WO1999035245A9 - Methods for preparing and using immortalized human neuroendocrine cells - Google Patents
Methods for preparing and using immortalized human neuroendocrine cellsInfo
- Publication number
- WO1999035245A9 WO1999035245A9 PCT/US1999/000553 US9900553W WO9935245A9 WO 1999035245 A9 WO1999035245 A9 WO 1999035245A9 US 9900553 W US9900553 W US 9900553W WO 9935245 A9 WO9935245 A9 WO 9935245A9
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- cells
- cell
- human
- insulin
- promoter
- Prior art date
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
- G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
- G01N33/502—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing non-proliferative effects
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
- G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
- G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
- G01N33/5014—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing toxicity
- G01N33/5017—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing toxicity for testing neoplastic activity
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
- G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
- G01N33/502—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing non-proliferative effects
- G01N33/5041—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing non-proliferative effects involving analysis of members of signalling pathways
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
- G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
- G01N33/5044—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics involving specific cell types
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
- G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
- G01N33/5044—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics involving specific cell types
- G01N33/5058—Neurological cells
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
- G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
- G01N33/5044—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics involving specific cell types
- G01N33/507—Pancreatic cells
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
- G01N33/5091—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing the pathological state of an organism
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
Definitions
- the present invention relates generally to the field of human cell biology. More particularly, it provides methods for preparing immortalized human cells and cell lines of neuroendocrine origin, such as human ⁇ -cells, and the cells and cell lines thus produced.
- the methods for preparing the cells are generally based on the expression of an immortalizing construct and, in certain embodiments, include the use of cell-specific expression, multiple constructs, modified promoters, viral delivery and defined culture media.
- Methods of using the immortalized human cells for example, in the production of secretory polypeptides, drug discovery, diagnostic applications such as continuous, non-invasive glucose monitoring and in cell-based delivery methods are also provided.
- Cells of neuroendocrine origin generally have the capacity to synthesize and secrete one or more polypeptide products in a regulated manner.
- cells of the anterior or intermediate lobes of the pituitary produce growth hormone or proopiomelanocortin (POMC)- derived peptides, such as ACTH and MSH; thyroid C cells secrete calcitonin; and distinct types of pancreatic cells produce and secrete hormones such as glucagon and insulin.
- POMC proopiomelanocortin
- Neuroendocrine cells by definition have sorting mechanisms, whereby a given polypeptide or protein, destined for secretion, is targeted to the regulated secretory pathway or the default constitutive secretory pathway.
- Neuroendocrine cells also have processes for achieving secretory protein maturation, which generally involves protein folding, disulfide bond formation, glycosylation, endoproteolytic processing as well as other types of post- translational modifications.
- Neuroendocrine cells also exhibit controlled release of the secretory protein or polypeptide, most often in response to one or more external signaling molecules, or "secretagogues", and thus have regulatory pathways allowing the cells to secrete a desired product from the secretory storage granules in response to physiological or pharmacological stimuli.
- neuroendocrine cells are the ⁇ -cells of the islets of Langerhans in the pancreas, which cells secrete insulin in response to secretagogues such as amino acids, glyceraldehyde, free fatty acids, and, most prominently, glucose.
- secretagogues such as amino acids, glyceraldehyde, free fatty acids, and, most prominently, glucose.
- the capacity of normal islet ⁇ -cells to sense a rise in blood glucose concentration and to respond to elevated levels of glucose by secreting insulin is critical to the control of blood glucose levels. Increased insulin secretion in response to a glucose load prevents chronic hyperglycemia in normal individuals by stimulating glucose uptake into peripheral tissues, particularly muscle and adipose tissue.
- IDDM Insulin- dependent diabetes mellitus
- NIDDM non-insulin dependent diabetes
- IDDM involves specific destruction of the insulin producing ⁇ -cells of the islets of Langerhans.
- the destruction of ⁇ -cells in IDDM appears to be a result of specific autoimmune attack, in which the patient's own immune system recognizes and destroys the ⁇ -cells, but not the surrounding ⁇ -cells (glucagon producing) or ⁇ -cells (somatostatin producing) that comprise the islet.
- Loss or impaired function of other cells of neuroendocrine origin is associated with other human diseases and disorders. For example, the failure of substantia nigra cells to properly produce dopamine results in Parkinson's Disease, the failure of thyroid cells to properly produce thyroid hormones results in athyrotic cretinism, and the loss of adrenal gland cells, with the consequent failure to produce adrenal hormones, results in Adison's Disease.
- U.S. Patent 5,427,940 provided, for the first time, recombinant cells that secrete insulin in response to glucose.
- the generation of such artificial ⁇ -cells is achieved through the introduction of one or more genes selected from the insulin gene, the glucokinase gene and the
- GLUT-2 glucose transporter gene so as to provide an engineered cell having all three of these genes in a biologically functional and glucose-responsive configuration.
- Patent 4,195,125; PCT application WO 87/05929) and expression of transfected oncogenes have failed to produce immortalized insulin-secreting human cells that retain regulated insulin-secreting ability over time.
- the present invention overcomes these and other drawbacks inherent in the prior art by providing methods for the production of immortalized human cells and cell lines of neuroendocrine origin.
- the cells of the invention may be used, for example, in the in vitro production of secreted polypeptides, in drug screening and discovery applications, in diagnostic applications such as continuous, non-invasive glucose monitoring and in the development of in vivo cell-based delivery of proteins and polypeptides.
- the immortalized cells of the present invention are functionally defined as having maintained a regulated secretory pathway, as being stable to in vitro culture and, in certain embodiments, as being amenable to further engineering. Accordingly, the present invention provides methods for preparing immortal human neuroendocrine cells.
- the immortal human neuroendocrine cells of the invention will generally be characterized as comprising at least a first immortalizing genetic construct under the control of at least a first promoter specific for the neuroendocrine cell, wherein the cell secretes at least a first polypeptide.
- the method comprises providing to a non-immortal human neuroendocrine cell that secretes at least a first polypeptide an effective amount of at least a first immortalizing product.
- non-immortal human neuroendocrine cells While in certain aspects of the invention a purified or isolated human neuroendocrine cell will be utilized as the starting non-immortalized cell, in many aspects of the present invention, the non-immortal human neuroendocrine cells will be present in a heterogeneous, relatively heterogeneous, partially purified, or pre-selected cell population that comprises the non-immortal human neuroendocrine cells.
- the method comprises providing to a cell population comprising non-immortal human neuroendocrine cells an effective amount of at least a first immortalizing genetic construct comprising at least a first immortalizing expression unit under the transcriptional control of a promoter specific for the neuroendocrine cells, the at least a first immortalizing genetic construct specifically expressing at least a first immortalizing product in the non-immortalized human neuroendocrine cells within the cell population.
- the present invention also provides methods for preparing immortal human neuroendocrine cells, generally characterized as comprising providing to a non-immortal human neuroendocrine cell an effective amount at least a first immortalizing genetic construct comprising at least a first telomerase catalytic component under the control of at least a first promoter that expresses the at least a first telomerase catalytic component in the cell, wherein the cell secretes at least a first polypeptide.
- the promoter is specific for the neuroendocrine cell.
- the immortalizing genetic construct after immortalization will be excised from the genome of the cell, and thus separated from the cell, by use of a molecular biological excision system, for example, such as the Cre/Lox site-specific recombination system or by the use of the recombination activating genes, RAG 1 and RAG 2, in conjunction with the use of specific recombination signal sequences (RSSs).
- a molecular biological excision system for example, such as the Cre/Lox site-specific recombination system or by the use of the recombination activating genes, RAG 1 and RAG 2, in conjunction with the use of specific recombination signal sequences (RSSs).
- the cells of the invention may be characterized as stable human neuroendocrine cells which comprise at least a first immortalizing genetic construct under the control of a promoter, in certain embodiments a promoter that is specific for the neuroendocrine cell, wherein the promoter expresses the at least a first immortalizing genetic construct to a degree sufficient to effect immortalization of the cell, and wherein the cell secretes at least a first polypeptide.
- the promoter it is not required that the promoter be "specific" in the context of being naturally expressed only in the one neuroendocrine cell that is to be immortalized by the methods of the invention. In these embodiments all that is required is that the promoter be "context specific", in that the promoter will be present only in the cell types to be immortalized and not within other cell types in a population of starting cells. For example, in a population of starting cells for the intended generation of an immortal, stable human ⁇ -cell, the use of one or more promoters that are expressed in tissues other than ⁇ -cells is contemplated so long as those promoters chosen are not capable of directing expression in other cell types within the population of starting cells, particularly those cells such as fibroblasts, ductal cells, and the like.
- the immortal human neuroendocrine cells of the invention will be stable cells that have maintained a functional, regulated secretory pathway, wherein the cells secrete one or more polypeptides via the intact secretory pathway.
- the immortal human neuroendocrine cells will preferably secrete at least a first endogenous secretory polypeptide or peptide.
- the immortal human neuroendocrine cells will preferably secrete at least a first exogenous secretory polypeptide or peptide, or at least a first endogenous or exogenous polypeptide or peptide, preferably a bioactive polypeptide or peptide, that is not normally secreted from the human neuroendocrine cell.
- the cell may be provided with at least a first exogenous gene that encodes at least a first exogenous polypeptide or peptide, leading to secretion of at least a first exogenous polypeptide or peptide by the cell.
- the expression of a gene encoding at least a first endogenous polypeptide is inhibited in conjunction with providing the cell at least a first gene encoding at least a first exogenous polypeptide.
- the immortal human neuroendocrine cells of the invention may be characterized as human cells that have a functional, regulated secretory pathway, wherein the cells comprise at least a first immortalizing genetic construct, such as a telomerase catalytic subunit, under the control of a promoter, or a promoter that is specific for the cell, wherein secretion of at least a first polypeptide from the cells is regulated or modulated in response to at least a first selected modulator.
- a first immortalizing genetic construct such as a telomerase catalytic subunit
- secretagogue will be used for modulators of secretion that lead to increased secretion of a polypeptide from a cell
- inhibitor will be used for modulators of secretion that lead to decreased secretion of a polypeptide from a cell.
- secretion of at least a first polypeptide from the immortal human neuroendocrine cells is regulated or modulated in response to glucose.
- the cells of the invention will be that they are culturable and will be capable of growing in vitro, which cells may thus be described as "immortal cells”. It will also be generally required that the cells of the invention maintain at least a minimum differentiated phenotype, and as such the human neuroendocrine cells of the invention may be characterized as differentiated human cells having a regulated secretory pathway and comprising at least a first immortalizing genetic construct under the control of one or more promoter, or preferably a promoter specific for the secretory cell, wherein the cells maintain a differentiated phenotype after immortalization and secrete at least a first polypeptide.
- the sources of starting materials to provide the population of starting cells for use in the present invention include, for example, fetal cells, primary cells obtained from human tissues, cells obtained from neuroendocrine cell lines and cells obtained from human neuroendocrine tumors, such as may be obtained from a resected tumor, for example an insulinoma.
- the starting, non-immortalized human neuroendocrine cell is passaged in vivo.
- the starting cells will be a population of cells that predominantly include pancreatic ⁇ -cells. In other preferred embodiments, the population of starting cells will be enriched for pituitary cells.
- the immortal human neuroendocrine cells of the invention will preferably secrete one or more of the secretory polypeptides listed herein in Table 1, Table 2, Table 3, Table 4 or Table 5.
- Secretory polypeptides that are glycosylated or amidated are preferred in certain aspects of the invention.
- a secreted enzyme such as adenosine deaminase, galactosidase, glucosidase, lecithinxholesterol acyltransferase (LCAT), factor IX, sphingolipase, lysosomal acid lipase, lipoprotein lipase, hepatic lipase, pancreatic lipase related protein, pancreatic lipase or uronidase are preferred.
- LCAT lecithinxholesterol acyltransferase
- factor IX factor IX
- sphingolipase lysosomal acid lipase
- lipoprotein lipase lipoprotein lipase
- pancreatic lipase related protein pancreatic lipase or uronidase
- pancreatic lipase or uronidase are preferred.
- immortal human neuroendocrine cells that secrete leptin, LCAT, or a hormone
- Immortal human ⁇ -cells that secrete insulin will be preferred in certain aspects of the invention, with cells that secrete biologically active, correctly processed human insulin being more preferred.
- the human insulin may be expressed from an endogenous human insulin gene, or in certain aspects from an exogenous human insulin gene.
- the immortal human ⁇ -cells of the invention may also be advantageously used to secrete endogenous human amylin.
- Another preferred cell type of the invention, pituitary cells may be advantageously used to secrete endogenous human growth hormone, ACTH, leuteinizing hormone, follicle stimulating hormone or MSH.
- pancreatic ⁇ -cells and pituitary cells further cells within Table 1 that are more preferred for use in the present invention include thyroid C cells, which secrete endogenous human calcitonin; intestinal endocrine cells, which secrete endogenous human GLP-1 and GIP; and pancreatic ⁇ -cells, which secrete endogenous human glucagon.
- the immortalizing genetic constructs for use in generating the immortal human neuroendocrine cells of the invention may comprise one or more genes, cDNAs or other coding region or transcriptional units that encode any protein, polypeptide or peptide that effects immortalization of a cell when expressed or overexpressed in the cell.
- Exemplary immortalizing constructs include those that express growth factors, such as insulin, hepatocyte growth factor (HGF), platelet derived growth factor (PDGF), nerve growth factor (NGF), growth hormone or epidermal growth factor (EGF), and growth factor receptors, such as an insulin, insulin-like growth factor 1 (IGF-1), HGF, PDGF, growth factor or EGF receptor.
- oncogenes Additional exemplary immortalizing genes, certain of which are herein termed “proto- oncogenes”, “oncogenes” or “mutant tumor suppressors”, are disclosed herein in Table 8.
- Table 8 generally categorizes the various oncogenes and mutant tumor suppressors, hereafter termed “oncogenes” for simplicity, that may be used in the invention according to functional criteria defining their effects on a cell.
- the immortal human neuroendocrine cells of the invention will comprise, or will have comprised during their generation, at least a first immortalizing genetic construct that comprises two operative immortalizing units or oncogenes, or three immortalizing operative units or oncogenes, or in certain embodiments, may even comprise four or five separate immortalizing oncogenes or more.
- an immortalizing oncogene it may be preferable to include distinct oncogenes that fall into different functional categories. For example, a combination of one oncogene that expresses a protein that perturbs signal transduction may be used in conjunction with an oncogene that expresses a protein that affects or alters the cell cycle control mechanisms.
- any two or more oncogenes selected from the diverse groups of oncogenes that perturb signal transduction, affect cell cycle, alter nuclear transcription, inhibit apoptosis, or that fail to promote apoptosis may be used; as may components of telomerase, such as the catalytic subunit (TERT), and one or more other oncogenes that express immortalizing proteins with pleiotropic activities.
- telomerase such as the catalytic subunit (TERT)
- TERT catalytic subunit
- preferred oncogenes that alter cell cycle control include those that express a cyclin Dl protein.
- Preferred oncogenes that alter nuclear transcription include E2F and the myc family oncogenes that express Myc proteins; apoptosis inhibiting oncogenes preferably include members of the bcl gene family, such as bcl-2; and mutant tumor suppressor oncogenes preferably include mutant p53, p21, menin and mutant Retinoblastoma (Rb) genes.
- the expression of an oncogene that encodes an immortalizing viral protein exemplified by, but not limited to, the SV40 or polyoma large T antigens is particularly contemplated.
- the immortalizing genetic construct comprises a temperature sensitive gene that expresses a temperature sensitive large T antigen, allowing for the expression of the construct to be regulated in a temperature-dependent manner.
- the immortal human neuroendocrine cells will comprise, or will have been generated via the provision of, at least a first genetic construct that comprises at least a first growth factor or growth factor receptor gene.
- the growth factor or growth factor receptor genes may themselves act as the immortalizing genetic construct.
- growth factors and growth factor receptors per se are not oncogenes, when used in the manner disclosed herein, these genes will be used to effect immortalization of the target cell.
- the expression, or preferably the overexpression, of at least a first growth factor gene will result in the synthesis and secretion of at least a first growth factor into the extracellular environment. The growth factor will then act in a paracrine manner, in order to stimulate the target cell by binding to an expressed cell surface receptor.
- the expression or overexpression of at least a first growth factor receptor gene may be used in a similar manner to increase the numbers of growth factor receptors expressed by the cell, such that the provision of growth factors in the media will promote immortalization, or at least will provide an added stimulus towards immortalization.
- both at least a first growth factor gene and at least a first growth factor receptor gene may be provided to the same target cell in order to effect immortalization or to generally stimulate the immortalization process. In the embodiments described above, the provision of at least a first growth factor receptor gene is generally preferred.
- the at least a first growth factor receptor gene may be provided to the cell via infection with one type of recombinant virus expressing the growth factor receptor, allowing for further manipulation of the cell by infection with other recombinant viruses expressing one or more genes encoding immortalizing oncogenic products or even further growth factors.
- the cell-specific expression of at least a first growth factor receptor will provide the means for effecting specific immortalization of the target human neuroendocrine cells by providing to the extracellular media one or more growth factors that specifically bind to and activate the provided at least a first growth factor receptor.
- at least a first particular growth factor not normally expressed by the target cell will be provided, allowing for the specific stimulation of only the target cells upon the provision of at least a first exogenous growth factor to the media.
- the present invention further contemplates the use of at least a first growth factor or growth factor receptor gene in combination with at least a first immortalizing genetic construct that comprises one or more oncogenes, such as those oncogenes listed in Table 8.
- the growth factor or growth factor receptor gene will provide an added stimulus that supplements the already immortalizing activities of the at least a first oncogenic element expressed specifically in the target cell.
- the currently preferred biological components for use in this invention are hepatocyte growth factor (HGF), insulin-like growth factor- 1 (IGF-1), platelet-derived growth factor (PDGF), growth hormone, or even epidermal growth factor (EGF) or basic fibroblast growth factor (bFGF), with the corresponding receptors being the HGF, IGF-1, PDGF, growth hormone, EGF or bFGF receptor genes.
- the preferred components are the chicken growth hormone and the corresponding chicken growth hormone receptor.
- the human neuroendocrine cell is grown in defined media, in media comprising at least a first growth factor specific for the neuroendocrine cell, or in defined media further supplemented with at least a first growth factor specific for the neuroendocrine cell.
- the human neuroendocrine cell is a human pancreatic ⁇ -cell and the growth factor is HGF, IGF-1, PDGF, NGF or growth hormone.
- the human neuroendocrine cell is grown in the defined media shown in Table 9.
- the human neuroendocrine cell is proliferating prior to provision of at least a first immortalizing genetic construct.
- Exemplary methods by which the human neuroendocrine cell may be induced to proliferate include growth on a stimulatory cell matrix, growth in contact with a stimulatory growth factor or initial transfection with DNA comprising at least a first gene encoding at least a first stimulatory growth factor.
- the human neuroendocrine cell is induced to proliferate by initial infection with a virus, such as adenovirus or adeno-associated virus (AAV).
- AAV adeno-associated virus
- the human neuroendocrine cell is induced to proliferate by initial infection with a virus that comprises at least a first gene that induces cellular proliferation, the gene under the control of a promoter specific for the neuroendocrine cell.
- the promoter used to drive_ the immortalizing oncogene expression is a promoter that is specific for the target human neuroendocrine cell, or that provides specific expression in the context of the population of starting cells for use in the invention.
- the promoter is a human glucagon-like peptide- 1 (GLP-1) or alpha-glycoprotein promoter (GenBank Accession Number L05632).
- GLP-1 human glucagon-like peptide- 1
- alpha-glycoprotein promoter GenBank Accession Number L05632
- Other exemplary promoters specific for human neuroendocrine cells are listed herein in Table 1. Any one or more of such promoters may be used in the context disclosed herein.
- the target cells will be human pancreatic ⁇ -cells, in which instances the preferred promoter will be an insulin gene promoter.
- the promoter may be a rat insulin gene promoter (RIP), as exemplified by RIPl or RIP2, or the promoter may be a human insulin gene promoter (HIP).
- the target cells will be pituitary cells, wherein the preferred promoters will be a growth hormone gene promoter or a proopiomelanocortin (POMC) gene promoter.
- POMC proopiomelanocortin
- the promoter used to direct expression of the immortalizing genetic construct will be a promoter that has been modified to have increased transcriptional activity, i.e., it will be an "enhanced promoter". This includes both promoters that have been changed in terms of their base sequence, and promoters that comprise multimerized promoter elements.
- an enhanced promoter may comprise an enhanced insulin gene promoter, such as one that comprises multimerized RIP elements or multimerized HIP elements.
- Transfection methods such as calcium phosphate, liposomes, gene gun, electroporation and even direct injection are particularly contemplated.
- any and all viruses suitable for use in gene delivery fall within the present invention.
- retroviruses adeno-associated viruses (AAV), lentiviruses or adenoviruses will be used.
- AAV adeno-associated viruses
- the currently most preferred embodiment concerns the use of recombinant adenovirus or recombinant retrovirus.
- the combined use of one or more viruses, particularly the use of adenovirus with retrovirus, two adenoviruses and AAV with adenovirus, is contemplated in certain aspects of this invention.
- the human neuroendocrine cell is provided with at least a first immortalizing genetic construct by two rounds of infection with a recombinant virus that comprises the construct.
- the cell may be provided with the immortalizing genetic construct by a first infection with a recombinant virus that comprises the construct followed by a second infection with a distinct, recombinant virus that comprises the construct.
- the cell is provided with a first and a second immortalizing genetic construct by a first infection with a recombinant virus that comprises the first construct followed by a second infection with a recombinant virus that comprises the second construct, the first and second immortalizing genetic constructs comprising distinct immortalizing expression units.
- the human neuroendocrine cell is provided with a first immortalizing genetic construct by transfection, and is then provided with a second immortalizing genetic construct by infection with a recombinant virus that comprises the second immortalizing genetic construct.
- the first and second immortalizing genetic constructs may comprise the same immortalizing expression unit, or distinct immortalizing expression units.
- the starting human neuroendocrine cell is a primary islet cell
- the primary islet cell is provided with an adenovirus comprising at least a first temperature sensitive large T-antigen (TsTAg) immortalizing construct under the control of a cytomegalovirus (CMV) or a RIP promoter, and then provided with a retrovirus comprising at least a first telomere catalytic subunit (TERT) immortalizing construct under the control of a RIP promoter.
- TsTAg temperature sensitive large T-antigen
- CMV cytomegalovirus
- RIP a RIP promoter
- the starting human neuroendocrine cell is an insulinoma
- the insulinoma is provided with an adenovirus or a retrovirus comprising at least a first temperature sensitive large T-antigen (TsTAg) immortalizing construct under the control of a CMV or a RIP promoter, and then provided with a retrovirus comprising at least a first telomere catalytic subunit (TERT) immortalizing construct under the control of a RIP promoter.
- compositions and methods for use in regulating the expression of the at least a first immortalizing genetic construct when supplied to the human neuroendocrine cell are provided.
- One method of control is to use at least a first temperature-sensitive immortalizing genetic construct, such as a temperature- sensitive large T antigen gene.
- Other methods of effecting control include methods in which the expression of the immortalizing genetic construct is conditional on the addition of an exogenous compound or component, such as using a Lac repressor system in conjunction with exogenously added IPTG, using a tetracycline regulatory system, which is dependent upon the addition of exogenous tetracycline or one or more tetracycline derivatives, or using the ecdysone-inducible expression system, which is dependent upon the addition of an ecdysone receptor ligand, including, but not limited to, ecdysone or the synthetic analog muristerone A.
- an exogenous compound or component such as using a Lac repressor system in conjunction with exogenously added IPTG, using a tetracycline regulatory system, which is dependent upon the addition of exogenous tetracycline or one or more tetracycline derivatives, or using the ecdysone-inducible expression system, which is dependent upon the addition of an ec
- Control of the at least a first immortalizing genetic construct may also be effected by actually physically removing the at least a first immortalizing genetic construct from the immortal human neuroendocrine cell once immortalization has been achieved. Any molecular biological method by which to prepare and use a removable genetic construct may be used in these aspects of the invention.
- a currently preferred system is Cre/Lox, in which the immortalizing genetic construct is flanked by loxP sites that are recognized by the Cre protein.
- Another preferred method by which to separate the immortalizing construct from the resultant immortal cell is to use a recombination activating system in which the immortalizing genetic construct is flanked by recombination signal sequences (RSSs), which are recognized by proteins encoded by genes termed RAG 1 or RAG 2 (Recombination Activating Gene 1 and 2).
- RSSs recombination signal sequences
- Yet another preferred method for removal of the immortalizing construct is the incorporation of the immortalizing construct on a non-integrative or extrachromosomal (episomal) adenoviral vector. As the immortalized cells divide, the adenoviral vector is continually diluted out as it is not integrated into the genomic DNA of the cells, thus eventually removing the immortalizing construct from the immortalized cells through normal methods of cell propagation.
- the methods of the invention may be used to prepare an immortal human neuroendocrine cell that maintains all physiological functions and responses, it is not required that the resultant cell maintain every such biological function normally expressed by the cell type.
- modification and re-engineering of the secretory responses of the immortal cells may be achieved using further recombinant technology. So long as an immortal cell has been generated that retains the necessary secretory pathway components, the increased secretion of at least a first endogenous secretory polypeptide may be effected by the provision of one or more recombinant genes, such as, e.g., processing genes.
- the resultant immortal cells of the invention may also be modified or re-engineered to change the pattern of secretion of one or more secretory proteins or polypeptides in response to one or more modulators, such as secretagogues that normally act to stimulate secretion by the neuroendocrine cells, or inhibitors that normally act to inhibit secretion by the neuroendocrine cells.
- the human neuroendocrine cell secretes insulin, GLP-1, growth hormone, amylin or leptin in response to glucose and the cell is engineered to modify the secretion of GLP-1 , growth hormone, amylin or leptin in response to glucose.
- One particular example of this is re-engineering immortal human ⁇ -cells to be glucose-responsive or to modify the glucose-responsiveness of the immortal cells. This may be achieved by the provision of one or more genes selected from an insulin gene, a GLUT-2 gene or a glucokinase (hexokinase IV) gene.
- U.S. Patent No. 5,427,940 is incorporated herein by reference in its entirety for the purposes of describing re-engineering of cells to provide glucose-responsive, insulin-secreting cells.
- glucose-responsive engineering steps contemplated for use with the immortal human ⁇ -cells of the invention include various methods for reducing hexokinase I and/or hexokinase II activity within the immortal cells.
- the blocking of protein production is discussed below in terms of hexokinase reduction, it will be understood that one or more of these techniques will be applicable to the reduction of the production of any desired protein.
- hexokinase I and/or hexokinase II activity may be achieved by any one or more of a variety of methods.
- antisense technology in which an antisense RNA molecule that is complementary to and binds to a hexokinase gene or RNA transcript is provided to the cell, and/or knockout technology, which refers to the application of a targeted gene disruption protocol (U.S. Patent No. 5,427,940), such as homologous recombination, random insertion or genomic site directed mutagenesis.
- hexokinase reduction include the use of ribozymes targeted to hexokinase sequences, the use of various compositions that are effective to displace hexokinase from the mitochondria, and/or the use of one or more components or enzymes that act to stimulate the production of trehalose-6-phosphate.
- the present invention further provides various methods of using the resultant human neuroendocrine cells disclosed herein.
- the invention also provides immortal human neuroendocrine cells that have the capacity to be passaged in vivo.
- the immortal human neuroendocrine cells or populations of such cells are grown in contact with a solid support or comprised within a bioreactor.
- the immortal cells have been formulated in a pharmaceutically acceptable medium or vehicle, and immortal cells or populations thereof have been encapsulated within a biocompatible coating or implantable device.
- the neuroendocrine cells provided will be immortal human cells, or a population of immortal human neuroendocrine cells, that secrete insulin in response to glucose.
- Such cells may be comprised within an implantable device or encapsulated in a biocompatible coating intended for use in treating an animal, such as a human subject, having, suspected of having, or at risk for developing pre-clinical diabetes or overt diabetes.
- Distinct molecular biological compositions are also provided by the present invention.
- An example of such is an isolated DNA segment that functions to promote gene expression of a heterologous gene when the gene is operatively positioned downstream from the DNA segment, wherein the DNA segment comprises multimerized RIP promoter elements and comprises the DNA sequence of SEQ ID NO: 11.
- recombinant adenoviral and retroviral vectors and recombinant infectious adenoviruses and retroviruses are provided hereby which are, or comprise, a vector comprising at least a first immortalizing genetic unit, preferably at least a first telomerase catalytic component (TERT), under the transcriptional control of neuroendocrine cell-specific promoter operative in human neuroendocrine cells, preferably, a promoter listed in Table 1, and most preferably a promoter operative in pancreatic ⁇ -cells or pituitary cells.
- a vector comprising at least a first immortalizing genetic unit, preferably at least a first telomerase catalytic component (TERT), under the transcriptional control of neuroendocrine cell-specific promoter operative in human neuroendocrine cells, preferably, a promoter listed in Table 1, and most preferably a promoter operative in pancreatic ⁇ -cells or pituitary cells.
- compositions of the present invention are recombinant vectors and gene delivery vehicles or viruses comprising such vectors, wherein the vectors comprise at least a first immortalizing genetic unit, in preferred embodiments at least a first telomerase catalytic component (TERT), under the transcriptional control of an insulin gene promoter comprising multimerized RIP promoter elements, wherein the vector expresses the immortalizing genetic unit specifically in human pancreatic ⁇ -cells.
- the vectors comprise at least a first immortalizing genetic unit, in preferred embodiments at least a first telomerase catalytic component (TERT), under the transcriptional control of an insulin gene promoter comprising multimerized RIP promoter elements, wherein the vector expresses the immortalizing genetic unit specifically in human pancreatic ⁇ -cells.
- TERT telomerase catalytic component
- the present invention provides various methods of using the immortal human neuroendocrine cells disclosed herein.
- Exemplary methods include those methods for producing selected polypeptides, which methods generally comprise first culturing a population of human neuroendocrine cells that secrete at least a first selected polypeptide, wherein the cells comprise at least a first immortalizing genetic construct, in preferred aspects at least a first telomerase catalytic component (TERT), under the control of a promoter, preferably a promoter specific for the neuroendocrine cells, and subsequently collecting the at least a first selected polypeptide so secreted.
- TERT telomerase catalytic component
- the present invention also provides methods for the therapeutic provision of one or more selected proteins or polypeptides to human subjects, or even to animals. These methods generally comprise administering to a subject or animal believed to be in need of the one or more selected polypeptide an effective amount of a population of human neuroendocrine cells that secrete the one or more selected polypeptide, wherein the cells comprise at least a first immortalizing genetic construct, in certain preferred aspects at least a first telomerase catalytic component (TERT), under the control of a promoter, preferably a promoter specific for the neuroendocrine cells.
- the cells secrete at least a first selected human polypeptide or peptide.
- the cells provided will preferably be encapsulated within a biocompatible coating or within a selectively permeable device.
- An example of the treatment methods of the present invention is the treatment of diabetes in diabetic human subjects or even animals known or suspected to have diabetes.
- These methods generally comprise providing glucose-responsive insulin secreting capability to such human subject or animal via the administration of a biologically effective amount of a population of human neuroendocrine cells that secrete insulin in response to glucose, the cells comprising at least a first immortalizing genetic construct, in preferred aspects at least a first telomerase catalytic component (TERT), under the control of a promoter, preferably a promoter specific for the neuroendocrine cells.
- a promoter preferably a promoter specific for the neuroendocrine cells.
- compositions and methods of the present invention can be used in connection with subjects "in need of one of the products secreted by the cells", such as, e.g., insulin, growth hormone, amylin and the like.
- the "in need of criteria covers any and all situations in which the subject would receive one or more benefits from provision of the cells and secreted products. Therefore, "in need of covers prophylactic needs and benefits and disease maintenance needs and benefits, as well as therapeutic benefits, generally marked by an alleviation of symptoms or complications and/or an improvement in one or more clinical markers of disease.
- prophylactic needs include subjects that are at risk of developing a disease state that can be prevented or delayed by a treatment method of the invention; whereas “maintenance” needs include subjects that are at risk of disease progression and/or acute or chronic complications thereof, which can be prevented or slowed by a treatment method of the invention.
- the secretagogue responsive immortalized human neuroendocrine cells are advantageously used to deliver a physiologically relevant protein product in response to a physiologically relevant stimuli.
- the instant immortalized human neuroendocrine cells that secrete insulin in response to glucose are useful not only in diabetic insulin therapy, but also find use in reversing hyperglycemia, restoring normoglycemia, yet avoiding life-threatening hypoglycemia, and such like.
- Type I or insulin dependent diabetes mellitus IDDM
- Type II or non-insulin dependent diabetes mellitus NIDDM
- gestational diabetes warmen who either develop diabetic symptoms or whose pre-existing diabetic condition worsens incident to pregnancy.
- the insulin-secreting cells and methods can be used to provide a relatively constant supply of insulin to a patient in need of a constant insulin supply, the amount of which can be controlled simply by the number of immortalized human neuroendocrine cells administered. Therefore, in these aspects of the present invention, the glucose-responsiveness of the cells is not critical.
- the claimed methods and compositions can be used in intensive insulin therapy. Intensive insulin therapy lowers the risk of complications of diabetes, such as diabetic retinopathy and nephropathy. Prior to the present disclosure, intensive insulin delivery was achieved simply using an external insulin pump or repeated injections, which cannot be regulated in response to changes in blood glucose.
- the immortalized human neuroendocrine cells of the present invention can be similarly used to control glucose levels.
- the clinical applicability and effectiveness of using the insulin-producing immortalized cells of the present invention can also be readily monitored by determining the levels of one or more markers indicative of clinical benefit, for example microalbuminuria, albuminuria and/or glycated hemoglobin (HbAlc).
- HbAlc glycated hemoglobin
- Lowering of glycated hemoglobin towards the normal range is a much desired clinical goal for intensive insulin therapy and for reducing diabetic complications.
- achieving normalized glycated hemoglobin levels has been difficult to achieve with conventional insulin therapy.
- FIG. 1 ⁇ -cell signal transduction and integration. Multiple signaling pathways are involved in the regulation of insulin secretion. Insulin secretion is regulated by effectors including metabolic fuels and hormones, and is subject to regulation as well by synthetic compounds. The various modulators of secretion exert effects via specific cell surface receptors (for example GLP-1, PP, IBMX, clonidine, epinephrine, somatostatin and carbachol), metabolic pathways (for example glucose, amino acids, FFA and IBMX), and ion fluxes (for example diazoxide, sulfonyl ureas, prandin, arginine and FFA). Most changes in secretion are mediated through changes in intracellular calcium.
- specific cell surface receptors for example GLP-1, PP, IBMX, clonidine, epinephrine, somatostatin and carbachol
- metabolic pathways for example glucose, amino acids, FFA and IBMX
- ion fluxes for example diazoxid
- FIG. 2A and FIG. 2B Regulated secretion from engineered human cell lines.
- FIG. 2A Fold insulin secretion (vertical axis) from ⁇ G 498/20 was measured in a two hour static incubation assay at basal conditions (0 mM; 1) or stimulated conditions: 10 mM glucose (2); 100 ⁇ M IBMX (3), 10 mM glucose + 100 ⁇ M IBMX (4); 100 ⁇ M carbachol (5); 100 ⁇ M carbachol + 10 mM glucose (6); 10 nM PMA (7); 10 nM PMA + 10 mM glucose (8); RPMI Medium + 100 ⁇ M diazoxide + BSA (9); or a stimulatory cocktail (RPMI medium supplemented with 10 mM glucose; BSA; 10 mM each arginine, leucine, glutamine; 100 ⁇ M carbachol, and 100 ⁇ M IBMX; 10) (horizontal axis).
- FIG. 2B Insulin secretion (ng insulin/ 10 6 cells/2 hours; vertical axis) under basal (open bars) and stimulated (hatched bars) conditions from cell line ⁇ G 498/45 (7) and engineered cell lines 793/15 (1), 793/28 (2), 794/11 (3), 794/47 (4), 796/13 (5) and 796/15 (6) derived from ⁇ G 498/45 (horizontal axis).
- Cell line ⁇ G 498/45 (created by transfection of ⁇ G H03 with a plasmid conferring resistance to neomycin and encoding human insulin) was engineered for increased levels of insulin expression by the introduction of a number of plasmids, all of which encoded human insulin but varied in the genes encoding antibiotic resistance.
- the 793, 794, and 796 cell lines are resistant to mycophenolic acid, puromycin, and hygromycin, respectively.
- the data show the presence of a regulated secretory pathway in the progenitor cell line (498/45) and the maintenance of this capacity through a second round of engineering (793, 794, and 796 cell lines).
- the increase in stimulated secretion over basal secretion ranges from about 6- to 15- fold among the various clones.
- FIG. 3 Insulin secretion (ng/flask/hour; vertical axis) under basal (cross-hatched bars) and stimulated (open bars) conditions from cell line ⁇ G 498/45 (6) and engineered cell lines
- Transgenic CMV-insulin/SV40-Neo
- clonal derivatives of ⁇ G H04 known to secrete human insulin were tested for the capacity to secrete human insulin from the regulated secretory pathway.
