WO1998025145A1 - Improvements in or relating to screening for papilloma viruses - Google Patents
Improvements in or relating to screening for papilloma viruses Download PDFInfo
- Publication number
- WO1998025145A1 WO1998025145A1 PCT/GB1997/003321 GB9703321W WO9825145A1 WO 1998025145 A1 WO1998025145 A1 WO 1998025145A1 GB 9703321 W GB9703321 W GB 9703321W WO 9825145 A1 WO9825145 A1 WO 9825145A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- hpv
- binding
- protein
- cells
- leu
- Prior art date
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
- G01N33/56983—Viruses
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/08—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from viruses
- C07K16/081—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from viruses from DNA viruses
- C07K16/084—Papovaviridae, e.g. papillomavirus, polyomavirus, SV40, BK virus, JC virus
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/30—Immunoglobulins specific features characterized by aspects of specificity or valency
- C07K2317/34—Identification of a linear epitope shorter than 20 amino acid residues or of a conformational epitope defined by amino acid residues
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
- C07K2317/55—Fab or Fab'
Definitions
- This invention relates to a method of screening for precursor lesions which can lead to cervical malignancy, methods of detecting and typing HPV infections, and reagents of use in the above methods .
- PVs Papillomaviruses
- HPV 1 or HPV63 cause benign cutaneous warts which progress to malignancy only rarely, while high risk viruses such as HPV 16 and HPV31 cause flat warts at mucosal sites, and are associated with high grade cervical intraepithelial neoplasia (CIN) and cancer (Schneider, 1994). Formation of an HPV-induced tumour is thought to require infection of an epithelial basal cell, and the expression of viral early proteins in order to stimulate cell proliferation.
- HPV infection can be detected in a sample taken from a patient by using molecules which bind specifically to E4 protein of HPVs.
- the invention provides a method of screening samples for pre-cancerous cervical lesions, using molecules which bind specifically to HPV E4 protein.
- HPV 16 E4 protein to be cytoplasmic, and to be produced in cells supporting vegetative viral DNA replication.
- the invention provides a method of detecting a papilloma virus infection in an organism, the method comprising the steps of: obtaining a sample of the organism's cells from the site of potential papilloma virus infection; contacting the cells with a molecule that binds specifically to papilloma virus E4 protein; and monitoring said binding.
- the invention provides a method of screening for pre-cancerous cervical lesions, comprising the steps of: obtaining a sample of cervical cells from a subject; contacting the cells with a molecule that binds specifically to HPV E4 protein; and monitoring said binding.
- the invention provides a method of determining the type(s) of HPV infection in a patient, the method comprising the steps of: obtaining a sample of the patient's cells from the site of HPV infection; contacting the cells with a molecule that binds specifically to a subset of HPV E4 proteins; and monitoring said binding.
- the invention provides an antibody molecule, or an antigen-binding variant thereof, which binds specifically to HPV E4 protein in the region of amino acid residues RPIPKPSPWAPKKHRRLSSDQDSQTP of HPV 16 E4 protein, or the corresponding hydrophilic, acid/base-rich region of other HPV E4 proteins.
- the invention moreover concerns the use of molecules capable of binding to E4 to target antiviral agents capable of destroying papilloma viruses and/or cells infected by papilloma viruses.
- Such molecules may be antibodies or peptides as described above and exemplified herein, optionally conjugated to anticancer or antiviral agents .
- Figure 1A shows the amino acid sequence of HPV 16 E4 protein and the binding sites of various antibody molecules or E4-specific antigen-binding fragments of antibodies
- Figure IB shows the sequence of the E4 protein from HPV 16 (top row), HPV1 (bottom row) and a consensus sequence (middle row), and the binding sites of various antibodies or antigen-binding variants of antibodies;
- Figures 2A-2D show four sensograms (arbitrary response units against time in seconds . ) obtained using surface plasmon resonance apparatus;
- Figures 3-8 are micrographs showing variously stained samples, as explained in the text.
- Figure 9 is an amino acid sequence alignment of part of HPV E4 proteins.
- the method according to the present invention permits the detection, identification and diagnosis of papilloma viruses and papilloma virus infections in organisms susceptible to such infections.
- Such organisms are preferably mammals, and most preferably humans.
- the papilloma virus may be a type or types of human papilloma virus (HPV).
- the sample of patient's cells may comprise skin cells (e.g. in the case of warts, veruccas and the like, caused by cutaneous HPV infections). Cutaneous lesions, such as those induced by HPV types 5, 8, 14, 17, 20, are difficult to manage clinically, and are often associated with malignancies in immunosuppressed patients (Benton et al, 1992 Papillomavirus Reports 3, 23-26).
- the sample may comprise mucosal cells, especially cervical cells, in the case of HPV infections of the urinogenital tract. Methods of obtaining and preparing such samples for use in the method of the invention are known to those skilled in the art or will be apparent from the present disclosure.
- pre-cancerous cervical lesions is intended to refer to those abnormalities which clinically may be described as “pre-malignant” conditions and which may, without treatment, proceed to full malignancies. As set forth above, such lesions are screened for routinely by, for example, cervical smear testing.
- the present invention allows for cells obtained from patients by methods such as cervical smears to be tested more accurately and more quickly for HPV infection.
- the molecule which binds specifically to E4 protein comprises an antibody molecule or an antigen-binding variant thereof, such as an Fab, Fv, scFv, "diabody” and the like.
- the molecule may comprise monoclonal or polyclonal antibodies, or antigen-binding portions of antibodies selected from libraries by screening (e.g. using phage display technology).
- the molecule may be some other polypeptide, peptide, a synthetic compound or an RNA or DNA aptamer, generated by a procedure such as SELEX.
- the molecule comprises a label moiety, such as a fluorophore, chromophore, enzyme or radio-label, so as to facilitate monitoring of binding of the molecule to E4 protein.
- labels are well-known to those skilled in the art and include, for example, fluorescein isothiocyanate (FITC), ⁇ - galactosidase, horseradish peroxidase, streptavidin, biotin, S or I. Other examples will be apparent to those skilled in the art.
- the label may in some instances be conjugated to the antibody or antigen-binding variant, or may be present (where the label is a peptide or polypeptide) as a fusion protein.
- the molecules used in the method of the invention bind selectively to the E4 protein of a certain HPV type or types, but not to the E4 protein of other HPV types.
- the invention can be used to determine the type or types of HPV infecting a patient. This is very significant, as progression to malignant disease (and hence clinical prognosis) is heavily dependent on HPV type.
