 | 2021-03-25 | Bristol-Myers Squibb Company | Antibodies binding to vista at acidic ph |
WO2021055694A1 (en) | 2019-09-20 | 2021-03-25 | Genentech, Inc. | Dosing for anti-tryptase antibodies |
WO2021062244A1 (en) | 2019-09-25 | 2021-04-01 | Surface Oncology, Inc. | Anti-il-27 antibodies and uses thereof |
WO2021062085A1 (en) | 2019-09-27 | 2021-04-01 | Genentech, Inc. | Dosing for treatment with anti-tigit and anti-pd-l1 antagonist antibodies |
WO2021070181A1 (en) | 2019-10-08 | 2021-04-15 | Nectin Therapeutics Ltd. | Antibodies against the poliovirus receptor (pvr) and uses thereof |
WO2021076196A1 (en) | 2019-10-18 | 2021-04-22 | Genentech, Inc. | Methods of using anti-cd79b immunoconjugates to treat diffuse large b-cell lymphoma |
WO2021080682A1 (en) | 2019-10-24 | 2021-04-29 | Massachusetts Institute Of Technology | Monoclonal antibodies that bind human cd161 and uses thereof |
WO2021091605A1 (en) | 2019-11-04 | 2021-05-14 | Compugen Ltd. | Combination therapy with anti-pvrig antibodies formulations and anti-pd-1 antibodies |
WO2021092171A1 (en) | 2019-11-06 | 2021-05-14 | Genentech, Inc. | Diagnostic and therapeutic methods for treatment of hematologic cancers |
WO2021110873A1 (en) | 2019-12-04 | 2021-06-10 | Medimmune Limited | Antibodies against lif and uses thereof |
WO2021116119A1 (en) | 2019-12-09 | 2021-06-17 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Antibodies having specificity to her4 and uses thereof |
WO2021119505A1 (en) | 2019-12-13 | 2021-06-17 | Genentech, Inc. | Anti-ly6g6d antibodies and methods of use |
US11845799B2 (en) | 2019-12-13 | 2023-12-19 | Genentech, Inc. | Anti-Ly6G6D antibodies and methods of use |
WO2021131021A1 (en) | 2019-12-27 | 2021-07-01 | 中外製薬株式会社 | Anti-ctla-4 antibody and use thereof |
WO2021129872A1 (en) | 2019-12-27 | 2021-07-01 | 高诚生物医药(香港)有限公司 | Anti-ox40 antibody and use thereof |
US11859000B2 (en) | 2020-01-06 | 2024-01-02 | Vaccinex Inc. | Anti-CCR8 antibodies and uses thereof |
WO2021142002A1 (en) | 2020-01-06 | 2021-07-15 | Vaccinex, Inc. | Anti-ccr8 antibodies and uses thereof |
WO2021140202A1 (en) | 2020-01-08 | 2021-07-15 | argenx BV | Methods for treating pemphigus disorders |
WO2021139777A1 (en) | 2020-01-10 | 2021-07-15 | 上海复宏汉霖生物技术股份有限公司 | Anti-tigit antibodies and usage method |
WO2021155149A1 (en) | 2020-01-31 | 2021-08-05 | Genentech, Inc. | Methods of inducing neoepitope-specific t cells with a pd-1 axis binding antagonist and an rna vaccine |
WO2021162020A1 (en) | 2020-02-12 | 2021-08-19 | 中外製薬株式会社 | Anti-cd137 antigen-binding molecule for use in cancer treatment |
WO2021173844A1 (en) | 2020-02-26 | 2021-09-02 | Biograph 55, Inc. | C19 c38 bispecific antibodies |
WO2021170067A1 (en) | 2020-02-28 | 2021-09-02 | 上海复宏汉霖生物技术股份有限公司 | Anti-cd137 construct and use thereof |
WO2021170071A1 (en) | 2020-02-28 | 2021-09-02 | Shanghai Henlius Biotech, Inc. | Anti-cd137 constructs, multispecific antibody and uses thereof |
WO2021175954A1 (en) | 2020-03-04 | 2021-09-10 | Imcheck Therapeutics Sas | Antibodies having specificity for btnl8 and uses thereof |
WO2021176424A1 (en) | 2020-03-06 | 2021-09-10 | Ona Therapeutics, S.L. | Anti-cd36 antibodies and their use to treat cancer |
WO2021177438A1 (en) | 2020-03-06 | 2021-09-10 | 第一三共株式会社 | Antibody-drug conjugate including novel cyclic dinucleotide derivative |
WO2021183207A1 (en) | 2020-03-10 | 2021-09-16 | Massachusetts Institute Of Technology | COMPOSITIONS AND METHODS FOR IMMUNOTHERAPY OF NPM1c-POSITIVE CANCER |
WO2021180205A1 (en) | 2020-03-13 | 2021-09-16 | 江苏恒瑞医药股份有限公司 | Pvrig binding protein and its medical uses |
WO2021183849A1 (en) | 2020-03-13 | 2021-09-16 | Genentech, Inc. | Anti-interleukin-33 antibodies and uses thereof |
WO2021188749A1 (en) | 2020-03-19 | 2021-09-23 | Genentech, Inc. | Isoform-selective anti-tgf-beta antibodies and methods of use |
US11365239B2 (en) | 2020-03-20 | 2022-06-21 | Tsb Therapeutics (Beijing) Co., Ltd. | Anti-SARS-COV-2 antibodies and uses thereof |
