WO1998049195A1 - Corona virus-like particles as tools for vaccination and therapy - Google Patents

Corona virus-like particles as tools for vaccination and therapy Download PDF

Info

Publication number
WO1998049195A1
WO1998049195A1 PCT/NL1998/000237 NL9800237W WO9849195A1 WO 1998049195 A1 WO1998049195 A1 WO 1998049195A1 NL 9800237 W NL9800237 W NL 9800237W WO 9849195 A1 WO9849195 A1 WO 9849195A1
Authority
WO
WIPO (PCT)
Prior art keywords
virus
protein
particle
coronavirus
particle according
Prior art date
Application number
PCT/NL1998/000237
Other languages
French (fr)
Inventor
Petrus Josephus Marie Rottier
Original Assignee
Universiteit Utrecht
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Universiteit Utrecht filed Critical Universiteit Utrecht
Priority to AU73507/98A priority Critical patent/AU7350798A/en
Publication of WO1998049195A1 publication Critical patent/WO1998049195A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011—Details
    • C12N2770/20011—Coronaviridae
    • C12N2770/20022—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011—Details
    • C12N2770/20011—Coronaviridae
    • C12N2770/20023—Virus like particles [VLP]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011—Details
    • C12N2770/20011—Coronaviridae
    • C12N2770/20041—Use of virus, viral particle or viral elements as a vector
    • C12N2770/20045—Special targeting system for viral vectors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2810/00—Vectors comprising a targeting moiety
    • C12N2810/50—Vectors comprising as targeting moiety peptide derived from defined protein
    • C12N2810/60—Vectors comprising as targeting moiety peptide derived from defined protein from viruses
    • C12N2810/609—Vectors comprising as targeting moiety peptide derived from defined protein from viruses positive strand RNA viruses

Definitions

  • the present invention relates to virus-like particles (VLPs) derived from corona viruses which are modified in various ways, genomically or in their protein composition, thereby exposing at their surface various biological or target molecules and/or carrying within the particles molecules with biological activity which need to be protected or shielded and/or containing genomes from which parts of authentic coronavirus genes or sequences have been removed or altered or into which foreign genes or sequences have been incorporated.
  • VLPs virus-like particles
  • viruses intrinsically represent the most natural delivery systems and seem thus pre-eminently suitable as therapeutic carriers. Their exploitation requires that we can engineer virus-like particles and tailor them to their new function. Such particles must be equipped with specific targeting information and "loaded” with a genetic or non- genetic message. The idea to use viruses for the better is not new but has been limited mainly to retroviruses and adenoviruses which may have limited value as tools for gene therapy .
  • Coronavirions have a rather simple structure. They consist of a nucleocapsid surrounded by a lipid membrane.
  • the helical nucleocapsid is composed of the RNA genome packaged by one type of protein, the nucleocapsid protein N.
  • the viral envelope generally contains 3 membrane proteins: the spike protein (S) , the membrane protein (M) and the envelope protein (E) .
  • S spike protein
  • M membrane protein
  • E envelope protein
  • Some coronaviruses have a fourth protein in their membrane, the hemagglutinin-esterase protein (HE) .
  • HE hemagglutinin-esterase protein
  • the coronavirus nucleocapsids are assembled in the cytoplasm.
  • the nucleocapsids interact with the viral envelope proteins which after their synthesis in the endoplasmic reticulum accumulate in the intermediate compartment, a membrane system localized between the endoplasmic reticulum (ER) and the Golgi complex.
  • This membrane system acts as the budding compartment: the interaction of the nucleocapsids with the viral envelope proteins leads to the pinching off of virions which are then released from the cell by exocytosis .
  • VLP virus-like particles
  • CD CD > ⁇ - ra ra P- P 0 tr t P- P- P- CD 0 TJ CD • --• CD J to CD P 0 PJ 0
  • CD tr ft CD tr TJ CD P tr ⁇ ⁇ CD 0 LQ P- CD 0 P- CD rt ⁇ LQ CD : ra
  • CD CD CD CD 3 0 PJ P- ⁇ PJ tr ⁇ ; P- tr ft CD ⁇ PJ P- 0 P ra ⁇ l PJ 0 CD tr ⁇
  • CD TJ TJ CD P ⁇ > tr CD CD ⁇ PJ P tr P- P tr CD ⁇ P- ft P- J
  • constructs are inserted into plasmids behind a bacteriophage T7 polymerase promoter.
  • the constructs are then co-transfected with plasmids carrying the MHV M and E genes, both also behind the T7 promotor, in OST-7 cells which have been infected with a recombinant vaccina virus expressing the T7 polymerase.
  • the resulting VLPs contain the chimaeric MHV/FIPV S protein.
  • the VLP is provided by the methods used as above with ectodomains of the spike protein of infectious bronchitis coronavirus (IBV) , or the ectodomain (or part thereof) of an envelope protein of any enveloped virus not belonging to the coronaviruses .
  • MHV-based VLPs are provided by the invention which carry at their surface the ectodomain of the pseudorabies virus (PRV) glycoprotein gD instead of the MHV spike ectodomain or the luminal (i.e. amino-terminal) domain (or part thereof) of any nonviral type I membrane protein.
  • PRV pseudorabies virus
  • VLPs are provided that have a cell specificity for chicken cells, or pig cells, or cells reactive with the type I membrane protein.
  • VLPs are produced with modifications that are contained within the particles. This is achieved by the incorporation of modified constructs of any of the corona viral proteins S, M, E and HE. In corona virus particles these proteins have their carboxy-terminal domain enclosed within the interior of the viral envelope. Thus, foreign protein sequences incorporated within, appended to or replacing the carboxy- terminal domain are enclosed as well.
  • VLPs can be provided that contain protein moieties, or fragments thereof, from another virus, or non-viral proteins such as hormones, such as erytrhopoietin.
  • VLPs containing a biological active protein or fragments thereof which is/are shielded by the viral envelope and can be released and/or retrieved later, when the viral membrane is degraded or fused with another membrane.
  • This allows the in vi tro production in cells, or the in vivo production in secretory glands such as milk glands of biologically active substance which are otherwise harmful or toxic to the producing cells, or which for other reasons need to be produced in a shielded form.
  • MHV-based VLPs are provided carrying on their surface or inside an enzy atically active molecule like furin, or a cytokine, or a hormone receptor, or another viral or nonviral polypeptide with biological activity.
  • VLPs are provided with (additional) targeting means that serve to direct the VLP to cells otherwise not accessible to the original corona virus .
  • the invention provides VLPs which are modified at the ectodomain and/or the ectodomain of any of the viral proteins.
  • the VLPs are provided with modified biological molecules as targeting means that serve to direct the VLP to interact with other biological molecules that mirror or can interact with the target means, such as receptor proteins on cells, be it hormone receptors, specific immunoglobulines on B- cells, MHC and MHC associated molecules present on T-cells and other cells, transfer proteins or other receptor molecules known to the person skilled in the field of cell surface receptors.
  • the targeting means can also be provided to interact with known binding sites of selected enzymes on proteins or other molecules that serve as substrate for the selected enzyme.
  • MHV-based VLPs are provided exposing an immunogenic determinant of a bacterial toxin.
  • the VLPs serve as immunogen or vaccine, here directed against the bacterial toxin.
  • B-lymfocytes carrying the corresponding immunoglobuline at their surface are in this case the target cells for the VLPs, once recognozed by the B- lymfocyte, this cell(s) will multiply and produce the appropriate antibody.
  • Preparation of VLPs or coronaviruses with modified spikes can be achieved genetically by modification of the viral genome such that it expresses the modified S protein in infected cells.
  • coronaviruses containing altered spikes in a different way by expressing modified S genes in cells which are in addition infected with coronavirus .
  • the co-incorporation of the mutant spike provides the virus with new targeting means.
  • MHV particles containing the chimaeric MHV/FIPV S protein.
  • the chimaeric S gene construct is expressed in L cells which are subsequently infected with wild-type MHV strain A59 (MHV-A59) or a mutant thereof.
  • the progeny virus released by the cells contains the modified S protein.
  • the altered targeting was used to infect feline cells which are naturally not susceptible to MHV.
  • the cells are now infected as shown by immunofluorescence and produce normal MHV.
  • MHV containing chimaeric S proteins in which part of the S ectodomain has been replaced by the corresponding part (i.e. the luminal or amino-terminal domain) of the human CD4 molecule, as an example of a nonviral protein.
  • modified coronaviruses have acquired the property to infect HIV-infected cells and cells expressing HIV envelope glycoprotein through the specific recognition of the CD4 and HIV gpl20 complex.
  • the HIV-infected cells will undergo a lytic infection, effectively reducing the number of HIV-infected cells in the body and thereby reducing the severity of the disease or even terminating the infection.
  • deletion or mutation can be achieved with a cDNA clone or by recombination.
  • Attenuation is provided by the preparation of an MHV mutant from which an essential gene has been deleted by recombination.
  • a mouse cell line is provided in which the MHV E gene has been chromosomally integrated allowing the E protein to be produced by the expression of the gene.
  • MHV lacking an E gene has been produced in normal mouse cells by recombination using a synthetic RNA containing a perfect copy of the MHV genomic 3 ' -end except for the lack of an intact E gene.
  • the E- defective virus is able to grow only in the cells complementing the defect.
  • the virus produced is attenuated such that it can infect other mouse cells, but non- productively: the lack of an E protein prevents the assembly of progeny.
  • MHV derived VLP is provided into which a reporter gene such as LacZ or green fluorescent protein has been recombined and one in which the chimaeric MHV/FIPV S gene has been incorporated.
  • the expression of the genes is shown by blue or green- fluorescent staining of VLP infected cells and by the acquired ability to infect feline cells, respectively.
  • the other way to obtain coronavirus-based delivery vehicles uses VLPs comprising foreign RNA sequences. Incorporation of foreign RNA sequences into these particles requires their packaging into nucleocapsids.
  • N protein molecules Viral RNA-packaging by nucleocapsid (N) protein molecules occurs by the recognition of specific sequences, packaging signal (s) by the N protein.
  • packaging signal includes a 69 nucleotides long region in gene IB.
  • RNAs containing the coronavirus packaging signal (s), or defective coronaviral genomes in which these signal (s) have been retained but into which foreign sequences have been incorporated, are assembled into VLPs when introduced into cells expressing the N, M and E ( ⁇ S) genes .
  • the VLP can introduce into a target cell a defined RNA that may have one of several functions.
  • An example provided by the invention is a RNA acting as mRNA and specifying a particular protein such as a toxin or an inducer of apoptosis or an antibody fragment .
  • Another example is an antisense RNA or an RNA with ribozyme activity.
  • VLPs which will only carry one or a few pseudo-NC.
  • the invention thus provides the RNAs with amplification signals such that they will be multiplied in the target cell.
  • Semliki Forest virus (SFV) replication sequences are used as the basis of the RNA construct.
  • SFV-derived mRNA further comprising the coronavirus encapsidation sequences and specifying a reporter protein are assembled into VLPs.
  • the SFV-driven amplification allows synthesis of the reporter protein in cells; in animals the appearance of antibodies to the reporter protein testifies to the productive delivery of the VLPs ' content .
  • the invention also provides a VLP which is an antigen or epitope delivery vehicle meant for the induction of specific immune responses, cellular and/or humoral, systemic and/or local, including the induction and production of specific antibodies against proteins, to achieve protection against infection by pathogens, of viral and nonviral origin.
  • VLP which is an antigen or epitope delivery vehicle meant for the induction of specific immune responses, cellular and/or humoral, systemic and/or local, including the induction and production of specific antibodies against proteins, to achieve protection against infection by pathogens, of viral and nonviral origin.
  • the invention provides the induction of antibodies against the reporter protein derived from SFV- derived mRNA further comprising the coronavirus encapsidation sequences and specifying a reporter protein, as described above.
  • the induction of antibodies is demonstrated in mice to the FIPV spike and to PRV gD by immunization with the VLPs, also described above.
  • immune responses can be elicited both against proteins which are encoded by the altered genome of the VLP and/or against proteins which have been incorporated as targeting means in the VLP, thereby partly or wholly replacing the original spike protein.
  • the examples illustrate the applicability of the approach for the induction of immune responses against proteins as diverse as for instance viral, bacterial, parasitic, cellular and hormonal origins.
  • the induction of protective immunity in mice against PRV by the gD exposing VLPs is provided.
  • the example illustrates the applicability of the approach in principle for vaccination against viral, bacterial and parasitic pathogens including for instance human coronaviruses .
  • the invention also provides VLPs for diagnostic purposes. In immunoassay always a great need exists for a well- defined, specific and sensitive antigen that can be prepared in large quantities.
  • the use of MHV- based VLPs carrying the PRV gD ectodomain in an ELISA to detect gD antibodies is provided.
  • the invention also provides VLPs which have fully maintained the original spike protein but which are altered genomically to attenuated the VLP and/or to encode nucleotide sequences that need to be delivered at the cells to which the original coronavirus was targeted.
  • VLPs which have fully maintained the original spike protein but which are altered genomically to attenuated the VLP and/or to encode nucleotide sequences that need to be delivered at the cells to which the original coronavirus was targeted.
  • intestinal epithelial cells, or respiratory epithelial cells that are normally infected by TGEV, or PRCV, respectively, can now interact with VLPs derived from TGEV or PRCV, or other cell-specific coronaviruses if needed, to express proteins normally not expressed by said viruses.
  • respiratory epithelial cells of cystic fibrosis patients can be induced to express lung surfactant molecules that are encoded by the altered genome of the VLP.
  • Coronaviruses are assembled intracellularly by budding into the intermediate compartment and, later in infection, into the endoplasmic reticulum (ER; Klumperman et al . , 1994; Krijnse Locker et al . , 1994).
  • the cytoplasmically synthesized nucleocapsid (NC) - the viral genomic RNA packaged by nucleocapsid protein (N) molecules - interacts with cytoplasmically exposed domains of viral membrane proteins accumulated in the pre-Golgi membranes. Subsequent budding results in the formation of virions that follow the exocytic pathway out of the cell.
  • VLPs coronavirus-like particles
  • S spike-like particles
  • VLP assembly provides us with an extremely valuable and convenient tool to study aspects of coronavirus assembly. This was demonstrated very clearly in a study of the structural requirements of the M protein for assembly. In this study we showed by co-expression of mutated M proteins with the E protein that particle formation is sensitive to changes in all domains of the M protein, i.e. the luminal N-terminal domain, the transmembrane domains and the cytoplasmic C-terminal domain. Particularly the identity of the extreme C-terminus appeared to be very important; substitutions of the terminal residue can abolish VLP assembly nearly completely as does its deletion; deletion of the last two residues or more is fully fatal. To further demonstrate that the VLP assembly system is a faithful model for coronavirion assembly, we introduced several of these mutations into the viral genome by RNA recombination. The results were essentially fully concordant.
  • the aim of the further examples was to study the incorporation of the S protein into viral particles.
  • Ascitis G73 was obtained from a cat infected with feline infectious peritonitis virus (FIPV) and contained antibodies to this virus 1 spike protein.
  • Two expression constructs were prepared encoding mirror image chimaeric MHV/FIPV S proteins : one protein (designated S * ) has the transmembrane + cytoplasmic domain of MHV S and the luminal domain (i.e. ectodomain) of FIPV
  • the construction made use of a convenient Styl site occurring at an identical position in both the MHV S gene and the FIPV S gene; this Styl site marks the location where in the S protein the ectodomain turns into the transmembrane domain.
  • pTFMS encoding the S * gene
  • pBl cDNA clone de Groot et al . , 1989
  • FIPV strain 79-1146 S sequences FIPV strain 79-1146 S sequences.
  • a chimaeric S gene construct was prepared consisting of the 3' Styl/BamHI fragment of the MHV S gene (Vennema et al . , 1990) and the 5' coding sequence of the
  • FIPV S gene spanning the AUG initiation codon down to the corresponding Styl site.
  • the chimaeric gene was ligated as a BamHI fragment into the vector pTUG3 (Vennema et al . ,
  • the reverse chimaeric construct, encoding the S* gene was prepared from the complementary 5' BamHl/Styl MHV S gene fragment and the 3 ' Styl/Sall FIPV S gene fragment and was cloned into pTUC (Vennema et al . , 1991) .
  • the plasmid was designated pMFS .
  • RNA donor construct pFVl described by Fischer et al . (1997) was extended in the upstream direction of the S gene by incorporating 1. Ikb sequences of the MHV gene 2.
  • the chimaeric S gene was introduced into this plasmid as follows. Convenient restriction sites were first introduced into the modified donor construct at the 5 ' end of the S gene and just downstream of the 3 ' end of this gene.
  • an Avrll site was engineered by mutating nucleotides 36 and 37 (both thymidines) in the S signal sequence encoding region into cytidines.
  • the sequence TCTCCTGG was changed into the Sse8387I restriction enzyme recognition sequence CCTGCAGG.
  • a chimaeric S * construct was prepared bordered by the same restriction sites.
  • the Avrll site was engineered using the following PCR primer: 5 ' -CCTAGGGTATATTGGTGATTTTAGATGCATACAAGTTAACGTAACAC-3 ' .
  • the Sse83871 site was created using the PCR primer TCTGTCTTTCCTGCAGGGGCTGTGAT .
  • chimaeric gene construct was retrieved using Avrll and Sse83871 and ligated into the donor plasmid that had been treated previously with the same enzymes.
  • Capped RNA was transcribed from the resulting donor plasmid and used for electroporation into MHV-infected L2 cells to allow recombination (Fischer et al . , 1997).
  • the cells were plated onto a monolayer of FCWF cells to enable multiplication of the recombinant virus .
  • the genes were (co) transfected into OST-7 cells infected with the recombinant vaccinia virus vTF7-3.
  • the proteins were labeled with 35 S-amino acids for 3h starting at 5h post infection (p.i.) .
  • Cells were then lysed, lysates were cleared by centrifugation and prepared for immun- oprecipitation using various antibodies. The analysis of the precipitated proteins is shown in Fig.l.
  • the M and S proteins were correctly expressed as shown by the immun- oprecipitates obtained with the anti-MHV antiserum (K134) raised against purified MHV (lanes 1 and 3) .
  • the E protein (which requires a higher gel percentage to be resolved) is poorly recognized by this serum (not shown) .
  • the monoclonal antibody J 1.3 specifically precipitated the M protein (lanes 4 and 8) , though with a lower efficiency than did K134.
  • Another monoclonal antibody, A3.10 precipitated the S protein with high specificity and efficiency (lane 5) .
  • the antibodies in the feline ascitic fluid G73 recognized the chimaeric protein S * but not the MHV S protein (or the M protein; lanes 2,6 and 7) .
  • VLPs produced by the combination of M, E and S * (lane 3) , not those resulting from M + E + S coexpression (lane 6), could be immunoisolated by the G73 antibodies. That this result (lane 3) was indeed specific was additionally shown by the lack of M protein isolation by these feline antibodies after coexpression of only the M and S * proteins (lane 4) . It should be noted that the direct demonstration of the S * protein in gels was was impaired by the strong copurification of an apparently secreted host cell protein with similar electrophoretic mobility.
  • a derivative of the chimaeric S * gene was incorporated into MHV by homologous RNA recombination.
  • Synthetic capped RNA transcribed from a donor DNA construct containing the S * gene was transfected into murine L2 cells that had been infected with MHV.
  • the cells were plated onto monolayers of FCWF-D cells.
  • the effect of recombination was evident from the formation of huge syncytia by the feline cells. No syncytia were formed when no RNA was transfected nor with any other donor RNA lacking the FIPV sequences .
  • the recombinant virus harvested from the culture media was used to infect fresh FCWF-D cells.
  • CD 0 0 LQ ra ft tr CD CD CD CD PJ a. 0 P- 0 CD CD
  • FIG. 1 Biochemical analysis of expressed viral proteins.
  • OST-7 cells grown in parallel in 3.5cm culture dishes were infected with VTF7-3 and transfected after lh with one or more of the plasmids pTUMM, pTU S, pTM5ab and pTFMS (5mg per plasmid) . They were incubated at 37°C.
  • Lysates were cleared by centrifugation in an Eppendorf centrifuge for 10 min at 10,000 rpm. Immunoprecipitations were done using 200ml-aliquots of cleared lysate which were diluted with 800ml immunoprecipitation buffer (20mM Tris-HCl [pH7.6], 150mM NaCl, 5m EDTA, 0.5% sodium deoxycholate, 0.1% SDS, lmg of protease inhibitors per ml) before adding the antibodies (2ml K134, 3ml G73, 150ml Jl .3 or 20ml A3.10) . After overnight incubation at 4°C 30ml Pansorbin (Calbio- chem) suspension was added and incubation continued for lh.
  • immunoprecipitation buffer 20mM Tris-HCl [pH7.6], 150mM NaCl, 5m EDTA, 0.5% sodium deoxycholate, 0.1% SDS, lmg of protease inhibitors per ml
  • FIG. 1 Analysis of VLPs by affinity purification.
  • CD 3 TJ 2 CD PJ 0 P 3 cJ Hi P, PJ P P h-- rt 3 c
  • CD td CO 0 CD ⁇ o CD rt ⁇ Hi P- 0 >-3 TJ CD P.

