WO1996018727A1 - Adeno-associated derived vector systems for gene delivery and integration into target cells - Google Patents
Adeno-associated derived vector systems for gene delivery and integration into target cells Download PDFInfo
- Publication number
- WO1996018727A1 WO1996018727A1 PCT/US1995/016413 US9516413W WO9618727A1 WO 1996018727 A1 WO1996018727 A1 WO 1996018727A1 US 9516413 W US9516413 W US 9516413W WO 9618727 A1 WO9618727 A1 WO 9618727A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- nucleic acid
- acid construct
- nucleotide sequence
- mammalian cell
- aav
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/745—Blood coagulation or fibrinolysis factors
- C07K14/755—Factors VIII, e.g. factor VIII C (AHF), factor VIII Ag (VWF)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
- C12N2750/00011—Details
- C12N2750/14011—Parvoviridae
- C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
- C12N2750/14141—Use of virus, viral particle or viral elements as a vector
- C12N2750/14143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
Definitions
- the present invention relates generally to vectors for gene delivery and integration More specifically, the invention relates to adeno-associated virus (AAV) derived vector systems for use in gene delivery which provide for integration of a selected nucleotide sequence into a target cell genome.
- AAV adeno-associated virus
- Retroviral systems generally employ packaging lines which have an integrated defective provirus (the "helper") that expresses all of the genes of the virus but cannot package its own genome due to a deletion of the packaging signal Thus, the cell line produces empty viral shells.
- Producer lines can be derived from the packaging lines which, in addition to the helper, contain a viral vector which includes sequences required in cis for replication and packaging of the virus, known as the long terminal repeats (LTRs)
- LTRs long terminal repeats
- the selected gene can be inserted in the vector and packaged in the viral shells synthesized by the retroviral helper.
- the recombinant virus can then be isolated and delivered to a subject
- various retroviral systems see, e.g., U.S. Patent No. 5,219,740; Miller and Rosman (1989) BioTechniques 7:980-990; Miller, A.D. (1990) Human Gene Therapy I 5-14, Scarpa et al. (1991) Virology 180:849-852; Burns et al. (1993) Proc. Nail. Acad. Sci. USA
- retroviral systems suffer from several drawbacks In particular, retroviral particles are relatively labile and hence unstable Therefore, purification of recombinant viruses can lead to significant loss in titer Furthermore, retroviruses have a limited host range and cannot integrate into nonreplicating cells Accordingly, cells which do not normally divide, such as mature neurons, or cells which replicate slowly, cannot be genetically altered using retroviral vectors unless stimulated to divide before infection Additionally, and importantly, retroviruses are known to cause disease in certain animals, including humans, and thus pose a significant health risk to the subject transfected with a recombinant virus Finally, retrovirus vectors integrate into the host cell chromosome randomly, which may cause insertional mutagenesis by activating oncogenes or inactivating tumor suppressor genes Adenovirus based systems have been developed for gene delivery in an attempt to overcome these problems.
- Human adenoviruses are double-stranded DNA viruses which enter cells by receptor-mediated endocytosis These viruses are particularly well suited for gene transfer because they are easy to grow and manipulate and they exhibit a broad host range in vivo and in vitro
- adenoviruses can infect human cells of hematopoietic, lymphoid and myeloid origin.
- adenoviruses infect quiescent as well as replicating target cells Unlike retroviruses which integrate into the host genome, adenoviruses persist extrachromosomally thus minimizing the risks associated with insertional mutagenesis
- the virus is easily produced at high titers and is stable so that it can be purified and stored Even in the replication-competent form, adenoviruses cause only low level morbidity and are not associated with human malignancies Accordingly, adenovirus vectors have been developed which make use of these advantages For a description of adenovirus vectors and their uses see, e.g., Haj-Ahmad and Graham (1986) J Virol. 57 267-274, Bett et al.
- adenovirus vectors suffer from several drawbacks.
- adenovirus vectors express proteins transiently because the transferred gene does not integrate into the chromosome of the target cell. Hence, as the cells divide, the transferred gene is lost In this regard, such vectors are ineffective for long term gene therapy
- adenovirus vectors express viral proteins that may elicit an immune response which may decrease the life of the transduced cell. This immune response may preclude subsequent treatments because of humoral and/or T cell responses
- AAV adeno-associated virus
- AAV is a human DNA parvovirus which belongs to the genus Dependovirus.
- the AAV genome is composed of a linear, single-stranded DNA molecule which contains approximately 4680 bases (Berns and Bohenzky (1987) Advances in Virus Research (Academic Press, Inc ) 12 243-307)
- the genome includes inverted terminal repeats (ITRs) at each end which function in cis as origins of DNA replication and as packaging signals for the virus
- ITRs inverted terminal repeats
- the internal nonrepeated portion of the genome includes two large open reading frames, known as the AAV rep and cap regions, respectively
- These regions code for the viral proteins involved in replication and packaging of the vi ⁇ on A family of at least four viral proteins are synthesized from the AAV rep region, Rep 78, Rep 68, Rep 52 and Rep 40, named according to their apparent molecular weight
- the AAV cap region encodes at least three proteins, VP1, VP2 and NP3
- AAV requires coinfection with an unrelated helper virus, such as adenovirus, a herpesvirus or vaccinia, in order for a productive infection to occur
- helper virus such as adenovirus, a herpesvirus or vaccinia
- AAV establishes a latent state by insertion of its genome into a host cell chromosome
- a helper virus rescues the integrated copy which can then replicate to produce infectious viral progeny
- AAV has a wide host range and is able to replicate in cells from any species so long as there is coinfection with a helper virus that will also multiply in that species
- human AAV will replicate in canine cells coinfected with a canine adenovirus
- AAV is not associated with any human or animal disease, does not appear to alter the biological properties of the host cell upon integration and is able to integrate into nondivid g cells It has also recently been found that AAV is capable of site-specific integration into a host cell genome
- Recombinant AAV vi ⁇ ons can be produced in a suitable host cell which has been transfected with both an AAV helper plasmid and an AAV vector
- An AAV helper plasmid generally includes AAV rep and cap coding regions, but lacks AAV ITRs Accordingly, the helper plasmid can neither replicate nor package itself
- An AAV vector generally includes a selected gene of interest bounded by AAV ITRs which provide for viral replication and packaging functions
- Both the helper plasmid and the AAV vector bearing the selected gene are introduced into a suitable host cell by transient transfection The transfected cell is then infected with a helper virus, such as an adenovirus, which transactivates the AAV promoters present on the helper plasmid that direct the transcription and translation of AAV rep and cap regions
- Recombinant AAV vi ⁇ ons harboring the selected gene are formed and can be purified from the preparation
- integration when it occurs, does not appear to be site specific Although such recomb
- nucleotide sequence integration systems that are capable of the site-specific integration features provided by AAV vi ⁇ ons, yet are not limited in the size of the nucleotide sequence that can be integrated In this manner, large DNA molecules can be inserted into suitable target cells without the concomitant risk of insertional mutagenesis due to random integration events such as have been experienced with various prior systems Until the present invention, this unique set of features has not been provided in gene integration systems that will be practical for therapeutic use
- the present invention provides for novel systems for gene integration
- AAV derived vector systems are described which allow for the integration of a selected nucleotide sequence into a recipient cell genome Integration can be targeted to a defined and benign genomic site, thereby eliminating the risk of insertional mutagenesis which can occur with viruses which integrate randomly
- the selected nucleotide sequence is not limited by size as in previous systems, since the AAV derived vector systems are not packaged in AAV vi ⁇ ons
- the vectors can be provided in recombinant molecules, including a plasmid or a virus.
- the vectors can be provided in recombinant adenoviruses, thereby combining the advantages of prior adenovirus and AAV gene delivery systems while avoiding their limitations.
- the system has a broad host range and can be used to infect quiescent as well as replicating target cells. Recombinant viruses can be produced at high titers and are stable so that they can be purified and stored. Furthermore, the system is safe and does not cause human diseases or cancers.
- the invention is directed to a method of integrating a selected nucleotide sequence into the genome of a mammalian cell, comprisin (a) providing: (i) a first nucleic acid construct comprising a nucleotide sequence flanked by a 5' and a 3' adeno-associated virus inverted terminal repeat, and (ii) a second nucleic acid construct having a rep coding region operably linked to control elements capable of directing the transcription and translation of the rep coding region in the mammalian cell; (b) expressing the rep coding region of the second nucleic acid construct, thereby producing an amount of rep expression product capable of facilitating the integration of the nucleotide sequence of the first nucleic acid construct; and (c) integrating the nucleotide sequence of the first nucleic acid construct into the mammalian cell, the integration being facilitated by the rep expression product.
- the invention contemplates a mammalian cell containing the same nucleic acid constructs.
- the invention contemplates a method of integrating a selected nucleotide sequence into the genome of a mammalian cell, comprising: (a) providing: (i) a first nucleic acid construct comprising a nucleotide sequence flanked by a 5' and a 3 1 adeno- associated virus inverted terminal repeat, and (ii) an amount of rep expression product capable of facilitating the integration of the nucleotide sequence of the first nucleic acid construct; and (b) integrating the nucleotide sequence of the first nucleic acid construct into the mammalian cell, the integration being facilitated by the rep expression product.
- a further embodiment of the present invention contemplates a mammalian cell containing the same nucleic acid constructs.
- the first nucleic acid construct is a recombinant adeno- associated virus.
- the first nucleic acid construct is a plasmid; the mammalian cell is transfected with the plasmid in particular embodiments.
- the first nucleic acid construct and the second nucleic acid construct are present on the same vector. Conversely, the first nucleic acid construct and the second nucleic acid construct are present on different vectors in other embodiments.
- the invention contemplates a nucleotide sequence of the first nucleic acid construct that is integrated into a chromosome of the mammalian cell
- the chromosome is chromosome 19q.
- the nucleotide sequence of the first nucleic acid construct is more than 5,000 base pairs, while it is more than 10,000 base pairs in other embodiments.
- the nucleotide sequence of the first nucleic acid construct encodes a polypeptide.
- the polypeptide encodes at least a portion of the factor VIII gene in some embodiments. That is, the present invention is not limited to a particular sequence encoding a protein that retains factor VIII activity.
- the invention is directed to recombinant DNA molecules, and preferably to plasmids, comprising the nucleic acid constructs disclosed above.
- the invention is directed to a recombinant virus comprising the above-described nucleic acid constructs, as well as to target cells infected with the recombinant virus.
- the virus is a recombinant adenovirus.
- the invention is directed to a method of treating an acquired or inherited disease in a subject, comprising transfecting or infecting a selected target cell from the subject with a plasmid or recombinant virus, respectively comprising the nucleic acid constructs as described above.
- Figure 1 is a depiction of one embodiment of the subject invention wherein a recombinant adenovirus which includes a nucleic acid construct comprising a rep coding region and a selected nucleotide sequence bounded by AAV ITRs, is used to infect a target cell.
- the presence of both the rep protein and the AAV ITRs serve to cause targeted integration of the selected nucleotide sequence into chromosome 19 of the target cell
- Figure 2 diagramatically depicts several strategies used in the examples to demonstrate rep mediated integration of the selected nucleotide sequence into chromosome 19 of the target cell
- Figure 3 depicts several diagrams of nucleic acid constructs of pAAV and derivatives thereof.
- Figure 4 is a diagram of the AAVSl region of chromosome 19 depicting an AAV derivative ⁇ i.e., a provirus) integrated into the AAVS l region.
- AAV derivative ⁇ i.e., a provirus
- Each inverted viral terminal repeat is symbolized by an open rectangle containing a solid triangle; an expanded view of one of the ITRs is also shown.
- the numbered solid arrows represent primers.
- Figure 5A indicates whether site specific integration occurred in 293 cells infected with wild type AAV2 at three different multiplicities of infection.
- Figure 5B indicates whether site specific integration occurred in HeLa cells infected with wild type AAV2 at three different multiplicities of infection.