- the invention provides a method of determining the type(s) of HPV infection in a patient, the method comprising the steps of: obtaining a sample of the patient's cells from the site of HPV infection: contacting the cells with a molecule that binds specifically to a subject of HPV E4 proteins; and monitoring said binding.
- the subset of E4 proteins to which the molecule binds may consist of a single HPV type E4 protein, or may consist of a plurality of E4 proteins of different types, but will not encompass the E4 proteins of all known HPV types, such that binding or non-binding (as appropriate) of the molecule to the E4 protein present in the cell sample will allow an investigator to make certain deductions about the identity of the HPV type(s) infecting the patient.
- the higher risk mucosal types (31 , 33, 35, 51, 52, 58, 61 and 16, 18, 45, 56) cause asymptomatic flat warts (flat concyloma) which can progress to high grade cervical intraepithelial neoplasia (CIN) and cancer.
- CIN cervical intraepithelial neoplasia
- the highest risk of progression to malignancy is associated with lesions caused by HPV types 16, 18, 45 and 56.
- Molecules which bind to desired HPV types, but not to undersired HPV types may be generated for example by randomisation and selection techniques. These include phage display, and other techniques suitable for displaying antibodies or other polypeptides; and procedures for generating nucleic acid binding molecules, for example RNA aptamers, such as SELEX. These procedures are well known to those of ordinary skill in the art and described below for the purposes of exemplification.
- the invention accordingly provides HPV-binding molecules targetted to the HPV E4 protein, which are useful in methods as described herein.
- E4-binding molecules are preferably targeted to extracellular portions of the E4 polypeptide. Such portions tend to be hydrophilic in character. Preferably, therefore, the E4 binding molecules according to the invention specifically bind to hydrophilic portions of the HPV E4 protein.
- the present invention moreover provides a particular region of the E4 protein to which molecules (particularly antibody molecules or variants thereof) may bind with considerable specificity.
- the region varies in amino acid sequence between HPVs of different types. The region corresponds to a peak of hydrophilicity in the E4 protein and is probably surface- exposed. The region is highly charged (acid/base-rich).
- the amino acid sequence of the region is (from N-terminal to C-terminal) RPIPKPSPWAPKKHRRLSSDQDSQTP.
- the amino acid sequence of the E4 proteins of other HPV types will not necessarily be identical to that in type 16, but with the benefit of the present disclosure (e.g. figure 9) the corresponding region can readily be identified in other E4 proteins by those skilled in the art by use of conventional alignment and sequence comparison computer programs (about 65 of the 70 or so known HPV genomes have been cloned and sequenced).
- the invention provides an antibody molecule, or an antigen- binding variant thereof, which binds specifically to HPV E4 protein in the region of amino acid residues RPIPKPSPWAPKKHRRLSSDQDSQTP of HPV 16 E4 protein, or the corresponding hydrophilic, acid/base-rich region of other HPV E4 proteins, preferably other than the antibody TVG 402 identified by Doorbar et al, (1992 Virology 187, 353-359).
- the invention provides the use of an antibody molecule, or an antigen- binding variant thereof, which binds specifically to HPV E4 protein in the region of amino acid residues RPIPKPSPWAPKKHRRLSSDQDSQTP of HPV16 E4 protein, or the corresponding hydrophilic, acid/base-rich region of other HPV E4 proteins for the detection of HPV infections as described herein.
- FIG. 9 shows a consensus-type amino acid sequence ("most likely") on the top row, with the sequence of HPV E4 proteins below. Dots indicate gaps introduced to facilitate the alignment, dashes denote amino acid residue matches with the consensus sequence. Numbering on the right hand side of the figure indicates the number of amino acid residues from the actual or predicted E1 ⁇ E4 splice site. It will be appreciated by those skilled in the art from the alignment that whilst the hydrophilicity of the region is conserved amongst different HPV types, the actual amino acid sequence varies quite considerably, such that reagents binding to this region may be expected to be highly HPV type-specific.
- the antibody of the invention has a binding site, as identified by the SPOTS epitope mapping system, within the region RRIPKPSPWAPKKHR (or the corresponding amino acid sequence from other HPV types).
- a particularly preferred molecule is the Fab fragment TVG405, described further below, which binds to the epitope PKPSPWAPKKH(R) with extremely high affinity and is of particular usefulness in the methods of the invention defined above.
- the arginine residue indicated in brackets at the C-terminal of the TVG405 epitope is not essential for high affinity binding.
- the Fab fragment TVG405 was isolated by the present inventor using phage display technology, as described below.
- Those skilled in the art will understand that different antibodies or Fab fragments may readily be obtained by using similar phage display techniques (and screening with E4 proteins or portions thereof), or by using more conventional immunisation techniques (e.g. immunising mice, rabbits, rats or the like with E4 protein or peptides corresponding to portions of the E4 protein) to obtain polyclonal antisera or monoclonal antibodies (using well known hybridoma techniques of Milstein et al).
- Complete antibody molecules can readily be prepared from Fab - encoding sequences (e.g. isolated by phage display techniques) using standard DNA manipulation techniques described by Sambrook et al, (Molecular Cloning: A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory Press, NY, USA) to join appropriate DNA sequences.
- DNA manipulative techniques can be used to modify DNA sequences encoding anti-E4 antibodies or antigen-binding variants thereof.
- site-directed muta enesis or PCR can be used to modify the coding sequences, so as to produce modified anti-E4 antibodies with different binding specificities or affinities.
- fusion proteins comprising the E4-binding site of an Fab, Fv or antibody and the like, may be prepared.
- Molecules capable of binding E4 may be used as anti-viral or anti-cancer agents, or parts of such agents.
- antibody molecules or E4-binding peptide as described above may be employed for this purpose.
- the E4 protein and/or molecules capable of binding thereto may be used to design E4-binding molecules, preferably small molecules, by rational drug design.
- Such a process preferably involves the crystallisation of E4 or a molecule capable of binding thereto. More preferably, such a process involves the co-crystallisation of E4 and a binding agent. Such a procedure gives information concerning the interaction between E4 and the binding molecule, which can be used to design small molecules capable of mimicking the binding interaction.
- Crystallisation involves the preparation of a crystallisation buffer, for example by mixing a solution of the peptide or peptide complex with a "reservoir buffer", preferably in a 1: 1 ratio, with a lower concentration of the precipitating agent necessary for crystal formation.
- concentration of the precipitating agent i increased, for example by addition of precipitating agent, for example by titration, or by allowing the concentration of precipitating agent to balance by diffusion between the crystallisation buffer and a reservoir buffer. Under suitable conditions such diffusion of precipitating agent occurs along the gradient of precipitating agent, for example from the reservoir buffer having a higher concentration of precipitating agent into the crystallisation buffer having a lower concentration of precipitating agent.
