WO1996033736A1 - Malaria peptides and vaccines - Google Patents

Malaria peptides and vaccines Download PDF

Info

Publication number
WO1996033736A1
WO1996033736A1 PCT/US1996/005798 US9605798W WO9633736A1 WO 1996033736 A1 WO1996033736 A1 WO 1996033736A1 US 9605798 W US9605798 W US 9605798W WO 9633736 A1 WO9633736 A1 WO 9633736A1
Authority
WO
WIPO (PCT)
Prior art keywords
pfempl
polypeptide
nucleic acid
amino acid
acid sequence
Prior art date
Application number
PCT/US1996/005798
Other languages
French (fr)
Inventor
Dror I. Baruch
Brittan L. Pasloske
Russell J. Howard
Original Assignee
Affymax Technologies N.V.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Affymax Technologies N.V. filed Critical Affymax Technologies N.V.
Priority to AU58512/96A priority Critical patent/AU5851296A/en
Publication of WO1996033736A1 publication Critical patent/WO1996033736A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/44—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from protozoa
    • C07K14/445—Plasmodium
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • the present invention generally relates to novel proteins, and fragments thereof, as well as nucleic acids which encode these proteins, and methods of making and using these proteins in diagnostic, prophylactic and therapeutic applications.
  • the present invention relates to proteins from the Plasj ⁇ diuji. falciparum erythrocyte membrane protein 1 (“PfEMPl”) gene family and fragments thereof which are derived from malaria parasitized eryhthrocytes.
  • these proteins are derived from the erythrocyte membrane protein of Plasmodium falciparum parasitized erythrocytes, also termed "PfEMPl".
  • the present invention also provides nucleic acids encoding these proteins, which proteins and nucleic acids are associated with the pathology of malaria infections, and which may be used as vaccines or other prophylactic treatments for the prevention of malaria infections, and/or in diagnosing and treating the symptoms of patients who suffer from malaria and associated diseases.
  • the present invention was made with U.S. Government support under UNDP/World Bank/WHO grant No. 920570 and AID grant DPE-0453-G-SS-8049-00, and the government may have certain rights in the invention.
  • Endothelial cell surface proteins such as CD36, thrombospondin (TSP) and ICAM-l have been identified as major host receptors for mature PE. See, e .g. , Barnwell et al. , J. Immunol . (1985) 135:3494-3497; Roberts et al., Nature (1985) 318:64-66; and Berendt et al., Nature (1989) 341:57-59. PE sequestration confers unique advantages for
  • P. falciparum parasites (Howard and Gilladoga, Blood (1989) 74:2603-2618), but also contributes directly to the acute pathology of P. falciparum (Miller et al., Science (1994) 264:1878-1883).
  • P. falciparum infection is associated with neurological impairment and cerebral pathology seen increasingly in severe drug-resistant malaria (Howard and Gilladoga, supra) .
  • the genesis of human cerebral malaria is likely due to a combination of factors including particular parasite phenotypes (Berendt et al. , Parasitol .
  • P . falciparum PE The capacity of P . falciparum PE to express variant forms of PfEMPl contributes to the special virulence of this parasite. Variant parasites can evade variant-specific antibodies elicited by earlier infections.
  • the P. falciparum variant antigens have been defined in vitro using antiseru prepared in Aotus monkeys infected with individual parasite strains (Howard et al., Molec . Biochem . Parasitol . (1988) 27:207-223).
  • Antibodies raised against a particular parasite will only react by PE agglutination, indirect immuno- fluorescence or immunoelectronmicroscopy with PE from the same strain (van Schravendijk et al., Blood (1991) 78:226-236).
  • Such studies with PE from malaria patients in diverse geographic locations and sera from the same or different patients confirm that PE in natural isolates express variant surface antigens and that individual patients respond to infection by production of isolate-specific antibodies (Marsh and Howard, Science (1986) 231:150-153; Aguiar et al., Am . J. Trop. Med. Hyg. (1992) 47:621-632; Iqbal et al., Trans . R. Soc. Trop. Med . Hyg. (1993) 87:583-588.
  • Expression of a variant antigen on PE has also been demonstrated in several simian, murine and human malaria species, including
  • PfEMPl was identified as a 125 I-labeled, size diverse protein (200-350 kD) on PE that is lacking from uninfected erythrocytes, and that is also labeled by biosynthetic incorporation of radiolabeled amino acids (Leech et al., J . Exp . Med .
  • PfEMPl is not extracted from PE by neutral detergents such as Triton X-100 but is extracted by SDS, suggesting that it is linked to the erythrocyte cytoskeleton (Aley et al., J. Med . Exp. (1984) 160:1585-1590). After addition of excess Triton X-100, PfEMPl is immunoreactive with appropriate serum antibodies (Howard et al., (1988), supra) . Mild trypsinization of intact PE rapidly cleaves PfEMPl from the cell surface (Leech et al.
  • PfEMPl bears antigenically diverse epitopes since it is immunoprecipitated from particular strains of P. falciparum by antibodies from sera of Aotus monkeys infected with the same strain, but not by antibodies from animals infected with heterologous strains (Howard et al. (1988) , supra) .
  • Knobless PE derived from parasite passage in splenectomized Aotus monkeys do not express surface PfEMPl and are not agglutinated with sera from immune individuals or infected monkeys (Howard et al.
  • VCAM-1 vascular cell adhesion molecule-1
  • ELAM-1 endothelial leukocyte adhesion molecule-1
  • the present invention provides substantially pure polypeptides which have amino acid sequences substantially homologous to the amino acid sequence of a PfEMPl protein, or biologically active fragments thereof.
  • the polypeptides of the present invention are substantially homologous to the amino acid sequence shown in Figure 2 or 12, biologically active fragments or analogues thereof.
  • pharmaceutical compositions comprising these polypeptides.
  • the present invention provides nucleic acids which encode the above described polypeptides. Particularly preferred nucleic acids will be substantially homologous to a part or whole of the nucleic acid sequence shown in Figure 12 or the nucleic acid encoding for the sequences shown in Figures 20 or 21.
  • the present invention also provides expression vectors comprising these nucleic acid sequences and cells capable of expressing same.
  • the present invention provides antibodies which recognize and bind PfEMPl polypeptides or biologically active fragments thereof. More preferred are those peptides which recognize and bind PfEMPl proteins associated with infection by more than one variant of . fal ciparum .
  • the present invention provides methods of inhibiting the formation of PfEMPl/ligand complex, comprising contacting PfEMPl or its ligands with polypeptides of the present invention.
  • the present invention provides methods of inhibiting sequestration of erythrocytes in a patient suffering from a malaria infection, comprising administering to said patient, an effective amount of a polypeptide of the present invention. Such administration may be carried out prior to or following infection.
  • the present invention provides a method of detecting the presence or absence of
  • the method comprises exposing the sample to an antibody of the invention, and detecting binding, if any, between the antibody and a component of the sample.
  • the present invention provides a method of determining whether a test compound is an antagonist of PfEMPl/ligand complex formation.
  • the method comprises incubating the test compound with PfEMPl or a biologically active fragment thereof, and its ligand, under conditions which permit the formation of the complex.
  • the amount of complex formed in the presence of the test compound is determined and compared with the amount of complex formed in the absence of the test compound. A decrease in the amount of complex formed in the presence of the test compound is indicative that the compound is an antagonist of PfEMPl/ligand complex formation.
  • Figure l shows a map of two Malayan Camp strain (“MC”) PfEMPl genes and recombinant protein fragments ("RP") .
  • the predicted open reading frame is shown starting from nucleotide +1.
  • CDNA clones Al through El and Gl are located with their boundaries (nucleotide number) .
  • Each clone was shown by PCR to be physically linked to the adjacent clones an confirmed by sequence overlap.
  • Clone D3 was linked 3' only to clone El and not to clones DI or D2.
  • gDNA clone F-gDNA was linked by sequence overlap to cDNAs DI and D2.
  • FIG. 1 shows the predicted amino acid sequence of two MC PfEMPl genes deduced from cDNA and gDNA clones, up to amino acid 2924.
  • the position of the putative 725 bp intron (nucleotides 7429-8153) is indicated by a vertical arrow. The likely transmembrane domain is boxed.
  • After amino acid 871 the extensive sequence differences in cDNAs D2 and D3 are shown as separate sequences extending 3' with contiguity to F- gDNA and cDNA El respectively. Amino acid sequence identity in these two sequences is shown in bold.
  • the four Duffy shows the predicted amino acid sequence of two MC PfEMPl genes deduced from cDNA and gDNA clones, up to amino acid 2924.
  • the position of the putative 725 bp intron is indicated by a vertical arrow.
  • the likely transmembrane domain is boxed.
  • After amino acid 871 the extensive sequence differences in cDNA
  • DBL domains denoted DBL-l through DBL-4 and three cysteine-rich motifs (“CRM”) between the DBL domains denoted CRM-1 through CRM-3, are shaded. Consensus amino acids in each DBL domain are underlined and conserved cysteines of the CRM motif are indicated by underlined dots.
  • Figure 3 shows alignment of the three CRMs with amino acid numbers indicated.
  • CRM-1 and CRM-2 share the motif CX 3 CX 3 CXC.
  • CRM-3 has less homology, that is more pronounced within a restricted sequence 2371-2390 that includes the CX 3 CXC motif.
  • Figure 4 shows autoradiographs of Southern blot hybridization of cDNA clones from the MC PfEMPl gene with DNA from various P . falciparum parasites digested with Eco RI or Eco RI and Hind III.
  • Panel A shows probing with cDNA Al, from the 5 1 end of the gene, shows hybridization to multiple bands with all P . falciparum parasites tested.
  • Panel B shows probing with clone Cl showing hybridization to fewer bands with MC K+ and MC K- parasites only. Markers of molecular mass in kd are indicated on the left. Table 2 summarizes the results obtained with additional cDNA and gDNA probes.
  • Figures 5A-5E show immunoprecipitation of 125 IPfEMPl from MC K+ PE with non-crossreacting antibodies elicited by immunization with recombinant proteins.
  • results with preim une serum are shown on the left gel lane with results for post-immunization serum from the same animal on the right.
  • Sera from rabbits (rab 1-6) and rats (rat 1-4) were used for immunoprecipitation of SDS extracts from MC K+ PE that had been surface labeled by lactoperoxidase catalyzed radioiodination. Immunoprecipitation was followed by SDS-PAGE and autoradiography.
  • the markers of molecular mass in kiloDalton are indicated on the left.
  • Figure 5A rabbits and rats were immunized with rCl-2. 125 I-PfEMPl is identified on the left by immunoprecipitation with a strain-specific anti-MC K+ serum.
  • Figure 5B sera from two rabbits immunized with rDl.
  • Figure 5C the 125 I-band immunoprecipitated by anti-rCl-2 and anti-rDl sera shares properties of detergent extraction and trypsin sensitivity with PfEMPl.
  • MC K+ PE were radioiodinated and some of the cells treated with trypsin (5 min. , 10 ⁇ g/ml) .
  • Sequential Triton X100 and SDS extracts were immunoprecipitated with three sera that define 125 I-PfEMPl of MC K+ parasites: pool of human immune serum; Aotus anti-MC K+ serum; rabbit 05-75 anti- PfEMP3 and PfEMPl serum.
  • the prebleed and post-rCl-2 immunization bleed from rabbit 1 were analyzed in parallel.
  • the anti-PfEMPl antibodies in anti-rCl-2 and anti-rDl sera do not crossreact.
  • Sera were preadsorbed with glutathione-Sepharose beads (none) , with GST or GST fusion proteins derived from MC PfEMPl (rBl, rCl-2, rDl) or other P. falciparum genes (rA62-5, rPfEMP3) and used for immunoprecipitation. Only a portion of the autoradiograph is shown.
  • Figure 6 shows the immunoblotting of diverse P. falciparum parasites with rabbit anti-rCl-2 serum identifying antigenic cross reactivity between the PfEMPl protein of MC K+ parasites and PfEMPl bands of several other parasites known to express antigenically distinct PfEMPl antigens.
  • SDS extracts from 2.5 X 10 s parasites were subjected to SDS-PAGE and transferred to PVDF membrane. The membrane was incubated with rabbit #2 anti-rCl-2 serum, 1 hour at room temperature. Bound antibodies were visualized by the ECL western blot method.
  • Figure 7 shows antisera raised against the rCl-2 fragment of MC K+ PfEMPl reacting with the surface of MC K+ in a strain-specific manner. Results shown for anti-rCl-2 rat serum #1. Panels A and B show indirect immunofluorescence of intact non-fixed PE of MC K+ strain detected by confocal fluorescence imaging microscopy. Cells (4% parasite ia) were incubated with anti-rCl-2 serum and visualized by
  • Panel A is a bright field showing a pigmented (mature) PE and several uninfected erythrocytes.
  • Panel B shows fluorescence of the same field with reactivity only on the surface of the PE. The focal concentration of fluorescence is attributed to the narrow plane of confocal microscopy. The bar equals 10 ⁇ m.
  • Figure 8 shows antibody mediated PE agglutination observed by light microscopy.
  • Anti-rCl-2 serum agglutinated mature MC K+ PE (1:20 dilution) but not MC K- PE or K+C+ ItG2-ICAM PE (1:5 dilution).
  • Pre-immune (prebleed) serum of the same animal did not agglutinate MC K+ PE (1:5 dilution).
  • Aotus anti MC K+ sera only agglutinated MC K+ PE.
  • the bar equals 500 ⁇ m.
  • the infected blood showed 8-15% parasitemia. Similar results obtained with other anti-rCl-2 sera are summarized in Table 3.
  • FIG 9 shows immunoelectron-microscopy of intact MC K+ PE with anti-rCl-2 serum identified PfEMPl expression specifically at knob protrusions rather than at areas of the PE surface membrane between knobs.
  • Treatment with rat antiserum was followed by treatment with 5 nm gold-conjugated goat anti-rat IgG. 5 nm gold particles were deposited on >50% of the knobs.
  • Figure 10 shows that antisera to the rCl-2 fragment of MC K+ PfEMPl block adherence of MC K+ PE to immobilized CD36 but do not block adherence to immobilized TSP.
  • PE or PRBC
  • the number of adherent PE remaining after washing was determined by light microscopy counting. Sera collected at day 28, after 2 immunizations was also active. Results shown as means and standard deviations of quadruplicate assays.
  • the graph shows PE preincubated with binding medium (BM) alone (no addition) or with BM containing 1:5 dilution or rat anti-PfEMP3 serum or rat anti-rCl-2 sera (rat #1-4).
  • Rat anti-rCl-2 sera blocked adherence of PE to CD36 (solid bars) but not to TSP (hatched bars) .
  • the inhibition of adherence observed with sera from rats 1, 2, and, 4 were significantly different from that of the control (p ⁇ 0.0004).
  • Figure 11 shows the concentration dependent blockade of adherence to CD36 with rat anti-rCl-2.
  • Immune filled circles
  • pre-immune serum open circles
  • Figures 12A-12L show the nucleic acid sequence with the deduced amino acid sequence of the MC PfEMPl gene. After base 2613 the extensive sequence differences in cDNAs D2 and D3 are shown as separate sequences extending 3' with contiguity to F-gDNA and cDNA El respectively.
  • Figure 13 shows the binding of CHO cells expressing surface CD36, to immobilized recombinant PfEMPl protein fragments.
  • CHO-CD36 cells were shown to bind to the fragment denoted rCl-2, however no binding was observed with the other fragments tested. Similarly no binding was observed with CHO- ICAM cells or control CHO cells.
  • Figure 14 shows the binding of CHO-CD36 cells in cells/mm 2 as a function of rCl-2 concentration added to the solid support.
  • Figures 15A and 15B are Western blots showing binding of CD36 to immobilized rCl-2.
  • Figure 15A shows that CD36 binds to immobilized rCl-2 and not to GST or to the MCvar-1 recombinant proteins rAl(3-158), rBl(161-385) , rCl- 1(402-605), rDl(818-1003) , rD2(982-1320, rFl-1(1300-1707) , rFl-2 (1688-2190) , rFl-3 (2171-2450) , rGl(2550-2794) or the MCvar-2 specific recombinant proteins rD3(992-1243) , rEl- 1(1219-1471) and rEl-2(1454-1719) or to the RP fusion partner, GST.
  • Figure 15B again shows that rCl-2 binds CD36, but fails to bind other cell surface receptors (P
  • Figure 16 shows a bar graph showing blockade of PE adherence to CD36 (shown as % of PE binding to immobilized CD36) , in the presence of various fragments of PfEMPl, e . g. , rA62-5, rBl, rCl-2 and rDl, and the GST fusion partner (rGST) .
  • Treatment with rCl-2 substantially blocks adherence of PE of different P. falciparum strains to CD36 (MC R+ (solid bars) , clone ItG2-ICAM (hatched bars) , clone ItG2-Gl (grey bars) and clone Palo Alto K- C+ (open bars) ) .
  • Figure 17 is a bar graph showing the effects of different fragments of PfEMPl on the binding of Malayan Camp strain and ItG2-ICAM strain parasitized erythrocyte to CD36.
  • Figure 18 shows the binding of PE from MC and ItG- ICAM strains to CD36 as a function of rCl-2 concentration.
  • Figure 19 shows binding of CD36 to immobilized fragments of rCl-2. Shown is the binding to fragment rCl-2[l- 233], rCl-2[l-59], rCl-2[l-87], rCl-2[1-102] , rCl-2[1-140] , rCl-2[1-192] and full length rCl-2.
  • the fragment designations indicate the position of the starting and ending amino acids from amino acids 575-808 (or 1 through 233) of the sequence shown in Figure 2.
  • Figure 20 shows deduced amino acid sequences of the corresponding rCl-2[1-179] region of PfEMPl genes from 11 different P. falciparum strains and clones.
  • sequences were obtained by PCR using the 1 and 179 primer set of MC PfEMPl. Sequences were obtained by amplification from genomic DNA (indicated by lower case g before the strain designation) by PCR from cDNA libraries (cMC and cFVO) or RT-PCR (dtG-F6) and cC5. These sequences, indicated by lower case c before the strain designation, represent the product of an expressed var gene. conserveed amino acids are indicated in the consensus sequence at the top of the sequence alignment chart.
  • Figure 21 shows the deduced amino acid sequences of the corresponding rCl-2[10-151] region of PfEMPl genes from six different P. falciparum strains and clones. These sequences were obtained by PCR using the universal primer set deduced from the sequences shown in Figure 20. Sequences were obtained by amplification from genomic DNA (indicated by the small g before the name of the strain) and by PCR from cDNA libraries (cMC) . These sequences, indicated by the small c, represent the product of an expressed var gene. In the MC strain, multiple var genes are shown. conserveed amino acids are indicated in the consensus sequence shown above the listed sequences.
  • Figure 22 shows the predicted structure of the MC PfEMPl gene product.
  • the figure shows the size and location of recombinant proteins (GST and MBP) derived from the sequence of MCvar-1 and MCvar-2.
  • Figure 23 shows immunoprecipitation with anti-rCl-2 and anti-MC specific sera and affinity purification with immobilized CD36 and TSP of labeled fragments cleaved from the surface of iodinated PE of strain MC K+ by mild trypsinization.
  • Figure 24 shows the concentration dependent blockade of adherence of strain MC PE to CD36 with rCl-2[1-233] and rCl-2[1-179] .
  • Determined IC 50 values are 1.2 ⁇ M for rCl-2 and 0.78 ⁇ M for rCl-2[1-179],
  • Figure 25 shows concentration dependent reversal of adherence of strain MC PE to CD36 with rCl-2[1-233] with an IC 5 o value of approximately o.5 ⁇ M.
  • the present invention generally relates to the Plasmodium falciparum erythrocyte membrane protein 1 ("PfEMPl") , nucleic acids which encode PfEMPl, and antibodies which specifically recognize PfEMPl.
  • PfEMPl Plasmodium falciparum erythrocyte membrane protein 1
  • the polypeptides, antibodies and nucleic acids are useful in a variety of applications including therapeutic, prophylactic, including vaccination, diagnostic and screening applications.
  • the data described herein, indicates that PfEMPl is responsible for both antigenic variation and receptor properties on PE, both of which are central to the special virulence and pathology of P. falciparum .
  • falciparum biology as the malarial adherence receptor for host proteins on microvascular endothelium, as described herein, indicates its usefulness in a malaria vaccine, in modelling prophylactic drugs, and also as a target for therapeutics to reverse PE adherence in acute cerebral malaria (Howard and Gilladoga, 1989) .
  • the present invention provides substantially pure PfEMPl polypeptides, analogs or biologically active fragments thereof.
  • substantially pure or isolated refer, interchangeably, to proteins, polypeptides and nucleic acids which are separated from proteins or other contaminants with which they are naturally associated.
  • a protein or polypeptide is considered substantially pure when that protein makes up greater than about 50% of the total protein content of the composition containing that protein, and typically, greater than about 60% of the total protein content. More typically, a substantially pure protein will make up from about 75 to about 90% of the total protein. Preferably, the protein will make up greater than about 90%, and more preferably, greater than about 95% of the total protein in the composition.
  • biologically active fragment refers to portions of the proteins or polypeptides, e.g., a PfEMPl derived polypeptide, which portions possess a particular biological activity, e.g., one or more activities found in a full length PfEMPl polypeptide.
  • biological activity may include the ability to bind a particular protein, substrate or ligand, to elicit antibodies reactive with PE, PfEMPl, the recombinant proteins or fragments thereof, to block, reverse or otherwise inhibit an interaction between two proteins, between an enzyme and its substrate, between an epitope and an antibody, or may include a particular catalytic activity.
  • polypeptides of the present invention particularly preferred polypeptides or biologically active fragments include, e.g., polypeptides that possess one or more of the biological activities described above, such as the the ability to bind a ligand of PfEMPl or inhibit the binding of PfEMPl to one or more of its ligands, e.g., CD36, TSP, ICAM-l, VCAM-1, ELAM-1, Chondroitin sulfate or by the presence within the polypeptide fragment of antigenic determinants which permit the raising of antibodies to that fragment.
  • polypeptides that possess one or more of the biological activities described above such as the the ability to bind a ligand of PfEMPl or inhibit the binding of PfEMPl to one or more of its ligands, e.g., CD36, TSP, ICAM-l, VCAM-1, ELAM-1, Chondroitin sulfate or by the presence within the polypeptide fragment of antigenic determinants which
  • polypeptides of the present invention may also be characterized by their immunoreactivity with antibodies raised against PfEMPl proteins or polypeptides.
  • the polypeptides are capable of inhibiting an interaction between a PfEMPl protein and an antibody raised against a PfEMPl protein.
  • fragments may be specifically immunoreactive with an antibody raised against a PfEMPl protein. Such fragments are also referred to herein as "immunologically active fragments.”
  • such biologically active fragments will be from about 5 to about 500 amino acids in length.
  • these peptides will be from about 20 to about 250 amino acids in length, and preferably from about 50 to about 200 amino acids in length.
  • the length of the fragment may depend, in part, upon the application for which the particular peptide is to be used. For example, for raising antibodies, the peptides may be of a shorter length, e .g. , from about 5 to about 50 amino acids in length, whereas for binding applications, the peptides may have a greater length, e .g. , from about 50 to about 500 amino acids in length, preferably, from about 100 to about 250 amino acids in length, and more preferably, from about 100 to about 200 amino acids in length.
  • polypeptides of the present invention may generally be prepared using recombinant or synthetic methods well known in the art. Recombinant techniques are generally described in Sambrook, et al., Molecular Cloning: A Laboratory Manual , (2nd ed.) Vols. 1-3, Cold Spring Harbor Laboratory, (1989) . Techniques for the synthesis of polypeptides are generally described in Merrifield, J. Amer. Chem . Soc . 85:2149-2456 (1963), Atherton, et al. , Solid Phase Peptide Synthesis : A Practical Approach , IRL Press (1989) , and Merrifield, Science 232:341-347 (1986). In preferred aspects, the polypeptides of the present invention may be expressed by a suitable host cell that has been transfected with a nucleic acid of the invention, as described in greater detail below.
  • polypeptides of the present invention can be carried out by methods that are generally well known in the art.
  • the polypeptides may be purified using readily available chromatographic methods, e.g., ion exchange, hydrophobic interaction, HPLC or affinity chromatography, to achieve the desired purity.
  • Affinity chromatography may be particularly attractive in allowing the investigator to take advantage of the specific biological activity of the desired peptide, e.g., ligand binding, presence of antigenic determinants, or the like.
  • Exemplary polypeptides of the present invention will generally comprise an amino acid sequence that is substantially homologous to the amino acid sequence of a PfEMPl protein, or biologically active fragments thereof, or may include sequences that may take on a homologous conformation.
  • the polypeptides of the present invention will comprise an amino acid sequence that is substantially homologous to the amino acid sequence shown in Figure 2, Figure 12, Figure 20 and Figure 21, or a biologically active fragment thereof.
  • substantially homologous is meant an amino acid sequence which is at least about 50% homologous to the amino acid sequence of PfEMPl or a biologically active fragment thereof, preferably at least about 90% homologous, and more preferably at least about 95% homologous.
  • substantially homologous may include a sequence that is at least 50% homologous, but that presents a homologous structure in three dimensions, i.e., includes a substantially similar surface charge or presentation of hydrophobic groups.
  • polypeptides examples include polypeptides having an amino acid sequence substantially homologous to the MC PfEMPl amino acid sequence as shown in Figure 2 or Figure 12, and PfEMPl of other P. falciparum strains as shown in Figures 20 and 21, as well as biologically active fragments of these polypeptides.
  • Preferred peptides include those peptide fragments of PfEMPl that are involved in the sequestration of parasitized erythrocytes.
  • Examples of these preferred peptides include peptides which comprise an amino acid sequence which is substantially homologous to amino acids 576 through 755 of the PfEMPl amino acid sequence shown in Figure 2 or Figure 12 or those sequences shown in Figures 20 and 21.
  • peptides and peptide fragments of PfEMPl which are relatively conserved among the variant strains of P . falciparum or which contain regions of high homology to PfEMPl proteins from other strains.
  • the term "relatively conserved” generally refers to amino acid sequences that are substantially homologous to portions of the amino acid sequence shown in Figure 2 and Figure 12.
  • Figure 12 may be used to amplify nucleic acids from other strains of P. falciparum.
  • Particularly preferred primer sequences include the primer sequences shown in Table 1, below.
  • universal primer compositions described in greater detail below and also shown in Table 1, may be used to amplify sequences that encode the peptides of the present invention.
  • relatively conserved peptides include those that are contained in a region of PfEMPl proteins that corresponds to amino acids 576 through 755 of the amino acid sequence of MC PfEMPl, as shown in Figure 2. Similar regions have been specifically elucidated in a number of P. falciparum strains (See Figures 20 and 21) . In general, these corresponding regions may be described as containing amino acid sequences that are encoded by the universal primer sequences described below. Generally, these amino acid sequences have one or more of the following general structures:
  • the polypeptides may contain both of the above general amino acid sequences.
  • Particularly preferred amino acid sequences will possess the conserved amino acids shown in the various fragments shown in Figures 20 and 21.
  • conserved amino acid sequences of six amino acids or greater, shown in Figures 20 and 21 may be used as epitopes for generation of antibodies that cross react with multiple P. falciparum strains.
  • the peptides of the invention may be free or tethered, or may include labeled groups for detection of the presence of the polypeptides.
  • Suitable labels include radioactive, fluorescent and catalytic labeling groups that are well known in the art and that are substantially described herein, e.g., signalling enzymes, chemical reporter groups, polypeptide signals, biotin and the like.
  • the peptides may include modifications to the N and C-termini of the peptide, e.g., an acylated N-terminus or amidated C- terminus.
  • amino acid variants of the above described polypeptides may include insertions, deletions and substitutions with other amino acids.
  • amino acids may be substituted with different amino acids having similar structural characteristics, e.g., net charge, hydrophobicity, or the like.
  • phenylalanine may be substituted with tyrosine, as a similarly hydrophobic residue.
  • Glycosylation modifications either changed, increased amounts or decreased amounts, as well as other sequence modifications are also envisioned.
  • peptidomimetics of the polypeptides of the present invention are also provided.
  • Peptide analogs are commonly used in the pharmaceutical industry as non-peptide drugs with properties analogous to those of the template peptide. These types of non-peptide compound are termed "peptide mimetics” or “peptidomimetics” (Fauchere, J. (1986) Adv . Drug Res . 15:29; Veber and Freidinger (1985) TJNS p.392; and Evans et al. (1987) J. Med . Chem 30:1229, and are usually developed with the aid of computerized molecular modeling.
  • Peptide mimetics that are structurally similar to therapeutically useful peptides may be used to produce an equivalent therapeutic or prophylactic effect.
  • Peptide mimetics may have significant advantages over polypeptide embodiments, including, for example: more economical production, greater chemical stability, enhanced pharmacological properties (half-life, absorption, potency, efficacy, etc.), altered specificity (e . g . , a broad-spectrum of biological activities) , reduced antigenicity, and others.
  • Labeling of peptidomimetics usually involves covalent attachment of one or more labels, directly or through a spacer (e.g., an amide group), to non-interfering position(s) on the peptidomimetic that are predicted by quantitative structure- activity data and/or molecular modeling.
  • Such non-interfering positions generally are positions that do not form direct contacts with the molecules to which the peptidomimetic binds (e.g., CD36) to produce the therapeutic effect.
  • Derivitization (e .g. , labelling) of peptidomimetics should not substantially interfere with the desired biological or pharmacological activity of the peptidomimetic.
  • peptidomimetics of peptides of the invention bind to their ligands (e.g., CD36) with high affinity and possess detectable biological activity (i.e., are agonistic or antagonistic to one or more ligand-mediated phenotypic changes) .
  • Systematic substitution of one or more amino acids of a consensus sequence with a D-amino acid of the same type may be used to generate more stable peptides.
  • constrained peptides comprising a consensus sequence or a substantially identical consensus sequence variation may be generated by methods known in the art (Rizo and Gierasch (1992) Ann. Rev . Biochem . 61: 387; for example, by adding internal cysteine residues capable of forming intramolecular disulfide bridges which cyclize the peptide.
  • Polypeptides of the present invention may also be characterized by their ability to bind antibodies raised against PfEMPl, or fragments thereof.
  • these antibodies recognize polypeptide domains that are homologous to the PfEMPl proteins from a number of variants of P. falciparum . These homologous domains will generally be present throughout the family of PfEMPl proteins.
  • a variety of immunoassay formats may be used to select antibodies specifically immunoreactive with a particular protein or domain.
  • solid-phase ELISA immunoassays are routinely used to select monoclonal antibodies specifically immunoreactive with a protein. See Harlow and Lane (1988) Antibodies, A Laboratory Manual , Cold Spring Harbor Publications, New York, for a description of immunoassay formats and conditions that can be used to determine specific immunoreactivity.
  • Antibodies to PfEMPl and its fragments are discussed in greater detail, below.
  • the terms "polypeptide” or “peptide” are used interchangeably to refer to peptides, peptidomimetics, analogs, and the like, as described above.
  • polypeptides of the present invention may be used as isolated polypeptides, or may exist as fusion proteins.
  • a "fusion protein” generally refers to a composite protein made up of two or more separate, heterologous proteins which are normally not fused together as a single protein.
  • a fusion protein may comprise a fusion of two or more heterologous or homologous sequences, provided these sequences are not normally fused together. Fusion proteins will generally be made by either recombinant nucleic acid methods, i.e., as a result of transcription and translation of a gene fusion comprising a segment encoding a polypeptide comprising a PfEMPl protein and a segment which encodes one or more heterologous proteins, or by chemical synthesis methods well known in the art.
  • nucleic acid sequences which encode the above described polypeptides and biologically active fragments.
  • nucleic acid sequences will comprise a segment that is substantially homologous to a portion or fragment of the nucleic acid sequence shown in Figure 12, and more typically, the nucleic acid sequence from about nucleotide position -211 to about position 3559 of the nucleotide sequence shown in Figures 12, 20 and 21.
  • the nucleic acids of the present invention will comprise at least about 15 consecutive nucleotides of the nucleic acid sequence shown in Figures 12, 20 or 21, more preferably, at least about 20 contiguous nucleotides, still more preferably, at least about 30 contiguous nucleotides, and still more preferably, at least about 50 contiguous nucleotides from the nucleotide sequence shown in Figures 12, 20 or 21.
  • Substantial homology in the nucleic acid context means that the segments, or their complementary strands, when compared, are the same when properly aligned with the appropriate nucleotide insertions or deletions, in at least about 60% of the nucleotides, typically, at least about 70%, more typically, at least about 80%, usually, at least about 90%, and more usually, at least about 95% to 98% of the nucleotides.
  • substantial homology exists when the segments will hybridize under selective hybridization conditions to a strand, or its complement, typically using a sequence of at least about 15 contiguous nucleotides derived from the PfEMPl nucleic acid sequence.
  • larger segments will usually be preferred, e .g.
  • At least about 20 or 30 contiguous nucleotides more usually about 40 contiguous nucleotides, and preferably more than about 50 contiguous nucleotides.
  • Selective hybridization exists when hybridization occurs which is more selective than total lack of specificity. See, Kanehisa, Nucleic Acid Res . 12:203-213 (1984) .
  • Nucleic acids of the present invention include RNA, cDNA, genomic DNA, synthetic forms and mixed polymers, both sense and antisense strands. Furthermore, different alleles of each isoform are also included.
  • the present invention also provides recombinant nucleic acids which are not otherwise naturally occurring.
  • the nucleic acids included in the present invention will typically comprise RNA or DNA or mixed polymers.
  • the DNA compositions will generally include a coding region which encodes a polypeptide comprising an amino acid sequence substantially homologous to the amino acid sequence of a PfEMPl protein. More preferred are those DNA segments comprising a nucleotide sequence which encodes a CD36 binding fragment of the PfEMPl protein.
