WO1995005465A1 - Erythropoietin analogs - Google Patents
Erythropoietin analogs Download PDFInfo
- Publication number
- WO1995005465A1 WO1995005465A1 PCT/US1994/009257 US9409257W WO9505465A1 WO 1995005465 A1 WO1995005465 A1 WO 1995005465A1 US 9409257 W US9409257 W US 9409257W WO 9505465 A1 WO9505465 A1 WO 9505465A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- thr
- asn
- epo
- erythropoietin
- ser
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/475—Growth factors; Growth regulators
- C07K14/505—Erythropoietin [EPO]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- A61K38/18—Growth factors; Growth regulators
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P7/00—Drugs for disorders of the blood or the extracellular fluid
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P7/00—Drugs for disorders of the blood or the extracellular fluid
- A61P7/06—Antianaemics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
Definitions
- the present invention relates to erythropoietin analogs having at least one additional site for glycosylation or a rearrangement of at least one site for glycosylation.
- the invention also relates to DNA sequences encoding said erythropoietin analogs, and recombinant plasmids and host cells for analog expression.
- Erythropoietin is a glycoprotein hormone involved in the maturation of erythroid progenitor cells into erythrocytes. It is essential in regulating levels of red blood cells in circulation. Naturally occurring erythropoietin is produced by the liver during fetal life and by the kidney of adults and circulates in the blood and stimulates the production of red blood cells in bone marrow. Anemia is almost invariably a
- glycosylation can dramatically affect the physical properties of proteins and can also be important in protein stability, secretion, and
- Glycosylation occurs at specific locations along the polypeptide backbone and is usually of two types: O-linked oligosaccharides are attached to serine or threonine residues while N-linked oligosaccharides are attached to asparagine residues when they are part of the sequence Asn-X-Ser/Thr, where X can be any amino acid except proline.
- the structures of N-linked and O-linked oligosaccharides and the sugar residues found in each type are different.
- One type of sugar that is commonly found on both is N-acetylneuraminic acid
- Sialic acid is usually the terminal residue of both N-linked and
- O-linked oligosaccharides and, by virtue of its negative charge, may confer acidic properties to the
- glycoprotein glycoprotein
- Both human urinary derived erythropoietin and recombinant erythropoietin (expressed in mammalian cells) having the amino acid sequence 1-165 of human erythropoietin contain three N-linked and one O-linked oligosaccharide chains which together comprise about 40% of the total molecular weight of the glycoprotein.
- N-linked glycosylation occurs at asparagine residues located at positions 24, 38 and 83 while O-linked glycosylation occurs at a serine residue located at position 126 (Lai et al. J. Biol. Chem. 261, 3116
- Enzymatic treatment of glycosylated erythropoietin to remove all sialic acid residues results in a loss of in vivo activity but does not affect in vitro activity
- Glycoproteins such as erythropoietin can be separated into different charged forms using techniques such as isoelectric focusing (IEF) .
- IEF isoelectric focusing
- erythropoietin having a defined sialic acid content and biological activity.
- Pharmaceutical compositions containing such molecules would have therapeutic benefit.
- glycosylation The added sites for glycosylation may result in a greater number of carbohydrate chains, and higher sialic acid content, than human erythropoietin.
- Erythropoietin analogs comprising amino acid sequences which include the rearrangement of at least one site for glycosylation are also provided.
- Analogs comprising an addition of one or more amino acids to the carboxy terminal end of erythropoietin wherein the addition provides at least one glycosylation site are also included.
- the invention further encompasses DNA
- Figure 1 shows an analytical isoelectric focusing gel of the separate recombinant erythropoietin isoforms.
- Gel lanes 1-11 show isoforms ranging from less acidic (higher pi) in lane 1 to more acidic (lower pI), in lane 11.
- Purified recombinant erythropoietin containing a mixture of isoforms 9-14 is also shown in the far left and right lanes of the gel.
- Figure 2 shows the relationship between the number of sialic acids per erythropoietin isoform and the in vivo specific activity of each isoform expressed as units per mg of erythropoietin polypeptide.
- Figure 3 shows an analytical isoelectric focusing gel of defined mixtures of recombinant
- erythropoietin isoforms prepared by anion exchange chromatography under different conditions.
- Gel lanes 1-6 represent, respectively, erythropoietin isoforms eluted in a high salt wash after washing the Q-Sepharose fast flow column with 150 mM acetic acid, pH 4.7, 150 mM acetic acid (unbuffered), 200 mM acetic acid, pH 4.7, 250 mM acetic acid, pH 4.7, 300 mM acetic acid, pH 4.7 or 300 mM acetic acid (unbuffered).
- 150 mM acetic acid pH 4.7, 150 mM acetic acid (unbuffered)
- 200 mM acetic acid pH 4.7, 250 mM acetic acid, pH 4.7, 300 mM acetic acid, pH 4.7 or 300 mM acetic acid (unbuffered).
- erythropoietin isoforms 8 to 12 achieved by subjecting cell conditioned medium applied to a column of
- Figure 5 shows the amino acid sequence of human erythropoietin. Squares indicate asparagine residues to which N-linked carbohydrate chains are attached and an asterisk indicates the serine residue modified with an O-linked carbohydrate chain.
- Figures 6A, 6B, and 6C show the series of cloning steps used in generating plasmids for the construction and analysis of analogs of human
- Figure 7 shows a Western blot analysis of COS cell supernatants of human sequence erythropoietin and indicated erythropoietin analogs.
- the analogs [Asn 9 , Serli] EPO, [Asn 69 ] EPO, [Asn 125 , Ser 127 ] EPO, and
- Figure 8 shows a Western blot analysis of COS cell supernatants of human sequence erythropoietin and indicated erythropoietin analogs after treatment with N-glycanase.
- Thr 125 ] EPO were constructed as described in Example 6. The analogs [Val 126 ] EPO, [Pro 124 ] EPO, [Pro 125 ] EPO, [Thr 127 ] EPO, [Pro 125 , Ser 127 ] EPO and [Thr 125 , Ser 127 ] EPO are shown for comparison.
- Figure 9 shows an isoelectric focusing gel of pools 2, 3 and 4 obtained by Q-Sepharose and C4 reverse phase chromatography of cell medium that supported the growth of CHO cells transfected with erythropoietin cDNA containing the [Thr 125 ] mutation.
- Purified recombinant erythropoietin containing a mixture of isoforms were obtained using procedures described in Example 2 of Lai et al., supra, except that DEAE-Agarose chromatography is replaced by Q-Sepharose chromatography, is also shown in the left and right lanes of the gel.
- Figure 10 shows a Western blot analysis of COS cell supernatants of recombinant human erythropoietin (rHuEPO) and selected analogs. The construction of the analogs is described in Example 6. Analogs N9, N14, N18, N19, N21, N24 and N39 have at least one additional carbohydrate chain as evidenced by slower gel mobility.
- Figure 11 shows a Western blot analysis of COS cell supernatants of recombinant human erythropoietin and EPO N14 analog during N-glycanase digestion. Time points were taken at 0, 4, 12 and 45 minutes and after overnight digestion.
- Figure 12 shows an isoelectric focusing gel of
- EPO N14 analog isoform preparations The low isoform pool contains EPO N14 analog having mostly 6-12 sialic acids per molecule, the medium isoform pool contains analog N14 having mostly 10-15 sialic acids per
- the high isoform pool contains EPO N14 analog having mostly 12-17 sialic acids per molecule.
- Figure 13 shows the pharmacokinetics of recombinant human erythropoietin, isolated isoform 14 and EPO N14 analog (isoforms 15-17) after intravenous injection into rats.
- Figure 14 shows a cold displacement assay of 125 I labeled recombinant human erythropoietin binding to the erythropoietin receptor in the presence of varying amounts of unlabeled rHuEPO, isolated isoform 14 or EPO N14 analog.
- Figure 15 shows a mouse hematocrit study comparing the activity of EPO N14 high isoform pool (0.036 and 0.0712 ⁇ g), isolated isoform 14 (0.036 and 0.0712 ⁇ g), EPO 177 low isoform pool (0.0712 ⁇ g) and rHuEPO (0.071 ⁇ g).
- the subject invention provides erythropoietin isoforms.
- the specific isoforms of erythropoietin obtained in accordance with the present invention, and their properties, may vary depending upon the source of the starting material.
- the isoforms of urinary derived human erythropoietin are different than the isoforms of recombinant erythropoietin.
- the invention relates to an erythropoietin isoform having a specific number (i.e. a fixed number greater than 0) of sialic acids per erythropoietin molecule, said number selected from the group consisting of 1-14.
- a specific number i.e. a fixed number greater than 0
- sialic acids per erythropoietin molecule said number selected from the group consisting of 1-14.
- said number is 9, 10, 11, 12, 13, or 14.
- said number is greater than 14, advantageously 16-23.
- erythropoietin isoform refers to erythropoietin preparations having a single isoelectric point (pI), and having the same amino acid sequence.
- erythropoietin includes naturally occurring erythropoietin, urinary derived human erythropoietin as well as nonnaturally occurring polypeptides having an amino acid sequence and glycosylation sufficiently duplicative of that of naturally occurring erythropoietin to allow possession of in vivo biological properties of causing bone marrow cells to increase production of
- erythropoietin corresponds to erythropoietin molecules having from 1-14 sialic acids, and each isoform present in purified recombinant erythropoietin has an in vivo activity which is related to the number of sialic acids the isoform possesses.
- erythropoietin is the product of the expression of an exogenous DNA sequence that has been transfected into a non-human eucaryotic host cell, that is, in a preferred embodiment the erythropoietin is "recombinant erythropoietin".
- Recombinant erythropoietin is advantageously produced according to the procedures described in commonly owned Lin U.S. Patent 4,703,008 hereby incorporated by
- Recombinant erythropoietin can be purified according to the general procedures described in
- Erythropoietin purified according to Example 2 of Lai et al. supra contains predominantly six isoforms when analyzed by IEF.
- Example 4 (This more acidic form, migrating at >14 sialic acids on an IEF gel may contain nonsialic acid negative charges as shown by the resistance of some of the charge to sialidase digestion). These isoforms differ from each other by sialic acid content. As shown in the Examples, this is demonstrated by isolating 10 of these isoforms by preparative IEF and determining the sialic acid content of five of them. Of the isoforms assayed for sialic acid content, it is found that the five isoforms contained either 9, 10, 11, 12 or 13 sialic acid residues.
- Isoforms 5 through 11 There is a relationship between the relative in vivo specific activity of erythropoietin and number of sialic acid residues per erythropoietin molecule from the isoforms 5 through 11 (each isoform is designated herein by the number of sialic acids per erythropoietin molecule). Isoforms 11 through 14 have approximately the same relative in vivo specific activity. Isoforms 5-14 were assayed for in vivo activity by the exhypoxic polycythemic mouse bioassay and the amount of each isoform present is determined by Bradford protein assay, absorbance at 280 nm or by radioimmunoassay (RIA) for erythropoietin. RIA determinations (Egrie et al.
- polypeptide the average specific activity of purified erythropoietin as determined by RIA, to give protein concentrations of isolated isoforms or isoform mixtures expressed as mg erythropoietin polypeptide/ml.
- erythropoietin polypeptide/ml the average specific activity of purified erythropoietin as determined by RIA
- the in vivo specific activities referred to herein are measurements of relative in vivo specific activities and are not measurements of absolute in vivo specific activities. For the purposes of this
- the specific activities are used only to compare relative activities of isoforms that have been assayed using the same assay, using the same conditions including the same internal standard, the same type of animals, having the same analysis of the data used to calculate specific activity, the same assay for
- compositions comprising two or more erythropoietin isoforms.
- the compositions comprise a mixture of isoforms having greater than a predetermined number of sialic acids per erythropoietin molecule, e.g. greater than 11 sialic acids per erythropoietin molecule, or greater than 12 sialic acids per molecule, e . g . a mixture of isoforms 12, 13 and 14.
- compositions comprise mixtures of isoforms having a predetermined number of sialic acids per erythropoietin molecule, e .g. less than 12, but greater than 8 sialic acids per molecule as in, for example, a mixture of isoforms 9, 10, and 11 .
- the invention also provides for compositions of
- erythropoietin isoforms wherein the relative amounts of the isoforms are the same or different .
- a mixture of isoforms 9, 10 and 11 could have the isoforms present in a variety of ratios such as 1 : 1 : 1 , 2 : 3 : 1 or 20 : 20 : 1.
- compositions comprise mixtures of less than four isoforms, for example a mixture of isoforms 11, 12, and 13, or a mixture of 12 and 14, or a mixture of 7 and 13.
- this invention also provides methods of isolating selected erythropoietin isoforms
- ion exchange chromatography and chromatofocusing involve application of either crude human erythropoietin (cell conditioned media) or
- the protein it is preferable to apply the protein to the column at about pH 7 while for purified preparations the protein can be applied to the column at pH 7 down to about pH 4 . After washing the column with buffer at about pH 4 , those erythropoietin isoforms that remain bound on the ion exchange column are eluted by
- the isoforms are eluted from the column by a gradient of decreasing pH or by washing the column with a high concentration of salt .
- individual isoforms are isolated using ion exchange chromatography .
- isoform 14 was isolated using ion exchange chromatography as described in Example 8.
- analogs of human erythropoietin refers to erythropoietin with one or more changes in the amino acid sequence of human erythropoietin which result in an increase in the number of sites for sialic acid
- Analogs are generated by site-directed mutagenesis having additions, deletions, or
- Such analogs may have a greater number of carbohydrate chains than human erythropoietin .
- the erythropoietin analogs of the present invention comprise an amino acid sequence which includes at least one additional site for glycosylation .
- Analogs having levels of sialic acid greater than those found in human erythropoietin are generated by adding
- glycosylation sites which do not perturb the secondary or tertiary conformation required for biological
- erythropoietin has 1, 2 or 3 additional sites for N-glycosylation or O-glycosylation, resulting in the addition of 1, 2, or 3 additional N-linked or O-linked carbohydrate chains.
- a leucine at position 69 is replaced by an asparagine to give the sequence Asn-Leu-Ser, which serves as a fourth site for
- N-glycosylation Such a change can commonly provide up to four additional sialic acids per molecule.
- Examples of changes that generate additional O-glycosylation sites are alanine at position 125 to threonine and alanines at positions 124 and 125 to proline and threonine, respectively.
- Analogs may be constructed which have one or more additional N-linked and O-linked chains, for example, analogs NO1 and N02 described in Table 5.
- the subject invention includes many other analogs of human erythropoietin having additional sites for glycosylation.
- Analogs having increased levels of carbohydrate attachment at a glycosylation site are also encompassed by the invention. Such analogs usually involve the substitution of one or more amino acids which are in close proximity to an N-linked or O-linked site. As a result of these amino acid changes, a greater proportion of erythropoietin polypeptides will have a carbohydrate modification.
- the glycosylation sites may be naturally occurring or generated by
- analog N13 does not generate an additional carbohydrate chain even though a
- glycosylation site was introduced at position 88.
- analogs N14 and N18 which have serine and valine residues, respectfully, substituted at position 87, have an additional carbohydrate chain at position 88.
- analogs which have one or more amino acids extending from the carboxy terminal end of erythropoietin and wherein the carboxy terminal extension provides at least one
- an analog was constructed by fusing the carboxy-terminal 28 amino acids of human chorionic gonadotropin (HCG) to the arginine residue at position 166 of human
- HCG carboxy-terminal fragment has four sites for O-glycosylation (Kessler et al., J. Biol. Chem. 254, 7907 (1979)).
- Tables 3, 4 and 5 list erythropoietin analogs which have additional sites for N-linked and/or O-linked carbohydrate chains.
- the analogs have the sequence Asn-X-Ser/Thr substituted at various positions in the human erythropoietin polypeptide chain to create
- Table 6 lists those analogs which add at least one additional N-linked or one additional O-linked carbohydrate chain, or add additional N-linked and
- the erythropoietin analogs of the present invention also encompass erythropoietin having an amino acid sequence which includes a rearrangement of at least one site for glycosylation.
- a rearrangement of a glycosylation site as used herein refers to the deletion of one or more glycosylation sites in human
- Analogs R1, R2 and R3 are examples of such rearrangements and were constructed by deletion of the N-linked sites at positions 24, 38 or 83, respectively, and addition of an N-linked site at position 88.
- carbohydrate site rearrangements are possible and the resulting analogs may or may not have a greater number of glycosylation sites compared to human erythropoietin.
- positions of carbohydrate chains in erythropoietin may be changed in order to generate useful analogs without significantly affecting the biological activity.
- erythropoietin analogs can be the product of expression of an exogenous DNA sequence, i.e., produced through recombinant DNA technology, or can be synthesized products.
- An exogenous DNA sequence comprises cDNA, genomic DNA or chemically synthesized DNA encoding an erythropoietin analog.
- Recombinant DNA plasmids and eucaryotic host cells useful for the expression of said analogs are also provided.
