WO2001058479A9 - Immunotherapy using interleukin 13 receptor subunit alpha 2 - Google Patents

Immunotherapy using interleukin 13 receptor subunit alpha 2

Info

Publication number
WO2001058479A9
WO2001058479A9 PCT/US2001/004384 US0104384W WO0158479A9 WO 2001058479 A9 WO2001058479 A9 WO 2001058479A9 US 0104384 W US0104384 W US 0104384W WO 0158479 A9 WO0158479 A9 WO 0158479A9
Authority
WO
WIPO (PCT)
Prior art keywords
subject
immune response
protein
response against
peptide
Prior art date
Application number
PCT/US2001/004384
Other languages
French (fr)
Other versions
WO2001058479A1 (en
Inventor
Waldemar Debinski
Original Assignee
Penn State Res Found
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Penn State Res Found filed Critical Penn State Res Found
Priority to CA002398136A priority Critical patent/CA2398136A1/en
Priority to AU2001236892A priority patent/AU2001236892A1/en
Priority to JP2001557587A priority patent/JP2004511425A/en
Priority to EP01909106A priority patent/EP1257289A1/en
Publication of WO2001058479A1 publication Critical patent/WO2001058479A1/en
Publication of WO2001058479A9 publication Critical patent/WO2001058479A9/en

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/715Receptors; Cell surface antigens; Cell surface determinants for cytokines; for lymphokines; for interferons
    • C07K14/7155Receptors; Cell surface antigens; Cell surface determinants for cytokines; for lymphokines; for interferons for interleukins [IL]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/0005Vertebrate antigens
    • A61K39/0011Cancer antigens
    • A61K39/001184Cancer testis antigens, e.g. SSX, BAGE, GAGE or SAGE
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • A61P35/04Antineoplastic agents specific for metastasis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2866Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against receptors for cytokines, lymphokines, interferons
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/505Medicinal preparations containing antigens or antibodies comprising antibodies
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/51Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/515Animal cells
    • A61K2039/5156Animal cells expressing foreign proteins
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/51Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/53DNA (RNA) vaccination
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/545Medicinal preparations containing antigens or antibodies characterised by the dose, timing or administration schedule