  • cDNA encoding the polypeptides of the present invention may be readily employed as a probe useful for obtaining genes which encode the PfEMPl polypeptides of the present invention. Preparation of these probes may be carried out by generally well known methods.
  • the cDNA probes may be prepared from the amino acid sequence of the PfEMPl protein.
  • probes may be prepared based upon segments of the amino acid sequence which possess relatively low levels of degeneracy, i.e., few or one possible nucleic acid sequences which encode therefor. Suitable synthetic DNA fragments may then be prepared, e.g., by the phosphoramidite method described by Beaucage and Carruthers, Tetra . Letts .
  • nucleotide sequences which are relatively conserved among the PfEMPl coding sequences for the various P. falciparum strains may be used as suitable probes.
  • a double stranded probe may then be obtained by either synthesizing the complementary strand and hybridizing the strands together under appropriate conditions or by adding the complementary strand using DNA polymerase with an appropriate primer sequence.
  • Such cDNA probes may be used in the design of oligonucleotide probes and primers for screening and cloning such genes, e .g. , using well known PCR techniques, or, alternatively, may be used to detect the presence or absence of a PfEMPl gene in a cell.
  • Such nucleic acids, or fragments may comprise part or all of the cDNA sequence that encodes the polypeptides of the present invention.
  • Effective cDNA probes may comprise as few as 15 consecutive nucleotides in the cDNA sequence, but will often comprise longer segments. Further, these probes may further comprise an additional nucleotide sequence, such as a transcriptional primer sequence for cloning, or a detectable group for easy identification and location of complementary sequences.
  • cDNA or genomic libraries of various types may be screened for new alleles or related sequences using the above probes. The choice of cDNA libraries normally corresponds to tissue sources which are abundant in mRNA for the desired polypeptides. Phage libraries are normally preferred, e . g .
  • nucleic acids of the present invention also include the PCR product or RT-PCR product, produced using the above described primer probes.
  • primer probes derived from the nucleotide sequence shown in Figure 12 may be used to amplify sequences from different malaria parasites, and in particular, different strains of P. falciparum.
  • particularly preferred nucleic acid sequences include those nucleic acid sequences which are PCR amplified using the following oligonucleotide probes:
  • the number designation indicates the amino acid position within amino acids 575 through 808 of the amino acid sequence shown in Figure 2 and 12, which is encoded by the respective end of the probe (3 * or 5 • ) .
  • nucleic acids which are PCR amplified using the following primer probe combinations: 5'-l: 3'59, 3' 140, 3 '179; 5'53: 3 '140, 3'179; and 5'140:3' 179.
  • nucleic acid segments which encode the relatively conserved peptides described above. Examples of these oligonucleotides which have been identified from the previously described P . falciparum strains are shown in Table 1, below:
  • single sequence lines indicate the primary sequence of the primer.
  • a and T it refers to a step in the synthesis of the primer sequence where equal amounts of each base were added to the synthesis step, resulting in equal amounts of each base being coupled to growing oligomers in that position.
  • three bases are shown for a given position, equal amounts of the three bases are added to the synthesis step.
  • expression of the full length primer required the addition of additional bases to the 5' primer, e.g., a CTT before the TTT, to correct for truncation problems upon inserting the primer into the vector used.
  • the general structure of the universal 3' primer sequence can be described as a mixture of a number of individual primer sequences where each individual primer has the following general structure:
  • each of the individual primer sequences within the universal 5' primer is represented by the general structure:
  • X 12 is selected from G and A
  • X 13 is selected from A and T
  • X 14 is selected from G and T
  • X 15 is selected from A and T
  • X 16 is selected from of T
  • a and C is selected from A and C
  • X 17 is selected from A and C
  • X 18 is selected from of T and C
  • X 19 is selected from G and C and X 20 is selected from T and A.
  • the above-described universal primer sequences are particularly useful in identifying corresponding gene sequences in different strains of P. falciparum, as well as in the design of particularly preferred peptides of the invention.
  • the above universal primers may be particularly useful in generating a "finger print" identification of individual P . falciparum cells and clones by amplifying a distinct set of PCR products of varying sizes from the var genes and/or the expressed var genes of these cells and clones.
  • the nucleic acids of the present invention may be present in whole cells, cell lysates or in partially pure or substantially pure or isolated form. Such “substantially pure” or “isolated” forms of these nucleic acids generally refer to the nucleic acid separated from contaminants with which it is generally associated, e.g., lipids, proteins and other nucleic acids.
  • the nucleic acids of the present invention will be greater than about 50% pure. Typically, the nucleic acids will be more than about 60% pure, more typically, from about 75% to about 90% pure, and preferably, from about 95% to about 98% pure.
  • the present invention also provides substantially similar nucleic acid sequences, allelic variations and natural or induced sequences of the above described nucleic acids, as well as chemically modified and substituted nucleic acids, e.g., those which incorporate modified nucleotide bases or which incorporate a labelling group.
  • chemically modified and substituted nucleic acids e.g., those which incorporate modified nucleotide bases or which incorporate a labelling group.
  • the nucleic acids of the present invention may also comprise a segment encoding a heterologous protein, such that the gene is expressed to produce the two proteins as a fusion protein, as substantially described above.
  • nucleic acids of the present invention may also be used in the preparation of the polypeptides of the present invention, as described above.
  • DNA encoding the polypeptides of the present invention will typically be incorporated into DNA constructs capable of introduction to and expression in an in vitro cell culture.
  • the nucleic acids of the present invention may be used to produce a suitable recombinant host cell.
  • DNA constructs will be suitable for replication in a unicellular host, such as bacteria, e.g., E. coli, viruses or yeast , but may also be intended for introduction into a cultured mammalian, plant, insect, or other eukaryotic cell lines.
  • DNA constructs prepared for introduction into bacteria or yeast will typically include a replication system recognized by the host, the intended DNA segment encoding the desired polypeptide, transcriptional and translational initiation and termination regulatory sequences operably linked to the polypeptide encoding segment.
  • a DNA segment is operably linked when it is placed into a functional relationship with another DNA segment.
  • a promoter or enhancer is operably linked to a coding sequence if it stimulates the transcription of the sequence
  • DNA for a signal sequence is operably linked to DNA encoding a polypeptide if it is expressed as a preprotein that participates in the secretion of the polypeptide.
  • DNA sequences that are operably linked are contiguous, and in the case of a signal sequence both contiguous and in reading phase.
  • enhancers need not be contiguous with the coding sequences whose transcription they control. Linking is accomplished by ligation at convenient restriction sites or at adapters or linkers inserted in lieu thereof.
  • the selection of an appropriate promoter sequence will generally depend upon the host cell selected for the expression of the DNA segment. Examples of suitable promoter sequences include prokaryotic, and eukaryotic promoters well known in the art. See, e . g. , Sambrook et al. , supra.
  • the transcriptional regulatory sequences will typically include a heterologous enhancer or promoter which is recognized by the host.
  • promoters such as the trp, lac and phage promoters, tRNA promoters and glycolytic enzyme promoters are known and available. See Sambrook et al. , supra . Conveniently available expression vectors which include the replication system and transcriptional and translational regulatory sequences together with the insertion site for the PfEMPl polypeptide encoding segment may be employed. Examples of workable combinations of cell lines and expression vectors are described in Sambrook et al., supra , and in Metzger et al., Nature 334:31-36 (1988).
  • the vectors containing the DNA segments of interest can be transferred into the host cell by well known methods, which may vary depending upon the type of host used. For example, calcium chloride transfection is commonly used for prokaryotic cells, whereas calcium phosphate treatment may be used for other hosts. See, Sambrook et al. , supra .
  • the term "transformed cell” as used herein, includes the progeny of originally transformed cells.
  • nucleic acids which encode the polypeptides of the present invention i.e., subcloning the nucleic acids into expression vectors, labeling probes, DNA hybridization and the like, are generally described in Sambrook, et al. , supra.
  • nucleic acid encoding a peptide of the present invention is first cloned or isolated in a form suitable for ligation into an expression vector. After ligation, the vectors containing the nucleic acids fragments or inserts are introduced into a suitable host cell, for the expression of the polypeptide of the invention. The polypeptides may then be purified or isolated from the host cells. Methods for the synthetic preparation of oligonucleotides are generally described in Gait, Oligonucleotide Synthesis: A Practical Approach , IRL Press (1990) .
  • the DNA is isolated from a genomic or cDNA library using labeled oligonucleotide probes specific for sequences in the desired DNA. Restriction endonuclease digestion of genomic DNA or cDNA containing the appropriate genes can be used to isolate the DNA encoding the binding domains of these proteins. From the PfEMPl sequence given in Figure 12, a panel of restriction endonucleases can be constructed to give cleavage of the DNA in desired regions, i.e., to obtain segments which encode biologically active fragments of the PfEMPl protein.
  • DNA encoding the polypeptides of the present invention is identified by its ability to hybridize with a nucleic acid probe in, for example a Southern blot format. These regions are then isolated using standard methods. See, e .g. , Sambrook, et al., supra .
  • PCR polymerase chain reaction
  • Appropriate primers and probes for amplifying the nucleic acids described herein may be generated from analysis of the PfEMPl oligonucleotide sequence, such as those shown in Figure 12 and Table 1. Briefly, oligonucleotide primers complementary to the two 3 ' borders of the DNA region to be amplified are synthesized. The PCR is then carried out using the two primers. See, e .g. , PCR Protocols: A Guide to Methods and Applications (Innis, M. , Gelfand, D. , Sninsky, J. and White, T. , ed ⁇ .) Academic Press (1990).
  • Primers can be selected to amplify various sized segments from the PfEMPl oligonucleotide sequence.
  • the primers may also contain a restriction site and additional bases to permit "in-frame” cloning of the insert into an appropriate expression vector, using the restriction sites present on the primers.
  • nucleic acids and polypeptides of the present invention are also useful in producing antibodies, either polyclonal or monoclonal. These antibodies are produced by immunizing an appropriate vertebrate host, e.g., rat, mouse, rabbit or goat, with a polypeptide of the invention, or its fragment, or plasmid DNA containing a nucleic acid of the invention, alone or in conjunction with an adjunct. Usually, two or more immunizations are involved, and a few days following the last injection, the blood or spleen of the host will be harvested.
  • an appropriate target immune system typically a mouse or rabbit, but also including goats, sheep, cows, guinea pigs, monkeys and rats.
  • the substantially purified antigen or plasmid is presented to the immune system in a fashion determined by methods appropriate for the animal. These and other parameters are well known to immunologists. Typically, injections are given in the footpads, intramuscularly, intradermally or intraperitoneally.
  • the immunoglobulins produced by the host can be precipitated, isolated and purified by routine methods, including affinity purification. For monoclonal antibodies, appropriate animals will be selected and the desired immunization protocol followed.
  • the spleens of these animals are excised and individual spleen cells are fused, typically, to immortalized myeloma cells under appropriate selection conditions. Thereafter, the cells are clonally separated and the supernatants of each clone are tested for the production of an appropriate antibody specific for the desired region of the antigen.
  • Techniques for producing antibodies are well known in the art. See, e.g., Goding et al.. Monoclonal Antibodies : Principles and Practice (2d ed.) Acad. Press, N.Y., and Harlow and Lane, Antibodies : A Laboratory Manual , Cold Spring Harbor Laboratory, New York (1988) .
  • the antibodies generated can be used for a number of purposes, e.g., as probes in immunoassays, for inhibiting
  • PfEMPl binding to its ligands thereby inhibiting or reducing erythrocyte sequestration, in diagnostics or therapeutics, or in research to further elucidate the mechanism of various aspects of malarial infection, and particularly, P . falciparum infection.
  • the antibodies of the present invention can be used with or without modification. Frequently, the antibodies will be labeled by joining, either covalently or non-covalently, a substance whiqh provides for a detectable signal. Such labels include those that are well known in the art, such as the labels described previously for the polypeptides of the invention. Additionally, the antibodies of the invention may be chimeric, human-like or humanized, in order to reduce their potential antigenicity, without reducing their affinity for their target. Chimeric, human-like and humanized antibodies have generally been described in the art.
  • such chimeric, human-like or humanized antibodies comprise variable regions, e.g., complementarity determining regions (CDR) (for humanized antibodies), from a mammalian animal, i.e., a mouse, and a human framework region.
  • CDR complementarity determining regions
  • the antigenicity is reduced.
  • Preparation of these hybrid antibodies may be carried out by methods well known in the art.
  • Preferred antibodies are those that are specifically immunoreactive with the polypeptides of the present invention and their immunologically active fragments.
  • the specified antibodies bind to a particular protein and do not bind in a significant amount to other proteins present in the sample.
  • a variety of immunoassay formats may be used to select antibodies specifically immunoreactive with a particular protein.
  • solid-phase ELISA immunoassays are routinely used to select monoclonal antibodies specifically immunoreactive with a protein. See Harlow and Lane (1988) Antibodies, A Laboratory Manual, Cold Spring Harbor Publications, New York, for a description of immunoassay formats and conditions that can be used to determine specific immunoreactivity.
  • the antibodies generated can be used for a number of purposes, e.g., as probes in immunoassays, for inhibiting interaction between a PfEMPl protein and its ligand, e.g., CD- 36, TSP, ICAM-l, VCAM-1, ELAM-1, or Chondroitin sulfate, thereby inhibiting or reducing the level of PfEMPl-ligand interaction, in diagnostics or therapeutics, or in research to further elucidate the mechanism of malarial pathology, e.g., erythrocyte sequestration.
  • the antibodies are used to block or reverse the interaction between a polypeptide of the invention and an associating ligand or PE, the antibody will generally be referred to as a "blocking antibody.”
  • Preferred antibodies are those monoclonal or polyclonal antibodies which specifically recognize and bind the polypeptides of the invention. Accordingly, these preferred antibodies will specifically recognize and bind the polypeptides which have an amino acid sequence that is substantially homologous to the amino acid sequence shown in Figures 2 , 20 or 21, or immunologically active fragments thereof. Still more preferred are antibodies which are capable of forming an antibody-ligand complex with the relatively conserved polypeptide fragments of PfEMPl sequences, and are thereby capable of blocking an interaction of PfEMPl from a variety of P . falciparum strains, and PfEMPl ligands.
  • polypeptides, antibodies, and nucleic acids of the present invention have a variety of important uses, including, but not limited to, diagnostic, screening, prophylactic, including vaccination, and therapeutic applications.
  • the present invention provides methods and reagents useful in detecting the presence of PfEMPl in a sample. These detection methods are particularly useful in diagnosing malarial infections in a patient.
  • the antibodies of the present invention may be used to assay for the presence or absence of PfEMPl in a sample.
  • Immunoassay techniques for the detection of the particular antigen are very well known in the art.
  • the immunoassays of the present invention can be performed in any of several configurations, which are reviewed extensively in Enzyme Immunoassay, E.T. Maggio, ed. , CRC Press, Boca Raton, Florida (1980) ; "Practice and Theory of Enzyme Immunoassays," P.
  • these methods comprise contacting the antibody with a sample to be tested, and detecting any specific binding between the antibody and a protein within the sample. Typically, this will be in a blot format, e.g., western blot, or in an ELISA format. Methods of performing these assay formats are well known in the art. See, e.g., Basic and Clinical Immunology, 7th ed. (D. Stites and A Terr, eds., 1991).
  • these diagnostic methods comprise contacting a sample with an antibody to PfEMPl, as described herein, and determining whether the antibody binds to any portion of the sample.
  • the sample may be a whole blood sample, or some fraction thereof, e.g. an erythrocyte containing sample.
  • diagnostic methods are well known in the art, and are described in the above described references.
  • the immunoreactivity of the antibody with the sample indicates the presence of PfEMPl in the sample, and, in the case of a sample derived from a patient, a possible malarial infection.
  • labeled polypeptides of the present invention may be used as diagnostic reagents in detecting the presence or absence of antibodies to PfEMPl, in a patient. The presence of antibodies within a patient would be indicative that the patient had been exposed to a malaria parasite sufficiently to result in an antigenic response.
  • nucleic acid probes of the invention may be used in a similar manner, i.e., to identify the presence in a sample of a DNA segment encoding a PfEMPl polypeptide, or as PCR or RT-PCR primers to amplify and then detect PfEMPl encoding nucleic acid segments.
  • Such assays typically involve the immobilization of nucleic acids in the sample, followed by interogation of the immobilized sequences with a chemically labeled oligonucleotide probe, as described herein. Hybridization of the probe to the immobilized sample indicates the presence of a DNA segment encoding PfEMPl, and thus, a malarial infection.
  • assays may be further designed to indicate not only the presence of a Malarial parasite, but also indicate the strain of parasite present.
  • assay conformations may be adopted, which conformations are generally well known in the art.
  • the present invention provides methods for screening compounds to determine whether or not the particular compound is an antagonist of a symptom of a malarial infection.
  • the screening methods of the present invention can be used to determine whether a test compound is an antagonist of the sequestration of erythrocytes which is associated with P. falciparum malaria. More particularly, the screening methods can determine whether a compound is an antagonist of the PfEMPl/ligand interaction.
  • Ligands of PfEMPl generally include, e.g., CD36, TSP, ELAM-1, ICAM-l, VCAM-1 or Chondroitin sulfate.
  • the screening methods of the present invention comprise contacting PfEMPl protein, or a fragment thereof, and/or ligand protein, with a compound which is to be screened ("test compound") .
  • the level of PfEMPl/ligand complex formed may then be detected and compared to a control, e .g. , in the absence of the test compound.
  • a decrease in the level of PfEMPl/ligand interaction is indicative that the test compound is an antagonist of that interaction.
  • test compound may be a chemical compound, a mixture of chemical compounds, a biological macromolecule, or an extract made from biological materials, such as bacteria, phage, yeast, plants, fungi, animal cells or tissues.
  • Test compounds are evaluated for potential activity as antagonists of PfEMPl/ligand interaction by inclusion in the screening assays described herein.
  • An "antagonist” refers to a compound which will diminish the level of PfEMPl/ligand interaction, over a control. It will often be desirable in the screening assays of the present invention, to provide one of the PfEMPl or ligand proteins immobilized on a solid support.
  • Suitable solid supports include, e.g., agarose, cellulose, dextran, Sephadex, Sepharose, carboxymethyl cellulose, polystyrene, filter paper, nitrocellulose, ion exchange resins, plastic films, glass beads, polyaminemethylvinylether maleic acid copolymer, amino acid copolymer, ethylene-maleic acid copolymer, nylon, silk, etc.
  • the support may be in the form of, e.g., a test tube, microtiter plate, beads, test strips, flat surface, e.g., for blotting formats, or the like.
  • the reaction of the PfEMPl polypeptide or its ligand with the particular solid support may be carried out by methods well known in the art, e.g., binding to an immobilized anti-PfEMPl antibody, or binding to prederivatized solid support.
  • detectable groups, or labels are generally well known in the art.
  • a detectable group may be a radiolabel, such as, 125 I, 32 P or 35 S, or a fluorescent or chemiluminescent group.
  • the detectable group may be a substrate, cofactor, inhibitor, affinity ligand, antibody binding epitope tag, or an enzyme which is capable of being assayed.
  • Suitable enzymes include, e.g., horseradish peroxidase, luciferase, or another readily assayable enzymes.
  • These enzyme groups may be attached to the PfEMPl polypeptide, or its ligand by chemical means or maybe expressed as a fusion protein, as already described.
  • the other protein e.g., PfEMPl or its fragment, will be labelled with an appropriate detectable group.
  • Assaying whether a compound is an antagonist of the interaction of the two proteins is then a matter of contacting the labelled PfEMPl polypeptide or fragment with the immobilized ligand, in the presence of the test compound, under conditions which allow specific binding of the two proteins.
  • the amount of label bound to the solid support is compared to a control, where no test compound was added. Where a test compound results in a reduction of the amount of label which binds to a solid support, that compound is an antagonist of the PfEMPl/ligand interaction.
  • the polypeptides of the present invention may also be used in therapeutic applications, for the treatment of human and/or non-human mammalian patients.
  • the therapeutic uses of the polypeptides of the present invention include the treatment of symptoms of existing disorders, as well as prophylactic applications.
  • prophylactic refers to the prevention of a particular disorder, or symptoms of a particular disorder.
  • prophylactic treatments will generally include drugs which actively participate in the prevention of a particular disorder such as a malaria infection, or symptoms thereof.
  • Prophylactic applications will also include treatments which elicit a preventative response from a patient, including, for example, an immunological response as in the case of vaccination.
  • both therapeutic and prophylactic applications will comprise administering an effective amount of the compositions of the present invention to a patient, to treat or prevent symptoms, or the onset of a malarial parasite infection.
  • An "effective amount", as the term is used herein, is defined as the amount of the composition which is necessary to achieve the desired goal, i.e. alleviation of symptoms, prevention of symptoms or infection, or treatment of disease.
  • the polypeptides of the present invention may be used in a variety of treatments.
  • the polypeptides of the invention are particularly useful as a vaccine, to elicit an immunological response by a patient, e.g., production of antibodies specific for PfEMPl.
  • such vaccine applications generally involve the administration of the PfEMPl protein or biologically active fragments thereof, to the host or patient.
  • the patient's immune system will generate antibodies to the particular PfEMPl protein or fragment introduced.
  • An amount of the polypeptides sufficient to produce an immunological response in a patient is termed "an immunogenically effective amount.”
  • the vaccines of the present invention will contain an immunogenically effective amount of the polypeptides of the present invention.
  • the immune response of the patient may include generation of antibodies, activation of cytotoxic T- lymphocytes against cells expressing the polypeptides, e.g., PE, or other mechanisms known to the skilled artisan. See, e.g., Paul, Fundamental Immunology, 2d Edition, Raven Press.
  • Useful carriers are well known in the art, and include for example, thyroglobulin, albumins such as human serum albumin, tetanus toxoid, polyamino acids such as poly(D-lysine; D- glutamic acid) , influenza, hepatitis B virus core protein, hepatitis B virus recombinant vaccine.
  • the vaccines can also contain a physiologically tolerable diluent, such as water, buffered water, buffered saline, saline and typically may further include an adjuvant, such as incomplete Freunds adjuvant, aluminum phosphate, aluminum hydroxide, alum, or other materials well known in the art.
  • the nucleic acids of the present invention may also be used as vaccines for the prevention of malaria symptoms, and/or infection by malaria parasites. See Sedegah, et al. Proc . Nat ' l Acad . Sci . (1994) 91:9866-9870.
  • plasmid DNA comprising the nucleic acids of the present invention may be directly administered to a patient. Expression of this "naked" DNA will have effects similar to the injection of the actual polypeptides, as described above. Specifically, the patient's immune response to the presence of the proteins expressed from the DNA, will result in the production of antibodies to that protein.
  • the nucleic acids may also be used to design antisense probes to interupt transcription of PfEMPl peptides in parasitized erythocytes. Antisense methods are generally well known in the art.
  • the polypeptides of the present invention may also be used as prophylactic treatments to prevent the onset of symptoms of malarial infection.
  • administration of the polypeptides can directly inhibit, block or reverse the sequestration of erythrocytes in patients suffering from P. falciparum malaria infections.
  • the polypeptides of the invention may be used to compete with or displace PE associated PfEMPl in binding CD36.
  • the blockage or reversal of sequestration will reduce or eliminate the microvascular occlusion generally associated with the pathology of this type of malaria, which, again, can lead to destruction of the PE by the host.
  • the antibodies of the invention may also be used in a similar fashion.
  • the antibodies which are capable of binding the polypeptides of the present invention, may be directly administered to a patient.
  • the antibodies of the present invention are effective in blocking, reducing or reversing PfEMPl mediated interactions, e.g., erythrocyte sequestration.
  • Chimeric, human-like or humanized antibodies are particularly useful for administration to human patients.
  • such antibodies may also be used as a passive vaccination method to provide a subject with a short term immunization, much as anti-hepatitis A injections have been used previously.
  • the polypeptides, antibodies and nucleic acids of the invention may be used to treat a patient already suffering from a malarial infection.
  • the compositions of the present invention may be administered to a patient suffering from a malarial infection to treat symptoms associated with that infection. More particularly, these compositions may be administered to the patient to prevent or reduce erythrocyte sequestration and the resulting microvascular occlusion associated with malarial, and more specifically, P. falciparum , infections.
  • polypeptides, nucleic acids and antibodies of the present invention may be administered alone, for therapeutic and prophylactic applications, these elements will generally be administered as part of a pharmaceutical composition, e.g., in combination with a pharmaceutically acceptable carrier. Typically, a single composition may be used in both therapeutic and prophylactic applications.
  • compositions suitable for use in the present invention are generally described in Remington ' s Pharmaceutical Sciences , Mack Publishing Co., 17th ed. (1985).
  • the pharmaceutical compositions of the present invention are intended for parenteral, topical, oral, or local administration.
  • the invention provides pharmaceutical compositions that comprise a solution of the agents described above, e.g., polypeptides of the invention, dissolved or suspended in a pharmaceutically acceptable carrier, preferably an aqueous carrier.
  • a pharmaceutically acceptable carrier preferably an aqueous carrier.
  • aqueous carriers may be used, e.g., water, buffered water, saline glycine, and the like.
  • These compositions may be sterilized by conventional, well known methods, e.g., sterile filtration.
  • compositions may contain pharmaceutically acceptable auxiliary substances as required to approximate physiological conditions, such as pH adjusting and buffering agents, tonicity adjusting agents, wetting agents, and the like, for example sodium acetate, sodium lactate, sodium chloride, potassium chloride, calcium chloride, sorbitan monolaurate, triethanolamine oleate, etc.
  • auxiliary substances as required to approximate physiological conditions, such as pH adjusting and buffering agents, tonicity adjusting agents, wetting agents, and the like, for example sodium acetate, sodium lactate, sodium chloride, potassium chloride, calcium chloride, sorbitan monolaurate, triethanolamine oleate, etc.
  • conventional nontoxic solid carriers may be used which include, for example, pharmaceutical grades of mannitol, lactose starch, magnesium stearate, sodium saccharin, talcum, cellulose, glucose, sucrose, magnesium carbonate, and the like.
  • a pharmaceutically acceptable nontoxic composition may be formed by incorporating any of the normally employed excipients, such as the previously listed carriers, and generally, 10-95% of active ingredient, and more preferably 25-75% active ingredient.
  • the pharmaceutical compositions may include the active ingredient as part of a matrix to prevent proteolytic degradation of the active ingredient by digestive process, e.g., by providing the pharmaceutical composition within a liposomal composition, according to methods well known in the art. See, e.g.. Remington ' s Pharmaceutical Sciences , Mack Publishing Co., 17th Ed. (1985).
  • the polypeptides are generally supplied in finely divided form along with a surfactant or prope11ant.
  • the surfactant will be soluble in the propellant.
  • Representative of such agents are the esters or partial esters of fatty acids containing from 6 to 22 carbon atoms, such as caproic, octanoic, lauric, palmitic, stearic, linoleic, linolenic, olesteric and oleic acids, with an aliphatic polyhydric alcohol or its cyclic anhydride.
  • Mixed esters, such as mixed or natural glycerides may be employed.
  • a carrier can also be included, as desired, as with, e.g., lecithin for intranasal delivery.
  • the above described compositions are suitable for a single administration or a series of administrations. When given as a series, e.g., as a vaccine booster, the inoculations subsequent to the initial administration are given to boost the immune response, and are typically referred to as booster inoculations.
  • compositions to be administered to the patient will vary depending upon what is to be administered to the patient, the state of the patient, the manner of administration, and the particular application, e . g. , therapeutic or prophylactic.
  • the compositions are administered to the patient already suffering from a malarial infection, in an amount sufficient to inhibit the spread of the parasite through the erythrocytes, # and thereby cure or at least partially arrest the symptoms of the disease and its associated complications.
  • a therapeutically effective amount An amount adequate to accomplish this is termed "a therapeutically effective amount.” Amounts effective for this use will depend upon the severity of the disease and the weight and general state of the patient, but will generally be in the range of from about 1 mg to about 5 g of active agent per day, preferably from about 50 mg per day to about 500 mg per day, and more preferably, from about 50 mg to about 100 mg per day, for a 70 kg patient.
  • immunogenically effective amounts will also depend upon the composition, the manner of administration and the weight and general state of the patient, as well as the judgment of the prescribing physician.
  • the general range for the initial immunization will be from about 100 ⁇ g to about 1 g of polypeptide for a 70 kg patient, followed by boosting dosages of from about 1 ⁇ g to about 1 gm of polypeptide pursuant to a boosting regimen over weeks to months, depending upon the patient's response and condition, e.g., by measuring the level of parasite or antibodies in the patient's blood.
  • nucleic acids typically from about 30 to about 100 ⁇ g of nucleic acid is injected into a 70 kg patient, more typically, about 50 to 150 ⁇ g of nucleic acid is injected, followed by boosting treatments as appropriate.
  • falciparum parasites in human erythrocytes MC K+C+R-; MC K-C-; ItG 2 -Gl (K+C+) ; FCR 3 /C5 (K+C+) ; FCR 3 /C6 (K-C-) ; 7G8 (K+) ; D10(K+C+ [TSP only]); Palo Alto, PA (K-C+) ; HB3 (K+C+ [TSP only]) and Dd2 (K+, low C+) .
  • FVO(K+C+) was derived from Aotus monkey 1150. Unless indicated, C+ refers to adherence to both CD36 and TSP.
  • P. falciparum gDNA was isolated from mature PE by lysis in NP40 (Pasloske et al., Molec . Biochem . Parasitol . (1993) 59:59-72). DNA for Southern blotting was digested with Eco RI or Eco RI/Hind III and blotted under high stringency (Pasloske, et al., supra) .
  • the MC K+ cDNA library was prepared in the expression plasmid pJFE14DAF (Alamo et al., manuscript submitted) as described by (Elliott et al., Proc . Nat ' l Acad . Sci . (1990) 87:6363-6367).
  • PfEMPl clones were isolated from the cDNA library using a modified version of the "leapfrog" method (Gibbons et al., Proc . Nat ' l Acad. Sci . (1991) 88:8563- 8567).
  • cDNA clones extending 5' or 3' from previously isolated DNA clones were generated by PCR using an oligonucleotide primer 100-150 bases from the proximal terminus region of the cloned sequence and another primer derived from the vector arm flanking the cloning site.
  • PCR was performed on 10 ng of the cDNA library using 30 cycles with a profile of 1 min. at 94°C, 1 min. at 55°C and 2.5 min. at 72 ⁇ C.
  • the PCR products were fractionated on low melt agarose gels and products of 1-3 kb were gel purified (Wizard PCR preps, Promega, Madison, WI) , cloned into pAMP vector (Life Technologies Inc.
  • PCR primers were designed with 5' adaptor sequences for directional insertion into the pAMP vector. PfEMPl clones were identified by direct colony hybridization using end-labeled oligonucleotides designed 50-100 bases internal to the sequence specific PCR primer.
  • Plasmid DNA was isolated from the recombinant clones using the Wizard Miniprep DNA isolation system (Promega, Madison, WI) , alkali denatured and sequenced via the dideoxy chain termination method using the Sequenase kit (USB, Cleveland, Ohio) . Either vector specific or custom oligonucleotides primers were used for primer directed sequencing. For some of the clones, the insert was subcloned into the pBluescript SK-vector (Stratagene cloning system, La Jolla, CA) and unidirectional deletion mutants generated using Exonuclease III (Henikoff, Gene (1984) 28:351-359).
