WO1994029351A2 - Antibodies - Google Patents

Antibodies Download PDF

Info

Publication number
WO1994029351A2
WO1994029351A2 PCT/GB1994/001290 GB9401290W WO9429351A2 WO 1994029351 A2 WO1994029351 A2 WO 1994029351A2 GB 9401290 W GB9401290 W GB 9401290W WO 9429351 A2 WO9429351 A2 WO 9429351A2
Authority
WO
WIPO (PCT)
Prior art keywords
antibody
altered
human
complement
antibodies
Prior art date
Application number
PCT/GB1994/001290
Other languages
French (fr)
Other versions
WO1994029351A3 (en
Inventor
Susan Adrienne Morgan
John Spencer Emtage
Mark William Bodmer
Diljeet Singh Athwal
Original Assignee
Celltech Limited
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from GB939312415A external-priority patent/GB9312415D0/en
Priority claimed from GB9401597A external-priority patent/GB9401597D0/en
Priority claimed from GB9402499A external-priority patent/GB9402499D0/en
Priority claimed from GB9406244A external-priority patent/GB9406244D0/en
Application filed by Celltech Limited filed Critical Celltech Limited
Priority to JP7501518A priority Critical patent/JPH08511420A/en
Priority to EP94917750A priority patent/EP0714409A1/en
Priority to AU69341/94A priority patent/AU691811B2/en
Publication of WO1994029351A3 publication Critical patent/WO1994029351A3/en
Publication of WO1994029351A2 publication Critical patent/WO1994029351A2/en

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2803Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
    • C07K16/2833Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily against MHC-molecules, e.g. HLA-molecules
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/70Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/73Inducing cell death, e.g. apoptosis, necrosis or inhibition of cell proliferation
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/70Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/73Inducing cell death, e.g. apoptosis, necrosis or inhibition of cell proliferation
    • C07K2317/732Antibody-dependent cellular cytotoxicity [ADCC]

Definitions

  • This invention relates to altered antibodies, to pharmaceutical, therapeutic and diagnostic compositions containing said antibodies; to processes for preparing said compositions; to methods of therapy and diagnosis using said antibodies, to a method of modulating the function of cell surface associated antigens using said antibodies; to DNA sequences coding for said antibodies; to cloning and expression vectors containing DNA sequences coding for said antibodies; to host cells transformed with said vectors and to processes for preparing said antibodies.
  • Complement consists of a complex series of proteins.
  • the proteins of the complement system form two interrelated enzyme cascades, termed the classical and alternative pathways, providing two routes to the cleavage of C3, the central event in the complement system.
  • the sequence of events comprising the classical complement pathway is recognition, enzymatic activation, and membrane attack leading to cell death.
  • the recognition unit of the complement system is the C1 complex.
  • the C1 complement protein complex is a unique feature of the classical complement cascade leading to C3 conversion.
  • Complement fixation occurs when the C1q subcomponent binds directly to immunoglobulin antigen immune complex. Whether or not complement fixation occurs depends on a number of constraints. For example, only certain subclasses of immunoglobulin can fix complement even under optimal conditions. These are lgG1, lgG3 and IgM in man and lgG2a, lgG2b and IgM in mice.
  • the C1q molecule is potentially multivalent for attachment to the complement fixation sites of immunoglobulin.
  • the C H 2 domain of IgG and probably the C H 4 domain of IgM contain binding sites for C1q.
  • Fc bearing cells also play a role in enhancing the effect of the immune response by binding to and opsonising, phagocytosing or killing target cells coated with antibody of the relevant class.
  • Three IgG binding receptors Fc ⁇ R have been described for murine and human leukocytes.
  • Fc ⁇ RI has high binding affinity for monomeric IgG
  • Fc ⁇ RII and Fc ⁇ RIII have low affinity for mono IgG and interact mainly with antigen complexed IgG.
  • the presence of Fc receptors confers on these immune cells the ability to mediate a number of effector mechanisms important in the effector phase of the humoral response.
  • the gamma 1 isotype of human IgG like lgG3, binds to FcRI and, when complexed with its cognate antigen, activates complement and binds to FcRII and FcRIII.
  • human lgG2 and lgG4 are relatively inactive isotypes; both fail to activate the classical complement pathway and lgG4 binds weakly to FcRI [Burton, D R and Woof, J M (1992) Adv. Immunol. 51, 1. Lucisano Valim, Y M and Lachmann, P J. (1991) Clin. exp. Immunol, 84, 1].
  • Complement fixation could be restored to human lgG4 with just the carboxyi terminal of C H 2 from residue 292 of lgG1 and not the N- terminal half or any other domain.
  • Duncan & Winter (1988) [Nature, 332, 21] identified a motif in C H 2 of Glu 318, Lys 320 and Lys 322 of the mouse lgG2b isotype. Changing any of these residues abolished C1q binding, as did the use of competitive peptides of sequences in this region.
  • the C1q motif residues are also found in antibodies that do not fix complement suggesting that these residues may well be necessary but not sufficient for complement activation.
  • Residues Glu 318, Lys 320 and Lys 322 are conserved in all the human IgGs, rat lgG2b and lgG2c, mouse lgG2a, lgG2b and lgG3, guinea pig lgG1 and rabbit IgG. Further experiments showed that the affinity of human C1q for mutant mouse lgG2b antibodies in which residue 235 was mutated was unaffected i.e. it was in the same range of values as that obtained with the wild type.
  • the invention provides a method of treating diseases in which antibody therapy leads to undesirable toxicity due to antibody mediated complement fixation comprising administering an altered antibody wherein one or more amino acid residues in the N-terminal region of the C H 2 domain of said antibody are altered characterised in that the ability of said antibody to fix complement is altered as compared to unaltered antibody.
  • the altered antibody binds to one or more cellular Fc receptors especially FcRIII and excluding FcRI i.e. the antibody does not bind significantly to FcRI, and more preferably binding to FcRI is abolished.
  • the invention provides an altered antibody wherein one or more amino acid residues in the N-terminal region of the C H 2 domain of said antibody are altered characterised in that the ability of said antibody to fix complement is altered, as compared to unaltered antibody.
  • the invention therefore provides an altered antibody wherein one or more amino acid residues in the N-terminal region of the C H 2 domain of said antibody are altered characterised in that the ability of said antibody to fix complement is altered as compared to unaltered antibody and said altered antibody binds to one or more cellular Fc receptors especially FcRIII and does not bind significantly to FcRI.
  • the constant region of the antibodies to be altered according to the invention may be of animal origin and is preferably of human origin. It may also be of any isotype but is preferably human IgG and most preferably human lgG1.
  • amino acid residue(s) which is altered lies within amino acid positions 231 to 239, preferably within 234 to 239. In a particularly preferred embodiment of the invention the amino acid residue(s) which is altered lies within the motif Leu 234 Leu 235 Gly 236 Gly 237 Pro 238 Ser 239.
  • amino acid residue(s) which is altered is either Leu 235 and/or Gly 237.
  • the term 'altered' when used in conjunction with the ability of an antibody to fix complement most usually indicates a decrease in the ability of antibody to fix complement compared to the starting antibody.
  • complement fixation denotes that human complement fixation is preferably ⁇ 30%, more preferably ⁇ 20% and most preferably ⁇ 10% of the level seen with the starting wild type unaltered antibody.
  • the term 'significantly' as used with respect to FcRI binding denotes that the binding of antibody to FcRI is typically ⁇ 20%, and is most preferably ⁇ 10% of that seen with unaltered antibody.
  • the altered antibodies of the invention preferably bind to FcRIII as measured by their ability to mediate antibody dependent cellular cytotoxicity (ADCC) at a concentration no greater than ten times that of the wild type unaltered antibody.
  • ADCC antibody dependent cellular cytotoxicity
  • the proteins encoded in the Major Histocompatibility Complex region of the genome are involved in many aspects of immunological recognition. It is known that all mammals and probably all vertebrates possess basically equivalent MHC systems and that immune response genes are linked to the MHC.
  • the HLA gene cluster on chromosome 6 In man the major histocompatibility complex is the HLA gene cluster on chromosome 6. The main regions are D, B, C and A. The D region contains genes for class II proteins which are involved in cooperation and interaction between cells of the immune system. Many diseases have been found to be associated with the D region of the HLA gene cluster. Studies to date have shown associations with an enormous variety of diseases, including most autoimmune diseases (see for example, European Patent No. 68790). European Patent No. 68790 suggests controlling diseases associated with a particular allele of certain regions of the MHC such as the HLA-D region in humans by selectively suppressing the immune response(s) controlled by a monoclonal antibody specific for an MHC-class II antigen.
  • the invention provides an MHC specific antibody wherein one or more amino acid residues in the N-terminal region of the C H 2 domain of said antibody are altered characterised in that the ability of said antibody to fix complement is altered as compared to unaltered antibody.
  • the invention provides an MHC specific monoclonal antibody characterised in that said antibody has been altered at position 235 of the N-terminal region of the C H 2 domain.
  • the alteration in the N-terminal region of the C H 2 domain of the antibody while altering the ability to fix complement additionally inhibits the binding to FcRI receptors.
  • the antibodies are preferably specific for MHC-class II antigens and due to the alteration of one or more amino acid residues in the N-terminal region of the C H 2 domain will not bind significantly to FcRI.
  • the altered antibodies of the invention or for use according to the invention are directed against an MHC class II antigen characterised in that said antibody has been altered at position 235 of the N-terminal region of the C H 2 domain.
  • the altered antibodies of the invention or for use according to the invention are directed against an MHC class II antigen characterised in that said antibody has been altered at position 235 of the N-terminal region of the C H 2 domain and the ability of said antibody to fix complement is altered as compared to unaltered antibody and said altered antibody binds to one or more cellular Fc receptors especially FcRIII and does not bind significantly to FcRI.
  • the invention provides a method for producing an altered antibody with altered ability to fix complement comprising altering one or more amino acids in the N-terminal region of the C H 2 domain of said antibody, altering the ability of said antibody to fix complement as compared with unaltered antibody.
  • the term 'altered antibody' is used to denote an antibody which differs from the wild type unaltered antibody at one or more amino acid residues in the N-terminal region of the C H 2 domain of the Fc region of the antibody.
  • the alteration may for example comprise the substitution or replacement of the starting wild type antibody amino acid by another amino acid, or the deletion of an amino acid residue.
  • the naturally occurring amino acid at position 235 of the N-terminal region of the C H 2 domain is a leucine residue.
  • the alterations at position 235 of replacing leucine by glutamic acid or alanine have been found particularly effective at producing a potent immuno-suppressive antibody with minimal toxicity in vitro and which is tolerated in vivo.
  • the alteration at position 237 of replacing glycine by alanine has been found to produce an antibody with an intermediate ability to fix human complement, i.e. the complement fixation level is approximately 15-80%, preferably 20-60%, most preferably 20-40% of that seen with the starting wild type unaltered antibody.
  • residue(s) could similarly be replaced using an analogous process to that described herein, by any other amino acid residue or amino acid derivative, having for example an inappropriate functionality on its side chain. This may be achieved by for example changing the charge and/or polarity of the side chain.
  • the altered antibodies of the invention may also be produced for example, by deleting residues such as 235, or by, for example, inserting a glycosylation site at a suitable position in the molecule.
  • Such techniques are well known in the art, see for example the teaching of published European patent application EP-307434.
  • the altered antibodies of the invention may also be produced by exchanging lower hinge regions of antibodies of different isotypes.
  • a G1/G2 lower hinge exchange abolished complement fixation and is a further preferred embodiment of the invention. This is described in more detail in the accompanying examples.
  • the G1/G2 lower hinge exchange results in an antibody with altered residues in the 231 to 238 region of the N-terminal region of the C H 2 domain wherein one or more residues may be altered and/or deleted.
  • the antibody is a human lgG1 antibody directed against an MHC class II antigen.
  • the invention provides a method of modulating the function of cell surface associated antigens avoiding complement mediated toxicity comprising administering an altered antibody wherein one or more amino acid residues in the N-terminal region of the C H 2 domain of said antibody are altered characterised in that the ability of said antibody to fix complement is altered as compared to unaltered antibody.
  • said altered antibody is able to bind to one or more cellular Fc receptors especially FcRIII while binding to FcRI is significantly reduced.
  • cell surface antigens include for example adhesion molecules, T-cell receptor, CD4, CD8, CD3, CD28, CD69, MHC Class I, MHC Class II and CD25.
  • the invention also includes therapeutic, pharmaceutical and diagnostic compositions comprising the altered antibodies according to the invention and the uses of these products and the compositions in therapy and diagnosis.
  • the invention provides a therapeutic, pharmaceutical or diagnostic composition
  • a therapeutic, pharmaceutical or diagnostic composition comprising an altered antibody according to the invention, in combination with a pharmaceutically acceptable excipient, diluent or carrier.
  • the invention also provides a process for the preparation of a therapeutic, pharmaceutical or diagnostic composition comprising admixing an altered antibody according to the invention together with a pharmaceutically acceptable excipient, diluent or carrier.
  • the antibodies and compositions may be for administration in any appropriate form and amount according to the therapy in which they are employed.
  • the altered antibodies for use in the therapeutic, diagnostic, or pharmaceutical compositions, pr for use in the method of treatment of diseases in which antibody therapy leads to undesirable toxicity due to antibody mediated complement fixation are preferably MHC specific antibodies most preferably specific for MHC Class II antigens, and most preferably have specificity for antigen ic determinants dependent on the
  • the therapeutic, pharmaceutical or diagnostic composition may take any suitable form for administration, and, preferably is in a form suitable for parenteral administration e.g. by injection or infusion, for example by bolus injection or continuous infusion.
  • parenteral administration e.g. by injection or infusion, for example by bolus injection or continuous infusion.
  • the product may take the form of a suspension, solution or emulsion in an oily or aqueous vehicle and it may contain formulatory agents such as suspending, preservative, stabilising and/or dispersing agents.
  • the antibody or composition may be in dry form, for reconstitution before use with an appropriate sterile liquid.
  • the formulation may contain, in addition to the active ingredient, additives such as: starch - e.g. potato, maize or wheat starch or cellulose - or starch derivatives such as microcrystalline cellulose; silica; various sugars such as lactose; magnesium carbonate and/or calcium phosphate. It is desirable that, if the formulation is for parental administration it will be well tolerated by the patient's digestive system. To this end, it may be desirable to include in the formulation mucus formers and resins. It may also be desirable to improve tolerance by formulating the antibody or compositions in a capsule which is insoluble in the gastric juices. It may also be preferable to include the antibody or composition in a controlled release formulation.
  • additives such as: starch - e.g. potato, maize or wheat starch or cellulose - or starch derivatives such as microcrystalline cellulose; silica; various sugars such as lactose; magnesium carbonate and/or calcium phosphate.
  • mucus formers and resins it may also
  • the formulation may contain a binding and/or lubricating agent, for example polymeric glycols, gelatins, cocoa-butter or other vegetable waxes or fats.
  • a binding and/or lubricating agent for example polymeric glycols, gelatins, cocoa-butter or other vegetable waxes or fats.
  • the invention also provides methods of therapy and diagnosis comprising administering an effective amount of an altered antibody according to the invention to a human or animal subject.
  • the antibodies and compositions may be for administration in any appropriate form and amount according to the therapy in which they are employed.
  • the dose at which the antibody is administered depends on the nature of the condition to be treated and on whether the antibody is being. used prophylactically or to treat an existing condition.
  • the dose will also be selected according to the age and conditions of the patient.
  • a therapeutic dose of the antibodies according to the invention may be, for example, preferably between 0.1-25mg/kg body weight per single therapeutic dose and most preferably between 0.1-10mg/kg body weight per single therapeutic dose.
  • immunological diseases which may be treated with the antibodies of the invention include for example joint disease such as ankylosing spondylitis, juvenile rheumatoid arthritis, rheumatoid arthritis; neurological disease such as multiple sclerosis; pancreatic disease such as diabetes, juvenile onset diabetes; gastrointestinal tract disease such as chronic active hepatitis, celiac disease, ulcerative colitis, Crohns disease, pernicious anaemia; skin diseases such as psoriasis; allergic diseases such as asthma and in transplantation related conditions such as graft versus host disease, and allograft rejection.
  • Other diseases include those described in European Patent No. 68790.
  • the altered antibodies of the invention may also be useful in the treatment of infectious diseases e.g. viral or bacterial infections and in cancer immunotherapy.
  • the term 'antibody' is used to cover natural antibodies, chimeric antibodies and CDR-grafted or humanised antibodies.
  • Chimeric antibodies are antibodies in which an antigen binding site comprising the complete variable domains of one antibody is linked to constant domains derived from another antibody. Methods for carrying out such chimerisation procedures are described in EP 120694 (Celltech Limited), EP 125023 (Genentech Inc and City of Hope), EP 171496 (Res. Dev. Corp. Japan), EP 173494 (Stanford University) and WO 86/01533 (Celltech Ltd).
  • CDR grafted or humanised antibodies are antibody molecules having an antigen binding site derived from an immunoglobulin from a non-human species and remaining immunoglobulin-derived parts of the molecule being derived from a human immunoglobulin. Procedures for generating CDR-grafted or humanised antibodies are described in WO 91/09967 (Celltech Ltd), WO 90/07861 (Protein Design Labs. Inc) and WO 92/11383 (Celltech Ltd).
  • the invention also includes DNA sequences coding for the altered antibodies according to the invention; cloning and expression vectors containing the DNA sequences, host cells transformed with the DNA sequences and processes for producing the altered antibodies according to the invention comprising expressing the DNA sequences in the transformed host cells.
  • a process for producing an altered antibody of the invention comprises: a. producing in an expression vector an operon having a DNA sequence which encodes an antibody heavy or light chain.
  • alteration in the N-terminal region of the C H 2 domain may be made using techniques such as site directed mutagenesis after the whole altered antibody has been expressed.
  • site directed mutagenesis after the whole altered antibody has been expressed.
  • DNA sequences should be expressed following the teaching described above for altered antibody.
  • the DNA sequences preferably encode a humanised antibody; a CDR-grafted heavy and/or light chain or a chimeric antibody.
  • the cell line may be transfected with two vectors, the first vector containing the operon encoding the light chain-derived polypeptide and the second vector containing the operon encoding the heavy chain derived polypeptide.
  • the vectors are identical except in so far as the coding sequences and selectable markers are concerned so as to ensure as far as possible that each polypeptide chain is equally expressed.
  • a single vector may be used, the vector including a selectable marker and the operons encoding both light chain- and heavy chain-derived polypeptides.
  • the altered antibody according to the invention is preferably derived from the anti-MHC antibody L243, which has been deposited at the American
  • Type Culture Collection Rockville, Maryland USA under Accession number ATCC HB55, and is most preferably a chimeric or a CDR-grafted derivative thereof.
  • L243 was previously described by Lampson and Levy [J. Immunol. (1980) 125, 293].
  • DNA sequences coding for the altered antibodies according to the invention may be synthed completely or in part using oligonucleotide synthesis techniques. Site-directed mutagenesis and polymerase chain reaction (PCR) techniques may be used as appropriate. See for example "PCR Technology Principles and Applications for DNA Amplification” (1989), Ed. H. A. Eriich, Stockton Press, N.Y. London.
  • PCR polymerase chain reaction
  • oligonucleotide directed synthesis as described by Jones et al [Nature, 321 , 522 (1986)] may be used.
  • oligonucleotide directed mutagenesis may be used as described by Kramer et al [Nucleic Acid Res. 12 9441 (1984)].
  • Any suitable host cell/vector system may be used for the expression of the DNA sequences coding for the altered antibody.
  • Bacterial e.g. E.coli and other microbial systems may be used.
  • Eucaryotic e.g. mammalian host cell expression systems may also be used such as for example COS cells and CHO cells [Bebbington, C R (1991) Methods 2, 136-145], and myeloma or hybridoma cell lines [Bebbington, C R et al (1992) Bio/Technology 10, 169-175].
  • altered antibody is derived from L243 CHO based expression systems are preferably used.
  • Immune function/immunosuppression by antibodies may be assayed using techniques well known in the art including for example: Mixed Lymphocyte Responses and T-cell antigen recall responses to Tetanus Toxoid. These assays are described in detail in the following examples. The invention is illustrated in the following non-limiting examples and with reference to the following figures in which:
  • Figure 1 shows: a map of plasmid pMR15.1
  • Figure 2 shows: a map of plasmid pMR14
  • Figure 3 shows: the nucieotide sequence and predicted amino acid sequence of L243 heavy chain
  • Figure 4 shows: the nucieotide and amino acid sequences of
  • Figure 5 shows: the nucieotide sequence and predicted amino acid sequence of L243 light chain
  • Figure 6 shows: a map of plasmid pGamma 1
  • Figure 7 shows: a map of plasmid pGamma 2
  • Figure 8 shows: the nucieotide sequence of hinge and C H 2 region of human C-gamma 1
  • FIG. 9 shows: Antigen binding potency of L243 human isotype series
  • FIG. 10 shows: FcRI binding of L243 isotype series
  • Figure 11 shows: human complement fixation by L243 isotype series e
  • Figure 12 shows: binding of human Clq to L243 human isotype series
  • Figure 13 shows: human complement fixation by L243 isotype
  • Figure 14 shows: guinea pig complement fixation by L243 isotype
  • Figure 15 shows: rabbit complement fixation by L243 isotype
  • FIG. 16 shows: FcRIII binding of L243 isotype series by ADCC
  • Figure 17 shows: L243 Isotype Series Inhibition of TT recall response
  • Figure 18 shows: L243 Isotype Series Inhibition of TT recall response
  • FIG. 19 shows: L243 Isotype Series Inhibition of Mixed Lymphocyte
  • Figure 20 shows: L243 Isotype Series Inhibition of TT response
  • FIG. 21 shows: L243 Isotype Series Inhibition of Mixed Lymphocyte
  • Figure 22 shows: the nucieotide and amino acid sequence of VI region in
  • Figure 23 shows: shows the nucieotide and amino acid sequence of VI region of
  • Figure 24 shows: the nucieotide and amino acid sequence of Vh region of L243-gH
  • Figure 25 shows: a graph of the results of a competition assay for L243 grafts vs FITC-chimeric L243
  • Figure 26 shows: a graph of a Scatchard analysis for L243 gamma 4
  • Figure 27 shows: a graph of FcRIII binding of chimeric, grafted
  • Figure 28 shows: a graph of immunosuppressive activity of CDR grafted
  • Figure 29 shows: a graph of CDR grafted L243 and grafted [L235E]
  • Figure 30 shows: a graph of complement mediated cytotoxic potency of
  • RNA was prepared from 3 ⁇ 10exp7 L243 hybridoma cells as described below. Cells were washed in physiological saline and dissolved in RNAzol (0.2ml per 10exp6 cells). Chloroform (0.2ml per 2ml homogenate) was added, the mixture shaken vigorously for 15 seconds and then left on ice for 15 minutes. The resulting aqueous and organic phases were separated by centrifugation for 15 minutes in an Eppendorf centrifuge and RNA precipitated from the aqueous phase by the addition of an equal volume of isopropanol. After 15 minutes on ice, the RNA was pelleted by centrifugation, washed with 70% ethanol, dried and dissolved in sterile, RNAase free water. The yield of RNA was 350 ⁇ g.
  • the sequence of the first nine amino acids of the mature L243 light chain was determined to be NH2-DIQMTQSPAS.
  • cDNA genes for the variable regions of L243 heavy and light chains were synthesised using reverse transcriptase to produce single stranded cDNA copies of the mRNA present in the total RNA, followed by Polymerase Chain Reaction (PCR) on the cDNAs with specific oligonucleotide primers.
  • PCR Polymerase Chain Reaction
  • cDNA was synthesised in a 20 ⁇ l reaction containing the following reagents: 50mM Tris-HCI PH8.3, 75mM KCI, 10mM dithiothreitol, 3mM MgC.2, 0.5mM each deoxyribonucleoside triphosphates, 20 units RNAsin, 75ng random hexanucleotide primer, 2 ⁇ g L243 RNA and 200 units Moloney Murine Leukemia Virus reverse transcriptase. After incubation at 42°C for 60 min the reaction was terminated by heating at 95°C for 5 minutes. b) PCR
  • the 3' primers are shown in Table 3.
  • the light chain primer spans the V - C junction of the antibody and contains a restriction site for the enzyme Spl1 to facilitate cloning of the VI PCR fragment.
  • the heavy chain 3' primers are a mixture designed to span the J - C junction of the antibody.
  • the first 23 nucleotides are identical to those found at the start of human C - gamma 1 , 2, 3 and 4 genes and include the Apa1 restriction site common to these human isotypes.
  • the 3' region of the primers contain a mixed sequence based on those found in known mouse antibodies [Kabat E A, Wu, T.T.; Perry H M, Gottesman K S, and Foeller L; In: Sequences of
  • Incubations (20 ⁇ l) for the PCR were set up as follows. Each reaction contained 10 mM Tris-HCI pH 8.3, 1.5 mM MgCt ⁇ , 50 mM KCI, 0.01% w/v gelatin, 0.25 mM each deoxyribonucleoside triphosphate, 1 - 6 pmoles 5' primer mix (Table 4), 6 pmoles 3' primer, 1 ⁇ l cDNA and 0.25 units Taq polymerase. Reactions were incubated at 95°C for 5 minutes and then cycled through 94°C for 1 minute, 55°C for 1 minute and 72°C for 1 minute. After 30 cycles, aliquots of each reaction were analysed by electrophoresis on an agarose gel.
  • DNA fragments produced in reactions B2, B3 and B5 were digested with the enzymes BstB1 and Spl1, concentrated by ethanol precipitation, electrophoresed on a 1.4 % agarose gel and DNA bands in the range of 400 base pairs recovered. These were cloned by ligation into the vector pMR15.1 ( Figure 1) that had been restricted with BstB1 and Spl1 . After ligation, mixtures were transformed into E. coli LM1035 and plasmids from the resulting bacterial colonies screened for inserts by digestion with BstB1 and Spl1. Representatives with inserts from each ligation were analysed further by nucieotide sequencing.
  • Plasmid DNA (pE1701 and pE1702) from two isolates containing Vh inserts from reaction B9 was sequenced using the primers R1053 (which primes in the 3' region of the HCMV promoter in pMR14) and R720 (which primes in the 5' region of human C - gamma 4 and allows sequencing through the DNA insert on pMR14).
  • the determined nucieotide sequence and predicted amino acid sequence of L243 Vh in pE1702 is given in Figure 3.
  • the nucieotide sequence for the Vh insert in pE1701 was found to be identical to that in pE1702 except at nucieotide 20 (A in pE1701) and nucieotide 426 (A in pE1701). These two differences are in the signal peptide and J regions of Vh respectively and indicate that the two clones examined are independent isolates arising from the use of different primers from the mixture of oligonucleotides during the PCR stage.
  • clones 182 and 183 contain a VI gene that codes for a signal peptide of 20 amino acids, while the VI gene in clones 43 and 45 results from priming with a different set of oligonucleotides and has a leader sequence of only 15 amino acids.
  • Clone 192 does not code for L243 VI. Instead, examination of the database of antibody sequences [Kabat, 1991] indicates that clone 192 contains the VI gene for MOPC21, a light chain synthesised by the NS1 myeloma fusion partner used in the production of the L243 hybridoma.
  • Clones 182 and 183 are identical except at nucleotide 26 (T in clone 182, C in clone 183). This difference can be accounted for by the use of different primers in the PCR and indicates that clones 182 and 183 are independent isolates of the same gene.
  • the L243 Vh gene was subcloned on a HindIII - Apal fragment into pGamma 1 and pGamma 2, vectors containing the human C - gamma 1 and C - gamma 2 genes respectively ( Figures 6 and 7).
  • Human Isotype mutants were subcloned on a HindIII - Apal fragment into pGamma 1 and pGamma 2, vectors containing the human C - gamma 1 and C - gamma 2 genes respectively ( Figures 6 and 7).
  • PCR mutagenesis was used to change residue 235 in human C - gammal contained in the vector pGamma 1 from leucine to either glutamic acid or to alanine and to change residue 237 from glycine to alanine.
  • the lower hinge region of human C-gamma 1 was also replaced by the corresponding region of human C-gamma 2.
  • the following oligonucleotides were used to effect these changes: i) L235E change
  • oligonucleotides used in the PCR mutagenesis are:
  • R4732 and R4912 prime between nucleotides 834 and 858 and between nucleotides 1156 and 1137 respectively in human C - gamma 1 ( Figure 8).
  • reactions (20 ⁇ l) were prepared containing the following reagents : 10 mM Tris - HCl pH 8.3, 1.5 mM MgCI2, 50 mM KCl, 0.01% gelatin, 0.25 mM each deoxyribonucleoside triphosphate, 50 ng pGamma 1 DNA, 0.4 unit Taq polymerase and 6 pmoles of each of the primer.
  • the following combinations of primers were used:
  • Second round PCR was in a 100 ⁇ l reaction containing 10 mM Tris - HCl pH 8.3, 1.5 mM MgCI2, 50 mM KCI, 0.01 % gelatin, 0.25 mM each deoxyribonucleoside triphosphate, 2 units Taq polymerase, 1/20 of each pair of DNA fragments from the first round reaction and 30 pmoles of each of R4732 and R4912.
  • the reactions were extracted with phenol / chloroform (1/1) and precipitated with ethanol. Fragments were digested with Bgl11 and Sty1 , electrophoresed on a 1.4 % agarose gel and DNA bands of 250 base-pairs recovered from gel slices as previously described.
  • Bgl II - Sty1 fragments were ligated in a 3 - way ligation to the 830 base-pair Sty1 - EcoRI fragment, containing the C - terminal part of the C H 2 domain and the entire CH3 domain of human C - gamma 1, and the BgIII - EcoR1 vector fragment from pGammal (see Figure 6).
  • plasmid minipreps from resulting colonies were screened for the presence of the Bgl II - Sty1 fragment and representatives of each taken for nucieotide sequence analysis. From this, plasmids containing the desired sequence were identified and, for future reference, named as follows : pGammal [L235E] containing glutamic acid at residue 235,
  • Antibody for biological evaluation was produced by transient expression of the appropriate heavy and light chain pairs after co-transfection into Chinese Hamster Ovary (CHO) cells using calcium phosphate precipitation.
  • the calcium phosphate precipitate was prepared by mixing 1.25 ml of 0.25M CaCI2 containing 50 ⁇ g of each of heavy and light chain expression vectors with 1.25 ml of 2 ⁇ HBS (16.36 gm NaCI, 11.9 gm HEPES and 0.4 gm Na2HPO4 in 1 litre water with the pH adjusted to 7.1 with NaOH) and adding immediately into the medium on the cells.
  • the samples were titrated in the microtitre wells in 2-fold dilutions to give a final volume of 0.1 ml in each well and the plates incubated at room temperature for 1 hr with shaking. After the first incubation step the plates were washed 10 times with distilled water and then incubated for 1 hr as before with 0.1 ml of a mouse monoclonal anti-human kappa (clone GD12) peroxidase conjugated antibody (The Binding Site, code MP135) at a dilution of 1 in 700 in conjugate buffer. The plate was washed again and substrate solution (0.1 ml) added to each well.
  • clone GD12 mouse monoclonal anti-human kappa peroxidase conjugated antibody
  • Substrate solution contained 150 ⁇ l N,N,N,N-tetramethylbe ⁇ zidine (10 mg/ml in DMSO), 150 ⁇ l hydrogen peroxide (30% solution) in 10 ml 0.1 M sodium acetate/sodium citrate, pH6.0. The plate was developed for 5 -10 minutes until the absorbance at 630nm was approximately 1.0 for the top standard. Absorbance at 630nm was measured using a plate reader and the concentration of the sample determined by comparing the titration curves with those of the standard. TABLE 1
  • CH1 5'ATGAAATGCAGCTGGGTCAT(G,C)TTCTT3'
  • CH2 5'ATGGGATGGAGCT(A,G)TATCAT(C,G)(C, T)TCTT3'
  • CH6 5'ATGGCTGTC(C,T)T(G,A)G(G,C)GCT(G,A)CTCTTCTG3' CH7 : 5'ATGG(G,A)ATGGAGC(G,T) GG(G,A)TCTTT(A,C)TCTT3 ,
  • CL1 5 ⁇ TGAAGTTGCCTGTTAGGCTGTTGGTGCT3'
  • CL2 5'ATGGAG(T,A)CAGACACACTCCTG(T,C)TATGGGT3'
  • CL9 5 , ATGGT(G,A)TCC(T,A)CA(G,C)CTCAGTTCCTT3
  • CL10 5'ATGTATATATGTTTGTTGTCTATTTC3'
  • CL11 5'ATGGAAGCCCCAGCTCAGCTTCTCTT3'
  • Murine L243 (lgG2a) was labelled with fluorescein (FITC) using standard, techniques. All dilutions, manipulations and incubations were done in
  • the ability of the engineered variants of L243 to bind to FcgRI was measured.
  • the principle of this experiment is that antibodies will bind to cells through Fc receptors and the affinity of this interaction is determined by the subclass and hence the structure of the Fc of the antibody.
  • the assay is based on the ability of the engineered antibodies to compete for binding with FITC labelled murine lgG2a to I FN ⁇ stimulated U937 cells.
  • U937 myelomonocytic cells, when incubated with 500 ⁇ /ml IFN ⁇ (Genzyme UK) for 24 hours, expresses high levels of FcgRI, as assessed by CD64 binding and monomeric lgG2a binding, low levels of Fc ⁇ RII and no Fc ⁇ RIII.
  • U937 cells are washed extensively in DMEM containing 25mM HEPES (Gibco UK), incubated for 2 hours at 37°C in RPMI 1640 (Gibco UK) and then washed again in DMEM containing 25mM HEPES (Gibco UK) to remove bovine IgG bound to Fc receptors.
  • Serial dilutions of engineered antibodies were prepared in 50 ⁇ l in Phosphate Buffered Saline (Gibco UK) containing 0.1% sodium azide in V-bottom 96 well microtitre plates' (ICN/Flow UK) and were incubated with 5x10 4 U937 cells in 50 ⁇ l for 30min at 4°C. 50 ⁇ l of FITC labelled lgG2a antibody was then added to all wells, at a previously determined optimal concentration, for a further 90min at
  • the principle of the experiment is that antibodies will mediate complement lysis of target cells bearing their cognate antigen if the Fc of the antibody is able to interact with the components of the (usually classical) complement cascade.
  • the critical interaction is with the C1q molecule.
  • the source of complement in these experiments is human venous blood freshly drawn into endotoxin free glass bottles which is then allowed to clot at 37°C for 1 hour. The clot is detached from the glass and then incubated at 4°C for 2 hours to allow it to retract. The clot is then removed and the serum separated from the remaining red cells by centrifugation at 1000g. Once prepared, the serum can be stored for up to one month at -20°C without noticeable deterioration of potency but is best used fresh.
  • Target cells JY B lymphoblastoid cell line bearing high levels of HLA-DR
  • Serial antibody dilutions are prepared in duplicate in V-bottom 96 well microtitre plates (ICN/Flow UK) in 25 ⁇ l.
  • Control wells containing medium only are also prepared to establish the spontaneous release of label giving the assay background.
  • Target 51 Cr labelled JY cells are added to all wells in 10 ⁇ l.
  • the same number of JY cells are also added to wells containing 2% Triton ⁇ 100 in water to establish the 100% release value.
  • Target cells and antibody are incubated together and, after 1 hour at room temperature, 25 ⁇ l serum as a source of complement is added to all wells (except the 100%) for a further 1 hour at room temperature.
  • 100 ⁇ l of EDTA saline at 4°C is then added to stop any further cell killing, the microtitre plates are centrifuged at 200g to pellet the intact cells and 100 ⁇ l supernatant is removed and counted in a gamma counter.
  • Percent cell lysis is calculated by subtracting the background from all values and then expressing them as a percentage of the adjusted maximum release. Replicates vary by less than 5%. Percent cell lysis is then plotted against antibody dilution.
  • 5 ⁇ 10 4 indicator cells JY B lymphoblastoid cell line bearing high levels of HLA-DR were coated with the different engineered antibodies by incubating at saturating concentrations for 1 hour at 4°C in RB polystyrene tubes (2052 12x75mm Falcon UK). After washing, serial dilutions of FITC labelled C1q in 100 ⁇ l were added and were incubated together for a further 30 min at 4°C. After washing, binding of C1q was revealed using a Fluorescence Activated Cell Scanner (FACS Becton Dickinson). After appropriate analysis, median fluorescence intensity is plotted against C1q concentration.
  • FACS Becton Dickinson Fluorescence Activated Cell Scanner
  • the G1[L235E] and G1[L235A] modifications behaved differently when rabbit or guinea pig serum was used as a source of complement instead of human.
  • rabbit C they caused the same level of lysis as the wild type G1.
  • guinea pig they caused 40% and 49% plateau level killing, respectively, compared with 80% killing by the lgG1 wild type.
  • the 235 change only affects human complement binding indicating that rabbit and guinea pig complement interact differently with human lgG1 (see Figures 13-15).
  • ADCC antibody dependent cell mediated cytotoxicity
  • PBMC Peripheral blood mononuclear cells
  • the cells are then washed three times, to remove free radiolabel, and resuspended at 2 ⁇ 10 6 /ml.
  • Serial antibody dilutions are prepared in duplicate in sterile U-bottom 96 well microtitre plates (Falcon UK) in 25 ⁇ l. Control wells containing medium only are also prepared to establish the spontaneous release of label giving the assay background.
  • Target 51 Cr labelled JY cells are added to all wells in 10 ⁇ l. The same number of JY cells are also added to wells containing 2% Triton x100 in water to establish the 100% release value.
  • Target cells and antibody are incubated together and, after 30min at room temperature, 25 ⁇ l effector cells are added to all wells (except the 100%) for a further 4 hours at 37°C.
  • microtitre plates 100 ⁇ l of EDTA saline at 4°C is then added to stop any further cell killing, the microtitre plates are centrifuged at 200g to pellet the intact cells and 100 ⁇ l supernatant is removed and counted in a gamma counter.
  • Percent cell lysis is calculated by subtracting the background from all values and then expressing them as a percentage of the adjusted maximum release. Replicates vary by less than 5%. Percent cell lysis is then plotted against antibody dilution. Results
  • L243 lgG2 was unable to mediate peripheral blood mononuclear cell cytotoxicity (ADCC) of HLA-DR positive JY lymphoblastoid cells at concentrations up to 100 ⁇ /ml.
  • lgG4 caused a low level of ADCC (20% maximum killing at 1 ⁇ /ml) which could be abrogated by the Leu 235 to Glu change.
  • Wild type lgG1 was a potent mediator of cell killing giving 50% cell death at 5ng/ml antibody.
  • Gly to Ala at 237 reduced the igG1 wild type killing to the level seen with lgG4.
  • Exchanging the whole lower hinge region with the sequence found in human lgG2 gave intermediate levels of killing with 500ng/ml needed for 50% cell death.
  • changes at 235 in lgG1 had minimal effect on ADCC.
  • Changing the Leu 235 to Ala gave levels of killing comparable with the G1 wild type (9ng/ml for 50% cell death)) and changing the Leu 235 to Glu reduced ADCC a little (40ng/ml for 50% cell death).
  • a change in the previously described C1q binding motif, from Lys to Ala at 320 had no effect on the ability of lgG1 to mediate ADCC.
  • the immunosuppressive potency of engineered variants of L243 was assessed using a mixed lymphocyte reaction.
  • the principle of the experiment is that when leucocytes from one individual are mixed with those of another which express different HLA alleles, they will recognise each other as foreign and will become activated. This activation is dependent, primarily, on interactions between the CD3/TcR complex on T cells and the MHC-II molecule on antigen presenting cells. Antibodies that bind to MHC-II are known to inhibit this reaction.
  • PBMC Peripheral blood mononuclear cells
  • Serial antibody dilutions are prepared in triplicate in sterile U-bottom 96 well microtitre plates (Falcon UK) in 100 ⁇ l. Control wells containing medium only and optimal Cyclosporin (Sandimmun®, Sandoz) levels (100nM) are also prepared to establish the maximum response and maximum inhibition, respectively. Equal numbers of irradiated stimulators and responders are mixed together and 100 ⁇ l are added to each well. Wells of stimulator alone and responders alone are also set up as controls. The experiment is incubated at 37°C in 100% humidity and 5%CO 2 for 5 days. Response is measured by assessing proliferation during the last 18 hours of culture by incubation with 1 ⁇ Ci/well 3 H-Thymidine (Amersham UK), harvesting on to glass filter mattes and counting using a beta counter.
  • T lymphocytes from an individual previously immunised with Tetanus Toxoid will respond to TT when re-exposed ex vivo. This activation is dependent on the interaction between the CD3/TcR complex on T ceils and the MHC-II molecule on cells which process and present the antigen. Antibodies that bind to MHC-II are known to inhibit this reaction. Lymphocytes are prepared fresh for each experiment. Human venous blood is drawn into endotoxin free tubes containing heparin. Peripheral blood mononuclear cells (PBMC) are prepared by density gradient centrifugation according to the manufacturers instructions (Pharmacia).
  • PBMC Peripheral blood mononuclear cells
  • PBMC peripheral blood mononuclear cells
  • PBMC peripheral blood mononuclear cells
  • RPMI 1640 medium Gibco UK
  • 2mM Glutamine Gibco UK
  • 100 ⁇ /ml/100 ⁇ g/ml Penicillin/ Streptomycin Gibco
  • 10% foetal calf serum Sigma UK
  • Serial antibody dilutions are prepared in triplicate in sterile U-bottom 96' well microtitre plates (Falcon UK) in 100 ⁇ l. 50 ⁇ l containing an optimal concentration of TT, previously determined by experimentation, is added to all wells. Control wells containing medium only or Cyclosporin
  • Results are plotted as CPM against antibody concentration. Replicates vary by less than 10%.
  • G1/G2 L hinge exchange mutant was intermediate in immuno-suppresser potency, there was no correlation between complement fixation or FcRI binding and immuno-suppression, G1 binding well to FcRI and fixing complement and G1[L235E] doing neither, but both giving good immunosuppression. But, there was good correlation with FcRIII binding. Human G1 and G1[L235E] interact with FcRIII and give good immunosuppression. The G1/G2 L hinge is intermediate in FcRIII binding and immuno-suppression. In contrast, the G237A mutation in human G1, in agreement with published observations, reduces FcRIII binding. This antibody gave poor immunosuppression. (Table 5). Table 6 shows a number of L243 isotype mutants.
  • G1/G2Lh 10 500 >20/0
  • L243 is a mouse monoclonal antibody raised against human MHC Class II.
  • the nucieotide and amino acid sequences of L243 VI and Vh are shown in Figures 5 and 3 respectively.
  • the following examples describe the humanisation of the L243 antibody (CDR grafting).
  • L243-gL1 The construction of L243-gL1 is given below in detail.
  • the following oligonucleotides were used in the Polymerase Chain Reactions (PCR) to introduce changes into the framework regions of the chimeric light chain: R5043 : 5 'GTAGGAGACCGGGTCACCATCACATGTCGAGCAAA3 '
  • R5CH4 5 'CTGAGGAGCTTTTCCTGGTTTCTGCTGATACCATGCTAAA3 '
  • R5045 5 'AAACCAGGAAAAGCTCCTCAGCTCCTGATCTTTGCTGCATC3 '
  • R5046 5 'CTTCTGGCTGCAGGCTGGAGATAGTTAGGGTATACTGTGTGCC3 '
  • R5047 5 'CTTCAGCCTGCAGCCAGAAGATTTTGCTACTTATTACTGTCAA3 '
  • R5048 5 'GGGCCGCTACCGTACGTTTTAGTTCCACTTTGGTGCCTTGACCGAA3 '
  • the reaction 100 ⁇ l, contained 10 mM Tris-HCI pH 8.3, 1.5 mM MgCI2, 50 mM KCI, 0.01% w/v gelatin, 1/10 of each of the three PCR fragments from the first set of reactions, 30 pmoles of R5043 and R5048 and 2.5 units Taq polymerase. Reaction temperatures were as above.
  • the mixture was extracted with phenol / chloroform and then with chloroform and precipitated with ethanol. The ethanol precipitate was recovered by centrifugation, dissolved in the appropriate buffer and restricted with the enzymes BstEII and Spll.
  • the resulting product was finally electrophoresed on an agarose gel and the 270 base pair DNA fragment recovered from a gel slice and ligated into the vector pMR15.1 ( Figure 1) that had previously been digested with the same enzymes.
  • the ligation mixture was used to transform E. coli LM1035 and resulting colonies analysed by PCR, restriction enzyme digests and nucieotide sequencing.
  • the nucieotide and amino acid sequence of the VI region of L243-gL1 is shown in Figure 22.
  • L243-gL2 was constructed from L243-gL1 using PCR.
  • the following oligonucleotides were used to introduce the amino acid changes : R1053 : 5 'GCTGACAGACTAACAGACTGTTCC3 '
  • the reaction 100 ⁇ l, contained 10 mM Tris-HCI pH 8.3, 1.5 mM MgCI2, 50 mM KCI, 0.01% w/v gelatin, 1/5 of each of the PCR fragments from the first set of reactions, 30 pmoles of R1053 and R684 and 2.5 units Taq polymerase. Reaction temperatures were as above.
  • the mixture was extracted with phenol / chloroform and then with chloroform and precipitated with ethanol.
  • the ethanol precipitate was recovered by centrifugation, dissolved in the appropriate buffer and restricted with the enzymes BstEII and Spll.
  • the resulting product was finally electrophoresed on an agarose gel and the 270 base pair DNA fragment recovered from a gel slice and ligated into the vector pMR15.1 ( Figure 1) that had previously been digested with the same enzymes.
  • the ligation mixture was used to transform E. coli LM1035 and resulting colonies analysed by PCR, restriction enzyme digests and nucieotide sequencing.
  • the nucleotide and amino acid sequence of the VI region of L243-gL2 is shown in Figure 23.
  • L243 heavy chain was found to be most homologous to human heavy chains belonging to subgroup 1 and therefore the consensus sequence of the human subgroup 1 frameworks was chosen to accept the L243 heavy chain CDRs.
  • L243 differs from the human consensus at 28 positions (underlined). After analysis of the contribution that any of these might make to antigen binding, only residues 27,67,69,71,72 and 75 were retained in the CDR grafted heavy chain, L243-gH.
  • L243gH was assembled by subjecting overlapping oligonucleotides to PCR in the presence of the appropriate primers.
  • the following oligonucleotides. were used in the PCR: R3004 : 5 'GGGGGGAAGCTTGCCGCCACCATGG3 ' R3005 : 5 'CCCCCCGGGCCCTTTGTAGAAGCAG3 ' R4902 : 5 'GACAACAGGAGTGCACTCTCAGGTGCAGCTGGTGCAGTCTGGAGC
  • CAGGGACTCGAGTGGA3 ' R4904 5 ' CCTACGTACGCAGACGACTTCAAGGGAAGATTCACATTCACACTG
  • TCCCATCCACTCGAGTCCCTGTCCAG3 ' R4900 5 'TTGCACAGTAGTACACTGCTGTGTCCTCAGATCTCAGAGAAGACA GCTCCATGTATGCTGTAGATGCAGAT3 ' R4901 : 5 'CCCCCCGGGCCCTTTGTAGAAGCAGAAGACACTGTCACCAGTGTT
  • the assembly reaction 50 ⁇ l, contained 10 mM Tris-HCI pH 8.3, 1.5 mM MgCI2, 50 mM KCI, 0.01% w/v gelatin, 0.25 mM each deoxyribonucleoside triphosphate, 1 pmole of each Of R4897 - R4905, 10 pmoles of each of R3004 and R3005 and 2.5 units Taq polymerase. Reactions were cycled through 94 C for 1 minute, 55 C for 1 minute and 72 C for 1 minute. After 30 cycles, the reaction was extracted with phenol/chloroform (1/1), then with chloroform and precipitated with ethanol. After centrifugation, the DNA was dissolved in the appropriate restriction buffer and digested with HindIII and ApaI.
  • pMR14 contains the human gamma 4 heavy chain constant region and so the heavy chain expressed from this vector will be a gamma 4 isotype.
  • the ligation mixture was used to transform E. coli LM1035 and resulting bacterial colonies screened by restriction digest and nucieotide sequence analysis. In this way, a plasmid containing the correct sequence for L243gH was identified ( Figure 24). Construction of Gamma 1 versions of chimeric and CDR grafted L243 heavy chain
  • Human Gamma 1 versions of L243 heavy chains were constructed by transferring the variable regions of both the murine and the CDR grafted heavy chains as HindIII to Apal fragments into the vector pGammal ( Figure 6). This vector contains the human Gamma 1 heavy chain constant region.
  • Chimeric and CDR grafted L243 was produced for biological evaluation by transient expression of heavy and light chain pairs after co-transfection into Chinese Hamster Ovary (CHO) cells using calcium phosphate precipitation as described above for production of chimeric L243.
  • Antibody concentration was determined using a human Ig ELISA (see below). b) ELISA
  • the samples were titrated in the microtitre wells in 2-fold dilutions to give a final volume of 0.1 ml in each well and the plates incubated at room temperature for 1 hr with shaking. After the first incubation step the plates were washed 10 times with distilled water and then incubated for 1 hr as before with 0.1 ml of a mouse monoclonal anti-human kappa (clone GD12) peroxidase conjugated antibody (The Binding Site, code MP135) at a dilution of 1 in 700 in conjugate buffer. The plate was washed again and substrate solution (0.1 ml) added to each well.
  • clone GD12 mouse monoclonal anti-human kappa peroxidase conjugated antibody
  • Substrate solution contained 150 ⁇ l N,N,N,N-tetramethylbenzidine (10 mg/ml in DMSO), 150 ⁇ l hydrogen peroxide (30% solution) in 10 ml 0.1 M sodium acetate/sodium citrate, pH6.0. The plate was developed for 5 -10 minutes until the absorbance at 630nm was approximately 1.0 for the top standard. Absorbance at 630nm was measured using a plate reader and the concentration of the sample determined by comparing the titration curves with those of the standard. c) Competition Assay
  • the principle of this assay is that if the antigen binding region has been correctly transferred from the murine to human frameworks, then the CDR grafted antibody will compete equally well with a labelled chimeric antibody for binding to human MHC Class II. Any changes in the antigen binding potency will be revealed in this system.
  • Chimeric L243 was labelled with fluorescein (FITC) using the method of Wood et al [Wood.T., Thompson, S and Goldstein, G 1965, J. Immunol 95, 225-229 and used in the competition assay described above.
  • FITC fluorescein
  • Figure 25 compares the ability of combinations of L243 heavy and light chains to compete with FITC-labelled chimeric L243 for binding to JY cells. All combinations were effective competitors although none of those containing CDR grafted heavy or light chains were as effective as the chimeric antibody itself. Thus, the combinations cH/gL1 , gH/cL and gH/gL1 were 89%, 78% and 64% respectively, as effective as chimeric L243 in this assay. d) Determination of Affinity constants by Scatchard Analysis
  • L243 antibodies were titrated from 10 ⁇ g/ml in PBS, 5% fetal calf serum, 0.1% sodium azide in 1.5-fold dilutions (150 ⁇ l each) before incubation with 5 ⁇ 10 4 JY cells per titration point for 1 hour on ice. The cells were previously counted, washed and resuspended in the same medium as the samples. After incubation, the cells were washed with 5ml of the above medium, spun down and the supernatant discarded. Bound antibody was revealed by addition of 100 ⁇ l of a 1/100 dilution of FITC conjugated antihuman Fc monoclonal (The Binding Site; code MF001).
  • the cells were then incubated for 1 hour on ice and then the excess FITC conjugate removed by washing as before.
  • Cells were dispersed in 250 ⁇ l of the same buffer and the median fluorescence intensity per cell was determined in a FACScan (Becton Dickinson) and calibrated using standard beads (Flow Cytometry standards Corporation). The number of molecules of antibody bound per cell at each antibody concentration was thus established and used to generate Scatchard plots. For the purpose of calculation, it was assumed that the valency of binding of the FITC conjugate to L243 was 1:1 and that the F/P ratio was 3.36 (as given by the manufacturer).
  • the principle of the experiment is that when leucocytes from one individual are mixed with those of another individual which express different HLA alleles, they will recognise each other as foreign and the lymphocytes will become activated. This activation is dependent primarily on interactions between the CD3/TcR complex on T cells and the MHC Class II molecule on antigen presenting cells. L243 is known to inhibit this reaction.

Abstract

The invention provides antibodies with altered ability to fix complement. The invention further relates to pharmaceutical, therapeutic and diagnostic compositions containing said antibodies and to methods of therapy and diagnosis using said antibodies. The invention additionally provides a method of modulating the function of cell surface associated antigens using said antibodies. Also provided are processes for preparing said antibodies.