Definitions

  • the invention relates generally to the fields of biology, immunology, medicine, and oncology. More particularly, the invention relates to the use of the interleukin 13 (IL-13) receptor subunit alpha 2 (IL-13R ⁇ 2) as an immune system modulator and target for vaccines for the treatment and prevention of cancer.
  • IL-13 interleukin 13
  • IL-13R ⁇ 2 interleukin 13 receptor subunit alpha 2
  • TAA tumor-associated antigens
  • TSA tumor-specific antigens
  • melanoma associated antigens include prostate specific antigen (PSA), E6 and E7, carcinoembryonic antigen (CEA), p53, and gangliosides (e.g., GM2). More recent studies have shown that certain TAAs and TSAs are particularly effective at stimulating specific immune responses.
  • MAGE- 1 (Melanoma Antigen 1) as a T-cell activating TSA. Traversari et al., Immunogenetics, 35: 145-152, 1992. Subsequently other groups using similar techniques identified other T-cell activating melanoma antigens including other MAGEs, MART-1, glycoprotein 100 (g lOO), tyrosinase, BAGE, and GAGE. Reviewed by Maeurer et al., supra. One of the most exciting recent findings in cancer immunology came after the SEREX (for serological analysis of recombinant cDNA expression libraries) technique was developed.
  • SEREX for serological analysis of recombinant cDNA expression libraries
  • the SEREX technique involves screening a cDNA expression library of an autologous tumor by exposing the library to antibodies contained in a patient's sera.
  • Several active cancer antigens have been identified using this technique. See, Old, L. J. and T. C. Chen, J. Exp. Med., 187: 1163-1167, 1998.
  • SEREX analysis showed that patients produce a high titer of IgG antibodies against cancer antigens- a finding that indicated that indicated that helper T cells (e.g., CD4+ T cells) and B cells cooperate in stimulating an immune response against the cancer.
  • helper T cells e.g., CD4+ T cells
  • CTAs cancer/testis antigens
  • CTAs share several common features including (a) among normal organs, almost exclusive expression in the testis, (b) expression in a wide variety of tumors, (c) presence of multiple members in each identified family, and (d) localization of their genes to the X chromosome (with the notable exception of SCP 1). Chen et al, J. Biol. Chem., 273: 17618-17625, 1998. Based on the foregoing criteria, several previously identified TAAs or TSAs (e.g., MAGE, BAGE and GAGE) were re-discovered as CTAs.
  • TAAs or TSAs e.g., MAGE, BAGE and GAGE
  • IL-13R ⁇ 2 is a cancer/testis antigen. This discovery is important because, in contrast to most other cancer-associated agents, most of the cancer/testis antigens so far tested as active immunotherapy agents against cancer have proven very effective in stimulating anti-cancer immune responses in subjects. Thus, the present discovery provides methods and compositions for preventing and/or treating cancers that express IL-13R ⁇ 2.
  • the invention relates to the treatment and/or prevention of high-grade gliomas (HGG) in a subject as HGG cells have been shown to express high levels of IX- 13R ⁇ 2 on their surfaces.
  • Human HGG are rapidly progressing heterogeneous brain tumors of astroglial origin.
  • the present invention is especially important because no effective modalities for treating HGG are yet accepted for clinical use.
  • IL-13 a more restrictive receptor for IL-13, that is a receptor that binds IL-13 in an IL-4 independent manner.
  • IL-13R 2 a new IL-13 binding protein, termed IL-13R 2
  • This protein was shown to have affinity for IL-13 but not IL-4.
  • this characteristic relates to the more restrictive receptor for IL-13 expressed on HGG.
  • IL-13Roc2 serves as a selective target for HGG and other cancers that express IL-13R 2 because, as described in more detail below, with the exception of testis, normal human tissue expresses little or no IL-13R ⁇ 2. And although many normal tissues express a receptor that binds IL-13, this receptor
  • IL-13R ⁇ 2 (sometimes termed the "shared” receptor because it binds both IL-13 and IL-4) differs functionally from IL-13R ⁇ 2 (believed to be the "restrictive” receptor) in that the shared receptor binds both IL-13 and IL-4, while the restrictive receptor binds only IL-13.
  • the two receptors also differ structurally, with the restrictive receptor being a 42 kDa monomer and the shared receptor being a heterodimer composed of a 45 kDa component (termed IL-
  • IL-13R ⁇ 2 is strongly expressed only in testis. This finding along with the showing that (a) IL-13R ⁇ 2 is preferentially over-expressed on HGG but not normal central nervous system (CNS) tissue and (b) that the IL-13R ⁇ 2 gene is localized to chromosome X, indicates that IL-13R ⁇ 2 is a CTA. Because other CTAs have proven to stimulate a strong immune response against cancer cells, the present invention provides methods and compositions useful for generating or increasing an anti-cancer immune response in a subject.
  • CNS central nervous system
  • the invention features a method for stimulating a immune response against IL-13R ⁇ 2 in a subject having or at risk for developing a disease having cells expressing IL-13R ⁇ 2.
  • the method includes the steps of: (a) formulating an anti-cancer vaccine outside of the subject, the vaccine including an agent that can stimulate an immune response against IL-13R ⁇ 2 when administered to an animal; and (b) administering the vaccine to the subject in an amount sufficient to stimulate an immune response against IL- 13R ⁇ 2 in the subject.
  • the invention features a composition for stimulating an immune response against IL-13R ⁇ 2 when administered to an animal.
  • the composition includes: (a) an isolated agent that can stimulate an immune response against IL-13R ⁇ 2 when administered to an animal; and (b) a pharmaceutically acceptable carrier.
  • the agent that can stimulate an immune response against IL-13R 2 can include a peptide including at least seven contiguous amino acids of SEQ ID NO: 1.
  • the agent can be a protein including the amino acid sequence of SEQ ID NO: 1.
  • the agent can also take the form of a nucleic acid that encodes a peptide including at least seven contiguous amino acids of SEQ ID NO: 1.
  • Such a nucleic acid can be used as a naked DNA or in an expression vector construct including the nucleic acid.
  • the agent that can stimulate an immune response against IL-13R ⁇ 2 can also be a cell.
  • This cell can be one that expresses a peptide including at least seven contiguous amino acids of SEQ ID NO: 1 , or one into which a purified nucleic acid that encodes a peptide including at least seven contiguous amino acids of SEQ ID NO:l has been introduced.
  • the vaccines and compositions within the invention can further include an adjuvant such as an aluminum salt; an oil-in- water emulsion; a composition including saponin; a composition including a bacterial protein; or a cytokine.
  • an adjuvant such as an aluminum salt; an oil-in- water emulsion; a composition including saponin; a composition including a bacterial protein; or a cytokine.
  • the method of the invention can further include a step of providing a subject (e.g., a human being) having or at risk for developing a cancer having cells expressing IL-13R ⁇ 2 (e.g., glioma cells). Also in the method, the step of administering the vaccine to the subject in an amount sufficient to stimulate an immune response against IL-13R ⁇ 2 in the subject can include administering the vaccine in at least a first dose and a second dose, wherein the first dose is administered to the subject at least 24 hours before the second dose is administered to the subject.
  • a subject e.g., a human being
  • IL-13R ⁇ 2 e.g., glioma cells
  • nucleic acid means a chain of two or more nucleotides.
  • RNA ribonucleic acid
  • DNA deoxyribonucleic acid
  • An "isolated" nucleic acid is one that has been substantially separated or purified away from other nucleic acid sequences in the cell of the organism in which the nucleic acid naturally occurs, i.e., other chromosomal and extrachromosomal DNA and RNA, e.g., by conventional nucleic acid purification methods.
  • the term therefore includes a recombinant nucleic acid molecule incorporated into a vector, into an autonomously replicating plasmid or virus, or into the genomic DNA of a prokaryote or eukaryote.
  • a "recombinant" nucleic acid molecule is one made by an artificial combination of two otherwise separated segments of sequence, e.g., by chemical synthesis or by the manipulation of isolated segments of nucleic acids by genetic engineering techniques.
  • nucleic acid molecule or polypeptide When referring to a nucleic acid molecule or polypeptide, the term “native” refers to a naturally-occurring (e.g., a "wild-type") nucleic acid or polypeptide.
  • a “homolog” of an IL- 13R ⁇ 2 gene is a gene sequence encoding an IL-13R ⁇ 2 polypeptide isolated from a species other than Homo sapiens.
  • naked nucleic acid is meant an isolated nucleic acid not incorporated in an expression vector.
  • IL-13R ⁇ 2 gene or "IL-13R 2 polynucleotide” is meant a native IL- 13R ⁇ 2 encoding nucleic acid sequence (e.g., the IL-13R ⁇ 2 cDNA sequence shown as SEQ ID NO: 1
  • protein means any peptide-linked chain of amino acids, regardless of length or post-translational modification, e.g., glycosylation or phosphorylation.
  • peptide is used herein to refer to amino acid chains less than about 25 amino acid residues in length, while the terms “protein” and “polypeptide” are used to refer to larger amino acid chains.
  • isolated means proteins or peptides that are isolated from other cellular proteins or are made synthetically. The term thus encompasses both purified and recombinant polypeptides.
  • recombinant protein or “recombinant peptide” refers to a protein or peptide that is produced by recombinant nucleic acid techniques, wherein generally, a nucleic acid encoding the peptide or protein is inserted into a suitable expression vector which is in turn used to transform a host cell such that, when cultured under appropriate conditions, the cell produces the peptide or protein.
  • LL-13R ⁇ 2 protein IL-13R ⁇ 2 polypeptide
  • IL-13R ⁇ 2 polypeptide or simply “LL-13R ⁇ 2” is meant an expression product of an IL-13R ⁇ 2 gene such as the protein of SEQ ID NO: 1 (Fig. 1); or a protein that shares at least 65% (but preferably 75, 80, 85, 90 , 95, 96, 97 ,98, or 99%) amino acid sequence identity with SEQ ID NO:l and cross-reacts with antibodies that specifically bind the protein of SEQ ID NO: 1.
  • sequence identity means the percentage of identical subunits at corresponding positions in two sequences when the two sequences are aligned to maximize subunit matching, i.e., taking into account gaps and insertions.
  • sequence identity means the percentage of identical subunits at corresponding positions in two sequences when the two sequences are aligned to maximize subunit matching, i.e., taking into account gaps and insertions.
  • the length of the compared sequences is at least 60 nucleotides, more preferably at least 75 nucleotides, and most preferably 100 nucleotides.
  • Sequence identity is typically measured using sequence analysis software (e.g., Sequence Analysis Software Package of the Genetics Computer Group, University of Wisconsin Biotechnology Center, 1710 University Avenue, Madison, WI 53705).
  • a first nucleic-acid sequence is "operably" linked with a second nucleic-acid sequence when the first nucleic-acid sequence is placed in a functional relationship with the second nucleic-acid sequence.
  • a promoter is operably linked to a coding sequence if the promoter affects the transcription or expression of the coding sequence.
  • operably > linked DNA sequences are contiguous and, where necessary to join two protein coding regions, in reading frame.
  • the term "vector” refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked.
  • a vector capable of directing the expression of a gene to which it is operatively linked is referred to herein as an "expression vector.”
  • promoter means a nucleic acid sequence that regulates expression of a selected nucleic acid sequence operably linked to the promoter, and which effects expression of the selected nucleic acid sequence in cells.
  • tissue specific promoters i.e. promoters, which effect expression of the selected nucleic acid sequence only in specific cells (e.g. cells of a specific tissue).
  • the term also covers so-called “leaky” promoters, which regulate expression of a selected nucleic acid primarily in one tissue, but cause expression in other tissues as well.
  • the term also encompasses both non-tissue specific promoters and promoters that are constitutively active and inducible.
  • lymphocyte e.g., a B cell or T cell
  • the stimulation of an immune response against a specific antigen can be measured as an increase in antibody titer against that antigen or the activation of one or more lymphocytes having a surface receptor specific for the antigen.
  • Activation of lymphocytes can be determined by conventional assays, e.g., the induction of mitosis, secretion of cytokines, modulation of cell surface molecule expression, secretion of immunoglobulin (B cells), and increased killing of target cells (cytotoxic T cells).
  • bind means that one molecule recognizes and adheres to a particular second molecule in a sample, but does not substantially recognize or adhere to other structurally unrelated molecules in the sample.
  • a first molecule that "specifically binds" a second molecule has a binding affinity greater than about 10 5 to 10 6 liters/mole for that second molecule.
  • antibody any antigen-binding peptide derived from an immunoglobulin.
  • the term includes polyclonal antisera, monoclonal antibodies, fragments of immunoglobulins produced by enzymatic digestion (e.g., Fab fragments) or genetic engineering (e.g., sFv fragments).
  • Fab fragments fragments of immunoglobulins produced by enzymatic digestion
  • sFv fragments genetic engineering
  • Fig. 1 is the amino acid sequence of the native H. sapiens IL-13R ⁇ 2 protein.
  • Fig. 2 is the nucleic acid sequence of a cDNA corresponding to a native mRNA encoding the native H. sapiens IL-13R 2 protein.
  • Fig. 3 is a schematic representation of two types of IL13 receptors: the shared with IL4 physiological, heterodimeric IL13/4R, and an IL4-independent monomeric, HGG- associated IL13R.
  • A 140-kDa IL4R ⁇ -chain.
  • B 45-kDa IL13R c -chain;
  • a and B constitute the elements of the heterodimeric high affinity IL13/4R.
  • C a 42-kDa monomer of IL13R ⁇ 2.
  • Fig. 4 is a Northern blot analysis of human IL13R ⁇ 2 transcripts (closed figure) in series of CNS (panels I and II) and peripheral tissues (panels III and IN). The migration position of mR ⁇ A is shown in kilobases. Films were exposed for 2 weeks.
  • Fig. 5 is a Northern blot analysis of human LL13R ⁇ 2 transcripts (closed figure) in series of CNS (panels I and II) and peripheral tissues (panels III and IV). The migration position of mRNA is shown in kilobases. Films were exposed for 2 weeks except for membranes shown in panels III and IN, which were exposed for 3 days.
  • Fig. 6 is a Northern blot analysis of human 140-kDa IL4R ⁇ -chain transcripts (closed figure) in series of CNS (panels I and II) and peripheral tissues (panel IN). The migration position of mR ⁇ A is shown in kilobases. Films were exposed for 2 weeks.
  • Fig. 7 is a Northern blot analysis of human ⁇ -actin transcripts in CNS (panels I and II) and peripheral tissues (panel IN). The migration position of mR ⁇ A is shown in kilobases. Films were exposed for 1-3 hours.
  • Fig. 8 is a Northern blot analysis of transcripts of different IL13 receptors in malignant glioma cells (G-48, A- 172 MG, U-373 MG, and U-251 MG), normal human umbilical vein endothelial cells (HUVEC) and in surgical specimens of GBM and normal human brain. The migration position of mRNA is shown in kilobases. Films were exposed for 2 weeks, except for actin (1 hr).
  • the invention encompasses compositions and methods relating to stimulating an immune response against IL-13R ⁇ 2 in a subject having or being at risk for developing a cancer or other disease having cells expressing IL-13R 2.
  • the below described preferred embodiments illustrate adaptations of these compositions and methods. Nonetheless, from the description of these embodiments, other aspects of the invention can be made and/or practiced based on the description provided below.
  • IL-13R ⁇ 2 is a receptor for the lymphokine IL-13.
  • IL-13 has been identified as a homologue of IL-4 that is secreted by both B and T cells. Minty et al.,
  • IL-13 receptor termed the shared IL-13/IL-4 receptor, which is a heterodimer that includes an IL-13 binding subcomponent named IL- 13R ⁇ l (Interleukin 13 receptor alpha one).
  • IL- 13R ⁇ l Interleukin 13 receptor alpha one
  • the shared receptor also includes a protein referred to as pi 40 (or IL-4R ⁇ ), the subcomponent responsible for IL-4 binding.
  • pi 40 or IL-4R ⁇
  • IL-13 results in responses very similar to those responses that occur after exposure to IL-4. Zurawski, G., and J.E. de Vries, Stem Cells. 12: 169-174, 1994.
  • Examples of cellular responses resulting from both IL-13 and IL-4 exposure include enhanced expression of CD72, IgM, and MHC class II antigen, as well as induced CD23 expression and IgE heavy-chain gene production in B lymphocytes. Id.
  • IL-13R ⁇ l was not the only IL-13 binding site that existed on cells. In previous studies, it was demonstrated that many cancers, most notably HGG, are capable of binding IL-13.
  • Debinski et al. Clin. Cancer Res., 1 : 1253- 1258, 1995; Debinski et al., J. Biol. Chem., 271: 22428-22433, 1996; Debinski et al., Nature Biotech., 16: 449-453, 1998; Debinski et al., Critic Rev. Oncogen., 9: 256-268, 1998;
  • IL-13R ⁇ 2 The gene encoding this protein, termed IL-13R ⁇ 2, was subsequently cloned and sequenced. Id.
  • the proposed structures of the shared IL- 13/4 receptor and the IL-4-independent receptor for IL- 13 are shown in Fig. 3.
  • IL-13R ⁇ 2 is a transmembrane receptor, it is exposed to the extracellular environment independently of MHC presentation.
  • cytotoxic agents or antibodies can be directly targeted to cancer cells bearing IL-13R ⁇ 2 on their surface.
  • This discovery that IL-13R ⁇ 2 is a CTA associated with HGG is significant because no other HGG-associated antigens of this prevalence are known that could serve as a basis for a rational design of anti-glioma vaccines.
  • the invention provides vaccines that can stimulate an immune response against IL- 13R ⁇ 2 in a subject when administered to the subject.
  • Vaccines within the invention include an antigenic agent which can take the form of any substance that can evoke or increase an immune response against IL-13R ⁇ 2 when introduced into a subject.
  • Typical immune responses include (a) the production of, or increase in titer of, antibodies that specifically bind IL-13R ⁇ 2 and (b) the activation of T lymphocytes (e.g., to kill a target cell or provide help in the activation of antibody production in B lymphocytes).
  • antigenic agents have been shown to be effective in stimulating an immune response against a protein antigen, including, for example, protein- and peptide-based vaccines, tumor-cell vaccines, dendritic cell/gene therapy vaccines and DNA/viral vaccines. See, e.g., Greten, T.F. and E.M. Jaffee, J. Clin. Oncol., 17: 1047-1060, 1999.
  • various substances such as adjuvants and excipients/carriers can be included in the vaccine compositions of the invention to non-specifically enhance the antigen-specific immune response stimulated by the antigenic agent and to facilitate delivery of the other components of the vaccine to a subject.
  • the antigenic agent for use in the vaccines of the invention can take the form of the native IL-13R ⁇ 2 (SEQ ID NO:l) or a peptide fragment of IL-13R ⁇ 2.
  • Vaccines made with the whole protein antigen are advantageous because they have the capability of stimulating an immune response against all of the potential antigenic sites expressed by the protein.
  • Vaccines made with peptide antigens e.g., 7-15 or 8-12 contiguous amino acids of the whole protein
  • Peptide-based vaccines are sometimes advantageous over whole protein-based vaccines where it is desired to more specifically target the stimulated immune response, e.g., to avoid undesired cross reactions.
  • peptides for use in the vaccine can be selected to correspond to (1) specific epitopes of the antigens that are known to be presented by MHC class I or MHC class II molecules, or (2) a modified form of an epitope that either exhibits an increased stability in vivo or a higher binding affinity for an MHC molecule than the native epitope, while still being capable of specific activation of T-cells.
  • MHC class I or MHC class II molecules or
  • vaccines with in the invention can include an IL-13R ⁇ 2 protein as an antigenic agent.
  • Preferred forms of IL-13R ⁇ 2 protein include a purified native IL-13R ⁇ 2 protein that has the amino acid sequence shown in Fig. 1 (SEQ ID NO:l).
  • Variants of the native IL-13R ⁇ 2 protein such as fragments, analogs and derivatives of native IL-13R ⁇ 2 are also contemplated for use as an antigenic agent in the vaccines of the invention.
  • Such variants include, e.g., a polypeptide encoded by a naturally occurring allelic variant of the native IL-13R ⁇ 2 gene, a polypeptide encoded by a homolog of the native IL-13R ⁇ 2 gene, and a polypeptide encoded by a non-naturally occurring variant of the native IL-13R ⁇ 2 gene.
  • Preferred versions of such variants are those that are able to stimulate an immune response to native IL- 13R ⁇ 2 upon administration to a subject as part of a vaccine.
  • IL-13R ⁇ 2 protein variants have a peptide sequence that differs from the native IX- 13R ⁇ 2 protein in one or more amino acids.
  • the peptide sequence of such variants can feature a deletion, addition, or substitution of one or more amino acids of the native IL-13R ⁇ 2 polypeptide.
  • Amino acid insertions are preferably of about 1 to 4 contiguous amino acids, and deletions are preferably of about 1 to 10 contiguous amino acids.
  • variant IL-13R ⁇ 2 proteins substantially maintain a native IL-13R ⁇ 2 protein functional activity (e.g., the ability to specifically bind IL-13).
  • variant IL-13R ⁇ 2 proteins lack or feature a significant reduction in an IL-13R ⁇ 2 protein functional activity.
  • preferred IL- 13R ⁇ 2 protein variants can be made by expressing nucleic acid molecules within the invention that feature silent or conservative changes.
  • Variant IL-13R ⁇ 2 proteins with substantial changes in functional activity can be made by expressing nucleic acid molecules within the invention that feature less than conservative changes.
  • IL-13R ⁇ 2 protein fragments corresponding to one or more particular motifs (e.g., those likely to bind with high affinity to MHC molecules) and/or domains are within the invention as are those of arbitrary sizes.
  • peptide fragments of IL-13R ⁇ 2 protein consisting of at least 5, 10, 25, 30, 40, 50, 50, 70, 75, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 300 or more contiguous amino acids of the IL-13R ⁇ 2 protein are within the scope of the present invention.
  • Fragments of between 7 and 15 amino acids (preferably 8-12 amino acids) in length are preferred as peptides of such size have been shown to serve as efficient immunogenic agents.
  • Methods for identifying efficiently immunogenic peptides of a whole protein are known in the art, e.g., using amphipathicity algorithms. See, e.g., Berzofsky, J. A., Ann. N. Y. Acad. Sci., 12:256, 1993; U.S. Patent Nos. 5,976,541 and 5,980,899.
  • Peptides that are most immunogenic in a subject can also be determined by preparing a series of overlapping peptide fragments (e.g., 7-30 amino contiguous amino acids long) of the whole antigen, administering the subject (or a series of genetically similar such subjects) such fragments in a vaccine composition, and analyzing the subject(s) for the stimulation of an immune response. Those peptide fragments that induce the desired response can then be selected.
  • a series of overlapping peptide fragments e.g., 7-30 amino contiguous amino acids long
  • Isolated peptidyl portions of IL-13R ⁇ 2 proteins can be obtained by screening peptides recombinantly produced from the corresponding fragment of the nucleic acid encoding such peptides.
  • fragments can be chemically synthesized using techniques known in the art such as conventional Merrifield solid phase f-Moc or t-Boc chemistry.
  • an IL-13R ⁇ 2 protein of the present invention may be arbitrarily divided into fragments of desired length with no overlap of the fragments, or preferably divided into overlapping fragments of a desired length. The fragments can be produced (recombinantly or by chemical synthesis) and tested to identify those peptidyl fragments which can function antigenic agents that stimulate an immune response against an IL-13R ⁇ 2 protein.
  • IL-13R ⁇ 2 proteins are recombinant forms of the IL-13R ⁇ 2 proteins.
  • Recombinant polypeptides preferred for use in the present invention, in addition to native IL-13R ⁇ 2 protein, are encoded by a nucleic acid that has at least 85% sequence identity (e.g., 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100%) with the nucleic acid sequence of SEQ ID NO:2.
  • variant IL-13R ⁇ 2 have the ability to stimulate an immune response against the native IL-13R ⁇ 2 protein.
  • IL-13R ⁇ 2 protein variants can be generated through various techniques known in the art.
  • IL-13R ⁇ 2 protein variants can be made by mutagenesis, such as by introducing discrete point mutation(s), or by truncation. Mutation can give rise to an IX- 13R ⁇ 2 protein variant having more, substantially the same, or merely a subset of the antigenic activity of the native IL- 13R ⁇ 2 protein.
  • Other variants of IL- 13R ⁇ 2 that can be generated include those that are resistant or more susceptible to proteolytic cleavage, as for example, due to mutations which alter protease target sequences.
  • Whether a change in the amino acid sequence of a peptide results in a IL-13R ⁇ 2 protein variant having greater or lesser antigenic activity than native IL-13R ⁇ 2 protein can be readily determined by comparing the variant with the native IL-13R ⁇ 2 protein for the ability to stimulate an immune response against IL-13R ⁇ 2 in subjects vaccinated with the respective proteins.
  • IL-13R ⁇ 2 protein variants can be generated from a degenerate oligonucleotide sequence.
  • Chemical synthesis of a degenerate gene sequence can be carried out in an automatic DNA synthesizer, and the synthetic genes then ligated into an appropriate expression vector.
  • the purpose of a degenerate set of genes is to provide, in one mixture, all of the sequences encoding the desired set of potential IL-13R ⁇ 2 protein sequences.
  • the synthesis of degenerate oligonucleotides is well known in the art (see for example, Narang, SA (1983) Tetrahedron 39:3; Itakura et al. (1981) Recombinant DNA, Proc. 3rd Cleveland
  • a library of coding sequence fragments can be provided for an IL-13R ⁇ 2 gene clone in order to generate a variegated population of IL-13R ⁇ 2 protein fragments for screening and subsequent selection of fragments having the ability to stimulate an immune response against IL-13R ⁇ 2 in a subject.
  • a variety of techniques are known in the art for generating such libraries, including chemical synthesis.
  • a library of coding sequence fragments can be generated by (i) treating a double-stranded PCR fragment of an IL-13R ⁇ 2 gene coding sequence with a nuclease under conditions wherein nicking occurs only about once per molecule; (ii) denaturing the double-stranded DNA; (iii) renaturing the DNA to form double-stranded DNA which can include sense/antisense pairs from different nicked products; (iv) removing single-stranded portions from reformed duplexes by treatment with SI nuclease; and (v) ligating the resulting fragment library into an expression vector.
  • an expression library can be derived which codes for N-terminal, C-terminal and internal fragments of various sizes.
  • the invention also provides for reduction of IL-13R ⁇ 2 proteins to generate mimetics, e.g. peptide or non-peptide agents, that are able to stimulate an immune response against IL-
  • non-hydrolyzable peptide analogs of the amino acid residues of IL-13 R ⁇ 2 proteins and peptides thereof can be generated using benzodiazepine (e.g., see Freidinger et al. in Peptides: Chemistry and Biology, G. R. Marshall ed., ESCOM Publisher: Leiden, Netherlands, 1988), azepine (e.g., see Huffman et al. in Peptides: Chemistry and Biology, G. R. Marshall ed., ESCOM Publisher: Leiden, Netherlands, 1988), substituted gamma lactam rings (Garvey et al. in Peptides: Chemistry and Biology, G. R.
  • IL-13R ⁇ 2 proteins may also be chemically modified to create IL-13R ⁇ 2 derivatives by forming covalent or aggregate conjugates with other chemical moieties, such as glycosyl groups, lipids, phosphate, acetyl groups and the like.
  • Covalent derivatives of IL-13R ⁇ 2 proteins or peptides can be prepared by linking the chemical moieties to functional groups on amino acid side chains of the protein/peptide or at the N- terminus or at the C-terminus of the protein/peptide.
  • IL-13R ⁇ 2 proteins may also be fused to one or more other proteins.
  • an IL-13R ⁇ 2 protein or immunogenic portion thereof may be fused to another protein that serves as a targeting ligand to deliver the IL-13R ⁇ 2 protein or portion to a particular target site in a subject (e.g., in order to stimulate a local immune response at that site).
  • an IX- 13R ⁇ 2 protein or peptide can be fused to a mutant IL-13 molecule or anti-IL-13 receptor antibody to specifically target the IL-13R ⁇ 2 protein or peptide to a tumor, e.g., a HGG.
  • the IL-13R ⁇ 2 proteins and peptides of the invention can be made by known methods.
  • a host cell fransfected with a nucleic acid vector directing expression of a nucleotide sequence encoding the subject proteins or peptides can be cultured under appropriate conditions to allow expression of the peptide to occur.
  • the cells may be harvested, lysed, and the protein isolated.
  • a recombinant IL-13R ⁇ 2 protein or peptide can be isolated from host cells using techniques known in the art for purifying proteins including ion-exchange chromatography, gel filtration chromatography, ultrafiltration, electrophoresis, and immunoaffinity purification with antibodies specific for such protein or peptide.
  • an IL-13R ⁇ 2 protein or peptide after expressed in a cell, it can be isolated using immuno-affinity chromatography.
  • an anti-IL-13R ⁇ 2 antibody that specifically binds the subject proteins or peptides can be immobilized on a column chromatography matrix, and the matrix can be used for immuno-affinity chromatography to purify the proteins or peptides from cell lysates by standard methods (see, e.g., Ausubel et al., supra).
  • the proteins or peptides can be further purified by other standard techniques, e.g., high performance liquid chromatography (see, e.g., Fisher, Laboratory Techniques In Biochemistry And Molecular Biology, Work and Burdon, eds., Elsevier, 1980).
  • high performance liquid chromatography see, e.g., Fisher, Laboratory Techniques In Biochemistry And Molecular Biology, Work and Burdon, eds., Elsevier, 1980.
  • the IL-13R ⁇ 2 proteins or peptides utilized in the invention are expressed as a fusion protein containing an affinity tag (e.g.,
  • an adjuvant in association with an antigenic agent (e.g., a IL-13R ⁇ 2 protein or peptide fragment thereof) of a vaccine of the invention, can be used to boost the immune response.
  • Suitable adjuvants for use in the invention can include any substance that can non-specifically enhance an antigen-specific immune response stimulated by an antigenic agent.
  • adjuvants include for example: (1) Freund's adjuvant (complete and incomplete) (2) oil-in-water emulsion formulations such as the RibiTM adjuvant system (Corixa, Seattle, Washington) (3) aluminum salts (e.g., aluminum hydroxide, aluminum phosphate, aluminum sulfate, etc); (4) saponin-based adjuvants (StimulonTM from Aquila Biosciences, Framingham, Massachusetts); (5) cytokines such as IL-1, IL-2, macrophage colony stimulating factor, and tumor necrosis factor; and (6) other substances that act as immunostimulating agents such as muramyl peptides or bacterial cell wall components, toxins, and toxoids.
  • the vaccine compositions of the invention can further contain a pharmaceutically acceptable carrier or excipient.
  • a pharmaceutically acceptable carrier or excipient e.g., the protein/peptide antigen and adjuvant
  • the protein/peptide antigen and adjuvant can be mixed with a diluent such as water, saline, glycerol, ethanol, etc.
  • a diluent such as water, saline, glycerol, ethanol, etc.
  • Other substances, such as preservatives, surfactants, emulsifying agents, buffers, etc. can also be included.
  • the protein peptide-based vaccine compositions of the invention are prepared for parenteral injection as liquid solutions or suspensions.
  • the vaccine compositions can also be prepared as solids (e.g., a lyophilized powder) that can be reconstituted in a liquid (e.g., saline) prior to injection into a subject.
  • the vaccine compositions can also be emulsified or encapsulated in liposomes.
  • nucleic acid-based vaccines are known to elicit a prominent cell-mediated immune response. See, e.g., Donnely et al., 1997; Rosenberg, S.A., Immunity 10:281, 1999.
  • the antigenic agent for use in the vaccines of the invention can take the form of a nucleic acid that can stimulate an immune response against IL-13R ⁇ 2 when administered to a subject.
  • nucleic acids include those that encode the native IL-13R ⁇ 2 such as the nucleic acid shown herein as SEQ ID NO:2 (Fig. 2), a variant of the native IL-13R ⁇ 2, or a peptide fragment of that native or variant IL-13R ⁇ 2.
