WO2000005356A1

WO2000005356A1 - Methods and compositions for inhibition of angiogenesis

Info

Publication number: WO2000005356A1
Application number: PCT/US1999/013338
Authority: WO
Inventors: Judah Folkman; Jie Lin
Original assignee: Children's Medical Center Corporation
Priority date: 1998-07-21
Filing date: 1999-06-11
Publication date: 2000-02-03
Also published as: AU4440199A

Abstract

We have now discovered a novel class of antiangiogenic proteins and peptides. Some of the proteins are more potent antiangiogenic agents than presently known proteins such as angiostatin and endostatin. The proteins that can be antiangiogenic agents include those of SEQ ID NOS:1, 2 and 3. We have also discovered pharmaceutical compositions containing an angiogenic inhibitory polypeptide or nucleic acids encoding such a polypeptide, in therapeutically effective amounts that are capable of inhibiting endothelial cell proliferation, and their methods of use.

Description

METHODS AND COMPOSITIONS FOR INHIBITION OF ANGIOGENESIS

BACKGROUND OF THE INVENTION

1. Field of the Invention

The present invention provides for a novel pharmaceutical composition, and method of use thereof for treatment of diseases or disorders involving abnormal angiogenesis.

2. Background

Blood vessels are the means by which oxygen and nutrients are supplied to living tissues and waste products are removed from living tissue. Angiogenesis refers to the process by which new blood vessels are formed. See, for example, the review by Folkman and Shing, J. Biol. Chem. 267 (16), 10931- 10934 (1992). Thus, where appropriate, angiogenesis is a critical biological process. It is essential in reproduction, development and wound repair. However, inappropriate angiogenesis can have severe negative consequences. For example, it is only after many solid tumors are vascularized as a result of angiogenesis that the tumors have a sufficient supply of oxygen and nutrients that permit it to grow rapidly and metastasize. Because maintaining the rate of angiogenesis in its proper equilibrium is so critical to a range of functions, it must be carefully regulated in order to maintain health. The angiogenesis process is believed to begin with the degradation of the basement membrane by proteases secreted from endothelial cells (EC) activated by mitogens such as vascular endothelial growth factor (VEGF) and basic fibroblast growth factor (bFGF) . The cells migrate and proliferate, leading to the formation of solid endothelial cell sprouts into the stromal space, then, vascular loops are formed and capillary tubes develop with formation of tight junctions and deposition of new basement membrane.

In adults, the proliferation rate of endothelial cells is typically low compared to other cell types in the body. The turnover time of these cells can exceed one thousand days. Physiological exceptions in which ^~~ angiogenesis results in rapid proliferation typically occurs under tight regulation, such as found in the female reproduction system and during wound healing.

The rate of angiogenesis involves a change in the local equilibrium between positive and negative regulators of the growth of microvessels. The therapeutic implications of angiogenic growth factors were first described by Folkman and colleagues over two decades ago (Folkman, N. Engl. J. Med., 285: 1 182- 1 186 ( 1971)). Abnormal angiogenesis occurs when the body loses at least some control of angiogenesis, resulting in either excessive or insufficient blood vessel growth. For instance, conditions such as ulcers, strokes, and heart attacks may result from the absence of angiogenesis normally required for natural healing. In contrast, excessive blood vessel proliferation can result in tumor growth, tumor spread, blindness, psoriasis and rheumatoid arthritis.

Thus, there are instances where a greater degree of angiogenesis is desirable— increasing blood circulation, wound healing, and ulcer healing. For example, recent investigations have established the feasibility of using recombinant angiogenic growth factors, such as fibroblast growth factor (FGF) family (Yanagisawa-Miwa, et al., Science, 257: 1401- 1403 ( 1992) and Baffour, et al., J Vase Surg, 16: 181-91 ( 1992)) , endothelial cell growth factor (ECGF)(Pu, et al., J Surg Res, 54:575-83 ( 1993)) , and more recently, vascular endothelial growth factor (VEGF) to expedite and/ or augment collateral artery development in animal models of myocardial and hindlimb ischemia (Takeshita, et al., Circulation, 90:228-234 ( 1994) and Takeshita, et al., J Clin Invest, 93:662-70 ( 1994)).

Conversely, there are instances, where inhibition of angiogenesis is desirable. For example, many diseases are driven by persistent unregulated angiogenesis, also sometimes referred to as "neovascularization." In arthritis, new capillary blood vessels invade the joint and destroy cartilage. In diabetes, new capillaries invade the vitreous, bleed, and cause blindness. Ocular neovascularization is the most common cause of blindness. Tumor growth and metastasis are angiogenesis-dependent. A tumor must continuously stimulate the growth of new capillary blood vessels for the^" tumor itself to grow.