- Figure 6 indicates whether site specific integration occurred in 293 cells transfected with a recombinant AAV vector plasmid or derivatives thereof.
- Figure 7A depicts diagrams of targeting vectors used in the experiments described in the examples
- Figure 7B depicts diagrams of helper plasmids used in the experiments described in the examples.
- Figure 8 is a diagram illustrating steps used in the construction of p2TRcos.
- Figure 9 indicates whether site specific integration occurred in 293 cells transfected alone with either p2TRlacZ, p2TRF8, or p2TRcos; cotransfected with either p2TRlacZ and pRR5, p2TRF8 and pRR5, or p2TRcos and pRR5; and cotransfected with either p2TRlacZ and pGN1764, p2TRF8 and pGN1764, or p2TRcos and pGN1764.
- Figure 10 depicts the results of a Southern Blot performed on ⁇ -galactosidase-positive clones of 293 cells transfected with a targeting vector and a helper plasmid.
- FIG. 1 diagramatically illustrates the fluorescence in situ hybridization (FISH) strategy used in the examples.
- FISH fluorescence in situ hybridization
- Figure 12A diagrammatically depicts some of the characteristics of the AAVSl region of chromosome 19.
- Figure 12B diagrammatically depicts some of the characteristics of p2TRlacZ that was co-transfected with helper plasmid pRR5 (not shown) into 293 cells to produce a ⁇ - galactosidase-positive clone manipulated in some of the experiments.
- Figure 12C diagrammatically depicts, in the top portion, arrangement of the integrated p2TRlacZ plasmid sequences within chromosome 19. Sequence information pertaining to the left junction of the integration site is shown in the bottom left portion, while sequence O 96/18727 PC ⁇ 7US95/16413 information pertaining to the right
- Gene transfer or “gene delivery” refers to methods or systems for reliably inserting a particular nucleotide sequence (e g , DNA) into targeted cells Such methods preferably result in the integration of the transferred genetic material into the genome of target cells
- Gene transfer provides a unique approach for the treatment of acquired and inherited diseases, and a number of systems have been developed in the art for gene transfer into mammalian cells See, e g , ⁇ J S> Patent No 5,399,346
- AAV ITRs adeno-associated virus inverted terminal repeats
- flanking AAV ITRs are positioned 5' and 3' of one or more selected heterologous nucleotide sequences and, together with the rep coding region or the Rep expression product, provide for the integration of the selected sequences into the genome of a target cell
- AAV ITR regions are known See, e g , Kotin, R M (1994) Human Gene Therapy 5 793-801, Berns, K I "Parvovi ⁇ dae and their Replication" in Fundamental Virology, 2nd Edition, (B N Fields and D M Kn ⁇ e, eds ) for the AAV-2 sequence
- an "AAV ITR" need not have the wild-type nucleotide sequence depicted, but may be altered, e g , by the insertion, deletion or substitution of nucleotides
- the AAV ITR may be derived from any of several AAV serotypes, including without limitation, AAV- 1, AAV-2, AAV-3, AAV-4, AAV-5, AAVX7, etc
- the 5' and 3 ' ITRs which flank a selected heterologous nucleotide sequence need not necessarily be identical or derived from the same AAV serotype or isolate, so long as they function as intended, I e
- AAV vector a vector derived from an adeno-associated virus serotype, including without limitation, AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAVX7, etc
- AAV vectors can have one or more of the AAV wild-type genes deleted in whole or part, preferably the rep and/or cap genes, but retain functional flanking ITR sequences
- AAV vectors can be constructed using recombinant techniques that are known in the art to include one or more heterologous nucleotide sequences flanked on both ends (5 and 3 ' ) with functional AAV ITRs
- an AAV vector can include at least one AAV ITR and a suitable promoter sequence positioned upstream of the heterologous nucleotide sequence and at least one AAV ITR positioned downstream of the heterologous sequence
- a "recombinant AAV vector plasmid" refers to one type of recombinant AAV vector wherein the vector comprises a plasmid As with AAV vectors in general, 5' and 3' ITRs flank the selected heterologous nucleotide sequence
- AAV vectors can also include transcription sequences such as polyadenylation sites, as well as selectable markers or reporter genes, enhancer sequences, and other control elements which allow for the induction of transcription Such control elements are described more fully below
- AAV virion refers to a complete virus particle
- An AAV virion may be a wild type AAV particle (comprising a linear, single-stranded AAV nucleic acid genome associated with an AAV capsid, i.e., a protein coat), or a recombinant AAV particle (described below)
- single-stranded AAV nucleic acid molecules can be packaged into an AAV virion, both the sense and the antisense strands are equally infectious
- the term "recombinant AAV virion” or "rAAV” is defined as an infectious, replication-defective virus composed of an AAV protein shell encapsidating (i.e., surrounding with a protein coat) a heterologous nucleotide sequence, which in turn is flanked 5' and 3' by AAV ITRs
- Suitable nucleotide sequences for use in AAV vectors include any functionally relevant nucleotide sequence
- the AAV vectors of the present invention can comprise any desired gene that encodes a protein that is defective or missing from a target cell genome or that encodes a non-native protein having a desired biological or therapeutic effect (e , an antiviral function), or the sequence can correspond to a molecule having an antisense or ribozyme function.
- Suitable genes include those used for the treatment of inflammatory diseases, autoimmune, chronic and infectious diseases, including such disorders as AIDS, cancer, neurological diseases, cardiovascular disease, hypercholestemia; various blood disorders including various anemias, thalasemias and hemophilia; genetic defects such as cystic fibrosis, Gaucher's Disease, adenosine deaminase (ADA) deficiency, emphysema, etc
- antisense oligonucleotides e.g., short oligonucleotides complementary to sequences around the translational initiation site (AUG codon) of an mRNA
- a number of antisense oligonucleotides that are useful in antisense therapy for cancer and for viral diseases have been described in the art See, e.g , Han et al (1991 ) Proc Nat/ Acad Set USA 88 4313-4317, Uhlmann et at (1990) Chem Rev 90 543-584, Helene et al (1990) Biochim Biophvs Ada 1049 99-125, Agarwal el al (1988) Proc Nail Acad Sci USA 85 7079-7083, and Heikkila et al (1987) Nature 328 445- 449
- suitable ⁇ bozymes see, e g , Cech et al ( 1992) / Biol Chem 267 17479-17482 and U S Patent No 5,225
- recombinant virus is meant a virus that has been genetically altered, e g , by the addition or insertion of a heterologous nucleic acid construct into the particle
- the terms “facilitate,” “facilitation,” and the like refer broadly to making an action or result more easily achieved
- the expression product of the rep gene is required to target selected nucleotide sequences into a cell's genome
- the term includes, but is not limited to, site specific integration of nucleotide sequences into chromosome 19
- AAV rep coding region is meant the art-recognized region of the AAV genome which encodes the replication proteins of the virus which are collectively required for replicating the viral genome, or functional homologues thereof such as the human herpesvirus
- the rep coding region includes at least the genes encoding for AAV Rep 78 and Rep 68 (the “long forms of Rep"), and Rep 52 and Rep 40 (the “short forms of Rep”), or functional homologues thereof
- AAV rep coding region see, e g , Muzyczka, N (1992) Current Topics m Microhiol and
- the rep coding region can be derived from any viral serotype, such as the AAV serotypes described above
- the region need not include all of the wild-type genes but may be altered, e g , by the insertion, deletion or substitution of nucleotides, so long as the rep genes present provide for sufficient integration functions when expressed in a suitable target cell
- Rep expression products are defined herein to include both the short forms and the long forms of AAV Rep, including functional homologous thereof
- transfection is used to refer to the uptake of foreign DNA by a cell and a cell has been "transfected” when exogenous DNA has been introduced inside the cell membrane
- transfection techniques are generally known in the art See, e g , Graham et al (1973) Virology, 52 456, Sambrook et al (1989) Molecular Cloning, a laboratory manual, Cold Spring Harbor Laboratories, New York, Davis et al ( 1986) Basic Methods in Molecular Biology, Elsevier, and Chu et al (1981) Gene J_3 197
- Such techniques can be used to introduce one or more exogenous DNA moieties, such as an AAV vector, AAV helper constructs, and other nucleic acid molecules, into suitable host cells
- nucleotide sequence integration system intends the operative combination of (1 ) a first nucleic acid construct comprising a nucleotide sequence of interest flanked by a 5' and a 3' AAV ITR, and (2) either a further nucleic acid construct having a rep coding region operably linked to control elements capable of directing the transcription and translation of the rep coding region in a suitable target cell, or a suitable amount of Rep expression products, whereby the nucleotide integration system provides for the integration of the nucleotide sequence of interest from the first construct into the genome of a target cell that has been transfected with said integration system
- target cell or “target mammalian cell” is meant a cell which has been transformed, or is capable of transformation, by a nucleic acid construct or an AAV vector bearing a selected nucleotide sequence of interest
- the term includes the progeny of the parent cell, whether or not the progeny is identical in morphology or in genetic make-up to the original parent, so long as the selected nucleotide sequence is present
- a cell has been "stably transformed” with a nucleic acid construct comprising a selected nucleotide sequence of interest when the construct has been introduced inside the cell membrane and the sequence of interest has been integrated into the target cell genome such that the integrated nucleotide sequence is capable of being inherited by daughter cells through chromosome replication
- the cell can be transformed using any of several techniques, including transduction, transfection and infection Stability is demonstrated by the ability of the target cell to establish cell lines or clones comprised of a population of daughter cells which contain the nucleotide sequence of interest
- heterologous as it relates to nucleic acid sequences such as coding sequences and control sequences, denotes sequences that are not normally joined together, and/or are not normally associated with a particular cell
- a heterologous region of a nucleic acid construct or an AAV vector is a segment of nucleic acid within or attached to another nucleic acid molecule that is not found in association with the other molecule in nature
- a heterologous region of a nucleic acid construct could include a coding sequence flanked by sequences not found in association with the coding sequence in nature
- heterologous coding sequence is a construct where the coding sequence itself is not found in nature (e g , synthetic sequences having codons different from the native gene) Similarly, a cell transformed with a construct which is not normally present in the cell would be considered heterologous for purposes of this invention. Allelic variation or naturally occurring mutational events do not give rise to heterologous DNA, as used herein.
- a "coding sequence” or a sequence which "encodes" a particular protein is a nucleic acid sequence which is transcribed (in the case of DNA) and translated (in the case of mRNA) into a polypeptide in vitro or in vivo when placed under the control of appropriate regulatory sequences.
- a coding sequence can include, but is not limited to, cDNA from procaryotic or eucaryotic mRNA, genomic DNA sequences from procaryotic or eucaryotic DNA, and even synthetic DNA sequences.
- a transcription termination sequence will usually be located 3' to the coding sequence.
- nucleic acid sequence refers to a DNA or RNA sequence.
- the term captures sequences that include any of the known base analogs of DNA and RNA such as, but not limited to 4-acetylcytosine, 8-hydroxy-N6-methyladenosine, aziridinylcytosine, pseudoisocytosine, 5-(carboxyhydroxylmethyl) uracil, 5-fluorouracil, 5 >romouracil, 5- carboxymethylaminomethyl-2-thiouracil, 5-carboxymethylaminomethyluracil, dihydrouracil, inosine, N6-isopentenyladenine, 1-methyladenine, 1-methylpseudouracil, 1-methylguanine, 1- methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5- methylcytosine, N6-methyladenine, 7-methylguanine, 5-methylaminomethyluracil, 5-meth
- control sequences and “control elements” refer collectively to promoter sequences, polyadenylation signals, transcription termination sequences, upstream regulatory domains, origins of replication, internal ribosome entry sites ("IRES"), enhancers, and the like, which collectively provide for the replication, transcription and translation of a coding sequence in a recipient cell. Not all of these control sequences/elements need always be present so long as the selected coding sequence is capable of being replicated, transcribed and translated in an appropriate host cell.
- IRS internal ribosome entry sites
- Operaably linked refers to an arrangement of elements wherein the components so described are configured so as to perform their usual function.
