WO1995031562A1 - Process for inhibiting the growth of a culture of lactic acid bacteria, and optionally lysing the bacterial cells, and uses of the resulting lysed culture - Google Patents

Abstract

The invention provides a process for inhibiting the growth of a culture of lactic acid bacteria, or a product containing such culture e.g. a cheese product, in which in the cells of the lactic acid bacteria a holin obtainable from bacteriophages of Gram-positive bacteria, esp. from bacteriophages of lactic acid bacteria is produced in situ, the gene encoding said holin being under control of a first regulatable promoter, said holin being capable of exerting a bacteriostatic effect on the cells in which it is produced by means of a system, whereby the cell membrane is perforated, while preferably the natural production of autolysin is not impaired. It is preferable that additionally a lysin obtainable from lactic acid bacteria or their bacteriophages is produced in situ in the cells of the lactic acid bacteria, the gene encoding said lysin being under control of a second regulatable promoter, whereby the produced lysin effects lysis of the cells of the lactic acid bacteria. The second regulatable promoter can be the same as the first regulatable promoter and the genes encoding the holin and the lysin, respectively can be placed under the same regulatable promoter in one operon. Preferably the promoters are regulatable by the food-grade ingredients or parameters. Other uses of the invention include preparing a mixture of peptides which are modified by peptidases freed after the lysis, using the lysed culture as a bactericidal agent against spoiling bacteria or pathogenic bacteria for improving the shelf life of a product containing the lysed culture.

Description

Process for inhibiting the growth of a culture of lactic acid bacteria, and optionally lysing the bacterial cells, and uses of the resulting lysed culture

Background of the invention and prior art

The invention relates to a process for inhibiting the growth of a culture of lactic acid bacteria, and optionally lysing the cells of said bacteria.

In this specification the following abbreviations of names of micro-organisms are used: E. = Escherichia, e.g. E. coli , L . = Lactococcus , e.g. L. lactis , M. = Micrococcus , e.g. M. lysodeikticus ,

S. = Streptococcus , e.g. S. faecalis and S. pneumonia.

In one aspect the invention relates to a process for the lysis of a culture of lactic acid bacteria, or a product containing such culture, by means of a lysin e.g. in producing a fermented food product, e.g. in cheese-making. Such a process is known from WO 90/00599

(AGRICULTURAL & FOOD RESEARCH COUNCIL (AFRC) , M.J. Gasson, published 25 January 1990, ref. 1). According to that patent specification the lysin from a Lactococcus (preferably prolate-headed) bacteriophage was used to lyse bacterial starter cultures during cheese-making. Exemplified was the lysin of the bacteriophage φvML3 of Lactococcus lactis ML3. In particular, the lysin can be added to a cheese product or a cheese precursor mixture, e.g. after whey removal, milling and salting. However, this solution has the disadvantage that thorough mixing of the contents of the lysed cells with the cheese product is not easily obtained. Another disadvantage is that the lysin was produced by Escherichia coli cells, which are not food-grade. It is explicitly stated if the cell wall of the host cell is not itself degraded by the lysin then the lysin secreting transformed host may be useful in suppressing populations of bacteria which are susceptible to lysis by the lysin. Nothing is mentioned regarding addition of a transformed host cell in improving chees flavor, certainly not a transformed lactic acid bacterium.

As an alternative it is suggested in that patent specification "to encapsulate the lysin so that the timing of its addition is not important. The encapsulating agent dissolves after the cheese-making process is complete thus not affecting the starter bacteria before their role in acidification was complete."

This suggested alternative has the disadvantages, that (a) an encapsulating material has to be used, and (b) said material must not dissolve before the end of the cheese making process. Moreover, if the encapsulated lysin is added at the beginning of the cheese-making process, e.g. while adding the cheese starter culture to the milk, about 90% of it is removed with the whey. Thus one has to add about tenfold the required effective amount, which is economically not attractive. In a later publication CA. Shearman, K. Jury & M.J. Gasson (Feb. 1992, ref. 2) described an autolytic Lactococcus lactis expressing a cloned lactococcal bacteriophage φvML3 lysin gene. In particular they stated that

"(e)xpression of the cloned lysin did not impair the ability of Lactococcus lactis subsp. lactis and

Lactococcus lactis subsp. cremo is strains to metabolize lactose, to clot milk and produce acid

(data not shown)".

It was suggested that during the exponential phase the lysin would not, or would insufficiently be expressed. It would only be expressed in sufficient amounts to lyse an appreciable proportion of the cells during the stationary phase, which occurs at the end of the normal fermentation process. The article illustrates that maintenance of transformed lactococcal strains could be a problem. Maintenance at a temperature below 30°C slightly delayed the onset of lysis but at 30°C regrowth of lysin resistant bacteria occurred. As alternative buffering in a sucrose medium with a sucrose percentage higher than 20% was given. This does not seem to be suitable in a process of fermentation like cheese making where the fermentation step occurs at 30°C or higher and the presence of more than 20% sucrose is not acceptable.

Furthermore, at the end of that publication it was indicated that expression in the stationary phase is not completely controlled. In addition the use of osmotic buffer in a cheese maturing process is probably not very efficient timewise when taking into consideration the length of time required for a Gouda cheese immersed in a brine bath to achieve the desired degree of salt flavour the osmotic effect of salt concentration is not going to be very quick. The Cheddar cheese making process would probably be more suitable as the salt addition step is more efficient, however, still requires a mixing step. Both disclosures described the use of a lysin originating from a lactococcal bacteriophage lysin, that means an enzyme produced in nature by an undesired substance like a bacteriophage, because bacteriophage contaminations are a major problem in large scale industrial dairy fermentation processes.

In a review article R. Young (1992, ref. 4) gives a survey of the state of the art on bacteriophage lysis, both mechanism and regulation. Especially in the section "Lysis in Phage Infections of Gram- Positive Hosts" on pages 468-47 it was indicated that the DNA sequence found by Shearman c.s. (1989. ref. 5). which DNA sequence seems to be the same as that given in ref. 1, is probably not correct and that the deduced amino acid sequence might be quite different due to a mutation causing a phase shift in the reading frame. More particularly it is speculated that the DNA sequence of the lysin gene like the pneumococcal phage associated lysin genes had no signal sequence which could account for secretion across the cytoplasmic membrane, however, this was puzzling in view of the absence of a typical N-terminal signal sequence which raises the question of how the lytic enzymes escape the cytoplasm and gain access to the cell wall. In the above mentioned review of R. Young (1992, ref. 4, especially on page 469 in the paragraph bridging both columns and pages 472-473 in the section HOLIN FAMILY) it is argued that an additional protein is required for the action of bacteriophage lysins on the cell wall of infected cells. This additional protein is required for the access of the murein hydrolase, which is the more scientific name for the bacteriophage lysin, to its murein substrate. In that review the term "holin" was used for this additional protein. It was described in that review that the holin makes perforations in the cell wall enabling the lysins to pass the membrane so that subsequently the lysins can hydrolase the murein part of the cell wall. In this specification "holin" also means a protein or peptide required for the access of a lysin to its substrate, the murein part of the cell wall.

In the Young et al review it is stated that the realignment of the Shearman sequence and assumptions of a sequencing error obscuring a start codon does present a possible basis for establishing the requirement for a holin to effect the release of this phage encoded murein hydrolase. Young et al. further state "If our analysis so far has taught us anything it is that any phage with a lysozyme gene should have a holin gene". This statement is however contradicted somewhat further on in the same article where a lys A clone of mvl which does not appear to possess a holin encoding sequence is illustrated as exhibiting lytic activity.

Young et al further examined the putative holin family and disclose 8 different proteins unrelated in primary sequence for which genetic or physiological evidence of holin function exists. Some postulations concerning structure and function are made, however nothing definite appears to be settled regarding this issue. They indicate that as these proteins are small, hydrophobic, without enzyme function and lethal this is an array of characteristics not likely to attract legions of biochemists. This field is thus illustrated as being quite complex with little factual knowledge and a deal of speculation.

In a publication of Ward c.s. (1993; ref. 6) it is also suggested that the sequence of Shearman et al. (1989; ref. 5) is probably not correct. Comparison with a very similar phage lvsin gene confirmed that a frame shift in the Shearman et al. (ref. 5) sequence is needed for aligning the two DNA sequences. Moreover, this comparison teaches that the real phage lysin is encoded by an ORF that is probably 5 bases longer than disclosed by Shearman et al. (ref. 5)- C. Platteeuw and W.M. de Vos (1992, ref. 3) described the location, characterization and expression in Escherichia coli of lytic enzyme-encoding gene, lytA , of Lactococcus lactis bacteriophage φUS3. It was described that the φvML3 lysin, which is active on a wide range of lactococcal strains, lacked homology with known lytic enzymes. The bacteriophage φUS3 was identified during studying bacteriophages specific for the cheese-making strain Lactococcus lactis SK11 (NIZO) . The results showed that the deduced amino acid sequence of LytA shares similarities with that of an autolysin of Streptococcus pneumonia , suggesting that the bacteriophage φUS3 encodes an amidase rather than a lysozyme-tvpe muramidase. The above illustrates the difficulties facing a person skilled in the art wishing to isolate DNA-sequences from different organisms. The lack of information regarding sequences and the lack of homology between known sequences makes use of probes and primers derived from known sequences quite unlikely to lead to successful isolation of a correct DNA sequence encoding a holin from different organisms.

In EP-A2-0510907 (AFRC, M.J. Gasson, published 28 October 1992, ref. 7) the use of bacteriophages of food-contaminating or pathogenic bacteria or the lysins thereof to kill such bacteria was described. Examples included lysins from bacteriophages of Listeria monocytogenes (phage φLM4) and Clostridium tyrobutyricum (phage φP) . Also tests for bacterial contamination can be made specific for specific bacteria by using the appropriate bacteriophage or lysin thereof and determining whether cells are lysed thereby. That European patent thus describes the use of lysins obtained from phages of food-contaminating or even pathogenic bacteria, which is not desirable for food-grade applications. Moreover, the use of such lysins is further away from the subject of this invention, which will be discussed below as it does not lie in improving flavour of food products by autolysis of lactic acid bacteria.

In another aspect the invention relates to a process for inhibiting the growth of a culture of lactic acid bacteria without lysing the cells.

The growth of lactic acid bacteria can be inhibited in several ways.

For example, in normal fermentations with lactic acid bacteria, e.g. for the production of yoghurt, when a certain low pH is obtained the high amount of lactic acid stops further fermentation. The growth changes from the log phase to the stationary phase which in effect is some sort of inhibition of the growth.

Another possibility is that the nutrients become scarce and the so-called starvation occurs, because the necessary ingredients are no longer available for growth of the bacteria. This means that no further growth occurs. Still another possibility is the effect of pasteurization or sterilization causing cell death.