The current treatment of these diseases is inadequate. Agents which prevent continued angiogenesis, e.g, drugs (TNP-470), monoclonal antibodies, antisense nucleic acids and proteins (angiostatin and endostatin) are currently being tested. See, Battegay, J. Mol. Med., 73, 333- 346 ( 1995); Hanahan et al. , Cell, 86, 353-364 ( 1996); Folkman, N. Engl. J. Med., 333, 1757- 1763 ( 1995). Although preliminary results with the antiangiogenic proteins are promising, they are relatively large in size and their difficult to use and produce. Moreover, proteins are subject to enzymatic degradation. Thus, new agents that inhibit angiogenesis are needed. New antiangeogenic proteins or peptides that show improvement in size, ease of production, stability and/or potency would be desirable.

SUMMARY OF THE INVENTION

We have now discovered a novel class of antiangiogenic proteins and peptides. Some of the proteins are more potent antiangiogenic agents than presently known proteins such as angiostatin and endostatin. The proteins that can be antiangiogenic agents include those of SEQ ID NOS: l , 2 and 3. We have also discovered pharmaceutical compositions containing an angiogenic inhibitory polypeptide or nucleic acids encoding such a polypeptide, in therapeutically effective amounts that are capable of inhibiting endothelial cell proliferation, and their methods of use.

As used herein an "angiogenic inhibitory polypeptide" refers to a polypeptide having at least one of the following domains: (a) IGF (insulin-like growth factor) binding domain (consens sequence: GCGCCxxC); (b) vWFC (von Willebrand factor type C repeat, Mancuso et al., J. Biol. Chem. 264: 19514- 19527 ( 1989)); (c) TSP- 1 (Thrombospodin type 1 domain,consens sequence: WSxCSccCG); and (d) CTCK-2 (C-terminal cysteine knot profile, Bork P., FEBS 327: 125- 130(1993)), wherein the polypeptide is an inhibitor of bFGF- stimulated bovine endothelial cell proliferation. That inhibition can be determined by known means such as by using the assay of Folkman et al.(_Vαt.. Aca. Sci Proc. USA 76: 5217-5221 , ( 1979)). Preferably, the protein having at least one of those domains displays those greater than 80% homology with a protein selected from the group consisting of SEQ ID rTO: 1^" (bovine orthologue for the human connective tissue growth factor, Example 1), SEQ ID NO:2 (human connective tissue growth factor, Bradham et al., J. Cell. Biol. 1 14: 1285- 1294 ( 1991)) and SEQ ID NO:3 (fisp- 12, Ryseck et al., Cell Growth Differ. 2:225-233 ( 1991)).

In another embodiment, the angiogenic inhibitory polypeptide has at least two of the above listed domains, more preferably three and most preferably all four domains.

Angiogenic inhibitory polypeptides are preferably members of a family of growth regulators referred to as the CCN family. See, e.g., review by Bork P., FEBS 327: 125- 130(1993). More preferably, the angiogenic inhibitory polypeptides are mammalian connective tissue growth factors.

In a further embodiment, the invention encompasses polypeptides which have at least about 80% identity compared to a mammalian connective tissue growth factor selected from the group consisting of SEQ ID NO: l , SEQ ID NO:2, and SEQ ID NO:3 and, more preferably, at least about 85% identity. In more preferred embodiment, this identity is greater than 90%. In a still more preferred embodiment, this identity is greater than 95%.

The invention further relates to treatment of neovascular disorders by administration of a pharmaceutical composition comprising an angiogenic inhibitory polypeptide of the invention or nucleic acid encoding such a polypeptide, and a pharmaceutically acceptable carrier. Such angiogenic inhibitory polypeptides include the mammalian connective tissue growth factor of SEQ ID NO: 1 , 2 or 3, and fragments and analogs thereof.

In one embodiment, a pharmaceutical composition of the invention is administered to treat a cancerous condition, or to prevent progression from the pre-neoplastic or pre-malignant state into a neoplastic or a malignant state. In other specific embodiments, a pharmaceutical composition of the invention is administered to treat ocular disorders associated with neovascularization . Other aspects of the invention are disclosed infra.

DETAILED DESCRIPTION OF THE INVENTION We have discovered that the proteins of SEQ ID NOS: 1, 2 and 3 display antiangiogenic activity. For example, the protein of SEQ ID NO: l is more potent than angiostatin as determined by a known assay such as the assay of Folkman et al.( roc. Natl. Aca. Sci. USA 76: 5217-5221, (1979)). The present invention also relates to therapeutic methods and compositions using "angiogenic inhibitory polypeptides," that have the following properties:

1. have at least one of the following domains: IGF (insulin-like growth factor) binding domain (consens sequence: GCGCCxxC), vWFC (von Willebrand factor type C repeat, Mancuso et al., J. Biol Chem. 264: 19514-19527 (1989)), TSP- 1 (Thrombospodin type 1 domain, consens sequence: WSxCSccCG) and CTCK-2 (C-terminal cysteine knot profile, Bork P., FEBS 327: 125- 130(1993));