- operably linked to a coding sequence are capable of effecting the expression of the coding sequence
- the control sequences need not be contiguous with the coding sequence, so long as they function to direct the expression thereof Thus, for example, intervening untranslated yet transcribed sequences can be present between a promoter sequence and the coding sequence and the promoter sequence can still be considered "operably linked" to the coding sequence
- homology refers to the percent of identity between two polynucleotide or two polypeptide moieties
- correspondence between the sequence from one moiety to another can be determined by techniques known in the art For example, homology can be determined by a direct comparison of the sequence information between two polypeptide molecules by aligning the sequence information and using readily available computer programs Alternatively, homology can be determined by hybridization of polynucleotides under conditions which form stable duplexes between homologous regions, followed by digestion with single-stranded-specific nuclease(s), and size determination of the digested fragments Two DNA, or two polypeptide sequences are "substantially homologous" to each other when at least about 80%, preferably at least about 90%, and most preferably at least about 95% of the nucleotides or amino acids match over a defined length of the molecules, as determined using the methods above
- a “functional homologue,” or a “functional equivalent” of a given polypeptide includes molecules derived from the native polypeptide sequence, as well as recombinantly produced or chemically synthesized polypeptides which function in a manner similar to the reference molecule to achieve a desired result
- a functional homologue of AAV Rep expression products e g , Rep 78, Rep 68, Rep 52 and Rep 40
- nucleotide sequence integration system which allows for the efficient targeting and integration of a selected nucleotide sequence into the genome of a target mammalian cell
- a particular feature of the invention is that such integration can be directed to non-essential regions of particular chromosomes of the target cell, thereby avoiding the risk of insertional mutagenesis which can occur with random integration of a viral vector
- the present invention makes use of a DNA vector comprising a first nucleic acid construct bearing a selected nucleotide sequence The selected sequence is flanked on the 5' and 3' ends with AAV ITRs
- a second nucleic acid construct which includes a rep coding region
- the rep coding region can be positioned either upstream or downstream of the selected nucleotide sequence
- a particular embodiment of the subject invention wherein the rep coding region and the selected nucleotide sequence are found on the same DNA vector, is shown
- the first and second nucleic acid constructs can be engineered using recombinant techniques known to those of skill in the art.
- the first nucleic acid construct which harbors the nucleotide sequence of interest bounded by the AAV ITRs can be constructed by directly inserting a selected sequence into an AAV genome which has the rep and cap coding regions excised, e g using restriction enzymes Other portions of the AAV genome can also be deleted, so long as a sufficient portion of the ITRs remain to allow for integration functions
- Such constructs can be designed using techniques well known in the art. See, e.g., U.S. Patent Nos.
- the AAV ITRs can be excised from the viral genome or from an AAV vector containing the same and fused 5' and 3' of the selected nucleotide sequence which is present in another vector, using standard ligation techniques, such as those described in
- ligations can be accomplished in 20 mM Tris-Cl pH 7.5, 10 mM MgCl-, 10 mM DTT, 33 ug/ml BSA, 10 mM-50 mM NaCl, and either 40 uM ATP, 0.01-0 02 (Weiss) units T4 DNA ligase at 0°C (for "sticky end” ligation) or 1 M ATP, 0.3-0 6 ( Stamms) units T4 DNA ligase at 14°C (for "blunt end” ligation) Intermolecular "sticky end” ligations are usually performed at 30-100 ⁇ g/ml total DNA concentrations (5-
- AAV vectors which contain ITRs have been described in, e.g., U.S Patent no. 5, 139,941. In particular, several AAV vectors are described therein which are available from the American Type Culture Collection (“ATCC”) under accession numbers 53222, 53223, 53224, 53225 and 53226
- chime ⁇ c genes can be produced synthetically which include the AAV ITR sequences fused 5' and 3' of the selected nucleotide sequence AAV ITR nucleotide sequences are known See, e g , Kotin, R M (1994) Human Gene Therapy 5 793-801 , and
- the selected nucleotide sequence of the first nucleic acid construct can comprise any desired gene that encodes a protein that is defective or missing from a recipient cell genome or that encodes a non-native protein having a desired biological or therapeutic effect (e g , an antiviral function), or the sequence can correspond to a molecule having an antisense or ⁇ bozyme function
- Suitable genes include those used for the treatment of inflammatory diseases, autoimmune, chronic and infectious diseases, including such disorders as AIDS cancer, neurological diseases, cardiovascular disease, hypercholestemia, various blood disorders including various anemias, thalasemias and hemophilia, genetic defects such as cystic fibrosis, Gaucher's Disease, adenosine deaminase (ADA) deficiency, emphysema, etc
- a second nucleic acid construct which includes a rep coding region
- the presence of rep provides for targeted insertion of the selected nucleotide sequence (from the first nucleic acid construct) into non-essential regions of particular chromosomes
- Rep expression products are thought to mediate integration events which take place between compatible AAV ITR sequences and sequences present in a target cell genome
- the integration locus for AAV (termed “AAVSl ”) is human chromosome 19ql3 3-qter European Patent Appln No 931 14941 3 (Publication No 0 592 836 Al), Samulski et al (1991) EMBO K) 3941- 3950, Kotin et al (1992) EMBO J U 5071-5078
- AAV vectors including the AAV rep coding region positioned between the ITRs have been shown to integrate into AAVSl of chromosome 19 Shelling and Smith ( 1994) Gene Therapy __ 165-169 Rep recognition sequence
- the rep coding region can be obtained from the viral genome or from a vector known to include the same
- a number of rep containing AAV vectors are known, including the several vectors described in, e g , U S Patent no 5, 139,941 , having ATCC accession numbers 53222, 53223, 53224, 53225 and 53226
- methods of obtaining the HHV-6 homologue of AAV rep are described in Thomson el al (1994) Virology 204 304- 31 1
- the rep coding region will be operably linked to control sequences that direct the transcription and translation thereof
- control elements include one or more of promoters, polyadenylation signals, transcription termination sequences, upstream regulatory domains, replication sequences, enhancers, and the like, which collectively provide for the transcription and translation of the rep coding region when present in the target cell
- Useful promoter sequences include those derived from sequences encoding mammalian viral genes Examples include but are not limited to the homologous AAV promoters, the
- SV40 early promoter mouse mammary tumor virus LTR promoter, adenovirus maior late promoter (Ad MLP), a herpes simplex virus (HSV) promoter, a cytomegalovirus (CMV) promoter, a rous sarcoma virus (RSV) promoter, synthetic promoters, hybrid promoters, and the like
- HSV herpes simplex virus
- CMV cytomegalovirus
- RSV rous sarcoma virus
- synthetic promoters hybrid promoters, and the like
- sequences derived from nonviral genes such as the mu ⁇ ne metallothionein gene, will also find use herein Such promoter sequences are commercially available from, e g , Stratagene
- Rep proteins can be made when integration of the desired nucleotide sequence into the genome of the target cell is desired
- Regulatory sequences are known to those of skill in the art, and include e g , elements derived from the lac operator-repressor system (see, e g , Hu and Davidson Cell (1987) 48 555-566), origins of replication including those derived from papovaviruses, such as the SV40 origin of replication (SV40o ⁇ ) for which the T antigen is the effector, as well as cellular origins of replication, such as the dihydrofolate reductase (dhfr) gene for which methotrexate is the effector See, e g Urlaub et al (1980) Proc Natl Acad Sci USA 77 4216-4220, Rungold et al (1981) ./ Mol and Appl Genet 1 165-175 For these methods, the appropriate effector will be available in the target cell at the time that expression of the AAV tep coding region is desired Systems for administering regulatory compounds are known in the art See, e g , International Publication No WO 88
- the second nucleic acid construct which includes the AAV rep coding region may also include selectable markers, such as genes which confer antibiotic resistance or sensitivity, or impart color, or change the antigenic characteristics, when the transformed cells are grown in an appropriate selective medium
- selectable markers such as genes which confer antibiotic resistance or sensitivity, or impart color, or change the antigenic characteristics, when the transformed cells are grown in an appropriate selective medium
- the cell to be transformed will depend on the purpose for gene transfer, e g , the disease state being treated
- the system of the present invention can be used to deliver and integrate nucleotide sequences into any nucleated cell including stem, progenitor and erythroid cells, as well as any of the various white blood cells such as lymphocytes, neutrophils, eosinophils, basophils, monocytes, tissue specific cells, such as those derived from lung, heart, kidney, liver, spleen, pancreatic tissue, connective tissue, muscle and bone tissue including osteocytes, gang ocytes, epithelial and endothelial cells, ependymal cells, reticuloendothelial cells, dendritic and neural cells, and the like
- target cells will be transformed with the nucleotide sequence integration system of the present invention either /// vivo or ex vivo If transformed ex vivo, the desired target cell type will be removed from the subject, transformed and reintroduced into the subject
- a number of methods are known in the art for transforming cells, including dextran-mediated transfection, calcium phosphate precipitation, polybrene mediated transfection, protoplast fusion, electroporation, encapsulation of the nucleic acid constructs in Iiposomes, and direct microinjection of the DNA into nuclei
- Such systems are known in the art and have been described in e g , Finney and Bishop (1993) Science 260 1524-1527
- the transformed cells can be screened for those cells harboring the selected gene, using conventional techniques such as Southern blots and/or PCR
- nucleic acid constructs will be formulated into pharmaceutical compositions and will generally be administered parenterally, e g , by injection Additional formulations suitable for other modes of administration include oral and pulmonary formulations, suppositories, and transdermal applications
- Dosage treatment may be a single dose schedule or a multiple dose schedule
- One of skill in the art can readily determine an appropriate dosage using standard dose response curves
- recombinant viruses can be used to deliver the constructs of the present invention to the target cell.
- the present invention has been exemplified using an adenovirus as the delivery system, as depicted in Figure 1
- any recombinant virus which is capable of infecting the target cell of interest will find use in the present system
- the nucleic acid constructs will first be used to transform a selected virus and the transformed virus, in turn, used to deliver a selected nucleotide sequence to a suitable target cell
- any of the various human adenovirus strains such as but not limited to, adenovirus type 2 (Ad2), adenovirus type 5 (Ad5), adenovirus type 7 (Ad7), adenovirus type 12 (Ad 12), will find use herein
- Other adenoviruses which will also be useful with the present invention include mutant adenoviruses which have been manipulated, such as by the removal of
- adenovirus chimeric vectors such as those described in Michael et al. J Biol. Chem. ( 1993) 268:6866-6869 and Wagner et al. Proc. Natl. Acad. Sci. USA (1992) 89 6099- 6103, can also be used for gene delivery
- a recombinant AAV virion can be used to deliver constructs of the present invention into the target cell.
- Recombinant AAV virions as defined above, comprise a heterologous nucleotide sequence flanked 5' and 3' by AAV ITRs.
- carrier viruses which will find use for the delivery of the various nucleic acid constructs to the target cell include those derived from the pox family of viruses, including vaccinia virus and avian poxvirus, as well as any of the various herpesviruses such as HSV. CMV, EBV, VZ etc.
- the use of these viruses to deliver gene sequences is well known in the art Methods for the insertion of foreign genes in vaccinia virus have been described in detail See, e.g., Mackett, M et al. in DNA Cloning: A Practical Approach, vol II (D Glover, ed.) pp. 191-21 1; Mackett et al. (1984) J. Virol. 49:857-864, Fuerst et al. (1986) Proc. Nat/. Acad. Sci. USA 83 8122-8126; and U.S. Patent No 4,722,848
- Avipoxviruses such as the fowlpox and canarypox viruses
- Methods for producing recombinant Avipoxviruses are known in the art and employ genetic recombination, as described above with respect to the production of vaccinia viruses See, e.g., WO 91/12882, WO 89/03429, and WO 92/03545
- nucleic acid constructs of the present nucleotide sequence integration system can be used to deliver selected sequences to a variety of cell and tissue types for the production of transgenic organisms, as well as for gene therapy, vaccination, or for characterizing a variety of genes and the mechanism of their actions
- the instant methods will also find use in ribozyme and antisense therapy.
