WO1999063090A2 - Protease inhibitor peptides - Google Patents
Protease inhibitor peptides Download PDFInfo
- Publication number
- WO1999063090A2 WO1999063090A2 PCT/US1999/012276 US9912276W WO9963090A2 WO 1999063090 A2 WO1999063090 A2 WO 1999063090A2 US 9912276 W US9912276 W US 9912276W WO 9963090 A2 WO9963090 A2 WO 9963090A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- protease inhibitor
- ala
- val
- inhibitor according
- glu
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/81—Protease inhibitors
- C07K14/8107—Endopeptidase (E.C. 3.4.21-99) inhibitors
- C07K14/811—Serine protease (E.C. 3.4.21) inhibitors
- C07K14/8114—Kunitz type inhibitors
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
- C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
- C07K14/4711—Alzheimer's disease; Amyloid plaque core protein
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
Definitions
- CPB cardiopulmonary bypass
- CPB chronic myeloma
- a "whole body inflammatory response" caused by activation of plasma protease systems and blood cells through interactions with the artificial surfaces of the heart-lung machine
- Butler et ai Ann. Thorac. Surg. 55:552 (1993); Edmunds et ai, J. Card. Surg. 8:404 (1993)
- plasma factor XII XII
- Factor XII is a single-chain 80 kDa protein that circulates in plasma as an inactive zymogen. Contact with negatively charged nonendothelial surfaces, like those of the bypass circuit, causes surface-bound factor XII to be autoactivated to the active serine protease factor Xlla. See Colman, Agents Actions Suppl. 42:125 (1993). Surface- activated factor Xlla then processes prekallikrein (PK) to active kallikrein, which in turn cleaves more Xlla from XII in a reciprocal activation reaction that results in a rapid amplification of the contact pathway. Factor XHa can also activate the first component of complement Cl, leading to production of the anaphylatoxin C5a through the classical complement pathway.
- PK prekallikrein
- kallikrein kallikrein
- Factor XHa can also activate the first component of complement Cl, leading to production of the anaphylatoxin C5a
- the CPB-induced inflammatory response includes changes in capillary permeability and interstitial fluid accumulation.
- Cleavage of high molecular weight kininogen (HK) by activated kallikrein generates the potent vasodilator bradykinin, which is thought to be responsible for increasing vascular permeability, resulting in edema, especially in the lung.
- the lung is particularly susceptible to damage associated with CPB, with some patients exhibiting what has been called "pump lung syndrome" following bypass, a condition indistinguishable from adult respiratory distress. See Johnson et al., J. Thorac. Cardiovasc. Surg. 107:1193 (1994).
- Post-CPB pulmonary injury includes tissue damage thought to be mediated by neutrophil sequestration and activation in the microvasculature of the lung. Butler et ai, supra; Johnson, et al, supra.
- Activated factor XII can itself stimulate neutrophil aggregation.
- Activated neutrophils may damage tissue through release of oxygen-derived free radicals, proteolytic enzymes such as elastase, and metabolites of arachidonic acid. Release of neutrophil products in the lung can cause changes in vascular tone, endothelial injury and loss of vascular integrity.
- Intrinsic inhibition of the contact system occurs through inhibition of activated XHa by Cl -inhibitor (Cl-ENH). See Colman, supra. During CPB, massive activation of plasma proteases and consumption of inhibitors overwhelm this natural inhibitory mechanism. A potential therapeutic strategy for reducing post-bypass pulmonary injury mediated by neutrophil activation would, therefore, be to block the formation and activity of the neutrophil agonists kallikrein, factor XHa, and C5a by inhibition of proteolytic activation of the contact system.
- BPPI basic pancreatic protease inhibitor
- aprotinin is of bovine origin, there is concern that repeated administration to patients could lead to the development of an immune response to aprotinin in the patients, precluding its further use.
- the proteases inhibited by aprotinin during CPB appear to include plasma kallikrein and plasmin. See, e.g., Scott, et ai, Blood 69:1431 (1987).
- Aprotinin is an inhibitor of plasmin (K, of 0.23nM), and the observed reduction in blood loss may be due to inhibition of fibrinolysis through the blocking of plasmin action.
- aprotinin inhibits plasma kallikrein (Kj of 20nM), it does not inhibit activated factor XII, and consequently only partially blocks the contact system during CPB.
- factor Xlla By inhibiting the proteolytic activity of factor Xlla, kallikrein production would be prevented, blocking amplification of the contact system, neutrophil activation and bradykinin release. Inhibition of Xlla would also prevent complement activation and production of C5a. More complete inhibition of the contact system during CPB could, therefore, be achieved through the use of a better Xlla inhibitor.
- Protein inhibitors of factor Xlla are known.
- active site mutants of ⁇ i-antitrypsin that inhibit factor XHa have been shown to inhibit contact activation in human plasma. See Patston et al, J. Biol. Chem. 265:10786 (1990).
- the large size and complexity (greater than 400 amino acid residues) of these proteins present a significant challenge for recombinant protein production, since large doses will almost certainly be required during CPB.
- it is a potent inhibitor of both kallikrein and plasmin, nearly 1 gram of aprotinin must be infused into a patient to inhibit the massive activation of the kallikrein-kinin and fibrinolytic systems during CPB.
- APPI human amyloid ⁇ -protein precursor
- KPI Kunitz serine protease inhibitor domain
- KPI shares about 45% amino acid sequence identity with aprotinin.
- the isolated KPI domain has been prepared by recombinant expression in a variety of systems, and has been shown to be an active serine protease inhibitor. See, for example, Sinha, et al, J. Biol. Chem. 265:8983 (1990).
- the measured in vitro Kj of KPI against plasma kallikrein is 45nM, compared to 20nM for aprotinin.
- Aprotinin, KPI, and other Kunitz-type serine protease inhibitors have been engineered by site-directed mutagenesis to improve inhibitory activity or specificity.
- substitution of Lys 15 of aprotinin with arginine resulted in an inhibitor with a K,- of 0.32nM toward plasma kallikrein, a 100-fold improvement over natural aprotinin.
- PCT application No. 89/10374 See also Norris et al, Biol. Chem. Hoppe Seyler 371:3742 (1990).
- Phage display methods have been recently used for preparing and screening derivatives of Kunitz-type protease inhibitors. See PCT Application No. 92/15605, which describes specific sequences for 34 derivatives of aprotinin, some of which were reportedly active as elastase and cathepsin inhibitors. The amino acid substitutions in the derivatives were distributed throughout almost all positions of the aprotinin molecule. Phage display methods have also been used to generate KPI variants that inhibit factor Vila and kallikrein. See Dennis et al, J. Biol. Chem. 269:22129 and 269:22137 (1994).
- protease inhibitors that can bind to and inhibit the activity of serine proteases are greatly desirable.
- serine proteases such as kallikrein; chymotrypsins A and B; trypsin; elastase; subtilisin; coagulants and procoagulants, particularly those in active form, including coagulation factors such as factors Vila, IXa, Xa, Xla, and XHa; plasmin; thrombin; proteinase-3; enterokinase; acrosin; cathepsin; urokinase; and tissue plasminogen activator.
- novel protease inhibitors that can ameliorate one or more of the undesirable clinical manifestations associated with enhanced serine protease activity, for example by reducing pulmonary damage or blood loss during CPB.
- novel protease inhibitors with high expression levels, as well as with high yields.
- the present invention relates to peptides that can bind to and preferably exhibit inhibition of the activity of serine proteases. Those peptides can also provide a means of ameliorating, treating or preventing clinical conditions associated with increased activity of serine proteases. Particularly, the novel peptides of the present invention preferably exhibit a more potent and specific (i.e., greater) inhibitory effect toward serine proteases of interest in comparison to known serine protease inhibitors.
- proteases include: kallikrein; chymotrypsins A and B; trypsin; elastase; subtilisin; coagulants and procoagulants, particularly those in active form, including coagulation factors such as factors Vila, Ca, Xa, Xla, and XHa; plasmin; thrombin; proteinase-3; enterokinase; acrosin; cathepsin; urokinase; and tissue plasminogen activator.
- the peptides of the present invention preferably exhibit a greater potency and specificity for inhibiting one or more serine proteases of interest (e.g., kallikrein, plasmin " and factors Vila, IXa, Xa, Xla, and XHa) than the potency and specificity exhibited by native KPI or other known serine protease inhibitors.
- serine proteases of interest e.g., kallikrein, plasmin " and factors Vila, IXa, Xa, Xla, and XHa
- novel peptides of the present invention preferably comprise substituting the tyrosine residue at position 48.
- Such substituted peptides may exhibit an increased level of recombinant expression in comparison to the expression levels of serine proteases that do not have that substitution. The effect of this substitution may be manifested not only on the substituted KPI peptides of the present invention, but on wild-type KPI as well.
- the peptides of the present invention that comprise the N-terminal sequence Glu- Val-Val-Arg (residues -4 to -1) may also preferably exhibit increased yields via a substitution of that N-terminal sequence to Asp-Val-Val-Arg.
- the invention provides protease inhibitors that can ameliorate one or more of the undesirable clinical manifestations associated with enhanced serine protease activity, for example, by reducing pulmonary damage or blood loss during CPB.
- the present invention relates to protease inhibitors comprising the following sequences: X'-Val-Cys-Ser-Glu-Gln-Ala-Glu-X ⁇ Gly-X ⁇ Cys-Arg-Ala- ⁇ -X ⁇ X 6 ⁇ 7 - Trp-Tyr-Phe-Asp-Val-Thr-Glu-Gly-Lys-Cys-Ala-Pro-Phe-X 8 -Tyr-Gly-Gly-Cys-X 9 -X 10 - X"-X 12 -Asn-Asn-Phe-Asp-Thr-Glu-Glu-X 13 -Cys-Met-Ala-Val-Cys-Gly-Ser-Ala-
- a further aspect of the present invention provides protease inhibitors wherein X 1 is Asp-Val-Val-Arg-Glu-, X 2 is Thr, Val, or Ser, X 3 is Pro, X 4 is Ala or Met, X 5 is He, X 6 is Ser or Tyr, X 7 is His, X 8 is Phe, X 9 is Gly, X 10 is Gly, X 11 is Asn, and X 12 is Arg.
- protease inhibitors wherein X 1 is Asp- Val-Val-Arg-Glu-, X 2 is Pro, X 4 is Ala, X 5 is lie, X 6 is Phe, X 7 is Arg, X 8 is Phe, X 9 is Gly, X 10 is Gly, X 11 is Asn, and X 12 is Arg. Yet another aspect of the present invention provides protease inhibitors wherein X 2 is Thr or Val. Another aspect of the present invention provides protease inhibitors wherein X 2 is Thr. A further aspect of the present invention provides protease inhibitors wherein X 2 is Val.
- protease inhibitors wherein X 2 is Thr or Val, and X 4 is Ala.
- a further aspect of the present invention provides protease inhibitors wherein X 2 is Thr or Val, and X 4 is Met.
- Yet another aspect of the present invention provides protease inhibitors wherein X 2 is Thr, X 4 is Ala, X 6 is Tyr, and X 13 is His.
- a further aspect of the present invention provides protease inhibitors wherein X 2 is Thr, X 4 is Ala, X 6 is Tyr, and X 13 is Gin.
- Another aspect of the present invention provides protease inhibitors wherein X 2 is Thr, X 4 is Ala, X 6 is Tyr, and X 13 is Ala.
- protease inhibitors wherein X 2 is Thr, X 4 is Ala, X 6 is Tyr, and X 13 is Asp. Another aspect of the present invention provides protease inhibitors wherein X 2 is Thr, X 4 is Met, X 6 is Ser, and X 13 is selected from His, Ala, or Gin. Another aspect of the present invention provides protease inhibitors wherein X is Val, X 4 is Ala, X 6 is Tyr, and X 13 is selected from His, Ala, or Gin. Another aspect of the present invention provides protease inhibitors wherein X 2 is Thr, X 4 is Ala, X 6 is Tyr, and X 13 is selected from His, Ala, or Gin.
- Another aspect of the present invention provides protease inhibitors wherein X 13 is selected from His or Ala. Another aspect of the present invention provides protease inhibitors wherein X 13 is selected from His or Ala. Another aspect of the present invention provides protease inhibitors wherein X 13 is His. A further aspect of the present invention provides protease inhibitors wherein X 13 is Ala. A further aspect of the present invention provides an isolated DNA molecule comprising a DNA sequence encoding a protease inhibitor of the invention. Another aspect of the present invention provides an isolated DNA molecule operably linked to a regulatory sequence that controls expression of the coding sequence of the protease inhibitor in a host cell.
- Another aspect of the present invention provides an isolated DNA molecule operably linked to a regulatory sequence that controls expression of the coding sequence of the protease inhibitor in a host cell further comprising a DNA sequence encoding a secretory signal peptide. That secretory signal peptide may preferably comprise the signal sequence of yeast oc-mating factor.
- Another aspect of the present invention provides a host cell transformed with a DNA molecule.
- Another aspect of the present invention provides a host cell transformed with any of the DNA molecules defined above.
- Such a host cell may preferably comprise E. coli or a yeast cell. When said host cell is a yeast cell, the yeast cell may preferably be Saccharomyces cerevisiae.
- yeast cell When said host cell is a yeast cell, the yeast cell may preferably be Pichia pastoris.
- Another aspect of this invention provides a method for producing a protease inhibitor, comprising the steps of culturing a host cell as defined above and isolating and purifying said protease inhibitor.
- a further aspect of this invention provides a pharmaceutical composition, comprising a protease inhibitor together with a pharmaceutically acceptable sterile vehicle.
- An additional aspect of the present invention provides a method of treatment of a clinical condition associated with increased activity of one or more serine proteases, comprising administering to a patient suffering from said clinical condition an effective amount of a pharmaceutical composition comprising a protease inhibitor of the present invention together with a pharmaceutically acceptable sterile vehicle. That method of treatment may preferably be used to treat the clinical condition of blood loss during surgery.