  • Vaccines made with a nucleic acid that encodes the whole protein antigen are advantageous because they have the potential for stimulating an immune response against all of the different antigenic sites expressed by the protein.
  • Vaccines made with a nucleic acid that encodes a peptide antigen e.g., 7-15 amino acids of the whole protein
  • the form of the nucleic acid used in a vaccine of the invention can be any suitable for stimulating an immune response against IL-13R ⁇ 2 when administered to a subject.
  • the nucleic acid can be in the form of "naked DNA” or it can be incorporated in an expression vector.
  • a description of suitable nucleic acids is presented below.
  • Nucleic acids that are most immunogenic in a subject can be determined by preparing several of the below listed nucleic acids (e.g., those that encode the whole antigen or peptide fragments thereof), administering the subject (or a series of genetically similar such subjects) such nucleic acids in a vaccine composition (e.g., as naked nucleic acid or in an expression vector in a suitable carrier), and analyzing the subject(s) for the stimulation of an immune response. Those nucleic acids that induce the desired response can then be selected.
  • a vaccine composition e.g., as naked nucleic acid or in an expression vector in a suitable carrier
  • Nucleic acid molecules utilized in the present invention as an antigenic agent may be in the form of RNA or in the form of DNA (e.g., cDNA, genomic DNA, and synthetic DNA).
  • the DNA may be double-stranded or single-stranded, and if single-stranded may be the coding (sense) strand or non-coding (anti-sense) strand.
  • the coding sequence which encodes the native IL-13R ⁇ 2 protein may be identical to the nucleotide sequence shown in Fig. 2. It may also be a different coding sequence which, as a result of the redundancy or degeneracy of the genetic code, encodes the same polypeptide as shown in SEQ ID NO:l (Fig. 1).
  • nucleic acid molecules useful in the invention are variants of the native IL- 13R ⁇ 2 gene such as those that encode fragments (e.g., post-translationally processed forms of), analogs and derivatives of a native IL-13R ⁇ 2 protein.
  • variants may be, e.g., a naturally occurring allelic variant of the native IL-13R ⁇ 2 gene, a homolog of the native IX- 13R ⁇ 2 gene, or a non-naturally occurring variant of the native IL-13R ⁇ 2 gene.
  • These variants have a nucleotide sequence that differs from the native IL-13R ⁇ 2 gene in one or more bases.
  • nucleotide sequence of such variants can feature a deletion, addition, or substitution of one or more nucleotides of the native IL-13R ⁇ 2 gene.
  • Nucleic acid insertions are preferably of about 1 to 10 contiguous nucleotides, and deletions are preferably of about 1 to 30 contiguous nucleotides.
  • Naturally occurring allelic variants of the native IL-13R ⁇ 2 gene within the invention are nucleic acids isolated from human tissue that have at least 75% (e.g., 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, and 99%) sequence identity with the native IL-13R ⁇ 2 gene, and encode polypeptides having structural similarity to native IL-13R ⁇ 2 protein.
  • 75% e.g., 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, and 99%
  • Homologs of the native IL-13R ⁇ 2 gene within the invention are nucleic acids isolated from other species that have at least 75% (e.g., 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, and 99%) sequence identity with the native IL-13R ⁇ 2 gene, and encode polypeptides having structural similarity to native IL-13R ⁇ 2 protein.
  • 75% e.g., 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, and 99%
  • Non-naturally occurring IL-13R ⁇ 2 gene variants are nucleic acids that do not occur in nature (e.g., are made by the hand of man), have at least 75% (e.g., 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, and 99%) sequence identity with the native IL-13R ⁇ 2 gene, and encode polypeptides having structural similarity to native IL-13R ⁇ 2 protein.
  • 75% e.g., 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, and 99%
  • non- naturally occurring IL-13R ⁇ 2 gene variants are those that encode a fragment of a IL-13R ⁇ 2 protein, those that hybridize to the native IL-13R ⁇ 2 gene or a complement of to the native IL- 13R ⁇ 2 gene under stringent conditions, those that share at least 65% sequence identity with the native IL-13R ⁇ 2 gene or a complement of the native IL-13R ⁇ 2 gene, and those that encode a IL- 13R ⁇ 2 fusion protein.
  • Nucleic acids encoding fragments of native IL-13R ⁇ 2 protein within the invention are those that encode, e.g., 2, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300 or more amino acid residues of the native IX- 13R ⁇ 2 protein. Shorter oligonucleotides (e.g., those of 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 50, 100, 125, 150, or 200 base pairs in length) that encode fragments of the native IL-13R ⁇ 2 protein can be used. Nucleic acids encoding fragments of native IL-13R ⁇ 2 protein can be made by enzymatic digestion (e.g., using a restriction enzyme) or chemical degradation of the full length native IL-13R ⁇ 2 gene or variants thereof.
  • Shorter oligonucleotides e.g., those of 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 50
  • Nucleic acid molecules encoding IL-13R ⁇ 2 fusion proteins are also within the invention.
  • Such nucleic acids can be made by preparing a construct (e.g., an expression vector) that expresses a IL-13R ⁇ 2 fusion protein when introduced into a suitable host.
  • a construct e.g., an expression vector
  • such a construct can be made by ligating a first polynucleotide encoding an IX- 13R ⁇ 2 protein fused in frame with a second polynucleotide encoding another protein (e.g., a detectable label or carrier protein) such that expression of the construct in a suitable expression system yields a fusion protein.
  • IL-13R ⁇ 2 fusion proteins can be used, e.g., to enhance the immunogenicity of IL-13R ⁇ 2 peptides, to facilitate purification of IL-13R ⁇ 2 proteins/peptides, or to track the location of the IL-13R ⁇ 2 fusion protein after it has been administered to a subject.
  • nucleotide sequence of the native IL-13R ⁇ 2 gene arid the amino acid sequence of a native IL-13R ⁇ 2 protein
  • those skilled in the art can create nucleic acid molecules that have minor variations in their nucleotide sequences, by, for example, standard nucleic acid mutagenesis techniques or by chemical synthesis.
  • Variant IL-13R ⁇ 2 nucleic acid molecules can be expressed to produce variant IL-13R ⁇ 2 proteins.
  • the invention provides for the use of naked nucleic acid vaccines to stimulate an immune response against IL-13R ⁇ 2.
  • Representative naked nucleic acid vaccines for use in this method include a DNA encoding one or more immunogenic portions of IL-13R ⁇ 2 along with sufficient other 5' and 3' elements to direct expression of the foregoing.
  • the use of naked nucleic acids for stimulating both class I and class II restricted immune responses against a particular protein is known in the art. See, e.g., Rosenberg, S.A., Immunity 10:281, 1999; Ulmer et al, Science, 259: 1745, 1993; Donnelly et al, Ann. NY Acad. Sci., 772:40,
  • nucleic acid vaccines can be administered to a subject by any suitable technique.
  • naked DNA encoding a peptide portion of IL-13R ⁇ 2 can be injected into muscle cells of a subject or naked DNA- coated gold particles can be introduced into skin cells (to be taken up by dendritic cells) of a subject using a gene gun.
  • Expression Vector Vaccines The invention also provides for the use of expression vector vaccines to stimulate an immune response against IL-13R ⁇ 2.
  • a nucleic acid encoding one or more peptide or protein antigens of IL-13R ⁇ 2 is incorporated into a vector that allows expression of the antigen(s) in a host cell (e.g., a cell inside a subject or administered to a subject).
  • the nucleic acid encoding the antigen(s) is generally be under the operational control of other sequences contained within the vector such as a promoter sequences (e.g., tissue specific, constitutively active, or inducible) or enhancer sequences.
  • the antigen(s) encoded by the vector are expressed when the vector is introduced into a host cell in a subject. After expression, the antigen(s) can associate with an MHC molecule for presentation to immune system cells such as T lymphocytes, thus stimulating an immune response. See, e.g., Corr et al, J. Exp. Med. 184:1555 (1996).
  • Vectors for use in the invention can be any capable of expressing an encoded antigen(s) in a subject.
  • vectors derived from bacterial plasmids and viruses may be used. Representative viral vectors include retroviral, adenoviral, and adeno-associated viral vectors. See, e.g., Gene Therapy: Principles and Applications, ed. T. Blackenstein, Springer Verlag, 1999; Gene Therapy Protocols (Methods in Molecular Medicine), ed. P.D.
  • Cell-based vaccines are provided in the invention to stimulate an immune response against IL-13R ⁇ 2.
  • cancer cells isolated from a patient have been harbored in vitro and fransfected with DNA encoding for immune stimulants, such as cytokines, MHC molecules or co-stimulatory molecules.
  • immune stimulants such as cytokines, MHC molecules or co-stimulatory molecules.
  • the fransfected cancer cells were then re-injected to the patient in order to activate the immune system in order to generate an anti-cancer response.
  • the invention further provides an isolated cell expressing IX-13R ⁇ 2 or a peptide fragment of IL-13R ⁇ 2.
  • Cells expressing IL-13R ⁇ 2 can be isolated from a subject having such cells (e.g., from testis or HGG). Cells that do not express IL-13R ⁇ 2 can be made to express this protein in a number of different ways. As one example, cells can be cultured with IL-13R ⁇ 2 or peptide fragments thereof under conditions in which fragments of IX-
  • cells can be made to express IL-13R ⁇ 2 by introducing a nucleic acid encoding an IL-13R ⁇ 2 protein, a peptide fragment of IL-13R ⁇ 2, or a variant of the foregoing into the cells, and culturing such cells under conditions that cause the cells to express the protein or peptide.
  • Cellular expression of the protein, peptide, or variant can be monitored by any conventional technique.
  • fluorescently labeled antibodies that specifically bind the protein, peptide, or variant can be used to detect expression of the protein, peptide, or variant on a cell. See, e.g., Kim et al, J. Immunother. 20:276, 1997.
  • Western blotting using antibodies that specifically bind the protein, peptide, or variant can be used to detect expression of the protein, peptide, or variant in lysates of a cell.
  • Cell types suitable for stimulating an immune response against IL-13R ⁇ 2 can be prokaryotic or eukaryotic. A number of such cells are known in the art, so an exhaustive list is not provided herein. Examples of suitable prokaryotic cells include bacterial cells such as E. coli, B.
  • suitable eukaryotic cells include plant, yeast, insect, avian, nematode (e.g., C elegans), and mammalian cells (e.g., autologous cells from a human patient that are to be later reintroduced into the patient). These cells can be cultured in conventional nutrient media modified as appropriate for inducing promoters, selecting transformants, or amplifying the genes encoding the desired sequences.
  • cells that can be used to stimulate an immune response against IL-13R ⁇ 2 include those that express a peptide comprising a least 7 (e.g., 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more) contiguous amino acids of SEQ ID NO:l.
  • a peptide comprising a least 7 e.g., 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more
  • an isolated cell expressing a protein having the sequence of SEQ ID NO:l can be used.
  • Cells into which have been introduced a purified nucleic acid that encodes a peptide comprising a least 7 contiguous amino acids of SEQ ID NO:l might also be used.
  • any cell that can express IL- 13R ⁇ 2 protein, a peptide fragment of IL- 13R ⁇ 2, or a variant of the foregoing can be used to stimulate an immune response in a subject, some are preferred because of their particular antigen presentation capabilities.
  • examples of such cells include antigen-presenting cells (APCs) such as B lymphocytes, monocytes/macrophages, dendritic cells (DC), and other cells expressing major histocompatability complex (MHC) and/or costimulatory molecules.
  • APCs antigen-presenting cells
  • B lymphocytes such as B lymphocytes, monocytes/macrophages, dendritic cells (DC), and other cells expressing major histocompatability complex (MHC) and/or costimulatory molecules.
  • APCs antigen-presenting cells
  • DC dendritic cells
  • MHC major histocompatability complex
  • DC are known to function as particularly strong APCs, their use in the cell- based vaccine of the invention is particularly preferred. See, e.g., Banchereau et al, Ann. Rev. Immunology, 18:767, 2000.
  • DC can be made to express an IL-13R ⁇ 2 protein, a peptide fragment of IL-13R ⁇ 2, or a variant thereof as described above.
  • DC can be removed from a subject, contacted with the selected antigen, and then returned to the subject to stimulate an immune response.
  • the DC can also be treated with an activating substance such as a cytokines.
  • Those cell-based vaccines that are most effective in stimulating an immune response against IL-13R ⁇ 2 in a subject can be determined by preparing a series of different cell-based vaccine (e.g. those expressing whole antigen or specific peptide fragments of the antigen), administering a subject (or a series of genetically similar subjects) such different vaccines, and analyzing the subject(s) for the stimulation of an immune response. Those vaccines that induce the desired response can then be selected.
  • a series of different cell-based vaccine e.g. those expressing whole antigen or specific peptide fragments of the antigen
  • anti-idiotypic antibody vaccines to stimulate an immune response against IL-13R ⁇ 2 in a subject.
  • anti-idiotypic antibodies are prepared that feature an internal "image" of one or more immunogenic portions of IL-13R ⁇ 2. See, e.g., U.S. Patent Nos. 5,053,224; 5,208,146; 5,612,030; and 5,925,362.
  • Administration of these anti-idiotypic antibodies in a vaccine composition to a subject can stimulate an immune response against the "image" of an immunogenic portion of IL-13R ⁇ 2 which cross-reacts against actual immunogenic portions of IL-13R ⁇ 2.
  • polyclonal anti-idiotypic antibodies can be generated by immunizing a host animal with monoclonal antibodies raised against an epitope of IL-13R ⁇ 2. Methods ofpreparing monoclonal and polyclonal antibodies as described in more detail below.
  • the vaccines/antigenic agents featured in the invention can be used to raise antibodies useful in the invention.
  • Polyclonal antibodies are heterogeneous populations of antibody molecules that are contained in the sera of the immunized animals.
  • Antibodies within the invention therefore include polyclonal antibodies and, in addition, monoclonal antibodies, single chain antibodies, Fab fragments, F(ab') 2 fragments, and molecules produced using a Fab expression library.
  • Monoclonal antibodies, which are homogeneous populations of antibodies to a particular antigen can be prepared using the IL-13R ⁇ 2 proteins and peptides described above and standard hybridoma technology (see, for example, Kohler et al, Nature 256:495, 1975; Kohler et al, Eur. J. Immunol.
  • monoclonal antibodies can be obtained by any technique that provides for the production of antibody molecules by continuous cell lines in culture such as described in Kohler et al, Nature 256:495, 1975, and U.S. Pat. No. 4,376,110; the human B-cell hybridoma technique (Kosbor et al, Immunology Today 4:72, 1983; Cole et al, Proc. Natl. Acad. Sci.
  • Such antibodies can be of any immunoglobulin class including IgG, IgM, IgE, IgA, IgD and any subclass thereof.
  • a hybridoma producing a mAb of the invention may be cultivated in vitro or in vivo. The ability to produce high titers of mAbs in vivo makes this a particularly useful method of production. Human or humanoid. antibodies that specifically bind a IL-13R ⁇ 2 protein can also be produced using known methods.
  • polyclonal antibodies can also be collected from human subjects having such antibodies in their sera, e.g., subjects administered vaccines that stimulate antibody production against IL-13R ⁇ 2.
  • human antibodies against IL-13R ⁇ 2 protein can be made by adapting known techniques for producing human antibodies in animals such as mice. See, e.g., Fishwild, D. M. et al, Nature Biotechnology 14
  • polyclonal or monoclonal antibodies can be tested for specific IL- 13R ⁇ 2 recognition by Western blot or immunoprecipitation analysis by standard methods, for example, as described in Ausubel et al, supra.
  • Antibodies that specifically recognize and bind to IL-13R ⁇ 2 are useful in the invention.
  • such antibodies can be used in an immunoassay to monitor the level of IL-13R ⁇ 2 in a sample (e.g., to determine the amount of cellular expression or subcellular location of IL-13R ⁇ 2, or the presence and amount of soluble forms of IL-13R ⁇ 2 in a liquid sample).
  • IL-13R ⁇ 2 protein selective antibodies of the invention are produced using fragments of the IL-13R ⁇ 2 protein that lie outside highly conserved regions and appear likely to be antigenic by criteria such as high frequency of charged residues.
  • Cross-reactive anti-IL- 13R ⁇ 2 protein antibodies are produced using a fragment of a IL-13R ⁇ 2 protein that is conserved among members of this family of proteins.
  • fragments are generated by standard techniques of PCR, and are then cloned into the pGEX expression vector (Ausubel et al, supra). Fusion proteins are expressed in E. coli and purified using a glutathione agarose affinity matrix as described in Ausubel, et al, supra.
  • fusions can be generated for each protein, and each fusion can be injected into at least two rabbits.
  • Antisera can be raised by injections in a series, preferably including at least three booster injections.
  • Antiserum is also checked for its ability to immunoprecipitate recombinant IL-13R ⁇ 2 proteins or control proteins, such as glucocorticoid receptor, CAT, or luciferase.
  • Single chain antibodies can be adapted to produce single chain antibodies against a IL-13R ⁇ 2 protein, or a fragment thereof.
  • Single chain antibodies are formed by linking the heavy and light chain fragments of the Fv region via an amino acid bridge, resulting in a single chain polypeptide.
  • Antibody fragments that recognize and bind to specific epitopes can be generated by known techniques.
  • such fragments include but are not limited to F(ab') 2 fragments that can be produced by pepsin digestion of the antibody molecule, and Fab fragments that can be generated by reducing the disulfide bridges of F(ab') 2 fragments.
  • Fab expression libraries can be constructed (Huse et al, Science 246:1275, 1989) to allow rapid and easy identification of monoclonal Fab fragments with the desired specificity.
  • the invention provides methods for stimulating a immune response against IX- 13R ⁇ 2 in a subject having or at risk for developing a cancer having cells expressing IL- 13 R ⁇ 2. Such methods can be performed by (a) formulating as anti-cancer vaccine composition (as described above) outside of the subject and (b) administering the vaccine to the subject in an amount sufficient to stimulate an immune response against IL-13R ⁇ 2 in the subject. Subjects
  • compositions and methods of the invention can be utilized with any suitable subject, e.g., an animal such as a mammal (e.g., human beings, dogs, cats, goats, sheep, cows, horses, etc.).
  • a mammal e.g., human beings, dogs, cats, goats, sheep, cows, horses, etc.
  • a human patient suffering or at risk for developing a cancer or other disease that has cells that overexpress IL-13R ⁇ 2 e.g., a brain cancer such as HGG
  • a brain cancer such as HGG
  • IL-13R ⁇ 2 as a Component of a Polyvalent Vaccine
  • the invention also provides polyvalent vaccines that incorporate one or more of the foregoing compositions that can stimulate an immune response against IL-13R ⁇ 2 in a subject.
  • Two general types of polyvalent vaccines are within the invention.
  • a vaccine that contains more than one agent that can stimulate and immune response against IL-13R ⁇ 2 e.g., a composition that contains 2, 3, 4, 5, 6 , 7, 8, or more different peptides listed in Table 1 below.
  • a vaccine that contains both (a) an agent that can stimulate and immune response against IL-13R ⁇ 2 and (b) a different agent that can stimulate an immune response against a molecule other than IL- 13R ⁇ 2 e.g., another TSA or TAA.
  • the vaccine compositions of the present invention can be used in a method for stimulating an immune response against IL-13R ⁇ 2 in a subject.
  • an vaccine compositon of the invention can be administered to a subject by any method that stimulates the aforesaid immune response.
  • the exact method selected is determined by the particular vaccine composition to administered.
  • the injection can be in situ (i.e., to a particular tissue or location on a tissue, e.g., into a tumor or lymph node), intramuscular, intravenous, intraperitoneal, or by another parenteral route.
  • the vaccine may be administered by subcutaneous or intradermal injection. In some cases other routes can be used, e.g. intravenous injection, intraperitoneal injection, or in situ injection into target tissue.
  • Naked nucleic acid vaccines or expression vector vaccines may be administered by intramuscular injection.
  • Cell-based vaccines can be introduced into an animal by any suitable method, e.g., subcutaneous injection.
  • the vaccines of the invention can also be administered by a non-parenteral route, e.g, by oral, buccal, urethral, vaginal, or rectal administration.
  • Formulations for injection may be presented in unit dosage form, for example, in ampoules or in multi-dose containers, with an added preservative.
  • the compositions may take such forms as suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
  • the vaccine compositions may be in powder form (e.g., lyophilized) for constitution with a suitable vehicle, for example, sterile pyrogen-free water, before use.
  • the antigenic compositions can be mixed with a pharmaceutically acceptable carrier or excipient.
  • pharmaceutically acceptable carriers and excipients include diluents such as water, saline, citrate buffered saline, phosphate buffered saline, acetate buffered saline, and bicarbonate buffered saline; and stabilizing agents such as amino acids, alcohols, proteins (for example, serum albumin), EDTA, mannitol, sorbitol, and glycerol
  • carriers and excipients are preferably sterile and pyrogen-free.
  • USP grade carriers and excipients are particularly preferred for delivery of vaccine compositions to human subjects.
  • the vaccine compositions can also be formulated for long-term release as a depot preparation by adding the antigenic agent to suitable polymeric or hydrophobic materials or ion exchange resins. They can also be made by preparing the vaccine composition as a sparingly soluble derivative. Depot preparations can be administered to a subject by implantation (e.g., subcutaneous or intramuscular surgical implantation) or by injection. Methods for making the foregoing formulations are well known and can be found in, for example, Remington's Pharmaceutical Sciences.
  • the vaccine compositions of the invention are preferably administered to a subject in an amount sufficient to stimulate an immune response against IL-13R ⁇ 2 in the subject, and not cause an overly toxic effect.
  • a therapeutically effective amount can be determined as described below.
  • Toxicity and therapeutic efficacy of the vaccines utilized in the invention can be determined by standard pharmaceutical procedures, using either cells in culture or experimental animals to determine the LD 50 (the dose lethal to 50% of the population) and the
  • ED 50 the dose therapeutically effective in 50% of the population.
  • the dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD 50 /ED 50 .
  • Vaccines that exhibit large therapeutic indices are preferred. While those that exhibit toxic side effects may be used, care should be taken to design a delivery system that minimizes the potential damage of such side effects. Data obtained from animal studies can be used in formulating a range of dosage for use in humans.
  • the dosage of such vaccines lies preferably within a range that include an ED 50 with little or no toxicity.
  • the dosage may vary- within this range depending upon the dosage form employed and the route of administration utilized.
  • the vaccines of the invention can be administered to a subject using various different vaccination schedules.
  • a nucleic acid vaccine might be administered to a subject only once, while a protein/peptide- based vaccine might be administered to the subject on multiple occasions (1, 2, 3, 4, 5 or more times).
  • a first dose of a vaccine compositions of the invention may be administered to a subject at least 24 hours before a second (booster) dose is administered to the subject.
  • kits for stimulating an immune response against IX- 13R ⁇ 2 in a subject can include a container holding one or more of the antigenic agents described above in a pharmaceutically acceptable form.
  • the antigenic agent(s) in the container can be in liquid form (e.g., as a solution) or in solid form (e.g., as a lyophilized or desiccated powder).
  • the kits within the invention can further include a container holding a pharmaceutically acceptable solution (e.g., sterile saline with or without dextrose) for reconstituting the solid into a liquid suitable for injection.
  • the kits of the invention can further include (a) one or more devices to administer the antigenic agent, e.g., a needle or syringe, a packaged alcohol pad, etc.; and/or (b) printed instructions for using the kit.
  • Example 1- IL-13R ⁇ 2 Mimics the Biological Features of an HGG-associated receptor for IL-13
  • CHO cells Normal Chinese hamster ovary (CHO) cells were fransfected with a pcDNA 3.1 plasmid (Invitrogen) containing the full length open reading frame of IL-13R ⁇ 2 and positive clones were selected with geneticin. The expression of IL-13R ⁇ 2 in these clones was tested for their ability to bind I25 I-labeled IL-13. Selected clones were shown to bind labeled IL-13 independently of IL-4. In addition, labeled IL- 13 was displaced by IL- 13.E 13K, a mutant of
  • IL-13 shown to have a greater affinity for the IL-13 binding protein on HGG than for the shared IL-13/IL-4 receptor found in a plethora of tissues under a physiological state. Furthermore, these IL-13R ⁇ fransfected CHO cells were exposed to an IL-13.E13K- PE38QQR cytotoxin, a fusion protein showing potent dose dependent cyto toxicity on HGG cells. The clones expressing the receptor were killed in direct proportion to their affinity for
  • IL-13 but not CHO cells alone or CHO cells fransfected with an empty plasmid. In neutralization experiments, an excess of IL-13 prevented the cytotoxic effect of IL-13. El 3K- PE38QQR. Therefore the only way the toxin, PE38QQR, could have entered and killed the cells was through receptor-mediated endocytosis, a process directed through the IL-13 portion of the cytotoxin. Use of an IL13.E13K/enhanced green flourescent protein (EGFP) fusion protein confirmed that this process occurred. Thus, IL-13R ⁇ 2 was demonstrated to share properties ascribed to more restrictive, IL-4 independent, IL-13 binding sites found on HGGs in situ and in vitro.
  • EGFP green flourescent protein
  • RNA was extracted from the cells using the acid-guanidium isothiocyanate-phenol-chloroform method. Poly(A)+ RNA was further isolated using the Mini-oligo(dT) Cellulose Spin Column Kit (5 prime-3 prime Inc., Boulder, CO).
  • RNA-blotted membranes were also purchased from Clontech (Palo Alto, CA).
  • MTETM Multiple Tissue Expression
  • Two sets of Human Brain Multiple Tissue Northern (MTNTM) Blots (cat # 7755-1 and 7769-1) were assayed to confirm the true presence of the transcripts.
  • two Human Tissue Northern (MTNTM) Blots (cat # 7759-1 and 7760-1) were analyzed to verify the tissue distribution of the IL-13R ⁇ 2 transcript.
  • cDNA containing human IL13R ⁇ 2 was provided by Dr. Pascual Ferrara of Sanofibericht.
  • cDNA containing human IL13R ⁇ 1 (and also 93 bases of murine IL-13) was provided by Dr. Douglas J. Hilton of The Walter and Eliza Hall Institute of Medical Research. Plasmid pHuIL4R/ID was used to obtain a fragment of IL4R ⁇ by the restriction digest. The fragments were electrophoresed on a 1% agarose gel, excised from the gel and purified using QIAquick Gel Extraction Kit (Qiagen Inc., Valencia, CA). Actin cDNA was purchased from Clontech Labs.
  • the primers for human IL-13R ⁇ 2 were as follows: forward 5' - AAGATTTGGAAGCTTATGGCTTTCGTTTGC - 3' (SEQ ID NO:3) reverse 5' - TCCCTCGAAGCTTCATGTATCACAGAAAAA - 3' (SEQ ID NO:4)
  • the primers for human IL13R ⁇ l were as follows: forward 5 ' - ATTATTAAGCTTATGGAGTGGCCGGCG - 3 ' (SEQ ID NO:5) reverse 5' - TAACCGGAAGCTTCACTGAGAGGCTTT - 3' (SEQ ID NO:6)
  • Membranes were pre-hybridized overnight at 42° C in a solution consisting of 50% formamide, 5x SSC, 50 mM sodium phosphate, 5x Denhardt's, 50 ⁇ g/ml sheared salmon sperm DNA, and 1% SDS. Membranes were subsequently hybridized overnight at 42° C in the same solution with the addition of full length cDNA probes labeled by random priming (Life Technologies, Rockville, MD) with 32 P-dCTP using l-2x 10 6 cpm/ml.
  • the membranes were washed with 2x SSC/0.2% SDS at 42° C for 20 minutes followed by two washes with lx SSC/0.1% SDS at 42° C for 20 minutes each.
  • the membranes were exposed to autoradioraphic film X-OMAT AR (Eastman Kodak
  • IL13R ⁇ l a component of a heterodimeric form of 1X13 receptor that is shared with IL4, 1X13/4 receptor was examined in a variety of normal human tissues (Fig. 5) by either dot-blot analyses (not shown) or blots of electrophoretically separated transcripts (Fig. 5, panels I-IV).
  • Fig. 5 normal human tissues
  • dot-blot analyses not shown
  • Fig. 5 blots of electrophoretically separated transcripts
  • mRNA size fractionated mRNAs confirmed the many positive signals seen in dot blots with the strongest signals observed in ovary, heart, liver and lung (Fig. 5, panels III and IV, respectively).
  • liver showed two hybridized species of mRNA: one of 4.5 kb and the other of 2.0 kb, as an example of a normal organ with doublet of positive signals of different sizes.
  • discrete regions of normal human brain did produce clear-cut positive hybridization signals for IL13R ⁇ l (Fig. 5, panels I and II).
  • many vital peripheral organs exhibited hybridization bands corresponding to the mRNA of 4.5-4.65 kb (Fig. 5, panels III and IV).
  • IL4R ⁇ is another component of a heterodimeric form of IL13 receptor that is shared with IL4, i.e., the shared IL13/4 receptor.
  • IL4R ⁇ is another component of a heterodimeric form of IL13 receptor that is shared with IL4, i.e., the shared IL13/4 receptor.
  • All Northern blot analysis membranes used in this study demonstrated enriched content of the IL4R ⁇ transcripts in a variety of tissues (Fig. 6, panels I, II, and IV). The presence of the transcripts within the CNS was most evident, as it was for IL13R ⁇ l, in medulla, spinal cord, substantia nigra and thalamus (Fig. 6, panels I and II).
  • IL4R ⁇ IL4R ⁇
  • discrete regions of normal human brain contain transcripts for both IL13R l and IL4R ⁇ , a complete heterodimer of the shared 1X13/4 receptor.
  • several vital peripheral organs contained the two subunits of the IL13/4 receptor, including heart, liver, lung and intestinal tract.
  • Control hybridization of ⁇ -actin All membranes used for Northern blot analysis of IL13 receptors transcripts were also hybridized with a cDNA probe for a house-keeping gene, ⁇ -actin (Fig. 7; dot blots and panel III not shown). The intensity of the signals for ⁇ -actin was usually in accordance with the amount of mRNA present on the membranes, as estimated by the manufacturer.
  • IL13 receptors Gene expression of IL13 receptors in cells. Gene expression of the two IL13 receptors was also examined in malignant and normal cells (Fig. 8). Transcripts for IX- 13R ⁇ 2, IL13R l, IL4R ⁇ and ⁇ -actin were examined in serial hybridization assays. Isolated explant cells of HGG (G-48) as well as human malignant glioma established cell lines (A- 172 MG, U-373 MG, and U-251 MG) demonstrated intense signals for IL- 13R ⁇ 2 (Fig. 8). On the other hand, the transcripts for the elements of the shared 1X13/4 receptor, IL-13R ⁇ l and IL4R ⁇ , were found at lower levels when compared with that for IL-13R ⁇ 2 (Fig.
  • A- 172 MG cells appeared to be the most enriched in the components of the 1X13/4 receptor heterodimer.
  • two species of different sizes of the transcripts for both IL-13R ⁇ 2 and IL-13R ⁇ l were seen in cells (Fig. 8).
  • human umbilical vein endothelial cells (HUVEC) showed the presence of transcripts for IL-13R ⁇ l and IL4R ⁇ , but not those for IL-13R ⁇ 2 (Fig. 8).
  • gene expression of IL-13R ⁇ 2 was detected in two specimens of HGG (Fig. 8, HGG 13 and HGG 52), but not in two normal brain specimens (Fig. 8, NB 3 and NB 6). However, the transcripts for IL-13R ⁇ l were found in all of these specimens. In other experiments, several additional HGG brain tumor specimens were determined to express IL-13R ⁇ 2.
  • Table I presents a list of IL-13R ⁇ 2 peptides that might be used to stimulate an immune response against IL-13R ⁇ 2 in a subject.
  • the listed peptides were obtained using a computer program provided by the Ludwig Institute For Cancer Research (Lausanne,