- antisense therapy and oligonucleotides useful in the same see, Uhlmann, E and Peyman, A (1990) Chem. Rev. 90 543-584
- Chem. Rev. 90 543-584 For a discussion of ribozymes see, Cech et al. (1992) J. Biol. Chem.
- TVI Tumorted Vector Integration
- AAV integrates with high efficiency into human chromosome 19 (at position 19q 13 3-qter)
- AAV contains a large open reading rrame, AAV rep, that encodes at least four proteins implicated in the replication of the virus.
- the four proteins - Rep 78, Rep 68, Rep 52 and Rep 40 - are named according to their apparent molecular weight.
- Rep 78 and Rep 68 termed the "long forms of Rep" are expressed from the p5 promotor (see below).
- the long forms of Rep possess a number of biochemical activities that directly implicates them in the replication of the virus. These activities include binding the viral inverted terminal repeats (ITRs), nicking at the terminal resolution site, and helicase activity.
- ITRs viral inverted terminal repeats
- nicking at the terminal resolution site
- helicase activity Kotin, R.M. (1994) Human Gene Therapy 5_:793-801.
- Rep78 and Rep 68 mediate the formation of a complex between the ITR in the hairpin configuration and a 109 bp sequence from the AAV integration site that contains a similar 12 nucleotide core rep binding site.
- the present invention contemplates, among other things, the provision of a desired gene that encodes a protein that is defective or missing from a target cell genome in a patient.
- the present invention also contemplates a method of treating a patient suffering from a disease state by providing the patient with human cells genetically engineered to encode the required protein.
- the cells may be genetically engineered in vitro by removing the cells from the patient, introducing the desired gene into the cells, then reintroducing the genetically engineered cells back into the patient.
- other methods of introducing desired genes into a patient are known and are within the scope of the present invention.
- U.S. Patent No. 5,399,346 to Anderson et al. which is hereby incorporated by reference, discusses several other methods that may be used in conjunction with the present invention.
- a stable human cell line, 293, (readily available through, e g , the American Type Culture Collection under accession number ATCC CRL1573) was grown to approximately 75% confluency in medium consisting of DMEM with 10% FBS and Pen/Strep The 293 cells were then transfected with an AAV-LacZ vector plasmid (pABl l), using the calcium phosphate precipitation method pAB 1 1 was deposited with the American Type Culture Collection, pABl l was assigned ATCC No. .
- the 293 cells were also transfected with AAV helper plasmids containing either the rep gene (pGN1980) or the rep and cap genes (pGN1764) or with the AAV-LacZ plasmid (pAB 1 1 ) as a control
- the rep containing plasmid included the AAV rep coding region
- PCR amplified DNA would be expected to be heterogeneous ( Figure 2) as template DNA is obtained from a pool of cells in which many integration reactions have occurred and as AAV integration sites in this region are spread over several hundred base pairs
- Figure 2 a 300 bp fragment should be generated This fragment should hybridize to a Sac/Bam probe derived from the AAVSl region
- the presence of a 300 bp band on a Southern would be indicative of integration
- a PCR reaction was conducted as described above For the PCR reaction, 200 ⁇ M dNTPs were combined with 2 ⁇ M of each primer, in lx PCR buffer (Bochr Kit), l OOng DNA and 1 unit of Taq polymerase The amplification cycle proceeded for
- the PCR product was recut with S ⁇ cl by mixing lO ⁇ L of amplified DNA with 2 units of S ⁇ cl in 2 ⁇ L buffer A (lOx) and 8 ⁇ L H 2 O The mixture was incubated at 37°C for 1 hour to generate a 300 bp fragment which was amplified and resolved by electrophoresis and transferred to nitrocellulose DNA from the cells cotransfected with both the AAV-LacZ and one or both of the helper plasmids hybridized to a 300 bp Sac/Ba probe derived from the AAVS 1 region, indicating that site-specific integration had occurred EXAMPLE 2
- 293 cells were transfected either with an AAV-neo plasmid vector, pWP8-AAV-TK- neo, alone or cotransfected with pWP8 and either the rep containing plasmid (pGN1980) or rep and cap containing plasmid (pGN1764), both described above
- the number of neo resistant colonies were counted for each vector construct as follows Cells were placed under G418 selection (400 ⁇ g/mL) 48 hours after transfection Media was replaced every 3 days Plates were stained with a staining solution of 2% methylene blue 2% and 50% EtOH After 2 minutes, the monolayers were washed and the stained clones counted
- the number of G418 recombinant colonies increased 3x in the presence of pGN1980 and 3 Ox in the presence of pGN1764
- Both the human embryonal kidney cell line, 293, and HeLa cells were used in the experiments of this example
- the 293 cells are readily available through, e g , the ATCC (ATCC accession number CRL1573)
- the HeLa cells are also readily available through the ATCC (e g , number CCL2)
- pAAV is a plasmid carrying a replication-competent AAV provirus pAAV is identical to psub201 , the structure of psub201 is provided in U S Patent No 5,436,146 to Shenk et al which is hereby incorporated by reference
- Four mutants of pAAV were constructed pAAVMl, pAAVM2, pAAVM3, and pAAVM4 ( Figure 3)
- pAAVMl contained a deletion in the cap region between Apal sites at position 2943 and 4040
- the other three derivatives (/ e , pAAVM2, pAAVM3, and pAAVM4) contained insertions in the rep region
- an 8 bp Ascl linker (denoted by the *) was inserted in the
- the transfection procedure was performed according to the procedure that follows The conditions were the same for both 293 cells and HeLa cells
- the culture media consisted of DMEM (Gibco #12-614F), 10% FBS (Hyclone # A-l l l-L), 50 units/mL Pen ⁇ c ⁇ llm/50 units/mL streptomycin (Gibco #15070-014) and 2 mM L-glutamine (BioWhittaker #17-605E) The cells were incubated overnight at 37°C in an atmosphere containing 5% CO 2
- a calcium phosphate-DNA precipitate was prepared immediately before transfection For each condition, 224 ⁇ L of Milli-Q (Class III) water were added Next, 26 ⁇ L of 2 5 M CaCl 2 were added, followed by 2 ⁇ g of each DNA While gently mixing the
- the media and precipitate were aspirated from each well Two mL of growth media were gently added, taking care not to disturb the cell monolayer Next, the media was aspirated from the well, and 2 mL of fresh growth media were added The plate was then returned to the incubator
- Genomic DNA was extracted from the pool of transfected cells Genomic DNA was isolated for PCR and digestion by the same procedure, described below
- Phenol/chloroform extraction was then performed (for larger preparations, the phases can be separated at 3000 rpm in 15 mL tubes in a Beckman GS-6R table top centrifuge)
- the upper aqueous phases were ethanol precipitated with 0 1 volumes of 3 M sodium acetate and 3 volumes of ethanol at -80°C for approximately 15 minutes It was necessary to vigorously shake the preparations to ensure that the DNA was well mixed
- the DNA was then formed into a pellet by microfuging at full speed for 15 minutes at 4°C (for larger preparations, the DNA can be pelleted at 7000 rpm at 4°C) Thereafter, the DNA was washed with 70% ethanol Finally, the DNA was resuspended in 100 ⁇ L of TE and RNase A at 10 ⁇ g/mL (for 1 - 5 x 10 6 cells in a six-well plate).
- DNA may require an overnight incubation at 37°C, with rotation, to enable the DNA to get into solution.
- FIG 4 is a schematic map of the AAVSl region of chromosome 19 depicting an AAV derivative ⁇ i.e., a provirus) integrated into the AAVSl region (the region is labeled as chr.19-AAVS1 in Figure 4).
- the integration locus for AAV is human chromosome 19q l3.3-qter; this is termed the "AAVS l region”.
- the inverted viral terminal repeats are symbolized by open rectangles containing solid triangles; the points of the triangles indicate the direction or orientation of the ITR such that the triangles point away from the recombinant vector sequence.
- ITRs is shown by the open rectangle containing the letters a, b, c, and d; each letter represents a discrete nucleic acid sequence.
- primer 100 is derived from the a',c' region of the AAV ITR and primer 81 is derived from the d region of the AAV ITR.
- the letters a', b', and c' represent the inverse sequence found in a, b, and c, respectively.
- primers complementary to sequences of the AAVS 1 region or the integrated AAV derivative are indicated by arrows.
- the tip of the arrow represents the 3' end of the each primer.
- Primers 79, 80, and 97 are derived from AAVSl The sequence of these primers are as follows: Primer 79: 5'-ACTTTGAGCTCTACTGGCTTC-3' (SEQ ID NO 1 ); Primer 80: 5'-GGAGGATCCGCTCAGAGG-3' (SEQ ID NO:2); and Primer 97:
- primers 81 and 100 are derived from ⁇ i.e., are complementary to) the AAV ITR. Kotin et al. (1992) EMBO J. 11:5071-5078.
- the sequence of Primer 81 is 5'-AGGAACCCCT AGTGATGGAGT-3' (SEQ ID NO:4)
- the sequence of Primer 100 is 5'-CGGCCTCAGTGAGCGAGCGCGC-3' (SEQ ID NO:5)
- Primer 98 derived from the p5 promotor, has the following sequence: 5'-CGCGTTCAAACCTCCCGCTTCAA AATG-3' (SEQ ID NO:6).
- the location of a probe (double stranded DNA), a SacllBamHl restriction fragment, complementary to the AAVSl region is indicated by line labeled "probe" in Figure 4
- a PCR assay was used to detect site specific integration in unselected pools of transfected cells If site specific integration has occurred, it should be possible to detect it by PCR, using a pair of primers, one complementary to the AAV ITR and the other complementary to the AAVS l region of chromosome 19 (/ e , 19ql 3 3-qter)
- the PCR amplified DNA would be expected to be heterogeneous (See Figure 2), as template DNA is obtained from a pool of cells in which many integration reactions have occurred, moreover, wild type AAV is believed to integrate in a region of 19ql3 3-qter spanning several hundred base pairs
- all specific PCR amplification products should hybridize to a Sacl-BamHl fragment derived from the AAVS l region
- specific amplification products can be detected by DNA hybridization on dot blots using a
- the PCR reaction was performed according to the procedure described hereafter An aliquot of DNA corresponding to 10 4 genomes (cells) was used in the PCR reaction
- lOO ⁇ M dNTPs were combined with l ⁇ M each of primers 97 and 100 in IX NEB buffer for vent polymerase supplemented with 2 mM MgSO 4 , and 2 units of Deep
- PCR reaction product 10% of the PCR reaction product was transferred to a nylon Zeta-Probe blotting membrane (Biorad) using a dot blot apparatus That sample was then hybridized, according to the manufacturer's protocol, to the probe (/ e , the SacllBamHl restriction fragment, derived from the AAVSl region of chromosome 19)
- the probe comprised a random primed 32 P labeled PCR fragment
- the probe fragment was first generated by PCR, then labeled
- the PCR comprised 0 1 ⁇ g of human genomic DNA and the primers were primer 79 and primer 80
- the PCR conditions were as follows lx laq buffer, 0 2 mM dNTP in a total volume of 90 ⁇ L
- the PCR amplification was performed using Taq polymerase as follows 1 cycle at 99°C for 5 minutes, pause at 75°C, 97°C for 5 seconds, 3 cycles at 97°C for 10 seconds, 55°C for 10 seconds, and 72°C
- PCR assay was validated using wild type AAV to infect the 293 cells and the
- Figure 5A depicts the results of 293 cells infected with wild type AAV2 at three different multiplicities of infection (MOIs);
- Figure 5B depicts the results obtained from analysis of HeLa cells infected with wild type AAV2 at three different MOIs - l ⁇ 10 ⁇ and
- MOI is the number of recombinant AAV virions used to infect each cell as detected by determining the number of single stranded genomes by quantitative DNA hybridization. Unless otherwise indicated, the results presented in Figures 5A and B were obtained using the same procedures. Referring to Figures 5A and B, a signal indicative of site specific integration was detected in both 293 cells and HeLa cells at all three
- Example 3 identified those DNA sequences required for integration.