- Expression vectors include any vector which is capable of expressing cloned DNA sequences in a eucaryotic host cell, particularly those vectors used for expression in COS and CHO cells. Examples of such vectors include plasmids pEC and pDEC ⁇ described in Example 6 of the specification. The cultivation of COS and CHO host cells expressing erythropoietin analogs was carried out using procedures known to one skilled in the art.
- Isolated isoforms and mixtures, of isoforms derived from erythropoietin analogs are obtained using the methods described above for preparing isoforms of human erythropoietin. These methods may include isoelectric focusing, ion exchange chromatography and chromatofocusing. Preferably, ion exchange
- Another embodiment of the invention relates to mammalian (e.g., Chinese Hamster Ovary, CHO) host cells which preferentially synthesize isoforms of human erythropoietin or erythropoietin analogs having greater than a specific number of sialic acids per molecule, e.g. greater than 10 sialic acids per molecule.
- mammalian e.g., Chinese Hamster Ovary, CHO
- Erythropoietin molecules have N-linked and O-linked oligosaccharides structures which can limit the sialic acid content of the molecule. For example,
- tetraantennary four-branched N-linked oligosaccharides most commonly provide four possible sites for sialic acid attachment while bi- and triantennary
- oligosaccharide chains which can substitute for the tetraantennary form at asparagine-linked sites, commonly have at most only two or three sialic acids attached.
- O-linked oligosaccharides commonly provide two sites for sialic acid attachment.
- erythropoietin molecules can accommodate a total of 14 sialic acid residues provided all three N-linked oligosaccharides are
- tetraantennary Mammalian cell cultures are screened for those cells that preferentially add tetraantennary chains to recombinant erythropoietin, thereby maximizing the number of sites for sialic acid attachment.
- the N-linked oligosaccharides of urinary erythropoietin contain sialic acid in both an ⁇ 2,3 and an ⁇ 2,6 linkage to galactose (Takeuchi et al. J. Biol. Chem. 263, 3657(1988)).
- sialic acid in the ⁇ 2,3 linkage is added to galactose on the mannose ⁇ 1, 6 branch and the sialic acid in the ⁇ 2,6 linkage i's added to the galactose on the mannose ⁇ 1,3 branch.
- the enzymes that add these sialic acids ⁇ -galactoside ⁇ 2,3 sialyltransferase and ⁇ -galactoside ⁇ 2, 6
- sialyltransferase are most efficient at adding sialic acid to the mannose ⁇ 1,6 and mannose ⁇ 1,3 branches respectively.
- DHFR Dihydrofolate reductase
- Chinese Hamster Ovary (CHO) cells are a commonly used host cell for the production of recombinant glycoproteins including recombinant erythropoietin.
- recombinant erythropoietin produced in CHO cells lacks sialic acid in the 2,6 linkage to galactose (Sasaki et al. (1987), supra; Takeuchi et al. (1987), supra).
- human erythropoietin or an erythropoietin analog is produced in CHO cells that are transfected with a functional ⁇ -galactoside ⁇ 2, 6 sialyltransferase gene to give incorporation of sialic acid in ⁇ 2,6 linkage to galactose.
- the resulting isoforms will contain sialic acid having both ⁇ 2,3 and ⁇ 2,6 linkages to galactose. See Lee et al. J. Biol. Chem. 264, 13848 (1989), hereby incorporated by reference, for a
- compositions comprising a therapeutically effective amount of a specific isoform or mixture of isoforms together with a suitable diluent, adjuvant and/or carrier useful in erythropoietin therapy.
- compositions comprising a therapeutically effective amount of an erythropoietin analog together with a suitable diluent, adjuvant and/or carrier are also encompassed.
- a "therapeutically effective amount” as used herein refers to that amount which provides therapeutic effect for a given condition and
- the administration of isoforms of human erythropoietin or erythropoietin analogs is preferably by parenteral routes. The specific route chosen will depend upon the condition being treated.
- the administration of isoforms of human erythropoietin or erythropoietin analogs is preferably done as part of a formulation containing a suitable carrier, such as human serum albumin, a suitable diluent, such as a buffered saline solution, and/or a suitable adjuvant.
- a suitable carrier such as human serum albumin
- a suitable diluent such as a buffered saline solution
- the required dosage will be in amounts sufficient to raise the hematocrit of patients and will vary depending upon the severity of the condition being treated, the method of administration used and the like.
- erythropoietin standard used in the in vivo bioassays employed in the Examples is a recombinant erythropoietin standard that was standardized against a partially purified urinary erythropoietin standard.
- erythropoietin standard used in the in vivo bioassays employed in the Examples.
- the in vivo specific activities are expressed in "units/ml", “units/mg” and units/A 280 " and not as
- IU/ml "IU/mg” and IU/A 280 " because the erythropoietin standard employed has not been directly correlated to any existing international standard.
- Example 1 Isolation of Recombinant Erythropoietin Isoforms
- Recombinant erythropoietin is produced as described in Lin, supra.
- Recombinant erythropoietin used as starting material for the first and third isoform isolations is purified according to the
- the sixth isoform preparation used as its starting material a purified preparation of recombinant erythropoietin having from 4 to 13 sialic residues.
- This material was purified as per Example 2 of Lai et al. except for a modification to the ion exchange column (elution of the recombinant erythropoietin with a sodium chloride gradient at pH 8.4 and omission of the acetic acid/urea wash) which results in retention of most of the isoforms present in the starting material.
- the first preparation approximately 20 mg of recombinant erythropoietin in 6.8 ml of 20 mM sodium citrate/ 100 mM sodium chloride, pH 7.0 are applied to the gel and focused at 8 watts for approximately 16 hours. After isoelectric focusing, the isoform bands in the gel are visualized by a paper contact print of the gel bed.
- the print is made and then fixed by soaking in 3 changes (approximately 10 minutes each, room temperature) of fixing solution (40% methanol/10% acetic acid/10% TCA/3.5% sulfosalicylic acid), subjected to one change (approximately 10 minutes) of 40% methanol/10% acetic acid (30-60°C), stained for 15 minutes at 60°C in 0.125% Coomassie Blue R-250/40% methanol/10% acetic acid, and then destained in 7.5% methanol/10% acetic acid in order to visualize the separated isoforms.
- fixing solution 50% methanol/10% acetic acid/10% TCA/3.5% sulfosalicylic acid
- the region of the granulated gel bed containing the isoforms ( ⁇ 50% of the resin) is removed, water is added ( ⁇ 16 ml), and the slurry is poured into a 5.5 ⁇ 24.5 inch tray and evaporated to -40 g net weight. This preparation is focused for a second time and a contact print of the gel bed is made as before. The portion of gel containing each of the six discernible isoforms is removed from the gel bed.
- erythropoietin in 21.8 ml of distilled water is applied to the gel and focused at 2 watts for 25 minutes, 10 watts for 20 hours and 15 watts for 15 minutes. Protein bands corresponding to the individual isoforms are observed visually and removed from the gel bed. Distilled water is added to gel-isolated isoforms to generate a slurry and the resulting supernatants are analyzed by analytical isoelectric focusing. An equal volume of 1 M Tris-HCl, pH 7.2 is added to each slurry, the suspensions are placed into separate small columns, and the liquid phase is allowed to flow through the column to elute the isoforms. Each flow through is concentrated and buffer exchanged to 20 mM sodium citrate/ 100 mM sodium chloride, pH 7.0 using Amicon disposable ultrafiltration devices having a 10,000 dalton molecular weight cutoff. An analytical
- isoelectric focusing gel revealed that pools containing predominantly the single isoforms 9, 10, 11, 12, 13 and 14 were obtained.
- a fourth isoform preparation used as its starting material erythropoietin containing isoforms 3-9 (prepared as described above). Prior to preparative isoelectric focusing carried out essentially as
- ampholytes (Pharmalyte 2.5-5) were pre-fractionated in a Rotofor (Bio-Rad, Richmond, CA) liquid phase isoelectric
- the prefractionation was carried out by mixing 6.7 mL of Pharmalyte 2.5-5 with 15 g of urea and adding purified water to bring the volume to 50 mL.
- Ampholytes were removed from the isoforms using a Centrieluter (Amicon, Danvers, MA) and a
- the isoforms were then buffer exchanged into 0.1 M sodium chloride by gel filtration using Sephadex G-25 (Pharmacia). Analytical isoelectric focusing of the five resulting pools showed them to contain isoforms 4,5,6,7, and 8. Isoform 4 ran as several bands, indicating that it may have undergone some degradation.
- the fifth isoform preparation was modified by the addition of a pre-focusing step to the flat bed isoelectric focusing procedure. In this modification, the protein was not added to the ampholyte/urea/gel mixture prior to electrophoresis but was added to the isoelectric focusing apparatus following generation of the pH gradient in the gel bed.
- the pre-focusing modification was undertaken to make the ultraviolet absorbance characteristics of the isoform preparations more similar to that of the starting recombinant erythropoietin. This improvement in spectral characteristics can be seen in the ratio of absorbance at 280 and 260 nm for the isolated isoforms.
- the average ratio of absorbance at 280 nm to that at 260 nm (A 280 /A 260 ) for isoforms from preparations 2 and 3 (non-prefocused) is 1.36 ⁇ 0.11 while the average
- a 280 /A 260 ratio for preparations 5 and 6 is 1.68 ⁇ 0.20.
- the average A 280 /A 260 ratios are 1.39 ⁇ 0. 11 and 1 .74 ⁇ 0.09 for preparations 2 & 3 and 5 & 6, respectively.
- Isoform 14 may have the most atypical spectrum because it is present in the smallest amounts and is thus more subject to interferences by trace contamination by ampholyte components or because it is nearest to the electrode during the flat bed isoelectric focusing procedure).
- Example 2 of Lai et al. (modified as described earlier by using Q-Sepharose as the anion exchange resin) is 1.91 ⁇ 0.04.
- the starting material for isoform preparation #6 was a recombinant erythropoietin preparation containing isoforms 4-13.
- the ampholytes were pre-focused in the Rotofor apparatus as per the fourth preparation. Ampholyte fractions having measured pHs of between 3.7 and 4.8 were used for the flat bed isoelectric focusing.
- the flat bed was pre-focused as in run #5 and isoforms 9,10,11,12 and 13 were obtained after ultrafiltration (Centricon-10) to remove carrier ampholytes.
- sialic acid residues are cleaved from the glycoproteins by hydrolysis with 0.35 M sulfuric acid at 80°C for 30 minutes and the solutions are neutralized with sodium hydroxide prior to analysis. In order to estimate the amount of
- Isoforms are designated according to the number of sialic acids per molecule and range from least acidic (Isoform 9) to most acidic (Isoform 13). Isoforms 9-13 are shown in gel lanes 6-10 of Figure 1. Quantities of Isoform 14 are insufficient to accurately measure the sialic acid content.
- the sialic acid content of this isoform is inferred from its migration on IEF gels relative to other isoforms.
- the sialic acid content of isoforms 5-8 (preparation #4) has not been measured but is likewise inferred from their migration on IEF gels.
- the isoforms isolated as described in Example 1 are assayed by absorbance at 280 nm, by
- Quantitation of the amount of erythropoietin protein present using a radioimmunoassay for erythropoietin produced results having higher relative in vivo specific activity for certain isoforms because of an apparent decreased immunoreactivity of isoforms containing large amounts of sialic acid leading to an underestimation of the erythropoietin concentration and thus an
- n is the number of independent isoform preparations which contribute to the specific activity value. In most cases several in vivo assays were performed on each isoform preparation. The same in vivo data contribute to the specific activity
- Erythropoietin purified according to the procedures described in Lai et al., supra and containing a mixture of isoforms 9 to 14 is used as a standard for the RIAs and in vivo assays.
- the relative specific activities expressed as units/mg erythropoietin polypeptide can be converted to units/A 280 by multiplying by 0.807 mg erythropoietin polypeptide/A 280 .
- the conversion factor is derived by multiplying the extinction coefficient of erythropoietin (1.345 mg/A 280 ) by the protein content of the
- erythropoietin glycoprotein (about 60% by weight, Davis et al. Biochemistry 26, 2633 (1987)) to obtain mg erythropoietin polypeptide/A280 (i.e., 1.345 mg erythropoietin/A 280 ⁇ 0.60 mg polypeptide/mg
- erythropoietin 0.807 mg polypeptide/A 280 ).
- specific activities expressed as units/mg erythropoietin polypeptide can be multiplied by the factor 0.60 mg polypeptide/mg erythropoietin
- glycoprotein to give specific activities expressed as units/mg erythropoietin glycoprotein.
- Cell conditioned media from the production of recombinant erythropoietin according to the procedures described in Lin, supra are concentrated and diafiltered against 10 mM Tris, pH 7.2. Protein concentration is determined by the Bradford microprotein assay using bovine serum albumin as a standard. 19.6 ml of the solution containing 40 mg of total protein is made 20 ⁇ M in CUSO 4 , filtered through a 0.45 micron cutoff filter and loaded onto a 4 ml bed volume (1.05 cm height ⁇ 2.2 cm diameter) column packed with Q Sepharose Fast Flow (Pharmacia) which has been equilibrated with 10 mM Tris, pH 6.8 to 7.0 at 4°C. After sample application, the column is washed with two column volumes of the same buffer. The column flow rate is about 1 ml/min. Six separate columns are set up using this procedure to select defined erythropoietin isoform mixtures.
- the eluted isoform pools from each column are concentrated and solvent exchanged into water using an Amicon Centricon-10 microconcentrator.
- the results of analytical isoelectric focusing of these concentrated pools are shown in Figure 3.
- Gel lanes 1-6 represent defined erythropoietin isoform mixtures eluted from column 1-6, respectively.
- the "isoform mixture" shown in the far right gel lane of Figure 3 represents cell media which is applied to a Q-Sepharose column as described above, the column is washed with 5 mM acetic acid, 1 mM glycine, 20 ⁇ M CuSO 4 , 6M urea, and the erythropoietin isoform mixture is eluted from the column using the procedures described above.
- sialic acids containing from approximately 8 to approximately 12 sialic acids are eluted from the column using a gradient starting at approximately 2 mM acetic acid in 6 M urea/1 mM glycine/20 ⁇ M CUSO4 and running to 40 mM acetic acid/6 M urea/1 mM glycine/20 ⁇ M CUSO 4
- the total volume of the gradient is approximately 40 column volumes and fractions of approximately one column volume each are collected into vessels containing a volume of Tris buffer sufficient to bring the pH into the range of 6-8.5 so as to avoid long term exposure of the collected fractions to low pH.
- Figure 4 shows the separation of isoforms 8-11 which may be achieved by this procedure.
- Isoforms 12-14 which remain bound to the column at the end of the gradient are eluted by washing with a buffer consisting of 10 mM TrisHCl, 140 mM NaCI, 20 mM CuSO 4 (pH 7.0).
- the isoforms (separated during the gradient or eluted by the sodium chloride solution) are freed of contaminating proteins by reverse phase chromatography followed by gel
- oligonucleotide primers were synthesized for use in in vitro mutagenesis:
- EPO 5' GGGCCTGGCCAACCTGTCGGAAG 3' (SEQ ID. NO: 3)
- EPO 5' TCCCCTCCAGATAATGCCTCAGCTGC 3' (SEQ ID. NO: 4)
- EPO 5' CAGATGCGAACTCATCTGCTCCAC 3'
- EPO 5' AGGCCTGCAGGAATGGGAGCAGATGACCAGGTG 3' (SEQ ID. NO: 6)
- EPO 5' TCCAGATGCGACCTCAGCTGCTC 3' (SEQ ID. NO: 7)
- EPO was constructed to add an N-glycosylation site at Asn 69.
- Ser 127 EPO was constructed to add an N-glycosylation site at Asn 125.
- Thr 125 EPO and [Pro 124 , Thr 125 ] EPO were constructed to add an
- oligonucleotide primers were synthesized for use in in vitro mutagenesis:
- the oligonucleotide primer 5' AGATCCGACCACCGCTGCTCCAC 3' (SEQ ID. NO: 16) is used to generate [Pro 124 , Thr 125 , Thr 126 ] EPO.
- the oligonucleotide primer 5' AGATCCGACCACCGCTGCTCCAC 3' (SEQ ID. NO: 16) is used to generate [Pro 124 , Thr 125 , Thr 126 ] EPO.
- the oligonucleotide primer 5' AGATCCGACCACCGCTGCTCCAC 3' (SEQ ID. NO: 16) is used to generate [Pro 124 , Thr 125 , Thr 126 ] EPO.
- the oligonucleotide primer 5' AGATCCGACCACCGCTGCTCCAC 3' (SEQ ID. NO: 16) is used to generate [Pro 124 , Thr 125 , Thr 126 ] EPO.
- 5'TGCTCCACTCACAACAATCACTG 3' (SEQ ID. NO: 17) is then used to generate [Pro 124 , Thr 125 , Thr 126 , Thr 131 ] EPO. [Asn 69 , Thr 71 ] EPO and [Ser 68 , Asn 69 , Thr 71 ]
- EPO are constructed to add an N-glycosylation site at Asn 69 and to enhance N-glycosylation at that site. [Asn 125 , Thr 127 ] EPO, [Asn 125 , Thr 127 , Thr 131 ] EPO,
- [Pro 124 , Asn 125 , Ser 127 ] EPO and [Pro 124 , Asn 125 , Thr 127 ] EPO are constructed to add an N-glycosylation site at Asn 125 and to increase glycosylation at that site .
