WO1998054306A1

WO1998054306A1 - Method for isolating an intracellular substance

Info

Publication number: WO1998054306A1
Application number: PCT/FR1998/001098
Authority: WO
Inventors: Lyse Santoro; Patrick Broyer; Bruno Mougin
Original assignee: Bio Merieux
Priority date: 1997-05-29
Filing date: 1998-05-29
Publication date: 1998-12-03
Also published as: FR2763957B1; FR2763957A1; AU8024298A

Abstract

The invention concerns a method for isolating a nucleic and/or protein intracellular substance, from a cell sample suspended in a liquid, comprising the following steps: exposing the sample to at least an electric pulse, whereof at least one characteristic is determined for a partial or complete lysis of the intracellular substance; separating from the lysed cell substance a nucleic and/or protein fraction. The invention is characterised in that: a) the duration of the electric pulse, defined by the time interval during which the voltage is not less than 50 % of the maximum voltage, is not less than 200 ms; and b) after separating protein fraction from the nucleic fraction of the lysed cells, the nucleic and/or protein fraction can be directly subjected to at least a treating step.

Description

METHOD FOR ISOLATING INTRACELLULAR MATERIAL

The present invention relates to a method for isolating intracellular, nucleic and / or protein material, from a cell sample suspended in a liquid, comprising a cell lysis step and a separation step.

The process of the invention is simple to implement, is suitable for any cell, eukaryotic cell, prokaryotic cell, in particular Gram + or Gram - bacteria, whatever the nature and the resistance of the cell envelope, and makes it possible to '' Direct access to the intracellular material without the need for an additional purification step.

The Applicant has discovered, completely unexpectedly, that the exposure of a cell sample to an electric pulse, under determined reaction conditions, leads to cell lysis with maximum yield, while liberating intracellular constituents in a form directly exploitable in a subsequent stage of treatment, in particular separation.

As summarized in the article by TY TSONG (in Biophysical Journal of Biochemical Society (1991) (5 (), 297-308), there is a known method of electrical treatment of a suspension of cells, used in the technique known as electroporation, and characterized by the exposure of the suspension to an electric field. According to this technique, the cell membrane is perforated to obtain pores, through which the intracellular constituents will exit, but through which it is thus possible to The introduction of various exogenous substances. The wide variety of substances which can be incorporated, such as, for example, molecules with biological or pharmaceutical activity, acids or fragments of nucleic acids, and in particular plasmids, gives this technique a wide spectrum of uses. More precisely, this technique consists in applying an electric field of an intensity greater than the dielectric force of the cell membrane, resulting in a modification of its conductivity and therefore of its permeability. Provided that it operates under substantially isotonic conditions so that an osmotic pressure of the same order exists between the interior and the exterior of the cell, this structural transformation of the membrane is reversible, and when the suspension is no longer subjected as a result of the electric field, the pores close up, trapping the exogenous substances that have entered. Each species of cell has an optimal value for the electric field. The latter depends directly on the resistance and the constitution of the cell wall. It should be noted that a field of too high intensity causes the formation of pores of such a size that they can no longer close, and thus causes the death of the cell.

K. KINOSITA et al. (Biochimica and Biophysica Acta (1979) 554. 479-497) observed that the exposure of an isotonic suspension of erythrocytes to an electric field leads to an increase in membrane permeability, but that the flux of solute entering at inside the cell by the pores formed in the membrane, causes swelling of the cell which causes its lysis. However, this lysis phenomenon after electroporation, resulting from an overpressure inside the cell, has been observed for erythrocytes which have a fairly weak plasma membrane, and cannot be generalized to all types of cells, in particular bacteria.

Patent application WO 91/18103 discloses a method for making cell membranes permeable in order to make molecules penetrate inside. The method consists in emitting two successive short-duration rectangular type discharges, the first of 400 to 25,000 V / cm, of a duration of 10 μs to 10 ms and of capacity 40 μF, the second from 50 to 1000 V / cm with a duration of 1 ms to 1 s, with a capacity of 1800 μF. The two electrical impulses must follow each other in a very short period of time, less than 10 s, so that the cell mortality rate is not too high.

Patent application WO 88/02777 discloses a method of extracting cellular content of any origin while preserving the cellular structure by the application of several short electrical discharges, of a duration between 1 ns and 1 ms, with an electric field varying from 100 to 15000 V / cm.

US Patent 5,326,530 discloses a method for killing bacteria present in a contaminated product. The process consists in irreversibly breaking the membranes of bacteria by applying electrical impulses of the order of at least a few hundred at 10,000 V / cm for an extremely short period of between 0.2 and 200 μs.