- the experiments in this example are directed at indicating that rep expression in trans mediates site specific integration of large pieces of DNA
- FIG. 7A depicts diagrams of the targeting vectors used in this example.
- the rep and cap genes of pAVV Figure 3
- an expression cassette comprising the CMV promoter fused to the lacZ gene (p2TRlacZ)
- an expression cassette comprising the CMV promoter fused to the human factor VIII cDNA (p2TRF8), respectively.
- an ITR-kan r -ITR cassette was inserted into a yeast cosmid. Details regarding the construction of these vectors are presented below.
- p2TRlacZ is a derivative of psub201 (see U.S. Patent No. 5,436, 146 to Shenk et al.) in which the Xba ⁇ fragment carrying the rep and cap genes present in psub201 were replaced with an expression cassette composed of the CMV promotor fused to the lacZ gene.
- p2TRlacZ was constructed according to the following procedure.
- an oligonucleotide encoding the restriction enzyme sites Notl-Mlul-SnaBl-Agel-BstBl-BssHll-Ncol-Hpa -BspEl- Pmfl-RsrU-Not (5'-GCGGCCGCACGCGTACGTACCGGTTCGAAGCGCACGG CCGACCATGGTTAACTCCGGACACGTGCGGACCGCGGCCGC-3') (SEQ ID NO 7) was synthesized and cloned into pUC19 cut with Kasl-Earl(pa ti_ ⁇ ) and blunted, producing a 2757 bp vector fragment.
- the ITR-kan r -ITR cassette inserted into the Notl site was constructed as follows
- the ITRs from psub201 were modified to add Sse I and Notl linkers in order to achieve the following structures 5'ITR Ssel- wII-ITR-.Yb ⁇ l-Notl, 3' ITR NotI--YZ> ⁇ I-ITR-.Pv..II-SseI
- FIG. 7B depicts diagrams of the helper vectors used in this example
- the following abbreviations and symbols are used the open rectangle labeled "rep” in its interior (coding region, i.e., open reading frame, for the rep gene); the open rectangle labeled "cap” in its interior (coding region, i.e., open reading frame, for the cap gene), the solid triangles with a vertical line attached (location of the endogenous promoters for encoding p5, pi 9, and p40 proteins)
- the open rectangle labeled "rep” in its interior
- the open rectangle labeled "cap” in its interior (coding region, i.e., open reading frame, for the cap gene)
- the solid triangles with a vertical line attached location of the endogenous promoters for encoding p5, pi 9, and p40 proteins
- AAV helper plasmids Two AAV helper plasmids were constructed, (i) pGN1764, which includes the AAV rep and cap coding regions (described in Example 1), and (ii) pRR5 , which includes the AAV rep coding region and only part of the cap coding region pGN1764 contains the entire AAV coding region
- This plasmid included the same insert as that found on pAAV-Ad (Samulski et al. J. Virol.
- pRR5 was constructed as follows First, psub201 was digested with Apal, the 1 103 base pair fragment in the cap region was removed, and then the two ends were religated The resulting construct was then digested with Xb ⁇ l, to create a 3 2 kb AAV genomic fragment That 3.2 kb fragment was subsequently inserted into the Spel site of p680E3 (Ketner et al.,
- site specific integration did not occur when the three ITR- containing plasmids (i.e., p2TRlacZ, p2TRF8, and p2TRcos) were transfected into 293 cells alone; the lack of site specific integration is indicated by the absence of a strong signal
- cotransfection with both Rep-expressing plasmids ⁇ i.e., pGN1764 and pRR5 resulted in the integration of all three ITR-containing plasmids
- the experiments described in this example are directed at confirming the chromosomal location of the integrated target vectors. More specifically, the experiments in this example indicate that site specific integration occurs into the AAVSl region of chromosome 1 Preparation of Nucleic Acid Constructs
- pRSVRepCap was constructed according to the following procedure First, a Bgfl linker was inserted into the AAV genome (pGN1764) at the H ⁇ l site eleven nucleotides 5' to the ATG codon of Rep 78, this insertion resulted in the creation of pGN1782 pGN1782 was then digested with Bg/ll and Xbal to yield a 4174 bp fragment containing the rep and cap coding sequences, but lacking the p5 promoter This fragment was then treated with Klenow enzyme in the presence of dNTPs and hgated with Notl linkers Thereafter, the fragment was digested, with Notl, gel purified, and hgated into the Notl site of pORS
- ⁇ -galactosidase by cells allowed detection of those cells successfully transfected in order to pick clones of cells that could then be expanded
- the following reagents, supplies, and methods were used in the ⁇ -galactosidase procedure described below Tissue culture reagents and supplies (l) DMEM (Bio-Whittaker cat # 12-614F), containing 10% fetal calf serum ( ⁇ yClone cat #A1 1 1 1-L, heat-inactivated at 56°C for 1 hour),
- fixative solution consisted of Dulbecco ' s phosphate buffered saline without calcium and magnesium (HyClone catalog-B-4004-L) containing 2% formaldehyde and 0 2% glutaraldehyde The solution was prepared by combining Dulbecco's PBS, 25% aqueous glutaraldehyde, and 37% formaldehyde The fixative solution was prepared fresh on the day it was used ( ⁇ ) staining buffer The staining buffer consisted of Dulbecco's phosphate buffered saline without calcium and magnesium (HyClone cat -B-4004-L) containing 5mM K 3 Fe(CN) 6 , 5mM K 4 Fe(CN) 6 , and 2mM MgCI 2 This solution was prepared from the following stock reagents Dulbecco's PBS, 200 mM
- fixative solution for 100 mL, 0 8 of 25% aqueous glutaraldehyde and 5 4 mL of 37% formaldehyde were added to 93 8 mL of dulbecco's PBS
- fixative solution and an equal volume of Dulbecco's PBS were placed on ice
- staining buffer for 100 L add 2 5 mL of 200 mM K 3 Fe(CN) 6 , 2 5 mL of 200mM K 4 Fe(CN) 6 , and 0 2 mL of 1 M MgCl 2 were added to 94 8 mL of Dulbecco's PBS, and (in) substrate solution this solution should be prepared no more than 30 minutes before use
- For 100 mL, 97 5 mL of staining buffer were warmed to 37°C, 2 5 mL of X-gal stock solution (40 mg/mL X
- Each well of the 12-well tissue culture plate to be stained required 1 mL of fixative solution, 1 mL of Dulbecco's PBS, and 1 mL of substrate solution
- the medium was aspirated from the wells, 1 mL of cold fixative solution was added, and then a 5 minute incubation period was commenced
- the fixative solution was aspirated, the wells were washed once with 1 mL of Dulbecco's PBS, and then replaced with 1 mL of warm substrate solution
- the plate was incubated for 24 hours at 37°C (do not use a CO 2 incubator) in the dark (wrapped in aluminum foil) Although the cell cultures began to stain immediately, they required 24 hours to fully develop before counting
- lane 4 represents cells cotransfected with p2TRlacZ and pRR5
- lanes 1-3 and 5-7 represent cells cotransfected with p2TRlacZ and pRSVRepCap
- lane 8 is the control (293 cells)
- Genomic DNA (10 ⁇ g from each clone) from the seven ⁇ -galactosidase positive clones was restricted with HinOlll, a restriction enzyme that has no restriction site in either the AAVS l region or in p2TRlacZ
- HinOlll a restriction enzyme that has no restriction site in either the AAVS l region or in p2TRlacZ
- the resulting digests were then resolved by electrophoresis on a 0.8% agarose gel (Gibco-BRL), and the product was transferred to a nitrocellulose membrane (Schleicher and Schuell)
- genomic DNA extracts were then analyzed by Southern blot using an AAVSl probe (a 3 5 kb EcoRl-Kpnl fragment derived from the AAVSl region of chromosome 19)
- Figure 10 a Southern blot, depicts the results of the hybridization analyses, each of lanes 1-7 contained the genomic DNA extract from one of the ⁇ -galacatasidase-positive clones
- the position and structure of the integrated p2TRlacZ in one of the seven ⁇ - galactosidase expressing clones was characterized in two independent ways. First, using fluorescent in situ hybridization, the integration event was mapped to one homolog of chromosome 19 at position 19ql3.4. Second, the integrated sequences were cloned, taking advantage of the fact that the entire p2TRlacZ ⁇ i.e., the colEl origin and the amp selectable marker) appears to be integrated. Both of these procedures and the results obtained are discussed in detail below.
- Metaphase chromosomes were prepared using standard cytogenetic techniques from cell line 293 lac z (CRL1573). Purified DNA from plasmid clone p2TRlacZ was labeled with digoxigenin-dUTP by nick translation. Labeled probe (p2TRlacZ) was combined with sheared human genomic DNA and cohybridized to metaphase chromosomes with a probe from the E2A locus (Genome Systems, Inc.). Hybridization was carried out in a solution containing
- FIG. 1 The method is diagrammatically depicted in Figure 1 1.
- the p2TRlacZ probe was used to mark the integration site of p2TRlacZ in the AAVS 1 region of chromosome 19; the E2A probe was used to mark the p arm of all of the copies of chromosome 19 present in the cell ⁇ i.e., the E2A probe specifically identifies the p arm on chromosome 19)
- This experiment resulted in the labelling, by the E2A probe, of four copies per cell of chromosome 19 at 19pl3 and the labelling, by the 2TRlacZ probe, of 1 copy of chromosome 19 at 19q l3 4.
- the resulting plasmid was characterized and the structure of the integrated plasmid sequences were determined along with the nature of the integration site.
- FIG. 12A diagrammatically depicts several of the characteristics of the AAVS l region of chromosome 19.
- the AAVSl region is represented by the large open rectangle (labeled "AAVS l ").
- Two restriction enzyme sites within the AAVS l region are indicated by the vertical lines protruding from that region ⁇ i.e., E oRl and Kpn ⁇ , located 1 bp and 3530 bp downstream of the 5' end of the AAVSl region, respectively)
- the binding site for the Rep expression product is represented by the shaded square (labeled
- FIG. 12B diagrammatically depicts the plasmid p2TRlacZ.
- p2TRlacZ is a derivative of psub201 (see U.S. Patent No. 5,436, 146 to Shenk et al. ) in which the Xbal fragment carrying the rep and cap genes present in psub201 were replaced with an expression cassette composed of the CMV promotor fused to the lacZ gene.
- the psub201 vector fragment is indicated by the solid region, and the approximate positions of the bacterial ori and amp r genes within that fragment are labelled "ori" and "amp,” respectively.
- Each of the two ITRs is depicted as an open box containing a shaded arrowhead.
- the lacZ gene is indicated by the slanted lines and the fused CMV promoter is indicated by the open region connecting the /acZ gene to one of the ITRs
- Cells from human cell line 293 were cotransfected with p2TRlacZ ( Figure 12B) and with helper plasmid pRR5 (not shown), resulting in the chromosome 19 integration product shown in the top portion of Figure 12C.
- Figure 12C uses the same designations that were used in Figures 12A and B Briefly, the AAVS l region is represented by the large open rectangle (labeled “AAVS l ”) The psub201 vector fragments of p2TRlacZ are indicated by the shaded rectangles, and the approximate positions of the bacterial ori and amp r genes within those fragments are labelled "ori" and "amp,” respectively. Each ITR is depicted by an open box containing a shaded arrowhead. Finally, the lacZ gene is indicated by the slanted lines, and the fused CMV promoter is indicated by the open rectangles (labeled "CMV") connecting the lacZ gene to an ITR (the junction between each CMV promoter and each ITR is indicated by the Spel restriction site).
- CMV fused "CMV”
- Figure 12C also contains information relating to other restriction enzyme sites (i.e., HinOlll and E oRV), indicated by the vertical lines protruding from the chromosome 19 integration product.
