WO2000034326A1

WO2000034326A1 - Fluorescent proteins from non-bioluminescent species of class anthozoa, genes encoding such proteins and uses thereof

Info

Publication number: WO2000034326A1
Application number: PCT/US1999/029473
Authority: WO
Inventors: Sergey Anatolievich Lukyanoy; Arcady Fedorovich Fradkov; Yulii Aleksandrovich Labas; Mikhail Vladimirovich Matz; Gisele Green; Ying Chen; Li Ding
Original assignee: Clontech Laboratories, Inc.
Priority date: 1998-12-11
Filing date: 1999-12-10
Publication date: 2000-06-15

Abstract

The present invention is directed to novel fluorescent proteins from non-bioluminescent organisms from the Class Anthozoa. Also disclosed are cDNAs encoding the fluorescent proteins.

Description

FLUORESCENT PROTEINS FROM NON-BIOLUMINESCENT SPECIES OF CLASS ANTHOZOA, GENES ENCODING SUCH PROTEINS AND USES THEREOF

BACKGROUND OF THE INVENTION

Cross-reference to Related Application

This is a divisional application of U.S.S.N. 09/210,330 filed on December 1 1 , 1998.

Field of the Invention

This invention relates to the field of molecular biology. More specifically, this invention relates to novel fluorescent proteins , cDNAs encoding the proteins and uses thereof.

Description of the Related Art

Fluorescence labeling is a particularly useful tool for marking a protein, cell, or organism of interest. Traditionally, a protein of interest is purified, then covalently conjugated to a fluorophore derivative. For in vivo studies, the protein-dye complex is then inserted into cells of interest using micropipetting or a method o f reversible permeabilization. The dye attachment and insertion steps, however, make the process laborious and difficult to control. An alternative method of labeling proteins of interest is to concatenate o r fuse the gene expressing the protein of interest to a gene expressing a marker, then express the fusion product. Typical markers for this method of protein labeling include β-galactosidase, firefly luciferase and bacterial luciferase. These markers, however, require exogenous substrates or cofactors and are therefore of limited use for in vivo studies .

A marker that does not require an exogenous cofactor o r substrate is the green fluorescent protein (GFP) of the jellyfish Aequorea victoria, a protein with an excitation maximum at 395 nm, a second excitation peak at 475 nm and an emission maximum at 5 1 0 nm. GFP is a 238-amino acid protein, with amino acids 65-67 involved in the formation of the chromophore.

Uses of GFP for the study of gene expression and protein localization are discussed in detail by Chalfie et al. in Science 263 ( 1994), 802-805, and Heim et al. in Proc. Nat. Acad. Sci. 91 ( 1 994) , 12501 - 12504. Additionally, Rizzuto et al. in Curr. Biology 5 ( 1 995 ) , 635-642, discuss the use of wild-type GFP as a tool for visualizing subcellular organelles in cells, while Kaether and Gerdes in Febs Letters 369 (1995), 267-271 , report the visualization of protein transport along the secretory pathway using wild-type GFP. The expression of GFP in plant cells is discussed by Hu and Cheng in Febs Letters 369 ( 1995 ) , 331-334, while GFP expression in Drosophila embryos is described by Davis et al. in Dev. Biology 170 (1995), 726-729. Crystallographic structures of wild-type GFP and the mutant

GFP S65T reveal that the GFP tertiary structure resembles a barrel (Ormo et al., (1996) Science 273: 1392-1395 ; Yang, et al., ( 1 996 ) Nature Biotech 14: 1246-1251). The barrel consists of beta sheets in a compact antiparallel structure, where, in the center, an alpha helix containing the chromophore is shielded by the barrel. The comp ac t structure makes GFP very stable under diverse and/or harsh conditions such as protease treatment, making GFP an extremely useful reporter i n general. However, the stability of GFP makes it sub-optimal for determining short-term or repetitive events.

A great deal of research is being performed to improve th e properties of GFP and to produce GFP reagents useful and optimized for a variety of research purposes. New versions of GFP have b een developed, such as a "humanized" GFP DNA, the protein product o f which has increased synthesis in mammalian cells (Haas, et al., Current Biology 6 (1996), 315-324; Yang, et al., Nucleic Acids Research 24 ( 1996), 4592-4593). One such humanized protein is "enhanced green fluorescent protein" (EGFP). Other mutations to GFP have resulted i n blue-, cyan- and yellow-green light emitting versions. Despite the great utility of GFP, however, other fluorescent proteins with properties similar to or different from GFP would be useful in the art. Novel fluorescent proteins result in possible new colors, or produce pH- dependent fluorescence. Other benefits of novel fluorescent proteins include fluorescence resonance energy transfer (FRET) possibilities based on new spectra and better suitability for larger excitation.

The prior art is deficient in novel fluorescent proteins wherein the DNA coding sequences are known. The present invention fulfills this long-standing need in the art.

SUMMARY OF THE INVENTION

The present invention is directed to DNA sequences encoding fluorescent proteins selected from the group consisting of: (a) an isolated DNA from an organism from the Class Anthozoa which encodes a fluorescent protein; (b) an isolated DNA which hybridizes t o the isolated DNA of (a) and which encodes a fluorescent protein; an d (c) an isolated DNA differing from the isolated DNAs of (a) and (b) in codon sequence due to the degeneracy of the genetic code and th at encodes a fluorescent protein. Preferably, the DNA is isolated from a non-bioluminescent organism from Class Anthozoa. More preferably, the DNA has the sequence selected from the group consisting of SEQ ID Nos. 55, 57, 62, 64 and 66 and the fluorescent protein has the amino acid sequence selected from the group consisting of SEQ ID Nos. 56, 63 , 65 and 67.

In another embodiment of the present invention, there is provided a vector capable of expressing the DNA of the present invention in a recombinant cell comprising said DNA and regulatory elements necessary for expression of the DNA in the cell. Preferably, the DNA encodes a fluorescent protein having the amino acid sequence selected from the group consisting of SEQ ID Nos. 56, 63, 65 and 67.

In still another embodiment of the present invention, there is provided a host cell transfected with a vector of the present invention, such that the host cell expresses a fluorescent protein. Preferably, the cell is selected from the group consisting of bacterial cells, mammalian cells, plant cells, insect cells and yeast cells. A representative example of bacterial cell is an E. coli cell.