- basal conditions HBSS with no glucose
- stimulated conditions HBSS + 25 mM KC1 + 2.5 mM Forskolin + 50 ⁇ M IBMX
- ⁇ G H04 clones 707/55, 707/63, 707/76, 707/94, and 707/96.
- the clonal line derived from ⁇ G H03 there was a robust response to the aforementioned secretagogue cocktail, with about a 5-fold difference between basal and stimulated secretion.
- FIG. 4 Schematic representation of a 2-step method for creating human neuroendocrine cell lines.
- Primary tissues such as human islets; or neuroendocrine tumors, such as insulinomas, can be induced to proliferate through transgenic expression of growth- promoting proteins.
- a preferred protocol for such engineering is to selectively direct gene expression with the use of tissue-specific promoters and to provide transgenes via infection with recombinant adenovirus.
- the cell population of interest is subject to enhanced rates of immortalization via infection with recombinant retroviruses.
- FIG. Total insulin release (insulin, ng/24 hours; vertical axis) from a human insulinoma over time (days; horizontal axis).
- a freshly excised human insulinoma, about 1 cm was processed and initially plated into two tissue culture wells, 9.6 cm each. The cells that survived were subsequently aliquoted into a variety of culture conditions. At the times indicated, tissue culture media samples were obtained from each of the cell samples, and insulin was measured by RIA. The insulin output from the different samples was summed to give total output.
- FIG 6. Acute insulin secretion (insulin, ng/50 IEQ/90 min; vertical axis) from human islets in BetaGene Medium supplemented with various concentrations of glucose (mM; horizontal axis). Islets were cultured in BetaGene Medium with 3.9 mM (D), 7.8 mM (O) and 22 mM ( ⁇ ) glucose for about 2 weeks. Although lower glucose was less deleterious than the higher concentration, both resulted in impaired secretory response.
- FIG 7. Maintenance of human islets in BetaGene Medium supplemented with 1% fetal bovine serum (FBS; 1), 3.5% FBS (2), 10% FBS (3) or 5% horse serum (ES; 4) (horizontal axis).
- FBS fetal bovine serum
- ES 5% horse serum
- the serum requirements of human islets were tested in long term (at least 2 months) cultures supplemented with various amounts of serum, 1%, 3.5%, or 10% FBS and 5% horse serum (ES).
- insulin secretion (insulin, ng/well; vertical axis) from islets cultured in 10% FBS exhibited lower response to glucose (2.2 mM, open bar; 11 mM, cross-hatched bar) or to a stronger mixed secretagogue stimulus (Swiss secretory cocktail, hatched bar).
- the sustained insulin output from human islets with 1% FBS supplementation suggested that human islets may also secrete insulin and survive under serum-free conditions.
- FIG. 8 Comparison of commonly used medias to BetaGene Medium in the maintenance of human islets. Islets were cultured for 2-3 months with BetaGene Medium (1), Medium 199 (2), alpha MEM (3), or CMRL (4) (horizontal axis), all with equivalent glucose, and 0.1% BSA. In four independent islet isolations the insulin output (average insulin output, ng/well/day; vertical axis) was the highest with islets cultured in BetaGene Medium. In contrast, CMRL performed the poorest, essentially with no islet survival past 2 months with all 4 isolations studied.
- FIG. 9 Long-term culture of human islets in BetaGene Medium restores and maintains glucose-stimulated insulin secretion.
- the capacity of BetaGene Medium to sustain the dose-responsive nature of the insulin secretory response (insulin, ng/50 IEQ/90 min; vertical axis) was evaluated with continuous cultures.
- Human islets were stimulated with varied glucose concentrations (mM; horizontal axis) at intervals to monitor secretory changes that may occur with time.
- a common finding was an initially poor response (shown at 1 week (O)), with increased function with time of culture in BetaGene Medium (6 weeks (D) and 13 weeks ( ⁇ )), and a maintained capability to secrete insulin in response to glucose for times >4 months.
- FIG. 10A and FIG. 10B Processing of proinsulin to mature insulin is enhanced by culturing human islets in BetaGene Medium. Insulin content was extracted from HI21 and fractionated by HPLC. Unprocessed insulin is retained longer on the HPLC column, while mature insulin elutes more rapidly. Insulin immunoreactivity (ng/ml) is shown on the vertical axis, and fraction number is shown on the horizontal axis.
- FIG 10A Initially, 99% of the insulin was unprocessed insulin (peak centered about fraction 80; about 700 ng), with only 29 ng mature insulin/1000 IEQ.
- FIG 10B Processing of proinsulin to mature insulin is enhanced by culturing human islets in BetaGene Medium. Insulin content was extracted from HI21 and fractionated by HPLC. Unprocessed insulin is retained longer on the HPLC column, while mature insulin elutes more rapidly. Insulin immunoreactivity (ng/ml) is shown on the vertical axis, and fraction number is shown on the horizontal axis.
- FIG. 11A and FIG. 11B Modified RIP activity in transiently transfected RIN cells.
- FIG. 11A A schematic representation of the types of modified RIP promoters.
- Modified RIP promoter - human growth hormone (hGH) constructs (-205 RIP (1), -415RIP (2), FF3/-205RIP (3), FF6/-205RIP (4), -415RIP/FFE2/-205RIP (5), FFE3/-415RIP (6), FFE6/-415RIP (7); vertical axis) were transiently transfected into RIN cells. After 48 to 96 hours, hGH protein levels in the medium were determined by a radioimmunoassay (hGH levels relative to -415RIP (open bar); horizontal axis). The modified RIP promoters, FFE3/- 415RIP and FFE6/-415RIP, were approximately 5-fold stronger than the RIP (-415RIP) promoter itself.
- FIG 12A, FIG. 12B and FIG. 12C Modified RIP activity in stably transfected RIN cells.
- the CMV promoter (5), RIP promoter (1), and several modified RIP promoters (FFE3/RIP (2), FFE6/RIP (3), FFE6/RIP/RIPint (4); vertical axis) were fused to insulin and were stably transfected into RIN cells.
- FIG. 12A Insulin mRNA levels (shown relative to RIP mRNA level (open bar); horizontal axis) for each promoter construct were determined by Northern blot and quantitated with a phosphoimager. Cyclophilin mRNA levels were also determined by a phosphoimager as a control for Northern blot loading differences.
- FIG. 12B The CMV promoter (5), RIP promoter (1), and several modified RIP promoters (FFE3/RIP (2), FFE6/RIP (3), FFE6/RIP/RIPint (4); vertical axis) were fused to insulin and were
- Insulin protein levels secreted into the culture medium were determined by a radioimmunoassay.
- FIG. 12C Insulin protein levels within the cell (insulin content relative to RIP (open bar); horizontal axis) were determined by a radioimmunoassay after breaking open the cells by sonication.
- the modified RIP promoters were significantly stronger than the RIP promoter by itself.
- the FFE6 modified RIP promoters approach the activity of the very strong CMV promoter.
- FIG. 13 Schematic representation of the mitogenic signal pathways in ⁇ -cells. Mitogenic pathways are shown for insulin-like growth factor- 1 (IGF-1) and for growth hormone (GH).
- IGF-l/IGF-1 receptor complex can signal cell mitogenesis via two pathways but in ⁇ -cells it does so primarily through the IRS pathway. Mitogenic stimulation of ⁇ -cells by GH is through the JAK STAT pathway.
- FIG. 14 IGF-1 stimulation of ⁇ -cell growth in the presence of increasing glucose concentrations. Shown are INSl cells with no IGF-1 (open bars) and INSl cells with IGF-1 (10 nM; hatched bars) incubated at different glucose concentrations (glucose, mM; horizontal axis).
- glucose alone can initiate INSl cell growth in a dose-dependent manner reaching a maximum of approximately 10-fold at 18 mM glucose.
- the effect of glucose on INSl cell growth is potentiated by IGF-1 reaching a maximum of INSl cell growth at 15 mM glucose.
- FIG. 15 Growth hormone stimulation of ⁇ -cell growth in the presence of increasing glucose concentrations. Shown are INSl cells with no rGH (open bars) and INSl cells with rGH (10 nM; hatched bars) incubated at different glucose concentrations (glucose, mM; horizontal axis). The fold increase in [ H]-thymidine inco ⁇ oration above no glucose/no rGH control is shown on the vertical axis. The action of rGH, like that of IGF-1, requires a background of glucose to exert its effects.
- the rGH has little effect on cell growth until a threshold of 6 mM glucose and reaches a maximum at 15 mM glucose where there is an approximately 50-fold increase in [ H]-thymidine inco ⁇ oration over that at 0 mM glucose.
- FIG. 16 Additive effects of IGF-1 and rGH on ⁇ -cell growth.
- INSl cells were incubated with no IGF-1 or rGH (D), 10 nM IGF-1 alone ( ⁇ ), 10 nM rGH alone (O), or both 10 nM IGF-1 and 10 nM rGH (•) at increasing glucose concentrations (glucose, mM; horizontal axis).
- the fold increase in [ H]-thymidine inco ⁇ oration above no glucose/no rGH control is shown on the vertical axis.
- both IGF- 1 and rGH potentiate the effect of glucose on INS 1 cell growth to approximately the same degree.
- An additive effect on cell growth is observed when both growth factors are added to INSl cells at the same time.
- FIG 17A, FIG. 17B, FIG. 17C, FIG. 17D and FIG. 17E Adenoviral overexpression of IRS- 1, IRS-2, and SV40 large T-antigen in INSl cells. Shown are uninfected INSl cells (FIG. 17A) and INSl cells were infected with either AdV- ⁇ Gal (FIG. 17B), AdV-IRS-1
- FIG. 17C AdV-IRS-2 (FIG. 17D), or AdV-large T-antigen (Tag; (FIG. 17E)) for 1 hour. After 1 hour, the cells were washed and incubated another 24 hours. No IGF-1 (open bars) or IGF-1 (10 nM; cross-hatched bars) was added to the INSl cells in the presence of either 3 mM or 15 mM glucose (glucose, mM; horizontal axis). The fold increase in [ H]-thym ⁇ d ⁇ ne inco ⁇ oration above "zero" glucose control is shown on the vertical axis.
- Adenoviral- mediated overexpression of IRS-2 in INSl cells in the presence of 10 nM IGF-1 and 15 mM glucose resulted in an approximately 200-fold increase in [ H]-thymidine inco ⁇ oration compared to uninfected cells without glucose.
- AdV-IRS-1 infected cells in the presence of 10 nM IGF-1 and 15 mM glucose showed no increase of [ 3 H]-thymidine inco ⁇ oration over and above that for uninfected cells or cells infected with AdV- ⁇ Gal in the presence of 10 nM IGF-1 and 15 mM glucose.
- BetaGene Medium enhances growth of an engineered, human neuroendocrine cell line.
- the ⁇ G 785/5 cell line was derived from ⁇ G H04 cells which were derived and routinely cultured in RPMI with FBS.
- Time (days) is shown on the horizontal axis.
- BetaGene Medium enhances secretory function of an engineered, human neuroendocrine cell line ( ⁇ G 785/5).
- Human growth hormone (hGH) output ( ⁇ g/well/ our; vertical axis) of ⁇ G 785/5 cells in BetaGene media with FBS (BG-FBS, •) or SF (BG-SF, O) and RPMI media with FBS (RPMI-FBS, ⁇ ) or SF (RPMI-SF, D), is shown.
- Time (days) is shown on the horizontal axis.
- the human growth hormone (hGH) output of cells grown in BetaGene Medium with FBS was approximately 5 times greater than growth hormone output from cells in RPMI with FBS.
- BetaGene Medium maintains secretory function of ⁇ G 18/3E1 cell line.
- the insulin secretory function (insulin, ⁇ g/well/day; vertical axis) of ⁇ G 18/3E1 cells cultured in BetaGene Medium with SF (D) and with 0.5% FBS ( ⁇ ), 1% FBS (A), 2% FBS (O) or 5% FBS (•) is shown.
- the insulin secretory function of ⁇ G 18/3E1 cells was maintained when cells were cultured in BetaGene Medium supplemented with 5%, 2%, or 1% FBS. There was an impairment of secretory function with cells supplemented with 0.5% FBS or SF during the plateau phase of growth (about day 8 to 9 of culture). The secretory impairment at plateau phase under these conditions may be due to decreased biosynthesis or processing of insulin rather than an impairment of secretion.
- FIG 21 Growth in BetaGene Medium maintains regulated secretion from the ⁇ G 18/E1 cell line.
- ⁇ G 18/3E1 cells were grown and maintained at plateau phase for 4 days in BetaGene Medium supplemented with SF + minerals (1), SF + minerals and amino acids (2), SF + amino acids (3), or 2% FBS (4) (horizontal axis).
- Basal (open bars) and stimulated (hatched bars) insulin secretion (ng/well/hour; vertical axis) in response to a secretagogue cocktail is shown for various SF- and 2% FBS- supplemented cultures in BetaGene Medium.
- BetaGene Medium enhances production of GLP-1 from an engineered, rodent neuroendocrine cell line.
- the capability of BetaGene medium to sustain processing and secretion of a peptide that yields proteolytically cleaved and amidated products was evaluated by measuring GLP-1 (amidated and non-amidated) production (GLP-1 immunoreactivity, pg/flask; vertical axis).
- GLP-1 immunoreactivity, pg/flask; vertical axis ⁇ G 191/26 cells were plated in T25 flasks with BetaGene Medium and then the medium was switched to RPMI (1), RPMI with 75 ⁇ M ascorbate (2), or BetaGene Medium (3) (horizontal axis), all with 2% FBS.
- FIG 23 Ascorbate-2-phosphate supplemented media enhances insulin production of an engineered human neuroendocrine cell line.
- a suspension culture of ⁇ G 498/45 cells (PD33) were plated in varying concentrations (ascorbate concentration, mM; horizontal axis) of ascorbic acid (O) or A-2-P ( ⁇ ). Samples were collected for insulin assay (insulin, ng/well/day; vertical axis) and medium changed after 2 and 5 days of culture.
- ascorbate altered insulin output by reducing insulin about 20%, only at the highest concentration.
- high concentrations of ascorbate were cytotoxic, while about 400 ⁇ M concentrations of both ascorbate and A-2-P enhanced insulin secretion.
- the highest concentration of A-2-P did not inhibit insulin output.
- FIG 24 Media supplementation with ascorbate-2-phosphate can effect increased amidation activity with cultured cells.
- Production of amidated (hatched bars) and nonamidated (open bars) GLP-1 was determined by i munoassay (GLP-1 immunoreactivity, ng/100 ⁇ l assayed; vertical axis) of secreted cell products from cells cultured 1 day in RPMI medium (with 2% FBS) supplemented with varying concentrations of A-2-P ( ⁇ M; horizontal axis).
- the dose-response shows half-maximal and maximal amidation activity with about 1 and 10-100 ⁇ M of A-2-P.
- the amount of amidated GLP-1 plateaued from 25-1000 ⁇ M.
- FIG 25 Optimal copper concentration for PAM Activity. ⁇ G 191/26 cell monolayers in T25 flasks were changed to RPMI medium ⁇ copper, or BetaGene Medium ⁇ additional copper (the latter medium contains 5 nM copper). Shown on the horizontal axis are RPMI without CuSO 4 (1), RPMI with 0.5 ⁇ M CuSO 4 (2), BG without additional CuSO 4 (3), BG with 0.5 ⁇ M CuSO 4 (4), BG with 0.25 ⁇ M CuSO 4 (5), and BG with 1 ⁇ M CuSO 4 (6).
- FIG 26 Lack of Cytotoxic Effect of ascorbate-2-phosphate on Primary Human Islets.
- Human islets encapsulated in alginate beads were set up in 24 well plates with about 50 islet equivalents/well and cultured in BetaGene Medium with or without added A-2-P and copper.
- Control cultures 1 (D) and 2 ( ⁇ ), pretreatment (O), 0.5 mM ascorbate (•) and 2 M ascorbate ( ⁇ ) are shown.
- Secretory function and glucose-sensing was determined by incubating the islets with different concentrations of glucose (from 2.2 mM to 22 mM; horizontal axis) for 90 minutes, and determining insulin secretion (insulin, ng well/1.5 hr; vertical axis).
- This glucose dose-response test was performed immediately before adding ascorbate to the cultures and at 2 week intervals. In the first 2 weeks 500 ⁇ M A-2-P, and 1 ⁇ M copper was supplemented. In the second 2 weeks ascorbate was increased to 2 mM, copper was kept at 1 ⁇ M. A-2-P did not impair function as indicated by sensing of glucose, and the maintenance of maximal insulin secretion indicates that there is minimal toxicity of A- 2-P for these culture times.
- HGF/SF hepatocyte growth factor/scatter factor
- This retroviral-oncogene approach has yet to yield stable cells derived from ⁇ -cells.
- the cell line established in Levine et al. (1995) secreted very small amounts of insulin in early passages (3 to 4 ng/million cells/24 hours) when stimulated by nicotinamide. Insulin secretion was also not stable, falling to undetectable amounts in later passages of the cell line. Furthermore, the H-r s of Levine et al. (1995) has separately been reported to induce ⁇ -cell destruction and diabetes in transgenic mice that express H-ras from the rat insulin II gene promoter (Efrat and Hanahan, 1989).
- Neisor et al. (1979) Another approach proposed for use in preparing an insulin-producing cell line is described in Neisor et al. (1979), and generally concerns the use of a temperature-sensitive Rous sarcoma or SV40 virus. This method is again limited by the lack of demonstration of stable cells derived from ⁇ -cells.
- Cell lines generated in Neisor et al. (1979) had very low insulin content (less than 1 ng/million cells, compared to normal islets which contain approximately 5 ⁇ g of insulin/million cells), and levels that quickly fell to undetectable levels after the third subculture.
- U.S. Patent No. 4,332,893 itself states that these methods are not suitable for preparing human ⁇ -cells for use in the treatment of patients with diabetes. For example, it is stated that most temperature sensitive mutants of Rous sarcoma virus are "leaky,” which means that the mutant gene product is not completely inactivated at the non-permissive temperature. In light of the evident problems in terms of safety risks that would result from the leakiness of cells administered to a diabetic patient, U.S. Patent 4,332,893 states that human pancreatic cells should not be transformed according to the methods described therein.
- U.S. Patent 4,332,893 teaches that cells designed for in vivo uses in human patients should be either bovine or porcine cells. The reasoning is that if the conditionally transformed bovine or porcine cells become leaky and proliferate, they are likely to rupture any semipermeable membrane within which they have been housed, thus releasing the transplanted cells into the human host. The use of the xenograftic cells will then cause the host patient to initiate a significant immune response which will lead to the rejection of the foreign cells, which the authors propose would take place before any oncogenic potential of the cells is realized.
- the present invention provides many approaches to the selection and transformation only of ⁇ -cells, thus overcoming the difficulties not addressed by U.S. Patent 4,332,893, associated with the realization that a completely homogenous population of ⁇ -cells may not be purifiable.
- the possibility of producing insulin-producing cell lines by cell fusion techniques are described in U.S. Patent 4,195,125 and PCT application WO 87/05929. Cells described in
- a number of insulinoma cell lines have been established by expression of SV40 large T antigen in ⁇ -cells of transgenic animals under control of the rat insulin promoter/enhancer. Early lines produced by this method, such as ⁇ TC-1 and ⁇ TC-3, were shown to be glucose responsive, but with maximal secretion occurring at subphysiological glucose levels (Efrat et al, 1988). In one cell line studied, the insulin secretion from ⁇ TCl cells decreased by a factor of 10 between passage number 50 and passage number 63. Moreover, as a general trend observed for these cell lines, both the insulin content and insulin secretion decreased from passage 10 to passage 63.
- MIN6 and MIN7 which have different phenotypes and different insulin secretory profiles despite being generated with the identical insulin promoter-SV40 large T antigen construct.
- the MIN6 line shows a 10-fold increase in insulin secretion when glucose concentrations are raised from 5 to 25 mM, while the MIN7 line was found to be unresponsive to glucose.
- the MIN6 line was found to express high levels of the GLUT-2 glucose transporter and low levels of GLUT-1, while the MIN7 line expressed GLUT-1 and virtually no GLUT-2 (Miyazaki et ⁇ /., 1990).
- ⁇ TC- 6 A separate rodent cell line derived by the transgenic T-antigen approach termed ⁇ TC- 6, which, like MIN6, performs glucose stimulated insulin secretion with a concentration dependence similar to islets, and retains GLUT-2 and glucokinase expression in lieu of hexokinase and GLUT-1, has been reported (Efrat et al, 1993). However, growth of these cells in culture results in a left shift in the glucose dose-response curve, with no apparent change in the expression of GLUT-2 and GLUT-1, a small increase in glucokinase activity, and a 6-fold increase in hexokinase.
- ⁇ TC6-F7 soft agar cloning of ⁇ TC-6 cells to establish a cell line ( ⁇ TC6-F7) which retains glucose responsiveness at physiological glucose concentrations through at least 55 passages.
- ⁇ TC6-F7 a cell line which retains glucose responsiveness at physiological glucose concentrations through at least 55 passages.
- These cells express high levels of glucokinase and GLUT-2, low levels of hexokinase activity, and no detectable GLUT-1.
- the conclusion reached by these authors is that the original ⁇ TC- 6 cell line was actually a heterogeneous population of cells, with the less differentiated cells in the population having a selective advantage in tissue culture over the more differentiated cells (Knaack et ⁇ /., 1994).
- NIT-1 cells Using yet another non-engineered ⁇ -cell line, mouse NIT-1 cells, loss of function has been reported at even lower passage numbers (Hamaguchi et al, 1991). In common with RIN and ⁇ TC cells, NIT-1 cells also exhibit a decreased sensitivity to glucose as a function of time in culture, but this is evident as early as passage 16. It was shown that the glucose-stimulated insulin secretion is already lost by passage 16, with passage 19 showing a further decline in function.
- bHC insulinoma cell lines
- T antigen transgenic mice Radvanyi et al, 1993
- These cells display well-differentiated phenotype but grow very slowly.
- transgenic expression of SV40 T antigen can be used to produce rodent islet ⁇ -cell lines, of which a small percentage appear to retain a well-differentiated phenotype. Irrespective of whether the resultant rodent cells prove to have the desired stability and/or properties, it will be understood that such a transgenic animal approach simply cannot be applied to the procurement of human cell lines. Furthermore, whether the cell lines described to date will remain differentiated for periods of sufficient duration to allow their use in hormone replacement therapy is still an open issue, as acknowledged by the groups from which they came (Efrat et al, 1995). The foregoing animal studies also do not address the utility of T antigen for transformation of primary human neuroendocrine cells in culture.
- TAG expression has not been demonstrated in ⁇ -cells, and many neuroendocrine cell types, including ⁇ -cells, have limited capacity for cell division (Finegood et al, 1995), and often lose their differentiated phenotype in tissue culture.
- xenograft tissue including recombinantly engineered cells generated by the methods of U.S. Patent No. 5,427,940, are generally intended for use in transplantation into diabetic animals and patients in the context of a selectively permeable capsule or device, the use of tissue from other species can still result in an immunological reaction.
- the administered cells themselves would be encapsulated within the biocompatible device, it will be understood that the immunological reactions associated with such a therapy will not generally include a significant antibody-mediated immune response.
- the administered cells would generally release one or more molecules, such as peptides, proteins, cytokines and the like, which would be small enough to diffuse through the semipermeable membrane, these released factors would be capable of initiating an immune response in the host animal or patient.
- cells of the immune system would be attracted to the area of implantation, and would be activated upon contact with the released foreign molecules, and would in turn produce various immunological effector molecules, such as cytokines and biological mediators such as TNF (tumor necrosis factor).
- TNF tumor necrosis factor
- the present invention provides for the generation of immortalized human neuroendocrine cells, these cells could be used in the form of an allograft for the treatment of diabetes in human patients. It is an advantage of the invention that the generation of stable human cells is complimentary to the technology of U.S. Patent No. 5,427,940, allowing the glucose-sensing engineering methods disclosed therein to be applied to the stable human cell lines generated by the present invention. It is contemplated that the combination of such approaches will produce cell lines that have high therapeutic relevance. However, prior to the present invention, such an approach could not be pursued due to the lack of stable human neuroendocrine cells.
- the present inventors reasoned that previous methods to create an immortalized human neuroendocrine cell line, such as a human ⁇ -cell line, have failed due to the inte ⁇ lay among several potentially rate-limiting factors, particularly the use of methods that result in non- selective and/or uncontrolled transformation. Phenotypically differentiated ⁇ -cells have an extremely low rate of cell replication (Pittenger et al, 1995), therefore it is not feasible to use stable gene expression systems that rely on cell replication to inco ⁇ orate the proteins for transformation.
- heterogeneous populations of cells such as islets, which are made up of several distinct cell types - fibroblasts, ductal cells, ⁇ -, ⁇ -, and ⁇ -cells - the use of immortalization methods that result in non-selective transformation results in cell lines of indeterminate phenotype. Loss of differentiated phenotype results from use of immortalizing methods that result in uncontrolled transformation (Soldevila et al, 1991). Also, the inadequate numbers of primary human islets have limited these technological efforts. Furthermore, the limited availability of human islets for experimental manipulation has hampered efforts to create a phenotypically stable ⁇ -cell line.
- DNA that encodes transforming proteins to the cells and/or the nucleus and the use of insufficient numbers of proteins that cooperatively interact to drive transformation have been significant limitations.
- the goal in creating an immortalized human ⁇ -cell is to produce a transformed ⁇ -cell line capable of replicating at a rate resulting in population expansion in culture, and maintaining sustained insulin secretion.
- the prior art methods of human islet tissue culture have, at best, only been able to produce a population of ⁇ -cells whose number is static due to very low rates of proliferation, and whose ability to produce insulin in a regulated manner is severely impaired (Brendel et al, 1994); ⁇ -cells that divide at an enhanced rate but have suboptimal insulin content and secretory response (Otonkoski et al, 1993); or transformed cell lines that de-differentiate and quickly lose normal function with respect to insulin (Soldevila et al. 1991).
- Transformation of human cells is a rare event both in vivo as evidenced by tumorogenesis
- DNA tumor viruses such as SV40 large TAG to transform rodent cells and some types of human cells is related to their multifunctional properties.
- SV40 large TAG binds to and inactivates both p53 and Retinoblastoma (RB), two growth suppressor genes (Shay et al, 1991b).
- RB Retinoblastoma
- transformation by SV40 large TAG is accompanied by chromosomal aneuploidy, and presumably promotes the accumulation of genetic lesions in cellular genes that regulate growth (Shay et al, 1993). Not only are a multiplicity of events a requirement for transformation, it has also become apparent that proteins which promote transformation do so by acting cooperatively to promote growth and inhibit cell death (Hunter, 1991).
- pancreatic ⁇ -cells may be more resistant to transformation than most other cell types.
- adult human differentiated ⁇ -cells have little or no capacity for cell division. Any replenishment of differentiated ⁇ -cells in adults is likely to come from growth and differentiation of progenitor cells (Vinik et al, 1996).
- the inability of humans to renew the ⁇ -cell population is demonstrated in vivo by the irreversible nature of Type I diabetes, a disease characterized by the destruction of ⁇ -cells (Unger and Foster, 1992), and in vitro by the difficulties associated with the expansion of islet cultures (Hayek et al. , 1995).
- Insulinomas are typically very small (0.5 to
- IA-2 insulinoma-associated cDNAs
- IA-2 encodes a protein that is related to the protein tyrosine phosphatase family and is thought to be a cell-surface receptor.
- IA-1 The other cDNA is designated IA-1 and is a member the zinc-finger transcription factor family.
- IA- 1 also shows a restricted expression pattern, with a overexpression occurring mainly in neuroendocrine tumors (Goto et al, 1992).
- MENl This disorder is characterized by the combined and increased occurrence of tumors of the parathyroid, pancreatic islet cell, and anterior pituitary.
- the gene linked to MENl maps to chromosome 11, band l lql3, and the corresponding gene has recently been cloned (Chandrasekharappa et al, 1997). Menin, the protein encoded by this gene, has been demonstrated to be a nuclear protein (Guru et al, 1998), and to function in normal cells as a tumor suppressor, with most neuroendocrine tumors studied to date having a double mutation in MENl. It has thus been proposed that the mutation associated with MENl functions in a restricted fashion in transformation, and may be uniquely involved in the development of endocrine tumors.
- transforming components are concerned, the inventors reasoned that improvements in the efficiency of DNA delivery for selective, stable gene expression of transforming proteins, and the expression of more than one protein simultaneously, which proteins cooperatively interact to drive transformation in a more controlled or refined manner, will overcome the problems that previously hindered the development of a phenotypically stable neuroendocrine cell line.
- the inventors envisioned that the cooperation of multiple proteins that regulate cellular growth, senescence, and apoptosis will be preferable.
- Oncogenes and tumor suppressors can alter cell growth by several modes of action including perturbations in extra- and intra-cellular signaling (Cross and Dexter, 1991 ; Cantley et al, 1991; Baserga, 1994); direct effects on the cell cycle (Cordon- Cardo, 1995; Arnold, 1995; Kamb, 1995); inhibition of tumor suppressor genes and proteins (reviewed by Hale et al. , 1996; Marshall, 1991 ); and alterations in nuclear transcription (Hunter, 1991). Recently, an additional protein has emerged as a potentially universal contributor to cellular transformation.
- Telomerase activity defined as the lengthening of telomeres at the end of chromosomes, is expressed at relatively high levels in most human cancers that have been examined to date (Shay and Wright, 1996).
- the catalytic subunit of telomerase referred to as TERT or EST2
- TERT The catalytic subunit of telomerase
- the immortalizing construct comprises the catalytic subunit or component of telomerase.
- the catalytic subunit of telomerase will not need to have full or complete activity to find utility in many aspects of the present invention.
- the catalytic subunit will have sufficient activity to extend the end of a chromosome by at least one telomeric repeat unit.
- the telomerase activity can be measured by any of the telomerase assays described in detail herein below. In any event, the catalytic subunit of telomerase will have sufficient activity to effect the immortalization of the particular human neuroendocrine starting cell utilized.
- immortalized human neuroendocrine cell lines such as human ⁇ -cell lines
- the inventors reasoned that the generation of immortalized human neuroendocrine cells would, in fact, be achievable through the use of promoters, for example tissue-specific promoters, to direct expression of transforming genes, for example the catalytic subunit of telomerase, in specific target cells within a population of human cells, despite the lack of success reported by previous investigators employing related techniques.
- the invention provides immortalized cells of human neuroendocrine lineages that have maintained their differentiated phenotype and thus have a defined, regulated secretory pathway and are stable in in vitro culture.
- the present invention also provides methods for making and using such cells.
- the present invention concerns the use of tissue specific promoters that have been engineered to provide greater transcriptional activity. This is exemplified by the rat insulin promoters (modRIP) containing multimerized enhancer elements.
- a currently preferred method of delivering the promoter-immortalizing construct, or preferably the tissue-specific promoter-telomerase catalytic subunit construct, to the target neuroendocrine cells is to use infection with recombinant adenoviruses. This results in a high efficiency of gene delivery to cells that are normally refractory to other methods of DNA transfection.
- the invention contemplates the use of several transforming genes in combination, and in certain embodiments distinct viral vectors (i.e., adenoviral and retroviral vectors) to deliver transforming genes in combination.
- the transformation methods of the invention concern the su ⁇ rising use of defined culture additives, such as growth factors, that further promote specific neuroendocrine cell growth in preference to that of other cell types, or toxins that specifically inhibit the growth of unwanted cell types.
- ⁇ -cells are provided with a hormone receptor expressed from a tissue-specific promoter, ⁇ -cells are then selectively stimulated to proliferate by the addition of the cognate hormone to defined media. With a dividing ⁇ -cell population, retroviral constructs are then used to efficiently deliver one or more transforming constructs to the genome.
- the ability to control expression of the transforming gene is included, as exemplified by temperature-sensitive constructs and by ecdysone- inducible promoters or promoters containing lac operon sites, so transcription is regulatable.
- Secretory cells especially neuroendocrine cells, have several endogenous functions that make them uniquely suited for production of a wide range of proteins, including secreted peptide hormones. These specialized functions are encompassed by the regulated secretory pathway.
- the regulated secretory pathway embodies the secretory granules of neuroendocrine cells which serve as the site of maturation and storage of a large class of peptide hormones with profound biological functions. Proper biological function of the peptides is due both to their secretion in a regulated and titratable manner as well as a complex set of post- translational modifications resulting in the final biologically active product.
- these cells can be used in vitro to produce large amounts of proteins, in vitro and/or in vivo as drug discovery/development tools, in vivo to supply therapeutic proteins, or in vivo to immunize hosts, for example, even in the production of monoclonal antibodies.
- Regulated secretory cells present a natural bioreactor containing specialized enzymes involved in the processing and maturation of secreted proteins. These processing enzymes include endoproteases (Steiner et al, 1992) and carboxypeptidases (Fricker, 1988) for the cleavage of prohormones to hormones, and PAM, an enzyme catalyzing the amidation of a number of peptide hormones (Eipper et al, 1992). Similarly, maturation and folding of peptide hormones is performed in a controlled, stepwise manner with defined parameters including pH, calcium and redox states.
- a cell specialized for secreting proteins via a regulated pathway can also secrete proteins via the constitutive secretory pathway. Many cell types secrete proteins by the constitutive pathway with little or no secretion through a regulated pathway.
- secretory cell defines cells specialized for regulated secretion, and excludes cells that are not specialized for regulated secretion.
- the regulated secretory pathway is found in secretory cell types such as endocrine, exocrine, neuronal, some gastrointestinal tract cells and other cells of the diffuse endocrine system.
- the origin of the starting cells for use in the present invention thus include human tissues and tumors of neuroendocrine lineages that have a well defined regulated secretory pathway. Cells with defined conditions for culturing ex vivo with some replicative capacity are also preferred. Pancreatic ⁇ -cells and pituitary cells are preferred for use in the present invention, with ⁇ -cells being more preferred. Examples of such cells are shown in Table 1 below (Pearse and Takor, 1979; Nylen and Becker, 1995).
- regulated secretory pathway means that the amount and/or rate of secretion of an endogenous polypeptide can be stimulated by external stimuli, commonly referred to as secretagogues.
- Secretagogues can be physiological in nature, e.g., glucose, amino acids, or hormones, or pharmacological, e.g., IBMX, forskolin, or sulfonylureas.
- Polypeptides destined for the regulated secretory pathway are stored in intracellular storage vesicles known as secretory granules.
- fetal cells are preferred for use as the starting human neuroendocrine cells.
- Human fetal organs such as fetal pancreases at 18 to 24 gestational weeks, can be obtained through nonprofit organ procurement centers, with patient consent for tissue donation being obtained. Dissection of specific organs from the fetuses is often done at the procurement centers. Isolation of fetal pancreases and islets is performed by established techniques (Otonkoski et al, 1993; inco ⁇ orated herein by reference).
- cells from primary human tissues are preferred for use as the starting human neuroendocrine cells.
- Human organs can be obtained from autopsies through nonprofit organ procurement centers.
- High quality human islets are available, for example, from Dr. Camillo Ricordi of the University of Miami Medical Center, an islet transplant surgeon who supplies human islets to scientists throughout the United States. Automated methods for isolation of human pancreatic islets have been established (Ricordi et al, 1988; inco ⁇ orated herein by reference).
- Explanted tumor samples from surgically resected tumors are another preferred starting material. More preferred are insulinomas and pituitary tumors.
- a preferred option as a starting material for achieving a human ⁇ -cell line is to use an insulinoma cell line from a resected human insulinoma tumor.
- Two exemplary insulinomas have been reported (Gueli et al, 1987; Cavallo et al, 1992). In general, these cells are likely to have difficulty processing proinsulin to insulin (Comi and Gorden, 1995), and often express significant levels of other select hormones, such as glucagon and somatostatin.
- the inventors obtained ten independent human insulinomas and maintained these samples in cultures for variable periods of time. Typically the tumor specimens display time- limited capacities for cellular proliferation and a progressive loss in insulin production. Prior to the present disclosure, no certifiable human ⁇ -cell lines had been established from resected insulinomas. This is in contrast to the success researchers have had in establishing human cell lines from other tumor types. For example, researchers at the National Cancer Institute have reported success rates of 35% in establishing cell lines from small cell lung carcinomas (Gazdar and Minna, 1996).
- insulinomas are typically very small (0.5 to 1 cm) in size and, very rarely (-1% of all cases), exhibit metastatic potential. As predicted, patients with this tumor type do not present with pain or occlusion; rather, the clinical symptom is hypoglycemia. It is believed that the vast majority of insulinomas are the result of ⁇ -cell hype ⁇ lasia, and very rarely does this hype ⁇ lasia progress to a truly cancerous phenotype of aggressive growth, tissue invasion, and distal metastasis. The inventors reasoned that the same factors that tend to make insulinomas a relatively benign tumor type are the same factors that are rate-limiting in the establishment of cell lines in vitro.
- tumor cell lines and insulinomas arising from explants of resected neuroendocrine tumors are not necessarily, by definition, stable cells; some such cells maintain a differentiated phenotype for two, four or about six months at the maximum.
- the NCI has approximately 250 cell lines, about 100 of which are reported to possess some level of neuroendocrine properties.
- such cells are intended for use as starting materials in the present invention. Table 2 below is exemplary of these human neuroendocrine cell lines.
- Table 2 describes the properties of certain exemplary cell lines that are contemplated as starting cells for use in certain aspects of the instant application.