Description

ANTIBODIES
FIELD OF THE INVENTION
This invention relates to altered antibodies, to pharmaceutical, therapeutic and diagnostic compositions containing said antibodies; to processes for preparing said compositions; to methods of therapy and diagnosis using said antibodies, to a method of modulating the function of cell surface associated antigens using said antibodies; to DNA sequences coding for said antibodies; to cloning and expression vectors containing DNA sequences coding for said antibodies; to host cells transformed with said vectors and to processes for preparing said antibodies.
BACKGROUND OF THE INVENTION
In order for an antibody to be effective therapeutically it is desirable that it achieves the required physiological effect without producing any significant adverse toxic effects. Such toxic effects may be mediated, for example, via complement fixation. Antibody when bound to its cognate antigen can link to and activate the complement cascade. Complement consists of a complex series of proteins. The proteins of the complement system form two interrelated enzyme cascades, termed the classical and alternative pathways, providing two routes to the cleavage of C3, the central event in the complement system. The sequence of events comprising the classical complement pathway is recognition, enzymatic activation, and membrane attack leading to cell death. The recognition unit of the complement system is the C1 complex. The C1 complement protein complex is a unique feature of the classical complement cascade leading to C3 conversion. Complement fixation occurs when the C1q subcomponent binds directly to immunoglobulin antigen immune complex. Whether or not complement fixation occurs depends on a number of constraints. For example, only certain subclasses of immunoglobulin can fix complement even under optimal conditions. These are lgG1, lgG3 and IgM in man and lgG2a, lgG2b and IgM in mice. The C1q molecule is potentially multivalent for attachment to the complement fixation sites of immunoglobulin. The CH2 domain of IgG and probably the CH4 domain of IgM contain binding sites for C1q. Fc bearing cells also play a role in enhancing the effect of the immune response by binding to and opsonising, phagocytosing or killing target cells coated with antibody of the relevant class. Three IgG binding receptors (FcγR) have been described for murine and human leukocytes. FcγRI has high binding affinity for monomeric IgG, while FcγRII and FcγRIII have low affinity for mono IgG and interact mainly with antigen complexed IgG. The presence of Fc receptors confers on these immune cells the ability to mediate a number of effector mechanisms important in the effector phase of the humoral response. The gamma 1 isotype of human IgG, like lgG3, binds to FcRI and, when complexed with its cognate antigen, activates complement and binds to FcRII and FcRIII. Conversely, human lgG2 and lgG4 are relatively inactive isotypes; both fail to activate the classical complement pathway and lgG4 binds weakly to FcRI [Burton, D R and Woof, J M (1992) Adv. Immunol. 51, 1. Lucisano Valim, Y M and Lachmann, P J. (1991) Clin. exp. Immunol, 84, 1].
Localisation of amino acid residues of IgG that interact with FcRI in the CH2 domain of human IgG is well established [Woof, J M et al (1986) Molec. Immunol. 23, 319. Lund, J et al (1991) J. Immunol, 147. 2657; Canfield, S M and Morrison, S L (1991), J. exp. Med. 173, 1483; Chappel, S M et al, (1991) Proc. Natl. Acad. Sci. 88i, 9036; Chappel, S M et al (1993), J. Biol. Chem 268, 25124; Alegre, M-L et al (1992) J. Immunol, 148. 3461]. Amino acid sequence comparisons of the CH2 domains of antibodies from different species and subclasses that bind well to FcRI suggested that a region at the N-terminal end of CH2 comprising residues Leu 234 - Ser 239 (using the Kabat Eu numbering system [Kabat, E A et al, (1987) Sequences of proteins of Immunological interest. US Dept. of Health and Human Services, Bethesda, MD, USA]) is critical for interaction with FcRI. The motif Leu 234, Leu 235, Gly 236, Gly 237, Pro 238, Ser 239, is present in all IgG isotypes with high affinity for FcRI [Woof, J M et al (1986), Molec. Immunol. 23, 319]. Domain exchanges between Ig's with different Fc effector functions have demonstrated the importance of CH2 for FcRI binding [Canfield, S M and Morrison, S L (1991), J. exp. Med. 173, 1483; Chappel, S M et al, (1991) Proc. Natl. Acad. Sci. S3, 9036; Chappel, S M et al (1993), J. Biol. Chem 268, 25124] in particular the residue 235. Replacement of the Leu residue at position 235 with a Glu residue reduces the affinity of lgG3 for FcRI by 100 fold [Lund, J et al (1991) J. Immunol, 147. 2657; Canfield, S M and Morrison, S L (1991), J. exp. Med. 173, 1483]. The same Leu 235 to Glu change when performed on an lgG4 variant of OKT3 [Alegre, M-L et al (1992) J. Immunol, 148, 3461] abolished its FcRI binding and, consequently, its mitogenic properties.
Although the sequence requirements for FcRIII binding has been less extensively studied, Sarmay et al. [(1992) Molec. Immunol. 29, 633] have identified the CH2 domain residues 234 to 237 as important for lgG3 binding to all three Fc receptors. The relative importance of each residue differs with each Fc receptor with 235 and 237 being most important for FcRIII mediated cell killing. In contrast, another Fc mediated function, C1q binding and subsequent complement activation, appears to require the carboxyl terminal half of the CH2 domain [Tao, M H., Canfield, S M., and Morrison, S L(1991) J. Exp. Med. 173. 1025]. Morrison's group, following sequence analysis of polymorphisms in the CH2 domain of human IgGs also identified the importance of the C-terminal region of CH2. With a Pro to Ser change at 331 in lgG1 they abolished complement fixation and reduced C1q binding [Tao, M H et al (1993), J. Exp. Med. 178, 661]. Using inter- and intradomain switch variants of CAMPATH-1, Greenwood et al. (1993) [Eur. J. Immunol. 23, 1098] further endorsed the importance of the C-terminal end of CH2. Complement fixation could be restored to human lgG4 with just the carboxyi terminal of CH2 from residue 292 of lgG1 and not the N- terminal half or any other domain. Duncan & Winter (1988) [Nature, 332, 21] identified a motif in CH2 of Glu 318, Lys 320 and Lys 322 of the mouse lgG2b isotype. Changing any of these residues abolished C1q binding, as did the use of competitive peptides of sequences in this region. However, the C1q motif residues are also found in antibodies that do not fix complement suggesting that these residues may well be necessary but not sufficient for complement activation.
We have found that amino acid residues necessary for C1q and FcR binding of human lgG1 are located in the N-terminal region of the CH2 domain, residues 231 to 238, using a matched set of engineered antibodies based on the anti-HLA DR antibody L243. Changing the leucine 235 in the CH2 region of lgG3 and lgG4 to glutamic acid was already known to abolish FcRI binding, we have confirmed this for lgG1 and also found a concomitant abolition of human complement fixation with retention of FcRIII mediated function. Changing the glycine at 237 to alanine of lgG1 also abolished FcRI binding and reduced complement fixation and FcRIII mediated function. Exchanging the whole region 233 to 236, with the sequence found in human lgG2 abolished FcRI binding andcomplement fixation and reduced FcRIII mediated function of lgG1. In contrast, a change in the previously described C1q binding motif, from lysine at 320 to alanine had no effect on IgG 1 -mediated complement fixation. The proposed site Leu 234 - Leu 235 - Gly 236 - Gly 237 - Pro 238 - Ser 239, is present in all IgG isotypes with high affinity for FcγRI. Recent mutagenesis experiments on lgG3 antibodies have introduced point mutations in this region and the ability of the mutants to interact with FcγRI has been examined [Lund et al (1991) J. Immunol 147, 2657-2662]. The most marked effect is seen at position 235 where replacement of the naturally occurring Leu residue with a Glu residue produces an Ig with a > 100-fold decrease in affinity for FcγRI.
Our observation of the effect of this alteration at residue 235 on the ability of the antibody to fix complement was highly surprising. Earlier protein engineering studies had introduced mutations at various positions in order to locate the C1q-binding site on IgG [Duncan & Winter (1988) Nature, 332, 738-740]. The binding site for C1q was localised to three side chains, Glu 318, Lys 320 and Lys 322 of the mouse lgG2b isotype. Residues Glu 318, Lys 320 and Lys 322 are conserved in all the human IgGs, rat lgG2b and lgG2c, mouse lgG2a, lgG2b and lgG3, guinea pig lgG1 and rabbit IgG. Further experiments showed that the affinity of human C1q for mutant mouse lgG2b antibodies in which residue 235 was mutated was unaffected i.e. it was in the same range of values as that obtained with the wild type. Although the fact that altering residue 235 of the CH2 region of IgG is known to abolish FcγRI binding as we too observed, this concomitant substantial reduction in complement fixation has not been reported or suggested elsewhere and was completely unexpected. SUMMARY OF THE INVENTION
The invention provides a method of treating diseases in which antibody therapy leads to undesirable toxicity due to antibody mediated complement fixation comprising administering an altered antibody wherein one or more amino acid residues in the N-terminal region of the CH2 domain of said antibody are altered characterised in that the ability of said antibody to fix complement is altered as compared to unaltered antibody.
In a preferred embodiment the altered antibody binds to one or more cellular Fc receptors especially FcRIII and excluding FcRI i.e. the antibody does not bind significantly to FcRI, and more preferably binding to FcRI is abolished.
Accordingly in a further aspect the invention provides an altered antibody wherein one or more amino acid residues in the N-terminal region of the CH2 domain of said antibody are altered characterised in that the ability of said antibody to fix complement is altered, as compared to unaltered antibody.
In a further preferred embodiment the invention therefore provides an altered antibody wherein one or more amino acid residues in the N-terminal region of the CH2 domain of said antibody are altered characterised in that the ability of said antibody to fix complement is altered as compared to unaltered antibody and said altered antibody binds to one or more cellular Fc receptors especially FcRIII and does not bind significantly to FcRI. The constant region of the antibodies to be altered according to the invention may be of animal origin and is preferably of human origin. It may also be of any isotype but is preferably human IgG and most preferably human lgG1.
In a preferred embodiment of the invention the amino acid residue(s) which is altered lies within amino acid positions 231 to 239, preferably within 234 to 239. In a particularly preferred embodiment of the invention the amino acid residue(s) which is altered lies within the motif Leu 234 Leu 235 Gly 236 Gly 237 Pro 238 Ser 239.
In a most preferred embodiment the amino acid residue(s) which is altered is either Leu 235 and/or Gly 237.
DETAILED DESCRIPTION OF THE INVENTION
As used herein the term 'altered' when used in conjunction with the ability of an antibody to fix complement most usually indicates a decrease in the ability of antibody to fix complement compared to the starting antibody. By choosing appropriate amino acids to alter it is possible to produce an antibody the ability of which to fix complement is substantially reduced such as for example by altering residue Leu 235. It is also possible to produce an antibody with an intermediate ability to fix complement by, for example altering amino acid residue Gly 237.
As used herein the phrase 'substantially reduce complement fixation' denotes that human complement fixation is preferably≤30%, more preferably≤20% and most preferably≤10% of the level seen with the starting wild type unaltered antibody.
The term 'significantly' as used with respect to FcRI binding denotes that the binding of antibody to FcRI is typically <20%, and is most preferably ≤10% of that seen with unaltered antibody. The altered antibodies of the invention preferably bind to FcRIII as measured by their ability to mediate antibody dependent cellular cytotoxicity (ADCC) at a concentration no greater than ten times that of the wild type unaltered antibody.
The proteins encoded in the Major Histocompatibility Complex region of the genome are involved in many aspects of immunological recognition. It is known that all mammals and probably all vertebrates possess basically equivalent MHC systems and that immune response genes are linked to the MHC.
In man the major histocompatibility complex is the HLA gene cluster on chromosome 6. The main regions are D, B, C and A. The D region contains genes for class II proteins which are involved in cooperation and interaction between cells of the immune system. Many diseases have been found to be associated with the D region of the HLA gene cluster. Studies to date have shown associations with an enormous variety of diseases, including most autoimmune diseases (see for example, European Patent No. 68790). European Patent No. 68790 suggests controlling diseases associated with a particular allele of certain regions of the MHC such as the HLA-D region in humans by selectively suppressing the immune response(s) controlled by a monoclonal antibody specific for an MHC-class II antigen. We have found that by altering an MHC-class II specific antibody at position 235 in the N-terminal region of the CH2 domain it is possible to produce an antibody which fully retains its immunosuppressive properties but which has substantially reduced toxicity in vitro and is tolerated in vivo. In a further preferred embodiment the invention provides an MHC specific antibody wherein one or more amino acid residues in the N-terminal region of the CH2 domain of said antibody are altered characterised in that the ability of said antibody to fix complement is altered as compared to unaltered antibody. In a preferred embodiment the invention provides an MHC specific monoclonal antibody characterised in that said antibody has been altered at position 235 of the N-terminal region of the CH2 domain. In some instances such as with MHC specific monoclonal antibodies it may be desfrable that the alteration in the N-terminal region of the CH2 domain of the antibody while altering the ability to fix complement additionally inhibits the binding to FcRI receptors. The antibodies are preferably specific for MHC-class II antigens and due to the alteration of one or more amino acid residues in the N-terminal region of the CH2 domain will not bind significantly to FcRI.
In a further preferred embodiment the altered antibodies of the invention or for use according to the invention are directed against an MHC class II antigen characterised in that said antibody has been altered at position 235 of the N-terminal region of the CH2 domain.
In a particularly preferred embodiment, the altered antibodies of the invention or for use according to the invention are directed against an MHC class II antigen characterised in that said antibody has been altered at position 235 of the N-terminal region of the CH2 domain and the ability of said antibody to fix complement is altered as compared to unaltered antibody and said altered antibody binds to one or more cellular Fc receptors especially FcRIII and does not bind significantly to FcRI.
In a further aspect the invention provides a method for producing an altered antibody with altered ability to fix complement comprising altering one or more amino acids in the N-terminal region of the CH2 domain of said antibody, altering the ability of said antibody to fix complement as compared with unaltered antibody.
As used herein the term 'altered antibody' is used to denote an antibody which differs from the wild type unaltered antibody at one or more amino acid residues in the N-terminal region of the CH2 domain of the Fc region of the antibody. The alteration may for example comprise the substitution or replacement of the starting wild type antibody amino acid by another amino acid, or the deletion of an amino acid residue.
The residue numbering used herein is according to the Eu index described in Kabat et al [(1991) in: Sequences of Proteins of Immunological Interest, 5th Edition. United States Department of Health and Human Services.]
In human lgG1 and lgG3 antibodies the naturally occurring amino acid at position 235 of the N-terminal region of the CH2 domain is a leucine residue. The alterations at position 235 of replacing leucine by glutamic acid or alanine have been found particularly effective at producing a potent immuno-suppressive antibody with minimal toxicity in vitro and which is tolerated in vivo. The alteration at position 237 of replacing glycine by alanine has been found to produce an antibody with an intermediate ability to fix human complement, i.e. the complement fixation level is approximately 15-80%, preferably 20-60%, most preferably 20-40% of that seen with the starting wild type unaltered antibody.
The residue(s) could similarly be replaced using an analogous process to that described herein, by any other amino acid residue or amino acid derivative, having for example an inappropriate functionality on its side chain. This may be achieved by for example changing the charge and/or polarity of the side chain.
The altered antibodies of the invention may also be produced for example, by deleting residues such as 235, or by, for example, inserting a glycosylation site at a suitable position in the molecule. Such techniques are well known in the art, see for example the teaching of published European patent application EP-307434.
The altered antibodies of the invention may also be produced by exchanging lower hinge regions of antibodies of different isotypes. For example a G1/G2 lower hinge exchange abolished complement fixation and is a further preferred embodiment of the invention. This is described in more detail in the accompanying examples. The G1/G2 lower hinge exchange results in an antibody with altered residues in the 231 to 238 region of the N-terminal region of the CH2 domain wherein one or more residues may be altered and/or deleted.
In a particularly preferred embodiment of the invention the antibody is a human lgG1 antibody directed against an MHC class II antigen.
In a further aspect the invention provides a method of modulating the function of cell surface associated antigens avoiding complement mediated toxicity comprising administering an altered antibody wherein one or more amino acid residues in the N-terminal region of the CH2 domain of said antibody are altered characterised in that the ability of said antibody to fix complement is altered as compared to unaltered antibody.
In a preferred embodiment of this aspect of the invention said altered antibody is able to bind to one or more cellular Fc receptors especially FcRIII while binding to FcRI is significantly reduced. Examples of such cell surface antigens include for example adhesion molecules, T-cell receptor, CD4, CD8, CD3, CD28, CD69, MHC Class I, MHC Class II and CD25.
The invention also includes therapeutic, pharmaceutical and diagnostic compositions comprising the altered antibodies according to the invention and the uses of these products and the compositions in therapy and diagnosis.
Thus in a further aspect the invention provides a therapeutic, pharmaceutical or diagnostic composition comprising an altered antibody according to the invention, in combination with a pharmaceutically acceptable excipient, diluent or carrier.
The invention also provides a process for the preparation of a therapeutic, pharmaceutical or diagnostic composition comprising admixing an altered antibody according to the invention together with a pharmaceutically acceptable excipient, diluent or carrier.
The antibodies and compositions may be for administration in any appropriate form and amount according to the therapy in which they are employed.
The altered antibodies for use in the therapeutic, diagnostic, or pharmaceutical compositions, pr for use in the method of treatment of diseases in which antibody therapy leads to undesirable toxicity due to antibody mediated complement fixation are preferably MHC specific antibodies most preferably specific for MHC Class II antigens, and most preferably have specificity for antigen ic determinants dependent on the
DRα chain.
The therapeutic, pharmaceutical or diagnostic composition may take any suitable form for administration, and, preferably is in a form suitable for parenteral administration e.g. by injection or infusion, for example by bolus injection or continuous infusion. Where the product is for injection or infusion, it may take the form of a suspension, solution or emulsion in an oily or aqueous vehicle and it may contain formulatory agents such as suspending, preservative, stabilising and/or dispersing agents.
Alternatively, the antibody or composition may be in dry form, for reconstitution before use with an appropriate sterile liquid.
If the antibody or composition is suitable for parental administration the formulation may contain, in addition to the active ingredient, additives such as: starch - e.g. potato, maize or wheat starch or cellulose - or starch derivatives such as microcrystalline cellulose; silica; various sugars such as lactose; magnesium carbonate and/or calcium phosphate. It is desirable that, if the formulation is for parental administration it will be well tolerated by the patient's digestive system. To this end, it may be desirable to include in the formulation mucus formers and resins. It may also be desirable to improve tolerance by formulating the antibody or compositions in a capsule which is insoluble in the gastric juices. It may also be preferable to include the antibody or composition in a controlled release formulation.
If the antibody or composition is suitable for rectal administration the formulation may contain a binding and/or lubricating agent, for example polymeric glycols, gelatins, cocoa-butter or other vegetable waxes or fats. The invention also provides methods of therapy and diagnosis comprising administering an effective amount of an altered antibody according to the invention to a human or animal subject.
The antibodies and compositions may be for administration in any appropriate form and amount according to the therapy in which they are employed. The dose at which the antibody is administered depends on the nature of the condition to be treated and on whether the antibody is being. used prophylactically or to treat an existing condition. The dose will also be selected according to the age and conditions of the patient. A therapeutic dose of the antibodies according to the invention may be, for example, preferably between 0.1-25mg/kg body weight per single therapeutic dose and most preferably between 0.1-10mg/kg body weight per single therapeutic dose. immunological diseases which may be treated with the antibodies of the invention include for example joint disease such as ankylosing spondylitis, juvenile rheumatoid arthritis, rheumatoid arthritis; neurological disease such as multiple sclerosis; pancreatic disease such as diabetes, juvenile onset diabetes; gastrointestinal tract disease such as chronic active hepatitis, celiac disease, ulcerative colitis, Crohns disease, pernicious anaemia; skin diseases such as psoriasis; allergic diseases such as asthma and in transplantation related conditions such as graft versus host disease, and allograft rejection. Other diseases include those described in European Patent No. 68790.
The altered antibodies of the invention may also be useful in the treatment of infectious diseases e.g. viral or bacterial infections and in cancer immunotherapy. As used herein the term 'antibody' is used to cover natural antibodies, chimeric antibodies and CDR-grafted or humanised antibodies. Chimeric antibodies are antibodies in which an antigen binding site comprising the complete variable domains of one antibody is linked to constant domains derived from another antibody. Methods for carrying out such chimerisation procedures are described in EP 120694 (Celltech Limited), EP 125023 (Genentech Inc and City of Hope), EP 171496 (Res. Dev. Corp. Japan), EP 173494 (Stanford University) and WO 86/01533 (Celltech Ltd). CDR grafted or humanised antibodies are antibody molecules having an antigen binding site derived from an immunoglobulin from a non-human species and remaining immunoglobulin-derived parts of the molecule being derived from a human immunoglobulin. Procedures for generating CDR-grafted or humanised antibodies are described in WO 91/09967 (Celltech Ltd), WO 90/07861 (Protein Design Labs. Inc) and WO 92/11383 (Celltech Ltd).
In further aspects the invention also includes DNA sequences coding for the altered antibodies according to the invention; cloning and expression vectors containing the DNA sequences, host cells transformed with the DNA sequences and processes for producing the altered antibodies according to the invention comprising expressing the DNA sequences in the transformed host cells.
According to a further aspect of the invention there is provided a process for producing an altered antibody of the invention which process comprises: a. producing in an expression vector an operon having a DNA sequence which encodes an antibody heavy or light chain.
b. producing in an expression vector an operon having a DNA sequence which encodes a complementary antibody light or heavy chain.
c. transfecting a host cell with both operons, and
d. culturing the transfected cell line to produce the antibody molecule wherein at least one of the expression vectors contains a DNA sequence encoding an antibody heavy chain in which one or more amino acid residues in the N-terminal region of the CH2 domain of said antibody has been altered from that in the corresponding unaltered antibody.
As will be readily apparent to one skilled in the art, the alteration in the N-terminal region of the CH2 domain may be made using techniques such as site directed mutagenesis after the whole altered antibody has been expressed. To express unaltered antibody the DNA sequences should be expressed following the teaching described above for altered antibody.
The DNA sequences preferably encode a humanised antibody; a CDR-grafted heavy and/or light chain or a chimeric antibody. The cell line may be transfected with two vectors, the first vector containing the operon encoding the light chain-derived polypeptide and the second vector containing the operon encoding the heavy chain derived polypeptide. Preferably the vectors are identical except in so far as the coding sequences and selectable markers are concerned so as to ensure as far as possible that each polypeptide chain is equally expressed.
Alternatively, a single vector may be used, the vector including a selectable marker and the operons encoding both light chain- and heavy chain-derived polypeptides.
The general methods by which the vectors may be constructed, transfection methods and culture methods are well known per se. Such methods are shown, for instance, in Maniatis et al, Molecular Cloning, Cold Spring Harbor, New York 1989 and Primrose and Old, Principles of Gene Manipulation, Blackwell, Oxford, 1980.
The altered antibody according to the invention is preferably derived from the anti-MHC antibody L243, which has been deposited at the American
Type Culture Collection, Rockville, Maryland USA under Accession number ATCC HB55, and is most preferably a chimeric or a CDR-grafted derivative thereof. L243 was previously described by Lampson and Levy [J. Immunol. (1980) 125, 293].
The standard techniques of molecular biology may be used to prepare DNA sequences coding for the altered antibodies according to the invention. Desired DNA sequences may be synthesised completely or in part using oligonucleotide synthesis techniques. Site-directed mutagenesis and polymerase chain reaction (PCR) techniques may be used as appropriate. See for example "PCR Technology Principles and Applications for DNA Amplification" (1989), Ed. H. A. Eriich, Stockton Press, N.Y. London. For example, oligonucleotide directed synthesis as described by Jones et al [Nature, 321 , 522 (1986)] may be used. Also oligonucleotide directed mutagenesis may be used as described by Kramer et al [Nucleic Acid Res. 12 9441 (1984)].
Any suitable host cell/vector system may be used for the expression of the DNA sequences coding for the altered antibody. Bacterial e.g. E.coli and other microbial systems may be used. Eucaryotic e.g. mammalian host cell expression systems may also be used such as for example COS cells and CHO cells [Bebbington, C R (1991) Methods 2, 136-145], and myeloma or hybridoma cell lines [Bebbington, C R et al (1992) Bio/Technology 10, 169-175].
Where the altered antibody is derived from L243 CHO based expression systems are preferably used.
Assays for determining FcRIII binding indirectly via ADCC assays and for determining complement fixation and C1q binding are well known in the art, and are described in detail in the following examples.
Immune function/immunosuppression by antibodies may be assayed using techniques well known in the art including for example: Mixed Lymphocyte Responses and T-cell antigen recall responses to Tetanus Toxoid. These assays are described in detail in the following examples. The invention is illustrated in the following non-limiting examples and with reference to the following figures in which:
Figure 1 shows: a map of plasmid pMR15.1
Figure 2 shows: a map of plasmid pMR14
Figure 3 shows: the nucieotide sequence and predicted amino acid sequence of L243 heavy chain
Figure 4 shows: the nucieotide and amino acid sequences of
(a) clone 43, (b) clone 183 (c) clone 192
Figure 5 shows: the nucieotide sequence and predicted amino acid sequence of L243 light chain
Figure 6 shows: a map of plasmid pGamma 1
Figure 7 shows: a map of plasmid pGamma 2
Figure 8 shows: the nucieotide sequence of hinge and CH2 region of human C-gamma 1
Figure 9 shows: Antigen binding potency of L243 human isotype series
Figure imgf000018_0002
Figure imgf000018_0001
Figure 10 shows: FcRI binding of L243 isotype series
Figure imgf000018_0003
Figure imgf000018_0004
Figure 11 shows: human complement fixation by L243 isotype series e
Figure imgf000018_0005
Figure imgf000018_0006
Figure 12 shows: binding of human Clq to L243 human isotype series
Figure imgf000018_0008
Figure imgf000018_0007
Figure 13 shows: human complement fixation by L243 isotype
Figure imgf000019_0002
Figure imgf000019_0001
Figure 14 shows: guinea pig complement fixation by L243 isotype
Figure imgf000019_0003
Figure imgf000019_0004
Figure 15 shows: rabbit complement fixation by L243 isotype
Figure imgf000019_0005
Figure imgf000019_0006
Figure 16 shows: FcRIII binding of L243 isotype series by ADCC
Figure imgf000019_0007
Figure imgf000019_0008
Figure 17 shows: L243 Isotype Series Inhibition of TT recall response
Figure imgf000019_0009
Figure 18 shows: L243 Isotype Series Inhibition of TT recall response
Figure imgf000019_0011
Figure imgf000019_0010
Figure 19 shows: L243 Isotype Series Inhibition of Mixed Lymphocyte
Reaction.
Figure imgf000019_0013
Figure imgf000019_0012
Figure imgf000020_0001
Figure 20 shows: L243 Isotype Series Inhibition of TT response
Figure imgf000020_0002
Figure 21 shows: L243 Isotype Series Inhibition of Mixed Lymphocyte
Reaction
Figure imgf000020_0003
Figure 22 shows: the nucieotide and amino acid sequence of VI region in
L243-gL1
Figure 23 shows: shows the nucieotide and amino acid sequence of VI region of
L243-gL2
Figure 24 shows: the nucieotide and amino acid sequence of Vh region of L243-gH
Figure 25 shows: a graph of the results of a competition assay for L243 grafts vs FITC-chimeric L243
Figure imgf000020_0004
Figure 26 shows: a graph of a Scatchard analysis for L243 gamma 4
Figure imgf000020_0005
Figure 27 shows: a graph of FcRIII binding of chimeric, grafted and
grafted [L235E] L243 as measured by ADCC
Figure imgf000020_0006
Figure imgf000021_0001
Figure 28 shows: a graph of immunosuppressive activity of CDR grafted
L243 measured by MLR
Figure imgf000021_0002
Figure 29 shows: a graph of CDR grafted L243 and grafted [L235E]
L243 TT recall response
Figure imgf000021_0003
Figure 30 shows: a graph of complement mediated cytotoxic potency of
CDR grafted L243 and CDR grafted [L235E] L243
Figure imgf000021_0004
DETAILED DESCRIPTION OF SPECIFIC EMBODIMENTS OF THE INVENTION EXAMPLES
Example 1
Gene Cloning and Expression
RNA preparation from L243 hybridoma cells
Total RNA was prepared from 3 × 10exp7 L243 hybridoma cells as described below. Cells were washed in physiological saline and dissolved in RNAzol (0.2ml per 10exp6 cells). Chloroform (0.2ml per 2ml homogenate) was added, the mixture shaken vigorously for 15 seconds and then left on ice for 15 minutes. The resulting aqueous and organic phases were separated by centrifugation for 15 minutes in an Eppendorf centrifuge and RNA precipitated from the aqueous phase by the addition of an equal volume of isopropanol. After 15 minutes on ice, the RNA was pelleted by centrifugation, washed with 70% ethanol, dried and dissolved in sterile, RNAase free water. The yield of RNA was 350 μg.
Amino acid sequence of the L243 light chain.
The sequence of the first nine amino acids of the mature L243 light chain was determined to be NH2-DIQMTQSPAS.
PCR cloning of L243 Vh and VI
The cDNA genes for the variable regions of L243 heavy and light chains were synthesised using reverse transcriptase to produce single stranded cDNA copies of the mRNA present in the total RNA, followed by Polymerase Chain Reaction (PCR) on the cDNAs with specific oligonucleotide primers. a) cDNA synthesis
cDNA was synthesised in a 20μl reaction containing the following reagents: 50mM Tris-HCI PH8.3, 75mM KCI, 10mM dithiothreitol, 3mM MgC.2, 0.5mM each deoxyribonucleoside triphosphates, 20 units RNAsin, 75ng random hexanucleotide primer, 2μg L243 RNA and 200 units Moloney Murine Leukemia Virus reverse transcriptase. After incubation at 42°C for 60 min the reaction was terminated by heating at 95°C for 5 minutes. b) PCR
Aliquots of the cDNA were subjected to PCR using combinations of primers for the heavy and light chains. The nucieotide sequences of the 5' primers for the heavy and light chains are shown in Tables 1 and 2 respectively. These sequences, ail of which contain a restriction site starting 6 nucleotides from their 5' ends, followed by the sequence GCCGCCACC to allow optimal translation of the resulting mRNAs, an initiator codon and a further 20 - 30 nucleotides, are a compilation based on the leader peptide sequences of known mouse antibodies [Kabat et al (1991 ) in Sequences of Proteins of Immunological Interest, 5th Edition - United States Department of Health and Human Services].
The 3' primers are shown in Table 3. The light chain primer spans the V - C junction of the antibody and contains a restriction site for the enzyme Spl1 to facilitate cloning of the VI PCR fragment. The heavy chain 3' primers are a mixture designed to span the J - C junction of the antibody. The first 23 nucleotides are identical to those found at the start of human C - gamma 1 , 2, 3 and 4 genes and include the Apa1 restriction site common to these human isotypes. The 3' region of the primers contain a mixed sequence based on those found in known mouse antibodies [Kabat E A, Wu, T.T.; Perry H M, Gottesman K S, and Foeller L; In: Sequences of
Proteins of Immunological Interest, 5th Edition, US Department of Health and Human Services (1991)].
The combinations of primers described above enables the PCR products for Vh and VI to be cloned directly into the appropriate expression vector (see below) to produce chimeric (mouse - human) heavy and light chains and for these genes to be expressed in mammalian cells to produce chimeric antibodies of the desired isotype.
Incubations (20 μl) for the PCR were set up as follows. Each reaction contained 10 mM Tris-HCI pH 8.3, 1.5 mM MgCtø, 50 mM KCI, 0.01% w/v gelatin, 0.25 mM each deoxyribonucleoside triphosphate, 1 - 6 pmoles 5' primer mix (Table 4), 6 pmoles 3' primer, 1 μl cDNA and 0.25 units Taq polymerase. Reactions were incubated at 95°C for 5 minutes and then cycled through 94°C for 1 minute, 55°C for 1 minute and 72°C for 1 minute. After 30 cycles, aliquots of each reaction were analysed by electrophoresis on an agarose gel. Reactions containing 5' primer mixes B1 , B2, B3 and B5 produced bands with sizes consistent with full length VI fragments while reaction B9 produced a fragment with a size expected of a Vh gene. The band produced by the B1 primers was not followed up as previous results had shown that this band corresponds to a light chain pseudogene produced by the hybridoma cell. c) Molecular cloning of the PCR fragments
DNA fragments produced in reactions B2, B3 and B5 were digested with the enzymes BstB1 and Spl1, concentrated by ethanol precipitation, electrophoresed on a 1.4 % agarose gel and DNA bands in the range of 400 base pairs recovered. These were cloned by ligation into the vector pMR15.1 (Figure 1) that had been restricted with BstB1 and Spl1 . After ligation, mixtures were transformed into E. coli LM1035 and plasmids from the resulting bacterial colonies screened for inserts by digestion with BstB1 and Spl1. Representatives with inserts from each ligation were analysed further by nucieotide sequencing.
In a similar manner, the DNA fragments produced in reaction B9 and digested with HindIII and Apa1 were cloned into the vector pMR14 (Figure 2) that had been restricted with HindIII and Apa1.
Again, representative plasmids containing inserts were analysed by nucieotide sequencing. d) Nucleotide sequence analysis
Plasmid DNA (pE1701 and pE1702) from two isolates containing Vh inserts from reaction B9 was sequenced using the primers R1053 (which primes in the 3' region of the HCMV promoter in pMR14) and R720 (which primes in the 5' region of human C - gamma 4 and allows sequencing through the DNA insert on pMR14). The determined nucieotide sequence and predicted amino acid sequence of L243 Vh in pE1702 is given in Figure 3. The nucieotide sequence for the Vh insert in pE1701 was found to be identical to that in pE1702 except at nucieotide 20 (A in pE1701) and nucieotide 426 (A in pE1701). These two differences are in the signal peptide and J regions of Vh respectively and indicate that the two clones examined are independent isolates arising from the use of different primers from the mixture of oligonucleotides during the PCR stage.
To analyse the light chain clones, sequence derived from priming with R1053 was examined. The nucleotide sequence and predicted amino acid sequence of the VI genes arising from reactions B2 (clone 183), B3 (clone 43 and B5 (clone 192) are shown in Figure 4. Comparison of the predicted protein sequences shows the following: i) clones 182, 183, 43 and 45 all code for a VI gene which, when the signal peptide is removed, produces a light chain whose sequence is identical to that determined by amino acid sequence analysis for L243 light chain (see above). ii) clones 182 and 183 contain a VI gene that codes for a signal peptide of 20 amino acids, while the VI gene in clones 43 and 45 results from priming with a different set of oligonucleotides and has a leader sequence of only 15 amino acids. iii) Clone 192 does not code for L243 VI. Instead, examination of the database of antibody sequences [Kabat, 1991] indicates that clone 192 contains the VI gene for MOPC21, a light chain synthesised by the NS1 myeloma fusion partner used in the production of the L243 hybridoma. iv) Clones 182 and 183 are identical except at nucleotide 26 (T in clone 182, C in clone 183). This difference can be accounted for by the use of different primers in the PCR and indicates that clones 182 and 183 are independent isolates of the same gene.
The nucieotide sequence and predicted amino acid sequence of the complete VI gene from clone 183 is shown in Figure 5.
Construction of human gamma 1 and gamma 2 isotypes.
The L243 Vh gene was subcloned on a HindIII - Apal fragment into pGamma 1 and pGamma 2, vectors containing the human C - gamma 1 and C - gamma 2 genes respectively (Figures 6 and 7). Human Isotype mutants
PCR mutagenesis was used to change residue 235 in human C - gammal contained in the vector pGamma 1 from leucine to either glutamic acid or to alanine and to change residue 237 from glycine to alanine. The lower hinge region of human C-gamma 1 was also replaced by the corresponding region of human C-gamma 2. The following oligonucleotides were used to effect these changes: i) L235E change
R4911 5' GCACCTGAACTCGAGGGGGGACCGTCAGTC3'
R4910 5'CCCCCCTCGAGTTCAGGTGCTGAGGAAG3'
II) L235A change
R5081 5'GCACCTGAACTCGCAGGGGGACCGTCAGTC3'
R5082 5'GACTGACGGTCCCCCTGCGAGTTCAGGTGC3'
III) G237A change
R5088 5'GCACCTGAACTCCTGGGTGCACCGTCAGTC3'
R5087 5'GACTGACGGTGCACCCAGGAGTTCAGGTGC3'
IV) Exchange of lower hinge regions
R4909 5'GCACCTCCAGTGGCAGGACCGTCAGTCTTCCTC3' R4908 5'CGGTCCTGCCACTGGAGGTGCTGAGGAAGAG3'
Other oligonucleotides used in the PCR mutagenesis are:
R4732 5'CAGCTCGGACACCTTCTCTCCTCC3'
R4912 5'CCACCACCACGCATGTGACC3'
R4732 and R4912 prime between nucleotides 834 and 858 and between nucleotides 1156 and 1137 respectively in human C - gamma 1 (Figure 8).
The general strategy for the PCR mutagenesis was as follows. For each amino acid change, two rounds of PCR were used to generate DNA fragments containing the required substitutions. These fragments were then restricted with the enzymes Bgl II and Sty1 and used to replace the corresponding fragments containing the wild type sequence in the pGamma 1 vector, (Figure 6). For the first round PCR, reactions (20 μl) were prepared containing the following reagents : 10 mM Tris - HCl pH 8.3, 1.5 mM MgCI2, 50 mM KCl, 0.01% gelatin, 0.25 mM each deoxyribonucleoside triphosphate, 50 ng pGamma 1 DNA, 0.4 unit Taq polymerase and 6 pmoles of each of the primer. The following combinations of primers were used:
R4911 / R4912,
R4910 / R4732,
R5081 / R4912,
R5082 / R4732,
R5088 / R4912,
R5087 / R4732,
R4909 / R4912,
R4908 / R4732. After 30 cycles through 94°C for 1 minute, 55°C for 1 minute and 72°C for 1 minute, the reactions were extracted with chloroform, the newly synthesised DNA precipitated with ethanol, dissolved in water and electrophoresed on a 1.4 % agarose gel. Gel slices containing the DNA fragments were excised from the gel, the DNA recovered from the agarose using a "Mermaid"™ kit (from Stratech Scientific Ltd., Luton, England) and eluted into 20μl sterile water.
Second round PCR was in a 100 μl reaction containing 10 mM Tris - HCl pH 8.3, 1.5 mM MgCI2, 50 mM KCI, 0.01 % gelatin, 0.25 mM each deoxyribonucleoside triphosphate, 2 units Taq polymerase, 1/20 of each pair of DNA fragments from the first round reaction and 30 pmoles of each of R4732 and R4912. After 30 cycles, see above, the reactions were extracted with phenol / chloroform (1/1) and precipitated with ethanol. Fragments were digested with Bgl11 and Sty1 , electrophoresed on a 1.4 % agarose gel and DNA bands of 250 base-pairs recovered from gel slices as previously described. These Bgl II - Sty1 fragments were ligated in a 3 - way ligation to the 830 base-pair Sty1 - EcoRI fragment, containing the C - terminal part of the CH2 domain and the entire CH3 domain of human C - gamma 1, and the BgIII - EcoR1 vector fragment from pGammal (see Figure 6). After transformation into LM1035, plasmid minipreps from resulting colonies were screened for the presence of the Bgl II - Sty1 fragment and representatives of each taken for nucieotide sequence analysis. From this, plasmids containing the desired sequence were identified and, for future reference, named as follows : pGammal [L235E] containing glutamic acid at residue 235,
pGammal [L235A] containing alanine at residue 235,
pGammal [G237A] containing alanine at residue 237,
pGammal [g1— >g2] containing the C-gamma 2 lower hinge region.
The above plasmids were each restricted with Hind111 and Apal and the Hind111 - Apal fragment containing L243 Vh inserted to produce the following plasmids: L243Gamma1[L235E]
L243Gamma1[L235A]
L243Gamma1[G237A]
L243Gamma [g1— >g2] a) Production of chimeric L243 antibody
Antibody for biological evaluation was produced by transient expression of the appropriate heavy and light chain pairs after co-transfection into Chinese Hamster Ovary (CHO) cells using calcium phosphate precipitation.
On the day prior to transfection, semi - confluent flasks of CHO-L761 cells were trypsinised, the cells counted and T75 flasks set up each with 10exp7 cells. On the next day, the culture medium was changed 3 hours before transfection. For transfection, the calcium phosphate precipitate was prepared by mixing 1.25 ml of 0.25M CaCI2 containing 50 μg of each of heavy and light chain expression vectors with 1.25 ml of 2×HBS (16.36 gm NaCI, 11.9 gm HEPES and 0.4 gm Na2HPO4 in 1 litre water with the pH adjusted to 7.1 with NaOH) and adding immediately into the medium on the cells. After 3 hours at 37 C in a CO2 incubator, the medium and precipitate were removed and the cells shocked by the addition of 15 ml 15 % glycerol in phosphate buffered saline (PBS) for 1 minute. The glycerol was removed, the cells washed once with PBS and incubated for 48 - 96 hours in 25 ml medium containing 10 mM sodium butyrate. Antibody was purified from the culture medium by binding to and elution from protein A - Sepharose and quantitated using an 1g ELISA (see below). b) ELISA
For the ELISA, Nunc ELISA plates were coated overnight at 4°C with a F(ab)2 fragment of a polyclonal goat anti-human Fc fragment specific antibody (Jackson Immuno-research, code 109-006-098) at 5 μg/ml in coating buffer (15mM sodium carbonate, 35mM sodium hydrogen carbonate, pH6.9). Uncoated antibody was removed by washing 5 times with distilled water. Samples and purified standards to be quantitated were diluted to approximately 1 μg/ml in conjugate buffer (0.1 M Tris-HCI pH7.0, 0.1M NaCl, 0.2% v/v Tween 20, 0,2% w/v Hammersten casein). The samples were titrated in the microtitre wells in 2-fold dilutions to give a final volume of 0.1 ml in each well and the plates incubated at room temperature for 1 hr with shaking. After the first incubation step the plates were washed 10 times with distilled water and then incubated for 1 hr as before with 0.1 ml of a mouse monoclonal anti-human kappa (clone GD12) peroxidase conjugated antibody (The Binding Site, code MP135) at a dilution of 1 in 700 in conjugate buffer. The plate was washed again and substrate solution (0.1 ml) added to each well. Substrate solution contained 150 μl N,N,N,N-tetramethylbeπzidine (10 mg/ml in DMSO), 150 μl hydrogen peroxide (30% solution) in 10 ml 0.1 M sodium acetate/sodium citrate, pH6.0. The plate was developed for 5 -10 minutes until the absorbance at 630nm was approximately 1.0 for the top standard. Absorbance at 630nm was measured using a plate reader and the concentration of the sample determined by comparing the titration curves with those of the standard. TABLE 1
Oligonucleotide primers for the 5' region
of mouse heavy chains.
CH1 : 5'ATGAAATGCAGCTGGGTCAT(G,C)TTCTT3' CH2 : 5'ATGGGATGGAGCT(A,G)TATCAT(C,G)(C, T)TCTT3'
CH3 : 5,ATGAAG(A,T)TGTGGTTAAACTGGGTTTT3'
CH4 : 5'ATG(G,A)ACTTTGGG(T,C)TCAGCTTG(G,A)T3'
CH5 : 5'ATGGACTCCAGGCTCAATTTAGTTTT3'
CH6 : 5'ATGGCTGTC(C,T)T(G,A)G(G,C)GCT(G,A)CTCTTCTG3' CH7 : 5'ATGG(G,A)ATGGAGC(G,T) GG(G,A)TCTTT(A,C)TCTT3,
CH8 : 5'ATGAGAGTGCTGATTCTTTTGTGS'
CH9 : 5'ATGG(C,A)TTGGGTGTGGA(A,C)CTTGCTATT3'
CH10 : 5'ATGGGCAGACTTACATTCTCATTCCT3'
CH11 : 5'ATGGATTTTGGGCTGATTTTTTTTATTG3" CH12 : 5'ATGATGGTGTTAAGTCTTCTGTACCT3'
Each of the above primers has the sequence
5'GCGCGCAAGCTTGCCGCCACC3' added to its 5' end. TABLE 2
Oligonucleotide primers for the 5' region of
mouse light chains.
CL1 : 5ΑTGAAGTTGCCTGTTAGGCTGTTGGTGCT3' CL2 : 5'ATGGAG(T,A)CAGACACACTCCTG(T,C)TATGGGT3'
CL3 : 5ΑTGAGTGTGCTCACTCAGGTCCT3'
CL4 : 5,ATGAGG(G,A)CCCCTGCTCAG(A,T)TT(C,T)TTGG3'
CL5 : 57.TGGATTT(T,A)CAGGTGCAGATT(T,A)TCAGCTT3'
CL6 : 5'ATGAGGT(T,G)C(T,C)(T,C)TG(T,C)T(G,C)AG(T,C)T(T,C)CTG
(A,G)G3'
CL7 : 5'ATGGGC(T,A)TCAAGATGGAGTCACA3'
CL8 : 5,ATGTGGGGA(T,C)CT(G,T)TTT(T,C)C(A,C)(A,C)TTTTTCA
AT3'
CL9 : 5,ATGGT(G,A)TCC(T,A)CA(G,C)CTCAGTTCCTT3, CL10 : 5'ATGTATATATGTTTGTTGTCTATTTC3' CL11 : 5'ATGGAAGCCCCAGCTCAGCTTCTCTT3'
Each of the above primers has the sequence
5'GGACTGTTCGAAGCCGCCACC3' added to its 5' end. TABLE 3
Oligonucleotide primers for the 3' ends
of mouse Vh and VI genes.
Light chain ( CL12 ) :
5'GGATACAGTTGGTGCAGCATCCGTACGTTT3'
Heavy chain ( R2155 ):
5'GCAGATGGGCCCTTCGTTGAGGCTG(A,C)(A,G)GAGAC(G,T,A)GTGA3'
TABLE 4
5' Primer mixtures for PCR
B1 : CL2.
B2 : CL6.
B3 : CL8.
B4 : CL4, CL9.
B5 : CL1, CL3, CL5.CL7, CL10, CL11.
B6 : CH6.
B7 : CH7.
B8 : CH2, CH4.
B9 : CH1 , CH3, CH5, CH8, CH9, CH10, CH11 , CH12. Example 2
Biological properties of engineered L243
The aim of the following experiments was to separate the immunosuppressive effects of anti-MHC-II antibodies from possible toxic consequences of their use. In the process we hope to demonstrate which Fc effector functions are necessary for immunosuppression.
ANTIGEN BINDING POTENCY BY INHIBITION ASSAY
The principle of this experiment is that antibodies that have the same binding will compete equally well with a labelled antibody for their cognate antigen. Any changes in the antigen binding potency of the engineered L243 antibodies will be revealed in this system.
Murine L243 (lgG2a) was labelled with fluorescein (FITC) using standard, techniques. All dilutions, manipulations and incubations were done in
Phosphate Buffered Saline (Gibco UK) containing 0.1% Sodium Azide
(BDH UK) and 5% Foetal Calf Serum (Sigma UK). Serial dilutions of engineered antibodies in 100μl in RB polystyrene tubes (2052 12×75mm
Falcon UK) were premixed with a constant amount in 100μl (at a previously determined optimal concentration) of the labelled antibody on 5×104 indicator cells (JY B lymphoblastoid cell line bearing high levels of HLA- DR). Cells and antibody were incubated together at 4°C for 30m in, washed twice and binding revealed using a Fluorescence Activated Cell
Scanner (FACS Becton Dickinson). After appropriate analysis, median fluorescence intensity is plotted against antibody concentration.
Results
As expected, none of the changes in the Fc portion of the molecule affected antigen binding ability (Figure 9).
ASSESSMENT OF FCγ RI BINDING.
The ability of the engineered variants of L243 to bind to FcgRI was measured. The principle of this experiment is that antibodies will bind to cells through Fc receptors and the affinity of this interaction is determined by the subclass and hence the structure of the Fc of the antibody. The assay is based on the ability of the engineered antibodies to compete for binding with FITC labelled murine lgG2a to I FNγ stimulated U937 cells.
U937 (myelomonocytic) cells, when incubated with 500μ/ml IFNγ (Genzyme UK) for 24 hours, expresses high levels of FcgRI, as assessed by CD64 binding and monomeric lgG2a binding, low levels of FcγRII and no FcγRIII.
U937 cells are washed extensively in DMEM containing 25mM HEPES (Gibco UK), incubated for 2 hours at 37°C in RPMI 1640 (Gibco UK) and then washed again in DMEM containing 25mM HEPES (Gibco UK) to remove bovine IgG bound to Fc receptors. Serial dilutions of engineered antibodies were prepared in 50μl in Phosphate Buffered Saline (Gibco UK) containing 0.1% sodium azide in V-bottom 96 well microtitre plates' (ICN/Flow UK) and were incubated with 5x104 U937 cells in 50μl for 30min at 4°C. 50μl of FITC labelled lgG2a antibody was then added to all wells, at a previously determined optimal concentration, for a further 90min at
4°C. Cells were washed once in the microtitre tray, transferred to RB polystyrene tubes (2052 12×75mm Falcon UK) washed once again and binding was revealed using a Fluorescence Activated Cell Scanner (FACS
Becton Dickinson). After appropriate analysis, median fluorescence intensity is plotted against antibody concentration.
Results
Changes in the N-terminal region of the CH2 domain of lgG1 had profound effects on binding to FcRI (Figure 10). As expected, wild type lgG1 bound well to FcRI, lgG4 about 10 times less well and lgG2 did not bind at all. We have confirmed that the Leu 235 to Glu change in human lgG4 reduced its low FcRI binding to nothing and that the same change in lgG1 completely abolishes FcRI binding. Ala at 235 reduced (by about 100 fold) but did not ablate FcRI binding. Changing Gly 237 to Ala of lgG1 also abolished FcRI as did exchanging the whole region 233 to 236, with the sequence found in human lgG2. The G1[K320A] change had no effect on FcRI binding. ANTIBODY DEPENDENT COMPLEMENT
MEDIATED CYTOTOXICITY.
The ability of the engineered variants of L243 to fix human complement was assessed using the technique of antibody dependent complement mediated cytotoxicity.
The principle of the experiment is that antibodies will mediate complement lysis of target cells bearing their cognate antigen if the Fc of the antibody is able to interact with the components of the (usually classical) complement cascade. The critical interaction is with the C1q molecule.
The source of complement in these experiments is human venous blood freshly drawn into endotoxin free glass bottles which is then allowed to clot at 37°C for 1 hour. The clot is detached from the glass and then incubated at 4°C for 2 hours to allow it to retract. The clot is then removed and the serum separated from the remaining red cells by centrifugation at 1000g. Once prepared, the serum can be stored for up to one month at -20°C without noticeable deterioration of potency but is best used fresh.
All manipulations, dilutions and incubations are done in RPMI 1640 medium (Gibco UK) containing 2mM Glutamine (Gibco UK) and 10% foetal calf serum (Sigma UK). Target cells (JY B lymphoblastoid cell line bearing high levels of HLA-DR) are labelled with 1mCi Na51Cr for 1 hour at room temperature, agitated every 15 min. The cells are then washed three times, to remove free radiolabel, and resuspended at 2×106/ml. Serial antibody dilutions are prepared in duplicate in V-bottom 96 well microtitre plates (ICN/Flow UK) in 25μl. Control wells containing medium only are also prepared to establish the spontaneous release of label giving the assay background. Target 51Cr labelled JY cells are added to all wells in 10μl. The same number of JY cells are also added to wells containing 2% Triton ×100 in water to establish the 100% release value. Target cells and antibody are incubated together and, after 1 hour at room temperature, 25μl serum as a source of complement is added to all wells (except the 100%) for a further 1 hour at room temperature. 100μl of EDTA saline at 4°C is then added to stop any further cell killing, the microtitre plates are centrifuged at 200g to pellet the intact cells and 100μl supernatant is removed and counted in a gamma counter.
Percent cell lysis is calculated by subtracting the background from all values and then expressing them as a percentage of the adjusted maximum release. Replicates vary by less than 5%. Percent cell lysis is then plotted against antibody dilution.
Results
The ability of L243 to fix human complement was not affected by all the changes made in the N-terminal region of the CH2 domain, residues 233 to 237 (Figure 11). Wild type lgG1 mediated potent killing with 600ng/ml giving half maximum cell killing (64% maximum). lgG2 and lgG4 caused no cell killing even at 20μg/ml. The Gly to Ala at 237 gave an intermediate level killing (20% maximum killing at 2μg/ml). Exchanging the whole lower hinge region with the sequence found in human lgG2 failed to cause lysis even at 20μg/ml. Changes at 235 in lgG1 had unexpectedly profound effects on human complement fixation. Changing the Leu 235 to Glu abolished complement lysis (no killing at 20μg/ml). Ala at 235 permitted low levels of killing. In contrast, a change in the previously described C1q binding motif [Duncan A R and Winter G (1998), Nature, 332, 21.], from Lys to Ala at 320 effected no change from the lgG1 wild type killing (70% maximum cell killing and half the cells dead with 600ng/ml). DIRECT BINDING OF C1q
Measurement of the direct binding of human C1q to different engineered variants of L243 was established to confirm that complement mediated cytotoxicity was due to activation of the classical pathway. Purified human C1q (Sigma UK) was directly labelled with fluorescein isothiocyanate (FITC Sigma) using conventional methods. All dilutions, manipulations and incubations were done in Phosphate Buffered Saline (Gibco UK) containing 0.1% Sodium Azide (BDH UK) and 5% Foetal Calf Serum (Sigma UK). 5×104 indicator cells (JY B lymphoblastoid cell line bearing high levels of HLA-DR) were coated with the different engineered antibodies by incubating at saturating concentrations for 1 hour at 4°C in RB polystyrene tubes (2052 12x75mm Falcon UK). After washing, serial dilutions of FITC labelled C1q in 100μl were added and were incubated together for a further 30 min at 4°C. After washing, binding of C1q was revealed using a Fluorescence Activated Cell Scanner (FACS Becton Dickinson). After appropriate analysis, median fluorescence intensity is plotted against C1q concentration.
Results
Direct binding of human C1q to the L243 human isotype series confirmed the results with complement mediated cytotoxicity (Figure 12). Labelled human C1q bound well to wild type lgG1 , when bound to JY cells, and bound poorly to lgG4. Equilibrium dissociation constants were determined essentially as described by Krause et al. [Behring Inst. Mitt. SZ 56 (1990)] and were 1.2 ×10- 7M and 1.5 ×10-8M for lgG4 and lgG1 respectively. These values compare favourably with those obtained for the mouse antibodies lgG1 and lgG2a which have similar functions [Leatherbarrow and Dwek (1984), Molec. Immunol. 21, 321]. The Leu 235 to Glu change in lgG1 reduced the binding of C1q to the same level as lgG4. In contrast, a change in the previously described C1q binding motif [Duncan A R and Winter G (1988) Nature 332, 21], from Lys to Ala at 320 had no effect on
C1q binding. The Leu 235 to Glu change in lgG4 did not alter wild type binding.
Rabbit and Guinea Pig complement
The G1[L235E] and G1[L235A] modifications behaved differently when rabbit or guinea pig serum was used as a source of complement instead of human. With rabbit C they caused the same level of lysis as the wild type G1. With guinea pig they caused 40% and 49% plateau level killing, respectively, compared with 80% killing by the lgG1 wild type. The 235 change only affects human complement binding indicating that rabbit and guinea pig complement interact differently with human lgG1 (see Figures 13-15).
ANTIBODY DEPENDENT CELL MEDIATED CYTOTOXICITY.
The ability of the engineered variants of L243 to bind to FcgRIII was assessed using antibody dependent cell mediated cytotoxicity (ADCC). The principle of the experiment is that antibodies will mediate lysis of target cells bearing their cognate antigen if the Fc of the antibody is able to interact with Fc receptor bearing effector cells capable of cytotoxicity. The critical interaction is between antibody Fc and cellular Fc receptors.
Effector cells are prepared fresh for each experiment. Human venous blood is drawn into endotoxin free tubes containing heparin. Peripheral blood mononuclear cells (PBMC) are prepared by density gradient centrifugation according to the manufacturers instructions (Pharmacia). PBMC are adjusted to 1×107 cells/ml in RPMI 1640 medium (Gibco UK) containing 2mM Glutamine (Gibco UK) and 10% foetal calf serum (Sigma UK), in which all manipulations, dilutions and incubations are done. Target cells (JY B lymphoblastoid cell line bearing high levels of HLA-DR) are labelled with 1mCi Na51Cr for 1 hour at room temperature, agitated every 15 min. The cells are then washed three times, to remove free radiolabel, and resuspended at 2×106/ml. Serial antibody dilutions are prepared in duplicate in sterile U-bottom 96 well microtitre plates (Falcon UK) in 25μl. Control wells containing medium only are also prepared to establish the spontaneous release of label giving the assay background. Target 51Cr labelled JY cells are added to all wells in 10μl. The same number of JY cells are also added to wells containing 2% Triton x100 in water to establish the 100% release value. Target cells and antibody are incubated together and, after 30min at room temperature, 25μl effector cells are added to all wells (except the 100%) for a further 4 hours at 37°C. 100μl of EDTA saline at 4°C is then added to stop any further cell killing, the microtitre plates are centrifuged at 200g to pellet the intact cells and 100μl supernatant is removed and counted in a gamma counter.
Percent cell lysis is calculated by subtracting the background from all values and then expressing them as a percentage of the adjusted maximum release. Replicates vary by less than 5%. Percent cell lysis is then plotted against antibody dilution. Results
Not all the changes made in the N-terminal region of the CH2 domain, residues 233 to 237, affected FcRIII mediated function (Figure 16 and Tables 5 and 7). L243 lgG2 was unable to mediate peripheral blood mononuclear cell cytotoxicity (ADCC) of HLA-DR positive JY lymphoblastoid cells at concentrations up to 100γ/ml. lgG4 caused a low level of ADCC (20% maximum killing at 1γ/ml) which could be abrogated by the Leu 235 to Glu change. Wild type lgG1 was a potent mediator of cell killing giving 50% cell death at 5ng/ml antibody. Gly to Ala at 237 reduced the igG1 wild type killing to the level seen with lgG4. Exchanging the whole lower hinge region with the sequence found in human lgG2 gave intermediate levels of killing with 500ng/ml needed for 50% cell death. In contrast, changes at 235 in lgG1 had minimal effect on ADCC. Changing the Leu 235 to Ala gave levels of killing comparable with the G1 wild type (9ng/ml for 50% cell death)) and changing the Leu 235 to Glu reduced ADCC a little (40ng/ml for 50% cell death). A change in the previously described C1q binding motif, from Lys to Ala at 320 had no effect on the ability of lgG1 to mediate ADCC.
IMMUNE FUNCTION
Ex vivo T cell function experiments were performed where an interaction between MHC-II and the T cell receptor was an obligatory requirement for T cell activation. The L243 isotype series was tested in mixed lymphocyte reactions, which measures both naive and memory T cell activation, and recall responses to tetanus toxoid which only measures a memory T cell response.
Mixed Lymphocyte Reaction.
The immunosuppressive potency of engineered variants of L243 was assessed using a mixed lymphocyte reaction.
The principle of the experiment is that when leucocytes from one individual are mixed with those of another which express different HLA alleles, they will recognise each other as foreign and will become activated. This activation is dependent, primarily, on interactions between the CD3/TcR complex on T cells and the MHC-II molecule on antigen presenting cells. Antibodies that bind to MHC-II are known to inhibit this reaction.
Leucocytes are prepared fresh for each experiment. Human venous blood from two individuals is drawn into endotoxin free tubes containing heparin. Peripheral blood mononuclear cells (PBMC) are prepared by density gradient centrifugation according to the manufacturers instructions (Pharmacia). PBMC are adjusted to 2×106 cells/ml in RPM1 1640 medium (Gibco UK) containing 2mM Glutamine (Gibco UK), 100μ/ml/100μg/ml Penicillin/ Streptomycin (Gibco) and 10% foetal calf serum (Sigma UK), in which all manipulations, dilutions and incubations are done. PBMC from one individual are irradiated with 3000 rads. These cells will be stimulate a response from the other individual. Serial antibody dilutions are prepared in triplicate in sterile U-bottom 96 well microtitre plates (Falcon UK) in 100μl. Control wells containing medium only and optimal Cyclosporin (Sandimmun®, Sandoz) levels (100nM) are also prepared to establish the maximum response and maximum inhibition, respectively. Equal numbers of irradiated stimulators and responders are mixed together and 100μl are added to each well. Wells of stimulator alone and responders alone are also set up as controls. The experiment is incubated at 37°C in 100% humidity and 5%CO2 for 5 days. Response is measured by assessing proliferation during the last 18 hours of culture by incubation with 1μCi/well 3H-Thymidine (Amersham UK), harvesting on to glass filter mattes and counting using a beta counter.
Results are plotted as CPM against antibody concentration. Replicates vary by less than 10%. T cell Recall Response to Tetanus Toxoid
The ability of the engineered variants of L243 to suppress a secondary response was assessed using a recall response to Tetanus Toxoid.
The principle of the experiment is that T lymphocytes from an individual previously immunised with Tetanus Toxoid (TT) will respond to TT when re-exposed ex vivo. This activation is dependent on the interaction between the CD3/TcR complex on T ceils and the MHC-II molecule on cells which process and present the antigen. Antibodies that bind to MHC-II are known to inhibit this reaction. Lymphocytes are prepared fresh for each experiment. Human venous blood is drawn into endotoxin free tubes containing heparin. Peripheral blood mononuclear cells (PBMC) are prepared by density gradient centrifugation according to the manufacturers instructions (Pharmacia). PBMC are adjusted to 2×106 cells/ml in RPMI 1640 medium (Gibco UK) containing 2mM Glutamine (Gibco UK), 100μ/ml/100μg/ml Penicillin/ Streptomycin (Gibco) and 10% foetal calf serum (Sigma UK), in which all manipulations, dilutions and incubations are done.
Serial antibody dilutions are prepared in triplicate in sterile U-bottom 96' well microtitre plates (Falcon UK) in 100μl. 50μl containing an optimal concentration of TT, previously determined by experimentation, is added to all wells. Control wells containing medium only or Cyclosporin
(Sandimmun, Sandoz) (100nM) are also prepared to establish the maximum response and maximum inhibition, respectively. 50μl PBMC are then added to each well. The experiment is incubated at 37°C in 100% humidity and 5%C02 for 7 days. Response is measured by assessing proliferation during the last 18 hours of culture by incubation with 1μCi/well
3H-Thymidine, harvesting on to glass filter mattes and counting using a beta counter.
Results are plotted as CPM against antibody concentration. Replicates vary by less than 10%.
Results (Figures 17-21)
There were no significant or qualitative differences between the effects of the L243 human isotype series between the MLR and TT response.
Maximal inhibition was achieved with G1, G1[L235E] and G1[L235A].
Approximately two orders of magnitude more of G2, G4 and G1[G237A] was required to give similar levels of inhibition. The G1/G2 L hinge exchange mutant was intermediate in immuno-suppresser potency, there was no correlation between complement fixation or FcRI binding and immuno-suppression, G1 binding well to FcRI and fixing complement and G1[L235E] doing neither, but both giving good immunosuppression. But, there was good correlation with FcRIII binding. Human G1 and G1[L235E] interact with FcRIII and give good immunosuppression. The G1/G2 L hinge is intermediate in FcRIII binding and immuno-suppression. In contrast, the G237A mutation in human G1, in agreement with published observations, reduces FcRIII binding. This antibody gave poor immunosuppression. (Table 5). Table 6 shows a number of L243 isotype mutants.
Conclusion
We have found that amino acid residues necessary for C1q and FcR binding of human lgG1 are located in the N-terminal region of the CH2 domain, residues 231 to 238, using a matched set of engineered' antibodies based on the anti-HLA DR antibody L243. Changing the leucine 235 in the CH2 region of lgG3 and lgG4 to glutamic acid was already known to abolish FcRI binding, we have confirmed this for lgG1 and also found a concomitant abolition of human complement fixation with retention of FcRIII mediated function. Changing the giycine at 237 to alanine of lgG1 also abolished FcRI binding and reduced complement fixation and FcRIII mediated function. Exchanging the whole region 233 to 236, with the sequence found in human lgG2 abolished FcRI binding and complement fixation and reduced FcRIII mediated function of lgG1. In contrast, a change in the previously described C1q binding motif, from lysine at 320 to alanine had no effect on IgG 1 -mediated complement fixation.
The effect of these changes in lgG1 on FcRI binding are similar to published observations using lgG3 and lgG4 [Lund J et al J. Immunol. 1991. 147, 265; and Alegre M-L et al J. Immunol. 1992. 148, 3461] with changes at 235 and 237 in the lower hinge/N-terminal CH2 region markedly reducing FcRI binding. The similarities between these three isotypes strongly suggests that they interact with FcRI in a similar way. We have found residues necessary for FcRIII binding of human lgG1 within the lower hinge/N-terminal end of the CH2 region. Modification at 237 and exchanging the lower hinge for lgG2 residues caused low and intermediate levels, respectively, of FcRIII mediated killing. These effects are similar to those reported by Sarmay et al [Molec. Immunol. 1992.29, 633] for human lgG3. In contrast to Sarmay et al using lgG3, our changes at residue 235 of lgG1 had little effect on FcRIII binding.
Greenwood et al [Eur. J. Immunol. 1993. 23, 1098], using inter and intra domain switch variants between lgG1 and lgG4, identify residues in lgG1 necessary for FcRIII binding in the C-terminal half of the CH2 domain beyond 292. This indicates that the residues we have identified within the lower hinge/N-terminal end of the CH2 region are necessary but not sufficient for FcRIII effector function mediated through binding of human lgG1. lgG1 variants with changes at 235 failed to mediate lysis with human complement and did not bind purified human C1q. We also found that an lgG1 molecule containing a change at 320 gave complement mediated killing equivalent to the lgG1 wild type. Residues, Glu 318, Lys 320 and Lys 322 were identified by protein engineering studies as necessary in mouse lgG2b for C1q binding [Duncan, A R and Winter G, Nature, 1988. 322, 21]. The same study also demonstrated that the 235 change in mouse lgG2b left unchanged its affinity for human C1q [Duncan, A R and Winter G, Nature, 1988. 322, 21]. The apparent contradiction between these observations is probably due to differences in C1q contacts between human lgG1 and mouse lgG2b.
We found that most changes in the lower hinge/N-terminal end of the CH2 domain affect C1q binding. The G1/G2 lower hinge exchange abolished complement fixation and the change at 237 also reduces it significantly. In contrast, Greenwood et al [Eur. J. Immunol. 1993. 23, 1098], found residues necessary for human complement fixation in the C-terminal half of the CH2 domain. Tao et al [J. exp. Med. 1993. 178. 661] also identify the C-terminal half of the CH2 domain as necessary for complement fixation. They are able to separate C1q binding from complement mediated lysis. lgG1 with a Pro to Ser change at 331, in the C-terminal half of the CH2 domain, is able to bind human C1q as well as the wild type but is unable to activate complement. This predicts that the amino acids that we have identified within the lower hinge/N-terminal end of the CH2 region are necessary for C1q binding and that the C-terminal residues are necessary for the binding and activation of the antibody dependent complement cascade beyond C1q.
TABLE 5 Summary of L-243 Isotype Series
L243 RI RIII C1q MLR TT - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
G2 - - - ++ ++
G4 + - - ++ ++
G1 +++ +++ +++ ++++ ++++
G1L235E - ++± ± +++± +++± G1L235A + +++ + ++++ ++++
G1G237A + + + ++ ++
TABLE 6
Human Isotype Mutants
Gene Residue From To NAME
G1 235 L E G1[L235E]
G1 235 L A G1[L235A]
G1 237 G A G1[G237A]
G1 320 K A G1[K320A]
G4 235 L E G4[L235E]
G1 231-238 APELLGGP AP-PVAGP G1/G2L-hinge
TABLE 7
Summary of L-243 Isotype Series
L243 RIa Rlllb Complement
G2 >10 >100000 >20/0
G4 1.2 10000ex >20/0
G4[L235E] >10 > 100000 >20/0
G1 0.13 5 0.6/65
G1/G2Lh >10 500 >20/0
G1[L235E] >10 40 >20/0
G1[L235A] 5.0 9 >20/0
G1[G237A] >10 10000eX 2.0/20
G1[K320A] 0.1 10 0.6/70
a) mg/ml antibody necessary for 50% inhibition of binding of FITC- labelled mouse lgG2a antibody to U937 cells. b) ng/ml antibody necessary for half maximal cell killing in ADCC. (ex) extrapolated value. c) mg/ml antibody necessary for half maximal cell killing by human complement and percent plateau cell killing. EXAMPLE 3
L243 is a mouse monoclonal antibody raised against human MHC Class II. The nucieotide and amino acid sequences of L243 VI and Vh are shown in Figures 5 and 3 respectively. The following examples describe the humanisation of the L243 antibody (CDR grafting).
CDR grafting of L243 liαht chain
Alignment of the framework regions of L243 light chain with those of the four human light chain subgroups [Kabat, E.A., Wu, T.T., Perry, H.M., Gottesman, K.S. and Foeller, C. 1991 , Sequences of Proteins of Immunological Interest, Fifth Edition] revealed that L243 was most homologous to antibodies in human light chain subgroup 1. Consequently, for constructing the CDR grafted light chain, the framework regions chosen corresponded to those of the human Group 1 consensus sequence. A' comparison of the amino acid sequences of the framework regions of L243 and the consensus human group I light chains is given below and shows that there are 21 differences (underlined) between the two sequences.
Analysis of the contribution that any of these framework differences might have on antigen binding (see published International patent application No. WO91/09967) identified 4 residues for investigation; these are at positions 45,49,70 and 71. Based on this analysis, two versions of the CDR grafted light chain were constructed. In the first of these, L243-gL1 , residues 45,49,70 and 71 are derived from the L243 light chain while in the second, L243-gL2, all residues are human consensus.
Light chain Comparisons
Kl
Figure imgf000048_0001
Figure imgf000049_0001
Construction of CDR grafted light chain L243-gL1
The construction of L243-gL1 is given below in detail. The following oligonucleotides were used in the Polymerase Chain Reactions (PCR) to introduce changes into the framework regions of the chimeric light chain: R5043 : 5 'GTAGGAGACCGGGTCACCATCACATGTCGAGCAAA3 '
R5CH4 : 5 'CTGAGGAGCTTTTCCTGGTTTCTGCTGATACCATGCTAAA3 ' R5045 : 5 'AAACCAGGAAAAGCTCCTCAGCTCCTGATCTTTGCTGCATC3 ' R5046 : 5 'CTTCTGGCTGCAGGCTGGAGATAGTTAGGGTATACTGTGTGCC3 ' R5047 : 5 'CTTCAGCCTGCAGCCAGAAGATTTTGCTACTTATTACTGTCAA3 ' R5048 : 5 'GGGCCGCTACCGTACGTTTTAGTTCCACTTTGGTGCCTTGACCGAA3 '
Three reactions, each of 20 μl, were set up each containing 10 mM Tris- HCI pH 8.3, 1.5 mM MgCI2, 50 mM KCI, 0.01% w/v gelatin, 0.25 mM each deoxyribonucleoside triphosphate, 0.1 μg chimeric L243 light chain DNA , 6 pmoles of R5043/R5044 or R5045/R5046 or R5047/R5048 and 0.25 units Taq polymerase. Reactions were cycled through 94°C for 1 minute, 55°C for 1 minute and 72°C for 1 minute. After 30 cycles, each reaction was analysed by electrophoresis on an agarose gel and the PCR fragments excised from the gel and recovered using a Mermaid Kit.
Aliquots of these were then subjected to a second round of PCR. The reaction, 100 μl, contained 10 mM Tris-HCI pH 8.3, 1.5 mM MgCI2, 50 mM KCI, 0.01% w/v gelatin, 1/10 of each of the three PCR fragments from the first set of reactions, 30 pmoles of R5043 and R5048 and 2.5 units Taq polymerase. Reaction temperatures were as above. After the PCR, the mixture was extracted with phenol / chloroform and then with chloroform and precipitated with ethanol. The ethanol precipitate was recovered by centrifugation, dissolved in the appropriate buffer and restricted with the enzymes BstEII and Spll. The resulting product was finally electrophoresed on an agarose gel and the 270 base pair DNA fragment recovered from a gel slice and ligated into the vector pMR15.1 (Figure 1) that had previously been digested with the same enzymes.
The ligation mixture was used to transform E. coli LM1035 and resulting colonies analysed by PCR, restriction enzyme digests and nucieotide sequencing. The nucieotide and amino acid sequence of the VI region of L243-gL1 is shown in Figure 22.
Construction of CDR grafted light chain L243-gL2
L243-gL2 was constructed from L243-gL1 using PCR. The following oligonucleotides were used to introduce the amino acid changes : R1053 : 5 'GCTGACAGACTAACAGACTGTTCC3 '
R5350 :
5 'TCTAGATGGCACACCATCTGCTAAGTTTGATGCAGCATAGATCAGGAGCTTAGGA
GC3 '
R5349 :
5 'GCAGATGGTGTGCCATCTAGATTCAGTGGCAGTGGATCAGGCACAGACTTTACCC
TAAC3 '
R684 : 5 'TTCAACTGCTCATCAGAT3 '
Two reactions, each 20 μl, were set up each containing 10 mM Tris-HCI pH 8.3, 1.5 mM MgCI2, 50 mM KCI, 0.01% w/v gelatin, 0.25 mM each deoxyribonucleoside triphosphate, 0.1 μg L243-gL1, 6 pmoles of R1053/ R5350 or R5349/R684 and 0.25 units Taq polymerase. Reactions were cycled through 94°C for 1 minute, 55°C for 1 minute and 72°C for 1 minute. After 30 cycles, each reaction was analysed by electrophoresis on an agarose gel and the PCR fragments excised from the gel and recovered using a Mermaid Kit. Aliquots of these were then subjected to a second round of PCR. The reaction, 100 μl, contained 10 mM Tris-HCI pH 8.3, 1.5 mM MgCI2, 50 mM KCI, 0.01% w/v gelatin, 1/5 of each of the PCR fragments from the first set of reactions, 30 pmoles of R1053 and R684 and 2.5 units Taq polymerase. Reaction temperatures were as above. After the PCR, the mixture was extracted with phenol / chloroform and then with chloroform and precipitated with ethanol. The ethanol precipitate was recovered by centrifugation, dissolved in the appropriate buffer and restricted with the enzymes BstEII and Spll. The resulting product was finally electrophoresed on an agarose gel and the 270 base pair DNA fragment recovered from a gel slice and ligated into the vector pMR15.1 (Figure 1) that had previously been digested with the same enzymes.
The ligation mixture was used to transform E. coli LM1035 and resulting colonies analysed by PCR, restriction enzyme digests and nucieotide sequencing. The nucleotide and amino acid sequence of the VI region of L243-gL2 is shown in Figure 23.
CDR grafting of L243 heavy chain
CDR grafting of L243 heavy chain was accomplished using the same strategy as described for the light chain. L243 heavy chain was found to be most homologous to human heavy chains belonging to subgroup 1 and therefore the consensus sequence of the human subgroup 1 frameworks was chosen to accept the L243 heavy chain CDRs.
A comparison of the framework regions of the two structures is shown below where it can be seen that L243 differs from the human consensus at 28 positions (underlined). After analysis of the contribution that any of these might make to antigen binding, only residues 27,67,69,71,72 and 75 were retained in the CDR grafted heavy chain, L243-gH.
Heavy chain comparisons
2
7
Figure imgf000051_0001
Figure imgf000052_0001
Construction of CDR grafted heavy chain. L-243 gH
L243gH was assembled by subjecting overlapping oligonucleotides to PCR in the presence of the appropriate primers. The following oligonucleotides. were used in the PCR: R3004 : 5 'GGGGGGAAGCTTGCCGCCACCATGG3 ' R3005 : 5 'CCCCCCGGGCCCTTTGTAGAAGCAG3 ' R4902 : 5 'GACAACAGGAGTGCACTCTCAGGTGCAGCTGGTGCAGTCTGGAGC
AGAGGTGAAGAAGCCTGGAGCATCTG3 ' R4903 : 5 'ACATTCACAAATTACGGAATGAATTGGGTGAGACAGGCACCTGGA
CAGGGACTCGAGTGGA3 ' R4904 : 5 ' CCTACGTACGCAGACGACTTCAAGGGAAGATTCACATTCACACTG
GAGACATCTGCATCTACAGCATACAT3 ' R4905 : 5 'CAGCAGTGTACTACTGTGCAAGAGACATTACAGCAGTGGTACCTA
CAGGATTCGACTACTGGGGACAGGGA3 ' R4897 : 5 'TGAGAGTGCACTCCTGTTGTCACAGACAGGAAGAACAGGAACACC
CAAGACCACTCCATGGTGGCGGCAAGCTTCCCCCC3 ' R4898 : 5 'CATTCCGTAATTTGTGAATGTGAATCCAGATGCCTTACAAGACAC
CTTCACAGATGCTCCAGGCTTCTTCA3 ' R4899 : 5 'GAAGTCGTCTGCGTACGTAGGCTCTCTTGTGTATGTATTAATCCA
TCCCATCCACTCGAGTCCCTGTCCAG3 ' R4900 : 5 'TTGCACAGTAGTACACTGCTGTGTCCTCAGATCTCAGAGAAGACA GCTCCATGTATGCTGTAGATGCAGAT3 ' R4901 : 5 'CCCCCCGGGCCCTTTGTAGAAGCAGAAGACACTGTCACCAGTGTT
CCCTGTCCCCAGTAGTCGAA3 '
The assembly reaction, 50 μl, contained 10 mM Tris-HCI pH 8.3, 1.5 mM MgCI2, 50 mM KCI, 0.01% w/v gelatin, 0.25 mM each deoxyribonucleoside triphosphate, 1 pmole of each Of R4897 - R4905, 10 pmoles of each of R3004 and R3005 and 2.5 units Taq polymerase. Reactions were cycled through 94 C for 1 minute, 55 C for 1 minute and 72 C for 1 minute. After 30 cycles, the reaction was extracted with phenol/chloroform (1/1), then with chloroform and precipitated with ethanol. After centrifugation, the DNA was dissolved in the appropriate restriction buffer and digested with HindIII and ApaI. The resulting fragment was isolated from an agarose gel and ligated into pMR14 (Figure 2) that had previously been digested with the same enzymes. pMR14 contains the human gamma 4 heavy chain constant region and so the heavy chain expressed from this vector will be a gamma 4 isotype. The ligation mixture was used to transform E. coli LM1035 and resulting bacterial colonies screened by restriction digest and nucieotide sequence analysis. In this way, a plasmid containing the correct sequence for L243gH was identified (Figure 24). Construction of Gamma 1 versions of chimeric and CDR grafted L243 heavy chain
Human Gamma 1 versions of L243 heavy chains were constructed by transferring the variable regions of both the murine and the CDR grafted heavy chains as HindIII to Apal fragments into the vector pGammal (Figure 6). This vector contains the human Gamma 1 heavy chain constant region.
Evaluation of activities of CDR grafted genes
The activities of the CDR grafted genes were evaluated by expressing them in mammalian cells and purifying and quantitating the newly synthesised antibodies. The methodology for this is described next, followed by a description of the biochemical and cell based assays used for the biological characterisation of the antibodies. a) Gene Expression in CHO cells
Chimeric and CDR grafted L243 was produced for biological evaluation by transient expression of heavy and light chain pairs after co-transfection into Chinese Hamster Ovary (CHO) cells using calcium phosphate precipitation as described above for production of chimeric L243. Antibody concentration was determined using a human Ig ELISA (see below). b) ELISA
For the ELISA, Nunc ELISA plates were coated overnight at 4°C with a F(ab)2 fragment of a polyclonal goat anti-human Fc fragment specific antibody (Jackson Immuno-research, code 109-006-098) at 5 μg/ml in coating buffer (15mM sodium carbonate, 35mM sodium hydrogen carbonate, pH6.9). Uncoated antibody was removed by washing 5 times with distilled water. Samples and purified standards to be quantitated were diluted to approximately 1 μg/ml in conjugate buffer (0.1 M Tris-HCl pH7.0, 0.1M NaCI, 0.2% v/v Tween 20, 0,2% w/v Hammersten casein). The samples were titrated in the microtitre wells in 2-fold dilutions to give a final volume of 0.1 ml in each well and the plates incubated at room temperature for 1 hr with shaking. After the first incubation step the plates were washed 10 times with distilled water and then incubated for 1 hr as before with 0.1 ml of a mouse monoclonal anti-human kappa (clone GD12) peroxidase conjugated antibody (The Binding Site, code MP135) at a dilution of 1 in 700 in conjugate buffer. The plate was washed again and substrate solution (0.1 ml) added to each well. Substrate solution contained 150μl N,N,N,N-tetramethylbenzidine (10 mg/ml in DMSO), 150μl hydrogen peroxide (30% solution) in 10 ml 0.1 M sodium acetate/sodium citrate, pH6.0. The plate was developed for 5 -10 minutes until the absorbance at 630nm was approximately 1.0 for the top standard. Absorbance at 630nm was measured using a plate reader and the concentration of the sample determined by comparing the titration curves with those of the standard. c) Competition Assay
The principle of this assay is that if the antigen binding region has been correctly transferred from the murine to human frameworks, then the CDR grafted antibody will compete equally well with a labelled chimeric antibody for binding to human MHC Class II. Any changes in the antigen binding potency will be revealed in this system.
Chimeric L243 was labelled with fluorescein (FITC) using the method of Wood et al [Wood.T., Thompson, S and Goldstein, G 1965, J. Immunol 95, 225-229 and used in the competition assay described above.
Figure 25 compares the ability of combinations of L243 heavy and light chains to compete with FITC-labelled chimeric L243 for binding to JY cells. All combinations were effective competitors although none of those containing CDR grafted heavy or light chains were as effective as the chimeric antibody itself. Thus, the combinations cH/gL1 , gH/cL and gH/gL1 were 89%, 78% and 64% respectively, as effective as chimeric L243 in this assay. d) Determination of Affinity constants by Scatchard Analysis
L243 antibodies were titrated from 10μg/ml in PBS, 5% fetal calf serum, 0.1% sodium azide in 1.5-fold dilutions (150μl each) before incubation with 5×104 JY cells per titration point for 1 hour on ice. The cells were previously counted, washed and resuspended in the same medium as the samples. After incubation, the cells were washed with 5ml of the above medium, spun down and the supernatant discarded. Bound antibody was revealed by addition of 100μl of a 1/100 dilution of FITC conjugated antihuman Fc monoclonal (The Binding Site; code MF001). The cells were then incubated for 1 hour on ice and then the excess FITC conjugate removed by washing as before. Cells were dispersed in 250μl of the same buffer and the median fluorescence intensity per cell was determined in a FACScan (Becton Dickinson) and calibrated using standard beads (Flow Cytometry standards Corporation). The number of molecules of antibody bound per cell at each antibody concentration was thus established and used to generate Scatchard plots. For the purpose of calculation, it was assumed that the valency of binding of the FITC conjugate to L243 was 1:1 and that the F/P ratio was 3.36 (as given by the manufacturer).
A Scatchard plot comparing the affinities of chimeric L243 (cH/cL), L243-gH/L243-gL1 and L243-gH/L243-gL2 is shown in Figure 26. Chimeric L243 was found to have an apparent Kd of 4.1 nM while the CDR grafted antibodies containing gL1 and gL2 light chains had apparent Kd of 6.4nM and 9.6nM respectively. The difference in Kd values of the antibodies with the two CDR grafted light chains reflects the contribution made by residues 45,49,70 and 71 that had been retained, in L243-gL1, from the parent light chain. e) Antibody dependent cell mediated cytotoxicity
The ability of chimeric and CDR grafted L243 to mediate antibody dependent ceil cytotoxicity (ADCC) was compared as described previously. The principle of the experiment is that antibodies will mediate lysis of target cells bearing their cognate antigen if the Fc of the antibody is able to interact with Fc receptor bearing effector cells capable of cytotoxicity. A comparison of the activities of chimeric (cH/cL) and CDR grafted (gH/gL1) L243 human gamma 1 isotypes in the above assay is shown in Figure 27. Both antibodies were effective mediators of cell lysis with maximal activity being achieved at antibody concentrations of less than 100 ng/ml. There was no significant difference between the activities of the two antibodies. f) Immune function tests
Ex vivo T cell function experiments were performed where an interaction between MHC-II and the T cell receptor was an obligatory requirement for T cell activation. Chimeric and CDR grafted L243 antibodies were compared in mixed lymphocyte reactions, which measures both naive and memory T cell activation, and in recall responses to tetanus toxoid which only measures a memory T cell response. 1) Mixed Lymphocyte reaction - as described above
The principle of the experiment is that when leucocytes from one individual are mixed with those of another individual which express different HLA alleles, they will recognise each other as foreign and the lymphocytes will become activated. This activation is dependent primarily on interactions between the CD3/TcR complex on T cells and the MHC Class II molecule on antigen presenting cells. L243 is known to inhibit this reaction.
When an MLR was carried out to compare the effectiveness of the Gamma 1 isotypes of chimeric and CDR grafted L243 as inhibitors of T cell activation, no significant differences were observed between the two antibodies (Figure 28). Greater than 90% inhibition of the MLR was observed using 100 ng/ml of either antibody. 2) T cell recall response to Tetanus toxoid
The ability of chimeric and CDR grafted L243 to suppress a secondary response was assessed using a recall response to Tetanus toxin. The principle of the experiment is described above. The results of an experiment comparing the ability of human gamma 1 isotypes of chimeric and CDR grafted L243 to inhibit the response to TT is shown in Figure 29. Both antibodies were effective inhibitors of the T cell response to TT and produced titration curves that were indistinguishable. EXAMPLE 4
The ability of CDR grafted L243 with the alteration at position 235 i.e. L[235E] to mediate antibody dependent cell cytoxicity (ADCC) was measured essentially as described in the previous examples. The results are shown in Figure 27.
Similarly the CDR grafted L243 [L235E] antibody was tested in a mixed lymphocyte reaction and in recall response to tetanus toxoid essentially as described in the previous Examples. The results are provided in Figures 28 and 29. The ability of the CDR-grafted L243 antibody [L235E] to fix human complement was assessed using the technique of antibody dependent complement mediated cytotoxicity as described in the previous Examples. The results are shown in Figure 30.