- [Thr 125 , Thr 126 ] EPO and [Pro 124 , Thr 125 , Thr 126 , Ser 131 ] EPO are constructed to add an O-glycosylation site at Thr 125 and to increase glycosylation at that site.
- Plasmid DNA derived from Hu13 was digested with BstEII and BglII restriction enzymes, the resulting DNA fragments were subjected to agarose gel electrophoresis, and the 810 base pair (bp)
- Plasmid pBRgHuEPO contains the erythropoietin genomic gene as a BamHI fragment inserted into a derivative of pBR322, as described in commonly owned Lin patent, supra.
- pBRgHuEPO was also digested with BstEII and BglII and the 6517 bp vector fragment was recovered. Ligation of the two fragments results in IGT1.
- pDSVL (described in commonly owned Lin patent, supra, and shown in Figure 5B) was digested with BamHI and the isolated 2.8 kilobase (kb) BamHI fragment from IGT1 containing erythropoietin cDNA was ligated into it.
- pEC-1 was digested with BamHI and BglII and the 820 bp erythropoietin cDNA fragment was isolated. It was ligated into the BamHI site of m13mp18 to give m13-EC-1. Single stranded DNA was recovered from supernatants of E. coli strain RZ1032 infected by m13-EC-1 as described by Kunkel et al. Methods in
- reaction volume was adjusted to 10 ⁇ l with water, the mixture was heated to 65°C for annealing of the primer to the template.
- plaques on nutrient agar were transferred to Gene Screen filters (New England Nuclear). The filters were dried under a heat lamp and then incubated for one hour in 6x SSC containing 1% SDS at 60°C .
- the oligonucleotide primer above (8 pmoles) was end-labeled with T4 polynucleotide kinase and ⁇ 32 P-iabeled ATP and incubated with the filters overnight in 6x SSC, 0.5% SDS and 100 mg/ml salmon sperm DNA at 37°C for the [Asn 124 ] mutation, 55°C for the
- pEC-1 was digested with BstEII followed by a partial digestion with BglII and the 5' termini of the resulting fragments are dephosphorylated with bacterial alkaline phosphatase in 10 mM Tris, pH 8 at 60°C for 60 minutes.
- the 7 kb vector fragment lacking the 810 bp BstEII-BglII fragment was isolated and ligated to the erythropoietin fragments above.
- the resulting plasmids (designated pEC-X where X is the analog number) contain DNA encoding erythropoietin analogs having altered amino acid residues at the indicated positions.
- an analog of erythropoietin was constructed by in vitro mutagenesis that deleted amino acid residues 41-55. This resulted in a smaller (775 bp) EPO containing BstEII-BglII fragment. The fragment was inserted into pECl as described above.
- pEC34 was digested with BstEII, partially digested with BglII, dephosphorylated and the vector isolated as described above. The 7kb vector fragment was then ligated to erythropoietin fragments as described above. Cloning with pEC34 allows easy discrimination between
- Reclosures result in a smaller BstEII-BglII fragment than analogs and these can be easily differentiated on agarose gels.
- Plasmids designated pDEC-X were constructed by inserting erythropoietin cDNA into pDEC ⁇ , which is a derivative of plasmid pDS ⁇ 2.
- the expression vector pDS ⁇ 2 is generally described in
- pDEC ⁇ was derived from pDS ⁇ 2 by the following steps:
- the HindIII site of pDS ⁇ 2 was deleted by digesting pDS ⁇ 2 DNA with HindIII, treating the HindIII cohesive ends with E. coli DNA Polymerase (Klenow fragment) and dNTPs, and religating the blunt-ended vector.
- the resulting plasmid was pDS ⁇ 2 ⁇ H.
- pDS ⁇ 2 ⁇ H was digested with Sail and a synthetic oligonucleotide having an SV40 splice signal with a Sail linker attached to the 3' end of the splice signal was ligated to it.
- the synthetic oligonucleotide had the following sequence (SEQ ID. NO: 18) :
- pDS ⁇ 2 ⁇ H splice was digested with SalI and blunt-ended by treating the cohesive ends with T4 DNA polymerase and dNTPs.
- pDEC was digested with KpnI and PvuII and blunt-ended by treating the cohesive ends with mung bean nuclease.
- the plasmid was religated to delete the excised KpnI-PvuII fragment resulting in the plasmid pDEC ⁇ .
- pDEC-X plasmids were made from pDEC ⁇ by complete digestion with BstEII followed by a partial digestion with BglII.
- the vector fragment lacking erythropoietin coding sequences was isolated and ligated to the 810 bp BstEII-BglII fragments containing the desired plasmid.
- pDEC(N47) and pDEC(N48) pDEC(N47) which contains asn30 thr32 val87 asn88 and thr90 mutations was constructed from pDEC(N18) and pDEC(N4).
- pDEC(N18) was digested with HindII and BglII and a 445 bp fragment was isolated.
- pDEC(N4) was digested with BstEII and HindIII and a 377 bp fragment was isolated. These two fragments were ligated into pDEC ⁇ cut with BstEII and BglII as described above resulting in pDEC(N47).
- pDEC(N48) which contains asn69 thr71 ser87 asn88 and thr90 mutations was constructed from pDEC(N14) and pDEC(N11).
- pDEC(N14) was digested with Hindi! and BglII and a 445 bp fragment was isolated.
- pDEC(Nll) was digested with BstEII and HindII and a 377 bp fragment was isolated. These two fragments were ligated into pDEC ⁇ cut with BstEII and BglII as described above
- pDEC(062) (HCG-Erythropoietin Fusion)
- pDEC(062) was assembled from pECl and a 107 base pair StuI-BglII synthetic DNA linker containing the carboxy terminal 28 amino acids from human chorionic gonadotropin (ser-ser-ser-lys-ala-pro-pro-pro-ser-leu-pro-ser-pro-ser-arg-leu-pro-gly-pro-ser-asp-thr-pro-ile-leu-pro-gln) (SEQ ID. NO: 25) (Pierce et al. Ann.
- pECl was digested with StuI and BglII and the 610bp DNA fragment was isolated.
- the synthetic linker was phosphorylated with ATP and polynucleotide kinase and ligated with the pECl fragment into pDEC ⁇ previously digested with BstEII and partially digested with BglII as described above.
- Construction of pDEC(NO1) pDEC(NO1) was assembled from pDEC(062) (HCGEPO) and pDEC(N14) (Ser 87 Asn 88 Thr 90 ).
- pDEC177 was digested with StuI and BglII and the 610bp DNA fragment
- pDEC(062) was digested with StuI and BglII and the 107 base pair fragment was isolated. These two DNA fragments were ligated into pDEC ⁇ previously digested with BstEII and partially digested with BglII as described above.
- pDEC(NO2) pDEC(N02) was assembled from pDEC(062) (HCG- EPO) and pDEC(N47) (Asn 30 Thr 32 Val 87 Asn 88 Thr 90 ).
- pDEC(N47) was digested with StuI and BglII and the 610bp DNA fragment containing the Asn 30 Thr 32 Val 87 Asn 88 Thr 90
- pDEC(O62) was digested with StuI and BglII and the 107 base pair fragment was isolated. These two DNA fragments were ligated into pDEC ⁇ previously digested with BstEII and partially digested with BglII as described above. Construction of PDEC(N16) (Ser 87 Asn 88 Thr 90 Ala 162 ) pDEC(N16) was assembled from
- pDEC(N14) (Ser 87 Asn 88 Thr 90 ) and pDEC258 (Ala 162 ).
- pDEC258 was constructed using procedures for in vitro
- pDEC(N14) was digested with StuI and BglII and the 610bp DNA fragment containing the Ser 87 Asn 88 Thr 90 mutations was isolated with GeneCleanTM.
- pDEC258 was digested with StuI and BglII and a 210 base pair fragment was isolated. These two DNA fragments were ligated into pDEC ⁇ previously digested with BstEII and partially digested with BglII as described above.
- pDEC(R1) (gln 24 ser 87 asn 88 thr 90 )
- DEC(R2) (gln 38 ser 87 asn 88 thr 90 )
- pDEC(R3) gln 83 ser 87 asn 88 thr 90
- pEC9 (gln 83 ) was constructed using the primer
- a volume of supernatant containing 5-20 units from COS cells transfected with erythropoietin analog cDNAs as described in Example 6 was immunoprecipitated overnight at room temperature with a rabbit antierythropoietin polyclonal antibody. 20-80 ⁇ l of 1:1 Protein A-Sepharose in phosphate buffered saline (PBS) was added to the immunoprecipitate and allowed to incubate for one hour at room temperature. The samples were centrifuged, washed with PBS and, where indicated, the pellet was treated with N-glycanase to remove
- PBS phosphate buffered saline
- RIAs were performed according to Egrie et al., supra. EIAs were performed with CLINIGENTM EIA kit (R and D Systems) using procedures supplied by the manufacturer. The in vivo biological activity of erythropoietin analogs was determined on supernatants from CHO cells expressing an erythropoietin analog or on purified erythropoietin obtained from CHO cell
- the mononucleated cells from human bone marrow cells were partially purified on a ficoll-paque cushion and washed in Iscove medium before plating to remove the adherent cells.
- the culture medium contained 0.9% methyl cellulose and did not include any bovine serum albumin.
- the erythropoietin analogs transfected and expressed in COS cells as described in Example 6 were analyzed in crude COS cell supernatants using RIA, EIA and an erythroid colony forming assay.
- Purified human sequence erythropoietin has an in vitro activity that was comparable to the RIA activity as determined by the above-mentioned assays.
- HCG C-terminal extension 3 at least 3g 1.0-1.3
- HCG extension 4 at least 3g 1.5
- dO-linked chain at Ser 126 is present on 70% of human erythropoietin molecules.
- eAnalogs having reduced O-glycosylation have a carbohydrate chain at Ser 126 on less than 70% of the molecules.
- fThr 12 3 EPO has two O-linked chains on greater than 60% of the molecules.
- Thr 125 EPO has two O-linked chains on about 40% of the molecules.
- Pro 124 Thr 125 EPO has two O-linked chains on greater than 80% of the molecules.
- Ratio of in vivo activity , to RIA or EIA was determined as described in footnote a of Table 6.
- the erythropoietin analog [Thr 125 ] EPO was constructed as described in [Section A] Example 6.
- [Thr 125 ] mutation was isolated by cleaving the plasmid pEC containing the [Thr 125 ] mutation with BstEII and BglII and ligating the fragment to pDEC ⁇ , [a derivative of pDS ⁇ 2] (described in Example 6).
- erythropoietin cDNA was transfected into DHFR-deficient CHO cells.
- 770 ml of CHO cell conditioned medium was concentrated using a 10,000 dalton molecular weight cutoff membrane and diafiltered against 10 mM Tris-HCl, pH 8.6 to a final volume of 34 ml.
- a 17 ml. aliquot of the concentrate was loaded onto a Q-Sepharose fast flow column (5 ml bed volume) equilibrated in the same buffer and eluted in a linear gradient of 0-250 mM NaCI in 10 mM Tris-HCl, pH 8. 6.
- Aliquots of column fractions, either untreated or digested with N-glycanase were analyzed by SDS-PAGE or IEF and pools (designated 2, 3 and 4) were made based upon the isoform and/or
- the EPO N14 analog was purified using a three step procedure consisting of ion exchange
- Conditional medium from CHO cells expressing the EPO N14 analog was harvested and
- the concentrated medium was loaded at ⁇ 12 A 280 /ml resin to Q-Sepharose FF (Pharmacia) column equilibrated in 10mM Tris pH 8.5 at a flow rate of 0.2 cm/min.
- the isoform pool was loaded at ⁇ 5 A 280 /ml resin to a reverse phase C4 column (Vydac) equilibrated in 20% ethanol/10mM Tris pH 7.0 at a flow rate of 2.5 cm/min.
- the column was washed with 1CV of 20%
- Pool #1 was concentrated approximately 65-fold and pool #2 approximately 250-fold using Centricon 10's (Amicon). Each pool was buffer exchanged into 20mM NaCitrate/100mM NaCI pH7.0.
- EPO N14 analog was purified using a three step procedure consisting of ion exchange chromatography, reverse phase HPLC, and hydroxylapatite chromatography.
- the concentrated medium was loaded at ⁇ 10 A 280 /ml resin to Q-Sepharose FF (Pharmacia) column equilibrated in 10mM Tris pH 8.5 at a flow rate of 0.2 cm/min.
- IEF gel pH 3-5 Three separate fraction pools were prepared based on the isoform distribution as determined by IEF. A low isoform pool (isoform 4-12), a medium isoform pool (isoform 5-15), and a high isoform pool (isoform 6-18) were made.
- Each sample was diluted to 2 A 280 /ml in 10mM Tris pH 7.2 and an equal volume of 4M Guanidine HCI (GuHCl), 10mM CHAPS, 10mM Tris pH 7.2 was added for a final sample concentration of 1 A 280 /ml.
- Each sample was loaded onto a hydroxylapatite minicolumn equilibrated with 2M GuHCl, 5mM CHAPS, 10mM Tris pH 7.2. The column was washed with equilibration buffer and 1 CV fractions of flow through were collected.
- the final pools were analyzed by SDS-PAGE and IEF gels.
- the IEF gels are shown in Figure 12.
- the RIA and in vivo activity assays were performed as described in Example 7A.
- the in vivo activity of the final isoform pools is reported in Table 8.
- the high sialic acid isoform pool was used in experiments to determine the increase in the hematocrit of mice. TABLE 8
- EPO N14 isoform pools were prepared as described in Example 7C. rHuEPO was prepared
- rHuEPO isoform 14 was purified as follows: rHuEPO consisting of a mixture of isoforms 10, 11, 12, 13, 14 and 15 was loaded to a
- Sprague-Dawley rats weighing between 310-378g. At various time points after administration, 0.3ml of blood was collected and serum was prepared by centrifugation. The 125 I-EPO (either recombinant human, isolated isoform 14, or EPO N14 analog) concentration in 0.1ml of each serum sample was then determined following an overnight 4°C incubation with 90% ethanol. The ethanol-precipitated 125 I-EPO in each serum sample was counted in a gamma counter and the resulting pharmacokinetic curves are shown in figure 13. The pharmacokinetic parameters were determined for each rat using PCNONLIN 4.0
- erythropoietin group also had the fastest clearance half-life of 1.78 hrs compared to 2.40 hrs for isolated isoform 14 and 3.03 hrs for EPO N14 analog.
- EPO N14 analog isoforms 15-17
- erythropoietin receptor was studied by a cold displacement assay using human erythroleukemia 0CIM1 cells (Papayannopoulou et al. Blood 64 (supp.l), 116a (1984)).
- Increasing concentrations of unlabeled EPO N14 were incubated with OCIM1 cells along with a constant concentration of 125 I-rHuEPO to determine the amount of EPO N14 required to compete with 125 I rHuEPO for binding to the receptor.
- OCIM1 cells Chrot al. 1 cells
- Unlabeled EPO N14 was diluted in assay buffer and added in amounts of 0.03ng, 0. lng, 0.3ng, 1.0ng, 3.0ng, 10.0ng, and 30.0ng (based on peptide mass).
- CD1 mice (about 30g) were injected
- erythropoietin preparations was based on peptide mass, so that a 30g mouse received either 0.071 ⁇ g of
- mice high pool and isoform 14. The hematocrits of all mice were determined at baseline and twice weekly thereafter by retroorbital bleeds. At the conclusion of the experiment, serum from all animals was collected and assayed for antibodies to the injected product. Data from animals judged to be negative for neutralizing antibodies was used for subsequent analysis.
- mice treated with the EPO N14 high isoform pool attained the highest group average hematocrits compared to the other preparations.
- Isoform 14, recombinant human EPO and the EPO N14 low isoform pool increased hematocrit to a lesser extent.
- EPO N14 high isoform pool appears to be more active on a peptide mass basis than any other preparation tested. Both the EPO N14 high isoform pool and isoform 14 were more active than recombinant human EPO.
- the EPO N14 low pool had the lowest activity when any of the analyses was used for comparison.
- 3Total hematocrit increase was calculated as the group average hematocrit on day 39 minus group average hematocrit at baseline.