Summary of the invention

It has now been found that holin on its own already has a bacteriostatic effect on Gramnegative bacteria like E. coli and

Grampositive bacteria like lactic acid bacteria. Thus according to a first embodiment the invention provides a process as described in claim 1, i.e. a process for inhibiting the growth of a culture of lactic acid bacteria, which process comprises the in situ production in the cells of the lactic acid bacteria of a holin obtainable from bacteriophages of

Gram-positive bacteria, esp. from bacteriophages of lactic acid bacteria, the gene encoding said holin being under control of a first regulatable promoter, said first regulatable promoter not normally being associated with said holin gene, said holin being capable of exerting a bacteriostatic effect on the cells in which it is produced by means of a system, whereby the cell membrane is perforated, while preferably the natural production of autolysin is not impaired.

According to a second embodiment the invention provides a process as described in claim 2, i.e. a process according to the first embodiment, which additionally comprises the in situ production in the cells of the lactic acid bacteria of a lysin obtainable from lactic acid bacteria other foodgrade grampositive microorganisms or their bacteriophages, the gene encoding said lysin being under control of a second regulatable promoter, whereby the produced lysin effects lysis of the cells of the grampositive or gramnegative bacteria, preferably the lactic acid bacteria.

Preferably the second regulatable promoter is the same as the first regulatable promoter (claim 3), a d more preferably the gene encoding the holin and the gene encoding the lysin are placed under control of the same regulatable promoter in one operon (claim 4). It is advantageous for food fermentations when said first or second promoter or both can be regulated by food-grade ingredients or parameters (claim 5)- The processes according to the invention can be used in the culture of lactic acid bacteria as such, but they can also be used in a product containing such culture (claim 6) . A specific embodiment of this latter possibility is a process in which the lactic acid bacteria culture is used for producing a fermented food product obtainable by the fermentative action of the lactic acid bacteria and subsequently the lactic acid bacteria in the fermented food product are lysed (claim 7) • A specific example of such process is one in which the fermented food product is a cheese product (claim 8) . Then an additional cheese ripening step can be carried out, whereby some of the constituents after leaving the lysed cells will change the composition of the cheese product (claim 9).

A third embodiment of the invention relates to a process for combatting spoiling bacteria or pathogenic bacteria, in which a lysed culture obtained by a process according to the second embodiment of the invention is used as a bactericidal agent (claim 10). One way of use as a bactericidal agent is a process for improving the shelf life of a consumer product, in which a product obtained by a process according to either the first or the second embodiment of the invention and containing free holin or free lysin or both is incorporated into said consumer product in such amount that in the resulting consumer product the growth of spoiling bacteria or pathogenic bacteria is inhibited or that their viability is strongly reduced (claim 11). Such consumer products comprise edible products, cosmetic products, and products for cleaning fabrics, hard surfaces and human skin (claim 12). Examples of such products may be bread and bread improvers; butter, margarine and low calorie substitutes therefor; cheeses; dressings and mayonnaise-like products; meat products; food ingredients containing peptides; shampoos; creams or lotions for treatment of the human skin; soap and soap-replacement products; washing powders or liquids; and products for cleaning food production equipment and kitchen utensils.

A fourth embodiment of the invention is a process for modifying a mixture of peptides, which comprises (1) combining a culture of lactic acid bacteria with a mixture of peptides obtained by proteolysis of proteins, the cells of said culture containing both a gene encoding a holin under control of a first regulatable promoter and a gene encoding a lysin under control of a second regulatable promoter, which second and first promoter can be the same and which first and second promoter are not normally associated with the respective genes, and (2) effecting induction of the promoter or promoters for producing both the holin and the lysin in such amounts that the cells of the lactic acid bacteria are lysed and the contents of the cells containing peptidases will modify the composition of the mixture of peptides (claim 13). In order to achieve sufficient bacterium growth the host cell must not lyse too quickly, preferably lysis will occur at the end of the log phase or commencement of the stationary phase.

An alternative is a process for modifying a mixture of peptides, which comprises treating a mixture of peptides obtained by proteolysis of proteins with a lysed culture obtained by a process according to the second embodiment of the invention (claim 14).

The proteins to be proteolysed can be, for example, milk proteins or vegetable proteins, or both (claim 15).

Any of the above-mentioned processes as claimed in claims 1-15, wherein the holin is encoded by a nucleic acid sequence according to any of claims 18-20 and/or is expressed from a recombinant vector according to any of claims 21-24 and/or is expressed by a recombinant cell according to any of claims 2 -27 fall within the intended scope of the invention. In addition an alternative suitable embodiment of a process according to the invention can be directed at the inducible expression of a lysin having the amino acid sequence of sequence id no 7 or being a functional equivalent thereof.

A nucleic acid sequence encoding a holin derivable from a grampositive bacterium such as a lactic acid bacterium, in particular a L. lactis or a bacteriophage derivable from such a grampositive bacterium also falls within the scope of the invention. Such a nucleic acid sequence can for example encode the amino acid sequence of sequence id no 6 or a functional equivalent thereof such as the nucleic acid sequence of nucleotides 103-328 of sequence id no 5- Any nucleic acid sequence according to the invention can further be operatively linked to a first regulatable promoter, said first regulatable promoter not normally being associated with the holin encoding sequence.

Also comprised by the invention are recombinant vectors comprising any of the nucleic acid sequences in any of the claimed embodiments, said vector preferably further being foodgrade. In addition such a recombinant vector according to the invention may suitably further comprise a nucleic acid sequence encoding a lysin, both the holin and the lysin being derivable from a grampositive bacterium such as a lactic acid bacterium, in particular a L. lactis or a bacteriophage derivable from such a grampositive bacterium, a preferred embodiment of a recombinant vector according to the invention further comprises the natural attachment/integration system of a bacteriophage. The natural attachment/integration system of a bacteriophage can comprise the bacteriophage attachment site and an integrase gene located such that integration of the holin and optionally lysin gene will occur, said system preferably being derived from a bacteriophage that is derivable from a food grade host cell, preferably a lactic acid bacterium. A suitable recombinant vector according to the invention comprises the nucleic acid sequence encoding the holin and the nucleic acid sequence encoding the lysin operatively linked to a foodgrade inducible promoter that can be induced via a food grade mechanism. Such a promoter system can for example be a thermosensitive complex inducible promoter as is disclosed in EP94201355 and is present on plasmid pIRl4. A recombinant host cell comprising a nucleic acid sequence according to any of claims 18-20 in a setting other than in its native bacteriophage and/or a recombinant vector according to any of claims 21-24 is claimed. Any of the abovementioned embodiments of recombinant host cell further comprising a nucleic acid sequence encoding a lysin, said lysin preferably being derivable from a grampositive bacterium such as a lactic acid bacterium, in particular a L. lactis or a bacteriophage derivable from such a grampositive bacterium, said nucleic acid sequence encoding a lysin preferably being in a setting other than in its native bacteriophage or bacterium is also suitable. Preferably a recombinant host cell according to the invention will be a food grade host cell, preferably a lactic acid bacterium. Most preferably the host cell is of the same type from which the holin and/or lysin encoding nucleic acid sequences are derived.

Brief description of the drawings

FIGURE LEGENDS belonging to the draft publication

Fig. 1. A) Schematic outline of the PCR reactions used for the amplification of lytP, lytR , and the combination of lytP and lytB. The ORF's are indicated by hatched arrows. Sequences of the amplification primers 1-4 (lytl-lyt4) are given in Table 2 and as sequence id no 1-4 in the Sequence Listing. The scale is in kilobases (kb) .

B) Schematic representation of the plasmid constructions. See for details Materials and Methods. Abbreviations: Em", erythromycin resistance marker; Amp^R, ampicillin resistance marker; Cm^R, chloramphenicol resistance marker; P_spac is a hybrid regulatory region, constructed by Yansura and Henner (29), which contains the RNA polymerase recognition sequences of an early SP01 promoter and the lac operator; lad, lac repressor under the control of the Baci llus licheniformis penicillinase transcriptional and translational signals, indicated as P_pen (29); P_x and P₂, promoters P, and P₂ of the bacteriophage Rl-t; T, transcription terminator; ori, origin of replication; rro , Rl-t repressor gene. Fig. 2. Alignment of ORF 23 and the L. lactis subsp. cremoτis c2 lysin (c2) . Identical amino acid residues are indicated with asterisks, conserved changes by dots.

Fig. 3- Nucleotide sequence of a 1200 bp DNA fragment of Rl-t carrying lytP and lytR as represented in sequence id no 5- The deduced amino acid sequences of lytP and lytR are indicated in sequence id no 6 and 7 respectively. The putative ribosomal binding sites (RBS) are underlined. Asterisks represent stop codons. The stem-loop structure downstream of lytR is indicated by solid arrows.

Fig. 4. Analysis of the lytic activity of the lytR gene product. Cell free extracts of E. coli cells carrying the plasmid pAG58 (lanes 1 and 2) or pAG5δR (lanes 3 and 4) were obtained two hours after the addition of IPTG. Abbreviations: ni, non-induced; i, induced. The arrow indicates the position of a clearing zone as a result of lytic activity exhibited by the lytR gene product. Fig. 5- A) Deduced amino acid sequence of the lytP gene product (sequence id no 6). Predicted transmembrane segments are indicated by bars, the predicted β-turn region by t's. Charged amino acid residues are indicated + or -, depending on the sign of the charge.

B) Topological model of LytP based on the computer predictions. The membrane-spanning amino acids are indicated.

Fig. 6. A) The effect of expression of lytR, lytR , or the combination of lytR and lytR on the optical density of E. coli MC1000 cells. Optical density measurements of E. coli cells carrying either pAG58 (a), pAG5δR (b) , pAG58P (c) or pAG5δPR (d) , with (•) or without (°) the addition of the inducer (IPTG) are indicated as a function of time. The time scale is in hours before and after the time of induction (indicated by arrow).

B) The number of colony forming units per ml of E. coli cells carrying either pAG5δ (empty bars), pAG5δR (checkered bars), pAG5δP (hatched bars), or pAG5δPR (filled bars) before (left diagram), and after two hours after induction (right diagram).

Fig. 7- The effect of the induced expression of lytR, lytR , or the combination of lytR and lytR on the optical density of L. lactis subsp. cremoris LL302 cells. Optical density measurements of induced L. lactis cells carrying either pIR12 (•), pIRIP (Δ) , pIRlR (*). or pIRlPR (°) respectively, are indicated as a function of growth. The optical density (0D) measurements of L. lactis carrying pIRlPR, not exposed to mitomycin C, are represented by (°) . Time scale is in hours after the time of induction with mitomycin C (1 μg/ml).

The invention is illustrated by a draft publication, which is given below.

Inducible lysis of Lactococcus lactis mediated by the Lactococcus lactis subsp. cτemoτis bacteriophage Rl-t lysis functions.