WO2021194481A1 (en) | 2020-03-24 | 2021-09-30 | Genentech, Inc. | Dosing for treatment with anti-tigit and anti-pd-l1 antagonist antibodies |
WO2021194913A1 (en) | 2020-03-24 | 2021-09-30 | Genentech, Inc. | Tie2-binding agents and methods of use |
WO2021195464A2 (en) | 2020-03-26 | 2021-09-30 | Genentech, Inc. | Modified mammalian cells |
WO2021195513A1 (en) | 2020-03-27 | 2021-09-30 | Novartis Ag | Bispecific combination therapy for treating proliferative diseases and autoimmune disorders |
WO2021198034A1 (en) | 2020-03-30 | 2021-10-07 | F. Hoffmann-La Roche Ag | Antibody that binds to vegf and pdgf-b and methods of use |
WO2021202235A1 (en) | 2020-04-01 | 2021-10-07 | University Of Rochester | Monoclonal antibodies against the hemagglutinin (ha) and neuraminidase (na) of influenza h3n2 viruses |
WO2021198333A1 (en) | 2020-04-01 | 2021-10-07 | F. Hoffmann-La Roche Ag | Bispecific antigen binding molecules targeting ox40 and fap |
WO2021198335A1 (en) | 2020-04-01 | 2021-10-07 | F. Hoffmann-La Roche Ag | Bispecific antibodies comprising a modified c-terminal crossfab fragment |
WO2021202959A1 (en) | 2020-04-03 | 2021-10-07 | Genentech, Inc. | Therapeutic and diagnostic methods for cancer |
WO2021207449A1 (en) | 2020-04-09 | 2021-10-14 | Merck Sharp & Dohme Corp. | Affinity matured anti-lap antibodies and uses thereof |
WO2021207662A1 (en) | 2020-04-10 | 2021-10-14 | Genentech, Inc. | Use of il-22fc for the treatment or prevention of pneumonia, acute respiratory distress syndrome, or cytokine release syndrome |
WO2021217051A1 (en) | 2020-04-24 | 2021-10-28 | Genentech, Inc. | Methods of using anti-cd79b immunoconjugates |
WO2021214277A1 (en) | 2020-04-24 | 2021-10-28 | F. Hoffmann-La Roche Ag | Enzyme and pathway modulation with sulfhydryl compounds and their derivatives |
WO2021222167A1 (en) | 2020-04-28 | 2021-11-04 | Genentech, Inc. | Methods and compositions for non-small cell lung cancer immunotherapy |
WO2021222935A2 (en) | 2020-04-28 | 2021-11-04 | The Rockefeller University | Neutralizing anti-sars-cov-2 antibodies and methods of use thereof |
WO2021219871A2 (en) | 2020-04-30 | 2021-11-04 | Aduro Biotech Holdings, Europe B.V. | Anti-cd103 antibodies |
WO2021220199A1 (en) | 2020-04-30 | 2021-11-04 | Novartis Ag | Ccr7 antibody drug conjugates for treating cancer |
WO2021225892A1 (en) | 2020-05-03 | 2021-11-11 | Levena (Suzhou) Biopharma Co., Ltd. | Antibody-drug conjugates (adcs) comprising an anti-trop-2 antibody, compositions comprising such adcs, as well as methods of making and using the same |
WO2021226551A1 (en) | 2020-05-08 | 2021-11-11 | Alpine Immune Sciences, Inc. | April and baff inhibitory immunomodulatory proteins and methods of use thereof |
US11274140B2 (en) | 2020-05-08 | 2022-03-15 | Alpine Immune Sciences, Inc. | APRIL and BAFF inhibitory immunomodulatory proteins and methods of use thereof |
WO2021226553A2 (en) | 2020-05-08 | 2021-11-11 | Alpine Immune Sciences, Inc. | April and baff inhibitory immunomodulatory proteins with and without a t cell inhibitory protein and methods of use thereof |
WO2021228956A1 (en) | 2020-05-12 | 2021-11-18 | INSERM (Institut National de la Santé et de la Recherche Médicale) | New method to treat cutaneous t-cell lymphomas and tfh derived lymphomas |
WO2021233834A1 (en) | 2020-05-17 | 2021-11-25 | Astrazeneca Uk Limited | Sars-cov-2 antibodies and methods of selecting and using the same |
WO2021234160A2 (en) | 2020-05-22 | 2021-11-25 | Formycon Ag | Ace2 fusion proteins and uses thereof |
WO2021238886A1 (en) | 2020-05-27 | 2021-12-02 | Staidson (Beijing) Biopharmaceuticals Co., Ltd. | Antibodies specifically recognizing nerve growth factor and uses thereof |
WO2021243204A1 (en) | 2020-05-29 | 2021-12-02 | 23Andme, Inc. | Anti-cd200r1 antibodies and methods of use thereof |