2. inhibit bFGF-stimulated bovine endothelial cell proliferation using a known assay; and 3. the peptide segment has greater than 80% homology with the corresponding segment of a protein selected from the group consisting of SEQ ID NO: 1 (bovine orthologue for the human connective tissue growth factor, Example 1), SEQ ID NO:2 (human connective tissue growth factor, Bradham et al., J. Cell. Biol. 114: 1285- 1294 (1991)) and SEQ ID NO:3 ifisp- 12, Ryseck et al., Cell

Growth Differ. 2:225-233 (1991)).

Homology is determined using the BLAST program provided by GenBank at the National Library of Medicine. GenBank can be accessed via the Internet at www.ncbi.nlm.gov/.

In a preferred embodiment of the invention, the angiogenesis inhibitory polypeptide is a peptide consisting of at least a fragment of SEQ ID NO: 1, 2 or 3, which is effective to inhibit endothelial cell proliferation using the above assay of Folkman et al. In the above Folkman assay the protein of SEQ ID NO: 1 shows sT^~ greater potency than angiostatin and endostatin. One can readily determine relative antiangiogenic activity by using the activity of a known antiangiogenic compound and comparing the angiogenic inhibition of the proteins and polypeptides of the present invention.

In another embodiment, the invention encompasses peptides which are homologous to bovine connective tissue growth factor (Al) (SEQ ID NO:l) or fragments thereof. In one embodiment, the amino acid sequence of the peptide has at least 80% identity compared to the fragment of bovine connective tissue growth factor from which it is derived (the "prototype fragment") . In another embodiment, this identity is greater than 85%. In a more preferred embodiment, this identity is greater than 90%. In a most preferred embodiment, the amino acid sequence of the peptide has at least 95% identity with the prototype fragment. Fragments can be at least 10 amino acids, and in preferred embodiments at least 50, 75, 100, 120, and 200 amino acids, respectively.

In another embodiment, the invention encompasses peptides which are homologous to human connective tissue growth factor (SEQ ID NO: 2) or fragments thereof. In one embodiment, the amino acid sequence of the peptide has at least 80% identity with the prototype human connective tissue growth factor. In another embodiment, this identity is greater than 85%. In a more preferred embodiment, this identity is greater than 90%. In a most preferred embodiment, the amino acid sequence of the peptide has at least 95% identity with the prototype fragment. Fragments can be at least 10 amino acids, and in preferred 25 embodiments at least 50, 75, 100, 120, and 200 amino acids, respectively.

In another embodiment, the invention encompasses peptides, which are homologous to fisp- 12 (SEQ ID NO:3), the mouse orthologue of human connective tissue growth factor, or fragments thereof. In one embodiment, the amino acid sequence of the peptide has at least 80% identity with the prototype fisp-12. In another embodiment, this identity is greater than 85%. In a more preferred embodiment, this identity is greater than 90%. In a most preferred embodiment, the amino acid sequence of the peptide has at least 95% identity with the prototype fragment. Fragments can be at least 10^" amino acids, and in preferred embodiments at least 50, 75, 100, 120 and 200 amino acids in length, respectively.

In other specific embodiments, the angiogenic inhibitory polypeptides of the invention are human connective tissue growth factor isoforms from other mammalian species, e.g. , rabbit, rat, ovine and porcine.

Angiogenic inhibitory polypeptides of the invention can be combined with a therapeutically effective amount of another molecule which negatively regulates angiogenesis which may be, but is not limited to, platelet factor 4, thrombospondin- 1 , tissue inhibitors of metalloproteases (TIMPl and TIMP2) prolactin ( 16-Kd fragment), angiostatin (38-Kd fragment of plasminogen) , endostatin, bFGF soluble receptor, transforming growth factor β, interferon alfa, and placenta! proliferin-related protein.

An angiogenic inhibitory polypeptide of the invention may also be combined with chemo therapeutic agents.

Connective tissue growth factor protein analogs, can be made by altering the protein sequences by substitutions, additions or deletions that provide for functionally equivalent molecules. These include, but are not limited to, connective tissue growth factor protein analogs, fragments, or analogs containing, as a primary amino acid sequence, all or part of the amino acid sequence of an connective tissue growth factor protein analogs including altered sequences in which functionally equivalent amino acid residues are substituted for residues within the sequence resulting in a silent change. For example, one or more amino acid residues within the sequence can be substituted by another amino acid of a similar polarity, which acts as a functional equivalent, resulting in a silent alteration.