Claims

1. An altered antibody wherein one or more amino acid residues in the N-terminal region of the CH2 domain of said antibody are altered characterised in that the ability of said antibody to fix complement is altered as compared to unaltered antibody.
2. An antibody according to Claim 2 which binds to one or more cellular Fc receptors and does not bind significantly to FcR1.
3. An antibody according to Claim 1 or 2 wherein the amino acid residue which is altered lies within amino acid positions 231 to 239.
4. An antibody according to any of the preceding claims which is an MHC specific antibody.
5. A method for producing an altered antibody with altered ability to fix complement as compared to unaltered antibody comprising altering one or more amino acids in the N-terminal region of the CH2 domain of said antibody altering the ability of said antibody to fix complement as compared with unaltered antibody.
6. A method of modulating the function of cell surface associated antigens avoiding complement mediated toxicity comprising administration of an altered antibody wherein one or more amino acid residues in the N-terminal region of the CH2 domain of said antibody are altered characterised in that the ability of said antibody to fix complement is altered as compared to unaltered antibody and also said antibody.
7. A method according to Claim 6 wherein said altered antibody is able to bind one or more cellular Fc receptors especially FcRIII while binding to FcRI is significantly reduced.
8. A therapeutic, diagnostic or pharmaceutical composition comprising an altered antibody according to any of the preceding claims.
9. A process for the preparation of a therapeutic, pharmaceutical or diagnostic composition comprising admixing an altered antibody according to any of the preceding claims together with a pharmaceutically acceptable excipient, diluent or carrier.
10. A method of therapy and diagnosis comprising administering an effective amount of an altered antibody according to any of the preceding claims to a human or animal subject.
11. A process for producing an altered antibody according to any of the preceding claims comprising:
a) producing in an expression vector an operon having a DNA sequence which encodes an antibody heavy or light chain
b) producing in an expression vector an operon having a DNA sequence which encodes a complementary antibody light or heavy chain
c) transfecting a host cell with both operons
and
d) culturing the transfected cell line to produce the antibody molecule.
12. A process according to Claim 11 wherein said DNA sequences encode a humanised antibody.
13. A process according to Claim 12 wherein said DNA sequences encode a CDR-grafted heavy and/or light chain, or a chimeric antibody
14. A process according to Claim 11 , 12 or 13 wherein at least one of the expression vectors contains a DNA sequence encoding an antibody heavy chain in which one or more amino acid residues in the N- terminal region of the CH2 domain has been altered from that in the corresponding unaltered antibody.
15. A process according to Claim 11 or 12 wherein the alteration in the N- terminal region of the CH2 domain is made after the unaltered antibody has been expressed.
16. An altered antibody according to any of the preceding claims derived from the anti-MHC antibody L243 (ATCC HB55).
17. An altered antibody according to any of the preceding claims wherein the lower hinge of said antibody has been exchanged with an antibody of different isotype.
18. An altered antibody according to Claim 17 wherein an lgG1 lower hinge region has been exchanged with a lgG2 lower hinge region.
19. A method of treating diseases in which antibody therapy leads to undesirable toxicity due to antibody mediated complement fixation comprising administering an altered antibody wherein one or more amino acid residues in the N-terminal region of the CH2 domain of said antibody are altered characterised in that the ability of said antibody to fix complement is altered as compared to unaltered antibody.
PCT/GB1994/001290 1993-06-16 1994-06-15 Antibodies WO1994029351A2 (en)

Priority Applications (3)

Application Number Priority Date Filing Date Title
JP7501518A JPH08511420A (en) 1993-06-16 1994-06-15 Body
EP94917750A EP0714409A1 (en) 1993-06-16 1994-06-15 Antibodies
AU69341/94A AU691811B2 (en) 1993-06-16 1994-06-15 Antibodies

Applications Claiming Priority (8)

Application Number Priority Date Filing Date Title
GB9312415.4 1993-06-16
GB939312415A GB9312415D0 (en) 1993-06-16 1993-06-16 Altered antibodies
GB9401597.1 1994-01-27
GB9401597A GB9401597D0 (en) 1994-01-27 1994-01-27 Altered antibodies
GB9402499A GB9402499D0 (en) 1994-02-09 1994-02-09 Altered abtibodies
GB9402499.9 1994-02-09
GB9406244A GB9406244D0 (en) 1994-03-29 1994-03-29 Altered antibodies
GB9406244.5 1994-03-29

Publications (2)

Publication Number Publication Date
WO1994029351A3 WO1994029351A3 (en) 1994-12-22
WO1994029351A2 true WO1994029351A2 (en) 1994-12-22

Family

ID=27451034

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB1994/001290 WO1994029351A2 (en) 1993-06-16 1994-06-15 Antibodies

Country Status (5)

Country Link
EP (1) EP0714409A1 (en)
JP (1) JPH08511420A (en)
AU (1) AU691811B2 (en)
CA (1) CA2163345A1 (en)
WO (1) WO1994029351A2 (en)