WO2021247769A1 (en) | 2020-06-02 | 2021-12-09 | Dynamicure Biotechnology Llc | Anti-cd93 constructs and uses thereof |
WO2021249990A2 (en) | 2020-06-08 | 2021-12-16 | Hoffmann-La Roche Inc. | Anti-hbv antibodies and methods of use |
WO2021252977A1 (en) | 2020-06-12 | 2021-12-16 | Genentech, Inc. | Methods and compositions for cancer immunotherapy |
WO2021257503A1 (en) | 2020-06-16 | 2021-12-23 | Genentech, Inc. | Methods and compositions for treating triple-negative breast cancer |
WO2021257124A1 (en) | 2020-06-18 | 2021-12-23 | Genentech, Inc. | Treatment with anti-tigit antibodies and pd-1 axis binding antagonists |
WO2021259880A1 (en) | 2020-06-22 | 2021-12-30 | Almirall, S.A. | Anti-il-36 antibodies and methods of use thereof |
WO2021259199A1 (en) | 2020-06-22 | 2021-12-30 | 信达生物制药(苏州)有限公司 | Anti-cd73 antibody and use thereof |
WO2021262783A1 (en) | 2020-06-24 | 2021-12-30 | Genentech, Inc. | Apoptosis resistant cell lines |
WO2021262791A1 (en) | 2020-06-25 | 2021-12-30 | Merck Sharp & Dohme Corp. | High affinity antibodies targeting tau phosphorylated at serine 413 |
US11702467B2 (en) | 2020-06-25 | 2023-07-18 | Merck Sharp & Dohme Llc | High affinity antibodies targeting tau phosphorylated at serine 413 |
WO2022008688A1 (en) | 2020-07-10 | 2022-01-13 | F. Hoffmann-La Roche Ag | Antibodies which bind to cancer cells and target radionuclides to said cells |
WO2022016037A1 (en) | 2020-07-17 | 2022-01-20 | Genentech, Inc. | Anti-notch2 antibodies and methods of use |
WO2022023735A1 (en) | 2020-07-28 | 2022-02-03 | Femtogenix Limited | Cytotoxic agents |
WO2022026763A1 (en) | 2020-07-29 | 2022-02-03 | Dynamicure Biotechnology Llc | Anti-cd93 constructs and uses thereof |
WO2022031749A1 (en) | 2020-08-03 | 2022-02-10 | Genentech, Inc. | Diagnostic and therapeutic methods for lymphoma |
WO2022031978A1 (en) | 2020-08-06 | 2022-02-10 | Bioverativ Usa Inc. | Inflammatory cytokines and fatigue in subject with a complement mediated disease |
WO2022034044A1 (en) | 2020-08-10 | 2022-02-17 | Astrazeneca Uk Limited | Sars-cov-2 antibodies for treatment and prevention of covid-19 |
WO2022046644A1 (en) | 2020-08-25 | 2022-03-03 | Gilead Sciences, Inc. | Multi-specific antigen binding molecules targeting hiv and methods of use |
WO2022043517A2 (en) | 2020-08-27 | 2022-03-03 | Cureab Gmbh | Anti-golph2 antibodies for macrophage and dendritic cell differentiation |
WO2022047222A2 (en) | 2020-08-28 | 2022-03-03 | Genentech, Inc. | Crispr/cas9 multiplex knockout of host cell proteins |
WO2022049165A1 (en) | 2020-09-04 | 2022-03-10 | F. Hoffmann-La Roche Ag | Antibody that binds to vegf-a and ang2 and methods of use |
WO2022050954A1 (en) | 2020-09-04 | 2022-03-10 | Genentech, Inc. | Dosing for treatment with anti-tigit and anti-pd-l1 antagonist antibodies |
US11970539B2 (en) | 2020-09-14 | 2024-04-30 | Ichnos Sciences SA | Antibodies that bind to IL1RAP and uses thereof |
WO2022053715A1 (en) | 2020-09-14 | 2022-03-17 | Ichnos Sciences SA | Antibodies that bind to il1rap and uses thereof |
WO2022067262A1 (en) | 2020-09-28 | 2022-03-31 | Dynamicure Biotechnology Llc | Anti-cd93 constructs and uses thereof |
WO2022076462A1 (en) | 2020-10-05 | 2022-04-14 | Genentech, Inc. | Dosing for treatment with anti-fcrh5/anti-cd3 bispecific antibodies |
WO2022086957A1 (en) | 2020-10-20 | 2022-04-28 | Genentech, Inc. | Peg-conjugated anti-mertk antibodies and methods of use |
WO2022087149A2 (en) | 2020-10-22 | 2022-04-28 | Gilead Sciences, Inc. | Interleukin-2-fc fusion proteins and methods of use |
WO2022090801A2 (en) | 2020-10-26 | 2022-05-05 | Compugen Ltd. | Pvrl2 and/or pvrig as biomarkers for treatment |
WO2022093981A1 (en) | 2020-10-28 | 2022-05-05 | Genentech, Inc. | Combination therapy comprising ptpn22 inhibitors and pd-l1 binding antagonists |
WO2022090469A2 (en) | 2020-10-29 | 2022-05-05 | Formycon Ag | Ace2 fusion proteins and uses thereof |