The present invention is also directed to an isolated an d purified fluorescent protein coded for by DNA selected from the group consisting of: (a) isolated DNA from an organism from Class Anthozoa which encodes a fluorescent protein; (b) isolated DNA which hybridizes to the isolated DNA of (a) and which encodes a fluorescent protein; and (c) isolated DNA differing from the isolated DNAs of (a) and (b) in codon sequence due to the degeneracy of the genetic code, and which encodes a fluorescent protein. Preferably, the protein has the amino acid sequence selected from the group consisting of SEQ ID Nos. 56, 63 , 65 and 67. The present invention is also directed to a DNA sequence encoding a fluorescent protein selected from the group consisting of: (a) an isolated DNA which encodes a fluorescent protein, wherein said DNA is from an organism from Class Anthozoa and wherein said organism does not exhibit bioluminescence; (b) an isolated DNA which hybridizes to isolated DNA of (a) and which encodes a fluorescent protein; and (c) an isolated DNA differing from the isolated DNAs o f (a) and (b) in codon sequence due to degeneracy of the genetic c o de and which encodes a fluorescent protein. Preferably, the organism is from Sub-class Zoantharia, Order Corallimorpharia. More preferably, the organism is from Family Discosomatidae, Genus Discosoma. Most particularly, the present invention is drawn to a novel fluorescent protein from Discosoma sp. "red", drFP583, or a fusion fluorescent protein drFP583/dmFP592.

The present invention is further directed to an amino acid sequence which can be used as a basis for designing an oligonucleotide probe for identification of a DNA encoding a fluorescent protein b y means of hybridization, wherein the sequence is selected from th e group consisting of SEQ ID Nos. 3, 5, 8, 11, 12, 14. Preferably, such a n oligonucleotide has a nucleotide sequence selected from the group consisting of SEQ ID Nos. 4, 6, 7, 9, 10, 13, 15, 16.

Other and further aspects, features, and advantages of th e present invention will be apparent from the following description o f the presently preferred embodiments of the invention given for th e purpose of disclosure. BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1 shows the modified strategy of 3'-RACE used t o isolate the target fragments. Sequences of the oligonucleotides u s ed are shown in Table 2. Dpi and Dp2 are the degenerate primers used i n the first and second PCR, respectively (see Tables 3 and 4 for th e sequences of degenerate primers). In the case of Discosoma sp. "red", the first degenerate primer used was NGH (SEQ ID No. 4), and th e second degenerate primer used was GEGa (SEQ ID No. 6) or NFP (SEQ ID No. 13) or PVMb (SEQ ID No. 16).

Figure 2 shows the excitation and emission spectrum o f the novel fluorescent protein from Discosoma sp. "red", drFP583.

Figure 3 shows separate detection of drFP583 and enhanced green fluorescent protein (EGFP) transiently expressed in HeLa cells. Figure 3A shows the image obtained for EGFP using Chroma filter s et 31001. Figure 3B shows the image taken from the same field of view for drFP583 using filter set 31002. The images shown in Figures 3A an d 3B were pseudocolored and overlayed in Figure 3C . Figure 3D shows phase contrast taken from the same field of view as that in Figure 3C. Figure 4 shows separate detection of humanized drFP583, enhanced cyan fluorescent protein (ECFP) and enhanced yellow- green fluorescent protein (EYFP) in a triple-labeled HeLa cell. Figure 4 A shows the image obtained from one cell co-expressing all three fluorescent proteins using Omega filter set XF 35 for DsRed l -Mito (drFP583-Mito, humanized drFP583). Figure 4B shows the image for EYFP-Tub using filter set XF 104. Figure 4C shows the image for ECFP- Nuc using filter set XF 114. The images shown in Figures 4A, 4B and 4C were peudocolored and overlayed to show all three signals in o n e image in Figure 4D. DETAILED DESCRIPTION OF THE INVENTION

As used herein, the term "GFP" refers to the basic green fluorescent protein from Aequorea victoria, including prior art versions of GFP engineered to provide greater fluorescence or fluoresce in different colors. The sequence of Aequorea victoria GFP (SEQ ID No.

54) has been disclosed in Prasher et al., Gene 1 11 (1992), 229-33.

As used herein, the term "EGFP" refers to mutant variant o f GFP having two amino acid substitutions: F64L and S65T (Heim et al., Nature 373 ( 1995), 663-664). The term "humanized" refers to changes made to the GFP nucleic acid sequence to optimize the codons for expression of the protein in human cells (Yang et al., Nucleic Acids Research 24 (1996), 4592-4593).

In accordance with the present invention there may b e employed conventional molecular biology, microbiology, and recombinant DNA techniques within the skill of the art. Such techniques are explained fully in the literature. See, e.g., Maniatis, Fritsch & Sambrook, "Molecular Cloning: A Laboratory Manual ( 1982) ; "DNA Cloning: A Practical Approach," Volumes l and II (D.N. Glover ed . 1985); "Oligonucleotide Synthesis" (M.J. Gait ed. 1984); "Nucleic Acid Hybridization" (B.D. Hames & SJ. Higgins eds. (1985)); "Transcription and Translation" (B.D. Hames & S . Higgins eds. ( 1984)); "Animal Cell Culture" (R.I. Freshney, ed. ( 1986)); "Immobilized Cells and Enzymes" (IRL Press, (1986)); B. Perbal, "A Practical Guide To Molecular Cloning" ( 1984) .

A "vector" is a replicon, such as plasmid, phage or cosmid, to which another DNA segment may be attached so as to bring about the replication of the attached segment. A "DNA molecule" refers to the polymeric form o f deoxyribonucleotides (adenine, guanine, thymine, or cytosine) in either single stranded form or a double-stranded helix. This term refers only to the primary and secondary structure of the molecule, and does n o t limit it to any particular tertiary forms. Thus, this term includes double-stranded DNA found, inter alia, in linear DNA molecules (e.g. , restriction fragments), viruses, plasmids, and chromosomes.

A DNA "coding sequence" is a DNA sequence which is transcribed and translated into a polypeptide in vivo when placed under the control of appropriate regulatory sequences. The boundaries of the coding sequence are determined by a start codon a t the 5' (amino) terminus and a translation stop codon at the 3 ' (carboxyl) terminus. A coding sequence can include, but is not limited to, prokaryotic sequences, cDNA from eukaryotic mRNA, genomic DNA sequences from eukaryotic (e.g., mammalian) DNA, and synthetic DNA sequences. A polyadenylation signal and transcription termination sequence may be located 3' to the coding sequence.

As used herein, the term "hybridization" refers to th e process of association of two nucleic acid strands to form a n antiparallel duplex stabilized by means of hydrogen bonding between residues of the opposite nucleic acid strands.

The term "oligonucleotide" refers to a short (under 1 00 bases in length) nucleic acid molecule.