  • primers from within the two clones were used to generate PCR products from MC gDNA and the cDNA library and the identity of the generated product was confirmed by size, hybridization with oligonucleotides and direct sequencing (fmol sequencing system, Promega, Madison, WI) . Sequences were analyzed using DNASTAR (DNASTAR Inc. , Madison, WI) sequence analysis sof ware.
  • GST fusion proteins and Maltose Binding Protein (MBP) fusion proteins were constructed by cloning of PCR products carrying a Bam HI site at the 5' end and an EcoRI site at the 3' end of the BamHl/EcoRI sites of the pGEX-3X vector (Pharmacia Biotech) for GST and into modified pMAL vector (New England Biolab) for MBP fusion proteins.
  • the recombinant fusion proteins generated were: rAl (a.a.3-158), rBl (a.a. 161-385), rci-l (a.a. 402-605), rCl-2 (a.a. 576- 808) , rDl (a.a.
  • rD2 (982-1320), rFl-1 (1300-1707), rFl-2 (1688-2190), rFl-3 (2171-2450) , rGl (2550-2794), rD3 (992-1243), rEl-1 (1219-1471), rEl-2 (1454-1719), and rGST (See Figure 15A) .
  • Clone Fl-2 was cloned into Smal/Notl sites of the pMal vector and expressed as an MBP fusion only. The fusion proteins were expressed in E. coli DH5- or Sure-2 cells.
  • the GST fusion proteins were purified on glutathione-Sepharose (Pharmacia, LKB Biotechnology, Piscataway, NJ) (van Schravendijk et al., supra) except that PBS was replaced with a column buffer (20 mM Tris, 200 mM NaCI, pH 7.5). MBP fusion proteins were purified on Amylose Resin (New England Biolab) according to the manufacturer's procedure. rA62-5 was derived from clone A62 and rPfEMP3 corresponding to the 12.1.3 RP (van Schravendijk et al.). G. Antibodies
  • Mouse MAb 179 recognizes an epitope sequence incorporated into the carboxy terminus of sCD36 expressed as phosphoinositol glycan-linked extracellular domain (Affy ax Research Institute) .
  • Mouse MAb 141 recognizes GST.
  • Adherence blocking anti-CD36 MAb 8A6 (Barnwell et al., J. Clin . Invest . (1989) 84:765-772) was a gift from Dr. J. Barnwell (New York Medical Center, NY) .
  • Rabbit serum 05-75 which recognizes both PfEMP3 and MC PfEMPl was described previously (Schravendijk et al., supra) .
  • a human immune serum pool was prepared from five individuals resident in a P.
  • Aotus anti-P. falciparum sera 779 and 9050 were derived from animals infected with the Aotus MC K+ strain and drug cured (Leech et al., J. Exp. Med . (1984) 159:1567-1575) .
  • RP (as listed above, except for Fl-2) in solution or bound to the purification resin, e.g., glutathione- Sepharose 4B beads (Pharmacia) or Amylose Resin, were used to immunize goats (1 mg RP) , rabbits (0.1 mg RP) and rats (0.05 mg RP) .
  • Initial immunization was performed with Freund's complete adjuvant followed by booster immunizations with Freund's incomplete adjuvant at days 21, 35, 49 and 63 and then monthly. Animals were bled seven days after each boost.
  • Extr ction And Xronun ⁇ precj i atiPP Mature intact PE were enriched to >90% by the percoll-sorbitol method (Kutner et al. , J. Cell . Physiol . (1985) 125:521-527) after initial disruption of rosettes (Handunnetti et al. , supra .
  • Fifty or 100 ⁇ l of PE were iodinated by the lactoperoxidase method using 1-2.5 mCi or 5 mCi of Na 1 5 I (Amersham) respectively, and sequentially extracted with 1% (w/v) Triton X-100 followed by 2% (W/v) SDS (van Schravendijk et al.).
  • iodinated PE were incubated at 10% hematocrit with 10 ⁇ g/ml of trypsin-TPCK (Sigma, St. Louis, Missouri) in PBS for 5-10 minutes at 21°C. Trypsinization was terminated by adding an equal volume of 200 ⁇ g/ml soybean trypsin inhibitor type I-S (Sigma, St. Louis, Missouri) in PBS. The trypsinized cells were sequentially extracted as above.
  • Immunoprecipitation used 5-7 ⁇ l of 125 I-SDS extract, 10-15 ⁇ l of 125 I-Triton X-100 extract, or 15-25 ⁇ l of tryptic supernatant from surface iodinated cells, reconstituted in 500 ⁇ l of 50 mM Tris, 150 mM NaCI, 5 mM EDTA and 1% Triton X-100 pH 8.0 (NETT buffer) containing 1% BSA (Clinical grade, ICN Biomedicals, Irvine, CA) and a cocktail of protease inhibitors (1 mM PEfabloc SC, Boehringer Mannheim Bioche icals, Indianapolis, IN) , 1 mM pepstatin A, 10 ⁇ g/ml each of benzamidine, leupeptin and aprotinin, 3.7 ⁇ g/ml of N-tosyl L-lysine chloromethylketone and N-tosyl L-phenylalanine chloromethylketone (Sigma,
  • Trophozoite-stage PE were extracted sequentially with 1% Triton X-100 and 2% SDS to a final concentration of 10 8 parasites per ml. 2.5 ⁇ l of extract was SDS-PAGE fractionated on 5% acrylamide gels, transferred onto Immobilon-P membrane (Millipore Corp. , Bedford, MA) and immunoblotted using an ECL Western blotting protocol (Amersham Int., Buckinghamshire, England). Membranes were incubated overnight at 5 ⁇ C in 50 mM Tris, 150 mM NaCI, 0.1% Tween 20 pH 8.0 (TBS-T) containing 10% w/v nonfat dry milk, followed by
  • Soluble CD36 was obtained in the form of harvest supernatant by cleaving phosphoinositol glycan-linked CD36 from the surface of stable transfected CHO cells using PI-PLC (Lin et al.. Science (1990) 249:677-679) and stored at 5°C.
  • the CD36 concentration in the harvest supt. was approx. 1-
  • TSP 2 ⁇ g/ml.
  • Purified TSP was purchased from Gibco BRL.
  • a modification of the standard microscopic adherence microassay (Hasler et al., Am . J. Trop. Med . Hyg . (1993) 48:332-347) was used for antibody-mediated inhibition of PE adherence. 7 ⁇ l of MAb 179 at 50 ⁇ g/ml in PBS was used to coat each well (lhr, 2l°C) , washed once with 50 ⁇ l of PBS and blocked, 30 minutes, 21°C with PBS containing 1% BSA.
  • the blocking solution was washed twice with PBS and 50 ⁇ l of the appropriate amount (usually 0.2, 0.4 or 2 ⁇ g/ml) of sCD36 added and incubated 2l°C for 1 hr. TSP at 50 ⁇ g /ml was coated directly on the plastic (2 h, 21°C) . Each well was washed twice with BM. PE were washed once with BM and resuspended to 4% hematocrit in BM +10% FCS. An equal volume of diluted serum was added and the cells incubated with the sera for 1 h. at 37°C. 50 ⁇ l of cells at 2% hematocrit were added to each well and incubated 1 h at 37°C.
  • the plates were washed four times with BM, the cells fixed, strained and counted (Hasler et al.).
  • the recombinant proteins were preincubated for 1 hour with the immobilized receptor before PE were added. Reversal of PE adherence to CD36 was performed by allowing 30 minute adherence with PE followed by 3 washes with BM and addition of BM containing antibodies or recombinant protein for 45 minutes, followed by two washes, fixing and staining, as described above.
  • Bio-Rad MRC-600 system (Bio-Rad Laboratories, Cambridge, MA) interfaced to an Olympus IMT-2 inverted microscope as described previously (Gormley et al. , J. Cell . Biol . (1992) 119:1481-1495).
  • the samples were washed three times with RPMI and Rhodamine (TRITC)-labeled goat anti-rat IgG (Jackson ImmunoResearch Laboratories, Inc.) added at a 1:10 dilution in RPMI for 30 minutes, 37 ⁇ C.
  • the cells were washed three times in RPMI, diluted to 0.3% hematocrit and viewed in a Dvorak chamber.
  • rat serum was added at 1:100 dilution for 1 h, at 25°C with constant shaking, followed by three washes with RPMI.
  • 5 nm gold conjugated goat anti-rat IgG Goldmark Biologicals was incubated with the cells at a 1:50 dilution in RPMI, 30 minutes, 25°C.
  • the cells were washed three times with RPMI, fixed overnight at 4°C in 2% glutaraldehyde, 1% tannic acid, 4% sucrose, 0.1 M phosphate buffer pH 7.4, washed with o.l M phosphate buffer and post-fixed in 2% osmium tetroxide in
  • Oligonucleotide primers were synthesized based upon the sequence of PfEMPl.
  • the name of the primer represents the position of the amino acid coded at the 5' or 3' end of the oligonucleotide.
  • Oligonucleotides from the coding strand of rCl-2 (a.a. 576-808 of PfEMPl) were as follows:
  • Oligonucleotides from the noncoding strand were as follows:
  • Oligonucleotides from the coding strand (5' oligos) carried a BamHl site and oligonucleotides from the non-coding strand (3' oligos) carried an EcoRI site at their 5' ends.
  • RNA from late-ring stages of P. falciparum was isolated as described before (Pasloske et al. 1993) or using Catrimox-14 (Iowa Biotechnology Corp.) and lithium chloride precipitation according to the manufacturers instructions.
  • the RNA was Dnase-1 treated to remove all contaminating DNA. Complete removal of DNA was verified by PCR reaction using various sets of primers (no PCR product) .
  • RNA was treated with 1 unit of Dnase-1 (promega) for 15 min at 21 ⁇ C, followed by the addition of 2 mM EDTA and 15 min. incubation at 65°C, phenol chloroform extraction and ethanol precipitation. 1-2 ⁇ g of treated RNA was reversed transcribed in volume of 30 ⁇ l with 0.5-1 ⁇ M of the Cl-2 179-EcoRI primer containing an EcoRI restriction site.
  • Cl-2 primer sequence (egg aat tct g)GAG CGG GCG ACA CTT CTA TCT (with the EcoRI restriction site indicated in lower case) .
  • RNA was heat denatured at 70°C for 10-15 min in the presence of the Cl-2 179-EcoRI primer and cooled on ice (1-2 min). 0.1 M DTT, RT buffer, 30-40 units of RNAsin and 0.5M dNTPs added and the mix was equilibrated at 50°C for 2 min before addition of 300 units of superscript RT (Gibco BRL) and lh incubation at 50°C.
  • the RNA template was removed from the first strand cDNA by 15 min. incubation at 37 ⁇ C with 2-3 units of Rnase H (Gibco BRL) and purified with glass max purification system (Gibco BRL) .
  • the purified first strand cDNA was subjected to PCR as above with the Cl-2 179-EcoRI and the Cl-2 1-BamHl [ (cgc gga tec) AAG GAA GAC AAA ATT ATG TCC TAT (with the BamHI site in lower case)] primer set, only the 1 min 42°C incubation was replaced with 1 min at 50°C.
  • RNA derived a mock RT reaction (no enzyme) was performed. Non-DNase RNA and gDNA were used as additional controls.
  • the PCR products were cloned into the pGEX-3X vector sequenced and tested for protein expression as above.
  • Universal Degenerate Oligonucleotide Primers Degenerate oligonucleotides were prepared for use as universal primers to PCR the corresponding regions from gDNA of different P. falciparum strains.
  • the 5' forward primer included a Bam HI site and the 3' primers carried a EcoRI site for direct cloning into the pGEX-3X vector as described above (See discussion of GST fusion proteins) . From the sequences of a number of P. falciparum strains, universal degenerate primer sequences were identified as follows:
  • PCR amplification using these universal primer compositions was performed with 50-100 ng of DNA, 0.5 ⁇ M of each primer, 2.5 units of Tag enzyme, 200 uM dNTPs in 50 ⁇ l volume. Initial denaturation 2 min at 94°C followed by 30 cycles of 50 sec at 94°C, 1 min at 42 ⁇ C, 90 sec at 72 C and final extension at 72°C for 10 min. The products were gel isolated (WizardTM PCR DNA isolation kit, Promega) , digested with BamHl and EcoRI, cloned into pGEX-3X vector as described and sequenced.
  • GST fusion protein rCl-2 (233 amino acids from positions 576- 808 of the MC PfEMPl) denoted rCl-2[l-233] , was carried out as described in Section F, above.
  • Cysteines at various positions were replaced by using a primer sequence with a Serine codon in place of the corresponding Cysteine codon, generating the following mutant fragments rCl-2[1-179] Ser 159 , rCl-2[1-179] Ser 168 , rCl-2[1-179]Ser 159 and Ser 168 , rCl-2[l- 179] Ser 45 and rCl-2[1-179] Ser 49 recombinant protein with a serine substitution of each or both cysteines. All mutants were tested for expression, and produced similar amounts of recombinant protein as determined by SDS-PAGE stained with coomassie blue. Oligonucleotides from the above, particularly those corresponding to the 1-179 region, were used to generate a PCR product from 10 different strains of P. falciparum, and GST-fusion proteins were prepared.
  • PBS at pH 7.4 was spotted on parafilm masked petri dish for l hour at 21°C.
  • the dish was washed twice with RPMI-1640, at pH 7.3 containing 1% BSA (clinical grade, ICN, Irvine CA) , and incubated with RPMI + 1% BSA for 30 minutes at 21°C.
  • the dish was then washed twice with RPMI + 0.05% BSA.
  • Purified fusion proteins 50-200 ⁇ g/ml in PBS) were added to the dish and incubated for 1 hour at 21°C.
  • the dish was again washed twice with RPMI + 0.05% BSA.
  • RP recombinant protein
  • PBS recombinant protein
  • CD36 0.2 ⁇ g/ml
  • the resin was washed three times with PBS and resuspended in 400 ⁇ l of BM (or BM containing 1 mM Ca 2+ at pH 7.3, for thrombospondin (TSP) experiments). lOO ⁇ l if sCD36, other pig-tailed receptors(approx. 1-5 ⁇ g/ml) or human TSP (Gibco-BRL, 20 ⁇ g/ml) was added and incubated for 2.5 hours at 21°C, with rotation. The resin was washed twice with 1 ml of BM, once with 1 ml BM without BSA, and then solubilized with 40 ⁇ l of 5% SDS sample buffer.
  • BM or BM containing 1 mM Ca 2+ at pH 7.3
  • TSP thrombospondin
  • Chimeric protein composed of the 5' portion of the rCl-2 [1-179] sequence of one P. falciparum strain and a 3' portion derived from the sequence of a different strain were prepared by taking advantage of a unique Mfe-1 restriction site (CAATTG) present in the sequence of rCl-2 [1-179] of different strains.
  • the site resides at position 433 in strain MC R+, position 418 in ItG2-F6, 376 in clone FCR3-C5 and position 439 of HB3 (except for the sequence of MC R+, all sequences were obtained from gDNA) .
  • the 5' fragment of ItG2-F6, HB3 and FCR3-C5 were ligated to the 3'-pGEX fragment of MC R+ and the 5' fragment of MC R+ was ligated to the 3'-pGEX fragment of ItG2-F6, HB3 and FCR3-C5 thus creating six chimeric constructs: ItG2-F6/MC R+, FCR3-C5/MC R+, HB3/MC R+, MC R+/ItG2-F6, MC R+/FCR3-C5 and MC R+/HB3.
  • the ligation products were transformed into DH5 ⁇ cells, sequenced and screened for protein expression.
  • the chimeric fusion proteins were assayed by the "ECL" RCRP method as described above.
  • Reversal of PE adherence to CD36 was performed by allowing 30 minute adherence with PE followed by 3 washes with BM and addition of BM containing antibodies or recombinant protein for 45 minutes, followed by two washes, fixing and staining, as described above.
  • a cDNA library of K+ MC strain parasites was subjected to PCR with primers derived from A62 to generate cDNA clones extending 5*.
  • DI cDNA
  • Figure 1 From DI additional contiguous cDNA clones were produced, extending 5', designated A1-C2 ( Figure 1). Clones D2 and D3 were also identified by PCR with this cDNA library ( Figure 1) . D2 overlapped DI completely whereas D3 diverged from the sequence shared by DI and D2 in several places ( Figure 2) . Repeated attempts to identify stable overlapping cDNAs that extend 3' from DI or D2 were unsuccessful.
  • Clone Al included 244 nucleotides before a start codon and initiation of a single open reading frame which extended through overlapping cDNA clones via D3 to the 3' end of El (5186 nucleotides, MC var 2 Figure l) , or to clone Gl via D2 and the F-g DNA clone (9159 nucleotides, MC var 1 Figure 1) .
  • PCR products were generated corresponding to clones Bl-F-gDNA and A1-D1/D2 of MC var-1, and clones Bl-El and A1-D3 of MC var-2, thus identifying var-1 and var-2 as two independent PfEMPl genes of MC strain parasites.
  • Figure 2 Analysis of the distribution of the 105 cysteines and other residues (Figure 2) revealed 4 domains, denoted DBL-1 through DBL 4, homologous with the Duffy antigen Binding Ligand (DBL) domains of P. vivax, P. falciparum and P. knowlesi, each containing 5 consensus motifs rich in cysteine residues ( Figure 2) . Between the DBL domains there are 3 examples of another cysteine rich motif (CRM) with 3 cysteines in a 7 amino acid stretch and additional homology over approx. 45 amino acids. These domains, denoted CRM-1, CRM-2, CRM-3, share the sequence CNXKCXCX 2 K and are located between the different DBLs ( Figure 2) . CRM-1 and CRM-2 are more closely related than CRM-3, sharing a longer motif, CX 3 CX 3 CXC, and other residues over 38-42 amino acids
  • fragments derived from bp 455-3768 and the 3' end did not hybridize with DNA from all parasites, reacting almost exclusively with MC parasites ( Figure 4B and Table 1) .
  • the novel gene shares extreme 5' sequence and the region 3644-6446 with gDNA of diverse parasites, while the central region (nucleotides 455 to 3768) and the 3' end are significantly different between MC and other parasites. Since there is only a single Eco RI site, within fragment F, and no Hind III sites in the sequence, the presence of multiple fragments with MC K+C+ parasites indicates multiple forms of the novel gene. This is consistent with significant sequence differences in independent cDNA clones from the same parasite.
  • Example 4- Antibodies Generated Against Recombinant Fusion Proteins Recognize PfEMPl To identify the gene corresponding to the novel cDNA, laboratory animals were immunized with RP corresponding to different parts of the cDNA. A number of recombinant proteins were were expressed as GST or MBP-fusions in E . coli ( Figure 1).
  • RP The RP (rAl[3-158] , rBl[161-385] , rCl-l[402-605] , rCl-2[576-808] , rCl-2[1-179]-MC, rCl-2 [1-179]-"ItG” , rCl-2[l- 179]-"HB3", rDl[818-1003] , rD2 [982-1320] , rFl-1 [ 1300-1707] , rFl-3[2171-2450], rGl[2550-2794] , rD3 [992-1243] , rEl-l[1219- 1471], rEl-2[1454-l719] ) were readily purified and used for immunization in either rats, rabbits or goats (See Tables 8 and 9, below) .
  • Sera were screened for immunoprecipitation of 125 I-protein from SDS extracts of PE containing mature asexual stages of MC K+ parasites, immunoprecipitation of labeled fragments cleaved from the surface of iodinated PE (MC K+) by mild trypsinization (Figure 23) .
  • a high molecular weight 1 5 I-protein was immunoprecipitated by sera from several animals immunized with rCl-2 but not by pre-immune sera (Figure 5A) .
  • Rat anti-rCl-2 antibodies immunoprecipitate a 90 kd tryptic fragment (TF90) also immunoprecipitated with Aotus anti MC specific sera.
  • the same fragment was affinity purified with immobilized CD36 but not by other immobilized host receptors.
  • the fragment TF125 affinity purified with TSP was immunoprecipitated by antibodies to rDl, rFl-l and rFl-3 (See Table 9 and Figure 23) . This is a further indication that the TSP binding domain may be contained on the region corresponding to these protein fragments.
  • Two rabbits immunized with rDl also produced immunoprecipitating antibodies ( Figure 5B and Table 9) . Sera from two rabbits immunized with rBl failed to immunoprecipitate 125 I-labeled proteins.
  • the properties of the 125 I-protein identified by the anti rCl-2 and rDl sera were identical to those of 1 5 I-PfEMPl ( Figure 5C) .
  • the 125 I-protein co-migrated with 125 I-PfEMPl immunoprecipitated by three critical sera: a pool of human immune serum that agglutinates MC K+ PE; Aotus anti-MC K+ serum that specifically agglutinates and immunoprecipitates 125 I-PfEMPl from this strain (Howard et al., 1988) and, rabbit 05-75 serum that immunoprecipitates MC strain
  • 125 I-PfEMPl van Schravendijk et al. , supra.
  • the 125 I-protein was not immunoprecipitated from the Triton X-100 extract of 1 5 I-labeled MC PE and was destroyed by treatment of intact PE with trypsin, additional properties which define 125 I-PfEMPl ( Figure 5C) .
  • the anti-rCl-2 and rDl sera did not immunoprecipitate 125 I-PfEMPl from ItG2-ICAM parasites, even though a 12S I-PfEMPl was immunoprecipitated by the pooled human sera.
  • the anti-rCl-2 and anti-rDl sera define MC K+ strain-specific epitope(s) on 125 I-PfEMPl, similar to sera from Aotus monkeys infected with this parasite (Howard et al. , 1988, supra) .
  • PfEMPl proteins share epitopes recognized by antibodies raised against the rCl-2 portion of MC strain PfEMPl, no hybridization of the Cl DNA fragment to DNA from these parasites was found.
  • Sera raised against the RP listed in Example 4 and Table 9 were screened for antibody-mediated agglutination of intact PE.
  • MC K- PE were not agglutinated ( Figure 8 & Table 3).
  • the initial failure of ItG2-ICAM and MC K- PE to be agglutinated by the anti-rCl-2 sera correlates with the failure of such sera to immunoprecipitate 1 5 I-PfEMPl from these parasites.
  • later bleeds e.g., >day 195 of rat #1 anti rCl-2 and at least one of rat anti-rDl agglutinated PE of different strains.
  • SERUM AGGL a TITER AGGL. a TITER AGGL. a TITER human immune pool 4+ 125 4+ 125 0 —
  • Rats #1-4 0 — ND ND ND ND prebleed a. Semi-quantitative agglutination score at 1:5 serum dilution: 0, no agglutination; 1+, 10 or more agglutinates of ⁇ 20 PE; 2+, 10 or more agglutinates of 20-50 PE; 3+, 10 or more agglutinates of 100-200 PE; 4+, 10 or more agglutinates >200 PE.
  • b Reciprocal of maximum serum dilution at which PE agglutination was observed.
  • Rat sera tested were found to be active from second immunization and with monthly boosters, were also reactive beyond day 200. Immunoelectronmicroscopy was performed to localize the reactivity of the anti-rCl-2 antibodies on the PE surface.
  • Treatment of intact MC K+ PE with rat anti-rCl-2 antibodies followed by gold-conjugated goat anti-rat IgG yielded deposition of gold particles on the PE outer membrane ( Figure 9) . Up to 30% of schizont stage PE were positive. The deposition of gold particles was confined to knobs ( Figure 9) , with 50-70% of the knobs labeled. Gold particles were not deposited after treatment with control sera or rat anti-PfEMP3 serum. No binding was detected with ItG2-ICAM, MC K- PE or uninfected erythrocytes. PfEMPl, as defined by the anti-rCl-2 sera, is therefore localized on the surface membrane of PE at know protrusions.
  • Rat anti-rCl-2 antibodies react specifically with the surface of mature asexual PE. In all tests for surface reactivity, these antibodies react exclusively with MC stain K+ PE, congruent with immunoprecipitation of 125 I-PfEMPl exclusively from these parasites.
  • PE were preincubated with test serum before adding the mixture to plastic dishes coated with CD36 or TSP.
  • Rabbit sera raised against rBl, rCl-2 and rDl had no effect on PE adherence to TSP or CD36, even at 1:5 dilution (Table 4).
  • Rat sera to rBl and rDl had no effect on PE adherence to CD36 or TSP.
  • each of the 4 rat sera raised against rCl-2 blocked adherence of MC K+ PE to CD36 but had no effect on adherence to TSP ( Figure 10) .
  • rat and goat sera raised against rCl-2[576-808] and rat sera raised against rCl-2[1-179]-MC blocked PE adherence to CD36 (Table 9).
  • the extent of inhibition at 1:5 serum dilution ranged from 15-60%.
  • Aotus anti MC K+ sera inhibited 15% dilution.
  • the preimmune rat sera had an inhibitory effect of 10-30% at 1:5 dilution, with ⁇ 10% inhibition at dilutions of 1:10 or greater ( Figure 11).
  • the inhibitory effect of preimmune sera was eliminated or markedly reduced by dialysis. This had no effect on inhibition mediated by immune rat sera.
  • Antibodies to rCl-2 block adherence of PE to CD36 in a strain specific manner, but do not effect the binding to thrombospondin, thus identifying rCl-2 as the possible binding domain of MC PfEMPl for CD36.
  • CHO, CHO-CD36 or CHO-ICAM cells were incubated with immobilized recombinant proteins derived from different parts of the MC PfEMPl gene. CHO and CHO-ICAM cells did not bind to any of the RPs tested.
  • CHO-CD36 cells bound specifically to rCl-2 (130 cells/mm 2 ) , but did not bind to rBl or rDl derived from the MC PfEMPl gene, rA62-5 of the A62 clone or GST alone (See Figure 13) .
  • the binding of CHO-CD36 cells to rCl-2 was concentration dependent and reaches apparent saturation at RP concentrations of approx. 100 ⁇ g/ml with a maximum binding of about 250 cells/mm 2 at 200 ⁇ g/ml (see Figure 15) . No binding of CHO or CHO-ICAM cells to rCl-2 was apparent at the highest concentration tested.
  • Example 8- Binding of CD36 to rCl-2 The binding of CD36 to different RP was tested with a modification of the RCPR assay, described above. GST-fusion proteins were immobilized to protein-G Sepharose beads, coated with anti-GST MAbs (MAb 141.4) . The immobilized fusion proteins were then incubated with the pig-tailed, soluble host cell receptors. Bound receptors were detected with MAb 179 using ECL western blotting.
  • CD36 was affinity purified using immobilized rCl-2 and did not bind to immobilized rAl(3-i58), rBl(l61-385) , rCl-l(402- 605), rDl(818-1003) , rFl-1(1300-1707) , rFl-2 (1688-2190) , rFl-3(2171- 2450), rGl(2550-2794) or the MCvar-2 specific recombinant proteins rD3(992-1243) , rEl-1(1219-1471) and rEl-2 (1454-1719) or to the RP fusion partner, GST.
  • Example 9- rCl-2 Blocks Adherence of PE to CD36
  • Antibodies to rCl-2 were shown to selectively block and reverse adherence of PE of the MC strain, in a strain specific manner.
  • MAbs which bind CD36 have been shown to block all strains tested.
  • rCl-2 binds directly to CD36, it was then tested for its ability to block the binding of PE from other parasite strains.
  • rCl-2 was preincubated with immobilized CD36 before the addition of PE containing the same concentration of RP.
  • Four different parasite strains of diverse geographic origin, adherence phenotypes and knob expression were tested.
  • strains also express a serologically distinct PfEMPl molecule as shown by agglutination and other assays, as described.
  • rCl-2 blocked adherence of PE from all four strains by upwards of 75-98% (See Figure 16) .
  • the four strains included in Figure 16 were MC R+ (solid bars) , clone ItG2-ICAM (hatched bars) , clone ItG2-Gl (grey bars) and clone Palo Alto K+ (open bars)).
  • Other strains tested included MC R-, ItG2-F6, FCR 3 -C5, Palo Alto (K-) and Dd2.
  • rCl-1 blocked adherence in each case, indicating that blockade of adherence by rCl-2 is not strain specific. None of the other RP tested had any effect on adherence to CD36 by PE of other strains, except for a small effect (15-20%) of rDl on adherence of PE of strain ItG2-ICAM. Blockade of PE adherence to CD36 by rCl-2 was concentration dependent with an IC 50 (50% reduction in cell adherence) ranging from 0.3 ⁇ M (15 ⁇ g/ml) to 1 ⁇ M (53 ⁇ g/ml) (see Figure 18) . Blockade of adherence of strain ItG-ICAM was almost identical to blockade of adherence of strain MC (see Figure 17) .
  • rCl-2[1-179] blocked adherence with an IC 50 of 0.78 ⁇ M (See Figure 24). These results demonstrate that although the CD36 binding region of different strains may be serologically distinct, they bind the same region of CD36, and this binding may be blocked by rCl-2. rCl-2 [1-179] reversed adherence of PE to CD36 with an approximate IC 50 of 0.5 ⁇ M (See Figure 25) .
  • deletion mutants of RP rCl-2 were generated as described in Example 1(N), and their interaction with CD36 was tested. Deletion mutants were generated by PCR techniques known in the art, and as described herein. The mutants were immobilized on MAb 141.4 coated protein G sepharose beads, directly from the bacterial lysate. The binding of CD36 to the immobilized RP was tested with the RCRP assay (See Figure 19, and summarized in Table 5). Of those fragments tested, the smallest to retain the ability to bind CD36 was the 1- 179 fragment.
  • the 1-140 fragment did not bind to CD36, indicating that features important to binding of CD36 may lie within the segment including amino acids 140-179. Additionally, mutants 25- 179, 25-192 or 11-179 did not bind CD36.
  • the first 30 amino acids of rCl-2 are also expressed in rCl-l which did not bind CD36. Thus, amino acids 1-10, 1-25 and 140-179 appear to be important, in combination, for CD36 binding. The possibility of other important regions located between these regions cannot be excluded. SDS-PAGE of rCl-2 under reduced and nonreduced conditions show a shift in mobility of the RP, indicating the possible existence of at least one disulfide bond.
  • N/A Low expression of RP.
  • Reduction of rCl-2, followed by alkylation with iodoacetamide was associated with lower mobility on SDS-PAGE and no binding of CD36 (Table 4). Without alkylation, the protein refolded and bound CD36 (Table 4) .
  • binding of rCl-2 to CD36 appears to require a defined shape and is not entirely promoted by a simple linear sequence.
  • PCR products were generated from different P . falciparum strains.
  • Primers corresponding to amino acids 1-233 and 1-179 as well as the universal primers gave PCR products from P. falciparum DNA only and failed to produce a product from the DNA of P. cynemolgi , P . fragile , P. caotnyi or P . knowlesi .
  • the 1-233 fragment (complete rCl-2) was amplified only from MC strains of P. falciparum (K+C+R+, K+C+R-, K-C-R-) , and not from the other strains tested.
  • the 1-179 fragment gave PCR products from ten of eleven strains tested, and only failed to react with the Dd2 strain.
  • the region of residues 80-140 is more degenerate and shows much less conservation. From this region, three types of sequences are apparent (See Figure 20) .
  • the first is the MC type including the three MC sequences MC R+ (cDNA and gDNA) , MC R- and MC K-.
  • the second is the "ItG” type that includes the gDNA sequences of strains FCR3-C5, FCR3-C6, ItG2-F6. ItG2-Gl, ItG2-ICAM and Palo Alto and the cDNA sequence of FVO.
  • HB3 contains the gDNA sequence of HB3 and the cDNA sequences of FCR-C5 and ItG2-F6.
  • the binding of CD36 to immobilized rCl-2[1-179] polypeptides derived from the gDNA sequence of several different strains of P. falciparum is shown in Table 5. The alignment of these sequences was used to identify and prepare conserved degenerate universal oligonucleotides to PCR and identify different sequences corresponding to rCl-2 [10-151] from all P . falciparum strains and isolates.
  • the sequence of the Dd2 strain was almost identical to the published sequence of the Dd2 var-7 gene (Su et al. , supra).
  • the cysteines of CRM-1, locaated at the 30-55 region of the alignment are conserved in all strains. However, some sequences show different spacing between the cysteines and are of the form of CIN(D)X 6 _ 7 CI(K)X 2 _ 4 CX 2 K(D)CXCF. Additionally, conserved sequences are found from position 10 (FWXWVXXMLXDS * XWR(K) and the sequence in the region of residue 140 (i.e., TTIDK(X)LXH. Additional conserved amino acids are found at different locations of the alignment ( Figures 20 and 21) .
  • These universal primers have been effectively used to amplify sequences from every strain tested.
  • the PCR products of the universal primers can also be used to identify and make fingerprints from strains, clones or isolates of P. falciparum .
  • the PCR products originating from a particular sample can be labeled according to known labeling methods (e.g.
  • This method can also detect changes in the expressed var by RT-PCR similar to Smith et al. Some such changes may be related to phenotypic changes in the adherence properties of the PE.
  • PA FVO (cDNA derived)
  • Fusion proteins derived from the MC strain showed strong binding to CD36. Recombinant proteins derived from sequences of other strains had little or no detectable binding to CD36. This was true for proteins derived from the expressed var gene of adherence positive strains (FVO, ItG2-F6 and FCR-C5) as well for recombinants derived from gDNA sequences. This results from inappropriate folding of the recombinant protein in the bacterial host, as the protein contains 7 cysteine residues.
  • Chimeric proteins were prepared which were composed in part from the sequence of the strong CD36 binding recombinant protein of the MC parasites complemented with a sequence from week or non-reactive rCl-2 [1-179] clones.
  • Six chimeric proteins were prepared and tested for binding of CD36 (Table 6) .
  • One of these chimeric proteins MC R+/ItG2-F6 had substantial binding (about 50% of the binding of MC R+ rCl-2 [1-179]).
  • Several other proteins including MC R+/HB3, MC R+/FCR3-C5 and FCR3-C5/MC R+ had lower binding activities.
  • R+/ItG2-F6 recombinant protein indicates that the rCl-2 [1-179] is involved with binding to CD36 and that the inability to obtain high- binding recombinant proteins from strains other than MC is most likely due to incorrect folding of these recombinant proteins in E. coli.
  • This procedure is particularly imortant for sequences generated with the universal primers since these sequences lack the two 3' cysteine codons which are important for binding.
  • the above chimeric protein clone, with a 5' portion from a universal primer and a 3' clone from one of the rCl-2[1-179] sequences will have the 3' cysteines important for its function.
  • rCl-2[1-179] (“FVO") sequence with a terminal six histidine tag in yeast produced a correctly folded protein that bound to CD36 and blocked 50% adherence (IC 50 )of MC PE to CD36 at 50 ⁇ g/ml and gave 70% blockage at 100 ⁇ g/ml.
  • the rCl-2[1-179] "MC” product appeared to be proteolytically cleaved and did not bind CD36 or block adherence of PE.
  • the recombinant rCl-2[1-179] region from two different P . falciparum parasites was shown to mediate adherence of PE to CD36.
  • PfEMPl has been attributed the dual properties of antigenic variation on the surface of P. falciparum parasitized erythrocytes ("PE") , and receptor properties of adherence to host proteins on microvascular endothelial cells.
  • PE P. falciparum parasitized erythrocytes
  • receptor properties of adherence to host proteins on microvascular endothelial cells For a review of these findings, see, e.g., Howard and Gilladoga, (1989), and Pasloske and Howard, (1994) , supra .
  • PfEMPl is therefore at the crux of understanding the molecular pathogenesis of P . falciparum malaria insofar as it involves antigenic variation and evasion of antimalarial immunity, as well as PE sequestration and the consequent vascular obstruction. The molecular basis for these phenomena has languished however since repeated attempts to clone PfEMPl have failed.
  • Rat sera tested were found to be active from second immunization and with monthly boosters, were also reactive beyond day 200.
  • PfEMPl as identified by immunoprecipitation of 125 I-labeled PE surface proteins, has been shown to be antigenically diverse with different parasite strains and clones (Leech et al. , J . Exp. Med . (1984) 159:1567-1575); Howard et al. , (1988), supra ; Schravendijk et al. , (1991), supra ; Biggs et al. , J . Immunol . (1992) 149:2047-2054).
  • the 1 5 I-immunoprecipitated protein was defined as PfEMPl by its molecular size, specific detergent extraction properties and sensitivity to low levels of trypsin (Aley et al., (1984); Leech et al., J. Exp. Med . (1984) 159:1567-1575; Howard et al. , (1988), supra) .
  • PfEMPl has been associated with the property of adherence of PE to CD36 and other endothelial cell surface proteins (Howard and Gilladoga, (1989), supra) . Sera raised against rCl-2 specifically blocked PE adherence to CD36. The ability of sera to block adherence of PE was generally correlated with agglutination of the same PE (Howard et al. , (1988), supra ; Iqbal et al. , Trans . R . Soc . Trop. Med . Hyg . (1993) 87:583-588). The results obtained with the anti rCl-2 sera support and verify these observations. Furthermore, the RP, rCl-2 binds to CD36 and blocks and reverses the adherence of several strains to CD36. These results prove that PE binding to CD36 is mediated by PfEMPl.
  • amino acid motif CX 3 CX 3 CXC occurs in only a small number of animal proteins, including human von Willebrand's Factor as well as in numerous plant protein sequences, it is not identified with any specific structural or biologic function. Also of potential relevance to the adherence properties of PfEMPl was the observation of an RGD motif and an LDV motif , both associate with protein-protein interaction and cells attachment (for review, Kuhn and Eble, Trends Cell Biol . (1994) 4:256-261) . These motifs occur in some PfEMPl sequences but not in others.
  • One of the MC K+ PfEMPl sequences includes a RGD motif, while the PfEMPl variant sequence represented by the D3-E1-CDNA lacked this motif. The appearance of such motifs in only some of the PfEMPl genes may explain the extraordinary diversity and plasticity of PE adherence phenotype.
  • Antibodies to rCl-2 block PE adherence to CD36 but not to TSP.
  • different tryptic fragments of 125 I-PfEMPl released from the surface of MC K+ PE bind to TSP and CD36, suggesting that these receptor properties reside in different parts of the PfEMPl protein.
  • the capacity of anti-rCl-2 serum antibodies to immunoprecipitate the same tryptic fragment affinity purified by CD36 and not with TSP and to block and reverse adherence to CD36 but without effect on adherence to TSP is consistent with these observations.
  • rCl-2, encoded by clone Cl specifically bound to CD36, and not to other host cell receptors, including TSP and ICAM-l.
  • Solubilized PfEMPl has also been found to bind CD-36, TSP or ICAM-l. Similarly, tryptic fragments cleaved from PE surface bind to CD36 and TSP. This and other data, above, confirms that PfEMPl is responsible for both the antigenic variation and receptor properties on PE, which are central to the special virulence and pathology of P. falciparum .