WO2022098648A2 (en) | 2020-11-04 | 2022-05-12 | Genentech, Inc. | Dosing for treatment with anti-cd20/anti-cd3 bispecific antibodies and anti-cd79b antibody drug conjugates |
WO2022098628A2 (en) | 2020-11-04 | 2022-05-12 | Genentech, Inc. | Subcutaneous dosing of anti-cd20/anti-cd3 bispecific antibodies |
WO2022098870A1 (en) | 2020-11-04 | 2022-05-12 | The Rockefeller University | Neutralizing anti-sars-cov-2 antibodies |
WO2022098638A2 (en) | 2020-11-04 | 2022-05-12 | Genentech, Inc. | Dosing for treatment with anti-cd20/anti-cd3 bispecific antibodies |
WO2022097060A1 (en) | 2020-11-06 | 2022-05-12 | Novartis Ag | Cd19 binding molecules and uses thereof |
WO2022097065A2 (en) | 2020-11-06 | 2022-05-12 | Novartis Ag | ANTIBODY Fc VARIANTS |
WO2022097061A1 (en) | 2020-11-06 | 2022-05-12 | Novartis Ag | Anti-cd19 agent and b cell targeting agent combination therapy for treating b cell malignancies |
WO2022102634A1 (en) | 2020-11-11 | 2022-05-19 | 第一三共株式会社 | COMBINATION OF ANTIBODY-DRUG CONJUGATE WITH ANTI-SIRPα ANTIBODY |
WO2022115451A1 (en) | 2020-11-24 | 2022-06-02 | Novartis Ag | Mcl-1 inhibitor antibody-drug conjugates and methods of use |
WO2022112942A2 (en) | 2020-11-24 | 2022-06-02 | Novartis Ag | Anti-cd48 antibodies, antibody drug conjugates, and uses thereof |
WO2022119976A1 (en) | 2020-12-01 | 2022-06-09 | Aptevo Research And Development Llc | Heterodimeric psma and cd3-binding bispecific antibodies |
WO2022130182A1 (en) | 2020-12-14 | 2022-06-23 | Novartis Ag | Reversal binding agents for anti-natriuretic peptide receptor 1 (npr1) antibodies and uses thereof |
WO2022129120A1 (en) | 2020-12-17 | 2022-06-23 | F. Hoffmann-La Roche Ag | Anti-hla-g antibodies and use thereof |
WO2022127793A1 (en) | 2020-12-18 | 2022-06-23 | 珠海泰诺麦博生物技术有限公司 | Respiratory syncytial virus-specific binding molecule |
WO2022135467A1 (en) | 2020-12-23 | 2022-06-30 | 信达生物制药(苏州)有限公司 | Anti-b7-h3 antibody and uses thereof |
WO2022140797A1 (en) | 2020-12-23 | 2022-06-30 | Immunowake Inc. | Immunocytokines and uses thereof |
WO2022148732A1 (en) | 2021-01-06 | 2022-07-14 | F. Hoffmann-La Roche Ag | Combination therapy employing a pd1-lag3 bispecific antibody and a cd20 t cell bispecific antibody |
WO2022152656A1 (en) | 2021-01-12 | 2022-07-21 | F. Hoffmann-La Roche Ag | Split antibodies which bind to cancer cells and target radionuclides to said cells |
WO2022152701A1 (en) | 2021-01-13 | 2022-07-21 | F. Hoffmann-La Roche Ag | Combination therapy |
WO2022155324A1 (en) | 2021-01-15 | 2022-07-21 | The Rockefeller University | Neutralizing anti-sars-cov-2 antibodies |
WO2022165275A2 (en) | 2021-01-28 | 2022-08-04 | Compugen Ltd. | Combination therapy with anti-pvrig antibodies formulations and anti-pd-1-antibodies |
WO2022165266A1 (en) | 2021-01-28 | 2022-08-04 | Compugen Ltd. | Anti-pvrig antibodies formulations and uses thereof |
WO2022163846A1 (en) | 2021-02-01 | 2022-08-04 | 第一三共株式会社 | Novel method for producing antibody-immunostimulator conjugate |
WO2022169872A1 (en) | 2021-02-03 | 2022-08-11 | Genentech, Inc. | Multispecific binding protein degrader platform and methods of use |
US11866505B2 (en) | 2021-02-17 | 2024-01-09 | Prometheus Biosciences, Inc. | Anti-CD30L antibodies and uses thereof |
WO2022187272A1 (en) | 2021-03-01 | 2022-09-09 | Xilio Development, Inc. | Combination of masked ctla4 and pd1/pdl1 antibodies for treating cancer |
WO2022187270A1 (en) | 2021-03-01 | 2022-09-09 | Xilio Development, Inc. | Combination of ctla4 and pd1/pdl1 antibodies for treating cancer |
WO2022184854A2 (en) | 2021-03-03 | 2022-09-09 | Formycon Ag | Formulations of ace2 fc fusion proteins |
WO2022184082A1 (en) | 2021-03-03 | 2022-09-09 | Sorrento Therapeutics, Inc. | Antibody-drug conjugates comprising an anti-bcma antibody |
WO2022187863A1 (en) | 2021-03-05 | 2022-09-09 | Dynamicure Biotechnology Llc | Anti-vista constructs and uses thereof |
WO2022192898A2 (en) | 2021-03-10 | 2022-09-15 | Immunowake Inc. | Immunomodulatory molecules and uses thereof |