Abstract

A method for stimulating an immune response against IL-13Rα2 in a subject having or at risk for developing a disease having cells expressing IL-13Rα2 includes the steps of formulating the anti-cancer vaccine outside of the subject and administering the vaccine to the subject in an amount sufficient to stimulate an immune response against IL-13Rα2 in a subject. A compostion for stimulating an immune response against IL-13Rα2 in a subject having or at risk for developing a disease having cells expressing IL-13Rα2 includes an isolated agent that can stimulate immune response against IL-13Rα2.

Description

IMMUNOTHERAPY USING INTERLEUKIN 13 RECEPTOR SUBUNIT ALPHA 2
CROSS REFERENCE TO RELATED APPLICATION The present application claims the benefit of U.S. provisional application serial number 60/181,000 filed February 8, 2000.
STATEMENTAS TO FEDERALLY SPONSORED RESEARCH
This invention was made with Government support under grant number CA74154 awarded by the National Cancer Institute of the National Institutes of Health. The Government may have certain rights in the invention.
FIELD OF THE INVENTION The invention relates generally to the fields of biology, immunology, medicine, and oncology. More particularly, the invention relates to the use of the interleukin 13 (IL-13) receptor subunit alpha 2 (IL-13Rα2) as an immune system modulator and target for vaccines for the treatment and prevention of cancer.
BACKGROUND Cancer is presently the second leading cause of death in developed nations. Wingo et al, J. Reg. Management, 25:43-51 (1998). Despite recent research that has revealed many of the molecular mechanisms of tumorigenesis, few new treatments have achieved widespread clinical success in treating solid tumors. The mainstay treatments for most malignancies thus remain gross resection, chemotherapy, and radiotherapy. While increasingly successful, each of these treatments still causes numerous undesired side effects. The primary cause of this is that none of these conventional methods specifically targets only diseased cells. For example, surgery results in pain, traumatic injury to healthy tissue, and scarring. Radiotherapy and chemotherapy cause nausea, immune suppression, gastric ulceration and secondary tumorigenesis. In an effort to develop techniques to more specifically target diseased cells, progress in tumor immunology has led to the discovery of antigens that are preferentially or specifically expressed on cancer cells. These tumor-associated antigens (TAA) or tumor- specific antigens (TSA) have been used as antigenic agents in cancer vaccines designed to stimulate an immune response selectively directed against cancer cells expressing such antigens. See, Tumor Immunology: Immunotherapy and Cancer Vaccines. A. G. Dalgleish and M. J. Browning, eds., Cambridge University Press, 1996; Immunotherapy in Cancer. M. Gore and P. Riches, eds., John Wiley & Son Ltd., 1996; Maeurer et al., Melanoma Res., 6:11-24 (1996). Among the most widely studied of these antigens are melanoma associated antigens, prostate specific antigen (PSA), E6 and E7, carcinoembryonic antigen (CEA), p53, and gangliosides (e.g., GM2). More recent studies have shown that certain TAAs and TSAs are particularly effective at stimulating specific immune responses.
For example, pioneering research with melanoma associated antigens led to the identification of MAGE- 1 (Melanoma Antigen 1) as a T-cell activating TSA. Traversari et al., Immunogenetics, 35: 145-152, 1992. Subsequently other groups using similar techniques identified other T-cell activating melanoma antigens including other MAGEs, MART-1, glycoprotein 100 (g lOO), tyrosinase, BAGE, and GAGE. Reviewed by Maeurer et al., supra. One of the most exciting recent findings in cancer immunology came after the SEREX (for serological analysis of recombinant cDNA expression libraries) technique was developed.
Sahin et al., Proc. Natl. Acad. Sci. USA, 92: 11810-11813, 1995. The SEREX technique involves screening a cDNA expression library of an autologous tumor by exposing the library to antibodies contained in a patient's sera. Several active cancer antigens have been identified using this technique. See, Old, L. J. and T. C. Chen, J. Exp. Med., 187: 1163-1167, 1998. Moreover, SEREX analysis showed that patients produce a high titer of IgG antibodies against cancer antigens- a finding that indicated that helper T cells (e.g., CD4+ T cells) and B cells cooperate in stimulating an immune response against the cancer.
In addition, SEREX analyses led to the identification of a group of cancer antigens termed "cancer/testis" antigens (CTAs). CTAs share several common features including (a) among normal organs, almost exclusive expression in the testis, (b) expression in a wide variety of tumors, (c) presence of multiple members in each identified family, and (d) localization of their genes to the X chromosome (with the notable exception of SCP 1). Chen et al, J. Biol. Chem., 273: 17618-17625, 1998. Based on the foregoing criteria, several previously identified TAAs or TSAs (e.g., MAGE, BAGE and GAGE) were re-discovered as CTAs. Notably, unlike many non-CTA antigens, most of these previously identified CTAs as well as newly identified CTAs (e.g., SSX2, NY-ESO-1, SCP1 and CT7) have unequivocally been shown to stimulate an immune response in a subject. SUMMARY The invention relates to the discovery that IL-13Rα2 is a cancer/testis antigen. This discovery is important because, in contrast to most other cancer-associated agents, most of the cancer/testis antigens so far tested as active immunotherapy agents against cancer have proven very effective in stimulating anti-cancer immune responses in subjects. Thus, the present discovery provides methods and compositions for preventing and/or treating cancers that express IL-13Rα2.
In particular, the invention relates to the treatment and/or prevention of high-grade gliomas (HGG) in a subject as HGG cells have been shown to express high levels of IX- 13Rα2 on their surfaces. Human HGG are rapidly progressing heterogeneous brain tumors of astroglial origin. The present invention is especially important because no effective modalities for treating HGG are yet accepted for clinical use. Previously, it was shown that the vast majority of HGG patients over-express a more restrictive receptor for IL-13, that is a receptor that binds IL-13 in an IL-4 independent manner. Recently, a new IL-13 binding protein, termed IL-13R 2, was cloned. This protein was shown to have affinity for IL-13 but not IL-4. In a rough comparison, this characteristic relates to the more restrictive receptor for IL-13 expressed on HGG. Here we demonstrate that, IL-13Roc2 serves as a selective target for HGG and other cancers that express IL-13R 2 because, as described in more detail below, with the exception of testis, normal human tissue expresses little or no IL-13Rα2. And although many normal tissues express a receptor that binds IL-13, this receptor
(sometimes termed the "shared" receptor because it binds both IL-13 and IL-4) differs functionally from IL-13Rα2 (believed to be the "restrictive" receptor) in that the shared receptor binds both IL-13 and IL-4, while the restrictive receptor binds only IL-13. The two receptors also differ structurally, with the restrictive receptor being a 42 kDa monomer and the shared receptor being a heterodimer composed of a 45 kDa component (termed IL-
13Rc ) and a 140 kDa component (termed IL-4Rα).
As indicated above, our tissue distributions studies showed that, among normal tissues, IL-13Rα2 is strongly expressed only in testis. This finding along with the showing that (a) IL-13Rα2 is preferentially over-expressed on HGG but not normal central nervous system (CNS) tissue and (b) that the IL-13Rα2 gene is localized to chromosome X, indicates that IL-13Rα2 is a CTA. Because other CTAs have proven to stimulate a strong immune response against cancer cells, the present invention provides methods and compositions useful for generating or increasing an anti-cancer immune response in a subject.
Accordingly, in one aspect the invention features a method for stimulating a immune response against IL-13Rα2 in a subject having or at risk for developing a disease having cells expressing IL-13Rα2. The method includes the steps of: (a) formulating an anti-cancer vaccine outside of the subject, the vaccine including an agent that can stimulate an immune response against IL-13Rα2 when administered to an animal; and (b) administering the vaccine to the subject in an amount sufficient to stimulate an immune response against IL- 13Rα2 in the subject. In another aspect the invention features a composition for stimulating an immune response against IL-13Rα2 when administered to an animal. The composition includes: (a) an isolated agent that can stimulate an immune response against IL-13Rα2 when administered to an animal; and (b) a pharmaceutically acceptable carrier.
In both of the foregoing method and composition, the agent that can stimulate an immune response against IL-13R 2 can include a peptide including at least seven contiguous amino acids of SEQ ID NO: 1. For example, the agent can be a protein including the amino acid sequence of SEQ ID NO: 1. The agent can also take the form of a nucleic acid that encodes a peptide including at least seven contiguous amino acids of SEQ ID NO: 1. Such a nucleic acid can be used as a naked DNA or in an expression vector construct including the nucleic acid. The agent that can stimulate an immune response against IL-13Rα2 can also be a cell. This cell can be one that expresses a peptide including at least seven contiguous amino acids of SEQ ID NO: 1 , or one into which a purified nucleic acid that encodes a peptide including at least seven contiguous amino acids of SEQ ID NO:l has been introduced.
The vaccines and compositions within the invention can further include an adjuvant such as an aluminum salt; an oil-in- water emulsion; a composition including saponin; a composition including a bacterial protein; or a cytokine.
The method of the invention can further include a step of providing a subject (e.g., a human being) having or at risk for developing a cancer having cells expressing IL-13Rα2 (e.g., glioma cells). Also in the method, the step of administering the vaccine to the subject in an amount sufficient to stimulate an immune response against IL-13Rα2 in the subject can include administering the vaccine in at least a first dose and a second dose, wherein the first dose is administered to the subject at least 24 hours before the second dose is administered to the subject.
Unless otherwise defined, all technical terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Definitions of molecular biology terms can be found, for example, in Rieger et al., Glossary of Genetics: Classical and Molecular, 5th edition, Springer-Nerlag: New York, 1991; and Lewin, Genes V, Oxford University Press: New York, 1994. Standard one-letter nomenclature for nucleotide bases, and one- and three-letter nomenclature for amino acid residues are used. As used herein, a "nucleic acid" means a chain of two or more nucleotides. For example, RNA (ribonucleic acid) and DNA (deoxyribonucleic acid) are nucleic acids. An "isolated" nucleic acid is one that has been substantially separated or purified away from other nucleic acid sequences in the cell of the organism in which the nucleic acid naturally occurs, i.e., other chromosomal and extrachromosomal DNA and RNA, e.g., by conventional nucleic acid purification methods. The term therefore includes a recombinant nucleic acid molecule incorporated into a vector, into an autonomously replicating plasmid or virus, or into the genomic DNA of a prokaryote or eukaryote. It includes a separate molecule such as a cDNA, a genomic fragment, a fragment produced by polymerase chain reaction (PCR), or a restriction fragment. It also includes recombinant nucleic acid molecules and chemically synthesized nucleic acid molecules. A "recombinant" nucleic acid molecule is one made by an artificial combination of two otherwise separated segments of sequence, e.g., by chemical synthesis or by the manipulation of isolated segments of nucleic acids by genetic engineering techniques.
When referring to a nucleic acid molecule or polypeptide, the term "native" refers to a naturally-occurring (e.g., a "wild-type") nucleic acid or polypeptide. A "homolog" of an IL- 13Rα2 gene is a gene sequence encoding an IL-13Rα2 polypeptide isolated from a species other than Homo sapiens. By the phrase "naked nucleic acid" is meant an isolated nucleic acid not incorporated in an expression vector.
By the terms "iL-13Rα2 gene" or "IL-13R 2 polynucleotide" is meant a native IL- 13Rα2 encoding nucleic acid sequence (e.g., the IL-13Rα2 cDNA sequence shown as SEQ
ID NO: 2 (Fig. 2)), genomic sequences from which IL-13R 2 cDNA can be transcribed, and/or allelic variants and homologs of the foregoing. As used herein, "protein," "peptide," or "polypeptide" means any peptide-linked chain of amino acids, regardless of length or post-translational modification, e.g., glycosylation or phosphorylation. Generally, the term "peptide" is used herein to refer to amino acid chains less than about 25 amino acid residues in length, while the terms "protein" and "polypeptide" are used to refer to larger amino acid chains. When referring to a protein or peptide, the term
"isolated" means proteins or peptides that are isolated from other cellular proteins or are made synthetically. The term thus encompasses both purified and recombinant polypeptides. The term "recombinant protein" or "recombinant peptide" refers to a protein or peptide that is produced by recombinant nucleic acid techniques, wherein generally, a nucleic acid encoding the peptide or protein is inserted into a suitable expression vector which is in turn used to transform a host cell such that, when cultured under appropriate conditions, the cell produces the peptide or protein.
By "LL-13Rα2 protein" "IL-13Rα2 polypeptide," or simply "LL-13Rα2" is meant an expression product of an IL-13Rα2 gene such as the protein of SEQ ID NO: 1 (Fig. 1); or a protein that shares at least 65% (but preferably 75, 80, 85, 90 , 95, 96, 97 ,98, or 99%) amino acid sequence identity with SEQ ID NO:l and cross-reacts with antibodies that specifically bind the protein of SEQ ID NO: 1.
As used herein, "sequence identity" means the percentage of identical subunits at corresponding positions in two sequences when the two sequences are aligned to maximize subunit matching, i.e., taking into account gaps and insertions. When a subunit position in both of the two sequences is occupied by the same monomeric subunit, e.g., if a given position is occupied by an adenine in each of two DNA molecules, then the molecules are identical at that position. For example, if 7 positions in a sequence 10 nucleotides in length are identical to the corresponding positions in a second 10-nucleotide sequence, then the two sequences have 70% sequence identity. Preferably, the length of the compared sequences is at least 60 nucleotides, more preferably at least 75 nucleotides, and most preferably 100 nucleotides. Sequence identity is typically measured using sequence analysis software (e.g., Sequence Analysis Software Package of the Genetics Computer Group, University of Wisconsin Biotechnology Center, 1710 University Avenue, Madison, WI 53705). A first nucleic-acid sequence is "operably" linked with a second nucleic-acid sequence when the first nucleic-acid sequence is placed in a functional relationship with the second nucleic-acid sequence. For instance, a promoter is operably linked to a coding sequence if the promoter affects the transcription or expression of the coding sequence. Generally, operably > linked DNA sequences are contiguous and, where necessary to join two protein coding regions, in reading frame.
As used herein, the term "vector" refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked. A vector capable of directing the expression of a gene to which it is operatively linked is referred to herein as an "expression vector." As used herein, the term "promoter" means a nucleic acid sequence that regulates expression of a selected nucleic acid sequence operably linked to the promoter, and which effects expression of the selected nucleic acid sequence in cells. The term encompasses "tissue specific" promoters, i.e. promoters, which effect expression of the selected nucleic acid sequence only in specific cells (e.g. cells of a specific tissue). The term also covers so-called "leaky" promoters, which regulate expression of a selected nucleic acid primarily in one tissue, but cause expression in other tissues as well. The term also encompasses both non-tissue specific promoters and promoters that are constitutively active and inducible.
By the phrase "stimulating an immune response" is meant eliciting or increasing the activation of a lymphocyte (e.g., a B cell or T cell) or other immune system component. The stimulation of an immune response against a specific antigen can be measured as an increase in antibody titer against that antigen or the activation of one or more lymphocytes having a surface receptor specific for the antigen. Activation of lymphocytes can be determined by conventional assays, e.g., the induction of mitosis, secretion of cytokines, modulation of cell surface molecule expression, secretion of immunoglobulin (B cells), and increased killing of target cells (cytotoxic T cells).
As used herein, "bind," "binds," or "interacts with" means that one molecule recognizes and adheres to a particular second molecule in a sample, but does not substantially recognize or adhere to other structurally unrelated molecules in the sample. Generally, a first molecule that "specifically binds" a second molecule has a binding affinity greater than about 105 to 106 liters/mole for that second molecule.
By the term "antibody" is meant any antigen-binding peptide derived from an immunoglobulin. The term includes polyclonal antisera, monoclonal antibodies, fragments of immunoglobulins produced by enzymatic digestion (e.g., Fab fragments) or genetic engineering (e.g., sFv fragments). Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In the case of conflict, the present specification, including definitions will control. In addition, the particular embodiments discussed below are illustrative only and not intended to be limiting.
BRIEF DESCRIPTION OF THE DRAWINGS The invention is pointed out with particularity in the appended claims. The above and further advantages of this invention may be better understood by referring to the following description taken in conjunction with the accompanying drawings, in which:
Fig. 1 is the amino acid sequence of the native H. sapiens IL-13Rα2 protein. Fig. 2 is the nucleic acid sequence of a cDNA corresponding to a native mRNA encoding the native H. sapiens IL-13R 2 protein.
Fig. 3 is a schematic representation of two types of IL13 receptors: the shared with IL4 physiological, heterodimeric IL13/4R, and an IL4-independent monomeric, HGG- associated IL13R. A, 140-kDa IL4R α-chain. B, 45-kDa IL13R c -chain; A and B constitute the elements of the heterodimeric high affinity IL13/4R. C, a 42-kDa monomer of IL13Rα2.
Fig. 4 is a Northern blot analysis of human IL13Rα2 transcripts (closed figure) in series of CNS (panels I and II) and peripheral tissues (panels III and IN). The migration position of mRΝA is shown in kilobases. Films were exposed for 2 weeks.
Fig. 5 is a Northern blot analysis of human LL13Rα2 transcripts (closed figure) in series of CNS (panels I and II) and peripheral tissues (panels III and IV). The migration position of mRNA is shown in kilobases. Films were exposed for 2 weeks except for membranes shown in panels III and IN, which were exposed for 3 days. Fig. 6 is a Northern blot analysis of human 140-kDa IL4R α-chain transcripts (closed figure) in series of CNS (panels I and II) and peripheral tissues (panel IN). The migration position of mRΝA is shown in kilobases. Films were exposed for 2 weeks.
Fig. 7 is a Northern blot analysis of human β-actin transcripts in CNS (panels I and II) and peripheral tissues (panel IN). The migration position of mRΝA is shown in kilobases. Films were exposed for 1-3 hours. Fig. 8 is a Northern blot analysis of transcripts of different IL13 receptors in malignant glioma cells (G-48, A- 172 MG, U-373 MG, and U-251 MG), normal human umbilical vein endothelial cells (HUVEC) and in surgical specimens of GBM and normal human brain. The migration position of mRNA is shown in kilobases. Films were exposed for 2 weeks, except for actin (1 hr).
DETAILED DESCRIPTION The invention encompasses compositions and methods relating to stimulating an immune response against IL-13Rα2 in a subject having or being at risk for developing a cancer or other disease having cells expressing IL-13R 2. The below described preferred embodiments illustrate adaptations of these compositions and methods. Nonetheless, from the description of these embodiments, other aspects of the invention can be made and/or practiced based on the description provided below.
Biological Methods
Methods involving conventional molecular biology techniques are described herein. Such techniques are generally known in the art and are described in detail in methodology treatises such as Molecular Cloning: A Laboratory Manual, 2nd ed., vol. 1-3, ed. Sambrook et al., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989; and Current Protocols in Molecular Biology, ed. Ausubel et al., Greene Publishing and Wiley-Interscience, New York, 1992 (with periodic updates). Methods for chemical synthesis of nucleic acids are discussed, for example, in Beaucage and Carruthers, Terra. Letts. 22:1859-1862, 1981, and Matteucci et al., J. Am. Chem. Soc. 103:3185, 1981. Chemical synthesis of nucleic acids can be performed, for example, on commercial automated oligonucleotide synthesizers. Immunological methods (e.g., preparation of antigen-specific antibodies, immunoprecipitation, and immunoblotting) are described, e.g., in Current Protocols in Immunology, ed. Coligan et al., John Wiley & Sons, New York, 1991; and Methods of Immunological Analysis, ed. Masseyeff et al., John Wiley & Sons, New York, 1992. Conventional methods of gene transfer and gene therapy can also be adapted for use in the present invention. See, e.g., Gene Therapy: Principles and Applications, ed. T. Blackenstein, Springer Nerlag, 1999; Gene Therapy Protocols (Methods in Molecular Medicine), ed. P.D. Robbins, Humana Press, 1997; and Retro-vectors for Human Gene Therapy, ed. CP. Hodgson, Springer Nerlag, 1996.
Identification of IL-13Rα2 as a Cancer/Testis Antigen
As its name implies, IL-13Rα2 is a receptor for the lymphokine IL-13. IL-13 has been identified as a homologue of IL-4 that is secreted by both B and T cells. Minty et al.,
Nature, 36: 248-251, 1993; McKenzie et al., Proc. Natl. Acad. Sci. USA, 90: 3735-3739, 1993. Several types of normal cells contain an IL-13 receptor termed the shared IL-13/IL-4 receptor, which is a heterodimer that includes an IL-13 binding subcomponent named IL- 13Rαl (Interleukin 13 receptor alpha one). Hilton et al., Proc. Natl. Acad. Sci. USA, 93: 497-501, 1996; Aman et al., J. Biol. Chem., 271: 29265-29270, 1996; Miloux et al., FEBS Letters, 40: 163-166, 1997. In addition to IL-13Rαl, the shared receptor also includes a protein referred to as pi 40 (or IL-4Rα), the subcomponent responsible for IL-4 binding. Idzerda et al., J. Exp. Med., 171: 861-873, 1990; Hilton et al., Proc. Natl. Acad. Sci. USA, 93: 497-501, 1996; Debinski et al, Nature Biotech., 16: 449-453, 1995; Zurawski et al, EMBO J., 12: 2663-2670, 1993; Minty et al., Nature, 36: 248-251, 1993. Exposing cells to
IL-13 results in responses very similar to those responses that occur after exposure to IL-4. Zurawski, G., and J.E. de Vries, Stem Cells. 12: 169-174, 1994. Examples of cellular responses resulting from both IL-13 and IL-4 exposure include enhanced expression of CD72, IgM, and MHC class II antigen, as well as induced CD23 expression and IgE heavy-chain gene production in B lymphocytes. Id.
In an interesting development, it was found that IL-13Rαl was not the only IL-13 binding site that existed on cells. In previous studies, it was demonstrated that many cancers, most notably HGG, are capable of binding IL-13. Debinski et al., Clin. Cancer Res., 1 : 1253- 1258, 1995; Debinski et al., J. Biol. Chem., 271: 22428-22433, 1996; Debinski et al., Nature Biotech., 16: 449-453, 1998; Debinski et al., Critic Rev. Oncogen., 9: 256-268, 1998;
Debinski et al., Clin. Cancer Res., 5: 985-990, 1999. Through these studies, it became increasingly clear that the IL-13 binding capacity of many of these tumors was not mediated through the shared IL-13/IL-4 receptor (i.e., the receptor now known to be a heterodimer composed of IL-13Rαl/pl40). Notably, in lymphoid cells that contain the shared receptor, saturating the receptors with IL-4 blocked IL-13 binding. Zurawski et al., EMBO J., 12:
2663-2670, 1993. This was not the case using HGG cells, where IL-13 binding was unaltered even where a large excess of IL-4 used in neutralization assays. Debinski et al., Clin. Research Res., 1: 1253-1258, 1995; Debinski et al., J. Biol. Chem., 271: 22428-22433, 1996; Debinski et al., Nature Biotech., 16: 449-453, 1998. In further experiments, rationally designed IL-13 mutants were generated that maintained their ability to bind glioblastoma (HGG) cells but lost their ability to interact and cause signaling in cells expressing only the
IL-4/IL-13 shared receptor. Debinski et al., Nature Biotech., 16: 449-453, 1998; Thompson, J. P. and W. Debinski, J. Biol. Chem., 274: 29944-29950, 1999; Debinski, W., and J. P. Thompson, Clin. Cancer Res., 5: 3143s-3147s, 1999. This evidence supported the existence of an additional IL-13 binding protein, unrelated to known IL-4 binding proteins. Additional evidence was derived when a novel IL-13 binding protein on cells of renal cell carcinoma metastases (Caki-1 cells) was isolated and the gene encoding the protein cloned. Caput et al., J. Biol. Chem., 271:16921, 1996. The gene encoding this protein, termed IL-13Rα2, was subsequently cloned and sequenced. Id. This novel IL-13 binding protein, referred to herein as IL-13Rα2, was shown not to specifically bind IL-4. The proposed structures of the shared IL- 13/4 receptor and the IL-4-independent receptor for IL- 13 are shown in Fig. 3.
To investigate whether this newly discovered receptor is present in HGG, we evaluated its gene expression in HGG established cell lines, and HGG explant cells and tumor specimens. In addition to these studies on HGG, we screened a plethora of normal central nervous system (CNS) tissues and peripheral organs for the mRNA transcripts of IL- 13Rα2 in order to characterize the normal tissue expression pattern of this new receptor in detail. From these studies, we discovered that IL-13Rα2 expression is virtually absent in all normal adult tissue except testis. In earlier studies, the gene encoding IL-13Rα2 was localized to the X chromosome. Guo et al., Genomics, 42: 141-145, 1997.
Accordingly, our discovery allowed us to characterize the IL-13Rα2 protein as a member of the CTA group of tumor antigens. Moreover, because IL-13Rα2 is a transmembrane receptor, it is exposed to the extracellular environment independently of MHC presentation. Thus, in contrast to intracellular antigens that must be displayed as a peptide fragment in complex with an MHC molecule on the cell surface to be recognized by immune system components, cytotoxic agents or antibodies can be directly targeted to cancer cells bearing IL-13Rα2 on their surface. This discovery that IL-13Rα2 is a CTA associated with HGG is significant because no other HGG-associated antigens of this prevalence are known that could serve as a basis for a rational design of anti-glioma vaccines. Vaccines
The invention provides vaccines that can stimulate an immune response against IL- 13Rα2 in a subject when administered to the subject. Vaccines within the invention include an antigenic agent which can take the form of any substance that can evoke or increase an immune response against IL-13Rα2 when introduced into a subject. Typical immune responses include (a) the production of, or increase in titer of, antibodies that specifically bind IL-13Rα2 and (b) the activation of T lymphocytes (e.g., to kill a target cell or provide help in the activation of antibody production in B lymphocytes). A number of different antigenic agents have been shown to be effective in stimulating an immune response against a protein antigen, including, for example, protein- and peptide-based vaccines, tumor-cell vaccines, dendritic cell/gene therapy vaccines and DNA/viral vaccines. See, e.g., Greten, T.F. and E.M. Jaffee, J. Clin. Oncol., 17: 1047-1060, 1999. In addition to the foregoing, various substances such as adjuvants and excipients/carriers can be included in the vaccine compositions of the invention to non-specifically enhance the antigen-specific immune response stimulated by the antigenic agent and to facilitate delivery of the other components of the vaccine to a subject.