- Diffusion may be achieved for example by vapour diffusion techniques allowing diffusion in the common gas phase.
- Known techniques are, for example, vapour diffusion methods, such as the "hanging drop” or the “sitting drop” method.
- vapour diffusion method a drop of crystallisation buffer containing the protein is hanging above or sitting beside a much larger pool of reservoir buffer.
- the balancing of the precipitating agent can be achieved through a semipermeable membrane that separates the crystallisation buffer from the reservoir buffer and prevents dilution of the protein into the reservoir buffer.
- the peptide or peptide/binding partner complex preferably has a concentration of up to 30 mg/ml, preferably from about 2 mg/ml to about 4 mg/ml.
- Formation of crystals can be achieved under various conditions which are essentially determined by the following parameters: pH, presence of salts and additives, precipitating agent, protein concentration and temperature.
- the pH may range from about 4.0 to 9.0.
- concentration and type of buffer is rather unimportant, and therefore variable, e.g. in dependence with the desired pH.
- Suitable buffer systems include phosphate, acetate, citrate, Tris, MES and HEPES buffers.
- Useful salts and additives include e.g. chlorides, sulphates and further salts specified in Example 1.
- the buffer contains a precipitating agent selected from the group consisting of a water miscible organic solvent, preferably polyethylene glycol having a molecular weight of between 100 and 20000, preferentially between 4000 and 10000, or a suitable salt, such as a sulphates, particularly ammonium sulphate, a chloride, a citrate or a tartrate.
- a crystal of E4 itself or an E4-derived peptide, or E4 (peptide)/binding partner complex according to the invention may be chemically modified, e.g. by heavy atom derivatization. Briefly, such derivatization is achievable by soaking a crystal in a solution containing heavy metal atom salts, or a organometallic compounds, e.g.
- the location(s) of the bound heavy metal atom(s) can be determined by X-ray diffraction analysis of the soaked crystal, which information may be used e.g. to construct a three-dimensional model of the peptide.
- a three-dimensional model is obtainable, for example, from a heavy atom derivative of a crystal and/or from all or part of the structural data provided by the crystallisation. Preferably building of such model involves homology modelling and/or molecular replacement.
- the preliminary homology model can be created by a combination of sequence alignment with any of the E4 proteins the sequence of which is known, secondary structure prediction and screening of structural libraries.
- sequences of HSV 16 and 34 E4 can be aligned as set forth herein.
- Computational software may also be used to predict the secondary structure of E4 peptides or peptide complexes.
- the peptide sequence may be incorporated into the E4 structure.
- Structural incoherences e.g. structural fragments around insertions/deletions can be modelled by screening a structural library for peptides of the desired length and with a suitable conformation.
- a side chain rotamer library may be employed.
- the final homology model is used to solve the crystal structure of E4 or peptides thereof by molecular replacement using suitable computer software.
- the homology model is positioned according to the results of molecular replacement, and subjected to further refinement comprising molecular dynamics calculations and modelling of the inhibitor used for crystallisation into the electron density.
- E4 expression correlates strongly with vegetative DNA replication in HPV-infected cells, making detection of E4 expression a particularly appropriate indicator of HPV infection, and thus particularly useful in screening for precancerous cervical lesions.
- Samples comprising cervical cells may be taken as usual. These are be spread for example on a microscope slide or other support using techniques known in the art, for example as exemplified herein, and stained with, for example, an anti-E4 Fab. Detection may be performed with a secondary antibody -enzyme conjugate (horseradish peroxidase, alkaline phosphatase), or the Fab could be directly conjugated, for example to a fluorophore, such as FITC.
- a secondary antibody -enzyme conjugate horseradish peroxidase, alkaline phosphatase
- Fab could be directly conjugated, for example to a fluorophore, such as FITC.
- This approach may be adapted for use with systems that are currently available for increasing the sensitivity of antibody detection.
- cervical smears are examined routinely by microscopy.
- the proposed approach would require no new equipment and could easily fit around existing methods. It is envisaged that the standard method of detection may be modified.
- Antibody binding may be carried out while the cells are in suspension, with cells being spun down prior to analysis. This would improve the quality of the screen.
- the E4 protein can be detected in productively infected HPV- induced lesions, and in low and high grade cervical neoplasia even when differentiation of the infected keratinocyte is insufficient to support production of capsid proteins and assembly of infections virions.
- E4 expression correlates closely with vegetative viral DNA replication indicating that detection of the E4 protein is as efficient as detection of viral DNA replication for the detection of virus infection.
- the E4 protein is abundant in the upper layers of infected tissue and is thus detectable in cells taken during routine smear tests.
- polyclonal antiserum to the N-terminus of the protein is raised against an N-terminal synthetic peptide ( -E4 N term).
- Polyclonal antibodies (to HPV 16 and HPV63 E4 proteins) are prepared by immunisation of rabbits with maltose binding protein E4 fusion protein (MBP-E4). Antibody titres are monitored in ELISA using purified glutathione S transferase E4 fusion protein (GST-E4).
- Antibodies to the N-terminus of the protein are raised against the synthetic peptide MADPAAATKYPLC after conjugation to thyroglobulin or keyhole limpet haemocyanin through its C-terminal cysteine residue. Conjugation is carried out using m-Maleimidobenzoyl-N-hydroxysuccinimide ester (MBS) as described by Green et al (1982).
- MBS m-Maleimidobenzoyl-N-hydroxysuccinimide ester
- Antibody specificities are confirmed by epitope mapping, as follows: the HPV 16 E4 protein is synthesised as a series of 85 overlapping octamers (single amino acid overlap) by solid phase fmoc chemistry using the SPOTS epitope mapping system (Genosys Biotechnologies, Cambridge, UK). Accuracy of synthesis is confirmed using the HPV16 E1 ⁇ E4 monoclonal TVG402 which binds the major antigenic site of the protein (Doorbar et al, 1992). Filters are regenerated as described by the manufacturers and antibody binding is visualised by ECL (Amersham, Little Chalfont, UK).
- Polyclonal serum is used at 1/250 dilution, purified Fabs at approximately 1 g/ml, and hybridoma supernatant at 1/10 dilution.
- Figure 1A the sequences of the 85 overlapping E4 synthetic peptides are shown at the top of the figure, and the results of the epitope mapping experiments are shown below. The dark spots represent binding of the antibody to the synthetic peptide shown above it. Only the portion of the filter containing peptides which react with each antibody are shown.