Substitutes for an amino acid within the sequence may be selected from other members as of the class to which the amino acid belongs. For example, the nonpolar (hydrophobic) amino acids include alanine, leucine, isoleucine, valine, praline, phenylalanine, tryptophan and methionine. The polar neutral amino acids include glycine, serine, threonine, cysteine, tyrosine, asparagine, and glutamine. The positively charged (basic) amino acids include arginine, lysine and histidine. The negatively charged (acidic) amino acids include aspartic acid and glutamic acid.

One embodiment of the invention provides for molecules consisting of or comprising a fragment of at least 10 (continuous) amino acids of a connective tissue growth factor protein that is capable of inhibiting endothelial cell proliferation. In other embodiments, this molecule consists of at least 20 or 50 amino acids of the connective tissue growth factor protein. In specific embodiments, such molecules consist of or comprise fragments of a connective tissue growth factor protein of at least 75, 120 or 200 amino acids.

In a preferred embodiment, the protein is a mammalian connective tissue growth factor protein. In alternative embodiments, it is a human, bovine or murine connective tissue growth factor protein. The connective tissue growth factor proteins, fragments and analogs of the invention can be derived from tissue or produced by various methods known in the art. The manipulations, which result in their production, can occur at the gene or protein level. For example, a cloned gene sequence coding for connective tissue growth factor proteins can be modified by any of numerous strategies known in the art. Sambrook et al., 1990, Molecular Cloning, A Laboratory- Manual, 2d ea., Cold Spring Harbor Laboratory, Cold Spring Harbor, New York. The sequence can be cleaved at appropriate sites with restriction endonuclease(s), followed by further enzymatic modification if desired, isolated, and ligated in vitro. In the production of the gene encoding a derivative or analog, care should be taken to ensure that the modified gene remains within the same translational reading frame as the troponin subunit gene, uninterrupted by translational stop signals, in the gene region where the desired troponin activity is encoded.

The connective tissue growth factors are preferably produced by recombinant methods. See the procedures disclosed in Example 1 , which follows. A wide variety of molecular and biochemical methods are available for generating and expressing the polypeptides of the present invention; see e.g. the procedures disclosed in Molecular Cloning, A Laboratory Manual (2nd Ed., Sambrook, Fritsch and Maniatis, Cold Spring Harbor) , Current Protocols in Molecular Biology (Eds. Aufubel, Brent, Kingston, More, Feidman, Smith and Stuhl, Greene Publ. Assoc, Wiley-Interscience, NY, N.Y. 1992) or other procedures that are otherwise known in the art. For example, the polypeptides of the invention may be obtained by chemical synthesis, expression in bacteria such as E. coli and eukaryotes such as yeast, baculovirus, or mammalian cell-based expression systems, etc., depending on the size, nature and quantity of the polypeptide.

The term "isolated" means that the polypeptide is removed from its original environment. For example, a naturally-occurring polynucleotides or polypeptides present in a living animal is not isolated, but the same polynucleotides or DNA or polypeptides, separated from some or all of the coexisting materials in the natural system, is isolated. Such polynucleotides could be part of a vector and/ or such polynucleotides or polypeptides could be part of a composition, and still be isolated in that such vector or composition is not part of its natural environment.

Where it is desired to express a polypeptide of the invention any suitable system can be used. The general nature of suitable vectors, expression vectors and constructions therefor will be apparent to those skilled in the art.

Suitable expression vectors may be based on phages or plasmids, both of which are generally host-specific, although these can often be engineered for other hosts. Other suitable vectors include cosmids and retroviruses, and any other vehicles, which may or may not be specific for a given system. Control sequences, such as recognition, promoter, operator, inducer, terminator and other sequences essential and/ or useful in the regulation of expression, will be readily apparent to those skilled in the art.

Correct preparation of nucleotide sequences may be confirmed, for example, by the method of Sanger et al. (Proc. Natl. Acad. Sci. USA 74:5463-7 ( 1977)).

A DNA fragment encoding an angiogenic inhibitory polypeptide may readily be inserted into a suitable vector. Ideally, the receiving vector has suitable restriction sites for ease of insertion, but blunt-end ligation, fό example, may also be used, although this may lead to uncertainty over reading frame and direction of insertion. In such an instance, it is a matter of course to test transformants for expression, 1 in 6 of which should have the correct reading frame. Suitable vectors may be selected as a matter of course by those skilled in the art according to the expression system desired.

By transforming a suitable organism or, preferably, eukaryotic cell line, such as HeLa, with the plasmid obtained, selecting the transformant with ampicillin or by other suitable means if required, and adding tryptophan or other suitable promoter-inducer (such as indoleacrylic acid) if necessary, the desired polypeptide or protien may be expressed. The extent of expression may be analyzed by SDS polyacrylamide gel electrophoresis-SDS-PAGE (Lemelli, Nature 227:680-685 ( 1970)).