Abstract

The present invention generally relates to novel proteins, and fragments thereof, as well as nucleic acids which encode these proteins, and methods of making and using these proteins in both diagnostic and therapeutic applications. In particular, the present invention relates to PfEMP1 proteins and fragments thereof which are associated with the pathology of malaria infections, and which may be used in preventing, diagnosing and/or treating the symptoms of patients who suffer from malaria and associated diseases.

Description

MALARIA PEPTIDES AND VACCINES This application is a continuation-in-part of U.S.
Patent Application Serial No. 08/430,908, filed April 27, 1995, which is hereby incorporated herein by reference in its entirety for all purposes.
The present invention generally relates to novel proteins, and fragments thereof, as well as nucleic acids which encode these proteins, and methods of making and using these proteins in diagnostic, prophylactic and therapeutic applications. In particular, the present invention relates to proteins from the Plasjπσdiuji. falciparum erythrocyte membrane protein 1 ("PfEMPl") gene family and fragments thereof which are derived from malaria parasitized eryhthrocytes. In particular, these proteins are derived from the erythrocyte membrane protein of Plasmodium falciparum parasitized erythrocytes, also termed "PfEMPl". The present invention also provides nucleic acids encoding these proteins, which proteins and nucleic acids are associated with the pathology of malaria infections, and which may be used as vaccines or other prophylactic treatments for the prevention of malaria infections, and/or in diagnosing and treating the symptoms of patients who suffer from malaria and associated diseases.
The present invention was made with U.S. Government support under UNDP/World Bank/WHO grant No. 920570 and AID grant DPE-0453-G-SS-8049-00, and the government may have certain rights in the invention.
BACKGROUND OF THE INVENTION Erythrocytes infected with the malaria parasite P . falciparum disappear from the peripheral circulation as they mature from the ring stage to trophozoites (Bignami and Bastianeli, Reforma Medica (1889) 6:1334-1335). This phenomenon, known as sequestration, results from parasitized erythrocyte ("PE") adherence to icrovascular endothelial cells in diverse organs (Miller, Am . J . Trop . Med . Hyg . (1969) 18:860-865) . Sequestration is associated temporally with expression of knob protrusions (Leech et al., J . Cell . Biol . (1984) 98:1256-1264), expression of a very large antigenically variant surface protein, called PfEMPl (Aley et al., J. Exp. Med . (1984) 160:1585-1590; Leech et al., J. Exp. Med . (1984) 159:1567-1575; Howard et al., Molec . Biochem . Parasitol . (1988) 27:207-223), and expression of new receptor properties which mediate adherence to endothelial cells (Miller, supra ; Udeinya et al. , Science (1981) 213:555-557. Endothelial cell surface proteins such as CD36, thrombospondin (TSP) and ICAM-l have been identified as major host receptors for mature PE. See, e .g. , Barnwell et al. , J. Immunol . (1985) 135:3494-3497; Roberts et al., Nature (1985) 318:64-66; and Berendt et al., Nature (1989) 341:57-59. PE sequestration confers unique advantages for
P. falciparum parasites (Howard and Gilladoga, Blood (1989) 74:2603-2618), but also contributes directly to the acute pathology of P. falciparum (Miller et al., Science (1994) 264:1878-1883). Of the four human malarias, only P. falciparum infection is associated with neurological impairment and cerebral pathology seen increasingly in severe drug-resistant malaria (Howard and Gilladoga, supra) . Although the genesis of human cerebral malaria is likely due to a combination of factors including particular parasite phenotypes (Berendt et al. , Parasitol . Today (1994) 10:412- 414) , inappropriate immune responses and the phenotype of endothelial cell surface molecules in the cerebral microvasculature (Pasloske and Howard, Ann . Rev. Med. (1994) 45:283-295), adherence of PE to cerebral blood vessels and consequent local icrovascular occlusion is a major contributing factor. See, e . g. , Berendt et al. , supra ; Patnaik et al., Am . J. Trop. Med . Hyg. (1994) 51:642-647.
The capacity of P . falciparum PE to express variant forms of PfEMPl contributes to the special virulence of this parasite. Variant parasites can evade variant-specific antibodies elicited by earlier infections. The P. falciparum variant antigens have been defined in vitro using antiseru prepared in Aotus monkeys infected with individual parasite strains (Howard et al., Molec . Biochem . Parasitol . (1988) 27:207-223). Antibodies raised against a particular parasite will only react by PE agglutination, indirect immuno- fluorescence or immunoelectronmicroscopy with PE from the same strain (van Schravendijk et al., Blood (1991) 78:226-236). Such studies with PE from malaria patients in diverse geographic locations and sera from the same or different patients confirm that PE in natural isolates express variant surface antigens and that individual patients respond to infection by production of isolate-specific antibodies (Marsh and Howard, Science (1986) 231:150-153; Aguiar et al., Am . J. Trop. Med. Hyg. (1992) 47:621-632; Iqbal et al., Trans . R. Soc. Trop. Med . Hyg. (1993) 87:583-588. Expression of a variant antigen on PE has also been demonstrated in several simian, murine and human malaria species, including
P. knowlesi (Brown and Brown, Nature (1965) 208:1286-1288; Barnwell et al., Infect . Immun . (1983) 40:985-994), P. chabaudi (Gilks et al. , Parasite Immunol . (1990) 12:45-64; Brannan et al., Proc. R . Soc . Lond . Biol . Sci . (1994) 256:71- 75), P. fragile (Handunnetti et al., J. Exp. Med . (1987)
165:1269-1283) and P. vivax (Mendis et al.. Am . J . Trop. Med . Hyg. (1988) 38:42-46). Laboratory studies with P. knowlesi (Brown and Brown, supra ; Barnwell et al., supra) or P . falciparum (Hommel et al. , J . Exp. Med. (1983) 157:1137- 1148) in monkeys and P. chabaudi in mice (Gilks et al., supra) confirmed that antigenic variation at the PE surface is associated with prolonged or chronic infection and the capacity to repeatedly re-establish blood infection in previously infected animals. Studies with cloned parasites demonstrated that antigenic variants can arise with extraordinary frequency, e . g. , 2 % per generation with P. falciparum (Roberts et al. , Nature (1992) 357:689-692) and 1.6 % per generation with P. chabaudi (Brannan et al., supra ) . PfEMPl was identified as a 125I-labeled, size diverse protein (200-350 kD) on PE that is lacking from uninfected erythrocytes, and that is also labeled by biosynthetic incorporation of radiolabeled amino acids (Leech et al., J . Exp . Med . (1984) 159:1567-1575; Howard et al., Molec. Biochem . Parasitol . (1988) 27:20 -223) . PfEMPl is not extracted from PE by neutral detergents such as Triton X-100 but is extracted by SDS, suggesting that it is linked to the erythrocyte cytoskeleton (Aley et al., J. Med . Exp. (1984) 160:1585-1590). After addition of excess Triton X-100, PfEMPl is immunoreactive with appropriate serum antibodies (Howard et al., (1988), supra) . Mild trypsinization of intact PE rapidly cleaves PfEMPl from the cell surface (Leech et al. , J. Exp . Med . (1984) 159:1567-1575). PfEMPl bears antigenically diverse epitopes since it is immunoprecipitated from particular strains of P. falciparum by antibodies from sera of Aotus monkeys infected with the same strain, but not by antibodies from animals infected with heterologous strains (Howard et al. (1988) , supra) . Knobless PE derived from parasite passage in splenectomized Aotus monkeys (Aley et al., supra) do not express surface PfEMPl and are not agglutinated with sera from immune individuals or infected monkeys (Howard et al. (1988) , supra; Howard and Gilladoga, Blood (1989) 74:2603-2618). In general, sera that react with the PE surface by indirect immunofluorescence and antibody-mediated PE agglutination are the only sera to immunoprecipitate 125I-labeled PfEMPl from any particular strain (Howard et al., (1988), supra ; van Schravendijk et al. , Blood (1991) 78:226- 236; Biggs et al., J. Immunol . (1992) 149:2047-2054). The adherence of parasitized erythrocytes to endothelial cells is mediated by multiple receptor/counter- receptor interactions, including CD36, thrombospondin and intracellular adhesion molecule-1 (ICAM_1) as the major host cell receptors (Howard and Gilladoga, Blood (1989) 74:2603- 2618, Pasloske and Howard, Ann. Rev. Med . (1994) 45:283-295). Vascular cell adhesion molecule-1 (VCAM-1) and endothelial leukocyte adhesion molecule-1 (ELAM-1) have also been implicated as additional endothelial cell receptors that can mediate adherence of a minority of P. falciparum PE (Ockenhouse, et al., J . Exp . Med . (1992) 176:1183-1189, and Howard and Pasloske, supra) . The adherence receptors on the surface of PE has not yet been conclusively identified, and several molecules, including AG 332 (Udomsangpetch, et al. , Nature (1989) 338:763-765), modified band 3 (Crandall, et al. , Proc . Nat ' l Acad . Sci . USA (1993) 90:4703-4707), Sequestrin (Ockenhouse, Proc . Nat ' l Acad . Sci . USA (1991) 88:3175-3179), and PfEMPl (Howard and Gilladoga, supra , and Pasloske and Howard, supra) , have been proposed as candidates. Several pieces of indirect evidence have linked expression of PfEMPl with the acquisition of new host protein receptor properties on the surface of PE (Howard and Gilladoga, supra ; Pasloske and Howard, Ann . Rev . Med . (1994) 45:283-295). PE adherence is correlated with the expression of PfEMPl on the surface of mature stage PE (Leech, et al., J. Exp. Med . (1984) 159:1567- 1575) . Alterations in the adherence phenotype of the PE selected for in vitro are usually associated with the emergence of new forms of PfEMPl (Biggs, et al. , J. Immunol . (1992) 149:2047-2054; Roberts, et al. , Nature (1992) 357:689- 692) . Mild trypsinization of intact mature PE cleaves the extracellular portion of PfEMPl and at the same time, reduces or eliminates PE cytoadherence (Leech, et al., supra) Previously described antibody mediated blockade or reversal of cytoadherence is strain specific and is correlated with the ability of the reacting sera to agglutinate the corresponding PE and to immunoprecipitate the surface labeled 125I-PfEMPl (Howard, et al. , Molec. Biochem . Parasitol . (1988) 27:207- 224) . Pfalhesin (modified band 3) have been shown to bind CD36 under non-physiological conditions (Crandall, et al.,
Exp . Parasitol . (1994) 78:203-209). Sequestrin, which appears to be homologous to PfEMPl, extracted with TXlOO from knobless PE, was shown to bind to immobilized CD36 (Ockenhouse, Proc . Nat ' l Acad . Sci . USA (1991) 88:3175-3179). The complex nature and/or mechanism of malarial antigenic variation, and its particular virulence has created a need for methods and compositions which may be useful in the treatment diagnosis and prevention of malaria infections. The present invention meets these and other needs.
SUMMARY OF THE INVENTION It is a general object of the invention to provide proteins and polypeptides that are derived from PfEMPl proteins, nucleic acids encoding these proteins and antibodies that are specifically immunoreactive with these proteins. It is a further object to provide methods of using these various compositions in diagnosis, treatment or prevention of the onset of symptoms of a malaria parasite infection. It is a further object to provide methods of screening compounds to identify further compositions which may be used in these methods.
In one embodiment, the present invention provides substantially pure polypeptides which have amino acid sequences substantially homologous to the amino acid sequence of a PfEMPl protein, or biologically active fragments thereof. In preferred aspects, the polypeptides of the present invention are substantially homologous to the amino acid sequence shown in Figure 2 or 12, biologically active fragments or analogues thereof. Also provided are pharmaceutical compositions comprising these polypeptides.
In another embodiment, the present invention provides nucleic acids which encode the above described polypeptides. Particularly preferred nucleic acids will be substantially homologous to a part or whole of the nucleic acid sequence shown in Figure 12 or the nucleic acid encoding for the sequences shown in Figures 20 or 21. The present invention also provides expression vectors comprising these nucleic acid sequences and cells capable of expressing same.
In an additional embodiment, the present invention provides antibodies which recognize and bind PfEMPl polypeptides or biologically active fragments thereof. More preferred are those peptides which recognize and bind PfEMPl proteins associated with infection by more than one variant of . fal ciparum .
In a further embodiment, the present invention provides methods of inhibiting the formation of PfEMPl/ligand complex, comprising contacting PfEMPl or its ligands with polypeptides of the present invention.
In a related embodiment, the present invention provides methods of inhibiting sequestration of erythrocytes in a patient suffering from a malaria infection, comprising administering to said patient, an effective amount of a polypeptide of the present invention. Such administration may be carried out prior to or following infection.
In still another embodiment, the present invention provides a method of detecting the presence or absence of
PfEMPl in a sample. The method comprises exposing the sample to an antibody of the invention, and detecting binding, if any, between the antibody and a component of the sample.
In an additional embodiment, the present invention provides a method of determining whether a test compound is an antagonist of PfEMPl/ligand complex formation. The method comprises incubating the test compound with PfEMPl or a biologically active fragment thereof, and its ligand, under conditions which permit the formation of the complex. The amount of complex formed in the presence of the test compound is determined and compared with the amount of complex formed in the absence of the test compound. A decrease in the amount of complex formed in the presence of the test compound is indicative that the compound is an antagonist of PfEMPl/ligand complex formation.
BRIEF DESCRIPTION OF THE DRAWINGS Figure l shows a map of two Malayan Camp strain ("MC") PfEMPl genes and recombinant protein fragments ("RP") . The predicted open reading frame is shown starting from nucleotide +1. CDNA clones Al through El and Gl are located with their boundaries (nucleotide number) . Each clone was shown by PCR to be physically linked to the adjacent clones an confirmed by sequence overlap. Clone D3 was linked 3' only to clone El and not to clones DI or D2. gDNA clone F-gDNA was linked by sequence overlap to cDNAs DI and D2. The regions of PfEMPl expressed as GST fusion proteins, rBl, rCl-1, rCl-2, rDl, are shown, with the total amino acid length of each and boundary amino acids. Figure 2 shows the predicted amino acid sequence of two MC PfEMPl genes deduced from cDNA and gDNA clones, up to amino acid 2924. The position of the putative 725 bp intron (nucleotides 7429-8153) is indicated by a vertical arrow. The likely transmembrane domain is boxed. After amino acid 871 the extensive sequence differences in cDNAs D2 and D3 are shown as separate sequences extending 3' with contiguity to F- gDNA and cDNA El respectively. Amino acid sequence identity in these two sequences is shown in bold. The four Duffy
Binding Ligand ("DBL") domains, denoted DBL-l through DBL-4 and three cysteine-rich motifs ("CRM") between the DBL domains denoted CRM-1 through CRM-3, are shaded. Consensus amino acids in each DBL domain are underlined and conserved cysteines of the CRM motif are indicated by underlined dots.
Figure 3 shows alignment of the three CRMs with amino acid numbers indicated. CRM-1 and CRM-2 share the motif CX3CX3CXC. CRM-3 has less homology, that is more pronounced within a restricted sequence 2371-2390 that includes the CX3CXC motif.
Figure 4 shows autoradiographs of Southern blot hybridization of cDNA clones from the MC PfEMPl gene with DNA from various P . falciparum parasites digested with Eco RI or Eco RI and Hind III. Panel A shows probing with cDNA Al, from the 51 end of the gene, shows hybridization to multiple bands with all P . falciparum parasites tested. Panel B shows probing with clone Cl showing hybridization to fewer bands with MC K+ and MC K- parasites only. Markers of molecular mass in kd are indicated on the left. Table 2 summarizes the results obtained with additional cDNA and gDNA probes.
Figures 5A-5E show immunoprecipitation of 125IPfEMPl from MC K+ PE with non-crossreacting antibodies elicited by immunization with recombinant proteins. In Figures 5A and 5B, results with preim une serum are shown on the left gel lane with results for post-immunization serum from the same animal on the right. Sera from rabbits (rab 1-6) and rats (rat 1-4) were used for immunoprecipitation of SDS extracts from MC K+ PE that had been surface labeled by lactoperoxidase catalyzed radioiodination. Immunoprecipitation was followed by SDS-PAGE and autoradiography. The markers of molecular mass in kiloDalton are indicated on the left. In Figure 5A, rabbits and rats were immunized with rCl-2. 125I-PfEMPl is identified on the left by immunoprecipitation with a strain-specific anti-MC K+ serum. In Figure 5B, sera from two rabbits immunized with rDl. In Figure 5C, the 125I-band immunoprecipitated by anti-rCl-2 and anti-rDl sera shares properties of detergent extraction and trypsin sensitivity with PfEMPl. MC K+ PE were radioiodinated and some of the cells treated with trypsin (5 min. , 10 μg/ml) . Sequential Triton X100 and SDS extracts were immunoprecipitated with three sera that define 125I-PfEMPl of MC K+ parasites: pool of human immune serum; Aotus anti-MC K+ serum; rabbit 05-75 anti- PfEMP3 and PfEMPl serum. The prebleed and post-rCl-2 immunization bleed from rabbit 1 were analyzed in parallel. In Figures 5D and 5E, the anti-PfEMPl antibodies in anti-rCl-2 and anti-rDl sera do not crossreact. Sera were preadsorbed with glutathione-Sepharose beads (none) , with GST or GST fusion proteins derived from MC PfEMPl (rBl, rCl-2, rDl) or other P. falciparum genes (rA62-5, rPfEMP3) and used for immunoprecipitation. Only a portion of the autoradiograph is shown.
Figure 6 shows the immunoblotting of diverse P. falciparum parasites with rabbit anti-rCl-2 serum identifying antigenic cross reactivity between the PfEMPl protein of MC K+ parasites and PfEMPl bands of several other parasites known to express antigenically distinct PfEMPl antigens. SDS extracts from 2.5 X 10s parasites (trophozoite and schizont stage) were subjected to SDS-PAGE and transferred to PVDF membrane. The membrane was incubated with rabbit #2 anti-rCl-2 serum, 1 hour at room temperature. Bound antibodies were visualized by the ECL western blot method.
Figure 7 shows antisera raised against the rCl-2 fragment of MC K+ PfEMPl reacting with the surface of MC K+ in a strain-specific manner. Results shown for anti-rCl-2 rat serum #1. Panels A and B show indirect immunofluorescence of intact non-fixed PE of MC K+ strain detected by confocal fluorescence imaging microscopy. Cells (4% parasite ia) were incubated with anti-rCl-2 serum and visualized by
TRITC-conjugated goat anti-rat IgG. Panel A is a bright field showing a pigmented (mature) PE and several uninfected erythrocytes. Panel B shows fluorescence of the same field with reactivity only on the surface of the PE. The focal concentration of fluorescence is attributed to the narrow plane of confocal microscopy. The bar equals 10 μm.
Figure 8 shows antibody mediated PE agglutination observed by light microscopy. Anti-rCl-2 serum agglutinated mature MC K+ PE (1:20 dilution) but not MC K- PE or K+C+ ItG2-ICAM PE (1:5 dilution). Pre-immune (prebleed) serum of the same animal did not agglutinate MC K+ PE (1:5 dilution). Aotus anti MC K+ sera only agglutinated MC K+ PE. The bar equals 500 μm. The infected blood showed 8-15% parasitemia. Similar results obtained with other anti-rCl-2 sera are summarized in Table 3.
Figure 9 shows immunoelectron-microscopy of intact MC K+ PE with anti-rCl-2 serum identified PfEMPl expression specifically at knob protrusions rather than at areas of the PE surface membrane between knobs. Treatment with rat antiserum was followed by treatment with 5 nm gold-conjugated goat anti-rat IgG. 5 nm gold particles were deposited on >50% of the knobs. Figure 10 shows that antisera to the rCl-2 fragment of MC K+ PfEMPl block adherence of MC K+ PE to immobilized CD36 but do not block adherence to immobilized TSP. PE (or PRBC) were preincubated with diluted serum before transfer to wells containing the immobilized proteins. The number of adherent PE remaining after washing was determined by light microscopy counting. Sera collected at day 28, after 2 immunizations was also active. Results shown as means and standard deviations of quadruplicate assays. The graph shows PE preincubated with binding medium (BM) alone (no addition) or with BM containing 1:5 dilution or rat anti-PfEMP3 serum or rat anti-rCl-2 sera (rat #1-4). Rat anti-rCl-2 sera blocked adherence of PE to CD36 (solid bars) but not to TSP (hatched bars) . The inhibition of adherence observed with sera from rats 1, 2, and, 4 were significantly different from that of the control (p<0.0004).
Figure 11 shows the concentration dependent blockade of adherence to CD36 with rat anti-rCl-2. Immune (filled circles) and pre-immune serum (open circles ) from rat #1 were tested at different dilutions for blockade of adherence of MC K+ PE to CD36.
Figures 12A-12L show the nucleic acid sequence with the deduced amino acid sequence of the MC PfEMPl gene. After base 2613 the extensive sequence differences in cDNAs D2 and D3 are shown as separate sequences extending 3' with contiguity to F-gDNA and cDNA El respectively.
Figure 13 shows the binding of CHO cells expressing surface CD36, to immobilized recombinant PfEMPl protein fragments. CHO-CD36 cells were shown to bind to the fragment denoted rCl-2, however no binding was observed with the other fragments tested. Similarly no binding was observed with CHO- ICAM cells or control CHO cells.
Figure 14 shows the binding of CHO-CD36 cells in cells/mm2 as a function of rCl-2 concentration added to the solid support.
Figures 15A and 15B are Western blots showing binding of CD36 to immobilized rCl-2. Figure 15A shows that CD36 binds to immobilized rCl-2 and not to GST or to the MCvar-1 recombinant proteins rAl(3-158), rBl(161-385) , rCl- 1(402-605), rDl(818-1003) , rD2(982-1320, rFl-1(1300-1707) , rFl-2 (1688-2190) , rFl-3 (2171-2450) , rGl(2550-2794) or the MCvar-2 specific recombinant proteins rD3(992-1243) , rEl- 1(1219-1471) and rEl-2(1454-1719) or to the RP fusion partner, GST. Figure 15B again shows that rCl-2 binds CD36, but fails to bind other cell surface receptors (P-selectin, L-selectin, E-selectin, VCAM-1 and ICAM-l) .
Figure 16 shows a bar graph showing blockade of PE adherence to CD36 (shown as % of PE binding to immobilized CD36) , in the presence of various fragments of PfEMPl, e . g. , rA62-5, rBl, rCl-2 and rDl, and the GST fusion partner (rGST) . Treatment with rCl-2 substantially blocks adherence of PE of different P. falciparum strains to CD36 (MC R+ (solid bars) , clone ItG2-ICAM (hatched bars) , clone ItG2-Gl (grey bars) and clone Palo Alto K- C+ (open bars) ) .
Figure 17 is a bar graph showing the effects of different fragments of PfEMPl on the binding of Malayan Camp strain and ItG2-ICAM strain parasitized erythrocyte to CD36. Figure 18 shows the binding of PE from MC and ItG- ICAM strains to CD36 as a function of rCl-2 concentration.
Figure 19 shows binding of CD36 to immobilized fragments of rCl-2. Shown is the binding to fragment rCl-2[l- 233], rCl-2[l-59], rCl-2[l-87], rCl-2[1-102] , rCl-2[1-140] , rCl-2[1-192] and full length rCl-2. The fragment designations indicate the position of the starting and ending amino acids from amino acids 575-808 (or 1 through 233) of the sequence shown in Figure 2. Figure 20 shows deduced amino acid sequences of the corresponding rCl-2[1-179] region of PfEMPl genes from 11 different P. falciparum strains and clones. These sequences were obtained by PCR using the 1 and 179 primer set of MC PfEMPl. Sequences were obtained by amplification from genomic DNA (indicated by lower case g before the strain designation) by PCR from cDNA libraries (cMC and cFVO) or RT-PCR (dtG-F6) and cC5. These sequences, indicated by lower case c before the strain designation, represent the product of an expressed var gene. Conserved amino acids are indicated in the consensus sequence at the top of the sequence alignment chart.
Figure 21 shows the deduced amino acid sequences of the corresponding rCl-2[10-151] region of PfEMPl genes from six different P. falciparum strains and clones. These sequences were obtained by PCR using the universal primer set deduced from the sequences shown in Figure 20. Sequences were obtained by amplification from genomic DNA (indicated by the small g before the name of the strain) and by PCR from cDNA libraries (cMC) . These sequences, indicated by the small c, represent the product of an expressed var gene. In the MC strain, multiple var genes are shown. Conserved amino acids are indicated in the consensus sequence shown above the listed sequences.
Figure 22 shows the predicted structure of the MC PfEMPl gene product. The figure shows the size and location of recombinant proteins (GST and MBP) derived from the sequence of MCvar-1 and MCvar-2.
Figure 23 shows immunoprecipitation with anti-rCl-2 and anti-MC specific sera and affinity purification with immobilized CD36 and TSP of labeled fragments cleaved from the surface of iodinated PE of strain MC K+ by mild trypsinization.
Figure 24 shows the concentration dependent blockade of adherence of strain MC PE to CD36 with rCl-2[1-233] and rCl-2[1-179] . Determined IC50 values are 1.2 μM for rCl-2 and 0.78 μM for rCl-2[1-179],
Figure 25 shows concentration dependent reversal of adherence of strain MC PE to CD36 with rCl-2[1-233] with an IC 5o value of approximately o.5 μM.
DESCRIPTION OF THE PREFERRED EMBODIMENTS The present invention generally relates to the Plasmodium falciparum erythrocyte membrane protein 1 ("PfEMPl") , nucleic acids which encode PfEMPl, and antibodies which specifically recognize PfEMPl. The polypeptides, antibodies and nucleic acids are useful in a variety of applications including therapeutic, prophylactic, including vaccination, diagnostic and screening applications. The data described herein, indicates that PfEMPl is responsible for both antigenic variation and receptor properties on PE, both of which are central to the special virulence and pathology of P. falciparum . The central role of PfEMPl in P. falciparum biology, as the malarial adherence receptor for host proteins on microvascular endothelium, as described herein, indicates its usefulness in a malaria vaccine, in modelling prophylactic drugs, and also as a target for therapeutics to reverse PE adherence in acute cerebral malaria (Howard and Gilladoga, 1989) .
I. Polypeptides of the Present Invention
Soluble PfEMPl has been reported to bind to CD36, TSP and ICAM-l, and tryptic fragments of PfEMPl cleaved from the PE surface have been shown to bind to TSP or CD36 (Baruch, et al., Molecular Parasitology Meeting at Woods Hole, Sept 18- 22, 1994). Accordingly, in one aspect, the present invention provides substantially pure PfEMPl polypeptides, analogs or biologically active fragments thereof. The terms "substantially pure" or "isolated" refer, interchangeably, to proteins, polypeptides and nucleic acids which are separated from proteins or other contaminants with which they are naturally associated. A protein or polypeptide is considered substantially pure when that protein makes up greater than about 50% of the total protein content of the composition containing that protein, and typically, greater than about 60% of the total protein content. More typically, a substantially pure protein will make up from about 75 to about 90% of the total protein. Preferably, the protein will make up greater than about 90%, and more preferably, greater than about 95% of the total protein in the composition.
The term "biologically active fragment" as used herein, refers to portions of the proteins or polypeptides, e.g., a PfEMPl derived polypeptide, which portions possess a particular biological activity, e.g., one or more activities found in a full length PfEMPl polypeptide. For example, such biological activity may include the ability to bind a particular protein, substrate or ligand, to elicit antibodies reactive with PE, PfEMPl, the recombinant proteins or fragments thereof, to block, reverse or otherwise inhibit an interaction between two proteins, between an enzyme and its substrate, between an epitope and an antibody, or may include a particular catalytic activity. With regard to the polypeptides of the present invention, particularly preferred polypeptides or biologically active fragments include, e.g., polypeptides that possess one or more of the biological activities described above, such as the the ability to bind a ligand of PfEMPl or inhibit the binding of PfEMPl to one or more of its ligands, e.g., CD36, TSP, ICAM-l, VCAM-1, ELAM-1, Chondroitin sulfate or by the presence within the polypeptide fragment of antigenic determinants which permit the raising of antibodies to that fragment.
The polypeptides of the present invention may also be characterized by their immunoreactivity with antibodies raised against PfEMPl proteins or polypeptides. In particularly preferred aspects, the polypeptides are capable of inhibiting an interaction between a PfEMPl protein and an antibody raised against a PfEMPl protein. Additionally or alternatively, such fragments may be specifically immunoreactive with an antibody raised against a PfEMPl protein. Such fragments are also referred to herein as "immunologically active fragments."
Generally, such biologically active fragments will be from about 5 to about 500 amino acids in length. Typically, these peptides will be from about 20 to about 250 amino acids in length, and preferably from about 50 to about 200 amino acids in length. Generally, the length of the fragment may depend, in part, upon the application for which the particular peptide is to be used. For example, for raising antibodies, the peptides may be of a shorter length, e .g. , from about 5 to about 50 amino acids in length, whereas for binding applications, the peptides may have a greater length, e .g. , from about 50 to about 500 amino acids in length, preferably, from about 100 to about 250 amino acids in length, and more preferably, from about 100 to about 200 amino acids in length. The polypeptides of the present invention may generally be prepared using recombinant or synthetic methods well known in the art. Recombinant techniques are generally described in Sambrook, et al., Molecular Cloning: A Laboratory Manual , (2nd ed.) Vols. 1-3, Cold Spring Harbor Laboratory, (1989) . Techniques for the synthesis of polypeptides are generally described in Merrifield, J. Amer. Chem . Soc . 85:2149-2456 (1963), Atherton, et al. , Solid Phase Peptide Synthesis : A Practical Approach , IRL Press (1989) , and Merrifield, Science 232:341-347 (1986). In preferred aspects, the polypeptides of the present invention may be expressed by a suitable host cell that has been transfected with a nucleic acid of the invention, as described in greater detail below.
Isolation and purification of the polypeptides of the present invention can be carried out by methods that are generally well known in the art. For example, the polypeptides may be purified using readily available chromatographic methods, e.g., ion exchange, hydrophobic interaction, HPLC or affinity chromatography, to achieve the desired purity. Affinity chromatography may be particularly attractive in allowing the investigator to take advantage of the specific biological activity of the desired peptide, e.g., ligand binding, presence of antigenic determinants, or the like.
Exemplary polypeptides of the present invention will generally comprise an amino acid sequence that is substantially homologous to the amino acid sequence of a PfEMPl protein, or biologically active fragments thereof, or may include sequences that may take on a homologous conformation. In particularly preferred aspects, the polypeptides of the present invention will comprise an amino acid sequence that is substantially homologous to the amino acid sequence shown in Figure 2, Figure 12, Figure 20 and Figure 21, or a biologically active fragment thereof.
By "substantially homologous" is meant an amino acid sequence which is at least about 50% homologous to the amino acid sequence of PfEMPl or a biologically active fragment thereof, preferably at least about 90% homologous, and more preferably at least about 95% homologous. In some aspects, substantially homologous may include a sequence that is at least 50% homologous, but that presents a homologous structure in three dimensions, i.e., includes a substantially similar surface charge or presentation of hydrophobic groups.
Examples of preferred polypeptides include polypeptides having an amino acid sequence substantially homologous to the MC PfEMPl amino acid sequence as shown in Figure 2 or Figure 12, and PfEMPl of other P. falciparum strains as shown in Figures 20 and 21, as well as biologically active fragments of these polypeptides.
Preferred peptides include those peptide fragments of PfEMPl that are involved in the sequestration of parasitized erythrocytes. Examples of these preferred peptides include peptides which comprise an amino acid sequence which is substantially homologous to amino acids 576 through 755 of the PfEMPl amino acid sequence shown in Figure 2 or Figure 12 or those sequences shown in Figures 20 and 21.
Also among the particularly preferred peptides of the present invention are those peptides and peptide fragments of PfEMPl which are relatively conserved among the variant strains of P . falciparum or which contain regions of high homology to PfEMPl proteins from other strains. The term "relatively conserved" generally refers to amino acid sequences that are substantially homologous to portions of the amino acid sequence shown in Figure 2 and Figure 12. However, also included within the definition of this term are peptides which are encoded by a nucleic acid which is a PCR product of primer probes, and particularly, universal primers, derived from the PfEMPl nucleic acid sequence. In particular, primer probes derived from the nucleic acid sequence shown in
Figure 12, may be used to amplify nucleic acids from other strains of P. falciparum. Particularly preferred primer sequences include the primer sequences shown in Table 1, below. Similarly, universal primer compositions, described in greater detail below and also shown in Table 1, may be used to amplify sequences that encode the peptides of the present invention.
Specific examples of relatively conserved peptides include those that are contained in a region of PfEMPl proteins that corresponds to amino acids 576 through 755 of the amino acid sequence of MC PfEMPl, as shown in Figure 2. Similar regions have been specifically elucidated in a number of P. falciparum strains (See Figures 20 and 21) . In general, these corresponding regions may be described as containing amino acid sequences that are encoded by the universal primer sequences described below. Generally, these amino acid sequences have one or more of the following general structures:
TTIDIO LX-jHE and/or FFWX3WVX4X5ML
where X1 is selected from leucine or isoleucine, X2 is selected from glutamine and asparagine, X3 is selected from the methionine, lysine and aspartic acid, X4 is selected from histidine, threonine and tyrosine and X5 is selected from aspartic acid, glutamic acid and histidine. In particularly preferred aspects, the polypeptides may contain both of the above general amino acid sequences. Particularly preferred amino acid sequences will possess the conserved amino acids shown in the various fragments shown in Figures 20 and 21. In particular, conserved amino acid sequences of six amino acids or greater, shown in Figures 20 and 21 (above the sequences) , may be used as epitopes for generation of antibodies that cross react with multiple P. falciparum strains.
The peptides of the invention may be free or tethered, or may include labeled groups for detection of the presence of the polypeptides. Suitable labels include radioactive, fluorescent and catalytic labeling groups that are well known in the art and that are substantially described herein, e.g., signalling enzymes, chemical reporter groups, polypeptide signals, biotin and the like. Additionally, the peptides may include modifications to the N and C-termini of the peptide, e.g., an acylated N-terminus or amidated C- terminus.
Also included within the present invention are amino acid variants of the above described polypeptides. These variants may include insertions, deletions and substitutions with other amino acids. For example, in some aspects, amino acids may be substituted with different amino acids having similar structural characteristics, e.g., net charge, hydrophobicity, or the like. For example, phenylalanine may be substituted with tyrosine, as a similarly hydrophobic residue. Glycosylation modifications, either changed, increased amounts or decreased amounts, as well as other sequence modifications are also envisioned.
In addition to the above polypeptides which consist only of naturally-occurring amino acids, peptidomimetics of the polypeptides of the present invention are also provided. Peptide analogs are commonly used in the pharmaceutical industry as non-peptide drugs with properties analogous to those of the template peptide. These types of non-peptide compound are termed "peptide mimetics" or "peptidomimetics" (Fauchere, J. (1986) Adv . Drug Res . 15:29; Veber and Freidinger (1985) TJNS p.392; and Evans et al. (1987) J. Med . Chem 30:1229, and are usually developed with the aid of computerized molecular modeling. Peptide mimetics that are structurally similar to therapeutically useful peptides may be used to produce an equivalent therapeutic or prophylactic effect. Generally, peptidomimetics are structurally similar to a paradigm polypeptide (i . e . , a polypeptide that has a biological or pharmacological activity) , such as naturally- occurring receptor-binding polypeptide, but have one or more peptide linkages optionally replaced by a linkage selected from the group consisting of: -CH2ΝH-, -CH2S-, -CH2-CH2-, - CH=CH- (cis and trans), -C0CH2-, -CH(OH)CH2-, and -CH2SO-, by methods known in the art and further described in the following references: Spatola, A.F. in Chemistry and Biochemistry of Amino Acids, Peptides, and Proteins ,
B. Weinstein, eds., Marcel Dekker, New York, p. 267 (1983); Spatola, A.F., Vega Data (March 1983), Vol. 1, Issue 3, "Peptide Backbone Modifications" (general review) ; Morley, J.S., Trends Pharm Sci (1980) pp. 463-468 (general review); Hudson, D. et al., Jnt J Pept Prot Res (1979) 14:177-185 (- CH2NH-, CH2CH2-) ; Spatola, A.F. et al.. Life Sci (1986) 38:1243-1249 (-CH2-S) ; Hann, M.M. , J Chem Soc Perkin Trans I (1982) 307-314 (-CH-CH-, cis and trans); Almquist, R.G. et al., J Med Chem (1980) 23:1392-1398 (-COCH2-) ; Jennings-White,