Cited By (1114)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996008512A1 (en) * 1994-09-16 1996-03-21 Austin Research Institute Cancer And Anti-Inflammatory Syndicate No. 1 POLYPEPTIDES WITH Fc BINDING ABILITY
WO1999032659A1 (en) * 1997-12-22 1999-07-01 Stiftelsen Universitetsforskning Bergen (Unifob) METHOD FOR DISEASE PROGNOSIS BASED ON Fc RECEPTOR GENOTYPING
WO1999051642A1 (en) * 1998-04-02 1999-10-14 Genentech, Inc. Antibody variants and fragments thereof
US6194551B1 (en) 1998-04-02 2001-02-27 Genentech, Inc. Polypeptide variants
US6204007B1 (en) 1994-03-29 2001-03-20 Celltech Therapeutics Limited Antibodies against E-selectin
US6242195B1 (en) 1998-04-02 2001-06-05 Genentech, Inc. Methods for determining binding of an analyte to a receptor
WO2001077342A1 (en) 2000-04-11 2001-10-18 Genentech, Inc. Multivalent antibodies and uses therefor
US6528624B1 (en) 1998-04-02 2003-03-04 Genentech, Inc. Polypeptide variants
US6737056B1 (en) 1999-01-15 2004-05-18 Genentech, Inc. Polypeptide variants with altered effector function
WO2004074430A2 (en) * 2002-12-06 2004-09-02 Diadexus, Inc. Compositions, splice variants and methods relating to lung specific genes and proteins
WO2005070963A1 (en) * 2004-01-12 2005-08-04 Applied Molecular Evolution, Inc Fc region variants
EP1620467A2 (en) * 2003-05-02 2006-02-01 Xencor, Inc. Optimized fc variants and methods for their generation
US7053202B2 (en) 2001-10-19 2006-05-30 Millennium Pharmaceuticals, Inc. Immunoglobulin DNA cassette molecules, monobody constructs, methods of production, and methods of use therefor
US7083784B2 (en) 2000-12-12 2006-08-01 Medimmune, Inc. Molecules with extended half-lives, compositions and uses thereof
WO2006089133A2 (en) 2005-02-15 2006-08-24 Duke University Anti-cd19 antibodies and uses in oncology
US7147851B1 (en) 1996-08-15 2006-12-12 Millennium Pharmaceuticals, Inc. Humanized immunoglobulin reactive with α4β7 integrin
US7183387B1 (en) 1999-01-15 2007-02-27 Genentech, Inc. Polypeptide variants with altered effector function
WO2007067992A2 (en) 2005-12-08 2007-06-14 Medarex, Inc. Human monoclonal antibodies to fucosyl-gm1 and methods for using anti-fucosyl-gm1
US7247302B1 (en) 1996-08-02 2007-07-24 Bristol-Myers Squibb Company Method for inhibiting immunoglobulin-induced toxicity resulting from the use of immunoglobulins in therapy and in vivo diagnosis
US7262278B2 (en) 2001-10-15 2007-08-28 Kirin Beer Kabushiki Kaisha Anti-HLA-DR antibody
WO2007127506A2 (en) 2006-01-20 2007-11-08 Genentech, Inc. Anti-ephrinb2 antibodies and methods using same
WO2008031056A2 (en) 2006-09-08 2008-03-13 Medimmune, Llc Humanized anti-cd19 antibodies and their use in treatment of oncology, transplantation and autoimmune disease
WO2008030611A2 (en) 2006-09-05 2008-03-13 Medarex, Inc. Antibodies to bone morphogenic proteins and receptors therefor and methods for their use
US7355008B2 (en) 2003-01-09 2008-04-08 Macrogenics, Inc. Identification and engineering of antibodies with variant Fc regions and methods of using same
WO2008052187A2 (en) 2006-10-27 2008-05-02 Genentech. Inc. Antibodies and immunoconjugates and uses therefor
US7371826B2 (en) 1999-01-15 2008-05-13 Genentech, Inc. Polypeptide variants with altered effector function
WO2008070569A2 (en) 2006-12-01 2008-06-12 Medarex, Inc. Human antibodies that bind cd22 and uses thereof
WO2008074004A2 (en) 2006-12-14 2008-06-19 Medarex, Inc. Human antibodies that bind cd70 and uses thereof
WO2008076560A2 (en) 2006-11-15 2008-06-26 Medarex, Inc. Human monoclonal antibodies to btla and methods of use
US7416726B2 (en) 2000-04-13 2008-08-26 The Rockefeller University Enhancement of antibody-mediated immune responses
WO2008150525A1 (en) 2007-06-04 2008-12-11 Genentech, Inc. Anti-notch1 nrr antibodies and methods using same
US7476724B2 (en) 2004-08-05 2009-01-13 Genentech, Inc. Humanized anti-cmet antibodies
US7495085B2 (en) 2003-03-14 2009-02-24 Wyeth Antibodies against human or mouse IL-21 receptor
WO2009032845A2 (en) 2007-09-04 2009-03-12 Compugen, Ltd. Polypeptides and polynucleotides, and uses thereof as a drug target for producing drugs and biologics
WO2009054863A2 (en) 2006-12-13 2009-04-30 Medarex, Inc. Human antibodies that bind cd19 and uses thereof
US7528236B2 (en) 2004-09-03 2009-05-05 Genentech, Inc. Humanized anti-beta7 antagonists and uses therefor
US7531175B2 (en) 1999-02-12 2009-05-12 Genetics Institute Llc Methods for modulation of immune responses using humanized immunoglobulins reactive with B7-1 molecules
WO2009081201A2 (en) 2007-12-21 2009-07-02 Medimmune Limited BINDING MEMBERS FOR INTERLEUKIN-4 RECEPTOR ALPHA (IL-4Rα) - 173
US7563441B2 (en) * 2004-04-13 2009-07-21 Hoffman-La Roche Inc. Anti-P-selectin antibodies
WO2009100309A2 (en) 2008-02-08 2009-08-13 Medimmune, Llc Anti-ifnar1 antibodies with reduced fc ligand affinity
US7597889B1 (en) * 1998-05-08 2009-10-06 Cambridge Enterprise Limited Binding molecules derived from immunoglobulins which do not trigger complement mediated lysis
WO2009131256A1 (en) 2008-04-24 2009-10-29 Gene Techno Science Co., Ltd. Humanized antibodies specific for amino acid sequence rgd of an extracellular matrix protein and the uses thereof
US7632497B2 (en) 2004-11-10 2009-12-15 Macrogenics, Inc. Engineering Fc Antibody regions to confer effector function
EP2135619A1 (en) 2003-12-10 2009-12-23 Millennium Pharmaceuticals, Inc. Humanized anti-CCR2 antibodies and methods of use therefor
US7658921B2 (en) 2000-12-12 2010-02-09 Medimmune, Llc Molecules with extended half-lives, compositions and uses thereof
US7659374B2 (en) 2004-08-16 2010-02-09 Medimmune, Llc Eph receptor Fc variants with enhanced antibody dependent cell-mediated cytotoxicity activity
WO2010015608A1 (en) 2008-08-05 2010-02-11 Novartis Ag Compositions and methods for antibodies targeting complement protein c5
US7662925B2 (en) 2002-03-01 2010-02-16 Xencor, Inc. Optimized Fc variants and methods for their generation
US7666421B2 (en) 1999-02-12 2010-02-23 Genetics Institute, Llc Methods of treatment of autoimmune diseases using humanized immunoglobulin reactive with B7-2
EP2161336A1 (en) 2005-05-09 2010-03-10 ONO Pharmaceutical Co., Ltd. Human monoclonal antibodies to programmed death 1(PD-1) and methods for treating cancer using anti-PD-1 antibodies alone or in combination with other immunotherapeutics
US7700097B2 (en) 2003-06-27 2010-04-20 Biogen Idec Ma Inc. Purification and preferential synthesis of binding molecules
US7700099B2 (en) 2005-02-14 2010-04-20 Merck & Co., Inc. Non-immunostimulatory antibody and compositions containing the same
US7704505B2 (en) 1994-08-15 2010-04-27 Medimmune, Llc Human-murine chimeric antibodies against respiratory syncytial virus
WO2010056804A1 (en) 2008-11-12 2010-05-20 Medimmune, Llc Antibody formulation
WO2010067308A2 (en) 2008-12-08 2010-06-17 Compugen Ltd. Polypeptides and polynucleotides, and uses thereof as a drug target for producing drugs and biologics
US7740847B2 (en) 2004-08-04 2010-06-22 Applied Molecular Evolution, Inc. Variant Fc regions
WO2010070346A2 (en) 2008-12-18 2010-06-24 Medimmune Limited BINDING MEMBERS FOR INTERLEUKIN-4 RECEPTOR ALPHA (IL-4Ra) - 836
WO2010072740A2 (en) 2008-12-23 2010-07-01 Astrazeneca Ab TARGETED BINDING AGENTS DIRECTED TO α5β1 AND USES THEREOF
EP2221316A1 (en) 2005-05-05 2010-08-25 Duke University Anti-CD19 antibody therapy for autoimmune disease
WO2010094720A2 (en) 2009-02-19 2010-08-26 Glaxo Group Limited Improved anti-tnfr1 polypeptides, antibody variable domains & antagonists
US7786270B2 (en) 2006-05-26 2010-08-31 Macrogenics, Inc. Humanized FcγRIIB-specific antibodies and methods of use thereof
WO2010102175A1 (en) 2009-03-05 2010-09-10 Medarex, Inc. Fully human antibodies specific to cadm1
WO2010108127A1 (en) 2009-03-20 2010-09-23 Genentech, Inc. Bispecific anti-her antibodies
US7803904B2 (en) 1995-09-01 2010-09-28 Millennium Pharmaceuticals, Inc. Mucosal vascular addressing and uses thereof
US7803377B2 (en) 2006-06-06 2010-09-28 Genentech, Inc. Anti-DLL4 antibodies and methods using same
WO2010111367A1 (en) 2009-03-25 2010-09-30 Genentech, Inc. Anti-fgfr3 antibodies and methods using same
WO2010111254A1 (en) 2009-03-25 2010-09-30 Genentech, Inc. Novel anti-alpha5beta1 antibodies and uses thereof
WO2010112458A1 (en) 2009-03-31 2010-10-07 Novartis Ag Composition and methods of use for therapeutic antibodies specific for the il-12 receptore betal subunit
WO2010125003A1 (en) 2009-04-27 2010-11-04 Novartis Ag Compositions and methods for increasing muscle growth
EP2251026A1 (en) 2000-06-08 2010-11-17 Immune Disease Institute, Inc. Methods and compositions for inhibiting immunoglobulin-mediated reperfusion injury
WO2010146550A1 (en) 2009-06-18 2010-12-23 Pfizer Inc. Anti notch-1 antibodies
US7863419B2 (en) 2003-08-22 2011-01-04 Biogen Idec Ma Inc. Antibodies having altered effector function and methods for making the same
EP2275448A2 (en) 2003-12-19 2011-01-19 Genentech, Inc. Monovalent antibody fragments useful as therapeutics
WO2011006914A2 (en) 2009-07-16 2011-01-20 Glaxo Group Limited Antagonists, uses & methods for partially inhibiting tnfr1
WO2011014438A1 (en) 2009-07-31 2011-02-03 N.V. Organon Fully human antibodies to btla
WO2011014457A1 (en) 2009-07-27 2011-02-03 Genentech, Inc. Combination treatments
WO2011021146A1 (en) 2009-08-20 2011-02-24 Pfizer Inc. Osteopontin antibodies
EP2290077A2 (en) 2004-03-01 2011-03-02 Immune Disease Institute, Inc. Natural IGM antibodies and inhibitors thereof
WO2011029823A1 (en) 2009-09-09 2011-03-17 Novartis Ag Monoclonal antibody reactive with cd63 when expressed at the surface of degranulated mast cells
EP2298348A1 (en) 2000-04-14 2011-03-23 Millennium Pharmaceuticals, Inc. Antibody binding alpha4Beta7 integrin and its use to treat inflammatory bowel disease
US7923221B1 (en) * 1983-04-08 2011-04-12 Genentech, Inc Methods of making antibody heavy and light chains having specificity for a desired antigen
WO2011047083A1 (en) 2009-10-13 2011-04-21 Oxford Biotherapeutics Ltd. Antibodies against epha10
WO2011050188A1 (en) 2009-10-22 2011-04-28 Genentech, Inc. Anti-hepsin antibodies and methods using same
WO2011049868A1 (en) 2009-10-19 2011-04-28 Genentech, Inc. Modulators of hepatocyte growth factor activator
WO2011051217A1 (en) 2009-10-27 2011-05-05 Glaxo Group Limited Stable anti-tnfr1 polypeptides, antibody variable domains & antagonists
WO2011056772A1 (en) 2009-11-04 2011-05-12 Schering Corporation Engineered anti-tslp antibody
WO2011056502A1 (en) 2009-10-26 2011-05-12 Genentech, Inc. Bone morphogenetic protein receptor type ii compositions and methods of use
WO2011057120A1 (en) 2009-11-05 2011-05-12 Genentech, Inc. Methods and composition for secretion of heterologous polypeptides
WO2011056497A1 (en) 2009-10-26 2011-05-12 Genentech, Inc. Activin receptor type iib compositions and methods of use
WO2011056494A1 (en) 2009-10-26 2011-05-12 Genentech, Inc. Activin receptor-like kinase-1 antagonist and vegfr3 antagonist combinations
EP2325208A1 (en) 2005-12-15 2011-05-25 Genentech, Inc. Polyubiquitin antibodies
EP2327423A2 (en) 2006-02-21 2011-06-01 Wyeth LLC Human antibodies against human interleukin-22 (IL-22)
WO2011068993A1 (en) 2009-12-02 2011-06-09 Acceleron Pharma Inc. Compositions and methods for increasing serum half-life of fc fusion proteins.
WO2011067711A2 (en) 2009-12-01 2011-06-09 Compugen Ltd Novel heparanase splice variant
WO2011071577A1 (en) 2009-12-11 2011-06-16 Genentech, Inc. Anti-vegf-c antibodies and methods using same
WO2011079185A1 (en) 2009-12-23 2011-06-30 Genentech, Inc. Anti-bv8 antibodies and uses thereof
WO2011076781A1 (en) 2009-12-22 2011-06-30 Novartis Ag Tetravalent cd47-antibody constant region fusion protein for use in therapy
US7973136B2 (en) 2005-10-06 2011-07-05 Xencor, Inc. Optimized anti-CD30 antibodies
EP2343551A1 (en) 2006-04-10 2011-07-13 Genentech, Inc. Disheveled PDZ modulators
WO2011085343A1 (en) 2010-01-11 2011-07-14 Alexion Pharmaceuticals, Inc Biomarkers of immunomodulatory effects in humans treated with anti-cd200 antibodies
US7985833B2 (en) 2000-04-21 2011-07-26 Fuso Pharmaceutical Industries, Ltd. Collectin
WO2011100403A1 (en) 2010-02-10 2011-08-18 Immunogen, Inc Cd20 antibodies and uses thereof
WO2011098449A1 (en) 2010-02-10 2011-08-18 Novartis Ag Methods and compounds for muscle growth
WO2011103242A1 (en) 2010-02-18 2011-08-25 Genentech, Inc. Neuregulin antagonists and use thereof in treating cancer
WO2011101328A2 (en) 2010-02-18 2011-08-25 Roche Glycart Ag Treatment with a humanized igg class anti egfr antibody and an antibody against insulin like growth factor 1 receptor
US8008443B2 (en) 2005-04-26 2011-08-30 Medimmune, Llc Modulation of antibody effector function by hinge domain engineering
WO2011106528A1 (en) * 2010-02-24 2011-09-01 Immunogen, Inc. Folate receptor 1 antibodies and immunoconjugates and uses thereof
WO2011119661A1 (en) 2010-03-24 2011-09-29 Genentech, Inc. Anti-lrp6 antibodies
EP2383295A1 (en) 2003-12-10 2011-11-02 Medarex, Inc. IP-10 antibodies and their uses
WO2011137395A1 (en) 2010-04-30 2011-11-03 Rother Russell P Anti-c5a antibodies and methods for using the antibodies
WO2011138391A1 (en) 2010-05-06 2011-11-10 Novartis Ag Compositions and methods of use for therapeutic low density lipoprotein - related protein 6 (lrp6) multivalent antibodies
WO2011138392A1 (en) 2010-05-06 2011-11-10 Novartis Ag Compositions and methods of use for therapeutic low density lipoprotein -related protein 6 (lrp6) antibodies
EP2388323A2 (en) 2008-01-11 2011-11-23 Gene Techno Science Co., Ltd. Humanized anti-9 integrin antibodies and the uses thereof
WO2011147834A1 (en) 2010-05-26 2011-12-01 Roche Glycart Ag Antibodies against cd19 and uses thereof
WO2011153346A1 (en) 2010-06-03 2011-12-08 Genentech, Inc. Immuno-pet imaging of antibodies and immunoconjugates and uses therefor
US8084582B2 (en) 2003-03-03 2011-12-27 Xencor, Inc. Optimized anti-CD20 monoclonal antibodies having Fc variants
WO2011161119A1 (en) 2010-06-22 2011-12-29 F. Hoffmann-La Roche Ag Antibodies against insulin-like growth factor i receptor and uses thereof
WO2011161189A1 (en) 2010-06-24 2011-12-29 F. Hoffmann-La Roche Ag Anti-hepsin antibodies and methods of use
EP2402373A2 (en) 2006-01-05 2012-01-04 Genentech, Inc. Anti-EphB4 Antibodies and Methods Using Same
WO2012006503A1 (en) 2010-07-09 2012-01-12 Genentech, Inc. Anti-neuropilin antibodies and methods of use
AU2008229860B2 (en) * 2003-05-02 2012-01-12 Xencor, Inc Optimized Fc variants and methods for their generation
US8101720B2 (en) 2004-10-21 2012-01-24 Xencor, Inc. Immunoglobulin insertions, deletions and substitutions
WO2012010582A1 (en) 2010-07-21 2012-01-26 Roche Glycart Ag Anti-cxcr5 antibodies and methods of use
WO2012018771A1 (en) 2010-08-03 2012-02-09 Genentech, Inc. Chronic lymphocytic leukemia (cll) biomarkers
WO2012017003A1 (en) 2010-08-05 2012-02-09 F. Hoffmann-La Roche Ag Anti-mhc antibody anti-viral cytokine fusion protein
EP2418220A2 (en) 2003-12-10 2012-02-15 Medarex, Inc. Interferon alpha antibodies and their uses
WO2012020096A1 (en) 2010-08-13 2012-02-16 Medimmune Limited Monomeric polypeptides comprising variant fc regions and methods of use
WO2012020006A2 (en) 2010-08-13 2012-02-16 Roche Glycart Ag Anti-fap antibodies and methods of use
WO2012020038A1 (en) 2010-08-13 2012-02-16 Roche Glycart Ag Anti-tenascin-c a2 antibodies and methods of use
WO2012022734A2 (en) 2010-08-16 2012-02-23 Medimmune Limited Anti-icam-1 antibodies and methods of use
WO2012022814A1 (en) 2010-08-20 2012-02-23 Novartis Ag Antibodies for epidermal growth factor receptor 3 (her3)
US8124731B2 (en) 2002-03-01 2012-02-28 Xencor, Inc. Optimized Fc variants and methods for their generation
WO2012025536A1 (en) 2010-08-25 2012-03-01 F. Hoffmann-La Roche Ag Antibodies against il-18r1 and uses thereof
WO2012031027A1 (en) 2010-08-31 2012-03-08 Genentech, Inc. Biomarkers and methods of treatment
US8133982B2 (en) 2004-05-10 2012-03-13 Macrogenics, Inc. FcγRIIB specific antibodies and methods of use thereof
EP2431392A1 (en) 2006-02-21 2012-03-21 Wyeth LLC Antibodies against human IL-22 and uses therefor
WO2012035518A1 (en) 2010-09-17 2012-03-22 Compugen Ltd. Compositions and methods for treatment of drug resistant multiple myeloma
WO2012045703A1 (en) 2010-10-05 2012-04-12 Novartis Ag Anti-il12rbeta1 antibodies and their use in treating autoimmune and inflammatory disorders
WO2012047968A2 (en) 2010-10-05 2012-04-12 Genentech, Inc. Mutant smoothened and methods of using the same
EP2446904A2 (en) 2006-05-30 2012-05-02 Genentech, Inc. Anti-CD22 antibodies, their immunoconjugates and uses thereof
WO2012064836A1 (en) 2010-11-10 2012-05-18 Genentech, Inc. Methods and compositions for neural disease immunotherapy
US8187593B2 (en) 2002-08-14 2012-05-29 Macrogenics, Inc. FcγRIIB specific antibodies and methods of use thereof
US8188231B2 (en) 2002-09-27 2012-05-29 Xencor, Inc. Optimized FC variants
EP2463305A1 (en) 2006-01-12 2012-06-13 Alexion Pharmaceuticals, Inc. Antibodies to OX-2/CD200 and uses thereof
EP2465870A1 (en) 2005-11-07 2012-06-20 Genentech, Inc. Binding polypeptides with diversified and consensus VH/VL hypervariable sequences
EP2468772A2 (en) 2006-03-16 2012-06-27 Genentech, Inc. Antibodies to EGFL7 and methods for their use
EP2468776A2 (en) 2007-02-09 2012-06-27 Genentech, Inc. Anti-Robo4 antibodies and uses therefor
WO2012088313A1 (en) 2010-12-22 2012-06-28 Genentech, Inc. Anti-pcsk9 antibodies and methods of use
WO2012087962A2 (en) 2010-12-20 2012-06-28 Genentech, Inc. Anti-mesothelin antibodies and immunoconjugates
WO2012092539A2 (en) 2010-12-31 2012-07-05 Takeda Pharmaceutical Company Limited Antibodies to dll4 and uses thereof
EP2476705A1 (en) 2004-12-28 2012-07-18 Innate Pharma Monoclonal antibodies against NKG2A
WO2012100346A1 (en) 2011-01-24 2012-08-02 Ym Biosciences Inc. Antibodies selective for cells presenting egfr at high density
WO2012106634A1 (en) 2011-02-03 2012-08-09 Alexion Pharmaceuticals, Inc. Use of an anti-cd200 antibody for prolonging the survival of allografts
EP2486941A1 (en) 2006-10-02 2012-08-15 Medarex, Inc. Human antibodies that bind CXCR4 and uses thereof
WO2012138975A1 (en) 2011-04-07 2012-10-11 Genentech, Inc. Anti-fgfr4 antibodies and methods of use
WO2012140627A1 (en) 2011-04-15 2012-10-18 Compugen Ltd. Polypeptides and polynucleotides, and uses thereof for treatment of immune related disorders and cancer
WO2012142515A2 (en) 2011-04-13 2012-10-18 Bristol-Myers Squibb Company Fc fusion proteins comprising novel linkers or arrangements
WO2012145539A1 (en) 2011-04-20 2012-10-26 Acceleron Pharma, Inc. Endoglin polypeptides and uses thereof
US8298533B2 (en) 2008-11-07 2012-10-30 Medimmune Limited Antibodies to IL-1R1
WO2012146630A1 (en) 2011-04-29 2012-11-01 F. Hoffmann-La Roche Ag N-terminal acylated polypeptides, methods for their production and uses thereof
WO2012151248A2 (en) 2011-05-02 2012-11-08 Millennium Pharmaceuticals, Inc. FORMULATION FOR ANTI-α4β7 ANTIBODY
WO2012151247A2 (en) 2011-05-02 2012-11-08 Millennium Pharmaceuticals, Inc. FORMULATION FOR ANTI-α4β7 ANTIBODY
US8309690B2 (en) 2005-07-01 2012-11-13 Medimmune, Llc Integrated approach for generating multidomain protein therapeutics
WO2012155019A1 (en) 2011-05-12 2012-11-15 Genentech, Inc. Multiple reaction monitoring lc-ms/ms method to detect therapeutic antibodies in animal samples using framework signature pepides
WO2012156309A1 (en) 2011-05-13 2012-11-22 Millegen Antibodies against her3
WO2012158704A1 (en) 2011-05-16 2012-11-22 Genentech, Inc. Fgfr1 agonists and methods of use
US8318907B2 (en) 2004-11-12 2012-11-27 Xencor, Inc. Fc variants with altered binding to FcRn
WO2012162561A2 (en) 2011-05-24 2012-11-29 Zyngenia, Inc. Multivalent and monovalent multispecific complexes and their uses
EP2530090A2 (en) 2006-10-19 2012-12-05 CSL Limited Anti-IL-13R alpha 1 antibodies and their uses thereof
EP2532677A1 (en) 2005-10-21 2012-12-12 Novartis AG Human antibodies against il13 and therapeutic uses
EP2535355A2 (en) 2005-03-23 2012-12-19 Genmab A/S Antibodies against CD38 for treatment of multiple myeloma
WO2012172495A1 (en) 2011-06-14 2012-12-20 Novartis Ag Compositions and methods for antibodies targeting tem8
WO2012171996A1 (en) 2011-06-15 2012-12-20 F. Hoffmann-La Roche Ag Anti-human epo receptor antibodies and methods of use
WO2012172521A1 (en) 2011-06-16 2012-12-20 Novartis Ag Soluble proteins for use as therapeutics
WO2012175508A1 (en) 2011-06-22 2012-12-27 F. Hoffmann-La Roche Ag Removal of target cells by circulating virus-specific cytotoxic t-cells using mhc class i comprising complexes
WO2012175692A1 (en) 2011-06-22 2012-12-27 INSERM (Institut National de la Santé et de la Recherche Médicale) Anti-axl antibodies and uses thereof
WO2012175691A1 (en) 2011-06-22 2012-12-27 INSERM (Institut National de la Santé et de la Recherche Médicale) Anti-axl antibodies and uses thereof
EP2540741A1 (en) 2006-03-06 2013-01-02 Aeres Biomedical Limited Humanized anti-CD22 antibodies and their use in treatment of oncology, transplantation and autoimmune disease
WO2013003625A2 (en) 2011-06-28 2013-01-03 Oxford Biotherapeutics Ltd. Antibodies
WO2013003680A1 (en) 2011-06-30 2013-01-03 Genentech, Inc. Anti-c-met antibody formulations
WO2013006437A1 (en) 2011-07-01 2013-01-10 Novartis Ag Method for treating metabolic disorders
WO2013008171A1 (en) 2011-07-11 2013-01-17 Glenmark Pharmaceuticals S.A. Antibodies that bind to ox40 and their uses
WO2013010955A1 (en) 2011-07-15 2013-01-24 Morphosys Ag Antibodies that are cross-reactive for macrophage migration inhibitory factor (mif) and d-dopachrome tautomerase (d-dt)
WO2013025853A1 (en) 2011-08-17 2013-02-21 Genentech, Inc. Neuregulin antibodies and uses thereof
WO2013026832A1 (en) 2011-08-23 2013-02-28 Roche Glycart Ag Anti-mcsp antibodies
US8388955B2 (en) 2003-03-03 2013-03-05 Xencor, Inc. Fc variants
US8394374B2 (en) 2006-09-18 2013-03-12 Xencor, Inc. Optimized antibodies that target HM1.24
EP2567709A2 (en) 2007-11-02 2013-03-13 Novartis AG Molecules and methods for modulating low-density-lipoprotein receptor-related protein 6 (LRP6)
WO2013040433A1 (en) 2011-09-15 2013-03-21 Genentech, Inc. Methods of promoting differentiation
WO2013043715A1 (en) 2011-09-19 2013-03-28 Genentech, Inc. Combination treatments comprising c-met antagonists and b-raf antagonists
US8409568B2 (en) 2005-10-14 2013-04-02 Medimmune, Llc Mutant antibody Fc domains and fusion proteins thereof
WO2013052155A1 (en) 2011-10-05 2013-04-11 Genentech, Inc. Methods of treating liver conditions using notch2 antagonists
WO2013055998A1 (en) 2011-10-14 2013-04-18 Genentech, Inc. ANTI-HtrA1 ANTIBODIES AND METHODS OF USE
WO2013056008A1 (en) 2011-10-14 2013-04-18 Genentech, Inc. Zymogen activators
WO2013054307A2 (en) 2011-10-14 2013-04-18 Novartis Ag Antibodies and methods for wnt pathway-related diseases
WO2013056148A2 (en) 2011-10-15 2013-04-18 Genentech, Inc. Methods of using scd1 antagonists
WO2013059531A1 (en) 2011-10-20 2013-04-25 Genentech, Inc. Anti-gcgr antibodies and uses thereof
EP2586796A1 (en) 2007-10-12 2013-05-01 Novartis AG Compositions and methods for use for antibodies against sclerostin
WO2013063001A1 (en) 2011-10-28 2013-05-02 Genentech, Inc. Therapeutic combinations and methods of treating melanoma
WO2013070565A1 (en) 2011-11-07 2013-05-16 Medimmune, Llc Multispecific and multivalent binding proteins and uses thereof
WO2013078170A1 (en) 2011-11-21 2013-05-30 Genentech, Inc. Purification of anti-c-met antibodies
WO2013083497A1 (en) 2011-12-06 2013-06-13 F. Hoffmann-La Roche Ag Antibody formulation
WO2013084148A2 (en) 2011-12-05 2013-06-13 Novartis Ag Antibodies for epidermal growth factor receptor 3 (her3) directed to domain ii of her3
WO2013084147A2 (en) 2011-12-05 2013-06-13 Novartis Ag Antibodies for epidermal growth factor receptor 3 (her3)
WO2013096791A1 (en) 2011-12-23 2013-06-27 Genentech, Inc. Process for making high concentration protein formulations
WO2013093762A1 (en) 2011-12-21 2013-06-27 Novartis Ag Compositions and methods for antibodies targeting factor p
WO2013106485A2 (en) 2012-01-09 2013-07-18 The Scripps Research Institute Ultralong complementarity determining regions and uses thereof
WO2013106489A1 (en) 2012-01-09 2013-07-18 The Scripps Research Institute Humanized antibodies with ultralong cdr3s
WO2013109856A2 (en) 2012-01-18 2013-07-25 Genentech, Inc. Methods of using fgf19 modulators
WO2013109819A1 (en) 2012-01-18 2013-07-25 Genentech, Inc. Anti-lrp5 antibodies and methods of use
EP2623516A2 (en) 2005-12-02 2013-08-07 Genentech, Inc. Compositions and methods for the treatment of diseases and disorders associated with cytokine signaling involving antibodies that bind to IL-22 and IL-22R
EP2626371A1 (en) 2007-07-31 2013-08-14 MedImmune, LLC Multispecific epitope binding proteins and uses thereof
WO2013120056A1 (en) 2012-02-11 2013-08-15 Genentech, Inc. R-spondin translocations and methods using the same
WO2013120929A1 (en) 2012-02-15 2013-08-22 F. Hoffmann-La Roche Ag Fc-receptor based affinity chromatography
US8524867B2 (en) 2006-08-14 2013-09-03 Xencor, Inc. Optimized antibodies that target CD19
US8530627B2 (en) 2002-08-14 2013-09-10 Macrogenics, Inc. FcγRIIB specific antibodies and methods of use thereof
WO2013137920A1 (en) 2012-03-16 2013-09-19 Genentech, Inc. Engineered conformationally-stabilized proteins
EP2641612A1 (en) 2008-02-05 2013-09-25 Bristol-Myers Squibb Company Alpha 5 - beta 1 antibodies and their uses
US8546543B2 (en) 2004-11-12 2013-10-01 Xencor, Inc. Fc variants that extend antibody half-life
EP2644205A1 (en) 2007-04-12 2013-10-02 The Brigham and Women's Hospital, Inc. Targeting ABCB5 for cancer therapy
WO2013148315A1 (en) 2012-03-27 2013-10-03 Genentech, Inc. Diagnosis and treatments relating to her3 inhibitors
WO2013149159A1 (en) 2012-03-30 2013-10-03 Genentech, Inc. Anti-lgr5 antibodies and immunoconjugates
WO2013151762A1 (en) 2012-04-05 2013-10-10 Ac Immune S.A. Humanized tau antibody
WO2013162654A1 (en) 2012-04-25 2013-10-31 Biodesy, Llc Methods for detecting allosteric modulators of proteins
WO2013165940A1 (en) 2012-05-01 2013-11-07 Genentech, Inc. Anti-pmel17 antibodies and immunoconjugates
EP2662390A1 (en) 2004-06-21 2013-11-13 Medarex, L.L.C. Interferon alpha receptor 1 antibodies and their uses
WO2013170191A1 (en) 2012-05-11 2013-11-14 Genentech, Inc. Methods of using antagonists of nad biosynthesis from nicotinamide
WO2013177470A1 (en) 2012-05-23 2013-11-28 Genentech, Inc. Selection method for therapeutic agents
WO2013184514A1 (en) 2012-06-04 2013-12-12 Irm Llc Site-specific labeling methods and molecules produced thereby
WO2013183032A2 (en) 2012-06-08 2013-12-12 Glenmark Pharmaceuticals S.A. Anti-trka antibodies with enhanced inhibitory properties and derivatives thereof
US8617554B2 (en) 2009-05-13 2013-12-31 Genzyme Corporation Anti-human CD52 immunoglobulins
US8618248B2 (en) 2006-10-31 2013-12-31 President And Fellows Of Harvard College Phosphopeptide compositions and anti-phosphopeptide antibody compositions and methods of detecting phosphorylated peptides
WO2014008391A1 (en) 2012-07-05 2014-01-09 Genentech, Inc. Expression and secretion system
WO2014006124A1 (en) 2012-07-04 2014-01-09 F. Hoffmann-La Roche Ag Covalently linked antigen-antibody conjugates
WO2014006118A1 (en) 2012-07-04 2014-01-09 F. Hoffmann-La Roche Ag Anti-theophylline antibodies and methods of use
WO2014008218A1 (en) 2012-07-02 2014-01-09 Bristol-Myers Squibb Company Optimization of antibodies that bind lymphocyte activation gene-3 (lag-3), and uses thereof
WO2014006123A1 (en) 2012-07-04 2014-01-09 F. Hoffmann-La Roche Ag Anti-biotin antibodies and methods of use
WO2014011521A1 (en) 2012-07-09 2014-01-16 Genentech, Inc. Immunoconjugates comprising anti - cd79b antibodies
WO2014011519A1 (en) 2012-07-09 2014-01-16 Genentech, Inc. Immunoconjugates comprising anti-cd79b antibodies
WO2014011520A1 (en) 2012-07-09 2014-01-16 Genentech, Inc. Immunoconjugates comprising anti-cd22 antibodies
WO2014011518A1 (en) 2012-07-09 2014-01-16 Genentech, Inc. Immunoconjugates comprising anti-cd22 antibodies
WO2014018625A1 (en) 2012-07-25 2014-01-30 Kolltan Pharmaceuticals, Inc. Anti-kit antibodies and uses thereof
WO2014020056A1 (en) 2012-08-02 2014-02-06 F. Hoffmann-La Roche Ag METHOD FOR PRODUCING SOLUBLE FcR AS Fc-FUSION WITH INERT IMMUNOGLOBULIN Fc-REGION AND USES THEREOF
US8647625B2 (en) 2004-07-26 2014-02-11 Biogen Idec Ma Inc. Anti-CD154 antibodies
EP2703011A2 (en) 2007-05-07 2014-03-05 MedImmune, LLC Anti-icos antibodies and their use in treatment of oncology, transplantation and autoimmune disease
WO2014037899A2 (en) 2012-09-07 2014-03-13 Novartis Ag Il-18 binding molecules
US8679492B2 (en) 2009-02-23 2014-03-25 Glenmark Pharmaceuticals S.A. Humanized antibodies that bind to CD19 and their uses
US8697071B2 (en) 2005-08-10 2014-04-15 Macrogenics, Inc. Identification and engineering of antibodies with variant Fc regions and methods of using same
US8709432B2 (en) 2011-04-01 2014-04-29 Immunogen, Inc. Methods for increasing efficacy of FOLR1 cancer therapy
WO2014072306A1 (en) 2012-11-08 2014-05-15 F. Hoffmann-La Roche Ag Her3 antigen binding proteins binding to the beta-hairpin of her3
EP2733153A1 (en) 2012-11-15 2014-05-21 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods for the preparation of immunoconjugates and uses thereof
WO2014078268A2 (en) 2012-11-13 2014-05-22 Genentech, Inc. Anti-hemagglutinin antibodies and methods of use
WO2014084859A1 (en) 2012-11-30 2014-06-05 Novartis Ag Molecules and methods for modulating tmem16a activities
WO2014089111A1 (en) 2012-12-05 2014-06-12 Novartis Ag Compositions and methods for antibodies targeting epo
WO2014093396A1 (en) 2012-12-10 2014-06-19 Biogen Idec Ma Inc. Anti-blood dendritic cell antigen 2 antibodies and uses thereof
EP2746290A2 (en) 2007-06-06 2014-06-25 Domantis Limited Polypeptides, antibody variable domains and antagonists
US8775090B2 (en) 2008-12-12 2014-07-08 Medimmune, Llc Crystals and structure of a human IgG Fc variant with enhanced FcRn binding
WO2014107739A1 (en) 2013-01-07 2014-07-10 Eleven Biotherapeutics, Inc. Antibodies against pcsk9
WO2014106602A1 (en) 2013-01-02 2014-07-10 Glenmark Pharmaceuticals S.A. Antibodies that bind to tl1a and their uses
WO2014116749A1 (en) 2013-01-23 2014-07-31 Genentech, Inc. Anti-hcv antibodies and methods of using thereof
US8795667B2 (en) 2007-12-19 2014-08-05 Macrogenics, Inc. Compositions for the prevention and treatment of smallpox
US8802820B2 (en) 2004-11-12 2014-08-12 Xencor, Inc. Fc variants with altered binding to FcRn
WO2014124258A2 (en) 2013-02-08 2014-08-14 Irm Llc Specific sites for modifying antibodies to make immunoconjugates
WO2014122613A1 (en) 2013-02-08 2014-08-14 Novartis Ag Anti-il-17a antibodies and their use in treating autoimmune and inflammatory disorders
WO2014124316A2 (en) 2013-02-08 2014-08-14 Irm Llc Specific sites for modifying antibodies to make immunoconjugates
WO2014126871A1 (en) 2013-02-12 2014-08-21 Bristol-Myers Squibb Company Tangential flow filtration based protein refolding methods
WO2014126884A1 (en) 2013-02-12 2014-08-21 Bristol-Myers Squibb Company High ph protein refolding methods
EP2769993A1 (en) 2007-12-14 2014-08-27 Novo Nordisk A/S Antibodies against human NKG2D and uses thereof
WO2014128235A1 (en) 2013-02-22 2014-08-28 F. Hoffmann-La Roche Ag Methods of treating cancer and preventing drug resistance
WO2014131715A1 (en) 2013-02-26 2014-09-04 Roche Glycart Ag Anti-mcsp antibodies
WO2014138364A2 (en) 2013-03-06 2014-09-12 Genentech, Inc. Methods of treating and preventing cancer drug resistance
WO2014144850A1 (en) 2013-03-15 2014-09-18 Genentech, Inc. Methods of treating cancer and preventing cancer drug resistance
WO2014144791A2 (en) 2013-03-15 2014-09-18 Dana-Farber Cancer Institute, Inc. Therapeutic peptides
WO2014143739A2 (en) 2013-03-15 2014-09-18 Biogen Idec Ma Inc. Anti-alpha v beta 6 antibodies and uses thereof
WO2014145016A2 (en) 2013-03-15 2014-09-18 Genentech, Inc. Il-22 polypeptides and il-22 fc fusion proteins and methods of use
WO2014144865A2 (en) 2013-03-15 2014-09-18 Genentech, Inc. Anti-crth2 antibodies and methods of use
WO2014144466A1 (en) 2013-03-15 2014-09-18 Biogen Idec Ma Inc. Anti-alpha v beta 6 antibodies and uses thereof
WO2014151866A1 (en) 2013-03-15 2014-09-25 Genentech, Inc. Compositions and methods for diagnosis and treatment of hepatic cancers
WO2014153030A2 (en) 2013-03-14 2014-09-25 Genentech, Inc. Methods of treating cancer and preventing cancer drug resistance
WO2014152358A2 (en) 2013-03-14 2014-09-25 Genentech, Inc. Combinations of a mek inhibitor compound with an her3/egfr inhibitor compound and methods of use
WO2014151680A1 (en) 2013-03-15 2014-09-25 Biogen Idec Ma Inc. Treatment and prevention of acute kidney injury using anti-alpha v beta 5 antibodies
WO2014151006A2 (en) 2013-03-15 2014-09-25 Genentech, Inc. Biomarkers and methods of treating pd-1 and pd-l1 related conditions
WO2014150877A2 (en) 2013-03-15 2014-09-25 Ac Immune S.A. Anti-tau antibodies and methods of use
WO2014160160A2 (en) 2013-03-13 2014-10-02 Novartis Ag Antibody drug conjugates
WO2014159835A1 (en) 2013-03-14 2014-10-02 Genentech, Inc. Anti-b7-h4 antibodies and immunoconjugates
WO2014159239A2 (en) 2013-03-14 2014-10-02 Novartis Ag Antibodies against notch 3
US8853369B2 (en) 2010-06-18 2014-10-07 Genentech, Inc. Anti-Axl antibodies and methods of use
WO2014177460A1 (en) 2013-04-29 2014-11-06 F. Hoffmann-La Roche Ag Human fcrn-binding modified antibodies and methods of use
WO2014177461A1 (en) 2013-04-29 2014-11-06 F. Hoffmann-La Roche Ag Fcrn-binding abolished anti-igf-1r antibodies and their use in the treatment of vascular eye diseases
WO2014205300A2 (en) 2013-06-21 2014-12-24 Novartis Ag Lectin-like oxidized ldl receptor1 antibodies and methods of use
WO2014205302A2 (en) 2013-06-21 2014-12-24 Novartis Ag Lectin-like oxidized ldl receptor1 antibodies and methods of use
WO2015010100A2 (en) 2013-07-18 2015-01-22 Fabrus, Inc. Humanized antibodies with ultralong complementarity determining regions
EP2829551A1 (en) 2006-10-19 2015-01-28 CSL Limited High affinity antibody antagonists of interleukin-13 receptor alpha 1
WO2015017146A2 (en) 2013-07-18 2015-02-05 Fabrus, Inc. Antibodies with ultralong complementarity determining regions
WO2015022658A2 (en) 2013-08-14 2015-02-19 Novartis Ag Methods of treating sporadic inclusion body myositis
US8969526B2 (en) 2011-03-29 2015-03-03 Roche Glycart Ag Antibody Fc variants
US8975377B2 (en) 2007-08-13 2015-03-10 Vasgene Therapeutics, Inc Cancer treatment using humanized antibodies that bind to EphB4
EP2851372A1 (en) 2007-11-30 2015-03-25 Genentech, Inc. Anti-VEGF antibodies
WO2015042108A1 (en) 2013-09-17 2015-03-26 Genentech, Inc. Methods of using anti-lgr5 antibodies
WO2015046467A1 (en) 2013-09-27 2015-04-02 中外製薬株式会社 Method for producing polypeptide heteromultimer
WO2015052230A1 (en) 2013-10-11 2015-04-16 F. Hoffmann-La Roche Ag Multispecific domain exchanged common variable light chain antibodies
WO2015054670A1 (en) 2013-10-11 2015-04-16 Genentech, Inc. Nsp4 inhibitors and methods of use
WO2015057939A1 (en) 2013-10-18 2015-04-23 Biogen Idec Ma Inc. Anti-s1p4 antibodies and uses thereof
WO2015058132A2 (en) 2013-10-18 2015-04-23 Genentech, Inc. Anti-rspo antibodies and methods of use
WO2015061441A1 (en) 2013-10-23 2015-04-30 Genentech, Inc. Methods of diagnosing and treating eosinophilic disorders
WO2015067986A1 (en) 2013-11-07 2015-05-14 INSERM (Institut National de la Santé et de la Recherche Médicale) Neuregulin allosteric anti-her3 antibody
US9040041B2 (en) 2005-10-03 2015-05-26 Xencor, Inc. Modified FC molecules
WO2015075011A1 (en) 2013-11-21 2015-05-28 F. Hoffmann-La Roche Ag ANTI-alpha-SYNUCLEIN ANTIBODIES AND METHODS OF USE
US9051373B2 (en) 2003-05-02 2015-06-09 Xencor, Inc. Optimized Fc variants
WO2015085210A1 (en) 2013-12-06 2015-06-11 Dana-Farber Cancer Institute, Inc. Therapeutic peptides
WO2015089344A1 (en) 2013-12-13 2015-06-18 Genentech, Inc. Anti-cd33 antibodies and immunoconjugates
WO2015089117A1 (en) 2013-12-09 2015-06-18 Allakos Inc. Anti-siglec-8 antibodies and methods of use thereof
US9062116B2 (en) 2009-04-23 2015-06-23 Infinity Pharmaceuticals, Inc. Anti-fatty acid amide hydrolase-2 antibodies and uses thereof
WO2015091656A1 (en) 2013-12-20 2015-06-25 F. Hoffmann-La Roche Ag HUMANIZED ANTI-Tau(pS422) ANTIBODIES AND METHODS OF USE
WO2015095410A1 (en) 2013-12-17 2015-06-25 Genentech, Inc. Methods of treating cancer using pd-1 axis binding antagonists and an anti-cd20 antibody
WO2015095418A1 (en) 2013-12-17 2015-06-25 Genentech, Inc. Methods of treating her2-positive cancers using pd-1 axis binding antagonists and anti-her2 antibodies
WO2015095423A2 (en) 2013-12-17 2015-06-25 Genentech, Inc. Combination therapy comprising ox40 binding agonists and pd-1 axis binding antagonists
WO2015100299A1 (en) 2013-12-24 2015-07-02 Argen-X N.V. Fcrn antagonists and methods of use
WO2015101586A1 (en) 2014-01-03 2015-07-09 F. Hoffmann-La Roche Ag Bispecific anti-hapten/anti-blood brain barrier receptor antibodies, complexes thereof and their use as blood brain barrier shuttles
WO2015101588A1 (en) 2014-01-06 2015-07-09 F. Hoffmann-La Roche Ag Monovalent blood brain barrier shuttle modules
WO2015101589A1 (en) 2014-01-03 2015-07-09 F. Hoffmann-La Roche Ag Covalently linked polypeptide toxin-antibody conjugates
WO2015101587A1 (en) 2014-01-03 2015-07-09 F. Hoffmann-La Roche Ag Covalently linked helicar-anti-helicar antibody conjugates and uses thereof
WO2015107026A1 (en) 2014-01-15 2015-07-23 F. Hoffmann-La Roche Ag Fc-region variants with modified fcrn- and maintained protein a-binding properties
WO2015112909A1 (en) 2014-01-24 2015-07-30 Genentech, Inc. Methods of using anti-steap1 antibodies and immunoconjugates
EP2905030A1 (en) 2008-08-11 2015-08-12 E. R. Squibb & Sons, L.L.C. Human antibodies that bind lymphocyte activation gene-3 (LAG-3) and uses thereof
WO2015120233A1 (en) 2014-02-08 2015-08-13 Genentech, Inc. Methods of treating alzheimer's disease
WO2015120075A2 (en) 2014-02-04 2015-08-13 Genentech, Inc. Mutant smoothened and methods of using the same
WO2015120280A1 (en) 2014-02-08 2015-08-13 Genentech, Inc. Methods of treating alzheimer's disease
WO2015127405A2 (en) 2014-02-21 2015-08-27 Genentech, Inc. Anti-il-13/il-17 bispecific antibodies and uses thereof
WO2015131155A1 (en) 2014-02-28 2015-09-03 Allakos Inc. Methods and compositions for treating siglec-8 associated diseases
US9127060B2 (en) 2010-12-15 2015-09-08 Wyeth Llc Anti-Notch1 antibodies
WO2015134894A1 (en) 2014-03-07 2015-09-11 Alexion Pharmaceuticals, Inc. Anti-c5 antibodies having improved pharmacokinetics
WO2015138615A2 (en) 2014-03-12 2015-09-17 Irm Llc Specific sites for modifying antibodies to make immunoconjugates
WO2015139046A1 (en) 2014-03-14 2015-09-17 Genentech, Inc. Methods and compositions for secretion of heterologous polypeptides
US9139863B2 (en) 2012-03-16 2015-09-22 Genentech, Inc. Engineered conformationally-stabilized proteins
WO2015140591A1 (en) 2014-03-21 2015-09-24 Nordlandssykehuset Hf Anti-cd14 antibodies and uses thereof
WO2015148531A1 (en) 2014-03-24 2015-10-01 Genentech, Inc. Cancer treatment with c-met antagonists and correlation of the latter with hgf expression
EP2927244A1 (en) 2008-09-19 2015-10-07 MedImmune, LLC Antibodies directed to DLL4 and uses thereof
WO2015153514A1 (en) 2014-03-31 2015-10-08 Genentech, Inc. Combination therapy comprising anti-angiogenesis agents and ox40 binding agonists
WO2015153513A1 (en) 2014-03-31 2015-10-08 Genentech, Inc. Anti-ox40 antibodies and methods of use
US9156915B2 (en) 2012-04-26 2015-10-13 Thomas Jefferson University Anti-GCC antibody molecules
WO2015162590A1 (en) 2014-04-24 2015-10-29 Novartis Ag Methods of improving or accelerating physical recovery after surgery for hip fracture
WO2015164615A1 (en) 2014-04-24 2015-10-29 University Of Oslo Anti-gluten antibodies and uses thereof
WO2015164330A1 (en) 2014-04-21 2015-10-29 Millennium Pharmaceuticals, Inc. Anti-psyk antibody molecules and use of same for syk-targeted therapy
US9182406B2 (en) 2008-08-04 2015-11-10 Biodesy, Inc. Nonlinear optical detection of molecules comprising an unnatural amino acid possessing a hyperpolarizability
WO2015171523A1 (en) 2014-05-05 2015-11-12 Regeneron Pharmaceuticals, Inc. Humanized c5 and c3 animals
WO2015179658A2 (en) 2014-05-22 2015-11-26 Genentech, Inc. Anti-gpc3 antibodies and immunoconjugates
WO2015179835A2 (en) 2014-05-23 2015-11-26 Genentech, Inc. Mit biomarkers and methods using the same
US9200079B2 (en) 2004-11-12 2015-12-01 Xencor, Inc. Fc variants with altered binding to FcRn
US9200073B2 (en) 2012-08-31 2015-12-01 Immunogen, Inc. Diagnostic assays and kits for detection of folate receptor 1
WO2015184099A1 (en) 2014-05-28 2015-12-03 4-Antibody Ag Anti-gitr antibodies and methods of use thereof
WO2015187835A2 (en) 2014-06-06 2015-12-10 Bristol-Myers Squibb Company Antibodies against glucocorticoid-induced tumor necrosis factor receptor (gitr) and uses thereof
WO2015191986A1 (en) 2014-06-13 2015-12-17 Genentech, Inc. Methods of treating and preventing cancer drug resistance
WO2015191715A1 (en) 2014-06-11 2015-12-17 Genentech, Inc. Anti-lgr5 antibodies and uses thereof
US9217018B2 (en) 2011-12-15 2015-12-22 Sergei B Onikienko HSP70 fusion protein conjugates and uses thereof
WO2015198217A2 (en) 2013-02-08 2015-12-30 Novartis Ag Compositions and methods for long-acting antibodies targeting il-17
WO2016007775A1 (en) 2014-07-11 2016-01-14 Genentech, Inc. Notch pathway inhibition
WO2016007235A1 (en) 2014-07-11 2016-01-14 Genentech, Inc. Anti-pd-l1 antibodies and diagnostic uses thereof
EP2982379A1 (en) 2005-07-01 2016-02-10 E. R. Squibb & Sons, L.L.C. Human monoclonal antibodies to programmed death ligand 1 (pd-l1)
WO2016020880A2 (en) 2014-08-07 2016-02-11 Novartis Ag Angiopoietin-like 4 antibodies and methods of use
WO2016020882A2 (en) 2014-08-07 2016-02-11 Novartis Ag Angiopoetin-like 4 (angptl4) antibodies and methods of use
WO2016020791A1 (en) 2014-08-05 2016-02-11 Novartis Ag Ckit antibody drug conjugates
WO2016024195A1 (en) 2014-08-12 2016-02-18 Novartis Ag Anti-cdh6 antibody drug conjugates
US9266961B2 (en) 2012-06-15 2016-02-23 Genentech, Inc. Anti-PCSK9 antibodies, formulations, dosing, and methods of use
WO2016028672A1 (en) 2014-08-19 2016-02-25 Merck Sharp & Dohme Corp. Anti-lag3 antibodies and antigen-binding fragments
WO2016028656A1 (en) 2014-08-19 2016-02-25 Merck Sharp & Dohme Corp. Anti-tigit antibodies
US9284375B2 (en) 2005-04-15 2016-03-15 Macrogenics, Inc. Covalent diabodies and uses thereof
EP2995315A1 (en) 2009-05-15 2016-03-16 University Health Network Compositions and methods for treating hematologic cancers targeting the sirp alpha- cd47 interaction
WO2016040868A1 (en) 2014-09-12 2016-03-17 Genentech, Inc. Anti-cll-1 antibodies and immunoconjugates
WO2016040856A2 (en) 2014-09-12 2016-03-17 Genentech, Inc. Cysteine engineered antibodies and conjugates
WO2016044396A1 (en) 2014-09-17 2016-03-24 Genentech, Inc. Immunoconjugates comprising anti-her2 antibodies and pyrrolobenzodiazepines
US9296816B2 (en) 2005-04-15 2016-03-29 Macrogenics, Inc. Covalent diabodies and uses thereof
WO2016057846A1 (en) 2014-10-08 2016-04-14 Novartis Ag Compositions and methods of use for augmented immune response and cancer therapy
EP3009454A2 (en) 2009-04-20 2016-04-20 Oxford Bio Therapeutics Limited Antibodies specific to cadherin-17
WO2016061389A2 (en) 2014-10-16 2016-04-21 Genentech, Inc. Anti-alpha-synuclein antibodies and methods of use
US9321831B2 (en) 2007-06-01 2016-04-26 Medimmune Limited RSV-specific binding molecules and means for producing them
WO2016073794A1 (en) 2014-11-05 2016-05-12 Genentech, Inc. Methods of producing two chain proteins in bacteria
WO2016073378A1 (en) 2014-11-03 2016-05-12 Genentech, Inc. Assays for detecting t cell immune subsets and methods of use thereof
WO2016073791A1 (en) 2014-11-05 2016-05-12 Genentech, Inc. Methods of producing two chain proteins in bacteria
WO2016073157A1 (en) 2014-11-06 2016-05-12 Genentech, Inc. Anti-ang2 antibodies and methods of use thereof
WO2016073282A1 (en) 2014-11-06 2016-05-12 Genentech, Inc. Combination therapy comprising ox40 binding agonists and tigit inhibitors
WO2016075670A1 (en) 2014-11-14 2016-05-19 Novartis Ag Antibody drug conjugates
WO2016077369A1 (en) 2014-11-10 2016-05-19 Genentech, Inc. Animal model for nephropathy and agents for treating the same
WO2016077381A1 (en) 2014-11-10 2016-05-19 Genentech, Inc. Anti-interleukin-33 antibodies and uses thereof
WO2016081639A1 (en) 2014-11-19 2016-05-26 Genentech, Inc. Antibodies against bace1 and use thereof for neural disease immunotherapy
WO2016081748A2 (en) 2014-11-21 2016-05-26 Bristol-Myers Squibb Company Antibodies against cd73 and uses thereof
WO2016081384A1 (en) 2014-11-17 2016-05-26 Genentech, Inc. Combination therapy comprising ox40 binding agonists and pd-1 axis binding antagonists
WO2016081640A1 (en) 2014-11-19 2016-05-26 Genentech, Inc. Anti-transferrin receptor / anti-bace1 multispecific antibodies and methods of use
WO2016081643A1 (en) 2014-11-19 2016-05-26 Genentech, Inc. Anti-transferrin receptor antibodies and methods of use
WO2016086147A1 (en) 2014-11-26 2016-06-02 Millennium Pharmaceuticals, Inc. Vedolizumab for the treatment of fistulizing crohn's disease
WO2016090210A1 (en) 2014-12-05 2016-06-09 Genentech, Inc. ANTI-CD79b ANTIBODIES AND METHODS OF USE
WO2016094566A2 (en) 2014-12-10 2016-06-16 Genentech, Inc. Blood brain barrier receptor antibodies and methods of use
WO2016091891A1 (en) 2014-12-09 2016-06-16 INSERM (Institut National de la Santé et de la Recherche Médicale) Human monoclonal antibodies against axl
WO2016098079A2 (en) 2014-12-19 2016-06-23 Novartis Ag Compositions and methods for antibodies targeting bmp6
WO2016098356A1 (en) 2014-12-19 2016-06-23 Chugai Seiyaku Kabushiki Kaisha Anti-c5 antibodies and methods of use
WO2016097865A1 (en) 2014-12-19 2016-06-23 Regenesance B.V. Antibodies that bind human c6 and uses thereof
US9376495B2 (en) 2011-05-21 2016-06-28 Macrogenics, Inc. Deimmunized serum-binding domains and their use in extending serum half-life
WO2016115345A1 (en) 2015-01-14 2016-07-21 The Brigham And Women's Hospital, Treatment of cancer with anti-lap monoclonal antibodies
WO2016117346A1 (en) 2015-01-22 2016-07-28 Chugai Seiyaku Kabushiki Kaisha A combination of two or more anti-c5 antibodies and methods of use
WO2016118961A1 (en) 2015-01-24 2016-07-28 Academia Sinica Cancer markers and methods of use thereof
WO2016125495A1 (en) 2015-02-05 2016-08-11 Chugai Seiyaku Kabushiki Kaisha Antibodies comprising an ion concentration dependent antigen-binding domain, fc region variants, il-8-binding antibodies, and uses therof
WO2016134335A2 (en) 2015-02-19 2016-08-25 Compugen Ltd. Pvrig polypeptides and methods of treatment
WO2016134333A1 (en) 2015-02-19 2016-08-25 Compugen Ltd. Anti-pvrig antibodies and methods of use
US9428789B2 (en) 2011-03-21 2016-08-30 Biodesy, Inc. Classification of kinase inhibitors using nonlinear optical techniques
WO2016135066A1 (en) 2015-02-26 2016-09-01 INSERM (Institut National de la Santé et de la Recherche Médicale) Fusion proteins and antibodies comprising thereof for promoting apoptosis
WO2016142782A1 (en) 2015-03-09 2016-09-15 Argen-X N.V. Methods of reducing serum levels of fc-containing agents using fcrn antagonsits
WO2016149276A1 (en) 2015-03-16 2016-09-22 Genentech, Inc. Methods of detecting and quantifying il-13 and uses in diagnosing and treating th2-associated diseases
WO2016146833A1 (en) 2015-03-19 2016-09-22 F. Hoffmann-La Roche Ag Biomarkers for nad(+)-diphthamide adp ribosyltransferase resistance
WO2016168771A2 (en) 2015-04-17 2016-10-20 Alpine Immune Sciences, Inc. Immunomodulatory proteins with tunable affinities
WO2016172551A2 (en) 2015-04-24 2016-10-27 Genentech, Inc. Methods of identifying bacteria comprising binding polypeptides
WO2016179517A1 (en) 2015-05-07 2016-11-10 Agenus Inc. Anti-ox40 antibodies and methods of use thereof
WO2016179003A1 (en) 2015-05-01 2016-11-10 Genentech, Inc. Masked anti-cd3 antibodies and methods of use
WO2016188911A1 (en) 2015-05-22 2016-12-01 INSERM (Institut National de la Santé et de la Recherche Médicale) Human monoclonal antibodies fragments inhibiting both the cath-d catalytic activity and its binding to the lrp1 receptor
WO2016196726A1 (en) 2015-06-05 2016-12-08 Genentech, Inc. Anti-tau antibodies and methods of use
WO2016196679A1 (en) 2015-06-02 2016-12-08 Genentech, Inc. Compositions and methods for using anti-il-34 antibodies to treat neurological diseases
WO2016193872A2 (en) 2015-06-05 2016-12-08 Novartis Ag Antibodies targeting bone morphogenetic protein 9 (bmp9) and methods therefor
WO2016196228A1 (en) 2015-05-29 2016-12-08 Bristol-Myers Squibb Company Antibodies against ox40 and uses thereof
WO2016196343A1 (en) 2015-05-29 2016-12-08 Genentech, Inc. Humanized anti-ebola virus glycoprotein antibodies and methods of use
WO2016196298A1 (en) 2015-05-29 2016-12-08 Genentech, Inc. Therapeutic and diagnolstic methods for cancer
WO2016200836A1 (en) 2015-06-08 2016-12-15 Genentech, Inc. Methods of treating cancer using anti-ox40 antibodies
WO2016200835A1 (en) 2015-06-08 2016-12-15 Genentech, Inc. Methods of treating cancer using anti-ox40 antibodies and pd-1 axis binding antagonists
WO2016204966A1 (en) 2015-06-16 2016-12-22 Genentech, Inc. Anti-cd3 antibodies and methods of use
WO2016205176A1 (en) 2015-06-15 2016-12-22 Genentech, Inc. Antibodies and immunoconjugates
WO2016203432A1 (en) 2015-06-17 2016-12-22 Novartis Ag Antibody drug conjugates
WO2016205320A1 (en) 2015-06-17 2016-12-22 Genentech, Inc. Methods of treating locally advanced or metastatic breast cancers using pd-1 axis binding antagonists and taxanes
WO2016205520A1 (en) 2015-06-16 2016-12-22 Genentech, Inc. Humanized and affinity matured antibodies to fcrh5 and methods of use
WO2016205531A2 (en) 2015-06-17 2016-12-22 Genentech, Inc. Anti-her2 antibodies and methods of use
WO2016205200A1 (en) 2015-06-16 2016-12-22 Genentech, Inc. Anti-cll-1 antibodies and methods of use
WO2016207858A1 (en) 2015-06-26 2016-12-29 Novartis Ag Factor xi antibodies and methods of use
WO2017004091A1 (en) 2015-06-29 2017-01-05 Genentech, Inc. Type ii anti-cd20 antibody for use in organ transplantation
WO2017009712A1 (en) 2015-07-13 2017-01-19 Compugen Ltd. Hide1 compositions and methods
US9562099B2 (en) 2013-03-14 2017-02-07 Genentech, Inc. Anti-B7-H4 antibodies and immunoconjugates
WO2017024171A1 (en) 2015-08-04 2017-02-09 Acceleron Pharma Inc. Methods for treating myeloproliferative disorders
WO2017021893A1 (en) 2015-08-03 2017-02-09 Novartis Ag Methods of treating fgf21-associated disorders
US9580506B2 (en) 2005-07-21 2017-02-28 Genmab A/S Potency assays for antibody drug substance binding to an Fc receptor
WO2017040342A1 (en) 2015-08-28 2017-03-09 Genentech, Inc. Anti-hypusine antibodies and uses thereof
WO2017040790A1 (en) 2015-09-01 2017-03-09 Agenus Inc. Anti-pd-1 antibodies and methods of use thereof
WO2017042701A1 (en) 2015-09-09 2017-03-16 Novartis Ag Thymic stromal lymphopoietin (tslp)-binding antibodies and methods of using the antibodies
WO2017046994A1 (en) 2015-09-18 2017-03-23 Chugai Seiyaku Kabushiki Kaisha Il-8-binding antibodies and uses thereof
WO2017046676A1 (en) 2015-09-16 2017-03-23 Novartis Ag Polyomavirus neutralizing antibodies
WO2017053807A2 (en) 2015-09-23 2017-03-30 Genentech, Inc. Optimized variants of anti-vegf antibodies
WO2017050729A1 (en) 2015-09-22 2017-03-30 Spring Bioscience Corporation Anti-ox40 antibodies and diagnostic uses thereof
EP3150636A1 (en) 2015-10-02 2017-04-05 F. Hoffmann-La Roche AG Tetravalent multispecific antibodies
WO2017055443A1 (en) 2015-10-02 2017-04-06 F. Hoffmann-La Roche Ag Anti-pd1 antibodies and methods of use
WO2017055404A1 (en) 2015-10-02 2017-04-06 F. Hoffmann-La Roche Ag Bispecific antibodies specific for pd1 and tim3
WO2017059289A1 (en) 2015-10-02 2017-04-06 Genentech, Inc. Pyrrolobenzodiazepine antibody drug conjugates and methods of use
WO2017055540A1 (en) 2015-10-02 2017-04-06 F. Hoffmann-La Roche Ag Bispecific anti-human a-beta/human transferrin receptor antibodies and methods of use
WO2017055398A2 (en) 2015-10-02 2017-04-06 F. Hoffmann-La Roche Ag Bispecific antibodies specific for a costimulatory tnf receptor
WO2017055542A1 (en) 2015-10-02 2017-04-06 F. Hoffmann-La Roche Ag Bispecific anti-human cd20/human transferrin receptor antibodies and methods of use
US9617336B2 (en) 2012-02-01 2017-04-11 Compugen Ltd C10RF32 antibodies, and uses thereof for treatment of cancer
WO2017060144A1 (en) 2015-10-07 2017-04-13 F. Hoffmann-La Roche Ag Bispecific antibodies with tetravalency for a costimulatory tnf receptor
WO2017064675A1 (en) 2015-10-16 2017-04-20 Genentech, Inc. Hindered disulfide drug conjugates
WO2017066714A1 (en) 2015-10-16 2017-04-20 Compugen Ltd. Anti-vsig1 antibodies and drug conjugates
WO2017068511A1 (en) 2015-10-20 2017-04-27 Genentech, Inc. Calicheamicin-antibody-drug conjugates and methods of use
US9637547B2 (en) 2013-08-30 2017-05-02 Immunogen, Inc. Monoclonal antibodies for detection of folate receptor 1
WO2017075124A1 (en) 2015-10-29 2017-05-04 Merck Sharp & Dohme Corp. Antibody neutralizing human respiratory syncytial virus
WO2017072662A1 (en) 2015-10-29 2017-05-04 Novartis Ag Antibody conjugates comprising toll-like receptor agonist
WO2017075173A2 (en) 2015-10-30 2017-05-04 Genentech, Inc. Anti-factor d antibodies and conjugates
WO2017072210A1 (en) 2015-10-29 2017-05-04 F. Hoffmann-La Roche Ag Anti-variant fc-region antibodies and methods of use
WO2017079768A1 (en) 2015-11-08 2017-05-11 Genentech, Inc. Methods of screening for multispecific antibodies
US9657106B2 (en) 2003-03-03 2017-05-23 Xencor, Inc. Optimized Fc variants
WO2017087678A2 (en) 2015-11-19 2017-05-26 Bristol-Myers Squibb Company Antibodies against glucocorticoid-induced tumor necrosis factor receptor (gitr) and uses thereof
WO2017095875A1 (en) 2015-11-30 2017-06-08 Bristol-Myers Squibb Company Anti human ip-10 antibodies and their uses
WO2017093947A1 (en) 2015-12-04 2017-06-08 Novartis Ag Antibody cytokine engrafted compositions and methods of use for immunoregulation
US9684000B2 (en) 2010-12-16 2017-06-20 Genentech, Inc. Diagnosis and treatments relating to TH2 inhibition
EP3181580A1 (en) 2006-11-02 2017-06-21 Acceleron Pharma Inc. Alk1 receptor and ligand antagonists and uses thereof
WO2017106129A1 (en) 2015-12-16 2017-06-22 Merck Sharp & Dohme Corp. Anti-lag3 antibodies and antigen-binding fragments
WO2017103895A1 (en) 2015-12-18 2017-06-22 Novartis Ag Antibodies targeting cd32b and methods of use thereof
WO2017104779A1 (en) 2015-12-18 2017-06-22 Chugai Seiyaku Kabushiki Kaisha Anti-c5 antibodies and methods of use
US9688775B2 (en) 2001-08-27 2017-06-27 Genentech, Inc. System for antibody expression and assembly
EP3184547A1 (en) 2015-10-29 2017-06-28 F. Hoffmann-La Roche AG Anti-tpbg antibodies and methods of use
WO2017112956A1 (en) 2015-12-23 2017-06-29 Moonshot Pharma Llc Methods for inducing an immune response
US9695236B2 (en) 2008-04-02 2017-07-04 Macrogenics, Inc. BCR-complex-specific antibodies and methods of using same
US9695233B2 (en) 2012-07-13 2017-07-04 Roche Glycart Ag Bispecific anti-VEGF/anti-ANG-2 antibodies and their use in the treatment of ocular vascular diseases
US9708407B2 (en) 2013-03-15 2017-07-18 Genzyme Corporation Anti-CD52 antibodies
US9708408B2 (en) 2006-12-08 2017-07-18 Macrogenics, Inc. Methods for the treatment of disease using immunoglobulins having Fc Regions with altered affinities for FcγRactivating and FcγRinhibiting
US9714295B2 (en) 2010-03-04 2017-07-25 Macrogenics, Inc. Antibodies reactive with B7-H3, immunologically active fragments thereof and uses thereof
US9714282B2 (en) 2003-09-26 2017-07-25 Xencor, Inc. Optimized Fc variants and methods for their generation
WO2017127764A1 (en) 2016-01-20 2017-07-27 Genentech, Inc. High dose treatments for alzheimer's disease
WO2017136558A1 (en) 2016-02-04 2017-08-10 Curis, Inc. Mutant smoothened and methods of using the same
US9737599B2 (en) 2006-06-26 2017-08-22 Macrogenics, Inc. Combination of FcγRIIB-specific antibodies and CD20-specific antibodies and methods of use thereof
WO2017152085A1 (en) 2016-03-04 2017-09-08 Bristol-Myers Squibb Company Combination therapy with anti-cd73 antibodies
WO2017151502A1 (en) 2016-02-29 2017-09-08 Genentech, Inc. Therapeutic and diagnostic methods for cancer
WO2017160699A2 (en) 2016-03-14 2017-09-21 Millennium Pharmaceuticals, Inc. Method of preventing graft versus host disease
WO2017160700A1 (en) 2016-03-14 2017-09-21 Millennium Pharmaceuticals, Inc. Methods of treating or preventing graft versus host disease
WO2017159699A1 (en) 2016-03-15 2017-09-21 Chugai Seiyaku Kabushiki Kaisha Methods of treating cancers using pd-1 axis binding antagonists and anti-gpc3 antibodies
WO2017161173A1 (en) 2016-03-16 2017-09-21 Merrimack Pharmaceuticals, Inc. Engineered trail for cancer therapy
WO2017165778A1 (en) 2016-03-24 2017-09-28 Millennium Pharmaceuticals, Inc. Methods of treating gastrointestinal immune-related adverse events in immune oncology treatments
WO2017165734A1 (en) 2016-03-25 2017-09-28 Genentech, Inc. Multiplexed total antibody and antibody-conjugated drug quantification assay
WO2017162678A1 (en) 2016-03-22 2017-09-28 INSERM (Institut National de la Santé et de la Recherche Médicale) Humanized anti-claudin-1 antibodies and uses thereof
WO2017165742A1 (en) 2016-03-24 2017-09-28 Millennium Pharmaceuticals, Inc. Methods of treating gastrointestinal immune-related adverse events in anti-ctla4 anti-pd-1 combination treatments
WO2017181111A2 (en) 2016-04-15 2017-10-19 Genentech, Inc. Methods for monitoring and treating cancer
WO2017180864A1 (en) 2016-04-14 2017-10-19 Genentech, Inc. Anti-rspo3 antibodies and methods of use
WO2017181079A2 (en) 2016-04-15 2017-10-19 Genentech, Inc. Methods for monitoring and treating cancer
WO2017181152A2 (en) 2016-04-15 2017-10-19 Alpine Immune Sciences, Inc. Cd80 variant immunomodulatory proteins and uses thereof
WO2017181148A2 (en) 2016-04-15 2017-10-19 Alpine Immune Sciences, Inc. Icos ligand variant immunomodulatory proteins and uses thereof
WO2017189724A1 (en) 2016-04-27 2017-11-02 Novartis Ag Antibodies against growth differentiation factor 15 and uses thereof
US9809647B2 (en) 2010-11-19 2017-11-07 Eisai R&D Management Co., Ltd. Neutralizing anti-CCL20 antibodies
WO2017191101A1 (en) 2016-05-02 2017-11-09 F. Hoffmann-La Roche Ag The contorsbody - a single chain target binder
US9815890B2 (en) 2010-06-22 2017-11-14 The Regents Of The University Of Colorado, A Body Corporate Antibodies to the C3d fragment of complement component 3
WO2017196663A1 (en) 2016-05-09 2017-11-16 Bristol-Myers Squibb Company Tl1a antibodies and uses thereof
WO2017197234A1 (en) 2016-05-13 2017-11-16 Bioatla, Llc Anti-ror2 antibodies, antibody fragments, their immunoconjugates and uses thereof
WO2017194441A1 (en) 2016-05-11 2017-11-16 F. Hoffmann-La Roche Ag Modified anti-tenascin antibodies and methods of use
US9822181B2 (en) 2013-08-23 2017-11-21 Macrogenics, Inc. Bi-specific monovalent diabodies that are capable of binding CD123 and CD3, and uses thereof
WO2017201449A1 (en) 2016-05-20 2017-11-23 Genentech, Inc. Protac antibody conjugates and methods of use
WO2017205721A1 (en) 2016-05-27 2017-11-30 Agenus Inc. Anti-tim-3 antibodies and methods of use thereof
WO2017203450A1 (en) 2016-05-25 2017-11-30 Novartis Ag Reversal binding agents for anti-factor xi/xia antibodies and uses thereof
WO2017205741A1 (en) 2016-05-27 2017-11-30 Genentech, Inc. Bioanalytical method for the characterization of site-specific antibody-drug conjugates
US9834606B2 (en) 2013-09-13 2017-12-05 Beigene, Ltd Anti-PD1 antibodies and their use as therapeutics and diagnostics
WO2017214024A1 (en) 2016-06-06 2017-12-14 Genentech, Inc. Silvestrol antibody-drug conjugates and methods of use
WO2017218434A1 (en) 2016-06-12 2017-12-21 Millennium Pharmaceuticals, Inc. Method of treating inflammatory bowel disease
WO2017216724A1 (en) 2016-06-15 2017-12-21 Novartis Ag Methods for treating disease using inhibitors of bone morphogenetic protein 6 (bmp6)
WO2017223405A1 (en) 2016-06-24 2017-12-28 Genentech, Inc. Anti-polyubiquitin multispecific antibodies
WO2018007314A1 (en) 2016-07-04 2018-01-11 F. Hoffmann-La Roche Ag Novel antibody format
WO2018013818A2 (en) 2016-07-14 2018-01-18 Bristol-Myers Squibb Company Antibodies against tim3 and uses thereof
US9879042B2 (en) 2014-09-08 2018-01-30 Academia Sinica Human iNKT cell activation using glycolipids
WO2018020476A1 (en) 2016-07-29 2018-02-01 Aduro Biotech Holdings, Europe B.V. Anti-pd-1 antibodies
WO2018022945A1 (en) 2016-07-28 2018-02-01 Alpine Immune Sciences, Inc. Cd112 variant immunomodulatory proteins and uses thereof
WO2018022946A1 (en) 2016-07-28 2018-02-01 Alpine Immune Sciences, Inc. Cd155 variant immunomodulatory proteins and uses thereof
WO2018021450A1 (en) 2016-07-29 2018-02-01 中外製薬株式会社 Bispecific antibody exhibiting increased alternative fviii-cofactor-function activity
WO2018022479A1 (en) 2016-07-25 2018-02-01 Biogen Ma Inc. Anti-hspa5 (grp78) antibodies and uses thereof
EP3279215A1 (en) 2009-11-24 2018-02-07 MedImmune Limited Targeted binding agents against b7-h1
WO2018027203A1 (en) 2016-08-05 2018-02-08 Allakos, Inc. Anti-siglec-7 antibodies for the treatment of cancer
WO2018025178A1 (en) 2016-08-02 2018-02-08 Aduro Biotech Holdings, Europe B.V. Antibodies against human ctla-4
US9889197B2 (en) 2005-04-15 2018-02-13 Macrogenics, Inc. Covalently-associated diabody complexes that possess charged coil domains and that are capable of enhanced binding to serum albumin
WO2018029124A1 (en) 2016-08-08 2018-02-15 F. Hoffmann-La Roche Ag Therapeutic and diagnostic methods for cancer
WO2018031662A1 (en) 2016-08-11 2018-02-15 Genentech, Inc. Pyrrolobenzodiazepine prodrugs and antibody conjugates thereof
US9896508B2 (en) 2010-03-04 2018-02-20 Macrogenics, Inc. Antibodies reactive with B7-H3 and uses thereof
US9908938B2 (en) 2013-03-14 2018-03-06 Macrogenics, Inc. Bispecific molecules that are immunoreactive with immune effector cells that express an activating receptor and an antigen expressed by a cell infected by a virus and uses thereof
WO2018044970A1 (en) 2016-08-31 2018-03-08 University Of Rochester Human monoclonal antibodies to human endogenous retrovirus k envelope (herv-k) and uses thereof
WO2018050878A1 (en) 2016-09-19 2018-03-22 F. Hoffmann-La Roche Ag Complement factor based affinity chromatography
WO2018058022A1 (en) 2016-09-26 2018-03-29 Merck Sharp & Dohme Corp. Anti-cd27 antibodies
WO2018057849A1 (en) 2016-09-23 2018-03-29 Genentech, Inc. Uses of il-13 antagonists for treating atopic dermatitis
US9932400B2 (en) 2013-08-23 2018-04-03 Macrogenics, Inc. Bi-specific monovalent diabodies that are capable of binding to gpA33 and CD3, and uses thereof
WO2018065501A1 (en) 2016-10-05 2018-04-12 F. Hoffmann-La Roche Ag Methods for preparing antibody drug conjugates
WO2018068028A1 (en) 2016-10-06 2018-04-12 Genentech, Inc. Therapeutic and diagnostic methods for cancer
WO2018071500A1 (en) 2016-10-11 2018-04-19 Agenus Inc. Anti-lag-3 antibodies and methods of use thereof
WO2018081648A2 (en) 2016-10-29 2018-05-03 Genentech, Inc. Anti-mic antibidies and methods of use
US9963510B2 (en) 2005-04-15 2018-05-08 Macrogenics, Inc. Covalent diabodies and uses thereof
US9969789B2 (en) 2012-12-17 2018-05-15 Trillium Therapeutics Inc. Treatment of CD47+ disease cells with SIRP alpha-Fc fusions
WO2018087720A1 (en) 2016-11-14 2018-05-17 Novartis Ag Compositions, methods, and therapeutic uses related to fusogenic protein minion
US9975965B2 (en) 2015-01-16 2018-05-22 Academia Sinica Compositions and methods for treatment and detection of cancers
WO2018091580A1 (en) 2016-11-18 2018-05-24 F. Hoffmann-La Roche Ag Anti-hla-g antibodies and use thereof
WO2018093821A1 (en) 2016-11-15 2018-05-24 Genentech, Inc. Dosing for treatment with anti-cd20/anti-cd3 bispecific antibodies
WO2018091724A1 (en) 2016-11-21 2018-05-24 Cureab Gmbh Anti-gp73 antibodies and immunoconjugates
WO2018094300A1 (en) 2016-11-19 2018-05-24 Potenza Therapeutics, Inc. Anti-gitr antigen-binding proteins and methods of use thereof
US9982041B2 (en) 2014-01-16 2018-05-29 Academia Sinica Compositions and methods for treatment and detection of cancers
US9981030B2 (en) 2013-06-27 2018-05-29 Academia Sinica Glycan conjugates and use thereof
WO2018098363A2 (en) 2016-11-23 2018-05-31 Bioverativ Therapeutics Inc. Bispecific antibodies binding to coagulation factor ix and coagulation factor x
WO2018106776A2 (en) 2016-12-07 2018-06-14 Genentech, Inc. Anti-tau antibodies and methods of use
WO2018106864A1 (en) 2016-12-07 2018-06-14 Agenus Inc. Antibodies and methods of use thereof
WO2018106862A1 (en) 2016-12-07 2018-06-14 Agenus Inc. Anti-ctla-4 antibodies and methods of use thereof
WO2018106781A1 (en) 2016-12-07 2018-06-14 Genentech, Inc Anti-tau antibodies and methods of use
WO2018111890A1 (en) 2016-12-12 2018-06-21 Genentech, Inc. Methods of treating cancer using anti-pd-l1 antibodies and antiandrogens
US10005847B2 (en) 2014-05-27 2018-06-26 Academia Sinica Anti-HER2 glycoantibodies and uses thereof
WO2018114748A1 (en) 2016-12-20 2018-06-28 F. Hoffmann-La Roche Ag Combination therapy of anti-cd20/anti-cd3 bispecific antibodies and 4-1bb (cd137) agonists
WO2018116255A1 (en) 2016-12-23 2018-06-28 Novartis Ag Factor xi antibodies and methods of use
WO2018115960A1 (en) 2016-12-19 2018-06-28 Mosaic Biomedicals, S.L. Antibodies against lif and uses thereof
WO2018119171A1 (en) 2016-12-23 2018-06-28 Potenza Therapeutics, Inc. Anti-neuropilin antigen-binding proteins and methods of use thereof
US10011658B2 (en) 2015-04-03 2018-07-03 Eureka Therapeutics, Inc. Constructs targeting AFP peptide/MHC complexes and uses thereof
WO2018129029A1 (en) 2017-01-04 2018-07-12 Immunogen, Inc. Met antibodies and immunoconjugates and uses thereof
WO2018129451A2 (en) 2017-01-09 2018-07-12 Merrimack Pharmaceuticals, Inc. Anti-fgfr antibodies and methods of use
WO2018127473A1 (en) 2017-01-03 2018-07-12 F. Hoffmann-La Roche Ag Bispecific antigen binding molecules comprising anti-4-1bb clone 20h4.9
US10023892B2 (en) 2014-05-27 2018-07-17 Academia Sinica Compositions and methods relating to universal glycoforms for enhanced antibody efficacy
US10035843B2 (en) 2009-10-06 2018-07-31 Medimmune Limited RSV-specific binding molecule
WO2018143266A1 (en) 2017-01-31 2018-08-09 Chugai Seiyaku Kabushiki Kaisha A pharmaceutical composition for use in the treatment or prevention of a c5-related disease and a method for treating or preventing a c5-related disease
WO2018142322A1 (en) 2017-02-03 2018-08-09 Novartis Ag Anti-ccr7 antibody drug conjugates
EP3360567A1 (en) 2007-11-07 2018-08-15 Genentech, Inc. Amp for use in treating microbial disorders
WO2018148585A1 (en) 2017-02-10 2018-08-16 Genentech, Inc. Anti-tryptase antibodies, compositions thereof, and uses thereof
WO2018146594A1 (en) 2017-02-08 2018-08-16 Novartis Ag Fgf21 mimetic antibodies and uses thereof
US10053510B2 (en) 2013-05-24 2018-08-21 Promis Neurosciences Inc. FasR antibodies and methods of use
WO2018151821A1 (en) 2017-02-17 2018-08-23 Bristol-Myers Squibb Company Antibodies to alpha-synuclein and uses thereof
US10059768B2 (en) 2014-09-12 2018-08-28 Genentech, Inc. Anti-B7-H4 antibodies and immunoconjugates
WO2018157027A1 (en) 2017-02-27 2018-08-30 Regeneron Pharmaceuticals, Inc. Humanized model of kidney and liver disorders
WO2018160841A1 (en) 2017-03-01 2018-09-07 Genentech, Inc. Diagnostic and therapeutic methods for cancer
WO2018158398A1 (en) 2017-03-02 2018-09-07 INSERM (Institut National de la Santé et de la Recherche Médicale) Antibodies having specificity to nectin-4 and uses thereof
WO2018170026A2 (en) 2017-03-16 2018-09-20 Alpine Immune Sciences, Inc. Cd80 variant immunomodulatory proteins and uses thereof
WO2018170021A1 (en) 2017-03-16 2018-09-20 Alpine Immune Sciences, Inc. Pd-l1 variant immunomodulatory proteins and uses thereof
WO2018170023A1 (en) 2017-03-16 2018-09-20 Alpine Immune Sciences, Inc. Pd-l2 variant immunomodulatory proteins and uses thereof
WO2018175752A1 (en) 2017-03-22 2018-09-27 Genentech, Inc. Optimized antibody compositions for treatment of ocular disorders
WO2018175460A1 (en) 2017-03-24 2018-09-27 Novartis Ag Methods for preventing and treating heart disease
US10086054B2 (en) 2013-06-26 2018-10-02 Academia Sinica RM2 antigens and use thereof
US10087236B2 (en) 2009-12-02 2018-10-02 Academia Sinica Methods for modifying human antibodies by glycan engineering
WO2018178076A1 (en) 2017-03-29 2018-10-04 F. Hoffmann-La Roche Ag Bispecific antigen binding molecule for a costimulatory tnf receptor
WO2018178055A1 (en) 2017-03-29 2018-10-04 F. Hoffmann-La Roche Ag Bispecific antigen binding molecule for a costimulatory tnf receptor
WO2018183175A1 (en) 2017-03-28 2018-10-04 Genentech, Inc. Methods of treating neurodegenerative diseases
WO2018183889A1 (en) 2017-03-30 2018-10-04 Potenza Therapeutics, Inc. Anti-tigit antigen-binding proteins and methods of use thereof
WO2018185045A1 (en) 2017-04-04 2018-10-11 F. Hoffmann-La Roche Ag Novel bispecific antigen binding molecules capable of specific binding to cd40 and to fap
WO2018187518A1 (en) 2017-04-07 2018-10-11 Merck Sharp & Dohme Corp. Anti-ilt4 antibodies and antigen-binding fragments
WO2018185043A1 (en) 2017-04-05 2018-10-11 F. Hoffmann-La Roche Ag Bispecific antibodies specifically binding to pd1 and lag3
WO2018185618A1 (en) 2017-04-03 2018-10-11 Novartis Ag Anti-cdh6 antibody drug conjugates and anti-gitr antibody combinations and methods of treatment
WO2018185046A1 (en) 2017-04-05 2018-10-11 F. Hoffmann-La Roche Ag Anti-lag3 antibodies
US10100116B2 (en) 2006-06-26 2018-10-16 Macrogenics, Inc. FcγRIIB-specific antibodies and methods of use thereof
WO2018190719A2 (en) 2017-04-13 2018-10-18 Aduro Biotech Holdings, Europe B.V. Anti-sirp alpha antibodies
WO2018191502A2 (en) 2017-04-13 2018-10-18 Agenus Inc. Anti-cd137 antibodies and methods of use thereof
WO2018191660A1 (en) 2017-04-14 2018-10-18 Genentech, Inc. Diagnostic and therapeutic methods for cancer
WO2018195472A1 (en) 2017-04-21 2018-10-25 Genentech, Inc. Use of klk5 antagonists for treatment of a disease
US10111951B2 (en) 2013-09-06 2018-10-30 Academia Sinica Human iNKT cell activation using glycolipids with altered glycosyl groups
WO2018198091A1 (en) 2017-04-28 2018-11-01 Novartis Ag Antibody conjugates comprising toll-like receptor agonist and combination therapies
WO2018201096A1 (en) 2017-04-27 2018-11-01 Tesaro, Inc. Antibody agents directed against lymphocyte activation gene-3 (lag-3) and uses thereof
WO2018200818A2 (en) 2017-04-28 2018-11-01 Millennium Pharmaceuticals, Inc. Method of treating pediatric disorders
US10118969B2 (en) 2014-05-27 2018-11-06 Academia Sinica Compositions and methods relating to universal glycoforms for enhanced antibody efficacy
US10119972B2 (en) 2014-03-27 2018-11-06 Academia Sinica Reactive labelling compounds and uses thereof
EP3398966A1 (en) 2008-05-02 2018-11-07 Acceleron Pharma, Inc. Methods and compositions for modulating angiogenesis and pericyte composition
WO2018204594A1 (en) 2017-05-04 2018-11-08 Acceleron Pharma Inc. Tgf-beta receptor type ii fusion proteins and uses thereof
WO2018204363A1 (en) 2017-05-01 2018-11-08 Agenus Inc. Anti-tigit antibodies and methods of use thereof
US10131713B2 (en) 2008-04-02 2018-11-20 Macrogenics, Inc. HER2/neu-specific antibodies and methods of using same
US10130714B2 (en) 2012-04-14 2018-11-20 Academia Sinica Enhanced anti-influenza agents conjugated with anti-inflammatory activity
WO2018213097A1 (en) 2017-05-15 2018-11-22 University Of Rochester Broadly neutralizing anti-influenza monoclonal antibody and uses thereof
WO2018215937A1 (en) 2017-05-24 2018-11-29 Novartis Ag Interleukin-7 antibody cytokine engrafted proteins and methods of use in the treatment of cancer
WO2018215936A1 (en) 2017-05-24 2018-11-29 Novartis Ag Antibody-cytokine engrafted proteins and methods of use in the treatment of cancer
WO2018215938A1 (en) 2017-05-24 2018-11-29 Novartis Ag Antibody-cytokine engrafted proteins and methods of use
WO2018218056A1 (en) 2017-05-25 2018-11-29 Birstol-Myers Squibb Company Antibodies comprising modified heavy constant regions
WO2018215935A1 (en) 2017-05-24 2018-11-29 Novartis Ag Antibody-cytokine engrafted proteins and methods of use for immune related disorders
WO2018220446A1 (en) 2017-06-01 2018-12-06 Compugen Ltd. Triple combination antibody therapies
US10150818B2 (en) 2014-01-16 2018-12-11 Academia Sinica Compositions and methods for treatment and detection of cancers
WO2018229706A1 (en) 2017-06-16 2018-12-20 Novartis Ag Combination therapy for the treatment of cancer
WO2018229715A1 (en) 2017-06-16 2018-12-20 Novartis Ag Compositions comprising anti-cd32b antibodies and methods of use thereof
WO2018229612A1 (en) 2017-06-12 2018-12-20 Novartis Ag Method of manufacturing bispecific antibodies, bispecific antibodies and therapeutic use of such antibodies
WO2018237097A1 (en) 2017-06-20 2018-12-27 Amgen Inc. Method of treating or ameliorating metabolic disorders using binding proteins for gastric inhibitory peptide receptor (gipr) in combination with glp-1 agonists
WO2018236904A1 (en) 2017-06-19 2018-12-27 Surface Oncology, Inc. Combination of anti-cd47 antibodies and cell death-inducing agents, and uses thereof
WO2018237335A1 (en) 2017-06-23 2018-12-27 VelosBio Inc. Ror1 antibody immunoconjugates
WO2019003104A1 (en) 2017-06-28 2019-01-03 Novartis Ag Methods for preventing and treating urinary incontinence
US10174124B2 (en) 2013-12-17 2019-01-08 Genentech, Inc. Anti-CD3 antibodies and methods of use
US10172875B2 (en) 2015-09-17 2019-01-08 Immunogen, Inc. Therapeutic combinations comprising anti-FOLR1 immunoconjugates
EP3424530A1 (en) 2013-03-15 2019-01-09 Zyngenia, Inc. Multivalent and monovalent multispecific complexes and their uses
EP3428190A1 (en) 2014-02-12 2019-01-16 F. Hoffmann-La Roche AG Anti-jagged1 antibodies and methods of use
WO2019018757A1 (en) 2017-07-21 2019-01-24 Genentech, Inc. Therapeutic and diagnostic methods for cancer
WO2019022187A1 (en) 2017-07-27 2019-01-31 第一三共株式会社 Anti-cd147 antibody
WO2019023347A1 (en) 2017-07-26 2019-01-31 Forty Seven, Inc. Anti-sirp-alpha antibodies and related methods
WO2019033043A2 (en) 2017-08-11 2019-02-14 Genentech, Inc. Anti-cd8 antibodies and uses thereof
US10208129B2 (en) 2010-12-06 2019-02-19 National Research Council Of Canada Antibodies selective for cells presenting ErbB2 at high density
US10208120B2 (en) 2014-11-05 2019-02-19 Genentech, Inc. Anti-FGFR2/3 antibodies and methods using same
WO2019036605A2 (en) 2017-08-17 2019-02-21 Massachusetts Institute Of Technology Multiple specificity binders of cxc chemokines and uses thereof
US10214765B2 (en) 2012-08-18 2019-02-26 Academia Sinica Cell-permeable probes for identification and imaging of sialidases
WO2019040780A1 (en) 2017-08-25 2019-02-28 Five Prime Therapeutics Inc. B7-h4 antibodies and methods of use thereof
WO2019059411A1 (en) 2017-09-20 2019-03-28 Chugai Seiyaku Kabushiki Kaisha Dosage regimen for combination therapy using pd-1 axis binding antagonists and gpc3 targeting agent
WO2019065795A1 (en) 2017-09-29 2019-04-04 中外製薬株式会社 Multispecific antigen-binding molecule having blood coagulation factor viii (fviii) cofactor function-substituting activity, and pharmaceutical formulation containing said molecule as active ingredient
WO2019065964A1 (en) 2017-09-29 2019-04-04 第一三共株式会社 Antibody-pyrrolobenzodiazepine derivative conjugate
US10251952B2 (en) 2014-06-26 2019-04-09 Hoffmann-La Roche Inc. Humanized anti-tau(pS422) antibody brain shuttles and use thereof
WO2019075090A1 (en) 2017-10-10 2019-04-18 Tilos Therapeutics, Inc. Anti-lap antibodies and uses thereof
WO2019074983A1 (en) 2017-10-10 2019-04-18 Alpine Immune Sciences, Inc. Ctla-4 variant immunomodulatory proteins and uses thereof
WO2019077092A1 (en) 2017-10-20 2019-04-25 F. Hoffmann-La Roche Ag Method for generating multispecific antibodies from monospecific antibodies
WO2019079520A2 (en) 2017-10-18 2019-04-25 Alpine Immune Sciences, Inc. Variant icos ligand immunomodulatory proteins and related compositions and methods
US10274488B2 (en) 2008-07-15 2019-04-30 Academia Sinica Glycan arrays on PTFE-like aluminum coated glass slides and related methods
WO2019081983A1 (en) 2017-10-25 2019-05-02 Novartis Ag Antibodies targeting cd32b and methods of use thereof
US10279021B2 (en) 2014-03-14 2019-05-07 Dana-Faber Cancer Institute, Inc. Vaccine compositions and methods for restoring NKG2D pathway function against cancers
WO2019089753A2 (en) 2017-10-31 2019-05-09 Compass Therapeutics Llc Cd137 antibodies and pd-1 antagonists and uses thereof
WO2019090263A1 (en) 2017-11-06 2019-05-09 Genentech, Inc. Diagnostic and therapeutic methods for cancer
WO2019086362A1 (en) 2017-10-30 2019-05-09 F. Hoffmann-La Roche Ag Method for in vivo generation of multispecific antibodies from monospecific antibodies
WO2019100052A2 (en) 2017-11-20 2019-05-23 Compass Therapeutics Llc Cd137 antibodies and tumor antigen-targeting antibodies and uses thereof
US10302655B2 (en) 2008-12-05 2019-05-28 Glaxo Group Limited Methods for selecting protease resistant polypeptides
WO2019102353A1 (en) 2017-11-22 2019-05-31 Novartis Ag Reversal binding agents for anti-factor xi/xia antibodies and uses thereof
WO2019106578A2 (en) 2017-12-01 2019-06-06 Novartis Ag Polyomavirus neutralizing antibodies
US10317393B2 (en) 2007-03-23 2019-06-11 Academia Sinica Alkynyl sugar analogs for labeling and visualization of glycoconjugates in cells
WO2019110823A1 (en) 2017-12-08 2019-06-13 Argenx Bvba Use of fcrn antagonists for treatment of generalized myasthenia gravis
EP3502140A1 (en) 2017-12-21 2019-06-26 F. Hoffmann-La Roche AG Combination therapy of tumor targeted icos agonists with t-cell bispecific molecules
WO2019126133A1 (en) 2017-12-20 2019-06-27 Alexion Pharmaceuticals, Inc. Liquid formulations of anti-cd200 antibodies
WO2019126536A1 (en) 2017-12-20 2019-06-27 Alexion Pharmaceuticals Inc. Humanized anti-cd200 antibodies and uses thereof
WO2019126472A1 (en) 2017-12-22 2019-06-27 Genentech, Inc. Use of pilra binding agents for treatment of a disease
US10336784B2 (en) 2016-03-08 2019-07-02 Academia Sinica Methods for modular synthesis of N-glycans and arrays thereof
US10338069B2 (en) 2010-04-12 2019-07-02 Academia Sinica Glycan arrays for high throughput screening of viruses
WO2019129677A1 (en) 2017-12-29 2019-07-04 F. Hoffmann-La Roche Ag Anti-vegf antibodies and methods of use
WO2019129211A1 (en) 2017-12-28 2019-07-04 Nanjing Legend Biotech Co., Ltd. Antibodies and variants thereof against pd-l1
US10344092B2 (en) 2013-08-09 2019-07-09 Macrogenics, Inc. Bi-specific monovalent Fc diabodies that are capable of binding CD32B and CD79b and uses thereof
US10342858B2 (en) 2015-01-24 2019-07-09 Academia Sinica Glycan conjugates and methods of use thereof
WO2019136179A1 (en) 2018-01-03 2019-07-11 Alpine Immune Sciences, Inc. Multi-domain immunomodulatory proteins and methods of use thereof
WO2019134981A1 (en) 2018-01-05 2019-07-11 Ac Immune Sa Misfolded tdp-43 binding molecules
WO2019140229A1 (en) 2018-01-12 2019-07-18 Bristol-Myers Squibb Company Antibodies against tim3 and uses thereof
EP3514174A1 (en) 2015-06-29 2019-07-24 Ventana Medical Systems, Inc. Materials and methods for performing histochemical assays for human pro-epiregulin and amphiregulin
EP3514178A1 (en) 2013-03-15 2019-07-24 Novartis AG Antibody drug conjugates
WO2019143636A1 (en) 2018-01-16 2019-07-25 Lakepharma, Inc. Bispecific antibody that binds cd3 and another target
WO2019148020A1 (en) 2018-01-26 2019-08-01 Genentech, Inc. Compositions and methods of use
WO2019148026A1 (en) 2018-01-26 2019-08-01 Genentech, Inc. Il-22 fc fusion proteins and methods of use
US10370455B2 (en) 2014-12-05 2019-08-06 Immunext, Inc. Identification of VSIG8 as the putative VISTA receptor (V-R) and use thereof to produce VISTA/VSIG8 agonists and antagonists
EP3520816A2 (en) 2009-10-23 2019-08-07 Millennium Pharmaceuticals, Inc. Anti-gcc antibody molecules and related compositions and methods
WO2019152642A1 (en) 2018-02-01 2019-08-08 Merck Sharp & Dohme Corp. Anti-pd-1/lag3 bispecific antibodies
EP3524626A1 (en) 2007-03-22 2019-08-14 Biogen MA Inc. Binding proteins, including antibodies, antibody derivatives and antibody fragments, that specifically bind cd154 and uses thereof
WO2019157308A1 (en) 2018-02-08 2019-08-15 Genentech, Inc. Bispecific antigen-binding molecules and methods of use
WO2019157358A1 (en) 2018-02-09 2019-08-15 Genentech, Inc. Therapeutic and diagnostic methods for mast cell-mediated inflammatory diseases
WO2019158645A1 (en) 2018-02-14 2019-08-22 Abba Therapeutics Ag Anti-human pd-l2 antibodies
WO2019165434A1 (en) 2018-02-26 2019-08-29 Genentech, Inc. Dosing for treatment with anti-tigit and anti-pd-l1 antagonist antibodies
WO2019165140A1 (en) 2018-02-21 2019-08-29 Genentech, Inc. DOSING FOR TREATMENT WITH IL-22 Fc FUSION PROTEINS
WO2019168403A2 (en) 2018-03-02 2019-09-06 Labo Bio-Medical Investments B.V. Multispecific binding molecules for the prevention, treatment and diagnosis of neurodegenerative disorders
WO2019172165A1 (en) 2018-03-05 2019-09-12 学校法人埼玉医科大学 Pharmaceutical composition for treating or preventing heterotopic ossification
WO2019178269A2 (en) 2018-03-14 2019-09-19 Surface Oncology, Inc. Antibodies that bind cd39 and uses thereof
WO2019175071A1 (en) 2018-03-13 2019-09-19 F. Hoffmann-La Roche Ag Therapeutic combination of 4-1 bb agonists with anti-cd20 antibodies
WO2019178316A1 (en) 2018-03-14 2019-09-19 Genentech, Inc. Anti-klk5 antibodies and methods of use
WO2019183040A1 (en) 2018-03-21 2019-09-26 Five Prime Therapeutics, Inc. ANTIBODIES BINDING TO VISTA AT ACIDIC pH
US10428146B2 (en) 2014-07-22 2019-10-01 Cb Therapeutics, Inc. Anti PD-1 antibodies
WO2019191552A1 (en) 2018-03-29 2019-10-03 Genentech, Inc. Modulating lactogenic activity in mammalian cells
US10435470B2 (en) 2014-08-05 2019-10-08 Cb Therapeutics, Inc. Anti-PD-L1 antibodies
WO2019195514A1 (en) 2018-04-04 2019-10-10 Genentech, Inc. Methods for detecting and quantifying fgf21
WO2019195126A1 (en) 2018-04-02 2019-10-10 Bristol-Myers Squibb Company Anti-trem-1 antibodies and uses thereof
EP3552631A1 (en) 2018-04-10 2019-10-16 Inatherys Antibody-drug conjugates and their uses for the treatment of cancer
WO2019200357A1 (en) 2018-04-12 2019-10-17 Surface Oncology, Inc. Biomarker for cd47 targeting therapeutics and uses therefor
WO2019197903A1 (en) 2018-04-12 2019-10-17 Mosaic Biomedicals Slu Combination of lif inhibitors and pd-1 axis inhibitors for use in treating cancer
WO2019202041A1 (en) 2018-04-18 2019-10-24 F. Hoffmann-La Roche Ag Multispecific antibodies and use thereof
WO2019202040A1 (en) 2018-04-18 2019-10-24 F. Hoffmann-La Roche Ag Anti-hla-g antibodies and use thereof
WO2019213384A1 (en) 2018-05-03 2019-11-07 University Of Rochester Anti-influenza neuraminidase monoclonal antibodies and uses thereof
WO2019214707A1 (en) 2018-05-11 2019-11-14 信达生物制药(苏州)有限公司 Preparations comprising anti-pcsk9 antibodies and use thereof
WO2019220204A2 (en) 2018-05-14 2019-11-21 Mosaic Biomedicals Slu Antibodies against lif and dosage forms thereof
US10495645B2 (en) 2015-01-16 2019-12-03 Academia Sinica Cancer markers and methods of use thereof
WO2019229699A1 (en) 2018-05-31 2019-12-05 Novartis Ag Hepatitis b antibodies
WO2019229701A2 (en) 2018-06-01 2019-12-05 Novartis Ag Binding molecules against bcma and uses thereof
WO2019229658A1 (en) 2018-05-30 2019-12-05 Novartis Ag Entpd2 antibodies, combination therapies, and methods of using the antibodies and combination therapies
US10501521B2 (en) 2012-12-21 2019-12-10 Hoffmann-La Roche Inc. Disulfide-linked multivalent MHC class I comprising multi-function proteins
WO2019235426A1 (en) 2018-06-04 2019-12-12 中外製薬株式会社 Antigen-binding molecule showing changed half-life in cytoplasm
WO2019241758A1 (en) 2018-06-15 2019-12-19 Alpine Immune Sciences, Inc. Pd-1 variant immunomodulatory proteins and uses thereof
WO2019246557A1 (en) 2018-06-23 2019-12-26 Genentech, Inc. Methods of treating lung cancer with a pd-1 axis binding antagonist, a platinum agent, and a topoisomerase ii inhibitor
WO2019243900A2 (en) 2018-06-18 2019-12-26 Mosaic Biomedicals Slu Combination of lif inhibitors and platinum-based antineoplastic agents for use in treating cancer
WO2020007817A1 (en) 2018-07-04 2020-01-09 F. Hoffmann-La Roche Ag Novel bispecific agonistic 4-1bb antigen binding molecules
EP3594240A1 (en) 2013-05-20 2020-01-15 F. Hoffmann-La Roche AG Anti-transferrin receptor antibodies and methods of use
WO2020014132A2 (en) 2018-07-09 2020-01-16 Five Prime Therapeutics, Inc. Antibodies binding to ilt4
WO2020014327A2 (en) 2018-07-11 2020-01-16 Five Prime Therapeutics, Inc. Antibodies binding to vista at acidic ph
WO2020014306A1 (en) 2018-07-10 2020-01-16 Immunogen, Inc. Met antibodies and immunoconjugates and uses thereof
WO2020013170A1 (en) 2018-07-10 2020-01-16 国立大学法人神戸大学 ANTI-SIRPα ANTIBODY
US10538592B2 (en) 2016-08-22 2020-01-21 Cho Pharma, Inc. Antibodies, binding fragments, and methods of use
WO2020018789A1 (en) 2018-07-18 2020-01-23 Genentech, Inc. Methods of treating lung cancer with a pd-1 axis binding antagonist, an antimetabolite, and a platinum agent
US10544225B2 (en) 2014-07-03 2020-01-28 Beigene, Ltd. Anti-PD-L1 antibodies and their use as therapeutics and diagnostics
WO2020027279A1 (en) 2018-08-01 2020-02-06 Chugai Seiyaku Kabushiki Kaisha A pharmaceutical composition for use in the treatment or prevention of a c5-related disease and a method for treating or preventing a c5-related disease
WO2020025703A1 (en) 2018-08-01 2020-02-06 Imcheck Therapeutics Sas Anti-btn3a antibodies and their use in treating cancer or infectious disorders
WO2020027330A1 (en) 2018-08-03 2020-02-06 中外製薬株式会社 Antigen-binding molecule containing two antigen-binding domains that are linked to each other
EP3608674A1 (en) 2018-08-09 2020-02-12 Regeneron Pharmaceuticals, Inc. Methods for assessing binding affinity of an antibody variant to the neonatal fc receptor
WO2020033925A2 (en) 2018-08-09 2020-02-13 Compass Therapeutics Llc Antibodies that bind cd277 and uses thereof
WO2020033926A2 (en) 2018-08-09 2020-02-13 Compass Therapeutics Llc Antibodies that bind cd277 and uses thereof
WO2020033923A1 (en) 2018-08-09 2020-02-13 Compass Therapeutics Llc Antigen binding agents that bind cd277 and uses thereof
WO2020032230A1 (en) 2018-08-10 2020-02-13 中外製薬株式会社 Anti-cd137 antigen-binding molecule and utilization thereof
EP3611188A1 (en) 2014-11-06 2020-02-19 F. Hoffmann-La Roche AG Fc-region variants with modified fcrn-binding and methods of use
WO2020037154A1 (en) 2018-08-17 2020-02-20 23Andme, Inc. Anti-il1rap antibodies and methods of use thereof
WO2020050406A1 (en) 2018-09-06 2020-03-12 第一三共株式会社 Novel cyclic dinucleotide derivative and antibody-drug conjugate thereof
WO2020049286A1 (en) 2018-09-03 2020-03-12 Femtogenix Limited Polycyclic amides as cytotoxic agents
WO2020056077A1 (en) 2018-09-13 2020-03-19 The Board Of Regents Of The University Of Texas System Novel lilrb4 antibodies and uses thereof
WO2020053742A2 (en) 2018-09-10 2020-03-19 Novartis Ag Anti-hla-hbv peptide antibodies
WO2020061349A1 (en) 2018-09-21 2020-03-26 Genentech, Inc. Diagnostic methods for triple-negative breast cancer
WO2020061060A1 (en) 2018-09-19 2020-03-26 Genentech, Inc. Therapeutic and diagnostic methods for bladder cancer
WO2020061376A2 (en) 2018-09-19 2020-03-26 Alpine Immune Sciences, Inc. Methods and uses of variant cd80 fusion proteins and related constructs
US10604577B2 (en) 2015-10-22 2020-03-31 Allakos Inc. Methods and compositions for treating systemic mastocytosis
US10604561B2 (en) 2016-09-16 2020-03-31 Chugai Seiyaku Kabushiki Kaisha Anti-dengue virus antibodies, polypeptides containing variant Fc regions, and methods of use
US10611825B2 (en) 2011-02-28 2020-04-07 Hoffmann La-Roche Inc. Monovalent antigen binding proteins
WO2020070035A1 (en) 2018-10-01 2020-04-09 F. Hoffmann-La Roche Ag Bispecific antigen binding molecules with trivalent binding to cd40
WO2020070041A1 (en) 2018-10-01 2020-04-09 F. Hoffmann-La Roche Ag Bispecific antigen binding molecules comprising anti-fap clone 212
WO2020076969A2 (en) 2018-10-10 2020-04-16 Tilos Therapeutics, Inc. Anti-lap antibody variants and uses thereof
WO2020081493A1 (en) 2018-10-16 2020-04-23 Molecular Templates, Inc. Pd-l1 binding proteins
WO2020079580A1 (en) 2018-10-15 2020-04-23 Novartis Ag Trem2 stabilizing antibodies
WO2020081767A1 (en) 2018-10-18 2020-04-23 Genentech, Inc. Diagnostic and therapeutic methods for sarcomatoid kidney cancer
US10633457B2 (en) 2014-12-03 2020-04-28 Hoffmann-La Roche Inc. Multispecific antibodies
US10640564B2 (en) 2014-10-17 2020-05-05 Ichnos Sciences SA Antibodies that bind to CCR6 and their uses
US10640555B2 (en) 2009-06-16 2020-05-05 Hoffmann-La Roche Inc. Bispecific antigen binding proteins
WO2020089811A1 (en) 2018-10-31 2020-05-07 Novartis Ag Dc-sign antibody drug conjugates
WO2020095922A1 (en) 2018-11-07 2020-05-14 第一三共株式会社 Method of improving blood kinetics of peptide
WO2020096959A1 (en) 2018-11-05 2020-05-14 Genentech, Inc. Methods of producing two chain proteins in prokaryotic host cells
WO2020102555A1 (en) 2018-11-16 2020-05-22 Memorial Sloan Kettering Cancer Center Antibodies to mucin-16 and methods of use thereof
WO2020108530A1 (en) 2018-11-27 2020-06-04 信达生物制药(苏州)有限公司 Anti-il-23p19 antibody and uses thereof
WO2020113141A2 (en) 2018-11-30 2020-06-04 Alpine Immune Sciences, Inc. Cd86 variant immunomodulatory proteins and uses thereof
WO2020112781A1 (en) 2018-11-28 2020-06-04 Bristol-Myers Squibb Company Antibodies comprising modified heavy constant regions
EP3662930A1 (en) 2015-09-24 2020-06-10 AbVitro LLC Hiv antibody compositions and methods of use
WO2020117257A1 (en) 2018-12-06 2020-06-11 Genentech, Inc. Combination therapy of diffuse large b-cell lymphoma comprising an anti-cd79b immunoconjugates, an alkylating agent and an anti-cd20 antibody
WO2020117952A2 (en) 2018-12-05 2020-06-11 Genentech, Inc. Diagnostic methods and compositions for cancer immunotherapy
WO2020118011A1 (en) 2018-12-06 2020-06-11 Alexion Pharmaceuticals, Inc. Anti-alk2 antibodies and uses thereof
WO2020123275A1 (en) 2018-12-10 2020-06-18 Genentech, Inc. Photocrosslinking peptides for site specific conjugation to fc-containing proteins
WO2020121059A1 (en) 2018-12-14 2020-06-18 Northern Biologics Inc. Anti-periostin antibodies and uses thereof
WO2020132231A1 (en) 2018-12-21 2020-06-25 Genentech, Inc. Methods of producing polypeptides using a cell line resistant to apoptosis
WO2020128612A2 (en) 2018-12-21 2020-06-25 Novartis Ag Antibodies to pmel17 and conjugates thereof
WO2020127873A1 (en) 2018-12-21 2020-06-25 F. Hoffmann-La Roche Ag Antibody that binds to vegf and il-1beta and methods of use
WO2020132220A1 (en) 2018-12-21 2020-06-25 23Andme, Inc. Anti-il-36 antibodies and methods of use thereof
WO2020128863A1 (en) 2018-12-19 2020-06-25 Novartis Ag Anti-tnf-alpha antibodies
WO2020132230A2 (en) 2018-12-20 2020-06-25 Genentech, Inc. Modified antibody fcs and methods of use
WO2020132034A1 (en) 2018-12-20 2020-06-25 23Andme, Inc. Anti-cd96 antibodies and methods of use thereof
WO2020139920A2 (en) 2018-12-26 2020-07-02 City Of Hope Activatable masked anti-ctla4 binding proteins
WO2020141145A1 (en) 2018-12-30 2020-07-09 F. Hoffmann-La Roche Ag Anti-rabbit cd19 antibodies and methods of use
US10717778B2 (en) 2014-09-29 2020-07-21 Duke University Bispecific molecules comprising an HIV-1 envelope targeting arm
WO2020150496A1 (en) 2019-01-16 2020-07-23 Compass Therapeutics Llc Formulations of antibodies that bind human cd137 and uses thereof
WO2020148207A1 (en) 2019-01-14 2020-07-23 INSERM (Institut National de la Santé et de la Recherche Médicale) Human monoclonal antibodies binding to hla-a2
WO2020150152A1 (en) 2019-01-14 2020-07-23 Genentech, Inc. Methods of treating cancer with a pd-1 axis binding antagonist and an rna vaccine
WO2020153467A1 (en) 2019-01-24 2020-07-30 中外製薬株式会社 Novel cancer antigens and antibodies of said antigens
WO2020154293A1 (en) 2019-01-22 2020-07-30 Bristol-Myers Squibb Company Antibodies against il-7r alpha subunit and uses thereof
WO2020154405A2 (en) 2019-01-22 2020-07-30 Genentech, Inc. Immunoglobulin a antibodies and methods of production and use
WO2020154410A1 (en) 2019-01-23 2020-07-30 Genentech, Inc. Methods of producing multimeric proteins in eukaryotic host cells
EP3689910A2 (en) 2014-09-23 2020-08-05 F. Hoffmann-La Roche AG Method of using anti-cd79b immunoconjugates
WO2020157491A1 (en) 2019-01-29 2020-08-06 Femtogenix Limited G-a crosslinking cytotoxic agents
US10745467B2 (en) 2010-03-26 2020-08-18 The Trustees Of Dartmouth College VISTA-Ig for treatment of autoimmune, allergic and inflammatory disorders
WO2020176748A1 (en) 2019-02-27 2020-09-03 Genentech, Inc. Dosing for treatment with anti-tigit and anti-cd20 or anti-cd38 antibodies
US10768174B2 (en) 2014-12-23 2020-09-08 Bluelight Therapeutics, Inc. Attachment of proteins to interfaces for use in nonlinear optical detection
US10767232B2 (en) 2014-11-03 2020-09-08 Genentech, Inc. Methods and biomarkers for predicting efficacy and evaluation of an OX40 agonist treatment
EP3705498A1 (en) 2013-08-22 2020-09-09 Acceleron Pharma Inc. Tgf-beta receptor type ii variants and uses thereof
US10774145B2 (en) 2015-06-17 2020-09-15 Allakos Inc. Methods and compositions for treating fibrotic diseases
WO2020185535A1 (en) 2019-03-08 2020-09-17 Genentech, Inc. Methods for detecting and quantifying membrane-associated proteins on extracellular vesicles
WO2020186176A1 (en) 2019-03-14 2020-09-17 Genentech, Inc. Treatment of cancer with her2xcd3 bispecific antibodies in combination with anti-her2 mab
US10781254B2 (en) 2010-03-26 2020-09-22 The Trustees Of Dartmouth College VISTA regulatory T cell mediator protein, VISTA binding agents and use thereof
WO2020196474A1 (en) 2019-03-25 2020-10-01 第一三共株式会社 Antibody-pyrrolobenzodiazepine derivative conjugate
WO2020196712A1 (en) 2019-03-27 2020-10-01 第一三共株式会社 Combination of antibody-pyrrolobenzodiazepine derivative conjugate and parp inhibitor
US10793633B2 (en) 2011-09-30 2020-10-06 Dana-Farber Cancer Institute, Inc. Therapeutic peptides
US10793621B2 (en) 2011-02-28 2020-10-06 Hoffmann-La Roche Inc. Nucleic acid encoding dual Fc antigen binding proteins
WO2020208177A1 (en) 2019-04-11 2020-10-15 Argenx Bvba ANTI-IgE ANTIBODIES
WO2020210358A1 (en) 2019-04-08 2020-10-15 Biogen Ma Inc. Anti-integrin antibodies and uses thereof
WO2020213724A1 (en) 2019-04-19 2020-10-22 中外製薬株式会社 Chimeric receptor recognizing modification site of antibody
WO2020214867A1 (en) 2019-04-17 2020-10-22 Alpine Immune Sciences, Inc. Methods and uses of variant icos ligand (icosl) fusion proteins
WO2020214995A1 (en) 2019-04-19 2020-10-22 Genentech, Inc. Anti-mertk antibodies and their methods of use
US10822402B2 (en) 2015-06-24 2020-11-03 Hoffmann-La Roche Inc. Humanized anti-tau(pS422) antibodies and methods of use
EP3733244A1 (en) 2013-10-02 2020-11-04 Medlmmune, LLC Neutralizing anti-influenza a antibodies and uses thereof
WO2020226986A2 (en) 2019-05-03 2020-11-12 Genentech, Inc. Methods of treating cancer with an anti-pd-l1 antibody
US10836830B2 (en) 2015-12-02 2020-11-17 Agenus Inc. Antibodies and methods of use thereof
WO2020232169A1 (en) 2019-05-14 2020-11-19 Genentech, Inc. Methods of using anti-cd79b immunoconjugates to treat follicular lymphoma
WO2020236841A2 (en) 2019-05-20 2020-11-26 Novartis Ag Antibody drug conjugates having linkers comprising hydrophilic groups
WO2020236817A2 (en) 2019-05-20 2020-11-26 Novartis Ag Mcl-1 inhibitor antibody-drug conjugates and methods of use
WO2020236792A1 (en) 2019-05-21 2020-11-26 Novartis Ag Cd19 binding molecules and uses thereof
WO2020236797A1 (en) 2019-05-21 2020-11-26 Novartis Ag Variant cd58 domains and uses thereof
WO2020234473A1 (en) 2019-05-23 2020-11-26 Ac Immune Sa Anti-tdp-43 binding molecules and uses thereof
WO2020236795A2 (en) 2019-05-21 2020-11-26 Novartis Ag Trispecific binding molecules against bcma and uses thereof
US10864203B2 (en) 2016-07-05 2020-12-15 Beigene, Ltd. Combination of a PD-1 antagonist and a RAF inhibitor for treating cancer
WO2020250159A1 (en) 2019-06-12 2020-12-17 Novartis Ag Natriuretic peptide receptor 1 antibodies and methods of use
WO2020260326A1 (en) 2019-06-27 2020-12-30 F. Hoffmann-La Roche Ag Novel icos antibodies and tumor-targeted antigen binding molecules comprising them
WO2020263830A1 (en) 2019-06-25 2020-12-30 Gilead Sciences, Inc. Flt3l-fc fusion proteins and methods of use
WO2021009047A1 (en) 2019-07-12 2021-01-21 F. Hoffmann-La Roche Ag Antibodies which bind to cancer cells and target radionuclides to said cells
WO2021009263A1 (en) 2019-07-16 2021-01-21 INSERM (Institut National de la Santé et de la Recherche Médicale) Antibodies having specificity for cd38 and uses thereof
WO2021011678A1 (en) 2019-07-15 2021-01-21 Bristol-Myers Squibb Company Anti-trem-1 antibodies and uses thereof
WO2021011681A1 (en) 2019-07-15 2021-01-21 Bristol-Myers Squibb Company Antibodies against human trem-1 and uses thereof
WO2021010326A1 (en) 2019-07-12 2021-01-21 中外製薬株式会社 Anti-mutation type fgfr3 antibody and use therefor
US10899836B2 (en) 2016-02-12 2021-01-26 Janssen Pharmaceutica Nv Method of identifying anti-VISTA antibodies
WO2021014389A1 (en) 2019-07-24 2021-01-28 H. Lundbeck A/S Anti-mglur5 antibodies and uses thereof
WO2021019036A1 (en) 2019-07-31 2021-02-04 F. Hoffmann-La Roche Ag Dosage and administration regimen for the treatment or prevention of c5-related diseases by the use of the anti-c5 antibody crovalimab
WO2021020282A1 (en) 2019-07-26 2021-02-04 学校法人埼玉医科大学 Antibody recognizing extracellular region of alk2/acvr1
WO2021021837A2 (en) 2019-07-29 2021-02-04 Compugen Ltd. Anti-pvrig antibodies formulations and uses thereof
WO2021019033A1 (en) 2019-07-31 2021-02-04 F. Hoffmann-La Roche Ag Dosage and administration regimen for the treatment or prevention of c5-related diseases by the use of the anti-c5 antibody crovalimab
WO2021024209A1 (en) 2019-08-06 2021-02-11 Aprinoia Therapeutics Inc. Antibodies that bind to pathological tau species and uses thereof
WO2021030488A1 (en) 2019-08-12 2021-02-18 Bienvenue David Leonard 4-1bb and ox40 binding proteins and related compositions and methods, antibodies against 4-1bb, antibodies against ox40
EP3783029A1 (en) 2015-05-12 2021-02-24 F. Hoffmann-La Roche AG Therapeutic and diagnostic methods for cancer
EP3782654A1 (en) 2014-09-12 2021-02-24 Genentech, Inc. Anti-her2 antibodies and immunoconjugates
US10933115B2 (en) 2012-06-22 2021-03-02 The Trustees Of Dartmouth College VISTA antagonist and methods of use
WO2021042019A1 (en) 2019-08-30 2021-03-04 Agenus Inc. Anti-cd96 antibodies and methods of use thereof
EP3789399A1 (en) 2014-11-21 2021-03-10 Bristol-Myers Squibb Company Antibodies comprising modified heavy constant regions
WO2021050645A1 (en) 2019-09-12 2021-03-18 Genentech, Inc. Compositions and methods of treating lupus nephritis
WO2021053560A1 (en) 2019-09-18 2021-03-25 Novartis Ag Combination therapy with entpd2 and cd73 antibodies
WO2021053559A1 (en) 2019-09-18 2021-03-25 Novartis Ag Entpd2 antibodies, combination therapies, and methods of using the antibodies and combination therapies
WO2021055698A1 (en) 2019-09-19 2021-03-25 Bristol-Myers Squibb Company Antibodies binding to vista at acidic ph
WO2021055577A2 (en) 2019-09-18 2021-03-25 Genentech, Inc. Anti-klk7 antibodies, anti-klk5 antibodies, multispecific anti-klk5/klk7 antibodies, and methods of use
WO2021055694A1 (en) 2019-09-20 2021-03-25 Genentech, Inc. Dosing for anti-tryptase antibodies
US10961311B2 (en) 2016-04-15 2021-03-30 Macrogenics, Inc. B7-H3 binding molecules, antibody drug conjugates thereof and methods of use thereof
WO2021062085A1 (en) 2019-09-27 2021-04-01 Genentech, Inc. Dosing for treatment with anti-tigit and anti-pd-l1 antagonist antibodies
WO2021062244A1 (en) 2019-09-25 2021-04-01 Surface Oncology, Inc. Anti-il-27 antibodies and uses thereof
US10968273B2 (en) 2010-04-05 2021-04-06 Fundacio Privada Institut D'investigacio Oncologica Vall D'hebron (Vhio) Antibody recognizing human leukemia inhibitory factor (LIF) and use of anti-LIF antibodies in the treatment of diseases associated with unwanted cell proliferation
WO2021070181A1 (en) 2019-10-08 2021-04-15 Nectin Therapeutics Ltd. Antibodies against the poliovirus receptor (pvr) and uses thereof
WO2021076196A1 (en) 2019-10-18 2021-04-22 Genentech, Inc. Methods of using anti-cd79b immunoconjugates to treat diffuse large b-cell lymphoma
WO2021080682A1 (en) 2019-10-24 2021-04-29 Massachusetts Institute Of Technology Monoclonal antibodies that bind human cd161 and uses thereof
WO2021091605A1 (en) 2019-11-04 2021-05-14 Compugen Ltd. Combination therapy with anti-pvrig antibodies formulations and anti-pd-1 antibodies
WO2021092171A1 (en) 2019-11-06 2021-05-14 Genentech, Inc. Diagnostic and therapeutic methods for treatment of hematologic cancers
US11009509B2 (en) 2015-06-24 2021-05-18 Janssen Pharmaceutica Nv Anti-VISTA antibodies and fragments
US11014987B2 (en) 2013-12-24 2021-05-25 Janssen Pharmaceutics Nv Anti-vista antibodies and fragments, uses thereof, and methods of identifying same
WO2021110873A1 (en) 2019-12-04 2021-06-10 Medimmune Limited Antibodies against lif and uses thereof
WO2021116119A1 (en) 2019-12-09 2021-06-17 INSERM (Institut National de la Santé et de la Recherche Médicale) Antibodies having specificity to her4 and uses thereof
WO2021119505A1 (en) 2019-12-13 2021-06-17 Genentech, Inc. Anti-ly6g6d antibodies and methods of use
EP3842457A1 (en) 2015-09-09 2021-06-30 Novartis AG Thymic stromal lymphopoietin (tslp)-binding molecules and methods of using the molecules
EP3842453A1 (en) 2014-11-06 2021-06-30 F. Hoffmann-La Roche AG Fc-region variants with modified fcrn- and protein a-binding properties
WO2021131021A1 (en) 2019-12-27 2021-07-01 中外製薬株式会社 Anti-ctla-4 antibody and use thereof
WO2021129872A1 (en) 2019-12-27 2021-07-01 高诚生物医药(香港)有限公司 Anti-ox40 antibody and use thereof
US11053294B2 (en) 2018-09-27 2021-07-06 Xilio Development, Inc. Masked cytokine polypeptides
US11053308B2 (en) 2016-08-05 2021-07-06 Chugai Seiyaku Kabushiki Kaisha Method for treating IL-8-related diseases
WO2021142002A1 (en) 2020-01-06 2021-07-15 Vaccinex, Inc. Anti-ccr8 antibodies and uses thereof
WO2021140202A1 (en) 2020-01-08 2021-07-15 argenx BV Methods for treating pemphigus disorders
WO2021139777A1 (en) 2020-01-10 2021-07-15 上海复宏汉霖生物技术股份有限公司 Anti-tigit antibodies and usage method
EP3851118A1 (en) 2013-10-25 2021-07-21 Acceleron Pharma Inc. Endoglin peptides to treat fibrotic diseases
WO2021155149A1 (en) 2020-01-31 2021-08-05 Genentech, Inc. Methods of inducing neoepitope-specific t cells with a pd-1 axis binding antagonist and an rna vaccine
EP3862365A1 (en) 2016-01-08 2021-08-11 F. Hoffmann-La Roche AG Methods of treating cea-positive cancers using pd-1 axis binding antagonists and anti-cea/anti-cd3 bispecific antibodies
WO2021162020A1 (en) 2020-02-12 2021-08-19 中外製薬株式会社 Anti-cd137 antigen-binding molecule for use in cancer treatment
WO2021173844A1 (en) 2020-02-26 2021-09-02 Biograph 55, Inc. C19 c38 bispecific antibodies
WO2021170071A1 (en) 2020-02-28 2021-09-02 Shanghai Henlius Biotech, Inc. Anti-cd137 constructs, multispecific antibody and uses thereof
WO2021170067A1 (en) 2020-02-28 2021-09-02 上海复宏汉霖生物技术股份有限公司 Anti-cd137 construct and use thereof
WO2021176424A1 (en) 2020-03-06 2021-09-10 Ona Therapeutics, S.L. Anti-cd36 antibodies and their use to treat cancer
WO2021175954A1 (en) 2020-03-04 2021-09-10 Imcheck Therapeutics Sas Antibodies having specificity for btnl8 and uses thereof
WO2021177438A1 (en) 2020-03-06 2021-09-10 第一三共株式会社 Antibody-drug conjugate including novel cyclic dinucleotide derivative
EP3878866A1 (en) 2013-04-29 2021-09-15 F. Hoffmann-La Roche AG Fc-receptor binding modified asymmetric antibodies and methods of use
WO2021183207A1 (en) 2020-03-10 2021-09-16 Massachusetts Institute Of Technology COMPOSITIONS AND METHODS FOR IMMUNOTHERAPY OF NPM1c-POSITIVE CANCER
WO2021180205A1 (en) 2020-03-13 2021-09-16 江苏恒瑞医药股份有限公司 Pvrig binding protein and its medical uses
WO2021183849A1 (en) 2020-03-13 2021-09-16 Genentech, Inc. Anti-interleukin-33 antibodies and uses thereof
US11123426B2 (en) 2014-06-11 2021-09-21 The Trustees Of Dartmouth College Use of vista agonists and antagonists to suppress or enhance humoral immunity
WO2021188749A1 (en) 2020-03-19 2021-09-23 Genentech, Inc. Isoform-selective anti-tgf-beta antibodies and methods of use
WO2021195464A2 (en) 2020-03-26 2021-09-30 Genentech, Inc. Modified mammalian cells
WO2021194481A1 (en) 2020-03-24 2021-09-30 Genentech, Inc. Dosing for treatment with anti-tigit and anti-pd-l1 antagonist antibodies
WO2021195513A1 (en) 2020-03-27 2021-09-30 Novartis Ag Bispecific combination therapy for treating proliferative diseases and autoimmune disorders
WO2021194913A1 (en) 2020-03-24 2021-09-30 Genentech, Inc. Tie2-binding agents and methods of use
WO2021202235A1 (en) 2020-04-01 2021-10-07 University Of Rochester Monoclonal antibodies against the hemagglutinin (ha) and neuraminidase (na) of influenza h3n2 viruses
WO2021198034A1 (en) 2020-03-30 2021-10-07 F. Hoffmann-La Roche Ag Antibody that binds to vegf and pdgf-b and methods of use
WO2021198335A1 (en) 2020-04-01 2021-10-07 F. Hoffmann-La Roche Ag Bispecific antibodies comprising a modified c-terminal crossfab fragment
WO2021202959A1 (en) 2020-04-03 2021-10-07 Genentech, Inc. Therapeutic and diagnostic methods for cancer
WO2021207662A1 (en) 2020-04-10 2021-10-14 Genentech, Inc. Use of il-22fc for the treatment or prevention of pneumonia, acute respiratory distress syndrome, or cytokine release syndrome
WO2021207449A1 (en) 2020-04-09 2021-10-14 Merck Sharp & Dohme Corp. Affinity matured anti-lap antibodies and uses thereof
US11149088B2 (en) 2016-04-15 2021-10-19 Bioatla, Inc. Anti-Axl antibodies, antibody fragments and their immunoconjugates and uses thereof
EP3896091A1 (en) 2015-08-11 2021-10-20 Legend Biotech Ireland Limited Chimeric antigen receptors targeting bcma and methods of use thereof
WO2021217051A1 (en) 2020-04-24 2021-10-28 Genentech, Inc. Methods of using anti-cd79b immunoconjugates
WO2021214277A1 (en) 2020-04-24 2021-10-28 F. Hoffmann-La Roche Ag Enzyme and pathway modulation with sulfhydryl compounds and their derivatives
WO2021222935A2 (en) 2020-04-28 2021-11-04 The Rockefeller University Neutralizing anti-sars-cov-2 antibodies and methods of use thereof
WO2021220199A1 (en) 2020-04-30 2021-11-04 Novartis Ag Ccr7 antibody drug conjugates for treating cancer
WO2021219871A2 (en) 2020-04-30 2021-11-04 Aduro Biotech Holdings, Europe B.V. Anti-cd103 antibodies
WO2021222167A1 (en) 2020-04-28 2021-11-04 Genentech, Inc. Methods and compositions for non-small cell lung cancer immunotherapy
WO2021226551A1 (en) 2020-05-08 2021-11-11 Alpine Immune Sciences, Inc. April and baff inhibitory immunomodulatory proteins and methods of use thereof
WO2021225892A1 (en) 2020-05-03 2021-11-11 Levena (Suzhou) Biopharma Co., Ltd. Antibody-drug conjugates (adcs) comprising an anti-trop-2 antibody, compositions comprising such adcs, as well as methods of making and using the same
WO2021228956A1 (en) 2020-05-12 2021-11-18 INSERM (Institut National de la Santé et de la Recherche Médicale) New method to treat cutaneous t-cell lymphomas and tfh derived lymphomas
US11180557B2 (en) 2012-06-22 2021-11-23 King's College London Vista modulators for diagnosis and treatment of cancer
WO2021233834A1 (en) 2020-05-17 2021-11-25 Astrazeneca Uk Limited Sars-cov-2 antibodies and methods of selecting and using the same
WO2021234160A2 (en) 2020-05-22 2021-11-25 Formycon Ag Ace2 fusion proteins and uses thereof
WO2021238886A1 (en) 2020-05-27 2021-12-02 Staidson (Beijing) Biopharmaceuticals Co., Ltd. Antibodies specifically recognizing nerve growth factor and uses thereof
WO2021243204A1 (en) 2020-05-29 2021-12-02 23Andme, Inc. Anti-cd200r1 antibodies and methods of use thereof
WO2021247769A1 (en) 2020-06-02 2021-12-09 Dynamicure Biotechnology Llc Anti-cd93 constructs and uses thereof
EP3922649A1 (en) 2015-10-30 2021-12-15 F. Hoffmann-La Roche AG Anti-htra1 antibodies and methods of use thereof
WO2021249990A2 (en) 2020-06-08 2021-12-16 Hoffmann-La Roche Inc. Anti-hbv antibodies and methods of use
WO2021252977A1 (en) 2020-06-12 2021-12-16 Genentech, Inc. Methods and compositions for cancer immunotherapy
US11203638B2 (en) 2017-05-05 2021-12-21 Allakos Inc. Methods and compositions for treating perennial allergic conjunctivitis and keratoconjunctivitis
WO2021257503A1 (en) 2020-06-16 2021-12-23 Genentech, Inc. Methods and compositions for treating triple-negative breast cancer
WO2021257124A1 (en) 2020-06-18 2021-12-23 Genentech, Inc. Treatment with anti-tigit antibodies and pd-1 axis binding antagonists
WO2021259199A1 (en) 2020-06-22 2021-12-30 信达生物制药(苏州)有限公司 Anti-cd73 antibody and use thereof
WO2021259880A1 (en) 2020-06-22 2021-12-30 Almirall, S.A. Anti-il-36 antibodies and methods of use thereof
WO2021262791A1 (en) 2020-06-25 2021-12-30 Merck Sharp & Dohme Corp. High affinity antibodies targeting tau phosphorylated at serine 413
WO2021262783A1 (en) 2020-06-24 2021-12-30 Genentech, Inc. Apoptosis resistant cell lines
US11214619B2 (en) 2018-07-20 2022-01-04 Surface Oncology, Inc. Anti-CD112R compositions and methods
EP3936524A2 (en) 2015-05-11 2022-01-12 F. Hoffmann-La Roche AG Compositions and methods of treating lupus nephritis
WO2022008688A1 (en) 2020-07-10 2022-01-13 F. Hoffmann-La Roche Ag Antibodies which bind to cancer cells and target radionuclides to said cells
WO2022016037A1 (en) 2020-07-17 2022-01-20 Genentech, Inc. Anti-notch2 antibodies and methods of use
WO2022026763A1 (en) 2020-07-29 2022-02-03 Dynamicure Biotechnology Llc Anti-cd93 constructs and uses thereof
WO2022023735A1 (en) 2020-07-28 2022-02-03 Femtogenix Limited Cytotoxic agents
US11242392B2 (en) 2013-12-24 2022-02-08 Janssen Pharmaceutica Nv Anti-vista antibodies and fragments
US11242393B2 (en) 2018-03-23 2022-02-08 Bristol-Myers Squibb Company Antibodies against MICA and/or MICB and uses thereof
WO2022031749A1 (en) 2020-08-03 2022-02-10 Genentech, Inc. Diagnostic and therapeutic methods for lymphoma
WO2022031978A1 (en) 2020-08-06 2022-02-10 Bioverativ Usa Inc. Inflammatory cytokines and fatigue in subject with a complement mediated disease
WO2022034044A1 (en) 2020-08-10 2022-02-17 Astrazeneca Uk Limited Sars-cov-2 antibodies for treatment and prevention of covid-19
US11254748B2 (en) 2005-04-15 2022-02-22 Macrogenics, Inc. Covalent diabodies and uses thereof
WO2022043517A2 (en) 2020-08-27 2022-03-03 Cureab Gmbh Anti-golph2 antibodies for macrophage and dendritic cell differentiation
WO2022046644A1 (en) 2020-08-25 2022-03-03 Gilead Sciences, Inc. Multi-specific antigen binding molecules targeting hiv and methods of use
WO2022047222A2 (en) 2020-08-28 2022-03-03 Genentech, Inc. Crispr/cas9 multiplex knockout of host cell proteins
WO2022049165A1 (en) 2020-09-04 2022-03-10 F. Hoffmann-La Roche Ag Antibody that binds to vegf-a and ang2 and methods of use
WO2022050954A1 (en) 2020-09-04 2022-03-10 Genentech, Inc. Dosing for treatment with anti-tigit and anti-pd-l1 antagonist antibodies
US11274157B2 (en) 2017-01-12 2022-03-15 Eureka Therapeutics, Inc. Constructs targeting histone H3 peptide/MHC complexes and uses thereof
WO2022053715A1 (en) 2020-09-14 2022-03-17 Ichnos Sciences SA Antibodies that bind to il1rap and uses thereof
US11286300B2 (en) 2015-10-01 2022-03-29 Hoffmann-La Roche Inc. Humanized anti-human CD19 antibodies and methods of use
WO2022067262A1 (en) 2020-09-28 2022-03-31 Dynamicure Biotechnology Llc Anti-cd93 constructs and uses thereof
WO2022076462A1 (en) 2020-10-05 2022-04-14 Genentech, Inc. Dosing for treatment with anti-fcrh5/anti-cd3 bispecific antibodies
WO2022086957A1 (en) 2020-10-20 2022-04-28 Genentech, Inc. Peg-conjugated anti-mertk antibodies and methods of use
WO2022087149A2 (en) 2020-10-22 2022-04-28 Gilead Sciences, Inc. Interleukin-2-fc fusion proteins and methods of use
WO2022093981A1 (en) 2020-10-28 2022-05-05 Genentech, Inc. Combination therapy comprising ptpn22 inhibitors and pd-l1 binding antagonists
WO2022090801A2 (en) 2020-10-26 2022-05-05 Compugen Ltd. Pvrl2 and/or pvrig as biomarkers for treatment
WO2022090469A2 (en) 2020-10-29 2022-05-05 Formycon Ag Ace2 fusion proteins and uses thereof
WO2022098628A2 (en) 2020-11-04 2022-05-12 Genentech, Inc. Subcutaneous dosing of anti-cd20/anti-cd3 bispecific antibodies
WO2022097060A1 (en) 2020-11-06 2022-05-12 Novartis Ag Cd19 binding molecules and uses thereof
WO2022098870A1 (en) 2020-11-04 2022-05-12 The Rockefeller University Neutralizing anti-sars-cov-2 antibodies
WO2022097065A2 (en) 2020-11-06 2022-05-12 Novartis Ag ANTIBODY Fc VARIANTS
WO2022097061A1 (en) 2020-11-06 2022-05-12 Novartis Ag Anti-cd19 agent and b cell targeting agent combination therapy for treating b cell malignancies
WO2022098638A2 (en) 2020-11-04 2022-05-12 Genentech, Inc. Dosing for treatment with anti-cd20/anti-cd3 bispecific antibodies
WO2022098648A2 (en) 2020-11-04 2022-05-12 Genentech, Inc. Dosing for treatment with anti-cd20/anti-cd3 bispecific antibodies and anti-cd79b antibody drug conjugates
US11332524B2 (en) 2018-03-22 2022-05-17 Surface Oncology, Inc. Anti-IL-27 antibodies and uses thereof
US11332523B2 (en) 2014-05-28 2022-05-17 Academia Sinica Anti-TNF-alpha glycoantibodies and uses thereof
US11332533B2 (en) 2007-09-26 2022-05-17 Chugai Seiyaku Kabushiki Kaisha Modified antibody constant region
WO2022102634A1 (en) 2020-11-11 2022-05-19 第一三共株式会社 COMBINATION OF ANTIBODY-DRUG CONJUGATE WITH ANTI-SIRPα ANTIBODY
WO2022115451A1 (en) 2020-11-24 2022-06-02 Novartis Ag Mcl-1 inhibitor antibody-drug conjugates and methods of use
WO2022112942A2 (en) 2020-11-24 2022-06-02 Novartis Ag Anti-cd48 antibodies, antibody drug conjugates, and uses thereof
US11352403B2 (en) 2018-05-14 2022-06-07 Werewolf Therapeutics, Inc. Activatable interleukin-2 polypeptides and methods of use thereof
WO2022119976A1 (en) 2020-12-01 2022-06-09 Aptevo Research And Development Llc Heterodimeric psma and cd3-binding bispecific antibodies
US11359028B2 (en) 2016-11-09 2022-06-14 Agenus Inc. Anti-OX40 antibodies and anti-GITR antibodies
US11365239B2 (en) 2020-03-20 2022-06-21 Tsb Therapeutics (Beijing) Co., Ltd. Anti-SARS-COV-2 antibodies and uses thereof
WO2022130182A1 (en) 2020-12-14 2022-06-23 Novartis Ag Reversal binding agents for anti-natriuretic peptide receptor 1 (npr1) antibodies and uses thereof
WO2022129120A1 (en) 2020-12-17 2022-06-23 F. Hoffmann-La Roche Ag Anti-hla-g antibodies and use thereof
WO2022127793A1 (en) 2020-12-18 2022-06-23 珠海泰诺麦博生物技术有限公司 Respiratory syncytial virus-specific binding molecule
WO2022135467A1 (en) 2020-12-23 2022-06-30 信达生物制药(苏州)有限公司 Anti-b7-h3 antibody and uses thereof
WO2022140797A1 (en) 2020-12-23 2022-06-30 Immunowake Inc. Immunocytokines and uses thereof
US11377485B2 (en) 2009-12-02 2022-07-05 Academia Sinica Methods for modifying human antibodies by glycan engineering
US11384149B2 (en) 2013-08-09 2022-07-12 Macrogenics, Inc. Bi-specific monovalent Fc diabodies that are capable of binding CD32B and CD79b and uses thereof
WO2022148732A1 (en) 2021-01-06 2022-07-14 F. Hoffmann-La Roche Ag Combination therapy employing a pd1-lag3 bispecific antibody and a cd20 t cell bispecific antibody
US11390670B2 (en) 2016-12-19 2022-07-19 Medimmune Limited Antibodies against LIF and uses thereof
WO2022155324A1 (en) 2021-01-15 2022-07-21 The Rockefeller University Neutralizing anti-sars-cov-2 antibodies
WO2022152656A1 (en) 2021-01-12 2022-07-21 F. Hoffmann-La Roche Ag Split antibodies which bind to cancer cells and target radionuclides to said cells
WO2022152701A1 (en) 2021-01-13 2022-07-21 F. Hoffmann-La Roche Ag Combination therapy
US11401348B2 (en) 2009-09-02 2022-08-02 Xencor, Inc. Heterodimeric Fc variants
WO2022165275A2 (en) 2021-01-28 2022-08-04 Compugen Ltd. Combination therapy with anti-pvrig antibodies formulations and anti-pd-1-antibodies
WO2022165266A1 (en) 2021-01-28 2022-08-04 Compugen Ltd. Anti-pvrig antibodies formulations and uses thereof
WO2022163846A1 (en) 2021-02-01 2022-08-04 第一三共株式会社 Novel method for producing antibody-immunostimulator conjugate
WO2022169872A1 (en) 2021-02-03 2022-08-11 Genentech, Inc. Multispecific binding protein degrader platform and methods of use
WO2022187863A1 (en) 2021-03-05 2022-09-09 Dynamicure Biotechnology Llc Anti-vista constructs and uses thereof
WO2022187270A1 (en) 2021-03-01 2022-09-09 Xilio Development, Inc. Combination of ctla4 and pd1/pdl1 antibodies for treating cancer
WO2022187272A1 (en) 2021-03-01 2022-09-09 Xilio Development, Inc. Combination of masked ctla4 and pd1/pdl1 antibodies for treating cancer
WO2022184082A1 (en) 2021-03-03 2022-09-09 Sorrento Therapeutics, Inc. Antibody-drug conjugates comprising an anti-bcma antibody
WO2022184854A2 (en) 2021-03-03 2022-09-09 Formycon Ag Formulations of ace2 fc fusion proteins
WO2022192898A2 (en) 2021-03-10 2022-09-15 Immunowake Inc. Immunomodulatory molecules and uses thereof
WO2022192647A1 (en) 2021-03-12 2022-09-15 Genentech, Inc. Anti-klk7 antibodies, anti-klk5 antibodies, multispecific anti-klk5/klk7 antibodies, and methods of use
US11447573B2 (en) 2016-07-20 2022-09-20 Nanjing Legend Biotech Co., Ltd. Multispecific antigen binding proteins and methods of use thereof
US11447564B2 (en) 2017-04-26 2022-09-20 Eureka Therapeutics, Inc. Constructs specifically recognizing glypican 3 and uses thereof
WO2022197877A1 (en) 2021-03-19 2022-09-22 Genentech, Inc. Methods and compositions for time delayed bio-orthogonal release of cytotoxic agents
WO2022198192A1 (en) 2021-03-15 2022-09-22 Genentech, Inc. Compositions and methods of treating lupus nephritis
US11453710B2 (en) 2018-05-14 2022-09-27 Werewolf Therapeutics, Inc. Activatable interleukin 12 polypeptides and methods of use thereof
WO2022204724A1 (en) 2021-03-25 2022-09-29 Dynamicure Biotechnology Llc Anti-igfbp7 constructs and uses thereof
WO2022212645A1 (en) 2021-03-31 2022-10-06 Bioverativ Usa Inc. Reducing surgery-associated hemolysis in cold agglutinin disease patients
WO2022212876A1 (en) 2021-04-02 2022-10-06 The Regents Of The University Of California Antibodies against cleaved cdcp1 and uses thereof
US11471488B2 (en) 2016-07-28 2022-10-18 Alpine Immune Sciences, Inc. CD155 variant immunomodulatory proteins and uses thereof
US11472881B2 (en) 2016-10-11 2022-10-18 Nanjing Legend Biotech Co., Ltd. Single-domain antibodies and variants thereof against CTLA-4
WO2022221720A1 (en) 2021-04-16 2022-10-20 Novartis Ag Antibody drug conjugates and methods for making thereof
WO2022225880A1 (en) 2021-04-19 2022-10-27 Genentech, Inc. Modified mammalian cells
WO2022235867A2 (en) 2021-05-06 2022-11-10 The Rockefeller University Neutralizing anti-sars- cov-2 antibodies and methods of use thereof
WO2022236134A1 (en) 2021-05-07 2022-11-10 Surface Oncology, Inc. Anti-il-27 antibodies and uses thereof
WO2022236335A1 (en) 2021-05-07 2022-11-10 Alpine Immune Sciences, Inc. Methods of dosing and treatment with a taci-fc fusion immunomodulatory protein
WO2022241082A1 (en) 2021-05-14 2022-11-17 Genentech, Inc. Agonists of trem2
WO2022241446A1 (en) 2021-05-12 2022-11-17 Genentech, Inc. Methods of using anti-cd79b immunoconjugates to treat diffuse large b-cell lymphoma
WO2022246259A1 (en) 2021-05-21 2022-11-24 Genentech, Inc. Modified cells for the production of a recombinant product of interest
WO2022243261A1 (en) 2021-05-19 2022-11-24 F. Hoffmann-La Roche Ag Agonistic cd40 antigen binding molecules targeting cea
WO2022245671A1 (en) 2021-05-18 2022-11-24 Gilead Sciences, Inc. Methods of using flt3l-fc fusion proteins
US11510966B2 (en) 2016-04-15 2022-11-29 Evive Biotechnology (Shanghai) Ltd Use of IL-22 in treating necrotizing enterocolitis
US11525000B2 (en) 2016-04-15 2022-12-13 Immunext, Inc. Anti-human VISTA antibodies and use thereof
US11529416B2 (en) 2012-09-07 2022-12-20 Kings College London Vista modulators for diagnosis and treatment of cancer
WO2022263357A1 (en) 2021-06-14 2022-12-22 Argenx Iip Bv Anti-il-9 antibodies and methods of use thereof
WO2022266660A1 (en) 2021-06-17 2022-12-22 Amberstone Biosciences, Inc. Anti-cd3 constructs and uses thereof
WO2022270612A1 (en) 2021-06-25 2022-12-29 中外製薬株式会社 Use of anti-ctla-4 antibody
WO2022269451A1 (en) 2021-06-22 2022-12-29 Novartis Ag Bispecific antibodies for use in treatment of hidradenitis suppurativa
WO2022270611A1 (en) 2021-06-25 2022-12-29 中外製薬株式会社 Anti–ctla-4 antibody
WO2023279092A2 (en) 2021-07-02 2023-01-05 Genentech, Inc. Methods and compositions for treating cancer
WO2023275621A1 (en) 2021-07-01 2023-01-05 Compugen Ltd. Anti-tigit and anti-pvrig in monotherapy and combination treatments
WO2023283611A1 (en) 2021-07-08 2023-01-12 Staidson Biopharma Inc. Antibodies specifically recognizing tnfr2 and uses thereof
US11555038B2 (en) 2017-01-25 2023-01-17 Beigene, Ltd. Crystalline forms of (S)-7-(1-(but-2-ynoyl)piperidin-4-yl)-2-(4-phenoxyphenyl)-4,5,6,7-tetrahydropyrazolo[1,5-a]pyrimidine-3-carboxamide, preparation, and uses thereof
WO2023288241A1 (en) 2021-07-14 2023-01-19 Genentech, Inc. Anti-c-c motif chemokine receptor 8 (ccr8) antibodies and methods of use
WO2023288182A1 (en) 2021-07-12 2023-01-19 Genentech, Inc. Structures for reducing antibody-lipase binding
WO2023284714A1 (en) 2021-07-14 2023-01-19 舒泰神(北京)生物制药股份有限公司 Antibody that specifically recognizes cd40 and application thereof
WO2023004386A1 (en) 2021-07-22 2023-01-26 Genentech, Inc. Brain targeting compositions and methods of use thereof
WO2023001884A1 (en) 2021-07-22 2023-01-26 F. Hoffmann-La Roche Ag Heterodimeric fc domain antibodies
WO2023010095A1 (en) 2021-07-28 2023-02-02 F. Hoffmann-La Roche Ag Methods and compositions for treating cancer
WO2023007472A1 (en) 2021-07-30 2023-02-02 ONA Therapeutics S.L. Anti-cd36 antibodies and their use to treat cancer
WO2023011338A1 (en) 2021-08-02 2023-02-09 信达生物制药(苏州)有限公司 Anti-cd79b×cd3 bispecific antibody and use thereof
WO2023012147A1 (en) 2021-08-03 2023-02-09 F. Hoffmann-La Roche Ag Bispecific antibodies and methods of use
US11578372B2 (en) 2012-11-05 2023-02-14 Foundation Medicine, Inc. NTRK1 fusion molecules and uses thereof
WO2023019092A1 (en) 2021-08-07 2023-02-16 Genentech, Inc. Methods of using anti-cd79b immunoconjugates to treat diffuse large b-cell lymphoma
WO2023019239A1 (en) 2021-08-13 2023-02-16 Genentech, Inc. Dosing for anti-tryptase antibodies
US11584927B2 (en) 2014-08-28 2023-02-21 Bioatla, Inc. Conditionally active chimeric antigen receptors for modified T-cells
US11584793B2 (en) 2015-06-24 2023-02-21 Hoffmann-La Roche Inc. Anti-transferrin receptor antibodies with tailored affinity
WO2023021055A1 (en) 2021-08-19 2023-02-23 F. Hoffmann-La Roche Ag Multivalent anti-variant fc-region antibodies and methods of use
US11591388B2 (en) 2019-06-07 2023-02-28 argenx BV Pharmaceutical formulations of FcRn inhibitors suitable for subcutaneous administration
WO2023028591A1 (en) 2021-08-27 2023-03-02 Genentech, Inc. Methods of treating tau pathologies
US11597768B2 (en) 2017-06-26 2023-03-07 Beigene, Ltd. Immunotherapy for hepatocellular carcinoma
WO2023034750A1 (en) 2021-08-30 2023-03-09 Genentech, Inc. Anti-polyubiquitin multispecific antibodies
EP4155321A1 (en) 2021-06-04 2023-03-29 Chugai Seiyaku Kabushiki Kaisha Anti-ddr2 antibodies and uses thereof
WO2023052541A1 (en) 2021-09-30 2023-04-06 Imcheck Therapeutics Combination of an anti-btn3a activating antibody and an il-2 agonist for use in therapy
WO2023056403A1 (en) 2021-09-30 2023-04-06 Genentech, Inc. Methods for treatment of hematologic cancers using anti-tigit antibodies, anti-cd38 antibodies, and pd-1 axis binding antagonists
WO2023056362A1 (en) 2021-09-30 2023-04-06 Seagen Inc. B7-h4 antibody-drug conjugates for the treatment of cancer
WO2023056069A1 (en) 2021-09-30 2023-04-06 Angiex, Inc. Degrader-antibody conjugates and methods of using same
WO2023064958A1 (en) 2021-10-15 2023-04-20 Compugen Ltd. Combination therapy with anti-pvrig antibodies formulations, anti-tigit antibodies, and anti-pd-1 antibodies
WO2023079086A1 (en) 2021-11-05 2023-05-11 Astrazeneca Uk Limited Composition for treatment and prevention of covid-19
WO2023086807A1 (en) 2021-11-10 2023-05-19 Genentech, Inc. Anti-interleukin-33 antibodies and uses thereof
US11654135B2 (en) 2017-06-22 2023-05-23 Moonshot Pharma Llc Methods for treating colon cancer with compositions comprising amlexanox and immune checkpoint inhibitors
US11655303B2 (en) 2019-09-16 2023-05-23 Surface Oncology, Inc. Anti-CD39 antibody compositions and methods
US11654104B2 (en) 2013-11-07 2023-05-23 Evive Biotechnology (Shanghai) Ltd Use of IL-22 dimer in manufacture of a medicament for intravenous administration
WO2023091968A1 (en) 2021-11-17 2023-05-25 Disc Medicine, Inc. Methods for treating anemia of kidney disease
WO2023091887A1 (en) 2021-11-16 2023-05-25 Genentech, Inc. Methods and compositions for treating systemic lupus erythematosus (sle) with mosunetuzumab
WO2023088959A1 (en) 2021-11-16 2023-05-25 Ac Immune Sa Novel molecules for therapy and diagnosis
US11661452B2 (en) 2018-03-20 2023-05-30 WuXi Biologics Ireland Limited Anti-lag-3 antibody polypeptide
WO2023094571A1 (en) 2021-11-25 2023-06-01 Formycon Ag Stabilization of ace2 fusion proteins
WO2023094507A1 (en) 2021-11-24 2023-06-01 Formycon Ag Improved ace2 fusion proteins
US11673968B2 (en) 2014-06-26 2023-06-13 Hoffmann-La Roche Inc. Anti-BRDU antibodies and methods of use
WO2023114829A1 (en) 2021-12-15 2023-06-22 Genentech, Inc. Stabilized il-18 polypeptides and uses thereof
WO2023117834A1 (en) 2021-12-20 2023-06-29 F. Hoffmann-La Roche Ag Agonistic ltbr antibodies and bispecific antibodies comprising them
WO2023131901A1 (en) 2022-01-07 2023-07-13 Johnson & Johnson Enterprise Innovation Inc. Materials and methods of il-1beta binding proteins
US11701357B2 (en) 2016-08-19 2023-07-18 Beigene Switzerland Gmbh Treatment of B cell cancers using a combination comprising Btk inhibitors
WO2023139107A1 (en) 2022-01-18 2023-07-27 argenx BV Galectin-10 antibodies
WO2023141445A1 (en) 2022-01-19 2023-07-27 Genentech, Inc. Anti-notch2 antibodies and conjugates and methods of use
US11713353B2 (en) 2018-01-15 2023-08-01 Nanjing Legend Biotech Co., Ltd. Single-domain antibodies and variants thereof against PD-1
EP4219555A1 (en) 2013-12-23 2023-08-02 F. Hoffmann-La Roche AG Antibodies and methods of use
WO2023147399A1 (en) 2022-01-27 2023-08-03 The Rockefeller University Broadly neutralizing anti-sars-cov-2 antibodies targeting the n-terminal domain of the spike protein and methods of use thereof
US11739132B2 (en) 2019-05-14 2023-08-29 Werewolf Therapeutics, Inc. Separation moieties and methods of use thereof
WO2023168352A1 (en) 2022-03-03 2023-09-07 Yale University Humanized 3e10 antibodies, variants, and antigen binding fragments thereof
US11752207B2 (en) 2017-07-11 2023-09-12 Compass Therapeutics Llc Agonist antibodies that bind human CD137 and uses thereof
WO2023172883A1 (en) 2022-03-07 2023-09-14 Alpine Immune Sciences, Inc. Immunomodulatory proteins of variant cd80 polypeptides, cell therapies thereof and related methods and uses
WO2023173026A1 (en) 2022-03-10 2023-09-14 Sorrento Therapeutics, Inc. Antibody-drug conjugates and uses thereof
EP4245374A2 (en) 2022-03-18 2023-09-20 Compugen Ltd. Pvrl2 and/or pvrig as biomarkers for treatment
WO2023178357A1 (en) 2022-03-18 2023-09-21 Evolveimmune Therapeutics, Inc. Bispecific antibody fusion molecules and methods of use thereof
WO2023178192A1 (en) 2022-03-15 2023-09-21 Compugen Ltd. Il-18bp antagonist antibodies and their use in monotherapy and combination therapy in the treatment of cancer
EP4249066A2 (en) 2014-12-23 2023-09-27 Bristol-Myers Squibb Company Antibodies to tigit
US11771698B2 (en) 2013-01-18 2023-10-03 Foundation Medicine, Inc. Methods of treating cholangiocarcinoma
US11774452B2 (en) 2021-11-05 2023-10-03 American Diagnostics & Therapy, LLC Antibodies against carcinoembryonic antigens
WO2023186756A1 (en) 2022-03-28 2023-10-05 F. Hoffmann-La Roche Ag Interferon gamma variants and antigen binding molecules comprising these
WO2023191816A1 (en) 2022-04-01 2023-10-05 Genentech, Inc. Dosing for treatment with anti-fcrh5/anti-cd3 bispecific antibodies
WO2023187657A1 (en) 2022-03-30 2023-10-05 Novartis Ag Methods of treating disorders using anti-natriuretic peptide receptor 1 (npr1) antibodies
EP4257200A2 (en) 2015-03-06 2023-10-11 Takeda Pharmaceutical Company Limited Method of treating primary sclerosing cholangitis
US11786529B2 (en) 2017-11-29 2023-10-17 Beigene Switzerland Gmbh Treatment of indolent or aggressive B-cell lymphomas using a combination comprising BTK inhibitors
WO2023201299A1 (en) 2022-04-13 2023-10-19 Genentech, Inc. Pharmaceutical compositions of therapeutic proteins and methods of use
WO2023209177A1 (en) 2022-04-29 2023-11-02 Astrazeneca Uk Limited Sars-cov-2 antibodies and methods of using the same
WO2023215737A1 (en) 2022-05-03 2023-11-09 Genentech, Inc. Anti-ly6e antibodies, immunoconjugates, and uses thereof
WO2023217743A1 (en) 2022-05-10 2023-11-16 Imcheck Therapeutics Anti-btn3a antibodies for use in methods of treating gastro-intestinal inflammatory disorders
WO2023219613A1 (en) 2022-05-11 2023-11-16 Genentech, Inc. Dosing for treatment with anti-fcrh5/anti-cd3 bispecific antibodies
WO2023217933A1 (en) 2022-05-11 2023-11-16 F. Hoffmann-La Roche Ag Antibody that binds to vegf-a and il6 and methods of use
US11820830B2 (en) 2004-07-20 2023-11-21 Xencor, Inc. Optimized Fc variants
WO2023237928A2 (en) 2022-06-10 2023-12-14 Horizon Therapeutics Ireland Dac Igf1r antibodies
WO2023239803A1 (en) 2022-06-08 2023-12-14 Angiex, Inc. Anti-tm4sf1 antibody-drug conjugates comprising cleavable linkers and methods of using same
WO2023240058A2 (en) 2022-06-07 2023-12-14 Genentech, Inc. Prognostic and therapeutic methods for cancer
WO2023242372A1 (en) 2022-06-15 2023-12-21 argenx BV Fcrn/hsa binding molecules and methods of use
WO2023245048A1 (en) 2022-06-15 2023-12-21 Bioverativ Usa Inc. Anti-complement c1s antibody formulation
WO2023250507A1 (en) 2022-06-24 2023-12-28 Bioverativ Usa Inc. Methods for treating complement-mediated diseases
US11866505B2 (en) 2021-02-17 2024-01-09 Prometheus Biosciences, Inc. Anti-CD30L antibodies and uses thereof
WO2024015897A1 (en) 2022-07-13 2024-01-18 Genentech, Inc. Dosing for treatment with anti-fcrh5/anti-cd3 bispecific antibodies
WO2024020579A1 (en) 2022-07-22 2024-01-25 Bristol-Myers Squibb Company Antibodies binding to human pad4 and uses thereof
WO2024020564A1 (en) 2022-07-22 2024-01-25 Genentech, Inc. Anti-steap1 antigen-binding molecules and uses thereof
WO2024020432A1 (en) 2022-07-19 2024-01-25 Genentech, Inc. Dosing for treatment with anti-fcrh5/anti-cd3 bispecific antibodies
WO2024020407A1 (en) 2022-07-19 2024-01-25 Staidson Biopharma Inc. Antibodies specifically recognizing b- and t-lymphocyte attenuator (btla) and uses thereof
US11884739B2 (en) 2014-05-27 2024-01-30 Academia Sinica Anti-CD20 glycoantibodies and uses thereof
WO2024026496A1 (en) 2022-07-28 2024-02-01 Compugen Ltd. Combination therapy with anti-pvrig antibodies formulations and anti-pd-1 antibodies
US11891432B2 (en) 2018-03-15 2024-02-06 Chugai Seiyaku Kabushiki Kaisha Anti-dengue virus antibodies having cross-reactivity to Zika virus and methods of use
WO2024028731A1 (en) 2022-08-05 2024-02-08 Janssen Biotech, Inc. Transferrin receptor binding proteins for treating brain tumors
WO2024028732A1 (en) 2022-08-05 2024-02-08 Janssen Biotech, Inc. Cd98 binding constructs for treating brain tumors
US11905327B2 (en) 2017-12-28 2024-02-20 Nanjing Legend Biotech Co., Ltd. Single-domain antibodies and variants thereof against TIGIT
WO2024037633A2 (en) 2022-08-19 2024-02-22 Evive Biotechnology (Shanghai) Ltd Formulations comprising g-csf and uses thereof
US11912754B2 (en) 2017-10-12 2024-02-27 Immunowake Inc. VEGFR-antibody light chain fusion protein
WO2024044675A1 (en) 2022-08-25 2024-02-29 Beigene, Ltd. Methods of cancer treatment using anti-pd1 antibodies in combination with anti-tim3 antibodies
WO2024049949A1 (en) 2022-09-01 2024-03-07 Genentech, Inc. Therapeutic and diagnostic methods for bladder cancer
WO2024052503A1 (en) 2022-09-08 2024-03-14 Institut National de la Santé et de la Recherche Médicale Antibodies having specificity to ltbp2 and uses thereof
WO2024054929A1 (en) 2022-09-07 2024-03-14 Dynamicure Biotechnology Llc Anti-vista constructs and uses thereof
US11932685B2 (en) 2007-10-31 2024-03-19 Xencor, Inc. Fc variants with altered binding to FcRn
US11939383B2 (en) 2018-03-02 2024-03-26 Five Prime Therapeutics, Inc. B7-H4 antibodies and methods and use thereof
WO2024077239A1 (en) 2022-10-07 2024-04-11 Genentech, Inc. Methods of treating cancer with anti-c-c motif chemokine receptor 8 (ccr8) antibodies
WO2024074498A1 (en) 2022-10-04 2024-04-11 Imcheck Therapeutics Combination of a btn3a activating antibody, a bcl2 inhibitor and hypomethylating agent for use in treating cancer
WO2024077018A2 (en) 2022-10-04 2024-04-11 Alpine Immune Sciences, Inc. Methods and uses of taci-fc fusion immunomodulatory protein
US11958903B2 (en) 2018-03-30 2024-04-16 Nanjing Legend Biotech Co., Ltd. Single-domain antibodies against LAG-3 and uses thereof
US11970539B2 (en) 2020-09-14 2024-04-30 Ichnos Sciences SA Antibodies that bind to IL1RAP and uses thereof

