WO2002020812A1 - Genetic engineering of syringyl-enriched lignin in plants - Google Patents

Genetic engineering of syringyl-enriched lignin in plants Download PDF

Info

Publication number
WO2002020812A1
WO2002020812A1 PCT/US2001/027534 US0127534W WO0220812A1 WO 2002020812 A1 WO2002020812 A1 WO 2002020812A1 US 0127534 W US0127534 W US 0127534W WO 0220812 A1 WO0220812 A1 WO 0220812A1
Authority
WO
WIPO (PCT)
Prior art keywords
plant
sequence
gene
sad
lignin
Prior art date
Application number
PCT/US2001/027534
Other languages
French (fr)
Inventor
Vincent Lee C. Chiang
Laigeng Li
Original Assignee
Board Of Control Of Michigan Technological University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Board Of Control Of Michigan Technological University filed Critical Board Of Control Of Michigan Technological University
Priority to BR0113654-2A priority Critical patent/BR0113654A/en
Priority to JP2002525819A priority patent/JP2004520015A/en
Priority to IL15475901A priority patent/IL154759A0/en
Priority to AU2001288765A priority patent/AU2001288765B2/en
Priority to EP01968521A priority patent/EP1320617A4/en
Priority to AU8876501A priority patent/AU8876501A/en
Priority to CA002421215A priority patent/CA2421215A1/en
Publication of WO2002020812A1 publication Critical patent/WO2002020812A1/en
Priority to IL154759A priority patent/IL154759A/en

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004Oxidoreductases (1.)
    • C12N9/0006Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8243Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
    • C12N15/8245Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine involving modified carbohydrate or sugar alcohol metabolism, e.g. starch biosynthesis
    • C12N15/8246Non-starch polysaccharides, e.g. cellulose, fructans, levans
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8243Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
    • C12N15/8255Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine involving lignin biosynthesis