According to the invention, there is provided a method allowing in a very short time to lyse all the cells from a suspension, whatever the cell concentration, that is to say even for high concentrations, in order to isolate an intracellular nucleic and / or protein material, which is separated and which, after separation, is liable to be directly subjected to a processing step.

This process for isolating intracellular nucleic and / or protein material, from a cell sample suspended in a liquid, comprises the steps of:

- The sample is exposed to at least one electrical pulse, at least one characteristic of which is determined to allow partial or complete lysis of the cells; a nucleic fraction and / or a protein fraction are separated from the lysed cells, and is characterized in that:

(a) the duration of the electrical pulse, defined by the time interval during which the electrical voltage is at least equal to 50% of the maximum voltage, is at least equal to 200 ms, and

(b) after separation of the protein fraction from the nucleic fraction of the lysed cells, the nucleic fraction may be subjected directly to at least one processing step. Before setting out variants of the process of the invention, and detailing its characteristics and advantages, certain terms used in the present description and the claims are defined below.

By "isolation of an intracellular material" according to the invention is understood the separation, according to a specific or aspecific isolation method, qualitatively and / or quantitatively.

According to a variant of the method of the invention, as well as the illustration which is made of it in Example 2 and 3 which follow, the method is applied to the isolation of nucleic material, but of course, this particular implementation does not introduce any limitation to this material. Thus, the intracellular material to be isolated can consist of a protein fraction. By "cell sample" according to the invention is understood any sample capable of containing cells, in particular a biological sample such as that obtained from a biological fluid, a sample of food origin. The sample consists of all or part of a sample, in particular it can consist of an aliquot, a dilution.

By "partial or complete lysis of cells" according to the invention, it is understood that the membranes and / or wall of the cells present in the cell sample are irreversibly lysed, so as to release the intacellular material which one wishes to isolate and then treat . By "capable of being subjected directly to a processing step", it is understood that the isolated intracellular material can be, without additional purification step, subjected to a processing step useful for detecting and / or identifying a component of the fraction of the isolated intracellular material.

According to the invention, an electrical pulse is defined as a significant contribution of electrical energy over a short period. For step (a), the duration of the pulse can in particular be determined by the capacity and / or the electrical resistance of an electrical charging circuit. For example, the capacitance has a value at least equal to 500 μF, preferably at least equal to 950 μF, and / or the resistance has a value at least equal to 50 Ohms.

A characteristic of the electric pulse is advantageously determined to establish in the sample an electric field at least equal to 2500 V / cm.

The characteristics of the electrical pulse to be applied to the cell sample to cause lysis according to the invention can be achieved by means of an electric generator recommended for the electroporation technique, although the range of values of the characteristics according to the invention lies outside the field of those used in electroporation.

For a better yield of cell lysis, the liquid in which the cell sample is in suspension is preferably water.

In a particular implementation of the inventive method, the intracellular material to be isolated is a nucleic acid material, and separating the nucleic material ^'by contacting the lysed cell sample with a protease or a compound releasing organic radicals . The protease or said reagent can be introduced initially into the cell sample, during or after step (a) of lysis. The protease is in particular chosen from pronase, subtilysins, pepsin, trypsin, lysozyme, chymotrypsin, 1 'α-chymotrypsin and proteinase K. Advantageously, proteinase K is used. The concentration of proteinase K in the The sample is between 0.5 and 9 mg / ml, preferably between 3 to 6 mg / ml, and more preferably, the concentration is equal to 6 mg / ml.

A radical-releasing compound useful for separating nucleic material is a compound which can produce, under certain conditions such as exposure to a source of light, thermal energy, or under certain chemical conditions, a radical carrying at least one free electron , very unstable and very reactive. A preferred compound is a per-compound, in particular chosen from periodate, paraperiodate, sodium peroxide, perborate and for example sodium perborate tetrahydrate.

In a preferred embodiment according to the invention, the processing step is a step of detecting at least one component of the nucleic fraction or a step of amplifying at least one component of the nucleic fraction.

In this step of the method for processing a nucleic material, it is desirable that the lysis step (a) leads to at least partial denaturation, or even fragmentation, of the nucleic material to be treated. However, the method of the invention can also make it possible to recover intact intracellular material. By intact is meant material that is substantially undenatured and unfragmented. For this purpose, we will preferably choose an electrical pulse determined by a capacity of 500 μF, a resistance of 186 Ohms and an electrical voltage of 500 V. The present invention is illustrated below in the following examples 1 to 3, with reference to FIGS. 1 to 6.