Families Citing this family (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7179892B2 (en) 2000-12-06 2007-02-20 Neuralab Limited Humanized antibodies that recognize beta amyloid peptide
US7132100B2 (en) 2002-06-14 2006-11-07 Medimmune, Inc. Stabilized liquid anti-RSV antibody formulations
US8946387B2 (en) 2002-08-14 2015-02-03 Macrogenics, Inc. FcγRIIB specific antibodies and methods of use thereof
US8968730B2 (en) 2002-08-14 2015-03-03 Macrogenics Inc. FcγRIIB specific antibodies and methods of use thereof
US7960512B2 (en) 2003-01-09 2011-06-14 Macrogenics, Inc. Identification and engineering of antibodies with variant Fc regions and methods of using same
WO2007094842A2 (en) 2005-12-02 2007-08-23 Genentech, Inc. Binding polypeptides and uses thereof
JP5898082B2 (en) 2009-10-07 2016-04-06 マクロジェニクス,インコーポレーテッド Fc region-containing polypeptide exhibiting improved effector function by changing the degree of fucosylation and use thereof
JO3437B1 (en) * 2009-10-30 2019-10-20 Esai R & D Man Co Ltd Improved anti human Fraktalkine antibodies and uses thereof
HUE028629T2 (en) * 2009-12-23 2016-12-28 Synimmune Gmbh Anti-flt3 antibodies and methods of using the same
US8362210B2 (en) 2010-01-19 2013-01-29 Xencor, Inc. Antibody variants with enhanced complement activity
AU2012277376B2 (en) 2011-06-30 2016-11-24 Compugen Ltd. Polypeptides and uses thereof for treatment of autoimmune disorders and infection
US9487587B2 (en) 2013-03-05 2016-11-08 Macrogenics, Inc. Bispecific molecules that are immunoreactive with immune effector cells of a companion animal that express an activating receptor and cells that express B7-H3 and uses thereof
US8986691B1 (en) 2014-07-15 2015-03-24 Kymab Limited Method of treating atopic dermatitis or asthma using antibody to IL4RA
US8980273B1 (en) 2014-07-15 2015-03-17 Kymab Limited Method of treating atopic dermatitis or asthma using antibody to IL4RA

Non-Patent Citations (8)

* Cited by examiner, † Cited by third party
Title
EUROPEAN JOURNAL OF IMMUNOLOGY, vol.23, 1993 pages 1098 - 1104 GREENWOOD J. ET AL. 'Structural motifs involved in human IgG antibody effector functions' cited in the application *
INTERNATIONAL REVIEWS OF IMMUNOLOGY, vol.10, June 1993, LONDON GB pages 241 - 250 JOLIFFE L. K. 'Humanized antibodies: enhancing therapeutic utility through antibody engineering' *
JOURNAL OF IMMUNOLOGY, vol.125, 1980, BALTIMORE US pages 293 - 299 LAMPSON L. A. ET AL. 'Two populationS of Ia-like molecules on a human B cell line' cited in the application *
JOURNAL OF IMMUNOLOGY, vol.148, June 1992, BALTIMORE US pages 3461 - 3468 ALEGRE M.-L. ET AL. 'Effect of a single amino acid mutation on the activating and immunosuppressive properties of a "humanized" OKT3 monoclonal antibody' cited in the application *
NATURE, vol.332, 1988, LONDON GB pages 738 - 740 DUNCAN A.R. ET AL. 'The binding site for C1q on IgG' cited in the application *
PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF USA, vol.80, 1983, WASHINGTON US pages 6632 - 6636 NOSE M. ET AL. 'Biological significance of carbohydrate chains on monoclonal antibodies' *
PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF USA, vol.88, October 1991, WASHINGTON US pages 9036 - 9040 CHAPPEL M. S. ET AL. 'Identification of the Fcgamma receptor class I binding site in human IgG through the use of recombinant IgG1/IgG2 hybrid and point-mutated antibodies' cited in the application *
THE JOURNAL OF EXPERIMENTAL MEDICINE, vol.173, no.4, April 1991 pages 1025 - 1028 TAO M.-H. ET AL. 'The differential ability of human IgG1 and IgG4 to activate complement is determined by the COOH-terminal seqence of the Ch2 domain' cited in the application *