WO2022192647A1 (en) | 2021-03-12 | 2022-09-15 | Genentech, Inc. | Anti-klk7 antibodies, anti-klk5 antibodies, multispecific anti-klk5/klk7 antibodies, and methods of use |
WO2022198192A1 (en) | 2021-03-15 | 2022-09-22 | Genentech, Inc. | Compositions and methods of treating lupus nephritis |
WO2022197877A1 (en) | 2021-03-19 | 2022-09-22 | Genentech, Inc. | Methods and compositions for time delayed bio-orthogonal release of cytotoxic agents |
WO2022204724A1 (en) | 2021-03-25 | 2022-09-29 | Dynamicure Biotechnology Llc | Anti-igfbp7 constructs and uses thereof |
WO2022212645A1 (en) | 2021-03-31 | 2022-10-06 | Bioverativ Usa Inc. | Reducing surgery-associated hemolysis in cold agglutinin disease patients |
WO2022212876A1 (en) | 2021-04-02 | 2022-10-06 | The Regents Of The University Of California | Antibodies against cleaved cdcp1 and uses thereof |
WO2022221720A1 (en) | 2021-04-16 | 2022-10-20 | Novartis Ag | Antibody drug conjugates and methods for making thereof |
WO2022225880A1 (en) | 2021-04-19 | 2022-10-27 | Genentech, Inc. | Modified mammalian cells |
WO2022235867A2 (en) | 2021-05-06 | 2022-11-10 | The Rockefeller University | Neutralizing anti-sars- cov-2 antibodies and methods of use thereof |
WO2022236134A1 (en) | 2021-05-07 | 2022-11-10 | Surface Oncology, Inc. | Anti-il-27 antibodies and uses thereof |
WO2022236335A1 (en) | 2021-05-07 | 2022-11-10 | Alpine Immune Sciences, Inc. | Methods of dosing and treatment with a taci-fc fusion immunomodulatory protein |
WO2022241446A1 (en) | 2021-05-12 | 2022-11-17 | Genentech, Inc. | Methods of using anti-cd79b immunoconjugates to treat diffuse large b-cell lymphoma |
WO2022241082A1 (en) | 2021-05-14 | 2022-11-17 | Genentech, Inc. | Agonists of trem2 |
WO2022245671A1 (en) | 2021-05-18 | 2022-11-24 | Gilead Sciences, Inc. | Methods of using flt3l-fc fusion proteins |
WO2022243261A1 (en) | 2021-05-19 | 2022-11-24 | F. Hoffmann-La Roche Ag | Agonistic cd40 antigen binding molecules targeting cea |
WO2022246259A1 (en) | 2021-05-21 | 2022-11-24 | Genentech, Inc. | Modified cells for the production of a recombinant product of interest |
EP4155321A1 (en) | 2021-06-04 | 2023-03-29 | Chugai Seiyaku Kabushiki Kaisha | Anti-ddr2 antibodies and uses thereof |
WO2022263357A1 (en) | 2021-06-14 | 2022-12-22 | Argenx Iip Bv | Anti-il-9 antibodies and methods of use thereof |
WO2022266660A1 (en) | 2021-06-17 | 2022-12-22 | Amberstone Biosciences, Inc. | Anti-cd3 constructs and uses thereof |
WO2022269451A1 (en) | 2021-06-22 | 2022-12-29 | Novartis Ag | Bispecific antibodies for use in treatment of hidradenitis suppurativa |
WO2022270611A1 (en) | 2021-06-25 | 2022-12-29 | 中外製薬株式会社 | Anti–ctla-4 antibody |
WO2022270612A1 (en) | 2021-06-25 | 2022-12-29 | 中外製薬株式会社 | Use of anti-ctla-4 antibody |
WO2023275621A1 (en) | 2021-07-01 | 2023-01-05 | Compugen Ltd. | Anti-tigit and anti-pvrig in monotherapy and combination treatments |
WO2023279092A2 (en) | 2021-07-02 | 2023-01-05 | Genentech, Inc. | Methods and compositions for treating cancer |
WO2023283611A1 (en) | 2021-07-08 | 2023-01-12 | Staidson Biopharma Inc. | Antibodies specifically recognizing tnfr2 and uses thereof |
WO2023288182A1 (en) | 2021-07-12 | 2023-01-19 | Genentech, Inc. | Structures for reducing antibody-lipase binding |
WO2023284714A1 (en) | 2021-07-14 | 2023-01-19 | 舒泰神(北京)生物制药股份有限公司 | Antibody that specifically recognizes cd40 and application thereof |
WO2023288241A1 (en) | 2021-07-14 | 2023-01-19 | Genentech, Inc. | Anti-c-c motif chemokine receptor 8 (ccr8) antibodies and methods of use |
WO2023001884A1 (en) | 2021-07-22 | 2023-01-26 | F. Hoffmann-La Roche Ag | Heterodimeric fc domain antibodies |
WO2023004386A1 (en) | 2021-07-22 | 2023-01-26 | Genentech, Inc. | Brain targeting compositions and methods of use thereof |
WO2023010095A1 (en) | 2021-07-28 | 2023-02-02 | F. Hoffmann-La Roche Ag | Methods and compositions for treating cancer |