"DNA regulatory sequences", as used herein, are transcriptional and translational control sequences, such as promoters , enhancers, polyadenylation signals, terminators, and the like, that provide for and/or regulate expression of a coding sequence in a ho s t cell. A "promoter sequence" is a DNA regulatory region capable of binding RNA polymerase in a cell and initiating transcription of a downstream (3' direction) coding sequence. For purposes of defining the present invention, the promoter sequence is bounded at its 3 ' terminus by the transcription initiation site and extends upstream ( 5 ' direction) to include the minimum number of bases or elements necessary to initiate transcription at levels detectable above background. Within the promoter sequence will be found a transcription initiation site, as well as protein binding domains responsible for the binding of RNA polymerase. Eukaryotic promoters will often, but not always, contain "TATA" boxes and "CAT" boxes . Various promoters, including inducible promoters, may be used t o drive the various vectors of the present invention.

As used herein, the terms "restriction endonucleases" and "restriction enzymes" refer to bacterial enzymes, each of which cu t double-stranded DNA at or near a specific nucleotide sequence.

A cell has been "transformed" or "transfected" by exogenous or heterologous DNA when such DNA has been introduced inside the cell. The transforming DNA may or may not be integrated (covalently linked) into the genome of the cell. In prokaryotes, yeast, and mammalian cells for example, the transforming DNA may b e maintained on an episomal element such as a plasmid. With respect t o eukaryotic cells, a stably transformed cell is one in which th e transforming DNA has become integrated into a chromosome so that i t is inherited by daughter cells through chromosome replication. This stability is demonstrated by the ability of the eukaryotic cell t o establish cell lines or clones comprised of a population of daughter cells containing the transforming DNA. A "clone" is a population o f cells derived from a single cell or common ancestor by mitosis. A "cell line" is a clone of a primary cell that is capable of stable growth in vitro for many generations.

A "heterologous" region of the DNA construct is a n identifiable segment of DNA within a larger DNA molecule that is n o t found in association with the larger molecule in nature. Thus, when the heterologous region encodes a mammalian gene, the gene will usually be flanked by DNA that does not flank the mammalian genomic DNA in the genome of the source organism. In another example, heterologous DNA includes coding sequence in a construct where portions of genes from two different sources have been brought together so as to produce a fusion protein product. Allelic variations or naturally-occurring mutational events do not give rise to a heterologous region of DNA as defined herein.

As used herein, the term "reporter gene" refers to a coding sequence attached to heterologous promoter or enhancer elements an d whose product may be assayed easily and quantifiably when th e construct is introduced into tissues or cells.

The amino acids described herein are preferred to be in th e "L" isomeric form. The amino acid sequences are given in one-letter code (A: alanine; C: cysteine; D: aspartic acid; E: gluetamic acid; F: phenylalanine; G: glycine; H: histidine; I: isoleucine; K: lysine; L: leucine M: metionine; N: asparagine; P: proline; Q: gluetamine; R: arginine; S serine; T: threonine; V: valine; W: tryptophane; Y: tyrosine; X: any residue). NH2 refers to the free amino group present at the amino terminus of a polypeptide. COOH refers to the free carboxy group present at the carboxy terminus of a polypeptide. In keeping with standard polypeptide nomenclature, J Biol. Chem., 243 (1969), 3552- 59 is used. The present invention is directed to an isolated DNA selected from the group consisting of: (a) isolated DNA from a n organism from the Class Anthozoa which encodes a fluorescent protein; (b) isolated DNA which hybridizes to isolated DNA of (a) and which encodes a fluorescent protein; and (c) isolated DNA differing from the isolated DNAs of (a) and (b) in codon sequence due to th e degeneracy of the genetic code, and which encodes a fluorescent protein. Preferably, the DNA has the sequence selected from the group consisting of SEQ ID Nos. 55, 57, 62, 64 and 66, and the fluorescent protein has the amino acid sequence selected from the group consisting of SEQ ID Nos. 56, 63, 65 and 67.

In another embodiment of the present invention, there is provided a vector capable of expressing the DNA of the present invention in a recombinant cell comprising said DNA and regulatory elements necessary for expression of the DNA in the cell. Specifically, the DNA encodes a fluorescent protein having the amino acid sequence selected from the group consisting of SEQ ID Nos. 56, 63, 65 and 67.

In still another embodiment of the present invention, there is provided a host cell transfected with the vector of the pre sent invention, which expresses a fluorescent protein of the present invention. Preferably, the cell is selected from the group consisting o f bacterial cells, mammalian cells, plant cells and insect cells. A representative example of bacterial cell is an E. coli cell.

The present invention is also directed to a DNA sequence encoding a fluorescent protein selected from the group consisting of: (a) an isolated DNA which encodes a fluorescent protein, wherein said DNA is from an organism from Class Anthozoa and wherein said organism does not exhibit bioluminescence; (b) an isolated DNA which hybridizes to isolated DNA of (a) and which encodes a fluorescent protein; and (c) an isolated DNA differing from the isolated DNAs o f

(a) and (b) in codon sequence due to degeneracy of the genetic code and which encodes a fluorescent protein. Preferably, the organism is from Sub-class Zoantharia, Order Corallimorpharia. More preferably, the organism is from Family Discosomatidae, Genus Discosoma. Most preferably, the organism is Discosoma sp. "red".

The present invention is also directed to an isolated an d purified fluorescent protein coded for by DNA selected from the group consisting of: (a) an isolated protein encoded by a DNA which encodes a fluorescent protein wherein said DNA is from an organism from Class

Anthozoa and wherein said organism does not exhibit bioluminescence;

(b) an isolated protein encoded by a DNA which hybridizes to isolated DNA of (a); and (c) an isolated protein encoded by a DNA differing from the isolated DNAs of (a) and (b) in codon sequence due t o degeneracy of the genetic code. Preferably, the isolated and purified fluorescent protein is drFP583, or a fusion fluorescent protein drFP583/dmFP592.

The present invention is further directed to an amino acid sequence which can be used as a basis for designing an oligonucleotide probe for identification of a DNA encoding a fluorescent protein b y means of hybridization, wherein the amino acid sequence is selected from the group consisting of SEQ ID Nos. 3, 5, 8, 11, 12, 14. Preferably, such an oligonucleotide has a nucleotide sequence selected from th e group consisting of SEQ ID Nos. 4, 6, 7, 9, 10, 13, 15, 16 and is used a s a primer in polymerase chain reaction. Alternatively, it can be used as a probe for hybridization screening of the cloned genomic or cDNA library. The following examples are given for the purpose o f illustrating various embodiments of the invention and are not meant t o limit the present invention in any fashion.

EXAMPLE 1

Riological Material

Novel fluorescent proteins were identified from several genera of Anthozoa which do not exhibit any bioluminescence but have fluorescent color as observed under usual white light or ultraviolet light. Six species were chosen (see Table 1).