- KEY NCI, National Cancer Institute; ATCC, American Type Culture Collection; NE, neuroendocrine; PAM, peptidylglycine alpha-amidatin monooxygenase; SYN, synaptophysin; PC, proconvertase; VIM, vimentin; AB, antibiotic; S/R, sensitive/resistant; G, G418; H, hygromycin; ouabain; P, puromycin; B, blasticidin; Hd, histidinol; Mca, mycophenolic acid; Z, Zeocin; TG, transgene expression +/-; NP, neomycin phosphotransferase; I, insulin; G, glucagon/glycentin; GH, growth hormone; NT, not tested
- ⁇ G H03 cells are derived from a human non-small cell lung carcinoma (ATCC).
- CRL-5816 These cells have a neuroendocrine phenotype, and can be grown in a monolayer. This line was derived by Gazdar and associates from a lung tissue obtained from a patient prior to therapy. H03 cells as obtained from the ATCC are not able to synthesize the peptide neuromedin B (NMB) or the gastrin releasing peptide (GRP).
- NMB peptide neuromedin B
- GFP gastrin releasing peptide
- lung carcinoma cells include cells designated herein as ⁇ G H04, ⁇ G H05, ⁇ G H07, ⁇ G H09, ⁇ G H19, ⁇ G H20 and ⁇ G H21. These, as well as additional cells lines derived from other sources, are described in further detail herein below. These cell lines are only exemplary starting cells for use in the present application; given the teachings provided herein, one of ordinary skill in the art will be able to identify additional cells with characteristics that would make them appropriate for use in the present invention.
- HOI cells (ATCC Number: CCL-251) also may be used in the present invention. These cells are human colorectal carcinoma cells having an epithelial mo ⁇ hology. These cells grow in floating aggregates of round cells. A characteristic that makes these cells useful in the context of the present invention is that they contain cytoplasmic dense core granules characteristic of endocrine secretion.
- ⁇ G H02 cells are obtained from the ATCC (CRL-1803) are derived from a thyroid medullary carcinoma. Their mo ⁇ hology is epithelial and are known to produce high levels of calcitonin and carcinoembryonic antigen (CEA). Chromosomal analysis of the cell line and tumors induced in nude mice reveal an aneuploid human karyotype with several marker chromosomes.
- ⁇ G H04 cells are obtained from the ATCC (CRL-5803) are lung carcinoma cells and have a neuroendocrine phenotype. The cells have a homozygous partial deletion of the p53 protein, and lack expression of p53 protein. The cells are able to synthesize the peptide NMB at 0.1 pmol/mg protein, but not the gastrin releasing peptide (GRP).
- Another lung carcinoma cell contemplated for use in certain embodiments of the present invention is designated ⁇ G H05 (ATCC Number: CRL-5808). This is a classic small cell lung cancer cell line with an epithelial mo ⁇ hology. This line was derived from cells recovered from pleural effusion taken from a patient after chemotherapy.
- ⁇ G H05 expresses elevated levels of the 4 biochemical markers of SCLC: neuron specific enolase, the brain isoenzyme of creatine kinase, L-dopa carboxylase and bombesin-like immunoreactivity.
- the cells express the c-kit gene as well as the L-myc gene, and L-myc is amplified.
- the cells express easily detectable levels of p53 mRNA compared to levels found in normal lung.
- ⁇ G H06 (ATCC Number: CRL-5815), having an epithelial mo ⁇ hology; these cells produce neuromedin B (NMB).
- NMB neuromedin B
- This line was derived from tissue taken prior to therapy. This is the best differentiated of the available bronchial carcinoid lines.
- the cells express easily detectable levels of p53 mRNA compared to levels found in normal lung.
- the cells are able to synthesize the peptide NMB (at 0.1 pmol/mg protein), but not the gastrin releasing peptide (GRP).
- GFP gastrin releasing peptide
- the cell line secretes a parathyroid hormone-like protein which is calcium stimulated through a protein kinase C pathway. Further, growth of ⁇ G H06 cells is inhibited by epidermal growth factor (EGF) receptor monoclonal antibodies.
- EGF epidermal growth factor
- ⁇ G H07 Another classic small cell lung cancer cell line is ⁇ G H07 (ATCC Number: CRL- 5804). This line was derived from cells recovered from pleural effusion obtained from a patient prior to therapy, and expresses elevated levels of the 4 biochemical markers of SCLC: neuron-specific enolase, the brain isoenzyme of creatine kinase, L-dopa carboxylase and bombesin-like immunoreactivity. Only trace amounts of the retinoblastoma susceptibility gene (RB) mRNA, were detected. RB protein was not detected. The cells express the c-kit gene as well as the N-myc gene. N-myc is not amplified.
- RB retinoblastoma susceptibility gene
- the cells are not able to synthesize the peptide neuromedin B (NMB) or the gastrin-releasing peptide (GRP). They express easily detectable levels of p53 mRNA compared to levels found in normal lung. These cells are also useful for transfection studies.
- ⁇ G H08 are carcinoma cells isolated from a stage 3A squamous cell lymph node carcinoma (ATCC Number: CRL-5867).
- ⁇ G H09 are derived from an atypical lung carcinoid and are available form the ATCC (CRL-5838).
- ⁇ G H10 cell line is a commercially available cell line derive from lung carcinoma (ATCC Number CCL-185)
- Another similar cell line is ATCC number CCL- 185.1 derived from CCL-185 which was initiated through explant culture of lung carcinomatous tissue.
- CCL- 185.1 are adapted to growth in serum-free medium.
- ⁇ G Hl l cells may be obtained form ATCC (number HTB-9) and are derived from a bladder carcinoma.
- ⁇ G HI 3 (ATCC Number: CRL-2139) are from a primitive neuroectodermal brain tumor. The cells express CCK specific mRNA and synthesize considerable quantities of variably processed CCK prohormone.
- CCL-249 are designated herein as ⁇ G HI 4 and are derived from a colon adenocarcinoma. This is one of 14 colorectal carcinoma cell lines derived from a well differentiated sigmoid tumor from a patient prior to therapy. The line was initially grown in medium with fetal bovine serum, but was later adapted to growth in the chemically defined medium ACL-4. Floating aggregates produce tubuloglandular structures lined by columnar epithelia.
- ⁇ G HI 5 are from a colorectal carcinoma (ATCC Number: CCL-253) and have an epithelial phenotype. This line was derived from a metastasis to the abdominal wall obtained from a patient after treatment with 5-fluorouracil.
- ⁇ G HI 6 are the same as the commercially available cell line of ATCC Number: CRL-5974. These are gastric carcinoma cells that express the surface glycoproteins carcinoembryonic antigen (CEA) and TAG 72 and the muscarinic cholinergic and vasoactive intestinal peptide (VIP) receptors, but lack gastrin receptors
- HTB-10 are the cells referred to herein as ⁇ G HI 8. These cells are derived from a neuroblastoma cell line and is one of two cell lines (see also ATCC HTB-11) of neurogenic origin.
- ⁇ G H19 or ATCC Number: HTB-184 are small cell lung carcinoma cells of an extrapulmonary origin and are from an adrenal metastasis in an adult. The cells produce easily detectable p53 mRNA at levels comparable to those in normal lung tissue.
- ⁇ G H20 (ATCC Number: HTB-177) is a large cell carcinoma cell line derived from the pleural fluid of a patient with large cell cancer of the lung.
- the cells stain positively for keratin and vimentin but are negative for neurofilament triplet protein.
- the line expresses some properties of neuroendocrine cells, is relatively chemosensitive and can be cloned in soft agar (with or without serum).
- ⁇ G H21 (ATCC Number: CRL-2195) is yet another small cell lung carcinoma
- SCLC SCLC cell
- SCLC SCLC cell that is contemplated for use as a starting cell in certain aspects of the present invention. It can grow as suspension and loosely adherent culture, and is a biochemically stable continuously cultured cell line that has retained important features of SCLC.
- the line was derived from a non-encapsulated primary lung tumor from the apical portion of the upper lobe of the left lung.
- This cell line is an unusual undifferentiated large cell variant of small cell lung carcinoma. It has the mo ⁇ hology of a variant, but the biochemical properties of a classic SCLC. Electron microscopy revealed the presence of gland formation and intracytoplasmic lamellar bodies. The cells have neuroendocrine markers L-dopa decarboxylase and dense core secretory granules.
- ⁇ G H23 is a long-term tissue culture cell line derived from a metastatic human carcinoid tumor of the pancreas (Evers et al., 1991; Parekh et al., 1994). This cell line is also known as BON (Evers et al., 1991); tumors derived from this cell line are histologically identical to the original tumor.
- the cells have significant amounts of neurotensin, pancreastatin, and serotonin (5-HT), as demonstrated in the cells by radioimmunoassay (RIA), and chromogranin A, bombesin, and 5-HT, as confirmed by immunocytochemistry.
- RIA radioimmunoassay
- the cells possess neurosecretory granules and functional receptors for acetylcholine, 5-HT, isoproterenol, and somatostatin.
- BON cells possess a specific transport system for uptake of 5-HT from the medium; this uptake system may be a route for regulation of autocrine effects of 5-HT on carcinoid cells (Parekh et al, 1994).
- This unique human carcinoid tumor cell line provides an exemplary starting material for the bioengineering described herein and possess intracellular mechanisms ideally adapted for secretagogue action in the release of amines and peptides.
- ⁇ G H25 (ATCC Number: HB-8065), which is derived from a hepatoblastoma.
- This cell line produces ⁇ -fetoprotein, albumin, ⁇ -2-macroglobulin, ⁇ -1-antitrypsin, transferrin; ⁇ -1-antichymotrypsin, haptoglobin, ceruloplasmin, plasminogen, and demonstrates decreased expression of apoA-I mRNA and increased expression of catalase mRNA in response to gramoxone (oxidative stress), complement (C4), C3 activator, fibrinogen, ⁇ -1 acid glycoprotein, ⁇ -2-HS-glycoprotein, ⁇ -lipoprotein and retinol binding protein.
- C4 oxidative stress
- fibrinogen fibrinogen
- fibrinogen ⁇ -1 acid glycoprotein
- ⁇ -2-HS-glycoprotein ⁇ -lipoprotein
- retinol binding protein retinol binding protein
- Table 1 shown above is exemplary of the types of cells contemplated for use in the present invention. ⁇ -cells and pituitary cells are preferred for use in the present invention, with ⁇ -cells being more preferred. Additional cell types useful in the present invention will be readily known to those of skill in the art.
- pituitary cells are preferred for use with this invention.
- pituitary cells may allow for higher efficiency of transformation as culture conditions have been reported for promoting the proliferation of rodent pituitary cells in vitro (Nicol et l, 1990).
- the inventors contemplate establishing similar conditions for human pituitary cells which will allow for retroviral infection and provide a means for efficiently introducing transforming genes.
- Pituitary cells may have an advantage for use in cell-based therapies of IDDM as there is a suggestion that this cell type can survive and sustain secretory function in autoimmune disease.
- the POMC promoter was used to drive expression of insulin in the cells of the intermediate lobe of transgenic nonobese diabetic (NOD) mice. Such cells were resistant to autoimmune-dependent destruction even when implanted next to islets in which ⁇ -cells were destroyed during the course of the disease (Lipes et al, 1996).
- Secretory Polypeptides Expression of one or more proteins or polypeptides that are normally secreted can be engineered into neuroendocrine cells.
- the cDNA's encoding a number of useful human proteins are available. Examples would include soluble CD-4, Factor VIII, Factor IX, von Willebrand Factor, TPA, urokinase, hirudin, interferons, TNF, interleukins, hematopoietic growth factors, antibodies, albumin, leptin, transferrin and nerve growth factors.
- Exemplary secretory polypeptides are listed in Table 1 above, and in Tables 3-5 below.
- Peptide hormones claimed herein for engineering in neuroendocrine cells are grouped into three classes with specific examples given for each. These classes are defined by the complexity of their post-translational processing. Class I is represented by growth hormone, prolactin and parathyroid hormone. A more extensive list of human peptides that are included in Class I is given in Table 3. These require relatively limited proteolytic processing followed by storage and stimulated release from secretory granules. Class II is represented by insulin and glucagon. A more extensive list of human peptide hormones that are included in Class II are given in Table 4. Further proteolytic processing is required, with both endoproteases and carboxypeptidases processing of larger precursor molecules occurring in the secretory granules.
- Class III is represented by amylin, glucagon-like peptide I and calcitonin. Again, a more extensive list of Class III human peptide hormones is given in Table 5. In addition to the proteolytic processing found in the Class II peptides, amidation of the C-terminus is required for proper biological function.
- Adrenocorticotropin (ACTH) Gastric Inhibitory Peptide (GIP)
- Angiotensin I and II Glucagon ⁇ -endo ⁇ hin Insulin ⁇ -Melanocyte Stimulating Hormone ( ⁇ -MSH) Lipotropins
- CGRP Calcitonin Gene related Peptide
- PTH-rP Parathyroid Hormone-related protein
- PTH-rP Parathyroid Hormone-related protein
- PTH-111 PTH-rP
- VIP Vasoactive Intestinal Peptide
- AVP Vasopressin
- Alpha Melanocyte Stimulating Hormone alpha-MSH
- Atrial Natriuretic Factor 5-28)
- AMF Amylin
- Amyloid P Component SAP-1 Corticotropin Releasing Hormone (CRH) Growth Hormone Releasing Factor (GHRH) Luteinizing Hormone-Releasing Hormone (LHRH) Neuropeptide Y Substance K (Neurokinin A ) Substance P Thyrotropin Releasing Hormone (TRH)
- the engineered cells may express and/or overexpress one or more enzymes of therapeutic value.
- enzymes include, but are not limited to, adenosine deaminase (e.g. Genbank Accession Nos. P55265; U18121; U73107; Z97053; P00813; U75503; DUHUA), galactosidase (e.g. Genbank Accession Nos P54803; P51569; P23780; D00039), glucosidase (e.g.
- P00740 human K02402 (human) P00741 (bovine) and A22493
- sphingolipase e.g., lysosomal acid lipase (e.g., Genbank Accession Nos P38571 ; S41408), lipoprotein lipase (e.g., Genbank Accession No. P06858), hepatic lipase (e.g., Genbank Accession Nos. AF037404; PI 1150; P07098), pancreatic lipase related protein (e.g., Genbank Accession Nos. P54315; P54317) pancreatic lipase (PI 6233) and uronidase.
- Genbank Accession Nos P38571 ; S41408 lipoprotein lipase
- hepatic lipase e.g., Genbank Accession Nos. AF037404; PI 1150; P07098
- expression vector or construct means any type of genetic construct containing a nucleic acid coding for a gene product in which part or all of the nucleic acid encoding sequence is capable of being transcribed.
- the transcript may be translated into a protein, but it need not be.
- expression includes both transcription of a gene and translation of a RNA into a gene product.
- expression only includes transcription of the nucleic acid, for example, to generate antisense or ribozyme constructs.
- vectors are contemplated to be those vectors in which the coding portion of the DNA segment, whether encoding a full length protein or smaller peptide, is positioned under the transcriptional control of a promoter.
- a “promoter” refers to a DNA sequence recognized by the synthetic machinery of the cell, or introduced synthetic machinery, required to initiate the specific transcription of a gene.
- the phrases “operatively positioned", “under control” or “under transcriptional control” means that the promoter is in the correct location and orientation in relation to the nucleic acid to control RNA polymerase initiation and expression of the gene.
- the promoter may be in the form of the promoter that is naturally associated with a particular gene, as may be obtained by isolating the 5' non-coding sequences located upstream of the coding segment or exon, for example, using recombinant cloning and/or polymerase chain reaction (PCRTM) technology, in connection with the compositions disclosed herein (PCR technology is disclosed in U.S. Patent 4,683,202 and U.S. Patent 4,682,195, each inco ⁇ orated herein by reference).
- PCRTM polymerase chain reaction
- a recombinant or heterologous promoter is intended to refer to a promoter that is not normally associated with a particular gene in its natural environment.
- Such promoters may include promoters normally associated with other genes, and/or promoters isolated from any other bacterial, viral, eukaryotic, or mammalian cells.
- promoter that effectively directs the expression of the DNA segment in the cell type chosen for expression.
- the use of promoter and cell type combinations for protein expression is generally known to those of skill in the art of molecular biology, for example, see Sambrook et al. (1989), inco ⁇ orated herein by reference.
- the promoters employed may be constitutive, or inducible, and can be used under the appropriate conditions to direct high level expression of the introduced DNA segment, such as is advantageous in the large-scale production of recombinant proteins or peptides.
- At least one module in a promoter functions to position the start site for RNA synthesis.
- the best known example of this is the TATA box, but in some promoters lacking a TATA box, such as the promoter for the mammalian terminal deoxynucleotidyl transferase gene and the promoter for the SV40 late genes, a discrete element overlying the start site itself helps to fix the place of initiation.
- promoter elements regulate the frequency of transcriptional initiation. Typically, these are located in the region 30-110 bp upstream of the start site, although a number of promoters have been shown to contain functional elements downstream of the start site as well.
- the spacing between promoter elements frequently is flexible, so that promoter function is preserved when elements are inverted or moved relative to one another. In the tk promoter, the spacing between promoter elements can be increased to 50 bp apart before activity begins to decline. Depending on the promoter, it appears that individual elements can function either co-operatively or independently to activate transcription.
- the promoter is required to express the transforming genetic construct to a degree sufficient to effect transformation of a target cell type amongst a population of different cell types such that the transformed target cell results in the generation of a stable human regulated secretory cell.
- Promoters can be classified into two groups, ubiquitous and tissue- or cell-specific. Ubiquitous promoters activate transcription in all or most tissues and cell types. Examples of ubiquitous promoters are cellular promoters like the histone promoters, promoters for many metabolic enzyme genes such as hexokinase I and glyceraldehyde-3-phosphate dehydrogenase, and many viral promoters such as the cytomegalovirus promoter (CMVp) and the Rous sarcoma virus promoter (RSVp). In certain aspects of the present invention, these promoters are appropriate for use with the immortalizing constructs described herein, as well as finding use in additional aspects of the present invention. Additional examples of these types of promoters that are contemplated for use in the present invention are listed below in Tables 6 and 7.
- Tissue- or cell-specific promoters activate transcription in a restricted set of tissues or cell types or, in some cases, only in a single cell type of a particular tissue.
- stringent cell-specific promoters are the insulin gene promoters which are expressed in only a single cell type (pancreatic ⁇ -cells) while remaining silent in all other cell types, and the immunoglobulin gene promoters which are expressed only in cell types of the immune system.
- the promoter may be "context specific" in that it will be expressed only in the desired cell type and not in other cell types that are likely to be present in the population of target cells, e.g., it will be expressed in ⁇ -cells, but not in ⁇ - or ⁇ -cells, when introduced into intact human islets.
- an insulin promoter targets the expression of a linked transforming oncogene selectively to ⁇ -cells of a human islet preparation even though rnany other contaminating cell types exist in the preparation.
- the present invention is applicable to the generation of stably transformed neuroendocrine secretory cell lines other than ⁇ -cells, other context specific promoters may be employed.
- the cell-specific prolactin gene promoter can be used to express a linked transforming oncogene selectively to lactotrophs surrounded by all the other cell types present in a pituitary cell preparation.
- HIP can direct cell-specific expression of linked genes in rodent ⁇ -cell lines and rat primary islets, albeit, at a somewhat lower level than that observed for RIPl (Melloul et al, 1993).
- the inventors postulate that RIP1 and RIP2 should function effectively in human ⁇ -cells.
- FF RIPl FAR/FLAT minienhancer
- neuroendocrine cell specific promoter is used to define a promoter that is specific for one or more types of neuroendocrine cells.
- a promoter that specifically expresses of at least a first immortalizing construct in one, two, three, four, a plurality or all neuroendocrine cell types, but not in other, non-neuroendocrine cell types, is contemplated for use.
- glucagon promoter GenBank accession number X03991
- growth hormone promoter GenBank accession numbers J03071 and K00470
- POMC gene promoter GenBank accession numbers V01510 and K02406
- calcitonin promoter GenBank accession number XI 5943
- GIP gene promoter GenBank accession number M31674
- ⁇ -glycoprotein promoter Genbank accession number LO5632
- Promoters can be modified in a number of ways to increase their transcriptional activity. Multiple copies of a given promoter can be linked in tandem, mutations which increase activity may be introduced, single or multiple copies of individual promoter elements may be attached, parts of unrelated promoters may be fused together, or some combination of all of the above can be employed to generate highly active promoters. All such methods are contemplated for use in connection with the present invention. German et al.
- CMV promoter which has high but short-lived transcriptional activity in dog myoblasts
- MCKp muscle-specific creatine kinase promoter
- modified rat insulin promoters containing multimerized enhancer elements have been engineered.
- modRIP modified rat insulin promoters
- the currently preferred modRIP contains six multimerized repeats of a 50 base pair region of the cis acting enhancer of RIP, placed upstream of an intact copy of RIP.
- CMVp cytomegalovirus promoter
- the particular promoter that is employed to control the expression of a nucleic acid is not believed to be critical, so long as it is capable of expressing the nucleic acid in the targeted cell.
- a promoter that is capable of being expressed in a human cell.
- a promoter might include either a human or viral promoter.
- Preferred promoters include those derived from HSV, including the HNFl ⁇ promoter.
- Another preferred embodiment are the tetracycline controlled promoters.
- the human cytomegalovirus (CMV) immediate early gene promoter, the SV40 early promoter and the Rous sarcoma virus long terminal repeat can be used to obtain high-level expression of transgenes.
- CMV cytomegalovirus
- the use of other viral or mammalian cellular or bacterial phage promoters which are well-known in the art to achieve expression of a transgene is contemplated as well, provided that the levels of expression are sufficient for a given pu ⁇ ose.
- Tables 6 and 7 below list several elements/promoters which may be employed, in the context of the present invention, to regulate the expression of a particular gene, except as discussed above when a promoter that is specific for expression in a particular cell type is required or desired. This list is not intended to be exhaustive of all the possible elements involved in the promotion of transgene expression but, merely, to be exemplary thereof.
- Enhancers were originally detected as genetic elements that increased transcription from a promoter located at a distant position on the same molecule of DNA. This ability to act over a large distance had little precedent in classic studies of prokaryotic transcriptional regulation. Subsequent work showed that regions of DNA with enhancer activity are organized much like promoters. That is, they are composed of many individual elements, each of which binds to one or more transcriptional proteins.
- enhancers The basic distinction between enhancers and promoters is operational. An enhancer region as a whole must be able to stimulate transcription at a distance; this need not be true of a promoter region or its component elements. On the other hand, a promoter must have one or more elements that direct initiation of RNA synthesis at a particular site and in a particular orientation, whereas enhancers lack these specificities. Promoters and enhancers are often overlapping and contiguous, often seeming to have a very similar modular organization. Additionally any promoter/enhancer combination (as per the Eukaryotic Promoter Data Base EPDB) could also be used to drive expression of a transgene. Use of a T3, T7 or SP6 cytoplasmic expression system is another possible embodiment. Eukaryotic cells can support cytoplasmic transcription from certain bacterial promoters if the appropriate bacterial polymerase is provided, either as part of the delivery complex or as an additional genetic expression construct. _
- a suitable clone or clones may proceed to prepare an expression system.
- DNA segment(s) for expression in human neuroendocrine cells may be performed by techniques generally known to those of skill in recombinant expression. It is believed that a number of different expression systems may be employed in the expression of proteins and peptides in the present invention.
- cDNA and genomic sequences are suitable for expression in human neuroendocrine cells, as these cells will generally process the genomic transcripts to yield functional mRNA for translation into protein.
- a cDNA version of the gene it is believed that the use of a cDNA version will provide advantages in that the size of the gene will generally be much smaller and more readily employed to transfect the targeted cell than will the genomic version of the gene, which will typically be up to an order of magnitude larger than the cDNA version of the gene.
- the inventors do not exclude the possibility of employing a genomic version of a particular gene where desired.
- polyadenylation site e.g., 5'-AATAAA-3'
- the poly A addition site is placed about 30 to 2000 nucleotides "downstream" of the termination site of the protein at a position prior to transcription termination.
- the nature of the polyadenylation signal is not believed to be crucial to the successful practice of the invention, and any such sequence may be employed.
- Preferred embodiments include the SV40 polyadenylation signal and the bovine growth hormone polyadenylation signal, convenient and known to function well in various target cells.
- a terminator are also contemplated as an element of the expression cassette. These elements can serve to enhance message levels and to minimize read through from the cassette into other sequences.
- a specific initiation signal also may be required for efficient translation of coding sequences. These signals include the ATG initiation codon and adjacent sequences. Exogenous translational control signals, including the ATG initiation codon, may need to be provided. One of ordinary skill in the art would readily be capable of determining this and providing the necessary signals. It is well known that the initiation codon must be "in-frame" with the reading frame of the desired coding sequence to ensure translation of the entire insert. The exogenous translational control signals and initiation codons can be either natural or synthetic. The efficiency of expression may be enhanced by the inclusion of appropriate transcription enhancer elements.
- a particular protein may be co-expressed with one or more additional selected protein(s) or polypeptide(s), wherein the proteins may be co-expressed in the same cell or one or more particular gene(s) may be provided to a human neuroendocrine cell that already has another selected protein.
- Co-expression may be achieved by co-transfecting the cell with two or more distinct recombinant vectors, each bearing a copy of the respective DNA.
- a single recombinant vector may be constructed to include the coding regions for the two or more proteins, which could then be expressed in cells transfected with the single vector.
- the term "co-expression" herein refers to the expression of two or more selected proteins in the same recombinant cell.
- IRES elements are used to create multigene, or polycistronic, messages.
- IRES elements are able to bypass the ribosome scanning model of 5' methylated Cap dependent translation and begin translation at internal sites (Pelletier and Sonenberg, 1988; Jang et al, 1988).
- IRES elements from two members of the picornavirus family polio and encephalomyocarditis have been described (Pelletier and Sonenberg, 1988), as well an IRES from a mammalian message (Macejak and Sarnow, 1991).
- IRES elements can be linked to heterologous open reading frames.
- each open reading frame can be transcribed together, each separated by an IRES, creating polycistronic messages.
- IRES element By virtue of the IRES element, each open reading frame is accessible to ribosomes for efficient translation. Multiple genes can be efficiently expressed using a single promoter/enhancer to transcribe a single message.
- Any heterologous open reading frame can be linked to IRES elements. This includes genes for secreted proteins, multi-subunit proteins, encoded by independent genes, intracellular or membrane-bound proteins and selectable markers. In this way, expression of several proteins can be simultaneously engineered into a cell with a single construct and a single selectable marker.
- engineered and recombinant cells are intended to refer to a human neuroendocrine cell into which an exogenous DNA segment or gene, such as a cDNA or genomic version of a gene has been introduced. Therefore, engineered cells are distinguishable from naturally occurring cells which do not contain a recombinantly introduced exogenous DNA segment or gene. Engineered cells are thus cells having a gene or genes introduced through the hand of man. Recombinant cells include those having an introduced cDNA or genomic version of a gene, and also include genes positioned adjacent to a promoter not naturally associated with the particular introduced gene.
- an expression vector that comprises a wild-type or mutant protein-encoding nucleic acid under the control of one or more promoters.
- a coding sequence "under the control of a promoter, one positions the 5' end of the transcription initiation site of the transcriptional reading frame generally between about 1 and about 50 nucleotides "downstream" of (i.e., 3' of) the chosen promoter.
- the "upstream” promoter stimulates transcription of the DNA and promotes expression of the encoded recombinant protein. This is the meaning of "recombinant expression” in this context.
- Suitable expression vectors include, but are not limited to, bacteriophage, plasmid, cosmid, viral, or artificial chromosome (including, but not limited to, bacterial artificial chromosome (BAC), yeast artificial chromosome (YAC) and human artificial chromosome (HAC)) expression vectors.
- BAC bacterial artificial chromosome
- YAC yeast artificial chromosome
- HAC human artificial chromosome
- Expression vectors for use in mammalian such cells ordinarily include an origin of replication (as necessary), a promoter located in front of the gene to be expressed, along with any necessary ribosome binding sites, RNA splice sites, polyadenylation site, and transcriptional terminator sequences.
- the origin of replication may be provided either by construction of the vector to include an exogenous origin, such as may be derived from SV40 or other viral (e.g., Polyoma, Adeno, VSV, BPV) source, or may be provided by the host cell chromosomal replication mechanism. If the vector is integrated into the host cell chromosome, the latter is often sufficient.
- the promoters may be derived from the genome of mammalian cells (e.g., metallothionein promoter) or from mammalian viruses (e.g., the adenovirus late promoter; the vaccinia virus 7.5K promoter). Further, it is also possible, and may be desirable, to utilize promoter or control sequences normally associated with the desired gene sequence, provided such control sequences are compatible with the human neuroendocrine cell systems.
- a number of viral based expression systems may be utilized, for example, commonly used promoters are derived from polyoma, Adenovirus 2, and most frequently Simian Virus 40 (SV40).
- the early and late promoters of SV40 virus are particularly useful because both are obtained easily from the virus as a fragment which also contains the SV40 viral origin of replication. Smaller or larger SV40 fragments may also be used, provided there is included the approximately 250 bp sequence extending from the Hr ⁇ dlll site toward the Bgll site located in the viral origin of replication.
- the coding sequences may be ligated to an adenovirus transcription translation control complex, e.g., the late promoter and tripartite leader sequence.
- This chimeric gene may then be inserted in the adenovirus genome by in vitro or in vivo recombination. Insertion in a non-essential region of the viral genome (e.g., region El or E3) will result in a recombinant virus that is viable and capable of expressing a desired protein in infected hosts.
- cell lines that stably express constructs encoding a desired protein may be engineered.
- host cells can be transformed with vectors controlled by appropriate expression control elements (e.g., promoter, enhancer, sequences, transcription terminators, polyadenylation sites, etc.), and a selectable marker.
- appropriate expression control elements e.g., promoter, enhancer, sequences, transcription terminators, polyadenylation sites, etc.
- engineered cells may be allowed to grow for 1-2 days in an enriched media, and then are switched to a selective media.
- the selectable marker in the recombinant plasmid confers resistance to the selection and allows cells to stably integrate the plasmid into their chromosomes and grow to form foci which in turn can be cloned and expanded into cell lines.
- the present invention also provides recombinant candidate screening and selection methods which are based upon whole cell assays and which, preferably, employ a reporter gene that confers on its recombinant hosts a readily detectable phenotype that emerges only under conditions where a general DNA promoter positioned upstream of the reporter gene is functional.
- reporter genes encode a polypeptide (marker protein) not otherwise produced by the host cell which is detectable by analysis of the cell culture, e.g., by fluorometric, radioisotopic or spectrophotometric analysis of the cell culture.
- a genetic marker is provided which is detectable by standard genetic analysis techniques, such as DNA amplification by PCRTM or hybridization using fluorometric, radioisotopic or spectrophotometric probes.
- Exemplary enzymes for screening include esterases, phosphatases, proteases (tissue plasminogen activator or urokinase) and other enzymes capable of being detected by their activity, as will be known to those skilled in the art.
- Contemplated for use in the present invention is green fluorescent protein (GFP) as a marker for transgene expression (Chalfie et al, 1994). The use of GFP does not need exogenously added substrates, only irradiation by near UV or blue light, and thus has significant potential for use in monitoring gene expression in living cells.
- GFP green fluorescent protein
- CAT chloramphenicol acetyltransferase
- CAT chloramphenicol acetyltransferase
- Other marker genes within this class are well known to those of skill in the art, and are contemplated for use in the present invention.
- reporter genes which confer detectable characteristics on a host cell are those which encode polypeptides, generally enzymes, which render their transformants resistant against toxins.
- Examples of this class of reporter genes are: the neo gene (Colberre- Garapin et al, 1981) which protects host cells against toxic levels of the antibiotic G418; the gene conferring streptomycin resistance (U. S. Patent 4,430,434); the gene conferring hygromycin B resistance (Santerre et al, 1984; U. S.
- a protein may be "overexpressed", i.e., expressed in increased levels relative to its natural expression in cells.
- overexpression may be assessed by a variety of methods, including radiolabeling and/or protein purification. However, simple and direct methods are preferred, for example, those involving SDS PAGE and protein staining or western blotting, followed by quantitative analyses, such as densitometric scanning of the resultant gel or blot.
- a specific increase in the level of the recombinant protein or peptide in comparison to the level in natural cells is indicative of overexpression, as is a relative abundance of the specific protein in relation to the other proteins produced by the host cell and, e.g., visible on a gel.
- Exemplary immortalizing genes and constructs are listed herein in Table 8. Any one or more of the genes listed therein may be used in the context of the present invention. Where two or more immortalizing genes are provided to a human neuroendocrine cell, it may be preferable to provide genes from different functional categories, such as those that perturb signal transduction, affect cell cycle, alter nuclear transcription, alter telomere structure or function, inhibit apoptosis, or that exert pleiotropic activities. It will be understood that the genes listed in Table 8 are only exemplary of the types of oncogenes, mutated tumor suppressors and other immortalizing genetic constructs and elements that may be used in this invention. Further immortalizing genes and constructs will be known to those of ordinary skill in the art.
- Representative members of this class are genes or cDNAs encoding tyrosine kinases, serine/threonine kinases, growth factors and receptors, small GTPases, and receptor-type tyrosine phosphatase IA-2.
- Exemplary of the members preferred for use in the present invention is neu (also known as her2 or erbB-2; GenBank accession numbers Ml 1730, X03363, U02326 and S57296). neu was discovered as an oncogene in breast cancer, but it is also found in other forms of cancer, neu appears to be a member of the receptor tyrosine kinase family.
- insulin receptor substrate-1 insulin receptor substrate-1
- insulin receptor substrate-2 insulin receptor substrate-2
- HGFr hepatocyte growth factor receptor
- Other preferred members are insulin-like growth factor 1 receptor (GenBank accession number X04434 and M24599), and GTPase Gs ⁇ (GenBank accession numbers X56009, X04409).
- Gs ⁇ is associated with pituitary tumors that secrete growth hormone, but not other neuroendocrine or endocrine tumors.
- cyclin Dl also known as PRAD or bcl-1; GenBank accession numbers M64349 and M73554. This is an oncogene primarily associated with parathyroid tumors.
- Exemplary is c-myc (GenBank accession numbers J00120, K01980, M23541, V00501, X00364.
- Telomeres occur at the end of linear chromosomes, and are required for the completion of DNA replication and the maintenance of genetic stability (Shay, 1997; Greider, 1998). Telomere length is variable in cell types and lineages. In general, cells with the capacity for unlimited or indefinite replication (most cancer cells, cancer cell lines, and embryonic tissues) maintain long telomeres, whereas a loss in telomere length is accompanied by cellular senescence as exhibited by most somatic cell types of adult tissues. Telomere length is determined by the activity of telomerase, a ribonucleoprotein enzyme composed of at least two components: TERC, the RNA component; and TERT, the catalytic subunit of the enzyme.
- telomere adds hexameric repeats (TTAGGG) to the telomeric end of chromosomes.
- TTAGGG hexameric repeats
- the tight association between telomere length and the capacity for cellular division has led to the hypothesis that telomerase may function as the molecular "clock" that determines the proliferative potential of a given cell. Consequently, telomerase has received attention as an agent in aging and as a novel target in the development of cancer therapies.
- the inventors contemplate the use of the catalytic subunit of telomerase, TERT, to immortalize human pancreatic ⁇ -cells.
- telomerase-positive versus telomerase-negative cell populations have been complemented by studies of human cancers, with increased telomerase activity occurring in about 90% of tumors.
- TERT expression may be the rate-limiting step in many cases of cellular immortalization (Kallakury et al, 1997; Kolquist et ah, 1998; Tsutsumi et ah, 1997).
- One presently preferred strategy is a two-step immortalization strategy, in which a first transgene induces or increases the rate of cellular proliferation, and the additive effects of a second transgene provides stably immortalized cell lines.
- Certain preferred embodiments utilize the expression of human TERT (GenBank accession numbers: AF018176 and AFO 15950) either as the first or second immortalizing product or component, or the first and second immortalizing product or component.
- the expression of TERT alone is sufficient to provide human insulinoma cells with unlimited capacity for proliferation.
- the directed expression of TERT is afforded through the use of tissue-specific and cell-specific promoters. Promoters specific for the pancreatic ⁇ -cell include the insulin promoter and modified derivatives of this promoter that maintain specificity yet have stronger transcriptional activity.
- TERT is amplified by RT-PCR from the mRNA of a human cell line known to have telomerase activity. Following cloning into plasmid vectors and DNA sequencing to confirm the fidelity of replication, TERT is subcloned into plasmids for ⁇ -cell specific expression. Expression of TERT can be achieved by any of the methods described herein, including virally-mediated expression or expression achieved through plasmid transfections.
- telomerase catalytic activity will not need to be present in order to generate an immortalized human neuroendocrine cell.
- constructs with less than full telomerase catalytic activity will have utility in certain embodiments of the present invention.
- One of ordinary skill in the art will be readily able to test the catalytic activity of telomerase using any of a number of assays that have been described in the art.
- U.S. Patent Nos. 5,629,154 and 5,648,215 (inco ⁇ orated herein by reference in their entirety) describe a telomeric repeat amplification protocol (TRAP) assay that may be used to determine the telomerase activity in a particular sample.