Suitable methods for growing and transforming cultures etc. are usefully illustrated in, for example, Maniatis (Molecular Cloning, A Laboratory Notebook, Maniatis et al. (eds.), Cold Spring Harbor Labs, N.Y. ( 1989)).

Cultures useful for production of polypeptides or proteins may suitably be cultures of any living cells, and may vary from prokaryotic expression systems up to eukaryotic expression systems. One preferred prokaryotic system is that of E. coli, owing to its ease of manipulation.

However, it is also possible to use a higher system, such as a mammalian cell line, for expression of a eukaryotic protein. Currently preferred cell lines for transient expression are the HeLa and Cos cell lines. Other expression systems include the Chinese Hamster Ovary (CHO) cell line and the baculovirus system.

Other expression systems which may be employed include streptomycetes, for example, and yeasts, such as Saccharomyces spp., especially S. cerevisiae. Any system may be used as desired, generally depending on what is required by the operator. Suitable systems may also be used to amplify the genetic material, but it is generally convenient tcTuse E. coli for this purpose when only proliferation of the DNA is required.

The polypeptides and proteins may be isolated from the fermentation or cell culture and purified using any of a variety of conventional methods including: liquid chromatography such as normal or reversed phase, using HPLC, FPLC and the like; affinity chromatography (such as with inorganic ligands or antibodies); size exclusion chromatography; immobilized metal chelate chromatography; gel electrophoresis; and the like. One of skill in the art may select the most appropriate isolation and purification techniques without departing from the scope of this invention.

The polypeptides may be generated by any of several chemical techniques. For example, they may be prepared using the solid-phase synthetic technique originally described by R. B. Merrifield, "Solid Phase Peptide Synthesis. I. The Synthesis Of A Tetrapeptide", J. Am. Chem. Soc, 83, pp. 2149-54 (1963), or they may be prepared by synthesis in solution. A summary of peptide synthesis techniques may be found in E. Gross & H. J. Meinhofer, 4 The Peptides: Analysis, Synthesis, Biology; Modern Techniques Of Peptide And Amino Acid Analysis, John Wiley & Sons, ( 1981) and M. Bodanszky, Principles Of Peptide Synthesis, Springer- Verlag ( 1984).

The functional activity and/ or therapeutically effective dose of an angiogenic inhibitory polypeptide or nucleic acid encoding therefor can be assayed in vitro by various methods. For example, where one is assaying for the ability of the angiogenic inhibitory polypeptides, fragments, and analogs, to inhibit or interfere with the proliferation of capillary endothelial cells (EC) in vitro, various bioassays known in the art can be used, including, but not limited to, radioactive incorporation into nucleic acids, calorimetric assays and cell counting.

Inhibition of endothelial cell proliferation may be measured by calorimetric determination of cellular acid phosphatase activity or electronic cell counting. These methods provide a quick and sensitive screen for determining the number of endothelial cells in culture after treatment with the connective tissue growth factor protein, derivative, or analog of the invention, and an angiogenesis stimulating factor such as aFGF. The calorimetric determination of cellular acid phosphatase activity is described by Connolly et al., 1986, J. Anal. Biochem. J52: 136- 140. According to this method, capillary endothelial cells are treated with angiogenesis stimulating factors, such as aFGF, and a range of potential inhibitor concentrations. These samples are incubated to allow for growth, and then harvested, washed, lysed in a buffer containing a phosphatase substrate, and then incubated a second time. A basic solution is added to stop the reaction and color development is determined at 405λ. According to Connolly et al., a linear relationship is obtained between acid phosphatase activity and endothelial cell number up to 10,000 cells/sample. Standard curves for acid phosphatase activity are also generated from known cell numbers in order to confirm that the enzyme levels reflect the actual EC numbers. Percent inhibition is determined by comparing the cell number of samples exposed to stimulus with those exposed to both stimulus and inhibitor.

The incorporation of radioactive thymidine by capillary endothelial cells represents another means by which to assay for the inhibition of endothelial cell proliferation by a potential angiogenesis inhibitor. According to this method, a predetermined number of capillary endothelial cells are grown in the presence of 3H-Thymidine stock, an angiogenesis stimulator such as for example, bFGF, and a range of concentrations of the angiogenesis inhibitor to be tested. Following incubation, the cells are harvested and the extent of thymidine incorporation is determined.

The ability of varying concentrations of angiogenic inhibitory polypeptides to interfere with the process of capillary endothelial cell migration in response to an angiogenic stimulus can be assayed using the modified Boyden chamber technique.

Another means by which to assay the functional activity of angiogenic inhibitory polypeptides involves examining the ability of the compounds to inhibit the directed migration of capillary endothelial cells which ultimately results in capillary tube formation. This ability may be assessed for example, using an assay in which capillary endothelial cells plated on collagen gels are challenged with the inhibitor, and determining whether capillary-like tube structures are formed by the cultured endothelial cells.