Abstract

The present invention provides virus-like particles (VLPs) derived from corona viruses which are modified in various ways, genomically or in their protein composition, thereby exposing at their surface various biological or target molecules and/or carrying within the particles molecules with biological activity which need to be protected or shielded and/or containing genomes from which parts of authentic coronavirus genes or sequences have been removed or altered or into which foreign genes or sequences have been incorporated. The VLPs can for example be used as systems for the targeted delivery of therapeutic agents in the body or can be used as vaccine or as antigen in diagnostic tests.

Description

Title: Corona virus-like particles as tools for vaccination and therapy
The present invention relates to virus-like particles (VLPs) derived from corona viruses which are modified in various ways, genomically or in their protein composition, thereby exposing at their surface various biological or target molecules and/or carrying within the particles molecules with biological activity which need to be protected or shielded and/or containing genomes from which parts of authentic coronavirus genes or sequences have been removed or altered or into which foreign genes or sequences have been incorporated.
One of the major needs in present-day medicine is systems for the targeted delivery of therapeutic agents in the body. By consequence, the development of carriers that can direct cargo to specified groups of cells and introduce this cargo into these cells such that it can exert its biological activity, is a major challenge in biomedical research. Tremendous efforts have already been spent in the development and testing of systems based on liposomes, microspheres, antibodies etc. for delivery of drugs, genes, peptides and proteins. Though many of these approaches are promising, the actual successes so far are limited. Viruses are transmissible agents which by their very nature carry out targeted delivery. In order to survive in the ecosystem they have shaped this feature to perfection.
They have evolved structures and mechanisms to ensure that they precisely find the right target cells and introduce their genetic or enzymatic material into the cytoplasm without becoming trapped into the degradative lysosomal pathway.
By virtue of their combined targeting and delivery features, viruses intrinsically represent the most natural delivery systems and seem thus pre-eminently suitable as therapeutic carriers. Their exploitation requires that we can engineer virus-like particles and tailor them to their new function. Such particles must be equipped with specific targeting information and "loaded" with a genetic or non- genetic message. The idea to use viruses for the better is not new but has been limited mainly to retroviruses and adenoviruses which may have limited value as tools for gene therapy .
Coronavirions have a rather simple structure. They consist of a nucleocapsid surrounded by a lipid membrane. The helical nucleocapsid is composed of the RNA genome packaged by one type of protein, the nucleocapsid protein N. The viral envelope generally contains 3 membrane proteins: the spike protein (S) , the membrane protein (M) and the envelope protein (E) . Some coronaviruses have a fourth protein in their membrane, the hemagglutinin-esterase protein (HE) .
In infected cells the coronavirus nucleocapsids are assembled in the cytoplasm. The nucleocapsids interact with the viral envelope proteins which after their synthesis in the endoplasmic reticulum accumulate in the intermediate compartment, a membrane system localized between the endoplasmic reticulum (ER) and the Golgi complex. This membrane system acts as the budding compartment: the interaction of the nucleocapsids with the viral envelope proteins leads to the pinching off of virions which are then released from the cell by exocytosis .
We have recently demonstrated that the assembly of coronaviral particles does not require the involvement of nucleocapsids. Particles devoid of a nucleocapsid are assembled in cells when the viral envelope protein genes are co-expressed. The minimal requirements for the formation of virus-like particles (VLP's) are the M and E protein: the S protein is dispensable but is incorporated if present through its interactions with the M protein. ω > to to H
LΠ o LΠ O LΠ LΠ
H rt P- Ω rt Pl tr 0 J CΩ 3 CD LQ TJ H 0 ra rt ft 0 CD tr m l P ra tr Ω M rt to
0 tr tr 0 CD 0 tr CD P- 0 tr P- 0 X CD PJ tr 0 TJ tr CD tr ft CD tr 0 0 CD CD 0 CD P- tr P-
3 CD CD CD CD ft p- rt TJ 0 P (D 0 CD CD I-1 CD P 0 0 Ω QA H1 TJ 3 PJ o
PJ p. CD rt 0 J tr CD tr CD 0 0 rt Ω P P- CD ta ) CD ≤ ^ P CD P QA P CD rt Ω p- CD PJ CD 0 tr ω -1 CD Ω ra 3 P- TJ cp P- PJ < CD S ø CD 0 P CD P- 0 0 0 tr ø 3 TJ h-1 CD P- rr 0 P- tr 0 P- P- Ω P CD TJ CD • PJ CD ft 0 rt m rt CD
0 P- PJ PJ TJ 0 CD ft (D P- ø Ω h-1 CD ø P- CD P rt - P- ≤ 0 CD LQ PJ CD P- tr 3 tr P 0 P P Ω P Ω P P- P- o CD LQ ) CD ra CD Ω 0 •• C P. tr J Ω P P- o CD P-
^ CD o PJ CD o o CD Ω ω CD 0 PJ < P- 0 CD o 0
•- ø Ω
3 rt P J O P) ø P- rt P- CD P- 0 Ω O < •- 3 ra < PJ tr CD CD CD TJ Ω 0 LQ PJ rt "< ---, rt Ω PJ Ω CD TJ P o tr rt o P CD tr -r1
P- tr CD I P- o O 0 P- 0 < P PJ ø 0 o ft tr P- 0 CD 3 J PJ TJ o ^ P P P 0 P P P ^_ Ω rt 0 tr1 P- 3 LQ Ω rt tr O S CD . CD 3 TJ tr < ra m PJ
3 CD P CD PJ O o PJ \. tr P TI ø CD CD J ø i-1 0 rt CD P CD CD P CD 0
0 P P- LQ PJ Ω o rt P- 0 P 0 (D ra < CD ft P P P- LQ PJ P Ω rt Ω PJ P) PJ iQ CD 0 P- 0 CD CD ø PJ P P- P- — CD CD P- P CD Ω < ^ s CD PJ Lπ P tr P- ø 0 P
P- TJ PJ 0 CD TJ rt < Ω PJ P 0 0 PJ 0 P- CD ) CD (D P •> P- CD CD tr rt CD CD
Ω 0 ft rt • 0 P- 0 Ω Ω rt ft LQ LQ CD ft P t 0 ft σ P- CD CD tr
PJ J CD 0 tr p 0 PJ ra rt tr P- CD P -2 P- ^ H TJ 0 P- TJ P- Ω Ω CD tr CD
PJ Ω PJ 0 P. CD ≤ ø rt P- P ø tr PJ 0 • P- - tr 0 Ω TJ 0 CD P> Ω ø 0 Ω
P- 0 0 P ra tr m PJ < P P CD rt 0 0 P- 0 (D ^ PJ H1 • LQ .= 0 PJ rt 3
3 0 P- P- J CD P- P- P- ^ P- Ω CD Ω h-1 <: P. TJ P- 0 P
0 LQ 0 0 Ω LQ ø P- J P J TJ 0 o tr LΠ CD CD ^ t ra CD PJ Ω LQ 0 h-1 ft LQ P. <! tr CD P- ^ 0 Ω P P P P TJ P- t < o tr • CD P- Ω CD 0
CD -—-, 0 tr P- 0 ø LQ CD TJ (D 0 3 £ P Ω P- 0 Ω t CD P- 0 P- Ω 0
Ω TJ ra CD CD P CD LQ ≤ P < J CD o 0 P- as 0 P- O o ra Ω rt O CD 3 ø PJ P- 0 0 0 o CD tr ≤ <l 0 3 P- ft X 0 < CD o P CD 0 ^ P 0 P-
P 0 3 ft P ra P LQ P- P- PJ 0 P- P- PJ P- 0 ^ (D O to CD Ω 0 0 Ω
CD 0 0 P CD CD 0 CD Ω P CD CD 0 3 P- P- ft TJ 0 0 o P PJ CD CD 0 CD P
CD CD ><- ra ra P- P 0 tr t P- P- P- CD 0 TJ CD • --• CD J to CD P = 0 PJ 0
P- CD 0 LQ 0 p- 0 0 3 CD so 0 ra Ω P- CD
≤ 0 0 Ω tr P- 0 ra 3 ø ø ø P- Ω PJ CD PJ <^1 J < - 0 P- -3 0 PJ < 0 Ω
P- 0 Pi CD CQ CD CD CD ra Ω CD O 0 ? CD ø CD P- Ω tr P CD P- 0
(t — rt tr CD LQ -Q CD CD rt 0 P, P tr CD 0 P 0 0 P H rt P- < CD P CD TJ tr tr CD CD -Q P CD ø tr tr 3 O \ CD rt ø ø ra CD Ω PJ 0 P- P- P-
CD .. CD 0 CD 0 CD CD P- TJ P- 0 0 P- rt tr Ω CD ^« tr rt Ω o Ω tr CD CD ra CD 0 P rt 0 0 0 PJ P 0 tr P- CD ^ 0 σs tr 0 P- ø CD P>
P- CD Ω P 0 TJ ra Ω O 0 TJ CD < LQ CD Ω P 0 CD ~* — P) P- PJ P J ra
PJ CD ft ft 0 CD 3 PJ 0 P- < € P- 3 P 0 P- . D 0 P CD . PJ p P Ω -S ø o CD tr P LQ ft PJ P P- CD < CD O rt PJ ? Ω CD CD 0 PJ
CD CD tr CD 0 ra P ≤ CD rt P- P- P- 0 rt AQ tr1 0 P tr Ω CD PJ 0 o 0
P Ω 0 TJ 0 P- tr tr P- Ω o P- ra tr 0 TJ CD CD 0 J TJ P CD CD P- PJ
CD CD X ft ra tr CD PJ P- TJ Ω PJ 0 0 CD P- - P 0 TJ TJ TJ TJ 0 PJ 0 CD tr
0 TJ ^ 0 0 P- l-1 CD < Ω P h-1 - 0 ra J TJ CD (t 3 Ω CD J CD 0 tr PJ J ; ft rt P 0 0 CD -Q CD tr 0 CD ra TJ J 0 0 P- P ) P ra P- rt P < ra
0 rt Ω ø 0 CD 0 PJ LQ CD CD P CD P CD P. rt P J CD ø tr CD P-
CD tr ft CD tr TJ CD P tr ξ ø CD 0 LQ P- CD 0 P- CD rt Λ LQ CD : ra
PJ P P- P- 0 0 0 CD PJ Ω 3 CD PJ 0 P- CD Ω Ω P, CD 0 ^ CD
P tr 3 ø O P Ω CD P 0 rt P ^ CD 3 rt tr PJ PJ -1 CD rt TJ P- P Q P- P- QA 0 CD 0 rt CD J CD ra < ft P- J P- (D TJ TJ CD CD P- 0 O rt 3 . CD
CD 0 0 P- ra < tr ra ra P- CD P tr -• P- P- rt tr 0 P J CD CD CD 0 tr ft PJ tr P- < rt PJ ø P- P- P Ω LQ X P Ω tr i-1 LQ Ω P- CD CD rt 0 CD CD
P- P- h-1 LQ 0 P ø tr CD o 0 0 CD ø CD 0 ? P- M P ^ tr CD PJ PJ ø ø Ω J J 3 P H rt CD 0 PJ PJ S CD CD S P Q LQ TJ P- Ω M P- < 0 CD P PJ 0 LQ .— i hs CD -1 P ω P- 0 CD J 0 0 0 CD <! CD CD P. P- ω ^ CD o 0 PJ Q-
P P CQ CD P- 0 0 0 rt 0 P- LQ D tr
P- CD
ω L t to H H o o o j - TJ r 3 s « M J rt < 0 tr rt « CD J rt TJ ø < rt TJ 3 Ω Ω ft T P- < -3 P- -2 ω
P s τι H CD 0 tr 0 Ω tr t"1 CD tr tr 0 TJ m tr P CD t tr P 0 0 0 tr CD P 0 tr* P- 0 P- TJ
CD < H 0 H J P- Ω CD TJ CD CD P- P- D CD 0 t, TJ CD 0 P- P 0 CD P 0 ft TJ rt ra rt CD
TJ rt __ CD 0 Ω J CD rt 0 Ω 0 ? 0 ft P rt CD 0 ft P- < 0 tr rt tr Ω
TJ < CD H- Ω tr ra < tr tr 0 tr 0 CD Ω <! CD rt P- CD CD ft 0 PJ < < P- J 0 J P-
P P- P- 0 0 Hi CD TJ PJ CD P ø CD P- P- P- PJ CD tr P- P- PJ P- P- CD P- Ω Ω 0 0 PJ
0 - • 0 PJ M J 0 P- f CD CD rt ^-~ TJ P) P 0 P ^ 0 CD <; ø P P- CD CD Ω rt Ω P-
P- CD CD P p tr CD TJ ra PJ CD P ft ø CD LQ TJ CD CD P- PJ h-1 o CD ≤ Ω ø H O CD TJ CD rt P- PJ TJ P- •3 0 CD CD CD P Ω P Hι P p) P- P-
Ω TJ tr P. P tr CD ra Ω P- PJ TJ ft ≤ ft 0 0 0 CD PJ O P tr CD P- CD P. ft
CD PJ CD 0 Ω 0 Ω CD ;v Ω CD PJ 0 CD P- P- P- X CD P-
P ra Hi 3 O t 0 P 0 Ω "g <! 0 P P- P 3 o ;
CD CD P P- -S P- (t 0 P- CD rt CD CD 3 0 0 CD TJ CD rt CD CD P> 0 CD 3 P PJ P- P- o ft P- 0 P- ? tr LQ rt P) tr 0 P- 3 rt 0 LQ Ω P <! CD tr P- H P- CD P- TJ CD TJ P T 3 (t CD CD P- P CD P Lq tr Ω tr ft rt CD J
^ Ω < P- 0 P- 0 0 3 ra J CD P tr o CD 0 tr CD 3 rt CD P ø P 0 CD ft P- CD P Ω tr1 0 CD ω ra ζj" 0 tr P. 0 ^ ft 0 TJ TJ CD 0 0 PJ P 0 0 0 CD P- 0
3 CD TJ CD 0 ft CD 0 ra h-1 rt tr — ft rt PJ CD J -• rt P- p) 0 TJ 0 0 P- 0 LQ CD CD P J CD ra Hi P- J P- P. Ω CD PJ CD rt CD ft tr P Ω 0 P- P- 0 P 0 P CD 0 0 P ft ft 0 • • P- 0 ø P- CD 0 P- tr rt 0 tr CD rt P- CD ft ø Ω CD 1 0 PJ 3 tr ft ^ 0
P- Ω 0 s IP p. 0 3 TJ 0 0 0 CD < tr CD P- Hi tr Lq 0 Ω ft TJ <! CD PJ CD tr 0 PJ ø TJ J CD rt ft P- CD
5 < Ω P- P P 0 CD P P- 0 --■ CD 0 0 <
LQ J 0 CD 0 ϊ- 0 P- tr 0 Ω P ft 0 tr1 Ω o ti J TJ CD P P- o P ft P- P-
P Ω tr ft rt tr CD CD 0 P) CD tr P TJ CD P o ø 0 TJ 0 0 ft 0 P- "< 0 ft P
Ω ft 0 ft CO P- tr 0 P P Ω CD P- - tr < P h-1 0 CD ra 0 < 0 tr rt 0
0 P- 0 P- rt Ω CD 0 CD rt PJ P ft LQ ø P- P- CD P- PJ J PJ 3 P- CD 0 P- CD ra CD J CD
0 Ω ≤ 0 tr tr tr CD Ω 0 CD TJ O P- P- CD ϊ. 0 3 ø ft Ω < 0 0 CD 0 0 P- P CD
CD ø 0 CD 3 rt P CD 0 CD PJ P- 0 0 X tr 3 rr CD P- P- P- CD PJ rt 0 CD LQ ra rt CD CD CD rt Ω 0 ft 0 P- rt TJ P 0 < PJ rt P- 0 ø tr CD P- 0 P CD P- P CD P- 0 0 CD
P CD 0 rt 0 0 tr 0 tr 0 rt 3 CD Ω Lq 0 P- Lq LQ PJ rt tr 0 CD Ω 0 P ft Ω
0 rt TJ rt P 0 CD CD rt LQ CD 0 P- PJ 0 rt tr P- 0 0 P -, h-1 P- PJ rt 0 PJ
Ω CD CD tr PJ ft CD tr CD P Ω P- rt Ω O Ω J P- TJ *-* CD <! z < PJ 0 PJ 3 0 rt p- P P CD 0 J P- CD Ω 0 P- 0 P- 0 tr J 0 0 rt PJ ω CD tr P- tr Ω 0 Ω 0
CD rt P- CD P- tr 0 CD tr Ω 0 CD 0 P 0 P- Lq Lq tr P 0 P- P h-1 J Ω CD tr tr (t CD 3 0 CD 0 h-1 ra o LQ — ,--. 0 0 P 0 P- P- TJ P- rt P 0 tr Ω 0 CD 0 rt CD CD