Definitions

  • the invention relates to a novel DNA sequence, which encodes a previously unidentified lignin biosynthetic pathway enzyme, sinapyl alcohol dehydrogenase (SAD), that regulates the biosynthesis of syringyl lignin in plants.
  • SAD sinapyl alcohol dehydrogenase
  • Lignin a complex phenolic polymer
  • angiosperm and gymnosperm trees which, in turn, are the principal sources of fiber for making paper and cellulosic products.
  • Lignin generally constitutes about 25% of the dry weight of the wood, making it the second most abundant organic compound on earth after cellulose. Lignin provides rigidity to wood for which it is well suited due, in part, to its resistance to biochemical degradation.
  • lignin is nonetheless problematic to post-harvest, cellulose-based wood/crop processing for fiber, chemical, and energy production because it must be removed or degraded from cellulose at great expense.
  • lignin In angiosperms, lignin is composed of a mixture of guaiacyl and syringyl monolignols, and can be degraded at considerably less energy and chemical cost than gymnosperm lignin, which consists almost entirely of guaiacyl moieties (Freudenberg, 1965). It has been estimated that, if syringyl lignin through genetic engineering, could be incorporated into gymnosperm guaiacyl lignin or into angiosperms to increase the syringyl lignin content, the annual saving in processing of such genetically engineered plants as opposed to their wild types would be in the range of $6 to $10 billion in the U.S. alone.
  • This partial syringyl monolignol pathway which diverges from guaiacyl pathway at coniferaldehyde, is mediated by genes encoding the enzymes coniferyl aldehyde 5-hydroxylase (CAld5H) (Osakabe et al, 1999) and S-adenosyl-L-methionine (SAM)-dependent 5-hydroxyconiferaldehyde O- methyltransferase (AldOMT) (Li et al, 2000), respectively, for the formation of sinapaldehyde (see, Fig. 1).
  • CAld5H coniferyl aldehyde 5-hydroxylase
  • SAM S-adenosyl-L-methionine
  • AldOMT al-methyltransferase
  • sinapaldehyde must be enzymatically converted into sinapyl alcohol, the syringyl monolignol, for the biosynthesis of syringyl lignin in plants (see, Fig. 1).
  • the gene encoding such an enzyme i.e., a sinapyl alcohol dehydrogenase (SAD)
  • SAD sinapyl alcohol dehydrogenase
  • the present invention provides an isolated complete DNA sequence encoding a novel enzyme, sinapyl alcohol dehydrogenase, SAD, that is obligatory to and plays a dominant role in the biosynthesis of syringyl lignin in plants.
  • SAD catalyzes the conversion of sinapaldehyde to sinapyl alcohol, the syringyl monolignol.
  • the production of SAD, and hence, the production of syringyl monolignol may be increased by supplying extra copies of the SAD gene, or decreased by insertion of the SAD gene or a portion thereof into the genome of a plant, in antisense orientation so that the amount of
  • the invention provides whole gymnosperm plants containing genes which increase production of syringyl lignin and repress production of guaiacyl lignin.
  • the invention addresses the problem of providing gymnosperm species which are easier to delignify in pulping processes.
  • the invention provides a method for making an expression cassette insertable into a gymnosperm cell for the purpose of inducing formation of syringyl lignin in a gymnosperm plant derived from the cell.
  • the present invention provides a method for modifying genes involved in lignin biosynthesis in gymnosperm species so that production of syringyl lignin is increased while production of guaiacyl lignin is suppressed.
  • the invention advantageously identifies, isolates, and/or clones those genes in angiosperms responsible for production of syringyl lignin.
  • the invention also advantageously provides for identification and isolation of a polynucleotide encoding a sinapyl alcohol dehydrogenase (SAD) from an angiosperm species and for the use of such polynucleotide to alter the lignin biosynthesis in a gymnosperm.
  • SAD sinapyl alcohol dehydrogenase
  • Figure 1 is a schematic representation of plant monolignol pathways for production of coniferyl alcohol and sinapyl alcohol;
  • Figure 2 illustrates a SAD polynucleotide DNA sequence (SEQ ID NO: 1) and its corresponding SAD amino acid sequence (SEQ ID NO: 2), Figure 2A and 2B respectively;
  • Figure 3 is a phylogenetic analysis of Aspen SAD and plant CADs;
  • Figure 4 illustrates molecular characterization of Aspen PtCAD and PtS AD
  • Figure 5 illustrates HPLC-UV/MS analysis of recombinant PtCAD and PtSAD reactions
  • Figure 6 illustrates inhibition kinetics of PtCAD and PtSAD
  • Figure 7 illustrates the location of guaiacyl and syringyl lignins in Aspen stem;
  • Figure 8 illustrates the immunolocalization of PtCAld5H, and PtSAD proteins in Aspen stem;
  • Figure 9 illustrates the immuno-reactivity of CAD and SAD proteins in various plants.
  • the present invention relates to a gene that encodes sinapyl alcohol dehydrogenase (SAD), the last key enzyme in syringyl monolignol biosynthesis and provides an isolated complete DNA sequence encoding the novel enzyme, SAD.
  • SAD sinapyl alcohol dehydrogenase
  • the invention further provides a method of altering the lignin composition, i.e., producing syringyl-enriched lignin in plants, by transforming the plants with the SAD gene wherein the gene is expressed and causes an increased syringyl content of the lignin polymer.
  • the present invention is of particular value to the paper and pulp industries because lignin containing higher syringyl monomer content is more susceptible to chemical delignification.
  • lignin containing higher syringyl monomer content is more susceptible to chemical delignification.
  • vast amounts of energy and time are consumed in the delignification process.
  • Woody plants transformed with an active SAD gene offer a significant advantage in the delignification process over conventional paper feedstocks.
  • modification of the lignin composition in grasses by the insertion and expression of a heterologous SAD gene offers a unique method for increasing the digestibility of grasses and is of significant potential economic benefit to the farm and agricultural industries.
  • the invention provides a gene and a DNA construct useful for the transformation of plant tissue to alter the lignin monomer composition.
  • Plants suitable for transformation in accordance with the present invention include plants that naturally lack syringyl lignin or those that accumulate lignin with a high guaiacyl-syringyl ratio. Plants also suitable for transformation in accordance with the present invention include plants whose lignin could be modified using antisense transformation constructs that reduce the syringyl contents of the transgenic plants' lignin if such an alteration is desirable. Specifically, suitable plants include, but are not limited to gymnosperms, angiosperms, grasses, legumes, forage crops and the like.
  • gene refers to a nucleic acid fragment that expresses a specific protein including the regulatory sequences preceding (5' noncoding) and following (3' noncoding) the coding region.
  • “Native” gene refers to the gene as found in nature with its own regulatory sequences.
  • Non-coding region refers to that portion of the gene that does not directly encode a polypeptide. The boundaries of the non-coding region are located before the start codon and after the stop codon. The non-coding region includes the untranslated regions of the genomic DNA.
  • Endogenous gene refers to the native gene normally found in its natural location in the genome.
  • Transgene refers to a gene that is introduced by gene transfer into the host organism.
  • Coding sequence refers to that portion of the gene that contains the information for encoding a polypeptide.
  • the boundaries of the coding sequence are determined by a start codon at the 5' (amino) terminus and a translation stop codon at the 3' (carboxyl) terminus.
  • a coding sequence can include, for example, prokaryotic sequences, cDNA from eukaryotic mRNA, genomic DNA, and even synthetic DNA sequences.
  • Promoter refers to a DNA sequence, in a given gene, which sequence controls the expression of the coding sequence by providing the recognition site for RNA polymerase and other factors required for proper transcription. Most genes have regions of DNA sequence that are promoter sequences which regulate gene expression. Promoter regions are typically found in the 5' flanking DNA sequence upstream from the coding sequence in both prokaryotic and eukaryotic cells. A promoter sequence provides for regulation of transcription of the downstream gene sequence and typically includes from about 50 to about 2000 nucleotide base pairs. Promoter sequences also contain regulatory sequences such as enhancer sequences that can influence the level of gene expression. Some isolated promoter sequences can provide for gene expression of heterologous DNAs, that is DNA different from the natural homologous DNA.
  • Promoter sequences are also known to be strong or weak or inducible.
  • a strong promoter provides for a high level of gene expression, whereas a weak promoter provides for a very low level of gene expression.
  • An inducible promoter is a promoter that provides for turning on and off of gene expression in response to an exogenously added agent or to an environmental or developmental stimulus.
  • An isolated promoter sequence that is a strong promoter for heterologous DNAs is advantageous because it provides for a sufficient level of gene expression to allow for easy detection and selection of transformed cells, and provides for a high level of gene expression when desired.
  • a promoter may also contain DNA sequences that are involved in the binding of protein factors which control the effectiveness of transcription initiation in response to physiological or developmental conditions.
  • Regulatory sequence(s) refers to nucleotide sequences located upstream (5'), within, and/or downstream (3') of a coding sequence, which control the transcription and/or expression of the coding sequences in conjunction with the protein biosynthetic apparatus of the cell. Regulatory sequences include promoters, translation leader sequences, transcription termination sequences and polyadenylation sequences.
  • Encoding and “coding” refer to the process by which a gene, through the mechanisms of transcription and translation, provides the information to a cell from which a series of amino acids can be assembled into a specific amino acid sequences to produce an active enzyme.
  • the process of encoding a specific amino acid sequence includes DNA sequences that may involve base changes that do not cause a change in the encoded amino acid, or which involve base changes which may alter one or more amino acids, but do not affect the functional properties of the protein encoded by the DNA sequence. It is therefore understood that the invention encompasses more than the specific exemplary sequences. Modifications to the sequences, such as deletions, insertions or substitutions in the sequence which produce silent changes that do not substantially affect the functional properties of the resulting protein molecule are also contemplated. For example, alterations in the gene sequence which reflect the degeneracy of the genetic code, or which result in the production of a chemically equivalent amino acid at a given site, are contemplated.
  • a codon for the amino acid alanine, a hydrophobic amino acid may be substituted by a codon encoding another less hydrophobic residue, such as glycine, or a more hydrophobic residue, such as valine, leucine or isoleucine.
  • a codon encoding another less hydrophobic residue such as glycine
  • a more hydrophobic residue such as valine, leucine or isoleucine.
  • changes which result in substitution of one negatively charged residue for another such as aspartic acid for glutamic acid, or one positively charged residue for another, such as lysine for arginine, can also be expected to produce a biologically equivalent product.
  • Nucleotide changes which result in alteration of the N- terminal and C-terminal portions of the protein molecule would also not be expected to alter the activity of the protein.
  • sequences encompassed by this invention are also defined by their ability to hybridize, under stringent condition, with the sequences exemplified herein. “Expression” is meant to refer to the production of a protein product encoded by a gene. “Overexpression” refers to the production of a gene product in transgenic organisms that exceed levels of production in normal or non-transformed organisms.
  • “Functional portion” or “functional fragment” or “functional equivalent” of an enzyme is that portion, fragment, or equivalent which contains the active site for binding one or more reactants or is capable of improving or regulating the rate of reaction.
  • the active site may be made up of separate portions present on one or more polypeptide chains and will generally exhibit high substrate specificity.
  • Enzyme encoded by a nucleotide sequence includes enzymes encoded by a nucleotide sequence which includes partial isolated DNA sequences.
  • Transformation refers to the transfer of a foreign gene into the genome of a host organism and its genetically stable inheritance.
  • % identity refers to the percentage of the nucleotides/amino acids of one polynucleotide/polypeptide that are identical to the nucleotides/amino acids of another sequence of polynucleotide/polypeptide as identified by a program such as GAP from Genetics Computer Group Wisconsin (GCG) package (version 9.0) (Madison, WI). GAP uses the algorithm of Needleman and Wunsch (J. Mol. Biol. 48: 443-453, 1970) to find the alignment of two complete sequences that maximizes the number of matches and minimizes the number of gaps. When parameters required to run the above algorithm are not specified, the default values offered by the program are contemplated.
  • Substantial homology refers to a 70% or more similarity or 70% homology wherein "% similarity” or “% homology” between two polypeptide sequences is a function of the number of similar positions shared by two sequences on the basis of the scoring matrix used divided by the number of positions compared and then multiplied by 100. This comparison is made when two sequences are aligned (by introducing gaps if needed) to determine maximum homology.
  • the PowerBlast program implemented by the National Center for Biotechnology Information, can be used to compute optimal, gapped alignments.
  • GAP program from Genetics Computer Group Wisconsin package (version 9.0) (Madison, WI) can also be used.
  • “Lignin monomer composition” refers to the relative ratios of guaiacyl monomer and syringyl monomer found in lignified plant tissue. "Plant” includes whole plants and portions of plants, including plant organs (e.g., roots, stems, leaves, etc).
  • Angiosperm refers to plants that produce seeds encased in an ovary.
  • Angiosperm is Liquidambar styraciflua (L.)[sweetgum].
  • Gymnosperm refers to plants that produce naked seeds, i.e., seeds that are not encased in an ovary.
  • a specific example of a gymnosperm is Pinus taeda (L.)[loblolly pine].
  • isolated and/or purified in reference to a nucleic acid molecule or polypeptide are meant to refer to in vitro isolation of a nucleic acid or polypeptide molecule from its natural cellular environment, and from association with other components of the cell so that it can be sequenced, replicated and/or expressed.
  • Vector is a recombinant nucleic acid construct, such as a plasmid, phage, genome, virus genome, cosmid, or artificial chromosome, to which a polynucleotide of the present invention may be attached.
  • the vector may bring about the replication of the attached segment, e.g., in the case of a cloning vector.
  • Stinapyl alcohol dehydrogenase or “SAD” refers to the enzyme in the plant phenylpropanoid biosynthetic pathway, which catalyzes the conversion of sinapaldehyde to sinapyl alcohol and permits the production of syringyl lignin.
  • the SAD DNA sequence (Fig. 2A) was identified from quaking aspen, Populus tremuloides. It is understood that this sequence can be used as a probe to clone its equivalent (i.e., with substantial homology or substantial identity is defined herein) from any plant species by techniques (EST, PCR, RT-PCR, anti-SAD antibodies, anti-SAD polypeptide antibodies, etc.) well known in the art.
  • SAD DNA sequence is defined herein as any DNA sequences that encode enzymes capable of catalyzing specifically the conversion of sinapaldehyde into sinapyl alcohol according to the enzyme assay methods described herein.
  • the enzymes indicated for each of the reaction steps are: 4-coumaric acid 3-hydroxylase (C3H) which converts 4-coumarate (1) to caffeate (2); 4-coumarate-CoA ligase (4CL) converts caffeate (2) to caffeoyl CoA (3) which in turn is converted to feruloyl CoA (4) by caffeoyl-CoA O-methyltransferase (CCoAOMT); cinnamoyl-CoA reductase (CCR) converts feruloyl CoA (4) to coniferaldehyde (5); coniferyl alcohol dehydrogenase (CAD) converts coniferaldehyde (5) to the guaiacyl monolignol coniferyl alcohol (6); at coniferaldehyde (5), the pathway splits wherein coniferaldehyde (5) can also be converted to 5-hydroxyconiferaldehyde (7) by coniferaldeyde 5-hydroxylase (CA
  • the present invention is the first disclosure of a separate enzyme for the formation of sinapyl alcohol from sinapaldehyde.
  • CAD and SAD together regulate the quantity and composition of guaiacyl-syringyl lignin.
  • the present invention provides an isolated SAD protein and SAD cDNA clones, which can now be used to modify lignification.
  • SEQ ID NO 1 gives the sequence listing for the SAD cDNA from Populus tremuloides
  • SEQ ID NO 2 gives the sequence listing for the deduced SAD polypeptide.
  • Table 1 A comparison of the amino acid sequences of all reported CAD-like enzymes to the novel SAD enzyme of the present invention is provided in Table 1 below.
  • CAD has been characterized for several different species. The values listed in Table 1 indicate the percent amino acid identity. Table 1 illustrates that SAD exhibits only about 50% amino acid sequence identity to all other known CADs, demonstrating that SAD is a different and novel enzyme with different biochemical function from other CADs. Therefore, the
  • SAD protein sequence is phylogenetically distinguishable from the sequences of all currently known monolignol CADs.
  • a DNA construct which is a plant DNA having a promoter sequence, a coding region and a terminator sequence.
  • the coding region encodes the SAD enzyme essential to lignin biosynthesis.
  • the coding region is suitably a minimum size of 50 bases.
  • the gene promoter is positioned at the 5'- end of a transgene (the transgene may be SAD alone or SAD together with another enzyme from the plant monolignols as described hereinafter) for controlling the transgene expression and a gene termination sequence that is located at the 3'-end of the transgene for signaling the end of the transcription of the transgene.
  • the DNA construct in accordance with the present invention is suitably incorporated into the genome of a plant by transformation to alter lignin biosynthesis, e.g., to provide syringyl-enriched lignin.
  • the DNA construct may include clones provided herein, namely PtXAD (later renamed PtSAD), described hereinafter, and variants thereof such as are permitted by the degeneracy of the genetic code or the functional equivalents thereof.
  • the DNA constructs of the present invention may be inserted into plants to regulate production of the SAD enzyme.
  • the production of the protein may be increased or reduced, either throughout or at particular stages in the life of the plant.
  • the orientation of the DNA coding sequence, promoter, and termination sequence can serve to either suppress lignin formation or amplify lignin formation.
  • the DNA is in the antisense orientation.
  • the DNA is in the sense orientation, thus to provide one or more additional copies of the DNA in the plant genome.