Figure 1 represents the percentage of cell lysis as a function of the capacitance of the capacitor, for two values of the voltage of 2.5 kV and 0.45 kV respectively, and a resistance of 186 Ohms.

Figure 2 represents the percentage of cell lysis as a function of the capacitance of the capacitor, for a voltage of 500 V and a resistance of 186 Ohms.

Figure 3 shows the percentage of cell lysis as a function of the capacitance of the capacitor, for two values of the distance between the electrodes respectively, for a voltage of 500 V and a resistance of 186 Ohms.

FIG. 4 represents the percentage of cell lysis as a function of the resistance of the capacitor, for three values of the capacity respectively, and for a voltage of 500 V. FIG. 5 represents the percentage of cell lysis as a function of the capacity of the capacitor, for two values of the volume of the cell suspension respectively, for a voltage of 500 V and a resistance of 186 Ohms. FIG. 6 represents the percentage of detection of nucleic acids as a function of the electrical pulse, and more particularly of the capacity of the capacitor producing the pulse, for a voltage of 500 V and a resistance of 186 Ohms. Example 1 Effectiveness of the Process of the Invention on the Lysis of Bacteria

1) General protocol

The following protocol constitutes the general procedure for implementing the method of the invention. Gram-walled bacteria Staphylococcus epidermidis (strain A054) grown in BBC liquid medium (Brain Heart Brain) are centrifuged at 2500 rpm for 10 minutes, before being resuspended in water at a concentration of 3.3 × 10 ^ cells / ml. 300 μl of the suspension are placed in an electroporation tank characterized by a distance between the two electrodes of 2 mm or 4 mm. The tank is placed on an electrical circuit whose electrical parameters are chosen as follows:

- variable voltage from 0 to 2.5 kV, - variable resistance from 0 to 780 Ohms,

- variable capacity from 25 to 3190 μF.

After launching the electric pulse, the electric discharge takes place in a few milliseconds between the two electrodes. The bacterial suspension thus treated is kept in ice.

The percentage of lysis after the pulse is determined immediately after collection of the sample, by measuring the optical density at 550 nm. The percentage of lysis is equal to the ratio of the OD value at 550 nm of the bacterial solution after pulse, to the OD value at 550 nm before pulse.

2) Influence of various parameters, in particular electrical on the efficiency of the lysis The influence of the capacity, the resistance of the capacitor, the electric field and the volume of the suspension was studied, a) Capacity Initially, we used the Bio Puis Rad Gen I device (n ° 165-2098 version 8-90).

According to the operating instructions for the device, two voltage values have been chosen, 450 V and 2.5 kV. The capacitance values were varied from 0 to 25 μFD at 2.5 kV, and from 0 to 960 μF at 450 V. The resistance value is fixed at 186 Ohms. The distance between the two electrodes is 2 mm. As indicated by the results appearing in FIG. 1, it can be seen that for a given voltage, the percentage of cell lysis increases with the increase in the applied capacity. For example, it can be noted that 50% lysis is obtained with a capacity of 960 μF and a voltage of 450 V.

In a second step, the lysis efficiency could be improved by the use of a second device (BTX from Gentronics, MedGene Science) allowing to test higher capacitance values, up to 3190 μF with a voltage equal to 500 V. The tests carried out on this device, the results of which appear in FIG. 2, confirm that cell lysis is all the more effective the higher the capacity, at constant resistance and tension. Thus, for capacitance values greater than 950 μF, and voltage and resistance values equal to 500 V and 186 Ohms, respectively, 100% of the bacteria S. treated epidermidis are lysed. b) Electric field The influence of the value of the electric field

(E = V / d) was then analyzed for constant voltage (V), capacity and resistance values and by varying the distance (d) between the electrodes of the electroporation tank, The device used is the BTX from Gentronics.

At 500 V, when the distance is multiplied by two, the electric field applied at any point in the solution is divided by a factor of two. It is found under these conditions that the efficiency of the lysis is reduced, as shown in Figure 3. We also note in this case, that it is necessary to apply a capacity of 500 μF to obtain at least 90% of cell lysis. c) Resistance

The efficiency of cell lysis was analyzed under constant voltage conditions of 500 V, and for variable capacitance values (from 500 μF to 3190 μF) and resistance (from 0 to 780 Ohms). As indicated by the results shown in Figure 4, the efficiency of cell lysis increases with the value of resistance for constant values of voltage and capacity. d) Volume of the cell suspension

The cell lysis protocol as described above was then carried out at constant voltage (500 V), constant resistance (186 Ohms) and variable capacity (from 0 to 3190 μF) on a suspension sample of 300 μl or 800 μl, in order to to study the influence of the volume of the sample to be treated on the efficiency of cell lysis.