0 CD 0 Ω CD TJ CD P rt P P- "• 0 fl) Ω Ω PJ ø — CD tr CD P- 0 Ω rt 0 ft 3 Ω PJ 0 P- CD P 0 0 . PJ P- 0 Ω J J P ra 0 CD 1 tr o 0 tr P- P- 0 tr tr rt ft ιp i 0 0 CD < < 0 LQ rt rt rt — 0 0 0 h-1 ^ 0 0 --■ P- ft CD 0 ft P H- P- P- P- 0 rt PJ 3 • t"1 P- P- P- tr 0 P- ti P- ra Ω CD P tr D CD P- 0 PJ 3 rt o ø ft CD J rt TI P TJ Ω < P- TJ 0 CD 0 1 P 3 CD ? rt CD o CD ra CD
CD CD CD 3 0 PJ P- ø PJ tr <; P- tr ft CD ø PJ P- 0 P ra <l PJ 0 CD tr Ω
Ω PJ CD CD CD -* CD ra P- 0 CD tr CD PJ rt o CD P- h-1 0 CD €. rt ft
Ω Ω CD Ω P- P P TJ P CD J • Ω o TJ rt ft P P- P TJ P- rt CD tr CD
0 tr O 0 + P- Ω < Ω s- CD 0 — -. ra P CD TJ P CD tr 3 tr J .-^ PJ 0 ft tr • J
P P- ^ P Ω 0 t-1 0 P- Ω CD 0 TJ TJ CD P Ω 3 P CD CD (D CD P- 3 P P tr CD ft
0 3 CD 0 o Ω P TJ P CΩ P- P P- PJ 0 0 0 PJ 3 3 P- CD 0 ft P- α rt
0 J 0 PJ CD 0 CD O CD ?r P TJ TJ 0 rt P- u < 0 rt P P- LQ 0 CΛ 0 J 0
PJ CD PJ PJ P TJ 0 0 P- w TJ CD ft P CD rt P- CD P f P tr CD Ω P- P 1 P- P
P 0 < ft tr P- J PJ PJ 0 Ω CD P> 0 rt P PJ O CD ω ) TJ P- CD m I-1 0 TJ 0 CD P-
< P- P- tr 0 ;v <! P O P- P P TJ CD tr rt P- 0 • 0 Lq P 0 Ω CD P) TJ P LQ 0
P- Ω P CD X CD P- CD < ft rt CD ft P X P- CD P- 0 CD CD 3 p- o ω CD 0 ft
P 0 P P- ^ tr 0 TJ CD CD 0 rt CD ø PJ TJ 0 ft CD 0 ' CD ø CD CD ra CD 1 0 TJ P ^ ft rt 0 CD ø CD P, 0 Ω tr TJ 3 * ra P- . — . < CD CD 0 P P
CD TJ TJ CD P ø => tr CD CD α PJ P tr P- P tr CD < P- ft P- J
P- P- P- o m tr r CD P- CD rt PJ ?s ra 0 P ra -7" P P 0 Ω s ? <i ?r -~. • CD tr P 0 P- P- ø P P- PJ rr J tr o Tl 0 PJ - ft
CD CD CD s P- P CD CD ø P CD rt CD rt CD ø P- o ra ra rt
§ CD P tX CD 0 tr PJ PJ tr tr P- CD Ω — • CD rt
< CD tr PJ ft h-1 P- CD 0 tr tr ω P. •<: ~-' D ø CD CD
gene in which the region encoding the amino-terminal domain is replaced by the corresponding domain of FIPV. These constructs are inserted into plasmids behind a bacteriophage T7 polymerase promoter. The constructs are then co-transfected with plasmids carrying the MHV M and E genes, both also behind the T7 promotor, in OST-7 cells which have been infected with a recombinant vaccina virus expressing the T7 polymerase. The resulting VLPs contain the chimaeric MHV/FIPV S protein. In another embodiment of the invention, the VLP is provided by the methods used as above with ectodomains of the spike protein of infectious bronchitis coronavirus (IBV) , or the ectodomain (or part thereof) of an envelope protein of any enveloped virus not belonging to the coronaviruses . For example, MHV-based VLPs are provided by the invention which carry at their surface the ectodomain of the pseudorabies virus (PRV) glycoprotein gD instead of the MHV spike ectodomain or the luminal (i.e. amino-terminal) domain (or part thereof) of any nonviral type I membrane protein. In this way VLPs are provided that have a cell specificity for chicken cells, or pig cells, or cells reactive with the type I membrane protein. In yet another embodiment of the invention, VLPs are produced with modifications that are contained within the particles. This is achieved by the incorporation of modified constructs of any of the corona viral proteins S, M, E and HE. In corona virus particles these proteins have their carboxy-terminal domain enclosed within the interior of the viral envelope. Thus, foreign protein sequences incorporated within, appended to or replacing the carboxy- terminal domain are enclosed as well. In this way, VLPs can be provided that contain protein moieties, or fragments thereof, from another virus, or non-viral proteins such as hormones, such as erytrhopoietin. This allows the production of VLPs containing a biological active protein or fragments thereof, which is/are shielded by the viral envelope and can be released and/or retrieved later, when the viral membrane is degraded or fused with another membrane. This allows the in vi tro production in cells, or the in vivo production in secretory glands such as milk glands of biologically active substance which are otherwise harmful or toxic to the producing cells, or which for other reasons need to be produced in a shielded form. As another embodiment, MHV-based VLPs are provided carrying on their surface or inside an enzy atically active molecule like furin, or a cytokine, or a hormone receptor, or another viral or nonviral polypeptide with biological activity. In these examples, VLPs are provided with (additional) targeting means that serve to direct the VLP to cells otherwise not accessible to the original corona virus .
The invention provides VLPs which are modified at the ectodomain and/or the ectodomain of any of the viral proteins. By modifying the ectodomain of the spike protein, the VLPs are provided with modified biological molecules as targeting means that serve to direct the VLP to interact with other biological molecules that mirror or can interact with the target means, such as receptor proteins on cells, be it hormone receptors, specific immunoglobulines on B- cells, MHC and MHC associated molecules present on T-cells and other cells, transfer proteins or other receptor molecules known to the person skilled in the field of cell surface receptors. The targeting means can also be provided to interact with known binding sites of selected enzymes on proteins or other molecules that serve as substrate for the selected enzyme.
In a further embodiment of the invention, MHV-based VLPs are provided exposing an immunogenic determinant of a bacterial toxin. This is an example whereby the VLPs serve as immunogen or vaccine, here directed against the bacterial toxin. B-lymfocytes carrying the corresponding immunoglobuline at their surface are in this case the target cells for the VLPs, once recognozed by the B- lymfocyte, this cell(s) will multiply and produce the appropriate antibody. Preparation of VLPs or coronaviruses with modified spikes can be achieved genetically by modification of the viral genome such that it expresses the modified S protein in infected cells. Here we also provide the preparation of coronaviruses containing altered spikes in a different way by expressing modified S genes in cells which are in addition infected with coronavirus . The co-incorporation of the mutant spike provides the virus with new targeting means. As an example we demonstrate the production of MHV particles containing the chimaeric MHV/FIPV S protein. The chimaeric S gene construct is expressed in L cells which are subsequently infected with wild-type MHV strain A59 (MHV-A59) or a mutant thereof. The progeny virus released by the cells contains the modified S protein. To demonstrate the altered targeting the virus was used to infect feline cells which are naturally not susceptible to MHV. The cells are now infected as shown by immunofluorescence and produce normal MHV. As another example we demonstrate the production of MHV containing chimaeric S proteins in which part of the S ectodomain has been replaced by the corresponding part (i.e. the luminal or amino-terminal domain) of the human CD4 molecule, as an example of a nonviral protein. These modified coronaviruses have acquired the property to infect HIV-infected cells and cells expressing HIV envelope glycoprotein through the specific recognition of the CD4 and HIV gpl20 complex. As a result, the HIV-infected cells will undergo a lytic infection, effectively reducing the number of HIV-infected cells in the body and thereby reducing the severity of the disease or even terminating the infection.
As another example, we demonstrate the production of MHV containing spike molecules of which the amino-terminal part has been replaced by a single chain-antibody fragment recognizing a specific cell surface protein that is expressed on cells that can normally not be infected with MHV. The modified virus is able to infect these otherwise refractory cells. This example illustrates the principle u> ) to CO H H
LΠ o LΠ o LΠ O
PJ - -2 rt Ω Ω -2 Lq P- Ω H CD P- rt P 0 LQ ip P- H o - ft Ω PJ rt O CD PJ P- rt
Ω P- 0 P- tr CD 0 tr CD 0 PJ 0 P- ø tr P- rt CD CD 0 tr p H 0 tr CD P tr O 0 P- P- 0 P- 0 tr
Ω h-> P P 0 P- 0 0 Ω ip rt CD tr tr 0 0 Ω P- 0 α 3 CD CD (D 0 0 CD ft P PJ
O o Ω 0 CD O 0 0 o CD CD 0 0 CD ra ω 0 P CD ft LQ TJ P- CD 0 rt
TJ 3 0 ra J tr 3 Ω tr P Ω N P CD 3 P PJ tr P CD CD ft Ω CD tr h-1 tr Ω P
0 ø Lq P- CD rt CD TJ h-A TJ CD ^ -3 CD TJ Ω P- CD TJ tr ; iP CD CD P) 0 ft 3 P-
P- tr ra CD tr PJ 0 Ω P- O -- pj g P- PJ 0 J P P) rt 0 0 0 rt 0 ^ P- CD PJ ø
CD CD rt 0 -1 P- PJ o J P CD p h-1 CD o P CD P 0 rt tr P P CD O CD CD Ω ^ P. rt tr ) tr I-1 0 m 0 Ω P> — - rt CD CΩ CD CD 0 PJ < PJ P- CD CD TJ 0 X tr ra P- rt
CD Ω TJ 0 0 LQ CD rt CD Ω P- — Ω ft tr tr1 ra CD P TJ PJ rt PJ PJ ^ rt 0 tr
P. CD 0 3 -3 0 P- Ω • O tr CD tr P- CD TJ TJ 0 PJ CΩ P- 0 rt 3 P- CD P 0 0 P- h-> P ^ 0 P- ft M Ω - ~, 3 0 P P- X 0 D CD ft TJ 0 m -3 tr X TJ ø ft PJ ra tr TJ 0 tr ___ J Ω TJ LQ CD o TJ rt Lq PJ Ω CD ; P- CD CD P- CD i ra P-
>< CD 0 ? 0 LQ CD > 0 ra tr J P tr Ω O rt ø P Ω CD P) 3 3 CD ø -3 ra P- Lq — P- CD 0 o CD PJ tr P o PJ CD rt CD ø CD CD rt PJ
LQ « CD 0 rt P PJ α ra o tr LQ ra rt 0 P- 0 P tr m 0 CD tr rt - 0 CD o
CD P- CD 0 tr 0 CD s tr P ^ o P- P- m P CD Ω CD ra P- Ω ^ ø rt ra CD P TJ CD > CD CD rt ra Ω CD 0 CD < 0 CD P- h-1 tr tr o rt ft
0 tr rt CD P 0 P- 3 tr CD PJ TJ P- CD P o ø CD Ω 0 0 P Ω CD tr P-
3 0 tr P P- CD Ω q P) (D ø 0 Lq 0 tr P rt Ω CD -3 P* PJ CD •
P- -3 CD CD o Lq ra tr tr ø ?r P CD h-1 0 ø ø 0 CD 0 rt 0 ft ø ^ P- 0 CD
Ω tr PJ Ω P ø CD ϋ 0 ^ P- CD X P P- PJ rt P tr 0 CD 0 Ω < .
PJ P- rt Ω O CD 0 0 O ø ≤ CD Lq 0 <! TJ tr CD CD CD P- h-1 Ω rt CD 3 P- ra PJ CD Lq CD e PJ to J ft 0 CD p- P CD rt CD 0 rt P 0 O h-> P tr h-1 tr CD h-1 tr LQ CD P- Ω ^ CD ^ !2. Ω tr rt ø P (D tr PJ P- tr PJ rt P h-> PJ :
^ 0 P- 0 Λ 0 tr ø 0 0 > ft J P CD P- ø CD ? CD ø 0 CD L tr CD rt 0 CD 0 0 Lq P- J CD CD CD 0 CD H- rt ^ CD CD CD P- P P- 0 3 CD P- P-
PJ tr PJ J CD CD CD rt 0 CD CD <! CD 0 PJ 3 tr CD 3 CD P 0 0 ra 0 h-1 CD rt ft rt CD 0 TJ < P- Ω CD LQ CD rt 0 0 CD m TJ PJ CD CD Ω K ø CD P TJ CD
>< CD tr P- Ω PJ CD 0 Ω CD o CD CD tr P P P- CD h-1 TJ ft < rt Ω ft P- CD
CD CD 0 0 CD P CD 0 CD CD PJ P- 0 0 CD < CD ra PJ >? P
P P- ^ 0 CD CD rt 3 < CD PJ CD 0 CD 0 Lq rt 0 Ω P- -2 0 0 P- CD ft
P- ø tr • 0 tr J P- rt tr1 P CD P- tr CD <! P- P P- P PJ ? 0 Ω CΩ P-
0 rt CD P- Ω P- 0 ^ CD 0 0 tr TI PJ ø CD Λ LQ CD o Ω 0 ≤ ra ø PJ CD CΩ 0
LQ CD 3 0 rjd CD CΩ P- P- CD ra CD ra ø ≤ CD 0 tr P- ra CD 0 0 Ω LQ
P CD CD to N TJ o CD tr CD < CD PJ 0 ft ø 0 Ω . P Lq -3 tr CD O ) CD CD Ω P- ft 3 CD 0 Ω rt 0 P P- 0 ^ CD P- tn O 3 J CD CD ø CD CD CD P < tr Ω 0 Ω PJ 0 tr rt 0 0 0 rt P Ω ra 0 CD PJ h-1 Hi ø CD • O CD
CD rt 0 0 CD α P) tr P tr CD ø CD • 0 < - 0 h-1 tr CD CD P- h-- ra 0 P
• ft • cα P P z, ft CD 0 TJ X P- CD CΩ CD ^ CD < ø CD CD Pi PJ ^
< tr CD σ O < D P- 0 PJ O h-1 P P- tr CD P- Ω tr
P- > P> P- CD P- P- Ω o Ω PJ Ω rt tr CD P- P- 0 P- CD 0 0 o ?r 3 0 Ω rt CD CD < ra