Cited By (1613)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7923221B1 (en) * 1983-04-08 2011-04-12 Genentech, Inc Methods of making antibody heavy and light chains having specificity for a desired antigen
US6204007B1 (en) 1994-03-29 2001-03-20 Celltech Therapeutics Limited Antibodies against E-selectin
US6407214B1 (en) 1994-03-29 2002-06-18 Celltech Therapeutics Limited Antibodies against E-selectin
US8562994B2 (en) 1994-08-15 2013-10-22 Medimmune, Llc Human-murine chimeric antibodies against respiratory syncytial virus
US7704505B2 (en) 1994-08-15 2010-04-27 Medimmune, Llc Human-murine chimeric antibodies against respiratory syncytial virus
WO1996008512A1 (en) * 1994-09-16 1996-03-21 Austin Research Institute Cancer And Anti-Inflammatory Syndicate No. 1 POLYPEPTIDES WITH Fc BINDING ABILITY
US7803904B2 (en) 1995-09-01 2010-09-28 Millennium Pharmaceuticals, Inc. Mucosal vascular addressing and uses thereof
US8277808B2 (en) 1995-09-01 2012-10-02 Millennium Pharmaceuticals, Inc. Mucosal vascular addressins and uses thereof
US7247302B1 (en) 1996-08-02 2007-07-24 Bristol-Myers Squibb Company Method for inhibiting immunoglobulin-induced toxicity resulting from the use of immunoglobulins in therapy and in vivo diagnosis
US7147851B1 (en) 1996-08-15 2006-12-12 Millennium Pharmaceuticals, Inc. Humanized immunoglobulin reactive with α4β7 integrin
US7402410B2 (en) 1996-08-15 2008-07-22 Millennium Pharmaceuticals, Inc. Humanized immunoglobulin reactive with α4β7 integrin
WO1999032659A1 (en) * 1997-12-22 1999-07-01 Stiftelsen Universitetsforskning Bergen (Unifob) METHOD FOR DISEASE PROGNOSIS BASED ON Fc RECEPTOR GENOTYPING
US6194551B1 (en) 1998-04-02 2001-02-27 Genentech, Inc. Polypeptide variants
US7297775B2 (en) 1998-04-02 2007-11-20 Genentech, Inc. Polypeptide variants
US6528624B1 (en) 1998-04-02 2003-03-04 Genentech, Inc. Polypeptide variants
US6538124B1 (en) 1998-04-02 2003-03-25 Genentech, Inc. Polypeptide variants
US7364731B2 (en) 1998-04-02 2008-04-29 Genentech, Inc. Polypeptide variants
US6242195B1 (en) 1998-04-02 2001-06-05 Genentech, Inc. Methods for determining binding of an analyte to a receptor
US7741072B2 (en) 1998-04-02 2010-06-22 Genentech, Inc. Polypeptide variants
WO1999051642A1 (en) * 1998-04-02 1999-10-14 Genentech, Inc. Antibody variants and fragments thereof
US7597889B1 (en) * 1998-05-08 2009-10-06 Cambridge Enterprise Limited Binding molecules derived from immunoglobulins which do not trigger complement mediated lysis
US7183387B1 (en) 1999-01-15 2007-02-27 Genentech, Inc. Polypeptide variants with altered effector function
EP2386574A2 (en) 1999-01-15 2011-11-16 Genentech, Inc. Polypeptide variants with altered effector function
US7332581B2 (en) 1999-01-15 2008-02-19 Genentech, Inc. Polypeptide variants with altered effector function
US7335742B2 (en) 1999-01-15 2008-02-26 Genentech, Inc. Polypeptide variants with altered effector function
US7416727B2 (en) 1999-01-15 2008-08-26 Genentech, Inc. Polypeptide variants with altered effector function
US6737056B1 (en) 1999-01-15 2004-05-18 Genentech, Inc. Polypeptide variants with altered effector function
EP2366713A2 (en) 1999-01-15 2011-09-21 Genentech, Inc. Polypeptide variants with altered effector function
US7122637B2 (en) 1999-01-15 2006-10-17 Genentech, Inc. Polypeptide variants with altered effector function
US7371826B2 (en) 1999-01-15 2008-05-13 Genentech, Inc. Polypeptide variants with altered effector function
US8163882B2 (en) 1999-01-15 2012-04-24 Genentech, Inc. Polypeptide variants with altered effector function
EP2364997A2 (en) 1999-01-15 2011-09-14 Genentech, Inc. Polypeptide variants with altered effector function
US7785791B2 (en) 1999-01-15 2010-08-31 Genentech, Inc. Polypeptide variants with altered effector function
US7790858B2 (en) 1999-01-15 2010-09-07 Genentech, Inc. Polypeptide variants with altered effector function
US7666421B2 (en) 1999-02-12 2010-02-23 Genetics Institute, Llc Methods of treatment of autoimmune diseases using humanized immunoglobulin reactive with B7-2
US7531175B2 (en) 1999-02-12 2009-05-12 Genetics Institute Llc Methods for modulation of immune responses using humanized immunoglobulins reactive with B7-1 molecules
EP2857516A1 (en) 2000-04-11 2015-04-08 Genentech, Inc. Multivalent antibodies and uses therefor
WO2001077342A1 (en) 2000-04-11 2001-10-18 Genentech, Inc. Multivalent antibodies and uses therefor
US7416726B2 (en) 2000-04-13 2008-08-26 The Rockefeller University Enhancement of antibody-mediated immune responses
EP2298348A1 (en) 2000-04-14 2011-03-23 Millennium Pharmaceuticals, Inc. Antibody binding alpha4Beta7 integrin and its use to treat inflammatory bowel disease
EP3167902A1 (en) 2000-04-14 2017-05-17 Millennium Pharmaceuticals, Inc. Antibody binding alpha4beta7 integrin and its use to treat inflammatory bowel disease
US8604162B2 (en) 2000-04-21 2013-12-10 Fuso Pharmaceutical Industries, Ltd. Collectin
US7985833B2 (en) 2000-04-21 2011-07-26 Fuso Pharmaceutical Industries, Ltd. Collectin
EP2251026A1 (en) 2000-06-08 2010-11-17 Immune Disease Institute, Inc. Methods and compositions for inhibiting immunoglobulin-mediated reperfusion injury
US8012476B2 (en) 2000-12-12 2011-09-06 Medimmune, Llc Molecules with extended half-lives, compositions and uses thereof
US8475792B2 (en) 2000-12-12 2013-07-02 Medimmune, Llc Molecules with extended half-lives, compositions and uses thereof
US8795661B2 (en) 2000-12-12 2014-08-05 Medimmune, Llc Molecules with extended half-lives, compositions and uses thereof
US7670600B2 (en) 2000-12-12 2010-03-02 MedImmine, LLC Molecules with extended half-lives, compositions and uses thereof
US7704497B2 (en) 2000-12-12 2010-04-27 Medimmune, Llc Molecules with extended half-lives, compositions and uses thereof
US7083784B2 (en) 2000-12-12 2006-08-01 Medimmune, Inc. Molecules with extended half-lives, compositions and uses thereof
US7658921B2 (en) 2000-12-12 2010-02-09 Medimmune, Llc Molecules with extended half-lives, compositions and uses thereof
US8323962B2 (en) 2000-12-12 2012-12-04 Medimmune, Llc Molecules with extended half-lives, compositions and uses thereof
US9562100B2 (en) 2000-12-12 2017-02-07 Medimmune Llc Molecules with extended half-lives, compositions and uses thereof
US9688775B2 (en) 2001-08-27 2017-06-27 Genentech, Inc. System for antibody expression and assembly
US7262278B2 (en) 2001-10-15 2007-08-28 Kirin Beer Kabushiki Kaisha Anti-HLA-DR antibody
US7053202B2 (en) 2001-10-19 2006-05-30 Millennium Pharmaceuticals, Inc. Immunoglobulin DNA cassette molecules, monobody constructs, methods of production, and methods of use therefor
US8093357B2 (en) 2002-03-01 2012-01-10 Xencor, Inc. Optimized Fc variants and methods for their generation
US8124731B2 (en) 2002-03-01 2012-02-28 Xencor, Inc. Optimized Fc variants and methods for their generation
US7662925B2 (en) 2002-03-01 2010-02-16 Xencor, Inc. Optimized Fc variants and methods for their generation
US8734791B2 (en) 2002-03-01 2014-05-27 Xencor, Inc. Optimized fc variants and methods for their generation
US8187593B2 (en) 2002-08-14 2012-05-29 Macrogenics, Inc. FcγRIIB specific antibodies and methods of use thereof
US8530627B2 (en) 2002-08-14 2013-09-10 Macrogenics, Inc. FcγRIIB specific antibodies and methods of use thereof
US8039592B2 (en) 2002-09-27 2011-10-18 Xencor, Inc. Optimized Fc variants and methods for their generation
US8093359B2 (en) 2002-09-27 2012-01-10 Xencor, Inc. Optimized Fc variants and methods for their generation
US10183999B2 (en) 2002-09-27 2019-01-22 Xencor, Inc. Optimized Fc variants and methods for their generation
US9193798B2 (en) 2002-09-27 2015-11-24 Xencor, Inc. Optimized Fc variants and methods for their generation
US10184000B2 (en) 2002-09-27 2019-01-22 Xencor, Inc. Optimized Fc variants and methods for their generation
US9353187B2 (en) 2002-09-27 2016-05-31 Xencor, Inc. Optimized FC variants and methods for their generation
US8188231B2 (en) 2002-09-27 2012-05-29 Xencor, Inc. Optimized FC variants
US8809503B2 (en) 2002-09-27 2014-08-19 Xencor, Inc. Optimized Fc variants and methods for their generation
US8383109B2 (en) 2002-09-27 2013-02-26 Xencor, Inc. Optimized Fc variants and methods for their generation
US8858937B2 (en) 2002-09-27 2014-10-14 Xencor, Inc. Optimized Fc variants and methods for their generation
WO2004074430A2 (en) * 2002-12-06 2004-09-02 Diadexus, Inc. Compositions, splice variants and methods relating to lung specific genes and proteins
WO2004074430A3 (en) * 2002-12-06 2004-12-16 Diadexus Inc Compositions, splice variants and methods relating to lung specific genes and proteins
US9028815B2 (en) 2003-01-09 2015-05-12 Macrogenics, Inc. Identification and engineering of antibodies with variant FC regions and methods of using same
US7355008B2 (en) 2003-01-09 2008-04-08 Macrogenics, Inc. Identification and engineering of antibodies with variant Fc regions and methods of using same
US10584176B2 (en) 2003-03-03 2020-03-10 Xencor, Inc. Fc variants with increased affinity for FcγRIIc
US8084582B2 (en) 2003-03-03 2011-12-27 Xencor, Inc. Optimized anti-CD20 monoclonal antibodies having Fc variants
US8735545B2 (en) 2003-03-03 2014-05-27 Xencor, Inc. Fc variants having increased affinity for fcyrllc
US9657106B2 (en) 2003-03-03 2017-05-23 Xencor, Inc. Optimized Fc variants
US10113001B2 (en) 2003-03-03 2018-10-30 Xencor, Inc. Fc variants with increased affinity for FcyRIIc
US9663582B2 (en) 2003-03-03 2017-05-30 Xencor, Inc. Optimized Fc variants
US8388955B2 (en) 2003-03-03 2013-03-05 Xencor, Inc. Fc variants
US7495085B2 (en) 2003-03-14 2009-02-24 Wyeth Antibodies against human or mouse IL-21 receptor
US8143385B2 (en) 2003-03-14 2012-03-27 Wyeth Llc Nucleic acids coding for antibodies against human IL-21 receptor and uses therefor
EP2184298A1 (en) 2003-03-14 2010-05-12 Wyeth a Corporation of the State of Delaware Antibodies against human IL-21 receptor and uses therefor
US9051373B2 (en) 2003-05-02 2015-06-09 Xencor, Inc. Optimized Fc variants
EP1620467A2 (en) * 2003-05-02 2006-02-01 Xencor, Inc. Optimized fc variants and methods for their generation
AU2008229860B2 (en) * 2003-05-02 2012-01-12 Xencor, Inc Optimized Fc variants and methods for their generation
US8603473B2 (en) 2003-06-27 2013-12-10 Biogen Idec Ma Inc. Modified binding molecules comprising connecting peptides
US7700097B2 (en) 2003-06-27 2010-04-20 Biogen Idec Ma Inc. Purification and preferential synthesis of binding molecules
US8318917B2 (en) 2003-08-22 2012-11-27 Biogen Idec Ma Inc. Nucleic acids encoding antibodies having altered effector function and methods for making the same
US7863419B2 (en) 2003-08-22 2011-01-04 Biogen Idec Ma Inc. Antibodies having altered effector function and methods for making the same
US9714282B2 (en) 2003-09-26 2017-07-25 Xencor, Inc. Optimized Fc variants and methods for their generation
EP2383295A1 (en) 2003-12-10 2011-11-02 Medarex, Inc. IP-10 antibodies and their uses
EP2418220A2 (en) 2003-12-10 2012-02-15 Medarex, Inc. Interferon alpha antibodies and their uses
EP2135619A1 (en) 2003-12-10 2009-12-23 Millennium Pharmaceuticals, Inc. Humanized anti-CCR2 antibodies and methods of use therefor
EP2865687A1 (en) 2003-12-10 2015-04-29 E. R. Squibb & Sons, L.L.C. IP-10 antibodies and their uses
EP2275448A2 (en) 2003-12-19 2011-01-19 Genentech, Inc. Monovalent antibody fragments useful as therapeutics
WO2005070963A1 (en) * 2004-01-12 2005-08-04 Applied Molecular Evolution, Inc Fc region variants
EA009746B1 (en) * 2004-01-12 2008-04-28 Эпплайд Молекьюлар Эволюшн, Инк. Fc region variants
EP2290077A2 (en) 2004-03-01 2011-03-02 Immune Disease Institute, Inc. Natural IGM antibodies and inhibitors thereof
US7824684B2 (en) 2004-04-13 2010-11-02 Hoffmann-La Roche Inc. Methods of inhibiting the binding of P-selectin to PSGL-1 with anti-P-selectin antibodies
USRE44389E1 (en) 2004-04-13 2013-07-23 Hoffman-La Roche Inc. Methods of inhibiting the binding of P-selectin to PSGL-1 with anti-P-selectin antibodies
USRE44359E1 (en) 2004-04-13 2013-07-09 Hoffmann-La Roche Inc Nucleic acid molecules encoding anti-P-selectin antibodies
US7754867B2 (en) 2004-04-13 2010-07-13 Hoffmann-La Roche Inc. Nucleic acid molecules encoding anti-P-selectin antibodies
US7563441B2 (en) * 2004-04-13 2009-07-21 Hoffman-La Roche Inc. Anti-P-selectin antibodies
USRE43568E1 (en) 2004-04-13 2012-08-07 Hoffmann-La Roche Inc. Anti-P-selectin antibodies
US8133982B2 (en) 2004-05-10 2012-03-13 Macrogenics, Inc. FcγRIIB specific antibodies and methods of use thereof
EP2662390A1 (en) 2004-06-21 2013-11-13 Medarex, L.L.C. Interferon alpha receptor 1 antibodies and their uses
US11820830B2 (en) 2004-07-20 2023-11-21 Xencor, Inc. Optimized Fc variants
US8647625B2 (en) 2004-07-26 2014-02-11 Biogen Idec Ma Inc. Anti-CD154 antibodies
US8961976B2 (en) 2004-07-26 2015-02-24 Biogen Idec Ma Inc. Anti-CD154 antibodies
US7740847B2 (en) 2004-08-04 2010-06-22 Applied Molecular Evolution, Inc. Variant Fc regions
US7476724B2 (en) 2004-08-05 2009-01-13 Genentech, Inc. Humanized anti-cmet antibodies
US7659374B2 (en) 2004-08-16 2010-02-09 Medimmune, Llc Eph receptor Fc variants with enhanced antibody dependent cell-mediated cytotoxicity activity
EP2322556A1 (en) 2004-09-03 2011-05-18 Genentech, Inc. Humanized anti-beta7 antagonists and uses therefor
US7528236B2 (en) 2004-09-03 2009-05-05 Genentech, Inc. Humanized anti-beta7 antagonists and uses therefor
US8835133B2 (en) 2004-09-03 2014-09-16 Genentech, Inc. Humanized anti-beta7 antagonists and uses therefor
US8124082B2 (en) 2004-09-03 2012-02-28 Genentech, Inc. Humanized anti-beta7 antagonists and uses therefor
US7687605B2 (en) 2004-09-03 2010-03-30 Genentech, Inc. Humanized anti-beta7 antagonists and uses therefor
US8779100B2 (en) 2004-09-03 2014-07-15 Genentech, Inc. Humanized anti-beta7 antagonists and uses therefor
US8101720B2 (en) 2004-10-21 2012-01-24 Xencor, Inc. Immunoglobulin insertions, deletions and substitutions
US7632497B2 (en) 2004-11-10 2009-12-15 Macrogenics, Inc. Engineering Fc Antibody regions to confer effector function
US8802820B2 (en) 2004-11-12 2014-08-12 Xencor, Inc. Fc variants with altered binding to FcRn
US9200079B2 (en) 2004-11-12 2015-12-01 Xencor, Inc. Fc variants with altered binding to FcRn
US9803023B2 (en) 2004-11-12 2017-10-31 Xencor, Inc. Fc variants with altered binding to FcRn
US8546543B2 (en) 2004-11-12 2013-10-01 Xencor, Inc. Fc variants that extend antibody half-life
US8852586B2 (en) 2004-11-12 2014-10-07 Xencor, Inc. Fc variants with altered binding to FcRn
US8367805B2 (en) 2004-11-12 2013-02-05 Xencor, Inc. Fc variants with altered binding to FcRn
US8883973B2 (en) 2004-11-12 2014-11-11 Xencor, Inc. Fc variants with altered binding to FcRn
US11198739B2 (en) 2004-11-12 2021-12-14 Xencor, Inc. Fc variants with altered binding to FcRn
US8324351B2 (en) 2004-11-12 2012-12-04 Xencor, Inc. Fc variants with altered binding to FcRn
US8338574B2 (en) 2004-11-12 2012-12-25 Xencor, Inc. FC variants with altered binding to FCRN
US8318907B2 (en) 2004-11-12 2012-11-27 Xencor, Inc. Fc variants with altered binding to FcRn
US10336818B2 (en) 2004-11-12 2019-07-02 Xencor, Inc. Fc variants with altered binding to FcRn
EP2476705A1 (en) 2004-12-28 2012-07-18 Innate Pharma Monoclonal antibodies against NKG2A
EP3026063A1 (en) 2004-12-28 2016-06-01 Innate Pharma S.A. Monoclonal antibodies against nkg2a
US7700099B2 (en) 2005-02-14 2010-04-20 Merck & Co., Inc. Non-immunostimulatory antibody and compositions containing the same
WO2006089133A2 (en) 2005-02-15 2006-08-24 Duke University Anti-cd19 antibodies and uses in oncology
EP2548575A1 (en) 2005-02-15 2013-01-23 Duke University Anti-CD19 antibodies that mediate ADCC for use in treating autoimmune diseases
EP2535355A2 (en) 2005-03-23 2012-12-19 Genmab A/S Antibodies against CD38 for treatment of multiple myeloma
EP2567976A2 (en) 2005-03-23 2013-03-13 Genmab A/S Antibodies against CD38 for treatment of multiple myeloma
EP3312196A1 (en) 2005-03-23 2018-04-25 Genmab A/S Antibodies against cd38 for treatment of multiple myeloma
EP3153525A1 (en) 2005-03-23 2017-04-12 Genmab A/S Antibodies against cd38 for treatment of multiple myeloma
EP2551282A2 (en) 2005-03-23 2013-01-30 Genmab A/S Antibodies against CD38 for treatment of multiple myeloma
US9284375B2 (en) 2005-04-15 2016-03-15 Macrogenics, Inc. Covalent diabodies and uses thereof
US11254748B2 (en) 2005-04-15 2022-02-22 Macrogenics, Inc. Covalent diabodies and uses thereof
US10093739B2 (en) 2005-04-15 2018-10-09 Macrogenics, Inc. Covalent diabodies and uses thereof
US11254747B2 (en) 2005-04-15 2022-02-22 Macrogenics, Inc. Covalent diabodies and uses thereof
US9296816B2 (en) 2005-04-15 2016-03-29 Macrogenics, Inc. Covalent diabodies and uses thereof
US10093738B2 (en) 2005-04-15 2018-10-09 Macrogenics, Inc. Covalent diabodies and uses thereof
US9889197B2 (en) 2005-04-15 2018-02-13 Macrogenics, Inc. Covalently-associated diabody complexes that possess charged coil domains and that are capable of enhanced binding to serum albumin
US9963510B2 (en) 2005-04-15 2018-05-08 Macrogenics, Inc. Covalent diabodies and uses thereof
US8697396B2 (en) 2005-04-26 2014-04-15 Medimmune, Llc Modulation of antibody effector function by hinge domain engineering
US8008443B2 (en) 2005-04-26 2011-08-30 Medimmune, Llc Modulation of antibody effector function by hinge domain engineering
EP2221316A1 (en) 2005-05-05 2010-08-25 Duke University Anti-CD19 antibody therapy for autoimmune disease
EP3530736A2 (en) 2005-05-09 2019-08-28 ONO Pharmaceutical Co., Ltd. Human monoclonal antibodies to programmed death 1 (pd-1) and methods for treating cancer using anti-pd-1 antibodies alone or in combination with other immunotherapeutics
EP2418278A2 (en) 2005-05-09 2012-02-15 Ono Pharmaceutical Co., Ltd. Human monoclonal antibodies to programmed death 1(PD-1) and methods for treating cancer using anti-PD-1 antibodies alone or in combination with other immunotherapeutics
EP2161336A1 (en) 2005-05-09 2010-03-10 ONO Pharmaceutical Co., Ltd. Human monoclonal antibodies to programmed death 1(PD-1) and methods for treating cancer using anti-PD-1 antibodies alone or in combination with other immunotherapeutics
EP2439272A2 (en) 2005-05-09 2012-04-11 Ono Pharmaceutical Co., Ltd. Human monoclonal antibodies to programmed death 1(PD-1) and methods for treating cancer using anti-PD-1 antibodies alone or in combination with other immunotherapeutics
EP2439273A2 (en) 2005-05-09 2012-04-11 Ono Pharmaceutical Co., Ltd. Human monoclonal antibodies to programmed death 1(PD-1) and methods for treating cancer using anti-PD-1 antibodies alone or in combination with other immunotherapeutics
EP2982379A1 (en) 2005-07-01 2016-02-10 E. R. Squibb & Sons, L.L.C. Human monoclonal antibodies to programmed death ligand 1 (pd-l1)
US8309690B2 (en) 2005-07-01 2012-11-13 Medimmune, Llc Integrated approach for generating multidomain protein therapeutics
US9580506B2 (en) 2005-07-21 2017-02-28 Genmab A/S Potency assays for antibody drug substance binding to an Fc receptor
US8697071B2 (en) 2005-08-10 2014-04-15 Macrogenics, Inc. Identification and engineering of antibodies with variant Fc regions and methods of using same
US9040041B2 (en) 2005-10-03 2015-05-26 Xencor, Inc. Modified FC molecules
US7973136B2 (en) 2005-10-06 2011-07-05 Xencor, Inc. Optimized anti-CD30 antibodies
US9574006B2 (en) 2005-10-06 2017-02-21 Xencor, Inc. Optimized anti-CD30 antibodies
US8409568B2 (en) 2005-10-14 2013-04-02 Medimmune, Llc Mutant antibody Fc domains and fusion proteins thereof
US9567389B2 (en) 2005-10-14 2017-02-14 Medimmune, Llc Cell display of antibody libraries
EP2532679A1 (en) 2005-10-21 2012-12-12 Novartis AG Human antibodies against il13 and therapeutic uses
EP2532677A1 (en) 2005-10-21 2012-12-12 Novartis AG Human antibodies against il13 and therapeutic uses
EP2465870A1 (en) 2005-11-07 2012-06-20 Genentech, Inc. Binding polypeptides with diversified and consensus VH/VL hypervariable sequences
EP2623516A2 (en) 2005-12-02 2013-08-07 Genentech, Inc. Compositions and methods for the treatment of diseases and disorders associated with cytokine signaling involving antibodies that bind to IL-22 and IL-22R
EP3006466A2 (en) 2005-12-02 2016-04-13 Genentech, Inc. Compositions and methods for the treatment of diseases and disorders associated with cytokine signaling involving antibodies that bind to il-22 and il-22r
WO2007067992A2 (en) 2005-12-08 2007-06-14 Medarex, Inc. Human monoclonal antibodies to fucosyl-gm1 and methods for using anti-fucosyl-gm1
EP3309170A1 (en) 2005-12-15 2018-04-18 Genentech, Inc. Polyubiquitin antibodies
EP2325208A1 (en) 2005-12-15 2011-05-25 Genentech, Inc. Polyubiquitin antibodies
EP2402373A2 (en) 2006-01-05 2012-01-04 Genentech, Inc. Anti-EphB4 Antibodies and Methods Using Same
EP3156418A1 (en) 2006-01-05 2017-04-19 Genentech, Inc. Anti-ephb4 antibodies and methods using same
EP3101033A1 (en) 2006-01-12 2016-12-07 Alexion Pharmaceuticals, Inc. Antibodies to ox-2/cd200 and uses thereof
EP2463305A1 (en) 2006-01-12 2012-06-13 Alexion Pharmaceuticals, Inc. Antibodies to OX-2/CD200 and uses thereof
WO2007127506A2 (en) 2006-01-20 2007-11-08 Genentech, Inc. Anti-ephrinb2 antibodies and methods using same
EP2327423A2 (en) 2006-02-21 2011-06-01 Wyeth LLC Human antibodies against human interleukin-22 (IL-22)
EP3020729A1 (en) 2006-02-21 2016-05-18 Wyeth LLC Antibodies against human il-22 and uses therefor
EP2431392A1 (en) 2006-02-21 2012-03-21 Wyeth LLC Antibodies against human IL-22 and uses therefor
EP2540741A1 (en) 2006-03-06 2013-01-02 Aeres Biomedical Limited Humanized anti-CD22 antibodies and their use in treatment of oncology, transplantation and autoimmune disease
EP2468772A2 (en) 2006-03-16 2012-06-27 Genentech, Inc. Antibodies to EGFL7 and methods for their use
EP2343551A1 (en) 2006-04-10 2011-07-13 Genentech, Inc. Disheveled PDZ modulators
US7786270B2 (en) 2006-05-26 2010-08-31 Macrogenics, Inc. Humanized FcγRIIB-specific antibodies and methods of use thereof
EP2447282A2 (en) 2006-05-30 2012-05-02 Genentech, Inc. Anti-CD22 Antibodies, their Immunoconjugates and uses thereof
EP2446904A2 (en) 2006-05-30 2012-05-02 Genentech, Inc. Anti-CD22 antibodies, their immunoconjugates and uses thereof
US7803377B2 (en) 2006-06-06 2010-09-28 Genentech, Inc. Anti-DLL4 antibodies and methods using same
US9737599B2 (en) 2006-06-26 2017-08-22 Macrogenics, Inc. Combination of FcγRIIB-specific antibodies and CD20-specific antibodies and methods of use thereof
US10100116B2 (en) 2006-06-26 2018-10-16 Macrogenics, Inc. FcγRIIB-specific antibodies and methods of use thereof
US11098125B2 (en) 2006-06-26 2021-08-24 Macrogenics, Inc. FcγRIIB-specific antibodies and methods of use thereof
US8524867B2 (en) 2006-08-14 2013-09-03 Xencor, Inc. Optimized antibodies that target CD19
US11618788B2 (en) 2006-08-14 2023-04-04 Xencor, Inc. Optimized antibodies that target CD19
US9803020B2 (en) 2006-08-14 2017-10-31 Xencor, Inc. Optimized antibodies that target CD19
US10626182B2 (en) 2006-08-14 2020-04-21 Xencor, Inc. Optimized antibodies that target CD19
WO2008030611A2 (en) 2006-09-05 2008-03-13 Medarex, Inc. Antibodies to bone morphogenic proteins and receptors therefor and methods for their use
WO2008031056A2 (en) 2006-09-08 2008-03-13 Medimmune, Llc Humanized anti-cd19 antibodies and their use in treatment of oncology, transplantation and autoimmune disease
US8394374B2 (en) 2006-09-18 2013-03-12 Xencor, Inc. Optimized antibodies that target HM1.24
US9040042B2 (en) 2006-09-18 2015-05-26 Xencor, Inc. Optimized antibodies that target HM1.24
EP2486941A1 (en) 2006-10-02 2012-08-15 Medarex, Inc. Human antibodies that bind CXCR4 and uses thereof
EP2829551A1 (en) 2006-10-19 2015-01-28 CSL Limited High affinity antibody antagonists of interleukin-13 receptor alpha 1
EP2530090A2 (en) 2006-10-19 2012-12-05 CSL Limited Anti-IL-13R alpha 1 antibodies and their uses thereof
EP2845866A1 (en) 2006-10-27 2015-03-11 Genentech, Inc. Antibodies and immunoconjugates and uses therefor
WO2008052187A2 (en) 2006-10-27 2008-05-02 Genentech. Inc. Antibodies and immunoconjugates and uses therefor
US8618248B2 (en) 2006-10-31 2013-12-31 President And Fellows Of Harvard College Phosphopeptide compositions and anti-phosphopeptide antibody compositions and methods of detecting phosphorylated peptides
EP3181580A1 (en) 2006-11-02 2017-06-21 Acceleron Pharma Inc. Alk1 receptor and ligand antagonists and uses thereof
WO2008076560A2 (en) 2006-11-15 2008-06-26 Medarex, Inc. Human monoclonal antibodies to btla and methods of use
WO2008070569A2 (en) 2006-12-01 2008-06-12 Medarex, Inc. Human antibodies that bind cd22 and uses thereof
US9708408B2 (en) 2006-12-08 2017-07-18 Macrogenics, Inc. Methods for the treatment of disease using immunoglobulins having Fc Regions with altered affinities for FcγRactivating and FcγRinhibiting
US10711069B2 (en) 2006-12-08 2020-07-14 Macrogenics, Inc. Methods for the treatment of disease using immunoglobulins having Fc regions with altered affinities for FcγRactivating and FcγRinhibiting
US11787871B2 (en) 2006-12-08 2023-10-17 Macrogenics, Inc. Methods for the treatment of disease using immunoglobulins having fc regions with altered affinities for FcgammaRactivating and FegammaRinhibiting
WO2009054863A2 (en) 2006-12-13 2009-04-30 Medarex, Inc. Human antibodies that bind cd19 and uses thereof
WO2008074004A2 (en) 2006-12-14 2008-06-19 Medarex, Inc. Human antibodies that bind cd70 and uses thereof
EP2468776A2 (en) 2007-02-09 2012-06-27 Genentech, Inc. Anti-Robo4 antibodies and uses therefor
EP3524626A1 (en) 2007-03-22 2019-08-14 Biogen MA Inc. Binding proteins, including antibodies, antibody derivatives and antibody fragments, that specifically bind cd154 and uses thereof
US10317393B2 (en) 2007-03-23 2019-06-11 Academia Sinica Alkynyl sugar analogs for labeling and visualization of glycoconjugates in cells
EP3431103A1 (en) 2007-04-12 2019-01-23 The Brigham and Women's Hospital, Inc. Targeting abcb5 for cancer therapy
EP2644205A1 (en) 2007-04-12 2013-10-02 The Brigham and Women's Hospital, Inc. Targeting ABCB5 for cancer therapy
EP2703011A2 (en) 2007-05-07 2014-03-05 MedImmune, LLC Anti-icos antibodies and their use in treatment of oncology, transplantation and autoimmune disease
EP2737907A2 (en) 2007-05-07 2014-06-04 MedImmune, LLC Anti-icos antibodies and their use in treatment of oncology, transplantation and autoimmune disease
US9321831B2 (en) 2007-06-01 2016-04-26 Medimmune Limited RSV-specific binding molecules and means for producing them
US10730931B2 (en) 2007-06-01 2020-08-04 Medimmune Limited RSV-specific binding molecules and means for producing them
US10059757B2 (en) 2007-06-01 2018-08-28 Medimmune Limited RSV-specific binding molecules and means for producing them
WO2008150525A1 (en) 2007-06-04 2008-12-11 Genentech, Inc. Anti-notch1 nrr antibodies and methods using same
EP2746290A2 (en) 2007-06-06 2014-06-25 Domantis Limited Polypeptides, antibody variable domains and antagonists
EP2746291A2 (en) 2007-06-06 2014-06-25 Domantis Limited Pulmonary formulation comprising an immunoglobulin single variable domain which binds to TNFR1
EP2626371A1 (en) 2007-07-31 2013-08-14 MedImmune, LLC Multispecific epitope binding proteins and uses thereof
US8975377B2 (en) 2007-08-13 2015-03-10 Vasgene Therapeutics, Inc Cancer treatment using humanized antibodies that bind to EphB4
EP2769729A1 (en) 2007-09-04 2014-08-27 Compugen Ltd. Polypeptides and polynucleotides, and uses thereof as a drug target for producing drugs and biologics
WO2009032845A2 (en) 2007-09-04 2009-03-12 Compugen, Ltd. Polypeptides and polynucleotides, and uses thereof as a drug target for producing drugs and biologics
US10098934B2 (en) 2007-09-04 2018-10-16 Compugen Ltd Polypeptides and polynucleotides, and uses thereof as a drug target for producing drugs and biologics
EP2769728A1 (en) 2007-09-04 2014-08-27 Compugen Ltd. Polypeptides and polynucleotides, and uses thereof as a drug target for producing drugs and biologics
US11332533B2 (en) 2007-09-26 2022-05-17 Chugai Seiyaku Kabushiki Kaisha Modified antibody constant region
EP2586796A1 (en) 2007-10-12 2013-05-01 Novartis AG Compositions and methods for use for antibodies against sclerostin
US11932685B2 (en) 2007-10-31 2024-03-19 Xencor, Inc. Fc variants with altered binding to FcRn
EP2567709A2 (en) 2007-11-02 2013-03-13 Novartis AG Molecules and methods for modulating low-density-lipoprotein receptor-related protein 6 (LRP6)
EP3305324A1 (en) 2007-11-02 2018-04-11 Novartis AG Molecules and methods for modulating low-density-lipoprotein receptor-related protein 6 (lrp6)
EP3360567A1 (en) 2007-11-07 2018-08-15 Genentech, Inc. Amp for use in treating microbial disorders
EP3173425A1 (en) 2007-11-30 2017-05-31 Genentech, Inc. Anti-vegf antibodies
EP2851372A1 (en) 2007-11-30 2015-03-25 Genentech, Inc. Anti-VEGF antibodies
EP2769993A1 (en) 2007-12-14 2014-08-27 Novo Nordisk A/S Antibodies against human NKG2D and uses thereof
US8795667B2 (en) 2007-12-19 2014-08-05 Macrogenics, Inc. Compositions for the prevention and treatment of smallpox
EP3211010A1 (en) 2007-12-21 2017-08-30 Medimmune Limited Binding members for interleukin-4 receptor alpha (il-4r) - 173
EP2604628A2 (en) 2007-12-21 2013-06-19 Medimmune Limited Binding members for interleukin-4 receptor alpha (IL-4R) - 173
WO2009081201A2 (en) 2007-12-21 2009-07-02 Medimmune Limited BINDING MEMBERS FOR INTERLEUKIN-4 RECEPTOR ALPHA (IL-4Rα) - 173
EP2388323A2 (en) 2008-01-11 2011-11-23 Gene Techno Science Co., Ltd. Humanized anti-9 integrin antibodies and the uses thereof
EP2650017A2 (en) 2008-02-05 2013-10-16 Bristol-Myers Squibb Company Alpha 5 - beta 1 antibodies and their uses
EP2641612A1 (en) 2008-02-05 2013-09-25 Bristol-Myers Squibb Company Alpha 5 - beta 1 antibodies and their uses
EP2250279A2 (en) * 2008-02-08 2010-11-17 MedImmune, LLC Anti-ifnar1 antibodies with reduced fc ligand affinity
US10301390B2 (en) 2008-02-08 2019-05-28 Astrazeneca Ab Anti-IFNAR1 antibodies with reduced Fc ligand affinity
US9988459B2 (en) 2008-02-08 2018-06-05 Astrazeneca Ab Anti-IFNAR1 antibodies with reduced Fc ligand affinity
EP2250279A4 (en) * 2008-02-08 2011-03-30 Medimmune Llc Anti-ifnar1 antibodies with reduced fc ligand affinity
WO2009100309A2 (en) 2008-02-08 2009-08-13 Medimmune, Llc Anti-ifnar1 antibodies with reduced fc ligand affinity
US10131713B2 (en) 2008-04-02 2018-11-20 Macrogenics, Inc. HER2/neu-specific antibodies and methods of using same
US11028183B2 (en) 2008-04-02 2021-06-08 Macrogenics, Inc. HER2/neu-specific antibodies and methods of using same
US9695236B2 (en) 2008-04-02 2017-07-04 Macrogenics, Inc. BCR-complex-specific antibodies and methods of using same
US10479831B2 (en) 2008-04-02 2019-11-19 Macrogenics, Inc BCR-complex-specific antibodies and methods of using same
WO2009131256A1 (en) 2008-04-24 2009-10-29 Gene Techno Science Co., Ltd. Humanized antibodies specific for amino acid sequence rgd of an extracellular matrix protein and the uses thereof
EP3398966A1 (en) 2008-05-02 2018-11-07 Acceleron Pharma, Inc. Methods and compositions for modulating angiogenesis and pericyte composition
US10274488B2 (en) 2008-07-15 2019-04-30 Academia Sinica Glycan arrays on PTFE-like aluminum coated glass slides and related methods
US9880172B2 (en) 2008-08-04 2018-01-30 Biodesy, Inc. Nonlinear optical detection of molecules comprising an unnatural amino acid possessing a hyperpolarizability
US9182406B2 (en) 2008-08-04 2015-11-10 Biodesy, Inc. Nonlinear optical detection of molecules comprising an unnatural amino acid possessing a hyperpolarizability
EP2837388A1 (en) 2008-08-05 2015-02-18 Novartis AG Compositions and methods for antibodies targeting complement protein C5
EP2815766A1 (en) 2008-08-05 2014-12-24 Novartis AG Compositions and methods for antibodies targeting complement protein C5
WO2010015608A1 (en) 2008-08-05 2010-02-11 Novartis Ag Compositions and methods for antibodies targeting complement protein c5
EP3597216A1 (en) 2008-08-11 2020-01-22 E. R. Squibb & Sons, L.L.C. Human antibodies that bind lymphocyte activation gene-3 (lag-3) and uses thereof
EP2905030A1 (en) 2008-08-11 2015-08-12 E. R. Squibb & Sons, L.L.C. Human antibodies that bind lymphocyte activation gene-3 (LAG-3) and uses thereof
EP4147714A1 (en) 2008-08-11 2023-03-15 E. R. Squibb & Sons, L.L.C. Human antibodies that bind lymphocyte activation gene-3 (lag-3) and uses thereof
EP2927244A1 (en) 2008-09-19 2015-10-07 MedImmune, LLC Antibodies directed to DLL4 and uses thereof
US8741604B2 (en) 2008-11-07 2014-06-03 Medimmune Limited Nucleic acid molecule encoding a specific IL-1R1 antibody
US9200074B2 (en) 2008-11-07 2015-12-01 Medimmune Limited Antibodies to IL-1 R1 and methods of making them
US8298533B2 (en) 2008-11-07 2012-10-30 Medimmune Limited Antibodies to IL-1R1
WO2010056804A1 (en) 2008-11-12 2010-05-20 Medimmune, Llc Antibody formulation
US10302655B2 (en) 2008-12-05 2019-05-28 Glaxo Group Limited Methods for selecting protease resistant polypeptides
US10466252B2 (en) 2008-12-05 2019-11-05 Glaxo Group Limited Methods for selecting protease resistant polypeptides
EP2865689A1 (en) 2008-12-08 2015-04-29 Compugen Ltd. FAM26F polypeptides and polynucleotides, and uses thereof as a drug target for producing drugs and biologics
WO2010067308A2 (en) 2008-12-08 2010-06-17 Compugen Ltd. Polypeptides and polynucleotides, and uses thereof as a drug target for producing drugs and biologics
US8775090B2 (en) 2008-12-12 2014-07-08 Medimmune, Llc Crystals and structure of a human IgG Fc variant with enhanced FcRn binding
WO2010070346A2 (en) 2008-12-18 2010-06-24 Medimmune Limited BINDING MEMBERS FOR INTERLEUKIN-4 RECEPTOR ALPHA (IL-4Ra) - 836
WO2010072740A2 (en) 2008-12-23 2010-07-01 Astrazeneca Ab TARGETED BINDING AGENTS DIRECTED TO α5β1 AND USES THEREOF
WO2010094720A2 (en) 2009-02-19 2010-08-26 Glaxo Group Limited Improved anti-tnfr1 polypeptides, antibody variable domains & antagonists
US8679492B2 (en) 2009-02-23 2014-03-25 Glenmark Pharmaceuticals S.A. Humanized antibodies that bind to CD19 and their uses
WO2010102175A1 (en) 2009-03-05 2010-09-10 Medarex, Inc. Fully human antibodies specific to cadm1
WO2010108127A1 (en) 2009-03-20 2010-09-23 Genentech, Inc. Bispecific anti-her antibodies
EP3088420A1 (en) 2009-03-20 2016-11-02 F. Hoffmann-La Roche AG Bispecific anti-her antibodies
EP2679600A1 (en) 2009-03-25 2014-01-01 Genentech, Inc. Anti-FGFR3 antibodies and methods using same
US11401333B2 (en) 2009-03-25 2022-08-02 Genentech, Inc. Anti-FGFR3 antibodies and methods using same
US8410250B2 (en) 2009-03-25 2013-04-02 Genentech, Inc. Anti-FGFR3 antibodies and methods using same
WO2010111367A1 (en) 2009-03-25 2010-09-30 Genentech, Inc. Anti-fgfr3 antibodies and methods using same
US9499623B2 (en) 2009-03-25 2016-11-22 Genentech, Inc. Anti-FGFR3 antibodies and methods using same
WO2010111254A1 (en) 2009-03-25 2010-09-30 Genentech, Inc. Novel anti-alpha5beta1 antibodies and uses thereof
US9161977B2 (en) 2009-03-25 2015-10-20 F. Hoffmann-La Roche Ag Anti-FGFR3 antibodies and methods using same
US8710189B2 (en) 2009-03-25 2014-04-29 Genentech, Inc. Anti-FGFR3 antibodies and methods using same
US10000571B2 (en) 2009-03-25 2018-06-19 Genentech, Inc. Anti-FGFR3 antibodies and methods using same
US10287356B2 (en) 2009-03-25 2019-05-14 Genentech, Inc. Anti-FGFR3 antibodies and methods using same
EP3702371A1 (en) 2009-03-25 2020-09-02 Genentech, Inc. Anti-fgfr3 antibodies and methods using same
WO2010112458A1 (en) 2009-03-31 2010-10-07 Novartis Ag Composition and methods of use for therapeutic antibodies specific for the il-12 receptore betal subunit
EP3009454A2 (en) 2009-04-20 2016-04-20 Oxford Bio Therapeutics Limited Antibodies specific to cadherin-17
US9062116B2 (en) 2009-04-23 2015-06-23 Infinity Pharmaceuticals, Inc. Anti-fatty acid amide hydrolase-2 antibodies and uses thereof
WO2010125003A1 (en) 2009-04-27 2010-11-04 Novartis Ag Compositions and methods for increasing muscle growth
EP3275900A1 (en) 2009-04-27 2018-01-31 Novartis AG Compositions and methods for increasing muscle growth
EP2998405A1 (en) 2009-05-13 2016-03-23 Genzyme Corporation Anti-human cd52 immunoglobulins
EP3683317A2 (en) 2009-05-13 2020-07-22 Genzyme Corporation Anti-human cd52 immunoglobulins
US11945874B2 (en) 2009-05-13 2024-04-02 Genzyme Corporation Anti-human CD52 immunoglobulins
US8617554B2 (en) 2009-05-13 2013-12-31 Genzyme Corporation Anti-human CD52 immunoglobulins
EP4311863A2 (en) 2009-05-15 2024-01-31 University Health Network Compositions and methods for treating hematologic cancers targeting the sirp alpha- cd47 interaction
EP2995315A1 (en) 2009-05-15 2016-03-16 University Health Network Compositions and methods for treating hematologic cancers targeting the sirp alpha- cd47 interaction
US10907209B2 (en) 2009-05-15 2021-02-02 University Health Network Compositions and methods for treating hematological cancers targeting the SIRPα CD47 interaction
US10640555B2 (en) 2009-06-16 2020-05-05 Hoffmann-La Roche Inc. Bispecific antigen binding proteins
US11673945B2 (en) 2009-06-16 2023-06-13 Hoffmann-La Roche Inc. Bispecific antigen binding proteins
EP3431501A1 (en) 2009-06-18 2019-01-23 Pfizer Inc Anti notch-1 antibodies
US9090690B2 (en) 2009-06-18 2015-07-28 Pfizer Inc. Anti Notch-1 antibodies
WO2010146550A1 (en) 2009-06-18 2010-12-23 Pfizer Inc. Anti notch-1 antibodies
WO2011006914A2 (en) 2009-07-16 2011-01-20 Glaxo Group Limited Antagonists, uses & methods for partially inhibiting tnfr1
WO2011014457A1 (en) 2009-07-27 2011-02-03 Genentech, Inc. Combination treatments
EP3199551A2 (en) 2009-07-31 2017-08-02 E. R. Squibb & Sons, L.L.C. Fully human antibodies to btla
WO2011014438A1 (en) 2009-07-31 2011-02-03 N.V. Organon Fully human antibodies to btla
WO2011021146A1 (en) 2009-08-20 2011-02-24 Pfizer Inc. Osteopontin antibodies
US11401348B2 (en) 2009-09-02 2022-08-02 Xencor, Inc. Heterodimeric Fc variants
WO2011029823A1 (en) 2009-09-09 2011-03-17 Novartis Ag Monoclonal antibody reactive with cd63 when expressed at the surface of degranulated mast cells
US10035843B2 (en) 2009-10-06 2018-07-31 Medimmune Limited RSV-specific binding molecule
US10723786B2 (en) 2009-10-06 2020-07-28 Medimmune, Limited RSV-specific binding molecule
WO2011047083A1 (en) 2009-10-13 2011-04-21 Oxford Biotherapeutics Ltd. Antibodies against epha10
US8759491B2 (en) 2009-10-19 2014-06-24 Genentech, Inc. Modulators of hepatocyte growth factor activator
WO2011049868A1 (en) 2009-10-19 2011-04-28 Genentech, Inc. Modulators of hepatocyte growth factor activator
WO2011050188A1 (en) 2009-10-22 2011-04-28 Genentech, Inc. Anti-hepsin antibodies and methods using same
EP3520816A2 (en) 2009-10-23 2019-08-07 Millennium Pharmaceuticals, Inc. Anti-gcc antibody molecules and related compositions and methods
WO2011056502A1 (en) 2009-10-26 2011-05-12 Genentech, Inc. Bone morphogenetic protein receptor type ii compositions and methods of use
WO2011056494A1 (en) 2009-10-26 2011-05-12 Genentech, Inc. Activin receptor-like kinase-1 antagonist and vegfr3 antagonist combinations
WO2011056497A1 (en) 2009-10-26 2011-05-12 Genentech, Inc. Activin receptor type iib compositions and methods of use
WO2011051217A1 (en) 2009-10-27 2011-05-05 Glaxo Group Limited Stable anti-tnfr1 polypeptides, antibody variable domains & antagonists
WO2011056772A1 (en) 2009-11-04 2011-05-12 Schering Corporation Engineered anti-tslp antibody
EP3594356A1 (en) 2009-11-04 2020-01-15 Merck Sharp & Dohme Corp. Engineered anti-tslp antibody
WO2011057120A1 (en) 2009-11-05 2011-05-12 Genentech, Inc. Methods and composition for secretion of heterologous polypeptides
EP3279215A1 (en) 2009-11-24 2018-02-07 MedImmune Limited Targeted binding agents against b7-h1
WO2011067711A2 (en) 2009-12-01 2011-06-09 Compugen Ltd Novel heparanase splice variant
US10087236B2 (en) 2009-12-02 2018-10-02 Academia Sinica Methods for modifying human antibodies by glycan engineering
WO2011068993A1 (en) 2009-12-02 2011-06-09 Acceleron Pharma Inc. Compositions and methods for increasing serum half-life of fc fusion proteins.
US11377485B2 (en) 2009-12-02 2022-07-05 Academia Sinica Methods for modifying human antibodies by glycan engineering
US11267870B2 (en) 2009-12-02 2022-03-08 Academia Sinica Methods for modifying human antibodies by glycan engineering
WO2011071577A1 (en) 2009-12-11 2011-06-16 Genentech, Inc. Anti-vegf-c antibodies and methods using same
WO2011076781A1 (en) 2009-12-22 2011-06-30 Novartis Ag Tetravalent cd47-antibody constant region fusion protein for use in therapy
WO2011079185A1 (en) 2009-12-23 2011-06-30 Genentech, Inc. Anti-bv8 antibodies and uses thereof
WO2011085343A1 (en) 2010-01-11 2011-07-14 Alexion Pharmaceuticals, Inc Biomarkers of immunomodulatory effects in humans treated with anti-cd200 antibodies
WO2011100403A1 (en) 2010-02-10 2011-08-18 Immunogen, Inc Cd20 antibodies and uses thereof
WO2011098449A1 (en) 2010-02-10 2011-08-18 Novartis Ag Methods and compounds for muscle growth
WO2011103242A1 (en) 2010-02-18 2011-08-25 Genentech, Inc. Neuregulin antagonists and use thereof in treating cancer
WO2011101328A2 (en) 2010-02-18 2011-08-25 Roche Glycart Ag Treatment with a humanized igg class anti egfr antibody and an antibody against insulin like growth factor 1 receptor
US8557966B2 (en) 2010-02-24 2013-10-15 Immunogen, Inc. Folate receptor 1 antibodies and immunoconjugates and uses thereof
US9598490B2 (en) 2010-02-24 2017-03-21 Immunogen, Inc. Folate receptor 1 antibodies and immunoconjugates and uses thereof
US9670278B2 (en) 2010-02-24 2017-06-06 Immunogen, Inc. Folate receptor 1 antibodies and immunoconjugates and uses thereof
US9133275B2 (en) 2010-02-24 2015-09-15 Immunogen, Inc. Folate receptor 1 antibodies and immunoconjugates and uses thereof
US9670280B2 (en) 2010-02-24 2017-06-06 Immunogen, Inc. Folate receptor 1 antibodies and immunoconjugates and uses thereof
US9657100B2 (en) 2010-02-24 2017-05-23 Immunogen, Inc. Folate receptor 1 antibodies and immunoconjugates and uses thereof
WO2011106528A1 (en) * 2010-02-24 2011-09-01 Immunogen, Inc. Folate receptor 1 antibodies and immunoconjugates and uses thereof
US10301385B2 (en) 2010-02-24 2019-05-28 Immunogen, Inc. Folate receptor 1 antibodies and immunoconjugates and uses thereof
US9670279B2 (en) 2010-02-24 2017-06-06 Immunogen, Inc. Folate receptor 1 antibodies and immunoconjugates and uses thereof
US10752683B2 (en) 2010-02-24 2020-08-25 Immunogen, Inc. Folate receptor 1 antibodies and immunoconjugates and uses thereof
US9714295B2 (en) 2010-03-04 2017-07-25 Macrogenics, Inc. Antibodies reactive with B7-H3, immunologically active fragments thereof and uses thereof
US9896508B2 (en) 2010-03-04 2018-02-20 Macrogenics, Inc. Antibodies reactive with B7-H3 and uses thereof
US9714296B2 (en) 2010-03-04 2017-07-25 Macrogenics, Inc. Antibodies reactive with B7-H3, immunologically active fragments thereof and uses thereof
US10730945B2 (en) 2010-03-04 2020-08-04 Macrogenics, Inc. Antibodies reactive with B7-H3 and users thereof
US10683364B2 (en) 2010-03-04 2020-06-16 Macrogenics, Inc. Antibodies reactive with B7-H3, immunologically active fragments thereof and uses thereof
WO2011119661A1 (en) 2010-03-24 2011-09-29 Genentech, Inc. Anti-lrp6 antibodies
US10745467B2 (en) 2010-03-26 2020-08-18 The Trustees Of Dartmouth College VISTA-Ig for treatment of autoimmune, allergic and inflammatory disorders
US10781254B2 (en) 2010-03-26 2020-09-22 The Trustees Of Dartmouth College VISTA regulatory T cell mediator protein, VISTA binding agents and use thereof
US10968273B2 (en) 2010-04-05 2021-04-06 Fundacio Privada Institut D'investigacio Oncologica Vall D'hebron (Vhio) Antibody recognizing human leukemia inhibitory factor (LIF) and use of anti-LIF antibodies in the treatment of diseases associated with unwanted cell proliferation
US10338069B2 (en) 2010-04-12 2019-07-02 Academia Sinica Glycan arrays for high throughput screening of viruses
US9221901B2 (en) 2010-04-30 2015-12-29 Alexion Pharmaceuticals, Inc. Methods of treating complement-associated disorders with anti-C5a antibodies
WO2011137395A1 (en) 2010-04-30 2011-11-03 Rother Russell P Anti-c5a antibodies and methods for using the antibodies
US9371378B1 (en) 2010-04-30 2016-06-21 Alexion Pharmaceuticals, Inc. Anti-C5a antibodies
US11407821B2 (en) 2010-04-30 2022-08-09 Alexion Pharmaceuticals, Inc. Anti-C5A antibodies
US9469690B2 (en) 2010-04-30 2016-10-18 Alexion Pharmaceuticals, Inc. Methods of treating complement-associated disorders with anti-C5a antibodies
US10450370B2 (en) 2010-04-30 2019-10-22 Alexion Pharmaceuticals, Inc. Anti-C5a antibodies
US9963503B2 (en) 2010-04-30 2018-05-08 Alexion Pharmaceuticals, Inc. Methods of producing anti-C5a antibodies
EP2824111A2 (en) 2010-04-30 2015-01-14 Alexion Pharmaceuticals, Inc. Anti-C5A Antibodies and Methods for Using the Antibodies
US9434784B1 (en) 2010-04-30 2016-09-06 Alexion Pharmaceuticals, Inc. Nucleic acids encodng anti-C5A antibodies
US9309310B2 (en) 2010-04-30 2016-04-12 Alexion Pharmaceuticals, Inc. Nucleic acids encoding anti-C5a antibodies
WO2011138392A1 (en) 2010-05-06 2011-11-10 Novartis Ag Compositions and methods of use for therapeutic low density lipoprotein -related protein 6 (lrp6) antibodies
EP3345926A1 (en) 2010-05-06 2018-07-11 Novartis AG Compositions and methods of use for therapeutic low density lipoprotein-related protein 6 (lrp6) antibodies
WO2011138391A1 (en) 2010-05-06 2011-11-10 Novartis Ag Compositions and methods of use for therapeutic low density lipoprotein - related protein 6 (lrp6) multivalent antibodies
EP4234698A2 (en) 2010-05-06 2023-08-30 Novartis AG Compositions and methods of use for therapeutic low density lipoprotein-related protein 6 (lrp6) antibodies
WO2011147834A1 (en) 2010-05-26 2011-12-01 Roche Glycart Ag Antibodies against cd19 and uses thereof
US8771966B2 (en) 2010-06-03 2014-07-08 Genentech, Inc. Immuno-PET imaging of antibodies and immunoconjugates and uses therefor
WO2011153346A1 (en) 2010-06-03 2011-12-08 Genentech, Inc. Immuno-pet imaging of antibodies and immunoconjugates and uses therefor
US8853369B2 (en) 2010-06-18 2014-10-07 Genentech, Inc. Anti-Axl antibodies and methods of use
EP3098240A2 (en) 2010-06-18 2016-11-30 F. Hoffmann-La Roche AG Anti-axl antibodies and methods of use
USRE47761E1 (en) 2010-06-18 2019-12-10 Genentech, Inc. Anti-axl antibodies and methods of use
WO2011161119A1 (en) 2010-06-22 2011-12-29 F. Hoffmann-La Roche Ag Antibodies against insulin-like growth factor i receptor and uses thereof
US9815890B2 (en) 2010-06-22 2017-11-14 The Regents Of The University Of Colorado, A Body Corporate Antibodies to the C3d fragment of complement component 3
USRE49339E1 (en) 2010-06-22 2022-12-20 The Regents Of The University Of Colorado, A Body Corporate Antibodies to the C3D fragment of complement component 3
WO2011161189A1 (en) 2010-06-24 2011-12-29 F. Hoffmann-La Roche Ag Anti-hepsin antibodies and methods of use
WO2012006503A1 (en) 2010-07-09 2012-01-12 Genentech, Inc. Anti-neuropilin antibodies and methods of use
WO2012010582A1 (en) 2010-07-21 2012-01-26 Roche Glycart Ag Anti-cxcr5 antibodies and methods of use
WO2012018771A1 (en) 2010-08-03 2012-02-09 Genentech, Inc. Chronic lymphocytic leukemia (cll) biomarkers
WO2012017003A1 (en) 2010-08-05 2012-02-09 F. Hoffmann-La Roche Ag Anti-mhc antibody anti-viral cytokine fusion protein
WO2012020038A1 (en) 2010-08-13 2012-02-16 Roche Glycart Ag Anti-tenascin-c a2 antibodies and methods of use
WO2012020006A2 (en) 2010-08-13 2012-02-16 Roche Glycart Ag Anti-fap antibodies and methods of use
WO2012020096A1 (en) 2010-08-13 2012-02-16 Medimmune Limited Monomeric polypeptides comprising variant fc regions and methods of use
EP3333194A1 (en) 2010-08-13 2018-06-13 Roche Glycart AG Anti-fap antibodies and methods of use
WO2012022734A2 (en) 2010-08-16 2012-02-23 Medimmune Limited Anti-icam-1 antibodies and methods of use
WO2012022814A1 (en) 2010-08-20 2012-02-23 Novartis Ag Antibodies for epidermal growth factor receptor 3 (her3)
US8883975B2 (en) 2010-08-25 2014-11-11 Hoffmann-La Roche, Inc. Antibodies against IL-18R1 and uses thereof
WO2012025536A1 (en) 2010-08-25 2012-03-01 F. Hoffmann-La Roche Ag Antibodies against il-18r1 and uses thereof
WO2012031027A1 (en) 2010-08-31 2012-03-08 Genentech, Inc. Biomarkers and methods of treatment
EP3264089A1 (en) 2010-08-31 2018-01-03 Genentech, Inc. Biomarkers and methods of treatment
WO2012035518A1 (en) 2010-09-17 2012-03-22 Compugen Ltd. Compositions and methods for treatment of drug resistant multiple myeloma
WO2012047968A2 (en) 2010-10-05 2012-04-12 Genentech, Inc. Mutant smoothened and methods of using the same
WO2012045703A1 (en) 2010-10-05 2012-04-12 Novartis Ag Anti-il12rbeta1 antibodies and their use in treating autoimmune and inflammatory disorders
WO2012064836A1 (en) 2010-11-10 2012-05-18 Genentech, Inc. Methods and compositions for neural disease immunotherapy
EP3176184A1 (en) 2010-11-10 2017-06-07 F. Hoffmann-La Roche AG Methods and compositions for neural disease immunotherapy
US9809647B2 (en) 2010-11-19 2017-11-07 Eisai R&D Management Co., Ltd. Neutralizing anti-CCL20 antibodies
US10208129B2 (en) 2010-12-06 2019-02-19 National Research Council Of Canada Antibodies selective for cells presenting ErbB2 at high density
US9127060B2 (en) 2010-12-15 2015-09-08 Wyeth Llc Anti-Notch1 antibodies
US9995755B2 (en) 2010-12-16 2018-06-12 Genentech, Inc. Diagnosis and treatments relating to TH2 inhibition
US11226341B2 (en) 2010-12-16 2022-01-18 Genentech, Inc. Method of treating asthma using an IL-13 antibody
US9684000B2 (en) 2010-12-16 2017-06-20 Genentech, Inc. Diagnosis and treatments relating to TH2 inhibition
EP3447491A2 (en) 2010-12-16 2019-02-27 F. Hoffmann-La Roche AG Diagnosis and treatments relating to th2 inhibition
EP3296321A1 (en) 2010-12-20 2018-03-21 F. Hoffmann-La Roche AG Anti-mesothelin antibodies and immunoconjugates
WO2012087962A2 (en) 2010-12-20 2012-06-28 Genentech, Inc. Anti-mesothelin antibodies and immunoconjugates
WO2012088313A1 (en) 2010-12-22 2012-06-28 Genentech, Inc. Anti-pcsk9 antibodies and methods of use
WO2012092539A2 (en) 2010-12-31 2012-07-05 Takeda Pharmaceutical Company Limited Antibodies to dll4 and uses thereof
WO2012100346A1 (en) 2011-01-24 2012-08-02 Ym Biosciences Inc. Antibodies selective for cells presenting egfr at high density
US10570211B2 (en) 2011-01-24 2020-02-25 Gilead Sciences, Inc. Antibodies selective for cells presenting EGFR at high density
WO2012106634A1 (en) 2011-02-03 2012-08-09 Alexion Pharmaceuticals, Inc. Use of an anti-cd200 antibody for prolonging the survival of allografts
US10611825B2 (en) 2011-02-28 2020-04-07 Hoffmann La-Roche Inc. Monovalent antigen binding proteins
US10793621B2 (en) 2011-02-28 2020-10-06 Hoffmann-La Roche Inc. Nucleic acid encoding dual Fc antigen binding proteins
US9428789B2 (en) 2011-03-21 2016-08-30 Biodesy, Inc. Classification of kinase inhibitors using nonlinear optical techniques
US8969526B2 (en) 2011-03-29 2015-03-03 Roche Glycart Ag Antibody Fc variants
US11135305B2 (en) 2011-04-01 2021-10-05 Immunogen, Inc. Methods for increasing efficacy of FOLR1 cancer therapy
US8709432B2 (en) 2011-04-01 2014-04-29 Immunogen, Inc. Methods for increasing efficacy of FOLR1 cancer therapy
WO2012138975A1 (en) 2011-04-07 2012-10-11 Genentech, Inc. Anti-fgfr4 antibodies and methods of use
US10214579B2 (en) 2011-04-13 2019-02-26 Bristol-Myers Squibb Company Fc fusion proteins comprising novel linkers or arrangements
WO2012142515A2 (en) 2011-04-13 2012-10-18 Bristol-Myers Squibb Company Fc fusion proteins comprising novel linkers or arrangements
EP3896083A1 (en) 2011-04-13 2021-10-20 Bristol-Myers Squibb Company Fc fusion proteins comprising novel linkers or arrangements
EP3144320A1 (en) 2011-04-13 2017-03-22 Bristol-Myers Squibb Company Fc fusion proteins comprising novel linkers or arrangements
EP3415528A2 (en) 2011-04-13 2018-12-19 Bristol-Myers Squibb Company Fc fusion proteins comprising novel linkers or arrangements
US9469676B2 (en) 2011-04-13 2016-10-18 Bristol-Myers Squibb Company Fc fusion proteins comprising novel linkers or arrangements
WO2012140627A1 (en) 2011-04-15 2012-10-18 Compugen Ltd. Polypeptides and polynucleotides, and uses thereof for treatment of immune related disorders and cancer
EP3549952A1 (en) 2011-04-20 2019-10-09 Acceleron Pharma Inc. Endoglin polypeptides and uses thereof
WO2012145539A1 (en) 2011-04-20 2012-10-26 Acceleron Pharma, Inc. Endoglin polypeptides and uses thereof
WO2012146630A1 (en) 2011-04-29 2012-11-01 F. Hoffmann-La Roche Ag N-terminal acylated polypeptides, methods for their production and uses thereof
WO2012151248A2 (en) 2011-05-02 2012-11-08 Millennium Pharmaceuticals, Inc. FORMULATION FOR ANTI-α4β7 ANTIBODY
EP3311834A1 (en) 2011-05-02 2018-04-25 Millennium Pharmaceuticals, Inc. Formulation for anti-alpha4beta7 antibody
US9663579B2 (en) 2011-05-02 2017-05-30 Millennium Pharmaceuticals, Inc. Formulation for anti-α4β7 antibody
US10143752B2 (en) 2011-05-02 2018-12-04 Millennium Pharmaceuticals, Inc. Methods of treating ulcerative colitis
US11560434B2 (en) 2011-05-02 2023-01-24 Millennium Pharmaceuticals, Inc. Formulation for anti-α4β7 antibody
US10040855B2 (en) 2011-05-02 2018-08-07 Millennium Pharmaceuticals, Inc. Formulation for anti-α4β7 antibody
US10004808B2 (en) 2011-05-02 2018-06-26 Millennium Pharmaceuticals, Inc. Methods of treating ulcerative colitis
WO2012151247A2 (en) 2011-05-02 2012-11-08 Millennium Pharmaceuticals, Inc. FORMULATION FOR ANTI-α4β7 ANTIBODY
EP3263178A1 (en) 2011-05-02 2018-01-03 Millennium Pharmaceuticals, Inc. Formulation for anti-alpha4beta7 antibody
EP3329965A1 (en) 2011-05-02 2018-06-06 Millennium Pharmaceuticals, Inc. Dosing regimen of anti-alpha4beta7-antibodies
US9764033B2 (en) 2011-05-02 2017-09-19 Millennium Pharmaceuticals, Inc. Formulation for anti-α4β7 antibody
WO2012155019A1 (en) 2011-05-12 2012-11-15 Genentech, Inc. Multiple reaction monitoring lc-ms/ms method to detect therapeutic antibodies in animal samples using framework signature pepides
WO2012156309A1 (en) 2011-05-13 2012-11-22 Millegen Antibodies against her3
WO2012158704A1 (en) 2011-05-16 2012-11-22 Genentech, Inc. Fgfr1 agonists and methods of use
EP3219730A1 (en) 2011-05-16 2017-09-20 F. Hoffmann-La Roche AG Fgfr1 agonists and methods of use
US9376495B2 (en) 2011-05-21 2016-06-28 Macrogenics, Inc. Deimmunized serum-binding domains and their use in extending serum half-life
WO2012162561A2 (en) 2011-05-24 2012-11-29 Zyngenia, Inc. Multivalent and monovalent multispecific complexes and their uses
WO2012172495A1 (en) 2011-06-14 2012-12-20 Novartis Ag Compositions and methods for antibodies targeting tem8
WO2012171996A1 (en) 2011-06-15 2012-12-20 F. Hoffmann-La Roche Ag Anti-human epo receptor antibodies and methods of use
WO2012172521A1 (en) 2011-06-16 2012-12-20 Novartis Ag Soluble proteins for use as therapeutics
WO2012175508A1 (en) 2011-06-22 2012-12-27 F. Hoffmann-La Roche Ag Removal of target cells by circulating virus-specific cytotoxic t-cells using mhc class i comprising complexes
WO2012175692A1 (en) 2011-06-22 2012-12-27 INSERM (Institut National de la Santé et de la Recherche Médicale) Anti-axl antibodies and uses thereof
WO2012175691A1 (en) 2011-06-22 2012-12-27 INSERM (Institut National de la Santé et de la Recherche Médicale) Anti-axl antibodies and uses thereof
WO2013003625A2 (en) 2011-06-28 2013-01-03 Oxford Biotherapeutics Ltd. Antibodies
US9487589B2 (en) 2011-06-30 2016-11-08 Genentech, Inc. Anti-c-met-antibody formulations
WO2013003680A1 (en) 2011-06-30 2013-01-03 Genentech, Inc. Anti-c-met antibody formulations
WO2013006437A1 (en) 2011-07-01 2013-01-10 Novartis Ag Method for treating metabolic disorders
WO2013008171A1 (en) 2011-07-11 2013-01-17 Glenmark Pharmaceuticals S.A. Antibodies that bind to ox40 and their uses
WO2013010955A1 (en) 2011-07-15 2013-01-24 Morphosys Ag Antibodies that are cross-reactive for macrophage migration inhibitory factor (mif) and d-dopachrome tautomerase (d-dt)
WO2013025853A1 (en) 2011-08-17 2013-02-21 Genentech, Inc. Neuregulin antibodies and uses thereof
WO2013026832A1 (en) 2011-08-23 2013-02-28 Roche Glycart Ag Anti-mcsp antibodies
WO2013040433A1 (en) 2011-09-15 2013-03-21 Genentech, Inc. Methods of promoting differentiation
WO2013043715A1 (en) 2011-09-19 2013-03-28 Genentech, Inc. Combination treatments comprising c-met antagonists and b-raf antagonists
US10793633B2 (en) 2011-09-30 2020-10-06 Dana-Farber Cancer Institute, Inc. Therapeutic peptides
WO2013052155A1 (en) 2011-10-05 2013-04-11 Genentech, Inc. Methods of treating liver conditions using notch2 antagonists
EP3461839A1 (en) 2011-10-14 2019-04-03 F. Hoffmann-La Roche AG Anti-htra1 antibodies and methods of use
US8623821B2 (en) 2011-10-14 2014-01-07 Genentech, Inc. Zymogen activators
EP3653222A1 (en) 2011-10-14 2020-05-20 Novartis AG Antibodies and methods for wnt pathway-related diseases
WO2013054307A2 (en) 2011-10-14 2013-04-18 Novartis Ag Antibodies and methods for wnt pathway-related diseases
WO2013055998A1 (en) 2011-10-14 2013-04-18 Genentech, Inc. ANTI-HtrA1 ANTIBODIES AND METHODS OF USE
WO2013056008A1 (en) 2011-10-14 2013-04-18 Genentech, Inc. Zymogen activators
WO2013056148A2 (en) 2011-10-15 2013-04-18 Genentech, Inc. Methods of using scd1 antagonists
WO2013059531A1 (en) 2011-10-20 2013-04-25 Genentech, Inc. Anti-gcgr antibodies and uses thereof
WO2013063001A1 (en) 2011-10-28 2013-05-02 Genentech, Inc. Therapeutic combinations and methods of treating melanoma
US9580509B2 (en) 2011-11-07 2017-02-28 Medimmune, Llc Multispecific and multivalent binding proteins and uses thereof
WO2013070565A1 (en) 2011-11-07 2013-05-16 Medimmune, Llc Multispecific and multivalent binding proteins and uses thereof
WO2013078170A1 (en) 2011-11-21 2013-05-30 Genentech, Inc. Purification of anti-c-met antibodies
EP3590538A1 (en) 2011-12-05 2020-01-08 Novartis AG Antibodies for epidermal growth factor receptor 3 (her3)
WO2013084148A2 (en) 2011-12-05 2013-06-13 Novartis Ag Antibodies for epidermal growth factor receptor 3 (her3) directed to domain ii of her3
WO2013084147A2 (en) 2011-12-05 2013-06-13 Novartis Ag Antibodies for epidermal growth factor receptor 3 (her3)
WO2013083497A1 (en) 2011-12-06 2013-06-13 F. Hoffmann-La Roche Ag Antibody formulation
US9217018B2 (en) 2011-12-15 2015-12-22 Sergei B Onikienko HSP70 fusion protein conjugates and uses thereof
EP3330288A1 (en) 2011-12-21 2018-06-06 Novartis AG Compositions and methods for antibodies targeting factor p
WO2013093762A1 (en) 2011-12-21 2013-06-27 Novartis Ag Compositions and methods for antibodies targeting factor p
WO2013096791A1 (en) 2011-12-23 2013-06-27 Genentech, Inc. Process for making high concentration protein formulations
WO2013106485A2 (en) 2012-01-09 2013-07-18 The Scripps Research Institute Ultralong complementarity determining regions and uses thereof
WO2013106489A1 (en) 2012-01-09 2013-07-18 The Scripps Research Institute Humanized antibodies with ultralong cdr3s
EP3663314A1 (en) 2012-01-09 2020-06-10 The Scripps Research Institute Humanized antibodies with ultralong cdr3s
WO2013109819A1 (en) 2012-01-18 2013-07-25 Genentech, Inc. Anti-lrp5 antibodies and methods of use
WO2013109856A2 (en) 2012-01-18 2013-07-25 Genentech, Inc. Methods of using fgf19 modulators
US9617336B2 (en) 2012-02-01 2017-04-11 Compugen Ltd C10RF32 antibodies, and uses thereof for treatment of cancer
WO2013120056A1 (en) 2012-02-11 2013-08-15 Genentech, Inc. R-spondin translocations and methods using the same
WO2013120929A1 (en) 2012-02-15 2013-08-22 F. Hoffmann-La Roche Ag Fc-receptor based affinity chromatography
US11814409B2 (en) 2012-02-15 2023-11-14 Hoffmann-La Roche Inc. Fc-receptor based affinity chromatography
US9139863B2 (en) 2012-03-16 2015-09-22 Genentech, Inc. Engineered conformationally-stabilized proteins
WO2013137920A1 (en) 2012-03-16 2013-09-19 Genentech, Inc. Engineered conformationally-stabilized proteins
WO2013148315A1 (en) 2012-03-27 2013-10-03 Genentech, Inc. Diagnosis and treatments relating to her3 inhibitors
WO2013149159A1 (en) 2012-03-30 2013-10-03 Genentech, Inc. Anti-lgr5 antibodies and immunoconjugates
US9175089B2 (en) 2012-03-30 2015-11-03 Genentech, Inc. Anti-LGR5 antibodies and immunoconjugates
WO2013151762A1 (en) 2012-04-05 2013-10-10 Ac Immune S.A. Humanized tau antibody
US10130714B2 (en) 2012-04-14 2018-11-20 Academia Sinica Enhanced anti-influenza agents conjugated with anti-inflammatory activity
WO2013162654A1 (en) 2012-04-25 2013-10-31 Biodesy, Llc Methods for detecting allosteric modulators of proteins
US9662405B2 (en) 2012-04-26 2017-05-30 Thomas Jefferson University Method of treating cancer by administering chimeric antigen receptor comprising anti-GCC antibody
US9156915B2 (en) 2012-04-26 2015-10-13 Thomas Jefferson University Anti-GCC antibody molecules
US9056910B2 (en) 2012-05-01 2015-06-16 Genentech, Inc. Anti-PMEL17 antibodies and immunoconjugates
US10196454B2 (en) 2012-05-01 2019-02-05 Genentech, Inc. Anti-PMEL17 antibodies and immunoconjugates
US9597411B2 (en) 2012-05-01 2017-03-21 Genentech, Inc. Anti-PMEL17 antibodies and immunoconjugates
WO2013165940A1 (en) 2012-05-01 2013-11-07 Genentech, Inc. Anti-pmel17 antibodies and immunoconjugates
WO2013170191A1 (en) 2012-05-11 2013-11-14 Genentech, Inc. Methods of using antagonists of nad biosynthesis from nicotinamide
EP3605090A1 (en) 2012-05-23 2020-02-05 F. Hoffmann-La Roche AG Selection method for therapeutic agents
WO2013177470A1 (en) 2012-05-23 2013-11-28 Genentech, Inc. Selection method for therapeutic agents
WO2013184514A1 (en) 2012-06-04 2013-12-12 Irm Llc Site-specific labeling methods and molecules produced thereby
WO2013183032A2 (en) 2012-06-08 2013-12-12 Glenmark Pharmaceuticals S.A. Anti-trka antibodies with enhanced inhibitory properties and derivatives thereof
US9266961B2 (en) 2012-06-15 2016-02-23 Genentech, Inc. Anti-PCSK9 antibodies, formulations, dosing, and methods of use
US11180557B2 (en) 2012-06-22 2021-11-23 King's College London Vista modulators for diagnosis and treatment of cancer
US10933115B2 (en) 2012-06-22 2021-03-02 The Trustees Of Dartmouth College VISTA antagonist and methods of use
US11752189B2 (en) 2012-06-22 2023-09-12 The Trustees Of Dartmouth College Vista antagonist and methods of use
WO2014008218A1 (en) 2012-07-02 2014-01-09 Bristol-Myers Squibb Company Optimization of antibodies that bind lymphocyte activation gene-3 (lag-3), and uses thereof
EP3275899A1 (en) 2012-07-02 2018-01-31 Bristol-Myers Squibb Company Optimization of antibodies that bind lymphocyte activation gene-3 (lag-3), and uses thereof
EP3795592A1 (en) 2012-07-02 2021-03-24 Bristol-Myers Squibb Company Optimization of antibodies that bind lymphocyte activation gene-3 (lag-3), and uses thereof
US9765153B2 (en) 2012-07-04 2017-09-19 Hoffmann-La Roche Inc. Anti-biotin antibodies and methods of use
US10517945B2 (en) 2012-07-04 2019-12-31 Hoffman-La Roche Inc. Covalently linked antigen-antibody conjugates
WO2014006123A1 (en) 2012-07-04 2014-01-09 F. Hoffmann-La Roche Ag Anti-biotin antibodies and methods of use
WO2014006118A1 (en) 2012-07-04 2014-01-09 F. Hoffmann-La Roche Ag Anti-theophylline antibodies and methods of use
WO2014006124A1 (en) 2012-07-04 2014-01-09 F. Hoffmann-La Roche Ag Covalently linked antigen-antibody conjugates
US9925272B2 (en) 2012-07-04 2018-03-27 Hoffmann-La Roche Inc. Anti-theophylline antibodies and methods of use
EP3578660A1 (en) 2012-07-05 2019-12-11 F. Hoffmann-La Roche AG Expression and secretion system
WO2014008391A1 (en) 2012-07-05 2014-01-09 Genentech, Inc. Expression and secretion system
WO2014011521A1 (en) 2012-07-09 2014-01-16 Genentech, Inc. Immunoconjugates comprising anti - cd79b antibodies
WO2014011519A1 (en) 2012-07-09 2014-01-16 Genentech, Inc. Immunoconjugates comprising anti-cd79b antibodies
WO2014011520A1 (en) 2012-07-09 2014-01-16 Genentech, Inc. Immunoconjugates comprising anti-cd22 antibodies
WO2014011518A1 (en) 2012-07-09 2014-01-16 Genentech, Inc. Immunoconjugates comprising anti-cd22 antibodies
US10683345B2 (en) 2012-07-13 2020-06-16 Roche Glycart Ag Bispecific anti-VEGF/anti-ANG-2 antibodies and their use in the treatment of ocular vascular diseases
US9695233B2 (en) 2012-07-13 2017-07-04 Roche Glycart Ag Bispecific anti-VEGF/anti-ANG-2 antibodies and their use in the treatment of ocular vascular diseases
EP4063391A1 (en) 2012-07-25 2022-09-28 Celldex Therapeutics, Inc. Anti-kit antibodies and uses thereof
EP3381943A1 (en) 2012-07-25 2018-10-03 Celldex Therapeutics, Inc. Anti-kit antibodies and uses thereof
WO2014018625A1 (en) 2012-07-25 2014-01-30 Kolltan Pharmaceuticals, Inc. Anti-kit antibodies and uses thereof
WO2014020056A1 (en) 2012-08-02 2014-02-06 F. Hoffmann-La Roche Ag METHOD FOR PRODUCING SOLUBLE FcR AS Fc-FUSION WITH INERT IMMUNOGLOBULIN Fc-REGION AND USES THEREOF
US10214765B2 (en) 2012-08-18 2019-02-26 Academia Sinica Cell-permeable probes for identification and imaging of sialidases
US9200073B2 (en) 2012-08-31 2015-12-01 Immunogen, Inc. Diagnostic assays and kits for detection of folate receptor 1
US10613093B2 (en) 2012-08-31 2020-04-07 Immunogen, Inc. Diagnostic assays and kits for detection of folate receptor 1
US9702881B2 (en) 2012-08-31 2017-07-11 Immunogen, Inc. Diagnostic assays and kits for detection of folate receptor 1
US10180432B2 (en) 2012-08-31 2019-01-15 Immunogen, Inc. Diagnostic assays and kits for detection of folate receptor 1
WO2014037899A2 (en) 2012-09-07 2014-03-13 Novartis Ag Il-18 binding molecules
EP3725805A1 (en) 2012-09-07 2020-10-21 Novartis AG Il-18 binding molecules
US11529416B2 (en) 2012-09-07 2022-12-20 Kings College London Vista modulators for diagnosis and treatment of cancer
US11578372B2 (en) 2012-11-05 2023-02-14 Foundation Medicine, Inc. NTRK1 fusion molecules and uses thereof
WO2014072306A1 (en) 2012-11-08 2014-05-15 F. Hoffmann-La Roche Ag Her3 antigen binding proteins binding to the beta-hairpin of her3
EP3461501A1 (en) 2012-11-13 2019-04-03 F. Hoffmann-La Roche AG Anti-hemagglutinin antibodies and methods of use
WO2014078268A2 (en) 2012-11-13 2014-05-22 Genentech, Inc. Anti-hemagglutinin antibodies and methods of use
EP2733153A1 (en) 2012-11-15 2014-05-21 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods for the preparation of immunoconjugates and uses thereof
WO2014084859A1 (en) 2012-11-30 2014-06-05 Novartis Ag Molecules and methods for modulating tmem16a activities
EP3851454A1 (en) 2012-12-05 2021-07-21 Novartis AG Compositions and methods for antibodies targeting epo
WO2014089111A1 (en) 2012-12-05 2014-06-12 Novartis Ag Compositions and methods for antibodies targeting epo
WO2014093396A1 (en) 2012-12-10 2014-06-19 Biogen Idec Ma Inc. Anti-blood dendritic cell antigen 2 antibodies and uses thereof
EP3686218A1 (en) 2012-12-10 2020-07-29 Biogen MA Inc. Anti-blood dendritic cell antigen 2 antibodies and uses thereof
US9969789B2 (en) 2012-12-17 2018-05-15 Trillium Therapeutics Inc. Treatment of CD47+ disease cells with SIRP alpha-Fc fusions
US10906954B2 (en) 2012-12-17 2021-02-02 Trillium Therapeutics Inc. Treatment of CD47+ disease cells with SIRPα-Fc fusions
US10501521B2 (en) 2012-12-21 2019-12-10 Hoffmann-La Roche Inc. Disulfide-linked multivalent MHC class I comprising multi-function proteins
US9290576B2 (en) 2013-01-02 2016-03-22 Glenmark Pharmaceuticals S.A. Antibodies that bind to TL1A and their uses
WO2014106602A1 (en) 2013-01-02 2014-07-10 Glenmark Pharmaceuticals S.A. Antibodies that bind to tl1a and their uses
WO2014107739A1 (en) 2013-01-07 2014-07-10 Eleven Biotherapeutics, Inc. Antibodies against pcsk9
US11771698B2 (en) 2013-01-18 2023-10-03 Foundation Medicine, Inc. Methods of treating cholangiocarcinoma
WO2014116749A1 (en) 2013-01-23 2014-07-31 Genentech, Inc. Anti-hcv antibodies and methods of using thereof
WO2014124316A2 (en) 2013-02-08 2014-08-14 Irm Llc Specific sites for modifying antibodies to make immunoconjugates
WO2015198217A2 (en) 2013-02-08 2015-12-30 Novartis Ag Compositions and methods for long-acting antibodies targeting il-17
EP3929217A2 (en) 2013-02-08 2021-12-29 Novartis AG Specific sites for modifying antibodies to make immunoconjugates
EP3656786A1 (en) 2013-02-08 2020-05-27 Novartis AG Anti-il-17a antibodies and their use in treating autoimmune and inflammatory disorders
WO2014124258A2 (en) 2013-02-08 2014-08-14 Irm Llc Specific sites for modifying antibodies to make immunoconjugates
WO2014122613A1 (en) 2013-02-08 2014-08-14 Novartis Ag Anti-il-17a antibodies and their use in treating autoimmune and inflammatory disorders
WO2014126884A1 (en) 2013-02-12 2014-08-21 Bristol-Myers Squibb Company High ph protein refolding methods
WO2014126871A1 (en) 2013-02-12 2014-08-21 Bristol-Myers Squibb Company Tangential flow filtration based protein refolding methods
EP3617220A1 (en) 2013-02-12 2020-03-04 Bristol-Myers Squibb Company High ph protein refolding methods
EP3744728A1 (en) 2013-02-12 2020-12-02 Bristol-Myers Squibb Company Tangential flow filtration based protein refolding methods
EP3299378A1 (en) 2013-02-12 2018-03-28 Bristol-Myers Squibb Company High ph protein refolding methods
WO2014128235A1 (en) 2013-02-22 2014-08-28 F. Hoffmann-La Roche Ag Methods of treating cancer and preventing drug resistance
WO2014131715A1 (en) 2013-02-26 2014-09-04 Roche Glycart Ag Anti-mcsp antibodies
WO2014138364A2 (en) 2013-03-06 2014-09-12 Genentech, Inc. Methods of treating and preventing cancer drug resistance
WO2014160160A2 (en) 2013-03-13 2014-10-02 Novartis Ag Antibody drug conjugates
US9908938B2 (en) 2013-03-14 2018-03-06 Macrogenics, Inc. Bispecific molecules that are immunoreactive with immune effector cells that express an activating receptor and an antigen expressed by a cell infected by a virus and uses thereof
US10150813B2 (en) 2013-03-14 2018-12-11 Genentech, Inc. Anti-B7-H4 antibodies and immunoconjugates
US9562099B2 (en) 2013-03-14 2017-02-07 Genentech, Inc. Anti-B7-H4 antibodies and immunoconjugates
US10730947B2 (en) 2013-03-14 2020-08-04 Macrogenics, Inc. Bispecific molecules that are immunoreactive with immune effector cells that express an activating receptor and an antigen expressed by a cell infected by a virus and uses thereof
WO2014153030A2 (en) 2013-03-14 2014-09-25 Genentech, Inc. Methods of treating cancer and preventing cancer drug resistance
EP3611189A1 (en) 2013-03-14 2020-02-19 Novartis AG Antibodies against notch 3
WO2014152358A2 (en) 2013-03-14 2014-09-25 Genentech, Inc. Combinations of a mek inhibitor compound with an her3/egfr inhibitor compound and methods of use
WO2014159835A1 (en) 2013-03-14 2014-10-02 Genentech, Inc. Anti-b7-h4 antibodies and immunoconjugates
WO2014159239A2 (en) 2013-03-14 2014-10-02 Novartis Ag Antibodies against notch 3
US11421031B2 (en) 2013-03-14 2022-08-23 Macrogenics, Inc. Bispecific molecules that are immunoreactive with immune effector cells that express an activating receptor and an antigen expressed by a cell infected by a virus and uses thereof
US11230600B2 (en) 2013-03-14 2022-01-25 Genentech, Inc. Anti-B7-H4 antibodies and immunoconjugates
EP3299391A1 (en) 2013-03-14 2018-03-28 Genentech, Inc. Anti-b7-h4 antibodies and immunoconjugates
US11130791B2 (en) 2013-03-15 2021-09-28 Genentech, Inc. Methods for treating metabolic syndrome using IL-22 Fc fusion proteins
WO2014143739A2 (en) 2013-03-15 2014-09-18 Biogen Idec Ma Inc. Anti-alpha v beta 6 antibodies and uses thereof
WO2014144791A2 (en) 2013-03-15 2014-09-18 Dana-Farber Cancer Institute, Inc. Therapeutic peptides
US9708407B2 (en) 2013-03-15 2017-07-18 Genzyme Corporation Anti-CD52 antibodies
US11155591B2 (en) 2013-03-15 2021-10-26 Genentech, Inc. Methods of treating acute pancreatitis using IL-22 fc fusion proteins
US11136365B2 (en) 2013-03-15 2021-10-05 Genentech, Inc. Methods for preventing or treating cardiovascular conditions using il-22 fc fusion proteins
US11332507B2 (en) 2013-03-15 2022-05-17 Genentech, Inc. IL-22 Fc fusion proteins
WO2014145016A2 (en) 2013-03-15 2014-09-18 Genentech, Inc. Il-22 polypeptides and il-22 fc fusion proteins and methods of use
EP3424530A1 (en) 2013-03-15 2019-01-09 Zyngenia, Inc. Multivalent and monovalent multispecific complexes and their uses
EP3385277A1 (en) 2013-03-15 2018-10-10 F. Hoffmann-La Roche AG Il-22 polypeptides and il-22 fc fusion proteins and methods of use
US10160793B2 (en) 2013-03-15 2018-12-25 Genentech, Inc. Methods of treating inflammatory bowel disease using IL-22 Fc fusion proteins
WO2014144865A2 (en) 2013-03-15 2014-09-18 Genentech, Inc. Anti-crth2 antibodies and methods of use
WO2014144466A1 (en) 2013-03-15 2014-09-18 Biogen Idec Ma Inc. Anti-alpha v beta 6 antibodies and uses thereof
WO2014144850A1 (en) 2013-03-15 2014-09-18 Genentech, Inc. Methods of treating cancer and preventing cancer drug resistance
US10745483B2 (en) 2013-03-15 2020-08-18 Dana-Farber Cancer Institute, Inc. Therapeutic peptides
WO2014151866A1 (en) 2013-03-15 2014-09-25 Genentech, Inc. Compositions and methods for diagnosis and treatment of hepatic cancers
EP3666886A1 (en) 2013-03-15 2020-06-17 Dana-Farber Cancer Institute, Inc. Therapeutic peptides
EP4356960A2 (en) 2013-03-15 2024-04-24 F. Hoffmann-La Roche AG Biomarkers and methods of treating pd-1 and pd-l1 related conditions
EP3633377A1 (en) 2013-03-15 2020-04-08 F. Hoffmann-La Roche AG Biomarkers and methods of treating pd-1 and pd-l1 related conditions
WO2014151680A1 (en) 2013-03-15 2014-09-25 Biogen Idec Ma Inc. Treatment and prevention of acute kidney injury using anti-alpha v beta 5 antibodies
WO2014151006A2 (en) 2013-03-15 2014-09-25 Genentech, Inc. Biomarkers and methods of treating pd-1 and pd-l1 related conditions
WO2014150877A2 (en) 2013-03-15 2014-09-25 Ac Immune S.A. Anti-tau antibodies and methods of use
US10584155B2 (en) 2013-03-15 2020-03-10 Genentech, Inc. Pharmaceutical compositions of IL-22 Fc fusion proteins
US10544198B2 (en) 2013-03-15 2020-01-28 Genentech, Inc. Methods of accelerating or improving wound healing using IL-22 FC fusion proteins
EP3514178A1 (en) 2013-03-15 2019-07-24 Novartis AG Antibody drug conjugates
US9815880B2 (en) 2013-03-15 2017-11-14 Genentech, Inc. IL-22 Fc fusion proteins
US10087227B2 (en) 2013-03-15 2018-10-02 Genentech, Inc. Nucleic acids encoding IL-22 Fc fusion proteins
EP3878866A1 (en) 2013-04-29 2021-09-15 F. Hoffmann-La Roche AG Fc-receptor binding modified asymmetric antibodies and methods of use
WO2014177460A1 (en) 2013-04-29 2014-11-06 F. Hoffmann-La Roche Ag Human fcrn-binding modified antibodies and methods of use
WO2014177461A1 (en) 2013-04-29 2014-11-06 F. Hoffmann-La Roche Ag Fcrn-binding abolished anti-igf-1r antibodies and their use in the treatment of vascular eye diseases
EP3628685A1 (en) 2013-04-29 2020-04-01 F. Hoffmann-La Roche AG Human fcrn-binding modified antibodies and methods of use
EP4324480A2 (en) 2013-05-20 2024-02-21 F. Hoffmann-La Roche AG Anti-transferrin receptor antibodies and methods of use
EP3594240A1 (en) 2013-05-20 2020-01-15 F. Hoffmann-La Roche AG Anti-transferrin receptor antibodies and methods of use
US10053510B2 (en) 2013-05-24 2018-08-21 Promis Neurosciences Inc. FasR antibodies and methods of use
WO2014205300A2 (en) 2013-06-21 2014-12-24 Novartis Ag Lectin-like oxidized ldl receptor1 antibodies and methods of use
WO2014205302A2 (en) 2013-06-21 2014-12-24 Novartis Ag Lectin-like oxidized ldl receptor1 antibodies and methods of use
US10086054B2 (en) 2013-06-26 2018-10-02 Academia Sinica RM2 antigens and use thereof
US9981030B2 (en) 2013-06-27 2018-05-29 Academia Sinica Glycan conjugates and use thereof
WO2015010100A2 (en) 2013-07-18 2015-01-22 Fabrus, Inc. Humanized antibodies with ultralong complementarity determining regions
WO2015017146A2 (en) 2013-07-18 2015-02-05 Fabrus, Inc. Antibodies with ultralong complementarity determining regions
US10344092B2 (en) 2013-08-09 2019-07-09 Macrogenics, Inc. Bi-specific monovalent Fc diabodies that are capable of binding CD32B and CD79b and uses thereof
US11384149B2 (en) 2013-08-09 2022-07-12 Macrogenics, Inc. Bi-specific monovalent Fc diabodies that are capable of binding CD32B and CD79b and uses thereof
WO2015022658A2 (en) 2013-08-14 2015-02-19 Novartis Ag Methods of treating sporadic inclusion body myositis
EP3705498A1 (en) 2013-08-22 2020-09-09 Acceleron Pharma Inc. Tgf-beta receptor type ii variants and uses thereof
US9932400B2 (en) 2013-08-23 2018-04-03 Macrogenics, Inc. Bi-specific monovalent diabodies that are capable of binding to gpA33 and CD3, and uses thereof
US9822181B2 (en) 2013-08-23 2017-11-21 Macrogenics, Inc. Bi-specific monovalent diabodies that are capable of binding CD123 and CD3, and uses thereof
US10787521B2 (en) 2013-08-23 2020-09-29 Macrogenics, Inc. Bi-specific monovalent diabodies that are capable of binding CD123 and CD3, and uses thereof
US10858430B2 (en) 2013-08-23 2020-12-08 Macrogenics, Inc. Bi-specific monovalent diabodies that are capable of binding to gpA33 and CD3, and uses thereof
US11932701B2 (en) 2013-08-30 2024-03-19 Immunogen, Inc. Method for increasing the efficacy of cancer therapy by administering an anti-FOLR1 immunoconjugate
US11198736B2 (en) 2013-08-30 2021-12-14 Immunogen, Inc. Method for identifying an ovarian cancer in a subject likely to respond to anti-folate receptor 1 (FOLR1) antibody
US9637547B2 (en) 2013-08-30 2017-05-02 Immunogen, Inc. Monoclonal antibodies for detection of folate receptor 1
US10544230B2 (en) 2013-08-30 2020-01-28 Immunogen, Inc. Methods of using antibodies to detect folate receptor 1 (FOLR1)
US10017578B2 (en) 2013-08-30 2018-07-10 Immunogen, Inc. Methods of treating cancer in a patient by administering anti-folate-receptor-1 (FOLR1) antibodies
US10111951B2 (en) 2013-09-06 2018-10-30 Academia Sinica Human iNKT cell activation using glycolipids with altered glycosyl groups
US10918714B2 (en) 2013-09-06 2021-02-16 Academia Sinica Human iNKT cell activation using glycolipids with altered glycosyl groups
US9834606B2 (en) 2013-09-13 2017-12-05 Beigene, Ltd Anti-PD1 antibodies and their use as therapeutics and diagnostics
US10519235B2 (en) 2013-09-13 2019-12-31 Beigene Switzerland Gmbh Anti-PD1 antibodies and their use as therapeutics and diagnostics
US11186637B2 (en) 2013-09-13 2021-11-30 Beigene Switzerland Gmbh Anti-PD1 antibodies and their use as therapeutics and diagnostics
US9988450B2 (en) 2013-09-13 2018-06-05 Beigene Switzerland Gmbh Anti-PD1 antibodies and their use as therapeutics and diagnostics
US11673951B2 (en) 2013-09-13 2023-06-13 Beigene Switzerland Gmbh Anti-PD1 antibodies and their use as therapeutics and diagnostics
WO2015042108A1 (en) 2013-09-17 2015-03-26 Genentech, Inc. Methods of using anti-lgr5 antibodies
US10246515B2 (en) 2013-09-17 2019-04-02 Genentech, Inc. Methods of treating hedgehog-related diseases with an anti-LGR5 antibody
WO2015046467A1 (en) 2013-09-27 2015-04-02 中外製薬株式会社 Method for producing polypeptide heteromultimer
EP3733244A1 (en) 2013-10-02 2020-11-04 Medlmmune, LLC Neutralizing anti-influenza a antibodies and uses thereof
US9975963B2 (en) 2013-10-11 2018-05-22 Genentech, Inc. NSP4 inhibitors and methods of use
WO2015052230A1 (en) 2013-10-11 2015-04-16 F. Hoffmann-La Roche Ag Multispecific domain exchanged common variable light chain antibodies
WO2015054670A1 (en) 2013-10-11 2015-04-16 Genentech, Inc. Nsp4 inhibitors and methods of use
US10323099B2 (en) 2013-10-11 2019-06-18 Hoffmann-La Roche Inc. Multispecific domain exchanged common variable light chain antibodies
US10246519B2 (en) 2013-10-11 2019-04-02 Genentech, Inc. NSP4 inhibitors and methods of use
WO2015057939A1 (en) 2013-10-18 2015-04-23 Biogen Idec Ma Inc. Anti-s1p4 antibodies and uses thereof
WO2015058132A2 (en) 2013-10-18 2015-04-23 Genentech, Inc. Anti-rspo antibodies and methods of use
WO2015061441A1 (en) 2013-10-23 2015-04-30 Genentech, Inc. Methods of diagnosing and treating eosinophilic disorders
EP3851118A1 (en) 2013-10-25 2021-07-21 Acceleron Pharma Inc. Endoglin peptides to treat fibrotic diseases
WO2015067986A1 (en) 2013-11-07 2015-05-14 INSERM (Institut National de la Santé et de la Recherche Médicale) Neuregulin allosteric anti-her3 antibody
US11654104B2 (en) 2013-11-07 2023-05-23 Evive Biotechnology (Shanghai) Ltd Use of IL-22 dimer in manufacture of a medicament for intravenous administration
WO2015075011A1 (en) 2013-11-21 2015-05-28 F. Hoffmann-La Roche Ag ANTI-alpha-SYNUCLEIN ANTIBODIES AND METHODS OF USE
US10106611B2 (en) 2013-12-06 2018-10-23 Dana-Farber Cancer Institute, Inc. Antibodies that bind to MHC class I polypeptide-related sequence A
WO2015085210A1 (en) 2013-12-06 2015-06-11 Dana-Farber Cancer Institute, Inc. Therapeutic peptides
WO2015089117A1 (en) 2013-12-09 2015-06-18 Allakos Inc. Anti-siglec-8 antibodies and methods of use thereof
EP3611191A1 (en) 2013-12-09 2020-02-19 Allakos Inc. Anti-siglec-8 antibodies and methods of use thereof
US9546215B2 (en) 2013-12-09 2017-01-17 Allakos Inc. Anti-Siglec-8 antibodies and methods of use thereof
WO2015089344A1 (en) 2013-12-13 2015-06-18 Genentech, Inc. Anti-cd33 antibodies and immunoconjugates
EP3461845A1 (en) 2013-12-13 2019-04-03 Genentech, Inc. Anti-cd33 antibodies and immunoconjugates
WO2015095423A2 (en) 2013-12-17 2015-06-25 Genentech, Inc. Combination therapy comprising ox40 binding agonists and pd-1 axis binding antagonists
WO2015095410A1 (en) 2013-12-17 2015-06-25 Genentech, Inc. Methods of treating cancer using pd-1 axis binding antagonists and an anti-cd20 antibody
US11186650B2 (en) 2013-12-17 2021-11-30 Genentech, Inc. Anti-CD3 antibodies and methods of use
US11530275B2 (en) 2013-12-17 2022-12-20 Genentech, Inc. Anti-CD3 antibodies and methods of use
US11732054B2 (en) 2013-12-17 2023-08-22 Genentech, Inc. Anti-CD3 antibodies and methods of use
US10174124B2 (en) 2013-12-17 2019-01-08 Genentech, Inc. Anti-CD3 antibodies and methods of use
EP3680254A1 (en) 2013-12-17 2020-07-15 F. Hoffmann-La Roche AG Methods of treating her2-positive cancers using pd-1 axis binding antagonists and anti-her2 antibodies
WO2015095418A1 (en) 2013-12-17 2015-06-25 Genentech, Inc. Methods of treating her2-positive cancers using pd-1 axis binding antagonists and anti-her2 antibodies
EP3527587A1 (en) 2013-12-17 2019-08-21 F. Hoffmann-La Roche AG Combination therapy comprising ox40 binding agonists and pd-l1 binding antagonists
US10640572B2 (en) 2013-12-17 2020-05-05 Genentech, Inc. Anti-CD3 antibodies and methods of use
US10865251B2 (en) 2013-12-17 2020-12-15 Genentech, Inc. Anti-CD3 antibodies and methods of use
EP3647324A1 (en) 2013-12-17 2020-05-06 F. Hoffmann-La Roche AG Methods of treating cancers using pd-1 axis binding antagonists and taxanes
WO2015091656A1 (en) 2013-12-20 2015-06-25 F. Hoffmann-La Roche Ag HUMANIZED ANTI-Tau(pS422) ANTIBODIES AND METHODS OF USE
US10465000B2 (en) 2013-12-20 2019-11-05 Hoffmann-La Roche Inc. Humanized anti-Tau(pS422) antibodies and methods of use
EP4219555A1 (en) 2013-12-23 2023-08-02 F. Hoffmann-La Roche AG Antibodies and methods of use
EP3626738A1 (en) 2013-12-24 2020-03-25 Argenx BVBA Fcrn antagonists and methods of use
WO2015100299A1 (en) 2013-12-24 2015-07-02 Argen-X N.V. Fcrn antagonists and methods of use
US11242392B2 (en) 2013-12-24 2022-02-08 Janssen Pharmaceutica Nv Anti-vista antibodies and fragments
US11014987B2 (en) 2013-12-24 2021-05-25 Janssen Pharmaceutics Nv Anti-vista antibodies and fragments, uses thereof, and methods of identifying same
US11505585B2 (en) 2013-12-24 2022-11-22 argenx BV FcRn antagonists and methods of use
WO2015101587A1 (en) 2014-01-03 2015-07-09 F. Hoffmann-La Roche Ag Covalently linked helicar-anti-helicar antibody conjugates and uses thereof
WO2015101589A1 (en) 2014-01-03 2015-07-09 F. Hoffmann-La Roche Ag Covalently linked polypeptide toxin-antibody conjugates
US10561737B2 (en) 2014-01-03 2020-02-18 Hoffmann-La Roche Inc. Bispecific anti-hapten/anti-blood brain barrier receptor antibodies, complexes thereof and their use as blood brain barrier shuttles
US10519249B2 (en) 2014-01-03 2019-12-31 Hoffmann-La Roche Inc. Covalently linked polypeptide toxin-antibody conjugates
US10407511B2 (en) 2014-01-03 2019-09-10 Hoffmann-La Roche Inc. Covalently linked helicar-anti-helicar antibody conjugates and uses thereof
WO2015101586A1 (en) 2014-01-03 2015-07-09 F. Hoffmann-La Roche Ag Bispecific anti-hapten/anti-blood brain barrier receptor antibodies, complexes thereof and their use as blood brain barrier shuttles
WO2015101588A1 (en) 2014-01-06 2015-07-09 F. Hoffmann-La Roche Ag Monovalent blood brain barrier shuttle modules
WO2015107026A1 (en) 2014-01-15 2015-07-23 F. Hoffmann-La Roche Ag Fc-region variants with modified fcrn- and maintained protein a-binding properties
EP3835318A1 (en) 2014-01-15 2021-06-16 F. Hoffmann-La Roche AG Fc-region variants with modified fcrn- and maintained protein a-binding properties
US10150818B2 (en) 2014-01-16 2018-12-11 Academia Sinica Compositions and methods for treatment and detection of cancers
US9982041B2 (en) 2014-01-16 2018-05-29 Academia Sinica Compositions and methods for treatment and detection of cancers
WO2015112909A1 (en) 2014-01-24 2015-07-30 Genentech, Inc. Methods of using anti-steap1 antibodies and immunoconjugates
WO2015120075A2 (en) 2014-02-04 2015-08-13 Genentech, Inc. Mutant smoothened and methods of using the same
EP3718563A1 (en) 2014-02-08 2020-10-07 F. Hoffmann-La Roche AG Methods of treating alzheimer's disease
WO2015120280A1 (en) 2014-02-08 2015-08-13 Genentech, Inc. Methods of treating alzheimer's disease
EP3900738A1 (en) 2014-02-08 2021-10-27 F. Hoffmann-La Roche AG Methods of treating alzheimer's disease
WO2015120233A1 (en) 2014-02-08 2015-08-13 Genentech, Inc. Methods of treating alzheimer's disease
EP3428190A1 (en) 2014-02-12 2019-01-16 F. Hoffmann-La Roche AG Anti-jagged1 antibodies and methods of use
EP3825332A1 (en) 2014-02-12 2021-05-26 F. Hoffmann-La Roche AG Anti-jagged1 antibodies and methods of use
WO2015127405A2 (en) 2014-02-21 2015-08-27 Genentech, Inc. Anti-il-13/il-17 bispecific antibodies and uses thereof
EP4014995A1 (en) 2014-02-28 2022-06-22 Allakos Inc. Methods and compositions for treating siglec-8 associated diseases
US10183996B2 (en) 2014-02-28 2019-01-22 Allakos Inc. Methods and compositions for treating Siglec-8 associated diseases
WO2015131155A1 (en) 2014-02-28 2015-09-03 Allakos Inc. Methods and compositions for treating siglec-8 associated diseases
WO2015134894A1 (en) 2014-03-07 2015-09-11 Alexion Pharmaceuticals, Inc. Anti-c5 antibodies having improved pharmacokinetics
EP3594235A1 (en) 2014-03-07 2020-01-15 Alexion Pharmaceuticals, Inc. Anti-c5 antibodies having improved pharmacokinetics
EP3095795A1 (en) 2014-03-07 2016-11-23 Alexion Pharmaceuticals, Inc. Anti-c5 antibodies having improved pharmacokinetics
WO2015138615A2 (en) 2014-03-12 2015-09-17 Irm Llc Specific sites for modifying antibodies to make immunoconjugates
EP3960767A2 (en) 2014-03-12 2022-03-02 Novartis AG Specific sites for modifying antibodies to make immunoconjugates
US10279021B2 (en) 2014-03-14 2019-05-07 Dana-Faber Cancer Institute, Inc. Vaccine compositions and methods for restoring NKG2D pathway function against cancers
WO2015139046A1 (en) 2014-03-14 2015-09-17 Genentech, Inc. Methods and compositions for secretion of heterologous polypeptides
WO2015140591A1 (en) 2014-03-21 2015-09-24 Nordlandssykehuset Hf Anti-cd14 antibodies and uses thereof
WO2015148531A1 (en) 2014-03-24 2015-10-01 Genentech, Inc. Cancer treatment with c-met antagonists and correlation of the latter with hgf expression
US10240207B2 (en) 2014-03-24 2019-03-26 Genentech, Inc. Cancer treatment with c-met antagonists and correlation of the latter with HGF expression
US10119972B2 (en) 2014-03-27 2018-11-06 Academia Sinica Reactive labelling compounds and uses thereof
WO2015153513A1 (en) 2014-03-31 2015-10-08 Genentech, Inc. Anti-ox40 antibodies and methods of use
US9975957B2 (en) 2014-03-31 2018-05-22 Genentech, Inc. Anti-OX40 antibodies and methods of use
WO2015153514A1 (en) 2014-03-31 2015-10-08 Genentech, Inc. Combination therapy comprising anti-angiogenesis agents and ox40 binding agonists
EP3632934A1 (en) 2014-03-31 2020-04-08 F. Hoffmann-La Roche AG Anti-ox40 antibodies and methods of use
US10730951B2 (en) 2014-03-31 2020-08-04 Genentech, Inc. Anti-OX40 antibodies and methods of use
WO2015164330A1 (en) 2014-04-21 2015-10-29 Millennium Pharmaceuticals, Inc. Anti-psyk antibody molecules and use of same for syk-targeted therapy
WO2015164615A1 (en) 2014-04-24 2015-10-29 University Of Oslo Anti-gluten antibodies and uses thereof
WO2015162590A1 (en) 2014-04-24 2015-10-29 Novartis Ag Methods of improving or accelerating physical recovery after surgery for hip fracture
EP3461495A1 (en) 2014-04-24 2019-04-03 Novartis AG Methods of improving or accelerating physical recovery after surgery for hip fracture
US11178860B2 (en) 2014-05-05 2021-11-23 Regeneron Pharmaceuticals, Inc. Humanized C5 animals
US10492477B2 (en) 2014-05-05 2019-12-03 Regeneron Pharmaceuticals, Inc. Humanized C5 animals
US10524458B2 (en) 2014-05-05 2020-01-07 Regeneron Pharmaceuticals, Inc. Humanized C3 animals
WO2015171523A1 (en) 2014-05-05 2015-11-12 Regeneron Pharmaceuticals, Inc. Humanized c5 and c3 animals
US9795121B2 (en) 2014-05-05 2017-10-24 Regeneron Pharmaceuticals, Inc. Humanized C3 animals
WO2015179658A2 (en) 2014-05-22 2015-11-26 Genentech, Inc. Anti-gpc3 antibodies and immunoconjugates
WO2015179835A2 (en) 2014-05-23 2015-11-26 Genentech, Inc. Mit biomarkers and methods using the same
US10118969B2 (en) 2014-05-27 2018-11-06 Academia Sinica Compositions and methods relating to universal glycoforms for enhanced antibody efficacy
US10618973B2 (en) 2014-05-27 2020-04-14 Academia Sinica Anti-HER2 glycoantibodies and uses thereof
US11884739B2 (en) 2014-05-27 2024-01-30 Academia Sinica Anti-CD20 glycoantibodies and uses thereof
US11319567B2 (en) 2014-05-27 2022-05-03 Academia Sinica Fucosidase from bacteroides and methods using the same
US10023892B2 (en) 2014-05-27 2018-07-17 Academia Sinica Compositions and methods relating to universal glycoforms for enhanced antibody efficacy
US10005847B2 (en) 2014-05-27 2018-06-26 Academia Sinica Anti-HER2 glycoantibodies and uses thereof
US10800849B2 (en) 2014-05-28 2020-10-13 Agenus Inc. Anti-GITR antibodies and methods of use thereof
WO2015184099A1 (en) 2014-05-28 2015-12-03 4-Antibody Ag Anti-gitr antibodies and methods of use thereof
US11401335B2 (en) 2014-05-28 2022-08-02 Agenus Inc. Anti-GITR antibodies and methods of use thereof
US10829559B2 (en) 2014-05-28 2020-11-10 Agenus Inc. Anti-GITR antibodies and methods of use thereof
EP3498295A1 (en) 2014-05-28 2019-06-19 Agenus Inc. Anti-gitr antibodies and methods of use thereof
US10577426B2 (en) 2014-05-28 2020-03-03 Agenus Inc. Anti-GITR antibodies and methods of use thereof
US10280226B2 (en) 2014-05-28 2019-05-07 Agenus Inc. Anti-GITR antibodies and methods of use thereof
US11332523B2 (en) 2014-05-28 2022-05-17 Academia Sinica Anti-TNF-alpha glycoantibodies and uses thereof
US10155818B2 (en) 2014-05-28 2018-12-18 Agenus Inc. Anti-GITR antibodies and methods of use thereof
US11897962B2 (en) 2014-05-28 2024-02-13 Agenus Inc. Anti-GITR antibodies and methods of use thereof
WO2015187835A2 (en) 2014-06-06 2015-12-10 Bristol-Myers Squibb Company Antibodies against glucocorticoid-induced tumor necrosis factor receptor (gitr) and uses thereof
EP3998079A1 (en) 2014-06-06 2022-05-18 Bristol-Myers Squibb Company Antibodies against glucocorticoid-induced tumor necrosis factor receptor (gitr) and uses thereof
EP3610924A1 (en) 2014-06-06 2020-02-19 Bristol-Myers Squibb Company Antibodies against glucocorticoid-induced tumor necrosis factor receptor (gitr) and uses thereof
WO2015191715A1 (en) 2014-06-11 2015-12-17 Genentech, Inc. Anti-lgr5 antibodies and uses thereof
US11123426B2 (en) 2014-06-11 2021-09-21 The Trustees Of Dartmouth College Use of vista agonists and antagonists to suppress or enhance humoral immunity
WO2015191986A1 (en) 2014-06-13 2015-12-17 Genentech, Inc. Methods of treating and preventing cancer drug resistance
US11673968B2 (en) 2014-06-26 2023-06-13 Hoffmann-La Roche Inc. Anti-BRDU antibodies and methods of use
US10251952B2 (en) 2014-06-26 2019-04-09 Hoffmann-La Roche Inc. Humanized anti-tau(pS422) antibody brain shuttles and use thereof
US10544225B2 (en) 2014-07-03 2020-01-28 Beigene, Ltd. Anti-PD-L1 antibodies and their use as therapeutics and diagnostics
US11512132B2 (en) 2014-07-03 2022-11-29 Beigene, Ltd. Anti-PD-L1 antibodies and their use as therapeutics and diagnostics
WO2016007775A1 (en) 2014-07-11 2016-01-14 Genentech, Inc. Notch pathway inhibition
WO2016007235A1 (en) 2014-07-11 2016-01-14 Genentech, Inc. Anti-pd-l1 antibodies and diagnostic uses thereof
EP3309174A1 (en) 2014-07-11 2018-04-18 Genentech, Inc. Anti-pd-l1 antibodies and diagnostic uses thereof
US10981994B2 (en) 2014-07-22 2021-04-20 Apollomics Inc. Anti PD-1 antibodies
US10428146B2 (en) 2014-07-22 2019-10-01 Cb Therapeutics, Inc. Anti PD-1 antibodies
US11560429B2 (en) 2014-07-22 2023-01-24 Apollomics Inc. Anti PD-1 antibodies
US11111300B2 (en) 2014-08-05 2021-09-07 Apollomics Inc. Anti PD-L1 antibodies
US10435470B2 (en) 2014-08-05 2019-10-08 Cb Therapeutics, Inc. Anti-PD-L1 antibodies
WO2016020791A1 (en) 2014-08-05 2016-02-11 Novartis Ag Ckit antibody drug conjugates
US11827707B2 (en) 2014-08-05 2023-11-28 Apollomics Inc. Anti PD-L1 antibodies
WO2016020882A2 (en) 2014-08-07 2016-02-11 Novartis Ag Angiopoetin-like 4 (angptl4) antibodies and methods of use
WO2016020880A2 (en) 2014-08-07 2016-02-11 Novartis Ag Angiopoietin-like 4 antibodies and methods of use
EP4122957A1 (en) 2014-08-07 2023-01-25 Novartis AG Angiopoietin-like 4 antibodies and methods of use
WO2016024195A1 (en) 2014-08-12 2016-02-18 Novartis Ag Anti-cdh6 antibody drug conjugates
WO2016028672A1 (en) 2014-08-19 2016-02-25 Merck Sharp & Dohme Corp. Anti-lag3 antibodies and antigen-binding fragments
EP3834842A1 (en) 2014-08-19 2021-06-16 Merck Sharp & Dohme Corp. Anti-lag3 antibodies and antigen-binding fragments
WO2016028656A1 (en) 2014-08-19 2016-02-25 Merck Sharp & Dohme Corp. Anti-tigit antibodies
US11584927B2 (en) 2014-08-28 2023-02-21 Bioatla, Inc. Conditionally active chimeric antigen receptors for modified T-cells
US10533034B2 (en) 2014-09-08 2020-01-14 Academia Sinica Human iNKT cell activation using glycolipids
US9879042B2 (en) 2014-09-08 2018-01-30 Academia Sinica Human iNKT cell activation using glycolipids
EP3782654A1 (en) 2014-09-12 2021-02-24 Genentech, Inc. Anti-her2 antibodies and immunoconjugates
WO2016040868A1 (en) 2014-09-12 2016-03-17 Genentech, Inc. Anti-cll-1 antibodies and immunoconjugates
US10059768B2 (en) 2014-09-12 2018-08-28 Genentech, Inc. Anti-B7-H4 antibodies and immunoconjugates
US11084877B2 (en) 2014-09-12 2021-08-10 Genentech, Inc. Anti-CLL-1 antibodies and immunoconjugates
EP3693391A1 (en) 2014-09-12 2020-08-12 Genentech, Inc. Anti-cll-1 antibodies and immunoconjugates
WO2016040856A2 (en) 2014-09-12 2016-03-17 Genentech, Inc. Cysteine engineered antibodies and conjugates
US11286302B2 (en) 2014-09-12 2022-03-29 Genentech, Inc. Anti-B7-H4 antibodies and immunoconjugates
WO2016044396A1 (en) 2014-09-17 2016-03-24 Genentech, Inc. Immunoconjugates comprising anti-her2 antibodies and pyrrolobenzodiazepines
EP3689910A2 (en) 2014-09-23 2020-08-05 F. Hoffmann-La Roche AG Method of using anti-cd79b immunoconjugates
US10717778B2 (en) 2014-09-29 2020-07-21 Duke University Bispecific molecules comprising an HIV-1 envelope targeting arm
WO2016057846A1 (en) 2014-10-08 2016-04-14 Novartis Ag Compositions and methods of use for augmented immune response and cancer therapy
WO2016057841A1 (en) 2014-10-08 2016-04-14 Novartis Ag Compositions and methods of use for augmented immune response and cancer therapy
WO2016061389A2 (en) 2014-10-16 2016-04-21 Genentech, Inc. Anti-alpha-synuclein antibodies and methods of use
US10640564B2 (en) 2014-10-17 2020-05-05 Ichnos Sciences SA Antibodies that bind to CCR6 and their uses