  • the DNA is suitably a full-length cDNA copy.
  • Constructs in accordance with the present invention may be used to transform cells of both monocotyledons and dicotyledons plants in various ways known in the art. In many cases, such plant cells may be cultured to regenerate whole plants which subsequently reproduce to give successive generations of genetically modified plants. Examples of plants that are suitably genetically modified in accordance with the present invention, include but are not limited to, trees such a aspen, poplar, pine and eucalyptus. Promoters and Termination Sequences
  • the promoter in a construct of the present invention can provide for expression of the linked DNA segment.
  • the promoter can also be inducible so that gene expression can be turned on or off by an exogenously added agent. It may also be preferable to combine the desired DNA segment with a promoter that provides tissue specific expression or developmentally regulated gene expression in plants.
  • the promoter may be selected from promoters known to operate in plants, e.g., CaMV35S, GPAL2, GPAL3 and endogenous plant promoter controlling expression of the SAD enzyme, i.e., the endogenous promoter of the SAD gene.
  • a constitutive promoter such as the CaMV35S promoter (Odell et al. 1985), or CaMV 19S (Lawton et al, 1987) can be used to drive the expression of the transgenes in all tissue types in a target plant.
  • Other promoters are nos (Ebert et al.
  • tissue specific promoter permits functions to be controlled more selectively.
  • the use of a tissue-specific promoter has the advantage that the SAD enzyme is only produced in the tissue in which its action is required.
  • tissue-specific promoters such as those that confine the expression of the transgenes in developing xylem where lignification occurs, may be used in the inventive DNA constructs.
  • a DNA segment can be combined with the promoter by standard methods as described in Sambrook et al, 2nd ed. (1982). Briefly, a plasmid containing a promoter such as the CaMV 35S promoter can be constructed as described in Jefferson (1987) or obtained from Clontech Lab, Palo Alto, California (e.g., pBI121 or pBI221). Typically, these plas ids are constructed to provide for multiple cloning sites having specificity for different restriction enzymes downstream from the promoter. The DNA segment can be subcloned downstream from the promoter using restriction enzymes to ensure that the DNA is inserted in proper orientation with respect to the promoter so that the DNA can be expressed.
  • the gene termination sequence is located 3' to the DNA sequence to be transcribed.
  • Various gene termination sequences known in the art may be used in the present inventive constructs. These include nopaline synthase (NOS) gene termination sequence (see, e.g., references cited in co-pending, commonly-owned PCT Application "Method to Introduce Multiple Genes into Plants", Serial No. PCT/US00/27704, filed
  • a marker gene may also be incorporated into the inventive DNA constructs to aid the selection of plant tissues with positive integration of the transgene.
  • Marker genes are genes that impart a distinct phenotype to cells expressing the marker gene and thus, allow such transformed cells to be distinguished from cells that do not have the marker.
  • suitable marker genes are known to the art and can be employed in the practice of the invention, such as neomycin phosphotransferase II (NPT II) gene that confers resistance to kanamycin or hygromycin antibiotics which would kill the non- transformed plant tissues containing no NPT ⁇ gene (Bevan et al, 1983).
  • NPT II neomycin phosphotransferase II
  • Numerous other exemplary marker genes are described in co-pending, commonly owned PCT Application "Method to Introduce Multiple Genes into Plants", Serial No. PCT/US00/27704, filed October 6, 2000, incorporated herein by reference.
  • Transformation of tissues or cells from plants, for instance, trees, with the inventive DNA construct and the subsequent production of transgenic plants can be achieved by a variety of techniques known in the art.
  • Agrobacterium- and microprojectile-mediated techniques for transferring a DNA construct into host plant tissues are particularly suitable for tree species (Tsai et al, 1994; Ellis et al 1993; and others described in co-pending, commonly owned PCT Application, PCT/US00/27704, filed October 6, 2000 "Method to introduce multiple genes into plants", incorporated herein by reference).
  • transgenic plant tissues resistant to, e.g., antibiotics, such as kanamycin can be selected and cultured to regenerate whole plants, using techniques also well known in the art (Tsai et al, 1994; Ellis et al. 1993; and others described in co-pending, commonly owned PCT Application, PCT/US00/27704( ⁇ /?ra)). Transformation and regeneration protocols are readily adaptable to many plant species. Many transformation and regeneration protocols have been published for plant species. (See, co-pending, commonly-owned PCT Application Serial No. PCT/USOO/27704 (supra)).
  • CAD coniferyl alcohol dehydrogenase
  • Fig. 1 A guaiacyl pathway gene encoding coniferyl alcohol dehydrogenase (CAD, Fig. 1) from Populus tremuloides (GenBank #AF217957) was first cloned. This cDNA was designated as PtCAD (GenBank #AF217957).
  • PtCAD GenBank #AF217957
  • CAD's substrate specificity for coniferaldehyde also confirms that there is a need for another enzyme, SAD of the present invention, in the biosynthesis of syringyl monolignol, sinapyl alcohol, as illustrated in Fig. 1.
  • a differential cloning strategy was designed to isolate candidate SAD genes based on their discernable sequences from that of CAD, as described above.
  • Low- and high-stringency differential screening (further described in Example 2 herein below) of 1.8 x 10 4 pfu from the Populus tremuloides xylem cDNA library using PtCAD cDNA as a probe resulted in the isolation of two groups of positive clones, based on sequence analysis, i.e., Group 1 sequences and Group U sequences.
  • Group I sequences of 12 clones were identical to PtCAD, and the sequences of group II cDNAs were identical to each other but different from PtCAD.
  • PtSAD cDNA SEQ ID NO: 1
  • SEQ ID NO: 2 is 1,446-b ⁇ long, encoding an ORF of 362 amino acids (SEQ ID NO: 2) with a calculated MW of 38,991 and a pi of 6.69.
  • Co-factor and zinc binding sequences identified in common alcohol dehydrogenases (ADHs) (Jornvall et al, 1987; O'Malley et al, 1992; Galliano et al, 1993) were found in PtSAD cDNA.
  • Znl binding motif and the structural Zn2 consensus were located at amino acid residues 71 to 85 and residues 91 to 117, respectively.
  • NADP-binding site was identified at residues 191 to 196.
  • PtSAD exhibited only about 50% amino acid sequence identity to all the other known full-length monolignol CADs (see, Table 1 supra). However, it showed insignificantly low amino acid sequence identity (10-40%) to those ADHs considered to be associated with pathogen-defense functions (Jornvall et al, 1987; Brill et al, 1999). These sequence characteristics confirm that PtSAD belongs to a novel class of ADHs, discernable from the commonly known monolignol CADs. This is fully supported by the phylogenetic analysis of PtSAD and available full-length monolignol CAD protein sequences showing that these monolignol CADs (Fig. 3) form a cluster distinctly separated from PtSAD.
  • This cluster of monolignol CADs is guaiacyl-specific in view of the extensive amino acid sequence similarity (-80 to 98%) of these genes with the guaiacyl-specific PtCAD and with CADs from loblolly pine and spruce, the single- copy gene involved in the biosynthesis of guaiacyl monolignol in gymnosperms (O'Malley et al, 1992; Galliano et al, 1993; MacKay et al. 1995).
  • the phylogenetic analysis may reflect an ancient divergence of the guaiacyl CAD phylogenetic group into a more syringyl-specialized one, to which PtSAD belongs.
  • PtSAD cDNA was expressed in E. coli to produce its recombinant protein.
  • HPLC-MS analysis of the enzyme reaction production demonstrated that PtSAD had a specific activity of 786 nmol/min/mg protein with coniferaldehyde.
  • PtSAD had a specific activity of 6964 nmol/min/mg protein with sinapaldehyde, indicating that the catalytic efficiency of PtSAD with sinapaldehyde is 9 times higher than with coniferaldehyde.
  • PtSAD is specific for sinapaldehyde and SAD sinapyl alcohol dehydrogenase catalyzes the conversion of sinapaldehyde to sinapyl alcohol.
  • CAD is guaiacyl-specific for the formation of guaiacyl monolignol, coniferyl alcohol, and SAD catalyzes the exclusive biosynthesis of syringyl monolignol, sinapyl alcohol.
  • SAD catalyzes the exclusive biosynthesis of syringyl monolignol, sinapyl alcohol.
  • SAD enzyme is essential for the biosynthesis of syringyl lignin in plants, and that the incorporation of an SAD gene into transgenic plants is a viable mechanism for successful engineering of syringyl lignin in plants.
  • Example 1 Isolation of SAD cDNA from aspen Populus tremuloides
  • An aspen developing xylem cDNA library was constructed in ⁇ gt22A vector according to manufacturer's protocols (GJJBCO BRL).
  • the aspen CAD cDNA (GenBank #AF217957) was used as a probe to differentially screen the cDNA library under high and low stringency hybridization conditions. About 6,000 pfu from the cDNA library were lifted onto 4 individual nylon membranes. Two such blotted membranes were hybridized with 32 P-labeled CAD cDNA probe under low stringency conditions (50°C) and the other two under high stringency (65°C). In this way, a total of 18,000 pfu were screened. High density hybridization signals were detected on membranes probed under either high or low stringency conditions.
  • low density signal were detected only on membranes probed under low stringency condition.
  • the high density signals on high stringency membrane were perfectly aligned with the high density signals on low stringency membrane, allowing a differential isolation of positive clones with low density signal.
  • the high density clones were confirmed to be aspen CAD cDNA.
  • the positives with low density signal were further screened until a single clone was isolated.
  • the purified ⁇ gt22A clones were then subcloned into pBluescriptS/K plasmid vector through Notl and EcoRI cloning sites.
  • This cDNA clone was first designated as PtXAD and then renamed as SAD after its biochemical function was confirmed.
  • CAD cDNA PtCAD
  • PtCAD CAD cDNA
  • Group I contained 12 cDNAs with sequences identical to PtCAD. Sequences of the eight cDNAs constituting group JJ were identical to each other but differed from PtCAD. Two of the eight clones in group II were full-length cDNAs and were tentatively named PtSAD.
  • the open reading frame of PtSAD was 1086 bp, encoding a 39-kD protein with a pi of 6.69.
  • the deduced amino acid sequence of PtSAD was 53% identical to that of PtCAD and -50% identical to that of other angiosperm monolignol CADs, but it exhibited insignificant identity (10 to 40%) with the sequences of alcohol dehydrogenases (ADHs) associated with pathogen defense (Brill et al, 1999).
  • PtCAD on the other hand, showed extensive amino acid sequence identity with CADs from Populus trichocarpa X Populus deltaides (97%) (PtCADA; Nan Doorsselaere et al, 1995), Eucalyptus gunnii (81%) (pEuCAD2; Grima-Pettenati et al, 1993), tobacco (82%) (pTCAD14; Knight et al, 1992), lucern (79%) (MsaCad2; Brill et al, 1999), and other reported angiosperms (-80%) (Brill et al, 1999). Therefore, PtSAD belongs to a novel class of ADHs.
  • RNA gel blot analysis was conducted to investigate the tissue-specific expression of PtCAD and PtSAD in aspen.
  • the greatest PtCAD expression was found in tissue types containing a large amount of lignifying xylem, but its expression was lower in phloem-enriched tissues (internodes 1 to 3; Figure 4C).
  • Protein gel blot analysis was also conducted to verify the tissue-specific expression of PtCAD and PtSAD.
  • Polyclonal antisera was obtained against affinity- purified PtCAD and PtSAD recombinant proteins produced in Eschenchia coli and protein gel blotting was used to verify the specificity of PtCAD and PtSAD antibodies against PtCAD and PtSAD recombinant proteins.
  • PtCAD antibody did not cross-react with PtSAD protein (Figure 4E)
  • PtSAD antibody did not cross-react with PtCAD protein ( Figure 4F).
  • the PtCAD protein exhibited the expected molecular mass of -39 kD and was more abundant in protein extracts from xylem than from phloem tissue ( Figure 4E). In contrast, the strongest signal using PtSAD antibody was detected in phloem protein extracts ( Figure 4F).
  • RNA and protein gel blot analyses consistently indicated that both PtCAD and PtSAD were associated with lignification. Strong PtSAD expression in syringyl lignin-enriched phloem (Grand et al, 1982) suggests a specialized role for PtSAD in syringyl monolignol biosynthesis. Therefore, characterized herein are the biochemical functions of the PtCAD and PtSAD genes.
  • the PCR product was cloned into the Ndel and Notl sites of pET23 b + vector (Novagen, Madison, WI) to fuse a His tag at the Carboxyl terminus of the cloned sequence.
  • the engineered pET23 b + construct was transferred into Eschenchia coli host strain BL21(DE3) (Novagen).
  • Induction and purification of recombinant PtCAD and PtSAD were performed as described (Li et al, 2000). Differentiating stem xylem was collected during the growing season from aspen, hophorn beam (Ostrya virginiana), yellow birch
  • the affinity-purified PtCAD and PtSAD recombinant proteins were used to immunize rabbits (Alpha Diagnostic, San Antonio, TX).
  • the antibodies diluted 1:3000, were used in protein gel blot analyses of xylem crude proteins (Osakabe et al, 1999). Protein concentrations were determined by the Bio-Rad protein assay system.
  • SAD enzyme activity assay The SAD enzyme reactions were conducted in a final volume of 300 ⁇ l containing 100 mM sodium phosphate buffer, 500 M substrate syringyl aldehyde (or coniferyl aldehyde), l ⁇ g recombinant SAD protein, 2.5 mM ⁇ -mercaptoethanol and 500 ⁇ M NADPH, with varying pHs (5.4, 6.0, 6.4, 7.0, 7.4, 8.0 or 8.4). After 10 min at 30°C, the reaction was terminated and extracted with 0.5 ml ethyl acetate.
  • the basic enzyme reaction mixture contained 50 mM sodium phosphate buffer, 5 mM ⁇ -mercaptoethanol, 500 ⁇ M NADPH or NADP, purified recombinant protein (boiled protein was used as a control), and phenolic substrate in a final volume of 500 ⁇ L
  • 500 ⁇ M aldehyde substrate and 1 ⁇ g of purified recombinant PtCAD or PtSAD protein (-25 pmol) were used.
  • the substrate and recombinant PtCAD or PtSAD protein concentrations described above were used in sodium phosphate buffers, pH 5 to 8.5. All reactions were for 10 minutes at 30 C.
  • reaction time was 4 min and pH was 8.0 for PtCAD (1.2 ⁇ g of purified recombinant protein) and 7.0 for PtSAD (0.1 ⁇ g).
  • concentrations 0.5 to 200 ⁇ M
  • concentrations 0.5 to 200 ⁇ M
  • -coumaraldehyde, caffealdehyde, coniferaldehyde, 5-hydroxyconiferaldehyde, or sinapaldehyde were used to measure K m , V max , and the enzyme turnover number, k cat .
  • the enzyme turnover number k cat .
  • the gradient program was 20% acetonitrile in lOmM formic acid, pH 2.5, for 12 min, 20 to 100% acetonitrile from 12 to 16 min, and hold at 100% acetonitrile for 5 to 10 min; detection was with an HP 1100 diode array detector and an HP 1100 liquid chromatography-MS detector system with an atmospheric pressure onization-electrospray source in negative ion mode.
  • the reaction products were identified and confirmed by comparing the ion fragmentation patterns of the product and the authentic standard in MS scanning mode at 70 V.
  • the product quantity and K, negligence, Vmax, kcat, and apparent inhibition constant (Ki) values (means ⁇ SE) were determined as described (Osakabe et al, 1999; Li et al, 2000).
  • the results of the inhibition kinetics for both the CAD enzyme (i.e. Table 2) and the SAD enzyme (i.e., Table 3) using a variety of substrates are illustrated below. Table 2
  • aldehydes and their alcohol derivatives were obtained from Sigma/ Aldrich, except the following: p-coumaraldehyde, p-coumaryl alcohol, caffealdehyde, caffeyl alcohol, 5-hydroxyconiferaldehyde, and 5-hydroxyconiferyl alcohol were prepared chemically from their corresponding benzaldehyde derivatives as described (Osakabe et al, 1999; Li et al, 2000). The structural identities of these compounds were confirmed by 1H-NMR. -Coumaraldehyde: ⁇ (acetone-d ⁇ ; standard carbon numbers were used)
  • Example 6 Histochemical Lignin Analysis, Immunolocalizatlon, and Microscopy
  • fresh hand-cut sections 20 ⁇ m thick) from stem internodes of 4-month-old, greenhouse-grown aspen plants (clone 271) were incubated immediately in freshly prepared saturated chlorinated water for 10 min at 4°C. After three washes with water, the sections were incubated in 4% sodium sulfite at room temperature for 5 min, mounted in 50% glycerol, and photographed using a Nikon (Tokyo, Japan) Eclipse 400 fluorescence microscope. Segments (-1 mm thick) from the same internodes used for histochemical analysis were used for immunolocalization on the basis of the protocol of Wittich et al.
  • the segments were fixed in 4% paraformaldehyde in 0.1 M PBS (4 mM sodium phosphate, pH 7.4, and 200mM NaCl) for 12 hr at 4°C. After washing in PBS for 2 hr at 4°C, the segments were dehydrated in an ethanol series, infiltrated, and embedded in butyl methyl methacrylate. Polymerization was performed under UN light (365 nm) for 40 hr at -20°C in a UNC2 CRYO Chamber (PELCO, Redding, CA). Sections (3 ⁇ m thick) were prepared with a Leica (wetzlar, Germany) RM 2155 microtome and mounted on Superfrost/plus (Fisher) slides.
  • PBS mM sodium phosphate, pH 7.4, and 200mM NaCl
  • Example 7 Histochemical and Chemical Detection of Guaiacyl and Syringyl Lignin Distributions in Aspen Stem Vascular Tissues
  • Guaiacyl-syringyl lignin appeared during the differentiation of secondary vascular systems, as indicated by the chemical analyses of stem internodes 5 and beyond (Figure 7H). However, the deposition of syringyl lignin in the secondary xylem followed that of guaiacyl lignin, as manifested by the color change from bright light brown to pink and then red in developing, partially lignified, and extensively lignified secondary xylem elements, respectively (Figure 7G). This is consistent with the reported sequential deposition of guaiacyl followed by syringyl lignins in xylem cells of angiosperms (Terashima et al, 1986; Saka and Goring, 1988).
  • PtSAD is in line with the guaiacyl and syringyl lignin deposition patterns in phloem and xylem elements.
  • PtCAd5H another syringyl pathway protein
  • Example 8 Irnmunolocalization of PtCAD, PtCAd5H, and PtSAD in Aspen Stem Internodes Conditions similar to those present during protein gel blot analyses, by which the specificities of PtCAD and PtSAD antibodies were verified ( Figures 4E and 4F), were applied to cellular irnmunolocalization.
  • PtSAD and PtCAld5H were visualized in tissue sections after the anti-rabbit IgG-alkaline phosphatase reaction with nitroblue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate substrate.
  • PtCAD signals were visualized with Fast Red substrate. Serial sections were analyzed.
  • PtCAd5H are associated with vascular elements containing enriched syringyl lignin.
  • angiosperm plants are genetically transformed with sense SAD gene driven by any appropriate promoter and via any appropriate genetic transformation system.
  • gymnosperm plants are genetically transformed with sense SAD genes driven by any appropriate promoter and via any appropriate genetic transformation system.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Chemical & Material Sciences (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Nutrition Science (AREA)
  • Cell Biology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Medicinal Chemistry (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