P ft rt ft Ω ø P 0 Ω 0 o < ?r tr CD CD 0 0 CD P P- O PJ tr P- Ω P- TJ
0 rt 0 P- Ω PJ 3 0 P P- PJ CD Λ rt CD P) CD ^ h-1 ø CD Ω ft ω P CD
CD CD rt P- P 0 CD tr TJ ø 0 P uq ø O 0 Ξ P rt Ω P- P- PJ 0 CD P- ø Ω
0 tr CD 0 Ω P- P- ><: CD 0 J CD < tr CD PJ X CD ft 0 ^ ø ra P- ft 0 CD 0 0 Lq ø P- PJ P- (D 0 Ω rt ; CD CD ra pi TJ P- P- CD Lq CD tr PJ : P- J P P- CD J 0 0 < P Ω CD tr < P- rt tr P CD "< 0 CD X P- CD P-
P rt 3 < TJ 0 0 rt LQ P- TJ 0 0 Ω CD (D P- CD PJ CD CD P- 0 ra 0 CD Ω
0 P- z TJ P- 0 0 P- P J P CD Pi CD w tr 0 Ω ø X ? PJ rt
0 0 P- 0 P P P- 3 0 PJ PJ Ω CD ra CD < p- CD Ω CD < P- CD TJ Ω J
Lq 0 I-1 P 0 PJ 0 CD 0 tr 0 I-1 ? P- S CD tr P- σ Ω h-1 CD PJ CD P- 3 tr tr 0 J tr I-1 rt ra ft CD J Lq P- CD P ^ tr h-1 P P CD CΩ PI PJ P
Ω J CD CD CD PJ P- Lq Lq ø rt 0 Ω tr PJ CD CD CD CD P- 0 CD Ω iQ P- tr LQ
PJ ø 0 CD P- Ω 0 0 <! CD P- tr 0 CD h-> CΩ 0 0 CD (t O CD ø CD CD
0 0 rt ft P- P- ø ø to P- 3 • 0 P ft rt P 0 Lq tl 0 0 P- tr P- tr P. J 3 CD ; " • 0
CD CD LQ
deletion or mutation. Again, this can be achieved with a cDNA clone or by recombination.
As an example of the invention attenuation is provided by the preparation of an MHV mutant from which an essential gene has been deleted by recombination. A mouse cell line is provided in which the MHV E gene has been chromosomally integrated allowing the E protein to be produced by the expression of the gene. MHV lacking an E gene has been produced in normal mouse cells by recombination using a synthetic RNA containing a perfect copy of the MHV genomic 3 ' -end except for the lack of an intact E gene. The E- defective virus is able to grow only in the cells complementing the defect. The virus produced is attenuated such that it can infect other mouse cells, but non- productively: the lack of an E protein prevents the assembly of progeny.
As an example the principle of incorporating foreign genetic sequences into attenuated or not-attenuated VLPs or coronaviruses and of their expression is the following provided by the invention. An MHV derived VLP is provided into which a reporter gene such as LacZ or green fluorescent protein has been recombined and one in which the chimaeric MHV/FIPV S gene has been incorporated. The expression of the genes is shown by blue or green- fluorescent staining of VLP infected cells and by the acquired ability to infect feline cells, respectively. The other way to obtain coronavirus-based delivery vehicles uses VLPs comprising foreign RNA sequences. Incorporation of foreign RNA sequences into these particles requires their packaging into nucleocapsids. Viral RNA-packaging by nucleocapsid (N) protein molecules occurs by the recognition of specific sequences, packaging signal (s) by the N protein. In MHV the packaging signal includes a 69 nucleotides long region in gene IB. Foreign
(noncoronaviral) RNAs containing the coronavirus packaging signal (s), or defective coronaviral genomes in which these signal (s) have been retained but into which foreign sequences have been incorporated, are assembled into VLPs when introduced into cells expressing the N, M and E (±S) genes .
The VLP can introduce into a target cell a defined RNA that may have one of several functions. An example provided by the invention is a RNA acting as mRNA and specifying a particular protein such as a toxin or an inducer of apoptosis or an antibody fragment . Another example is an antisense RNA or an RNA with ribozyme activity. For most purposes it is essential to acquire multiple copies of the RNA in each cell to obtain the desired effect. This may not be feasible with VLPs which will only carry one or a few pseudo-NC. The invention thus provides the RNAs with amplification signals such that they will be multiplied in the target cell. To achieve this goal, Semliki Forest virus (SFV) replication sequences are used as the basis of the RNA construct. SFV-derived mRNA further comprising the coronavirus encapsidation sequences and specifying a reporter protein are assembled into VLPs. The SFV-driven amplification allows synthesis of the reporter protein in cells; in animals the appearance of antibodies to the reporter protein testifies to the productive delivery of the VLPs ' content .
The invention also provides a VLP which is an antigen or epitope delivery vehicle meant for the induction of specific immune responses, cellular and/or humoral, systemic and/or local, including the induction and production of specific antibodies against proteins, to achieve protection against infection by pathogens, of viral and nonviral origin.
As an example the invention provides the induction of antibodies against the reporter protein derived from SFV- derived mRNA further comprising the coronavirus encapsidation sequences and specifying a reporter protein, as described above. As another example the induction of antibodies is demonstrated in mice to the FIPV spike and to PRV gD by immunization with the VLPs, also described above. Thus immune responses can be elicited both against proteins which are encoded by the altered genome of the VLP and/or against proteins which have been incorporated as targeting means in the VLP, thereby partly or wholly replacing the original spike protein. The examples illustrate the applicability of the approach for the induction of immune responses against proteins as diverse as for instance viral, bacterial, parasitic, cellular and hormonal origins. As an example the induction of protective immunity in mice against PRV by the gD exposing VLPs is provided. The example illustrates the applicability of the approach in principle for vaccination against viral, bacterial and parasitic pathogens including for instance human coronaviruses . The invention also provides VLPs for diagnostic purposes. In immunoassay always a great need exists for a well- defined, specific and sensitive antigen that can be prepared in large quantities. As an example the use of MHV- based VLPs carrying the PRV gD ectodomain in an ELISA to detect gD antibodies is provided. The invention also provides VLPs which have fully maintained the original spike protein but which are altered genomically to attenuated the VLP and/or to encode nucleotide sequences that need to be delivered at the cells to which the original coronavirus was targeted. For example, in this way, intestinal epithelial cells, or respiratory epithelial cells, that are normally infected by TGEV, or PRCV, respectively, can now interact with VLPs derived from TGEV or PRCV, or other cell-specific coronaviruses if needed, to express proteins normally not expressed by said viruses. In this way, respiratory epithelial cells of cystic fibrosis patients can be induced to express lung surfactant molecules that are encoded by the altered genome of the VLP.
To further demonstrate the invention various examples are provided in the experimental part of this description which is not limiting the invention. Experimental part
Coronaviruses are assembled intracellularly by budding into the intermediate compartment and, later in infection, into the endoplasmic reticulum (ER; Klumperman et al . , 1994; Krijnse Locker et al . , 1994). The cytoplasmically synthesized nucleocapsid (NC) - the viral genomic RNA packaged by nucleocapsid protein (N) molecules - interacts with cytoplasmically exposed domains of viral membrane proteins accumulated in the pre-Golgi membranes. Subsequent budding results in the formation of virions that follow the exocytic pathway out of the cell.
Recently, Vennema et al . , 1996 discovered that the budding of coronavirus particles does not require a NC, whereas others (Bos et al . , 1996) did not demonstrate the independance of VLP assembly from NC. The viral membrane proteins M, E and S, when synthesized by co-expression of their genes in cells, give rise to the production of coronavirus-like particles (VLPs) that are morphologically similar to normal virions (Vennema et al . , 1996) . Moreover, this process is not dependent on the spike (S) protein: spikeless particles were formed when only the genes encoding the membrane (M) protein and the envelope (E) protein were co-expressed. Incorporation of S into VLPs or virions is mediated by the M protein with which S associates (Opstelten et al . , 1995).
The availability of the VLP system as provided by the invention provides us with an extremely valuable and convenient tool to study aspects of coronavirus assembly. This was demonstrated very clearly in a study of the structural requirements of the M protein for assembly. In this study we showed by co-expression of mutated M proteins with the E protein that particle formation is sensitive to changes in all domains of the M protein, i.e. the luminal N-terminal domain, the transmembrane domains and the cytoplasmic C-terminal domain. Particularly the identity of the extreme C-terminus appeared to be very important; substitutions of the terminal residue can abolish VLP assembly nearly completely as does its deletion; deletion of the last two residues or more is fully fatal. To further demonstrate that the VLP assembly system is a faithful model for coronavirion assembly, we introduced several of these mutations into the viral genome by RNA recombination. The results were essentially fully concordant.
The aim of the further examples was to study the incorporation of the S protein into viral particles. In particular, we manipulated the ectodomain of the protein. The results again show that this domain can be replaced by that of an unrelated coronavirus; the interactions with the M protein that draw the S protein into a viral particle apparently reside in its transmembrane or cytoplasmic domain.
Materials and methods
Coexpression of genes; analysis of VLPs .
The mouse hepatitis virus strain A59 (MHV) M, E and S gene expression constructs, the procedures for the coexpression of viral genes in mammalian cells, the methods for the analyses of radiolabeled protein and VLP synthesis have all been previously described (Vennema et al, 1996 and references therein) .
In addition to the polyclonal anti-MHV serum (K134) , two monoclonal antibodies were used: Jl .3 and A3.10 which recognize the ectodomains of the MHV M and S protein, respectively. Ascitis G73 was obtained from a cat infected with feline infectious peritonitis virus (FIPV) and contained antibodies to this virus1 spike protein.
Construction of chimaeric S constructs .
Two expression constructs were prepared encoding mirror image chimaeric MHV/FIPV S proteins : one protein (designated S*) has the transmembrane + cytoplasmic domain of MHV S and the luminal domain (i.e. ectodomain) of FIPV
S, the other (designated S#) has the inverse composition.
The construction made use of a convenient Styl site occurring at an identical position in both the MHV S gene and the FIPV S gene; this Styl site marks the location where in the S protein the ectodomain turns into the transmembrane domain.