TABLE 1

Anthozoa Species Used in This Study

Species Area of Origination Fluorescent Color

Anemonia Western Pacific bright green tentacle tips maj ano

Clavularia sp. Western Pacific bright green tentacles an d oral disk

Zoanthus sp. Western Pacific green-yellow tentacles an d oral disk

Discosoma sp . Western Pacific orange-red spots oral disk "red"

Discosoma Western Pacific blue-green stripes on oral striata disk

Discosoma sp . Western Pacific faintly purple oral disk "magenta"

Discosoma sp . Western Pacific green spots on oral disk "green"

Anemonia Mediterranean purple tentacle tips sulcata

EXAMPLE 2

cDNA Preparation

Total RNA was isolated from the species of interest according to the protocol of Chomczynski and Sacchi (Chomczynski P., et al., Anal. Biochem. 162 ( 1987), 156- 159). First-strand cDNA was synthetized starting with 1-3 μg of total RNA using SMART PCR cDNA synthesis kit (CLONTECH) according to the provided protocol with th e only alteration being that the "cDNA synthesis primer" provided in th e kit was replaced by the primer TN3 (5'- CGCAGTCGACCG(T)_!3, SEQ ID No. 1) (Table 2). Amplified cDNA samples were then prepared a s described in the protocol provided except the two primers used for PCR were the TS primer (5'-AAGCAGTGGTATCAACGCAGAGT, SEQ ID No. 2 ) (Table 2) and the TN3 primer (Table 2), both in 0.1 μM concentration. Twenty to twenty-five PCR cycles were performed to amplify a cDNA sample. The amplified cDNA was diluted 20-fold in water and 1 μl o f this dilution was used in subsequent procedures.

TABLE 2

Oligos Used in cDNA Synthesis and R ACE

TN3 : 5'-CGCAGTCGACCG(T)₁₃

(SEQ ID No. 1)

T7-TN3 : 5'-GTAATACGACTCACTATAGGGCCGCAGTCGACCG(T)_l3

(SEQ ID No. 17)

TS-primer: 5'-AAGCAGTGGTATCAACGCAGAGT

(SEQ ID No. 2)

T7-TS: 5 ' -GTAATACGACTCACTATAGGGC AAGCAGTGGTATC AACGCAGAGT

(SEQ ID No. 18)

T7 : 5 '-GTAATACGACTCACTATAGGGC

(SEQ ID No. 19)

TS-oligo 5' -AAGCAGTGGTATC AACGCAGAGTACGCrGrGrG

(SEQ ID No. 53)

EXAMPLE 3

Oligo Design

To isolate fragments of novel fluorescent protein cDNAs, PCR using degenerate primers was performed. Degenerate primers were designed to match the sequence of the mRNAs in regions that were predicted to be the most invariant in the family of fluorescent proteins. Four such stretches were chosen (Table 3) and variants o f degenerate primers were designed. All such primers were directed t o the 3 '-end of mRNA. All oligos were gel-purified before use. Table 2 shows the oligos used in cDNA synthesis and RACE.

TABLE 3

Key Amino Acid Stretches and Corresponding Degenerate Primers Used for Isolation of Fluorescent Proteins

EXAMPLE 4

Isolation of 3'-cDNA Fragments of nFPs

The modified strategy of 3'-RACE was used to isolate th e target fragments (see Figure 1). The RACE strategy involved tw o consecutive PCR steps. The first PCR step involved a first degenerate primer (Table 4) and the T7-TN3 primer (SEQ ID No. 17) which has a 3 ' portion identical to the TN3 primer used for cDNA synthesis ( for sequence of T7-TN3, Table 2). The reason for substituting the longer T7-TN3 primer in this PCR step was that background amplification which occurred when using the shorter TN3 primer was suppres sed effectively, particularly when the T7-TN3 primer was used at a low concentration (0.1 _M) (Frohman et al., (1998) PNAS USA, 85, 8998 - 9002). The second PCR step involved the TN3 primer (SEQ ID No. 1 , Table 2) and a second degenerate primer (Table 4).

TABLE 4

Combinations of Degenerate Primers for First and Second PCR Resulting in Specific Amplification of 3 '-Fragments of nFP cDNA

Species First Second Degenerate Primer

Degenerate

Primer

Anemonia majano NGH GNGb (SEQ ID No. 4) (SEQ ID No. 10)

Clavularia sp. NGH GEGa (SEQ ID No. 4) (SEQ ID No. 6)

Zoanthus sp. NGH GEGa (SEQ ID No. 4) (SEQ ID No. 6)

Discosoma sp. "red" NGH GEGa (SEQ ID No. 6), (SEQ ID No. 4) NFP (SEQ ID No. 13) or PVMb (SEQ ID No. 16)

Discosoma striata NGH NFP (SEQ ID No. 4) (SEQ ID No. 13)

Anemonia sulcata NGH GEGa (SEQ ID No. 6) (SEQ ID No. 4) or NFP (SEQ ID No. 13)

The first PCR reaction was performed as follows: 1 μl of 20-fold dilution of the amplified cDNA sample was added into the reaction mixture containing IX Advantage KlenTaq Polymerase Mix with provided buffer (CLONTECH), 200 μM dNTPs, 0.3 μM of first degenerate primer (Table 4) and 0.1 μM of T7-TN3 (SEQ ID No. 17) primer in a total volume of 20 μl. The cycling profile was (Hybaid OmniGene Thermocycler, tube control mode): 1 cycle for 95°C, 10 sec; 55°C, 1 min.; 72°C, 40 sec; 24 cycles for 95°C, 10 sec; 62°C, 30 sec; 72°C, 4 0 sec. The reaction was then diluted 20-fold in water and 1 μl of this dilution was added to a second PCR reaction, which contained IX Advantage KlenTaq Polymerase Mix with the buffer provided by th e manufacturer (CLONTECH), 200 μM dNTPs, 0.3 μM of the s econd degenerate primer (Table 4) and 0.1 μM of TN3 primer. The cycling profile was (Hybaid OmniGene Thermocycler, tube control mode): 1 cycle for 95°C, 10 sec; 55°C (for GEG/GNG or PVM) or 52°C (for NFP), 1 min.; 72°C, 40 sec; 13 cycles for 95°C, lOsec; 62°C (for GEG/GNG o r PVM) or 58°C (for NFP), 30 sec; 72°C, 40 sec The product of PCR was cloned into PCR-Script vector (Stratagene) according to th e manufacturer' s protocol.