- HinOlll and E oRV restriction enzyme sites
- the right and left junctions between plasmid and genomic DNA were sequenced The sequence of the right junction was compared to the nucleic acid sequences of the lacZ gene and a portion of the AAVS 1 region.
- the nucleic acid sequences are set forth in the bottom right-hand portion of Figure 12C and are as follows: (i) right junction: 5' -
- nucleic acid sequences of p2TRlacZ were compared to the nucleic acid sequences of p2TRlacZ and a portion of genomic DNA
- the nucleic acid sequences are set forth in the bottom left-hand portion of Figure 12C and are as follows (i) left junction 5' - CCTGAGCCACGCGCAGCTGCATTAA - 3' (SEQ ID NO 15), (ii) P 2TRlacZ 5' - GAGCG
- AGCGAGCGCGCAGCTGC - 3' (SEQ ID NO 16), and (iii) portion of genomic DNA which flanks the site of integration 5' - CCTGAGCCA - 3'
- the breakpoint with respect to the genomic DNA is represented by the vertical line in SEQ ID NO 15 in Figure 12C
- the breakpoint in the plasmid is adjacent to a Rep binding site present in the outboard "a" portion of the ITR (corresponding to a' in Figure 4)
- the genomic DNA at this junction is of unknown origin
- the first 19 bp of genomic DNA 5' of the left junction are identical to an internal portion of Alu repeats [See E J Mange and A P Mange, Basic Human Genetics, pp. 270-73, Sinauer Associates, Inc (1994)] No homology to the remainder of the Alu repeat or to other DNA was detected in the sequence more distal to the left junction
- sequence analysis results physically demonstrate the integration of p2TRlacZ into the AAVS 1 region
- results provide confirmation of the data obtained by fluorescent //; situ hybridization showing that the p2TRlacZ integration site is on the q arm of chromosome 19
- MOLECULE TYPE DNA (genomic)
- MOLECULE TYPE DNA (genomic)
- MOLECULE TYPE DNA (genomic)
- MOLECULE TYPE DNA (genomic)
- MOLECULE TYPE DNA (genomic)
- MOLECULE TYPE DNA (genomic)
- MOLECULE TYPE DNA (genomic)
- MOLECULE TYPE DNA (genomic)
- MOLECULE TYPE DNA (genomic)
- xi SEQUENCE DESCRIPTION: SEQ ID NO: 16: GAGCGAGCGA GCGCGCAGCT GC 22
Abstract
Description
Claims
Priority Applications (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
EP95943844A EP0793713A4 (en) | 1994-12-16 | 1995-12-15 | Adeno-associated derived vector systems for gene delivery and integration into target cells |
JP08519292A JP2001500361A (en) | 1994-12-16 | 1995-12-15 | Adeno-associated vector system for gene transfer and integration into target cells |
Applications Claiming Priority (4)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US35750394A | 1994-12-16 | 1994-12-16 | |
US08/357,503 | 1994-12-16 | ||
US08/525,835 | 1995-09-08 | ||
US08/525,835 US5843742A (en) | 1994-12-16 | 1995-09-08 | Adeno-associated derived vector systems for gene delivery and integration into target cells |
Publications (1)
Publication Number | Publication Date |
---|---|
WO1996018727A1 true WO1996018727A1 (en) | 1996-06-20 |
Family
ID=26999681
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/US1995/016413 WO1996018727A1 (en) | 1994-12-16 | 1995-12-15 | Adeno-associated derived vector systems for gene delivery and integration into target cells |
Country Status (5)
Country | Link |
---|---|
US (1) | US5843742A (en) |
EP (1) | EP0793713A4 (en) |
JP (1) | JP2001500361A (en) |
CA (1) | CA2206244A1 (en) |
WO (1) | WO1996018727A1 (en) |
Cited By (22)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1998011244A2 (en) | 1996-09-11 | 1998-03-19 | The Government Of The United States Of America, Represented By The Secretary, Department Of Health And Human Services | Aav4 vector and uses thereof |
WO1998018950A2 (en) * | 1996-10-25 | 1998-05-07 | Deutsches Krebsforschungszentrum Stiftung des öffentlichen Rechts | Aav-dna helper virus sequences |
WO1998028417A1 (en) * | 1996-12-23 | 1998-07-02 | Gene-Cell | Nucleic acid constructs and uses thereof for direct nucleic acid incorporation into cells |
WO1998045462A1 (en) * | 1997-04-08 | 1998-10-15 | Istituto Di Ricerche Di Biologia Molecolare P. Angeletti S.P.A. | Recombinant vectors derived from adeno-associated virus suitable for gene therapy |
US5856152A (en) * | 1994-10-28 | 1999-01-05 | The Trustees Of The University Of Pennsylvania | Hybrid adenovirus-AAV vector and methods of use therefor |
US5866552A (en) * | 1996-09-06 | 1999-02-02 | The Trustees Of The University Of Pennsylvania | Method for expressing a gene in the absence of an immune response |
EP1005376A1 (en) * | 1997-03-14 | 2000-06-07 | The Children's Hospital Of Philadelphia | Methods and compositions for use in gene therapy for treatment of hemophilia |
US6251677B1 (en) | 1997-08-25 | 2001-06-26 | The Trustees Of The University Of Pennsylvania | Hybrid adenovirus-AAV virus and methods of use thereof |
US6387368B1 (en) | 1999-02-08 | 2002-05-14 | The Trustees Of The University Of Pennsylvania | Hybrid adenovirus-AAV virus and methods of use thereof |
JP2002531124A (en) * | 1998-12-10 | 2002-09-24 | バイエル・コーポレーシヨン | Vector having terminal repeat sequence of Epstein-Barr virus |
US6468524B1 (en) | 2000-03-22 | 2002-10-22 | The United States Of America, As Represented By The Secretary Of The Department Of Health And Human Services | AAV4 vector and uses thereof |
US6632670B1 (en) | 1995-09-08 | 2003-10-14 | Genzyme Corporation | AAV vectors for gene therapy |
AU771545B2 (en) * | 1996-09-11 | 2004-03-25 | Government Of The United States Of America, As Represented By The Secretary Of The Department Of Health And Human Services, The | AAV4 vector and uses thereof |
FR2867197A1 (en) * | 2004-03-02 | 2005-09-09 | Franck Yves Simon Matheux | Non-viral method for producing linear nucleic acid sequences, useful for gene transfer, especially therapy, using a plasmid that contains minimal optimized sequences and primers or restriction enzymes |
US7090836B2 (en) | 2002-06-21 | 2006-08-15 | Institut Pasteur | Vector for expressing α-L-iduronidase and method of treating MPS I by stereotactic injection into the brain of a mammal |
US7419817B2 (en) | 2002-05-17 | 2008-09-02 | The United States Of America As Represented By The Secretary Department Of Health And Human Services, Nih. | Scalable purification of AAV2, AAV4 or AAV5 using ion-exchange chromatography |
US7479554B2 (en) | 1998-05-28 | 2009-01-20 | The United States Of America As Represented By The Department Of Health And Human Services | AAV5 nucleic acids |
US8137960B2 (en) | 2003-12-04 | 2012-03-20 | The United States Of America As Represented By The Department Of Health And Human Services | Bovine adeno-associated viral (BAAV) vector and uses thereof |
EP2500434A1 (en) * | 2011-03-12 | 2012-09-19 | Association Institut de Myologie | Capsid-free AAV vectors, compositions, and methods for vector production and gene delivery |
US8283151B2 (en) | 2005-04-29 | 2012-10-09 | The United States Of America, As Represented By The Secretary, Department Of Health And Human Services | Isolation, cloning and characterization of new adeno-associated virus (AAV) serotypes |
US8927269B2 (en) | 2003-05-19 | 2015-01-06 | The United States Of America, As Represented By The Secretary, Department Of Health And Human Services | Avian adenoassociated virus and uses thereof |
US20170008975A1 (en) * | 2014-01-28 | 2017-01-12 | Lankenau Institute For Medical Research | Anti-Tissue Inhibitor of Metalloproteinase-4 (Timp-4) Antibodies and Methods of Use Thereof |
Families Citing this family (74)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20060088938A1 (en) * | 1995-12-15 | 2006-04-27 | Mitchell Lloyd G | Methods and compositions for use in spliceosome mediated RNA trans-splicing in plants |
US20030027250A1 (en) * | 1995-12-15 | 2003-02-06 | Mitchell Lloyd G. | Methods and compositions for use in spliceosome mediated RNA trans-splicing |
US20020193580A1 (en) * | 1995-12-15 | 2002-12-19 | Mitchell Lloyd G. | Methods and compositions for use in spliceosome mediated RNA trans-splicing |
EP0888086B1 (en) | 1996-02-15 | 2005-07-27 | Biosense Webster, Inc. | Excavation probe |
US6443974B1 (en) | 1996-07-28 | 2002-09-03 | Biosense, Inc. | Electromagnetic cardiac biostimulation |
US6835395B1 (en) | 1997-05-14 | 2004-12-28 | The University Of British Columbia | Composition containing small multilamellar oligodeoxynucleotide-containing lipid vesicles |
US6054312A (en) * | 1997-08-29 | 2000-04-25 | Selective Genetics, Inc. | Receptor-mediated gene delivery using bacteriophage vectors |
US20030129750A1 (en) * | 1998-02-05 | 2003-07-10 | Yitzhack Schwartz | Homing of donor cells to a target zone in tissue using active therapeutics or substances |
DE69838526T2 (en) | 1998-02-05 | 2008-07-03 | Biosense Webster, Inc., Diamond Bar | Device for releasing a drug in the heart |
US20030113303A1 (en) * | 1998-02-05 | 2003-06-19 | Yitzhack Schwartz | Homing of embryonic stem cells to a target zone in tissue using active therapeutics or substances |
US6436392B1 (en) * | 1998-05-20 | 2002-08-20 | University Of Iowa Research Foundation | Adeno-associated virus vectors |
US6221349B1 (en) | 1998-10-20 | 2001-04-24 | Avigen, Inc. | Adeno-associated vectors for expression of factor VIII by target cells |
US6200560B1 (en) * | 1998-10-20 | 2001-03-13 | Avigen, Inc. | Adeno-associated virus vectors for expression of factor VIII by target cells |
US6759237B1 (en) | 1998-11-05 | 2004-07-06 | The Trustees Of The University Of Pennsylvania | Adeno-associated virus serotype 1 nucleic acid sequences, vectors and host cells containing same |
CA2348382C (en) * | 1998-11-10 | 2013-09-17 | The University Of North Carolina At Chapel Hill | Chimeric parvovirus vectors and methods of making and administering the same |
US6303362B1 (en) | 1998-11-19 | 2001-10-16 | The Board Of Trustees Of The Leland Stanford Junior University | Adenoviral vector and methods for making and using the same |
US6340591B1 (en) | 1998-12-14 | 2002-01-22 | University Of Maryland | Integrative protein-DNA cochleate formulations and methods for transforming cells |
US6441156B1 (en) * | 1998-12-30 | 2002-08-27 | The United States Of America As Represented By The Department Of Health And Human Services | Calcium channel compositions and methods of use thereof |
US6403784B1 (en) | 1999-02-09 | 2002-06-11 | Lexicon Genetics Incorporated | Human uncoupling proteins and polynucleotides encoding the same |
US20040043488A1 (en) * | 1999-02-17 | 2004-03-04 | University Of Pittsburgh Of The Commonwealth System Of Higher Education | Adeno-associated viral gene-transfer vector system |
US6890726B1 (en) | 1999-04-06 | 2005-05-10 | Oklahoma Medical Research Foundation | Method for selecting recombinase variants with altered specificity |
US6893865B1 (en) * | 1999-04-28 | 2005-05-17 | Targeted Genetics Corporation | Methods, compositions, and cells for encapsidating recombinant vectors in AAV particles |