WO2023007472A1 (en) | 2021-07-30 | 2023-02-02 | ONA Therapeutics S.L. | Anti-cd36 antibodies and their use to treat cancer |
WO2023011338A1 (en) | 2021-08-02 | 2023-02-09 | 信达生物制药(苏州)有限公司 | Anti-cd79b×cd3 bispecific antibody and use thereof |
WO2023012147A1 (en) | 2021-08-03 | 2023-02-09 | F. Hoffmann-La Roche Ag | Bispecific antibodies and methods of use |
WO2023019092A1 (en) | 2021-08-07 | 2023-02-16 | Genentech, Inc. | Methods of using anti-cd79b immunoconjugates to treat diffuse large b-cell lymphoma |
WO2023019239A1 (en) | 2021-08-13 | 2023-02-16 | Genentech, Inc. | Dosing for anti-tryptase antibodies |
WO2023021055A1 (en) | 2021-08-19 | 2023-02-23 | F. Hoffmann-La Roche Ag | Multivalent anti-variant fc-region antibodies and methods of use |
WO2023028591A1 (en) | 2021-08-27 | 2023-03-02 | Genentech, Inc. | Methods of treating tau pathologies |
WO2023034750A1 (en) | 2021-08-30 | 2023-03-09 | Genentech, Inc. | Anti-polyubiquitin multispecific antibodies |
WO2023056362A1 (en) | 2021-09-30 | 2023-04-06 | Seagen Inc. | B7-h4 antibody-drug conjugates for the treatment of cancer |
WO2023056069A1 (en) | 2021-09-30 | 2023-04-06 | Angiex, Inc. | Degrader-antibody conjugates and methods of using same |
WO2023056403A1 (en) | 2021-09-30 | 2023-04-06 | Genentech, Inc. | Methods for treatment of hematologic cancers using anti-tigit antibodies, anti-cd38 antibodies, and pd-1 axis binding antagonists |
WO2023052541A1 (en) | 2021-09-30 | 2023-04-06 | Imcheck Therapeutics | Combination of an anti-btn3a activating antibody and an il-2 agonist for use in therapy |
WO2023064958A1 (en) | 2021-10-15 | 2023-04-20 | Compugen Ltd. | Combination therapy with anti-pvrig antibodies formulations, anti-tigit antibodies, and anti-pd-1 antibodies |
US11774452B2 (en) | 2021-11-05 | 2023-10-03 | American Diagnostics & Therapy, LLC | Antibodies against carcinoembryonic antigens |
WO2023079086A1 (en) | 2021-11-05 | 2023-05-11 | Astrazeneca Uk Limited | Composition for treatment and prevention of covid-19 |
WO2023086807A1 (en) | 2021-11-10 | 2023-05-19 | Genentech, Inc. | Anti-interleukin-33 antibodies and uses thereof |
WO2023091887A1 (en) | 2021-11-16 | 2023-05-25 | Genentech, Inc. | Methods and compositions for treating systemic lupus erythematosus (sle) with mosunetuzumab |
WO2023088959A1 (en) | 2021-11-16 | 2023-05-25 | Ac Immune Sa | Novel molecules for therapy and diagnosis |
WO2023091968A1 (en) | 2021-11-17 | 2023-05-25 | Disc Medicine, Inc. | Methods for treating anemia of kidney disease |
WO2023094507A1 (en) | 2021-11-24 | 2023-06-01 | Formycon Ag | Improved ace2 fusion proteins |
WO2023094571A1 (en) | 2021-11-25 | 2023-06-01 | Formycon Ag | Stabilization of ace2 fusion proteins |
WO2023114829A1 (en) | 2021-12-15 | 2023-06-22 | Genentech, Inc. | Stabilized il-18 polypeptides and uses thereof |
WO2023117834A1 (en) | 2021-12-20 | 2023-06-29 | F. Hoffmann-La Roche Ag | Agonistic ltbr antibodies and bispecific antibodies comprising them |
WO2023131901A1 (en) | 2022-01-07 | 2023-07-13 | Johnson & Johnson Enterprise Innovation Inc. | Materials and methods of il-1beta binding proteins |
WO2023139107A1 (en) | 2022-01-18 | 2023-07-27 | argenx BV | Galectin-10 antibodies |
WO2023141445A1 (en) | 2022-01-19 | 2023-07-27 | Genentech, Inc. | Anti-notch2 antibodies and conjugates and methods of use |
WO2023147399A1 (en) | 2022-01-27 | 2023-08-03 | The Rockefeller University | Broadly neutralizing anti-sars-cov-2 antibodies targeting the n-terminal domain of the spike protein and methods of use thereof |
WO2023168352A1 (en) | 2022-03-03 | 2023-09-07 | Yale University | Humanized 3e10 antibodies, variants, and antigen binding fragments thereof |
WO2023172883A1 (en) | 2022-03-07 | 2023-09-14 | Alpine Immune Sciences, Inc. | Immunomodulatory proteins of variant cd80 polypeptides, cell therapies thereof and related methods and uses |