- Yet another aspect of the present invention provides a method for inhibiting the activity of serine proteases of interest in a mammal comprising administering a therapeutically effective dose of a pharmaceutical composition comprising a protease inhibitor of the present invention together with a pharmaceutically acceptable sterile vehicle, wherein said serine proteases are selected from the group consisting of: kallikrein; chymotrypsins A and B; trypsin; elastase; subtilisin; coagulants and procoagulants, particularly those in active form, including coagulation factors such as factors Vila, DCa, Xa, Xla, and XHa; plasmin; thrombin; proteinase-3; enterokinase; acrosin; cathepsin; urokinase; and tissue plasminogen activator.
- kallikrein chymotrypsins A and B
- trypsin elastase
- subtilisin subtilisin
- protease inhibitors comprising the sequence: X'-Val-Cys-Ser-Glu-Gln-Ala-Glu-X ⁇ Gly-Pro-Cys-Arg-Ala-Ala-Ile-Tyr- His-Trp-Tyr-Phe-Asp-Val-Thr-Glu-Gly-Lys-Cys-Ala-Pro-Phe-Phe-Tyr-Gly-Gly-Cys- Gly-Gly-Asn-Arg-Asn-Asn-Phe-Asp-Thr-Glu-Glu-X 3 -Cys-Met-Ala-Val-Cys-Gly-Ser- Ala-Ile, wherein X 1 is selected from Glu-Val-Val-Arg-Glu-, Asp-Val-Val-Arg-Glu-, Asp, or Glu; X 2 is selected from Thr and Val; X 3 is selected from His, Gin, Ala, or
- a further aspect of the present invention relates to protease inhibitors wherein X 1 is Glu-Val-Val-Arg-Glu. Yet another aspect of the present invention provides for protease inhibitors wherein X 2 is Thr. An additional aspect of the present invention provides protease inhibitors wherein X 2 is Val. Yet another aspect of the present invention provides protease inhibitors wherein X 3 is His. Another aspect of the present invention provides protease inhibitors wherein X 3 is Gin. Another aspect of the present invention provides protease inhibitors wherein X 3 is Ala. Another aspect of the present invention provides protease inhibitors wherein X 3 is Asp.
- protease inhibitors wherein X 1 is Asp-Val-Val-Arg-Glu. Another aspect of the present invention provides protease inhibitors wherein X is Thr. Another aspect of the present invention provides protease inhibitors wherein X 2 is Val. Another aspect of the present invention provides protease inhibitors wherein X 3 is His. Another aspect of the present invention provides protease inhibitors wherein X 3 is Gin. Another aspect of the present invention provides protease inhibitors wherein X 3 is Ala. Another aspect of the present invention provides protease inhibitors wherein X 3 is Asp. Another aspect of the present invention provides protease inhibitors wherein X 1 is Glu.
- a further aspect of the present invention provides protease inhibitors wherein X 2 is Thr. Another aspect of the present invention provides protease inhibitors wherein X 2 is Val. Another aspect of the present invention provides protease inhibitors wherein X 3 is His. Another aspect of the present invention provides protease inhibitors wherein X 3 is Gin.
- protease inhibitors wherein X 3 is Ala. Another aspect of the present invention provides protease inhibitors wherein X 3 is Asp. Another aspect of the present invention provides protease inhibitors wherein X 1 is Asp. Another aspect of the present invention provides protease inhibitors wherein X 2 is Thr. Another aspect of the present invention provides protease inhibitors wherein X 2 is Val. Another aspect of the present invention provides protease inhibitors wherein X 3 is His. Another aspect of the present invention provides protease inhibitors wherein X 3 is Gin. Another aspect of the present invention provides protease inhibitors wherein X 3 is Ala. Another aspect of the present invention provides protease inhibitors wherein X 3 is Asp.
- protease inhibitors wherein X 1 is Glu-Val-Val-Arg-Glu-, X 2 is Thr, Val, or Ser, X 3 is Pro, X 4 is Ala or Met, X 5 is He, X 6 is Ser or Tyr, X 7 is His, X 8 is Phe, X 9 is Gly, X 10 is Gly, X 11 is Asn, and X 12 is Arg.
- Another aspect of the present invention provides protease inhibitors wherein X 2 is Thr or Val.
- Another aspect of the present invention provides protease inhibitors wherein X 2 is Thr.
- Another aspect of the present invention provides protease inhibitors wherein X 2 is Val.
- protease inhibitors wherein X is Thr or Val, and X 4 is Ala. Another aspect of the present invention provides protease inhibitors wherein X 2 is Thr or Val, and X 4 is Met. Another aspect of the present invention provides protease inhibitors wherein X 2 is Thr, X 4 is Ala, X 6 is Tyr, and X 13 is His. Another aspect of the present invention provides protease inhibitors wherein X 2 is Thr, X 4 is Ala, X 6 is Tyr, and X 13 is Gin. Another aspect of the present invention provides protease inhibitors wherein X 2 is Thr, X 4 is Ala, X 6 is Tyr, and X 13 is Ala.
- protease inhibitors wherein X 2 is Thr, X 4 is Ala, X° is Tyr, and X 13 is Asp.
- Another aspect of the present invention provides protease inhibitors wherein X 2 is Thr, X 4 is Met, X 6 is Ser, and X 13 is selected from His, Ala, or Gin.
- Another aspect of the present invention provides a protease inhibitors wherein X 2 is Val, X 4 is Ala, X 6 is Tyr, and X 13 is selected from His, Ala, or Gin.
- protease inhibitors wherein X 2 is Thr, X 4 is Ala, X 6 is Tyr, and X 13 is selected from His, Ala, or Gin. Another aspect of the present invention provides protease inhibitors wherein X 13 is selected from His or Ala. Another aspect of the present invention provides protease inhibitors wherein X 13 is selected from His or Ala. Another aspect of the present invention provides protease inhibitors wherein X 13 is His. Another aspect of the present invention provides protease inhibitors wherein X 13 is Ala.
- Another aspect of the present invention provides an isolated DNA molecule comprising a DNA sequence encoding a protease inhibitor. Another aspect of the present invention provides an isolated DNA molecule operably linked to a regulatory sequence that controls expression of the coding sequence in a host cell. Another aspect of the present invention provides an isolated DNA molecule further comprising a DNA sequence encoding a secretory signal peptide. Another aspect of the present invention provides an isolated DNA molecule wherein said secretory signal peptide comprises the signal sequence of yeast oc-mating factor. Another aspect of the present invention provides a host cell transformed with any of the DNA molecules defined above. Such a host cell may preferably comprise E. coli or a yeast cell.
- the yeast cell When said host cell is a yeast cell, the yeast cell may preferably be Saccharomyces cerevisiae. When said host cell is a yeast cell, the yeast cell may preferably be Pichia pastoris.
- Another aspect of the present invention provides for a method for producing a protease inhibitor, comprising the steps of culturing a host cell as defined above and isolating and purifying said protease inhibitor.
- a further aspect of this invention provides a pharmaceutical composition, comprising a protease inhibitor together with a pharmaceutically acceptable sterile vehicle.
- An additional aspect of the present invention provides a method of treatment of a clinical condition associated with increased activity of one or more serine proteases, comprising administering to a patient suffering from said clinical condition an effective amount of a pharmaceutical composition comprising a protease inhibitor of the present invention together with a pharmaceutically acceptable sterile vehicle. That method of treatment may preferably be used to treat the clinical condition of blood loss during surgery.
- Another aspect of the present invention provides a method for inhibiting the activity of serine proteases of interest in a mammal comprising administering a therapeutically effective dose of a pharmaceutical composition comprising a protease inhibitor of the present invention together with a pharmaceutically acceptable sterile vehicle, wherein said serine proteases are selected from the group consisting of: kallikrein; chymotrypsins A and B; trypsin; elastase; subtilisin; coagulants and procoagulants, particularly those in active form, including coagulation factors such as factors Vila, IXa, Xa, Xla, and Xlla; plasmin; thrombin; proteinase-3; enterokinase; acrosin; cathepsin; urokinase; and tissue plasminogen activator.
- kallikrein chymotrypsins A and B
- trypsin elastase
- subtilisin subtilisin
- Yet another aspect of the present invention provides a method for increasing the. expression levels of recombinant protease inhibitors comprising the step of culturing a host cell transformed with an isolated DNA molecule comprising a DNA sequence encoding a protease inhibitor.
- a host cell is E. coli or a yeast cell.
- the yeast cell may preferably be Saccharomyces cerevisiae.
- the yeast cell may preferably be Pichia pastoris.
- Another aspect of the present invention provides a method for increasing the yield of recombinant protease inhibitors comprising the step of culturing a host cell transformed with an isolated DNA molecule comprising a DNA sequence encoding a protease inhibitor according to claim 1, wherein X 1 is Asp-Val-Val-Arg-Glu-, and isolating and purifying said protease inhibitor.
- the yeast cell may preferably be Saccharomyces cerevisiae.
- the yeast cell may preferably be Pichia pastoris.
- protease inhibitors comprising the sequence: X'-Val-Cys-Ser-Glu-Gln-Ala-Glu-X ⁇ Gly-Pro-Cys-Arg-Ala ⁇ -He-X 4 - X s -T ⁇ -Tyr-Phe-Asp-Val-Thr-Glu-Gly-Lys-Cys-Ala-Pro-Phe-Phe-Tyr-Gly-Gly-Cys- Gly-Gly-Am-Arg-Asn-Asn-Phe-Asp-Thr-Glu-Glu-X ⁇ -Cys-Met-Ala-Val-Cys-Gly-Ser- Ala-Ile, wherein: X 1 is selected from Glu-Val-Val-Arg-Glu-, Asp-Val-Val-Arg-Glu-, Asp, or Glu; X 2 is selected from Thr or Val; X 3 is selected from Arg and Met; X 4 is selected
- a further aspect of the present invention provides protease inhibitors comprising the sequence: X'-Val-Cys-Ser-Glu-Gln-Ala-Glu-Thr-Gly-Pro-Cys-Arg-Ala-Leu-Phe- Lys-Arg-T ⁇ -Tyr-Phe-Asp-Val-Thr-Glu-Gly-Lys-Cys-Ala-Pro-Phe-Phe-Tyr-Gly-Gly- Cys-Leu-Gly-Asp-Arg-Asn-Asn-Phe-Asp-Thr-Glu-Glu-X 2 -Cys-Met-Ala-Val-Cys-Gly- Ser-Ala-Ile, wherein: X 1 is selected from Glu-Val-Val-Arg-Glu-, Asp- Val- Val- Arg- Glu-, Asp, and Glu; X 2 is selected from His, Gin, Ala, and Asp.
- protease inhibitors wherein X 1 is Asp-Val-Val-Arg-Glu. Another aspect of the present invention provides protease inhibitors wherein X 2 is His. Another aspect of the present invention provides protease inhibitors wherein X 2 is Gin. Another aspect of the present invention provides protease inhibitors wherein X 2 is Ala. Another aspect of the present invention provides protease inhibitors wherein X 2 is Asp. Another aspect of the present invention provides protease inhibitors wherein X 1 is Glu-Val-Val-Arg- Glu. Yet another aspect of the present invention provides protease inhibitors wherein X 2 is His.
- a further aspect of the present invention provides protease inhibitors wherein X 2 is Gin. Another aspect of the present invention provides protease inhibitors wherein X 2 is Ala. Another aspect of the present invention provides protease inhibitors wherein X 2 is Asp.
- Yet another aspect of the present invention provides protease inhibitors wherein X 1 is Asp.
- a further aspect of the present invention provides protease inhibitors wherein X 2 is His.
- Another aspect of the present invention provides protease inhibitors wherein X 2 is Gin.
- Another aspect of the present invention provides protease inhibitors wherein X 2 is Ala.
- Another aspect of the present invention provides protease inhibitors wherein X 2 is Asp.
- Yet another aspect of the present invention provides protease inhibitors wherein X 1 is Glu.
- Another aspect of the present invention provides protease inhibitors wherein X 2 is His.
- a further aspect of the present invention provides protease inhibitors wherein X 2 is Gin.
- protease inhibitors wherein X 2 is Ala.
- protease inhibitors wherein X 2 is Asp.
- protease inhibitors comprising the sequence: Asp-Val-Val-Arg-Glu-Val-Cys-Ser-Glu-Gln-Ala-Glu-Thr- Gly-Pro-Cys-Arg-Ala-Leu-Phe-Lys-Arg-T ⁇ -Tyr-Phe-Asp-Val-Thr-Glu-Gly-Lys-Cys- Ala-Pro-Phe-Phe-Tyr-Gly-Gly-Cys-Leu-Gly-Asp-Arg-Asn-Asn-Phe-Asp-Thr-Glu-Glu- Tyr-Cys-Met-Ala-Val-Cys-Gly-Ser-Ala-Ile.
- Figure 1 shows the strategy for the construction of plasmid pTW10:KPI.
- Figure 2 shows the sequence of the synthetic gene for KPI (1 ⁇ 57) fused to the bacterial phoA secretory signal sequence.
- Figure 3 shows the strategy for construction of plasmid pKPI-61.
- Figure 4 shows the 192 bp Xbal-Hina ⁇ H synthetic gene fragment encoding KPI (1 ⁇ 57) and four amino acids from yeast oc-mating factor.
- Figure 5 shows the synthetic 201 bp Xbal-HindUl fragment encoding KPI (-4 ⁇ 57) in PKPI-61.
- Figure 6 shows the strategy for the construction of plasmid pTWl 13.
- Figure 7 shows plasmid pTWl 13, encoding the 445 bp synthetic gene for yeast ⁇ c-factor-KPI(-4 ⁇ 57) fusion.
- Figure 8 shows the amino acid sequence for KPI (-4 ⁇ 57).
- Figure 9 shows the strategy for constructing plasmid pTW6165.
- Figure 10 shows plasmid, pTW6165, encoding the 445 bp synthetic gene for yeast oc-factor-KPI(-4 ⁇ 57; M15A, S17W) fusion.
- Figure 11 shows the sequences of the annealed oligonucleotide pairs used to construct plasmids pTW6165, pTW6166, pTW6175, pBG028, pTW6183, pTW6184, pTW6185, pTW6173, and pTW6174.