The present invention relates to a novel DNA sequence, which encodes a previously unidentified lignin biosynthetic pathway enzyme, sinapyl alcohol dehydrogenase (SAD) that regulates the biosynthesis of syringyl lignin in plants. Also provided are methods for incorporating this novel SAD gene sequence or substantially similar sequences into a plant genome for genetic engineering of syringyl-enriched lignin in plants.

Description

GENETIC ENGINEERING OF SYRINGYL-ENRICHED LIGNIN IN PLANTS
CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Application No. 60/230,086, filed on September 5, 2000, and is incorporated herein by reference.
STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT
This invention was made with United States Government support awarded by the
Energy Biosciences Program, and the United States Department of Agriculture, research grant numbers USDA 99-35103-7986, USDA 01-03749, and DOE DE-FG02- 01ER15179. The United States Government has certain rights in this invention.
BACKGROUND OF THE INVENTION
The invention relates to a novel DNA sequence, which encodes a previously unidentified lignin biosynthetic pathway enzyme, sinapyl alcohol dehydrogenase (SAD), that regulates the biosynthesis of syringyl lignin in plants. Methods for incorporating this novel SAD gene sequence or sequences similar to this SAD gene into plant genome for genetic engineering of syringyl-enriched lignin in plants are also provided.
Lignin, a complex phenolic polymer, is a major part of the supportive structure of most woody plants including angiosperm and gymnosperm trees which, in turn, are the principal sources of fiber for making paper and cellulosic products. Lignin generally constitutes about 25% of the dry weight of the wood, making it the second most abundant organic compound on earth after cellulose. Lignin provides rigidity to wood for which it is well suited due, in part, to its resistance to biochemical degradation.
Despite its importance to plant growth and structure, lignin is nonetheless problematic to post-harvest, cellulose-based wood/crop processing for fiber, chemical, and energy production because it must be removed or degraded from cellulose at great expense. Certain structural constituents of lignin, such as the guaiacyl moiety, promote monomer cross-linkages that increase lignin resistance to degradation (Sarkanen, 1971; Chang and Sarkanen, 1973; Chiang and Funaoka, 1990). In angiosperms, lignin is composed of a mixture of guaiacyl and syringyl monolignols, and can be degraded at considerably less energy and chemical cost than gymnosperm lignin, which consists almost entirely of guaiacyl moieties (Freudenberg, 1965). It has been estimated that, if syringyl lignin through genetic engineering, could be incorporated into gymnosperm guaiacyl lignin or into angiosperms to increase the syringyl lignin content, the annual saving in processing of such genetically engineered plants as opposed to their wild types would be in the range of $6 to $10 billion in the U.S. alone. Consequently, there has been long-standing incentive to understand the biosynthesis of syringyl monolignol to genetically engineer plants to contain more syringyl lignin, thus, facilitating wood/crop processing (Trotter, 1990; Bugos et al, 1991; Boudet et al, 1995; Hu et al, 1999). Although it has been known that syringyl lignin is derived from guaiacyl lignin, only a partial syringyl monolignol pathway and its genes encoding the enzymes that catalyze the steps of the pathway have been uncovered. This partial syringyl monolignol pathway, which diverges from guaiacyl pathway at coniferaldehyde, is mediated by genes encoding the enzymes coniferyl aldehyde 5-hydroxylase (CAld5H) (Osakabe et al, 1999) and S-adenosyl-L-methionine (SAM)-dependent 5-hydroxyconiferaldehyde O- methyltransferase (AldOMT) (Li et al, 2000), respectively, for the formation of sinapaldehyde (see, Fig. 1). However, sinapaldehyde must be enzymatically converted into sinapyl alcohol, the syringyl monolignol, for the biosynthesis of syringyl lignin in plants (see, Fig. 1). The gene encoding such an enzyme, i.e., a sinapyl alcohol dehydrogenase (SAD), has never been identified nor cloned and represents a missing gene that is indispensable for genetic engineering of syringyl lignin in plants. Thus, there is a need for the identification and isolation of this key gene (SAD) for genetic augmentation of syringyl monolignol biosynthesis in plants and for the methods for such genetic manipulation comprising the use of this key gene.
BRIEF SUMMARY OF THE INVENTION The present invention provides an isolated complete DNA sequence encoding a novel enzyme, sinapyl alcohol dehydrogenase, SAD, that is obligatory to and plays a dominant role in the biosynthesis of syringyl lignin in plants. SAD catalyzes the conversion of sinapaldehyde to sinapyl alcohol, the syringyl monolignol. The production of SAD, and hence, the production of syringyl monolignol may be increased by supplying extra copies of the SAD gene, or decreased by insertion of the SAD gene or a portion thereof into the genome of a plant, in antisense orientation so that the amount of
SAD for catalyzing the sinapyl alcohol is reduced, if so desired.
In one aspect, the invention provides whole gymnosperm plants containing genes which increase production of syringyl lignin and repress production of guaiacyl lignin. Thus the invention addresses the problem of providing gymnosperm species which are easier to delignify in pulping processes.
In another aspect, the invention provides a method for making an expression cassette insertable into a gymnosperm cell for the purpose of inducing formation of syringyl lignin in a gymnosperm plant derived from the cell. In an additional aspect, the present invention provides a method for modifying genes involved in lignin biosynthesis in gymnosperm species so that production of syringyl lignin is increased while production of guaiacyl lignin is suppressed.
The invention advantageously identifies, isolates, and/or clones those genes in angiosperms responsible for production of syringyl lignin. The invention also advantageously provides for identification and isolation of a polynucleotide encoding a sinapyl alcohol dehydrogenase (SAD) from an angiosperm species and for the use of such polynucleotide to alter the lignin biosynthesis in a gymnosperm.
BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 is a schematic representation of plant monolignol pathways for production of coniferyl alcohol and sinapyl alcohol;
Figure 2 illustrates a SAD polynucleotide DNA sequence (SEQ ID NO: 1) and its corresponding SAD amino acid sequence (SEQ ID NO: 2), Figure 2A and 2B respectively; Figure 3 is a phylogenetic analysis of Aspen SAD and plant CADs;
Figure 4 illustrates molecular characterization of Aspen PtCAD and PtS AD; Figure 5 illustrates HPLC-UV/MS analysis of recombinant PtCAD and PtSAD reactions;
Figure 6 illustrates inhibition kinetics of PtCAD and PtSAD; Figure 7 illustrates the location of guaiacyl and syringyl lignins in Aspen stem;
Figure 8 illustrates the immunolocalization of PtCAld5H, and PtSAD proteins in Aspen stem; Figure 9 illustrates the immuno-reactivity of CAD and SAD proteins in various plants.
DETAILED DESCRIPTION OF THE INVENTION The present invention relates to a gene that encodes sinapyl alcohol dehydrogenase (SAD), the last key enzyme in syringyl monolignol biosynthesis and provides an isolated complete DNA sequence encoding the novel enzyme, SAD. The invention further provides a method of altering the lignin composition, i.e., producing syringyl-enriched lignin in plants, by transforming the plants with the SAD gene wherein the gene is expressed and causes an increased syringyl content of the lignin polymer.
The present invention is of particular value to the paper and pulp industries because lignin containing higher syringyl monomer content is more susceptible to chemical delignification. Currently, vast amounts of energy and time are consumed in the delignification process. Woody plants transformed with an active SAD gene offer a significant advantage in the delignification process over conventional paper feedstocks. Similarly, modification of the lignin composition in grasses by the insertion and expression of a heterologous SAD gene offers a unique method for increasing the digestibility of grasses and is of significant potential economic benefit to the farm and agricultural industries. The invention provides a gene and a DNA construct useful for the transformation of plant tissue to alter the lignin monomer composition. Plants suitable for transformation in accordance with the present invention include plants that naturally lack syringyl lignin or those that accumulate lignin with a high guaiacyl-syringyl ratio. Plants also suitable for transformation in accordance with the present invention include plants whose lignin could be modified using antisense transformation constructs that reduce the syringyl contents of the transgenic plants' lignin if such an alteration is desirable. Specifically, suitable plants include, but are not limited to gymnosperms, angiosperms, grasses, legumes, forage crops and the like.
The terms used in this specification generally have their ordinary meanings in the art, within the context of the invention and in the specific context where each term is used. Certain terms are discussed below, or elsewhere in the specification, to provide additional guidance to the person of skill in the art in describing the compositions and methods of the invention and how to make and use them. It will be appreciated that the same thing can be said in more than one way. Consequently, alternative language and synonyms may be used for any one or more of the terms discussed herein, nor is any special significance to be placed upon whether or not a term is elaborated or discussed herein. Synonyms for certain terms are provided. A recital of one or more synonyms does not exclude the use of other synonyms. The use of examples anywhere in this specification, including examples of any terms discussed herein, is illustrative only, and in no way limits the scope and meaning of the invention or of any exemplified term.
Likewise, the invention is not limited to the preferred embodiments.
As used herein, "gene" refers to a nucleic acid fragment that expresses a specific protein including the regulatory sequences preceding (5' noncoding) and following (3' noncoding) the coding region. "Native" gene refers to the gene as found in nature with its own regulatory sequences.
"Non-coding region" refers to that portion of the gene that does not directly encode a polypeptide. The boundaries of the non-coding region are located before the start codon and after the stop codon. The non-coding region includes the untranslated regions of the genomic DNA.
"Endogenous gene" refers to the native gene normally found in its natural location in the genome.
"Transgene" refers to a gene that is introduced by gene transfer into the host organism.
"Coding sequence" refers to that portion of the gene that contains the information for encoding a polypeptide. The boundaries of the coding sequence are determined by a start codon at the 5' (amino) terminus and a translation stop codon at the 3' (carboxyl) terminus. A coding sequence can include, for example, prokaryotic sequences, cDNA from eukaryotic mRNA, genomic DNA, and even synthetic DNA sequences.
"Promoter" (or promoter sequence) refers to a DNA sequence, in a given gene, which sequence controls the expression of the coding sequence by providing the recognition site for RNA polymerase and other factors required for proper transcription. Most genes have regions of DNA sequence that are promoter sequences which regulate gene expression. Promoter regions are typically found in the 5' flanking DNA sequence upstream from the coding sequence in both prokaryotic and eukaryotic cells. A promoter sequence provides for regulation of transcription of the downstream gene sequence and typically includes from about 50 to about 2000 nucleotide base pairs. Promoter sequences also contain regulatory sequences such as enhancer sequences that can influence the level of gene expression. Some isolated promoter sequences can provide for gene expression of heterologous DNAs, that is DNA different from the natural homologous DNA. Promoter sequences are also known to be strong or weak or inducible. A strong promoter provides for a high level of gene expression, whereas a weak promoter provides for a very low level of gene expression. An inducible promoter is a promoter that provides for turning on and off of gene expression in response to an exogenously added agent or to an environmental or developmental stimulus. An isolated promoter sequence that is a strong promoter for heterologous DNAs is advantageous because it provides for a sufficient level of gene expression to allow for easy detection and selection of transformed cells, and provides for a high level of gene expression when desired. A promoter may also contain DNA sequences that are involved in the binding of protein factors which control the effectiveness of transcription initiation in response to physiological or developmental conditions. "Regulatory sequence(s)" refers to nucleotide sequences located upstream (5'), within, and/or downstream (3') of a coding sequence, which control the transcription and/or expression of the coding sequences in conjunction with the protein biosynthetic apparatus of the cell. Regulatory sequences include promoters, translation leader sequences, transcription termination sequences and polyadenylation sequences. "Encoding" and "coding" refer to the process by which a gene, through the mechanisms of transcription and translation, provides the information to a cell from which a series of amino acids can be assembled into a specific amino acid sequences to produce an active enzyme. It is understood that the process of encoding a specific amino acid sequence includes DNA sequences that may involve base changes that do not cause a change in the encoded amino acid, or which involve base changes which may alter one or more amino acids, but do not affect the functional properties of the protein encoded by the DNA sequence. It is therefore understood that the invention encompasses more than the specific exemplary sequences. Modifications to the sequences, such as deletions, insertions or substitutions in the sequence which produce silent changes that do not substantially affect the functional properties of the resulting protein molecule are also contemplated. For example, alterations in the gene sequence which reflect the degeneracy of the genetic code, or which result in the production of a chemically equivalent amino acid at a given site, are contemplated. Thus, a codon for the amino acid alanine, a hydrophobic amino acid, may be substituted by a codon encoding another less hydrophobic residue, such as glycine, or a more hydrophobic residue, such as valine, leucine or isoleucine. Similarly, changes which result in substitution of one negatively charged residue for another, such as aspartic acid for glutamic acid, or one positively charged residue for another, such as lysine for arginine, can also be expected to produce a biologically equivalent product. Nucleotide changes which result in alteration of the N- terminal and C-terminal portions of the protein molecule would also not be expected to alter the activity of the protein. In some cases, it may in fact be desirable to make mutants of the sequence to study the effect of retention of biological activity of the protein. Each of these proposed modifications is well within the routine skill in the art, as is the determination of retention of biological activity in the encoded products. Moreover, the skilled artisan recognizes that sequences encompassed by this invention are also defined by their ability to hybridize, under stringent condition, with the sequences exemplified herein. "Expression" is meant to refer to the production of a protein product encoded by a gene. "Overexpression" refers to the production of a gene product in transgenic organisms that exceed levels of production in normal or non-transformed organisms.
"Functional portion" or "functional fragment" or "functional equivalent" of an enzyme is that portion, fragment, or equivalent which contains the active site for binding one or more reactants or is capable of improving or regulating the rate of reaction. The active site may be made up of separate portions present on one or more polypeptide chains and will generally exhibit high substrate specificity.
"Enzyme encoded by a nucleotide sequence" includes enzymes encoded by a nucleotide sequence which includes partial isolated DNA sequences. "Transformation" refers to the transfer of a foreign gene into the genome of a host organism and its genetically stable inheritance.
"% identity" refers to the percentage of the nucleotides/amino acids of one polynucleotide/polypeptide that are identical to the nucleotides/amino acids of another sequence of polynucleotide/polypeptide as identified by a program such as GAP from Genetics Computer Group Wisconsin (GCG) package (version 9.0) (Madison, WI). GAP uses the algorithm of Needleman and Wunsch (J. Mol. Biol. 48: 443-453, 1970) to find the alignment of two complete sequences that maximizes the number of matches and minimizes the number of gaps. When parameters required to run the above algorithm are not specified, the default values offered by the program are contemplated.
"Substantial homology" or "substantial similarity" refers to a 70% or more similarity or 70% homology wherein "% similarity" or "% homology" between two polypeptide sequences is a function of the number of similar positions shared by two sequences on the basis of the scoring matrix used divided by the number of positions compared and then multiplied by 100. This comparison is made when two sequences are aligned (by introducing gaps if needed) to determine maximum homology. The PowerBlast program, implemented by the National Center for Biotechnology Information, can be used to compute optimal, gapped alignments. GAP program from Genetics Computer Group Wisconsin package (version 9.0) (Madison, WI) can also be used.
"Lignin monomer composition" refers to the relative ratios of guaiacyl monomer and syringyl monomer found in lignified plant tissue. "Plant" includes whole plants and portions of plants, including plant organs (e.g., roots, stems, leaves, etc).
"Angiosperm" refers to plants that produce seeds encased in an ovary. A specific example of an angiosperm is Liquidambar styraciflua (L.)[sweetgum].
"Gymnosperm" refers to plants that produce naked seeds, i.e., seeds that are not encased in an ovary. A specific example of a gymnosperm is Pinus taeda (L.)[loblolly pine].
"Isolated" and/or "purified" in reference to a nucleic acid molecule or polypeptide are meant to refer to in vitro isolation of a nucleic acid or polypeptide molecule from its natural cellular environment, and from association with other components of the cell so that it can be sequenced, replicated and/or expressed.
"Vector" is a recombinant nucleic acid construct, such as a plasmid, phage, genome, virus genome, cosmid, or artificial chromosome, to which a polynucleotide of the present invention may be attached. In a specific embodiment, the vector may bring about the replication of the attached segment, e.g., in the case of a cloning vector. "Sinapyl alcohol dehydrogenase" or "SAD" refers to the enzyme in the plant phenylpropanoid biosynthetic pathway, which catalyzes the conversion of sinapaldehyde to sinapyl alcohol and permits the production of syringyl lignin. In the illustrated embodiment of the present invention, the SAD DNA sequence (Fig. 2A) was identified from quaking aspen, Populus tremuloides. It is understood that this sequence can be used as a probe to clone its equivalent (i.e., with substantial homology or substantial identity is defined herein) from any plant species by techniques (EST, PCR, RT-PCR, anti-SAD antibodies, anti-SAD polypeptide antibodies, etc.) well known in the art. SAD DNA sequence is defined herein as any DNA sequences that encode enzymes capable of catalyzing specifically the conversion of sinapaldehyde into sinapyl alcohol according to the enzyme assay methods described herein.
The Phenyl Propanoid Biosynthetic Pathway: Reference is made to Figure 1 which shows different steps in the biosynthetic pathways from 4-coumarate (1) to guaiacyl (coniferyl alcohol (6)) and syringyl (sinapyl alcohol (9)) monolignols for the formation of guaiacyl-syringyl lignin together with the enzymes responsible for catalyzing each step. The enzymes indicated for each of the reaction steps are: 4-coumaric acid 3-hydroxylase (C3H) which converts 4-coumarate (1) to caffeate (2); 4-coumarate-CoA ligase (4CL) converts caffeate (2) to caffeoyl CoA (3) which in turn is converted to feruloyl CoA (4) by caffeoyl-CoA O-methyltransferase (CCoAOMT); cinnamoyl-CoA reductase (CCR) converts feruloyl CoA (4) to coniferaldehyde (5); coniferyl alcohol dehydrogenase (CAD) converts coniferaldehyde (5) to the guaiacyl monolignol coniferyl alcohol (6); at coniferaldehyde (5), the pathway splits wherein coniferaldehyde (5) can also be converted to 5-hydroxyconiferaldehyde (7) by coniferaldeyde 5-hydroxylase (CAld5H); 5-hydroxyconiferaldehyde O- methyltransferase (AldOMT) converts 5-hydroxconiferaldehyde (7) to sinapaldehyde (8) which, in turn, is converted to the syringyl monolignol, sinapyl alcohol (9) by sinapyl alcohol dehydrogenase (SAD). It had been previously reported that this final step to the formation of sinapyl alcohol was catalyzed by CAD. The present invention is the first disclosure of a separate enzyme for the formation of sinapyl alcohol from sinapaldehyde. CAD and SAD together regulate the quantity and composition of guaiacyl-syringyl lignin. The present invention provides an isolated SAD protein and SAD cDNA clones, which can now be used to modify lignification. SEQ ID NO 1 gives the sequence listing for the SAD cDNA from Populus tremuloides, while SEQ ID NO 2 gives the sequence listing for the deduced SAD polypeptide.
A comparison of the amino acid sequences of all reported CAD-like enzymes to the novel SAD enzyme of the present invention is provided in Table 1 below. CAD has been characterized for several different species. The values listed in Table 1 indicate the percent amino acid identity. Table 1 illustrates that SAD exhibits only about 50% amino acid sequence identity to all other known CADs, demonstrating that SAD is a different and novel enzyme with different biochemical function from other CADs. Therefore, the