WO2023173026A1 (en) | 2022-03-10 | 2023-09-14 | Sorrento Therapeutics, Inc. | Antibody-drug conjugates and uses thereof |
WO2023178192A1 (en) | 2022-03-15 | 2023-09-21 | Compugen Ltd. | Il-18bp antagonist antibodies and their use in monotherapy and combination therapy in the treatment of cancer |
WO2023178357A1 (en) | 2022-03-18 | 2023-09-21 | Evolveimmune Therapeutics, Inc. | Bispecific antibody fusion molecules and methods of use thereof |
EP4245374A2 (en) | 2022-03-18 | 2023-09-20 | Compugen Ltd. | Pvrl2 and/or pvrig as biomarkers for treatment |
WO2023186756A1 (en) | 2022-03-28 | 2023-10-05 | F. Hoffmann-La Roche Ag | Interferon gamma variants and antigen binding molecules comprising these |
WO2023187657A1 (en) | 2022-03-30 | 2023-10-05 | Novartis Ag | Methods of treating disorders using anti-natriuretic peptide receptor 1 (npr1) antibodies |
WO2023191816A1 (en) | 2022-04-01 | 2023-10-05 | Genentech, Inc. | Dosing for treatment with anti-fcrh5/anti-cd3 bispecific antibodies |
WO2023201299A1 (en) | 2022-04-13 | 2023-10-19 | Genentech, Inc. | Pharmaceutical compositions of therapeutic proteins and methods of use |
WO2023209177A1 (en) | 2022-04-29 | 2023-11-02 | Astrazeneca Uk Limited | Sars-cov-2 antibodies and methods of using the same |
WO2023215737A1 (en) | 2022-05-03 | 2023-11-09 | Genentech, Inc. | Anti-ly6e antibodies, immunoconjugates, and uses thereof |
WO2023217743A1 (en) | 2022-05-10 | 2023-11-16 | Imcheck Therapeutics | Anti-btn3a antibodies for use in methods of treating gastro-intestinal inflammatory disorders |
WO2023217933A1 (en) | 2022-05-11 | 2023-11-16 | F. Hoffmann-La Roche Ag | Antibody that binds to vegf-a and il6 and methods of use |
WO2023219613A1 (en) | 2022-05-11 | 2023-11-16 | Genentech, Inc. | Dosing for treatment with anti-fcrh5/anti-cd3 bispecific antibodies |
WO2023240058A2 (en) | 2022-06-07 | 2023-12-14 | Genentech, Inc. | Prognostic and therapeutic methods for cancer |
WO2023239803A1 (en) | 2022-06-08 | 2023-12-14 | Angiex, Inc. | Anti-tm4sf1 antibody-drug conjugates comprising cleavable linkers and methods of using same |
WO2023237928A2 (en) | 2022-06-10 | 2023-12-14 | Horizon Therapeutics Ireland Dac | Igf1r antibodies |
WO2023242362A1 (en) | 2022-06-15 | 2023-12-21 | argenx BV | Fcrn/antigen-binding molecules and methods of use |
WO2023242372A1 (en) | 2022-06-15 | 2023-12-21 | argenx BV | Fcrn/hsa binding molecules and methods of use |
WO2023245048A1 (en) | 2022-06-15 | 2023-12-21 | Bioverativ Usa Inc. | Anti-complement c1s antibody formulation |
WO2023242361A1 (en) | 2022-06-15 | 2023-12-21 | argenx BV | Fcrn binding molecules and methods of use |
WO2023250507A1 (en) | 2022-06-24 | 2023-12-28 | Bioverativ Usa Inc. | Methods for treating complement-mediated diseases |
WO2024015897A1 (en) | 2022-07-13 | 2024-01-18 | Genentech, Inc. | Dosing for treatment with anti-fcrh5/anti-cd3 bispecific antibodies |
WO2024020407A1 (en) | 2022-07-19 | 2024-01-25 | Staidson Biopharma Inc. | Antibodies specifically recognizing b- and t-lymphocyte attenuator (btla) and uses thereof |
WO2024020432A1 (en) | 2022-07-19 | 2024-01-25 | Genentech, Inc. | Dosing for treatment with anti-fcrh5/anti-cd3 bispecific antibodies |
WO2024020579A1 (en) | 2022-07-22 | 2024-01-25 | Bristol-Myers Squibb Company | Antibodies binding to human pad4 and uses thereof |
WO2024020564A1 (en) | 2022-07-22 | 2024-01-25 | Genentech, Inc. | Anti-steap1 antigen-binding molecules and uses thereof |
WO2024026496A1 (en) | 2022-07-28 | 2024-02-01 | Compugen Ltd. | Combination therapy with anti-pvrig antibodies formulations and anti-pd-1 antibodies |
WO2024028732A1 (en) | 2022-08-05 | 2024-02-08 | Janssen Biotech, Inc. | Cd98 binding constructs for treating brain tumors |
WO2024028731A1 (en) | 2022-08-05 | 2024-02-08 | Janssen Biotech, Inc. | Transferrin receptor binding proteins for treating brain tumors |
WO2024037633A2 (en) | 2022-08-19 | 2024-02-22 | Evive Biotechnology (Shanghai) Ltd | Formulations comprising g-csf and uses thereof |