- Figure 12 shows the sequence of plasmid pTW6166 encoding the fusion of yeast oc-factor and KPI(-4 ⁇ 57; Ml 5 A, S17Y).
- Figure 13 shows the sequence of plasmid pTW6175 encoding the fusion of yeast oc-factor and KPI(-4 ⁇ 57; M15L, S17F).
- Figure 14 shows the sequence of plasmid pBG028 encoding the fusion of yeast oc-factor and KPI(-4 ⁇ 57; M15L, S17Y).
- Figure 15 shows the sequence of plasmid pTW6183 encoding the fusion of yeast oc-factor and KPI(-4 ⁇ 57; I16H, S17F).
- Figure 16 shows the sequence of plasmid pTW6184 encoding the fusion of yeast oc-factor and KPI(-4 ⁇ 57; I16H, S17Y).
- Figure 17 shows the sequence of plasmid pTW6185 encoding the fusion of yeast oc-factor and KPI(-4 ⁇ 57; I16H, S17W).
- Figure 18 shows the sequence of plasmid pTW6173 encoding the fusion of yeast oc-factor and KPI(-4 ⁇ 57; M15A, I16H).
- Figure 19 shows the sequence of plasmid pTW6174 encoding the fusion of yeast oc-factor and KPI(-4 ⁇ 57; M15L, I16H).
- Figure 20 shows the sequence of plasmid pBG022 encoding the fusion of yeast oc-factor and KPI (-4 ⁇ 57; M15A, S17Y, R18H, Y48H).
- Figure 21 shows the sequence of plasmid pBG033 encoding the fusion of yeast oc-factor and KPI (-4 ⁇ 57; T9V, M15A, R18H, Y48H).
- Figure 22 shows the sequence of plasmid pBG048 encoding the fusion of yeast oc-factor and KPI (-4 ⁇ 57; Y48H).
- Figure 23 shows the sequence of plasmid pBG049 encoding the fusion of yeast oc-factor and KPI (-4 ⁇ 57; M15A, S17Y, R18H).
- Figure 24 shows the sequence of plasmid pBG050 encoding the fusion of yeast oc-factor and KPI (-4 ⁇ 57; T9V, M15A, S17Y, R18H).
- Figure 25 shows the sequence of the coding region for phoA signal: KPI- BG022: glu protein contained within the phage display vector pDWl-L6-16.
- Figure 26 shows the sequence of the coding region for yeast oc-factor and KPI- P48 library contained within the P48 library.
- Figure 27 shows the amino acid sequence of KPI (-4 ⁇ 57; M15A, S17W).
- Figure 28 shows the amino acid sequence of KPI (-4 ⁇ 57; M15A, S17Y).
- FIG. 29 shows the amino acid sequence of KPI (-4 ⁇ 57; M15L, S17F).
- Figure 30 shows the amino acid sequence of KPI (-4 ⁇ 57; M15L, S17Y).
- Figure 31 shows the amino acid sequence of KPI (-4 ⁇ 57; I16H, S17F).
- Figure 32 shows the amino acid sequence of KPI (-4 ⁇ 57; I16H, S17Y).
- Figure 33 shows the amino acid sequence of KPI (-4 ⁇ 57; I16H, S17W).
- Figure 34 shows the amino acid sequence of KPI (-4 ⁇ 57; M15A, S17F).
- Figure 35 shows the amino acid sequence of KPI (-4 ⁇ 57; M15A, I16H).
- Figure 36 shows the amino acid sequence of KPI (-4 ⁇ 57; M15L, I16H).
- Figure 37 shows the amino acid sequence of KPI (-4 ⁇ 57; M15A, S17Y, R18H, Y48H).
- Figure 38 shows the amino acid sequence of KPI (-4 ⁇ 57; T9V, M15A, R18H, Y48H).
- Figure 39 shows the amino acid sequence of KPI (-4 ⁇ 57; Y48H).
- Figure 40 shows the amino acid sequence of KPI (-4 ⁇ 57; M15A, S17Y, R18H).
- Figure 41 shows the amino acid sequence of KPI (-4 ⁇ 57; T9V, M15A, S17Y, R18H).
- Figure 42 shows the amino acid sequence of KPI-P48 library (-4 ⁇ 57; M15A, S17Y, R18H, Y28X) encoded by the P48 library.
- Figure 43 shows the construction of plasmid pSP26- mp:Fl.
- Figure 44 shows the construction of plasmid pgJH.
- Figure 45 shows the construction of plasmid pR ⁇ oA:KPI:gHI.
- Figure 46 shows the construction of plasmid pLGl.
- Figure 47 shows the construction of plasmid pAL51.
- Figure 48 shows the construction of plasmid pAL53.
- Figure 49 shows the construction of plasmid
- Figure 50 shows the construction of plasmid pDWl #14.
- Figure 51 shows the construction of plasmid pBG022.
- Figure 52 shows the construction of plasmid pBG048.
- Figure 53 shows the construction of plasmid pBG049.
- Figure 54 shows the construction of plasmid pBG050.
- Figure 55 shows the construction of the P48 library.
- Figure 56 shows the coding region for the fusion ofp ⁇ A-KPI (155)-genei ⁇ .
- Figure 57 shows the construction of plasmid pDWl 14-2.
- Figure 58 shows the construction of KPI Library 16-19.
- Figure 59 shows the expression unit encoded by the members of KPI Library 16- 19.
- Figure 60 shows the /?AoA-KPI(155)-geneE_I region encoded by the most frequently occurring randomized KPI region.
- Figure 61 shows the construction of pDD185 KPI (-4 ⁇ 57; M15A, S17F).
- Figure 62 shows the sequence of yeast oc-factor fused to KPI (-4 ⁇ 57; M15A, S17F).
- Figure 63 shows the inhibition constants (KjS) determined for purified KPI variants against the selected serine proteases kallikrein, factor Xa, and factor Xlla.
- Figure 64 shows the inhibition constants (KjS) determined for KPI variants against kallikrein, plasmin, and factors Xa, Xla, and Xlla.
- Figure 65 shows the post-surgical blood loss in pigs in the presence (KPI) and absence (NS) of KPI 185-1 (M15A, S17F).
- Figure 66 shows the post-surgical hemoglobin loss in pigs in the presence (KPI) and absence (NS) of KPI 185-1 (M15A, S17F).
- Figure 67 shows the oxygen tension in the presence and absence of KPI, before CPB, immediately after CPB, and at 60 and 180 minutes after the end of CPB.
- Figure 68 summarizes the results shown in Figures 65-67.
- Figure 69 shows the inhibitor constants (Kis) determined for KPI variants against kallikrein in nM and expression levels (mg/ml) of those variants.
- Figure 70 shows a comparison of the survival time of rat xenografts in the presence and absence of KPI-BG022.
- Figure 71 shows a comparison of damage in a rat model of TNBS (trinitrobenzene sulfonic acid) induced colitis in the presence and absence of KPI- BG022.
- Figure 72 shows a comparison of the HPLC traces, after lyophilization, of KPI having the N-terminus sequence Glu-Val-Val-Arg (E-KPI) and KPI having the N- terminus sequence Asp-Val-Val-Arg (D-KPI).
- the present invention provides peptides that can bind to and preferably inhibit the activity of serine proteases. These inhibitory peptides can also provide a means of ameliorating, treating or preventing clinical conditions associated with increased activity of serine proteases.
- the novel peptides of the present invention preferably exhibit a more potent and specific (i.e., greater) inhibitory effect toward serine proteases of interest than known serine protease inhibitors.
- proteases include: kallikrein; chymotrypsins A and B; trypsin; elastase; subtilisin; coagulants and procoagulants, particularly those in active form, including coagulation factors such as factors Vila, IXa, Xa, Xla, and Xlla; plasmin; thrombin; proteinase-3; enterokinase; acrosin; cathepsin; urokinase; and tissue plasminogen activator.
- the peptides of the present invention preferably exhibit a greater potency and specificity for inhibiting one or more serine proteases of interest (e.g., kallikrein, plasmin and factors Vila, IXa, Xa, Xla, and Xlla) than the potency and specificity exhibited by native KPI or other known serine protease inhibitors.
- the peptides of the present invention preferably comprise a substitution at position 48. Such position 48 substituted peptides may exhibit an increased level of expression in comparison to the expression levels of serine proteases that do not have that substitution.
- the effect of this substitution may be manifested not only on the substituted KPI peptides of the present invention, but on wild-type KPI as well.
- the peptides of the present invention that comprise the N- terminal sequence Glu- Val- Val- Arg (residues -4 to -1) may also preferably exhibit increased yields via a substitution to Asp-Val-Val-Arg.
- Peptides of the present invention may be used to reduce the tissue damage caused by activation of the proteases of the contact pathway of the blood during surgical procedures such as cardiopulmonary bypass (CPB). Inhibition of contact pathway proteases reduces the "whole body inflammatory response" that can accompany contact pathway activation, and that can lead to tissue damage, and possibly death.
- the peptides of the present invention may also be used in conjunction with surgical procedures to reduce activated serine protease-associated perioperative and postoperative blood loss. For instance, perioperative blood loss of this type may be particularly severe during CPB surgery.
- Pharmaceutical compositions comprising the peptides of the present invention may be used in conjunction with surgery such as CPB; administration of such compositions may occur preoperatively, perioperatively or postoperatively.
- Examples of other clinical conditions associated with increased serine protease activity for which the peptides of the present invention may be used include: CPB-induced inflammatory response; post-CPB pulmonary injury; pancreatitis; allergy-induced protease release; deep vein thrombosis; thrombocytopenia; rheumatoid arthritis; adult respiratory distress syndrome; chronic inflammatory bowel disease; psoriasis; hyperfibrinolytic hemorrhage; organ preservation; wound healing; and myocardial infarction.
- Other examples of preferable uses of the peptides of the present invention are described in U.S. Patent No. 5,187,153.
- the invention is based upon the novel substitution of amino acid residues in the peptide corresponding to the naturally occurring KPI protease inhibitor domain of human amyloid ⁇ -amyloid precursor protein (APPI). These substitutions produce peptides that can bind to serine proteases and preferably exhibit an inhibition of the activity of serine proteases.
- the peptides also preferably exhibit a more potent and specific serine protease inhibition than known serine protease inhibitors.
- peptides are provided that may exhibit a more potent and specific inhibition of one or more serine proteases of interest, e.g., kallikrein, plasmin and factors Xa, Xla, X ⁇ a, and Xlla.
- the present invention also includes pharmaceutical compositions comprising an effective amount of at least one of the peptides of the invention, in combination with a pharmaceutically acceptable sterile vehicle, as described in REMINGTON'S
- the three-dimensional structure reveals two binding loops within KPI that contact the protease.
- the first loop extends from residue Thr 9 to He 16
- the second loop extends from residue Phe 32 to Gly 37 .
- the two protease binding loops are joined through the disulfide bridge extending from Cys 12 to Cys 36 .
- KPI contains two other disulfide bridges, between Cys 3 and Cys 53 , and between Cys 28 to Cys 49 .
- substituted peptides including peptides comprising substitutions at position 9, substitutions of at least two of the four residues at positions 15-18 and substitutions at position 48 may exhibit more potent and specific serine protease inhibition toward selected serine proteases of interest than exhibited by the natural KPI peptide domain.
- substitutions T9V, M15A, S17Y and M15A ,S17Y in the context of the R18H substitution exhibited such potent serine protease inhibition. See Figures 63, 64 and 69D.
- the peptides of the present invention preferably comprise a substitution at position 48.
- Such position 48 substituted peptides may exhibit an increased level of expression in comparison to the expression levels of serine proteases that do not have that substitution.
- the effect of this substitution may be manifested not only on the substituted KPI peptides of the present invention, but on wild-type KPI as well.
- the peptides of the present invention that comprise the N-terminal sequence Glu- Val- Val- Arg (residues -4 to -1) may also preferably exhibit increased yields via a substitution to Asp-Val-Val-Arg.
- substitutions at position 48 may exhibit an increased level of expression of KPI peptides in comparison to the expression levels of such peptides not having such a substitution.
- These substituted peptides exhibiting an increased level of expression also may preferably comprise one or more additional substitutions at residues 9, 11, 13-18, 32 and 37-40; in particular, such peptides may preferably comprise a substitution at positions 9 or 37 and/or substitution of at least two of the four residues at positions 15-18.
- Those additionally substituted peptides may exhibit more potent and specific serine protease inhibition toward selected serine proteases of interest than exhibited by the natural KPI peptide domain as well as increased expression levels.
- One specific embodiment of the invention is based upon a finding that an expression vector prepared to express the KPI variant Ml 5 A, S17Y, R18H underwent a spontaneous mutation at position 48 which changed the native tyrosine to histidine (Y48H) and that this mutation conferred beneficial properties.
- the KPI variant M15A, S17Y, R18H (pBG049) was constructed using methods known to those skilled in the art and its expression levels compared with the KPI variant M15A, S17Y, R18H, Y48H (pBG022).
- the expression level of KPI variant M15A, S17Y, R18H was increased over five-fold by replacing the native tyrosine at position 48 with histidine. See Figures 69 A and B.
- this Y48H substitution confers improvements in expression levels upon KPI variants as well as upon native sequence KPI.
- the expression level of wild-type KPI was increased on the average approximately five to six-fold by replacing the native tyrosine at position 48 with histidine (pBG048;Y48H), glutamine (pBG072; Y48Q) or alanine (pBG073; Y48A). See Figures 69B and F.
- KPI-P48 was constructed for expression of KPI (M15A, S17Y, R18H) in which the amino acids exhibiting at position 48 are randomized. See Figure 55.
- the amino acid sequences of the KPI-P48 Library contained within the P48 Library are shown in Figure 26.
- Those substituted peptides included substituting the native tyrosine at position 48 with histidine (pBG022; 50D4, 50B6.Y48H), glutamine (50B6, 50L1, 50M1; Y48Q), alanine (50P5, 50C4; Y48A) and aspartic acid (50N1; Y48D). See Figures 69B, E and F.