WO2016073378A1 (en) 2014-11-03 2016-05-12 Genentech, Inc. Assays for detecting t cell immune subsets and methods of use thereof
US10767232B2 (en) 2014-11-03 2020-09-08 Genentech, Inc. Methods and biomarkers for predicting efficacy and evaluation of an OX40 agonist treatment
US10845364B2 (en) 2014-11-03 2020-11-24 Genentech, Inc. Assays for detecting T cell immune subsets and methods of use thereof
WO2016073791A1 (en) 2014-11-05 2016-05-12 Genentech, Inc. Methods of producing two chain proteins in bacteria
EP3753948A1 (en) 2014-11-05 2020-12-23 Genentech, Inc. Methods of producing two chain proteins in bacteria
WO2016073794A1 (en) 2014-11-05 2016-05-12 Genentech, Inc. Methods of producing two chain proteins in bacteria
US10066002B2 (en) 2014-11-05 2018-09-04 Genentech, Inc. Methods of producing two chain proteins in bacteria
US11091530B2 (en) 2014-11-05 2021-08-17 Genentech, Inc. Methods of producing two chain proteins in bacteria
US10112994B2 (en) 2014-11-05 2018-10-30 Genentech, Inc. Methods of producing two chain proteins in bacteria
US11299539B2 (en) 2014-11-05 2022-04-12 Genentech, Inc. Methods of producing two chain proteins in bacteria
US10208120B2 (en) 2014-11-05 2019-02-19 Genentech, Inc. Anti-FGFR2/3 antibodies and methods using same
WO2016073157A1 (en) 2014-11-06 2016-05-12 Genentech, Inc. Anti-ang2 antibodies and methods of use thereof
EP3611188A1 (en) 2014-11-06 2020-02-19 F. Hoffmann-La Roche AG Fc-region variants with modified fcrn-binding and methods of use
WO2016073282A1 (en) 2014-11-06 2016-05-12 Genentech, Inc. Combination therapy comprising ox40 binding agonists and tigit inhibitors
EP3842453A1 (en) 2014-11-06 2021-06-30 F. Hoffmann-La Roche AG Fc-region variants with modified fcrn- and protein a-binding properties
WO2016077369A1 (en) 2014-11-10 2016-05-19 Genentech, Inc. Animal model for nephropathy and agents for treating the same
EP3552488A1 (en) 2014-11-10 2019-10-16 F. Hoffmann-La Roche AG Animal model for nephropathy and agents for treating the same
EP3783023A1 (en) 2014-11-10 2021-02-24 H. Hoffnabb-La Roche Ag Anti-interleukin-33 antibodies and uses thereof
WO2016077381A1 (en) 2014-11-10 2016-05-19 Genentech, Inc. Anti-interleukin-33 antibodies and uses thereof
WO2016075670A1 (en) 2014-11-14 2016-05-19 Novartis Ag Antibody drug conjugates
WO2016081384A1 (en) 2014-11-17 2016-05-26 Genentech, Inc. Combination therapy comprising ox40 binding agonists and pd-1 axis binding antagonists
WO2016081640A1 (en) 2014-11-19 2016-05-26 Genentech, Inc. Anti-transferrin receptor / anti-bace1 multispecific antibodies and methods of use
WO2016081639A1 (en) 2014-11-19 2016-05-26 Genentech, Inc. Antibodies against bace1 and use thereof for neural disease immunotherapy
WO2016081643A1 (en) 2014-11-19 2016-05-26 Genentech, Inc. Anti-transferrin receptor antibodies and methods of use
EP3845565A2 (en) 2014-11-19 2021-07-07 Genentech, Inc. Antibodies against bace1 and use thereof for neural disease immunotherapy
WO2016081748A2 (en) 2014-11-21 2016-05-26 Bristol-Myers Squibb Company Antibodies against cd73 and uses thereof
EP3789399A1 (en) 2014-11-21 2021-03-10 Bristol-Myers Squibb Company Antibodies comprising modified heavy constant regions
EP3725808A1 (en) 2014-11-21 2020-10-21 Bristol-Myers Squibb Company Antibodies against cd73 and uses thereof
EP3581585A1 (en) 2014-11-26 2019-12-18 Millennium Pharmaceuticals, Inc. Vedolizumab for the treatment of fistulizing crohn's disease
WO2016086147A1 (en) 2014-11-26 2016-06-02 Millennium Pharmaceuticals, Inc. Vedolizumab for the treatment of fistulizing crohn's disease
US10633457B2 (en) 2014-12-03 2020-04-28 Hoffmann-La Roche Inc. Multispecific antibodies
US10370455B2 (en) 2014-12-05 2019-08-06 Immunext, Inc. Identification of VSIG8 as the putative VISTA receptor (V-R) and use thereof to produce VISTA/VSIG8 agonists and antagonists
WO2016090210A1 (en) 2014-12-05 2016-06-09 Genentech, Inc. ANTI-CD79b ANTIBODIES AND METHODS OF USE
WO2016091891A1 (en) 2014-12-09 2016-06-16 INSERM (Institut National de la Santé et de la Recherche Médicale) Human monoclonal antibodies against axl
WO2016094566A2 (en) 2014-12-10 2016-06-16 Genentech, Inc. Blood brain barrier receptor antibodies and methods of use
WO2016098356A1 (en) 2014-12-19 2016-06-23 Chugai Seiyaku Kabushiki Kaisha Anti-c5 antibodies and methods of use
WO2016098079A2 (en) 2014-12-19 2016-06-23 Novartis Ag Compositions and methods for antibodies targeting bmp6
EP3981794A1 (en) 2014-12-19 2022-04-13 Chugai Seiyaku Kabushiki Kaisha Anti-c5 antibodies and methods of use
EP3945096A1 (en) 2014-12-19 2022-02-02 Regenesance B.V. Antibodies that bind human c6 and uses thereof
WO2016097865A1 (en) 2014-12-19 2016-06-23 Regenesance B.V. Antibodies that bind human c6 and uses thereof
US10768174B2 (en) 2014-12-23 2020-09-08 Bluelight Therapeutics, Inc. Attachment of proteins to interfaces for use in nonlinear optical detection
EP4249066A2 (en) 2014-12-23 2023-09-27 Bristol-Myers Squibb Company Antibodies to tigit
WO2016115345A1 (en) 2015-01-14 2016-07-21 The Brigham And Women's Hospital, Treatment of cancer with anti-lap monoclonal antibodies
US9975965B2 (en) 2015-01-16 2018-05-22 Academia Sinica Compositions and methods for treatment and detection of cancers
US10495645B2 (en) 2015-01-16 2019-12-03 Academia Sinica Cancer markers and methods of use thereof
WO2016117346A1 (en) 2015-01-22 2016-07-28 Chugai Seiyaku Kabushiki Kaisha A combination of two or more anti-c5 antibodies and methods of use
US10342858B2 (en) 2015-01-24 2019-07-09 Academia Sinica Glycan conjugates and methods of use thereof
WO2016118961A1 (en) 2015-01-24 2016-07-28 Academia Sinica Cancer markers and methods of use thereof
US11180548B2 (en) 2015-02-05 2021-11-23 Chugai Seiyaku Kabushiki Kaisha Methods of neutralizing IL-8 biological activity
WO2016125495A1 (en) 2015-02-05 2016-08-11 Chugai Seiyaku Kabushiki Kaisha Antibodies comprising an ion concentration dependent antigen-binding domain, fc region variants, il-8-binding antibodies, and uses therof
EP3816179A2 (en) 2015-02-05 2021-05-05 Chugai Seiyaku Kabushiki Kaisha Fc region variant comprising a modified fcrn-binding domain
EP4129320A1 (en) 2015-02-19 2023-02-08 Compugen Ltd. Anti-pvrig antibodies and methods of use
EP3978929A1 (en) 2015-02-19 2022-04-06 Compugen Ltd. Pvrig polypeptides and methods of treatment
EP3653221A1 (en) 2015-02-19 2020-05-20 Compugen Ltd. Anti-pvrig antibodies and methods of use
EP3295951A1 (en) 2015-02-19 2018-03-21 Compugen Ltd. Anti-pvrig antibodies and methods of use
WO2016134335A2 (en) 2015-02-19 2016-08-25 Compugen Ltd. Pvrig polypeptides and methods of treatment
WO2016134333A1 (en) 2015-02-19 2016-08-25 Compugen Ltd. Anti-pvrig antibodies and methods of use
WO2016135066A1 (en) 2015-02-26 2016-09-01 INSERM (Institut National de la Santé et de la Recherche Médicale) Fusion proteins and antibodies comprising thereof for promoting apoptosis
EP4257200A2 (en) 2015-03-06 2023-10-11 Takeda Pharmaceutical Company Limited Method of treating primary sclerosing cholangitis
EP4006051A1 (en) 2015-03-09 2022-06-01 Argenx BVBA Methods of reducing serum levels of fc-containing agents using fcrn antagonists
WO2016142782A1 (en) 2015-03-09 2016-09-15 Argen-X N.V. Methods of reducing serum levels of fc-containing agents using fcrn antagonsits
WO2016149276A1 (en) 2015-03-16 2016-09-22 Genentech, Inc. Methods of detecting and quantifying il-13 and uses in diagnosing and treating th2-associated diseases
WO2016146833A1 (en) 2015-03-19 2016-09-22 F. Hoffmann-La Roche Ag Biomarkers for nad(+)-diphthamide adp ribosyltransferase resistance
US10011658B2 (en) 2015-04-03 2018-07-03 Eureka Therapeutics, Inc. Constructs targeting AFP peptide/MHC complexes and uses thereof
EP3875477A1 (en) 2015-04-17 2021-09-08 Alpine Immune Sciences, Inc. Immunomodulatory proteins with tunable affinities
WO2016168771A2 (en) 2015-04-17 2016-10-20 Alpine Immune Sciences, Inc. Immunomodulatory proteins with tunable affinities
US11319359B2 (en) 2015-04-17 2022-05-03 Alpine Immune Sciences, Inc. Immunomodulatory proteins with tunable affinities
EP3913052A1 (en) 2015-04-24 2021-11-24 F. Hoffmann-La Roche AG Methods of identifying bacteria comprising binding polypeptides
WO2016172551A2 (en) 2015-04-24 2016-10-27 Genentech, Inc. Methods of identifying bacteria comprising binding polypeptides
EP3778640A1 (en) 2015-05-01 2021-02-17 Genentech, Inc. Masked anti-cd3 antibodies and methods of use
WO2016179003A1 (en) 2015-05-01 2016-11-10 Genentech, Inc. Masked anti-cd3 antibodies and methods of use
WO2016179517A1 (en) 2015-05-07 2016-11-10 Agenus Inc. Anti-ox40 antibodies and methods of use thereof
EP3936524A2 (en) 2015-05-11 2022-01-12 F. Hoffmann-La Roche AG Compositions and methods of treating lupus nephritis
EP4238994A2 (en) 2015-05-11 2023-09-06 F. Hoffmann-La Roche AG Compositions and methods of treating lupus nephritis
EP3783029A1 (en) 2015-05-12 2021-02-24 F. Hoffmann-La Roche AG Therapeutic and diagnostic methods for cancer
WO2016188911A1 (en) 2015-05-22 2016-12-01 INSERM (Institut National de la Santé et de la Recherche Médicale) Human monoclonal antibodies fragments inhibiting both the cath-d catalytic activity and its binding to the lrp1 receptor
WO2016196298A1 (en) 2015-05-29 2016-12-08 Genentech, Inc. Therapeutic and diagnolstic methods for cancer
WO2016196343A1 (en) 2015-05-29 2016-12-08 Genentech, Inc. Humanized anti-ebola virus glycoprotein antibodies and methods of use
EP4335931A2 (en) 2015-05-29 2024-03-13 F. Hoffmann-La Roche AG Therapeutic and diagnostic methods for cancer
EP3708681A1 (en) 2015-05-29 2020-09-16 F. Hoffmann-La Roche AG Therapeutic and diagnostic methods for cancer
WO2016196228A1 (en) 2015-05-29 2016-12-08 Bristol-Myers Squibb Company Antibodies against ox40 and uses thereof
WO2016196679A1 (en) 2015-06-02 2016-12-08 Genentech, Inc. Compositions and methods for using anti-il-34 antibodies to treat neurological diseases
WO2016196726A1 (en) 2015-06-05 2016-12-08 Genentech, Inc. Anti-tau antibodies and methods of use
WO2016193872A2 (en) 2015-06-05 2016-12-08 Novartis Ag Antibodies targeting bone morphogenetic protein 9 (bmp9) and methods therefor
WO2016200835A1 (en) 2015-06-08 2016-12-15 Genentech, Inc. Methods of treating cancer using anti-ox40 antibodies and pd-1 axis binding antagonists
WO2016200836A1 (en) 2015-06-08 2016-12-15 Genentech, Inc. Methods of treating cancer using anti-ox40 antibodies
WO2016205176A1 (en) 2015-06-15 2016-12-22 Genentech, Inc. Antibodies and immunoconjugates
US11192950B2 (en) 2015-06-16 2021-12-07 Genentech, Inc. Humanized and affinity matured antibodies to FcRH5 and methods of use
US10323094B2 (en) 2015-06-16 2019-06-18 Genentech, Inc. Humanized and affinity matured antibodies to FcRH5 and methods of use
US10501545B2 (en) 2015-06-16 2019-12-10 Genentech, Inc. Anti-CLL-1 antibodies and methods of use
WO2016205520A1 (en) 2015-06-16 2016-12-22 Genentech, Inc. Humanized and affinity matured antibodies to fcrh5 and methods of use
US11466087B2 (en) 2015-06-16 2022-10-11 Genentech, Inc. Anti-CLL-1 antibodies and methods of use
EP3916018A1 (en) 2015-06-16 2021-12-01 Genentech, Inc. Anti-cd3 antibodies and methods of use
WO2016204966A1 (en) 2015-06-16 2016-12-22 Genentech, Inc. Anti-cd3 antibodies and methods of use
WO2016205200A1 (en) 2015-06-16 2016-12-22 Genentech, Inc. Anti-cll-1 antibodies and methods of use
EP4299073A2 (en) 2015-06-16 2024-01-03 F. Hoffmann-La Roche AG Humanized and affinity matured antibodies to fcrh5 and methods of use
US10774145B2 (en) 2015-06-17 2020-09-15 Allakos Inc. Methods and compositions for treating fibrotic diseases
WO2016205320A1 (en) 2015-06-17 2016-12-22 Genentech, Inc. Methods of treating locally advanced or metastatic breast cancers using pd-1 axis binding antagonists and taxanes
WO2016203432A1 (en) 2015-06-17 2016-12-22 Novartis Ag Antibody drug conjugates
WO2016205531A2 (en) 2015-06-17 2016-12-22 Genentech, Inc. Anti-her2 antibodies and methods of use
US11584793B2 (en) 2015-06-24 2023-02-21 Hoffmann-La Roche Inc. Anti-transferrin receptor antibodies with tailored affinity
US10822402B2 (en) 2015-06-24 2020-11-03 Hoffmann-La Roche Inc. Humanized anti-tau(pS422) antibodies and methods of use
US11009509B2 (en) 2015-06-24 2021-05-18 Janssen Pharmaceutica Nv Anti-VISTA antibodies and fragments
WO2016207858A1 (en) 2015-06-26 2016-12-29 Novartis Ag Factor xi antibodies and methods of use
US10465011B2 (en) 2015-06-26 2019-11-05 Novartis Ag Factor XI antibodies and methods of use
WO2017004091A1 (en) 2015-06-29 2017-01-05 Genentech, Inc. Type ii anti-cd20 antibody for use in organ transplantation
EP3514174A1 (en) 2015-06-29 2019-07-24 Ventana Medical Systems, Inc. Materials and methods for performing histochemical assays for human pro-epiregulin and amphiregulin
EP3978525A1 (en) 2015-06-29 2022-04-06 Ventana Medical Systems, Inc. Materials and methods for performing histochemical assays for human pro-epiregulin and amphiregulin
EP3971211A1 (en) 2015-07-13 2022-03-23 Compugen Ltd. Hide1 compositions and methods
WO2017009712A1 (en) 2015-07-13 2017-01-19 Compugen Ltd. Hide1 compositions and methods
WO2017021893A1 (en) 2015-08-03 2017-02-09 Novartis Ag Methods of treating fgf21-associated disorders
EP4218792A1 (en) 2015-08-04 2023-08-02 Acceleron Pharma Inc. Composition for treating myeloproliferative disorders
WO2017024171A1 (en) 2015-08-04 2017-02-09 Acceleron Pharma Inc. Methods for treating myeloproliferative disorders
EP4282877A2 (en) 2015-08-11 2023-11-29 Legend Biotech Ireland Limited Chimeric antigen receptors targeting bcma and methods of use thereof
EP3896091A1 (en) 2015-08-11 2021-10-20 Legend Biotech Ireland Limited Chimeric antigen receptors targeting bcma and methods of use thereof
EP4282878A2 (en) 2015-08-11 2023-11-29 Legend Biotech Ireland Limited Chimeric antigen receptors targeting bcma and methods of use thereof
EP4063397A1 (en) 2015-08-11 2022-09-28 Legend Biotech Ireland Limited Chimeric antigen receptors based on single-domain antibodies and methods of use thereof
WO2017040342A1 (en) 2015-08-28 2017-03-09 Genentech, Inc. Anti-hypusine antibodies and uses thereof
EP3932953A1 (en) 2015-08-28 2022-01-05 F. Hoffmann-La Roche AG Anti-hypusine antibodies and uses thereof
WO2017040790A1 (en) 2015-09-01 2017-03-09 Agenus Inc. Anti-pd-1 antibodies and methods of use thereof
EP3842457A1 (en) 2015-09-09 2021-06-30 Novartis AG Thymic stromal lymphopoietin (tslp)-binding molecules and methods of using the molecules
WO2017042701A1 (en) 2015-09-09 2017-03-16 Novartis Ag Thymic stromal lymphopoietin (tslp)-binding antibodies and methods of using the antibodies
WO2017046676A1 (en) 2015-09-16 2017-03-23 Novartis Ag Polyomavirus neutralizing antibodies
US10172875B2 (en) 2015-09-17 2019-01-08 Immunogen, Inc. Therapeutic combinations comprising anti-FOLR1 immunoconjugates
US11033564B2 (en) 2015-09-17 2021-06-15 Immunogen, Inc. Therapeutic combinations comprising anti-FOLR1 immunoconjugates
WO2017046994A1 (en) 2015-09-18 2017-03-23 Chugai Seiyaku Kabushiki Kaisha Il-8-binding antibodies and uses thereof
WO2017050729A1 (en) 2015-09-22 2017-03-30 Spring Bioscience Corporation Anti-ox40 antibodies and diagnostic uses thereof
WO2017053807A2 (en) 2015-09-23 2017-03-30 Genentech, Inc. Optimized variants of anti-vegf antibodies
EP3662930A1 (en) 2015-09-24 2020-06-10 AbVitro LLC Hiv antibody compositions and methods of use
US11286300B2 (en) 2015-10-01 2022-03-29 Hoffmann-La Roche Inc. Humanized anti-human CD19 antibodies and methods of use
WO2017055540A1 (en) 2015-10-02 2017-04-06 F. Hoffmann-La Roche Ag Bispecific anti-human a-beta/human transferrin receptor antibodies and methods of use
WO2017055404A1 (en) 2015-10-02 2017-04-06 F. Hoffmann-La Roche Ag Bispecific antibodies specific for pd1 and tim3
WO2017055443A1 (en) 2015-10-02 2017-04-06 F. Hoffmann-La Roche Ag Anti-pd1 antibodies and methods of use
WO2017059289A1 (en) 2015-10-02 2017-04-06 Genentech, Inc. Pyrrolobenzodiazepine antibody drug conjugates and methods of use
US10941205B2 (en) 2015-10-02 2021-03-09 Hoffmann-La Roche Inc. Bispecific anti-human A-beta/human transferrin receptor antibodies and methods of use
US11603411B2 (en) 2015-10-02 2023-03-14 Hoffmann-La Roche Inc. Bispecific anti-human CD20/human transferrin receptor antibodies and methods of use
WO2017055398A2 (en) 2015-10-02 2017-04-06 F. Hoffmann-La Roche Ag Bispecific antibodies specific for a costimulatory tnf receptor
EP3150636A1 (en) 2015-10-02 2017-04-05 F. Hoffmann-La Roche AG Tetravalent multispecific antibodies
WO2017055542A1 (en) 2015-10-02 2017-04-06 F. Hoffmann-La Roche Ag Bispecific anti-human cd20/human transferrin receptor antibodies and methods of use
WO2017060144A1 (en) 2015-10-07 2017-04-13 F. Hoffmann-La Roche Ag Bispecific antibodies with tetravalency for a costimulatory tnf receptor
WO2017064675A1 (en) 2015-10-16 2017-04-20 Genentech, Inc. Hindered disulfide drug conjugates
WO2017066714A1 (en) 2015-10-16 2017-04-20 Compugen Ltd. Anti-vsig1 antibodies and drug conjugates
WO2017068511A1 (en) 2015-10-20 2017-04-27 Genentech, Inc. Calicheamicin-antibody-drug conjugates and methods of use
US10604577B2 (en) 2015-10-22 2020-03-31 Allakos Inc. Methods and compositions for treating systemic mastocytosis
WO2017072662A1 (en) 2015-10-29 2017-05-04 Novartis Ag Antibody conjugates comprising toll-like receptor agonist
WO2017072210A1 (en) 2015-10-29 2017-05-04 F. Hoffmann-La Roche Ag Anti-variant fc-region antibodies and methods of use
US10358480B2 (en) 2015-10-29 2019-07-23 Merck Sharp & Dohme Corp. Antibody neutralizing human respiratory syncytial virus
US11566065B2 (en) 2015-10-29 2023-01-31 Merck Sharp & Dohme Llc Antibody neutralizing human respiratory syncytial virus
EP3797797A1 (en) 2015-10-29 2021-03-31 Novartis AG Antibody conjugates comprising toll-like receptor agonist
US10072072B2 (en) 2015-10-29 2018-09-11 Merck Sharp & Dohme Corp. Antibody neutralizing human respiratory syncytial virus
US10323079B2 (en) 2015-10-29 2019-06-18 Merck Sharp & Dohme Corp. Antibody neutralizing human respiratory syncytial virus
US9963500B2 (en) 2015-10-29 2018-05-08 Merck Sharp & Dohme Corp. Antibody neutralizing human respiratory syncytial virus
EP3184547A1 (en) 2015-10-29 2017-06-28 F. Hoffmann-La Roche AG Anti-tpbg antibodies and methods of use
WO2017075124A1 (en) 2015-10-29 2017-05-04 Merck Sharp & Dohme Corp. Antibody neutralizing human respiratory syncytial virus
US11008380B2 (en) 2015-10-29 2021-05-18 Merck Sharp & Dohme Corp. Antibody neutralizing human respiratory syncytial virus
WO2017075173A2 (en) 2015-10-30 2017-05-04 Genentech, Inc. Anti-factor d antibodies and conjugates
EP3922649A1 (en) 2015-10-30 2021-12-15 F. Hoffmann-La Roche AG Anti-htra1 antibodies and methods of use thereof
WO2017079768A1 (en) 2015-11-08 2017-05-11 Genentech, Inc. Methods of screening for multispecific antibodies
WO2017087678A2 (en) 2015-11-19 2017-05-26 Bristol-Myers Squibb Company Antibodies against glucocorticoid-induced tumor necrosis factor receptor (gitr) and uses thereof
WO2017095875A1 (en) 2015-11-30 2017-06-08 Bristol-Myers Squibb Company Anti human ip-10 antibodies and their uses
US10836830B2 (en) 2015-12-02 2020-11-17 Agenus Inc. Antibodies and methods of use thereof
US11447557B2 (en) 2015-12-02 2022-09-20 Agenus Inc. Antibodies and methods of use thereof
WO2017093947A1 (en) 2015-12-04 2017-06-08 Novartis Ag Antibody cytokine engrafted compositions and methods of use for immunoregulation
WO2017106129A1 (en) 2015-12-16 2017-06-22 Merck Sharp & Dohme Corp. Anti-lag3 antibodies and antigen-binding fragments
WO2017104779A1 (en) 2015-12-18 2017-06-22 Chugai Seiyaku Kabushiki Kaisha Anti-c5 antibodies and methods of use
WO2017103895A1 (en) 2015-12-18 2017-06-22 Novartis Ag Antibodies targeting cd32b and methods of use thereof
WO2017112956A1 (en) 2015-12-23 2017-06-29 Moonshot Pharma Llc Methods for inducing an immune response
US10898483B2 (en) 2015-12-23 2021-01-26 Moonshot Pharma Llc Methods for inducing an immune response by promoting premature termination codon read-through
US11135221B2 (en) 2015-12-23 2021-10-05 Moonshot Pharma Llc Methods for inducing an immune response
US10966976B2 (en) 2015-12-23 2021-04-06 Moonshot Pharma Llc Methods for inducing an immune response by inhibition of nonsense mediated decay
WO2017112955A1 (en) 2015-12-23 2017-06-29 Pharma Llc Moonshot Methods for inducing an immune response by inhibition of nonsense mediated decay
US11957678B2 (en) 2015-12-23 2024-04-16 Moonshot Pharma Llc Methods for inducing an immune response
EP3862365A1 (en) 2016-01-08 2021-08-11 F. Hoffmann-La Roche AG Methods of treating cea-positive cancers using pd-1 axis binding antagonists and anti-cea/anti-cd3 bispecific antibodies
WO2017127764A1 (en) 2016-01-20 2017-07-27 Genentech, Inc. High dose treatments for alzheimer's disease
WO2017136558A1 (en) 2016-02-04 2017-08-10 Curis, Inc. Mutant smoothened and methods of using the same
US10899836B2 (en) 2016-02-12 2021-01-26 Janssen Pharmaceutica Nv Method of identifying anti-VISTA antibodies
EP4155415A1 (en) 2016-02-29 2023-03-29 Genentech, Inc. Therapeutic and diagnostic methods for cancer
WO2017151502A1 (en) 2016-02-29 2017-09-08 Genentech, Inc. Therapeutic and diagnostic methods for cancer
WO2017152085A1 (en) 2016-03-04 2017-09-08 Bristol-Myers Squibb Company Combination therapy with anti-cd73 antibodies
US10336784B2 (en) 2016-03-08 2019-07-02 Academia Sinica Methods for modular synthesis of N-glycans and arrays thereof
WO2017160700A1 (en) 2016-03-14 2017-09-21 Millennium Pharmaceuticals, Inc. Methods of treating or preventing graft versus host disease
WO2017160699A2 (en) 2016-03-14 2017-09-21 Millennium Pharmaceuticals, Inc. Method of preventing graft versus host disease
EP4112641A1 (en) 2016-03-15 2023-01-04 Chugai Seiyaku Kabushiki Kaisha Methods of treating cancers using pd-1 axis binding antagonists and anti-gpc3 antibodies
WO2017159699A1 (en) 2016-03-15 2017-09-21 Chugai Seiyaku Kabushiki Kaisha Methods of treating cancers using pd-1 axis binding antagonists and anti-gpc3 antibodies
WO2017161173A1 (en) 2016-03-16 2017-09-21 Merrimack Pharmaceuticals, Inc. Engineered trail for cancer therapy
WO2017162678A1 (en) 2016-03-22 2017-09-28 INSERM (Institut National de la Santé et de la Recherche Médicale) Humanized anti-claudin-1 antibodies and uses thereof
WO2017165742A1 (en) 2016-03-24 2017-09-28 Millennium Pharmaceuticals, Inc. Methods of treating gastrointestinal immune-related adverse events in anti-ctla4 anti-pd-1 combination treatments
WO2017165778A1 (en) 2016-03-24 2017-09-28 Millennium Pharmaceuticals, Inc. Methods of treating gastrointestinal immune-related adverse events in immune oncology treatments
EP4273551A2 (en) 2016-03-25 2023-11-08 F. Hoffmann-La Roche AG Multiplexed total antibody and antibody-conjugated drug quantification assay
WO2017165734A1 (en) 2016-03-25 2017-09-28 Genentech, Inc. Multiplexed total antibody and antibody-conjugated drug quantification assay
WO2017180864A1 (en) 2016-04-14 2017-10-19 Genentech, Inc. Anti-rspo3 antibodies and methods of use
EP3865511A1 (en) 2016-04-14 2021-08-18 F. Hoffmann-La Roche AG Anti-rspo3 antibodies and methods of use
US11078282B2 (en) 2016-04-15 2021-08-03 Alpine Immune Sciences, Inc. CD80 variant immunomodulatory proteins and uses thereof
US10961311B2 (en) 2016-04-15 2021-03-30 Macrogenics, Inc. B7-H3 binding molecules, antibody drug conjugates thereof and methods of use thereof
WO2017181079A2 (en) 2016-04-15 2017-10-19 Genentech, Inc. Methods for monitoring and treating cancer
WO2017181152A2 (en) 2016-04-15 2017-10-19 Alpine Immune Sciences, Inc. Cd80 variant immunomodulatory proteins and uses thereof
US11525000B2 (en) 2016-04-15 2022-12-13 Immunext, Inc. Anti-human VISTA antibodies and use thereof
US11479609B2 (en) 2016-04-15 2022-10-25 Alpine Immune Sciences, Inc. CD80 variant immunomodulatory proteins and uses thereof
US11591400B2 (en) 2016-04-15 2023-02-28 Macrogenics, Inc. B7-H3 directed antibody drug conjugates
US11603403B2 (en) 2016-04-15 2023-03-14 Immunext, Inc. Anti-human vista antibodies and use thereof
US11603402B2 (en) 2016-04-15 2023-03-14 Immunext, Inc. Anti-human vista antibodies and use thereof
US10882914B2 (en) 2016-04-15 2021-01-05 Alpine Immune Sciences, Inc. ICOS ligand variant immunomodulatory proteins and uses thereof
US11498967B2 (en) 2016-04-15 2022-11-15 Alpine Immune Sciences, Inc. CD80 variant immunomodulatory proteins and uses thereof
WO2017181148A2 (en) 2016-04-15 2017-10-19 Alpine Immune Sciences, Inc. Icos ligand variant immunomodulatory proteins and uses thereof
US11897959B2 (en) 2016-04-15 2024-02-13 Bioatla, Inc. Anti-AXL antibodies, antibody fragments and their immunoconjugates and uses thereof
US11510966B2 (en) 2016-04-15 2022-11-29 Evive Biotechnology (Shanghai) Ltd Use of IL-22 in treating necrotizing enterocolitis
US11649283B2 (en) 2016-04-15 2023-05-16 Immunext, Inc. Anti-human vista antibodies and use thereof
US11149088B2 (en) 2016-04-15 2021-10-19 Bioatla, Inc. Anti-Axl antibodies, antibody fragments and their immunoconjugates and uses thereof
US11359022B2 (en) 2016-04-15 2022-06-14 Alpine Immune Sciences, Inc. CD80 variant immunomodulatory proteins and uses thereof
WO2017181111A2 (en) 2016-04-15 2017-10-19 Genentech, Inc. Methods for monitoring and treating cancer
WO2017189724A1 (en) 2016-04-27 2017-11-02 Novartis Ag Antibodies against growth differentiation factor 15 and uses thereof
EP3889175A1 (en) 2016-05-02 2021-10-06 F. Hoffmann-La Roche AG The contorsbody - a single chain target binder
WO2017191101A1 (en) 2016-05-02 2017-11-09 F. Hoffmann-La Roche Ag The contorsbody - a single chain target binder
US10968279B2 (en) 2016-05-09 2021-04-06 Bristol-Myers Squibb Company TL1A antibodies and uses thereof
US11767364B2 (en) 2016-05-09 2023-09-26 Bristol-Myers Squibb Company TL1A antibodies and methods of treatment
WO2017196663A1 (en) 2016-05-09 2017-11-16 Bristol-Myers Squibb Company Tl1a antibodies and uses thereof
WO2017194441A1 (en) 2016-05-11 2017-11-16 F. Hoffmann-La Roche Ag Modified anti-tenascin antibodies and methods of use
US11879011B2 (en) 2016-05-13 2024-01-23 Bioatla, Inc. Anti-ROR2 antibodies, antibody fragments, their immunoconjucates and uses thereof
EP4122958A1 (en) 2016-05-13 2023-01-25 BioAtla, Inc. Anti-ror2 antibodies, antibody fragments, their immunoconjugates and uses thereof
WO2017197234A1 (en) 2016-05-13 2017-11-16 Bioatla, Llc Anti-ror2 antibodies, antibody fragments, their immunoconjugates and uses thereof
US11254742B2 (en) 2016-05-13 2022-02-22 Bioatla, Inc. Anti-Ror2 antibodies, antibody fragments, their immunoconjugates and uses thereof
WO2017201449A1 (en) 2016-05-20 2017-11-23 Genentech, Inc. Protac antibody conjugates and methods of use
US10647780B2 (en) 2016-05-25 2020-05-12 Novartis Ag Reversal binding agents for anti-factor XI/XIa antibodies and uses thereof
WO2017203450A1 (en) 2016-05-25 2017-11-30 Novartis Ag Reversal binding agents for anti-factor xi/xia antibodies and uses thereof
WO2017205721A1 (en) 2016-05-27 2017-11-30 Agenus Inc. Anti-tim-3 antibodies and methods of use thereof
WO2017205741A1 (en) 2016-05-27 2017-11-30 Genentech, Inc. Bioanalytical method for the characterization of site-specific antibody-drug conjugates
WO2017214024A1 (en) 2016-06-06 2017-12-14 Genentech, Inc. Silvestrol antibody-drug conjugates and methods of use
WO2017218434A1 (en) 2016-06-12 2017-12-21 Millennium Pharmaceuticals, Inc. Method of treating inflammatory bowel disease
WO2017216724A1 (en) 2016-06-15 2017-12-21 Novartis Ag Methods for treating disease using inhibitors of bone morphogenetic protein 6 (bmp6)
WO2017223405A1 (en) 2016-06-24 2017-12-28 Genentech, Inc. Anti-polyubiquitin multispecific antibodies
WO2018007314A1 (en) 2016-07-04 2018-01-11 F. Hoffmann-La Roche Ag Novel antibody format
US10864203B2 (en) 2016-07-05 2020-12-15 Beigene, Ltd. Combination of a PD-1 antagonist and a RAF inhibitor for treating cancer
US11534431B2 (en) 2016-07-05 2022-12-27 Beigene Switzerland Gmbh Combination of a PD-1 antagonist and a RAF inhibitor for treating cancer
US11591392B2 (en) 2016-07-14 2023-02-28 Bristol-Myers Squibb Company Antibodies against TIM3 and uses thereof
WO2018013818A2 (en) 2016-07-14 2018-01-18 Bristol-Myers Squibb Company Antibodies against tim3 and uses thereof
US10533052B2 (en) 2016-07-14 2020-01-14 Bristol-Myers Squibb Company Antibodies against TIM3 and uses thereof
US10077306B2 (en) 2016-07-14 2018-09-18 Bristol-Myers Squibb Company Antibodies against TIM3 and uses thereof
US11447573B2 (en) 2016-07-20 2022-09-20 Nanjing Legend Biotech Co., Ltd. Multispecific antigen binding proteins and methods of use thereof
WO2018022479A1 (en) 2016-07-25 2018-02-01 Biogen Ma Inc. Anti-hspa5 (grp78) antibodies and uses thereof
WO2018022945A1 (en) 2016-07-28 2018-02-01 Alpine Immune Sciences, Inc. Cd112 variant immunomodulatory proteins and uses thereof
US11471488B2 (en) 2016-07-28 2022-10-18 Alpine Immune Sciences, Inc. CD155 variant immunomodulatory proteins and uses thereof
WO2018022946A1 (en) 2016-07-28 2018-02-01 Alpine Immune Sciences, Inc. Cd155 variant immunomodulatory proteins and uses thereof
US11834490B2 (en) 2016-07-28 2023-12-05 Alpine Immune Sciences, Inc. CD112 variant immunomodulatory proteins and uses thereof
WO2018021450A1 (en) 2016-07-29 2018-02-01 中外製薬株式会社 Bispecific antibody exhibiting increased alternative fviii-cofactor-function activity
US10494436B2 (en) 2016-07-29 2019-12-03 Aduro Biotech Holdings, Europe B.V. Anti-PD-1 antibodies
WO2018020476A1 (en) 2016-07-29 2018-02-01 Aduro Biotech Holdings, Europe B.V. Anti-pd-1 antibodies
WO2018025178A1 (en) 2016-08-02 2018-02-08 Aduro Biotech Holdings, Europe B.V. Antibodies against human ctla-4
US10808030B2 (en) 2016-08-02 2020-10-20 Aduro Biotech Holdings, Europe B.V. Anti-HCTLA-4 antibodies
US11053308B2 (en) 2016-08-05 2021-07-06 Chugai Seiyaku Kabushiki Kaisha Method for treating IL-8-related diseases
WO2018027203A1 (en) 2016-08-05 2018-02-08 Allakos, Inc. Anti-siglec-7 antibodies for the treatment of cancer
US11780912B2 (en) 2016-08-05 2023-10-10 Chugai Seiyaku Kabushiki Kaisha Composition for prophylaxis or treatment of IL-8 related diseases
WO2018029124A1 (en) 2016-08-08 2018-02-15 F. Hoffmann-La Roche Ag Therapeutic and diagnostic methods for cancer
WO2018031662A1 (en) 2016-08-11 2018-02-15 Genentech, Inc. Pyrrolobenzodiazepine prodrugs and antibody conjugates thereof
US11701357B2 (en) 2016-08-19 2023-07-18 Beigene Switzerland Gmbh Treatment of B cell cancers using a combination comprising Btk inhibitors
US10538592B2 (en) 2016-08-22 2020-01-21 Cho Pharma, Inc. Antibodies, binding fragments, and methods of use
WO2018044970A1 (en) 2016-08-31 2018-03-08 University Of Rochester Human monoclonal antibodies to human endogenous retrovirus k envelope (herv-k) and uses thereof
US10844113B2 (en) 2016-09-16 2020-11-24 Chugai Seiyaku Kabushiki Kaisha Anti-dengue virus antibodies, polypeptides containing variant Fc regions, and methods of use
US11780908B2 (en) 2016-09-16 2023-10-10 Chugai Seiyaku Kabushiki Kaisha Anti-dengue virus antibodies, polypeptides containing variant FC regions, and methods of use
US10604561B2 (en) 2016-09-16 2020-03-31 Chugai Seiyaku Kabushiki Kaisha Anti-dengue virus antibodies, polypeptides containing variant Fc regions, and methods of use
US11440942B2 (en) 2016-09-19 2022-09-13 Hoffmann-La Roche Inc. Complement factor based affinity chromatography
WO2018050878A1 (en) 2016-09-19 2018-03-22 F. Hoffmann-La Roche Ag Complement factor based affinity chromatography
EP4268845A2 (en) 2016-09-23 2023-11-01 F. Hoffmann-La Roche AG Uses of il-13 antagonists for treating atopic dermatitis
WO2018057849A1 (en) 2016-09-23 2018-03-29 Genentech, Inc. Uses of il-13 antagonists for treating atopic dermatitis
WO2018058022A1 (en) 2016-09-26 2018-03-29 Merck Sharp & Dohme Corp. Anti-cd27 antibodies
WO2018065501A1 (en) 2016-10-05 2018-04-12 F. Hoffmann-La Roche Ag Methods for preparing antibody drug conjugates
WO2018068028A1 (en) 2016-10-06 2018-04-12 Genentech, Inc. Therapeutic and diagnostic methods for cancer
US11472881B2 (en) 2016-10-11 2022-10-18 Nanjing Legend Biotech Co., Ltd. Single-domain antibodies and variants thereof against CTLA-4
WO2018071500A1 (en) 2016-10-11 2018-04-19 Agenus Inc. Anti-lag-3 antibodies and methods of use thereof
US10844119B2 (en) 2016-10-11 2020-11-24 Agenus Inc. Anti-LAG-3 antibodies and methods of use thereof
US10882908B2 (en) 2016-10-11 2021-01-05 Agenus Inc. Anti-LAG-3 antibodies and methods of use thereof
WO2018081648A2 (en) 2016-10-29 2018-05-03 Genentech, Inc. Anti-mic antibidies and methods of use
US11359028B2 (en) 2016-11-09 2022-06-14 Agenus Inc. Anti-OX40 antibodies and anti-GITR antibodies
WO2018087720A1 (en) 2016-11-14 2018-05-17 Novartis Ag Compositions, methods, and therapeutic uses related to fusogenic protein minion
US11466094B2 (en) 2016-11-15 2022-10-11 Genentech, Inc. Dosing for treatment with anti-CD20/anti-CD3 bispecific antibodies
WO2018093821A1 (en) 2016-11-15 2018-05-24 Genentech, Inc. Dosing for treatment with anti-cd20/anti-cd3 bispecific antibodies
WO2018091580A1 (en) 2016-11-18 2018-05-24 F. Hoffmann-La Roche Ag Anti-hla-g antibodies and use thereof
EP4335874A2 (en) 2016-11-18 2024-03-13 F. Hoffmann-La Roche AG Anti-hla-g antibodies and use thereof
WO2018094300A1 (en) 2016-11-19 2018-05-24 Potenza Therapeutics, Inc. Anti-gitr antigen-binding proteins and methods of use thereof
EP4015532A1 (en) 2016-11-21 2022-06-22 cureab GmbH Anti-gp73 antibodies and immunoconjugates
WO2018091724A1 (en) 2016-11-21 2018-05-24 Cureab Gmbh Anti-gp73 antibodies and immunoconjugates
WO2018098363A2 (en) 2016-11-23 2018-05-31 Bioverativ Therapeutics Inc. Bispecific antibodies binding to coagulation factor ix and coagulation factor x
WO2018106862A1 (en) 2016-12-07 2018-06-14 Agenus Inc. Anti-ctla-4 antibodies and methods of use thereof
WO2018106776A2 (en) 2016-12-07 2018-06-14 Genentech, Inc. Anti-tau antibodies and methods of use
WO2018106781A1 (en) 2016-12-07 2018-06-14 Genentech, Inc Anti-tau antibodies and methods of use
WO2018106864A1 (en) 2016-12-07 2018-06-14 Agenus Inc. Antibodies and methods of use thereof
EP4289484A2 (en) 2016-12-07 2023-12-13 Agenus Inc. Anti-ctla-4 antibodies and methods of use thereof
WO2018111890A1 (en) 2016-12-12 2018-06-21 Genentech, Inc. Methods of treating cancer using anti-pd-l1 antibodies and antiandrogens
US10206999B2 (en) 2016-12-19 2019-02-19 Mosaic Biomedicals, S.L. Antibodies against LIF and uses thereof
US11390670B2 (en) 2016-12-19 2022-07-19 Medimmune Limited Antibodies against LIF and uses thereof
EP4321219A2 (en) 2016-12-19 2024-02-14 Medimmune Limited Antibodies against lif and uses thereof
US10583191B2 (en) 2016-12-19 2020-03-10 Mosaic Biomedicals Slu Antibodies against LIF and uses thereof
WO2018115960A1 (en) 2016-12-19 2018-06-28 Mosaic Biomedicals, S.L. Antibodies against lif and uses thereof
WO2018114748A1 (en) 2016-12-20 2018-06-28 F. Hoffmann-La Roche Ag Combination therapy of anti-cd20/anti-cd3 bispecific antibodies and 4-1bb (cd137) agonists
WO2018116255A1 (en) 2016-12-23 2018-06-28 Novartis Ag Factor xi antibodies and methods of use
WO2018119171A1 (en) 2016-12-23 2018-06-28 Potenza Therapeutics, Inc. Anti-neuropilin antigen-binding proteins and methods of use thereof
US11168147B2 (en) 2016-12-23 2021-11-09 Novartis Ag Factor XI antibodies and methods of use
WO2018127473A1 (en) 2017-01-03 2018-07-12 F. Hoffmann-La Roche Ag Bispecific antigen binding molecules comprising anti-4-1bb clone 20h4.9
WO2018129029A1 (en) 2017-01-04 2018-07-12 Immunogen, Inc. Met antibodies and immunoconjugates and uses thereof
WO2018129451A2 (en) 2017-01-09 2018-07-12 Merrimack Pharmaceuticals, Inc. Anti-fgfr antibodies and methods of use
US11274157B2 (en) 2017-01-12 2022-03-15 Eureka Therapeutics, Inc. Constructs targeting histone H3 peptide/MHC complexes and uses thereof
US11555038B2 (en) 2017-01-25 2023-01-17 Beigene, Ltd. Crystalline forms of (S)-7-(1-(but-2-ynoyl)piperidin-4-yl)-2-(4-phenoxyphenyl)-4,5,6,7-tetrahydropyrazolo[1,5-a]pyrimidine-3-carboxamide, preparation, and uses thereof
WO2018143266A1 (en) 2017-01-31 2018-08-09 Chugai Seiyaku Kabushiki Kaisha A pharmaceutical composition for use in the treatment or prevention of a c5-related disease and a method for treating or preventing a c5-related disease
EP4223774A2 (en) 2017-01-31 2023-08-09 Chugai Seiyaku Kabushiki Kaisha A pharmaceutical composition for use in the treatment or prevention of a c5-related disease and a method for treating or preventing a c5-related disease
WO2018142322A1 (en) 2017-02-03 2018-08-09 Novartis Ag Anti-ccr7 antibody drug conjugates
WO2018146594A1 (en) 2017-02-08 2018-08-16 Novartis Ag Fgf21 mimetic antibodies and uses thereof
WO2018148585A1 (en) 2017-02-10 2018-08-16 Genentech, Inc. Anti-tryptase antibodies, compositions thereof, and uses thereof
US11827695B2 (en) 2017-02-17 2023-11-28 Bristol-Myers Squibb Company Antibodies to alpha-synuclein and uses thereof
WO2018151821A1 (en) 2017-02-17 2018-08-23 Bristol-Myers Squibb Company Antibodies to alpha-synuclein and uses thereof
US11142570B2 (en) 2017-02-17 2021-10-12 Bristol-Myers Squibb Company Antibodies to alpha-synuclein and uses thereof
WO2018157027A1 (en) 2017-02-27 2018-08-30 Regeneron Pharmaceuticals, Inc. Humanized model of kidney and liver disorders
WO2018160841A1 (en) 2017-03-01 2018-09-07 Genentech, Inc. Diagnostic and therapeutic methods for cancer
WO2018158398A1 (en) 2017-03-02 2018-09-07 INSERM (Institut National de la Santé et de la Recherche Médicale) Antibodies having specificity to nectin-4 and uses thereof
US11230588B2 (en) 2017-03-16 2022-01-25 Alpine Immune Sciences, Inc. CD80 variant immunomodulatory proteins and uses thereof
WO2018170023A1 (en) 2017-03-16 2018-09-20 Alpine Immune Sciences, Inc. Pd-l2 variant immunomodulatory proteins and uses thereof
WO2018170026A2 (en) 2017-03-16 2018-09-20 Alpine Immune Sciences, Inc. Cd80 variant immunomodulatory proteins and uses thereof
US11117948B2 (en) 2017-03-16 2021-09-14 Alpine Immune Sciences, Inc. CD80 variant immunomodulatory proteins and uses thereof
EP4306537A2 (en) 2017-03-16 2024-01-17 Alpine Immune Sciences, Inc. Pd-l1 variant immunomodulatory proteins and uses thereof
WO2018170021A1 (en) 2017-03-16 2018-09-20 Alpine Immune Sciences, Inc. Pd-l1 variant immunomodulatory proteins and uses thereof
US11117950B2 (en) 2017-03-16 2021-09-14 Alpine Immune Sciences, Inc. CD80 variant immunomodulatory proteins and uses thereof
US11732022B2 (en) 2017-03-16 2023-08-22 Alpine Immune Sciences, Inc. PD-L2 variant immunomodulatory proteins and uses thereof
US11117949B2 (en) 2017-03-16 2021-09-14 Alpine Immune Sciences, Inc. CD80 variant immunomodulatory proteins and uses thereof
US11639375B2 (en) 2017-03-16 2023-05-02 Alpine Immune Sciences, Inc. CD80 variant immunomodulatory proteins and uses thereof
US11096988B2 (en) 2017-03-16 2021-08-24 Alpine Immune Sciences, Inc. CD80 variant immunomodulatory proteins and uses thereof
WO2018175752A1 (en) 2017-03-22 2018-09-27 Genentech, Inc. Optimized antibody compositions for treatment of ocular disorders
WO2018175460A1 (en) 2017-03-24 2018-09-27 Novartis Ag Methods for preventing and treating heart disease
WO2018183175A1 (en) 2017-03-28 2018-10-04 Genentech, Inc. Methods of treating neurodegenerative diseases
WO2018178055A1 (en) 2017-03-29 2018-10-04 F. Hoffmann-La Roche Ag Bispecific antigen binding molecule for a costimulatory tnf receptor
WO2018178076A1 (en) 2017-03-29 2018-10-04 F. Hoffmann-La Roche Ag Bispecific antigen binding molecule for a costimulatory tnf receptor
WO2018183889A1 (en) 2017-03-30 2018-10-04 Potenza Therapeutics, Inc. Anti-tigit antigen-binding proteins and methods of use thereof
WO2018185618A1 (en) 2017-04-03 2018-10-11 Novartis Ag Anti-cdh6 antibody drug conjugates and anti-gitr antibody combinations and methods of treatment
WO2018185045A1 (en) 2017-04-04 2018-10-11 F. Hoffmann-La Roche Ag Novel bispecific antigen binding molecules capable of specific binding to cd40 and to fap
WO2018185046A1 (en) 2017-04-05 2018-10-11 F. Hoffmann-La Roche Ag Anti-lag3 antibodies
WO2018185043A1 (en) 2017-04-05 2018-10-11 F. Hoffmann-La Roche Ag Bispecific antibodies specifically binding to pd1 and lag3
US11053315B2 (en) 2017-04-07 2021-07-06 Merck Sharp & Dohme Corp. Anti-ILT4 antibodies and antigen-binding fragments
WO2018187518A1 (en) 2017-04-07 2018-10-11 Merck Sharp & Dohme Corp. Anti-ilt4 antibodies and antigen-binding fragments
US11897956B2 (en) 2017-04-07 2024-02-13 Merck Sharp & Dohme Llc Anti-ILT4 antibodies and antigen-binding fragments
US11897957B2 (en) 2017-04-07 2024-02-13 Merck Sharp & Dohme Llc Anti-ILT4 antibodies and antigen-binding fragments
WO2018190719A2 (en) 2017-04-13 2018-10-18 Aduro Biotech Holdings, Europe B.V. Anti-sirp alpha antibodies
WO2018191502A2 (en) 2017-04-13 2018-10-18 Agenus Inc. Anti-cd137 antibodies and methods of use thereof
US10851164B2 (en) 2017-04-13 2020-12-01 Aduro Biotech Holdings, Europe B.V. Anti-SIRPα antibodies
WO2018191660A1 (en) 2017-04-14 2018-10-18 Genentech, Inc. Diagnostic and therapeutic methods for cancer
WO2018195472A1 (en) 2017-04-21 2018-10-25 Genentech, Inc. Use of klk5 antagonists for treatment of a disease
US11447564B2 (en) 2017-04-26 2022-09-20 Eureka Therapeutics, Inc. Constructs specifically recognizing glypican 3 and uses thereof
WO2018201096A1 (en) 2017-04-27 2018-11-01 Tesaro, Inc. Antibody agents directed against lymphocyte activation gene-3 (lag-3) and uses thereof
WO2018198091A1 (en) 2017-04-28 2018-11-01 Novartis Ag Antibody conjugates comprising toll-like receptor agonist and combination therapies
WO2018200818A2 (en) 2017-04-28 2018-11-01 Millennium Pharmaceuticals, Inc. Method of treating pediatric disorders
WO2018204363A1 (en) 2017-05-01 2018-11-08 Agenus Inc. Anti-tigit antibodies and methods of use thereof
EP4275698A2 (en) 2017-05-01 2023-11-15 Agenus Inc. Anti-tigit antibodies and methods of use thereof
EP4241848A2 (en) 2017-05-04 2023-09-13 Acceleron Pharma Inc. Tgf-beta receptor type ii fusion proteins and uses thereof
WO2018204594A1 (en) 2017-05-04 2018-11-08 Acceleron Pharma Inc. Tgf-beta receptor type ii fusion proteins and uses thereof
US11203638B2 (en) 2017-05-05 2021-12-21 Allakos Inc. Methods and compositions for treating perennial allergic conjunctivitis and keratoconjunctivitis
WO2018213097A1 (en) 2017-05-15 2018-11-22 University Of Rochester Broadly neutralizing anti-influenza monoclonal antibody and uses thereof
WO2018215938A1 (en) 2017-05-24 2018-11-29 Novartis Ag Antibody-cytokine engrafted proteins and methods of use
WO2018215935A1 (en) 2017-05-24 2018-11-29 Novartis Ag Antibody-cytokine engrafted proteins and methods of use for immune related disorders
WO2018215937A1 (en) 2017-05-24 2018-11-29 Novartis Ag Interleukin-7 antibody cytokine engrafted proteins and methods of use in the treatment of cancer
WO2018215936A1 (en) 2017-05-24 2018-11-29 Novartis Ag Antibody-cytokine engrafted proteins and methods of use in the treatment of cancer
WO2018218056A1 (en) 2017-05-25 2018-11-29 Birstol-Myers Squibb Company Antibodies comprising modified heavy constant regions
EP4098662A1 (en) 2017-05-25 2022-12-07 Bristol-Myers Squibb Company Antibodies comprising modified heavy constant regions
WO2018220446A1 (en) 2017-06-01 2018-12-06 Compugen Ltd. Triple combination antibody therapies
WO2018229612A1 (en) 2017-06-12 2018-12-20 Novartis Ag Method of manufacturing bispecific antibodies, bispecific antibodies and therapeutic use of such antibodies
WO2018229715A1 (en) 2017-06-16 2018-12-20 Novartis Ag Compositions comprising anti-cd32b antibodies and methods of use thereof
WO2018229706A1 (en) 2017-06-16 2018-12-20 Novartis Ag Combination therapy for the treatment of cancer
WO2018236904A1 (en) 2017-06-19 2018-12-27 Surface Oncology, Inc. Combination of anti-cd47 antibodies and cell death-inducing agents, and uses thereof
WO2018237097A1 (en) 2017-06-20 2018-12-27 Amgen Inc. Method of treating or ameliorating metabolic disorders using binding proteins for gastric inhibitory peptide receptor (gipr) in combination with glp-1 agonists
US11654135B2 (en) 2017-06-22 2023-05-23 Moonshot Pharma Llc Methods for treating colon cancer with compositions comprising amlexanox and immune checkpoint inhibitors
WO2018237335A1 (en) 2017-06-23 2018-12-27 VelosBio Inc. Ror1 antibody immunoconjugates
US11597768B2 (en) 2017-06-26 2023-03-07 Beigene, Ltd. Immunotherapy for hepatocellular carcinoma
WO2019003104A1 (en) 2017-06-28 2019-01-03 Novartis Ag Methods for preventing and treating urinary incontinence
US11752207B2 (en) 2017-07-11 2023-09-12 Compass Therapeutics Llc Agonist antibodies that bind human CD137 and uses thereof
WO2019018757A1 (en) 2017-07-21 2019-01-24 Genentech, Inc. Therapeutic and diagnostic methods for cancer
WO2019023347A1 (en) 2017-07-26 2019-01-31 Forty Seven, Inc. Anti-sirp-alpha antibodies and related methods
WO2019022187A1 (en) 2017-07-27 2019-01-31 第一三共株式会社 Anti-cd147 antibody
US11739150B2 (en) 2017-08-11 2023-08-29 Genentech, Inc. Anti-CD8 antibodies and uses thereof
WO2019033043A2 (en) 2017-08-11 2019-02-14 Genentech, Inc. Anti-cd8 antibodies and uses thereof
WO2019036605A2 (en) 2017-08-17 2019-02-21 Massachusetts Institute Of Technology Multiple specificity binders of cxc chemokines and uses thereof
US11814431B2 (en) 2017-08-25 2023-11-14 Five Prime Therapeutics, Inc. B7-H4 antibodies and methods of use thereof
US11306144B2 (en) 2017-08-25 2022-04-19 Five Prime Therapeutics, Inc. B7-H4 antibodies and methods of use thereof
WO2019040780A1 (en) 2017-08-25 2019-02-28 Five Prime Therapeutics Inc. B7-h4 antibodies and methods of use thereof
WO2019059411A1 (en) 2017-09-20 2019-03-28 Chugai Seiyaku Kabushiki Kaisha Dosage regimen for combination therapy using pd-1 axis binding antagonists and gpc3 targeting agent
WO2019065964A1 (en) 2017-09-29 2019-04-04 第一三共株式会社 Antibody-pyrrolobenzodiazepine derivative conjugate
WO2019065795A1 (en) 2017-09-29 2019-04-04 中外製薬株式会社 Multispecific antigen-binding molecule having blood coagulation factor viii (fviii) cofactor function-substituting activity, and pharmaceutical formulation containing said molecule as active ingredient
US11230601B2 (en) 2017-10-10 2022-01-25 Tilos Therapeutics, Inc. Methods of using anti-lap antibodies
EP4219540A2 (en) 2017-10-10 2023-08-02 Alpine Immune Sciences, Inc. Ctla-4 variant immunomodulatory proteins and uses thereof
WO2019074983A1 (en) 2017-10-10 2019-04-18 Alpine Immune Sciences, Inc. Ctla-4 variant immunomodulatory proteins and uses thereof
US11753458B2 (en) 2017-10-10 2023-09-12 Alpine Immune Sciences, Inc. CTLA-4 variant immunomodulatory proteins and uses thereof
WO2019075090A1 (en) 2017-10-10 2019-04-18 Tilos Therapeutics, Inc. Anti-lap antibodies and uses thereof
US11912754B2 (en) 2017-10-12 2024-02-27 Immunowake Inc. VEGFR-antibody light chain fusion protein
US11613566B2 (en) 2017-10-18 2023-03-28 Alpine Immune Sciences, Inc. Variant ICOS ligand immunomodulatory proteins and related compositions and methods
WO2019079520A2 (en) 2017-10-18 2019-04-25 Alpine Immune Sciences, Inc. Variant icos ligand immunomodulatory proteins and related compositions and methods
WO2019077092A1 (en) 2017-10-20 2019-04-25 F. Hoffmann-La Roche Ag Method for generating multispecific antibodies from monospecific antibodies
WO2019081983A1 (en) 2017-10-25 2019-05-02 Novartis Ag Antibodies targeting cd32b and methods of use thereof
WO2019086362A1 (en) 2017-10-30 2019-05-09 F. Hoffmann-La Roche Ag Method for in vivo generation of multispecific antibodies from monospecific antibodies
US11718679B2 (en) 2017-10-31 2023-08-08 Compass Therapeutics Llc CD137 antibodies and PD-1 antagonists and uses thereof
WO2019089753A2 (en) 2017-10-31 2019-05-09 Compass Therapeutics Llc Cd137 antibodies and pd-1 antagonists and uses thereof
WO2019090263A1 (en) 2017-11-06 2019-05-09 Genentech, Inc. Diagnostic and therapeutic methods for cancer
WO2019100052A2 (en) 2017-11-20 2019-05-23 Compass Therapeutics Llc Cd137 antibodies and tumor antigen-targeting antibodies and uses thereof
WO2019102353A1 (en) 2017-11-22 2019-05-31 Novartis Ag Reversal binding agents for anti-factor xi/xia antibodies and uses thereof
US11786529B2 (en) 2017-11-29 2023-10-17 Beigene Switzerland Gmbh Treatment of indolent or aggressive B-cell lymphomas using a combination comprising BTK inhibitors
WO2019106578A2 (en) 2017-12-01 2019-06-06 Novartis Ag Polyomavirus neutralizing antibodies
WO2019110823A1 (en) 2017-12-08 2019-06-13 Argenx Bvba Use of fcrn antagonists for treatment of generalized myasthenia gravis
WO2019126536A1 (en) 2017-12-20 2019-06-27 Alexion Pharmaceuticals Inc. Humanized anti-cd200 antibodies and uses thereof
WO2019126133A1 (en) 2017-12-20 2019-06-27 Alexion Pharmaceuticals, Inc. Liquid formulations of anti-cd200 antibodies
WO2019122049A1 (en) 2017-12-21 2019-06-27 F. Hoffmann-La Roche Ag Combination therapy of tumor targeted icos agonists with t-cell bispecific molecules
EP3502140A1 (en) 2017-12-21 2019-06-26 F. Hoffmann-La Roche AG Combination therapy of tumor targeted icos agonists with t-cell bispecific molecules
WO2019126472A1 (en) 2017-12-22 2019-06-27 Genentech, Inc. Use of pilra binding agents for treatment of a disease
WO2019129211A1 (en) 2017-12-28 2019-07-04 Nanjing Legend Biotech Co., Ltd. Antibodies and variants thereof against pd-l1
US11905327B2 (en) 2017-12-28 2024-02-20 Nanjing Legend Biotech Co., Ltd. Single-domain antibodies and variants thereof against TIGIT
WO2019129677A1 (en) 2017-12-29 2019-07-04 F. Hoffmann-La Roche Ag Anti-vegf antibodies and methods of use
WO2019136179A1 (en) 2018-01-03 2019-07-11 Alpine Immune Sciences, Inc. Multi-domain immunomodulatory proteins and methods of use thereof
WO2019134981A1 (en) 2018-01-05 2019-07-11 Ac Immune Sa Misfolded tdp-43 binding molecules
WO2019140229A1 (en) 2018-01-12 2019-07-18 Bristol-Myers Squibb Company Antibodies against tim3 and uses thereof
US11713353B2 (en) 2018-01-15 2023-08-01 Nanjing Legend Biotech Co., Ltd. Single-domain antibodies and variants thereof against PD-1
WO2019143636A1 (en) 2018-01-16 2019-07-25 Lakepharma, Inc. Bispecific antibody that binds cd3 and another target
WO2019148020A1 (en) 2018-01-26 2019-08-01 Genentech, Inc. Compositions and methods of use
WO2019148026A1 (en) 2018-01-26 2019-08-01 Genentech, Inc. Il-22 fc fusion proteins and methods of use
US11072658B2 (en) 2018-02-01 2021-07-27 Merck Sharp & Dohme Corp. Anti-PD-1/LAG3 bispecific antibodies
WO2019152642A1 (en) 2018-02-01 2019-08-08 Merck Sharp & Dohme Corp. Anti-pd-1/lag3 bispecific antibodies
WO2019157308A1 (en) 2018-02-08 2019-08-15 Genentech, Inc. Bispecific antigen-binding molecules and methods of use
US11866498B2 (en) 2018-02-08 2024-01-09 Genentech, Inc. Bispecific antigen-binding molecules and methods of use
WO2019157358A1 (en) 2018-02-09 2019-08-15 Genentech, Inc. Therapeutic and diagnostic methods for mast cell-mediated inflammatory diseases
WO2019158645A1 (en) 2018-02-14 2019-08-22 Abba Therapeutics Ag Anti-human pd-l2 antibodies
WO2019165140A1 (en) 2018-02-21 2019-08-29 Genentech, Inc. DOSING FOR TREATMENT WITH IL-22 Fc FUSION PROTEINS
WO2019165434A1 (en) 2018-02-26 2019-08-29 Genentech, Inc. Dosing for treatment with anti-tigit and anti-pd-l1 antagonist antibodies
US11939383B2 (en) 2018-03-02 2024-03-26 Five Prime Therapeutics, Inc. B7-H4 antibodies and methods and use thereof
WO2019168403A2 (en) 2018-03-02 2019-09-06 Labo Bio-Medical Investments B.V. Multispecific binding molecules for the prevention, treatment and diagnosis of neurodegenerative disorders
WO2019172165A1 (en) 2018-03-05 2019-09-12 学校法人埼玉医科大学 Pharmaceutical composition for treating or preventing heterotopic ossification
WO2019175071A1 (en) 2018-03-13 2019-09-19 F. Hoffmann-La Roche Ag Therapeutic combination of 4-1 bb agonists with anti-cd20 antibodies
WO2019178316A1 (en) 2018-03-14 2019-09-19 Genentech, Inc. Anti-klk5 antibodies and methods of use
US10793637B2 (en) 2018-03-14 2020-10-06 Surface Oncology, Inc. Antibodies that bind CD39 and uses thereof
EP4043496A1 (en) 2018-03-14 2022-08-17 Surface Oncology, Inc. Antibodies that bind cd39 and uses thereof
WO2019178269A2 (en) 2018-03-14 2019-09-19 Surface Oncology, Inc. Antibodies that bind cd39 and uses thereof
US10738128B2 (en) 2018-03-14 2020-08-11 Surface Oncology, Inc. Antibodies that bind CD39 and uses thereof
US11891432B2 (en) 2018-03-15 2024-02-06 Chugai Seiyaku Kabushiki Kaisha Anti-dengue virus antibodies having cross-reactivity to Zika virus and methods of use
US11661452B2 (en) 2018-03-20 2023-05-30 WuXi Biologics Ireland Limited Anti-lag-3 antibody polypeptide
WO2019183040A1 (en) 2018-03-21 2019-09-26 Five Prime Therapeutics, Inc. ANTIBODIES BINDING TO VISTA AT ACIDIC pH
US11332524B2 (en) 2018-03-22 2022-05-17 Surface Oncology, Inc. Anti-IL-27 antibodies and uses thereof
US11242393B2 (en) 2018-03-23 2022-02-08 Bristol-Myers Squibb Company Antibodies against MICA and/or MICB and uses thereof
WO2019191552A1 (en) 2018-03-29 2019-10-03 Genentech, Inc. Modulating lactogenic activity in mammalian cells
US11958903B2 (en) 2018-03-30 2024-04-16 Nanjing Legend Biotech Co., Ltd. Single-domain antibodies against LAG-3 and uses thereof
WO2019195126A1 (en) 2018-04-02 2019-10-10 Bristol-Myers Squibb Company Anti-trem-1 antibodies and uses thereof
US11155618B2 (en) 2018-04-02 2021-10-26 Bristol-Myers Squibb Company Anti-TREM-1 antibodies and uses thereof
WO2019195514A1 (en) 2018-04-04 2019-10-10 Genentech, Inc. Methods for detecting and quantifying fgf21
WO2019197428A1 (en) 2018-04-10 2019-10-17 Inatherys Antibody-drug conjugates and their uses for the treatment of cancer
EP3552631A1 (en) 2018-04-10 2019-10-16 Inatherys Antibody-drug conjugates and their uses for the treatment of cancer
WO2019200357A1 (en) 2018-04-12 2019-10-17 Surface Oncology, Inc. Biomarker for cd47 targeting therapeutics and uses therefor
WO2019197903A1 (en) 2018-04-12 2019-10-17 Mosaic Biomedicals Slu Combination of lif inhibitors and pd-1 axis inhibitors for use in treating cancer
WO2019202041A1 (en) 2018-04-18 2019-10-24 F. Hoffmann-La Roche Ag Multispecific antibodies and use thereof
WO2019202040A1 (en) 2018-04-18 2019-10-24 F. Hoffmann-La Roche Ag Anti-hla-g antibodies and use thereof
WO2019213384A1 (en) 2018-05-03 2019-11-07 University Of Rochester Anti-influenza neuraminidase monoclonal antibodies and uses thereof
WO2019214707A1 (en) 2018-05-11 2019-11-14 信达生物制药(苏州)有限公司 Preparations comprising anti-pcsk9 antibodies and use thereof
US11352403B2 (en) 2018-05-14 2022-06-07 Werewolf Therapeutics, Inc. Activatable interleukin-2 polypeptides and methods of use thereof
WO2019220204A2 (en) 2018-05-14 2019-11-21 Mosaic Biomedicals Slu Antibodies against lif and dosage forms thereof
US11453710B2 (en) 2018-05-14 2022-09-27 Werewolf Therapeutics, Inc. Activatable interleukin 12 polypeptides and methods of use thereof
US11535658B2 (en) 2018-05-14 2022-12-27 Werewolf Therapeutics, Inc. Activatable interleukin-2 polypeptides and methods of use thereof
WO2019229658A1 (en) 2018-05-30 2019-12-05 Novartis Ag Entpd2 antibodies, combination therapies, and methods of using the antibodies and combination therapies
WO2019229699A1 (en) 2018-05-31 2019-12-05 Novartis Ag Hepatitis b antibodies
US11932681B2 (en) 2018-05-31 2024-03-19 Novartis Ag Hepatitis B antibodies
WO2019229701A2 (en) 2018-06-01 2019-12-05 Novartis Ag Binding molecules against bcma and uses thereof
WO2019235426A1 (en) 2018-06-04 2019-12-12 中外製薬株式会社 Antigen-binding molecule showing changed half-life in cytoplasm
WO2019241758A1 (en) 2018-06-15 2019-12-19 Alpine Immune Sciences, Inc. Pd-1 variant immunomodulatory proteins and uses thereof
WO2019243900A2 (en) 2018-06-18 2019-12-26 Mosaic Biomedicals Slu Combination of lif inhibitors and platinum-based antineoplastic agents for use in treating cancer
WO2019246557A1 (en) 2018-06-23 2019-12-26 Genentech, Inc. Methods of treating lung cancer with a pd-1 axis binding antagonist, a platinum agent, and a topoisomerase ii inhibitor
WO2020007817A1 (en) 2018-07-04 2020-01-09 F. Hoffmann-La Roche Ag Novel bispecific agonistic 4-1bb antigen binding molecules
WO2020014132A2 (en) 2018-07-09 2020-01-16 Five Prime Therapeutics, Inc. Antibodies binding to ilt4
WO2020013170A1 (en) 2018-07-10 2020-01-16 国立大学法人神戸大学 ANTI-SIRPα ANTIBODY
WO2020014306A1 (en) 2018-07-10 2020-01-16 Immunogen, Inc. Met antibodies and immunoconjugates and uses thereof
WO2020014327A2 (en) 2018-07-11 2020-01-16 Five Prime Therapeutics, Inc. Antibodies binding to vista at acidic ph
WO2020018789A1 (en) 2018-07-18 2020-01-23 Genentech, Inc. Methods of treating lung cancer with a pd-1 axis binding antagonist, an antimetabolite, and a platinum agent
US11214619B2 (en) 2018-07-20 2022-01-04 Surface Oncology, Inc. Anti-CD112R compositions and methods
US11279758B2 (en) 2018-07-20 2022-03-22 Surface Oncology, Inc. Anti-CD112R compositions and methods
WO2020027279A1 (en) 2018-08-01 2020-02-06 Chugai Seiyaku Kabushiki Kaisha A pharmaceutical composition for use in the treatment or prevention of a c5-related disease and a method for treating or preventing a c5-related disease
WO2020025703A1 (en) 2018-08-01 2020-02-06 Imcheck Therapeutics Sas Anti-btn3a antibodies and their use in treating cancer or infectious disorders
WO2020027330A1 (en) 2018-08-03 2020-02-06 中外製薬株式会社 Antigen-binding molecule containing two antigen-binding domains that are linked to each other
EP3608674A1 (en) 2018-08-09 2020-02-12 Regeneron Pharmaceuticals, Inc. Methods for assessing binding affinity of an antibody variant to the neonatal fc receptor
WO2020033923A1 (en) 2018-08-09 2020-02-13 Compass Therapeutics Llc Antigen binding agents that bind cd277 and uses thereof
WO2020033926A2 (en) 2018-08-09 2020-02-13 Compass Therapeutics Llc Antibodies that bind cd277 and uses thereof
WO2020033925A2 (en) 2018-08-09 2020-02-13 Compass Therapeutics Llc Antibodies that bind cd277 and uses thereof
WO2020032230A1 (en) 2018-08-10 2020-02-13 中外製薬株式会社 Anti-cd137 antigen-binding molecule and utilization thereof
WO2020037154A1 (en) 2018-08-17 2020-02-20 23Andme, Inc. Anti-il1rap antibodies and methods of use thereof
WO2020049286A1 (en) 2018-09-03 2020-03-12 Femtogenix Limited Polycyclic amides as cytotoxic agents
WO2020050406A1 (en) 2018-09-06 2020-03-12 第一三共株式会社 Novel cyclic dinucleotide derivative and antibody-drug conjugate thereof
WO2020053742A2 (en) 2018-09-10 2020-03-19 Novartis Ag Anti-hla-hbv peptide antibodies
WO2020056077A1 (en) 2018-09-13 2020-03-19 The Board Of Regents Of The University Of Texas System Novel lilrb4 antibodies and uses thereof
WO2020061060A1 (en) 2018-09-19 2020-03-26 Genentech, Inc. Therapeutic and diagnostic methods for bladder cancer
WO2020061376A2 (en) 2018-09-19 2020-03-26 Alpine Immune Sciences, Inc. Methods and uses of variant cd80 fusion proteins and related constructs
EP4249917A2 (en) 2018-09-21 2023-09-27 F. Hoffmann-La Roche AG Diagnostic methods for triple-negative breast cancer
WO2020061349A1 (en) 2018-09-21 2020-03-26 Genentech, Inc. Diagnostic methods for triple-negative breast cancer
EP4321530A2 (en) 2018-09-27 2024-02-14 Xilio Development, Inc. Masked cytokine polypeptides
US11827685B2 (en) 2018-09-27 2023-11-28 Xilio Development, Inc. Masked cytokine polypeptides
US11053294B2 (en) 2018-09-27 2021-07-06 Xilio Development, Inc. Masked cytokine polypeptides
US11866476B2 (en) 2018-09-27 2024-01-09 Xilio Development, Inc. Masked IL-2-Fc fusion polypeptides
US11718655B2 (en) 2018-09-27 2023-08-08 Xilio Development, Inc. Masked interleukin-12 polypeptides
US11827686B2 (en) 2018-09-27 2023-11-28 Xilio Development, Inc. Masked cytokine polypeptides
WO2020070041A1 (en) 2018-10-01 2020-04-09 F. Hoffmann-La Roche Ag Bispecific antigen binding molecules comprising anti-fap clone 212
WO2020070035A1 (en) 2018-10-01 2020-04-09 F. Hoffmann-La Roche Ag Bispecific antigen binding molecules with trivalent binding to cd40
US11130802B2 (en) 2018-10-10 2021-09-28 Tilos Therapeutics, Inc. Anti-lap antibody variants
WO2020076969A2 (en) 2018-10-10 2020-04-16 Tilos Therapeutics, Inc. Anti-lap antibody variants and uses thereof
WO2020079580A1 (en) 2018-10-15 2020-04-23 Novartis Ag Trem2 stabilizing antibodies
WO2020081493A1 (en) 2018-10-16 2020-04-23 Molecular Templates, Inc. Pd-l1 binding proteins
WO2020081767A1 (en) 2018-10-18 2020-04-23 Genentech, Inc. Diagnostic and therapeutic methods for sarcomatoid kidney cancer
WO2020089811A1 (en) 2018-10-31 2020-05-07 Novartis Ag Dc-sign antibody drug conjugates
WO2020096959A1 (en) 2018-11-05 2020-05-14 Genentech, Inc. Methods of producing two chain proteins in prokaryotic host cells
WO2020095922A1 (en) 2018-11-07 2020-05-14 第一三共株式会社 Method of improving blood kinetics of peptide
WO2020102555A1 (en) 2018-11-16 2020-05-22 Memorial Sloan Kettering Cancer Center Antibodies to mucin-16 and methods of use thereof
WO2020108530A1 (en) 2018-11-27 2020-06-04 信达生物制药(苏州)有限公司 Anti-il-23p19 antibody and uses thereof
WO2020112781A1 (en) 2018-11-28 2020-06-04 Bristol-Myers Squibb Company Antibodies comprising modified heavy constant regions
WO2020113141A2 (en) 2018-11-30 2020-06-04 Alpine Immune Sciences, Inc. Cd86 variant immunomodulatory proteins and uses thereof
WO2020117952A2 (en) 2018-12-05 2020-06-11 Genentech, Inc. Diagnostic methods and compositions for cancer immunotherapy
EP4198057A1 (en) 2018-12-05 2023-06-21 F. Hoffmann-La Roche AG Diagnostic methods and compositions for cancer immunotherapy
WO2020117257A1 (en) 2018-12-06 2020-06-11 Genentech, Inc. Combination therapy of diffuse large b-cell lymphoma comprising an anti-cd79b immunoconjugates, an alkylating agent and an anti-cd20 antibody
WO2020118011A1 (en) 2018-12-06 2020-06-11 Alexion Pharmaceuticals, Inc. Anti-alk2 antibodies and uses thereof
WO2020123275A1 (en) 2018-12-10 2020-06-18 Genentech, Inc. Photocrosslinking peptides for site specific conjugation to fc-containing proteins
WO2020121059A1 (en) 2018-12-14 2020-06-18 Northern Biologics Inc. Anti-periostin antibodies and uses thereof
WO2020128863A1 (en) 2018-12-19 2020-06-25 Novartis Ag Anti-tnf-alpha antibodies
WO2020132034A1 (en) 2018-12-20 2020-06-25 23Andme, Inc. Anti-cd96 antibodies and methods of use thereof
WO2020132230A2 (en) 2018-12-20 2020-06-25 Genentech, Inc. Modified antibody fcs and methods of use
WO2020128612A2 (en) 2018-12-21 2020-06-25 Novartis Ag Antibodies to pmel17 and conjugates thereof
WO2020127873A1 (en) 2018-12-21 2020-06-25 F. Hoffmann-La Roche Ag Antibody that binds to vegf and il-1beta and methods of use
WO2020132220A1 (en) 2018-12-21 2020-06-25 23Andme, Inc. Anti-il-36 antibodies and methods of use thereof
WO2020132231A1 (en) 2018-12-21 2020-06-25 Genentech, Inc. Methods of producing polypeptides using a cell line resistant to apoptosis
WO2020139926A2 (en) 2018-12-26 2020-07-02 Akrevia Therapeutics Inc. Anti-ctla4 antibodies and methods of use thereof
WO2020139920A2 (en) 2018-12-26 2020-07-02 City Of Hope Activatable masked anti-ctla4 binding proteins
WO2020141145A1 (en) 2018-12-30 2020-07-09 F. Hoffmann-La Roche Ag Anti-rabbit cd19 antibodies and methods of use
WO2020148207A1 (en) 2019-01-14 2020-07-23 INSERM (Institut National de la Santé et de la Recherche Médicale) Human monoclonal antibodies binding to hla-a2
WO2020150152A1 (en) 2019-01-14 2020-07-23 Genentech, Inc. Methods of treating cancer with a pd-1 axis binding antagonist and an rna vaccine
WO2020150496A1 (en) 2019-01-16 2020-07-23 Compass Therapeutics Llc Formulations of antibodies that bind human cd137 and uses thereof
US11919962B2 (en) 2019-01-22 2024-03-05 Bristol Myers-Squibb Company Antibodies against IL-7R alpha subunit and uses thereof
WO2020154405A2 (en) 2019-01-22 2020-07-30 Genentech, Inc. Immunoglobulin a antibodies and methods of production and use
WO2020154293A1 (en) 2019-01-22 2020-07-30 Bristol-Myers Squibb Company Antibodies against il-7r alpha subunit and uses thereof
US11008395B2 (en) 2019-01-22 2021-05-18 Bristol Myers-Squibb Company Antibodies against IL-7R alpha subunit and uses thereof
WO2020154410A1 (en) 2019-01-23 2020-07-30 Genentech, Inc. Methods of producing multimeric proteins in eukaryotic host cells
WO2020153467A1 (en) 2019-01-24 2020-07-30 中外製薬株式会社 Novel cancer antigens and antibodies of said antigens
WO2020157491A1 (en) 2019-01-29 2020-08-06 Femtogenix Limited G-a crosslinking cytotoxic agents
WO2020176748A1 (en) 2019-02-27 2020-09-03 Genentech, Inc. Dosing for treatment with anti-tigit and anti-cd20 or anti-cd38 antibodies
WO2020185535A1 (en) 2019-03-08 2020-09-17 Genentech, Inc. Methods for detecting and quantifying membrane-associated proteins on extracellular vesicles
WO2020186176A1 (en) 2019-03-14 2020-09-17 Genentech, Inc. Treatment of cancer with her2xcd3 bispecific antibodies in combination with anti-her2 mab
WO2020196474A1 (en) 2019-03-25 2020-10-01 第一三共株式会社 Antibody-pyrrolobenzodiazepine derivative conjugate
WO2020196712A1 (en) 2019-03-27 2020-10-01 第一三共株式会社 Combination of antibody-pyrrolobenzodiazepine derivative conjugate and parp inhibitor
WO2020210358A1 (en) 2019-04-08 2020-10-15 Biogen Ma Inc. Anti-integrin antibodies and uses thereof
WO2020208177A1 (en) 2019-04-11 2020-10-15 Argenx Bvba ANTI-IgE ANTIBODIES
WO2020214867A1 (en) 2019-04-17 2020-10-22 Alpine Immune Sciences, Inc. Methods and uses of variant icos ligand (icosl) fusion proteins
WO2020213724A1 (en) 2019-04-19 2020-10-22 中外製薬株式会社 Chimeric receptor recognizing modification site of antibody
WO2020214995A1 (en) 2019-04-19 2020-10-22 Genentech, Inc. Anti-mertk antibodies and their methods of use
WO2020226986A2 (en) 2019-05-03 2020-11-12 Genentech, Inc. Methods of treating cancer with an anti-pd-l1 antibody
US11739132B2 (en) 2019-05-14 2023-08-29 Werewolf Therapeutics, Inc. Separation moieties and methods of use thereof
WO2020232169A1 (en) 2019-05-14 2020-11-19 Genentech, Inc. Methods of using anti-cd79b immunoconjugates to treat follicular lymphoma
WO2020236817A2 (en) 2019-05-20 2020-11-26 Novartis Ag Mcl-1 inhibitor antibody-drug conjugates and methods of use
WO2020236841A2 (en) 2019-05-20 2020-11-26 Novartis Ag Antibody drug conjugates having linkers comprising hydrophilic groups
WO2020236795A2 (en) 2019-05-21 2020-11-26 Novartis Ag Trispecific binding molecules against bcma and uses thereof
WO2020236797A1 (en) 2019-05-21 2020-11-26 Novartis Ag Variant cd58 domains and uses thereof
WO2020236792A1 (en) 2019-05-21 2020-11-26 Novartis Ag Cd19 binding molecules and uses thereof
WO2020234473A1 (en) 2019-05-23 2020-11-26 Ac Immune Sa Anti-tdp-43 binding molecules and uses thereof
US11591388B2 (en) 2019-06-07 2023-02-28 argenx BV Pharmaceutical formulations of FcRn inhibitors suitable for subcutaneous administration
WO2020250159A1 (en) 2019-06-12 2020-12-17 Novartis Ag Natriuretic peptide receptor 1 antibodies and methods of use
WO2020263830A1 (en) 2019-06-25 2020-12-30 Gilead Sciences, Inc. Flt3l-fc fusion proteins and methods of use
WO2020260326A1 (en) 2019-06-27 2020-12-30 F. Hoffmann-La Roche Ag Novel icos antibodies and tumor-targeted antigen binding molecules comprising them
WO2021010326A1 (en) 2019-07-12 2021-01-21 中外製薬株式会社 Anti-mutation type fgfr3 antibody and use therefor
WO2021009047A1 (en) 2019-07-12 2021-01-21 F. Hoffmann-La Roche Ag Antibodies which bind to cancer cells and target radionuclides to said cells
WO2021011678A1 (en) 2019-07-15 2021-01-21 Bristol-Myers Squibb Company Anti-trem-1 antibodies and uses thereof
WO2021011681A1 (en) 2019-07-15 2021-01-21 Bristol-Myers Squibb Company Antibodies against human trem-1 and uses thereof
WO2021009263A1 (en) 2019-07-16 2021-01-21 INSERM (Institut National de la Santé et de la Recherche Médicale) Antibodies having specificity for cd38 and uses thereof
WO2021014389A1 (en) 2019-07-24 2021-01-28 H. Lundbeck A/S Anti-mglur5 antibodies and uses thereof
WO2021020282A1 (en) 2019-07-26 2021-02-04 学校法人埼玉医科大学 Antibody recognizing extracellular region of alk2/acvr1
WO2021021837A2 (en) 2019-07-29 2021-02-04 Compugen Ltd. Anti-pvrig antibodies formulations and uses thereof
WO2021019036A1 (en) 2019-07-31 2021-02-04 F. Hoffmann-La Roche Ag Dosage and administration regimen for the treatment or prevention of c5-related diseases by the use of the anti-c5 antibody crovalimab
WO2021019033A1 (en) 2019-07-31 2021-02-04 F. Hoffmann-La Roche Ag Dosage and administration regimen for the treatment or prevention of c5-related diseases by the use of the anti-c5 antibody crovalimab
WO2021024209A1 (en) 2019-08-06 2021-02-11 Aprinoia Therapeutics Inc. Antibodies that bind to pathological tau species and uses thereof
WO2021030488A1 (en) 2019-08-12 2021-02-18 Bienvenue David Leonard 4-1bb and ox40 binding proteins and related compositions and methods, antibodies against 4-1bb, antibodies against ox40
WO2021042019A1 (en) 2019-08-30 2021-03-04 Agenus Inc. Anti-cd96 antibodies and methods of use thereof
WO2021050645A1 (en) 2019-09-12 2021-03-18 Genentech, Inc. Compositions and methods of treating lupus nephritis
US11655303B2 (en) 2019-09-16 2023-05-23 Surface Oncology, Inc. Anti-CD39 antibody compositions and methods
WO2021055577A2 (en) 2019-09-18 2021-03-25 Genentech, Inc. Anti-klk7 antibodies, anti-klk5 antibodies, multispecific anti-klk5/klk7 antibodies, and methods of use
WO2021053560A1 (en) 2019-09-18 2021-03-25 Novartis Ag Combination therapy with entpd2 and cd73 antibodies
WO2021053559A1 (en) 2019-09-18 2021-03-25 Novartis Ag Entpd2 antibodies, combination therapies, and methods of using the antibodies and combination therapies
WO2021055698A1 (en) 2019-09-19 2021-03-25 Bristol-Myers Squibb Company Antibodies binding to vista at acidic ph
WO2021055694A1 (en) 2019-09-20 2021-03-25 Genentech, Inc. Dosing for anti-tryptase antibodies
WO2021062244A1 (en) 2019-09-25 2021-04-01 Surface Oncology, Inc. Anti-il-27 antibodies and uses thereof
WO2021062085A1 (en) 2019-09-27 2021-04-01 Genentech, Inc. Dosing for treatment with anti-tigit and anti-pd-l1 antagonist antibodies
WO2021070181A1 (en) 2019-10-08 2021-04-15 Nectin Therapeutics Ltd. Antibodies against the poliovirus receptor (pvr) and uses thereof
WO2021076196A1 (en) 2019-10-18 2021-04-22 Genentech, Inc. Methods of using anti-cd79b immunoconjugates to treat diffuse large b-cell lymphoma
WO2021080682A1 (en) 2019-10-24 2021-04-29 Massachusetts Institute Of Technology Monoclonal antibodies that bind human cd161 and uses thereof
WO2021091605A1 (en) 2019-11-04 2021-05-14 Compugen Ltd. Combination therapy with anti-pvrig antibodies formulations and anti-pd-1 antibodies
WO2021092171A1 (en) 2019-11-06 2021-05-14 Genentech, Inc. Diagnostic and therapeutic methods for treatment of hematologic cancers
WO2021110873A1 (en) 2019-12-04 2021-06-10 Medimmune Limited Antibodies against lif and uses thereof
WO2021116119A1 (en) 2019-12-09 2021-06-17 INSERM (Institut National de la Santé et de la Recherche Médicale) Antibodies having specificity to her4 and uses thereof
WO2021119505A1 (en) 2019-12-13 2021-06-17 Genentech, Inc. Anti-ly6g6d antibodies and methods of use
US11845799B2 (en) 2019-12-13 2023-12-19 Genentech, Inc. Anti-Ly6G6D antibodies and methods of use
WO2021131021A1 (en) 2019-12-27 2021-07-01 中外製薬株式会社 Anti-ctla-4 antibody and use thereof
WO2021129872A1 (en) 2019-12-27 2021-07-01 高诚生物医药(香港)有限公司 Anti-ox40 antibody and use thereof
US11859000B2 (en) 2020-01-06 2024-01-02 Vaccinex Inc. Anti-CCR8 antibodies and uses thereof
WO2021142002A1 (en) 2020-01-06 2021-07-15 Vaccinex, Inc. Anti-ccr8 antibodies and uses thereof
WO2021140202A1 (en) 2020-01-08 2021-07-15 argenx BV Methods for treating pemphigus disorders
WO2021139777A1 (en) 2020-01-10 2021-07-15 上海复宏汉霖生物技术股份有限公司 Anti-tigit antibodies and usage method
WO2021155149A1 (en) 2020-01-31 2021-08-05 Genentech, Inc. Methods of inducing neoepitope-specific t cells with a pd-1 axis binding antagonist and an rna vaccine
WO2021162020A1 (en) 2020-02-12 2021-08-19 中外製薬株式会社 Anti-cd137 antigen-binding molecule for use in cancer treatment
WO2021173844A1 (en) 2020-02-26 2021-09-02 Biograph 55, Inc. C19 c38 bispecific antibodies
WO2021170067A1 (en) 2020-02-28 2021-09-02 上海复宏汉霖生物技术股份有限公司 Anti-cd137 construct and use thereof
WO2021170071A1 (en) 2020-02-28 2021-09-02 Shanghai Henlius Biotech, Inc. Anti-cd137 constructs, multispecific antibody and uses thereof
WO2021175954A1 (en) 2020-03-04 2021-09-10 Imcheck Therapeutics Sas Antibodies having specificity for btnl8 and uses thereof
WO2021176424A1 (en) 2020-03-06 2021-09-10 Ona Therapeutics, S.L. Anti-cd36 antibodies and their use to treat cancer
WO2021177438A1 (en) 2020-03-06 2021-09-10 第一三共株式会社 Antibody-drug conjugate including novel cyclic dinucleotide derivative
WO2021183207A1 (en) 2020-03-10 2021-09-16 Massachusetts Institute Of Technology COMPOSITIONS AND METHODS FOR IMMUNOTHERAPY OF NPM1c-POSITIVE CANCER
WO2021180205A1 (en) 2020-03-13 2021-09-16 江苏恒瑞医药股份有限公司 Pvrig binding protein and its medical uses
WO2021183849A1 (en) 2020-03-13 2021-09-16 Genentech, Inc. Anti-interleukin-33 antibodies and uses thereof
WO2021188749A1 (en) 2020-03-19 2021-09-23 Genentech, Inc. Isoform-selective anti-tgf-beta antibodies and methods of use
US11365239B2 (en) 2020-03-20 2022-06-21 Tsb Therapeutics (Beijing) Co., Ltd. Anti-SARS-COV-2 antibodies and uses thereof
WO2021194481A1 (en) 2020-03-24 2021-09-30 Genentech, Inc. Dosing for treatment with anti-tigit and anti-pd-l1 antagonist antibodies
WO2021194913A1 (en) 2020-03-24 2021-09-30 Genentech, Inc. Tie2-binding agents and methods of use
WO2021195464A2 (en) 2020-03-26 2021-09-30 Genentech, Inc. Modified mammalian cells
WO2021195513A1 (en) 2020-03-27 2021-09-30 Novartis Ag Bispecific combination therapy for treating proliferative diseases and autoimmune disorders
WO2021198034A1 (en) 2020-03-30 2021-10-07 F. Hoffmann-La Roche Ag Antibody that binds to vegf and pdgf-b and methods of use
WO2021202235A1 (en) 2020-04-01 2021-10-07 University Of Rochester Monoclonal antibodies against the hemagglutinin (ha) and neuraminidase (na) of influenza h3n2 viruses
WO2021198333A1 (en) 2020-04-01 2021-10-07 F. Hoffmann-La Roche Ag Bispecific antigen binding molecules targeting ox40 and fap
WO2021198335A1 (en) 2020-04-01 2021-10-07 F. Hoffmann-La Roche Ag Bispecific antibodies comprising a modified c-terminal crossfab fragment
WO2021202959A1 (en) 2020-04-03 2021-10-07 Genentech, Inc. Therapeutic and diagnostic methods for cancer
WO2021207449A1 (en) 2020-04-09 2021-10-14 Merck Sharp & Dohme Corp. Affinity matured anti-lap antibodies and uses thereof
WO2021207662A1 (en) 2020-04-10 2021-10-14 Genentech, Inc. Use of il-22fc for the treatment or prevention of pneumonia, acute respiratory distress syndrome, or cytokine release syndrome
WO2021217051A1 (en) 2020-04-24 2021-10-28 Genentech, Inc. Methods of using anti-cd79b immunoconjugates
WO2021214277A1 (en) 2020-04-24 2021-10-28 F. Hoffmann-La Roche Ag Enzyme and pathway modulation with sulfhydryl compounds and their derivatives
WO2021222167A1 (en) 2020-04-28 2021-11-04 Genentech, Inc. Methods and compositions for non-small cell lung cancer immunotherapy
WO2021222935A2 (en) 2020-04-28 2021-11-04 The Rockefeller University Neutralizing anti-sars-cov-2 antibodies and methods of use thereof
WO2021219871A2 (en) 2020-04-30 2021-11-04 Aduro Biotech Holdings, Europe B.V. Anti-cd103 antibodies
WO2021220199A1 (en) 2020-04-30 2021-11-04 Novartis Ag Ccr7 antibody drug conjugates for treating cancer
WO2021225892A1 (en) 2020-05-03 2021-11-11 Levena (Suzhou) Biopharma Co., Ltd. Antibody-drug conjugates (adcs) comprising an anti-trop-2 antibody, compositions comprising such adcs, as well as methods of making and using the same
WO2021226551A1 (en) 2020-05-08 2021-11-11 Alpine Immune Sciences, Inc. April and baff inhibitory immunomodulatory proteins and methods of use thereof
US11274140B2 (en) 2020-05-08 2022-03-15 Alpine Immune Sciences, Inc. APRIL and BAFF inhibitory immunomodulatory proteins and methods of use thereof
WO2021226553A2 (en) 2020-05-08 2021-11-11 Alpine Immune Sciences, Inc. April and baff inhibitory immunomodulatory proteins with and without a t cell inhibitory protein and methods of use thereof
WO2021228956A1 (en) 2020-05-12 2021-11-18 INSERM (Institut National de la Santé et de la Recherche Médicale) New method to treat cutaneous t-cell lymphomas and tfh derived lymphomas
WO2021233834A1 (en) 2020-05-17 2021-11-25 Astrazeneca Uk Limited Sars-cov-2 antibodies and methods of selecting and using the same
WO2021234160A2 (en) 2020-05-22 2021-11-25 Formycon Ag Ace2 fusion proteins and uses thereof
WO2021238886A1 (en) 2020-05-27 2021-12-02 Staidson (Beijing) Biopharmaceuticals Co., Ltd. Antibodies specifically recognizing nerve growth factor and uses thereof
WO2021243204A1 (en) 2020-05-29 2021-12-02 23Andme, Inc. Anti-cd200r1 antibodies and methods of use thereof
WO2021247769A1 (en) 2020-06-02 2021-12-09 Dynamicure Biotechnology Llc Anti-cd93 constructs and uses thereof
WO2021249990A2 (en) 2020-06-08 2021-12-16 Hoffmann-La Roche Inc. Anti-hbv antibodies and methods of use
WO2021252977A1 (en) 2020-06-12 2021-12-16 Genentech, Inc. Methods and compositions for cancer immunotherapy
WO2021257503A1 (en) 2020-06-16 2021-12-23 Genentech, Inc. Methods and compositions for treating triple-negative breast cancer
WO2021257124A1 (en) 2020-06-18 2021-12-23 Genentech, Inc. Treatment with anti-tigit antibodies and pd-1 axis binding antagonists
WO2021259880A1 (en) 2020-06-22 2021-12-30 Almirall, S.A. Anti-il-36 antibodies and methods of use thereof
WO2021259199A1 (en) 2020-06-22 2021-12-30 信达生物制药(苏州)有限公司 Anti-cd73 antibody and use thereof
WO2021262783A1 (en) 2020-06-24 2021-12-30 Genentech, Inc. Apoptosis resistant cell lines
WO2021262791A1 (en) 2020-06-25 2021-12-30 Merck Sharp & Dohme Corp. High affinity antibodies targeting tau phosphorylated at serine 413
US11702467B2 (en) 2020-06-25 2023-07-18 Merck Sharp & Dohme Llc High affinity antibodies targeting tau phosphorylated at serine 413
WO2022008688A1 (en) 2020-07-10 2022-01-13 F. Hoffmann-La Roche Ag Antibodies which bind to cancer cells and target radionuclides to said cells
WO2022016037A1 (en) 2020-07-17 2022-01-20 Genentech, Inc. Anti-notch2 antibodies and methods of use
WO2022023735A1 (en) 2020-07-28 2022-02-03 Femtogenix Limited Cytotoxic agents
WO2022026763A1 (en) 2020-07-29 2022-02-03 Dynamicure Biotechnology Llc Anti-cd93 constructs and uses thereof
WO2022031749A1 (en) 2020-08-03 2022-02-10 Genentech, Inc. Diagnostic and therapeutic methods for lymphoma
WO2022031978A1 (en) 2020-08-06 2022-02-10 Bioverativ Usa Inc. Inflammatory cytokines and fatigue in subject with a complement mediated disease
WO2022034044A1 (en) 2020-08-10 2022-02-17 Astrazeneca Uk Limited Sars-cov-2 antibodies for treatment and prevention of covid-19
WO2022046644A1 (en) 2020-08-25 2022-03-03 Gilead Sciences, Inc. Multi-specific antigen binding molecules targeting hiv and methods of use
WO2022043517A2 (en) 2020-08-27 2022-03-03 Cureab Gmbh Anti-golph2 antibodies for macrophage and dendritic cell differentiation
WO2022047222A2 (en) 2020-08-28 2022-03-03 Genentech, Inc. Crispr/cas9 multiplex knockout of host cell proteins
WO2022049165A1 (en) 2020-09-04 2022-03-10 F. Hoffmann-La Roche Ag Antibody that binds to vegf-a and ang2 and methods of use
WO2022050954A1 (en) 2020-09-04 2022-03-10 Genentech, Inc. Dosing for treatment with anti-tigit and anti-pd-l1 antagonist antibodies
US11970539B2 (en) 2020-09-14 2024-04-30 Ichnos Sciences SA Antibodies that bind to IL1RAP and uses thereof
WO2022053715A1 (en) 2020-09-14 2022-03-17 Ichnos Sciences SA Antibodies that bind to il1rap and uses thereof
WO2022067262A1 (en) 2020-09-28 2022-03-31 Dynamicure Biotechnology Llc Anti-cd93 constructs and uses thereof
WO2022076462A1 (en) 2020-10-05 2022-04-14 Genentech, Inc. Dosing for treatment with anti-fcrh5/anti-cd3 bispecific antibodies
WO2022086957A1 (en) 2020-10-20 2022-04-28 Genentech, Inc. Peg-conjugated anti-mertk antibodies and methods of use
WO2022087149A2 (en) 2020-10-22 2022-04-28 Gilead Sciences, Inc. Interleukin-2-fc fusion proteins and methods of use
WO2022090801A2 (en) 2020-10-26 2022-05-05 Compugen Ltd. Pvrl2 and/or pvrig as biomarkers for treatment
WO2022093981A1 (en) 2020-10-28 2022-05-05 Genentech, Inc. Combination therapy comprising ptpn22 inhibitors and pd-l1 binding antagonists
WO2022090469A2 (en) 2020-10-29 2022-05-05 Formycon Ag Ace2 fusion proteins and uses thereof
WO2022098648A2 (en) 2020-11-04 2022-05-12 Genentech, Inc. Dosing for treatment with anti-cd20/anti-cd3 bispecific antibodies and anti-cd79b antibody drug conjugates
WO2022098628A2 (en) 2020-11-04 2022-05-12 Genentech, Inc. Subcutaneous dosing of anti-cd20/anti-cd3 bispecific antibodies
WO2022098870A1 (en) 2020-11-04 2022-05-12 The Rockefeller University Neutralizing anti-sars-cov-2 antibodies
WO2022098638A2 (en) 2020-11-04 2022-05-12 Genentech, Inc. Dosing for treatment with anti-cd20/anti-cd3 bispecific antibodies
WO2022097060A1 (en) 2020-11-06 2022-05-12 Novartis Ag Cd19 binding molecules and uses thereof
WO2022097065A2 (en) 2020-11-06 2022-05-12 Novartis Ag ANTIBODY Fc VARIANTS
WO2022097061A1 (en) 2020-11-06 2022-05-12 Novartis Ag Anti-cd19 agent and b cell targeting agent combination therapy for treating b cell malignancies
WO2022102634A1 (en) 2020-11-11 2022-05-19 第一三共株式会社 COMBINATION OF ANTIBODY-DRUG CONJUGATE WITH ANTI-SIRPα ANTIBODY
WO2022115451A1 (en) 2020-11-24 2022-06-02 Novartis Ag Mcl-1 inhibitor antibody-drug conjugates and methods of use
WO2022112942A2 (en) 2020-11-24 2022-06-02 Novartis Ag Anti-cd48 antibodies, antibody drug conjugates, and uses thereof
WO2022119976A1 (en) 2020-12-01 2022-06-09 Aptevo Research And Development Llc Heterodimeric psma and cd3-binding bispecific antibodies
WO2022130182A1 (en) 2020-12-14 2022-06-23 Novartis Ag Reversal binding agents for anti-natriuretic peptide receptor 1 (npr1) antibodies and uses thereof
WO2022129120A1 (en) 2020-12-17 2022-06-23 F. Hoffmann-La Roche Ag Anti-hla-g antibodies and use thereof
WO2022127793A1 (en) 2020-12-18 2022-06-23 珠海泰诺麦博生物技术有限公司 Respiratory syncytial virus-specific binding molecule
WO2022135467A1 (en) 2020-12-23 2022-06-30 信达生物制药(苏州)有限公司 Anti-b7-h3 antibody and uses thereof
WO2022140797A1 (en) 2020-12-23 2022-06-30 Immunowake Inc. Immunocytokines and uses thereof
WO2022148732A1 (en) 2021-01-06 2022-07-14 F. Hoffmann-La Roche Ag Combination therapy employing a pd1-lag3 bispecific antibody and a cd20 t cell bispecific antibody
WO2022152656A1 (en) 2021-01-12 2022-07-21 F. Hoffmann-La Roche Ag Split antibodies which bind to cancer cells and target radionuclides to said cells
WO2022152701A1 (en) 2021-01-13 2022-07-21 F. Hoffmann-La Roche Ag Combination therapy
WO2022155324A1 (en) 2021-01-15 2022-07-21 The Rockefeller University Neutralizing anti-sars-cov-2 antibodies
WO2022165275A2 (en) 2021-01-28 2022-08-04 Compugen Ltd. Combination therapy with anti-pvrig antibodies formulations and anti-pd-1-antibodies
WO2022165266A1 (en) 2021-01-28 2022-08-04 Compugen Ltd. Anti-pvrig antibodies formulations and uses thereof
WO2022163846A1 (en) 2021-02-01 2022-08-04 第一三共株式会社 Novel method for producing antibody-immunostimulator conjugate
WO2022169872A1 (en) 2021-02-03 2022-08-11 Genentech, Inc. Multispecific binding protein degrader platform and methods of use
US11866505B2 (en) 2021-02-17 2024-01-09 Prometheus Biosciences, Inc. Anti-CD30L antibodies and uses thereof
WO2022187272A1 (en) 2021-03-01 2022-09-09 Xilio Development, Inc. Combination of masked ctla4 and pd1/pdl1 antibodies for treating cancer
WO2022187270A1 (en) 2021-03-01 2022-09-09 Xilio Development, Inc. Combination of ctla4 and pd1/pdl1 antibodies for treating cancer
WO2022184854A2 (en) 2021-03-03 2022-09-09 Formycon Ag Formulations of ace2 fc fusion proteins
WO2022184082A1 (en) 2021-03-03 2022-09-09 Sorrento Therapeutics, Inc. Antibody-drug conjugates comprising an anti-bcma antibody
WO2022187863A1 (en) 2021-03-05 2022-09-09 Dynamicure Biotechnology Llc Anti-vista constructs and uses thereof
WO2022192898A2 (en) 2021-03-10 2022-09-15 Immunowake Inc. Immunomodulatory molecules and uses thereof
WO2022192647A1 (en) 2021-03-12 2022-09-15 Genentech, Inc. Anti-klk7 antibodies, anti-klk5 antibodies, multispecific anti-klk5/klk7 antibodies, and methods of use
WO2022198192A1 (en) 2021-03-15 2022-09-22 Genentech, Inc. Compositions and methods of treating lupus nephritis
WO2022197877A1 (en) 2021-03-19 2022-09-22 Genentech, Inc. Methods and compositions for time delayed bio-orthogonal release of cytotoxic agents
WO2022204724A1 (en) 2021-03-25 2022-09-29 Dynamicure Biotechnology Llc Anti-igfbp7 constructs and uses thereof
WO2022212645A1 (en) 2021-03-31 2022-10-06 Bioverativ Usa Inc. Reducing surgery-associated hemolysis in cold agglutinin disease patients
WO2022212876A1 (en) 2021-04-02 2022-10-06 The Regents Of The University Of California Antibodies against cleaved cdcp1 and uses thereof
WO2022221720A1 (en) 2021-04-16 2022-10-20 Novartis Ag Antibody drug conjugates and methods for making thereof
WO2022225880A1 (en) 2021-04-19 2022-10-27 Genentech, Inc. Modified mammalian cells
WO2022235867A2 (en) 2021-05-06 2022-11-10 The Rockefeller University Neutralizing anti-sars- cov-2 antibodies and methods of use thereof
WO2022236134A1 (en) 2021-05-07 2022-11-10 Surface Oncology, Inc. Anti-il-27 antibodies and uses thereof
WO2022236335A1 (en) 2021-05-07 2022-11-10 Alpine Immune Sciences, Inc. Methods of dosing and treatment with a taci-fc fusion immunomodulatory protein
WO2022241446A1 (en) 2021-05-12 2022-11-17 Genentech, Inc. Methods of using anti-cd79b immunoconjugates to treat diffuse large b-cell lymphoma
WO2022241082A1 (en) 2021-05-14 2022-11-17 Genentech, Inc. Agonists of trem2
WO2022245671A1 (en) 2021-05-18 2022-11-24 Gilead Sciences, Inc. Methods of using flt3l-fc fusion proteins
WO2022243261A1 (en) 2021-05-19 2022-11-24 F. Hoffmann-La Roche Ag Agonistic cd40 antigen binding molecules targeting cea
WO2022246259A1 (en) 2021-05-21 2022-11-24 Genentech, Inc. Modified cells for the production of a recombinant product of interest
EP4155321A1 (en) 2021-06-04 2023-03-29 Chugai Seiyaku Kabushiki Kaisha Anti-ddr2 antibodies and uses thereof
WO2022263357A1 (en) 2021-06-14 2022-12-22 Argenx Iip Bv Anti-il-9 antibodies and methods of use thereof
WO2022266660A1 (en) 2021-06-17 2022-12-22 Amberstone Biosciences, Inc. Anti-cd3 constructs and uses thereof
WO2022269451A1 (en) 2021-06-22 2022-12-29 Novartis Ag Bispecific antibodies for use in treatment of hidradenitis suppurativa
WO2022270611A1 (en) 2021-06-25 2022-12-29 中外製薬株式会社 Anti–ctla-4 antibody
WO2022270612A1 (en) 2021-06-25 2022-12-29 中外製薬株式会社 Use of anti-ctla-4 antibody
WO2023275621A1 (en) 2021-07-01 2023-01-05 Compugen Ltd. Anti-tigit and anti-pvrig in monotherapy and combination treatments
WO2023279092A2 (en) 2021-07-02 2023-01-05 Genentech, Inc. Methods and compositions for treating cancer
WO2023283611A1 (en) 2021-07-08 2023-01-12 Staidson Biopharma Inc. Antibodies specifically recognizing tnfr2 and uses thereof
WO2023288182A1 (en) 2021-07-12 2023-01-19 Genentech, Inc. Structures for reducing antibody-lipase binding
WO2023284714A1 (en) 2021-07-14 2023-01-19 舒泰神(北京)生物制药股份有限公司 Antibody that specifically recognizes cd40 and application thereof
WO2023288241A1 (en) 2021-07-14 2023-01-19 Genentech, Inc. Anti-c-c motif chemokine receptor 8 (ccr8) antibodies and methods of use
WO2023001884A1 (en) 2021-07-22 2023-01-26 F. Hoffmann-La Roche Ag Heterodimeric fc domain antibodies
WO2023004386A1 (en) 2021-07-22 2023-01-26 Genentech, Inc. Brain targeting compositions and methods of use thereof
WO2023010095A1 (en) 2021-07-28 2023-02-02 F. Hoffmann-La Roche Ag Methods and compositions for treating cancer
WO2023007472A1 (en) 2021-07-30 2023-02-02 ONA Therapeutics S.L. Anti-cd36 antibodies and their use to treat cancer
WO2023011338A1 (en) 2021-08-02 2023-02-09 信达生物制药(苏州)有限公司 Anti-cd79b×cd3 bispecific antibody and use thereof
WO2023012147A1 (en) 2021-08-03 2023-02-09 F. Hoffmann-La Roche Ag Bispecific antibodies and methods of use
WO2023019092A1 (en) 2021-08-07 2023-02-16 Genentech, Inc. Methods of using anti-cd79b immunoconjugates to treat diffuse large b-cell lymphoma
WO2023019239A1 (en) 2021-08-13 2023-02-16 Genentech, Inc. Dosing for anti-tryptase antibodies
WO2023021055A1 (en) 2021-08-19 2023-02-23 F. Hoffmann-La Roche Ag Multivalent anti-variant fc-region antibodies and methods of use
WO2023028591A1 (en) 2021-08-27 2023-03-02 Genentech, Inc. Methods of treating tau pathologies
WO2023034750A1 (en) 2021-08-30 2023-03-09 Genentech, Inc. Anti-polyubiquitin multispecific antibodies
WO2023056362A1 (en) 2021-09-30 2023-04-06 Seagen Inc. B7-h4 antibody-drug conjugates for the treatment of cancer
WO2023056069A1 (en) 2021-09-30 2023-04-06 Angiex, Inc. Degrader-antibody conjugates and methods of using same
WO2023056403A1 (en) 2021-09-30 2023-04-06 Genentech, Inc. Methods for treatment of hematologic cancers using anti-tigit antibodies, anti-cd38 antibodies, and pd-1 axis binding antagonists
WO2023052541A1 (en) 2021-09-30 2023-04-06 Imcheck Therapeutics Combination of an anti-btn3a activating antibody and an il-2 agonist for use in therapy
WO2023064958A1 (en) 2021-10-15 2023-04-20 Compugen Ltd. Combination therapy with anti-pvrig antibodies formulations, anti-tigit antibodies, and anti-pd-1 antibodies
US11774452B2 (en) 2021-11-05 2023-10-03 American Diagnostics & Therapy, LLC Antibodies against carcinoembryonic antigens
WO2023079086A1 (en) 2021-11-05 2023-05-11 Astrazeneca Uk Limited Composition for treatment and prevention of covid-19
WO2023086807A1 (en) 2021-11-10 2023-05-19 Genentech, Inc. Anti-interleukin-33 antibodies and uses thereof
WO2023091887A1 (en) 2021-11-16 2023-05-25 Genentech, Inc. Methods and compositions for treating systemic lupus erythematosus (sle) with mosunetuzumab
WO2023088959A1 (en) 2021-11-16 2023-05-25 Ac Immune Sa Novel molecules for therapy and diagnosis
WO2023091968A1 (en) 2021-11-17 2023-05-25 Disc Medicine, Inc. Methods for treating anemia of kidney disease
WO2023094507A1 (en) 2021-11-24 2023-06-01 Formycon Ag Improved ace2 fusion proteins
WO2023094571A1 (en) 2021-11-25 2023-06-01 Formycon Ag Stabilization of ace2 fusion proteins
WO2023114829A1 (en) 2021-12-15 2023-06-22 Genentech, Inc. Stabilized il-18 polypeptides and uses thereof
WO2023117834A1 (en) 2021-12-20 2023-06-29 F. Hoffmann-La Roche Ag Agonistic ltbr antibodies and bispecific antibodies comprising them
WO2023131901A1 (en) 2022-01-07 2023-07-13 Johnson & Johnson Enterprise Innovation Inc. Materials and methods of il-1beta binding proteins
WO2023139107A1 (en) 2022-01-18 2023-07-27 argenx BV Galectin-10 antibodies
WO2023141445A1 (en) 2022-01-19 2023-07-27 Genentech, Inc. Anti-notch2 antibodies and conjugates and methods of use
WO2023147399A1 (en) 2022-01-27 2023-08-03 The Rockefeller University Broadly neutralizing anti-sars-cov-2 antibodies targeting the n-terminal domain of the spike protein and methods of use thereof
WO2023168352A1 (en) 2022-03-03 2023-09-07 Yale University Humanized 3e10 antibodies, variants, and antigen binding fragments thereof
WO2023172883A1 (en) 2022-03-07 2023-09-14 Alpine Immune Sciences, Inc. Immunomodulatory proteins of variant cd80 polypeptides, cell therapies thereof and related methods and uses
WO2023173026A1 (en) 2022-03-10 2023-09-14 Sorrento Therapeutics, Inc. Antibody-drug conjugates and uses thereof
WO2023178192A1 (en) 2022-03-15 2023-09-21 Compugen Ltd. Il-18bp antagonist antibodies and their use in monotherapy and combination therapy in the treatment of cancer
WO2023178357A1 (en) 2022-03-18 2023-09-21 Evolveimmune Therapeutics, Inc. Bispecific antibody fusion molecules and methods of use thereof
EP4245374A2 (en) 2022-03-18 2023-09-20 Compugen Ltd. Pvrl2 and/or pvrig as biomarkers for treatment
WO2023186756A1 (en) 2022-03-28 2023-10-05 F. Hoffmann-La Roche Ag Interferon gamma variants and antigen binding molecules comprising these
WO2023187657A1 (en) 2022-03-30 2023-10-05 Novartis Ag Methods of treating disorders using anti-natriuretic peptide receptor 1 (npr1) antibodies
WO2023191816A1 (en) 2022-04-01 2023-10-05 Genentech, Inc. Dosing for treatment with anti-fcrh5/anti-cd3 bispecific antibodies
WO2023201299A1 (en) 2022-04-13 2023-10-19 Genentech, Inc. Pharmaceutical compositions of therapeutic proteins and methods of use
WO2023209177A1 (en) 2022-04-29 2023-11-02 Astrazeneca Uk Limited Sars-cov-2 antibodies and methods of using the same
WO2023215737A1 (en) 2022-05-03 2023-11-09 Genentech, Inc. Anti-ly6e antibodies, immunoconjugates, and uses thereof
WO2023217743A1 (en) 2022-05-10 2023-11-16 Imcheck Therapeutics Anti-btn3a antibodies for use in methods of treating gastro-intestinal inflammatory disorders
WO2023217933A1 (en) 2022-05-11 2023-11-16 F. Hoffmann-La Roche Ag Antibody that binds to vegf-a and il6 and methods of use
WO2023219613A1 (en) 2022-05-11 2023-11-16 Genentech, Inc. Dosing for treatment with anti-fcrh5/anti-cd3 bispecific antibodies
WO2023240058A2 (en) 2022-06-07 2023-12-14 Genentech, Inc. Prognostic and therapeutic methods for cancer
WO2023239803A1 (en) 2022-06-08 2023-12-14 Angiex, Inc. Anti-tm4sf1 antibody-drug conjugates comprising cleavable linkers and methods of using same
WO2023237928A2 (en) 2022-06-10 2023-12-14 Horizon Therapeutics Ireland Dac Igf1r antibodies
WO2023242362A1 (en) 2022-06-15 2023-12-21 argenx BV Fcrn/antigen-binding molecules and methods of use
WO2023242372A1 (en) 2022-06-15 2023-12-21 argenx BV Fcrn/hsa binding molecules and methods of use
WO2023245048A1 (en) 2022-06-15 2023-12-21 Bioverativ Usa Inc. Anti-complement c1s antibody formulation
WO2023242361A1 (en) 2022-06-15 2023-12-21 argenx BV Fcrn binding molecules and methods of use
WO2023250507A1 (en) 2022-06-24 2023-12-28 Bioverativ Usa Inc. Methods for treating complement-mediated diseases
WO2024015897A1 (en) 2022-07-13 2024-01-18 Genentech, Inc. Dosing for treatment with anti-fcrh5/anti-cd3 bispecific antibodies
WO2024020407A1 (en) 2022-07-19 2024-01-25 Staidson Biopharma Inc. Antibodies specifically recognizing b- and t-lymphocyte attenuator (btla) and uses thereof
WO2024020432A1 (en) 2022-07-19 2024-01-25 Genentech, Inc. Dosing for treatment with anti-fcrh5/anti-cd3 bispecific antibodies
WO2024020579A1 (en) 2022-07-22 2024-01-25 Bristol-Myers Squibb Company Antibodies binding to human pad4 and uses thereof
WO2024020564A1 (en) 2022-07-22 2024-01-25 Genentech, Inc. Anti-steap1 antigen-binding molecules and uses thereof
WO2024026496A1 (en) 2022-07-28 2024-02-01 Compugen Ltd. Combination therapy with anti-pvrig antibodies formulations and anti-pd-1 antibodies
WO2024028732A1 (en) 2022-08-05 2024-02-08 Janssen Biotech, Inc. Cd98 binding constructs for treating brain tumors
WO2024028731A1 (en) 2022-08-05 2024-02-08 Janssen Biotech, Inc. Transferrin receptor binding proteins for treating brain tumors
WO2024037633A2 (en) 2022-08-19 2024-02-22 Evive Biotechnology (Shanghai) Ltd Formulations comprising g-csf and uses thereof
WO2024044675A1 (en) 2022-08-25 2024-02-29 Beigene, Ltd. Methods of cancer treatment using anti-pd1 antibodies in combination with anti-tim3 antibodies
WO2024049949A1 (en) 2022-09-01 2024-03-07 Genentech, Inc. Therapeutic and diagnostic methods for bladder cancer
WO2024054929A1 (en) 2022-09-07 2024-03-14 Dynamicure Biotechnology Llc Anti-vista constructs and uses thereof
WO2024052503A1 (en) 2022-09-08 2024-03-14 Institut National de la Santé et de la Recherche Médicale Antibodies having specificity to ltbp2 and uses thereof
WO2024074498A1 (en) 2022-10-04 2024-04-11 Imcheck Therapeutics Combination of a btn3a activating antibody, a bcl2 inhibitor and hypomethylating agent for use in treating cancer
WO2024077018A2 (en) 2022-10-04 2024-04-11 Alpine Immune Sciences, Inc. Methods and uses of taci-fc fusion immunomodulatory protein
WO2024077239A1 (en) 2022-10-07 2024-04-11 Genentech, Inc. Methods of treating cancer with anti-c-c motif chemokine receptor 8 (ccr8) antibodies