C. et al.. Tetrahedron Lett (1982) 23:2533 (-C0CH2-) ; Szelke, M. et al., European Appln. EP 45665 (1982) CA: 97:39405 (1982) (-CH(0H)CH2-) ; Holladay, M.W. et al.. Tetrahedron Lett (1983) 24:4401-4404 (-C(OH)CH2-) ; and Hruby, V.J. , Life Sci (1982) 31:189-199 (-CH2-S-) .
Peptide mimetics may have significant advantages over polypeptide embodiments, including, for example: more economical production, greater chemical stability, enhanced pharmacological properties (half-life, absorption, potency, efficacy, etc.), altered specificity (e . g . , a broad-spectrum of biological activities) , reduced antigenicity, and others. Labeling of peptidomimetics usually involves covalent attachment of one or more labels, directly or through a spacer (e.g., an amide group), to non-interfering position(s) on the peptidomimetic that are predicted by quantitative structure- activity data and/or molecular modeling. Such non-interfering positions generally are positions that do not form direct contacts with the molecules to which the peptidomimetic binds (e.g., CD36) to produce the therapeutic effect. Derivitization (e .g. , labelling) of peptidomimetics should not substantially interfere with the desired biological or pharmacological activity of the peptidomimetic. Generally, peptidomimetics of peptides of the invention bind to their ligands (e.g., CD36) with high affinity and possess detectable biological activity (i.e., are agonistic or antagonistic to one or more ligand-mediated phenotypic changes) . Systematic substitution of one or more amino acids of a consensus sequence with a D-amino acid of the same type (e.g., D-lysine in place of L-lysine) may be used to generate more stable peptides. In addition, constrained peptides comprising a consensus sequence or a substantially identical consensus sequence variation may be generated by methods known in the art (Rizo and Gierasch (1992) Ann. Rev . Biochem . 61: 387; for example, by adding internal cysteine residues capable of forming intramolecular disulfide bridges which cyclize the peptide. Polypeptides of the present invention may also be characterized by their ability to bind antibodies raised against PfEMPl, or fragments thereof. Preferably, these antibodies recognize polypeptide domains that are homologous to the PfEMPl proteins from a number of variants of P. falciparum . These homologous domains will generally be present throughout the family of PfEMPl proteins. A variety of immunoassay formats may be used to select antibodies specifically immunoreactive with a particular protein or domain. For example, solid-phase ELISA immunoassays are routinely used to select monoclonal antibodies specifically immunoreactive with a protein. See Harlow and Lane (1988) Antibodies, A Laboratory Manual , Cold Spring Harbor Publications, New York, for a description of immunoassay formats and conditions that can be used to determine specific immunoreactivity. Antibodies to PfEMPl and its fragments are discussed in greater detail, below. As used herein, the terms "polypeptide" or "peptide" are used interchangeably to refer to peptides, peptidomimetics, analogs, and the like, as described above.
The polypeptides of the present invention may be used as isolated polypeptides, or may exist as fusion proteins. A "fusion protein" generally refers to a composite protein made up of two or more separate, heterologous proteins which are normally not fused together as a single protein. Thus, a fusion protein may comprise a fusion of two or more heterologous or homologous sequences, provided these sequences are not normally fused together. Fusion proteins will generally be made by either recombinant nucleic acid methods, i.e., as a result of transcription and translation of a gene fusion comprising a segment encoding a polypeptide comprising a PfEMPl protein and a segment which encodes one or more heterologous proteins, or by chemical synthesis methods well known in the art.
II. Nucleic Acids of the Present Invention and Cells Capable of Expressing Same
Also provided in the present invention are isolated nucleic acid sequences which encode the above described polypeptides and biologically active fragments. Typically, such nucleic acid sequences will comprise a segment that is substantially homologous to a portion or fragment of the nucleic acid sequence shown in Figure 12, and more typically, the nucleic acid sequence from about nucleotide position -211 to about position 3559 of the nucleotide sequence shown in Figures 12, 20 and 21. Preferably, the nucleic acids of the present invention will comprise at least about 15 consecutive nucleotides of the nucleic acid sequence shown in Figures 12, 20 or 21, more preferably, at least about 20 contiguous nucleotides, still more preferably, at least about 30 contiguous nucleotides, and still more preferably, at least about 50 contiguous nucleotides from the nucleotide sequence shown in Figures 12, 20 or 21.
Substantial homology in the nucleic acid context means that the segments, or their complementary strands, when compared, are the same when properly aligned with the appropriate nucleotide insertions or deletions, in at least about 60% of the nucleotides, typically, at least about 70%, more typically, at least about 80%, usually, at least about 90%, and more usually, at least about 95% to 98% of the nucleotides. Alternatively, substantial homology exists when the segments will hybridize under selective hybridization conditions to a strand, or its complement, typically using a sequence of at least about 15 contiguous nucleotides derived from the PfEMPl nucleic acid sequence. However, larger segments will usually be preferred, e .g. , at least about 20 or 30 contiguous nucleotides, more usually about 40 contiguous nucleotides, and preferably more than about 50 contiguous nucleotides. Selective hybridization exists when hybridization occurs which is more selective than total lack of specificity. See, Kanehisa, Nucleic Acid Res . 12:203-213 (1984) .
Nucleic acids of the present invention include RNA, cDNA, genomic DNA, synthetic forms and mixed polymers, both sense and antisense strands. Furthermore, different alleles of each isoform are also included. The present invention also provides recombinant nucleic acids which are not otherwise naturally occurring. The nucleic acids included in the present invention will typically comprise RNA or DNA or mixed polymers. The DNA compositions will generally include a coding region which encodes a polypeptide comprising an amino acid sequence substantially homologous to the amino acid sequence of a PfEMPl protein. More preferred are those DNA segments comprising a nucleotide sequence which encodes a CD36 binding fragment of the PfEMPl protein. cDNA encoding the polypeptides of the present invention, or fragments thereof, may be readily employed as a probe useful for obtaining genes which encode the PfEMPl polypeptides of the present invention. Preparation of these probes may be carried out by generally well known methods. For example, the cDNA probes may be prepared from the amino acid sequence of the PfEMPl protein. In particular, probes may be prepared based upon segments of the amino acid sequence which possess relatively low levels of degeneracy, i.e., few or one possible nucleic acid sequences which encode therefor. Suitable synthetic DNA fragments may then be prepared, e.g., by the phosphoramidite method described by Beaucage and Carruthers, Tetra . Letts . 22:1859-1862 (1981). Alternatively, nucleotide sequences which are relatively conserved among the PfEMPl coding sequences for the various P. falciparum strains may be used as suitable probes. A double stranded probe may then be obtained by either synthesizing the complementary strand and hybridizing the strands together under appropriate conditions or by adding the complementary strand using DNA polymerase with an appropriate primer sequence. Such cDNA probes may be used in the design of oligonucleotide probes and primers for screening and cloning such genes, e .g. , using well known PCR techniques, or, alternatively, may be used to detect the presence or absence of a PfEMPl gene in a cell. Such nucleic acids, or fragments may comprise part or all of the cDNA sequence that encodes the polypeptides of the present invention. Effective cDNA probes may comprise as few as 15 consecutive nucleotides in the cDNA sequence, but will often comprise longer segments. Further, these probes may further comprise an additional nucleotide sequence, such as a transcriptional primer sequence for cloning, or a detectable group for easy identification and location of complementary sequences. cDNA or genomic libraries of various types may be screened for new alleles or related sequences using the above probes. The choice of cDNA libraries normally corresponds to tissue sources which are abundant in mRNA for the desired polypeptides. Phage libraries are normally preferred, e . g . , λgtll, but plasmid or YAC libraries may also be used. Clones of a library are spread onto plates, transferred to a substrate for screening, denatured, and probed for the presence of the desired sequences. In a related aspect, the nucleic acids of the present invention also include the PCR product or RT-PCR product, produced using the above described primer probes. For example, primer probes derived from the nucleotide sequence shown in Figure 12, may be used to amplify sequences from different malaria parasites, and in particular, different strains of P. falciparum. Examples of particularly preferred nucleic acid sequences include those nucleic acid sequences which are PCR amplified using the following oligonucleotide probes:
5' la: AAGGAAGACAAAATTATGTCCTAT
25: AATGGAGAGACGAACATGG
53: TCCAAAAATGGGTTGAACAAAAA 80: ATTGGACTCATGATGATTTTC
96: TTTTGGAAATTATTCAGGATACT
135: CTAAAGGTTTTGTCGCTGAAA
156: AAGCCGATAAATGCCTAAAAAC
3' 59: TTTTTGTTCAACCCATTTTTGGA
87: TGAAGAAAATCATCATGAGTCCA
102: AGTATCCTGAATAATTTCCAA
140: TTCAGCGACAAAACCTTTAGT
179: GAGCGGGCGACACTTCTATCT 192: CTTAGGGTCGGCAGGTGGTG
233: ATCCGTCTTTTCCTCCTGGACTT
a. The number designation indicates the amino acid position within amino acids 575 through 808 of the amino acid sequence shown in Figure 2 and 12, which is encoded by the respective end of the probe (3 * or 5• ) .
Included among the most preferred of the above described nucleic acid sequences are the nucleic acids which are PCR amplified using the following primer probe combinations: 5'-l: 3'59, 3' 140, 3 '179; 5'53: 3 '140, 3'179; and 5'140:3' 179. Also included among the most preferred oligonucleotides are those nucleic acid segments which encode the relatively conserved peptides described above. Examples of these oligonucleotides which have been identified from the previously described P . falciparum strains are shown in Table 1, below:
Table 1
Plasmodium 3' primer falciparum Strain
MC type ACT ACA ATT GAT AAA TTA CTA CAA CAC GAA ITG type ACC ACA ATT GAT AAA TTG CTC AAT CAC GAA HB-3 type ACT ACA ATT GAT AAA ATA CTA CAA CAC GAA
Degenerate ACC ACA ATT GAT AAA TTA CTA CAA CAC GAA
Universal T A G C A T
Primers
Primer
MC type TTT TTT TGG ATG TGG GTA CAT GAT ATG TTA ITG type TTT TTT TGG AAG TGG GTT ACC GAA ATG TTA HB-3 type TTT TTT TGG GAT TGG GTT TAT CAT ATG TTA
Degenerate TTT TTT TGG GAG TGG GTA TAT GAT ATG TTA
Universal ATT T ACC C A
Primers C
In the synthesis of the universal primer sequences, single sequence lines indicate the primary sequence of the primer. Where two bases are shown for a single position, e.g., A and T, it refers to a step in the synthesis of the primer sequence where equal amounts of each base were added to the synthesis step, resulting in equal amounts of each base being coupled to growing oligomers in that position. Similarly, where three bases are shown for a given position, equal amounts of the three bases are added to the synthesis step. This results in a mixture of oligonucleotide sequences having all possible combinations of sequences reflecting the multiple bases at each of te indicated positions. In some cases, expression of the full length primer required the addition of additional bases to the 5' primer, e.g., a CTT before the TTT, to correct for truncation problems upon inserting the primer into the vector used.
Thus, based upon the above sequences, the general structure of the universal 3' primer sequence can be described as a mixture of a number of individual primer sequences where each individual primer has the following general structure:
ACX6ACA ATT GAT AAA X7TX8 CTX9 XXQAXH CAC GAA
where X6 is selected from C and T, X7 is selected from T and A, X8 is selected from G and A, X9 is selected from C and A, X10 is selected from C and A and Xχι is selected from T and A. Similarly, each of the individual primer sequences within the universal 5' primer is represented by the general structure:
TTT TTT TGG X12Xι3X1 TGG GTX15 Xι6Xι7Xι8 Xi9A 20 ATG TTA
where X12 is selected from G and A, X13 is selected from A and T, X14 is selected from G and T, X15 is selected from A and T, X16 is selected from of T, A and C, X17 is selected from A and C, X18 is selected from of T and C, X19 is selected from G and C and X20 is selected from T and A. The above-described universal primer sequences are particularly useful in identifying corresponding gene sequences in different strains of P. falciparum, as well as in the design of particularly preferred peptides of the invention. The above universal primers may be particularly useful in generating a "finger print" identification of individual P . falciparum cells and clones by amplifying a distinct set of PCR products of varying sizes from the var genes and/or the expressed var genes of these cells and clones.
The nucleic acids of the present invention may be present in whole cells, cell lysates or in partially pure or substantially pure or isolated form. Such "substantially pure" or "isolated" forms of these nucleic acids generally refer to the nucleic acid separated from contaminants with which it is generally associated, e.g., lipids, proteins and other nucleic acids. The nucleic acids of the present invention will be greater than about 50% pure. Typically, the nucleic acids will be more than about 60% pure, more typically, from about 75% to about 90% pure, and preferably, from about 95% to about 98% pure.
The present invention also provides substantially similar nucleic acid sequences, allelic variations and natural or induced sequences of the above described nucleic acids, as well as chemically modified and substituted nucleic acids, e.g., those which incorporate modified nucleotide bases or which incorporate a labelling group. In addition to comprising a segment which encodes a
PfEMPl protein or fragment thereof, the nucleic acids of the present invention may also comprise a segment encoding a heterologous protein, such that the gene is expressed to produce the two proteins as a fusion protein, as substantially described above.
In addition to their use as probes, the nucleic acids of the present invention may also be used in the preparation of the polypeptides of the present invention, as described above. DNA encoding the polypeptides of the present invention will typically be incorporated into DNA constructs capable of introduction to and expression in an in vitro cell culture. Often, the nucleic acids of the present invention may be used to produce a suitable recombinant host cell. Specifically, DNA constructs will be suitable for replication in a unicellular host, such as bacteria, e.g., E. coli, viruses or yeast , but may also be intended for introduction into a cultured mammalian, plant, insect, or other eukaryotic cell lines. DNA constructs prepared for introduction into bacteria or yeast will typically include a replication system recognized by the host, the intended DNA segment encoding the desired polypeptide, transcriptional and translational initiation and termination regulatory sequences operably linked to the polypeptide encoding segment. A DNA segment is operably linked when it is placed into a functional relationship with another DNA segment. For example, a promoter or enhancer is operably linked to a coding sequence if it stimulates the transcription of the sequence; DNA for a signal sequence is operably linked to DNA encoding a polypeptide if it is expressed as a preprotein that participates in the secretion of the polypeptide. Generally, DNA sequences that are operably linked are contiguous, and in the case of a signal sequence both contiguous and in reading phase. However, enhancers need not be contiguous with the coding sequences whose transcription they control. Linking is accomplished by ligation at convenient restriction sites or at adapters or linkers inserted in lieu thereof. The selection of an appropriate promoter sequence will generally depend upon the host cell selected for the expression of the DNA segment. Examples of suitable promoter sequences include prokaryotic, and eukaryotic promoters well known in the art. See, e . g. , Sambrook et al. , supra. The transcriptional regulatory sequences will typically include a heterologous enhancer or promoter which is recognized by the host. The selection of an appropriate promoter will depend upon the host, but promoters such as the trp, lac and phage promoters, tRNA promoters and glycolytic enzyme promoters are known and available. See Sambrook et al. , supra . Conveniently available expression vectors which include the replication system and transcriptional and translational regulatory sequences together with the insertion site for the PfEMPl polypeptide encoding segment may be employed. Examples of workable combinations of cell lines and expression vectors are described in Sambrook et al., supra , and in Metzger et al., Nature 334:31-36 (1988).
The vectors containing the DNA segments of interest, e.g., those encoding polypeptides comprising a PfEMPl protein or fragments thereof, can be transferred into the host cell by well known methods, which may vary depending upon the type of host used. For example, calcium chloride transfection is commonly used for prokaryotic cells, whereas calcium phosphate treatment may be used for other hosts. See, Sambrook et al. , supra . The term "transformed cell" as used herein, includes the progeny of originally transformed cells.
Techniques for manipulation of nucleic acids which encode the polypeptides of the present invention, i.e., subcloning the nucleic acids into expression vectors, labeling probes, DNA hybridization and the like, are generally described in Sambrook, et al. , supra.
In recombinant methods, generally the nucleic acid encoding a peptide of the present invention is first cloned or isolated in a form suitable for ligation into an expression vector. After ligation, the vectors containing the nucleic acids fragments or inserts are introduced into a suitable host cell, for the expression of the polypeptide of the invention. The polypeptides may then be purified or isolated from the host cells. Methods for the synthetic preparation of oligonucleotides are generally described in Gait, Oligonucleotide Synthesis: A Practical Approach , IRL Press (1990) .
There are various methods of isolating the nucleic acids which encode the polypeptides of the present invention. Typically, the DNA is isolated from a genomic or cDNA library using labeled oligonucleotide probes specific for sequences in the desired DNA. Restriction endonuclease digestion of genomic DNA or cDNA containing the appropriate genes can be used to isolate the DNA encoding the binding domains of these proteins. From the PfEMPl sequence given in Figure 12, a panel of restriction endonucleases can be constructed to give cleavage of the DNA in desired regions, i.e., to obtain segments which encode biologically active fragments of the PfEMPl protein. Following restriction endonuclease digestion, DNA encoding the polypeptides of the present invention is identified by its ability to hybridize with a nucleic acid probe in, for example a Southern blot format. These regions are then isolated using standard methods. See, e .g. , Sambrook, et al., supra .
The polymerase chain reaction, or "PCR" can also be used to prepare nucleic acids which encode the polypeptides of the present invention. PCR technology is used to amplify nucleic acid sequences of the desired nucleic acid, e.g., the DNA which encodes the polypeptides of the invention, directly from mRNA, cDNA, or genomic or cDNA libraries.
Appropriate primers and probes for amplifying the nucleic acids described herein, may be generated from analysis of the PfEMPl oligonucleotide sequence, such as those shown in Figure 12 and Table 1. Briefly, oligonucleotide primers complementary to the two 3 ' borders of the DNA region to be amplified are synthesized. The PCR is then carried out using the two primers. See, e .g. , PCR Protocols: A Guide to Methods and Applications (Innis, M. , Gelfand, D. , Sninsky, J. and White, T. , edε.) Academic Press (1990). Primers can be selected to amplify various sized segments from the PfEMPl oligonucleotide sequence. The primers may also contain a restriction site and additional bases to permit "in-frame" cloning of the insert into an appropriate expression vector, using the restriction sites present on the primers.
III. Antibodies The nucleic acids and polypeptides of the present invention, or fragments thereof, are also useful in producing antibodies, either polyclonal or monoclonal. These antibodies are produced by immunizing an appropriate vertebrate host, e.g., rat, mouse, rabbit or goat, with a polypeptide of the invention, or its fragment, or plasmid DNA containing a nucleic acid of the invention, alone or in conjunction with an adjunct. Usually, two or more immunizations are involved, and a few days following the last injection, the blood or spleen of the host will be harvested. For production of polyclonal antibodies, an appropriate target immune system is selected, typically a mouse or rabbit, but also including goats, sheep, cows, guinea pigs, monkeys and rats. The substantially purified antigen or plasmid is presented to the immune system in a fashion determined by methods appropriate for the animal. These and other parameters are well known to immunologists. Typically, injections are given in the footpads, intramuscularly, intradermally or intraperitoneally. The immunoglobulins produced by the host can be precipitated, isolated and purified by routine methods, including affinity purification. For monoclonal antibodies, appropriate animals will be selected and the desired immunization protocol followed. After the appropriate period of time, the spleens of these animals are excised and individual spleen cells are fused, typically, to immortalized myeloma cells under appropriate selection conditions. Thereafter, the cells are clonally separated and the supernatants of each clone are tested for the production of an appropriate antibody specific for the desired region of the antigen. Techniques for producing antibodies are well known in the art. See, e.g., Goding et al.. Monoclonal Antibodies : Principles and Practice (2d ed.) Acad. Press, N.Y., and Harlow and Lane, Antibodies : A Laboratory Manual , Cold Spring Harbor Laboratory, New York (1988) . Other suitable techniques involve the in vitro exposure of lymphocytes to the antigenic polypeptides or alternatively, to selection of libraries of antibodies in phage or similar vectors. Huse et al., Generation of Large Combinatorial Library of the Immunoglobulin Repertoire in Phage Lambda, Science 246:1275-1281 (1989). Monoclonal antibodies with affinities of 108 liters/mole, preferably 109 to 1010 or stronger, will be produced by these methods.
The antibodies generated can be used for a number of purposes, e.g., as probes in immunoassays, for inhibiting
PfEMPl binding to its ligands, thereby inhibiting or reducing erythrocyte sequestration, in diagnostics or therapeutics, or in research to further elucidate the mechanism of various aspects of malarial infection, and particularly, P . falciparum infection.
The antibodies of the present invention can be used with or without modification. Frequently, the antibodies will be labeled by joining, either covalently or non-covalently, a substance whiqh provides for a detectable signal. Such labels include those that are well known in the art, such as the labels described previously for the polypeptides of the invention. Additionally, the antibodies of the invention may be chimeric, human-like or humanized, in order to reduce their potential antigenicity, without reducing their affinity for their target. Chimeric, human-like and humanized antibodies have generally been described in the art. Generally, such chimeric, human-like or humanized antibodies comprise variable regions, e.g., complementarity determining regions (CDR) (for humanized antibodies), from a mammalian animal, i.e., a mouse, and a human framework region. By incorporating as little foreign sequence as possible in the hybrid antibody, the antigenicity is reduced. Preparation of these hybrid antibodies may be carried out by methods well known in the art.
Preferred antibodies are those that are specifically immunoreactive with the polypeptides of the present invention and their immunologically active fragments. The phrase "specifically immunoreactive," when referring to the interaction between an antibody of the invention and a particular protein, refers to an antibody that specifically recognizes and binds with relatively high affinity to the particular protein, such that this binding is determinative of the presence of the protein in a heterogeneous population of proteins and other biologies. Thus, under designated immunoassay conditions, the specified antibodies bind to a particular protein and do not bind in a significant amount to other proteins present in the sample. A variety of immunoassay formats may be used to select antibodies specifically immunoreactive with a particular protein. For example, solid-phase ELISA immunoassays are routinely used to select monoclonal antibodies specifically immunoreactive with a protein. See Harlow and Lane (1988) Antibodies, A Laboratory Manual, Cold Spring Harbor Publications, New York, for a description of immunoassay formats and conditions that can be used to determine specific immunoreactivity.
The antibodies generated can be used for a number of purposes, e.g., as probes in immunoassays, for inhibiting interaction between a PfEMPl protein and its ligand, e.g., CD- 36, TSP, ICAM-l, VCAM-1, ELAM-1, or Chondroitin sulfate, thereby inhibiting or reducing the level of PfEMPl-ligand interaction, in diagnostics or therapeutics, or in research to further elucidate the mechanism of malarial pathology, e.g., erythrocyte sequestration. Where the antibodies are used to block or reverse the interaction between a polypeptide of the invention and an associating ligand or PE, the antibody will generally be referred to as a "blocking antibody."
Preferred antibodies are those monoclonal or polyclonal antibodies which specifically recognize and bind the polypeptides of the invention. Accordingly, these preferred antibodies will specifically recognize and bind the polypeptides which have an amino acid sequence that is substantially homologous to the amino acid sequence shown in Figures 2 , 20 or 21, or immunologically active fragments thereof. Still more preferred are antibodies which are capable of forming an antibody-ligand complex with the relatively conserved polypeptide fragments of PfEMPl sequences, and are thereby capable of blocking an interaction of PfEMPl from a variety of P . falciparum strains, and PfEMPl ligands.
IV. Methods of Use
The polypeptides, antibodies, and nucleic acids of the present invention have a variety of important uses, including, but not limited to, diagnostic, screening, prophylactic, including vaccination, and therapeutic applications.
A. Diagnostic Applications
In a particularly preferred aspect, the present invention provides methods and reagents useful in detecting the presence of PfEMPl in a sample. These detection methods are particularly useful in diagnosing malarial infections in a patient.
For example, in a particularly preferred aspect, the antibodies of the present invention may be used to assay for the presence or absence of PfEMPl in a sample. Immunoassay techniques for the detection of the particular antigen are very well known in the art. For a review of immunological and immunoassay procedures in general, see Basic and Clinical Immunology 7th Edition (D. Stites and A. Terr ed.) 1991. Moreover, the immunoassays of the present invention can be performed in any of several configurations, which are reviewed extensively in Enzyme Immunoassay, E.T. Maggio, ed. , CRC Press, Boca Raton, Florida (1980) ; "Practice and Theory of Enzyme Immunoassays," P. Tijssen, Laboratory Techniques in Biochemistry and Molecular Biology, Elsevier Science Publishers B.V. Amsterdam (1985); and, Harlow and Lane, Antibodies, A Laboratory Manual , supra . Generally, these methods comprise contacting the antibody with a sample to be tested, and detecting any specific binding between the antibody and a protein within the sample. Typically, this will be in a blot format, e.g., western blot, or in an ELISA format. Methods of performing these assay formats are well known in the art. See, e.g., Basic and Clinical Immunology, 7th ed. (D. Stites and A Terr, eds., 1991).
Typically, these diagnostic methods comprise contacting a sample with an antibody to PfEMPl, as described herein, and determining whether the antibody binds to any portion of the sample. In the case of human diagnostic techniques, the sample may be a whole blood sample, or some fraction thereof, e.g. an erythrocyte containing sample. Generally, such diagnostic methods are well known in the art, and are described in the above described references. The immunoreactivity of the antibody with the sample, indicates the presence of PfEMPl in the sample, and, in the case of a sample derived from a patient, a possible malarial infection. Alternatively, labeled polypeptides of the present invention may be used as diagnostic reagents in detecting the presence or absence of antibodies to PfEMPl, in a patient. The presence of antibodies within a patient would be indicative that the patient had been exposed to a malaria parasite sufficiently to result in an antigenic response.
Similarly, the nucleic acid probes of the invention may be used in a similar manner, i.e., to identify the presence in a sample of a DNA segment encoding a PfEMPl polypeptide, or as PCR or RT-PCR primers to amplify and then detect PfEMPl encoding nucleic acid segments. Such assays typically involve the immobilization of nucleic acids in the sample, followed by interogation of the immobilized sequences with a chemically labeled oligonucleotide probe, as described herein. Hybridization of the probe to the immobilized sample indicates the presence of a DNA segment encoding PfEMPl, and thus, a malarial infection. As described above, assays may be further designed to indicate not only the presence of a Malarial parasite, but also indicate the strain of parasite present. Although described in terms of an immobilized xample probed with a solution based oligonucleotide probe, a wide variety of assay conformations may be adopted, which conformations are generally well known in the art.
B. Screening Applications
In another particularly preferred aspect, the present invention provides methods for screening compounds to determine whether or not the particular compound is an antagonist of a symptom of a malarial infection. In particular, the screening methods of the present invention can be used to determine whether a test compound is an antagonist of the sequestration of erythrocytes which is associated with P. falciparum malaria. More particularly, the screening methods can determine whether a compound is an antagonist of the PfEMPl/ligand interaction. Ligands of PfEMPl generally include, e.g., CD36, TSP, ELAM-1, ICAM-l, VCAM-1 or Chondroitin sulfate.
Generally, the screening methods of the present invention comprise contacting PfEMPl protein, or a fragment thereof, and/or ligand protein, with a compound which is to be screened ("test compound") . The level of PfEMPl/ligand complex formed may then be detected and compared to a control, e .g. , in the absence of the test compound. A decrease in the level of PfEMPl/ligand interaction is indicative that the test compound is an antagonist of that interaction.
A test compound may be a chemical compound, a mixture of chemical compounds, a biological macromolecule, or an extract made from biological materials, such as bacteria, phage, yeast, plants, fungi, animal cells or tissues. Test compounds are evaluated for potential activity as antagonists of PfEMPl/ligand interaction by inclusion in the screening assays described herein. An "antagonist" refers to a compound which will diminish the level of PfEMPl/ligand interaction, over a control. It will often be desirable in the screening assays of the present invention, to provide one of the PfEMPl or ligand proteins immobilized on a solid support. Suitable solid supports include, e.g., agarose, cellulose, dextran, Sephadex, Sepharose, carboxymethyl cellulose, polystyrene, filter paper, nitrocellulose, ion exchange resins, plastic films, glass beads, polyaminemethylvinylether maleic acid copolymer, amino acid copolymer, ethylene-maleic acid copolymer, nylon, silk, etc. The support may be in the form of, e.g., a test tube, microtiter plate, beads, test strips, flat surface, e.g., for blotting formats, or the like. The reaction of the PfEMPl polypeptide or its ligand with the particular solid support may be carried out by methods well known in the art, e.g., binding to an immobilized anti-PfEMPl antibody, or binding to prederivatized solid support. In addition to the foregoing, it may also be desirable to provide either the PfEMPl or its ligand linked to a suitable detectable group to make detection of binding of one protein to the other, simpler. Useful detectable groups, or labels, are generally well known in the art. For example, a detectable group may be a radiolabel, such as, 125I, 32P or 35S, or a fluorescent or chemiluminescent group. Alternatively, the detectable group may be a substrate, cofactor, inhibitor, affinity ligand, antibody binding epitope tag, or an enzyme which is capable of being assayed. Suitable enzymes include, e.g., horseradish peroxidase, luciferase, or another readily assayable enzymes. These enzyme groups may be attached to the PfEMPl polypeptide, or its ligand by chemical means or maybe expressed as a fusion protein, as already described. Generally, where one of the above proteins, e.g., the PfEMPl ligand, is immobilized on a solid support, the other protein, e.g., PfEMPl or its fragment, will be labelled with an appropriate detectable group. Assaying whether a compound is an antagonist of the interaction of the two proteins is then a matter of contacting the labelled PfEMPl polypeptide or fragment with the immobilized ligand, in the presence of the test compound, under conditions which allow specific binding of the two proteins. The amount of label bound to the solid support is compared to a control, where no test compound was added. Where a test compound results in a reduction of the amount of label which binds to a solid support, that compound is an antagonist of the PfEMPl/ligand interaction.
C. Therapeutic and Prophylactic Applications
In addition to the above described uses, the polypeptides of the present invention may also be used in therapeutic applications, for the treatment of human and/or non-human mammalian patients. The therapeutic uses of the polypeptides of the present invention include the treatment of symptoms of existing disorders, as well as prophylactic applications. The term "prophylactic" refers to the prevention of a particular disorder, or symptoms of a particular disorder. Thus, prophylactic treatments will generally include drugs which actively participate in the prevention of a particular disorder such as a malaria infection, or symptoms thereof. Prophylactic applications will also include treatments which elicit a preventative response from a patient, including, for example, an immunological response as in the case of vaccination.
Typically, both therapeutic and prophylactic applications will comprise administering an effective amount of the compositions of the present invention to a patient, to treat or prevent symptoms, or the onset of a malarial parasite infection. An "effective amount", as the term is used herein, is defined as the amount of the composition which is necessary to achieve the desired goal, i.e. alleviation of symptoms, prevention of symptoms or infection, or treatment of disease. In prophylactic applications, the polypeptides of the present invention may be used in a variety of treatments. For example, the polypeptides of the invention are particularly useful as a vaccine, to elicit an immunological response by a patient, e.g., production of antibodies specific for PfEMPl. In particular, such vaccine applications generally involve the administration of the PfEMPl protein or biologically active fragments thereof, to the host or patient. In response to this administration, the patient's immune system will generate antibodies to the particular PfEMPl protein or fragment introduced. An amount of the polypeptides sufficient to produce an immunological response in a patient is termed "an immunogenically effective amount." Thus, the vaccines of the present invention will contain an immunogenically effective amount of the polypeptides of the present invention. The immune response of the patient may include generation of antibodies, activation of cytotoxic T- lymphocytes against cells expressing the polypeptides, e.g., PE, or other mechanisms known to the skilled artisan. See, e.g., Paul, Fundamental Immunology, 2d Edition, Raven Press. Useful carriers are well known in the art, and include for example, thyroglobulin, albumins such as human serum albumin, tetanus toxoid, polyamino acids such as poly(D-lysine; D- glutamic acid) , influenza, hepatitis B virus core protein, hepatitis B virus recombinant vaccine. The vaccines can also contain a physiologically tolerable diluent, such as water, buffered water, buffered saline, saline and typically may further include an adjuvant, such as incomplete Freunds adjuvant, aluminum phosphate, aluminum hydroxide, alum, or other materials well known in the art.
Alternatively, the nucleic acids of the present invention may also be used as vaccines for the prevention of malaria symptoms, and/or infection by malaria parasites. See Sedegah, et al. Proc . Nat ' l Acad . Sci . (1994) 91:9866-9870. For example, plasmid DNA comprising the nucleic acids of the present invention may be directly administered to a patient. Expression of this "naked" DNA will have effects similar to the injection of the actual polypeptides, as described above. Specifically, the patient's immune response to the presence of the proteins expressed from the DNA, will result in the production of antibodies to that protein. The nucleic acids may also be used to design antisense probes to interupt transcription of PfEMPl peptides in parasitized erythocytes. Antisense methods are generally well known in the art.