Different combinations of degenerate primers were tried in the first and second PCR reactions on the DNA from each species until a combination of primers was found that resulted in specific amplification— meaning that a pronounced band of expected size (about 650-800 bp for NGH and GEG/GNG and 350-500 bp for NFP an d PVM— sometimes accompanied by a few minor bands) was detected o n agarose gel after two PCR reactions. The primer combinations of choice for different species of the Class Anthozoa are listed in Table 4. Some other primer combinations also resulted in amplification o f fragments of correct size, but the sequence of these fragments showed no homology to the other fluorescent proteins identified or t o Aequorea victoria GFP. EXAMPLE 5

Obtaining Full -Length cDNA Copies

Upon sequencing the obtained 3 '-fragments of novel fluorescent protein cDNAs, two nested 5 '-directed primers were synthesized for cDNA (Table 5), and the 5' ends of the cDNAs were then amplified using two consecutive PCRs. In the next PCR reaction, the novel approach of "step-out PCR" was used to suppress background amplification. The step-out reaction mixture contained lx Advantage KlenTaq Polymerase Mix using buffer provided by the manufacturer (CLONTECH), 200 μM dNTPs, 0.2 μM of the first gene-specific primer (see Table 5), 0.02 μM of the T7-TS primer (SEQ ID No. 18), 0.1 μM o f T7 primer (SEQ ID No. 19) and 1 μl of the 20-fold dilution of th e amplified cDNA sample in a total volume of 20 μl. The cycling profile was (Hybaid OmniGene Thermocycler, tube control mode): 23 -27 cycles for 95°C, 10 se ; 60°C, 30 sec; 72°C, 40 sec. The product o f amplification was diluted 50-fold in water and one μl of this dilution was added to the second (nested) PCR. The reaction contained IX Advantage KlenTaq Polymerase Mix with provided buffer (CLONTECH), 200 μM dNTPs, 0.2 μM of the second gene-specific primer and 0.1 μM of TS primer (SEQ ID No. 2) in a total volume of 20 μl. The cycling profile was (Hybaid OmniGene Thermocycler, tube control mode): 1 2 cycles for 95°C, 10 sec; 60°C, 30 sec; 72°C, 40 sec. The product o f amplification was then cloned into pAtlas vector (CLONTECH) according to the manufacturer' s protocol. TABLE 5

Gene-Specific Primers Used for S'-R ACF.

Species First Primer Second (Nested) Primer

Anemonia 5 ' -GAAATAGTCAGGC ATACTGGT 5'-GTCAGGCATAC maj ano (SEQ ID No. 20) TGGTAGGAT (SEQ ID No. 21)

Clavularia 5'-CTTGAAATAGTCTGCTATATC 5'-TCTGCTATATC sp . (SEQ ID No. 22) GTCTGGGT (SEQ ID No. 23)

Zoanthus 5 ' - 5 ' -GTCTACTATGTCTT

GTTCTTGAAATAGTCTACTATGT sp . GAGGAT

(SEQ ID No. 24) (SEQ ID No. 25)

Discosoma 5 '-CAAGCAAATGGCAAAGGTC 5'-CGGTATTGTGGCC sp. "red" (SEQ ID No. 26) TTCGTA (SEQ ID No. 27)

Discosoma 5 ' -TTGTCTTCTTCTGC AC AAC 5'-CTGCACAACGG striata (SEQ ID No. 28) GTCCAT (SEQ ID No. 29)

Anemonia 5'-CCTCTATCTTCATTTCCTGC 5 ' -TATCTTCATTTCCT sulcata (SEQ ID No. 30) GCGTAC

(SEQ ID No. 31)

Discosoma 5'-TTCAGCACCCCATCACGAG 5'-ACGCTCAGAGCTG sp . (SEQ ID No. 32) GGTTCC

"magenta" (SEQ ID No. 33)

Discosoma 5'-CCCTCAGCAATCCATCACGTTC 5'-ATTATCTCAGTGGA sp. "green" (SEQ ID No. 34) TGGTTC (SEQ ID No. 35) EXAMPLE 6

Expression of nFPs in E. r.oli.

To prepare a DNA construct for novel fluorescent protein expression, two primers were synthesized for each cDNA: a 5 ' -directed "downstream" primer with the annealing site located in the 3'-UTR o f the cDNA and a 3 '-directed "upstream" primer corresponding to th e site of translation start site (not including the first ATG codon) (Table 6). Primers with SEQ ID Nos. 43 and 44 were the primers used t o prepare the dr583 DNA. Both primers had 5'-heels coding for a site for a restriction endonuclease; in addition, the upstream primer was designed so as to allow the cloning of the PCR product into the pQE30 vector (Qiagen) in such a way that resulted in the fusion of reading frames of the vector-encoded 6xHis-tag and nFP. The PCR was performed as follows: 1 μl of the 20-fold dilution of the amplified cDNA sample was added to a mixture containing lx Advantage KlenTaq Polymerase Mix with buffer provided by the manufacturer (CLONTECH), 200 μM dNTPs, 0.2 μM of upstream primer and 0.2 μM of downstream primer, in a final total volume of 20 μl. The cycling profile was (Hybaid OmniGene Thermocycler, tube control mode): 23-27 cycles for 95°C , 10 sec; 60°C, 30 sec; 72°C, 40 sec The product of this amplification step was purified by phenol-chlorophorm extraction and ethanol precipitation and then cloned into pQE30 vector using restriction endonucleases corresponding to the primers' sequence according t o standard protocols.

All plasmids were amplified in XL-1 blue E. coli and purified by plasmid DNA miniprep kits (CLONTECH). The recombinant clones were selected by colony color, and grown in 3 ml of LB medium (supplemented with 100 μg/ml of ampicillin) at 37°C overnight. 100 μl of the overnight culture was transferred into 200 ml of fresh IB medium containing 100 μg/ml of ampicillin and grown at 37°C, 200 rpm up to OD₆₀₀ 0.6-0.7. 1 mM IPTG was then added to the culture a n d incubation was allowed to proceed at 37°C for another 16 hours. The cells were harvested and recombinant protein, which incorporated 6 x His tags on the N-terminus, was purified using TALON™ metal-affinity resin according to the manufacturer's protocol (CLONTECH).

TABLE 6

Primers Used to Obtain Full Coding Region of nFPs for Cloning i n to

Expression Construct

Species Upstream Primer Downstream Primer

Anemonia 5 ' -acalggalc-cgctctttcaaaca 5 ' -tagtactcgagcttattcgta maj ano agtttatc (SEQ ID No. 36) tttcagtgaaatc BamHl (SEQ ID No. 37) Xhol

L: 5 ' -acaiggaic.caacatttttttga gaaacg (SEQ ID No. 38) 5 ' -tagtacic-gagcaacacaa

Clavularia BamHl accctcagacaa sp . S: 5 ' -acatggatccaaa!?ctctaar.e (SEQ ID No. 40) accatg (SEQ ID No. 39) Xhol BamHl

Zoanthus 5 '- acatggatccgctca ptcaaag 5 ' -tagtactcgaggttggaactacat sp . cacggt (SEQ ID No. 41) tcttatca (SEQ ID No. 42) BamHl Xhol

Discosoma 5 ' - acatggatccapgtcttccaagaat 5 ' -tagtactcgaggagccaagttc sp. "red" gttatc (SEQ ID No. 43) agcctta (SEQ ID No. 44) BamHl Xhol