The construction of pTFMS, encoding the S* gene, used the pBl cDNA clone (de Groot et al . , 1989) as a source of FIPV strain 79-1146 S sequences. Using standard DNA manipultion methods a a chimaeric S gene construct was prepared consisting of the 3' Styl/BamHI fragment of the MHV S gene (Vennema et al . , 1990) and the 5' coding sequence of the
FIPV S gene spanning the AUG initiation codon down to the corresponding Styl site. The chimaeric gene was ligated as a BamHI fragment into the vector pTUG3 (Vennema et al . ,
1991) behind a bacteriophage T7 promoter.
The reverse chimaeric construct, encoding the S* gene, was prepared from the complementary 5' BamHl/Styl MHV S gene fragment and the 3 ' Styl/Sall FIPV S gene fragment and was cloned into pTUC (Vennema et al . , 1991) . The plasmid was designated pMFS .
Cell fusion assay. Spike proteins were expressed in subconfluent BHK-21 cell cultures grown in 3.5 cm dishes using the vaccinia virus system, now with strain Ankara (MVA) expressing the T7 polymerase (MVA-T7pol) . Per dish 3mg plasmid DNA was transfected. From 2h p.i. cells were kept at 32 °C. At 5h p.i. the transfection medium was taken off and indicator cells were added: felis catus whole foetus (fcwf-D) , 5 x 105 cells per dish. The appearance of syncytia was monitored light microscopically.
Generation of recombinant MHV wi th chimaeric spikes
Homologous RNA recombination as descrived before (Fischer et al . , [1997] and references therein) was used to introduce the chimaeric S* protein into the MHV genome. In order to allow recombination of RNA at locations upstream of the S gene, the RNA donor construct pFVl described by Fischer et al . (1997) was extended in the upstream direction of the S gene by incorporating 1. Ikb sequences of the MHV gene 2. The chimaeric S gene was introduced into this plasmid as follows. Convenient restriction sites were first introduced into the modified donor construct at the 5 ' end of the S gene and just downstream of the 3 ' end of this gene. At the 5' end an Avrll site was engineered by mutating nucleotides 36 and 37 (both thymidines) in the S signal sequence encoding region into cytidines. Just downstream of the S gene the sequence TCTCCTGG was changed into the Sse8387I restriction enzyme recognition sequence CCTGCAGG. Subsequently, a chimaeric S* construct was prepared bordered by the same restriction sites. The Avrll site was engineered using the following PCR primer: 5 ' -CCTAGGGTATATTGGTGATTTTAGATGCATACAAGTTAACGTAACAC-3 ' . The Sse83871 site was created using the PCR primer TCTGTCTTTCCTGCAGGGGCTGTGAT . Finally, the chimaeric gene construct was retrieved using Avrll and Sse83871 and ligated into the donor plasmid that had been treated previously with the same enzymes. Capped RNA was transcribed from the resulting donor plasmid and used for electroporation into MHV-infected L2 cells to allow recombination (Fischer et al . , 1997). The cells were plated onto a monolayer of FCWF cells to enable multiplication of the recombinant virus .
Results
Coexpression of protein genes and evaluation of antibody- specifici ties .
In order to biochemically demonstrate the expression of the MHV M, E and S protein and of the chimaeric S protein (S*) and to show their recognition by specific antibodies, the genes were (co) transfected into OST-7 cells infected with the recombinant vaccinia virus vTF7-3. The proteins were labeled with 35S-amino acids for 3h starting at 5h post infection (p.i.) . Cells were then lysed, lysates were cleared by centrifugation and prepared for immun- oprecipitation using various antibodies. The analysis of the precipitated proteins is shown in Fig.l. The M and S proteins were correctly expressed as shown by the immun- oprecipitates obtained with the anti-MHV antiserum (K134) raised against purified MHV (lanes 1 and 3) . The E protein (which requires a higher gel percentage to be resolved) is poorly recognized by this serum (not shown) . The monoclonal antibody J 1.3 specifically precipitated the M protein (lanes 4 and 8) , though with a lower efficiency than did K134. Another monoclonal antibody, A3.10, precipitated the S protein with high specificity and efficiency (lane 5) . Finally, the antibodies in the feline ascitic fluid G73 recognized the chimaeric protein S* but not the MHV S protein (or the M protein; lanes 2,6 and 7) .
Incorporation of chimaeric S protein into VLPs To demonstrate the incorporation of the chimaeric S* protein into MHV VLPs two approaches were taken. In one approach we affinity-purified the VLPs from the culture media of the cells using the monoclonal antibodies and the ascitic fluid. The isolation of the particles was monitored by the appearance of the M protein as shown in Fig.2. Using the M-specific antibody Jl .3 the release of VLPs was observed to occur when cells expressed M + E + S (lane 7) or M + E + S* (lane 1) . Importantly, no M protein was picked up if the E protein was not present (lane 5), consistent with our earlier findings that VLP assembly minimally requires the combination of M and E (Vennema et al . , 1996) . The VLPs produced during coexpression of M, E and S could also be immunoisolated with the MHV S-specific antibody A3.10 (lane 8) . This was, however, not the case when S had been replaced by S* (lane 2) , as was to be expected since this monoclonal antibody recognizes the Sl- domain of MHV S, which is lacking in the chimaeric protein. Conversely, the VLPs produced by the combination of M, E and S* (lane 3) , not those resulting from M + E + S coexpression (lane 6), could be immunoisolated by the G73 antibodies. That this result (lane 3) was indeed specific was additionally shown by the lack of M protein isolation by these feline antibodies after coexpression of only the M and S* proteins (lane 4) . It should be noted that the direct demonstration of the S* protein in gels was was impaired by the strong copurification of an apparently secreted host cell protein with similar electrophoretic mobility.
To further prove the specificity of the affinity- purification approach, we also analyzed some aliquots of culture fluids in which the VLPs had been disrupted by the addition of detergent. Now no M protein was precipitated by the feline antibodies from the culture fluid of cells expressing the combination of M, E and S* (lane 9) . This observation confirms that the precipitation of M seen in the absence of detergent (lane 3) is the result of the purification of S*-containing VLPs by the S*-specific antibodies.
In the other approach to demonstrate the assembly of the chimaeric S* protein into viral particles we pelleted the VLPs from the culture fluid of cells coexpressing the various genes. Cleared culture supernatants were layered onto a 25 % (w/w) sucrose solution and centrifuged. Pellets were dissolved and analyzed directly in gel. As shown in Fig.3 the production of VLPs was most easily seen by the appearance of the M protein in the pellets (lanes 1, 3 and 5) . When no E protein was coexpressed, no M protein was observed as expected (lanes 2 and 4) . Of the three S proteins coexpressed in this particular experiment it is clear that both MHV S (lane 1) and chimaeric S* (lane 3) are incorporated into VLPs. No incorporation was observed of the wild-type FIPV S protein (lane 5) nor of the inverse chimaeric S protein (S#, not shown) . Biological activi ty of chimaeric spike proteins . In order to determine whether the chimaeric S* protein was biologically active, i.e. able to bind receptors on feline cells and to induce membrane fusion, a cocultivation assay was performed. The S* protein was expressed in BHK-21 cells. As controls the MHV S protein and the FIPV S protein were expressed in parallel as well as the inverse chimaeric spike protein Ss, composed of an MHV-derived N-terminal (i.e. luminal) domain and a FlPV-derived transmembrane + cytoplasmic domain. Feline fcwf-D indicator cells were added 5h p.i. and the cultures were monitored for fusion. As illustrated by the light microscopical observations pictured in Fig.4, wild-type FIPV S protein but not wild- type MHV S protein induced syncytium formation as expected. Importantly, also the chimaeric S* protein was fully biologically active: extensive fusion was observed. This was not the case for the inverse construct, S* .
Generation of recombinant MHV wi th chimaeric spikes : Targeting of murine coronavirus to non-murine cells .
A derivative of the chimaeric S* gene was incorporated into MHV by homologous RNA recombination. Synthetic capped RNA transcribed from a donor DNA construct containing the S* gene was transfected into murine L2 cells that had been infected with MHV. The cells were plated onto monolayers of FCWF-D cells. The effect of recombination was evident from the formation of huge syncytia by the feline cells. No syncytia were formed when no RNA was transfected nor with any other donor RNA lacking the FIPV sequences . The recombinant virus harvested from the culture media was used to infect fresh FCWF-D cells.
Discussion
Noncovalent interactions with the viral M protein mediate the incorporation of spikes into the envelope of coronaviruses (Opstelten et al . , 1995) . In experiments described above we demonstrate that these interactions u> Co to H H o o o
0 PJ cq ft rt P- T Ω rt to TJ Ω tr H rt TJ tr P- 0 P- Ω pi 0 3 rt TJ ra TI P CO 0
0 Ω CD tr 0 PJ 0 tr 0 0 tr H P CD P- tr 0 P CD ra P P) 0 0 0 tr 0 0 P J 0 H CD * Ω
P iP 0 CD CD P Ω J J 0 LQ PJ 0 0 CD 0 0 <! Ω P P CD ft PJ P Hi TJ 3
0 P- LQ 0 rt ra Ω 0 rt Ω ft h-1 PJ ft P- ø 3 P- 0 0 CD CD 0 ft Hi < PJ TJ Ω
3 0
PJ P- Ω 0 CD P 3 (t PJ CD CD CD o Ω CD CD ø 0 P- J P- Ω CΩ P- P- P- P 0
3 P P 0 0 P
P CD tr 0 ft TJ J P- ft rt P- Lq tr m P- rt rt < ø TJ J cq tr 0 0 3 Ω Ω 0
CD P- ra 0 tr 0 CD tr 0 P- P- P- CD 0 P P- CD Ω <! ø 0 <! h-1 CD P- rt
Pi P-
^ P- tr 3 Ξ P CD 3 0 CD CD 0 Ω 3 3 ra 0 P P P- < O CD 3 CD (D tr CD 0
^ PJ P- rt PJ CD PJ P Ξ J PJ tr P- PJ tr J P TJ CD tr CD 0 CD P
0 CD rt tr CΩ 3 1— ' CD TI P- J PJ CD TJ ø 3 0 rt J P < P r rt o tr P P tr CD CD tr Ω M 0 CD P CD P Ω P- rr P- 0 O CD PJ P tr tr
CD CD P- TJ P ^ CD TJ Ω P) P- o CD rt Ω Ω rt tr tr ø > rt CD CD tr CD
Ω Ω rt TJ PJ - PJ 0 tr PJ P- P TJ < -2 0 Ω Ω < P- CD P P- 0- TJ CD CΩ CD CD CD Ω m P- PJ
P o ø tr tr P Ω rt P- P- P- CD PJ P- CD P- 0 0 ra Ω
0 tr 3 TJ CD P 0 CD P- O P- (t P) 0 P- ω P PJ 0 O P 0 P 0 CD P Lq
P- tr P D rt ft CD
(D ø P CD Ω 0 < * PJ CD rt 0 rt <; Ω CD tr P ft 0 PJ ra 0 0 CD H- CD PJ P- rt IP P- PJ ra 0 P
CD P- 0 CD P- 0 P tr CD ft P- h-1
TJ tr
Ω P- 0 rt Ω P- ø 0 0 P- TJ P- rt 0 P < J PJ Ω CD rt 0 0 P- CD -2 CD I—1 Ω ft (t J CD Ω h-1 s -3 0 < P- 0 < P- TJ rt rt P- CD h-1 0 -P p- rt Ω ra P X
PJ ^ ft P- CD CD t p- CD rt P PJ (D
0 CD < H- r rt ft ft PJ tr P- tr P P- CD CD 0 o CD o 0 Ω rt tr P-
TJ ra CD 0 rt ^ tr P- rt CD P PJ ø CD PJ tr P 3 J tr 0 < ft 0 tr tr tr -2 CD P- . ft rt P- 0 ra PJ PJ PJ P P- Z CD tr ft