Protein/Peptide Based Vaccines
The antigenic agent for use in the vaccines of the invention can take the form of the native IL-13Rα2 (SEQ ID NO:l) or a peptide fragment of IL-13Rα2. Vaccines made with the whole protein antigen are advantageous because they have the capability of stimulating an immune response against all of the potential antigenic sites expressed by the protein. Vaccines made with peptide antigens (e.g., 7-15 or 8-12 contiguous amino acids of the whole protein), on the other hand, will generally stimulate an immune response against fewer than all of the potential antigenic sites expressed by the protein. Peptide-based vaccines are sometimes advantageous over whole protein-based vaccines where it is desired to more specifically target the stimulated immune response, e.g., to avoid undesired cross reactions. For example, peptides for use in the vaccine can be selected to correspond to (1) specific epitopes of the antigens that are known to be presented by MHC class I or MHC class II molecules, or (2) a modified form of an epitope that either exhibits an increased stability in vivo or a higher binding affinity for an MHC molecule than the native epitope, while still being capable of specific activation of T-cells. See, Ayyoub et al., J. Biol. Chem., 274: 10227-10234, 1999; Parkhurst et al., Immunol., 157: 2539-2548, 1996. Peptide-based vaccines have been shown to circumvent immune tolerance to the intact proteins. Disis et al., J. Immunol, 156: 3151-3158, 1996. In addition to vaccines composed of only one type of peptide fragment, other vaccines within the invention also include those made up of a cocktail of several different peptides derived from IL- 13Rα2.
As indicated above, vaccines with in the invention can include an IL-13Rα2 protein as an antigenic agent. Preferred forms of IL-13Rα2 protein include a purified native IL-13Rα2 protein that has the amino acid sequence shown in Fig. 1 (SEQ ID NO:l). Variants of the native IL-13Rα2 protein such as fragments, analogs and derivatives of native IL-13Rα2 are also contemplated for use as an antigenic agent in the vaccines of the invention. Such variants include, e.g., a polypeptide encoded by a naturally occurring allelic variant of the native IL-13Rα2 gene, a polypeptide encoded by a homolog of the native IL-13Rα2 gene, and a polypeptide encoded by a non-naturally occurring variant of the native IL-13Rα2 gene. Preferred versions of such variants are those that are able to stimulate an immune response to native IL- 13Rα2 upon administration to a subject as part of a vaccine.
IL-13Rα2 protein variants have a peptide sequence that differs from the native IX- 13Rα2 protein in one or more amino acids. The peptide sequence of such variants can feature a deletion, addition, or substitution of one or more amino acids of the native IL-13Rα2 polypeptide. Amino acid insertions are preferably of about 1 to 4 contiguous amino acids, and deletions are preferably of about 1 to 10 contiguous amino acids. In some applications, variant IL-13Rα2 proteins substantially maintain a native IL-13Rα2 protein functional activity (e.g., the ability to specifically bind IL-13). For other applications, variant IL-13Rα2 proteins lack or feature a significant reduction in an IL-13Rα2 protein functional activity. Where it is desired to retain a functional activity of native IL-13Rα2 protein, preferred IL- 13Rα2 protein variants can be made by expressing nucleic acid molecules within the invention that feature silent or conservative changes. Variant IL-13Rα2 proteins with substantial changes in functional activity can be made by expressing nucleic acid molecules within the invention that feature less than conservative changes.
IL-13Rα2 protein fragments corresponding to one or more particular motifs (e.g., those likely to bind with high affinity to MHC molecules) and/or domains are within the invention as are those of arbitrary sizes. For example, peptide fragments of IL-13Rα2 protein consisting of at least 5, 10, 25, 30, 40, 50, 50, 70, 75, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 300 or more contiguous amino acids of the IL-13Rα2 protein are within the scope of the present invention. Fragments of between 7 and 15 amino acids (preferably 8-12 amino acids) in length (e.g., those sized to fit in the grooves of MHC molecules) are preferred as peptides of such size have been shown to serve as efficient immunogenic agents. Methods for identifying efficiently immunogenic peptides of a whole protein are known in the art, e.g., using amphipathicity algorithms. See, e.g., Berzofsky, J. A., Ann. N. Y. Acad. Sci., 12:256, 1993; U.S. Patent Nos. 5,976,541 and 5,980,899. Peptides that are most immunogenic in a subject can also be determined by preparing a series of overlapping peptide fragments (e.g., 7-30 amino contiguous amino acids long) of the whole antigen, administering the subject (or a series of genetically similar such subjects) such fragments in a vaccine composition, and analyzing the subject(s) for the stimulation of an immune response. Those peptide fragments that induce the desired response can then be selected.
Isolated peptidyl portions of IL-13Rα2 proteins can be obtained by screening peptides recombinantly produced from the corresponding fragment of the nucleic acid encoding such peptides. In addition, fragments can be chemically synthesized using techniques known in the art such as conventional Merrifield solid phase f-Moc or t-Boc chemistry. For example, similar to the technique described above, an IL-13Rα2 protein of the present invention may be arbitrarily divided into fragments of desired length with no overlap of the fragments, or preferably divided into overlapping fragments of a desired length. The fragments can be produced (recombinantly or by chemical synthesis) and tested to identify those peptidyl fragments which can function antigenic agents that stimulate an immune response against an IL-13Rα2 protein.
Another aspect of the present invention concerns recombinant forms of the IL-13Rα2 proteins. Recombinant polypeptides preferred for use in the present invention, in addition to native IL-13Rα2 protein, are encoded by a nucleic acid that has at least 85% sequence identity (e.g., 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100%) with the nucleic acid sequence of SEQ ID NO:2. In a preferred embodiment, variant IL-13Rα2 have the ability to stimulate an immune response against the native IL-13Rα2 protein. IL-13Rα2 protein variants can be generated through various techniques known in the art. For example, IL-13Rα2 protein variants can be made by mutagenesis, such as by introducing discrete point mutation(s), or by truncation. Mutation can give rise to an IX- 13Rα2 protein variant having more, substantially the same, or merely a subset of the antigenic activity of the native IL- 13Rα2 protein. Other variants of IL- 13Rα2 that can be generated include those that are resistant or more susceptible to proteolytic cleavage, as for example, due to mutations which alter protease target sequences. Whether a change in the amino acid sequence of a peptide results in a IL-13Rα2 protein variant having greater or lesser antigenic activity than native IL-13Rα2 protein can be readily determined by comparing the variant with the native IL-13Rα2 protein for the ability to stimulate an immune response against IL-13Rα2 in subjects vaccinated with the respective proteins.
As another example, IL-13Rα2 protein variants can be generated from a degenerate oligonucleotide sequence. Chemical synthesis of a degenerate gene sequence can be carried out in an automatic DNA synthesizer, and the synthetic genes then ligated into an appropriate expression vector. The purpose of a degenerate set of genes is to provide, in one mixture, all of the sequences encoding the desired set of potential IL-13Rα2 protein sequences. The synthesis of degenerate oligonucleotides is well known in the art (see for example, Narang, SA (1983) Tetrahedron 39:3; Itakura et al. (1981) Recombinant DNA, Proc. 3rd Cleveland
Sympos. Macromolecules, ed. AG Walton, Amsterdam: Elsevier pp 273-289; Itakura et al. (1984) Annu. Rev. Biochem. 53:323; Itakura et al. (1984) Science 198:1056; Ike et al. (1983) Nucleic Acid Res. 11 :477. Such techniques have been employed in the directed evolution of other proteins (see, for example, Scott et al. (1990) Science 249:386-390; Roberts et al. (1992) Proc. Natl. Acad. Sci. USA 89:2429-2433; Devlin et al. (1990)
Science 249: 404-406; Cwirla et al. (1990) Proc. Natl. Acad. Sci. USA 87: 6378-6382; as well as U.S. Pat. Nos. 5,223,409; 5,198,346; and 5,096,815).
Similarly, a library of coding sequence fragments can be provided for an IL-13Rα2 gene clone in order to generate a variegated population of IL-13Rα2 protein fragments for screening and subsequent selection of fragments having the ability to stimulate an immune response against IL-13Rα2 in a subject. A variety of techniques are known in the art for generating such libraries, including chemical synthesis. In one embodiment, a library of coding sequence fragments can be generated by (i) treating a double-stranded PCR fragment of an IL-13Rα2 gene coding sequence with a nuclease under conditions wherein nicking occurs only about once per molecule; (ii) denaturing the double-stranded DNA; (iii) renaturing the DNA to form double-stranded DNA which can include sense/antisense pairs from different nicked products; (iv) removing single-stranded portions from reformed duplexes by treatment with SI nuclease; and (v) ligating the resulting fragment library into an expression vector. By this exemplary method, an expression library can be derived which codes for N-terminal, C-terminal and internal fragments of various sizes.
The invention also provides for reduction of IL-13Rα2 proteins to generate mimetics, e.g. peptide or non-peptide agents, that are able to stimulate an immune response against IL-
13Rα2 in a subject. For instance, non-hydrolyzable peptide analogs of the amino acid residues of IL-13 Rα2 proteins and peptides thereof can be generated using benzodiazepine (e.g., see Freidinger et al. in Peptides: Chemistry and Biology, G. R. Marshall ed., ESCOM Publisher: Leiden, Netherlands, 1988), azepine (e.g., see Huffman et al. in Peptides: Chemistry and Biology, G. R. Marshall ed., ESCOM Publisher: Leiden, Netherlands, 1988), substituted gamma lactam rings (Garvey et al. in Peptides: Chemistry and Biology, G. R. Marshall ed., ESCOM Publisher: Leiden, Netherlands, 1988), keto-methylene pseudopeptides (Ewenson et al. (1986) J. Med. Chem. 29:295; and Ewenson et al. in Peptides: Structure and Function (Proceedings of the 9th American Peptide Symposium) Pierce Chemical Co. Rockland, 111, 1985), beta-turn dipeptide cores (Nagai et al. (1985) Tetrahedron Lett 26:647; and Sato et al. (1986) J. Chem. Soc. Perkin. Trans. 1: 1231), and b-aminoalcohols (Gordon et al. (1985) Biochem. Biophys. Res. Commun. 126:419; and Dann et al. (1986) Biochem. Biophys. Res. Commun. 134:71). IL-13Rα2 proteins may also be chemically modified to create IL-13Rα2 derivatives by forming covalent or aggregate conjugates with other chemical moieties, such as glycosyl groups, lipids, phosphate, acetyl groups and the like. Covalent derivatives of IL-13Rα2 proteins or peptides can be prepared by linking the chemical moieties to functional groups on amino acid side chains of the protein/peptide or at the N- terminus or at the C-terminus of the protein/peptide.
IL-13Rα2 proteins may also be fused to one or more other proteins. For example, an IL-13Rα2 protein or immunogenic portion thereof may be fused to another protein that serves as a targeting ligand to deliver the IL-13Rα2 protein or portion to a particular target site in a subject (e.g., in order to stimulate a local immune response at that site). For instance, an IX- 13Rα2 protein or peptide can be fused to a mutant IL-13 molecule or anti-IL-13 receptor antibody to specifically target the IL-13Rα2 protein or peptide to a tumor, e.g., a HGG. Numerous methods of fusing two or more proteins together are known in the art, e.g., making and expressing a recombinant fusion construct, or using a cross-linking agent to covalently bond the two or more proteins together to form one molecule. Any suitable for this application might be used in the invention.
The IL-13Rα2 proteins and peptides of the invention can be made by known methods. For example, a host cell fransfected with a nucleic acid vector directing expression of a nucleotide sequence encoding the subject proteins or peptides can be cultured under appropriate conditions to allow expression of the peptide to occur. The cells may be harvested, lysed, and the protein isolated. A recombinant IL-13Rα2 protein or peptide can be isolated from host cells using techniques known in the art for purifying proteins including ion-exchange chromatography, gel filtration chromatography, ultrafiltration, electrophoresis, and immunoaffinity purification with antibodies specific for such protein or peptide.
For example, after an IL-13Rα2 protein or peptide has been expressed in a cell, it can be isolated using immuno-affinity chromatography. For instance, an anti-IL-13Rα2 antibody that specifically binds the subject proteins or peptides can be immobilized on a column chromatography matrix, and the matrix can be used for immuno-affinity chromatography to purify the proteins or peptides from cell lysates by standard methods (see, e.g., Ausubel et al., supra). After immuno-affinity chromatography, the proteins or peptides can be further purified by other standard techniques, e.g., high performance liquid chromatography (see, e.g., Fisher, Laboratory Techniques In Biochemistry And Molecular Biology, Work and Burdon, eds., Elsevier, 1980). In another embodiment, the IL-13Rα2 proteins or peptides utilized in the invention are expressed as a fusion protein containing an affinity tag (e.g.,
GST) that facilitates its purification.
In association with an antigenic agent (e.g., a IL-13Rα2 protein or peptide fragment thereof) of a vaccine of the invention, an adjuvant can be used to boost the immune response. Suitable adjuvants for use in the invention can include any substance that can non-specifically enhance an antigen-specific immune response stimulated by an antigenic agent. Many such adjuvants are known, including for example: (1) Freund's adjuvant (complete and incomplete) (2) oil-in-water emulsion formulations such as the Ribi™ adjuvant system (Corixa, Seattle, Washington) (3) aluminum salts (e.g., aluminum hydroxide, aluminum phosphate, aluminum sulfate, etc); (4) saponin-based adjuvants (Stimulon™ from Aquila Biosciences, Framingham, Massachusetts); (5) cytokines such as IL-1, IL-2, macrophage colony stimulating factor, and tumor necrosis factor; and (6) other substances that act as immunostimulating agents such as muramyl peptides or bacterial cell wall components, toxins, and toxoids. To facilitate their formulation for administration to a subject, the vaccine compositions of the invention (e.g., the protein/peptide antigen and adjuvant) can further contain a pharmaceutically acceptable carrier or excipient. For example the protein/peptide antigen and adjuvant can be mixed with a diluent such as water, saline, glycerol, ethanol, etc. Other substances, such as preservatives, surfactants, emulsifying agents, buffers, etc. can also be included. Typically, the protein peptide-based vaccine compositions of the invention are prepared for parenteral injection as liquid solutions or suspensions. The vaccine compositions can also be prepared as solids (e.g., a lyophilized powder) that can be reconstituted in a liquid (e.g., saline) prior to injection into a subject. The vaccine compositions can also be emulsified or encapsulated in liposomes.
Nucleic Acid-based Vaccines
Nucleic acid-based vaccines are known to elicit a prominent cell-mediated immune response. See, e.g., Donnely et al., 1997; Rosenberg, S.A., Immunity 10:281, 1999. Thus, in addition to protein/peptide based vaccines, the antigenic agent for use in the vaccines of the invention can take the form of a nucleic acid that can stimulate an immune response against IL-13Rα2 when administered to a subject. Examples of such nucleic acids include those that encode the native IL-13Rα2 such as the nucleic acid shown herein as SEQ ID NO:2 (Fig. 2), a variant of the native IL-13Rα2, or a peptide fragment of that native or variant IL-13Rα2. Vaccines made with a nucleic acid that encodes the whole protein antigen are advantageous because they have the potential for stimulating an immune response against all of the different antigenic sites expressed by the protein. Vaccines made with a nucleic acid that encodes a peptide antigen (e.g., 7-15 amino acids of the whole protein), on the other hand, will generally stimulate an immune response against fewer than all of the potential antigenic sites expressed by the protein.
The form of the nucleic acid used in a vaccine of the invention can be any suitable for stimulating an immune response against IL-13Rα2 when administered to a subject. For example, the nucleic acid can be in the form of "naked DNA" or it can be incorporated in an expression vector. A description of suitable nucleic acids is presented below. Nucleic acids that are most immunogenic in a subject can be determined by preparing several of the below listed nucleic acids (e.g., those that encode the whole antigen or peptide fragments thereof), administering the subject (or a series of genetically similar such subjects) such nucleic acids in a vaccine composition (e.g., as naked nucleic acid or in an expression vector in a suitable carrier), and analyzing the subject(s) for the stimulation of an immune response. Those nucleic acids that induce the desired response can then be selected.
Nucleic acid molecules utilized in the present invention as an antigenic agent may be in the form of RNA or in the form of DNA (e.g., cDNA, genomic DNA, and synthetic DNA).
The DNA may be double-stranded or single-stranded, and if single-stranded may be the coding (sense) strand or non-coding (anti-sense) strand. The coding sequence which encodes the native IL-13Rα2 protein may be identical to the nucleotide sequence shown in Fig. 2. It may also be a different coding sequence which, as a result of the redundancy or degeneracy of the genetic code, encodes the same polypeptide as shown in SEQ ID NO:l (Fig. 1).
Other nucleic acid molecules useful in the invention are variants of the native IL- 13Rα2 gene such as those that encode fragments (e.g., post-translationally processed forms of), analogs and derivatives of a native IL-13Rα2 protein. Such variants may be, e.g., a naturally occurring allelic variant of the native IL-13Rα2 gene, a homolog of the native IX- 13Rα2 gene, or a non-naturally occurring variant of the native IL-13Rα2 gene. These variants have a nucleotide sequence that differs from the native IL-13Rα2 gene in one or more bases. For example, the nucleotide sequence of such variants can feature a deletion, addition, or substitution of one or more nucleotides of the native IL-13Rα2 gene. Nucleic acid insertions are preferably of about 1 to 10 contiguous nucleotides, and deletions are preferably of about 1 to 30 contiguous nucleotides.
Naturally occurring allelic variants of the native IL-13Rα2 gene within the invention are nucleic acids isolated from human tissue that have at least 75% (e.g., 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, and 99%) sequence identity with the native IL-13Rα2 gene, and encode polypeptides having structural similarity to native IL-13Rα2 protein. Homologs of the native IL-13Rα2 gene within the invention are nucleic acids isolated from other species that have at least 75% (e.g., 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, and 99%) sequence identity with the native IL-13Rα2 gene, and encode polypeptides having structural similarity to native IL-13Rα2 protein. Public and/or proprietary nucleic acid databases can be searched in an attempt to identify other nucleic acid molecules having a high percent (e.g., 70, 80, 90% or more) sequence identity to the native IL-13Rα2 gene. Non-naturally occurring IL-13Rα2 gene variants are nucleic acids that do not occur in nature (e.g., are made by the hand of man), have at least 75% (e.g., 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, and 99%) sequence identity with the native IL-13Rα2 gene, and encode polypeptides having structural similarity to native IL-13Rα2 protein. Examples of non- naturally occurring IL-13Rα2 gene variants are those that encode a fragment of a IL-13Rα2 protein, those that hybridize to the native IL-13Rα2 gene or a complement of to the native IL- 13Rα2 gene under stringent conditions, those that share at least 65% sequence identity with the native IL-13Rα2 gene or a complement of the native IL-13Rα2 gene, and those that encode a IL- 13Rα2 fusion protein.
Nucleic acids encoding fragments of native IL-13Rα2 protein within the invention are those that encode, e.g., 2, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300 or more amino acid residues of the native IX- 13Rα2 protein. Shorter oligonucleotides (e.g., those of 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 50, 100, 125, 150, or 200 base pairs in length) that encode fragments of the native IL-13Rα2 protein can be used. Nucleic acids encoding fragments of native IL-13Rα2 protein can be made by enzymatic digestion (e.g., using a restriction enzyme) or chemical degradation of the full length native IL-13Rα2 gene or variants thereof.
Nucleic acid molecules encoding IL-13Rα2 fusion proteins are also within the invention. Such nucleic acids can be made by preparing a construct (e.g., an expression vector) that expresses a IL-13Rα2 fusion protein when introduced into a suitable host. For example, such a construct can be made by ligating a first polynucleotide encoding an IX- 13Rα2 protein fused in frame with a second polynucleotide encoding another protein (e.g., a detectable label or carrier protein) such that expression of the construct in a suitable expression system yields a fusion protein. IL-13Rα2 fusion proteins can be used, e.g., to enhance the immunogenicity of IL-13Rα2 peptides, to facilitate purification of IL-13Rα2 proteins/peptides, or to track the location of the IL-13Rα2 fusion protein after it has been administered to a subject.
Using the nucleotide sequence of the native IL-13Rα2 gene arid the amino acid sequence of a native IL-13Rα2 protein, those skilled in the art can create nucleic acid molecules that have minor variations in their nucleotide sequences, by, for example, standard nucleic acid mutagenesis techniques or by chemical synthesis. Variant IL-13Rα2 nucleic acid molecules can be expressed to produce variant IL-13Rα2 proteins.
Naked Nucleic Acid Vaccines
The invention provides for the use of naked nucleic acid vaccines to stimulate an immune response against IL-13Rα2. Representative naked nucleic acid vaccines for use in this method include a DNA encoding one or more immunogenic portions of IL-13Rα2 along with sufficient other 5' and 3' elements to direct expression of the foregoing. The use of naked nucleic acids for stimulating both class I and class II restricted immune responses against a particular protein is known in the art. See, e.g., Rosenberg, S.A., Immunity 10:281, 1999; Ulmer et al, Science, 259: 1745, 1993; Donnelly et al, Ann. NY Acad. Sci., 772:40,
1995; Scheurs et al, Cancer res. 58:2509, 1998; Hurpin et al, Vaccine 16:208, 1998; Lekutis et al, J. Immunol. 158:4471, 1997; Manickan et al, J. Leukoc. Biol. 61:125, 1997. These methods can be adapted for use in the present invention by using a nucleic acid encoding one or more immunogenic portions of IL-13Rα2. Naked nucleic acid vaccines can be administered to a subject by any suitable technique. For example, naked DNA encoding a peptide portion of IL-13Rα2 can be injected into muscle cells of a subject or naked DNA- coated gold particles can be introduced into skin cells (to be taken up by dendritic cells) of a subject using a gene gun.
Expression Vector Vaccines The invention also provides for the use of expression vector vaccines to stimulate an immune response against IL-13Rα2. In a typical application of this technique, a nucleic acid encoding one or more peptide or protein antigens of IL-13Rα2 is incorporated into a vector that allows expression of the antigen(s) in a host cell (e.g., a cell inside a subject or administered to a subject). The nucleic acid encoding the antigen(s) is generally be under the operational control of other sequences contained within the vector such as a promoter sequences (e.g., tissue specific, constitutively active, or inducible) or enhancer sequences. The antigen(s) encoded by the vector are expressed when the vector is introduced into a host cell in a subject. After expression, the antigen(s) can associate with an MHC molecule for presentation to immune system cells such as T lymphocytes, thus stimulating an immune response. See, e.g., Corr et al, J. Exp. Med. 184:1555 (1996). Vectors for use in the invention can be any capable of expressing an encoded antigen(s) in a subject. For example, vectors derived from bacterial plasmids and viruses may be used. Representative viral vectors include retroviral, adenoviral, and adeno-associated viral vectors. See, e.g., Gene Therapy: Principles and Applications, ed. T. Blackenstein, Springer Verlag, 1999; Gene Therapy Protocols (Methods in Molecular Medicine), ed. P.D.
Robbins, Humana Press, 1997; and Retro-vectors for Human Gene Therapy, ed. CP. Hodgson, Springer Verlag, 1996.
Cell-based Vaccines
Cell-based vaccines are provided in the invention to stimulate an immune response against IL-13Rα2. In similar approaches using different cancer-associated antigen, cancer cells isolated from a patient have been harbored in vitro and fransfected with DNA encoding for immune stimulants, such as cytokines, MHC molecules or co-stimulatory molecules. The fransfected cancer cells were then re-injected to the patient in order to activate the immune system in order to generate an anti-cancer response. Greten, T.F., and E.M. Jaffee, J. Clin. Oncol, 17: 1047-1060, 1999; Simons et al, Cancer Res., 57: 1537-1546, 1997.
The invention further provides an isolated cell expressing IX-13Rα2 or a peptide fragment of IL-13Rα2. Cells expressing IL-13Rα2 can be isolated from a subject having such cells (e.g., from testis or HGG). Cells that do not express IL-13Rα2 can be made to express this protein in a number of different ways. As one example, cells can be cultured with IL-13Rα2 or peptide fragments thereof under conditions in which fragments of IX-
13Rα2 become associated with MHC molecules on the cell surface. Alternatively, cells can be made to express IL-13Rα2 by introducing a nucleic acid encoding an IL-13Rα2 protein, a peptide fragment of IL-13Rα2, or a variant of the foregoing into the cells, and culturing such cells under conditions that cause the cells to express the protein or peptide. Cellular expression of the protein, peptide, or variant can be monitored by any conventional technique.
For example, fluorescently labeled antibodies that specifically bind the protein, peptide, or variant can be used to detect expression of the protein, peptide, or variant on a cell. See, e.g., Kim et al, J. Immunother. 20:276, 1997. In addition, Western blotting using antibodies that specifically bind the protein, peptide, or variant can be used to detect expression of the protein, peptide, or variant in lysates of a cell. Cell types suitable for stimulating an immune response against IL-13Rα2 can be prokaryotic or eukaryotic. A number of such cells are known in the art, so an exhaustive list is not provided herein. Examples of suitable prokaryotic cells include bacterial cells such as E. coli, B. subtilis, and mycobacteria. Examples of suitable eukaryotic cells include plant, yeast, insect, avian, nematode (e.g., C elegans), and mammalian cells (e.g., autologous cells from a human patient that are to be later reintroduced into the patient). These cells can be cultured in conventional nutrient media modified as appropriate for inducing promoters, selecting transformants, or amplifying the genes encoding the desired sequences.