- proteolytic cleavage sites that give rise to the 16K and 10/1 IK gene products in the E1 ⁇ E4 protein of HPVl are indicated beneath the HPVl sequence allowing prediction of putative sites in the E1 ⁇ E4 sequence of HPVl 6.
- Immunotubes (Life Technologies, Paisley, UK) are coated overnight at 4°C with either MBP-E4 or GST-E4 at a concentration of 0.1 g/ml. These are subsequently blocked at 37°C for 1 hour in PBS/2% admireTM prior to incubation in the presence of 10 11 phage on a blood tube rotator (37°C). Unbound phage are poured off and tubes are washed lOx with PBS/0.1 % Tween 20. Binders are eluted with lOOmM triethylamine pH 11.0 (1ml) and immediately neutralised with IM Tris (pH8.0) before being reintroduced into E. coli TGI cells. The enriched library is grown up and the selection procedure repeated three more times.
- Phage selections are carried out alternately against GST 16 El ⁇ E4 and MBP 16 E1 A E4 in order to prevent isolation of antibodies to MBP or GST protein, using a repertoire of 6.5 x 10 10 (Griffiths et al, 1994).
- MBP 16 E4 is expressed at higher levels ( > 50mg/litre of bacteria) than the GST fusion (approx. 5mg/litre of bacteria) but, in any event, antibody isolation requires as little as 1 g of antigen (Hawkins et al, 1992).
- Phage displaying antibodies with affinity for E4 are identified by ELISA (against GST-E4, MBP-E4, GST and MBP), and activity is confirmed by phage western blotting.
- Immunoglobulin genes are transferred from the isolated phage into the bacterial expression vector pUC119.His.myc (Griffiths et al 1994) and soluble Fabs are purified from the periplasmic space of induced bacteria by Nickel-NTA chromatography (Qiagen, Crawley UK). Antibody titres are established by ELISA.
- Fab TVG 407 binds an epitope which is identical to that recognised by the hybridoma-derived Mab, TVG 409 (Fig 1).
- the remaining synthetic Fabs recognise novel epitopes upstream (TVG 405) or downstream (TVG 407) of this major antigenic region of E4 and the results are summarised in Figure 1.
- TVG 405 heavy chain CDR3 sequence LLRGAFDY light chain CDR3 sequence: NSRDSSGGNAV
- MBP-E4 aggregates are dissociated under reducing conditions in 0.5% SDS, lmM ⁇ -mercaptoethanol, 50mM Na 2 CO 3 /NaHCO 3 (pH 8.5) and biotinylated using NHS-LC-biotin (Sigma, St Louis, USA; 25mg/ml in DMSO) at a biotimprotein molar ratio of 6: 1 (Johnson et al, 1991).
- Monomeric MBP-E4 is recovered by FPLC chromatography using a Superdex S200 HR10/30 column run in 6M Urea/lmM ⁇ — mercaptoethanol/PBS/0.2mM EDTA (pH7 2), before being bound to a streptavidin— coated sensor chip and "refolded” in vitro in PBS/0.2mM EDTA/O. lmg/ml protease- free BSA (Sigma).
- Fabs are isolated from purified TVG402 using an Immunopure Fab kit (Pierce, Rockford, USA), and monomeric preparations are obtained by FPLC gel chromatography (Superdex S200 HR10/30 column run in PBS/0.2mM EDTA (pH 7.2)) Sensor chip surfaces are regenerated using 6M urea column buffer (described above). On and off rates are derived by non linear curve fitting using the proprietary 'BIAanalysis' software.
- Binding activities are in the order of 20% of total protein levels for the bacterially-derived antibodies, and 50% for Fabs derived from hybridoma culture supernatant.
- the affinities of TVG405 and TVG402 are calculated from on- and off- rates obtained by non-linear curve fitting to sets of BIAcore binding curves.
- Figure 2A shows an overlay of binding curves (sensograms) obtained after passing Fab TVG405 over a BIAcore chip coated with MBP-E4 fusion protein as described above.
- Fab concentrations range from lOmM (lowest curve) to 300nM (upper curve) through 5 intermediate dilutions. The extent of binding is indicated in resonance units on the X- axis, against time in seconds on the Y-axis.
- Purified Fab is injected at around 100 seconds and washing initiated at 700 seconds.
- the affinity (Kj) of TVG405 is calculated as between 0.3 and 1.25nM by analysis of the association and dissociation curves using BIAevaluation software (Pharmacia, UK).
- Figure 2B shows an overlay of binding curves (as described above) for the hybridoma- derived Fab TVG402 over a concentration range lOOnM to 1 M.
- the K d is estimated as 70nM.
- TVG405 has an association rate constant (k on ) of 1.8 x 10 6 M S "1 and an off rate (k ⁇ ) of 2 x 10 3 s "1 indicating a molar dissociation constant (Kd) of approximately InM.
- the best hybridoma-derived antibody - TVG402 - has an affinity of only 70nM, and had a k on of 4.2xl0 4 M " '.s " ' and a k off value of 3xl0 3 s '1 .
- TVG 406 and 407 display rapid kinetics and are thus examined by Scatchard analysis of equilibrium binding data, as shown for TVG407.
- Figure 2C shows the equilibrium binding curve of Fab TVG407, which displays rapid kinetics.
- Figure 2D shows Scatchard analysis of the data presented in Fig. 2C using BIAevaluation software. Equilibrium values are corrected for bulk refractive index changes by subtracting values from a surface blocked with biotin, from the values shown in Fig. 2C. In the plot shown the slope is - K d and the Y-axis intercept is 'R max ' , i.e. the binding level at saturation with Fab.
- the uncorrected K d values for TVG407 and TVG406 are 250nM and 140nM which, when the activity of the Fab preparation is considered, indicates actual affinities of 50nM and 28nM.
- TVG407 has an affinity (Kd) of 50nm after correction for biological activity, and TVG406 has an affinity (Kd) of 28nM.
- Kd affinity
- Kd affinity of 50nm after correction for biological activity
- Kd affinity of 28nM.
- the amino acid sequence of the heavy and light chain CDR3 loops are established by DNA sequencing, further confirming that the three antibodies are distinct.
- a commercially available two-hybrid screening kit is purchased from ClonTech and employed for identifying naturally occurring E4-binding peptides, according to the instructions given by the manufacturer.
- a HeLa cDNA library obtained from the same supplier, is screened. By this method, seven DNA sequences are isolated which encode
- E4-binding polypeptides of which three are identified after sequencing.
- the first peptide is ferritin.
- the second peptide is a keratin filament binding protein, which has the sequence set forth in SEQ. ID. No. 2.