Assays for the ability to inhibit angiogenesis in vivo include the chick chorioallantoic membrane assay and mouse, rat or rabbit corneal pocket assays. See, Polverini et al., 1991 , Methods Enzymol. 198: 440-450. According the corneal pocket assays, a tumor of choice is implanted into the cornea of the test animal in the form of a corneal pocket. The potential angiogenesis inhibitor is applied to the corneal pocket and the corneal pocket is routinely examined for neovascularization.

The therapeutically effective dosage for inhibition of angiogenesis in vivo, defined as inhibition of capillary endothelial cell proliferation, migration, and/ or blood vessel growth, may be extrapolated from in vitro inhibition assays using the compositions of the invention above or in combination with other angiogenesis inhibiting factors. The effective dosage is also dependent on the method and means of delivery. For example, in some applications, as in the treatment of psoriasis or diabetic retinopathy, the inhibitor is delivered in a topical-ophthalmic carrier. In other applications, as in the treatment of solid tumors, the inhibitor is delivered by means of a biodegradable, polymeric implant. The protein can also be modified, for example, by polyethyleneglycol treatment.

Diseases, disorders, or conditions, associated with abnormal angiogenesis or neovascularization, and can be treated with a theraputic compound of the invention include, but are not limited to retinal neovascularization, tumor growth, hemagioma, solid tumors, leukemia, metastasis, psoriasis, neovascular glaucoma, diabetic retinopathy, arthritis, endometriosis, and retinopathy of prematurity (ROP).

The term "effective amount" refers to an amount of the angiogenic inhibitory polypeptide the invention sufficient to exhibit a detectable therapeutic effect. The therapeutic effect may include, for example, without limitation, inhibiting the growth of undesired tissue or malignant cells, inhibiting inappropriate angiogenesis (neovascularization), limiting tissue damage caused by chronic inflammation, inhibition of tumor cell growth, and the like. The precise effective amount for a subject will depend upon the subject's size and health, the nature and severity of the condition to be treated, and the like. Thus, it is not possible to specify an exact effective amount in advance. However, the effective amount for a given situation can be determined by routine experimentation based on the information provided herein.

The term "pharmaceutically acceptable" refers to compounds and compositions which may be administered to mammals without undue toxicity. Exemplary pharmaceutically acceptable salts include mineral acid salts such as hydrochlorides, hydrobromides, phosphates, sulfates, and the like; and the salts of organic acids such as acetates, propionates, malonates, benzoates, and the like.

The angiogenic inhibitory polypeptides of the invention are administered orally, topically, or by parenteral means, including subcutaneous and intramuscular injection, implantation of sustained release depots, intravenous injection, intranasal administration, and the like. Accordingly, angiogenic inhibitory polypeptides of the invention are preferably administered as a pharmaceutical composition comprising an angiogenic inhibitory polypeptide of the invention in combination with a pharmaceutically acceptable carrier. Such compositions may be aqueous solutions, emulsions, creams, ointments, suspensions, gels, liposomal suspensions, and the like. Suitable carriers (excipients) include water, saline, Ringer's solution, dextrose solution, and solutions of ethanol, glucose, sucrose, dextran, mannose, mannitol, sorbitol, polyethylene glycol (PEG), phosphate, acetate, gelatin, collagen, Carbopol Registered TM , vegetable oils, and the like. One may additionally include suitable preservatives, stabilizers, antioxidants, antimicrobials, and buffering agents, for example, BHA, BHT, citric acid, ascorbic acid, tetracycline, and the like. Cream or ointment bases useful in formulation include lanolin, Silvadene Registered TM (Marion), Aquaphor Registered TM (Duke Laboratories), and the like. Other topical formulations include aerosols, bandages, and other wound dressings. Alternatively one may incorporate or encapsulate the theraputic compound of the invention in a suitable polymer matrix or membrane, thus providing a sustained-release delivery device suitable for implantation near the site to be treated locally. Other devices include ^~~ indwelling catheters and devices such as the Alzet Registered TM minipump. Ophthalmic preparations may be formulated using commercially available vehicles such as Sorbi-care Registered TM (Allergan), Neodecadron Registered TM (Merck, Sharp & Dohme), Lacrilube Registered TM , and the like, or may employ topical preparations such as that described in U.S. Pat. No. 5, 124, 155, incorporated herein by reference. Further, one may provide a theraputic compound of the invention in solid form, especially as a lyophilized powder. Lyophilized formulations typically contain stabilizing and bulking agents, for example human serum albumin, sucrose, mannitol, and the like. A thorough discussion of pharmaceutically acceptable excipients is available in Remington's Pharmaceutical Sciences (Mack Pub. Co.).