- a commercially available kit is available to determine telomerase activity (TRAP-eze Telomerase Detection Kit; Oncor, Inc., Gaithersburg,MD).
- the method comprises preparing a cell extract from a cell sample, placing an aliquot of the cell extract in a reaction mixture comprising a telomerase substrate lacking a telomeric repeat sequence and a buffer in which telomerase can catalyze extension of the telomerase substrate by addition of telomeric repeat sequences, adding to the reaction mixture a primer comprising a sequence sufficiently complementary to a telomeric repeat to hybridize specifically to the telomeric repeat under conditions such that if an extended telomerase substrate is present in the reaction mixture, the primer will hybridize to the extended telomerase substrate and extend to form a complementary copy of the extended telomerase substrate.
- the presence of telomerase activity is correlated with the presence of duplex DNA molecules comprising an extended telomerase substrate bound to an extended primer, and the absence of telomerase activity is correlated with the absence of such duplex DNA molecules.
- the DNA polymerase is preferably a thermostable DNA polymerase. Using such a polymerase, multiple cycles of primer extension can be carried out.
- ligase chain reaction Barany, 1991
- nucleic acid sequence-based amplification Compton, 1991
- self-sustained sequence replication (Guatelli et ah, 1990)
- strand displacement amplification (Walker et ah, X 992)
- branched DNA signal amplification (Urdea, 1994).
- human telomerase activity may be determined by measuring the rate of elongation of an appropriate repetitive sequence (primer), having 2 or more, usually 3 or more, repeats of the telomere unit sequence, TTAGGG.
- the sequence is labeled with a specific binding pair member at a convenient site, e.g., internally or at the 5 '-terminus, which specific binding pair member allows for separation of extended sequences.
- a radioactive nucleotide triphosphates or other labeled nucleotide triphosphate the inco ⁇ orated radioactivity can be measured as cpm per unit weight of DNA as a function of unit of time, thus providing a quantitative measure of telomerase activity.
- Any other detectable signal and label may also be used, for example fluorescent or enzymatic labels, as described in detail herein.
- the activity may be measured using cytoplasmic extracts, nuclear extracts, lysed cells, whole cells, and the like.
- the particular sample which is employed and the manner of pretreatment will be primarily one of convenience.
- the pretreatment will be carried out under conditions which avoids denaturation of the telomerase, so as to maintain the telomerase activity.
- the primer sequence will be selected or labeled so as to allow ready separation of the elongated sequence, which represents the telomerase activity of the sample, from any other DNA present in the sample.
- the nucleotide triphosphates which may be employed may include at least one nucleotide triphosphate which is labeled.
- the label will usually be radiolabel, but other labels may also be present.
- the labels may include specific binding pair members, where the reciprocal member may be labeled with fluorescers, enzymes, or other detectable label, as described in detail herein.
- the nucleotide triphosphates may be directly labeled with other labels, such as fluorescent labels.
- the sequence elongation usually will be carried out at a convenient temperature, generally from about 20°C to 60°C, and for a time sufficient to allow for at least about 100 bp to be added on the average to the initial sequence, generally about 30-90 minutes.
- the reaction may be terminated by any convenient means, such as denaturation, e.g., heating, addition of an inhibitor, rapid removal of the sequence by means of the label, and washing, or the like.
- denaturation e.g., heating, addition of an inhibitor, rapid removal of the sequence by means of the label, and washing, or the like.
- the separated DNA may then be washed to remove any non-specific binding DNA, followed by a measurement of the label by any conventional means.
- telomerase activity can use antibodies specific for the telomerase protein, where one may determine the amount of telomerase protein in a variety of ways. For example, one may use polyclonal antisera bound to a surface or a monoclonal antibody for a first epitope bound to a surface, and labeled polyclonal antisera or labeled monoclonal antibody to a second epitope dispersed in a medium, where one can detect the amount of label bound to the surface as a result of the telomerase protein or subunit thereof bridging between the two antibodies.
- telomerase RNA may be used to determine whether a cell is immortalized.
- reverse transcriptase and the polymerase chain reaction determine the presence and amount of the telomerase RNA as indicative of the amount of telomerase present in the cells.
- in situ hybridization can be used to determine the expression of the catalytic subunit of telomerase (TERT) at the single-cell level (Kolquist et al, 1998). The determination of telomerase activity by any of the above techniques may be used to determine whether a cell is immortalized.
- Inhibitors of Apoptosis Preferred for use is bcl-2 (distinct from bcl-1, cyclin Dl; GenBank accession numbers
- SV40 large T antigen (TAG; GenBank accession number J02400), SEQ ID NO:l (nucleic acid) and SEQ ID NO:2 (peptide sequence).
- temperature sensitive large T antigen SEQ ID NO: 3 (nucleic acid) and SEQ ID NO:4 (peptide sequence) and human papilloma virus E6 (hpv E6; Genbank accession numbers X67160, A06328, V01116, X03321) and E7 (hpv E7; Genbank accession numbers A06328, V01116. X03321).
- mutant p53, retinoblastoma and MEN-1 are mutant p53, retinoblastoma and MEN-1 (GenBank accession number
- the invention contemplates the use of several immortalizing gene constructs in combination.
- the immortalizing genetic construct may include more than one operative immortalizing unit, or more than one construct can be supplied.
- the invention contemplates the use of one or more growth factor receptor genes and/or one or more growth factor genes as the immortalizing elements.
- human ⁇ -cells are infected with a recombinant adenovirus that provides overexpression of growth hormone receptor (GenBank Accession Nos. J04811 and X06562) controlled by the modRIP (or modHIP) promoter, ⁇ -cells cultured in a defined medium would then be stimulated to proliferate by the addition of growth hormone to the medium.
- the replicating population of ⁇ -cells are then transformed by retroviral constructs that will result in stable expression of growth hormone receptor or_ an alternate immortalizing gene.
- IGF-1 receptor and its ligand in the medium
- cGH chicken growth hormone
- cGHr chicken growth hormone receptor
- the signaling substrate of growth factor receptors such as IRS-2 in the case of IGF-1 receptor
- the nucleic acid encoding the one or more immortalizing product(s), the one or more secreted protein or polypeptide, or any additional protein or polypeptide may be stably integrated into the genome of the cell.
- the nucleic acid may be stably maintained in the cell as a separate, episomal segment of DNA.
- Such nucleic acid segments or "episomes" encode sequences sufficient to permit maintenance and replication independent of or in synchronization with the host cell cycle. How the immortalization and/or additional expression construct is delivered to a cell and where in the cell the nucleic acid remains is dependent on the type of immortalization and/or expression construct employed. All delivery methods are contemplated for use in the context of the present invention, although certain methods are preferred, as outlined below.
- the construct In order to effect expression of one or more immortalizing or other expression construct, the construct must be delivered into a cell. As described below, the preferred mechanism for delivery is via viral infection, where the construct is encapsidated in an infectious viral particle. However, several non-viral methods for the transfer of one or more immortalizing or other expression constructs into cultured mammalian cells also are contemplated by the present invention. In one embodiment of the present invention, the expression construct may consist only of naked recombinant DNA or plasmids. Transfer of the construct may be performed by any of the methods mentioned which physically or chemically permeabilize the cell membrane.
- the one or more immortalizing or other expression construct may be entrapped in a liposome.
- Liposomes are vesicular structures characterized by a phospholipid bilayer membrane and an inner aqueous medium. Multilamellar liposomes have multiple lipid layers separated by aqueous medium. They form spontaneously when phospholipids are suspended in an excess of aqueous solution. The lipid components undergo self-rearrangement before the formation of closed structures and entrap water and dissolved solutes between the lipid bilayers (Ghosh and Bachhawat, 1991). Also contemplated is an expression construct complexed with Lipofectamine (Gibco BRL).
- Liposome-mediated nucleic acid delivery and expression of foreign DNA in vitro has been very successful (Nicolau and Sene, 1982; Fraley et al, 1979; Nicolau et al, 1987). Wong et al. (1980) demonstrated the feasibility of liposome-mediated delivery and expression of foreign DNA in cultured chick embryo, HeLa and hepatoma cells.
- the liposome may be complexed with a hemagglutinating virus (HVJ). This has been shown to facilitate fusion with the cell membrane and promote cell entry of liposome-encapsulated DNA (Kaneda et al, 1989).
- HVJ hemagglutinating virus
- the liposome may be complexed or employed in conjunction with nuclear non-histone chromosomal proteins (HMG-1) (Kato et al, 1991).
- HMG-1 nuclear non-histone chromosomal proteins
- the liposome may be complexed or employed in conjunction with both HVJ and HMG-1.
- the one or more immortalizing or other expression construct is introduced into the cell via electroporation. Electroporation involves the exposure of a suspension of cells and DNA to a high-voltage electric discharge.
- Mouse pre-B lymphocytes have been transfected with human kappa-immunoglobulin genes (Potter et al, 1984), and rat hepatocytes have been transfected with the chloramphenicol acetyltransferase gene (Tur-Kaspa et al, 1986) in this manner.
- electroporation of islets examples include Soldevila et al. (1991) and PCT application WO 91/09939.
- the one or more immortalizing or other expression construct is introduced to the cells using calcium phosphate precipitation.
- Human KB cells have been transfected with adenovirus 5 DNA (Graham and Van Der Eb, 1973) using this technique.
- mouse L(A9), mouse C127, CHO, CV-1, BHK, NIH3T3 and HeLa cells were transfected with a neomycin marker gene (Chen and Okayama, 1987), and rat hepatocytes were transfected with a variety of marker genes (Rippe et al. , 1990).
- the one or more immortalizing or other expression construct is delivered into the cell using DEAE-dextran followed by polyethylene gly col.
- reporter plasmids were introduced into mouse myeloma and erythroleukemia cells (Gopal, 1985).
- Another embodiment of the invention for transferring one or more naked DNA immortalizing or other expression construct into cells may involve particle bombardment. This method depends on the ability to accelerate DNA-coated microprojectiles to a high velocity allowing them to pierce cell membranes and enter cells without killing them (Klein et al, 1987).
- Several devices for accelerating small particles have been developed. One such device relies on a high voltage discharge to generate an electrical current, which in turn provides the motive force (Yang et al, 1990).
- the microprojectiles used have consisted of biologically inert substances such as tungsten or gold beads.
- Gainer et al. (1996) have transfected mouse islets with a luciferase gene/human immediate early promoter reporter construct, using biolistic particles accelerated by helium pressure.
- Further embodiments of the present invention include the introduction of the one or more immortalizing or other expression construct by direct microinjection or sonication loading.
- Direct microinjection has been used to introduce nucleic acid constructs into
- Xenopus oocytes Harland and Weintraub, 1985
- LTK " fibroblasts have been transfected with the thymidine kinase gene by sonication loading (Fechheimer et al, 1987).
- the one or more immortalizing or other expression construct is introduced into the cell using adenovirus assisted transfection.
- Increased transfection efficiencies have been reported in cell systems using adenovirus coupled systems (Kelleher and Vos, 1994; Cotten et al, 1992; Curiel, 1994), and the inventors contemplate using the same technique to increase transfection efficiencies into human islets.
- receptor-mediated delivery vehicles that may be employed to deliver the one or more immortalizing or other expression construct to the target cells. These take advantage of the selective uptake of macromolecules by receptor-mediated endocytosis that will be occurring in the target cells. In view of the cell type-specific distribution of various receptors, this delivery method adds another degree of specificity to the present invention. Specific delivery in the context of another mammalian cell type is described by Wu and Wu (1993; inco ⁇ orated herein by reference). Certain receptor-mediated gene targeting vehicles comprise a cell receptor-specific ligand and a DNA-binding agent. Others comprise a cell receptor-specific ligand to which the DNA construct to be delivered has been operatively attached.
- ligands have been used for receptor-mediated gene transfer (Wu and Wu, 1987, 1988; Wagner et al, 1990; Ferkol et al, 1993; Perales et al, 1994; Myers, EPO 0273085), which establishes the operability of the technique.
- the ligand will be chosen to correspond to a receptor specifically expressed on the neuroendocrine target cell population.
- the DNA delivery vehicle component of a cell-specific gene targeting vehicle may comprise a specific binding ligand in combination with a liposome.
- the nucleic acids to be delivered are housed within the liposome and the specific binding ligand is functionally inco ⁇ orated into the liposome membrane.
- the liposome will thus specifically bind to the receptors of the target cell and deliver the contents to the cell.
- Such systems have been shown to be functional using systems in which, for example, epidermal growth factor (EGF) is used in the receptor-mediated delivery of a nucleic acid to cells that exhibit upregulation of the EGF receptor.
- EGF epidermal growth factor
- the DNA delivery vehicle component of the targeted delivery vehicles may be a liposome itself, which will preferably comprise one or more lipids or glycoproteins that direct cell-specific binding.
- a liposome itself, which will preferably comprise one or more lipids or glycoproteins that direct cell-specific binding.
- Nicolau et al. (1987) employed lactosyl-ceramide, a galactose-terminal asialganglioside, inco ⁇ orated into liposomes and observed an increase in the uptake of the insulin gene by hepatocytes.
- the one or more immortalizing or other expression constructs of the present invention can be specifically delivered into the target cells in a similar manner.
- adenovirus expression vector is meant to include those constructs containing adenovirus sequences sufficient to (a) support packaging of the construct and (b) to ultimately express a tissue-specific transforming construct that has been cloned therein.
- the expression vector comprises a genetically engineered form of adenovirus.
- retrovirus the adenoviral infection of host cells does not result in chromosomal integration because adenoviral DNA can replicate in an episomal manner without potential genotoxicity.
- adenoviruses are structurally stable, and no genome rearrangement has been detected after extensive amplification.
- Adenovirus is particularly suitable for use as a gene transfer vector because of its mid- sized genome, ease of manipulation, high titer, wide target-cell range and high infectivity.
- Both ends of the viral genome contain 100-200 base pair inverted repeats (ITRs), which are cis elements necessary for viral DNA replication and packaging.
- ITRs inverted repeats
- the early (E) and late (L) regions of the genome contain different transcription units that are divided by the onset of viral DNA replication.
- the El region (El A and E1B) encodes proteins responsible for the regulation of transcription of the viral genome and a few cellular genes. The expression of the
- E2 region results in the synthesis of the proteins for viral DNA replication.
- MLP major late promoter
- TPL 5'- tripaitite leader
- recombinant adenovirus is generated from homologous recombination between shuttle vector and pro virus vector. Due to the possible recombination between two proviral vectors, wild-type adenovirus may be generated from this process. Therefore, it is critical to isolate a single clone of virus from an individual plaque and examine its genomic structure.
- adenovirus generation and propagation of the current adenovirus vectors, which are replication deficient, depend on a unique helper cell line, designated 293, which was transformed from human embryonic kidney cells by Ad5 DNA fragments and constitutively expresses El proteins (Graham et al, 1977). Since the E3 region is dispensable from the adenovirus genome (Jones and Shenk, 1978), the current adenovirus vectors, with the help of 293 cells, carry foreign DNA in either the El, the E3, or both the El and E3 regions (Graham and Prevec, 1991). In nature, adenovirus can package approximately 105% of the wild-type genome (Ghosh-Choudhury et al, 1987), providing capacity for about 2 kb of extra DNA.
- the maximum capacity of the current adenovirus vector is under 7.5 kb, or about 15% of the total length of the vector. More than 80% of the adenovirus viral genome remains in the vector backbone.
- Helper cell lines may be derived from human cells such as human embryonic kidney cells, muscle cells, hematopoietic cells or other human embryonic mesenchymal or epithelial cells.
- the helper cells may be derived from the cells of other mammalian species that are permissive for human adenovirus. Such cells include, e.g., Vero cells or other monkey embryonic mesenchymal or epithelial cells.
- the preferred helper cell line is 293.
- Racher et al (1995) disclosed improved methods for culturing 293 cells and propagating adenovirus.
- natural cell aggregates are grown by inoculating individual cells into 1 liter siliconized spinner flasks (Techne, Cambridge, UK) containing 100-200 ml of media. Following stirring at 40 ⁇ m, the cell viability is estimated with trypan blue.
- Fibra-Cel microcarriers (Bibby Sterlin, Stone, UK) (5 g/l) is employed as follows.
- cells are allowed to grow to about 80% confluence, after which time the media is replaced (to 25% of the final volume) and adenovirus added at an MOI of 0.05. Cultures are left stationary overnight, following which the volume is increased to 100% and shaking commenced for another 72 h.
- the adenovirus may be of any of the 42 different known serotypes or subgroups A-F.
- Adenovirus type 5 of subgroup C is the preferred starting material in order to obtain the conditional replication-defective adenovirus vector preferred for use in the present invention. This is because Adenovirus type 5 is a human adenovirus about which a great deal of biochemical and genetic information is known, and it has historically been used for most constructions employing adenovirus as a vector.
- the typical vector according to the present invention is replication defective and will not have an adenovirus El region.
- the position of insertion of the construct within the adenovirus sequences is not critical to the invention.
- the polynucleotide encoding the gene of interest may also be inserted in lieu of the deleted E3 region in E3 replacement vectors as described by Karlsson et al. (1986) or in the E4 region where a helper cell line or helper virus complements the E4 defect.
- Adenovirus growth and manipulation is known to those of skill in the art, and exhibits broad host range in vitro and in vivo. This group of viruses can be obtained in high titers, e.g., 10 -10 plaque-forming units per ml, and they are highly infective. The life cycle of adenovirus does not require integration into the host cell genome. The foreign genes delivered by adenovirus vectors are episomal and, therefore, have low genotoxicity to host cells. No side effects have been reported in studies of vaccination with wild-type adenovirus (Couch et al, 1963; Top et al, 1971), demonstrating their safety and therapeutic potential as in vivo gene transfer vectors.
- Adenovirus vectors have been used in eukaryotic gene expression (Levrero et al, 1991; Gomez-Foix et al, 1992) and vaccine development (Grunhaus and Horwitz, 1992; Graham and Prevec, 1992). Recently, animal studies suggested that recombinant adenovirus could be used for gene therapy (Stratford-Perricaudet and Perricaudet, 1991; Stratford- Perricaudet et al, 1990; Rich et al, 1993).
- Recombinant adenovirus and adeno-associated virus can both infect and transduce non-dividing human primary cells. Gene transfer efficiencies of approximately 70% for isolated rat islets have been demonstrated by the inventors (Becker et al. , 1994a; Becker et al, 1994b; Becker et al, 1996) as well as by other investigators (Gainer et al, 1996).
- Adeno-associated virus is an attractive vector system for use in the human cell transformation of the present invention as it has a high frequency of integration and it can infect nondividing cells, thus making it useful for delivery of genes into mammalian cells in tissue culture (Muzyczka, 1992).
- AAV has a broad host range for infectivity (Tratschin, et al, 1984; Laughlin, et al, 1986; Lebkowski, et al, 1988; McLaughlin, et al, 1988), which means it is applicable for use with human neuroendocrine cells, however, the tissue-specific promoter aspect of the present invention will ensure specific expression of the transforming construct in aspects of the invention where this is desired or required. Details concerning the generation and use of rAAV vectors are described in U.S. Patent No. 5,139,941 and U.S. Patent No. 4,797,368, each inco ⁇ orated herein by reference.
- AAV is a dependent parvovirus in that it requires coinfection with another virus (either adenovirus or a member of the he ⁇ es virus family) to undergo a productive infection in cultured cells (Muzyczka, 1992).
- another virus either adenovirus or a member of the he ⁇ es virus family
- helper virus the wild type AAV genome integrates through its ends into human chromosome 19 where it resides in a latent state as a provirus (Kotin et al, 1990; Samulski et al, 1991).
- rAAV is not restricted to chromosome 19 for integration unless the AAV Rep protein is also expressed (Shelling and Smith, 1994).
- recombinant AAV (rAAV) virus is made by cotransfecting a plasmid containing the gene of interest flanked by the two AAV terminal repeats (McLaughlin et al. , 1988; Samulski et al, 1989; each inco ⁇ orated herein by reference) and an expression plasmid containing the wild type AAV coding sequences without the terminal repeats, for example pIM45 (McCarty et al, 1991; inco ⁇ orated herein by reference).
- the cells are also infected or transfected with adenovirus or plasmids carrying the adenovirus genes required for AAV helper function.
- rAAV virus stocks made in such fashion are contaminated with adenovirus which must be physically separated from the rAAV particles (for example, by cesium chloride density centrifugation).
- adenovirus vectors containing the AAV coding regions or cell lines containing the AAV coding regions and some or all of the adenovirus helper genes could be used (Yang et al, 1994a; Clark et al, 1995). Cell lines carrying the rAAV DNA as an integrated provirus can also be used (Flotte et al, 1995).
- the present invention contemplates infection of the target cells with a recombinant adeno-associated virus (AAV) containing at least a first immortalizing construct driven by a promoter that expresses the immortalizing construct in the human neuroendocrine cell, for example a tissue specific promoter.
- AAV adeno-associated virus
- Recombinant AAV plasmids with RIP driving T antigen have been constructed, and are preferred for use in certain aspects of the present invention.
- the retroviruses are a group of single-stranded RNA viruses characterized by an ability to convert their RNA to double-stranded DNA in infected cells by a process of reverse- transcription (Coffin, 1990).
- the resulting DNA then stably integrates into cellular chromosomes as a provirus and directs synthesis of viral proteins.
- the integration results in the retention of the viral gene sequences in the recipient cell and its descendants.
- the retroviral genome contains three genes, gag, pol, and env that code for capsid proteins, polymerase enzyme, and envelope components, respectively.
- a sequence found upstream from the gag gene contains a signal for packaging of the genome into virions.
- Two long terminal repeat (LTR) sequences are present at the 5' and 3' ends of the viral genome. These contain strong promoter and enhancer sequences and are also required for integration in the host cell genome (Coffin, 1990).
- a nucleic acid encoding a gene of interest is inserted into the viral genome in the place of certain viral sequences to produce a virus that is replication-defective.
- a packaging cell line containing the gag, pol, and env genes but without the LTR and packaging components is constructed (Mann et al, 1983).
- Retroviral vectors are able to infect a broad variety of cell types. However, integration and stable expression require the division of host cells (Paskind et al, 1975).
- a major determinant of virus titer is the number of packagable RNA transcripts per producer cell, which is dependent on the integrated proviral DNA copy number.
- Packaging cell lines are coated with viral envelope glycoproteins and are thus resistant to infection by virus of the same host range, but not virus of a different host range. This process is called interference. Therefore, recombinant retroviruses can shuttle back and forth between amphotropic and ecotropic packaging cell lines in a mixed culture (referred to as ping- ponging), thus leading to an increase in proviral DNA copy number and virus titer (Bestwick et al, 1988).
- Some drawbacks to the ping-pong process are that transfer of packaging functions between ecotropic and anphotropic lines can lead eventually to generation of replication-competent helper virus.
- viral vectors may be employed as expression constructs in the present invention.
- Vectors derived from viruses such as vaccinia virus (Ridgeway, 1988; Baichwal and Sugden,
- Chang et al. recently introduced the chloramphenicol acetyltransferase (CAT) gene into duck hepatitis B virus genome in the place of the polymerase, surface, and pre-surface coding sequences. It was cotransfected with wild-type virus into an avian hepatoma cell line. Culture media containing high titers of the recombinant virus were used to infect primary duckling hepatocytes. Stable CAT gene expression was detected for at least 24 days after transfection (Chang et al, 1991).
- CAT chloramphenicol acetyltransferase
- the nucleic acids to be delivered are housed within an infective virus that has been engineered to express a specific binding ligand.
- the virus particle will thus bind specifically to the cognate receptors of the target cell and deliver the contents to the cell.
- a novel approach designed to allow specific targeting of retrovirus vectors was recently developed based on the chemical modification of a retrovirus by the chemical addition of lactose residues to the viral envelope. This modification can permit the specific infection of hepatocytes via sialoglycoprotein receptors.
- a further alternative for practicing the present invention is to use adenovirus or AAV infection of primary cells leading to in vitro expansion of a primary cell population that is then amenable to stable oncogene transfer by methods requiring cellular proliferation such as retroviral transduction, plasmid transfection of expanding cells (Lipofectin or electroporation), or a second round of adenovirus and/or AAV infection.
- Another embodiment of the invention is to use alternating AAV and adenovirus infections. Propagation of AAV is dependent upon adenovirus, and using both viruses may lead to more productive infections. Such a method may increase the number of final cells that have oncogenes integrated and expressed.
- adenoviral gene delivery affords a very low rate of integration of viral and recombinant DNAs into the host cell genome. Consequently, adenoviral gene expression is diluted when the cells divide and typically is used only for transient gene expression.
- An advantage that adenoviral gene delivery has over many other viral vectors is that entry of the virus into the cell and the expression of transgenic proteins is not dependent on cellular replication. This benefit of adenoviral gene delivery is in contrast to retroviruses where the integration and sustained expression of virally introduced DNA is dependent on cellular replication.
- pancreatic ⁇ -cells typically do not divide in culture and are thereby resistant to transformation by immortalizing gene constructs delivered by retroviruses.
- human ⁇ -cells can be infected with adenovirus for the pu ⁇ oses of transgenic protein expression.
- human ⁇ -cells or pancreatic islets are first be infected with a recombinant adenovirus that provides for the expression of a growth-promoting protein to stimulate cellular division.
- Cellular replication is monitored by measuring thymidine inco ⁇ oration or other techniques that have been developed to monitor DNA replication.
- dividing cells are enriched by FACS.
- FACS Fluorescence Activated Cell Sorting
- ⁇ -cells can be cultured and even induced to divide as described (Clark and Chick, 1990; Beattie et al. 1991; Hayek et al. 1995; each inco ⁇ orated herein by reference).
- Human islets isolated by an automated method (Ricordi et al, 1988) are maintained in culture and transformed by the inventive engineered expression of proteins that promote accelerated cell replication.
- the transformation methods of the invention preferably involve the use of specific culture conditions designed to preferentially promote neuroendocrine cell growth, which are used in conjunction with the stable activation of cell specific gene promoter controlled protein expression.
- the culture conditions are achieved by manipulating the following cell culture variables: media growth survival factors (such as IGF-1, growth hormone, prolactin, PDGF, hepatocyte growth factor, and transferrin), media differentiation factors (such as TGF- ⁇ ), media lipids, media metabolites (such as glucose, pyruvate, galactose, and amino acids), media serum (percentage serum, serum fraction, species of serum), gaseous exchange (ratio atmospheric O 2 :CO 2 , and media volume), physical form of the islets prior to plating (whole, dispersed, or cell sorted islet cells), and extracellular substrate for cellular attachment (such as laminin, collagen, matrigel, and HTB-9 bladder carcinoma derived matrix).
- media growth survival factors such as IGF-1, growth hormone, prolactin, PDGF, hepatocyte growth factor, and transferrin
- media differentiation factors such as TGF- ⁇
- media lipids such as glucose, pyruvate, galactose, and amino acids
- Fibroblast growth/survival in culture is eliminated by culturing the islets in defined media using factors (such as IGF-1, cysteine, and growth hormone) to selectively confer a growth/survival advantage to ⁇ -cells in preference to fibroblasts.
- factors such as IGF-1, cysteine, and growth hormone
- Establishment of fibroblast free cultures will allow prolonged maintenance of human islet ⁇ -cells in culture for subsequent infection with adenovirus expression vectors in cases where ⁇ -cells are in a non-proliferative state, or retrovirus expression vectors for ⁇ -cells which have been induced to proliferate by oncogene expression. Fibroblasts may even be killed by fibroblast-directed toxins.
- Media comprising one or more growth factors that stimulate the growth of the target neuroendocrine cell and do not substantially stimulate growth of distinct cells in the cell population; i.e., act to induce preferential growth of the target cells rather than faster-growing, more hardy cells in the population, may be used to deplete fibroblasts.
- growth factors that stimulate the growth of the target neuroendocrine cell and do not substantially stimulate growth of distinct cells in the cell population; i.e., act to induce preferential growth of the target cells rather than faster-growing, more hardy cells in the population, may be used to deplete fibroblasts. Examples include defined serum free conditions used for ⁇ -cells (Clark et al, 1990; inco ⁇ orated herein by reference), or inclusion of growth or differentiation factors known to allow preferential growth of ⁇ -cells (WO 95/29989; inco ⁇ orated herein by reference).
- the inventors have developed a media composition that will be particularly useful in the growth and propagation of the cells of the present invention.
- the rational behind the development of "BetaGene” media had its beginnings with the observation that in bioreactor high density cultures of ⁇ -cell line RIN-38, ethanolamine was a rapidly consumed component of the growth medium. An equimolar mixture of ethanolamine- phosphoethanolamine was found to protect RIN-38 ⁇ -cells from linoleic acid toxicity (approximately 30 ⁇ g/ml in serum-free medium).
- the serum-free cultures then were returned to the same base media supplemented with FBS, with continued insulin monitoring.
- the media screened were those most commonly used for culture of primary islets in the literature. Performance of the different media were indicated by the rate and magnitude of functional loss, as well as the rate of recovery and completeness of recovery after return to FBS supplementation.
- Media such as F12 and RPMI were not readily evaluated by this approach, due to the low calcium concentration of these media and resultant deterioration of the Ca-alginate hydrogel. The latter were then evaluated as equal mixtures with Ml 99 and MEM.
- BetaGene Media is at concentrations that would be found in mixed formulations, while others reflect optimization by the inventors.
- ascorbate-2-phosphate a stabilized form of ascorbate (ascorbate-2-phosphate) was screened for dose-dependent deleterious effects on growth and insulin secretion. None was encountered over a wide range of concentrations from 10 " to 10 " M.
- An intermediate concentration of stabilized ascorbate-2-phosphate was tested for its effect on amidation, using cells engineered to express GLP-1 or amylin. The intermediate concentration (50-100 ⁇ M) was found to greatly improve amidation, both in flask and high density scale-up cultures, and was thus identified as the preferred concentration for BetaGene Media.
- Bicarbonate was increased in the formulation to provide better pH control for scale-up cultures (such as the CellCubeTM).
- Zinc was supplemented because primary ⁇ -cells have high concentrations of zinc and several islet enzymes bind Zn , and insulin crystal is coordinate with Zn.
- glucose concentrations are known to be critical for ⁇ -cell culture.
- One objective of the media development was to derive a formulation that would optimally support primary pancreatic islets as well as ⁇ -cell lines. As a result, human islets were used to determine a glucose concentration that could support survival and function of human islets in culture.
- Glucose in the range of 7 mM (6-8 mM) provided long term survival (months) of human islets, with maintenance of glucose sensing, as indicated by dose-response studies of glucose-induced insulin secretion, and by maintained (and in islets of two donors restored) insulin processing.
- BetaGene media Table 9 below provides an exemplary composition of BetaGene media. Further compositions of BetaGene media contemplated for use in the present invention are found in
- Vitamin A acetate 0.00014
- Cells may be induced to proliferate by initial infection with adenovirus or adeno-associated virus (AAV) comprising a gene that induces cellular proliferation, the gene being under the control of a promoter specific for the regulated secretory cell.
- AAV adeno-associated virus
- the cells may alternatively be induced to proliferate by growth on a stimulatory cell matrix.
- the lack of an immune response in the nude rat is known to allow long term survival and expression of recombinant adenovirus infected cells (Dai et al , 1995; Yang et al, 1994b).
- the final attributes of the cell lines of the present invention are functionally defined as having maintained a regulated secretory pathway, being stable to in vitro culture and, preferably, as being amenable to further engineering.
- the resultant human secretory or neuroendocrine cell will be "culturable", i.e., it will be capable of growing in vitro and producing the desired endogenous secretory polypeptide with a demonstrated regulated secretory pathway.
- An “immortalized” or “stable, transformed” human regulated secretory cell in the context of the present invention will be a cell that exhibits in vitro growth for at least twenty population doublings (Freshney, 1994).
- the resultant human regulated secretory cell will also maintain the required differentiated phenotype after transformation, i.e., it will exhibit the phenotypic properties of a demonstrable regulated secretory pathway, secretory storage granules, the capacity for peptide processing, and will produce one or more selected endogenous or exogenous secretory polypeptide(s).
- the resultant immortalized human ⁇ -cells of the present invention will exhibit the capacity to grow in vitro, with a minimum of at least about 20 population doublings, or preferably, of about 30, about 40, about 50, about 60, about 70, or about 80 population doublings. Even more preferably, the resultant immortalized human ⁇ -cells of the invention will have even further increments of population doublings up to and including a completely transformed state wherein the cells grow in pe ⁇ etuity.
- the immortalized human ⁇ -cells of the present invention will also exhibit the capacity to produce biologically active human insulin.
- Biologically active insulin is dependent on proteolytic cleavage of preproinsulin to proinsulin and, finally, insulin, as well as disulphide bond formation.
- the insulin produced may be comprised entirely of mature insulin; or entirely of the biological precursor of mature insulin, termed proinsulin; or of all possible mixtures of proinsulin, insulin, and processing intermediates that are produced in the course of conversion of proinsulin to insulin.
- While the preferred embodiment of the present invention are immortalized cells that produce primarily or exclusively mature insulin, cells that produce proinsulin will also be useful in various embodiments. Such cells are useful per se, particularly as any form of insulin can be obtained in vitro, purified and converted to mature insulin.
- PC2 and PC3 proteases known as PC2 and PC3 that are responsible for the conversion of proinsulin to insulin can be introduced into the immortalized human ⁇ -cells by genetic engineering methods, thereby enhancing the efficiency of conversion of proinsulin to insulin.
- the immortalized human ⁇ -cells of the present invention will generally exhibit a minimal insulin content of about 5 ng/million cells, but may contain as much as, or even more insulin than, normal isolated human islets, which have approximately 1-10 ⁇ g/million cells. It will be understood that the cells of the present invention may contain any amount of insulin within the above-specified ranges, such as about 10 ng insulin/million cells, about 50 ng, about 100 ng, about 200 ng, about 500 ng, about 1000 ng (1 ⁇ g), about 2 ⁇ g, about 5 ⁇ g, about 10 ⁇ g, about 20 ⁇ g, about 50 ⁇ g, about 75 ⁇ g, up to and including about 100 ⁇ g insulin/million cells. It will be understood that any and all integers within these ranges will define an insulin content that may be present within the immortalized, stable human ⁇ -cells of the invention.
- the immortalized human ⁇ -cells of the present invention may be defined as cells having an insulin content of between about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, up to and including about 100% of normal human islet content, which is about 1-10 ⁇ g/million cells.
- the immortalized human ⁇ -cells of the present invention will preferably exhibit enhanced insulin secretion when exposed to one or more secretagogues selected from IBMX, carbachol, amino acids, and glucose, or when exposed to a secretory "cocktail" of such compounds.
- the immortalized human ⁇ -cells will more preferably exhibit enhanced insulin secretion when exposed to glucose, and will most preferably exhibit enhanced insulin secretion when exposed to 10 mM glucose.
- the increase in insulin secretion in response to a non-glucose secretagogue or cocktail thereof should be at least about 1.1 times or about 1.5 times that observed in cells incubated in the absence of the secretagogue or secretory cocktail. However, in preferred embodiments, the increase in insulin secretion in response to a non-glucose secretagogue or cocktail thereof should be at least about double that observed in cells incubated in the absence of the secretagogue or secretory cocktail. In more preferred embodiments, a higher increase will be observed, up to and including a 3-fold, 5-fold, 10-fold, 20-fold, 50-fold, 100-fold, 200-fold, 300-fold, 500-fold, 750-fold or even about a 1000-fold enhancement.
- the immortalized human ⁇ -cells of the present invention will preferably exhibit a glucose-stimulated insulin secretion (GSIS) response.
- GSIS glucose-stimulated insulin secretion
- This increase in secretion should be at least about 1.1 times or about 1.5 times that observed in cells incubated in the absence of glucose. More preferred are increases in secretion of at least about double that observed in cells incubated in the absence of glucose, with even more preferred increases being higher, up to and including a 3-fold, 5-fold, 10-fold, 20-fold, 50-fold, 100-fold, 200-fold, 300-fold, 500-fold, 750-fold or even about a 1000-fold enhancement, including all increments therebetween.
- glucose responsive insulin secretion will be observed in the range of 1.0 to 20 mM glucose. GSIS response will more preferably occur with a threshold for response of 3-5 mM glucose, with maximal secretion stimulated by 10-20 mM glucose, as occurs in normal human islets. Cell lines with glucose dose responses occurring over a higher or lower range will also have significant utility, given that any regulated insulin production will be useful.
- GSIS response not originally in the range observed for normal human islets will still be useful.
- Such cells will be amenable to genetic engineering methods, as embodied in U.S. Patent 5,427,940, and as further disclosed herein, in order to alter the glucose dose response. These methods are contemplated for use in applications with immortalized human cells to achieve the desired glucose concentration dependence.
- immortalized human ⁇ -cells that are completely lacking glucose responsiveness are also included within the invention, since the known genetic engineering methods (U.S. Patent 5,427,940) can be used to confer glucose sensing in neuroendocrine cell lines previously lacking a glucose response.
- the immortalizing genetic construct may, therefore, be functionally and/or physically separated from the cell after immortalization. Advantages include generation of cell lines that do not constitutively express oncogenes which can act as tumor antigens in vivo, control of growth of the resulting tumor lines for stable in vivo use and possibly the control of the differentiated state of the resultant cell line.
- temperature sensitive oncogenes allows for turning the growth promoting activity on and off.