- MOLECULE TYPE protein
Abstract
Description
Claims
Priority Applications (13)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CA002147124A CA2147124C (en) | 1993-08-17 | 1994-08-16 | Erythropoietin analogs |
KR1019950701453A KR100328769B1 (en) | 1993-08-17 | 1994-08-16 | Erythropoietin analog |
UA95058432A UA49793C2 (en) | 1993-08-17 | 1994-08-16 | Human erythropoietin analogs (variants), dna sequences encoding erythropoietin analog (variants), eukaryotic host cells transfected with plasmid dna (variants), pharmaceutical formulation (variants) |
HU9501435A HU220334B (en) | 1993-08-17 | 1994-08-16 | Erythropoietin analogs |
JP7507153A JP2938572B2 (en) | 1993-08-17 | 1994-08-16 | Erythropoietin analog |
SK502-95A SK282003B6 (en) | 1993-08-17 | 1994-08-16 | Human erythropoietin analogs, dna sequence, eucaryotic host cell and pharmaceutical preparation |
NZ273134A NZ273134A (en) | 1993-08-17 | 1994-08-16 | Erythropoietin analogs, their production and compositions thereof |
AU76327/94A AU677097B2 (en) | 1993-08-17 | 1994-08-16 | Erythropoietin analogs |
NO19951445A NO323104B1 (en) | 1993-08-17 | 1995-04-12 | Analogs of human erythropoietin, DNA sequences encoding them, eukaryotic host cell transfected with the DNA sequences, preparations comprising the analogs, use of the analogs to increase hematocrit, and methods for preparing the analogs. |
FI951792A FI117136B (en) | 1993-08-17 | 1995-04-13 | A process for the preparation of therapeutically useful erythropoietin analogs |
KR1019957001453A KR960701994A (en) | 1993-08-17 | 1995-04-15 | ERYTHROPOIETIN ANALOGS |
LVP-95-99A LV10972B (en) | 1993-08-17 | 1995-04-17 | Erythropoietin analogs |
NO2007008C NO2007008I2 (en) | 1993-08-17 | 2007-06-29 | Analogs of human erythropoietin, DNA sequences encoding them, eukaryotic host cell transfected with the DNA sequences, preparations comprising the analogs, use of the analogues to increase hematocrit, and method of preparing the analogs. |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US10801693A | 1993-08-17 | 1993-08-17 | |
US08/108,016 | 1993-08-17 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO1995005465A1 true WO1995005465A1 (en) | 1995-02-23 |
Family
ID=22319789
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/US1994/009257 WO1995005465A1 (en) | 1993-08-17 | 1994-08-16 | Erythropoietin analogs |
Country Status (27)
Country | Link |
---|---|
EP (1) | EP0640619B2 (en) |
JP (3) | JP2938572B2 (en) |
KR (2) | KR100328769B1 (en) |
CN (1) | CN1057534C (en) |
AT (1) | ATE155796T1 (en) |
AU (1) | AU677097B2 (en) |
CA (1) | CA2147124C (en) |
CZ (3) | CZ291229B6 (en) |
DE (2) | DE10199059I2 (en) |
DK (1) | DK0640619T4 (en) |
ES (1) | ES2105442T5 (en) |
FI (1) | FI117136B (en) |
GR (1) | GR3024815T3 (en) |
HK (1) | HK1001589A1 (en) |
HU (1) | HU220334B (en) |
IL (4) | IL110669A (en) |
LU (1) | LU90850I2 (en) |
LV (1) | LV10972B (en) |
NL (1) | NL300075I2 (en) |
NO (2) | NO323104B1 (en) |
NZ (1) | NZ273134A (en) |
RU (1) | RU2159814C2 (en) |
SI (1) | SI0640619T2 (en) |
SK (1) | SK282003B6 (en) |
UA (1) | UA49793C2 (en) |
WO (1) | WO1995005465A1 (en) |
ZA (1) | ZA946122B (en) |
Cited By (156)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1997013783A1 (en) * | 1995-10-09 | 1997-04-17 | Pharmacia & Upjohn Company | An acceptor polypeptide for an n-acetylgalactosaminyltransferase |
US5696250A (en) * | 1995-02-15 | 1997-12-09 | Amgen Inc. | DNA encoding megakaryocyte growth and development factor analogs |
US5989538A (en) * | 1995-02-15 | 1999-11-23 | Amgen Inc. | Mpl ligand analogs |
US6048971A (en) * | 1992-07-28 | 2000-04-11 | Beth Israel Deaconess Medical Center | Recombinant human erythropoietin mutants |
WO2000024893A2 (en) * | 1998-10-23 | 2000-05-04 | Amgen Inc. | Methods and compositions for the prevention and treatment of anemia |
WO2000047741A1 (en) * | 1999-02-12 | 2000-08-17 | Amgen Inc. | Glycosylated leptin compositions and related methods |
WO2000068376A1 (en) * | 1999-05-07 | 2000-11-16 | Genentech, Inc. | Novel chimpanzee erythropoietin (chepo) polypeptides and nucleic acids encoding the same |
US6504007B1 (en) | 1996-03-14 | 2003-01-07 | Genentech, Inc. | GDNF receptor |
US6531121B2 (en) | 2000-12-29 | 2003-03-11 | The Kenneth S. Warren Institute, Inc. | Protection and enhancement of erythropoietin-responsive cells, tissues and organs |
US6548653B1 (en) | 1998-06-15 | 2003-04-15 | Genzyme Transgenics Corporation | Erythropoietin analog-human serum albumin fusion |
US6555343B1 (en) | 1999-05-07 | 2003-04-29 | Genentech Inc. | Chimpanzee erythropoietin (CHEPO) polypeptides and nucleic acids encoding the same |
US6583272B1 (en) * | 1999-07-02 | 2003-06-24 | Hoffmann-La Roche Inc. | Erythropoietin conjugates |
US6586398B1 (en) * | 2000-04-07 | 2003-07-01 | Amgen, Inc. | Chemically modified novel erythropoietin stimulating protein compositions and methods |
KR100400637B1 (en) * | 1996-02-06 | 2004-03-10 | 씨제이 주식회사 | Biologically useful peptide |
US6831060B2 (en) | 1999-05-07 | 2004-12-14 | Genentech, Inc. | Chimpanzee erythropoietin (CHEPO) polypeptides and nucleic acids encoding the same |
DE10235248B4 (en) * | 2001-11-29 | 2004-12-23 | Cheil Jedang Corp. | Fusion protein with enhanced in vivo activity of erythropoietin |
US7041794B2 (en) * | 2001-04-04 | 2006-05-09 | Genodyssee | Polynucleotides and polypeptides of the erythropoietin gene |
US7091326B2 (en) | 2001-12-03 | 2006-08-15 | Cheil Jedang Corporation | Fusion protein having enhanced in vivo erythropoietin activity |
US7132280B2 (en) | 1999-04-15 | 2006-11-07 | Crucell Holland, B.V. | Recombinant protein production in a human cell |
WO2006120030A1 (en) | 2005-05-13 | 2006-11-16 | Charite Universitätsmedizin - Berlin | Erythropoietin variants |
US7192759B1 (en) | 1999-11-26 | 2007-03-20 | Crucell Holland B.V. | Production of vaccines |
WO2007108505A1 (en) | 2006-03-22 | 2007-09-27 | Chugai Seiyaku Kabushiki Kaisha | Erythropoietin solution preparation |
US7291484B2 (en) | 2003-05-09 | 2007-11-06 | Crucell Holland B.V. | Processes for culturing E1-immortalized cells to increase product yields |
US7297680B2 (en) | 1999-04-15 | 2007-11-20 | Crucell Holland B.V. | Compositions of erythropoietin isoforms comprising Lewis-X structures and high sialic acid content |
US7304150B1 (en) | 1998-10-23 | 2007-12-04 | Amgen Inc. | Methods and compositions for the prevention and treatment of anemia |
US7309687B1 (en) | 1999-04-13 | 2007-12-18 | The Kenneth S. Warren Institute, Inc. | Methods for treatment and prevention of neuromuscular and muscular conditions by peripherally administered erythropoietin |
WO2008023725A1 (en) | 2006-08-22 | 2008-02-28 | Chugai Seiyaku Kabushiki Kaisha | Preventive and/or therapeutic agent for peripheral neuropathy |
US7345019B1 (en) | 1999-04-13 | 2008-03-18 | The Kenneth S. Warren Institute, Inc. | Modulation of excitable tissue function by peripherally administered erythropoietin |
WO2008111503A1 (en) | 2007-03-09 | 2008-09-18 | National University Corporation Obihiro University Of Agriculture And Veterinary Medicine | Protective agent for transplanted organ |
US7504248B2 (en) | 2001-12-07 | 2009-03-17 | Crucell Holland B.V. | Production of viruses viral isolates and vaccines |
US7514072B1 (en) | 1998-12-14 | 2009-04-07 | Hannelore Ehrenreich | Method for the treatment of cerebral ischaemia and use of erythropoietin or erythropoietin derivatives for the treatment of cerebral ischaemia |
US7521220B2 (en) | 1999-11-26 | 2009-04-21 | Crucell Holland B.V. | Production of vaccines |
US7527961B2 (en) | 1999-11-26 | 2009-05-05 | Crucell Holland B.V. | Production of vaccines |
WO2009094551A1 (en) | 2008-01-25 | 2009-07-30 | Amgen Inc. | Ferroportin antibodies and methods of use |
US7604960B2 (en) | 1999-04-15 | 2009-10-20 | Crucell Holland B.V. | Transient protein expression methods |
EP2156843A2 (en) | 2004-01-23 | 2010-02-24 | EPOPLUS GmbH & Co. KG | Use of low-dose erythropoietin for the treatment of acute or chronic renal insufficiency and for the treatment of wounds |
WO2010056981A2 (en) | 2008-11-13 | 2010-05-20 | Massachusetts General Hospital | Methods and compositions for regulating iron homeostasis by modulation bmp-6 |
EP2191838A1 (en) | 2002-07-26 | 2010-06-02 | EPOPLUS GmbH & Co. KG | Erythropoetin for the stimulation of endothelial precursor cells |
US7847079B2 (en) | 2001-12-21 | 2010-12-07 | Human Genome Sciences, Inc. | Albumin fusion proteins |
US7851438B2 (en) | 2006-05-19 | 2010-12-14 | GlycoFi, Incorporated | Erythropoietin compositions |
WO2011011674A2 (en) | 2009-07-24 | 2011-01-27 | Dr. Reddy's Laboratories Ltd. | Production of erythropoiesis stimulating protein using metal ions |
EP2281828A2 (en) | 2000-12-29 | 2011-02-09 | The Kenneth S. Warren Institute, Inc. | Compositions comprising modified erythropoietin |
US7888101B2 (en) | 2005-12-08 | 2011-02-15 | Amgen Inc. | Host cells comprising alpha 1,2 mannosidase and culture methods thereof |
WO2011050333A1 (en) | 2009-10-23 | 2011-04-28 | Amgen Inc. | Vial adapter and system |
EP2319530A1 (en) | 2006-01-27 | 2011-05-11 | Hannelore Ehrenreich | Method for treating and/or preventing multiple sclerosis, and use of erythropoietin in the production of a drug for intermittent treatment and/or intermittent prevention of multiple sclerosis |
US7972810B2 (en) | 2005-12-08 | 2011-07-05 | Amgen Inc. | Production of glycoproteins using manganese |
WO2011156373A1 (en) | 2010-06-07 | 2011-12-15 | Amgen Inc. | Drug delivery device |
US8114839B2 (en) * | 2002-09-09 | 2012-02-14 | Hanall Biopharma Co., Ltd. | Protease resistant modified erythropoietin polypeptides |
US8236561B2 (en) | 1999-04-15 | 2012-08-07 | Crucell Holland B.V. | Efficient production of IgA in recombinant mammalian cells |
EP2498096A1 (en) | 2006-07-21 | 2012-09-12 | Amgen Inc. | Method of detecting and/or measuring hepcidin in a sample |
WO2012135315A1 (en) | 2011-03-31 | 2012-10-04 | Amgen Inc. | Vial adapter and system |
CN102788720A (en) * | 2012-06-05 | 2012-11-21 | 西北大学 | Membrane assisted separation of glycoprotein all N-linked carbohydrate chain and identification method thereof |
WO2013055873A1 (en) | 2011-10-14 | 2013-04-18 | Amgen Inc. | Injector and method of assembly |
EP2620448A1 (en) | 2008-05-01 | 2013-07-31 | Amgen Inc. | Anti-hepcidin antibodies and methods of use |
US8535923B2 (en) | 2009-04-27 | 2013-09-17 | Cytonet Gmbh & Co. Kg | Encapsulated liver cell composition |
US8633153B2 (en) | 2002-04-04 | 2014-01-21 | Amgen Inc. | Transthyretin variants |
US8716240B2 (en) | 2001-10-10 | 2014-05-06 | Novo Nordisk A/S | Erythropoietin: remodeling and glycoconjugation of erythropoietin |
US8716239B2 (en) | 2001-10-10 | 2014-05-06 | Novo Nordisk A/S | Granulocyte colony stimulating factor: remodeling and glycoconjugation G-CSF |
WO2014081780A1 (en) | 2012-11-21 | 2014-05-30 | Amgen Inc. | Drug delivery device |
WO2014144096A1 (en) | 2013-03-15 | 2014-09-18 | Amgen Inc. | Drug cassette, autoinjector, and autoinjector system |
US8841439B2 (en) | 2005-11-03 | 2014-09-23 | Novo Nordisk A/S | Nucleotide sugar purification using membranes |
WO2014149357A1 (en) | 2013-03-22 | 2014-09-25 | Amgen Inc. | Injector and method of assembly |
US8853161B2 (en) | 2003-04-09 | 2014-10-07 | Novo Nordisk A/S | Glycopegylation methods and proteins/peptides produced by the methods |
US8895303B2 (en) | 2006-11-13 | 2014-11-25 | Charite-Universitatsmedizin Berlin | Method of cell culture and method of treatment comprising a vEPO protein variant |
US8911967B2 (en) | 2005-08-19 | 2014-12-16 | Novo Nordisk A/S | One pot desialylation and glycopegylation of therapeutic peptides |
US8916360B2 (en) | 2003-11-24 | 2014-12-23 | Novo Nordisk A/S | Glycopegylated erythropoietin |
US8969532B2 (en) | 2006-10-03 | 2015-03-03 | Novo Nordisk A/S | Methods for the purification of polypeptide conjugates comprising polyalkylene oxide using hydrophobic interaction chromatography |
US9005625B2 (en) | 2003-07-25 | 2015-04-14 | Novo Nordisk A/S | Antibody toxin conjugates |
WO2015061386A1 (en) | 2013-10-24 | 2015-04-30 | Amgen Inc. | Injector and method of assembly |
WO2015061389A1 (en) | 2013-10-24 | 2015-04-30 | Amgen Inc. | Drug delivery system with temperature-sensitive control |
US9029331B2 (en) | 2005-01-10 | 2015-05-12 | Novo Nordisk A/S | Glycopegylated granulocyte colony stimulating factor |
WO2015080509A1 (en) | 2013-11-29 | 2015-06-04 | 씨제이헬스케어 주식회사 | Method for purifying darbepoetin alfa |
US9050304B2 (en) | 2007-04-03 | 2015-06-09 | Ratiopharm Gmbh | Methods of treatment using glycopegylated G-CSF |
WO2015119906A1 (en) | 2014-02-05 | 2015-08-13 | Amgen Inc. | Drug delivery system with electromagnetic field generator |
US9150848B2 (en) | 2008-02-27 | 2015-10-06 | Novo Nordisk A/S | Conjugated factor VIII molecules |
US9180165B2 (en) | 2007-07-19 | 2015-11-10 | Hannelore Ehrenreich | Use of EPO receptor activation or stimulation for the improvement of the EDSS score in patients with multiple sclerosis |
WO2015171777A1 (en) | 2014-05-07 | 2015-11-12 | Amgen Inc. | Autoinjector with shock reducing elements |
US9187546B2 (en) | 2005-04-08 | 2015-11-17 | Novo Nordisk A/S | Compositions and methods for the preparation of protease resistant human growth hormone glycosylation mutants |
US9187532B2 (en) | 2006-07-21 | 2015-11-17 | Novo Nordisk A/S | Glycosylation of peptides via O-linked glycosylation sequences |
US9200049B2 (en) | 2004-10-29 | 2015-12-01 | Novo Nordisk A/S | Remodeling and glycopegylation of fibroblast growth factor (FGF) |
WO2015187799A1 (en) | 2014-06-03 | 2015-12-10 | Amgen Inc. | Systems and methods for remotely processing data collected by a drug delivery device |
WO2016049036A1 (en) | 2014-09-22 | 2016-03-31 | Intrinsic Lifesciences Llc | Humanized anti-hepcidin antibodies and uses thereof |
WO2016061220A2 (en) | 2014-10-14 | 2016-04-21 | Amgen Inc. | Drug injection device with visual and audio indicators |
US9320797B2 (en) | 2007-09-27 | 2016-04-26 | Amgen Inc. | Pharmaceutical formulations |