SUMMARY

This work describes the involvement of two genes of the temperate Lactococcus lactis subsp. cremoris bacteriophage Rl-t, lytR and lytR, in the lysis of its host. The gene product of lytR exhibits lytic activity as it hydrolysed Micrococcus lysodeikticus autoclaved cell walls. The gene product of lytR is required in conjunction with lytR to obtain efficient lysis in vivo in Escherichia coli as was shown by induction studies monitoring the optical density as a measure of cell lysis: expression of lytR alone did not cause significant lysis of E. coli cells whereas simultaneous expression of lytR and lytR caused lysis of this bacterium. LytP therefore seems to have a similar function as the S protein of the E. coli phage lambda, i . e. rendering the murein substrate accessible to the lysin.

Both lytR and lytR were subcloned in an inducible expression-vector for L. lactis. Induction of both genes in L. lactis was shown to result in cell lysis as monitored by a decrease in optical density.

INTRODUCTION

Host cell lysis by temperate bacteriophages is accomplished by at least two fundamentally different mechanisms (30). The small single- stranded DNA phage φX174 encodes a protein which forms a channel to transport complete phage particles from the cytoplasm of the host to the environment (4, 7, 27). However, most of the known phages encode an enzyme with murein-degrading activity. These so-called lysins cause breakdown of the peptidoglycan layer which is followed by lysis of the host and the release of the phage particles.

Lysins of bacteriophages of Gram-negative bacteria so-far characterized lack a signal sequence needed for sec-dependent transport across the inner membrane. A second lysis function, encoded by a gene located immediately upstream of the lysin gene, is required for efficient lysis. This gene encodes a so-called holin which is believed to form holes in the cell membrane, thereby rendering the murein substrate accessible to the lysin (30).

Until recently it was believed that in Gram-positive bacteria, phage-mediated lysis was solely accomplished through the action of a phage-encoded lysin. Transit of the phage-encoded lysin across the membrane was thought to occur via the general secretory route. However, the observation that a signal sequence required for this type of transport is absent in many of the identified lysins, raised the question how the murein-degrading activity gains access to the cell wall. There is now growing support for the idea that many of these phages require a second function for lysis of their Gram-positive host. Recently it was shown that the Baci l lus subti lis phage φ29, gene 14, situated immediately upstream of the lysin gene, specifies a protein required for efficient release of the phage lysin to the substrate-containing environment (20) . Sequence analysis of the complete L. lactis subsp. cremoris bacteriophage Rl-t genome has revealed the presence of an open reading frame (ORF) similar to several lysins of other bacteriophages. In this work we show that the corresponding gene, designated lytR , indeed encodes a protein with cell wall degrading activity in vitro .

Table 1. Bacterial strains, plasmids and bacteriophage

relevant features reference

Bacterial strains

L. lactis subsp. cremoris LL302 MGI363 carrying the pWVOl repA gene on the chromosome to ensure efficient replication This work

E. coli

MC1000 αrαD139, ΔZαcx74, Δ(αr , leu) 7697 , galU, galK, strA

Plasmids pUClδ Ap^r 2δ pXNB Ap^r pUClδ derivative, containing a 4.1-kb Xbal/Nhel- fragment of e Rl-t This work pAG5δ Ap^r Cm^1* δ pAG5βP Ap^r Cm^1"; pAG5δ derivative carrying lytR This work pAG5δR Ap^r Cm^r; pAG5δ derivative carrying lytR This work

PAG58PR Em^r Cm^r; pAG5δ derivative carrying lytR and lytR This work pUClδP Ap^r pUClδ derivative carrying lytR This work pUClβR Ap^r pUClδ derivative carrying lytR This work pUClδPR Ap^r pUClδ derivative carrying lytR and lytR This work pIR12 Em^r carrying the regulatory region of Rl-t This work pIRIP Em^r pIR12 derivative carrying lytR This work pIRlR Em^r pIR12 derivative carrying lytR This work pIRlPR Em^r pIR12 derivative carrying lytR and lytR This work

Bacteriophage

Rl-t type P335, small isometric lactococcal phage, isolated from

L. lactis subsp. cremoris Rl 9, H

Em^r, Ap^r, and Cm^1* represent resistances to erythromycin, ampicillin, and chloramphenicol, respectively. With the use of two species-specific inducible expression systems we show that LytR requires an additional gene product, specified by lytR upstream of lytR , for efficient in vivo lysis of E. coli and L. lactis.

MATERIALS AND METHODS

Bacterial strains, phage, plasmids, and media

The bacterial strains, phage and plasmids used in this study are listed in Table 1. E. coli was grown in TY broth (17) or on TY broth solidified with 1.5% agar. L. lactis was grown in glucose M17 broth (21), or on glucose M17 agar. Erythromycin was used at 100 μg/ml and 5 US/ml for E. coli and L. lactis , respectively. For E. coli , ampicillin and chloramphenicol were used at a concentration of 100 μg/ml and 5 Ug/^ml» respectively.

DNA techniques

Plasmid DNA was isolated essentially by the method of Birnboim and Doly (1). Restriction enzymes, Klenow enzyme, T4 DNA ligase, and T4 DNA polymerase were obtained from Boehringer GmbH (Mannheim, Germany) and used according to the instructions of the supplier. Synthetic oligonucleotides were synthesized using an Applied Biosystems 3δlA DNA synthesizer (Applied Biosystems Inc., Foster City, Calif.). Polymerase chain reactions were performed using Vent polymerase (New England Biolabs Inc., Beverly, MA.). Samples were heated to 94 °C for 2 min, after which target DNA was amplified in 25 subsequent cycles under the following conditions: 9 °C for 1 min; 50 °C for 2 min; 73 °C for 1 min. The primers used for amplification are listed in Table 2 and sequence id no 1-4 of the Sequence Listing. E. coli was used as a host for obtaining recombinant plasmids. Transformation of E. coli was performed by the method of Mandel and Higa (12). Plasmids were introduced in L. lactis subsp. cremoris LL302, which contains a copy of the pWVOl repA gene on the chromosome to ensure efficient replication, by means of electroporation (23). DNA and protein sequences were analyzed using the programs developed by Staden (19). Analysis of the LytP protein was computed with the PC/Gene program (version 6.7; IntelliGenetics, Inc., Geneva, Switzerland) using the membrane spanning domain search program SOAP, or the β-turn search program BETATURN. Table 2. Primers used for amplification of lytP and lytR

primer DNA sequence (5'->3')

Lytl AAAACCCGGGAAGCTTGTCGACAGCAGTGATTGGTTCAACG

Lyt2 TTCTAG GCTTCCATGCCCCTTCTTTTTTATTATTGAC

Lyt3 AAAACCCGGGAAGCTTGTCGACGATAATACAGCAAGCCTAGTC

Lyt4 TTTTTCTAGAAGCTTCKATCrcG GCGGGGTTAATTTATCC

Hinάlll (AAGCTT) , Sphl (GCATGC) , and Sail (GTCGAC) restriction enzyme sites are depicted boldfaced.

IPTG and mitomycin C induction

Overnight cultures were diluted hundred-fold in fresh glucose M17 medium (L. lactis) or TY medium supplemented with 0.5% glucose (E. coli ) and grown until the culture reached an 0D600 of 0.3 at which point isopropyl-β-D-thiolgalactopyranoside (IPTG) or mitomycin C (Sigma

Chemical Co. , St.Louis, Mo. ) was added to a final concentration of 5mM or 1 μg/ml, respectively. Before the addition of IPTG, E. coli cells were collected by centrifugation and resuspended in an equal volume of TY medium without additional glucose.

Lytic activity assay

The lytic activity assay was performed essentially as described by Potvin et al . (15) with some minor adjustments as reported by Buist et al. (2).

Plasmid constructions

The lytR and lytR containing fragments of the Rl-t genome were amplified using polymerase chain reactions (PCR's). A 4.1-kb Xbal/Nhel fragment of the Rl-t genome containing both lytR and lytR was subcloned in the unique Xbal site of pUClδ resulting in the plasmid pXNB. Using pXNB as a template, amplification with three different primer combinations (lytl-lyt2, Iyt3-lyt4, and lytl-lyt4; see Fig. 1A) yielded three DNA fragments carrying either lytR, lytR , or the combined lytR and lytR , respectively. Following digestion with Sphl and Hindlll these three PCR products were subcloned in Hindlll and Sphl restricted pAG5δ, which resulted in plasmids pAG5δP, pAG5δR, and pAG5δPR, carrying lytR, lytR , and the combined lytR and lytR , respectively, under the control of the IPTG inducible P_spac promoter (Fig. IB). For lysis studies in L. lactis plasmids pAG5δP, pAG5δR and pAG5δPR were first restricted with Sphl and Sail . Subsequently, the DNA fragments, carrying lytR, LytR and the combination of lytR and LytR , were first subcloned in Sphl/SαZI-cut pUClδ. The Hindll /Hindlll fragments of these three constructs, designated pUClδP, pUClδR, and pUClδPR, were cloned in the iVruI and Hindlll sites of pIR12, resulting in the plasmids pIRIP, pIRlR, and pIRlPR, containing lytR, lytR , and both lytR and lytR, respectively, under the transcriptional control of the Rl-t promoter-operator region (Fig. 4B) . These plasmids were transformed to L. lactis subsp. lactis strain LL302 which contains a copy of the pWVOl repA gene on the chromosome to ensure efficient replication of pWVOl-derived plasmids. The construction of plasmid pIR12 was described in a co-pending application EP-94201353.3, filed on the same date entitled: Process for the lysis of a culture of lactic acid bacteria by means of a lysin, and uses of the resulting lysed culture, the specification of which is incorporated herein by reference.

RESULTS

Cloning and sequence analysis of the Rl-t lysis functions.

The switch from lysogenic to lytic life cycle of the temperate L. lactis subsp. cremoris phage Rl-t will ultimately result in host cell lysis caused by phage-encoded lysis function(s) , followed by the release of phage particles. Inspection of the DNA sequence of Rl-t revealed that ORF 23. which specifies a protein of 270 amino acids with a calculated molecular weight of 30,214 Da, shows significant similarity with the lysin genes of the L. lactis bacteriophages c2 (sequence id no δ) and φML3 (26, lδ) . The similarity between the deduced amino acid sequence of ORF 23 with the c2 lysin is shown in Figure 2. Moreover, ORF 23 specifies an amino acid sequence similar to the amino acid sequences of the N- terminal portions of the amidase Hbl of the Streptococcus pneumoniae bacteriophage HB-3 (16), and the S. pneumoniae LytA autolysin (5). Therefore, ORF 23, hereafter designated lytR (Fig. 3) (sequence id no 7), is a likely candidate for the phage-encoded lysin gene. This was not to be predicted as is apparent from the previously cited Young reference.