- the third polypeptide is a novel polypeptide recognised as a member of the DEADbox family of proteins, which contain the characteristic sequence motif DEAD.
- the sequence of the third polypeptide is shown in SEQ. ID. No. 3.
- a series of overlapping peptides of between 10 and 20 amino acids in length is generated by PCR and displayed on phage as described above.
- the binders are subsequently employed as screening agents to identify HPV 16 in mucosal lesions.
- RNA oligonucleotides which are capable of specific binding to target molecules can be generated by selection procedures such as SELEX.
- the SELEX method involves selection of nucleic acid aptamers, single-stranded nucleic acids capable of binding to a desired target, from a library of oligonucleotides.
- the SELEX method includes steps of contacting the library with the target under conditions favourable for binding, partitioning unbound nucleic acids from those nucleic acids which have bound specifically to target molecules, dissociating the nucleic acid-target complexes, amplifying the nucleic acids dissociated from the nucleic acid-target complexes to yield a ligand-enriched library of nucleic acids, then reiterating the steps of binding, partitioning, dissociating and amplifying through as many cycles as desired to yield highly specific, high affinity nucleic acid ligands to the target molecule.
- DNA oligonucleotides 73 bases in length, having a randomised portion of 26 bases, are used for the development of an aptamer capable of binding E4.
- a library of synthetic RNA oligonucleotides having the following structure is prepared:
- N stands for any possible base in the random region.
- the random region is generated by using a mixture of all four nucleotides (ratio 6:5:5:4, A:C:G:T, to allow for differences in coupling efficiency) during the synthesis of each nucleotide in that stretch of the oligonucleotide library.
- the resulting complexity is theoretically 4 molecules.
- the scale of synthesis (O. l ⁇ mol) followed by gel purification yields 8.8nmol which puts an absolute upper limit of approximately 5x10 on the number of different molecules actually present.
- PCR Amplification with a 5' primer that introduces the recognition site for T7 RNA Polymerase (5' TAATACGACTCACTATAGGGAGACAAGAATAAACGCTCAA 3') and 3 'primer (5' GCCTGTTGTGAGCCTCCTGTCGAA 3 ') results in the following template for transcription:
- RNA transcript itself has the following sequence: 5' GGGAGACAAGAAUAAACGCUCAA (26N) UUCGACAGGAGGCUCACAACAGGC 3'
- Anti-E4 aptamers are selected using a conventional SELEX procedure as described in US Patent 5,270,163. Each round consists of the following steps:
- RNA and E4 protein are mixed, incubated at 37° C , washed through a nitrocellulose filter, and RNA is eluted from the filters.
- RNA eluted from filters is extended with AMV reverse transcriptase in the presence of 50 picomoles of 3' primer in a 50 ⁇ l reaction under conditions described in Gauss et al. (1987).
- 50 picomoles of 5' primer is added and in a reaction volume of lOO ⁇ l and amplified with Taq DNA polymerase as described in Innis (1988) for 30 cycles.
- Figure 3 illustrates the use of synthetic Fabs to localise HPV 16 E4 protein in vivo by immunostaining of a low grade HPV16 CIN I with Fab NIP-C11 (Griffiths et al, 1994), which has no reactivity towards HPV16 E4 (Fig. 3A), and the E4-specific Fab TVG405 which is described here (Figs. 3B, C, D).
- Fabs are detected using 9E10 as secondary antibody followed by anti-mouse FITC conjugate.
- E4 is detectable in the upper layers of the epidermis but at greatly varying levels between different lesions with often only a few positive cells being apparent (C, D). The position of the basal layer is arrowed in C and D. Magnification is 200X.
- Epitope exposure by microwave treatment enhances the sensitivity of E4 detection, and even allows staining using TVG402 (Doorbar et al, 1992).
- the extent of E4 expression varies greatly between different lesions (8 HPV16-associated CIN1 biopsies are examined), ranging from expression only in rare cells scattered throughout the biopsy (Fig. 3), to widespread distribution throughout the most differentiated layers of the epidermis (Fig. 4), comparable to the distribution of E4 in cutaneous warts caused by HPVl and HPV63 where the production of infections virions is also high (Fig. 4).
- CIN 1 low grade cervical intraepithelial neoplasia caused by HPV16.
- E4 and LI levels are also found to correlate closely, although expression of the two proteins is not coincident (as previously suggested (Brown et al, 1994). E4 expression precedes the synthesis of the major capsid protein by several cell layers (as revealed by double staining, see Fig. 4) and in high grade cervical lesions (CIN 2/CIN 3) E4 is often abundant, even though the expression of LI is no longer supported (Fig 4). This time delay between the commencement of E4 synthesis and the assembly of infectious virions is most apparent in HPV63, where E4 expression coincided with migration of an infected basal cell into the parabasal layers, while expression of LI is restricted to a narrow strip of cells in the upper granular layer.
- Figure 4 demonstrates that synthesis of E4 is not directly linked to the expression of capsid proteins in high and low grade HPV16 lesions, and benign warts.
- Figure 4 shows the results of triple staining using anti LI antisera (Figs. 4A, D, G), HPV16 E4 Fab TVG405 (Figs. 4B and 4E), polyclonal antisera to HPV63 E4 (Fig. 4H), and with DAPI (Figs. 4C, F, I).
- A, B and C represent a low grade HPV16-induced lesion (CIN I).
- D, E and F represent a high grade HPV16-induced lesion (CIN II/III).
- G, H and I represent a section through a verruca caused by HPV63.
- CIN II/III we assume that terminal differentiation is insufficient to support synthesis of virion structural proteins (D) although E4 expression is abundant (E).
- D virion structural proteins
- E E4 expression is abundant
- the basal layer is indicated by an arrow on the D API-stained images. Magnification is 100X.
- Vegetative viral DNA replication is found to begin in cells of the mid spinous layer and to correlate exactly with the onset of E4 expression (Fig 5).
- Figure 5 demonstrates that onset of vegetative viral DNA replication coincides with E4 expression in low grade HPV16 lesions and in benign cutaneous warts.
- the figure shows triple staining using the HPV 16 E4 antibodies TVG402, 405 and 406 (Fig. 5 A) and HPVl E4 antibodies 4.37 and 9.95 (Fig. 5D), biotinylated DNA probe (Fig. 5B - HPV16, Fig. 5E - HPVl), or DAPI (Figs. 5C and F).
- A, B and C represent a section through an HPVl ⁇ -induced CIN I
- D, E and F represent a section through an HPVl-induced verruca.
- Figure 6 illustrates that productive infection interferes with normal epithelial terminal differentiation in low grade HPV 16 lesions and in benign cutaneous warts.