WO2016100781A1 (en) | 2014-12-19 | 2016-06-23 | Amgen Inc. | Drug delivery device with proximity sensor |
WO2016100055A1 (en) | 2014-12-19 | 2016-06-23 | Amgen Inc. | Drug delivery device with live button or user interface field |
US9493499B2 (en) | 2007-06-12 | 2016-11-15 | Novo Nordisk A/S | Process for the production of purified cytidinemonophosphate-sialic acid-polyalkylene oxide (CMP-SA-PEG) as modified nucleotide sugars via anion exchange chromatography |
WO2017039786A1 (en) | 2015-09-02 | 2017-03-09 | Amgen Inc. | Syringe assembly adapter for a syringe |
US9657098B2 (en) | 2013-03-15 | 2017-05-23 | Intrinsic Lifesciences, Llc | Anti-hepcidin antibodies and uses thereof |
WO2017100501A1 (en) | 2015-12-09 | 2017-06-15 | Amgen Inc. | Auto-injector with signaling cap |
WO2017120178A1 (en) | 2016-01-06 | 2017-07-13 | Amgen Inc. | Auto-injector with signaling electronics |
WO2017160799A1 (en) | 2016-03-15 | 2017-09-21 | Amgen Inc. | Reducing probability of glass breakage in drug delivery devices |
WO2017189089A1 (en) | 2016-04-29 | 2017-11-02 | Amgen Inc. | Drug delivery device with messaging label |
WO2017192287A1 (en) | 2016-05-02 | 2017-11-09 | Amgen Inc. | Syringe adapter and guide for filling an on-body injector |
WO2017197222A1 (en) | 2016-05-13 | 2017-11-16 | Amgen Inc. | Vial sleeve assembly |
WO2017200989A1 (en) | 2016-05-16 | 2017-11-23 | Amgen Inc. | Data encryption in medical devices with limited computational capability |
WO2017209899A1 (en) | 2016-06-03 | 2017-12-07 | Amgen Inc. | Impact testing apparatuses and methods for drug delivery devices |
WO2018004842A1 (en) | 2016-07-01 | 2018-01-04 | Amgen Inc. | Drug delivery device having minimized risk of component fracture upon impact events |
WO2018034784A1 (en) | 2016-08-17 | 2018-02-22 | Amgen Inc. | Drug delivery device with placement detection |
WO2018081234A1 (en) | 2016-10-25 | 2018-05-03 | Amgen Inc. | On-body injector |
US9988427B2 (en) | 2005-05-13 | 2018-06-05 | Charite Universitaetsmedizen-Berlin | Erythropoietin variants |
WO2018136398A1 (en) | 2017-01-17 | 2018-07-26 | Amgen Inc. | Injection devices and related methods of use and assembly |
WO2018152073A1 (en) | 2017-02-17 | 2018-08-23 | Amgen Inc. | Insertion mechanism for drug delivery device |
WO2018151890A1 (en) | 2017-02-17 | 2018-08-23 | Amgen Inc. | Drug delivery device with sterile fluid flowpath and related method of assembly |
WO2018165499A1 (en) | 2017-03-09 | 2018-09-13 | Amgen Inc. | Insertion mechanism for drug delivery device |
WO2018164829A1 (en) | 2017-03-07 | 2018-09-13 | Amgen Inc. | Needle insertion by overpressure |
WO2018165143A1 (en) | 2017-03-06 | 2018-09-13 | Amgen Inc. | Drug delivery device with activation prevention feature |
WO2018172219A1 (en) | 2017-03-20 | 2018-09-27 | F. Hoffmann-La Roche Ag | Method for in vitro glycoengineering of an erythropoiesis stimulating protein |
EP3381445A2 (en) | 2007-11-15 | 2018-10-03 | Amgen Inc. | Aqueous formulation of antibody stablised by antioxidants for parenteral administration |
WO2018183039A1 (en) | 2017-03-28 | 2018-10-04 | Amgen Inc. | Plunger rod and syringe assembly system and method |
WO2018226515A1 (en) | 2017-06-08 | 2018-12-13 | Amgen Inc. | Syringe assembly for a drug delivery device and method of assembly |
WO2018226565A1 (en) | 2017-06-08 | 2018-12-13 | Amgen Inc. | Torque driven drug delivery device |
WO2018237225A1 (en) | 2017-06-23 | 2018-12-27 | Amgen Inc. | Electronic drug delivery device comprising a cap activated by a switch assembly |
WO2018236619A1 (en) | 2017-06-22 | 2018-12-27 | Amgen Inc. | Device activation impact/shock reduction |
WO2019014014A1 (en) | 2017-07-14 | 2019-01-17 | Amgen Inc. | Needle insertion-retraction system having dual torsion spring system |
WO2019018169A1 (en) | 2017-07-21 | 2019-01-24 | Amgen Inc. | Gas permeable sealing member for drug container and methods of assembly |
WO2019022951A1 (en) | 2017-07-25 | 2019-01-31 | Amgen Inc. | Drug delivery device with gear module and related method of assembly |
WO2019022950A1 (en) | 2017-07-25 | 2019-01-31 | Amgen Inc. | Drug delivery device with container access system and related method of assembly |
WO2019032482A2 (en) | 2017-08-09 | 2019-02-14 | Amgen Inc. | Hydraulic-pneumatic pressurized chamber drug delivery system |
WO2019036181A1 (en) | 2017-08-18 | 2019-02-21 | Amgen Inc. | Wearable injector with sterile adhesive patch |
WO2019040548A1 (en) | 2017-08-22 | 2019-02-28 | Amgen Inc. | Needle insertion mechanism for drug delivery device |
WO2019070552A1 (en) | 2017-10-06 | 2019-04-11 | Amgen Inc. | Drug delivery device with interlock assembly and related method of assembly |
WO2019070472A1 (en) | 2017-10-04 | 2019-04-11 | Amgen Inc. | Flow adapter for drug delivery device |
WO2019074579A1 (en) | 2017-10-09 | 2019-04-18 | Amgen Inc. | Drug delivery device with drive assembly and related method of assembly |
WO2019089178A1 (en) | 2017-11-06 | 2019-05-09 | Amgen Inc. | Drug delivery device with placement and flow sensing |
WO2019090086A1 (en) | 2017-11-03 | 2019-05-09 | Amgen Inc. | Systems and approaches for sterilizing a drug delivery device |
WO2019090303A1 (en) | 2017-11-06 | 2019-05-09 | Amgen Inc. | Fill-finish assemblies and related methods |
WO2019094138A1 (en) | 2017-11-10 | 2019-05-16 | Amgen Inc. | Plungers for drug delivery devices |
WO2019099322A1 (en) | 2017-11-16 | 2019-05-23 | Amgen Inc. | Autoinjector with stall and end point detection |
WO2019099324A1 (en) | 2017-11-16 | 2019-05-23 | Amgen Inc. | Door latch mechanism for drug delivery device |
US10428129B2 (en) | 2012-12-18 | 2019-10-01 | Ubi Pharma Inc. | Recombinant protein |
EP3556411A1 (en) | 2015-02-17 | 2019-10-23 | Amgen Inc. | Drug delivery device with vacuum assisted securement and/or feedback |
WO2019231582A1 (en) | 2018-05-30 | 2019-12-05 | Amgen Inc. | Thermal spring release mechanism for a drug delivery device |
WO2019231618A1 (en) | 2018-06-01 | 2019-12-05 | Amgen Inc. | Modular fluid path assemblies for drug delivery devices |
EP3593839A1 (en) | 2013-03-15 | 2020-01-15 | Amgen Inc. | Drug cassette |
WO2020023336A1 (en) | 2018-07-24 | 2020-01-30 | Amgen Inc. | Hybrid drug delivery devices with grip portion |
WO2020023444A1 (en) | 2018-07-24 | 2020-01-30 | Amgen Inc. | Delivery devices for administering drugs |
WO2020023451A1 (en) | 2018-07-24 | 2020-01-30 | Amgen Inc. | Delivery devices for administering drugs |
WO2020023220A1 (en) | 2018-07-24 | 2020-01-30 | Amgen Inc. | Hybrid drug delivery devices with tacky skin attachment portion and related method of preparation |
WO2020028009A1 (en) | 2018-07-31 | 2020-02-06 | Amgen Inc. | Fluid path assembly for a drug delivery device |
WO2020068623A1 (en) | 2018-09-24 | 2020-04-02 | Amgen Inc. | Interventional dosing systems and methods |
WO2020065576A1 (en) | 2018-09-27 | 2020-04-02 | Universidad Nacional Del Litoral | Modified human erythropoietin |
WO2020068476A1 (en) | 2018-09-28 | 2020-04-02 | Amgen Inc. | Muscle wire escapement activation assembly for a drug delivery device |
WO2020072846A1 (en) | 2018-10-05 | 2020-04-09 | Amgen Inc. | Drug delivery device having dose indicator |
WO2020072577A1 (en) | 2018-10-02 | 2020-04-09 | Amgen Inc. | Injection systems for drug delivery with internal force transmission |
WO2020081479A1 (en) | 2018-10-15 | 2020-04-23 | Amgen Inc. | Drug delivery device having damping mechanism |
WO2020081480A1 (en) | 2018-10-15 | 2020-04-23 | Amgen Inc. | Platform assembly process for drug delivery device |
WO2020091956A1 (en) | 2018-11-01 | 2020-05-07 | Amgen Inc. | Drug delivery devices with partial drug delivery member retraction |
WO2020091981A1 (en) | 2018-11-01 | 2020-05-07 | Amgen Inc. | Drug delivery devices with partial drug delivery member retraction |
WO2020092056A1 (en) | 2018-11-01 | 2020-05-07 | Amgen Inc. | Drug delivery devices with partial needle retraction |
WO2020219482A1 (en) | 2019-04-24 | 2020-10-29 | Amgen Inc. | Syringe sterilization verification assemblies and methods |
WO2021041067A2 (en) | 2019-08-23 | 2021-03-04 | Amgen Inc. | Drug delivery device with configurable needle shield engagement components and related methods |
EP3981450A1 (en) | 2015-02-27 | 2022-04-13 | Amgen, Inc | Drug delivery device having a needle guard mechanism with a tunable threshold of resistance to needle guard movement |
EP4074355A1 (en) | 2011-04-20 | 2022-10-19 | Amgen Inc. | Autoinjector apparatus |
WO2022246055A1 (en) | 2021-05-21 | 2022-11-24 | Amgen Inc. | Method of optimizing a filling recipe for a drug container |
WO2023209074A1 (en) | 2022-04-28 | 2023-11-02 | Institut National de la Santé et de la Recherche Médicale | Methods of restoring erythropoiesis in patients suffering from a sf3b1 mutant myelodysplastic syndrome by correcting coasy mis-splicing |
Families Citing this family (77)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US7217689B1 (en) | 1989-10-13 | 2007-05-15 | Amgen Inc. | Glycosylation analogs of erythropoietin |
US5952226A (en) * | 1996-11-05 | 1999-09-14 | Modex Therapeutiques | Hypoxia responsive EPO producing cells |
PT902085E (en) * | 1997-09-01 | 2004-02-27 | Aventis Pharma Gmbh | RECOMBINANT HUMAN ERYTHROPOIETIN WITH ADVANCED GLYCOSILACA PROFILE |
ATE267215T1 (en) | 1997-12-08 | 2004-06-15 | Lexigen Pharm Corp | HETERODIMARY FUSION PROTEINS FOR USE FOR TARGETED IMMUNTHERAPY AND GENERAL IMMUNE EXCITATION |
JO2291B1 (en) * | 1999-07-02 | 2005-09-12 | اف . هوفمان لاروش ايه جي | Erythopintin derivatives |
SK782002A3 (en) | 1999-07-21 | 2003-08-05 | Lexigen Pharm Corp | FC fusion proteins for enhancing the immunogenicity of protein and peptide antigens |
WO2001036489A2 (en) * | 1999-11-12 | 2001-05-25 | Merck Patent Gmbh | Erythropoietin forms with improved properties |
CA2399832C (en) | 2000-02-11 | 2011-09-20 | Stephen D. Gillies | Enhancing the circulating half-life of antibody-based fusion proteins |
AU2001255516B2 (en) * | 2000-04-21 | 2007-01-18 | Amgen Inc. | Methods and compositions for the prevention and treatment of anemia |
NZ522030A (en) * | 2000-05-15 | 2004-11-26 | F | Erythropoietin composition with a multiple charged inorganic anion i.e. a sulfate a citrate or a phosphate to stabilize the composition |
US7259146B2 (en) | 2000-05-26 | 2007-08-21 | Ortho-Mcneil Pharmaceutical, Inc. | Neuroprotective peptides |
JP5490972B2 (en) | 2000-08-04 | 2014-05-14 | 中外製薬株式会社 | Protein injection formulation |
DK1314437T3 (en) | 2000-08-11 | 2014-07-14 | Chugai Pharmaceutical Co Ltd | Stabilized antibody-containing preparations |
DE60117919T2 (en) * | 2000-12-11 | 2006-12-14 | Cheil Jedang Corp. | FUSION PROTEIN WITH IMPROVED IN VIVO ERYTHROPOIETING EFFECT |
KR101229995B1 (en) | 2000-12-11 | 2013-02-06 | 씨제이 주식회사 | Fusion protein having the enhanced in vivo activity of erythropoietin |
KR100645843B1 (en) | 2000-12-20 | 2006-11-14 | 에프. 호프만-라 로슈 아게 | Erythropoietin conjugates |
US7767643B2 (en) | 2000-12-29 | 2010-08-03 | The Kenneth S. Warren Institute, Inc. | Protection, restoration, and enhancement of erythropoietin-responsive cells, tissues and organs |
US20030072737A1 (en) | 2000-12-29 | 2003-04-17 | Michael Brines | Tissue protective cytokines for the protection, restoration, and enhancement of responsive cells, tissues and organs |
DE60219961T8 (en) | 2001-02-02 | 2008-04-17 | Ortho-Mcneil Pharmaceutical, Inc. | TREATMENT OF NEUROLOGICAL FUNCTIONAL DISORDERS WITH FRUCTOPYRANOSESULFAMATE AND ERYTHROPOETIN |
CA2440221C (en) | 2001-03-07 | 2013-02-05 | Merck Patent Gesellschaft Mit Beschraenkter Haftung | Expression technology for proteins containing a hybrid isotype antibody moiety |
WO2002072615A1 (en) | 2001-03-09 | 2002-09-19 | Chugai Seiyaku Kabushiki Kaisha | Method of purifying protein |
DE10112825A1 (en) | 2001-03-16 | 2002-10-02 | Fresenius Kabi De Gmbh | HESylation of active ingredients in aqueous solution |
WO2002079415A2 (en) | 2001-03-30 | 2002-10-10 | Lexigen Pharmaceuticals Corp. | Reducing the immunogenicity of fusion proteins |
EP2975382B1 (en) | 2001-04-17 | 2017-12-27 | Chugai Seiyaku Kabushiki Kaisha | Method of quantifying surfactant |
BR0209177A (en) | 2001-05-03 | 2004-10-05 | Merck Patent Gmbh | Recombinant tumor specific antibody and use |
US6930086B2 (en) | 2001-09-25 | 2005-08-16 | Hoffmann-La Roche Inc. | Diglycosylated erythropoietin |
US6818613B2 (en) | 2001-11-07 | 2004-11-16 | Ortho-Mcneil Pharmaceutical, Inc. | Aqueous sustained-release formulations of proteins |
JP2005530678A (en) | 2001-11-28 | 2005-10-13 | オーソーマクニール ファーマシューティカル, インコーポレイテッド | Erythropoietin administration therapy for anemia treatment |
ES2381025T3 (en) | 2001-12-04 | 2012-05-22 | Merck Patent Gmbh | Immunocytokines with modulated selectivity |
DE10209822A1 (en) | 2002-03-06 | 2003-09-25 | Biotechnologie Ges Mittelhesse | Coupling of low molecular weight substances to a modified polysaccharide |
DE10209821A1 (en) | 2002-03-06 | 2003-09-25 | Biotechnologie Ges Mittelhesse | Coupling of proteins to a modified polysaccharide |
US7129267B2 (en) | 2002-03-11 | 2006-10-31 | Janssen Pharmaceutica N.V. | Methods for SHP1 mediated neuroprotection |
BR0312395A (en) * | 2002-07-01 | 2007-06-19 | Kenneth S Warren Inst Inc | recombinant mutein protective tissue cytokine, mammalian cell responsive recombinant tissue protective cytokine, isolated nucleic acid molecule, vector, expression vector, genetically engineered cell, cell, pharmaceutical composition, method for protecting, maintaining or enhancing the viability of a cell, tissue or organ isolated from a mammalian body, use of a recombinant tissue protective cytokine, method for facilitating the transcytosis of a molecule through an endothelial cell barrier in a mammal, and composition for transporting a molecule through of transcytosis through an endothelial cell barrier |
AU2003246486A1 (en) * | 2002-07-19 | 2004-02-09 | Cangene Corporation | Pegylated erythropoietic compounds |
WO2004019966A1 (en) | 2002-08-27 | 2004-03-11 | Chugai Seiyaku Kabushiki Kaisha | Method of stabilizing protein solution preparation |
US7459435B2 (en) | 2002-08-29 | 2008-12-02 | Hoffmann-La Roche Inc. | Treatment of disturbances of iron distribution |