To test this supposition, lytR was cloned into the IPTG inducible expression-vector pAG5δ, resulting in pAG5δR (Fig. IB). Cell- free extracts of E. coli cells containing pAG5δR were assayed for lytic activity on an SDS-polyacrylamide gel in which Micrococcus lysodeikticus autoclaved cell walls were co-polymerized. After staining of the cell wall-containing gel with methylene blue, a clearing zone is expected at positions corresponding to lytic proteins due to the breakdown of incorporated cell walls. As shown in Figure 4, in cell free extracts of pAG5δ-containing E. coli cells a clearing zone was absent at the position corresponding to a protein with the expected molecular weight of the litH-encoded protein. Cell free extracts of pAG5δR-containing cells, however, gave rise to a clearing zone at the expected position. A weak clearing zone was obtained with cell free extracts of uninduced cells due to limited expression of the lytR gene. Cell free extracts of induced pAG5δR-containing cells showed an extended clearing zone, which became very large in extracts obtained two hours after induction. According to the rules of Von Heijne (25), LytR does not seem to contain a signal sequence specific for secreted proteins using the sec-dependent transport system. This apparent lack of a signal sequence has also been observed in lysins of other bacteriophages of both Gram¬ negative and Gram-positive bacteria. For host cell lysis to occur these phages require a protein that forms holes in the cytoplasmic membrane to render the host cell peptidoglycan layer accessible to the lysin (30). ORF 22, which is situated upstream of lytR , specifies a protein of 75 amino acids with a predicted molecular weight of 7.6δδ Da (sequence id no 6) . Although the predicted amino acid sequence shows no similarity with the putative hole-forming proteins of other phages, computer analysis of the protein product of ORF 22 , designated hereafter as lytR, predicted structural similarities with these proteins. Computer analysis revealed that the protein, specified by lytR, has a high probability of containing a pair of transmembrane domains, separated by a sequence with a high probability of adopting a beta turn conformation (Fig. 5)- In addition it contains a charged C terminus and is highly hydrophobic. Therefore, this protein might function as a pore-forming protein required for the release across the cytoplasmic membrane of the Rl-t encoded LytR.

LytP and lytR are required for lysis in Escherichia coli

To determine whether the lytR and lytR gene products are involved in host cell lysis, lytR, lytR , and the combination of lytR and lytR were subcloned in the inducible expression- vector pAG5δ, resulting in pAG5δP, pAG5δR and pAG5δPR, respectively (Fig. IB). Induction studies were performed with E. coli MClOOO carrying these plasmids to examine the effects of the expression of the cloned genes on the optical density of the cells (Fig. 6A) . Induction of lytR expression did not cause any lysis of pAG58R-containing E. coli cells as was determined by optical density measurements. The induction of lytR expression, however, almost immediately halted the increase in the optical density of pAG5δP- containing cells. The expression of both lytR and lytR in E. coli caused lysis. Lysis occurred almost immediately after the addition of IPTG to pAG5δPR-containing cells, as was demonstrated by the decrease in optical density which was associated with a dramatic decrease in colony forming units (CFU's) as compared to the uninduced control (Fig. 6B) . No significant difference in CFU's between cells carrying pAG5δ and pAG5δR was observed. However, the induction of lytR had a significant effect on the viability of pAG5δP-containing cells. The number of CFU's dropped more than 200-fold within two hours.

Expression of lytR and lytR in Lactococcus lactis

In order to examine the effects of the expression of either lytR, lytR or the combined lytR and lytR on the optical density of L. lactis cells, plasmids pIRIP, pIRlR, and pIRlPR were constructed (Fig. IB). Transcription of lytR, lytR , and both lytR and lytR in these plasmids is controlled by the regulatory region of phage Rl-t, which incorporates the gene specifying the repressor (rro) of Rl-t in addition to its cognate operator region (see Fig. IB) . Expression was induced by the addition of the DNA damaging substance mitomycin C. Induction studies were performed with L. lactis subsp. cremoris LL302 cells carrying the plasmids described above. Figure 7 shows that the addition of mitomycin C to L. lactis cells carrying pIR12 slows down the increase in optical density similar to pIRlP-containing L. lactis cells. The addition of mitomycin C to genetically non-modified lactococci caused lysis of a small portion of the cells (results not shown). The expression of lytR as well as the simultaneous expression of lytR and lytR led to a decrease in optical density, as compared to pIR12-containing cells to which mitomycin C had been added, indicating cell lysis.

DISCUSSION

We recently determined the nucleotide sequence of the temperate L. lactis subsp. cremoris bacteriophage Rl-t. On the basis of the similarity of the deduced amino acid sequence with various (auto)lysins we postulated that ORF 23, designated lytR , could specify the phage- encoded lysin. The lytR gene product would consist of 270 amino acids with an estimated molecular weight of 30,214 Da. By assaying cell-free extracts of E. coli cells expressing lytR , it was shown that lytR indeed specified a protein with lytic activity.

The similarity of LytR is mainly limited to the C-terminal parts of the lysins of the lactococcal bacteriophages c2 and φvML3, whereas the N-terminal part of LytR is similar to the amino acid sequence of the N-terminal portion of the S. pneumoniae LytA autolysin. It has been proposed that LytA consists of two functional modules (16), the C- terminal domain specifying the binding site to the murein substrate and the N-terminal domain determining the specificity of the enzyme. Since LytA is an iV-acetylmuramoyl-L-alanine amidase (6) , it is tempting to speculate that LytR is also an W-acetylmuramoyl-L-alanine amidase. Because of the lack of an apparent signal peptide, we hypothesized that, like many other phage-encoded lysins, LytR needs an additional factor in order to gain access to the cell wall. ORF 22 , designated lytR , which is situated immediately upstream of lytR , can specify a protein of 75 amino acids with the characteristics of a so- called holin which, for other phages, was shown to render the murein substrate accessible to lysins which lack a signal peptide (30) .

This hypothesis was corroborated by the observation that the expression of lytR is indeed needed for efficient lysis of E. coli in vivo . In fact, induction of lytR expression did not result in lysis of E. coli . However, E. coli did lyse when, in addition to lytR, lytR was also expressed. From these results it was concluded that the transit of LytR across the inner membrane is dependent on the lytR gene product. The induction of solely lytR almost immediately halted the increase in optical density and had a dramatic effect on the viability of the induced cells. This is probably caused by the spontaneous insertion of the protein into the lipid bilayer, inducing nonspecific lesions in the inner membrane and thereby dissipating the membrane potential (20) . Presumably LytP forms pores in the cytoplasmic membrane, thus allowing LytR to gain access to the cell wall. An inducible expression system for Lactococci recently developed in our laboratory , made it possible to examine the effects of expression of lytR , lytR , and the combined lytR and lytR in L. lactis . Expression of the combined lytR and lytR in L. lactis resulted in lysis of the cells. In contrast to E. coli , lysis was also observed when only lytR was expressed. Lysis of cells solely expressing lytR is probably caused by the combined effect of mitomycin C and LytR: Since mitomycin C lyses a small proportion of the cells (results not shown), LytR is extruded in the medium, thus acting upon the cell wall from without, and masking the additional requirement for LytP to effect lysis as was the case in E. coli .

For bacteriophages of both Gram-negative and Gram-positive bacteria, a system based on a murein hydrolase and a second protein required for the access of the hydrolase to its murein substrate, seems to be a general phenomenon in lysis strategies. Recently it was shown that, in addition to the B. subti lis phage φ29-encoded lysin, efficient lysis of E. coli also required the gene 14 product. Also several lactococcal bacteriophages seem to encode an additional factor needed for host cell lysis. On the basis of structural similarity, it has been postulated that the bacteriophages c2 and φvML3 encode a holin (26, 30). The deduced amino acid sequence of 0RF2 of the virulent bacteriophage φU53, isolated from L. lactis SK11 (14), also shares the characteristic structural traits of a holin, making it likely that it is involved in the translation of the phage-encoded lysin, LytA. This report, however, proves for the first time that a Lαctococcus-specified holin is required for phage-induced lysis.

DRAFT PUBLICATION 2

Development of a food-grade, thermo-inducible lysis system using the regulatory region and lysis functions of the temperate Lactococcus lactis subsp. cremoris bacteriophage Rl-t.

Introduction

The system is based on the food-grade removal of most of the genomic DNA of a temperate lactococcal bacteriophage in such a way that an inducible regulatory region of the temperate bacteriophage is directly placed upstream of the lysis functions encoded by the prophage. As an example of the general applicability of this strategy to any prophage with a similar genetic structure, bacteriophage Rl-t was taken. To obtain the desired deletion, plasmid pBTSl was constructed (Figure 8). In the future pBTS2 will be constructed in which rro is replaced by rro^τs and therefore can be used to make this system thermo-inducible. Experimental procedures

Bacterial strains, phage, plasmids, and media

The bacterial strains, phage, and plasmids used in this study are listed in Table 3- Escherichia coli JM101 was grown in TY broth (Rottlander and Trautner, 1970) with vigorous agitation, or on TY agar, at 37 °C. When needed, ampicillin, isopropyl-β-D-thiogalactopyranoside (IPTG) and 5-bromo-4-chloro-3^_indolyl β-galactopyranoside (X-gal) (all from Sigma Chemical Co., St. Louis, MO.) were used at concentrations of 100 μg/ml, ImM and 0.002J. (wt/vol), respectively. L. lactis subsp. cremoris was grown in M17 broth (Terzaghi and Sandine, 1975), or on M17 agar, supplemented with 0. % glucose or lactose at 30 °C. When appropriate, erythromycin (Boehringer Mannheim, GmbH, Germany) and X-gal were used at concentrations of μg/ml and 0.004^*5. (wt/vol), respectively.

General DNA techniques and transformation

General DNA techniques were performed as described by Sambrook et al. (19δ9). Plasmid DNA was isolated by the method of Birnboim and Doly (1979) and by using QIAGEN Midi-Plasmid isolation columns (Qiagen Inc..Chatsworth, Ca. ) . Restriction enzymes, alkaline phosphatase and T4 DNA ligase were obtained from Boehringer Mannheim and were used according to the instructions of the supplier. Transformation of E. coli was performed as described by Mandel and Higa (1970). L. lactis LLlOδ was transformed by electroporation using a Gene Pulser (Bio-Rad Laboratories, Richmond, Calif.), as described by Holo and Nes (19δ9) with the modifications suggested by Leenhouts and Venema (1993)_' Electroporation of L. lactis Rl, R131 and R1K10 was done as decribed by van der Lelie et al. (19δδ). Oligonucleotides were synthesized using an Applied Biosystems 3δlA DNA synthesizer (Applied Biosystems, Inc., Foster City, Calif.). Polymerase chain reactions (PCR's) were performed using Vent polymerase (New England Biolabs, Inc., Beverly, MA.). After heating of the samples to 94 "C for two minutes, target DNA was amplified in 30 subsequent cycles under the following conditions: 9 °C for 1 min; 50 °C for 2 min; 73 °C for 3 min. PCR fragments were purified using the QIAEX DNA Gel Extraction Kit (Qiagen Inc.). Isolation of Rl-t phage particles and DNA

An overnight culture of L. lactis Rl was diluted hundred-fold in 500 ml fresh lactose M17 medium and grown until the culture reached an 0D600 of 0.8 at which point mitomycin C (Sigma) was added to a final concentration of 2.5 μg/ml. Incubation at 30 °C was continued in the dark until lysis occurred. Cells debris was removed by centrifugation for 10 min at 6000 rpm. Phage particles were precipitated by incubation with NaCl (0.5 M) and polyethylene glycol 6000 (10 % [wt/vol]) for three hours on ice and purified by a CsCl step gradient as described by Sambrook et al. (1989). The bacteriophage Rl-t suspension was dialysed against several changes of 150 mM NaCl, 15 mM trisodiumcitrate. Phage DNA was obtained by extracting the suspension twice with phenol. The DNA solution was subsequently dialysed against 10 mM Tris-HCl/1 mM EDTA, pH 8,0.