Discosoma 5 ' - acatggatccagttggtccaagagtgtg 5 ' -tagcgagslctatcatgcctc striata (SEQ ID No. 45) gtcacct (SEQ ID No. 46)

BamHl Sad

Anemonia 5 ' - acatggatccgcttcctttttaaagaagact 5 ' -tagtactcgagtcctt.gggagc sulcata (SEQ ID No. 47) ggcttg (SEQ ID No. 48) BamHl Xhol

Discosoma 5'- acatggatccagttgttccaagaatgtgat 5'-tagtac_Lc_gaggccattacg sp . (SEQ ID No. 49) ctaatc (SEQ ID No. 50)

"magenta" BamHl Xhol

Discosoma 5 '-acatggatc.cagtgcacttaaagaagaaatj 5 '-tagtactcgagattcggtttaat sp. "green" (SEQ ID No. 51) gccttg (SEQ ID No. 52) EXAMPLE 7

Novel Fluorescent Protein drFP583 and cDNA Encoding drFP583

One of the full-length cDNAs encoding fluorescent proteins found is described herein (drFP583). The nucleic acid sequence an d deduced amino acid sequence are SEQ ID Nos. 55 and 56, respectively. The spectral properties of drFP583 is listed in Table 7, and the emission and excitation spectra for the drFP583 is shown in Figure 2.

TABLE 7

Spectral Properties of the Isolated drFP 83

Species: Discosoma Max. Extinction sp. "red" Coefficient: 22 ,500 nFP Name: drFP583 Quantum

Yield 0.23

Absorbance Relative

Max. (nm): 55 8 Brightness: * 0.24

Emission

Max. (nm): 5 8 3

*relative brightness is extinction coefficient multiplied by qu antum yield divided by the same value for A. victoria GFP .

EXAMPLE S

Expression of drFP583 in Mammalian Cells HeLa cells were transfected either with plasmid pDsRedl -Nl

(vector containing the DNA encoding drFP583) or plasmid pEGFP-Cl (encoding EGFP from Aequoria victoria). Immediately after th e transfection, cells were mixed and plated on coverslips. Cells were incubated for 48 hours at 37°C then fixed in 3.7 % formaldehyde. Cells were mounted in mounting medium and observed by fluorescence microscopy. Images were taken from the same field of view with Chroma filter set 31001 for EGHP (Figure 3A), and filter set 31002 for drFP583 (Figure 3B) using a cooled CCD camera (Roper Scientific) an d MetaMorph software (Universal Imaging). The images (Figures 3A and 3B) were pseudocolored and overlayed in Figure 3C. Phase contrast was taken from the same field of view and overlayed in Figure 3D.

EXAMPLE 9

Generation of Humani zed drFP583

Since mammalian expression is a very popular tool, hum an favored codon version is needed for better expression in mammalian cells. Humanzied drFP583 was therefore generated by changing wild type drFP583 nucleotide sequence to optimize the codons for expression of the fluorescent protein. The nucleotide sequence of th e humanized drFP583 is shown in SEQ ID No. 57.

EXAMPLE 10

Expression of Humanized drFP583 in Mammalian Cells HeLa cells were transiently co-transfected with plasmids pECFP-Nuc, pEYFP-Tub and pDsRedl-Mito (humanized drFP583). After transfection, cells were incubated for 48 hours at 37 °C then fixed in 3.7

% formaldehyde. Cells were mounted in mounting medium an d observed by fluorescence microscopy. Images were taken of one cell co-expressing all three fluorescent proteins with Omega filter set XF 3 5 for DsRedl-Mito (Figure 4A), XF 104 for EYFP-Tub (Figure 4B) and XF

114 for ECFP-Nuc (Figure 4C) using a cooled CCD camera (Roper

Scientific) and MetaMorph software (Universal Imaging). Individual images were peudocolored and overlayed to show all three signals i n one image (Figure 4D). Protein DsRedl-Mito localizes to mitochondria,

EYFP-Tub localizes to the microtubular network, and ECFP-Nuc localizes to the nucleus.

As a conclusion, drFP583 does emit to a low extent also in the cyan (ECFP), green (EGFP) and yellow-green (EYFP) emission channels (filter sets). High expression levels or highly concentrated protein in intracellular structures can therefore result in high signal intensities that will give some bleedthrough in the other emission wavelengths. The bleedthrough is small and should not affect multiple labeling recording in most cases.

EXAMPLE 11

Mutants of Humanized drFP 8

Mutants of humanized drFP583 were generated using error prone PCR technique (Clontech). Mutations occurred at amino acids 42, 71, 105, 120, 161 and 197 (numbering starting from the first Methionine). Table 8 lists the mutants that were generated and their properties .

TABLE 8

Mutants of Humanized drFP583

EXAMPLE 12

Characterization and Applications of E5 Mutant. E5 (VI 05 A, S 197T) changes its fluorescence from green t o red over time both in vitro and in vivo, in E. coli and in mammalian cells. Also, E5 folds faster than wild type drFP583 both in E. coli an d mammalian cells (Table 8).

Since it allows the "two color" reporting mode for monitoring of the promoter activity, i.e., for both active or shutdown state of the promoter, there is a separate color, serving as an indicator of that state, E5 can be used as a transcriptional reporter. Different from "one color" mode, "two color" mode has a measurable signal (color) present for both states of the process as opposed to "one color" mode (e.g. destabilized GFP) wherein the absence of the color is an indicator of the second state. Namely, newly produced E5 protein fluoresces in green, indicating on-going promoter activity. Over time, the protein will mature, acquiring the red fluorescence. So if th e promoter is no longer active, all the protein will eventually mature, resulting in the dominant red fluorescence. In case the promoter is still active both red and green fluorescence will be readily detected. Thus E5 as a "two color" reporter allows study of gene expres sion similar to destabilized GFP, but with permanent "signature" of past gene activity in the cells, tissues or entire organism. For example, at th e tissue level, E5 may help to distinguish the stem cells from differentiated cells. Providing the promoter is only active in the s tem cells, the E5 reporter will label the stem cell population in green an d red, the progenitor cells would be labeled predominantly in red, th e terminally differentiated will not fluoresce (due to the titration out o f protein during cell division). E5 could be used for spatial and temporal visualization o f newly synthesized vs. accumulated fusion proteins. That is, E5 c ould function like a fusion tag. Possible applications envisaged at different organizational levels. At the cellular level, E5 may help to visualize an d distinguish the newly synthesized proteins in various compartments such as outer membrane, microvillae, ER, Golgi, mitochondria, nuclei, various components of cellular matrix and focal adhesion complexes . At the tissue level, E5 may be helpful in visualizing newly formed vs. preexisting structures e.g. membrane junctions, components o f extracellular matrix.