- the KPI peptides of the present invention may also comprise a substitution at its N-terminus. Specifically, such a substitution was found to alleviate the problems associated with the purification and subsequent isolation of the expressed peptides of the present invention having a glutamic acid residue at its N- termjnus.
- This specific substitution changes the additional N-terminal amino acids from the KPI protein sequence (Glu-Val-Val-Arg, designated residues -4 to -1) immediately proceeding the KPI domain in APPI to Asp-Val-Val-Arg. Specifically, this substitution is thought to prevent cyclization of the N-terminus glutamic acid during purification of the expressed peptides of the present invention.
- one or more additional KPI peptide residues are substituted, such substitutions preferably occurring among residues 9, 11, 13-18, 32, 37- 40, and 48.
- those substituted peptides including peptides comprising substitutions at position 9, substitutions of at least two of the four residues at positions 15-18 and substitutions at position 48 preferably exhibit the desired potency and specificity as well as an increased level of expression in comparison to the expression levels of other serine proteases without those specific substitutions.
- the peptides of the present invention preferably exhibit a greater potency and specificity for inhibiting one or more serine proteases of interest (e.g., kallikrein, plasmin and factors Vila, DCa, Xa, Xla, and Xlla) than the potency and specificity exhibited by native KPI or other known serine protease inhibitors as well as an increased level of expression in comparison to the expression levels of other serine proteases without those specific substitutions.
- serine proteases of interest e.g., kallikrein, plasmin and factors Vila, DCa, Xa, Xla, and Xlla
- That greater potency and specificity may be manifested by the peptides of the present invention by exhibiting binding constants for serine proteases of interest that are less than the binding constants exhibited by native KPI, or other known serine protease inhibitors, for such proteases.
- the serine protease inhibitory properties of peptides of the present invention were measured for the serine proteases of interest kallikrein, plasmin and factors Xa, Xla, and Xlla.
- Methodologies for measuring the inhibitory properties of the KPI variants of the present invention are known to those skilled in the art, e.g., by determining the inhibition constants of the variants toward serine proteases of interest, as described in Example 4, infra.
- Such studies measure the ability of the novel peptides of the present invention to bind to one or more serine proteases of interest and to preferably exhibit a greater potency and specificity for inhibiting one or more serine protease of interest than known serine protease inhibitors such as native KPI.
- the clinical and therapeutic efficacy of the peptides of the present invention can be assayed by in vitro and in vivo methodologies known to those skilled in the art, e.g., as described in Examples 5-8, infra.
- BPTI RPDFCLEPPYTGPCKAR ⁇ RYFWAKA GL CQTFVYiiG ⁇ RAKKNNFKSAEDCMRTCGGA 1 10 20 30 40 50
- the peptides of the present invention can be created by synthetic techniques or recombinant techniques which employ genomic or cDNA cloning methods.
- KPI variants of the present invention can be routinely synthesized using solid phase or solution phase peptide synthesis.
- Methods of preparing relatively short peptides such as KPI by chemical synthesis are well known in the art.
- KPI variants could, for example be produced by solid-phase peptide synthesis techniques using commercially available equipment and reagents such as those available from Milligen (Bedford, MA) or Applied Biosystems-Perkin Elmer (Foster City, CA).
- segments of KPI variants could be prepared by solid-phase synthesis and linked together using segment condensation methods such as those described by Dawson et al, Science 266:776 (1994).
- substitution of any amino acid can be achieved simply by replacement of the residue that is to be substituted with a different amino acid monomer.
- KPI variants are produced by recombinant DNA technology. See PCT application WO 96/35788, hereby inco ⁇ orated in its entirety. This requires the preparation of genes encoding each KPI variant that is to be made. Suitable genes can be constructed by oligonucleotide synthesis using commercially available equipment, such as that provided by Milligen and Applied Biosystems, supra. The genes can be prepared by synthesizing the entire coding and non-coding strands, followed by annealing the two strands. Alternatively, the genes can be prepared by ligation of smaller synthetic oligonucleotides by methods well known in the art. Genes encoding KPI variants are produced by varying the nucleotides introduced at any step of the synthesis to change the amino acid sequence encoded by the gene.
- KPI variants are made by site-directed mutagenesis of a gene encoding KPI.
- Methods of site-directed mutagenesis are well known in the art. See, for example, Ausubel et ai, (eds.) CURRENT PROTOCOLS IN MOLECULAR BIOLOGY (Wiley Interscience, 1987); PROTEIN ENGINEERING (Oxender & Fox eds., A. Liss, Inc. 1987). These methods require the availability of a gene encoding KPI or a variant thereof, which can then be mutagenized by known methods to produce the desired KPI variants.
- linker-scanning and polymerase chain reaction mediated techniques can be used for pmposes of mutagenesis. See PCR TECHNOLOGY (Erlich ed., Stockton Press 1989); CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, vols. 1 & 2, loc. cit.
- a gene encoding KPI can be obtained by cloning the naturally occurring gene, as described for example in U.S. Patents Nos. 5,223,482 and 5,187,153, which are hereby inco ⁇ orated by reference in their entireties. In particular, see columns 6-9 of U.S. Patent No. 5,187,153. See also PCT Application No. 93/09233.
- a synthetic gene encoding KPI is produced by chemical synthesis, as described above.
- the gene may encode the 57-amino acid KPI domain shown in Table 1, or it may also encode additional N-terminal amino acids from the APPI protein sequence, such as the four amino acid sequence (Glu-Val-Val-Arg or Asp- Val-Val-Arg, designated residues -4 to -1) immediately preceding the KPI domain in APPI.
- the synthetic KPI gene contains restriction endonuclease recognition sites that facilitate excision of DNA cassettes from the KPI gene. These cassettes can be replaced with small synthetic oligonucleotides encoding the desired changes in the KPI peptide sequence. See Ausubel, supra.
- This method also allows the production of genes encoding KPI as a fusion peptide with one or more additional peptide or protein sequences.
- the DNA encoding these additional sequences is arranged in-frame with the sequence encoding KPI such that, upon translation of the gene, a fusion protein of KPI and the additional peptide or protein sequence is produced.
- Methods of making such fusion proteins are well known in the art.
- additional peptide sequences that can be encoded in the genes are secretory signal peptide sequences, such as bacterial leader sequences, for example ompA andphoA, that direct secretion of proteins to the bacterial periplasmic space.
- the additional peptide sequence is a yeast secretory signal sequence, such as ⁇ -mating factor, that directs secretion of the peptide when produced in yeast.
- Additional genetic regulatory sequences can also be introduced into the synthetic gene that are operably linked to the coding sequence of the gene, thereby allowing synthesis of the protein encoded by the gene when the gene is introduced into a host cell.
- regulatory genetic sequences that can be introduced are: promoter and enhancer sequences and transcriptional and translational control sequences. Other regulatory sequences are well known in the art. See Ausubel et ⁇ , supra, and Sambrook et al, supra.
- the KPI sequence is prepared by ligating together synthetic oligonucleotides to produce a gene encoding an in-frame fusion protein of yeast ⁇ -mating factor with either KPI (1 ⁇ 57) or KPI (-4 ⁇ 57).
- the gene constructs prepared as described above are conveniently manipulated in host cells using methods of manipulating recombinant DNA techniques that are well known in the art. See, for example Sambrook et al, MOLECULAR CLONING: A LABORATORY MANUAL, Second Edition, (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY 1989), and Ausubel, supra.
- the host cell used for manipulating the KPI constructs is E. coli.
- the construct can be ligated into a cloning vector and propagated in E. coli by methods that are well known in the art. Suitable cloning vectors are described in Sambrook, supra, or are commercially available from suppliers such as Promega (Madison, WI), Stratagene (San Diego, CA) and Life Technologies (Gaithersburg, MD).
- genes encoding KPI variants are obtained by manipulating the coding sequence of the construct by standard methods of site-directed mutagenesis, such as excision and replacement of small DNA cassettes, as described supra. See Ausubel, supra, and Sinha et al, supra. See also U.S. Patent 5,373,090, which is herein inco ⁇ orated by reference in its entirety. See particularly, columns 4-12 of U.S. Patent 5,272,090. These genes are then used to produce the KPI variant peptides as described below.
- KPI variants can be produced using phage display methods. See, for example, Dennis et al, supra, which is hereby inco ⁇ orated by reference in its entirety. See also U.S. Patent Nos. 5,223,409 and 5,403,484, which are hereby also inco ⁇ orated by reference in their entireties.
- libraries of genes encoding variants of KPI are fused in-frame to genes encoding surface proteins of filamentous phage, and the resulting peptides are expressed (displayed) on the surface of the phage. The phage are then screened for the ability to bind, under appropriate conditions, to serine proteases of interest immobilized on a solid support.
- KPI variant peptides Large libraries of phage can be used, allowing simultaneous screening of the binding properties of a large number of KPI variants. Phage that have desirable binding properties are isolated and the sequences of the genes encoding the corresponding KPI variants is determined. These genes are then used to produce the KPI variant peptides as described below.
- substitutions at position 48 may exhibit an increased level of expression of KPI peptides, both wild-type and substituted, in comparison to the expression levels of such peptides not having such a substitution.
- Such peptides having a substitution at position 48 also may preferably comprise one or more additional substitutions at residues 9, 11, 13-18, 32 and 37-40; in particular, such peptides may preferably comprise a substitution at positions 9 or 37 and or substitution of at least two of the four residues at positions 15-18.
- Those additionally substituted peptides may exhibit more potent and specific serine protease inhibition toward selected serine proteases of interest than exhibited by the natural KPI peptide domain as well as increased expression levels.
- KPI variants are expressed in S. cerevisiae.
- the KPI variants are cloned into expression vectors to produce a chimeric gene encoding a fusion protein of the KPI variant with yeast ⁇ -mating factor.
- the mating factor acts as a signal sequence to direct secretion of the fusion protein from the yeast cell, and is then cleaved from the fusion protein by a membrane-bound protease during the secretion process.
- the expression vector is transformed into S. cerevisiae, the transformed yeast cells are cultured by standard methods, and the KPI variant is purified from the yeast growth medium.
- Recombinant bacterial cells expressing the peptides of the present invention are grown in any of a number of suitable media, for example LB, and the expression of the recombinant antigen induced by adding IPTG to the media or switching incubation to a higher temperature. After culturing the bacteria for a further period of between 2 and 24 hours, the cells are collected by centrifugation and washed to remove residual media. The bacterial cells are then lysed, for example, by disruption in a cell homogenizer and centrifuged to separate dense inclusion bodies and cell membranes from the soluble cell components.
- This centrifugation can be performed under conditions whereby dense inclusion bodies are selectively enriched by inco ⁇ oration of sugars such as sucrose into the buffer and centrifugation at a selective speed. If the recombinant peptide is expressed in inclusion bodies, as is the case in many instances, these can be washed in any of several solutions to assist in the removal of any contaminating host proteins, then solubilized in solutions containing high concentrations of urea (e.g., 8M) or chaotropic agents such as guanidine hydrochloride in the presence of reducing agents such as ⁇ -mercaptoethanol or DTT (dithiothreitol).
- urea e.g. 8M
- chaotropic agents such as guanidine hydrochloride in the presence of reducing agents such as ⁇ -mercaptoethanol or DTT (dithiothreitol).
- the peptides of the present invention may be advantageous to incubate the peptides of the present invention for several hours under conditions suitable for the peptides to undergo a refolding process into a conformation which more closely resembles that of native KPI.
- Such conditions generally include low protein concentrations less than 500 ⁇ g/ml, low levels of reducing agent, concentrations of urea less than 2M and often the presence of reagents such as a mixture of reduced and oxidized glutathione which facilitate the interchange of disulphide bonds within the protein molecule.
- the refolding process can be monitored, for example, by SDS-PAGE or with antibodies, which are specific for the native molecule (which can be obtained from animals vaccinated with the native molecule isolated from parasites).
- the peptide can then be purified further and separated from the refolding mixture by chromatography on any of several supports including ion exchange resins, gel permeation resins or on a variety of affinity columns.
- KPI variants can be achieved by standard methods of protein purification, e.g., using various chromatographic methods including high performance liquid chromatography and adso ⁇ tion chromatography. The purity and the quality of the peptides can be confirmed by amino acid analyses, molecular weight determination, sequence determination and mass spectrometry. See, for example, PROTEIN PURIFICATION METHODS: A PRACTICAL APPROACH, Harris et al, eds. (IRL Press, Oxford, 1989).
- the yeast cells are removed from the growth medium by filtration or centrifugation, and the KPI variant is purified by affinity chromatography on a column of trypsin-agarose, followed by reversed-phase HPLC.
- the KPI peptides of the present invention may also comprise a substitution at its N-terminus. Placing the amino acid sequence Asp-Val- Val-Arg (designated residues -4 to -1) immediately before the KPI domain was found to alleviate the problems associated with the purification and subsequent isolation of the expressed peptides of the present invention having a glutamic acid residue at its N-terminus. In a preferred embodiment, this substitution changes the additional N- terminal amino acids from the KPI protein sequence (Glu-Val-Val-Arg, designated residues -4 to -1) immediately proceeding the KPI domain to Asp-Val- Val-Arg.
- Figure 72 provides a comparison of the HPLC traces, after lyophilization, of KPI having the N-terminal sequence Glu-Val-Val-Arg (E-KPI) and KPI having the N-terminus sequence Asp- Val- Val-Arg (D-KPI). Those KPI samples were injected onto a YMC- Phenyl HPLC column (Cat.
- KPI variants Once KPI variants have been purified, they are tested for their ability to bind to and inhibit serine proteases of interest in vitro.
- the peptides of the present invention preferably exhibit a more potent and specific inhibition of serine proteases of interest than known serine protease inhibitors, such as the natural KPI peptide domain.
- binding and inhibition can be assayed for by determining the inhibition constants for the peptides of the present invention toward serine proteases of interest and comparing those constants with constants determined for known serine protease inhibitors, e.g., the native KPI domain, toward those proteases.
- Methods for determining inhibition constants of protease inhibitors are well known in the art. See Fersht, ENZYME STRUCTURE AND MECHANISM, 2nd ed., W.H. Freeman and Co., New York, (1985).