- Figure 6(i) (keratin expression) shows triple staining using the HPV16 E4 Fabs TVG405/TVG406 (Fig. 6(i)A), HPV 1 E4 monoclonals 4.37/9.95 (D), and HPV63 E4 polyclonal antibodies (G), in conjunction with antibodies to the differentiation-specific mucosal keratins 4 and 13 (B) or cutaneous keratins 1 and 10 (E, H).
- Figures 6(i) C, F and I show the DAPI counter stain.
- A, B and C represent a section through a HPV 16- induced CIN I.
- FIG. D, E and F show a section through the edge of an HPVl-induced verruca
- Figures 6(i) G, H and I show a section through an HPV63-induced wart.
- differentiation-specific keratins are less apparent in E4-positive cells than in neighbouring cells (A, B, D, E) although this is not the case with HPV63 (G, H).
- Nuclear degeneration (visualised by DAPI counter staining) is retarded in E4-expressing cells (A, C. D, F). Magnification is 200X.
- Figure 6(ii) relates to filaggrin expression.
- the figure shows triple staining, as described above, except that Figures 6(ii) B and E show filaggrin staining.
- E4 staining is shown in figures 6(ii) A and D
- DAPI counter staining is shown in figures 6(ii) C and F.
- A, B and C represent the edge of an HPV63-induced wart where normal skin (left hand side of figure) meets the benign tumour (right hand side of figure).
- D, E and F show the granular layer of an HPVl-induced wart.
- E4-positive cells do not express detectable levels of the differentiation-specific marker filaggrin, and show marked nuclear preservation when compared to neighbouring uninfected or non-permissive cells. Magnification is 200X.
- HPV 16 E4 proteins The intracellular distribution of the HPV 16 E4 proteins is distinct from the distribution ofE4 in cutaneous lesions caused by HPVl and HPV63.
- the E1 ⁇ E4 protein of HPVl is predominantly cytoplasmic and assembles into inclusions that coalesce and increase in size as the cell migrates towards the surface of the skin.
- the E1 ⁇ E4 protein of HPV63 is found to have a fibrous and granular distribution.
- HPV16 E4 had a filamentous and perinuclear distribution in cells of the lower epidermal layers (Fig, 7), and assembled into prominent structures only in the more differentiated cell layers. These 'inclusions' are always found singly per cell (c.f.
- Figure 7 shows the association of the HPV 16 E4 proteins with perinuclear bundles and filamentous structure in vivo, in particular the detection of HPV 16 E4 proteins in the upper layers (Figs. 7A, B) and lower layers (Figs. 7C, D) of a HPV 16 CIN I using a mixture of Fabs TVG405 and TVG406.
- E4 In the upper layers E4 is diffuse throughout the cytoplasm but with a prominent perinuclear pattern. Concentration of E4 into perinuclear bundles (arrowed in Fig. 7B) is apparent in these cells.
- E4 has a predominantly perinuclear and filamentous appearance (Figs. 7C, D), but is not concentrated into perinuclear bundles.
- Magnification for Figs. 7A and C is 200X; that for B and D is 400X.
- Figure 8 provides evidence for processing of the HPV 16 E4 proteins in vivo and shows triple staining in the upper layers of a HPV 16 CIN using HPV 16 E4 Fab TVG406 which recognises an epitope in the C-terminal half of the E4 protein (Fig. 8A), an antibody to the N-terminal 12 amino acids of the HPV 16 E1 ⁇ E4 protein (Fig. 8B) and DAPI (Fig. 8C).
- TVG402, 403, 404, 405 and 407 produced staining patterns that are not significantly different from that of TVG 406.
- Slides suitable for imaging of cells derived from cervical smears stained using anti-E4 antibodies are prepared by the method set forth in US 5,346,831.
- Cells are isolated from a patient according to conventional procedures and dissolved in 10ml alcohol/saline buffer.
- the sample is prepared for centrifugation by disaggregating the clumps or clusters of cells in the sample vial by vortexing. After disaggregation, the sample is drained completely and layered over a density gradient in a 12 ml conical tube, wherein the density gradient is formed with a plasma expander material comprising 6% betastarch solution, and 0.9% physiological saline, also known by the tradename "Hespan” made by NPBI, Emmer-Compascuum, the Netherlands.
- 50 ⁇ l of deionized H 2 O is added, and the sample mixed by syringing 5 times through a 0.042 inch tip.
- 150 ⁇ l of sample followed by 500 ⁇ l of deionized H 2 O is dispensed into a sedimentation vessel attached to a slide which has been conventionally coated with Poly-L lysine (1 % Sigma).
- the transferred sample is allowed to settle within the vessel for approximately 10 minutes.
- the excess sample is aspirated off and the chamber rinsed with 2 ml deionized H 2 O two times (aspirating between each addition).
- FITC-labelled Fabs are then applied to the cells according to known procedures and the binding visualised by fluorescence microscopy.