EP1681303B1 (en) | 2002-09-11 | 2013-09-04 | Fresenius Kabi Deutschland GmbH | HASylated polypeptides, especially HASylated erythropoietin |
US8420789B2 (en) | 2002-09-11 | 2013-04-16 | Chugai Seiyaku Kabushiki Kaisha | Method for removing DNA contaminants from a protein-containing sample |
WO2004024776A1 (en) | 2002-09-11 | 2004-03-25 | Fresenius Kabi Deutschland Gmbh | Method of producing hydroxyalkyl starch derivatives |
DE20321793U1 (en) | 2002-09-11 | 2010-06-02 | Fresenius Kabi Deutschland Gmbh | Hydroxyalkyl starch derivatives |
AU2003273413A1 (en) | 2002-10-08 | 2004-05-04 | Fresenius Kabi Deutschland Gmbh | Pharmaceutically active oligosaccharide conjugates |
NZ539472A (en) * | 2002-10-17 | 2008-05-30 | Pharming Intellectual Pty Bv | Protein modification |
US7459436B2 (en) | 2002-11-22 | 2008-12-02 | Hoffmann-La Roche Inc. | Treatment of disturbances of iron distribution |
ES2346205T3 (en) | 2002-12-17 | 2010-10-13 | Merck Patent Gmbh | HUMANIZED ANTIBODY (H14.18) OF ANTIBODY 14.18 OF MOUSE THAT LINKS TO GD2 AND ITS FUSION WITH IL-2. |
WO2005014655A2 (en) | 2003-08-08 | 2005-02-17 | Fresenius Kabi Deutschland Gmbh | Conjugates of hydroxyalkyl starch and a protein |
ZA200603396B (en) | 2003-09-29 | 2007-11-28 | Warren Pharmaceuticals Inc | Tissue protective cytokines for the treatment and prevention of sepsis and the formation of adhesions |
US7910547B2 (en) | 2003-12-30 | 2011-03-22 | Augustinus Bader | Tissue regeneration method |
TWI417303B (en) | 2004-03-11 | 2013-12-01 | Fresenius Kabi De Gmbh | Conjugates of hydroxyalkyl starch and a protein, prepared by reductive amination |
WO2006010143A2 (en) | 2004-07-13 | 2006-01-26 | Neose Technologies, Inc. | Branched peg remodeling and glycosylation of glucagon-like peptide-1 [glp-1] |
US7597884B2 (en) | 2004-08-09 | 2009-10-06 | Alios Biopharma, Inc. | Hyperglycosylated polypeptide variants and methods of use |
CN100432107C (en) * | 2005-10-25 | 2008-11-12 | 北京大学 | Protein for promoting erythrocyte growth factor activity and its use |
CN101062407A (en) | 2006-04-29 | 2007-10-31 | 中国科学院上海生命科学研究院 | Function of erythropoietin in the preventing and treating of retinal injury |
CN101337988B (en) * | 2006-10-31 | 2013-01-09 | 沈阳三生制药有限责任公司 | New erythrocyte-stimulating factor analogues |
JP2010510794A (en) | 2006-11-28 | 2010-04-08 | ハナル ファーマシューティカル カンパニー リミテッド | Modified erythropoietin polypeptide and therapeutic use thereof |
JP2010534194A (en) * | 2007-06-15 | 2010-11-04 | チューリッヒ大学 | Novel treatment for nervous system disorders |
CN103113464B (en) * | 2007-07-02 | 2014-08-20 | 沈阳三生制药有限责任公司 | Natural human erythropoietin analogue |
CN103073631A (en) * | 2007-07-02 | 2013-05-01 | 沈阳三生制药有限责任公司 | Hemopoietin analogue |
EP2070950A1 (en) | 2007-12-14 | 2009-06-17 | Fresenius Kabi Deutschland GmbH | Hydroxyalkyl starch derivatives and process for their preparation |
NZ620606A (en) | 2008-02-08 | 2015-08-28 | Ambrx Inc | Modified leptin polypeptides and their uses |
EP2095829A1 (en) | 2008-02-27 | 2009-09-02 | LEK Pharmaceuticals D.D. | Selenium containing modifying agents and conjugates |
JP5665733B2 (en) | 2008-04-21 | 2015-02-04 | ノボ ノルディスク ヘルス ケア アーゲー | Highly glycosylated human coagulation factor IX |
US20120172299A1 (en) | 2008-09-23 | 2012-07-05 | F. Hoffmann-La Roche Ag | Purification of erythropoietin |
CN107022020A (en) | 2008-09-26 | 2017-08-08 | Ambrx公司 | The animal erythropoietin polypeptides and its purposes of modification |
US9150894B2 (en) * | 2009-02-19 | 2015-10-06 | Xellia Pharmaceuticals Aps | Process for purifying lipopeptides |
WO2011024025A1 (en) * | 2009-08-28 | 2011-03-03 | Avesthagen Limited | An erythropoietin analogue and a method thereof |
US20120115637A1 (en) | 2010-06-30 | 2012-05-10 | Nike, Inc. | Golf Balls Including A Crosslinked Thermoplastic Polyurethane Cover Layer Having Improved Scuff Resistance |
US8193296B2 (en) | 2010-06-30 | 2012-06-05 | Nike, Inc. | Golf balls including crosslinked thermoplastic polyurethane |
RU2451071C1 (en) * | 2010-12-10 | 2012-05-20 | Российская Федерация, от имени которой выступает Министерство образования и науки Российской Федерации (Минобрнауки России) | Mus musculus cultivated hybrid cell strain producer of monoclonal antibodies specific to human recombinant erythropoietin (versions) |
US8979676B2 (en) | 2011-08-23 | 2015-03-17 | Nike, Inc. | Multi-core golf ball having increased initial velocity at high swing speeds relative to low swing speeds |
US9089739B2 (en) | 2011-08-23 | 2015-07-28 | Nike, Inc. | Multi-core golf ball having increased initial velocity |
KR101443257B1 (en) * | 2011-10-18 | 2014-09-19 | 주식회사 종근당 | Methods for Purifying Erythropoietin Analogs Having Lower Isoelectric Point |
WO2016044676A2 (en) | 2014-09-18 | 2016-03-24 | AskGene Pharma, Inc. | Novel feline erythropoietin receptor agonists |
EP3428284B1 (en) * | 2016-03-09 | 2022-05-11 | JCR Pharmaceuticals CO., LTD. | Method for producing mutant human erythropoietin |
GB2550418A (en) | 2016-05-20 | 2017-11-22 | Laing Peter | An improved vaccine against flaviviruses avoiding elicitation or stimulation of infection-enhancing antibodies |
JP6258536B1 (en) * | 2017-03-03 | 2018-01-10 | 協和発酵キリン株式会社 | Method for producing darbepoetin composition and method for culturing darbepoetin-producing cells |
US11667686B2 (en) | 2017-06-06 | 2023-06-06 | Kindred Biosciences, Inc. | Erythropoietin and analogs for veterinary use |
WO2022159414A1 (en) | 2021-01-22 | 2022-07-28 | University Of Rochester | Erythropoietin for gastroinfestinal dysfunction |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP0267678A1 (en) * | 1986-09-15 | 1988-05-18 | Genzyme Corporation | Recombinant human erythropoietin |
EP0428267A2 (en) * | 1989-10-13 | 1991-05-22 | Amgen Inc. | Erythropoietin isoforms |
Family Cites Families (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
NZ210501A (en) * | 1983-12-13 | 1991-08-27 | Kirin Amgen Inc | Erythropoietin produced by procaryotic or eucaryotic expression of an exogenous dna sequence |
-
1994
- 1994-08-15 CN CN94109128A patent/CN1057534C/en not_active Expired - Lifetime
- 1994-08-15 ZA ZA946122A patent/ZA946122B/en unknown
- 1994-08-15 IL IL110669A patent/IL110669A/en not_active IP Right Cessation
- 1994-08-15 IL IL192290A patent/IL192290A0/en unknown
- 1994-08-16 NZ NZ273134A patent/NZ273134A/en not_active IP Right Cessation
- 1994-08-16 DK DK94112732T patent/DK0640619T4/en active
- 1994-08-16 RU RU95115239/14A patent/RU2159814C2/en active
- 1994-08-16 WO PCT/US1994/009257 patent/WO1995005465A1/en active IP Right Grant
- 1994-08-16 JP JP7507153A patent/JP2938572B2/en not_active Expired - Lifetime
- 1994-08-16 UA UA95058432A patent/UA49793C2/en unknown
- 1994-08-16 EP EP94112732A patent/EP0640619B2/en not_active Expired - Lifetime
- 1994-08-16 CZ CZ1995917A patent/CZ291229B6/en not_active IP Right Cessation
- 1994-08-16 KR KR1019950701453A patent/KR100328769B1/en not_active IP Right Cessation
- 1994-08-16 DE DE2001199059 patent/DE10199059I2/en active Active
- 1994-08-16 SK SK502-95A patent/SK282003B6/en unknown
- 1994-08-16 ES ES94112732T patent/ES2105442T5/en not_active Expired - Lifetime
- 1994-08-16 HU HU9501435A patent/HU220334B/en active Protection Beyond IP Right Term
- 1994-08-16 AU AU76327/94A patent/AU677097B2/en not_active Expired
- 1994-08-16 AT AT94112732T patent/ATE155796T1/en active
- 1994-08-16 DE DE69404401T patent/DE69404401T3/en not_active Expired - Lifetime
- 1994-08-16 SI SI9430078T patent/SI0640619T2/en unknown
- 1994-08-16 CA CA002147124A patent/CA2147124C/en not_active Expired - Lifetime
-
1995
- 1995-04-12 NO NO19951445A patent/NO323104B1/en not_active IP Right Cessation
- 1995-04-13 FI FI951792A patent/FI117136B/en not_active IP Right Cessation
- 1995-04-15 KR KR1019957001453A patent/KR960701994A/en unknown
- 1995-04-17 LV LVP-95-99A patent/LV10972B/en unknown
-
1997
- 1997-09-22 GR GR970402449T patent/GR3024815T3/en unknown
-
1998
- 1998-01-21 HK HK98100522A patent/HK1001589A1/en not_active IP Right Cessation
- 1998-08-24 JP JP25324498A patent/JP3664590B2/en not_active Expired - Lifetime
-
2000
- 2000-05-16 IL IL13618800A patent/IL136188A0/en unknown
- 2000-05-16 IL IL13618900A patent/IL136189A0/en unknown
-
2001
- 2001-02-06 CZ CZ2001463A patent/CZ291343B6/en not_active IP Right Cessation
- 2001-02-06 CZ CZ2001462A patent/CZ291342B6/en not_active IP Right Cessation
- 2001-11-07 LU LU90850C patent/LU90850I2/en unknown
- 2001-12-06 NL NL300075C patent/NL300075I2/en unknown
-
2004
- 2004-06-25 JP JP2004188815A patent/JP3664723B2/en not_active Expired - Lifetime
-
2007
- 2007-06-29 NO NO2007008C patent/NO2007008I2/en unknown
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP0267678A1 (en) * | 1986-09-15 | 1988-05-18 | Genzyme Corporation | Recombinant human erythropoietin |
EP0428267A2 (en) * | 1989-10-13 | 1991-05-22 | Amgen Inc. | Erythropoietin isoforms |
Cited By (254)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US6048971A (en) * | 1992-07-28 | 2000-04-11 | Beth Israel Deaconess Medical Center | Recombinant human erythropoietin mutants |
US6489293B1 (en) | 1992-07-28 | 2002-12-03 | Beth Israel Deaconess Medical Center | Recombinant human erythropoietin with altered biological activity |
US5989538A (en) * | 1995-02-15 | 1999-11-23 | Amgen Inc. | Mpl ligand analogs |
US5756083A (en) * | 1995-02-15 | 1998-05-26 | Amgen Inc. | Mpl ligand analogs |
US5696250A (en) * | 1995-02-15 | 1997-12-09 | Amgen Inc. | DNA encoding megakaryocyte growth and development factor analogs |
US7399833B1 (en) | 1995-02-15 | 2008-07-15 | Elliott Steven G | MGDF analogs |
WO1997013783A1 (en) * | 1995-10-09 | 1997-04-17 | Pharmacia & Upjohn Company | An acceptor polypeptide for an n-acetylgalactosaminyltransferase |
KR100400637B1 (en) * | 1996-02-06 | 2004-03-10 | 씨제이 주식회사 | Biologically useful peptide |
US7105484B2 (en) | 1996-03-14 | 2006-09-12 | Genentech, Inc. | GDNF receptorα |
US6504007B1 (en) | 1996-03-14 | 2003-01-07 | Genentech, Inc. | GDNF receptor |
US7691606B2 (en) | 1996-03-14 | 2010-04-06 | Genentech, Inc. | Polynucleotides encoding GDNFRα |
US6548653B1 (en) | 1998-06-15 | 2003-04-15 | Genzyme Transgenics Corporation | Erythropoietin analog-human serum albumin fusion |
US7101971B2 (en) | 1998-06-15 | 2006-09-05 | Gtc Biotherapeutics, Inc. | Erythropoietin analog-human serum albumin fusion |
US7304150B1 (en) | 1998-10-23 | 2007-12-04 | Amgen Inc. | Methods and compositions for the prevention and treatment of anemia |
WO2000024893A3 (en) * | 1998-10-23 | 2000-09-14 | Amgen Inc | Methods and compositions for the prevention and treatment of anemia |
EP1813624A1 (en) * | 1998-10-23 | 2007-08-01 | Amgen Inc. | Methods and compositions for the prevention and treatment of anemia |
AU774989B2 (en) * | 1998-10-23 | 2004-07-15 | Amgen, Inc. | Methods and compositions for the prevention and treatment of anemia |
US7973009B2 (en) | 1998-10-23 | 2011-07-05 | Amgen Inc. | Methods and compositions for the prevention and treatment of anemia |
US8268588B2 (en) | 1998-10-23 | 2012-09-18 | Amgen Inc. | Methods and compositions for the prevention and treatment of anemia |
WO2000024893A2 (en) * | 1998-10-23 | 2000-05-04 | Amgen Inc. | Methods and compositions for the prevention and treatment of anemia |
US7977311B2 (en) | 1998-10-23 | 2011-07-12 | Amgen Inc. | Methods and compositions for the prevention and treatment of anemia |
US7514072B1 (en) | 1998-12-14 | 2009-04-07 | Hannelore Ehrenreich | Method for the treatment of cerebral ischaemia and use of erythropoietin or erythropoietin derivatives for the treatment of cerebral ischaemia |
WO2000047741A1 (en) * | 1999-02-12 | 2000-08-17 | Amgen Inc. | Glycosylated leptin compositions and related methods |
US7345019B1 (en) | 1999-04-13 | 2008-03-18 | The Kenneth S. Warren Institute, Inc. | Modulation of excitable tissue function by peripherally administered erythropoietin |
US7309687B1 (en) | 1999-04-13 | 2007-12-18 | The Kenneth S. Warren Institute, Inc. | Methods for treatment and prevention of neuromuscular and muscular conditions by peripherally administered erythropoietin |
US7410941B1 (en) | 1999-04-13 | 2008-08-12 | The Kenneth S. Warren Institute, Inc. | Methods for treatment of neurodegenerative conditions by peripherally administered erythropoietin |
US7132280B2 (en) | 1999-04-15 | 2006-11-07 | Crucell Holland, B.V. | Recombinant protein production in a human cell |
US7604960B2 (en) | 1999-04-15 | 2009-10-20 | Crucell Holland B.V. | Transient protein expression methods |
US7833753B2 (en) | 1999-04-15 | 2010-11-16 | Crucell Holland B.V. | Methods of producing erythropoietin isoforms comprising Lewis-X structures and high sialic acid content and compositions of the same |
US7491532B2 (en) | 1999-04-15 | 2009-02-17 | Crucell Holland, B.V. | Recombinant protein production in a human cell |
US8236561B2 (en) | 1999-04-15 | 2012-08-07 | Crucell Holland B.V. | Efficient production of IgA in recombinant mammalian cells |
US7470523B2 (en) | 1999-04-15 | 2008-12-30 | Crucell Holland B.V. | Recombinant protein production in a human cell |
US7297680B2 (en) | 1999-04-15 | 2007-11-20 | Crucell Holland B.V. | Compositions of erythropoietin isoforms comprising Lewis-X structures and high sialic acid content |
WO2000068376A1 (en) * | 1999-05-07 | 2000-11-16 | Genentech, Inc. | Novel chimpanzee erythropoietin (chepo) polypeptides and nucleic acids encoding the same |
JP2002543784A (en) * | 1999-05-07 | 2002-12-24 | ジェネンテック・インコーポレーテッド | Novel chimpanzee erythropoietin (CHEPO) polypeptide and nucleic acid encoding the same |
US6831060B2 (en) | 1999-05-07 | 2004-12-14 | Genentech, Inc. | Chimpanzee erythropoietin (CHEPO) polypeptides and nucleic acids encoding the same |
US6555343B1 (en) | 1999-05-07 | 2003-04-29 | Genentech Inc. | Chimpanzee erythropoietin (CHEPO) polypeptides and nucleic acids encoding the same |
US6583272B1 (en) * | 1999-07-02 | 2003-06-24 | Hoffmann-La Roche Inc. | Erythropoietin conjugates |