JP2003501043A (en) | 1999-05-28 | 2003-01-14 | ターゲティッド ジェネティクス コーポレイション | Methods and compositions for reducing levels of tumor necrosis factor (TNF) in TNF-related disorders |
EP1939300A1 (en) | 1999-05-28 | 2008-07-02 | Targeted Genetics Corporation | Methods and compositions for lowering the level of tumor necrosis factor (TNF) in TNF-associated disorders |
EP1246532A2 (en) * | 1999-06-07 | 2002-10-09 | Mirus Corporation | Delivery of single stranded dna for expression |
US7122335B1 (en) | 1999-06-08 | 2006-10-17 | University Of Iowa Research Foundation | Compounds and methods to enhance rAAV transduction |
CA2376400A1 (en) * | 1999-06-08 | 2000-12-14 | University Of Iowa Research Foundation | Compounds and methods to enhance raav transduction |
US6165754A (en) * | 1999-06-08 | 2000-12-26 | Cornell Research Foundation, Inc. | Method of expressing an exogenous nucleic acid |
US6410236B1 (en) | 1999-09-01 | 2002-06-25 | The Regents Of The University Of Michigan | Correcting diastolic dysfunction in heart failure |
US7241447B1 (en) * | 1999-10-07 | 2007-07-10 | University Of Iowa Research Foundation | Adeno-associated virus vectors and uses thereof |
AU7879000A (en) * | 1999-10-12 | 2001-04-23 | University Of North Carolina At Chapel Hill, The | Adeno-associated virus vectors encoding factor viii and methods of using the same |
AU782326B2 (en) | 1999-10-12 | 2005-07-21 | Lexicon Pharmaceuticals, Inc. | Human LDL receptor family proteins and polynucleotides encoding the same |
AU2001240018A1 (en) | 2000-03-03 | 2001-09-17 | The Board Of Trustees Of The Leland Stanford Junior University | Adeno-associated viral compositions and methods |
US6790667B1 (en) | 2000-05-30 | 2004-09-14 | Lexicon Genetics Incorporated | Human mitochondrial proteins and polynucleotides encoding the same |
US20040235173A1 (en) * | 2000-07-03 | 2004-11-25 | Gala Design, Inc. | Production of host cells containing multiple integrating vectors by serial transduction |
CA2413156C (en) * | 2000-07-03 | 2009-08-18 | Gala Design, Inc. | Expression vectors |
AU2001271614B2 (en) * | 2000-07-03 | 2007-05-31 | Catalent Pharma Solutions, Llc | Host cells containing multiple integrating vectors |
US20030224415A1 (en) * | 2001-06-29 | 2003-12-04 | Gala Design, Inc. | Selection free growth of host cells containing multiple integrating vectors |
US20040126774A1 (en) * | 2001-01-08 | 2004-07-01 | Mitchell Lioyd G. | Correction of factor VIII genetic defects using spliceosome mediated RNA trans splicing |
ES2305246T3 (en) * | 2001-06-01 | 2008-11-01 | Wyeth | COMPOSITIONS FOR THE SYSTEMIC ADMINISTRATION OF SEQUENCES CODING OSEAS MORPHOGENETIC PROTEINS. |
US7449562B2 (en) * | 2001-06-29 | 2008-11-11 | Novartis Ag | PERV screening method and use thereof |
US8241622B2 (en) * | 2001-07-13 | 2012-08-14 | University Of Iowa Research Foundation | Adeno-associated virus vectors with intravector heterologous terminal palindromic sequences |
JP2004534543A (en) * | 2001-07-13 | 2004-11-18 | ユニバーシテイ・オブ・アイオワ・リサーチ・フアウンデーシヨン | Pseudotyped adeno-associated virus and uses thereof |
CA2460157A1 (en) | 2001-09-18 | 2003-03-27 | Clontech Laboratories, Inc. | Site-specific recombinase based method for producing adenoviral vectors |
EP1451295B1 (en) * | 2001-11-02 | 2015-06-03 | Athersys, Inc. | Methods for mutating genes in cells and animals using insertional mutagenesis |
AU2003209226A1 (en) * | 2002-01-11 | 2003-07-30 | Michael Tennant | Adiponectin gene therapy |
US7399753B2 (en) * | 2002-02-25 | 2008-07-15 | Virxsys Corporation | Trans-splicing mediated photodynamic therapy |
US7384738B2 (en) * | 2002-03-28 | 2008-06-10 | Bremel Robert D | Retrovirus-based genomic screening |
US20040038304A1 (en) * | 2002-03-28 | 2004-02-26 | Gala Design, Inc. | Antibody libraries |
WO2003086451A1 (en) * | 2002-04-05 | 2003-10-23 | Centocor, Inc. | Asthma-related anti-il-13 immunoglobulin derived proteins, compositions, methods and uses |
US7078037B2 (en) * | 2002-04-19 | 2006-07-18 | The Arizona Board Of Regents On Behalf Of The University Of Arizona | Peptides and DNA encoding the peptides useful for immunizations against Coccidioides spp. infections |
JP2005536231A (en) * | 2002-05-08 | 2005-12-02 | イントロン,インコーポレーテッド | Use of spliceosome-mediated RNA trans-splicing to bring cell-selective replication to adenovirus |
ATE471387T1 (en) * | 2002-10-23 | 2010-07-15 | Virxsys Corp | SCREENING METHOD FOR IDENTIFYING EFFECTIVE PRE-TRANS SPLICING MOLECULES |
US7262027B2 (en) * | 2003-03-14 | 2007-08-28 | Medical College Of Ohio | Polypeptide and DNA immunization against Coccidioides spp. infections |
US20050095225A1 (en) * | 2003-03-31 | 2005-05-05 | Engelhardt John F. | Compounds and methods for pharmico-gene therapy of epithelial sodium channel associated disorders |
US20050221429A1 (en) * | 2004-01-16 | 2005-10-06 | Cardinal Health Pts, Llc | Host cells containing multiple integrating vectors comprising an amplifiable marker |
WO2005070948A1 (en) * | 2004-01-23 | 2005-08-04 | Intronn, Inc. | Correction of alpha-1-antitrypsin genetic defects using spliceosome mediated rna trans splicing |
US7968334B2 (en) * | 2004-01-23 | 2011-06-28 | Virxsys Corporation | Expression of apoAI and variants thereof using spliceosome mediated RNA trans-splicing |
JP2007518423A (en) * | 2004-01-23 | 2007-07-12 | イントロン、インコーポレイテッド | Expression of ApoA-1 and its variants using spliceosome-mediated RNA trans-splicing |
US20060094110A1 (en) * | 2004-07-30 | 2006-05-04 | Mcgarrity Gerard J | Use of spliceosome mediated RNA trans-splicing for immunotherapy |
US20060134658A1 (en) * | 2004-08-09 | 2006-06-22 | Garcia-Blanco Mariano A | Use of RNA trans-splicing for generation of interfering RNA molecules |
DE102004047492B4 (en) * | 2004-09-23 | 2006-07-20 | Jost-Werke Gmbh & Co. Kg | Method for transmitting electrical, pneumatic or hydraulic energy and a power transmission system |
US7871795B2 (en) | 2004-10-08 | 2011-01-18 | Virxsys Corporation | Targeted trans-splicing of highly abundant transcripts for in vivo production of recombinant proteins |
WO2006083331A2 (en) * | 2004-10-08 | 2006-08-10 | Intronn, Inc | Use of rna trans-splicing for antibody gene transfer and antibody polypeptide production |
CN101124328A (en) * | 2004-12-15 | 2008-02-13 | 北卡罗来纳查佩尔山大学 | Chimeric vectors |
US20090017062A1 (en) * | 2006-04-28 | 2009-01-15 | Iowa Research Foundation Iowa Centers For Enterpri | Methods and compounds to alter virus infection |
AU2006344750A1 (en) * | 2006-06-15 | 2007-12-27 | Targeted Genetics Corporation | Methods for treating target joints in inflammatory arthritis using AAV vectors encoding a TNF antagonist |
US8685720B2 (en) * | 2006-11-03 | 2014-04-01 | The Trustees Of Princeton University | Engineered cellular pathways for programmed autoregulation of differentiation |
US8889641B2 (en) | 2009-02-11 | 2014-11-18 | The University Of North Carolina At Chapel Hill | Modified virus vectors and methods of making and using the same |
US9265813B2 (en) | 2011-10-27 | 2016-02-23 | Wellstat Ophthalmics Corporation | Vectors encoding rod-derived cone viability factor |
US10377801B2 (en) | 2015-11-04 | 2019-08-13 | Northwestern University | Amelioration of chronic kidney disease |
US10669320B2 (en) | 2015-11-18 | 2020-06-02 | The Regents Of The University Of Michigan | Mps1 and KNL1 phosphorylation system |
WO2017139381A1 (en) | 2016-02-08 | 2017-08-17 | University Of Iowa Research Foundation | Methods to produce chimeric adeno-associated virus/bocavirus parvovirus |
EA201892006A1 (en) | 2016-03-07 | 2019-04-30 | Юниверсити Оф Айова Рисерч Фаундейшн | AAV-MEDIATED EXPRESSION USING THE SYNTHETIC PROMOTER AND ENCHANSER |
Family Cites Families (23)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US4722848A (en) * | 1982-12-08 | 1988-02-02 | Health Research, Incorporated | Method for immunizing animals with synthetically modified vaccinia virus |
US4965199A (en) * | 1984-04-20 | 1990-10-23 | Genentech, Inc. | Preparation of functional human factor VIII in mammalian cells using methotrexate based selection |
US5139941A (en) * | 1985-10-31 | 1992-08-18 | University Of Florida Research Foundation, Inc. | AAV transduction vectors |
US5219740A (en) * | 1987-02-13 | 1993-06-15 | Fred Hutchinson Cancer Research Center | Retroviral gene transfer into diploid fibroblasts for gene therapy |
WO1988009809A2 (en) * | 1987-06-12 | 1988-12-15 | Cetus Corporation | Cell system for expression of recombinant protein without production of virus |
DE10399031I1 (en) * | 1987-08-28 | 2004-01-29 | Health Research Inc | Recombinant viruses. |
US5399346A (en) * | 1989-06-14 | 1995-03-21 | The United States Of America As Represented By The Department Of Health And Human Services | Gene therapy |
US5436146A (en) * | 1989-09-07 | 1995-07-25 | The Trustees Of Princeton University | Helper-free stocks of recombinant adeno-associated virus vectors |
US5225347A (en) * | 1989-09-25 | 1993-07-06 | Innovir Laboratories, Inc. | Therapeutic ribozyme compositions and expression vectors |
FR2658432B1 (en) * | 1990-02-22 | 1994-07-01 | Medgenix Group Sa | MICROSPHERES FOR THE CONTROLLED RELEASE OF WATER-SOLUBLE SUBSTANCES AND PREPARATION METHOD. |
WO1992001070A1 (en) * | 1990-07-09 | 1992-01-23 | The United States Of America, As Represented By The Secretary, U.S. Department Of Commerce | High efficiency packaging of mutant adeno-associated virus using amber suppressions |
MY109299A (en) * | 1990-08-15 | 1996-12-31 | Virogenetics Corp | Recombinant pox virus encoding flaviviral structural proteins |
US5173414A (en) * | 1990-10-30 | 1992-12-22 | Applied Immune Sciences, Inc. | Production of recombinant adeno-associated virus vectors |
JP3534749B2 (en) * | 1991-08-20 | 2004-06-07 | アメリカ合衆国 | Adenovirus-mediated gene transfer into the gastrointestinal tract |
CA2106260A1 (en) * | 1992-09-17 | 1994-03-18 | Robert M. Kotin | Human adeno-associated virus integration site dna and uses thereof |
EP0733122A4 (en) * | 1993-05-26 | 1998-06-10 | Us Health | Fusion proteins containing adeno-associated virus rep protein and bacterial protein |
US5834441A (en) * | 1993-09-13 | 1998-11-10 | Rhone-Poulenc Rorer Pharmaceuticals Inc. | Adeno-associated viral (AAV) liposomes and methods related thereto |
AU678867B2 (en) * | 1993-11-09 | 1997-06-12 | Medical College Of Ohio, The | Stable cell lines capable of expressing the adeno-associated virus replication gene |
AU688428B2 (en) * | 1993-11-09 | 1998-03-12 | Johns Hopkins University, The | Generation of high titers of recombinant AAV vectors |
US5693531A (en) * | 1993-11-24 | 1997-12-02 | The United States Of America As Represented By The Department Of Health And Human Services | Vector systems for the generation of adeno-associated virus particles |