- the inhibition experiments are carried out using a chromogenic synthetic protease substrate, as described, for example, in Bender et al, J. Amer. Chem. Soc. 88:5890 (1966). Measurements taken by this method can be used to calculate inhibition constants (K,- values) of the peptides of the present invention toward serine proteases of interest. See Bieth in BAYER-SYMPOSIUM V "PROTEINASE INHIBITORS", Fritz et al, eds., pp. 463-69, Springer- Verlag, Berlin, Heidelberg, New York, (1974). KPI variants that exhibit potent and specific inhibition of one or more serine proteases ofinterest may subsequently be tested in vivo. In vitro testing, however, is not a prerequisite for in vivo studies of the peptides of the present invention.
- the peptides of the present invention may be tested, alone or in combination, for their therapeutic efficacy by various in vivo methodologies known to those skilled in the art, e.g., the ability of KPI variants to reduce postoperative bleeding can be tested in standard animal models.
- cardiopulmonary bypass surgery can be carried out on animals such as pigs in the presence of KPI variants, or in control animals where the KPI variant is not used.
- the use of pigs as a model for studying the clinical effects associated with CPB has previously been described. See Redmond et al, Ann. Thorac Surg. 56:474 (1993).
- the KPI variant is supplied to the animals in a pharmaceutical sterile vehicle by methods known in the art, for example by continuous intravenous infusion. Chest tubes can be used to collect shed blood for a defined period of time. The shed blood, together with the residual intrathoracic blood found after sacrifice of the animal can be used to calculate hemoglobin (Hgb) loss. The postoperative blood and Hgb loss is then compared between the test and control animals to determine the effect of the KPI variants. E. Therapeutic use of KPI variants
- KPI variants of the present invention found to exhibit therapeutic efficacy may preferably be used and administered, alone or in combination or as a fusion protein, in a manner analogous to that currently used for aprotinin or other known serine protease inhibitors. See Butler et al, supra.
- Peptides of the present invention generally may be administered in the manner that natural peptides are administered.
- a therapeutically effective dose of the peptides of the present invention preferably affects the activity of the serine proteases of interest such that the clinical condition may be treated, ameliorated or prevented.
- Therapeutically effective dosages of the peptides of the present invention can be determined by those skilled in the art, e.g., through in vivo or in vitro models.
- the peptides of the present invention may be administered in total amounts of approximately 0.01 to approximately 500, specifically 0.1 to 100 mg/kg body weight, if desired in the form of one or more administrations, to achieve therapeutic effect. It may, however, be necessary to deviate from such administration amounts, in particular depending on the nature and body weight of the individual to be treated, the nature of the medical condition to be treated, the type of preparation and the administration of the peptide, and the time interval over which such administration occurs.
- compositions comprising peptides of the present invention are advantageously administered in the form of injectable compositions.
- Such peptides may be preferably administered to patients via continuous intravenous infusion, but can also be administered by single or multiple injections.
- a typical composition for such pu ⁇ ose comprises a pharmaceutically acceptable carrier.
- Pharmaceutically acceptable carriers include aqueous solutions, non- toxic excipients, including salts, preservatives, buffers and the like, as described in REMINGTON'S PHARMACEUTICAL SCIENCES, pp. 1405-12 and 1461-87 (1975) and THE NATIONAL FORMULARY XIV., 14th Ed. Washington: American Pharmaceutical Association (1975).
- Aqueous carriers include water, alcoholic/aqueous solutions, saline solutions, parenteral vehicles such as sodium chloride, Ringer's dextrose, etc.
- Intravenous vehicles include fluid and nutrient replenishers.
- Preservatives include antimicrobials, anti-oxidants, chelating agents and inert gases.
- the pH and exact concentration of the various components of the composition are adjusted according to routine skills in the art. See GOODMAN AND OILMAN'S THE PHARMACOLOGICAL BASIS FOR THERAPEUTICS (7th ed.).
- the peptides of the present invention may be present in such pharmaceutical preparations in a concentration of approximately 0.1 to 99.5% by weight, specifically 0.5 to 95% by weight, relative to the total mixture.
- Such pharmaceutical preparations may also comprise other pharmaceutically active substances in addition to the peptides of the present invention. Other methods of delivering the peptides to patients will be readily apparent to the skilled artisan.
- mammalian serine proteases that may exhibit inhibition by the peptides of the present invention include: kallikrein; chymotrypsins A and B; trypsin; elastase; subtilisin; coagulants and procoagulants, particularly those in active form, including coagulation factors such as thrombin and factors Vila, IXa, Xa, Xla, and Xlla; plasmin; proteinase-3; enterokinase; acrosin; cathepsin; urokinase; and tissue plasminogen activator.
- kallikrein kallikrein
- chymotrypsins A and B trypsin
- elastase subtilisin
- coagulants and procoagulants particularly those in active form, including coagulation factors such as thrombin and factors Vila, IXa, Xa, Xla, and Xlla
- plasmin proteinase-3
- Examples of conditions associated with increased serine protease activity include: CPB-induced inflammatory response; post-CPB pulmonary injury, pancreatitis; allergy-induced protease release; deep vein thrombosis; thrombocytopenia; rheumatoid arthritis; adult respiratory distress syndrome; chronic inflammatory bowel disease; psoriasis; hyperfibrinolytic hemorrhage; organ preservation; wound healing; and myocardial infarction.
- Other examples of the use of the peptides of the present invention are described in U.S. Patent No. 5,187,153.
- the inhibitors of the present invention may also be used for inhibition of serine protease activity in vitro, for example during the preparation of cellular extracts to prevent degradation of cellular proteins.
- the inhibitors of the present invention may preferably be used in a manner analogous to the way that aprotinin, or other known serine protease inhibitors, are used.
- aprotinin as a protease inhibitor for preparation of cellular extracts is well known in the art, and aprotinin is sold commercially for this pu ⁇ ose.
- the present invention, thus generally described, will be understood more readily by reference to the following examples, which are provided by way of illustration and are not intended to be limiting of the present invention.
- EXAMPLES Example 1. Expression of wild-type KPI (-4 ⁇ 57)
- Plasmid pTW10:KPI is a bacterial expression vector encoding the 57 amino acid form of KPI fused to the bacterial phoA signal sequence.
- the strategy for the construction of pTW10:KPI is shown in Figure 1. Plasmid pcDNAII (Invitrogen, San Diego, CA) was digested with vwII and the larger of the two resulting PvuR fragments (3013 bp) was isolated.
- Bacterial expression plasmid pSP26 was digested with Mlul and RsrU, and the 409 bp Mlul-RsrU fragment containing the pT ⁇ promoter element and transcription termination signals was isolated by electrophoresis in a 3% NuSieve Agarose gel (FMC Co ⁇ ., Rockland, ME). Plasmid pSP26, containing a heparin-binding EGF-like growth factor (HB-EGF) insert between the Ndel and HindUI sites, is described as pNA28 in Thompson et al, J. Biol. Chem. 269:2541 (1994). Plasmid pSP26 was deposited in host E.
- HB-EGF heparin-binding EGF-like growth factor
- a synthetic gene was constructed encoding the bacterial phoA secretory signal sequence fused to the amino terminus of KPI(1 ⁇ 57).
- the synthetic gene contains cohesive ends for Ndel and HindUJ, and also inco ⁇ orates restriction endonuclease recognition sites for Agel, RsrU, AatU and Bam ⁇ U, as shown in Figure 2.
- the synthetic phoA- ⁇ ?l gene was constructed from 6 oligonucleotides of the following sequences (shown 5 '-3'):
- oligonucleotides were phosphorylated and annealed in pairs: 6167 + 6169, 6165 + 6166, 6168 + 6164.
- T4 DNA Ligase Buffer New England Biolabs,
- Plasmid pTW10:KPI was digested with Agel and HindUl; the resulting 152 bp Agel-HindLU fragment containing a portion of the KPI synthetic gene was isolated by preparative gel electrophoresis.
- the annealed oligonucleotides were then ligated to the Agel-HindLU fragment of the KPI (1 ⁇ 57) synthetic gene.
- the resulting 192 bp Xbal-Hind l synthetic gene (shown in Figure 4) was purified by preparative gel electrophoresis, and ligated into plasmid pUC 19 which had previously been digested with Xbal and HindUl.
- the ligation products were used to transform E. coli strain MCI 061. Ampicillin-resistant colonies were picked and used to prepare plasmid pKPI-57 by standard methods.
- pKPI-57 was digested with Xbal and Agel and the smaller fragment replaced with annealed oligos 234 + 235, which encode 4 amino acid residues of yeast ⁇ -mating factor fused a 4 amino acid residue amino-terminal extension ofKPI(l ⁇ 57).
- CTAGATAAAAGAGAGGTTGTTAGAGAGGTGTGCTCTGAACAAGCTGAGA 235 CCGGTCTCAGCTTGTTCAGAGCACACC ⁇ CTCTAACAACC ⁇ CTCTTTTAT
- the 4 extra amino acids are encoded in the amyloid ⁇ -protein precursor/protease nexin-2 (APPI) which contains the KPI domain.
- APPI amyloid ⁇ -protein precursor/protease nexin-2
- Figure 5 The synthetic 201 bp Xbal-HindLU fragment encoding KPI(-4 ⁇ 57) in pKPI-61 is shown in Figure 5.
- Plasmid pSP35 was constructed from yeast expression plasmid pYES2 (Invitrogen, San Diego, CA) as follows. A 267 bp PvuU-Xbal fragment was generated by PCR from yeast ⁇ - mating factor DNA using oligos 6274 and 6273:
- 6274 GGGGGCAGCTGTATAAACGATTAAAA 6273: GGGGGTCTAGAGATACCCCTTCTTCTTTAG
- This PCR fragment encoding an 82 amino acid portion of yeast ⁇ -mating factor, including the secretory signal peptide and pro-region, was inserted into pYES2 that had been previously digested with PvuU and Xbal.
- the resulting plasmid is denoted pSP34.
- Two oligonucleotide pairs, 6294 + 6292 were then ligated to 6290 + 6291, and the resulting 135 bp fragment was purified by gel electrophoresis.
- pSP35 was digested with Xbal and HindUl to remove the insert, and ligated with the 201 bp Xbal-HindLU fragment of pKPI-61, encoding KPI
- the resulting plasmid pTWl 13 encodes the 445 bp synthetic gene for the ⁇ - factor-KPI(-4 ⁇ 57) fusion. See Figure 7.
- the cell pellet was resuspended in 200 ml ice-cold water, respun, and resuspended in 100 ml ice-cold water, then pelleted again.
- the washed cell pellet was resuspended in 10 ml ice-cold 1M sorbitol, recentrifuged, then resuspended in a final volume of 0.2 ml ice-cold 1M sorbitol.
- a 40 ml aliquot of cells was placed into the chamber of a cold 0.2 cm electroporation cuvette (Invitrogen), along with 100 ng plasmid DNA for pTWl 13.
- the cuvette was placed into an Invitrogen Electroporator II and pulsed at 1500 V, 25F, 100 ⁇ . Electroporated cells were diluted with 0.5 ml 1M sorbitol, and 0.25 ml was spread on an SD agar plate containing 1M sorbitol. After 3 days' growth at 30°C, individual colonies were streaked on SD + CAA agar plates.
- Yeast cultures were grown in a rich broth and the galactose promoter of the KPI expression vector induced with the addition of galactose as described by Sherman, Methods Enzymol. 194:3 (1991).
- a single well-isolated colony of pTW113/ABL115 was used to inoculate a 10 ml overnight culture in Yeast Batch Medium.
- 1L Yeast Batch Medium which had been made 0.2% glucose was inoculated to an OD ⁇ oo of 0.1 with the overnight culture.
- the 1L culture was induced by the addition of 20 ml Yeast Galactose Feed Medium.
- Example 2 Recombinant Expression of site-directed KPI(-4 ⁇ 57) variants
- Expression vectors for the production of specific variants of KPI(-4 ⁇ 57) were all constructed using the pTWl 13 backbone as a starting point.
- an expression construct was created by replacing the 40 bp RsrU-AatU fragment of the synthetic KPI gene contained in pTWl 13 with a pair of annealed oligonucleotides which encode specific codons mutated from the wild-type KPI(-4 ⁇ 57) sequence.
- the convention used for designating the amino substituents in the KPI variants indicates first the single letter code for the amino acid found in wild-type KPI, followed by the position of the residue, followed by the code for the replacement amino acid.
- M15R indicates that the methionine residue at position 15 is replaced by an arginine.
- Plasmid pTWl 13 was digested with Asr ⁇ and AatU, and the larger of the two resulting fragments was isolated.
- An oligonucleotide pair (812 + 813) was phosphorylated, annealed and gel- purified as described above.
- Figures 12-19 show the synthetic genes for the ⁇ -factor fusions with each KPI(-4 ⁇ 57) variant.
- Transformation of yeast with expression vectors Yeast strain ABL115 was transformed by electroporation exactly according to the protocol described for transformation by pTWl 13.
- KPI(-4 ⁇ 57) variants were purified according to the procedure described for KPI (-4 ⁇ 57).
- the amino acid sequences of KPI(-4 ⁇ 57) variants are shown in Figures 27-36.
- Vector pSP26__4mp:Fl contributes the basic plasmid backbone for the construction of the phage display vector for the phoA:KPl fusion, pDWl #14.
- pS?26- ⁇ mp:F ⁇ contains a low- copy number origin of replication, the ampicillin-resistance gene (Amp) and the FI origin for production of single-stranded phagemid DNA.
- the ampicillin-resistance gene was generated through polymerase chain reaction (PCR) amphfication from the plasmid genome of PUC19 using oligonucleotides 176 and 177.
- PCR amplification of Amp was done according to standard techniques, using Taq polymerase (Perkin-Elmer Cetus, Norwalk, CT). Amplification from plasmid pUC19 with these oligonucleotides yielded a fragment of 1159 bp, containing PflMl and Clal restriction sites.
- the PCR product was digested with PflMl and Clal and purified by agarose gel electrophoresis in 3% NuSieve Agarose (FMC Co ⁇ .).