SAD protein sequence is phylogenetically distinguishable from the sequences of all currently known monolignol CADs.
Table 1. Comparison of all CAD-like protein sequences available in the database. Values indicate % amino acid sequence identity.
Figure imgf000011_0001
1: M. sativa, AF083332; 2: PtCAD, AF217957; 3: P. deltoides, zl9568; 4: A. corada, D13991; 5: N. tabacum, x62343; 6: N. tabacum, x62344; 7: E. globulus, AF038561; 8: E. gunnii, x65631; 9: Z mays, aj005702; 10: Z. mays, yl3733; 11: S. offininarum, AJ231135; 12: P. radiada, u62394; 13: P. taeda, z37992; 14: P. taeda, z37991; 15: P. abies, x27675; 16: PtXAD (renamed PtSAD). DNA Constructs
According to the present invention, there is provided a DNA construct which is a plant DNA having a promoter sequence, a coding region and a terminator sequence. The coding region encodes the SAD enzyme essential to lignin biosynthesis. The coding region is suitably a minimum size of 50 bases. The gene promoter is positioned at the 5'- end of a transgene (the transgene may be SAD alone or SAD together with another enzyme from the plant monolignols as described hereinafter) for controlling the transgene expression and a gene termination sequence that is located at the 3'-end of the transgene for signaling the end of the transcription of the transgene.
The DNA construct in accordance with the present invention is suitably incorporated into the genome of a plant by transformation to alter lignin biosynthesis, e.g., to provide syringyl-enriched lignin. The DNA construct may include clones provided herein, namely PtXAD (later renamed PtSAD), described hereinafter, and variants thereof such as are permitted by the degeneracy of the genetic code or the functional equivalents thereof.
The DNA constructs of the present invention may be inserted into plants to regulate production of the SAD enzyme. Depending on the nature of the construct, the production of the protein may be increased or reduced, either throughout or at particular stages in the life of the plant. For example, the orientation of the DNA coding sequence, promoter, and termination sequence can serve to either suppress lignin formation or amplify lignin formation. For the down-regulation of lignin synthesis, the DNA is in the antisense orientation. For the amplification of lignin biosynthesis, the DNA is in the sense orientation, thus to provide one or more additional copies of the DNA in the plant genome. In this case, the DNA is suitably a full-length cDNA copy. It is also possible to target expression of the gene to specific cell types of the plants, such as the epidermis, the xylem, the roots, etc. Constructs in accordance with the present invention may be used to transform cells of both monocotyledons and dicotyledons plants in various ways known in the art. In many cases, such plant cells may be cultured to regenerate whole plants which subsequently reproduce to give successive generations of genetically modified plants. Examples of plants that are suitably genetically modified in accordance with the present invention, include but are not limited to, trees such a aspen, poplar, pine and eucalyptus. Promoters and Termination Sequences
Various gene promoter sequences are well known in the art and can be used in the DNA constructs of present invention. The promoter in a construct of the present invention can provide for expression of the linked DNA segment. The promoter can also be inducible so that gene expression can be turned on or off by an exogenously added agent. It may also be preferable to combine the desired DNA segment with a promoter that provides tissue specific expression or developmentally regulated gene expression in plants.
The promoter may be selected from promoters known to operate in plants, e.g., CaMV35S, GPAL2, GPAL3 and endogenous plant promoter controlling expression of the SAD enzyme, i.e., the endogenous promoter of the SAD gene. Use of a constitutive promoter such as the CaMV35S promoter (Odell et al. 1985), or CaMV 19S (Lawton et al, 1987) can be used to drive the expression of the transgenes in all tissue types in a target plant. Other promoters are nos (Ebert et al. 1987), Adh (Walker et al, 1987), sucrose synthase (Yang et al, 1990), -tubulin, ubiquitin, actin (Wang et al, 1992), cab (Sullivan et al, 1989), PEPCase (Hudspeth et al, 1989) or those associated with the R gene complex (Chandler et al, 1989). On the other hand, use of a tissue specific promoter permits functions to be controlled more selectively. The use of a tissue-specific promoter has the advantage that the SAD enzyme is only produced in the tissue in which its action is required. Suitably, tissue-specific promoters, such as those that confine the expression of the transgenes in developing xylem where lignification occurs, may be used in the inventive DNA constructs.
A DNA segment can be combined with the promoter by standard methods as described in Sambrook et al, 2nd ed. (1982). Briefly, a plasmid containing a promoter such as the CaMV 35S promoter can be constructed as described in Jefferson (1987) or obtained from Clontech Lab, Palo Alto, California (e.g., pBI121 or pBI221). Typically, these plas ids are constructed to provide for multiple cloning sites having specificity for different restriction enzymes downstream from the promoter. The DNA segment can be subcloned downstream from the promoter using restriction enzymes to ensure that the DNA is inserted in proper orientation with respect to the promoter so that the DNA can be expressed. The gene termination sequence is located 3' to the DNA sequence to be transcribed. Various gene termination sequences known in the art may be used in the present inventive constructs. These include nopaline synthase (NOS) gene termination sequence (see, e.g., references cited in co-pending, commonly-owned PCT Application "Method to Introduce Multiple Genes into Plants", Serial No. PCT/US00/27704, filed
October 6, 2000).
Marker Genes
A marker gene may also be incorporated into the inventive DNA constructs to aid the selection of plant tissues with positive integration of the transgene. "Marker genes" are genes that impart a distinct phenotype to cells expressing the marker gene and thus, allow such transformed cells to be distinguished from cells that do not have the marker. Many examples of suitable marker genes are known to the art and can be employed in the practice of the invention, such as neomycin phosphotransferase II (NPT II) gene that confers resistance to kanamycin or hygromycin antibiotics which would kill the non- transformed plant tissues containing no NPT π gene (Bevan et al, 1983). Numerous other exemplary marker genes are described in co-pending, commonly owned PCT Application "Method to Introduce Multiple Genes into Plants", Serial No. PCT/US00/27704, filed October 6, 2000, incorporated herein by reference.
Transformation
Transformation of tissues or cells from plants, for instance, trees, with the inventive DNA construct and the subsequent production of transgenic plants can be achieved by a variety of techniques known in the art. For example, Agrobacterium- and microprojectile-mediated techniques for transferring a DNA construct into host plant tissues are particularly suitable for tree species (Tsai et al, 1994; Ellis et al 1993; and others described in co-pending, commonly owned PCT Application, PCT/US00/27704, filed October 6, 2000 "Method to introduce multiple genes into plants", incorporated herein by reference). After transformation, transgenic plant tissues resistant to, e.g., antibiotics, such as kanamycin, can be selected and cultured to regenerate whole plants, using techniques also well known in the art (Tsai et al, 1994; Ellis et al. 1993; and others described in co-pending, commonly owned PCT Application, PCT/US00/27704(^/?ra)). Transformation and regeneration protocols are readily adaptable to many plant species. Many transformation and regeneration protocols have been published for plant species. (See, co-pending, commonly-owned PCT Application Serial No. PCT/USOO/27704 (supra)).
DNA Clones
A guaiacyl pathway gene encoding coniferyl alcohol dehydrogenase (CAD, Fig. 1) from Populus tremuloides (GenBank #AF217957) was first cloned. This cDNA was designated as PtCAD (GenBank #AF217957). E. coZi-expressed recombinant PtCAD protein was characterized for its catalytic activity with coniferaldehyde and sinapaldehyde. Because monolignol biosynthetic pathway intermediates are present together in lignifying tissues (Osakabe et al, 1999; Li et al. 2000), the PtCAD enzyme activity with a mixture of coniferaldehyde and sinapaldehyde was assayed. As shown in Fig. 5 (a) and (c), the reaction mixture was separated by HPLC after the enzyme reaction. Only coniferyl alcohol was formed from coniferaldehyde, as corroborated by mass spectrometry-based chemical structural analysis, and PtCAD had no reaction with sinapaldehyde. Thus, PtCAD has a specific catalytic reaction function with coniferaldehyde for the biosynthesis of guaiacyl monolignol, coniferyl alcohol (Fig. 1). CAD's substrate specificity for coniferaldehyde also confirms that there is a need for another enzyme, SAD of the present invention, in the biosynthesis of syringyl monolignol, sinapyl alcohol, as illustrated in Fig. 1.
A differential cloning strategy was designed to isolate candidate SAD genes based on their discernable sequences from that of CAD, as described above. Low- and high-stringency differential screening (further described in Example 2 herein below) of 1.8 x 104 pfu from the Populus tremuloides xylem cDNA library using PtCAD cDNA as a probe resulted in the isolation of two groups of positive clones, based on sequence analysis, i.e., Group 1 sequences and Group U sequences. Group I sequences of 12 clones were identical to PtCAD, and the sequences of group II cDNAs were identical to each other but different from PtCAD. Two of the 8 clones in group II were full-length cDNAs and designated as PtSAD. PtSAD cDNA (SEQ ID NO: 1) is 1,446-bρ long, encoding an ORF of 362 amino acids (SEQ ID NO: 2) with a calculated MW of 38,991 and a pi of 6.69. Co-factor and zinc binding sequences identified in common alcohol dehydrogenases (ADHs) (Jornvall et al, 1987; O'Malley et al, 1992; Galliano et al, 1993) were found in PtSAD cDNA. Znl binding motif and the structural Zn2 consensus were located at amino acid residues 71 to 85 and residues 91 to 117, respectively. An
NADP-binding site was identified at residues 191 to 196.
Furthermore, PtSAD exhibited only about 50% amino acid sequence identity to all the other known full-length monolignol CADs (see, Table 1 supra). However, it showed insignificantly low amino acid sequence identity (10-40%) to those ADHs considered to be associated with pathogen-defense functions (Jornvall et al, 1987; Brill et al, 1999). These sequence characteristics confirm that PtSAD belongs to a novel class of ADHs, discernable from the commonly known monolignol CADs. This is fully supported by the phylogenetic analysis of PtSAD and available full-length monolignol CAD protein sequences showing that these monolignol CADs (Fig. 3) form a cluster distinctly separated from PtSAD. This cluster of monolignol CADs is guaiacyl-specific in view of the extensive amino acid sequence similarity (-80 to 98%) of these genes with the guaiacyl-specific PtCAD and with CADs from loblolly pine and spruce, the single- copy gene involved in the biosynthesis of guaiacyl monolignol in gymnosperms (O'Malley et al, 1992; Galliano et al, 1993; MacKay et al. 1995). Thus, the phylogenetic analysis may reflect an ancient divergence of the guaiacyl CAD phylogenetic group into a more syringyl-specialized one, to which PtSAD belongs. Repeated screening of independent sets of pfu from Populus tremuloides xylem cDNA libraries with either PtCAD or PtSAD cDNA probes always resulted in the isolation of clones identical to either PtCAD or PtSAD, indicating the two predominant monolignol ADHs in lignifying xylem, CAD and SAD.
To demonstrate the biochemical function of PtSAD gene, PtSAD cDNA was expressed in E. coli to produce its recombinant protein. When coniferaldehyde alone was incubated with PtSAD recombinant protein, HPLC-MS analysis of the enzyme reaction production demonstrated that PtSAD had a specific activity of 786 nmol/min/mg protein with coniferaldehyde. However, PtSAD had a specific activity of 6964 nmol/min/mg protein with sinapaldehyde, indicating that the catalytic efficiency of PtSAD with sinapaldehyde is 9 times higher than with coniferaldehyde. Thus, PtSAD is specific for sinapaldehyde and SAD sinapyl alcohol dehydrogenase catalyzes the conversion of sinapaldehyde to sinapyl alcohol.
Proof of the sinapaldehyde-specific nature of PtSAD came from the PtSAD recombinant protein reaction with a mixture of coniferaldehyde and sinapaldehyde. HPLC-MS analysis (Fig. 5) of the reaction of PtSAD with a mixture of coniferaldehyde and sinapaldehyde demonstrated conclusively that sinapyl alcohol is the exclusive product from sinapaldehyde and that in an in vivo situation PtSAD would not react with coniferaldehyde. Thus, taken together, CAD is guaiacyl-specific for the formation of guaiacyl monolignol, coniferyl alcohol, and SAD catalyzes the exclusive biosynthesis of syringyl monolignol, sinapyl alcohol. Furthermore, these results suggest discrete roles in plants for CAD and SAD proteins in coordinating cell-specific biosynthesis of guaiacyl and syringyl lignins. A cDNA encoding this SAD enzyme has now been cloned for the first time. It was concluded that the presence of SAD enzyme is essential for the biosynthesis of syringyl lignin in plants, and that the incorporation of an SAD gene into transgenic plants is a viable mechanism for successful engineering of syringyl lignin in plants.
The invention will be further described by the following non-limiting examples.
Example 1: Isolation of SAD cDNA from aspen Populus tremuloides
An aspen developing xylem cDNA library was constructed in λgt22A vector according to manufacturer's protocols (GJJBCO BRL). The aspen CAD cDNA (GenBank #AF217957) was used as a probe to differentially screen the cDNA library under high and low stringency hybridization conditions. About 6,000 pfu from the cDNA library were lifted onto 4 individual nylon membranes. Two such blotted membranes were hybridized with 32P-labeled CAD cDNA probe under low stringency conditions (50°C) and the other two under high stringency (65°C). In this way, a total of 18,000 pfu were screened. High density hybridization signals were detected on membranes probed under either high or low stringency conditions. However, low density signal were detected only on membranes probed under low stringency condition. The high density signals on high stringency membrane were perfectly aligned with the high density signals on low stringency membrane, allowing a differential isolation of positive clones with low density signal. The high density clones were confirmed to be aspen CAD cDNA. The positives with low density signal were further screened until a single clone was isolated. The purified λgt22A clones were then subcloned into pBluescriptS/K plasmid vector through Notl and EcoRI cloning sites. The sequencing results indicated that the isolated cDNA clone is 1,425-bp long (SEQ ID NO: 1) and encodes a 362 amino acid protein (SEQ ID NO: 2) which shows a 53% sequence identity with aspen CAD protein. This cDNA clone was first designated as PtXAD and then renamed as SAD after its biochemical function was confirmed.
Sequences of clones that hybridized with the probe only under low stringency conditions were identical to each other but distinct from PtCAD. Two of these low stringency probe-hybridizing clones were found to be full-length cDNAs; they were designated PtSAD and sequenced (ABI31O; Perkin-Elmer) in both directions (GenBank accession number AF273256).
Example 2: Cloning of a Novel Alcohol Dehydrogenase Gene, PtSAD, from Aspen
To test the hypothesis of distinct CAD and SAD genes in angiosperms, CAD cDNA, PtCAD, was cloned from developing xylem of aspen and used to screen for related sequences in the same species. Low- and high-stringency differential screening of 2.4 x 104 plaque-forming units from an aspen xylem cDNA library (Wu et al, 2000) resulted in the isolation of two groups of positive clones. Group I contained 12 cDNAs with sequences identical to PtCAD. Sequences of the eight cDNAs constituting group JJ were identical to each other but differed from PtCAD. Two of the eight clones in group II were full-length cDNAs and were tentatively named PtSAD.
The open reading frame of PtSAD was 1086 bp, encoding a 39-kD protein with a pi of 6.69. The deduced amino acid sequence of PtSAD was 53% identical to that of PtCAD and -50% identical to that of other angiosperm monolignol CADs, but it exhibited insignificant identity (10 to 40%) with the sequences of alcohol dehydrogenases (ADHs) associated with pathogen defense (Brill et al, 1999). PtCAD, on the other hand, showed extensive amino acid sequence identity with CADs from Populus trichocarpa X Populus deltaides (97%) (PtCADA; Nan Doorsselaere et al, 1995), Eucalyptus gunnii (81%) (pEuCAD2; Grima-Pettenati et al, 1993), tobacco (82%) (pTCAD14; Knight et al, 1992), lucern (79%) (MsaCad2; Brill et al, 1999), and other reported angiosperms (-80%) (Brill et al, 1999). Therefore, PtSAD belongs to a novel class of ADHs. Cofactor and zinc binding sequences conserved in ADHs (Jornvall et al, 1987) were present in PtSAD (Figure 1). The Znl binding motif and structural Zn2 consensus regions (Jornvall et al, 1987; MacKay et al, 1995) were located at amino acid residues 71 to 85 and 91 to 117, respectively. A ΝADP binding site (Jornvall et al, 1987) was identified at residues 191 to 196. Repeated screening of the aspen xylem cDNA library with either PtCAD or PtSAD cDNA probes always resulted in the isolation of clones identical to either PtCAD or PtSAD, indicating that they are the two predominant monolignol-related ADHs in lignifying xylem. Phylogenetic analysis of PtSAD and available full-length monolignol CAD protein sequences showed that gymnosperm and angiosperm CADs form a cluster that does not include PtSAD (Figure 2). The angiosperm monolignol CADs in this cluster share -70% amino acid sequence identity with gymnosperm CADs but -50% with
PtSAD, suggesting that all of these putative angiosperm monolignol CADs may be guaiacyl specific. These results also may reflect a divergence of the guaiacyl CAD phylogenetic group into a more syringyl-specialized group, to which PtSAD belongs.
Example 3: DNA and RNA Gel Blot Analysis
Aspen genomic DNA and total RNA from various aspen tissues were isolated as described (Li et al, 1997; Hu et al, 1998). To determine whether there are other PtCAD and PtSAD related sequences in aspen, a gel blot analysis was done with aspen genomic DNA digested by various restriction enzymes and hybridized with either PtCAD (Figure 4A) or PtSAD (Figure 4B) full-length cDNA probes. DNA and RNA gel blot hybridizations were performed under high stringency conditions (Hu et al, 1998). Probes were PtCAD or PtSAD cDNA labeled with α-32P-dATP (Amersham) using the DEC A prime labeling system (Ambion, Austin, TX).
There was a strong single band in each lane, but a weak single band also was detected in each lane, perhaps evidence of a distantly related sequence. Together with our cDNA screening results, we interpret these data to indicate that PtCAD and PtSAD likely are the predominant members of a small gene family in aspen.
DNA gel blot analysis also clearly demonstrated that PtCAD and PtSAD did not cross-hybridize with each other. Thus, using the same hybridization conditions and PtCAD and PtSAD full-length cDNA probes, RNA gel blot analysis was conducted to investigate the tissue-specific expression of PtCAD and PtSAD in aspen. The greatest PtCAD expression was found in tissue types containing a large amount of lignifying xylem, but its expression was lower in phloem-enriched tissues (internodes 1 to 3; Figure 4C). Strong expression of PtSAD was detected in tissues undergoing rapid phloem (internodes 1 to 3; Figure 4D) and xylem (internodes 4 to 9; Figure 4D) development. The expression of PtCAD and PtSAD was not observed in leaves in which vascular mid- veins were removed.
Protein gel blot analysis was also conducted to verify the tissue-specific expression of PtCAD and PtSAD. Polyclonal antisera was obtained against affinity- purified PtCAD and PtSAD recombinant proteins produced in Eschenchia coli and protein gel blotting was used to verify the specificity of PtCAD and PtSAD antibodies against PtCAD and PtSAD recombinant proteins. For the various recombinant protein amounts (up to 75 ng) tested, PtCAD antibody did not cross-react with PtSAD protein (Figure 4E), and PtSAD antibody did not cross-react with PtCAD protein (Figure 4F). The PtCAD protein exhibited the expected molecular mass of -39 kD and was more abundant in protein extracts from xylem than from phloem tissue (Figure 4E). In contrast, the strongest signal using PtSAD antibody was detected in phloem protein extracts (Figure 4F). RNA and protein gel blot analyses consistently indicated that both PtCAD and PtSAD were associated with lignification. Strong PtSAD expression in syringyl lignin-enriched phloem (Grand et al, 1982) suggests a specialized role for PtSAD in syringyl monolignol biosynthesis. Therefore, characterized herein are the biochemical functions of the PtCAD and PtSAD genes.
Example 4: Determination of Enzyme Activity To determine the enzyme activity of Aspen SAD having the amino acid SEQ ID
NO: 2, the following experiments were conducted:
(i) Expression and Purification of PtCAD and PtSAD Recombinant Proteins and Preparation of Plant Protein Extracts The coding sequences of PtCAD and PtSAD were amplified by polymerase chain reaction (PCR) using primers designed to introduce Ndel and Notl sites immediately upstream of their start and stop codons, a sense primer SEQ ID NO: 3 (5'GGCATATGTCCAAGTCACCAGAA3') and an antisense primer SEQ ID NO: 4 (5 GCGGCCOCGGGCTTCGTAGCTGCCAA3'). The PCR product was cloned into the Ndel and Notl sites of pET23 b+ vector (Novagen, Madison, WI) to fuse a His tag at the Carboxyl terminus of the cloned sequence. After sequence confirmation, the engineered pET23 b+ construct was transferred into Eschenchia coli host strain BL21(DE3) (Novagen). Induction and purification of recombinant PtCAD and PtSAD were performed as described (Li et al, 2000). Differentiating stem xylem was collected during the growing season from aspen, hophorn beam (Ostrya virginiana), yellow birch