US7964198B2 (en) | 1999-11-26 | 2011-06-21 | Crucell Holland B.V. | Production of vaccines |
US7833788B2 (en) | 1999-11-26 | 2010-11-16 | Crucell Holland B.V. | Production of vaccines |
US7521220B2 (en) | 1999-11-26 | 2009-04-21 | Crucell Holland B.V. | Production of vaccines |
US7527961B2 (en) | 1999-11-26 | 2009-05-05 | Crucell Holland B.V. | Production of vaccines |
US7550284B2 (en) | 1999-11-26 | 2009-06-23 | Crucell Holland B.V. | Production of vaccines |
US7192759B1 (en) | 1999-11-26 | 2007-03-20 | Crucell Holland B.V. | Production of vaccines |
US7262166B2 (en) * | 2000-04-07 | 2007-08-28 | Amgen Inc. | Chemically modified novel erythropoietin stimulating protein compositions and methods |
US6586398B1 (en) * | 2000-04-07 | 2003-07-01 | Amgen, Inc. | Chemically modified novel erythropoietin stimulating protein compositions and methods |
EP2281828A2 (en) | 2000-12-29 | 2011-02-09 | The Kenneth S. Warren Institute, Inc. | Compositions comprising modified erythropoietin |
US6531121B2 (en) | 2000-12-29 | 2003-03-11 | The Kenneth S. Warren Institute, Inc. | Protection and enhancement of erythropoietin-responsive cells, tissues and organs |
US7041794B2 (en) * | 2001-04-04 | 2006-05-09 | Genodyssee | Polynucleotides and polypeptides of the erythropoietin gene |
US8716240B2 (en) | 2001-10-10 | 2014-05-06 | Novo Nordisk A/S | Erythropoietin: remodeling and glycoconjugation of erythropoietin |
US8716239B2 (en) | 2001-10-10 | 2014-05-06 | Novo Nordisk A/S | Granulocyte colony stimulating factor: remodeling and glycoconjugation G-CSF |
DE10235248B4 (en) * | 2001-11-29 | 2004-12-23 | Cheil Jedang Corp. | Fusion protein with enhanced in vivo activity of erythropoietin |
US7091326B2 (en) | 2001-12-03 | 2006-08-15 | Cheil Jedang Corporation | Fusion protein having enhanced in vivo erythropoietin activity |
US8802417B2 (en) | 2001-12-07 | 2014-08-12 | Crucell Holland B.V. | Production of viruses, viral isolates and vaccines |
US7504248B2 (en) | 2001-12-07 | 2009-03-17 | Crucell Holland B.V. | Production of viruses viral isolates and vaccines |
US8252739B2 (en) | 2001-12-21 | 2012-08-28 | Human Genome Sciences, Inc. | Albumin fusion proteins |
US7847079B2 (en) | 2001-12-21 | 2010-12-07 | Human Genome Sciences, Inc. | Albumin fusion proteins |
US8513189B2 (en) | 2001-12-21 | 2013-08-20 | Human Genome Sciences, Inc. | Albumin fusion proteins |
US9296809B2 (en) | 2001-12-21 | 2016-03-29 | Human Genome Sciences, Inc. | Albumin fusion proteins |
US8993517B2 (en) | 2001-12-21 | 2015-03-31 | Human Genome Sciences, Inc. | Albumin fusion proteins |
US9221896B2 (en) | 2001-12-21 | 2015-12-29 | Human Genome Sciences, Inc. | Albumin fusion proteins |
US8071539B2 (en) | 2001-12-21 | 2011-12-06 | Human Genome Sciences, Inc. | Albumin fusion proteins |
US8633153B2 (en) | 2002-04-04 | 2014-01-21 | Amgen Inc. | Transthyretin variants |
EP2191838A1 (en) | 2002-07-26 | 2010-06-02 | EPOPLUS GmbH & Co. KG | Erythropoetin for the stimulation of endothelial precursor cells |
US8114839B2 (en) * | 2002-09-09 | 2012-02-14 | Hanall Biopharma Co., Ltd. | Protease resistant modified erythropoietin polypeptides |
US8853161B2 (en) | 2003-04-09 | 2014-10-07 | Novo Nordisk A/S | Glycopegylation methods and proteins/peptides produced by the methods |
US7291484B2 (en) | 2003-05-09 | 2007-11-06 | Crucell Holland B.V. | Processes for culturing E1-immortalized cells to increase product yields |
US8008043B2 (en) | 2003-05-09 | 2011-08-30 | Crucell Holland B.V. | Cultures of E1-immortalized cells and processes for culturing the same to increase product yields therefrom |
US7608431B2 (en) | 2003-05-09 | 2009-10-27 | Crucell Holland B.V. | Fed-batch process for production of erythropoietin in human embryonic retina cells that express adenovirus E1A |
US9005625B2 (en) | 2003-07-25 | 2015-04-14 | Novo Nordisk A/S | Antibody toxin conjugates |
US8916360B2 (en) | 2003-11-24 | 2014-12-23 | Novo Nordisk A/S | Glycopegylated erythropoietin |
EP2156843A2 (en) | 2004-01-23 | 2010-02-24 | EPOPLUS GmbH & Co. KG | Use of low-dose erythropoietin for the treatment of acute or chronic renal insufficiency and for the treatment of wounds |
US9200049B2 (en) | 2004-10-29 | 2015-12-01 | Novo Nordisk A/S | Remodeling and glycopegylation of fibroblast growth factor (FGF) |
US10874714B2 (en) | 2004-10-29 | 2020-12-29 | 89Bio Ltd. | Method of treating fibroblast growth factor 21 (FGF-21) deficiency |
EP2402450A1 (en) | 2004-12-30 | 2012-01-04 | Crucell Holland B.V. | Methods to obtain recombinant proteins with decreased LacdiNac structures |
US9029331B2 (en) | 2005-01-10 | 2015-05-12 | Novo Nordisk A/S | Glycopegylated granulocyte colony stimulating factor |
US9187546B2 (en) | 2005-04-08 | 2015-11-17 | Novo Nordisk A/S | Compositions and methods for the preparation of protease resistant human growth hormone glycosylation mutants |
WO2006120030A1 (en) | 2005-05-13 | 2006-11-16 | Charite Universitätsmedizin - Berlin | Erythropoietin variants |
US9988427B2 (en) | 2005-05-13 | 2018-06-05 | Charite Universitaetsmedizen-Berlin | Erythropoietin variants |
US8911967B2 (en) | 2005-08-19 | 2014-12-16 | Novo Nordisk A/S | One pot desialylation and glycopegylation of therapeutic peptides |
US8841439B2 (en) | 2005-11-03 | 2014-09-23 | Novo Nordisk A/S | Nucleotide sugar purification using membranes |
EP1957630B1 (en) | 2005-12-08 | 2016-02-17 | Amgen Inc. | Improved production of glycoproteins using manganese |
EP2495308A1 (en) | 2005-12-08 | 2012-09-05 | Amgen Inc. | Improved production of glycoproteins using manganese |
US8460896B2 (en) | 2005-12-08 | 2013-06-11 | Amgen Inc. | Host cells and culture methods |
EP3026109A1 (en) | 2005-12-08 | 2016-06-01 | Amgen Inc. | Improved production of glycoproteins using manganese |
US7888101B2 (en) | 2005-12-08 | 2011-02-15 | Amgen Inc. | Host cells comprising alpha 1,2 mannosidase and culture methods thereof |
US7972810B2 (en) | 2005-12-08 | 2011-07-05 | Amgen Inc. | Production of glycoproteins using manganese |
EP4155385A1 (en) | 2005-12-08 | 2023-03-29 | Amgen Inc. | Improved production of glycoproteins using manganese |
US8617878B2 (en) | 2005-12-08 | 2013-12-31 | Amgen Inc. | Production of glycoproteins using manganese |
US9273110B2 (en) | 2005-12-08 | 2016-03-01 | Amgen Inc. | Production of glycoproteins using manganese |
US8680248B2 (en) | 2005-12-08 | 2014-03-25 | Amgen Inc. | Host cells comprising alpha 1,2 mannosidase and culture methods thereof |
EP1957630B2 (en) † | 2005-12-08 | 2023-03-29 | Amgen Inc. | Improved production of glycoproteins using manganese |
US8247210B2 (en) | 2005-12-08 | 2012-08-21 | Amgen Inc. | Host cells comprising alpha 1,2 mannosidase and culture methods thereof |
EP3026109B1 (en) * | 2005-12-08 | 2022-03-09 | Amgen Inc. | Improved production of glycoproteins using manganese |
US9254312B2 (en) | 2006-01-27 | 2016-02-09 | Hannelore Ehrenreich | Method for the treatment and/or prophylaxis of multiple sclerosis, and use of erythropoietin for the manufacture of a medicament for the intermittent treatment and/or intermittent prophylaxis of multiple sclerosis |
EP2319530A1 (en) | 2006-01-27 | 2011-05-11 | Hannelore Ehrenreich | Method for treating and/or preventing multiple sclerosis, and use of erythropoietin in the production of a drug for intermittent treatment and/or intermittent prevention of multiple sclerosis |
WO2007108505A1 (en) | 2006-03-22 | 2007-09-27 | Chugai Seiyaku Kabushiki Kaisha | Erythropoietin solution preparation |
US8546329B2 (en) | 2006-03-22 | 2013-10-01 | Chugai Seiyaku Kabushiki Kaisha | Erythropoietin solution preparation |
US7851438B2 (en) | 2006-05-19 | 2010-12-14 | GlycoFi, Incorporated | Erythropoietin compositions |
US8137954B2 (en) | 2006-05-19 | 2012-03-20 | Glycofi, Inc. | Erythropoietin compositions |
US9187532B2 (en) | 2006-07-21 | 2015-11-17 | Novo Nordisk A/S | Glycosylation of peptides via O-linked glycosylation sequences |
EP2498096A1 (en) | 2006-07-21 | 2012-09-12 | Amgen Inc. | Method of detecting and/or measuring hepcidin in a sample |
WO2008023725A1 (en) | 2006-08-22 | 2008-02-28 | Chugai Seiyaku Kabushiki Kaisha | Preventive and/or therapeutic agent for peripheral neuropathy |
US8969532B2 (en) | 2006-10-03 | 2015-03-03 | Novo Nordisk A/S | Methods for the purification of polypeptide conjugates comprising polyalkylene oxide using hydrophobic interaction chromatography |
US8895303B2 (en) | 2006-11-13 | 2014-11-25 | Charite-Universitatsmedizin Berlin | Method of cell culture and method of treatment comprising a vEPO protein variant |
WO2008111503A1 (en) | 2007-03-09 | 2008-09-18 | National University Corporation Obihiro University Of Agriculture And Veterinary Medicine | Protective agent for transplanted organ |
US9050304B2 (en) | 2007-04-03 | 2015-06-09 | Ratiopharm Gmbh | Methods of treatment using glycopegylated G-CSF |
US9493499B2 (en) | 2007-06-12 | 2016-11-15 | Novo Nordisk A/S | Process for the production of purified cytidinemonophosphate-sialic acid-polyalkylene oxide (CMP-SA-PEG) as modified nucleotide sugars via anion exchange chromatography |
US9180165B2 (en) | 2007-07-19 | 2015-11-10 | Hannelore Ehrenreich | Use of EPO receptor activation or stimulation for the improvement of the EDSS score in patients with multiple sclerosis |
US9320797B2 (en) | 2007-09-27 | 2016-04-26 | Amgen Inc. | Pharmaceutical formulations |
US10653781B2 (en) | 2007-09-27 | 2020-05-19 | Amgen Inc. | Pharmaceutical formulations |
EP3381445A2 (en) | 2007-11-15 | 2018-10-03 | Amgen Inc. | Aqueous formulation of antibody stablised by antioxidants for parenteral administration |
US9688759B2 (en) | 2008-01-25 | 2017-06-27 | Amgen, Inc. | Ferroportin antibodies and methods of use |
WO2009094551A1 (en) | 2008-01-25 | 2009-07-30 | Amgen Inc. | Ferroportin antibodies and methods of use |
EP2574628A1 (en) | 2008-01-25 | 2013-04-03 | Amgen Inc. | Ferroportin antibodies and methods of use |
US9175078B2 (en) | 2008-01-25 | 2015-11-03 | Amgen Inc. | Ferroportin antibodies and methods of use |
EP2803675A2 (en) | 2008-01-25 | 2014-11-19 | Amgen, Inc | Ferroportin antibodies and methods of use |
US9150848B2 (en) | 2008-02-27 | 2015-10-06 | Novo Nordisk A/S | Conjugated factor VIII molecules |
EP2620448A1 (en) | 2008-05-01 | 2013-07-31 | Amgen Inc. | Anti-hepcidin antibodies and methods of use |
EP2816059A1 (en) | 2008-05-01 | 2014-12-24 | Amgen, Inc | Anti-hepcidin antibodies and methods of use |
EP3693014A1 (en) | 2008-11-13 | 2020-08-12 | The General Hospital Corporation | Methods and compositions for regulating iron homeostasis by modulation bmp-6 |
WO2010056981A2 (en) | 2008-11-13 | 2010-05-20 | Massachusetts General Hospital | Methods and compositions for regulating iron homeostasis by modulation bmp-6 |
US9517247B2 (en) | 2009-04-27 | 2016-12-13 | Cytonet Gmbh & Co. Kg | Encapsulated liver cell composition |
US8535923B2 (en) | 2009-04-27 | 2013-09-17 | Cytonet Gmbh & Co. Kg | Encapsulated liver cell composition |
WO2011011674A2 (en) | 2009-07-24 | 2011-01-27 | Dr. Reddy's Laboratories Ltd. | Production of erythropoiesis stimulating protein using metal ions |
EP3009447A1 (en) | 2009-07-24 | 2016-04-20 | Dr. Reddy's Laboratories, Ltd. | Production of erythropoiesis stimulating protein using metal ions |
WO2011050333A1 (en) | 2009-10-23 | 2011-04-28 | Amgen Inc. | Vial adapter and system |
WO2011156373A1 (en) | 2010-06-07 | 2011-12-15 | Amgen Inc. | Drug delivery device |
WO2012135315A1 (en) | 2011-03-31 | 2012-10-04 | Amgen Inc. | Vial adapter and system |
EP4074355A1 (en) | 2011-04-20 | 2022-10-19 | Amgen Inc. | Autoinjector apparatus |
WO2013055873A1 (en) | 2011-10-14 | 2013-04-18 | Amgen Inc. | Injector and method of assembly |
EP3335747A1 (en) | 2011-10-14 | 2018-06-20 | Amgen Inc. | Injector and method of assembly |
EP3269413A1 (en) | 2011-10-14 | 2018-01-17 | Amgen, Inc | Injector and method of assembly |
EP3744371A1 (en) | 2011-10-14 | 2020-12-02 | Amgen, Inc | Injector and method of assembly |
EP3045188A1 (en) | 2011-10-14 | 2016-07-20 | Amgen, Inc | Injector and method of assembly |
EP3045190A1 (en) | 2011-10-14 | 2016-07-20 | Amgen, Inc | Injector and method of assembly |
EP3045187A1 (en) | 2011-10-14 | 2016-07-20 | Amgen, Inc | Injector and method of assembly |
EP3045189A1 (en) | 2011-10-14 | 2016-07-20 | Amgen, Inc | Injector and method of assembly |
CN102788720A (en) * | 2012-06-05 | 2012-11-21 | 西北大学 | Membrane assisted separation of glycoprotein all N-linked carbohydrate chain and identification method thereof |
US11458247B2 (en) | 2012-11-21 | 2022-10-04 | Amgen Inc. | Drug delivery device |
US11439745B2 (en) | 2012-11-21 | 2022-09-13 | Amgen Inc. | Drug delivery device |
EP3072548A1 (en) | 2012-11-21 | 2016-09-28 | Amgen, Inc | Drug delivery device |
EP3656426A1 (en) | 2012-11-21 | 2020-05-27 | Amgen, Inc | Drug delivery device |
US10682474B2 (en) | 2012-11-21 | 2020-06-16 | Amgen Inc. | Drug delivery device |
EP3081249A1 (en) | 2012-11-21 | 2016-10-19 | Amgen, Inc | Drug delivery device |
EP4234694A2 (en) | 2012-11-21 | 2023-08-30 | Amgen Inc. | Drug delivery device |
WO2014081780A1 (en) | 2012-11-21 | 2014-05-30 | Amgen Inc. | Drug delivery device |
US11344681B2 (en) | 2012-11-21 | 2022-05-31 | Amgen Inc. | Drug delivery device |
US10428129B2 (en) | 2012-12-18 | 2019-10-01 | Ubi Pharma Inc. | Recombinant protein |
US10239941B2 (en) | 2013-03-15 | 2019-03-26 | Intrinsic Lifesciences Llc | Anti-hepcidin antibodies and uses thereof |
US9803011B2 (en) | 2013-03-15 | 2017-10-31 | Intrinsic Lifesciences Llc | Anti-hepcidin antibodies and uses thereof |
US9657098B2 (en) | 2013-03-15 | 2017-05-23 | Intrinsic Lifesciences, Llc | Anti-hepcidin antibodies and uses thereof |
WO2014144096A1 (en) | 2013-03-15 | 2014-09-18 | Amgen Inc. | Drug cassette, autoinjector, and autoinjector system |
EP3593839A1 (en) | 2013-03-15 | 2020-01-15 | Amgen Inc. | Drug cassette |
WO2014149357A1 (en) | 2013-03-22 | 2014-09-25 | Amgen Inc. | Injector and method of assembly |
EP3831427A1 (en) | 2013-03-22 | 2021-06-09 | Amgen Inc. | Injector and method of assembly |