Nucleic acid (DNA) encoding an angiogenic inhibitory polypeptide of the invention can be delivered to a host by any method known to those of skill in the art. For example, catheters, injection, intravenous, parenteral, intraperitoneal and subcutaneous injection, oral or other known routes of administration. The nucleic acid may be delivered "naked" or via a viral vector or liposome.

The amount of angiogenic inhibitory polypeptide of the invention required to treat any particular disorder will of course vary depending upon the nature and severity of the disorder, the age and condition of the subject, and other factors readily determined by one of ordinary skill in the art.

The invention also provides a pharmaceutical pack or kit comprising one or more containers filled with one or more of the ingredients of the pharmaceutical compositions of the invention. Optionally associated with such container(s) can be a notice in the form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which notice reflects approval by the agency of manufacture, use or sale for human administration.

The references cited throughout this application are herein incorporated by reference. The present invention is further illustrated by the following

Examples. These Examples are provided to aid in the understanding of the invention and are not construed as a limitation thereof.

EXAMPLES

Example 1 :

Cloning of Al cDNA from Bovine Aortic Endothelial Cells and

Production of Recombinant Al Protein in Mammalian Cells

Al cDNA was cloned from bovine aortic endothelial cells by differential screening. A cDNA phage library was prepared from bovine aortic endothelial cells by inserting cDNAs into the Ecorl and Xho I sites of pBluscript vector (Sratagene) . Approximately 50,000 plaques were lifted with replica filters for differential hybridization. Probes were prepared by reverse transcription. First, mRNAs were isolated from confluent bovine aortic endothelial (BAE) cells treated with or without 1 nM tumor necrosis factor alpha (TNF-α) for 6 hours. Then one microgram of each mRNA was used to synthesize radioactive cDNA probes of up to 2xl0⁹ cpm/μg specific- activity, using M-MuLV reverse transcriptase. Plaques preferentially hybridized with cDNA probe from untreated BAE cells were cloned and further analyzed.

The Al gene was highly expressed in untreated BAE cells but dramatically down-regulated in TNF-α treated BAE cells. This warranted further studies to look at its antiangiogenic activaties.

The cDNA encoding Al including the signal peptide was PCR amplified using Taq DNA polymerase. The sequences of the primers were:

5'CTCGAGATGTCAGCCACCGGCCTGGGC3' (SEQ ID NO:4) 5ΑAGCTTGGCCATGTCTCCATACATCTT3' (SEQ ID NO: 5)

The amplified fragment was then inserted into the Xho I and Hind III sites of pcDNA3. la, a mammalian expression vector that carries a c-myc epitope for detection and a polyhistidine sequence for purification of the resulted fusion protein (Invitrogen). The sequence of the construct was confirmed by automatic sequencing. The construct was transfected into 293T cells for transient expression and CHO cells for stable expression of Al protein. Recombinant Al protein was isolated from the conditioned media of the above transfected cells by affinity chromatography using HisBind Resin from Novagen.

Example 2:

Recombinant Al protein inhibits endothelial cell proliferation in vitro.

The ability of Al protein to inhibit growth of endothelial cells was tested by BCE proliferation assay (Folkman et al. , Natl. Aca. Sci Proc. USA 76: 5217-5221, 1979). Briefly, cultured bovine capillary endothelial cells dispersed with 0.05% trypsin/0.53 mM EDTA were plated onto gelatinized (Difco) 24-well culture plates ( 12,500 cell/well) in DMEM containing 10% bovine calf serum (BCS) and incubated for 24 hours. The media was replaced with 0.25 ml DMEM containing 5% bovine calf serum and either buffer only or buffer containing 25 ng/ml to 1 μg/ml of recombinant Al protein were added. After 20 minutes of incubation, same media containing bFGF were added to obtain a final volume of 0.5 ml and 1 ng/ml bFGF. After 72 hours, the cells were counted with a Coulter Counter.

The recombinant Al protein potently inhibited endothelial cell proliferation. At concentration of 1 μg/ml, the Al protein inhibited bFGF driven endothelial cell proliferation by 80%. The IC50 (the concentration for half-maximum inhibition) was approximately 50- 100 ng/ml. The inhibition was dose dependent and saturable.

Recombinant Al protein did not inhibit the growth of bovine fibroblasts in culture, indicating that the effect was endothelial cell specific.

Example 3:

Al protein inhibits tumor angiogenesis and tumor growth in vivo

The same construct used for producing recombinant Al protein in vitro was transfected into a human melanoma cell line in culture. Tumor cells that produced recombinant Al protein were selected and cloned. To test the effect of Al protein on tumor angiogenesis and tumor growth inl^ήvo. lxlO⁵ human melanoma cells expressing Al protein or transfected with vector alone were inoculated subcutaneously into the upper-dorsal region of 6-week old male nude mice.