(Betula alleghaniensis), sugar maple (Acer saccharum), red maple (Acer rubrum), sweetgum (Liquidambar styraciflua), and loblolly pine (Pinus taeda) and used to isolate crude protein extracts as described (Li et al, 2000).
(ii) Preparation of Anti-PtCAD and Anti-PtSAD Antibodies and Protein Gel Blot Analysis
The affinity-purified PtCAD and PtSAD recombinant proteins were used to immunize rabbits (Alpha Diagnostic, San Antonio, TX). The antibodies, diluted 1:3000, were used in protein gel blot analyses of xylem crude proteins (Osakabe et al, 1999). Protein concentrations were determined by the Bio-Rad protein assay system.
(iii) SAD enzyme activity assay The SAD enzyme reactions were conducted in a final volume of 300 μl containing 100 mM sodium phosphate buffer, 500 M substrate syringyl aldehyde (or coniferyl aldehyde), lμg recombinant SAD protein, 2.5 mM β-mercaptoethanol and 500 μM NADPH, with varying pHs (5.4, 6.0, 6.4, 7.0, 7.4, 8.0 or 8.4). After 10 min at 30°C, the reaction was terminated and extracted with 0.5 ml ethyl acetate. The extraction was repeated 4 times and the combined ethyl acetate was evaporated and dissolved in the HPLC mobile phase for LC-MS identification and quantitation of the reaction products as we did before (Osakabe et al, 1999; Li et al 2000). An optimal pH of 7.0 was found for SAD reactions. The SAD reactions with mixed substrates, sinapaldehyde and coniferyl aldehyde, were therefore conducted at the optimal pH 7.0 under above- described conditions.
(iv) HPLC-UV/MS Analysis of Enzyme Functions and Reaction Kinetics
The basic enzyme reaction mixture contained 50 mM sodium phosphate buffer, 5 mM β-mercaptoethanol, 500 μM NADPH or NADP, purified recombinant protein (boiled protein was used as a control), and phenolic substrate in a final volume of 500 μL For the substrate specificity test, 500 μM aldehyde substrate and 1 μg of purified recombinant PtCAD or PtSAD protein (-25 pmol) were used. To characterize the enzyme pH optima, the substrate and recombinant PtCAD or PtSAD protein concentrations described above were used in sodium phosphate buffers, pH 5 to 8.5. All reactions were for 10 minutes at 30 C.
For normal and inhibition kinetic analyses, the reaction time was 4 min and pH was 8.0 for PtCAD (1.2 μg of purified recombinant protein) and 7.0 for PtSAD (0.1 μg). For kinetics, varying concentrations (0.5 to 200 μM) of -coumaraldehyde, caffealdehyde, coniferaldehyde, 5-hydroxyconiferaldehyde, or sinapaldehyde were used to measure Km, Vmax, and the enzyme turnover number, kcat. For inhibition kinetics, the
PtCAD-mediated reduction of sinapaldehyde (1 to 200 μM) was assayed in the presence of 1 to 5 μM coniferaldehyde, and the PtSAD-catalyzed reduction of coniferaldehyde (1 to 200 μM) was assayed in the presence of 1 to 5 μM sinapaldehyde. All reactions were terminated by the addition of 10 μL of 6 N HCI (to bring the pH to 2) and 500 ng of internal standard o-coumaric acid and analyzed by HPLC-UV/MS.
An aliquot of 100 μL of reaction mixture was injected directly onto a Supelcosil LC-ABZ column (15 cm x 4.6 mm x 5 μm; Supelco, Bellefonte, PA) with automatic sample injection and separated isocratically with a Hewlett-Packard (HP) 1100 liquid chromatography system at 40°C and a flow rate of 0.25 mL/min. The gradient program was 20% acetonitrile in lOmM formic acid, pH 2.5, for 12 min, 20 to 100% acetonitrile from 12 to 16 min, and hold at 100% acetonitrile for 5 to 10 min; detection was with an HP 1100 diode array detector and an HP 1100 liquid chromatography-MS detector system with an atmospheric pressure onization-electrospray source in negative ion mode. The reaction products were identified and confirmed by comparing the ion fragmentation patterns of the product and the authentic standard in MS scanning mode at 70 V. The product quantity and K,„, Vmax, kcat, and apparent inhibition constant (Ki) values (means ±SE) were determined as described (Osakabe et al, 1999; Li et al, 2000). The results of the inhibition kinetics for both the CAD enzyme (i.e. Table 2) and the SAD enzyme (i.e., Table 3) using a variety of substrates are illustrated below. Table 2
Kinetic Properties of the Recombinant PtCAD Protein
Substrate Km » max Λ kca ,ta » max'^-m
(μM) (nmol min -1 μg"1) (min"1) (.%) p-Coumaraldehyde 6.2±1.1 0.17±0.04 6.8±0.2 30.1
Caffealdehyde 37.0±5.4 0.15±0.03 6.0±.02 4.4
Coniferaldehyde 2.3±0.8 0.21±0.03 8.4±0.3 100
5-Hydroxyconiferaldehyde 17.5±2.5 0.17±0.04 6.8±0.4 10.6
Sinapaldehyde 9.1±1.2 O.lO±O.Ol 4.0± 12.0 a&cat, enzyme turnover number
Values are means ±SE for three independent assays.
Table 3
Kinetic Properties of the Recombinant PtSAD Protein
Substrate Km » max ^cat » max'-k-m
(μM) (nmol min _1 μg"1) (min"1) (%) p-Coumaraldehyde 15.6± 1.4 2.9±0.3 116±11 27.4
Caffealdehyde 140.0±9.1 2.0±0.1 80±4 2.2
Coniferaldehyde 12.7±1.5 2.3±0.2 92±6 26.6
5-Hydroxyconiferaldehyde 36.1±2.3 3.8±0.4 152+16 15.5
Sinapaldehyde 7.4± 1.1 5.0±0.3 200±13 100 a£cat, enzyme turnover number
Values are means ±SE for three independent assays.
Example 5: Chemical Synthesis and Thioacidolysis Analysis of Aspen Stem Monolignol composition
All aldehydes and their alcohol derivatives were obtained from Sigma/ Aldrich, except the following: p-coumaraldehyde, p-coumaryl alcohol, caffealdehyde, caffeyl alcohol, 5-hydroxyconiferaldehyde, and 5-hydroxyconiferyl alcohol were prepared chemically from their corresponding benzaldehyde derivatives as described (Osakabe et al, 1999; Li et al, 2000). The structural identities of these compounds were confirmed by 1H-NMR. -Coumaraldehyde: δ (acetone-dβ; standard carbon numbers were used)
6.48QH, dd, Jl = 15.9, J2 = 7.8, C8H), 6.80 (2H, m, Ar-H), 7.46 (1H, d, J = 15.8, C7H),
7.48 (2H, m, Ar-H), 9.50 (1H, d, C9H); p-coumaryl alcohol: δ (acetone-de) 4.18 (2H, dd,
Jl = 4, J2 = 1, C9H), 6.19 (1H, dt, Jl = 15.9, J2 = 5.5, C8H). 6.49 (1H, d, J = 15.9, C7M), 6.78 (2H, m, Ar-H), 7.26 (2M, m, Ar-H); caffealdehyde: δ (acetone-de) 6.53 (1H, dd, Jl = 15.7, J2 = 1.6, C8H), 6.90 (1H, d, J = 7.9, C5H), 7.10 (1H, dd, Jl = 7.9, J2 = 2.1,
C6H), 7.20QH, d, J 2.1, C2H), 7.51 (1H, d, J = 15.7, C7H), 9.61 (1H, d, J = 1.6, C9H); caffeyl alcohol: δ (acetone-de) 4.17 (2H, d, J 5.5, C9H), 6.14 (1H, dt, Jl = 15.9, J2 = 5.5,
C8H), 6.43 (1H, dt, Jl = 15.9, J2 = 1.5, C7H), 6.75 (2H, d, J = 1.5, C5H, C6H), 6.92 (1H, d, J = 1.5, C2H); 5-hydroxyconiferaldehyde: δ (acetone-de) 3.88 (3H, s, OCH3), 6.60 (1H, dd, Jl = 15.6, J2 = 7.8, C8H), 6.88 (1H, d, J = 1.7, C6H), 6.95 (1H, d, / = 1.7, C2H), 7.50 (1H, d, J = 15.6, C7H), 9.61 (1H, d, J = 7.8, C9H); 5-hydroxyconiferyl alcohol: δ (acetone-de) 3.87 (3H, s, OCH3), 4.28 (2H, t, J = 5.5, C9H), 6.20 (1H, dt, Jl = 15.9, J2 = 5.5, C8H), 6.47 (1H, d, J = 15.9, C7H), 6.51 (1H, d, J = 1.8, C6H), 6.64 (1H, d, J = 1.8, C2H). For analysis of monolignol composition, aspen stem internodes were extracted with benzene/alcohol and subjected to gas chromatography-mass spectrometry (MS)- based thioacidolysis (Rolando et al, 1992; Tsai et al, 1998).
Example 6: Histochemical Lignin Analysis, Immunolocalizatlon, and Microscopy For histochemical localization of lignin, fresh hand-cut sections (-20 μm thick) from stem internodes of 4-month-old, greenhouse-grown aspen plants (clone 271) were incubated immediately in freshly prepared saturated chlorinated water for 10 min at 4°C. After three washes with water, the sections were incubated in 4% sodium sulfite at room temperature for 5 min, mounted in 50% glycerol, and photographed using a Nikon (Tokyo, Japan) Eclipse 400 fluorescence microscope. Segments (-1 mm thick) from the same internodes used for histochemical analysis were used for immunolocalization on the basis of the protocol of Wittich et al. (1999) with modifications. The segments were fixed in 4% paraformaldehyde in 0.1 M PBS (4 mM sodium phosphate, pH 7.4, and 200mM NaCl) for 12 hr at 4°C. After washing in PBS for 2 hr at 4°C, the segments were dehydrated in an ethanol series, infiltrated, and embedded in butyl methyl methacrylate. Polymerization was performed under UN light (365 nm) for 40 hr at -20°C in a UNC2 CRYO Chamber (PELCO, Redding, CA). Sections (3 μm thick) were prepared with a Leica (wetzlar, Germany) RM 2155 microtome and mounted on Superfrost/plus (Fisher) slides. Slides were rinsed with acetone to remove butyl methyl methacrylate from the sections, which were rehydrated in an ethanol series and blocked first with 0.1 M hydroxyammonium chloride for 5 min and then with 1% BSA for 30 min at room temperature. After incubation with anti-PtCAD, anti-PtCAld5H (Osakabe et al, 1999), anti-PiAldOMT (Li et al, 2000), or anti-PtSAD antibodies (in 1:500 dilution) for 2 hr at 37°C, slides were washed in PBS containing 0.1% BSA and incubated with goat anti- rabbit antibody conjugated with alkaline phosphatase (1:100; Boehringer Mannheim) for 1.5 hr at 37°C. After washing in PBS, slides incubated with anti-PtSAD, antiPtCAld5H, or anti-PtAldOMT antibodies were reacted at pH 9.5 with a mixture of dimethylformamide and nitroblue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate, and those incubated with anti-PtCAD antibodies were treated with Fast Red TR/Naphthol AS-MX (Sigma); both treatments were for 20 to 30 min at room temperature. Pre- immune serum was used as the control. The slides then were mounted in 50% glycerol and observed with a Nikon Eclipse 400 microscope, and images were taken using a Sony (Tokyo, Japan) DKC-5000 digital photo camera.
Example 7: Histochemical and Chemical Detection of Guaiacyl and Syringyl Lignin Distributions in Aspen Stem Vascular Tissues
The in situ relationship between PtCAD/PtSAD and guaiacyl syringyl lignin biosynthesis was identified by analyzing the distribution of guaiacyl and syringyl lignins in vascular systems of the aspen stem. Syringyl lignin can be distinguished chromogenically from guaiacyl lignin in situ by Cross/Bevan or Maule color reaction
(Nakano and Meshitsuka, 1992). The lignin-based chromophore-forming mechanisms in these two methods are similar. The chlorination of the syringyl nucleus leads to a pink (lignifying cells) or red (lignified cells) color, whereas the guaiacyl nucleus produces a light (lignifying cells) to dark (lignified cells) brown color (Bland, 1966; Wardrop,
1981). The Cross/Bevan method was used in these experiments because of its mild reaction conditions, circumventing the problem of thin tissue section destruction that often occurs during Maule color reactions. In the primary vascular tissues, lignin was observed only in xylem and was of the guaiacyl type, as revealed by the brown staining of protoxylem and metaxylem vessel elements between stem internodes 1 and 4 (Figures 7 A and 7B). This was further confirmed by thioacidolysis analysis of stem lignin, which demonstrated the exclusive detection of guaiacyl monomers (Figure 7D). The primary xylem remained as the only stem tissue containing pure guaiacyl lignin (Figures 7E to 7G). Guaiacyl-syringyl lignin appeared during the differentiation of secondary vascular systems, as indicated by the chemical analyses of stem internodes 5 and beyond (Figure 7H). However, the deposition of syringyl lignin in the secondary xylem followed that of guaiacyl lignin, as manifested by the color change from bright light brown to pink and then red in developing, partially lignified, and extensively lignified secondary xylem elements, respectively (Figure 7G). This is consistent with the reported sequential deposition of guaiacyl followed by syringyl lignins in xylem cells of angiosperms (Terashima et al, 1986; Saka and Goring, 1988).
Aggregated protophloem parenchyma cells, the precursors of primary phloem fibers (Esau, 1965), were present in primary growth tissues (Figures 7A to 7C), but these cells were not stained for lignin, likely because of their lack of secondary wall thickening. They also failed to stain for guaiacyl lignin once lignification and secondary thickening began (Figure 71). Instead, syringyl-positive pink (Figure 71) to red (Figures
7E and 7F) coloration prevailed in these cells as they differentiated into fibers. Indeed, phloem fibers are known for their enrichment in syringyl lignin, but they do accumulate guaiacyl-syringyl lignin (Grand et al, 1982). Together, these observations indicate that in direct contrast to the lignification sequence in secondary xylem elements, the biosynthesis of syringyl lignin precedes and overwhelms that of guaicyl lignin in primary phloem fibers.
Irnmunolocalization was used to verify whether PtCAD is associated with guaiacyl lignin-synthesizing primary xylem and whether the distribution of PtCAD and
PtSAD is in line with the guaiacyl and syringyl lignin deposition patterns in phloem and xylem elements. The distribution of another syringyl pathway protein, PtCAd5H, also was analyzed.
Example 8: Irnmunolocalization of PtCAD, PtCAd5H, and PtSAD in Aspen Stem Internodes Conditions similar to those present during protein gel blot analyses, by which the specificities of PtCAD and PtSAD antibodies were verified (Figures 4E and 4F), were applied to cellular irnmunolocalization. PtSAD and PtCAld5H were visualized in tissue sections after the anti-rabbit IgG-alkaline phosphatase reaction with nitroblue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate substrate. PtCAD signals were visualized with Fast Red substrate. Serial sections were analyzed. Pre-immune serum used at the same protein concentration as the anti-PtCAD, anti-PtSAD, or anti-PtCAld5H antiserum gave no immunolabeling signal (data not shown). At the third internode, PtCAD was detected almost exclusively in developing metaxylem vessels (Figure 8A). PtSAD was not detected in metaxylem vessels but was most conspicuous in protophloem parenchyma cells and in the parenchymatous storage tissue, the medullary sheath (Figure 8B).
The cellular distribution of PtCAld5H (Figure 8C) conformed with that of PtSAD. At the third internode, the lignification and secondary wall thickening had begun in metaxylem vessels but not in protophloem parenchyma cells (Figures 7A to 7C). Consistently, no lignin color reaction was observed in protophloem parenchyma cells (Figure 7A), despite the detection in these cells of PtSAD and PtCAld5H (Figures 8B and 8C). However, at internode 6, both syringyl lignin deposition (Figure 71) and PtSAD signals (data not shown) were observed in these cells undergoing differentiation into primary phloem fibers. At the eighth internode, PtSAD signals diminished in these differentiating fiber cells (Figure 8E), signifying the near completion of syringyl monolignol biosynthesis in these cells (Figure 7E).
At this stage, PtCAD became more conspicuous than PtSAD in these maturing fibers (Figure 8D), indicative of an active biosynthesis of guaiacyl monolignol. As the primary phloem continued its centripetal course of differentiation, new protophloem parenchyma cells appeared adjacent to the maturing fibers toward the center of the stem. These new primary phloem fiber precursors (Esau, 1965) were labeled with PtSAD (Figure 8E) but not yet with PtCAD (Figure 8D). At internode 12, PtSAD signals disappeared in primary phloem fibers (Figure 81), suggesting the completion of syringyl monolignol biosynthesis in these cells. However, PtCAD signals remained strong in these maturing fibers (Figure 8H). At internode 15, neither PtCAD nor PtSAD was detected in these fibers that became fully lignified (data not shown). These results agree with those of histochemical lignin localization indicating that the biosynthesis of syringyl lignin precedes that of guaiacyl lignin in primary phloem fibers.
However, these procambium-derived primary phloem elements and the secondary xylem exhibited contrasting lignification sequences. PtCAD appeared in xylem fusiform initials before PtSAD (Figures 8H and 81), consistent with chemical and histochemical evidence that the biosynthesis of syringyl lignin lags behind that of guaiacyl lignin in the secondary xylem. Furthermore, in the differentiating secondary xylem, PtCAD signals were most conspicuous in maturing vessels (Figures 8F and 8H) but also were strong in developing fiber and ray cells. PtSAD signals were strongest in syringyl lignin — enriched radial and axial ray cells (Figure 8G) (Wardrop and Dadswell, 1952; Musha and
Goring, 1975) and were conspicuous in maturing fiber cells but were nearly absent from developing vessels (Figures 8G and 81). These protein distribution patterns in the secondary xylem were sustained through older internodes (data not shown). These results and histochemical observations consistently demonstrated that PtCAD is associated with cells specializing in guaiacyl lignin synthesis and that PtSAD and
PtCAd5H are associated with vascular elements containing enriched syringyl lignin.
Example 9: Production of syringyl-enriched lignin in transformed plants
The following genetic transformations illustrate production of syringyl-enriched lignin in plants.
A. To produce syringyl-enriched lignin in angiosperm plants, angiosperm plants are genetically transformed with sense SAD gene driven by any appropriate promoter and via any appropriate genetic transformation system.
B. To produce syringyl-enriched lignin in gymnosperm plants, gymnosperm plants are genetically transformed with sense SAD genes driven by any appropriate promoter and via any appropriate genetic transformation system.
The invention has now been described and exemplified with some specificity, those skilled in the art will appreciate the various modifications, including variation, additions and omissions, that may be made in what has been described. Accordingly, it is intended that these modifications also be encompassed by the present invention and that the scope of the present invention be limited solely by the broadest interpretation that lawfully can be accorded the appended claims. REFERENCES
Bevan et al, 1983, Nature, 304:184
Bugos et al, 1991, Plant Mol Biol 17:203. Chang, H.M., and Sarkanen, K.V., 1973, Tappi 56: 132.
Chiang, V.L., and Funaoka, M., 1990, Holzforschung 44:309.
Ellis et al, 1993, Bio Technology 11:84.
Freudenberg, K., 1965, Science 148:595.
Baucher, et al, 1996, Plant Physiol. 112:1479. Bland, D.E., 1966, Holzforschung 20: 12.
Boudet, et al, 1995, New Phytol. 129:203.
Brill, et αZ., 1999, Plant Mol. Biol. 41:279.
Chen, et αZ.,1999, Planta 207: 597.
Corner, E.J.H.,1968, The Life of Plants. (New York: New American Library). Esau, K.,1965, Plant Anatomy, 2nd ed. (New York: John Wiley and Sons).
Fergus, B.J., and Goring, D.A.I., 1970a, Holzforschung 24:113.
Fergus, B.J., and Goring, D.A.I., 1970b, Holzforschung 24:118.
Frey-Wyssling, A., and Bosshard, H.H.,1959, Holzforschung 13:129.
Galliano, et al, 1993a, Plant Mol Biol. 23:145. Galliano, et al, 1993b, Phytochemistry 32:557.
Goffner et al, 1992, Planta 188:48.
Goffner et αZ., 1994, Plant Physiol. 106:625.
Goffner et al, 1998, Plant Mol. Biol. 36:755.
Grand et al, 1982, Holzforschung 36:217. Grima-Pettenati et al. , 1993, Plant Mol. Biol. 21 : 1085.
Grima-Pettenati et al, 1994, Phytochemistry 37:941.
Gross, G.G., 1980, Adv. Bot. Res. 8:25.
Guo et al, 2001, Plant Cell 13:73.
Hahlbrock, K., and Scheel, D., 1989, Plant Mol. Biol 40:347. Halpin et al , 1992, Plant Physiol. 98: 12.
Halpin et al, 1994, Plant J. 6:339.
Hawkins, S.E., and Boudet, A.M., 1994, Plant Physiol. 104:75.
Hibino et al, 1993a, Phytochemistry 32:565. Hibino et al, 1993b, Plant Cell Physiol. 34:659.
Higuchi, T., 1997,. (New York: Springer-Verlag).
Higuchi et al, 1994, J. Biotechnol. 37:151.
Hu et al, 1998, Proc. Natl Acad. Sci. USA 95:5407. Hu et al. , 1999, Nat. Biotechnol. 17:808.
Humphreys et al., 1999, Proc. Nati. Acad. Sci. USA 96:10045.
Jornvall et al, 1987, Eur. J. Biochem. 167:195.
Kawamura, I, and Higuchi, T., 1962, J. Jpn. Wood Res. Soc. 8:148.
Knight et al, 1992, Plant Mol Biol. 19:793. Kutsuki et al. , 1982,. Phytochemistry 21:19.
Lacombe et al, 1997, Plant J. 11:429.
Li et al, 1997, Proc. Natl. Acad. Sci. USA 94:5431.
Li et al, 1999, Plant Mol. Biol. 40:555.
Li et al, 2000, J. Biol Chem. 275:6537. Luderitz, T., and Grisebach, H., 1981, Eur. J. Biochem. 119:115.
MacKay et al, 1995, Mol. Gen. Genet. 247:537.
Mansell et al, 1974, Phytochemistry 13:2427.
Mansell et al, 1976, Phytochemistry 15:1849.
Musha, Y., and Goring, D.A.I., 1975, Wood Sci. Technol. 9:45. Nakano, J., and Meshitsuka, G., 1992, C.W. Dence and SY. Lin, eds (New York:
Springer-Verlag), 23.
O'Malley et al, Plant Physiol. 98:1364.
Osakabe et al, 1999, Proc. Nati. Acad. Sci. USA 96:8955.
Parvathi et al, 2001, Plant J. 25:193. Raven, J.A. (1977), Advances in Botanical Research, H.W. Woolhouse, ed (London:
Academic Press), 153.
Rolando et al, 1992, Methods in Lignin Chemistry, C.W. Dence and S.Y. Lin, eds (New
York: Springer-Verlag), 334.
Ryser, U., and Keller, B., 1992, Plant Cell 4:773. Saka, S., and Goring, D.A.I., 1985, Biosynthesis and Biodegradation of Wood
Components, T. Higuchi, ed (New York: Academic Press), 141.
Saka, S., and Goring, D.A.I., 1988, Holzforschung 42:149.
Samaj et al, 1998, Planta 204:437. Sarkanen, K.N., and Hergert, H.L., 1971, Lignins: Occurrence, Formation, Structure and
Reaction, K.N. Sarkanen and CH. Ludwig, eds (New York: Wiley-Interscience), 43.
Sami et al., 1984, Eur. J. Biochem. 139:259.
Sato et αZ., 1991, Plant Physiol. 113:425. Scurfield, G., 1973, Science 179:647.
Scurfield, G., and Bland, D.E., 1963, J. Horde. Sci. 38:297.
Somssich et al , 1989, Plant Mol Biol. 12:227.
Somssich et al, 1996, Proc. Natl Acad. Sci. USA 93:14199.
Stewart et al, 1997, Planta 201:311. Terashima et al, 1986, Holzforschung 42:101.
Towers, G.H.N., and Gibbs, R.D., 1953, Nature 172:25.
Trotter, P.C., 1990, Tech. Assoc. Pulp Paper bid. J. 73:198.
Tsai et αZ., 1998, Plant Physiol. 117:101.
Umezawa, T., 1994, Wood Molecular Biology, T. Higuchi, ed (Tokyo: Buneido Publishing), 140.
Nan Doorsselaere et al, 1995, Plant Physiol. Biochem. 33:105.
Wardrop, A.B., 1971, Lignins: Occurrence, Formation, Structure and Reaction, K.N.
Sarkanen and CH. Ludwig, eds (New York: Wiley-lnterscience), 19.
Wardrop, A.B., 1981, Xylem Cell Development, J.R. Barnett, ed (Tunbridge Wells, UK: Castle House Publications), 115.
Wardrop, A.B., and Dadswell, H.E., 1952, Aust. J. Sci. Res. Ser. B Biol Sci. 5:223.
Wardrop, A.B., and Davies, G.W., 1964, Aust. J. Bot. 12:24.
Wengenmayer et al, 1976, Ewr. J. Biochem. 65:529.
Whetten, R., and Sederoff, R., 1995, Plant Cell 7:1001. Whetten et al, 1998, Annu. Rev. Plant Physiol. Plant Mol. Biol. 49:585.
Wittich et al, 1999, Protoplasma 208:224.
Wu et al, 2000, Plant J. 22:495.
Wyrambik, D., and Grisebach, H., 1975, Eur. J. Biochem. 59:9.
Wyrambik, D., and Grisebach, H., 1979, Eur. J. Biochem. 97:503. Ye et al. , 1994, Plant Cell 6:1421.
Zhang, X.-H., and Chiang, V.L., 1997, Plant Physiol. 113:65.
Zhong et al, 1998, Plant Cell 10:2033.
Zinser et al, 1998, Planta 204:169.