US5856152A (en) * | 1994-10-28 | 1999-01-05 | The Trustees Of The University Of Pennsylvania | Hybrid adenovirus-AAV vector and methods of use therefor |
US6342390B1 (en) * | 1994-11-23 | 2002-01-29 | The United States Of America As Represented By The Secretary Of Health And Human Services | Lipid vesicles containing adeno-associated virus rep protein for transgene integration and gene therapy |
AU707866B2 (en) * | 1994-12-06 | 1999-07-22 | Targeted Genetics Corporation | Packaging cell lines for generation of high titers of recombinant AAV vectors |
-
1995
- 1995-09-08 US US08/525,835 patent/US5843742A/en not_active Expired - Lifetime
- 1995-12-15 CA CA002206244A patent/CA2206244A1/en not_active Abandoned
- 1995-12-15 EP EP95943844A patent/EP0793713A4/en not_active Withdrawn
- 1995-12-15 JP JP08519292A patent/JP2001500361A/en not_active Ceased
- 1995-12-15 WO PCT/US1995/016413 patent/WO1996018727A1/en not_active Application Discontinuation
Non-Patent Citations (4)
Title |
---|
CURRENT OPINION IN BIOTECHNOLOGY, Volume 3, issued 1992, BARRIE J. CARTER, "Adeno-Associated Virus Vectors", pages 533-539. * |
HUMAN GENE THERAPY, Volume 5, issued 1994, ROBERT M. KOTIN, "Prospects for the Use of Adeno-Associated Virus as a Vector for Human Gene Therapy", pages 793-801. * |
MOLECULAR AND CELLULAR BIOLOGY, Volume 8, Number 10, issued October 1988, LEBKOWSKI et al., "Adeno-Associated Virus: A Vector System for Efficient Introduction and Integration of DNA Into a Variety of Mammalian Cell Types", pages 3988-3996. * |
See also references of EP0793713A4 * |
Cited By (41)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5856152A (en) * | 1994-10-28 | 1999-01-05 | The Trustees Of The University Of Pennsylvania | Hybrid adenovirus-AAV vector and methods of use therefor |
US5871982A (en) * | 1994-10-28 | 1999-02-16 | The Trustees Of The University Of Pennsylvania | Hybrid adenovirus-AAV virus and methods of use thereof |
EP1983057A3 (en) * | 1995-09-08 | 2009-01-07 | Genzyme Corporation | Improved AAV vectors for gene therapy |
US6632670B1 (en) | 1995-09-08 | 2003-10-14 | Genzyme Corporation | AAV vectors for gene therapy |
US5866552A (en) * | 1996-09-06 | 1999-02-02 | The Trustees Of The University Of Pennsylvania | Method for expressing a gene in the absence of an immune response |
US8507267B2 (en) | 1996-09-11 | 2013-08-13 | U.S. Dept. of Health and Human Services, National Institutes of Health | AAV4 vector and uses thereof |
AU771545B2 (en) * | 1996-09-11 | 2004-03-25 | Government Of The United States Of America, As Represented By The Secretary Of The Department Of Health And Human Services, The | AAV4 vector and uses thereof |
US7718424B2 (en) | 1996-09-11 | 2010-05-18 | The United States Of America As Represented By The Department Of Health And Human Services | AAV4 vector and uses thereof |
WO1998011244A2 (en) | 1996-09-11 | 1998-03-19 | The Government Of The United States Of America, Represented By The Secretary, Department Of Health And Human Services | Aav4 vector and uses thereof |
US8846389B2 (en) | 1996-09-11 | 2014-09-30 | The United States Of America, As Represented By The Secretary, Department Of Health And Human Services | AAV4 vector and uses thereof |
WO1998011244A3 (en) * | 1996-09-11 | 1998-05-22 | Us Gov Health & Human Serv | AAV4 vector and uses thereof |
WO1998018950A3 (en) * | 1996-10-25 | 1998-06-18 | Deutsches Krebsforsch | AAV-DNA helper virus sequences |
WO1998018950A2 (en) * | 1996-10-25 | 1998-05-07 | Deutsches Krebsforschungszentrum Stiftung des öffentlichen Rechts | Aav-dna helper virus sequences |
US7148341B2 (en) | 1996-10-25 | 2006-12-12 | Deutsches Krebsforschungszentrum Stiftung Des Offentlichen Rechts | AAV DNA comprising helper virus sequences |
WO1998028417A1 (en) * | 1996-12-23 | 1998-07-02 | Gene-Cell | Nucleic acid constructs and uses thereof for direct nucleic acid incorporation into cells |
US7998734B2 (en) | 1997-03-14 | 2011-08-16 | The Children's Hospital Of Philadelphia | Methods and compositions for use in gene therapy for treatment of hemophilia |
EP1005376A4 (en) * | 1997-03-14 | 2004-11-24 | Philadelphia Children Hospital | Methods and compositions for use in gene therapy for treatment of hemophilia |
EP1005376A1 (en) * | 1997-03-14 | 2000-06-07 | The Children's Hospital Of Philadelphia | Methods and compositions for use in gene therapy for treatment of hemophilia |
WO1998045462A1 (en) * | 1997-04-08 | 1998-10-15 | Istituto Di Ricerche Di Biologia Molecolare P. Angeletti S.P.A. | Recombinant vectors derived from adeno-associated virus suitable for gene therapy |
US6251677B1 (en) | 1997-08-25 | 2001-06-26 | The Trustees Of The University Of Pennsylvania | Hybrid adenovirus-AAV virus and methods of use thereof |
US7479554B2 (en) | 1998-05-28 | 2009-01-20 | The United States Of America As Represented By The Department Of Health And Human Services | AAV5 nucleic acids |
JP2002531124A (en) * | 1998-12-10 | 2002-09-24 | バイエル・コーポレーシヨン | Vector having terminal repeat sequence of Epstein-Barr virus |
US6387368B1 (en) | 1999-02-08 | 2002-05-14 | The Trustees Of The University Of Pennsylvania | Hybrid adenovirus-AAV virus and methods of use thereof |
US6468524B1 (en) | 2000-03-22 | 2002-10-22 | The United States Of America, As Represented By The Secretary Of The Department Of Health And Human Services | AAV4 vector and uses thereof |
US7419817B2 (en) | 2002-05-17 | 2008-09-02 | The United States Of America As Represented By The Secretary Department Of Health And Human Services, Nih. | Scalable purification of AAV2, AAV4 or AAV5 using ion-exchange chromatography |
US7090836B2 (en) | 2002-06-21 | 2006-08-15 | Institut Pasteur | Vector for expressing α-L-iduronidase and method of treating MPS I by stereotactic injection into the brain of a mammal |
US8927269B2 (en) | 2003-05-19 | 2015-01-06 | The United States Of America, As Represented By The Secretary, Department Of Health And Human Services | Avian adenoassociated virus and uses thereof |
US9238800B2 (en) | 2003-05-19 | 2016-01-19 | The United States Of America, As Represented By The Secretary, Department Of Health And Human Services | Avian adenoassociated virus and uses thereof |
US9193769B2 (en) | 2003-12-04 | 2015-11-24 | The United States Of America, As Represented By The Secretary, Department Of Health And Human Services | Bovine adeno-associated viral (BAAV) vector and uses thereof |
US8685722B2 (en) | 2003-12-04 | 2014-04-01 | The United States Of America, As Represented By The Secretary, Department Of Health And Human Services | Bovine adeno-associated viral (BAAV) vector and uses thereof |
US8137960B2 (en) | 2003-12-04 | 2012-03-20 | The United States Of America As Represented By The Department Of Health And Human Services | Bovine adeno-associated viral (BAAV) vector and uses thereof |
FR2867197A1 (en) * | 2004-03-02 | 2005-09-09 | Franck Yves Simon Matheux | Non-viral method for producing linear nucleic acid sequences, useful for gene transfer, especially therapy, using a plasmid that contains minimal optimized sequences and primers or restriction enzymes |
US8283151B2 (en) | 2005-04-29 | 2012-10-09 | The United States Of America, As Represented By The Secretary, Department Of Health And Human Services | Isolation, cloning and characterization of new adeno-associated virus (AAV) serotypes |
CN103764831A (en) * | 2011-03-11 | 2014-04-30 | 肌肉学研究协会 | Capsid-free AAV vectors, compositions, and methods for vector production and gene delivery |
WO2012123430A1 (en) | 2011-03-11 | 2012-09-20 | Association Institut De Myologie | Capsid-free aav vectors, compositions, and methods for vector production and gene delivery |
US9598703B2 (en) | 2011-03-11 | 2017-03-21 | Association Institut De Myologie; Université Pierre Et Marie Curie (Paris 6); Centre National De La Recherche Scientifique; Institut National De La Santé De Lad Recherche Médicale | Capsid-free AAV vectors, compositions, and methods for vector production and gene delivery |
AU2012228376B2 (en) * | 2011-03-11 | 2017-06-22 | Association Institut De Myologie | Capsid-free AAV vectors, compositions, and methods for vector production and gene delivery |
CN103764831B (en) * | 2011-03-11 | 2019-11-01 | 肌肉学研究协会 | AAV carrier, composition without capsid and the method for preparing carrier and gene delivery |
EP4227415A2 (en) | 2011-03-11 | 2023-08-16 | Association Institut de Myologie | Capsid-free aav vectors, compositions, and methods for vector production and gene delivery |
EP2500434A1 (en) * | 2011-03-12 | 2012-09-19 | Association Institut de Myologie | Capsid-free AAV vectors, compositions, and methods for vector production and gene delivery |
US20170008975A1 (en) * | 2014-01-28 | 2017-01-12 | Lankenau Institute For Medical Research | Anti-Tissue Inhibitor of Metalloproteinase-4 (Timp-4) Antibodies and Methods of Use Thereof |
Also Published As
Publication number | Publication date |
---|---|
EP0793713A1 (en) | 1997-09-10 |
EP0793713A4 (en) | 1998-07-01 |
CA2206244A1 (en) | 1996-06-20 |
JP2001500361A (en) | 2001-01-16 |
US5843742A (en) | 1998-12-01 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US5843742A (en) | Adeno-associated derived vector systems for gene delivery and integration into target cells | |
AU2022200502B2 (en) | Adeno-associated virus vector variants for high efficiency genome editing and methods thereof | |
US7238674B2 (en) | Methods for delivering DNA to muscle cells using recombinant adeno-associated virus vectors | |
US8784799B2 (en) | Duplexed parvovirus vectors | |
CA2236968C (en) | Accessory functions for use in recombinant aav virion production | |
EP1696036B1 (en) | Use of recombinant adeno-associated virus in the manufacture of a medicament for gene therapy via muscle cells | |
US20010006955A1 (en) | Method for recombinant adeno-associated virus-directed gene therapy | |
US6207457B1 (en) | Targeted nucleotide sequence delivery and integration system |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): CA JP |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LU MC NL PT SE |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
ENP | Entry into the national phase |
Ref document number: 2206244 Country of ref document: CA Ref country code: CA Ref document number: 2206244 Kind code of ref document: A Format of ref document f/p: F |
|
ENP | Entry into the national phase |
Ref country code: JP Ref document number: 1996 519292 Kind code of ref document: A Format of ref document f/p: F |
|
WWE | Wipo information: entry into national phase |
Ref document number: 1995943844 Country of ref document: EP |
|
WWP | Wipo information: published in national office |
Ref document number: 1995943844 Country of ref document: EP |
|
WWW | Wipo information: withdrawn in national office |
Ref document number: 1995943844 Country of ref document: EP |