- oncogenes that are active at lower than physiological temperatures ( . e. 32 to 34°C) and off at physiological or higher temperatures (37 to 39°C)_are preferred.
- immortalized, stable cell lines can be expanded, and further genetic modifications can be made and characterized in vitro at the low, permissive temperatures. When placed in vivo, these same cell lines will be exposed to the non- permissive temperature, and will not grow.
- a temperature sensitive version of the S V40 virus was isolated and shown to have a mutation in the coding region of the large T antigen gene (Bourre and Sarasin, 1983).
- Conditional Expression Promoters capable of driving expression of heterologous genes in response to an exogenously added compound allow for conditional expression of oncogenes inserted under the control of the promoter. The addition of the promoting agent then allows stable cell lines to be expanded and transformed. When placed in vivo, expression of the oncogene is turned off, unless the activating factor is provided.
- lac repressor system Fieck et al, 1992; Wyborski and Short, 1991; each inco ⁇ orated herein by reference
- tetracycline regulatory system U.S. Patent 5,464,758; Gossen and Bujard, 1992; Gossen et al, 1995; each inco ⁇ orated herein by reference
- ecdysone inducible expression system No et al, 1996), which is commercially available from Invitrogen, Inco ⁇ orated (San Diego, CA; catalog number KI 000-01).
- exogenously added compounds include, but are not limited to, lactose, IPTG, tetracycline or a tetracycline derivative, ecdysone or muristerone A, rapamycin and FK506.
- the present invention contemplates the use of the CrelLox site-specific recombination system (Sauer, 1993, available through Gibco/BRL, Inc., Gaithersburg, Md.) to rescue specific genes out of a genome, for example to remove one or more immortalizing constructs out of the genome.
- the system involves the use of a bacterial nucleotide sequence knows as a LoxP site, which is recognized by the bacterial Cre protein.
- the Cre protein catalyzes a site- specific recombination event. This event is bidirectional, i.e., Cre will catalyze the insertion of sequences at a LoxP site or excise sequences that lie between two LoxP sites.
- the present invention also contemplates the use of recombination activating genes (RAG) 1 and 2 to rescue immortalizing constructs or other specific genes from the genome of immortalized cell lines.
- RAG-1 GenBank accession number M29475
- RAG-2 GenBank accession numbers M64796 and M338278
- RGSs specific recombination signal sequences
- V(D)J V(D)J recombination required for the assembly of immunoglobulin and T cell receptor genes
- the immortalizing construct of interest is engineered to contain flanking RSSs. Following immortalization, the immortalizing construct that is internal to the RSSs can be deleted from the genome by the transient expression of RAG-1 and RAG-2 in the immortalized cell.
- the present invention also contemplates augmenting or increasing the capabilities of cells to produce one or more biologically active polypeptides, and changing the pattern of response to various secretagogues, including re-engineering responsiveness to certain secretagogues, if necessary. Additional methods of engineering cells can be found in PCT patent applications publication numbers WO 97/26334 and WO 97/26321, inco ⁇ orated specifically herein by reference in their entirety.
- Blocking expression of one or more endogenous gene product is an important modification of host cells according to the present invention.
- the targeted endogenous gene encodes a protein normally secreted by the host cell. Blocking expression of this endogenous gene product, while engineering high level expression of genes of interest, represents a unique way of designing cells for protein production.
- Cells generated by this two-step process express heterologous proteins, including a variety of natural or engineered proteins (fusions, chimeras, protein fragments, etc.). Cell lines developed in this way are uniquely suited for in vivo cell-based delivery or in vitro large- scale production of defined peptide hormones with little or no contaminating or unwanted endogenous protein production.
- a number of basic approaches are contemplated for blocking of expression of an endogenous gene in host cells, including homologous recombination, random integration, antisense technology, ribozyme technology and genomic site directed mutagenesis. Methods for blocking production of endogenous proteins and peptides is discussed in greater detail in the context of reduction of hexokinase in Section XI(B) below.
- the present invention contemplates the supplemental expression or overexpression of proteins involved in maintaining the specialized phenotype of host cells, especially their secretory capacity. Such proteins may be used to supplement the cell's natural enzymes.
- IPFl Insulin Promoter Factor 1
- Insulin promoter factor 1 (IPF-1 ; also referred to as STF-1, IDX-1, PDX-1 and ⁇ TF-1) is a homeodomain-containing transcription factor proposed to play an important role in both pancreatic development and insulin gene expression in mature ⁇ -cells (Ohlsson et al, 1993, Leonard et al, 1993, Miller et al, 1994, Kruse et al, 1993). In embryos, IPF-1 is expressed prior to islet cell hormone gene expression and is restricted to positions within the primitive foregut where the pancreas will later form. Indeed, mice in which the IPF-1 gene is disrupted by targeted knockout do not form a pancreas (Jonsson et al, 1994).
- IPF-1 expression becomes restricted predominantly to ⁇ -cells. IPF-1 binds to TAAT consensus motifs contained within the FLAT E and PI elements of the insulin enhancer/promoter, whereupon, it interacts with other transcription factors to activate insulin gene transcription (Peers et al, 1994).
- IPF-1 will generally be present in the resultant immortalized human ⁇ -cells of the present invention
- the overexpression of IPF-1 in human ⁇ -cell lines may be used to serve two pu ⁇ oses. First, it will increase transgene expression under the control of the insulin enhancer/promoter. Second, as IPF-1 appears to be critically involved in ⁇ -cell maturation, stable overexpression of IPF-1 in the ⁇ -cell lines should encourage these cells to maintain the differentiated function of a normal human ⁇ -cell.
- Additional cell-specific transcription factors contemplated for use in the present invention include, but are not limited to, CDX-3 and LMX-1 (LMX1.1 and LMX1.2) (German et al, 1992b; German et al, 1994), NKX6.1 (Inoue et al, 1997), NKX2.2 (Sussel et al,
- Beta-2 (Sander and German, 1997), E47/Pan-1 (Johnson et al, 1997), ISL1 (Ahlgren et al, 1997) and PAX6 (Sander et al, X 997).
- the augmentation and increase of the stable cells' capacity to produce biologically active polypeptides can also be accomplished by overexpressing the proteins involved in protein processing, such as the endoproteases PC2 and PC3 (Steiner et al, 1992) or even the peptide amidating enzyme, PAM (Eipper et al, 1992).
- the use of increasing the expression of other dibasic peptidases, such as furin, is also contemplated, as is the expression of carboxy peptidases .
- the present invention further includes embodiments where the resultant immortalized neuroendocrine cells are further engineered to modify the secretion of the endogenous secretory polypeptide in response to one or more secretagogues.
- the engineering of the resultant immortalized cells to generate a more physiologically- relevant regulated secretory response includes engineering the expression or overexpression of signaling proteins known to play a role in the regulated secretory response of neuroendocrine cells.
- signaling proteins known to play a role in the regulated secretory response of neuroendocrine cells.
- These include cell surface proteins such as the ⁇ -cell-specific inwardly rectifying potassium channel ( ⁇ -cell inward rectifier, BIR or KIR; Inagaki et al, 1995), involved in release of the secretory granule contents upon glucose stimulation, the sulfonylurea receptor (SUR), and ATP sensitive channel.
- Other heterologous releasing factor receptors may be used in these aspects of the invention, as may adrenergic receptors and the like.
- ⁇ -cells which assist with potentiating the glucose- stimulated degranulation of ⁇ -cells include the glucagon-like peptide I receptor (Thorens, 1992) and the glucose-dependent insulinotropic polypeptide receptor (also known as gastric inhibitory peptide receptor) (Usdin et al, 1993), which can also be engineered into immortalized human neuroendocrine cells according to the present invention.
- glucagon-like peptide I receptor Thiorens, 1992
- glucose-dependent insulinotropic polypeptide receptor also known as gastric inhibitory peptide receptor
- ⁇ -cell-specific signaling receptors as well as GLUT-2 and glucokinase (see below) are involved in secretory granule release in response to glucose. In this way, glucose stimulated release of a peptide targeted to the secretory granule can be re-engineered or enhanced.
- cell surface signaling proteins involved in non-glucose-stimulated release of secretory granule contents can be engineered into the immortalized human neuroendocrine cells of the present invention.
- releasing factor receptors such as Growth Hormone Releasing Factor Receptor (Lin et al,
- the pancreatic ⁇ -cell is continually exposed to a complex mixture of molecules that modulate insulin synthesis, storage, and exocytosis.
- the information in this mixture is translated to regulatory signals by three distinct mechanisms: (1) transport into the cell and metabolism of fuels, (2) ion fluxes, relative to extracellular and intracellular ion pools, and.(3) hormonal signals that are mediated via receptors (reviewed in Komatsu et ah, 1997).
- the transport and metabolism of glucose is a dominant signal that regulates insulin secretion.
- a large portion of the glucose effect is mediated by K + -ATP channels, depends on membrane
- Amino acids are another fuel that participate in insulin secretion via the regulation of the K - ATP channel.
- Glucose metabolism also affects intracellular Ca stores by mechanisms that are independent of K + -ATP channels. This portion of glucose-regulated insulin secretion is augmented by many other molecules involved in glycemic control such as fatty acids and muscarinic receptor ligands. Binding to the muscarinic receptor by acetylcholine results in the activation of phospholipases, enzymes that catalyze the conversion of phophoinositides to inositol triphosphates (IP3) and diacylglycerol (DAG). Increased IP3 levels stimulate the release of Ca + from intracellular stores and contribute to signals for exocytosis of insulin.
- IP3 inositol triphosphates
- DAG diacylglycerol
- Increased IP3 levels stimulate the release of Ca + from intracellular stores and contribute to signals for exocytosis of insulin.
- a central theme in Ca -induced secretion is the activation of Ca /calmodulin-dependent
- Protein kinase C is stimulated by DAG and functions to augment glucose-stimulated insulin secretion ( Komatsu et ah, 1997).
- Prentki has proposed a model for glucose metabolism that takes into account many aspects of stimulated insulin secretion (Prentki, 1996). This model categorizes stimulatory events as glycolytic and post-glycolytic and supports the view that the glucose-mediated regulation of insulin secretion cannot be fully explained by the effects of the K -ATP channels
- pyruvate is a key intermediate metabolite and its fate provides two distinct mechanisms to stimulate secretion.
- Pyruvate dehydrogenase which is stimulated by an increase in the ATP/ ADP ratio resulting from glycolysis, moves the metabolism of glucose toward the citric acid cycle by the conversion of pyruvate to acetyl CoA.
- Carbon fluxes through the citric acid cycle boost the ATP/ ADP ratio even higher, and stimulate the closure of K -ATP channels and the concomitant increases in intracellular Ca .
- Pyruvate is also a key metabolite in anaplerosis, the replenishment of citric acid cycle intermediates.
- This arm of pyruvate metabolism is initiated by the activity of pyruvate carboxylase, an enzyme that catalyzes the conversion of pyruvate to citrate.
- citrate carboxylase an enzyme that catalyzes the conversion of pyruvate to citrate.
- malonyl CoA a molecule that provides a link between glucose metabolism and fatty acid metabolism.
- Increases in malonyl CoA promote the accumulation of fatty acid intermediates,
- the glucose-responsiveness can be re-engineered into an immortalized human neuroendocrine cell that secretes insulin but in which the glucose-response has been lost, diminished or shifted.
- the basis for engineering the immortalized cells to produce a cell with glucose- regulated insulin secretion is disclosed in U.S. Patent 5,427,940, inco ⁇ orated herein by reference.
- U.S. Patent 5,427,940 discloses islet and non-islet cell lines of neuroendocrine origin which are engineered for insulin expression and glucose regulation.
- the insulin gene can be supplied to such an engineered cell and, although this will not be required in many aspects of the present invention, it is also contemplated.
- AtT-20 cells which are derived from ACTH secreting cells of the anterior pituitary. It has been demonstrated that stable transfection of AtT-20 cells with a construct in which a viral promoter is used to direct expression of the human proinsulin cDNA results in cell lines that secrete the correctly processed and mature insulin polypeptide (Moore et al, 1983). Insulin secretion from such lines (generally termed AtT-20ins) can be stimulated by agents such as forskolin or dibutyryl cAMP, with the major secreted product in the form of mature insulin.
- agents such as forskolin or dibutyryl cAMP
- AtT-20ins cells do not respond to glucose as a secretagogue (Hughes et al, 1991).
- AtT-20 cells express the glucokinase gene (Hughes et al, 1991, Liang et al, 1991) and at least in some lines, low levels of glucokinase activity (Hughes et al, 1991; 1992; Quaade et al, 1991), but are completely lacking in GLUT-2 expression (Hughes et al, 1991; 1992).
- Stable transfection of these cells with GLUT-2, but not the related transporter GLUT-1 confers glucose-stimulated insulin secretion (U.S. Patent 5,427,940; Hughes et al, 1992, 1993).
- AtT-20ins cells The studies with AtT-20ins cells are important because they demonstrate that neuroendocrine cell lines that lack glucose-stimulated peptide release may be engineered for this function. Therefore, once an immortalized human neuroendocrine cell that has a regulated secretory pathway has been generated by the present invention, certain elements of the responsiveness can be re-engineered into the stable cell. In contrast, the "regulated secretory pathway", including the secretory granules, endopeptidases and post-translational modification enzymes, cannot be re-engineered into a cell lacking such a pathway.
- U.S. Patent 5,427,940 inco ⁇ orated herein by reference, describes methods for conferring glucose sensing in neuroendocrine cells and cell lines by transfection of such cells with one or more genes selected from the insulin gene, the glucokinase gene and the GLUT-2 glucose transporter gene, so as to provide an engineered cell having all three of these genes.
- the glucokinase and GLUT-2 genes are thus preferred for use in re-engineering stable human cells.
- U.S. Patent 5,427,940 discloses that three functional genes are required to give glucose- responsive insulin secreting capacity to a cell: an insulin gene, a GLUT-2 glucose transporter gene and a glucokinase gene. In the practice of the re-engineering aspects of the present invention, therefore, it may be that only one of these three genes needs to additionally supplied, expressed or overexpressed.
- the immortalized human cell produces and expresses a reasonable level of insulin, but in a non-regulated manner, the provision of either or both of a functional glucokinase gene and a GLUT-2 gene will be desired.
- One of ordinary skill in the art will be readily able to test the levels of glucokinase and GLUT-2 expression, either by molecular biological hybridization or biochemical activity assays, in order to determine which one or both of such enzymes is not sufficiently expressed or active and should therefore be supplied in recombinant form. If the stable cell does not express either of the aforementioned genes in a functional fashion, or at physiological levels, it will be preferred to introduce both genes.
- the constructs of GenBank accession numbers J03145 and M25807, respectively may be used.
- even the insulin gene could be re-engineered and overexpressed in an immortalized neuroendocrine cell of the invention.
- GLUT-1 conferred glucose-stimulated insulin secretion, this was achieved with maximal responsiveness at subphysiological glucose levels.
- One of the inventors reasoned that this was likely due to a non-optimal hexokinase: glucokinase ratio (U.S. Patent 5,427,940).
- the stable cells of the invention may be modified to any degree such that they have a reduced a low K m hexokinase activity relative to the stable parent cell from which the re-engineered cell was prepared.
- cells in which a moderate hexokinase inhibition is achieved will have utility.
- Such inhibition levels are contemplated to be those in which the low K m hexokinase activity is reduced by at least about 5%, about 10%, about 15%, about 20%, or about 25% relative to control levels.
- Re-engineered cells exhibiting more significant inhibition are also contemplated within the invention. Accordingly, cells in which the low K m hexokinase activity is reduced by about 30%, about 40%, about 50%, about 60% or even about 70% or higher, with respect to control levels, are contemplated as part of this invention and will be preferred in certain embodiments.
- GK. ⁇ K ratio the ratio of glucokinase to hexokinase
- GK. ⁇ K ratio the ratio of glucokinase to hexokinase
- cells of this invention will have a low K m hexokinase activity that has been reduced to a level appropriate to confer more physiological insulin secretion capacity to the cell.
- GSIS glucose-stimulated insulin secretion
- the GSIS of normal islet ⁇ -cells generally occurs at glucose concentrations of between about 3 mM to 20 mM, with ranges of 5 to 20 mM and 4 to 9 mM being frequently reported. Insulin responses in these ranges would therefore be described as "near-homeostatic insulin secretion.”
- Cells that comprise an inhibitor in an amount effective to reduce the low K m hexokinase activity of the cell to a level sufficient to confer insulin secretion in response to an extracellular glucose concentration of between about 1 mM and about 20 mM will thus be most preferred.
- Extracellular glucose concentrations of "between about 1 mM and about 20 mM " will be understood to include each and every numerical value within this range, such as being about 1, 2, 3, 4, 5, 6, 7, 7.5, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 and about 20 mM or so.
- any one of a variety of methods may be employed, including blocking of expression of the gene in the immortalized human cells and/or inhibiting or reducing the activity of any protein produced.
- the hexokinase gene construct of GenBank accession number J04526 may be utilized.
- constructs can be designed to introduce nucleic acids complementary to a target endogenous gene, i.e., an antisense approach. Expression of RNAs corresponding to these complementary nucleic acids will interfere with the transcription and/or translation of the target sequences. Inhibitory constructs can still further be designed to homologously recombine into the hexokinase endogenous gene locus, rendering the endogenous gene nonfunctional, i.e., a knock-out approach. Genetic constructs may also be designed to introduce nucleic acids encoding ribozymes, RNA-cleaving enzymes, that will specifically cleave the target hexokinase mRNA.
- complementary sequences By complementary, it is meant that polynucleotides are those which are capable of base-pairing according to the standard Watson-Crick complementarity rules. That is, the larger purines will base pair with the smaller pyrimidines to form combinations of guanine paired with cytosine (G:C) and adenine paired with either thymine (A:T) in the case of DNA, or adenine paired with uracil (A:U) in the case of RNA. Inclusion of less common bases such as inosine, 5-methylcytosine, 6-methyladenine, hypoxanthine and others in hybridizing sequences does not interfere with pairing.
- Antisense polynucleotides when introduced into a target cell, specifically bind to their target polynucleotide, in this case, hexokinase, and interfere with transcription, RNA processing, transport, translation and/or stability.
- Antisense RNA constructs, or DNA encoding such antisense RNAs may be employed to inhibit hexokinase gene transcription or translation or both within the immortalized human neuroendocrine cells of the present invention.
- Antisense constructs may be designed to bind to the promoter and other control regions, exons, introns or even exon-intron boundaries of a hexokinase gene. It is contemplated that effective antisense constructs will often include regions complementary to intron/exon splice junctions. Thus, antisense constructs with complementarity to regions within 50-200 bases of an intron-exon splice junction of hexokinase are contemplated for use herewith. It has been observed that some exon sequences can be included in the construct without seriously affecting the target selectivity thereof. The amount of exonic material included will vary depending on the particular exon and intron sequences used. One can readily test whether too much exon DNA is included simply by testing the constructs in vitro to determine whether the expression of hexokinase and/or other genes having complementary sequences is affected. _
- Antisense or “complementary” means polynucleotide sequences that are substantially complementary over their entire length and have very few base mismatches. For example, sequences of fifteen bases in length may be termed complementary when they have complementary nucleotides at thirteen or fourteen positions. Naturally, sequences which are completely complementary will be sequences which are entirely complementary throughout their entire length and have no base mismatches. Other sequences with lower degrees of homology also are contemplated. For example, an antisense construct which has limited regions of high homology, but also contains a non-homologous region (e.g., ribozyme) could be designed. These molecules, though having less than 50% homology, would bind to target sequences under appropriate conditions.
- genomic DNA may be combined with cDNA or synthetic sequences to generate specific constructs.
- a genomic clone will need to be used.
- the cDNA or a synthesized polynucleotide may provide more convenient restriction sites for the remaining portion of the construct and, therefore, would be used for the rest of the sequence.
- homologous recombination relies, like antisense, on the tendency of nucleic acids to base pair with complementary sequences. In this instance, the base pairing serves to facilitate the interaction of two separate nucleic acid molecules so that strand breakage and repair can take place.
- the "homologous” aspect of the method relies on sequence homology to bring two complementary sequences into close proximity, while the "recombination” aspect provides for one complementary sequence to replace the other by virtue of the breaking of certain bonds and the formation of others.
- homologous recombination is used as follows. First, the target gene is selected within the host cell, in this case, hexokinase. Sequences homologous to the hexokinase target gene are then included in a genetic construct, along with some mutation that will render the target gene inactive (stop codon, interruption, and the like). The homologous sequences flanking the inactivating mutation are said to "flank" the mutation. Flanking, in this context, simply means that target homologous sequences are located both upstream (5') and downstream (3') of the mutation. These sequences should correspond to some sequences upstream and downstream of the target gene. The construct is then introduced into the cell, thus permitting recombination between the cellular sequences and the construct.
- the genetic construct will normally act as far more than a vehicle to interrupt the gene.
- a selectable marker gene This gene permits selection of cells that have integrated the construct into their genomic DNA by conferring resistance to various biostatic and biocidal drugs.
- a heterologous gene that is to be expressed in the cell also may advantageously be included within the construct. The arrangement might be as follows:
- Another refinement of the homologous recombination approach involves the use of a "negative" selectable marker.
- a "negative" selectable marker is the use of the cytosine deaminase gene in a negative selection method as described in U.S. Patent No. 5,624,830 (inco ⁇ orated herein by reference).
- This marker unlike the selectable marker, causes death of cells which express the marker. Thus, it is used to identify undesirable recombination events.
- These recombinants also may contain the selectable marker gene and may express the heterologous protein of interest, but will, in all likelihood, not have the desired "knock out” phenotype.
- a negative selectable marker By attaching a negative selectable marker to the construct, but outside of the flanking regions, one can select against many random recombination events that will inco ⁇ orate the negative selectable marker. Homologous recombination should not introduce the negative selectable marker, as it is outside of the flanking sequences.
- random integration is like homologous recombination, however, in that a gene construct, often containing a heterologous gene and a selectable marker, integrates into the target cell genomic DNA via strand breakage and reformation.
- Ribozymes are RNA-protein complexes that cleave nucleic acids in a site-specific fashion. Ribozymes have specific catalytic domains that possess endonuclease activity (Kim and Cech, 1987; Gerlach et al, 1987; Forster and Symons, 1987).
- ribozymes accelerate phosphoester transfer reactions with a high degree of specificity, often cleaving only one of several phosphoesters in an oligonucleotide substrate (Cech et al, 1981; Michel and Westhof, 1990; Reinhold-Hurek and Shub, 1992).
- This specificity has been attributed to the requirement that the substrate bind via specific base-pairing interactions to the internal guide sequence ("IGS") of the ribozyme prior to chemical reaction.
- IGS internal guide sequence
- Ribozyme catalysis has primarily been observed as part of sequence-specific cleavage/ligation reactions involving nucleic acids (Joyce, 1989; Cech et al, 1981).
- U.S. Patent No. 5,354,855 reports that certain ribozymes can act as endonucleases with a sequence specificity greater than that of known ribonucleases and approaching that of the DNA restriction enzymes.
- sequence-specific ribozyme-mediated inhibition of gene expression may be particularly suited to therapeutic applications (Scanlon et al, 1991; Sarver et al, 1990; Sioud et al, 1992).
- ribozymes elicited genetic changes in some cells lines to which they were applied; the altered genes included the oncogenes H-ras, c-fos and genes of HIV. Most of this work involved the modification of a target mRNA, based on a specific mutant codon that is cleaved by a specific ribozyme.
- RNA cleavage activity examples include sequences from the Group I self splicing introns including Tobacco Ringspot Virus (Prody et al, 1986), Avocado Sunblotch Viroid (Palukaitis et al, 1979 and Symons, 1981), and Lucerne Transient Streak Virus (Forster and Symons, 1987). Sequences from these and related viruses are referred to as hammerhead ribozyme based on a predicted folded secondary structure.
- ribozymes include sequences from RNase P with RNA cleavage activity (Yuan et al, 1992, Yuan and Altman, 1994, and U.S. Patent Nos. 5,168,053 and 5,624,824), hai ⁇ in ribozyme structures (Berzal-Herranz et al, 1992 and Chowrira et al, 1993) and Hepatitis Delta virus based ribozymes.
- the general design and optimization of ribozyme directed RNA cleavage activity has been discussed in detail (Haseloff and Gerlach, 1988, Symons, 1992, Chowrira et al. , X 994, and Thompson et al. , X 995).
- Ribozymes are targeted to a given sequence by virtue of annealing to a site by complimentary base pair interactions. Two stretches of homology are required for this targeting. These stretches of homologous sequences flank the catalytic ribozyme structure defined above. Each stretch of homologous sequence can vary in length from 7 to 15 nucleotides. The only requirement for defining the homologous sequences is that, on the target RNA, they are separated by a specific sequence which is the cleavage site.
- the cleavage site is a dinucleotide sequence on the target RNA is a uracil (U) followed by either an adenine, cytosine or uracil (A,C or U) (Perriman et al, 1992 and Thompson et al, 1995).
- the frequency of this dinucleotide occurring in any given RNA is statistically 3 out of 16. Therefore, for a given target messenger RNA of 1000 bases, 187 dinucleotide cleavage sites are statistically possible.
- the message for low K m hexokinases targeted here are greater than 3500 bases long, with greater than 500 possible cleavage sites.
- hexokinase-targeted ribozymes The identification of operative and preferred sequences for use in hexokinase-targeted ribozymes is simply a matter of preparing and testing a given sequence, and is a routinely practiced "screening" method known to those of skill in the art.
- hexokinase may further be inhibited by any one or more of the methods described below.
- Particularly contemplated are agents that displace hexokinase from mitochondria and thus competitively reduce hexokinase activity.
- This group of agents includes inactive hexokinases and fragments thereof that retain mitochondrial binding functions and, also, hexokinase-glucokinase chimeras that further substitute glucokinase activity for hexokinase activity. Metabolic inhibitors of hexokinase activity that stimulate the production of trehalose-6-phosphate may also be used. All of the inhibitory agents may be provided in the form of a gene or vector that expresses the particular agent.
- genes have been characterized that participate in DNA repair (Tsukuda et ah, 1989; Bauchwitz and Holloman, 1990).
- One such gene, REC2 encodes a protein that catalyzes homologous pairing between complementary nucleic acids and is required for a functional recombinational repair pathway (Kmiec et ah, 1994; Rubin et ah, 1994).
- homologous pairing was more efficient between RNA-DNA hybrids than the corresponding DNA duplexes (Kmiec et al, 1994; PCT, WO 96/22364).
- efficiency in pairing between DNA:DNA duplexes could be enhanced by increasing the length of the DNA oligonucleotides (Kmiec et al, 1994).
- RNA-DNA oligonucleotides chimeric RNA-DNA oligonucleotides (RDOs) in the targeted modification of genes in mammalian cell lines (Yoon et al, 1996; Cole-Strauss et al, 1996; PCT WO95/15972).
- the RNA-DNA oligonucleotides that were used to test this application contained self-annealing sequences such that double- hai ⁇ in capped ends are formed. This feature is thought to increase the in vivo half-life of the RDO by decreasing degradation by helicases and exonucleases. Further, the RDOs contained a single base pair that differs from the target sequence and otherwise aligns in perfect register.
- the single mismatch will be recognized the DNA repair enzymes.
- the RDOs contained RNA residues modified by 2'-O-methylation of the ribose sugar. Such modification makes the RDO resistant to degradation by ribonuclease activity (Monia et ah, 1993).
- RDOs were used to target and correct an alkaline phosphatase cDNA in that was maintained in the episomal DNA of Chinese hamster ovary cells. An inactive form of alkaline phosphatase was converted to a wild-type form with an efficiency of about 30% (Yoon et ah, 1996).
- a genetic mutation within chromosomal DNA was targeted and corrected.
- a lymphoid blast cell line was derived from a patient with sickle cell disease who was homozygous for a point mutation in the ⁇ -globin gene.
- the overall frequency of gene conversion from the mutant to the wild-type form was very high and was found to be dose-dependent on the concentration of the RDOs (Cole-Strauss et ah, 1996).
- RDOs or DNA oligonucleotides for the pu ⁇ oses of targeted gene conversion is broadly applicable to various mammalian cell lines, then it offers several advantages to current technologies that have been used to accomplish gene disruption such as homologous recombination.
- gene conversion by RDO or DNA oligonucleotides occurs in various cell lines at an efficiency of 30% then this will represent a much higher rate than has been reported for targeted gene disruption via homologous recombination.
- only short sequences are required for gene disruption by RDOs or DNA oligonucleotides (typically 60 mers to 70 mers); whereas homologous recombination requires very long stretches of complementary sequences.
- homologous sequences from 9 to 15 kilobases are typically recommended in the construction of targeting vectors.
- construction of DNA vectors for homologous recombination usually involves extensive gene mapping studies and time consuming efforts in the isolation of genomic DNA sequences. Such efforts are unnecessary if RDOs are used for targeted gene conversions.
- assays for gene conversion by RDOs can be performed 4 to 6 hours following introduction of the RDOs or DNA oligonucleotides into the cell.
- gene conversion by homologous recombination requires a relatively long period of time (days to weeks) between the time of introducing the targeting vector DNA and assaying for recombinants. 6.
- Low K m hexokinases are distinguished from glucokinase in that they are allosterically regulated by glucose-6-phosphate and by binding to mitochondria (Wilson, 1968; 1973; 1985; 1994). Micromolar concentrations of glucose-6-phosphate inhibit the activities of hexokinases I, II, and III, but appreciable inhibition of glucokinase requires glucose-6-phosphate concentrations in excess of 10 mM. Binding of hexokinases I and II to mitochondria alters their kinetic properties (Wilson, 1968; 1985; 1995), while glucokinase does not appear to be capable of binding to mitochondria at all (Becker et al. 1996).
- hexokinase I When bound to mitochondria, hexokinase I undergoes an increase in affinity (a decrease in K m ) for its substrate ATP (Wilson, 1985). In addition, the enzyme becomes far less inhibitable by glucose-6-phosphate, as indicated by a several-fold increase in Kj for this ligand (Wilson, 1985). Studies with hexokinase I have revealed the existence of two types of mitochondrial binding sites (Kabir and Wilson, 1994). Glucose-6-phosphate causes displacement of a proportion of mitochondrially-bound hexokinase from one type of site. The enzyme that remains bound to mitochondria after glucose-6-phosphate treatment is considered to occupy the second site, from which it can be removed by treatment with 0.5 M KSCN.
- inhibitory agents for use in these aspects of the invention will be agents that competitively reduce low K m hexokinase activity.
- One example of such an agent is the glucokinase enzyme.
- Other possible examples include glycerol kinase.
- Preferred examples of these agents are agents that lack low K m hexokinase activity and that displace low K m hexokinase from mitochondria, as described below.
- hexokinase inhibitors of this type are those that compete for hexokinase binding sites and consequentially displace endogenous low K m hexokinases from their mitochondrial binding sites within an intact cell.
- Such "displacing agents" will generally comprise a mitochondrial binding region from the N-terminal domain of a low K m hexokinase, such as hexokinase I or hexokinase II.
- compositions for use in these aspects may comprise the N-terminal 15 amino acids of a hexokinase enzyme, preferably hexokinase I or II, since this segment should be easily expressed in cells and retained as a stable peptide.
- Constructs comprising the entire N-terminal domain of either hexokinase I or hexokinase II, or the intact, full-length hexokinase I or II proteins that have been rendered inactive by site-directed mutagenesis of amino acids that are important for the enzyme's catalytic function are also contemplated. Constructs based upon hexokinase I will be particularly, or even exclusively, preferred in certain embodiments.
- N-terminal domain construct The reason for preferring the N-terminal domain construct is that this element seems to comprise a complete structural domain, based upon studies in which this domain can be expressed in bacteria and shown to bind glucose-6-phosphate (Wilson, 1994; Arora et al, 1993; White et al, 1987; White et al, 1990). This suggests that the intact N-terminal domain should fold and form a structure analogous to its structure in the full-length hexokinase I or II protein. As the inventors contemplate that this structure mediates attachment of the intact hexokinase protein to mitochondria, the intact, correctly folded N-terminal domain is a preferred embodiment of hexokinase inhibition.
- Ncol restriction enzyme site in the D ⁇ A sequence corresponding to amino acid 482.
- This Ncol site allows the fragment encoding the ⁇ -terminal domain to be easily isolated and subcloned, and also allows direct fusion of the ⁇ -terminal domain of hexokinase to the intact functional sequence of glucokinase via an Ncol site located at the AUG start codon of this gene.
- peptides, polypeptides and protein domains of any intermediate length between about 15 amino acids and about 455 amino acids, and longer proteins may be used in displacing endogenous hexokinase from the mitochondria. Accordingly, constructs comprising about 20, about 50, about 100, about 150, about 200, about 300 or about 400 amino acids in length may be used for these pu ⁇ oses.
- hexokinase proteins include those that have been subjected to chemical mutagenesis and also those produced using molecular biological techniques and recombinant protein production.
- hexokinase The identification of appropriate polypeptide regions and/or particular amino acid sites that may be targeted in order to inactivate hexokinase will be known to those of skill in the art.
- the crystal structure of certain hexokinase enzymes is available. Coupling the crystal structure information with a comparison of the primary sequence information for various distinct hexokinases will allow one to identify those regions and sites that are important for hexokinase activity, such as the binding sites for ATP, glucose and glucose-6-phosphate. This information can be used in connection with preparing mutants and variants for use herewith. Deletion of certain amino acids or peptide segments, as may be achieved by molecular biological manipulation, is another contemplated method for preparing inactive hexokinases.
- VDAC voltage-dependent anion channels
- porins form a channel through which metabolites such as ATP and various anions traverse the outer mitochondrial membrane. Binding of hexokinases to porin thus may ensure a supply of intramitochondrially-generated ATP as substrate.
- glycerol kinase is another protein thought to bind to mitochondria via porins or VDACs (Adams et al, 1991). Glycerol kinase catalyzes formation of glycerol phosphate from glycerol, using ATP as phosphate donor. Thus, expression of glycerol kinase in cell lines represents another means by which to displace endogenous low-K m hexokinases from their normal mitochondrial binding site.
- a particularly powerful method of inhibiting hexokinase within a mammalian cell involves the displacement of hexokinase from the mitochondria and the concomitant provision of inactive glucokinase.
- This is advantageously achieved by providing to the cell a hexokinase-glucokinase chimera or fusion protein, in which the hexokinase portion is capable of binding to the mitochondria and yet does not exhibit hexokinase catalytic activity, and in which the glucokinase portion is catalytically active.
- Chemically-fused polypeptides are a possibility, but recombinant proteins are naturally most preferred for use in this manner.
- any glucokinase-derived sequence that contains enough primary sequence information to confer glucokinase catalytic activity to the chimera will be useful in this context. However, it will often be preferred to use the entire glucokinase enzyme as this is more straightforward in terms of methodology. Again, one may look to the extensive information available in various published references in order to assist with the identification of appropriate glucokinase enzymes or fragments thereof.
- glucose phosphorylation is also catalyzed by a family of hexokinases that are related in sequence and function to the mammalian hexokinase gene family.
- Yeast cells contain other genes involved in carbohydrate metabolism for which there are no mammalian counte ⁇ arts.
- the trehalose-6-phosphate synthase/trehalose-6-phosphate phosphatase complex is an example of such an activity.
- the trehalose-6-phosphate synthase/phosphatase complex catalyzes the formation of trehalose, a disaccharide of two glucose molecules ( ⁇ -D-glucopyranosyl (1-1) ⁇ -D- glucopyranoside) by first forming trehalose-6-phosphate by condensation of two molecules of glucose-6-phosphate and then using its phosphatase activity to remove the phosphate groups to generate free trehalose (Bell et al, 1992).
- Trehalose is thought to represent a form of storage polysaccharide in yeast, bacteria and other lower organisms, but neither the trehalose- 6-phosphate synthase enzyme complex nor its products trehalose-6-phosphate or free trehalose are known to be present in mammalian cells.
- trehalose-6-phosphate can inhibit the activity of hexokinases from a variety of different organisms, including rat brain, which expresses predominantly hexokinase I (Blazquez et al, 1993). This has led to the suggestion that trehalose-6-phosphate may be an important regulator of glycolytic flux in yeast cells.
- the yeast gene known as cif-1 was originally cloned from yeast that are unable to grow in glucose (Blazquez et al, 1993) and subsequently shown to be identical to the smallest subunit (56 kDa) of the trehalose phosphate synthase/trehalose-6- phosphate phosphatase complex (Bell et al, 1992).
- Cells lacking in the CIF-1 gene product exhibit rapid depletion of ATP, presumably because they are unable to produce trehalose-6- phosphate that normally serves to moderate yeast hexokinase activity. It is believed that the 56 kDa CIF-1 gene product encodes the trehalose phosphate synthase activity (Bell et al, 1992).
- a further method for inhibiting low K m hexokinase activity in mammalian cells is to express an enzyme, such as yeast trehalose-6-phosphate synthase, that will allow trehalose-6- phosphate to accumulate. This will have two effects. First, the accumulated trehalose-6- phosphate will serve to allosterically inhibit endogenous low K m hexokinase activity.
- this enzyme will divert glucose-6-phosphate into trehalose-6-phosphate at low, non-stimulatory glucose concentrations where low K m hexokinases but not glucokinases are active, thereby "short-circuiting" metabolic signaling for insulin secretion, which is thought to require ATP produced via further glucose metabolism (Newgard and McGarry, 1995).