Claims

CLAIM(S)
1. An isolated sinapyl alcohol dehydrogenase (SAD) gene.
2. A cDNA comprising a nucleotide sequence encoding SAD or a functional fragment thereof.
3. A cDNA comprising a nucleotide sequence encoding a polypeptide having an amino acid sequence with substantial similarity to that of SAD to exhibit SAD activity.
4. A cDNA of claim 2 comprising of SEQ ID NO: 1
5. An isolated and purified DNA molecule comprising a DNA segment having a transcriptional regulatory region of a plant SAD gene.
6. An isolated polynucleotide comprising a nucleotide sequence selected from the group consisting of complements, reverse complements and reverse sequences of a nucleotide sequence of SEQ ID NO: 1.
7. An isolated polynucleotide comprising a nucleotide sequence that hybridizes under stringent hybridization conditions to :
(a) SEQ ID NO: 1;
(b) complements of a sequence of (a)
(c) reverse complements of a sequence of (a); and
(d) reverse sequences of a sequence of (a).
8. A polynucleotide comprising a nucleotide sequence that differs only in one or more conservative deletions, insertions or substitutions from:
(a) SEQ ID NO: 1;
(b) complements of a sequence of (a); (c) reverse complements of a sequence of (a); and
(d) reverse sequences of a sequence of (a).
9. A polynucleotide comprising a nucleotide sequence having at least 70% sequence similarity to: (a) SEQ ID NO: 1;
(b) complements of a sequence of (a);
(c) reverse complements of a sequence of (a); and
(d) reverse sequences of a sequence of (a).
10. A polypeptide encoded by the cDNA of claim 2, comprising an amino acid sequence having the sequence of SAD, a sequence conservative variant thereof having a amino acid sequence substantially similar to that of SAD or a functional fragment thereof.
11. A polypeptide of claim 10 comprising of SEQ ID NO: 2.
12. A method of altering lignin monomer composition in a plant tissue comprising:
(a) introducing a DNA construct comprising a nucleotide sequence encoding SAD or a polypeptide sequence substantially similar to SAD, wherein the sequence is operably linked to promoter and gene termination sequences functional in a plant host;
(b) regenerating the plant cells to provide a transgenic plant; and (c) expressing the DNA construct in the cells of the transgenic plant in an amount effective to alter the lignin monomer composition of the plant.
13. A method of claim 12, wherein the plant tissue is a plant cell, plant organ, or an entire plant.
14. The method of claim 12 wherein the plant tissue is selected from the group consisting of angiosperm and gymnosperm.
15. A method for producing a plant cell having altered lignin structure comprising:
(a) transforming a plant cell with a polynucleotide of claim 9 to yield a transgenic plant cell; and
(b) cultivating the transgenic cell under conditions conducive to regeneration and mature plant growth.
16. A method of modifying the activity of an enzyme in a plant comprising stably incorporating into the genome of the plant a polynucleotide of claim 9.
17. A method of altering the content or composition of lignin in a plant, comprising stably incorporating into the genome of the plant by transformation a recombinant DNA comprising a gene promoter sequence and a gene terminator, and an interposed region comprising a nucleotide sequence encoding an DNA sequence which has sufficient sequence similarity to an endogenous plant sinapyl alcohol dehydrogenase gene such that when said nucleotide sequence is expressed the expression of said endogenous plant sinapyl alcohol dehydrogenase gene is inhibited, and wherein said nucleotide sequence is a plant sinapyl alcohol dehydrogenase gene or functional fragment thereof.
18. A method of increasing the activity of sinapyl alcohol dehydrogenase in a plant, comprising inserting into the genome of a culture of cells of a plant by transformation a recombinant DNA comprising a gene promoter sequence and a gene terminator, and an interposed region comprising a nucleotide sequence which has sufficient sequence similarity to the endogenous plant gene specifying sinapyl alcohol dehydrogenase that when said nucleotide sequence is expressed, expression of the endogenous sinapyl alcohol dehydrogenase gene is increased; selecting cells from the culture which contain the inserted recombinant DNA; regenerating whole plants from the selected cells; and selecting whole plants, regenerated from the selected cells, which have a phenotype characterized by reduced sinapyl alcohol dehydrogenase activity, and wherein said nucleotide sequence is a plant sinapyl alcohol dehydrogenase gene or functional fragment thereof.
19. A plant having incorporated into its genome a recombinant DNA molecule comprising a nucleotide sequence encoding SAD.
20. The plant of claim 19 which is a tree.
21. The plant of claim 19 wherein the nucleotide sequence encoding SAD is in the sense orientation.
22. A plant of claim 19, wherein the plant is an angiosperm.
23. A plant of claim 19, wherein the plant is a gymnosperm.
24. A transgenic plant which has substantially altered lignin monomer composition a recombinant DNA molecule comprising a nucleotide encoding a plant SAD operably linked to a promoter, the recombinant DNA being expressed in an amount effective to alter the lignin monomer composition of the plant.
25. A transgenic plant cell comprising a DNA construct with a promoter sequence, a coding region for SAD and a termination sequence.
26. A plant comprising a transgenic plant cell of claim 25 and fruit, seeds and progeny thereof.
27. A DNA construct for incorporation into the genome of a plant to alter the lignin monomer composition of the plant, comprising an operably linked gene promoter sequence, a nucleotide sequence encoding SAD or a sequence substantially similar thereto, and a gene termination functional in a plant cell.
28. A transgenic plant cell comprising a DNA construct according to claim 27.
29. The DNA construct of claim 27 wherein the plant is a gymnosperm.
30. The DNA construct of claim 27 wherein the plant is a angiosperm.
31. The DNA construct of claim 27 wherein the nucleotide sequence encoding SAD is in a sense orientation.
32. The DNA construct of claim 27 wherein the nucleotide sequence encoding SAD is in a antisense orientation.
33. The DNA construct of claim 27 wherein the promoter can be constitutive or tissue-specific.
34. The DNA construct of claim 27 wherein the promoter can be homologous or heterologous.
35. A DNA construct comprising, in the 5'-3' direction:
(a) a gene promoter sequence,
(b) a polynucleotide of any one of the sequences of claims 8 or 9, SEQ ID NO: 1 or a substantially similar sequence, comprising a gene coding for an enzyme involved in a lignin biosynthetic pathway; and
(c) a gene termination sequence.
36. The DNA construct of claim 27 wherein the non-coding region is in a sense orientation.
37. The DNA construct of claim 27 wherein the non-coding region is in an antisense orientation.
38. The DNA construct of claim 27 , wherein the gene promoter sequence provides for transcription in xylem.
39. A DNA construct comprising a gene promoter sequence, and a gene terminator, and an interposed region comprising a nucleotide sequence encoding a protein which has sufficient sequence similarity to an endogenous plant sinapyl alcohol dehydrogenase gene that when said nucleotide sequence is expressed the expression of said endogenous plant gene is inhibited, said endogenous plant gene being a gene which encodes sinapyl alcohol dehydrogenase, and wherein said nucleotide sequence is a plant sinapyl alcohol dehydrogenase gene or functional fragment thereof.
40. A DNA construct comprising, in the 5'-3' direction:
(a) a gene promoter sequence;
(b) a polynucleotide of any one of claims 8 or 9 comprising at least one open reading frame coding for at least one functional portion of an enzyme involved in a lignin biosynthetic pathway; and
(c) a gene termination sequence.
41. A method of altering lignin composition in a plant, comprising incorporating into the genome of the plant a DNA construct according to claim 27 in an amount and under conditions effective to allow at least a portion of the plant's cells to incorporate the construct into the plant genome.
42. The method of claim 41 wherein the altered lignin composition correlates to an increase in syringyl monolignol relative to a similar control plant that does not incorporate the DNA construct into its genome.
43. A method of obtaining altered expression of sinapyl alcohol dehydrogenase in a plant, comprising incorporating into the genome of the plant a DNA construct according to claim 27.
44. The method of claim 43 wherein the altered expression correlates to an increase in expression of sinapyl alcohol dehydrogenase relative to a similar control plant that does not incorporate the DNA construct into its genome.
PCT/US2001/027534 2000-09-05 2001-09-05 Genetic engineering of syringyl-enriched lignin in plants WO2002020812A1 (en)

Priority Applications (8)

Application Number Priority Date Filing Date Title
BR0113654-2A BR0113654A (en) 2000-09-05 2001-09-05 Genetic construction of syringyl-enriched lignin in plants
JP2002525819A JP2004520015A (en) 2000-09-05 2001-09-05 Genetic manipulation of syringyl-enriched lignin in plants
IL15475901A IL154759A0 (en) 2000-09-05 2001-09-05 Genetic engineering of syringyl-enriched lignin in plants
AU2001288765A AU2001288765B2 (en) 2000-09-05 2001-09-05 Genetic engineering of syringyl-enriched lignin in plants
EP01968521A EP1320617A4 (en) 2000-09-05 2001-09-05 Genetic engineering of syringyl-enriched lignin in plants
AU8876501A AU8876501A (en) 2000-09-05 2001-09-05 Genetic engineering of syringyl-enriched lignin in plants
CA002421215A CA2421215A1 (en) 2000-09-05 2001-09-05 Genetic engineering of syringyl-enriched lignin in plants
IL154759A IL154759A (en) 2000-09-05 2003-03-05 Polynucleotides encoding a protein which catalyzes conversion of sinapaldehyde to sinapyl alcohol and use thereof

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US23008600P 2000-09-05 2000-09-05
US60/230,086 2000-09-05

Publications (1)

Publication Number Publication Date
WO2002020812A1 true WO2002020812A1 (en) 2002-03-14

Family

ID=22863901

Family Applications (2)

Application Number Title Priority Date Filing Date
PCT/US2001/027445 WO2002020717A2 (en) 2000-09-05 2001-09-05 Methods for simultaneous control of lignin content and composition, and cellulose content in plants
PCT/US2001/027534 WO2002020812A1 (en) 2000-09-05 2001-09-05 Genetic engineering of syringyl-enriched lignin in plants

Family Applications Before (1)

Application Number Title Priority Date Filing Date
PCT/US2001/027445 WO2002020717A2 (en) 2000-09-05 2001-09-05 Methods for simultaneous control of lignin content and composition, and cellulose content in plants

Country Status (11)

Country Link
US (4) US6812377B2 (en)
EP (1) EP1320617A4 (en)
JP (2) JP4871487B2 (en)
CN (1) CN1473198A (en)
AR (2) AR030616A1 (en)
AU (3) AU2001288716A1 (en)
BR (2) BR0113699A (en)
CA (1) CA2421215A1 (en)
IL (4) IL154760A0 (en)
WO (2) WO2002020717A2 (en)
ZA (1) ZA200301785B (en)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7154027B2 (en) 2001-11-07 2006-12-26 Jeroen Demmer Compositions isolated from forage grasses and methods for their use
CN1318579C (en) * 2003-08-08 2007-05-30 浙江省农业科学院 Gene engineering method for raising plant useful secondary substance content
EP2557172A3 (en) * 2004-04-06 2013-02-20 Alellyx S.A. Cambium/Xylem-preferred promoters and uses thereof
AU2015202457B2 (en) * 2004-04-06 2017-06-15 Fibria Celulose S/A Cambium/xylem-preferred promoters and uses thereof