WO2015061386A1 (en) | 2013-10-24 | 2015-04-30 | Amgen Inc. | Injector and method of assembly |
EP3789064A1 (en) | 2013-10-24 | 2021-03-10 | Amgen, Inc | Injector and method of assembly |
WO2015061389A1 (en) | 2013-10-24 | 2015-04-30 | Amgen Inc. | Drug delivery system with temperature-sensitive control |
EP3421066A1 (en) | 2013-10-24 | 2019-01-02 | Amgen, Inc | Injector and method of assembly |
EP3501575A1 (en) | 2013-10-24 | 2019-06-26 | Amgen, Inc | Drug delivery system with temperature-sensitive-control |
US10723775B2 (en) | 2013-11-29 | 2020-07-28 | Cj Healthcare Corporation | Method for purifying darbepoetin alfa |
WO2015080509A1 (en) | 2013-11-29 | 2015-06-04 | 씨제이헬스케어 주식회사 | Method for purifying darbepoetin alfa |
WO2015119906A1 (en) | 2014-02-05 | 2015-08-13 | Amgen Inc. | Drug delivery system with electromagnetic field generator |
WO2015171777A1 (en) | 2014-05-07 | 2015-11-12 | Amgen Inc. | Autoinjector with shock reducing elements |
EP3785749A1 (en) | 2014-05-07 | 2021-03-03 | Amgen Inc. | Autoinjector with shock reducing elements |
WO2015187797A1 (en) | 2014-06-03 | 2015-12-10 | Amgen Inc. | Controllable drug delivery system and method of use |
WO2015187793A1 (en) | 2014-06-03 | 2015-12-10 | Amgen Inc. | Drug delivery system and method of use |
WO2015187799A1 (en) | 2014-06-03 | 2015-12-10 | Amgen Inc. | Systems and methods for remotely processing data collected by a drug delivery device |
US11213624B2 (en) | 2014-06-03 | 2022-01-04 | Amgen Inc. | Controllable drug delivery system and method of use |
US11738146B2 (en) | 2014-06-03 | 2023-08-29 | Amgen Inc. | Drug delivery system and method of use |
EP4036924A1 (en) | 2014-06-03 | 2022-08-03 | Amgen, Inc | Devices and methods for assisting a user of a drug delivery device |
US10323088B2 (en) | 2014-09-22 | 2019-06-18 | Intrinsic Lifesciences Llc | Humanized anti-hepcidin antibodies and uses thereof |
WO2016049036A1 (en) | 2014-09-22 | 2016-03-31 | Intrinsic Lifesciences Llc | Humanized anti-hepcidin antibodies and uses thereof |
EP3943135A2 (en) | 2014-10-14 | 2022-01-26 | Amgen Inc. | Drug injection device with visual and audible indicators |
WO2016061220A2 (en) | 2014-10-14 | 2016-04-21 | Amgen Inc. | Drug injection device with visual and audio indicators |
EP3848072A1 (en) | 2014-12-19 | 2021-07-14 | Amgen Inc. | Drug delivery device with proximity sensor |
WO2016100055A1 (en) | 2014-12-19 | 2016-06-23 | Amgen Inc. | Drug delivery device with live button or user interface field |
EP3689394A1 (en) | 2014-12-19 | 2020-08-05 | Amgen Inc. | Drug delivery device with live button or user interface field |
WO2016100781A1 (en) | 2014-12-19 | 2016-06-23 | Amgen Inc. | Drug delivery device with proximity sensor |
US10765801B2 (en) | 2014-12-19 | 2020-09-08 | Amgen Inc. | Drug delivery device with proximity sensor |
US11357916B2 (en) | 2014-12-19 | 2022-06-14 | Amgen Inc. | Drug delivery device with live button or user interface field |
US10799630B2 (en) | 2014-12-19 | 2020-10-13 | Amgen Inc. | Drug delivery device with proximity sensor |
US11944794B2 (en) | 2014-12-19 | 2024-04-02 | Amgen Inc. | Drug delivery device with proximity sensor |
EP3556411A1 (en) | 2015-02-17 | 2019-10-23 | Amgen Inc. | Drug delivery device with vacuum assisted securement and/or feedback |
EP3981450A1 (en) | 2015-02-27 | 2022-04-13 | Amgen, Inc | Drug delivery device having a needle guard mechanism with a tunable threshold of resistance to needle guard movement |
WO2017039786A1 (en) | 2015-09-02 | 2017-03-09 | Amgen Inc. | Syringe assembly adapter for a syringe |
WO2017100501A1 (en) | 2015-12-09 | 2017-06-15 | Amgen Inc. | Auto-injector with signaling cap |
WO2017120178A1 (en) | 2016-01-06 | 2017-07-13 | Amgen Inc. | Auto-injector with signaling electronics |
WO2017160799A1 (en) | 2016-03-15 | 2017-09-21 | Amgen Inc. | Reducing probability of glass breakage in drug delivery devices |
EP4035711A1 (en) | 2016-03-15 | 2022-08-03 | Amgen Inc. | Reducing probability of glass breakage in drug delivery devices |
EP3721922A1 (en) | 2016-03-15 | 2020-10-14 | Amgen Inc. | Reducing probability of glass breakage in drug delivery devices |
WO2017189089A1 (en) | 2016-04-29 | 2017-11-02 | Amgen Inc. | Drug delivery device with messaging label |
WO2017192287A1 (en) | 2016-05-02 | 2017-11-09 | Amgen Inc. | Syringe adapter and guide for filling an on-body injector |
WO2017197222A1 (en) | 2016-05-13 | 2017-11-16 | Amgen Inc. | Vial sleeve assembly |
WO2017200989A1 (en) | 2016-05-16 | 2017-11-23 | Amgen Inc. | Data encryption in medical devices with limited computational capability |
WO2017209899A1 (en) | 2016-06-03 | 2017-12-07 | Amgen Inc. | Impact testing apparatuses and methods for drug delivery devices |
WO2018004842A1 (en) | 2016-07-01 | 2018-01-04 | Amgen Inc. | Drug delivery device having minimized risk of component fracture upon impact events |
WO2018034784A1 (en) | 2016-08-17 | 2018-02-22 | Amgen Inc. | Drug delivery device with placement detection |
WO2018081234A1 (en) | 2016-10-25 | 2018-05-03 | Amgen Inc. | On-body injector |
WO2018136398A1 (en) | 2017-01-17 | 2018-07-26 | Amgen Inc. | Injection devices and related methods of use and assembly |
WO2018151890A1 (en) | 2017-02-17 | 2018-08-23 | Amgen Inc. | Drug delivery device with sterile fluid flowpath and related method of assembly |
WO2018152073A1 (en) | 2017-02-17 | 2018-08-23 | Amgen Inc. | Insertion mechanism for drug delivery device |
WO2018165143A1 (en) | 2017-03-06 | 2018-09-13 | Amgen Inc. | Drug delivery device with activation prevention feature |
WO2018164829A1 (en) | 2017-03-07 | 2018-09-13 | Amgen Inc. | Needle insertion by overpressure |
WO2018165499A1 (en) | 2017-03-09 | 2018-09-13 | Amgen Inc. | Insertion mechanism for drug delivery device |
WO2018172219A1 (en) | 2017-03-20 | 2018-09-27 | F. Hoffmann-La Roche Ag | Method for in vitro glycoengineering of an erythropoiesis stimulating protein |
EP4241807A2 (en) | 2017-03-28 | 2023-09-13 | Amgen Inc. | Plunger rod and syringe assembly system and method |
WO2018183039A1 (en) | 2017-03-28 | 2018-10-04 | Amgen Inc. | Plunger rod and syringe assembly system and method |
WO2018226565A1 (en) | 2017-06-08 | 2018-12-13 | Amgen Inc. | Torque driven drug delivery device |
WO2018226515A1 (en) | 2017-06-08 | 2018-12-13 | Amgen Inc. | Syringe assembly for a drug delivery device and method of assembly |
WO2018236619A1 (en) | 2017-06-22 | 2018-12-27 | Amgen Inc. | Device activation impact/shock reduction |
WO2018237225A1 (en) | 2017-06-23 | 2018-12-27 | Amgen Inc. | Electronic drug delivery device comprising a cap activated by a switch assembly |
WO2019014014A1 (en) | 2017-07-14 | 2019-01-17 | Amgen Inc. | Needle insertion-retraction system having dual torsion spring system |
EP4292576A2 (en) | 2017-07-21 | 2023-12-20 | Amgen Inc. | Gas permeable sealing member for drug container and methods of assembly |
WO2019018169A1 (en) | 2017-07-21 | 2019-01-24 | Amgen Inc. | Gas permeable sealing member for drug container and methods of assembly |
WO2019022951A1 (en) | 2017-07-25 | 2019-01-31 | Amgen Inc. | Drug delivery device with gear module and related method of assembly |
WO2019022950A1 (en) | 2017-07-25 | 2019-01-31 | Amgen Inc. | Drug delivery device with container access system and related method of assembly |
EP4085942A1 (en) | 2017-07-25 | 2022-11-09 | Amgen Inc. | Drug delivery device with gear module and related method of assembly |
WO2019032482A2 (en) | 2017-08-09 | 2019-02-14 | Amgen Inc. | Hydraulic-pneumatic pressurized chamber drug delivery system |
WO2019036181A1 (en) | 2017-08-18 | 2019-02-21 | Amgen Inc. | Wearable injector with sterile adhesive patch |
WO2019040548A1 (en) | 2017-08-22 | 2019-02-28 | Amgen Inc. | Needle insertion mechanism for drug delivery device |
WO2019070472A1 (en) | 2017-10-04 | 2019-04-11 | Amgen Inc. | Flow adapter for drug delivery device |
EP4257164A2 (en) | 2017-10-06 | 2023-10-11 | Amgen Inc. | Drug delivery device with interlock assembly and related method of assembly |
WO2019070552A1 (en) | 2017-10-06 | 2019-04-11 | Amgen Inc. | Drug delivery device with interlock assembly and related method of assembly |
WO2019074579A1 (en) | 2017-10-09 | 2019-04-18 | Amgen Inc. | Drug delivery device with drive assembly and related method of assembly |
WO2019090079A1 (en) | 2017-11-03 | 2019-05-09 | Amgen Inc. | System and approaches for sterilizing a drug delivery device |
WO2019090086A1 (en) | 2017-11-03 | 2019-05-09 | Amgen Inc. | Systems and approaches for sterilizing a drug delivery device |
WO2019090303A1 (en) | 2017-11-06 | 2019-05-09 | Amgen Inc. | Fill-finish assemblies and related methods |
WO2019089178A1 (en) | 2017-11-06 | 2019-05-09 | Amgen Inc. | Drug delivery device with placement and flow sensing |
WO2019094138A1 (en) | 2017-11-10 | 2019-05-16 | Amgen Inc. | Plungers for drug delivery devices |
WO2019099322A1 (en) | 2017-11-16 | 2019-05-23 | Amgen Inc. | Autoinjector with stall and end point detection |
WO2019099324A1 (en) | 2017-11-16 | 2019-05-23 | Amgen Inc. | Door latch mechanism for drug delivery device |
WO2019231582A1 (en) | 2018-05-30 | 2019-12-05 | Amgen Inc. | Thermal spring release mechanism for a drug delivery device |
WO2019231618A1 (en) | 2018-06-01 | 2019-12-05 | Amgen Inc. | Modular fluid path assemblies for drug delivery devices |
WO2020023444A1 (en) | 2018-07-24 | 2020-01-30 | Amgen Inc. | Delivery devices for administering drugs |
WO2020023336A1 (en) | 2018-07-24 | 2020-01-30 | Amgen Inc. | Hybrid drug delivery devices with grip portion |
WO2020023451A1 (en) | 2018-07-24 | 2020-01-30 | Amgen Inc. | Delivery devices for administering drugs |
WO2020023220A1 (en) | 2018-07-24 | 2020-01-30 | Amgen Inc. | Hybrid drug delivery devices with tacky skin attachment portion and related method of preparation |
WO2020028009A1 (en) | 2018-07-31 | 2020-02-06 | Amgen Inc. | Fluid path assembly for a drug delivery device |
WO2020068623A1 (en) | 2018-09-24 | 2020-04-02 | Amgen Inc. | Interventional dosing systems and methods |
WO2020065576A1 (en) | 2018-09-27 | 2020-04-02 | Universidad Nacional Del Litoral | Modified human erythropoietin |
WO2020068476A1 (en) | 2018-09-28 | 2020-04-02 | Amgen Inc. | Muscle wire escapement activation assembly for a drug delivery device |
WO2020072577A1 (en) | 2018-10-02 | 2020-04-09 | Amgen Inc. | Injection systems for drug delivery with internal force transmission |
WO2020072846A1 (en) | 2018-10-05 | 2020-04-09 | Amgen Inc. | Drug delivery device having dose indicator |
WO2020081480A1 (en) | 2018-10-15 | 2020-04-23 | Amgen Inc. | Platform assembly process for drug delivery device |
WO2020081479A1 (en) | 2018-10-15 | 2020-04-23 | Amgen Inc. | Drug delivery device having damping mechanism |
WO2020091956A1 (en) | 2018-11-01 | 2020-05-07 | Amgen Inc. | Drug delivery devices with partial drug delivery member retraction |
WO2020091981A1 (en) | 2018-11-01 | 2020-05-07 | Amgen Inc. | Drug delivery devices with partial drug delivery member retraction |
WO2020092056A1 (en) | 2018-11-01 | 2020-05-07 | Amgen Inc. | Drug delivery devices with partial needle retraction |
WO2020219482A1 (en) | 2019-04-24 | 2020-10-29 | Amgen Inc. | Syringe sterilization verification assemblies and methods |
WO2021041067A2 (en) | 2019-08-23 | 2021-03-04 | Amgen Inc. | Drug delivery device with configurable needle shield engagement components and related methods |
WO2022246055A1 (en) | 2021-05-21 | 2022-11-24 | Amgen Inc. | Method of optimizing a filling recipe for a drug container |
WO2023209074A1 (en) | 2022-04-28 | 2023-11-02 | Institut National de la Santé et de la Recherche Médicale | Methods of restoring erythropoiesis in patients suffering from a sf3b1 mutant myelodysplastic syndrome by correcting coasy mis-splicing |
Also Published As
Similar Documents
Publication | Publication Date | Title |
---|---|---|
AU677097B2 (en) | Erythropoietin analogs | |
US7217689B1 (en) | Glycosylation analogs of erythropoietin | |
US5856298A (en) | Erythropoietin isoforms | |
AU646822B2 (en) | Erythropoietin isoforms | |
JPH05103675A (en) | Production of human nerve growth factor 2 | |
IE83805B1 (en) | Erythropoietin analogs |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): AT AU BB BG BR BY CA CH CN CZ DE DK ES FI GB HU JP KP KR KZ LK LT LU LV MG MN MW NL NO NZ PL PT RO RU SD SE SK UA UZ VN |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN ML MR NE SN TD TG |
|
WWE | Wipo information: entry into national phase |
Ref document number: PV1995-917 Country of ref document: CZ |
|
WWE | Wipo information: entry into national phase |
Ref document number: 951792 Country of ref document: FI Ref document number: 2147124 Country of ref document: CA Ref document number: 273134 Country of ref document: NZ |
|
WWE | Wipo information: entry into national phase |
Ref document number: 1019950701453 Country of ref document: KR |
|
WWE | Wipo information: entry into national phase |
Ref document number: 50295 Country of ref document: SK |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
122 | Ep: pct application non-entry in european phase | ||
WWP | Wipo information: published in national office |
Ref document number: PV2001-463 Country of ref document: CZ Ref document number: PV1995-917 Country of ref document: CZ Ref document number: PV2001-462 Country of ref document: CZ |
|
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
EX32 | Extension under rule 32 effected after completion of technical preparation for international publication |
Free format text: TM |
|
WWE | Wipo information: entry into national phase |
Ref document number: PV2001-462 Country of ref document: CZ Ref document number: PV2001-463 Country of ref document: CZ |
|
WWG | Wipo information: grant in national office |
Ref document number: PV1995-917 Country of ref document: CZ |
|
WWG | Wipo information: grant in national office |
Ref document number: PV2001-463 Country of ref document: CZ Ref document number: PV2001-462 Country of ref document: CZ |
|
WWG | Wipo information: grant in national office |
Ref document number: 951792 Country of ref document: FI |