- a currently preferred gene for use in these aspects is the S. cerevisiae gene encoding trehalose-6-phosphate synthase (TPS1). Genes from several other organisms encoding trehalose-6-phosphate synthase have been isolated and the amino acid sequences deduced. These include E. coli (Accession # X69160), S. pombe (# Z29971), Mycobacterium laprae (# U15187) and Aspergillus niger (# U07184). It is contemplated that any of the foregoing or other biological functional equivalents thereof may be used in the context to the present invention.
- HK inhibition Any of the methods of HK inhibition described above may be combined with one another and, particularly, may also be used in combination with glucokinase ove ⁇ roduction. Glucokinase ove ⁇ roduction alone is even thought to be a useful method of inhibiting hexokinase, as set forth below.
- Low K m hexokinases including hexokinases I and II that are present at high levels in mammalian cell lines, are inhibited by glucose-6-phosphate.
- methods for maintaining glucose-6-phosphate at high levels in cell lines may also be employed.
- the preferred method for achieving consistently high levels of glucose-6-phosphate in cells is to overexpress glucokinase in such lines.
- glucokinase is considered advantageous for two distinct reasons.
- expression of glucokinase is part of the basic glucose-stimulated insulin secretion re-engineering.
- Glucokinase expression has the added benefit of maintaining high levels of glucose-6-phosphate to keep low K m hexokinases in an inhibited state. This advantage would become particularly relevant at glucose concentrations in the physiological range (4-9 mM), because glucokinase is active at these levels.
- glucokinase is a member of the hexokinase gene family, it is not itself inhibited by glucose-6- phosphate.
- Mammalian cultures have advantages over cultures derived from the less advanced lifeforms in their ability to post-translationally process complex protein structures such as disulfide-dependent folding and glycosylation.
- Neuroendocrine cell types have added unique capacities of endoproteolytic cleaving, C-terminal amidation and regulated secretion. Indeed, mammalian cell culture is now the preferred source of a number of important proteins for use in human and animal medicine, especially those which are relatively large, complex or glycosylated.
- aspects of the present invention take advantage of the biochemical and cellular capacities of stable neuroendocrine cells as well as of recently available bioreactor technology.
- Growing cells according to the present invention in a bioreactor allows for large scale production and secretion of complex, fully biologically-active polypeptides into the growth media.
- the purification strategy can be greatly simplified, thus lowering production cost.
- Animal and human cells can be propagated in vitro in two modes: as non-anchorage dependent cells growing freely in suspension throughout the bulk of the culture; or as anchorage-dependent cells requiring attachment to a solid substrate for their propagation (i.e., a monolayer type of cell growth).
- Non-anchorage dependent or suspension cultures from continuous established cell lines are the most widely used means of large scale production of cells and cell products.
- Large scale suspension culture based on microbial (bacterial and yeast) fermentation technology has clear advantages for the manufacturing of mammalian cell products. The processes are relatively straightforward to operate and scale up. Homogeneous conditions can be provided in the reactor which allows for precise monitoring and control of temperature, dissolved oxygen, and pH, and ensure that representative samples of the culture can be taken.
- suspension cultured cells cannot always be used in the production of biologicals. Suspension cultures are still considered to have tumorigenic potential and thus their use as substrates for production put limits on the use of the resulting products in human and veterinary applications (Petricciani, 1985; Larsson and Litwin, 1987). Viruses propagated in suspension cultures as opposed to anchorage-dependent cultures can sometimes cause rapid changes in viral markers, leading to reduced immunogenicity (Bruemann et l, 1980). Finally, sometimes even recombinant cell lines can secrete considerably higher amounts of products when propagated as anchorage-dependent cultures as compared with the same cell line in suspension (Nilsson and Mosbach, 1987). For these reasons, different types of anchorage-dependent cells are used extensively in the production of different biological products.
- the current invention includes stable cells which are anchorage-dependent of nature.
- Anchorage-dependent cells when grown in suspension, will attach to each other and grow in clumps, eventually suffocating cells in the inner core of each clump as they reach a size that leaves the core cells unsustainable by the culture conditions. Therefore, an efficient means of large-scale culture of anchorage-dependent cells is also provided in order to effectively take advantage of stable cells' capacity to secrete heterologous proteins.
- Instrumentation and controls include agitation, temperature, dissolved oxygen, and pH controls. More advanced probes and autoanalyzers for on-line and off-line measurements of turbidity (a function of particles present), capacitance (a function of viable cells present), glucose/lactate, carbonate/bicarbonate and carbon dioxide are also available. Maximum cell densities obtainable in suspension cultures are relatively low at about 2-4 x 10 cells/ml of medium (which is less than 1 mg dry cell weight per ml), well below the numbers achieved in microbial fermentation.
- the stirred reactor design has successfully been used on a scale of 8000 liter capacity for the production of interferon (Phillips et al, 1985; Mizrahi, 1983).
- Cells are grown in a stainless steel tank with a height-to-diameter ratio of 1 :1 to 3:1.
- the culture is usually mixed with one or more agitators, based on bladed disks or marine propeller patterns. Agitator systems offering less shear forces than blades have been described. Agitation may be driven either directly or indirectly by magnetically coupled drives. Indirect drives reduce the risk of microbial contamination through seals on stirrer shafts.
- the airlift reactor also initially described for microbial fermentation and later adapted for mammalian culture, relies on a gas stream to both mix and oxygenate the culture.
- the gas stream enters a riser section of the reactor and drives circulation. Gas disengages at the culture surface, causing denser liquid free of gas bubbles to travel downward in the downcomer section of the reactor.
- the main advantage of this design is the simplicity and lack of need for mechanical mixing. Typically, the height-to-diameter ratio is 10:1.
- the airlift reactor scales up relatively readily, has good mass transfer of gasses and generates relatively low shear forces.
- a batch process is a closed system in which a typical growth profile is seen. A lag phase is followed by exponential, stationary and decline phases. In such a system, the environment is continuously changing as nutrients are depleted and metabolites accumulate. This makes analysis of factors influencing cell growth and productivity, and hence optimization of the process, a complex task. Productivity of a batch process may be increased by controlled feeding of key nutrients to prolong the growth cycle. Such a fed-batch process is still a closed system because cells, products and waste products are not removed.
- perfusion of fresh medium through the culture can be achieved by retaining the cells with a fine mesh spin filter and spinning to prevent clogging.
- Spin filter cultures can produce cell densities of approximately 5 x 10 cells/ml.
- a true open system and the most basic perfusion process is the chemostat in which there is an inflow of medium and an outflow of cells and products.
- Culture medium is fed to the reactor at a predetermined and constant rate which maintains the dilution rate of the culture at a value less than the maximum specific growth rate of the cells (to prevent washout of the cell mass from the reactor).
- Culture fluid containing cells, cell products and byproducts is removed at the same rate.
- roller bottle Being little more than a large, differently shaped T-flask, simplicity of the system makes it very dependable and, hence, attractive. Fully automated robots are available that can handle thousands of roller bottles per day, thus eliminating the risk of contamination and inconsistency associated with the otherwise required intense human handling. With frequent media changes, roller bottle
- microcarrier cultures offer a high surface-to- volume ratio (variable by changing the carrier concentration) which leads to high cell density yields and a potential for obtaining highly concentrated cell products.
- Cell yields are up to 1-2 ⁇ x 10 cells/ml when cultures are propagated in a perfused reactor mode.
- cells can be propagated in one unit process vessels instead of using many small low-productivity vessels (i.e., flasks or dishes). This results in far better utilization and a considerable saving of culture medium.
- propagation in a single reactor leads to reduction in need for facility space and in the number of handling steps required per cell, thus reducing labor cost and risk of contamination.
- microcarrier suspension culture makes it possible to monitor and control environmental conditions (e.g., pH, pO 2 , and concentration of medium components), thus leading to more reproducible cell propagation and product recovery.
- environmental conditions e.g., pH, pO 2 , and concentration of medium components
- microcarriers settle out of suspension easily, use of a fed-batch process or harvesting of cells can be done relatively easily.
- microcarrier cultures are relatively easily scaled up using conventional equipment used for cultivation of microbial and animal cells in suspension.
- microencapsulation One method which has shown to be particularly useful for culturing mammalian cells is microencapsulation.
- the mammalian cells are retained inside a semipermeable hydrogel membrane.
- a porous membrane is formed around the cells permitting the exchange of nutrients, gases, and metabolic products with the bulk medium surrounding the capsule.
- Several methods have been developed that are gentle, rapid and non-toxic and where the resulting membrane is sufficiently porous and strong to sustain the growing cell mass throughout the term of the culture. These methods are all based on soluble alginate gelled by droplet contact with a calcium-containing solution.
- Lim (1982) describes cells concentrated in an approximately 1% solution of sodium alginate which are forced through a small orifice, forming droplets, and breaking free into an approximately 1% calcium chloride solution.
- the droplets are then cast in a layer of polyamino acid that ionically bonds to the surface alginate.
- the alginate is reliquified by treating the droplet in a chelating agent to remove the calcium ions.
- Other methods use cells in a calcium solution to be dropped into a alginate solution, thus creating a hollow alginate sphere.
- a similar approach involves cells in a chitosan solution dropped into alginate, also creating hollow spheres.
- Microencapsulated cells are easily propagated in stirred tank reactors and, with beads sizes in the range of 150-1500 ⁇ m in diameter, are easily retained in a perfused reactor using a fine-meshed screen.
- the ratio of capsule volume to total media volume can kept from as dense as 1 :2 to 1 :10. With intracapsular cell densities of up to 10 , the effective cell density in the culture is 1-5 x 10 7 .
- microencapsulation over other processes include the protection from the deleterious effects of shear stresses which occur from sparging and agitation, the ability to easily retain beads for the pu ⁇ ose of using perfused systems, scale up is relatively straightforward and the ability to use the beads for implantation.
- Perfusion refers to continuous flow at a steady rate, through or over a population of cells (of a physiological nutrient solution). It implies the retention of the cells within the culture unit as opposed to continuous-flow culture which washes the cells out with the withdrawn media (e.g., chemostat).
- the idea of perfusion has been known since the beginning of the century, and has been applied to keep small pieces of tissue viable for extended microscopic observation. The technique was initiated to mimic the cells milieu in vivo where cells are continuously supplied with blood, lymph, or other body fluids. Without perfusion, cells in culture go through alternating phases of being fed and starved, thus limiting full expression of their growth and metabolic potential.
- the current use of perfused culture is to grow cells at high densities (i.e., 0.1-5 x 10 8 cells/ml). In order to increase densities beyond 2-
- the medium has to be constantly replaced with a fresh supply in order to make up for nutritional deficiencies and to remove toxic products.
- Perfusion allows for a far better control of the culture environment (pH, pO 2 , nutrient levels, etc.) and is a means of significantly increasing the utilization of the surface area within a culture for cell attachment.
- Microcarrier and microencapsulated cultures are readily adapted to perfused reactors but, as noted above, these culture methods lack the capacity to meet the demand for cell densities above 10 cells/ml. Such densities will provide for the advantage of high product titer in the medium (facilitating downstream processing), a smaller culture system (lowering facility needs), and a better medium utilization (yielding savings in serum and other expensive additives). Supporting cells at high density requires efficient perfusion techniques to prevent the development of non-homogeneity.
- the cells of the present invention may, irrespective of the culture method chosen, be used in protein production and as cells for in vitro cellular assays and screens as part of drug development protocols.
- Neuroendocrine cells by definition, have sorting mechanisms, whereby a given polypeptide or protein, destined for secretion, is targeted to the regulated secretory pathway or the default constitutive secretory pathway. Loss or impaired function of neuroendocrine cells is associated with a variety of human diseases and disorders.
- NIDDM has been hampered by an insufficiency of in vitro assays that are biologically relevant, stable, and allow for high through-put.
- the preferred material for in vitro screens for the pu ⁇ oses of identifying therapeutics is functional islets from human cadavers.
- Such use of human islets is impractical due to extremely limited amounts of material, age-related difference in ⁇ -cell function, and complicated as well by the batch-to batch variation that has been observed for islet preparations (Jansson et al, 1995; McClenaghan et al, 1996).
- One material that could be potentially used in biological screens to identify candidate agents as therapies for NIDDM are rodent ⁇ -cell lines.
- Several such cell lines have been established, maintained for extended periods in vitro, and characterized with regard to the synthesis and regulated secretion of insulin.
- the cell lines include those established from the pancreatic islets of rat (Chick et al, 1977; Gazdar et al, 1980; McClenaghan et al, 1996) hamster (Ashcroft et al, 1986), and mouse (Miyazaki et al, 1990; Knaack et al, 1994).
- These cell lines and their clonal derivatives potentially provide an unlimited supply of material; however, they are deficient in other properties important for their use as screening tools for therapeutic agents for diabetes.
- ⁇ -cell lines described to date are deficient in key functional aspects when compared to islet ⁇ -cells. Insulin content is decreased and proinsulin processing is often impaired (Poitout et al, 1996). In ⁇ -cell lines the threshold or magnitude of gluco e- stimulated insulin secretion (GSIS) and response to agents that can potentiate GSIS are often not representative of primary ⁇ -cells (Newgard, 1996). In addition, many ⁇ -cell lines express peptides that are not expressed by the primary ⁇ -cell such as somatostatin, pancreatic polypeptide, and glucagon (Madsen et al, 1986).
- HIT cells One of the most ubiquitous properties of established ⁇ -cell lines is phenotypic instability such that, with extended cultivation, the cells lose those traits that are singularly ⁇ - cell in nature.
- HIT cells many ⁇ TC cell lines, and unengineered RIN cell lines have less insulin content than a normal ⁇ -cell (Radvanyi et al, 1993), and this level has been reported to drop if the cells are maintained in culture for multiple population doublings (Clark et al, 1990; Poitout et al, 1996).
- HIT cells lose responsiveness to glucose, arginine, and various secretagogues with serial passages (Zhang et al, 1989).
- ⁇ TC cell lines display relatively normal GSIS at early passages, but with continuous propagation these cells acquire aberrant insulin secretion that is characterized by a hypersensitivity to glucose (Efrat et al, 1988; Efrat et al, 1993; Poitout et al, 1996).
- the present invention provides immortal human neuroendocrine cells lines with a phenotypic integrity that allows them to be used as screening tools for the identification of novel substances that can be employed in the modulation of secretory function that is manifest in a number of diseased states including diabetes. Further, these cells may be engineered to ensure that glucose sensing and responsiveness is maintained over a period of time, i.e., indefinitely.
- the components for such a system, and methods of making and using such cell lines are set forth in detail below. 1.
- NIDDM neurodegenerative disease .
- the onset and progression of NIDDM are marked by discreet stages of ⁇ -cell dysfunction and failure with defects in insulin secretion presenting throughout the disease (Porte 1991 ; Granner and O'Brien 1992; Polonsky 1995; Polonsky et al, 1996).
- the early phases of NIDDM often are characterized by insulin resistance and a compensatory increase in the secretion of insulin.
- hyperinsulinemia fails to completely overcome insulin resistance, mild fasting hyperglycemia and impaired glucose tolerance become detectable.
- hypoinsulinemia presents.
- the first-phase of insulin secretion is short in duration and facilitates immediate glucose disposal. Its loss, typically early in NIDDM, results in postprandial hyperglycemia.
- GSIS glucose-stimulated insulin secretion
- Glucolipotoxicity refers to the detrimental effects that sustained elevations of plasma glucose and free fatty acids have on ⁇ - cell metabolism. The resulting disruption of ⁇ -cell fuel metabolism leads to faulty insulin secretion and contributes to ongoing ⁇ -cell failure.
- Optimal glucose-sensing and subsequent insulin secretion have been linked to two key ⁇ -cell proteins: the glucose transporter, type 2 (GLUT-2) and hexokinase, type IV, (glucokinase).
- the relatively low affinity of these proteins for glucose allows them to be rate- limiting in the transport and metabolism of glucose and provides the glucose-sensing required for physiologically relevant insulin secretion (Newgard and McGarry 1995; Matschinsky 1996).
- Cytosolic long chain fatty acyl-CoA esters and free fatty acids are potentiators of GSIS (DeFronzo, 1997). Partitioning of fatty acyl-CoA molecules between the cytoplasm and mitochondria is regulated by glucose. Basal glucose levels stimulate transport into the mitochondria and ⁇ -oxidation, and elevations of intracellular glucose promote increases in cytoplasmic concentrations of long-chain fatty acyl CoA esters and potentiation of GSIS.
- CPT-1 carnitine palmitoyl transferase 1
- the protein that transports fatty acyl-CoA molecules into the mitochondria from the cytoplasm is inhibited by malonyl CoA, a metabolite that increases with increases in glucose metabolism (DeFronzo, 1997).
- malonyl CoA a metabolite that increases with increases in glucose metabolism
- Leptin is a peptide hormone synthesized in and secreted from adipocytes. It has dramatic effects on body composition by regulating food intake and thermogenesis. Rodent strains with defects either in leptin production or leptin receptors are obese and a have high incidence of NIDDM. Increases in plasma leptin levels have been shown to reduce body fat in several obese and non-obese rodent models. Leptin receptors are expressed in tissues throughout the body and have been shown to be present in pancreatic islets.
- Leptin has been shown to induce enzymes of fatty acid oxidation and deplete triglyceride pools in pancreatic islets (Shimabukuro et al, 1997a; Zhou et al, 1997). It is postulated that leptin functions in normal physiology to protect the ⁇ -cell from lipotoxicity and helps to prevent adipogenic diabetes (Shimabukuro et al, 1997a, b; Zhou et al, 1997). It is currently unknown if defects in leptin-regulated fatty acid metabolism are causally linked to progressive ⁇ -cell failure that is characteristic of NIDDM in humans.
- NIDDM ⁇ -cell failure characteristic of NIDDM is a complex and multi-faceted process.
- the only pharmaceutical agents that target the ⁇ -cell in NIDDM are the sulfonylurea agents. These drugs treat the symptom of hyperglycemia by interacting with K + -
- ATP channels to stimulate insulin secretion.
- long-term use of the sulfonylurea drugs often results in a loss of drug efficacy.
- No drugs are available for the following defects that are often seen in diabetes: correcting defects in fatty acid metabolism, preventing oxidative damage to ⁇ -cells, restoring the potency of glucose and other secretagogues in insulin secretion, stimulating insulin secretion via receptors other than SUR/KIR or internal signaling machinery, and preventing or retarding progressive ⁇ -cell failure.
- Engineered immortal human neuroendocrine cell lines with stable phenotypes can be used to screen compounds that alter insulin secretion. These engineered cells afford the capacity of in vivo testing of candidate compounds for safety and efficacy.
- the present invention provides an immortal human neuroendocrine secretory cell that may be employed in the identification of modulators of secretory function.
- Such compounds will be especially useful in a variety of diseased states in which secretory function has been impaired. An example of such a state would be the loss of ⁇ -cell integrity that is manifest in diabetes.
- immortalized secretory cells that have a stable neuroendocrine phenotype are used to identify compounds that will be useful in the regulating this secretory function.
- a cell line that will be representative of a human islet ⁇ -cell.
- engineered cell lines have a measurable activity that accurately reflects the regulation and capacity of the secretory pathway.
- One way to achieve this endpoint is to express a transgenic polypeptide at high levels that is processed and secreted through the regulated secretory pathway.
- Such a peptide by definition, will be detectable in the media of the cultured cells, and its secretion will be dependent of the stimulatory or inhibitory signals that are received and processed by the cell.
- the regulated pathway of the ⁇ -cell encompasses both acute regulation of insulin secretion (i.e. a large increment between the unstimulated and stimulated states) and the complete processing of proinsulin to the mature insulin polypeptide.
- secretory granules allow the storage of insulin as a depot at the plasma membrane that can be released within seconds of arrival of a fuel-derived or hormonal signal, and also serve as the site of conversion of proinsulin to insulin by virtue of their high concentrations of the relevant convertases PCI (also known as PC3) and PC2.
- the presence of secretory granules and retention of proinsulin processing capacity represent a major advantage of insulinoma and other neuroendocrine cell lines relative to cells less specialized for secretion of peptide hormones such as hepatoma cells or fibroblasts.
- a second, and certainly central parameter, is for the cell to be equipped with a capacity for secretagogue sensing and responsiveness.
- glucose responsiveness has several components that must be considered, including the appropriate threshold for the response (islet ⁇ -cells typically respond to glucose at concentrations in excess of the fasting level of 4-5 mM), rapid response dynamics ( ⁇ -cells secrete insulin in response to glucose within minutes of its application and turn off insulin secretion nearly as rapidly when glucose is removed) and an appropriate magnitude of response.
- engineered cell lines retain phenotypic and genotypic stability. This includes both genes that are inserted or deleted during the course of engineering and key endogenous genes. This is a significant limitation on current technology.
- the immortalized human neuroendocrine secretory cell lines described by the present invention have a stable neuroendocrine phenotype. They are able to providing a measurable secretion of the secretory product and secretagogue responsive, thereby indicating that these cell lines respond to modulators of secretory function. Therefore, within certain embodiments of the invention, methods are provided for screening for modulators of secretory function. Such methods may use the cells of the present invention either as adherent cells on a culture dish, as part of an alginate biomatrix, in suspension culture or in any other form that permits the secretion of the polypeptide to be monitored. These cells are then used as reagents to screen small molecule and peptide libraries to identify modulators of secretory function.
- Secretory function embodies all aspects of the cell's capacity to sense the extracellular milieu, respond to that milieu via the activation and inhibition of a variety of intracellular signaling mechanisms, and accordingly regulate the secretion of a peptide or hormone from the secretory pathway. Regulation from the secretory pathway can occur at any phase in the synthesis and release of a peptide or hormone including gene transcription; stability of the mRNA; translation; post-translational modifications such as proteolytic processing, formation of disulfide bonds, amidation, and glycosylation; trafficking through the secretory tubules and vesicles; storage within the secretory granule; membrane fusions, and exocytosis.
- the secretory function may be manifest as the secretion of a particular polypeptide from a secretory cell.
- the polypeptide is generally secreted into the media of the cells, from where it can be quantified using any of a number of techniques.
- the polypeptide may be detected directly from the media using for example, ELISA, RIA and the like.
- the polypeptide may be purified prior to detection according to known methods, such as precipitation (e.g., ammonium sulfate), HPLC, immunoprecipitation, ion exchange chromatography, affinity chromatography (including immunoaffinity chromatography) or various size separations (sedimentation, gel electrophoresis, gel filtration).
- precipitation e.g., ammonium sulfate
- HPLC high-hexyl chromatography
- immunoprecipitation e.g., ion exchange chromatography
- affinity chromatography including immunoaffinity chromatography
- various size separations sedimentation, gel electrophoresis, gel filtration.
- the purified polypeptide may then quantified through immunodetection methods
- the present invention provides methods of screening for stimulators of secretory function, by monitoring secretory function in the absence of the candidate substance and comparing such results to the assay performed in the presence of candidate secretory function stimulators.
- the present invention concerns a method for identifying such stimulators. It is contemplated that this screening technique will prove useful in the general identification of a compound that will serve the pu ⁇ ose of promoting, augmenting or increasing the secretion of, for example, a polypeptide from a secretory cell as exemplified by the immortalized human neuroendocrine secretory cells of the present invention. Such compounds will be useful in the treatment of various secretory disorders resulting from impaired secretory function, such as for example, diabetes, Parkinson's disease, athyrotic cretinism and Adison's disease.
- the present invention is directed to a method for determining the ability of a candidate substance to stimulate the secretory function of immortalized cells that either naturally secrete molecules or have been engineered to possess secretory function as described herein.
- the method including generally the steps of:
- step (d) comparing the secretory function of the cell in step (c) with the secretory function of the cell of step (a).
- Secretory function may be determined by measuring the amount of secreted molecule.
- the secreted molecule will be a polypeptide such as an amidated polypeptide, glycosylated polypeptide, a hormone or a growth factor.
- these molecules may be detected using any of a number of techniques well known to those of skill in the art as described herein below.
- Secretory function may also be monitored indirectly by measuring, for example, intracellular calcium or membrane potential with the use of fluorescent indicator molecules.
- the present invention is directed to a method for determining the ability of a candidate substance to have an inhibitory or even antagonistic effect on secretion from the immortalized cells described herein.
- the method including generally the steps of:
- step (d) comparing the secretory function of the cell in step (c) with the secretory function of the cell of step (a).
- a candidate substance as being capable of inhibiting secretory function one would measure or determine such a secretory activity in the absence of the added candidate substance and monitoring the secretory function. One would then add the candidate inhibitory substance to the cell and determine the secretory function in the presence of the candidate inhibitory substance. A candidate substance which is inhibitory would decrease the secretion from said cell, relative to the amount of secretion in its absence.
- Candidate Substances refers to any molecule that is capable of modulating secretory function.
- the candidate substance may be a protein or fragment thereof, a small molecule inhibitor, or even a nucleic acid molecule. It may prove to be the case that the most useful pharmacological compounds for identification through application of the screening assay will be compounds that are structurally related to other known modulators of secretion.
- the active compounds may include fragments or parts of naturally-occurring compounds or may be only found as active combinations of known compounds which are otherwise inactive. However, prior to testing of such compounds in humans or animal models, it will be necessary to test a variety of candidates to determine which have potential.
- the active compounds may include fragments or parts of naturally- occurring compounds or may be found as active combinations of known compounds which are otherwise inactive. Accordingly, the present invention provides screening assays to identify agents which stimulate or inhibit cellular secretion, it is proposed that compounds isolated from natural sources, such as animals, bacteria, fungi, plant sources, including leaves and bark, and marine samples may be assayed as candidates for the presence of potentially useful pharmaceutical agents. It will be understood that the pharmaceutical agents to be screened could also be derived or synthesized from chemical compositions or man-made compounds. Thus, it is understood that the candidate substance identified by the present invention may be polypeptide, polynucleotide, small molecule inhibitors or any other compounds that may be designed through rational drug design starting from known secretagogues or inhibitors of secretory function.
- the candidate screening assays are relatively simple to set up and perform, with the provision of the immortal human neuroendocrine cells of the present invention and in light of the present disclosure.
- assaying for a candidate substance after obtaining an immortalized secretory cell of the present invention, one will admix a candidate substance with the cell, under conditions which would allow measurable secretion to occur. In this fashion, one can measure the ability of the candidate substance to stimulate the secretory function of the cell in the absence of the candidate substance.
- the candidate substance is admixed with the cell. In this fashion the ability of the candidate inhibitory substance to reduce, abolish, or otherwise diminish secretion from said cell may be detected.
- Effective amounts in certain circumstances are those amounts effective to reproducibly stimulate secretion from the cell in comparison to their normal levels. Compounds that achieve significant appropriate changes in activity will be used. Significant increase in secretory function, e.g., as measured using RIA, HPLC, ELISA, biological activity and the like are represented by an increase/decrease in secretion of at least about 30%-40%, and most preferably, by increases of at least about 50%, with higher values of course being possible.
- the active compounds of the present invention also may be used for the generation of antibodies which may then be used in analytical and preparatory techniques for detecting and quantifying further such inhibitors. _
- Purification techniques are well known to those of skill in the art, and will be used to purify the molecules secreted from the immortalized secretory cells of the present invention. These techniques tend to involve the separation of the secreted protein or other secretory molecule from other components of the mixture. Having separated the secreted product from the other components, the sample may be purified using chromatographic and electrophoretic techniques to achieve complete purification. Analytical methods particularly suited to the preparation of a pure peptide are ion-exchange chromatography, exclusion chromatography; polyacrylamide gel electrophoresis; isoelectric focusing. A particularly efficient method of purifying peptides is fast protein liquid chromatography or even HPLC.
- the secreted molecule is a polypeptide and may be isolated from the conditioned media and analyzing the extracts by HPLC as described (Halban, et al, 1986, Sizonenko and Halban, 1991). Solvent systems, gradients and flow rates used were as described by Halban, et al, (1986) however it is well within the skill of the ordinary person in the art to adapt the chromatography conditions to suit individual need. Standards may be used to obtain optimization of chromatography conditions and methods. Certain aspects of the present invention concern the purification, and in particular embodiments, the substantial purification, of a secreted product.
- purified as used herein, is intended to refer to a composition, isolatable from other components, wherein the product is purified to any degree relative to its naturally-obtainable state, i.e., in this case, relative to its purity within a hepatocyte or ⁇ -cell extract.
- a purified protein or peptide therefore also refers to a protein or peptide, free from the environment in which it may naturally occur.
- purified will refer to a protein or peptide composition that has been subjected to fractionation to remove various other components, and which composition substantially retains its expressed biological activity. Where the term “substantially purified” is used, this designation will refer to a composition in which the protein or peptide forms the major component of the composition, such as constituting about 50% or more of the proteins in the composition.
- Various methods for quantifying the degree of purification of the protein or peptide will be known to those of skill in the art in light of the present disclosure. These include, for example, determining the specific activity of an active fraction, or assessing the number of polypeptides within a fraction by SDS/PAGE analysis.
- a preferred method for assessing the purity of a fraction is to calculate the specific activity of the fraction, to compare it to the specific activity of the initial extract, and to thus calculate the degree of purity, herein assessed by a "-fold purification number".
- the actual units used to represent the amount of activity will, of course, be dependent upon the particular assay technique chosen to follow the purification and whether or not the expressed protein or peptide exhibits a detectable activity.
- Partial purification may be accomplished by using fewer purification steps in combination, or by utilizing different forms of the same general purification scheme. For example, it is appreciated that a cation-exchange column chromatography performed utilizing an HPLC apparatus will generally result in a greater -fold purification than the same technique utilizing a low pressure chromatography system. Methods exhibiting a lower degree of relative purification may have advantages in total recovery of protein product, or in maintaining the activity of an expressed protein.
- High Performance Liquid Chromatography is characterized by a very rapid separation with extraordinary resolution of peaks. This is achieved by the use of very fine particles and high pressure to maintain an adequate flow rate. Separation can be accomplished in a matter of minutes, or at most an hour. Moreover, only a very small volume of the sample is needed because the particles are so small and close-packed that the void volume is a very small fraction of the bed volume. Also, the concentration of the sample need not be very great because the bands are so narrow that there is very little dilution of the sample.
- Gel chromatography is a special type of partition chromatography that is based on molecular size.
- the theory behind gel chromatography is that the column, which is prepared with tiny particles of an inert substance that contain small pores, separates larger molecules from smaller molecules as they pass through or around the pores, depending on their size.
- the sole factor determining rate of flow is the size.
- Gel chromatography is unsu ⁇ assed for separating molecules of different size because separation is independent of all other factors such as pH, ionic strength, temperature, etc. There also is virtually no adso ⁇ tion, less zone spreading and the elution volume is related in a simple matter to molecular weight.
- Affinity Chromatography is a chromatographic procedure that relies on the specific affinity between a substance to be isolated and a molecule that it can specifically bind to. This is a receptor-ligand type interaction.
- the column material is synthesized by covalently coupling one of the binding partners to an insoluble matrix. The column material is then able to specifically adsorb the substance from the solution. Elution occurs by changing the conditions to those in which binding will not occur (alter pH, ionic strength, temperature, etc.).
- Lectins are a class of substances that bind to a variety of polysaccharides and glycoproteins. Lectins are usually coupled to agarose by cyanogen bromide. Concanavalin A coupled to Sepharose was the first material of this sort to be used and has been widely used in the isolation of polysaccharides and glycoproteins other lectins that have been include lentil lectin, wheat germ agglutinin which has been useful in the purification of N-acetyl glucosaminyl residues and Helix pomatia lectin.
- Lectins themselves are purified using affinity chromatography with carbohydrate ligands. Lactose has been used to purify lectins from castor bean and peanuts; maltose has been useful in extracting lectins from lentils and jack bean; N-acetyl-D galactosamine is used for purifying lectins from soybean; N-acetyl glucosaminyl binds to lectins from wheat germ; D-galactosamine has been used in obtaining lectins from clams and L-fucose will bind to lectins from lotus.
- the matrix should be a substance that itself does not adsorb molecules to any significant extent and that has a broad range of chemical, physical and thermal stability.
- the ligand should be coupled in such a way as to not affect its binding properties.
- the ligand should also provide relatively tight binding. And it should be possible to elute the substance without destroying the sample or the ligand.
- affinity chromatography One of the most common forms of affinity chromatography is immunoaffinity chromatography. The generation of antibodies that would be suitable for use in accord with the present invention is discussed briefly below, and is within the skill of the ordinary artisan in light of the present disclosure.
- the present invention encompasses methods for determining the effects of active compounds on the secretory function of the immortalized secretory cells of the present invention. Generally, this will be achieved by determining the secretion of, for example a secretory polypeptide, of the immortalized secretory cell in the presence of the active compounds and comparing the level of secretion with those levels observed in normal cells of the same type. In this manner the secretory function of the immortalized secretory cells may be quantitated.
- the immunodetection methods of the present invention have evident utility in the detection of polypeptide secretion.
- a sample containing the secreted moiety is contacted with a corresponding antibody.
- a modulator screening assay is performed in which cells secreting a polypeptide are exposed to a test or candidate substance under suitable conditions and for a time sufficient to permit the agent to effect secretion of the polypeptide.
- the secretion of the polypeptide is then detected by incubating the reaction mixture with for example a specific antibody, which antibody may be labeled directly or may be detected secondarily, (e.g., using a labeled idiotypic or species specific antibody) under conditions that permit the formation of immune complexes between the polypeptide and its specific antibody.
- the test reaction is compared to a control reaction which lacks the test sample.
- the presence and/or amount of complexes formed between the polypeptide and the antibody is detected in the test sample (e.g. by determining the presence or amount of label bound directly to the antibody or to a secondary antibody directed against the primary antibody).
- agents that inhibit polypeptide secretion will demonstrate a reduced binding with polypeptide- specific antibodies relative to the control sample and agents that induce or stimulate polypeptide secretion will demonstrate an increased binding with specific antibodies relative to the control sample.
- the present invention concerns immunodetection methods for binding, purifying, removing, quantifying or otherwise generally detecting biologically the secreted components.
- the steps of various useful immunodetection methods have been described in the scientific literature and are well known to those of skill in the art.
- the immunobinding methods include obtaining a sample suspected of containing a compound of interest (i.e. the secreted molecule), and contacting the sample with an antibody under conditions effective to allow the formation of immunocomplexes.
- the immunobinding methods include methods for detecting or quantifying the amount of a reactive component in a sample, which methods require the detection or quantitation of any immune complexes formed during the binding process.
- the biological sample analyzed may be any sample that is suspected of containing a secreted molecule from the immortalized, human neuroendocrine secretory cells of the present invention.
- a cell may be an immortalized human neuroendocrine cell, an immortalized human pancreatic ⁇ -cell, or even any biological fluid that comes into contact with the secretory cells in vivo.
- the sample-antibody composition such as a tissue section, ELISA plate, dot blot or western blot, will generally be washed to remove any non-specifically bound antibody species, allowing only those antibodies specifically bound within the primary immune complexes to be detected.
- the secreted protein, peptide or corresponding antibody employed in the detection may itself be linked to a detectable label, wherein one would then simply detect this label, thereby allowing the amount of the primary immune complexes in the composition to be determined.
- the first added component that becomes bound within the primary immune complexes may be detected by means of a second binding ligand that has binding affinity for the encoded protein, peptide or corresponding antibody.
- the second binding ligand may be linked to a detectable label.
- the second binding ligand is itself often an antibody, which may thus be termed a "secondary" antibody.
- the primary immune complexes are contacted with the labeled, secondary binding ligand, or antibody, under conditions effective and for a period of time sufficient to allow the formation of secondary immune complexes.
- the secondary immune complexes are then generally washed to remove any non-specifically bound labeled secondary antibodies or ligands, and the remaining label in the secondary immune complexes is then detected.
- Further methods include the detection of primary immune complexes by a two step approach.
- a second binding ligand such as an antibody, that has binding affinity for the encoded protein, peptide or corresponding antibody is used to form secondary immune complexes, as described above.
- the secondary immune complexes are contacted with a third binding ligand or antibody that has binding affinity for the second antibody, again under conditions effective and for a period of time sufficient to allow the formation of immune complexes (tertiary immune complexes).
- the third ligand or antibody is linked to a detectable label, allowing detection of the tertiary immune complexes thus formed.
- This system may provide for signal amplification if desired.
- the secreted proteins or peptides of the invention will be detected in a preferred embodiment in ELISA assays.
- Antibodies against such secreted proteins are readily available to those of skill in the art.
- Immunoassays in their most simple and direct sense, are binding assays. Certain preferred immunoassays are the various types of enzyme linked immunosorbent assays (ELISA) and radioimmunoassays (RIA) known in the art.
- antibodies binding to the secreted proteins of the invention are immobilized onto a selected surface exhibiting protein affinity, such as a well in a polystyrene microtiter plate. Then, a test composition containing the secreted polypeptide is added to the wells. After binding and washing to remove non-specifically bound immune complexes, the bound antibody may be detected. Detection is generally achieved by the addition of a second antibody specific for the target protein, that is linked to a detectable label. This type of ELISA is a "sandwich ELISA". Detection may also be achieved by the addition of a second antibody, followed by the addition of a third antibody that has binding affinity for the second antibody, with the third antibody being linked to a detectable label.