As indicated in FIG. 5, the cell lysis obtained under the electrical conditions described is independent of the volume of cell suspension placed between the two electrodes.

3) Efficiency of the lysis according to the method of the invention on other cell species The lysis method according to the invention can be applied to other cell species. For this, the second protocol described in a) (BTX, MedGene Science) was tested on other cells (Mycobacterium gordonae, Escherichia coli, Listeria monocytogenes, Streptococcus pneumoniae, Bacillus stearothezmophilus, Micrococcus sp., Actinomyces viscosus, Actinomyces naeslundii,

Stomatococcus mucilaginosus, Nocardia asteroides,

Rhodococcus sp. ) by setting the following electrical parameters as follows: Voltage 500V,

Capacity 1500 μF and Resistance 186 Ohms.

The results obtained indicate that the percentage of cell lysis for each of the cases analyzed is between 80 and 100%. Example 2: Analysis of 16S nucleic acids (DNA / RNA) obtained after lysis according to the method of the invention.

After the centrifugation step (see example 1), the bacterial pellet (S. epidermidis - strain A054) is suspended in water at a concentration of 3.3 × 10 6 cells / ml in the presence or absence of proteinase K at the final concentration of 6 mg / ml (EC 3.4.21.14 Boehringer-Mannheim, ref. 1092766). The protocol is carried out under the conditions determined in Example 1 (voltage: 500 V, resistance: 186 Ohms and capacity: 1500 μF). When the bacterial suspension additionally contains proteinase K, after cell lysis the sample is incubated for 15 minutes at 37 ° C. After treatment, the samples are kept in ice.

The efficiency of cell lysis is determined as described in Example 1 by measuring the OD at 550 nm. It is found that this efficiency (100%) is not influenced by the presence of proteinase K in the lysis medium. Furthermore, analysis on 0.8% agarose gel of an aliquot of the lysed sample shows that in the absence of proteinase K treatment, the nucleic material does not penetrate the gel and remains in the wells. gel with cell debris. On the other hand, the nucleic acids released in the samples subjected to digestion by proteinase K migrate in the gel according to their size.

In a second series of experiments, the nucleic acids obtained after lysis, with / without treatment with proteinase K, were analyzed with the Vidas device (bioMérieux France) which makes it possible to specifically detect nucleic acids according to the hybridization technique said sandwich, using oligonucleic capture and specific detection probes of the 16S nucleic acids of S. epidermidis ΕP 0632269). Oligonucleotides of capture and detection have respectively the sequence 5 '-GACCACCTGTCACTCTGTCCC-3' (SEQ ID NO: 1) and 5'- GGAAGGGGAAAACTCTATCTC-3 '(SEQ ID NO: 2). The detection probe is labeled by coupling with alkaline phosphatase (AKP).

This analysis shows that in the absence of treatment with proteinase K, the DNA / RNA nucleic acids released after electroporation are not detectable by the technique used. On the contrary, treatment with proteinase K allows specific detection of said nucleic acids, released during cell lysis.

The influence of the electrical parameter relating to capacity on the specific detection of 16S nucleic acids from S. epidermidis has been analyzed. The results appear in FIG. 6. The detection of nucleic acids is expressed in RFU, that is to say in relative fluorescence unit. These results confirm the influence of the capacity in the release of the nucleic acids contained in the cells during the lysis carried out in accordance with the invention.

Example 3: Amplification of DNA nucleic acids and 16S RNA released by lysis according to the method of one invention. The nucleic acids collected according to example 2 are subjected to an amplification. The lysis conditions are as follows:

BTX Gentronics device, Voltage 500 V, Resistance 186 Ohms,

Capacity 1500 μFD, one electrical pulse.

Two specific amplification protocols for S nucleic acids. epidermidis were made from the lysates collected, i.e. a PCR protocol for DNA amplification, a NASBA protocol for the amplification of 16S rRNA.

PCR protocol: the PCR technique followed is that described by Goodman in PCR strategies, Ed: Innis, Gelford and Sninsky Académie press 1995, pp 17-31. Two amplification primers were used, they have the following sequences:

Primer 1 5 'ATCTTGACATCCTCTGACC 3' SEQ ID NO: 3 Primer 2 5 'TCGACGGCTAGCTCCAAAT 3' SEQ ID NO: 4 The following temperature cycles were used:

1 time 3 minutes 94 ° C

2 minutes 65 ° C

35 times 1 minute 72 ° C 1 minute 94 ° C

2 minutes 65 ° C 1 time 5 minutes 72 ° C

NASBA protocol: the NASBA technique followed is that described by Van Der Vliet et al., J. Gen. Microbiol.