The polypeptides of the present invention, and analogs thereof, may also be used as prophylactic treatments to prevent the onset of symptoms of malarial infection. For example, administration of the polypeptides can directly inhibit, block or reverse the sequestration of erythrocytes in patients suffering from P. falciparum malaria infections. In particular, the polypeptides of the invention may be used to compete with or displace PE associated PfEMPl in binding CD36. The blockage or reversal of sequestration will reduce or eliminate the microvascular occlusion generally associated with the pathology of this type of malaria, which, again, can lead to destruction of the PE by the host. The antibodies of the invention may also be used in a similar fashion. In particular, the antibodies, which are capable of binding the polypeptides of the present invention, may be directly administered to a patient. By binding PfEMPl, the antibodies of the present invention are effective in blocking, reducing or reversing PfEMPl mediated interactions, e.g., erythrocyte sequestration. Chimeric, human-like or humanized antibodies are particularly useful for administration to human patients. Additionally, such antibodies may also be used as a passive vaccination method to provide a subject with a short term immunization, much as anti-hepatitis A injections have been used previously.
In alternative aspects, the polypeptides, antibodies and nucleic acids of the invention may be used to treat a patient already suffering from a malarial infection. In particular, the compositions of the present invention may be administered to a patient suffering from a malarial infection to treat symptoms associated with that infection. More particularly, these compositions may be administered to the patient to prevent or reduce erythrocyte sequestration and the resulting microvascular occlusion associated with malarial, and more specifically, P. falciparum , infections.
Although the polypeptides, nucleic acids and antibodies of the present invention may be administered alone, for therapeutic and prophylactic applications, these elements will generally be administered as part of a pharmaceutical composition, e.g., in combination with a pharmaceutically acceptable carrier. Typically, a single composition may be used in both therapeutic and prophylactic applications.
Pharmaceutical formulations suitable for use in the present invention are generally described in Remington ' s Pharmaceutical Sciences , Mack Publishing Co., 17th ed. (1985). The pharmaceutical compositions of the present invention are intended for parenteral, topical, oral, or local administration. Where the pharmaceutical compositions are administered parenterally, the invention provides pharmaceutical compositions that comprise a solution of the agents described above, e.g., polypeptides of the invention, dissolved or suspended in a pharmaceutically acceptable carrier, preferably an aqueous carrier. A variety of aqueous carriers may be used, e.g., water, buffered water, saline glycine, and the like. These compositions may be sterilized by conventional, well known methods, e.g., sterile filtration. The resulting aqueous solutions may be packaged for use as is, or lyophilized for combination with a sterile solution prior to administration. The compositions may contain pharmaceutically acceptable auxiliary substances as required to approximate physiological conditions, such as pH adjusting and buffering agents, tonicity adjusting agents, wetting agents, and the like, for example sodium acetate, sodium lactate, sodium chloride, potassium chloride, calcium chloride, sorbitan monolaurate, triethanolamine oleate, etc. For solid compositions, conventional nontoxic solid carriers may be used which include, for example, pharmaceutical grades of mannitol, lactose starch, magnesium stearate, sodium saccharin, talcum, cellulose, glucose, sucrose, magnesium carbonate, and the like. For oral administration, a pharmaceutically acceptable nontoxic composition may be formed by incorporating any of the normally employed excipients, such as the previously listed carriers, and generally, 10-95% of active ingredient, and more preferably 25-75% active ingredient. In addition, for oral administration of peptide based compounds, the pharmaceutical compositions may include the active ingredient as part of a matrix to prevent proteolytic degradation of the active ingredient by digestive process, e.g., by providing the pharmaceutical composition within a liposomal composition, according to methods well known in the art. See, e.g.. Remington ' s Pharmaceutical Sciences , Mack Publishing Co., 17th Ed. (1985).
For aerosol administration, the polypeptides are generally supplied in finely divided form along with a surfactant or prope11ant. Preferably, the surfactant will be soluble in the propellant. Representative of such agents are the esters or partial esters of fatty acids containing from 6 to 22 carbon atoms, such as caproic, octanoic, lauric, palmitic, stearic, linoleic, linolenic, olesteric and oleic acids, with an aliphatic polyhydric alcohol or its cyclic anhydride. Mixed esters, such as mixed or natural glycerides may be employed. A carrier can also be included, as desired, as with, e.g., lecithin for intranasal delivery. The above described compositions are suitable for a single administration or a series of administrations. When given as a series, e.g., as a vaccine booster, the inoculations subsequent to the initial administration are given to boost the immune response, and are typically referred to as booster inoculations.
The amount of the above compositions to be administered to the patient will vary depending upon what is to be administered to the patient, the state of the patient, the manner of administration, and the particular application, e . g. , therapeutic or prophylactic. In therapeutic applications, the compositions are administered to the patient already suffering from a malarial infection, in an amount sufficient to inhibit the spread of the parasite through the erythrocytes, #and thereby cure or at least partially arrest the symptoms of the disease and its associated complications. An amount adequate to accomplish this is termed "a therapeutically effective amount." Amounts effective for this use will depend upon the severity of the disease and the weight and general state of the patient, but will generally be in the range of from about 1 mg to about 5 g of active agent per day, preferably from about 50 mg per day to about 500 mg per day, and more preferably, from about 50 mg to about 100 mg per day, for a 70 kg patient.
For prophylactic applications, immunogenically effective amounts will also depend upon the composition, the manner of administration and the weight and general state of the patient, as well as the judgment of the prescribing physician. For the peptide, peptide analog and antibody based pharmaceutical compositions, the general range for the initial immunization (for either prophylactic or therapeutic applications) will be from about 100 μg to about 1 g of polypeptide for a 70 kg patient, followed by boosting dosages of from about 1 μg to about 1 gm of polypeptide pursuant to a boosting regimen over weeks to months, depending upon the patient's response and condition, e.g., by measuring the level of parasite or antibodies in the patient's blood. For nucleic acids, typically from about 30 to about 100 μg of nucleic acid is injected into a 70 kg patient, more typically, about 50 to 150 μg of nucleic acid is injected, followed by boosting treatments as appropriate.
The present invention is further illustrated by the following examples. These examples are merely to illustrate aspects of the present invention and are not intended as limitations of this invention.
V. EXAMPLES
Example 1- General Procedures A. Parasites
The Malayan Camp MC K+R+C+ (knob, rosetting and cytoadherence positive) line of P. falciparu-π, denoted MC K+, the ItG2-ICAM K+C+ clone which binds to CD36, TSP, and ICAM-l (Ockenhouse et al., J. Infect . Dis . (1991) 164:163-169), and the ItG2-F6 (K+ C+ [CD36,TSP, ICAM-l]) were maintained in culture with 0+ RBC (Handunnetti et al., Am J. Trop. Med . Hyg . (1992) 46:371-381). DNA or proteins were also extracted from the following P. falciparum parasites in human erythrocytes: MC K+C+R-; MC K-C-; ItG2-Gl (K+C+) ; FCR3/C5 (K+C+) ; FCR3/C6 (K-C-) ; 7G8 (K+) ; D10(K+C+ [TSP only]); Palo Alto, PA (K-C+) ; HB3 (K+C+ [TSP only]) and Dd2 (K+, low C+) . FVO(K+C+) was derived from Aotus monkey 1150. Unless indicated, C+ refers to adherence to both CD36 and TSP.
B. Preparation of Nucleic Acids
P. falciparum gDNA was isolated from mature PE by lysis in NP40 (Pasloske et al., Molec . Biochem . Parasitol . (1993) 59:59-72). DNA for Southern blotting was digested with Eco RI or Eco RI/Hind III and blotted under high stringency (Pasloske, et al., supra) .
C . Screening OF MC gDNA Expression Library
The genomic DNA λgtll expression library and screening of the library with antibodies has been described (Pasloske et al. , supra) . Rabbit serum 05-75 (van
Schravendijk et al., Am . J. Trop. Med. Hyg. (1993) 49:552-565) was exhaustively adsorbed with the λgtll-12.1.3 clone (Pasloske et al.) and used at 1:150 dilution for screening the gDNA library. Clones so derived were subcloned into the SK- vector (Stratagene, Cloning Systems, La Jolla, CA) .
D. Isolation Of cDNA Clones
The MC K+ cDNA library was prepared in the expression plasmid pJFE14DAF (Alamo et al., manuscript submitted) as described by (Elliott et al., Proc . Nat ' l Acad . Sci . (1990) 87:6363-6367). PfEMPl clones were isolated from the cDNA library using a modified version of the "leapfrog" method (Gibbons et al., Proc . Nat ' l Acad. Sci . (1991) 88:8563- 8567). cDNA clones extending 5' or 3' from previously isolated DNA clones were generated by PCR using an oligonucleotide primer 100-150 bases from the proximal terminus region of the cloned sequence and another primer derived from the vector arm flanking the cloning site. PCR was performed on 10 ng of the cDNA library using 30 cycles with a profile of 1 min. at 94°C, 1 min. at 55°C and 2.5 min. at 72βC. The PCR products were fractionated on low melt agarose gels and products of 1-3 kb were gel purified (Wizard PCR preps, Promega, Madison, WI) , cloned into pAMP vector (Life Technologies Inc. Gaithersburg, MD) and transformed into E. coli DH5-ot Max. Efficiency cells (Life Technologies, Gaithersburg, MD) or Sure-2 cells (Stratagene cloning Systems, La Jolla, CA) . To facilitate cloning, the PCR primers were designed with 5' adaptor sequences for directional insertion into the pAMP vector. PfEMPl clones were identified by direct colony hybridization using end-labeled oligonucleotides designed 50-100 bases internal to the sequence specific PCR primer.
E. DNA Secnαencing and Analysis Plasmid DNA was isolated from the recombinant clones using the Wizard Miniprep DNA isolation system (Promega, Madison, WI) , alkali denatured and sequenced via the dideoxy chain termination method using the Sequenase kit (USB, Cleveland, Ohio) . Either vector specific or custom oligonucleotides primers were used for primer directed sequencing. For some of the clones, the insert was subcloned into the pBluescript SK-vector (Stratagene cloning system, La Jolla, CA) and unidirectional deletion mutants generated using Exonuclease III (Henikoff, Gene (1984) 28:351-359). To ensure that new clones were continuous with the initial ones, primers from within the two clones were used to generate PCR products from MC gDNA and the cDNA library and the identity of the generated product was confirmed by size, hybridization with oligonucleotides and direct sequencing (fmol sequencing system, Promega, Madison, WI) . Sequences were analyzed using DNASTAR (DNASTAR Inc. , Madison, WI) sequence analysis sof ware.
F. Recombinant Fusion Proteins
GST fusion proteins and Maltose Binding Protein (MBP) fusion proteins were constructed by cloning of PCR products carrying a Bam HI site at the 5' end and an EcoRI site at the 3' end of the BamHl/EcoRI sites of the pGEX-3X vector (Pharmacia Biotech) for GST and into modified pMAL vector (New England Biolab) for MBP fusion proteins. The recombinant fusion proteins generated were: rAl (a.a.3-158), rBl (a.a. 161-385), rci-l (a.a. 402-605), rCl-2 (a.a. 576- 808) , rDl (a.a. 818-1003), rD2 (982-1320), rFl-1 (1300-1707), rFl-2 (1688-2190), rFl-3 (2171-2450) , rGl (2550-2794), rD3 (992-1243), rEl-1 (1219-1471), rEl-2 (1454-1719), and rGST (See Figure 15A) . Clone Fl-2 was cloned into Smal/Notl sites of the pMal vector and expressed as an MBP fusion only. The fusion proteins were expressed in E. coli DH5- or Sure-2 cells. The GST fusion proteins were purified on glutathione-Sepharose (Pharmacia, LKB Biotechnology, Piscataway, NJ) (van Schravendijk et al., supra) except that PBS was replaced with a column buffer (20 mM Tris, 200 mM NaCI, pH 7.5). MBP fusion proteins were purified on Amylose Resin (New England Biolab) according to the manufacturer's procedure. rA62-5 was derived from clone A62 and rPfEMP3 corresponding to the 12.1.3 RP (van Schravendijk et al.). G. Antibodies
Mouse MAb 179 recognizes an epitope sequence incorporated into the carboxy terminus of sCD36 expressed as phosphoinositol glycan-linked extracellular domain (Affy ax Research Institute) . Mouse MAb 141 recognizes GST. Adherence blocking anti-CD36 MAb 8A6 (Barnwell et al., J. Clin . Invest . (1989) 84:765-772) was a gift from Dr. J. Barnwell (New York Medical Center, NY) . Rabbit serum 05-75 which recognizes both PfEMP3 and MC PfEMPl was described previously (Schravendijk et al., supra) . A human immune serum pool was prepared from five individuals resident in a P. falciparum endemic area of Ghana (Schravendijk et al., supra). Aotus anti-P. falciparum sera 779 and 9050 were derived from animals infected with the Aotus MC K+ strain and drug cured (Leech et al., J. Exp. Med . (1984) 159:1567-1575) .
RP (as listed above, except for Fl-2) in solution or bound to the purification resin, e.g., glutathione- Sepharose 4B beads (Pharmacia) or Amylose Resin, were used to immunize goats (1 mg RP) , rabbits (0.1 mg RP) and rats (0.05 mg RP) . Initial immunization was performed with Freund's complete adjuvant followed by booster immunizations with Freund's incomplete adjuvant at days 21, 35, 49 and 63 and then monthly. Animals were bled seven days after each boost. H. Surface Iodination. Trvpsinization. Sequential
Extr ction And Xronunφprecj i atiPP Mature intact PE were enriched to >90% by the percoll-sorbitol method (Kutner et al. , J. Cell . Physiol . (1985) 125:521-527) after initial disruption of rosettes (Handunnetti et al. , supra . Fifty or 100 μl of PE were iodinated by the lactoperoxidase method using 1-2.5 mCi or 5 mCi of Na1 5I (Amersham) respectively, and sequentially extracted with 1% (w/v) Triton X-100 followed by 2% (W/v) SDS (van Schravendijk et al.). For trvpsinization, iodinated PE were incubated at 10% hematocrit with 10 μg/ml of trypsin-TPCK (Sigma, St. Louis, Missouri) in PBS for 5-10 minutes at 21°C. Trypsinization was terminated by adding an equal volume of 200 μg/ml soybean trypsin inhibitor type I-S (Sigma, St. Louis, Missouri) in PBS. The trypsinized cells were sequentially extracted as above. Immunoprecipitation used 5-7 μl of 125I-SDS extract, 10-15 μl of 125I-Triton X-100 extract, or 15-25 μl of tryptic supernatant from surface iodinated cells, reconstituted in 500 μl of 50 mM Tris, 150 mM NaCI, 5 mM EDTA and 1% Triton X-100 pH 8.0 (NETT buffer) containing 1% BSA (Clinical grade, ICN Biomedicals, Irvine, CA) and a cocktail of protease inhibitors (1 mM PEfabloc SC, Boehringer Mannheim Bioche icals, Indianapolis, IN) , 1 mM pepstatin A, 10 μg/ml each of benzamidine, leupeptin and aprotinin, 3.7 μg/ml of N-tosyl L-lysine chloromethylketone and N-tosyl L-phenylalanine chloromethylketone (Sigma, St. Louis, Missouri)). The reconstituted extracts were incubated overnight with <10 μl of sera and processed as previously described (Van Schravendijk et al., supra) . For depletion of anti PfEMPl antibodies with PfEMPl-RP, 7.5 μl of sera were incubated, 3 h 21°C, in 500 μl of NETT-BSA containing 15 μg of RP bound to glutathione-Sepharose 4B beads. The beads were centrifuged and removed, 5 μl of 125I-SDS extract added and immunoprecipitation performed. I. Western Blots
Trophozoite-stage PE were extracted sequentially with 1% Triton X-100 and 2% SDS to a final concentration of 108 parasites per ml. 2.5 μl of extract was SDS-PAGE fractionated on 5% acrylamide gels, transferred onto Immobilon-P membrane (Millipore Corp. , Bedford, MA) and immunoblotted using an ECL Western blotting protocol (Amersham Int., Buckinghamshire, England). Membranes were incubated overnight at 5βC in 50 mM Tris, 150 mM NaCI, 0.1% Tween 20 pH 8.0 (TBS-T) containing 10% w/v nonfat dry milk, followed by
1 h incubation with the primary Ab diluted in TBS-T, 5% w/v dry milk (TTM) , one wash with TBS-T, two with high-salt TTM (0.5 M NaCI) and two with TTM. HRP-conjugated donkey anti Rabbit IgG (Jackson ImmunoResearch Labs. Inc.) was diluted 1:50,000 in TTM and added to the membranes for 45 minutes. The membranes were washed once with TBS-T, twice with high-salt TTM, three times with TTM containing 0.5% Triton X-100 and three times with TBS-T. J. PE Agglutination
Agglutination assays were performed with modifications as described earlier (Aguiar et al. , Am. J. Trop. Med . Hyg. (1992) 47:621-632). PE were washed twice with RPMI-1640, 25 mM HEPES, 1% BSA pH 6.8 or 7.2 (binding media (BM) ) and resuspended to 20% hematocrit. 15 μl of blood was mixed with an equal volume of diluted sera, incubated 45 minutes at 37βC, in a G24 environmental incubator shaker (New Brunswick Scientific) with continuous rotation (125 rpm) examined microscopically and scored based on the size and number of the specific PE agglutinates.
K. Soluble Receptors And Cytoadherence Microassay
Soluble CD36 was obtained in the form of harvest supernatant by cleaving phosphoinositol glycan-linked CD36 from the surface of stable transfected CHO cells using PI-PLC (Lin et al.. Science (1990) 249:677-679) and stored at 5°C. The CD36 concentration in the harvest supt. was approx. 1-
2 μg/ml. Purified TSP was purchased from Gibco BRL. A modification of the standard microscopic adherence microassay (Hasler et al., Am . J. Trop. Med . Hyg . (1993) 48:332-347) was used for antibody-mediated inhibition of PE adherence. 7 μl of MAb 179 at 50 μg/ml in PBS was used to coat each well (lhr, 2l°C) , washed once with 50 μl of PBS and blocked, 30 minutes, 21°C with PBS containing 1% BSA. The blocking solution was washed twice with PBS and 50 μl of the appropriate amount (usually 0.2, 0.4 or 2 μg/ml) of sCD36 added and incubated 2l°C for 1 hr. TSP at 50 μg /ml was coated directly on the plastic (2 h, 21°C) . Each well was washed twice with BM. PE were washed once with BM and resuspended to 4% hematocrit in BM +10% FCS. An equal volume of diluted serum was added and the cells incubated with the sera for 1 h. at 37°C. 50 μl of cells at 2% hematocrit were added to each well and incubated 1 h at 37°C. After removing the parafilm mask, the plates were washed four times with BM, the cells fixed, strained and counted (Hasler et al.). For determination of adherence of recombinant proteins, the recombinant proteins were preincubated for 1 hour with the immobilized receptor before PE were added. Reversal of PE adherence to CD36 was performed by allowing 30 minute adherence with PE followed by 3 washes with BM and addition of BM containing antibodies or recombinant protein for 45 minutes, followed by two washes, fixing and staining, as described above.
L. gonfpcal riMPresgence Imaging Micrpscopv Immunofluorescence microscopy wa& performed with a
Bio-Rad MRC-600 system (Bio-Rad Laboratories, Cambridge, MA) interfaced to an Olympus IMT-2 inverted microscope as described previously (Gormley et al. , J. Cell . Biol . (1992) 119:1481-1495). 1 X 108 cells (P=4%, trophozoite and schizont stages) were washed three times in RPMI-1640 (RPMI) , resuspended in 10 μl of serum and incubated, 2 h, 37βC, with constant shaking. The samples were washed three times with RPMI and Rhodamine (TRITC)-labeled goat anti-rat IgG (Jackson ImmunoResearch Laboratories, Inc.) added at a 1:10 dilution in RPMI for 30 minutes, 37βC. The cells were washed three times in RPMI, diluted to 0.3% hematocrit and viewed in a Dvorak chamber.
M. Immunoelectron Microscopy
Cells (5% hematocrit P=5%) were incubated in RPMI containing 2% BSA, 30 minutes, 25°C with constant shaking.
Primary rat serum was added at 1:100 dilution for 1 h, at 25°C with constant shaking, followed by three washes with RPMI. 5 nm gold conjugated goat anti-rat IgG (Goldmark Biologicals) was incubated with the cells at a 1:50 dilution in RPMI, 30 minutes, 25°C. The cells were washed three times with RPMI, fixed overnight at 4°C in 2% glutaraldehyde, 1% tannic acid, 4% sucrose, 0.1 M phosphate buffer pH 7.4, washed with o.l M phosphate buffer and post-fixed in 2% osmium tetroxide in
0.05 M phosphate buffer (pH 7.4) on ice for 90 minutes. The specimens were washed four times with deionized water and incubated with 1% uranyl acetate for 15 minutes at 25°C, washed four times with deionized water, embedded in 2% agarose and dehydrated in graded steps of acetone. The cells were infiltrated and embedded in Spurrs. Thin sections were cut on a Reichert-Jung Ultracut E ultramicrotome and post-stained with 2% uranyl acetate and 1% lead citrate. The sections were examined with Hitachi H-7000 STEM. N. Preparation of rCl-2 Fragments
1. Oligonucleotide Primers
Oligonucleotide primers were synthesized based upon the sequence of PfEMPl. The name of the primer represents the position of the amino acid coded at the 5' or 3' end of the oligonucleotide. Oligonucleotides from the coding strand of rCl-2 (a.a. 576-808 of PfEMPl) were as follows:
1: AAGGAAGACAAAATTATGTCCTAT
25: AATGGAGAGACGAACATGG 53: TCCAAAAATGGGTTGAACAAAAA
80: ATTGGACTCATGATGATTTTC
96: TTTTGGAAATTATTCAGGATACT
135: CTAAAGGTTTTGTCGCTGAAA
156: AAGCCGATAAATGCCTAAAAAC
Oligonucleotides from the noncoding strand were as follows:
59: TTTTTGTTCAACCCATTTTTGGA 87: TGAAGAAAATCATCATGAGTCCA
102: AGTATCCTGAATAATTTCCAA
140: TTCAGCGACAAAACCTTTAGT
179: GAGCGGGCGACACTTCTATCT 192: CTTAGGGTCGGCAGGTGGTG 233: ATCCGTCTTTTCCTCCTGGACTT
Oligonucleotides from the coding strand (5' oligos) carried a BamHl site and oligonucleotides from the non-coding strand (3' oligos) carried an EcoRI site at their 5' ends.
2. RT-PCR Protocol
Total RNA from late-ring stages of P. falciparum was isolated as described before (Pasloske et al. 1993) or using Catrimox-14 (Iowa Biotechnology Corp.) and lithium chloride precipitation according to the manufacturers instructions. The RNA was Dnase-1 treated to remove all contaminating DNA. Complete removal of DNA was verified by PCR reaction using various sets of primers (no PCR product) . Usually, 1 μg of
RNA was treated with 1 unit of Dnase-1 (promega) for 15 min at 21βC, followed by the addition of 2 mM EDTA and 15 min. incubation at 65°C, phenol chloroform extraction and ethanol precipitation. 1-2 μg of treated RNA was reversed transcribed in volume of 30 μl with 0.5-1 μM of the Cl-2 179-EcoRI primer containing an EcoRI restriction site. Cl-2 primer sequence: (egg aat tct g)GAG CGG GCG ACA CTT CTA TCT (with the EcoRI restriction site indicated in lower case) . The RNA was heat denatured at 70°C for 10-15 min in the presence of the Cl-2 179-EcoRI primer and cooled on ice (1-2 min). 0.1 M DTT, RT buffer, 30-40 units of RNAsin and 0.5M dNTPs added and the mix was equilibrated at 50°C for 2 min before addition of 300 units of superscript RT (Gibco BRL) and lh incubation at 50°C. The RNA template was removed from the first strand cDNA by 15 min. incubation at 37βC with 2-3 units of Rnase H (Gibco BRL) and purified with glass max purification system (Gibco BRL) . The purified first strand cDNA was subjected to PCR as above with the Cl-2 179-EcoRI and the Cl-2 1-BamHl [ (cgc gga tec) AAG GAA GAC AAA ATT ATG TCC TAT (with the BamHI site in lower case)] primer set, only the 1 min 42°C incubation was replaced with 1 min at 50°C. To ensure that the product is RNA derived a mock RT reaction (no enzyme) was performed. Non-DNase RNA and gDNA were used as additional controls. The PCR products were cloned into the pGEX-3X vector sequenced and tested for protein expression as above.
3. Universal Degenerate Oligonucleotide Primers Degenerate oligonucleotides were prepared for use as universal primers to PCR the corresponding regions from gDNA of different P. falciparum strains. The 5' forward primer included a Bam HI site and the 3' primers carried a EcoRI site for direct cloning into the pGEX-3X vector as described above (See discussion of GST fusion proteins) . From the sequences of a number of P. falciparum strains, universal degenerate primer sequences were identified as follows:
Unil79-5' c i ^H*F^ HP^P^P TGG GAG TGG GTA TAT GAT ATG TTA
ATT T ACC C A C
AA: F F W M W V H D M L K T E D Y H
Unil79-3'
3 ' ACC ACA ATT GAT AAA TTA CTA CAA CAC GAA T A G C A T
AA: T T I D K L L Q H E
I N
PCR amplification using these universal primer compositions was performed with 50-100 ng of DNA, 0.5 μM of each primer, 2.5 units of Tag enzyme, 200 uM dNTPs in 50 μl volume. Initial denaturation 2 min at 94°C followed by 30 cycles of 50 sec at 94°C, 1 min at 42βC, 90 sec at 72 C and final extension at 72°C for 10 min. The products were gel isolated (Wizard™ PCR DNA isolation kit, Promega) , digested with BamHl and EcoRI, cloned into pGEX-3X vector as described and sequenced.
4. Preparation of Fragments of rCl-2T1-2331 and Mutant Fusion Proteins of rCl-2T1-2331 The preparation, production and purification of the
GST fusion protein rCl-2 (233 amino acids from positions 576- 808 of the MC PfEMPl) denoted rCl-2[l-233] , was carried out as described in Section F, above. Recombinant protein fragments Of rCl-2[1-233] ; rCl-2[1-192] , rCl-2[1-179] , rCl-2[1-140] , rCl-2[1-102] , rCl-2[l-87], rCl-2[l-59], rCl-2[11-179] , rCl- 2[25-179], rCl-2[53-192] , rCl-2[80-192] , rCl-2[96-192] , rCl- 2[135-192], rCl-2[156-192] and rCl-2[156-233] were generated using the above described primers. Cysteines at various positions were replaced by using a primer sequence with a Serine codon in place of the corresponding Cysteine codon, generating the following mutant fragments rCl-2[1-179] Ser159, rCl-2[1-179] Ser168, rCl-2[1-179]Ser159 and Ser168, rCl-2[l- 179] Ser45 and rCl-2[1-179] Ser49 recombinant protein with a serine substitution of each or both cysteines. All mutants were tested for expression, and produced similar amounts of recombinant protein as determined by SDS-PAGE stained with coomassie blue. Oligonucleotides from the above, particularly those corresponding to the 1-179 region, were used to generate a PCR product from 10 different strains of P. falciparum, and GST-fusion proteins were prepared.
O. Binding of CHO Cells to GST-PfEMPl Fusion Protein. Immobilized on Plastic 7μl of 50μg/ml of MAb 141.4 (Mouse IgG, anti-GST)in
PBS at pH 7.4 was spotted on parafilm masked petri dish for l hour at 21°C. The dish was washed twice with RPMI-1640, at pH 7.3 containing 1% BSA (clinical grade, ICN, Irvine CA) , and incubated with RPMI + 1% BSA for 30 minutes at 21°C. The dish was then washed twice with RPMI + 0.05% BSA. Purified fusion proteins (50-200μg/ml in PBS) were added to the dish and incubated for 1 hour at 21°C. The dish was again washed twice with RPMI + 0.05% BSA. 50 μl of approximately 2 X 106 cells/ml (CHO, CHO-CD36 or CHO-ICAM cells) in RPMI + 0.05% BSA were incubated with the immobilized fusion protein for 1 hour at 37°C. The dish was then washed four times, then fixed, stained and counted. The results are presented as cells bound/mm2 +/- standard dev.
P. Blockade of PE Adherence with Recombinant Protein Derived from PfEMPl
30 μl of recombinant protein (RP) in PBS (approx. 100 μg/ml, or as indicated) were incubated for 1 hour at 21βC with CD36 (0.2 μg/ml) , immobilized to plastic as described above, then aspirated. 50 μl of parasitized erythrocytes (PE) (P=6-10%) at 2% hematocrit in RPMI, 25 mM HEPES, 1 % BSA, pH 6.8 (BM) were added to the immobilized protein and incubated for 1 hour at 37°C, washed four times with BM, fixed stained and counted as above. Reversal of PE adherence to CD36 was performed substantially as described in Section K, above.
Q. Receptor/Counter Receptor Precipitation Assay (RCPR. and Analysis of Mutant Recombinant Fusion Proteins 25 μl of GammaBind™ Plus Sepharose resin (Pharmacia LKB BioTech. , Uppsala, Sweden) was coated with 15 μg of MAb 141.4 for 1 hour at 21°C. The resin was washed three times with PBS and resuspended in 1 ml of BM. 5μg of purified GST- fusion protein, or 50 μl of lysate from bacteria expressing the GST fusion protein was added, and the mixture was incubated for 2 hours at 21βC with rotation. The resin was washed three times with PBS and resuspended in 400μl of BM (or BM containing 1 mM Ca2+ at pH 7.3, for thrombospondin (TSP) experiments). lOOμl if sCD36, other pig-tailed receptors(approx. 1-5 μg/ml) or human TSP (Gibco-BRL, 20 μg/ml) was added and incubated for 2.5 hours at 21°C, with rotation. The resin was washed twice with 1 ml of BM, once with 1 ml BM without BSA, and then solubilized with 40 μl of 5% SDS sample buffer. 5 or 10 μl of the solubilized sample were fractionated by SDS-PAGE on a 10% acrylamide gel (5% for TSP) and ECL western blot as described. 1.25 μg/ml of biotinylated-MAb 179 or rabbit serum 186 (anti-TSP) , diluted 1:5000 were used to detect bound pig-tail receptors, or bound TSP, followed by secondary HRP-conjugated streptavidin or HRP- conjugated donkey anti rabbit IgG (Jackson ImmunoResearch Labs, Inc., West Grove, PA).
R. Preparation of Chimeric rCl-2 r1-1791 GST Fusion Proteins
Chimeric protein composed of the 5' portion of the rCl-2 [1-179] sequence of one P. falciparum strain and a 3' portion derived from the sequence of a different strain were prepared by taking advantage of a unique Mfe-1 restriction site (CAATTG) present in the sequence of rCl-2 [1-179] of different strains. The site resides at position 433 in strain MC R+, position 418 in ItG2-F6, 376 in clone FCR3-C5 and position 439 of HB3 (except for the sequence of MC R+, all sequences were obtained from gDNA) . Cl-2 [1-179] clones (in PGEX-3X vector) of the different strains were digested with BamHl and Mfe-l and the different parts (BamHl-Mfel 5' part of the sequence and the remaining 3' part pGEX-3X fragment) and purified from agarose gel. The 5' fragment of ItG2-F6, HB3 and FCR3-C5 were ligated to the 3'-pGEX fragment of MC R+ and the 5' fragment of MC R+ was ligated to the 3'-pGEX fragment of ItG2-F6, HB3 and FCR3-C5 thus creating six chimeric constructs: ItG2-F6/MC R+, FCR3-C5/MC R+, HB3/MC R+, MC R+/ItG2-F6, MC R+/FCR3-C5 and MC R+/HB3. The ligation products were transformed into DH5α cells, sequenced and screened for protein expression. The chimeric fusion proteins were assayed by the "ECL" RCRP method as described above.
Reversal of PE adherence to CD36 was performed by allowing 30 minute adherence with PE followed by 3 washes with BM and addition of BM containing antibodies or recombinant protein for 45 minutes, followed by two washes, fixing and staining, as described above.
Example 2- Identification of cDNA
Previously, the preparation of a rabbit serum, 05-75, which reacted with two very large (>300 kD) malarial proteins, PfEMPl and PfEMP3, associated with the erythrocyte membrane of P. falciparum PE was described (van Schravendijk et al. , supra) . Adsorption of serum 05-75 against a recombinant protein (RP) corresponding to part of PfEMP3 (ø-gal-12.1.3) , ablated im unoreactivity with PfEMP3 without effect on immunoprecipitation of 125I-PfEMPl (van Schravendijk et al., supra) . Screening of a gDNA λgtll expression library from MC parasites with 05-75 serum preadsorbed with the X12.1.3 clone identified one insert that hybridized to a large (8-10 kb) mRNA band of size sufficient to encode a very large protein. This 1.8 kb insert, denoted A62, gave maximal signal intensity with RNA from late ring stage parasites. RP derived from part of clone A62 blocked immunoprecipitation of MC PfEMPl by serum 05-75. In view of these results this gDNA clone was explored further. A cDNA library of K+ MC strain parasites was subjected to PCR with primers derived from A62 to generate cDNA clones extending 5*. One of these clones, of 1.1 kb, included sequences corresponding to the 3" end of clone DI, but proved to be highly unstable in E. coli .
Nevertheless, repeated PCR using diverse probes from this clone identified a more stable cDNA, denoted DI (Figure 1) . From DI additional contiguous cDNA clones were produced, extending 5', designated A1-C2 (Figure 1). Clones D2 and D3 were also identified by PCR with this cDNA library (Figure 1) . D2 overlapped DI completely whereas D3 diverged from the sequence shared by DI and D2 in several places (Figure 2) . Repeated attempts to identify stable overlapping cDNAs that extend 3' from DI or D2 were unsuccessful. However, the sequence was extended 3' from DI (and D2) by PCR cloning from the MC parasite gDNA, extending the sequence to 8227 nucleotides (Figure 1, F-gDNA) . Further 3' extension, generated the cDNA clone Gl, extending this contiguous sequence to 9159 nucleotides (Figure 1) . The cDNA sequence was extended further 3' from D3 to identify clone El
(Figure 1) . Both sequences are of full length and show the extracellular domain of the MC-PfEMPl. The deduced amino acid sequence of these variants is shown in Figure 2 and 12.
Example 3- Structure Of The Gene and Variant Sequences
Clone Al included 244 nucleotides before a start codon and initiation of a single open reading frame which extended through overlapping cDNA clones via D3 to the 3' end of El (5186 nucleotides, MC var 2 Figure l) , or to clone Gl via D2 and the F-g DNA clone (9159 nucleotides, MC var 1 Figure 1) . PCR products were generated corresponding to clones Bl-F-gDNA and A1-D1/D2 of MC var-1, and clones Bl-El and A1-D3 of MC var-2, thus identifying var-1 and var-2 as two independent PfEMPl genes of MC strain parasites. These genes have overlapping sequence with a single amino acid substitution between cDNA clones D2 and D3 up to amino acid 871 at which point their sequences diverged (Figure 2) . A 725 bp intron was identified at nucleotide 7429 by comparison with sequence data obtained for other genes in the same family described in an accompanying report, giving a deduced amino acid sequence of 2924 residues (Figure 12) . Small differences in nucleotide sequence and deduced amino acid sequences were observed in several of the overlapping cDNA clones (Figure 2) . A single, putative transmembrane domain (amino acids 2450-2475) was identified just before the putative splice junction, followed by a presumed intracellular domain encoded by the 3' exon. The majority of the protein sequence is therefore extracellular (amino acids 1-2449, Figure 2), with a relatively short intracellular domain (-440 amino acids) . This is consistent with the combined size of tryptic fragments of MC PfEMPl (210 kDa) generated from treatment of intact PE. The 2574 amino acid sequence from MC strain parasites shows extensive homology with the several sequences in a gene family. Analysis of the Swiss-Prot, NBRF-PIR and Translated GenBank (release 86) databases identifies the sequence as novel. There are 18 potential N-linked glycosylation sites. A RGD motif (amino acids 1212-1214) and a LDV motif (amino acids 142-144) that could be involved in protein-protein adhesion are evident in the sequence (Figure 2) . The deduced amino acid sequence lacked stretches of tandem repeats.
Analysis of the distribution of the 105 cysteines and other residues (Figure 2) revealed 4 domains, denoted DBL-1 through DBL 4, homologous with the Duffy antigen Binding Ligand (DBL) domains of P. vivax, P. falciparum and P. knowlesi, each containing 5 consensus motifs rich in cysteine residues (Figure 2) . Between the DBL domains there are 3 examples of another cysteine rich motif (CRM) with 3 cysteines in a 7 amino acid stretch and additional homology over approx. 45 amino acids. These domains, denoted CRM-1, CRM-2, CRM-3, share the sequence CNXKCXCX2K and are located between the different DBLs (Figure 2) . CRM-1 and CRM-2 are more closely related than CRM-3, sharing a longer motif, CX3CX3CXC, and other residues over 38-42 amino acids
(Figure 3) . Although there are 6 cysteine residues between DBL-3 and DBL-4, a CRM was absent from this region. Southern blotting of fragments of the novel genes with Eco RI or Eco RI plus Hind III digested gDNA was performed with DNA from K+C+ and K-C- MC strain parasites together with DNA from 6 other parasites of widely dispersed geographic origin and diverse adherence phenotypes (Figure 4 and Table 1). The Al fragment from the 5' end of the gene (-244-518) hybridized to DNA from all eight parasites, yielding 5-8 hybridization-positive fragments of similar size. Similar results were obtained with 3 other fragments from bp 3226-6446 (fragments El, F-a, F-b, Table 2). In contrast, fragments derived from bp 455-3768 and the 3' end (6692-8227) did not hybridize with DNA from all parasites, reacting almost exclusively with MC parasites (Figure 4B and Table 1) . Hence, the novel gene shares extreme 5' sequence and the region 3644-6446 with gDNA of diverse parasites, while the central region (nucleotides 455 to 3768) and the 3' end are significantly different between MC and other parasites. Since there is only a single Eco RI site, within fragment F, and no Hind III sites in the sequence, the presence of multiple fragments with MC K+C+ parasites indicates multiple forms of the novel gene. This is consistent with significant sequence differences in independent cDNA clones from the same parasite.
Table 2
Southern blot hybridization of DNA clones from the MC PfEMPl gene with EcoRI digested DNA of different P. -falciparum parasites.
p . falcipa— am strain/Clone
Frag. MC MC Dd2 FCR3- FCR3- ItG2- ItG2- PALO
# K+ K- C5 C6 ICAM Gl ALTO
Al + + +* + • + * + + +
Bl + + - - - +* +* -
Cl + + - - - - - -
DI + + - - - - - -
D2 + + + — - - - -
D3 + + - - - - - -
El + + + + + + + +
F-a + + + +* + * *
+* -
F-b + + + +* +* + + * + *
F-c + +* 4- - - + - -
Gl +t +t +t +t +t ♦f +t +t
* Weak hybridization ' Multiple bands
# DNA fragments Al - Gl are defined in Figure l. Fragments F-a, F-b, and F-c correspond to bp 3226-5139, 5140-6446 and 6692-8227 in the map (Figure 1) .
Southern blot hybridization was performed as in Figure 4 and experimental procedures.
Example 4- Antibodies Generated Against Recombinant Fusion Proteins Recognize PfEMPl To identify the gene corresponding to the novel cDNA, laboratory animals were immunized with RP corresponding to different parts of the cDNA. A number of recombinant proteins were were expressed as GST or MBP-fusions in E . coli (Figure 1). The RP (rAl[3-158] , rBl[161-385] , rCl-l[402-605] , rCl-2[576-808] , rCl-2[1-179]-MC, rCl-2 [1-179]-"ItG" , rCl-2[l- 179]-"HB3", rDl[818-1003] , rD2 [982-1320] , rFl-1 [ 1300-1707] , rFl-3[2171-2450], rGl[2550-2794] , rD3 [992-1243] , rEl-l[1219- 1471], rEl-2[1454-l719] ) were readily purified and used for immunization in either rats, rabbits or goats (See Tables 8 and 9, below) .