- the samples containing the secreted polypeptide are immobilized onto the well surface and then contacted with the antibodies of the invention.
- the bound antigen is detected.
- the immune complexes may be detected directly. Again, the immune complexes may be detected using a second antibody that has binding affinity for the first antibody, with the second antibody being linked to a detectable label.
- Another ELISA in which the proteins or peptides are immobilized involves the use_of antibody competition in the detection.
- labeled antibodies are added to the wells, allowed to bind to the secreted protein, and detected by means of their label.
- the amount of marker antigen in an unknown sample is then determined by mixing the sample with the labeled antibodies before or during incubation with coated wells.
- the presence of marker antigen in the sample acts to reduce the amount of antibody available for binding to the well and thus reduces the ultimate signal. This is appropriate for detecting antibodies in an unknown sample, where the unlabeled antibodies bind to the antigen-coated wells and also reduces the amount of antigen available to bind the labeled antibodies.
- ELISAs have certain features in common, such as coating, incubating or binding, washing to remove non-specifically bound species, and detecting the bound immune complexes. These are described as follows:
- a plate with either antigen or antibody In coating a plate with either antigen or antibody, one will generally incubate the wells of the plate with a solution of the antigen or antibody, either overnight or for a specified period of hours. The wells of the plate will then be washed to remove incompletely adsorbed material. Any remaining available surfaces of the wells are then "coated" with a nonspecific protein that is antigenically neutral with regard to the test antisera. These include bovine serum albumin (BSA), casein and solutions of milk powder.
- BSA bovine serum albumin
- casein casein
- the coating of nonspecific adso ⁇ tion sites on the immobilizing surface reduces the background caused by nonspecific binding of antisera to the surface.
- a secondary or tertiary detection means rather than a direct procedure.
- the immobilizing surface is contacted with the control and/or clinical or biological sample to be tested under conditions effective to allow immune complex (antigen/antibody) formation.
- Detection of the immune complex then requires a labeled secondary binding ligand or antibody, or a secondary binding ligand or antibody in conjunction with a labeled tertiary antibody or third binding ligand.
- Under conditions effective to allow immune complex (antigen/antibody) formation means that the conditions preferably include diluting the antigens and antibodies with solutions such as BSA, bovine gamma globulin (BGG) and phosphate buffered saline (PBSVTweenTM. These added agents also tend to assist in the reduction of nonspecific background.
- BSA bovine gamma globulin
- PBSVTweenTM phosphate buffered saline
- suitable conditions also mean that the incubation is at a temperature and for a period of time sufficient to allow effective binding. Incubation steps are typically from about 1 to 2 to 4 hours, at temperatures preferably on the order of 25° to 27°C, or may be overnight at about 4°C or so.
- the contacted surface is washed so as to remove non-complexed material.
- a preferred washing procedure includes washing with a solution such as PBS/TweenTM, or borate buffer. Following the formation of specific immune complexes between the test sample and the originally bound material, and subsequent washing, the occurrence of even minute amounts of immune complexes may be determined.
- the second or third antibody will have an associated label to allow detection.
- this label will be an enzyme that will generate color development upon incubating with an appropriate chromogenic substrate.
- a urease, glucose oxidase, alkaline phosphatase or hydrogen peroxidase-conjugated antibody for a period of time and under conditions that favor the development of further immune complex formation (e.g., incubation for 2 hours at room temperature in a PBS-containing solution such as PBS-TweenTM).
- the amount of label is quantified, e.g., by incubation with a chromogenic substrate such as urea and bromocresol pu ⁇ le or 2,2'-azido-di-(3-ethyl-benzthiazoline-6- sulfonic acid [ABTS] and H 2 O 2 , in the case of peroxidase as the enzyme label. Quantitation is then achieved by measuring the degree of color generation, e.g., using a visible spectra spectrophotometer.
- a chromogenic substrate such as urea and bromocresol pu ⁇ le or 2,2'-azido-di-(3-ethyl-benzthiazoline-6- sulfonic acid [ABTS] and H 2 O 2 , in the case of peroxidase as the enzyme label.
- Quantitation is then achieved by measuring the degree of color generation, e.g., using a visible spectra spectrophotometer.
- the screening assay uses live cells in the 96-well format has long been the standard used as the format lends itself to automation and robotics handling.
- the 96-well plate format allows for a variety of different candidate substances to be tested in one plate.
- use of live cells for the pu ⁇ ose of drug screening has inherent problems associated with the handling of the cells. Handling attachment dependent cell culture in the 96-well format becomes difficult when there is a need for several exchanges of solution. The forces of surface tension associated with the meniscus on the well wall stress and even damages cells on the bottom of the well as aqueous solutions are removed or added.
- the cells are encapsulated in highly porous, biocompatible hydrogels in a bead form.
- the encapsulated cells are placed in a 96-well plates that inco ⁇ orates a filter-bottom.
- the cells are then incubated with the candidate substance for a suitable period of time to allow the cell to secrete the polypeptide of interest. This incubation step is followed by the harvesting of the media from the cells by the application of a vacuum below the plate to empty all wells in one step.
- the collected samples are then assayed for the presence of the secreted peptide using standard ELISA techniques well known to those of skill in the art.
- the detection assays may be radioimmunoassays as described by various groups (Halban et ah, 1986; Pieber, et al, 1994). Standard commercially available radioimmunoassays are available from Coat-a-count, Diagnostic Products Co ⁇ ., Los
- non-immunologic procedures in the measuring the secretory function according to the of the present invention.
- non-immunologic procedures for example, when examining molecules that are involved in receptor interactions, it is possible to set up assays that look at the occupancy of relevant receptor molecules. This can be performed, for example, by using labeled ligand molecules that will be compete with the ligand (stimulators and inhibitor) in the sample. The more ligand in the sample, the less labeled receptor that will be bound to the receptor.
- Labels include radiolabels, fluorescent labels and chemiluminescent labels.
- diagnostic assays include those that look for the presence of biological activity of the secreted polypeptide.
- compositions of the stable cells in a form appropriate for the intended application, which will most usually be within a selectively permeable membrane.
- the cells will generally be prepared as a composition that is essentially free of pyrogens, as well as other impurities that could be harmful to humans or animals.
- Aqueous compositions of the present invention comprise an effective amount of stable neuroendocrine cells dispersed in a pharmaceutically acceptable carrier or aqueous medium, and preferably encapsulated.
- pharmaceutically acceptable carrier refers to molecular entities and compositions that do not produce adverse, allergic, or other untoward reactions when administered to an animal or a human.
- pharmaceutically acceptable carrier includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and abso ⁇ tion delaying agents and the like.
- this term is particularly intended to include biocompatible implantable devices and encapsulated cell populations.
- the use of such media and agents for pharmaceutically active substances is well know in the art. Except insofar as any conventional media or agent is incompatible with the vectors or cells of the present invention, its use in therapeutic compositions is contemplated. Supplementary active ingredients also can be inco ⁇ orated into the compositions.
- the cell preparations may further contain a preservative to prevent growth of microorganisms.
- Intravenous vehicles include fluid and nutrient replenishers.
- Preservatives include antimicrobial agents, anti-oxidants, chelating agents and inert gases. The pH and exact concentration of the various components in the pharmaceutical are adjusted according to well-known parameters.
- the engineered cells of the present invention may be introduced into animals, including human subjects, with certain needs, such as patients with insulin-dependent diabetes.
- cells are engineered to achieve glucose dose responsiveness resembling that of islets.
- other cells will also achieve advantages in accordance with the invention.
- Madsen and coworkers have shown that implantation of poorly differentiated rat insulinoma cells into animals results in a return to a more differentiated state, marked by enhanced insulin secretion in response to metabolic fuels (Madsen et al, 1988). These studies suggest that exposure of engineered cell lines to the in vivo milieu may have some effects on their response(s) to secretagogues.
- a preferred method of administration involves the encapsulation of the engineered cells in a biocompatible coating.
- the cells are entrapped in a capsular coating that protects the contents from immunological responses.
- One preferred encapsulation technique involves encapsulation with alginate-polylysine-alginate. Capsules made employing this technique generally have a diameter of approximately 1 mm and should contain several hundred cells.
- Cells may thus be implanted using the alginate-polylysine encapsulation technique of O'Shea and Sun (1986), with modifications, as later described by Fritschy et al. (1991; both references inco ⁇ orated herein by reference).
- the engineered cells are suspended in 1.3% sodium alginate and encapsulated by extrusion of drops of the cell/alginate suspension through a syringe into CaCl 2 . After several washing steps, the droplets are suspended in polylysine and re-washed. The alginate within the capsules is then reliquified by suspension in 1 mM EGTA and then rewashed with Krebs balanced salt buffer.
- An alternative approach is to seed Amicon fibers with stable cells of the present invention.
- the cells become enmeshed in the fibers, which are semipermeable, and are thus protected in a manner similar to the micro encapsulates (Altman et al, 1986; inco ⁇ orated herein by reference).
- the cells may be implanted intraperitoneally, usually by injection into the peritoneal cavity through a large gauge needle (23 gauge).
- a tubular semi-permeable membrane was coiled inside a protective housing to provide a compartment for the islet cells.
- Each end of the membrane was then connected to an arterial polytetrafluoroethylene (PTFE) graft that extended beyond the housing and joined the device to the vascular system as an arteriovenous shunt.
- PTFE polytetrafluoroethylene
- the implantation of such a device containing islet allografts into pancreatectomized dogs was reported to result in the control of fasting glucose levels in 6/10 animals. Grafts of this type encapsulating engineered cells could also be used in accordance with the present invention.
- Implantation employing such encapsulation techniques are preferred for a variety of reasons. For example, transplantation of islets into animal models of diabetes by this method has been shown to significantly increase the period of normal glycemic control, by prolonging xenograft survival compared to unencapsulated islets (O'Shea and Sun, 1986; Fritschy et al, 1991). Also, encapsulation will prevent uncontrolled proliferation of clonal cells. Capsules containing cells are implanted (approximately 1,000-10,000/animal) intraperitoneally and blood samples taken daily for monitoring of blood glucose and insulin.
- An alternate approach to encapsulation is to simply inject glucose-sensing cells into the scapular region or peritoneal cavity of diabetic mice or rats, where these cells are reported to form tumors (Sato et al, 1962). Implantation by this approach may circumvent problems with viability or function, at least for the short term, that may be encountered with the encapsulation strategy. This approach will allow testing of the function of the cells in experimental animals, which is a viable use of the present invention, but certainly is not applicable as an ultimate strategy for treating human diabetes. Nonetheless, as a pre-clinical test, this will be understood to have significant utility.
- biohybrid artificial organs encompass all devices which substitute for an organ or tissue function and inco ⁇ orate both synthetic materials and living cells.
- Implantable immunoisolation devices will preferably be used in forms in which the tissue is protected from immune rejection by enclosure within a semipermeable membrane.
- Those of skill in the art will understand device design and performance, as it relates to maintenance of cell viability and function. Attention is to be focused on oxygen supply, tissue density and the development of materials that induce neovascularization at the host tissue-membrane interface; and also on protection from immune rejection. Membrane properties may even be further adapted to prevent immune rejection, thus creating clinically useful implantable immunoisolation devices.
- unit dose refers to a physically discrete unit suitable for use in a subject, each unit containing a predetermined quantity of the therapeutic composition calculated to produce the desired response in association with its administration, i.e., the appropriate route and treatment regimen.
- the quantity to be administered both according to number of treatments and unit dose, depends on the subject to be treated, the state of the subject, and the protection desired. Precise amounts of the therapeutic composition also depend on the judgment of the practitioner and are peculiar to each individual.
- IDM Insulin-dependent diabetes mellitus
- Glucose is the predominant fuel source for the central nervous system (CNS); yet tissues of the CNS are incapable of synthesizing glucose and can store the metabolic fuel for only minutes.
- the concentration of glucose in the CNS is maintained by the tight regulation of plasma glucose levels which are kept within a narrow range (70-150 mg/dL or 3.9 - 8.3 mMol/L) by the inte ⁇ lay among multiple molecules and signaling pathways within the glucoregulatory system.
- Glucoregulatory failure caused by insulin deficiency and resulting in hyperglycemia is the common affliction of diabetes mellitus.
- hypoglycemia is a relatively rare clinical disorder except when it occurs as a side effect of diabetes treatment.
- hypoglycemic effects of insulin and sulphonylureas cannot be overlooked and need to be remedied.
- ⁇ -cells could be engineered to express human glucagon, and made responsive to epinephrine by the expression of ⁇ l- or ⁇ - adrenergic receptors or vasopressin receptors.
- ⁇ -cells could be engineered in such a manner as to decrease the secretion of insulin in response to hypoglycemia.
- the ⁇ -cells are generally engineered to express receptors for agents that will suppress the secretion of insulin, for example glucocorticoid receptors, pancreatic polypeptide receptors and ⁇ 2-adrenergic receptors.
- certain aspects of the present invention are directed towards diabetes therapy that will balance the hyperglycemic effects of loss of ⁇ -cell function and the hypoglycemic effects of insulin therapies, thereby normalizing plasma glucose.
- Additional aspects of glycemic control contemplated for use in the present invention are found in U.S. Provisional Patent Applications Serial Nos. 60/071,193 and 60/087,821 (entitled “Compositions and Methods for Glycemic Control Of Cells”; Attorney Docket Nos. BTGN:042PZ1 and BTGN:042PZ2), filed January 12, 1998 and June 3, 1998, respectively, and U.S. Patent Application Serial No. 09/ , (entitled "Compositions and Methods for
- the regulatory mechanisms that maintain systemic glucose balance involve hormonal, neural and substrate factors. Just as insulin secretion from the ⁇ -cell is complexly regulated, there are multiple hormones and peptides (in addition to insulin) that are involved in the regulation of plasma glucose concentrations including glucagon, epinephrine, cortisol and pancreatic polypeptide. Many of these molecules mediate their effects by direct effects on the pancreatic ⁇ -cell, while others mediate their effects at the levels of hepatic glucose metabolism, dietary glucose abso ⁇ tion, and indirect endocrine effects. The inte ⁇ lay between these signals in maintaining normal glucose balances is discussed in further detail herein below.
- Glucoregulatory hormones include insulin, glucagon, epinephrine, and cortisol.
- Insulin is the major hormone responsible for lowering plasma glucose concentrations (Service, 1983: Marks and Rose, 1981; Cryer, 1988; Cryer et al, 1989). It inhibits glucose synthesis and stimulates glucose utilization (Rizza et al, 1981).
- Pancreatic ⁇ -cells secrete insulin into the hepatic portal circulatory system for effects on the liver and at various peripheral organs. Overall, insulin inhibits gluconeogenesis and glycogenolysis at the liver and converts the liver into an organ of glucose uptake.
- Glucose raising or "glucose counter-regulatory hormones" include glucagon, epinephrine, norepinephrine, pancreatic polypeptide, vasopressin and cortisol.
- Glucagon is secreted by the ⁇ -cells of the pancreatic islets into the hepatic circulation, its physiological site of action being the liver (Service, 1983: Marks and Rose, 1981; Cryer, 1988; Cryer et al, 1989). It potently activates gluconeogenesis and glycogenolysis and mediates a transient increase of hepatic glucose production within minutes. Even in the event of sustained glucagon release, hepatic glucose production returns to basal rates in approximately 90 minutes although the hormone continues to support glucose production (Rizza and Gerich, 1979).
- Glucagon-induce hyperglycemia is transient because the glucagon- induced increase in glycogenolysis does not persists, an effect likely to be due to the glucose induced insulin secretion coupled with the autoregulatory effects of hyperglycemia (Gherrington et ⁇ /., 1981).
- Epinephrine is an adrenomedullary hormone that also mediates a hyperglycemic effect.
- epinephrine It has a dual role in that it stimulates hepatic glucose production and limits glucose utilization.
- the direct and indirect actions of epinephrine are mediated through the ⁇ - and ⁇ -adrenergic mechanisms in humans (Rizza et al, 1980; Berk et al, 1985; Clutter et al, 1988).
- the ⁇ -adrenergic limitation of insulin secretion is an action of epinephrine. It allows the hyperglycemic response to occur, although an increase in insulin secretion in response to increased levels of plasma glucose limits the magnitude of hyperglycemia (Berk et al, 1985; Clutter et al, 1988).
- epinephrine The ⁇ -adrenergic stimulation of glucagon secretion by epinephrine also occurs (Gerich et al, 1976; Gray et al, 1980) but its contribution to hyperglycemic effects of epinephrine are relatively minor (Berk et al, 1985; Clutter et al, 1988). Further, epinephrine also acts directly to increase hepatic gluconeogenesis and glycogenolysis.
- pancreatic polypeptide is secreted by the pp-cells of pancreatic islet cells and has a hyperglycemic effect.
- the pancreatic content of this polypeptide is of a similar order of magnitude as that of glucagon and insulin.
- arginine vasopressin which increases in response to hypoglycemia.
- glucagon plays a central role in promoting glucose recovery in hypoglycemia.
- Epinephrine compensates largely for deficient glucagon secretion.
- Glucose recovery from insulin-induced hypoglycemia fails to occur in the absence of both glucagon and epinephrine.
- glucose counter-regulation can become totally disrupted by combined deficiencies in glucagon and epinephrine.
- the present invention provides an immortal human neuroendocrine secretory cell that may be employed in the treatment, prevention or alleviation of hypoglycemia and/or diabetes.
- Such cells will be especially useful in singular or combination therapy of IDDM in which the glucose counter-regulatory system has been compromised.
- immortalized secretory cells that have a stable neuroendocrine phenotype will be used to provide a counter to the hypoglycemic effects of insulin by providing hyperglycemic factors or novel ways to inhibit insulin secretion. In particular embodiments, this will entail the expression and secretion of glucagon.
- the present invention will entail the surface expression of ⁇ - or ⁇ -adrenergic receptors which will promote the hyperglycemic effects of epinephrine and epinephrine-related compounds, e.g., norepinephrine on insulin-secreting cells.
- the present invention will in particular aspects employ immortal human neuroendocrine cell lines to secrete hormones or express polypeptides that will be useful in glucose regulation and counter-regulation, in order to achieve a physiologically normal glucose concentration in disorders such as diabetes.
- cells will be engineered to be phenotypically like pancreatic ⁇ -cells in that they are glucagon secretory cells.
- Such cells may be engineered to express and secrete glucagon, or will have express receptors that will augment, increase or otherwise enhance the production of endogenous glucagon, in response to hypoglycemia.
- cells will be engineered to be phenotypically like pancreatic ⁇ -cells.
- Such cells will express and secrete insulin, and regulators of insulin secretion, such as GLUT-2 and glucokinase.
- these cells will be engineered to express polypeptides that will suppress, decrease or otherwise down-regulate insulin production or action in response to hypoglycemia.
- the ⁇ -cells will have glucose sensing capacity in the form of GLUT-2 and glucokinase expression as described in U.S. Patent 5,427,940.
- the cell can be a pancreatic ⁇ -cell or a cell that is a glucagon secreting cell.
- the regulated pathway of the ⁇ -cell encompasses both acute regulation of polypeptide secretion (i.e., a large increment between the unstimulated and stimulated states) and the complete processing of polypeptide.
- secretory granules allow the storage of insulin as a depot at the plasma membrane that can be released within seconds of arrival of a fuel-derived or hormonal signal, and also serve as the site of conversion of proinsulin to insulin by virtue of their high concentrations of the relevant convertases PCI (also known as PC3) and PC2.
- PCI also known as PC3
- PC3 the relevant convertases
- the presence of secretory granules and retention of proinsulin processing capacity represent a major advantage of insulinoma and other neuroendocrine cell lines relative to cells less specialized for secretion of peptide hormones such as hepatoma cells or fibroblasts.
- a second parameter is that the cell may be equipped with a capacity for secretagogue sensing and responsiveness.
- the cells able to sense the glucose concentration of their environment are preferred.
- U.S. Patent 5,427,940 inco ⁇ orated herein by reference) described engineering this capacity into cells.
- engineered cell lines retain phenotypic and genotypic stability. This includes both genes that are inserted or deleted during the course of engineering and key endogenous genes. As discussed herein, this is a significant limitation on current technology.
- a variety of host cells are contemplated to be useful as the starting cells that will be engineered to provide the therapeutic expression of the polypeptides discussed herein.
- secreted polypeptides such as glucagon it will be desirable, for the polypeptide to be released from cells in response to the hypoglycemic environment of the cell.
- insulin secreting cells it will be desirable to provide these cells with glucose and counter- regulatory sensing capacities such that in hypoglycemic conditions the insulin secretion can be down-regulated.
- the polypeptide is a receptor
- the immortalized human neuroendocrine cells and cell lines that retain the characteristics of the primary cell are the preferred starting material.
- the instant cells and cell lines overcome the failures of previous attempts at immortalization of human pancreatic ⁇ -cells, which have resulted in cell lines that do not retain the defining properties of the primary ⁇ -cell, such as the capacity to synthesize insulin and secrete it from the regulated secretory pathway.
- Regulated secretory cells present a natural bioreactor containing specialized enzymes involved in the processing and maturation of secreted proteins. These processing enzymes include endoproteases (Steiner et al, 1992) and carboxypeptidases (Fricker, 1988) for the cleavage of prohormones to hormones and PAM, an enzyme catalyzing the amidation of a number of peptide hormones (Eipper et al, 1992). Similarly, maturation and folding of peptide hormones is performed in a controlled, stepwise manner with defined parameters including pH, calcium and redox states.
- a cell specialized for secreting proteins via a regulated pathway also can secrete proteins via the constitutive secretory pathway. Many cell types secrete proteins by the constitutive pathway with little or no secretion through a regulated pathway.
- secretory cell defines cells specialized for regulated secretion, and excludes cells that are not specialized for regulated secretion.
- the regulated secretory pathway is found in secretory cell types such as endocrine, exocrine, neuronal, some gastrointestinal tract cells and other cells of the diffuse endocrine system.
- the origin of the starting cells for use in the present invention thus include human tissues and tumors of neuroendocrine lineages that have a well defined regulated secretory pathway. Cells with defined conditions for culturing ex vivo with some replicative capacity are also preferred. Neuroendocrine cells, such as pancreatic ⁇ cells, pancreatic ⁇ -cells and pituitary cells are preferred for use in the present invention. Examples of such cells are shown in Table 1 (Pearse and Takor, 1979; Nylen and Becker, 1995).
- the neuroendocrine cells of the invention will preferably secrete one or more of the endogenous secretory polypeptides listed herein in Table 1.
- Stable ⁇ cells that secrete glucagon will be preferred in certain aspects of the invention, with cells that secrete correctly processed human glucagon being more preferred. Also preferred will be those cells that express receptors for providing control of glucagon secretion.
- the stable ⁇ -cells of the invention also may advantageously be engineered to express ⁇ 2-adrenergic receptors, pancreatic polypeptide receptors, vasopressin receptors, glucocorticoid receptors and the like.
- engineered ⁇ -cells will further express insulin as well as glucose sensing genes such as GLUT-2 and glucokinase as described in U.S. Patent 5,427,940.
- pancreatic ⁇ -cells In addition to pancreatic ⁇ -cells, pancreatic ⁇ -cells also are preferred for use in the present invention. These cells will be engineered for glucagon expression and secretory capacity into the starting cells disclosed herein above. Alternatively, the endogenous glucagon secretion of these ⁇ -cells will be augmented using stimulation by epinephrine and epinephrine related molecules such as norepinephrine and clonidine. Such epinephrine stimulatory phenotype may be engineered into the ⁇ -cell by providing the cell with the ability to express an adrenergic receptor. More particularly the cell will express an ⁇ -adrenergic receptor, in even more preferred embodiments the cell will express an ⁇ l -adrenergic receptor.
- epinephrine stimulatory phenotype may be engineered into the ⁇ -cell by providing the cell with the ability to express an adrenergic receptor. More particularly the cell will
- glucose counter-regulation is a term that refers to the effects on the glucose metabolism that are opposite to those mediated by insulin. As such glucose counter-regulation refers to the correction of hypoglycemia or the prevention of hypoglycemia. Thus, a factor that mediates glucose counter-regulation reduces insulin secretion and raises the glucose level from hypoglycemic toward hyperglycemic, but more preferably towards the normal physiological glucose levels.
- a glucose counter-regulatory hormone is defined as one that responds to hypoglycemia either with alterations in the plasma levels or activity. Most often it is envisioned that such hormones will increase in levels or activity in response to hypoglycemia. These hormones can include those known to be directly glucose counterregulatory such as epinephrine, glucagon, pancreatic polypeptide, vasopressin, and cortisol, and also includes hormones that are glucose counterregulatory by indirect mechanisms such as growth hormone, various neuropeptides, ACTH, somatostatin, and so on. It is also within the scope of this invention to engineer secretory functions into cells for novel mechanisms of glycemic control.
- he effect of overexpression of various receptors and/or channels on insulin-secreting cells may improve the regulation of secretion to minimize inappropriate release of the peptide under hypoglycemic conditions.
- Any receptor or channel that affects membrane polarization, especially to hype ⁇ olarize, will impact secretory function.
- alpha-2 adrenergic receptor ATCC number 59303, HPalpha2GEN Genbank accession numbers Ml 8415, M23533, inco ⁇ orated herein by reference
- glucagon-like peptide I receptor Genbank accession numbers: L23503, U10037, UOl 156, UOl 104: each inco ⁇ orated herein by reference
- somatostatin receptor V mouse Genbank accession number AF004740; human Genbank accession numbers: L14865, L14856, M81830, M96738, M81829, L07833 each inco ⁇ orated herein by reference
- SUR channel Genbank accession numbers L78207, U63455, L78243, inco ⁇ orated herein by reference
- KIR channel pancreatic polypeptide receptor
- the cells of the present invention may be employed to screen for other such compounds.
- Glucose is the most important stimulator of insulin secretion, not only because of its potent direct effects but also because it is permissive for the stimulatory action of a wide array of other secretagogues. While there is good evidence to suggest that glucose exerts its effect through its own metabolism, resulting in the creation of signals that appear to work through modulation of ion channel activities and influx of extracellular Ca 2+ , the exact nature of the metabolic coupling factors remains unknown. The magnitude of the insulin secretory response appears to be related to the rate of ⁇ -cell glucose metabolism, and both parameters are sha ⁇ ly increased in response to modest increments in extracellular glucose concentrations within the physiological range of 4 to 8 mM.
- ⁇ -cells are equipped with the glucose transporter GLUT-2 and the glucose phosphorylating enzyme glucokinase which have kinetic properties, particularly a relatively low affinity for glucose, that are ideal for modulation of glucose responsiveness at the relatively high concentrations of the sugar encountered in the circulation (Newgard and McGarry 1995).
- the present invention also provides for the testing of candidate substances for their ability to modulate secretory function of cell in in vivo contexts.
- This approach has the added advantage of assessing (i) the function of cells under normal, physiologic conditions including the presence of various intercellular signaling mechanisms and (ii) the ability of candidate substances to target cells local, regional or distal to their site of administration and (iii) localization and/or tissue distribution of a secreted metabolite or downstream effector metabolite. Different formulations including time release compositions also may be assessed.
- this format permits testing on the basis of physiologic states rather than the mere increase or decrease of secretory function. This provides additional information on the actual potential therapeutic benefit of the substance for the host, testing of therapeutic vs. toxic concentrations to establish therapeutic ranges and drug safety parameters, as well as allowing for in vivo interactions to be monitored.
- the preferred embodiment for in vivo screening of candidate substances involves the use of a nude rodent model.
- the nude mouse lacks immune functions that might compromise or interfere with testing of implanted cells of the present invention.
- This system is well characterized and is used for a variety of other pu ⁇ oses including a model of transplanted human cancer.
- Yet another preferred model is one in which the animal has diabetes (IDDM or NIDDM).
- immortalized secretory cells of the present invention will be transferred, as part of an implantable device (described elsewhere in this document) into a suitable site of the host animal.
- a suitable site of the host animal typically, subcutaneous implant on the flank, back or hindlimb of the animal, or intraperitoneal insertion, is preferred.
- Particular issues that will affect the choice of implantation site include (i) similarity to the normal site the cells might be found or implanted clinically and (ii) the importance of establishing a supporting vasculature structure for the implant.
- the initial step involves the determination of steady state levels of any metabolite that will be used as a read-out for effects on modulation of the implanted cells. This often will involve taking peripheral blood measurements of the metabolite of interest. Such metabolites include, but are not limited to, glucose, insulin, glucagon, GLP-1, amylin, leptin, somatostatin and growth hormone. Alternatively, one may assess functional attributes of the animal such as alteration in blood glucose in the case of insulin and loss of body fat in the case of leptin. Other parameters that could be monitored include, in body weight, food intake, blood pressure, metabolic rate, body temperature, serum minerals, etc.
- the candidate substance is administered.
- the candidate substance formulated in a pharmacologically acceptable fashion, will be administered to the animal. Suitable routes include oral, rectal, vaginal, buccal, topical, inhalation or intravenous or intraarterial injection. Also contemplated are intramuscular, intraperitoneal, intraocular, subcutaneous or submucosal administration.
- the metabolite will be tested from the appropriate tissue or fluid from the host animal. Fluids include blood, lymph, saliva, sputum, feces, urine, semen or tears.
- Tissues that may be sampled include liver, brain, muscle, pancreas, spleen, testis, ovarian, stomach, intestine, endocrine glands, adrenal glands and kidney.
- different methodology also described above, will be used to separate and identify the presence, quantity and/distribution of the metabolite.
- histologic examination involving microscopy, may be performed. Modulation of the metabolite or function, in the presence of the candidate substance, as compared with the levels determined prior to provision of the candidate substances, will indicate that the candidate substance is a modulator of that metabolite or function.
- rescue of the implant may be performed for the pu ⁇ ose of determining the secretory status of the implant cells. Any change in the behavior or characteristics of the cells could impact the results.
- Proper controls will include animals implanted with empty devices and animals implanted with devices populated with "placebo" (non-responsive, non-secretory) cells.
- ⁇ G 498/20, ⁇ G 498/44, and ⁇ G 498/45 were studied for the capacity to secrete insulin from the regulated pathway and respond to modulators of secretion.
- Cells were plated in 12- well tissue culture dishes (250,000 cells/well), maintained for 72 hr in BetaGene Medium, and washed twice, 20 min each, in HEPES/bicarbonate-buffered salt solution (HBBSS; in mmol/1: 114 NaCI, 4.7 KC1, 1.21 KH 2 PO 4 , 1.16 MgSO 4 , 25.5 NaHCO 3 , 2.5 CaCl 2 , 10 mM HEPES) supplemented with 0.1% BSA but lacking glucose.
- HEPES/bicarbonate-buffered salt solution HEPES/bicarbonate-buffered salt solution
- Insulin secretion was stimulated by incubating the cells for 2 hr in HBBSS containing 0.1% BSA and supplemented with 10 mM IBMX, 100 ⁇ M carbachol, or 10 nM of the phorbol ester, PMA; all in the presence or absence of 10 mM glucose.
- ⁇ G 498/20 respond robustly to carbachol and PMA (about 10- to 15-fold over basal), however, the cells were unresponsive to glucose and IBMX.
- ⁇ G 498/44 and ⁇ G 498/45 were nearly identical in their secretion profiles as compared to ⁇ G 498/20. These data are consistent with the presence of a regulated secretory pathway; and it appears that protein kinase C-mediated events dominate in the regulation of secretion.
- these lung neuroendocrine cell lines do not mimic the response of pancreatic ⁇ -cells or ⁇ -cell lines to glucose alone or the glucose-potentiator, IBMX.
- ⁇ G 498/45 was further engineered for increased levels of insulin expression by the introduction of a number of plasmids, all of which encoded human insulin but varied in the genes encoding antibiotic resistance.
- the 793, 794, and 796 cell lines are resistant to mycophenolic acid, puromycin, and hygromycin, respectively.
- the data in FIG. 2B show the presence of a regulated secretory pathway in the progenitor cell line (498/45) and the maintenance of this capacity through a second round of engineering (793, 794, and 796 cell lines). Insulin content and secretion were increased by about 3- to 4-fold in second generation clonal cell lines.
- the insulin secreted from two of these high-producing clones (793/28 and 793/15) was fractionated by high-performance liquid chromatography, and immunoreactive insulin species were quantified by radioimmunoassay using human insulin standards.
- Proinsulin was effectively processed to mature insulin, with mature insulin representing the majority of the total insulin in media extracts.
- ⁇ G H03 cells have been engineered to express glucagon like peptide 1 (GLP-1) and human growth hormone (hGH).
- GLP-1 glucagon like peptide 1
- hGH human growth hormone
- the human neuroendocrine cell line ⁇ G H04 was stably transfected with BetaGene plasmid AA603 (SV40 driving the expression of neomycin phosphotransferase and CMV driving expression of human insulin) resulting in monoclonal cell lines ⁇ G 707/55, 707/63, 707/76, 707/94 and 707/96.
- the clonal cell lines were studied for their ability to secrete insulin in response to various modulators of secretion, as previously described. In each of the 5 clonal cell lines insulin secretion did not change with respect to basal in response to stimulation by 10 mM IBMX, 100 mM carbachol, or 10 nM PMA and 10 mM glucose.
- FIG. 3 illustrates the secretion response of ⁇ G 707/55, 63, 76, 94, 96 clones and the clonal derivative of ⁇ G H03 ( ⁇ G 498/45) to the secretagogue cocktail described above.
- ⁇ G 498/45 cells secrete in excess of 500 ng/flask/hour of insulin.
- ⁇ G 707 clonal lines secrete a negligible amount of insulin under these conditions.
- Cell content of ⁇ G 707/55 was analyzed by HPLC for insulin. A small proinsulin peak was detected, however no mature insulin was detected within these cells.
- BetaGene plasmid CD303 (CMV driving expression of human growth hormone, SV40 driving neomycin resistance) was used to establish cell lines resistant to G418.
- the monoclonal cell line ⁇ G 785/5 was analyzed for cell content versus secreted human growth hormone on a Western blot. The results indicated a small fraction of human growth hormone stored within the cells and a large fraction of this peptide in the medium.
- ⁇ G H04 cell line despite the presence of multiple proteins associated with a neuroendocrine phenotype, is not a preferred candidate for secretion of transgenic peptides from the regulated secretory pathway.
- These cells use a constitutive mode of secretion, rather than a regulated secretory pathway, perhaps due to an inability to depolarize the cell membrane or an absence of dense core granules for peptide storage.
- ⁇ G H04 cells do not process insulin to its mature form.
- fusion proteins containing a furin site between a given prohormone sequence and the sequence encoding the mature peptide hormone may provide the capacity for processing of the transgenic fusion protein through the constitutive pathway that apparently dominates secretion from these cells.
- the overexpression of PCI and/or PC2 proteins involved in granule formation such as chromagranin A and chromagranin B, or proteins required for trafficking through the regulated secretory pathway such as carboxypeptidase E may be required for restoration of a functional regulated secretory pathway in the ⁇ G H04 cell line.
- Carboxypeptidase E is a particularly attractive candidate, as carboxypeptidase E is not expressed in ⁇ G H04 cells.
- a two-step transformation procedure has been devised to create a human ⁇ -cell line (FIG. 4).
- Preferred starting materials consist of either a surgically removed human neuroendocrine tumor such as an insulinoma, or isolated primary tissue such as human islets.
- the ⁇ -cells in these tissues proliferate at a very slow rate, therefore, the first step is to get them to grow. This is accomplished by infecting insulinomas and/or islets with a recombinant adenovirus expressing an oncogene under the control of the rat insulin 1 gene promoter (RIP).
- RIP rat insulin 1 gene promoter
- Adenovirus is the preferred viral vector because it infects and expresses the transgene in nondividing cells. RIP selectively expresses the oncogene, in this case, temperature sensitive SV40 T-antigen (tsTAG), in only ⁇ -cells. In response to tsTAG expression, the ⁇ -cells proliferate while other cell types remain quiescent.
- tsTAG temperature sensitive SV40 T-antigen
- the adenovirus does not integrate into the genome and thus advantageously does not provide long-term expression of tsTAG. Following this initial transformation, a second transformation step is required.
- the second step is to immortalize the proliferating ⁇ -cells by infection with a recombinant retrovirus also expressing an oncogene like tsTAG under the control of RIP. Retroviruses require cellular division in order to integrate into the genome. Once integrated, the transgene is stably expressed resulting in an immortalized cell.
- EXAMPLE 4 Culturing of Human Insulinomas
- the present invention contemplates the use of cell lines derived from human insulinomas as starting cells for the instant methods to produce immortalized human neuroendocrine cells. This example describes the culturing of human insulinomas.
- tissue culture medium BetaGene medium supplemented with 3.5% fetal bovine serum (FBS), 200 U penicillin/streptomycin, and 50 ⁇ g/ml gentamycin).
- FBS fetal bovine serum
- 50 ⁇ g/ml gentamycin 50 ⁇ g/ml gentamycin.
- the tissue is kept on ice and sterile, keeping the transit time to less than 30 minutes.
- the tissue is minced with iris scissors until it is reduced to pieces 1 mm or smaller.
- the tumor is then transferred to 40 mesh tissue sieve through which the large pieces are forced using rubber pestle.
- the cells are then washed twice for a period of 15 minutes each with fresh culture media containing antibiotics.
- the tissue is then split onto standard Falcon tissue culture dishes and dishes coated with matrigel extracellular matrix.