- Bacterial expression vector pSP26 (supra) was digested with Pfl U and Clal and the larger vector fragment was purified.
- the PflMl-Clal PCR fragment was ligated into the previously digested pSP26 containing the Amp gene.
- the ligation product was used to transform E. coli strain MCI 061 and colonies were selected by ampicillin resistance.
- the resulting plasmid is denoted pSP26_4mp.
- the FI origin of replication from the mammalian expression vector pcDNAH (Invitrogen) was isolated in a 692 bp E ⁇ rl fragment. Plasmid pcDNAH was digested with Earl and the resulting 692 bp fragment purified by agarose gel electrophoresis. Earl-Notl adapters were added to the 692 bp Earl fragment by ligation of two annealed oligonucleotide pairs, 179 + 180 and 181 + 182. The oligo pairs were annealed as described above.
- the oligonucleotide-ligated fragment was then ligated into the single Notl site of ?S?26 ⁇ - mp to yield the vector pSP26_ m/7.Fl.
- pgHI The construction of pgHI is outlined in Figure 44.
- the portion of the phage genei ⁇ protein gene contained by the PDWl #14 phagemid vector was originally obtained as a PCR amplification product from vector ml3mp8.
- a portion of ml3mp8 genelH encoding the carboxyl-terminal 158 amino acid residues of the genei ⁇ product was isolated by PCR amplification of ml3mp8 nucleotide residues 2307-2781 using PCR oligos 6162 and 6160.
- the PCR oligos contain Bam U and HindUl restriction recognition sites such that PCR from ml3mp8 plasmid D ⁇ A with the oligo pair yielded a 490 bp BamtU- Hind U fragment encoding the appropriate portion of genei ⁇ .
- the PCR product was ligated between the Ba Hl and HindUl sites within the polylinker of PUC19 to yield plasmid pgHI.
- the 490 bp BamiU-HindUl fragment of pgEQ encoding the C- terminal portion of the genelH product was then isolated and ligated between the Bam U and HindUl sites of pRAoA:KPI to yield vector pRAoa:KPI:gffl.
- the pRAoA:KPI:gIH vector encodes a 236 amino acid residue fusion of thephoA signal peptide, KPI (1 ⁇ 57) and the carboxyl-terminal portion of the genelH product.
- FIG. 46 Construction of pLGl is illustrated in Figure 46.
- the exact genei ⁇ sequences contained in vector PDWl #14 originate with phage display vector pLGl.
- a modified genei ⁇ segment was generated by PCR amplification of the genelH region from pglH using PCR oligonucleotides 6308 and 6305.
- BamiU-HindUl fragment encoding a genei ⁇ product shortened by 3 amino acid residues at the amino-terminal portion of the segment of the geneHI fragment encoded by pgl ⁇ .
- a 161 bp Ndel-Bam U fragment was generated by PCR amplification from bacterial expression plasmid pTHW05 using oligonucleotides 6306 and 6307.
- Vector pAL51 contains the genei ⁇ sequences of pLGl which are to be inco ⁇ orated in vector pDWl #14.
- a 1693 bp fragment of plasmid pBR322 was isolated, extending from the
- Plasmid pLGl was digested with _4_sp7181 and BamhU, removing an 87 bp fragment. The overhanging Asp71Sl end was blunted by treatment with Klenow fragment, and the PvuU-BamHl fragment isolated from pBR322 was Ugated into this vector, resulting in the insertion of a 1693 bp "sniffer" region between the Asp71 ' l and BamYU sites. The 78 bp Ndel- Asp71Zl region of the resulting plasmid was removed and replaced with the annealed oligo pair 6512 + 6513.
- the newly created 74 bp Ndel-Asp71 ' l fragment encodes the phoA signal peptide, and contains a BstEU cloning site.
- the resulting plasmid is denoted pAL51.
- Plasmid pAL53 contributes most of the vector sequence of pDWl #14, including the basic vector backbone with Amp gene, FI origin, low copy number origin of replication, genei ⁇ segment, phoA promoter and pho A signal sequence. Plasmid pAL51 was digested with Ndel and HindUl and the resulting 2248 bp
- Ndel-HindlU fragment encoding the phoA signal peptide, sniffer region and geneDI region was isolated by preparative agarose gel electrophoresis.
- the Ndel-HindL . fragment was ligated into plasmid pSP26__4/7./?:Fl between the Ndel and HindUl sites, resulting in plasmid pAL52.
- the AoA promoter region and signal peptide was generated by amplification of a portion of the E. coli genome by PCR, using oligonucleotide primers 405 and 406.
- the resulting PCR product is a 332 bp Mlul-BstEU fragment, which contains the phoA promoter region and signal peptide sequence. This fragment was used to replace the 148 bp Mlul-BstEU segment of pAL52, resulting in vector pAL53.
- FIG. 49 Construction of pSP26:Amp:Fl:PhoA:KPI:gIII Construction of pSP26_ m/7:Fl:P ⁇ oA:KPI:gi ⁇ is illustrated in Figure 49.
- This particular vector is the source of the KPI coding sequence found in vector pDWl #14.
- Plasmid pPhoa.:KPl:gUl was digested with Ndel and HindUl, and the resulting 714 bp Ndel-HindUl fragment was purified, and then inserted into vector pSP26_ ⁇ m/7:Fl between the Ndel and HindUl sites.
- the resulting plasmid is denoted pSP26 m/7:Fl :PAoA:KPI:gi ⁇ .
- KPI were amplified from plasmid by PCR, using oligonucleotide primers 424 and 425.
- the resulting 172 bp ⁇ tE ⁇ -5 ⁇ m ⁇ I fragment encodes most of KPI (155). This fragment was used to replace the stuffer region in pAL53 between the BstEU and Bam ⁇ U sites.
- the resulting plasmid, pDWl #14, is the parent KPI phage display vector for preparation of randomized KPI phage libraries.
- the coding region for the phoA-KPI (155)-gene_H fusion is shown in Figure 56.
- pDWl 14-2 Construction of pDWl 14-2 is illustrated in Figure 57.
- the first step in the construction of the KPI phage Ubraries in pDWl #14 was the replacement of the Agel- Bam ⁇ U fragment within the KPI coding sequence with a stuffer fragment. This greatly aids in preparation of randomized KPI Ubraries, which are substantially free of contamination of phagemid genomes encoding wild-type KPI sequence.
- Plasmid pDWl #14 was digested with Agel and Bam ⁇ U, and the 135 bp Agel-
- Bam ⁇ U fragment encoding KPI was discarded.
- a stuffer fragment was created by PCR amplification of a portion of the pBR322 7et gene, extending from the Bam ⁇ l site at nucleotide 375 to nucleotide 1284, using oUgo primers 266 and 252.
- the resulting 894 bp Agel-Bam U stuffer fragment was then inserted into the geI/5 ⁇ /nHI-digested pDWl #14 to yield the phagemid vector pDWl 14-2.
- This vector was the starting point for construction of the randomized KPI libraries.
- KPI Library 16-19 is outlined in Figure 58.
- Library 16-19 was constructed to display KPI-genei ⁇ fusions in which amino acid positions Ala 14 , Met 15 , He 16 and Ser 17 are randomized.
- plasmid pDWl 14-2 was digested with Agel and Bam ⁇ U to remove the stuffer region, and the resulting vector was purified by preparative agarose gel electrophoresis.
- Plasmid pDWl #14 was used as template in a PCR amplification of the KPI region extending from the Agel site to the Bam ⁇ U site.
- the oligonucleotide primers used were 544 and 551.
- Oligonucleotide primer 544 contains four randomized codons of the sequence NNS, where N represents equal mixtures of A/G/C T and S an equal mixture of G or C. Each NNS codon thus encodes all 20 amino acids plus a single possible stop codon, in 32 different DNA sequences.
- PCR amplification from the wild-type KPI gene resulted in the production of a mixture of 135 bp Agel-BamHl fragments all containing different sequences in the randomized region.
- the PCR product was purified by preparative agarose gel electrophoresis and ligated into the AgeVBamYU digested pDWl 14-2 vector.
- the ligation mixture was used to transform E. coli Topi OF 1 cells (Invitrogen) by electroporation according to the manufacturer's directions.
- the resulting Library 16-19 contained approximately 400,000 independent clones.
- the potential size of the Ubrary, based upon the degeneracy of the priming PCR oligo #544 was 1,048,576 members.
- the expression unit encoded by the members of Library 16-19 is shown in Figure 59.
- M13KO7 helper phage as described by Matthews et al, Science 260:1113 (1993).
- Human plasma kallikrein Enzyme Research Laboratories, South Bend, IN
- Bound phage were eluted sequentiaUy by successive 5 minute washes: 0.5 ml 50mM sodium citrate, pH 6.0, 150mM NaCl; 0.5 ml 50mM sodium citrate, pH 4.0, 150mM NaCl; and 0.5 ml 50mM glycine, pH 2.0, 150mM NaCl. Eluted phage were neutralized immediately and phagemids from the pH 2.0 elution were titered and amplified for reselection. After three rounds of selection on kalUkrein-Sepharose, phagemid DNA was isolated from 22 individual colonies and subjected to DNA sequence analysis.
- KPI The most frequently occurring randomized KPI region encoded: Ala 14 -Ala 15 -Ile 16 - Phe 17 .
- the AoA-KPI-geneHI region encoded by this class of selected KPI phage is shown in Figure 60.
- the KPI variant encoded by these phagemids is denoted KPI (155; Ml 5 A, SI 7F).
- FIG. 61 outlines the construction of pDD185 KPI (-4 ⁇ 57; M15A, S17F).
- the sequences encoding KPI were moved from one phagemid vector, pDWl (16-19) 185, to the yeast expression vector so that the KPI variant could be purified and tested.
- Plasmid pTW113 encoding wild-type KPI (-4 ⁇ 57) was digested with Agel and BamiU and the 135 bp Agel-BamHl fragment was discarded.
- the 135 bp Agel-BamHl fragment of pDWl (16-19) 185 was isolated and Ugated into the yeast vector to yield plasmid pDD185, encoding ⁇ -factor fused to KPI (-4 ⁇ 57; M15A, S17F). See Figure
- Transformation of yeast strain ABL115 with pDD185, induction of yeast cultures, and purification of KPI (-4 ⁇ 57; M15A, S17F) pDD185 was accompUshed as described for the other KPI variants.
- Library 6 was constructed to display KPI-geneHI fusions in which amino acid positions Ala 14 , He 16 , Ser 17 and Arg 18 are randomized, but position 15 was held constant as Ala.
- plasmid pDWl #14 was used as the template in a PCR amplification of the KPI region extending from the Agel site to the Bam l site.
- the oUgonucleotide primers used were 551 and 1003.
- Oligonucleotide primer 1003 contained four randomized codons of the sequence NNS, where N represents equal mixtures of A G/C/T and S an equal mixture of G or C. Each NNS codon thus encodes all 20 amino acids plus a single possible stop, in 32 different DNA sequences.
- PCR ampiificaUon from the wild-type KPI gene resulted in the production of a mixture of 135 bp Agel-BamHL fragments all containing different sequences in the randomized region.
- the PCR product was phenol extracted, ethanol precipitated, digested with BamlU and purified by preparative agarose gel electrophoresis. Plasmid pDWl 14-2 was digested with BamlU, phenol extracted and ethanol precipitated.
- the msert was ligated at high molar rauo to the vector, which was then digested with Agel to remove the stuffer region.
- the vector containing the insert was purified by agarose gel electrophoresis and recircula ⁇ zed.
- the resulting Ubrary contains approximately 5x10 ⁇ independent clones.
- Library 7 was constructed to display KPI-geneHI fusions in which amino acid positions Ala 14 , Met 15 , He 16 , Ser 17 and Arg 18 are randomized.
- plasmid pDWl #14 was used as template in a PCR amplification of the KPI region extending from the Agel site to the BamlU site.
- the ohgonucleotide primers used were 551 and 1179.
- Ohgonucleotide p ⁇ mer 1179 contains five randomized codons of the sequence NNS, where N represents equal mixtures of A G/C T and S an equal mixture of G or C. Each NNS codon thus encoded all 20 amino acids plus a single possible stop, in 32 different DNA sequences.
- PCR ampUfication from the wild-type KPI gene resulted in the production of a mixture of 135 bp Agel-BamkU fragments all containing different sequences in the randomized region.
- the PCR product was phenol extracted, ethanol precipitated, digested with BamlU and purified by preparative agarose gel electrophoresis. Plasmid pDWl 14-2 was digested with BamlU, phenol extracted and ethanol precipitated.
- Factor XHa (0.5 mg) in 5mM sodium acetate pH 8.3 was incubated with Biotin Ester (Zymed) at room temperature for 1.5 h, then buffer-exchanged into assay buffer (AB). Approximately lxlO 10 phage panicles of each amplified Library 6 or 7 in PBS, pH 7.5, containing 300mM NaCl and 0.1% gelatin, were incubated with 50 pmoles of active biotinylated human factor XHa in a total volume of 200 ⁇ l. Phage were allowed to bind for 2 h at room temperature, with rocking.
- Bound phage were eluted sequentially by successive 5 minute washes: 0.5 ml 50mM sodium citrate, pH 6.0, 150mM NaCl; 0.5 ml 50mM sodium citrate, pH 4.0, 150mM NaCl; and 0.5 ml 50mM glycine, pH 2.0, 150mM NaCl. Eluted phage were neutralized immediately and phagemids from the pH 2.0 elution were titered and ampUfied for reselection. After 3 or 4 rounds of selection with factor XHa, phagemid DNA was isolated from individual colonies and subjected to DNA sequence analysis.
- Sequences in the randomized regions were compared with one another to identify consensus sequences appearing more than once. From Library 6 a phagemid was identified which encoded M15L, S17Y, R18H. From Library 7 a phagemid was identified which encoded Ml 5 A, S17Y, R18H.
- Library P48 was constructed to for expression of KPI (Ml 5 A, S17Y, R18H) IN WHICH AMINO ACID n which amino acid position Tyr 48 is randomized. Construction of Library P48 is detailed in Figure 55.