CD 0 0 LQ ra ft tr CD CD CD PJ a. 0 P- 0 CD CD
Hi 0 ? Ω Ω P- 0 tr CΩ P, CD
CD 0 J ø P- Ω ra ø Ω rt rt TJ 0 CD CD P- 0 0 rt P tr P- 0 m Ω rt — ' ra ft rt h-> tr tr P- P P) tr CΩ CD P- CD X Ω tr 3
0 Pi CD Pi CD f CD 0 0 CD 0 PJ ra CD CD CD - ra CD P- PJ P P- J ? P 3 o rt ^ tr tr tr CD 1 — ' P- P 3 X CD CD ^ P CD CP Ω CΩ Ω o 0 0 tr h>- rt Ω
O ø s CD CD -2 P- H ø p) TJ rr CΩ PJ ra • P- Ξ ft PJ 0 m CD ft 3 3 J
X Ω PJ CΩ P- < CD CD
PJ P- PJ p- P tr PJ tr ω 0 CD 0 -2 0 ra CD PJ rt i
< ft r
P CΩ 0 P- • Ω ø Ω ø CD CD ^ p- 1 tr 0 0 Ω • PJ rt tr ft Ω P CD tr PJ
CD P- CD P Ω CD CD h- 3 ft 0 rt w
0 tr P (D tr ^ 3 P CD 0
Ω P- CΩ PJ Pi P- -2 CD T P- ti PJ 0 3 CD PJ ft CD ft P- P- D P Ω, -2 3 o
H CD 0 0 Ω p- tr PJ CD h-' CD rt <! 0 0 ø 0 P- . 0 PJ P- ft -2 Ω 0 Ω CD ø 3 tr 3 ft i CD CD IP CD PJ 3 ^ rt ø 0 0 P- h-1 P- CD CD TJ TJ PJ 0 PJ
CD P- tr P h-1 TJ CD CD 0 rt ra 3 PJ P 0 0 CD P TJ σs P P-
0 P- 0 w J ' CD PJ 3 0 rt o Ω i ø Ω ft 0 o PJ P H CD 0
CD 0 o CΩ P π tr CD tr J CΩ 0 O ) P- O CD o tr rt CΩ o
P- J 0 ft
0 Ω s2 PJ P- o 0 CD 0 tr 3 ø 0 P- P P CD CD 3 0 rt P PJ 0
0 Ω ø tr P- CD 3 P P- TJ (t tr 0 P TJ tr P- P- 3 CD CD ft
CD ft CD tr 0 Ω CD tr 0 PJ CD PJ 0 TJ CD 0 Ω PJ P- ra CD
P. PJ CD CD ft 3 rt < P \, P- CD 3 PJ o
0 0 3 0 P ft P P CD P- 0 P- ft ø h-1 <: rt CD iP P CD 0 tr CD 0 3 P 0 0 J CD PJ P- 2 ft 0 tr
LQ CΩ P- P- P- CD P- 0 ft 0 PJ PJ P- ø Ω CD
^ 0 -2 0 0 < 0 Ω P- P Ω * TJ
P PJ CD P rt PJ CD 0 CΩ 0 P- P CD Ω PJ P P- P 0 CD Ω 0
TJ 0 rt CD ft rt P- CD P- ø rt 0 CD ft D rt CD P 0 ø tr P- 0 CD --■ C P CO
P -3 ra 0 0 tr P- rt 0 h-1 Ω 0 CD tr tr P- tr rt
3 0 CD TJ P- TJ CD
0 Ω
O tr 0 Ω CD
1 — ' 0 LQ CD 0 ø PJ 0 ft CD Ω CD CD P P P- J 0 P PJ 0
0 Lq 0 rt m tr P PJ P- CD CD 0 CD cn TJ CD <! P PJ 0 TJ
P- TJ rt tr CD P
P- Ω P tr m TJ CD 0 J ø P- CD rt TJ 0 ft TJ CD P- CD <! o tr 0 CD CD ft P 0 P- P- rt o < P- P PJ tr o TJ PJ rt CD P P- rt
CD P tr 0 P- N rt rt tr ø TJ P- o P- CD (t ^ tr P P tr 0 PJ P 3. CD
CD J 0 2 < CD rt -3 0 ft CD tr CD 0 P 0 ø CD CD P) Ω CD CD ø t∑!
P Ω CD P- CD tr P- tr ft ra CD 0 rt J CΩ Ω -Q rt rt rt 0 CD CD < 0
CD CD ^ P P- P- CD rt ø 0 tr CD P- 0 tr CD ft *- •
0 Ω tr CD
0 to 0 Ω TJ CD Ω CD P- ft
-2 PJ CD -2 K ft PJ H1 0 0 0 ^ tr
* ft H tr tr rt CD H- 0 CD Ω P CD CD tr ø' J CD CD PJ CD O • 1 CD ra ø CD CD
further evidence that it is possible to change the targeting properties of coronaviruses by modifying the spike protein, allowing the viruses to cross the species barrier.
T.FGF ΠS TO FTGTTRF.S
Figure 1: Biochemical analysis of expressed viral proteins. OST-7 cells grown in parallel in 3.5cm culture dishes were infected with VTF7-3 and transfected after lh with one or more of the plasmids pTUMM, pTU S, pTM5ab and pTFMS (5mg per plasmid) . They were incubated at 37°C. At 5h p.i., after a starvation period of 0.5h, they were radiolabeled with 35S-amino acids (100 mCi/dish) for 3h after which the culture fluids were taken off and the cells washed with PBS containing Ca++ (0.9mM) and Mg++ (0.5mM) and solubilized in 600 ml/dish lysis buffer (20mM Tris-HCl [pH7.6], 150mM NaCl, 1% Nonidet P-40, 0.5% sodium deoxycholate, 0.1% SDS, lmg of aprotinin, leupeptin, and pepstatin) . Lysates were cleared by centrifugation in an Eppendorf centrifuge for 10 min at 10,000 rpm. Immunoprecipitations were done using 200ml-aliquots of cleared lysate which were diluted with 800ml immunoprecipitation buffer (20mM Tris-HCl [pH7.6], 150mM NaCl, 5m EDTA, 0.5% sodium deoxycholate, 0.1% SDS, lmg of protease inhibitors per ml) before adding the antibodies (2ml K134, 3ml G73, 150ml Jl .3 or 20ml A3.10) . After overnight incubation at 4°C 30ml Pansorbin (Calbio- chem) suspension was added and incubation continued for lh. Immune complexes were then pelleted and washed 3 times with wash buffer I (20mM Tris-HCl [pH7.6], 150mM NaCl, 5mM EDTA, 0.1% Nonidet P-40) and once with wash buffer II (20mM Tris- HCl [pH7.6], 0.1% Nonidet P-40). Final pellets were suspended in Laemmli sample buffer, kept at room temperature for 10 min, heated at 95°C for 2 min, cleared by centrifugation at 10,000 rpm for 5 min and analyzed in 15% polyacrylamide gel. In the figure the combinations of plasmids that had been co-transfected and the antibodies used to immunoprecipitate proteins are indicated as are the positions of the M, S and S* protein.
Figure 2: Analysis of VLPs by affinity purification.
The culture fluids obtained in an experiment as described for Fig.l were cleared by centrifugation at 4,000 rpm for UJ ω to to H o o o ft Hi 0 ) TJ TI P) rt i TJ if-. J Ω Ω P to 3 P- O TI Q, rr* PJ TJ PJ ft P> PJ tr ft -2 σs H
PJ Ω 0 P- PJ P- 0 tr tr P o CD 0 PJ tr o ø CO P- |_1 . PJ J ø P- ø tr ø tr CD o O
? - ft Hi P q α CD CD 0 o CD 0 I-1 P Hi pl q 0 CD 0
• ø ft ιp P- CD o P- Hi PJ P o
CD 0 Hi a PJ 0 ft s; ft ft P- TJ CD CD ø P- P CD CD P- • 3 P- Hi rt CD 3 3 ø 0 CD CD P Ω rt Ω CD P 0 0 Ω -J P ø CD CD tr P- PJ rt CD P-
-3 ft P t-1 CD tr 0 Ω P- TJ o P- P P- Ω ft CD • TJ Ω . 3 ø P- P rt TJ ø
Pi CD tr CD CD P- TJ 3 0 (D Hi CD PJ Hi CD Ω rt SO H . 3 rt 0 Ω tr CD Ω rt CD 0 ra *> 3 • _ CD rt 0 tr CD J P- 1 P- p ø P- Hi 0 _ — , CD P Hi P- ft J P- ø LQ CD CD rt rt y-1 .. ø H ∞ CD tr ø r *> Hi 0 t td Z Ω CD pl ø PJ CD tr PJ 0 tr tr -2 LP CO CD CD Ω Ω O P- Ω Ω rf- P- ffi co CD 0 n P tr PJ 0 ft CD ft T CD CD CD P- D s P TJ P- rt g 3 P J tr cp « P Ω P- CD rt PJ CΩ P- CD ^ ft ft PJ CD 0 Ω P P- rt Ω ____ 3 3 CD ø tr Ω CD ft Ω Ω P- PJ Ω P TJ tr LQ PJ tr P TJ CD o CD CD P- ø CD P)
TJ rt t Ω 0 0 TJ o ^ -2 ø 0 0 -2 -2 P CD CD P CD 3 Ω ra 3 CD pl ø P M
H 0 3 P CO Ω 0 N CD P- PJ P- CD ) < Ω ^ CD tr P- CD 0 P CD CD TJ
P- 3 CD Ω CD ft * CD CD CD P ft ft P CD H -3 CD < LQ CD P- TJ -2 CD 3 P- PJ TJ
. P- Ω ft Ω CD P- P- CD Ω h-1 PJ
TJ tr CD 3 TI ø P- tr1 CD CD J 0 P- CD CD m Ω CD CD
Ω CD P ?r < rt Ω CD P) 0 P- -o CD TJ 0 P PJ ft P Ω 1 P- o Ω 0
P 0 0 J P- Hi Ω tr 0 ^ rt P- P- P- ra ft CD rt PJ CD Ω CTi ffi 3 0
Ω Ω ft Hi ft P- ft CD CD D t rt O ; CO 0 CD L ø Ω J P- ft 0 o o TJ C 0 to CD ra r P P- Hi CD 0 ft m P P 1 Ω tr 0 PJ P- Ω CD PJ Ω o CD ft P
CD Ω . CD J 2 o P- CD
P- m tr TJ ra Z 0 TJ PJ TJ ^ PJ 0 0 0 CΩ TJ CD 3 CD Ω 0 Hi ra O . 0 < ø 0 CD Ω Ω Hi P, CD PJ tr Pl 0 PJ TJ J CD TJ 0 , — , X P P
0 TJ Pl CΩ o 1— ' 0 P tr PJ ^ P CD PJ "< P- z ft TJ CD P- CD Ω
P- tr > Hi Hi CD ^ < Lq Ω CD CD rt ^ PJ ' CΩ • : Ω Ω CD P- P P) X CD tr CD ft Ω CD rt CD Pl 0 X PJ CD 0 CD 2 rt y-1 CD CD PJ Hi P CD PJ - -J CD 3 0
CΩ PJ Ω -J CD ft TJ Ω rt Ω CD *• P P1 CD P- CD CD ft CD P, ft P- • -2 CL. CD rt h-> Hi ft TJ P- tr P P CD ft I-1 P. PJ CD ft 0 CD CD CD CD iP σi CD P. P
PJ Ω tr CD 0 o CD CD ^ P- O CD J TJ ø CD LQ Ω . X TJ P- 0 P P- P-
P ^ P h-1 0 CD 0 TJ PJ PJ rt pl CD Hi Ω TJ CD 0 Ω ^ CD 0 0 !--'.
CD 3 TJ 2 CD PJ 0 P 3 cJ Hi P, PJ P P h-- rt 3 c
PJ • 0 P- PJ 0 CD
P- 3 f < 0 CD P- UJ 2 CD ø < CD TJ rt CD Ω ^ CΩ 0 ft Lq
CΩ Pi ft P- P 0 CD P- J CD Hi ft
P- TJ P, P, 0 to ω Ω r1 P PJ CΩ Ω P CD ui Ω tr PJ CD tr tr P- Hi CD rt
Ω P P- CD P 0 o * ft w TJ CD Ω Hi ra P P- Ω o -2 CD 0 •
0 CD o ft CD PJ TJ CD PJ Ω 3 0 PJ tr n CD • CD P rt Hi tr CD 3 CD CΩ Hi 3
-2 0 P Ω "< rt rt P 3 P- X PJ • TJ P. • I D P- CD CD P 2 -2 > ø TJ Ω PJ ft CD 0 Lq LQ to Ω Pl Ω CD P- 0 tr Ω PJ CD P- ø
P- Ω Z 0 CD P- ft CD P- tr y-1 P- n 2 PJ 3 0 ø P- rt TJ ft 0 -3 CD ιq 3 rt
O Ω Hi CD P- 0 CD rt <Λ° 0 P- CD Hi ft CD rt Ω P PJ 0 Hi CD PJ tr CD 3 P-
Hi rt Hi P- ra Z CD - P) ft Ω CD ^ TJ Ω CΩ Hi PJ n CD 0 ø tr ø CD α CD PJ rt PJ 0 CD J PJ CD -A tr CD 0 TJ 1 ft CD CD P -A P. ø Ω ft P ^ Ω 0 0 CD 3 rt 0 CD PJ CD P --■ ft P TJ Ω CD Ω P CD -. Ω tr CD 0 Ω ft t rt CD TJ Ω TJ Hi J f Ω CD 0 Hi P- CD 4-. rt TJ P-
CD CΩ Ω CD CD tr J Ω P CD ft -2 ø H 0 Ω P 0 ra 0 -2 Ω P CD
^ P- ø O P (t CD ~J Ω CD CD CD tr P rt P- P- ft CΩ Ω tr PJ Ω -3 rt CD CΩ
Hi CD ft h-1 0 Hi CD P CD P- p P CD tr TJ tr P P- CD ø 3J p- i Ω
Ω tr P- CD s2 P- Ω tr o CD CD TJ -2 CD P- P- CD
P PJ P- 3 P- P- z
0 PJ P- 0 ft P- P- TJ 0 o Z Pl P- r CD 0 tr P- PJ ft W CD ιp TJ CD
-2 Z rt Hi tr 0 tr Hi o Ω tr TI rt P- Ω PJ Hi CD N tr CD Lq 0 σ ra P- P
0 0 Z (D tr CD P- o Hi 0 P- 2 tr CΩ 0 rt P- P- CD P pl H rt CD
-2 PJ P Ω P- CD Ω in tr CD < Lq rt CD CD rt P CD P Z i '
P- -3 CΩ CD ft 2 Ω CD P TJ tr ø- . 0 CD rt f ø tr l-h < P- CD rt PJ
0 CD CD PJ CΩ 3 P- ø CD ø TJ P CD o T1 3 ft X P- o P CΩ < ft P- PJ Ω rt TI CD P PJ m CD P TJ tr CD tr Ω Ω
CD CD CD ra 0 J 0 tr P -2 CD Hi •-. • CD CD P- H CD 0 CD
CD td CO 0 CD Ω o CD rt ^ Hi P- 0 >-3 TJ CD P.
C-. ffi P- P- 3 P P CD o 0 w ft
CD « P) 0 CD P 1 P 3 £- ft ft CD Ω
expressions: wild-type MHV S (MHV-S); wild-type FIPV S (FIPV-S) ; chimaeric MHV/FIPV S* (S*) ; chimaeric MHV/FIPV S# (S#) ; mock-transfection (-DNA); mock-infection + mock- transfection (-MVA-DNA).
RF-FF-RFiN FnS
Bos, E.C., Luytjes, W., van der Meulen, H.V. , Koerten, H.K., and Spaan, W.J.M. (1996). The production of recombinant infectious DI -particles of a murine coronavirus in the absence of helper virus. Virology 218, 52-60.
Fischer, F., Stegen, C.F., Koetzner, C.A., and Masters, P.S. (1997) . Analysis of a recombinant mouse hepatitis virus expressing a foreign gene reveals a novel aspect of coronavirus transcription. J. Virol. 71, 5148-5160.
Groot R.J. de, Maduro, J., Lenstra, J.A., Horzinek, M.C., Zeijst, B.A.M. van der, and Spaan, W.J.M. (1989) . cDNA cloning and sequence analysis of the gene encoding the peplomer protein of feline infectious peritonitis virus. J. Gen. Virol. 68, 2639-2646.
Klumperman, J. , Krijnse Locker, J., Meijer, A., Horzinek, M.C., Geuze, H.J., and Rottier, P.J.M. (1994). Coronavirus M proteins accumulate in the Golgi complex beyond the site of virion budding. J.Virol. 68, 6523-6534.
Krijnse Locker, J., Ericsson, M., Rottier, P.J.M. , and Griffiths, G. (1994). Characterization of the budding compartment of mouse hepatitis virus: evidence that transport from the RER to the Golgi complex requires only one vesicular transport step. J. Cell Biol. 124, 55-70.
Opstelten, D.-J.E., Raamsman, M.J.B., Wolfs, K. , Horzinek, M.C., and Rottier, P.J.M. (1995) . Envelope glycoprotein interactions in coronavirus assembly. J. Cell Biol. 131, 339-349.
Rottier, P.J.M. (1995) . The coronavirus membrane protein. In: The Coronaviridae (S .G. Siddell , Ed.), Plenum Press, New York, pp.115-139. Vennema, H. , Heijnen, L., Zijderveld, A., Horzinek, M.C., and Spaan, W.J.M. (1990) . Intracellular transport of recombinant coronavirus spike proteins: implications for virus assembly. J. Virol. 64, 339-346.
Vennema, H. , Rijnbrand, R. , Heijnen, L., Horzinek, M.C., and Spaan, W.J.M. (1991) . Enhancement of the vaccinia virus/phage T7 RNA polymerase expression system using encephalomyocarditis virus 5 ' -untranslated region sequences. Gene 108, 201-210.
Vennema H., Godeke, G.-J., Rossen, J.W.A. , Voorhout, W.F., Horzinek, M.C., Opstelten, D.-J.E., and Rottier, P.J.M. (1996). Nucleocapsid- independent assembly of coronavirus- like particles by coexpression of viral envelope proteins. EMBO J. 15, 2020-2028.