Further examples of cells that can be used to stimulate an immune response against IL-13Rα2 include those that express a peptide comprising a least 7 (e.g., 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more) contiguous amino acids of SEQ ID NO:l. For instance, an isolated cell expressing a protein having the sequence of SEQ ID NO:l can be used. Cells into which have been introduced a purified nucleic acid that encodes a peptide comprising a least 7 contiguous amino acids of SEQ ID NO:l might also be used. Although any cell that can express IL- 13Rα2 protein, a peptide fragment of IL- 13Rα2, or a variant of the foregoing can be used to stimulate an immune response in a subject, some are preferred because of their particular antigen presentation capabilities. Examples of such cells include antigen-presenting cells (APCs) such as B lymphocytes, monocytes/macrophages, dendritic cells (DC), and other cells expressing major histocompatability complex (MHC) and/or costimulatory molecules.
Since DC are known to function as particularly strong APCs, their use in the cell- based vaccine of the invention is particularly preferred. See, e.g., Banchereau et al, Ann. Rev. Immunology, 18:767, 2000. DC can be made to express an IL-13Rα2 protein, a peptide fragment of IL-13Rα2, or a variant thereof as described above. For example, DC can be removed from a subject, contacted with the selected antigen, and then returned to the subject to stimulate an immune response. To enhance their antigen presentation capability, the DC can also be treated with an activating substance such as a cytokines.
Those cell-based vaccines that are most effective in stimulating an immune response against IL-13Rα2 in a subject can be determined by preparing a series of different cell-based vaccine (e.g. those expressing whole antigen or specific peptide fragments of the antigen), administering a subject (or a series of genetically similar subjects) such different vaccines, and analyzing the subject(s) for the stimulation of an immune response. Those vaccines that induce the desired response can then be selected.
Anti-idiotypic Antibody Vaccines
The invention also contemplates the use of anti-idiotypic antibody vaccines to stimulate an immune response against IL-13Rα2 in a subject. In this method, anti-idiotypic antibodies are prepared that feature an internal "image" of one or more immunogenic portions of IL-13Rα2. See, e.g., U.S. Patent Nos. 5,053,224; 5,208,146; 5,612,030; and 5,925,362. Administration of these anti-idiotypic antibodies in a vaccine composition to a subject can stimulate an immune response against the "image" of an immunogenic portion of IL-13Rα2 which cross-reacts against actual immunogenic portions of IL-13Rα2. As one example, polyclonal anti-idiotypic antibodies can be generated by immunizing a host animal with monoclonal antibodies raised against an epitope of IL-13Rα2. Methods ofpreparing monoclonal and polyclonal antibodies as described in more detail below.
Antibody Production The vaccines/antigenic agents featured in the invention can be used to raise antibodies useful in the invention. Polyclonal antibodies are heterogeneous populations of antibody molecules that are contained in the sera of the immunized animals. Antibodies within the invention therefore include polyclonal antibodies and, in addition, monoclonal antibodies, single chain antibodies, Fab fragments, F(ab')2 fragments, and molecules produced using a Fab expression library. Monoclonal antibodies, which are homogeneous populations of antibodies to a particular antigen, can be prepared using the IL-13Rα2 proteins and peptides described above and standard hybridoma technology (see, for example, Kohler et al, Nature 256:495, 1975; Kohler et al, Eur. J. Immunol. 6:511, 1976; Kohler et al, Eur. J. Immunol. 6:292, 1976; Hammerling et al, "Monoclonal Antibodies and T Cell Hybridomas," Elsevier, N.Y., 1981; Ausubel et al, supra). In particular, monoclonal antibodies can be obtained by any technique that provides for the production of antibody molecules by continuous cell lines in culture such as described in Kohler et al, Nature 256:495, 1975, and U.S. Pat. No. 4,376,110; the human B-cell hybridoma technique (Kosbor et al, Immunology Today 4:72, 1983; Cole et al, Proc. Natl. Acad. Sci. USA 80:2026, 1983), and the EBV-hybridoma technique (Cole et al, "Monoclonal Antibodies and Cancer Therapy," Alan R. Liss, Inc., pp. 77-96, 1983). Such antibodies can be of any immunoglobulin class including IgG, IgM, IgE, IgA, IgD and any subclass thereof. A hybridoma producing a mAb of the invention may be cultivated in vitro or in vivo. The ability to produce high titers of mAbs in vivo makes this a particularly useful method of production. Human or humanoid. antibodies that specifically bind a IL-13Rα2 protein can also be produced using known methods. For example, polyclonal antibodies can also be collected from human subjects having such antibodies in their sera, e.g., subjects administered vaccines that stimulate antibody production against IL-13Rα2. As another example, human antibodies against IL-13Rα2 protein can be made by adapting known techniques for producing human antibodies in animals such as mice. See, e.g., Fishwild, D. M. et al, Nature Biotechnology 14
(1996): 845-851; Heijnen, I. et al, Journal of Clinical Investigation 97 (1996): 331-338; Lonberg, N. et al, Nature 368 (1994): 856-859; Morrison, S. L., Nature 368 (1994): 812-813; Neuberger, M., Nature Biotechnology 14 (1996): 826; and US Patent Nos. 5,545,806; 5,569,825; 5,877,397; 5,939,598; 6,075,181; 6,091?001; 6,114,598; and 6,130,314. Humanoid antibodies against IL-13Rα2 can be made from non-human antibodies by adapting known methods such as those described in U.S. Patent Nos. 5,530, 101; 5,585,089; 5,693,761; and 5,693,762.
Once produced, polyclonal or monoclonal antibodies can be tested for specific IL- 13Rα2 recognition by Western blot or immunoprecipitation analysis by standard methods, for example, as described in Ausubel et al, supra. Antibodies that specifically recognize and bind to IL-13Rα2 are useful in the invention. For example, such antibodies can be used in an immunoassay to monitor the level of IL-13Rα2 in a sample (e.g., to determine the amount of cellular expression or subcellular location of IL-13Rα2, or the presence and amount of soluble forms of IL-13Rα2 in a liquid sample). Preferably, IL-13Rα2 protein selective antibodies of the invention are produced using fragments of the IL-13Rα2 protein that lie outside highly conserved regions and appear likely to be antigenic by criteria such as high frequency of charged residues. Cross-reactive anti-IL- 13Rα2 protein antibodies are produced using a fragment of a IL-13Rα2 protein that is conserved among members of this family of proteins. In one specific example, such fragments are generated by standard techniques of PCR, and are then cloned into the pGEX expression vector (Ausubel et al, supra). Fusion proteins are expressed in E. coli and purified using a glutathione agarose affinity matrix as described in Ausubel, et al, supra.
In some cases it may be desirable to minimize the potential problems of low affinity or specificity of antisera. In such circumstances, two or three fusions can be generated for each protein, and each fusion can be injected into at least two rabbits. Antisera can be raised by injections in a series, preferably including at least three booster injections. Antiserum is also checked for its ability to immunoprecipitate recombinant IL-13Rα2 proteins or control proteins, such as glucocorticoid receptor, CAT, or luciferase.
Techniques described for the production of single chain antibodies (e.g., U.S. Pat. Nos. 4,946,778, 4,946,778, and 4,704,692) can be adapted to produce single chain antibodies against a IL-13Rα2 protein, or a fragment thereof. Single chain antibodies are formed by linking the heavy and light chain fragments of the Fv region via an amino acid bridge, resulting in a single chain polypeptide.
Antibody fragments that recognize and bind to specific epitopes can be generated by known techniques. For example, such fragments include but are not limited to F(ab')2 fragments that can be produced by pepsin digestion of the antibody molecule, and Fab fragments that can be generated by reducing the disulfide bridges of F(ab')2 fragments. Alternatively, Fab expression libraries can be constructed (Huse et al, Science 246:1275, 1989) to allow rapid and easy identification of monoclonal Fab fragments with the desired specificity.
Method of Inducing an Anti-IL-13Rα2 Immune Response in a Subject
The invention provides methods for stimulating a immune response against IX- 13Rα2 in a subject having or at risk for developing a cancer having cells expressing IL- 13 Rα2. Such methods can be performed by (a) formulating as anti-cancer vaccine composition (as described above) outside of the subject and (b) administering the vaccine to the subject in an amount sufficient to stimulate an immune response against IL-13Rα2 in the subject. Subjects
The compositions and methods of the invention can be utilized with any suitable subject, e.g., an animal such as a mammal (e.g., human beings, dogs, cats, goats, sheep, cows, horses, etc.). A human patient suffering or at risk for developing a cancer or other disease that has cells that overexpress IL-13Rα2 (e.g., a brain cancer such as HGG) is a particularly preferred subject.
IL-13Rα2 as a Component of a Polyvalent Vaccine
The invention also provides polyvalent vaccines that incorporate one or more of the foregoing compositions that can stimulate an immune response against IL-13Rα2 in a subject. Two general types of polyvalent vaccines are within the invention. First, a vaccine that contains more than one agent that can stimulate and immune response against IL-13Rα2 (e.g., a composition that contains 2, 3, 4, 5, 6 , 7, 8, or more different peptides listed in Table 1 below). Second, a vaccine that contains both (a) an agent that can stimulate and immune response against IL-13Rα2 and (b) a different agent that can stimulate an immune response against a molecule other than IL- 13Rα2 (e.g., another TSA or TAA).
Administering Vaccines to a Subject
The vaccine compositions of the present invention can be used in a method for stimulating an immune response against IL-13Rα2 in a subject. In this method, an vaccine compositon of the invention can be administered to a subject by any method that stimulates the aforesaid immune response. The exact method selected is determined by the particular vaccine composition to administered. For parenteral administration by injection, the injection can be in situ (i.e., to a particular tissue or location on a tissue, e.g., into a tumor or lymph node), intramuscular, intravenous, intraperitoneal, or by another parenteral route. For example, for a protein/peptide based vaccine the vaccine may be administered by subcutaneous or intradermal injection. In some cases other routes can be used, e.g. intravenous injection, intraperitoneal injection, or in situ injection into target tissue.
Naked nucleic acid vaccines or expression vector vaccines may be administered by intramuscular injection. Cell-based vaccines can be introduced into an animal by any suitable method, e.g., subcutaneous injection. In addition to parenteral routes, the vaccines of the invention can also be administered by a non-parenteral route, e.g, by oral, buccal, urethral, vaginal, or rectal administration. Formulations for injection may be presented in unit dosage form, for example, in ampoules or in multi-dose containers, with an added preservative. The compositions may take such forms as suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents. Alternatively, the vaccine compositions may be in powder form (e.g., lyophilized) for constitution with a suitable vehicle, for example, sterile pyrogen-free water, before use.
To facilitate delivery of the antigenic compositions (e.g., antigenic agent plus adjuvant) of the invention to an animal, the antigenic compositions can be mixed with a pharmaceutically acceptable carrier or excipient. Examples of such pharmaceutically acceptable carriers and excipients include diluents such as water, saline, citrate buffered saline, phosphate buffered saline, acetate buffered saline, and bicarbonate buffered saline; and stabilizing agents such as amino acids, alcohols, proteins (for example, serum albumin), EDTA, mannitol, sorbitol, and glycerol To minimize the chance of infection or adverse reaction when administered to a subject, carriers and excipients are preferably sterile and pyrogen-free. USP grade carriers and excipients are particularly preferred for delivery of vaccine compositions to human subjects. The vaccine compositions can also be formulated for long-term release as a depot preparation by adding the antigenic agent to suitable polymeric or hydrophobic materials or ion exchange resins. They can also be made by preparing the vaccine composition as a sparingly soluble derivative. Depot preparations can be administered to a subject by implantation (e.g., subcutaneous or intramuscular surgical implantation) or by injection. Methods for making the foregoing formulations are well known and can be found in, for example, Remington's Pharmaceutical Sciences.
Dosing
The vaccine compositions of the invention are preferably administered to a subject in an amount sufficient to stimulate an immune response against IL-13Rα2 in the subject, and not cause an overly toxic effect. Such a therapeutically effective amount can be determined as described below.
Toxicity and therapeutic efficacy of the vaccines utilized in the invention can be determined by standard pharmaceutical procedures, using either cells in culture or experimental animals to determine the LD50 (the dose lethal to 50% of the population) and the
ED50 (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD50/ED50. Vaccines that exhibit large therapeutic indices are preferred. While those that exhibit toxic side effects may be used, care should be taken to design a delivery system that minimizes the potential damage of such side effects. Data obtained from animal studies can be used in formulating a range of dosage for use in humans. The dosage of such vaccines lies preferably within a range that include an ED50 with little or no toxicity. The dosage may vary- within this range depending upon the dosage form employed and the route of administration utilized. The vaccines of the invention can be administered to a subject using various different vaccination schedules. For example, a nucleic acid vaccine might be administered to a subject only once, while a protein/peptide- based vaccine might be administered to the subject on multiple occasions (1, 2, 3, 4, 5 or more times). For example, in an effort to stimulate a strong immune response, a first dose of a vaccine compositions of the invention may be administered to a subject at least 24 hours before a second (booster) dose is administered to the subject.
Kits
The invention also provides kits for stimulating an immune response against IX- 13Rα2 in a subject. Such kits can include a container holding one or more of the antigenic agents described above in a pharmaceutically acceptable form. The antigenic agent(s) in the container can be in liquid form (e.g., as a solution) or in solid form (e.g., as a lyophilized or desiccated powder). Where, for example, the antigenic agent is a solid, the kits within the invention can further include a container holding a pharmaceutically acceptable solution (e.g., sterile saline with or without dextrose) for reconstituting the solid into a liquid suitable for injection. The kits of the invention can further include (a) one or more devices to administer the antigenic agent, e.g., a needle or syringe, a packaged alcohol pad, etc.; and/or (b) printed instructions for using the kit.
Examples
Example 1- IL-13Rα2 Mimics the Biological Features of an HGG-associated receptor for IL-13
Normal Chinese hamster ovary (CHO) cells were fransfected with a pcDNA 3.1 plasmid (Invitrogen) containing the full length open reading frame of IL-13Rα2 and positive clones were selected with geneticin. The expression of IL-13Rα2 in these clones was tested for their ability to bind I25I-labeled IL-13. Selected clones were shown to bind labeled IL-13 independently of IL-4. In addition, labeled IL- 13 was displaced by IL- 13.E 13K, a mutant of
IL-13 shown to have a greater affinity for the IL-13 binding protein on HGG than for the shared IL-13/IL-4 receptor found in a plethora of tissues under a physiological state. Furthermore, these IL-13Rα fransfected CHO cells were exposed to an IL-13.E13K- PE38QQR cytotoxin, a fusion protein showing potent dose dependent cyto toxicity on HGG cells. The clones expressing the receptor were killed in direct proportion to their affinity for
IL-13, but not CHO cells alone or CHO cells fransfected with an empty plasmid. In neutralization experiments, an excess of IL-13 prevented the cytotoxic effect of IL-13. El 3K- PE38QQR. Therefore the only way the toxin, PE38QQR, could have entered and killed the cells was through receptor-mediated endocytosis, a process directed through the IL-13 portion of the cytotoxin. Use of an IL13.E13K/enhanced green flourescent protein (EGFP) fusion protein confirmed that this process occurred. Thus, IL-13Rα2 was demonstrated to share properties ascribed to more restrictive, IL-4 independent, IL-13 binding sites found on HGGs in situ and in vitro.
Example 2- Identification of IL-13Rα2 as a Cancer Testis Antigen Materials and Methods
Sources of RNA. High-grade glioma cell lines A-172 MG, U-373 MG, U-251 MG and human glioblastoma multiforme explant cells (G-48) were grown in culture in appropriate media. Total RNA was extracted from the cells using the acid-guanidium isothiocyanate-phenol-chloroform method. Poly(A)+ RNA was further isolated using the Mini-oligo(dT) Cellulose Spin Column Kit (5 prime-3 prime Inc., Boulder, CO). 2 μg of Poly (A)+ RNA was electrophoresed on a 1% agarose formaldehyde gel, transferred to 0.45 μm magna charge nylon (MSI, Westborough, MA) and UV-crosslinked (Sfratagene, La Jolla,
CA). RNA-blotted membranes were also purchased from Clontech (Palo Alto, CA). Two Multiple Tissue Expression (MTE™) Blots (cat # 7770-1 and 7775-1; www.clontech.com/mtn/index.html) were analyzed to determine the tissue distribution of the 1X13 binding proteins. Two sets of Human Brain Multiple Tissue Northern (MTN™) Blots (cat # 7755-1 and 7769-1) were assayed to confirm the true presence of the transcripts. In addition, two Human Tissue Northern (MTN™) Blots (cat # 7759-1 and 7760-1) were analyzed to verify the tissue distribution of the IL-13Rα2 transcript. cDNA Probes. cDNA probes were generated either by PCR (IL-13Rα2 and IL13Rαl) or by restriction digest (IL-4Rα = pl40). cDNA containing human IL13Rα2 was provided by Dr. Pascual Ferrara of Sanofi Recherche. cDNA containing human IL13Rα 1 (and also 93 bases of murine IL-13) was provided by Dr. Douglas J. Hilton of The Walter and Eliza Hall Institute of Medical Research. Plasmid pHuIL4R/ID was used to obtain a fragment of IL4Rα by the restriction digest. The fragments were electrophoresed on a 1% agarose gel, excised from the gel and purified using QIAquick Gel Extraction Kit (Qiagen Inc., Valencia, CA). Actin cDNA was purchased from Clontech Labs.
The primers for human IL-13Rα2 were as follows: forward 5' - AAGATTTGGAAGCTTATGGCTTTCGTTTGC - 3' (SEQ ID NO:3) reverse 5' - TCCCTCGAAGCTTCATGTATCACAGAAAAA - 3' (SEQ ID NO:4)
The primers for human IL13Rαl were as follows: forward 5 ' - ATTATTAAGCTTATGGAGTGGCCGGCG - 3 ' (SEQ ID NO:5) reverse 5' - TAACCGGAAGCTTCACTGAGAGGCTTT - 3' (SEQ ID NO:6)
Northern Blot Analysis. Membranes were pre-hybridized overnight at 42° C in a solution consisting of 50% formamide, 5x SSC, 50 mM sodium phosphate, 5x Denhardt's, 50 μg/ml sheared salmon sperm DNA, and 1% SDS. Membranes were subsequently hybridized overnight at 42° C in the same solution with the addition of full length cDNA probes labeled by random priming (Life Technologies, Rockville, MD) with 32P-dCTP using l-2x 106 cpm/ml. Following hybridization, the membranes were washed with 2x SSC/0.2% SDS at 42° C for 20 minutes followed by two washes with lx SSC/0.1% SDS at 42° C for 20 minutes each. The membranes were exposed to autoradioraphic film X-OMAT AR (Eastman Kodak
Co., Rochester, NY) and placed at -80° C for 1, 3 and 14 days. The membranes were subsequently stripped and re-probed up to three more times. The membranes were probed first with IL-13Rα2, followed by IL13Rαl, IX-4Rα= pl40, and actin. Films were scanned on a transparency scanner at a pixel size of 88x88 micron (Molecular Dynamics, Sunnyvale, CA). The images were compiled in Paint Shop Pro V 5.0 (Jasc software Inc., Eden Prairie,
MN).
Results
Northern blot analysis of transcripts for IL-13Rα2 in normal organs. To explore the expression of IL-13Rα2, an extensive examination of the presence of transcripts for this protein among multiple normal tissues, including 20 discrete regions of the CNS and a variety of normal peripheral organs was performed. All Northern blots using same membranes were performed with respective labeled cDNAs in the following order: IL-13Rα2, IL13Rαl, IL4α and β-actin. This assured that the levels of transcripts for IL-13Rα2 were not underestimated due to the usage of membranes with mRNA. Both the dot-blot analyses (not shown) and the electrophoretically separated transcripts for IL-13Rα2 (Fig. 4, panels I-IV) demonstrated mostly undetectable, or very weak signals in few cases, of IL-13Rα2 transcripts in the organs studied, even after 2-week of film exposure. The first dot blot performed, however, surprisingly showed an unusually high density of labeling with IL-13Rα2 cDNA probe to transcripts derived from testis. This was also found using another Northern blot membrane. A few other organs had transcripts that hybridized to the IL-13Rα2 cDNA (aorta, liver, and pituitary gland). The density of labeling in the dot blots was much lower than in the testis blot. Of importance, there was no evidence for the presence of significant IL-13Rα2 expression in the CNS.
To confirm these findings made using dot blot analysis, additional blots were performed using electrophoretically separated mRNAs. Again, the discrete regions of normal human brain did not produce clear-cut hybridization signals (Fig. 4, panels I and II). On the other hand, the only organ with prominent hybridization band corresponding to the mRNA of 1.5 kb was seen in testis (Fig. 4, panel III). Poorly detectable signals were seen in placenta, liver, and kidney (Fig. 4, panel IV). Thus, among normal tissues, testes was the only one that prominently expressed IL-13Rα2. No transcripts for IL-13Rα2 were readily detected in the CNS.
Northern blot analysis of transcripts for IL13Rαl in normal tissues. The expression of IL13Rαl, a component of a heterodimeric form of 1X13 receptor that is shared with IL4, 1X13/4 receptor was examined in a variety of normal human tissues (Fig. 5) by either dot-blot analyses (not shown) or blots of electrophoretically separated transcripts (Fig. 5, panels I-IV). The results unequivocally demonstrated that IL 13Rα 1 was expressed in a variety of the organs, including CNS tissue from medulla, spinal cord, substantia nigra, thalamus, and corpus callosum. Size fractionated mRNAs confirmed the many positive signals seen in dot blots with the strongest signals observed in ovary, heart, liver and lung (Fig. 5, panels III and IV, respectively). Of interest, liver showed two hybridized species of mRNA: one of 4.5 kb and the other of 2.0 kb, as an example of a normal organ with doublet of positive signals of different sizes. In summary, discrete regions of normal human brain did produce clear-cut positive hybridization signals for IL13Rαl (Fig. 5, panels I and II). In addition, many vital peripheral organs exhibited hybridization bands corresponding to the mRNA of 4.5-4.65 kb (Fig. 5, panels III and IV). Gene expression analysis of IL4Rα in normal tissues. In addition to IL13Rαl, IL4Rα is another component of a heterodimeric form of IL13 receptor that is shared with IL4, i.e., the shared IL13/4 receptor. Thus, whether the distribution of IL4Rα gene expression corresponded to that of IL13Rαl was analyzed. All Northern blot analysis membranes used in this study demonstrated enriched content of the IL4Rα transcripts in a variety of tissues (Fig. 6, panels I, II, and IV). The presence of the transcripts within the CNS was most evident, as it was for IL13Rαl, in medulla, spinal cord, substantia nigra and thalamus (Fig. 6, panels I and II). Among normal peripheral organs, liver, lung, kidney, intestinal tract, spleen, stomach, and testis demonstrated gene expression of IL4Rα, which was generally similar to that seen with IL13Rαl (not shown). Thus, discrete regions of normal human brain contain transcripts for both IL13R l and IL4Rα, a complete heterodimer of the shared 1X13/4 receptor. Furthermore, several vital peripheral organs contained the two subunits of the IL13/4 receptor, including heart, liver, lung and intestinal tract. Control hybridization of β-actin. All membranes used for Northern blot analysis of IL13 receptors transcripts were also hybridized with a cDNA probe for a house-keeping gene, β-actin (Fig. 7; dot blots and panel III not shown). The intensity of the signals for β-actin was usually in accordance with the amount of mRNA present on the membranes, as estimated by the manufacturer.
Gene expression of IL13 receptors in cells. Gene expression of the two IL13 receptors was also examined in malignant and normal cells (Fig. 8). Transcripts for IX- 13Rα2, IL13R l, IL4Rα and β-actin were examined in serial hybridization assays. Isolated explant cells of HGG (G-48) as well as human malignant glioma established cell lines (A- 172 MG, U-373 MG, and U-251 MG) demonstrated intense signals for IL- 13Rα2 (Fig. 8). On the other hand, the transcripts for the elements of the shared 1X13/4 receptor, IL-13Rαl and IL4Rα, were found at lower levels when compared with that for IL-13Rα2 (Fig. 8). A- 172 MG cells appeared to be the most enriched in the components of the 1X13/4 receptor heterodimer. Of interest, two species of different sizes of the transcripts for both IL-13Rα2 and IL-13Rαl were seen in cells (Fig. 8). In a control assay, human umbilical vein endothelial cells (HUVEC) showed the presence of transcripts for IL-13Rαl and IL4Rα, but not those for IL-13Rα2 (Fig. 8). In summary, gene expression of IL-13Rα2 was detected in two specimens of HGG (Fig. 8, HGG 13 and HGG 52), but not in two normal brain specimens (Fig. 8, NB 3 and NB 6). However, the transcripts for IL-13Rαl were found in all of these specimens. In other experiments, several additional HGG brain tumor specimens were determined to express IL-13Rα2.
Example 3- Representative Immunogenic Peptides of IL-13Rα2
Table I presents a list of IL-13Rα2 peptides that might be used to stimulate an immune response against IL-13Rα2 in a subject. The listed peptides were obtained using a computer program provided by the Ludwig Institute For Cancer Research (Lausanne,
Switzerland) on the Internet at http://www-ludwig.unil.ch.SEREX.html This program provided the best (at high stingency) fit of predicted immunogenic peptides that bind specific classes of MHC molecules (i.e., the various alleles of human MHC Class I indicated in Table I). The peptides indicated with the "*" are those that should bind under high stringency. The skilled artisan could produce these peptides as described herein (e.g., by automated peptide synthesis) and use each in a vaccine preparation that would be administered to a variety of test subjects (e.g. those with different MHC types) as also described herein. The immune response stimulated by each of these peptides in the subjects could then be assessed, so that those that stimulate the desired immune responses in particular test subjects could be identified.
Table I
Binding peptides prediction: * = high stringency
Figure imgf000036_0001
Figure imgf000037_0001
Figure imgf000038_0001
Figure imgf000039_0001
Figure imgf000040_0001
Figure imgf000041_0001
Figure imgf000042_0001
Figure imgf000043_0001
Figure imgf000044_0001
Other Embodiments
This description has been by way of example of how the compositions and methods of invention can be made and carried out. Those of ordinary skill in the art will recognize that various details may be modified in arriving at the other detailed embodiments, and that many of these embodiments will come within the scope of the invention. Therefore, to apprise the public of the scope of the invention and the embodiments covered by the invention, the following claims are made.