Sera were screened for immunoprecipitation of 125I-protein from SDS extracts of PE containing mature asexual stages of MC K+ parasites, immunoprecipitation of labeled fragments cleaved from the surface of iodinated PE (MC K+) by mild trypsinization (Figure 23) . A high molecular weight 1 5I-protein was immunoprecipitated by sera from several animals immunized with rCl-2 but not by pre-immune sera (Figure 5A) . Rat anti-rCl-2 antibodies immunoprecipitate a 90 kd tryptic fragment (TF90) also immunoprecipitated with Aotus anti MC specific sera. The same fragment was affinity purified with immobilized CD36 but not by other immobilized host receptors. The fragment TF125 affinity purified with TSP was immunoprecipitated by antibodies to rDl, rFl-l and rFl-3 (See Table 9 and Figure 23) . This is a further indication that the TSP binding domain may be contained on the region corresponding to these protein fragments. Two rabbits immunized with rDl also produced immunoprecipitating antibodies (Figure 5B and Table 9) . Sera from two rabbits immunized with rBl failed to immunoprecipitate 125I-labeled proteins.
The properties of the 125I-protein identified by the anti rCl-2 and rDl sera were identical to those of 1 5I-PfEMPl (Figure 5C) . The 125I-protein co-migrated with 125I-PfEMPl immunoprecipitated by three critical sera: a pool of human immune serum that agglutinates MC K+ PE; Aotus anti-MC K+ serum that specifically agglutinates and immunoprecipitates 125I-PfEMPl from this strain (Howard et al., 1988) and, rabbit 05-75 serum that immunoprecipitates MC strain
125I-PfEMPl (van Schravendijk et al. , supra) . The 125I-protein was not immunoprecipitated from the Triton X-100 extract of 1 5I-labeled MC PE and was destroyed by treatment of intact PE with trypsin, additional properties which define 125I-PfEMPl (Figure 5C) .
The anti-rCl-2 and rDl sera did not immunoprecipitate 125I-PfEMPl from ItG2-ICAM parasites, even though a 12SI-PfEMPl was immunoprecipitated by the pooled human sera. Hence, the anti-rCl-2 and anti-rDl sera define MC K+ strain-specific epitope(s) on 125I-PfEMPl, similar to sera from Aotus monkeys infected with this parasite (Howard et al. , 1988, supra) . To address the possibility that immunoprecipitating antibodies elicited by rCl-2 and rDl immunization cross react or result from spurious cross-reactivity, anti-rCl-2 and anti-rDl sera were preadsorbed with different GST-fusion RP and immunoprecipitation of 125I-PfEMPl repeated. Preadsorption of anti-rCl-2 serum with glutathione-Sepharose beads bearing rCl-2 completely ablated the capacity of this serum to immunoprecipitate 125I-PfEMPl, while beads bearing rDl, rBl, rA62-5, rPfEMP3 or GST itself had no effect on the immunoprecipitation (Figure 5D) . In contrast, preadsorption of anti-rDl serum with beads bering rCl-2 had no effect on immunoprecipitation, while in this case preadsorption with rDl completely ablated immunoprecipitation (Figure 5E) . This demonstrates that elicitation of the anti-PfEMPl antibodies by these two RP does not reflect cross reactivity and that GST per se does not involve the elicitation of the anti-PfEMPl antibodies. The anti-rCl-2 and anti-rDl sera independently define structural similarity between each RP and two regions of the MC K+ PfEMPl. Hence, the cDNA corresponds to part of the PfEMPl gene of the MC strain of P. falciparum. None of the sera precipitated 125I-PfEMPl from SDS or Triton X-100 extracts of surface iodinated PE from MC K- parasites. Since 1 5I-PfEMPl is absent from the surface of these non-adherent PE (Aley et al. , J. Exp. Med. (1984) 160:1585-1590), these results are consistent with the identity of the novel gene as PfEMPl.
Rabbit sera against rCl-2 were tested for reactivity on Western blotting with proteins in SDS extracts of different P. falciparum strains and clones (Figure 6) . This panel of parasites included examples with known differences in the size and antigenic specificity of their 125I-labeled PfEMPl proteins as defined by immunoprecipitation with strain-specific Aotus sera. A high molecular weight, size variant antigen was identified in many of the parasite samples but was missing from the uninfected human erythrocyte sample (NRBC in Figure 6) . The erythrocyte spectrin bands were immunoreactive with all parasites and with uninfected erythrocytes. The pre-bleed of this rabbit sera was also reactive to spectrin but did not recognized the size-variant bands. Low level cross-reactivity with Histidine rich protein 1 (HRP1) was also detected (Figure 6) . Several pieces of evidence lead to the conclusion that the size-variant antigens (200 to >300 kDa) identified by the rabbit anti-rCl-2 sera are the PfEMPl proteins of these parasites. First, the MC K+ sample exhibited a reactive band, whereas the MC K- sample exhibited little or no reactivity. Second, FVO strain showed a reactive band at approximately 205 kDa, migrating just faster than the spectrin 1.2 band. A similar size 125I-PfEMPl protein is detected with this parasite (van Schravendijk et al. , Blood (1991) 78:226-236). Third, trypsinization of intact MC K+ PE reduced the intensity of the immunoreactive band in a manner that was dependent on the dose and time of trypsinization. Fourth, FCR-3 parasite clones exhibited 2 or 3 reactive bands absent from uninfected erythrocytes with mobilities characteristic of clone C5 125I-PfEMPl. ItG2Gl, HB2, D10 and 7G8 parasites each possessed a single reactive band but with different apparent molecular weights, while ItG2-ICAM, Dd2 and PA parasites did not display a reactive band. Although the immunoreactive
PfEMPl proteins share epitopes recognized by antibodies raised against the rCl-2 portion of MC strain PfEMPl, no hybridization of the Cl DNA fragment to DNA from these parasites was found. Other parasites, including some known to possess a different form of PfEMPl, lack epitopes defined by antibodies raised against this part of the MC PfEMPl.
Example 5- Anti-PfEMPl Antibodies React With The Surface
Of PE In a Strain-Specific Manner Rabbit and rat anti-rCl-2 sera were tested by confocal fluorescence microscopy for reaction with the surface of intact, non-fixed PE. Neither of the two rabbit anti-rCl-2 sera tested were positive with MC strain PE. However, each of the four rat sera reacted by indirect immunofluorescence with the surface of MC PE (Figure 7, panels A and B, Table 2). The immunofluorescence reactivity was distributed in a speckled pattern over the entire PE surface. Fluorescence staining was observed on -80% of late-trophozoite and schizont PE.
Preimmune rat sera or rat sera to PfEMP3 (van Schravendijk et al., 1993, supra ) were not reactive. Uninfected erythrocytes and erythrocytes infected with young trophozoites or ring stages were not labeled. No reactivity was found with MC K-, ItG2-ICAM, ItG2-Gl or FCR3/C5 PE.
Sera raised against the RP listed in Example 4 and Table 9 were screened for antibody-mediated agglutination of intact PE.
Two of the four rabbit sera against rCl-2 mediated agglutination (dilution 1:5) of MC strain PE, after disruption of rosettes. 3 out of four rat anti-rDl sera agglutinated MC strain PE, after rosettes were disrupted. No agglutination was detected with rabbit anti-rDl sera. Each of the four rat sera against rCl-2 mediated specific PE agglutination (Table 2) . Agglutinates of several to hundreds of intact, mature PE were formed after incubation of infected blood with rat anti-rCl-2 sera (Figure 8) . These agglutinates closely resembled those seen with Aotus anti-MC serum (Figure 8) . Each of the rat sera collected after the first immunization with rCl-2 were agglutinating with a titer of >1:10. The extent of agglutination and titer increased after subsequent immunizations, with titers of 1:10 to >1:100 (Table 3). Uninfected erythrocytes were not present in these agglutinates, nor were preimmune sera reactive. PE from other parasites known to express an antigenically different form of PfEMPl, ItG2-lCAM and Palo Alto ("PA") were not agglutinated (Figure 8 & Table 3), although they were agglutinated by pooled human immune sera. MC K- PE were not agglutinated (Figure 8 & Table 3). The initial failure of ItG2-ICAM and MC K- PE to be agglutinated by the anti-rCl-2 sera correlates with the failure of such sera to immunoprecipitate 1 5I-PfEMPl from these parasites. However, later bleeds (e.g., >day 195) of rat #1 anti rCl-2 and at least one of rat anti-rDl agglutinated PE of different strains. These sera agglutinated PE of strain MC R+, ItG2-F6 and ItG2-ICAM, with some cross-reactivity with strain Palo Alto (See Table 9) , but did not agglutinate PE of strains MC R-, ItG2-Gl or Dd2. These results indicate that PfEMPl contains antigenic epitopes that are cross reactive in some, but not all strains.
Table 3 Agglutination of PE with sera containing anti-PfEMPl antibodies.
PARASITE STRAIN
MC K+ ItG- ICAM MC K-
SERUM AGGL.a TITER AGGL.a TITER AGGL.a TITER human immune pool 4+ 125 4+ 125 0 —
Aotus anti MCK+ 4+ 125 0 — 0 — (9050)
Aotus anti MCK- 0 — ND ND 0 (7925) —
Rat #1 anti rCl-2 4+ >100 0C 2+d 0 —
Rat #2 anti rCl-2 3+ 20 0 l+d 0 ——
Rat #3 anti rCl-2 1+ 10 0 l+d 0 —
Rat #4 anti rCl-2 3+ 20 0 l+d 0 —
Rats #1-4 0 — ND ND ND ND prebleed a. Semi-quantitative agglutination score at 1:5 serum dilution: 0, no agglutination; 1+, 10 or more agglutinates of <20 PE; 2+, 10 or more agglutinates of 20-50 PE; 3+, 10 or more agglutinates of 100-200 PE; 4+, 10 or more agglutinates >200 PE. b. Reciprocal of maximum serum dilution at which PE agglutination was observed. c. Few, very small agglutinates (less than 1+) were detected at dilution of 1:5 d. Agglutination score of sera of day >195. ND: Not determined.
Rat sera tested, were found to be active from second immunization and with monthly boosters, were also reactive beyond day 200. Immunoelectronmicroscopy was performed to localize the reactivity of the anti-rCl-2 antibodies on the PE surface. Treatment of intact MC K+ PE with rat anti-rCl-2 antibodies followed by gold-conjugated goat anti-rat IgG yielded deposition of gold particles on the PE outer membrane (Figure 9) . Up to 30% of schizont stage PE were positive. The deposition of gold particles was confined to knobs (Figure 9) , with 50-70% of the knobs labeled. Gold particles were not deposited after treatment with control sera or rat anti-PfEMP3 serum. No binding was detected with ItG2-ICAM, MC K- PE or uninfected erythrocytes. PfEMPl, as defined by the anti-rCl-2 sera, is therefore localized on the surface membrane of PE at know protrusions.
Rat anti-rCl-2 antibodies react specifically with the surface of mature asexual PE. In all tests for surface reactivity, these antibodies react exclusively with MC stain K+ PE, congruent with immunoprecipitation of 125I-PfEMPl exclusively from these parasites.
Example 6- Anti-PfEMPl Antibodies Block Adherence Of PE To CD36 But Not To TSP
To test serum-dependent inhibition of PE adherence, PE were preincubated with test serum before adding the mixture to plastic dishes coated with CD36 or TSP. Rabbit sera raised against rBl, rCl-2 and rDl had no effect on PE adherence to TSP or CD36, even at 1:5 dilution (Table 4). Rat sera to rBl and rDl had no effect on PE adherence to CD36 or TSP. In contrast, each of the 4 rat sera raised against rCl-2 blocked adherence of MC K+ PE to CD36 but had no effect on adherence to TSP (Figure 10) . In further experiments, rat and goat sera raised against rCl-2[576-808] , and rat sera raised against rCl-2[1-179]-MC blocked PE adherence to CD36 (Table 9). The extent of inhibition at 1:5 serum dilution ranged from 15-60%. By comparison, Aotus anti MC K+ sera inhibited 15% dilution. In some experiments the preimmune rat sera had an inhibitory effect of 10-30% at 1:5 dilution, with <10% inhibition at dilutions of 1:10 or greater (Figure 11). The inhibitory effect of preimmune sera was eliminated or markedly reduced by dialysis. This had no effect on inhibition mediated by immune rat sera. Each of the rat sera raised against rCl-2 inhibited adherence to CD36 in a dose-dependent manner. The results for the most potent rat serum (serum #1) (Figure 11) show blockade of adherence titratable to 1:100 dilution with significant inhibition over the preimmune control. At 1:10 dilution, dialyzed sera from three rats inhibited 27-64%, while dialyzed preimmune sera were without effect (Table 3) . Another control rat serum, anti-PfEMPl, raised against an unrelated GST-malarial fusion protein, had no effect on adherence. None of the rat anti-rCl-2 sera, (dilution > 1:10), blocked adherence of ItG2-ICAM, PA K-C+ or ItG2Gl PE to CD36. These results further demonstrate that the anti-rCl-2 are specific for interaction with the surface of MC K+ PE and support the idea that PfEMPl mediates adherence of PE to CD36.
Example 7- Binding of CHO-CD36 cells to Recombinant rCl-2 Fusion Protein
Antibodies to rCl-2 block adherence of PE to CD36 in a strain specific manner, but do not effect the binding to thrombospondin, thus identifying rCl-2 as the possible binding domain of MC PfEMPl for CD36. To test if recombinant protein rCl-2 mediate adherence to CD36, CHO, CHO-CD36 or CHO-ICAM cells were incubated with immobilized recombinant proteins derived from different parts of the MC PfEMPl gene. CHO and CHO-ICAM cells did not bind to any of the RPs tested. CHO-CD36 cells bound specifically to rCl-2 (130 cells/mm2) , but did not bind to rBl or rDl derived from the MC PfEMPl gene, rA62-5 of the A62 clone or GST alone (See Figure 13) . The binding of CHO-CD36 cells to rCl-2 was concentration dependent and reaches apparent saturation at RP concentrations of approx. 100 μg/ml with a maximum binding of about 250 cells/mm2 at 200 μg/ml (see Figure 15) . No binding of CHO or CHO-ICAM cells to rCl-2 was apparent at the highest concentration tested.
Example 8- Binding of CD36 to rCl-2 The binding of CD36 to different RP was tested with a modification of the RCPR assay, described above. GST-fusion proteins were immobilized to protein-G Sepharose beads, coated with anti-GST MAbs (MAb 141.4) . The immobilized fusion proteins were then incubated with the pig-tailed, soluble host cell receptors. Bound receptors were detected with MAb 179 using ECL western blotting. CD36 was affinity purified using immobilized rCl-2 and did not bind to immobilized rAl(3-i58), rBl(l61-385) , rCl-l(402- 605), rDl(818-1003) , rFl-1(1300-1707) , rFl-2 (1688-2190) , rFl-3(2171- 2450), rGl(2550-2794) or the MCvar-2 specific recombinant proteins rD3(992-1243) , rEl-1(1219-1471) and rEl-2 (1454-1719) or to the RP fusion partner, GST.
Example 9- rCl-2 Blocks Adherence of PE to CD36 Antibodies to rCl-2 were shown to selectively block and reverse adherence of PE of the MC strain, in a strain specific manner. However, MAbs which bind CD36 have been shown to block all strains tested. As rCl-2 binds directly to CD36, it was then tested for its ability to block the binding of PE from other parasite strains. rCl-2 was preincubated with immobilized CD36 before the addition of PE containing the same concentration of RP. Four different parasite strains of diverse geographic origin, adherence phenotypes and knob expression were tested. These strains also express a serologically distinct PfEMPl molecule as shown by agglutination and other assays, as described. At lOOμg/ml RP, rCl-2 blocked adherence of PE from all four strains by upwards of 75-98% (See Figure 16) . The four strains included in Figure 16 were MC R+ (solid bars) , clone ItG2-ICAM (hatched bars) , clone ItG2-Gl (grey bars) and clone Palo Alto K+ (open bars)). Other strains tested included MC R-, ItG2-F6, FCR3-C5, Palo Alto (K-) and Dd2. rCl-1 blocked adherence in each case, indicating that blockade of adherence by rCl-2 is not strain specific. None of the other RP tested had any effect on adherence to CD36 by PE of other strains, except for a small effect (15-20%) of rDl on adherence of PE of strain ItG2-ICAM. Blockade of PE adherence to CD36 by rCl-2 was concentration dependent with an IC50 (50% reduction in cell adherence) ranging from 0.3 μM (15 μg/ml) to 1 μM (53 μg/ml) (see Figure 18) . Blockade of adherence of strain ItG-ICAM was almost identical to blockade of adherence of strain MC (see Figure 17) . rCl-2[1-179] blocked adherence with an IC50 of 0.78 μM (See Figure 24). These results demonstrate that although the CD36 binding region of different strains may be serologically distinct, they bind the same region of CD36, and this binding may be blocked by rCl-2. rCl-2 [1-179] reversed adherence of PE to CD36 with an approximate IC50 of 0.5 μM (See Figure 25) .
Example 10- Structure-Function Analysis of the CD36 Binding Domain of PfEMPl
To locate the minimal fragment of rCl-2 that binds CD36, and to identify the region in the rCl-2 RP which is important for binding, deletion mutants of RP rCl-2 were generated as described in Example 1(N), and their interaction with CD36 was tested. Deletion mutants were generated by PCR techniques known in the art, and as described herein. The mutants were immobilized on MAb 141.4 coated protein G sepharose beads, directly from the bacterial lysate. The binding of CD36 to the immobilized RP was tested with the RCRP assay (See Figure 19, and summarized in Table 5). Of those fragments tested, the smallest to retain the ability to bind CD36 was the 1- 179 fragment. The 1-140 fragment did not bind to CD36, indicating that features important to binding of CD36 may lie within the segment including amino acids 140-179. Additionally, mutants 25- 179, 25-192 or 11-179 did not bind CD36. The first 30 amino acids of rCl-2 are also expressed in rCl-l which did not bind CD36. Thus, amino acids 1-10, 1-25 and 140-179 appear to be important, in combination, for CD36 binding. The possibility of other important regions located between these regions cannot be excluded. SDS-PAGE of rCl-2 under reduced and nonreduced conditions show a shift in mobility of the RP, indicating the possible existence of at least one disulfide bond. Replacement of cysteines 159 and 168 by serine, either together or separately, resulted in a reduction in the ability of the 1-179 fragment to bind CD36. However, all three separate mutations (cys-159-ser, cys-168-ser, and cys-159-ser in combination with cys-168-ser) retained some ability to bind CD36. These results are shown in Table 4, below.
In addition, each of the 5 cysteines at the 51 region of rCl-2 [1-179], CRM1 region, was replaced with a serine as described before. The binding of CD36 to the corresponding fusion protein is also described in Table . Table 4
Binding of CD36 to Immobilized Fragments of rCl-2
Figure imgf000070_0001
N/A=Low expression of RP. Reduction of rCl-2, followed by alkylation with iodoacetamide was associated with lower mobility on SDS-PAGE and no binding of CD36 (Table 4). Without alkylation, the protein refolded and bound CD36 (Table 4) . Thus, binding of rCl-2 to CD36 appears to require a defined shape and is not entirely promoted by a simple linear sequence.
Example 11- Regions Homologous to rCl-2 Amplified from Other P. falciparum Strains Using the primers derived from different parts of rCl-2,
PCR products were generated from different P . falciparum strains. Primers corresponding to amino acids 1-233 and 1-179 as well as the universal primers gave PCR products from P. falciparum DNA only and failed to produce a product from the DNA of P. cynemolgi , P . fragile , P. caotnyi or P . knowlesi . The 1-233 fragment (complete rCl-2) was amplified only from MC strains of P. falciparum (K+C+R+, K+C+R-, K-C-R-) , and not from the other strains tested. The 1-179 fragment gave PCR products from ten of eleven strains tested, and only failed to react with the Dd2 strain. Identical results were obtained when the fragments corresponding to 53-179, 53-140, 1-140 and 1-59 fragments were amplified. These strains and clones have different knob and adherence properties and express size and antigenically diversed PfEMPl molecules. The PCR products amplified from the different strains appeared to be of similar size. That PCR product was generated among a variety of strains using primers corresponding to fragments 1-59 and 140-179 as well as the universal primers, indicates conservation of the sequences in these regions and also the apparent importance of these regions in ligand binding. The universal primers similarly gave products from gDNA and cDNA, first strand (RT-PCR) of all strains tested.
The binding of CD36 to immobilized GST-fusion proteins derived from the different P . falciparum strains is summarized in Table 5.
The alignment of the sequences obtained with the 1-179 primers from gDNA and from expressed vars (cDNA and RT-PCR) shows the 5'-end of the molecule (residues 1-78) and the 3 *-end of the molecule (residues 140-180) are the more conserved part of the molecule (Figure 20) . This conclusion is supported by the alignment of the sequences obtained with the universal primers (Figures 20 and 21) . Within these regions there are many residues that are identical in substantially all strains. These sequences are indicated as single amino acids in the consensus sequence shown in Figures 20 and 21. Some sequences show limited substitution of conserved sequences. These amino acid sequences are also indicated on the consensus alignment sequence. Accordingly, it appears that conserved, highly conserved and semi-conserved amino acids are important for the structure and function of CD36 binding domain, and can be used to model additional sequences with similar binding potential. The region of residues 80-140 is more degenerate and shows much less conservation. From this region, three types of sequences are apparent (See Figure 20) . The first is the MC type including the three MC sequences MC R+ (cDNA and gDNA) , MC R- and MC K-. The second is the "ItG" type that includes the gDNA sequences of strains FCR3-C5, FCR3-C6, ItG2-F6. ItG2-Gl, ItG2-ICAM and Palo Alto and the cDNA sequence of FVO. The third group, named "HB3" contains the gDNA sequence of HB3 and the cDNA sequences of FCR-C5 and ItG2-F6. The binding of CD36 to immobilized rCl-2[1-179] polypeptides derived from the gDNA sequence of several different strains of P. falciparum is shown in Table 5. The alignment of these sequences was used to identify and prepare conserved degenerate universal oligonucleotides to PCR and identify different sequences corresponding to rCl-2 [10-151] from all P . falciparum strains and isolates.
With the universal primer sets unil79-5' and unil79-3 ' , 12 out of 12 strains tested (MC R+, MC K-, MC R-, Dd2, FCR3-C5, FCR3- C6, HB3, ItG2-F6, ItG2-Gl, It-ICAM, Palo Alto and cDNA of FVO and MC R+) produced a PCR product of similar size. The PCR results indicated that more than one product was produced in many preparations. Some of the obtained sequences were almost identical or very similar to the sequence obtained with the 1-179 primer set. However, other clones differed from those obtained with the 1-179 primers. The sequence of the Dd2 strain was almost identical to the published sequence of the Dd2 var-7 gene (Su et al. , supra). The cysteines of CRM-1, locaated at the 30-55 region of the alignment are conserved in all strains. However, some sequences show different spacing between the cysteines and are of the form of CIN(D)X6_7CI(K)X2_4CX2K(D)CXCF. Additionally, conserved sequences are found from position 10 (FWXWVXXMLXDS*XWR(K) and the sequence in the region of residue 140 (i.e., TTIDK(X)LXH. Additional conserved amino acids are found at different locations of the alignment (Figures 20 and 21) . The above data demonstrate that the unil79 primer sets are very useful tools for obtaining and identifying that portion of the rCl-2 [1-179] region involved in adherence to CD36 from different strains of P . falciparum . These universal primers have been effectively used to amplify sequences from every strain tested. The PCR products of the universal primers can also be used to identify and make fingerprints from strains, clones or isolates of P. falciparum . In particular, the PCR products originating from a particular sample can be labeled according to known labeling methods (e.g. , those described herein) and separated on a sequencing gel apable of separating large fragments (i.e., >500 bases) that only differ in size by one or two nucleotides. This method can also detect changes in the expressed var by RT-PCR similar to Smith et al. Some such changes may be related to phenotypic changes in the adherence properties of the PE.
a le 5
P. falciparum Strain Binding to CD36
MC R+ (cDNA derived) +++
MC R+ +++
MC R- +++
MC K- +++
ItG2-Gl +/-
ItG2-F6 +/-
ItG2-ICAM +/-
FCR3-C5 +
FCR3-C6 +/-
HB3 +/-
PA FVO (cDNA derived)
Fusion proteins derived from the MC strain showed strong binding to CD36. Recombinant proteins derived from sequences of other strains had little or no detectable binding to CD36. This was true for proteins derived from the expressed var gene of adherence positive strains (FVO, ItG2-F6 and FCR-C5) as well for recombinants derived from gDNA sequences. This results from inappropriate folding of the recombinant protein in the bacterial host, as the protein contains 7 cysteine residues.
Chimeric proteins were prepared which were composed in part from the sequence of the strong CD36 binding recombinant protein of the MC parasites complemented with a sequence from week or non-reactive rCl-2 [1-179] clones. Six chimeric proteins were prepared and tested for binding of CD36 (Table 6) . One of these chimeric proteins MC R+/ItG2-F6 had substantial binding (about 50% of the binding of MC R+ rCl-2 [1-179]). Several other proteins including MC R+/HB3, MC R+/FCR3-C5 and FCR3-C5/MC R+ had lower binding activities. The positive binding of the chimeric MC
R+/ItG2-F6 recombinant protein indicates that the rCl-2 [1-179] is involved with binding to CD36 and that the inability to obtain high- binding recombinant proteins from strains other than MC is most likely due to incorrect folding of these recombinant proteins in E. coli. This procedure is particularly imortant for sequences generated with the universal primers since these sequences lack the two 3' cysteine codons which are important for binding. The above chimeric protein clone, with a 5' portion from a universal primer and a 3' clone from one of the rCl-2[1-179] sequences will have the 3' cysteines important for its function.
Table 6
Chimeric Recombinant Protein Binding of CD36 (5' / 3' sequence)
HB3/MC - ItG2-F6/MC -
FCR3-C5/MC +/-
MC /HB3 +/-
MC/ItG2-F6 +++
MC/FCR3-C5 +
In an effort to overcome possible folding problems, expression was also tested in eukaryotic expression systems. rCl- 2[1-179] ("MC") transiently expressed on the surface of COS-7 cells bound to CD36. The rCl-2[1-179]-ItG construct did not bind to CD36 while the HB3 construct showed very low level expression. The results of these expressions are shown in Table 7, below.
Table 7
Properties of rCl-2 [1-179] Expressed in Eukaryotic Expression Sytems
Figure imgf000075_0001
cleaved product. However, expression of the rCl-2[1-179] ("FVO") sequence with a terminal six histidine tag in yeast produced a correctly folded protein that bound to CD36 and blocked 50% adherence (IC50)of MC PE to CD36 at 50 μg/ml and gave 70% blockage at 100 μg/ml. The rCl-2[1-179] "MC" product appeared to be proteolytically cleaved and did not bind CD36 or block adherence of PE. Thus, the recombinant rCl-2[1-179] region from two different P . falciparum parasites was shown to mediate adherence of PE to CD36.
VI. Summary of Results
PfEMPl has been attributed the dual properties of antigenic variation on the surface of P. falciparum parasitized erythrocytes ("PE") , and receptor properties of adherence to host proteins on microvascular endothelial cells. For a review of these findings, see, e.g., Howard and Gilladoga, (1989), and Pasloske and Howard, (1994) , supra . PfEMPl is therefore at the crux of understanding the molecular pathogenesis of P . falciparum malaria insofar as it involves antigenic variation and evasion of antimalarial immunity, as well as PE sequestration and the consequent vascular obstruction. The molecular basis for these phenomena has languished however since repeated attempts to clone PfEMPl have failed.
Several independent criteria establish that the genes described herein encode the PfEMPl protein of K+ MC strain P . falciparum . The relevant results are summarized in Tables 8 and 9.
Table 8
Properties of antisera against PfEMPl recombinant fusion proteins-a
Immunogenb Species PfEMPl PE PE Blockade immuno-pptc aggl.d IFAe of PE adherencef rBl(161- rabbit 0/2 0/2 NDg 0/2 385) rCl-2 rabbit 3/4 2/4h 0/2 0/4 (576-808) rCl-2 rat 4/4 4/41 4/4 4/4 (576-808) rDl (818- rabbit 2/2 0/2 ND 0/2 1003) rDl (818- rat ND 3/4^ ND 0/2 1003) a. Results shown as [number of antisera scoring positive for property]/[number of animals immunized]. b. GST fusion proteins corresponding to fragments of MC K+ PfEMPl. c. Immunoprecipitation of 125I-PfEMPl from SDS-extract of MC K+ PE. d. Agglutination at 1:5 dilution of intact mature stage PE of MC K+ PE. e. Indirect immunofluorescence with intact non-fixed MC K+ PE. f. Blockade of adherence of MC K+ PE to immobilized CD36 at 1:5 serum dilution. g. ND: not determined. h. Agglutination was detected after disruption of rosettes. i. Agglutination was observed with sera of day >195 of PE from strains MC, ItG-ICAM and ItG2-F6. j. Agglutination was observed after disruption of rosettes.
Agglutination was observed for parasitized erythrocytes of
MC R+ and ItG-ICAM and ItG2-F6 strains.
Rat sera tested, were found to be active from second immunization and with monthly boosters, were also reactive beyond day 200.
Table 9 Properties of antisera against PfEMPl recombinant fusion proteins
Figure imgf000078_0001
Table 10
Properties of antisera against PfEMPl recombinant fusion proteins
Figure imgf000079_0001
rEl- GST rat 1/4
1[1219-
1471] rEl- GST rat 1/4
2[1454-
1719]
Some sera tested did not agglutinate PE from strains MC R-, itG2-Gl, FCR3-C5, Dd2, D10 and HB3. PE from strain ItG2-F6 were agglutinated by normal rat sera and thus could not be tested.
PfEMPl, as identified by immunoprecipitation of 125I-labeled PE surface proteins, has been shown to be antigenically diverse with different parasite strains and clones (Leech et al. , J . Exp. Med . (1984) 159:1567-1575); Howard et al. , (1988), supra ; Schravendijk et al. , (1991), supra ; Biggs et al. , J . Immunol . (1992) 149:2047-2054). Antibodies generated in multiple animals by immunization with RP derived from two different parts of the cDNA immunoprecipitate 125I-PfEMPl only from MC strain PE and failed to immunoprecipitate PfEMPl from the PfEMPl bearing PE of strain ItG2- ICAM. The 1 5I-immunoprecipitated protein was defined as PfEMPl by its molecular size, specific detergent extraction properties and sensitivity to low levels of trypsin (Aley et al., (1984); Leech et al., J. Exp. Med . (1984) 159:1567-1575; Howard et al. , (1988), supra) . Competition experiments with the two recombinant proteins ("RP") proved that the capacity of these anti-recombinant sera to immunoprecipitate 125I-PfEMPl was not due to the presence of a cross-reactive epitopes on these immunogens. Western blotting with different strains and clones indicated that the anti rCl-2 serum was reactive with variable size bands, including some which show migration similar to 1 5I-PfEMPl from these strains (Howard et al. , (1988), supra; van Schravendijk et al. , (1991), supra) . However, much more cross-reactivity is apparent among fully unfolded PfEMPls, as with Western blotting, than among the native proteins.
Second, since PfEMPl is expressed as a variant protein on the PE surface (Howard et al., Molec . Biochem . Parasitol . (1988) 27:207-223; van Schravendijk et al., (1991), supra; Roberts et al., Nature (1992) 318:64-66), sera raised against the RP should react in a strain-specific manner with the surface of intact PE. Rat anti-rC21-2 sera reacted with the surface of intact MC K+ PE by mediating specific agglutination, by indirect immunofluorescence and by immunoelectronmicroscopy. This reactivity was specific to MC K+ strain and was not evident with any other strain including the MC K- strain known to lack surface-exposed PfEMPl (Aley et al. , (1984)). However, sera raised to rDl showed cross-reactive agglutination of PE from several strains (MC R+, ItG2-ICAM and ItG2-F6) but not other strains (MC R-, ItG2-Gl, Palo Alto, FCR3-C5 and Dd2) . The same was observed with rat serum to rCl-2 of dat >195. Agglutination of PE from several strains (but not all) by rat serum to rDl or serum to rCl-2 of day >195 suggests the expression of cross-reactive epitopes of PfEMPl on the PE surface and that these epitopes normally do not elicit antibodies during natural course of infection in monkeys or humans. These cross-reactive epitopes may be limited to a subset of PfEMPl variants. Human sera from an adult subject living in an endemic area, eluted from the surface of PE, has been shown to agglutinate PE of several strains (Marsh and Howard, Science (1986) , supra) , which raises the possibility that cross-reactive epitopes can be expressed on the surface of PE of different isolates. The surface accessibility of these and other epitopes of PfEMPl can be greatly reduced by the formation of rosettes, as demonstrated by the increase in PE agglutination by anti-PfEMPl sera, upon disruption of rosettes. Thus, formation of rosettes may confer an advantage to the parasite by reducing the accessibility of antibodies to the surface of the PE. Reactivity of these anti-PfEMPl antibodies on immunoelectronmicroscopy was restricted to the knob protrusions on PE, in agreement with earlier studies that demonstrated specific binding of isolate-specific antibodies to knobs (van Schravendijk et al., (1991), supra, and specific binding of CD36 and TSP to knobs (Nakamura et al. , J. JJistochem. Cytochem . (1992) 40:1419-1422).
Finally, PfEMPl has been associated with the property of adherence of PE to CD36 and other endothelial cell surface proteins (Howard and Gilladoga, (1989), supra) . Sera raised against rCl-2 specifically blocked PE adherence to CD36. The ability of sera to block adherence of PE was generally correlated with agglutination of the same PE (Howard et al. , (1988), supra ; Iqbal et al. , Trans . R . Soc . Trop. Med . Hyg . (1993) 87:583-588). The results obtained with the anti rCl-2 sera support and verify these observations. Furthermore, the RP, rCl-2 binds to CD36 and blocks and reverses the adherence of several strains to CD36. These results prove that PE binding to CD36 is mediated by PfEMPl.
Analysis of the MC PfEMPl sequence would predict that each cDNA clone would hybridize to a single band of Eco RI or Eco RI/Hind III digested DNA. In contrast, hybridization to more than one band was apparent with every clone, indicating more than one gene copy in the parasite genome. This is supported by the data showing two variants of the MC strain PfEMPl gene. Thus, P. falciparum parasites have a family of PfEMPl genes that constitute shared and diverse sequences. PfEMPl displays antigenic variation with extremely high frequency (Roberts et al., (1992), supra). Antigenic switching is apparently associated with expression of a different PfEMPl gene. Thus, antigenic differences in the PfEMPl extracellular domains, a property expected from the earlier serology (Marsh and Howard, Science (1986) 231:150-153; Aguiar et al., (1992), supra ; Iqbal et al. , (1993), supra) and immunochemical studies (Leech et al., J. Exp. Med. (1984) 159:1567-1575; Howard et al. , (1988) , supra) , derive from these sequence differences. Within the protein, large domains can be identified with clear homology to the Duffy Binding Ligand domains characteristic of EBA-175 and DABP. The MC PfEMPl sequence possesses four of these domains, defined by particular sequence motifs. In view of the known property of the DBL domains to participate in the binding of merozoite surface proteins to erythrocyte proteins (Chitnis and Miller, J . Exp. Med . (1994) 180:497-506), it might be anticipated that these domains represent the regions responsible for adherence of PfEMPl to CD36, TSP and other proteins expressed on endothelial cells. The rCl-2 RP which elicited adherence-blocking antibodies lacked any portion of the DBL domains but included the CRM-1 cysteine-rich motifs. The cysteines in this CRM-1 motif, CX3CX3CXC are conserved among different strains. Although the amino acid motif CX3CX3CXC occurs in only a small number of animal proteins, including human von Willebrand's Factor as well as in numerous plant protein sequences, it is not identified with any specific structural or biologic function. Also of potential relevance to the adherence properties of PfEMPl was the observation of an RGD motif and an LDV motif , both associate with protein-protein interaction and cells attachment (for review, Kuhn and Eble, Trends Cell Biol . (1994) 4:256-261) . These motifs occur in some PfEMPl sequences but not in others. One of the MC K+ PfEMPl sequences includes a RGD motif, while the PfEMPl variant sequence represented by the D3-E1-CDNA lacked this motif. The appearance of such motifs in only some of the PfEMPl genes may explain the extraordinary diversity and plasticity of PE adherence phenotype.
Antibodies to rCl-2 block PE adherence to CD36 but not to TSP. In separate studies it has been demonstrated that different tryptic fragments of 125I-PfEMPl released from the surface of MC K+ PE bind to TSP and CD36, suggesting that these receptor properties reside in different parts of the PfEMPl protein. The capacity of anti-rCl-2 serum antibodies to immunoprecipitate the same tryptic fragment affinity purified by CD36 and not with TSP and to block and reverse adherence to CD36 but without effect on adherence to TSP is consistent with these observations. rCl-2, encoded by clone Cl, specifically bound to CD36, and not to other host cell receptors, including TSP and ICAM-l. This RP also blocked the adherence of PE to CD36, but did not effect binding to TSP. In contrast to the strain specific blockade of adherence shown by rCl-2 sera and other blocking anti-PE sera, rCl-2 itself, blocked adherence of PE from four separate strains to CD36, indicating that different P . falciparum strains bind to the same region (139-155) of CD36. Structure function analysis of rCl-2 reveals a binding fragment consisting of amino acids 1-179. Within this fragment, the first 25 amino acids appear to be important for binding. The cysteines at positions 159-168 also appear to be important for binding, indicating an important tertiary structure. The CRM-1 region, conserved in several strains, as well as the region defined by residues 140-179 also appear to have some role in the structure or binding activity. Conserved residues among different var genes (figs. 20 and 21) appear to be important to the structure and function of the CD36 binding domain of P. falciparum parasites
Solubilized PfEMPl has also been found to bind CD-36, TSP or ICAM-l. Similarly, tryptic fragments cleaved from PE surface bind to CD36 and TSP. This and other data, above, confirms that PfEMPl is responsible for both the antigenic variation and receptor properties on PE, which are central to the special virulence and pathology of P. falciparum .
While the foregoing invention has been described in some detail for purposes of clarity and understanding, it will be clear to one skilled in the art from a reading of this disclosure that various changes in form and detail can be made without departing from the true scope of the invention. All publications and patent documents cited in this application are incorporated by reference in their entirety for all purposes to the same extent as if each individual publication or patent document were so individually denoted.