Claims

1. A virus-like particle derived from a coronavirus provided with a at least one biologically active protein or fragment thereof associated with the surface of said viruslike particle other than the natural ectodomain of any one protein of the original corona virus.
2. A virus-like particle derived from a coronavirus provided with a at least one biologically active protein or fragment thereof associated with the inside of said virus- like particle other than the natural endodomain of any one protein of the original corona virus.
3. A virus-like particle derived from a coronavirus provided with a at least one functional targeting means associated with the surface of said virus-like particle other than the natural spike protein of the original corona virus.
4. A virus-like particle derived from a coronavirus according to any of claims 1 to 3 wherein said particle is provided with a coronavirus genome wherein a gene or parts thereof have been deleted.
5. A virus-like particle derived from a coronavirus according to any of claims 1 to 3 wherein said particle is provided with a coronavirus genome wherein a foreign gene or parts thereof have been inserted.
6. A virus-like particle according to claim 4 or 5 which has been attenuated.
7. A virus-like particle according to any of claims 1 to 6 which is a gene delivery vehicle.
8. A virus-like particle according to any of claims 1 to 6 which is an antigen or epitope delivery vehicle.
9. A virus-like particle according to anyone of claims 1 to 8 in which said biologically active molecule or said targeting means is a protein or -(poly) peptide
10. A virus-like particle according to claim 9 in which the targeting means is a membrane component.
11. A virus-like particle according to claim 10 in which the membrane component comprises a viral envelope protein.
12. A virus-like particle according to claim 11 in which the membrane component comprises at least a part of a spike protein or a derivative thereof.
13. A virus-like particle according to claim 12 in which the membrane component comprises at least a cell surface receptor molecule.
14. A virus-like particle according to claim 13 in which the receptor molecule comprises the CD4 molecule or a derivative thereof.
15. A virus-like particle according to claim 14 in which the targeting means comprises a molecule, or fragments thereof, selected from the group of microbial antigens, hormones, enzymes and toxins.
16. A virus-like particle according to claim 9 in which the targeting means comprises a molecule, or fragments thereof, selected from a single-chain antibody fragment.
17. A composition comprising a virus-like particle according to any of claims 1 to 16 for therapeutic use.
18. A composition comprising a virus-like particle according to any of claims 1 to 16 and a pharmaceutically acceptable carrier for use as an immunogen or vaccine.
19. A composition comprising a virus-like particle according to any of claims 1 to 16 for diagnostic use.
PCT/NL1998/000237 1997-04-29 1998-04-29 Corona virus-like particles as tools for vaccination and therapy WO1998049195A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU73507/98A AU7350798A (en) 1997-04-29 1998-04-29 Corona virus-like particles as tools for vaccination and therapy