Also Published As

Publication number Publication date
JPH08511420A (en) 1996-12-03
AU691811B2 (en) 1998-05-28
AU6934194A (en) 1995-01-03
WO1994029351A3 (en) 1994-12-22
EP0714409A1 (en) 1996-06-05
CA2163345A1 (en) 1994-12-22

Similar Documents

Publication Publication Date Title
AU691811B2 (en) Antibodies
EP0715653B1 (en) Humanised antibodies
AU2004283135B2 (en) Antibodies having a mutated amino acid residue at position 268 (CH2 region) in constant regions
US5834597A (en) Mutated nonactivating IgG2 domains and anti CD3 antibodies incorporating the same
CA2212750C (en) Humanized antibodies against cd3
CN116333133A (en) anti-GPRC 5D antibodies, bispecific antigen binding molecules binding GPRC5D and CD3 and uses thereof
US20020032312A1 (en) Therapeutic compounds comprised of anti-fc receptor antibodies
EP1362868A2 (en) Humanized and chimeric monoclonal antibodies that bind epidermal growth factor receptor (EGF-R)
PL180157B1 (en) Humanised antibodies and their application
JP2004000249A (en) Preparation of antibody
AU2004245038A1 (en) De-immunized anti-CD3 antibody
CA2295604C (en) Lo-cd2a antibody and uses thereof for inhibiting t cell activation and proliferation
US5730979A (en) LO-CD2a antibody and uses thereof for inhibiting T cell activation and proliferation
AU2002226086C1 (en) Silensed anti-CD28 antibodies and use thereof
JP2001521374A (en) LO-CD2a antibody inhibiting T cell activation and proliferation and use thereof
JP4808841B2 (en) LO-CD2a antibodies that inhibit T cell activation and proliferation and methods of use thereof
AU778551B2 (en) Novel peptide and screening method by using the same
JP2024508048A (en) Preparation of Siglec-15 binding protein and its use

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AT AU BB BG BR BY CA CH CN CZ DE DK ES FI GB GE HU JP KE KG KP KR KZ LK LU LV MD MG MN MW NL NO NZ PL PT RO RU SD SE SI SK TJ TT UA US UZ VN

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
WWE Wipo information: entry into national phase

Ref document number: 2163345

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 1994917750

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 1996 564250

Country of ref document: US

Date of ref document: 19960212

Kind code of ref document: A

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWP Wipo information: published in national office

Ref document number: 1994917750

Country of ref document: EP

WWW Wipo information: withdrawn in national office

Ref document number: 1994917750

Country of ref document: EP