- MOLECULE TYPE cDNA
- HYPOTHETICAL NO
- ANTI -SENSE NO
Abstract
Description
Claims
Priority Applications (8)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
EP97947162A EP1021722B1 (en) | 1996-12-03 | 1997-12-03 | Improvements in or relating to screening for papilloma viruses |
DE69733721T DE69733721T2 (en) | 1996-12-03 | 1997-12-03 | IMPROVEMENTS OF SCREENING METHODS FOR PAPILLOMA VIRUSES |
AU52311/98A AU744391B2 (en) | 1996-12-03 | 1997-12-03 | Improvements in or relating to screening for papilloma viruses |
CA002270995A CA2270995C (en) | 1996-12-03 | 1997-12-03 | Improvements in or relating to screening for papilloma viruses |
AT97947162T ATE299594T1 (en) | 1996-12-03 | 1997-12-03 | IMPROVEMENTS IN SCREENING METHODS FOR PAPILLOMA VIRUSES |
JP52534498A JP4206133B2 (en) | 1996-12-03 | 1997-12-03 | Improvement of or related to papillomavirus screening |
US09/314,268 US6346377B1 (en) | 1996-12-03 | 1999-05-18 | Screening for papilloma viruses |
US10/008,524 US7135281B2 (en) | 1996-12-03 | 2001-11-05 | Screening for papilloma viruses |
Applications Claiming Priority (4)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
GB9625142.6 | 1996-12-03 | ||
GB9625142A GB9625142D0 (en) | 1996-12-03 | 1996-12-03 | Virus identification |
GBGB9718745.4A GB9718745D0 (en) | 1996-12-03 | 1997-09-05 | Improvements in or relating to screening for carcinoma |
GB9718745.4 | 1997-09-05 |
Related Child Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US09/314,268 Continuation US6346377B1 (en) | 1996-12-03 | 1999-05-18 | Screening for papilloma viruses |
Publications (1)
Publication Number | Publication Date |
---|---|
WO1998025145A1 true WO1998025145A1 (en) | 1998-06-11 |
Family
ID=26310537
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/GB1997/003321 WO1998025145A1 (en) | 1996-12-03 | 1997-12-03 | Improvements in or relating to screening for papilloma viruses |
Country Status (11)
Country | Link |
---|---|
US (2) | US6346377B1 (en) |
EP (1) | EP1021722B1 (en) |
JP (1) | JP4206133B2 (en) |
AT (1) | ATE299594T1 (en) |
AU (1) | AU744391B2 (en) |
CA (1) | CA2270995C (en) |
DE (1) | DE69733721T2 (en) |
DK (1) | DK1021722T3 (en) |
ES (1) | ES2242236T3 (en) |
GB (1) | GB9718745D0 (en) |
WO (1) | WO1998025145A1 (en) |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2002008764A1 (en) * | 2000-07-24 | 2002-01-31 | Medical Research Council | Detection of abnormalities leading to cervical malignancy |
US8609351B2 (en) * | 1997-10-21 | 2013-12-17 | Cancer Research Technology Limited | Detection of dysplastic or neoplastic cells using anti-MCM4 antibodies |
Families Citing this family (25)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
GB9718745D0 (en) * | 1996-12-03 | 1997-11-12 | Medical Res Council | Improvements in or relating to screening for carcinoma |
AU763757B2 (en) * | 1999-04-16 | 2003-07-31 | Ortho-Mcneil Pharmaceutical, Inc. | Enriched antigen-specific T-cells, and related therapeutic and prophylactic compositions and methods |
US20070031826A1 (en) * | 2005-08-05 | 2007-02-08 | My Gene | Diagnostic kit for determining the genotype of a human papilloma virus and method of using thereof |
WO2008070222A2 (en) * | 2006-08-21 | 2008-06-12 | Cytotrend Biotech Engineering Limited Usa Inc | A method of surface plasmon resonance (spr) technology to detect genomic disorders for prenatal diagnosis |
US20100086920A1 (en) * | 2006-09-18 | 2010-04-08 | Cmed Technologies Ltd. | Method to assess cancer susceptibility and differential diagnosis of metastases of unknown primary tumors |
WO2008036470A2 (en) * | 2006-09-19 | 2008-03-27 | Cmed Technologies Ltd. | A method for screening of infectious agents in blood |
WO2008036474A2 (en) * | 2006-09-21 | 2008-03-27 | Cmed Technologies Ltd. | A method to detect tumor markers and diagnosis of undifferenciated tumors |
WO2008070223A2 (en) * | 2006-09-21 | 2008-06-12 | Cmed Technologies Ltd. | A method to remove repetitive sequences from human dna |
WO2008070227A2 (en) * | 2006-09-25 | 2008-06-12 | Cmed Technologies Ltd. | A method for the identification of human immunodeficiency virus related antibodies in blood |
WO2008082710A2 (en) * | 2006-09-25 | 2008-07-10 | Cmed Technologies Ltd. | A method of surface plasmon resonance (spr) technology to detect genomic aberrations in patients with multiple myeloma |
US20100028856A1 (en) * | 2006-09-25 | 2010-02-04 | Cmed Technologies Ltd. | Method to detect virus related immunological markers for the diagnosis of hepatitis b virus infection |
US20090311699A1 (en) * | 2006-09-25 | 2009-12-17 | Cmed Technologies Ltd. | Method of surface plasmon resonance (spr) to detect genomic aberrations in patients with chronic lymphocytic leukemia |
US20100047789A1 (en) * | 2006-09-25 | 2010-02-25 | Cmed Technologies Ltd. | Method of surface plasmon resonance (spr) to detect genomic disorders for postnatal diagnosis |
US20100041018A1 (en) * | 2006-09-25 | 2010-02-18 | Cmed Technologies Ltd. | Method to detect virus related immunological markers for the diagnosis of hepatitis c virus infection |
US20100086937A1 (en) * | 2006-09-27 | 2010-04-08 | Cmed Technologies Ltd. | method to detect treponema pallidum immunological markers for the diagnosis of syphilis |
WO2008066997A2 (en) * | 2006-09-27 | 2008-06-05 | Cmed Technologies Ltd. | A method for quantitative measurement of cardiac biochemical markers |
US20100021930A1 (en) * | 2006-09-27 | 2010-01-28 | Cmed Technologies Ltd. | Application of surface plasmon resonance technology to maternal serum screening for congenital birth defects |
US8158343B2 (en) * | 2006-09-27 | 2012-04-17 | Cmed Technologies Ltd. | Method to detect virus related immunological markers for the diagnosis of respiratory tract infections |
US8110409B2 (en) * | 2006-09-27 | 2012-02-07 | Cmed Technologies Ltd. | Method to measure serum biomarkers for the diagnosis of liver fibrosis |
US8114682B2 (en) * | 2006-09-27 | 2012-02-14 | Cmed Technologies Ltd. | Method for the quantitative evaluation of sex hormones in a serum sample |
WO2008067007A2 (en) * | 2006-09-28 | 2008-06-05 | Cmed Technologies Ltd. | A method for quantitative measurement of thyroid homrones and related antibodies in a serum sample |
US8110408B2 (en) * | 2006-09-28 | 2012-02-07 | Cmed Technologies Ltd. | Method for quantitative detection of diabetes related immunological markers |
US7838215B2 (en) * | 2007-09-25 | 2010-11-23 | Canvir, Inc. | Advanced cervical cell screening methods |
WO2009045216A1 (en) * | 2007-10-04 | 2009-04-09 | Cmed Technologies Ltd. | Application of surface plasmon resonance technology for detecting and genotyping hpv |