Claims

What is claimed is:
1. A method for stimulating a immune response against IL- 13Rα2 in a subject having or at risk for developing a disease having cells expressing IL-13Rα2, the method comprising the steps of: (a) formulating an anti-cancer vaccine outside of the subject, the vaccine comprising an agent that can stimulate an immune response against IL-13Rα2 when administered to an animal; and (b) administering the vaccine to the subject in an amount sufficient to stimulate an immune response against IL- 13Rα2 in the subject.
2. The method of claim 1 , wherein the agent that can stimulate an immune response against IL-13Rα2 comprises a peptide comprising at least seven contiguous amino acids ofSEQ ID NO:l.
3. The method of claim 1, wherein the agent that can stimulate an immune response against IL-13Rα2 is a protein comprising the amino acid sequence of SEQ ID NO:l.
4. The method claim 1, wherein the vaccine further comprises an adjuvant.
5. The method of claim 4, wherein the adjuvant comprises a substance selected from the group consisting of: an aluminum salt; an oil-in- water emulsion; a composition comprising saponin; a composition comprising a bacterial protein; and a cytokine.
6. The method of claim 4, wherein step (b) of administering the vaccine to the subject in an amount sufficient to stimulate an immune response against IL-13Rα2 in the subject comprises administering the vaccine in at least a first dose and a second dose, wherein said first dose is administered to the subject at least 24 hours before said second dose is administered to the subject.
7. The method of claim 1 , wherein the agent that can stimulate an immune response against IL-13Rα2 comprises a nucleic acid that encodes a peptide comprising at least seven contiguous amino acids of SEQ ID NO: 1.
8. The method of claim 7, wherein the nucleic acid is a naked DNA.
9. The method of claim 7, wherein the nucleic acid is incorporated into an expression vector.
10. The method of claim 1, wherein the agent that can stimulate an immune response against IL-13Rα2 comprises a cell expressing a peptide comprising at least seven contiguous amino acids of SEQ ID NO: 1.
11. The method of claim 10, wherein the peptide comprising at least seven contiguous amino acids of SEQ ID NO: 1 is a protein comprising the amino acid sequence of SEQ ID NO: 1.
12. The method of claim 1, wherein the agent that can stimulate an immune response against IL-13Rα2 comprises a cell into which has been introduced a purified nucleic acid that encodes a peptide comprising at least seven contiguous amino acids of SEQ ID NO:l.
13. The method of claim 1, further comprising the step of providing a subject having or at risk for developing a cancer having cells expressing IL-13Rα2.
14. The method of claim 13, wherein the cells expressing IL-13R 2 are glioma cells.
15. The method of claim 13, wherein the subject is a human being.
16. A composition for stimulating an immune response against IL-13Rα2 when administered to an animal, the composition comprising: (a) an isolated agent that can stimulate an immune response against IL-13Rα2 when administered to an animal; and (b) a pharmaceutically acceptable carrier.
17. The composition of claim 16, wherein the agent that can stimulate an immune response against IL-13Rα2 when administered to an animal comprises a peptide comprising at least seven contiguous amino acids of SEQ ID NO: 1.
18. The composition of claim 17, wherein the peptide comprising at least seven contiguous amino acids of SEQ ID NO: 1 is a protein comprising the amino acid sequence of SEQ ID NO: 1.
19. The composition of claim 17, wherein the composition further comprises an adjuvant.
20. The composition of claim 19, wherein the adjuvant comprises a substance selected from the group consisting of: an aluminum salt; an oil-in- water emulsion; a composition comprising saponin; a composition comprising a bacterial protein; and a cytokine.
21. The composition of claim 20, wherein the agent that can stimulate an immune response against IL-13Rα2 when administered to an animal comprises a nucleic acid that encodes a peptide comprising at least seven contiguous amino acids of SEQ ID NO: 1.
22. The composition of claim 21 , wherein the nucleic acid is a naked DNA.
23. The composition of claim 21, wherein the nucleic acid is incorporated into an expression vector.
24. The composition of claim 20, wherein the agent that can stimulate an immune response against IL-13Rα2 comprises a cell expressing a peptide comprising at least seven contiguous amino acids of SEQ ID NO: 1.
25. The method of claim 24, wherein the peptide comprising at least seven contiguous amino acids of SEQ ID NO: 1 is a protein comprising the amino acid sequence of SEQ ID NO: 1.
26. The composition of claim 25, wherein the agent that can stimulate an immune response against IL-13Rα2 comprises a cell into which has been introduced a purified nucleic acid that encodes a peptide comprising at least seven contiguous amino acids of SEQ ID NO:l.
27. A method for directing an antibody to cells expressing IL-13Rα2 in a subject, the method comprising the steps of: (a) formulating a pharmaceutical composition outside of a subject, the pharmaceutical composition comprising an antibody that specifically binds IL-13Rα2 and a pharmaceutically acceptable carrier; and (b) administering the pharmaceutical composition to the subject in an amount sufficient to allow the antibody to specifically bind to the cells expressing IL-13Rα2 in the subject.
28. The method of claim 27, wherein the antibody is a monoclonal antibody.
29. The method of claim 27, wherein the antibody is a polyclonal antibody.
30. A pharmaceutical composition comprising an antibody that specifically binds IL- 13Rα2 and a pharmaceutically acceptable carrier.
31. The pharmaceutical composition of claim 30, wherein the antibody is a monoclonal antibody.
32. The pharmaceutical composition of claim 30, wherein the antibody is a polyclonal antibody.
PCT/US2001/004384 2000-02-08 2001-02-08 Immunotherapy using interleukin 13 receptor subunit alpha 2 WO2001058479A1 (en)

Priority Applications (4)

Application Number Priority Date Filing Date Title
CA002398136A CA2398136A1 (en) 2000-02-08 2001-02-08 Immunotherapy using interleukin 13 receptor subunit alpha 2
AU2001236892A AU2001236892A1 (en) 2000-02-08 2001-02-08 Immunotherapy using interleukin 13 receptor subunit alpha 2
JP2001557587A JP2004511425A (en) 2000-02-08 2001-02-08 Interleukin 13 receptor subunit alpha-2 used for immunotherapy
EP01909106A EP1257289A1 (en) 2000-02-08 2001-02-08 Immunotherapy using interleukin 13 receptor subunit alpha 2

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US18100000P 2000-02-08 2000-02-08
US60/181,000 2000-02-08

Publications (2)

Publication Number Publication Date
WO2001058479A1 WO2001058479A1 (en) 2001-08-16
WO2001058479A9 true WO2001058479A9 (en) 2002-10-31

Family

ID=22662463

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2001/004384 WO2001058479A1 (en) 2000-02-08 2001-02-08 Immunotherapy using interleukin 13 receptor subunit alpha 2

Country Status (6)

Country Link
US (7) US20020197266A1 (en)
EP (1) EP1257289A1 (en)
JP (1) JP2004511425A (en)
AU (1) AU2001236892A1 (en)
CA (1) CA2398136A1 (en)
WO (1) WO2001058479A1 (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9023338B2 (en) 2006-09-26 2015-05-05 Cedars-Sinai Medical Center Cancer stem cell antigen vaccines and methods
US9068020B2 (en) 2008-09-02 2015-06-30 Cedars-Sinai Medical Center CD133 epitopes
US9095538B2 (en) 2006-09-28 2015-08-04 Cedars-Sinai Medical Center Cancer vaccines and vaccination methods