- the tissue is maintained under standard tissue culture atmospheric conditions of 37°C; 5% CO 2 /95% air; and humidified.
- the tissue is then cultured with media composed of 30% conditioned tissue culture media (BetaGene medium containing 3.5% fetal bovine serum (FBS) conditioned by culture with ⁇ G 261/13, a rat ⁇ -cell line stably transfected with pCB6 (CMV promoter and neo resistance marker) expressing the full length human growth hormone coding region), 70% BetaGene Medium, 1% FBS, 50 ⁇ g/ml gentamycin.
- BetaGene medium containing 3.5% fetal bovine serum (FBS) conditioned by culture with ⁇ G 261/13, a rat ⁇ -cell line stably transfected with pCB6 (CMV promoter and neo resistance marker) expressing the full length human growth hormone coding region
- IEQ islet equivalents
- An islet equivalent is the number of cells/volume that is found in an islet with a diameter of a 150 ⁇ m. Insulin content and secretory response of the islets were assayed first upon receipt and second after culture in BetaGene medium. Proper insulin processing was also analyzed before and after culture in BetaGene medium.
- Islet prep suspensions were spun down in a bench top centrifuge at 1000 ⁇ m for 2 minutes at room temperature to pellet the cells.
- the shipping medium was aspirated leaving approximately 5 ml behind to avoid disrupting the pellet.
- the pellets were resuspended in the remaining 5 ml medium and transferred to a new 50 ml conical tube.
- the samples were spun down a second time, all but 5 ml of the medium was aspirated, and a fresh aliquot of BetaGene medium with supplements was added and allowed to incubate for another 15 minutes. After the second and final incubation, the islets were spun down and all of the medium was removed. The pellet was resuspended in complete BetaGene medium at a density of 1000 IEQ per milliliter.
- Islet cells do not divide in culture and may be overrun by various replicating cells which are present in islet preps as shipped. Encapsulating the cells immediately upon receipt minimizes the growth of fibroblasts and other cell types.
- the islets were resuspended in a 2% sodium alginate solution (50% high viscosity and
- each islet preparation was used to assess insulin content of the islets upon receipt.
- Prior to culture in BetaGene medium 2000 IEQ were removed from the stock and spun down to pellet the islets. The medium was removed completely without disturbing the cell pellet.
- the islets were washed one time with phosphate-buffered saline (PBS) and spun down. The pellet was dispersed in 0.5 ml content buffer (1M acetic acid, 0.1% BSA) and frozen at -80°C.
- the cells were thawed, sonicated (3 bursts at setting 5-6 on a Fisher Scientific 60 sonic dismembrator) and the insoluble debris were pelleted at 14,000 ⁇ m for 10 minutes at 4°C. The supernatant was then transferred to a clean tube and a portion was analyzed by HPLC.
- Encapsulated islets were cultured in BetaGene medium and fed 3 times weekly. The islets were removed from the alginate to extract the insulin content. To recover the islets, the beads were incubated in 6 mM EDTA/10 ml BetaGene medium and the alginate was dispersed by pipetting until the mixture became homogeneous. The mixture was centrifuged at 1/2 speed in a benchtop centrifuge for 5 minutes, the supernatant with alginate was removed and the islets washed with 10 ml PBS/2 mM EDTA. The solution was spun again and the pellet was resuspended in 5 ml PBS to remove EDTA, spun again and resuspended in content buffer for analysis by HPLC as described above.
- Alginate encapsulated islets were cultured in 24 well plates for at least 4 days, with about 50 IEQ/well (or 5 beads) in 2 ml of medium. The day before the study the culture medium was replaced with fresh medium. The day of the study the islets were equilibrated for 90 minutes with BetaGene Medium with low glucose. The medium was then removed and replaced with 1 ml of RPMI without glucose, or Modified BetaGene Medium, (manufactured without glucose), that was supplemented with glucose to provide concentrations between 2.2 and 22 mM glucose, and 22 mM + IBMX. The islets were then incubated at 37°C for 90 minutes and samples collected at the end of 90 minutes for assay of insulin. Each experimental value usually represents results from 6 replicate wells. The glucose concentration providing 50% of maximal stimulation (Stim-50) was calculated from the fitted line of the glucose dose-response curve.
- the serum requirements of human islets were tested in long term (about 2 months) cultures supplemented with various amounts of serum, 1%, 3.5%, or 10% FBS and 5% horse serum (ES). In four independent isolations the average daily insulin output for 60-90 days was minimally affected by amount of serum supplementation. However, the overall tendency was for higher FBS to yield lower output. Similarly, in an acute secretion experiment, insulin secretion from islets cultured in 10% FBS exhibited lower response to glucose or to a stronger mixed secretagogue stimulus (FIG. 7). The sustained insulin output from human islets with 1% FBS supplementation (in BetaGene Medium) suggested that human islets may also secrete insulin and survive under serum-free conditions.
- BetaGene Medium The capacity of BetaGene Medium to sustain the dose-responsive nature of the insulin secretory response was evaluated with continuous cultures. Human islets were stimulated with varied glucose concentrations at intervals to monitor secretory changes that may occur with time. It has been previously noted that the capacity of human islets to respond to glucose is impacted by isolation methods and conditions, in particular, cold ischemia time. Cold ischemia of the preparations studies varied between 10 and 22 h. Variables related to donors and isolations produce considerable variation among islet isolations. As a result, the magnitude of response is not found with all preparations. However, a common finding was an initially poor response, with increased function with time of culture in BetaGene Medium, and a maintained capability to secrete insulin in response to glucose for times >4 months (FIG. 9).
- the sustained secretory function for months in culture was also accompanied by maintained insulin content and insulin processing. This is illustrated with both islets that have initially low or initially high insulin contents, and with islets that initially exhibit minimal insulin processing capacity.
- the insulin content of islets from HI28 was low upon arrival, 0.3 ⁇ g/lOOO IEQ with >90% mature, processed insulin.
- the insulin content of mature, processed insulin with HI28 islets cultured 1.5 months in BetaGene Medium was increased 4 fold to 1.3 ⁇ g/1000 IEQ.
- the final insulin content was 4.97 ⁇ g/1000 IEQ, with 89% mature, processed insulin.
- FIG. 10A shows the fractionation of insulin extracted from islets of HI21. Initially, 99% of the insulin was unprocessed insulin, with only 29 ng mature insulin/1000 IEQ. The mature insulin content was increased 18-fold to 512 ng/lOOO IEQ after 4 weeks of culture in BetaGene Medium; this represents >90% of the insulin content (FIG. 10B).
- Another islet preparation initially making only proinsulin upon arrival was HI27. Prior to culture, essentially 100% of the insulin content was proinsulin. HI27 islets were cultured 8 weeks, and then insulin content was fractionated by HPLC. With this isolation as well, islets had regained the capacity to process insulin.
- tsA58 A temperature-sensitive mutant of the SV40 large T antigen, tsA58 (Bourre and Sarasin 1983) was isolated from pBS/tsA58.
- the tsA58 coding region (tsTAG) was isolated by partial digestion with Hpal, treatment with Klenow fragment, followed by digestion with EcoRI.
- the resulting 2532 base fragment (S ⁇ Q ID NO: 1) was ligated into pCMV8/IR ⁇ S/Neo (Clark et ah, 1995) previously digested with BamHX, Klenow treated, then digested with EcoRI.
- the resulting expression plasmid expresses a bicistronic message driven by the human cytomegalovirus promoter with the tsTAG upstream of the G418 resistance gene. Drug resistance to G418 results from translation of the downstream Neo gene due to the internal ribosome entry site (IRES, Macejak and Sarnow, 1991).
- a second tsTAG expression plasmid was constructed in which the CMV promoter was replaced with the rat Insulin 1 promoter (RIP).
- pCMV/tsTAG/IRES/Neo was digested with Spel and EcoRI, removing the CMV promoter, and replaced with RIP on a 440 bp Spell 'EcoRI fragment derived from pRIP7/TNS (Clark et ah, X 996), generating pRIP/tsTAG/IR ⁇ S/Neo.
- tsTAG Recombinant adenoviruses expressing tsTAG under the control of either the RIP promoter or the CMV promoter were constructed.
- the tsTAG encoding fragment was isolated from pCMV/tsTAG/IR ⁇ S/Neo by digestion with Sail, treatment with Klenow fragment, followed by EcoRI digestion. The fragment was ligated into pAC/RIP that had been digested with BamHl, Klenow treated and digested with EcoRI, generating pAC/RIPtsTAG.
- pAC/CMVtsTAG was constructed by removing tsTAG from pBS/tsA58 and ligating into pAC/CMV to produce pAC/RIPtsTAG.
- Retroviral expression plasmids were constructed in order to produce recombinant retroviruses capable of expressing tsTAG under the control of the tissue-specific rat insulin promoter.
- a fragment containing RIP/tsTAG was isolated from pRIP/tsTAG/IRES/Neo by digestion with Sail, Klenow treatment followed by Spel digestion. This fragment was ligated into pBS/hGH PolyA that had been treated with Xbal, Klenow treated and digested with Spel, generating pBS/RIP/tsTAG/hGH PolyA.
- the hGH PolyA sequence in pBS/hGH PolyA is a 625 base sequence which directs efficient transcriptional termination and polyadenylation of mRNAs.
- pBS/RIP/tsTAG/hGH PolyA was digested with Sacl, Klenow treated, followed by digestion with Sail allowing isolation of a RIP/tsTAG/hGH PolyA containing fragment.
- This fragment was ligated into two retroviral plasmids, pBabeNeo and pBabePuro (Morgenstern and Land 1990), following digestion with SnaBl and Sail, generating pBabeNeo/RIPtsTAG and pBabePuro/RIPtsTAG, respectively.
- E6/E7 genes (Genbank accession number K02718) were cloned into the viral vector backbone
- E6/E7/LXSN was then introduced into the PA317 packaging cell line (Osborne et ah, 1990) to produce replication-defective recombinant retrovirus.
- the full length IGF-1 receptor mRNA (Genbank accession number: X04434) was reverse transcribed and amplified by the polymerase chain reaction (RT-PCR).
- Total RNA was isolated from A549 cells using RNAzol B RNA isolation reagent (Cinna/Biotex Laboratories International).
- RT-PCR was performed using SuperscriptTM Preamplification System (Life Technologies) followed by amplification with High Fidelity Platinum Taq polymerase (Life Technologies).
- the IGF1 receptor cDNA was gel purified and cloned as an EcoRIAB ⁇ mH ⁇ fragment into EcoRI/Zf ⁇ /wHI digested CW102 resulting in plasmid DM202.
- tsTAG Cell-specific transcription of tsTAG was determined for both pBABE/Neo/RIPtsTAG and pXTl/RIPtsTAG (construction of these plasmids is detailed in Example 6) in RIN cells and in 293 human fibroblast cells.
- the retroviral plasmids were stably transfected into both cell types, and levels of tsTAG mRNA and protein were determined by Northern and Western blotting, respectively. Significant levels of tsTAG mRNA and protein were detected in RIN cell extracts containing either retroviral plasmid, whereas no expression of tsTAG mRNA or protein was observed in 293 cell extracts containing either retroviral construct.
- RIN 1046-38 cells were infected with adeno/RIP-tsTAG at varying multiplicities of infection (MOI). The virus was left on the cells for 2 hours then washed off and the cells received fresh medium. The infected cultures were incubated at 37°C for 48 hours, and then were shifted to 33.5°C for an additional 48 to 72 hours. The cells were washed with PBS and then fixed in Carnoy's fixative for immunocytochemistry using an anti-TAG antibody (Santa Cruz Biotechnology) to detect TAG expression. Approximately 10 to 20% of the RIN cells were intensely stained for TAG expression at MOIs of approximately 30 to 300 viral particles per cell.
- MOI multiplicities of infection
- recombinant plasmids utilizing the insulin promoter engineered for enhanced activity are constructed (see Example 8). These constructs provide ⁇ -cell specific expression of the oncogene, and in the case of the insulin promoter with enhanced function, also provide a level of gene expression nearly equivalent to that achievable with the CMV promoter.
- the media was aspirated off 6 well cluster dishes containing primary cultures of islets with the cells well attached to dishes. Then 2 ml of Ml 99 media/ 10% FBS containing lOOO pfu/cell was added (estimating 500,000 cells from 500 islets and 5 x 10 8 pfu/2 ml media). The sample was incubated at 37°C for 1 hour, the media was aspirated, and then 6 ml of Ml 99/4% FBS was added. The sample was cultured for 24 hours, and then expression was checked.
- CMV is a more efficient gene promoter in cultured rat islet cells than the rat insulin promoter, although at this time it cannot be ruled out that the difference in ⁇ -gal expression under these promoters was due to differences in the titer of viable adenovirus used to infect the islet cultures. It was also observed that fibroblasts stained for the presence of ⁇ -galactosidase in cultures infected with pAC-CMV- ⁇ -gal but did not stain in cultures infected with pAC-RIP- ⁇ -gal, indicating a specificity for RIP promoter expression in islet ⁇ -cells. These studies demonstrate the feasibility of maintaining primary cultures of islet tissue and using adenovirus expression systems to modify protein production of these cultures. D. Expression in Neuroendocrine Cells Using the ⁇ -glycoprotein Promoter
- the pituitary gland secretes a number of different hormones including leutenizing hormone (LH), thyroid stimulating hormone (TSH) and follicle stimulating hormone (FSH) using a regulated secretory pathway.
- LH leutenizing hormone
- TSH thyroid stimulating hormone
- FSH follicle stimulating hormone
- Each of these hormones contain an alpha and beta subunit.
- the beta subunits are expressed only in the appropriate pituitary cell types, giving specificity to each hormone.
- the alpha subunit, called ⁇ -glycoprotein is common to all pituitary hormones and is expressed in all pituitary cell types. Although expression of this protein is fairly ubiquitous in the pituitary, it is postulated to be specific to neuroendocrine cell types only.
- the ⁇ -glycoprotein promoter may aid in expression of transforming proteins within neuroendocrine cells only and not within non-neuroendocrine cell types which may be also be present in the culture or tumor.
- the ⁇ -glycoprotein promoter (Genbank accession number LO5632) was amplified by PCR from human liver DNA (Clontech) using Taq Plus Long (StrataGene). Oligonucleotides AT255 (5' GGGGAACTAGTAAACTCTTTGTTGAAG 3'; SEQ ID NO: 14) and AT256 (5' CTCAGTAACTCGAGTTAATGAAGTCCT 3'; SEQ ID NO: 15) were used in 40 rounds of PCR with denaturation at 94°C (30 sec), annealing at 55°C (30 sec) and extension at 72°C (2 min) to amplify the promoter.
- BetaGene plasmid BL436 CMV-neo
- BetaGene plasmid DM102 ⁇ -gly coprotein-neo
- AtT20, RIN38, and H03 cells were transfected with BetaGene plasmids BL436 (CMVneo), BY428 (RIPneo) and DM102 ( ⁇ -glycoprotein-neo) by electroporation as described herein. Clones resistant to G418 were counted after 13 days of selection. Pituitary cells (AtT20) transfected with BY428 did not survive selection with G418. DM102 created about 75% fewer clones than BL436 in the same cell line. In RJN38 (rat insulinoma) and H03 (human neuroendocrine) cells, DM102 colony formation was equivalent to BY428 with BL436 creating 75% more clones. These data indicate that the ⁇ -glycoprotein promoter provides neuroendocrine-specific gene expression. EXAMPLE 8 Modified Insulin Promoters
- FF minienhancer Far-FLAT minienhancers
- oligonucleotides are BamHl and BgHl recognition sites.
- the oligonucleotides were annealed and ligated in the presence of restriction enzymes BamRl and Bglll. Since BamHl and Bgl ⁇ l produce compatible DNA ends but can no longer be digested by BamHl or Bgl ⁇ l, the only multimers that escaped BamHl and BgHl digestion were ligated head-to-tail.
- FFE minienhancers in which the three italicized bases in SEQ ID NO:5 and SEQ ID NO:6 above were mutated are called FFE minienhancers.
- FFE minienhancers are constructed essentially as described above by generating oligonucleotides corresponding to the region of
- TAATC7A ⁇ T7ACCCTAGGTCTAA-3' top strand; SEQ ID NO:7);
- FFE minienhancers were shown to be more active than FF minienhancers when both are attached to a minimal promoter (German et al. 1992a).
- FF and FFE minienhancer dimers, trimers, etc. were separated by polyacrylamide gel electrophoresis and blunt-end cloned into the transient transfection vector, pBS/RIP/hGH, at either a Xhol site immediately upstream of -415 of the intact RIP, into an Avrll site at -206 of an intact RIP, or into an Apal site immediately upstream of -205RIP.
- the number and orientation of minienhancer repeats were verified by DNA sequencing.
- FF and FFE minienhancer/RIP-hGH constructs were transiently cotransfected along with Rous sarcoma virus-chloramphenicol acetyltransferase (RSV-CAT), an internal control plasmid used to monitor differences in transfection efficiencies, into 1 x 10 RIN cells by electroporation (Chu and Berg 1987) as modified by Bassel-Duby et al. (1992).
- the cells were incubated overnight in 199 medium containing 5 mM butyrate. The next day 199 medium containing butyrate was removed and new medium without butyrate was placed on the cells. After 48 to 96 hours, expression of the transfected genes was measured by hGH protein accumulation in the culture medium (Selden et al.
- the stable transfection vector, pFFE3/RIP8/TNS/IRES/NEO containing three copies of FFE minienhancers was generated by inserting a blunt-ended KpnllHin ⁇ lll FFE3/RIP into pCMV8/INS/IRES/NEO in which the CMV promoter was removed with Spel and S ⁇ cl.
- pFFE6/RIP8/TNS/IRES/NEO was constructed by inserting an ⁇ l/blunt-ended H dIII FFE6/RIP fragment into pRIP8/hG ⁇ polyA in which RIP was removed by Apal/EcoRV.
- a BgHllStul INS/IRES/NEO fragment was then inserted into pFFE6/RIP8/hGH polyA to complete pFFE6/RIP8/INS/IRES/NEO.
- RlPi rat insulin 1 gene intron
- RlPi was obtained by polymerase chain reaction from rat genomic DNA using oligonucleotides 5 * -CTCCCAAGCTTAAGTGACCAGCTACAA-3' (SEQ ID NO:9) and 5'-GGGCAA CCTAGGTACTGGACCTTCTATC-3' (SEQ ID NO: 10). These oligos produced a 185 bp product containing the 119 bp RlPi (Cordell et al. 1979) and a H dIII site on the 5' end and a BamHl site on the 3' end.
- the PCR product was digested with H dIII and BamHl and ligated into pNoTA/T7, whereupon it was removed with Xbal blunt-ended with Klenow/H dIII and inserted into EcoRV/Hwdlll digested pRIP8/TNS/TR ⁇ S/N ⁇ O to generate pRIP8/RIPi/INS/IRES/NEO.
- pFFE6/RIP8/RIPi/INS/IRES/NEO was constructed by replacing the 5' adenovirus-immunoglobulin hybrid intron/INS/IRES of pFFE6/RIP8/TNS/IRES/NEO with RIPi/INS/IRES from pRIP8/RIPi/TNS/IRES/NEO.
- FFE6 promoters also proved to be cell-specific. FFE6 promoters were fused with the neomycin gene to generate FFE6/RIP8/NEO. This plasmid was stably transfected into RIN cells, 293 cells, and pituitary AtT-20 cells. When challenged with G418, drug-resistant colonies were only present in RIN cells. As a control, CMV/NEO was also stably transfected into RIN cells, 293 cells, and pituitary AtT-20 cells. After selection in G418, a large number of drug-resistant colonies were present in all three lines.
- RIP derivatives like FFE6/RIP8/RIPi possess two important characteristics necessary for optimal expression of linked transforming genes in human ⁇ -cells: 1) they will direct expression of the transforming gene to ⁇ -cells and remain silent in other cell types associated with the islet preparation; and 2) they will deliver high levels of the transforming gene similar to those obtained from the very strong, non-cell-specific CMVp.
- pancreatic islets suitable for transplantation.
- One possible means of circumventing this problem is to somehow induce human ⁇ -cells to grow, either to increase the number of human islet ⁇ -cells or to produce a human ⁇ -cell line suitable for transplantation.
- Pancreatic islet ⁇ -cell growth can occur from two separate pathways (Swenne, 1992). New islets can differentiate from budding of pancreatic ductule epithelium (neogenesis), or from the replication of existing islet ⁇ -cells. Neogenesis of islets is thought to primarily occur during fetal and perinatal stages of development, but has also been observed in the regenerating adult pancreas (Bonner-Weir, 1992). Replication of existing pancreatic ⁇ -cells has been seen in the late fetal stages, but is thought to be the principal means of increasing ⁇ -cell mass in the adult (Swenne, 1992).
- the expression of the GH-receptor has been identified on ⁇ -cells (Hellerstrom et al, 1991).
- the GH related peptides, prolactin and placental lactogen have similar stimulatory effects on ⁇ -cell replication reflecting lactogenic as well as GH-receptors on the ⁇ -cell surface (Moldrup and Nielsen, 1990).
- GH mediates its growth effect on ⁇ -cells by stimulating the production of IGF-I in islets which in turn mediates a paracrine or autocrine effect to stimulate ⁇ -cell replication (Nielsen, 1982). While this may in part be so, (indeed IGF-I alone has been shown to stimulate fetal ⁇ -cell replication 2-fold (Brelje and Sorenson, 1991)), it is also clear that GH can exert a stimulation of adult ⁇ -cell replication independently of IGF-I (Swenne et al, 1987). Gastrin and cholecystokinin can instigate a small increase in ⁇ -cell replication (Bonner-Weir, 1992).
- EGF does not appear to affect ⁇ -cell replication even though significant
- EGF binding to ⁇ -cells has been observed (Nielsen, 1989), suggesting that the EGF signal transduction pathway is not functional in pancreatic ⁇ -cells.
- PDGF does not appear to affect ⁇ -cell replication, but this is due to there being very few PDGF-receptors on ⁇ -cells.
- the PDGF ⁇ receptor is transfected into ⁇ -cells only a 50% increase in DNA synthesis was observed upon stimulation with PDGF ⁇ -chain (Welsh et al, 1990), suggesting that a post-receptor signal transduction mechanism for ⁇ -cell replication is only partly present.
- pancreatic ⁇ -cells a mitogenic signal transduction pathway mediated via Ras activation can be induced.
- proto-oncogene expression is undetectable or extremely low, but in islets transfected with v-src, or a combination of c-myc and c-Ha-ras, only a modest 50% increased cell replication rate was observed (Welsh et al. , 1987).
- these studies imply that it is important to appropriately activate a mitogenic signal transduction pathway in ⁇ -cells as well as to overexpress certain key elements within that pathway.
- the present Example concerns the identification of mitogenic signal transduction pathways in pancreatic ⁇ -cells, which in turn indicates an appropriate growth factor and signaling pathway to exploit for inducing ⁇ -cell growth in vitro and/or establishing novel ⁇ -cell lines.
- the inventors have found that IGF-1 and activation of a signal transduction pathway via IRS-2 and p70 S6K can induce up to a 30-fold increase in ⁇ -cell growth in insulinoma cells.
- Recombinant adenoviruses were generated to overexpress the IGF-1 receptor and/or IRS-2 in primary isolated islets (preferably human islets) to determine the effects of IGF-1 induced ⁇ -cell growth.
- Recombinant Adenovirus Construction In order to obtain high overexpression and efficient gene transfer of mitogenic signal transduction proteins in primary islets, the recombinant adenovirus system was used. Essentially, replication deficient recombinant adenoviruses were constructed (Becker et al, 1994a; Becker et al. 1994b). Initially, adenoviral constructs to markedly increase in vitro islet ⁇ -cell expression of IRS-1 (as a putative control for IRS-2), IRS-2, IGF-1 receptor, and insulin receptor (as a putative control for IGF-1 receptor) were produced.
- Recombinant adenoviruses where IRS-1, IRS-2, IGF-1 receptor, or insulin receptor expression is driven by the ubiquitous CMV-promoter using pAC-CMV
- CMV-promoter using pAC-CMV
- recombinant adenoviruses for specific ⁇ -cell expression driven by the insulin promoter using pAC-RIP
- Recombinant adenoviruses expressing ⁇ -galactosidase and luciferase driven by the CMV-promoter are used as controls.
- a pAC-RIP driven luciferase expressing recombinant adenovirus is used as a control.
- Recombinant adenovirus infection of isolated islets is performed (Becker et al, 1994), and IRS-1, IRS-2, IGF-1 receptor and insulin receptor overexpression in islets is confirmed by Northern analysis and immunoblotting.
- Recombination of the pAC and pJM17 vectors to generate El A deficient recombinant adenovirus can only accommodate an -3.8 kb insert into pAC shuttle vector.
- the IRS-1, IRS-2, IGF-1 receptor, and insulin receptor cDNA inserts are all >3.8 kb. Therefore, an E3 deficient vector (in this case pBHGl 1) instead of pJM17 is used to generate El A and E3 deficient recombinant adenovirus.
- the pBHGl 1 vector enables inserts of up to 9 kb into pAC to be used which is suitable for IRS-1, IRS-2, IGF-1 receptor, and insulin receptor cDNAs.
- Isolated rat islets are used as a primary model, which are isolated as previously described (Alarc ⁇ n et al, 1993). The studies are then repeated in human islets. Further characterization of mitogenic signal transduction pathways in the RITz and the INS-1 cell lines is conducted, and these cells are used as positive controls for investigation of IRS-2/IGF-1 receptor overexpression in islets.
- RITz-cells are isolated from the well granulated line of NEDH-rat transplantable insulinoma tissue by cellular sieving and PercollTM centrifugation gradient purification. They are maintained in culture under identical conditions for INS-1 cells (Alarc ⁇ n et al, 1993). In terms of insulin secretion, RITz-cells are not responsive to glucose in the physiological range, but are when elevating intracellular cAMP, phorbol esters, and/or depolarization.
- Measurement of Cell Growth Several parameters are used for measurement of cell growth. First, the cell number is counted in a standard volume using a heamocytometer.
- H-thymidine inco ⁇ oration into cellular DNA is used as a predictor of ⁇ -cell growth (Myers and White, 1996).
- [ 3 H]-thymidine (1 ⁇ Ci/ml) to cells
- incubations were performed under various conditions for 2 -4 hr at 37°C.
- Cells were then washed three times in ice-cold HBBSS, lysed in 2 ml of 1 mg/ml SDS solution on ice, and transferred to 12-ml tubes.
- 2.5 ml ice cold 20% (wt/vol) trichloroacetic acid the cell extract was poured over a Whatman glass-fiber filter in a Millipore filtration apparatus.
- the filter was washed twice with ice-cold 10% (wt/vol) trichloroacetic acid, air dried, and counted by liquid scintillation counting.
- the individual replicating ⁇ -cells in islets or ⁇ -cell lines are identified and counted using a BrdU-staining kit (Amersham).
- This technique has the advantage of readily distinguishing between islet ⁇ -cells and non ⁇ -cells by double staining with a second antibody against insulin. An increase in a population of ⁇ -cells could result in part from an inhibition of ⁇ -cells entering apoptosis.
- the number of apoptotic IRS-2/IGF-1 receptor overexpressing cells is also measured by the TUNEL (terminal deoxynucleotidyl transferase biotin-dUTP nick end labeling) method (kit obtained from Upstate Biotechnology Inc.). Measurement of -cell Differentiation. Ideally, when inducing primary islet ⁇ -cells to grow, the maintenance of as much of the ⁇ -cell's differentiation state as possible is desired.
- the (de)differentiation state is assessed using three parameters: I) Glucose-regulated proinsulin biosynthesis translation- To date all the available transformed ⁇ -cell lines (except the relatively well differentiated low passage MIN6 cells) do not possess a phenotype of specific regulated proinsulin biosynthesis by a physiologically relevant range of glucose concentrations. Maintenance of correct glucose stimulated proinsulin biosynthesis in IRS- 2/IGF-l receptor overexpressing islet ⁇ -cells (Alarc ⁇ n et al, 1993) is an indication of maintaining a differentiation state.
- Regulated (pro) insulin release- Dedifferentiated transformed ⁇ -cell lines have a tendency to constitutively secrete an increased proportion of proinsulin, and also lose their response to relevant secretagogues, especially glucose in the 2- 20 mM range.
- Pulse-chase radiolabeling protocols (Alarc ⁇ n et al, 1995) are used to assess the proinsulin nsulin ratio released from IRS-2/IGF-1 receptor overexpressing islet ⁇ -cells in response to glucose and a stimulatory cocktail containing multiple secretagogues and potentiators of glucose-stimulated insulin secretion and thus assess the differentiation state.
- pl ⁇ phosphorylation state- The extent of p70 phosphorylation in ⁇ -cell lines tends to correlate with dedifferentiation state and growth rate of the cells.
- the phosphosphorylation of p70 occurs on multiple sites on the molecule, with 5 phosphorylated forms observed by immunobloting (due to electrophoretic retardation of the
- Changes in protein-protein interactions is measured (e.g., IGF-1 instigated IRS-2-PI3 kinase association by immunoprecipitation with p85 PI3 kinase antibody followed by immunoblotting with either anti-phosphotyrosine and/or IRS-2 antibodies); the phosphorylation state of a particular protein is determined (e.g., using specific antibodies that recognize only phosphorylated MAP kinase, or immunoblotting for gel retardation analysis of p70 or immunoprecipitation followed by anti-phosphotyrosine immunoblotting); and induction of enzyme activity is measured (e.g., MAP kinase or PI3 kinase assays).
- Necessary reagents or assay kits are purchased form UBI.
- IRS-2 mRNA levels for IRS-2 were increased >50-fold in insulinoma cells compared to isolated islets.
- IRS-2 mRNA levels for IRS-2 were increased >50-fold in insulinoma cells compared to isolated islets.
- These very high levels of IRS-2 mRNA were also found in RIN 1046-38, RTN-m5F, INS-1, ⁇ TC3, HIT and MIN6 cell lines, but not in ⁇ TC-1, AtT20, PC-12, GH-3, 293, Cos, CHO or 3T3-L1 cell-lines where IRS-2 mRNA levels were comparable to those in isolated rat islets.
- the elevated IRS-2 levels appear to be peculiar to insulinoma cell lines.
Abstract
Description
Claims
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU22199/99A AU2219999A (en) | 1998-01-12 | 1999-01-11 | Methods for preparing and using immortalized human neuroendocrine cells |
Applications Claiming Priority (4)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US7120998P | 1998-01-12 | 1998-01-12 | |
US60/071,209 | 1998-01-12 | ||
US9110598P | 1998-06-29 | 1998-06-29 | |
US60/091,105 | 1998-06-29 |
Publications (3)
Publication Number | Publication Date |
---|---|
WO1999035245A2 WO1999035245A2 (en) | 1999-07-15 |
WO1999035245A9 true WO1999035245A9 (en) | 1999-09-30 |
WO1999035245A3 WO1999035245A3 (en) | 1999-10-28 |
Family
ID=26751958
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/US1999/000553 WO1999035245A2 (en) | 1998-01-12 | 1999-01-11 | Methods for preparing and using immortalized human neuroendocrine cells |
Country Status (2)
Country | Link |
---|---|
AU (1) | AU2219999A (en) |
WO (1) | WO1999035245A2 (en) |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US9364565B2 (en) | 2000-03-15 | 2016-06-14 | Orbusneich Medical, Inc. | Medical device with coating for capturing genetically-altered cells and methods of using same |
US9522217B2 (en) | 2000-03-15 | 2016-12-20 | Orbusneich Medical, Inc. | Medical device with coating for capturing genetically-altered cells and methods for using same |
Families Citing this family (11)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
AU2515600A (en) | 1999-01-21 | 2000-08-07 | Vitro Diagnostics, Inc. | Immortalized cell lines and methods of making the same |
DE10019195B4 (en) * | 2000-04-17 | 2006-03-09 | Heart Biosystems Gmbh | Reversible immortalization |
US20030082810A1 (en) * | 2001-02-26 | 2003-05-01 | Palle Serup | Methods for generating insulin-secreting cells suitable for transplantation |
EP1487274B1 (en) * | 2002-03-15 | 2010-10-13 | Duke University | Tissue engineering |
US7312077B2 (en) | 2002-10-02 | 2007-12-25 | Naoya Kobayashi | Insulin-secreting immortalized liver cell line modified by glucose sensitivity |
US8741555B2 (en) | 2004-05-14 | 2014-06-03 | Organ Recovery Systems, Inc. | Apparatus and method for perfusion and determining the viability of an organ |
WO2006045105A2 (en) | 2004-10-20 | 2006-04-27 | Vitro Diagnostics, Inc. | Generation and differentiation of adult stem cell lines |
US10176887B1 (en) | 2005-11-14 | 2019-01-08 | Organ Recovery Systems, Inc. | Ex vivo methods for drug discovery, development and testing |
US8771930B2 (en) * | 2007-05-18 | 2014-07-08 | Lifeline Scientific, Inc. | Ex vivo methods for testing toxicity of substances using donated human organs or tissues |
US8765364B2 (en) | 2007-05-18 | 2014-07-01 | Lifeline Scientific, Inc. | Ex vivo methods for validating substance testing with human organs and/or tissues |
CN115011549B (en) * | 2022-07-12 | 2023-08-22 | 上海交通大学医学院附属仁济医院 | Method for establishing gall bladder epithelial cells, gall bladder epithelial cell line and application thereof |
Family Cites Families (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1997026321A2 (en) * | 1996-01-19 | 1997-07-24 | Board Of Regents, The University Of Texas System | Recombinant expression of proteins from secretory cell lines |
-
1999
- 1999-01-11 WO PCT/US1999/000553 patent/WO1999035245A2/en active Application Filing
- 1999-01-11 AU AU22199/99A patent/AU2219999A/en not_active Abandoned
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US9364565B2 (en) | 2000-03-15 | 2016-06-14 | Orbusneich Medical, Inc. | Medical device with coating for capturing genetically-altered cells and methods of using same |
US9522217B2 (en) | 2000-03-15 | 2016-12-20 | Orbusneich Medical, Inc. | Medical device with coating for capturing genetically-altered cells and methods for using same |
Also Published As
Publication number | Publication date |
---|---|
WO1999035245A2 (en) | 1999-07-15 |
WO1999035245A3 (en) | 1999-10-28 |
AU2219999A (en) | 1999-07-26 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO1999035495A2 (en) | Identification of substances that modify cellular secretory function | |
US6110707A (en) | Recombinant expression of proteins from secretory cell lines | |
US6194176B1 (en) | Recombinant expression of proteins from secretory cell lines | |
Yoshihara et al. | ERRγ is required for the metabolic maturation of therapeutically functional glucose-responsive β cells | |
Beith et al. | Insulin stimulates primary β-cell proliferation via Raf-1 kinase | |
AU718254B2 (en) | Recombinant expression of proteins from secretory cell lines | |
US5427940A (en) | Engineered cells producing insulin in response to glucose | |
WO1999035245A9 (en) | Methods for preparing and using immortalized human neuroendocrine cells | |
EP0877810A1 (en) | Methods and compositions for inhibiting hexokinase | |
US9732329B2 (en) | Cells genetically modified to comprise pancreatic islet glucokinase and uses thereof | |
JP2003304878A (en) | Induction of insulin-producing cell | |
JP2009501002A (en) | Method for stimulating pancreatic beta cell proliferation | |
WO1997026322A2 (en) | Methods and compositions for inhibiting hexokinase | |
SG187525A1 (en) | Novel as160-like protein, test systems, methods and uses involving it for the identification of diabetes type 2 therapeutics | |
US6171856B1 (en) | Methods and compositions relating to no-mediated cytotoxicity | |
US20150056173A1 (en) | Beta cell growth and differentiation | |
WO1999006059A2 (en) | Methods and compositions relating to no-mediated cytotoxicity | |
Bouckenooghe et al. | Modulation of specific beta cell gene (re) expression during in vitro expansion of human pancreatic islet cells | |
WO2007075956A2 (en) | Methods for producing and using pancreatic endocrine cells | |
WO1995032740A1 (en) | Transformed human hepatoma cell line which releases insulin | |
Lee et al. | Reversal of diabetes in rats using GLP-1-expressing adult pancreatic duct-like precursor cells transformed from acinar to ductal cells | |
WO2001005943A2 (en) | Lcat recombinant cell line compositions and methods | |
AU4720500A (en) | Recombinant expression of proteins from secretory cell lines | |
AU1835801A (en) | Recombinant expression of proteins from secretory cell lines |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A2 Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US US UZ VN YU ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): GH GM KE LS MW SD SZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
AK | Designated states |
Kind code of ref document: C2 Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US US UZ VN YU ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: C2 Designated state(s): GH GM KE LS MW SD SZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
COP | Corrected version of pamphlet |
Free format text: PAGE 1, DESCRIPTION, REPLACED BY A NEW PAGE 1; PAGES 1/30-30/30, DRAWINGS, REPLACED BY NEW PAGES 1/30-30/30; DUE TO LATE TRANSMITTAL BY THE RECEIVING OFFICE |
|
AK | Designated states |
Kind code of ref document: A3 Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US US UZ VN YU ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A3 Designated state(s): GH GM KE LS MW SD SZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
NENP | Non-entry into the national phase in: |
Ref country code: KR |
|
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
122 | Ep: pct application non-entry in european phase |