Families Citing this family (30)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
IL154760A0 (en) 2000-09-05 2003-10-31 Univ Michigan Tech Methods for simultaneous control of lignin content and compositions, and cellulose content in plants
US7288696B2 (en) * 2000-09-05 2007-10-30 Board Of Control Of Michigan Technological University Genetic engineering of syringyl-enriched lignin in plants
SE0301233D0 (en) * 2003-04-28 2003-04-28 Swetree Technologies Ab Tissue specific promoters
US9238818B2 (en) * 2004-04-20 2016-01-19 Syngenta Participations Ag Methods and genetic constructs for modification of lignin composition of corn cobs
WO2005102034A2 (en) 2004-04-20 2005-11-03 Syngenta Participations Ag Regulatory sequences for expressing gene products in plant reproductive tissue
WO2005108577A1 (en) * 2004-05-06 2005-11-17 Agriculture Victoria Services Pty Ltd Plant cad1-like genes and their use
WO2006012594A2 (en) * 2004-07-24 2006-02-02 The Samuel Roberts Noble Foundation, Inc. Modification of lignin biosynthesis
BRPI0514436C1 (en) 2004-08-18 2008-06-24 Alellyx Sa method to change wood density
US7799906B1 (en) 2004-09-22 2010-09-21 Arborgen, Llc Compositions and methods for modulating lignin of a plant
US7456338B2 (en) * 2004-09-22 2008-11-25 Arborgen Llc Modification of plant lignin content
US7402428B2 (en) * 2004-09-22 2008-07-22 Arborgen, Llc Modification of plant lignin content
GB0422977D0 (en) * 2004-10-15 2004-11-17 Swetree Technologies Ab Methods for improving tree growth and wood properties
WO2008069878A2 (en) * 2006-10-27 2008-06-12 Ceres, Inc. Modulating lignin in plants
ATE541043T1 (en) 2005-03-08 2012-01-15 Basf Plant Science Gmbh EXPRESSION-ENHANCED INTRON SEQUENCE
BRPI0609713A2 (en) * 2005-03-28 2010-04-20 Syngenta Participations Ag METHOD FOR MODIFYING THE COMPOSITION OF LIGNIN IN CORN SABUGOS, METHOD FOR USING LUMININE CORN SABUGOS IN BIOMASS CONVERSION APPLICATIONS, AND METHOD FOR INCREASING THE NUTRITIONAL YIELD OF ANIMAL FEED
BRPI0610371A2 (en) * 2005-05-02 2010-06-15 Purdue Research Foundation processes for increasing the yield of fermentable sugars from vegetable straw
BRPI0617631A2 (en) * 2005-10-21 2011-08-02 Alellyx Sa transgenic plant, part of a transgenic plant, isolated polynucleotide sequence and method for producing a transgenic plant with increased cellulose content when compared to a non-transgenic plant
US8183432B2 (en) * 2006-02-28 2012-05-22 Japan Science And Technology Agency Plant having reduced lignin and cellulose contents without reducing glucan content, method of producing the same and utilization thereof
US20070240837A1 (en) * 2006-04-13 2007-10-18 Andritz Inc. Hardwood alkaline pulping processes and systems
CA2670096A1 (en) * 2006-11-21 2008-05-29 The Samuel Roberts Noble Foundation, Inc. Biofuel production methods and compositions
MX2009007918A (en) * 2007-02-08 2009-08-07 Basf Plant Science Gmbh Compositions and methods using rna interference of cad-like genes for control of nematodes.
AU2007200824B2 (en) * 2007-02-23 2011-03-24 Fibria Celulose S/A Altering wood density
WO2008118385A2 (en) * 2007-03-23 2008-10-02 Michigan State University Lignin reduction and cellulose increase in crop biomass via genetic engineering
BRPI0910848A2 (en) 2008-04-28 2015-08-18 Univ Michigan Tech Fiber-specific promoter elements
BRPI1012003A2 (en) 2009-06-05 2015-09-22 Univ Florida "isolation and targeted suppression of sugarcane lignin biosynthetic genes"
US9334505B2 (en) 2011-08-12 2016-05-10 Purdue Research Foundation Using corngrass1 to engineer poplar as a bioenergy crop
US9556420B2 (en) * 2013-06-18 2017-01-31 Brookhaven Science Associates, Llc Specialized (iso)eugenol-4-O-methyltransferases (s-IEMTs) and methods of making and using the same
CN108467898B (en) * 2017-02-23 2021-07-27 北京林业大学 Method for screening poplar wood quality characters by jointly utilizing microRNA and SNP in target gene thereof
KR102198787B1 (en) * 2019-09-05 2021-01-05 한국과학기술연구원 Novel feed crop comprising mutated COMT gene and uses thereof
CN116548262B (en) * 2023-04-15 2023-11-03 西藏自治区农牧科学院草业科学研究所 Planting method for mixed sowing of oat and common vetch forage grass in alpine arid region

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5451514A (en) * 1991-04-26 1995-09-19 Zeneca Limited Modification of lignin synthesis in plants
US5633439A (en) * 1992-05-29 1997-05-27 Zeneca Limited Expression of genes in transgenic plants using a cinnamyl alcohol dehydrogenase gene promoter

Family Cites Families (42)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4744026A (en) * 1986-04-11 1988-05-10 American Telephone And Telegraph Company, At&T Bell Laboratories Methods and apparatus for efficient resource allocation
US5295065A (en) * 1990-06-01 1994-03-15 Motorola, Inc. Resource-lot association coordinator
WO1992003905A2 (en) * 1990-08-31 1992-03-19 Ab Volvo A method and apparatus for optimally allocating resources
JPH05250377A (en) * 1992-03-04 1993-09-28 Fujitsu Ltd Scheduling system
JP3551443B2 (en) * 1992-06-02 2004-08-04 王子製紙株式会社 Cinnamyl alcohol dehydrogenase gene of udo and hardwood, and hardwood into which the gene is introduced
US5630070A (en) * 1993-08-16 1997-05-13 International Business Machines Corporation Optimization of manufacturing resource planning
US5434775A (en) * 1993-11-04 1995-07-18 The General Hospital Corporation Managing an inventory of devices
FR2718460B1 (en) * 1994-04-11 1996-05-31 Centre Nat Rech Scient DNA sequence coding for cinnamoyl CoA reductase in Eucalyptus, and its applications in the field of regulation of plant lignin levels.
US6801820B1 (en) * 1994-05-27 2004-10-05 Lilly Software Associates, Inc. Method and apparatus for scheduling work orders in a manufacturing process
JP3315844B2 (en) * 1994-12-09 2002-08-19 株式会社東芝 Scheduling device and scheduling method
DE19535084A1 (en) * 1995-09-21 1997-03-27 Ibm Dynamic optimisation of business processes managed by computer system
US5922928A (en) * 1995-11-30 1999-07-13 Board Of Control Of Michigan Technological University Genetic transformation and regeneration of plants
AUPN773496A0 (en) * 1996-01-25 1996-02-15 Task Solutions Pty Ltd Task management system
US5754451A (en) * 1996-02-29 1998-05-19 Raytheon Company Preventative maintenance and diagonstic system
US5970437A (en) * 1996-10-03 1999-10-19 Gorman; Alexander J. Computerized management of plant maintenance and program therefor
US6252135B1 (en) 1996-12-16 2001-06-26 International Paper Company Production of syringyl lignin in gymnosperms
US5995915A (en) * 1997-01-29 1999-11-30 Advanced Micro Devices, Inc. Method and apparatus for the functional verification of digital electronic systems
EP0983564A1 (en) * 1997-05-21 2000-03-08 Khimetrics, Inc. Method for controlled optimization of enterprise planning models
US6230200B1 (en) * 1997-09-08 2001-05-08 Emc Corporation Dynamic modeling for resource allocation in a file server
US6014633A (en) * 1997-09-24 2000-01-11 Deroyal Business Systems, L.L.C. Method for the analysis and standardization of bills of resources
US6096094A (en) * 1997-10-03 2000-08-01 National Instruments Corporation Configuration manager for configuring a data acquisition system
US6455762B1 (en) * 1997-11-12 2002-09-24 Board Of Control Of Michigan Technological University Methods of modifying lignin in plants by transformation with a 4-coumarate coenzyme a ligase nucleic acid
US6078912A (en) * 1998-04-15 2000-06-20 Travelhost, Inc. Computer-based system and method for resource determination and management
EP1006190A1 (en) * 1998-12-02 2000-06-07 Centrum Voor Plantenveredelings- En Reproduktieonderzoek Fruit flavour related genes and use thereof
EP1153134A1 (en) * 1999-02-01 2001-11-14 Cellfor Inc. Modification of lignin composition of gymnosperms
US6067486A (en) * 1999-02-01 2000-05-23 General Electric Company Method and system for planning repair of an aircraft engine
US6321207B1 (en) * 1999-04-15 2001-11-20 I2 Technologies Us, Inc. System and method for optimizing the allocation of a resource
AU7869700A (en) 1999-10-08 2001-04-23 Board Of Control Of Michigan Technological University Method of introducing a plurality of genes into plants
WO2001041024A1 (en) * 1999-12-01 2001-06-07 Sinex Aviation Technologies Corporation Dynamic aircraft maintenance management system
US6678716B1 (en) * 2000-06-19 2004-01-13 J. D. Edwards World Source Company System and method for managing processes
US6496814B1 (en) * 2000-07-19 2002-12-17 International Business Machines Corporation Method and system for integrating spatial analysis, and scheduling to efficiently schedule and monitor infrastructure maintenance
US7171372B2 (en) * 2000-08-07 2007-01-30 General Electric Company Computerized method and system for guiding service personnel to select a preferred work site for servicing transportation equipment
AU2001284952A1 (en) 2000-08-16 2002-02-25 Purdue Research Foundation Genes encoding mutant p-coumarate 3-hydroxylase (c3h) and methods of use
IL154760A0 (en) 2000-09-05 2003-10-31 Univ Michigan Tech Methods for simultaneous control of lignin content and compositions, and cellulose content in plants
US6738748B2 (en) * 2001-04-03 2004-05-18 Accenture Llp Performing predictive maintenance on equipment
US20020072988A1 (en) * 2000-12-13 2002-06-13 Itt Manufacturing Enterprises, Inc. Supply management system
US6691064B2 (en) * 2000-12-29 2004-02-10 General Electric Company Method and system for identifying repeatedly malfunctioning equipment
US6735549B2 (en) * 2001-03-28 2004-05-11 Westinghouse Electric Co. Llc Predictive maintenance display system
US20020143564A1 (en) * 2001-04-03 2002-10-03 Webb Brett M. Website for household inventory and maintenance with reminder system and method
US20020156692A1 (en) * 2001-04-20 2002-10-24 Squeglia Mark R. Method and system for managing supply of replacement parts of a piece of equipment
US6985803B2 (en) * 2001-05-30 2006-01-10 General Electric Company System and method for monitoring the condition of a vehicle
US20030036939A1 (en) * 2001-07-20 2003-02-20 Flores Abelardo A. Method and system configure to manage a maintenance process

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5451514A (en) * 1991-04-26 1995-09-19 Zeneca Limited Modification of lignin synthesis in plants
US5633439A (en) * 1992-05-29 1997-05-27 Zeneca Limited Expression of genes in transgenic plants using a cinnamyl alcohol dehydrogenase gene promoter

Non-Patent Citations (7)

* Cited by examiner, † Cited by third party
Title
BRILL E.M. ET AL.: "Molecular characterisation and expression of a wound-inducible cDNA encoding a novel cinnamyl-alcohol dehydrogenase enzyme in lucerne (Medicago sativa L.)", PLANT MOLECULAR BIOLOGY, vol. 41, pages 279 - 291, XP002906648 *
HIBINO T. ET AL.: "Cinnamyl alcohol dehydrogenase from aralia cordata: Cloning of the cDNA and expression of the gene in lignified tissues", PLANT CELL PHYSIOLOGY, vol. 3, no. 5, 1993, pages 659 - 665, XP002906651 *
JEFFERSON R.A.: "Assaying chimeric genes in plants: The GUS gene fusion system", PLANT MOLECULAR BIOLOGY REPORTER, vol. 5, no. 4, 1987, pages 387 - 405, XP002906650 *
LEYVA A. ET AL.: "cis-Element combinations determine phenylalamine ammonia-lyase gene tissue-specific expression patterns", THE PLANT CELL, vol. 4, 1992, pages 263 - 271, XP000918837 *
O'MALLEY D.M., PORTER S. AND SEDEROFF R.R.: "Purification, characterization and cloning of cinnamyl alcohol dehydrogenase in loblolly pine (pinus taeda L.)", PLANT PHYSIOLOGY, vol. 98, 1992, pages 1364 - 1371, XP002906649 *
PIQUEMAL J. ET AL.: "Down-regulation of cinnamoyl-CoA reductase induces significant changes of lignin profiles in transgenic tobacco plants", THE PLANT JOURNAL, vol. 13, no. 1, 1998, pages 71 - 83, XP002906652 *
See also references of EP1320617A4 *

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7154027B2 (en) 2001-11-07 2006-12-26 Jeroen Demmer Compositions isolated from forage grasses and methods for their use
US7732661B2 (en) 2001-11-07 2010-06-08 Jeroen Demmer Compositions isolated from forage grasses and methods for their use
US8003849B2 (en) 2001-11-07 2011-08-23 Jeroen Demmer Compositions isolated from forage grasses and methods for their use
CN1318579C (en) * 2003-08-08 2007-05-30 浙江省农业科学院 Gene engineering method for raising plant useful secondary substance content
EP2557172A3 (en) * 2004-04-06 2013-02-20 Alellyx S.A. Cambium/Xylem-preferred promoters and uses thereof
US9029637B2 (en) 2004-04-06 2015-05-12 Fibria Celulose S.A. Cambium/xylem-preferred promoters and uses thereof
AU2015202457B2 (en) * 2004-04-06 2017-06-15 Fibria Celulose S/A Cambium/xylem-preferred promoters and uses thereof

Also Published As

Publication number Publication date
IL154760A (en) 2011-01-31
BR0113654A (en) 2003-09-23
AR030615A1 (en) 2003-08-27
EP1320617A4 (en) 2005-01-19
US20020078474A1 (en) 2002-06-20
CA2421215A1 (en) 2002-03-14
AU2001288765B2 (en) 2006-04-27
ZA200301785B (en) 2004-03-04
US20050166283A1 (en) 2005-07-28
IL154759A0 (en) 2003-10-31
AU8876501A (en) 2002-03-22
JP4871487B2 (en) 2012-02-08
IL154760A0 (en) 2003-10-31
AU2001288716A8 (en) 2009-07-30
WO2002020717A2 (en) 2002-03-14
BR0113699A (en) 2004-06-08
US20020138870A1 (en) 2002-09-26
CN1473198A (en) 2004-02-04
EP1320617A1 (en) 2003-06-25
WO2002020717A3 (en) 2009-06-11
US6855864B2 (en) 2005-02-15
AU2001288765C1 (en) 2002-03-22
US7514596B2 (en) 2009-04-07
IL154759A (en) 2009-08-03
US6812377B2 (en) 2004-11-02
JP2004515224A (en) 2004-05-27
AU2001288716A1 (en) 2002-03-22
AR030616A1 (en) 2003-08-27
US20020124281A1 (en) 2002-09-05
JP2004520015A (en) 2004-07-08

Similar Documents

Publication Publication Date Title
AU2001288765B2 (en) Genetic engineering of syringyl-enriched lignin in plants
AU2001288765A1 (en) Genetic engineering of syringyl-enriched lignin in plants
Li et al. The last step of syringyl monolignol biosynthesis in angiosperms is regulated by a novel gene encoding sinapyl alcohol dehydrogenase
Whetten et al. Lignin biosynthesis.
Goujon et al. Genes involved in the biosynthesis of lignin precursors in Arabidopsis thaliana
Baucher et al. Biosynthesis and genetic engineering of lignin
Piquemal et al. Down-regulation of cinnamoyl-CoA reductase induces significant changes of lignin profiles in transgenic tobacco plants.
Dixon et al. The biosynthesis of monolignols: a “metabolic grid”, or independent pathways to guaiacyl and syringyl units?
AU762576B2 (en) Genetic engineering of lignin biosynthesis in plants
US6610908B1 (en) Manipulation of lignin composition in plants using a tissue-specific promoter
US5981837A (en) Method for regulation of plant lignin composition
US7888553B2 (en) Method for modifying lignin composition and increasing in vivo digestibility of forages
CA2404104C (en) Method for modifying lignin composition and increasing in vivo digestibility of forages
AU2001247731A1 (en) Method for modifying lignin composition and increasing in vivo digestibility of forages
US6441272B1 (en) Modification of lignin content and composition in plants
US7288696B2 (en) Genetic engineering of syringyl-enriched lignin in plants
Marjamaa et al. Lignification in development
Higuchi The discovery of lignin
AU2003248405B2 (en) Genetic engineering of lignin biosynthesis in plants
AU2005274622A1 (en) Polynucleotides, DNA constructs and methods for the alteration of plant lignin content and/or composition
Allina Phenylpropanoid metabolism in poplar: characterization of the 4-coumarate: CoA ligase gene family and a putative hydroxycinnamoyl-CoA thioesterase

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
WWE Wipo information: entry into national phase

Ref document number: 2003/01785

Country of ref document: ZA

Ref document number: 200301785

Country of ref document: ZA

Ref document number: 2421215

Country of ref document: CA

Ref document number: 2001288765

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 154759

Country of ref document: IL

Ref document number: 2002525819

Country of ref document: JP

WWE Wipo information: entry into national phase

Ref document number: 2001968521

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 018184065

Country of ref document: CN

WWP Wipo information: published in national office

Ref document number: 2001968521

Country of ref document: EP

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWW Wipo information: withdrawn in national office

Ref document number: 2001968521

Country of ref document: EP