One of the most fascinating applications of E5 seems to b e in the study of the mother-daughter relationship during the cell division and migration. A wide horizon is opening in the fields o f development as well as in the adult organisms to study the cell migration and differentiation. Allowing visualization of the expression "history", E5 can help to distinguishing between the mother cells where the promoter is actually active vs. the daughter cells containing th e accumulated protein but not producing fresh protein anymore. It would enable the study of the cell fates during development and organ remodeling, thus distinguishing between cell migration and cell expansion or differentiation.

In conclusion, E5 is basically applicable to any situation where GFP was previously used. Main advantage is that E5 can track down "the history" of promoter activity or protein localization in cells or tissues. With a better protein stability than GFP, E5 allows longer analysis window (wild type drFP583 is stable for at least 4 weeks in Xenopus, while EGFP starts to faint after two weeks). EXAMPLE 13

Characterization and Applications of E8 Mutant

E8 (N42H) has two fluorescence maximums, green and red , at all times and it folds much faster than drFP583 (Table 8).

Since it detects both green and red fluorescence simultaneously, E8 may be useful for studying processes related t o blood circulation and proteins/cells trafficking. Blood absorbs the green fluorescence; thus only the red fluorescence will be visible while the protein is trafficking in the blood. Both green and red fluorescence could be detected outside the bloodstream making the whole process easy to visualize and record. Monitoring both red and green fluorescence simultaneously may also help to reduce the background fluorescence problems for some tissues or cells.

EXAMPLE 14

Generation of drFP583/dmFP592 Hybrid Using Shuffling Procedure Non-humanized wild type coding region fragments from drFP583 and dmFP592 were amplified by PCR (22 cycles, 95°C, 15 sec , 68°C 1 min 20 sec.) using 1 ng of corresponding bacterial expression plasmids (pQE-30 derivatives with drFP583 and dmFP592 inserts , respectively) as templates. Oligonucleotides A (ACATGG ATCCAGGTCTTCCAAGAATGTTATC, SEQ ID No. 58), B (TAGTACTCG AGCCAAGTTCAGCCTTA, SEQ ID No. 59), C (ACATGGATCCAG TTGTTC CAAGAATGTGAT, SEQ ID No. 60), and D (TAGTACTCGAGGCCATTA CCGCTAATC, SEQ ID No. 61 ) were used as primers for amplifying the se fragments in a concentration of 0.2 mM. The PCR products were then purified by QIAquick PCR Purification Kit (QIAGEN). Afterwards, the purified fragments drFP583 and dmFP592 (300-500 ng each) were digested with restriction endonucleases EcoRl, Hindlll and Dral (10 U each) simultaneously. Reactions were performed in BamHl restriction buffer (NEB) supplemented BSA for 3h at 37°C. Total reaction volume was 30 ml . Upon completion, the resulted restriction fragments from each restriction reaction were separated by electrophoresis in agarose gels (1.5%), cut from gel and purified by QIAquick Gel Purification Kit (QIAGEN). The resulting sets of the purified restriction fragments from both drFP583 and dmFP592 were combined together and 50 ng of th em were put into ligation mix (IX T4 DNA ligation buffer, 400 NEB U of T4 DNA ligase) in total volume of 30 ml. The ligation was performed for 3h at room temperature and stopped by heating at 70°C within 20 min. The ligation mixture was then diluted by water ten-folds, and 1 ml of the dilution was preformed for PCR reaction (20 cycles, 95°C, 15 sec. 68°C lmin 20 sec) as template. Four oligonucleotides A, B, C, and D (SEQ ID Nos. 58-61 , respectively) were used simultaneously as primers for amplifying these fragments in a concentration of 0.1 m M each. After electrophoresis in an agarose gel (1.5%), the target fragment was purified by QIAquick Gel Purification Kit (QIAGEN) an d digested with restriction endonucleases BamHl and Xhol (30-50 U each) simultaneously in BamH I restriction buffer (NEB) supplemented with BSA for 3h at 37°C. After purification, the resulting fragment was cloned in pQE-30 plasmid linearized by BamHl and Sail. Ligation reaction was performed in IX T4 DNA ligation buffer and 400 NEB U o f T4 DNA ligase with a total volume of 20 ml for overnight at 16°C. After transformation of E.coli cells by 1/5 of the ligation volume an d incubation on LB/1 % agar plates which were supplemented by 1 00 mg/ml Ampacilin and 0.1 mM IPTG at 37°C for overnight, the resulting E.coli colonies were screened visually under fluorescent microscope using rhodamine filter set. The brightest red colonies were picked u p and placed in 200 ml LB medium with 100 mg/ml of Ampacilin. At OD₆₀₀=0.6, the E.coli culture was induced by IPTG (final concentration was 1 mM) and the fermentation continued for overnight. Purification of recombinant protein containing N-terminus 6Xhis tag was performed using TALON metal-affinity resin according to manufacturer's protocol.

EXAMPLE 15

Spectral Properties of drFP583/dmFP 97 Hyhrid

The emission and excitation spectra for drFP583/dmFP592 hybrid protein are basically the same as for dmFP592. Table 9 lists th e spectral properties of drFP583/dmFP592 hybrid protein.

TABLE 9

Spectral Properties of drFP583/dmFP597 Hyhrid

*relative quantum yield was determined as compared to the qu antum yield of A. victoria GFP.

**relative brightness is extinction coefficient multiplied by quantum yield divided by the same value for A. victoria GFP. EXAMPLE 16

Humanized drFP5S3/dmFP597. Hybrid and Mutants drFP583/dmFP592 hybrid was humanized (SEQ ID No. 62 for nucleotide sequence and SEQ ID No. 63 for deduced amino acid sequence). Further, two mutants were generated based on th e humanized drFP583/dmFP592, i.e., drFP583/dmFP592-2G an d drFP583/dmFP592-Q3. drFP583/dmFP592-2G contains two substitutions, K15Q and T217S (SEQ ID Nos. 64 and 65 for nucleotide and deduced amino acid sequences, respectively). This mutant was derived from the humanized drFP583/dmFP592 hybrid gene by random mutagenesis using Diversity PCR Mutagenesis Kit (Clontech) according to the corresponding protocol. drFP583/dmFP592-Q3 contains three substitutions, K15Q and K83M and T217S (SEQ ID Nos. 66 and 67 for nucleotide and deduced amino acid sequences, respectively). drFP583/dmFP592-Q3 mutant was derived from drFP583/dmFP592-2G mutant by random mutagenesis using Diversity PCR Mutagenesis Kit (Clontech) according to the corresponding protocol. drFP583/dmFP592-2G has similar brightness and folding rate as for non-humanized drFP583/dmFP592 hybrid. While drFP583/dmFP592-Q3 could be seen in E.coli cells as more dark re d than parental variant, i.e., drFP583/dmFP592-2G, and the purified protein solution has purple color. drFP583/dmFP592-Q3 has th e emission maximum of 616 nm and excitation maximum of 580 nm. EXAMPLE 17