GB0820720D0 (en) * | 2008-11-12 | 2008-12-17 | Norchip As | Method for worldwide screening of pre-cancer epithelial disease of the cervix |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP0451550A2 (en) * | 1990-03-20 | 1991-10-16 | BEHRINGWERKE Aktiengesellschaft | Seroreactive epitopes of human Papillomavirus (HPV) 16 proteins |
WO1991018294A1 (en) * | 1990-05-11 | 1991-11-28 | Medscand Ab | Synthetic peptides of human papillomaviruses 1, 5, 6, 8, 11, 16, 18, 31, 33 and 56, useful in immunossay for diagnostic purposes |
Family Cites Families (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US4777239A (en) * | 1986-07-10 | 1988-10-11 | The Board Of Trustees Of The Leland Stanford Junior University | Diagnostic peptides of human papilloma virus |
GB9718745D0 (en) * | 1996-12-03 | 1997-11-12 | Medical Res Council | Improvements in or relating to screening for carcinoma |
-
1997
- 1997-09-05 GB GBGB9718745.4A patent/GB9718745D0/en active Pending
- 1997-12-03 DK DK97947162T patent/DK1021722T3/en active
- 1997-12-03 AU AU52311/98A patent/AU744391B2/en not_active Ceased
- 1997-12-03 EP EP97947162A patent/EP1021722B1/en not_active Expired - Lifetime
- 1997-12-03 CA CA002270995A patent/CA2270995C/en not_active Expired - Fee Related
- 1997-12-03 ES ES97947162T patent/ES2242236T3/en not_active Expired - Lifetime
- 1997-12-03 JP JP52534498A patent/JP4206133B2/en not_active Expired - Fee Related
- 1997-12-03 AT AT97947162T patent/ATE299594T1/en not_active IP Right Cessation
- 1997-12-03 WO PCT/GB1997/003321 patent/WO1998025145A1/en active IP Right Grant
- 1997-12-03 DE DE69733721T patent/DE69733721T2/en not_active Expired - Lifetime
-
1999
- 1999-05-18 US US09/314,268 patent/US6346377B1/en not_active Expired - Fee Related
-
2001
- 2001-11-05 US US10/008,524 patent/US7135281B2/en not_active Expired - Fee Related
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP0451550A2 (en) * | 1990-03-20 | 1991-10-16 | BEHRINGWERKE Aktiengesellschaft | Seroreactive epitopes of human Papillomavirus (HPV) 16 proteins |
WO1991018294A1 (en) * | 1990-05-11 | 1991-11-28 | Medscand Ab | Synthetic peptides of human papillomaviruses 1, 5, 6, 8, 11, 16, 18, 31, 33 and 56, useful in immunossay for diagnostic purposes |
Non-Patent Citations (3)
Title |
---|
J. DOORBAR ET AL.: "Analysis of HPV-1 E4 gene expression using epitope defined antibodies.", THE EMBO JOURNAL, vol. 7, no. 3, 1988, OXFORD UK, pages 825 - 833, XP002057858 * |
J. DOORBAR ET AL.: "Characterization of events during the late stages of HPV 16 infection in vivo using high-affinity synthetic Fabs to E4.", VIROLOGY, vol. 238, no. 1, 1 December 1997 (1997-12-01), NEW YORK NY USA, pages 40 - 52, XP002057879 * |
J. DOORBAR ET AL.: "Identification of the human papilloma virus-1a E4 gene products.", THE EMBO JOURNAL, vol. 5, no. 2, 1986, OXFORD UK, pages 355 - 362, XP002057859 * |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US8609351B2 (en) * | 1997-10-21 | 2013-12-17 | Cancer Research Technology Limited | Detection of dysplastic or neoplastic cells using anti-MCM4 antibodies |
WO2002008764A1 (en) * | 2000-07-24 | 2002-01-31 | Medical Research Council | Detection of abnormalities leading to cervical malignancy |
Also Published As
Publication number | Publication date |
---|---|
GB9718745D0 (en) | 1997-11-12 |
DE69733721D1 (en) | 2005-08-18 |
US6346377B1 (en) | 2002-02-12 |
ES2242236T3 (en) | 2005-11-01 |
EP1021722B1 (en) | 2005-07-13 |
JP2001509886A (en) | 2001-07-24 |
ATE299594T1 (en) | 2005-07-15 |
DE69733721T2 (en) | 2006-05-18 |
DK1021722T3 (en) | 2005-08-08 |
AU744391B2 (en) | 2002-02-21 |
US7135281B2 (en) | 2006-11-14 |
CA2270995A1 (en) | 1998-06-11 |
US20030175682A1 (en) | 2003-09-18 |
CA2270995C (en) | 2006-10-10 |
EP1021722A1 (en) | 2000-07-26 |
AU5231198A (en) | 1998-06-29 |
JP4206133B2 (en) | 2009-01-07 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
AU744391B2 (en) | Improvements in or relating to screening for papilloma viruses | |
Doorbar et al. | Characterization of events during the late stages of HPV16 infectionin vivousing high-affinity synthetic fabs to E4 | |
CA2417075A1 (en) | Detection of abnormalities leading to cervical malignancy | |
EP2300824B1 (en) | Detection of early stages and late stages hpv infection | |
EP2522756A2 (en) | Method of producing an HPV protein using affinity chromatography | |
JP5771563B2 (en) | Monoclonal antibodies and methods for use in detecting cervical disease | |
US20080200344A1 (en) | Protein chips for HPV detection | |
US5968522A (en) | Immunogenic compositions and antibodies directed against human papillomavirus type 49 (HPV 49), type 50 (HPV 50), type 54 (HPV 54), and type 55 (HPV 55). | |
US20150153345A1 (en) | Antibodies specific to e6 proteins of hpv and use thereof | |
JP4694840B2 (en) | How to test for cervical cancer | |
US8372591B2 (en) | MCM6 and MCM7 monoclonal antibodies and methods for their use in the detection of cervical disease | |
CN108276491A (en) | monoclonal antibody capable of specifically recognizing HPV 18L 1 protein and application thereof | |
CN106191270A (en) | The diagnosis transcript of the HR HPV in different cervical lesionses and splice mode |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GE GH HU ID IL IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US UZ VN YU ZW AM AZ BY KG KZ MD RU TJ TM |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH KE LS MW SD SZ UG ZW AT BE CH DE DK ES FI FR GB GR IE IT LU MC |
|
DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
WWE | Wipo information: entry into national phase |
Ref document number: 52311/98 Country of ref document: AU |
|
ENP | Entry into the national phase |
Ref document number: 2270995 Country of ref document: CA |
|
WWE | Wipo information: entry into national phase |
Ref document number: 09314268 Country of ref document: US |
|
ENP | Entry into the national phase |
Ref country code: JP Ref document number: 1998 525344 Kind code of ref document: A Format of ref document f/p: F |
|
WWE | Wipo information: entry into national phase |
Ref document number: 1997947162 Country of ref document: EP |
|
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
WWP | Wipo information: published in national office |
Ref document number: 1997947162 Country of ref document: EP |
|
WWG | Wipo information: grant in national office |
Ref document number: 52311/98 Country of ref document: AU |
|
WWG | Wipo information: grant in national office |
Ref document number: 1997947162 Country of ref document: EP |