Claims

83 WHAT IS CLAIMED IS:
1. A substantially pure polypeptide, comprising a PfEMPl protein or a biologically active fragment or analogue thereof.
2. The polypeptide of claim 1, wherein the polypeptide comprises an amino acid sequence which is substantially homologous to an amino acid sequence shown in Figure 2, a biologically active fragment or analogue thereof.
3. The polypeptide of claim 2, wherein the polypeptide comprises an amino acid sequence which is substantially homologous to amino acids 576 through 755 of the amino acid sequence shown in Figure 2.
4. The polypeptide of in claim 3, wherein the polypeptide comprises an amino acid sequence which is substantially homologous to amino acids 576 through 808 of the amino acid sequence shown in Figure 2.
5. The polypeptide of claim 1, wherein the polypeptide further comprises a heterologous protein fused to said amino acid sequence substantially homologous to the amino acid sequence of PfEMPl, or biologically active fragment thereof.
6. A substantially pure polypeptide, said polypeptide comprising an amino acid sequence encoded by a nucleic acid sequence that is capable of hybridizing with at least one oligonucleotide in a mixture of oligonucleotides wherein each oligonucleotide in said mixture comprises a general nucleotide sequence:
ACX6ACA ATT GAT AAA X7TX8 CTX9 ^X^ CAC GAA
where X6 is selected from C and T, X7 is selected from T and A, X8 is selected from G and A, X9 is selected from C and A, X10 is selected from C and A and Xl is selected from T and A.
7. A substantially pure polypeptide, said polypeptide comprising an amino acid sequence that may be encoded by a nucleic acid sequence that is capable of hybridizing with at least one oligonucleotide in a mixture of oligonucleotides wherein each oligonucleotide in said mixture comprises the general nucleotide sequence:
TTT TTT TGG *12 X 13 \4 TGG GTX15 X16X17X18 XιgAX20 ATG TTA
where X12 ^s selected from G and A, X13 is selected from A and T, X14 is selected from G and T, X15 is selected from A and T, X16 is selected from of T, A and C, X17 is selected from A and C, X18 is selected from of T and C, X19 is selected from G and C and X20 is selected from T and A.
8. A substantially pure polypeptide, said polypeptide comprising one or more of general amino acid sequences:
TTIDKX1LX2HE; and FFWX3X4VX5X6ML
where Xx is selected from leucine or isoleucine, X2 is selected from glutamine and asparagine, X3 is selected from methionine, lysine and aspartic acid, X5 is selected from histidine, threonine and tyrosine and X6 is selected from aspartic acid, glutamic acid and histidine.
9. The polypeptide of claim 8, said polypeptide comprising an amino acid sequence substantially homologous to an amino acid sequences selected from the group consisting of an amino acid sequence of rl79 MC K+R+, rl79 MC K-, rl79 MC R-, rl79-C5, rl79-C6, rl79-ItG F6, rl79-ItG 2G1, rl79-ItG ICAM, rl79 PA and rl79- HB3 as shown in Figure 20.
10. An isolated nucleic acid, said nucleic acid comprising at least about 15 contiguous nucleotides and encoding a PfEMPl protein or a biologically active fragment thereof.
11. The isolated nucleic acid of claim 10, wherein the nucleic acid encodes an amino acid sequence which is substantially homologous to amino acids 576 through 755 of the amino acid sequence shown in Figure 2.
12. The isolated nucleic acid of claim 10, wherein the nucleic acid encodes an amino acid sequence which is substantially homologous to amino acids 576 through 808 of the amino acid sequence shown in Figure 2.
13. The isolated nucleic acid of claim 10, wherein the nucleic acid comprises at least 15 contiguous nucleotides from the nucleotide sequence shown in Figure 12.
14. The isolated nucleic acid of claim 10, wherein the nucleic acid comprises at least 50 contiguous nucleotides from the nucleotide sequence shown in Figure 12.
15. The isolated nucleic acid as recited in claim 10, wherein the nucleic acid comprises a nucleotide sequence which is substantially homologous to the nucleotide sequence shown in Figure 12.
16. An isolated nucleic acid, said nucleic acid comprising at least about 15 contiguous nucleotides and being capable of hybridizing to at least one oligonucleotide from a mixture of oligonucleotides wherein each oligonucleotide in said mixture comprises a general nucleotide sequence:
ACX6ACA ATT GAT AAA X7TX8 CTXg X10AX11 CAC GAA
where X6 is selected from C and T, X7 is selected from T and A, X8 is selected from G and A, X9 is selected from C and A, X10 is selected from C and A and XllL is selected from T and A.
17. An isolated nucleic acid, said nucleic acid comprising at least about 15 contiguous nucleotides and being capable of hybridizing to at least one oligonucleotide from a mixture of oligonucleotides wherein each oligonucleotide in said mixture comprises a general nucleotide sequence :
TTT TTT TGG X12 ι3 i TGG GTX15 X16X17X_.8 Xι9AX20 ATG TTA
where X12 is selected from G and A, X13 is selected from A and T, X1 is selected from G and T, X15 is selected from A and T, X16 is selected from of T, A and C, X17 is selected from A and C, X18 is selected from of T and C, X19 is selected from G and C and X20 is selected from T and A.
18. The nucleic acid of claim 17, wherein said nucleic acid encodes a polypeptide comprising an amino acid sequence selected from the group consisting of an amino acid sequence of rl79 MC K+R+, rl79 MC K-, rl79 MC R-, rl79-C5, rl79-C6, rl79-ItG F6, rl79-ItG 2G1, rl79-ItG ICAM, rl79 PA and rl79-HB3 as shown in Figure 20.
19. A nucleic acid probe, said probe comprising a general nucleotide sequence:
ACX6ACA ATT GAT AAA X7TX8 CTX9 XJQAXJ^ CAC GAA
where X6 is selected from C and T, X7 is selected from T and A, X8 is selected from G and A, X9 is selected from C and A, X10 is selected from C and A and Xια is selected from T and A.
20. The nucleic acid probe of claim 19, wherein said probe is capable of hybridizing with a nucleic acid which encodes a PfEMPl polypeptide or biologically active fragment thereof.
21. A nucleic acid probe, said probe comprising a general nucleotide sequence:
TTT TTT TGG X12 i3 i4 TGG GTX15 X_.6X17X1B ι9AX20 ATG TTA
where X12 is selected from G and A, X13 is selected from A and T, X14 is selected from G and T, X15 is selected from A and T, X16 is selected from of T, A and C, X17 is selected from A and C, X18 is selected from of T and C, X19 is selected from G and C and X20 is selected from T and A.
22. The nucleic acid probe of claim 21, wherein said probe is capable of hybridizing with a nucleic acid which encodes a PfEMPl polypeptide or biologically active fragment thereof.
23. An expression vector, said expression vector comprising a nucleic acid segment operably linked to a promoter sequence, wherein said nucleic acid segment encodes a PfEMPl protein or biologically active fragment thereof.
24. A method of preparing a PfEMPl polypeptide or biologically active fragment thereof comprising: inserting into an expression vector a nucleic acid which encodes a PfEMPl polypeptide or biologically active fragment thereof; transfecting a host cell capable of expressing said nucleic acid with said expression vector to express said PfEMPl polypeptide or biologically active fragment; and recovering said expressed PfEMPl polypeptide or biologically active fragment.
25. A recombinant host cell, wherein said host cell has been transfected with an expression vector comprising a nucleic acid segment operably linked to a promoter sequence, wherein said nucleic acid segment encodes a PfEMPl protein or biologically active fragment thereof, whereby said cell is capable of expressing said nucleic acid.
26. The recombinant host cell of claim 25, wherein said host cell is a CHO cell.
27. An isolated antibody, wherein said antibody is specifically immψigreactive with a PfEMPl polypeptide or a biologically active fragment thereof.
28. The antibody of claim 27, wherein said antibody is specifically immunoreactive with a polypeptide which comprises an amino acid sequence substantially homologous to an amino acid sequence shown in Figure 2, or a biologically active fragment thereof.
29. The antibody of claim 27, wherein said antibody is specifically immunoreactive with a polypeptide which comprises an amino acid sequence substantially homologous to amino acids 576 through 755 of the amino acid sequence shown in Figure 2.
30. The antibody of claim 27, wherein said antibody is specifically immunoreactive with a polypeptide which comprises an amino acid sequence substantially homologous to amino acids 576 through 808 of the amino acid sequence shown in Figure 2.
31. The antibody of claim 27, wherein said antibody is specifically immunoreactive with a polypeptide comprising one or more of general amino acid sequences:
TTIDKX1LX2HE; and FFWX3X4VX5X6ML
where Xx is selected from leucine or isoleucine, X2 is selected from glutamine and asparagine, X3 is selected from methionine, lysine and aspartic acid, X5 is selected from histidine, threonine and tyrosine and X6 is selected from aspartic acid, glutamic acid and histidine.
32. The antibody of claim 29, wherein said antibody is specifically immunoreactive with a polypeptide having an amino acid sequence selected from the group consisting of an amino acid sequence of rl79 MC K+R+, rl79 MC K-, rl79 MC R-, rl79-C5, rl79-C6, rl79-ItG F6, rl79-ItG 2G1, rl79-ItG ICAM, rl79 PA and rl79-HB3 as shown in Figure 13.
33. A pharmaceutical composition, comprising the polypeptide of claim 1, in a pharmaceutically acceptable carrier.
34. A pharmaceutical composition, comprising the nucleic acid of claim 10, in a pharmaceutically acceptable carrier.
35. A pharmaceutical composition comprising the antibody of claim 27, in a pharmaceutically acceptable carrier.
36. A method of inhibiting an interaction between PfEMPl and a PfEMPl-ligand, comprising contacting the PfEMPl-ligand with an effective amount of a PfEMPl polypeptide or biologically active fragment thereof.
37. A method of inhibiting an interaction between a PfEMPl polypeptide and a PfEMPl-ligand, comprising contacting the PfEMPl polypeptide with an effective amount of an antibody that is specifically immunoreactive with a PfEMPl polypeptide or biologically active fragment thereof.
38. The method of claim 37, wherein the PfEMPl ligand is selected from the group consisting of CD36, VCAM, ELAM, ICAM and TSP.
39. A method of treating a patient suffering from symptoms of a malaria parasite infection, comprising administering to the patient, an effective amount of the pharmaceutical composition of claim 33.
40. The method of claim 39, wherein the symptom of malaria parasite infection is sequestration of erythrocytes.
41. The method of claim 39, wherein the malaria parasite is P. falciparum .
42. A method of treating a patient suffering from symptoms of a malaria parasite infection, comprising administering to the patient, an effective amount of the pharmaceutical composition of claim 34.
43. The method of claim 42, wherein the symptom of malarial infection is sequestration of erythrocytes.
44. The method of claim 42, wherein the malaria parasite is P. falciparum.
45. A method of preventing symptoms of a malaria parasite infection in a patient, comprising administering to the patient an effective amount of the pharmaceutical composition of claim 33.
46. The method of claim 45, wherein the malaria parasite is P. falciparum .
47. The method of claim 45, wherein said administering step is prior to the malaria parasite infection, and the effective amount is an immunogenically effective amount.
48. A method of preventing symptoms of a malaria parasite infection in a patient, comprising administering to the patient an effective amount of the pharmaceutical composition of claim 35.
49. The method of claim 48, wherein the malaria parasite is P. falciparum.
50. The method of claim 48, wherein said administering step is prior to the malaria parasite infection, and the effective amount is an immunogenically effective amount.
51. A method of determining whether a test compound is an antagonist of PfEMPl/PfEMPl-ligand complex formation, comprising the steps of: incubating the test compound with a PfEMPl polypeptide, or a biologically active fragment thereof, and the PfEMPl-1 the PfEMPl-ligand, under conditions which permit the formation of the complex; determining the amount of complex formed during said incubating step, and comparing that amount with the amount of complex formed in the absence of the test compound, a decrease in the amount of the complex formed in the presence of the test compound being indicative that the compound is an antagonist of PfEMPl/PfEMPl-ligand complex formation.
52. The method as recited in claim 51, wherein the PfEMPl-ligand is CD36.
53. A method of identifying a P. falciparum parasite, comprising: amplifying nucleic acids from said parasite using a 3 ' primer sequence having a general nucleotide sequence:
ACX6ACA ATT GAT AAA X7TX8 CTX9 X10AX1;L CAC GAA
where X6 is selected from C and T, X7 is selected from T and A, X8 is selected from G and A, X9 is selected from C and A, X10 is selected from C and A and Xχι is selected from T and A, and a 5' primer sequence having a general nucleotide sequence:
TTT TTT TGG X12Xi3Xi TGG GTX15 X16X1 X18 X19AX20 ATG TTA
where X12 is selected from G and A, X13 is selected from A and T, X1 is selected from G and T, X15 is selected from A and T, X16 is selected from of T, A and C, X17 is selected from A and C, X18 is selected from of T and C, X19 is selected from G and C and X20 is selected from T and A; generating a characteristic pattern of said amplified nucleic acids; and comparing said characteristic pattern of said amplified nucleic acids to a known characteristic pattern of amplified nucleic acids from a known P . falciparum strain.
PCT/US1996/005798 1995-04-27 1996-04-26 Malaria peptides and vaccines WO1996033736A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU58512/96A AU5851296A (en) 1995-04-27 1996-04-26 Malaria peptides and vaccines

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US43090895A 1995-04-27 1995-04-27
US08/430,908 1995-04-27

Publications (1)

Publication Number Publication Date
WO1996033736A1 true WO1996033736A1 (en) 1996-10-31

Family

ID=23709593

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1996/005798 WO1996033736A1 (en) 1995-04-27 1996-04-26 Malaria peptides and vaccines

Country Status (2)

Country Link
AU (1) AU5851296A (en)
WO (1) WO1996033736A1 (en)

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999015557A1 (en) * 1997-09-19 1999-04-01 Karolinska Innovations Ab Malaria polypeptides
WO2000011179A1 (en) * 1998-08-21 2000-03-02 The Government Of The United States Of America, Represented By The Secretary, Department Of Health And Human Services RECOMBINANT MULTIVALENT MALARIAL VACCINE AGAINST $i(PLASMODIUM FALCIPARUM)
WO2001002005A2 (en) * 1999-06-30 2001-01-11 Isis Innovation Ltd. Treatment of dentritic cells for induction of immune tolerance
WO2004037856A2 (en) * 2002-10-25 2004-05-06 Institut Pasteur Plasmodium falciparum virulence factor var o
WO2013076492A1 (en) * 2011-11-22 2013-05-30 The University Court Of The University Of Edinburgh Malaria vaccine
EP2865754A1 (en) 1999-06-14 2015-04-29 BP Corporation North America Inc. Synthetic ligation reassembly in directed evolution

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1994003604A1 (en) * 1992-08-07 1994-02-17 Schering Corporation PfEMP3 MALARIA ANTIGEN, ANALOGS, ANTIBODIES AND USES THEREOF

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1994003604A1 (en) * 1992-08-07 1994-02-17 Schering Corporation PfEMP3 MALARIA ANTIGEN, ANALOGS, ANTIBODIES AND USES THEREOF

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
ANNU. REV. MED., 05 April 1994, Vol. 45, PASLOSKE B.L., "Malaria the Red Cell and the Endothelium", pages 283-295. *
MOLECULAR AND BIOCHEMICAL PARASITOLOGY, 1988, Vol. 27, HOWARD, "Two Approximately 300 Kilodalton Plasmodium Falciparum Proteins at the Surface Membrane of Infected Erythrocytes", pages 207-224. *
RES. IMMUNOL., 1991, Vol. 142, No. 8, LEECH, "Plasmodium Falciparum Cytoadherence", pages 681-686. *

Cited By (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999015557A1 (en) * 1997-09-19 1999-04-01 Karolinska Innovations Ab Malaria polypeptides
US7125958B1 (en) 1997-09-19 2006-10-24 Karolinska Innovations Ab Malaria polypeptides
WO2000011179A1 (en) * 1998-08-21 2000-03-02 The Government Of The United States Of America, Represented By The Secretary, Department Of Health And Human Services RECOMBINANT MULTIVALENT MALARIAL VACCINE AGAINST $i(PLASMODIUM FALCIPARUM)
US6828416B1 (en) 1998-08-21 2004-12-07 The United States Of America As Represented By The Department Of Health And Human Services Recombinant multivalent malarial vaccine against Plasmodium falciparum
EP2865754A1 (en) 1999-06-14 2015-04-29 BP Corporation North America Inc. Synthetic ligation reassembly in directed evolution
WO2001002005A2 (en) * 1999-06-30 2001-01-11 Isis Innovation Ltd. Treatment of dentritic cells for induction of immune tolerance
WO2001002005A3 (en) * 1999-06-30 2001-07-05 Isis Innovation Treatment of dentritic cells for induction of immune tolerance
WO2004037856A2 (en) * 2002-10-25 2004-05-06 Institut Pasteur Plasmodium falciparum virulence factor var o
WO2004037856A3 (en) * 2002-10-25 2004-07-29 Pasteur Institut Plasmodium falciparum virulence factor var o
WO2013076492A1 (en) * 2011-11-22 2013-05-30 The University Court Of The University Of Edinburgh Malaria vaccine

Also Published As

Publication number Publication date
AU5851296A (en) 1996-11-18

Similar Documents

Publication Publication Date Title
Baruch et al. Cloning the P. falciparum gene encoding PfEMP1, a malarial variant antigen and adherence receptor on the surface of parasitized human erythrocytes
Barnes et al. A novel multi-domain mucin-like glycoprotein of Cryptosporidium parvum mediates invasion
Pasloske et al. Cloning and characterization of a Plasmodium falciparum gene encoding a novel high-molecular weight host membrane-associated protein, PfEMP3
US6017538A (en) Plasmodium falciparum antigens inducing protective antibodies
US8378087B2 (en) Recombinant Plasmodium falciparum merozoite surface proteins 4 and 5 and their use
EP0428602A1 (en) Polypeptides and dna encoding same.
US5849306A (en) Binding domains from Plasmodium vivax and Plasmodium falciparum erythrocyte binding proteins
WO2001096370A2 (en) Cryptosporidium parvum antigens, antibodies thereto and diagnostic and therapeutic compositions thereof
EP0885012A1 (en) Malaria vaccine based upon the addition of a msa1 peptide
AU584881B2 (en) Improvements in or relating to the production of malaria vaccines
US20070098738A1 (en) MSP-3-like family of genes
WO1996033736A1 (en) Malaria peptides and vaccines
KR20000065265A (en) Recombinant Protein Containing C-terminal Fragment of Malaria Protozoal MSP-1
US6100067A (en) Molecules containing at least one peptide sequence carrying one or several epitopes characteristic of a protein produced by P. falciparum at the sporozoite stage and in the hepatocytes
AU675445B2 (en) Target antigens of transmission blocking antibodies for malaria parsites
US5422428A (en) Immunization against babesiosis using purified surface antigens of Babesia bigemina and similar immunogens
EP0372019B1 (en) RHOPTRY MEMBRANE ANTIGEN OF $i(PLASMODIUM FALCIPARUM)
US5646247A (en) Merozoite antigens localized at the apical end of the parasite
WO1994003604A1 (en) PfEMP3 MALARIA ANTIGEN, ANALOGS, ANTIBODIES AND USES THEREOF
JPH0686679A (en) Plasmodium sporozoite antigen
AU646662B2 (en) Antigenic proteins of plasmodium
AU646662C (en) Antigenic proteins of plasmodium
AU2001267206B2 (en) Cryptosporidium parvum antigens, antibodies thereto and diagnostic and therapeutic compositions thereof
WO1990011772A1 (en) Merozoite antigens localized at the apical end of the parasite
AU2001267206A1 (en) Cryptosporidium parvum antigens, antibodies thereto and diagnostic and therapeutic compositions thereof

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AL AM AT AU AZ BB BG BR BY CA CH CN CZ DE DK EE ES FI GB GE HU IS JP KE KG KP KR KZ LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK TJ TM TR TT UA UG US UZ VN AM AZ BY KG KZ MD RU TJ TM

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): KE LS MW SD SZ UG AT BE CH DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: CA