1993, 139: 2423. Two amplification primers were used, they present the following sequences:

Primer 1:

5 'GGTTTGTCACCGGCAGTCAACTTAGA 3' SEQ ID NO: 5 Primer 2:

5 'TCGAAGCAACGCGAAGAACCTTACCA 3' SEQ ID NO: 6

1) PCR amplification of the released DNA

10 μl of lysate are used for each PCR test. The amplicons produced are analyzed on 0.8% agarose gel and on Vidas according to the protocol described in Example 2. In the absence of proteinase K, it is found that the DNA released after lysis is not amplified. On the other hand, it is found that the DNA released after lysis in the presence of 0.3 μg / ml final proteinase K and incubation for 15 minutes at

37 ° C is amplified. Amplification signal is detected after specific sandwich hybridization of the amplicons produced on Vidas as described in Example 2, for an initial bacterial concentration equal to or greater than 300 bacteria / 300 μl.

2) NASBA amplification of the 16S RNA released 5 μl of lysate are used for each NASBA test. The amplicons produced are detected and quantified on a microplate by hybridization with a capture probe and a specific S detection probe. epidermidis, according to the method described by P. Cros et al., Lancet 1992, 240: 870. The detection probe is coupled to "Horse Radish Peroxidase" (HRP). The two probes have the following sequences: Capture probe:

5 'GATAGAGTTTTCCCCTTC 3 "SEQ ID NO: 7

Detection probe:

5 'GACATCCTCTGACCCCTC 3' SEQ ID NO: 8

In the absence of proteinase K, it is found that the 16S rRNA released after lysis, whether or not followed by an incubation of 15 minutes at 37 °, is not amplified. On the other hand, it is found that the 16S rRNA released after lysis in the presence of 0.3 μg / ml final proteinase K and incubation for 15 minutes at 37 ° C is amplified. An amplification signal is detected after specific hybridization of the amplicons produced on a microplate, as described above, for an initial bacterial concentration equal to or greater than 60 bacteria / ml.

Claims

1. A method for isolating an intracellular nucleic and / or protein material, from a cellular sample suspended in a liquid, comprising the steps of:

- The sample is exposed to at least one electrical pulse, at least one characteristic of which is determined to allow partial or complete lysis of the cells; - A nucleic fraction, e / or a protein fraction, is separated from the lysed cells, characterized in that:

(b) after separation of the protein fraction from the nucleic fraction of the lysed cells, the nucleic and / or protein fraction is capable of being subjected directly to at least one processing step.

2. Method according to claim 1, characterized in that the isolated intracellular material is a nucleic fraction.

3. Method according to claims 1 and 2, characterized in that the complete lysis of the cells leads to at least partial denaturation, or even fragmentation, of the nucleic material to be treated.

4. Method according to claim 1, characterized in that at least one characteristic of the electric pulse is determined to establish in the sample an electric field at least equal to 2500 V / cm.

5. Method according to claim 1, characterized in that the duration of one electrical pulse is determined by a capacity of 500 μF and an electrical resistance of 186 Ohms, for an electrical voltage of 500 V.

6. Method according to claim 1, characterized in that the liquid in which the cell sample is in suspension is water.

7. Method according to claims 1 and 2, characterized in that the nucleic material is separated by bringing the lysed cell sample into contact with a protease or a compound releasing organic radicals.

8. Method according to claim 7, characterized in that the protease or the compound is initially introduced into the cell sample.

9. Method according to claim 8, characterized in that the separation of the nucleic material is carried out with a protease, chosen from pronase, subtilysins, pepsin, trypsin, lysozyme, chymotrypsin, 1 'α-chymotrypsin and proteinase K.

10. Method according to claim 9, characterized in that the protease is proteinase K.

11. Method according to claim 10, characterized in that the concentration of proteinase K in the sample is between 0.5 and 9 mg / ml, preferably between 3 to 6 mg / ml, and more preferably the concentration is equal to 6 mg / ml.

12. A method according to claim 7, characterized in that the compound is a per-compound, in particular chosen from periodate, paraperiodate, sodium peroxide, perborate and for example sodium perborate tetrahydrate.

13. Method according to any one of claims 1 to 12, characterized in that the processing step is a step of detecting at least one component of the nucleic fraction.

14. Method according to any one of claims 1 to 12, characterized in that the processing step is a step of amplification of at least one component of the nucleic fraction.