Al over-expression suppressed the growth of human melanoma by more than 99.9% in nude mice, compared with the tumors transfected with the vector alone (control tumors) . From the end of the second week after inoculation, Al transfected tumors grew to 3-6 mm in diameter and then were held at a static stage, while control tumors continued growing to up to more than ten grams killing the mice. As of the filing date of the present application, Al transfected tumors were held static for 5 months in one experiment and 6 weeks in another (the experiment was still in progress at the time this application was filed). There was no sign of toxicity. Mice with Al transfected tumors were healthy and gained weight normally. The long- term inhibition of tumor growth also indicated that there was lack of drug resistance.

Autopsy and histology studies showed that the Al transfected tumors were disc-shaped pigmented tumors composed of a thin layer of viable tumor cells and a necrotic center. The thickness of viable tumor cell layer was 100- 120 μ throughout the entire tumor, which is exactly the effective oxygen diffusion distance. This suggests that the cells beyond this distance could not survive because of the lack of neovascularization in the tumor. In the viable tumor regions, mitotic figures were common but micro vessels were not found. These are typical histological characteristics of tumors suppressed by the inhibition of angiogenesis. Therefore, over expression of Al protein by tumor cells prevented tumor angiogenesis and consequently, tumor growth in vivo.

Over expression of Al protein in human melanoma cells did not alter cell growth in vitro, as compared with the cells transfected with the vector alone. This indicated that the above antitumor effect was not due to an anti-growth effect of Al protein directly against tumor cells.

Example 4 Functional Domains ^~~

Analysis of the Al peptide sequence revealed 4 functional domains. These are:

Amino acid 34- 100: IGF (insulin-like growth factor) binding domain The consensus sequence is GCGCCxxC.

103- 166: vWFC (von Willebrand factor type C repeat)

This domain covers cysteines 13-22. 201-242: TSP- 1 (Thrombospodin type 1 domain)

The consensus sequence is WSxCSccCG. 256-330: CTCK-2 C-terminal cysteine knot profile

The invention has been described in detail with reference to preferred embodiments thereof. However, it will be appreciated that those skilled in the art, upon consideration of this disclosure, may make modifications and improvements within the spirit and scope of the invention.

Claims

What is claimed is: ~~

1. A pharmaceutical composition comprising an amount of a peptide that is effective to inhibit angiogenesis, in which the peptide: a. has at least one of the following domains: insulin-like growth factor binding domain (consensus sequence: GCGCCxxC), Willebrand factor type C repeat, Thrombospodin type 1 domain (consensus sequence: WSxCSccCG) and C-terminal cysteine knot profile; b. inhibits bFGF- stimulated bovine endothelial cell proliferation using a known assay; and c. has greater than 80% homology with the corresponding segment of a protein selected from the group consisting of SEQ ID NO: l, SEQ ID NO:2 and SEQ ID NO:3; and a pharmaceutically acceptable carrier.

2. The composition of claim 1, wherein the peptide has at least an insulin-like growth factor binding domain and a von Willebrand factor type C repeat domain.

3. The composition of claim 1, wherein the peptide has at least an insulin-like growth factor binding domain, a von Willebrand factor type C repeat domain and a thrombospodin type 1 domain.

4. The composition of claim 1, wherein the peptide has an insulinlike growth factor binding domain, a von Willebrand factor type C repeat domain, a thrombospodin type 1 domain and a terminal cysteine knot profile.

5. The composition of claim 4, wherein the peptide is represented by SEQ ID NO: 1.

6. The composition of claim 4, wherein the peptide is represented by SEQ ID NO: 2.

7. The composition of claim 4, wherein the peptide is represented by SEQ ID NO: 3.

8. The composition of claim 1, wherein the carrier is acceptable for topical application to the skin.

9. A pharmaceutical composition comprising a nucleic acid encoding a peptide that is effective to inhibit angiogenesis, in which the peptide: a. has at least one of the following domains: insulin-like growth factor binding domain (consensus sequence: GCGCCxxC), Willebrand factor type C repeat, Thrombospodin type 1 domain (consensus sequence: WSxCSccCG) and C-terminal cysteine knot profile; b. inhibits bFGF- stimulated bovine endothelial cell proliferation using a known assay; and c. has greater than 80% homology with the corresponding segment of a protein selected from the group consisting of SEQ ID NO: l, SEQ ID NO:2 and SEQ ID NO:3; and a pharmaceutically acceptable carrier.

10. A method of inhibiting atopic angiogenesis in a subject, having a disease or disorder causing atopic angiogenesis requiring such inhibition, which comprises administering to the subject of pharmaceutical composition of claim 1 or 9.

11. The method of claim 10, in which the disease or disorder is a solid tumor.

12. The method of claim 11 , in which the tumor is a tumor of the central nervous system.

13. The method according to claim 10, in which the disease or disorder is an ophthalmologic disease or disorder.