Sequencing attB-siteε

The attachment sites attL and attR of the bacteriophage Rl-t lysogen L. lactis Rl were determined by means of cycle sequencing using the CircumVent Thermal Cycle Dideoxy DNA Sequencing Kit with Vent (exo^") DNA Polymerase (Biolabs, New England). Primers attBL and attBR with flanking Xibαl and PstI sites (Table 4) were used for cloning the attB site of L. lactis MG1363- The 272-bρ PCR fragment obtained with attBL and attBR was cut with Xbal and PstI and cloned in the Xbal/PstI sites of pUClδ and sequenced using the dideoxy-chain-termination method (Sanger et al. , 1977) and the T7 sequencing kit (Pharmacia AB, Uppsala, Sweden).

Phage titre determination

Supernatant taken from L. lactis R131 was diluted in 1 mM MgS0_ή.

The indicator strain L. lactis R1K10 was grown in GM17 until the 0D600 was 0.7_' 2 ml of culture were centrifuged and cells were resuspended in 2 ml 1 mM MgSO^. An aliquot of 100 μl diluted phage-particles were added to 200 μl cells. After incubation at room temperature for 20 minutes 3 ^ml Top agar (0.7# GM17 agar, 0.25% glycine, 10 mM CaCl₂) were added, mixed, and poored on a GM17 agar-plate ( 1.5% ) containing glycine (0.25%) and CaCl₂ (10 mM) . The plates were incubated overnight at 30 °C and the number of plaques were determined. Rely sogeni sat ion of L. lactis R1K10

After infection of L. lactis R1K10 with Rl-t phage particles, turbid plaques will be picked and tested for their ability to give UV- induction of prophage. Centrifuged cells of exponentially growing cultures will be resuspended in 1 ml 1 mM MgSOj, and irradiated with a Mineralight u.v. lamp (model UVG-54, 254 nm, 3.2 Jm-2s-l: Ultra-violet Products Inc.) for 10 seconds, then 1 ml 2 times GM17 + 10 mM CaCl₂ will be added. The culture will be incubated at 30 °C until lysis occurs.

mtomycin C induction

Overnight cultures of L. lactis were diluted hundred-fold in fresh glucose M17 medium and grown until an 0D600 of 0.3 at which point mitomycin C was added to a final concentration of 1 μg/ml.

Plasmid constructions

The plasmid pORIRlPR was constructed in L. lactis by subcloning the 2δ64-bp £c_>RI/SphI-fragment of pIRlPR into pORI28θ restricted with J-coRI and Sphl (Figure 8) . Homology analysis showed that ORF 25 of the Rl-t genome shared 9 % identity with the integrase-gene of bacteriophage phi LC3 (Lillehaug and Birkeland, 1993) and was therefore called intR. The intR region was amplified with flanking Sαcl and Xt>αl sites using PCR and primers intl and int2 (Table 4). Plasmid pUClδInt was constructed by cloning the resulting 1326-bp PCR-fragment digested with Sαcl and Xbal into the Sacl/Xbal sites of pUClδ. A 1047-bp Hindll fragment of pUClδInt, which contains the 5'-truncated intR , was subcloned into the alkaline phosphatase-treated Smαl-site of pUClδ. Both the resulting plasmid pUClδlntd and pUClδInt were constructed in E. coli JM101 (Figure 9). The 5'-truncated intR was cut out of pUClδlntd with EcόrXI and SαmHI and subcloned in the EeoRI and BαmHI sites of pORRlPR, resulting in pBTSl (Figure δ) . The latter construction was done in L. lactis LLlOδ. In the future rro will be replaced by rro^τs when this temperature inducible repressor is available. This will be done by replacing the 946-bp NcoI-EcoRI fragment of pBTSl with the comparable fragment containing rro^τs. This will result in pBTS2. Plasmid pIRl4 deposited at the Centraal Bureau voor Schimmelcultures in Baarn, The Netherlands comprises such a temperature sensitive rro . A detailed description is given in European Patent Application 94201355-δ.

Results

Plasmid pBTSl was introduced in L. lactis LLlOδ. As can be seen in figure 10, pBTSl is still able to give inducible lysis after mitomycin C induction.

The initial idea was to introduce pBTSl in L. lactis Rl. As pBTSl cannot replicate in L. lactis (it lacks the gene for the plasmid replication protein RepA) it will integrate into the chromosome of Rl under selective conditions. The integration will take place at either of three homologous regions: the intfl-region (A), the regulatory-region (B) or the region of the lytic functions (C) (Figure 11). With appropriate primer-sets the place of integration can be distinguished (Table 5 and Figure 11). After the first recombination step in the regions A or C, a second recombination step in the region C or A, respectively, will delete the whole prophage and plasmid from the chromosome of strain Rl, except for the desired functions. These two recombination steps will place the lytic functions directly under control of the regulatory region of Rl-t, in a one copy situation at a well defined and stable place in the chromosome of L. lactis . If the integration takes place in region B (regulatory region), the second recombination step will not result in the substitution of intR and rro for the 5'-truncated intR and rro^τs (future work), respectively. The integrase deletion is needed to prevent intR catalysed excision.

Because of the extremely low transformation efficiency of L. lactis Rl (less than 1 transformant/μg pVE6007) we tried to cure the strain of its natural plasmids. We succeeded in curing two plasmids of approximately 50 kb and 2 kb, by growing L. lactis Rl on glucose and incubation at 37 "C. The resulting strain L. lactis R131 was shown by UV- induction to still contain Rl-t prophage.

Sofar we have not succeeded in introducing pBTSl into L. lactis R131. It appears that the prophage is induced after the electroporation. This, together with the presence of MgCl₂ and CaCl₂ in the recovery medium, makes the cells lyse (Table 6).

Therefore, we are currently trying to obtain the pBTSl integrant by two additional strategies. Firstly, pBTSl and pVE6007 will be introduced together in L. lactis R1K10. pVE6007 encodes a temperature sensitive RepA protein enabling pBTSl to replicate. After relysogenisation of the resulting double transformant with phage Rl-t, pBTSl will integrate into the chromosome when raising the temperature to 37 °C. The second way to obtain a 'food-grade' inducible lysis system is to introduce pBTSl and pVE6007 together in L. lactis MGI363. The attB- region of this strain has been sequenced and appeared to have an homology of 99# with the αttB-region of L. lactis R1K10 (Figure 12). L. lactis MGI363 will be transformed with Rl-t DNA ligated at its cos-sites. After intfl-catalysed integration of the Rl-t chromosome into the attachment site of MG1363 (Figure 12) , pBTSl can integrate when raising the temperature to 37 °C.

Figure legends

Figure 8 Cloning scheme for the construction of pBTSl. EmR, erythromycin resistance gene; rro , Rl-t repressor gene; po , promoter(pl/p2)/operator region from bacteriophage Rl-t; tec , topological equivalent of lambda cro; lytR, Rl-t holin gene; lytR , Rl-t lysin gene; T, transcription terminator of prtP; ORI+, origin of replication of the lactococcal plasmid pWVOl; p32, promoter sequence of 0RF32 of L. lactis ; lacZ, β- galactosidase gene of E. coli ; ' intR , 5'-truncated Rl-t integrase gene; amp , ampicillin resistance gene. Only relevant restriction enzyme sites are shown.

Figure 9

Cloning scheme for the construction of pUClδlntd in which the integrase gene of bacteriophage Rl-t is 5'-truncated. intR , Rl-t integrase gene; lacZ , β-galactosidase gene of E. coli ; amp, ampicillin resistance gene; ' intR , 5'-truncated Rl-t integrase gene. Only relevant restriction enzyme sites are shown.

Figure 10

Effect of mitomycin C on 0D600 of L. lactis LL108 containing p0RI13 (Leenhouts and Venema, 1993) (open square) and pBTSl (filled triangle) . The cultures were induced with 1 μg/ml mitomycin C at time zero (dotted line) .

Figure 11

Schematic representation of the food-grade removal of most of the genomic DNA of Rl-t prophage in such a way that the inducible regulatory region of the temperate bacteriophage is directly placed upstream of the lysis functions encoded by the prophage. As an example, the integration of pBTSl in the integrase gene is depicted and the second recombination occurs in the region of the lytic functions. (A), integrase-region; (B) , regulatory-region; (C) , region of the lytic functions; attR, 'right' phage-host junction; intR, Rl-t integrase gene; rro , Rl-t repressor gene; tec , topological equivalent of lambda cro ; PROPHAGE, genomic DNA of Rl-t prophage; lytP, Rl-t holin gene; lytR , Rl-t lysin gene; αttl, 'left' phage-host junction; EmR , erythromycin resis- tance gene; lacZ , β-galactosidase gene of E. coli ; ' intR , 5'"truncated Rl-t integrase gene. The genes derived from the plasmid pBTSl are shaded. The primers: attBR, R100, attBL and R4θ are listed in table 4.

Figure 12

Comparison of the attB regions of L. lactis R1K10 and MGI363. The attB site is shaded. Asterisks indicate identical nucleotides.

TABLE 3. Bacterial strains, phages, and plasmid

Bacterial strain, phage Relevant Source or or plasmid characteristic's) reference

Bacterial strains L. lactis subsp. cremoris LL108 MG1363 (plas id-free strain) Leenhouts, unpublished results carrying the pWVOl repA gene, and the Cm' gene on the chromosome (high copy)

Rl Original Rl-t lysogenic L. lactis Lowrie, 1974 subsp. cremoris strain

R131 L. lactis Rl cured of two This study natural plasmids

R1K10 Rl-t indicator strain lab collection Escherichia coli JM101 supE thi Cι(lac-proAB-) Messing, 1979

[F traD36 proAB' lacF lacZdMlS)

Bacteriophage Rl-t type P335, small isometric temperate Lowrie, 1974 lactococcal phage, isolated from

L. lactis subsp. cremoris Rl

Plasmids pIRlPR Em^r Nauta et al., 1994"^b pORI280 Em^r Leenhouts and Venema, 1993 pORIRlPR Em^r This study pUC18 Ap' Yanisch-Perron et al., 1985 pUC18Int Ap' This study pUC18Intd Ap' This study pBTSl Em' This study pVE6007 Cm^r Maguin et al., 1992 pORI13 Em^r Leenhouts and Venema, 1993 TABLE 4. Nucleotide sequences of PCR primers

Primer Sequence

intl(_V._I) 5*-GCGCG_____C_I__CCGCTCAAGr-TGACGACAAGGG-3' (SEQ id no 9) in\2(Xbaϊ) 5'-GCGα^-__JΔGGATAGATGTG(-T^TAGATAATGGC-3^, (SEQ id no 10) attBL(XZwI) 5'-CK GCI_2--_-_-_^CAG<_TATrCTATCTGTrCGTA^ (SEQ id no 11) attBR(P..I) 5'-GCGCαΩC___jTACCTAAGCACACGAAGGCCTAGG-3' (SEQ id no 12)

R40 5'-CAAATTGGATAGTTAAGG-3' (SEQ id no 13)

R100 5^•-CTCGTGATTACTATTGG-3^, (SEQ id no 14)

^* The restriction enzyme sites are underlined.