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP97201292.6 1997-04-29
EP97201292 1997-04-29

Publications (1)

Publication Number Publication Date
WO1998049195A1 true WO1998049195A1 (en) 1998-11-05

Family

ID=8228281

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/NL1998/000237 WO1998049195A1 (en) 1997-04-29 1998-04-29 Corona virus-like particles as tools for vaccination and therapy

Country Status (2)

Country Link
AU (1) AU7350798A (en)
WO (1) WO1998049195A1 (en)

Cited By (18)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001002551A2 (en) * 1999-06-30 2001-01-11 Evotec Oai Ag Virus like particles, preparation and use in screening and functional genomics
EP1219705A1 (en) * 2000-12-29 2002-07-03 Evotec OAI AG Virus like particles, their preparation and their use preferably in pharmaceutical screening and functional genomics
WO2002092827A2 (en) * 2001-05-17 2002-11-21 Universiteit Utrecht Corona-virus-like particles comprising functionally deleted genomes
WO2004078203A2 (en) * 2003-03-03 2004-09-16 Akzo Nobel N.V. Infectious bronchitis virus with an altered spike gene
WO2004084940A1 (en) * 2003-03-26 2004-10-07 Cytos Biotechnology Ag Packaging of immunostimulatory oligonucleotides into virus-like particles: method of preparation and use
WO2005080419A1 (en) * 2003-05-16 2005-09-01 Institute Of Microbiology, Chinese Academy Of Sciences Polypeptide agent for inhibiting sars coronavirus and its derivatives and use thereof
WO2006056103A1 (en) * 2004-11-26 2006-06-01 Dna Shuttle Biopharm Co., Ltd. An expression vector encoding coronavirus-like particles
US7419802B2 (en) 1999-06-30 2008-09-02 Evotec Ag Virus like particles, their preparation and their use preferably in pharmaceutical screening and functional genomics
US7476517B2 (en) 1999-06-30 2009-01-13 Evotec Ag Virus like particles, their preparation and their use preferably in pharmaceutical screening and functional genomics
US7537767B2 (en) 2003-03-26 2009-05-26 Cytis Biotechnology Ag Melan-A- carrier conjugates
SG152020A1 (en) * 2003-08-06 2009-05-29 Nat Environment Agency Diagnostic methods
US7556957B2 (en) 2001-05-17 2009-07-07 Stichting Voor De Technische Wetenschappen Coronavirus-like particles comprising functionally deleted genomes
US7597905B2 (en) 2000-02-28 2009-10-06 Beacle Inc. Hollow protein nano-particles and method of introducing substances into cells
WO2012117045A1 (en) 2011-03-02 2012-09-07 Intervet International B.V. Infectious bronchitis virus (ibv) spike protein as subunit vaccine
US8574564B2 (en) 2005-12-14 2013-11-05 Cytos Biotechnology Ag Immunostimulatory nucleic acid packaged particles for the treatment of hypersensitivity
US8586728B2 (en) 2006-12-12 2013-11-19 Cytos Biotechnology Ag Oligonucleotides containing high concentrations of guanine monomers
US8691209B2 (en) 2001-09-14 2014-04-08 Cytos Biotechnology Ag Packaging of immunostimulatory substances into virus-like particles: method of preparation and use
US9404126B2 (en) 2006-06-12 2016-08-02 Kuros Biosciences Ag Processes for packaging aggregated oligonucleotides into virus-like particles of RNA bacteriophages

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1992003537A1 (en) * 1990-08-15 1992-03-05 Therion Biologics Corporation Self-assembling replication defective hybrid virus particles
WO1993005147A1 (en) * 1991-08-30 1993-03-18 The United States Of America, Represented By The Secretary, Department Of Health And Human Services Defective interfering hiv particles with chimeric cd4-env
WO1994008022A1 (en) * 1992-09-28 1994-04-14 Commonwealth Scientific And Industrial Research Organisation Vector to deliver and express foreign gene
WO1994010323A1 (en) * 1992-11-04 1994-05-11 Imperial Cancer Research Technology Limited Virus with modified binding moiety specific for the target cells
EP0652287A2 (en) * 1993-09-22 1995-05-10 American Home Products Corporation Poxviral vectors and their use as a vaccine against feline infectious peritonitis virus disease

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1992003537A1 (en) * 1990-08-15 1992-03-05 Therion Biologics Corporation Self-assembling replication defective hybrid virus particles
WO1993005147A1 (en) * 1991-08-30 1993-03-18 The United States Of America, Represented By The Secretary, Department Of Health And Human Services Defective interfering hiv particles with chimeric cd4-env
WO1994008022A1 (en) * 1992-09-28 1994-04-14 Commonwealth Scientific And Industrial Research Organisation Vector to deliver and express foreign gene
WO1994010323A1 (en) * 1992-11-04 1994-05-11 Imperial Cancer Research Technology Limited Virus with modified binding moiety specific for the target cells
EP0652287A2 (en) * 1993-09-22 1995-05-10 American Home Products Corporation Poxviral vectors and their use as a vaccine against feline infectious peritonitis virus disease

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
C.-L. LIAO ET AL.,: "Coronavirus defective-interfering RNA as an expression vector: the generation of a pseudorecombinant mouse hepatitis virus expressing hemagglutinin-esterase", VIROLOGY, vol. 208, 1995, ORLANDO, FL, US, pages 319 - 327, XP002034204 *
E.C.W. BOS ET AL.,: "The production of recombinant infectious DI-particles of a murine coronavirus in the absence of helper virus", VIROLOGY, vol. 218, 1996, ORLANDO, FL, US, pages 52 - 60, XP002043749 *
H. VENNEMA ET AL.,: "Nucleocapsid-independent assembly of coronavirus-like particles by co-expression of viral envelope protein genes", THE EMBO JOURNAL, vol. 15, no. 8, 1996, OXOFRD, GB, pages 2020 - 2028, XP002043750 *
M. MARIN ET AL.: "Targeted infection of human cells via major histocompatibility complex class I molecules by Moloney murine leukemia virus-derived viruses displaying single-chain antibody fragment-envelope fusion proteins", JOURNAL OF VIROLOGY, vol. 70, no. 5, 1996, WASHINGTON DC, US, pages 2957 - 2962, XP000615448 *

Cited By (29)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001002551A3 (en) * 1999-06-30 2001-11-08 Evotec Biosystems Ag Virus like particles, preparation and use in screening and functional genomics
WO2001002551A2 (en) * 1999-06-30 2001-01-11 Evotec Oai Ag Virus like particles, preparation and use in screening and functional genomics
US7476517B2 (en) 1999-06-30 2009-01-13 Evotec Ag Virus like particles, their preparation and their use preferably in pharmaceutical screening and functional genomics
US7419802B2 (en) 1999-06-30 2008-09-02 Evotec Ag Virus like particles, their preparation and their use preferably in pharmaceutical screening and functional genomics
US7597905B2 (en) 2000-02-28 2009-10-06 Beacle Inc. Hollow protein nano-particles and method of introducing substances into cells
EP1219705A1 (en) * 2000-12-29 2002-07-03 Evotec OAI AG Virus like particles, their preparation and their use preferably in pharmaceutical screening and functional genomics
WO2002092827A2 (en) * 2001-05-17 2002-11-21 Universiteit Utrecht Corona-virus-like particles comprising functionally deleted genomes
AU2002311668B2 (en) * 2001-05-17 2007-10-04 Stichting Voor De Technische Wetenschappen Corona-virus-like particles comprising functionally deleted genomes
WO2002092827A3 (en) * 2001-05-17 2004-05-27 Univ Utrecht Corona-virus-like particles comprising functionally deleted genomes
US7556957B2 (en) 2001-05-17 2009-07-07 Stichting Voor De Technische Wetenschappen Coronavirus-like particles comprising functionally deleted genomes
US8691209B2 (en) 2001-09-14 2014-04-08 Cytos Biotechnology Ag Packaging of immunostimulatory substances into virus-like particles: method of preparation and use
US9950055B2 (en) 2001-09-14 2018-04-24 Kuros Biosciences Ag Packaging of immunostimulatory substances into virus-like particles: method of preparation and use
WO2004078203A3 (en) * 2003-03-03 2004-11-25 Akzo Nobel Nv Infectious bronchitis virus with an altered spike gene
WO2004078203A2 (en) * 2003-03-03 2004-09-16 Akzo Nobel N.V. Infectious bronchitis virus with an altered spike gene
US7445785B2 (en) 2003-03-03 2008-11-04 Intervet International B.V. Infectious bronchitis virus with an altered spike gene
US7517520B2 (en) 2003-03-26 2009-04-14 Cytos Biotechnology Ag Packaging of immunostimulatory oligonucleotides into virus-like particles: method of preparation and use
US7537767B2 (en) 2003-03-26 2009-05-26 Cytis Biotechnology Ag Melan-A- carrier conjugates
AU2004224762B2 (en) * 2003-03-26 2009-12-24 Kuros Us Llc Packaging of immunostimulatory oligonucleotides into virus-like particles: method of preparation and use
WO2004084940A1 (en) * 2003-03-26 2004-10-07 Cytos Biotechnology Ag Packaging of immunostimulatory oligonucleotides into virus-like particles: method of preparation and use
WO2005080419A1 (en) * 2003-05-16 2005-09-01 Institute Of Microbiology, Chinese Academy Of Sciences Polypeptide agent for inhibiting sars coronavirus and its derivatives and use thereof
SG152020A1 (en) * 2003-08-06 2009-05-29 Nat Environment Agency Diagnostic methods
WO2006056103A1 (en) * 2004-11-26 2006-06-01 Dna Shuttle Biopharm Co., Ltd. An expression vector encoding coronavirus-like particles
US8574564B2 (en) 2005-12-14 2013-11-05 Cytos Biotechnology Ag Immunostimulatory nucleic acid packaged particles for the treatment of hypersensitivity
US9902972B2 (en) 2006-06-12 2018-02-27 Kuros Biosciences Ag Processes for packaging oligonucleotides into virus-like particles of RNA bacteriophages
US9404126B2 (en) 2006-06-12 2016-08-02 Kuros Biosciences Ag Processes for packaging aggregated oligonucleotides into virus-like particles of RNA bacteriophages
US10358656B2 (en) 2006-06-12 2019-07-23 Kuros Biosciences Ag Oligonucleotides packaged into virus-like particles of RNA bacteriophages
US8586728B2 (en) 2006-12-12 2013-11-19 Cytos Biotechnology Ag Oligonucleotides containing high concentrations of guanine monomers
US9914746B2 (en) 2006-12-12 2018-03-13 Kuros Biosciences Ag Oligonucleotides containing high concentrations of guanine monomers
WO2012117045A1 (en) 2011-03-02 2012-09-07 Intervet International B.V. Infectious bronchitis virus (ibv) spike protein as subunit vaccine

Also Published As

Publication number Publication date
AU7350798A (en) 1998-11-24

Similar Documents

Publication Publication Date Title
Kuo et al. Retargeting of coronavirus by substitution of the spike glycoprotein ectodomain: crossing the host cell species barrier
JP7250520B2 (en) Recombinant arterivirus replicon system and uses thereof
WO1998049195A1 (en) Corona virus-like particles as tools for vaccination and therapy
EP1470218B1 (en) Corona-virus-like particles comprising functionally deleted genomes
Tresnan et al. Feline aminopeptidase N serves as a receptor for feline, canine, porcine, and human coronaviruses in serogroup I
Casais et al. Reverse genetics system for the avian coronavirus infectious bronchitis virus
CA2074502C (en) Vaccines
Haijema et al. Switching species tropism: an effective way to manipulate the feline coronavirus genome
JP2593295B2 (en) Virus with recombinant surface protein
Godeke et al. Assembly of spikes into coronavirus particles is mediated by the carboxy-terminal domain of the spike protein
EP0013828B1 (en) Recombinant DNA, hosts transformed with it and processes for the preparation of polypeptides
Mueller et al. Expression of foreign proteins by poliovirus polyprotein fusion: analysis of genetic stability reveals rapid deletions and formation of cardioviruslike open reading frames
Woolston et al. Agroinfection and nucleotide sequence of cloned wheat dwarf virus DNA
AU2002311668A1 (en) Corona-virus-like particles comprising functionally deleted genomes
JPH09504961A (en) Modified plant viruses as vectors for heterologous peptides
CZ295138B6 (en) Nucleotide sequences of pestivirus strains, polypeptides encoded by these sequences and use thereof for diagnosis and prevention of pestivirus infections
JP2000513944A (en) Recombinant swinepox virus
EP0182442B1 (en) Recombinant dna molecules and their method of production
US7556957B2 (en) Coronavirus-like particles comprising functionally deleted genomes
Bosch et al. Coronavirus spike glycoprotein, extended at the carboxy terminus with green fluorescent protein, is assembly competent
Liao et al. Coronavirus defective-interfering RNA as an expression vector: the generation of a pseudorecombinant mouse hepatitis virus expressing hemagglutinin-esterase
Lai Replication of coronavirus RNA
JPH01160998A (en) Polypeptide
CN116640736A (en) Construction of SARS-CoV-2 vaccine candidate strain of recombinant human 4 type adenovirus vector and its application
Dixon et al. Cloning and manipulating cauliflower mosaic virus

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GE GH GM GW HU ID IL IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US UZ VN YU ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW SD SZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN ML MR NE SN TD TG

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

NENP Non-entry into the national phase

Ref country code: JP

Ref document number: 1998546852

Format of ref document f/p: F

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: CA