Possible Applications of Hybrid Mutants

Similar to fluorescent protein drFP583 or dmFP592, drFP583/dmFP592-Q3 could be used as a tool for investigation o f protein expression, transport and protein interactions in vivo, monitoring of promoter activity, and as a transcription reporter o r fusion tag. Besides, drFP583/dmFP592-Q3 could be chosen as the mo s t convenient partner to one of the existing green fluorescent protein variants in two/triple color labeling assays for simultaneous detection of expression of two or more proteins in vivo due to its strongly red- shifted position of emission maximum and practical absence o f excitation in green part of spectrum except any spectral overlapping and background fluorescence. The method of generating drFP583/dmFP592 hybrid c an have a general utility for generating hybrid genes (i.e., genes containing parts of different genes in various combinations) with improved fluorescent characteristics.

Additionally, drFP583/dmFP592-Q3 is the first red-shifted mutant, which demonstrates that spectral-shifted mutant could b e obtained by random mutagenesis.

Any patents or publications mentioned in this specification are indicative of the levels of those skilled in the art to which th e invention pertains. These patents and publications are incorporated by reference to the same extent as if each individual publication was specifically and individually indicated to be incorporated by reference.

One skilled in the art will appreciate readily that the present invention is adapted to carry out the objects and obtain the ends an d advantages mentioned, as well as those objects and ends inherent therein. The present examples, along with the methods, procedures , treatments, molecules, and specific compounds described herein, are presently representative of preferred embodiments, are exemplary, an d are not intended as limitations on the scope of the invention. Changes to the methods and compounds, and other uses, will occur to tho se skilled in the art and are encompassed within the spirit of the invention as defined by the scope of the claims.

Claims

WHAT IS CLAIMED IS:

1 . A DNA sequence encoding a fluorescent protein selected from the group consisting of: ( a ) an isolated DNA which encodes a fluorescent protein, wherein said DNA is from an organism from a Class Anthozoa an d wherein said organism does not exhibit bioluminescence;

( b ) an isolated DNA which hybridizes to isolated DNA o f (a) above and which encodes a fluorescent protein; and ( c ) an isolated DNA differing from the isolated DNAs o f

(a) and (b) above in codon sequence due to degeneracy of the genetic code and which encodes a fluorescent protein.

2 . The DNA sequence of claim 1, wherein said organism is from Sub-class Zoantharia.

3 . The DNA sequence of claim 2, wherein said organism is from Order Corallimorpharia.

4 . The DNA sequence of claim 3, wherein said organism is from Family Discosomatidae.

5 . The DNA sequence of claim 4, wherein said organism is from Genus Discosoma.

6 . A DNA sequence encoding a fluorescent protein selected from the group consisting of:

( a ) an isolated DNA which encodes a fluorescent protein, wherein said DNA has a sequence selected from the group consisting o f SEQ ID Nos. 55, 57, 62, 64 and 66;

( b ) an isolated DNA which hybridizes to isolated DNA o f (a) above and which encodes a fluorescent protein; and

( c ) an isolated DNA differing from the isolated DNAs o f (a) and (b) above in codon sequence due to degeneracy of the genetic code, and which encodes a fluorescent protein.

7 . The DNA sequence of claim 6, wherein said DNA encodes a fluorescent protein having an amino acid sequence selected from the group consisting of SEQ ID Nos. 56, 63, 65 and 67.

8 . The DNA sequence of claim 6, wherein said DNA is selected from the group consisting of non-humanized and humanized DNA.

9 . A vector capable of expressing the DNA sequence o f claim 1 in a recombinant cell, wherein said vector comprising said DNA and regulatory elements necessary for expression of the DNA in the cell.

1 0. The vector of claim 9, wherein said DNA encodes a fluorescent protein having the amino acid sequence selected from th e group consisting of SEQ ID Nos. 56, 63, 65 and 67.

1 1 . The vector of claim 9, wherein said DNA is selected from the group consisting of non-humanized and humanized DNA.

1 2. A host cell transfected with the vector of claim 9 , wherein said cell is capable of expressing a fluorescent protein.

1 3 . The host cell of claim 12, wherein said cell is selected from the group consisting of bacterial cells, mammalian cells, plant cell, yeast and insect cells.

14. The host cell of claim 13, wherein said bacterial cell is an E. coli cell.

1 5 . An isolated and purified fluorescent protein coded for by DNA selected from the group consisting of: ( a ) an isolated DNA which encodes a fluorescent protein from an organism from Class Anthozoa, wherein said organism doe s not exhibit bioluminescence;

( b ) an isolated DNA which hybridizes to isolated DNA of (a) above and which encodes a fluorescent protein; and ( c ) an isolated DNA differing from the isolated DNAs o f (a) and (b) above in codon sequence due to degeneracy of the genetic code and which encodes a fluorescent protein.

1 6. The isolated and purified fluorescent protein of claim 15, wherein said organism is from Sub-class Zoantharia.

1 7 . The isolated and purified fluorescent protein of claim

16, wherein said organism is from Order Corallimorpharia.

1 8 . The isolated and purified fluorescent protein of claim 17, wherein said organism is from Family Discosomatidae.

1 9. The isolated and purified fluorescent protein of claim 18, wherein said organism is from Genus Discosoma.

20. An isolated and purified fluorescent protein coded for by DNA selected from the group consisting of:

( a ) isolated DNA which encodes a fluorescent protein having an amino acid sequence selected from the group consisting o f

SEQ ID Nos. 56, 63, 65 and 67;

( b ) isolated DNA which hybridizes to isolated DNA of ( a ) above and which encodes a fluorescent protein; and ( c ) isolated DNA differing from said isolated DNAs of ( a ) and (b) above in codon sequence due to degeneracy of the genetic code and which encodes a fluorescent protein.

2 1 . The isolated and purified fluorescent protein of claim 20, wherein said protein is drFP583.

22. The isolated and purified fluorescent protein of claim 20, wherein said protein is drFP583/dmFP592 hybrid protein.

23 . An amino acid sequence which can be used as a basis for designing an oligonucleotide probe for identification of a DNA encoding a fluorescent protein by means of hybridization, wherein said sequence is selected from the group consisting of SEQ ID Nos. 3, 5, 8 , 11 , 12, 14.

24. The amino acid sequence of claim 23, wherein said oligonucleotide has a nucleotide sequence selected from the group consisting of SEQ ID Nos. 4, 6, 7, 9, 10, 13, 15, 16.