Families Citing this family (138)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2398136A1 (en) 2000-02-08 2001-08-16 The Penn State Research Foundation Immunotherapy using interleukin 13 receptor subunit alpha 2
WO2002017968A2 (en) * 2000-08-31 2002-03-07 The Government Of The United States Of America, As Represented By The Secretary Of The Department Of Health And Human Services Sensitization of cancer cells to immunoconjugate-induced cell death by transfection with il-13 receptor alpha chain-2
JP2005508375A (en) * 2001-11-09 2005-03-31 ネオファーム、インコーポレイティッド Selective treatment of tumors expressing IL-13
AU2002254348B2 (en) * 2002-03-22 2007-12-06 The Penn State Research Foundation Cancer immunotherapy
WO2004087758A2 (en) * 2003-03-26 2004-10-14 Neopharm, Inc. Il 13 receptor alpha 2 antibody and methods of use
EA009285B1 (en) * 2003-05-14 2007-12-28 Иммуноджен, Инк. Drug conjugate composition
WO2005037995A2 (en) * 2003-10-06 2005-04-28 Cedars-Sinai Medical Center Use of cox-2 inhibitor to prevent t-cell anergy induced by dendritic cell therapy
JP5015601B2 (en) * 2003-10-21 2012-08-29 セダーズ−シナイ メディカル センター Systems and methods for the treatment of cancer, including cancer of the central nervous system
WO2006034334A2 (en) 2004-09-21 2006-03-30 University Of Pittsburgh Of The Commonwealth System Of Higher Education Peptide analogs capable of enhancing stimulation of a glioma-specific ctl response
CA2587903A1 (en) * 2004-11-17 2006-05-26 Amgen Fremont Inc. Fully human monoclonal antibodies to il-13
CA2597407C (en) * 2005-02-11 2013-09-10 Immunogen, Inc. Process for preparing stable drug conjugates
NZ623901A (en) * 2005-08-03 2015-10-30 Immunogen Inc Immunoconjugate formulations
AU2006283726C1 (en) 2005-08-24 2015-05-07 Immunogen, Inc. Process for preparing maytansinoid antibody conjugates
US7867977B2 (en) * 2005-11-03 2011-01-11 The United States Of America As Represented By The Department Of Health And Human Services Immunogenic peptides and methods of use for treating and preventing cancer
US7820174B2 (en) 2006-02-24 2010-10-26 The United States Of America As Represented By The Department Of Health And Human Services T cell receptors and related materials and methods of use
US8088379B2 (en) 2006-09-26 2012-01-03 The United States Of America As Represented By The Department Of Health And Human Services Modified T cell receptors and related materials and methods
US8216565B2 (en) * 2007-01-12 2012-07-10 The United States Of America, As Represented By The Secretary Of The Department Of Health And Human Services GP100-specific T cell receptors and related materials and methods of use
TWI573806B (en) 2008-04-17 2017-03-11 巴克斯歐塔公司 Biologically active peptides
WO2010075303A1 (en) 2008-12-23 2010-07-01 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Splicing factors with a puf protein rna-binding domain and a splicing effector domain and uses of same
WO2010075417A1 (en) 2008-12-23 2010-07-01 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Survivin specific t cell receptor for treating cancer
US8530167B2 (en) 2009-02-09 2013-09-10 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Diagnostic and therapeutic uses of GNPTAB, GNPTG, and NAGPA in stuttering
US9296785B2 (en) 2009-04-17 2016-03-29 Wake Forest University Health Sciences IL-13 receptor binding peptides
CN104984360A (en) 2009-06-03 2015-10-21 伊缪诺金公司 Conjugation methods
WO2011041093A1 (en) 2009-10-01 2011-04-07 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Anti-vascular endothelial growth factor receptor-2 chimeric antigen receptors and use of same for the treatment of cancer
EP2531210A1 (en) 2010-02-04 2012-12-12 The United States Of America As Represented By The Office of Technology Transfer, National Institutes Of Health Vaccine and methods of use against strongyloides stercoralis infection
WO2011116026A2 (en) 2010-03-15 2011-09-22 The Board Of Trustees Of The University Of Illinois Inhibitors of beta integrin-g protein alpha subunit binding interactions
WO2011119906A1 (en) 2010-03-26 2011-09-29 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services HUMAN POLYOMAVIRUS 6 (HPyV6) AND HUMAN POLYOMAVIRUS 7 (HPyV7)
CA2809362C (en) 2010-08-24 2020-03-10 University Of Pittsburgh - Of The Commonwealth System Of Higher Educatn Interleukin-13 receptor alpha 2 peptide-based brain cancer vaccines
EP2619223B1 (en) 2010-09-21 2019-04-10 The U.S.A. as represented by the Secretary, Department of Health and Human Services Anti-ssx-2 t cell receptors and related materials and methods of use
WO2012054825A1 (en) 2010-10-22 2012-04-26 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Anti-mage-a3 t cell receptors and related materials and methods of use
US9068993B2 (en) 2010-11-04 2015-06-30 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Diagnostic assays and methods of use for detection of filarial infection
WO2012087943A2 (en) 2010-12-20 2012-06-28 The Regents Of The University Of Michigan Inhibitors of the epidermal growth factor receptor-heat shock protein 90 binding interaction
RS58367B1 (en) 2011-03-29 2019-03-29 Immunogen Inc Preparation of maytansinoid antibody conjugates by a one-step process
MY171008A (en) 2011-03-29 2019-09-23 Immunogen Inc Preparation of maytansinoid antibody conjugates by a one-step process
CN103596981B (en) 2011-04-08 2017-06-16 美国卫生和人力服务部 Anti-epidermal growth factor receptor variant III Chimeric antigen receptors and its purposes for treating cancer
JP6100764B2 (en) 2011-06-09 2017-03-22 アメリカ合衆国 Pseudomonas exotoxin A having low immunogenic T cell and / or B cell epitopes
EP2755997B1 (en) 2011-09-15 2018-07-04 The United States of America, as represented by The Secretary, Department of Health and Human Services T cell receptors recognizing hla-a1- or hla-cw7-restricted mage
WO2013040141A1 (en) 2011-09-16 2013-03-21 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Pseudomonas exotoxin a with less immunogenic b cell epitopes
WO2013052933A2 (en) 2011-10-06 2013-04-11 The Board Of Trustees Of The University Of Illinois Myosin binding protein-c for use in methods relating to diastolic heart failure
BR112014008849A2 (en) 2011-10-20 2017-09-12 Us Health chimeric anti-cd22 antigen receptors
CA3116051C (en) 2012-03-23 2023-09-26 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Anti-mesothelin chimeric antigen receptors
EP3912634B1 (en) 2012-05-16 2023-10-04 Stemline Therapeutics Inc. Cancer stem cell targeted cancer vaccines
DK3636665T3 (en) 2012-09-14 2022-10-03 Us Health T CELL RECEPTORS THAT RECOGNIZE MHC CLASS II-RESTRICTED MAGE-A3
SG10201702737TA (en) 2012-10-04 2017-05-30 Immunogen Inc Use of a pvdf membrane to purify cell-binding agent cytotoxic agent conjugates
WO2014065961A1 (en) 2012-10-24 2014-05-01 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services M971 chimeric antigen receptors
US8975033B2 (en) 2012-11-05 2015-03-10 The Johns Hopkins University Human autoantibodies specific for PAD3 which are cross-reactive with PAD4 and their use in the diagnosis and treatment of rheumatoid arthritis and related diseases
CN104936621A (en) 2012-11-07 2015-09-23 辉瑞公司 Anti-iL-13 receptor alpha 2 antibodies and antibody-drug conjugates
US20140234351A1 (en) 2013-02-14 2014-08-21 Immunocellular Therapeutics, Ltd. Cancer vaccines and vaccination methods
WO2014152361A1 (en) 2013-03-15 2014-09-25 Wake Forest University Health Sciences Antibodies against human and canine il-13ra2
US9790282B2 (en) 2013-03-25 2017-10-17 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Anti-CD276 polypeptides, proteins, and chimeric antigen receptors
EP2989120A4 (en) 2013-04-25 2017-04-19 Carmel-Haifa University Economic Corp. Synthetic anti-inflammatory peptides and use thereof
CN110511960B (en) 2013-07-15 2023-05-23 美国卫生和人力服务部 Anti-human papilloma virus 16 E6T cell receptor
CA2926215A1 (en) 2013-10-06 2015-04-09 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Modified pseudomonas exotoxin a
EP3077416B1 (en) 2013-12-06 2019-06-19 The United States of America, as represented by The Secretary, Department of Health and Human Services Thymic stromal lymphopoietin receptor-specific chimeric antigen receptors and methods using same
EP3092252B1 (en) 2014-01-08 2019-09-18 The U.S.A. as represented by the Secretary, Department of Health and Human Services Antibody targeting cell surface deposited complement protein c3d and use thereof
US11648335B2 (en) 2014-01-31 2023-05-16 Wake Forest University Health Sciences Organ/tissue decellularization, framework maintenance and recellularization
US10189908B2 (en) 2014-02-05 2019-01-29 The University Of Chicago Chimeric antigen receptors recognizing cancer-specific TN glycopeptide variants
KR102618267B1 (en) 2014-05-29 2023-12-27 더 유나이티드 스테이츠 오브 어메리카, 애즈 리프리젠티드 바이 더 세크러테리, 디파트먼트 오브 헬쓰 앤드 휴먼 서비씨즈 Anti-human papillomavirus 16 e7 t cell receptors
WO2016003893A1 (en) 2014-06-30 2016-01-07 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Detection of colorectal cancer with two novel heme-related molecules in human feces
CA2961609C (en) 2014-09-17 2023-03-21 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Anti-cd276 antibodies (b7h3)
EP3215164A1 (en) 2014-11-03 2017-09-13 Immures S.r.l. T cell receptors
CA2966932A1 (en) 2014-11-19 2016-05-26 Immunogen, Inc. Process for preparing cell-binding agent-cytotoxic agent conjugates
CN107835820B (en) 2015-01-26 2021-10-15 芝加哥大学 CAR T-cells recognizing cancer-specific IL13R alpha 2
CN107683289B (en) 2015-01-26 2021-08-06 芝加哥大学 IL13R alpha 2 binding agents and their use in cancer treatment
CN108603170A (en) 2015-06-12 2018-09-28 莱蒂恩技术公司 With the method for engineered T cell treating cancer
CA3001306A1 (en) 2015-10-09 2017-04-13 Miltenyi Biotec Technology, Inc. Chimeric antigen receptors and methods of use
EP3156067A1 (en) 2015-10-16 2017-04-19 Max-Delbrück-Centrum Für Molekulare Medizin High avidity hpv t-cell receptors
RS65120B1 (en) 2015-11-25 2024-02-29 Immunogen Inc Pharmaceutical formulations and methods of use thereof
TW201731532A (en) 2016-02-05 2017-09-16 伊繆諾金公司 Efficient process for preparing cell-binding agent-cytotoxic agent conjugates
US11098132B2 (en) 2016-05-16 2021-08-24 Takeda Pharmaceutical Company Limited Anti-factor IX Padua antibodies
DE102016115246C5 (en) 2016-08-17 2018-12-20 Immatics Biotechnologies Gmbh NEW T-CELL RECEPTORS AND THEIR USE IN IMMUNOTHERAPY
HUE057094T2 (en) 2016-08-17 2022-04-28 Immatics Biotechnologies Gmbh T cell receptors and immune therapy using the same
JP7160482B2 (en) 2016-09-02 2022-10-25 レンティジェン・テクノロジー・インコーポレイテッド Compositions and methods for treating cancer with DUOCAR
CN110049774A (en) 2016-10-07 2019-07-23 恩特罗姆公司 The microbiota sequence variants of tumor associated antigen epitope
EP3522915A2 (en) 2016-10-07 2019-08-14 Enterome S.A. Immunogenic compounds for cancer therapy
CN110022894B (en) * 2016-10-07 2024-01-19 恩特罗姆公司 Immunogenic compounds for cancer therapy
US11249082B2 (en) 2016-10-29 2022-02-15 University Of Miami Zika virus assay systems
DE102016123859B3 (en) 2016-12-08 2018-03-01 Immatics Biotechnologies Gmbh New T cell receptors and their use in immunotherapy
DE102016123847B3 (en) 2016-12-08 2018-04-05 Immatics Biotechnologies Gmbh New T cell receptors and their use in immunotherapy
LT3551221T (en) 2016-12-08 2022-02-10 Immatics Biotechnologies Gmbh Novel t cell receptors and immune therapy using the same
JP6706394B1 (en) 2017-01-09 2020-06-03 レンティジェン・テクノロジー・インコーポレイテッドLentigen Technology, Inc. Compositions and methods for treating cancer by anti-mesothelin immunotherapy
EP3354658A1 (en) 2017-01-25 2018-08-01 Max-Delbrück-Centrum für Molekulare Medizin in der Helmholtz-Gemeinschaft Novel t cell receptors and immune therapy using the same for the treatment of cancer and infectious diseases
DE102017106305A1 (en) 2017-03-23 2018-09-27 Immatics Biotechnologies Gmbh New T cell receptors and their use in immunotherapies against prame-positive cancers
AU2018240556A1 (en) 2017-03-24 2019-10-10 Lentigen Technology, Inc. Compositions and methods for treating cancer with anti-CD33 immunotherapy
US11390683B2 (en) 2017-05-18 2022-07-19 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Anti-mesothelin polypeptides and proteins
DE102017114737A1 (en) 2017-06-30 2019-01-03 Immatics Biotechnologies Gmbh New T cell receptors and their use in immunotherapy
CA3071624A1 (en) 2017-07-31 2019-02-07 Lentigen Technology, Inc. Compositions and methods for treating cancer with anti-cd19/cd20 immunotherapy
DK3661954T3 (en) 2017-08-03 2022-04-19 Amgen Inc INTERLEUKIN-21 MUTEINS AND METHODS OF TREATMENT
US20210332141A1 (en) 2017-08-30 2021-10-28 Amgen Inc. Insulin-like growth factor-1 receptor (igf-1r) binding proteins and methods of use
US11788093B2 (en) 2017-09-07 2023-10-17 University Of Florida Research Foundation, Inc. Chimeric antigen receptor t-cells expressing interleukin-8 receptor
IL293443A (en) 2017-09-08 2022-07-01 Amgen Inc Inhibitors of kras g12c and methods of using the same
ES2960419T3 (en) 2017-09-15 2024-03-04 Lentigen Tech Inc Compositions and methods of cancer treatment with anti-CD19 immunotherapy
SG11202002114RA (en) 2017-09-18 2020-04-29 Univ California Claudin6 antibodies and methods of treating cancer
WO2019079249A1 (en) 2017-10-16 2019-04-25 Lentigen Technology, Inc. Compositions and methods for treating cancer with anti-cd22 immunotherapy
EP3480212B1 (en) 2017-11-03 2023-09-27 Consejo Superior De Investigaciones Científicas Il13ralpha2 peptide and its uses
DK3707159T3 (en) 2017-11-06 2023-04-11 Immatics Biotechnologies Gmbh PREVIOUSLY UNKNOWN MODIFIED T CELL RECEPTORS AND IMMUNE THERAPY USING THEREOF
DE102017125888A1 (en) 2017-11-06 2019-05-23 Immatics Biotechnologies Gmbh New engineered T cell receptors and their use in immunotherapy
WO2019108656A1 (en) 2017-11-28 2019-06-06 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Microbicidal composition
JP7377802B2 (en) 2017-12-20 2023-11-10 レンティジェン・テクノロジー・インコーポレイテッド Compositions and methods for treating HIV/AIDS using immunotherapy
US20210061876A1 (en) 2017-12-29 2021-03-04 Max-Delbrück-Centrum Für Molekulare Medizin In Der Helmholtz-Gemeinschaft T cell receptors for tumor specific proteasome splice variants and uses thereof
CR20200330A (en) 2018-01-12 2020-12-23 Amgen Inc Anti-pd-1 antibodies and methods of treatment
US11830582B2 (en) 2018-06-14 2023-11-28 University Of Miami Methods of designing novel antibody mimetics for use in detecting antigens and as therapeutic agents
JOP20200343A1 (en) 2018-07-02 2020-12-31 Xencor Inc Anti-steap1 antigen-binding protein
EP3827020A1 (en) 2018-07-24 2021-06-02 Amgen Inc. Combination of lilrb1/2 pathway inhibitors and pd-1 pathway inhibitors
AU2019343184A1 (en) 2018-09-20 2021-04-15 Lentigen Technology, Inc. Compositions and methods for treating cancer with anti-CD123 immunotherapy
JP2022502043A (en) 2018-09-26 2022-01-11 レンティジェン・テクノロジー・インコーポレイテッドLentigen Technology, Inc. Compositions and Methods for Treating Cancer with Anti-CD19 / CD22 Immunotherapy
CN113412119A (en) 2018-11-30 2021-09-17 莱蒂恩技术公司 Compositions and methods for treating cancer with anti-CD 38 immunotherapy
MX2021008652A (en) 2019-01-18 2021-10-26 Janssen Biotech Inc Gprc5d chimeric antigen receptors and cells expressing the same.
JP2022524507A (en) 2019-03-06 2022-05-06 レンティジェン・テクノロジー・インコーポレイテッド Compositions and Methods for Treating Cancer with Self-Driven Chimeric Antigen Receptors
KR20210154158A (en) 2019-03-20 2021-12-20 더 리전트 오브 더 유니버시티 오브 캘리포니아 Claudin-6 Antibody and Drug Conjugates
EP3952886A1 (en) 2019-04-10 2022-02-16 Elevatebio Technologies, Inc Flt3-specific chimeric antigen receptors and methods of using the same
CA3140102A1 (en) 2019-05-30 2020-12-03 Dina SCHNEIDER Compositions and methods for treating cancer with anti-bcma immunotherapy
CN114174346A (en) 2019-07-26 2022-03-11 詹森生物科技公司 anti-HK 2 Chimeric Antigen Receptor (CAR)
CN112390894A (en) 2019-08-12 2021-02-23 广东东阳光药业有限公司 Chimeric antigen receptor and uses thereof
IL293046A (en) 2019-11-18 2022-07-01 Janssen Biotech Inc Anti-cd79 chimeric antigen receptors, car-t cells, and uses thereof
CA3160855A1 (en) 2019-12-09 2021-06-17 Adrian Wiestner Antibodies targeting cell surface deposited complement protein c3d and use thereof
US20220057381A1 (en) 2020-06-08 2022-02-24 Janssen Biotech, Inc. Cell-based assay for determining the in vitro tumor killing activity of chimeric antigen expressing immune cells
US11497770B2 (en) 2020-06-22 2022-11-15 Lentigen Technology, Inc. Compositions and methods for treating cancer with TSLPR-CD19 or TSLPR-CD22 immunotherapy
US20220064334A1 (en) 2020-07-17 2022-03-03 Janssen Biotech, Inc. Anti-idiotypic antibodies against anti-klk2 antibodies
WO2022013819A1 (en) 2020-07-17 2022-01-20 Janssen Biotech, Inc. Anti-idiotypic antibodies against anti-gprc5d antibodies
CA3171093A1 (en) 2020-11-05 2022-05-12 Dina SCHNEIDER Compositions and methods for treating cancer with anti-cd19/cd22 immunotherapy
JP2024504696A (en) 2021-01-20 2024-02-01 バイオアントレ エルエルシー CTLA4-binding proteins and methods of treating cancer
AU2022224508A1 (en) 2021-02-16 2023-10-05 Janssen Biotech, Inc. Materials and methods for enhanced linker targeting
EP4067371A1 (en) 2021-03-31 2022-10-05 Max-Delbrück-Centrum für Molekulare Medizin in der Helmholtz-Gemeinschaft T-cell receptors specific for hepatitis c virus peptides
EP4079753A1 (en) 2021-04-20 2022-10-26 Max-Delbrück-Centrum für Molekulare Medizin in der Helmholtz-Gemeinschaft T-cell receptors specific for both rac1- and rac2-derived mutated epitopes
JP2024514608A (en) 2021-04-15 2024-04-02 マックス-デルブリュック-ツェントルム フューア モレキュラーレ メディツィン イン デア ヘルムホルツ-ゲマインシャフト T cell receptor specific for both RAC1-derived and RAC2-derived mutant epitopes
CA3221929A1 (en) 2021-06-01 2022-12-08 Janssen Biotech, Inc Anti-idiotypic antibodies against anti-cd79b antibodies
TW202323276A (en) 2021-09-03 2023-06-16 瑞士伯恩大學 Compositions and methods for treating long qt syndrome
WO2023077343A1 (en) 2021-11-04 2023-05-11 Janssen Biotech, Inc. Bcma-targeted car-t cell therapy for multiple myeloma
WO2023081752A1 (en) 2021-11-04 2023-05-11 Janssen Biotech, Inc. Bcma-targeted car-t cell therapy for multiple myeloma
EP4223782A1 (en) 2022-02-07 2023-08-09 Max-Delbrück-Centrum für Molekulare Medizin in der Helmholtz-Gemeinschaft Novel t cell receptors and immune therapy using the same for the treatment of cancer
US11590169B1 (en) 2022-03-02 2023-02-28 Lentigen Technology, Inc. Compositions and methods for treating cancer with anti-CD123 immunotherapy
US20230338424A1 (en) 2022-03-02 2023-10-26 Lentigen Technology, Inc. Compositions and Methods for Treating Cancer with Anti-CD123 Immunotherapy
WO2023240287A1 (en) 2022-06-10 2023-12-14 Bioentre Llc Combinations of ctla4 binding proteins and methods of treating cancer
WO2024026107A2 (en) 2022-07-28 2024-02-01 Lentigen Technology, Inc. Chimeric antigen receptor therapies for treating solid tumors
WO2024040020A1 (en) 2022-08-15 2024-02-22 Absci Corporation Quantitative affinity activity specific cell enrichment
US20240075142A1 (en) 2022-08-26 2024-03-07 Lentigen Technology, Inc. Compositions and Methods for Treating Cancer with Fully Human Anti-CD20/CD19 Immunotherapy
WO2024050526A1 (en) 2022-09-02 2024-03-07 Biomarin Pharmaceutical Inc. Compositions and methods for treating long qt syndrome

Family Cites Families (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6004554A (en) * 1992-03-05 1999-12-21 Board Of Regents, The University Of Texas System Methods for targeting the vasculature of solid tumors
WO1993024640A2 (en) * 1992-06-04 1993-12-09 The Regents Of The University Of California Methods and compositions for in vivo gene therapy
US5614191A (en) * 1995-03-15 1997-03-25 The United States Of America As Represented By The Department Of Health And Human Services IL-13 receptor specific chimeric proteins and uses thereof
FR2742156A1 (en) * 1995-12-06 1997-06-13 Sanofi Sa IL-13 RECEPTOR POLYPEPTIDE
US5710023A (en) * 1996-03-01 1998-01-20 Genetics Institute, Inc. IL-13 cytokine receptor chain
WO1997047741A1 (en) * 1996-06-12 1997-12-18 Smithkline Beecham Corporation Hr-1 receptor
ATE243045T1 (en) * 1997-11-20 2003-07-15 Vical Inc TREATMENT OF CANCER BY USING CYTOKINE-EXPRESSING POLYNUCLEOTIDES AND COMPOSITIONS THEREOF
IL125608A0 (en) * 1998-07-30 1999-03-12 Yeda Res & Dev Tumor associated antigen peptides and use of same as anti-tumor vaccines
CA2398136A1 (en) 2000-02-08 2001-08-16 The Penn State Research Foundation Immunotherapy using interleukin 13 receptor subunit alpha 2
WO2002097114A2 (en) 2001-05-29 2002-12-05 Sirna Therapeutics, Inc. Nucleic acid treatment of diseases or conditions related to levels of ras, her2 and hiv
US7195916B2 (en) * 2001-09-13 2007-03-27 California Institute Of Technology Method for expression of small antiviral RNA molecules within a cell
US20040248296A1 (en) 2002-03-20 2004-12-09 Beresford Paul J. HIV therapeutic

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9023338B2 (en) 2006-09-26 2015-05-05 Cedars-Sinai Medical Center Cancer stem cell antigen vaccines and methods
US9095538B2 (en) 2006-09-28 2015-08-04 Cedars-Sinai Medical Center Cancer vaccines and vaccination methods
US9433667B2 (en) 2006-09-28 2016-09-06 Cedars-Sinai Medical Center Cancer vaccines and vaccination methods
US9068020B2 (en) 2008-09-02 2015-06-30 Cedars-Sinai Medical Center CD133 epitopes
US9382308B2 (en) 2008-09-02 2016-07-05 Cedars-Sinai Medical Center CD133 epitopes

Also Published As

Publication number Publication date
US20110110955A1 (en) 2011-05-12
AU2001236892A1 (en) 2001-08-20
US20080131448A1 (en) 2008-06-05
WO2001058479A1 (en) 2001-08-16
US20020197266A1 (en) 2002-12-26
CA2398136A1 (en) 2001-08-16
US20080206255A1 (en) 2008-08-28
US20110280885A1 (en) 2011-11-17
EP1257289A1 (en) 2002-11-20
JP2004511425A (en) 2004-04-15
US7960361B2 (en) 2011-06-14
US8435534B2 (en) 2013-05-07
US7338929B2 (en) 2008-03-04
US20020182219A1 (en) 2002-12-05
US20080166374A1 (en) 2008-07-10

Similar Documents

Publication Publication Date Title
US7338929B2 (en) Cancer immunotherapy
Kass et al. Induction of protective host immunity to carcinoembryonic antigen (CEA), a self-antigen in CEA transgenic mice, by immunizing with a recombinant vaccinia-CEA virus
US10799553B2 (en) Composition comprising a nucleotide sequence encoding an ELA2 fusion protein and plasmacytoid dendritic cells
IL142216A (en) Polypeptide containing an immunogenic portion of a native wti and pharmaceutical compositions containing the same
JP2002504334A (en) COMPOSITIONS COMPRISING OX-40 RECEPTOR BINDING FACTOR OR NUCLEIC ACID ENCODING THEREOF AND METHODS FOR ENHANCED ANTIGEN-SPECIFIC IMMune RESPONSE
US8076091B2 (en) Gene encoding a multidrug-resistance human P-glycoprotein homologue on chromosome 7P15-21 and uses thereof
US8258261B2 (en) Induction of tumor immunity by variants of folate binding protein
Song et al. IL-12 plasmid-enhanced DNA vaccination against carcinoembryonic antigen (CEA) studied in immune-gene knockout mice
AU2002254348B2 (en) Cancer immunotherapy
US20040265274A1 (en) Anti-tumor molecular vaccine and method of making thereof
Neglia et al. DNA vaccination against the ovarian carcinoma-associated antigen folate receptor α (FRα) induces cytotoxic T lymphocyte and antibody responses in mice
CA2815125C (en) Her2 dna vaccine as adjunct treatment for cancers in companion animals
US20080095789A1 (en) Vaccine
EP1356820A1 (en) DNA vaccine combined with an inducer of tumor cell apoptosis
CN100400100C (en) Methods for preventing or attenuating patthoangiogenic conditions
JP2018536002A (en) Vaccination with MICA / B alpha 3 domain for cancer treatment
Penichet et al. A murine B cell lymphoma expressing human HER2/neu undergoes spontaneous tumor regression and elicits antitumor immunity
US20100068263A1 (en) Method and Compositions for Stimulation of an Immune Response to TRP2 using a Xenogeneic TRP2 Antigen
WO1999053931A9 (en) Tumor cells with increased immunogenicity and uses thereof
Wu A unique tumor model and its application in the studies of a plasmid-based antigen-specific vaccine for cancer therapy
Ciesielski Epidermal growth factor receptor (EGFR) mutations and tumor-specific targeting of malignant glioma by vaccine-based immunotherapeutic approaches

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
WWE Wipo information: entry into national phase

Ref document number: 2398136

Country of ref document: CA

ENP Entry into the national phase

Ref country code: JP

Ref document number: 2001 557587

Kind code of ref document: A

Format of ref document f/p: F

WWE Wipo information: entry into national phase

Ref document number: 2001909106

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2001236892

Country of ref document: AU

AK Designated states

Kind code of ref document: C2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: C2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

COP Corrected version of pamphlet

Free format text: PAGES 1/8-8/8, DRAWINGS, REPLACED BY NEW PAGES 1/8-8/8; PAGES 1-5, SEQUENCE LISTING, REPLACED BY NEW PAGES 1-5; DUE TO LATE TRANSMITTAL BY THE RECEIVING OFFICE

WWP Wipo information: published in national office

Ref document number: 2001909106

Country of ref document: EP

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWW Wipo information: withdrawn in national office

Ref document number: 2001909106

Country of ref document: EP