TABLE 5. Primer-sets to check integration

Strain Primer-sets^{1, 2} artBR/RlOO attBL/R40

L lactis Rl 2271 bp - pBTSl integrated in: άilR-region (A) 1687 bp - regulatory-region (B) 2271 bp - lytic-region (C) 2271 bp 2249 bp

After second recomb. 1687 bp 2249 bp

¹ Primers are listed in Table 4. The sizes of the expected PCR-fragments are given.

TABLE 6. Rl-t induction by electrical pulse

Electrical Medium² OD600 of R131³ PFU/ml pulse (kV)¹ 1.5 hrs 4.5 hrs 21.5 hrs 4.5 hrs

0 GSM17 0.323 1.097 2.248 1.4 * lO^**

2.5 GSM17 0.228 0.783 2.000 4.4 * 10⁵

0 GSM17MC 0.242 0.530 1.120 1.1 * 10⁶

2.5 GSM17MC 0.190 0.189 0.107 1.9 * 10⁷

¹ Electroporation cuvette (2-mm electrode gap); 25 μF 200Ω

² Holo and Ness, 1989.

³ 40 μl competent cells (van der Lelie et al., 1988), cells harsvested at OD600 = 0.714

SEQUENCE LISTING

( 1 ) GENERAL INFORMATION:

( i ) APPLICANT :

(A) NAME: Quest International

(B) STREET: Huizerstraatweg 28

(C) CITY: Naarden (E) COUNTRY: The Netherlands

(F) POSTAL CODE (ZIP): 1411 GP

(G) TELEPHONE: 02159 - 99111 (H) TELEFAX: 02159 - 46067

(ii) TITLE OF INVENTION: Process for inhibiting the growth of a culture of lactic acid bacteria, and optionally lysing the bacterial cells, and uses of the resulting lysed culture.

(iii) NUMBER OF SEQUENCES: 8

(iv) COMPUTER READABLE FORM:

(A) MEDIUM TYPE: Floppy disk

(B) COMPUTER: IBM PC compatible

(C) OPERATING SYSTEM: PC-DOS/MS-DOS (D) SOFTWARE: Patentln Release #1.0, Version #1.25 (EPO)

(v) CURRENT APPLICATION DATA: APPLICATION NUMBER:

(2) INFORMATION FOR SEQ ID NO: 1:

(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 4l base pairs (B) TYPE: nucleic acid

(C) STRANDEDNESS: double

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic) (vi) ORIGINAL SOURCE:

(A) ORGANISM: Lactococcus phage Rl-t

(C) INDIVIDUAL ISOLATE: primer LYT1

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 1:

AAAACCCGGG AAGCTTGTCG ACAGCAGTGA TTGGTTCAAC G 4l

(2) INFORMATION FOR SEQ ID NO: 2:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 39 base pairs

(B) TYPE: nucleic acid (C) STRANDEDNESS: double

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(vi) ORIGINAL SOURCE:

(A) ORGANISM: Lactococcus phage Rl-t

(C) INDIVIDUAL ISOLATE: primer LYT2

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 2:

TTCTAGAAGC TTGCATGCCC CTTCTTTTTT ATTATTGAC 39

(2) INFORMATION FOR SEQ ID NO: 3:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 3 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: double (D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(vi) ORIGINAL SOURCE: (A) ORGANISM: Lactococcus phage Rl-t (C) INDIVIDUAL ISOLATE: primer LYT3

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 3=

AAAACCCGGG AAGCTTGTCG ACGATAATAC AGCAAGCCTA GTC 43

(2) INFORMATION FOR SEQ ID NO: 4:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 4l base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: double (D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(vi) ORIGINAL SOURCE: (A) ORGANISM: Lactococcus phage Rl-t

(C) INDIVIDUAL ISOLATE: primer LYT4

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 4:

TTTTTCTAGA AGCTTGCATG CGAAGCGGGG TTAATTTATC C 4l

(2) INFORMATION FOR SEQ ID NO: 5:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 1200 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: double

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(vi) ORIGINAL SOURCE:

(A) ORGANISM: Lactococcus phage Rl-t (C ) INDIVIDUAL ISOLATE : Fig . 3 cds lytP and cds lytR

( ix) FEATURE :

(A) NAME/KEY: CDS

(B) LOCATION: 103-.328

(ix) FEATURE:

(A) NAME/KEY: CDS

(B) LOCATION: 331.-1141

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 5 '

TCTACAGGTA CATGGGAAAA TATCGGTTCA GCAGTGATTG GTTCAACGAC AATATATTAT 60

TGGAAACGAA CTGCATAAAA AATAAAAAAT AGGAGAAAGA AC ATG AAA ACA TTT 114

Met Lys Thr Phe 1

TTT AAA GAT ATG GCA GAA CGT GCC ATT AAA ACA TTT GCA CAA GCA ATG 162 Phe Lys Asp Met Ala Glu Arg Ala He Lys Thr Phe Ala Gin Ala Met 5 10 15 20

ATT GGC GCT TTG GGT GCT GGT GCC ACA GGC TTA ATT GGG GTT GAT TGG 210 He Gly Ala Leu Gly Ala Gly Ala Thr Gly Leu He Gly Val Asp Trp 25 30 35

CTT CAA GCC TTG AGT ATC GCA GGG TTT GCA ACA GTG GTA TCA ATT CTT 258 Leu Gin Ala Leu Ser He Ala Gly Phe Ala Thr Val Val Ser He Leu 40 45 50

ACT TCA TTA GCA AGT GGG ATT CCG GGC GAT AAT ACA GCA AGC CTA GTC 306 Thr Ser Leu Ala Ser Gly He Pro Gly Asp Asn Thr Ala Ser Leu Val 55 60 65

AAT AAT AAA AAA GAA GGG GAA T AA ATG ACA ATT TAC GAC AAA ACG TTC 35 Asn Asn Lys Lys Glu Gly Glu Met Thr He Tyr Asp Lys Thr Phe 70 75 1 5 CTA CTC GGC ACA GGT CAA GGT TCG TCA CAA AAG GCG AGT AAT CGA TAT 402 Leu Leu Gly Thr Gly Gin Gly Ser Ser Gin Lys Ala Ser Asn Arg Tyr 10 15 20

ATC GTG ATT CAC GAT ACC GCC AAT GAT AAT AAC CAA GGT GAT AAT AGT 450 He Val He His Asp Thr Ala Asn Asp Asn Asn Gin Gly Asp Asn Ser 25 30 35 **0

GCC ACA AAT GAA GCG AGT TAT ATG CAC AAT AAC TGG CAA AAT GCC TAT 49δ Ala Thr Asn Glu Ala Ser Tyr Met His Asn Asn Trp Gin Asn Ala Tyr

45 50 55

ACT CAT GCC ATT GCT GGC TGG GAT AAA GTG TAT TTG GTA GGA GAA CCT 5 6 Thr His Ala He Ala Gly Trp Asp Lys Val Tyr Leu Val Gly Glu Pro 60 65 70

GGA TAT GTT GCT TAT GGT GCA GGG AGT CCA GCT AAT GAA CGC TCA CCG 594 Gly Tyr Val Ala Tyr Gly Ala Gly Ser Pro Ala Asn Glu Arg Ser Pro 75 60 65

TTC CAA ATC GAA CTC TCT CAC TAT TCA GAC CCA GCT AAA CAA CGT TCT 642 Phe Gin He Glu Leu Ser His Tyr Ser Asp Pro Ala Lys Gin Arg Ser 90 95 100

TCA TAT ATC AAC TAT ATC AAT GCT GTG CGT GAA CAA GCA AAA GTA TTC 690 Ser Tyr He Asn Tyr He Asn Ala Val Arg Glu Gin Ala Lys Val Phe 105 HO 115 120

GGT ATC CCT CTT ACT CTT GAT GGA GCA GGT AAT GGT ATC AAA ACT CAT 738 Gly He Pro Leu Thr Leu Asp Gly Ala Gly Asn Gly He Lys Thr His

125 130 135

AAA TGG GTT TCG GAT AAC CTT TGG GGA GAC CAT CAA GAC CCT TAC TCT 786 Lys Trp Val Ser Asp Asn Leu Trp Gly Asp His Gin Asp Pro Tyr Ser 140 145 150

TAT TTA ACA CGC ATT GGT ATT AGC AAA GAC CAA CTC GCC AAA GAC TTA δ34 Tyr Leu Thr Arg He Gly He Ser Lys Asp Gin Leu Ala Lys Asp Leu 155 160 165 GCA AAC GGT ATT GGT GGG GCA TCG AAA TCT AAT CAA TCT AAT AAC GAT δδ2 Ala Asn Gly He Gly Gly Ala Ser Lys Ser Asn Gin Ser Asn Asn Asp

GAT TCA ACA CAC GCA ATC AAC TAC ACA CCT AAC ATG GAG GAA AAA GAA 930 Asp Ser Thr His Ala He Asn Tyr Thr Pro Asn Met Glu Glu Lys Glu

165 190 195 200

ATG ACT TAT CTT ATT TTT GCA AAA GAC ACT AAA CGC TGG TAC ATC ACA 97δ Met Thr Tyr Leu He Phe Ala Lys Asp Thr Lys Arg Trp Tyr He Thr

205 210 215

AAC GGT ATT GAA ATC CGT TAT ATC AAA ACT GGT AGA GTT CTT GGA AAT 1026 Asn Gly He Glu He Arg Tyr He Lys Thr Gly Arg Val Leu Gly Asn 220 225 230

TAT CAA AAT CAA TGG TTG AAA TTC AAA CTT CCT GTG GAT ACT ATG TTC 1074 Tyr Gin Asn Gin Trp Leu Lys Phe Lys Leu Pro Val Asp Thr Met Phe 235 240 245

CAA GCA GAA GTC GAT AAA GAG TTT GGA ACT GGA GCA ACA AAT CCA AAT 1122 Gin Ala Glu Val Asp Lys Glu Phe Gly Thr Gly Ala Thr Asn Pro Asn 250 255 260