- plasmid pDWl- L6-16 encoding the pBG022 KPI peptide as a fusion with the ml3 glH protein, was used as template in a PCR ampUfication of the KPI region extending from the RsrU site to the BamlU site.
- the oligonucleotide primers used were 1663 and 1945. 1663 : GCTTTACTGTTTACCCCGGTGACCAAAGCCGAGGTGTGC
- Oligonucleotide primer 1945 contains a single randomized codon of the sequence SNN, where N represents equal mixtures of A G/C/T and S an equal mixture of G or C.
- PCR ampUfication from the wild- type KPI gene resulted in the production of a mixture of RsrU-BamiU fragments all containing different sequences in the randomized region.
- the PCR product was phenol extracted, ethanol precipitated, digested with RsrU and BamlU and purified by preparative agarose gel electrophoresis.
- Plasmid pBG022 was digested with RsrU and BamlU, phenol extracted and ethanol precipitated.
- the insert was ligated at high molar ratio to the vector.
- the vector containing the insert was purified by agarose gel electrophoresis and recircularized.
- KPI 155; M15L, S17Y, R18H
- KPI 155; M17A, S17Y, R18H
- Plasmid pTWl 13 encoding wild-type KPI (-4 ⁇ 57) was digested with Agel and BamlU and the 135 bp Agel-BamiU fragment was discarded.
- the 135 bp Agel-BamlU fragment of the phagemid vectors were isolated and Ugated into the yeast vector to yield plasmids pBG015 and pBG022, encoding yeast oc-factor fused to KPI (-4 ⁇ 57; M15L, S17Y, R18H), and KPI (-4 ⁇ 57; M15A, S17Y, R18H, having spontaneous mutation Y48H), respectively.
- Figure 20 shows the synthetic gene for the oc-factor fusion with KPI variant (-4 ⁇ 57; M15A, S17Y, R18H, having spontaneous mutation Y48H).
- Figure 37 shows the amino acid sequence of KPI variant (-4 ⁇ 57; M15A, S17Y, R18H, having spontaneous mutation Y48H).
- Plasmid pBG022 was digested with Xbal and RsrU, and the larger of the two resulting fragments was isolated.
- An oUgonucleotide pair (1593 + 1642) was phosphorylated, annealed and gel-purified as described previously.
- the annealed oligonucleotides were ligated into the Xbal and R5rH-digested pBG022, and the Ugation product was used to transform E. coli strain MCI 061 to ampicillin resistance.
- the resulting plasmid pBG033, encodes the 445 bp synthetic gene for the yeast oc-factor-KPI (-4 ⁇ 57; T9V, M15A, S17F, R18H) fusion.
- Figure 21 shows the synthetic gene for the oc-factor fusion with KPI variant (-4 ⁇ 57; T9V, M15A, S17Y, R18H, Y48H).
- Figure 38 shows the amino acid sequence of KPI variant (-4 ⁇ 57; T9V, M15A, S17Y, R18H, Y48H).
- FIG. 52 outlines the construction of pBG048 KPI (-4 ⁇ 57; Y48H).
- Plasmid pTW113 encoding wild-type KPI (-4 ⁇ 57) was digested with AatU and BamlU and the 92 bp AatU-BamiU fragment was discarded.
- Plasmid pBG022 encoding KPI (-4- 57; M15L, S17Y, R18H, Y48H) was digested with AatU and BamlU.
- the resulting 92 bp AaiU-BamlU fragment was isolated and Ugated into the yeast vector to yield plasmid pBG048, encoding yeast oc-factor fused to KPI (-4 ⁇ 57; Y48H).
- Figure 22 shows the synthetic gene for the oc-factor fusion with KPI variant (-4 ⁇ 57; Y48H).
- Figure 39 shows the amino acid sequence of KPI variant (-4 ⁇ 57; 48H).
- Plasmid pBG022 encoding KPI (-4 ⁇ 57; M15A, S17Y, R18H, Y48H) was digested with AatU and BamlU and the 92 bp AatU-BamlU fragment was discarded.
- Plasmid pTWl 13 encoding wild-type KPI (-4 ⁇ 57) was digested with ⁇ t ⁇ and Bam ⁇ U.
- the resulting 92 bp AatU-BamlU fragment was isolated and Ugated into the yeast vector to yield plasmid pBG048, encoding yeast oc-factor fused to KPI (-4 ⁇ 57; M15A, S17Y,
- Figure 23 shows the synthetic gene for the oc-factor fusion with KPI variant
- Figure 40 shows the amino acid sequence of KPI variant
- Figure 54 outlines the construction of pBG050 KPI (-4 ⁇ 57; T9V, M15A, S17Y, R18H).
- Plasmid pBG033 encoding KPI (-4 ⁇ 57; T9V, M15A, R18H, Y48H) was digested with AatU and BamlU and the 92 bp AatU-BamlU fragment was discarded.
- Plasmid pTWl 13 encoding wild-type KPI (-4 ⁇ 57) was digested with ⁇ tH and BamlU.
- FIG. 24 shows the synthetic gene for the oc-factor fusion with KPI variant (-4 ⁇ 57; T9V, M15A, S17Y, R18H).
- Figure 41 shows the amino acid sequence of KPI variant (-4 ⁇ 57; T9V, M15A, S17Y, R18H).
- Plasmid pBG015 was digested with Xbal and RsrU, and the larger of the two resulting fragments was isolated.
- An oligonucleotide pair (1593 + 1642) was phosphorylated, annealed and gel-purified as described previously.
- the annealed oUgonucleotides were Ugated into the Xbal and ⁇ sr ⁇ -digested pBG015, and the ligation product was used to transform E. coli strain MCI 061 to ampicillin resistance.
- the resulting plasmid pBG029 encodes the 445 bp synthetic gene for the yeast oc-factor-KPI (-4 ⁇ 57; T9V, M15L, S17F, R18H) fusion.
- Bound phage were eluted sequentially by successive 5 minute washes: 0.5 ml 50mM sodium citrate, pH 6.0, 150mM NaCl; 0.5 ml 50mM sodium citrate, pH 4.0 150mM NaCl; and 0.5 ml 50mM glycine, pH 2.0, 150mM NaCl. Eluted phage were neutralized immediately and phagemids from the pH 2.0 elution were titered and amplified for reselection. After three rounds of selection on Xa- Sepharose, phagemid DNA was isolated and subjected to DNA sequence analysis.
- Plasmid pTWl 13 encoding wild-type KPI (-4 ⁇ 57) was digested with Agel and BamlU and the 135 bp Agel-BamlU fragment was discarded.
- the 135 bp Agel-BamHl fragment of the phagemid vector was isolated and ligated into the yeast vector to yield plasmid pDD131, encoding yeast oc-factor fused to KPI (-4 ⁇ 57; M15L, I16F, S17K).
- Plasmid pDD131 was digested with Aatl and BamlU, and the larger of the two resulting fragments was isolated. An oUgonucleotide pair (738 + 739) was phosphorylated, annealed and gel-purified as described previously.
- the annealed oligonucleotides were ligated into the Aatl and if ⁇ mHI-digested pDD131, and the ligation product was used to transform E. coli strain MCI 061 to ampicillin resistance.
- the resulting plasmid pDD134 encodes the 445 bp synthetic gene for the yeast oc-factor-KPI (-4 ⁇ 57; M15L, I16F, S17K, G37Y) fusion.
- Plasmid pDD131 was digested with AatU and BamlU, and the larger of the two resulting fragments was isolated.
- An oligonucleotide pair (738 + 739) was phosphorylated, annealed and gel-purified as described previously.
- the annealed oUgonucleotides were ligated into the AatU and -B ⁇ mHI-digested pDD131, and the Ugation product was used to transform E. coli strain MC1061 to ampicillin resistance.
- the resulting plasmid pDD135 encodes the 445 bp synthetic gene for the yeast oc-factor-KPI (-4 ⁇ 57; M15L, I16F, S17K, G37L) fusion.
- concentrations of active human plasma kallikrein, factor XHa, and trypsin were determined by titration with p-nitrophenyl p'-guanidinobenzoate as described by Bender et al, supra, and Chase et al, Biochem. Biophys. Res. Commun. 29:508 (1967).
- Accurate concentrations of active KPI(-4 ⁇ 57) inhibitors were determined by titration of the activity of a known amount of active-site-titrated trypsin.
- each KPI(-4 ⁇ 57) variant (0.5 to lOOnMj was incubated with protease in low-binding 96-well microtiter plates at 30°C for 15-25 min, in lOOmM Tris- HC1, pH 7.5, with 500mM NaCl, 5mM KC1, 5mM CaC12, 5mM MgC12, 0.1% Difco gelatin, and 0.05% Triton X-100. Chromogenic synthetic substrate was then be added, and initial rates at 30°C recorded by the SOFTmax kinetics program via a T ⁇ ERMOmax microplate reader (Molecular Devices Co ⁇ ., Menlo Park, CA).
- the substrates used were N- ⁇ -benzoyl-L-Arg p-nitroanilide (ImM) for trypsin (20nM), and N-benzoyl-Pro-Phe-Arg p-nitroanilide (0.3mM) for plasma kallikrein (InM).
- the Enzfitter (Elsevier) program was used both to plot fractional activity (i.e., activity with inhibitor, divided by activity without inhibitor), a, versus total concentration of inhibitor, It, and to calculate the dissociation constant of the inhibitor (Kj) by fitting the curve to the following equation:
- KjS determined for purified KPI variants are shown in Figures 63 and 69.
- the most potent variant, KPI (-4 ⁇ 57; M15A, S17F) DD185 is 115-fold more potent as a human kallikrein inhibitor than wild-type KPI (-4 ⁇ 57).
- the least potent variant, KPI (-4 ⁇ 57; I16H, S17W) TW6185 is still 35-fold more potent than wild-type KPI.
- factor XHa For testing against factor XHa, essentially the same reaction conditions were used, except that the substrate was N-benzoyl-Ile-Glu-Gly-Arg p-nitroaniline hydrochloride and its methyl ester (obtained from Pharmacia Hepar, Franklin, OH), and com trypsin inhibitor (Enzyme Research Laboratories, South Bend, IN) was used as a control inhibitor.
- Factor XHa was also obtained from Enzyme Research Laboratories.
- KPI-BG022 was tested for its ability to delay transplant rejection in a rat model of acute xenograft rejection. Xenotransplantation of vascularized organs between discordant species results in hyperacute graft rejection within minutes to hours after graft reperfusion. Cardiac xenografts from male Hartley guinea pigs were heterotopically grafted into male rats that were complement deficient. Experimental animals received 5 mg kg KPI-BG022 IV prior to reperfusion, and control animals received saline placebo. The data in Figure 70 demonstrate that a single KPI-BG022 dose significantly prolongs survival of guinea pig hearts grafted into complement- deficient rats.
- Example 7 Effect of KPI Variant KPI-BG022 on Ulcerative Colitis
- KPI-BG022 was tested in a rat model of TNBS (trinitrobenzene sulfonic acid) induced -colitis. Animals were subjected to intracolonic instillation of TNBS to induce inflammation and ulceration. Tail-vein injection of KPI or vehicle was begun at the time of TNBS infusion and continued with three different dosing regimens: twice daily injections for 7 days; once daily injections for 7 days; and, two injections only in the day following injury. In each treatment group, half of the animals were sacrificed and scored for colonic injury 8 days following injury, and the remaining animals were sacrificed at 14 days.
- TNBS trinitrobenzene sulfonic acid
- KPI-BG022 will be tested in an ovine model of cardiopulmonary bypass- associated pulmonary pathophysiology and blood loss and conducted as described in Friedman, M., Sellke, F.W., Wang, S.Y., Weintraub, R.M., and Johnson, R.G. (1994) Circulation 90: II262-II268; Friedman, M., Wang, S.Y., Sellke, F.W., Cohn, W.E., Weintraub, R.M., and Johnson, R.G. (1996) J. Thorac. Cardiovasc. Surg. Ill: 460- 468) with modifications as follows: Surgical procedures:
- Lymph fluid will be collected from the lungs as follows: the efferent duct of the caudal mediastinal lymph node will be cannulated through a right thoracotomy in the fifth intercostal space using a silicone, heparin-coated catheter.
- a midline stemotomy will be performed and the pulmonary artery (PA) isolated and surrounded with an ultrasonic flowmeter (Transonic System, Ithaca, NY). Animals will be heparinized to achieve an activated clotting time (ACT) > 750 seconds as monitored using a Hemochron device. At the end of CPB the heparin will be reversed with protamine sulphate to baseline ACT.
- a catheter will be inserted into the left atrium (LA) for blood withdrawl and pressure recording, and the PA will be cannulated for continuous pressure monitoring. Venous drainage will be provided by a cannula in the right atrium (RA) and an aortic perfusion catheter will be placed in the aorta.
- the extraco ⁇ oreal circuit will consist of a roller pump (Cardiovascular Instruments, Wakefield, MA) and bubble oxygenator (Bently Bio-2, Baxter Health Care). The circuit will be primed with 1 1 lactated Ringer's solution.
- Myocardial protection will be provided by antegrade cold blood cardioplegia at 4°C using a 4:1 ratio of autologous blood to crystalloid cardioplegia (KC1 60 meq, mannitol 12.5 g, citrate-phosphate-dextrose solution 50 mL, THAM 10 meq, 5% dextrose and saline 0.225% QS). Iced slush will be used for topicial cooling to augment the cardioplegia.
- aortic cross-clamp cardioplegia Immediately after application of the aortic cross-clamp cardioplegia will be given until arrest of the heart and then reinfiised every 20 minutes. With institution of CPB all animals will be cooled to a core temperature of 27°C. After a mean time of 50 minutes, rewarming will be commenced approximately 10 minutes before removal of aortic cross-clamp to achieve a core temperature of 37°C at the termination of bypass. Flow will be maintained to keep aortic mean pressure not less than 40 mm/Hg. Norepinephrine bitartrate injection will be given through the CVP line to all animals after termination of CPB with an incrementally decreasing infusion rate until the infusion is stopped one hour post- CPB.