WO2024044675A1 (en) | 2022-08-25 | 2024-02-29 | Beigene, Ltd. | Methods of cancer treatment using anti-pd1 antibodies in combination with anti-tim3 antibodies |
WO2024049949A1 (en) | 2022-09-01 | 2024-03-07 | Genentech, Inc. | Therapeutic and diagnostic methods for bladder cancer |
WO2024054929A1 (en) | 2022-09-07 | 2024-03-14 | Dynamicure Biotechnology Llc | Anti-vista constructs and uses thereof |
WO2024052503A1 (en) | 2022-09-08 | 2024-03-14 | Institut National de la Santé et de la Recherche Médicale | Antibodies having specificity to ltbp2 and uses thereof |
WO2024074498A1 (en) | 2022-10-04 | 2024-04-11 | Imcheck Therapeutics | Combination of a btn3a activating antibody, a bcl2 inhibitor and hypomethylating agent for use in treating cancer |
WO2024077018A2 (en) | 2022-10-04 | 2024-04-11 | Alpine Immune Sciences, Inc. | Methods and uses of taci-fc fusion immunomodulatory protein |
WO2024077239A1 (en) | 2022-10-07 | 2024-04-11 | Genentech, Inc. | Methods of treating cancer with anti-c-c motif chemokine receptor 8 (ccr8) antibodies |
Also Published As
Publication number | Publication date |
---|---|
JPH08511420A (en) | 1996-12-03 |
AU691811B2 (en) | 1998-05-28 |
AU6934194A (en) | 1995-01-03 |
WO1994029351A3 (en) | 1994-12-22 |
EP0714409A1 (en) | 1996-06-05 |
CA2163345A1 (en) | 1994-12-22 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
AU691811B2 (en) | Antibodies | |
EP0715653B1 (en) | Humanised antibodies | |
AU2004283135B2 (en) | Antibodies having a mutated amino acid residue at position 268 (CH2 region) in constant regions | |
US5834597A (en) | Mutated nonactivating IgG2 domains and anti CD3 antibodies incorporating the same | |
CA2212750C (en) | Humanized antibodies against cd3 | |
CN116333133A (en) | anti-GPRC 5D antibodies, bispecific antigen binding molecules binding GPRC5D and CD3 and uses thereof | |
US20020032312A1 (en) | Therapeutic compounds comprised of anti-fc receptor antibodies | |
EP1362868A2 (en) | Humanized and chimeric monoclonal antibodies that bind epidermal growth factor receptor (EGF-R) | |
PL180157B1 (en) | Humanised antibodies and their application | |
JP2004000249A (en) | Preparation of antibody | |
AU2004245038A1 (en) | De-immunized anti-CD3 antibody | |
CA2295604C (en) | Lo-cd2a antibody and uses thereof for inhibiting t cell activation and proliferation | |
US5730979A (en) | LO-CD2a antibody and uses thereof for inhibiting T cell activation and proliferation | |
AU2002226086C1 (en) | Silensed anti-CD28 antibodies and use thereof | |
JP2001521374A (en) | LO-CD2a antibody inhibiting T cell activation and proliferation and use thereof | |
JP4808841B2 (en) | LO-CD2a antibodies that inhibit T cell activation and proliferation and methods of use thereof | |
AU778551B2 (en) | Novel peptide and screening method by using the same | |
JP2024508048A (en) | Preparation of Siglec-15 binding protein and its use |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A2 Designated state(s): AT AU BB BG BR BY CA CH CN CZ DE DK ES FI GB GE HU JP KE KG KP KR KZ LK LU LV MD MG MN MW NL NO NZ PL PT RO RU SD SE SI SK TJ TT UA US UZ VN |
|
AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
WWE | Wipo information: entry into national phase |
Ref document number: 2163345 Country of ref document: CA |
|
WWE | Wipo information: entry into national phase |
Ref document number: 1994917750 Country of ref document: EP |
|
ENP | Entry into the national phase |
Ref document number: 1996 564250 Country of ref document: US Date of ref document: 19960212 Kind code of ref document: A |
|
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
WWP | Wipo information: published in national office |
Ref document number: 1994917750 Country of ref document: EP |
|
WWW | Wipo information: withdrawn in national office |
Ref document number: 1994917750 Country of ref document: EP |