CGT GAC ATT TCA AAA GGA T AAATTAACCC CGCTTCGGCG GGTGTTTTTT 1171

Arg Asp He Ser Lys Gly 265 270

TAAATATAAT TTATTCAAAT AACATTTTT 1200

(2) INFORMATION FOR SEQ ID NO: 6:

(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 75 amino acids

(B) TYPE: amino acid (D) TOPOLOGY: linear

(ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 6:

Met Lys Thr Phe Phe Lys Asp Met Ala Glu Arg Ala He Lys Thr Phe 1 5 10 15

Ala Gin Ala Met He Gly Ala Leu Gly Ala Gly Ala Thr Gly Leu He 20 25 30

Gly Val Asp Trp Leu Gin Ala Leu Ser He Ala Gly Phe Ala Thr Val 35 40 45

Val Ser He Leu Thr Ser Leu Ala Ser Gly He Pro Gly Asp Asn Thr 50 55 60

Ala Ser Leu Val Asn Asn Lys Lys Glu Gly Glu 65 70 75

(2) INFORMATION FOR SEQ ID NO: 7:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 270 amino acids

(B) TYPE: amino acid (D) TOPOLOGY: linear

(ii) MOLECULE TYPE: protein

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 7:

Met Thr He Tyr Asp Lys Thr Phe Leu Leu Gly Thr Gly Gin Gly Ser 1 10 15

Ser Gin Lys Ala Ser Asn Arg Tyr He Val He His Asp Thr Ala Asn 20 25 30

Asp Asn Asn Gin Gly Asp Asn Ser Ala Thr Asn Glu Ala Ser Tyr Met 35 40 45 His Asn Asn Trp Gin Asn Ala Tyr Thr His Ala He Ala Gly Trp Asp 50 55 60

Lys Val Tyr Leu Val Gly Glu Pro Gly Tyr Val Ala Tyr Gly Ala Gly 65 70 75 60

Ser Pro Ala Asn Glu Arg Ser Pro Phe Gin He Glu Leu Ser His Tyr 65 90 95

Ser Asp Pro Ala Lys Gin Arg Ser Ser Tyr He Asn Tyr He Asn Ala 100 105 110

Val Arg Glu Gin Ala Lys Val Phe Gly He Pro Leu Thr Leu Asp Gly 115 120 125

Ala Gly Asn Gly He Lys Thr His Lys Trp Val Ser Asp Asn Leu Trp 130 135 140

Gly Asp His Gin Asp Pro Tyr Ser Tyr Leu Thr Arg He Gly He Ser 145 150 155 160

Lys Asp Gin Leu Ala Lys Asp Leu Ala Asn Gly He Gly Gly Ala Ser 165 170 175

Lys Ser Asn Gin Ser Asn Asn Asp Asp Ser Thr His Ala He Asn Tyr ιδo 185 190

Thr Pro Asn Met Glu Glu Lys Glu Met Thr Tyr Leu He Phe Ala Lys 195 ^" 200 205

Asp Thr Lys Arg Trp Tyr He Thr Asn Gly He Glu He Arg Tyr He 210 215 220

Lys Thr Gly Arg Val Leu Gly Asn Tyr Gin Asn Gin Trp Leu Lys Phe 225 230 235 240

Lys Leu Pro Val Asp Thr Met Phe Gin Ala Glu Val Asp Lys Glu Phe 245 250 255 Gly Thr Gly Ala Thr Asn Pro Asn Arg Asp He Ser Lys Gly 260 265 270

(2) INFORMATION FOR SEQ ID NO: 8:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 241 amino acids

(B) TYPE: amino acid (C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: protein

(vi) ORIGINAL SOURCE:

(A) ORGANISM: Lactococcus lactis subsp. cremoris

(C) INDIVIDUAL ISOLATE: Fig.2 c2 lysin

(xi ) SEQUENCE DESCRIPTION : SEQ ID NO : 8:

Leu Phe Pro Tyr Lys Lys Thr He He He He Gly Gly Gly Asn He 1 5 10 15

Lys Val Ser Gin Asn Gly Leu Asn Leu He Lys Glu Phe Glu Gly Cys 20 25 30

Arg Leu Thr Ala Tyr Lys Pro Val Pro Trp Glu Gin Met Tyr Thr He 35 40 45

Gly Trp Gly His Tyr Gly Val Thr Ala Gly Thr Thr Trp Thr Gin Ala 50 55 60

Gin Ala Asp Ser Gin Leu Glu He Asp He Asn Asn Lys Tyr Ala Pro 65 70 75 80

Met Val Asp Ala Tyr Val Lys Gly Lys Ala Asn Gin Asn Glu Phe Asp 65 90 95 Ala Leu Val Ser Leu Ala Tyr Asn Cys Gly Asn Val Phe Val Ala Asp 100 105 HO

Gly Trp Ala Pro Phe Ser His Ala Tyr Cys Ala Ser Met He Pro Lys 115 120 125

Tyr Arg Asn Ala Gly Gly Gin Val Leu Gin Gly Leu Val Arg Arg Arg 130 135 140

Gin Ala Glu Leu Asn Leu Phe Asn Lys Pro Val Ser Ser Asn Ser Asn 145 150 155 160

Gin Asn Asn Gin Thr Gly Gly Met He Lys Met Tyr Leu He He Gly 165 170 175

Leu Asp Asn Ser Gly Lys Ala Lys His Trp Tyr Val Ser Asp Gly Val ιδo 185 190

Ser Val Arg His Val Arg Thr He Arg Met Leu Glu Asn Tyr Gin Asn 195 200 205

Lys Trp Ala Lys Leu Asn Leu Pro Val Asp Thr Met Phe He Ala Glu 210 215 220

He Glu Ala Glu Phe Gly Arg Lys He Asp Met Ala Ser Gly Glu Val 225 230 235 240

Lys

List of references

1. WO 90/00599 (AGRICULTURAL _. FOOD RESEARCH COUNCIL; M.J. Gasson) published 25 January 1990; Uses of viral enzymes

2. CA. Shearman, K. Jury &. M.J. Gasson (AFRC); Biotechnology 10. (Feb. 1992) 196-199; Autolytic Lactococcus lactis expressing a lactococcal bacteriophage lysin gene

3. C. Platteeuw and W.M. de Vos (NIZ0) ; Gene 118 (1992) 115-120; Location, characterization and expression of lytic enzyme- encoding gene, lytA , of Lactococcus lactis bacteriophage φUS3

4. R. Young; Microbiol. Reviews 56 (1992) 430-4δl; Bacteriophage Lysis: Mechanism and Regulation; esp. pages 468-472: Lysis in Phage Infections of Gram-Positive Hosts, and Perspectives 5- C. Shearman, H. Underwood, K. Jury, and M. Gasson (AFRC); Mol. Gen. Genet. 218 (19δ9) 214-221; Cloning and DNA sequence analysis of a Lactococcus bacteriophage lysin gene

6. L.J.H. Ward, T.P.J. Beresford, M.W. Lubbers, B.D.W. Jarvis and A.W. Jarvis; Can. J. Microbiol. 33 (1993) 767-774; Sequence analysis of the lysin gene region of the prolate lactococcal bacteriophage c2

7. EP-A2-0 510 907 (AGRICULTURAL _. FOOD RESEARCH COUNCIL; M.J. Gasson) published 2δ October 1992; Bacteriophage lysins and their applications in destroying and testing for bacteria

Literature references of the draft publication 1 1 Birnboim, H.C., and Doly, J. (1979). A rapid alkaline extraction procedure for screening recombinant plasmid DNA. Nucleic Acids Res. 7: 1513-153- 2 Buist, G., Haandrikman, A.J., Leenhouts, K., Venema, G., and Kok, J. (1994). Molecular cloning and nucleotide sequence of a major Lactococcus lactis peptidoglycan hydrolase gene (acmA) . (to be published).

3 Casadaban, M.J., and Cohen, S.N.. (19δ0). Analysis of gene control signals by DNA fusion and cloning in Escherichia coli .

J. Mol. Biol. 138: 179-207.

4 Denhardt, D.T., Sinsheimer, R.L. (1965). The process of infection with bacteriophage φX174, HI. Phage maturation and lysis after synchronized infection. J. Mol. Biol. 12: 641-646.

5 Diaz, E., Lopez, R., and Garcia, J.L. (1992). Role of the major pneumococcal autolysin in the atypical response of a clinical isolate of Streptococcus pneumoniae . J. Bacteriol. 174: 550δ- 5515-

6 Howard, L.V., and Gooder, H. (1974). Specificity of the autolysin of Streptococcus (Diplococcus) pneumoniae . J. Bacteriol. 117: 794-δθ4.

7 Hutchison, C.A., III, and Sinsheimer, R.L. (1966). The process of infection with bacteriophage φl74. X. Mutations in a φX lysis gene. J. Mol. Biol. 18: 429-447- δ Jaacks, K.J., Healy, J., Losick, R., and Grossman, A.D. (19δ9). Identification and characterization of genes controlled by the sporulation-regulatory hene spoH in Baci llus subti lis . J. Bacteriol. 171: 4121-4129.

9 Jarvis, A.W., Fitzgerald, G.F., Mata, M., et al. (1991)- Species and type phages of lactococcal bacteriophages. Intervirology, 32: 2-9.

11 Lowrie, R.J. (1974). Lysogenic Strains of Group N Lactic Streptococci. Applied Microbiology, 27: 210-217.

12 Mandel, M. , and Higa, A. (1970). Calcium-dependent bacteriophage DNA infection. J. Mol. Biol. 53: 159-162.

14 Platteeuw, C, and De Vos, W.M. (1992). Location, characterization and expression of lytic enzyme-encoding gene, lytA , of Lactococcus lactis bacteriophage φUS3- Gene 118: 115-

120.

15 Potvin, C, Leclerc, D. , Tremblay, G. , Asselis, A., and Bellemare, G. (19δδ). Cloning, sequencing and expression of a Baci llus bacteriolytic enzyme in Escherichia coli . Mol. Gen. Genet. 214: 241-246.

16 Romero, A., Lopez, R. , and Garcia, P. (1990). Sequence of the Streptococcus pneumoniae bacteriophage HB-3 amidase reveals high homology with the major host autolysin. J. Bacteriol. 172: 5064-5070. 17 Rottlander, E. , and Trautner, T.A. (1970). Genetic and transfection studies with Baci llus subti lis phage SP50. J. Mol.Biol. 108:47-60. lδ Shearman, A. , Underwood, H. , Jury, K. , and Gasson, M. (19δ9). Cloning and DNA sequence analysis of a Lactococcus bacteriophage lysin gene. Mol.Gen.Genet. 218: 214-221.

19 Staden, R. (19δ2). Automation of the computer handling of gel reading data produced by the shotgun method of DNA sequencing.

Nucleic Acids Res. 10: 4731-4751- 0 Steiner, M. , Lubitz, W. , and Blasi. U. (1993). The missing link in phage lysis of Gram-positive bacteria: gene 14 of Baci llus subti lis phage φ29 encodes the functional homolog of the lambda S protein. J. Bacteriol. 175: 103δ-lθ42.