- Hemodyamic measurements will be made before institution of CPB (baseline), every 30 minutes during bypass and every 15 minutes for the first hour after termination of CPB. Thereafter measurements will be made every 30 minutes for 3 hours. Cardiac output will be determined as pulmonary artery flow (Qpa in L/min) or, during CPB, as pump flow. Cardiac index (CI), systemic vascular index (SVRI), pulmonary vascular resistance index (PVRI), will be calculated by standard equations. Simultaneous with the hemodynamic measurements, 2 ml blood samples will be collected from left and right artria and placed into ice-cooled EDTA tubes. Hematocrit, blood gases, and oxygen content will be measured for each sample. After blood is centrifuged, supernatant platelet, counts and white blood cell counts will be performed.
- Cardiac output will be determined as pulmonary artery flow (Qpa in L/min) or, during CPB, as pump flow. Cardiac index (CI), systemic vascular index (SVRI),
- Lymph volume will be measured and the protein content determined. Lymph protein clearance will be calculated as milliliters lung lymph flow per 30 minutes x lymph:plasma protein ratio. Protein clearance is considered reflective of the degree to which larger molecules leak into the lymph, as an indication of damage greater than that seen with lymph fluid flow alone.
- CPB total, non-pulsatile hypothermic CPB will be continued for 90 minutes with a cross-clamp time of 1 hour. Rewarming will start 10 minutes before removal of the cross-clamp and will be continued until a core temperature of 37°C is attained. CPB will be terminated when core temperature has stabilized at 37°C. Post-CPB monitoring will continue for 3 hours. Protamine will be given in the first 30 minutes post-CPB, and when ACT has been reduced to baseline levels the chest will be closed with a large-bore thoracostomy tube left in place for drainage.
- Blood and hemoglobin loss measurements The thoracostomy tube will be connected to a drainage system and suction applied at a force of 10 kPa. Drain losses will be collected for a total of two hours post-CPB, and then the stemotomy wound will be reopened and all shed blood will be aspirated from the thorax and pericardium. The volume of blood loss and hemoglobin will be measured and used to calculate the total hemoglobin loss in grams. Based on previous experience with this (Friedman et al, 1994; Friedman et al, 1996) model the control group should demonstrate several parameters of pulmonary injury, including increases in: pulmonary vascular resistance (PVR) (170% increase reported), pulmonary lymph flow (233% reported), and lung water (15% reported). An increase in sequestration of WBCs and platelets in the lung should be seen in the control group. Arterial oxygenation (PaO 2 ) should fall significantly upon cessation of CPB with a gradual recovery in the post-bypass period.
- PVR pulmonary vascular
Abstract
Description
Claims
Priority Applications (4)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
JP2000552284A JP2002517197A (en) | 1998-06-03 | 1999-06-03 | Protease inhibitor peptide |
CA002330191A CA2330191A1 (en) | 1998-06-03 | 1999-06-03 | Protease inhibitor peptides |
AU42295/99A AU4229599A (en) | 1998-06-03 | 1999-06-03 | Protease inhibitor peptides |
EP99926138A EP1082431A2 (en) | 1998-06-03 | 1999-06-03 | Protease inhibitor peptides |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US8788598P | 1998-06-03 | 1998-06-03 | |
US60/087,885 | 1998-06-03 |
Publications (2)
Publication Number | Publication Date |
---|---|
WO1999063090A2 true WO1999063090A2 (en) | 1999-12-09 |
WO1999063090A3 WO1999063090A3 (en) | 2000-03-02 |
Family
ID=22207848
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/US1999/012276 WO1999063090A2 (en) | 1998-06-03 | 1999-06-03 | Protease inhibitor peptides |
Country Status (5)
Country | Link |
---|---|
EP (1) | EP1082431A2 (en) |
JP (1) | JP2002517197A (en) |
AU (1) | AU4229599A (en) |
CA (1) | CA2330191A1 (en) |
WO (1) | WO1999063090A2 (en) |
Cited By (11)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
JP2005534647A (en) * | 2002-06-07 | 2005-11-17 | ダイアックス、コープ | Prevention and reduction of blood loss |
US7704949B2 (en) | 2002-06-07 | 2010-04-27 | Dyax Corp. | Kallikrein-inhibitor therapies |
US7718617B2 (en) | 2002-08-28 | 2010-05-18 | Dyax Corp. | Methods for preserving organs and tissues |
US8188045B2 (en) | 2004-09-27 | 2012-05-29 | Dyax Corp. | Kallikrein inhibitors and anti-thrombolytic agents and uses thereof |
US8637454B2 (en) | 2009-01-06 | 2014-01-28 | Dyax Corp. | Treatment of mucositis with kallikrein inhibitors |
US8663629B2 (en) | 1994-01-11 | 2014-03-04 | Dyax Corp. | Kallikrein-binding “kunitz domain” proteins and analogues thereof |
US8816055B2 (en) | 2011-01-06 | 2014-08-26 | Dyax Corp. | Plasma kallikrein binding proteins |
US8822653B2 (en) | 2010-01-06 | 2014-09-02 | Dyax Corp. | Plasma kallikrein binding proteins |
WO2017098516A1 (en) * | 2015-12-10 | 2017-06-15 | The National Institute for Biotechnology in the Negev Ltd. | VARIANTS OF AMYLOID beta-PROTEIN PRECURSOR INHIBITOR DOMAIN |
CN110051830A (en) * | 2019-03-14 | 2019-07-26 | 苏州新凝生物医药科技有限公司 | A kind of protease nexin II KPI protein mutant application |
US11286307B2 (en) | 2015-12-11 | 2022-03-29 | Takeda Pharmaceutical Company Limited | Plasma kallikrein inhibitors and uses thereof for treating hereditary angioedema attack |
Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1993009233A2 (en) * | 1991-10-31 | 1993-05-13 | The Salk Institute Biotechnology/Industrial Associates Inc. | Recombinant amyloid precursor protein inhibitor domain and treatment of various disease states |
WO1996035788A2 (en) * | 1995-05-08 | 1996-11-14 | Scios, Inc. | Kunitz type protease inhibitors |
US5663143A (en) * | 1988-09-02 | 1997-09-02 | Dyax Corp. | Engineered human-derived kunitz domains that inhibit human neutrophil elastase |
-
1999
- 1999-06-03 CA CA002330191A patent/CA2330191A1/en not_active Abandoned
- 1999-06-03 WO PCT/US1999/012276 patent/WO1999063090A2/en not_active Application Discontinuation
- 1999-06-03 JP JP2000552284A patent/JP2002517197A/en active Pending
- 1999-06-03 EP EP99926138A patent/EP1082431A2/en not_active Withdrawn
- 1999-06-03 AU AU42295/99A patent/AU4229599A/en not_active Abandoned
Patent Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5663143A (en) * | 1988-09-02 | 1997-09-02 | Dyax Corp. | Engineered human-derived kunitz domains that inhibit human neutrophil elastase |
WO1993009233A2 (en) * | 1991-10-31 | 1993-05-13 | The Salk Institute Biotechnology/Industrial Associates Inc. | Recombinant amyloid precursor protein inhibitor domain and treatment of various disease states |
WO1996035788A2 (en) * | 1995-05-08 | 1996-11-14 | Scios, Inc. | Kunitz type protease inhibitors |
Non-Patent Citations (2)
Title |
---|
DENNIS M S ET AL: "KUNITZ DOMAIN INHIBITORS OF TISSUE FACTOR-FACTOR VIIA. II. POTENT AND SPECIFIC INHIBITORS BY COMPETITIVE PHAGE SELECTION" JOURNAL OF BIOLOGICAL CHEMISTRY,US,AMERICAN SOCIETY OF BIOLOGICAL CHEMISTS, BALTIMORE, MD, vol. 269, no. 35, page 22137-22144 XP002015892 ISSN: 0021-9258 * |
LEHNINGER A: "Biochemistry" 1972 , WORTH PUBLISHERS , NEW YORK XP002125112 figures 4-3 * |
Cited By (26)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US8663629B2 (en) | 1994-01-11 | 2014-03-04 | Dyax Corp. | Kallikrein-binding “kunitz domain” proteins and analogues thereof |
US10245307B2 (en) | 2002-06-07 | 2019-04-02 | Dyax Corp. | Prevention and reduction of blood loss |
US7851442B2 (en) | 2002-06-07 | 2010-12-14 | Dyax Corp. | Prevention and reduction of blood loss |
US9114144B2 (en) | 2002-06-07 | 2015-08-25 | Dyax Corp. | Kallikrein-inhibitor therapies |
US7811991B2 (en) | 2002-06-07 | 2010-10-12 | Dyax Corp. | Prevention and reduction of blood loss |
US11344610B2 (en) | 2002-06-07 | 2022-05-31 | Takeda Pharmaceutical Company Limited | Prevention and reduction of blood loss |
US8124586B2 (en) | 2002-06-07 | 2012-02-28 | Dyax Corp. | Prevention and reduction of blood loss |
JP2005534647A (en) * | 2002-06-07 | 2005-11-17 | ダイアックス、コープ | Prevention and reduction of blood loss |
US9480733B2 (en) | 2002-06-07 | 2016-11-01 | Dyax Corp. | Prevention and reduction of blood loss |
JP2013049698A (en) * | 2002-06-07 | 2013-03-14 | Dyax Corp | Prevention and reduction of blood loss |
US7704949B2 (en) | 2002-06-07 | 2010-04-27 | Dyax Corp. | Kallikrein-inhibitor therapies |
JP2010155842A (en) * | 2002-06-07 | 2010-07-15 | Dyax Corp | Prevention and reduction of blood loss |
US7718617B2 (en) | 2002-08-28 | 2010-05-18 | Dyax Corp. | Methods for preserving organs and tissues |
US8188045B2 (en) | 2004-09-27 | 2012-05-29 | Dyax Corp. | Kallikrein inhibitors and anti-thrombolytic agents and uses thereof |
US9757437B2 (en) | 2004-09-27 | 2017-09-12 | Dyax Corp. | Kallikrein inhibitors and anti-thrombolytic agents and uses thereof |
US8637454B2 (en) | 2009-01-06 | 2014-01-28 | Dyax Corp. | Treatment of mucositis with kallikrein inhibitors |
US10336832B2 (en) | 2010-01-06 | 2019-07-02 | Dyax Corp. | Methods of inhibiting plasma kallikrein in edema patient |
US8822653B2 (en) | 2010-01-06 | 2014-09-02 | Dyax Corp. | Plasma kallikrein binding proteins |
US11505620B2 (en) | 2010-01-06 | 2022-11-22 | Takeda Pharmaceutical Company Limited | Methods of detecting plasma kallikrein |
US8816055B2 (en) | 2011-01-06 | 2014-08-26 | Dyax Corp. | Plasma kallikrein binding proteins |
US10370453B2 (en) | 2011-01-06 | 2019-08-06 | Dyax Corp. | Plasma kallikrein binding proteins |
US9266964B2 (en) | 2011-01-06 | 2016-02-23 | Dyax Corp. | Method of treating hereditary angioedema using plasma kallikrein binding antibodies |
US11401346B2 (en) | 2011-01-06 | 2022-08-02 | Takeda Pharmaceutical Company Limited | Nucleic acids encoding plasma kallikrein binding proteins |
WO2017098516A1 (en) * | 2015-12-10 | 2017-06-15 | The National Institute for Biotechnology in the Negev Ltd. | VARIANTS OF AMYLOID beta-PROTEIN PRECURSOR INHIBITOR DOMAIN |
US11286307B2 (en) | 2015-12-11 | 2022-03-29 | Takeda Pharmaceutical Company Limited | Plasma kallikrein inhibitors and uses thereof for treating hereditary angioedema attack |
CN110051830A (en) * | 2019-03-14 | 2019-07-26 | 苏州新凝生物医药科技有限公司 | A kind of protease nexin II KPI protein mutant application |
Also Published As
Publication number | Publication date |
---|---|
AU4229599A (en) | 1999-12-20 |
CA2330191A1 (en) | 1999-12-09 |
JP2002517197A (en) | 2002-06-18 |
WO1999063090A3 (en) | 2000-03-02 |
EP1082431A2 (en) | 2001-03-14 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US6906033B2 (en) | Protease inhibitor peptides | |
WO1996035788A2 (en) | Kunitz type protease inhibitors | |
US6583108B1 (en) | Human bikunin | |
PL183855B1 (en) | Inhibitors of serinic proteases and anticoagulative protecins extracted from nematodes | |
WO1997033996A9 (en) | Human bikunin | |
JPH09504696A (en) | Human Kunitz-type protease inhibitor | |
EP1082431A2 (en) | Protease inhibitor peptides | |
US5876971A (en) | Thrombin inhibitor from the saliva of protostomia | |
US20090170766A1 (en) | Chimeric Kunitz Domains and their Use | |
Apeler et al. | Expression, purification, biochemical and pharmacological characterization of a recombinant aprotinin variant | |
CA2159218A1 (en) | Novel polypeptide having factor xa inhibitory activity | |
CA2004764C (en) | Ancrod proteins, their preparation and use | |
JP2798573B2 (en) | Natural polypeptide having human neutrophil elastase inhibitory activity and pharmaceutical preparation containing the same | |
TW200846356A (en) | Preparation and use of variants of the kunitz domain 2 of the human placental bikunin gene | |
JPH05286996A (en) | Mew peptide or pseudopeptide compound having therapeutic activity in blood coagulation cascade |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A2 Designated state(s): AE AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): GH GM KE LS MW SD SL SZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
AK | Designated states |
Kind code of ref document: A3 Designated state(s): AE AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A3 Designated state(s): GH GM KE LS MW SD SL SZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
ENP | Entry into the national phase |
Ref document number: 2000 552284 Country of ref document: JP Kind code of ref document: A Ref document number: 2330191 Country of ref document: CA |
|
WWE | Wipo information: entry into national phase |
Ref document number: 1999926138 Country of ref document: EP |
|
WWP | Wipo information: published in national office |
Ref document number: 1999926138 Country of ref document: EP |
|
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
WWW | Wipo information: withdrawn in national office |
Ref document number: 1999926138 Country of ref document: EP |