21 Terzaghi, B.E., and Sandine, W.E. (1975). Improved medium for lactic streptococci and their bacteriophages. Appl. Microbiol. 29: 607-613. 2 Tinoco, I., Jr. Bore, P.N., Dengler, B., Levine., M.D., Uhlenbeck, O.C , Crothers, D.M. , and Gralla, J. (1973) •

Improved estimation of secundary structure in ribonucleic acids. Nature 246: 4θ-4l. 3 Van der Lelie, D., Van der Vossen, J.M.B.M, and Venema, G. (19δδ). Effect of plasmid incompatibility on DNA transfer to Streptococcus cremoris . Appl. Environ. Microbiol. 5 : β65^_δ71- 5 Von Heijne, G. (19δ6). A new method for predicting signal peptide cleavage sites. Nucleic Acids Res. 14: 4663-4690. 6 Ward, L.J.H., Beresford, T.P.J., Lubbers, M.W., Jarvis, B.D.W., and Jarvis, A.W. (1993)- Sequence analysis of the lysin gene region of the prolate lactococcal bacteriophage c2. Can. J.

Microbiol. 39: 767~77 . 7 Witte, A., Wanner, G., Blasi, U., Halfmann, Szostak, M., and Lubitz, W. (1990). Endogenous transmembrane tunnel formation mediated by φX174 lysis protein E. J. Bacteriol. 172: 4109- 4114.

2δ Yanisch-Perron, C, Vieira, J., and Messing, J. (1985). Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mplδ and pUC19 vectors. Gene 33: 103-119.

29 Yansura, D.G., and Henner, D.J. (19δ4). Use of the Escherichia coli lac repressor and operator to control gene expression in

Baci llus subti lis . Proc. Natl. Acad. Sci. USA 81: 439-443.

30 Young, R. (1992). Bacteriophage lysis: Mechanism and regulation. Microbiol. Res. 56: 430-461. References of draft publication 2

Birnboim, H.C., and Doly, J. 1979. A rapid alkaline extraction procedure for screening recombinant plasmid DNA. Nucleic Acids Res. 7:1513-1523-

Holo, H. and I.F. Nes. 19δ9. High-frequency transformation, by electroporation, of Lactococcus lactis subsp. cremoris grown with glycine in osmotically stabilized media. Appl. Environ. Microbiol.. 5:3119-3123-

Leenhouts, K.J. and G. Venema. 1993- Lactococcal plasmid vectors, p. 65- 94. In K. G. Hardy (ed.), Plasmids, a practical approach. Oxford University Press, Oxford.

Leenhouts, K. J. (unpublished results)

Lillehaug, D. , and N. K. Birkeland. 1993- Characterization of genetic elements required for site-specific integration of the temperate lactococcal bacteriophage φLC3 and construction of integration-negative φLC3 mutants. J. of Bact.. 175:1745-1755-

Lowrie, R. J. 1974. Lysogenic strains of group N Lactic Streptococci . Appl. Microbiol. 27:210-217.

Maguin, E. , P. Duwat, T. Hege, D. Ehrlich, and A. Gruss. 1992. New thermosensitive plasmid for gram-positive bacteria. Journal of Bact. 174:5633-5636.

Mandel, M. , and Higa, A. 1970. Calcium-dependent bacteriophage DNA infection. J. Mol. Biol. 53:159-162.

Messing, J. 1979- A multipurpose cloning system based on the singlestranded DNA bacteriophage M13- Recombinant DNA technical Bulletin, NIH Publication No. 79"99. 2, No. 2, p. 43-46.

Nauta, A., A.M. Ledeboer, G. Venema, and J. Kok. 199 ^a- Inhibiting growth of lactic acid bacteria by a holin and optionally lysing the cells and uses of the resulting lysed culture. European Patent aanvraag nr. EP-PA 94201354.1 (T7038) Nauta, A., A.M. Ledeboer, G. Venema, and J. Kok. 1994^b. Complex inducible promoter system derivable from a phage of a lactic acid bacterium and its use in a LAB for production of a desired protein. European Patent aanvraag nr. EP-PA 94201355-8 (T7039)

Rottlander, E. , and T.A. Trautner. 1970. Genetic and transfection studies with Bacillus subti lis phage SP50. J. Mol. Biol. 108:47-60.

Sanger, F. , S. Nicklen, and A. R. Coulson. 1977- DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 7 :5463-5467.

Sambrook, J., E.F. Fritsch, and T. Maniatis. 1989- Molecular cloning - a laboratory manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y..

Terzaghi, B.E. , and W.E. Sandine. 1975- Improved medium for lactic streptococci and their bacteriophages. Appl. Microbiol. 29:807-δl3.

Van der Lelie, D., J. M. B. M. van der Vossen, and G. Venema. 1988. Effect of plasmid incompatibility on DNA transfer to Streptococcus cremoris . Appl. Environ. Microbiol. 3:2583-2587.

Yanisch-Perron, C. , J. Vieira, and J. Messing. 1985. Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mpl8 and pUC19 vectors. Gene 33:103-119.

Claims

C L A I M S

1. Process for inhibiting the growth of a culture of lactic acid bacteria, which process comprises the in situ production in the cells of the lactic acid bacteria of a holin obtainable from bacteriophages of Gram-positive bacteria, esp. from bacteriophages of lactic acid bacteria, the gene encoding said holin being under control of a first regulatable promoter, said first regulatable promoter not normally being associated with the holin gene, said holin being capable of exerting a bacteriostatic effect on the cells in which it is produced by means of a system, whereby the cell membrane is perforated, while preferably the natural production of autolysin is not impaired.

2. Process according to claim 1, which additionally comprises the in situ production in the cells of the lactic acid bacteria of a lysin obtainable from grampositive bacteria, preferably lactic acid bacteria or their bacteriophages, the gene encoding said lysin being under control of a second regulatable promoter, said second regulatable promoter not normally being associated with the lysin gene whereby the produced lysin effects lysis of the cells of the lactic acid bacteria.

3. Process according to claim 2, in which the second regulatable promoter is the same as the first regulatable promoter.

4. Process according to claim 3, in which the gene encoding the holin and the gene encoding the lysin are placed under control of the same regulatable promoter in one operon.

5- Process according to claim 1 or 2, in which said first or second promoter or both are regulated by food-grade ingredients or parameters.

6. Process according to claim 1 or 2, in which the culture of lactic acid bacteria is part of a product containing such culture.

7. Process according to claim 6, in which the lactic acid bacteria culture is used for producing a fermented food product obtainable by the fermentative action of the lactic acid bacteria and subsequently the lactic acid bacteria in the fermented food product are lysed. δ. Process according to claim 7, in which the fermented food product is a cheese product.

9. Process according to claim δ, in which additionally a cheese ripening step is carried out, whereby some of the constituents after leaving the lysed cells will change the composition of the cheese product. 10. Process for combatting spoiling bacteria or pathogenic bacteria, in which a lysed culture obtained by a process as claimed in claim 2 is used as a bactericidal agent.

11. Process for improving the shelf life of a consumer product, in which a product obtained by a process as claimed in claim 1 or 2 and containing free holin or free lysin or both is incorporated into said consumer product in such amount that in the resulting consumer product the growth of spoiling bacteria or pathogenic bacteria is inhibited or that their viability is strongly reduced. 12. Process according to claim 11, in which the consumer product is selected from the group consisting of edible products, cosmetic products, and products for cleaning fabrics, hard surfaces and human skin.

13. Process for modifying a mixture of peptides, which comprises (1) combining a culture of lactic acid bacteria with a mixture of peptides obtained by proteolysis of proteins, the cells of said culture containing both a gene encoding a holin under control of a first regulatable promoter and a gene encoding a lysin under control of a second regulatable promoter, which second and first promoter can be the same, and which second and first promoters are not normally associated with the respective genes and

(2) effecting induction of the promoter or promoters for producing both the holin and the lysin in such amounts that the cells of the lactic acid bacteria are lysed and the contents of the cells containing peptidases will modify the composition of the mixture of peptides.

14. Process for modifying a mixture of peptides, which comprises treating a mixture of peptides obtained by proteolysis of proteins with a lysed culture obtained by a process according to claim 2.

15- Process according to claim 13 or 14, in which the proteins comprise milk proteins or vegetable proteins, or both. l6. Process according to any of the preceding claims, wherein the holin is encoded by a nucleic acid sequence according to any of claims 18-20 and/or is expressed from a recombinant vector according to any of claims 21-24 and/or is expressed by a recombinant cell according to any of claims 25-27.

17- Process according to any of claims 2-16, wherein the lysin has the amino acid sequence of sequence id no 7 or is a functional equivalent thereof. 18. A nucleic acid sequence encoding a holin derivable from a grampositive bacterium such as a lactic acid bacterium, in particular a L. lactis or a bacteriophage derivable from such a grampositive bacterium. 19- A nucleic acid sequence according to claim 18 encoding the amino acid sequence of sequence id no 6 or or a functional equivalent thereof such as the nucleic acid sequence of nucleotides 103~32δ of sequence id no 5- 20. A nucleic acid sequence according to claim lδ or 19, further being operatively linked to a first regulatable promoter, said first regulatable promoter not normally being associated with the holin encoding sequence.

21 A recombinant vector comprising a nucleic acid sequence according to any of claims 18-20, said vector preferably further being foodgrade.

22. A recombinant vector according to claim 21 further comprising a nucleic acid sequence encoding a lysin, both the holin and the lysin being derivable from a grampositive bacterium such as a lactic acid bacterium, in particular a L. lactis or a bacteriophage derivable from such a grampositive bacterium.

23. A recombinant vector according to claim 21 or 22 further comprising a the natural attachment/integration system of a bacteriophage for example said system comprising the bacteriophage attachment site and an integrase gene located such that integration of the holin and optionally lysin gene will occur, said system preferably being derived from a bacteriophage that is derivable from a food grade host cell, preferably a lactic acid bacterium.

24. A recombinant vector according to any of the claims 21-23, wherein the nucleic acid sequence encoding the holin and the nucleic acid sequence encoding the lysin are operatively linked to a foodgrade inducible promoter that can be induced via a food grade mechanism, for example by being a ther osensitive complex inducible promoter.

25. A recombinant host cell comprising a nucleic acid sequence according to any of claims 18-20 in a setting other than in its native bacteriophage and/or a recombinant vector according to any of claims 21- 24.

26. A recombinant host cell according to claim 25 further comprising a nucleic acid sequence encoding a lysin, said lysin preferably being derivable from a grampositive bacterium such as a lactic acid bacterium, in particular a L. lactis or a bacteriophage derivable from such a grampositive bacterium, said nucleic acid sequence encoding a lysin preferably being in a setting other than in its native bacteriophage or bacterium.

27. A recombinant host cell according to claim 25 or 26 being a food grade host cell, preferably a lactic acid bacterium, most preferably the host cell is of the same type from which the holin and/or lysin encoding nucleic acid sequences are derived

# * * * #